Note: Descriptions are shown in the official language in which they were submitted.
CA 02348156 2001-04-19
WO 00/Z3599 PCT/US99/24563
1 HUMAN PROTEINS RESPONSIBLE FOR ER DEGRADATION
BACKGROUND OF THE INVENTION
6
Field of the invention
The invention relates to degradation of proteins via the ubiquitin-
proteasome pathway. More particularly, the invention relates to the
degradation
of proteins at the endoplasmic reticulum, including cystic fibrosis
transmembrane
11 conductance regulator (CFTR), via the ubiquitin-proteasome pathway.
Summar,~r of the related art
Covalent modification of proteins through their conjugation with other
proteins is an important biological mechanism for regulating protein
metabolism
16 and biological activity. Hershko and Ciechanover, Annu. Rev. Biochem. 61:
761-
807 (1992) discloses conjugation of ubiquitin, one of the most conserved
eukaryotic proteins, to other proteins through an enzymatic mechanism, as well
as its role in protein degradation. Rock et al., Cell 78: 761-771 (1994)
discloses that
ubiquitination of protein antigens is required for processing of such
antigens.
21 Murray, Cell ~: 149-152 (1995), teaches that ubiquitination of cyclin is
involved
in cell cycle regulation. Scheffner et al., Cell 7~: 495-505 (1993) discloses
that
ubiquitination of p53 is involved in degradation of this tumor suppressor.
The enzymatic pathway for ubiquitination has been reasonably well
defined. Jentsch, Annu. Rev. Genet. 26: 179-207 (1992) discloses that
26 ubiquitination requires initial activation of a conserved C-terminal
glycine
residue by the ubiquitin activating enzyme, E1, through formation of ubiquitin
adenylate in an ATP-dependent process which liberates PPi, followed by
thioester formation at a thiol site in E1 with release of AMP. Ubiquitin is
then
transferred to a thiol site in ubiquitin conjugating enzyme, E2, through
formation
1
CA 02348156 2001-04-19
WO 00/23599 PCTNS99/Z4563
1 of a thioester bond. Ubiquitin is then transferred to.an epsilon amino group
of a
lysine residue in the target protein through an amide linkage, usually with
the
involvement of ubiquitin-protein isopeptide ligase, E3. Hopkin, J. Natl. Inst.
Health Res. 9: 36-42 (1997), teaches that target specificity is regulated by
the
particular combination of E2 and E3 protein, with more than 30 E2 proteins and
6 10 E3 proteins being known at present.
Most ubiquitin-conjugating enzymes thus far identified are soluble
proteins of the cytosol or of the nucleoplasm. Recent studies in yeast,
however,
report an integral membrane ubiquitin conjugating enzyme which is associated
with endoplasmic reticulum (ER) membrane. Sommer and Jentsch, Nature 3,~5:
11 176-179 (1993), discloses UBC6, a yeast integral membrane ubiquitin
conjugating
enzyme, and suggests that this enzyme mediates degradation of proteins at the
ER membrane. Biederer et al., EMBO J. 15: 2069-2076 (1996), teaches that
polyubiquitination, UBC6, a functional proteasome and UBC7, a soluble
ubiquitin-conjugating enzyme, are all required for proteolysis of key
components
16 of the translocation apparatus of the ER membrane.
The ER protein degradation system has now been proposed to be
associated with human disease. Aridor and Balch, Nature Medicine 5_: 745-750
(1999) teaches that many sporadic and inherited diseases arise from point
mutations which cause disorders in protein conformation and prevent export of
21 the protein from the ER. In many cases, the mutant protein undergoes rapid
degradation and the disease pathology is triggered by the absence of the
protein
from its target compartment. In other cases, the mutant protein accumulates in
the ER, with resultant toxic effects. Welsh and Smith, Cell 73:1251-1254
(1993) discloses that cystic fibrosis (CF) is caused by the functional absence
of a
26 plasma membrane chloride channel called cystic fibrosis transmembrane
conductance regulator (CFTR). Tsui, Trends Genet. 8: 392-398 (1992), teaches
that
the vast majority of CF cases are due to a deletion of a single phenylalanine
delta F508, hereafter "nF508") from a cytoplasmic portion of CFTR. Ward and
2
CA 02348156 2001-04-19
WO 00123599 PCT/US99/24563
Kopito, J. Biol. Chem. 2 9: 25710-25718 (1994), teaches that nF508 is retained
and
degraded in a pre-Golgi compartment. Yang et al., Proc. Natl. Acad. Sci. USA
90:
9480-9484 (1993), discloses that overexpressed nF508 precursors accumulate at
ER
membranes. Fra and Sitia, Sub-Cell Biochem. 21: 143-168 (1993), suggests that
immature eF508 molecules fail to fold properly and are degraded by a pathway
6 similar to yeast pathways described for ER degradation.
Qu et al., J. Biol. Chem. 271: 22791-22795 (1996) discloses that mutation in
the secretory protein a,-antitrypsin (al-AT) is associated with adult-onset
emphysema and infantile liver disease. The reference further teaches that lung
injury is due to a decrease in elastase inhibitory capacity ordinarily
provided by
11 a~-AT, whereas liver injury is due to the hepatotoxic effect of the
abnormally
folded mutant protein, which is retained in the ER The authors demonstrate
that
degradation of the mutant a~-AT protein, like that of nF508, is mediated by
the
proteasome. Qu et al. also teaches that a,-AT associates with the
transmembrane
molecular chaperone calnexin, and that it is the ubiquitination of calnexin
that
16 targets the complex for proteasome-mediated degradation.
These observations illustrate the need for new approaches for treating
diseases mediated by defects in ER processing.
Cheng et al., Cell 63: 827-834 (1990) suggests therapeutic treatment for CF
by blocking degradation of oF508. Unfortunately, such approaches have not been
21 successful. Ward et al., Cell $~: 121-127 (1995), teaches that proteasome
inhibitors
block the degradation of nF508 molecules, but that this leads to accumulation
of
polyubiquitinated oF508 forms which are not processed into a functional post-
ER
compartment.
There is, therefore, a need for methods and compositions for treating
26 human disease associated with proteasome-mediated ER protein degradation,
including promoting the maturation of mutant proteins such as oF508 and mutant
al-AT. Such methods may reside in preventing the ubiquitination of proteins
that
are the target of proteasome-mediated ER protein degradation. Ideally, such
3
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
methods would be specific for such proteins, including nF508 or CFTR or a,-AT,
rather than preventing ubiquitination of proteins generally.
4
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/Z4563
BRIEF SUMMARY OF THE INVENTION
The invention provides methods and compositions for treating human
disease associated with proteasome-mediated ER protein degradation. The
invention resides in the discovery of human proteins involved in proteasome-
6 mediated ER protein degradation and responsible for the ubiquitination of ER
proteins such as oF508, CFTR, and a,-AT. In a preferred embodiment, such
treatment entails promoting the maturation of oF508 into a functional CFTR and
provides understanding of the role of loss of CFTR function in cystic fibrosis
(CF).
In another preferred embodiment, such treatment entails promoting the
11 maturation of mutant a,-AT and/or preventing its accumulation iri the ER.
Thus, the methods and compositions according to the invention are more
specific
for proteins that are degraded in the ER by the ubiquitin-proteasome pathway,
such as nF508, CFTR, and at-AT, than are methods that would prevent
ubiquitination of proteins generally.
16 In certain aspects, the invention provides new purified ubiquitin-
conjugating enzymes and allelic variants thereof. In some embodiments, the new
purified ubiquitin-conjugating enzyme is membrane-bound. The primary amino
acid sequence of one preferred embodiment of such a membrane-bound
ubiquitin-conjugating enzyme (HSUBC14) is shown in Figure 1. The primary
21 amino acid sequence of a second preferred embodiment of such a membrane-
bound ubiquitin-conjugating enzyme (HSUBC15) is shown in Figure 2. In some
other embodiments, the new purified ubiquitin-conjugating enzyme is soluble.
The primary amino acid sequence of a preferred embodiment of such a soluble
ubiquitin-conjugating enzyme (HSUBC18) is shown in Figure 3.
26 In other aspects, the invention provides ubiquitin conjugating enzyme
expression elements. Such elements include, without limitation, isolated or
recombinant nucleic acid sequences encoding a ubiquitin conjugating enzyme
selected from the group consisting of HSUBC14, HSUBC15, HSUBC18, and
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
dominant negative mutants thereof, isolated or recombinant nucleic acid
sequences specifically homologous or specifically complementary thereto, and
vectors comprising any such isolated or recombinant nucleic acid sequences,
preferably expression vectors. Such ubiquitin conjugating enzyme expression
elements also include, without limitation, isolated or recombinant nucleic
acids
6 capable of expressing antisense transcripts targeted against a ubiquitin
conjugating enzyme selected from the group consisting of HSUBC14, HSUBC15,
and HSUBC18, and vectors comprising such isolated or recombinant nucleic
acids, preferably expression vectors.
The purified protein and its structural information provided herein
11 enables the preparation of HSUBC14-binding molecules (HSUBCI4BMs),
HSUBC15-binding molecules (HSUBCI5BMs), and HSUBC18-binding molecules
(HSUBCI8BMs), molecules that bind to HSUBC14, HSUBC15, or HSUBC18,
respectively. Thus, in some other aspects, the invention provides methods for
identifying HSUBCI4BMs, HSUBCI5BMs, and HSUBCI8BMs. One preferred
16 method according to these aspects of the invention comprises screening for
HSUBCI4BMs, HSUBCISBMs, or HSUBCI8BMs by contacting purified
HSUBC14, HSUBC15, or HSUBC18 according to the invention with populations
of molecules or mixed populations of molecules, and determining the presence
of
molecules which bind specifically to HSUBC14, HSUBC15, or HSUBC18.
21 Another preferred method according to these aspects of the invention
comprises
rationally designing molecules to bind HSUBC14, HSUBC15, or HSUBC18 based
upon structural information from the purified HSUBC14, HSUBC15, or HSUBC18
provided by the invention, and determining whether such rationally designed
molecules bind specifically to HSUBC14, HSUBC15, or HSUBC18. These aspects
26 of the invention include HSUBCI4BMs, HSUBCISBMs, and HSUBCI8BMs
identified by the methods according to the invention.
HSUBCI4BMs, HSUBCI5BMs, and HSUBCI8BMs can be used in
conventional assays to detect the presence or absence, and/or quantity of
6
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 HSUBC14, HSUBC15, or HSUBC18, or complexes of HSUBC14, HSUBC15, or
HSUBC18 with ubiquitin in a biological sample. Thus, in other aspects, the
invention pro~.~ides methods for determining the presence or absence and/or
quantity of H~UBC14, HSUBC15, HSUBC18, or complexes thereof with ubiquitin
in a biological sample. Such methods comprise providing a detectable
6 HSUBC14BM, HSUBC15BM, or HSUBC18BM to a biological sample, allowing the
detectable HSUBC14BM, HSUBC15BM, or HSUBC18BM to bind to HSUBC14,
HSUBC15, HSUBC18, or complex thereof with ubiquitin, if any is present in the
biological sample, and detecting the presence or absence and/or quantity of a
complex of the detectable HSUBC14BM, HSUBC15BM, or HSUBC18BM with the
11 HSUBC24, HSUBC15, HSUBC18, or complex thereof with ubiquitin.
Nucleic acid sequences specifically complementary to and/or specifically
homologous to nucleic acid sequences encoding HSUBC14, HSUBC15, or
HSUBC18 can also be used in conventional assays to detect the presence or
absence of HSUBC14, HSUBC15, or HSUBC18 nucleic acid in a biological sample.
