CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-1
CANCER ASSOCIATED ANTIGENS AND USES THEREFOR
Field of the Invention
The invention relates to nucleic acids and encoded polypeptides which are
cancer
associated antigens expressed in patients afflicted with a variety of cancers.
The invention
also relates to agents which bind the nucleic acids or polypeptides. The
nucleic acid
molecules, polypeptides coded for by such molecules and peptides derived
therefrom, as well
as related antibodies and cytolytic T lymphocytes, are useful, inter alia, in
diagnostic and
therapeutic contexts.
Background of the Invention
The mechanism by which T cells recognize foreign materials has been implicated
in
cancer. A number of cytolytic T lymphocyte (CTL) clones directed against
autologous
melanoma antigens, testicular antigens, and melanocyte differentiation
antigens have been
described. In many instances, the antigens recognized by these clones have
been
characterized.
The use of autologous CTLs for identifying tumor antigens requires that the
target
cells which express the antigens can be cultured in vitro and that stable
lines of autologous
CTL clones which recognize the antigen-expressing cells can be isolated and
propagated.
While this approach has worked well for melanoma antigens, other tumor types,
such as
epithelial cancers including breast and colon cancer, have proved refractory
to the approach.
More recently another approach to the problem has been described by Sahin et
al.
(Proc. Natl. Acad. Sci. USA 92:11810-11813, 1995). According to this approach,
autologous
antisera are used to identify immunogenic protein antigens expressed in cancer
cells by
screening expression libraries constructed from tumor cell cDNA. Antigen-
encoding clones
so identified have been found to have elicited an high-titer humoral immune
response in the
patients from which the antisera were obtained. Such a high-titer IgG response
implies helper
T cell recognition of the detected antigen. These tumor antigens can then be
screened for the
presence of MHC/HLA class I and class II motifs and reactivity with CTLs
Presently there is a need for additional cancer antigens for development of
therapeutics
and diagnosis applicable to a greater number of cancer patients having various
cancers.
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-2-
Summary of the Invention
Autologous antibody screening has now been applied to renal cancer using
antisera
from cancer patients. Numerous cancer associated antigens have been
identified. The
invention provides, inter alia, isolated nucleic acid molecules, expression
vectors containing
those molecules and host cells transfected with those molecules. The invention
also provides
isolated proteins and peptides, antibodies to thase proteins and peptides and
CTLs which
recognize the proteins and peptides. Fragments including functional fragments
and variants of
the foregoing also are provided. Kits containing the foregoing molecules
additionally are
provided. The foregoing can be used in the diagnosis, monitoring, research, or
treatment of
conditions characterized by the expression of one or more cancer associated
antigens.
Prior to the present invention, only a handful of cancer associated genes had
been
identified in the past 20 years. The invention involves the surprising
discovery of several
genes, some previously known and some previously unknown, which are expressed
in
individuals who have cancer. These individuals all have serum antibodies
against the proteins
(or fragments thereof] encoded by these genes. Thus, abnormally expressed
genes are
recognized by the host's immune system and therefore can form a basis for
diagnosis,
monitoring and therapy.
The invention involves the use of a single material, a plurality of different
materials
and even large panels and combinations of materials. For example, a single
gene, a single
protein encoded by a gene, a single functional fragment thereof, a single
antibody thereto, etc.
can be used in methods and products of the invention. Likewise, pairs, groups
and even
panels of these materials and optionally other cancer associated antigen genes
and/or gene
products can be used for diagnosis, monitoring and therapy. The pairs, groups
or panels can
involve 2, 3, 4, 5 or more genes, gene products, fragments thereof or agents
that recognize
such materials. A plurality of such materials are not only useful in
monitoring, typing,
characterizing and diagnosing cells abnormally expressing such genes, but a
plurality of such
materials can be used therapeutically. An example of the use of a plurality of
such materials
for the prevention, delay of onset, amelioration, etc. of cancer cells, which
express or will
express such genes prophylactically or acutely. Any and all combinations of
the genes, gene
products, and materials which recognize the genes and gene products can be
tested and
identified for use according to the invention. It would be far too lengthy to
recite all such
combinations; those skilled in the art, particularly in view of the teaching
contained herein,
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-3
will readily be able to determine which combinations are most appropriate for
which
circumstances.
As will be clear from the following discussion, the invention has in vivo and
ire vitro
uses, including for therapeutic, diagnostic, monitoring and research purposes.
One aspect of
the invention is the ability to fingerprint a cell expressing a number of the
genes identified
according to the invention by, for example, quantifying the expression of such
gene products.
Such fingerprints will be characteristic, for example, of the stage of the
cancer, the type of the
cancer, or even the effect in animal models of a therapy on a cancer. Cells
also can be
screened to determine whether such cells abnormally express the genes
identified according to
the invention.
The invention, in one aspect, is a method of diagnosing a disorder
characterized by
expression of a cancer associated antigen precursor coded for by a nucleic
acid molecule. The
method involves the steps of contacting a biological sample isolated from a
subject with an
agent that specifically binds to the nucleic acid molecule, an expression
product thereof, or a
fragment of an expression product thereof complexed with an MHC, preferably an
HLA,
molecule, wherein the nucleic acid molecule is a NA Group 1 nucleic acid
molecule, and
determining the interaction between the agent and the nucleic acid molecule,
the expression
product or fragment of the expression product as a determination of the
disorder.
In one embodiment the agent is selected from the group consisting of (a) a
nucleic
acid molecule comprising NA Group 1 nucleic acid molecules or a fragment
thereof, (b) a
nucleic acid molecule comprising NA Group 3 nucleic acid molecules or a
fragment thereof,
(c) a nucleic acid molecule comprising NA Group 5 nucleic acid molecules or a
fragment
thereof, (d) an antibody that binds to an expression product, or a fragment
thereof, of NA
group 1 nucleic acids, (e) an antibody that binds to an expression product, or
a fragment
thereof, of NA group 3 nucleic acids, (f) an antibody that binds to an
expression product, or a
fragment thereof, of NA group 5 nucleic acids, (g) and agent that binds to a
complex of an
MHC, preferably HLA, molecule and a fragment of an expression product of a NA
Group 1
nucleic acid, (h) an agent that binds to a complex of an MHC, preferably HLA,
molecule and
a fragment of an expression product of a NA group 3 nucleic acid, and (i) an
agent that binds
to a complex of an MHC, preferably HLA, molecule and a fragment of an
expression product
of a NA Group 5 nucleic acid.
The disorder may be characterized by expression of a plurality of cancer
associated
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-4-
antigen precursors. Thus the methods of diagnosis may include use of a
plurality of agents,
each of which is specific for a different human cancer associated antigen
precursor (including
at least one of the cancer associated antigen precursors disclosed herein),
and wherein said
plurality of agents is at least 2, at least 3, at least 4, at least 5, at
least 6, at least 7, at least 8, at
least 9 or at least 10 such agents.
In each of the above embodiments the agent may be specific for a human cancer
associated antigen precursor that is selected from the group consisting of
breast, gastric, lung,
prostate, renal, colon, thyroid, Hodgkin's disease, and hepatocarcinoma cancer
associated
antigen precursors.
In another aspect the invention is a method for determining regression,
progression or
onset of a condition characterized by expression of abnormal levels of a
protein encoded by a
nucleic acid molecule that is a NA Group 1 molecule. The method involves the
steps of
monitoring a sample, from a subject who has or is suspected of having the
condition, for a
parameter selected from the group consisting of (i) the protein, (ii) a
peptide derived from the
protein, (iii) an antibody which selectively binds the protein or peptide, and
(iv) cytolytic T
cells specific for a complex of the peptide derived from the protein and an
MHC molecule, as
a determination of regression, progression or onset of said condition. In one
embodiment the
sample is a body fluid, a body effusion or a tissue.
In another embodiment the step of monitoring comprises contacting the sample
with a
detectable agent selected from the group consisting of (a) an antibody which
selectively binds
the protein of (i), or the peptide of (ii), (b) a protein or peptide which
binds the antibody of
(iii), and (c) a cell which presents the complex of the peptide and MHC
molecule of (iv). In a
preferred embodiment the antibody, the protein, the peptide or the cell is
labeled with a
radioactive label or an enzyme. The sample in a preferred embodiment is
assayed for the
peptide.
According to another embodiment the nucleic acid molecule is one of the
following: a
NA Group 3 molecule or a NA Group 5 molecule. In yet another embodiment the
protein is a
plurality of proteins, the parameter is a plurality of parameters, each of the
plurality of
parameters being specific for a different of the plurality of proteins. In
certain embodiments
the protein is a plurality of proteins, at least one of which is kinectin, the
remainder of which
are non-kinectin cancer associated proteins, and wherein the parameter is a
plurality of
parameters, each of the plurality of parameters being specific for a different
of the plurality of
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-5-
proteins.
The invention in another aspect is a pharmaceutical preparation for a human
subject.
The pharmaceutical preparation includes an agent which when administered to
the subject
enriches selectively the presence of complexes of an HLA molecule and a human
cancer
associated antigen, and a pharmaceutically acceptable carrier, wherein the
human cancer
associated antigen is a fragment of a human cancer associated antigen
precursor encoded by a
nucleic acid molecule which comprises a NA Group 1 molecule. In one embodiment
the
nucleic acid molecule is a NA Group 3 nucleic acid molecule.
The agent in one embodiment comprises a plurality of agents, each of which
enriches
selectively in the subject complexes of an HLA molecule and a different human
cancer
associated antigen. Preferably the plurality is at least two, at least three,
at least four or at
least 5 different such agents.
In certain embodiments, the agent comprises a plurality of agents, at least
one of
which is kinectin, the remainder of which are non-kinectin cancer associated
proteins, and
each of which enriches selectively in the subject complexes of an HLA molecule
and a
different human cancer associated antigen.
In another embodiment the agent is selected from the group consisting of (1)
an
isolated polypeptide comprising the human cancer associated antigen, or a
functional variant
thereof, (2) an isolated nucleic acid operably linked to a promoter for
expressing the isolated
polypeptide, or functional variant thereof, (3) a host cell expressing the
isolated polypeptide,
or functional variant thereof, and (4) isolated complexes of the polypeptide,
or functional
variants thereof, and an HLA molecule.
The agent may be a cell expressing an isolated polypeptide. In one embodiment
the
agent is a cell expressing an isolated polypeptide comprising the human cancer
associated
antigen or a functional variant thereof. In another embodiment the agent is a
cell expressing
an isolated polypeptide comprising the human cancer associated antigen or a
functional
variant thereof, and wherein the cell expresses an HLA molecule that binds the
polypeptide.
The cell can express one or both of the polypeptide and HLA molecule
recombinantly. In
preferred embodiments the cell is nonproliferative. In other preferred
embodiments, the
isolated polypeptide is or includes a kinectin polypeptide. In yet another
embodiment the
agent is at least two, at least three, at least four or at least five
different polypeptides, each
representing a different human cancer associated antigen or functional variant
thereof.
CA 02344995 2001-04-04
WO 00/20587 PC'T/US99/22873
-6-
The agent in one embodiment is a PP Group 2 polypeptide. In other embodiments
the
agent is a PP Group 3 polypeptide or a PP Group 4 polypeptide.
In an embodiment each of the pharmaceutical preparations described herein also
includes an adjuvant.
According to another aspect the invention, a composition is provided which
includes
an isolated agent that binds selectively a PP Group 1 polypeptide. In separate
embodiments
the agent binds selectively to a polypeptide selected from the following: a PP
Group 2
polypeptide, a PP Group 3 polypeptide, a PP Group 4 polypeptide, and a PP
Group 5
polypeptide. In other embodiments, the agent is a plurality of different
agents that bind
selectively at least two, at least three, at least four, or at least five
different such polypeptides.
In each of the above described embodiments the agent may be an antibody. In a
preferred
embodiment, at least one of polypeptides is kinectin or a fragment thereof.
In another aspect the invention is a composition of matter composed of a
conjugate of
the agent of the above-described compositions of the invention and a
therapeutic or diagnostic
agent. Preferably the conjugate is of the agent and a therapeutic or
diagnostic that is an
antineoplastic.
The invention in another aspect is a pharmaceutical composition which includes
an
isolated nucleic acid molecule selected from the group consisting of: ( 1 ) NA
Group 1
molecules, and (2) NA Group 2 molecules, and a pharmaceutically acceptable
carrier. In one
embodiment the isolated nucleic acid molecule comprises a NA Group 3 or NA
Group 4
molecule. In another embodiment the isolated nucleic acid molecule comprises
at least two
isolated nucleic acid molecules coding for two different polypeptides, each
polypeptide
comprising a different cancer associated antigen. In preferred embodiments, at
least one of
the polypeptides is a kinectin polypeptide.
Preferably the pharmaceutical composition also includes an expression vector
with a
promoter operably linked to the isolated nucleic acid molecule. In another
embodiment the
pharmaceutical composition also includes a host cell recombinantly expressing
the isolated
nucleic acid molecule.
According to another aspect of the invention a pharmaceutical composition is
provided. The pharmaceutical composition includes an isolated polypeptide
comprising a PP
Group 1 or a PP Group 2 polypeptide, and a pharmaceutically acceptable
carrier. In one
embodiment the isolated polypeptide comprises a PP Group 3 or a PP Group 4
polypeptide.
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
In another embodiment the isolated polypeptide comprises at least two
different
polypeptides, each comprising a different cancer associated antigen at least
one of which is
encoded by a NA group 1 molecule as disclosed herein. In separate embodiments
the isolated
polypeptides are selected from the following: PP Group 3 polypeptides or HLA
binding
fragments thereof and PP Group S polypeptides or HLA binding fragments
thereof.
In an embodiment each of the pharmaceutical compositions described herein also
includes an adjuvant.
Another aspect the invention is an isolated nucleic acid molecule comprising a
NA
Group 3 molecule. Another aspect the invention is an isolated nucleic acid
molecule
comprising a NA Group 4 molecule.
The invention in another aspect is an isolated nucleic acid molecule selected
from the
group consisting of (a) a fragment of a nucleic acid selected from the group
of nucleic acid
molecules consisting of SEQ ID Nos numbered below and comprising all nucleic
acid
sequences among SEQ ID NOs 1-I 1 and 22-46, of sufficient length to represent
a sequence
unique within the human genome, and identifying a nucleic acid encoding a
human cancer
associated antigen precursor, (b) complements of (a), provided that the
fragment includes a
sequence of contiguous nucleotides which is not identical to any sequence
selected from the
sequence group consisting of (1) sequences having the GenBank accession
numbers of Table
1, (2) complements of ( I ), and (3 ) fragments of ( 1 ) and (2).
In one embodiment the sequence of contiguous nucleotides is selected from the
group
consisting of: (I) at least two contiguous nucleotides nonidentical to the
sequences in Table I,
(2) at least three contiguous nucleotides nonidentical to the sequences in
Table 1, (3) at least
four contiguous nucleotides nonidentical to the sequences in 'Table 1, (4) at
least five
contiguous nucleotides nonidentical to the sequences in Table 1, (5) at least
six contiguous
nucleotides nonidentical to the sequences in Table I, or (6) at least seven
contiguous
nucleotides nonidentical to the sequences in Table 1.
In another embodiment the fragment has a size selected from the group
consisting of at
least: 8 nucleotides, 10 nucleotides, 12 nucleotides, 14 nucleotides, 16
nucleotides, 18
nucleotides, 20, nucleotides, 22 nucleotides, 24 nucleotides, 26 nucleotides,
28 nucleotides, 30
nucleotides, SO nucleotides, 75 nucleotides, 100 nucleotides, 200 nucleotides,
1000
nucleotides and every integer length therebetween.
In yet another embodiment the molecule encodes a polypeptide which, or a
fragment
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
_g_
of which, binds a human HLA receptor or a human antibody.
Another aspect of the invention is an expression vector comprising an isolated
nucleic
acid molecule of the invention described above operably linked to a promoter.
According to one aspect the invention is an expression vector comprising a
nucleic
acid operably linked to a promoter, wherein the nucleic acid is a NA Group 1
or Group 2
molecule. In another aspect the invention is an expression vector comprising a
NA Group 1
or Group 2 molecule and a nucleic acid encoding an MHC, preferably HLA,
molecule.
In yet another aspect the invention is a host cell transformed or transfected
with an
expression vector of the invention described above.
In another aspect the invention is a host cell transformed or transfected with
an
expression vector comprising an isolated nucleic acid molecule of the
invention described
above operably linked to a promoter, or an expression vector comprising a
nucleic acid
operably linked to a promoter, wherein the nucleic acid is a NA Group 1 or 2
molecule and
further comprising a nucleic acid encoding HL,A.
According to another aspect of the invention an isolated polypeptide encoded
by the isolated
nucleic acid molecules the invention, described above, is provided. These
include PP Group
1-5 polypeptides. The invention also includes a fragment of the polypeptide
which is
immunogenic. In one embodiment the fragment, or a portion of the fragment,
binds HLA or a
human antibody. In still another aspect the invention provides as isolated
polypeptide
comprising a fragment of a kinectin polypeptide which is immunogenic.
The invention includes in another aspect an isolated fragment of a human
cancer
associated antigen precursor which, or portion of which, binds HLA or a human
aaitibody,
wherein the precursor is encoded by a nucleic acid molecule that is a NA Group
1 molecule.
In one embodiment the fragment is part of a complex with HLA. In another
embodiment the
fragment is between 8 and 12 amino acids in length. In another embodiment the
invention
includes an isolated polypeptide comprising a fragment of the polypeptide of
sufficient length
to represent a sequence unique within the human genome and identifying a
polypeptide that is
a human cancer associated antigen precursor.
According to another aspect of the invention a kit far detecting the presence
of the
expression of a cancer associated antigen precursor is provided. The kit
includes a pair of
isolated nucleic acid molecules each of which consists essentially of a
molecule selected from
the group consisting of (a) a 12-32 nucleotide contiguous segment of the
nucleotide sequence
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-9-
of any of the NA Group 1 molecules and (b) complements of ("a"), wherein the
contiguous
segments are nonoverlapping. In one embodiment the pair of isolated nucleic
acid molecules
is constructed and arranged to selectively amplify an isolated nucleic acid
molecule that is a
NA Group 3 molecule. Preferably, the pair amplifies a human NA Group 3
molecule.
According to another aspect of the invention a method for treating a subject
with a
disorder characterized by expression of a human cancer associated antigen
precursor is
provided. The method includes the step of administering to the subject an
amount of an agent,
which enriches selectively in the subject the presence of complexes of an HLA
molecule and a
human cancer associated antigen, effective to ameliorate the disorder, wherein
the human
cancer associated antigen is a fragment of a human cancer associated antigen
precursor
encoded by a nucleic acid molecule selected from the group consisting of (a) a
nucleic acid
molecule comprising NA group 1 nucleic acid molecules, (b) a nucleic acid
molecule
comprising NA group 3 nucleic acid molecules, (c) a nucleic acid molecule
comprising NA
group 5 nucleic acid molecules.
In one embodiment the disorder is characterized by expression of a plurality
of human
cancer associated antigen precursors and wherein the agent is a plurality of
agents, each of
which enriches selectively in the subject the presence of complexes of an HLA
molecule and a
different human cancer associated antigen. Preferably the plurality is at
least 2, at least 3, at
least 4, or at least 5 such agents. In a preferred embodiment, at least one of
the human cancer
associated antigens is kinectin or a fragment thereof.
In another embodiment the agent is an isolated polypeptide selected from the
group
consisting of PP Group l, PP Group 2, PP Group 3, PP Group 4, and PP group 5
polypeptides.
In yet another embodiment the disorder is cancer.
According to another aspect the invention is a method for treating a subject
having a
condition characterized by expression of a cancer associated antigen precursor
in cells of the
subject. The method includes the steps of (i) removing an immunoreactive cell
containing
sample from the subject, (ii) contacting the immunoreactive cell containing
sample to the host
cell under conditions favoring production of cytolytic T cells against a human
cancer
associated antigen which is a fragment of the precursor, (iii) introducing the
cytolytic T cells
to the subject in an amount effective to lyse cells which express the human
cancer associated
antigen, wherein the host cell is transformed or transfected with an
expression vector
comprising an isolated nucleic acid molecule operably linked to a promoter,
the isolated
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
- 10-
nucleic acid molecule being selected from the group of nucleic acid molecules
consisting of
NA Group 1, NA Group 2, NA Group 3, NA Group 4, NA Group 5.
In one embodiment the host cell recombinantly expresses an HLA molecule which
binds the human cancer associated antigen. In another embodiment the host cell
endogenously expresses an HLA molecule which binds the human cancer associated
antigen.
The invention includes in another aspect a method for treating a subject
having a
condition characterized by expression of a cancer associated antigen precursor
in cells of the
subject. The method includes the steps of (i) identifying a nucleic acid
molecule expressed by
the cells associated with said condition, wherein said nucleic acid molecule
is a NA Group 1
molecule (ii) transfecting a host cell with a nucleic acid selected from the
group consisting of
(a) the nucleic acid molecule identified, (b) a fragment of the nucleic acid
identified which
includes a segment coding for a cancer associated antigen, (c) deletions,
substitutions or
additions to (a) or (b), and (d) degenerates of (a), (b), or (c); (iii)
culturing said transfected
host cells to express the transfected nucleic acid molecule, and; (iv)
introducing an amount of
said host cells or an extract thereof to the subject effective to increase an
immune response
against the cells of the subject associated with the condition. Preferably,
the antigen is a
human antigen and the subject is a human. In certain preferred embodiments the
nucleic acid
molecule is a kinectin nucleic acid molecule.
In one embodiment the method also includes the step of (a) identifying an MHC
molecule which presents a portion of an expression product of the nucleic acid
molecule,
wherein the host cell expresses the same MHC molecule as identified in (a) and
wherein the
host cell presents an MHC binding portion of the expression product of the
nucleic acid
molecule.
In another embodiment the method also includes the step of treating the host
cells to
render them non-proliferative.
In yet another embodiment the immune response comprises a B-cell response or a
T
cell response. Preferably the response is a T-cell response which comprises
generation of
cytolytic T-cells specific for the host cells presenting the portion of the
expression product of
the nucleic acid molecule or cells of the subject expressing the human cancer
associated
antigen.
In another embodiment the nucleic acid molecule is a NA Group 3 molecule.
Another aspect of the invention is a method for treating or diagnosing or
monitoring a
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-11-
subject having a condition characterized by expression of an abnormal amount
of a protein
encoded by a nucleic acid molecule that is a NA Group 1 molecule. The method
includes the
step of administering to the subject an antibody which specifically binds to
the protein or a
peptide derived therefrom, the antibody being coupled to a therapeutically
useful agent, in an
amount effective to treat the condition.
In one embodiment the antibody is a monoclonal antibody. Preferably the
monoclonal
antibody is a chimeric antibody or a humanized antibody.
In another aspect the invention is a method for treating a condition
characterized by
expression in a subject of abnormal amounts of a protein encoded by a nucleic
acid molecule
that is a NA Group 1 nucleic acid molecule. The method involves the step of
administering to
a subject at least one of the pharmaceutical compositions of the invention
described above in
an amount effective to prevent, delay the onset of, or inhibit the condition
in the subject. In
one embodiment the condition is cancer. In another embodiment the method
includes the step
of first identifying that the subject expresses in a tissue abnormal amounts
of the protein.
The invention in another aspect is a method for treating a subject having a
condition
characterized by expression of abnormal amounts of a protein encoded by a
nucleic acid
molecule that is a NA Group 1 nucleic acid molecule. The method includes the
steps of (i}
identifying cells from the subject which express abnormal amounts of the
protein; (ii)
isolating a sample of the cells; (iii) cultivating the cells, and (iv)
introducing the cells to the
subject in an amount effective to provoke an immune response against the
cells.
In one embodiment the method includes the step of rendering the cells non-
proliferative, prior to introducing them to the subject.
In another aspect the invention is a method for treating a pathological cell
condition
characterized by abnormal expression of a protein encoded by a nucleic acid
molecule that is a
NA Group 1 nucleic acid molecule. The method includes the step of
administering to a
subject in need thereof an effective amount of an agent which inhibits the
expression or
activity of the protein.
In one embodiment the agent is an inhibiting antibody which selectively binds
to the
protein and wherein the antibody is a monoclonal antibody, a chimeric
antibody, a humanized
antibody or a fragment thereof. In another embodiment the agent is an
antisense nucleic acid
molecule which selectively binds to the nucleic acid molecule which encodes
the protein. In
yet another important embodiment the nucleic acid molecule is a NA Group 3
nucleic acid
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
- 12
molecule. In other preferred embodiments, the nucleic acid molecule is a
kinectin nucleic
acid molecule.
The invention includes in another aspect a composition of matter useful in
stimulating
an immune response to a plurality of proteins encoded by nucleic acid
molecules that are NA
Group 1 molecules. The composition is a plurality of peptides derived from the
amino acid
sequences of the proteins, wherein the peptides bind to one or more MHC
molecules
presented on the surface of the cells which express an abnormal amount of the
protein. In
preferred embodiments, at least one of the proteins is kinectin.
In one embodiment at least a portion of the plurality of peptides bind to MHC
molecules and elicit a cytolytic response thereto. In another embodiment the
composition of
matter includes an adjuvant. In another embodiment the adjuvant is a saponin,
GM-CSF, or
an interleukin. In still another embodiment, the compositions also includes at
least one
peptide useful in stimulating an immune response to at least one protein which
is not encoded
by nucleic acid molecules that are NA Group I molecules, wherein the at least
one peptide
binds to one or more MHC molecules.
According to another aspect the invention is an isolated antibody which
selectively
binds to a complex of: (i) a peptide derived from a protein encoded by a
nucleic acid molecule
that is a NA Group 1 molecule and (ii) and an MHC molecule to which binds the
peptide to
form the complex, wherein the isolated antibody does not bind to (i) or (ii)
alone.
In one embodiment the antibody is a monoclonal antibody, a chimeric antibody,
a
humanized antibody or a fragment thereof.
The invention also involves the use of the genes, gene products, fragments
thereof,
agents which bind thereto, and so on in the preparation of medicaments. A
particular
medicament is for treating cancer and a more particular medicament is for
treating breast
cancer, lung cancer, renal cancer, colon cancer, prostate cancer or gastric
cancer.
Detailed Description of the Invention
In the above summary and in the ensuing description, lists of sequences are
provided.
The lists are meant to embrace each single sequence separately, two or more
sequences
together where they form a part of the same gene, any combination of two or
more sequences
which relate to different genes, including and up to the total number on the
list, as if each and
every combination were separately and specifically enumerated. Likewise, when
mentioning
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-13-
fragment size, it is intended that a range embrace the smallest fragment
mentioned to the full-
length of the sequence (less one nucleotide or amino acid so that it is a
fragment), each and
every fragment length intended as if specifically enumerated. Thus, if a
fragment could be
between 10 and 15 in length, it is explicitly meant to mean 10, 11, 12, 13,
14, or 15 in length.
The summary and the claims mention antigen precursors and antigens. As used in
the
summary and in the claims, a precursor is substantially the full-length
protein encoded by the
coding region of the isolated DNA and the antigen is a peptide which complexes
with MHC,
preferably HLA, and which participates in the immune response as part of that
complex. Such
antigens are typically 9 amino acids long, although this may vary slightly.
As used herein, a subject is a human, non-human primate, cow, horse, pig,
sheep, goat,
dog, cat or rodent. In all embodiments human cancer antigens and human
subjects are
preferred.
The present invention in one aspect involves the cloning of cDNAs encoding
human
cancer associated antigen precursors using autologous antisera of subjects
having renal cancer.
The sequences of the clones representing genes identified according to the
methods described
herein are presented in the attached Sequence Listing. Of the foregoing, it
can be seen that
some of the clones are considered completely novel as no nucleotide or amino
acid
homologies to coding regions were found in the databases searched. Other
clones are novel
but have some homology to sequences deposited in databases (mainly EST
sequences).
Nevertheless, the entire gene sequence was not previously known. In some cases
no function
was suspected and in other cases, even if a function was suspected, it was not
know that the
gene was associated with cancer. In all cases, it was not known or suspected
that the gene
encoded a cancer antigen which reacted with antibody from autologous sera.
Analysis of the
clone sequences by comparison to nucleic acid and protein databases determined
that still
other of the clones surprisingly are closely related to other previously-
cloned genes. The
sequences of these related genes is also presented in the Sequence Listing.
The nature of the
foregoing genes as encoding antigens recognized by the immune systems of
cancer patients is,
of course, unexpected.
The invention thus involves in one aspect cancer associated antigen
polypeptides,
genes encoding those polypeptides, functional modifications and variants of
the foregoing,
useful fragments of the foregoing, as well as diagnostics and therapeutics
relating thereto.
Homologs and alleles of the cancer associated antigen nucleic acids of the
invention
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
- 14
can be identified by conventional techniques. Thus, an aspect of the invention
is those nucleic
acid sequences which code for cancer associated antigen precursors. Because
this application
contains so many sequences, the following chart is provided to identify the
various groups of
sequences discussed in the claims and in the summary:
Nucleic Acid Sequences
NA Group 1. (a) nucleic acid molecules which hybridize under stringent
conditions to a
molecule consisting of a nucleic acid sequence selected from the group
consisting of nucleic
acid sequences among SEQ ID NOs: 1-11 and 22-46 and which code for a cancer
associated
antigen precursor,
(b) deletions, additions and substitutions which code for a respective cancer
associated antigen precursor,
(c) nucleic acid molecules that differ from the nucleic acid molecules of (a)
or
(b) in codon sequence due to the degeneracy of the genetic code, and
(d) complements of (a), (b) or (c).
NA Group 2. Fragments of NA Group 1, which codes for a polypeptide which, or a
portion
of which, binds an MHC molecule to form a complex recognized by a an
autologous antibody
or lymphocyte.
NA Group 3. The subset of NA Group 1 where the nucleotide sequence is selected
from the
group consisting of:
(a) previously unknown human nucleic acids coding for a human cancer
associated antigen precursor (i.e. nucleic acid sequences among SEQ ID NOs: 1-
11),
(b) deletions, additions and substitutions which code for a respective human
cancer associated antigen precursor,
(c) nucleic acid molecules that differ from the nucleic acid molecules of (a)
or
(b) in codon sequence due to the degeneracy of the genetic code, and
(d) complements of (a), (b) or (c).
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-15
NA Group 4. Fragments of NA Group 3, which code for a polypeptide which, or a
portion of
which, binds to an MHC molecule to form a complex recognized by an autologous
antibody
or lymphocyte.
NA Group 5. A subset of NA Group 1, comprising human cancer associated
antigens that
react with allogeneic cancer antisera.
Polypeptide Sequences
PP Group Polypeptides encoded by
1. NA Group 1.
PP Group Polypeptides encoded by
2. NA Group 2
PP Group Polypeptides encoded by
3. NA Group 3.
PP Group Polypeptides encoded by
4. NA Group 4.
PP Group Polypeptides encoded by
5. NA Group S.
The term "stringent conditions" as used herein refers to parameters with which
the art
is familiar. Nucleic acid hybridization parameters may be found in references
which compile
such methods, e.g. Molecular Cloning: A Laboratory Manual, J. Sambrook, et
al., eds.,
Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New
York, 1989,
or Current Protocols in Molecular Biology, F.M. Ausubel, et al., eds., John
Wiley & Sons,
Inc., New York. More specifically, stringent conditions, as used herein,
refers, for example,
to hybridization at 65°C in hybridization buffer (3.5 x SSC, 0.02%
Ficoll, 0.02% polyvinyl
pyrrolidone, 0.02% Bovine Serum Albumin, 2.SmM NaHzP04(pH7), 0.5% SDS, 2mM
EDTA). SSC is 0.1 SM sodium chloride/O.15M sodium citrate, pH7; SDS is sodium
dodecyl
sulphate; and EDTA is ethylenediaminetetracetic acid. After hybridization, the
membrane
upon which the DNA is transferred is washed, for example, in 2 x SSC at room
temperature
and then at 0.1 - 0.5 x SSC/0.1 x SDS at temperatures up to 68°C.
There are other conditions, reagents, and so forth which can be used, which
result in a
similar degree of stringency. The skilled artisan will be familiar with such
conditions, and
thus they are not given here. It will be understood, however, that the skilled
artisan will be
able to manipulate the conditions in a manner to permit the clear
identification of homologs
and alleles of cancer associated antigen nucleic acids of the invention (e.g.,
by using lower
stringency conditions). The skilled artisan also is familiar with the
methodology for screening
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
- 16
cells and libraries for expression of such molecules which then are routinely
isolated, followed
by isolation of the pertinent nucleic acid molecule and sequencing.
In general homologs and alleles typically will share at least 7S% nucleotide
identity
and/or at least 90% amino acid identity to the sequences of cancer associated
antigen nucleic
acid and polypeptides, respectively, in some instances will share at least 90%
nucleotide
identity and/or at least 9S% amino acid identity and in still other instances
will share at least
9S% nucleotide identity and/or at least 99% amino acid identity. The homology
can be
calculated using various, publicly available software tools developed by NCBI
(Bethesda,
Maryland) that can be obtained through the Internet
(ftp:/ncbi.nlm.nih.gov/pub/). Exemplary
tools include the BLAST system available at httn://www.ncbi nlm nih <=ov,
using default
settings. Pairwise and ClustalW alignments (BLOSUM30 matrix setting) as well
as Kyte-
Doolittle hydropathic analysis can be obtained using the MacVector sequence
analysis
software (Oxford Molecular Group). Watson-Crick complements of the foregoing
nucleic
acids also are embraced by the invention.
In screening for cancer associated antigen genes, a Southern blot may be
performed
using the foregoing conditions, together with a radioactive probe. After
washing the
membrane to which the DNA is finally transferred, the membrane can be placed
against X-ray
film to detect the radioactive signal. In screening for the expression of
cancer associated
antigen nucleic acids, Northern blot hybridizations using the foregoing
conditions (see also
the Examples) can be performed on samples taken from breast cancer patients or
subjects
suspected of having a condition characterized by expression of breast cancer
associated
antigen genes. Amplification protocols such as polymerase chain reaction using
primers
which hybridize to the sequences presented also can be used for detection of
the cancer
associated antigen genes or expression thereof.
The renal cancer associated genes correspond to SEQ ID NOs. 1-11 and 22-3S.
Kinectin cancer associated sequences correspond to SEQ ID Nos:36-46. The
preferred cancer
associated antigens for the methods of diagnosis disclosed herein are those
which were found
to react with allogeneic cancer antisera (i.e. NA Group S). Encoded
polypeptides (e.g.,
proteins), peptides and antisera thereto are also preferred for diagnosis.
The invention also includes degenerate nucleic acids which include alternative
codons
to those present in the native materials. For example, serine residues are
encoded by the
codons TCA, AGT, TCC, TCG, TCT and AGC. Each of the six codons is equivalent
for the
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
_ 17_
purposes of encoding a serine residue. Thus, it will be apparent to one of
ordinary skill in the
art that any of the serine-encoding nucleotide triplets may be employed to
direct the protein
synthesis apparatus, in vitro or in vivo, to incorporate a serine residue into
an elongating breast
cancer associated antigen polypeptide. Similarly, nucleotide sequence triplets
which encode
other amino acid residues include, but are not limited to: CCA, CCC, CCG and
CCT (proline
codons); CGA, CGC, CGG, CGT, AGA and AGG (arginine codons); ACA, ACC, ACG and
ACT (threonine codons); AAC and AAT (asparagine codons); and ATA, ATC and ATT
(isoleucine codons). Other amino acid residues may be encoded similarly by
multiple
nucleotide sequences. Thus, the invention embraces degenerate nucleic acids
that differ from
the biologically isolated nucleic acids in codon sequence due to the
degeneracy of the genetic
code.
The invention also provides modified nucleic acid molecules which include
additions,
substitutions and deletions of one or more nucleotides. In preferred
embodiments, these
modified nucleic acid molecules and/or the polypeptides they encode retain at
least one
activity or function of the unmodified nucleic acid molecule and/or the
polypeptides, such as
antigenicity, enzymatic activity, receptor binding, formation of complexes by
binding of
peptides by MHC class I and class II molecules, etc. In certain embodiments,
the modified
nucleic acid molecules encode modified polypeptides, preferably polypeptides
having
conservative amino acid substitutions as are described elsewhere herein. The
modified
nucleic acid molecules are structurally related to the unmodified nucleic acid
molecules and in
preferred embodiments are sufficiently structurally related to the unmodified
nucleic acid
molecules so that the modified and unmodified nucleic acid molecules hybridize
under
stringent conditions known to one of skill in the art.
For example, modified nucleic acid molecules which encode polypeptides having
single amino acid changes can be prepared. Each of these nucleic acid
molecules can have
one, two or three nucleotide substitutions exclusive of nucleotide changes
corresponding to
the degeneracy of the genetic code as described herein. Likewise, modified
nucleic acid
molecules which encode polypeptides having two amino acid changes can be
prepared which
have, e.g., 2-6 nucleotide changes. Numerous modified nucleic acid molecules
like these will
be readily envisioned by one of skill in the art, including for example,
substitutions of
nucleotides in codons encoding amino acids 2 and 3, 2 and 4, 2 and 5, 2 and 6,
and so on. In
the foregoing example, each combination of two amino acids is included in the
set of
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/228~3
-18
modified nucleic acid molecules, as well as all nucleotide substitutions which
code for the
amino acid substitutions. Additional nucleic acid molecules that encode
polypeptides having
additional substitutions (i.e., 3 or more), additions or deletions (e.g., by
introduction of a stop
codon or a splice site(s)) also can be prepared and are embraced by the
invention as readily
envisioned by one of ordinary skill in the art. Any of the foregoing nucleic
acids or
polypeptides can be tested by routine experimentation for retention of
structural relation or
activity to the nucleic acids and/or polypeptides disclosed herein.
The invention also provides isolated unique fragments of cancer associated
antigen
nucleic acid sequences or complements thereof. A unique fragment is one that
is a 'signature'
for the larger nucleic acid. It, for example, is long enough to assure that
its precise sequence
is not found in molecules within the human genome outside of the cancer
associated antigen
nucleic acids defined above (and human alleles). Those of ordinary skill in
the art may apply
no more than routine procedures to determine if a fragment is unique within
the human
genome. Unique fragments, however, exclude fragments completely composed of
the
nucleotide sequences of any of GenBank accession numbers listed in Table I or
other
previously published sequences as of the filing date of the priority documents
for sequences
listed in a respective priority document or the filing date of this
application for sequences
listed for the first time in this application which overlap the sequences of
the invention.
