Note: Descriptions are shown in the official language in which they were submitted.
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
PLATELET-DERIVED GROWTH FACTOR C,
DNA CODING THEREFOR, AND USES THEREOF
This invention relates to growth factors for connective
tissue cells, fibroblasts, myofibroblasts and glial cells
and/or to growth factors for endothelial cells, and in
particular to a novel platelet-derived growth factor/vascular
endothelial growth factor-like growth factor, a polynucleotide
sequence encoding the factor, and to pharmaceutical and
diagnostic compositions and methods utilizing or derived from
the factor.
BACKGROUND OF THE INVENTION
In the developing embryo, the primary vascular network
is established by in situ differentiation of mesodermal cells
in a process called vasculogenesis. It is believed that all
subsequent processes involving the generation of new vessels
in the embryo and neovascularization in adults, are governed
by the sprouting or splitting of new capillaries from the
pre-existing vasculature in a process called angiogenesis
(Pepper et al., Enzyme & Protein, 1996 49 138-162; Breier et
al., Dev. Dyn. 1995 204 228-239; Risau, Nature, 1997 386
671-674). Angiogenesis is not only involved in embryonic
development and normal tissue growth, repair, and
regeneration, but is also involved in the female reproductive
cycle, establishment and maintenance of pregnancy, and in
repair of wounds and fractures. In addition to angiogenesis
which takes place in the normal individual, angiogenic events
are involved in a number of pathological processes, notably
tumor growth and metastasis, and other conditions in which
blood vessel proliferation, especially of the microvascular
system, is increased, such as diabetic retinopathy, psoriasis
and arthropathies. Inhibition of angiogenesis is useful in
preventing or alleviating these pathological processes.
On the other hand, promotion of angiogenesis is desirable
in situations where vascularization is to be established or
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PGT/US991Z2668
extended, for example after tissue or organ transplantation,
or to stimulate establishment of collateral circulation in
tissue infarction or arterial stenosis, such as in coronary
heart disease and thromboangitis obliterans.
The angiogenic process is highly complex and involves the
maintenance of the endothelial cells in the cell cycle,
degradation of the extracellular matrix, migration and
invasion of the surrounding tissue and finally, tube
formation. The molecular mechanisms underlying the complex
angiogenic processes are far from being understood.
Because of the crucial role of angiogenesis in so many
physiological and pathological processes, factors involved in
the control of angiogenesis have been intensively
investigated. A number of growth factors have been shown to
be involved in the regulation of angiogenesis; these include
fibroblast growth factors (FGFs), platelet-derived growth
factor (PDGF), transforming growth factor alpha (TGFa), and
hepatocyte growth factor (HGF). See for example Folkman et
al., J. Biol. Chem., 1992 267 10931-10934 for a review.
It has been suggested that a particular family of
endothelial cell-specific growth factors, the vascular
endothelial growth factors (VEGFs), and their corresponding
receptors is primarily responsible for stimulation of
endothelial cell growth and differentiation, and for certain
functions of the differentiated cells. These factors are
members of the PDGF family, and appear to act primarily via
endothelial receptor tyrosine kinases (RTKs).
Nine different proteins have been identified in the PDGF
family, namely two PDGFs (A and B), VEGF and six members that
are closely related to VEGF. The six members closely related
to VEGF are: VEGF-B, described in International Patent
Application PCT/US96/02957 (WO 96/26736) and in U.S. Patents
5,840,693 and 5,607,918 by Ludwig Institute for Cancer
-2-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Research and The University of Helsinki; VEGF-C, described in
Joukov et al., EMBO J., 1996 15 290-298 and Lee et al., Proc.
Natl. Acad. Sci. USA, 1996' 93 1988-1992; VEGF-D, described in
International Patent Application No. PCT/US97/14696 (WO
98/07832), and Achen et al., Proc. Natl. Acad. Sci. USA, 1998
95 548-553; the placenta growth factor (P1GF), described in
Maglione et al., Proc. Natl. Acad. Sci. USA, 1991 88 9267-
9271; VEGF2, described in International Patent Application No.
PCT/US94/05291 (WO 95/24473) by Human Genome Sciences, Inc;
and VEGF3, described in International Patent Application No.
PCT/US95/07283 (WO 96/39421) by Human Genome Sciences, Inc.
Each VEGF family member has between 30o and 45$ amino acid
sequence identity with VEGF. The VEGF family members share
a VEGF homology domain which contains the six cysteine
residues which form the cysteine knot motif. Functional
characteristics of the VEGF family include varying degrees of
mitogenicity for endothelial cells, induction of vascular
permeability and angiogenic and lymphangiogenic properties.
Vascular endothelial growth factor (VEGF) is a
homodimeric glycoprotein that has been isolated from several
sources. VEGF shows highly specific mitogenic activity for
endothelial cells. VEGF has important regulatory functions
in the formation of new blood vessels during embryonic
vasculogenesis and in angiogenesis during adult life
(Carmeliet et al., Nature, 1996 380 435-439; Ferrara et al.,
Nature, 1996 380 439-442; reviewed in Ferrara and Davis-Smyth,
Endocrine Rev., 1997 18 4-25). The significance of the role
played by VEGF has been demonstrated in studies showing that
inactivation of a single VEGF allele results in embryonic
lethality due to failed development of the vasculature
(Carmeliet et al., Nature; 1996 380 435-439; Ferrara et al.,
Nature, 1996 380 439-442). In addition VEGF has strong
chemoattractant activity towards monocytes, can induce the
-3-
SUBSTITUTE SHEET (RULE 2G)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
plasminogen activator and the plasminogen activator inhibitor
in endothelial cells, and can also induce microvascular
permeability. Because of the latter activity, it is sometimes
referred to as vascular permeability factor (VPF). The
isolation and properties of VEGF have been reviewed; see
Ferrara et al., J. Cellular Biochem., 1991 47 211-218 and
Connolly, J. Cellular Biochem., 1991 47 219-223. Alterative
mRNA splicing of a single VEGF gene gives rise to five
isoforms of VEGF.
VEGF-B has similar angiogenic and other properties to
those of VEGF, but is distributed and expressed in tissues
differently from VEGF. In particular, VEGF-B is very strongly
expressed in heart, and only weakly in lung, whereas the
reverse is the case for VEGF. This suggests that VEGF and
VEGF-B, despite the fact that they are co-expressed in many
tissues, may have functional differences.
VEGF-B was isolated using a yeast co-hybrid interaction
trap screening technique by screening for cellular proteins
which might interact with cellular resinoid acid-binding
protein type I (CRABP-I). Its isolation and characteristics
are described in detail in PCT/US96/02957 and in Olofsson et
al., Proc. Natl. Acad. Sci. USA, 1996 ~, 2576-2581.
VEGF-C was isolated from conditioned media of the PC-3
prostate adenocarcinoma cell line (CRL1435) by screening for
ability of the medium to produce tyrosine phosphorylation of
the endothelial cell-specific receptor tyrosine kinase VEGFR-3
(Flt4), using cells transfected to express VEGFR-3. VEGF-C
was purified using affinity chromatography with recombinant
VEGFR-3, and was cloned from a PC-3 cDNA library. Its
isolation and characteristics are described in detail in
Joukov et al., EMBO J., 1996 15 290-298.
VEGF-D was isolated from a human breast cDNA library,
commercially available from Clontech, by. screening with an
-4-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO OO/t8212 PC'f/US99/22668
expressed sequence tag obtained from a human cDNA library
designated "Snares Breast 3NbHBst" as a hybridization probe
(Achen et al., Proc. Natl. Acad. Sci. USA, 1998 95 548-553).
Its isolation and characteristics are described in detail in
International Patent Application No. PCT/US97/14696
(W098/07832).
The VEGF-D gene is broadly expressed in the adult human,
but is certainly not ubiquitously expressed. VEGF-D is
strongly expressed in heart, lung and skeletal muscle.
Intermediate levels of VEGF-D are expressed in spleen, ovary,
small intestine and colon, and a lower expression occurs in
kidney, pancreas, thymus, prostate and testis. No VEGF-D mRNA
was detected in RNA from brain, placenta, liver or peripheral
blood leukocytes.
P1GF was isolated from a term placenta cDNA library. Its
isolation and characteristics are described in detail in
Maglione et al., Proc. Natl. Acad. Sci. USA, 1991 88 9267-
9271. Presently its biological function is not well
understood.
VEGF2 was isolated from a highly tumorgenic, oestrogen
independent human breast cancer cell line. While this
molecule is stated to have about 22~ homology to PDGF and 300
homology to VEGF, the method of isolation of the gene encoding
VEGF2 is unclear, and no characterization of the biological
activity is disclosed.
VEGF3 was isolated from a cDNA library derived from colon
tissue. VEGF3 is stated to have about 36~ identity and 66$
similarity to VEGF. The method of isolation of the gene
encoding VEGF3 is unclear and no characterization of the
biological activity is disclosed.
Similarity between two proteins is determined by
comparing the amino acid sequence and conserved amino acid
substitutions of one of the proteins to the sequence of the
-5-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCTIUS99/Z2668
second protein, whereas identity is determined without
including the conserved amino acid substitutions.
PDGF/VEGF family members act primarily by binding to
receptor tyrosine kinases. Five endothelial cell-specific
receptor tyrosine kinases have been identified, namely VEGFR-1
(Flt-1), VEGFR-2 (KDR/Flk-1), VEGFR-3 (Flt4), Tie and
Tek/Tie-2. All of these have the intrinsic tyrosine kinase
activity which is necessary for signal transduction. The
essential, specific role in vasculogenesis and angiogenesis
of VEGFR-1, VEGFR-2, VEGFR-3, Tie and Tek/Tie-2 has been
demonstrated by targeted mutations inactivating these
receptors in mouse embryos.
The only receptor tyrosine kinases known to bind VEGFs
are VEGFR-1, VEGFR-2 and VEGFR-3. VEGFR-1 and VEGFR-2 bind
VEGF with high affinity, and VEGFR-1 also binds VEGF-B and
P1GF. VEGF-C has been shown to be the ligand for VEGFR-3, and
it also activates VEGFR-2 (Joukov et al., The EM80 Journal,
1996 15 290-298). VEGF-D binds to both VEGFR-2 and VEGFR-3.
A ligand for Tek/Tie-2 has been described in International
Patent Application No. PCT/US95/12935 (WO 96/11269) by
Regeneron Pharmaceuticals, Inc. The ligand for Tie has not
yet been identified.
Recently, a novel 130-135 kDa VEGF isoform specific
receptor has been purified and cloned (Soker et al., Cell,
1998 92 735-745). The VEGF receptor was found to specifically
bind the VEGFISS isoform via the exon 7 encoded sequence, which
shows weak affinity for heparin (Soker et al., Cell, 1998 92
735-745). Surprisingly, the receptor was shown to be
identical to human neuropilin-1 (NP-1), a receptor involved
in early stage neuromorphogenesis. P1GF-2 also appears to
interact with NP-1 (Migdal et al., J. Biol. Chem., 1998 273
22272-22278).
-6-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PGT/US99/22668
VEGFR-1, VEGFR-2 and VEGFR-3 are expressed differently
by endothelial cells. Both VEGFR-1 and VEGFR-2 are expressed
in blood vessel endothelia (Oelrichs et al., Oncogene, 1992
8 11-18; Kaipainen et al., J. Exp. Med., 1993 178 2077-2088;
Dumont et al., Dev. Dyn., 1995 203 80-92; Fong et al., Dev.
Dyn., 1996 207 1-10) and VEGFR-3 is mostly expressed in the
lymphatic endothelium of adult tissues (Kaipainen et al.,
Proc. Natl. Acad. Sci. USA, 1995 _9 3566-3570). VEGFR-3 is
also expressed in the blood vasculature surrounding tumors.
Disruption of the VEGFR genes results in aberrant
development of the vasculature leading to embryonic lethality
around midgestation. Analysis of embryos carrying a
completely inactivated VEGFR-1 gene suggests that this
receptor is required for functional organization of the
endothelium (Fong et al., Nature, 1995 376 66-70). However,
deletion of the intracellular tyrosine kinase domain of
VEGFR-1 generates viable mice with a normal vasculature
(Hiratsuka et al., Proc. Natl. Acad. Sci. USA 1998 95
9349-9359). The reasons underlying these differences remain
to be explained but suggest that receptor signalling via the
tyrosine kinase is not required for the proper function of
VEGFR-1. Analysis of homozygous mice with inactivated alleles
of VEGFR-2 suggests that this receptor is required for
endothelial cell proliferation, hematopoesis and
vasculogenesis (Shalaby et al., Nature, 1995 376 62-66;
Shalaby et al., Cell, 1997 89 981-990). Inactivation of
VEGFR-3 results in cardiovascular failure due to abnormal
organization of the large vessels (Dumont et al. Science, 1998
282 946-949).
Although VEGFR-1 is mainly expressed in endothelial cells
during development, it can also be found in hematopoetic
precursor cells during early stages of embryogenesis (Fong et
al., Nature, 1995 376 66-70). In adults, monocytes and
-7_
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT7US99/Z2668
macrophages also express this receptor (Barleon et al., Blood,
1996 87 3336-3343). In embryos, VEGFR-1 is expressed by most,
if not all, vessels (Breier et al., Dev. Dyn., 1995 204
228-239; Fong et al., Dev. Dyn., 1996 207 1-10).
The receptor VEGFR-3 is widely expressed on endothelial
cells during early embryonic development but as embryogenesis
proceeds becomes restricted to venous endothelium and then to
the lymphatic endothelium (Kaipainen et al., Cancer Res.,
1994 54 6571-6577; Kaipainen et al., Proc. Natl. Acad. Sci.
USA, 1995 92 3566-3570). VEGFR-3 is expressed on lymphatic
endothelial cells in adult tissues. This receptor is
essential for vascular development during embryogenesis.
Targeted inactivation of both copies of the VEGFR-3 gene in
mice resulted in defective blood vessel formation
characterized by abnormally organized large vessels with
defective lumens, leading to fluid accumulation in the
pericardial cavity and cardiovascular failure at post-coital
day 9.5. On the basis of these findings it has been proposed
that VEGFR-3 is required for the maturation of primary
vascular networks into larger blood vessels. However, the
role of VEGFR-3 in the development of the lymphatic
vasculature could not be studied in these mice because the
embryos died before the lymphatic system emerged.
Nevertheless it is assumed that VEGFR-3 plays a role in
development of the lymphatic vasculature and lymphangiogenesis
given its specific expression in lymphatic endothelial cells
during embryogenesis and adult life . This is supported by the
finding that ectopic expression of VEGF-C, a ligand for VEGFR-
3, in the skin of transgenic mice, resulted in lymphatic
endothelial cell proliferation and vessel enlargement in the
dermis. Furthermore this suggests that VEGF-C may have a
primary function in lymphatic endothelium, and a secondary
_8-
SUBSTITUTE SHEET (RULE 2b)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
function in angiogenesis and permeability regulation which is
shared with VEGF (Joukov et al., EMBO J., 1996 15 290-298).
Some inhibitors of the VEGF/VEGF-receptor system have
been shown to prevent tumor growth via an anti-angiogenic
mechanism; see Kim et al., Nature, 1993 362 841-844 and Saleh
et al., Cancer Res., 1996 56 393-401.
As mentioned above, the VEGF family of growth factors
are members of the PDGF family. PDGF plays a important role
in the growth and/or motility of connective tissue cells,
fibroblasts, myofibroblasts and glial cells (Heldin et al.,
"Structure of platelet-derived growth factor: Implications for
functional properties", Growth Factor, 1993 8 245-252).. In
adults, PDGF stimulates wound healing (Robson et al., Lancet,
1992 339 23-25). Structurally, PDGF isoforms are disulfide-
bonded dimers of homologous A- and B-polypeptide chains,
arranged as homodimers (PDGF-AA and PDGF-BB) or a heterodimer
(PDGF-AB).
PDGF isoforms exert their effects on target cells by
binding to two structurally related receptor tyrosine kinases
{RTKs). The alpha-receptor binds both the A- and B-chains of
PDGF, whereas the beta-receptor binds only the B-chain. These
two receptors are expressed by many in vitro grown cell lines,
and are mainly expressed by mesenchymal cells in vivo. The
PDGFs regulate cell proliferation, cell survival and
chemotaxis of many cell types in vitro {reviewed in Heldin et
a1. , Biochim Biophys Acta . , 1998 1378 F7 9-113 ) . In vivo, they
exert their effects in a paracrine mode since they often are
expressed in epithelial {PDGF-A) or endothelial cells (PDGF-B)
in close apposition to the PDGFR expressing mesenchyme. In
tumor cells and in cell lines grown in vitro, coexpression of
the PDGFs and the receptors generate autocrine loops which are
important for cellular transformation (Betsholtz et al., Cell,
_g_
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/1$212 PCT/US99/ZZ668
1984 39 447-57; Keating et al., J. R. Coll Surg Edinb., 1990
35 172-4). Overexpression of the PDGFs have been observed in
several pathological conditions, including maligancies,
arteriosclerosis, and fibroproliferative diseases (reviewed
in Heldin et al., The Molecular and Cellular Biology of Wound
Repair, New York: Plenum Press, 1996, 249-273).
The importance of the PDGFs as regulators of cell
proliferation and survival are well illustrated by recent gene
targeting studies in mice that have shown distinct
physiological roles for the PDGFs and their receptors despite
the overlapping ligand specificities of the PDGFRs.
Homozygous null mutations for either of the two PDGF ligands
or the receptors are lethal. Approximately 50$ of the
homozygous PDGF-A deficient mice have an early lethal
phenotype, while the surviving animals have a complex
postnatal phenotype with lung emphysema due to improper
alveolar septum formation because of a lack of alveolar
myofibroblasts (Bostrom et al., Cell, 1996 85 863-873). The
PDGF-A deficient mice also have a dermal phenotype
characterized by thin dermis, misshapen hair follicles and
thin hair (Karlsson et al., Development, 1999 126 2611-2).
PDGF-A is also required for normal development of
oligodendrocytes and subsequent myelination of the central
nervous system (Fruttiger et al., Development, 1999 126
457-67). The phenotype of PDGFR-alpha deficient mice is more
severe with early embryonic death at E10, incomplete cephalic
closure, impaired neural crest development, cardiovascular
defects, skeletal defects, and odemas [Soriano et al.,
Development, 1997 124 2691-70). The PDGF-B and PDGFR-beta
deficient mice develop similar phenotypes that are
characterized by renal, hematological and cardiovascular
abnormalities (Leveen et al., Genes Dev., 1994 8 1875-1887;
Soriano et al., Genes Dev., 1999 8_ 1888-96; Lindahl et al.,
-10-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
wo oons2lz rcTius99n2s~s
Science, 1997 277 242-5; Lindahl, Development, 1998 1i2~
3313-2), where the renal and cardiovascular defects, at least
in part, are due to the lack of proper recruitment of mural
cells (vascular smooth muscle cells, pericytes or mesangial
cells) to blood vessels (Leveen et al., Genes Dev., 1994 8_
1875-1887; Lindahl et al., Science, 1997 277 242-5; Lindahl
et al., Development, 1998 12~ 3313-2).
SUMMARY OF THE INVENTION
The invention generally provides an isolated novel growth
factor which has the ability to stimulate and/or enhance
proliferation or differentiation and/or growth and/or motility
of cells expressing a PDGF-C receptor including, but not
limited to, endothelial cells, connective tissue cells,
myofibroblasts and glial cells, an isolated polynucleotide
sequence encoding the novel growth factor, and compositions
useful for diagnostic and/or therapeutic applications.