16 Thus, in other aspects, the invention provides methods for determining the
presence or absence, and/or quantity of, HSUBC14, HSUBC15, or HSUBC18
nucleic acid in a biological sample. In preferred embodiments, such assays are
nucleic acid hybridization and/or amplification assays, such assays comprising
providing to the biological sample a nucleic acid sequence which is
specifically
21 complementary and/or specifically homologous to HSUBC14, HSUBC15, or
HSUBC18 nucleic acid.
In a sixth aspect, the invention provides methods for identifying
modulating ligands of HSUBC14, HSUBC15, or HSUBC18. Some HSUBCI4BMs,
HSUBCISBMs, and HSUBCI8BMs are capable of acting as antagonists or agonists
26 of HSUBC14, HSUBC15, or HSUBC18. Thus, the method according to these
aspects of the invention comprises providing HSUBCI4BMs, HSUBCI5BMs, or
HSUBCI8BMs to an assay system for HSUBC14, HSUBC15, or HSUBC18
participation in the ubiquitin-conjugation pathway, and determining whether
7
CA 02348156 2001-04-19
WO 00/23599 PCTNS99/24563
1 such HSUBCI4BMs, HSUBCISBMs, or HSUBC18BIVIs interfere with or enhance
the ability of HSUBC14, HSUBC15, or HSUBC18 to participate in the ubiquitin-
conjugation pathway. The HSUBCI4BMs, HSUBCI5BMs, or HSUBCI8BMs are
preferably provided as a population of molecules (most preferably rationally
designed molecules), or as a mixed population of molecules, as for example in
a
6 screening procedure. These aspects of the invention include modulating
ligands
of HSUBC14, HSUBC15, or HSUBC18 identified by this method according to the
invention.
In other aspects, the invention provides modulating ligands of HSUBC14,
HSUBC15, or HSUBC18. Preferred modulating ligands are HSUBCI4BMs,
11 HSUBCISBMs, or HSUBCI8BMs which act as antagonists, interfering with the
ability of HSUBC14, HSUBC15, or HSUBC18 to participate in the ubiquitin-
conjugation pathway. Other preferred modulating ligands are HSUBCI4BMs,
HSUBCISBMs, or HSUBCI8BMs which act as agonists, enhancing the ability of
HSUBC14, HSUBC15, or HSUBC18 to participate in the ubiquitin-conjugation
16 pathway. In certain embodiments, such HSUBCI4BMs, HSUBCI5BMs, or
HSUBCI8BMs preferably interact with HSUBC14, HSUBC15, or HSUBC18 to
inhibit or enhance the formation of a thioester bond between ubiquitin and
HSUBC14, HSUBC15, or HSUBC18, and/or transfer of ubiquitin to a protein
targeted for proteasome-mediated ER protein degradation, such as oF508, CFTR,
21 or al-AT.
In yet other aspects, the invention provides methods for modulating the
conjugation of ubiquitin or its transfer to a target protein, such as oF508,
CFTR, or
a,-AT. One preferred embodiment of the method according to these aspects of
the invention comprises providing a modulating ligand of HSUBC14, HSUBC15,
26 or HSUBC18, or a recombinant expression unit which expresses HSUBC14,
HSUBC15, or HSUBC18, or an antagonist thereof, to a biological system in which
ubiquitin is conjugated to a target protein, such as nF508, CFTR, or al-AT.
In still yet other aspects, the invention provides oligonucleotides that are
8
CA 02348156 2001-04-19
WO 00/23599 PCTNS99/24563
1 specifically complementary to a portion of a nucleotide sequence shown in
Figure
1, Figure 2, or Figure 3. Preferred embodiments include hybridization probes
and antisense oligonucleotides.
In still yet other aspects, the invention provides a method for
therapeutically treating diseases associated with proteasome-mediated ER
6 protein degradation. In certain preferred embodiments, the invention
provides a
method for therapeutically treating cystic fibrosis caused by failure of oF508
or
CFTR precursors to mature into functional CFTR. In certain other preferred
embodiments, the invention provides a method for therapeutically treating
emphysema caused by failure of mutant al-AT to be secreted. In yet other
11 preferred embodiments, the invention provides a method for therapeutically
treating Liver disease caused by an accumulation of mutant al-AT in the ER.
Preferred embodiments of these methods utilize agents that interfere with
HSUBC14, HSUBC15, or HSUBC18 protein function or expression of a gene
encoding HSUBC14, HSUBC15, or HSUBC18.
9
CA 02348156 2001-04-19
WO 00/23599 PCTNS99/24563
1
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows the nucleotide sequence [SEQ ID NO: 1] and deduced
amino acid sequence [SEQ ID NO: 2] for HSUBC14, with the active site cysteine
at
6 position 94 underlined.
Figure 2 shows the nucleotide sequence [SEQ ID NO: 3] and deduced
amino acid deduced amino acid sequence [SEQ ID NO: 4] for HSUBC15, with the
active site cysteine at position 91 underlined.
Figure 3 shows the nucleotide sequence [SEQ ID NO: 5] and deduced
11 amino acid sequence [SEQ ID NO: 6] for HSUBC18.
Figure 4 shows the alignment of the amino acid sequence for HSUBC14
with the yeast protein Ubc6 [SEQ ID NO: 7].
Figure 5 shows the alignment of the amino acid sequence for HSUBC15
with HSUBC14, the yeast protein Ubc6 [SEQ ID NO: 7], and the C. elegans
protein
16 ced 1022.1 [SEQ ID NO: 8].
Figure 6 shows the alignment of the amino acid sequence for HSUBC18
with the yeast protein Ubc7 [SEQ ID NO 9].
Figure 7 shows the results of an immunostaining experiment comparing
the immunostaining patterns of HSUBC14 (Ubchl4) and calreticulin.
21 Figure 8 shows the results of an immunostaining experiment comparing
the immunostaining patterns of HSUBC15 (Ubchl5) and calreticulin.
Figure 9 shows the results of an immunostaining experiment comparing
the immunostaining patterns of HSUBC18 (IJbchl8) and calreticulin.
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
DETAILED DESCRII''I ION OF THE PREFERRED EMBODIMENTS
The invention relates to degradation of proteins via the ubiquitin-
proteasome pathway. More particularly, the invention relates to the proteasome-
mediated ER protein degradation of target proteins, including, but not limited
to,
6 cystic fibrosis transmembrane conductance regulator (CFTR) and al-
antitrypsin
(al-AT), via the ubiquitin-proteasome pathway.
The invention provides methods and compositions for treating human
disease associated with proteasome-mediated ER protein degradation. The
invention resides in the discovery of human proteins involved in proteasome-
11 mediated ER protein degradation and responsible for the ubiquitination of
ER
proteins such as nF508, CFTR, and a,-AT. In a preferred embodiment, such
treatment entails promoting the maturation of oF508 into a functional CFTR and
provides understanding of the role of loss of CFTR function in cystic fibrosis
(CF).
In another preferred embodiment, such treatment entails promoting the
16 maturation of mutant a~-AT and/or preventing its accumulation in the ER.
Thus, the methods and compositions according to the invention are more
specific
for proteins that are degraded in the ER by the ubiquitin-proteasome pathway,
such as nF508, CFTR, and a1-AT, than are methods that would prevent
ubiquitination of proteins generally.
21 The novel human proteins of the invention are ubiquitin conjugating
enzymes. Certain of the new proteins are membrane-bound, while certain others
are soluble proteins. Because there are subtle differences in preferred
embodiments of some aspects of the invention relating to the membrane-bound
proteins as compared to the soluble proteins, the membrane-bound and soluble
26 proteins are separately described below. In particular, the first ten
aspects of the
invention described below relate to membrane-bound proteins, while the
description of the eleventh to twentieth aspects relates to soluble proteins.
Necessarily, there is considerable overlap in the descriptions relating to the
two
11
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 types of proteins, and they are combined in the Summary of the Invention
above.
In a first aspect, the invention provides new purified transmembrane
domain-containing ubiquitin-conjugating enzymes and allelic variants thereof.
The primary amino acid sequence of one preferred embodiment of the new
6 ubiquitin-conjugating enzyme (HSUBC14) is shown in Figure 1. The active site
cysteine, C94, forms thioester bonds with ubiquitin. Amino acid residues 231-
249
form a transmembrane domain. The transmembrane domain can be deleted to
form a soluble HSUBC14, which is a preferred embodiment of this aspect of the
invention. Accordingly, for purposes of the invention, "I-ISUBC14" refers to
both
11 the soluble and transmembrane domain-containing embodiments, unless
otherwise specified or evident from context. The full length protein has 39%
sequence identity to yeast Ubc6. An alignment of IiSUBCI4 with yeast Ubc6 is
shown in Figure 4.
The primary amino acid sequence of a second preferred embodiment of a
16 new ubiquitin-conjugating enzyme (HSUBC15) is shown in Figure 2. The active
site cysteine, C91, forms thioester bonds with ubiquitin. Amino acid residues
288-303 form a transmembrane domain. The transmembrane domain can be
deleted to form a soluble I3SUBC15, which is a preferred embodiment of this
aspect of the invention. Accordingly, for purposes of the invention, "I-
iSUBCIS"
21 refers to both the soluble and transmembrane domain-containing embodiments,
unless otherwise specified or evident from context. The full length protein
has
22% sequence identity to yeast Ubc6 and 40% sequence identity to a C. elegans
homologue, ced1022.1. An alignment of I-iSUBCIS with yeast Ubc6 and
ced1022.1 is shown in Figure 5.
26 For purposes of the invention, the terms "HSUBC14" and "HSUBC15" are
intended to include allelic variants thereof. An "allelic variant", as used
herein, is
a protein having at least about 50% amino acid sequence identity, more
preferably at least about 75%, even more preferably at least about 85%, still
more
12
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 preferably at least about 95%, , even more preferably at least about 96%,
yet even
more preferably at least about 97%, more preferably yet at least about 98% and
most preferably at least about 99% sequence identity to the amino acid
sequence
set forth in SEQ ID NO: 2 or SEQ ID NO: 4, or to a portion or protein
conjugate
thereof which retains the biological activities of HSUBC14 or HSUBC15,
6 respectively, to (1) form a thioester linkage with ubiquitin, and (2) to
transfer
ubiquitin to a target protein such as nF508 or to CFTR, both under conditions
as
described in the examples below and at a rate at least 10% of that of HSUBC14
or
HSUBC15, respectively, preferably at least 25% as fast, more preferably at
least
50% as fast, and most preferably at least 75% as fast.
11 Preferably, such biologically active portion of HSUBC14 comprises an
amino acid sequence spanning residue 94 in Figure 1, more preferably comprises
at least the amino acid sequence NTRLCLS, yet more preferably comprises at
least about 25 additional amino acids of HSUBC14, even more preferably at
least
about 50 additional amino acids of HSUBC14, still more preferably at least
about
16 75 additional amino acids of HSUBC14, yet even more preferably at least
about
100 additional amino acids of HSUBC14, and most preferably at least about 150
additional amino acids of HSUBC14.