A fragment which is completely composed of the sequence described in the
foregoing
GenBank deposits is one which does not include any of the nucleotides unique
to the
sequences of the invention. Thus, a unique fragment must contain a nucleotide
sequence other
than the exact sequence of those in GenBank or fragments thereof. The
difference may be an
addition, deletion or substitution with respect to the GenBank sequence or it
may be a
sequence wholly separate from the GenBank sequence.
Unique fragments can be used as probes in Southern and Northern blot assays to
identify such nucleic acids, or can be used in amplification assays such as
those employing
PCR. As known to those skilled in the art, large probes such as 200, 250, 300
or more
nucleotides are preferred for certain uses such as Southern and Northern
blots, while smaller
fragments will be preferred for uses such as PCR. Unique fragments also can be
used to
produce fusion proteins for generating antibodies or determining binding of
the polypeptide
fragments, or for generating immunoassay components. Likewise, unique
fragments can be
employed to produce nonfused fragments of the cancer associated antigen
polypeptides,
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
- 19
useful, for example, in the preparation of antibodies, and in immunoassays.
Unique fragments
further can be used as antisense molecules to inhibit the expression of cancer
associated
antigen nucleic acids and polypeptides, particularly for therapeutic purposes
as described in
greater detail below.
As will be recognized by those skilled in the art, the size of the unique
fragment will
depend upon its conservancy in the genetic code. Thus, some regions of cancer
associated
antigen sequences and complements thereof will require longer segments to be
unique while
others will require only short segments, typically between 12 and 32
nucleotides (e.g. 12, 13,
14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 and 32
or more bases long,
up to the entire length of the disclosed sequence. As mentioned above, this
disclosure intends
to embrace each and every fragment of each sequence, beginning at the first
nucleotide, the
second nucleotide and so on, up to 8 nucleotides short of the end, and ending
anywhere from
nucleotide number 8, 9, 10 and so on for each sequence, up to the very last
nucleotide
(provided the sequence is unique as described above).
Virtually any segment of the polypeptide coding region of novel cancer
associated
antigen nucleic acids, or complements thereof, that is I 8 or more nucleotides
in length will be
unique. Those skilled in the art are well versed in methods for selecting such
sequences,
typically on the basis of the ability of the unique fragment to selectively
distinguish the
sequence of interest from other sequences in the human genome of the fragment
to those on
known databases typically is all that is necessary, although in vitro
confirmatory hybridization
and sequencing analysis may be performed.
Especially preferred include nucleic acids encoding a series of epitopes,
known as
"polytopes". The epitopes can be arranged in sequential or overlapping fashion
(see, e.g.,
Thomson et al., Proc. Natl. Acad. Sci. USA 92:5845-5849, 1995; Gilbert et al.,
Nature
Biotechnol. 15:1280-1284, 1997), with or without the natural flanking
sequences, and can be
separated by unrelated linker sequences if desired. The polytope is processed
to generated
individual epitopes which are recognized by the immune system for generation
of immune
responses.
Thus, for example, peptides derived from a polypeptide having an amino acid
sequence encoded by one of the nucleic acid disclosed herein, and which are
presented by
MHC molecules and recognized by CTL or T helper lymphocytes, can be combined
with
peptides from one or more other cancer associated antigens (e.g. by
preparation of hybrid
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-20
nucleic acids or polypeptides) to form "polytopes". The two or more peptides
(or nucleic
acids encoding the peptides) can be selected from those described herein, or
they can include
one or more peptides of previously known cancer associated antigens. Exemplary
cancer
associated peptide antigens that can be administered to induce or enhance an
immune
response are derived from tumor associated genes and encoded proteins
including MAGE-A1,
MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A5, MAGE-A6, MAGE-A7, MAGE-A8,
MAGE-A9, MAGE-A10, MAGE-Al 1, MAGE-A12, MACE-13, GAGE-I, GAGE-2, GAGE-
3, GAGE-4, GAGE-5, GAGE-6, GAGE-7, GAGE-8, BAGE-I, RAGE-1, LB33/MUM-1,
PRAME, NAG, MAGE-B2, MAGE-B3, MAGE-B4, tyrosinase, brain glycogen
phosphorylase, Melan-A, MAGE-C1 MAGE-C2, NY-ESO-1, LAGE-I, SSX-1, SSX-2
(HOM-MEL-40) SSX-4, SSX-5, SCP-1 and CT-7. See, for example, PCT application
publication no. W096/10577. Other examples will be known to one of ordinary
skill in the
art (for example, see Coulie, Stem Cells 13:393-403, 1995), and can be used in
the invention
in a like manner as those disclosed herein. One of ordinary skill in the art
can prepare
polypeptides comprising one or more peptides and one or more of the foregoing
cancer
associated peptides, or nucleic acids encoding such polypeptides, according to
standard
procedures of molecular biology.
Thus polytopes are groups of two or more potentially immunogenic or immune
response stimulating peptides which can be joined together in various
arrangements (e.g.
concatenated, overlapping). The polytope (or nucleic acid encoding the
polytope) can be
administered in a standard immunization protocol, e.g. to animals, to test the
effectiveness of
the polytope in stimulating, enhancing and/or provoking an immune response.
The peptides can be joined together directly or via the use of flanking
sequences to
form polytopes, and the use of polytopes as vaccines is well known in the art
(see, e.g.,
Thomson et aL, Proc. Acad. Natl. Acad. Sci USA 92(13):5845-5849, 1995; Gilbert
et al.,
Nature Biotechnol. 15(12):1280-1284, 1997; Thomson et al., J. Immunol.
157(2):822-826,
1996; Tarn et al., J. Exp. Med. 171 ( 1 ):299-306, 1990). For example, Tam
showed that
polytopes consisting of both MHC class I and class II binding epitopes
successfully generated
antibody and protective immunity in a mouse model. Tam also demonstrated that
polytopes
comprising "strings" of epitopes are processed to yield individual epitopes
which are
presented by MHC molecules and recognized by CTLs. Thus polytopes containing
various
numbers and combinations of epitopes can be prepared and tested for
recognition by CTLs
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-21 -
and for efficacy in increasing an immune response.
It is known that tumors express a set of tumor antigens, of which only certain
subsets
may be expressed in the tumor of any given patient. Polytopes can be prepared
which
correspond to the different combination of epitopes representing the subset of
tumor rejection
antigens expressed in a particular patient. Polytopes also can be prepared to
reflect a broader
spectrum of tumor rejection antigens known to be expressed by a tumor type.
Polytopes can
be introduced to a patient in need of such treatment as polypeptide
structures, or via the use of
nucleic acid delivery systems known in the art (see, e.g., Allsopp et al.,
Eur. J. Immunol.
26(8):1951-1959, 1996). Adenovirus, pox virus, Ty-virus like particles, adeno-
associated
virus, plasmids, bacteria, etc. can be used in such delivery. One can test the
polytope delivery
systems in mouse models to determine efficacy of the delivery system. The
systems also can
be tested in human clinical trials.
In instances in which a human HLA class I molecule presents tumor rejection
antigens
derived from cancer associated nucleic acids, the expression vector may also
include a nucleic
acid sequence coding for the HLA molecule that presents any particular tumor
rejection
antigen derived from these nucleic acids and polypeptides. Alternatively, the
nucleic acid
sequence coding for such a HLA molecule can be contained within a separate
expression
vector. In a situation where the vector contains both coding sequences, the
single vector can
be used to transfect a cell which does not normally express either one. Where
the coding
sequences for a cancer associated antigen precursor and the HLA molecule which
presents it
are contained on separate expression vectors, the expression vectors can be
cotransfected. The
cancer associated antigen precursor coding sequence may be used alone, when,
e.g. the host
cell already expresses a HLA molecule which presents a cancer associated
antigen derived
from precursor molecules. Of course, there is no limit on the particular host
cell which can be
used. As the vectors which contain the two coding sequences may be used in any
antigen-
presenting cells if desired, and the gene for cancer associated antigen
precursor can be used in
host cells which do not express a HLA molecule which presents a cancer
associated antigen.
Further, cell-free transcription systems may be used in lieu of cells.
As mentioned above, the invention embraces antisense oligonucleotides that
selectively bind to a nucleic acid molecule encoding a cancer associated
antigen polypeptide,
to reduce the expression of cancer associated antigens. This is desirable in
virtually any
medical condition wherein a reduction of expression of cancer associated
antigens is
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
- 22
desirable, e.g., in the treatment of cancer. This is also useful for in vitro
or in vivo testing of
the effects of a reduction of expression of one or more cancer associated
antigens.
As used herein, the term "antisense oligonucleotide" or "antisense" describes
an
oligonucleotide that is an oligoribonucleotide, oligodeoxyribonucleotide,
modified
oligoribonucleotide, or modified oligodeoxyribonucleotide which hybridizes
under
physiological conditions to DNA comprising a particular gene or to an mRNA
transcript of
that gene and, thereby, inhibits the transcription of that gene and/or the
translation of that
mRNA. The antisense molecules are designed so as to interfere with
transcription or
translation of a target gene upon hybridization with the target gene or
transcript. Those
skilled in the art will recognize that the exact length of the antisense
oligonucleotide and its
degree of complementarity with its target will depend upon the specific target
selected,
including the sequence of the target and the particular bases which comprise
that sequence. It
is preferred that the antisense oligonucleotide be constructed and arranged so
as to bind
selectively with the target under physiological conditions, i.e., to hybridize
substantially more
to the target sequence than to any other sequence in the target cell under
physiological
conditions. Based upon the sequences of nucleic acids encoding breast cancer
associated
antigen, or upon allelic or homologous genomic and/or cDNA sequences, one of
skill in the
art can easily choose and synthesize any of a number of appropriate antisense
molecules for
use in accordance with the present invention. In order to be sufficiently
selective and potent
for inhibition, such antisense oligonucleotides should comprise at least 10
and, more
preferably, at least 15 consecutive bases which are complementary to the
target, although in
certain cases modified oligonucleotides as short as 7 bases in length have
been used
successfully as antisense oligonucleotides (Wagner et al., Nature Biotechnol.
14:840-844,
1996). Most preferably, the antisense oligonucleotides comprise a
complementary sequence
of 20-30 bases. Although oligonucleotides may be chosen which are antisense to
any region
of the gene or mRNA transcripts, in preferred embodiments the antisense
oligonucleotides
correspond to N-terminal or 5' upstream sites such as translation initiation,
transcription
initiation or promoter sites. In addition, 3'-untranslated regions may be
targeted. Targeting to
mRNA splicing sites has also been used in the art but may be less preferred if
alternative
mRNA splicing occurs. In addition, the antisense is targeted, preferably, to
sites in which
mRNA secondary structure is not expected (see, e.g., Sainio et al., Cell Mol.
Neurobiol.
14(5):439-457, 1994) and at which proteins are not expected to bind. Finally,
although the
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
- 23 -
listed sequences are cDNA sequences, one of ordinary skill in the art may
easily derive the
genomic DNA corresponding to the cDNA of a cancer associated antigen. Thus,
the present
invention also provides for antisense oligonucleotides which are complementary
to the
genomic DNA corresponding to nucleic acids encoding cancer associated
antigens. Similarly,
antisense to allelic or homologous cDNAs and genomic DNAs are enabled without
undue
experimentation.
In one set of embodiments, the antisense oligonucleotides of the invention may
be
composed of "natural" deoxyribonucleotides, ribonucleotides, or any
combination thereof.
That is, the S' end of one native nucleotide and the 3' end of another native
nucleotide may be
covalently linked, as in natural systems, via a phosphodiester internucleoside
linkage. These
oligonucleotides may be prepared by art recognized methods which may be
carried out
manually or by an automated synthesizer. They also may be produced
recombinantly by
vectors.
In preferred embodiments, however, the antisense oligonucleotides of the
invention
also may include "modified" oligonucleotides. That is, the oligonucleotides
may be modified
in a number of ways which do not prevent them from hybridizing to their target
but which
enhance their stability or targeting or which otherwise enhance their
therapeutic effectiveness.
The term "modified oligonucleotide" as used herein describes an
oligonucleotide in
which (1) at least two of its nucleotides are covalently linked via a
synthetic internucleoside
linkage (i.e., a linkage other than a phosphodiester linkage between the 5'
end of one
nucleotide and the 3' end of another nucleotide) and/or (2) a chemical group
not normally
associated with nucleic acids has been covalently attached to the
oligonucleotide. Preferred
synthetic internucleoside linkages are phosphorothioates, alkyiphosphonates,
phosphorodithioates, phosphate esters, alkylphosphonothioates,
phosphoramidates,
carbamates, carbonates, phosphate triesters, acetamidates, carboxymethyl
esters and peptides.
The term "modified oligonucleotide" also encompasses oligonucleotides with a
covalently modified base and/or sugar. For example, modified oligonucleotides
include
oligonucleotides having backbone sugars which are covaiently attached to low
molecular
weight organic groups other than a hydroxyl group at the 3' position and other
than a
phosphate group at the 5' position. Thus modified oligonucleotides may include
a 2'-O-
alkylated ribose group. In addition, modified oligonucleotides may include
sugars such as
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-24-
arabinose instead of ribose. The present invention, thus, contemplates
pharmaceutical
preparations containing modified antisense molecules that are complementary to
and
hybridizable with, under physiological conditions, nucleic acids encoding
breast cancer
associated antigen polypeptides, together with pharmaceutically acceptable
carriers.
Antisense oligonucleotides may be administered as part of a pharmaceutical
composition. Such a pharmaceutical composition may include the antisense
oligonucleotides
in combination with any standard physiologically and/or pharmaceutically
acceptable carriers
which are known in the art. The compositions should be sterile and contain a
therapeutically
effective amount of the antisense oligonucleotides in a unit of weight or
volume suitable for
administration to a patient. The term "pharmaceutically acceptable" means a
non-toxic
material that does not interfere with the effectiveness of the biological
activity of the active
ingredients. The term "physiologically acceptable" refers to a non-toxic
material that is
compatible with a biological system such as a cell, cell culture, tissue, or
organism. The
characteristics of the carrier will depend on the route of administration.
Physiologically and
pharmaceutically acceptable carriers include diluents, fillers, salts,
buffers, stabilizers,
solubilizers, and other materials which are well known in the art, as further
described below.
As used herein, a "vector" may be any of a number of nucleic acids into which
a
desired sequence may be inserted by restriction and ligation for transport
between different
genetic environments or for expression in a host cell. Vectors are typically
composed of DNA
although RNA vectors are also available. Vectors include, but are not limited
to, plasmids,
phagemids and virus genomes. A cloning vector is one which is able to
replicate
autonomously or integrated in the genone in a host cell, and which is further
characterized by
one or more endonuclease restriction sites at which the vector may be cut in a
determinable
fashion and into which a desired DNA sequence may be ligated such that the new
recombinant vector retains its ability to replicate in the host cell. In the
case of plasmids,
replication of the desired sequence may occur many times as the plasmid
increases in copy
number within the host bacterium or just a single time per host before the
host reproduces by
mitosis. In the case of phage, replication may occur actively during a lytic
phase or passively
during a lysogenic phase. An expression vector is one into which a desired DNA
sequence
may be inserted by restriction and ligation such that it is operably joined to
regulatory
sequences and may be expressed as an RNA transcript. Vectors may further
contain one or
more marker sequences suitable for use in the identification of cells which
have or have not
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
- 25 -
been transformed or transfected with the vector. Markers include, for example,
genes
encoding proteins which increase or decrease either resistance or sensitivity
to antibiotics or
other compounds, genes which encode enzymes whose activities are detectable by
standard
assays known in the art (e.g.,13-galactosidase, luciferase or alkaline
phosphatase), and genes
which visibly affect the phenotype of transformed or transfected cells, hosts,
colonies or
plaques (e.g., green fluorescent protein). Preferred vectors are those capable
of autonomous
replication and expression of the structural gene products present in the DNA
segments to
which they are operably joined.
As used herein, a coding sequence and regulatory sequences are said to be
"operably"
joined when they are covalently linked in such a way as to place the
expression or
transcription of the coding sequence under the influence or control of the
regulatory
sequences. If it is desired that the coding sequences be translated into a
functional protein,
two DNA sequences are said to be operably joined if induction of a promoter in
the S'
regulatory sequences results in the transcription of the coding sequence and
if the nature of the
linkage between the two DNA sequences does not ( 1 ) result in the
introduction of a frame-
shift mutation, (2) interfere with the ability of the promoter region to
direct the transcription
of the coding sequences, or (3) interfere with the ability of the
corresponding RNA transcript
to be translated into a protein. Thus, a promoter region would be operably
joined to a coding
sequence if the promoter region were capable of effecting transcription of
that DNA sequence
such that the resulting transcript might be translated into the desired
protein or polypeptide.
The precise nature of the regulatory sequences needed for gene expression may
vary
between species or cell types, but shall in general include, as necessary, 5'
non-transcribed
and 5' non-translated sequences involved with the initiation of transcription
and translation
respectively, such as a TATA box, capping sequence, CART sequence, and the
like.
Especially, such 5' non-transcribed regulatory sequences will include a
promoter region
which includes a promoter sequence for transcriptional control of the operably
joined gene.
Regulatory sequences rnay also include enhancer sequences or upstream
activator sequences
as desired. The vectors of the invention may optionally include S' leader or
signal sequences.
The choice and design of an appropriate vector is within the ability and
discretion of one of
ordinary skill in the art.
Expression vectors containing all the necessary elements for expression are
commercially available and known to those skilled in the art. See, e.g.,
Sambrook et al.,
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-26-
Molecular Cloning. A Laboratory Manual, Second Edition, Cold Spring Harbor
Laboratory
Press, 1989. Cells are genetically engineered by the introduction into the
cells of
heterologous DNA (RNA) encoding a breast cancer associated antigen polypeptide
or
fragment or variant thereof. That heterologous DNA (RNA) is placed under
operable control
of transcriptional elements to permit the expression of the heterologous DNA
in the host cell.
Preferred systems for mRNA expression in mammalian cells are those such as
pRc/CMV (available from Invitrogen, Carlsbad, CA) that contain a selectable
marker such as
a gene that confers 6418 resistance (which facilitates the selection of stably
transfected cell
lines) and the human cytomegalovirus (CMV) enhancer-promoter sequences.
Additionally,
suitable for expression in primate or canine cell lines is the pCEP4 vector
(Invitrogen), which
contains an Epstein Barn Virus (EBV) origin of replication, facilitating the
maintenance of
plasmid as a multicopy extrachromosomal element. Another expression vector is
the pEF-
BOS plasmid containing the promoter of polypeptide Elongation Factor 1 a,
which stimulates
efficiently transcription in vitro. The plasmid is described by Mishizuma and
Nagata (Nuc.
Acids Res. 18:5322, 1990), and its use in transfection experiments is
disclosed by, for
example, Demoulin (Mol. Cell. l3iol. 16:4710-4716, 1996). Still another
preferred expression
vector is an adenovirus, described by Stratford-Perricaudet, which is
defective for E 1 and E3
proteins (J. Clin. Invest. 90:626-630, 1992). The use of the adenovirus as an
Adeno.PlA
recombinant for the expression of an antigen is disclosed by Warnier et al.,
in intradermal
injection in mice for immunization against P1A (Int. J. Cancer, 67:303-310,
1996).
Additional vectors for delivery of nucleic acid are provided below.
The invention also embraces so-called expression kits, which allow the artisan
to
prepare a desired expression vector or vectors. Such expression kits include
at least separate
portions of a vector and one or more of the previously discussed cancer
associated antigen
nucleic acid molecules. Other components may be added, as desired, as long as
the previously
mentioned nucleic acid molecules, which are required, are included. The
invention also
includes kits for amplification of a cancer associated antigen nucleic acid,
including at least
one pair of amplification primers which hybridize to a cancer associated
antigen nucleic acid.
The primers preferably are 12-32 nucleotides in length and are non-overlapping
to prevent
formation of "primer-dimers". One of the primers will hybridize to one strand
of the cancer
associated antigen nucleic acid and the second primer will hybridize to the
complementary
strand of the cancer associated antigen nucleic acid, in an arrangement which
permits
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-27-
amplification of the cancer associated antigen nucleic acid. Selection of
appropriate primer
pairs is standard in the art. For example, the selection can be made with
assistance of a
computer program designed for such a purpose, optionally followed by testing
the primers fox
amplification specificity and efficiency.
The invention also permits the construction of cancer associated antigen gene
"knock-
outs" in cells and in animals, providing materials for studying certain
aspects of cancer and
immune system responses to cancer.
The invention also provides isolated polypeptides (including whole proteins
and
partial proteins) encoded by the foregoing cancer associated antigen nucleic
acids. Such
polypeptides are useful, for example, alone or as fusion proteins to generate
antibodies, as
components of an immunoassay or diagnostic assay or as therapeutics. Cancer
associated
antigen polypeptides can be isolated from biological samples including tissue
or cell
homogenates, and can also be expressed recombinantly in a variety of
prokaryotic and
eukaryotic expression systems by constructing an expression vector appropriate
to the
expression system, introducing the expression vector into the expression
system, and isolating
the recombinantly expressed protein. Short polypeptides, including antigenic
peptides (such
as are presented by MHC molecules on the surface of a cell for immune
recognition) also can
be synthesized chemically using well-established methods of peptide synthesis.
A unique fragment of a cancer associated antigen polypeptide, in general, has
the
features and characteristics of unique fragments as discussed above in
connection with nucleic
acids. As will be recognized by those skilled in the art, the size of the
unique fragment will
depend upon factors such as whether the fragment constitutes a portion of a
conserved protein
domain. Thus, some regions of cancer associated antigens will require longer
segments to be
unique while others will require only short segments, typically between 5 and
12 amino acids
(e.g. S, 6, 7, 8, 9, 10, 11 or 12 or more amino acids including each integer
up to the full
length).
Unique fragments of a polypeptide preferably are those fragments which retain
a
distinct functional capability of the polypeptide. Functional capabilities
which can be retained
in a unique fragment of a polypeptide include interaction with antibodies,
interaction with
other polypeptides or fragments thereof, selective binding of nucleic acids or
proteins, and
enzymatic activity. One important activity is the ability to act as a
signature for identifying
the polypeptide. Another is the ability to complex with HLA and to provoke in
a human an
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-28-
immune response. Those skilled in the art are well versed in methods for
selecting unique
amino acid sequences, typically on the basis of the ability of the unique
fragment to
selectively distinguish the sequence of interest from non-family members. A
comparison of
the sequence of the fragment to those on known databases typically is all that
is necessary.
The invention embraces variants of the cancer associated antigen polypeptides
described above. As used herein, a "variant" of a cancer associated antigen
polypeptide is a
polypeptide which contains one or more modifications to the primary amino acid
sequence of
a cancer associated antigen polypeptide. Modifications which create a cancer
associated
antigen variant can be made to a cancer associated antigen polypeptide 1 ) to
reduce or
eliminate an activity of a cancer associated antigen polypeptide; 2) to
enhance a property of a
cancer associated antigen polypeptide, such as protein stability in an
expression system or the
stability of protein-protein binding; 3) to provide a novel activity or
property to a cancer
associated antigen polypeptide, such as addition of an antigenic epitope or
addition of a
detectable moiety; or 4) to provide equivalent or better binding to an HLA
molecule.
Modifications to a cancer associated antigen polypeptide are typically made to
the nucleic
acid which encodes the cancer associated antigen polypeptide, and can include
deletions, point
mutations, truncations, amino acid substitutions and additions of amino acids
or non-amino
acid moieties. Alternatively, modifications can be made directly to the
polypeptide, such as
by cleavage, addition of a linker molecule, addition of a detectable moiety,
such as biotin,
addition of a fatty acid, and the like. Modifications also embrace fusion
proteins comprising
all or part of the cancer associated antigen amino acid sequence. One of skill
in the art will be
familiar with methods for predicting the effect on protein conformation of a
change in protein
sequence, and can thus "design" a variant cancer associated antigen
polypeptide according to
known methods. One example of such a method is described by Dahiyat and Mayo
in Science
278:82-87, 1997, whereby proteins can be designed de novo. The method can be
applied to a
known protein to vary a only a portion of the polypeptide sequence. By
applying the
computational methods of Dahiyat and Mayo, specific variants of a cancer
associated antigen
polypeptide can be proposed and tested to determine whether the variant
retains a desired
conformation.
In general, variants include cancer associated antigen polypeptides which are
modified
specifically to alter a feature of the polypeptide unrelated to its desired
physiological activity.
For example, cysteine residues can be substituted or deleted to prevent
unwanted disulfide
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-29-
linkages. Similarly, certain amino acids can be changed to enhance expression
of a breast
cancer associated antigen polypeptide by eliminating proteolysis by proteases
in an expression
system (e.g., dibasic amino acid residues in yeast expression systems in which
KEX2 protease
activity is present).
Mutations of a nucleic acid which encode a cancer associated antigen
polypeptide
preferably preserve the amino acid reading frame of the coding sequence, and
preferably do
not create regions in the nucleic acid which are likely to hybridize to form
secondary
structures, such a hairpins or Loops, which can be deleterious to expression
of the variant
polypeptide.
Mutations can be made by selecting an amino acid substitution, or by random
mutagenesis of a selected site in a nucleic acid which encodes the
polypeptide. Variant
polypeptides are then expressed and tested for one or more activities to
determine which
mutation provides a variant polypeptide with the desired properties. Further
mutations can be
made to variants (or to non-variant cancer associated antigen polypeptides)
which are silent as
to the amino acid sequence of the polypeptide, but which provide preferred
codons for
translation in a particular host. The preferred codons for translation of a
nucleic acid in, e.g.,
E coli, are well known to those of ordinary skill in the art. Still other
mutations can be made
to the noncoding sequences of a cancer associated antigen gene or cDNA clone
to enhance
expression of the polypeptide. The activity of variants of cancer associated
antigen
polypeptides can be tested by cloning the gene encoding the variant cancer
associated antigen
polypeptide into a bacterial or mammalian expression vector, introducing the
vector into an
appropriate host cell, expressing the variant cancer associated antigen
polypeptide, and testing
for a functional capability of the cancer associated antigen polypeptides as
disclosed herein.
For example, the variant cancer associated antigen polypeptide can be tested
for reaction with
autologous or allogeneic sera as disclosed in the Examples. Preparation of
other variant
polypeptides may favor testing of other activities, as will be known to one of
ordinary skill in
the art.
The skilled artisan will also realize that conservative amino acid
substitutions may be
made in cancer associated antigen polypeptides to provide functionally
equivalent variants of
the foregoing polypeptides, i.e, the variants retain the functional
capabilities of the cancer
associated antigen polypeptides. As used herein, a "conservative amino acid
substitution"
refers to an amino acid substitution which does not alter the relative charge
or size
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-30-
characteristics of the protein in which the amino acid substitution is made.
Variants can be
prepared according to methods for altering polypeptide sequence known to one
of ordinary
skill in the art such as are found in references which compile such methods,
e.g. Molecular
Cloning: A Laboratory Manual, J. Sambrook, et al., eds., Second Edition, Cold
Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, 1989, or Current Protocols in
Molecular
Biology, F.M. Ausubel, et al., eds., John Wiley & Sons, Inc., New York.
Exemplary
functionally equivalent variants of the cancer associated antigen polypeptides
include
conservative amino acid substitutions of in the amino acid sequences of
proteins disclosed
herein. Conservative substitutions of amino acids include substitutions made
amongst amino
acids within the following groups: (a) M, I, L, V; (b) F, Y, W; (c) K, R, H;
(d) A, G; (e) S, T;
(f) Q, N; and (g) E, D.
For example, upon determining that a peptide derived from a cancer associated
antigen
polypeptide is presented by an MHC molecule and recognized by CTLs (e.g., as
described in
the Examples), one can make conservative amino acid substitutions to the amino
acid
sequence of the peptide, particularly at residues which are thought not to be
direct contact
points with the MHC molecule. For example, methods for identifying functional
variants of
HLA class II binding peptides are provided in a published PCT application of
Strominger and
Wucherpfennig (PCT/US96/03182). Peptides bearing one or more amino acid
substitutions
also can be tested for concordance with known HLA/MHC motifs prior to
synthesis using,
e.g, the computer program described by D'Amaro and Drijfhout (D'Amaro et al.,
Human
Immunol. 43:13-18, 1995; Drijfliout et al., Human Immunol. 43:1-12, 1995). The
substituted
peptides can then be tested for binding to the MHC molecule and recognition by
CTLs when
bound to MHC. These variants can be tested for improved stability and are
useful, inter alia,
in vaccine compositions.
Conservative amino-acid substitutions in the amino acid sequence of cancer
associated
antigen polypeptides to produce functionally equivalent variants of cancer
associated antigen
polypeptides typically are made by alteration of a nucleic acid encoding a
cancer associated
antigen polypeptide. Such substitutions can be made by a variety of methods
known to one of
ordinary skill in the art. For example, amino acid substitutions may be made
by PCR-directed
mutation, site-directed mutagenesis according to the method of Kunkel (Kunkel,
Proc. Nat.
Acad. Sci. U.S.A. 82: 488-492, 1985), or by chemical synthesis of a gene
encoding a cancer
associated antigen polypeptide. Where amino acid substitutions are made to a
small unique
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-31 -
fragment of a cancer associated antigen polypeptide, such as an antigenic
epitope recognized
by autologous or allogeneic sera or cytolytic T lymphocytes, the substitutions
can be made by
directly synthesizing the peptide. The activity of fianctionally equivalent
fragments of cancer
associated antigen polypeptides can be tested by cloning the gene encoding the
altered cancer
associated antigen polypeptide into a bacterial or mammalian expression
vector, introducing
the vector into an appropriate host cell, expressing the altered cancer
associated antigen
polypeptide, and testing for a functional capability of the cancer associated
antigen
polypeptides as disclosed herein. Peptides which are chemically synthesized
can be tested
directly for function, e.g., for binding to antisera recognizing associated
antigens.
The invention as described herein has a number of uses, some of which are
described
elsewhere herein. First, the invention permits isolation of the cancer
associated antigen
protein molecules. A variety of methodologies well-known to the skilled
practitioner can be
utilized to obtain isolated cancer associated antigen molecules. The
polypeptide may be
purified from cells which naturally produce the polypeptide by chromatographic
means or
immunological recognition. Alternatively, an expression vector may be
introduced into cells
to cause production of the polypeptide. In another method, mRNA transcripts
may be
microinjected or otherwise introduced into cells to cause production of the
encoded
polypeptide. Translation of mRNA in cell-free extracts such as the
reticulocyte Iysate system
also may be used to produce polypeptide. Those skilled in the art also can
readily follow
known methods for isolating cancer associated antigen polypeptides. These
include, but are
not limited to, immunochromatography, HPLC, size-exclusion chromatography, ion-
exchange
chromatography and immune-affinity chromatography.
The isolation and identification of cancer associated antigen genes also makes
it
possible for the artisan to diagnose a disorder characterized by expression of
cancer associated
antigens. These methods involve determining expression of one or more cancer
associated
antigen nucleic acids, and/or encoded cancer associated antigen polypeptides
and/or peptides
derived therefrom. In the former situation, such determinations can be carried
out via any
standard nucleic acid determination assay, including the polymerase chain
reaction, or
assaying with labeled hybridization probes. In the latter situation, such
determinations can be
carned out by screening patient antisera for recognition of the polypeptide.
The invention also makes it possible isolate proteins which bind to cancer
associated
antigens as disclosed herein, including antibodies and cellular binding
partners of the cancer
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-32-
associated antigens. Additional uses are described further herein.
The invention also provides, in certain embodiments, "dominant negative"
polypeptides derived from cancer associated antigen polypeptides. A dominant
negative
polypeptide is an inactive variant of a protein, which, by interacting with
the cellular
machinery, displaces an active protein from its interaction with the cellular
machinery or
competes with the active protein, thereby reducing the effect of the active
protein. For
example, a dominant negative receptor which binds a ligand but does not
transmit a signal in
response to binding of the ligand can reduce the biological effect of
expression of the ligand.
Likewise, a dominant negative cataIytically-inactive kinase which interacts
normally with
target proteins but does not phosphorylate the target proteins can reduce
phosphorylation of
the target proteins in response to a cellular signal. Similarly, a dominant
negative
transcription factor which binds to a promoter site in the control region of a
gene but does not
increase gene transcription can reduce the effect of a normal transcription
factor by occupying
promoter binding sites without increasing transcription.
The end result of the expression of a dominant negative polypeptide in a cell
is a
reduction in function of active proteins. One of ordinary skill in the art can
assess the
potential for a dominant negative variant of a protein, and using standard
mutagenesis
techniques to create one or more dominant negative variant polypeptides. For
example, given
the teachings contained herein of renal cancer associated antigens, especially
those which are
similar to known proteins which have known activities, one of ordinary skill
in the art can
modify the sequence of the cancer associated antigens by site-specific
mutagenesis, scanning
mutagenesis, partial gene deletion or truncation, and the like. See, e.g:,
U.S. Patent No.
5,580,723 and Sambrook et al., Molecular Cloning: A Laboratory Manual, Second
Edition,
Cold Spring Harbor Laboratory Press, 1989. The skilled artisan then can test
the population
of mutagenized polypeptides for diminution in a selected and/or for retention
of such an
activity. Other similar methods for creating and testing dominant negative
variants of a
protein will be apparent to one of ordinary skill in the art.
The invention also involves agents such as polypeptides which bind to cancer
associated antigen polypeptides. Such binding agents can be used, for example,
in screening
assays to detect the presence or absence of cancer associated antigen
polypeptides and
complexes of cancer associated antigen polypeptides and their binding partners
and in
purification protocols to isolated cancer associated antigen polypeptides and
complexes of
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
- 33 -
cancer associated antigen polypeptides and their binding partners. Such agents
also can be
used to inhibit the native activity of the cancer associated antigen
polypeptides, for example,
by binding to such palypeptides.
The invention, therefore, embraces peptide binding agents which, for example,
can be
antibodies ar fragments of antibodies having the ability to selectively bind
to cancer
associated antigen polypeptides. Antibodies include polyclonal and monoclonal
antibodies,
prepared according to conventional methodology.
Significantly, as is well-known in the art, only a small portion of an
antibody
molecule, the paratope, is involved in the binding of the antibody to its
epitope (see, in
general, Clark, W.R. (1986) The Experimental Foundations of Modern Immunolo~y
Wiley &
Sons, Inc., New York; Roitt, I. (1991) Essential Immunoloay, ~th Ed.,
Blackwell Scientific
Publications, Oxford). The pFc' and Fc regions, for example, are effectors of
the complement
cascade but are not involved in antigen binding. An antibody from which the
pFc' region has
been enzymatically cleaved, or which has been produced without the pFc'
region, designated
an F(ab')2 fragment, retains both of the antigen binding sites of an intact
antibody. Similarly,
an antibody from which the Fc region has been enzymatically cleaved, or which
has been
produced without the Fc region, designated an Fab fragment, retains one of the
antigen
binding sites of an intact antibody molecule. Proceeding further, Fab
fragments consist of a
covalently bound antibody light chain and a portion of the antibody heavy
chain denoted Fd.
The Fd fragments are the major determinant of antibody specificity (a single
Fd fragment may
be associated with up to ten different light chains without altering antibody
specificity) and Fd
fragments retain epitope-binding ability in isolation.
Within the antigen-binding portion of an antibody, as is well-known in the
art, there
are complementarity determining regions (CDRs), which directly interact with
the epitope of
the antigen, and framework regions (FRs), which maintain the tertiary
structure of the
paratope (see, in general, Clark, 1986; Roitt, 1991 ). In both the heavy chain
Fd fragment and
the light chain of IgG immunoglobulins, there are four framework regions (FR1
through FR4)
separated respectively by three complementarity determining regions (CDR1
through CDR3).
The CDRs, and in particular the CDR3 regions, and more particularly the heavy
chain CDR3,
are largely responsible for antibody specificity.
It is now well-established in the art that the non-CDR regions of a mammalian
antibody may be replaced with similar regions of conspecific or heterospecific
antibodies
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-34-
while retaining the epitopic specificity of the original antibody. This is
most clearly
manifested in the development and use of "humanized" antibodies in which non-
human CDRs
are covalently joined to human FR and/or Fc/pFc' regions to produce a
functional antibody.
See, e.g., U.S. patents 4,816,567, 5,225,539, 5,585,089, 5,693,762 and
5,859,205.
Thus, for example, PCT International Publication Number WO 92/04381 teaches
the
production and use of humanized marine RSV antibodies in which at least a
portion of the
marine FR regions have been replaced by FR regions of human origin. Such
antibodies,
including fragments of intact antibodies with antigen-binding ability, are
often referred to as
"chimeric" antibodies.
Thus, as will be apparent to one of ordinary skill in the art, the present
invention also
provides for F(ab')z, Fab, Fv and Fd fragments; chimeric antibodies in which
the Fc and/or FR
and/or CDRl and/or CDR2 and/or light chain CDR3 regions have been replaced by
homologous human or non-human sequences; chimeric F(ab')2 fragment antibodies
in which
the FR and/or CDR1 and/or CDR2 and/or light chain CDR3 regions have been
replaced by
homologous human or non-human sequences; chimeric Fab fragment antibodies in
which the
FR and/or CDRI and/or CDR2 and/or light chain CDR3 regions have been replaced
by
homologous human or non-human sequences; and chimeric Fd fragment antibodies
in which
the FR and/or CDRI and/or CDR2 regions have been replaced by homologous human
or non-
human sequences. The present invention also includes so-called single chain
antibodies.
Thus, the invention involves polypeptides of numerous size and type that bind
specifically to cancer associated antigen polypeptides, and complexes of both
cancer
associated antigen polypeptides and their binding partners. These polypeptides
may be
derived also from sources other than antibody technology. For example, such
polypeptide
binding agents can be provided by degenerate peptide libraries which can be
readily prepared
in solution, in immobilized form or as phage display libraries. Combinatorial
libraries also
can be synthesized of peptides containing one or more amino acids. Libraries
further can be
synthesized of peptoids and non-peptide synthetic moieties.
