Note: Descriptions are shown in the official language in which they were submitted.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
1
SECRETORY PROTETN - 4$
TECHNICAL FIELD
The present invention relates generally to a new
cytokine having diagnostic and therapeutic uses. In
particular, the present invention relates to a novel
secreted protein designated 'Secretory Protein - 48' or
Zsig48 for short, and to nucleic acid molecules encoding
Zsig48.
BACKGROUND OF THE INVENTION
Proliferation, maintenance, survival and
differentiation of cells of multicellular organisms are
controlled by hormones and polypeptide growth factors.
These diffusable molecules allow cells to communicate with
each other and act in concert to form cells and organs,
and to repair and regenerate damaged tissue. Examples of
hormones and growth factors include the steroid hormones
(e. g. estrogen, testosterone), parathyroid hormone,
follicle stimulating hormone, the interleukins, platelet
derived growth factor (PDGF), epidermal growth factor
(EGF), granulocyte-macrophage colony stimulating factor
(GM-CSF), erythropoietin (EPO) and calcitonin.
Hormones and growth factors influence cellular
metabolism by binding to proteins. Proteins may be
integral membrane proteins that are linked to signaling
pathways within the cell, such as second messenger
systems. Other classes of proteins are soluble molecules,
such as the transcription factors.
Of particular interest are cytokines, molecules
that promote the proliferation, maintenance, survival or
differentiation of cells. Examples of cytokines include
CA 02344712 2001-03-30
WO 00/1879b PCTIUS99/22970
2
erythropoietin (EPO), which stimulates the development of
red blood cells; thrombopoietin (TPO), which stimulates
development of cells of the megakaryocyte lineage; and
granulocyte-colony stimulating factor (G-CSF), which
stimulates development of neutrophils. These cytokines
are useful in restoring normal blood cell levels in
patients suffering from anemia or receiving chemotherapy
for cancer. The demonstrated in vivo activities of these
cytokines illustrates the enormous clinical potential of,
and need for, other cytokines, cytoki~.e agonists, and
cytokine antagonists.
SUNfMARY OF THE INVENTION
The present invention fills this need by
providing for a secretory protein, designated 'Zsig48'
which can stimulate the proliferation of peripheral blood
mononuclear cells, i.e., T-cells, B-cells and monocytes,
(PBMNCs). The present invention also provides Zsig48
polypeptides and Zsig48 fusion proteins, as well as
nucleic acid molecules encoding such polypeptides and
proteins.
The human Zsig48 pvlypeptide with signal
sequence is comprised of a sequence which is 105 amino
acid residues as shown in SEQ ID NOs: 1 and 2. The signal
sequence is comprised of amino acid residues 1-26 of SEQ
ID N0:2. A mature Zsig48 polypeptide thus is comprised of
amino acid residues 27, a leucine, to and including amino
acid residue 105, a histidine, of SEQ ID NO:2 also defined
by SEQ ID N0:3. An alternative mature Zsig48 polypeptide
is comprised of amino acid residues 29, a leucine, to and
including amino acid residue 105 of SEQ ID NO: 2, also
defined by SEQ ID N0:4. In yet a third alternative signal
peptidase cleavage site, the signal sequence is comprised
CA 02344712 2001-03-30
WO 00/18796 PC1'/US99122970
3
of amino acid residues 1-40, the mature sequence being
comprised of amino acid residue 41, a proline, to and
including amino acid residue 105 of SEQ ID N0:2. This
mature sequence is also defined by SEQ ID N0:5. Another
mature sequence of Zsig48 extends from amino acid residue
26 to and including amino acid residue 105 of SEQ ID N0:2,
also represented by SEQ ID N0:16.
The present invention further provides
pharmaceutical compositions that comprise such
polypeptides, and a pharmaceutically acceptable carrier.
The present invention also includes variant
human Zsig48 polypeptides, wherein the variant poiypeptide
shares an identity with the amino acid sequence of SEQ ID
NOs:2, 3, 4, 5 or 16 selected from the group consisting of
at least 70% identity, at least 80% identity, at least 90%
identity, at least 95% identity, or greater than 95%
identity, and wherein any difference between the amino
acid sequence of the variant polypeptide and the amino
acid sequence of SEQ ID NOs:2, 3, 4 and 5 is due to one or
more conservative amino acid substitutions.
An additional embodiment of the present
invention relates to a peptide or polypeptide which has
the amino acid sequence of an epitope-bearing portion of a
Zsig48 polypeptide having an amino acid sequence described
above. Peptides or polypeptides having the amino acid
sequence of an epitope-bearing portion of a Zsig48
polypeptide of the present invention include portions of
such polypeptides with at least nine, preferably a~ least
15 and more preferably at least 30 to 50 amino acids,
although epitope-bearing polypeptides of any length up to
and including the entire amino acid sequence of a
polypeptide of the present invention described above are
also included in. the present invention. Also claimed are
any of these polypeptides that are fused to another
CA 02344712 2001-03-30
WO 00/18796 PCT/iJS99122970
4
polypeptide or carrier molecule. Examples of such
polypeptides are those polypeptides comprised of ane or
more of SEQ ID NOs: 8, 9, 10, 11, or 12.
The present invention also provides for isolated
polynucleotides which encode the above-described
palypeptides.
The present invention also provides isolated
nucleic acid molecules that encode a Zsig48 polypeptide,
wherein the nucleic acid molecule is selected from the
group consisting of (a) a nucleic acid molecule comprising
the nucleotide sequence of SEQ TD NO:1, (b) a nucleic acid
molecule which encodes isolated polypeptides having an
amino acid sequence that is at least 700, 80%, 90%, 95% or
99% identical to an amino acid sequence selected from the
group consisting of the polypeptide defined by SEQ ID
NOs:2, 3, 4 or 5; (c) a nucleic acid molecule that remains
hybridized following stringent wash conditions to a
nucleic acid molecule consisting of the nucleotide
sequence of SEQ ID NO:1, or the complement of SEQ ID NO:1,
and (d) a nucleic acid molecule that remains hybridized
following stringent wash conditions to a nucleic acid
molecule which encodes an isolated polypeptides having an
amino acid sequence that is at least 700, 800, 90%, 950 or
99o identical to an amino acid sequence selected from the
group consisting of the polypeptide defined by SEQ ID
NOs:2, 3, 4 and 5. SEQ ID N0:14 shows a genomic sequence
of Zsig48.
The present invention also provides vectors and
expression vectors comprising such nucleic acid molecules,
recombinant host cells comprising such vectors and
expression vectors, and recombinant viruses comprising
such expression vectors. These expression vectors and
recombinant host cells can be used to prepare Zsig48
polypeptides. In addition, the present invention provides
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
pharmaceutical compositions, comprising a pharmaceutically
acceptable carrier and at least one of such an expression
vector or recombinant virus. Preferably, such
pharmaceutical compositions comprise a human Zsig48 gene,
5 or a variant thereof.
The present invention further contemplates
antibodies and antibody fragments that specifically bind
with Zsig48 polypeptides. Such antibodies include
polyclonal antibodies, murine monoclonal antibodies,
humanized antibodies derived from murine monoclonal
antibodies, and human monoclonal antibodies. Examples of
antibody fragments include F (ab' ) 2, F (ab) 2, Fab' , Fab, Fv,
scFv, and minimal recognition units.
In addition, the presence of Zsig48 polypeptide
in a biological sample can be detected by methods that
comprise the steps of (a) contacting the biological sample
with an antibody, or an antibody fragment, that
specifically binds with a polypeptide having the amino
acid sequence of either SEQ ID NOs:2 3, 4 or 5, wherein
the contacting is performed under conditions that allow
the binding of the antibody or antibody fragment to the
biological sample, and (b) detecting any of the bound
antibody or bound antibody fragment.
The present invention also contemplates isolated
nucleic acid molecules comprising a nucleotide sequence
that encodes an Zsig48 secretion signal sequence and a
nucleotide sequence that encodes a biologically active
polypeptide, wherein the Zsig48 secretion signal sequence
comprises an amino acid sequence of residues 1 to 26, 1 to
28 or 1 to 40 of SEQ ID N0:2. Illustrative biologically
active polypeptides include Factor VIIa, proinsulin,
insulin, follicle stimulating hormone, tissue type
plasminogen activator, tumor necrosis factor, interleukin,
colony stimulating factor, interferon, erythropoietin, and
CA 02344712 2001-03-30
WO 00118796 PCT/US99122970
6
thrombopoietin. Moreover, the present invention provides
fusion proteins comprising a Zsig48 secretion signal
sequence and a polypeptide, wherein the Zsig48 secretion
signal sequence comprises an amino acid sequence of
residues 1 to 26, 1 to 28 or 1 to 40 of SEQ ID N0:2.
The present invention also contemplates anti-
idiotype antibodies, or anti-idiotype antibody fragments,
that specifically bind with an anti-Zsig48 antibody or
antibody fragment, wherein the anti-idiotype antibody, or
anti-idiotype antibody fragment, possesses the ability to
cause proliferation of T-cells, B-cells or monocytes.
The present invention further includes methods
for detecting an alteration in a chromosome containing
Zsig48. Illustrative chromosomal aberrations at the Zsig48
gene locus include aneuploidy, gene copy number changes,
insertions, deletions, restriction site changes and
rearrangements. These aberrations can occur within
flanking sequences, including upstream promoter and
regulatory regions, and can be manifested as physical
alterations within a coding sequence or changes in gene
expression level. Such methods are effected by examining
the Zsig48 gene and its gene products. In general,
suitable assay methods include molecular genetic
techniques known to those in the art, such as restriction
fragment length polymorphism analysis, short tandem repeat
analysis employing polymerise chain reaction techniques,
ligation chain reaction, ribonuclease protection assays,
use of single-nucleotide polymorphisms, protein truncation
assays, and other genetic linkage techniques known in the
art.
In particular, the present invention provides
methods for diagnosing an alteration in the Zsig48 gene of
an individual, comprising: (a) amplifying nucleic acid
molecules that encode Zsig48 from RNA isolated from a
CA 02344712 2001-03-30
WO 00/18T96 PCT/US99/22970
7
biological sample of the individual, and (b) detecting a
mutation in the amplified nucleic acid molecules, wherein
the presence of a mutation indicates an alteration in the
Zsig48 gene. Similarly, methods of detecting a chromosome
abnormality in a subject comprise: (a) amplifying nucleic
acid molecules that encode Zsig48 from RNA isolated from a
biological sample of the subject, and (b) detecting a
mutation in the amplified nucleic acid molecules, wherein
the presence of a mutation indicates a chromosome
abnormality. In variations of these methods, the
detecting step is performed by comparing the nucleotide
sequence of the amplified nucleic acid molecules to the
nucleotide sequence of SEQ ID NOs:l. Alternatively, the
detecting step can be performed by fractionating the
amplified nucleic acid molecules and control nucleic acid
molecules that encode the amino acid sequence of SEQ ID
NOs:2, and comparing the lengths of the fractionated
amplified and control nucleic acid molecules. Exemplary
methods for amplification include polymerase chain
reaction or reverse transcriptase--polymerase chain
reaction.
The present invention further provides for a
method for promoting the proliferation of leukocytes
comprising bringing the leukocytes into contact with
Zsig48.
These and other aspects of the inventian will
become evident upon reference to the following detailed
description and the attached drawings. In addition,
various references are identified below and are
incorporated by reference in their entirety.
DETAILED DESCRIPTION OF THE INVENTION
The teachings of all the references cited herein are
incorporated in their entirety herein by reference.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99122970
8
Definitions
In the description that follows; a number of
terms are used extensively. The following definitions are
provided to facilitate understanding of the invention.
As used herein, "nucleic acid" or "nucleic acid
l0 molecule" refers to polynucleotides, such as
deoxyribonucleic acid (DNA) or ribonucleic acid (RNA),
oligonucleotides, fragments generated by the polymerase
chain reaction (PCR), and fragments generated by any of
ligation, scission, endonuclease action, and exonuclease
action. Nucleic acid molecules can be composed of
monomers that are naturally-occurring nucleotides (such as
DNA and RNA), or analogs of naturally-occurring
nucleotides (e. g., a-enantiomeric forms of naturally-
occurring nucleotides), or a combination of both.
Modified nucleotides can have alterations in sugar
moieties and/or in pyrimidine or purine base moieties.
Sugar modifications include, for example, replacement of
one or more hydroxyl groups with halogens, alkyl groups,
amines, and azido groups, ar sugars can be functionalized
as ethers or esters. Moreover, the entire sugar moiety
can be replaced with sterically and electronically similar
structures, such as aza-sugars and carbocyclic sugar
analogs. Examples of modifications in a base moiety
include alkylated purines and pyrimidines, acylated
purines or pyrimidines, or other well-known heterocyclic
substitutes. Nucleic acid monomers can be linked by
phosphodiester bonds ar analogs of such linkages. Analogs
of phosphodiester linkages include phosphorothioate,
phosphorodithioate, phosphoroselenoate,
phosphorodiselenoate, phosphoroanilothioate,
phosphoranilidate, phosphoramidate, and the like. The
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
9
term "nucleic acid molecule" also includes so-called
"peptide nucleic acids," which comprise naturally-
occurring or modified nucleic acid bases attached to a
polyamide backbone. Nucleic acids can be either single
stranded or double stranded.
The term "complement of a nucleic acid molecule"
refers to a nucleic acid molecule having a complementary
nucleotide sequence and reverse orientation as compared to
a reference nucleotide sequence. For example, the
sequence 5' ATGCACGGG 3' is complementary to 5' CCCGTGCAT
3'.
The term "contig" denotes a nucleic acid
molecule that has a contiguous stretch of identical or
complementary sequence to another nucleic acid molecule.
Contiguous sequences are said to "overlap" a given stretch
of a nucleic acid molecule either in their entirety or
along a partial stretch of the nucleic acid molecule.
The term "degenerate nucleotide sequence"
denotes a sequence of nucleotides that includes one or
more degenerate codons as compared to a reference nucleic
acid molecule that encodes a polypeptide. Degenerate
codons contain different triplets of nucleotides, but
encode the same amino acid residue (i.e., GAU and GAC
triplets each encode Asp).
The term "structural gene" refers to a nucleic
acid molecule that is transcribed into messenger RNA
(mRNA), which is then translated into a sequence of amino
acids characteristic of a specific polypeptide.
An "isolated nucleic acid molecule" is a nucleic
acid molecule that is not integrated in the genomic DNA of
an organism. For example, a DNA molecule that encodes a
growth factor that has been separated from the genomic DNA
CA 02344712 2001-03-30
WO 0011$796 PCT/US99/22970
of a cell is an isolated DNA molecule. Another example of
an isolated nucleic acid molecule is a chemically-
synthesized nucleic acid molecule that is not integrated in
the genome of an organism. A nucleic acid molecule that
5 has been isolated from a particular species is smaller than
the complete DNA molecule of a chromosome from that
species.
A "nucleic acid molecule construct" is a nucleic
IO acid molecule, either single- or double-stranded, that has
been modified through human intervention to contain
segments of nucleic acid combined and juxtaposed in an
arrangement not existing in nature.
"Linear DNA" denotes non-circular DNA molecules
having free 5' and 3' ends. Linear DNA can be prepared
from closed circular DNA molecules, such as plasmids, by
enzymatic digestion or physical disruption.
"Complementary DNA (cDNA?" is a single-stranded
DNA molecule that is formed from an mRNA template by the
enzyme reverse transcriptase. Typically, a primer
complementary to portions of mRNA is employed for the
initiation of reverse transcription. Those skilled in the
art also use the term "cDNA" to refer to a double-stranded
DNA molecule consisting of such a single-stranded DNA
molecule and its complementary DNA strand. The term "cDNA"
also refers to a clone of a cDNA molecule synthesized from
an RNA template.
A "promoter" is a nucleotide sequence that
directs the transcription of a structural gene. Typically,
a promoter is located in the 5' non-coding region of a
gene, proximal to the transcriptional start site of a
structural gene. Sequence elements within promoters that
function in the initiation of transcription are often
characterized by consensus nucleotide sequences. These
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/2297fl
11
promoter elements include RNA polymerase binding sites,
TATA sequences, CART sequences, differentiation-specific
elements (DSEs; McGehee et al., Mol. Endocrinol. 7:551
(1993)), cyclic AMP response elements (CREs), serum
response elements (SREs; Treisman, Seminars .zn Cancer
Biol. 1:47 (1990)), glucocorticoid response elements
(GREs), and binding sites for other transcription factors,
such as CRE/ATF (O'Reilly et al., J. Biol. Chem. 267:19938
(1992)), AP2 (Ye et al., J. Biol. Chern. 269:25728 (1994)),
SP1, cAMP response element binding protein (CREB; Loeken,
Gene Expr. 3:253 (1993)) and octamer factors (see, in
general, Watson et al., eds., Molecular Biology of the
Gene, 4th ed. (The Benjamin/Cummings Publishing Company,
Inc. 1987), and Lemaigre and Rousseau, Bzochem. J. 303:1.
(1994)). If a promoter is an inducible promoter, then the
rate of transcription increases in response to an inducing
agent. In contrast, the rate of transcription is not
regulated by an inducing agent if the promoter is a
constitutive promoter. Repressible promoters are also
known.
A "core promoter" contains essential nucleotide
sequences for promoter function, including the TATA box
and start of transcription. By this definition, a core
promoter may or may not have detectable activity in the
absence of specific sequences that may enhance the
activity or confer tissue specific activity.
A '"regulatory element" is a nucleotide sequence
that modulates the activity of a core promoter. For
example, a regulatory element may contain a nucleotide
sequence that binds with cellular factors enabling
transcription exclusively or preferentially in particular
cells, tissues, or organelles. These types of regulatory
elements are normally associated with genes that are
expressed in a "cell-specific," "tissue-specific," or
'"organelle-specific" manner. For example, the Zsig48
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
12
regulatory element preferentially induces gene expression
in placenta, kidney, heart or leukocytes.
An "enhancer" is a type of regulatory element
that can increase the efficiency of transcription,
regardless of the distance or orientation of the enhancer
relative to the start site of transcription.
"Heterologous DNA" refers to a DNA molecule, or
a population of DNA molecules, that does not exist
naturally within a given. host cell. DNA molecules
heterologous to a particular host cell may contain DNA
derived from the host cell species (i.e., endogenous DNA)
so long as that host DNA is combined with non-host DNA
(.i.e., exogenous DNA). For example, a DNA molecule
containing a non-host DNA segment encoding a polypeptide
operably linked to a host DNA segment comprising a
transcription promoter is considered to be a heterologous
DNA molecule. Conversely, a heterologous DNA molecule can
comprise an endogenous gene operably linked with an
exogenous promoter. As another illustration, a DNA
molecule comprising a gene derived from a wild-type cell
is considered to be heterologous DNA if that DNA molecule
is introduced into a mutant cell that lacks the wild-type
gene.
A "polypeptide" is a polymer of amino acid
residues joined by peptide bonds, whether produced
naturally or synthetically. Polypeptides of less than
about 10 amino acid residues are commonly referred to as
"peptides."
A "protein" is a macromolecule comprising one or
more polypeptide chains. A protein may also comprise non-
peptidic components, such as carbohydrate groups.
Carbohydrates and other non-peptidic substituents may be
added to a protein by the cell in which the protein is
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99122970
13
produced, and will vary with the type of cell. Proteins
are defined herein in terms of their amino acid backbone
structures; substituents such as carbohydrate groups are
generally not specified, but may be present nonetheless.
A peptide or polypeptide encoded by a non-host
DNA molecule is a ''heterologous " peptide or polypeptide.
An "integrated genetic element" is a segment of
DNA that has been incorporated into a chromosome of a host
cell after that element is introduced into the cell
through human manipulation. Within the present invention,
integrated genetic elements are mast commonly derived from
linearized plasrnids that are introduced into the cells by
electroporation or other techniques. Integrated genetic
elements are passed from the original host cell to its
progeny.
A "cloning vector" is a nucleic acid molecule,
such as a plasmid, cosmid, or bacteriophage, that has the
capability of replicating autonomously in a host cell.
Cloning vectors typically contain one or a small number of
restriction endonuclease recognition sites that allow
insertion of a nucleic acid molecule in a determinable
fashion without loss of an essential biological function of
the vector, as well as nucleotide sequences encoding a
marker gene that is suitable for use in the identification
and selection of cells transformed with the cloning vector.
Marker genes typically include genes that provide
tetracycline resistance ar ampicillin resistance.
An "expression vector" is a nucleic acid molecule
encoding a gene that is expressed in a host cell.
Typically, an expression vector comprises a transcription
promoter, a gene, and a transcription terminator. Gene
expression is usually placed under the control of a
promoter, and such a gene is said to be "operably linked
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
14
to" the promoter. Similarly, a regulatory element and a
core promoter are operably linked if the regulatory element
modulates the activity of the core promoter.
A "recombinant host" is a cell that Contains a
heterologous nucleic acid molecule, such as a cloning
vector or expression vector. In the present context, an
example of a recombinant host is a cell that produces
Zsig48 from an expression vector. In contrast, Zsig48 can
be produced by a cell that is a "natural source" of
Zsig48, and that lacks an expression vector.
"Integrative transformants" are recombinant host
cells, in which heterologous DNA has become integrated
into the genomic DNA of the cells.
A "fusion protein" is a hybrid protein expressed
by a nucleic acid molecule comprising nucleotide sequences
of at least two genes. For example, a fusion protein can
comprise at least part of an Zsig48 polypeptide fused with
a polypeptide that binds an affinity matrix. Such a
fusion protein provides a means to isolate large
quantities of Zsig48 using affinity chromatography.
The term "receptor" denotes a cell-associated
protein that binds to a bioactive molecule termed a
"ligand." This interaction mediates the effect of the
ligand on the cell. Receptors can be membrane bound,
cytosolic or nuclear; monomeric (e. g., thyroid stimulating
hormone receptor, beta-adrenergic receptor) or multimeric
(e.g., PDGF receptor, growth hormone receptor, IL-3
receptor, GM-CSF receptor, G-CSF receptor, erythropoietin
receptor and IL-6 receptor). Membrane-bound receptors are
characterized by a mufti-domain structure comprising an
extracellular ligand-binding domain and an intracellular
effector domain that is typically involved in signal
transduction. In certain membrane-bound receptors, the
CA 02344712 2001-03-30
WO 00118796 PCT/US99I22970
extracellular ligand-binding domain and the intracellular
effector domain are located in separate polypeptides that
comprise the complete functional receptor.
5 In general, the binding of ligand to receptor
results in a conformational change in the receptor that
causes an interaction between the effector domain and
other molecules) in the cell, which in turn leads to an
alteration in the metabolism of the cell. Metabolic events
10 that are often linked to receptor-ligand interactions
include gene transcription, phosphorylation,
dephosphorylation, increases in cyclic AMP production,
mobilization of cellular calcium, mobilization of membrane
lipids, cell adhesion, hydrolysis of inositol lipids and
15 hydrolysis of phospholipids.
The term "secretory signal sequence" denotes a
DNA sequence that encodes a peptide (a "secretory
peptide") that, as a component of a larger polypeptide,
directs the larger polypeptide through a secretory pathway
of a cell in which it is synthesized. The larger
polypeptide is commonly cleaved to remove the secretory
peptide during transit through the secretory pathway.
An "isolated polypeptide" is a polypeptide that
is essentially free from contaminating cellular
components, such as carbohydrate, lipid, or other
proteinaceous impurities associated with the polypeptide
in nature. Typically, a preparation of isolated
polypeptide contains the polypeptide in a highly purified
form, i.e., at least about 80o pure, at least about 900
pure, at least about 95% pure, greater than 95% pure, or
greater than 99% pure. One way to show that a particular
protein preparation contains an isolated polypeptide is by
the appearance of a single band following sodium dodecyl
sulfate (SDS)-polyacrylamide gel electrophoresis of the
protein preparation and Coomassie Brilliant Blue staining
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
16
of the gel. However, the term "isolated" does not exclude
the presence of the same polypeptide in alternative
physical forms, such as dimers or alternatively
glycosylated or derivatized forms.
The terms "amino-terminal or N-terminal" and
"carboxyl-terminal or C-terminal" are used herein to
denote positions within polypeptides. Where the context
allows, these terms are used with reference to a
particular sequence or portion of a polypeptide to denote
proximity or relative position. For example, a certain
sequence positioned carboxyl-terminal to a reference
sequence within a polypeptide is located proximal to the
carboxyl terminus of the reference sequence, but is not
necessarily at the carboxyl terminus of the complete
polypeptide.
The term "expression" refers to the biosynthesis
of a gene product. For example, in the case of a
structural gene, expression involves transcription of the
structural gene into mRNA and the translation of mRNA into
one or more polypeptides.
The term "splice variant" is used herein to
denote alternative forms of RNA transcribed from a gene.
Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA
molecule, or less commonly between separately transcribed
RNA molecules, and may result in several mRNAs transcribed
from the same gene. Splice variants may encode
polypeptides having altered amino acid sequence. The term
splice variant is also used herein to denote a polypeptide
encoded by a splice variant of an mRNA transcribed from a
gene.
As used herein, the term "immunomodulator"
includes cytokines, stem cell growth factors,
CA 02344712 2001-03-30
WO OOII8796 PCT/US99122970
I7
lymphotoxins, co-stimulatory molecules, hematopoietic
factors, and synthetic analogs of these molecules.
The term "complement/anti-complement pair"
denotes non-identical moieties that form a non-covalently
associated, stable pair under appropriate conditions. For
instance, biotin and avidin (or streptavidin) are
prototypical members of a complement/anti-complement pair.
Other exemplary complement/anti-complement pairs include
receptor/ligand pairs, antibody/antigen (or hapten ar
epitope) pairs, sense/antisense polynucleotide pairs, and
the like. Where subsequent dissociation of the
complement/anti-complement pair is desirable, the
complement/anti-complement pair preferably has a binding
affinity of less than 109 M-1.
An "anti-idiotype antibody" is an antibody that
binds with the variable region domain of an
immunoglobulin. In the present context, an anti-idiotype
antibody binds with the variable region of an anti-
Zsig48-antibody, and thus, an anti-idiotype antibody
mimics an epitope of Zsig48.
An "antibody fragment" is a portion of an
antibody such as F(ab')2, F(ab)2, Fab', Fab, and the like.
Regardless of structure, an antibody fragment binds with
the same antigen that is recognized by the intact antibody.
For example, a Zsig48 monoclonal antibody fragment binds
with an epitope of Zsig48.
The term "antibody fragment" also includes a
synthetic or a genetically engineered polypeptide that
binds to a specific antigen, such as polypeptides
consisting of the light chain variable region, "Fv"
fragments consisting of the variable regions of the heavy
and light chains, recombinant single chain polypeptide
molecules in which light and heavy variable regions are
CA 02344712 2001-03-30
WO 00118796 PCT/US99/22970
18
connected by a peptide linker ("scFv proteins"), and
minimal recognition units consisting of the amino acid
residues that mimic the hypervariable region.
A "chimeric antibody" is a recombinant protein
that contains the variable domains and complementary
determining regions derived from a rodent antibody, while
the remainder of the antibody molecule is derived from a
human antibody.
"Humanized antibodies" are recombinant proteins
in which murine complementarity determining regions of a
monoclonal antibody have been transferred from heavy and
light variable chains of the murine immunoglobulin into a
human variable domain.
As used herein, a "therapeutic agent" is a
molecule or atom which is conjugated to an antibody moiety
to produce a conjugate which is useful for therapy.
Examples of therapeutic agents include drugs, toxins,
immunomodulators, chelators, boron compounds, photoactive
agents or dyes, and radioisotopes.
A "detectable label" is a molecule or atom which
can be conjugated to an antibody moiety to produce a
molecule useful for diagnosis. Examples of detectable
labels include chelators, photoactive agents,
radioisotopes, fluorescent agents, paramagnetic ions, or
other marker moieties.
The term "affinity tag" is used herein to denote
a polypeptide segment that can be attached to a second
polypeptide to provide for purification or detection of
the second polypeptide or provide sites for attachment of
the second polypeptide to a substrate. In principal, any
peptide or protein for which an antibody or other specific
binding agent is available can be used as an affinity tag.
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
19
Affinity tags include a poly-histidine tract, protein A
(Nilsson et al., EMBD J. 4:1075 (1985); Nilsson et al.,
Methods Enzymol. 198:3 (1991)), glutathione S transferase
(Smith and Johnson, Gene 67:31 (1988)), Glu-Glu affinity
tag (Grussenmeyer et al., Proc. Natl. Acad. Sc.i. USA
82:7952 (1985)), substance P, FLAG peptide (Hopp et al.,
Biotechnology 6:1204 (1988)), streptavidin binding
peptide, or other antigenic epitope or binding domain.
See, in general, Ford et al., Protein Expression and
Purification 2:95 (1991). DNAs encoding affinity tags are
available from commercial suppliers (e. g., Pharmacia
Biotech, Piscataway, NJ).
A "naked antibody" is an entire antibody, as
opposed to an antibody fragment, which is not conjugated
with a therapeutic agent. Naked antibodies include both
polyclonal and monoclonal antibodies, as well as certain
recombinant antibodies, such as chimeric and humanized
antibodies.
As used herein; the term "antibody component"
includes both an entire antibody and an antibody fragment.
An "immunoconjugate" is a conjugate of an
antibody component with a therapeutic agent or a
detectable label.
As used herein, the term "antibody fusion
protein" refers to a recombinant molecule that comprises
an antibody component and a therapeutic agent. Examples
of therapeutic agents suitable for such fusion proteins
include immunomadulators ("antibody-immunomodulator fusion
protein") and toxins ("antibody-toxin fusion protein").
A "tumor associated antigen" is a protein
normally not expressed, or expressed at lower levels, by a
normal counterpart cell. Examples of tumor associated
CA 02344712 2001-03-30
WO 00118796 PCT/US99122970
antigens include alpha-fetoprotein., carcinoembryonic
antigen, and Her-2/neu. Many other illustrations of tumor
associated antigens are known to those of skill in the
art. See, for example, Urban et al.; Ann. Rev. Immunol.
5 10:617 11992).
As used herein, an "infectious agent" denotes
both microbes and parasites. A "microbe" includes
viruses, bacteria, rickettsia, mycoplasma, protozoa, fungi
10 and like microorganisms. A "parasite" denotes infectious,
generally microscopic or very small multicellular
invertebrates, ar ova or juvenile forms thereof, which are
susceptible to immune-mediated clearance or lytic or
phagocytic destruction, such as malarial parasites,
15 spirochetes, and the like.
An "infectious agent antigen" is an antigen
associated with an infectious agent.
20 A "target polypeptide" or a "target peptide" is
an amino acid sequence that comprises at least one
epitope, and that is expressed on a target cell, such as a
tumor cell, or a cell that carries an infectious agent
antigen. T cells recognize peptide epitopes presented by
a major histocompatibility complex molecule to a target
polypeptide or target peptide and typically lyre the
target cell or recruit other immune cells to the site of
the target cell, thereby killing the target cell.