According to one aspect, the invention provides an
isolated and purified nucleic acid molecule which comprises
a polynucleotide sequence having at least 85~ identity, more
preferably at least 90$, and most preferably at least 95~
identity to at least nucleotides 37-1071 of the sequence set
out in Figure 1 (SEQ ID N0:2), at least nucleotides 6-956 of
the sequence set out in Figure 3 (SEQ ID N0:3) or at least
nucleotides 196 to 1233 of the sequence set out in Figure 5
(SEQ ID N0:6). The sequence of at least nucleotides 37-1071
of the sequence set out in Figure 1 (SEQ ID N0:2) or at least
nucleotides 196 to 1233 of the sequence set out in Figure 5
(SEQ ID N0:6) encodes a novel polypeptide, designated PDGF-C
(formally designated "VEGF-F"), which is structurally
homologous to PDGF-A, PDGF-B, VEGF, VEGF-B, VEGF-C and VEGF-D.
In a preferred embodiment, the nucleic acid molecule is a cDNA
-11-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
which comprises at least nucleotides 37-1071 of the sequence
set out in Figure 1 (SEQ ID N0:2), at least nucleotides 6-956
of the sequence set out in Figure 3 (SEQ ID N0:3) or at least
nucleotides 196 to 1233 of the sequence set out in Figure 5
(SEQ ID N0:6) . This aspect of the invention also encompasses
DNA molecules having a sequence such that they hybridize under
stringent conditions with at least nucleotides 37-1071 of the
sequence set out in Figure 1 (SEQ ID N0:2), at least
nucleotides 6-956 of the sequence set out in Figure 3 (SEQ ID
N0:3) or at least nucleotides 196 to 1233 of the sequence set
out in Figure 5 (SEQ ID N0:6) or fragments thereof.
According to a second aspect, the polypeptide of the
invention has the ability to stimulate and/or enhance
proliferation and/or differentiation and/or growth and/or
motility of cells expressing a PDGF-C receptor including, but
not limited to, endothelial cells, connective tissue cells,
myofibroblasts and glial cells and comprises a sequence of
amino acids corresponding to the amino acid sequence set out
in Figure 2 (SEQ ID N0:3), Figure 4 (SEQ ID N0:5) or Figure
6 (SEQ ID N0:7) , or a fragment or analog thereof which has the
ability to stimulate and/or enhance proliferation and/or
differentiation and/or growth and/or motility of cells
expressing a PDGF-C receptor including, but not limited to,
endothelial cells, connective tissue cells (such as
fibroblasts), myofibroblasts and glial cells. Preferably the
polypeptides have at least 85~ identity, more preferably at
least 90$, and most preferably at least 95~ identity to the
amino acid sequence of in Figure 2 ( SEQ ID NO : 3 ) , Figure 4
(SEQ ID N0:5) or Figure 6 (SEQ ID N0:7), or a fragment or
analog thereof having the biological activity of PDGF-C. A
preferred fragment is a truncated form of PDGF-C comprising
a portion of the PDGF/VEGF homology domain (PVHD) of PDGF-C.
The minimal domain is residues 230-345. However, the domain
-12-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PC1'/US99/Z2668
can extend towards the N terminus up to residue 164. Herein
the PVHD is defined as truncated PDGF-C. The truncated PDGF-C
is an activated form of PDGF-C.
As used in this application, percent sequence identity
is determined by using the alignment tool of "MEGALIGN" from
the Lasergene package (DNASTAR, Ltd. Abacus House, Manor Road,
West Ealing, London W130AS United Kingdom) and using its
preset conditions. The alignment is then refined manually,
and the number of identities are estimated in the regions
available for a comparison.
Preferably the polypeptide or the encoded polypeptide
from a polynucleotide has the ability to stimulate one or more
of proliferation, differentiation, motility, survival or
vascular permeability of cells expressing a PDGF-C receptor
including, but not limited to, vascular endothelial cells,
lymphatic endothelial cells, connective tissue cells (such as
fibroblasts), myofibroblasts and glial cells. Preferably the
polypeptide or the encoded polypeptide from a polynucleotide
has the ability to stimulate wound healing. PDGF-C can also
have antagonistic effects on cells, but are included in the
biological activities of PDGF-C. These abilities are referred
to hereinafter as "biological activities of PDGF-C" and can
be readily tested by methods known in the art.
As used herein, the term "PDGF-C" collectively refers to
the polypeptides of Figure 2 (SEQ ID N0:3), Figure 4 (SEQ ID
N0:5) or Figure 6 (SEQ ID N0:7), and fragments or analogs
thereof which have the biological activity of PDGF-C as
defined above, and to a polynucleotide which can code for
PDGF-C, or a fragment or analog thereof having the biological
activity of PDGF-C. The polynucleotide can be naked and/or
in a vector or liposome.
In another preferred aspect, the invention provides a
polypeptide possessing an amino acid sequence:
-13-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
PXCLLVXRCGGXCXCC (SEQ ID NO:1)
which is unique to PDGF-C and differs from the other members
of the PDGF/VEGF family of growth factors because of the
insertion of the three amino acid residues (NCA) between the
third and fourth cysteines (see Figure 9 - SEQ ID NOs:8-17).
Polypeptides comprising conservative substitutions,
insertions, or deletions, but which still retain the
biological activity of PDGF-C are clearly to be understood to
be within the scope of the invention. Persons skilled in the
art will be well aware of methods which can readily be used
to generate such polypeptides, for example the use of site-
directed mutagenesis, or specific enzymatic cleavage and
ligation. The skilled person will also be aware that
peptidomimetic compounds or compounds in which one or more
amino acid residues are replaced by a non-naturally occurring
amino acid or an amino acid analog may retain the required
aspects of the biological activity of PDGF-C. Such compounds
can readily be made and tested by methods known in the art,
and are also within the scope of the invention.
In addition, possible variant forms of the PDGF-C
polypeptide which may result from alternative splicing, as are
known to occur with VEGF and VEGF-B, and naturally-occurring
allelic variants of the nucleic acid sequence encoding PDGF-C
are encompassed within the scope of the invention. Allelic
variants are well known in the art, and represent alternative
forms or a nucleic acid sequence which comprise substitution,
deletion or addition of one or more nucleotides, but which do
not result in any substantial functional alteration of the
encoded polypeptide.
Such variant forms of PDGF-C can be prepared by targeting
non-essential regions of the PDGF-C polypeptide for
modification. These non-essential regions are expected to
fall outside the strongly-conserved regions indicated in
-14-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PGT/US99/Z2668
Figure 9 (SEQ ID NOs:B-17). In particular, the growth factors
of the PDGF family, including VEGF, are dimeric, and VEGF,
VEGF-B, VEGF-C, VEGF-D, P1GF, PDGF-A and PDGF-B show complete
conservation of eight cysteine residues in the N-terminal
domains, i.e. the PDGF/VEGF-like domains (Olofsson et al.,
Proc. Natl. Acad. Sci. USA, 1996 93 2576-2581; Joukov et al.,
EMBO J., 1996 15 290-298). These cysteines are thought to
be involved in intra- and inter-molecular disulfide bonding.
In addition there are further strongly, but not completely,
conserved cysteine residues in the C-terminal domains. Loops
1, 2 and 3 of each subunit, which are formed by intra-
molecular disulfide bonding, are involved in binding to the
receptors for the PDGF/VEGF family of growth factors
(Andersson et al., Growth Factors, 1995 12 159-164).
Persons skilled in the art thus are well aware that these
cysteine residues should be preserved in any proposed variant
form, and that the active sites present in loops 1, 2 and 3
also should be preserved. However, other regions of the
molecule can be expected to be of lesser importance for
biological function, and therefore offer suitable targets for
modification. Modified polypeptides can readily be tested for
their ability to show the biological activity of PDGF-C by
routine activity assay procedures such as the fibroblast
proliferation assay of Example 6.
It is contemplated that some modified PDGF-C polypeptides
will have the ability to bind to PDGF-C receptors on cells
including, but not limited to, endothelial cells, connective
tissue cells, myofibroblasts and/or glial cells, but will be
unable to stimulate cell proliferation, differentiation,
migration, motility or survival or to induce vascular
proliferation, connective tissue development or wound healing.
These modified polypeptides are expected to be able to act as
competitive or non-competitive inhibitors of the PDGF-C
-15-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
polypeptides and growth factors of the PDGF/VEGF family, and
to be useful in situations where prevention or reduction of
the PDGF-C polypeptide or PDGF/VEGF family growth factor
action is desirable. Thus such receptor-binding but non-
mitogenic, non-differentiation inducing, non-migration
inducing, non-motility inducing, non-survival promoting, non-
connective tissue development promoting, non-wound healing or
non-vascular proliferation inducing variants of the PDGF-C
polypeptide are also within the scope of the invention, and
are referred to herein as "receptor-binding but otherwise
inactive variant". Because PDGF-C forms a dimer in order to
activate its only known receptor, it is contemplated that one
monomer comprises the receptor-binding but otherwise inactive
variant modified PDGF-C polypeptide and a second monomer
comprises a wild-type PDGF-C or a wild-type growth factor of
the PDGF/VEGF family. These dimers can bind to its
corresponding receptor but cannot induce downstream signaling.
It is also contemplated that there are other modified
PDGF-C polypeptides that can prevent binding of a wild-type
PDGF-C or a wild-type growth factor of the PDGF/VEGF family
to its corresponding receptor on cells including, but not
limited to, endothelial cells, connective tissue cells (such
as fibroblasts), myofibroblasts and/or glial cells. Thus
these dimers will be unable to stimulate endothelial cell
proliferation, differentiation, migration, survival, or induce
vascular permeability, and/or stimulate proliferation and/or
differentiation and/or motility of connective tissue cells,
myofibroblasts or glial cells. These modified polypeptides
are expected to be able to act as competitive or non-
competitive inhibitors of the PDGF-C growth factor or a growth
factor of the PDGF/VEGF family, and to be useful in situations
where prevention or reduction of the PDGF-C growth factor or
PDGF/VEGF family growth factor action is desirable. Such
-16-
SUBSTITUTE SKEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PGTNS99I22668
situations include the tissue remodeling that takes place
during invasion of tumor cells into a normal cell population
by primary or metastatic tumor formation. Thus such the PDGF-
C or PDGF/VEGF family growth factor-binding but non-mitogenic,
non-differentiation inducing, non-migration inducing, non-
motility inducing, non-survival promoting, non-connective
tissue promoting, non-wound healing or non-vascular
proliferation inducing variants of the PDGF-C growth factor
are also within the scope of the invention, and are referred
to herein as "the PDGF-C growth factor-dimer forming but
otherwise inactive or interfering variants".
An example of a PDGF-C growth factor-dimer forming but
otherwise inactive or interfering variant is where the PDGF-C
has a mutation which prevents cleavage of CUB domain from the
protein. It is further contemplated that a PDGF-C growth
factor-dimer forming but otherwise inactive or interfering
variant could be made to comprise a monomer, preferably an
activated monomer, of VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C,
PDGF-A, PDGF-B or P1GF linked to a CUB domain that has a
mutation which prevents cleavage of CUB domain from the
protein. Dimers formed with the above mentioned PDGF-C growth
factor-dimer forming but otherwise inactive or interfering
variants and the monomers linked to the mutant CUB domain
would be unable to bind to their corresponding receptors.
A variation on this contemplation would be to insert a
proteolytic site between an activated monomer of VEGF, VEGF-B,
VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or P1GF and the mutant
CUB domain linkage which is dimerized to an activated monomer
of VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or
P1GF. An addition of the specific protease(s) for this
proteolytic site would cleave the CUB domain and thereby
release an activated dimer that can then bind to its
-17-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
corresponding receptor. In this way, a controlled release of
an activated dimer is made possible.
According to a third aspect, the invention provides a
purified and isolated nucleic acid encoding a polypeptide or
polypeptide fragment of the invention as defined above. The
nucleic acid may be DNA, genomic DNA, cDNA or RNA, and may be
single-stranded or double stranded. The nucleic acid may be
isolated from a cell or tissue source, or of recombinant or
synthetic origin. Because of the degeneracy of the genetic
code, the person skilled in the art will appreciate that many
such coding sequences are possible, where each sequence
encodes the amino acid sequence shown in Figure 2 (SEQ ID
N0:3), Figure 4 (SEQ ID N0:5) or Figure 6 (SEQ ID N0:7), a
bioactive fragment or analog thereof, a receptor-binding but
otherwise inactive or partially inactive variant thereof or
a PDGF-C-dimer forming but otherwise inactive or interfering
variants thereof.
A fourth aspect of the invention provides vectors
comprising the cDNA of the invention or a nucleic acid
molecule according to the third aspect of the invention, and
host cells transformed or transfected with nucleic acids
molecules or vectors of the invention. These may be
eukaryotic or prokaryotic in origin. These cells are
particularly suitable for expression of the polypeptide of the
invention, and include insect cells such as Sf9 cells,
obtainable from the American Type Culture Collection
(ATCC SRL-171) , transformed with a baculovirus vector, and the
human embryo kidney cell line 293-EBNA transfected by a
suitable expression plasmid. Preferred vectors of the
invention are expression vectors in which a nucleic acid
according to the invention is operatively connected to one or
more appropriate promoters and/or other control sequences,
such that appropriate host cells transformed or transfected
_18_
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
with the vectors are capable of expressing the polypeptide of
the invention. Other preferred vectors are those suitable for
transfection of mammalian cells, or for gene therapy, such as
adenoviral-, vaccinia- or retroviral-based vectors or
liposomes. A variety of such vectors is known in the art.
The invention also provides a method of making a vector
capable of expressing a polypeptide encoded by a nucleic acid
according to the invention, comprising the steps of
operatively connecting the nucleic acid to one or more
appropriate promoters and/or other control sequences, as
described above.
The invention further provides a method of making a
polypeptide according to the invention, comprising the steps
of expressing a nucleic acid or vector of the invention in a
host cell, and isolating the polypeptide from the host cell
or from the host cell's growth medium.
In yet a further aspect, the invention provides an
antibody specifically reactive with a polypeptide of the
invention or a fragment of the polypeptide. This aspect of
the invention includes antibodies specific for the variant
forms, immunoreactive fragments, analogs and recombinants of
PDGF-C. Such antibodies are useful as inhibitors or agonists
of PDGF-C and as diagnostic agents for detecting and
quantifying PDGF-C. Polyclonal or monoclonal antibodies may
be used. Monoclonal and polyclonal antibodies can be raised
against polypeptides of the invention or fragment or analog
thereof using standard methods in the art. In addition the
polypeptide can be linked to an epitope tag, such as the FLAG~
octapeptide (Sigma, St. Louis, MO), to assist in affinity
purification. For some purposes, for example where a
monoclonal antibody is to be used to inhibit effects of PDGF-C
in a clinical situation, it may be desirable to use humanized
or chimeric monoclonal antibodies. Such antibodies may be
-19-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/2Z668
further modified by addition of cytotoxic or cytostatic drugs .
Methods for producing these, including recombinant DNA
methods, are also well known in the art.
This aspect of the invention also includes an antibody
which recognizes PDGF-C and is suitably labeled.
Polypeptides or antibodies according to the invention may
be labeled with a detectable label, and utilized for
diagnostic purposes. Similarly, the thus-labeled polypeptide
of the invention may be used to identify its corresponding
receptor in situ. The polypeptide or antibody may be
covalently or non-covalently coupled to a suitable
supermagnetic, paramagnetic, electron dense, ecogenic or
radioactive agent for imaging. For use in diagnostic assays,
radioactive or non-radioactive labels may be used. Examples
I5 of radioactive labels include a radioactive atom or group,
such as 125I or 32P. Examples of non-radioactive labels include
enzymatic labels, such as horseradish peroxidase or
fluorimetric labels, such as fluorescein-5-isothiocyanate
(FITC). Labeling may be direct or indirect, covalent or non
covalent.
Clinical applications of the invention include diagnostic
applications, acceleration of angiogenesis in tissue or organ
transplantation, or stimulation of wound healing, or
connective tissue development, or to establish collateral
circulation in tissue infarction or arterial stenosis, such
as coronary artery disease, and inhibition of angiogenesis in
the treatment of cancer or of diabetic retinopathy and
inhibition of tissue remodeling that takes place during
invasion of tumor cells into a normal cell population by
primary or metastatic tumor formation. Quantitation of PDGF-C
in cancer biopsy specimens may be useful as an indicator of
future metastatic risk.
PDGF-C may also be relevant to a variety of lung
-20-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18211 PC1YUS99/22668
conditions. PDGF-C assays could be used in the diagnosis of
various lung disorders. PDGF-C could also be used in the
treatment of lung disorders to improve blood circulation in
the lung and/or gaseous exchange between the lungs and the
blood stream. Similarly, PDGF-C could be used to improve
blood circulation to the heart and OZ gas permeability in
cases of cardiac insufficiency. In a like manner, PDGF-C
could be used to improve blood flow and gaseous exchange in
chronic obstructive airway diseases.
Thus the invention provides a method of stimulation of
angiogenesis, lymphangiogenesis, neovascularization,
connective tissue development and/or wound healing in a
mammal in need of such treatment, comprising the step of
administering an effective dose of PDGF-C, or a fragment or
an analog thereof which has the biological activity of PDGF-C
to the mammal. Optionally the PDGF-C, or fragment or analog
thereof may be administered together with, or in conjunction
with, one or more of VEGF, VEGF-B, VEGF-C, VEGF-D, P1GF, PDGF-
A, PDGF-B, FGF and/or heparin.
Conversely, PDGF-C antagonists (e. g. antibodies and/or
competitive or noncompetitive inhibitors of binding of PDGF-C
in both dimer formation and receptor binding) could be used
to treat conditions, such as congestive heart failure,
involving accumulation of fluid in, for example, the lung
resulting from increases in vascular permeability, by exerting
an offsetting effect on vascular permeability in order to
counteract the fluid accumulation. PDGF-C can also be used
to treat fibrotic conditions including those found in the
lung, kidney and liver. Administrations of PDGF-C could be
used to treat malabsorptive syndromes in the intestinal tract,
liver or kidneys as a result of its blood circulation
increasing and vascular permeability increasing activities.
-21-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Thus, the invention provides a method of inhibiting
angiogenesis, lymphangiogenesis, neovascularization,
connective tissue development and/or wound healing in a mammal
in need of such treatment, comprising the step of
administering an effective amount of an antagonist of PDGF-C
to the mammal. The antagonist may be any agent that prevents
the action of PDGF-C, either by preventing the binding of
PDGF-C to its corresponding receptor on the target cell, or
by preventing activation of the receptor, such as using
receptor-binding PDGF-C variants. Suitable antagonists
include, but are not limited to, antibodies directed against
PDGF-C; competitive or non-competitive inhibitors of binding
of PDGF-C to the PDGF-C receptor(s), such as the receptor-
binding or PDGF-C dimer-forming but non-mitogenic PDGF-C
variants referred to above; compounds that bind to PDGF-C
and/or modify or antagonize its function, and anti-sense
nucleotide sequences as described below.
A method is provided for determining agents that bind to
an activated truncated form of PDGF-C. The method comprises
contacting an activated truncated form of PDGF-C with a test
agent and monitoring binding by any suitable means. Agents
can include both compounds and other proteins.
The invention provides a screening system for discovering
agents that bind an activated truncated form of PDGF-C. The
screening system comprises preparing an activated truncated
form of PDGF-C, exposing the activated truncated form of PDGF-
C to a test agent, and quantifying the binding of said agent
to the activated truncated form of PDGF-C by any suitable
means. This screening system can also be used to identify
agents which inhibit the proteolytic cleavage of the full
length PDGF-C protein and thereby prevent the release of the
activated truncated form of PDGF-C. For this use, the full
length PDGF-C must be prepared.
-22-
SUBSTITUTE SHEET (RULE 16)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22b68
Use of this screen system provides a means to determine
compounds that may alter the biological function of PDGF-C.
This screening method may be adapted to large-scale, automated
procedures such as a PANDEX~ (Baxter-Dade Diagnostics) system,
allowing fox efficient high-volume screening of potential
therapeutic agents.