Phage display can be particularly effective in identifying binding peptides
useful
according to the invention. Briefly, one prepares a phage library (using e.g.
m13, fd, or
lambda phage), displaying inserts from 4 to about 80 amino acid residues using
conventional
procedures. The inserts may represent, for example, a completely degenerate or
biased array.
One then can select phage-bearing inserts which bind to the cancer associated
antigen
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-35-
polypeptide. This process can be repeated through several cycles of
reselection of phage that
bind to the cancer associated antigen polypeptide. Repeated rounds lead to
enrichment of
phage bearing particular sequences. DNA sequence analysis can be conducted to
identify the
sequences of the expressed polypeptides. The minimal linear portion of the
sequence that
binds to the cancer associated antigen polypeptide can be determined. One can
repeat the
procedure using a biased library containing inserts containing part or all of
the minimal linear
portion plus one or more additional degenerate residues upstream or downstream
thereof.
Yeast two-hybrid screening methods also may be used to identify polypeptides
that bind to the
cancer associated antigen polypeptides. Thus, the cancer associated antigen
polypeptides of
the invention, or a fragment thereof, can be used to screen peptide libraries,
including phage
display libraries, to identify and select peptide binding partners of the
cancer associated
antigen polypeptides of the invention. Such molecules can be used, as
described, for
screening assays, for purification protocols, for interfering directly with
the functioning of
cancer associated antigen and for other purposes that will be apparent to
those of ordinary
skill in the art.
As detailed herein, the foregoing antibodies and other binding molecules may
be used
for example to identify tissues expressing protein or to purify protein.
Antibodies also may be
coupled to specific diagnostic labeling agents for imaging of cells and
tissues that express
cancer associated antigens or to therapeutically useful agents according to
standard coupling
procedures. Diagnostic agents include, but are not limited to, barium sulfate,
iocetamic acid.
iopanoic acid, ipodate calcium, diatrizoate sodium, diatrizoate meglumine,
metrizamide,
tyropanoate sodium and radiodiagnostics including positron emitters such as
fluorine-I 8 and
carbon-1 l, gamma emitters such as iodine-123, technitium-99m, iodine-131 and
indium-111,
nuclides for nuclear magnetic resonance such as fluorine and gadolinium. Other
diagnostic
agents useful in the invention will be apparent to one of ordinary skill in
the art. As used
herein, "therapeutically useful agents" include any therapeutic molecule which
desirably is
targeted selectively to a cell expressing one of the cancer antigens disclosed
herein, including
antineoplastic agents, radioiodinated compounds, toxins, other cytostatic or
cytolytic drugs,
and so forth. Antineoplastic therapeutics are well known and include:
aminoglutethimide,
azathioprine, bleomycin sulfate, busulfan, carmustine, chlorambucil,
cisplatin,
cyclophosphamide, cyclosporine, cytarabidine, dacarbazine, dactinomycin,
daunorubicin,
doxorubicin, taxol, etoposide, fluorouracil, interferon-a, lomustine,
mercaptopurine,
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-36-
methotrexate, mitotane, procarbazine HCI, thioguanine, vinblastine sulfate and
vincristine
sulfate. Additional antineoplastic agents include those disclosed in Chapter
52,
Antineoplastic Agents (Paul Calabresi and Bruce A. Chabner), and the
introduction thereto,
1202-1263, of Goodman and Gilman's "The Pharmacological Basis of
Therapeutics", Eighth
Edition, 1990, McGraw-Hill, Inc. (Health Professions Division). Toxins can be
proteins such
as, for example, pokeweed anti-viral protein, cholera toxin, pertussis toxin,
ricin, gelonin,
abrin, diphtheria exotoxin, or Pseudomonas exotoxin. Toxin moieties can also
be high
energy-emitting radionuclides such as cobalt-60.
In the foregoing methods, antibodies prepared according to the invention also
preferably are specific for the renal cancer associated antigen/MHC complexes
described
herein.
When "disorder" is used herein, it refers to any pathological condition where
the
cancer associated antigens are expressed. An example of such a disorder is
cancer, breast,
colon, gastric, renal, prostate and lung cancers as particular examples.
Samples of tissue and/or cells for use in the various methods described herein
can be
obtained through standard methods such as tissue biopsy, including punch
biopsy and cell
scraping, and collection of blood or other bodily fluids by aspiration or
other methods.
In certain embodiments of the invention, an immunoreactive cell sample is
removed
from a subject. By "immunoreactive cell" is meant a cell which can mature into
an immune
cell (such as a B cell, a helper T cell, or a cytolytic T cell) upon
appropriate stimulation. Thus
immunoreactive cells include CD34+ hematopoietic stem cells, immature T cells
and
immature B cells. When it is desired to produce cytolytic T cells which
recognize a cancer
associated antigen, the immunoreactive cell is contacted with a cell which
expresses a cancer
associated antigen under conditions favoring production, differentiation
andlor selection of
cytolytic T cells; the differentiation of the T cell precursor into a
cytolytic T cell upon
exposure to antigen is similar to clonal selection of the immune system.
Some therapeutic approaches based upon the disclosure are premised on a
response by
a subject's immune system, leading to lysis of antigen presenting cells, such
as breast cancer
cells which present one or more cancer associated antigens. One such approach
is the
administration of autologous CTLs specific to a cancer associated antigen/MHC
complex to a
subject with abnormal cells of the phenotype at issue. It is within the
ability of one of
ordinary skill in the art to develop such CTLs in vitro. An example of a
method for T cell
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-37-
differentiation is presented in International Application number
PCT/US96/05607. Generally,
a sample of cells taken from a subject, such as blood cells, are contacted
with a cell presenting
the complex and capable of provoking CTLs to proliferate. The target cell can
be a
transfectant, such as a COS cell. These transfectants present the desired
complex of their
surface and, when combined with a CTL of interest, stimulate its
proliferation. COS cells are
widely available, as are other suitable host cells. Specific production of CTL
clones is well
known in the art. The clonally expanded autologous CTLs then are administered
to the
subject.
Another method for selecting antigen-specific CTL clones has recently been
described
(Altman et al., Science 274:94-96, 1996; Dunbar et al., Curr. Biol. 8:413-416,
1998), in which
fluorogenic tetramers of MHC class I molecule/peptide complexes are used to
detect specific
CTL clones. Briefly, soluble MHC class I molecules are folded in vitro in the
presence of (3,-
microglobulin and a peptide antigen which binds the class I molecule. After
purification, the
MHC/peptide complex is purified and labeled with biotin. Tetramers are formed
by mixing
the biotinylated peptide-MHC complex with labeled avidin (e.g. phycoerythrin)
at a molar
ratio or 4: I . Tetramers are then contacted with a source of CTLs such as
peripheral blood or
lymph node. The tetramers bind CTLs which recognize the peptide antigen/MHC
class I
complex. Cells bound by the tetramers can be sorted by fluorescence activated
cell sorting to
isolate the reactive CTLs. The isolated CTLs then can be expanded in vitro for
use as
described herein.
To detail a therapeutic methodology, referred to as adoptive transfer
(Greenberg, J.
Immunol. 136(5): 1917, 1986; Riddel et al., Science 257: 238, 1992; Lynch et
al, Eur. J.
Immunol. 21: 1403-1410,1991; Kast et al., Cell 59: 603-614, 1989), cells
presenting the
desired complex (e.g., dendritic cells) are combined with CTLs leading to
proliferation of the
CTLs specific thereto. The proliferated CTLs are then administered to a
subject with a
cellular abnormality which is characterized by certain of the abnormal cells
presenting the
particular complex. The CTLs then lyse the abnormal cells, thereby achieving
the desired
therapeutic goal.
The foregoing therapy assumes that at least some of the subject's abnormal
cells
present the relevant HLA/cancer associated antigen complex. This can be
determined very
easily, as the art is very familiar with methods for identifying cells which
present a particular
HLA molecule, as well as how to identify cells expressing DNA of the pertinent
sequences, in
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-38-
this case a cancer associated antigen sequence. Once cells presenting the
relevant complex are
identified via the foregoing screening methodology, they can be combined with
a sample from
a patient, where the sample contains CTLs. If the complex presenting cells are
lysed by the
mixed CTL sample, then it can be assumed that a cancer associated antigen is
being presented,
and the subject is an appropriate candidate for the therapeutic approaches set
forth supra.
Adoptive transfer is not the only form of therapy that is available in
accordance with
the invention. CTLs can also be provoked in vivo, using a number of
approaches. One
approach is the use of non-proliferative cells expressing the complex. The
cells used in this
approach may be those that normally express the complex, such as irradiated
tumor cells or
cells transfected with one or both of the genes necessary for presentation of
the complex (i.e.
the antigenic peptide and the presenting HLA molecule). Chen et al. (Proc.
Natl. Acad. Sci.
USA 88: 110-114,1991) exemplifies this approach, showing the use of
transfected cells
expressing HPVE7 peptides in a therapeutic regime. Various cell types may be
used.
Similarly, vectors carrying one or both of the genes of interest may be used.
Viral or bacterial
vectors are especially preferred. For example, nucleic acids which encode a
cancer associated
antigen polypeptide or peptide may be operably linked to promoter and enhancer
sequences
which direct expression of the cancer associated antigen polypeptide or
peptide in certain
tissues or cell types. The nucleic acid may be incorporated into an expression
vector.
Expression vectors may be unmodified extrachromosornal nucleic acids, plasmids
or viral
genomes constructed or modified to enable insertion of exogenous nucleic
acids, such as those
encoding cancer associated antigen, as described elsewhere herein. Nucleic
acids encoding a
cancer associated antigen also may be inserted into a retroviral genome,
thereby facilitating
integration of the nucleic acid into the genome of the target tissue or cell
type. In these
systems, the gene of interest is carried by a microorganism, e.g., a Vaccinia
virus, pox virus,
herpes simplex virus, retrovirus or adenovirus, and the materials de facto
"infect" host cells.
The cells which result present the complex of interest, and are recognized by
autologous
CTLs, which then proliferate.
A similar effect can be achieved by combining the cancer associated antigen or
a
stimulatory fragment thereof with an adjuvant to facilitate incorporation into
antigen
presenting cells in vivo. The cancer associated antigen polypeptide is
processed to yield the
peptide partner of the HLA molecule while a cancer associated antigen peptide
may be
presented without the need for further processing. Generally, subjects can
receive an
CA 02344995 2001-04-04
WO 00120587 PCT/US99/22873
-39-
intradermal injection of an effective amount of the cancer associated antigen.
Initial doses can
be followed by booster doses, following immunization protocols standard in the
art. Preferred
cancer associated antigens include those found to react with allogeneic cancer
antisera, shown
in the examples below.
The invention involves the use of various materials disclosed herein to
"immunize"
subjects or as "vaccines". As used herein, "immunization" or "vaccination"
means increasing
or activating an immune response against an antigen. It does not require
elimination or
eradication of a condition but rather contemplates the clinically favorable
enhancement of an
immune response toward an antigen. Generally accepted animal models can be
used for
testing of immunization against cancer using a cancer associated antigen
nucleic acid. For
example, human cancer cells can be introduced into a mouse to create a tumor,
and one or
more cancer associated antigen nucleic acids can be delivered by the methods
described
herein. The effect on the cancer cells (e.g., reduction of tumor size) can be
assessed as a
measure of the effectiveness of the cancer associated antigen nucleic acid
immunization. Of
course, testing of the foregoing animal model using more conventional methods
for
immunization include the administration of one or more cancer associated
antigen
polypeptides or peptides derived therefrom, optionally combined with one or
more adjuvants
and/or cytokines to boost the immune response. Methods for immunization,
including
formulation of a vaccine composition and selection of doses, route of
administration and the
schedule of administration (e.g. primary and one or more booster doses), are
well known in
the art. The tests also can be performed in humans, where the end point is to
test for the
presence of enhanced levels of circulating CTLs against cells bearing the
antigen, to test for
levels of circulating antibodies against the antigen, to test for the presence
of cells expressing
the antigen and so forth.
As part of the immunization compositions, one or more cancer associated
antigens or
stimulatory fragments thereof are administered with one or more adjuvants to
induce an
immune response or to increase an immune response. An adjuvant is a substance
incorporated
into or administered with antigen which potentiates the immune response.
Adjuvants may
enhance the immunological response by providing a reservoir of antigen
(extracellularly or
within macrophages), activating macrophages and stimulating specific sets of
lymphocytes.
Adjuvants of many kinds are well known in the art. Specific examples of
adjuvants include
monophosphoryl lipid A (MPL, SmithKline Beecham), a congener obtained after
purification
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-40-
and acid hydrolysis of Salmonella minnesota Re 595 lipopolysaccharide;
saponins including
QS21 (SmithKline Beecham), a pure QA-21 saponin purified from Quillja
saponaria extract;
DQS21, described in PCT application W096/33739 (SmithKline Beecham); QS-7, QS-
17,
QS-18, and QS-L1 (So et al., Mol. Cells 7:178-186, 1997); incomplete Freund's
adjuvant;
complete Freund's adjuvant; montanide; and various water-in-oil emulsions
prepared from
biodegradable oils such as squalene and/or tocopherol. Preferably, the
peptides are
administered mixed with a combination of DQS21 /MPL. The ratio of DQS21 to MPL
typically will be about 1:10 to 10:1, preferably about 1:5 to 5:1 and more
preferably about I :1.
Typically for human administration, DQS21 and MPL will be present in a vaccine
formulation in the range of about 1 p,g to about 100 p.g. Other adjuvants are
known in the art
and can be used in the invention {see, e.g. Goding, Monoclonal Antibodies:
Principles and
Practice, 2nd Ed., 1986). Methods for the preparation of mixtures or emulsions
of peptide
and adjuvant are well known to those of skill in the art of vaccination.
Other agents which stimulate the immune response of the subject can also be
administered to the subject. For example, other cytokines are also useful in
vaccination
protocols as a result of their lymphocyte regulatory properties. Many other
cytokines useful
for such purposes will be known to one of ordinary skill in the art, including
interleukin-12
(IL-12) which has been shown to enhance the protective effects of vaccines
(see, e.g., Science
268: 1432-1434, 1995), GM-CSF and IL-18. Thus cytokines can be administered in
conjunction with antigens and adjuvants to increase the immune response to the
antigens.
There are a number of immune response potentiating compounds that can be used
in
vaccination protocols. These include costimulatory molecules provided in
either protein or
nucleic acid form. Such costimulatory molecules include the B7-l and B7-2
(CD80 and CD86
respectively) molecules which are expressed on dendritic cells (DC) and
interact with the
CD28 molecule expressed on the T cell. This interaction provides costimulation
(signal 2) to
an antigen/MHC/TCR stimulated (signal 1 ) T cell, increasing T cell
proliferation and effector
function. B7 also interacts with CTLA4 (CD 152) on T cells and studies
involving CTLA4
and B7 ligands indicate that the B7-CTLA4 interaction can enhance antitumor
immunity and
CTL proliferation (Zheng P., et al. Proc. Natl. Acad. Sci. USA 95 ( 11 ):6284-
6289 ( 1998)).
B7 typically is not expressed on tumor cells so they are not efficient antigen
presenting
cells (APCs) for T cells. Induction of B7 expression would enable the tumor
cells to stimulate
more efficiently CTL proliferation and effector function. A combination of
B7/IL-6/IL-12
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-41 -
costimulation has been shown to induce IFN-gamma and a Thl cytokine profile in
the T cell
population leading to further enhanced T cell activity (Gajewski et al., J.
Immunol, 154:5637-
5648 (1995)). Tumor cell transfection with B7 has ben discussed in relation to
in vitro CTL
expansion for adoptive transfer immunotherapy by Wang et al., (J. Immunol. ,
19:1-8 ( 1986)).
Other delivery mechanisms for the B7 molecule would include nucleic acid
(naked DNA)
immunization (Kim J., et al. Nat Biotechnol., 15:7:641-646 (1997)) and
recombinant viruses
such as adeno and pox (Wendtner et al., Gene Ther., 4:7:726-735 (1997)). These
systems are
all amenable to the construction and use of expression cassettes for the
coexpression of B7
with other molecules of choice such as the antigens or fragments) of antigens
discussed
herein (including polytopes) or cytokines. These delivery systems can be used
for induction
of the appropriate molecules in vitro and for in vivo vaccination situations.
The use of anti-
CD28 antibodies to directly stimulate T cells in vitro and in vivo could also
be considered.
Similarly, the inducible co-stimulatory molecule ICOS which induces T cell
responses to
foreign antigen could be modulated, for example, by use of anti-ICOS
antibodies (Hutloff et
al., Nature 397:263-266, 1999).
Lymphocyte function associated antigen-3 (LFA-3) is expressed on APCs and some
tumor cells and interacts with CD2 expressed on T cells. This interaction
induces T cell IL-2
and IFN-gamma production and can thus complement but not substitute, the
B7/CD28
costimulatory interaction (Parra et al., J. Immunol., 158:637-642 (1997),
Fenton et al., J.
Immunother., 21:2:95-108 (1998)).
Lymphocyte function associated antigen-1 (LFA-1 ) is expressed on leukocytes
and
interacts with ICAM-1 expressed on APCs and some tumor cells. This interaction
induces T
cell IL-2 and IFN-gamma production and can thus complement but not substitute,
the
B7/CD28 costimulatory interaction (Fenton et al., J. Immunother., 21:2:95-108
(1998)).
LFA-1 is thus a further example of a costimulatory molecule that could be
provided in a
vaccination protocol in the various ways discussed above for B7.
Complete CTL activation and effector function requires Th cell help through
the
interaction between the Th cell CD40L (CD40 ligand) molecule and the CD40
molecule
expressed by DCs (Ridge et al., Nature, 393:474 (1998), Bennett et al.,
Nature, 393:478
(1998), Schoenberger et al., Nature, 393:480 (1998)). This mechanism of this
costimulatory
signal is likely to involve upregulation of B7 and associated IL-6/IL-12
production by the DC
(APC). The CD40-CD40L interaction thus complements the signal 1 (antigen/MHC-
TCR)
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-42-
and signal 2 (B7-CD28) interactions.
The use of anti-CD40 antibodies to stimulate DC cells directly, would be
expected to
enhance a response to tumor antigens which are normally encountered outside of
a
inflammatory context or are presented by non-professional APCs (tumor cells).
In these
situations Th help and B7 costimulation signals are not provided. This
mechanism might be
used in the context of antigen pulsed DC based therapies or in situations
where Th epitopes
have not been defined within known TRA precursors.
A cancer associated antigen polypeptide, or a fragment thereof, also can be
used to
isolate their native binding partners. Isolation of such binding partners may
be performed
according to well-known methods. For example, isolated cancer associated
antigen
polypeptides can be attached to a substrate (e.g., chromatographic media, such
as polystyrene
beads, or a filter), and then a solution suspected of containing the binding
partner may be
applied to the substrate. If a binding partner which can interact with cancer
associated antigen
polypeptides is present in the solution, then it will bind to the substrate-
bound cancer
associated antigen polypeptide. The binding partner then may be isolated.
It will also be recognized that the invention embraces the use of the cancer
associated
antigen cDNA sequences in expression vectors, as well as to transfect host
cells and cell lines,
be these prokaryotic (e.g., E coli), or eukaryotic (e.g., dendritic cells, B
cells, CHO cells,
COS cells, yeast expression systems and recombinant baculovirus expression in
insect cells).
Especially useful are mammalian cells such as human, mouse, hamster, pig,
goat, primate, etc.
They may be of a wide variety of tissue types, and include primary cells and
cell lines.
Specific examples include keratinocytes, peripheral blood leukocytes, bone
marrow stem cells
and embryonic stem cells. The expression vectors require that the pertinent
sequence, i.e.,
those nucleic acids described supra, be operably linked to a promoter.
The invention also contemplates delivery of nucleic acids, polypeptides or
peptides for
vaccination. Delivery of polypeptides and peptides can be accomplished
according to
standard vaccination protocols which are well known in the art. In another
embodiment, the
delivery of nucleic acid is accomplished by ex vivo methods, i.e. by removing
a cell from a
subject, genetically engineering the cell to include a breast cancer
associated antigen, and
reintroducing the engineered cell into the subject. One example of such a
procedure is
outlined in U.S. Patent 5,399,346 and in exhibits submitted in the file
history of that patent, all
of which are publicly available documents. In general, it involves
introduction in vitro of a
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
- 43 -
functional copy of a gene into a cells) of a subject, and returning the
genetically engineered
cells) to the subject. The functional copy of the gene is under operable
control of regulatory
elements which permit expression of the gene in the genetically engineered
cell(s). Numerous
transfection and transduction techniques as well as appropriate expression
vectors are well
known to those of ordinary skill in the art, some of which are described in
PCT application
W095/00654. In vivo nucleic acid delivery using vectors such as viruses and
targeted
liposomes also is contemplated according to the invention.
In preferred embodiments, a virus vector for delivering a nucleic acid
encoding a
cancer associated antigen is selected from the group consisting of
adenoviruses, adeno-
associated viruses, poxviruses including vaccinia viruses and attenuated
poxviruses, Semliki
Forest virus, Venezuelan equine encephalitis virus, retroviruses, Sindbis
virus, and Ty virus-
like particle. Examples of viruses and virus-like particles which have been
used to deliver
exogenous nucleic acids include: replication-defective adenoviruses (e.g.,
Xiang et al.,
Virology 219:220-227, 1996; Eloit et al., J. Virol. 7:5375-5381, 1997;
Chengalvala et al.,
Vaccine 15:335-339, 1997), a modified retrovirus (Townsend et al., J. Virol.
71:3365-3374,
1997), a nonreplicating retrovirus (Irwin et al., J virol. 68:5036-5044,
1994), a replication
defective Semliki Forest virus (Zhao et al., Proc. Natl. Acad Sci. USA 92:3009-
3013, 1995),
canarypox virus and highly attenuated vaccinia virus derivative (Paoletti,
Proc. Natl. Acad.
Sci. USA 93:11349-I 1353, 1996), non-replicative vaccinia virus (Moss, Proc.
Natl. Acad Sci.
USA 93:11341-11348, 1996), replicative vaccinia virus (Moss, Dev. Binl. Stand.
82:55-63.
1994), Venzuelan equine encephalitis virus (Davis et al., J. Virol. 70:3781-
3787, 1996),
Sindbis virus (Pugachev et al., Virology 212:587-594, 1995), and Ty virus-like
particle
(Allsopp et al., Eur. J. Immunol 26:1951-1959, 1996). In preferred
embodiments, the virus
vector is an adenovirus.
Another preferred virus for certain applications is the adeno-associated
virus, a double-
stranded DNA virus. The adeno-associated virus is capable of infecting a wide
range of cell
types and species and can be engineered to be replication-deficient. It
further has advantages,
such as heat and lipid solvent stability, high transduction frequencies in
cells of diverse
lineages, including hematopoietic cells, and lack of superinfection inhibition
thus allowing
multiple series of transductions. The adeno-associated virus can integrate
into human cellular
DNA in a site-specific manner, thereby minimizing the possibility of
insertional mutagenesis
and variability of inserted gene expression. In addition, wild-type adeno-
associated virus
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-44-
infections have been followed in tissue culture for greater than 100 passages
in the absence of
selective pressure, implying that the adeno-associated virus genomic
integration is a relatively
stable event. The adeno-associated virus can also function in an
extrachromosomal fashion.
In general, other preferred viral vectors are based on non-cytopathic
eukaryotic viruses
in which non-essential genes have been replaced with the gene of interest. Non-
cytopathic
viruses include retroviruses, the life cycle of which involves reverse
transcription of genomic
viral RNA into DNA with subsequent proviral integration into host cellular
DNA.
Adenoviruses and retroviruses have been approved for human gene therapy
trials. In general,
the retroviruses axe replication-deficient (i.e., capable of directing
synthesis of the desired
proteins, but incapable of manufacturing an infectious particle). Such
genetically altered
retrovirai expression vectors have general utility for the high-efficiency
transduction of genes
in vivo. Standard protocols for producing replication-deficient retroviruses
(including the
steps of incorporation of exogenous genetic material into a plasmid,
transfection of a
packaging cell lined with plasmid, production of recombinant retroviruses by
the packaging
cell line, collection of viral particles from tissue culture media, and
infection of the target cells
with viral particles) are provided in Kriegler, M., "Gene Transfer and
Expression, A
Laboratory Manual," W.H. Freeman Co., New York (1990) and Murry, E.J. Ed.
"Methods in
Molecular Biology," vol. 7, Humana Press, Inc., Cliffton, New Jersey ( 1991 ).
Preferably the foregoing nucleic acid delivery vectors: ( 1 ) contain
exogenous genetic
material that can be transcribed and translated in a mammalian cell and that
can induce an
immune response in a host, and (2) contain on a surface a ligand that
selectively binds to a
receptor on the surface of a target cell, such as a mammalian cell, and
thereby gains entry to
the target cell.
Various techniques may be employed for introducing nucleic acids of the
invention
into cells, depending on whether the nucleic acids are introduced in vitro or
in vivo in a host.
Such techniques include transfection of nucleic acid-CaP04 precipitates,
transfection of
nucleic acids associated with DEAF, transfection or infection with the
foregoing viruses
including the nucleic acid of interest, liposome mediated transfection, and
the like. For
certain uses, it is preferred to target the nucleic acid to particular cells.
In such instances, a
vehicle used for delivering a nucleic acid of the invention into a cell (e.g.,
a retrovirus, or
other virus; a liposome) can have a targeting molecule attached thereto. For
example, a
molecule such as an antibody specific for a surface membrane protein on the
target cell or a
CA 02344995 2001-04-04
WO 00/20587 PCT/US99122873
- 45 -
ligand for a receptor on the target cell can be bound to or incorporated
within the nucleic acid
delivery vehicle. Preferred antibodies include antibodies which selectively
bind a cancer
associated antigen, alone or as a complex with a MHC molecule. Especially
preferred are
monoclonal antibodies. Where liposomes are employed to deliver the nucleic
acids of the
invention, proteins which bind to a surface membrane protein associated with
endocytosis
may be incorporated into the liposome formulation for targeting and/or to
facilitate uptake.
Such proteins include capsid proteins or fragments thereof tropic for a
particular cell type,
antibodies for proteins which undergo internalization in cycling, proteins
that target
intracellular localization and enhance intracellular half life, and the like.
Polymeric delivery
systems also have been used successfully to deliver nucleic acids into cells,
as is known by
those skilled in the art. Such systems even permit oral delivery of nucleic
acids.
When administered, the therapeutic compositions of the present invention can
be
administered in pharmaceutically acceptable preparations. Such preparations
may routinely
contain pharmaceutically acceptable concentrations of salt, buffering agents,
preservatives,
compatible carriers, supplementary immune potentiating agents such as
adjuvants and
cytokines and optionally other therapeutic agents.
The therapeutics of the invention can be administered by any conventional
route,
including injection or by gradual infusion over time. The administration may,
for example, be
oral, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous,
or transdermal.
When antibodies are used therapeutically, a preferred route of administration
is by pulmonary
aerosol. Techniques for preparing aerosol delivery systems containing
antibodies are well
known to those of skill in the art. Generally, such systems should utilize
components which
will not significantly impair the biological properties of the antibodies,
such as the paratope
binding capacity (see, for example, Sciarra and Cutie, "Aerosols," in Remin
ton's
Pharmaceutical Sciences, 18th edition, 1990, pp 1694-1712; incorporated by
reference).
Those of skill in the art can readily determine the various parameters and
conditions for
producing antibody aerosols without resort to undue experimentation. When
using antisense
preparations of the invention, slow intravenous administration is preferred.
The compositions of the invention are administered in effective amounts. An
"effective amount" is that amount of a cancer associated antigen composition
that alone, or
together with further doses, produces the desired response, e.g. increases an
immune response
to the cancer associated antigen. In the case of treating a particular disease
or condition
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-46-
characterized by expression of one or more cancer associated antigens, such as
renal cancer,
the desired response is inhibiting the progression of the disease. This may
involve only
slowing the progression of the disease temporarily, although more preferably,
it involves
halting the progression of the disease permanently. This can be monitored by
routine methods
or can be monitored according to diagnostic methods of the invention discussed
herein. The
desired response to treatment of the disease or condition also can be delaying
the onset or
even preventing the onset of the disease or condition.
Such amounts will depend, of course, on the particular condition being
treated, the
severity of the condition, the individual patient parameters including age,
physical condition,
size and weight, the duration of the treatment, the nature of concurrent
therapy (if any), the
specific route of administration and like factors within the knowledge and
expertise of the
health practioner. These factors are well known to those of ordinary skill in
the art and can be
addressed with no more than routine experimentation. It is generally preferred
that a
maximum dose of the individual components or combinations thereof be used,
that is, the
highest safe dose according to sound medical judgment. It will be understood
by those of
ordinary skill in the art, however, that a patient may insist upon a lower
dose or tolerable dose
for medical reasons, psychological reasons or for virtually any other reasons.
The pharmaceutical compositions used in the foregoing methods preferably are
sterile
and contain an effective amount of cancer associated antigen or nucleic acid
encoding cancer
associated antigen for producing the desired response in a unit of weight or
volume suitable
for administration to a patient. The response can, for example, be measured by
determining
the immune response following administration of the cancer associated antigen
composition
via a reporter system by measuring downstream effects such as gene expression,
or by
measuring the physiological effects of the cancer associated antigen
composition, such as
regression of a tumor or decrease of disease symptoms. Other assays will be
known to one of
ordinary skill in the art and can be employed for measuring the level of the
response.
The doses of cancer associated antigen compositions (e.g., polypeptide,
peptide,
antibody, cell or nucleic acid) administered to a subject can be chosen in
accordance with
different parameters, in particular in accordance with the mode of
administration used and the
state of the subject. Other factors include the desired period of treatment.
In the event that a
response in a subject is insufficient at the initial doses applied, higher
doses (or effectively
higher doses by a different, more localized delivery route) may be employed to
the extent that
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-47-
patient tolerance permits.
In general, for treatments for eliciting or increasing an immune response,
doses of
cancer associated antigen are formulated and administered in doses between 1
ng and 1 mg,
and preferably between 10 ng and 100 p.g, according to any standard procedure
in the art.
Where nucleic acids encoding cancer associated antigen of variants thereof are
employed,
doses of between 1 ng and 0.1 mg generally will be formulated and administered
according to
standard procedures. Other protocols for the administration of cancer
associated antigen
compositions will be known to one of ordinary skill in the art, in which the
dose amount,
schedule of injections, sites of injections, mode of administration (e.g.,
intra-tumoral) and the
like vary from the foregoing. Administration of cancer associated antigen
compositions to
mammals other than humans, e.g. for testing purposes or veterinary therapeutic
purposes, is
carried out under substantially the same conditions as described above.
Where cancer associated antigen peptides are used for vaccination, modes of
administration which effectively deliver the cancer associated antigen and
adjuvant, such that
an immune response to the antigen is increased, can be used. For
administration of a cancer
associated antigen peptide in adjuvant, preferred methods include intradermal,
intravenous,
intramuscular and subcutaneous administration. Although these are preferred
embodiments,
the invention is not limited by the particular modes of administration
disclosed herein.
Standard references in the art (e.g., Remington's Pharmaceutical Sciences,
18th edition, 1990)
provide modes of administration and formulations for delivery of immunogens
with adjuvant
or in a non-adjuvant carrier.
When administered, the pharmaceutical preparations of the invention are
applied in
pharmaceutically-acceptable amounts and in pharmaceutically-acceptable
compositions. The
term "pharmaceutically acceptable" means a non-toxic material that does not
interfere with the
effectiveness of the biological activity of the active ingredients. Such
preparations may
routinely contain salts, buffering agents, preservatives, compatible carriers,
and optionally
other therapeutic agents. When used in medicine, the salts should be
pharmaceutically
acceptable, but non-pharmaceutically acceptable salts may conveniently be used
to prepare
pharmaceutically-acceptable salts thereof and are not excluded from the scope
of the
invention. Such pharmacologically and pharmaceutically-acceptable salts
include, but are not
limited to, those prepared from the following acids: hydrochloric,
hydrobromic, sulfuric,
nitric, phosphoric, malefic, acetic, salicylic, citric, formic, malonic,
succinic, and the like.
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-48-
Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or
alkaline earth
salts, such as sodium, potassium or calcium salts.
A renal cancer associated antigen composition may be combined, if desired,
with a
pharmaceutically-acceptable carrier. The term "pharmaceutically-acceptable
carrier" as used
herein means one or more compatible solid or liquid fillers, diluents or
encapsulating
substances which are suitable for administration into a human. The term
"carrier" denotes an
organic or inorganic ingredient, natural or synthetic, with which the active
ingredient is
combined to facilitate the application. The components of the pharmaceutical
compositions
also are capable of being co-mingled with the molecules of the present
invention, and with
each other, in a manner such that there is no interaction which would
substantially impair the
desired pharmaceutical efficacy.
The pharmaceutical compositions may contain suitable buffering agents,
including:
acetic acid in a salt; citric acid in a salt; boric acid in a salt; and
phosphoric acid in a salt.
The pharmaceutical compositions also may contain, optionally, suitable
preservatives,
such as: benzalkonium chloride; chlorobutanol; parabens and thimerosal.
The pharmaceutical compositions may canveniently be presented in unit dosage
form
and may be prepared by any of the methods well-known in the art of pharmacy.
All methods
include the step of bringing the active agent into association with a carrier
which constitutes
one or more accessory ingredients. In general, the compositions are prepared
by uniformly
and intimately bringing the active compound into association with a liquid
carrier, a finely
divided solid carrier, or both, and then, if necessary, shaping the product.
Compositions suitable for oral administration may be presented as discrete
units, such
as capsules, tablets, lozenges, each containing a predetermined amount of the
active
compound. Other compositions include suspensions in aqueous liquids or non-
aqueous
liquids such as a syrup, elixir or an emulsion.
Compositions suitable for parenteral administration conveniently comprise a
sterile
aqueous or non-aqueous preparation of breast cancer associated antigen
polypeptides or
nucleic acids, which is preferably isotonic with the blood of the recipient.
This preparation
may be formulated according to known methods using suitable dispersing or
wetting agents
and suspending agents. The sterile injectable preparation also may be a
sterile injectable
solution or suspension in a non-toxic parenterally-acceptable diluent or
solvent, for example,
as a solution in 1,3-butane diol. Among the acceptable vehicles and solvents
that may be
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-49-
employed are water, Ringer's solution, and isotonic sodium chloride solution.
In addition,
sterile, fixed oils are conventionally employed as a solvent or suspending
medium. For this
purpose any bland fixed oil may be employed including synthetic mono-or di-
glycerides. In
addition, fatty acids such as oleic acid may be used in the preparation of
injectables. Carrier
formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc.
administrations
can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co.,
Easton, PA.
As used herein with respect to nucleic acids, the term "isolated" means: (i)
amplified
in vitro by, for example, polymerase chain reaction (PCR); (ii) recombinantly
produced by
cloning; (iii) purified, as by cleavage and gel separation; or (iv)
synthesized by, for example,
chemical synthesis. An isolated nucleic acid is one which is readily
manipulable by
recombinant DNA techniques well known in the art. Thus, a nucleotide sequence
contained in
a vector in which 5' and 3' restriction sites are known or for which
polymerase chain reaction
(PCR) primer sequences have been disclosed is considered isolated but a
nucleic acid
sequence existing in its native state in its natural host is not. An isolated
nucleic acid may be
substantially purified, but need not be. For example, a nucleic acid that is
isolated within a
cloning or expression vector is not pure in that it may comprise only a tiny
percentage of the
material in the cell in which it resides. Such a nucleic acid is isolated,
however, as the term is
used herein because it is readily manipulable by standard techniques known to
those of
ordinary skill in the art. An isolated nucleic acid as used herein is not a
naturally occurring
chromosome.
As used herein with respect to polypeptides, "isolated'' means separated from
its native
environment and present in sufficient quantity to permit its identification or
use. Isolated,
when referring to a protein or polypeptide, means, for example: (i)
selectively produced by
expression cloning or (ii) purified as by chromatography or electrophoresis.
Isolated proteins
or polypeptides may, but need not be, substantially pure. The term
"substantially pure" means
that the proteins or polypeptides are essentially free of other substances
with which they may
be found in nature or in vivo systems to an extent practical and appropriate
for their intended
use. Substantially pure polypeptides may be produced by techniques well known
in the art.
Because an isolated protein may be admixed with a pharmaceutically acceptable
carrier in a
pharmaceutical preparation, the protein may comprise only a small percentage
by weight of
the preparation. The protein is nonetheless isolated in that it has been
separated from the
substances with which it may be associated in living systems, i.e. isolated
from other proteins.
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-50-
Examples
Example 1: SEREX screenins of renal cancer cell line 1973/10 4
A standard cDNA library was prepared using S p.g of poly A+ RNA derived from
the
cell line 1973/10.4. A primary (unamplified) cDNA library was immunoscreened
(5 x 105
clones per library) by standard SEREX methodology, with absorbed autologous
patient serum
at 1:200 dilution [Sahin, U. et al., Proc Natl Acad Sci USA 92:11810-3 (1995);
Chen, Y.T. et
al. Proc Natl Acad Sci USA. 94:1914-8 (1997)].. Excluding false-positive
clones encoding
immunoglobulin gene fragments, clones were purified and sequence analyzed.
Comparisons
of the sequences showed that these clones represented cDNAs from 22 distinct
genes,
designated NY-REN-45 through NY-LU-66 (Table A and Sequence Listing (SEQ ID
NOs: l -
21)). A homology search through the GenBank/EMBO databases revealed that 14 of
the 22
genes corresponded to previously known molecules, and 8 others were unknown
genes, with
sequence identity limited only to short segments of known genes or to
expressed sequence
tags (ESTs).