Preferably, such biologically active portion of HSUBC25 comprises an
amino acid sequence spanning residue 91 in Figure 2, more preferably comprises
21 at least the amino acid sequence KKICLS, yet more preferably comprises at
least
about 25 additional amino acids of HSUBC15, even more preferably at least
about
50 additional amino acids of HSUBC15, still more preferably at least about 75
additional amino acids of HSUBC15, yet even more preferably at least about 100
additional amino acids of HSUBC15, and most preferably at least about 150
26 additional amino acids of HSUBC15.
The term "spanning residue x" is intended to mean comprising residue x
and amino acid residues in both the N-terminal and the C-terminal directions
from residue x, as that residue is indicated in Figure 1 or Figure 2.
Preferably,
13
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 such residues in the N-terminal and C-terminal directions are immediately
adjacent residue x. Such allelic variants have the biological activity of
HSUBC14
or HSUBC15, as discussed above. In alternative preferred embodiments, such
allelic variants are either rationally designed or naturally occurring allelic
variants, i.e., they are expressed in actual individual mammals, most
preferably
6 from actual individual humans or mice. Rationally designed allelic variants
can
be produced according to standard art-recognized procedures (see e.g.,
international publication W095/18974).
"Purified", as used herein means having less than about 25% by weight,
and preferably less than about 10% by weight contamination with other
proteins.
11 Such purified proteins may be obtained from natural sources, from
recombinant
expression, or by chemical synthesis. "Protein", as used herein and
hereinbelow
is intended to encompass any polypeptide having at least 10 amino acid
residues.
16 In a second aspect, the invention provides ubiquitin conjugating enzyme
expression elements. Such elements include, without limitation, isolated or
recombinant nucleic acid sequences encoding HSUBC14, HSUBC15, or dominant
negative mutants thereof, isolated or recombinant nucleic acid sequences
specifically homologous or specifically complementary thereto, and vectors
21 comprising any such isolated or recombinant nucleic acid sequences,
preferably
expression vectors. Such ubiquitin conjugating enzyme expression elements also
include; without limitation isolated or recombinant nucleic acids capable of
expressing antisense transcripts targeted against HSUBC14 or HSUBC15 and
vectors comprising such isolated or recombinant nucleic acids, preferably
26 expression vectors.
For purposes of the invention, amino acid sequence identity and homology
are determined using the program Clustal W Version 1.6 to do sequence
alignment (Thompson et al., Nucleic Acids Res 22: 4673-4680 (1994)). For
viewing
14
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 aligned sequences, the program GeneDoc Version 2.2 was used. A sequence is
"specifically homologous" to another sequence if it is sufficiently homologous
to
specifically hybridize to the exact complement of the sequence. A sequence is
"specifically complementary" to another sequence if it is sufficiently
homologous
to specifically hybridize to the sequence. A sequence "specifically
hybridizes" to
6 another sequence if it hybridizes to form Watson-Crick or Hoogsteen base
pairs
either in the body, or under conditions which approximate physiological
conditions with respect to ionic strength, e.g.,140 mM NaCI, 5 mM MgClz.
Preferably, such specific hybridization is maintained under stringent
conditions,
e.g., 0.2X SSC at 68°C.
1I A "recombinant expression element" is a nucleic acid sequence which
encodes HSUBC14 or HSUBC15, or a portion encoding at least 15 contiguous
amino acids thereof, or a dominant negative mutant thereof, or is capable of
expressing an antisense molecule specifically complementary thereto, or a
sense
molecule specifically homologous thereto, wherein the recombinant expression
16 unit may be in the form of linear DNA or RNA, covalently closed circular
DNA
or RNA, or as part of a chromosome, provided however that it cannot be the
native chromosomal locus for HSUBC14 or HSUBC15. Preferred recombinant
expression elements are vectors, which may include an origin of replication
and
are thus replicatable in one or more cell type. Certain preferred recombinant
21 expression elements are expression vectors, and further comprise at least a
promoter and passive terminator, thereby allowing transcription of the
recombinant expression element in a bacterial, fungal, plant, insect or
mammalian
cell. Preferred recombinant expression elements have at least 75% nucleic acid
sequence identity with the nucleic acid sequence set forth in SEQ ID NO: 2 or
26 SEQ ID NO: 4, more preferably at least 90%, even more preferably at least
95%,
and most preferably at least 99%, and encode a protein or peptide having
either
HSUBC14 or HSUBC15 biological activity, as described above, or activity as a
dominant negative mutant thereof, as further described below.
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 "Dominant negative mutants" are proteins or peptides derived from
HSUBC14 or HSUBC15 which inhibit the biological activity of HSUBC14 or
HSUBC15, respectively. Preferred dominant negative mutants include variants in
which the C at position 94 of HSUBC14 or the C at position 91 of HSUBC15 is
substituted, preferably by S. Preferred dominant negative mutants can be
6 derived from HSUBC14 or HSUBC15 and interfere with covalent bond formation
between ubiquitin and HSUBC14 or HSUBC15, respectively, or interfere with
transfer of ubiquitin from HSUBC14 or HSUBC15 to nF508, CFTR, or a1-AT.
Such dominant negative mutants can be prepared by art recognized procedures
(see e.g., Townsley et al., Proc. Natl. Acad. Sci. USA 94: 2362-2367 (1997)).
11 Preferably, such dominant negative mutant is a protein or peptide having
from
50% amino acid sequence identity to about 99% sequence identity to the amino
acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 4, or to a portion or
protein conjugate thereof which inhibits the biological activity of HSUBC14 or
HSUBC15 to form a thioester linkage with ubiquitin or transfer ubiquitin to a
16 target protein such as nF508, CFTR, or a~-AT, under conditions as described
in
the following examples. Preferably, such inhibition is by at least 50%,
preferably
by at least 75%, more preferably by at least 90% and most preferably by at
least
99%. In certain preferred embodiments, such inhibitory portion comprises an
amino acid sequence spanning residue 94 of HSUBC14, as shown in Figure 1,
21 more preferably comprises at least about 25 additional amino acids of
HSUBC14,
or at least about 50 additional amino acids of HSUBC14, or at least about 75
additional amino acids of HSUBC14, or at least about 100 additional amino
acids
of HSUBC14, or even at least about 150 additional amino acids of HSUBC14. In
certain other preferred embodiments, such inhibitory portion comprises an
amino
26 acid sequence spanning residue 91 of HSUBC15, as shown in Figure 2, more
preferably comprises at least about 25 additional amino acids of HSUBC15, or
at
least about 50 additional amino acids of HSUBC15, or at least about 75
additional
amino acids of HSUBC15, or at least about 100 additional amino acids of
16
CA 02348156 2001-04-19
WO 00/23599 PCT/US99l24563
HSUBC15, or even at least about 150 additional amino acids of HSUBC15.
For purposes of this aspect of the invention, the term "spanning residue x"
means comprising amino acid residues in both the N-terminal and C-terminal
directions from residue x, as that residue is shown in Figure 1 or Figure 2.
Preferably, residue x itself may be substituted by one or more amino acids,
more
6 preferably from about 1 to about 50 amino acids, or residue x may be absent.
Preferably the amino acids in the N-terminal and C-terminal directions from
residue x are each independently within 20 amino acids of residue x, as shown
in
Figure 1 or Figure 2, more preferably within 10, even more preferably within
5,
and most preferably are immediately adjacent residue x as shown in Figure 1 or
11 Figure 2. As used herein, oF508 may be used to refer to either the
phenylalanine
residue at position 508 of CFTR, or may more usually be used to refer to a
mutant
CFTR molecule in which such phenylalanine residue is substituted by one or
more amino acids, more preferably from about 1 to about 50 amino acids, or in
which such phenylalanine residue is deleted.
16
The purified protein and its structural information provided herein
enables the preparation of HSUBCI4BMs and HSUBCI5BMs, molecules that bind
to HSUBC14 or HSUBC15, respectively. Thus, in a third aspect, the invention
provides methods for identifying HSUBCI4BMs or HSUBCI5BMs. One
21 preferred method according to this aspect of the invention comprises
screening
for HSUBCI4BMs or HSUBCISBMs by contacting purified HSUBC14 or
HSUBC15 according to the invention with populations of molecules or mixed
populations of molecules and determining the presence of molecules which bind
specifically to HSUBC14 or HSUBC15. Another preferred method according to
26 this aspect of the invention comprises rationally designing molecules to
bind
HSUBC14 or HSUBC15 based upon structural information from the purified
HSUBC14 or HSUBC15 provided by the invention and determining whether such
rationally designed molecules bind specifically to HSUBC14 or HSUBC15. In
17
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
either case, soluble HSUBC14 and soluble HSUBC15 can be prepared by
removing the respective transmembrane domains, and the soluble proteins are
preferably used as targets for HSUBCI4BMs or HSUBCISBMs. Thus, for
purposes of this aspect of the invention, the terms "HSUBC14" and "HSUBC15"
specifically include soluble HSUBC14 and soluble HSUBC15.
6 Molecules that bind specifically to HSUBC14 or HSUBC15 are molecules
that bind to HSUBC14 or HSUBC15 with greater affinity than to other unrelated
proteins. Preferably, binding affinity of the molecule for FISUBC14 or HSUBC15
is at least 5-fold greater than its affinity for unrelated proteins, more
preferably at
least 10-fold greater, still more preferably at least 50-fold greater, and
most
11 preferably at least 100-fold greater. This aspect of the invention includes
HSUBCI4BMs and HSUBC25BMs identified by the methods according to the
invention.
As used herein, a"HSUBC14-binding molecule", or "HSUBC14BM", is a
molecule or macromolecule which binds under physiological conditions to
16 HSUBC14. A "HSUBC15-binding molecule", or "HSUBC15BM", is a molecule or
macromolecule which binds under physiological conditions to HSUBC15. "Binds
under physiological conditions" means forming a covalent or non-covalent
association with an affinity of at least 106M-', most preferably at least 109
M-' ,
either in the body, or under conditions which approximate physiological
21 conditions with respect to ionic strength, e.g., 140 mM NaCI, 5 mM MgCl2. A
"population of molecules", as used herein, refers to a plurality of identical
molecules. A"mixed population of molecules" refers to a plurality of molecules
wherein more than one type of molecule is present.
in certain preferred embodiments, a HSUBC14BM or HSUBC15BM
26 according to the invention is a peptide or a peptidomimetic. For purposes
of the
invention, a "peptide" is a molecule comprised of a linear array of amino acid
residues connected to each other in the linear array by peptide bonds. Such
peptides according to the invention may include from about three to about 500
18
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 amino acids, and may further include secondary, tertiary or quaternary
structures, as well as intermolecular associations with other peptides or
other
non-peptide molecules. Such intermolecular associations may be through,
without limitation, covalent bonding (e.g., through disulfide linkages), or
through
chelation, electrostatic interactions, hydrophobic interactions, hydrogen
bonding,
6 ion-dipole interactions, dipole-dipole interactions, or any combination of
the
above.