An "antigenic peptide" is a peptide which will
bind a major histocompatibility complex molecule to form
an MHC-peptide complex which is recognized by a T cell,
thereby inducing a cytotoxic lymphocyte response upon
presentation to the T cell. Thus, antigenic peptides are
capable of binding to an appropriate major
histocompatibility complex molecule and inducing a
cytotoxic T cells response, such as cell lysis or specific
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22974
21
cytokine release against the target cell which binds or
expresses the antigen. The antigenic peptide can be bound
in the context of a class I or class II major
histocompatibility complex molecule, on an antigen
presenting cell or on a target cell.
In eukaryotes, RNA polymerase II catalyzes the
transcription of a structural gene to produce mRNA. A
nucleic acid molecule can be designed to contain an RNA
polymerase II template in which the RNA transcript has a
sequence that is complementary to that of a specific mRNA.
The RNA transcript is termed an "anti-sense RNA" and a
nucleic acid molecule that encodes the anti-sense RNA is
termed an "anti-sense gene." Anti-sense RNA molecules are
capable of binding to mRNA molecules, resulting in an
inhibition of mRNA translation.
An "anti-sense oligonucleotide specific for
Zsig48" or an "Zsig48 anti-sense oligonucleotide" is an
oligonucleotide having a sequence (a) capable of forming a
stable triplex with a portion of a Zsig48 gene, or (b)
capable of forming a stable duplex with a portion of an
mRNA transcript of the Zsig48 gene.
A "ribozyme" is a nucleic acid molecule that
contains a catalytic center. The term includes RNA
enzymes, self-splicing RNAs, self-cleaving RNAs, and
nucleic acid molecules that perform these catalytic
functions. A nucleic acid molecule that encodes a
ribozyme is termed a "ribozyme gene."
An "external guide sequence" is a nucleic acid
molecule that directs the endogenous ribozyme, RNase P, to
a particular species of intracellular mRNA, resulting in
the cleavage of the mRNA by RNase P. A nucleic acid
molecule that encodes an external guide sequence is termed
an "external guide sequence gene."
CA 02344712 2001-03-30
WO OOI18796 PCT/US99122970
22
The term "variant human Zsig48 gene" refers to
nucleic acid molecules that encode a polypeptide having an
amino acid sequence that is a modification of SEQ ID N0:2.
Such variants include naturally-occurring polymorphisms of
Zsig48 genes, as well as synthetic genes that contain
conservative amino acid substitutions of the amino acid
sequence of SEQ ID NOs:2, 3, 4 or 5. Additional variant
forms of Zsig48 genes are nucleic acid molecules that
contain insertions or deletions of the nucleotide
sequences described herein. A variant Zsig48 gene can be
identified by determining whether the gene hybridizes with
a nucleic acid molecule having the nucleotide sequence of
SEQ ID N0:1, or its complement, under stringent
conditions.
Alternatively, variant Zsig48genes can be
identified by sequence comparison. Two amino acid
sequences have !'1000 amino acid sequence identity" if the
amino acid residues of the two amino acid sequences are
the same when aligned for maximal correspondence.
Similarly, two nucleotide sequences have "1000 nucleotide
sequence identity" if the nucleotide residues of the two
nucleotide sequences are the same when aligned for maximal
correspondence. Sequence comparisons can be performed
using standard software programs such as those included in
the LASERGENE bioinformatics computing suite, which is
produced by DNASTAR (Madison, Wisconsin). Other methods
for comparing two nucleotide or amino acid sequences by
determining optimal alignment are well-known to those of
skill in the art (see, for example, Peruski and Peruski,
The Internet and the New Biology: Tools for Genomic and
Molecu3ar Research (ASM Press, Inc. 1997), Wu et al.
(eds.), "Information Superhighway and Computer Databases
of Nucleic Acids and Proteins," in Methods in Gene
Biotechnology, pages 123-151 (CRC Press, Inc. 1997), and
Bishop (ed.), Guide to Human Genome Computing, 2nd Edition
CA 02344712 2001-03-30
WO 00/I8796 PCT/US99/22970
23
(Academic Press, Inc. 1998)). Particular methods for
determining sequence identity are described below.
Regardless of the particular method used to
identify a variant Zsig48 gene or variant Zsig48
polypeptide, a variant gene or polypeptide encoded by a
variant gene is functionally characterized by its ability
to bind specifically to an anti-Zsig48 antibody.
The term "allelic variant" is used herein to
denote any of two or mare alternative forms of a gene
occupying the same chromosomal locus. Allelic variation
arises naturally through mutation, and may result in
phenotypic polymorphism within populations. Gene
mutations can be silent (no change in the encoded
polypeptide) or may encode polypeptides having altered
amino acid sequence.
The term "ortholog" denotes a polypeptide or
protein obtained from one species that is the functional
counterpart of a polypeptide or protein from a different
species. Sequence differences among orthologs are the
result of speciation.
"Paralogs" are distinct but structurally related
proteins made by an organism. Paralogs are believed to
arise through gene duplication. For example, a,-globin, ~i-
globin, and myoglobin are paralogs of each other.
Due to the imprecision of standard analytical
methods, molecular weights and lengths of polymers are
understood to be approximate values. When such a value is
expressed as "about" X or "approximately" X, the stated
value of X will be understood to be accurate to +100.
CA 02344712 2001-03-30
WO 00118796 PCT/U599/22970
24
Introduction
Zsig48 as shown in SEQ ID N0:2 has a single
disulfide bond between the cysteine residue 48 and
cysteine residue 81, and an amphiphilic helix, i.e. a
helix which contains both a hydrophilic and a hydrophobic
face, from amino acid residue 88, a proline., to amino acid
residue 105, a histidine of SEQ ID N0:2. Thus, the
structure of Zsig48, especially the C-terminal helix
suggests that Zsig48 may be a peptide ligand for the G-
protein coupled 7-transmembrane domain tTMD) class of
receptors. G-protein -linked receptors act indirectly to
regulate the activity of a separate plasma membrane-bound
target protein, which can be an enzyme or an ion channel.
The interaction between the receptor and the target
protein is mediated by a third protein, called a trimeric
GTP-binding regulatory protein, i.e. a G protein. Thus,
Zsig48 binds to its G-protein coupled 7-TMD receptor. The
receptor then converts this extracellular event into one
or intracellular signals that alter the behavior of the
target cell. Accordingly, general utility claims for
ligands of this receptor class would be applicable for
Zsig48. These would include: alteration of cellular
metabolism and secretion, ion transport, cell
proliferation, differentiation.
It has been determined that Zsig48 is highly
expressed in the heart, placenta, and kidney. That Zsig48
is highly expressed in the placenta would suggests that
the polypeptide may function in fetal development directly
or indirectly by providing support functions to the
placenta such as blood vessel development or the transport
of metabolites. Transcript appearance in the heart further
suggests that Zsig48 may be important as a autocrine or
paracrine regulator of myocardial function. It has been
CA 02344712 2001-03-30
WO 00/1f796 PCTIUS99/22970
further determined by RT-PCR that Zsig48 is expressed in
leukocytes.
Example 3 below shows that Zsig48 can be used
5 to promote proliferation of leukocytes in an individual.
Production of the Human Zsig48 Gene
Polynucleotides, generally a cDNA sequence, of
the present invention encode the described polypeptides
10 herein. A cDNA sequence which encodes a polypeptide of
the present invention is comprised of a series of codons,
each amino acid residue of the polypeptide being encoded
by a codon and each codon being comprised of three
nucleotides. The amino acid residues axe encoded by their
15 respective codons as follows.
Alanine (Ala) is encoded by GCA, GCC, GCG or
GCT;
Cysteine (Cys) is encoded by TGC or TGT;
20 Aspartic acid (Asp) is encoded by GAC or GAT;.
Glutamic acid (Glu) is encoded by GAA or GAG;
Phenylalanine {Phe) is encoded by TTC or TTT;
Glycine (Gly) is encoded by GGA, GGC, GGG or
GGT;
25 Histidine (His) is encoded by CAC or CAT;
Isoleucine {Ile) is encoded by ATA, ATC or ATT;
Lysine {Lys) is encoded by AAA, or AAG;
Leucine (Leu) is encoded by TTA, TTG, CTA, CTC,
CTG or CTT;
Methionine (Met) is encoded by ATG;
Asparagine (Asn) is encoded by AAC or AAT;
Proline (Pro) is encoded by CCA, CCC, CCG or
CCT;
Glutamine (Gln) is encoded by CAA or CAG;
Arginine {Arg) is encoded by AGA, AGG, CGA, CGC,
CGG or CGT;
CA 02344712 2001-03-30
WO 00118796 PCT/US99/22970
26
Serine (Ser) is encoded by AGC, AGT, TCA, TCC,
TCG or TCT;
Threonine (Thr) is encoded by ACA, ACC, ACG or
ACT;
Valine (Val) is encoded by GTA, GTC, GTG or GTT;
Tryptophan (Trp) is encoded by TGG; and
Tyrosine (Tyr) is encoded by TAC or TAT.
It is to be recognized that according to the
present invention, when a polynucleotide is claimed as
described herein, it is understood that what is claimed
are both the sense strand, the anti-sense strand, and the
DNA as double-stranded having both the sense and anti-
sense strand annealed together by their respective
hydrogen bonds. Also claimed is the messenger RNA (mRNA)
which encodes the polypeptides of the president invention,
and which mRNA is encoded by the cDNA described herein.
Messenger RNA (mRNA) will encode a polypeptide using the
same codons as those defined herein, with the exception
that each thymine nucleotide (T) is replaced by a uracil
nucleotide (U) .
Nucleic acid molecules encoding a human Zsig48
gene can be obtained by screening a human cDNA or genomic
library using polynucleotide probes based upon SEQ ID
N0:1. These techniques are standard and well-established.
As an illustration, a nucleic acid molecule that
encodes a human Zsig48 gene can be isolated from a human
cDNA library. In this case, the first step would be to
prepare the cDNA library by isolating RNA from placenta,
kidney, leukocytes or heart tissue using methods well-known
to those of skill in the art. In general, RNA isolation
techniques must provide a method for breaking cells, a
means of inhibiting RNase-directed degradation of RNA, and
a method of separating RNA from DNA, protein, and
polysaccharide contaminants. For example, total RNA can be
CA 02344712 2001-03-30
WO 00/1879b PCT/US99I22970
27
isolated by freezing tissue in liquid nitrogen, grinding
the frozen tissue with a mortar and pestle to lyse the
cells, extracting the ground tissue with a solution of
phenol/chloroform to remove proteins, and separating RNA
from the remaining impurities by selective precipitation
with lithium chloride (see, for example, Ausubel et a1.
(eds.), Short Protocols in Molecular Biology, 3rd Edition,
pages 4-1 to 4-6 (John Wiley & Sans 1995) ("Ausubel
(1995)"l; Wu et al., Methods in Gene Biotechnology, pages
33-41 (CRC Press, Inc. 1997) ["Wu (1997)"J).
Alternatively, total RNA can be isolated from
placental, leukocyte, kidney or heart tissue by extracting
ground tissue with guanidinium isothiocyanate, extracting
with organic solvents, and separating RNA from contaminants
using differential centrifugation (see, for example,
Chirgwin et al., Biochemistry .18:52 (1979); Ausubel (1995)
at pages 4-1 to 4-6; Wu (1997) at pages 33-41).
In order to construct a cDNA library, poly(A)+
RNA must be isolated from a total RNA preparation. Poly(A)+
RNA can be isolated from total RNA using the standard
technique of oligo(dT)-cellulose chromatography (see, for
example, Aviv and Leder, Proc. Nat'Z Acad. Sci. USA
69:1408 (1972); Ausubel (1995) at pages 4-11 to 4-12).
Double-stranded cDNA molecules are synthesized
from poly(A)+ RNA using techniques well-known to those in
the art. (see, for example, Wu (1997) at pages 41-46).
Moreover, commercially available kits can be used to
synthesize double-stranded cDNA molecules. For example,
such kits are available from Life Technologies, Inc.
(Gaithersburg, MD), CLONTECH Laboratories, Inc. (Palo
Alto, CA), Promega Corporation (Madison, WI) and
STRATAGENE (La Jolla, CA).
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
28
Various cloning vectors are appropriate for the
construction of a cDNA library. For example, a cDNA
library can be prepared in a vector derived from
bacteriophage, such as a ~,gtl0 vector. See, for example,
Huynh et a.~., "Constructing and Screening cDNA Libraries
in ~,gtl0 and ~,gtll, " in DNA Cloning: A Practica3 Approach
VoI. 1, Glover (ed.), page 49 (IRL Press, 1985); Wu (1997)
at pages 47-52. .
Alternatively, double-stranded cDNA molecules can
be inserted into a plasmid vector, such as a pBLUESCRIPT
vector (STRATAGENE; La Jolla, CA}, a LAMDAGEM-4 (Promega
Corp.) or other commercially available vectors. Suitable
cloning vectors also can be obtained from the American Type
Culture Collection (Manassas, VA).
To amplify the cloned cDNA molecules, the cDNA
library is inserted into a prokaryotic host, using standard
techniques. For example, a cDNA library can be introduced
into competent E. coli DH5 cells, which can be obtained,
for example, from Life Technologies, Inc. (Gaithersburg,
MD ) .
A human genomic library can be prepared by means
well-known in the art (see, for example, Ausubel (1995) at
pages 5-1 to 5-6; Wu (1997) at pages 307-327). Genomic DNA
can be isolated by lysing tissue with the detergent
Sarkosyl, digesting the lysate with proteinase K, clearing
insoluble debris from the lysate by centrifugation,
precipitating nucleic acid from the lysate using
isopropanol, and purifying resuspended DNA on a cesium
chloride density gradient.
DNA fragments that are suitable for the
production of a genomic library can be obtained by the
random shearing of genomic DNA or by the partial digestion
of genomic DNA with restriction endonucleases. Genomic DNA
CA 02344712 2001-03-30
WO 00!18796 PCTlUS99122970
29
fragments can be inserted into a vector, such as a
bacteriophage or cosmid vector, in accordance with
conventional techniques, such as the use of restriction
enzyme digestion to provide appropriate termini, the use of
alkaline phosphatase treatment to avoid undesirable joining
of DNA molecules, and ligation with appropriate ligases.
Techniques for such manipulation are well-known in the art
(see, for example, Ausubel (1995) at pages 5-1 to 5-6; Wu
(1997) at pages 30?-327).
Nucleic acid molecules that encode a human
Zsig48 gene can also be obtained using the polymerase
chain reaction (PCR) with oligonucleotide primers having
nucleotide sequences that are based upon the nucleotide
sequences of the human Zsig48 gene, as described herein.
General methods for screening libraries with PCR are
provided by, for example, Yu et al., "Use of the
Polymerase Chain Reaction to Screen Phage Libraries," in
Methods in Mo~ecu3ax~ Biology, Vnl. 25: PCR Protoco.Is:
Current Methods and Applications, White (ed.), pages 211-
215 (Humana Press, Inc. 1993). Moreover, techniques for
using PCR to isolate related genes are described by, for
example, Preston, "Use of Degenerate Oligonucleotide
Primers and the Polymerase Chain Reaction to Clone Gene
Family Members," in Methods in MoZecu~ar Biology, VoI. ~5:
PCR Protocols: Current Methods and Applications, White
(ed.), pages 317-337 (Humana Press, Inc. 1993).
Alternatively, human genomic libraries can be obtained from
commercial sources such as Research Genetics (Huntsville,
AL) and the American Type Culture Collection (Manassas,
VA). A library containing cDNA or genomic clones can be
screened with one or more polynucleotide probes based upon
SEQ ID NO:1, using standard methods (see, for example,
Ausubel (1995) at pages 6-1 to 6-11).
Anti-~sig48 antibodies, produced as described
below, can also be used to isolate DNA sequences that
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
encode human Zsig48 genes from cDNA libraries. For
example, the antibodies can be used to screen ~,gtll
expression libraries, or the antibodies can be used for
immunoscreening following hybrid selection and translation
5 (see, for example, Ausubel (1995) at pages 6-12 to &-16;
Margolis et al., "Screening ~, expression libraries with
antibody and protein probes," in DNA C.~oning 2: Expression
Systems, 2nd Edition, Glover et a1. (eds.), pages 1-14
(Oxford University Press 1995)).
As an alternative, a ZsiggB gene can be obtained
by synthesizing nucleic acid molecules using mutually
priming long oligonucleotides and the nucleotide sequences
described herein (see, for example, Ausubel (1995) at
pages 8-8 to 8-9). Established techniques using the
polymerase chain reaction provide the ability to
synthesize DNA molecules at least two kilobases in length
(Adang et al., Plant Mo~ec. Biol. 21:1131 (1993), Bambot
et al., PCR Methods and Applications 2:266 (1993), Dillon
et al., !'Use of the Polymerase Chain Reaction for the
Rapid Construction of Synthetic Genes," in Methods in
Molecular Biology, Vol. 15: PCR Protoco~.s: Current Methods
and Applications, White (ed.), pages 263-268, (Humana
Press, Inc. 1993), and Holowachuk et al., PCR Methods
Appl. 4:299 (1995)).
The nucleic acid molecules of the present
invention can also be synthesized with "DNA synthesizers"
using protocols such as the phosphoramidite method. If
chemically-synthesized double stranded DNA is required for
an application such as the synthesis of a gene or a gene
fragment, then each complementary strand is made
separately. The production of short genes (60 to 80 base
pairs) is technically straightforward and can be
accomplished by synthesizing the complementary strands and
then annealing them. For the production of longer genes
(>300 base pairs), however, special strategies may be
CA 02344712 2001-03-30
WO 00/18796 PCT/US99I22970
31
required, because the coupling efficiency of each cycle
during chemical DNA synthesis is Seldom 100%. To overcome
this problem, synthetic genes (double-stranded) are
assembled in modular form from single-stranded fragments
that are from 20 to 100 nucleotides in length. Fox reviews
on polynucleotide synthesis, see, for example, Glick and
Pasternak, Molecular Biotechnology, Princip.~es and
Applications of Recombinant DNA (ASM Press 1994), Itakura
et al., Annu. Rev. Biochem. 53:323 (1984), and Climie et
al., Proc. Nat'1 Acad. Sci. USA 87:633 (1990) .
The sequence of a Zsig48 cDNA or Zs.ig48 genomic
fragment can be determined using standard methods.
Moreover, the identification of genomic fragments
containing a Zsig48 promoter or regulatory element can be
achieved using well-established techniques, such as
deletion analysis (see, generally, Ausubel (1995)).
Cloning of 5" flanking sequences also
facilitates production of Zsig48 proteins by '"gene
activation," following the methods disclosed in U.S.
Patent No. 5,&41,670. Briefly, expression of an
endogenous Zsig48 gene in a cell is altered by introducing
into the Zsig48 locus a DNA construct comprising at least
a targeting sequence, a regulatory sequence, an exon, and
an unpaired splice donor site. The targeting sequence is
a Zs.zg48 5' non-coding sequence that permits homologous
recombination of the construct with the endogenous Zsig48
locus, wherein the sequences within the construct become
operably linked with the endogenous Zsig48 coding
sequence. In this way, an endogenous Zsig48 promoter can
be replaced or supplemented with other regulatory
sequences to provide enhanced, tissue-specific, or
otherwise regulated expression.
CA 02344712 2001-03-30
WO 00118796 PCT/US99122970
3z
Production of Zsig48 Gene Variants
The present invention provides a variety of
nucleic acid molecules, including DNA and RNA molecules,
that encode the Zsig48 polypeptides disclosed herein.
Those skilled in the art will readily recognize that, in
view of the degeneracy of the genetic code, considerable
sequence variation is possible among these polynucleotide
molecules.
Different species can exhibit "preferential
codon usage." In general, see, Grantham et al., Nuc.
Acids Res. 8:1893 (1980), Haas et al. Curr. Biol. 6:315
(1996), Wain-Hobson et al., Gene 13:355 (1981), Grosjean
and Fiers, Gene 18:199 (1982), Holm, Nuc. Acids Res.
14:3075 (1986), Ikemura, J. Mol. Biol. 158:573 (1982),
Sharp and Matassi, Curr. Opin. Genet. Dev. 4:851 (1994),
Kane, Curr. Opin. Biotechnol. 6:494 (1995), and Makrides,
Microbiol. Rev. 60:512 (1996). As used herein, the term
"preferential codon usage" or "preferential codons" is a
term of art referring to protein translation codons that
are most frequently used in cells of a certain species,
thus favoring one or a few representatives of the possible
codons encoding each amino acid. For example, the amino
acid Threonine (Thr) may be encoded by ACA, ACC, ACG, or
ACT, but in mammalian cells ACC is the most commonly used
codon; in other species, for example, insect cells, yeast,
viruses or bacteria, different Thr codons may be
preferential. Preferential codons for a particular
species can be introduced into the polynucleotides of the
present invention by a variety of methods known in the
art. Introduction of preferential codon sequences into
recombinant DNA can, for example, enhance production of
the protein by making protein translation more efficient
within a particular cell type or species.
The present invention further provides variant
polypeptides and nucleic acid molecules that represent
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
33
counterparts from other species (orthologs). These
species include, but are not limited to mammalian, avian,
amphibian, reptile, fish, insect and other vertebrate and
invertebrate species. Of particular interest are Zsig48
polypeptides from other mammalian species, including
murine, porcine, ovine, bovine, canine, feline, equine,
and other primate polypeptides. Orthologs of human Zsig48
can be cloned using information and compositions provided
by the present invention in combination with conventional
cloning techniques. For~example, a cDNA can be cloned
using mRNA obtained from a tissue or cell type that
expresses Zsig~8 as disclosed herein. Suitable sources of
mRNA can be identified by probing northern blots with
probes designed from the sequences disclosed herein. A
I5 library is then prepared from mRNA of a positive tissue or
cell line.
A Zsig48-encoding cDNA can be isolated by a
variety of methods, such as by probing with a complete or
partial human cDNA or with onie or more sets of degenerate
probes based on the disclosed sequences. A cDNA can also
be cloned using the polymerase chain reaction with primers
designed from the representative human Zsig48 sequences
disclosed herein. Within an additional method, the cDNA
library can be used to transform or transfect host cells,
and expression of the cDNA of interest can be detected
with an antibody to Zsig48 polypeptide. Similar
techniques can also be applied to the isolation of genomic
clones, and to the isolation of nucleic molecules that
encode murine Zsig48.
Those skilled in the art will recognize that the
sequence disclosed in SEQ ID N0:1 represents a single
allele of human Zsig48, and that allelic variation and
alternative splicing are expected to occur. Allelic
variants of this sequence can be cloned by probing cDNA or
genomic libraries from different individuals according to
CA 02344712 2001-03-30
WO 00/1$796 PCT/US99122970
34
standard procedures. Allelic variants of the nucleotide
sequence shown in SEQ ID N0:1, including those containing
silent mutations and those in which mutations result in
amino acid sequence changes, are within the scope of the
present invention, as are proteins which are allelic
variants of SEQ ID NOs:2, 3, 4 and 5. cDNA molecules
generated from alternatively spliced mRNAs, which retain
the properties of the Zsig48 polypeptide are included
within the scope of the present invention, as are
20 polypeptides encoded by such cDNAs and mRNAs. Allelic
variants and splice variants of these sequences can be
cloned by probing cDNA or genomic libraries from different
individuals or tissues according to standard prbcedures
known in. the art .
Within preferred embodiments of the invention,
isolated nucleic acid molecules that encode human Zsig48
can hybridize to nucleic acid molecules having the
nucleotide sequence of SEQ ID N0:1, or a sequence
complementary thereto, under "stringent conditions." In
general, stringent conditions are selected to be about 5°C
lower than the thermal melting point (Tm) for the specific
sequence at a defined ionic strength and pH. The Tm is
the temperature (under defined ionic strength and pH) at
which 500 of the target sequence hybridizes to a perfectly
matched probe.
As an illustration, a nucleic acid molecule
encoding a variant Zsig48 polypeptide can be hybridized
with a nucleic acid molecule having the nucleotide
sequence of SEQ ID NO:l (or its complement) at 42°C
overnight in a solution comprising 50% formamide, SxSSC
(lxSSC: 0.15 M sodium chloride and 15 mM sodium citrate),
50 mM sodium phosphate (pH 7.5), 5x Denhardt's solution
(100x Denhardt's solution: 2% (w/v} Ficoll 400, 20 (w/v)
polyvinylpyrrolidone, and 2% (w/v) bovine serum albumin),
10% dextran sulfate, and 20 ~g/ml denatured, sheared
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
salmon sperm DNA. One of skill in the art can devise
variations of these hybridization conditions. For
example, the hybridization mixture can be incubated at a
higher temperature, such as about 65°C, in a solution that
5 does not contain formamide. Moreover, premixed
hybridization solutions are available (e: g., EXPRESSHYB
Hybridization Solution from CLONTECH Laboratories, Inc.),
and hybridization can be performed according to the
manufacturer's instructions.
Following hybridization, the nucleic acid
molecules can be washed to remove non-hybridized nucleic
acid molecules under stringent conditions, or under highly
stringent conditions. Typical stringent washing
conditions include washing in a solution of 0.5x - 2x SSC
with 0.1a sodium dodecyl sulfate (SDS) at 55 - 65°C. That
is, nucleic acid molecules encoding a variant Zsig48
polypeptide hybridize with a nucleic acid molecule having
the nucleotide sequence of SEQ ID N0:1 (or its complement)
under stringent washing conditions, in which the wash
stringency is equivalent to 0.5x - 2x SSC with 0.1% SDS at
55 - 65°C, including O.Sx SSC with O.lo SDS at 55°C, or
2xSSC with 0.1o SDS at 65°C. One of skill in the art can
readsly devise equivalent conditions, for example, by
substituting SSPE for SSC in the wash solution.
Typical highly stringent washing conditions
include washing in a solution of 0.1x - 0.2x SSC with 0.1%
sodium dodecyl sulfate (SDS) at 50 - 65°C. In other
words, nucleic acid molecules encoding a variant Zsig48
polypeptide hybridize with a nucleic acid molecule having
the nucleotide sequence of SEQ ID N0:1 (or its complement)
under highly stringent washing conditions, in which the
wash stringency is equivalent to 0.1x - 0.2x SSC with 0.10
SDS at 50 - 65°C, including 0.1x SSC with 0.1% SDS at
50°C, or 0.2xSSC with O.lo SDS at 65°C.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
36
The present invention also provides isolated
Zsig48 polypeptides that have a substantially similar
sequence identity to the polypeptides of SEQ ID N0:2, SEQ
ID N0:5, or their orthologs. The term "substantial3y
similar sequence identity" is used herein to denote
polypeptides having at least 70%, at least 800, at 3east
90%, at least 95% or greater than 95% sequence identity to
the sequences shown in SEQ ID N02:2, 3, 4 and 5; or their
orthologs.
The present invention also contemplates Zsig48
variant nucleic acid molecules that can be identified
using two criteria: a determination of the similarity
between the encoded polypeptide with the amino acid
sequence of SEQ ID N0:2, and a hybridization assay, as
described above. Such Zs.ig48 variants include nucleic
acid molecules (1) that hybridize with a nucleic acid
molecule having the nucleotide sequence of SEQ ID N0:1 (or
its complement) under stringent washing conditions, in
which the wash stringency is equivalent to 0.5x - 2x SSC
with 0.1% SDS at 55 - 65°C, and (2) that encode a
polypeptide having at least 70%, at least 800, at least
90%, at least 95% or greater than 95% sequence identity to
the amino acid sequence of SEQ ID NOs:2, 3, 4 or 5.
Alternatively, Zsig48 variants can be characterized as
nucleic acid molecules (1) that hybridize with a nucleic
acid molecule having the nucleotide sequence of SEQ ID
N0:1 (or its complement) under highly stringent washing
conditions, in which the wash stringency is equivalent to
0.1x - 0.2x SSC with 0.1% SDS at 50 - 65°C, and (2) that
encode a polypeptide having at least 70%, at least 80%, at
least 90%, at least 95% or greater than 95% sequence
identity to the amino acid sequence of SEQ ID NOs:2, 3, 4
or 5.
The present invention also contemplates human
Zsig48 variant nucleic acid molecules identified by at
CA 02344712 2001-03-30
WO 00118796 PCTIUS99l22970
37
least one of hybridization analysis and sequence identity
determination, with reference to SEQ ID NOs:2, 3, 4 or 5.
Percent sequence identity is determined by
conventional methods. See, for example, Altschul et al.,
Bull. Math. Bio. 48:603 (1986), and Henikoff and Henikoff,
Proc. Natl. Acad. Sci. USA 89:10915 (1992). Briefly, two
amino acid sequences are aligned to optimize the alignment
scores using a gap opening penalty of 10, a gap extension
penalty of 1, and the "BLOSUM 62" scoring matrix of
Henikoff and Henikoff (ib.id.) as shown in Table 1(amino
acids are indicated by the standard one-letter codes)
The percent identity is then calculated as: ((Total number
of identical matches]/ [length of the longer sequence plus
the number of gaps introduced into the longer sequence in
order to align the two sequences])(100).
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
38
t
ri N M
r-i a
H tf1 N N O
I I
Ul dt r-I M N N
I I I
~ ~ H ,--~ ~ M N
t I 1 I
G4 tU d' N N f-1 M ri
I t I I
IIt O N rl r-f r-I rl c-I
I I I i I
'x' Lf7 e-I M r-1 O rl M N N
I I I I I I t
a d' N N O M N r-i N rl c-I
t I t t i I
H ~H N M rl O M N rl M rl M
I I I I I I
x 00 M M r-I N rf N ri N N N M
I I I t I I I I I I
L,7 l>5 N d~ dt N M M N O N N M M
t I I i t I I t I I I
W ll1 N O M M r-f N M r-i O c-I M N N
t I I i I I 1 a t I
OI l.n N N O M N rl O M r-I O rl N v-1 N
1 I I I I f 1 I 1
U ~ M dt M M rW -I M r-I N M rl ~-I N N ri
I t I i I I I t I I I I I I I
l4 M O N v-I rl M dt r-I M M i-I O ~-I V~ M M
I a I I t I I I i I t I t
lfl r-i M O O O rl M M O N M N rl O ~ N M
I I I t I I I I I
Lfl O N M c-1 O N O' M N N rl M N v-I s-I M N M
t I t I I I I I s I t I I
t4', dl rl N N O ri r-I O N ~-t ~-I rl r-I N s-I r~ O M N O
I I I I i I I I I i I I I I
~ x z a a a w c~ x H a x ~ w a~ v~ H
~a
H
Ln O In o
r-i rl N
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
39
Those skilled in the art appreciate that there
are many established algorithms available to align two
amino acid sequences. The "FASTA" similarity search
algorithm of Pearson and Lipman is a suitable protein
alignment method for examining the level of identity
shared by an amino acid sequence disclosed herein and the
amino acid sequence of a putative Zsig48 variant. The
FASTA algorithm is described by Pearson and Lipman, Proc.
Nat~1 Acad. Sci: USA 85:2444 (1988), and by Pearson, Meth.