Analysis of isolated clones:
I. NY-REN clones which are known gene products
Designation Gene/Sequence IdentityAccession SEQ ID
Number NO
NY-REN-46 lactate dehydrogenaseY00711 22
B
NY-REN-47 EItK tyrosine kinaseD31661 23
NY-REN-48 PINCH protein 009284 24
NY-REN-51 BBP/53BP2 058334 25
NY-REN-52 steroid receptor 059302 26
coactivator
NY-REN-53 KIAA0336 mltNA tag AB002334 27
NY-REN-54 E6 oncogenic protein-X98033 28
associated protein
NY-REN-55 murine NEK1 protein545828 29
kinase
homologue
CA 02344995 2001-04-04
WO 00/20587 PCT/I1S99/22873
- SI -
NY-REN-56 6-phospho-fructokinaseD49817 30
NY-REN-59 lactate dehydrogenaseX02152 31
A
NY-REN-61 KIAA0081 mRNA tag D42039 32
NY-REN-63 DDB p127-associatedAF035950 33
protein
NY-REN-65 HREV 107 protein X92814 34
NY-REN-66 acidic ribosomal M 17887 35
phosphoprotein 2
II. Novel gene products
Clone SEO ID Size Tissue mRNA expressionProtein SEO ID
NO: NO
:
NY-REN-451 4.0kbUbiquitous 12
NY-REN-492 1. Ubiquitous 13
I
kb
NY-REN-503 l.8kbUbiquitous 14
NY-REN-574,5 2.9kbUbiquitous 15, 16
NY-REN-586 l.9kbUbiquitous 17
NY-REN-607 4.OkbUbiquitous I g
NY-REN-628,9 2.7kbUbiquitous 19, 20
NY-REN-6410,11 3.OkbUbiquitous 21
III. Clones which react with autologous sera only:
NY-REN-47
NY-REN-49
NY-REN-SO
IV. Clones which react with sera from normal control donors
Frequency of sera reactivity
Clone normal cancer patient
NY-REN-46 4/4 6/ 14
NY-REN-48 14/14 17/17
NY-REN-51 1 /12 3/17
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-52-
NY-REN-52 4/12 7/17
NY-REN-53 4/19 10/31
NY-REN-54 5/8 7/7
NY-REN-55 3/19 6/31
NY-REN-56 3/19 7/31
NY-REN-57 1 / I 9 3/31
NY-REN-58 1 /12 2/17
NY-REN-59 1 / 19 4/3 I
NY-REN-61 3/ 19 5/31
NY-REN-62 1 / 19 4/31
NY-REN-63 2/19 12/31
NY-REN-64 3/19 6/31
NY-REN-65 2/19 2/31
V. Clones which react with sera from cancer patients only (failed to react
with 19 normal
patient serum samples). These clones are preferred for therapeutic and
diagnostic
applications.
Frequency of reactivi~
NY-REN-32 3/31
NY-REN-45 3/31
NY-REN-57 2/31
NY-REN-60 5/31
NY-REN-66 2/31
VI. Additional allogeneic screening of NY-REN renal SEREX clones
Renal SEREX clones were tested for reactivity with sera from the normal and
various
cancer patients listed below.
Sera
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-53-
Clone normal colon renal lung breast
NY-REN-3 0/26 7/37 8/32 0/23 1/26
NY-REN-12 0/19 0/16 3/32 0/15 0/16
NY-REN-19 0/19 0/16 2/32 0/15 0/16
NY-REN-21 0/16 3/16 3/32 1/15 0/16
NY-REN-25 0/15 0/16 5/32 0/15 0/16
NY-REN-31 0/14 0/16 5/32 0/15 0/16
NY-REN-32 0/14 2/16 3/32 0/15 0/16
NY-REN-37 O/15 0/16 2/32 0/15 0/16
NY-REN-45 0/14 0/16 3/32 1/15 0/16
NY-REN-57 0/19 0/16 2/32 0/15 0/16
NY-REN-60 0/ 19 0/ 16 7/32 0/ 15 0/ 16
NY-REN-66 0/ 19 0/ 16 2/3 2 0/ 15 0/ 16
Example 2: SEREX screening of tumor cells and testis libraries
Standard cDNA libraries were prepared using poly A+ RNA derived from the
various
cancer sources, as well as testis. The cDNA libraries were immunoscreened by
standard
SEREX methodology, with absorbed autologous patient serum [Sahin, U. et al.,
Proc Natl
Acad Sci USA 92:11810-3 (1995); Chen, Y.T. et al. Proc Natl Acad Sci USA.
94:1914-8
(1997)]. Excluding false-positive clones encoding immunoglobulin gene
fragments, clones
were purified and sequence analyzed. Comparisons of the sequences showed that
these clones
all were substantially identical to the kinectin cDNA (GenBank Accession
number L25616).
Table A: Kinectin clones isolated by SEREX
Clone designationSEQID NO Library Patient sera for
screen
NGO-St-47 36 Gastric tumor autologous
TS-64-5' 3 7 Testis seminoma
HOM-TSOv3-41 38 Testis seminoma
(5')
HOM-TSOv3-41 39 Testis seminoma
(3')
HOM-HD2-2(3') 40 Hodgkin's diseaseautologous
HOM-HD2-232(3')41 Hodgkin's diseaseautologous
Thy4 (3') 42 Thyroid tumor autologous
CA 02344995 2001-04-04
WO 00/Z0587 PCTNS99/22873
-54-
Thy4 (3') 42 Thyroid tumor autologous
ThyS (3') 43 Thyroid tumor autologous
Thy8 (3 ) 44 Thyroid tumor autologous
ThylO (3') 45 Thyroid tumor autologous
NGO-Br-1 46 Breast cancer autologous
In addition, a hepatocarcinoma library screened with autologous sera also
identified several
clones which were sequenced and found to be substantially identical to
kinectin.
Allotvpi~(gastric cancer
12/12 gastric cancer patient sera recognized kinectin
0/27 normal individual sera recognized kinectin
Therefore it was determined that recognition of kinectin was diagnostic for
cancer patients.
Example 3: Preparation of recombinant cancer associated antigens
To facilitate screening of patients' sera fox antibodies reactive with cancer
associated
antigens, for example by ELISA, recombinant proteins are prepared according to
standard
procedures. In one method, the clones encoding cancer associated antigens are
subcloned into
a baculovirus expression vector, and the recombinant expression vectors are
introduced into
appropriate insect cells. Baculovirus/insect cloning systems are preferred
because post-
translational modifications are carried out in the insect cells. Another
preferred eukaryotic
system is the Drosophila Expression System from Invitrogen. Clones which
express high
amounts of the recombinant protein are selected and used to produce the
recombinant
proteins. The recombinant proteins are tested for antibody recognition using
serum from the
patient which was used to isolated the particular clone, or in the case of
cancer associated
antigens recognized by allogeneic sera, by the sera from any of the patients
used to isolate the
clones or sera which recognize the clones' gene products.
Alternatively, the cancer associated antigen clones are inserted into a
prokaryotic
expression vector for production of recombinant proteins in bacteria. Other
systems,
including yeast expression systems and mammalian cell culture systems also can
be used.
Example 4: Preparation of antibodies to cancer associated antigens
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-55-
The recombinant cancer associated antigens produced as in Example 4 above are
used
to generate polyclonal antisera and monoclonal antibodies according to
standard procedures.
The antisera and antibodies so produced are tested for correct recognition of
the cancer
associated antigens by using the antiseralantibodies in assays of cell
extracts of patients
known to express the particular cancer associated antigen (e.g. an ELISA
assay). These
antibodies can be used for experimental purposes (e.g. localization of the
cancer associated
antigens, immunoprecipitations, Western blots, etc.) as well as diagnostic
purposes (e.g.,
testing extracts of tissue biopsies, testing for the presence of cancer
associated antigens).
Example 5: Expression of cancer associated antigens in cancers of similar and
different
origin.
The expression of one or more of the cancer associated antigens is tested in a
range of
tumor samples to determine which, if any, other malignancies should be
diagnosed and/or
treated by the methods described herein. Tumor cell lines and tumor samples
are tested for
cancer associated antigen expression, preferably by RT-PCR according to
standard
procedures. Northern blots also are used to test the expression of the cancer
associated
antigens. Antibody based assays, such as ELISA and western blot, also can be
used to
determine protein expression. A preferred method of testing expression of
cancer associated
antigens (in other cancers and in additional same type cancer patients) is
allogeneic serotyping
using a modified SEREX protocol (as described above).
In all of the foregoing, extracts from the tumors of patients who provided
sera for the
initial isolation of the cancer associated antigens are used as positive
controls. The cells
containing recombinant expression vectors described in the Examples above also
can be used
as positive controls.
The results generated from the foregoing experiments provide panels of
multiple
cancer associated nucleic acids and/or polypeptides for use in diagnostic
(e.g. determining the
existence of cancer, determining the prognosis of a patient undergoing
therapy, etc.) and
therapeutic methods (e.g., vaccine composition, etc.).
Example 6: HLA typing of patients positive for cancer associated antigens
To determine which HLA molecules present peptides derived from the cancer
associated antigens of the invention, cells of the patients which express the
cancer associated
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-56-
antigens are HLA typed. Peripheral blood lymphocytes are taken from the
patient and typed
for HLA class I or class II, as well as for the particular subtype of class I
or class II. Tumor
biopsy samples also can be used for typing. HLA typing can be carried out by
any of the
standard methods in the art of clinical immunology, such as by recognition by
specific
monoclonal antibodies, or by HLA allele-specific PCR (e.g. as described in
W097/31126).
Example 7: Characterization of cancer associated antigen peptides presented by
MHC
class I and class II molecules.
Antigens which provoke an antibody response in a subject may also provoke a
cell-
mediated immune response. Cells process proteins into peptides for
presentation on MHC
class I or class II molecules on the cell surface for immune surveillance.
Peptides presented
by certain MHC/HLA molecules generally conform to motifs. These motifs are
known in
some cases, and can be used to screen the renal cancer associated antigens for
the presence of
potential class I and/or class II peptides. Summaries of class I and class II
motifs have been
published (e.g., Rammensee et al., Immunogenetics 41:178-228, 1995). Based on
the results
of experiments such as those described above, the HLA types which present the
individual
breast cancer associated antigens are known. Motifs of peptides presented by
these HLA
molecules thus are preferentially searched.
One also can search for class I and class II motifs using computer algorithms.
For
example, computer programs for predicting potential CTL epitopes based on
known class I
motifs has been described (see, e.g., Parker et al, J. Immunol. 152:163, 1994;
D'Amaro et al.,
Human Immunol. 43:13-18, 1995; Drijfhout et al., Human Immunol. 43:1-12,
1995).
Computer programs for predicting potential T cell epitopes based on known
class II motifs
has also been described (see, e.g Sturniolo et al., Nat Biotechnol 17(6):555-
61, 1999). HLA
binding predictions can conveniently be made using an algorithm available via
the Internet on
the National Institutes of Health World Wide Web site at URL
http://bimas.dcrt.nih.~ov . See
also the website of: SYFPEITHI: An Internet Database for MHC Ligands and
Peptide Motifs
(access via http://www.uni-tuebingen.de/uni/kxi/ or
httn://134.2.96.221/scripts/hlaserver dll/EpPredict htm. Methods for
determining HLA class
II peptides and making substitutions thereto are also known (e.g. Strominger
and
Wucherpfennig (PCT/US96/03182)).
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-57-
Example 8: Identification of the portion of a cancer associated poIypeptide
encoding an
antigen
To determine if the cancer associated antigens isolated as described above can
provoke
a cytolytic T lymphocyte response, the following method is performed. CTL
clones are
generated by stimulating the peripheral blood lymphocytes (PBLs) of a patient
with
autologous normal cells transfected with one of the clones encoding a cancer
associated
antigen polypeptide or with irradiated PBLs loaded with synthetic peptides
corresponding to
the putative protein and matching the consensus for the appropriate HLA class
I molecule (as
described above) to localize an antigenic peptide within the cancer associated
antigen clone
(see, e.g., Knuth et al., Proc. Natl. Acad. Sci. USA 81:3511-3515, 1984; van
der Bruggen et
al., Eur. J. Immuno1.24:3038-3043, 1994). These CTL clones are screened for
specificity
against COS cells transfected with the cancer associated antigen clone and
autologous HLA
alleles as described by Brichard et al. (Eur. J. Immunol. 26:224-230, 1996).
CTL recognition
of a cancer associated antigen is determined by measuring release of TNF from
the cytolytic T
lymphocyte or by 5'Cr release assay (Herin et al., Int. J. Cancer 39:390-396,
1987). If a CTL
clone specifically recognizes a transfected COS cell, then shorter fragments
of the cancer
associated antigen clone transfected in that COS cell are tested to identify
the region of the
gene that encodes the peptide. Fragments of the cancer associated antigen
clone are prepared
by exonuclease III digestion or other standard molecular biology methods.
Synthetic peptides
are prepared to confirm the exact sequence of the antigen.
Optionally, shorter fragments of cancer associated antigen cDNAs are generated
by
PCR. Shorter fragments are used to provoke TNF release or 5'Cr release as
above.
Synthetic peptides corresponding to portions of the shortest fragment of the
cancer
associated antigen clone which provokes TNF release are prepared.
Progressively shorter
peptides are synthesized to determine the optimal cancer associated antigen
tumor rejection
antigen peptides for a given HLA molecule.
A similar method is performed to determine if the cancer associated antigen
contains
one or more HLA class II peptides recognized by T cells. One can search the
sequence of the
cancer associated antigen polypeptides for HLA class II motifs as described
above. In
contrast to class I peptides, class II peptides are presented by a limited
number of cell types.
Thus for these experiments, dendritic cells or B cell clones which express HLA
class II
molecules preferably are used.
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-58-
Table 1: Sequence homologies
SEQ ID NO.: 1
AB002799, U46118RNU46118U19482AF026216AB002739, AB002730, AB002728,
AF058796, AB002777, AF020187, AF009411, AB015609, AF006627, M95076, 043527,
AB002741, 025896, AF006628, AF019093, D83352, 010355, M99575, 098288,
AF090440, AB007509, 082480, Y15794, AJ005572, AF029349, L10111, S80963,
038894, L41731, AF022733, AJ225108, Y11879, AF001688, 033214, 297178,
AF009413, AF019907, AF016371, X71980, AF001522, M77169, AF023132, D83476,
AJ009675, 090554, AF069329, AF098691, 234799, AF004947, 060199, AF022732,
AF019887, L02937, 055848, AF011331, AF095770, AF043533, X69524, M32882,
008214, 050897, AF017369, 035364, Y14339, AJ005969, 090555, 044430, 079296,
AF001501, AJ223316, D78609, LI41060, 259362, AF034387, 062398, AB005545,
AB002533, Y13865, AF009959, L02938, 010555, AL010296, AC003091, 037699,
S75970, AF071010, 281311, AB003681, X16353, AB002731, X53081, D63950,
D10911, D90115, X97065, 282275, AB016891, Y09455, X77990, , W58357, W07820,
AA188593, W81096, AA858164, AI018124, AI139112, AA769634, W00937, D80849,
AA448160, N98650, T31293, H15307, H51146, N29314, AA770301, AA187822,
AA978299, T31823, AA936910, AA993194, N41386, W45601, W81099, C05691,
D60153, AA780119, AA929004, 868608, 243271, N37029, AA974718, AA928663,
T30120, AA936583, H51109, N20251, W92917, T36035, AA980197, 224908, N79950,
AA872019, AA902275, N59810, 813443, AA740162, AA937759, N72168, AA970708,
T36257, AA933833, H15700, D51185, AA249138, 837356, W93028, 228641,
AA371994, N72757, AA719126, N56164, T31790, D57389, 291959, N58984,
AA897848, AA587009, 239343, AA659834, AA505490, 238243, D20349, AA252395,
AA025593, H70133, 809101, AA159862, AI032981, 228355, C75020, AI139692,
D82421, AI126922, C75170, AI016032, C18798, C75478, AI129339, C75472,
AA310765, D63057, C05952, AA357303, C16591, D82132, L48852, D82799, C75176,
AI124552, AA669409, 030155, C75118, AA374918, C75108, C05853, 030151,
D57346, AI127548, AA918527, AA317816, AA573490, 821.699, AA917928, 836311,
AA361522, AA701252, AI085492, H44387, AA156256, AA587935, AA976510,
AA515269, W73374, T27986, N34493, AA737770, N32609, N32612, H69920, ,
AA415293, AA413717, AA117350, AA292502, AA117343, AA545256, AA795651,
AA106372, 031322, AA681967, AA221922, AA600546, AA050610, AU018628, C80932,
AA920654, AA863834, AI099036, AA183239, AI115182, AA590910, W65628,
AA162291, , AA109490, AI052952, AA999324, AI105719, AI026280, AI072678,
AA964820, AA754198, AA944557, AI045710, C94989, AA971630, AA933231,
AA509077, AA257557, AA509328, AA109365, AA963207, AA435473, AA999306,
AA406689, AI105662, AA509174, AI108597, AA109374, AA925182, AA971671,
AA088161, AA752$12, AA626989, AA906924, AA840999, AA509033, C94899,
AA406875, AA842672, AA123619, AA072471, AA509339, AA933108, AI110259,
AA842135, N99262, AA661430, AA842512, AA180648, AI066048, AA559515,
AA406761, AA109423, AF074736, AA257676, D87312, AA257488, AA119390,
AI087701, W06665, W32852, AA123649, AA842505, AA509330, AA908025, AA257279,
AI105717, AA906673, AA627018, AA906850, AA161668, AA114453, AA109372,
AA257572, AA803997, AA406943, AA257495, AA842019, AA661368, AI082949,
AA892888, W06539, AA118223, AA406986, AA971717, AI096212, AA257707,
AA257649, AI053126, AA508950, AA713366, W69049, AA965381, AA208680,
AI057997, AA161707, AI058071, AA675858, AA257513, AI083337, AA406908,
AI083256, AA659956, AA842532, AA754036, AA753165, W18199, AI109620,
AI058022, AI064026, AA471431, AA032116, AA754549, AI108146, C92045,
AA843025, AI109103, AA509237, AA161620, AA257665, AA471605, W89932,
AA841358, AA843040, AA971695, AA003471, AA840977, AA509267, AA841711,
AA471488, AA257699, N98079, AA454318, W04102, AA842874, N99754, AA509307,
AA751845, AA661358, AA508954, AA406746, AA842720, W23363, AA508951,
AI068913, AA417920, AI108220, AA508996, AA471497, AA892911, AA842501,
AA123614, AA509218, AA597812, AA752986, AA752003, AA406839, AA508993,
AA161747, AA509008, AA180623, AA508986, AA892627, AA753129, AA509214,
AA406733, AI105737, N74818, AA753300, AA430818, AA417415, AA114426, 896936,
AA979829, AA246112, AA753138, AI058077, AA842964, AA966639, AA842265,
AA509025, AA601853, W15128, AA660039, AA842275, AA454424, AA180651,
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-59-
AA842423, AA257507, AI063375, AA180692, AA051990, W15099, AA180620, W00308,
AA406729, AA257712, AA257445, AA433148, C48534, AA495533, C08939, AA906845,
AA933362, AA509242, AA892023, W29144, AI087990, AA842237, AA601823, W06538,
AI087739, AI087524, AA842164, AA892642, AA471553, .AA842919, AI113700,
AA675813, AI083003, AI021727, AI083274, AI083309, W32823, AA253962,
AA114520, AA430792, C97230, AA842674, AI053141, D75937, AA893039, W68979,
AI105681, W91819, AA756971, AA509104, AAlll828, AI109720, AI110161,
AA933311, AA180602, AA842093, 886419, AI058057, AA186285, AA406891,
AI105725, AA406888, AA649397, N94700, W51718, AA547916, AA840696, 074116,
AA257756, AI082996, W9I818, N74830, AA123585, AA118229, AA459946, AA841367,
AA509109, AA892387, AI052833, AA751998, AA123634, AA257327, AA803962,
AA842993, AA471448, AA406716, AA891361, AA890661, AA713997, AA906759,
AA257695, AA841403, AA751834, AA406997, AI096182, AI105734, W15132, W59918,
AA089352, AA180566, AA257927, AA257522, AA906980, AA471469, AA509264,
AA509032, AA749469, AA752028, AA754167, AA754696, AAB42335, AA842574,
AI065957, AI065970, AI096289, AA109379, AA109472, AA114489, AA161689,
AA930830, AA406948, AA433296, AA454371, AA971492, AA471703, AA752086,
AA842629, AI096185, 847079, 886415, AA161711, AA161655, AA180599, AA257424,
AA257437, AA257749, AA433393, AA471419, AA471602, AA930922, AA661401,
AA752034, AA752066, AA842384, AI082936, AI083329, AI105677, 233912,
AA109362, AA109417, AA051807, AA430797, AA906799, AA430806, AA495598,
AA661116, AI082951, AI105685, AI114069, 897062, W59884, AA109292, AA751829,
AA754172, AA842257, AI082934, AI082958, AA180706, AA971516, AA508962,
AA751563, AA751816, AA753137, AA753167, AA840972, AA892079, AA874756,
AI105522, AI108829, AA180588, AA406676, AA471392, AA509142, AA840909,
AA842175, AI066854, 847172, AA161565, AA257643, AA753161, AA471447,
AA680450, AA752897, AA753237, AA892230, AA842544, AA161635, AA459928,
AA508933, AA509309, C41215, AA842585, D73786, D75990, D75808, AA627099,
N74809, AA257682, AA257517, AA257668, AA471970, AA509251, AA509051,
AA990913, C39627, C41200, C92101, C96071, C98950, AA840970, AA842156,
AA930902, AA842216, AA007706, AA406765, AA180574, AA842310, AI067585,
AI077003, AA756933, AA114501, AA406690, AA959490, AA661371, AA056797,
AA114372, AA180676, AI082955, AA406735, AA675796, AA752005, W29142,
AA109261, AA842401, AA842602, AA246079, AI043420, AA626993, AA123655,
AA257716, AA406931, AA791379, AI105668, AA842538, 847669, AA088150,
AA109308, AA738555, AA123638, AA180582, AA123597, AA971535, AA180728,
AA161741, AA186201, AA430817, AA433170, AA454407, AA471686, AA161596,
AA509110, AA675874, AA471540, 226577, AA753093, AI066829, D37716, AA627017,
N99292, AA50B936, AA257656, AA406768, AA471587, H39287, AA842931, AA161715,
AA509204, AA979935
SEQ ID NO.: 2, AF086243, AE001154, X62889, , W67765, W67769, AA997751,
AI141491, W76469, AA906091, AA872676, AA399825, H77545, H91001, W72232,
AA948309, AA361403, 857582, AA337188, AA215714, AA481093, T75310, AA976452,
AI120744, AA462558, AI158991, AA014020, AA285990, AA051099, AA473453,
AA896862, W56907, AA218305, AA020167, W85164, AA017810, W30604, AA541978,
W20894, AA023164, AA760925, AA024084, AA840049, , AA231755, T20699, C45833,
T24185, C68940, D37618, AA964657, AI011924
SEQ ID NO.: 3, L08501, 297205, 298950, AF010400, AC005162, L08502, D50608,
AA707653, AA861639, AA292496, AA702524, AI097367, AI138509, AI147933,
AI141836, AI075247, N63868, W88668, AA703196, AA625621, AA292247, AI032898,
AA005331, AA699781, AA427941, D31111, D31113, N92013, AA884207, AA094752,
870900, 816693, AA906542, 835112, AA481286, D80100, AA235512, AA960995,
AAB67982, D59403, W88874, AA558590, 810098, AA719917, H43573, 849500,
AA744780, AA047136, AA789101, AA906332, AA747301, AA830606, AA434559,
AA236698, AA328889, N98469, W17299, W96605, AA258082, AI078045, 811930,
W74577, AA703312, AI082727, 895189, N76461, AA010500, W63646, W38891,
AA490651, AA558805, W87891, AA160849, AA618177, AA776126, AA161281, ,
AA822308, AA499768, AA028780, AA183100, AA276783, AA120227, AA200285,
AA212541, AA116265, AA821616, AA265629, AA108599, W61565, AA030311, W42275,
AA419903, AA268027, AA028211, AA518504, AA125399, , C92235, C92002, C29917,
AI145662, C65317, AA901847, AI137443, 27.4719, D35515, 890625, H76970,
SEQ ID NO.: 4, AL031178, Y11905, AF031904, M34309, M29366, L33953, L33952,
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
-60-
L33956, L33954, L33957, 041289, X13369, AL022072, AJ223074, AF078695,
AC004683, X17267, AF025526, AF071798, AC005274, AB009537, X68248, AF035537,
AF056116, AB009052, AL023286, AF058701, L20725, AF001308, 022438, ,
AA211485, AA579574, AI078750, AA568661, AA604128, H49462, AA767424, H97012,
AA565823, H99963, AA827171, T87152, F22119, AA798975, T31504, 292997,
T89930, 802581, H75949, T87057, AA322268, 802700, AA005034, AA576177,
AI014302, AA398159, T83607, AA322497, AA211532, AA019517, 827657, AA026869,
N67589, T83782, AA129383, 239829, AA814308, AA425569, H67997, AA009420,
AA694513, AA007691, T62593, AA333601, H75339, AI057250, T62521, N73865,
AA004558, AA004489, AA007690, AA910241, AA456251, AA009568, AA391266,
T28757, AA132360, AA781316, AA956942, AA782765, AA662593, AA461351,
AA885220, N33840, AA843737, T62232, AA608559, AA64:3270, 844662, AI079863,
AI051088, N63305, W249S5, AA085886, W31918, AA097966, AA178965, AA369890,
AA515015, N79466, AA768162, AA869694, AA811390, AA839531, AA293263,
AA768335, AA799083, T57520, AA292001, AI085512, AA969032, AI027062,
AA595663, AA827242, AA799475, , AA472485, AA097011, AA959170, AA647546,
AA986669, AI006628, W12604, AI122356, AA571721, AA433697, AA880171,
AA015463, AA116290, 087721, AA437983, AA990395, AA265925, W19785, W89262,
AA059703, AA413613, AI020231, AA667024, AA907526, AA221491, AA222523,
076436, AA409700, W35766, , AA859485, H33704, T96512, 025899, T41882,
026586, 092302, AA660448, 094493, 025527, D35095, D33727, F14543, D37473,
T45969, AA040979, D68274, T38420, AA228607, AA660541, T38283, AA842575,
071889, T38745, D68465, T46732, AA59839.3, 023775, 0:64798, AA042719, F19972,
065873, N97974, AA114425, AA900956
SEQ ID NO.: 5, 029344, S80437, M76767, X62889, M84761, J03514, X62888,
X13415, X13135, 005714, AC004013, 058675, 547635, 281533, AC005250,
AC003661, AB008567, Y13449, X96401, AF026987, AF026488, , AA781445,
AI037943, AI129371, 015883, AI073336, AA909077, AA569092, AI039428,
AA568701, AA058907, AA911112, AA234022, N95359, AA565390, AA082927,
AA588430, D60358, AA045488, AA089417, N72089, AI143390, 851979, AA081939,
AA635907, T47621, AA579930, AA995057, AA827039, AA872990, AAS88319,
AA069032, AA062768, AA534011, W96904, H06082, AA938900, AA971262, AA836547,
AA251544, AA250742, AA830405, AA906492, AA102653, 8.38286, AA258075, H83302,
H38522, 861787, 833742, 824099, AI052406, AA931452, 823634, 839640,
AA974568, AI028383, AA312451, AA148800, AI138982, 836172, AA926921, ,
AA472563, AA919598, AA423256, AA476186, AA091992, W84938, AA797706,
AA709956, AA599361, AI006075, AA717202, AA008602, AA033399, AA472306,
AI037430, AI152943, AA475582, AA471792, AA530292, AA277496, AA718588,
AA823112, AA822771, AA710973, AA981780, AA718846, AA797557, AA510746,
AI036049, AA543891, AA606513, AA981758, AA822268, AA913161, AA472201,
AA696527, AA213036, AA168259, AA718549, AA458342, AA119918, AA879925,
AA050917, AA718814, AA793638, AA177899, AA575627, AA537367, AI121788,
AA203946, AA413157, AA517432, AA867736, AI037420, W30436, , 271851,
AA957915, AI112847, AA955881, AA963915, AI093663, 095061, AI009894,
AA957229, AI044678
SEQ ID NO.: 6, AC002426, AC004674, AC004675, AC004006, L12157, 020839,
046028, 020835, AC004058, X67115, X76266, M25985, 059759, AC005172, 070848,
AF042274, X14724, L31840, L41679, , W52480, AA863014, W56770, AA286755,
AA164604, W52777, AA814246, AA765427, AA873647, AA360577, AI139274,
AA770312, AA732557, AA568651, AA164603, W56729, AA199905, AA865009, 816889,
808110, F07672, AA577790, T11467, AA502989, AA366688, AA480628, AA516318,
AA090005, AA081908, F01265, AA780686, , AA466811, AA465808, AA197646,
AI157174, AA153086, AA197667, AA066612, AA058086, AA024186, AA110109,
AA880419, AA870161, AA153880, AA072995, , AI031052, AI093934, AA849320,
D15181, 095093, AI096188, T09655, 062926, AA996934, AA925202, AA817271,
AA901051, 803660, AA948980, AA658709, AA899946, AA957150, AA800160, T76196,
AA891787
SEQ ID NO.: 7, X63547, X63596, AF017306, 094839, 020657, AF017305,
AJ001589, L21998, D21270, 248245, 063834, 268006, L09573, D63819, AC005266,
AF025968, M94131, , AI056961, 015588, AA373847, AA887911, N87070, 839133,
AA226825, AA353972, AA325352, 888378, AA990675, AA456219, AA701415,
AA046611, AA456224, , AA065652, AA221497, AA710221, AA717401, AA254049,
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
-61 -
AA041745, AA510261, AA170745, AA656404, AA572506, AA179539, AA217630, ,
AI134284, 058957, 011202, AA413362, AA728532
SE ID NO.: 8, AB016886, 292811, AL021981, 052078, L46702, 023515, AC005555,
284814, 293016, D21138, X57513, L07194, D83711, M28988, 015974, 052513,
AF026939, L19120, J05258, 213985, 270691, 059227, , AA190526, AA769859,
AI014655, H88220, AA622877, N32046, H89609, AA682362, AA469420, AA375477,
AA284905, AA257109, N80276, H89373, N92393, AA884334, AA778708, AA766209,
AA535677, W46414, AA770266, AA983635, AA721113, H88219, 887349, AA628091, ,
AI116513, AA183589, AI035517, AA209952, AA184622, AI097904, AA016490,
AA162370, AA939521, AA162376, AA718152, AA048154, AA253815, AA795350, ,
AA996981, 044498, 091783, 044695, 044039, 062421, 047063, 045019, D36613,
060872, 050136, 069177, AI055708, D27648, 065648, AI119022, AI064663,
AI107213, AA395461, AA800126, AA891987, T01611, 02'7943, AI113482, 083830
SEQ ID NO.: 9, L93510, 071249, L11275, X73541, 228:317, AB008270, X75652,
005987, 085262, 024189, 246676, X70823, AC004981, D11079, X56121, M58053,
033636, 292773, 023168, D31662, , 815557, F01629, N71722, AA252548,
AA806751, T59557, AA612671, AA329585, AA295675, AA166990, AA128100, H46363,
AA125810, , AA396888, AA408999, AA270873, AA144722, AA863954, W10303, ,
038016, N96746, 237622, AA395862, 038756, F15295, N99294, W68877, 094749,
024349, F15569, AA113611, AA689197, N96676, 073598, F15569, L96559, W06235,
T09718, H77154, T14151, AI082914, AA650815, AA728021, AA072559, 092112,
T96743, 061743, AA550223, 012798, AA275531, AA681003, T75878, AI100097,
T75882, AA848187, T44109, AA542686, H21339
SEQ ID NO.: 10, 281595, 041372, 001317, AE000696, AC002057, X66250, L11665,
D13438, 029377, 250028, 090953, AA119228, AI025080, 880188, W28745,
AA381819, AA381991, 244165, H75915, AI124793, H08139, AA375957, AA381750,
AA166751, 842511, T26985, , AA971592, AA661387, AA606231, D35147
SEQ ID NO.: 11, X76998, 297632, AC004232, AC005184, AC002595, AC003991.
EQUIVALENTS
Those skilled in the art will recognize, or be able to ascertain using no more
than
routine experimentation, many equivalents to the specific embodiments of the
invention
described herein. Such equivalents are intended to be encompassed by the
following claims.
All references disclosed herein are incorporated by reference in their
entirety.
