Note: Descriptions are shown in the official language in which they were submitted.
CA 02348703 2001-04-27
WO 00/25?88 PCT/US99/24948
TITLE OF THE INVENTION
INHIBITORS OF PRENYL-PROTEIN TRANSFERASE
BACKGROUND OF THE INVENTION
The Ras proteins (Ha-Ras, Ki4a-Ras, Ki4b-Ras and N-Ras)
are part of a signalling pathway that links cell surface growth factor
receptors to nuclear signals initiating cellular proliferation. Biological
and biochemical studies of Ras action indicate that Ras functions like a
G-regulatory protein. In the inactive state, Ras is bound to GDP. Upon
growth factor receptor activation Ras is induced to exchange GDP for GTP
and undergoes a conformational change. The GTP-bound form
of Ras propagates the growth stimulatory signal until the signal is
terminated by the intrinsic GTPase activity of Ras, which returns
the protein to its inactive GDP bound form (D.R. Lowy and D.M.
Willumsen, Ann. Rev. Biochem. 62:851-891 (1993)). Mutated ras
genes (Ha-ras, Ki4a-ras, Ki4b-ras and N-ras) are found in many
human cancers, including colorectal carcinoma, exocrine pancreatic
carcinoma, and myeloid leukemias. The protein products of these
genes are defective in their GTPase activity and constitutively
transmit a growth stimulatory signal.
Ras must be localized to the plasma membrane for
both normal and oncogenic functions. At least 3 post-translational
modifications are involved with Ras membrane localization, and all
3 modifications occur at the C-terminus of Ras. The Ras C-terminus
contains a sequence motif termed a "CAAX" or "Cys-Aaal-Aaa2-Xaa" box
(Cys is cysteine, Aaa is an aliphatic amino acid, the Xaa is any amino
acid) (Willumsen et al., Nature 310:583-586 (1984)). Depend-
ing on the specific sequence, this motif serves as a signal sequence for the
enzymes farnesyl-protein transferase or geranylgeranyl-protein
transferase, which catalyze the alkylation of the cysteine residue of the
CAAX motif with a C15 or C20 isoprenoid, respectively. (S. Clarke., Ann.
Rev. Biochem. 61:355-386 (1992); W.R. Schafer and J. Rine,
Ann. Rev. Genetics 30:209-237 (1992)). Such enzymes that transfer an
isoprenoid moiety to the cysteine sulfur of a protein may be generally
-1-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
termed perenyl-protein transferases. The Ras protein is one of several
proteins that are known to undergo post-translational farnesylation.
Other farnesylated proteins include the Ras-related GTP-binding proteins
such as Rho, fungal mating factors, the nuclear lamins, and the gamma
subunit of transducin. James, et al., J. Biol. Chem. 269, 14182 (1994)
have identified a peroxisome associated protein Pxf which is also
farnesylated. James, et al., have also suggested that there are
farnesylated proteins of unknown structure and function in addition to
those listed above.
Inhibition of farnesyl-protein transferase has been shown
to block the growth of Ras-transformed cells in soft agar and to modify
other aspects of their transformed phenotype. It has also been demon-
strated that certain inhibitors of farnesyl-protein transferase selectively
block the processing of the Ras oncoprotein intracellularly (N.E. Kohl et
al., Science, 260:1934-1937 (1993) and G.L. James et al., Science,
260:1937-1942 (1993). Recently, it has been shown that an inhibitor of
farnesyl-protein transferase blocks the growth of ras-dependent tumors in
nude mice (N.E. Kohl et al., Proc. Natl. Acad. Sci U.S.A., 91:9141-9145
(1994) and induces regression of mammary and salivary carcinomas in ras
transgenic mice (N.E. Kohl et al., Nature Medici~te, 1:792-?97 (1995).
Indirect inhibition of farnesyl-protein transferase in vivo has
been demonstrated with lovastatin (Merck & Co., Rahway, NJ)
and compactin (Hancock et al., ibid; Casey et al., ibid; Schafer et al.,
Science 245:379 (1989)). These drugs inhibit HMG-CoA reductase, the
rate limiting enzyme for the production of polyisoprenoids including
farnesyl pyrophosphate. Farnesyl-protein transferase utilizes farnesyl
pyrophosphate to covalently modify the Cys thiol group of the Ras CAAX
box with a farnesyl group (R,eiss et al., Cell, 62:81-88 (1990); Schaber et
al., J. Biol. Chem., 265:14701-14704 (1990); Schafer et al., Science,
249:1133-1139 (1990); Manne et al., Proc. Natl. Acad. Sci USA, 87:7541-
7545 (1990)). Inhibition of farnesyl pyrophosphate biosynthesis by
inhibiting HMG-CoA reductase blocks Ras membrane localization in
cultured cells. However, direct inhibition of farnesyl-protein transferase
-2-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
would be more specific and attended by fewer side effects than would
occur with the required dose of a general inhibitor
of isoprene biosynthesis.
Inhibitors of farnesyl-protein transferase (FPTase) have been
described in two general classes. The first are analogs of farnesyl
diphosphate (FPP), while the second class of inhibitors is related to the
protein substrates (e.g., Ras) for the enzyme. The peptide derived
inhibitors that have been described are generally cysteine containing
molecules that are related to the CAAX motif that is the signal for protein
prenylation. (Schaber et al., ibid; Reiss et. al., ibid; Reiss
et al., PNAS, 88:732-736 (1991)). Such inhibitors may inhibit protein
prenylation while serving as alternate substrates for the farnesyl-protein
transferase enzyme, or may be purely competitive inhibitors (U.S. Patent
5,141,851, University of Texas; N.E. Kohl et al., Science, 260:1934-1937
(1993); Graham, et al., J. Med. Chem., 37, 725
(1994)). In general, deletion of the thiol from a CAAX derivative
has been shown to dramatically reduce the inhibitory potency of the
compound. However, the thiol group potentially places limitations
on the therapeutic application of FPTase inhibitors with respect to
pharmacokinetics, pharmacodynamics and toxicity. Therefore, a
functional replacement for the thiol is desirable.
It has recently been reported that farnesyl-protein
transferase inhibitors are inhibitors of proliferation of vascular
smooth muscle cells and are therefor a useful in the prevention and
therapy of arteriosclerosis and diabetic disturbance of blood vessels
(JP H7-112930).
It has recently been disclosed that certain tricvclic
compounds which optionally incorporate a piperidine moiety are inhibitors
of FPTase (VVO 95/10514, V~~O 95/10515 and VfO 95/10516). Imidazole-
containing inhibitors of farnesyl protein transferase have also been
disclosed (VVO 95109001 and EP 0 675 112 A1).
It is, therefore, an object of this invention to develop
peptidomimetic compounds that inhibit a prenyl-protein transferase and
thus, the post-translational prenylation of proteins. It is a further object
-3-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
of this invention to develop chemotherapeutic compositions containing the
compounds of this invention and methods for producing the compounds of
this invention.
SUMMARY OF THE INVENTION
The present invention comprises peptidomimetic piperazine-
containing macrocyclic compounds which inhibit a prenyl-protein
transferase. Further contained in this invention are chemotherapeutic
compositions containing these prenyl-protein transferase inhibitors and
methods for their production.
The compounds of this invention are illustrated by the
formula A:
R2a
~G~ R2b
Z3
"3
G
3a
~(CR~~2)s
Z ~A2
,/V Z2~
(CR~a2)n
V ~i(CR~~2)s
A
~~~r
A
DETAILED DESCRIPTION OF THE INVENTION
The compounds of this invention are useful in the inhibition
of a prenyl-protein transferase and the prenylation of the oncogene protein
Ras. In a first embodiment of this invention, the inhibitors of a prenyl-
protein transferase are illustrated by the formula A:
-4-
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
R2a
~ R2b
Z3
( Rlb2)P ~(CR~°2)s
Z~'~A2
V (CR~a2)n Z2
g
q U A~--(CR~~2)s
(R8)r
A
wherein:
Rla, g,lb~ Rlc and Rld are independently selected from:
a) hydrogen,
b) aryl, heterocycle, Cg-C10 cycloalkyl, C2-Cg alkenyl,
C2-Cg alkynyl, halogen, perfluoro C1-C6 alkyl, 8100-,
R11S(O)m-~ R10C(O)Ng,lO_~ (R,10)2N_C(O)_~ CN, N02
(R10)2N-C(NR,10)_, R10C(O)_, R100C(O)-, Ng, _N(R10)2~ or
R110C(O)NR10_,
c) unsubstituted or substituted C1-Cg alkyl wherein the
substitutent on the substituted C1-Cg alkyl is selected from
unsubstituted or substituted aryl, heterocyclic, C3-C10
cycloalkyl, C2-Cg alkenyl, C2-C6 alkynyl, halogen,
perfluoro C1-C6 alkyl, 8100-, R11S(O)m-, R10C(O)NR10-
(R10)2N-C(O)_, CN, (R,10)2N_C(NR10)_, R10C(O)_, R10OC(O)_
N3, -N(R10)2, and R110C(O)-NR10-;
g,2a~ R2b and R3a are independently selected from: H; unsubstituted or
substituted C1_g alkyl, unsubstituted or substituted C2_g alkenyl,
_5_
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
unsubstituted or substituted C2_g alkynyl, unsubstituted or substituted aryl,
unsubstituted or substituted heterocycle,
II RsR7 Rs
or ~ ,
O O
wherein the substituted group is substituted with one or more of
1) aryl or heterocycle, unsubstituted or substituted with:
a) C1_4 alkyl, .
b) (CH2)pORS,
c) (CH2)pNR6R7,
d) halogen,
e) CN,
2) C3_g cycloalkyl,
3) OR6,
4) SR4, S(O)R4, S02R4,
5) -NR6R7
Rs ,
-N~ R7
O
s
7) ~ s ~ ,
-N\/NR R
~(O
-6-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
-O\ / NR6R~
,
O
9) -O\ 'ORs
O
10) ~ NRsR~ ,
O
11 ) -S02-NRsR7 ,
Rs
12) -N-S02 R4 ,
13) Rs ,
O
14} ~ORs ,
O
15) N3, or
16) F; or
R2a and R3a are attached to the same C atom and are combined to form
- (CH2)u - wherein one of the carbon atoms is optionally replaced by a
moiety selected from: O, S(O)m, -NC(O)-, and -N(COR10)_ ;
and R2a and R3a are optionally attached to the same carbon atom;
R4 is selected from: C1_4 alkyl. C3_0 cycloalkyl, heteuocycle, ar3Jl,
unsubstituted or substituted with:
a) Cl_4 alkoxy,
b) aryl or heterocycle,
-7-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
c) halogen.
d) HO,
R11
a ~~I/)
O
f) -S02R11 , or
g) N(R10)2~
R5, R6 and R7 are independently selected from: H; C1_4 alkyl, C3_6
cycloalkyl, heterocycle, aryl, aroyl, heteroaroyl, arylsulfonyl,
heteroarylsulfonyl, unsubstituted or substituted with:
a) C1_4 alkoxy,
b) aryl or heterocycle,
c) halogen,
d) HO,
R11
e)
O
f) -SO2R11 , or
g) N~10)2~ or
R6 and R7 may be joined in a ring; and independently,
R5 and R7 may be joined in a ring;
R8 is independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C3-C10 cycloalkyl, C2-Cg alkenyl,
C2-Cg alkynyl, perffuoroalkyl, F, Cl, Br, 8100-, R11S(O)m-,
_g_
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
R10C(O)NR10-, (R10)2NC(O)_, R102N_C(NR10)-, CN, N02,
R10C(O)_, RIOpC(O)_~ N3~ _N(R10)2~ or R110C(O)NR10-, and
c) C1-Cg alkyl unsubstituted or substituted by unsubstituted or
substituted aryl, unsubstituted or substituted heterocycle,
Cg-C 10 cycloalkyl, C2-C6 alkenyl, C2-Cg alkynyl,
perfluoroalkyl, F, Cl, Br, 8100-, R11S(O)m-, R10C(O)NH-,
(R10)2NC(O)_~ R102N_C(NR10)-, CN, R10C(O)-, R,lOOC(O)_,
N3, -N(R10)2, or R10.OC(O)NH-;
R9 is selected from:
a) hydrogen,
b) C2-Cg alkenyl, C2-C6 alkynyl, perfluoroalkyl, F, Cl, Br,
R100-~ R11S(O)m-> R10C(O)NR10_~ (R10)2NC(O)_,
R102N-C(NR10)-, CN, N02, R10C(O)_, RlOpC(O)_, Ng
-N(R10)2, or R110C(O)NR10-, and
c) C1-C6 alkyl unsubstituted or substituted by perfluoroalkyl,
F, Cl, Br, 8100-, R11S(O)m-, R10C(O)NR,10_~ (R10)2NC(O)_~
R102N-C(NR10)-, CN, R10C(O)-, RioOC(O)_~ N3~ _N(R10)2~
or R110C(O)NR10_;
R10 is independently selected from hydrogen, C1-Cg alkyl, benzyl,
unsubstituted or substituted aryl and unsubstituted or
substituted heterocycle;
R11 is independently selected from C1-Cg alkyl unsubstituted or
substituted aryl and unsubstituted or substituted heterocycle;
A1 is selected from: a bond, -C(O)-, -C(O)NR10-, -NR10C(O)-, O,
_N(R,10)_~ _S(O)2N(R10)_~ -N(R10)S(O)2_~ and S(O)m
A2 is selected from: a bond, -C(O)-, -C(O)NR10-, -NR10C(O)-, O,
-N(R10)_, _S(O)2N(R10)_, _N(R,10)S(O)2_~ S(O)m and
-C(R1d)2-~
-9-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
G1~ G2 and G3 are independently selected from: H2 and O;
W is heterocycle;
V is selected from:
a) heterocycle, and
b) aryl;
X and Y are independently selected from: a bond, -C(=O)- or
-S(=O)m-
Z1 is selected from: unsubstituted or substituted aryl and unsubstituted
or substituted
heterocycle, wherein
the substituted
aryl or
substituted
heterocycle is
substituted with
one or
more of-.
1) C 1-4 alkyl, unsubstituted or substituted
with:
a) C1_4 alkoxy,
b) NR6R7,
c) C3_g cycloalkyl,
d) aryl or heterocycle,
e) HO,
~ -S(O)mR4, or
g) -C(O)NR6R7,
2) aryl or heterocycle,
3) halogen,
4) OR6
5) NR6R7~
6) CN,
7) N02,
8) CF3;
-S(O)mR4~
10) -C(O)NR6R7, or
11) Cg-Cg cycloalkyl;
- 10 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
Z2 is selected from: a bond, unsubstituted or substituted aryl and
unsubstituted or substituted heterocycle, wherein the
substituted aryl or substituted heterocycle is substituted
with one or more of
1) C1_4 alkyl, unsubstituted or substituted with:
a) C1_4 alkoxy,
b) NR6R7,
c) C3_6 cycloaIkyl,
d) aryl or heterocycle,
e) HO,
f) -S(O)mR4, or
g) -C(O)NR6R7,
2) aryl or heterocycle,
3) halogen,
4) OR6
5) NR6R7~
6) CN,
7) N02,
8) CF3;
-S(O)mR4~
10) -C(O)NR6R7, or
11) Cg-C6 cycloalkyl;
3
Z is selected from:
1) a unsubstituted or substituted group selected from aryl,
heteroaryl, arylmethyl, heteroarylmethyl, arylsulfonyl,
heteroarylsulfonyl, wherein the substituted group is substituted
with one or more of the following:
a) C1_4 alkyl, unsubstituted or substituted with:
C1-4 alkoxy, NR6R7, Cg_g cycloalkyl, unsubstituted or
substituted aryl, heterocycle, HO, -S(O)mR6a, or
-C(O}NR6R7,
b) aryl or heterocycle,
c) halogen,
- 11 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
d) OR6
e) NR6R7~
f) CN,
g) N02
h) CF3;
i) -S(O)mR4,
j) -C(O)NR6R7, or
k) C3-Cg cycloalkyl; or
2) unsubstituted C1-C6 alkyl, substituted C1-Cg alkyl,
unsubstituted Cg-Cg cycloalkyl or substituted Cg-C6 cycloalkyl,
wherein the substituted C1-C6 alkyl and substituted Cg-Cg
cycloalkyl is substituted with one or two of the following:
a) C 1 _4 alkoxy,
b) NR6R7,
c) C3_6 cycloalkyl,
d) -NR6C(O)R~,
e) HO,
~ _S(O)mR4~
g) halogen, or
h) perfluoroalkyl;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4;
q is 1 or 2;
r is 0 to 5;
s is independently 0, 1, 2 or 3; and
uis 4or5;
or a pharmaceutically acceptable salt or stereoisomer thereof.