For this screening system, an activated truncated form
of PDGF-C or full length PDGF-C is prepared as described
herein, preferably using recombinant DNA technology. A test
agent, e.g. a compound or protein, is introduced into a
reaction vessel containing the activated truncated form of or
full length PDGF-C. Binding of the test agent to the
activated truncated form of or full length PDGF-C is
determined by any suitable means which include, but is not
limited to, radioactively- or chemically-labeling the test
agent. Binding of the activated truncated form of or full
length PDGF-C may also be carried out by a method disclosed
in U.S. Patent 5,585,277, which is incorporated by reference.
In this method, binding of the test agent to the activated
truncated form of or full length PDGF-C is assessed by
monitoring the ratio of folded protein to unfolded protein.
Examples of this monitoring can include, but are not limited
to, monitoring the sensitivity of the activated truncated form
of or full length PDGF-C' to a protease, or amenability to
binding of the protein by a specific antibody against the
folded state of the protein.
Those of skill in the art will recognize that ICSO values
are dependent on the selectivity of the agent tested. For
example, an agent with an ICso which is less than 10 nM is
generally considered an excellent candidate for drug therapy.
However, an agent which has a lower affinity, but is selective
for a particular target, may be an even better candidate.
Those skilled in the art will recognize that any information
-23-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PGT/US99/22668
regarding the binding potential, inhibitory activity or
selectivity of a particular agent is useful toward the
development of pharmaceutical products.
Where a PDGF-C or a PDGF-C antagonist is to be used for
therapeutic purposes, the doses) and route of administration
will depend upon the nature of the patient and condition to
be treated, and will be at the discretion of the attending
physician or veterinarian. Suitable routes include oral,
subcutaneous, intramuscular, intraperitoneal or intravenous
injection, parenteral, topical application, implants etc.
Topical application of PDGF-C may be used in a manner
analogous to VEGF. For example, where used for wound healing
or other use in which enhanced angiogenesis is advantageous,
an effective amount of the truncated active form of PDGF-C is
administered to an organism in need thereof in a dose between
about 0.1 and 1000 ug/kg body weight.
The PDGF-C or a PDGF-C antagonist may be employed in
combination with a suitable pharmaceutical carrier. The
resulting compositions comprise a therapeutically effective
amount of PDGF-C or a PDGF-C antagonist, and a
pharmaceutically acceptable non-toxic salt thereof, and a
pharmaceutically acceptable solid or liquid carrier or
adj uvant . Examples of such a carrier or adj uvant include, but
are not limited to, saline, buffered saline, Ringer's
solution, mineral oil, talc, corn starch, gelatin, lactose,
sucrose, microcrystalline cellulose, kaolin, mannitol,
dicalcium phosphate, sodium chloride, alginic acid, dextrose,
water, glycerol, ethanol, thickeners, stabilizers, suspending
agents and combinations thereof. Such compositions may be in
the form of solutions, suspensions, tablets, capsules, creams,
salves, elixirs, syrups, wafers, ointments or other
conventional forms. The formulation to suit the mode of
administration. Compositions which comprise PDGF-C may
-24-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18Z1Z PCT/US99/22668
optionally further comprise one or more of PDGF-A, PDGF-B,
VEGF, VEGF-B, VEGF-C, VEGF-D, P1GF and/or heparin.
Compositions comprising PDGF-C will contain from about 0.1~
to 90~ by weight of the active compound ( s ) , and most generally
from about 10$ to 30~.
For intramuscular preparations, a sterile formulation,
preferably a suitable soluble salt form of the truncated
active form of PDGF-C, such as hydrochloride salt, can be
dissolved and administered in a pharmaceutical diluent such
as pyrogen-free water (distilled), physiological saline or 5~
glucose solution. A suitable insoluble form of the compound
may be prepared and administered as a suspension in an aqueous
base or a pharmaceutically acceptable oil base, e.g. an ester
of a long chain fatty acid such as ethyl oleate.
According to yet a further aspect, the invention provides
diagnostic/prognostic devices typically in the form of test
kits. For example, in one embodiment of the invention there
is provided a diagnostic/prognostic test kit comprising an
antibody to PDGF-C and a means for detecting, and more
preferably evaluating, binding between the antibody and PDGF-
C. In one preferred embodiment of the diagnostic/prognostic
device according to the invention, a second antibody (the
secondary antibody) directed against antibodies of the same
isotype and animal source of the antibody directed against
PDGF-C (the primary antibody) is provided. The secondary
antibody is coupled to a detectable label, and then either an
unlabeled primary antibody or PDGF-C is substrate-bound so
that the PDGF-C/primary antibody interaction can be
established by determining the amount of label bound to the
substrate following binding between the primary antibody and
PDGF-C and the subsequent binding of the labeled secondary
antibody to the primary antibody. In a particularly preferred
embodiment of the invention, the diagnostic/prognostic device
-25-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
may be provided as a conventional enzyme-linked immunosorbent
assay (ELISA) kit.
In another alternative embodiment, a
diagnostic/prognostic device may comprise polymerise chain
reaction means for establishing sequence differences of a
PDGF-C of a test individual and comparing this sequence
structure with that disclosed in this application in order to
detect any abnormalities, with a view to establishing whether
any aberrations in PDGF-C expression are related to a given
disease condition.
In addition, a diagnostic/prognostic device may comprise
a restriction length polymorphism (RFLP)generating means
utilizing restriction enzymes and genomic DNA from a test
individual to generate a pattern of DNA bands on a gel and
comparing this pattern with that disclosed in this application
in order to detect any abnormalities, with a view to
establishing whether any aberrations in PDGF-C expression are
related to a given disease condition.
In accordance with a further aspect, the invention
relates to a method of detecting aberrations in PDGF-C gene
in a test subject which may be associated with a disease
condition in the test subject. This method comprises
providing a DNA or RNA sample from said test subject;
contacting the DNA sample or RNA with a set of primers
specific to PDGF-C DNA operatively coupled to a polymerise and
selectively amplifying PDGF-C DNA from the sample by
polymerise chain reaction, and comparing the nucleotide
sequence of the amplified PDGF-C DNA from the sample with the
nucleotide sequences shown in Figure 1 (SEQ ID N0:2) or Figure
3 (SEQ ID N0:5). The invention also includes the provision
of a test kit comprising a pair of primers specific to PDGF-C
DNA operatively coupled to a polymerise, whereby said
-26-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/~JS99/Z2668
polymerase is enabled to selectively amplify PDGF-C DNA from
a DNA sample.
The invention also provides a method of detecting PDGF-C
in a biological sample, comprising the step of contacting the
sample with a reagent capable of binding PDGF-C, and detecting
the binding. Preferably the reagent capable of binding PDGF-C
is an antibody directed against PDGF-C, particularly
preferably a monoclonal antibody. In a preferred embodiment
the binding and/or extent of binding is detected by means of
a detectable label; suitable labels are discussed above.
In another aspect, the invention relates to a protein
dimer comprising the PDGF-C polypeptide, particularly a
disulfide-linked dimer. The protein dimers of the invention
include both homodimers of PDGF-C polypeptide and heterodimers
of PDGF-C and VEGF, VEGF-B, VEGF-C, VEGF-D, P1GF, PDGF-A or
PDGF-B.
According to a yet further aspect of the invention there
is provided a method for isolation of PDGF-C comprising the
step of exposing a cell which expresses PDGF-C to heparin to
facilitate release of PDGF-C from the cell, and purifying the
thus-released PDGF-C.
Another aspect of the invention involves providing a
vector comprising an anti-sense nucleotide sequence which is
complementary to at least a part of a DNA sequence which
encodes PDGF-C or a fragment or analog thereof that has the
biological activity of PDGF-C. In addition the anti-sense
nucleotide sequence can be to the promoter region of the PDGF-
C gene or other non-coding region of the gene which may be
used to inhibit, or at least mitigate, PDGF-C expression.
According to a yet further aspect of the invention such
a vector comprising an anti-sense sequence may be used~~to
inhibit, or at least mitigate, PDGF-C expression. The use of
a vector of this type to inhibit PDGF-C expression is favored
-27-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
in instances where PDGF-C expression is associated with a
disease, for example where tumors produce PDGF-C in order to
provide for angiogenesis, or tissue remodeling that takes
place during invasion of tumor cells into a normal cell
population by primary or metastatic tumor formation.
Transformation of such tumor cells with a vector containing
an anti-sense nucleotide sequence would inhibit or retard
growth of the tumor or tissue remodeling.
Another aspect of the invention relates to the discovery
that the full length PDGF-C protein is likely to be a latent
growth factor that needs to be activated by proteolytic
processing to release an active PDGF/VEGF homology domain.
A putative proteolytic site is found in residues 231-234 in
the full length protein, residues -RKSR-. This is a dibasic
motif . This site is structurally conserved in the mouse PDGF-
C. The -RKSR- putative proteolytic site is also found in
PDGF-A, PDGF-B, VEGF-C and VEGF-D. In these four proteins,
the putative proteolytic site is also found just before the
minimal domain for the PDGF/VEGF homology domain. Together
these facts indicate that this is the proteolytic site.
Preferred proteases include, but are not limited, to
plasmin, Factor X and enterokinase. The N-terminal CUB domain
may function as an inhibitory domain which might be used to
keep PDGF-C in a latent form in some extracellular compartment
and which is removed by limited proteolysis when PDGF-C is
needed.
According to this aspect of the invention, a method is
provided for producing an activated truncated form of PDGF-C
or for regulating receptor-binding specificity of PDGF-C.
These methods comprise the steps of expressing an expression
vector comprising a polynucleotide encoding a polypeptide
having the biological activity of PDGF-C and supplying a
proteolytic amount of at least one enzyme for processing the
-28-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99I22668
expressed polypeptide to generate the activated truncated form
of PDGF-C.
This aspect also includes a method for selectively
activating a polypeptide having a growth factor activity.
This method comprises the step expressing an expression vector
comprising a polynucleotide encoding a polypeptide having a
growth factor activity, a CUB domain and a proteolytic site
between the polypeptide and the CUB domain, and supplying a
proteolytic amount of at least one enzyme for processing the
expressed polypeptide to generate the activated polypeptide
having a growth factor activity.
In addition, this aspect includes the isolation of a
nucleic acid molecule which codes for a polypeptide having the
biological activity of PDGF-C and a polypeptide thereof which
comprises a proteolytic site having the amino acid sequence
RKSR or a structurally conserved amino acid sequence thereof .
Also this aspect includes an isolated dimer comprising
an activated monomer of PDGF-C and an activated monomer of
VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or P1GF
linked to a CUB domain, or alternatively, an activated monomer
of VEGF, VEGF-B, VEGF-C, VEGF-D, PDGF-C, PDGF-A, PDGF-B or
P1GF and an activated monomer of PDGF-C linked to a CUB
domain. The isolated dimer may or may not include a
proteolytic site between the activator monomer and the CUB
domain linkage.
Polynucleotides of the invention such as those described
above, fragments of those polynucleotides, and variants of
those polynucleotides with sufficient similarity to the non-
coding strand of those polynucleotides to hybridize thereto
under stringent conditions all are useful fox identifying,
purifying, and isolating polynucleotides encoding other, non-
human, mammalian forms of PDGF-C. Thus, such polynucleotide
fragments and variants are intended as aspects of the
_29_
SUBSTITUTE SHEET (RULE Z6)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
invention. Exemplary stringent hybridization conditions are
as follows: hybridization at 92°C in 5X SSC, 20 mM NaP09,
pH 6.8, 50$ formamide; and washing at 42°C in 0.2X SSC. Those
skilled in the art understand that it is desirable to vary
these conditions empirically based on the length and the GC
nucleotide base content of the sequences to be hybridized, and
that formulas for determining such variation exist. See for
example Sambrook et al, "Molecular Cloning: A Laboratory
Manual", Second Edition, pages 9.47-9.51, Cold Spring Harbor,
New York: Cold Spring Harbor Laboratory (1989).
Moreover, purified and isolated polynucleotides encoding
other, non-human, mammalian PDGF-C forms also are aspects of
the invention, as are the polypeptides encoded thereby and
antibodies that are specifically immunoreactive with the non-
human PDGF-C variants. Thus, the invention includes a
purified and isolated mammalian PDGF-C polypeptide and also
a purified and isolated polynucleotide encoding such a
polypeptide.
It will be clearly understood that nucleic acids and
polypeptides of the invention may be prepared by synthetic
means or by recombinant means, or may be purified from natural
sources.
It will be clearly understood that for the purposes of
this specification the word "comprising" means "included but
not limited to". The corresponding meaning applies to the
word "comprises".
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 (SEQ ID N0:2) shows the complete nucleotide
sequence of cDNA encoding a human PDGF-C (hPDGF-C)(2108 bp);
Figure 2 (SEQ ID N0:3) shows the deduced amino acid
sequence of full-length hPDGF-C which consists of 345 amino
-30-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
acid residues (the translated part of the cDNA corresponds to
nucleotides 37 to 1071 of Figure 1);
Figure 3 (SEQ ID N0:4) shows a cDNA sequence encoding a
fragment of human PDGF-C (hPDGF-C)(1536 bp);
Figure 4 (SEQ ID N0:5) shows a deduced amino acid
sequence of a fragment of hPDGF-C(translation of nucleotides
3 to 956 of the nucleotide sequence of Figure 3);
Figure 5 (SEQ ID N0:6) shows a nucleotide sequence of a
murine PDGF-C (mPDGF-C) cDNA;
Figure 6 (SEQ ID N0:7) shows the deduced amino acid
sequence of a fragment of mPDGF-C(the translated part of the
cDNA corresponds to nucleotides 196 to 1233 of Figure 5);
Figure 7 shows a comparative sequence alignment of the
hPDGF-C amino acid sequence of Figure 2 ( SEQ ID NO: 3 ) with the
mPDGF-C amino acid sequence of Figure 6 (SEQ ID N0:7);
Figure 8 shows a schematic structure of mPDGF-C with a
signal sequence (striped box), a N-terminal Clr/Cls/embryonic
sea urchin protein Uegf/bone morphogenetic protein 1 (CUB)
domain and the C-terminal PDGF/VEGF-homology domain (open
boxes);
Figure 9 shows a comparative sequence alignment of the
PDGF/VEGF-homology domains in human and mouse PDGF-C with
other members of the VEGF/PDGF family of growth factors (SEQ
ID NOs:8-17, respectively);
Figure 10 shows a phylogenetic tree of several growth
factors belonging to the VEGF/PDGF family;
Figure 11 provides the amino acid sequence alignment of
the CUB domain present in human and mouse PDGF-Cs (SEQ ID
NOs:l8 and 19, respectively) and other CUB domains present in
human bone morphogenic protein-1 (hBMP-1, 3 CUB domains CUB1-
3)(SEQ ID NOs:20-22, respectively) and in human neuropilin-1
(2 CUB domains)(SEQ ID NOs:23 and 24, respectively);
-31-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Figure 12 shows a Northern blot analysis of the
expression of PDGF-C transcripts in several human tissue s
Figure 13 shows the regulation of PDGF-C mRNA expression
by hypoxia; and
Figure 14 shows the expression of PDGF-C in human tumor
cell lines.
Figure 15 shows the results of immunoblot detection of
full length human PDGF-C in transfected COS-1 cells.
Figure 16 shows isolation and partial characterization
of full length PDGF-C.
Figure 17 shows isolation and partial characterization
of a truncated form of human PDGF-C containing the PDGF/VEGF
homology domain only.
Figure 18 provides a standard curve for the binding of
labeled PDGF-BB homodimers to PAE-1 cells expressing PDGF
alpha receptor.
Figure 19 provides a graphic representation of the
inhibition of binding of labeled PDGF-BB to PAE-1 cells
expressing PDGF alpha receptor by increasing amounts of
purified full length and truncated PDGF-CC proteins.
Figure 20 shows the effects of the full length and
truncated PDGF-CC homodimers on the phosphorylation of PDGF
alpha-receptor.
Figure 21 shows the mitogenic activities of the full
length and truncated PDGF-CC homodimers on fibroblasts.
Figure 22 graphically presents the results of the binding
assay of truncated PDGF-C to the PDGF receptors.
Figure 23 shows the immunoblot of the undigested full
length PDGF-C protein and the plasmin-generated 26-28 kDa
species.
Figure 24 graphically presents the results of the
competitive binding assay of full-length PDGF-C and truncated
PDGF-C for PDGFR-alpha receptors.
-32-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Figure 25 shows the analyses by SDS-PAGE of the human
PDGF-C CUB domain under reducing and non-reducing conditions.
Figures 26A-26V show PDGF-C expression in the developing
mouse embryo.
Figures 27A-27F show PDGF-C, PDGF-A and PDGFR-alpha
expression in the developing kidney.
Figures 28A-28F show histology of E 16.5 kidneys from
wildtype (Figures 28A and 28C), PDGFR-alpha -/- (Figures 28B
and 28F, PDGF-A -/- {Figure 28D) and PDGF-A/PDGF-B double -/-
(Figure 28E) kidneys.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
Figure 1 (SEQ ID N0:2) shows the complete nucleotide
sequence of cDNA encoding a human PDGF-C (hPDGF-C)(2108 bp),
which is a new member of the VEGF/PDGF family. A clone #4
{see Figures 3 and 4 - SEQ ID NOs:4 and 5) encoding hPDGF-C
was not full length and lacked approximately 80 base pairs of
coding sequence when compared to the mouse protein
(corresponding to 27 amino acids). Additional cDNA clones
were isolated from a human fetal lung cDNA library to obtain
an insert which included this missing sequence. Clone #10 had
a longer insert than clone #4. The insert of clone #10 was
sequenced in the 5' region and it was found to contain the
missing sequence. Clone #10 was found to include the full
sequence of human PDGF-C. Some 5'-untranslated sequence, the
translated part of the cDNA encoding human PDGF-C and some 3' -
untranslated nucleotide sequence are shown in Figure 1 (SEQ
ID N0:2). A stop codon in frame is located 21 by upstream of
the initiation ATG (the initiation ATG is underlined in Figure
1) .
Work to isolate this new human PDGF/VEGF began after a
search of the expressed sequence tag (EST) database, dbEST,
-33-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
at the National Center for Biotechnology Information (NCBI)
in Washington, DC, identified a human EST sequence (W21436)
which appears to encode part of the human homolog of the mouse
PDGF-C. Based on the human EST sequence, two oligonucleotides
were designed:
5'-GAA GTT GAG GAA CCC AGT G-3' forward (SEQ ID N0:25)
5'-CTT GCC AAG AAG TTG CCA AG-3' reverse (SEQ ID N0:26).
These oligonucleotides were used to amplify by polymerase
chain reaction (PCR) a polynucleotide of 348 bps from a Human
Fetal Lung 5'-STRETCH PLUS hgtl0 cDNA library, which was
obtained commercially from Clontech. The PCR product was
cloned into the pCR 2.1-vector of the Original TA Cloning Kit
(Invitrogen). Subsequently, the 348 bps cloned PCR product
was used to construct a hPDGF-C probe according to standard
techniques.
106 lambda-clones of the Human Fetal Lung 5' -STRETCH PLUS
l~gtl0 cDNA Library (Clontech) were screened with the hPDGF-C
probe according to standard procedures. Among several
positive clones, one, clone #4 was analyzed more carefully and
the nucleotide sequence of its insert was determined according
to standard procedures using internal and vector
oligonucleotides. The insert of clone #9 contains a partial
nucleotide sequence of the cDNA encoding the full length human
PDGF-C (hPDGF-C). The nucleotide sequence (1536 bp) of the
clone #4 insert is shown in Figure 3 (SEQ ID N0:4). The
translated portion of this cDNA includes nucleotides 6 to 956.