We claim:
CA 02344995 2001-04-04
WO 00/20587 _ PCT/US99/Z2873
SEQUENCE LISTING
<110> Ludwig Institute for Cancer Research
<120> Cancer Associated Antigens
and Uses Therefor
<130> L0961/7050Wo
<140> US 09/166,300
<141> 1997-10-05
<190> US 09/166,350
<141> 1997-10-05
<160> 95
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 4422
<212> DNA
<213> Homo Sapiens
<400> 1
gattattctggaggaagatgaccttcattttatggttatgtgtgtgtgtctgtgtgtctt60
tggaaaaatatatataattttttcaaataggaagccaacatatcaagtgatgaattaaag120
tatgctgcagaatatatattctaaaactacaaaaaagtcactgaatatcaaaatgataca180
gcttatacatatagttactgtgacaagtgacagactgctagttcagaattcaaaaatcct240
ttcctagtttgtgagataatgggctaaattccttctgcctgccactggggcaaagcaaat300
tgctttagtttttgatgagagttcttagaagtttgttggtattccttcatccacagcatc360
cattgttgaaataaccattttcagttgtgatgccttaactaagaagccaattgttagcct420
gaaatgcaatcttggtagccagtttcaatgaagctagagattagtcagaaaaagttagct980
gttgggctttagaaagggattttgagtcctgncatttctacttgggagcattttggagca590
gattaagctttcagtataaaaacaagtggctacctgatggaaacttttcttacccttata600
gggaaactgagcacaagctgaatgatattgtctgctgcaaaaaaaaacaaacaaaaaaaa660
aacaaaacaaaaaacaaaaaaaaaaaaaaaaaaacctcgtgccgaattcggcacgagggg720
aagccccgtgcaccccccgccctccggccgccgccgccccgctggccctgcagccgtcgc780
cgctgcctcgggctacagccccgggca cggtcccggctggggaaggagggcggcgag890
cgg
cgcgtccggagccgccggagatggcgggagggcactgcggcagcttccccgcggcggcgg900
ccggcagcggcgagatcgtccaactgaacgtaggggggaccagatttagtacctcaagac960
aaactcttatgtggattccagattcta tttccagtttgctgagtgggagaatttcaa1020
ttt
cacttcgagatgaaactggtgctatatttattgatagagatccagcagcatttgcaccca1080
ttttaaattttcttcggacaaaagaactagacttaaggggagtgagtattaatgttctca1190
ggcatgaagcagaattttacgggatcactccattagtaagaaggcttctcttatgtgaag1200
aattggagcgttcctcttgtggcagtgtcctttttcatggttacttgcccccaccaggta1260
ttcctagtcgtaaaataaacaacacagtcagatctgctgattctaggaatggtctaaatt1320
ctacagaaggtgaagcccggggaaatggtacacagcctgttctctctggaacgggagaag1380
aaactgttaggctaggatttcctgtggatccacgaaaggtgctaatagtagctggccatc1440
acaactggattgtagctgcatatgcccattttgctgngtggtacagaatcaaagaatctt1500
caggatggcagcaagtgtttacgagcccatatttggattggactatcgaacgagtagctt1560
taaatgcaaaggtggttggagggccacatggagacaaagacaaaatggttgctgttgcct1620
cagagagtagcatcatcttgtggagtgttcaggatgggggaagtggaagtgaaattggag1680
tgttcagcctgggtgttcctgtagatgctctcttctttattggtaaccagttggtggcca1740
cgagtcatacagggaaagtgggagtgtggaatgctgtcactcagcactggcaggttcaag1800
atgttgttcctataactagttatgacactgctggatcattccttctgcttggatgtaaca1860
atggatcaatatattacatagatatgcagaagttccccttgcgaatgaaagataatgatc1920
ttcttgtaactgaactgtatcatgatccttcaaatgatgctattactgctctgagtgttt1980
acctcacacccaaaacaagtgtcagtggtaactggatcgagatcgcctatggtacgagct2040
ctggagcagtacgagtgattgtacaacacccagagacagttgggtcaggtcctcagcttt2100
ttcagactttcacagttcaccgaagtcccgtaacaaaaatcatgctatcagagaagcatc2160
ttgtatcagtctgtgcagataataatcatgtccggacgtggacagtaacacgattcngag2220
gaatgatctctactcagccaggttct.actcctttagcgtcattcaagatactatccctgg2280
aggagacagaaagtcatggtagctattcctctggaaatgacataggaccttttggagagc2390
b5 gagacgatcaacaggtgtttatccagaaagttgttcccatcaccaacaaactatttgtaa2400
gactctcatcgactggaaaaagaatatgtgagatccaggctgttgactgtactacaatat2460
cctcatttacagtgagggaatgtgagggatccagtaggatgggctcaagaccaaggcgct2520
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
2
acttgttcac aggccatacaaatggcagtattcaaatgtgggatctgaccactgctatgg2580
atatggttaa caaaagtgaagataaggatgtaggtggtccaaccgaagaagagctactca2640
aattactcga tcaatgtgatttgagcacatctcgctgtgctactcctaacatcagtccag2700
caacttccgt agttcagcatagccacttacgagaatcaaattctagccttcagcttcagc2760
accatgatac cacccatgaagcagctacttacggttccatgaggccttacagagaaagtc2820
ctttattagc aagggcaagaaggactgagagctttcacagttatagggacttccagacta2880
ttaatttgaa cagaaatgtagaaagagctgtccctgaaaatggtaacttgggtccaatac2940
aagctgaagt gaaaggggcaacaggggaatgtaatatatctgagagaaagtctcctggag3000
tagaaataaa aagtttgagagaattggatagtggattggaagtgcataaaatagctgaag3060
l0 gtttttcaga atccaagaaaaggtcatcagaagatgaaaatgaaaataaaatagagttta3120
ggaagaaagg aggatttgaagggggaggattccttggaagaaagaaagttccctatctgg3180
catcatcacc aagtacttccgatggaggaactgactcacctggtactgcgtccccatctc3240
ctacaaagac tactccatctcctcggcataaaaaaagtgattcttcaggtcaggagtaca3300
gcttgtgaaa actcaccaaaatgaatagttgtttcggttacatttagatgaaagttaaac3360
tttactgaat ttcagtacattagtttttacactaaaactttacaagataaaattggactt3420
catttagtat ctttttaacagaattacttggaataatgagatacaataatcatatctctt3980
ttgacatttt ggaaatttttttaattttacaagtacatttaacagatcatttataaagca3590
ggagtccatt ttaacacttaccgar_tttttttggtttggaaacatattaccacgtcttaa3600
taggatggtg cccatataggtgagcatccctttagatcatgggaaccagcagactgcatt3660
cctaatcttc attatgcctgagacttgtcttacaatgttacctttaagtgaatcacataa3720
ttgtctttgg aacttggtctcccaacacttattgtgattgcaaagtgtttaccagatatt3780
tgatgaggtg ctatgtttgtgaaaaacatatcatgtaattcaaaaacactattgatattg3890
aataccagat accactatgtagtaagtcttttaggatgattttaatttagtcgtgcgtca3900
ttttctgatt ctcatcattgggagatcttaaatcttagcaagcattagcaatattaaatg3960
ccaaaattcc attgaaactttcaagttggagcaattgtctgtgtttgaaaagatgaaata4020
aaaataataa tcaagggcaaagctttgagtgcccagaagggaaagctgtaccagttgcta4080
acctgtcttg tttcaggagccaccatgtttttttttcagtgttancaacaatcatgataa4140
ttaaattaaa acnctagtttgttcacttgtaggactgcagttctgaattttgggttaaag4200
gttttggctg ctgtaagaatgtgaatttgaatgtattttgaattgtaagagcaaaagaac9260
gtttttgtac aattttttttcatttaattggaatgatcttcaggtttctacaaatagggt4320
aattgtaaat ttaaagcattagcatttattggtgaataatgtatatatccccattccaag4380
aaatataagt gagtgaagttgaaataaaatctttaaaattto 4422
<210> 2
<211> 502
<212> DNA
<213> Homo
Sapiens
<900> 2
gctagcttcg gcgcggatccctgggcgtccgtacgtcggagtccttcgtcctccagggtc 60
cctgttcttt gcgccagcgggaaccactatctctgcactcctggggttttgttacatggc 120
tgctttcctc aaaatgagtgttagtgtcaatttcttcagacctttcaccaggtttttggt 180
gccatttacc cttcataggaagagaaataacttaacaattttgcagagatacatgtcttc 290
caaaatacca gctgttacttatcctaaaaatgagagtacacgcccttctgaagagctaga 300
gttggataag tggaaaactaccatgaaatctagtgtgcaagaagaatgtgtttcaacaat 360
ctcaagcagt aaggatgaagatcctctagctgccaccagagagttcattgagatgtggag 920
attgcttggc agagaagtaccagaacacatcactgaagaagagctcaaaacccttatgga 980
atgtgtttct aacacagcaaas 502
<210> 3
<211> 1948
<212> DNA
<213> Homo Sapiens
<400> 3
ccatgtgagg gaggggcccgctcctgcttggtgacagagtcagcacgcggtggcctgcag 60
ttcctccagc agtgtgaccgggaggatctggtggaattggctctgcctcagctggctcag 120
gttgtgaccg tgtatgagtttcttctgatgaaggttgaaaaagatcatctagcaaagcct 180
tttttcccag ctatatataaggaatttgaagagttgcataaaatggttaagaaaatgtgc 290
caagattacc tcagtagttctggtctgtgttcccaggagaccctggaaataaacaatgat 300
aaggttgctg agtcattaggaatcacagaattcctacggaagaaagaaatacacccagac 360
aaccttggac ccaagcacctcagccgagacatggatggggagcagctagagggagctagc 420
agcgagaaga gggaacgtgaggctgcggaggagggactggcctcagtgaaaaggcccaga 480
agagaagccc tgtccaacgataccactgaatctcttgctgccaacagcagaggccgggag 590
aagcccaggc ccttgcatgctttgcccgctggtttttcccctccagtaaatgtgactgtc 600
tctccccgtt ctgaagaaagccatacaacgacggtttctggtggcaatgggagcgtgttc 660
caggcgggcc cgcagcttcaggcactggctaacttagaagccaggagggggtctataggt 720
CA 02344995 2001-04-04
WO 00/20587 _ PCT/US99/22873
gctgctctct catcccgggatgtcagtgggctgcctgtttatgctcagtcaggagagcct 780
aggaggctga cccaggcacaggtggcagcgtttcctggagagaatgctttggaacactct 890
tcagaccagg acacctgggacagcctgaggagcccgggtttctgcagccctttgtcatct 900
ggtggtggag cagagtccctgccgcctggggggcctggacatgcagaggcaggacacctc 960
ggcaaggttt gtgacttccacctgaaccaccagcagcccagccccaccagcgtcctgcct 1020
acagaggtgg cagcccctccgcttgagaaaattttgtctgtggatagcgtggcagtggac 1080
tgtgcctaca ggactgtgcccaagccagggcctcagcctggcccacatggatcactattg 1140
actgaagggt gtctcagaagcctttcgggggacttgaaccggttcccctgtgggatggag 1200
gtgcactctg gccagagagaactggagagcgtggttgctgtcggcgaagccatggctttg 1260
aaatttccaa tgggagccatgagttactgtctcagggacagaagcagatttttattcaga 1320
cttccgatgg gcttatcttgtcccctccaggtacaatagtgtctcaggaggaggacattg 1380
tcacagtgac tgatgcagaggggcgtgcctgcggatgggcccgctagaaggagttcctct 1940
agaagctgtg gagtcggtcgtcaccgcgagagccctcacagtgaagtggagtcagatcct 1500
agattcgtct gattttatccagagaaggtctatggcaagcaatgtatatttttctaatgt 1560
gaatattgca cagatgaaccttttatttataaagaataatgtctttctgccctgctgtct 1620
acatttttct atggagcttgtcataataatagcagatattacctgatcaggaatccctgt 1680
ggcgcgtctg acgctcatgagtttttcatgat.ggtgatgagtagcactgcactgtcacct 1790
gatgattggc cctgctccgtttcc~ttctctcctgggagatatgctgcttttccaccaga 1800
cttgctccat actagaagcttcttttgggttcaattaaaaagaaaataagctagtcattc 1860
tgggcagcat tttattgatagaagggggaaaaagtcatttctacttgcatgattttttaa 1920
attaaattaa attaaattaatttaaaaa lgqg
<210> 4
<211> 1486
<212> DNA
<213> Homo
sapiens
<400> 4
ccgcggcggc gtccggggtctccagtagggctgacgctccggtgctcgcacaatcccccg 60
cctcggctgg caacgggcgtccctccactccccgagtccccggcagccgccgccacccca 120
gcgcgccccg atctggccccctgccccgcgaagatggctgccgtacgccgggcccgcagt 1B0
tattgccgct gcctggtgcgcttctccgaccgagaactctgctaagctccgctgcagaga 240
caggcaggag tagacacccggacacccagcacccctcctccggggggcggtgcagagggg 300
gcacggagag cccctcgagcgcagcaggccgccccgccagcatggcagaagctgaggaag 360
attgtcattc tgatactgtcagagcagatgatgatgaagaaaatg<iaagtcctgctgaaa 420
cagatctgca ggcacaactccagatgttccgagctcagtggatgtttgaacttgctccag 480
gtgtaagctc tagcaatttagaaaatcgaccttgcagagcagcaagaggctctctccaga 540
aaacatcggc agataccaaaggaaaacaagaacaggcaaaagaagaaaaggctcgagaac 600
tcttcctaaa agcagtagaagaagaacaaaatggagctctctatgaagccatcaagtttt 660
atcgtagggc tatgcaacttgtacctgatatagagttcaagattacttatacccggtctc 720
cagatggtga tggcgttggaaacagctacattgaagataatgatgatgacagcaaaatgg 780
cagatctctt gtcctacttccagcagcaactcacatttcaggagtctgtgcttaaactgt 840
gtcagcctga gcttgagagcagtcagattcacatatcagtgctgccaatggaggtcctga 900
tgtacatctt ccgatgggtggtgtctagtgacttggacctcagatcattggagcagttgt 960
cgctggtgtg cagaggattctacatctgtgccagagaccctgaaat:atggcgtctggcct 1020
gcttgaaagt ttggggcagaagctgtattaaacttgttccgtacacgtcctggagagaga 1080
tgtttttaga acggcctcgtgttcggtttgatggcgtgtatatcagtaaaaccacatata 1140
ttcgtcaagg ggaacagtctcttgatggtttctatagagcctggcaccaagtggaatatt 1200
acaggtacat aagattctttcctgatggccatgtgatgatgttgacaacccctgaagagc 1260
ctcagtccat tgttccacgtttaagaactagggaataccaggactgatgccaattctact 1320
gggtcactat cgcttggcacaagacacagaccatcagacccaaagt~attttgctgtaata 1380
actaagaaaa aaaggaagaaaaaccacttggactataaatacccgatattttcgtcgggg 1440
tccctgtacc aaagaagccgaatcagaagttttcatgnnggggctn 1986
<210> 5
<211> 774
<212> DNA
<213> Homo sapiens
<400> 5
tgcgccaccc caccccaccccacccccgccatgcaacgggattgaagggtcctgccggtg 60
ggaccctgtc cggcccagtgccactgccccccgaggctgctagacgtaggtgttaggcat 120
gtcccaccca cccgccgcctcccacggcacctcggggacaccagagctgccgacttggag 180
actcctggtc tgtgaagagccggtggtgcccgtgcccgcaggaactgggctgggcctcgt 290
gcgcccgtgg ggtctgcgcttggtctttctgtgcttggatttgcatatttattgcattgc 300
tggtagagac ccccaggcctgtccaccctgccaagactcctcaggcagcgtgtgggtccc 360
gcactctgcc cccatttccccgatgtcccctgcgggcgcgggcagccacccaagcctgct 420
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
4
ggctgcggccccctctcggccaggcattggctcagcccgctgagtggggggtcgtgggcc480
agtccccgaggagctgggcccctgcacaggcacacagggcccggccacacccagcggccc590
cccgcacagccacccgtggggtgctgcccttatgcccggcgccgggcaccaactccatgt600
ttggtgtttgtctgtgtttgtttttcaagaaatgattcaaattgctgcttggattttgaa660
atttactgtaactgtcagtgtacacgtctggaccccgtttcatttttacaccaatttggt720
aaaaatgctgctctcagcctcccacaattaaaccgcatgtgatctccaaaaaaa 774
<210> 6
<211> 2936
<212> DNA
<213> Homo sapiens
<400> 6
cgtaacccttagtcccaatgcctccgtaagcggagttgagtgggtgcctgtggttggagc 60
IS tgtggaggtgtccccggtggcgagcgcggccagaactgcggtcacttaagttttccgtgt 120
gcgggttgcaaggagcgtgcgtgcgtctggtatagggaggacacctctggattgaggatc 180
ttatgacctactttagaggaaggtataatttggcttcctgagattctgccttagcaagaa 290
aggagtgggaaatacccttggaaagaaaactaaaacagtaagaaagccaaaacttatttt 300
tacatggttgtcagcacatttaccgatatggacacttttcccaataattttcctcctggt 360
ggagacagtggattgacaggttctcagtcggagttccagaaaatgttaattgatgaaagg 920
ttacgatgtgagcatcataaagctaattatcagacactgaaggctgaacacacaaggttg 480
cagaatgaacatgtaaagttacaaaatgaactcaagcacctgtttaatgaaaagcaaact 540
cagcaggaaaaacttcagctcctgcttgaagaactaagaggagaattagtagagaaaact 600
aaagatttagaagaaatgaaactgcagatattaactcccaaaaattggaattgctaagag 660
cccaaatacaacaagaattagaaactccaatgagagaacgttttaggaatctagatgaag 720
aggtagaaaagtatagagctgtatataataagcttcgctatgaacatacatttctcaagt 780
cagaatttgaacaccagaaggaagagtatgcacgtattttagatgaaggaaaaataaaat 840
atgaatcagagattgcaagactggaggaagataaagaagaactacgtaaccagctgctta 900
atgttgatctcacaaaagacagcaaacgagtggaacaacttgctcgagaaaaagtctatt 960
tgtgtcaaaaattaaaaggtttagaggctgaagtagcggaattaaaggctgaaaaggaga 1020
attctgaggctcaggtggaaaatgcccaaagaatacaggtgcggcagttggctgagatgc 1080
aggctacagtcagatccctgggggctgaaaaacaatcagctaatttacgggcagaacgct 1190
tggaaaaagagctacaatcaagcagtgaacaaaatacctttttaattaataaattgcata 1200
aagctgaacgagaaataaatacattgtccagtaaagtaaaagaacttaaacattcaaaca 1260
aactggaaataacagacatcaaactggagacagcaagagctaagagtgagctagaaagag 1320
aaaggaataagcttcaaagtgaactggatggattacagtcagacaatgaaattctcaaag 1380
cagctgttgaacatcacaaagtgctcttagtagaaaaggatcgtgaattaatacgtaaag 1990
tacaagctgccaaagaagaaggttatcaaaaacttgtggtattacaagatgaaaagttag 1500
aactcgagaacagattagcagatttggagaaaatgaaagtggaacatgatgtctggaggc 1560
aatctgaaaaggatcagtatgaagagaaattgcgggcttcacagatggcagaagagatca 1620
ccaggaaggagcttcagagtgttaggttaaaacttcagcaacaaattgtgactattgaaa 1680
atgcagagaaggaaaaaaatgaaaattctgacctaaaacagcaaatcagtagtttgcaga 1790
tccaagtgacttcacttgcacagtcagagaatgacttgctgaattcaaaccaaatgctga 1800
aggaaatggtggagagattaaaacaagaatgccgaaattttagaagccaagctgaaaaag 1860
cgcaactagaagctgaaaagacattggaagagaaacagatacagtggttggaagaaaagc 1920
ataagcttcatgaccgtatcacagacagagaagaaaagtacaatcaagctaaggagaaac 1980
tgcagcgagctgcaattgcccagaaaaagagaaaatctcttcatgaaaacaaattgaaaa 2040
gactacaagagaaagtagaagtcttggaggcaaagaaagaagaattggaaacagaaatca 2100
ggtcttaaatagacaaaatgttcctttgaagactatacaaggcttcaaaaaagactaaaa 2160
gatatacagagaagacataatgaatttcgaagtctaattttggttcctaacatgcctcca 2220
acagcatctatcaatcctgttagctttcagtcatcagccatggttccaagcatggaacta 2280
ccatttcctcctcatatgcaggaggaacaacatcaaagggaactctctctacttcgcaaa 2340
agactagaagaactggaaacaacacaaagaaaacaactagaggaacttggatcttccgga 2400
gaatgatgttcttggagaacaggcagatcaaaagaggtgaagttggtgactcagtaaaac 2460
ttgacattttaacctgtggcatttagatactttttactgtttgccaaaacacttgaatgt 2520
gcctcaagaaaaggtacctactacatgctgtattgtatgactgtcaggattttaagatta 2580
tacaagtgaagcattaaaagagaaattctcagagatatttagaatatttgacaatggttt 2640
gagaatgtaaaacaaaaaggaactagttagagtcaagttttaaaatttttactttgttga 2700
atttttttttttggcattttgagtgaaatataactatcattaattctctcttcatctttg 2760
agatgcttggccataacagggtccatacacatcttctggtttactatatacaaaaactgt 2820
agttgaaaaaagatgacaatttaaaagtcagcctaaagaatgtaaaggtatctatataca 2880
aaaggctaccttttctaaaatctgtgtgcacataattaaagagcttaatttttaaa 2936
<210> 7
<211> 1387
<212> DNA
<213> Homo sapiens
CA 02344995 2001-04-04
WO 00120587 PCT/US99/22873
<900> 7
aaaggctacatcattaacactagaaggaggacgattaaaacgaactccacagctgattca 60
tggaagagactatgaaatggtcccagaacctgtgtggagagcactttatcactggtatgg 120
S agcaaacctggccttacctagaccagttatcaagaacagcaagacagacatcccagagct 180
ggaattatttccccgctatcttctcttcctgagacagcagcctgccactcggacacagca 290
gtctaacatctgggtgaatatgggaaatgtaccttctccgaatgc:acctttaaagcgggt 300
attagcctatacaggctgttttagtcgaatgcagaccatcaaggaaattcacgaatatct 360
atctcaaaggctgcgcattaaagaggaagatatgcgcctgtggctatacaacagtgagaa 420
ctaccttactcttctggatgatgaggatcataaattggaatattt:gaaaatccaggatga 480
acaacacctggtaattgaagttcgcaacaaagatatgagttggccagaggagatgtcttt 540
tatagcaaatagtagtaaaatagatagacacaaggttcccacagaaaagggagccacagg 600
tctaagcaatctgggaaacacatgcttcatgaactcaagcatccagtgtgttagtaacac 660
acagccactgacacagtattttatctcagggagacatctttatgaactcaacaggacaaa 720
tcccattggtatgaaggggcatatggctaaatgctatggtgatttagtgcaggaactttg 780
gagtggaactcagaagaatgttgccccattaaagcttcggtggac:catagcaaaatatgc 890
tcccaggtttaatgggtttcagcaacaggactcccaagaacttctggcttttctcttgga 900
tggtcttcatgaagatcttaatcgagtccatgaaaagccatatgtggaactgaaggacag 960
tgatgggcgaccagactgggaagtagctgcagaggcctgggacaaccatctaagaagaaa 1020
tagatcaattgttgtggatttgttccatgggcagctaagatctcaagtaaaatgcaagac 1080
atgtgggcatataagtgtccgatttgaccctttcaattttttgtctttgccactaccaat 1190
ggacagttatatgcacttagaaataacagtgattaagttagatggtactacccctgtacg 1200
gtatggactaagactgaatatggatgaaaagtacacaggtttaaaaaaacagctgagtga 1260
tctctgtggacttaattcagaacaaatccttctagcagaagtacatggttccaacataaa 1320
2S gaactttcctcaggacaacccaaaaagtaccgaacttctcagtgaagtgggattttttgg 1380
tgtgcca 1387
<210> 8
<211> 799
<212> DNA
<213> Homo
Sapiens
<400> 8
gcccaacatggctggagcgcggcggaggtgagccggccgcccgcccgcagacgccccagc 60
3S ctactgcgcccgagtcccgcggccccagtggcgcctcagctctgcggtgccgaggcccaa 120
cggctcgatcgctgcccgccgccagcatgttgggcgccccggacgagagctccgtgcggg 180
tggctgtcagaataagaccacagcttgccaaagagaagattgaaggatgccatatttgta 240
catctgtcacaccaggagagcctcaggtcttcctagggaaagataaggcttttacttttg 300
actatgtatttgacattgactcccagcaagagcagatctacattcaatgtatagaaaaac 360
taattgaaggttgctttgaaggatacaatgctacagtttttgcttatggacaaactggag 920
ctggtaaaacatacacaatgggaacaggatttgatgttaacattgttgaggaagaactgg 480
gtattatttctcgagctgttaaacacctttttaagagtattgaagaaaaaaaacacatag 540
caattaaaaatgggcttcctgctccagattttaaagtgaatgcccaattcttagagctct 600
ataatgaagaggtccttgacttatttgataccactcgtgatattgatgcaaaaagtaaaa 660
4S aatcaaatataagaattcatgaagattcaactggagggaatttatactgtgggcgtttcc 720
aacacgtactgtgaatacagaatcnagag 749
<210> 9
<211> 686
<212> DNA
<213> Homo
Sapiens
<400> 9
tggaaattatagacctagcaaaaaaagatttagagaaggttgnaaagaaaagaaaagagg 60
SS aagnaaaaaagtgtggctggtaaagaggataatacagacactgaccaagagaagaaagaa 120
gaaaagggtgtttcggaaagagaaacccaatgaattagaagtggaagaaagtcaagaagt 180
gagtgatcatgaggatgaagaagaggaggaggaggaggaggaagatgacattgatggggg 240
tgaaagttctgatgaatcagattctgaatcagatgaaaaagccnattatcaagcagactt 300
ggcaaacattacttgtgaaattgcaattaagcaaaagctgattgatgaactagaaaacag 360
ccagaaaagactgcagactctgaaaaagcagtatgaagagaagntaatgatgctgcaaca 420
taaaattcgggatactcagcttgaaagagaccaggtgcttcaaaacttaggctcggtaga 480
atcttactcagaagaaaaagcaaaaaaagttaggtctgaatatgaaaagaaactccaagc 540
catgaacaaagaactgcagagacttcaagcagctcaaaaagaacatgcaaggttgcttaa 600
aaatcagtctcagtatgaaaagcnattgaagaaattgcagcaggatgtgatggaaatgaa 660
6S aaaaacaaaggttcgcctaatgaaaa 686
<210> 10
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
6
<211> 833
<212> DNA
<213> Homo sapiens
<900> 10
gttcttctgtcgccggcttcagcagcccgcgcccgggcaggaatagaagatgaacaaacc60
cataacaccatcaacatatgtgcgctgcctcaatgttggactaattaggaagctgtcaga120
ttttattgatcctcaagaaggatggaagaagttagctgtagctattaaaaaaccatctgg180
tgatgatagatacaatcagtttcacataaggagatttgaagcattacttcaaactggaaa240
aagtcccacttctgaattactgtttgactggggcaccacaaattgcacagttggtgatct300
tgtggatcttttgatccaaaatgaattttttgctcctgcgagtcttttgctcccagatgc360
tgttcccaaaactgctaatacactaccttctaaagaagctataacagttcagcaaaaaca420
gatgcctttctgtgacaaagacaggacattgatgacacctgtgcagaatcttgaacaaag480
ctatatgccacctgactcctcaagtccagaaaataaaagtttagaagttagtgatacacg590
l5 ttttcacagtttttcattttatgaattgaagaatgtcacaaataactttgatgaacgacc600
catttctgttggtggtaataaaatgggagagggaggatttggagttgtatataaagggct660
acgtaaataacacaactgtggcagtgaaagaa~gcttgcagcaatggttgacattactact720
gaaggaactgaaaccagcagtttgatccaagaaaataaaagtaatgggcaaaagtggtca780
accatggaaaaactttagtaggaacctacttgggttttctcaagtggatggga 833
<210> 11
<211> 799
<212> DNA
<213> Homo sapiens
<400> 11
taaaaatatccccttngatgatacctgccaataatgatatgtcccattattagattatgt60
tacatgccaaagtttaaaggaatttgggcagatccagttaaggttccttaaacaacntca120
ctttgagactgttgaaagggcctgacctaatccaagtgaaccccttgcaagaagaattct180
ccttgtaagccttgaagaagtatgtgagagggccacattggctaaaacctaaaggtggcc290
tctaggagatgagacctaccttccagttgtcagcaagcaggaaaaaaaaattgggacctc300
agttgcaaccacaaggaactgaattctgccaaaaatntgagtcagcttagaagagtactc360
caagcttcagatgataaccacagcctgggctgacacctggatttagctttgcatgatcct420
cagtatgagaatctatctgttctgtgctggacttctaatatatagaactgtgagataatg980
ggtcacattggctggatgtggtggctcatacctgtaaatcccagcactttgggaggccga540
ggcaggcagatcacctgaggtcaagagttcaagaccggcctggccaacatggtgaaaccc600
cgtctntactaaaaatacaaaaattagacgagcgtggtggtggacacctgtagtcccagc660
tgcttgggaggctgaggcaggagactagctggaaccagggaggtagaggttgcagtgagc720
tgagatcgtgccactgcactccagcctgggtgacagagtgagactc:catcataaataaat780
aaataaataaatgggtcnc 7gg
<210> 12
<211> 812
<212> PRT
<213> Homo sapiens
<900> 12
Met Ala GlyGlyHisCys GlySerPhePro AlaAlaAlaAlaGly Ser
1 5 10 15
Gly Glu IleValGlnLeu AsnValGlyGly ThrArgPheSerThr Ser
20 25 30
Arg Gln ThrLeuMetTrp IleProAspSer PhePheSerSerLeu Leu
35 90 95
Ser Gly ArgIleSerThr LeuArgAspGlu ThrGlyAlaIlePhe Ile
50 55 60
Asp Arg AspProAlaAla PheAlaProIle LeuAsnPheLeuArg Thr
70 75 80
Lys Glu LeuAspLeuArg GlyValSerIle AsnValLeuArgHis Glu
85 90 95
60 Ala Glu PheTyrGlyIle ThrProLeuVal ArgArgLeuLeuLeu Cys
100 105 110
Glu Glu LeuGluArgSer SerCysGlySer ValLeuPheHisGly Tyr
115 120 125
Leu Pro ProProGlyIle ProSerArgLys IleAsnAsnThrVal Arg
65 130 135 140
Ser Ala AspSerArgAsn GlyLeuAsnSer ThrGluGlyGluAla Arg
145 150 155 160
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
7
Gly GlyThr GlnPro Leu Gly Gly GluThrVal
Asn Val Ser Thr Glu
165 170 175
Arg GlyPhe ProValAsp LysValLeu I:leValAlaGly
Leu Pro
Arg
180 185 190
His HisAsnTrp IleValAlaAlaTyr AlaHisPhe AlaTyrArgIle
195 200 205
Lys GluSerSer GlyTrpGlnGlnVal PheThrSer ProTyrLeuAsp
210 215 220
Trp ThrIleGlu ArgValAlaLeuAsn AlaLysVal ValGlyGlyPro
225 230 235 240
His GlyAspLys AspLysMetValAla ValAlaSer GluSerSerIle
295 250 255
Ile LeuTrpSer ValGlnAspGlyGly SerGlySer GluIleGlyVal
260 265 270
l5 Phe SerLeuGly ValProVal.AspAla LeuPhePhe IleGlyAsnGln
275 280 285
Leu ValAlaThr SerHisThrGlyLys ValGlyVal TrpAsnAlaVal
290 295 300
Thr GlnHisTrp GlnValGlnAspVal ValProIle ThrSerTyrAsp
305 310 315 320
Thr AlaGlySer PheLeuLeuLeuGly CysAsnAsn GlySerIleTyr
325 330 335
Tyr IleAspMet GlnLysPheProLeu RrgMetLys AspAsnAspLeu
390 345 350
Leu ValThrGlu LeuTyrHisAspPro SerAsnAsp A.laIleThrAla
355 360 365
Leu SerValTyr LeuThrProLysThr SerValSer G.lyAsnTrpIle
370 375 380
Glu IleAlaTyr GlyThrSerSerGly AlaValArg ValIleValGln
385 390 395 400
His ProGluThr ValGlySerGlyPro GlnLeuPhe G1nThrPheThr
405 410 415
Val HisArgSex ProValThrLysIle MetLeuSer G1uLysHisLeu
420 425 430
Val SerValCys AlaAspAsnAsnHis ValArgThr TrpThrValThr
435 440 995
Arg PheGlyMet IleSerThrGlnPro GlySerThr ProLeuAlaSer
450 455 960
Phe LysIleLeu SerLeuGluGluThr GluSerHis GlySerTyrSer
465 970 475 480
Ser GlyAsnAsp IleGlyProPheGly GluArgAsp AspGlnGlnVal
985 490 995
Phe IleGlnLys ValValProIleThr AsnLysLeu PheValArgLeu
500 505 510
Ser SerThrGly LysArgIleCysGlu IleGlnAla ValAspCysThr
515 520 52.5
Thr IleSerSer PheThrValArgGlu CysGluGly SerSerArgMet
530 535 590
Gly SerArgPro ArgArgTyrLeuPhe ThrGlyHis ThrAsnGlySer
545 550 555 560
Ile GlnMetTrp AspLeuThrThrAla MetAspMet ValAsnLysSer
565 570 575
Glu AspLysAsp ValGlyGlyProThr GluGluGlu LeuLeuLysLeu
580 585 590
Leu AspGlnCys AspLeuSerThrSer ArgCysAla ThrProAsnIle
595 600 605
Ser ProAlaThr SerValValGlnHis SerHisLeu ArgGluSerAsn
610 615 620
Ser SerLeuGln LeuGlnHisHisAsp ThrThrHis GluAlaAlaThr
625 630 635 640
Tyr GlySerMet ArgProTyrArgGlu SerProLeu LeuAlaArgAla
645 650 655
Arg ArgThrGlu SerPheHisSerTyr ArgAspPhe GlnThrIleAsn
660 665 670
Leu AsnArgAsn ValGluArgAlaVal ProGluAsn GlyAsnLeuGly
675 680 685
Pro IleGlnAla GluValLysGlyAla ThrGlyGlu CysAsnIleSer
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
8
690 695 700
Glu Arg Lys Ser Pro Gly Val Glu Ile Lys Ser Leu Arg Glu Leu Asp
705 710 715 720
Ser Gly Leu Glu Val His Lys Ile Ala Glu Gly Phe Ser Glu Ser Lys
725 730 735
Lys Arg Sex Ser Glu Asp Glu Asn Glu Asn Lys Ile Glu Phe Arg Lys
740 745 750
Lys Gly Gly Phe Glu Gly Gly Gly Phe Leu Gly Arg Lys Lys Val Pro
755 760 765
Tyr Leu Ala Ser Ser Pro Ser Thr Ser Asp Gly Gly 7'hr Asp Ser Pro
770 775 780
Gly Thr Ala Ser Pro Ser Pro Thr Lys Thr Thr Pro Ser Pro Arg His
?85 790 795 800
Lys Lys Ser Asp Ser Ser Gly Gln Glu Tyr Ser Leu
805 B10
<210> 13
<211> 167
<212> PRT
<213> Homo
Sapiens
<900> 13
Liu Ala Ala A5gIleProGly ArgProTyrVal GlyValLeuArg
Ser
10 15
Pro Pro Ser LeuPhePheAla ProA1aGlyThr ThrIleSerAla
Gly
20 25 30
Leu Leu Phe CysTyrMet.Ala AlaPheLeuLys MetSerValSer
Gly
35 40 q5
Val Asn Phe ArgProPheThr ArgPheLeuVal ProPheThrLeu
Phe
50 55 60
His Arg Arg AsnAsnLeuThr IleLeuGlnArg TyrMetSerSer
Lys
65 '70 75 80
Lys Ile Ala ValThrTyrPro LysAsnGluSer ThrArgProSer
Pro
85 90 95
Glu Glu Glu LeuAspLysTrp LysThrThrMet LysSerSerVal
Leu
100 105 110
Gln Glu Cys ValSerThrIle SerSerSerLys AspGluAspPro
Glu
115 120 125
Leu Ala Thr ArgGluPheIle GluMetTrpArg LeuLeuGlyArg
Ala
130 135 190
Glu Val Glu HisIleThrGlu GluGluLeuLys ThrLeuMetGlu
Pro
145 150 155 160
Cys Val Asn ThrAlaLys
Ser
165
<210> 19
<211> 452
<212> PRT
<213> Homosapiens
<900> 14
Pro Cys Glu Gly Gly Ala Arg Ser Cys Leu Val Thr Glu Ser Ala Arg
1 5 10 15
Gly Gly Leu Gln Phe Leu Gln Gln Cys Asp Arg Glu Asp Leu Val Glu
20 25 30
Leu Ala Leu Pro Gln Leu Ala Gln Val Val Thr Val Tyr Glu Phe Leu
35 40 q5
Leu Met Lys Val Glu Lys Asp His Leu Ala Lys Pro Phe Phe Pro Ala
50 55 60
Ile Tyr Lys Glu Phe Glu Glu Leu His Lys Met Val Lys Lys Met Cys
70 75 80
Gln Asp Tyr Leu Ser Ser Ser Gly Leu Cys Ser Gln Glu Thr Leu Glu
85 90 95
Ile Asn Asn Asp Lys Val Ala Glu Ser Leu Gly Ile Thr Glu Phe Leu
65 100 105 110
Arg Lys Lys Glu Ile His Pro Asp Asn Leu Gly Pro Lys His Leu Ser
115 120 125
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
9
Arg AspMetAsp GlyGluGln Leu Ser SerGluLysArg
Glu
Gly
Ala
130 135 140
Glu ArgGluAla AlaGluGlu Gly AlaSerVal LysArgProArg
Leu
145 150 155 160
Arg GluAlaLeu SerAsnAsp ThrThrGluSerLeu AlaAlaAsnSer
165 170 175
Arg GlyArgGlu LysProArg ProLeuHisAlaLeu ProAlaGlyPhe
180 185 190
Ser ProProVal AsnValThr ValSerProArgSer GluGluSerHis
195 200 205
Thr ThrThrVal SerGlyGly AsnGlySerValPhe GlnAlaGlyPro
210 215 220
Gln LeuGlnAla LenAlaAsn LeuGluAlaArgArg GlySerIleGly
225 230 235 290
Ala AlaLeuSer SerArgAsp ValSerGlyLeuPro ValTyrAlaGln
245 250 255
Ser GlyGluPro ArgArgLeu ThrGlnAlaGlnVal AlaAlaPhePro
260 265 270
Gly GluAsnAla LeuGluHis SerSerAspGlnAsp ThrTrpAspSer
275 280 285
Leu ArgSerPro GlyPheCys SerProLeuSexSer GlyGlyGlyAla
290 295 300
Glu SerLeuPro ProGlyGly ProGlyHisAlaGlu AlaGlyHisLeu
305 310 315 320
Gly LysValCys AspPheHis LeuAsnHisGlnGln ProSerProThr
325 330 335
Ser ValLeuPro ThrGluVal AlaAlaProProLeu GluLysIleLeu
340 345 350
Ser ValAspSer ValAlaVal AspCysAlaTyrArg ThrValProLys
355 360 365
Pro GlyProGln ProGlyPro HisGlySerLeuLeu ThrGluGiyCys
370 375 380
Leu ArgSerLeu SerGlyAsp LeuAsnArgPhePro CysGlyMetGlu
385 390 395 400
Val HisSerGly GlnArgGlu LeuGluSerValVal AlaValGlyGlu
405 410 415
Ala MetAlaLeu LysPhePro MetGlyAlaMetSer TyrCysLeuArg
420 425 930
Asp ArgSerArg PheLeuPhe ArgLeuProMetGly LeuSerCysPro
435 940 445
Leu GlnValGln
450
<210> 15
<211> 321
<212> PRT
<213> Homo sapiens
<400> 15
Met Ala GluAla GluGluAspCysHis SerAspThrValArg AlaAsp
1 5 10 15
Asp Asp GluGlu AsnGluSerProAla GluThrAspLeuGln AlaGln
20 25 30
Leu Gln MetPhe ArgAlaGlnTrpMet PheGluLeuAlaPro GlyVal
35 40 45
Ser Ser SerAsn LeuGluAsnArgPro CysArgAlaAlaArg GlySex
50 55 60
Leu Gln LysThr SerAlaAspThrLys GlyLysG1nGluGln AlaLys
70 75 80
60 Glu Glu LysAla ArgGluLeuPheLeu LysAlaValGluGlu GluGln
85 90 95
Asn Gly AlaLeu TyrGluAlaIleLys PheTyrArgArgAla MetGln
100 105 110
Leu Val ProAsp IleGluPheLysIle ThrTyrThrArgSer ProAsp
65 115 120 125
Gly Asp GlyVal GlyAsnSerTyrIle GluAspAsnAspAsp AspSer
130 135 140
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
Lys Met AlaAspLeu LeuSerTyrPheGln GlnGlnLeu ThrPheGln
195 150 155 160
Glu Ser ValLeuLys LeuCysGlnProGlu LeuGluSer SerGlnIle
165 170 175
5 His Ile SerValLeu ProMetGluValLeu MetTyrIle PheArgTrp
180 185 190
Val Val SerSerAsp LeuAspLeuArgSer LeuGluGln LeuSerLeu
195 200 205
Val Cys ArgGlyPhe TyrIleCysAlaArg AspProGlu IleTrpArg