In a second embodiment of this invention, the compounds are
illustrated by the formula A:
- 12 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
R2a
1 R2b
Z3
3
l, R3a G
( R1b
2~p (C fZ~ ~2~s
Z~~.A2
'/V (CR~a2)n
q V A~~(CR~~2)s
(R$)r
A
wherein:
Rla and Rld are independently selected from: hydrogen and C1-Cg alkyl;
Rlb and Rlc are independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-Cg
alkenyl, and
c) unsubstituted or substituted C1-Cg alkyl wherein the
substitutent on the substituted C1-C6 alkyl is selected from
unsubstituted or substituted aryl, heterocycle, cycloalkyl,
alkenyl, 8100- and -N(R10)2;
R2b and R3a are independently selected from: H and CH3;
R2a is independently selected from H;
- 13 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
fVR6R7.
O
or CI_5 alkyl, unbranched or branched, unsubstituted or
substituted with one or more of:
1) aryl,
2) heterocycle,
3) OR6,
4) SR4, S02R4, or
O
and R2a and R3a are optionally attached to the same carbon atom;
R4 is selected from:
C1_4 alkyl and C3_g cycloalkyl, unsubstituted or substituted
with:
a) C1_4 alkoxy,
b} halogen, or
c) ax>y>1 or heteroc~Tcle;
R6 and R7 are independently selected from:
H; C1_q alkyl, Cg_6 cycloalkyl, aryl and heterocycle,
unsubstituted or substituted with:
a) C1_4 alkoxy,
b) halogen, or
c) aryl or heterocycle;
R8 is independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, unsubstituted or
substituted heterocycle, C1-Cg alkyl, C2-Cg alkenyl, C2-Cg
alkynyl, C1-C6 perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-,
- 14 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
CN, N02, (R,10}2N-C(NR10)-, R10C(O}-, -N(R10)2, or
R110C(O)NR10-, and
c) C1-Cg alkyl substituted by: unsubstituted or substituted
aryl, unsubstituted or substituted heterocycle, C1-CO
perfluoroalkyl, 8100-, R10C(O)NR10-, (R10)2N-C(NR10}_,
R10C(O)-, -N(R10)2, or R110C(O)NR10-;
R9 is selected from:
a} hydrogen,
b) C2-C6 alkenyl, C2-Cg alkynyl, C1-Cg perfluoroalkyl,
F, Cl, R100-, R11S(O}m-, R10C(O}NR10_~ CN~ N02,
(R10}2N-C(NR10}_, R10C(O}_, -N(R,10}2, or R110C(O)NR10-
and
c) C1-Cg alkyl unsubstituted or substituted by C1-Cg
perfluoroalkyl, F, Cl, R100-, R11S(O)m-, R10C(O)NR10-, CN,
(R10)2N_C(NR10)_, R10C(O)_, -N(R10)2, or R110C(O)NR10-;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl,
unsubstituted or substituted aryl and unsubstituted or
substituted heterocycle;
R11 is independently selected from C1-C6 alkyl, unsubstituted or
substituted aryl and unsubstituted or substituted heterocycle;
A1 is selected from: a bond, -C(O}-, -C(O)NR10-, -NR10C(O}-, O,
.N(R10)_~ -S(O)2N(R10}_~ _N(g,10)S(O}2_~ and S(O)m
A2 is selected from: a bond, -C(O)-, -C(O)NR10-, -NR10C(O)-, O,
-N(R10)-, -S(O)2N(R10}-~ _N(R,IO)s(O)2_~ S(O)m and
-C(R1d)2
G1~ G2 and G3 are independently selected from: H2 and O;
- 15 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
V is selected from:
a) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl,
thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl,
isoquinolinyl, and thienyl, and
b) aryl;
W is a heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl,
thiazolyl, oxazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl, or
isoquinolinyl;
X is a bond or -C(=O)-;
Y is a bond or -C(=O)-;
Z1 is selected from:
unsubstituted or substituted aryl or unsubstituted or
substituted heterocycle, wherein the substituted aryl or
substituted heterocycle is independently substituted with
one or two of
1) C1_4 alkyl, unsubstituted or substituted with:
a) C1_4 alkoxy,
b) NRSR7,
c) Cg_g cycloalkyl,
d) aryl or heterocycle,
e) HO,
f) -S(O)mR4, or
g) -C(O)NR6R7,
2) aryl or heterocycle,
3) halogen,
4) OR6
5) NR6R~
6) CN,
?) N02,
8) CFg;
- 16 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
-s(O)mR4~
10) -C(O)NR6R7, or
Il) Cg-Cg cycloalkyl;
Z2 is selected from: a bond, unsubstituted or substituted aryl and
unsubstituted or substituted heterocycle, wherein the
substituted aryl or substituted heterocycle is substituted
independently with one or two of:
1) C1_4 alkyl, unsubstituted or substituted with:
a) C1_4 alkoxy,
b) NR6R7,
c) C3_g cycloalkyl,
d) aryl or heterocycle,
e) HO,
~ -S(O)mR4~ or
g) -C(O)NR6R7,
2) aryl or heterocycle,
3) halogen,
4) OR6>
5) NR6R7~
6) CN,
7) N02,
8) CF3;
-S(O)mR4~
10) -C(O)NR6R7, or
11) C3-C6 cycloalkyl;
3
Z is selected from:
1) a unsubstituted or substituted group selected from aryl,
heteroaryl, arylmethyl, heteroarylmethyl, arylsulfonyl,
heteroarylsulfonyl, wherein the substituted group is substituted
with one or more of the following:
a) C1_4 alkyl, unsubstituted or substituted with:
- 17 -
CA 02348703 2001-04-27
WO 00/Z5788 PCT/US99/24948
C1_4 alkoxy, NR6R7, C3_6 cycloalkyl, unsubstituted or
substituted aryl, heterocycle, HO, -S(O)mRSa,
or
-C(O)NR6R7,
b) aryl or heterocycle,
c) halogen,
d) OR6
e) NR6R7~
f) CN,
g) N02
h) CFg;
i) -S(O)mR4,
j) -C(O)NR6R7, or
k) Cg-Cg cycloalkyl; or
2) unsubstituted
C1-Cg alkyl, substituted
C1-Cg alkyl,
unsubstituted
C3-C6 cycloalkyl
or substituted
C3-Cg cycloalkyl,
wherein the substituted
C1-C6 alkyl and
substituted C3-C6
cycloalkyl is substituted with one or two of the following:
a) C1_4 alkoxy,
b) NR6R7,
c) C3_g cycloalkyl,
d) -NR6C(O)R7,
e) HO,
~ _S(O)mR4~
g) halogen, or
h) perfluoroalkyl;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4;
q is 1 or 2;
r is 0 to 5;
s is independently 0, 1, 2 or 3; and
a is 4 or 5;
- 18 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
or a pharmaceutically acceptable salt or stereoisomer thereof.
In a third embodiment of this invention, the compounds are
illustrated by the formula B:
R2a
G2 G'
X ~~ 3
N -Z
"3
G
CR~b2)p Y R3a
CR~c
2~s
(CR~a2)n Z~
R9 N~ \ 1--~(CR~c2~s
A
(R8)r
B
wherein:
Rla is selected from: hydrogen or C1-Cg alkyl;
Rlb and Rlc are independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-Cg
alkenyl, and
c) C1-Cg alkyl unsubstituted or substituted by aryl, heterocycle,
cycloalkyl, alkenyl, 8100-, or -N(R10)2;
R3a is selected from H and CHg;
R2a is selected from H;
- 19 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/Z4948
~NRsR~.
O
and C1_5 alkyl, unbranched or branched, unsubstituted or
substituted with one or more of:
1) aryl,
2) heterocycle,
3) OR6,
4) SR6a, S02R4, or
~NR6R7
O
and any two of R2a and R3a are optionally attached to the same
carbon atom;
R4 is selected from:
C 1_4 alky l and Cg_~ cy cloalkel, unsubstituted or substituted
with:
a) C1_4 alkoxy,
b) halogen, or
c) ar~Tl or heterocy cle;
R6 and R7 are independently selected from:
a) hydrogen,
b) C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C1-Cg
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N_C(NR10)_~ R10C(O)-, RlOpC(O)_~ _N(R10)2, or
R110C(O)NR10-, and
c) C1-C6 alkyl substituted by C1-C6 perfluoroalkyl, 8100-,
R10C(O)NR10-, (R10)2N_C(NR10)-, R10C(O)-, R100C(O)-,
-N(R10)2, or R110C(O)NR10_;
R8 is independently selected from:
a) hydrogen,
- 20 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
b) unsubstituted or substituted aryl, C1-Cg alkyl, C2-Cg
alkenyl, C2-C6 alkynyl, C1-Cg perfluoroalkyl, F, Cl, R100-,
R,lOC(0)NR10_~ CN, N02, (R10)2N-C(NR10)_~ R10C(O)_~
-N(R10)2, or R110C(O)NR10-, and
c) C1-C6 alkyl substituted by: unsubstituted or substituted
aryl, C1-Cg perfluoroalkyl, 8100-, R10C(0)NR10_~
(R10)2N-C(NR10)-, R10C(O)-, -N(R10)2, or R110C(O)NR10-;
R9 is hydrogen or methyl;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and
unsubstituted or substituted aryl;
R11 is independently selected from C1-Cg alkyl and unsubstituted or
substituted aryl;
A1 is selected from: a bond, -C(O)- and O;
G1~ G2 and G3 are independently selected from: H2 and O;
V is selected from:
a) heterocycle selected from pyrrolidinyl, imidazolyl, pyridinyl,
thiazolyl, pyridonyl, 2-oxopiperidinyl, indolyl, quinolinyl,
isoquinolinyl, and thienyl, and
b) aryl;
X is a bond or -C(=O)-;
Y is a bond or -C(=O)-;
Z1 is selected from:
unsubstituted or substituted aryl or unsubstituted or
substituted heterocycle, wherein the substituted aryl or
substituted heterocycle is independently substituted with
- 21 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
one or two of:
1) CI_4 alkyl, unsubstituted or substituted with:
a) C1_4 alkoxy,
b) NR6R7,
c) C3_g cycloalkyl,
d) aryl or heterocycle,
e) HO,
f) -S(O)mR4, or
g) -C(O)NR6R7,
2) aryl or heterocycle,
3) halogen,
4) OR6
5) NR6R7~
6) CN,
7) N02,
8) CF3;
9) -S(O)mR4,
10) -C(O)NR6R7, or
I1) Cg-Cg cycloalkyl;
3
Z is selected from:
1) a unsubstituted or substituted group selected from aryl,
heteroaryl, arylmethyl, heteroarylmethyl, arylsulfonyl,
heteroarylsulfonyl, wherein the substituted group is substituted
with one or more of the following:
a) CI_4 alkyl, unsubstituted or substituted with:
CI_4 alkoxy, NR6R7, Cg_g cycloalkyl, unsubstituted or
substituted aryl, heterocycle, HO, -S(O)mR6a, or
-C(O)NR6R7,
b) aryl or heterocycle,
c) halogen,
d) OR6
e) NR6R7~
f) CN,
g) N02
- 22 -
Z1 is selected from:
CA 02348703 2001-04-27
WO 00/25788 PCT/U599/24948
h) CF3;
i) _S(O)mR4~
j) -C(O)NR6R7, or
k) C3-Cg cycloalkyl; or
2) unsubstituted C1-Cg alkyl, substituted C1-C6 alkyl,
unsubstituted Cg-Cg cycloalkyl or substituted Cg-C6 cycloalkyl,
wherein the substituted C1-Cg alkyl and substituted C3-Cg
cycloalkyl is substituted with one or two of the following:
a) C1_4 alkoxy,
b) NR6R7,
c) C3_6 cycloalkyl,
d) -NR6C(O)R7,
e) HO,
~ _S(O)mR4~
g) halogen, or
h) perfluoroalkyl;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4;
r is 0 to 5; and
s is independently 0, 1, 2 or 3;
or a pharmaceutically acceptable salt or stereoisomer thereof.
A preferred embodiment of the compounds of this invention is
illustrated by the formula C:
- 23 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
a
R3a , G~
N. N - Z3
R1b2)P
\ CR~~2)s
(CR~a2)n
R9 .NJ
,'A'~'(CR~°2)s
(R8)r
C
wherein:
R1a is selected from: hydrogen and C1-Cg alkyl;
R1b and R1c are independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10}2 or C2-Cg
alkenyl, and
c) C1-Cg alkyl unsubstituted or substituted by aryl, heterocycle,
cycloalkyl, alkenyl, 8100-, or -N(R10)2;
R3a is selected from H and CHg;
R2a is selected from H;
NR6R7.
O
and C1_5 alkyl, unbranched or branched, unsubstituted or
substituted with one or more of
- 24 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
1) aryl,
2) heterocycle,
3) OR6,
4) SRSa, S02R4, or
O
and any two of R2a and R3a are optionally attached to the same
carbon atom;
R'~ is selected from:
C1_4 alkyl and C3_~, cycloalk~-l, unsubstituted or substituted
with:
a) C 1 _4 alkoxy,
b) halogen, oz'
c) aryl or heterocycle;
R6 and R7 are independently selected from:
a) hydrogen,
b) C1-Cg alkyl, C2-Cg alkenyl, C2-C6 alkynyl, C1-Cg
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N-C(NR10)-, R10C(O)-, RlOpC(O)-~ -N(R10)2~ or
R110C(O)NR10-, and
c) C1-Cg alkyl substituted by C1-Cg perfluoroalkyl, 8100-,
R1~C(O)NR10-~ (R10)2N_C(NR10)-, R10C(O)-, RlOpC(O)-,
-N(R10)2, or R110C(O)NR10-;
R8 is independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, C1-Cg alkyl, C2-Cg
alkenyl, C2-Cg alkynyl, C1-C6 perfluoroalkyl, F, Cl, R100-,
R10C(O)NR10-, CN, N02~ (R10)2N_C(NR10)-, R,IOC(O)_~
-N(R10)2, or R110C(O)NR10-, and
- 25 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
c) C1-Cg alkyl substituted by unsubstituted or substituted
aryl, C1-C6 perfluoroalkyl, 8100-, R10C(O)NR10_,
(g,10)2N-C(NR10)-, R10C(O)-, -N(R10)2, or R110C(O)NR10_;
R9 is hydrogen or methyl;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and
unsubstituted or substituted aryl;
R11 is independently selected from C1-C6 alkyl and unsubstituted or
substituted aryl;
A1 is selected from: a bond, -C(0)- and O;
G1 and G3 are independently selected from: H2 and 0, provided that at
least one and only one of G1 and G3 are O;
X is a bond or -C(=O)-;
Y is a bond or -C(=O)-;
Z1 is selected from:
unsubstituted or substituted aryl or unsubstituted or
substituted heterocycle, wherein the substituted aryl or
substituted heterocycle is substituted with one or
two of
1) C1_4 alkyl, unsubstituted or substituted with:
a) C 1 _~ alkoxy,
b) NR6R7,
c) Cg_6 cycloalkyl,
d) aryl or heterocycle,
e) HO,
f) -S(O)mR4, or
g) -C(O)NR6R~,
- 26 -
CA 02348703 2001-04-27
WO 00/Z5788 PCT/US99/24948
2) aryl or heterocycle,
3) halogen,
4) OR6
5) NR6R7~
6) CN,
7) N02,
8) CF3;
9) -S(O)mR4,
10) -C(O)NR6R7, or
11) Cg-C6 cycloalkyl;
3
Z is selected from:
1) a unsub stituted or substituted group selected from
aryl,
heteroaryl, arylmethyl,
heteroarylmethyl,
arylsulfonyl,
heteroarylsulfonyl,
wherein the substituted
group is substituted
with one or
more of the following:
a) C1_4 alkyl, unsubstituted or substituted
with:
C1_4 alkoxy, NR6R7, Cg_6 cycloalkyl, unsubstituted
or
substituted aryl, heterocycle, HO, -S(O)mRSa,
or
-C(O)NR6R7,
b) aryl or heterocycle,
c) halogen,
d) OR6
e) NR6R7~
fj CN,
g) N02,
h) CF3;
i) -S(O)mR4,
j) -C(O)NR6R7, or
k) Cg-Cg cycloalkyl;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4;
r is 0 to 5; and
- 27 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99I24948
s is independently 0, 1, 2 or 3;
or a pharmaceutically acceptable salt or stereoisomer thereof.