Enzymol. 183:63 (1990). Briefly, FASTA first
characterizes sequence similarity by identifying regions
shared by the query sequence (e.g., SEQ ID N0:2) and a
test sequence that have either the highest density of
identities (if the ktup variable is 1) or pairs of
identities (if ktup=2), without considering conservative
amino acid substitutions, insertions, or deletions. The
ten regions with the highest density of identities are
then re-scored by comparing the similarity of all paired
amino acids using an amino acid substitution matrix, and
the ends of the regions are "trimmed" to include only
those residues that contribute to the highest score. If
there are several regions with scores greater than the
"cutoff" value (calculated by a predetermined formula
based upon the length of the sequence and the ktup value),
then the trimmed initial regions are examined to determine
whether the regions can be joined to form an approximate
alignment with gaps. Finally, the highest scoring regions
of the two amino acid sequences are aligned using a
modification of the Needleman-Wunsch-Sellers algorithm
(Needleman and Wunsch, J. MoI. Biol. 48:444 (1970);
Sellers, SIAM J. Appl. Math. 26:787 (1974)), which allows
for amino acid insertions and deletions. Illustrative
parameters for FASTA analysis are: ktup=1, gap opening
penalty=10, gap extension penalty=1, and substitution
matrix=BLOSUM62. These parameters can be introduced into
a FASTA program by modifying the scoring matrix file
CA 02344712 2001-03-30
WO OO/I8796 PCT/US99/22970
("SMA.TRIX"), as explained in Appendix 2 of Pearson, Meth.
Enzymol. 183:63 (1990).
FASTA can also be used to determine the sequence
5 identity of nucleic acid molecules using a ratio as
disclosed above. For nucleotide sequence comparisons, the
ktup value can range between one to six, preferably from
three to six, most preferably three, with other parameters
set as described above.
The present invention includes nucleic acid
molecules that encode a polypeptide having a conservative
amino acid change, compared with the amino acid sequence
of SEQ ID NOs:2, 3, 4 or 5. That is, variants can be
obtained that contain one or more amino acid substitutions
of SEQ ID NOs:2, 3, 4 or 5, in which an alkyl amino acid
is substituted for an alkyl amino acid in an Zsig48 amino
acid sequence, an aromatic amino acid is substituted for
an aromatic amino acid in an Zsig48 amino acid sequence, a
sulfur-containing amino acid is substituted for a sulfur-
containing amino acid in an Zsig48 amino acid sequence, a
hydroxy-containing amino acid is substituted for a
hydroxy-containing amino acid in an Zsig48 amino acid
sequence, an acidic amino acid is substituted for an
acidic amino acid in a Zsig48 amino acid sequence, a basic
amino acid is substituted for a basic amino acid in a
Zsig48 amino acid sequence, or a dibasic monocarboxylic
amino acid is substituted for a dibasic monocarboxylic
amino acid in an Zsig48 amino acid sequence.
Among the common amino acids, for example, a
"conservative amino acid substitution" is illustrated by a
substitution among amino acids within each of the
following groups: (1) glycine, alanine, valine, leucine;
and isoleucine, (2) phenylalanine, tyrosine, and
tryptophan, (3) serine and threonine, (4) aspartate and
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
41
glutamate, (5) glutamine and asparagine, and (6) lysine,
arginine and histidine.
Table 2
Conservative amino acid substitutions
Basic: arginine
lysine
histidine
Acidic: glutamic acid
aspartic acid
Polar: glutamine
asparagine
Hydrophobic: leucine
isoleucine
valine
Aromatic: phenylalanine
tryptophan
tyrosine
Small: glycine
alanine
serine
threonine
methionine
The BLOSUM62 table is an amino acid substitution
matrix derived from about 2,000 local multiple alignments
of protein sequence segments, representing highly
conserved regions of more than 500 groups of related
proteins (Henikoff and Henikoff, Proc. Nat'1 Acad. Sci.
USA 89:10915 (1992)). Accordingly, the BLOSUM62
substitution frequencies can be used to define
conservative amino acid substitutions that may be
introduced into the amino acid sequences of the present
CA 02344712 2001-03-30
WO 00/1$796 PCT/US99/22970
42
invention. Although it is possible to design amino acid
substitutions based solely upon chemical properties (as
discussed above). the language "conservative amino acid
substitution" preferably refers to a substitution
represented by a BLOSUM62 value of greater than. -1. For
example, an amino acid substitution is conservative if the
substitution is characterized by a BLOSUM62 value of 0,
1, 2, or 3. According to this system, preferred
conservative amino acid substitutions are characterized by
a BLOSUM62 value of at least 1 (e. g., 1, 2 or 3), while
more preferred conservative amino acid substitutions are
characterized by a BLOSUM62 value of at least 2 (e:g., 2
or 3 ) .
Particular variants of human Zsig48 are
characterized by having at least 70%, at least 80%, at
least 90%, at least 95% or greater than 95% sequence
identity to the corresponding human (i.e., SEQ ID NOs: 2,
3, 4 or 5) amino acid sequences, wherein the variation in
amino acid sequence is due to one or more conservative
amino acid substitutions.
Conservative amino acid changes in an Zsig48
gene can be introduced by substituting nucleotides for the
nucleotides recited in SEQ ID NO: 1. Such "conservative
amino acid" variants can be obtained, for example, by
oligonucleotide-directed mutagenesis, linker-scanning
mutagenesis, mutagenesis using the polymerase chain
reaction, and the like (see Ausubel (1995) at pages 8-10
to 8-22; and McPherson (ed.), Directed Mutagenesis: A
Practical Approach (IRL Press 1991)). The ability of such
variants to promote proliferation of T-cells, B-cells or
monocytes using a standard method, such as the assay
described herein. Alternatively, a variant Zsig48
polypeptide can be identified by the ability to
specifically bind anti- Zsig48 antibodies.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
43
The proteins of the present invention can also
comprise non-naturally occurring amino acid residues.
Non-naturally occurring amino acids include, without
limitation, trans-3-methylproline, 2,4-methanoproline,
cis-4-hydroxyproline, trans-4-hydroxyproline, N-
methylglycine, allo-threonine, methylthreonine,
hydroxyethylcysteine, hydroxyethylhomocysteine,
nitroglutamine, homoglutamine, pipecolic acid,
thiazolidine carboxylic acid, dehydroproline, 3- and 4-
methylproline, 3,3-dimethylproline, tert-leucine,
norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-
azaphenylalanine, and 4-fluorophenylalanine. Several
methods are known in the art for incorporating non-
naturally occurring amino acid residues into proteins.
For example, an in vitro system can be employed wherein
nonsense mutations are suppressed using chemically
aminoacylated suppressor tRNAs. Methods for synthesizing
amino acids and amirioacylating tRNA are known in the art.
Transcription and translation of plasmids containing
nonsense mutations is typically carried out in a cell-free
system comprising an E. coli S30 extract and commercially
available enzymes and other reagents. Proteins are
purified by chromatography. See, for example, Robertson
et al., J. Am. Chem. Soc. 113:2722 (1991), Ellman et al.,
Methods Enzymol. 202:301 (1991), Chung et al., Science
259:806 (1993), and Chung et al., Proc. Nat'1 Acad. Sci.
USA 90 :1014 5 ( 19 93 } .
In a second method, translation is carried out
in Xenopus oocytes by microinjection of mutated mRNA and
chemically aminoacylated suppressor tRNAs (Turcatti et
al., J. Biol. Chem. 271:19991 (1996)). Within a third
method, E. coli cells are cultured in the absence of a
natural amino acid that is to be replaced (e. g.,
phenylalanine) and in the presence of the desired non-
naturally occurring amino acids) (e.g., 2-
azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine,
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99I22970
as
or 4-fluorophenylalanine). The non-naturally occurring
amino acid is incorporated into the protein in place of
its natural counterpart. See, Koide et al., Biochem.
33:7470 (1994). Naturally occurring amino acid residues
can be converted to non-naturally occurring species by in
vitro chemical modification. Chemical modification can be
combined with site-directed mutagenesis to further expand
the range of substitutions (Wynn and Richards, Protein
Sci. 2:395 (1993)).
A limited number of non-conservative amino
acids, amino acids that are not encoded by the genetic
code, non-naturally occurring amino acids, and unnatural
amino acids may be substituted far Zsig48 amino~acid
residues.
Essential amino acids in the polypeptides of the
present invention can be identified according to
procedures known in the art, such as site-directed
mutagenesis or alanine-scanning mutagenesis [Cunningham
and Wells, Science 244:1081 (1989), Bass et al., Proc.
Nat'1 Acad. Sci. USA 88:4498 (1991), Coombs and Corey,
"Site-Directed Mutagenesis and Protein Engineering," in
Proteins: Analysis and Design, Angeletti (ed.), pages 259-
311 (Academic Press, Inc. 1998)]. In the latter
technique, single alanine mutations are introduced at
every residue in the molecule, and the resultant mutant
molecules are tested for biological activity as disclosed
below to identify amino acid residues that are critical to
the activity of the molecule. See also, Hilton et al., J.
Biol. Chem. 27I:4&99 (2996). Sequence analysis can also
identify motifs that reside within human Zsig48
polypeptides.
Although sequence analysis can be used to
identify Zsig48 ligand binding sites, the location of
Zsig48 ligand binding domains can also be determined by
CA 02344712 2001-03-30
WO 00!18796 PCT/US99/22970
physical analysis of structure, as determined by such
techniques as nuclear magnetic resonance, crystallography,
electron diffraction or photoaffinity labeling, in
conjunction with mutation of putative contact site amino
5 acids. See, for example, de Vos et al., Science 255:306
(1992}, Smith et al., J. Mol. Biol. 224:899 (1992), and
Wlodaver et al., FEBS Lett. 309:59 (1992). Moreover,
Zsig48 labeled with biotin or FITC can be used for
expression cloning of Zsig48 ligand.
Multiple amino acid substitutions can be made
and tested using known methods of mutagenesis and
screening, such as those disclosed by Reidhaar-Olson and
Sauer (Science 241:53 (1988)) or Bowie and Sauer (Proc.
Nat'1 Acad. Sc.i. USA 86:2152 (1989) ) . Briefly, these
authors disclose methods for simultaneously randomizing
two or mare positions in a polypeptide, selecting for
functional polypeptide, arid then sequencing the
mutagenized polypeptides to determine the spectrum of
allowable substitutions at each position. Other methods
that can be used include phage display (e.g., Lowman et
al., Biochem. 30:10832 (1991), Ladner et al., U.S. Patent
No. 5,223,409, Huse, international publication No. WO
92/06204, and region-directed mutagenesis {Derbyshire et
al., Gene 46:145 (1986), and Ner et al., DNA 7:127,
(1988) ) .
Variants of the disclosed Zsig48 nucleotide and
polypeptide sequences can also be generated through DNA
shuffling as disclosed by Stemmer, Nature 370:389 (1994),
Stemmer, Proc. Nat'1 Acad. Sci. USA 9.1:10747 {1994), and
international publication No. WO 97/20078. Briefly,
variant DNAs are generated by in vitro homologous
recombination by random fragmentation of a parent DNA
followed by reassembly using PCR, resulting in randomly
introduced point mutations. This technique can be
modified by using a family of parent DNAs, such as allelic
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
46
variants or DNAs from different species, to introduce
additional variability into the process. Selection or
screening for the desired activity, followed by additional
iterations of mutagenesis and assay provides for rapid
"evolution" of sequences by selecting for desirable
mutations while simultaneously selecting against
detrimental changes.
Mutagenesis methods as disclosed herein can be
combined with high-throughput, automated screening methods
to detect activity of cloned, mutagenized polypeptides in
host cells. Mutagenized DNA molecules that encode
biologically active polypeptides, or polypeptides that
bind with anti-Zsig48 antibodies, can be recovered from
the host cells and rapidly sequenced using modern
equipment. These methods allow the rapid determination of
the importance of individual amino acid residues in a
polypeptide of interest, and can be applied to
polypeptides of unknown structure.
The present invention also includes "functional
fragments" of Zsig48 polypeptides and nucleic acid
molecules encoding such functional fragments. Routine
deletion analyses of nucleic acid molecules can be
performed to obtain functional fragments of a nucleic acid
molecule that encodes a Zsig48 polypeptide. As an
illustration, DNA molecules having the nucleotide sequence
of SEQ ID N0:1 can be digested with Ba131 nuclease to
obtain a series of nested deletions. One alternative to
exonuclease digestion is to use oligonucleotide-directed
mutagenesis to introduce deletions or stop codons to
specify production of a desired fragment. Alternatively,
particular fragments of a Zsig48 gene can be synthesized
using the polymerase chain reaction.
The present invention also contemplates
functional fragments of a Zsig48 gene that has amino acid
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
47
changes, compared with the amino acid sequence of SEQ ID
N0:2. A variant Zsig48 gene can be identified on the
basis of structure by determining the level of identity
with nucleotide and amino acid sequences of SEQ ID NOs:
2,3, 4 or 5 as discussed above. An alternative approach
to identifying a variant gene on the basis of structure is
to determine whether a nucleic acid molecule encoding a
potential variant Zsig48 gene can hybridize to a nucleic
acid molecule having the nucleotide sequence of SEQ ID
NO:1, as discussed above.
The present invention also provides polypeptide
fragments or peptides comprising an [-bearing portion of a
Zsig48 polypeptide described herein. Such fragments or
peptides may comprise an "immunogenic epitope," which is a
part of a protein that elicits an antibody response when
the entire protein is used as an immunogen. Immunogenic
epitope-bearing peptides can be identified using standard
methods (see, for example, Geysen et al., Proc. .Nat'1
Acad. Sci. USA 81:3998 (1983)] Examples of such epitopes
(determined by Jameson-Wolf method, DNAstar described
below) are a polypeptide comprised of amino acid residue
38, a serine to and including amino acid residue 57, a
threonine, of SEQ ID N0:2 also defined by SEQ ID N0:8; a
polypeptide comprised of amino acid residue 38, a serine,
to and including amino acid residue 79, a threonine, of
SEQ ID N0:2, also defined by SEQ ID N0:9; a polypeptide
comprised of amino acid residue 38, a serine, to and
including amino acid residue 102, a serine,of SEQ ID N0:2
also defined by SEQ ID N0:10; a polypeptide comprised of
amino acid residue 60~, a threonine, to and including amino
acid residue 79, a threonine, of SEQ TD N0:2 also defined
by SEQ ID N0:11; and a polypeptide comprised of amino acid
residue 60, a threonine, to and including amino acid
residue 102, a serine of SEQ ID N0:2, also defined by SEQ
ID N0:12.
CA 02344712 2001-03-30
WO OO/I8796 PCTIUS99/22970
In contrast, polypeptide fragments ar peptides
may comprise an "antigenic epitope," which is a region of
a protein molecule to which an antibody can specifically
bind. Certain epitopes consist of a linear or contiguous
stretch of amino acids, and the antigenicity of such an
epitope is not disrupted by denaturing agents. It is known
in the art that relatively short synthetic peptides that
can mimic epitopes of a protein can be used to stimulate
the production of antibodies against the protein (see, for
example, Sutcliffe et al., Science 219:660 (1983)).
Accordingly, antigenic epitope-bearing peptides and
polypeptides of the present invention axe useful to raise
antibodies that bind with the palypeptides described
herein.
Antigenic epitope-bearing peptides and
polypeptides preferably contain at least four to ten amino
acids, at least ten to fifteen amino acids, or about 15 to
about 30 amino acids of SEQ ID N0:2. Such epitope-bearing
peptides and polypeptides can be produced by fragmenting a
Zsig48 polypeptide, or by chemical peptide synthesis, as
described herein. Moreover, epitopes can be selected by
phage display of random peptide libraries (see, for
example, Lane and Stephen, Curr. Opin. Immunol. 5:268
(1993), and Cortese et al., Curr. Opin. Biotechnol. 7:616
(1996)). Standard methods for identifying epitopes and
producing antibodies from small peptides that comprise an
epitope are described, for example, by Mole, "Epitope
Mapping," in Methods an Molecular Biology, VoI. 10, Manson
(ed.), pages 105-116 (The Humana Press, Inc. 1992), Price,
"Production and Characterization of Synthetic Peptide-
Derived Antibodies," in Monoclonal Antibodies: Production,
Engineering, and Clinical Application, Ritter and Ladyman
(eds.), pages 60-84 (Cambridge University Press 1995), and
Coligan et a1. (eds.), Current Protoco3s in Immunology,
pages 9.3.1 - 9.3.5 and pages 9.4.1 - 9.4.11 (John Wiley &
Sons 1997) .
CA 02344712 2001-03-30
WO 00/18796 PCT/US99122970
49
Regardless of the particular nucleotide sequence
of a variant Zsi.g48 gene, the gene encodes a polypeptide
that is characterized by its ability to bind specifically
to an anti-Zsig48 antibody.
For any Zsig48 polypeptide, including variants
and fusion proteins, one of ordinary skill in the art can
readily generate a fully degenerate polynucleotide
sequence encoding that variant using the information set
forth in Tables 1 and 2 above. Moreover, those of skill
in the art can use standard software to devise Zsig48
variants based upon the nucleotide and amino acid
sequences described herein. Accordingly, the present
invention includes a computer-readable medium encoded with
a data st7ructure that provides at least one of the
following sequences: SEQ ID NO:1, 2, 3, 4, 5, 8, 9, 10,
11, and 12. For example, a computer-readable medium can be
encoded with a data structure that provides at least one
of the following sequences: SEQ ID NO:1, SEQ ID N0:2.
Suitable forms of computer-readable media include magnetic
media and optically-readable media. Examples of magnetic
media include a hard or fixed drive, a random access
memory (RAM) chip, a floppy disk, digital linear tape
(DLT}, a disk cache, and a ZIP disk. Optically readable
media are exemplified by compact discs (e. g., CD-read only
memory (ROM), CD-re-writable (RW), and CD-recordable), and
digital versatile/video discs (DVD} (e. g., DVD-ROM, DVD-
RAM, and DVD+RW).
Production of Zsig48 Fusion Proteins and Conjugates
Fusion proteins of Zsig48 can be used to express
Zsig48 in a recombinant host, and to isolate expressed
Zsig48. As described below, particular Zsig48 fusion
proteins also have uses in diagnosis and therapy.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
One type of fusion protein comprises a peptide
that guides a Zsig48 polypeptide from a recombinant host
cell. To direct a Zsig48 into the secretory pathway of a
eukaryotic host cell, a secretory signal sequence (also
5 known as a signal peptide, a leader sequence, prepro
sequence or pre sequence) is provided in the Zsig48
expression vector. While the secretory signal sequence
may be derived from Zsig48, a suitable signal sequence may
also be derived from another secreted protein or
10 synthesized de novo. The secretory signal sequence is
operably linked to an Zsig48-encoding sequence such that
the two sequences are joined in the correct reading frame
and positioned to direct the newly synthesized polypeptide
into the secretory pathway of the host cell. Secretory
15 signal sequences are commonly positioned 5' to the
nucleotide sequence encoding the polypeptide of interest,
although certain secretory signal sequences may be
positioned elsewhere in the nucleotide sequence of
interest (see, e.g., Welch et al., U.S. Patent No.
20 5,037,743; Holland et al., U.S. Patent No. 5,143,830).
Although the secretory signal sequence of Zsig48
or another protein produced by mammalian cells (e. g.,
tissue-type plasminogen activator signal sequence, as
25 described, for example, in U.S. Patent No. 5,641,655) is
useful for expression of Zsig48 in recombinant mammalian
hosts, a yeast signal sequence is preferred for expression
in yeast cells. Examples of suitable yeast signal
sequences are those derived from yeast mating pheromone a-
30 factor (encoded by the MFcx1 gene), invertase (encoded by
the SUC2 gene), or acid phosphatase (encoded by the PH05
gene). See, for example, Romanos et al., '"Expression of
Cloned Genes in Yeast," in DNA Cloning 2: A Practical
Approach, 2nd Edition, Glover and Hames (eds.), pages 123-
35 167 (Oxford University Press 1995).
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
51
In bacterial cells, it is often desirable to
express a heterologous protein as a fusion protein to
decrease toxicity, increase stability, and to enhance
recovery of the expressed protein. For example, Zsig48
can be expressed as a fusion protein comprising a
glutathione S-transferase polypeptide. Glutathione S-
transferase fusion proteins are typically soluble, and
easily purifiable from E. coli lysates on immobilized
glutathione columns. In similar approaches, a Zsig48
fusion protein comprising a maltose binding protein
polypeptide can be isolated with an amylose resin column,
while a fusion protein comprising the C-terminal end of a
truncated Protein A gene can be purified using IgG-
Sepharose. Established techniques for expressing a
heterologous polypeptide as a fusion protein in a
bacterial cell are described, for example, by Williams et
al., "Expression of Foreign Proteins in E. col.i Using
Plasmid Vectors and Purification of Specific Polyclonal
Antibodies," in DNA C.~oning 2: A Practical Approach, 2"a
Edition, Glover and Hames (Eds.), pages 15-58 (Oxford
University Press 1995). In addition, commercially
available expression systems are available. Far example,
the PINPOINT Xa protein purification system (Promega
Corporation; Madison, WI) provides a method for isolating
a fusion protein comprising a polypeptide that becomes
biotinylated during expression with a resin that comprises
avidin.
Peptide tags that are useful for isolating
heterologous polypeptides expressed by either prokaryotic
or eukaryotic cells include polyHistidine tags (which have
an affinity for nickel-chelating resin), c-myc tags,
calmodulin binding protein (isolated with calmodulin
affinity chromatography), substance P, the RYIRS tag
(which binds with anti-RYIRS antibodies), the Glu-Glu tag,
and the FLAG tag (which binds with anti-FLAG antibodies).
See, for example, Luo et al., Arch. Biochem. Biophys.
CA 02344712 2001-03-30
WO 00/I8796 PCT/US99/22970
52
329:215 (1996), Morganti et al., Biotechnol. Appl.
Biochem. 23:67 (1996), and Zheng et al., Gene 186:55
(1997). Nucleic acid molecules encoding such peptide tags
are available, for example, from Sigma-Aldrich Corporation
(St. Louis, MO).
The present invention also contemplates that the
use of the secretory signal sequence contained in the
Zsig48 polypeptides of the present invention to direct
other polypeptides into the secretory pathway. A signal
fusion polypeptide can be made wherein a secretory signal
sequence derived from amino acid residues 1 to 26 or 1-28
or 1-40 of SEQ ID N0:2 is operably linked to another
polypeptide using methods known in the art and disclosed
herein. The secretory signal sequence contained in the
fusion polypeptides of the present invention is preferably
fused amino-terminally to an additional peptide to direct
the additional peptide into the secretory pathway. Such
constructs have numerous applications known in the art.
For example, these novel secretory signal sequence fusion
constructs can direct the secretion of an active component
of a normally non-secreted protein, such as a receptor.
Such fusions may be used in a transgenic animal or in a
cultured recombinant host to direct peptides through the
secretory pathway. With regard to the latter, exemplary
polypeptides include pharmaceutically active molecules
such as Factor VIIa, proinsulin, insulin, follicle
stimulating hormone, tissue type plasminogen activator,
tumor necrosis factor, interleukins (e.g., interleukin-1
(IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9,
IL-10, IL-11, IL-12, TL-13, IL-14, and IL-15), colony
stimulating factors (e. g., granulocyte-colony stimulating
factor (G-CSF) and granulocyte macrophage-colony
stimulating factor (GM-CSF)), interferons (e. g.,
interferons-a, -Vii, -y, -w, -8, and -z) , the stem cell
growth factor designated ~~Sl factor,' erythropoietin, and
thrombopoietin. The Zsig48 secretory signal sequence
CA 02344712 2001-03-30
WO 00118796 PCTIUS99/22970
53
contained in the fusion polypeptides of the present
invention is preferably fused amino-terminally to an
additional peptide to direct the additional peptide into
the secretory pathway. Fusion proteins comprising a
Zsig48 secretory signal sequence can be constructed using
standard techniques.
Another form of fusion protein comprises an
Zsig48 polypeptide and an immunoglobulin heavy chain
constant region, typically an Fc fragment, which contains
two or three constant region domains and a hinge region
but lacks the variable region. As an illustration, Chang
et al., U.S. Patent No. 5,723,125, describe a fusion
protein comprising a human interferon and a human
immunoglobulin Fc fragment. The C-terminal of the
interferon is linked to the N-terminal of the Fc fragment
by a peptide linker moiety. An example of a peptide
linker is a peptide comprising primarily a T cell inert
sequence, which is immunologically inert. An exemplary
peptide linker has the amino acid sequence: GGSGG SGGGG
SGGGG S (SEQ ID N0:17). In this fusion protein, a
preferred Fc moiety is a human y4 chain, which is stable in
solution and has little or no complement activating
activity. Accordingly, the present invention contemplates
a Zsig48 fusion protein that comprises a Zsig48 moiety and
a human Fc fragment, wherein the C-terminus of the Zsig48
moiety is attached to the N-terminus of the Fc fragment
via a peptide linker, such as a peptide consisting of the
amino acid sequence of SEQ ID N0:20. The Zsig48 moiety
can. be a Zsig48 molecule or a. fragment thereof .
In another variation, a Zsig48 fusion protein
comprises an IgG sequence, a Zsig48 moiety covalently
joined to the aminoterminal end of the IgG sequence, arid a
signal peptide that is covalently joined to the
aminoterminal of the Zsig48 moiety, wherein the IgG
sequence consists of the following elements in the
CA 02344712 2001-03-30
WO 00/18796 PCT/U599/22970
S4
following order: a hinge region, a CHZ domain, and a CH3
domain. Accordingly, the IgG sequence lacks a CH1 domain.
This general approach to producing fusion proteins that
comprise both antibody and nonantibody portions has been
described by LaRochelle et al., EP 742830 (WO 95/21258).
Fusion proteins comprising a Zsig48 moiety and
an Fc moiety can be used, for example, as an in vitro
assay tool. For example, the presence of a Zsig48 ligand
in a biological sample can be detected using a Zsig48-
immunoglobulin fusion protein, in which the Zsig48 moiety
is used to target the cognate ligand, and a macromolecule,
such as Protein A or anti-Fc antibody, is used to detect
the bound fusion protein-receptor complex. Moreover, such
fusion proteins can be used to identify agonists and
antagonists that interfere with the binding of Zsig48 to
its ligand.
In addition, antibody-Zsig48 fusion proteins,
comprising antibody variable domains, are useful as
therapeutic proteins, in which the antibody moiety binds
with a target antigen, such as a tumor associated antigen.
Methods of making antibody-cytokine fusion proteins are
known to those of skill in the art. For example, antibody
fusion proteins comprising an interleukin-2 moiety are
described by Boleti et al., Ann. Oncol. 6:945 (1995),
Nicolet et al., Cancer Gene Ther. 2:161 (1995), Becker et
a.I., Proc. Nat'1 Acad. Sci. USA 93:7825 (1996), Hank et
al., Clin. Cancer Res. 2:1951 (1996), and Hu et al., Cancer
Res. 56:4998 (1996). Moreover, Yang et al., Hum.
Antibodies Hybridomas 6:12 9 (1995), and Xiang et al., J.
Biotechnol. 53:3 (1997), describe fusion proteins that
include an F(ab')2 fragment and a tumor necrosis factor
alpha moiety. Additional cytokine-antibody fusion
proteins include IL-8, TL-12, ar interferon-z as the
cytokine moiety (Holzer et al., Cytokine 8:214 (1996);
Gillies et al.., J. Immunol. 160:6195 (1998); Xiang et al.,
CA 02344712 2001-03-30
WO 00118796
PCTIUS99/22Q70
Hum: Antibodies Hybridomas 7:2 (1996)). Also see, Gillies,
U.S. Patent No. 5,650,150.
Fusion proteins can be prepared by methods known
5 to those skilled in the art by preparing each component of
the fusion protein and chemically conjugating them.
Alternatively, a polynucleotide encoding both components
of the fusion protein in the proper reading frame can be
generated using known techniques and expressed by the
10 methods described herein. General methods fox enzymatic
and chemical cleavage of fusion proteins are described,
for example, by Ausubel (1995) at pages 16-19 to 16-25.
The present invention also contemplates
15 chemically modified Zsig48 compositions, in which an
Zsig48 polypeptide is linked with a polymer. Typically,
the polymer is water soluble so that the Zsig48 conjugate
does not precipitate in an aqueous environment, such as a:
physiological environment. An example of a suitable
20 polymer is one that has been modified to have a single
reactive group, such as an active ester for acylation, or
an aldehyde for alkylation, In this way, the degree of
polymerization can be controlled. An example of a
reactive aldehyde is polyethylene glycol propionaldehyde,
25 or mono-(C1-C10) alkoxy, or aryloxy derivatives thereof
(see, for example, Harris, et a3., U.S. Patent No.
5,252,714). The polymer may be branched or unbranched.
Moreover, a mixture of polymers can be used to produce
Zsig48 conjugates.
Zsig48 conjugates used for therapy should
preferably comprise pharmaceutically acceptable water-
soluble polymer moieties. Suitable water-soluble polymers
include polyethylene glycol (PEG), monomethoxy-PEG, mono-
(C1-C10)alkoxy-PEG, aryloxy-PEG, poly-(N-vinyl
pyrrolidone)PEG, tresyl monomethoxy PEG, PEG
propionaldehyde, bis-succinimidyl carbonate PEG, propylene
CA 02344712 2001-03-30
_ PCTIUS99I22970
WO 00/18796
56
glycol homopolymers, a polypropylene oxide/ethylene oxide
co-polymer, polyoxyethylated polyols (e. g., glycerol),
polyvinyl alcohol, dextran, cellulose, or other
carbohydrate-based polymers. Suitable PEG may have a
molecular weight from about 600 to about 50,000,
including, for example, 5,000, 12,000, 20,000 and 25,000.
A Zsig48 conjugate can also comprise a mixture of such
water-soluble polymers.
PEGylation by acylation typically requires
reacting an active ester derivative of PEG with a Zsig48
polypeptide: An example of an activated PEG ester is PEG
esterified to N-hydroxysuccinimide. As used herein, the
term "acylation" includes the following types of linkages
between Zsig48 and a water soluble polymer: amide,
carbamate, urethane, and the like. Methods for preparing
PEGylated Zsig48 by acylation will typically comprise the
steps of (a) reacting a Zsig48 palypeptide with PEG (such
as a reactive ester of an aldehyde derivative of PEG)
under conditions whereby one or more PEG groups attach to
Zsig48, and (b) obtaining the reaction product(s).
Generally, the optimal reaction conditions for acylation
reactions will be determined based upon known parameters
and desired results. For example, the larger the ratio of
PEG:Zsig48, the greater the percentage of polyPEGylated
Zsig48 product.
The product of PEGylation by acylation is
typically a polyPEGylated Zsig48 product, wherein the
lysine s-amino groups are PEGylated via an acyl linking
group. An example of a connecting linkage is an amide.
Typically, the resulting Zsig48 will be at least 95o mano-
di-, or tri-pegylated, although some species with higher
degrees of PEGylation may be formed depending upon the
reaction conditions. PEGylated species can be separated
from unconjugated Zsig48 polypeptides using standard
purification methods, such as dialysis, ultrafiltration,
CA 02344712 2001-03-30
WO 00/18796
57
PCTIUS99I22970
ion exchange chromatography, affinity chromatography, and
the like.
PEGylation by alkylation generally involves
reacting a terminal aldehyde derivative of PEG with Zsig48
in the presence of a reducing agent. PEG groups are
preferably attached to the polypeptide via a -CHZ-NH group.