10 210 215 220
Leu Ala CysLeuLys ValTrpGlyArgSer CysIleLys LeuValPro
225 230 235 290
Tyr Thr SerTrpArg GluMetPheLeuGlu ArgProArg ValArgPhe
245 250 255
Asp Gly ValTyrIle SerLysThrThrTyr IleArgGln GlyGluGln
260 265 270
Ser Leu AspGlyPhe TyrArgAlaTrpHis GlnValGlu TyrTyrArg
275 280 285
Tyr Ile ArgPhePhe ProAspGlyHisVal MetMetLeu ThrThrPro
290 295 300
Glu Glu ProGlnSer IleValProArgLeu ArgThrArg GluTyrGln
305 310 315 320
Asp
<210> 16
<211> 172
<212> PRT
<213> Homo s
sapien
<900> 16
Ala Cys ThrHisPro ProProProThr AlaProArgGly HisGln
Pro
1 5 10 15
Ser Cys LeuGlyAsp SerTrpSerVal LysSerArgTrp CysPro
Arg
20 25 30
Cys Pro GluLeuGly TrpAlaSerCys AlaArgGlyVal CysAla
Gln
35 40 95
Trp Ser CysAlaTrp IleCysIlePhe IleAlaLeuLeu ValGlu
Phe
50 55 60
Thr Pro ProValHis ProAlaLysThr ProGlnA.laAla CysGly
Arg
65 70 75 80
Ser Arg LeuProPro PheProArgCys ProLeuA:rgAla ArgAla
Thr
85 90 95
Ala Thr AlaCysTrp LeuArgProPro LeuGlyG:LnAla LeuAla
Gln
100 105 110
Gln Pro GluTrpGly ValValGlyGln SerProArgSer TrpAla
Ala
115 120 125
Pro Ala AlaHisArg AlaArgProHis ProAlaAlaPro ArgThr
Gln
130 135 140
Ala Thr GlyValLeu ProLeuCysPro AlaProGlyThr AsnSer
Arg
145 150 155 160
Met Phe ValCysLeu CysLeuPhePhe LysLys
Gly
165 170
<210> 17
<211> 472
<212> PRT
<213> Homo sapiens
<400> 17
Met Arg Glu Arg Phe Arg Asn Leu Asp Glu Glu Val Gl.u Lys Tyr Arg
1 5 10 15
Ala Val Tyr Asn Lys Leu Arg Tyr Glu His Thr Phe Leu Lys Ser Glu
20 25 30
Phe Glu His Gln Lys Glu Glu Tyr Ala Arg Ile Leu Asp Glu Gly Lys
35 40 45
Ile Lys Tyr Glu Ser Glu Ile Ala Arg Leu Glu Glu Asp Lys Glu Glu
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
I1
50 55 60
Leu ArgAsn GlnLeuLeuAsnVal AspLeu Asp Arg
Thr Ser
Lys Lys
65 70 75 80
Val GluGln LeuAlaArgGluLys ValTyrLeuCysGln LysLeu Lys
85 90 95
Gly LeuGlu AlaGluValAlaGlu LeuLysAlaGluLys GluAsn Ser
100 105 110
Glu AlaGln ValGluAsnAlaGln ArgIleGlnValArg GlnLeu Ala
115 120 125
Glu MetGln AlaThrValArgSer LeuGlyAlaGluI~ysGlnSer Ala
130 135 190
Asn LeuArg AlaGluArgLeuGlu LysGluLeuGlnSer SerSer Glu
145 150 155 160
Gln AsnThr PheLeuIleAsnLys LeuHisLysAlaGlu ArgGlu Ile
IS 165 170 175
Asn ThrLeu SerSerLysValLys GluLeuLysHisSer AsnLys Leu
180 185 190
Glu IleThr AspIleLysLeuGlu ThrAlaArgAlaLys SerGlu Leu
195 200 205
Glu ArgGlu ArgAsnLysLeuGln SerGluLeuAspGly LeuGln Sex
210 215 220
Asp AsnGlu IleLeuLysAlaAla ValGluHisHisLys ValLeu Leu
225 230 235 290
Val GluLys AspArgGluLeuIle ArgLysValGlnAla AlaLys Glu
245 250 255
Glu GlyTyr GlnLysLeuValVal LeuGlnAspGluLys LeuGlu Leu
260 265 270
Glu AsnArg LeuAlaAspLeuGlu LysMetLysValGlu HisAsp Val
275 280 285
Trp ArgGln SerGluLysAspGln TyrGluGluLysLeu ArgAla Ser
290 295 300
Gln MetAla GluGluIleThrArg LysGluLeuGlnSer ValArg Leu
305 310 315 320
Lys LeuGln GlnGlnIleVal.Thr IleGluAsnAlaG1u LysGlu Lys
325 330 335
Asn GluAsn SerAspLeuLysGln GlnIleSerSerLeu GlnIle Gln
390 395 350
Val ThrSer LeuAlaGlnSerGlu AsnAspLeuLeuAsn SerAsn Gln
355 360 365
Met LeuLys GluMetValGluArg LeuLysGlnGluCys ArgAsn Phe
370 375 380
Arg SerGln AlaGluLysAlaGln LeuGluAlaGluLys ThrLeu Glu
385 390 395 400
Glu LysGln IleGlnTrpLeuGlu GluLysHisLysLeu HisAsp Arg
405 910 915
Ile ThrAsp ArgGluGluLysTyr AsnGlnAlaLysG:LuLysLeu Gln
420 425 930
Arg AlaAla IleAlaGlnLysLys ArgLysSerLeuHis GluAsn Lys
435 490 445
Leu LysArg LeuGlnGluLysVal GluValLeuGluAla LysLys Glu
450 455 960
Glu LeuGlu ThrGluIleArgSer
465 470
<210> 18
<211> 962
<212> PRT
<213> Homo Sapiens
<400> 18 ,
Lys Ala Thr Ser Leu Thr Leu Glu Gly Gly Arg Leu Lys Arg Thr Pro
1 5 10 15
Gln Leu Ile His Gly Arg Asp Tyr Glu Met Val Pro G1u Pro Val Trp
20 25 30
Arg Ala Leu Tyr His Trp Tyr Gly Ala Asn Leu Ala Leu Pro Arg pro
35 90 45
Val Ile Lys Asn Ser Lys Thr Asp Ile Pro Glu Leu Glu Leu Phe Pro
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
12
50 55 60
Arg Tyr Leu Gln Pro Gln
Leu Phe Ala
Leu Thr
Arg Arg
Gln Thr
Gln
65 70 75 80
Ser Asn IleTrpVal AsnMetGlyAsn ValProSerProAsn AlaPro
85 90 95
Leu Lys ArgValLeu AlaTyrThrGly CysPheSerArgMet GlnThr
100 105 110
Ile Lys GluIleHis GluTyrLeuSer GlnArgLeuArgIle LysGlu
115 120 125
Glu Asp MetArgLeu TrpLeuTyrAsn SerGluAsnTyrLeu ThrLeu
130 135 190
Leu Asp AspGluAsp HisLysLeuGlu TyrLeuLysIleGln AspGlu
145 150 155 160
Gln His LeuValIle GluValArgAsn LysAspMetSerTrp ProGlu
IS 165 170 175
Glu Met SerPheIle AlaAsnSerSer LysIleAspArgHis LysVal
180 185 190
Pro Thr GluLysGly AlaThrGlyLeu SerAsnLeuGlyAsn ThrCys
195 200 205
Phe Met AsnSerSex IleGlnCysVal SerAsnThrGlnPro LeuThr
210 215 220
Gln Tyr PheIleSer GlyArgHisLeu TyrGluLeuAsnArg ThrAsn
225 230 235 240
Pro Ile GlyMetLys GlyHisMetAla LysCysTyrG.lyAsp LeuVal
295 250 255
Gln Glu LeuTrpSer GlyThrGlnLys AsnValAlaProLeu LysLeu
260 265 270
Arg Trp ThrIleAla LysTyrAlaPro ArgPheAsnGlyPhe GlnGln
275 280 285
Gln Asp SerGlnGlu LeuLeuAlaPhe LeuLeuAspGlyLeu HisGlu
290 295 300
Asp Leu AsnArgVal HisGluLysPro TyrValGluLeuLys AspSer
305 310 315 320
Asp Gly ArgProAsp TrpGluValAla AlaGluAlaTrpAsp AsnHis
325 330 335
Leu Arg ArgAsnArg SerIleValVal AspLeuPheHisGly GlnLeu
340 395 350
Arg Ser GlnValLys CysLysThrCys GlyHisIleSerVal ArgPhe
355 360 365
Asp Pro PheAsnPhe LeuSerLeuPro LeuProMetAspSer TyrMet
370 375 380
His Leu GluIleThr ValIleLysLeu AspGlyThrThrPro ValArg
385 390 395 400
Tyr Gly LeuArgLeu AsnMetAspGlu LysTyrThrGlyLeu LysLys
4 910 915
0
5
Gln Leu SerAspLeu CysGlyLeuAsn SerGluGlnIleLeu LeuAla
420 425 430
Glu Val HisGlySer AsnIleLysAsn PheProGlnAsp ProLys
Asn
935 440 945
Ser Thr GluLeuLeu SerGluValGly PhePheGlyValPro
450 455 960
<210> 19
<211> 293
<212> PRT
<213> Homo sapiens
<400> 19
Pro Thr Trp Leu Glu Arg Gly Gly Gly Glu Pro Ala Ala Arg Pro Gln
1 5 10 15
Thr Pro Gln Pro Thr Ala Pro Glu Ser Arg Gly Pro Ser Gly Ala Ser
20 25 30
Ala Leu Arg Cys Arg Gly Pro Thr Ala Arg Ser Leu Pro Ala Ala Ser
35 40 45
Met Leu Gly Ala Pro Asp Glu Ser Ser Val Arg Val Ala Val Arg Ile
50 55 60
Arg Pro Gln Leu Ala Lys Glu Lys Ile Glu Gly Cys His Ile Cys Thr
CA 02344995 2001-04-04
WO 00/20587 PCT/IJS99/22873
13
65 70 75 80
Ser ValThrPro GlyGluProGln ValPheLeuGly LysAspLysAla
85 90 95
Phe ThrPheAsp TyrValPheAsp IleAspSerGln GlnGluGlnIle
100 105 110
Tyr IleGlnCys IleGluLysLeu IleGluGlyCys PheGluGlyTyr
115 120 125
Asn AlaThrVal PheAlaTyrGly GlnThrGlyAla GlyLysThrTyr
130 135 140
l0 Thr MetGlyThr GlyPheAspVal AsnIleValGlu GluGluLeuGly
145 150 155 160
Ile IleSerArg AlaValLysHis LeuPheLysSer :IleGluGluLys
165 170 175
Lys HisIleAla IleLysAsnGly LeuProAlaPro AspPheLysVal
15 180 185 190
Asn AlaGlnPhe LeuGluLeuTyr AsnGluGluVal LeuAspLeuPhe
195 200 205
Asp ThrThrArg AspIleAspAla LysSerLysLys SerAsnIleArg
210 215 220
20 Ile HisGluAsp SerThrGlyGly AsnLeuTyrCys GlyArgPheGln
225 230 235 2q0
His ValLeu
25 <210> 20
<211> 223
<212> PRT
<213> Homo sapiens
30 <400> 20
Gly AsnTyrArg ProSerLysLys ArgPheArgGlu GlyLysGluLys
1 5 10 15
Lys ArgGlyLys LysValTrpLeu ValLysArgIle IleGlnThrLeu
20 25 30
35 Thr LysArgArg LysLysLysArg ValPheArgLys GluLysProAsn
35 90 45
Glu LeuGluVal GluGluSerGln GluValSerAsp HisGluAspGlu
50 55 60
Glu GluGluGlu GluGluGluGlu AspAspIleAsp GlyGlyGluSer
40 65 70 75 80
Ser AspGluSer AspSerGluSer AspGluLysAla TyrGlnAlaAsp
85 90 95
Leu AlaAsnIle ThrCysGluIle AlaIleLysGln LysLeuIleAsp
100 105 110
45 Glu LeuGluAsn SerGlnLysArg LeuGlnThrLeu LysLysGlnTyr
115 120 125
Glu GluLysMet MetLeuGlnHis LysIleArgAsp ThrGlnLeuGlu
130 135 190
Arg AspGlnVal LeuGlnAsnLeu GlySerValGlu SerTyrSerGlu
50 145 150 155 160
Glu LysAlaLys LysValArgSer GluTyrGluLys LysLeuGlnAla
165 170 175
Met AsnLysGlu LeuGlnArgLeu GlnAlaAlaGln LysGluHisAla
180 185 190
55 Arg LeuLeuLys AsnGlnSerGln TyrGluLysLeu LysLysLeuGln
195 200 205
Gln AspValMet GluMetLysLys ThrLysValArg LeuMetLys
210 215 220
60 <210> 21
<211> 206
<212> PRT
<213> Homo sapiens
65 <400> 21
Met Asn Lys Pro Ile Thr Pro Ser Thr Tyr Val Arg Cys Leu Asn Val
1 5 10 15
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
14
Gly Leu Ile Arg Lys Leu Ser Phe Ile Pro Gln Glu Gly
Asp Asp Trp
20 25 30
Lys Lys Leu Ala Val Ala Ile Lys Pro Gly Asp Asp Arg
Lys Ser Tyr
35 40 45
Asn Gln Phe His Ile Arg Arg Glu Ala Leu Gln Thr Gly
Phe Leu Lys
50 55 60
Ser Pro Thr Ser Glu Leu Leu Asp Trp Thr Thr Asn Cys
Phe Gly Thr
65 70 75 80
Val Gly Asp Leu Val Asp Leu Ile Gln Glu Phe Phe Ala
Leu Asn Pro
85 90 95
Ala Ser Leu Leu Leu Pro Asp Val Pro Thr Ala Asn Thr
Ala Lys Leu
100 105 110
Pro Ser Lys Glu Ala Ile Thr Gln Gln Gln Met Pro Phe
Val Lys Cys
115 120 125
Asp Lys Asp Arg Thr Leu Met Pro Val Asn heu Glu Gln
Thr Gln Ser
130 135 140
Tyr Met Pro Pro Asp Ser Ser Pro Glu Lys Ser Leu Glu
Ser Asn Val
145 150 155 160
Ser Asp Thr Arg Phe His Ser Ser Phe Glu Leu Lys Asn
Phe Tyr Val
165 170 175
Thr Asn Asn Phe Asp Glu Arg Ile Ser Gly Gly Asn Lys
Pro Val Met
180 185 190
Gly Glu Gly Gly Phe Gly Val Tyr Lys Leu Arg Lys
Val Gly
195 200 205
<210> 22
<211> 1260
<212> DNA
<213> Homo sapiens
<400> 22
cttctccgca cgactgttac agaggtctccagagccttctctctcctgtg caaaatggca60
actcttaagg aaaaactcat tgcaccagttgcggaagaagaggcaacagt tccaaacaat120
aagatcactg tagtgggtgt tggacaagttggtatggcgtgtgctatcag cattctggga180
aagtctctgg ctgatgaact tgctcagatgttttggaagataagct taaaggagaa290
tgtg
atgatggatc tgcagcatgg gagcttatttcttcagacacctaaaattgt ggcagataaa300
gattattctg tgaccgccaa ttctaagattgtagtggtaactgcaggagt ccgtcagcaa360
gaaggggaga gtcggctcaa tctggtgcagagaaatgttaatgtcttcaa attcattatt420
cctcagatcg tcaagtacag tcctgattgcatcataattgtggtttccaa cccagtggac480
attcttacgt atgttacctg gaaactaagtggattacccaaacaccgcgt gattggaagt540
ggatgtaatc tggattctgc tagatttcgctaccttatggctgaaaaact tggcattcat600
cccagcagct gccatggatg gattttgggggaacatggcgactcaagtgt ggctgtgtgg660
agtggtgtga atgtggcagg tgtttctctccaggaattgaatccagaaat gggaactgac720
aatgatagtg aaaattggaa ggaagtgcataagatggtggttgaaagtgc ctatgaagtc780
atcaagctaa aaggatatac caactgggctattggattaagtgtggctga tcttattgaa890
tccatgttga aaaatctatc caggattcatcccgtgtcaacaatggtaaa ggggatgtat900
ggcattgaga atgaagtctt cctgagccttccatgtatcctcaatgcccg gggattaacc960
agcgttatca accagaagct aaaggatgatgaggttgctcagctcaagaa aagtgcagat1020
accctgtggg acatccagaa ggacctaaaagacctgtgactagtgagctc taggctgtag1080
aaatttaaaa actacaatgt gattaactcgagcctttagttttcatccat gtacatggat1190
cacagtttgc tttgatcttc ttcaatatgtgaatttgggctcacagaatc aaagcctatg1200
cttggtttaa tgcttgcaat ctgagctcttgaacaaataaaattaactat tgtagtgtga1260
<210> 23
<211> 3151
<212> DNA
<213> Homo spaiens
<900> 23
taacacagtt gtgaaaagag atggatgtgg gttccagtcc tagccctgcc tgtgtgcact 60
tatgcagaaa cgctaatgga ctccactaca gcgactgctg agctgggctg gatggtgcat 120
cctccatcag ggtgggaaga ggtgagtggc tacgatgaga acatgaacac gatccgcacg 180
taccaggtgt gcaacgtgtt tgagtcaagc cagaacaact ggctacggac caagtttatc 240
cggcgccgtg gcgcccaccg catccacgtg gagatgaagt tttcggtgcg tgactgcagc 300
agcatcccca gcgtgcctgg ctcctgcaag gagaccttca acctctatta ctatgaggct 360
gactttgact cggccaccaa gaccttcccc aactggatgg agaatccatg ggtgaaggtg 920
gataccattg cagccgacga gagcttctcc caggtggacc tgggtgaccg cgtcatgaaa 980
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
atcaacaccg aggtgcggag cttcggacct gtgtcccgca gcggcttcta 540
cctggccttc
caggactatg gcggctgcat gtccctcatc gccgtgcgtg tcttctaccg 600
caagtgcccc
cgcatcatcc agaatggcgc catcttccag gaaaccctgt cgggggctga 660
gagcacatcg
t
c 720
S ggtggctg cccggggcag ctgcatcgcc aatgcggaag aggtggatgt acccatcaag
ctctactgta acggggacgg cgagtggctg gtgcccatcg ggcgctgcat 780
gtgcaaagca
ggcttcgagg ccgttgagaa tggcaccgtc tgccgaggtt gtccatctgg 840
gactttcaag
gccaaccaag gggatgaggc ctgtacccac tgtcccatca acagccggac 900
cacttctgaa
ggggccacca actgtgtctg ccgcaatggc tactacagag cagacctgga 960
ccccctggac
atgccctgca caaccatccc ctccgcgccc caggctgtga tttccagtgt 1020
10 caatgagacc
tccctcatgc tggagtggac ccctccccgc gactccggag gccgagagga 1080
cctcgtctac
aacatcatct gcaagagctg tggctcgggc cggggtgcct gcacccgctg 1190
cggggacaat
gtacagtacg caccacgcca gctaggcctg accgagccac gcatttacat 1200
cagtgacctg
ctggcccaca cccagtacac cttcgagatc caggctgtga acggcgttac 1260
tgaccagagc
cccttctcgc ctcagttcgc ctctgtgaac atcaccacca accaggcagc 1320
IS tccatcggca
gtgtccatca tgcatcaggt gagccgcacc gtggacagca ttaccctgtc 1380
gtggtcccag
ccagaccagc ccaatggcgt gatcctggac tatgagctgc agtar_tatga 1940
gaagcaggag
ctcagtgagt acaacgccac agccataaaa agccccacca acacggtcac 1500
cgtgcagggc
ctcaaagccg gcgccatcta tgtcttccag gtgcgggcac gcacc:gtggc 1560
aggctacggg
cgctacagcg gcaagatgta cttccagacc atgacagaag ccgat:tacca 1620
gacaagcatc
caggagaagt tgccactcat catcggctcc tcggccgctg gcctggtctt 1680
cctcattgct
gtggttgtca tcgccatcgt gtgtaacaga cgggggtttg agcgtgctga 1790
ctcggagtac
acggacaagc tgcaacacta caccagtggc cacatgaccc caggc:atgaa 1800
gatctacatc
gatcctttca cctacgagga ccccaacgag gcagtgcggg agtttgccaa 1860
ggaaattgac
atctcctgtg tcaaaattga gcaggtgatc ggagcagggg agttt.ggcga 1920
2S ggtctgcagt
ggccacctga agctgccagg caagagagag atctttgtgg ccatcaagac 1980
gctcaagtcg
ggctacacgg agaagcagcg ccgggacttc ctgagcgaag cctccatcat 2090
gggccagttc
gaccatccca acgtcatcca cctggagggt gtcgtgacca agagcacacc 2100
tgtgatgatc
atcaccgagt tcatggagaa tggctccctg gactcctttc tccggcaaaa 2160
cgatgggcag
ttcacagtca tccagctggt gggcatgctt cggggcatcg cagctggcat 2220
gaagtacctg
gcagacatga actatgttca ccgtgacctg gctgcccgca acatcctcgt 2280
caacagcaac
ctggtctgca aggtgtcgga ctttgggctc tcacgctttc tagaggacga 2340
tacctcagac
cccacctaca ccagtgccct gggcggaaag atccccatcc gctggacagc 2400
cccggaagcc
atccagtacc ggaagttcac ctcggccagt gatgtgtgga gctacggcat 2460
tgtcatgtgg
gaggtgatgt cctatgggga gcggccctac tgggacatga ccaaccagga 2520
tgtaatcaat
gccattgagc aggactatcg gctgccaccg cccatggact gcccagctgc 2580
cctgcaccaa
ctcatgctgg actgttggca gaaggaccgc aaccaccggc ccaagttcgg 2690
ccaaattgtc
aacacgctag acaagatgat ccgcaatccc aacagcctca aagccatggc 2700
gcccctctcc
tctggcatca acctgccgct gctggaccgc acgatccccg actacaccag 2760
ctttaacacg
gtggacgagt ggctgaaggc catcaagatg gggcagtaca aggagagctt 2820
cgccaatgcc
ggcttcacct cctttgacgt cgtgtctcag atgatgatgg aggacattct 2880
ccgggttggg
gtcactttgg ctggccacca gaaaaaaatc ctgaacagta tccaggtgat 2940
gcgggcgcag
atgaaccaga ttcagtctgt ggaggtttga cattcacctg cctcggctca 3000
cctcttcctc
caagccccgc cccctctgcc ccacgtgccg gccctcctgg tgctctatcc 3060
actgcagggc
cagccactcg ccaggaggcc acgggcacgg gaagaaccaa gcggtg ccag 3120
4S ccacgagacg
t
caccaagaa aacatgcaac tcaaacgacg g 3151
<210> 29
<211> 1234
<212> DNA
<213> Homo Sapiens
<400> 29
tagttcaaga caacagagac aaagctaaga tgaggaagtt ctgtacagtt 60
taggaaatag
aggctttcaa agataattcg cagtgatgtg aaactggcct cccaagccct 120
gataacaaca
tggccaacgc cctggccagc gccacttgcg agcgctgcaa gggcggcttt 180
gcgcccgctg
agaagatcgt gaacagtaat ggggagctgt accatgagca gtgtttcgtg 240
tgcgctcagt
gcttccagca gttcccagaa ggactcttct atgagtttga aggaagaaag 300
tactgtgaac
atgactttca gatgctcttt gccccttgct gtcatcagtg tggtgaattc 360
atcattggcc
gagttatcaa agccatgaat aacagctggc atccggagtg cttccgctgt 420
gacctctgcc
aggaagttct ggcagatatc gggtttgtca agaatgctgg gagacacctg 480
tgtcgcccct
gtcataatcg tgagaaagcc agaggccttg ggaaatacat ctgccagaaa 590
tgccatgcta
tcatcgatga gcagcctctg atattcaaga acgaccccta ccatccagac 600
catttcaact
gcgccaactg cgggaaggag ctgactgccg atgcacggga gctgaaaggg 660
gagctatact
gcctcccatg ccatgataaa atgggggtcc ccatctgtgg tgcttgccga 720
cggcccatcg
6S aagggcgcgt ggtgaacgct atgggcaagc agtggcatgt ggagcatttt 780
gtttgtgcca
agtgtgagaa accctttctt ggacatcgcc attatgagag gaaaggcctg 890
gcatattgtg
aaactcacta taaccagcta tttggtgatg tttgcttcca ctgcaatcgt 900
gttatagaag
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
16
gtgatgtggtctctgctcttaataaggcctggtgcgtgaactgctttgcctgttctacct 960
gcaacactaaattaacactcaagaataagtttgtggagtttgac:atgaagccagtctgta 1020
agaagtgctatgagatttccattggagctgaagaaaagacttaagaaactagctgagacc 1080
ttaggaaggaaataagttcctttattttttcttttctatgcaagataagagattaccaac 1190
attacttgtcttgatctacccatatttaaagctatatctcaaagcagttgagagaagagg 1200
acctatatgaatggttttatgtcatttttttaaa
1239
<210> 25
<211> 4539
<212> DNA
<213> Homo Sapiens
<400> 25
gtcacgagcg aaagccgcgtcagggggcccggccggggcgggggagcccg60
tcgaagagac
gggcttgttggtgccccagcccgcgcggagggcccttcggacccgcgcgccgccgctgcc120
gccgccgccgcctcgcaacaggtccgggcggcctcgctctccgctcccctcccccgcatc180
cgcgaccctccggggcacctcagctcggccggggccgcagtctggccacccgcttccatg290
cggttcgggtccaagatgatgccgatgtttcttaccgtgtatctcagtaacaatgagcag300
cacttcacagaagttccagttactccagaaacaatatgcagagacgtggtggatctgtgc360
aaagaacccggcgagagtgattgccatttggctgaagtgtggtgtggctctgtagagata420
gagtttcatcatgttggccaggatggtctcgatctcctgaccttgtgatccgcctgcctc480
ggcctcccaaagtgctggattacaggtgtgagccaccacgatcagcctctagtgtttaaa590
aaagaacgtccagttgcggataatgagcgaatgtttgatgttcttcaacgatttggaagt600
cagaggaacgaagttcgcttcttccttcgtcatgaacgcccccctggcagggacattgtg660
agtggaccaagatctcaggatccaagtttaaaaagaaatggtgtaaaagttcctggtgaa720
tatcgaagaaaggagaacggtgttaatagtcctaggatggatctgactcttgctgaactt780
caggaaatggcatctcgccagcagcaacagattgaagcccagcaacaattgctggcaact840
aaggaacagcgcttaaagtttttgaaacaacaagatcagcgacaacagcaacaagttgct900
gagcaggagaaacttaaaaggctaaaagaaatagctgagaatcaggaagctaagctaaaa960
aaagtgagagcacttaaaggccacgtggaacagaagagactaagc:aatgggaaacttgtg1020
gaggaaattgaacagatgaataatttgttccagcaaaaacagagggagctcgtcctggct1080
gtgtcaaaagtagaagaactgacc,sggcagctagagatgctcaagaacggcaggatcgac1140
agccaccatgacaatcagtctgcagtggctgagcttgatcgcctctataaggagctgcag1200
ctaagaaacaaattgaatcaagagcagaatgccaagctacaacaacagagggagtgtttg1260
aataagcgtaattcagaagtggcagtcatggataagcgtgttaatgagctgagggaccgg1320
ctgtggaagaagaaggcagctctacagcaaaaagaaaatctaccagtttcatctgatgga1380
aatcttccccagcaagccgcgtcagccccaagccgtgtggctgcagtaggtccctatatc1990
cagtcatctactatgcctcggatgccctcaaggcctgaattgctggtgaagccagccctg1500
ccggatggttccttggtcattcaggcttcagaggggccgatgaaaatacagacactgccc1560
aacatgagatctggggctgcttcacaaactaaaggctctaaaatccatccagttggccct1620
gattggagtccttcaaatgcagatcttttcccaagccaaggctctgcttctgtacctcaa1680
agcactgggaatgctctggatcaagttgatgatggagaggttccgctgagggagaaagag1740
aagaaagtgcgtccgttctcaatgtttgatgcagtagaccagtccaatgccccaccttcc1800
tttggtactctgaggaagaaccagagcagtgaagatatcttgcgggatgctcaggttgca1860
aataaaaatgtggctaaagtaccacctcctgttcctacaaaaccaaaacagattaatttg1920
ccttattttggacaaactaatcagccaccttcagacattaagccagacggaagttctcag1980
cagttgtcaacagttgttccgtccatgggaactaaaccaaaaccagcagggcagcagccg2040
agagtgctgctatctcccagcataccttcggttggccaagaccagaccctttctccaggt2100
tctaagcaagaaagtccacctgctgctgccgtccggccctttactccccagccttccaaa2160
gacaccttacttccacccttcagaaaaccccagaccgtggcagcaagttcaatatattcc2220
atgtatacgcaacagcaggcgccaggaaaaaacttccagcaggctgtgcagagcgcgttg2280
accaagactcataccagagggccacacttttcaagtgtatatggtaagcctgtaattgct2390
gctgcccagaatcaacagcagcacccagagaacatttattccaatagccagggcaagcct2900
ggcagtccagaacctgaaacagagcctgtttcttcagttcaggagaaccatgaaaacgaa2960
agaattcctcggccactcagcccaactaaattactgcctttcttatctaatccttaccga2520
aaccagagtgatgctgacctagaagccttacgaaagaaactgtctaacgcaccaaggcct2580
ctaaagaaacgtagttctattacagagccagagggtcctaatgggccaaatattcagaag2690
cttttatatcagaggaccaccatagcggccatggagaccatctctgtcccatcataccca2700
tccaagtcagcttctgtgactgccagctcagaaagcccagtagaaatccagaatccatat2760
ttacatgtggagcccgaaaaggaggtggtctctctggttcctgaatcattgtccccagag2820
gatgtggggaatgccagtacagagaacagtgacatgccagctccttctccaggccttgat2880
tatgagcctgagggagtcccagacaacagcccaaatctccagaataacccagaagaacca2940
aatccagaggctccacatgtgcttgatgtgtacctggaggagtaccctccatacccaccc3000
ccaccatacccatctggggagcctgaagggcccggagaagactcggtgagcatgcgcccg3060
cctgaaatcaccgggcaggtctctctgcctcctggtaaaaggacaaacttgcgtaaaact3120
ggctcagagcgtatcgctcatggaatgagggtgaaattcaacccccatgctttactgcta3180
gattcgtctttggagggagaatttgaccttgtacagagaattattt=atgaggttgatgac3290
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
17
ccaagcctgc ccaatgatgaaggcatcacggctcttcacaatgctgtgtgtgcaggccac3300
acagaaatcg ttaagttcctggtacagtttggtgtaaatgtaaatgctgctgatagtgat3360
ggatggactc cattacattgtgctgcctcatgtaacaacgtccaagtgtgtaagtttttg3420
gtggagtcag gagccgctgtgtttgccatgacctacagtgacatgcagactgctgcagat3480
aagtgcgagg aaatggaggaaggctacactcagtgctcccaatttctttatggagttcag3540
gagaagatgg gcataatgaataaaggagtcatttatgcgctttgggattatgaacctcag3600
aatgatgatg agctgcccatgaaagaaggagactgcatgacaatcatccacagggaagac3660
gaagatgaaa tcgaatggtggtgggcgcgccttaatgataaggagggatatgttccacgt3720
aacttgctgg gactgtacccaagaattaaaccaagacaaaggag<a ctgaaacttc3780
tggc
cacacagaat tttagtcaatgaagaattaatctctgttaagaagaagtaatacgattatt3840
tttggcaaaa atttcacaagacttattttaatgacaatgtagcttgaaagcgatgaagaa3900
tgtctctaga agagaatgaaggattgaagaattcaccattagaggacatttagcgtgatg3960
aaataaagca tctacgtcagcaggccatactgtgttggggcaaaggtgtcccgtgtagca4020
ctcagataag tatacagcgacaatcctgttttctacaagaatcctgtctagtaaatagga9080
tcatttattgggcagttgggaaatcagctctctgtcctgttgagtgttttcagcagctgc9190
tcctaaacca gtcctcctgccagaaaggaccagtgccgtcacatcgctgtctctgattgt9200
ccccggcacc agcaggccttggggctcactg~aggctcgaaggcactgcacaccttgtat9260
attgtcagtg aagaacgttagttggttgtcagtgaacaataactttattatatgagtttt9320
tgtagcatct taagaattatacatatgtttgaaatattgaaactaagctacagtaccagt4380
aattagatgt agaatcttgtttgtaggctgaattttaatctgtatttattgtcttttgta4990
tctcagaaat tagaaacttgctacagacttacccgtaatatttgtcaagatcatagctga4500
ctttaaaaac agttgtaataaactttttgatgct 9534
<210> 26
<211> 4660
<212> DNA
<213> Homo Sapiens
<400> 26
ggggcttagaaattaacaggttgtttatataattggccttaaatgaggtgagagtgaaga60
gactagagccatctctggaaaacatcattatcccattccccgggaagctaccctctggaa120
ctcaagatttgaccatatctgttttgaggattcattatgaacaaagaagtctcccaggtg180
tgaagtttttcaacatgagtggcctcggggacagttcatccgaccctgctaacccagact240
cacataagaggaaaggatcgccatgtgacacactggcatcaagcacggaaaagaggcgca300
gggagcaagaaaataaatatttagaagaactagctgagttactgtctgccaacattagtg360
acattgacagcttgagtgtaaaaccagacaaatgcaagattttga;sgaaaacagtcgatc420
agatacagctaatgaagagaatggaacaagagaaatcaacaactgatgacgatgtacaga480
aatcagacatctcatcaagtagtcaaggagtgatagaaaaggaatccttgggaccccttc590
ttttggaggctttggatggatttttctttgttgtgaactgtgaagggagaattgtatttg600
tgtcagagaatgtaaccagctacttaggttacaatcaggaggaattaatgaataccagcg660
tctacagcatactgcacgtgggggatcatgcagaatttgtgaagaatctgctaccaaaat720
cactagtaaatggagttcct.tggcctcaagaggcaacacgacgaaatagccataccttta780
actgcaggatgctaattcaccctccagatgagccagggaccgagaaccaagaagcttgcc840
agcgttatgaagtaatgcagtgtttcactgtgtcacagccaaaatcaattcaagaggatg900
gagaagatttccagtcatgtctgatttgtattgcacggcgattac<a cctccagcta960
cgg
ttacgggtgtagaatcctttatgaccaagcaagatactacaggtaaaatcatctctattg1020
atactagttccctgagagctgctggcagaactggttgggaagatttagtgaggaagtgca1080
tttatgcttttttccaacctcagggcagagaaccatcttatgccagacagctgttccaag1140
aagtgatgactcgtggcactgcctccagcccctcctatagattcatattgaatgatggga1200
caatgcttagcgcccacaccaagtgtaaactttgctaccctcaaagtccagacatgcaac1260
ctttcatcatgggaattcatatcatcgacagggagcacagtgggctttctcctcaagatg1320
acactaattctggaatgtcaattccccgagtaaatccctcggtcaatcctagtatctctc1380
cagctcatggtgtggctcgttcatccacattgccaccatccaacagcaacatggtatcca1940
ccagaataaaccgccagcagagctcagaccttcatagcagcagtcatagtaattctagca1500
acagccaaggaagtttcggatgctcacccggaagtcagattgtagc:caatgttgccttaa1560
accaaggacaggccagttcacagagcagtaatccctctttaaacct.caataattctccta1620
tggaaggtacaggaatatccctagcacagttcatgtctccaaggagacaggttacttctg1680
gattggcaacaaggcccaggatgccaaacaattcctttcctcctaatatttcgacattaa1740
gctctcccgttggcatgacaagtagtgcctgtaataataataaccgatcttattcaaaca1800
tcccagtaacatctttacagggtatgaatgaaggacccaataactccgttggcttctctg1860
ccagttctccagtcctcaggcagatgagctcacagaattcacctagcagattaaatatac1920
aaccagcaaaagctgagtccaaagataacaaagagattgcctcaattttaaatgaaatga1980
ttcaatctgacaacagctctagtgatggcaaacctctggattcagggcttctgcataaca2090
atgacagactttcagatggagacagtaaatactctcaaaccagtcacaaactagtgcagc2100
ttttgacaacaactgccgaacagcagttacggcatgctgatatagacacaagctgcaaag2160
atgtcctgtcttgcacaggcacttccaactctgcctctgctaactcttcaggaggttctt2220
gtccctcttctcatagctcattgacagaacggcataaaattctacaccggctcttacagg2280
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
18
agggtagccc ctcagatatc accactttgt ctgtcgagcc tgataaaaag 2340
gacagtgcat
ctacttctgt gtcagtgact ggacaggtac aaggaaactc cagtataaaa 2900
ctagaactgg
atgcttcaaa gaaaaaagaa tcaaaagacc atcagctcct acgctatctt 2960
ttagataaag
atgagaaaga tttaagatca actccaaacc tgagcctgga tgatgtaaag 2520
gtgaaagtgg
aaaagaaaga acagatggat ccatgtaata caaacccaac cccaatgacc 2580
aaacccactc
ctgaggaaat aaaactggag gcccagagcc agtttacagc tgaccttgac 2640
cagtttgatc
agttactgcc cacgctggag aaggcagcac agttgccagg cttatgtgag 2700
acagacagga
tggatggtgc ggtcaccagt gtaaccatca aatcggagat cctgccagct 2760
tcacttcagt
ccgccactgc cagacccact tccaggctaa atagattacc tgagctggaa 2820
ttggaagcaa
l0 ttgataacca atttggacaa ccaggaacag gcgatcagat tccatggaca 2880
aataatacag
tgacagctat aaatcagagt aaatcagaag accagtgtat tagctcacaa 2940
ttagatgagc
ttctctgtcc acccacaaca gtagaaggga gaaatgatga gaaggctctt 3000
cttgaacagc
tggtatcctt ccttagtggc aaagatgaaa ctgagctagc tgaactagac 3060
agagctctgg
gaattgacaa acttgttcag gggggtggat tagatgtatt atcagagaga 3120
tttccaccac
IS aacaagcaac gccacctttg atcatggaag aaagacccaa cctttattcc 3180
cagccttact
cttctccttc tcctactgcc aatctcccta gccctttcca aggc<itggtc 3240
aggcaaaaac
cttcactggg gacgatgcct gttcaagtaa cacctccccg aggt<~ctttt 3300
tcacctggca
tgggcatgca gcccaggcaa actctaaaca gacctccggc tgcac:ctaac 3360
cagcttcgac
ttcaactaca gcagcgatta cagggacaac agcagttgat acacc:aaaat 3420
cggcaagcta
20 tcttaaacca gtttgcagca actgctcctg ttggcatcaa tatgagatca 3480
ggcatgcaac
agcaaattac acctcagcca cccctgaatg ctcaaatgtt ggcac:aacgt 3590
cagcgggaac
tgtacagtca acagcaccga cagaggcagc taatacagca gcaaagagcc 3600
atgcttatga
ggcagcaaag ctttgggaac aacctccctc cctcatctgg actac:cagtt 3660
caaatgggga
acccccgtct tcctcagggt gctccacagc aattccccta tccac:caaac 3720
tatggtacaa
25 atccaggaac cccacctgct tctaccagcc cgttttcaca actagcagca 3780
aatcctgaag
catccttggc caaccgcaac agcatggtga gcagaggcat gacaggaaac 3890
ataggaggac
agtttggcac tggaatcaat cctcagatgc agcagaatgt cttccagtat 3900
ccaggagcag
gaatggttcc ccaaggtgag gccaactttg ctccatctct aagccctggg 3960
agctccatgg
tgccgatgcc aatccctcct cctcagagtt ctctgctcca gcaaactcca 4020
cctgcctccg
30 ggtatcagtc accagacatg aaggcctggc agcaaggagc gataggaaac 4080
aacaatgtgt
tcagtcaagc tgtccagaac cagcccacgc ctgcacagcc aggagtatac 9190
aacaacatga
gcatcaccgt ttccatggca ggtggaaata cgaatgttca gaacatgaac 9200
ccaatgatgg
cccagatgca gatgagctct ttgcagatgc caggaatgaa cactgtgtgc 9260
cctgagcaga
taaatgatcc cgcactgaga cacacaggcc tctactgcaa ccagctctca 9320
tccactgacc
35 ttctcaaaac agaagcagat ggaacccagg tgcaacaggt tcaggtgttt 4380
gctgacgtcc
agtgtacagt gaatctggta ggcggggacc cttacctgaa ccagcctggt 4490
ccactgggaa
ctcaaaagcc cacgtcagga ccacagaccc cccaggccca gcagaagagc 4500
ctccttcagc
agctactgac tgaataacca ctttr_aaagg aatgtgaaat ttaaataata 4560
gacatacaga
gatatacaaa tatattatat atttttctga gatttttgat atctcaatct 9620
gcagccattc
40 ttcaggtcgt agcatttgga gcaaaaaaaa aaaaaaaaaa 9660
<210> 27
<211> 6773
<212> DNA
45 <213> Homo sapiens
<400> 27
gcggctggtt cgggccggc ggcgggctgg cggagatgga ggatcttgtt 60
g caagatgggg
tggcttcacc gctacccct gggaccggga aatctaagaa ttggagaaag 120
a aaattgaaga
50 actcagatca aacctgtta ctgaaggaac tggtgatatt attaaggcat 180
a taactgaacg
tctggatgct ttcttctgg aaaaagcaga gactgagcaa cagtgtcttt 240
c ctctgaaaaa
ggaaaatata 300
aaaatgaagc
aagaggttga
ggattctgta
acaaagatgg
gagatgcaca
taaggagttg 360
gaacaatcac
atataaacta
tgtgaaagaa
attgaaaatt
tgaaaaatga
gttgatggca 420
gtacgttcca
aatacagtga
agacaaagct
aacttacaaa
agcagctgga
55 agaagcaatg 480
aatacgcaat
tagaactttc
agaacaactt
aaatttcaga
acaactctga
agataatgtt 540
aaaaaactac
aagaagagat
tgagaaaatt
aggccaggct
ttgaggagca
aattttatat 600
ctgcaaaagc
aattagacgc
taccactgat
gaaaagaagg