In another preferred embodiment of this invention,
the compounds are illustrated by the formula D:
Ra
~N _ Z3
/ O
( R b2) Y
P
CR~~2)s
N/yN OR~a2)n
R9
/ v .e'r''(CR~~2)s
(R8)r
D
wherein:
R1a is selected from: hydrogen and C1-C6 alkyl;
R1b and R1c are independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-Cg
alkenyl, and
c) C1-C6 alkyl unsubstituted or substituted by aryl, heterocycle,
cycloalkyl, alkenyl, 8100-, or -N(R10)2;
R3a is selected from H and CH3;
R2a is selected from H;
- 28 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
\ 'NRsR7.
O
and C1_5 alkyl, unbranched or branched, unsubstituted or
substituted with one or more of:
1) aryl,
2) heterocycle,
3) OR6,
4) SR6a, S02R4, or
5) NRsR~
O
and any two of R2 and R3 are optionally attached to the same
carbon atom;
R4 is selected from:
C1_4 alkyl and C3_g cycloalkyTl, unsubstituted or substituted
with:
a) C1_4 alkoxy,
b) halogen, or
c) ary~1 or heterocycle:
R6 and R7 are independently selected from:
a) hydrogen,
b) C1-Cg alkyl, C2-Cg alkenyl, C2-C6 alkynyl, C1-Cg
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N_C(NR10~_~ R10C(O)-, R100C(0)-, _N(R10)2~ or
R110C(O)NR10-, and
c) C1-Cg alkyl substituted by C1-C6 perfluoroalkyl, 8100-,
R10C(O)NR10-, (R10)2N_C(NR10)-, R10C(O)-, R100C(O)-,
-N(R10)2, or R110C(O)NR10_~
R8 is independently selected from:
a) hydrogen,
- 29 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-Cg
alkenyl, C2-Cg alkynyl, C1-C6 perfluoroalkyl, F, Cl, R100-,
R10C(O)NR10_~ CN, N02, (R10)2N_C(NR10)-, R10C(O)_~
-N(R10)2, or R110C(O)NR10-, and
c) C1-C6 alkyl substituted by unsubstituted or substituted
aryl, C1-Cg perffuoroalkyl, 8100-, R10C(O)NR10-
(R10)2N_C(NR10)-, R10C(O)-, _N(R10)2~ or R110C(O)NR10-;
R9 is hydrogen or methyl;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and
unsubstituted or substituted aryl;
R11 is independently selected from C1-Cg alkyl and unsubstituted or
substituted aryl;
A1 is selected from: a bond, -C(O)- and O;
X is a bond;
Y is a bond;
Z1 is selected from:
unsubstituted or substituted aryl or unsubstituted or
substituted heterocycle, wherein the substituted aryl
or substituted heterocycle is substituted with one or
two of:
1) C1_4 alkyl, unsubstituted or substituted with:
a) C1_4 alkoxy,
b) NR6R7,
c) C3-6 cycloalkyl,
d) aryl or heterocycle,
e) HO,
f) -S(O)mR4, or
- 30 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
g) -C(O)NR6R7,
2) aryl or heterocycle,
3) halogen,
4) OR6
5) NR6R7~
6) CN,
7) N02,
8) CF3;
9) -S(O)mR4,
IO) -C(O)NR6R7, or
11) C3-C6 cycloalkyl;
3
Z is selected from:
1) a unsubstituted or substituted group selected from aryl,
heteroaryl, arylmethyl, heteroarylmethyl, arylsulfonyl,
heteroarylsulfonyl, wherein the substituted group is substituted
with one or more of the following:
a) C1_4 alkyl, unsubstituted or substituted with:
CI_4 alkoxy, NR6R7, Cg_g cycloalkyl, unsubstituted
or substituted aryl, heterocycle, HO, -S(O)mR6a,
or -C(O)NR6R7,
b) aryl or heterocycle,
c) halogen,
d) OR6
e) NR6R7~
fj CN,
g) N02
h) CF3;
i) -S(O)mR4,
j) -C(O)NR6R7, or
k) C3-Cg cycloalkyl;
m is 0, 1 or 2;
n is 0, 1, 2, 3 or 4;
- 31 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
p is 0, 1, 2, 3 or 4;
r is 0 to 5; and
s is independently 0, l, 2 or 3;
or a pharmaceutically acceptable salt or stereoisomer thereof.
In further preferred embodiment of this invention,
the compounds are illustrated by the formula E:
X-N~~-~~ - Z3
O
CR~~2)s
Z1
R (CR~c
r-~ 2)s
wherein:
Rla is selected from: hydrogen and C1-C6 alkyl;
Rlb and Rlc are independently selected from:
a) hydrogen,
b) aryl, heterocycle, cycloalkyl, 8100-, -N(R10)2 or C2-C6
alkenyl, and
c) C1-Cg alkyl unsubstituted or substituted by aryl, heterocycle,
cycloalkyl, alkenyl, 8100-, or -N(R10)2;
- 32 -
(R$)r
E
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
R3a is selected from H and CH3;
R2a is selected from H;
\' N F26R7.
O
and C1_5 alkyl, unbranched or branched, unsubstituted or
substituted
with one or more
of
1) aryl,
2) heterocycle,
3) OR6,
4) SR6a, S02R4, or
O
and any two of R2 and R3 are optionally attached to the same
carbon atom;
R4 is selected from:
C1_4 alkyl and C3_~ cycloalkyl, unsubstituted or substituted
with:
a) C 1 _4 alkoxy,
b) halogen, or
c) aryl or heterocycle;
R6 and R7 are independently selected from:
a) hydrogen,
b) C1-C6 alkyl, C2-Cg alkenyl, C2-C6 alkynyl, C1-C6
perfluoroalkyl, F, Cl, R100-, R10C(O)NR10-, CN, N02,
(R10)2N-C(NR10)-, R10C(O)-, RlOpC(O)-~ _N(R,10)2~ or
R110C(O)NR10-, and
c) C1-Cg alkyl substituted by C1-Cg perfluoroalkyl, 8100-,
R10C(O)NR10-~ (R10)2N_C(NR10)-, R10C(O)-, RlOpC(O)-,
-N(R10)2, or R110C(O)NR10_;
- 33 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
R8 is independently selected from:
a) hydrogen,
b) unsubstituted or substituted aryl, C1-C6 alkyl, C2-C6
alkenyl, C2-C6 alkynyl, C1-C6 perfluoroalkyl, F, Cl, R100-,
R10C(O)NR10-, CN, N02, (R10)2N-C(NR10)_, R,10C(O)_~
-N(R10)2, or R110C(O)NR10-, and
c) C1-Cg alkyl substituted by unsubstituted or substituted
aryl, C1-Cg perfluoroalkyl, 8100-, R10C(O)NR10_,
(R,10)2N_C(NR10)_~ R10C(O)-, _N(R,10)2~ or R110C(O)NR10-
R9 is hydrogen or methyl;
R10 is independently selected from hydrogen, C1-C6 alkyl, benzyl and
unsubstituted or substituted aryl;
R11 is independently selected from C1-C6 alkyl and unsubstituted or
substituted aryl;
A1 is selected from: a bond, -C(O)- and O;
X is a bond;
Y is a bond;
Z1 is selected from:
unsubstituted or substituted aryl or unsubstituted or
substituted heterocycle, wherein the substituted aryl or
substituted heterocycle is substituted with one or
two o~
1) C1-4 alkyl, unsubstituted or substituted with:
a) C 1 _ 4 alkoxy,
b) NR6R7,
c) Cg_g cycloalkyl,
d) aryl or heterocycle,
- 34 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
e) HO,
~ -S(O)mR4, or
g) -C(O)NR6R7,
2) aryl or heterocycle,
3) halogen,
4) OR6
5) NR6R7~
6) CN,
7) N02,
8) CF3;
-S(O)mR4~
10) -C(O)NR6R7, or
11) C3-Cg cycloalkyl;
3
Z is selected from:
1) a unsubstituted
or substituted
group selected
from aryl,
heteroaryl, arylmethyl,
heteroarylmethyl,
arylsulfonyl,
heteroarylsulfonyl,
wherein the substituted
group is substituted
with one or more
of the following:
a) C1.4 alkyl, unsubstituted or substituted
with:
C1.4 alkoxy, NR6R7, C3.6 cycloalkyl, unsubstituted
or substituted aryl, heterocycle, HO, -S(O)mR6a,
or -C(O)NR6R7,
b) aryl or heterocycle,
c) halogen,
d) OR6
e) NR6R~
fj CN,
g) N02
h) CF3;
i) -S(O)mR4,
j) -C(O)NR6R7, or
k) Cg-C6 cycloalkyl;
m is 0, 1 or 2;
- 35 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
n is 0, 1, 2, 3 or 4;
p is 0, 1, 2, 3 or 4;
r is 0 to 5; and
s is independently 0, 1, 2 or 3;
or a pharmaceutically acceptable salt or stereoisomer thereof.
Specific examples of compounds of this invention are:
(~) 18-(3-Chlorophenyl)-16,16a,17,18,19,20-hexahydro-17-oxo-5H-6,10-
metheno-22H-benzo[b]pyrazino[2,1-a]imidazo[4,3-
h] [1,6,9]oxadiazacyclopentadecine-9-carbonitrile
(t)16,16a,17,18,19,20-Hexahydro-17-oxo-18-phenyl-5H-6,10-metheno-
22H-benzo[b]pyrazino[2,1-a]imidazo[4,3-
h] [1,6,9]oxadiazacyclopentadecine-9-carbonitrile
- 36 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
N---/~ N
'O
N
-N
~ O
j
CN
or a pharmaceutically acceptable salt or stereoisomer thereof.
The compounds of the present invention may have
asymmetric centers and occur as racemates, racemic mixtures, and as
individual enantiomers, with all possible isomers, including optical
isomers, being included in the present invention. When any variable (e.g.
aryl, heterocycle, R1, R2 etc.) occurs more than one time in any
constituent, its definition on each occurence is independent at every other
occurence. Also, combinations of substituents/or variables are permissible
only if such combinations result in stable compounds.
As used herein, "alkyl" is intended to include both branched
and straight-chain saturated aliphatic hydrocarbon groups having the
specified number of carbon atoms; "alkoxy" represents an alkyl group of
indicated number of carbon atoms attached through an oxygen bridge.
"Halogen" or "halo" as used herein means fluoro, chloro, bromo and iodo.
As used herein, "aryl" is intended to mean any stable
monocyclic or bicyclic carbon ring of up to 7 members in each ring,
wherein at least one ring is aromatic. Examples of such aryl elements
include phenyl, naphthyl, tetrahydronaphthyl, indanyl, biphenyl,
phenanthryl, anthryl or acenaphthyl.
The term heterocycle or heterocyclic, as used herein,
represents a stable 5- to 7-membexed monocyclic or stable 8- to
11-membered bicyclic heterocyclic ring which is either saturated or
unsaturated, and which consists of carbon atoms and from one to four
heteroatoms selected from the group consisting of N, O, and S, and
including any bicyclic group in which any of the above-defined heterocyclic
- 37 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
rings is fused to a benzene ring. The heterocyclic ring may be attached at
any heteroatom or carbon atom which results in the creation of a stable
structure. The term heterocycle or heterocyclic includes heteroaryl
moieties. Examples of such heterocyclic elements include, but are not
limited to, azepinyl, benzimidazolyl, benzisoxazolyl, benzofurazanyl,
benzopyranyl, benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl,
benzoxazolyl, chromanyl, cinnolinyl, dihydrobenzofuryl,
dihydrobenzothienyl, dihydrobenzothiopyranyl, dihydrobenzothiopyranyl
sulfone, furyl, imidazolidinyl, imidazolinyl, imidazolyl, indolinyl, indolyl,
isochromanyl, isoindolinyl, isoquinolinyl, isothiazolidinyl, isothiazolyl,
isothiazolidinyl, morpholinyl, naphthyridinyl, oxadiazolyl, 2-oxoazepinyl,
oxazolyl, 2-oxopiperazinyl, 2-oxopiperdinyl, 2-oxopyrrolidinyl, piperidyl,
piperazinyl, pyridyl, pyrazinyl, pyrazolidinyl, pyrazolyl, pyridazinyl,
pyrimidinyl, pyrrolidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl,
tetrahydrofuryl, tetrahydroisoquinolinyl, tetrahydroquinolinyl,
thiamorpholinyl, thiamorpholinyl sulfoxide, thiazolyl, thiazolinyl,
thienofuryl, thienothienyl, and thienyl.
As used herein, "heteroaryl" is intended to mean any stable
monocyclic or bicyclic carbon ring of up to 7 members in each ring,
wherein at least one ring is aromatic and wherein from one to four carbon
atoms are replaced by heteroatoms selected from the group consisting of
N, O, and S. Examples of such heterocyclic elements include, but are not
limited to, benzimidazolyl, benzisoxazolyl, benzofurazanyl, benzopyranyl,
benzothiopyranyl, benzofuryl, benzothiazolyl, benzothienyl, benzoxazolyl,
chromanyl, cinnolinyl, dihydrobenzofuryl, dihydrobenzothienyl,
dihydrobenzothiopyranyl, dihydrobenzothiopyranyl sulfone, furyl,
imidazolyl, indolinyl, indolyl, isochromanyl, isoindolinyl, isoquinolinyl,
isothiazolyl, naphthyridinyl, oxadiazolyl, pyridyl, pyrazinyl, pyrazolyl,
pyridazinyl, pyrimidinyl, pyrrolyl, quinazolinyl, quinolinyl, quinoxalinyl,
tetrahydroisoquinolinyl, tetrahydroquinolinyl, thiazolyl, thienofuryl,
thienothienyl, and thienyl.
As used herein in the definition of R2 and R3, the term "the
substituted group" intended to mean a substituted C1_g alkyl, substituted
- 38 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
C2_g alkenyl, substituted C2_g alkynyl, substituted aryl or substituted
heterocycle from which the substitutent(s) R2 and R3 are selected.