The deduced amino acid sequence of the translated portion of
the insert is illustrated in Figure 4 (SEQ ID N0:5). A
polypeptide of this deduced amino acid sequence would lack the
first 28 amino acid residues found in the full length hPDGF-C
polypeptide. However, this polypeptide includes a proteolytic
fragment which is sufficient to activate the PDGF alpha
-34-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00118212 PCT/US99/Z2668
receptors. It should be noted that the first glycine (Gly)
of .SEQ ID N0:5 is not found in the full length hPDGF-C.
A mouse EST sequence (AI020581) was identified in a
database search of the dbEST database at the NCBI in
Washington, DC, which appears to encode part of a new mouse
PDGF, PDGF-C. Large parts of the mouse cDNA was obtained by
PCR amplification using DNA from a mouse embryo l~gtl0 cDNA
library as the template. To amplify the 3' end of the cDNA,
a sense primer derived from the mouse EST sequence was used
(the sequence of this primer was 5'-CTT CAG TAC CTT GGA AGA
G, primer 1 (SEQ ID N0:27) ) To amplify the 5'end of the cDNA,
an antisense primer derived from the mouse EST was used (the
sequence of this primer was 5'-CGC TTG ACC AGG AGA CAA C,
primer 2 (SEQ ID N0:28) ) . The l~gtl0 vector primers were sense
5'-ACG TGA ATT CAG CAA GTT CAG CCT GGT TAA (primer 3 (SEQ ID
N0:29)) and antisense 5'-ACG TGG ATC CTG AGT ATT TCT TCC AGG
GTA (primer 4 (SEQ ID N0:30)). Combinations of the vector
primers and the internal primers obtained from the mouse EST
were used in standard PCR reactions. The sizes of the
amplified fragments were approx. 750 by (3'-fragment) and 800
by (5'-fragment), respectively. These fragments were cloned
into the pCR 2 .1 vector and subj ected to nucleotide sequences
analysis using vector primers and internal primers. Since
these fragments did not contain the full length sequence of
mPDGF-C, a mouse liver ZAP cDNA library was screened using
standard conditions. A 261 by 32P-labeled PCR fragment was
generated for use as a probe using primers 1 and 2 and using
DNA from the mouse embryo AgtlO library as the template (see
above). Several positive plaques were purified and the
nucleotide sequence of the inserts were obtained following
subcloning into pBluescript. Vector specific primers and
internal primers were used. By combining the nucleotide
sequence information of the generated PCR clones and the
-35-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
isolated clone, the full length amino acid sequence of mPDGF-C
could be deduced (see Figure 6)(SEQ ID N0:7).
Figure 7 shows a comparative sequence alignment of the
mouse and human amino acid sequences of PDGF-C (SEQ ID NOS:6
and 2, respectively). The alignment shows that human and
mouse PDGF-Cs display an identity of about 87$ with 95 amino
acid replacements found among the 345 residues of the full
length proteins. Almost all of the observed amino acid
replacements are conservative in nature. The predicted
cleavage site in mPDGF-C for the signal peptidase is between
residues G19 and T20. This would generate a secreted mouse
peptide of 326 amino acid residues.
Figure 8 provides a schematic domain structure of mouse
PDGF-C with a signal sequence (striped box), a N-terminal CUB
domain and the C-terminal PDGF/VEGF-homology domain (open
boxes). The amino acid sequences denoted by the lines have
no obvious similarities to CUB domains or to VEGF-homology
domains.
The high sequence identity suggests that human and mouse
PDGF-C have an almost identical domain structure. Amino acid
sequence comparisons revealed that both mouse and human PDGF-C
display a novel domain structure. Apart from the PDGF/VEGF-
homology domain located in the C-terminal region in both
proteins (residues 169 to 345), the N-terminal region in both
PDGF-Cs have a domain referred to as a CUB domain (Bork and
Beckmann, J. Mol. Biol., 1993 231, 539-545). This domain of
about 110 amino acids (amino acid residues 50-160) was
originally identified in complement factors Clr/Cls, but has
1 30 recently been identified in several other extracellular
proteins including signaling molecules such as bone
morphogenic protein 1 (BMP-1) (Wozney et al.,Science, 1988
,~42, 1528-1534) as well as in several receptor molecules such
-35-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
as neuropilin-1 (NP-1) (Soker et al., Cell, 1998 92 735-745).
The functional roles of CUB domains are not clear but it may
participate in protein-protein interactions or in interactions
with carbohydrates including heparin sulfate proteoglycans.
Figure 9 shows the amino acid sequence alignment of the
C-terminal PDGF/VEGF-homology domains of human and mouse PDGF-
Cs with the C-terminal PDGF/VEGF-homology domains of PDGF/VEGF
family members, VEGFISS. P1GF-2, VEGF-B16" Pox Orf VEGF, VEGF-
C, VEGF-D, PDGF-A and PDGF-B (SEQ ID NOs:8-17). Some of the
amino acid sequences in the N- and C-terminal regions in VEGF-
C and VEGF-D have been deleted in this figure . Gaps were
introduced to optimize the alignment. This alignment was
generated using the method of J. Hein, (Methods Enzymol. 1990
183 626-45) with PAM250 residue weight table. The boxed
residues indicate amino acids which match the PDGF-Cs within
two distance units.
The alignment shows that PDGF-C has the expected pattern
of invariant cysteine residues, a hallmark of members of this
family, with one exception. Between cysteine 3 and 4,
normally spaced by 2 residues there is an insertion of three
extra amino acids (NCA). This feature of the sequence in
PDGF-C was highly unexpected.
Based on the amino acid sequence alignments in Figure 9,
a phylogenetic tree was constructed and is shown in Figure 10.
The data show that the PDGF-C homology domain is closely
related to the PDGF/VEGF-homology domains of VEGF-C and VEGF-
D.
As shown in Figure 11, the amino acid sequences from
several CUB-containing proteins were aligned (SEQ ID NOs:l8-
24 ) . The results show that the single CUB domain in human and
mouse PDGF-C (SEQ ID NOs:l8 and 19, respectively) displays a
significant identify with the most closely related CUB
domains. Sequences from human BMP-1, with 3 CUB domains (CUB1-
-37-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
wo oona2iZ pcTius99nisss
3 (SEQ ID NOs:20-22)) and human neuropilin-1 with 2 CUB
domains (CUB1-2)(SEQ ID NOs:23 and 24, respectively) are
shown. Gaps were introduced to optimize the alignment. This
alignment was generated using the method of J. Hein, (Methods
Enzymol., 1990 183 626-45) with PAM250 residue weight table.
Figure 12 shows a Northern blot analysis of the
expression of PDGF-C transcripts in several human tissues.
The analysis shows that PDGF-C is encoded by a major
transcript of approximately 3.8-3.9 kb, and a minor of 2.8 kb.
The numbers to the right refer to the size of the mRNAs (in
kb). The tissue expression of PDGF-C was determined by
Northern blotting using a commercial Multiple Tissue Northern
blot (MTN, Clontech). The blots were hybridized at according
to the instructions from the supplier using ExpressHyb
solution at 68°C for one hour (high stringency conditions),
and probed with a 353 by hPDGF-C EST probe from the fetal lung
cDNA library screening as described above. The blots were
subsequently washed at 50°C in 2X SSC with 0.05 SDS for 30
minutes and at 50°C in O.1X SSC with 0.1°s SDS for an
additional 40 minutes. The blots were then put on film and
exposed at -70°C. The blots show that PDGF-C transcripts are
most abundant in heart, liver, kidney, pancreas and ovary
while lower levels of transcripts are present in most other
tissues, including placenta, skeletal muscle and prostate.
PDGF-C transcripts were below the level of detection in
spleen, colon and peripheral blood leucocytes.
Figure 13 shows the regulation of PDGF-C mRNA expression
by hypoxia. Size markers (in kb) are indicated to the left
in the lower panel. The estimated sizes of PDGF-C mRNAs is
indicated to the left in the upper panel (2.7 and 3.5 kbs,
respectively). To explore whether PDGF-C is induced by
hypoxia, cultured human skin fibroblasts were exposed to
hypoxia for 0, 4, 8 and 24 hours. Poly(A)+ mRNA was isolated
-38-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PGT/US99/22668
from cells using oligo-dT cellulose affinity purification.
Isolated mRNAs were electrophoresed through 12% agarose gels
using 4 ug of mRNA per line. A Northern blot was made and
hybridized with a probe for PDGF-C. The sizes of the two
bands were determined by hybridizing the same filter with a
mixture of hVEGF, hVEGF-B and hVEGF-C probes (Enholm et a1.
Oncogene, 1997 14 2475-2483), and interpolating on the basis
of the known sizes of these mRNAs. The results shown in Figure
13 indicate that PDGF-C is not regulated by hypoxia in human
skin fibroblasts.
Figure 14 shows the expression of PDGF-C mRNA in human
tumor cells lines. To explore whether PDGF-C was expressed
in human tumor cell lines, poly(A)+ mRNA was isolated from
several known tumor cell lines, the mRNAs were electrophoresed
through a 12% agarose gel and analyzed by Northern blotting
and hybridization with the PDGF-C probe. The results shown in
Figure 14 demonstrate that PDGF-C mRNA is expressed in several
types of human tumor cell lines such as JEG3 (a human
choriocarcinoma, ATCC #HTB-36), 6401 (a Wilms tumor, ATCC
#CRL-1441), DAMI (a megakaryoblastic leukemia), A549 (a human
lung carcinoma, ATCC #CCL-185) and HEL (a human
erythroleukemia, ATCC #TID-180). It is contemplated that
further growth of these PDGF-C expressing tumors can be
inhibited by inhibiting PDGF-C. As well as using PDGF-C
expression as a means of identifying specific types of tumors.
Example 1: Generation of specific antipeptide antibodies to
human PDGF-C
Two synthetic peptides were generated and then used to
raise antibodies against human PDGF-C. The first synthetic
peptide corresponds to residues 29-48 of the N-terminus of
full length PDGF-C and includes an extra cysteine residue at
the N- and C-terminus : CKFQFSSNKEQNGVQDPQHERC ( SEQ ID NO: 31 ) .
-39-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/I1S99/Z2668
The second synthetic peptide corresponds to residues 230-250
of the internal region of full length PDGF-C and includes an
extra cysteine residue at the C-terminus:
GRKSRVVDLNLLTEEVRLYSC (SEQ ID N0:32). The two peptides were
each conjugated to the carrier protein keyhole limpet
hemocyanin (KLH, Calbiochem) using N-succinimidyl
3-(2-pyridyldithio)propionate (SPDP) (Pharmacia Inc.)
according to the instructions of the supplier. 200-300
micrograms of the conjugates in phosphate buffered saline
(PBS) were separately emulsified in Freunds Complete Adjuvant
and injected subcutaneously at multiple sites in rabbits. The
rabbits were boostered subcutaneously at biweekly intervals
with the same amount of the conjugates emulsified in Freunds
Incomplete Adjuvant. Blood was drawn and collected from the
rabbits. The sera were prepared using standard procedures
known to those skilled in the art.
Example 2: Expression of full length human PDGF-C in
mammalian cells
The full length cDNA encoding human PDGF-C was cloned
into the mammalian expression vector, pSGS (Stratagene, La
Jolla, CA) that has the SV40 promoter. COS-1 cells were
transfected with this construct and in separate transfections,
with a pSG5 vector without the cDNA insert for a control,
using the DEAE-dextran procedure. Serum free medium was added
to the transfected COS-1 cells 24 hours after the
transfections and aliquots containing the secreted proteins
were collected for a 24 hour period after the addition of the
medium. These aliquots were subjected to precipitation using
ice cold 10$ trichloroacetic acid for 30 minutes, and the
precipitates were washed with acetone. The precipitated
proteins were dissolved in SDS loading buffer under reducing
conditions and separated on a SDS-PAGE gel using standard
-40-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
procedures. The separated proteins were electrotransferred
onto Hybond filter and immunoblotted using a rabbit antiserum
against the internal peptide of full length PDGF-C, the
preparation of which is described above. Bound antibodies
were detected using enhanced chemiluminescence (ECL, Amersham
Inc.). Figure 15 shows the results of this immunoblot. The
sample was only partially reduced and the monomer of the human
PDGF-C migrated as a 55 kDa species (the lower band) and the
dimer migrated as a 100 kDa species (upper band). This
indicates that the protein is secreted intact and that no
major proteolytic processing occurs during secretion of the
molecule in mammalian cells.
Example 3: Expression of full length and truncated human
PDGF-C in baculovirus infected Sf9 cells
The full length coding part of the human PDGF-C cDNA ( 970
bp) was amplified by PCR using Deep Vent DNA polymerase
(Biolabs) using standard conditions and procedures. The full
length PDGF-C was amplified for 30 cycles, where each cycle
consisted of one minute denaturization at 94°C, one minute
annealing at 56°C and two minutes extension at 72°C. The
forward primer used was 5'CGGGATCCCGAATCCAACCTGAGTAG3' (SEQ
ID N0:33) . This primer includes a BamHI site (underlined) for
in frame cloning. The reverse primer used was
5'GGAATTCCTAATGGTGATGGTGATGATGTTTGTCATCGTCATCTCCTCCTGTGCTC
CCTCT3' (SEQ ID N0:34). This primer includes an EcoRI site
(underlined) and sequences coding for a C-terminal 6X His tag
preceded by an enterokinase site. In addition, residues 230-
345 of the PDGF/VEGF homology domain (PVHD) of human PDGF-C
were amplified by PCR using Deep Vent DNA polymerase (Biolabs)
using standard conditions and procedures. The residues 230-
345 of the PVHD of PDGF-C were amplified for 25 cycles, where
each cycle consisted of one minute denaturization at 94°C,
-41-
SUBSTTTUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
four minutes annealing at 56°C and four minutes extension at
72°C. The forward primer used was 5'CGGATCCCGGAAGAAAATCCA
GAGTGGTG3' (SEQ ID N0:35). This primer includes a BamHI site
(underlined) for in frame cloning. The reverse primer used
was 5'GGAATTCCTAATGGTGATGGTGATGATGTTTGTCATCGTCATCTCCTCCTGTG
CTCCCTCT-3' (SEQ ID N0:36). This primer includes an EcoRI
site (underlined) and sequences coding for a C-terminal 6X His
tag preceded by an enterokinase site. The PCR products were
digested with BamHI and EcoRI and subsequently cloned into the
baculovirus expression vector, pAcGP67A. Verification of the
correct sequence of the PCR products cloned into the
constructs was by nucleotide sequencing. The expression
vectors were then co-transfected with BaculoGold linearized
baculovirus DNA into Sf9 insect cells according to the
manufactures protocol (Pharmingen). Recombined baculovirus
were amplified several times before beginning large scale
protein production and protein purification according to the
manual (Pharmingen).
Sf9 cells, adapted to serum free medium, were infected
with recombinant baculovirus at a multiplicity of infection
of about 7. Media containing the recombinant proteins were
harvested 4 days after infection and were incubated with
Ni-NTA-Agarose beads(Qiagen). The beads were collected in
a column and after extensive washing with 50 mM sodium
phosphate buffer pH 8, containing 300 mM NaCl (the washing
buffer), the bound proteins were eluted with increasing
concentrations of imidazole (from 100 mM to 500 mM) in the
washing buffer. The eluted proteins were analyzed by SDS-
PAGE using 12.5$ polyacrylamide gels under reducing and
non-reducing conditions. For immunoblotting analyses, the
proteins were electrotransferred onto Hybond filters for 45
minutes.
-42-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Figures 16A-C show the isolation and partial
characterization of full length human PDGF-C protein. In
Figure 16A, the recombinant full length protein was
visualized on the blot using antipeptide antibodies against
the N-terminal peptide(described above). In Figure 16B,
the recombinant full length protein was visualized on the
blot using antipeptide antibodies against the internal
peptide (described above). The separated proteins were
visualized by staining with Coomassie Brilliant Blue
(Figure 16C). The numbers at the bottom of Figures 16A-C
refer to the concentration of imidazole used to elute the
protein from the Ni-NTA column and are expressed in
molarity (M). Figures 16A-C also show that the full length
protein migrates as a 90 kDa species under non-reducing
conditions and as a 55 kDa species under reducing
conditions. This indicates that the full length protein
was expressed as a disulfide-linked dimer.
Figures 17A-C show the analysis of the isolation and
partial characterization of a truncated form of human PDGF-
C containing the PDGF/VEGF homology domain only. In Figure
17A, the immunoblot analysis of fractions eluted from the
Ni-agarose column demonstrates that the protein could be
eluted at imidazole concentrations ranging between 100-500
mM. The eluted fractions were analyzed under non-reducing
conditions, and the truncated human PDGF-C was visualized
on the blot using antipeptide antibodies against the
internal peptide (described above). Figure 17B shows the
Coomassie Brilliant Blue staining of the same fractions as
in Figure 17A. This shows that the procedure generates
highly purified material migrating as a 3G kDa species.
Figure 17C shows the Coomassie Brilliant Blue staining of
non-reduced (non-red.) and reduced (red.) truncated human
PDGF-C protein. The data show that the protein is a
-43-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
secreted dimer held together by disulfide bonds and that
the monomer migrates as a 24 kDa species.
Example 4: Receptor bindinc~properties of full lencrth and
truncated PDGF-C
To assess the interactions between full length and
truncated PDGF-C and the VEGF receptors, full length and
truncated PDGF-C were tested for their capacity to bind to
soluble Ig-fusion proteins containing the extracellular
domains of human VEGFR-1, VEGFR-2 and VEGFR-3 (Olofsson et
al., Proc. Natl. Acad. Sci. USA, 1998 95 11709-11714). The
fusion proteins, designated VEGFR-1-Ig, VEGFR-2-Ig and
VEGFR-3-Ig, were transiently expressed in human 293 EBNA
cells. All Ig fusion proteins were human VEGFRs. Cells
were incubated for 24 hours after transfection, washed with
Dulbecco's Modified Eagle Medium (DMEM) containing 0.2~
bovine serum albumin and starved for 24 hours. The fusion
proteins were then precipitated from the clarified
conditioned medium using protein A-Sepharose beads
(Pharmacia). The beads were combined with 100 microliters
of lOX binding buffer (5$ bovine serum albumin, 0.2% Tween
20 and 10 ug/ml heparin) and 900 microliter of conditioned
medium from 293 cells that had been transfected with
mammalian expression plasmids encoding full length or
truncated PDGF-C or control vector, then metabolically
labeled with 35S-cysteine and methionine (Promix, Amersham)
for 4 to 6 hours. After 2.5 hours, at room temperature,
the Sepharose beads were washed 3 times with binding buffer
at 4°C, once with phosphate buffered saline and boiled in
SDS-PAGE buffer. Labeled proteins that were bound to the
Ig-fusion proteins were analyzed by SDS-PAGE under reducing
conditions. Radiolabeled proteins were detected using a
phosphorimager analyzer. In all these analyses,
-49-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
radiolabeled PDGF-C failed to show any interaction with any
of the VEGF receptors.
Next, full length and truncated PDGF-C were tested for
their capacity to bind to human PDGF receptors alpha and
beta by analyzing their abilities to compete with PDGF-BB
for binding to PDGF receptors. The binding experiments
were performed on porcine aortic endothelial-1 (PAE-1)
cells stably expressing the human PDGF receptors alpha and
beta (Eriksson et al., EMBO J, 1992, 11, 543-550). Binding
experiments were performed essentially as in Heldin et al.
(EMBO J, 1988, 7 1387-1393). Different concentrations of
human full-length and truncated PDGF-C, or human PDGF-BB
were mixed with 5 ng/ml of lzsl-pDGF-BB in binding buffer
(PBS containing 1 mg/ml of bovine serum albumin). Aliquots
were incubated with the receptor expressing PAE-1 cells
plated in 24-well culture dishes on ice for 90 minutes.