aaacagttac
tcaactccaa 660
aatatcattg
aggctaattc
tcagcattac
caaaaaaata
ttaatagttt
gcaggaagag 720
cttttacagt
tgaaagctat
acaccaagaa
gaggtgaaag
agttgatgtg
60 ccagattgaa 780
gcatcagcta
aggaacatga
agcagagata
aataagttga
acgagctaaa
agagaactta 840
gtaaaacaat
gtgaggcaag
tgaaaagaac
atccagaaga
aatatgaatg
tgagttagaa 900
aatttaagga
aagccacctc
aaatgcaaac
caagacaatc
agatatgttc
tattctcttg 960
caagaaaata
catttgtaga
acaagtagta
aatgaa<~aag
tcaaacactt
agaagatacc 1020
ttaaaagaac
ttgaatctca
acacagtatc
ttaaaagatg
aggtaactta
65 tatgaataat 1080
cttaagttaa
aacttgaaat
ggatgctcaa
catataaagg
atgagttttt
tcatgaacgg 1140
gaagacttag
agtttaaaat
taatgaatta
ttactagcta
aagaagaaca
gggctgtgta 1200
attgaaaaat
taaaatctga
gctagcaggt
ttaaataaac
agttttgcta
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
19
tactgtagaacagcataaca 1260
gagaagtaca
gagtcttaag
gaacaacatc
aaaaagaaat
atcagaactaaatgagacat 1320
ttttgtcaga
ttcagaaaaa
gaaaaattaa
cattaatgtt
tgaaatacagggtcttaagg 1380
aacagtgtga
aaacctacag
caagaaaagc
aagaagcaat
tttaaattatgagagtttac ggaaatttta 1990
gagagattat caaacagaac
tgggggaatc
tgctggaaaaataagtcaag cagcaagcatctgatgttca1500
agttcgaatc
aatgaagcaa
tgaactgcagcagaagctcagaactgcttttactgaaaaagatgcccttctcgaaactgt1560
gaatcgcctccagggagaaaatgaaaagttactatctcaacaagaattggtaccagaact1620
tgaaaataccataaagaaccttcaagaaaagaatggagtatacttacttagtctcagtca1680
aagagataccatgttaaaagaattagaaggaaagataaattctcttactgaggaaaaaga1740
tgattttataaataaactgaaaaatt.cccatgaagaaatggataatttccataagaaatg1800
tgaaagggaagaaagattgattcttgaacttgggaagaaagtagagcaaacaatccagta1860
caacagtgaactagaacaaaaggtaaatgaattaacaggaggactagaggagactttaaa1920
agaaaaggatcaaaatgaccaaaaactagaaaaacttatggttcaaatgaaagttctctc1980
tgaagacaaagaagtattgtcagctgaagtgaagtctctttatgaggaaaacaataaact2040
cagttcagaaaaaaaacagttgagtagggatttggaggtttttttgtctcaaaaagaaga2100
tgttatccttaaagaacatattactcaattagaaaagaaacttcagttaatggttgaaga2160
gcaagataatttaaataaactgcttgaaaatgagcaagttcagaagttatttgttaaaac2220
tcagttgtatggttttcttaaagaaatgggatcagaagtttcagaagacagtgaagagaa2280
agatgttgttaatgtcctacaggcagtcggtgaatccttggcaaaaataaatgaggaaaa2340
atgcaacctggcttttcagcgtgatgaaaaagtattagagttagaaa agattaagtg2400
aag
ccttcaagaagagagtgtagttcagtgtgaagaacttaagtctttattgagagactatga2960
gcaagagaaagttctcttaaggaaagagttagaagaaatacagtcagaaaaagaggccct2520
gcagtctgatcttctagaaatgaagaatgctaatgaaaaaacaaggcttgaaaatcagaa2580
tcttttaattcaagttgaagaagtatctcaaacatgtagcaaaagtgaaatccataatga2690
aaaagaaaaatgttttataaaggaacatgaaaacctaaagccactactagaacaaaaaga2700
attacgagataggagagcagagttgatactattaaaggattccttagcaaaatcaccttc2760
tgtaaaaaatgatcctctgtcttcagtaaaagagttggaagaaaaaatagaaaatctgga2820
aaaagaatgcaaagaaaaggaggagaaaataaataagataaaattagttgccgtaaaggc2880
aaagaaagaactagattccagcagaaaagagacccagactgtgaaggaagaacttgaatc2990
tcttcgatc gaaaaggacca ttccatgagagatctcattcaaggagcaga3000
agttatctgc
aagctataag.aatcttttattagaatatgaaaagcagtcagagcaac:tggatgtggaaaa3060
agaacgtgctaataattttgagcatcgtattgaagaccttacaagacaattaagaaattc3120
gactttgcagtgtgaaacaataaattctgataatgaagatctcctggctcgtattgagac3180
attacagtctaatgccaaattattagaagtacagattttagaagtcc:agagagccaaagc3290
aatggtagacaaagaattagaagctgaaaaacttcagaaagaacagaagataaaggaaca3300
tgccactactgtaaatgaacttgaagaacttcaggtacaacttcaaaaggaaaagaaaca3360
gcttcagaaaaccatgcaagaattagagctggttaaaaaggatgccc:aacaaaccacatt3420
gatgaatatggaaatagctgattatgaacgtttgatgaaagaactaaatcaaaagttaac3480
taataaaaacaacaagatagaagatttggagcaagaaataaaaattcaaaaacagaaaca3540
agaaaccctacaagaagaaataacttcattacagtcttcagtacaacaatatgaagaaaa3600
aaacaccaaaatcaagcaattgcttgtgaaaaccaaaaaggaactggcagattcaaagca3660
agcagaaactgatcacttaatacttcaagcatctttaaaaggtgagctggaggcaagcca3720
gcagcaagtagaagtctataaaatacagctggctgaaataacatcagagaagcacaaaat3780
ccacgagcacctgaaaacctctgcggaacagcaccagcgtacgctaagtgcataccagca3840
gagagtgacagcactacaggaagagtgccgtgctgccaaggcagaacaagctactgtaac3900
ctctgaattcgagagctacaaagtccgagttcataatgttctaaaacaacagaaaaataa3960
atctatgtctcaggctgaaactgagggcgctaaacaagaaagggaacatctggaaatgct9020
gattgaccagctaaaaatcaaattacaagatagccaaaataacttacagattaatgtatc4080
tgaacttcaaacattgcagtctgaacatgatacactgctagaaaggcacaacaagatgct4140
gcaggaaactgtgtccaaagaggcggaactccgggaaaaattgtgttcaatacagtcaga4200
gaacatgatgatgaaatctgaacatacacagactgtgagtcagctaacatcccagaacga4260
ggtccttcgaaatagcttccgagatcaagtgcgacatttgcaggaagaacacagaaagac4320
agtggagacattacagcagcagctctccaagatggaagcacagctcttccagcttaagaa4380
tgaaccgaccacaagaagcccagtttcctctcaacaatctttgaagaaccttcgagaaag4440
gagaaacacagacctcccgcttctagacatgcacactgtaacccgggaagagggagaagg4500
catggagacaactgatacggagtctgtgtcttccgccagcacatacacacagtctttaga9560
gcagctgcttaactctcccgaaactaaacttgagcctccattatggcatgctgaatttac4620
caaagaagaattggttcagaagctcagttccaccacaaaaagtgcagatcacttaaacgg4680
cctgcttcgggaaacagaagcaaccaatgcaattcttatggagcaaattaagcttctcaa4740
aagtgaaataagaagattggaaaggaatcaagagcgagagaagtctgcagctaacctgga4800
atacttgaagaacgtcttgctgcagttcattttcttgaaaccaggtagtgaaagagagag4860
acttcttcctgttataaatacgatgttgcagctcagccctgaagaaaagggaaaacttgc4920
tgcggttgctcaaggtgaggaagaaaatgcttcccgttcttctggatgggcatcctatct4980
tcatagttggtctggacttcgataggttgatggaaggaatatttttattaaccaaataga5090
atctatttacaaaaatggttcacgtatattaccacaattcttttgtcaaaaagtgtgtat5100
atatgtttgcatctacatatatttgtacatctatatgacagatgtattttaaaagtttca5160
tcttgaagtaaaagtacaacagcttgaagtgttgatagcaggccacagccctctaactca5220
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
tgtgatttcccatgcatgctgccagaataaaaccaccaggaatgaattcactccccactt5280
ctctggaacctcaggacccgcccatttctcggcagtactgtgaattttgaagttaaacta5340
aattttggtaccataccaactggaatttaggctttaaaaataatgtttcaaggccaggtg5400
tggtgattcatgcctgaaatcccactactttgggaggctgaggctggagaattgcttgag5960
5 gctagtgagctgtgactcccactgcactccagctcggggaacagagcgagaccttgtctc5520
taaaaataatagtaataaaataaaaataacgttttatgactatttattgcaaggtcagag5580
ttacagattgttataaattgttgagaaatttttgtgattagaatatgaaggaaaaagctt5640
tgttggtaaaagtgacatgttaaggggctatgaagtaaatatgctgcagttaattgtgct5700
aagttaaaatacagtttagttatttgctttaaaataaactcttctttttttctttaaagt5760
f0 atactatctcaaaactcattatgttgtcagagccctagagctggctagtgtaacactgac5820
tatgagtaggtgggcccaccacttgagttgaggtgatttcatggtgtctttccaggctct5880
tgatagggtgtcactgcatgcaagccatgaatctgttttgagaatcctctccattttccc5990
aaataaaaacctatcacaacagtgactatatcactcagcattggat=ctaaatataaaagt6000
ggtgctttcagtgtttttggcagatagtgttccataagctttccat:cagaagggatttta6060
l5 gacaccttagaggtccgtgctacatcgtcacagttcctccgaataaccttaggtggtagt6120
gttacttgcctttgacacctctgcatatgttttaatgactagatccaaactgtgttgttc6180
ttaaatcaaaaattggataatttgtaatatttatgtgttaatcacacagtatgctctctg6240
aagttctcttaagccttcagtttatactcttaatttaattttcttt;ctgagctggagaac6300
tggctttgcactttggttacacagaacattggtttccaattcagtt;taactgaaatttgc6360
20 tgctgatatgttgagtttgttctttaaaaaatagctcatatatctcatctttcctcctgt6420
cttagaagaacagacctaactagtgaatgtattaatgaaaatgcatctatttcagagctg6480
acatgaagagtttagtttttttactttataaactgtgaatatgagtatgccagctgcata6590
cgatgtaactaatcatatttaaatatatttcactttctctttgactttagaccttttgaa6600
gtctgtataaacttgttttgaaatatagtctctgcttacgaatgtcataacaaaataatt6660
ttttgcatgataaaaaattactttgattacaaaaggcgtattctttcatggtttctgcaa6720
tgagaggaagtgtaatgattattttaatatttctattaaatatgtttaactgt 6773
<210> 28
<211> 2619
<212> DNA
<213> Homo Sapiens
<400> 28
atggccacag cttgtaaaagatcaggagaacctcagtctgacgacattgaagctagccga 60
atgaagcgag cagctgcaaagcatctaatagaacgctactaccaccagttaactgagggc 120
tgtggaaatg aagcctgcacgaatgagttttgtgcttcctgtccaacttttcttcgtatg 180
gataataatg cagcagctattaaagccctcgagctttataagattaatgcaaaactctgt 240
gatcctcatc cctccaagaaaggagcaagctcagcttaccttgagaactcgaaaggtgcc 300
cccaacaact cctgctctgagataaaaatgaacaagaaaggcgctagaattgattttaaa 360
gatgtgactt acttaacagaagagaaggtatatgaaattcttgaattatgtagagaaaga 920
gaggattatt cccctttaatccgtgttattggaagagttttttctagtgctgaggcattg 980
gtacagagct tccggaaagttaaacaacacaccaaggaagaactgaaatctcttcaagca 590
aaagatgaag acaaagatgaagatgaaaaggaaaaagctgcatgttctgctgctgctatg 600
gaagaagact cagaagcatcttcctcaaggataggtgatagctcacagggagacaacaat 660
ttgcaaaaat taggccctgatgatgtgtctgtggatattgatgccattagaagggtctac 720
accagattgc tctctaatgaaaaaattgaaactgcctttctcaatgcacttgtatatttg 780
tcacctaacg tggaatgtgacttgacgtatcacaatgtatactctcgagatcctaattat 840
ctgaatttgt tcattatcggaatggagaatagaaatctccacagtcctgaatatctggaa 900
atggctttgc cattattttgcaaagcgatgagcaagctaccccttgcagcccaaggaaaa 960
ctgatcagac tgtggtctaaatacaatgcagaccagattcggagaatgatggagacattt 1020
cagcaactta ttacttataaagtcataagcaatgaatttaacagtcgaaatctagtgaat 1080
gatgatgatg ccattgttgctgcttcgaagtgcttgaaaatggtttactatgcaaatgta 1140
gtgggagggg aagtggacacaaatcacaatgaagaagatgatgaagagcccatccctgag 1200
tccagcgagc tgacacttcaggaacttttgggagaagaaagaagaaacaagaaaggtcct 1260
cgagtggacc ccctggaaactgaacttggtgttaaaaccctggattgtcgaaaaccactt 1320
atcccttttg aagagtttattaatgaaccactgaatgaggttctagaaatggataaagat 1380
tatacttttt tcaaagtagaaacagagaacaaattctcttttatgacatgtccctttata 1490
ttgaatgctg tcacaaagaatttgggattatattatgacaatagaattcgcatgtacagt 1500
gaacgaagaa tcactgttctctacagcttagttcaaggacagcagttgaatccatatttg 1560
agactcaaag ttagacgtgaccatatcatagatgatgcacttgtccggctagagatgatc 1620
gctatggaaa atcctgcagacttgaagaagcagttgtatgtggaatttgaaggagaacaa 1680
ggagttgatg agggaggtgtttccaaagaattttttcagctggttgtggaggaaatcttc 1790
aatccagata ttggtatgttcacatacgatgaatctacaaaattgttttggtttaatcca 1800
tcttcttttg aaactgagggtcagtttactctgattggcatagtactgggtctggctatt 1860
tacaataact gtatactggatgtacattttcccatggttgtctac<~ggaagctaatgggg 1920
CA 02344995 2001-04-04
WO 00/20587 PCT/US99I22873
21
aaaaaaggaa cttttcgtgacttgggagactctcacccagttctatatcagagtttaaaa1980
gatttattgg agtatgaagggaatgtggaagatgacatgatgatcactttccagatatca2090
cagacagatc tttttggtaacccaatgatgtatgatctaaaggaaaatggtgataaaatt2100
ccaattacaa atgaaaacaggaaggaatttgtcaatctttattctgactacattctcaat2160
aaatcagtag aaaaacagttcaaggcttttcggagaggttttcatatggtgaccaatgaa2220
tctcccttaa agtacttattcagaccagaagaaattgaattgcttatatgtggaagccgg2280
aatctagatt tccaagcactagaagaaactacagaatatgacggtggctataccagggac2340
tctgttctga ttagggagttctgggaaatcgttcattcatttacagatgaacagaaaaga2900
ctcttcttgc agtttacaacgggcacagacagagcacctgtgggaggactaggaaaatta2960
aagatgatta tagccaaaaatggcccagacacagaaaggttacctacatctcatacttgc2520
tttaatgtgc ttttacttccggaatactcaagcaaagaaaaacttaaagagagattgttg2580
aaggccatca cgtatgccaaaggatttggcatgctgtaa 2619
<210> 29
l5 <211> 4263
<212> DNA
<213> Homo sapiens
<400> 29
ggccgttccc cagtagctctatggtttcag 60
ctctcctcag ggcggcaacg
tgcagcgtcc
ttaccttgag tgccctcaccccggaatccatagtcactgtgacgaggcgg120
cctgtgcagt
gaggacttgggcgacaggtagcctcccagtcccacacgctgcgggtccgcgcctggccaa180
gccacctcgacctgtgaagttgggggcggtacccagcaactccccctgtgcagccgccgt240
ttccaaggggtcaggaaccgctgtgtttgtttcgtccgcgtagccagggcgggtcgcgga300
gtactgtgcctgacccgacggtggcaagtctgacgcgtcagccagagaccggtgcccggt360
gtaggagtcgcagcctgggctgtgagcggctgctgggtagacagacttgctttctcttac420
agcatgtcatttccaaaatgcatcgtggtgcttctgccttaagtcctataggaagacact480
gccgccactagaccggtgcttatggtcgccactgttattctgactcaggtcccgtgtcat540
tgagcatatgtatgaaaatgccttaggagggaaccatggagaagtatgtgagactgcaga600
agattggagaaggttcatttggaaaagctgttcttgttaaatcgacagaggatggcagac660
attatgtcatcaaggaaattaacatctcaagaatgtctgataaagaaaggcaagaatcaa720
ggagagaagttgctgtattggcaaacatgaagcatccaaatattgtccaatataaagaat780
catttgaagaaaatggctctctctacatagtaatggattactgtgaaggaggtgatttgt840
ttaaacgaataaatgctcagaaaggcgctctgtttcaagaagaccagattttggactggt900
ttgtgcagatatgtttggctctgaagcatgtacatgatagaaaaattcttcaccgagaca960
taaagtcacagaacatatttctaaccaaagatgggacagtgcagca gattttggaa1020
tgga
ttgctcgagttcttaatagtactgtagagctggctcgaacttgcataggcactccatact1080
acttgtcacctgaaatctgtgaaaacaagccttataacaataaaagtgacatttgggctt1190
tgggctgtgtcctttatgagttgtgtacacttaaacatgcatttgaagctggaaacatga1200
aaaacctggtactgaagataatctccggatcctttcctccagtgtctccacattactcct1260
atgatctccgcagcttgctgtctcagttatttaaaagaaatcctagggatagaccatcag1320
tcaactccatattggagaaaggttttatagctaaacgaatcgaaaagtttctctcccctc1380
agcttattgcagaagaattttgtctaaaaacactttcaaagtttggaccacagcctctcc1440
caggtaaaagaccagcatcaggacaaggtgtcagttcttttgtccctgctcagaaaatca1500
caaagcctgctgctaaatacggagtgcctttaacatataagaagt.atggagataaaaagt1560
tacttgagaaaaaaccacccccaaaacataaacaggcccatcaaattcccgtgaagaaaa1620
tgaattctggagaagaaaggaagaaaatgtctgaggaagcagcaaaaaaaagaaggttgg1680
aatttattgagaaagaaaagaagcaaaaggatcagattaggttcctgaaggctgagcaga1740
tgaagcggcaagagaagcagcggttggagaggataaatagggccagggaacaaggatgga1800
ggaatgttttaagggctggtggaagcggtgaagtaaaggcttccttttttggcattggag1860
gggctgtctctccatcaccgtgttctcctcgaggccagtatgaacattaccatgccattt1920
ttgaccaaatgcagcggctaagagcagaagataatgaagcaagatggaaggggggaatct1980
atggtcgatggctcccagaaaggcaaaaaggacacttagctgtagagagagccaaccaag2090
tggaagaattcctacagcgtaaacgagaagctatgcagaataaagcccgagccgaaggac2100
acgtggtttatttggcaagactgaggcaaataagactacaaaattttaatgagcgccaac2160
agattaaagccaaacttcgtggtgagaataaagaagctgatggtaccaaaggacaagaag2220
caactgaagagactgacatgaggctcaaaaagatggagtcacttaaggcgcaaacaaatg2280
cacgtgctgctgtactaaaagaacagctggagcgaaaaagaaaggaagcttatgaaagag2390
aaaagaaagtatgggaagaacatttggtggcgagggtaaaaagctcagatgttcctctgc2400
ctttggaacttcttgaaacaggtggttctccatcaaagcagcaggtgaagcctgtcattt2460
ctgtgacttcagctttgaaagaagtgggcctggatggaagtttaactgatacccaggaag2520
aagaaatggaaaagagtaacagtgctatttcaagtaagcgagaaatcctgcgtaggctaa2580
atgaaaatcttaaagctcaagaggatgaaaaggaaaagcagcatcactcaggttcttgtg2640
agaccgttggtcacaaagatgagagagagtatgagacagaaaatgccatttcctctgatc2700
gcaagaagtgggagatgggaggtcagcttgtgattcctctcgatgcagtgacactggata2760
catccttctctgcaaccgaaaaacatactgtgggagaggttattaaattagattctaatg2820
gctctccaagaaaagtctgggggaaaaaccctacagattctgtgctgaagatacttggag2880
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
zz
aagctgaattacagctatagacagaactactagaaaacacatcttttaaaagtgaggttt2990
atgctgaagaggagaactacaaacccttacttactgaagaagagaatctgcagtgcattt3000
caaaagaaataaatccatcagctactgttgattctactgaaacgaaaagtccaaagttta3060
ctgaggtgtctccacaaatgtcagaaggaaatgtggaagaacctgatgatttggaaacag3120
aagttctacaagagccaagtagcacacacacagatgggagtttgccacctgttcttaatg3180
atgtgtggactagagagaaggaagcagctaaggaaactgagttggaagataaggttgctg3240
tgcagcagagtgaagtttgtgaagatagaattccagggaacgtggaccaatcctgtaagg3300
atcagagagatcctgcagtagacgattctccgcagtctggctgtgatgtagagaagtcag3360
tacagccagaatcgattttccagaaagtggttcattctaaggacttgaacttagttcagg3920
cagttcattgctcaccagaagaaccaattccaattcgatctcactctgattctccaccaa3980
aaactaagagcaagaattccttactgattggactttcaactggtctgtttgatgcaaaca3590
atccaaagatgctgaggacctgctcacttccagatctttccaagctgttcagaaccctaa3600
tggacgttcccactgtgggggacgttcatcaagacagtcttgaaatcgatgagctggaag3660
atgaaccaattaaagaagggccttctgattccgaagacactgtatttgaagaaactgaca3720
cagatttacaagagcttcaggcctcaatggagcagctgcttagggagcaaccaggtgacg3780
aatacagtgaggaggaagagtctgttttaaaaagcagcgatgtggagcagacagcaagag3890
ggacagatgccccagacgaggaggacaaccceagcagcgaaagcc:cctgaacgaggaatg3900
gcactcagataatagtgacgctgagaccactagtgaatgtgaatatgacagtgtctttaa3960
ccatttagaggaactaagacttcacttggagcaagaaatgggctttgaaaagttctttga9020
ggtttatgagaaagtaaaggctattcatgaggatgaagatgaaaatattgaaatttgttc4080
aacaatagttgagaatattttgggcaatgagcaccagcatctctatgccaagattctgca4140
tttagtcatggcagatggagcctatcaggaagataatgatgaataatcctcaggacattc4200
tttaatagtcaactgtaagaacacatttgaacttggctcataatacaagcttcctgggaa9260
ata
4263
<210> 30
<211> 1756
<212> DNA
<213> Homo Sapiens
<400> 30
tcgggcgcagccgcgaagatgccgttggaactgacgcagagccgagtgcagaagatctgg60
gtgcccgtggaccacaggccctcgttgcccagatcctgtgggccaaagctgaccaactcc120
cccaccgtcatcgtcatggtgggcca gcccggggcaagacctacatctccaagaag180
cccc
ctgactcgctacctcaactggattggcgtccccacaaaagtgttcaacgtcggggagtat290
cgccgggaggctgtgaagcagtacagctcctacaacttcttccgccccgacaatgaggaa300
gccatgaaagtccggaagcaatgtgccttagctgccttgagagatgtcaaaagctacctg360
gcgaaagaagggggacaaattgcggttttcgatgccaccaatactactagagagaggaga420
cacatgatccttcattttgccaaagaaaatgactttaaagcgtttttcatcgagtcggtg980
tgcgacgaccctacagttgtggcctccaatatcatggaagttaaaatctccagcccggat540
tacaaagactgcaactcggcagaagccatggacgacttcatgaagaggatcagttgctat600
gaagccagctaccagcccctcgaccccgacaaatgcgacagggacttgtcgctgatcaag660
gtgattgacgtgggccggaggttcctggtgaaccgggtgcaggaccacatccagagccgc720
atcgtgtactacctgatgaacatccacgtgcagccgcgtaccatctacctgtgccggcac780
ggcgagaacgagcacaacctccagggccgcatcgggggcgactcaggcctgtccagccgg840
ggcaagaagtttgccagtgctctgagcaagttcgtggaggagcagaacctgaaggacctg900
cgcgtgtggaccagccagctgaagagcaccatccagacggccgaggcgctgcggctgccc960
tacgagcagtggaaggcgctcaatgagatcgacgcgggcgtctgtgaggagctgacctac1020
gaggagatcagggacacctaccctgaggagtatgcgctgcgggagcaggacaagtactat1080
taccgctaccccaccggggagtcctaccaggacctggtccagcgcttggagccagtgatc1140
atggagctggagcggcaggagaatgtgctggtcatctgccaccaggccgtcctgcgctgc1200
ctgcttgcctacttcctggataagagtgcagaggagatgccctacctgaaatgccctctt1260
cacaccgtcctgaaactgacgcctgtcgcttatggctgccgtgtggaatccatctacctg1320
aacgtggagtccgtctgcacacaccgggagaggtcagaggatgcaaagaagggacctaac1380
ccgctcatgagacgcaatagtgtcaccccgctagccagccccgaacccaccaaaaagcct1440
cgcatcaacagctttgaggagcatgtggcctccacctcggccgccctgcccagctgcctg1500
cccccggaggtgcccacgcagctgcctggacaaaacatgaaaggct_cccggagcagcgct1560
gactcctccaggaaacactgaggcagacgtgtcggttccattccatttccatttctgcag1620
cttagcttgtgtcctgccctccgcccgaggcaaaacgtatcctgaggacttcttccggag1680
agggtggggtggagcagcgggggagccttggccgaagagaaccatgcttggcaccgtctg1740
tgtcccctcggccgct 1756
<210> 31
<211> 1661
<212> DNA
<213> Homo Sapiens
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
23
<400> 31
tgctgcagcc gctgccgccgattccggatctcattgccacgcgcccccgacgaccgcccg60
acgtgcattc ccgattccttttggttccaagtccaatatggcaactctaaaggatcagct120
gatttataat cttctaaaggaagaacagaccccccagaataagattacagttgttggggt180
tggtgctgtt ggcatggcctgtgccatcagtatcttaatgaaggacttggcagatgaact290
tgctcttgtt gatgtcatcgaagacaaattgaagggagagatgatggatctccaacatgg300
cagccttttc cttagaacaccaaagattgtctctggcaaagactataatgtaactgcaaa360
ctccaagctg gtcattatcacggctggggcacgtcagcaagagggagaaagccgtcttaa920
tttggtccag cgtaacgtgaacatatttaaattcatcattcctaatgttgtaaaatacag980
cccgaactgc aagttgcttattgtttcaaatccagtggatatctt:gacctacgtggcttg540
gaagataagt ggttttcccaaaaaccgtgttattggaagtggttgcaatctggattcagc600
ccgattccgt tacctgatgggggaaaggctgggagttcacccattaagctgtcatgggtg660
ggtccttggg gaacatggagattccagtgtgcctgtatggagtggaatgaatgttgctgg720
tgtctctctg aagactctgcacccagatttagggactgataaagataaggaacagtggaa780
IS agaggttcac aagcaggtggttgagagtgcttatgaggtgatcaaactcaaaggctacac840
atcctgggct attggactctctgtagcagatttggcagagagtataatgaagaatcttag900
gcgggtgcac ccagtttccaccatgattaagggtctttacggaataaaggatgatgtctt960
ccttagtgtt ccttgcattttgggacagaatggaatctcagaccttgtgaaggtgactct1020
gacttctgag gaagaggcccgtttgaagaagagtgcagatacactttgggggatccaaaa1080
ggagctgcaa ttttaaagtcttctgatgtcatatcatttcactgtctaggctacaacagg1140
attctaggtg gaggttgtgcatgttgtcctttttatctgatctgtgattaaagcagtaat1200
attttaagat ggactgggaaaaacatcaactcctgaagttagaaataagaatggtttgta1260
aaatccacag ctatatcctgatgctggatggtattaatcttgtgtagtcttcaactggtt1320
agtgtgaaat agttctgccacctctgacgcaccactgccaatgctgtacgtactgcattt1380
gccccttgag ccaggtggatgtttaccgtgtgttatataacttcctggctccttcactga1940
acatgcctag tccaacattttttcccagtgagtcacatcctgggatccagtgtataaatc1500
caatatcatg tcttgtgcataattcttccaaaggatcttattttgtgaactatatcagta1560
gtgtacatta ccatataatgtaaaaagatctacatacaaacaatgcaaccaactatccaa1620
gtgttatacc aactaaaacccccaataaaccttgaacagtg 1661
<210> 32
<211> 4169
<212> DNA
<213> Homo
Sapiens
<400> 32
ggcggcttcc aggtgggcgcgcaaggccgtggtcctgctttgtgcctctgacctgctgct60
gctgctgcta ctgctaccaccgcctgggtcctgcgcggccgaaggctcgcccgggacgcc120
cgacgagtct accccacctccccggaagaagaagaaggatattcgcgattacaatgatgc180
agacatggcg cgtcttctggagcaatgggagaaagatgatgacattgaagaaggagatct240
tccagagcac aagagaccttcagcacctgtcgacttctcaaagatagacccaagcaagcc300
tgaaagcata ttgaaaatgacgaaaaaagggaagactctcatgatgtttgtcactgtatc360
aggaagccct actgagaaggagacagaggaaattacgagcctctggcagggcagcctttt420
caatgccaac tatgacgtccagaggttcattgtgggatcagaccgtgctatcttcatgct9B0
tcgcgatggg agctacgcctgggagatcaaggactttttggtcggtcaagacaggtgtgc540
tgatgtaact ctggagggccaggtgtaccccggcaaaggaggaggaagcaaagagaaaaa600
taaaacaaag caagacaagggcaaaaaaaagaaggaaggagatctgaaatctcggtcttc660
caaggaagaa aatcgagctgggaataaaagagaagacctgtgatggggcagcagtgacgc720
gctgtggggg gacaggtggacgtggagagctctttgcccagctcctggggtgggagtggt780
ctcaggcaac tgcacaccggatgacattctagtgtcttctagaaagggtctgccacatga890
ccagtttgtg gtcaaagaattactgcttaataggcttcaagtaagaagacagatgttttc900
taattaatac tggacactgacaaattcatgtttactataaaatctccttacatggaaatg960
tgactgtgtt gctttttcccatttacacttggtgagtcatcaactctactgagattccac1020
tcccctccaa gcacctgctgtgattgggtggcctgctctgatcagatagcaaattctgat1080
cagagaagac tttaaaactcttgacttaattgagtaaactcttcatgccatatacatcat1140
tttcattatg ttaaaggtaaaatatgctttgtgaactcagatgtctgtagccaggaagcc1200
agggtgtgta aatccaaaatctatgcaggaaatgcggagaatagaaaatatgtcacttga1260
aatcctaagt agttttgaatttctttgacttgaatcttactcatcagtaagagaactctt1320
ggtgtctgtc aggttttatgtggtctgtaaagttaggggttctgttttgtttccttattt1380
aggaaagagt actgctggtgtcgaggggttatatgttccatttaatgtgacagttttaaa1490
ggatttaagt agggaatcagagtcctttgcagagtgtgacagacgactcaataacctcat1500
ttgtttctaa acatttttctttgataaagtgcctaaatctgtgctttcgtatagagtaac1560
atgatgtgct actgttgatgtctgattttgccgttcatgttagagcctactgtgaataag1620
agttagaaca tttatatacagatgtcatttctaagaactaaaattctttgggaaaaaccc1680
tcaattgtga ttttaataaattaaaagtagcacattacatggttagaaaatgtcagtgtt1790
aaagaatggt acaaagtgaaaagtgtatccctctcttgccgccggtggtagcttgtccca1800
gtggaagctg ctgttaacaatttgtgcccccacatccccctccctgcccatccaccaaaa1860
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
24
aaaagtacat ttacttatgtaaatgtactt atgtttgttt tggcctcaca1920
atggtgatgt
gcatctgttt ccccttaatttggtagctgc ctcgaaagaa ccacaccctc1980
tcacatttcc
tgcattctca gttctttgctttggatggga gcagtccccc caccctccag2040
catttgccct
gccatgccct ctccagggtgaggcctgtgt actagggtac taggccctga2100
gatctaccgt
aagaggcttt tcttgttcctcctgcatctt cgggagctgt tgtaggcccc2160
gaacctggag
gcccttggag aagagaactgtctgacagtg gccacaccct ggtggcataa2220
gggagagagc
acgagtccct gaatcatgccgtggctgaac ctgtgggctt tttctgttgt2280
caagccctgt
actcagggca gtttgatggggttactgtcc taatggccca gtataaagca2340
tgcatagcca
gctgttttga tgagataattgctttaattaagcaaaaggtagcaaagctt tcactccgcc2400
ctgtaccttc tgtttccacttaggagccttcccatgtcagaatgtgcaga tctgtctcat2960
tgtttcctgt gcagtgtgcccccacttcacccagtagtttctgtgtgtct gttatgtact2520
aggtactaca aggtgccaggacggtgtagatacagcctctgctatcgtaa aactcaatga2580
ttcggtgggg gaagacaaatgtcagtaatgtacaaagtaaaatggcagct gttagaagta2690
tgaaaggggc agggtagggggaggtagaatcttccctgaccaggttaaga aaaccagagg2700
ccttctctga gggcaagaggaggagaggagaaatagagtaaggca ggcag aggaaacagt2760
ctgagctaag accctgtggctagaagtggcagagggagaggcagcaggaa ggccagcggg2820
gaggctgggg cccagtgcaggcccaggttggaggagcgtagcacatggag tttggtagga2880
gtttgggacg ccctggtggatcttaattgtgatggggtgggtgtgaaagg cagtccaggt2940
tgcactggtt gcacaggagaagtgatcagaagaggaccccagcaggtgtg agccgtgagc3000
tgggaggtgc ttcagtagtgcaggccatagctgaaggtgtcctacatcag cagggtgatg3060
gtgaggtttg aaccactgtttcactgcatagtccctgctgatggacactt gagtgttcag3120
attttttgct ggtatattcagtgctgcagtggacattttcatacaaaata tttcggtaca3180
cttttgttta tatctgaaaggtaaattcctagcagtagaattatt.agagc aaacggaatt3240
taacattttg gtgtgtattgccaaattgccctcccaagtggtttagtcag cttacccttg3300
ccaacaatag atctatccttgccagccttgggcatcacatttaccagttt aatagattgt3360
aaaaccatat cttaattggctaccctgaagccaccatactggagaggctg cgtacagtgt3920
ttcacgtaga gagagggatacccaggaggcccacctgctccaaccccagc tgcatgagtc3480
ttcccagccc aggcacagacatgtggataagatttaaacatttccagccc cagccttcaa3590
gcaatcctag ttgacactgaggggagccaacataagctgagctgagaaac agtctgccca3600
gtctgcagat tcatgagcaaaagaaatgttgggctgggtacagtggctca cgcctgtaat3660
cccagtactt tgggaggccgaggtgggtggatcagttgaggtcaggagtt tgagaccagc3720
ctggccaaca tggtgaagccctgtctctactaaaaattagccgagtgtgg tggtgcgggc3780
ctgtaatccc agctactcaggtggctgaggcaggagaatggcttgaaccc gggaggcgga3840
ggttgcagtg agccaagatcaggccactgcactccagcctggatgacggg atgagactct3900
gtctcaaaaa aacgaaacaaaaattttttaagagaaatgtcatttgtttt tgtttttgag3960
acagggtctc actctgttgccctcactagagtgcagtagggatcacggct cactgaagtc9020
tctacctacc ggctcaattgatcttcccaccacagcctcccaaatagctg ggagaaatgt9080
cctgttttta atgaatttgtcttcctttttgtcttgtttgttttaatatc tagtgatcta9190
ataaatttgg atgatatcttttgactatc
9169
<210> 33
<211> 859
<212> DNA
<213> Homo Sapiens
<900> 33
catgccatgc tgggactatg 60
agcttaccaa ctggagataa
ccatcgagtc ctatgttcat
cgactggttg atagtacagt 120
caagtaaaac atgaatgtga
agatggaaaa gggggatact
tgccaggaag ttagagtatt 180
agaaaataga catatttact
tgccttacag aacaagccag
ctggaatctc aagatagttc 290
agcgaatcta ggatagagaa
ctgggaaaac ggacacagca
gaggaaatta aaagaaacaa 300
acaacatgaa ttgagaagtg
gaccaagttt tgataatcta
gagcacaaac aagcagtctg 360
taaatgatct tggaaagaaa
cctaaaagaa gtgcactcag
ctaaacacaa gagctcaaag 420
aagtggccaa aggagcagga
actcaccaac aatgaacaag
tgtttgcgag aacaagctaa 980
ccaaccaagt aagaggagga
cctcctgcag gagggtgctg
aaggagacct atcaccgaga 590
gtgaccaaaa tccaggagca
agatctgcag gctgcgtgac
gtcatgttct atcaaccatc 600
acctggagac tgcctgccga
acagcagaag gacccggcag
gaaatccagg atggcctcgg 660
agggacagat cctcgagccc
caacatcgcc tgcctcttcg
gggggcagtg ggccgcagca 720
ggaagttgcc agaggggcaa
ctccaggaag gtgaccttca
gagcaacaga ctgacactgt 780
catccctgag gagagt:gtgc
actgttctcc tgggaccttc
agctaaatgt acaagtgagg 840
gagggtgggc acgaaggccg
cctaataagt gccttcgtgg
ccttagagat 859
ggatgaggc
<210> 34
<211> 1070
<212> DNA
<213> Homo Sapiens
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
<400> 39
gcgattgctg gggctgcagcgctgcctccgagaccgagagtgggtggagcgggtcttcct60
ggaagggtgc gataaggccgggcgaggtgcctgggatgcttctccccttccgcgaggaag120
agatctaatt gggtagggcgggtgtagactagcctgccgagccgcccgctggcacctgca180
5 gcctcctggg cgcccgcgggcccggcgagaaagttgttaaagggagcgaggtggttgttc240
ctggggtccg aggcgcgcctctcacgccctgcccaacagaagccgcagtcccgtggggtc300
tggagacgca gtttccttgttaatgacaataaatccctgctccccctgcctcagacatct360
acgcagcgaa atcgagcctggccttgagggtccacaccgcgaggaagatgcgtgcgccca920
ttccagagcc taagcctggagacctgattgagatttttcgccctttctacagacactggg480
10 ccatctatgttggcgatggatatgtggttcatctggcccctccaagtgaggtcgcaggag540
ctggtgcagc cagtgtcatgtccgccctgactgacaaggccatcgtgaagaaggaattgc600
tgtatgatgt ggccgggagtgacaagtaccaggtcaacaacaaacatgatgacaagtact660
cgccgctgcc ctgcacgaaaatcatccagcgggcggaggagctggtggggcaggaggtgc720
tctacaagct gaccagtgagaactgcgagcactttgtgaatgagctgcgctatggagtcg780
15 cccgcagtgaccaggtcagagatgtcatcatcgctgcaagcgttgcaggaatgggcttgg890
cagccatgag ccttattggagtcatgttctcaagaaacaagcgacaaaagcaataactga900
aaaagactgt ctgtcagcgatgactttataca.tcaagggggtcttgttttgctagagagt960
ttggggtttg gtttgtggatttcattgtgatttataataaggcttattttcacagaataa1020
aataaagcaa aacgagggaggattttattgggggagtgcagcccaaaaaa 1070
20
<210> 35
<211> 460
<212> DNA
<213> Homo sapiens
<400> 35
cttttcctcccatgtcgccaccgaggtgccacgcgtgagacttctccgccgcctccgccg60
cagacgccgccgcgatgcgctacgtcgcctcctacctgctggctgccctagggggcaact120
cctcccccagcgccaaggacatcaagaagatcttggacagcgtgggtatcgaggcggacg180
~
acgaccggctcaacaaggttatcagtgagctgaatggaaaaaacattgaagacgtcattg240
cccagggtattggcaagcttgccagtgtacctgctggtggggctgtagccgtctctgctg300
ccccaggctctgcagcccctgctgctggttctgcccctgctgcagcagaggagaagaaag360
atgagaagaaggaggagtctgaagagtcagatgatgacatgggatt:tggcctttttgatt920
aaattcctgctcccctgcaaataaagcctttttacacatc 960
<210> 36
<211> 9416
<212> DNA
<213> Homo
sapiens
<400> 36
gccgcacagggttttataggatcacattgacaaaagtaccatggagttttatgagtcagc60
atattttattgttcttattccttcaatagttattacagtaattttcctcttcttctggct120
tttcatgaaagaaacattatatgatgaagttcttgcaaaacagaaaagagaacaaaagct180
tattcctaccaaaacagataaaaagaaagcagaaaagaaaaagaataaaaagaaagaaat240
ccagaatggaaacctccatgaatccgactctgagagtgtacctcgagactttaaattatc300
agatgctttggcagtagaagatgatcaagttgcacctgttccattgaatgtcgttgaaac360
ttcaagtagtgttagggaaagaaaaaagaaggaaaagaaacaaaagcctgtgcttgaaga920