Derivatization via reductive alkylation to
produce a monoPEGylated product takes advantage of the
differential reactivity of different types of primary
amino groups available for derivatization. Typically, the
reaction is performed at a pH that allows one to take
advantage of the pKa differences between the E-amino
groups of the lysine residues and the a,-amino group of the
N-terminal residue of the protein. By such selective
derivatization, attachment of a water-soluble polymer that
contains a reactive group such as an aldehyde, to a
protein is controlled. The conjugation with the polymer
occurs predominantly at the N-terminus of the protein
without significant modification of other reactive groups
such as the lysine side chain amino groups. The present
invention provides a substantially homogenous preparation
of Zsig48 monopolymer conjugates.
Reductive alkylation to produce a substantially
homogenous population of monopolymer Zsig48 conjugate
molecule can comprise the steps of: (a) reacting a Zsig48
polypeptide with a reactive PEG under reductive alkylation
conditions at a pH suitable to permit selective
modification of the a-amino group at the amino terminus of
the Zsig48, and (b) obtaining the reaction product(s).
The reducing agent used for reductive alkylation should be
stable in aqueous solution and preferably be able to
reduce only the Schiff base formed in. the initial process
of reductive alkylation. Preferred reducing agents
include sodium borohydride, sodium cyanoborohydride,
CA 02344712 2001-03-30
PCT/US99/22970
WO 00/18796
Sg
dimethylamine borane, trimethylamine borane, and pyridine
borane.
For a substantially homogenous population of
monopolymer Zsig48 conjugates, the reductive alkylation
reaction conditions are those which permit the selective
attachment of the water soluble polymer moiety to the N-
terminus of Zsig48. Such reaction conditions generally
provide for pKa differences between the lysine amino
groups and the a,-amino group at the N-terminus. The pH
also affects the ratio of polymer to protein to be used.
In general, if the pH is lower, a larger excess of polymer
to protein will be desired because the less reactive the
N-terminal a-group, the more polymer is needed to achieve
optimal conditions. If the pH is higher, the polymer:
Zsig48 need not be as large because more reactive groups
are available. Typically, the pH will fall within the
range of 3 - 9, or 3 - 6.
Another factor to consider is the molecular
weight of the water-soluble palymer. Generally, the
higher the molecular weight of the polymer, the fewer
number of polymer molecules which may be attached to the
protein. For PEGylation reactions, the typical molecular
weight is about 2 kDa to about 100 kDa, about 5 kDa to
about 50 kDa; or about 12 kDa to about 25 kDa. The molar
ratio of water-soluble polymer to Zsig48 will generally be
in the range of 1:1 to 100:1. Typically, the molar ratio
of water-soluble polymer to Zsig48 will be 1:1 to 20:1 for
polyPEGylation, and 1:1 to 5:1 for monoPEGylation.
General methods for producing conjugates
comprising Zsig48 and water-soluble polymer moieties are
known in the art. See, for example, Karasiewicz et aL.,
U.S. Patent No. 5,382,657, Greenwald et al., U.S. Patent
No. 5,738, 84&, Nieforth e~ al., Clin. Pharmacol. Ther.
CA 02344712 2001-03-30
WO 00118796 PCT/US99/22970
59
59:636 (1996), Monkarsh et al., Anal. Biochem. 247:434
(1997) ) .
Production of Zsig48 Polypeptides izz Cultured Cells
The polypeptides of the present invention,
including full-length polypeptides, functional fragments,
and fusion proteins, can be produced in recombinant host
cells following conventional techniques. To express a
Zsig48 gene, a nucleic acid molecule encoding the
polypeptide must be operably linked to regulatory sequences
that control transcriptional expression in an expression
vector and then, introduced into a host cell. In addition
to transcriptional regulatory sequences, such as promoters
and enhancers, expression vectors can include translational
regulatory sequences and a marker gene which is suitable
for selection of cells that carry the expression vector.
Expression vectors that are suitable for
production of a foreign protein in eukaryotic cells
typically contain (1) prokaryotic DNA elements coding for
a bacterial replication origin and an antibiotic
resistance marker to provide for the growth and selection
of the expression vector in a bacterial host; (2)
eukaryotic DNA elements that control initiation of
transcription, such as a promoter; and (3) DNA elements
that control the processing of transcripts, such as a
transcription termination/polyadenylation sequence. As
discussed above, expression vectors can also include
nucleotide sequences encoding a secretory sequence that
directs the heterologous polypeptide into the secretory
pathway of a host cell. For example, a Zsig48 expression
vector may comprise a Zsig48 gene and a secretory sequence
derived from a Zsig48 gene or another secreted gene.
Zsig48 proteins of the present invention may be
expressed in mammalian cells. Examples of suitable
CA 02344712 2001-03-30
PCT/US99l22970
WO 00118796
mammalian host cells include African green monkey kidney
cells (Vero; ATCC CRL 1587), human embryonic kidney cells
(293-HEK; ATCC CRL 1573), baby hamster kidney cells (BHK-
21, BHK-570; ATCC CRL 8544, ATCC CRL 10314), canine kidney
5 cells (MDCK; ATCC CCL 34), Chinese hamster ovary cells
(CHO-K1; ATCC CCL61; CHO DG44 [Chasin et al., Som. CeII.
Molec. Genet. 1.2:555 (1986)]), rat pituitary cells (GH1;
ATCC CCL82), HeLa S3 cells (ATCC CCL2.2), rat hepatoma
cells (H-4-II-E; ATCC CRL 1548) SV40-transformed monkey
10 kidney cells (COS-1; ATCC CRL 1650) and murine embryonic
cells (NIH-3T3; ATCC CRL 1658).
For a mammalian host, the transcriptional and
translational regulatory signals may be derived from viral
15 sources, such as adenovirus, bovine papilloma virus,
simian virus, or the like, in which the regulatory signals
are associated with a particular gene which has a high
level of expression. Suitable transcriptional and
translational regulatory sequences also can be obtained
20 from mammalian genes, such as actin, collagen, myosin, and
metallothionein genes.
Transcriptional regulatory sequences include a
promoter region sufficient-to direct the initiation of RNA
25 synthesis. Suitable eukaryotic promoters include the
promoter of the mouse metallothionein I gene (Hamer et
al., J. Molec. Appl. Genet. 1:273 (1982)), the TK promoter
of Herpes virus (McKnight, Cell 31:355 (1982)), the SV40
early promoter (Benoist et al., Nature 290:304 (1981)),
30 the Rous sarcoma virus promoter (Gorman et al., Proc.
Nat'1 Acad. Sci. LISA 79:6777 (1982)), the cytomegalovirus
promoter (Foecking et al., Gene 45:101 (1980)), and the
mouse mammary tumor virus promoter (see, generally,
Etcheverry, "Expression of Engineered Proteins in
35 Mammalian Cell Culture," in Protein Engineering:
Principles and Practice, Cleland et al. (eds.), pages 163-
181 (John Wiley & Sons, Inc. 1996)).
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
61
Alternatively, a prokaryotic promoter, such as
the bacteriophage T3 RNA polymerase promoter, can be used
to control Zsig48 gene expression in mammalian cells if
the prokaryotic promoter is regulated by a eukaryatic
promoter (Zhou et al., Mol. Cell. Biol. 10:4529 (2990),
and Kaufman et al., Nucl. Acids Res. 19:4485 (1991)).
An expression vector can be introduced into host
cells using a variety of standard techniques including
calcium phosphate transfection, liposome-mediated
transfection, microprojectile-mediated delivery,
electroporation, and the like. Preferably, the transfected
cells are selected and propagated to provide recombinant
host cells that comprise the expression vector stably
integrated in the host cell genome. Techniques for
introducing vectors into eukaryotic cells and techniques
for selecting such stable transfarmants using a dominant
selectable marker are described, far example, by Ausubel
(1995) and by Murray (ed.), Gene Transfer and Expression
Protocols (Humana Press 1991).
For example, one suitable selectable marker is a
gene that provides resistance to the antibiotic neomycin.
In this case, selection is carried out in the presence of
a neomycin-type drug, such as G-418 or the like.
Selection systems can also be used to increase the
expression level of the gene of interest, a process
referred to as "amplification." Amplification is carried
aut by culturing transfectants in the presence of a low
level of the selective agent and then increasing the
amount of selective agent to. select for cells that produce
high levels of the products of the introduced genes. A
preferred amplifiable selectable marker is dihydrofolate
reductase, which confers resistance to methotrexate.
Other drug resistance genes (e. g., hygromycin resistance,
mufti-drug resistance, puramycin acetyltransferase) can
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
62 '
also be used. Alternatively, markers that introduce an
altered phenotype, such as green fluorescent protein, or
cell surface proteins such as CD4, CD8, Class I MHC,
placental alkaline phosphatase may be used to sort
transfected cells from untransfected cells by such means
as FACS sorting or magnetic bead separation technology.
Zsig48 polypeptides can also be produced by
cultured mammalian cells using a viral delivery system.
Exemplary viruses for this purpose include adenovirus,
herpesvirus, vaccinia virus and adeno-associated virus
(AAV). Adenovirus, a double-stranded DNA virus, is
currently the best studied gene transfer vector for
delivery of heterologous nucleic acid (for a review, see
Becker et al., Meth. Cell Bial. 43:161 (1994), and Douglas
and Curiel, Science & Medicine 4:44 (1997)). Advantages
of the adenovirus system include the accommodation of
relatively large DNA inserts, the ability to grow to high-
titer, the ability to infect a broad range of mammalian
cell types, and flexibility that allows use with a large
number of available vectors containing different
promoters.
By deleting portions of the adenovirus genome,
larger inserts (up to 7 kb) of heterologous DNA can be
accommodated. These inserts can be incorporated into the
viral DNA by direct ligation or by homologous
recombination with a co-transfected plasmid. An option is
to delete the essential E1 gene from the viral vector,
which results in the inability to replicate unless the EZ
gene is provided by the host cell. Adenovirus vector-
infected human 293 cells (ATCC Nos. CRL-1573, 45504,
45505), for example, can be grown as adherent cells or in
suspension culture at relatively high cell density to
produce significant amounts of protein (see Gamier et
al., Cytotechnol. 15:145 (1994)).
CA 02344712 2001-03-30
WO 00/18796 PCT/U599I22970
63
Zsig48 genes may also be expressed in other
higher eukaryotic cells, such as avian, fungal, insect,
yeast, or plant cells. The baculovirus system provides an
efficient means to introduce cloned Zsig48 genes into
insect cells. Suitable expression vectors are based upon
the Autographs californica multiple nuclear polyhedrosis
virus (AcMNPV), and contain well-known promoters such as
Drosophila heat shock protein (hsp) 70 promoter,
Autographs californica nuclear polyhedrosis virus
immediate-early gene promoter (ie-1) and the delayed early
39It promoter, baculovirus p10 promoter, and the Drosophila
metallothionein promoter. A second method of making
recombinant baculovirus utilizes a transposon-based system
described by Luckow (Luckow, et a.I., J. Virol. 57:4566
(1993)). This system, which utilizes transfer vectors, is
sold in the BAC-to-BAC kit (Life Technologies, Rockville,
MD). This system utilizes a transfer vector, PFASTBAC
(Life Technologies) containing a Tn7 transposon to move
the DNA encoding the Zsig48 polypeptide into a baculovirus
genome maintained in E. coli as a large plasmid called a
"bacmid." See, Hill-Perkins and Possee, J. Gen. Virol.
71:971 (1990), Bonning, et al., J. Gen. ViroZ. 75:1551
11994), and Chazenbalk, and Rapoport, J. Biol. Chem.
270:1543 (1995). In addition, transfer vectors can
include an in-frame fusion with DNA encoding an epitope
tag at the C- or N-terminus of the expressed Zsig48
polypeptide, for example, a Glu-Glu epitope tag
(Grussenmeyer et al., Proc. Nat'. Acad. Sci. 82:7952
(1985)). Using a technique known in the art, a transfer
vector containing a Zsig48 gene is transformed into E.
coli, and screened for bacmids which contain an
interrupted .lacZ gene indicative of recombinant
baculovirus. The bacmid DNA containing the recombinant
baculovirus genome is then isolated using common
techniques.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
64
The illustrative pFASTBAC vector can be modified
to a considerable degree. For example, the polyhedrin
promoter can be removed and substituted with the
baculovirus basic protein promoter (also known as Poor,
p6.9 or MP promoter) which is expressed earlier in the
baculovirus infection, and has been shown to be
advantageous for expressing secreted proteins (see, for
example, Hill-Perkins and Possee, J. Gen. Virol. 71:971
(1990), Bonning, et al., J. Gen. Virol. 75:1551 {1994),
and Chazenbalk and Rapoport, J. Biol. Chem. 270:1543
(1995). In such transfer vector constructs, a short or
long version of the basic protein promoter can be used.
Moreover, transfer vectors can be constructed which
replace the native Zsig48 secretory signal sequences with
secretory signal sequences derived from insect proteins.
For example, a secretory signal sequence from Ecdysteroid
Glucosyltransferase (EGT), honey bee Melittin (Invitrogen
Corporation; Carlsbad, CA), or baculovirus gp67
(PharMingen: San Diego, CA) can be used in constructs to
replace the native Zsig48 secretory signal sequence.
The recombinant virus or bacmid is used to
transfect host cells. Suitable insect host cells include
cell lines derived from IPLB-Sf-21, a Spodoptera
frugiperda papal ovarian cell line, such as Sf9 (ATCC CRL
1711), Sf2lAE, and Sf21 (Invitrogen Corporation; San
Diego, CA), as well as Drosophila Schneider-2 cells, and
the HIGH FIVEO cell line (Tnvitrogen) derived from
Trichoplusia ni (U. S. Patent No. 5,300,435). Commercially
available serum-free media can be used to grow and to
maintain the cells. Suitable media are Sf900 IIT"' (Life
Technologies) or ESF 921T"' (Expression Systems) for the Sf9
cells; and Ex-ce11O405~"" (JRH Biosciences, Lenexa, KS) or
Express FiveOT"" (Life Technologies) for the T. ni cells.
When recombinant virus is used, the cells are typically
grown up from an inoculation density of approximately 2-5
x 105 cells to a density of 1-2 x 106 cells at which time a
CA 02344712 2001-03-30
WD 00118796 PCT/US99/22970
recombinant viral stock is added at a multiplicity of
infection (MOT) of 0.1 to 10, more typically near 3.
Established techniques for producing recombinant
5 proteins in baculovirus systems are provided by Bailey et
al., "Manipulation of Baculovirus Vectors," in Methods in
Molecular Biology, Volume 7: Gene Transfer and Expression
Protocols, Murray (ed.), pages 147-168 (The Humana Press,
Inc. 1991), by Patel et al., "The baculovirus expression
10 system," in DNA Cloning 2: Expression Systems, 2nd
Edgy ti on, Glover et a1 . (eds . ) , pages 205-244 (Oxford
University Press 1995), by Ausubel (1995) at pages 16-37
to 16-57, by Richardson (ed.), Baculovzrus Expression
Protocols (The Humana Press, Inc. 1995), and by Lucknow,
15 "Insect Cell Expression Technology," in Protein
Engineering: Principles and Practice, Cleland et al.
(eds.), pages 183-218 (John Wiley & Sons, Inc. 199G).
Fungal cells, including yeast cells, can also be
20 used to express the genes described herein. Yeast species
of particular interest in this regard include
Saccharomyces cerevisiae, Pichia pastoris, and Pich.ia
methanolica. Suitable promoters for expression in yeast
include promoters from GAL1 (galactose), PGK
25 (phosphoglycerate kinase), ADH (alcohol dehydrogenase),
AOXI (alcohol oxidase), HIS4 (histidinol dehydrogenase),
and the like. Many yeast cloning vectors have been
designed and are readily available. These vectors include
YIp-based vectors, such as YIp5, YRp vectors, such as
30 YRpl7, YEp vectors such as YEpl3 and YCp vectors, such as
YCpl9. Methods for transforming S. cerevisiae cells with
exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S.
Patent No. 4,599,311, Kawasaki et al., U.S. Patent No.
35 4,931,373, Brake, U.S. Patent No. 4,870,008, Welch et al.,
U.S. Patent No. 5,037,743, and Murray et al., U.S. Patent
No. 4,845,075. Transformed cells are selected by
CA 02344712 2001-03-30
WO 00118796 PCT/US99/22970
66
phenotype determined by the selectable marker, commonly
drug resistance or the ability to grow in the absence of a
particular nutrient (e. g., leucine). A preferred vector
system for use in Saccharomyces cerevisiae is the POT1
vector system disclosed by Kawasaki et aI. (U. S. Patent
No. 4,931,373), which allows transformed cells to be
selected by growth in glucose-containing media.
Additional suitable promoters and terminators for use in
yeast include those from glycolytic enzyme genes (see,
e.g., Kawasaki, U.S. Patent No. 4,599,311, Kingsman et
al., U.S. Patent No. 4,615,974, and Bitter, U.S. Patent
No. 4,977,092) and alcohol dehydrogenase genes. See also
U.S. Patents Nos. 4,990,446, 5,063,154, 5,139;936, and
4,661,454.
Transformation systems for other yeasts,
including Hansenula polymorpha,,Schizosaccharomyces pombe,
Kluyveromyces Iactis, Kluyveromyces fragilis, Ustilaga
maydis, Pichia pastoris, Pichia methanoli ca, Pi chic
guillermondii and Candida maltose are known in the art.
See, for example, Gleeson et al., J. Gen. Microbiol.
132:3459 (1986), and Cregg, U.S. Patent No. 4,882,279
Aspergillus cells may be utilized according to the methods
of McKnight et al., U.S. Patent No. 4,935,349. Methods
for transforming Acremonium chrysogenum are disclosed by
Sumino et al., U.S. Patent No. 5,162,228. Methods for
transforming Neurospora are disclosed by Lambowitz, U.S.
Patent No. 4,486,533.
For example, the use of Pichia methartolica as
host for the production of recombinant proteins is
disclosed by Raymond, U.S. Patent No. 5,716,808, Raymond,
U.S. Patent No. 5,736,383, Raymond et al., Yeast 14:11-23
(1998), and in international publication Nos. WO 97/17450,
WO 97/17451, WO 98/02536, and WO 98/02565. DNA molecules
for use in transforming P. methanolica will commonly be
prepared as double-stranded, circular plasmids, which are
CA 02344712 2001-03-30
WO 00!18796 PCT/US99/22970
67
preferably linearized prior to transformation. For
polypeptide production in P. methanolica, it is preferred
that the promoter and terminator in the plasmid be that of
a P. methanolica gene, such as a P. methanolica alcohol
utilization gene (AUG1 or AUG2). Other useful promoters
include those of the dihydroxyacetone synthase (DHAS),
formate dehydrogenase (FMD), and catalase (CAT) genes. To
facilitate integration of the DNA into the host
chromosome, it is preferred to have the entire expression
segment of the plasmid flanked at both ends by host DNA
sequences. A preferred selectable marker for use in
Pichia methanolica is a P. methanolica ADE2 gene, which
encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC;
EC 4.1.1.21), and which allows ade2 host cells to grow in
the absence of adenine. Fox large-scale, industrial
processes where it is desirable to minimize the use of
methanol, it is preferred to use host cells in which both
methanol utilization genes (AUG2 and AUG2) are deleted.
For production of secreted proteins, host cells deficient
in vacuolar protease genes (PEP4 and PR81) are preferred.
Electroporation is used to facilitate the introduction of
a plasmid containing DNA encoding a polypeptide of
interest into P. methanolica cells. P. methanolica cells
can be transformed by electroporation using an
exponentially decaying, pulsed electric field having a
field strength of from 2.5 to 4.5 kV/cm, preferably about
3.75 kv/cm, and a time constant (t) of from 1 to 40
milliseconds, most preferably about 20 milliseconds.
Expression vectors can also be introduced into
plant protoplasts, intact plant tissues, or isolated plant
cells. Methods for introducing expression vectors into
plant tissue include the direct infection or co-cultivation
of plant tissue with Agrobacterium tumefaciens,
microprojectile-mediated delivery, DNA injection,
electroporation, and the like. See, for example, Horsch et
al., Science 227:1229 (1985), Klein et al.; Biotechnology
CA 02344712 2001-03-30
WO 00118796 PCT/US99122970
68
10:268 (1992), and Miki et al., "Procedures for Introducing
Foreign DNA into Plants," in Methods in Plant Molecular
Biology and Biotechnology, Glick et a1. (eds.), pages 67-88
(CRC Press, 1993).
Alternatively, Zsig48 genes can be expressed in
prokaryotic host cell s. Suitable promoters that can be
used to express Zsig48 polypeptides in a prokaryotic host
are well-known to those of skill in the art and include
promoters capable of recognizing the T4, T3, Sp6 and T7
polymerases, the PR and PL promoters of bacteriophage
lambda, the trp, recA, heat shock, IacUV5, tac, Ipp-
lacSpr, phoA, and lacZ promoters of E. coli, promoters of
B. subtilis, the promoters of the bacteriophages of
Bacillus, Streptomyces promoters, the int promoter of
bacteriophage lambda, the bla promoter of pBR322, and the
CAT promoter of the chloramphenicol acetyl transferase
gene. Prokaryotic promoters have been reviewed by Glick,
J. Ind. Microblol. .1:277 (1987), Watson et al., Molecular
Biology of the Gene, 4th Ed. (Benjamin Cummins 1987), and
by Ausubel et al. (1995) .
Preferred prokaryotic hosts include E. coli and
Bac~lZus subt.i.lus. Suitable strains of E. coli include
BL21(DE3), BL21(DE3)pLysS, BL21(DE3)pLysE, DH1, DH4I, DHS,
DH5I, DH5IF', DH5TMCR, DHlOB, DH10B/p3, DH11S, C600,
HB101, JM101, JM105, JM109, JM110, K38, RR1, Y1088, Y1089,
CSH18, ER1451, and ER1647 (see, for example, Brown (ed.),
Molecular Biology Labfax (Academic Press 1991)). Suitable
strains of Bacillus subtilus include BR151, YB886, MI119,
MI120, and B170 (see,-for example, Hardy, "Bacillus
Cloning Methods," in DNA Cloning: A Practical Approach,
Glover (ed.) (IRL Press 1985)).
When expressing a Zsig48 polypeptide in bacteria
such as E. coli, the polypeptide may be retained in the
cytoplasm, typically as insoluble granules, or may be
CA 02344712 2001-03-30
WO 00/18796 PCT/CTS99122970
69
directed to the periplasmic space by a bacterial secretion
sequence. In the former case, the cells are lysed, and
the granules are recovered and denatured using, for
example, guanidine isothiocyanate or urea. The denatured
polypeptide can then be refolded and dimerized by diluting
the denaturant, such as by dialysis against a solution of
urea and a combination of reduced and oxidized
glutathione, followed by dialysis against a buffered
saline solution. In the latter case, the polypeptide can
be recovered from the periplasmic space in a soluble and
functional form by disrupting the cells (by, for example,
sonication or osmotic shock) to release the contents of
the periplasmic space and recovering the protein, thereby
obviating the need for denaturation and refolding.
Methods for expressing proteins in prokaryotic
hosts are well-known to those of skill in the art (see,
for example, Williams et al., "Expression of foreign
proteins in E. coli using plasmid vectors and purification
of specific polyclonal antibodies," in DNA Cloning 2:
Expression Systems, 2nd Edition, Glover et a1. (eds.),
page 15 (Oxford University Press 1995), Ward et al.,
"Genetic Manipulation and Expression of Antibodies," in
Monoclonal Antibodies: Principles and Applications, page
137 (Whey-Liss, Inc. 1995), and Georgiou, "Expression of
Proteins in Bacteria," in Protein Engineering: Pr.znciples
and Practice, Cleland et a1. (eds.), page 101 (John Wiley
& Sons, Inc. 2996)). Standard methods for introducing
expression vectors into bacterial, yeast, insect, and plant
cells are provided, for example, by Ausubel (1995).
General methods far expressing and recovering
foreign protein produced by a mammalian cell system are
provided by, for example, Etcheverry, "Expression of
Engineered Proteins in Mammalian Cell Culture," in Protein
Engineering: Principles and Practice, Cleland et a1.
(eds.), pages 163 (Wiley-Liss; Inc. 1996). Standard
CA 02344712 2001-03-30
WO 00/i8796 PCT/US99I22970
techniques for recovering protein produced by a bacterial
system is provided by, for example, Grisshammer et al.,
"Purification of over-produced proteins from E. coli
cells," in DNA Cloning 2: Expression Systems, 2nd Editzon,
5 Glover et a1. (eds.), pages 59-92 (Oxford University Press
1995). Established methods for isolating recombinant
proteins from a baculovirus system are described by
Richardson (ed.), Baculovzrus Expression Protocols (The
Humana Press, Inca 1995).
Isolation of Zsig48 Polypept.~des
It is preferred to purify the polypeptides of
the present invention to at least about 80% purity, more
preferably to at least about 90% purity, even more
preferably to at least about 95% purity, or even greater
than 95% purity with respect to contaminating
macromolecules, particularly other proteins and nucleic
acids, and free of infectious and pyrogenic agents. The
polypeptides of the present invention may also be purified
to a pharmaceutically pure state, which is greater than
99.9% pure. Preferably, a purified palypeptide is
substantially free of other polypeptides, particularly
other polypeptides of animal origin.
Fractionation and/or conventional purification
methods can be used to obtain preparations of Zsig48
purified from natural sources (e.g., placenta or
leukocytes), and recombinant Zsig48 polypeptides and
Zsig48 polypeptides purified from recombinant host cells.
In general, ammonium sulfate precipitation and acid or
chaotrope extraction may be used for fractionation of
samples. Exemplary purification steps may include
hydroxyapatite, size exclusion, FPLC and reverse-phase
high performance liquid chromatography. Suitable
chromatographic media include derivatized dextrans,
agarose, cellulose, polyacrylamide, specialty silicas, and
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
71
the like. PEI, DEAF, QAE and Q derivatives are preferred.
Exemplary chromatographic media include those media
derivatized with phenyl, butyl, or octyl groups, such as
Phenyl-Sepharose FF (Pharmacia), Toyopearl butyl 650 (Toro
Haas, Montgomeryville, PA), Octyl-Sepharose (Pharmacia)
and the like; or polyacrylic resins, such as Amberchrom CG
71 (Toso Haas) and the like. Suitable solid supports
include glass beads, silica-based resins, cellulosic
resins, agarose beads, cross-linked agarose beads,
polystyrene beads, cross-linked polyacrylamide resins and
the like that are insoluble under the conditions in which
they axe to be used. These supports may be modified with
reactive groups that allow attachment of proteins by amino
groups, carboxyl groups, sulfhydryl groups, hydroxyl
groups and/or carbohydrate moieties.
Examples of coupling chemistries include
cyanogen bromide activation, N-hydroxysuccinimide
activation, epoxide activation, sulfhydryl activation,
hydrazide activation, and carboxyl and amino derivatives
for carbodiimide coupling chemistries. These and other
solid media are well known and widely used in the art, and
are available from commercial suppliers. Selection of a
particular method for polypeptide isolation and
purification is a matter of routine design and is
determined in part by the properties of the chosen
support. See, for example, Affinity Chromatography:
Principles & Methods (Pharmacia LKB Biotechnology 1988),
and Doonan, Protein Purification Protocols (The Humana
Press 1996).
Additional variations in Zsig48 isolation and
purification can be devised by those of skill in the art.
For example, anti-Zsig48 antibodies, obtained as described
below, can be used to isolate large quantities of protein
by immunoaffinity purification. The use of monoclonal
antibody columns to purify interferons from recombinant
CA 02344712 2001-03-30
WO 00/I8796 pCT/US99/22970
7~ _
cells and from natural sources has been described, for
example, by Staehelin et al., J. Bio.l. Chem. 256:9750
(1981), and by Adolf et al., J. Biol. Chem. 265:9290
(1990). Moreover, methods for binding receptors, such as
Zsig48, to ligand polypeptides bound to support media are
well known in the art.
The polypeptides of the present invention can
also be isolated by exploitation of particular properties.
For example, immobilized metal ion adsorption (IMAC)
chromatography can be used to purify histidine-rich
proteins, including those comprising polyhistidine tags.
Briefly, a gel is first charged with divalent metal ions
to farm a chelate (Sulkowski, Trends in Biochem. 3:1
(1985)). Histidine-rich proteins will be adsorbed to this
matrix with differing affinities, depending upon the metal
ion used, and will be eluted by competitive elution,
lowering the pH, or use of strong chelating agents. Other
methods of purification include purification of
glycosylated proteins by lectin affinity chromatography
and ion exchange chromatography (M. Deutscher, (ed.),
Meth. Enzymol. 182:529 (1990)). For example, the
interferon-y isolation method of Rinderknecht et al., J.
Biol. Chem. 259:6790 (1984), requires the binding of the
interferon with concanavalin A-sepharose in one step.
Within additional embodiments of the invention, a fusion
of the polypeptide of interest and an affinity tag (e. g.,
maltose-binding protein, an immunoglobulin domain) may be
constructed to facilitate purification.
Zsig48 polypeptides or fragments thereof may
also be prepared through chemical synthesis, as described
below. Zsig48 polypeptides may be monomers or multimers;
glycosylated or non-glycosylated; PEGylated or non-
PEGylated; and may or may not include an initial
methianine amino acid residue.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
73
Peptides and polypeptides of the present
invention comprise at least six, preferably at least nine,
and more preferably at least 15 contiguous amino acid
residues of SEQ ID NOs:2, 3, 4 or 5. Within certain
embodiments of the invention, the polypeptides comprise
20, 30, 40, 50, 100, or more contiguous residues of these
amino acid sequences, for example, SEQ ID NOs: 8-12.
Nucleic acid molecules encoding such peptides and
po7.ypeptides are useful as polymerase chain reaction
primers and probes.
Chemical synthesis of Zsi,g48 Polypeptides
Zsig48 polypeptides of the present invention can
also be synthesized by exclusive solid phase synthesis,
partial solid phase methods, fragment condensation or
classical solution synthesis. The polypeptides are
preferably prepared by solid phase peptide synthesis, for
example as described by Merrifield, J. Am. Chem. Soc.
85:2149 (1963) .
Solid phase synthesis is usually carried out
from the carboxyl-terminus by coupling the alpha-amino
protected (side-chain protected) amino acid to a suitable
solid support. An ester linkage is formed~when the
attachment is made to a chloromethyl, chlortrityl or
hydroxymethyl resin, and the resulting polypeptide will
have a free carboxyl group at the C-terminus.
Alternatively, when an amide resin such as benzhydrylamine
or p-methylbenzhydrylamine resin (for tBoc chemistry) and
Rink amide or PAL resin (for Fmoc chemistry) are used, an
amide bond is formed and the resulting polypeptide will
have a carboxamide group at the C-terminus. These resins,
whether polystyrene- or polyamide-based or
polyethyleneglycol-grafted, with or without a handle or
linker, with or without the first amino acid attached, are
commercially available, and their preparations have been
CA 02344712 2001-03-30
WO 0011$796 PCT/US99122970
74
described by Stewart et aZ., "Solid Phase Peptide
Synthesis" (2nd Edition), (Pierce Chemical Co. 1984),
Bayer and Rapp, Chem. Pept. Prot. 3:3 (1986), Atherton et
a1. , Solid Phase Peptide Synthesis: A Practical Approach
(IRL Press 1989), and by Lloyd-Williams et aZ., Chemical
Approaches to the Synthesis of Peptides and Proteins (CRC
Press, Inc. 1997).