After three washes with binding buffer, cell-bound l2sI-
PDGF-BB was extracted by lysis of cells in 20 mM Tris-HC1,
pH 7.5, 10~ glycerol, 1~ Triton X-100. The amount of cell
bound radioactivity was determined in a gamma-counter. A
standard curve for the binding of lzSI-labeled PDGF BB
homodimers to PAE-1 cells expressing PDGF alpha-receptor is
shown in Figure 18. An increasing excess of the unlabeled
protein added to the incubations competed efficiently with
cell association of the radiolabeled tracer.
Figure 19 graphically shows that the truncated PDGF-C
efficiently competed for binding to the PDGF alpha-
receptor, while the full length protein did not. Both the
full length and truncated proteins failed to compete for
binding to the PDGF beta-receptor.
Example 5: PDGF alpha-receptor Phosphorylation
To test if PDGF-C causes increased phosphorylation of
-45-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCTNS99/Z2668
the PDGF alpha-receptor, full length and truncated PDGF-C
were tested for their capacity to bind to the PDGF alpha-
receptor and stimulate increased phosphorylation. Serum-
starved porcine aortic endothelial (PAE) cells stably
expressing the human PDGF alpha-receptor were incubated on
ice for 90 minutes with PBS supplemented with 1 mg/ml BSA
and lOng/ml of PDGF-AA, 100ng/ml of full length human PDGF-
CC homodimers (fIPDGF-CC), 100ng/ml of truncated PDGF-CC
homodimers (cPDGF-CC), or a mixture of lOng/ml of PDGF-AA
and 100ng/ml of truncated PDGF-CC. Full length and
truncated PDGF-CC homodimers were produced as described
above. Sixty minutes after the addition of the
polypeptides, the cells were lysed in lysis buffer (20 mM
tris-HC1, pH 7.5, 0.5~ Triton X-100, 0.5~ deoxycholic acid,
10 mM EDTA, 1 mM orthovanadate, 1 mM PMSF 1~ Trasylol).
The PDGF alpha-receptors were immunoprecipitated from
cleared lysates with rabbit antisera against the human PDGF
alpha-receptor (Eriksson et al., EMBO J, 1992 lI 543-550).
The precipitated receptors were applied to a SDS-PAGE gel.
After SDS gel electrophoresis, the precipitated receptors
were transferred to nitrocellulose filters, and the filters
were probed with anti-phosphotyrosine antibody PY-20,
(Transduction Laboratories). The filters were then
incubated with horseradish peroxidase-conjugated anti-mouse
antibodies. Bound antibodies were detected using enhanced
chemiluminescence (ECL, Amersham Inc). The filters were
then stripped and reprobed with the PDGF alpha-receptor
rabbit antisera, and the amount of receptors was determined
by incubation with horseradish peroxidase-conjugated anti-
rabbit antibodies. Bound antibodies were detected using
enhanced chemiluminescence (ECL, Amersham Inc). The
probing of the filters with PDGF alpha-receptor antibodies
confirmed that equal amounts of the receptor were present
-46-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
in all lanes. PDGF-AA is included in the experiment as a
control. Figure 20 shows that truncated, but not full
length PDGF-CC, efficiently induced PDGF alpha-receptor
tyrosine phosphorylation. This indicates that truncated
PDGF-CC is a potent PDGF alpha-receptor agonist.
Example 6: Mitoaenicity of PDGF-C for Fibroblasts
Figure 21 shows the mitogenic activities of truncated
and full length PDGF-CC on fibroblasts. The assay was
performed essentially as described in Mori et al., J. Biol.
Chem., 1991 266 21158-21164. Serum starved human foreskin
fibroblasts were incubated for 24 hours with 1 ml of serum-
free medium supplemented with 1 mg/ml BSA and 3ng/ml,
l0ng/ml or 30ng/ml of full length PDGF-CC (fIPDGF-CC),
truncated PDGF-CC (cPDGF-CC) or PDGF-AA in the presence of
0.2 umCi [3H]thymidine. After trichloroacetic acid (TCA)
precipitation, the incorporation of [3H]thymidine into DNA
was determined using a beta-counter. The results show that
truncated PDGF-CC, but not full length PDGF-CC, is a potent
mitogen for fibroblasts. PDGF-AA is included in the
experiment as a control.
PDGF-C does not bind to any of the known VEGF
receptors. PDGF-C is the only VEGF family member, thus
far, which can bind to and increase phosphorylation of the
PDGF alpha-receptor. PDGF-C is also the only VEGF family
member, thus far, to be a potent mitogen of fibroblasts.
These characteristics indicate that the truncated form of
PDGF-C may not be a VEGF family member, but instead a novel
PDGF. Furthermore, the full length protein is likely to be
a latent growth factor that needs to be activated by
proteolytic processing to release the active PDGF/VEGF
homology domain. A putative proteolytic site is the
-47-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/ZZ668
dibasic motif found in residues 231-234 in the full length
protein, residues -R-K-S-R-. This site is structurally
conserved in a comparison between mouse and human PDGF-Cs
(Figure 7). Preferred proteases include, but are not
limited to, Factor X and enterokinase. The N-terminal CUB
domain may be expressed as an inhibitory domain which might
be used to localize this latent growth factor in some
extracellular compartment (for example the extracellular
matrix) and which is removed by limited proteolysis when
need, for example during embryonic development, tissue
regeneration, tissue remodelling including bone
remodelling, active angiogenesis, tumor progression, tumor
invasion, metastasis formation and/or wound healing.
Example 7: PDGF Receptors Bindincr of Truncated PDGF-C
To assess the interactions between truncated PDGF-C
and the PDGF alpha and beta receptors, truncated PDGF-C was
tested for its capacity to bind to porcine aortic
endothelial-1 (PAE-1) cells expressing PDGF alpha or beta
receptors, respectively (Eriksson et al., EMBO J, 1992, 11
543-550). The binding experiments were performed
essentially as described in Heldin et al. (EMBO J, 1988, 7
1387-1393). Five micrograms of truncated PDGF-C protein in
ten microliters of sodium borate buffer was radiolabeled
using the Bolton-Hunter reagent (Amersham) to a specific
activity of 4 x lOs cpm/ng. Different concentrations of
radiolabeled truncated PDGF-C, with or without added
unlabeled protein, in binding buffer (PBS containing
1 mg/ml of bovine serum albumin) was added to the receptor
expressing PAE-1 cells plated in 24-well culture dishes on
ice for 90 minutes. After three washes with binding
buffer, cell-bound l2sI-labeled PDGF-C was extracted by
lysis of cells in 20 mM Tris-HC1, pH 7.5, 10~ glycerol, 1~
-48-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PGT/IJS99/22668
Triton X-100. The amount of cell-bound radioactivity was
determined in a gamma-counter. Non-specific binding was
estimated by including a 100-fold molar excess of truncated
PDGF-C in some experiments. All binding data represents
the mean of triplicate analyses and the experimental
variation in the experiment varied between 10-155. As seen
in Figure 22, truncated PDGF-C binds to cells expressing
PDGF alpha receptors, but not to beta receptor expressing
cells. The binding was specific as radiolabeled PDGF-C was
quantitatively displaced by a 100-fold molar excess of
unlabeled protein.
Example 8: Protease Effects on Full length PDGF-C
To demonstrate that full length PDGF-C can be
activated by limited proteolysis to release the PDGF/VEGF
homology domain from the CUB domain, the full length
protein was digested with different proteases. For
example, full length PDGF-C was digested with plasmin in 20
mM Tris-HC1 (pH 7.5) containing 1 mM CaCl2, 1 mM MgCl2 and
0.01 Tween 20 for 1.5 to 4.5 hours at 37°C using two to
three units of plasmin (Sigma) per ml. The released domain
essentially corresponded in size to the truncated PDGF-C
species previously produced in insect cells.
Plasmin-digested PDGF-C and undigested full length PDGF-C
were applied to a SDS-PAGE gel under reducing conditions.
After SDS-PAGE gel electrophoresis, the respective proteins
were transferred to a nitrocellulose filter, and the filter
was probed using a rabbit antipeptide antiserum to residues
230-250 in full length protein (residues GRKSRVVDLNLLTEEVR
LYSC (SEQ ID N0:37) located in just N-terminal to the
PDGF/VEGF homology domain). Bound antibodies were detected
using enhanced chemiluminescence (ECL, Amersham Inc).
Figure 23 shows the immunoblot with a 55 kDa undigested
-49-
SUBSTITUTE SHEET (RULE Z6)
CA 02344561 2001-03-29
WO 00/18212 PC'f/US99/2Z668
full length protein and the plasmin-generated 26-28 kDa
species.
Example 9: PDGF alpha ReceQtors Bindinq of Plasmin-diaested
PDGF-CC
To assess the interactions between plasmin-digested
PDGF-C and the PDGF alpha receptors, plasmin-digested PDGF-
C was tested for its capacity to bind to porcine aortic
endothelial-1 (PAE-1) cells expressing PDGF alpha receptors
(Eriksson et al., EMBO J, 1992, 11 543-550). The receptor
binding analyses were performed essentially as in Example 7
using 30 ng/ml of l2sl_labeled truncated PDGF-C as the
tracer. As seen in Figure 24, increasing concentrations of
plasmin-digested PDGF-C efficiently competed for binding to
the PDGF alpha receptors. In contrast, undigested full
length PDGF-C failed to compete for receptor binding.
These data indicate that full length PDGF-C is a latent
growth factor unable to interact with PDGF alpha receptors
and that limited proteolysis, which releases the C-terminal
PDGF/VEGF homology domain, is necessary to generate an
active PDGF alpha receptor ligand/agonist.
Example 10: Cloning and expression of the Human PDGF-C CUB
domain
A human PDGF-C 430 by cDNA fragment encoding the CUB
domain (amino acid residues 23 - 159 in full length PDGF-C)
was amplified by PCR using Deep Vent DNA polymerase
(Biolabs) using standard conditions and procedures. The
forward primer used was 5'cgagatcccgaatccaacctgagtag3' (SEQ
ID N0:38). This primer includes a BamHI site (underlined)
for in clone frame cloning. The reverse primer used was
5'ccg a tcctaatggtgatggtgatgatgtttgtcatcgtcgtcgacaatgttgta
-50-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
gtg3' (SEQ ID N0:39). This primer includes an EcoRI site
(underlined) and sequences coding for a C-terminal 6x His
tag preceded by an enterokinase site. The amplified PCR
fragment was subsequently cloned into a pACgp67A transfer
vector. Verification of the correct sequence of the
expression construct, CUB-pACgp67A, was by automatic
nucleotide sequencing. The expression vectors were then
co-transfected with BaculoGold linearized baculovirus DNA
into Sf9 insect cells according to the manufacture's
protocol (Pharmingen). Recombined baculovirus were
amplified several times before beginning large scale
protein production and protein purification according to
the manual (Pharmingen).
Sf9 cells, adapted to serum free medium, were infected
with recombinant baculovirus at a multiplicity of infection
of about 7. Media containing the recombinant proteins were
harvested 72 hours after infection and were incubated with
Ni-NTA-Agarose beads(Qiagen) overnight at 4°C. The beads
were collected in a column and after extensive washing with
50 mM sodium phosphate buffer pH 8, containing 300 mM NaCl
(the washing buffer), the bound proteins were eluted with
increasing concentrations of imidazole (from 100 mM to 400
mM) in the washing buffer. The eluted proteins were
analyzed by SDS-PAGE using a polyacrylamide gel under
reducing and non-reducing conditions.
Figure 25 shows the results from Coomassie blue
staining of the gel. The human PDGF-C CUB domain is.a
disulfide-linked homodimer with a molecular weight of about
55 KD under non-reducing conditions, while two monomers of
about 25 and 30 KD respectively are present under reducing
conditions. The heterogeneity is probably due to
heterogenous glycosylation of the two putative N-linked
glycosylation sites present in the CUB domain at amino acid
-51-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PC'T/US99/22668
positions 25 and 55. A protein marker lane is shown to the
left in the figure.
Example 11: Localization of PDGF-C transcripts in
developincr mouse embryos
To gain insight into the biological function of PDGF-
C, PDGF-C expression in mouse embryos was localized by non-
radioactive in situ hybridization in tissue sections from
the head (Figures 26A-26S) and urogenital tract (Figures
26T-26V) regions. The non-radioactive in situ
hybridization employed protocols and PDGF-A and PDGFR-alpha
probes are described in Bostrom et al., Cell, 1996 85 863-
873, which is hereby incorporated by reference. The PDGF-C
probe was derived from a mouse PDGF-C cDNA. The
hybridization patterns shown in Figures 26A-26V are for
embryos aged E16.5, but analogous patterns are seen at
E14.5, E15.5 and E17.5. Sense probes were used as controls
and gave no consistent pattern of hybridization to the
sections.
Figure 26A shows the frontal section through the mouth
cavity at the level of the tooth anlagen (t). The arrows
point to sites of PDGF-C expression in the oral ectoderm.
Also shown is the tongue (to). Figures 26B-26D show PDGF-C
expression in epithelial cells of the developing tooth
canal. Individual cells are strongly labeled in this area
(arrow in Figure 26D), as well as in the developing palate
ectoderm (right arrow in Figure 26C). Figure 26E shows the
frontal section through the eye, where PDGF-C expression is
seen in the hair follicles (double arrow) and in the
developing eyelid. Also shown is the retina (r). In
Figures 26F and 26G, the PDGF-C expression is found in the
outer root sheath of the developing hair follicle
-52-
SUBSTITUTE SKEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18Z1Z PCT/US99/2Z668
epithelium. In Figure 26H, PDGF-C expression is shown in
the developing eyelid. There is an occurrence of
individual strongly PDGF-C positive cells in the developing
opening. Also shown is the lens (1). In Figure 26I, PDGF-
C expression in the developing lacrimal gland is shown by
the arrow. In Figure 26J, PDGF-C expression in the
developing external ear is shown. Expression is seen in
the external auditory meatus (left arrow) and in the
epidermal cleft separating the prospective auricle (e).
Figures 26K and 26L show PDGF-C expression in the cochlea.
Expression is seen in the semi-circular canals (arrows in
26K). There is a polarized distribution of PDGF-C mRNA in
epithelial cells adjacent to the developing hair cells
(arrow in 26L). Figures 26M and 26N show PDGF-C expression
in the oral cavity. Horizontal sections show expression in
buccal epithelium (arrows in 26M) and in the forming cleft
between the lower lip buccal and the gingival epithelium
(arrows in 26N). Also shown is the tooth anlagen (t) and
the tongue (to). Figures 260 and 26P show PDGF-C
expression in the developing nostrils, shown on horizontal
sections. PDGF-C expression appears strongest before
stratification of the epithelium and the formation of the
canal proper (arrows in 260 and 26P). Also shown is the
developing nostrils (n). Figures 26Q-26S show PDGF-C
expression in developing salivary glands and ducts. Figure
26Q is the sublingual gland. Figures 26R and 26S show the
maxillary glands, the salivary gland (sg) and the salivary
duct (sd). Figures 26T-26V show the expression of PDGF-C
in the urogenital tract. Figure 26T shows the expression
of PDGF-C in the developing kidney metanephric mesoderm.
Figure 26U shows the expression of PDGF-C in the urethra
(ua) and in epithelium surrounding the developing penis.
-53-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Figure 26V shows the PDGF-C expression in the developing
ureter (u).
Example 12: PDGF-C, PDGF-A and PDGFR-alpha Expression in
the Developina Kidney
One of the strongest sites of PDGF-C expression is the
developing kidney and so expression of PDGF-C, PDGF-A and
PDGFR-alpha was looked at in the developing kidney.
Figures 27A-27F show the results of non-radioactive in situ
hybridization demonstrating the expression (blue staining
in unstained background visualized using DIC optics) of
mRNA for PDGF-C (Figures 27A and 27B), PDGF-A (Figures 27C
and 27D) and PDGFR-alpha (Figures 27E and 27F) in E16.5
kidneys. The white hatched line in Figures 27B, 27D and
27F outlines the cortex border. The bar in Figures 27A,
27C and 27E represents 250 um, and in Figures 27B, 27D and
27F represents 50 um.
PDGF-C expression is seen in the metanephric
mesenchyme (mm in Figure 27A), and appears to be
upregulated in the condensed mesenchyme (arrows in Figure
27B) undergoing epithelial conversion as a prelude to
tubular development, which is situated on each side of the
ureter bud (ub). PDGF-C expression remains at lower levels
in the early nephronal epithelial aggregates (arrowheads in
B), but is absent from mature glomeruli (gl) and tubular
structures.
PDGF-A expression is not seen in these early
aggregates, but is strong in later stages of tubular
development (Figures 24C and 24D). PDGF-A is expressed in
early nephronal epithelial aggregates (arrowheads in Figure
27D), but once the nephron is developed further, PDGF-A
expression becomes restricted to the developing Henle's
loop (arrow in Figure 27D). The strongest expression is
-54-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
seen in the Henle's loops in the developing marrow (arrows
in Figure 27C). The branching ureter (u) and the ureter
bud (ub) is negative for PDGF-A.
Thus, the PDGF-C and PDGF-A expression patterns in the
developing nephron are spatially and temporally distinct.
PDGF-C is expressed in the earliest stages (mesenchymal
aggregates) and PDGF-A in the latest stages (Henle's loop
formation) of nephron development.
PDGFR-alpha is expressed throughout the mesenchyme of
the developing kidney (Figures ~27E and 27F) and may hence
be targeted by both PDGF-C and PDGF-A. PDGF-B expression
is also seen in the developing kidney, but occurs only in
vascular endothelial cells. PDGFR-beta expression takes
place in perivascular mesenchyme, and its activation by
PDGF-B is critical for mesangial cell recruitment into
glomeruli.
These results demonstrate that PDGF-C expression
occurs in close spatial relationship to sites of PDGFR-
alpha expression, and are distinct from the expression
sites of PDGF-A or PDGF-B. This indicates that PDGF-C may
act through PDGFR-alpha in vivo, and may have functions
that are not shared with PDGF-A and PDGF-B.
Since the unique expression pattern of PDGF-C in the
developing kidney indicates a function as a PDGFR-alpha
agonist separate from that of PDGF-A or -B, a comparison
was made to the histology of embryonic day 16.5 kidneys
from PDGFR-alpha knockout mice (Figures 28B and 28F) with
kidneys from wildtype (Figures 28A and 28C), PDGF-A
knockout (Figure 28D) and PDGF-A/PDGF-B double knockout
(Figure 28E) mice. The bar in Figures 28A and 28B
represents 250 mm, and in Figures 28C-28F represents 50 pm.
Heterozygote mutants of PDGF-A, PDGF-B and PDGFR-alpha
(Bostrom et al., Cell, 1996 85 863-873; Lev~en et al.,
-55-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18211 PCT/US99/12668
Genes Dev., 1994 8 1875-1887; Soriano et al., Development,
1997 124 2691-70) were bred as C57B16/129sv hybrids and
intercrossed to produce homozygous mutant embryos. PDGF-
A/PDGF-B heterozygote mutants were crossed to generate
double PDGF-A/PDGF-B knockout embryos. Due to a high
degree of lethality of PDGF-A -/- embryos before E10
(Bostrom et al., Cell, 1996 85 863-873), the proportion of
double knockout E16.5 embryos obtained in such crosses were
less than 1/40. The histology of kidney phenotypes was
verified on at least two embryos of each genotype, except
the PDGF-A/PDGF-B double knockout for which only a single
embryo was obtained.
It is interesting that there is lack of interstitial
mesenchyme in the cortex of PDGFR-alpha -/- kidney (arrows
in Figure 28A and asterisk in Figure 28F) and the presence
of interstitial mesenchyme in all other genotypes
(asterisks in Figure 28C-E). The branching ureter (u) and
the metanephric mesenchyme (mm) and its epithelial
derivatives appear normal in all mutants. The abnormal
glomerulus in the PDGF-A/PDGF-B double knockout reflect
failure of mesangial cell recruitment into the glomerular
tuft due to the absence of PDGF-B.