As used herein in the definition of R6, R7 and R7a, the
substituted C1_g alkyl, substituted Cg_6 alkenyl, substituted aroyl,
substituted aryl, substituted heteroaroyl, substituted arylsulfonyl,
substituted heteroarylsulfonyl and substituted heterocycle include
moieties containing from 1 to 3 substitutents in addition to the point of
attachment to the rest of the compound.
When R2 and R3 are combined to form - (CH2)u -, cyclic
moieties are formed. Examples of such cyclic moieties include, but are not
limited to:
''.. '''n
In addition, such cyclic moieties may optionally include a
heteroatom(s). Examples of such heteroatom-containing cyclic moieties
include, but are not limited to:
,, ,
~, ~., ''',r '.,.
o~ SJ J
0
.,., ~.,, ..',,i ...,
J
o ~~ ~ o
O COR~o
Lines drawn into the ring systems from substituents (such as
from R2, R3, R4 etc.) indicate that the indicated bond may be attached to
any of the substitutable ring carbon atoms.
Preferably. Rla and Rlb are independently selected from:
hydrogen, -N(R.10)2, R.lOC(O)NR10- or unsubstituted oz' substituted
- 39 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
C1-Ct; alkyl wherein the substituent on the substituted G1-CO alk~rl is
selected from unsubstituted or substituted phenyl. -N(R10)p, RlOp_ and
R10C(p)NR10_.
Preferably, R1c is independently selected from: hydrogen, or
unsubst.ituted or substituted C1-CO alkyl wherein the substituent on the
substituted C 1-CO alkyl is selected from unsubstituted or substituted
phenyl. -N(R10)Z, 8100- and R10C(O)NR.10-.
Preferably, R2a is selected from H,
RsR~ Rs
O O
and an unsubstituted or substituted group, the group selected from C1_g
alkyl, C2_g alkenyl and C2_g alkynyl;
wherein the substituted group is substituted with one or more of
1) aryl or heterocycle, unsubstituted or substituted with:
a) C1_4 alkyl,
b) (CH2)pORS,
c) (CH2)pNR6R7,
d) halogen,
2) C3_6 cycloalkyl,
3) OR6,
4) SR6a, S(O)RSa, S02RSa,
5) -NR6R~
Rs
g -N R'
O
s
7 7a
-NUNR R
CIO
- 40 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
-O~ NR6R~
,
O
9) -O\ 'ORs
~O
10) ~ NRsR~ ,
O
11 -S02-NRsR~ ,
)
Rs
12 -N-SO -Rsa
2
13) ~ Rs ,
O
14) ~ORs ,
I I
O
15) N3, o~
16) F.
Preferably, RZb. R3a and R3b are independently- selected
from: hydrogen and C1-C~; alky:l.
Preferably-, R4 and R5 are hydrogen.
Preferably, R0. R7 and Rya are selected from: hydrogen,
unsubstituted or substituted C1-CO alkyl, unsubstituted or substituted
ary-1 and unsubstituted or substituted cycloalkyl.
Preferably. R6~~ is unsubstituted or substituted C1-Cg alkyl,
unsubstituted or substituted ar~-1 and unsubstituted or substituted
cy=cloalkyl.
- 41 -
CA 02348703 2001-04-27
WO 00/2588 PCT/US99/24948
Preferably , R'~ is by drogen or methyl. Most preferably , RO is
hydrogen.
Preferably, R10 is selected from H. C1-C~ alkyl and benzyl.
Preferably. A1 and AZ are independently selected from:
a bond, -C(O)NR10- -NR10C(O)-, O, -N(R10)-, -S(O)pN(R10)- and
-N(R10)S(O)2-.
Preferabl~l, one of G1 and G2 is O and the other is H2.
PreferablyT, G3 is H~.
Preferably, V is selected from heteroary>l and aryl. 11.-Iore
preferably, ~' is phenyTl.
Preferably, ~ and ~ are independently selected from: a bond
and -C(=O)-. More preferably, 1 and ~' are a bond.
Preferably. Z1 and Z2 are independently selected from
unsubstituted or substituted phenyl, unsubstituted or substituted
naphthyl, unsubstituted or substituted pyridyl, unsubstituted or
substituted furanyl and unsubstituted or substituted thien~-1. Nlore
preferably, Z1 is selected from unsubstituted or substituted phenyl and
unsubstituted or substituted naphthyl. ZVIore preferably, Z2 is selected
from a bond and unsubstituted or substituted phenyl.
Preferably, V'' is selected from imidazolinyl, imidazolyl,
oxazolyl., pyrazolyl, py~y~rolidinyl, thiazolyl and pyridyl. More preferably,
~' is selected from imidazolyl and pyridyl.
Preferably, n i~ 0, 1, or 2.
Preferably, r is 1 or 2.
Preferably p is 1, 2 or 3.
Preferable- s is 0 or 1.
Preferably, the moiety=
- 42 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
(CR~b2)p
~/~/ ''' (CRS a2)n
(Rs)q V- -
(R8)r
is selected from:
Rsb Rsa
i
sa~ \ R N ~
R N
and
i
CN CN
wherein Rga and R9b are independently selected R9.
It is intended that the definition of any substituent or
variable (e.g., Rla, R9, n, etc.) at a particular location in a molecule
be independent of its definitions elsewhere in that molecule. Thus,
-N(R10)2 represents -NHH, -NHCH3, -NHC2H5, etc. It is understood that
substituents and substitution patterns on the compounds of the instant
invention can be selected by one of ordinary skill in the art to provide
compounds that are chemically stable and that can be readily synthesized
by techniques known in the art, as well as those methods
set forth below, from readily available starting materials.
The pharmaceutically acceptable salts of the compounds of
this invention include the conventional non-toxic salts of the compounds of
this invention as formed, e.g., from non-toxic inorganic or organic acids.
For example, such conventional non-toxic salts include those derived from
inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic,
- 43 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
phosphoric, nitric and the like: and the salts prepared from organic acids
such as acetic, propionic, succinic, glycolic, stearic, lactic, malic,
tartaric,
citric, ascorbic, pamoic, malefic, hydroxymaleic, phenylacetic, glutamic,
benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic,
methanesulfonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and
the like.
The pharmaceutically acceptable salts of the compounds
of this invention can be synthesized from the compounds of this invention
which contain a basic moiety by conventional chemical methods.
Generally, the salts are prepared either by ion exchange chromatography
or by reacting the free base with stoichiometric amounts or with an excess
of the desired salt-forming inorganic or organic acid in a suitable solvent
or various combinations of solvents.
Reactions used to generate the compounds of this invention
are prepared by employing reactions as shown in the Schemes 1-16,
in addition to other standard manipulations such as ester hydrolysis,
cleavage of protecting groups, etc., as may be known in the literature
or exemplified in the experimental procedures. Substituents R, Ra, Rb
and Rsub, as shown in the Schemes, represent the substituents R2, R3,
R4, and R5, and substituents on Z1 and ZZ; however their point of
attachment to the ring is illustrative only and is not meant to be limiting.
These reactions may be employed in a linear sequence to
provide the compounds of the invention or they may be used to synthesize
fragments which are subsequently joined by the alkylation reactions
described in the Schemes.
S TLnopsis of Schemes 1-16:
The requisite intermediates are in some cases commercially
available, or can be prepared according to literature procedures. In
Scheme 1, for example, the synthesis of macrocyclic compounds of the
instant invention containing suitably substituted piperazines and the
preferred benzylimidazolyl moiety is outlined. Preparation of the
substituted piperazine intermediate is essentially that described by J. S.
Kiely and S. R. Priebe in Orsanic Preparations and Proceedings Int.,
- 44 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
1990, 22, 761-768. Boc-protected amino acids such as I, available
commercially or by procedures known to those skilled in the art, can be
coupled to N-arylmethyl acetal amines using a variety of dehydrating
agents such as DCC (dicyclohexycarbodiimide) or EDC~HCl (1-ethyl-3-(3-
dimethylaminopropyl)carbodiimide hydrochloride) in a solvent such as
methylene chloride , chloroform, dichloroethane, or in dimethylformamide.
The product II is then deprotected and cyclized with acid, for example
hydrogen chloride in chloroform or ethyl acetate, or trifluoroacetic acid in
methylene chloride, to give the 5,6-unsaturated piperazinone III.
Catalytic hydrogenation of III over palladium on carbon gives the
piperazinone IV, which may then be reacted with a suitably substituted
benzyloxybenzyl bromide in the presence of a strong base to give
intermediate VI. The ring carbonyl of intermediate VI may then be
reduced with lithium aluminum hydride and the benzyl protecting groups
catalytically removed to provide intermediate VII. The piperidine
nitrogen may be reacted with an activated ester to provide the
naphthylamide VIII, which can then be deprotected under acidic
conditions to provide intermediate IX. The piperidine nitrogen can
then be reductively alkylated with a suitably substituted fluorobenzyl-
imidazolyl aldehyde X to provide XI. Cesium carbonate nucleophilic
aromatic substitution reaction conditions result in an intramolecular
cyclization to yield compound XII of the instant invention. This
cyclization reaction and other cyclization reactions shown below that are
mediated by cesium carbonate depend on the presence of an electronic
withdrawing moiety (such as vitro, cyano, and the like) either ortho or
para to the fluorine atom.
Scheme 2 illustrates the synthesis of instant macrocyclic
compounds which comprise a piperazinone in the ring. Thus, the
protected piperazinone XIII is alkylated with a naphthylmethyl bromide
having a suitably positioned benzyloxy moiety. Removal of the Boc
protecting group provided intermediate XIV, which may be coupled to a
suitably substituted 1-benzylimidazole aldehyde XV to give intermediate
XVI. Removal of the benzyl protecting group followed by intramolecular
- 45 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
cyclization as previously described using the cesium carbonate conditions
to provide instant compound XVII.
Scheme 3 illustrates the preparation of instant compounds
which incorporate a piperazinone moiety in the macrocyclic ring wherein
the macrocycle is incorporated in the 4- and 5-position of the piperazinone.
Thus N-protected m-tyrosine XVIII is converted to the corresponding
aldehyde XIX. Aldehyde XIX is reacted with a suitably substituted amine
to provide intermediate XX, which is then treated with bromoacetyl
bromide to provide, after base mediated cyclization piperazinone XXI.
Removal of the Boc protecting group followed by reductive N-alkylation of
intermediate XXII with a suitably substituted 1-benzylimidazole aldehyde
XV provides intermediate XXIII, which, after removal of the benzyl
protecting group, can undergo intramolecular cyclization under the cesium
carbonate conditions to give compound XXIV of the instant invention.
Synthesis of compounds of formula A characterized
by "X" as a carbonyl moiety is illustrated in Scheme 4. The suitably
substituted 3-fluorobenzylimidazol-4-yl acetic acid XXV, prepared from
imidazol-4-yl acetic acid, is reacted with piperazinone XXVI to provide
intermediate XXVII. Deprotection, followed by intramolecular cyclization
provides compound XXVIII of the instant invention.
Scheme 5 illustrates incorporation of an indole moiety into
the macrocyclic ring. The synthesis starts with commercially available 5-
hydroxytyrosine XXIX which is converted to the coresponding suitably
protected aldehyde XXX. The aldehyde then undergoes the reactions
described in Scheme 3 hereinabove to provide compound XXXI of the
instant invention.
Expansion of the macrocyclic ring by incorporation of a
phenoxy moiety is illustrated in Scheme 6.
Scheme 7 illustrates the synthetic strategy that is
employed when the Rg substitutent is not an electronic withdrawing
moiety either ortho or para to the fluorine atom. In the absence of the
electronic withdrawing moiety, the intramolecular cyclization can be
accomplished via an Ullmann reaction. Thus, protected imidazolyl-
methylacetate is treated with a suitably substituted halobenzylbromide
- 46 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
to provide the 1-benzylimidazolyl intermediate XXXII. The acetate
functionality of intermediate XXXII was converted to an aldehyde which
was then reductively coupled to compound X:XXIII, which is obtained by
a
hydrogenation of intermediate XXVI (wherein R = H), illustrated in
Scheme 4. Coupling under standard Ullmann conditions provided
compound XXXIV of the instant invention.
Scheme 8 illustrates the incorporation of a sulfur containing
sidechain into the piperazinone ring component of the instant macrocyclic
compounds.
Illustrative examples of the preparation of compounds of the
instant invention that incorporate a 2,5-diketopiperazine moiety is shown
in Scheme 9. Intermediate XXXVI, shown in Scheme 9, may also be used
to synthesize a number of other macrocycles that incorporate other
heterocyclic "W' moieties, such as illustrated in Scheme 10.
Scheme 11 illustrates the preparation of macrocyclic
compounds of the instant invention that incorporate a 2,3-
diketopiperazine moiety.
Amino acids of the general formula XXXVII which have a
sidechain not found in natural amino acids may be prepared by the
reactions illustrated in Scheme 12 starting with the readily prepared
imine XLVI.
Schemes 13-16 illustrate syntheses of suitably substituted
aldehydes useful in the syntheses of the instant compounds wherein the
variable W is present as a pyridyl moiety. Similar synthetic strategies for
preparing alkanols that incorporate other heterocyclic moieties for
variable W are also well known in the art.