The "native chemical ligation" approach to
producing polypeptides is ane variation of total chemical
synthesis strategy (see, for example, Dawson et al.,
Science 266:776 (1994), Hackeng et al., Proc. Nat'1 Acad.
Sci. USA 94:7845 (1997}, and Dawson, Methods Enzymol. 287:
34 (1997)}. According to this method, an N-terminal
cysteine-containing peptide is chemically ligated to a
peptide having a C-terminal thioester group to form a
normal peptide bond at the ligation site.
The "expressed protein ligation" method is a
semi-synthesis variation of the ligation approach (see,
for example, Muir et a1, Proc. Nat'1 Acad. Sci. USA
95:6705 (1998}; Severinov and Muir, J. Biol. Chem.
273:16205 (1998}). Here, synthetic peptides and protein
cleavage fragments are linked to form the desired protein
product. This method is particularly useful for the site-
specific incorporation of unnatural amino acids (e. g.,
amino acids comprising biophysical or biochemical probes)
into proteins.
Tn an approach illustrated by Muir et aZ, Proc.
Nat'1 Acad. Sci. USA 95:6705 (1998), a gene or gene
fragment is cloned into the PCYB2-IMPACT vector (New
England Biolabs, Inc.; Beverly, MA) using the Ndel and
SmaI restriction sites. As a result, the gene or gene
fragment is expressed in frame fused with a chitin binding
domain sequence, and a Pro-G1y is appended to the native C
terminus of the protein of interest. The presence of a C-
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
terminal glycine reduces the chance of side reactions,
because the glycine residue accelerates native chemical
ligation. Affinity chromatography with a chitin resin is
used to purify the expressed fusion protein, and the
5 chemical ligation step is initiated by incubating the
resin-bound protein with thiophenol and synthetic peptide
in buffer. This mixture produces the in situ generation of
a highly reactive phenyl "thioester derivative of the
protein that rapidly ligates with the synthetic peptide to
10 produce the desired semi-synthetic protein.
A general class of Zsig48 analogs is provided by
anti-idiotype antibodies, and fragments thereof, as
described below. Moreover, recombinant antibodies
15 comprising anti-idiotype variable domains can be used as
analogs (see, for example, Monfardini et al., Proc. Assoc.
Am. Physicians 108:420 (1996)). Since the variable
domains of anti-idiotype Zsig48 antibodies mimic Zsig48,
these domains can provide either Zsig48 agonist or
20 antagonist activity.
A third approach to identifying Zsig48 analogs
is provided by the use of combinatorial libraries.
Methods for constructing and screening phage display and
25 other combinatorial libraries are provided, far example,
by Kay et al., Phage Display of Peptides and Proteins
(Academic Press 1996), Verdine, U.S. Patent No. 5,783,384,
Kay, et. al., U.S. Patent No. 5,747,334, and Kauffman et
al., U.S. Patent No. 5,723,323.
As a receptor, the activity of Zsig48 can be
measured by a silicon-based biosensor microphysiometer
which measures the extracellular acidification rate or
proton excretion associated with receptor binding and
subsequent cellular responses. An exemplary device is the
CYTOSENSOR Microphysiometer manufactured by Molecular
Devices Corp. (Sunnyvale, CA). A variety of cellular
CA 02344712 2001-03-30
WO 00/1$796 !'CT/US99/22970
76
responses, such as cell proliferation, ion transport,
energy production, inflammatory response, regulatory and
receptor activation, and the like, can be measured by this
method (see, for example, McConnell et al., Science
257:1906 {1992), Pitchford et al., Meth. Enzymol. 228:84
(1997), Arimilli et al., J. Immunol. Meth. 212:49 (1998),
and Van Liefde et al., Eur. J. Pharmacol. 346:87 (1998)).
Moreover, the microphysiometer can be used for assaying
adherent or non-adherent eukaryotic or prokaryotic cells.
Zsig48, its analogs, and anti-iodiotype Zsig48
antibodies can be used to identify and to isolate Zsig48
ligands. For example, proteins and peptides of the
present invention can be immobilized on a column and used
to bind ligand proteins from tissue and serum preparations
that are run over the column (Hermanson et a~I. {eds.),
Immobilized Affinity L.igand Techniques, pages 195-202
(Academic Press 1992)). Radiolabeled or affinity labeled
Zsig48 polypeptides can also be used to identify or to
localize Zsig48 ligands in a biological sample {see, for
example, Deutscher (ed.), Methods in Enzymol., vol. 182,
pages 721-37 (Academic Press 1990); Brunner et al., Ann.
Rev. Biochem. 62:483 (1993); Fedan et al., Biochern.
PharmacoZ. 33:1167 {1984)). Also see, Varthakavi and
Minocha, J. Gen. Virol. 77:1875 {1996), who describe the
use of anti-idiotype antibodies for receptor
identification.
In addition, a solid phase system can be used to
identify a Zsig48 ligand, or an agonist or antagonist of a
Zsig48 ligand. For example, a Zsig48 polypeptide or Zsig48
fusion protein can be immobilized onto the surface of a
receptor chip of a commercially available biosensor
instrument (BIACORE, Biacore AB; Uppsala, Sweden). The
use of this instrument is disclosed, for example, by
Karlsson, 1'mmunol. Methods 145:229 (1991), and Cunningham
and Wells, J. Mol. Biol. 234:554 (1993).
CA 02344712 2001-03-30
WO 00/1879b PCT/US99/22970
77
As an illustration, a Zsig48 polypeptide or
fusion protein is covalently attached, using amine or
sulfhydryl chemistry, to dextran fibers that are attached
to gold film within a flow cell. A test sample is then
passed through the cell. If a receptor is present in the
sample, it will bind to the immobilized polypeptide or
fusion protein, causing a change in the refractive index
of the medium, which is detected as a change in surface
plasmon resonance of the gold film. This system allows
the determination of on- arid off-rates, from which binding
affinity can be calculated, and assessment of
stoichiometry of binding. This System can also be used to
examine antibody-antigen interactions, and the
interactions of other complement/anti-complement pairs.
Produc~ioa of Antibodies to Zsig48 Proteins
Antibodies to Zsig48 can be obtained, for
example, using the product of a Zsig48 expression vector
or Zsig48 isolated from a natural source as an antigen.
Particularly useful anti-Zsig48 antibodies "bind
specifically" to Zsig48. Antibodies are considered to be
specifically binding if the antibodies exhibit at least
one of the following two properties: (1) antibodies bind
to Zsig48 with a threshold level of binding activity, and
(2) antibodies do not significantly cross-react with
polypeptides related to Zsig48.
With regard to the first characteristic,
antibodies specifically bind if they bind to a Zsig48
polypeptide, peptide or epitope with a binding affinity
(Ka) of 106 M-I or greater, preferably 10' M-1 or greater,
more preferably 108M-lor greater, and most preferably 109
M-lor greater. The binding affinity of an antibody can be
readily determined by one of ordinary skill in the art,
for example, by Scatchard analysis ~Scatchard, Ann. NY
CA 02344712 2001-03-30
WO 00118796 PCT/US99/22970
78
Acad. Sci. 51:660 (1949)]. With regard to the second
characteristic, antibodies do not significantly cross-
react with related polypeptide molecules, for example, if
they detect Zsig48, but not known related polypeptides
using a standard Western blot analysis.
Anti- Zsig48 antibodies can be produced using
antigenic Zsig48 epitope-bearing peptides and
polypeptides. Antigenic epitope-bearing peptides and
polypeptides of the present invention contain a sequence
of at least nine, preferably between 15 to about 30 amino
acids contained within SEQ ID N0:2, for example, SEQ ID
NOs: 8-12. However, peptides or polypeptides comprising a
larger portion of an amino acid sequence of the invention,
containing from 30 to 50 amino acids, or any length up to
and including the entire amino acid sequence of a
polypeptide of the invention, also are useful for inducing
antibodies that bind with Zsig48. It is desirable that
the amino acid sequence of the epitope-bearing peptide is
selected to provide substantial solubility in aqueous
solvents (i.e., the sequence includes relatively
hydrophilic residues, while hydrophobic residues are
preferably avoided). Moreover, amino acid sequences
containing proline residues may be also be desirable for
antibody production.
As an illustration, potential antigenic sites in
human Zsig48 were identified using the Jameson-Wolf
method, Jameson and Wolf, CABIOS 4:181, (1988), as
implemented by the PROTEAN program (version 3.14) of
LASERGENE (DNASTAR; Madison, WT). Default parameters were
used in this analysis. These resulted in the polypeptide
of SEQ ID NOs:8, 9, 10, 11 and 12 described above.
The Jameson-Wolf method predicts potential
antigenic determinants by combining six major subroutines
for protein structural prediction. Briefly, the Hopp-
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
79
Woods method, Hopp et al., Proc. Nat'1 Acad. Sc.i. USA
78:3824 (2981), was first used to identify amino acid
sequences representing areas of greatest local
hydrophilicity (parameter: seven residues averaged) . In
the second step, Emini's method, Emini et al., J. Virology
55:836 (1985), was used to calculate surface probabilities
(parameter: surface decision threshold (0.5) - 1).
Third, the Karplus-Schultz method, Karplus and Schultz,
Naturwissenschaften 72:212 (1985), was used to predict
backbone chain flexibility (parameter: flexibility
threshold (0.2) - 1). In the fourth and fifth steps of
the analysis, secondary structure predictions were applied
to the data using the methods of Chou-Fasman, Chou,
"Prediction of Protein Structural Classes from Amino Acid
Composition," in Prediction of Protein Structure and the
Principles of Protein Conformation, Fasman (ed.), pages
549-586 (Plenum Press 1990), and Garnier-Robson, Gamier
et al., J. Mol. Biol. 120:97 (1978) (Chou-Fasman
parameters: conformation table = 64 proteins; a region
threshold = 103; (3 region threshold = 105; Gamier-Robson
parameters: a and ~3 decision constants = 0). In the sixth
subroutine, flexibility parameters and hydropathy/solvent
accessibility factors were combined to determine a surface
contour value, designated as the "antigenic index."
Finally, a peak broadening function was applied to the
antigenic index, which broadens major surface peaks by
adding 20, 40, 60, or 80% of the respective peak value to
account for additional free energy derived from the
mobility of surface regions relative to interior regions.
This calculation was not applied, however, to any major
peak that resides in a helical region, since helical
regions tend to be less flexible.
The results of this analysis indicated that the
following amino acid sequences of SEQ ID N0:2 would
provide suitable antigenic peptides: SEQ ID NOs: 8, 9, 10,
11 and 12 as described above.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99122970
Polyclonal antibodies to recombinant Zsig48
protein or to Zsig48 isolated from natural sources can be
prepared using methods well-known to those of skill in the
5 art. See, for example, Green et al., "Production of
Polyclonal Antisera," in Immunochemical Protocols (Manson,
ed.), pages 1-5 (Humana Press 1992), and Williams et al.,
"Expression of foreign proteins in E. colt using plasmid
vectors and purification of specific polyclonal
10 antibodies," in DNA Cloning 2: Expression Systems, 2nd
Edition, Glover et aI. (eds.), page 15 (Oxford University
Press 1995). The immunogenicity of a Zsig48 polypeptide
can be increased through the use of an adjuvarit, such as
alum (aluminum hydroxide) or Freund's complete or
15 incomplete adjuvant. Polypeptides useful for immunization
also include fusion polypeptides, such as fusions of
Zsig48 or a portion thereof with an immunoglobulin
polypeptide or with maltose binding protein. The
polypeptide immunogen may be a full-length molecule or a
20 portion thereof. If the polypeptide portion is "hapten-
like," such portion may be advantageously joined or linked
to a macromolecular carrier (such as keyhole limpet
hemocyanin (KLH), bovine serum albumin (BSA) or tetanus
toxoid) for immunization.
Although polyclonal antibodies are typically
raised in animals such as horses, cows, dogs, chicken,
rats, mice, rabbits, guinea pigs, goats, or sheep, an
anti- Zsig48 antibody of the present invention may also be
derived from a subhuman primate antibody. General
techniques for raising diagnostically and therapeutically
useful antibodies in baboons may be found, for example, in
Goldenberg et al., international patent publication No. WO
91/11465, and in Losman et al., Int. J. Cancer 46:310
(1990) .
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
81 ..
Alternatively, monoclonal anti-Zsig48 antibodies
can be generated. Rodent monoclonal antibodies to
specific antigens may be obtained by methods known to
those skilled in the art (see, for example, Kohler et al.,
Nature 256:495 (1975), Coligan et a1. (eds.}, Current
Protocols in Immunology, Vol. 1, pages 2.5.1-2.6.7 (John
Wiley & Sons 1991) ['"Coligan'"] , Picksley et al.,
"Production of monoclonal antibodies. against proteins
expressed in E. col.i, "" in DNA Cloning 2: Expression
Systems, 2nd Edition., Glover et a1. (eds.), page 93
(Oxford University Press 1995)).
Briefly, monoclonal antibodies can be obtained
by injecting mice with a composition comprising an Zsig48
gene product, verifying the presence of antibody
production by removing a serum sample, removing the spleen
to obtain B-lymphocytes, fusing the B-lymphocytes with
myeloma cells to produce hybridomas, cloning the
hybridomas, selecting positive clones which produce
antibodies to the antigen, culturing the clones that
produce antibodies to the antigen, and isolating the
antibodies from the hybridama cultures.
In addition, an anti-Zsig48 antibody of the
present invention may be derived from a human monoclonal
antibody. Human monoclonal antibodies are obtained from
transgenic mice that have been engineered to produce
specific human antibodies in response to antigenic
challenge. In this technique, elements of the human heavy
and light chain locus are introduced into strains of mice
derived from embryonic stem cell lines that contain
targeted disruptions of the endogenous heavy chain and
light chain loci. The transgenic mice can synthesize human
antibodies specific for human antigens, and the mice can be
used to produce human antibody-secreting hybridomas.
Methods for obtaining human antibodies from transgenic mice
are described, for example, by Green et al., Nature Genet.
CA 02344712 2001-03-30
WO 00/1879b PCT/US99/22970
82
7:13 (1994), Lonberg et al., Nature 368:856 (1994), and
Taylor et al., Int. Immun. 6:579 (1994).
Monoclonal antibodies can be isolated and
purified from hybridoma cultures by a variety of well--
established techniques. Such isolation techniques include
affinity chromatography with Protein-A Sepharose, size-
exclusion chromatography, and ion-exchange chromatography
(see, for example, Coligan at pages 2.7.1-2.7.12 and pages
2.9.1-2.9.3; Baines et al., "Purification of
Immunoglabulin G (IgG)," in Methods in Molecular Biology,
Vol. Z0, pages 79-104 (The Humana Press, Inc. 1992)}.
For particular uses, it may be desirable to
prepare fragments of anti-Zsig48 antibodies. Such
antibody fragments can be obtained, for example, by
proteolytic hydrolysis of the antibody. Antibody
fragments can be obtained by pepsin or papain digestion of
whole antibodies by conventional methods. As an
illustration, antibody fragments can be produced by
enzymatic cleavage of antibodies with pepsin to provide a
5S fragment denoted F(ab')2. This fragment can be further
cleaved using a thiol reducing agent to produce 3.55 Fab'
monovalent fragments. Optionally, the cleavage reaction
can be performed using a blocking group for the sulfhydryl
groups that result from cleavage of disulfide linkages.
As an alternative, an enzymatic cleavage using pepsin
produces two monovalent Fab fragments and an Fc fragment
directly. These methods are described, for example, by
Goldenberg, U.S. patent No. 4,331,647, Nisonoff et al.,
Arch Biochem. Biophys. 89:230 (1960), Porter, Biochem. J.
73:119 (1959), Edelman et al., in Methods in Enzymology
VoI. 3, page 422 (Academic Press 2967), and by Coligan at
pages 2.8.1-2.8.10 and 2.10.-2.10.4.
Other methods of cleaving antibodies, such as
separation of heavy chains to form monovalent light-heavy
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
83
chain fragments, further cleavage of fragments, or other
enzymatic, chemical or genetic techniques may also be
used, so long as the fragments bind to the antigen that is
recognized by the intact antibody.
For example, Fv fragments comprise an
association of VH and VL chains. This association can be
noncovalent, as described by mbar et al., Proc. Nat'1
Acad. Sci. USA 69:2659 (1972). Alternatively, the
variable chains can be linked by an intermolecular
disulfide bond or cross-linked by chemicals such as
glutaraldehyde (see, for example, Sandhu, Crit. Rev.
Biotech. 12:437 (1992)).
The Fv fragments may comprise VH and V~, chains
which are connected by a peptide linker. These single-
chain antigen binding proteins (scFv) are prepared by
constructing a structural gene comprising DNA sequences
encoding the VH and VL domains which are connected by an
oligonucleotide. The structural gene is inserted into an
expression vector which is subsequently introduced into a
host cell, such as E. coZi. The recombinant host cells
synthesize a single polypeptide chain with a linker
peptide bridging the two V domains. Methods for producing
scFvs are described, for example, by Whitlow et al.,
Methods: A Companion to Methods in Enzymology 2:97 (1991)
(also see, Bird et al., Science 242:423 (1988), Ladner et
al., U.S. Patent No. 4,946,778, Pack et al.,
Bio/Techno3ogy 11:1271 (1993), and Sandhu, supra).
As an illustration, a scFV can be obtained by
exposing lymphocytes to Zsig48 polypeptide in v2tro, and
selecting antibody display libraries in phage or similar
vectors (for instance, through use of immobilized or
labeled Zsig48 protein or peptide). Genes encoding
polypeptides having potential Zsig48 polypeptide binding
domains can be obtained by screening random peptide
CA 02344712 2001-03-30
WO 00118796 PCTIUS99122970
84
libraries displayed on phage (phage display) or on
bacteria, such as E. coli. Nucleotide sequences encoding
the polypeptides can be obtained in a number of ways, such
as through random mutagenesis and random polynucleotide
synthesis. These random peptide display libraries can be
used to screen for peptides which interact with a known
target which can be a protein or polypeptide, such as a
ligand or receptor, a biological or synthetic
macromolecule, or organic or inorganic substances.
Techniques for creating and screening such random peptide
display libraries are known in the art (Ladner et al.,
U.S. Patent No. 5,223,409, Ladner et al., U.S. Patent No.
4,946,778, Ladner et al., U.S. Patent No. 5,403,484;
Ladner et aZ., U.S. Patent No. 5,571,698, and Kay et al.,
Phage Display of Peptides and Proteins (Academic Press,
Inc. 1996)) and random peptide display libraries and kits
for screening such libraries are available commercially,
for instance from CLONTECH Laboratories, Inc. (Palo Alto,
CA), Invitrogen Tnc. (San Diego, CA), New England Biolabs,
Inc. (Beverly, MA), and Pharmacia LKB Biotechnology Inc.
(Piscataway, NJ). Random peptide display libraries can be
screened using the Zsig48 sequences disclosed herein to
identify proteins which bind to Zsig48.
Another form of an antibody fragment is a
peptide coding for a single complementarity-determining
region (CDR). CDR peptides ("minimal recognition units")
can be obtained by constructing genes encoding the CDR of
an antibody of interest. Such genes are prepared, for
example, by using the polymerise chain reaction to
synthesize the variable region from RNA of antibody-
producing cells (see, for example, Larrick et al.,
Methods: A Companion to Methods in Enzymology 2:106
(1991), Courtenay-Luck, "Genetic Manipulation of
Monoclonal Antibodies," in Monoclona.Z Antibodies;
Production, Engineering and Clinica3 Application, Ritter
et a.I. (eds.), page 166 (Cambridge University Press 1995),
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
and Ward et al., "Genetic Manipulation and Expression of
Antibodies," in Monoclonal Antibodies: Principles and
Applications, Birch et al., {eds.}, page 137 (Wiley-Liss,
Inc . 1995 ) ) .
5
Alternatively, an anti-Zsig48 antibody may be
derived from a "humanized" monoclonal antibody. Humanized
monoclonal antibodies are produced by transferring mouse
complementary determining regions from heavy and light
10 variable chains of the mouse immunoglobulin into a human
variable domain. Typical residues of human antibodies are
then substituted in the framework regions of the murine
counterparts. The use of antibody components derived from
humanized monoclonal antibodies obviates potential
15 problems associated with the immunogenicity of murine
constant regions. General techniques for cloning murine
immunoglobulin variable domains axe described, for
example, by Orlandi et al., Proc. Nat'1 Acad. Sci. USA
86:3833 (1989). Techniques for producing humanized
20 monoclonal antibodies are described, for example, by Jones
et al., Nature 321:522 (198&), Carter et al., Proc. Nat'1
Acad. Sci. USA 89:4285 (1992), Sandhu, Crit. Rev. Biotech.
12:437 (1992), Singer et al., J. Immun. 150:2844 (1993},
Sudhir (ed.), Antibody Engineering Protocols (Humana
25 Press, Inc. 1995), Kelley, "Engineering Therapeutic
Antibodies," in Protein Engineering: Principles and
Practice, Cleland et a1. (eds.), pages 399-434 (John Wiley
& Sons, Inc. 1996), and by Queen et al., U.S. Patent No.
5,693,762 (1997).
Polyclonal anti-idiotype antibodies can be
prepared by immunizing animals with anti-Zsig48 antibodies
or antibody fragments, using standard techniques. See,
for example, Green et al., "Production of Polyclonal
Antisera," in Methods In Molecular Bio3ogy: Irnmunochemical
Protocols, Manson (ed.}, pages 1-12 (Humana Press 1992}.
Also, see Coligan at pages 2.4.1-2.4.7. Alternatively,
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
86
monoclonal anti-idiotype antibodies can be prepared using
anti-Zsig48 antibodies or antibody fragments as immunogens
with the techniques, described above. As another
alternative, humanized anti-idiotype antibodies or
subhuman primate anti-idiotype antibodies can be prepared
using the above-described techniques. Methods for
producing anti-idiotype antibodies are described, fox
example, by Irie, U.S. Patent No. 5,208,146, Greene, et.
al., U.S. Patent No. 5,637,677, and Varthakavi and
Minocha, J. Gen. Virol. 77:1875 (1996).
Diagnostic Application of Zsig48 Nuc.Ieotide Sequences
Nucleic acid molecules can be used to detect the
expression of a Zsig48 gene in a biological sample. Probe
molecules include double-stranded nucleic acid molecules
comprising the nucleotide sequence of SEQ ID N0:1 or a
fragment thereof, as well as single-stranded nucleic acid
molecules having the complement of the nucleotide sequence
of SEQ ID NO: l, or a fragment thereof. Probe molecules
may be DNA, RNA, oligonucleotides, and the like.
In a basic assay, a single-stranded probe
molecule is incubated with RNA, isolated from a biological
sample, under conditions of temperature and ionic strength
that promote base pairing between the probe and target
Zsig48 RNA species. After separating unbound probe from
hybridized molecules, the amount of hybrids is detected.
Illustrative biological samples include blood, urine,
saliva, tissue biopsy, and autopsy material.
Well-established hybridization methods of RNA
detection include northern analysis and dot/slot blot
hybridization (see, for example, Ausubel (1995) at pages
4-1 to 4-27, and Wu et al. (eds.), "Analysis of Gene
Expression at the RNA Level," in Methods in Gene
Biotechnology, pages 225-239 (CRC Press, Inc. 1997)).
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
87
Nucleic acid probes can be detectably labeled with
radioisotopes such as 32P or 35S . Alternatively, Zsig48 RNA
can be detected with a nonradioactive hybridization method
(see; for example, Isaac (ed.), Protocols for Nucleic Acid
Analysis by Noz2radioactive Probes (Humana Press, Inc.
1993)). Typically, nonradioactive detection is achieved by
enzymatic conversion of chromogenic or chemiluminescent
substrates. Illustrative nonradioactive moieties include
biotin, fluorescein, and digoxigenin.
Zsig48 oligonucleotide probes are also useful far
in viva diagnosis. As an illustration, laF-labeled
oligonucleotides can be administered to a subject and
visualized by positron emission tomography (Tavitian et
al., Nature Medicine 4:467 (1998)).
Numerous diagnostic procedures take advantage of
the polymerase chain reaction (PCR) to increase
sensitivity of detection methods. Standard techniques for
performing PCR are well-known (see, generally, Mathew
(ed.), Protocols in Human Molecular Genetics (Humana
Press, Inc. 1991), White (ed.), PCR Protocols: Current
Methods and Applications (Humana Press, Inc. 1993), Cotter
(ed.), Molecular Diagnosis of Cancer (Humana Press, Inc.
1996), Hanausek and Walaszek (eds.), Tumor Marker
Protocols (Humana Press, Inc. 3.998), Lo (ed.), Clinical
Applications of PCR (Humana Press, Inc. 1998), and Meltzer
(ed.), PCR in Bioanalysis (Humana Press, Inc. 1998)).
One variation of PCR for diagnostic assays is
reverse transcriptase-PCR (RT-PCR). In the RT-PCR
technique, RNA is isolated from a biological sample,
reverse transcribed to cDNA, and the cDNA is incubated
with Zsig48 primers (see, for example, Wu et al. (eds.),
"Rapid Isolation of Specific cDNAs or Genes by PCR," in
Methods in Gene Biotechnology, pages 15-28 (CRC Press,
CA 02344712 2001-03-30
WO 00/18796 PCT/US99122970
8$
Inc. 1997)). PCR is then performed and the products are
analyzed using standard techniques.
As an illustration, RNA is isolated from
biological sample using, for example, the gunadinium-
thiocyanate cell lysis procedure described above.
Alternatively, a solid-phase technique can be used to
isolate mRNA from a cell lysate. A reverse transcription
reaction can be primed with the isolated RNA using random
oligonucleotides, short homopolymers of dT, or Zs.ig48
anti-sense oligomers. Oligo-dT primers offer the
advantage that various mRNA nucleotide sequences are
amplified that can provide control target sequences.
Zsig48 sequences are amplified by the polymerase chain
reaction using two flanking oligonucleotide primers that
are typically 20 bases in length.
PCR amplification products can be detected using
a variety of approaches. For example, PCR products can be
fractionated by gel electrophoresis, and visualized by
ethidium bromide staining. Alternatively, fractionated
PCR products can be transferred to a membrane, hybridized
with a delectably-labeled Zsig48 probe, and examined by
autoradiography. Additional alternative approaches
include the use of digoxigenin-labeled deoxyribonucleic
acid triphosphates to provide chemiluminescence detection,
and the C-TRAK colorimetric assay.
Another approach for detection of Zsig48
expression is cycling probe technology (CPT), in which a
single-stranded DNA target binds with an excess of DNA-
RNA-DNA chimeric probe to form a complex, the RNA portion
is cleaved with RNAase H, and the presence of cleaved
chimeric probe is detected (see, for example, Beggs et
al., J. Clin. Microbiol. 34:2985 (1996), Bekkaoui et al.,
Biotechniques 20:240 (1996)). Alternative methods for
detection of Zsig48 sequences can utilize approaches such
CA 02344712 2001-03-30
WO 00/I$796 PCTlUS99/229T0
g9
as nucleic acid sequence-based amplification (NASBA),
cooperative amplification of templates by cross-
hybridization (CATCH), and the ligase chain reaction (LCR)
(see, for example, Marshall et al., U.S. Patent No.
5,686,272 (1997). Dyer et al., J. Virol. Methods 60:161
(1996), Ehricht et al., Eur. J. Biochem. 243:358 (1997),
and Chadwick et al., J. Virol. Methods 70:59 (1998)).
Other standard methods are known to those of skill in the
art.
Zsig48 probes and primers can also be used to
detect and to localize Zsig48 gene expression in tissue
samples. Methods for such in situ hybridization are well-
known to those of skill in the art (see, for example, Choo
(ed.), In Situ Hybridization Protocols (Humana Press, Inc.
1994), Wu et a1. (eds.), "Analysis of Cellular DNA or
Abundance of mRNA by Radioactive In.Situ Hybridization
IRISH)," in Methods in Gene Biotechnology, pages 259-278
(CRC Press, Inc. 1997}, and Wu et al. (eds.), "Localization
of DNA or Abundance of mRNA by Fluorescence In Situ
Hybridization (RTSH)," in Methods in Gene Biotechnology,
pages 279-289 (CRC Press, Inc. 1997)). Various additional
diagnostic approaches are well-known to those of skill in
the art (see, for example, Mathew (ed.), Protocols in
Human Molecular Genetics (Humana Press, Inc. 1991),
Coleman and Tsongalis, Molecu.~ar Diagnostics (Humana
Press, Inc. 1996), and Elles, Molecular Diagnosis of
Genetic Diseases (Humana Press, Inc., 1996)).
Nucleic acid molecules comprising Zsig48
nucleotide sequences can also be used to determine whether
a subject's chromosomes contain a mutation in the Zsig48
gene which has been mapped to chromosome 7q36.3.
Detectable chromosomal aberrations at the Zsi.g48 gene
locus include, but are not limited to, aneuploidy, gene
copy number changes, insertions, deletions, restriction
CA 02344712 2001-03-30
WO 00!18796 PCTIUS99l22970
site changes and rearrangements. Of particular interest
are genetic alterations that inactivate the Zsig48 gene.
Aberrations associated with the Zsig48 locus at
5 chromosome 7q36.3 can be detected using nucleic acid
molecules of the present invention by employing molecular
genetic techniques, such as restriction fragment length
polymorphism (RFLP) analysis, short tandem repeat (STR)
analysis employing PCR techniques, amplification-
10 refractory mutation system analysis (ARMS), single-strand
conformation polymorphism (SSCP) detection, RNase cleavage
methods, denaturing gradient gel electrophoresis,
fluorescence-assisted mismatch analysis (FAMA), and other
genetic analysis techniques known in the art (see, for
15 example, Mathew (ed.), Protocols in Human Molecular
Genetics (Humans Press, Inc. 1991), Marian, Chesf 208:255
(1995); Coleman and Tsongalis, Molecular Diagnostics
(Human Press, Inc. 1996), Elles (ed.) Molecular Diagnosis
of Genetic Diseases (Humans Press, Inc. 1996), Landegren
20 (ed.), Laboratory Protocols for Mutation Detection (Oxford
University Press 1996), Birren et a1. (eds.), Genome
Analysis, Vol. 2: Detecting Genes (Cold Spring Harbor
Laboratory Press 1998), Dracopoli et al. (eds.), Current
Protocols in Human Genetics (John Wiley & Sons 1998), and
25 Richards and Ward, "Molecular Diagnostic Testing," in
Principles of Molecular Medicine, pages 83-88 (Humans
Press, Inc. 1998)).
The protein truncation test is also useful for
30 detecting the inactivation of a gene in which translation-
terminating mutations produce only portions of the encoded
protein (see, for example, Stoppa-Lyonnet et al., Blood
92:3920 (1998)). According to this approach, RNA is
isolated from a biological sample, and used to synthesize
35 cDNA. PCR is then used to amplify the Zsig48 target
sequence and to introduce an RNA polymerase promoter, a
translation initiation sequence, and an in-frame ATG
CA 02344712 2001-03-30
WO 00/I$796 PCT/US99/22970
91
triplet. PCR products are transcribed using an RNA
polymerase, and the transcripts are translated in vitro
with a T7-coupled reticulocyte lysate system. The
translation products are then fractionated by SDS-PAGE to
determine the lengths of the translation products. The
protein truncation test is described, for example, by
Dracopoli et al..(eds.), Current Protocols in Human
Genetics, pages 9.11.1 - 9.12.18 (John Wiley & Sons 1998).