These results indicate that PDGFR-alpha knockouts have
a kidney phenotype, which is not seen in PDGF-A or PDGF-
A/PDGF-B knockouts, hence potentially reflecting loss of
signaling by PDGF-C. The phenotype consists of the marked
loss of interstitial mesenchyme in the developing kidney
cortex. The cells lost in PDGFR-alpha -/- kidneys are thus
normally PDGFR-alpha positive cells adjacent to the site of
expression of PDGF-C.
BIOASSAYS TO DETERMINE THE FUNCTION OF PDGF-C
Assays are conducted to evaluate whether PDGF-C has
-56-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
similar activities to PDGF-A, PDGF-B, VEGF, VEGF-B, VEGF-C
and/or VEGF-D in relation to growth and/or motility of
connective tissue cells, fibroblasts, myofibroblasts and
glial cells; to endothelial cell function; to angiogenesis;
and to wound healing. Further assays may also be
performed, depending on the results of receptor binding
distribution studies.
I. Mitogenicity of PDGF-C for Endothelial Cells
To test the mitogenic capacity of PDGF-C for
endothelial cells, the PDGF-C polypeptide is introduced
into cell culture medium containing 5~ serum and applied to
bovine aortic endothelial cells (BAEs) propagated in medium
containing 10~s serum. The BAEs are previously seeded in
24-well dishes at a density of 10,000 cells per well the
day before addition of the PDGF-C. Three days after
addition of this polypeptide the cells were dissociated
with trypsin and counted. Purified VEGF is included in the
experiment as positive control.
II. Assays of Endothelial Cell Function
a) Endothelial cell proliferation
Endothelial cell growth assays are performed by
methods well known in the art, e.g. those of Ferrara &
Henzel, Nature, 1989 380 439-443, Gospodarowicz et al.,
Proc. Natl. Acad. Sci. USA, 1989 86 7311-7315, and/or
Claffey et al., Biochem. Biophys. Acta, 1995 1296 1-9.
b) Cell adhesion assay
The effect of PDGF-C on adhesion of polymorphonuclear
granulocytes to endothelial cells is tested.
-57-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PGT/US99/Z2668
c) Chemotaxis
The standard Boyden chamber chemotaxis assay is used
to test the effect of PDGF-C on chemotaxis.
d) Plasminogen activator assay
Endothelial cells are tested for the effect of PDGF-C
on plasminogen activator and plasminogen activator
inhibitor production, using the method of Pepper et al.,
Biochem. Biophys. Res. Commun., 1991 181 902-906.
e) Endothelial cell Migration assay
The ability of PDGF-C to stimulate endothelial cells
to migrate and form tubes is assayed as described in
Montesano et al., Proc. Natl. Acad. Sci. USA, 1986 83 7297-
7301. Alternatively, the three-dimensional collagen gel
assay described in Joukov et al., EMBO J., 1996 15 290-298
or a gelatinized membrane in a modified Boyden chamber
(Glaser et al., Nature, 1980 2~ 483-484) may be used.
III. Angiogenesis Assay
The ability of PDGF-C to induce an angiogenic response
in chick chorioallantoic membrane is tested as described in
Leung et al., Science, 1989 24~ 1306-1309. Alternatively
the rat cornea assay of Rastinejad et al., Cell, 1989 56
345-355 may be used; this is an accepted method for assay
of in vivo angiogenesis, and the results are readily
transferrable to other in vivo systems.
IV. Wound 8~aling
The ability of PDGF-C to stimulate wound healing is
tested in the most clinically relevant model available, as
-58-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
described in Schilling et al., Surgery, 1959 46 702-710 and
utilized by Hunt et al., Surgery, 1967 114 302-307.
V. Th~ 8aemopoietic System
A variety of in vitro and in vivo assays using
specific cell populations of the haemopoietic system are
known in the art, and are outlined below. In particular a
variety of in vitro murine stem cell assays using
fluorescence-activated cell sorter to purified cells are
IO particularly convenient:
a) Repopulating Stem Cells
These are cells capable of repopulating the bone
marrow of lethally irradiated mice, and have the Lin-, Rhhl,
Ly-6A/E+, c-kit+ phenotype. PDGF-C is tested on these cells
either alone, or by co-incubation with other factors,
followed by measurement of cellular proliferation by 3H-
thymidine incorporation.
b) Late Stage Stem Cells
These are cells that have comparatively little bone
marrow repopulating ability, but can generate D13 CFU-S.
These cells have the Lin-, Rhhl, Ly-6A/E+, c-kit+ phenotype.
PDGF-C is incubated with these cells for a period of time,
injected into lethally irradiated recipients, and the
number of D13 spleen colonies enumerated.
c) Progenitor-Enriched Cells
These are cells that respond in vitro to single growth
factors and have the Lin-, Rhhl, Ly-6A/E+, c-kit+ phenotype.
This assay will show if PDGF-C can act directly on
haemopoietic progenitor cells. PDGF-C is incubated with
-59-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18Z1Z PC1'/US99/22b68
these cells in agar cultures, and the number of colonies
present after 7-14 days is counted.
VI. Atherosclerosis
Smooth muscle cells play a crucial role in the
development or initiation of atherosclerosis, requiring a
change of their phenotype from a contractile to a synthetic
state. Macrophages, endothelial cells, T lymphocytes and
platelets all play a role in the development of
atherosclerotic plaques by influencing the growth and
phenotypic modulations of smooth muscle cell. An in vitro
assay using a modified Rose chamber in which different cell
types are seeded on to opposite cover slips measures the
proliferative rate and phenotypic modulations of smooth
muscle cells in a multicellular environment, and is used to
assess the effect of PDGF-C on smooth muscle cells.
VII. Metastasis
The ability of PDGF-C to inhibit metastasis is assayed
using the Lewis lung carcinoma model, for example using the
method of Cao et al., J. Exp. Med., 1995 182 2069-2077.
VIII. Migration of Smooth Muscle Cells
The effects of the PDGF-C on the migration of smooth
muscle cells and other cells types can be assayed using the
method of Koyama et al., J. Biol. Chem., 1992 267 22806-
22812.
I7C. Chemotaxis
The effects of the PDGF-C on chemotaxis of fibroblast,
monocytes, granulocytes and other cells can be assayed
-60-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
using the method of Siegbahn et al., J. Clin. Invest., 1990
85 916-920.
X. PDGF-C is Other Cell Types
The effects of PDGF-C on proliferation,
differentiation and function of other cell types, such as
liver cells, cardiac muscle and other cells, endocrine
cells and osteoblasts can readily be assayed by methods
known in the art, such as 3H-thymidine uptake by in vitro
cultures. Expression of PDGF-C in these and other tissues
can be measured by techniques such as Northern blotting and
hybridization or by in situ hybridization.
XI. Coastructiori of PDGF-C Variants and Analogues
PDGF-C is a member of the PDGF family of growth
factors which exhibits a high degree of homology to the
other members of the PDGF family. PDGF-C contains eight
conserved cysteine residues which are characteristic of
this family of growth factors. These conserved cysteine
residues form intra-chain disulfide bonds which produce the
cysteine knot structure, and inter-chain disulfide bonds
that form the protein dimers which are characteristic of
members of the PDGF family of growth factors. PDGF-C
interacts with a protein tyrosine kinase growth factor
receptor.
In contrast to proteins where little or nothing is
known about the protein structure and active sites needed
for receptor binding and consequent activity, the design of
active mutants of PDGF-C is greatly facilitated by the fact
that a great deal is known about the active sites and
important amino acids of the members of the PDGF family of
growth factors.
-61-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99I22668
Published articles elucidating the structure/activity
relationships of members of the PDGF family of growth
factors include for PDGF: Oestman et al., J. Biol. Chem.,
1991 266 10073-1007?; Andersson et al., J. Biol. Chem.,
1992 267 11260-1266: Oefner et al., EMBO J., 1992 11 3921-
3926; Flemming et al., Molecular and Cell Biol., 1993 13
4066-4076 and Andersson et al., Growth Factors, 1995 12
159-164; and for VEGF: Kim et al., Growth Factors, 1992 7
53-64; Potgens et al., J. Biol. Chem., 1994 269 32879-32885
and Claffey et al., Biochem. Biophys. Acta, 1995 1246 1-9.
From these publications it is apparent that because of the
eight conserved cysteine residues, the members of the PDGF
family of growth factors exhibit a characteristic knotted
folding structure and dimerization, which result in
formation of three exposed loop regions at each end of the
dimerized molecule, at which the active receptor binding
sites can be expected to be located.
Based on this information, a person skilled in the
biotechnology arts can design PDGF-C mutants with a very
high probability of retaining PDGF-C activity by conserving
the eight cysteine residues responsible for the knotted
folding arrangement and for dimerization, and also by
conserving, or making only conservative amino acid
substitutions in the likely receptor sequences in the
loop 1, loop 2 and loop 3 region of the protein structure.
The formation of desired mutations at specifically
targeted sites in a protein structure is considered to be a
standard technique in the arsenal of the protein chemist
(Kunkel et al., Methods in Enzymol., 1987 154 367-382).
Examples of such site-directed mutagenesis with VEGF can be
found in Potgens et al., J. Biol. Chem., 1994 269 32879-
32885 and Claffey et al., Biochem. Biophys. Acta, 1995 1246
-62-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/Z2668
1-9. Indeed, site-directed mutagenesis is so common that
kits are commercially available to facilitate such
procedures (e. g. Promega 1994-1995 Catalog., Pages 142-
145) .
The connective tissue cell, fibroblast, myofibroblast
and glial cell growth and/or motility activity, the
endothelial cell proliferation activity, the angiogenesis
activity and/or the wound healing activity of PDGF-C
mutants can be readily confirmed by well established
screening procedures. For example, a procedure analogous
to the endothelial cell mitotic assay described by Claffey
et al., (Biochem. Biophys. Acta., 1995 1246 1-9) can be
used. Similarly the effects of PDGF-C on proliferation of
other cell types, on cellular differentiation and on human
metastasis can be tested using methods which are well known
in the art.
The foregoing description and examples have been set
forth merely to illustrate the invention and are not
intended to be limiting. Since modifications of the
disclosed embodiments incorporating the spirit and
substance of the invention may occur to persons skilled in
the art, the invention should be construed broadly to
include all variations falling within the scope of the
appended claims and equivalents thereof.
-63-
SUBSTITUTE SHEET (RULE 26)
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
SEQUENCE LISTING
<110> ERIKSSON, Ulf
AASE, Karin
LEE, Xuri
PONTEN, Annica
UUTELA, Marko
ALITALO, Kari
OESTMAN, Arne
HELDIN, Carl-Henrik
BETSHOLTZ, Christer
<120> PLATELET-DERIVED GROWTH FACTOR C, DNA CODING
THEREFOR, AND USES THEREOF
<130> Sequence Listing
<140> 60/102,961
<141> 1998-09-30
<150> 60/108,109
<151> 1998-11-12
<150> 60/110,749
<151> 1998-12-03
<150> 60/113,002
<151> 1998-12-18
<150> 60/135,426
<151> 1999-05-21
<150> 60/144,022
<151> 1999-07-15
<160> 39
<170> PatentIn Ver. 2.0
<210> 1
<211> 16
<212> PRT
<213> Homo sapiens
<400> 1
Pro Xaa Cys Leu Leu Val Xaa Arg Cys Gly Gly Xaa Cys Xaa Cys Cys
1 5 10 15
1
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
<210> 2
<211> 2108
<212> DNA
<213> Homo sapiens
<400> 2
ccccgccgtg agtgagctct caccccagtc agccaaatga gcctcttcgg gcttctcctg 60
gtgacatctg ccctggccgg ccagagacga gggactcagg cggaatccaa cctgagtagt 120
aaattccagt tttccagcaa caaggaacag aacggagtac aagatcctca gcatgagaga 180
attattactg tgtctactaa tggaagtatt cacagcccaa ggtttcctca tacttatcca 240
agaaatacgg tcttggtatg gagattagta gcagtagagg aaaatgtatg gatacaactt 300
acgtttgatg aaagatttgg gcttgaagac ccagaagatg acatatgcaa gtatgatttt 360
gtagaagttg aggaacccag tgatggaact atattagggc gctggtgtgg ttctggtact 420
gtaccaggaa aacagatttc taaaggaaat caaattagga taagatttgt atctgatgaa 480
tattttcctt ctgaaccagg gttctgcatc cactacaaca ttgtcatgcc acaattcaca 540
gaagctgtga gtccttcagt gctaccccct tcagctttgc cactggacct gcttaataat 600
gctataactg cctttagtac cttggaagac cttattcgat atcttgaacc agagagatgg 660
cagttggact tagaagatct atataggcca acttggcaac ttcttggcaa ggcttttgtt 720
tttggaagaa aatccagagt ggtggatctg aaccttctaa cagaggaggt aagattatac 780
agctgcacac ctcgtaactt ctcagtgtcc ataagggaag aactaaagag aaccgatacc 840
attttctggc caggttgtct cctggttaaa cgctgtggtg ggaactgtgc ctgttgtctc 900
cacaattgca atgaatgtca atgtgtccca agcaaagtta ctaaaaaata ccacgaggtc 960
cttcagttga gaccaaagac cggtgtcagg ggattgcaca aatcactcac cgacgtggcc 1020
ctggagcacc atgaggagtg tgactgtgtg tgcagaggga gcacaggagg atagccgcat 1080
caccaccagc agctcttgcc cagagctgtg cagtgcagtg gctgattcta ttagagaacg 1140
tatgcgttat ctccatcctt aatctcagtt gtttgcttca aggacctttc atcttcagga 1200
tttacagtgc attctgaaag aggagacatc aaacagaatt aggagttgtg caacagctct 1260
tttgagagga ggcctaaagg acaggagaaa aggtcttcaa tcgtggaaag aaaattaaat 1320
gttgtattaa atagatcacc agctagtttc agagttacca tgtacgtatt ccactagctg 1380
ggttctgtat ttcagttctt tcgatacggc ttagggtaat gtcagtacag gaaaaaaact 1940
gtgcaagtga gcacctgatt ccgttgcctt gcttaactct aaagctccat gtcctgggcc 1500
taaaatcgta taaaatctgg attttttttt ttttttttgc tcatattcac atatgtaaac 1560
cagaacattc tatgtactac aaacctggtt tttaaaaagg aactatgttg ctatgaatta 1620
aacttgtgtc rtgctgatag gacagactgg atttttcata tttcttatta aaatttctgc 1680
catttagaag aagagaacta cattcatggt ttggaagaga taaacctgaa aagaagagtg 1740
gccttatctt cactttatcg ataagtcagt ttatttgttt cattgtgtac atttttatat 1800
tctccttttg acattataac tgttggcttt tctaatcttg ttaaatatat ctatttttac 1860
caaaggtatt taatattctt ttttatgaca acttagatca actattttta gcttggtaaa 1920
tttttctaaa cacaattgtt atagccagag gaacaaagat ggatataaaa atattgttgc 1980
cctggacaaa aatacatgta tntccatccc ggaatggtgc tagagttgga ttaaacctgc 2040
attttaaaaa acctgaattg ggaanggaan ttggtaaggt tggccaaanc ttttttgaaa 2100
ataattaa 2108
<210> 3
<211> 345
<212> PRT
<213> Homo Sapiens
2
CA 02344561 2001-03-29
WO 00/18212 PCTNS99/22668
<400> 3
Met Ser Leu Phe Gly Leu Leu Leu Val Thr Ser Ala Leu Ala Gly Gln
1 5 10 15
Arg Arg Gly Thr Gln Ala Glu Ser Asn Leu Ser Ser Lys Phe Gln Phe
20 25 30
Ser Ser Asn Lys Glu Gln Asn Gly Val Gln Asp Pro Gln His Glu Arg
35 40 95
Ile Ile Thr Val Ser Thr Asn Gly Ser Ile His Ser Pro Arg Phe Pro
50 55 60
His Thr Tyr Pro Arg Asn Thr Val Leu Val Trp Arg Leu Val Ala Val
65 70 75 80
Glu Glu Asn Val Trp Ile Gln Leu Thr Phe Asp Glu Arg Phe Gly Leu
85 90 95
Glu Asp Pro Glu Asp Asp Ile Cys Lys Tyr Asp Phe Val Glu Val Glu
100 105 110
Glu Pro Ser Asp Gly Thr Ile Leu Gly Arg Trp Cys Gly Ser Gly Thr
115 120 125
Val Pro Gly Lys Gln Ile Ser Lys Gly Asn Gln Ile Arg Ile Arg Phe
130 135 140
Val Ser Asp Glu Tyr Phe Pro Ser Glu Pro Gly Phe Cys Ile His Tyr
145 150 155 160
Asn Ile Val Met Pro Gln Phe Thr Glu Ala Val Ser Pro Ser Val Leu
165 170 175
Pro Pro Ser Ala Leu Pro Leu Asp Leu Leu Asn Asn Ala Ile Thr Ala
180 185 190
Phe Ser Thr Leu Glu Asp Leu Ile Arg Tyr Leu Glu Pro Glu Arg Trp
195 200 205
Gln Leu Asp Leu Glu Asp Leu Tyr Arg Pro Thr Trp Gln Leu Leu Gly
210 215 220
Lys Ala Phe Val Phe Gly Arg Lys Ser Arg Val Val Asp Leu Asn Leu
225 230 235 240
Leu Thr Glu Glu Val Arg Leu Tyr Ser Cys Thr Pro Arg Asn Phe Ser
3
CA 02344561 2001-03-29
WO 00/18212 PCTNS99J22668
295 250 255
Val Ser Ile Arg Glu Glu Leu Lys Arg Thr Asp Thr Ile Phe Trp Pro
260 265 270
Gly Cys Leu Leu Val Lys Arg Cys Gly Gly Asn Cys Ala Cys Cys Leu
275 280 285
His Asn Cys Asn Glu Cys Gln Cys Val Pro Ser Lys Val Thr Lys Lys
290 295 300
Tyr His Glu Val Leu Gln Leu Arg Pro Lys Thr Gly Val Arg Gly Leu
305 310 315 320
His Lys Ser Leu Thr Asp Val Ala Leu Glu His His Glu Glu Cys Asp
325 330 335
Cys Val Cys Arg Gly Ser Thr Gly Gly
340 345
<210> 4
<211> 1536
<212> DNA
<213> Homo Sapiens
<400> 4
cgggtaaatt ccagttttcc agcaacaagg aacagaacgg agtacaagat cctcagcatg 60
agagaattat tactgtgtct actaatggaa gtattcacag cccaaggttt cctcatactt 120
atccaagaaa tacggtcttg gtatggagat tagtagcagt agaggaaaat gtatggatac 180
aacttacgtt tgatgaaaga tttgggcttg aagacccaga agatgacata tgcaagtatg 290
attttgtaga agttgaggaa cccagtgatg gaactatatt agggcgctgg tgtggttctg 300
gtactgtacc aggaaaacag atttctaaag gaaatcaaat taggataaga tttgtatctg 360
atgaatattt tccttctgaa ccagggttct gcatccacta caacattgtc atgccacaat 920
tcacagaagc tgtgagtcct tcagtgctac ccccttcagc tttgccactg gacctgctta 980
ataatgctat aactgccttt agtaccttgg aagaccttat tcgatatctt gaaccagaga 540
gatggcagtt ggacttagaa gatctatata ggccaacttg gcaacttctt ggcaaggctt 600
ttgtttttgg aagaaaatcc agagtggtgg atctgaacct tctaacagag gaggtaagat 660
tatacagctg cacacctcgt aacttctcag tgtccataag ggaagaacta aagagaaccg 720
ataccatttt ctggccaggt tgtctcctgg ttaaacgctg tggtgggaac tgtgcctgtt 780
gtctccacaa ttgcaatgaa tgtcaatgtg tcccaagcaa agttactaaa aaataccacg 840
aggtccttca gttgagacca aasaccggtg tcaggggatt gcacaaatca ctcaccgacg 900
tggccctgga gcaccatgag gagtgtgact gtgtgtgcag agggagcaca ggaggatagc 960
cgcatcacca ccagcagctc ttgcccagag ctgtgcagtg cagtggctga ttctattaga 1020
gaacgtatgc gttatctcca tccttaatct cagttgtttg cttcaaggac ctttcatctt 1080
caggatttac agtgcattct gaaagaggag acatcaaaca gaattaggag ttgtgcaaca 1140
gctcttttga gaggaggcct aaaggacagg agaaaaggtc ttcaatcgtg gaaagaaaat 1200
taaatgttgt attaaataga tcaccagcta gtttcagagt taccatgtac gtattccact 1260
4
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
agctgggttc tgtatttcag ttctttcgat acggcttagg gtaatgtcag tacaggaaaa 1320
aaactgtgca agtgagcacc tgattccgtt gccttgctta actctaaagc tccatgtcct 1380
gggcctaaaa tcgtataaaa tctggatttt tttttttttt tttgctcata ttcacatatg 1440
taaaccagaa cattctatgt actacaaacc tggtttttaa aaaggaacta tgttgctatg 1500
aattaaactt gtgtcatgct gataggacag actgga 1536
<210> 5
<211> 318
<212> PRT
<213> Homo Sapiens
<400> 5
Gly Lys Phe Gln Phe Ser Ser Asn Lys Glu Gln Asn Gly Val Gln Asp
1 5 10 15
Pro Gln His Glu Arg Ile Ile Thr Val Ser Thr Asn Gly Ser Ile His
20 25 30
Ser Pro Arg Phe Pro His Thr Tyr Pro Arg Asn Thr Val Leu Val Trp
35 40 45
Arg Leu Val Ala Val Glu Glu Asn Val Trp Ile Gln Leu Thr Phe Asp
50 55 60
Glu Arg Phe Gly Leu Glu Asp Pro Glu Asp Asp Ile Cys Lys Tyr Asp
65 70 75 80
Phe Val Glu Val Glu Glu Pro Ser Asp Gly Thr Ile Leu Gly Arg Trp
85 90 95
Cys Gly Ser Gly Thr Val Pro Gly Lys Gln Ile Ser Lys Gly Asn Gln
100 105 110
Ile Arg Ile Arg Phe Val Ser Asp Glu Tyr Phe Pro Ser Glu Pro Gly
115 120 125
Phe Cys Ile His Tyr Asn Ile Val Met Pro Gln Phe Thr Glu Ala Val
130 135 190
Ser Pro Ser Val Leu Pro Pro Ser Ala Leu Pro Leu Asp Leu Leu Asn
145 150 155 160
Asn Ala Ile Thr Ala Phe Ser Thr Leu Glu Asp Leu Ile Arg Tyr Leu
165 170 175
Glu Pro Glu Arg Trp Gln Leu Asp Leu Glu Asp Leu Tyr Arg Pro Thr
180 1B5 190
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Trp Gln Leu Leu Gly Lys Ala Phe Val Phe Gly Arg Lys Ser Arg Val
195 200 205
Val Asp Leu Asn Leu Leu Thr Glu Glu Val Arg Leu Tyr Ser Cys Thr
210 215 220
Pro Arg Asn Phe Ser Val Ser Ile Arg Glu Glu Leu Lys Arg Thr Asp
225 230 235 240
Thr Ile Phe Trp Pro Gly Cys Leu Leu Val Lys Arg Cys Gly Gly Asn
245 250 255
Cys Ala Cys Cys Leu His Asn Cys Asn Glu Cys Gln Cys Val Pro Ser
260 265 270
Lys Val Thr Lys Lys Tyr His Glu Val Leu Gln Leu Arg Pro Lys Thr
275 280 285
Gly Val Arg Gly Leu His Lys Ser Leu Thr Asp Val Ala Leu Glu His
290 295 300
His Glu Glu Cys Asp Cys Val Cys Arg Gly Ser Thr Gly Gly
305 310 315
<210> 6
<211> 1474
<212> DNA
<213> Murinae gen. sp.