- 47 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 1
ArCHO + NH2CHzCH(OC2H5)2 NaBH(OAc)3
OH
Ar CH2NHCH2CH(OC2H5)2 O N
i H O
EDC . HCI, HOST
DMF, Et3N, pH 7
/Ar
6N HCI
O N~IV~CH(OC2H5)2 THF
H O
H2 10%Pd/C
~N~ CH30H
O ~ Ar
,.O
O ~ Ar
IV
- 48 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
SCHEME 1 (continued)
HO
1. NaBH4, EtOH
Rs"b/ / O 2. NBS, {CH ) S,
32
CH2C12
,,O
~O
Br ~/N~
O Ar
IV
sub ~ >
NaHMDS, THF
V
O
LAH, THF
~N N~ reflux
Ar >
VII Bn
Rsub
10% Pd/C
>
Ar
H2, CH30H
Rsub
- 49 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 1 (continued)
02H
o ~ i i~
y--N N H
O
EDC-HCI, HOBT
VII H ~ \ DMF
Rsub
O ~ O Rsub
-N N _I_ HCI, EtOAc
O
H
Rsub
VIII
- 50 -
,,
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 1 continued)
R8 ~ ~ CH3 NBS~ R~ \ Br
(PhCO2)2 I
F F
OAc
N \> R ~-
~-N-Tr
N OAc
F
N
R~-
LiOH ~ ~ N OH
THF, H20 F
N
R
Pyr.S03 ~ CHO
Et3N
F
X N
- 51 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 1 (continued)
HO Na(Ac0)3BH
DCE
N H
X "
Cs2C03,
DMSO
R
XII
R ~-
C
N
F
Rsub
--
Rsub
- 52 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 2
Rsub
_ _ Rsub
R \ / N H2 R H _ _
BocNH"CHO ~ BocNH'
NaBH(OAc~
CICH2CH2C1
Ra Rsub
CI - -
CI ~ BocNH N
EtOAc / H20 /~
CIO
NaHC03
Ra Rsub
NaH ~ - -
DMF
D
XIII
- 53 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 2 fcontinued)
02H
OBn
Br
OBn
NaHMDS, THF
Ra Rsub
HCI, EtOAc
Bn
R
HO
N
F
~N
Na(Ac0)3BH
DCE
Bn
- 54 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 2 (continued)
Ra sub
R
N N
N H2, 10% Pd/C
y \ O
N
XVI
Bn
Cs2C03,
DMSO
r,a
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 3
H
H
/
Boc)20
v
OH THF O N OH
H2N ~ H O
O
XVIII
H
CH3NHOCH3 ~ HCI /
v
EDC . HCI, HOBT
DMF, Et3N, pH 7 ~ ~ N(CH3)OCH3
O N
H O
Bn
BnX, NaH / ~ LAH, Et20
N N(CH3)OCH3
H O
- 56 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 3 continued)
Bn
Z3-N H2
O N H NaBH(OAc)3'
H O CICH2CH2CI
XIX pH 6
Bn
1 ) BrCH2COBr
EtOAc, H20, NaHC03
H-Z3 2) NaH, THF, DMF
O N
H XX
O ,,O
O
3
~N -Z3 TFA, CH2CI2 HN -Z
-~-O
Bn0 XXII
Bn0
- 57 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 3 lcontinued~
O
R i
HN N-Z ~ ~ CHO
+ N
F
N
XXI i X
Bn0 O
a
R~ ~ ~ s
N N-Z
F
Na(Ac0)3BH N
4A MS, CICH2CH2C1
XXIII
3N HCI
Bn0
R ~ ~ Z3
H F
2
s
10% Pd/C
Z3
Cs2C03
DMSO
Rsub
R
XXIV
- 58 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 4
CH2C02H CH2C02CH3
CH30H
HCI H ~ HCI
Re ~ \ ~X
CH2C02CH3 1 ) CH3CN
(C6H5)3CBr~ ~ ~ F reflux
(C2H~3N N 2) CH30H, reflux
DMF Tr
R~ ~ N CH2C02CH3 2.5N HClag
s
<N \ 55°C
F
R = \ N CH2C02H
F N
XXV
- 59 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 4 (continued
Rsub
BocN N
Br
Bn0 / O
NaHMDS, THF
HCI, EtOAc
Bn
- 60 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 4 (continued
Rsub
R ' ~ CH2C02H R
__
HN , N
F N +
XXV
Bn
EDC ~ HCI
Rs HOBt
DMF
.' Y
Ra Rsub
F °v _ . /- 1
H2
10% Pd/C
XXV I I
- 61 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 4 (continued)
8
Ra Rsub
F O ~--~ _ _
N N
N-,/
O
H
CS2C03
DMSO
heat
R~
- 62 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/Z4948
SCHEME 5
H
(Boc)20
H2N THF
O
XXIX
H
13NHOCH3 ~ HCI
O N
H O ~DC . HCI, HOBT
DMF, Et3N, pH 7
H
N
UH
~ N(CH3)OCH3 BnX, K2C031DMF
_O N
H O
H
N
Utsn
~ N(CH3)OCH3 NaH, CH31
/ _O N
H n
- 63 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 5 I~CONT'D)
CH3
IN
v~sn
N(CH3)OCH3 LAH,
O N
H O
C H3
Z3_N H2
O N NaBH(OAc)3 ~
H O CICH2CH2CI
pH 6
CH3
N
I I
OBn 1 ) BrCH2COBr
~ NH-Z3 EtOAc, H20, NaHC03
' _O N _
H 2) NaH, THF, DMF
- 64 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 5 (continued
,,O
Ov ~ Z3 Z3
TFA, CH2C12
3
Bn B
O
CHO R
-Z
F F
X N
Na(Ac0)3BH
4A MS, CICH2CH2C1
3N HCI
,,O
Zs
H2
F t
10% Pd/C
- 65 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99124948
SCHEME 5 (Continued)
N
Cs2C03
DMSO CH3
R
XXXI
SCHEME 6
H
(Boc)20 \
THF ~ ~ OH
O N
p H O
H
CH3NHOCH3 ~ HCI
v
EDC . HCI, HOST > \
DMF, Et3N, pH 7 ~ ~ N(CH3)OCH3
O N
H O
(HO)2B Rsub'
OBn
Bn ~ LAH, Et20
> \
Cu(OAc)2 ~ N(CH3}OCH3
Et3N, CH2CI2 N
H n
- 66 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 6 (continued)
Zs_NH2
NaBH(OAc)3
CICH2CH2Ci
O N ~ pH 6
H O
1 ) BrCH2COBr
EtOAc, H20, NaHC03
2) NaH, THF, DMF
O N NHZ3 OBn
H
~p
Za Za
TFA, CH2(
CHO
v
N
F
N O
s
Na(Ac0)3BH R ~ ~ N N-Z3
4A MS, CICH2CH2C1 F
3N HCI N
- 67 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 6 (continued
O
s
R ~ ~ N N-Z3
H N
2
> F
10% Pd/C N
OH
~ O
Z3
Cs2C03
DMSO
- 68 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 7
HBr ~ N
N 1. 3-I-BnBr, EtOAc ~~OAc
~yOAc N
N 2. MeOH, 60 °C I
XXXI I
3. triturate
/ Rsub
H- N
XXXI I I
HO
LiOH~H~O S03~pyridine CHO
THF-H20 Et3N, DMS Na(Ac0)3BH
4A MS
CICH2CH2C1
n
N I 1. NaH, pyridine
V
I < , ~O 2. CuBr~SMe2, reflux
N
H
N'
y
R8
- 69 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
SCHEME 8
Rsub
H2N ~ ~ CICH2COC1 HN
r.
aq NaHC03 CI O
EtOAc
MeS
OH Rsub
(S)-methioninol _~_ 1. di-tert-butyl-
> HN HN ~ / azodicarboxytate
iPrOAc ~ >
Bu3P, EtOAc
2. HCI
MeS
(Boc)20
HCI ~ HN
THF
O
- 70 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 8~continued~
B
MeS I ~ NO2
O /Rsub
,
-N N
O ~ NaHMDS, THF
O
M
Rsub
HCI, EtOAc
Me HO
Rsub
1. Na(Ac0)3BH
4A MS
CICH2CH2CI
2. HCI
- 71 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 8 (continued,
MeS
Rsub
\\
N \ / MMPP/MeOH
F ~ \ O
N
Me02S
_ Rsub
N N
N \ ~ Pd/C, H2
\\
F ~ \ O THF, TFA
N
- 72 -
CA 02348703 2001-04-27
WO 00/25?88 PCTNS99/24948
SCHEME 8 (continued)
Me02S
R \ \ /Rsub
CS2CO3
DMSO
w~
N
Rsub
Rsub
- 73 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
SCHEME 9
H Bn
/ ~ /
BnX, NaH
v
v
O N OH ~ ~ OH
H I O N
O H O
XVIII
Bn
CICOCOCI
v
O N CI
H O
XXXV
H2N
R2 ~ R2
Rsub
H3C02C B~ K CO~ HsC02C
2 3
Rsub
z
H3C02C
BO
Et3N
sub
- 74 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 9 (continued
R2
H3C02C~ HCI
HCI ~ ,
> Rsub
EtOAc
R \ ~ CHO R ~~ \
F ~ F
N N
NaBH(OAc)3
CICH2CH2CI
8
R\ \
Pd/C, H2
THF, TFA F 'N
N-~ _N
Cs2CO3 ~~ O ~ \
> V
DMSO -~R~b
sub
R
R8~~~~~~0
- 75 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
SCHEME 10
2
H3C02C HCI Boc NH
H2 Boc NH CHO
NaBH(OAc)3
CICH2CH2G
CVI
2
Rsub
Boc NH N
CF3C02H
O I i CH2C12
Boc NH
OBn
sub
NH2 Boc20
CH2C12
N H2
- 76 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 10 (continued)
R2
sub / ~ CHO
BocH N
O I i NaBH(OAc)3
NH2 , , Et3N , CICHzCHzCI
R2
Rsub
BocHN ~ CF3C02H, CH2C12;
NaHC03
NH O
/ \ /
OBn
sub
NH2 ~NC
H AgCN
/ ~ /
_ 77 _
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 10 (continued)
sub
PdIC, H2
N
THF,TFA
~s
R
R2
CsC03
N
DMSO
R~
sub
R~
_ 78 _
CA 02348703 2001-04-27
WO 00/Z5788 PCT/US99/24948
SCHEME 11
Bn
H3C0 CI
I
v O
O N N H-Z3
H Et3N
R \ ~ C HO
O N
H3C02C~ F
N
HCI ~ HCI Z3
EtOAc NaBH(OAc)3
Et3N , CICHzCH2Cl
O/~O
R ~ ~ N Z3
F
N
Bn0
- ?9 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 11 (continued)
O~~O
~s
R.~~ -Zs
Pd/C, H2
N
F
THF, TFA N
HO
Cs2C03
DMSO
SCHEME 12
1. KOtBu, THF
C02Et R2x ~C02Et
-N H2N
Ph 2. 5% aqueous HCI HCI
XXXV I I I
1. Boc20, NaHC03 2
-C02H
BocHN
2. LiAIH4, Et20
XXXVI I
- 80 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 13
CH 3 1) HNO 2,Br 2 CO 2CH 3
2) KMnO
H 2N N 3) a H,H Br N
Rs
MgCI
Rs
CO 2CH 3
F
ZnCI 2,NiCl 2(Ph 3P) 2 ' F ~ N
Rs
NaBH 4 (excess) ~ CH 20H
F ~ N
Rs
SO 3~Py, Et 3N \~ / CHO
DMSO F \N
- 81 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 14
1. Et0(CO)CI
Rs Rs
2. ~ I
Br ~ F
CO 2CH 3 F ~ M9C1 O 2CH 3
Zn, CuCN
N 3. S, xylene, heat
Rs _
NaBH 4 SO 3'Py, Et 3N
-~
(excess) H 20H DMSO CHO
N
s MgCI
R\ F
Br / CO 2CH 3
F
~N 2CH 3
ZnCl2, NiCI 2(Ph3P)2
NaBH 4 20H SO 3'Py, Et 3N O
(excess) DMSO
N
- 82 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SCHEME 15
C02CH3
1. LDA, CO z
\N 2. Me OH, H + ~NJ
Rs
MgCI
F >CH3
ZnClz, NiCI z(Ph3P)z
NaBH 4 (excess; OH S03~Py, Et 3N
DMSO
Rs
F
CHO
y
N
- 83 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99I24948
SCHEME 16
C02CH3
1. LDA, CO 2 / I Br
~N Br r \ N
2. (CH 3)3SiCHN 2
R6 I ~ ~Br
R
F
2CH3
Zn, NiCl2(Ph3P)2
excess NaBH R
so 3~Py, Et 3N
20H pMSO
F
R
HO
In a preferred embodiment of the instant invention the
compounds of the invention are selective inhibitors of farnesyl-protein
transferase. A compound is considered a selective inhibitor of farnesyl-
protein transferase, for example, when its in vitro farnesyl-protein
transferase inhibitory activity, as assessed by the assay described in
Example 3, is at least 100 times greater than the in vitro activity of
the same compound against geranylgeranyl-protein transferase-type I
in the assay described in Example 4. Preferably, a selective compound
exhibits at least 1000 times greater activity against one of the enzymatic
- 84 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
activities when comparing geranylgeranyl-protein transferase-type I
inhibition and farnesyl-protein transferase inhibition.
It is also preferred that the selective inhibitor of farnesyl-
protein transferase is further characterized by:
b) an IC50 (a measure of in vitro inhibitory activity) for inhibition of
the prenylation of newly synthesized K-Ras protein more than
about 100-fold higher than the IC50 for the inhibition of the
farnesylation of hDJ protein.
When measuring such ICSps the assays described in Examples 8 and 9
ZO may be utilized.
It is also preferred that the selective inhibitor of farnesyl-
protein transferase is further characterized by:
c) an IC50 (a measurement of in vitro inhibitory activity) for
inhibition of K4B-Ras dependent activation of MAP kinases in cells
at least 100-fold greater than the IC50 for inhibition of the
farnesylation of the protein hDJ in cells.
It is also preferred that the selective inhibitor of farnesyl-
protein transferase is further characterized by:
d) an IC50 (a measurement of in vitro inhibitory activity) against
H-Ras dependent activation of MAP kinases in cells at least 1000
fold lower than the inhibitory activity (ICSp) against H-ras-CULL
(SEQ.ID.NO.: 1) dependent activation of MAP kinases in cells.
When measuring Ras dependent activation of MAP kinases in cells the
assays described in Example 7 may be utilized.
In another preferred embodiment of the instant invention the
compounds of the invention are dual inhibitors of farnesyl-protein
transferase and geranylgeranyl-protein transferase type I. Such a dual
inhibitor may be termed a Class II prenyl-protein transferase inhibitor
and will exhibit certain characteristics when assessed in in vitro assays,
which are dependent on the type of assay employed.
In a SEAP assay, such as described in Examples 7, it is
preferred that the dual inhibitor compound has an in vitro inhibitory
activity (IC50) that is less than about 12~,M against K4B-Ras dependent
activation of MAP kinases in cells.
- 85 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99124948
The Class II prenyl-protein transferase inhibitor may also be
characterized by:
a) an ICSp (a measurement of in vitro inhibitory activity) for
inhibiting K4B-Ras dependent activation of MAP kinases in cells
between 0.1 and 100 times the IC50 for inhibiting the farnesylation
of the protein hDJ in cells; and
b) an IC50 (a measurement of in vitro inhibitory activity) for
inhibiting K4B-Ras dependent activation of MAP kinases in cells
greater than 5-fold lower than the inhibitory activity (IC50) against
expression of the SEAP protein in cells transfected with the pCMV-
SEAP plasmid that constitutively expresses the SEAP protein.
The Class II prenyl-protein transferase inhibitor may also be
characterized by:
a) an IC50 (a measurement of in vitro inhibitory activity) against
H-Ras dependent activation of MAP kinases in cells greater than
2 fold lower but less than 20,000 fold lower than the inhibitory
activity (IC50) against H-ras-CULL (SEQ.ID.NO.: 1) dependent
activation of MAP kinases in cells; and
b) an IC50 (a measurement of in vitro inhibitory activity) against
H-ras-CULL dependent activation of MAP kinases in cells greater
than 5-fold lower than the inhibitory activity (IC50) against
expression of the SEAP protein in cells transfected with the pCMV-
SEAP plasmid that constitutively expresses the SEAP protein.
The Class II prenyl-protein transferase inhibitor may also be
characterized by:
a) an IC50 (a measurement of in vitro inhibitory activity) against
H-Ras dependent activation of MAP kinases in cells greater than
10-fold lower but less than 2,500 fold lower than the inhibitory
activity (IC50) against H-ras-CULL (SEQ.ID.NO.: 1) dependent
activation of MAP kinases in cells; and
b) an IC50 (a measurement of in vitro inhibitory activity) against
H-ras-CULL dependent activation of MAP kinases in cells greater
than 5 fold lower than the inhibitory activity (ICSp) against
- 86 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
expression of the SEAP protein in cells transfected with the pCMV-
SEAP plasmid that constitutively expresses the SEAP protein.
A method for measuring the activity of the inhibitors
of prenyl-protein transferase, as well as the instant combination
compositions, utilized in the instant methods against Ras dependent
activation of MAP kinases in cells is described in Example 7.
The instant compounds are useful as pharmaceutical agents
for mammals, especially for humans. These compounds may be
administered to patients for use in the treatment of cancer. Examples
of the type of cancer which may be treated with the compounds of this
invention include, but are not limited to, colorectal carcinoma, exocrine
pancreatic carcinoma, myeloid leukemias and neurological tumors. Such
tumors may arise by mutations in the ras genes themselves, mutations in
the proteins that can regulate Ras activity (i.e., neurofibromin (NF-1),
neu, src, abl, lck, fyn) or by other mechanisms.
The compounds of the instant invention inhibit farnesyl-
protein transferase and the farnesylation of the oncogene protein Ras.
The instant compounds may also inhibit tumor angiogenesis, thereby
affecting the growth of tumors (J. Rak et al. Cancer Research, 55:
4575-4580 (1995)). Such anti-angiogenesis properties of the instant
compounds may also be useful in the treatment of certain forms of vision
deficit related to retinal vascularization.