In a related approach, Zsig48 protein is
isolated from a subject, the molecular weight of the
isolated Zsig48 protein is determined, and then compared
with the molecular weight a normal Zsig48 protein, such as
a protein having the amino acid sequence of SEQ ID NOs:2,
3, 4 or 5. A substantially lower molecular weight for the
isolated Zsig48 protein is indicative that the protein is
truncated. In this context, "substantially lower
molecular weight" refers to at least about 10 percent
Lower, and preferably, at least about 25 percent lower.
The Zsig48 protein may be isolated by various procedures
known in the art including immunoprecipitation, solid
phase radioimmunoassay, enzyme-linked immun.osorbent assay,
or Western blotting. The molecular weight of the isolated
Zsig48 protein can be determined using standard
techniques, such as SDS-polyacrylamide gel
electrophoresis.
The present invention also contemplates kits for
performing a diagnostic assay for Zsig48 gene expression or
to detect mutations in the Zsig48 gene. Such kits comprise
nucleic acid probes, such as double-stranded nucleic acid
molecules comprising the nucleotide sequence of SEQ ID
N0:1, or a fragment thereof, as well as single-stranded
nucleic acid molecules having the complement of the
nucleotide sequence of SEQ ID NO:1, or a fragment thereof.
Probe molecules may be DNA, RNA, oligonucleotides, and the
CA 02344712 2001-03-30
WO OO1i8796 PCT/US99/22970
92
like. Kits may comprise nucleic acid primers for
performing PCR.
Preferably, such a kit contains all the
necessary elements to perform a nucleic acid diagnostic
assay described above. A kit will comprise at least one
container comprising a Zsig48 probe or primer. The kit
may also comprise a second container comprising one or
more reagents capable of indicating the presence of Zsig48
sequences. Examples of such indicator reagents include
detectable labels such as radioactive labels,
fluorochromes, chemiluminescent agents, and the like. A
kit may also comprise a means for conveying to the user
that the Zsig48 probes and primers are used to detect
Zsig48 gene expression. For example, written instructions
may state that the enclosed nucleic acid molecules can be
used to detect either a nucleic acid molecule that encodes
Zsig48, or a nucleic acid molecule having a nucleotide
sequence that is complementary to an Zsig48-encoding
nucleotide sequence. The written material can be applied
directly to a container, or the written material can be
provided in the form of a packaging insert.
Diagnostic Application of Anti-Zs.ig48 Antibodies
The present invention contemplates the use of
anti-Zsig48 antibodies to screen biological samples in
vitro for the presence of Zsig48. In one type of in vztro
assay, anti-Zsig48 antibodies are used in liquid phase.
Fox example, the presence of Zsig48 in a biological sample
can be tested by mixing the biological sample with a trace
amount of labeled Zsig48 and an anti-Zsig48 antibody under
conditions that promote binding between Zsig48 and its
antibody. Complexes of Zsig48 and anti-Zsig48 in the
sample can be separated from the reaction mixture by
contacting the complex with an immobilized protein which
binds with the antibody, such as an Fc antibody or
CA 02344712 2001-03-30
WO 00118796 PCT/US99l22970
93
Staphylococcus protein A. The concentration of Zsig48 in
the biological sample will be inversely proportional to the
amount of labeled Zsig48 bound to the antibody and directly
related to the amount of free Zsig48. Illustrative
biological samples include blood, urine, saliva, tissue
biopsy, and autopsy material.
Alternatively, in vitro assays can be performed
in which anti-Zsig48 antibody is bound to a solid-phase
carrier. For example, antibody can be attached to a
polymer, such as aminodextran, in order to link the
antibody to an insoluble support such as a polymer-coated
bead, a plate or a tube. Other suitable in vitro assays
will be readily apparent to those of skill in the art.
In another approach, anti- Zsig48 antibodies can
be used to detect Zsig48 in tissue sections prepared from a
biopsy specimen. Such immunochemical detection can be used
to determine the relative abundance of Zsig48 and to
determine the distribution of Zsig48 in the examined
tissue. General immunochemistry techniques are well
established (see, for example, Ponder, "Cell Marking
Techniques and Their Application," in Mammalian
Development: A Practical Approach, Monk (ed.), pages 115-38
(IRL Press 1987), Coligan at pages 5.8.1-5.8.8, Ausubel
(1995) at pages 14.6.1 to 14.6.13 (Wiley Interscience
1990), and Manson (ed.), Methods In Molecular Biology, Vol.
10: Immunochemical Protocols (The Humana Press, Ins.
1992) ) .
Immunochemical detection can be performed by
contacting a biological sample with an anti-Zsig48
antibody, and then contacting the biological sample with a
detestably labeled molecule which binds to the antibody.
For example, the delectably labeled molecule can comprise
an antibody moiety that binds to anti-Zsig48 antibody.
Alternatively, the anti-Zsig48 antibody can be conjugated
CA 02344712 2001-03-30
WO 00/1$796 PCT/US99/22970
94
with avidin/streptavidin (or biotin) and the detestably
labeled molecule can comprise biotin (or
avidin/streptavidin). Numerous variations of this basic
technique are well-known to those of skill in the art.
Alternatively, an anti-Zsig48 antibody can be
conjugated with a detectable label to form an anti-Zsig48
immunoconjugate. Suitable detectable labels include, for
example, a radioisotope, a fluorescent label, a
chemiluminescent label, an enzyme label, a bioluminescent
label or colloidal gold. Methods of making and detecting
such detestably-labeled immunoconjugates are well-known to
those of ordinary skill in the art, and are described in
more detail below.
The detectable label can be a radioisotope that
is detected by autoradiography. Isotopes that are
particularly useful for the purpose of the present
invention are 3H, 1251 ~ 131I, ass and 14C.
Anti-Zsig48 immunoconjugates can also be labeled
with a fluorescent compound. The presence of a
fluorescently-labeled antibody is determined by exposing
the immunoconjugate to light of the proper wavelength and
detecting the resultant fluorescence. Fluorescent labeling
compounds include fluorescein isothiocyanate, rhodamine,
phycoerytherin, phycocyanin, allophycocyanin, o-phthal-
dehyde and fluorescamine.
Alternatively, anti-Zsig48 immunoconjugates can
be detestably labeled by coupling an antibody component to
a chemiluminescent compound. The presence of the
chemiluminescent-tagged immunoconjugate is determined by
detecting the presence of luminescence that arises during
the course of a chemical reaction. Examples of chemi-
luminescent labeling compounds include luminol, isoluminol,
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
9S
an aromatic acridinium ester, an imidazole, an acridinium
salt and an oxalate ester.
Similarly, a bioluminescent compound can be used
to label anti-Zsig48 immunoconjugates of the present
invention. Bioluminescence is a type of chemiluminescence
found in biological systems in which a catalytic protein
increases the efficiency of the chemiluminescent reaction.
The presence of a bioluminescent protein is determined by
detecting the presence of luminescence. Bioluminescent
compounds that are useful for labeling include luciferin,
luciferase and aequorin.
Alternatively, anti-Zsig48 immunoconjugates can
be delectably labeled by linking an anti-Zsig48 antibody
component to an enzyme. When the anti-Zsig48-enzyme
conjugate is incubated in the presence of the appropriate
substrate, the enzyme moiety reacts with the substrate to
produce a chemical moiety rahich can be detected, for
example, by spectropholometric, fluorometric or visual
means. Examples of enzymes that can be used to detestably
label polyspecific immunoconjugates include ~i-galac-
tosidase, glucose oxidase, peroxidase and alkaline
phosphatase.
Those of skill in the art will know of other
suitable labels which can be employed in accordance with
the present invention. The binding of marker moieties to
anti-Zsig48 antibodies can be accomplished using standard
techniques known to the art. Typical methodology in this
regard is described by Kennedy et al., Clin. Ch.zm. Acta
70:1 (1976), Schurs et al., Clin. Ch.im. Acta 8z:1 (1977),
Shih et al., Int'1 J. Cancer 46:3101 (1990), Stein et al.,
Cancer Res. 50:1330 (1990), and Coligan, supra.
Moreover, the convenience and versatility of
immunochemical detection can be enhanced by using anti-
CA 02344712 2001-03-30
WO 00/1$796 PCT/US99122970
96
Zsig48 antibodies that have been conjugated with avidin,
streptavidin, and biotin (see, for example, Wilchek et a1.
(eds.), "Avidin-Biotin Technology," Methods In Enzymology,
Vol. 384 (Academic Press 1990), and Bayer et al.,
"Immunochemical Applications of Avidin-Biotin Technology,"
in Methods In Molecular Biology, Vol. I0, Manson (ed.),
pages 149-162 (The Humana Press, Inc. 1992).
Methods for performing immunoassays are well-
established. See, for example, Cook and Self, "Monoclonal
Antibodies in Diagnostic Immunoassays," in Monoclonal
Antibodies: Production, Engineering, and Clinical
Application, Ritter and Ladyman (eds.), pages 180-208,
(Cambridge University Press, 1995), Perry, "The Role of
Monoclonal Antibodies in the Advancement of Immunoassay
Technology, " in Monoclonal Antibodies: Priz~ciples and
Applications, Birch and Lennox (eds.), pages 107-120
(Wiley-Liss, Inc. 1995), and Diamandis, Immunoassay
(Academic Press, Inc. 1996). In a related approach, biotin-
or FITC-labeled Zsig48 can be used to identify cells that
bind Zsig48. Such can binding can be detected, for example,
using flow cytometry.
The present invention also contemplates kits for
performing an immunological diagnostic assay for Zsig48
gene expression. Such kits comprise at least one container
comprising an anti-Zsig48 antibody, or antibody fragment.
A kit may also comprise a second container comprising one
or more reagents capable of indicating the presence of
Zsig48 antibody or antibody fragments. Examples of such
indicator reagents include detectable labels such as a
radioactive label, a fluorescent label, a chemiluminescent
label, an enzyme label, a bioluminescent label, colloidal
gold, and the like. A kit may also comprise a means fox
conveying to the user that Zsig48 antibodies or antibody
fragments are used to detect Zsig48 protein. For example,
written instructions may state that the enclosed antibody
CA 02344712 2001-03-30
WO 00!18796 PCT/US99/22970
97
or antibody fragment can be used to detect Zsig48. The
written material can be applied directly to a container,
or the written material can be provided in the form of a
packaging insert.
Thexapeutic Uses of Polypeptides Having Zsig48 Activity
Molecules of the present invention can be used
to promote proliferation of peripheral blood leukocytes.
This can be useful in treating cancer patients whose
leukocytes have been depleted by chemotherapy, radiation
or illness. Zsig48 can be administered to patients
receiving bone marrow transplants to promote proliferation
of leukocytes produced by the transplanted marrow. Also
Zsig48 would be useful in treating immunosuppressed
individuals as in the elderly or human immmundeficiency
virus (HIV) infected individuals. Zsig48 can also be used
as a vaccine adjuvant to be administered with vaccines.
Generally, a dosage of Zsig48 administered for
inducing the proliferation of T-cells, B-cells and
monocytes (or Zsig48 analog or fusion protein) will vary
depending upon such factors as the patient's age, weight,
height, sex, general medical condition and previous
medical history. Typically, it is desirable to provide
the recipient with a dosage of Zsig48 which is in the
range of from about 1 pg/kg to 10 mg/kg per day (amount of
agent/body weight of patient), preferably the dose will
range from 4 - 100 ~.g/kg per day administered
intravenously although a lower or higher dosage also may
be administered as circumstances dictate.
Administration of a molecule having Zsig48
activity to a subject can be intravenous, intraarterial,
intraperitoneal, intramuscular, subcutaneous,
intrapleural, intrathecal, by perfusion through a regional
CA 02344712 2001-03-30
WO 00118796 PCT/US99/22970
98
catheter, or by direct intralesional injection. When
administering therapeutic proteins by injection, the
administration may be by continuous infusion or by single
or multiple boluses. Alternatively, Zsig48 can be
administered as a controlled release formulation. Far
example, Cleland and Jones, Pharm. Res. 13:1464 (1995),
describe a method for producing interferon-y encapsulated
in polylactic-coglycolic microspheres.
Additional routes of administration include
oral, dermal, mucosal-membrane, pulmonary, and
transcutaneous. Oral delivery is suitable for polyester
microspheres, zein microspheres, proteinoid microspheres,
polycyanoacrylate rnicrospheres, and lipid-based systems
jsee, for example, DiBase and Morrel, "Oral Delivery of
Microencapsulated Proteins," in Protein De.Iivery: Physical
Systems, Sanders and Hendren (eds.), pages 255-288 (Plenum
Press 1997)]. The feasibility of an intranasal delivery
is exemplified by such a mode of insulin administration
(see, for example, Hinchcliffe and Illum, Adv. Drug Deliv.
Rev. 35:199 (1999)]. Dry or liquid particles comprising
Zsig48 can be prepared and inhaled with the aid of dry-
powder dispersers, liquid aerosol generators, or
nebulizers [e. g., Pettit and Gombotz, TIBTE'CH 16:343
(1998); Patton et aZ., Adv. Drug Deliv. Rev. 35:235
(1999)). This approach is illustrated by the AERX diabetes
management system, which is a hand-held electronic inhaler
that delivers aerosolized insulin into the. lungs. Studies
have shown that proteins as large as 48,000 kDa have been
delivered across skin at therapeutic concentrations with
the aid of low-frequency ultrasound, which illustrates the
feasibility of transcutaneous administration [Mitragotri
et al., Science 269:850 (1995)]. Transdermal delivery
using electroporation provides another means to administer
Zsig48 (Potts et al., Pharm. Biotechnol. 20:213 11997)).
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
99
A pharmaceutical composition comprising a
protein, polypeptide, or peptide having Zsig48 activity
can be formulated according to known methods to prepare
pharmaceutically useful compositions, wherein the
therapeutic proteins are combined in a mixture with a
pharmaceutically acceptable carrier. A composition is
said to be a "pharmaceutically acceptable carrier" if its
administration can be tolerated by a recipient patient:
Sterile phosphate-buffered saline, water, TWEEN~ 80 with
mannitol and sodium acetate are examples of a
pharmaceutically acceptable carriers and additives. Other
suitable carriers are well-known to those in the art.
See, for example, Gennaro (ed.), Remington's
Pharmaceutical Sciences, 19th Edition (Mack Publishing
Company 19 9 5 ) .
For purposes of therapy, molecules having Zsig48
activity and a pharmaceutically acceptable carrier are
administered to a patient in a therapeutically effective
amount. A combination of a protein, polypeptide, or
peptide having Zsig48 activity and a pharmaceutically
acceptable carrier is said to be administered in a
"therapeutically effective amount" if the amount
administered is physiologically significant. An agent is
physiologically significant if its presence results in a
detectable change in the physiology of a recipient
patient. In the present context, an agent is
physiologically significant if its presence results in the
proliferation T-cells, B-cells ar monocytes.
A pharmaceutical composition comprising
molecules having Zsig48 activity can be furnished in
liquid form, in an aerosol, or in solid form. Proteins
having Zsig48 activity, such as human or murine Zsig48,
can be administered as a conjugate with a pharmaceutically
acceptable water-soluble polymer moiety, as described
above. As an illustration, a Zsig~B-polyethylene glycol
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
100
conjugate is useful to increase the circulating half-life
of the Zsig48, and to reduce the immunogenicity of the
polypeptide. Liquid forms, including liposome-
encapsulated formulations, are illustrated by injectable
solutions and oral suspensions. Exemplary solid forms
include capsules, tablets, and controlled-release forms,
such as a miniosmotic pump or an implant. Other dosage
forms can be devised by those skilled in the art, as
shown, for example, by Ansel and Popovich, Pharmaceutical
Dosage Forms and Drug Delivery Systems, 5th Edition (Lea &
Febiger 1990), Gennaro (ed.), Remington's Pharmaceutical
Sciences, 19th Edition (Mack Publishing Company 7.995) , and
by Ranade and Hollinger, Drug Delivery Systems (CRC Press
1996).
As an illustration, Zsig48 pharmaceutical
compositions may be supplied as a kit comprising a
container that comprises Zsig48, a Zsig48 agonist, or a
Zsig48 antagonist (e.g., an anti- Zsig48 antibody or
antibody fragment). Zsig48 can be provided in the form of
a solution for injection for single or multiple doses, or
as a sterile powder that will be reconstituted before
injection. Alternatively, such a kit can include a dry-
powder disperser, liquid aerosol generator, or nebulizer
for administration of a therapeutic polypeptide. Such a
kit may further comprise written information on
indications and usage of the pharmaceutical composition.
Moreover, such information may include a statement that
the Zsig48 composition is contraindicated in patients with
known hypersensitivity to Zsig48.
Therapeutic Uses of Zsig48 NucZe4tide Sequences
Immunomodulator Zsig48 genes can be introduced
into a subject to enhance immunological responses by
causing localized expression of Zsig48. As an
illustration "immunomodulator gene therapy" has been
CA 02344712 2001-03-30
WO OOII8796 PCTlUS99I22970
101
examined in model systems using vectors that express LL-2,
IL-3, IL-4, IL-6, IL-10, IL-12, IL-15, interferon-y, tumor
necrosis factor-a, or granulocyte-macrophage colony-
stimulating factor [see, for example, Cao et al., ~T.
Gastroenterol. Hepatol. 1I:1053 (1996), Tahara et al.,
Ann. N. Y. Acad. Sci. 795:275 (1996), Rakhmilevich et al.,
Hum. Gene Ther. 8:1303 (1997), and Cao et al.,
Transplantation 65:325 (1998)1. The present invention
includes the use of Zsig48 nucleotide sequences to augment
20 the immune system to promote proliferation of leukocytes
especially T-cells, B-cells or monocytes. In addition, a
therapeutic expression vector can be provided that
inhibits Zsig48 gene expression, such as an anti-sense
molecule, a ribozyme, or an external guide sequence
molecule.
There are numerous approaches to introduce a
Zsig48 gene to a subject, including the use of recombinant
host cel2s that express Zsig48, delivery of naked nucleic
acid encoding Zsig48,use of a cationic lipid carrier with
a nucleic acid molecule that encodes Zsig48, and the use
of viruses that express Zsig48, such as recombinant
retroviruses, recombinant adeno-associated viruses,
recombinant adenoviruses, and recombinant Herpes simplex
viruses [HSV] {see, for example, Mulligan, Science 260:926
(1993), Rosenberg et al., Science 242:1575 (1988), LaSalle
et aI . , Science 259: 988 (1993 ) , 't~lolff et a1 . , Science
247:1465 {1990), Breakfield and Deluca, The New .Biologist
3:203 (1991) ) . In an ex vivo approach, for example, cells
are isolated from a subject, transfected with a vector
that expresses a Zsig48 gene, and then transplanted into
the subject.
In order to effect expression of a Zsig48 gene,
an expression vector is constructed in which a nucleotide
sequence encoding a Zsig48 gene is operably linked to a
core promoter, and optionally a regulatory element, to
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
1 a2
control gene transcription. The general requirements of an
expression vector are described above.
Alternatively, a Zsig48 gene can be delivered
using recombinant viral vectors, including for example,
adenoviral vectors [e. g., Kass-Eisler et al., Proc. Nat'1
Acad. Sc.i. USA 90:11498 (1993), Kolls et al., Proc. Nat'1
Acad. Sci. USA 91:215 (1994), Li et al., Hum. Gene Ther.
4:403 (1993), Vincent et al., Nat. Genet. 5:130 (1993),
and Zabner et al., Cell 75:207 (1.993)], adenovirus-
associated viral vectors (Flotte et al., Proc. Nat'I Acad.
Sci. USA 90:10613 (1993)3, alphaviruses such as Semliki
Forest Virus and Sindbis Virus [Hertz and Huang, J. Vir.
66:857 (1992), Raju and Huang, J. Vir. 65:2501 (1991), and
Xiong et al., Science 243:1188 (1989)] , herpes viral
vectors [e. g., U.S. Patent Nos. 4,769,331, 4,859,587,
5,288,641 and 5,328,688), parvovirus vectors (Koering et
al., Hum. Gene Therap. 5:457 (1994)], pox virus vectors
[Ozaki et al., Biochem. Biophys. Res. Comm. 193:653
(1993), Panicali and Paoletti, Proc. Nat'1 Acad. Sc.z. USA
79:4927 (1982)], pox viruses, such as canary pox virus or
vaccinia virus [Fisher-Hoch et al., Proc. Nat'1 Acad. Sci.
USA 86:317 (1989), and Flexner et aZ., Ann. N.Y. Acad.
Sci. 569:86 (1989)], and retroviruses (e. g., Baba et al.,
J. Neurosurg 79:729 (1993), Ram et al., Cancer Res. 53:83
(1993), Takamiya et al., J. Neurosci. Res 33:493 (1992),
Vile and Hart, Cancer Res. 53:962 (1993), Vile and Hart,
Ca.rl.cer Res. 53:3860 (1993) , and Anderson et al., U.S.
Patent No. 5,399,346). Within various embodiments, either
the viral vector itself, or a viral particle which
contains the viral vector may be utilized in the methods
and compositions described below.
As an illustration of one system, adenovirus, a
double-stranded DNA virus, is a well-characterized gene
transfer vector for delivery of a heterologous nucleic
acid molecule (for a review, see Becker et al., Meth. Cell
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
103
Biol. 43:161 (1994); Douglas and Curiel, Science &
Medicine 4:44 (1997)]. The adenovirus system offers
several advantages including: (i) the ability to
accommodate relatively large DNA inserts, (ii) the ability
to be grown to high-titer, (iii) the ability to infect a
broad range of mammalian cell types, and (iv) the ability
to be used with many different promoters including
ubiquitous, tissue specific, and regulatable promoters.
In addition, adenoviruses can be administered by
intravenous injection, because the viruses are stable in
the bloodstream.
Using adenovirus vectors where portions of the
adenovirus genome are deleted, inserts are incorporated
into the viral DNA by direct ligation or by homologous
recombination with a co-transfected plasmid. In an
exemplary system, the essential E1 gene is deleted from
the viral vector, and the virus will not replicate unless
the E1 gene is provided by the host cell. When
intravenously administered to intact animals, adenovirus
primarily targets the liver. Although an adenoviral
delivery system with an E1 gene deletion cannot replicate
in the host cells, the host s tissue will express and
process an encoded heterologous protein. Host cells will
also secrete the heterologous protein if the corresponding
gene includes a secretory signal sequence. Secreted
proteins will enter the circulation from tissue that
expresses the heterologous gene,(e.g., the highly
vascularized liver).
Moreover, adenoviral vectors containing various
deletions of viral genes can be used to reduce or
eliminate immune responses to the vector. Such
adenoviruses are El-deleted, and in addition, contain
deletions of E2A or E4 (Lusky et al., J. Virol. 72:2022
(1998}; Raper et al., ~luman Gene Therapy 9:671 (1998)).
The deletion of E2b has also been reported to reduce
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
104
immune responses (Amalfitano et al . , J. Viro1. 72: 926
(1998)). By deleting the entire adenovirus genome, very
large inserts of heterologous DNA can be accommodated.
Generation of so called "gutless" adenoviruses, where all
viral genes are deleted, are particularly advantageous for
insertion of large inserts of heterologous DNA [for a
review, see Yeh. and Perricaudet, FASEB J. 11:615 (1997)).
High titer stocks of recombinant viruses capable
of expressing a therapeutic gene can be obtained from
infected mammalian cells using standard methods. For
example, recombinant HSV can be prepared in Vero cells, as
described by Brandt et al., J. Gen. Virol. 72:2043 (1991),
Herold et al., J. Gen. Virol. 75:1211 (1994), Visalli and
Brandt, Virology 385:419 (1991) , Grau et al. , Invest.
Ophtha.Imo~. Vis. Sci. 30:2474 (1989) , Brandt et al., J.
Virol. Meth. 36:209 (1992), and by Brown and MacLean
(eds.). HSV Virus Protocols (Humana Press 1997).
Alternatively, an expression vector comprising a
Zsig48 gene can be introduced into a subject's cells by
lipofection in vi.vo using liposomes. Synthetic cationic
lipids can be used to prepare liposomes for in vivo
transfection of a gene encoding a marker [Felgner et al.,
Proc. Nat'1 Acad. Sci. USA 84:7413 (1987); Mackey et al.,
Proc. Nat'1 Acad. Sci. USA 85:8027 (1988)]. The use of
lipofection to introduce exogenous genes into specific
organs in vivo has certain practical advantages.
Liposomes can be used to direct transfection to particular
cell types, which is particularly advantageous in a tissue
with cellular heterogeneity, such as the pancreas, liver,
kidney, and brain. Lipids may be chemically coupled to
other molecules for the purpose of targeting. Targeted
peptides (e. g., hormones or neurotransmitters), proteins
such as antibodies, or non-peptide molecules can be
coupled to liposomes chemically.
CA 02344712 2001-03-30
WO 00/18796 PC1'/US99/22970
105
Electroporation is another alternative mode of
administration. For example, Aihara and Miyazaki, Nature
Biotechnology 26:867 (1998); have demonstrated the use of
in vivo electroporation for gene transfer into muscle.
In an alternative approach to gene therapy, a
therapeutic gene may encode a Zsig48 anti-sense RNA that
inhibits the expression of Zsig48. Suitable sequences for
anti-sense molecules can be derived from the nucleotide
sequences of Zsig48 disclosed herein.
Alternatively, an expression vector can be
constructed in which a regulatory element is operably
linked to a nucleotide sequence that encodes a ribozyme.
Ribozymes can be designed to express endonuclease activity
that is directed to a certain target sequence in a mRNA
molecule (see, for example, Draper and Macejak, U.S.
Patent No. 5,496,698, McSwiggen, U.S. Patent No.
5,525,468, Chowrira and McSwiggen, U.S. Patent No.
5,631,359, and Robertson and Goldberg, U.S. Patent No.
5,225,337). In the context of the present invention,
ribozymes include nucleotide sequences that bind with
Zsig48 mRNA.
In another approach, expression vectors can be
constructed in which a regulatory element directs the
production of RNA transcripts capable of promoting RNase P-
mediated cleavage of mRNA molecules that encode a Zsig48
gene. According to this approach, an external guide
sequence can be constructed for directing the endogenous
ribozyme, RNase P, to a particular species of intracellular
mRNA, which is subsequently cleaved by the cellular
ribozyme (see, for example, Altman et al., U.S: Patent No.
5,168,053, Yuan et al., Science 263:1269 {1994}, Pace et
a.~., international publication No. WO 96/18733, George et
al., international publication No. W0 96/21731, and Werner
et al., international publication No. WO 97/33991).
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
106
Preferably, the external guide sequence comprises a ten to
fifteen nucleotide sequence complementary to Zszg48 mRNA,
and a 3'-NCCA nucleotide sequence, wherein N is preferably
a purine. The external guide sequence transcripts bind to
the targeted mRNA species by the formation of base pairs
between the mRNA and the complementary external guide
sequences, thus promoting cleavage of mRNA by RNase P at
the nucleotide located at the 5'-side of the base-paired
region.
In general, the dosage of a composition
comprising a therapeutic vector having a Zs.i.g48 nucleotide
acid sequence, such as a recombinant virus, will vary
depending upon such factors as the subject's age, weight,
height, sex, general medical condition and previous
medical history. Suitable routes of administration of
therapeutic vectors include intravenous injection,
intraarterial injection, intraperitoneal injection,
intramuscular injection, intratumoral injection, and
injection into a cavity that contains a tumor. As an
illustration, Horton et al., Proe. Nat'1 Acad. Sci. USA
96:1553 (1999), demonstrated that intramuscular injection
of plasmid DNA encoding interferon-a produces potent
antitumor effects on primary and metastatic tumors in a
marine model.
A composition comprising viral vectors, non-
viral vectors, or a combination of viral and non-viral
vectors of the present invention can be formulated
according to known methods to prepare pharmaceutically
useful compositions, whereby vectors or viruses are
combined in a mixture with a pharmaceutically acceptable
carrier. As noted above, a composition, such as
phosphate-buffered saline is said to be a
"pharmaceutically acceptable carrier" if its
administration can be tolerated by a recipient subject.
Other suitable carriers are well-known to those in the art
CA 02344712 2001-03-30
WO 00/1$796 PCT/US99122970
I07
(see, for example, Remington's Pharmaceutical Sciences,
19th Ed. (Mack Publishing Co. 1995), and Gilman's the
Pharmacological Basis of Therapeutics, 7th Ed. (MacMillan
Publishing Co. 1985)).
For purposes of therapy, a therapeutic gene
expression vector, or a recombinant virus comprising such
a vector, and a pharmaceutically acceptable carrier are
administered to a subject in a therapeutically effective
amount. A combination of an expression vector (or virus)
and a pharmaceutically acceptable carrier is said to be
administered in a "therapeutically effective amount" if
the amount administered is physiologically significant.
An agent is physiologically significant if its presence
results in a detectable change in the physiology of a
recipient subject. In the present context, an agent is
physiologically significant if its presence causes
proliferation T-cells, B-cells or monocytes.
When the subject treated with a therapeutic gene
expression vector or a recombinant virus is a human, then
the therapy is preferably somatic cell gene therapy. That
is, the preferred treatment of a human with a therapeutic
gene expression vector or a recombinant virus does not
entail introducing into cells a nucleic acid molecule that
can form part of a human germ line and be passed onto
successive generations (i.e., human germ line gene
therapy).
Production of Transgenic Mice
Transgenic mice can be engineered to over-
express the human Zsig48 gene in all tissues or under the
control of a tissue-specific or tissue-preferred
regulatory element. These over-producers of Zsig48 can be
used to characterize the phenotype that results from over-
expression, and the transgenic animals can serve as models
CA 02344712 2001-03-30
WO 00/18796 PCT/US99122970
108
for human disease caused by excess Zsig48. Transgenic mice
that over-express Zsig48 also provide model bioreactors
for production of Zsig48 in the milk or blood of larger
animals. Methods for producing transgenic mice are well-
known to those of skill in the art [see, for example,
Jacob, "Expression and Knockout of Interferons in
Transgenic Mice," in Overexpression and Knockout of
Cytokines in Transgenic Mice, Jacob (ed.), pages 111-124
(Academic Press, Ltd. 1994), Monastersky and Robl (eds.),
Strategies in Transgenic Animal Science (ASM Press 2995),
and Abbud and Nilson, "Recombinant Protein Expression in
Transgenic Mice," in Gene Expression Systems: Using Nature
for the Art of Expression, Fernandez and Hoeffler (eds.),
pages 367-397 (Academic Press, Inc. 1999)].
For example, a method for producing a transgenic
mouse that expresses a Zsig48 gene can begin with adult,
fertile males {studs) (B6C3f1, 2-8 months of age (Taconic
Farms, Germantown, NY)), vasectomized males (duds)
(B6D2f1, 2-8 months, (Taconic Farms)), prepubescent
fertile females (donors) (B6C3f1, 4-5 weeks, (laconic
Farms)) and adult fertile females {recipients) (B6D2f1, 2--
4 months, (laconic Farms)). The donors are acclimated for
one week and then injected with approximately 8 IU/mouse
of Pregnant Mare's Serum gonadotrophin (Sigma Chemical
Company; St. Louis, MO) I.P., and 46-47 hours later, 8
IU/mouse of human Chorionic Gonadotropin (hCG (Sigma))
I.P, to induce superovulation. Donors are mated with
studs subsequent to hormone injections. Ovulation
generally occurs within 13 hours of hCG injection.