In certain preferred embodiments, such an HSUBC14BM or HSUBC15
comprises a complementarity determining region of an antibody which binds
under physiological conditions to a peptide-containing epitope of HSUBC14 or
11 HSUBC15, or a peptidomimetic of such a complementarity determining region.
For purposes of the invention, a "complementarity determining region of an
antibody" is that portion of an antibody which binds under physiological
conditions to an epitope, including any framework regions necessary for such
binding, and which is preferably comprised of a subset of amino acid residues
16 encoded by the human heavy chain V, D and J regions, the human light chain
V
and J regions, and/or combinations thereof. Examples of such preferred
embodiments include an antibody, or an antibody derivative, which may more
preferably be a monoclonal antibody, a human antibody, a humanized antibody,
a single-chain antibody, a chimeric antibody, or an antigen-binding antibody
21 fragment.
Those skilled in the art are enabled to make any such antibody derivatives
using standard art-recognized techniques. For example, Jones et al., Nature
~2_l:
522-525 (1986) discloses replacing the CDRs of a human antibody with those
from a mouse antibody. Marx, Science 229: 455- 456 (1985) discusses chimeric
26 antibodies having mouse variable regions and human constant regions.
Rodwell,
Nature 342: 99-100 (1989) discusses lower molecular weight recognition
elements
derived from antibody CDR information. Clackson, Br. J. Rheumatol. X052: 36-39
(1991) discusses genetically engineered monoclonal antibodies, including Fv
19
18
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 fragment derivatives, single chain antibodies, fusion proteins chimeric
antibodies
and humanized rodent antibodies. Reichman et aL, Nature 332: 323-327 (1988)
discloses a human antibody on which rat hypervariable regions have been
grafted. Verhoeyen, et al., Science 239: 1534-1536 (1988) teaches grafting of
a
mouse antigen binding site onto a human antibody.
6 In addition, those skilled in the art are enabled to design and produce
peptidomimetics having binding characteristics similar or superior to such
complementarity determining region (see e.g., Horwell et al., Bioorg. Med.
Chem.
4_: 1573 (1996); Liskamp et al., Recl. Trav. Chim. Pays- Bas 1: lI3 (1994);
Gante et
al., Angew. Chem. Int. Ed. Engl. ~: 1699 (1994); Seebach et al., Helv. Chim.
Acta
11 79: 913 (1996)). Accordingly, all such antibody derivatives and
peptidomimetics
thereof are contemplated to be within the scope of the present invention.
Compositions according to the invention may further include physiologically
acceptable diluents, stabilizing agents, localizing agents or buffers.
Additional preferred HSUBCI4BMs or HSUBCISBMs according to the
16 invention include small molecules, which can be identified using screening
or
rational design approaches as discussed later herein.
HSUBCI4BMs and HSUBCISBMs can be used in conventional assays to
detect the presence or absence, and/or quantity of HSUBC14 or HSUBC15, or
21 complexes of HSUBC14 or HSUBC15 with ubiquitin, in a biological sample.
Thus, in a fourth aspect, the invention provides methods for determining the
presence or absence and/or quantity of HSUBC14 or HSUBC15 or complex
thereof with ubiquitin in a biological sample. Such methods comprise providing
a detectable HSUBC14BM or HSUBC15BM to a biological sample, allowing the
26 detectable HSUBC14BM or HSUBC15BM to bind to HSUBC14, HSUBC15, or
complex thereof with ubiquitin, if any is present irt the biological sample,
and
detecting the presence or absence and/or quantity of a complex of the
detectable
HSUBC14BM or HSUBC15BM with the HSUBC14, HSUBC15, or complex thereof
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
with ubiquitin.
A detectable HSUBC14BM or HSUBC15BM is an HSUBC14BM or
HSUBC15BM which can be detected in an assay. Such detection is preferably
through the direct or indirect binding of a tag or label on the HSUBC14BM or
HSUBC15BM. "Direct or indirect binding" means that the tag or label may be
6 directly connected to the HSUBC14BM or HSUBC15BM by intermolecular
association, or may be connected via intermediate molecules to the HSUBC14BM
or HSUBC15BM by intermolecular association. Such intermolecular associations
may be through, without limitation, covalent bonding (e.g., through disulfide
linkages), or through chelation, electrostatic interactions, hydrophobic
11 interactions, hydrogen bonding, ion-dipole interactions, dipole-dipole
interactions, or any combination of the above. Preferred tags and labels
include,
without limitation, radioisotopes, heavy metals, fluorescent labels,
chemoluminescent labels, enzymes and enzyme substrates. Preferred biological
samples include blood, serum, plasma, cells, tissue portions, and cell or
tissue
16 extracts. In certain preferred embodiments, the method according to this
aspect
of the invention takes the form of a conventional ELISA or RIA. In another
preferred embodiment, the method employs either direct or indirect
immunofluorescence. Additional preferred embodiments utilize in vivo imaging
of cells expressing HSUBC14 or HSUBC15 using conventional imaging agents
21 directly or indirectly bound to an HSUBC14BM or HSUBC15BM according to the
invention.
Nucleic acid sequences specifically complementary to and/or specifically
homologous to nucleic acid sequences encoding HSUBC14 or HSUBC15 can also
26 be used in conventional assays to detect the presence or absence of HSUBC14
or
HSUBC15 nucleic acid in a biological sample. Thus, in a fifth aspect, the
invention provides methods for determining the presence or absence and/or
quantity of HSUBC14 or HSUBC15 nucleic acid in a biological sample. In
21
CA 02348156 2001-04-19
WO 00/23599 PCTNS99/24563
preferred embodiments, such assays are nucleic acid hybridization and/or
amplification assays, such assays comprising providing to the biological
sample a
nucleic acid sequence which is specifically complementary and/or specifically
homologous to HSUBC14 or HSUBC15 nucleic acid. Particularly preferred
embodiments include Northern blotting, dot or slot blotting, and polymerase
6 chain reaction.
In a sixth aspect, the invention provides methods for identifying
modulating ligands of HSUBC14 or HSUBC15. Some HSUBCI4BMs and
HSUBCISBMs are capable of acting as antagonists or agonists of HSUBC14 or
11 HSUBClS. Thus, the method according to this aspect of the invention
comprises
providing HSUBCI4BMs or HSUBCI5BMs to an assay system for HSUBC14 or
HSUBC15 participation in the ubiquitin-conjugation pathway, and determining
whether such HSUBCI4BMs or HSUBCISBMs interfere with or enhance the
ability of HSUBC14 or HSUBC15 to participate in the ubiquitin-conjugation
16 pathway. The HSUBCI4BMs or HSUBCISBMs are preferably provided as a
population of molecules (most preferably rationally designed molecules), or as
a
mixed population of molecules, as for example in a screening procedure. This
aspect of the invention includes modulating ligands of HSUBC14 or HSUBC15
identified by this method according to the invention.
21 In preferred embodiments of this aspect of the invention, the method
comprises providing HSUBCI4BMs or HSUBCISBMs to an assay system for
HSUBC14 or HSUBC15 participation in the ubiquitination of ER proteins, and
determining whether such HSUBCI4BMs or HSUBCISBMs interfere with or
enhance the ability of HSUBC14 or HSUBC15 to participate in the ubiquitination
26 of ER proteins. More preferably, the ER protein is nF508, CFTR, or a,-AT.
Assessment of ability to interfere with or enhance the ability of HSUBC14 or
HSUBC15 to participate in the ubiquitin-conjugation pathway can conveniently
be carried out using an in vitro activity system, as later described herein.
22
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 Alternatively, the cloned gene encoding HSUBCI4.or HSUBC15 can be expressed
in yeast sec61 mutants, thereby allowing them to grow at restrictive
temperatures
(above 37°C (see Sommer and jentsch, Nature 365: 176-180 (1993)).
Inhibitors can
then be identified by their reversal of the ability of cells expressing HSUBC
14 or
HSUBC15 to grow at restrictive temperatures. In either case, such interference
or
6 enhancement preferably results in a reduction of ubiquitin-conjugation of at
least
50%, more preferably at least 90%, and most preferably, at least 99%, or an
increase of ubiquitin-conjugation of at least 50%, preferably at least 2-fold,
more
preferably at least 5-fold, most preferably at least 10-fold.
As used herein, nF508 may be used either to refer to a mutation of the
11 phenylalanine residue at position 508 of CFTR, or may more usually be used
to
refer to a mutant CFTR molecule in which such phenylalanine residue is
substituted by one or more amino acids, more preferably from about 1 to about
50
amino acids, or in which such phenylalanine residue is deleted.
16 In a seventh aspect, the invention provides modulating ligands of
HSUBC14 or HSUBC15. Preferred modulating ligands are HSUBCI4BMs or
HSUBCISBMs which act as antagonists, interfering with the ability of HSUBC14
or HSUBC15 to participate in the ubiquitination of ER proteins, and preferably
are capable of interfering with the conjugation of ubiquitin to eF508, CFTR,
or a,-
21 AT. Other preferred modulating ligands are HSUBCI4BMs or HSUBCI5BMs
which act as agonists, enhancing the ability of HSUBC14 or HSUBC15 to
participate in the ubiquitination of ER proteins, and preferably are capable
of
enhancing the conjugation of ubiquitin to nF508, CFTR, or a~-AT. In certain
embodiments, such HSUBCI4BMs or HSUBCISBMs preferably interact with
26 HSUBC14 or HSUBC15 to inhibit or enhance the formation of a thioester bond
between ubiquitin and HSUBC14 or HSUBC15 and/or inhibit or enhance the
transfer of ubiquitin to nF508, CFTR, or a~-AT.
Preferably, such inhibition or enhancement is specific, i.e., the modulating
23
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
ligand interferes with or enhances the ability of HSUBC14 or HSUBC1S to
participate in the conjugation of ubiquitin to nF508, CFTR, or al-AT at a
concentration that is lower than the concentration of the ligand required to
produce another, unrelated biological effect. Preferably, the concentration of
the
ligand required for ubiquitin-nF508, CFTR, or al-AT conjugation modulating
6 activity is at least 2-fold Lower, more preferably at least 5-fold lower,
even more
preferably at least 10-fold lower, and most preferably at least 20-fold lower
than
the concentration required to produce an unrelated biological effect.
In an eighth aspect, the invention provides methods for modulating the
11 conjugation of ubiquitin to HSUBC14 or HSUBC15 or its transfer to a target
protein, such as nF508, CFTR, or a~-AT. One preferred embodiment of the
method according to this aspect of the invention comprises providing a
modulating ligand of HSUBC14 or HSUBC15 or a recombinant expression unit
which expresses HSUBC14 or HSUBC15 or an antagonist thereof to a biological
16 system in which ubiquitin is conjugated to a target protein, preferably an
ER
protein such as nF508, CFTR, or a~-AT.
The term "biological system", as used herein, includes in vitro cell or tissue
extracts, cell cultures, tissue cultures, organ cultures, living plants and
animals,
including mammals, including without limitation humans and mice. An
21 "antagonist" is a molecule which inhibits the biological activity of
HSUBC14 or
HSUBC15.
In a ninth aspect, the invention provides oligonucleotides that are
specifically complementary to a portion of a nucleotide sequence shown in
Figure
26 1 or Figure 2. Preferred embodiments include hybridization probes and
antisense
oligonucleotides.