gcaggtcatcaaagaaagtgacgcatcaaagattcctggcaaaaaagtagaacctgtccc980
agttactaaacagcccacccctccctctgaagcagctgcctcgaagaagaaaccagggca590
gaagaagtctaaaaatggaagcgatgaccaggataaaaaggtggaaactctcatggtacc600
atcaaaaaggcaagaagcattgcccctccaccaagagactaaacaagaaagtggatcagg660
gaagaagaaagcttcatcaaagaaacaaaagacagaaaatgtcttcgtagatgaacccct720
tattcatgcaactacttatattcctttgatggataatgctgactcaagtcctgtggtaga780
SS taagagagaggttattgatttgcttaaacctgaccaagtagaagggatccagaaatctgg840
gactaaaaaactgaagaccgaaactgacaaagaaaatgctgaagtgaagtttaaagattt900
tcttctgtccttgaagactatgatgttttctgaagatgaggctctttgtgttgtagactt960
gctaaaggagaagtctggtgtaatacaagatgctttaaagaagtcaagtaagggagaatt1020
gactacgcttatacatcagcttcaagaaaaggacaagttactcgctgctgtgaaggaaga1080
tgctgctgctacaaaggatcggtgtaagcagttaacccaggaaatgatgacagagaaaga1190
aagaagcaatgtggttataacaaggatgaaagatcgaattggaacattagaaaaggaaca1200
taatgtatttcaaaacaaaatacatgtcagttatcaagagactcaacagatgcagatgaa1260
gtttcagcaagttcgtgagcagatggaggcagagatagctcacttgaagcaggaaaatgg1320
tatactgagagatgcagtcagcaacactacaaatcaactggaaagcaagcagtctgcaga1380
actaaataaactacgccaggattatgctaggttggtgaatgagctgactgagaaaacagg1940
aaagctacagcaagaggaagtccaaaagaagaatgctgagcaagcagctactcagttgaa1500
ggttcaactacaagaagctgagagaaggtgggaagaagttcagagctacatcaggaagag1560
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
26
aacagcggaa 1620
catgaggcag
cacagcaaga
tttacagagt
aaatttgtgg
ccaaagaaaa
tgaagtacag 1680
agtctgcata
gtaagcttac
agataccttg
gtatcaaaac
aacagttgga
gcaaagacta 1740
atgcagttaa
tggaatcaga
gcagaaaagg
gtgaacaaag
aagagtctct
acaaatgcag 1800
gttcaggata
ttttggagca
gaatgaggct
ttgaaagctc
aaattcagca
t
g cagatagcag 1860
tccattcc cccagacctc
cgcttcagtt
ctagcagaag
aattacataa
agtgattgca gaaaaggataagcagataaa 1920
t acagactgaa
gattctttag
caagtgaacg
gatcgttta acaagtaaag taaggatata atttcttatt 1980
aagaggaact cagaatatga
aaaagctgaa gtgcagaaattacaggccctggcaaatgag ctgcacatga 2040
caggctgctg
attggagaag atgcaacaaagtgtttatgttaaagatgataaaataagattgctggaaga 2100
gcaactacaa catgaaatttcaaacaaaatggaagaatttaagattctaaatgaccaaaa 2160
caaagcatta aaatcagaagttcagaagctacagactcttgtttctgaacagcctaataa 2220
ggatgttgtg gaacaaatggaaaaatgcattcaagaaaaagatgagaagttaaagactgt 2280
ggaagaatta cttgaaactggacttattcaggtggcaactaaagaagaggagctgaatgc 2390
aataagaaca gaaaattcatctctgacaaaagaagttcaagacttaaaagctaagcaaaa 2400
is
tgatcaggtt tcttttgcctctctagttgaagaacttaagaaagtgatccatgagaaaga 2460
tggaaagatc aagtctgtagaagagcttctggaggcagaacttctcaaagttgctaacaa 2520
ggagaaaact gttcaggatttgaaacaggaaataaaggctctaaaagaagaaataggaaa 2580
tgtccagctt gaaaaggctcaacagttatctatcacttccaaagttcaggagcttcagaa 2640
cttattaaaa ggaaaagaggaacagatgaataccatgaaggctgttttggaagagaaaga 2700
gaaagaccta gccaatacagggaagtggttacaggatcttcaagaagaaaatgaatcttt 2760
aaaagcacat gttcaggaagtagcacaacataacttgaaagaggcctcttctgcatcaca 2820
gtttgaagaa cttgagattgtgttgaaagaaaaggaaaatgaattgaagaggttagaagc 2880
catgctaaaa gagagggagagtgatctttctagcaaaacacagct:gttacaggatgtaca 2940
agatgaaaac aaattgtttaagtcccaaattgagcagcttaaacaacaaaactaccaaca 3000
2s
ggcatcttct tttccccctcatgaagaattattaaaagtaatttcagaaagagagaaaga 3060
aataagtggt ctctggaatgagttagattctttgaaggatgcagttgaacaccagaggaa 3120
gaaaaacaat gaaaggcagcaacaggtggaagctgttgagttggaggctaaagaagttct 3180
caaaaaatta tttccaaaggtgtctgtcccttctaatttgagttatggtgaatggttgca 3240
tggatttgaa aaaaaggcaaaagaatgtatggctggaacttcagggtcagaggaggttaa 3300
ggttctagag cacaagttgaaagaagctgatgaaatgcacacatt.gttacagctagagtg 3360
tgaaaaatac aaatccgtccttgcagaaacagaaggaattttacagaagctacagagaag 3420
tgttgagcaa gaagaaaataaatggaaagttaaggtcgatgaatc:acacaagactattaa 3480
acagatgcag tcatcatttacatcttcagaacaagagctagagcgattaagaagcgaaaa 3540
taaggatatt gaaaatctgagaagagaacgagaacatttggaaatggaactagaaaaggc 3600
3s
agagatggaa cgatctacctatgttacagaagtcagagagttgaaggcacagttaaatga 3660
aacactcaca aaacttagaactgaacaaaatgaaagacagaaggtagctggtgatttgca 3720
taaggctcaa cagtcactggagcttatccagtcaaaaatagtaaaagctgctggagacac 3780
tactgttatt gaaaatagtgatgtttccccagaaacggagtcttctgagaaggagacaat 3840
gtctgtaagt ctaaatcagactgtaacacagttacagcagttgcttcaggcggtaaacca 3900
acagctcaca aaggagaaagagcactaccaggtgttagagtgaagtaattgggaaactgt 3960
tcatttgagg ataaaaaaggcattgtattatattttgccaaattaaagccttatttatgt 4020
tttcaccctt tctactttgtcagaaacactgaacagagttttgtcttttctaatccttgt 4080
tagactactg atttaaagaaggaaaaaaaaaagccaactctgtagacaccttcagagttt 9190
agttttataa taaaaactgtttgaataattagacctttacattcctgaagataaacatgt 9200
4s aatcttttat cttattttgctcaataaaattgttcagaagatcaaagtggtaaagacaat 4260
gtaaaattta acattttaatactgatgttgtacactgttttacttaacattttgggaagt 9320
aactgcctct gacttcaactcaagaaaacacttttttgttgctaat 4380
gtaa
tcggtttttg
taatggcgtc agcaaataaaaggatgcttattattc 4416
s0 <210> 37
<211> 628
<212> DNA
<213> Homo Sapiens
ss <z2o>
<221> unsure
<222> 284..284
<223> n = a, c, g
or t
60 <220>
<221> unsure
<222> 594..594
<223> n = a, c, g
or t
6s <220>
<221> unsure
<222> 597..597
CA 02344995 2001-04-04
WO 00/20587 PCT1US99/22873
27
<223> n = a, c, g or t
<220>
<221> unsure
<222> 607..607
<223> n = a, c, g or t
<400> 37
ggcacgagaa gaagtctaaaaatggaagcgatgaccagggataaaaaggtggaaactctc 60
atggtaccat caaaaaggcaagaagcattgcccctccaccaagagactaaacaagaaagt 120
ggatcaggga agaagaaagcttcatcaaagaaacaaaagacagaaaatgtcttcgtagat 180
gaacccctta ttcatgcaactacttatattcctttgatggataatgctgactcaagtcct 290
gtggtagata agagagaggttatttatttgcttaaacctgaccnagtagaagggatccag 300
aaatctggga ctaaaaaactgaagacccaaactgacaaagaaaatgctgaagtgaagttt 360
aaagattttcttctgtcctttaagactatgatgttttctgaagatgaggctctttgtgtt 920
gtagacttgc taaaggagaagtctcgtgtaatacaagatgctttaaagaagtcaagtaag 480
ggagaattga ctacgcttatacatcagcttcaagaaaaggaccaagttactcgctgctgt 590
gaaggaagat gctgctgctacaaaggatccgtgtaagcagttac<~ccaggaatnatncca 600
aagaaanaca gagcaatttggtatacaa 628
<210> 38
<211> 730
<212> DNA
<213> Homo
sapiens
<220>
<221> unsure
<222> 127..127
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 260..260
<223> n = a, g or
c, t
<2zo>
<221> unsure
<222> 307..307
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 329..329
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 336..336
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 473..473
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 487..487
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 999..994
<223> n = a, g or
c, t
<220>
<221> unsure
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
28
<222> 563..563
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 640..690
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 681..681
<223> n = a, c, g or
t
<220>
IS <221> unsure
<222> 689..689
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 708..708
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 714..719
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 728..728
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 730..730
<223> n = a, c, g or
t
<400> 38
aaagaattcg gcacgagtgaagaccgaaactgacaaagaaaatgctgaagtgaagtttaa 60
agattyyctt ctgtccttgaagactatgatgttttctgaagatgaggctctttgtgttgt 120
agactyncta aaggagaagtctggtgtaatacaagatgctttaaagaagtcaagtaaggg 180
agaattgact acgcttatacatcagcttcaagaaaaggacaagtyactcgctgctgtgaa 290
ggaagatgct gctgcyacanaggatcggtgtaagcagttaacccaggaaatgatgacaga 300
gaaaganaga agcaatgtggttataacanggatganagaycgaatyggaacattagaaaa 360
ggracataat gtatyycaaaacaaaatacatgtcagtyatcaagagacycaacagatgca 420
gatgaagttt cagcaagttcgtgagcagatggaggcagagatagcycacttgnagcagga 480
aaatggnata ctgngagaatgcagtcagcaacactacaaatcaact:ggaaagcaagcagt 540
ctgcagaact aaataaactacgncaggattatgctaggttggtgaatgagcctgactgag 600
aaacaggaaa gctacagcaagaggaagtcaaagaagaatnctgagcaagcagctactcag 660
ttgaaggttc caactacacgnacgcctgngagaaggtgggggaggcgnttcagngcctac 720
atcagggngn
730
<210> 39
<211> 571
<212> DNA
<213> Homo Sapie ns
<220>
<221> unsure
<222> 37..37
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 42..42
<223> n = a, c, g or
t
CA 02344995 2001-04-04
WO 00/20587 29 PC'T/US99/22873
<220>
<221> unsure
<222> 64..69
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 67..67
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 73..73
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 86..99
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 106..107
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 117..117
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 139..139
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 153..153
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 243..243
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 257..257
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 264..264
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 319..319
<223> n = a, gor t
c,
<220>
<221> unsure
<222> 337..337
<223> n = a, gor t
c,
<220>
CA 02344995 2001-04-04
WO 00/20587 PCTNS99/22873
<221> unsure
<222> 341..341
<223> n = a, g or
c, t
5 <220>
<221> unsure
<222> 353..353
<223> n = a, g or
c, t
10 <220>
<221> unsure
<222> 362..362
<223> n = a, g or
c, t
15 <220>
<221> unsure
<222> 373..373
<223> n = a, g or.
c, t
20 <220>
<221> unsure
<222> 379..379
<223> n = a, g or
c, t
25 <220>
<221> unsure
<222> 384..385
<223> n = a, g or
c, t
30 <220>
<221> unsure
<222> 419,.919
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 421..421
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 427..427
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 933.433
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 440..442
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 449..444
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 448..448
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 450..450
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
31
<223> n = a, c, g or t
<220>
<221> unsure
<222> 455..455
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 986..486
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 488..489
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 493..493
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 496..497
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 500..500
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 504..509
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 506..507
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 515..515
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 520..520
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 523..523
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 525..526
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 538..538
<223> n = a, g or
c, t
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
32
<400> 39
aayacaatgc cttttttatcctcaaatagarcagttncccanttacttcactcttacacc 60
tggnagngct ctntctcctttgtgrnnnnnnnnnnnnnncccccynnccgaatggtnctg 120
taactgtgtt acagtctgntttaggcttacagncattgtctccttctcaggaggctccgt I80
ttctggggga acatcacttttttcaataacagtagtgtctcccgcagcttttactatttt 240
tgnctggata agctccngtgactnttgagccttatgcaaatcacc:agctaccttctgtct 300
ttcattttgt tcagttctnagttttgtgggtgtttcntttnactgtgccytcnactctct 360
gncttctgta acntagggnggtcnntccctctctgccttttctagttccctttcccaang 420
ntctcgntct ccnccccagnnngncaananccgcnatttttcgcttcttaattcggtcta 980
gccccngnnc cgnagnnggnaaangnnggctgcanccggnttnannaggcctgtgtgntt 590
catcggcctt tacctttccctttattttctt 571
<210> 40
<211> 644
IS <212> DNA
<213> Homo Sapiens
<220>
<221> unsure
<222> 915..915
<223> n = a, c, g or t
<220>
<221> unsure
<222> 525..526
<223> n = a, c, g or t
<400> 40
atattttgga gcagaatgaggctttgaaagctcaaattcagcagttccattcccagatag 60
cagcccagac ctccgcttcagttctagcagaagaattacataaagtgattgcagaaaagg 120
ataagcagat aaaacagactgaagattctttagcaagtgaacgtg;3tcgtttaacaagta 180
aagaagagga acttaaggatatacagaatatgaatttcttattaaaagctgaagtgcaga 240
aattacaggc cctggcaaatgagcaggctgctgctgcacatgaattggagaagatgcaac 300
acagtgttta tgttaaagatgataaaataagattgctggaagagcaactacaacatgaca 360
tttcaaacaa aatggaagaatttaagattctaaatgaccaaaacaaagcattaanatcag 420
aagttcagaa gctacagactcttgtttctgaacagcctaataaggatgttgtggaacaca 480
tggaaaaatg cattcaagaaaagatgagaagttaaagactgtggnngattacttgacact 540
ggacttattc aggtggcaactaaagagaggagctgatgcatagacagacattcatctctg 600
acaaagagtt caagacttacagctagcaaatgatcaggttcttg 644
<210> 41
<211> 566
<212> DNA
<213> Homo
sapiens
<220>
<221> unsure
<222> 47.47
<223> n = a, g
c, or
t
<220>
<221> unsure
<222> 59..59
<223> n = a, g
c, or
t
<220>
<221> unsure
<222> 91..91
<223> n = a, g
c, or
t
<220>
<221> unsure
<222> 104..104
<223> n = a, g
c, or
t
<220>
<221> unsure
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
33
<222> 941..441
<223> n = a, c, g or t
<220>
<221> unsure
<222> 498..448
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 457..957
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 525..525
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 539..539
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 564..569
<223> n = a, c, g or
t
<400> 41
caacacaatc tcaaggtcttcaaactgggatgcagaagag gcctctntca agttatgtng60
tgctacttcc tgaacaagggcttgaaaagantcaatggct tctngaagag cccgtaacca120
cttccccgta ttggctagggctttctctttctcttccaaa acagccttca tgggattcat180
ctgtgcctct tttccttttaataagttcygaagctcctga actttggaag tgatagataa290
cygttgagcc ttttcaagctggacatttcctatttcttct tttagagcct ttatttcccg300
tttcaaatcc cgaacagttttctccttgttagcaacattg agaagtgccg cctccagaag360
ctcttctaca gacttgatctttcacctctctcatggatca ctctcttaag gtcttcaact920
agagaggcaa aagaacccgancatttgntagttttangct cgaacttctt ttgtcagaga480
tgaattttct gttcttattgcattcagctcctcttcttta ggtgncacca gaataaggnc540
agtgtcaaga aattcttccacagnct 566
<210> 42
<211> 878
<212> DNA
<213> Homo sapiens
<220>
<221> unsure
<222> 595..595
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 756..756
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 766..766
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 815..815
<223> n = a, c, g or
t
<220>
<221> unsure
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
34
<222> 818..818
<223> n = a, c, g or t
<220>
<221> unsure
<222> 827..827
<223> n = a, c, g or t
<220>
<221> unsure
<222> 831..831
<223> n = a, c, g or t
<220>
IS <221> unsure
<222> 853..853
<223> n = a, c, g or t
<220>
<221> unsure
<222> 866..866
<223> n = a, c, g or t
<400> 42
accttaacct cctctgacctgaagttccagccatacattcttttgccttt ttttcaatcc60
atgcaaccat tcaccataactcaaattagaagggacagacacctttggaa ataatttttt120
gagaacttct ttagcctccaactcaacagcttccacctgttgctgccttt cattgttttt180
cttcctctgg tgttcaactgcatccttcaaagaatctaactcattccaga gaccacttat240
ttctttctct ctttctgaaattacttttaataattcttcatgagggggaa aagaagatgc300
ctgttggtag ttttgttgtttaagctgctcaatttgggacttaaacaatt tgttttcatc360
ttgtacatcc tgtaacagctgtgttttgctagaaagatcactctccctct cttttagcat420
ggcttctaac ctcttcaattcattt.tccttttctttcaacacaatctcaa gttcttcaaa980
ctgtgatgca gaagaggcctctttcaagttatgttgtgctacttcctgaa catgtgcttt540
taaaagattc attttcttcttgaagatcctgtaaccacttccctgtattg gctangtctt600
tctctttctc ttccaaaacagccttcaaggtattcatctgttcctctttt ccttttaaaa660
agttctgaag ctcctgaactttggaagtgatagataactgttgagccctt tcaagcctgg720
acattcctaa ttcctcctttaaaagccttaattccngtttcaaaanccga aacagttttc780
ccccttgtaa gcaactttgagaaattcggctccanaanccctcctanaga nttgatcttt840
caacctttcc aanggattactttccnaaagttccttaa 878
<210> 43
<211> 620
<212> DNA
<213> Homo Sapiens
<220>
<221> unsure
<222> 391..391
<223> n = a, c, g or t
<220>
<221> unsure
<222> 400..400
<223> n = a, c, g or t
<220>
<221> unsure
<222> 411..911
<223> n = a, c, g or t
<220>
<221> unsure
<222> 914.. 414
<223> n = a, c, g or t
<220>
<221> unsure
CA 02344995 2001-04-04
WO 00/20587 PCT/US99122873
<222> 418..418
<223> n = a, g
c, or
t
<220>
5 <221> unsure
<222> 921..921
<223> n = a, g
c, or
t
<220>
10 <221> unsure
<222> 427..928
<223> n = a, g
c, or
t
<220>
15 <221> unsure
<222> 935..435
<223> n = a, g
c, or
t
<220>
20 <221> unsure
<222> 496..496
<223> n = a, g
c, or
t
<220>
25 <221> unsure
<222> 954..455
<223> n = a, g
c, or
t
<220>
30 <221> unsure
<222> 463..463
<223> n = a, g
c, or
t
<220>
35 <221> unsure
<222> 465..965
<223> n = a, g
c, or
t
<220>
<221> unsure
<222> 471..471
<223> n = a, g
c, or
t
<220>
<221> unsure
<222> 480..480
<223> n = a, g
c, or
t
<220>
<221> unsure
<222> 984..484
<223> n = a, g
c, or
t
<220>
<221> unsure
<222> 490..490
<223> n = a, g
c, or
t
<220>
<221> unsure
<222> 493..493
<223> n = a, g
c, or
t
<220>
<221> unsure
<222> 500..500
<223> n = a, g
c, or
t
CA 02344995 2001-04-04
WO 00/20587 36 PCT/US99/22873
<220>
<221> unsure
<222> 514..515
<223> n = a, c, g or t
<220>
<221> unsure
<222> 529..524
<223> n = a, c, g or t
<220>
<221> unsure
<222> 539..539
<223> n = a, c, g or t
<220>
<221> unsure
<222> 568..568
<223> n = a, c, g or t
<220>
<221> unsure
<222> 573..574
<223> n = a, c, g or t
<220>
<221> unsure
<222> 581..581
<223> n = a, c, g or t
<220>
<221> unsure
<222> 600..600
<223> n = a, c, g or t
<220>
<221> unsure
<222> 604..604
<223> n = a, c, g or t
<220>
<221> unsure
<222> 608..608
<223> n = a, c, g or t
<220>
<221> unsure
<222> 616..616
<223> n = a, c, g or t
<220>
<221> unsure
<222> 619..619
<223> n = a, c, g or t
<400> 43
accttaacct cctctgaccctgaattccagccatacattc ttttgccttt ttttcaaatc60
catgcaacca ttcaccataactcaaattagaagggacaga cacctttgga aataattttt120
tgagaacttc tttagcctccaactcaacagcttccacctg ttgctgcctt tcattgtttt180
tcttcctctg gtgttcaactgcatccttcaaagaatctaa ctcattccag agaccactta240
tttctttctc tctttctgaaattacttttaataattcttc atgaggggga aaagaagatg300
cctgttggta gttttgttgtttaagctgctcaatttggga cttaaacaat ttgttttcat360
cctgtacatc ctgtaacagctgtgttttgcnaagaaagtn actccccctc nccnttanca420
nggggtnnca acctncttaaatacanttcctttnncttta aananaatct naggttcctn480
caangggtan tgnaaaaaangcccctttcaagtnnggttg tgcnacttcc tgaacatgng540
ctttaagatc attttctctgaagatccngtacnnttcccg nattggtagg cttcccttcn600
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
37
ttcnaaanag cttcanggng
620
<210> 94
<211> 623
<212> DNA
<213> Homo sapi ens
<220>
<221> unsure
<222> 25..25
<223> n = a, c, g ort
<220>
<221> unsure
<222> 409..909
<223> n = a, c, g ort
<220>
<221> unsure
<222> 412..412
<223> n = a, c, g ort
<220>
<221> unsure
<222> 414..414
<223> n = a, c, g ort
<220>
<221> unsure
<222> 923..423
<223> n = a, c, g ort
<220>
<221> unsure
<222> 426..426
<223> n = a, c, g ort
<220>
<221> unsure
<222> 435..435
<223> n = a, c, g ort
<220>
<221> unsure
<222> 499..444
<223> n = a, c, g ort
<220>
<221> unsure
<222> 450..450
<223> n = a, c, g ort
<220>
<221> unsure
<222> 454..454
<223> n = a, c, g ort
<220>
<221> unsure
<222> 459..459
<223> n = a, c, g ort
<220>
<221> unsure
<222> 490..490
<223> n = a, c, g ort
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
38
<220>
<221> unsure
<222> 508..508
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 511..511
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 515..515
<223> n = a, c, g or
t
IS
<220>
<221> unsure
<222> 524..524
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 595..595
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 555..555
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 564..564
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 600..600
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 611..611
<223> n = a, c, g or
t
<400> 44
accttaacct cctctgaccctgaantccagccatacattcttttgcctttttttcaaatc 60
catgcaacca ttcaccataactcaaattagaagggacagacacctttggaaataattttt 120
tgagaacttc tttagcctccaactcaacagcttccacctgttgctgcctttccttggaag 180
tcttgttcac tttgtcctgcagcattttttcagttgatgccaatgcttccattgcttccc 290
agtttttctc ccgaaggtcattgtttttcttcctctggtgttcaactgcatccttcaaag 300
aatctaactc attccagagaccacttatttctttctctctttctgaaattacttttaata 360
attcttcatg agggggaaaagaagatgcctggtgggaatttggtggttnaancnggccaa 420
ttnggnacct aaaanatttggttncaactngtanaccgngtaaaaactgtgttttgctaa 480
aaagataacn ccccctctctttaagcanggnttcnaacctcttnattcatttccttttct 540
tcaanaaatc tcagntctcaaacngggatgcaaaagaggctcttcaagttaggtgggcn 600
a
acttccggaa natggcctttaaa 623
<210> 45
<211> 625
<212> DNA
<213> Romo sapiens
<220>
<221> unsure
<222> 392..392
<223> n = a, c, g or t
CA 02344995 2001-04-04
WO 00/20587 PCT/US99I22873
39
<220>
<221> unsure
<222> 408..408
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 417..417
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 421..421
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 424..425
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 437..437
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 439..439
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 456..456
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 467..467
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 469..469
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 473..473
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 475..975
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 496..496
<223> n = a, g or
c, t
<220>
<221> unsure
<222> 499.,500
<223> n = a, g or
c, t
<220>
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
40
<221> unsure
<222> 516..516
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 529..524
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 535..535
<223> n = a, c, g or
t
IS <220>
<221> unsure
<222> 538..538
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 560..560
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 582..582
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 592..592
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 594..594
<223> n = a, c, g or
t
<220>
<221> unsure
<222> 604..604
<223> n = a, c, g or
t
<900> 45
accttaacct cctctgaccctgaagtccagccatacattcttttgcctttttttcaaatc 60
catgcaacca ttcaccataactcaaattagaagggacagacacctttggaaataattttt 120
tgagaacttc tttagcctccaactcaacagcttccacctgttgctgcctttcattgtttt 180
tcttcctctg gtgttcaactgcatccttcaaagaatctaactcattccagagaccactta 290
tttctttctc tctttctgaaattacttttaataattcttcatgagggggaaaagaagatg 300
cctgttggta gttttgttgtttaagctgctcaatttgggacttaaacaatttgttttcat 360
cttgtacatc ctggtaacagctgtgttttgcntagaaaagattactcnccctctctnttt 420
ncanngggtt caacccntnaaattacatttcccttntcttaaacaanantctnangttct 480
tcaaactgtg atgcanaannggctctttcaagttangttgtgcnacttcctgaanatntg 540
ctttaaagat catttcttcntgaaatccgtaaccacttcccngtatgggcangncttccc 600
ttcncttcaa aaaagcctcaaggta 625
<210> 46
<211> 4416
<212> DNA
<213> Homo sapie ns
<900> 46
gccgcacagg gttttataggatcacattgacaaaagtaccatggagttttatgagtcagc 60
atattttatt gttcttattccttcaatagttattacagtaattttcctcttcttctggct 120
tttcatgaaa gaaacattatatgatgaagttcttgcaaaacagaaaagagaacaaaagct 180
tattcctacc aaaacagataaaaagaaagcagaaaagaaaaagaataaaaagaaagaaat 240
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
41
ccagaatggaaacctccatg 300
aatccgactc
tgagagtgta
cctcgagact
ttaaattatc
agatgctttggcagtagaag tgcacctgtt 360
atgatcaagt ccattgaatg
tcgttgaaac
ttcaagtagtgttagggaaa ggaaaagaaa 420
gaaaaaagaa caaaagcctg
tgcttgaaga
gcaggtcatcaaagaaagtg gattcctggc 480
acgcatcaaa aaaaaagtag
aacctgtccc
agttactaaacagcccacccctccctctgaagcagctgcc 590
tcgaagaaga
aaccagggca
gaagaagtctaaaaatggaagcgatgaccacjgataaaaag 600
gtggaaactc
tcatggtacc
atcaaaaaggcaagaagcattgcccctccaccaagagactaaacaagaaagtggatcagg660
gaagaagaaagcttcatcaaagaaacaaaagacagaaaatgtcttcgtagatgaacccct720
tattcatgcaactacttatattcctttgatggataatgctgactcaagtcctgtggtaga780
taagagagaggttattgatttgcttaaacctgaccaagtagaagggatccagaaatctgg890
gactaaaaaactgaagaccgaaactgacaaagaaaatgctgaagtgaagtttaaagattt900
tcttctgtccttgaagactatgatgttttctgaagatgaggctctttgtgttgtagactt960
gctaaaggagaagtctggtgtaatacaagatgctttaaagaagtcaagtaagggagaatt1020
gactacgcttatacatcagcttcaagaaaaggacaagttactcgctgctgtgaaggaaga1080
tgctgctgctacaaaggatcggtgtaagcagttaacccaggaaatgatgacagagaaaga1190
aagaagcaatgtggttataacaaggatgaaagatcgaattggaacattagaaaaggaaca1200
taatgtatttcaaaacaaaatacatgtcagttatcaagagactcaacagatgcagatgaa1260
gtttcagcaagttcgtgagcagatggaggcagagatagctcacttgaagcaggaaaatgg1320
tatactgagagatgcagtcagcaacactacaaatcaactggaaagcaagcagtctgcaga1380
actaaataaactacgccaggattatgctaggttggtgaatgagctgactgagaaaacagg1440
aaagctacagcaagaggaagtccaaaagaagaatgctgagcaagcagctactcagttgaa1500
ggttcaactacaagaagctgagagaaggtgggaagaagttcagagctacatcaggaagag1560
aacagcggaacatgaggcagcacagcaagatttacagagtaaatttgtggccaaagaaaa1620
tgaagtacagagtctgcatagtaagcttacagataccttggtatcaaaacaacagttgga1680
gcaaagactaatgcagttaatggaatcagagcagaaaagggtgaacaaagaagagtctct1740
acaaatgcaggttcaggatattttggagcagaatgaggctttgaaagctcaaattcagca1800
gttccattcccagatagcagcccagacctccgcttcagttctagcagaagaattacataa1860
agtgattgcagaaaaggataagcagataaaacagactgaagattctttagcaagtgaacg1920
tgatcgtttaacaagtaaagaagaggaacttaaggatatacagaatatgaatttcttatt1980
aaaagctgaagtgcagaaattacaggccctggcaaatgagcaggctgctgctgcacatga2040
attggagaagatgcaacaaagtgtttatgttaaagatgataaaataagattgctggaaga2100
gcaactacaacatgaaatttcaaacaaaatggaagaatttaagattctaaatgaccaaaa2160
caaagcattaaaatcagaagttcagaagctacagactcttgtttctgaacagcctaataa2220
ggatgttgtggaacaaatggaaaaatgcattcaagaaaaagatgagaagttaaagactgt2280
ggaagaattacttgaaactggacttattcaggtggcaactaaagaagaggagctgaatgc2390
aataagaacagaaaattcatctctgacaaaagaagttcaagacttaaaagctaagcaaaa2400
tgatcaggtttcttttgcctctctagttgaagaacttaagaaagtgatccatgagaaaga2460
tggaaagatcaagtctgtagaagagcttctggaggcagaacttctcaaagttgctaacaa2520
ggagaaaactgttcaggatttgaaacaggaaataaaggctctaaaagaagaaataggaaa2580
tgtccagcttgaaaaggctcaacagttatctatcacttccaaagttcaggagcttcagaa2640
cttattaaaaggaaaagaggaacagatgaataccatgaaggctgttttggaagagaaaga2700
gaaagacctagccaatacagggaagtggttacaggatcttcaagaagaaaatgaatcttt2760
aaaagcacatgttcaggaagtagcacaacataacttgaaagaggcctcttctgcatcaca2820
gtttgaagaacttgagattgtgttgaaagaaaaggaaaatgaattgaagaggttagaagc2880
catgctaaaagagagggagagtgatctttctagcaaaacacagctgttacaggatgtaca2940
agatgaaaacaaattgtttaagtcccaaattgagcagcttaaacaacaaaactaccaaca3000
ggcatcttcttttccccctcatgaagaattattaaaagtaatttcagaaagagagaaaga3060
aataagtggtctctggaatgagttagattctttgaaggatgcagttgaacaccagaggaa3120
gaaaaacaatgaaaggcagcaacaggtggaagctgttgagttggaggctaaagaagttct3180
caaaaaattatttccaaaggtgtctgtcccttctaatttgagttatggtgaatggttgca3290
tggatttgaaaaaaaggcaaaagaatgtatggctggaacttcagggtcagaggaggttaa3300
ggttctagagcacaagttgaaagaagctgatgaaatgcacacattgttacagctagagtg3360
tgaaaaatacaaatccgtccttgcagaaacagaaggaattttacagaagctacagagaag3920
tgttgagcaagaagaaaataaatggaaagttaaggtcgatgaatcacacaagactattaa3980
acagatgcag.tcatcatttacatcttcagaacaagagctagagcgattaagaagcgaaaa3540
taaggatattgaaaatctgagaagagaacgagaacatttggaaatggaactagaaaaggc3600
agagatggaacgatctacctatgttacagaagtcagagagttgaaggcacagttaaatga3660
aacactcacaaaacttagaactgaacaaaatgaaagacagaaggtagctggtgatttgca3720
taaggctcaacagtcactggagcttatccagtcaaaaatagtaaaagctgctggagacac3780
tactgttattgaaaatagtgatgtttccccagaaacggagtcttctgagaaggagacaat3840
gtctgtaagtctaaatcagactgtaacacagttacagcagttgcttcaggcggtaaacca3900
acagctcacaaaggagaaagagcactaccaggtgttagagtgaagtaattgggaaactgt3960
tcatttgaggataaaaaaggcattgtattatattttgccaaattaaagccttatttatgt4020
tttcaccctttctactttgtcagaaacactgaacagagttttgtcttttctaatccttgt4080
tagactactgatttaaagaaggaaaaaaaaaagccaactctgtagacaccttcagagttt9140
agttttataataaaaactgtttgaataattagacctttacattcctgaagataaacatgt4200
aatcttttatcttattttgctcaataaaattgttcagaagatcaaagtggtaaagacaat4260
CA 02344995 2001-04-04
WO 00/20587 PCT/US99/22873
42
gtaaaattta acattttaat actgatgttg tacactgttt tacttaacat tttgggaagt 4320
aactgcctct gacttcaact caagaaaaca cttttttgtt gctaatgtaa tcggtttttg 4380
taatggcgtc agcaaataaa aggatgctta ttattc 4416