The compounds of this invention are also useful for inhibiting
other proliferative diseases, both benign and malignant, wherein Ras
proteins are aberrantly activated as a result of oncogenic mutation in
other genes (i.e., the Ras gene itself is not activated by mutation to an
oncogenic form) with said inhibition being accomplished by the
administration of an effective amount of the compounds of the invention to
a mammal in need of such treatment. For example, a component of NF-1
is a benign proliferative disorder.
The instant compounds may also be useful in the treatment
of certain viral infections, in particular in the treatment of hepatitis delta
and related viruses (J.S. Glenn et al. Science, 256:1331-1333 (1992).
- 87 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
The compounds of the instant invention are also useful in the
prevention of restenosis after percutaneous transluminal coronary
angioplasty by inhibiting neointimal formation (C. Indolfi et al. Nature
medicine, 1:541-545(1995).
The instant compounds may also be useful in the treatment
and prevention of polycystic kidney disease (D.L. Schaffner et al.
American Journal of Pathology, 142:1051-1060 (1993) and B. Cowley, Jr.
et aI.FASEB Journal, 2:A3I60 (1988)).
The instant compounds may also be useful for the treatment
of fungal infections.
The instant compounds may also be useful as inhibitors of
proliferation of vascular smooth muscle cells and therefore useful in the
prevention and therapy- of arteriosclerosis and diabetic vascular
pathologies.
The compounds of this invention may be administered
to mammals, preferably humans, either alone or, preferably, in
combination with pharmaceutically acceptable carriers, excipients
or diluents, in a pharmaceutical composition, according to standard
pharmaceutical practice. The compounds can be administered orally
or parenterally, including the intravenous, intramuscular, intraperitoneal,
subcutaneous, rectal and topical routes of administration.
The pharmaceutical compositions containing the active
ingredient may be in a form suitable for oral use, for example, as
tablets, troches, lozenges, aqueous or oily suspensions, dispersible
powders or granules, emulsions, hard or soft capsules, or syrups or elixirs.
Compositions intended for oral use may be prepared according to any
method known to the art for the manufacture of pharmaceutical
compositions and such compositions may contain one or more agents
selected from the group consisting of sweetening agents, flavoring agents,
coloring agents and preserving agents in order to provide
pharmaceutically elegant and palatable preparations. Tablets contain the
active ingredient in admixture with non-toxic pharmaceutically acceptable
excipients which are suitable for the manufacture of tablets. These
excipients may be for example, inert diluents, such as calcium carbonate,
_ 88 _
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
sodium carbonate, lactose, calcium phosphate or sodium phosphate;
granulating and disintegrating agents, for example, microcrystalline
cellulose, sodium crosscarmellose, corn starch, or alginic acid; binding
agents, for example starch, gelatin, polyvinyl-pyrrolidone or acacia, and
lubricating agents, for example, magnesium stearate, stearic acid or talc.
The tablets may be uncoated or they may
be coated by known techniques to mask the unpleasant taste of the drug
or delay disintegration and absorption in the gastrointestinal tract and
thereby provide a sustained action over a longer period. For example,
a water soluble taste masking material such as hydroxypropylmethyl-
cellulose or hydroxypropylcellulose, or a time delay material such as ethyl
cellulose, cellulose acetate buryrate may be employed.
Formulations for oral use may also be presented as hard
gelatin capsules wherein the active ingredient is mixed with an inert solid
diluent, for example, calcium carbonate, calcium phosphate or kaolin, or
as soft gelatin capsules wherein the active ingredient is mixed with water
soluble carrier such as polyethyleneglycol or an oil medium, for example
peanut oil, liquid paraffin, or olive oil.
Aqueous suspensions contain the active material in
admixture with excipients suitable for the manufacture of aqueous
suspensions. Such excipients are suspending agents, for example sodium
carboxymethylcellulose, methylcellulose, hydroxypropylmethyl-cellulose,
sodium alginate, polyvinyl-pyrrolidone, gum tragacanth and gum acacia;
dispersing or wetting agents may be a naturally-occurring phosphatide,
for example lecithin, or condensation products of an alkylene oxide with
fatty acids, for example polyoxyethylene stearate,
or condensation products of ethylene oxide with long chain aliphatic
alcohols, for example heptadecaethylene-oxycetanol, or condensation
products of ethylene oxide with partial esters derived from fatty acids and
a hexitol such as polyoxyethylene sorbitol monooleate, or condensation
products of ethylene oxide with partial esters derived from fatty acids and
hexitol anhydrides, for example polyethylene sorbitan monooleate. The
aqueous suspensions may also contain one or more preservatives, for
example ethyl, or n-propyl p-hydroxybenzoate, one or more coloring
_ 89 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
agents, one or more flavoring agents, and one or more sweetening agents,
such as sucrose, saccharin or aspartame.
Oily suspensions may be formulated by suspending the active
ingredient in a vegetable oil, for example arachis oil, olive oil, sesame oil
or coconut oil, or in mineral oil such as liquid paraffin. The oily
suspensions may contain a thickening agent, for example beeswax, hard
paraffin or cetyl alcohol. Sweetening agents such as those set forth above,
and flavoring agents may be added to provide a palatable oral
preparation. These compositions may be preserved by the addition of
an anti-oxidant such as butylated hydroxyanisol or alpha-tocopherol.
Dispersible powders and granules suitable for preparation of
an aqueous suspension by the addition of water provide the active
ingredient in admixture with a dispersing or wetting agent, suspending
agent and one or more preservatives. Suitable dispersing or wetting
agents and suspending agents are exemplified by those already mentioned
above. Additional excipients, for example sweetening, flavoring and
coloring agents, may also be present. These compositions may be
preserved by the addition of an anti-oxidant such as ascorbic acid.
The pharmaceutical compositions of the invention may
also be in the form of an oil-in-water emulsions. The oily phase may
be a vegetable oil, for example olive oil or arachis oil, or a mineral oil,
for example liquid paraffin or mixtures of these. Suitable emulsifying
agents may be naturally-occurring phosphatides, for example soy bean
lecithin, and esters or partial esters derived from fatty acids and hexitol
anhydrides, for example sorbitan monooleate, and condensation products
of the said partial esters with ethylene oxide, for example polyoxyethylene
sorbitan monooleate. The emulsions may also contain sweetening,
flavouring agents, preservatives and antioxidants.
Syrups and elixirs may be formulated with sweetening
agents, for example glycerol, propylene glycol, sorbitol or sucrose. Such
formulations may also contain a demulcent, a preservative, flavoring and
coloring agents and antioxidant.
The pharmaceutical compositions may be in the form of a
sterile injectable aqueous solutions. Among the acceptable vehicles and
- 90 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
solvents that may be employed are water, Ringer's solution and isotonic
sodium chloride solution.
The sterile injectable preparation may also be a sterile
injectable oil-in-water microemulsion where the active ingredient is
dissolved in the oily phase. For example, the active ingredient may be
first dissolved in a mixture of soybean oil and lecithin. The oil solution
then introduced into a water and glycerol mixture and processed to form a
microemulation.
The injectable solutions or microemulsions may be
introduced into a patient's blood-stream by local bolus injection.
Alternatively, it may be advantageous to administer the solution or
microemulsion in such a way as to maintain a constant circulating
concentration of the instant compound. In order to maintain such a
constant concentration, a continuous intravenous delivery device may
be utilized. An example of such a device is the Deltec CADD-PLUSTM
model 5400 intravenous pump.
The pharmaceutical compositions may be in the form of a
sterile injectable aqueous or oleagenous suspension for intramuscular and
subcutaneous administration. This suspension may be formulated
according to the known art using those suitable dispersing or wetting
agents and suspending agents which have been mentioned above. The
sterile injectable preparation may also be a sterile injectable solution or
suspension in a non-toxic parenterally-acceptable diluent or solvent, for
example as a solution in 1,3-butane diol. In addition, sterile, fixed oils
are conventionally employed as a solvent or suspending medium. For this
purpose any bland fixed oil may be employed including synthetic mono- or
diglycerides. In addition, fatty acids such as oleic acid find
use in the preparation of injectables.
Compounds of Formula A may also be administered in
the form of a suppositories for rectal administration of the drug. These
compositions can be prepared by mixing the drug with a suitable non-
irritating excipient which is solid at ordinary temperatures but liquid at
the rectal temperature and will therefore melt in the rectum to release the
drug. Such materials include cocoa butter, glycerinated gelatin,
- 91 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
hydrogenated vegetable oils, mixtures of polyethylene glycols of various
molecular weights and fatty acid esters of polyethylene glycol.
For topical use, creams, ointments, jellies, solutions or
suspensions, etc., containing the compound of Formula A are employed.
(For purposes of this application, topical application shall include mouth
washes and gargles.)
The compounds for the present invention can be
administered in intranasal form via topical use of suitable intranasal
vehicles and delivery devices, or v'ia transdermal routes, using those forms
of transdermal skin patches well known to those of ordinary skill in the
art. To be administered in the form of a transdermal delivery system, the
dosage administration will, of course, be continuous rather than
intermittent throughout the dosage regimen.
As used herein, the term "composition" is intended to
encompass a product comprising the specified ingredients in the specific
amounts, as well as any product which results, directly or indirectly, from
combination of the specific ingredients in the specified amounts.
When a compound according to this invention is
administered into a human subject, the daily dosage will normally be
determined by the prescribing physician with the dosage generally
varying according to the age, weight, sex and response of the individual
patient, as well as the severity of the patient's symptoms.
In one exemplary application, a suitable amount of compound
is administered to a mammal undergoing treatment for cancer.
Administration occurs in an amount between about 0.1 mg/kg of body
weight to about 60 mg/kg of body weight per day, preferably of between
0.5 mg/kg of body weight to about 40 mg/kg of body weight per day.
The compounds of the instant invention may also be
co-administered with other well known therapeutic agents that
are selected for their particular usefulness against the condition
that is being treated. For example, the compounds of the instant
invention may also be co-administered with other well known cancer
therapeutic agents that are selected for their particular usefulness
against the condition that is being treated. Included in such
- 92 -
CA 02348703 2001-04-27
WO 00!25788 PCT/US99/24948
combinations of therapeutic agents are combinations of the instant
farnesyl-protein transferase inhibitors and an antineoplastic agent. It
is also understood that such a combination of antineoplastic agent and
inhibitor of farnesyl-protein transferase may be used in conjunction
with other methods of treating cancer and/or tumors, including
radiation therapy and surgery.
Examples of an antineoplastic agent include, in general,
microtubule-stabilizing agents ( such as paclitaxel (also known as
Taxol~), docetaxel (also known as Taxotere~), epothilone A, epothilone B,
desoxyepothilone A, desoxyepothilone B or their derivatives); microtubule-
disruptor agents; alkylating agents, anti-metabolites; epidophyllotoxin; an
antineoplastic enzyme; a topoisomerase inhibitor; procarbazine;
mitoxantrone; platinum coordination complexes; biological response
modifiers and growth inhibitors; hormonal/anti-hormonal therapeutic
agents and haematopoietic growth factors.
Example classes of antineoplastic agents include, for
example, the anthracycline family of drugs, the vinca drugs, the
mitomycins, the bleomycins, the cytotoxic nucleosides, the taxanes,
the epothilones, discodermolide, the pteridine family of drugs, diynenes
and the podophyllotoxins. Particularly useful members of those classes
include, for example, doxorubicin, carminomycin, daunorubicin,
aminopterin, methotrexate, methopterin, dichloro-methotrexate,
mitomycin C, porfiromycin, 5-ffuorouracil, 6-mercaptopurine, gemcitabine,
cytosine arabinoside, podophyllotoxin or podo-phyllotoxin derivatives such
as etoposide, etoposide phosphate or teniposide, melphalan, vinblastine,
vincristine, leurosidine, vindesine, leurosine, paclitaxel and the like.
Other useful antineoplastic agents include estramustine, cisplatin,
carboplatin, cyclophosphamide, bleomycin, tamoxifen, ifosamide,
melphalan, hexamethyl melamine, thiotepa, cytarabin, idatrexate,
trimetrexate, dacarbazine, L-asparaginase, camptothecin, CPT-11,
topotecan, ara-C, bicalutamide, flutamide, leuprolide, pyridobenzoindole
derivatives, interferons and interleukins.
The preferred class of antineoplastic agents is the taxanes
and the preferred antineoplastic agent is paclitaxel.
- 93 -
CA 02348703 2001-04-27
PCTNS99124948
WO 00125788
iation therapy, including x-rays or gamma rays which are
Rad
' her an externally applied beam or by implantation of
delivered from eit
ources, maY also be used in combination with the instant
tiny radioactive s
'nhibitor of farnesyl-protein transferase alone to treat cancer.
Tonally, compounds of the instant invention may also be
i
Addlt
n sensitizers, as described in WO 97138697, published on
useful as radiatio
October 23, 1997, and herein incorporated by reference.
he instant compounds may also be useful in combination
T
'bitors of parts of the signaling pathway that links cell
with other inhi
wth factor receptors to nuclear signals initiating cellular
surface gro
ration. Thus, the instant compounds may be utilized in
prolife
with farnesyl pyrophosphate competitive inhibitors of
combination
of farnesyl-protein transferase or in combination with a
the activity
ich has Raf antagonist activity. The instant compounds may
compound wh
stered with compounds that are selective inhibitors of
also be co-admini
otein transferase. In particular, if the compound of
geranylgeranyl pr
a instant invention is a selective inhibitor of farnesyl-pxotem
th
co-administration with a compounds) that is a selective
t.ransferase,
1 eranyl protein transferase may provide an improved
inhibitor of gexany g
therapeutic effect.
In articular, the compounds disclosed in the following
p
and ublications may be useful as farnesyl pyrophosphate-
patents p
'nhibitor component of the instant composition: U.S. Ser.
competitive i
1254,228 and 081435,047. Those patents and publications are
Nos. 08
incorporated herein by reference.
In practicing methods of this invention, which
istering, simultaneously or sequentially or in any order,
comprise admin
rotein substrate-competitive inhibitor and a farnesyl
two or more of a p
-com etitive inhibitor, such administration can be orally or
pyrophosphate p
including intravenous, intramuscular, intraperitoneal,
parenterally,
al and topical routes of administration. It is preferred
subcutaneous, rect
dministration be orally. It is more preferred that such
that such a
be orally and simultaneously. When the protein substrate-
administration
inhibitor and farnesyl pyrophosphate-competitive inhibitor
competitive
_ 94
CA 02348703 2001-04-27
WO 00/Z5788 PCTNS99/24948
are administered sequentially, the administration of each can be by the
same method or by different methods.
The instant compounds may also be useful in combination
with an integrin antagonist for the treatment of cancer, as described in
U.S. Ser. No. 09/055,487, filed April 6, 1998, which is incorporated herein
by reference.
As used herein the term an integrin antagonist refers
to compounds which selectively antagonize, inhibit or counteract binding
of a physiological ligand to an integrin(s) that. is involved in the
regulation
of angiogenisis, or in the growth and invasi~~eness of tumor cells. In
particular, the term refers to compounds which selectively antagonize,
inhibit or counteract binding of a physiological ligand to
the av(33 integrin, which selectively antagonize, inhibit or counteract
binding of a physiological ligand to the av(35 integrin, which antagonize,
inhibit or counteract binding of a physiological ligand to both the av(33
integrin and the av(35 integrin, or which antagonize, inhibit or counteract
the activity of the particular integrin(s) expressed on capillary endothelial
cells. The term also refers to antagonists of the al(31, a2(31, a5~il, a6(31
and a6(34 integrins. The term also refers to antagonists of any
combination of av(33 integrin, av(35 integrin, aril, a2(31, a5/31, a6/31 and
a6(34 integrins. The instant compounds may also be useful with other
agents that inhibit angiogenisis and thereby inhibit the growth and
invasiveness of tumor cells, including, but not limited to angiostatin and
endostatin.