Copulation is confirmed by the presence of a vaginal plug
the morning following mating. Fertilized eggs are
collected under a surgical scope. The oviducts are
collected and eggs are released into urinanalysis slides
containing hyaluronidase (Sigma ). Eggs are washed once in
hyaluronidase, and twice in Whitten's W640 medium
{described, for example, by Menino and O'Claray, Bio.I.
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
109
Reprod. 77:159 {1986), and Dienhart and Downs, Zygote
4:129 (199&)) that has been incubated with 5% CO2, 5% 02,
and 90% N2 at 37°C. The eggs are then stored in a 37°C/5%
COZ incubator until microinjection.
Ten to twenty micrograms of plasmid DNA
containing a Zsig48 encoding sequence is linearized, gel-
purified, and resuspended in 10 mM Tris-HCl {pH 7.4), 0.25
mM EDTA (pH 8.0), at a final concentration of 5-10
nanograms per microliter for microinjection. For example,
the Zsig48 encoding sequences can encode the amino acid
sequence of SEQ ID NOs: 2, 3, 4 or 5. Plasmid DNA is
microinjected into harvested eggs contained in a drop of
W640 medium overlaid by warm, C02-equilibrated~mineral oil.
The DNA is drawn into an injection needle (pulled from a
0.75mm ID, 1mm OD borosilicate glass capillary), and
injected into individual eggs. Each egg is penetrated
with the injection needle, into one or both of the haploid
pronuclei. Picoliters of DNA are injected into the
pronuclei, and the injection needle withdrawn without
coming into contact with the nucleoli. The procedure is
repeated until all the eggs are injected. Successfully
microinjected eggs axe transferred into an organ tissue-
culture dish with pre-gassed W640 medium for storage
overnight in a 37°C/5% C02 incubator.
The following day, two-cell embryos are
transferred into pseudopregnant recipients. The recipients
are identified by the presence of copulation plugs, after
copulating with vasectomized duds. Recipients are
anesthetized and shaved on the dorsal left side and
transferred to a surgical microscope. A small incision is
made in the skin and through the muscle wall in the middle
of the abdominal area outlined by the ribcage, the saddle,
and the hind leg, midway between knee and spleen. The
reproductive organs are exteriorized onto a small surgical
drape. The fat pad is stretched out over the surgical
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99122970
110
drape, and a baby serrefine (Roboz, Rockville, MD) is
attached to the fat pad and left hanging over the back of
the mouse, preventing the organs from sliding back in.
With a fine transfer pipette containing mineral oil
followed by alternating W640 and air bubbles, 12-17
healthy two-cell embryos from the previous day's injection
are transferred into the recipient. The swollen ampulla is
located and holding the oviduct between the ampulla and
the bursa, a nick in the oviduct is made with a 28 g
needle close to the bursa, making sure not to tear the
ampulla or the bursa.
The pipette is transferred into the nick in the
oviduct, and the embryos are blown in, allowing the first
air bubble to escape the pipette. The fat pad is gently
pushed into the peritoneum, and the reproductive organs
allowed to slide in. The peritoneal wall is closed with
one suture and the skin closed with a wound clip. The
mice recuperate on a 37°C slide warmer for a minimum of
four hours. The recipients are returned to cages in pairs,
and allowed 19-21 days gestation. After birth, 19-21 days
postpartum is allowed before weaning. The weanlings are
sexed and placed into separate sex cages, and a 0.5 cm
biopsy (used for genotyping) is snipped off the tail with
clean scissors. Genomic DNA is prepared from the tail
snips using, for example, a QTAGEN DNEASY kit following
the manufacturer's instructions. Genomic DNA is analyzed
by PCR using primers designed to amplify a Zsig48 gene or
a selectable marker gene that was introduced in the same
plasmid. After animals are confirmed to be transgenic,
they are back-crossed into an inbred strain by placing a
transgenic female with a wild-type male, or a transgenic
male with one or two wild-type female(s). As pups are
born and weaned, the sexes are separated, and their tails
snipped for genotyping.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
111
To check for expression of a transgene in a live
animal, a partial hepatectomy is performed. A surgical
prep is made of the upper abdomen directly below the
zyphoid process. Using sterile technique, a small 1.5-
2 cm incision is made below the sternum and the left
lateral lobe of the liver exteriorized. Using 4-0 silk, a
tie is made around the lower lobe securing it outside the
body cavity. An atraumatic clamp is used to hold the tie
while a second loop of absorbable Dexon (American
Cyanamid; Wayne, N.J.7 is placed praximal to the first
tie. A distal cut is made from the Dexon tie and
approximately 100 mg of the excised liver tissue is placed
in a sterile petri dish. The excised liver section is
transferred to a 14 ml polypropylene round bottom tube and
snap frozen in liquid nitrogen and then stored on dry ice.
The surgical site is closed with suture and wound clips,
and the animal's cage placed on a 37°C heating pad for
24 hours post operatively. The animal is checked daily
post operatively and the wound clips removed 7-10 days
after surgery. The expression level of Zsig48 mRNA is
examined for each transgenic mouse using an RNA solution
hybridization assay or polymerase chain reaction.
In addition to producing transgenic mice that
over-express Zsig48, it is useful to engineer transgenic
mice with either abnormally low or no expression of the
gene. Such transgenic mice provide useful models for
diseases associated with a lack of Zsig48. As discussed
above, Zsig48 gene expression can be inhibited using anti-
sense genes, ribozyme genes, or external guide sequence
genes. To produce transgenic mice that under-express the
Zsig48 gene, such inhibitory sequences are targeted to
marine Zs.ig48 mRNA. Methods for producing transgenic mice
that have abnormally low expression of a particular gene
are known to those in the art [see, for example, Wu et
al., 'Gene Underexpression in Cultured Cells and Animals
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
112
by Antisense DNA and RNA Strategies," in Methods in Gene
Biotechnology, pages 205-224 (CRC Press 1997)].
An alternative approach to producing transgenic
mice that have little or no Zsig48 gene expression is to
generate mice having at least one normal Zsig48 allele
replaced by a nonfunctional Zsig48 gene. One method of
designing a nonfunctional Zsig48 gene is to insert another
gene, such as a selectable marker gene, within a nucleic
acid molecule that encodes murine Zsig48. Standard methods
for producing these so-called "knockout mice" are known to
those skilled in the art [see, for example, Jacob,
"Expression and Knockout of Interferons in Transgenic
Mice," in Overexpxession and Knockout of Cytokines in
Transgenic Mice, Jacob (ed.), pages 111-124 {Academic
Press, Ltd. 1994), and Wu et al., "New Strategies for Gene
Knockout," in Methods in Gene Biotechnology, pages 339-365
(CRC Press 1997)].
The present invention, thus generally described,
will be understood more readily by reference to the
following examples, which is provided by way of
illustration and is not intended to be limiting of the
present invention.
Example 1
Cloning of Zsig48
The expressed sequence tag (EST) of SEQ ID NO: 6 was
discovered through the random sequencing of a mixed
hematopoietic cDNA library, described in Example 2 below,
and the full-length clone isolated and sequenced resulting
in the sequences of SEQ TD NOs: 1 and 2.
Analysis of the 1.6 kb insert in pSLzsig48 revealed the
presence of an Eco RI adapter sequence used for cDNA
synthesis at the 5' end of the insert. At the 3' end of
the insert there is a Xho I site. However the Xho I site
lacks the flanking sequence that is present on the
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99I22970
113
oligonucleotide primer. This suggests that the pSLzig48
insert might be derived from a genomic contaminant that
co-purified with the cDNA preparation.
Example 2
Production of a Hematopoietic Cell cDNA Library
cDNAs from human hematopoietic cell lines, K562
(ATCC #CCL243), Daudi (ATCC #CCL213, HL-60(ATCC CCL240),
MOLT-4 (ATCC #CRL1582) and Raji ATCC #CCL86 were
synthesized in separate reactions and size fractionated in
the following manner. RNA extracted from each one of the
cell lines was reversed transcribed in the following
manner. The first strand cDNA reaction contained 10 ~1 of
twice poly d(T)-selected poly (A)+ mRNA from K562, Daudi,
HL-60, MOLT-4 or Raji cells (Clontech, Palo Alto, CA) at
a concentration of 1.0 mg/ml, and 2 ~1 of 20 pmole/~,l
first strand primer SEQ TD N0:7 {GTC TGG GTT CGC TAC TCG
AGG CGG CCG CTA TTT TTT TTT TTT TTT TTT) containing an Xho
I restriction site. The mixture was heated at 70°C for 3.0
minutes and cooled by chilling on ice. First strand cDNA
synthesis was initiated by the addition of 8 ~,1 of first
strand buffer (5x SUPERSCRIPTT"" buffer; Life Technologies,
Gaithersburg, MD), 4.0 ~1 of 100 mM dithiothreitol, and
3.0 ~l of a deoxynucleotide triphosphate (dNTP) solution
containing lO mM each of dTTP, dATP, dGTP and 5-methyl-
dCTP {Pharmacia LKB Biotechnology, Piscataway, NJ) to the
RNA-primer mixture. The reaction mixture was incubated at
37° C for 2 minutes, followed by the addition of 10 ~.1 of
200 U/~.1 RNase H- reverse transcriptase {SUPERSCRIPT II~%
Life Technologies). The efficiency of the first strand
synthesis was analyzed in a parallel reaction by the
addition of 1p ~Ci of 32P-adCTP to a 5 ~.1 aliquot from one
of the reaction mixtures to label the reaction for
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
114
analysis. The reactions were incubated at 37°C for 10
minutes, 45°C for 50 minutes, then incubated at 50°C for 10
minutes. Unincorporated 32P-adCTP in the labeled reaction
was removed by chromatography on a 400 pore size gel
filtration column (Clontech Laboratories, Palo Alto, CA).
The unincorporated nucleotides and primers in the
unlabeled first strand reactions were removed by
chromatography on 400 pore size gel filtration column
(Clontech Laboratories, Palo Alto, CA). The length of
labeled first strand cDNA was determined by agarose gel
electrophoresis.
The second strand reaction contained 135 ~.1 of
the unlabeled first strand cDNA, 40 ~l of 5x polymerise I
buffer (125 mM Tris: HCI, pH 7.5, 500 mM KC1, 25 mM MgCl2,
50mM (NH4) 2504}), 2.5 ~.l of 100 mM dithiothreitol, 5.0 ~,1
of a solution containing 10 mM of each deoxynucleotide
triphosphate, 7 ~1 of 5 mM ~i-NAD, 2.5 ~1 of 10 U/~1 E.
coli DNA ligase (New England Biolabs; Beverly, MA), 7 ~.1
of 10 U/~l E. coli DNA polymerise I (New England Biolabs,
Beverly, MA) , and 2 . 0 ~,1 of 2 U/~,1 RNase H (Life
Technologies, Gaithersburg, MD). A 10 ~.1 aliquot from one
of the second strand synthesis reactions was labeled by
the addition of 10 ~.Ci 32P-adCTP to monitor the
efficiency of second strand synthesis. The reactions were
incubated at 16° C for two hours, followed by the addition
of 1 ~.l of a 10 mM dNTP solution and 5.0 ~.1 T4 DNA
polymerise (10 U/~1, Boehringer Mannheim, Indianapolis,
IN) and incubated for an additional 10 minutes at 16°C.
Unincorporated 32P-adCTP in the labeled reaction was
removed by chromatography through a 400 pore size gel
filtration column (Clontech Laboratories, Palo Alto, CA)
before analysis by agarose gel electrophoresis. The
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99I22970
115
reaction was terminated by the addition of 20.0 ~l 0.5 M
EDTA and extraction with phenol/chloroform and chloroform
followed by ethanol precipitation in the presence of 3.0 M
Na acetate and 2 ~,l of PELLET PAINTS carrier (Novagen,
Madison, WI). The cDNAs were ethanol precipitated a second
time to remove possible trace levels of EDTA. The yield
of cDNA was estimated to be approximately 2 ~g from
starting mRNA template of 10 ~,g.
Eco RI adapters were ligated onto the 5' ends of
the cDNA described above to enable cloning into an
expression vector. A 12.0 ~C1 aliquot of cDNA ('"2.0 ~.g)
and 4 ~,l of 69 pmole/~l of Eco RI adapter {Pharmacia LKB
Biotechnology Inc., Piscataway, NJ) were mixed with 2.5 ~l
lOx lipase buffer (660 mM Tris-HCl pH 7.5, 100 mM MgCl2),
3.0 ~l of 10 mM ATP, 3.5 ~l 0.1 M DTT and 1 ~Zl of 15 U/~.1
T4 DNA lipase (Promega Corp., Madison; WI). The reaction
was incubated in a 0° to 22° C temperature gradient for 48
hours. The reaction was terminated by the adding 65 ~,l H20
and ZO ~,l lOX H buffer (Boehringer Mannheim, Indianapolis,
IN) and incubating the mixture at 70° C for 20 minutes.
To facilitate the directional cloning of the
cDNA into an expression vector, the cDNA was digested with
Xho I, resulting in a cDNA having a 5' Eco RI cohesive end
and a 3' Xho I cohesive end. The Xho I restriction site
at the 3' end of the cDNA had been previously introduced.
Restriction enzyme digestion was carried out in a reaction
mixture by the addition of 1.0 ~.1 of 40 U/~.l Xho I
(Boehringer Mannheim, Tndianapolis, IN). Digestion was
carried out at 37°C for one hour. The reaction was
terminated by incubation at 70°C for 20 minutes and
CA 02344712 2001-03-30
WO 00/I$796 PCT/US99/22970
116
chromatography through a 400 pore size gel filtration
column (Clontech Laboratories, Palo Alto, CA).
The cDNA was ethanol precipitated, washed with
70% ethanol, air dried and resuspended in 13.5 ~.l water,
2 ~1 of 10X kinase buffer (660 mM Tris-HC1, pH 7.5, 100 mM
MgCl2), 0.5 ~1 0.1 M DTT, 3 ~.1 10 mM ATP, 1.0 ~1 T4
polynucleotide kinase (10 U/~1, Life Technologies,
Gaithersburg, MD). Following incubation at 37° C for 30
minutes, the cDNA was ethanol precipitated in the presence
of 2.5 M Ammonium Acetate, and electrophoresed on a 0.80
low melt agarose gel. The contaminating adapters and cDNA
below 0.5 kb in length were excised and discarded. The
region of the gel containing cDNAs 0.5 to 2 kb in length
was excised and was placed in an empty adjacent lane of
the gel at a position identical in distance to the lane
origin. The electrodes were reversed, and the cDNA was
electrophoresed until the 0.5 to 2 kb length cDNA was
concentrated near the lane origin. The areas of the gel
containing the concentrated cDNAs were excised and placed
in a microfuge tube, and the approximate volume of the gel
slice was determined. An aliquot of water approximately
three times the volume of the gel slice (300 ~,1) and 35 ~.l
10x (3-agarose T buffer (New England Biolabs) was added to
the tube, and the agarose was melted by heating to 65°C for
15 minutes. Following equilibration of the sample to 45°C,
3 ~.1 of 1 U/~Cl ~3-agarose T (New England Biolabs, Beverly,
MA) was added, and the mixture was incubated for 60
minutes at 45°C to digest the agarose. After incubation,
40 ~.1 of 3 M Na acetate was added to the sample, and the
mixture was incubated on ice for 15 minutes. The sample
was centrifuged at 14,000 x g for 15 minutes at room
temperature to remove undigested agarose. The cDNA was
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
117
ethanol precipitated, washed in 70% ethanol, air-dried and
resuspended in 40 ~1 water.
Following recovery from low-melt agarose gel,
the 0.5-2 kb fractions were pooled and cloned into
pBLUESCRIPT (Gibco/BRL) to yield the K562L library. The
pooling of the cDNAs from the five cell lines was done to
increase message complexity, particularly for~cDNAs
encoding cytokines and cytokine receptors.
Example 3
Proliferation of Mixed Lymphocyte and Peripheral
Blood Monocytes using Zsig48
The object of the present example was to test
the effect of Zsig48 on peripheral blood leukocytes in a
mixed leukocyte reaction.
A mixed leukocyte reaction (MLR) is induced by
culturing mononuclear leukocytes (which include T cells, B
cells and monocytes from one individual with mononuclear
leukocytes derived from another individual. These cells
are generally isolated from peripheral blood. If there are
differences in the alleles of the major histocompatibility
complex (MHC) genes between the two individuals the
mononuclear cells will proliferate over a period of from
4-7 days. This proliferative response is measured by
incorporation of 3H-thymidine into DNA during cell
replication. This is called the allogeneic MLR. In the
present experiment the mononuclear cells from one of the
individuals was rendered incapable of proliferation, by
gamma irradiation prior to culture. The irradiated cells
are termed the stimulators and the untreated cells, still
capable of proliferation, are called the responders.
CA 02344712 2001-03-30
WO 00/1$796 PCT/US99/22970
118
Materials Used
RPMI 1640 (Gibco) Culture Medium
FICOLL PAQUE PLUS~ (Amersham-Pharmacia Biotech)
Procedure;
Blood was drawn from two healthy individuals.
The blood was diluted in tissue culture medium and layered
on top of a tube half full with Ficoll. Ficoll has a
density greater than that of lymphocytes but less than
that of red blood cells and granulocytes. After
centrifugation the red blood cells and granulocytes passed
down through the Ficoll to form a pellet at the bottom of
the tube while the mononuclear cells, i.e., T-cells, B-
cells and monocytes remained at the interface of the
medium and Ficoll. The layer containing the PBMNCs was
removed and resuspended in culture medium at a
concentration of about 5 x 108 cells per mL of culture
medium. The cells from one of the individuals were then
irradiated with 3300 rads gamma radiation. These
irradiated cells were termed the stimulators. Nothing was
done to the cells of the other individual. These non-
irradiated cells were termed the responder cells.
A suspension of both cells in medium was made
containing 1 x 106 cells per mL of responder cells and 0.15
X 106 cells per mL of stimulator cells. 100 ~,L aliquots of
the mixed cells were placed in a series of wells of a
multi-well plate. Into triplicate wells were placed
aliquots of solutions of Zsig48 at the following
concentrations: 0 ng/mL, 300 ng/mL, 200 ng/mL, 100 ng/mL,
50 ng/mL, 25 ng/mL, 10 ng/mL, 2 ng/mL, 0.1 ng/mL and 0.02
ng/mL.
CA 02344712 2001-03-30
WO 00/18796 PCT/US99l22970
119
A suspension of responder cells was also
irradiated with 3300 rads of gamma radiation. A suspension
of cells was then made containing 0.15 X 106 cells per mL
of irradiated responder and 1 x 106 of non-irradiated
responder cells. This mixture of irradiated and non-
irradiated responder cells was called mock mixed
leukocytes. 100 ~L aliquots of the mock mixed leukocytes
were placed in a series of wells of a multi-well plate.
Into triplicate wells were placed aliquots of solutions of
Zsig48 at the following concentrations: 0 ng/mL, 300
ng/mL, 200 ng/mL, 100 ng/mL, 50 ng/mL, 25 ng/mL, 10 ng/mL,
2 ng/mL, 0.1 ng/mL and 0.02 ng/mL.
The cultures were incubated 5days @37C with C02.
On day 5, each culture got l~Ci 3H-thymidine (Amersham-
Pharmacia Biotech). Plates were incubated another 20-24h.
The cells were harvested onto 96-well filter mats and the
mats were dried. About 30 ~L of scintillation fluid was
added to each spot containing the dried cells on the mat
and the radiation was detected for one minute by a
scintillation counter (Packard TOPCOUNT NXT~) as counts of
radiation per minute (CPM). This indicated the amount 3H-
thymidine which the cells took up which indicated the
amount of proliferation that the leukocytes underwent.
Because the wells were set up in triplicate, the results
below represent the average of the three wells at each
concentration of Zsig98.
Results
Mixed Leukocyte Reaction {Responder + Stimulator Cells)
Concentration of Zsig48 Added CPM {3H-Thymidine)
300 ng/mL 80,000 cpm
200 ng/mL 97,000 cpm
CA 02344712 2001-03-30
WO 00/18796 PCTIUS99/22970
120
100 ng/mL 83,000 cpm
50 ng/mL 103,000 cpm
25 ng/mL 65;000 cpm
ng/mL 71,000 cpm
5 2 ng/mL 38,000 cpm
0.1 ng/mL 21,000 cpm
0.02 ng/mL 27,000 cpm
0.00 ng/mL 43,000 cpm
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
121
UnMixed (Mock) Leukocyte Reaction
(Responder + Irradiated Responder Cells)
Concentration of CPM (3H-Thymidine)
Zsig48 Added
300 ng/mL 41,000 cpm
200 ng/mL 19,000 cpm
100 ng/mL 23,000 cpm
50 ng/mL 10,000 cpm
25 ng/mL 5,000 cpm
10 ng/mL 4,000 cpm
2 ng/mL 3,000 cpm
0.1 ng/mL 2,000 cpm
0.02 ng/mL 2,000 cpm
0.00 ng/mL 2,000 cpm
Conclusions
The data listed above shows thatZsig48 stimulates
the proliferat ion of leukocytes in th a mixed leukocyte
bo
reaction and i n an unmixed leukocyte reaction. Thus Zsig48
can be used to promote leukocyte prol iferation bath in
the
presence of an tigen and in those cases where the cells
have not been stimulated by antigen.
Example 4
Baculovirus Expression of zSig48
Two expression vectors were prepared to express
zSig48 polypeptides in insect cells: pSig48CEE, designed
to express a zSig48 polypeptide with a C-terminal GLU-GLU
tag and pSig48NEE, designed to express a zSig48
polypeptide with an N-terminal. GLU-GLU tag.
p8ig48CEE
A 335 by zSig48 fragment with BamHI and Xbal
restriction sites on the 5' and 3' ends, respectively, was
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
122
generated by PCR amplification from zsig48/pZP9. The
fragment was visualized by gel electrophoresis (1%
SeaPlaque/1% NuSieve). The band was excised, diluted to
0.5% agarose with 2 mM MgCl2, melted at 65°C and ligated
into an BamHI/Xba I digested baculovirus expression
vector, pZBV32L (a modification of the pFastBac expression
vector, the polyhedron promoter has been removed and
replaced with the late activating Basic Protein Promoter
and the coding sequence for the Glu-Glu tag as well as a
stop signal has been inserted at the 3' end of the
multiple cloning region). Forty-four point & nanograms of
the restriction digested zsig48 insert and 215.9 ng of the
corresponding vector were ligated overnight. The ligation
mix was diluted 3 fold in TE (10 mM Tris-HC1, pH 7.5 and 1
mM EDTA) and 4 fmol of the diluted ligation mix was
transformed into DHSa Library Efficiency competent cells
(Life Technologies) according to manufacturer's direction
by heat shock for 45 seconds in a 42°C waterbath. The
transformed DNA and cells were diluted in 450 ml of SOC
media (2e Bacto Tryptone, 0.5o Bacto Yeast Extract, 10 ml
1M NaCl, 1.5 mM KC1, 10 mM MgCl2, 10 mM MgS04 and 20 mM
glucose) and plated onto LB plates containing 100 mg/ml
ampicillin. Clones were analyzed by restriction digests
and 1 ml of the positive clone was transformed into 20 ml
DHlOBac Max Efficiency competent cells (GIBCO-BRL,
Gaithersburg, MD) according to manufacturer's instruction,
by heat shock for 45 seconds in a 42°C waterbath. The
transformed DNA was diluted in 980 ml SOC media (2 o Bacto
Tryptone, 0.5a Bacto Yeast Extract, 10 ml 1M NaCl, 1.5 mM
KCl, 10 mM MgCl2, 20 mM MgS04 and 20 mM glucose) and
plated onto Luria Agar plates containing 50 mg/ml
kanamycin, 7 mg/ml gentamicin, 10 mg/ml tetracycline, IPTG
and Bluo Gal. The cells were incubated for 48 hours at
37°C. A color selection was used to identify those cells
having virus that had incorporated into the plasmid
(referred to as a "bacmid"). Those colonies, which were
white in color, were picked for analysis. Bacmid DNA was
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
123
isolated from positive colonies using the QiaVac Miniprep8
system {Qiagen)according the manufacturer's directions.
Clones were screened for the correct insert by amplifying
DNA using primers to the Basic Protein Promoter and to the
SV40 terminus via PCR. Those having the correct insert
were used to transfect Spodoptera frugiperda (Sf9) cells.
pSig48NEE
A 263 by zSig48 fragment with BamHI and XbaI
restriction sites on the 5' and 3' ends, respectively, was
generated by PCR amplification from zsig48/pZP9 (described
above). The fragment was visualized by gel
electrophoresis and ligated into the expression vector,
pZBV3IL, as described above. One microliter of pSig48NEE
was used to independently transform 20 m1 DHlOBac Max
Efficiency competent cells (GIBCO-BRL,Gaithersburg, MD)
according to manufacturer's instruction, by heat shock at
42°C for 45 seconds. The transformants were then diluted
in 980 ml SOC media and plated on to Luria Agar plates as
described above. Bacmid DNA was isolated from positive
colonies and screened for the correct insert using the PCR
method as described above. Those having the correct
insert were used to transfect Spodoptera frugiperda (Sf9)
cells.
Transfection
Sf9 cells were seeded at 5 x 106 cells per 35
mm plate and allowed to attach for 1 hour at 27°C. Five
microliters of bacmid DNA was diluted with 100 ml Sf-900
II SFM. Six ml of CeIIFECTIN Reagent (Life Technologies)
was diluted with 100 ml Sf-900 II SFM. The bacmid DNA and
lipid solutions were gently mixed and incubated 30-45
minutes at room temperature. The media from one plate of
cells were aspirated, the cells were washed 1X with 2 ml
fresh media. Eight hundred microliters of Sf-900 II SFM
was added to the lipid-DNA mixture. The wash media was
CA 02344712 2001-03-30
WO 00/18796 PCT/US99I22970
124
aspirated and the DNA-lipid mix added to the cells. The
cells were incubated at 27°C for 4-5 hours. The DNA-lipid
mix was aspirated and 2 ml of Sf-900 II media was added to
each plate. The plates were incubated at 27°C, 900
humidity, for 96 hours after which the virus was
harvested.
Primary Amplification
Sf9 cells were grown in 50 ml Sf-900 II SFM in a
125 ml shake flask to an approximate density of 0.41-0.52
x 105 cells/ml. They were then infected with 100 ml of
the virus stock from above and incubated at 27°C for 2-3
days after which time the virus was harvested. The virus
I5 titers fox AcSig48CEE and AcSig48NEE were 1.08x108 pfu/ml
and 1.84x108 pfu/ml, respectively.
From the foregoing, it will be appreciated that,
although specific embodiments of the invention have been
described herein for purposes of illustration, various
modifications may be made without deviating from the
spirit and scope of the invention. Accordingly, the
invention is not limited except as by the appended claims.
CA 02344712 2001-03-30
WO 0011879b ~ PCTIUS99I22970
1
SEQUENCE LISTING
<110> ZymoGenetics. Inc.