For purposes of the invention, the term oligonucleotide includes polymers
of two or more deoxyribonucleotide, or any modified nucleoside, including 2'-
24
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
halo-nucleosides, 2'-O-substituted ribonucleosides,.deazanucleosides or any
combination thereof. Preferably, such oligonucleotides have from about 10 to
about I00 nucleosides, more preferably from about 15-50, and most preferably
from about 15 to 35. Such monomers may be coupled to each other by any of the
numerous known internucleoside linkages. In certain preferred embodiments,
6 these internucleoside linkages may be phosphodiester, phosphotriester,
phosphorothioate, or phosphoramidate linkages, or combinations thereof. The
term oligonucleotide also encompasses such polymers having chemically
modified bases or sugars and/or having additional substituents, including
without limitation lipophilic groups, intercalating agents, diamines and
11 adamantane. For purposes of the invention the term "2'-O-substituted" means
substitution of the 2' position of the pentose moiety with a halogen
(preferably Cl,
Br, or F), or an O-lower alkyl group containing 1-6 saturated or unsaturated
carbon atoms, or with an O-aryl or allyl group having 2-6 carbon atoms,
wherein
such alkyl, aryl or allyl group may be unsubstituted or may be substituted,
e.g.,
16 with halo, hydroxy, trifluoromethyl, cyano, nitro, acyl, acyloxy, alkoxy,
carboxyl,
carballcoxyl, or amino groups; or such 2' substitution may be with a hydroxy
group (to produce a ribonucleoside), an amino or a halo group, but not with a
2'-
H group. Certain embodiments of such oligonucleotides are useful in
hybridization assays. Other embodiments are useful as antisense
21 oligonucleotides for use in animal model or human therapeutic settings.
In a tenth aspect, the invention provides a method for therapeutically
treating diseases associated with proteasome-mediated ER protein degradation.
In certain preferred embodiments, the invention provides a method for
26 therapeutically treating cystic fibrosis caused by failure of nF508 or CFTR
precursors to mature into functional CFTR. Slowing the rate of ubiquitination
of
nF508 allows it to mature into functional CFTR. Thus, interference with
HSUBC14 or HSUBC15 function or expression should allow maturation into
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 functional CFTR.
In certain other preferred embodiments, the invention provides a method
for therapeutically treating emphysema caused by failure of mutant a,-AT to be
secreted. Slowing the rate of ubiquitination of calnexin should slow the rate
of
degradation of the al-AT that is associated to it, thereby allowing it to be
secreted.
6 Preferably, these embodiments utilize agents that interfere with HSUBC14
or HSUBC15 protein function or expression of a gene encoding HSUBC14 or
HSUBC15. Preferred agents that interfere with HSUBCI4 or HSUBC15 protein
function include modulating ligands of HSUBC14 or HSUBC15, respectively,
preferably modulating ligands of HSUBC14 or HSUBC15 which act as antagonists
11 of HSUBC14 or HSUBC15. Preferred agents that interfere with the expression
of
a gene encoding HSUBC14 or HSUBC15 include antisense nucleic acids or
antisense oligonucleotides specifically complementary to a portion of the
nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 3.
In other preferred embodiments, the invention provides a method for
16 therapeutically treating liver disease caused by accumulation of mutant al-
AT in
the ER Qu ef al. teaches that there is a lag in ER degradation of mutant a,-AT
in
hosts susceptible to the development of liver disease. Enhancing the rate of
ubiquitination of calnexin should increase the rate of degradation of the a1-
AT
associated with it.
21 Preferably, these embodiments utilize agents that enhance HSUBC14 or
HSUBC15 protein function or expression of a gene encoding HSUBC14 or
HSUBC15. Preferred agents that enhance HSUBC14 or HSUBC15 protein
function include modulating ligands of HSUBC14 or HSUBC15, respectively,
preferably modulating ligands of HSUBC14 or HSUBC15 which act as agonists of
26 HSUBC14 or HSUBC15.
In an eleventh aspect, the invention provides a new purified soluble
ubiquitin-conjugating enzyme and allelic variants thereof. The primary amino
26
CA 02348156 2001-04-19
WO 00/23599 PCTNS99/24563
acid sequence of a preferred embodiment of the new ubiquitin-conjugating
enzyme (HSUBC18) is shown in Figure 3. The active site cysteine, C89, forms
thioester bonds with ubiquitin. The protein has 62% sequence identity to yeast
Ubc7. An alignment of HsUbcl8 with yeast Ubc7 is shown in Figure 6.
For purposes of the invention, the term "HSUBC18" is intended to include
6 allelic variants thereof. An "allelic variant", as used herein, is a protein
having at
least about 75%, more preferably at least about 85%, still more preferably at
least
about 95%, even more preferably at least about 96%, yet even more preferably
at
least about 97%, more preferably yet at least about 98% and most preferably at
least about 99% sequence identity to the amino acid sequence set forth in SEQ
ID
11 NO: 6, or to a portion or protein conjugate thereof which retains the
biological
activities of HSUBC18 to (1) form a thioester linkage with ubiquitin, and (2)
to
transfer ubiquitin to a target protein such as nF508 or to CFTR, both under
conditions as described in the examples below and at a rate at least 10% of
that of
HSUBC18, preferably at least 25% as fast, more preferably at least 50% as
fast,
16 and most preferably at least 75% as fast. Preferably, such biologically
active
portion comprises an amino acid sequence spanning residue 89 in Figure 3, more
preferably comprises at least about 25 additional amino acids of HSUBC18, even
more preferably at least about 50 additional amino acids of HSUBC18, still
more
preferably at least about 75 additional amino acids of HSUBC18, yet even more
21 preferably at least about 100 additional amino acids of HSUBC18, and most
preferably at least about 150 additional amino acids of HSUBC18. "Spanning
residue 89" is intended to mean comprising amino acid residues in both the N-
terminal and the C-terminal directions from residue 89, as that residue is
indicated in Figure 3. Preferably, such residues in the N-terminal and C-
terminal
26 directions are immediately adjacent residue 89. Such allelic variants have
the
biological activity of HSUBC18, as discussed above. In alternative preferred
embodiments, such allelic variants are either rationally designed or naturally
occurring allelic variants, i.e., they are expressed in actual individual
mammals,
27
CA 02348156 2001-04-19
WO 00/Z3599 PCT/US99/24563
1 most preferably from actual individual humans or Fnice. Rationally designed
allelic variants can be produced according to standard art-recognized
procedures
(see e.g., international publication W095/ 18974). "Purified", as used herein
means
having less than about 25% by weight, and preferably less than about 10% by
weight contamination with other proteins. Such purified proteins may be
6 obtained from natural sources, from recombinant expression, or by chemical
synthesis. "Protein", as used herein and hereinbelow is intended to encompass
any polypeptide having at least 10 amino acid residues.
In a twelfth aspect, the invention provides HSUBC18 expression elements.
11 Such elements include, without limitation, isolated or recombinant nucleic
acid
sequences encoding HSUBC18 or dominant negative mutants thereof, or capable
of expressing antlsense transcripts thereof or nucleic acid sequences
specifically
homologous or specifically complementary thereto, and vectors comprising any
such recombinant expression elements, preferably expression vectors.
16 A sequence is "specifically homologous" to another sequence if it is
sufficiently homologous to specifically hybridize to the exact complement of
the
sequence. A sequence is "specifically complementary" to another sequence if it
is
sufficiently homologous to specifically hybridize to the sequence. A sequence
"specifically hybridizes" to another sequence if it hybridizes to form Watson-
21 Crick or Hoogsteen base pairs either in the body, or under conditions which
approximate physiological conditions with respect to ionic strength, e.g., 140
mM
NaCI, 5 mM MgCl2. Preferably, such specific hybridization is maintained under
stringent conditions, e.g., 0.2X SSC at 68°C. A "recombinant expression
element"
is a nucleic acid sequence which encodes HSUBC18, or a portion encoding at
least
26 15 contiguous amino acids thereof or encoding a dominant negative mutant
thereof, a nucleic acid sequence specifically homologous or specifically
complementary thereto, or a nucleic acid capable of expressing an antisense
molecule specifically complementary thereto or a sense molecule specifically
28
CA 02348156 2001-04-19
WO 00/23599 PCTNS99/24563
1 homologous thereto, wherein the recombinant expression unit may be in the
form
of linear DNA or RNA, covalently closed circular DNA or RNA, or as part of a
chromosome, provided however that it cannot be the native chromosomal locus
for HSUBC18. Preferred recombinant expression elements are vectors, which
may include an origin of replication and are thus replicatable in one or more
cell
6 type. Certain preferred recombinant expression elements are expression
vectors,
and further comprise at least a promoter and passive terminator, thereby
allowing transcription of the recombinant expression element in a bacterial,
fungal, plant, insect or mammalian cell. Preferred recombinant expression
elements have at least 75% nucleic acid sequence identity with the nucleic
acid
11 sequence set forth in SEQ ID NO: 5, more preferably at least 90%, even more
preferably at least 95%, and most preferably at least 99%, and encode a
protein or
peptide having either HSUBC18 biological activity, as described above, or
activity
as a dominant negative mutant thereof, as further described below.
"Dominant negative mutants" are proteins or peptides derived from
16 HSUBC18 which inhibit the biological activity of HSUBC18. Preferred
dominant
negative mutants include variants in which the C at position 89 of HSUBC18 is
substituted, preferably by S. Preferred dominant negative mutants can be
derived from HSUBC18 and interfere with covalent bond formation between
ubiquitin and HSUBC18 or transfer of ubiquitin from HSUBC18 to a target
21 protein such as nF508, CFTR, or al-AT. Such dominant negative mutants can
be
prepared by art recognized procedures (see e.g., Townsley et al., Proc. Natl.
Acad.
Sci. USA 94: 2362-2367 (1997)). Preferably, such dominant negative mutant is a
protein or peptide having from 75% amino acid sequence identity to about 99%
sequence identity to the amino acid sequence set forth in SEQ ID NO: 5, or to
a
26 portion or protein conjugate thereof which inhibits the biological activity
of
HSUBC18 to form a thioester linkage with ubiquitin or transfer ubiquitin to a
protein target such as oF508, CFTR, or a,-AT, under conditions as described in
the following examples by at least 50%, preferably by at least 75%, more
z9
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
preferably by at least 90% and most preferably by at least 99%. Preferably,
such
inhibitory portion comprises an amino acid sequence spanning residue 89, more
preferably comprises at least about 25 additional amino acids of HSUBC18, or
at
least about 50 additional amino acids of HSUBC18, or at least about 75
additional
amino acids of HSUBC18, or at least about 100 additional amino acids of
6 HSUBC18, or even at least about 150 additional amino acids of HSUBC18. For
purposes of this aspect of the invention, the term "spanning residue 89" means
comprising amino acid residues in both the N-terminal and C-terminal
directions
from residue 89, as that residue is shown in Figure 3. Preferably, residue 89
itself
may be substituted by one or more amino acids, more preferably from about 1 to
11 about 50 amino acids, or residue 89 may be absent. Preferably the amino
acids in
the N-terminal and C-terminal directions from residue 89 are each
independently
within 20 amino acids of residue 89, as shown in Figure 3, more preferably
within
10, even more preferably within 5, and most preferably are immediately
adjacent
residue 89 as shown in Figure 3. As used herein, oF508 may be used to refer to
16 either the phenylalanine residue at position 508 of CFTR, or may more
usually be
used to refer to a mutant CFTR molecule in which such phenylalanine residue is
substituted by one or more amino acids, more preferably from about 1 to about
50
amino acids, or in which such phenylalanine residue is deleted.