<400> 6
cacctggaga cacagaagag ggctctagga aaaattttgg atggggatta tgtggaaact 60
accctgcgat tctctgctgc cagagccggc caggcgcttc caccgcagcg cagcctttcc 120
ccgggctggg ctgagccttg gagtcgtcgc ttccccagtg cccgccgcga gtgagccctc 180
gccccagtca gccaaatgct cctcctcggc ctcctcctgc tgacatctgc cctggccggc 240
caaagaacgg ggactcgggc tgagtccaac ctgagcagca agttgcagct ctccagcgac 300
aaggaacaga acggagtgca agatccccgg catgagagag ttgtcactat atctggtaat 360
gggagcatcc acagcccgaa gtttcctcat acgtacccaa gaaatatggt gctggtgtgg 420
agattagttg cagtagatga aaatgtgcgg atccagctga catttgatga gagatttggg 480
ctggaagatc cagaagacga tatatgcaag tatgattttg tagaagttga ggagcccagt 540
gatggaagtg ttttaggacg ctggtgtggt tctgggactg tgccaggaaa gcagacttct 600
aaaggaaatc atatcaggat aagatttgta tctgatgagt attttccatc tgaacccgga 660
ttctgcatcc actacagtat tatcatgcca caagtcacag aaaccacgag tccttcggtg 720
ttgccccctt catctttgtc attggacctg ctcaacaatg ctgtgactgc cttcagtacc 780
ttggaagagc tgattcggta cctagagcca gatcgatggc aggtggactt ggacagcctc 840
tacaagccaa catggcagct tttgggcaag gctttcctgt atgggaaaaa aagcaaagtg 900
gtgaatctga atctcctcaa ggaagaggta aaactctaca gctgcacacc ccggaacttc 960
tcagtgtcca tacgggaaga gctaaagagg acagatacca tattctggcc aggttgtctc 1020
6
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
ctggtcaagc gctgtggagg aaattgtgcc tgttgtctcc ataattgcaa tgaatgtcag 1080
tgtgtcccac gtaaagttac aaaaaagtac catgaggtcc ttcagttgag accaaaaact 1140
ggagtcaagg gattgcataa gtcactcact gatgtggctc tggaacacca cgaggaatgt 1200
gactgtgtgt gtagaggaaa cgcaggaggg taactgcagc cttcgtagca gcacacgtga 1260
gcactggcat tctgtgtacc cccacaagca accttcatcc ccaccagcgt tggccgcagg 1320
gctctcagct gctgatgctg gctatggtaa agatcttact cgtctccaac caaattctca 1380
gttgtttgct tcaatagcct tcccctgcag gacttcaagt gtcttctaaa agaccagagg 1440
caccaanagg agtcaatcac aaagcactgc accg 1474
<210> 7
<211> 345
<212> PRT
<213> Murinae gen. sp.
<400> 7
Met Leu Leu Leu Gly Leu Leu Leu Leu Thr Ser Ala Leu Ala Gly Gln
1 5 10 15
Arg Thr Gly Thr Arg Ala Glu Ser Asn Leu Ser Ser Lys Leu Gln Leu
20 25 30
Ser Ser Asp Lys Glu Gln Asn Gly Val Gln Asp Pro Arg His Glu Arg
35 40 95
Val Val Thr Ile Ser Gly Asn Gly Ser Ile His Ser Pro Lys Phe Pro
50 55 60
His Thr Tyr Pro Arg Asn Met Val Leu Val Trp Arg Leu Val Ala Val
65 70 75 80
Asp Glu Asn Val Arg Ile Gln Leu Thr Phe Asp Glu Arg Phe Gly Leu
85 90 95
Glu Asp Pro Glu Asp Asp Ile Cys Lys Tyr Asp Phe Val Glu Val Glu
100 105 110
Glu Pro Ser Asp Gly Ser Val Leu Gly Arg Trp Cys Gly Ser Gly Thr
115 120 125
Val Pro Gly Lys Gln Thr Ser Lys Gly Asn His Ile Arg Ile Arg Phe
130 135 140
Val Ser Asp Glu Tyr Phe Pro Ser Glu Pro Gly Phe Cys Ile His Tyr
145 150 155 160
Ser Ile Ile Met Pro Gln Val Thr Glu Thr Thr Ser Pro Ser Val Leu
165 170 175
7
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Pro Pro Ser Ser Leu Ser Leu Asp Leu Leu Asn Asn Ala Val Thr Ala
180 185 190
Phe Ser Thr Leu Glu Glu Leu Ile Arg Tyr Leu Glu Pro Asp Arg Trp
195 200 205
Gln Val Asp Leu Asp Ser Leu Tyr Lys Pro Thr Trp Gln Leu Leu Gly
210 215 220
Lys Ala Phe Leu Tyr Gly Lys Lys Ser Lys Val Val Asn Leu Asn Leu
225 230 235 240
Leu Lys Glu Glu Val Lys Leu Tyr Ser Cys Thr Pro Arg Asn Phe Ser
295 250 255
Val Ser Ile Arg Glu Glu Leu Lys Arg Thr Asp Thr Ile Phe Trp Pro
260 265 270
Gly Cys Leu Leu Val Lys Arg Cys Gly Gly Asn Cys Ala Cys Cys Leu
275 280 285
His Asn Cys Asn Glu Cys Gln Cys Val Pro Arg Lys Val Thr Lys Lys
290 295 300
Tyr His Glu Val Leu Gln Leu Arg Pro Lys Thr Gly Val Lys Gly Leu
305 310 315 320
His Lys Ser Leu Thr Asp Val Ala Leu Glu His His Glu Glu Cys Asp
325 330 335
Cys Val Cys Arg Gly Asn Ala Gly Gly
340 395
<210> 8
<211> 192
<212> PRT
<213> Homo sapiens
<400> 8
Met Asn Phe Leu Leu Ser Trp Val His Trp Ser Leu Ala Leu Leu Leu
1 5 10 15
Tyr Leu His His Ala Lys Trp Ser Gln Ala Ala Pro Met Ala Glu Gly
20 25 30
Gly Gly Gln Asn His His Glu Val Val Lys Phe Met Asp Val Tyr Gln
35 40 95
8
CA 02344561 2001-03-29
WO 00/18212 PCT1US99/22668
Arg Ser Tyr Cys His Pro Ile Glu Thr Leu Val Asp Ile Phe Gln Glu
50 55 60
Tyr Pro Asp Glu Ile Glu Tyr Ile Phe Lys Pro Ser Cys Val Pro Leu
65 70 75 80
Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Gly Leu Glu Cys Val Pro
85 90 95
Thr Glu Glu Ser Asn Ile Thr Met Gln Ile Met Arg Ile Lys Pro His
100 105 110
Gln Gly Gln His Ile Gly Glu Met Ser Phe Leu Gln His Asn Lys Cys
115 120 125
Glu Cys Arg Pro Lys Lys Asp Arg Ala Arg Gln Glu Asn Pro Cys Gly
130 135 140
Pro Cys Ser Ser Glu Arg Arg Lys His Leu Phe Val Gln Asp Pro Gln
145 150 155 160
Thr Cys Lys Cys Ser Cys Lys Asn Thr Asp Ser Arg Cys Lys Ala Arg
165 170 175
Gln Leu Glu Leu Asn Glu Arg Thr Cys Arg Cys Asp Lys Pro Arg Arg
180 185 190
<210> 9
<211> 170
<212> PRT
<213> Homo Sapiens
<900> 9
Met Pro Val Met Arg Leu Phe Pro Cys Phe Leu Gln Leu Leu Ala Gly
1 5 10 15
Leu Ala Leu Pro Ala Val Pro Pro Gln Gln Trp Ala Leu Ser Ala Gly
20 25 30
Asn Gly Ser Ser Glu Val Glu Val Val Pro Phe Gln Glu Val Trp Gly
35 40 45
Arg Ser Tyr Cys Arg Ala Leu Glu Arg Leu Val Asp Val Val Ser Glu
9
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
50 55 60
Tyr Pro Ser Glu Val Glu His Met Phe Ser Pro Ser Cys Val Ser Leu
65 70 75 80
Leu Arg Cys Thr Gly Cys Cys Gly Asp Glu Asp Leu His Cys Val Pro
85 90 95
Val Glu Thr Ala Asn Val Thr Met Gln Leu Leu Lys Ile Arg Ser Gly
100 105 110
Asp Arg Pro Ser Tyr Val Glu Leu Thr Phe Ser Gln His Val Arg Cys
115 120 125
Glu Cys Arg Pro Leu Arg Glu Lys Met Lys Pro Glu Arg Arg Arg Pro
130 135 140
Lys Gly Arg Gly Lys Arg Arg Arg Glu Asn Gln Arg Pro Thr Asp Cys
195 150 155 160
His Leu Cys Gly Asp Ala Val Pro Arg Arg
165 170
<210> 10
<211> 188
<212> PRT
<213> Homo Sapiens
<400> 10
Met Ser Pro Leu Leu Arg Arg Leu Leu Leu Ala Ala Leu Leu Gln Leu
1 5 10 15
Ala Pro Ala Gln Ala Pro Val Ser Gln Pro Asp Ala Pro Gly His Gln
20 25 30
Arg Lys Val Val Ser Trp Ile Asp Val Tyr Thr Arg Ala Thr Cys Gln
35 40 45
Pro Arg Glu Val Val Val Pro Leu Thr Val Glu Leu Met Gly Thr Val
50 55 60
Ala Lys Gin Leu Val Pro Ser Cys Val Thr Val Gln Arg Cys Gly Gly
65 70 75 80
Cys Cys Pro Asp Asp Gly Leu Glu Cys Val Pro Thr Gly Gln His Gln
85 90 95
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Val Arg Met Gln Ile Leu Met Ile Arg Tyr Pro Ser Ser Gln Leu Gly
100 105 110
Glu Met Ser Leu Glu Glu His Ser Gln Cys Glu Cys Arg Pro Lys Lys
115 120 125
Lys Asp Ser Ala Val Lys Pro Asp Ser Pro Arg Pro Leu Cys Pro Arg
130 135 140
Cys Thr Gln His His Gln Arg Pro Asp Pro Arg Thr Cys Arg Cys Arg
145 150 155 160
Cys Arg Arg Arg Ser Phe Leu Arg Cys Gln Gly Arg Gly Leu Glu Leu
165 170 175
Asn Pro Asp Thr Cys Arg Cys Arg Lys Leu Arg Arg
180 185
<210> 11
<211> 133
<212> PRT
<213> Homo sapiens
<400> 11
Met Lys Leu Leu Val Gly Ile Leu Val Ala Val Cys Leu His Gln Tyr
1 5 10 15
Leu Leu Asn Ala Asp Sex Asn Thr Lys Gly Trp Ser Glu Val Leu Lys
20 25 30
Gly Ser Glu Cys Lys Pro Arg Pro Ile Val Val Pro Val Ser Glu Thr
35 40 45
His Pro Glu Leu Thr Ser Gln Arg Phe Asn Pro Pro Cys Val Thr Leu
50 55 60
Met Arg Cys Gly Gly Cys Cys Asn Asp Glu Ser Leu Glu Cys Val Pro
65 70 75 80
Thr Glu Glu Val Asn Val Ser Met Glu Leu Leu Gly Ala Ser Gly Ser
85 90 95
Gly Ser Asn Gly Met Gln Arg Leu Ser Phe Val Glu His Lys Lys Cys
100 105 110
Asp Cys Arg Pro Arg Phe Thr Thr Thr Pro Pro Thr Thr Thr Arg Pro
115 120 125
11
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Pro Arg Arg Arg Arg
130
<210> 12
<211> 919
<212> PRT
<213> Homo sapiens
<400> 12
Met His Leu Leu Gly Phe Phe Ser Val Ala Cys Ser Leu Leu Ala Ala
1 5 10 15
Ala Leu Leu Pro Gly Pro Arg Glu Ala Pro Ala Ala Ala Ala Ala Phe
20 25 30
Glu Ser Gly Leu Asp Leu Ser Asp Ala Glu Pro Asp Ala Gly Glu Ala
35 AO 45
Thr Ala Tyr Ala Ser Lys Asp Leu Glu Glu Gln Leu Arg Ser Val Ser
50 55 60
Ser Val Asp Glu Leu Met Thr Val Leu Tyr Pro Glu Tyr Trp Lys Met
65 70 75 80
Tyr Lys Cys Gln Leu Arg Lys Gly Gly Trp Gln His Asn Arg Glu Gln
85 90 95
Ala Asn Leu Asn Ser Arg Thr Glu Glu Thr Ile Lys Phe Ala Ala Ala
100 105 110
His Tyr Asn Thr Glu Ile Leu Lys Ser Ile Asp Asn Glu Trp Arg Lys
115 120 I25
Thr Gln Cys Met Pro Arg Glu Val Cys Ile Asp Val Gly Lys Glu Phe
130 135 140
Gly Val Ala Thr Asn Thr Phe Phe Lys Pro Pro Cys Val Ser Val Tyr
195 150 155 160
Arg Cys Gly Gly Cys Cys Asn Ser Glu Gly Leu Gln Cys Met Asn Thr
165 170 175
Ser Thr Ser Tyr Leu Ser Lys Thr Leu Phe Glu Ile Thr Val Pro Leu
180 185 190
Ser Gln Gly Pro Lys Pro Val Thr Ile Ser Phe Ala Asn His Thr Ser
12
CA 02344561 2001-03-29
WO 00/18212 PCTNS99/22668
195 200 205
Cys Arg Cys Met Ser Lys Leu Asp Val Tyr Arg Gln Val His Ser Ile
210 215 220
Ile Arg Arg Ser Leu Pro Ala Thr Leu Pro Gln Cys Gln Ala Rla Asn
225 230 235 240
Lys Thr Cys Pro Thr Asn Tyr Met Trp Asn Asn His Ile Cys Arg Cys
245 250 255
Leu Ala Gln Glu Asp Phe Met Phe Ser Ser Asp Ala Gly Asp Asp Ser
260 265 270
Thr Asp Gly Phe His Asp Ile Cys Gly Pro Asn Lys Glu Leu Asp Glu
275 280 285
Glu Thr Cys Gln Cys Val Cys Arg Ala Gly Leu Arg Pro Ala Ser Cys
290 295 300
Gly Pro His Lys Glu Leu Asp Arg Asn Ser Cys Gln Cys Val Cys Lys
305 310 315 320
Asn Lys Leu Phe Pro Ser Gln Cys Gly Ala Asn Arg Glu Phe Asp Glu
325 330 335
Asn Thr Cys Gln Cys Val Cys Lys Arg Thr Cys Pro Arg Asn Gln Pro
340 345 350
Leu Asn Pro Gly Lys Cys Ala Cys Glu Cys Thr Glu Ser Pro Gln Lys
355 360 365
Cys Leu Leu Lys Gly Lys Lys Phe His His Gln Thr Cys Ser Cys Tyr
370 375 380
Arg Arg Pro Cys Thr Asn Arg Gln Lys Ala Cys Glu Pro Gly Phe Ser
385 390 395 400
Tyr Ser Glu Glu Val Cys Arg Cys Val Pro Ser Tyr Trp Lys Arg Pro
905 910 415
Gln Met Ser
<210> 13
<211> 358
<212> PRT
13
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
<213> Homo Sapiens
<400> 13
Met Tyr Gly Glu Trp Gly Met Gly Asn Ile Leu Met Met Phe His Val
1 5 10 15
Tyr Leu Val Gln Gly Phe Arg Ser Glu His Gly Pro Val Lys Asp Phe
20 25 30
Ser Phe Glu Arg Ser Ser Arg Ser Met Leu Glu Arg Ser Glu Gln Gln
35 40 45
Ile Arg Ala Ala Ser Ser Leu Glu Glu Leu Leu Gln Ile Ala His Ser
50 55 60
Glu Asp Trp Lys Leu Trp Arg Cys Arg Leu Lys Leu Lys Ser Leu Ala
65 70 75 80
Ser Met Asp Ser Arg Ser Ala Ser His Arg Ser Thr Arg Phe Ala Ala
85 90 95
Thr Phe Tyr Asp Thr Glu Thr Leu Lys Val Ile Asp Glu Glu Trp Gln
100 105 110
Arg Thr Gln Cys Ser Pro Arg Glu Thr Cys Val Glu Val Ala Ser Glu
115 120 125
Leu Gly Lys Thr Thr Asn Thr Phe Phe Lys Pro Pro Cys Val Asn Val
130 135 140
Phe Arg Cys Gly Gly Cys Cys Asn Glu Glu Gly Val Met Cys Met Asn
145 150 155 160
Thr Ser Thr Ser Tyr Ile Ser Lys Gln Leu Phe Glu Ile Ser Val Pro
165 170 175
Leu Thr Ser Val Pro Glu Leu Val Pro Val Lys Ile Ala Asn His Thr
180 185 190
Gly Cys Lys Cys Leu Pro Thr Gly Pro Arg His Pro Tyr Ser Ile Ile
195 200 205
Arg Arg Ser Ile Gln Thr Pro Glu Glu Asp Glu Cys Pro His Ser Lys
210 215 220
Lys Leu Cys Pro Ile Asp Met Leu Trp Asp Asn Thr Lys Cys Lys Cys
225 230 235 240
19
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Val Leu Gln Asp Glu Thr Pro Leu Pro Gly Thr Glu Asp His Ser Tyr
245 250 255
Leu Gln Glu Pro Thr Leu Cys Gly Pro His Met Thr Phe Asp Glu Asp
260 265 270
Arg Cys Glu Cys Val Cys Lys Ala Pro Cys Pro Gly Asp Leu Ile Gln
275 280 285
His Pro Glu Asn Cys Ser Cys Phe Glu Cys Lys Glu Ser Leu Glu Ser
290 295 300
Cys Cys Gln Lys His Lys Ile Phe His Pro Asp Thr Cys Ser Cys Glu
305 310 315 320