The instant compounds may also be useful in combination
with an inhibitor of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA
reductase) for the treatment of cancer. Compounds which have inhibitory
activity for HMG-CoA reductase can be readily identified
by using assays well-known in the art. For example, see the assays
described or cited in U.S. Patent 4,231,938 at col. 6, and WO 84/02131
at pp. 30-33. The terms "HMG-CoA reductase inhibitor" and "inhibitor
of HMG-CoA reductase" have the same meaning when used herein.
Examples of HMG-CoA reductase inhibitors that may be
used include but are not limited to lovastatin (MEVACOR~; see US
- 95 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
Patent No. 4,231,938; 4,294,926; 4,319,039), simvastatin (ZOCOR~; see
US Patent No. 4,444,784; 4,820,850; 4,916,239), pravastatin
(PRAVACHOL~; see US Patent Nos. 4,346,227; 4,537,859; 4,410,629;
5,030,447 and 5,180,589), fluvastatin (LESCOL~; see US Patent Nos.
5,354,772; 4,911,165; 4,929,437; 5,189,164; 5,118,853; 5,290,946;
5,356,896), atorvastatin (LIPITOR~; see US Patent Nos. 5,273,995;
4,681,893; 5,489,691; 5,342,952) and cerivastatin (also known as
rivastatin and BAYCHOL~; see US Patent No. 5,177,080). The
structural formulas of these and additional HMG-CoA reductase
inhibitors that may be used in the instant methods are described at page
87 of M. Yalpani, "Cholesterol Lowering Drugs", Chemistry & Industry,
pp. 85-89 (5 February 1996) and US Patent Nos. 4,782,084 and 4,885,314.
The term HMG-CoA reductase inhibitor as used herein includes all
pharmaceutically acceptable lactone and open-acid forms (i.e., where the
lactone ring is opened to form the free acid)
as well as salt and ester forms of compounds which have HMG-CoA
reductase inhibitory activity, and therefor the use of such salts, esters,
open-acid and lactone forms is included within the scope of this invention.
An illustration of the lactone portion and its corresponding open-acid form
is shown below as structures I and II.
HO p HO
'COON
O OH
Lactone Open-Acid
I II
In HMG-CoA reductase inhibitor's where an open-acid form can exist, salt
and ester forms may preferably be formed from the open-acid, and all such
forms are included within the meaning of the term "HMG-CoA reductase
inhibitor" as used herein. Preferably, the HMG-CoA reductase inhibitor is
selected from lovastatin and simvastatin, and most preferably
- 96 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
simvastatin. Herein, the term "pharmaceutically acceptable salts" with
respect to the HMG-CoA reductase inhibitor shall mean non-toxic salts of
the compounds employed in this invention which are generally prepared
by reacting the free acid with a suitable organic or inorganic base,
particularly those formed from cations such as sodium, potassium,
aluminum, calcium, lithium, magnesium, zinc and
tetramethylammonium, as well as those salts formed from amines such as
ammonia, ethylenediamine, N-methylglucamine, lysine, arginine,
ornithine, choline, N,N'-dibenzylethylenediamine, chloroprocaine,
diethanolamine, procaine, N-benzylphenethylamine,
1-p-chlorobenzyl-2-pyrrolidine-1'-yl-methylbenzimidazole, diethylamine,
piperazine, and tris(hydroxymethyl)aminomethane. Further examples of
salt forms of HMG-CoA reductase inhibitors may include, but are not
limited to, acetate, benzenesulfonate, benzoate, bicarbonate, bisulfate,
bitartrate, borate, bromide, calcium edetate, camsylate, carbonate,
chloride, clavulanate, citrate, dihydrochloride, edetate, edisylate, estolate,
esylate, fumarate, gluceptate, gluconate, glutamate, glycollylarsanilate,
hexylresorcinate, hydrabamine, hydrobromide, hydrochloride,
hydroxynapthoate, iodide, isothionate, lactate, lactobionate, Iaurate,
malate, maleate, mandelate, mesylate, methylsulfate, mutate, napsylate,
nitrate, oleate, oxalate, pamaote, palmitate, panthothenate,
phosphate/diphosphate, polygalacturonate, salicylate, stearate,
subacetate, succinate, tannate, tartrate, teoclate, tosylate, triethiodide,
and valerate.
Ester derivatives of the described HMG-CoA reductase
inhibitor compounds may act as prodrugs which, when absorbed into the
bloodstream of a warm-blooded animal, may cleave in such a manner as to
release the drug form and permit the drug to afford improved therapeutic
efficacy.
Similarly, the instant compounds may be useful in
combination with agents that are effective in the treatment and
prevention of NF-1, restenosis, polycystic kidney disease, infections
of hepatitis delta and related viruses and fungal infections.
_ 97 _
CA 02348703 2001-04-27
WO 00/25788
PCTNS99/24948
If formulated as a fixed dose, such combination products
employ the combinations of this invention within the dosage range
described above and the other pharmaceutically active agents) within
its approved dosage range. Combinations of the instant invention may
alternatively be used sequentially with known pharmaceutically
acceptable agents) when a multiple combination formulation is
inappropriate.
The compounds of the instant invention are also useful as
a component in an assay to rapidly determine the presence and
quantity of farnesyl-protein transferase (FPTase) in a composition.
Thus the composition to be tested may be divided and the two portions
contacted with mixtures which comprise a known substrate of FPTase
(for example a tetrapeptide having a cysteine at the amine terminus)
and farnesyl pyrophosphate and, in one of the mixtures,
a compound of the instant invention. After the assay mixtures are
incubated for an sufficient period of time, well known in the art, to
allow the FPTase to farnesylate the substrate, the chemical content
of the assay mixtures may be determined by well known immuno-
logical, radiochemical or chromatographic techniques. Because
the compounds of the instant invention are selective inhibitors of
FPTase, absence or quantitative reduction of the amount of substrate
in the assay mixture without the compound of the instant invention
relative to the presence of the unchanged substrate in the assay
containing the instant compound is indicative of the presence of
FPTase in the composition to be tested.
It would be readily apparent to one of ordinary skill in
the art that such an assay as described above would be useful in
identifying tissue samples which contain farnesyl-protein transferase and
quantitating the enzyme. Thus, potent inhibitor compounds of the instant
invention may be used in an active site titration assay to determine the
quantity of enzyme in the sample. A series of samples composed of
aliquots of a tissue extract containing an unknown amount of farnesyl-
protein transferase, an excess amount of a known substrate of FPTase (for
example a tetrapeptide having a cysteine at the amine terminus) and
_ 98 _
CA 02348703 2001-04-27
WO 00lZ5788 PCT/US99/24948
farnesyl pyrophosphate are incubated for an appropriate period of time in
the presence of varying concentrations of a compound of the instant
invention. The concentration of a sufficiently potent inhibitor (i.e., one
that has a Ki substantially smaller than the concentration of enzyme in
the assay vessel) required to inhibit the enzymatic activity of the sample
by 50% is approximately equal to half of the concentration of the enzyme
in that particular sample.
EXAMPLES
Examples provided are intended to assist in a further
understanding of the invention. Particular materials employed, species
and conditions are intended to be further illustrative of the invention and
not limitative of the reasonable scope thereof.
EXAMPLE 1
(~) 18-(3-Chlorophenyl)-16,16a,17,18,19,20-hexahydro-17-oxo-5H-
6,10-metheno-22H-benzo [b]pyrazino [2,1-a]imidazo [4, 3-h] (1,6,9]
oxadiazacvclopentadecine-9-carbonitrile dihydrochloride
Step A: Preparation of 1-triphenylmethyl-4-(hydroxymethyl)-
imidazole
To a solution of 4-(hydroxymethyl)imidazole hydrochloride
(35.0 g, 260 mmol) in 250 mL of dry DMF at room temperature was added
triethylamine (90.6 mL, 650 mmol). A white solid precipitated from the
solution. Chlorotriphenylmethane (76.1 g, 273 mmol) in 500 mL of DMF
was added dropwise. The reaction mixture was stirred for 20 hours,
poured over ice, filtered, and washed with ice water. The resulting
product was slurried with cold dioxane, filtered, and dried in vacuo to
provide the titled product as a white solid which was sufficiently pure
for use in the next step.
_ 99 _
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
Step B: Preparation of 1-triphenylmethyl-4-(acetoxymethyl)-
imidazole
Alcohol from Step A (260 mmol, prepared above) was
suspended in 500 mL of pyridine. Acetic anhydride (74 mL, 780 mmol)
was added dropwise, and the reaction was stirred for 48 hours during
which it became homogeneous. The solution was poured into 2 L of
EtOAc, washed with water (3 x 1 L), 5% aq. HCl soln. (2 x I L), sat. aq.
NaHC03, and brine, then dried (Na2S04), filtered, and concentrated in
vacuo to provide the crude product. The acetate was isolated as a white
powder which was sufficiently pure for use in the next reaction.
Step C: Preparation of 4-cyano-3-fluorotoluene
To a degassed solution of 4-bromo-3-fluorotoluene (50.0 g,
264 mmol) in 500 mL of DMF was added Zn(CN)2 (18.6 g, 159 mmol) and
Pd(PPh3)4 (6.1 g, 5.3 mmol). The reaction was stirred at 80 °C for 6
hours,
then cooled to room temperature. The solution was poured into EtOAc,
washed with water, sat. aq. NaHC03, and brine, then dried (Na2S04),
filtered, and concentrated in vacuo to provide the crude product.
Purification by silica gel chromatography (0-5% EtOAc/hexane) provided
the titled product.
Step D: Prebaration of 4-cvano-3-fluorobenzylbromide
To a solution of the product from Step C (22.2 g, 165 mmol) in
220 mL of carbontetrachloride was added N-bromosuccinimide (29.2 g, 164
mmol) and benzoylperoxide (l.lg). The reaction was heated to reffux for
minutes, then cooled to room temperature. The solution was
concentrated in vacuo to one-third the original volume, poured into
EtOAc, washed with water, sat. aq. NaHC03, and brine, then dried
(Na2S04), filtered, and concentrated in vacuo to provide the crude
30 product. Analysis by 1H NMR indicated only partial conversion, so
the crude material was resubjected to the same reaction conditions for 2.5
hours, using 18 g (102 mmol) of N-bromosuccinimide. After workup, the
crude material was purified by silica gel chromatography (0-10%
EtOAc/hexane} to provide the desired product.
- 100 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
Step E: Preparation of 1-(4-cyano-3-fluorobenzyl)-5-(acetoxymethyl)-
imidazole hydrobromide
A solution of the product from Step B (36.72 g, 96.14 mmol)
and the product from Step D (20.67 g, 96.14 mmol) in 250 mL of EtOAc
was stirred at 60°C for 20 hours, during which a white precipitate
formed.
The reaction was cooled to room temperature and filtered
to provide the solid imidazolium bromide salt. The filtrate was
concentrated in vacuo to a volume of 100 mL, reheated at 60°C for two
hours, cooled to room temperature, and filtered again. The filtrate was
concentrated in vacuo to a volume 40 mL, reheated at 60°C for another
two hours, cooled to room temperature, and concentrated in vacuo to
provide a pale yellow solid. All of the solid material was combined,
dissolved in 300 mL of methanol, and warmed to 60°C. After two hours,
the solution was reconcentrated in vacuo to provide a white solid which
was triturated with hexane to remove soluble materials. Removal of
residual solvents in vacuo provided the titled product hydrobromide as a
white solid which was used in the next step without further purification.
Step F: Preparation of 1-(4-cyano-3-fluorobenzyl)-5-
(hydroxymethyl)imidazole
To a solution of the product from Step E (31.87 g, 89.77
mmol) in 300 mL of 2:1 THF/water at 0°C was added lithium hydroxide
monohydrate (7.53 g, 179 mmol). After two hours, the reaction was
concentrated in vacuo to a 100 mL volume, stored at 0°C for 30 minutes,
then filtered and washed with 700 mL of cold water to provide a brown
solid. This material was dried in vacuo next to P20s to provide the titled
product as a pale brown powder which was sufficiently pure for use in the
next step without further purification.
Step G: Preparation of 1-(4-cyano-3-fluorobenzyl)-5-
imidazolecarboxaldehyde
To a solution of the alcohol from Step F (2.31 g, 10.0 mmol) in
20 mL of DMSO at 0°C was added triethylamine (5.6 mL, 40 mmol), then
- 101 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
S03-pyridine complex (3.89 g, 25 mmol). After 30 minutes, the reaction
was poured into EtOAc, washed with water and brine, dried (Na2S04),
filtered, and concentrated in uacuo to provide the aldehyde as a pale
yellow powder which was sufficiently pure for use in the next step without
further purification.
Step H: Preparation of N-(3-chlorophenyl)ethylenediamine
hydrochloride
To a solution of 3-chloroaniline (30.0 mL, 284 mmol) in 500
mL of dichloromethane at 0°C was added dropwise a solution of 4 N HCl
in 1,4-dioxane (80 mL, 320 mmol HCl). The solution was warmed to room
temperature, then concentrated to dryness in uacuo to provide a white
powder. A mixture of this powder with 2-oxazolidinone (24.6 g,
282 mmol) was heated under nitrogen atmosphere at 160°C for 10 hours,
during which the solids melted, and gas evolution was observed. The
reaction was allowed to cool, forming the crude diamine hydrochloride salt
as a pale brown solid.
Step I: Preparation of N (tent-butoxycarbonyl)-N'-(3-
chlorophenyl)ethylenediamine
The amine hydrochloride from Step H (ca. 282 mmol, crude
material prepared above) was taken up in 500 mL of THF and 500 mL of
sat. aq. NaHC03 soln., cooled to 0°C, and di-tert-butylpyrocarbonate
(61.6
g, 282 mmol) was added. After 30 h, the reaction was poured into EtOAc,
washed with water and brine, dried (Na2S04), filtered, and concentrated
in uacuo to provide the titled carbamate as a brown oil which was used in
the next step without further purification.
St-~ J: Preparation of N [2-(tert-butoxycarbamoyl)ethyl]-N (3-
chlorophenyl)-2-chloroacetamide
A solution of the product from Step I (77 g, ca. 282 mmol) and
triethylamine (67 mL, 480 mmol) in 500 mL of CH2C12 was cooled
to 0°C. Chloroacetyl chloride (25.5 mL, 320 mmol) was added dropwise,
and the reaction was maintained at 0°C with stirring. After 3 h,
another
- 102 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
portion of chloroacetyl chloride (3.0 mL) was added dropwise. After 30
min, the reaction was poured into EtOAc (2 L) and washed with water,
sat. aq. NH4C1 soln, sat. aq. NaHC03 soln., and brine. The solution
was dried (Na2S04}, filtered, and concentrated in vacuo to provide the
chloroacetamide as a brown oil which was used in the next step without
further purification.
Step K: Preparation of 4-(tent-butoxycarbonyl)-1-(3-chlorophenyl)-2-
piperazinone
To a solution of the chloroacetamide from Step J (ca. 282
mmol) in 700 mL of dry DMF was added K2C03 (88 g, 0.64 mol). The
solution was heated in an oil bath at 70-75°C for 20 hours, cooled to
room
temperature, and concentrated in vacuo to remove ca. 500 mL of DMF.
The remaining material was poured into 33% EtOAc/hexane, washed with
water and brine, dried (Na2S04), filtered, and concentrated in vacuo to
provide the product as a brown oil. This material was purified by silica
gel chromatography (25-50% EtOAc/hexane) to yield pure product, along
with a sample of product (ca. 65% pure by HPLC) containing a less polar
impurity.