21 The purified protein and its structural information provided herein
enables the preparation of HSUBC18 binding molecules, HSUBCIBBMs. Thus, in
a thirteenth aspect, the invention provides methods for identifying
HSUBCI8BMs. One preferred method according to this aspect of the invention
comprises screening for HSUBCI8BMs by contacting purified HSUBC18
26 according to the invention and populations of molecules or mixed
populations of
molecules and determining the presence of molecules which bind specifically to
HSUBC18. Another preferred method according to this aspect of the invention
comprises rationally designing molecules to bind HSUBC18 based upon
CA 02348156 2001-04-19
WO 00/Z3599 PCT/US99/24563
1 structural information from the purified HSUBC18 provided by the invention
and
determining whether such rationally designed molecules bind specifically to
HSUBC18. Molecules that bind specifically to HSUBC18 are molecules that bind
to HSUBC18 with greater affinity than to other unrelated proteins. Preferably,
binding affinity of the molecule for HSUBC18 is at least 5-fold greater than
its
6 affinity for unrelated proteins, more preferably at least 10-fold greater,
still more
preferably at least 50-fold greater, and most preferably at least 100-fold
greater.
This aspect of the invention includes HSUBCIBBMs identified by the methods
according to the invention.
As used herein, a"HSUBC18-binding molecule", or "HSUBC18BM", is a
11 molecule or macromolecule which binds under physiological conditions to
HSUBC18. "Binds under physiological conditions" means forming a covalent or
non-covalent association with an affinity of at least 106M-', most preferably
at
least 109M-' , either in the body, or under conditions which approximate
physiological conditions with respect to ionic strength, e.g.,140 mM NaCI, 5
mM
16 MgCl2. A "population of molecules", as used herein, refers to a plurality
of
identical molecules. A"mixed population of molecules" refers to a plurality of
molecules wherein more than one type of molecule is present.
In certain preferred embodiments, a HSUBC18BM according to the
invention is a peptide or a peptidomimetic. For purposes of the invention, a
21 "peptide" is a molecule comprised of a linear array of amino acid residues
connected to each other in the linear array by peptide bonds. Such peptides
according to the invention may include from about three to about 500 amino
acids, and may further include secondary, tertiary or quaternary structures,
as
well as intermolecular associations with other peptides or other non-peptide
26 molecules. Such intermolecular associations may be through, without
limitation,
covalent bonding (e.g., through disulfide linkages), or through chelation,
electrostatic interactions, hydrophobic interactions, hydrogen bonding, ion-
dipole
interactions, dipole-dipole interactions, or any combination of the above.
31
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 In certain preferred embodiments, such an HSUBC18BM comprises a
complementarity determining region of an antibody which binds under
physiological conditions to a peptide-containing epitope of HSUBC18, or a
peptidomimetic of such a complementarity determining region. For purposes of
the invention, a "complementarity determining region of an antibody" is that
6 portion of an antibody which binds under physiological conditions to an
epitope,
including any framework regions necessary for such binding, and which is
preferably comprised of a subset of amino acid residues encoded by the human
heavy chain V, D and J regions, the human light chain V and J regions, and/or
combinations thereof. Examples of such preferred embodiments include an
11 antibody, or an antibody derivative, which may more preferably be a
monoclonal
antibody, a human antibody, a humanized antibody, a single-chain antibody, a
chimeric antibody, or an antigen-binding antibody fragment.
Those skilled in the art are enabled to make any such antibody derivatives
using standard art-recognized techniques. For example, Jones et al., Nature
X21:
16 522-525 (1986) discloses replacing the CDRs of a human antibody with those
from a mouse antibody. Marx, Science 229: 455- 456 (1985) discusses chimeric
antibodies having mouse variable regions and human constant regions. Rodwell,
Nature 42: 99-100 (1989) discusses lower molecular weight recognition elements
derived from antibody CDR information. Clackson, Br. J. Rheumatol. 30~r2: 36-
39
21 (1991) discusses genetically engineered monoclonal antibodies, including Fv
fragment derivatives, single chain antibodies, fusion proteins chimeric
antibodies
and humanized rodent antibodies. Reichman et al., Nature 332: 323-327 (1988)
discloses a human antibody on which rat hypervariable regions have been
grafted. Verhoeyen, et al., Science 239: 1534-1536 (1988) teaches grafting of
a
26 mouse antigen binding site onto a human antibody.
In addition, those skilled in the art are enabled to design and produce
peptidomimetics having binding characteristics similar or superior to such
complementarity determining region (see e.g., Horwell et al., Bioorg. Med.
Chem.
32
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
4: 1573 (1996); Liskamp et aL, Recl. Trav. Chim. Pays- Bas 1: 113 (1994);
Gante et
al., Angew. Chem. Int. Ed. Engl. 33: 1699 (1994); Seebach et al., Helv. Chim.
Acta
79: 913 (1996)). Accordingly, all such antibody derivatives and
peptidomimetics
thereof are contemplated to be within the scope of the present invention.
Compositions according to the invention may further include physiologically
6 acceptable diluents, stabilizing agents, localizing agents or buffers.
Additional preferred HSUBCI8BMs according to the invention include
small molecules, which can be identified using screening or rational design
approaches as discussed later herein.
11 HSUBCI8BMs can be used in conventional assays to detect the presence or
absence, and/or quantity of HSUBC18, or HSUBC18/ubiquitin complex in a
biological sample. Thus, in a fourteenth aspect, the invention provides
methods
for determining the presence or absence and/or quantity of HSUBC18 or
HSUBC18/ubiquitin complex in a biological sample. Such methods comprise
16 providing a detectable HSUBC18BM to a biological sample, allowing the
detectable HSUBC18BM to bind to HSUBC18 or HSUBC18/ubiquitin complex, if
any is present in the biological sample, and detecting the presence or absence
and/or quantity of a complex of the detectable HSUBC18BM and HSUBClB, or
HSUBC28/ubiquitin complex.
21 A detectable HSUBC18BM is an HSUBC18BM which can be detected in an
assay. Such detection is preferably through the direct or indirect binding of
a tag
or label on the HSUBC18BM. "Direct or indirect binding" means that the tag or
label may be directly connected to the HSUBC18BM by intermolecular
association, or may be connected via intermediate molecules to the HSUBC18BM
26 by intermolecular association. Such intermolecular associations may be
through,
without limitation, covalent bonding (e.g., through disulfide linkages), or
through
chelation, electrostatic interactions, hydrophobic interactions, hydrogen
bonding,
ion-dipole interactions, dipole-dipole interactions, or any combination of the
33
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 above. Preferred tags and labels include, without limitation, radioisotopes,
heavy
metals, fluorescent labels, chemoluminescent labels, enzymes and enzyme
substrates. Preferred biological samples include blood, serum, plasma, cells,
tissue portions, and cell or tissue extracts. In certain preferred
embodiments, the
method according to this aspect of the invention takes the form of a
conventional
6 ELISA or RIA. In another preferred embodiment, the method employs either
direct or indirect immunofluorescence. Additional preferred embodiments
utilize in vivo imaging of cells expressing HSUBC18 using conventional imaging
agents directly or indirectly bound to an HSUBC18BM according to the
invention.
11
Nucleic acid sequences specifically complementary to and/or specifically
homologous to nucleic acid sequences encoding HSUBC18 can also be used in
conventional assays to detect the presence or absence of HSUBC18 nucleic acid
in
a biological sample. Thus, in a fifteenth aspect, the invention provides
methods
16 for determining the presence or absence and/or quantity of HSUBC18 nucleic
acid in a biological sample. In preferred embodiments, such assays are nucleic
acid hybridization and/or amplification assays, such assays comprising
providing to the biological sample a nucleic acid sequence which is
specifically
complementary and/or specifically homologous to HSUBC18 nucleic acid.
21 Particularly preferred embodiments include Northern blotting, dot or slot
blotting, and polymerase chain reaction.
In a sixteenth aspect, the invention provides methods for identifying
modulating ligands of HSUBC18. Some HSUBCI8BMs are capable of acting as
26 antagonists or agonists of HSUBC18. Thus, the method according to this
aspect of
the invention comprises providing HSUBCI8BMs to an assay system for
HSUBC18 participation in the ubiquitin-conjugation pathway, and determining
whether such HSUBCI8BMs interfere with or enhance the ability of HSUBC18 to
34
CA 02348156 2001-04-19
WO 00/23599 PCTNS99/24563
participate in the ubiquitin-conjugation pathway. The HSUBCI8BMs are
preferably provided as a population of molecules (most preferably rationally
designed molecules), or as a mixed population of molecules, as for example in
a
screening procedure. This aspect of the invention includes modulating ligands
of
HSUBC18 identified by this method according to the invention.
6 In preferred embodiments of this aspect of the invention, the method
comprises providing HSUBCI8BMs to an assay system for HSUBC18
participation in the ubiquitination of ER proteins, and determining whether
such
HSUBCIBBMs interfere with or enhance the ability of HSUBC18 to participate in
the ubiquitination of ER proteins. More preferably, the ER protein is eF508,
11 CFTR, or a~-AT. Assessment of ability to interfere with or enhance the
ability of
HSUBC18 to participate in the conjugation of ubiquitin to eF508, CFTR, or a~-
AT
can converuentiy be carried out using an in vitro activity system, as later
described herein. Alternatively, the cloned gene encoding HSUBC18 can be
expressed in yeast sec61 mutants, thereby allowing them to grow at restrictive
16 temperatures (above 37°C (see Sommer and Jentsch, Nature ~5: 176-180
(1993)).
Inhibitors can then be identified by their reversal of the ability of cells
expressing
HSUBC18 to grow at restrictive temperatures. In either case, such interference
or
enhancement preferably results in a reduction of ubiquitin-eF508, CFTR, or a,-
AT conjugation of at least 50%, more preferably at least 90%, and most
preferably,
21 at least 99%, or an increase of ubiquitin-eF508, CFTR, or a,-AT conjugation
of at
least 50%, preferably at least 2-fold, more preferably at least 5-fold, most
preferably at least 10-fold.
In a seventeenth aspect, the invention provides modulating ligands of
26 HSUBC18. Preferred modulating ligands are HSUBCI8BMs which act as
antagonists, interfering with the ability of HSUBC18 to participate in the
ubiquitination of ER proteins and preferably are capable of interfering with
the
conjugation of ubiquitin to eF508, CFTR, or a~-AT. Other preferred modulating
CA 02348156 2001-04-19
WO 00/23599 PCT/US99124563
1 ligands are HSUBCI8BMs which act as agonists, enhancing the ability of
HSUBC18 to participate in the ubiquitination of ER proteins and preferably are
capable of enhancing the conjugation of ubiquitin to nF508, CFTR, or a~-AT. In
certain embodiments, such HSUBCI8BMs preferably interact with HSUBC18 to
inhibit or enhance the formation of a thioester bond between ubiquitin and
6 HSUBC18 and/or transfer of ubiquitin to a protein targeted for proteasome-
mediated ER protein degradation, such as oF508, CFTR, or a1-AT.