Asp Arg Cys Pro Phe His Thr Arg Thr Cys Ala Ser Arg Lys Pro Ala
325 330 335
Cys Gly Lys His Trp Arg Phe Pro Lys Glu Thr Arg Ala Gln Gly Leu
390 345 350
Tyr Ser Gln Glu Asn Pro
355
<210> 14
<211> 211
<212> PRT
<213> Homo Sapiens
<400> 14
Met Arg Thr Leu Ala Cys Leu Leu Leu Leu Gly Cys Gly Tyr Leu Ala
1 5 10 15
His Val Leu Ala Glu Glu Ala Glu Ile Pro Arg Glu Val Ile Glu Arg
20 25 30
Leu Ala Arg Ser Gln Ile His Ser Ile Arg Asp Leu Gln Arg Leu Leu
35 40 95
Glu Ile Asp Ser Val Gly Ser Glu Asp Ser Leu Asp Thr Ser Leu Arg
50 55 60
Ala His Gly Val His Ala Thr Lys His Val Pro Glu Lys Arg Pro Leu
65 70 75 80
Pro Ile Arg Arg Lys Arg Ser Ile Glu Glu Ala Val Pro Ala Val Cys
85 90 95
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Lys Thr Arg Thr Val Ile Tyr Glu Ile Pro Arg Ser Gln Val Asp Pro
100 105 110
Thr Ser Ala Asn Phe Leu Ile Trp Pro Pro Cys Val Glu Val Lys Arg
115 120 125
Cys Thr Gly Cys Cys Asn Thr Ser Ser Val Lys Cys Gln Pro Ser Arg
130 135 140
Val His His Arg Ser Val Lys Val Ala Lys Val Glu Tyr Val Arg Lys
145 150 155 160
Lys Pro Lys Leu Lys Glu Val Gln Val Arg Leu Glu Glu His Leu Glu
165 170 175
Cys Ala Cys Ala Thr Thr Ser Leu Asn Pro Asp Tyr Arg Glu Glu Asp
180 185 190
Thr Gly Arg Pro Arg Glu Ser Gly Lys Lys Arg Lys Arg Lys Arg Leu
195 200 205
Lys Pro Thr
210
<210> 15
<211> 291
<212> PRT
<213> Homo sapiens
<400> 15
Met Asn Arg Cys Trp Ala Leu Phe Leu Ser Leu Cys Cys Tyr Leu Arg
1 5 10 15
Leu Val Ser Ala Glu Gly Asp Pro Ile Pro Glu Glu Leu Tyr Glu Met
20 25 30
Leu Ser Asp His Ser Ile Arg Ser Phe Asp Asp Leu Gln Arg Leu Leu
35 40 45
His Gly Asp Pro Gly Glu Glu Asp Gly Ala Glu Leu Asp Leu Asn Met
50 55 60
Thr Arg Ser His Ser Gly Gly Glu Leu Glu Ser Leu Ala Arg Gly Arg
65 70 75 80
Arg Ser Leu Gly Ser Leu Thr Ile Ala Glu Pro Ala Met Ile Ala Glu
16
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
85 90 9S
Cys Lys Thr Arg Thr Glu Val Phe Glu Ile Ser Arg Arg Leu Ile Asp
100 105 110
Arg Thr Asn Ala Asn Phe Leu Val Trp Pro Pro Cys Val Glu Val Gln
115 120 125
Arg Cys Ser Gly Cys Cys Asn Asn Arg Asn Val Gln Cys Arg Pro Thr
130 135 140
Gln Val Gln Leu Arg Pro Val Gln Val Arg Lys Ile Glu Ile Val Arg
145 150 155 160
Lys Lys Pro Ile Phe Lys Lys Ala Thr Val Thr Leu Glu Asp His Leu
165 170 175
Ala Cys Lys Cys Glu Thr Val Ala Ala Ala Arg Pro Val Thr Arg Ser
180 185 190
Pro Gly Gly Ser Gln Glu Gln Arg Ala Lys Thr Pro Gln Thr Arg Val
195 200 205
Thr Ile Arg Thr Val Arg Val Arg Arg Pro Pro Lys Gly Lys His Arg
210 215 220
Lys Phe Lys His Thr His Asp Lys Thr Ala Leu Lys Glu Thr Leu Gly
225 230 235 290
Ala
<210> 16
<211> 182
<212> PRT
<213> Homo sapiens
<400> 16
Met Pro Gln Phe Thr Asp Cys Val Cys Arg Gly Ser Thr Gly Gly Glu
1 5 10 15
Ala Val Ser Pro Ser Val Leu Pro Pro Ser Ala Leu Pro Leu Asp Leu
20 25 30
Leu Asn Asn Ala Ile Thr Ala Phe Ser Thr Leu Glu Asp Leu Ile Arg
35 40 95
17
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Tyr Leu Glu Pro Glu Arg Trp Gln Leu Asp Leu Glu Asp Leu Tyr Arg
50 55 60
Pro Thr Trp Gln Leu Leu Gly Lys Ala Phe Val Phe Gly Arg Lys Ser
65 70 75 80
Arg Val Val Asp Leu Asn Leu Leu Thr Glu Glu Val Arg Leu Tyr Ser
85 90 95
Cys Thr Pro Arg Asn Phe Ser Val Ser Ile Arg Glu Glu Leu Lys Arg
100 105 110
Thr Asp Thr Ile Phe Trp Pro Gly Cys Leu Leu Val Lys Arg Cys Gly
115 120 125
Gly Asn Cys Ala Cys Cys Leu His Asn Cys Asn Glu Cys Gln Cys Val
130 135 190
Pro Ser Lys Val Thr Lys Lys Tyr His Glu Val Leu Gln Leu Arg Pro
195 150 155 160
Lys Thr Gly Val Arg Gly Leu His Lys Ser Leu Thr Asp Val Ala Leu
165 170 175
Glu His His Glu Glu Cys
180
<210> 17
<211> 182
<212> PRT
<213> Murinae gen, sp.
<900> 17
Met Pro Gln Val Thr Glu Thr Thr Ser Pro Ser Val Leu Pro Pro Ser
1 5 10 15
Ser Leu Ser Leu Asp Leu Leu Asn Asn Ala Val Thr Ala Phe Ser Thr
20 25 30
Leu Glu Glu Leu Ile Arg Tyr Leu Glu Pro Asp Arg Trp Gln Val Asp
35 40 95
Leu Asp Ser Leu Tyr Lys Pro Thr Trp Gln Leu Asp Cys Val Cys Arg
50 55 60
Gly Asn Ala Gly Gly Leu Gly Lys Ala Phe Leu Tyr Gly Lys Lys Ser
65 70 75 80
18
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Lys Val Val Asn Leu Asn Leu Leu Lys Glu Glu Val Lys Leu Tyr Ser
85 90 95
Cys Thr Pro Arg Asn Phe Ser Val Ser Ile Arg Glu Glu Leu Lys Arg
100 105 110
Thr Asp Thr Ile Phe Trp Pro Gly Cys Leu Leu Val Lys Arg Cys Gly
115 120 125
Gly Asn Cys Ala Cys Cys Leu His Asn Cys Asn Glu Cys Gln Cys Val
130 135 140
Pro Arg Lys Val Thr Lys Lys Tyr His Glu Val Leu Gln Leu Arg Pro
145 150 155 160
Lys Thr Gly Val Lys Gly Leu His Lys Ser Leu Thr Asp Val Ala Leu
165 170 175
Glu His His Glu Glu Cys
180
<210> 18
<211> 117
<212> PRT
<213> Murinae gen. sp.
<400> 18
Glu Arg Val Val Thr Ile Ser Gly Asn Gly Ser Ile His Ser Pro Lys
1 5 10 15
Phe Pro His Thr Tyr Pro Arg Asn Met Val Leu Val Trp Arg Leu Val
20 25 30
Ala Val Asp Glu Asn Val Arg Ile Gln Leu Thr Phe Asp Glu Arg Phe
35 40 95
Gly Leu Glu Asp Pro Glu Asp Asp Ile Cys Lys Tyr Asp Phe Val Glu
50 55 60
Val Glu Glu Pro Ser Asp Gly Ser Val Leu Gly Arg Trp Cys Gly Ser
65 70 75 80
Gly Thr Val Pro Gly Lys Gln Thr Ser Lys Gly Asn Met Ile Arg Ile
85 90 95
Arg Phe Val Ser Asp Glu Tyr Phe Pro Ser Glu Pro Gly Phe Cys Ile
19
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
100 105 110
His Tyr Ser Ile Ile
115
<210> 19
<211> 117
<212> PRT
<213> Homo sapiens
<400> 19
Glu Arg Ile Ile Thr Val Ser Thr Asn Gly Ser Ile His Ser Pro Arg
1 5 10 15
Phe Pro His Thr Tyr Pro Arg Asn Thr Val Leu Val Trp Arg Leu Val
20 25 30
Ala Val Glu Glu Asn Val Trp Ile Gln Leu Thr Phe Asp Glu Arg Phe
35 40 45
Gly Leu Glu Asp Pro Glu Asp Asp Ile Cys Lys Tyr Asp Phe Val Glu
50 55 60
Val Glu Glu Pro Ser Asp Gly Thr Ile Leu Gly Arg Trp Cys Gly Ser
65 70 75 80
Gly Thr Val Pro Gly Lys Gln Ile Ser Lys Gly Asn Gln Ile Arg Ile
85 90 95
Arg Phe Val Ser Asp Glu Tyr Phe Pro Ser Glu Pro Gly Phe Cys Ile
100 105 110
His Tyr Asn Ile Val
115
<210> 20
<211> 113
<212> PRT
<213> Homo Sapiens
<400> 20
Cys Gly Glu Thr Leu Gln Asp Ser Thr Gly Asn Phe Ser Ser Pro Glu
1 5 10 15
Tyr Pro Asn Gly Tyr Ser Ala His Met His Cys Val Trp Arg Ile Ser
20 25 30
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
Val Thr Pro Gly Glu Lys Ile Ile Leu Asn Phe Thr Ser Leu Asp Leu
35 40 45
Tyr Arg Ser Arg Leu Cys Trp Tyr Asp Tyr Val Glu Val Arg Asp Gly
50 55 60
Phe Trp Arg Lys Ala Pro Leu Arg Gly Arg Phe Cys Gly Ser Lys Leu
65 70 75 80
Pro Glu Pro Ile Val Ser Thr Asp Ser Arg Leu Trp Val Glu Phe Arg
85 90 95
Ser Ser Ser Asn Trp Val Gly Lys Gly Phe Phe Ala Val Tyr Glu Ala
100 105 110
Ile
<210> 21
<211> 112
<212> PRT
<213> Homo sapiens
<400> 21
Cys Gly Gly Asp Val Lys Lys Asp Tyr Gly His Ile Gln Ser Pro Asn
1 5 10 15
Tyr Pro Asp Asp Tyr Arg Pro Ser Lys Val Cys Ile Trp Arg Ile Gln
20 25 30
Val Ser Glu Gly Phe His Val Gly Leu Thr Phe Gln Ser Phe Glu Ile
35 40 45
Glu Arg Met Asp Ser Cys Ala Tyr Asp Tyr Leu Glu Val Arg Asp Gly
50 55 60
His Ser Glu Ser Ser Thr Leu Ile Gly Arg Tyr Cys Gly Tyr Glu Lys
65 70 75 80
Pro Asp Asp Ile Lys Ser Thr Ser Ser Arg Leu Trp Leu Lys Phe Val
g5 90 95
Ser Asp Gly Ser Ile Asn Lys Ala Gly Phe Ala Val Asn Phe Phe Lys
100 105 110
21
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
<210> 22
<211> 113
<212> PRT
<213> Homo Sapiens
<400> 22
Cys Gly Gly Phe Leu Thr Lys Leu Asn Gly Ser Ile Thr Ser Pro Gly
1 5 10 15
Trp Pro Lys Glu Tyr Pro Pro Asn Lys Asn Cys Ile Trp Gln Leu Val
20 25 30
Ala Pro Thr Gln Tyr Arg Ile Ser Leu Gln Phe Asp Phe Phe Glu Thr
35 90 95
Glu Gly Asn Asp Val Cys Lys Tyr Asp Phe Val Glu Val Arg Ser Gly
50 55 60
Leu Thr Ala Asp Ser Lys Leu His Gly Lys Phe Cys Gly Ser Glu Lys
65 70 75 80
Pro Glu Val Ile Thr Ser Gln Tyr Asn Asn Met Arg Val Glu Pro Lys
85 90 95
Ser Asp Asn Thr Val Ser Lys Lys Gly Phe Lys Ala His Phe Phe Ser
100 105 110
Glu
<210> 23
<211> 113
<212> PRT
<213> Homo sapiens
<900> 23
Gly Asp Thr Ile Lys Ile Glu Ser Pro Gly Tyr Leu Thr Ser Pro Gly
1 5 10 15
Tyr Pro His Ser Tyr His Pro Ser Glu Lys Cys Glu Trp Leu Ile Gln
20 25 30
Ala Pro Asp Pro Tyr Gln Arg Ile Met Ile Asn Phe Asn Pro His Phe
35 90 95
22
CA 02344561 2001-03-29
WO 00118212 PCT/US99/22668
Asp Leu Glu Asp Arg Asp Cys Lys Tyr Asp Tyr Val Glu Val Phe Asp
50 55 60
Gly Glu Asn Glu Asn Gly His Phe Arg Gly Lys Phe Cys Gly Lys Ile
65 70 75 80
Ala Pro Pro Pro Val Val Ser Ser Gly Pro Phe Leu Phe Ile Lys Phe
85 90 95
Val Ser Asp Tyr Glu Thr His Gly Ala Gly Phe Ser Ile Arg Tyr Glu
100 105 110
Ile
<210> 29
<211> 119
<212> PRT
<213> Homo sapiens
<400> 24
Cys Ser Gln Asn Tyr Thr Thr Pro Ser Gly Val Ile Lys Ser Pro Gly
1 5 10 15
Phe Pro Glu Lys Tyr Pro Asn Ser Leu Glu Cys Thr Tyr Ile Val Phe
20 25 30
Ala Pro Lys Met Ser Glu Ile Ile Leu Glu Phe Glu Ser Phe Asp Leu
35 40 45
Glu Pro Asp Ser Asn Pro Pro Gly Gly Met Phe Cys Arg Tyr Asp Arg
50 55 60
Leu Glu Ile Trp Asp Gly Phe Pro Asp Val Gly Pro His Ile Gly Arg
65 70 75 80
Tyr Cys Gly Gln Lys Thr Pro Gly Arg Ile Arg Ser Ser Ser Gly Ile
85 90 95
Leu Ser Met Val Phe Tyr Thr Asp Ser Ala Ile Ala Lys Glu Gly Phe
100 105 110
Ser Ala Asn Tyr Ser Val Leu
115
23
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
<210> 25
<211> 19
<212> DNA
<213> Homo Sapiens
<400> 25
gaagttgagg aacccagtg 19
<210> 26
<211> 20
<212> DNA
<213> Homo sapiens
<400> 26
cttgccaaga agttgccaag 20
<210> 27
<211> 19
<212> DNA
<213> Murinae gen. sp.
<400> 27
cttcagtacc ttggaagag 19
<210> 28
<211> 19
<212> DNA
<213> Murinae gen. sp.
<400> 28
cgcttgacca ggagacaac 19
<210> 29
<211> 30
<212> DNA
<213> Murinae gen. sp.
<400> 29
acgtgaattc agcaagttca gcctggttaa 30
<210> 30
<211> 30
<212> DNA
<213> Murinae gen. sp.
<400> 30
acgtggatcc tgagtatttc ttccagggta 30
24
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
<210> 31
<211> 22
<212> PRT
<213> Homo Sapiens
<400> 31
Cys Lys Phe Gln Phe Ser Ser Asn Lys Glu Gln Asn Gly Val Gln Asp
1 5 10 15
Pro Gln His Glu Arg Cys
<210> 32
<211> 21
<212> PRT
<213> Homo Sapiens
<400> 32
Gly Arg Lys Ser Arg Val Val Asp Leu Asn Leu Leu Thr Glu Glu Val
1 5 10 15
Arg Leu Tyr Ser Cys
<210> 33
<211> 26
<212> DNA
<213> Homo Sapiens
<900> 33
cgggatcccg aatccaacct gagtag 26
<210> 34
<211> 61
<212> DNA
<213> Homo sapiens
<900> 34
ggaattccta atggtgatgg tgatgatgtt tgtcatcgtc atctcctcct gtgctccctc 60
t 61
<210> 35
<211> 29
<212> DNA
<213> Homo Sapiens
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
<400> 35
cggatcccgg aagaaaatcc agagtggtg 29
<210> 36
<211> 61
<212> DNA
<213> Homo Sapiens
<400> 36
ggaattccta atggtgatgg tgatgatgtt tgtcatcgtc atctcctcct gtgctccctc 60
t 61
<210> 37
<211> 21
<212> PRT
<213> Homo Sapiens
<400> 37
Gly Arg Lys Ser Arg Val Val Asp Leu Asn Leu Leu Thr Glu Glu Val
1 5 10 15
Arg Leu Tyr Ser Cys
<210> 38
<211> 26
<212> DNA
<213> Homo Sapiens
<220>
<223> Forward PCR primer from the human PDGF-C 430 by
cDNA fragment encoding the CUB domain which
includes a BamHI site
<400> 38
cgggatcccg aatccaacct gagtag 26
<210> 39
<211> 60
<212> DNA
<213> Homo sapiens
<220>
<223> Reverse PCR primer from the human PDGF-C 430 by
cDNA fragment encoding the CUB domain which
includes a EcoRI site and sequences coding for a
C-terminal 6X His tag preceded by an enterokinase
26
CA 02344561 2001-03-29
WO 00/18212 PCT/US99/22668
site
<400> 39
ccggaattcc taatggtgat ggtgatgatg tttgtcatcg tcgtcgacaa tgttgtagtg 60
27