<120> Secretory Protein-48
<130> 98-17PC
<150> 09/164,740
<151> 1998-10-OI
<160> 17
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 1692
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (59)...(373)
<400> 1
tttttctaag ggatgagata agaataaata gaaattttgg catttcttct cacattag 58
atg ctg ggt tat tct gag ccc atg cca tgt gca cac cca ctt ggc ctc 106
Met Leu Gly Tyr Ser Glu Pro Met Pro Cys Ala His Pro Leu Gly Leu
1 5 10 15
ttc ctc tta ggc cta cac cct gcc ctt tct ttg ccc ctt gta gtt act 154
Phe Leu Leu Gly Leu His Pra Ala Leu Ser Leu Pro Leu Val Ual Thr
20 25 30
gtg get gga gtg atg agc gcc act ccc aag cat ggc ctg gaa caa tgt 202
Val Ala Gly Ual Met Ser Ala Thr Pro Lys His Gly Leu Glu Gln Cys
35 40 45
cct cct gcc cct cca cca gca gtg aca gga ttc act ggg gac tcg ggg 250
Pro Pro Ala Pro Pro Pro Ala Val Thr Gly Phe Thr Gly Asp Ser Gly
50 55 60
gca aag gag act gtg tca caa gac aaa agg agc cag ggt cac.aca tgg 298
Ala Lys Glu Thr Val Ser Gln Asp Lys Arg Ser Gln Gly His Thr Trp
CA 02344712 2001-03-30
WO 00/18796 PCT/US99122970
2
65 70 75 80
tgt acc ctc gcc ctg cct cac cca tgg ctg aca tgg gtt gga cac ctc 346
Cys Thr Leu Ala Leu Pro His Pro Trp Leu Thr Trp Val Gly His Leu
85 90 95
aga aat cat gtg tct tca gcg agc cac tgagagttgg ggctttatct 393
Arg Asn His Vai Ser Ser Ala Ser His
I00 105
gttactcggctaggggtaacctaaccgatgagactgtaactggttactgtaaataaccaa453
gctcccagtaatagtaaaccagtgacaaaaacaattcttatccaaaaaggttcacctttt513
tttaaaatgtgtgaactaaaacagtctttattgctctaagacattaaaatttgcactttt573
ttgatgttgaataccactgaatattttatttttatattttattacacagaaatacagcaa633
ttattacaaaacgagtattaggaatggcaaaggctttaggacagactattagcggaaaac693
atttggaacttaaggagtgttttacatttggaacttactttaaggagtgtcgttcagaca753
ctagctatatcttaacctcagtttttagaagtaagcaagctctcattttttgctattcat813
atttgaagtgattaaactcataaatttgaaatttactttttagagaccaaagattaaaat873
taggtgggatgtcagcttttaaaatatactaagatttcctacaactaccaatagcttatt933
tccctgggaaacagattacattgtagtacttaacccagaactcatgcagttcatccaaaa993
tgatggtaaacttttttcctcagaattacctaactttccttgactatgaattcaacattc1053
aagaatcttcttctggtagcaggagcggcagagaggacaggcatggaaaggaggcctgtc1113
tcccacggagaactcctctagtgccagcagacacgcatggtggaacacatgtgagcagga1173
caggagggccatctctctggaacgcctgcccgcacccacgcactgaccgccagcagcgga1233
gagaggggccaggcagatggagcactcctgggtctcccggcgcagagcctgcggcacaca1293
ggacaggaagaggccacgcgggttagtttcatcacagcagaaagttacttaaactgaaat1353
gcgaaccatgtgccccgagacatgggtcttcgaaacatgcggaagtttcattctgtgtta1413
aaatcacatgcattttatttatatatatacatatatatatatacacacacacatatactc1473
tgttactcctgggaactgtggaaagggttagtaacccacctgtgataagcaacatccaac1533
aggaacttccagaatttcaaactgaagggacctttgccgtcaccctaaagcccatgagga1593
aagtcctaccacaggtgcaggggcagctagggcagcggttaccccaggcctgacactcct1653
aggcttcccaaagtgagtcctcgacctcccccgctcgag 1692
<210>2
<211>105
<212>PRT
<213>Homo Sapiens
<400> 2
Met Leu Gly Tyr Ser Glu Pro Met Pro Cys Ala His Pro Leu Gly Leu
1 5 10 15
Phe Leu Leu Gly Leu His Pro Ala Leu Ser Leu Pro Leu Val Val Thr
20 25 30
Val Ala Gly Val Met Ser Ala Thr Pro Lys His Gly Leu Glu Gln Cys
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
3
35 40 45
Pro Pro Ala Pro Pro Pro Ala Val Thr Gly Phe Thr Gly Asp Ser Gly
50 55 60
Ala Lys Glu Thr Val Ser Gln Asp Lys Arg Ser Gln Gly His Thr Trp
65 70 75 80
Cys Thr Leu Ala Leu Pro His Pro Trp Leu Thr Trp Val Gly His Leu
85 90 95
Arg Asn His Val Ser Ser Ala Ser His
100 105
<210>3
<211>79
<212>PRT
<213>Homo Sapiens
<400> 3
Leu Pro Leu Val Val Thr Val Ala Gly Va1 Met Ser Ala Thr Pro Lys
1 5 10 15
His Gly Leu Glu Gln Cys Pra Pro Ala Pro Pro Pro Ala Val Thr Gly
20 25 30
Phe Thr Gly Asp Ser Gly Ala Lys Glu Thr Val Ser Gln Asp Lys Arg
35 40 45
Ser Gln Gly His Thr Trp Cys Thr Leu Ala Leu Pro His Pro Trp Leu
50 55 60
Thr Trp Val Gly His Leu Arg Asn His Ual Ser Ser Ala Ser His
65 70 75
<210>4
<211>77
<212>PRT
<213>Homo Sapiens
<400> 4
Leu Val Val Thr Val A1a Gly Val Met Ser Ala Thr Pro Lys His Gly
1 5 10 15
Leu Giu Gln Cys Pro Pro Ala Pro Pro Pro Ala Val Thr Gly Phe Thr
20 25 30
Gly Asp Ser Gly Ala Lys Glu Thr Val Ser Gln Asp Lys Arg Ser Gln
35 40 45
Gly His Thr Trp Cys Thr Leu Ala Leu Pro His Pro Trp Leu Thr Trp
50 55 60
Ual Gly His Leu Arg Asn His Val Ser Ser Ala Ser His
65 70 75
<210> 5
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
4
<211> 65
<212> PRT
<213> Homo Sapiens
<400> 5
Pro Lys Nis Gly Leu Glu Gln Cys Pro Pro Ala Pro Pro Pro Ala Ual
1 5 10 15
Thr Gly Phe Thr Gly Asp Ser Gly Ala Lys Glu Thr Ual Ser Gln Asp
20 25 30
Lys Arg Ser Gln Gly His Thr Trp Cys Thr Leu Ala Leu Pro His Pro
35 40 45
Trp Leu Thr Trp Ual Gly His Leu Arg Asn His Ual Ser Ser Ala Ser
50 55 60
His
<210> 6
<21I> 384
<212> DNA
<213> Homo Sapiens
<220>
<22I> variation
<222> (1)...(384)
<223> n is any nucleotide
<221> misc_feature
<222> (1). .(384)
<223> n = A,T,C or G
<400>
6
tttttctaagggatgagataagaataaatagaaattttggcatttcttctcacattagat 60
gctgggttattctgagcccatgccatgtgcacacccacttggcctcttcctcttaggcct 120
acaccctgccctttctttgccccttgtagttactgtggctggagtgatgagcgccactcc 180
caagcatggcctggaacaatgtcctcctgcccctccaccagcagtgacaggattcactgg 240
ggactcgggggcaaaggagactgtgtcacaagacaaaaggagccagggtcacacatggtg 300
ttacctcgccctgcctcacccatgggtgacatgggttggacacctcanaaatcntgtttc 360
ttcaccganccactgaaaattggg 384
<210> 7
<211> 48
<212> DNA
<213> Homo Sapiens
<400> 7
CA 02344712 2001-03-30
WO 00/18796 PC'T/US99/22970
gtctgggttc gctactcgag gcggccgcta tttttttttt tttttttt 48
<210>8
<211>20
<212>PRT
<213>Homo Sapiens
<400> 8
Ser Ala Thr Pro Lys His Gly Leu Glu Gln Cys Pro Pro Ala Pro Pro
1 5 10 15
Pro Ala Val Thr
<210>9
<211>42
<212>PRT
<213>Hamo sapiens
<400> 9
SerAla ProLys Nis Gly GluGln Cys Pro Pro Ala
Thr Leu Pro Pro
1 5 10 15
ProAla ThrGly Phe Thr AspSer Gly Ala Lys Glu
Val Gly Thr Val
20 25 30
SerGln LysArg Ser Gln MisThr
Asp Gly
35 40
<210>10
<211>65
<212>PRT
<213>Homo sapiens
<400> 10
Ser Ala Thr Pro Lys His Gly Leu Glu Gln Cys Pro Pro Ala Pro Pro
1 5 10 15
Pro Ala Ual Thr Gly Phe Thr Gly Asp Ser Gly Ala Lys Glu Thr Val
20 25 30
Ser Gln Asp Lys Arg Ser Gln Gly Nis Thr Trp Cys Thr Leu Ala Leu
35 40 45
Pro His Pro Trp Leu Thr Trp Val Gly His Leu Arg Asn His Val Ser
50 55 60
Ser
&5
<210> 11
<211> 20
CA 02344712 2001-03-30
WO 00/1$796 PCT/US99122970
6
<2I2> PRT
<213> Homo sapiens
<400> 11
Thr Gly Asp Ser Gly Ala Lys Glu Thr Val Ser Gln Asp Lys Arg Ser
I 5 10 15
Gln Gly His Thr
<210>12
<211>43
<212>PRT
<213>Homo sapiens
<400> I2
Thr Gly Asp Ser Gly Ala Lys Glu Thr Val Ser Gln Asp Lys Arg Ser
1 5 I0 15
Gln Gly His Thr Trp Cys Thr Leu Ala Leu Pro His Pro Trp Leu Thr
20 25 30
Trp Val Gly His Leu Arg Asn His Val Ser Ser
35 40
<210> 13
<211> 12001
<212> DNA
<213> Homo sapiens
<220>
<221> ~DS
<222> (10258)...(I0572)
<400>
13
actttgtgcaaaattccttcattaagccttagcttccttatctgtaatacagtgatagta 60
tcatcttcctgttagggtttttgtgaagatcaacggaaataattctgtaagatccttagc 120
atagcgcctggcacatcctaagaactcagtaaatattagcccctttattatgacgatggt 180
ggtcatggtggtggtgaggatgatacggtgtgaaaagcttatctcttggtaataatacct 240
tttagttaaagcttttttgaggcttggattttgcaagtattaggctaacccataagtctc 300
ttcattaagccagagaataaattcaagatgaaaacgttagcattcttggcattgatgtaa 3~0
tagaagagaggggatttactgttatgtgttccaagagtcacatgtattgtaatggtgtta 420
aaaacgggtaggtttagctaaagggtacaaacgtaacctatgaatgtatttttatgctta 480
tttccacattagtgctaaacatatttcaagttttatactttaaaaataccaggacaaagt 540
aaattatcttggtttggggtgggagggggttgtaattttatgacagaagaagggaaaggc 600
agtgacttcttgtagaaaatttttaaaaatcctgacattagctcatttacctgagttgac 660
atgatttgaatgcatatgactccatactggggcttttagctattgtaaaaggccacatac 720
tgatggattcattaaggtccagttttcagataacttaaacgatatgagcagcaataaagc 780
CA 02344712 2001-03-30
WO 00/18796 PCT/US99122970
7
ttctcagatc accaggcctt tccaaccttg atgtttgaga gggtgacctt tgggaggcac 840
aaaagatttc agatgagctg tccatatgta ttttactttg aatatgccct gggaggggat 900
ggctcatcaa atattgcaat gcctgacagg aaaaagtcac agctcatttc agctgacaca 960
ccagataact tatacctttt aatgcttagg tttaataaag ctggcccaac ttgaagtagg 1020
aatcaaacag tcctttttat cagatgtcta gcattaaaac ttaattttta agcctgttat 1080
aatatcagca agattagtta gccatggttt cagataaatt tccactttcc attcgctaaa 1140
tgagatggtt gcaaatgaac tgccgtaact ttagcttttg aattaggtat tctggacatc 1200
attttgctaa gaaagccttt attaaagtaa taaaacataa cctgatataa aaggccttat 1260
atgcatgtca gttccttgac cataagagag agtagaatta gcaagagttg tataaaacta 1320
cctaatagat acatttactt ttcttcccca gtgtttttca gtattctttg gggtgtgcta 1380
cggggcaatt tatacataga aaaagagtct tattaagtat atgtaatgtt tgaatgatct 1440
gagatcttaa cagggattta gctgagactt gtaatttgat tgtaaagtag ctatcccctt 1500
tctttctttt tttttgtaga gattttttcc cctctgctac tctgcccatt gataataata 1560
gtatccatct cagagaatat ctagcacata gtaaacacta gaaatttagc tgtggtgatg 1620
gtggtaatgg acgggattgt ttctggagtt gtctgcagaa gagacacatc agaacgtttc 1680
agaatgcata acctacatga cagccaagtt ttaggcgtga actcagataa tcgatcctaa 1740
aagggtgcct tcatttcagc tcagtcagtg ggtaccgcag tgatcctctg tcttcactca 1800
gtcccttttc taacaagctt gattttagca cacttcctca actccagcag ctgtgggttc 1860
ctattgtcat tcctgggacc tgaccatttt ttgtgttgga ttgatttctt ttttcccttc 1920
ccattcaaac ataggctcag ttttaccttt tctttcatta agatatgcag gtgacaggaa 1980
gattaaaatt tggagtgcta tattagttta tgagtgatgt aaaactgcct aataggtcag 2040
ttaccatgtg aaattttagg gagaaaaatc ttttccaagt aagttgttga gatgccagaa 2100
aggtctgagc ttcgtgaaaa gtattttctc aacatctgcc ctgtggaagt gctgctgtgt 2160
ggccataggc cacatgatga tcatttggtc aataacagac cacttgccta tgtgacagtg 2220
gccacagcag atgatcatgg agctgaaccg tttctgccag cagtggcgtg gcggctgttg 2280
taatgtcctg gcgccacgca tcagcttttc taggttcata tgtttctaga tgcacagata 2340
tgtgccatgg tgccgcagtg gctgcagcac tcaggacagt gacatgctgt ctgcttggta 2400
actgaggagc agccggccac accctgcagc ctagggatgg catggctgtg ccctctgggt 2460
gtatagatac actctatgat ggcatcacag cgacagaatc gctcgacagc gcatttctca 2520
gaatgcattc ctgttgttcg gcaacacctg actgtgttgc tgtatgtcat tgtgtttcat 2580
ttttattaaa gtgcttgacg ctccagtgcc acagaagctc ttacattttc ttctgccctt 2640
tctccctgtg agagggcaat gttggtctgt gtatcaggta tattatgtaa ataattgttt 2700
tatgatacag agagaaataa atgtaacttt aaaagatagt gatagttttt tattctgtga 2760
aatacctttg ggtagtgaga tattatttat gttcagttta ttcttttgtc atttctttat 2820
tttttagtaa tgttttccat tcttttcttt ttaattacat attaatattt ggctgtggct 2880
ttccctacat tttcctgcat gtgtgtaagg ggcaatttat tttactttat ttaaaatttt 2940
tttgagacag ggtctcctct gtcacccagg ctggagtgca gtggtgtgat cacatctcac 3000
tgcagtcaca acctgctgag ctcaaggaat tctcccacct cagcctccca gagtgctggg 3060
attataggca tgagccactg cagccagcta atttttgtgt ttttcatgaa catggggttt 3120
cacaatgttg cccaggcctg tctcaaaccc ctcagctcaa acgatccttc cacctcggcc 3180
tcctgaagtg ctgggatgac aggcgtgagc caccacgccc agcctgtgtg tgtgcatttt 3240
aaaatgcaag tgggaacgta tctgtctcgg gttaggttcc ctgagaagca cacttcagat 3300
gggaatctgc ttgccaggaa gaggtttatt agccgggttg ggacaacgga agaggaaggg 3360
gctgtgcaga gggaggaact gtgccgtgat gcagtcacac tggaagcctc cgctggccct 3420
cggggatgtt gtgacttcga tggcccttca gagctccact gaactgagaa gaagggacag 3480
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
8
gctcttagga ccctcacgtg ctgtcctgga aggggcagga cttccgcctt gcagcagtct 3540
tcagcttagg ccatccccaa agggaggttg ccagtaggga gaagaaatca ttcattcctc 3600
aaggggatct ggccagcacc tcacagcttt ccaaataaca cttagctttg taaatctcct 3660
cttctcccta ccctaaccct ttcccagcca ctcagcaata tatcatttct caccattttc 3720
ttaatttttt tgcagggctt cataaacttc acttaccaaa tacttcaagg gattcagaaa 3780
cagccaagcc ttctgtaaat gggcatcaga aagcactgtg agacgcacag acggcgtctt 3840
ctgccaccaa gagacccgag aactccagat tcacgacatt cctgtcccat gtagaagcat 3900
ttccattcaa ccgtggcccc tcttcagaac ctagacctat cagtgccatt tttttttcat 3960
aatctacgaa gaacttggct atggctgatc ttttttaaat ttaactttct gatggaccct 4020
gtagtttcca gttaagtgca gattccttac agacatatag aacagcgcat tcttctgtag 4080
acatttgctc atgttggtaa atacaatcac ccatatgaaa aaattgtttt cacctgatat 4140
gaaaatgtta gaaaaggcaa actccgggac ttctaaagat ttacttaaat cccattatgt 4200
actttattca gaatgtagaa gctgacttga aaggcatcct tggtactaag tgaagcttat 4260
tcagaaaatg catttttcaa atgcaatggc aactgcttgt agatatcatt tttgcagtgt 4320
atgttggagc tgtaatggtt gcaattatgt ttcttatttc cttaaaagca aaaagcgtag 4380
tttctgattt atgttataga atgatactga ttagactttg agccaagggg aaaatactaa 4440
attcttttaa acctggagcc ttagagagcc acaggaatat cttctgttgt acagtctaat 4500
aagctgtggt aggaagtatc atgtaatcac agtttaatga cagtttatgt atat atataa 4560
ttcagtattc cctctgataa catagttgcc agtgtttaat acacttgtaa cttggatttt 4620
taccttatag gctatatgta tactcagttt tttaaagcat ttttttcaga gatcacttaa 4680
ttccccatgc ttctgcaatg catataaaaa ctataaatgc cgagtggtag aaactcctct 4740
ttcttcatag tcctcaggct ttggttacat ttgcatatgc catttgaagc ctccagcttt 4800
taccagttta acatccaaag ttcacagcat cagcattcat ggtgtaagaa cagttttgca 4860
gtataacacg atctgataat cattcagtta ttaaattgta aataattatt gggatggttt 4920
cttggcttta agtccactga ataaaaacta tgaaattgca ctctgtgtca accatccact 4980
aggatagaat accgaaatct gtgcatgcaa aaataggaga tgggcccatt tgcacacaat 5040
tcgtagttat gcagtctgct atataaatat gttcacatgc actgtgtgta tgaaaataga 5100
tggtctgtgt tcagacaaaa gtaaaacatt tttttcaaat tgttacattt aaaggttttc 5160
tgggagaaat ttatgaaacg caggctgtgt ctatttgaca tcagaaattt ccactttaaa 5220
ccaaaataat aagaaacttt aatctgtata tttacaacct ttgttgagta cacttccccc 5280
ttatttatac gtctgcattt ccttccgagc ttcacatctt tctaaaatgc agcttggttt 5340
taaaataaaa gaacattcat tttgtgattc taaacaagct tcagtaaata ccaccagtat 5400
agtactggtg aatttctcag cataaaatcg acatacctaa aaagttaata aaattcagct 5460
cttttccaat ttcattgtta tgcctattga agtattaatt gccaggtttg atttttagtg 5520
aagcttggag tccatacttt gagcagacca agtgaaggga agaacagaaa gaaactcagg 5580
agtagagtaa tatcacttct cacttacacc actttcaggc acatccaaag agttcctaga 5640
tacttggaaa atgtctgaaa atttttaagt aaaatactaa acttttcagt gtttagctca 5700
actttttgtt catttggaag tttctctcca tccgaggact taagccagtt ttggatttgt 5760
aagccctgag tacaatacac ttcctggagg catcctcact gctgttgaag caaaggatat 5820
gcatggggtg gaaggacggc ttcgaacctg ggactcatat gccttgagaa caaatagatt 5880
gttacagcct tgggctgctg cgtaatcacg gttcctcgag gctcttcctg agcacatgcc 5940
caagcatctg cctctggaga gactgactcc aaatgcaggt gcttccattg gagctaggtc 6000
ggaggctgct ttatatgacg aactccagaa atggatgcca gaatacggag gccaaacgtt 6060
ctgagtcctg gtaaggacag tcgctctggg ggtcctcatt ttactgcagt tcctgcacgc 6120
cagtgaaaga gaggagatag accctggaag gcagagctgc agatgctcat catcaggtca 6180
CA 02344712 2001-03-30
WO flfl/18796 PCT/US99I2297fl
9
attctggagc tacagttttg tttctgactg gatagggatg caccagtgac tgtcacatca 6240
agcagtcctt ttattctctc tcctttagta tcgattttaa agggcattag gcactatggt 6300
tccagagttt cttggggaaa acttgcagat tcttattaat tggttctgca atacttaaat 6360
aaattatttt acaattataa gttttcagat tataacattt gtattaattt ttactgattt 6420
tccaagatac ttcttagatt tactatttac gtagctttat gtacattctc tgtaaaaata 6480
gacctctaaa tatgaggc~t tacatgaaat ttgtacacac atacacacta atgttagctc 6540
cttaaattgc tgcactaagg tgctggttag tagagatgga cggagcctct cgcgttttgc 6600
tctcagatgt gttaaaggcg cacgtgtacc tgctctcagc ggcagtgcgg cctccccatc 6660
tgctgggtgc ccatggccct ccctgcagcc tcagtgatga cctcgtctgc cagggacaca 6720
ggttttcatc atttacaggc tcttatgtgc tagttttgtt ggtagcacgt tatttaatgc 6780
ataaaggcag aattcttaca agtttttttt tttaatgtga acatagatgc agcaccgact 6840
ttttaaactt gaaaaaactg gtataatgtt aacttttaaa aataacattt ggacacacta 6900
gtaattgatt tttgtttaca gattgttttg tttacaaatt gttagtcttt gtttctatga 6960
gatactttta gtgtgacttt ttaaatgtct tagaaattaa aagttgtaca aaaagtgatt 7020
tcatatttgg tttataagca tttatatgtg gggtttattt gttcttttgt tttttccatc 7080
ttaaatatta tcatggctaa aacttaaggg tatttatagt ttaattccat ttcagtttta 7140
tagagggcag taattattct gatgaatgtt gaattaagaa atggatattt tctttctctg 7200
ttgtgcagtt attggtagat caatttctta taacccacaa tgtagcatca ataattgata 7260
gcatgtattt tatttaatta cttgaattat ttagacttga tttctctaat tttttccata 7320
aaaggactga acagcaccta cttgtggtct ggacagctta acccagagtt cctggaagaa 7380
taaatgctgt tagcatctgg ttaatttact ggcagacaga agcctactta cagtggcttt 7440
caactttttg accacagtaa gaaataaccc attacacaca cacacacaca cacactctct 7500
ctctctctct ctctctctct ctgtctctca gatacgtata agcaaaaatt taacaagaca 7560
gtacttgttt ttcctaagtg tgcatgctgg catcttctgt tttattattt ttaaaaatac 7620
tagacacaga cactaagtta ctttgtggcc tcctaataga tggcagactt cagtttgaaa 7680
agcatccctt tggaatgtgg tttaaaagaa gaaataatac aaagaccttt ttggagtttt 7740
tttttttttt ggtttttgaa tattgtttag gtaaaaatta ttgctgcaaa cacaactgaa 7800
gcaaaagtac tgtgtacgca aattacttgt tgcactgtag aaaatgtaat atcaggagaa 7860
gttcctaaaa ctcacaaata tatacaaaat ttcaaaactt ggtgattgat cca atgtct 7920
tgaaggaata ttaggcaata aacttacctt ttcaagagaa gttatttaac ttccaattct 7980
gtgttcttta attaggaaaa aattttttca aggttaacta taatcaaata ggaacttcac 8040
acaaaacctc attattcttg gatatggatt tggtgttctg ctgttacttc taaaggtggt 8100
acagaagtca agtttatgag cctggattat gaacagcagg gcggccctga tgtgagtggt 8160
tgtggaggac tagagtgatg tagaagaatc tgttgtgtct gagtgtgagg aggtggagag 8220
tcacgtgtgg gctatgggtc tgagaactga agttttaaca gttactaaaa ctgttttgtg 8280
gctgttgtaa tgtcttctcc tttcctttcc tttgaaaagc tgttactgaa tgaacgatgc 8340
cgcttacaaa cactgacact tcagaaccaa gcatatttga tactgctgta gctatttata 8400
ttgattctgc aacttctctt taacagcatc ttgaagtcat ccacagttgt tctatatgga 8460
ctccacagta gagtcagaga actaagtgac aagtggagca tcgtcctcct cctgctcact 8520
tcctcctcgc cacctctctg gcctggctat ccttcagtct gaagagtgat tcactttttc 8580
ttttcttttt agtctttact gtggaatctc atcaaagact tggaagcagg ggtggtgaga 8640
ggggcctggg gcgtggtgtg gagggtcgag ttctttgtcg tcccacagtc acccccagga 8700
ccaccttgcg aagccgaaaa tacacatctg cattttaccg acaaggaacg ccactgagaa 8760
agctgcagac atttgcctgg ggtcacgctt acagtgggca gatgaactgg atgtaaatac 8820
aggccagtac aaccgcagtc tcattttttc tttgttttag gttttcagtt tcttgttcat 8880
CA 02344712 2001-03-30
WO 00/18796 PCT/US99/22970
tcatgtacct tacagttcta ttatctggtt gataaagatt catgacaggt atcctcattc 8940
tagattataa cctttattct tatcaaatgc ctccagtccc acaattcgct aagaattctc 9000
tttctggact tgatagtgat ttaatgattc cccccgccca tggaatggta ggctcctaat 9060
taagtggatt taaaggcaaa aagggatgtg tgagaaggca caagaagtgg cttcatcttg 9120
caaggtgact gtcagacaag tgggttccaa cctgttaaaa taagggagga atggccacat 9180
cccgtaggga ctgctgtagc tgaccaggaa gacacaatga gggcagcaga cagggctctc 9240
cctgtccgct gagtcctccc atgaactcat gtttccaaag gccccactct ttcttggtca 9300
gtgtcccagt ttttatagaa gagacctgat gaggctgtgg agtaattgta taaaagcttg 9360
cactgttttc ctgacttgac ctgacaatgt ggcgttatct tcaaattgtc cagagaagta 9420
gctacttcat tcaggtcctt tttagcgttc tgtggttgca acttggtctc gcaagctttc 9480
gatgggcgcg ccattccatg gccacttttc agtaagaaaa ttgcctgatt ttctgttaac 9540
tgtcacaggc tgccctggac cattcctcag aactcatggg attttcgcga ccctcatcct 9600
cagtgaagtt agatgaccat tcctgccttt catcccaccg attttcctaa gtatctgttg 9660
cctgcaacta acactagttc ctgtgtcagt aaagtactgc acttggttgc aaagaataga 9720
gatggactct gccaacatag gcacggaagg tttacggggt ggatggcatg gctcacagat 9780
gtgatgagaa agccccggaa gaagtgttgg gcacagcctt aggcacaacc tttcctgggc 9840
tcttcccatc actgaatgat ccatgtatct ccgggactct ccttctagat ccaaagttta 9900
gggcggcgga atcggactgc tctggccttt gacacgtgcc tgtgctttgc ctgtcaacgc 9960
tatggggaga gagatgtcag cttacagaaa attgaggttc tgtgattcag tttccctctg 10020
ctctcttaga ataaaagtgc ttactcattg tttaaagcat tctccaaatt agtctgcaaa 10080
ttttttgata gtatacatcc ttaaaaaatg agcacatccc aatatatgca tatttattca 10140'
taaatgatac atacatatgt agctatataa tgtgtacatc acaaaacata ggagagtatt 10200
ttttctaagg gatgagataa gaataaatag aaattttggc atttcttctc acattag atg 10260
Met
1
ctg ggt tat tct gag ccc atg cca tgt gca cac cca ctt ggc ctc ttc 1030$
Leu Gly Tyr Ser Glu Pro Met Pro Cys Ala His Pro Leu Gly Leu Phe
5 10 15
ctc tta ggc cta cac cct gcc ctt tcc ttg ccc ctt gta gtt act gtg 10356
Leu Leu Gly Leu His Pro Ala Leu Ser Leu Pro Leu Val Val Thr Val
25 30
get gga gtg atg agc gcc act ccc aag cat ggc ctg gaa caa tgt cct 10404
Ala Gly Val Met Ser Ala Thr Pro Lys His Gly Leu Glu Gln Cys Pro
35 40 45
cct gcc cct cca cca gca gtg aca gga ttc act ggg gac tcg ggg gca 10452
Pro Ala Pro Pro Pro Ala Val Thr Gly Phe Thr Gly Asp Ser Gly Ala
50 55 60 65
aag gag act gtg tca caa gac aaa agg agc cag ggt cac aca tgg tgt 10500
Lys Glu Thr Val Ser Gln Asp Lys Arg Ser Gln Gly His Thr Trp Cys
CA 02344712 2001-03-30
WO 00/I8796 PCT/US99/22970
11
70 75 80
acc ctc gcc ctg cct cac cca tgg ctg aca tgg gtt gga cac ctc aga 10548
Thr Leu Ala Leu Pro His Pro Trp Leu Thr Trp Ual Gly His Leu Arg
85 90 95
aat cat gtg tct tca gcg agc cac tgagagttgg ggctttatct gttactcggc 10602
Asn His Val Ser Ser Ala Ser His
100 105
taggggtaac ctaaccgatg agactgtaac tggttactgt aaataaccaa gctcccagta 10662
atagtaaacc agtgacaaaa acaattctta tccaaaaagg ttcacttttt tttaaaatgt 10722
gtgaactaaa acagtcttta ttgctctaag acattaaaat ttgcactttt ttgatgttga 10782
ataccactga atattttatt tttatatttt attacacaga aatacagcaa ttattacaaa 10842
acgagtatta ggaatggcaa aggctttagg acagactatt agcggaaaac atttggaact 10902
taaggagtgt tttacatttg gaacttactt taaggagtgt cgttcagaca ctagctatat 10962
cttaacctca atttttagaa gtaagcaagc tctcattttt tgctattcat atttgaagtg 11022
attaaactca taaatttgaa atttactttt tagagaccaa agattaaaat taggtgggat 11082
gtcagctttt aaaatatact aagatttcct acaactacca atagcttatt tccctgggaa 11142
acagattaca ttgtagtact taacccagaa ctcatgcagt tcatccaaaa tgatggtaaa 11202
cttttttcct cagaattacc taactttcct tgactatgaa ttcaacattc aagaatcttc 11262
ttctggtagc aggagcggca gagaggacag gcatggaaag gaggcctgtc tcccacggag 11322
aactcctcta gtgccagcag acacgcatgg tggaacacat gtgagcagga caggagggcc 11382
atctctctgg aacgcctgcc tgcacccacg cgctgaccgc cagcagcgga gagaggggcc 11442
aggcagatgg agcactcgtg ggtctcccgg cgcagagcct gcggcacaca ggacgggaag 11502
aggccacgcg ggttagtttc atcacagcag aaagttactt aaactgaaat gcgaaccatg 11562
tgccccgaga catgggtctt cgaaacatgc ggaagtttca ttctgtgtta aaatcacatg 11622
cattttattt atatatatac atatatatat acacacacat atactctgtt actcctggga 11682
actgtggaaa gggttagtaa cccacctgtg ataagcaaca tccaacagga acttccagaa 11742
tttcaaactg aagggacctt tgccgtcacc ctaaagccca tgaggaaagt cctaccacag 11802
gtgcaggggc agctagggca gcggttaccc cgggactgac actcctaggc ttcccaaagt 11862
gagtcctcga cctcccccga catgccaccc ccacagcctc cacggctgca ccccgggcct 11922
gacactccta ggctccccaa agtgagtcct cgacctcccc ccacatgcca ctccccacag 11982
cctctgcagc tgcagctga 12001
<210>14
<211>105
<212>PRT
<213>Homo sapiens
<400> 14
Met Leu Gly Tyr Ser Glu Pro Met Pro Cys Ala His Pro Leu Gly Leu
1 5 10 15
Phe Leu Leu Gly Leu His Pro Ala Leu Ser Leu Pro Leu Ual Val Thr
CA 02344712 2001-03-30
WO 00/18796 PCT/U599/22970
12
20 25 30
UalAlaGly ValMetSer AlaThrPro LysHisGly LeuGlu GlnCys
35 40 45
ProProAla ProProPro AlaValThr GlyPheThr GlyAsp SerGly
50 55 60
AlaLysGlu ThrUalSer GlnAspLys ArgSerGln GiyHis ThrTrp
65 70 75 80
CysThrLeu AlaLeuPro HisProTrp LeuThrTrp ValGly HisLeu
85 90 95
ArgAsnHis ValSerSer AlaSerHis
100 105
<2I0>15
<211>89
<212>PRT
<213>Homo Sapiens
<400> 15
GlyGluTyrMet ProMet GluGlySer SerLeu ProLeuValUal Thr
1 5 10 15
ValAlaGlyVal MetSer AlaThrPro LysHis GlyLeuGluGln Cys
20 25 30
ProProAlaPro ProPro AlaValThr GlyPhe ThrGlyAspSer Gly
35 40 45
AlaLysGluThr UalSer GlnAspLys ArgSer GlnGlyHisThr Trp
50 55 60
CysThrLeuAla LeuPro HisProTrp LeuThr TrpValGlyHis Leu
65 70 75 80
ArgAsnHisUal SerSer AlaSerHis
85
<210>16
<211>80
<212>PRT
<213>Homo sapiens
<400> 16
SerLeuProLeu ValValThr ValAla GlyValMet SerAlaThr Pro
1 5 10 15
LysHisGlyLeu GluGlnCys ProPro AlaProPro ProAlaVal Thr
20 25 30
GlyPheThrGiy AspSerGly AlaLys GluThrVal SerGlnAsp Lys
35 40 45
ArgSerGlnGly HisThrTrp CysThr LeuAlaLeu ProHisPro Trp
50 55 60
CA 02344712 2001-03-30
WO 00/I8796
PCT/US99/22970
13
Leu Thr Trp Ual Gly His Leu Arg Asn His Uai Ser Ser Ala Ser His
65 70 75 80
<210>I7
<211>16
<2I2>PRT
<213>Homo sapiens
<400> 17
Gly Gly Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