Preferably, such inhibition or enhancement is specific, i.e., the modulating
ligand interferes with or enhances the ability of HSUBC18 to participate in
the
conjugation of ubiquitin to an ER protein such as eF508, CFTR, or a,-AT at a
11 concentration that is lower than the concentration of the ligand required
to
produce another, unrelated biological effect. Preferably, the concentration of
the
ligand required for ubiquitin-nF508, CFTR, or al-AT conjugation modulating
activity is at least 2-fold lower, more preferably at least 5-fold lower, even
more
preferably at least 10-fold lower, and most preferably at least 20-fold lower
than
16 the concentration required to produce an unrelated biological effect.
In an eighteenth aspect, the invention provides methods for modulating
the conjugation of ubiquitin to HSUBC18 or its transfer to a target protein,
preferably an ER protein such as oF508, CFTR, or al-AT. One preferred
21 embodiment of the method according to this aspect of the invention
comprises
providing a modulating ligand of HSUBC18 or a recombinant expression unit
which expresses HSUBC18 or an antagonist thereof to a biological system in
which ubiquitin is conjugated to a target protein, such as nF508, CFTR, or al-
AT.
The term "biological system", as used herein, includes in vitro cell or tissue
26 extracts, cell cultures, tissue cultures, organ cultures, living plants and
animals,
including mammals, including without limitation humans and mice. An
"antagonist" is a molecule which inhibits the biological activity of HSUBC18.
36
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 In a nineteenth aspect, the invention provides oligonucleotides that are
specifically complementary to a portion of a nucleotide sequence shown in
Figure
3. Preferred embodiments include hybridization probes and antisense
oligonucleotides.
For purposes of the invention, the term oligonucleotide includes polymers
6 of two or more deoxyribonucleotide, or any modified nucleoside, including 2'-
halo-nucleosides, 2'-O-substituted ribonucleosides, deazanucleosides or any
combination thereof. Preferably, such oligonucleotides have from about 10 to
about 100 nucleosides, more preferably from about 15-50, and most preferably
from about 15 to 35. Such monomers may be coupled to each other by any of the
11 numerous known internucleoside linkages. In certain preferred embodiments,
these internucleoside linkages may be phosphodiester, phosphotriester,
phosphorothioate, or phosphoramidate linkages, or combinations thereof. The
term oligonucleotide also encompasses such polymers having chemically
modified bases or sugars and/or having additional substituents, including
16 without limitation lipophilic groups, intercalating agents, diamines and
adamantane. For purposes of the invention the term "2'-O-substituted" means
substitution of the 2' position of the pentose moiety with a halogen
(preferably Cl,
Br, or F), or an O-lower alkyl group containing 1-6 saturated or unsaturated
carbon atoms, or with an O-aryl or allyl group having 2-6 carbon atoms,
wherein
21 such alkyl, aryl or allyl group may be unsubstituted or may be substituted,
e.g.,
with halo, hydroxy, trifluoromethyl, cyano, vitro, acyl, acyloxy, alkoxy,
carboxyl,
carbalkoxyl, or amino groups; or such 2' substitution may be with a hydroxy
group (to produce a ribonucleoside), an amino or a halo group, but not with a
2'-
H group. Certain embodiments of such oligonucleotides are useful in
26 hybridization assays. Other embodiments are useful as antisense
oligonucleotides for use in animal model or human therapeutic settings.
In a twentieth aspect, the invention provides a method for therapeutically
37
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 treating diseases associated with proteasome-mediated ER protein
degradation.
In certain preferred embodiments, the invention provides a method for
therapeutically treating cystic fibrosis caused by failure of eF508 or CFTR
precursors to mature into functional CFTR. Slowing the rate of ubiquitination
of
nF508 allows it to mature into functional CFTR. Thus, interference with
6 HSUBC14 or HSUBC15 function or expression should allow maturation into
functional CFTR.
In certain other preferred embodiments, the invention provides a method
for therapeutically treating emphysema caused by failure of mutant a,-AT to be
secreted. Slowing the rate of ubiquitination of calnexin should slow the rate
of
11 degradation of the a,-AT that is associated to it, thereby allowing it to
be secreted.
Preferably, these embodiments utilize agents that interfere with HSUBC 18
protein function or expression of a gene encoding HSUBC18. Preferred agents
that interfere with HSUBC18 protein function include modulating ligands of
HSUBC18, preferably modulating ligands of HSUBCI8 which act as antagonists
16 of HSUBC18. Preferred agents that interfere with the expression of a gene
encoding HSUBC18 include antisense nucleic acids or antisense oligonucleotides
specifically complementary to a portion of the nucleotide sequence set forth
in
SEQ ID NO: 5.
In other preferred embodiments, the invention provides a method for
21 therapeutically treating liver disease caused by accumulation of mutant a,-
AT in
the ER. Qu et al. teaches that there is a lag in ER degradation of mutant al-
AT in
hosts susceptible to the development of liver disease. Enhancing the rate of
ubiquitination of calnexin should increase the rate of degradation of the a,-
AT
associated with it.
26 Preferably, these embodiments utilize agents that enhance HSUBC18
protein function or expression of a gene encoding HSUBCIB. Preferred agents
that enhance HSUBC18 protein function include modulating ligands of
HSUBC18, preferably modulating ligands of HSUBC18 which act as agonists of
38
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 HSUBC18.
The patents and publications cited hereinabove and hereinbelow reflect the
knowledge in the art and are hereby incorporated by reference in entirety,
whether or not specifically so stated. Any inconsistency between these patents
6 and publications and the present disclosure shall be resolved in favor of
the
present disclosure.
The following examples are intended to further illustrate certain
particularly preferred embodiments of the invention and are not intended to
limit
11 the scope of the invention. Searches of the human EST database utilized the
program BLAST (Altschul et al.., Nucleic Acids Res 25: 3389-3402 (1997)).
Searches for transmembrane helices used the program Antheprot V.3.0 Gilbert
Deleague, Institute de Biologie et Chemie des Proteines 69 367 Lyon cdex 07,
France.
16
Example 1
Identification and Cloning of Human HSUBC14 Gene
The human EST database was searched using the first 120 amino acids of
the S, cerevisiae Ubc6 gene product as a query sequence. The EST clone GenBank
21 accession # W90647 was found to contain a nucleic acid sequence encoding
the
amino acid sequence MITPNGRXKCNTRLCLSITDFHPDTWNP. This sequence
contains 24 amino acids which are identical to the yeast Ubc6 sequence
flanking
the active site cysteine. This clone was used to search for further EST
clones. The
search led to the construction of a contiguous consensus sequence from
26 overlapping clones which predicts a gene to encode a protein having 259
amino
acids, with a predicted molecular mass of 28,897 Da. The contiguous nucleotide
sequence was obtained using nested PCR on a human leukocyte cDNA library.
The first PCR used primers having the sequence
39
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 GAGAGATGAGCAGCACCAGC (forward) and CTCACTCCTGCGCGATGCTC
(reverse). The second PCR was carried out with the primers
GGGAATTCCCATATC AGCAGCACCAGCAGTAAG (forward, initiator
methionine codon underlined) and
CCCAAGCTTT~CTCCTGCGCGATGCTCCTCAG (reverse, reverse compliment
6 of stop codon underlined). The second PCR product was digested with NdeI and
HindIII and ligated with the large fragment of NdeI/HindIII-digested pT7-7 to
yield the plasmid pT7-7-HSUBC14. The insert was sequenced by standard
procedures. The nucleotide sequence and deduced amino acid sequence are
shown in Figure 1. The encoded full-length protein has 259 amino acids, and
11 shares 39% amino acid sequence identity and 55% sequence homology with
yeast
Ubc6. This homology suggests that HSUBC14 plays a role in human ER
proteasome-mediated protein degradation, analogous to the role played by Ubc6
in yeast. An alignment of HSUBC14 with yeast Ubc6 is shown in Figure 4.
16 Example 2
Exlaression and localization of HSUBC14
Expression of Ubcl4 in HeLa cells was carried out by transfecting HeLa
cells with pFLAG-CMV-2 expression vector (Kodak, IBI) in which the human
Ubcl4 cDNA was inserted at the CIaI and KpnI site. This insertion generates a
21 protein sequence in which the N-terminus of Ubcl4 was extended by the amino
acid sequence MDYKDDDDKLAAANSS. Expression of the protein was
confirmed by Western blot using anti-FLAG antibodies that recognize the
sequence DYKDDDDK. When cell extract was centrifuged to separate the soluble
and particulate fractions, anti-FLAG immunoreactivity on Western blot was
26 detected only in the particulate fraction, as expected for a membrane-
anchored
ubiquitin conjugating enzyme.
To determine the intracellular localization of HSUBC14, HeLa cells
transfected with the pFLAG-CMV-2-HSUBC14 plasmid described above were
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 subjected to immunostaining using a mouse anti-FLAG antibody in conjunction
with a rabbit anti-calreticulin antibody (Affinity Bioreagents, Inc.). The
mouse
anti-FLAG antibody was detected with a secondary goat anti-mouse antibody
conjugated to OG488 (Molecular Probes). The rabbit anti-calreticulin antibody
was detected with a goat secondary anti-rabbit antibody conjugated to RedX
6 (Molecular Probes). Calreticulin is a resident protein of the endoplasmic
reticulum and is present in all cells. The immunostaining pattern of
calreticulin is
perinuclear, with reticular staining extending to the cell periphery. The
immunostaining pattern of the anti-FLAG in the transfected cells was largely
coincident with the calreticulin pattern, indicating that HSUBC14 was mainly
11 localized to the endoplasmic reticulum (see Figure 7). In addition, the
anti-FLAG
immunostaining pattern detected localization of HSUBC14 at the nuclear rim,
which was not distinctly stained by the anti-calreticulin antibody, and is
therefore
a specific characteristic of HSUBC14 localization.
A mutant of HSUBC14 was constructed by replacing the active site
16 cysteine with a serine using standard site-specific mutagenesis. The
immunostaining pattern of the mutant was determined by the same methods
described for the wild-type and was found to be identical to that of wild-type
HSUBC14.
21 Example 3
Thioester bond formation of HSUBC14 with ubic~uitin
Components (as indicated below) are incubated in a reaction buffer
containing 25 mM Hepes (pH7.0),10 mM MgZ+ and 1 mM ATP for 5 minutes at
30°C. The reaction is stopped by addition of SDS sample loading buffer.
Each
26 sample is divided into two aliquots, to one of which was added DTT to a
final
concentration of 10 mM. The DTT-containing sample is heated in a 95 °C
bath for
two minutes. Samples are separated on 10% SDS-Tricine PAGE, followed by
transfer to nitrocellulose filters. Filters are stained using conventional
Western
41
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 blot staining procedures with anti-FLAG antibodies. HSUBC14 is expected to
migrate as both a 29 kDa band and a 35 kDa band in the presence of ubiquitin
and ATP, and the presence of the 35 kDa band is expected to be reversible by
DTT.
Reaction No. Pr ins
6 1 E1 + ubiquitin
2 particulate fraction (from Example 2) + ubiquitin
3 particulate fraction (from Example 2) + ubiquitin + El
Example 4
11 Identification and Cloning of Human HSUBC15 Gene
The human EST database was searched using GenBank accession #
AA488873 as the starting query to obtain other human EST clones that contain
overlapping nucleic acid sequences. Sequences of the identified EST clones
were
aligned using the program CLUSTALW (Thompson et al., Nucleic Acids Res.
16 22:4673-4680 (1994)) or the program SeqMan (DNASTAR). These analyses
generated a contiguous sequence, as well as a consensus sequence (CON1).
Homology search of CON1 led to the identification of a putative C. elegans Ubc
gene (ced1022.1 ce02575). Another homology search was conducted using 10-20%
of the 5' and 3' sequences of CONl as the query sequence. the new EST clones
21 were assembled and used to construct a second consensus sequence (CON2).
The
CON2 sequence was translated, and the process was repeated until an initiator
methionine and a stop codon were identified.
The coding sequence of HSUBC15 was obtained by nested PCR on a
human leukocyte cDNA library. In the first PCR reaction, the primers
26 CAGCGACCCACCATGGAGACC (forward) and
GAAGCAGTTGAGTCACAGCTC (reverse) were used. The primers
CCATCGATGGAGACCCGCTACAAC (forward) and
CGCGGATCCTTATAACTCAAAGTC (reverse) were used in the second PCR
42
CA 02348156 2001-04-19
WO 00/23599 PCTNS99/24563
1 reaction. The product was Iigated to pCR2.1 and sequenced. The
experimentally
obtained nucleotide and deduced protein sequences are shown in Figure 2.
HSUBC15 contains 318 amino acids and has a predicted molecular mass of 35,181
Da. The full-length protein shares 22% amino acid sequence identity with yeast
Ubc6 and 40% amino acid sequence identity with C, elegr~ns ced1022.1. This
6 homology suggests that HSUBC15 may play a role in human ER proteasome-
mediated protein degradation analogous to the role played by Ubc in yeast. An
alignment of HSUBC15 with yeast Ubc6 and ced1022.1 is shown in Figure 5.
Example 5
11 Expression and localization of HSUBC15
Expression of HSUBC15 in HeLa cells was carried out by transfecting
HeLa cells with pFLAG-CMV-2 expression vector (Kodak, IBI) in which the
human Ubcl5 cDNA was inserted at the CIaI and KpnI site. This insertion
generates a protein sequence in which the N-terminus of HSUBC15 is extended
16 by the amino acid sequence MDYKDDDDKLAAANSS. Expression of the protein
was confirmed by Western blot using anti-FLAG antibodies that recognize the
sequence DYKDDDDK. When cell extract is centrifuged to separate the soluble
and particulate fractions, anti-FLAG immunoreactivity on Western blot is
detected in the particulate fraction, as expected for a membrane-anchored
21 ubiquitin conjugating enzyme. Deletion of the transmembrane domain allows
expression of soluble protein.
To determine the intracellular localization of HSUBC15, HeLa cells
transfected with the pFLAGCMV-2-HSUBC15 plasmid described above were
subjected to immunostaining using a mouse anti-FLAG antibody in conjunction
26 with a rabbit anti-calreticulin antibody (Affinity Bioreagents, Inc.). The
mouse
anti-FLAG antibody was detected with a secondary goat anti-mouse antibody
conjugated to OG488 (Molecular Probes). The rabbit anti-calreticulin antibody
was detected with a goat secondary anti-rabbit antibody conjugated to RedX
43
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
(Molecular Probes). Calreticulin is a resident protein of the endoplasmic
reticulum and is present in all cells. The immunostaining pattern of
calreticulin is
perinuclear, with reticular staining extending to the cell periphery. The
immunostaining pattern of the anti-FLAG in the transfected cells was
coincident
with the calreticulin pattern, indicating that HSUBC15 was mainly localized to
6 the endoplasmic reticulum (see Figure 8). The anti-FLAG immunostaining
pattern did not detect localization of HSUBC15 at the nuclear rim, which is a
specific characteristic of HSUBC14 localization.
A mutant of HSUBC15 was constructed by replacing the active site
cysteine with a serine using standard site-specific mutagenesis. The
11 immunostainirtg pattern of the mutant was determined by the same methods
described for the wild-type and was found to be identical to that of wild-type
HSUBC15.
Example 6
16 Thioester bond formation of HSUBC15 with ubic~uitin
Components (as indicated below) are incubated in a reaction buffer
containing 25 mM Hepes (pH 7.0),10 mM Mg2+ and 1 mM ATP for 5 minutes at
30°C. The reaction is stopped by addition of SDS sample loading buffer.
Each
sample is divided into two aliquots, to one of which was added DTT to a final
21 concentration of 10 mM. The DTT-containing sample is heated in a 95
°C bath for
two minutes. Samples are separated on 10% SDS-Tricine PAGE, followed by
transfer to nitrocellulose filters. Filters are stained using conventional
Western
blot staining procedures with anti-FLAG antibodies. HSUBC15 is expected to
migrate as both a 35 kDa band and a 41 kDa band in the presence of ubiquitin
26 and ATP, and the presence of the 41 kDa band is expected to be reversible
by
DTT.
Reaction No. Proteins
1 El + ubiquitin
44
CA 02348156 2001-04-19
WO 00123599 PCT/US99/24563
2 particulate fraction (from Example 5) + ubiquitin
3 particulate fraction (from Example 5) + ubiquitin + E1
Example 7
6 Preparation of dominant negative mutants of HSUBC14 and HSUBC15
The active site cysteine of a cloned HSUBC14 or HSUBC15 is replaced by a
serine using standard site-specific mutagenesis. The mutant protein is
expressed
in bacteria and purified. The ability of the mutant protein to form a stable
oxygen ester with ubiquitin is established as described in Example 3 above,
11 except that the bond formation is not labile in DTT. Dominant negative
mutant
activity is then established by introducing the mutant protein in increasing
concentrations in an assay as described in Example 3 above and demonstrating
dose-dependent inhibition of ubiquitin/HSUBC14 or ubiquitin/HSUBC15
complex formation.
16
Example 8
Reversal of nF508 pheno a
HEK cells are transfected with an expression vector expressing oF508
mutant CFTR using standard procedures (see Ward et al., Cell 83: 121-127
(1995)).
21 Transfected cells are established as a cell line and transfected with an
expression
vector expressing the dominant negative mutant prepared according to Example
4 or Example 9. In these transfectants, eF508 protein is not expected to form
the 7
kDa ladder characteristic of polyubiquitination.
26 Example 9
Identification and cloning of HSUBC18
The human EST database was searched using the yeast Ubc7 active site
sequence as the initial query sequence in the homology search. The EST clone
CA 02348156 2001-04-19
WO OOI23599 PCT/US99/24563
H85522 was discovered to contain a similar active site sequence and was used
as
the query sequence for a further search. Cloning was achieved using nested
PCR.
The first PCR utilized the primers AGGCGAGGTCGCTCGGCGCA (forward)
and GCGCCTGTGCGAGGCCAGGT (reverse). The second PCR used the primers
GGGAATTCCATATGGCGGGGACC (forward) and
6 CCCAAGCTl'I'CACAGTCCCAGAGACTT (reverse). The PCR product was
inserted into the plasmid pT7 at the NdeI and HindIII sites to generate
plasmid
pT7-7-HsUBCIB. The plasmid insert was sequenced and the nucleotide sequence
and deduced amino acid sequence are shown in Figure 3. The encoded full-
length protein has 165 amino acids (18.565 kDa) and shares 62% amino acid
11 sequence identity and 75% homology with yeast Ubc7. This high level of
homology predicts that HSUBC18 plays a role in human ER proteasome protein
degradation analogous to the role played by Ubc7 in yeast. An alignment of
HSUBC18 with the yeast protein Ubc7 is shown in Figure 6.
16 Example 10
Expression and localization of HSUBC18
Expression of HSUBC18 in HeLa cells was carried out by transfecting
HeLa cells with pFLAG-CMV-2 expression vector (Kodak, IBI) in which the
human Ubcl8 cDNA was inserted at the CIaI and KpnI site. This insertion
21 generates a protein sequence in which the N-terminus of HSUBC18 was
extended
by the amino acid sequence MDYKDDDDKLAAANSS. Expression of the protein
was confirmed by Western blot using anti-FLAG antibodies that recognize the
sequence DYKDDDDK.
To determine the intracellular localization of HSUBC18, HeLa cells
26 transfected with the pFLAG-CMV-2-HSUBC15 plasmid described above were
subjected to immunostaining using a mouse anti-FLAG antibody in conjunction
with a rabbit anti-calreticulin antibody (Affinity Bioreagents, Inc.). The
mouse
anti-FLAG antibody was detected with a secondary goat anti-mouse antibody
46
CA 02348156 2001-04-19
WO 00/23599 PCT/US99/24563
1 conjugated to OG488 (Molecular Probes). The imntunostaining pattern of the
anti-FLAG in the transfected cells indicated that HSUBC18 was concentrated in
the nucleus but was detected throughout the cytoplasm as well.
Example 12
6 Preparation of HSUBC18
The HSUBC18 gene construct, prepared according to Example 9, was
subcloned into the NdeI and HindIII sites of a modified pGEX-2TK plasmit
(Pharmacia) so as to express a fusion protein of glutathione-S-transferase
(GST)
and HSUBC18. The pGEX-HSUBC18 plasmid was transformed into the E. coli
11 strain BL21(DE3) (Novagen). Expression of the GST-HSUBC18 fusion was
induced by the addition of 1 mM IPTG. An S100 fraction of bacterial cells
expressing the GST-HSUBC18 fusion was incubated with glutathione-Sepharose
resin (Pharmacia). The resin was washed with PBS buffer containing 0.1%
TritonX-100 and 0.25 M KCI, and the GST-HSUBC18 fusion eluted with PBS
16 buffer containing 5 mM glutathione. The eluate was incubated with
biotinylated
thrombin, which cleaves the GST-HSUBC18 fusion to generate GST and
HSUBC18. The sample was dialyzed to remove glutathione. The biotinylated
thrombin was removed by incubation with streptavidin agarose (Pierce) and the
GST was removed by incubation with glutathione-Sepharose.
21
Example 12
Thioester bond formation with ubiduitin
Proteins (as indicated below) were incubated in a reaction buffer
containing 25 mM Hepes (pH7.0),10 mM Mg2+ and 1 mM ATP for 5 minutes at
26 30°C. The reaction was stopped by addition of SDS sample loading
buffer. Each
sample was divided into two aliquots, to one of which was added DTT to a final
concentration of 10 mM. The DTT-containing sample was heated in a 95 °C
bath
for two minutes. Samples were separated on 10% SDS-Tricine PAGE, followed
47
CA 02348156 2001-04-19
WO 00/23599 PCT/US991Z4563
1 by silver staining. HSUBC18 migrates at a slower rate in the presence of
ubiquitin and ATP, and that effect is reversible by DTT.
Reaction No. Proteins
1 E1 + ubiquitin
2 HSUBC18 + ubiquitin
6 3 HSUBC18 + ubiquitin + El
Example 13
Preparation of dominant ne~~ative mutants of HSUBC18
11 The active site cysteine of HSUBC18, cloned as described in Example 9,
was replaced by a serine using standard site-specific mutagenesis. The mutant
protein was expressed in bacteria and purified. The ability of the mutant
protein
to form a stable oxygen ester with ubiquitin was established as described in
Example 12 above, except that the bond formation was not labile in DTT.
16 Dominant negative mutant activity was then established by introducing the
mutant protein in increasing concentrations in an assay as described in
Example
22 above and demonstrating dose-dependent inhibition of ubiquitin/HSUBC18
complex formation.
48