Step L: Preparation of 2-(benzyloxy)benzyl alcohol
To a stirring solution of 2-(benzyloxy)benzaldehyde (lOg,
47 mmol) in 100mL of Ethanol, NaBH4 was added as a solid in small
portions. The reaction temperature was controlled with a room
temperature water bath. After stirring for 30 minutes, the reaction was
quenched by slow addition of 3N HCl. This solution was extracted with
EtOAc and the organic portion washed with water, Sat. Na2C03 and
brine. The solution was dried (Na2S04), filtered, and concentrated in
vacuo to provide the benzy alcohol which was used in the next step
without further purification.
Step M: Preparation of 2-(benzyloxy)benzylbromide
A solution of N Bromosuccinimide (1.848, 10.36 mmol) in
50mL of CHZC12 was cooled in a wet ice/acetone bath. Dimethyl sulfide
- 103 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
(0.91 mL, 12.44 mmol) was added and the reaction stirred for 10 minutes.
The product from Step L (1.48g, 6.91 mmol) in 25mL of CH2C12 was added
and the reaction was stirred at 0°C for 4.5 hours. The reaction was
poured into water/ice and seperated layers. The organic portion was
washed with brine , dried (Na2S04), filtered, and concentrated in uacuo to
provide the benzyl bromide.
Step N: Preparation of 4-(tert-butylcarbonyl)-3-( 2-(benzyloxy)benzyl)-
1-(3-chlorophenyl)-2-piperazinone
A solution of the product from Step K in dry THF was cooled
to -78 °C. A solution of Sodium bis(trimethylsilyl)amide in THF (1M,
3.2
mL, 3.2 mmol) was added slowly and the reaction stirred for 45 minutes.
A solution of the product from Step M (859 mg, 3.2 mmol) in 1 mL of THF
was added slowly and the reaction stirred for 2.5 hours. The reaction was
quenched at -?8 °C by the addition of HZO, warmed to room temperature
and diluted with EtOAc. The layers were seperated and the organic
portion washed with sat. NaHC03 solution and brine, dried (Na2S04),
filtered, and concentrated in uacuo to provide of the alkylated
piperazinone.
Step O: Preparation of 3-( 2-(benzyloxy)benzyl)-1-(3-chlorophenyl)-2-
piperazinone hydrochloride
Through a solution of the product from Step N (l.Og, 2.0
mmol) in 25 mL of ethyl acetate at 0°C was bubbled anhydrous HCl gas
for 5 minutes. After 30 minutes, the solution was concentrated in uacuo to
provide the titled salt as a white foam which was used in the next reaction
without further purification.
Step P: Preparation of 3-[2-(benzyloxy)benzyl]-1-(3-chlorophenyl)-4-
[1-(4-cyano-3-fluorobenzyl)-5-imidazolimidazolylmethylJ-2-
pinerazinone
To a solution of the amine hydrochloride from Step O (581
mg, 1.31 mmol) in 8 mL of 1,2-dichloroethane was added 4A molecular
sieves (500 mg), followed by sodium triacetoxyborohydride (416 mg, 1.96
- 104 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
mmol). The aldehyde from Step G (300 mg, 1.31 mmol) was added, and
the reaction was stirred for 16 hours. The reaction was poured into
EtOAc, washed with sat. aq. NaHCOg and brine, dried (Na2S04), filtered,
and concentrated in vdcuo. Purification by silica gel chromatography
(0-10% MeOH in EtOAc) provided the titled product.
Ste : Preparation of 1-(3-chlorophenyl)-4-[1-(4-cyano-3-
fluorobenzyl)-5-imidazolimidazolylmethyl]- of 3-[2-
~hydroxy~benz~l-2 piperazinone
To a solution of the benzyl ether from Step P (300 mg, 0.48
mmol) in 5 mL of 1:1 MeOH/EtOAc was added trifluoroacetic acid (0.10
mL) and 10% palladium on carbon (150 mg). The solution was stirred
under a balloon atmosphere of hydrogen at room temperature. After 18
hours, the solution was filtered through celite, and the filter pad was
rinsed with 1:1 MeOH/EtOAc. Concentrated in va~cuo and purified on six
1mm preperative TLC plates run in CHCI3:MeOH:NH40H (90:10:1) to
yield 80 mg as a 2:1 mixture of the titled compound along with the des-
chloro compound. This mixture was used as is for the next step.
Step R: Preparation of (t)18-(3-chlorophenyl)-16,16a,17,18,19,20-
hexahydro-17-oxo-5H-6,10-metheno-22H-benzo-
[b]pyrazino[2,1-a]imidazo[4,3-h][1,6,9]oxadiaza-
cyclopentadecine-9-carbonitrile dihydrochloride
To a solution of the product from Step Q (80 mg, ca. 0.15
mmol) in 5 mL of DMSO was added cesium carbonate (106 mg, 0.30
mmol). The reaction was warmed to 50°C under argon for one hour, then
heated to 80°C for 1.5 hours, allowed to cool to 50°C and stir
for 2 hours
more. The reaction was then cooled to room temperature. The solution
was poured into EtOAc and washed with water and brine,
dried (Na2S04), filtered, and concentrated in vaccuo. The resulting product
was purified on four 0.5 mm preperative TLC plates run in
CHCI3:MeOH:NH40H (90:10:1) The compound was converted to the HCl
salt by dissolving in a minimal amount of CH2C12 and treating with
- 105 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
excess saturated HCl/ether solution, and concentrating in vacuo to
provide the titled product.
FAB mass spectrum m/e 510 (M+1).
Analysis calculated for C2gH24C1N5O~ ~ 2.00 HCl ~ 0.10 H20:
C, 59.56; H, 4.52; N, 11.98;
Found: C, 59.60; H, 4.84; N, 11.71.
EXAMPLE 2
(t) 16,16a,17,18,19,20-Hexahydro-17-oxo-18-phenyl-5H-6,10-metheno-
22H-benzo [b]pyrazino [2,1-a]imidazo [4, 3-
h][1,6,9]oxadiazacyclopentadecine-9-carbonitrile dihydrochloride
The titled compound was isolated as a product of Step R of
example 1 as a white powder.
FAB mass spectrum m/e 476 (M+1).
Analysis calculated for C2gH2~N5O2 ~ 2.00 HCl ~ 1.15 H20:
C, 65.38; H, 5.35; N, 13.15;
Found: C, 65.35; H, 5.42; N, 12.75.
EXAMPLE 3
In vitro inhibition of ras farnesyl transferase
Transferase Assays. Isoprenyl-protein transferase
activity assays are carried out at 30°C unless noted otherwise. A
typical reaction contains (in a final volume of 50 ~L): [3H]farnesyl
diphosphate, Ras protein , 50 mM HEPES, pH 7.5, 5 mM MgCl2, 5 mM
dithiothreitol, 10 p,M ZnCl2, 0.1% polyethyleneglycol (PEG) (15,000-20,000
mw) and isoprenyl-protein transferase. The FPTase employed in the
assay is prepared by recombinant expression as described in Omer, C.A.,
Kral, A.M., Diehl, R.E., Prendergast, G.C., Powers,
- 106 -
CA 02348703 2001-04-27
PCTNS99/24948
WO OOI25788
S., Allen, C.M., Gibbs, J.B. and Kohl, N.E. (1993) Biochemistry
32:5167-5176. After thermally pre-equilibrating the assay mixture
in the absence of enzyme, reactions are initiated by the addition of
isoprenyl-protein transferase and stopped at timed intervals (typically
15 min) by the addition of 1 M HCl in ethanol (1 mL). The quenched
reactions are allowed to stand for 15 m (to complete the precipitation
process). After adding 2 mL of 100% ethanol, the reactions are vacuum-
filtered through Whatman GF/C filters. Filters are washed four times
with 2 mL aliquots of 100% ethanol, mixed with scintillation fluid (10 mL)
and then counted in a Beckman LS3801 scintillation counter.
For inhibition studies, assays are run as described above,
except inhibitors are prepared as concentrated solutions in 100% dimethyl
sulfoxide and then diluted 20-fold into the enzyme assay mixture.
Substrate concentrations for composition or inhibitor IC50 determinations
are as follows: FTase, 650 nM Ras-CVLS (SEQ.ID.NO.: 1), 100 nM
farnesyl diphosphate.
The compounds useful in the instant invention described in
the above Examples 1-2 were tested for inhibitory activity against human
FPTase by the assay described above and were found to have IC50 _of < 10
EWI.
EXA~'VIPLE 4
Modifiedln vitro GGTase inhibition assay
The modified geranylgeranyl-protein transferase inhibition
assay is carried out at room temperature. A typical reaction contains (in a
final volume of 50 ~.L): (3H]geranylgeranyl diphosphate, biotinylated Ras
peptide, 50 mM HEPES, pH 7.5, a modulating anion
(for example 10 mM glycerophosphate or 5mM ATP), 5 mM MgCl2,
10 ~M ZnCl2, 0.1% PEG (15,000-20,000 mw), 2 mM dithiothreitol,
and geranylgeranyl-protein transferase type I(GGTase). The GGTase-
type I enzyme employed in the assay is prepared as described in U.S. Pat.
No. 5,470,832, incorporated by reference. The Ras peptide is derived from
the K4B-Ras protein and has the following sequence: biotinyl-
GKKKKKKSKTKCVIM (single amino acid code) (SEQ. ID.NO.: 2).
- 107 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
Reactions are initiated by the addition of GGTase and stopped at timed
intervals (typically 15 min) by the addition of 200 ~L of a 3 mg/mL
suspension of streptavidin SPA beads (Scintillation Proximity Assay
beads, Amersham) in 0.2 M sodium phosphate, pH 4, containing 50
mM EDTA, and 0.5% BSA. The quenched reactions are allowed to stand
for 2 hours before analysis on a Packard TopCount scintillation counter.
For inhibition studies, assays are run as described above,
except compositions or inhibitors are prepared as concentrated solutions
in 100% dimethyl sulfoxide and then diluted 25-fold into the enzyme
ZO assay mixture. IC5p values are determined with Ras peptide near KM
concentrations. Enzyme and substrate concentrations for inhibitor IC5o
determinations are as follows: 75 pM GGTase-I, 1.6 ~.M Ras peptide, 100
nM geranylgeranyl diphosphate.
EXAMPLE 5
Cell-basedin vitro ras farnesvlation assay
The cell Iine used in this assay is a v-ras line derived
from either Ratl or NIH3T3 cells, which expressed viral Ha-ras p21. The
assay is performed essentially as described in DeClue, J.E. et al., Cancer
Research 51:712-7I7, (1991). Cells in 10 cm dishes at 50-75% conffuency
are treated with the test compound or composition (final concentration of
solvent, methanol or dimethyl sulfoxide, is 0.1%). After 4 hours at
37°C,
the cells are labeled in 3 ml methionine-free DMEM supple-mented with
10% regular DMEM, 2% fetal bovine serum and 400 mCi[35S)methionine
(1000 Ci/mmol). After an additional 20 hours, the cells are lysed in 1 ml
lysis buffer (1% NP40/20 mM HEPES, pH 7.5/5 mM MgCl2/1mM DTT/10
mg/ml aprotinen/2 mg/ml leupeptin/2 mg/ml antipain/0.5 mM PMSF) and
the lysates cleared by centrifugation at 100,000 x g for 45 min. Aliquots
of lysates containing equal numbers of acid-precipitable counts are bought
to 1 ml with IP buffer (lysis buffer lacking DTT) and immunoprecipitated
with the ras-specific monoclonal antibody Y13-259 (Furth, M.E. et al., J.
Virol. 43:294-304, (1982)). Following a 2 hour antibody incubation at
4°C,
200 ml of a 25% suspension of protein A-Sepharose coated with rabbit anti
- 108 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
rat IgG is added for 45 min. The immunoprecipitates are washed four
times with IP buffer (20 nM HEPES, pH 7.5/1 mM EDTA/1% Triton X-
100Ø5% deoxycholate/0.1%/SDS/0.1 M NaCl) boiled in SDS-PAGE
sample buffer and loaded on 13% acrylamide gels. When the dye front
reached the bottom, the gel is fixed, soaked in Enlightening, dried and
autoradiographed. The intensities of the bands corresponding to
farnesylated and nonfarnesylated ras proteins are compared to determine
the percent inhibition of farnesyl transfer to protein.
EXAMPLE 6
Cell-basedin vitro growth inhibition assay
To determine the biological consequences of FPTase
inhibition, the effect of the compounds or compositions of the instant
invention on the anchorage-independent growth of Ratl cells transformed
with either a v-ras, v-raf, or v-mos oncogene is tested. \Cells transformed
by v-Raf and v-Mos maybe included in the analysis
to evaluate the specificity of compounds or instant compositions for
Ras-induced cell transformation.
Rat 1 cells transformed with either v-ras, v-raf, or v-mos axe
seeded at a density of 1 x 104 cells per plate (35 mm in diameter)
in a 0.3% top agarose layer in medium A (Dulbecco's modified Eagle's
medium supplemented with 10% fetal bovine serum) over a bottom
agarose layer (0.6%). Both layers contain 0.1% methanol or an
appropriate concentration of the compound or instant composition
(dissolved in methanol at 1000 times the final concentration used in
the assay). The cells are fed twice weekly with 0.5 ml of medium A
containing 0.1% methanol or the concentration of the instant compound.
Photomicrographs are taken 16 days after the cultures are seeded
and comparisons are made.
EXAMPLE 7
Construction of SEAP reporterplasmid pDSE100
- 109 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
The SEAP reporter plasmid, pDSE100 was constructed by
ligating a restriction fragment containing the SEAP coding sequence into
the plasmid pCMV-RE-AHI. The SEAP gene is derived from
the plasmid pSEAP2-Basic (Clontech, Palo Alto, CA). The plasmid pCMV-
RE-AKI was constructed by Deborah Jones (Merck) and contains 5
sequential copies of the 'dyad symmetry response element' cloned
upstream of a 'CAT-TATA' sequence derived from the cytomegalovirus
immediate early promoter. The plasmid also contains a bovine growth
hormone poly-A sequence.
The plasmid, pDSE100 was constructed as follows. A
restriction fragment encoding the SEAP coding sequence was cut out
of the plasmid pSEAP2-Basic using the restriction enzymes EcoR1 and
HpaI. The ends of the linear DNA fragments were filled in with the
Klenow fragment of E. coli DNA Polymerase I. The 'blunt ended' DNA
containing the SEAP gene was isolated by electrophoresing the digest in
an agarose gel and cutting out the 1694 base pair fragment. The vector
plasmid pCMV-RE-AKI was linearized with the restriction enzyme Bgl-II
and the ends filled in with HIenow DNA Polymerase I. The SEAP DNA
fragment was blunt end ligated into the pCMV-RE-AKI vector
and the ligation products were transformed into DH5-alpha E. coli cells
(Gibco-BRL). Transformants were screened for the proper insert and then
mapped for restriction fragment orientation. Properly oriented
recombinant constructs were sequenced across the cloning junctions to
verify the correct sequence. The resulting plasmid contains the SEAP
coding sequence downstream of the DSE and CAT-TATA promoter
elements and upstream of the BGH poly-A sequence.
Alternative Construction of SEAP reporter plasmid pDSE101
The SEAP repotrer plasmid, pDSE101 is also constructed by
ligating a restriction fragment containing the SEAP coding sequence into
the plasmid pCMV-RE-AKI. The SEAP gene is derived from plasmid
pGEM7zf(-)/SEAP.
The plasmid pDSEI01 was constructed as follows: A
restriction fragment containing part of the SEAP gene coding sequence
- 110 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
was cut out of the plasmid pGEM7zf(-)/SEAP using the restriction
enzymes Apa I and KpnI. The ends of the linear DNA fragments were
chewed back with the Klenow fragment of E. coli DNA Polymerase I. The
"blunt ended" DNA containing the truncated SEAP gene was isolated by
electrophoresing the digest in an agarose gel and cutting out the 1910
base pair fragment. This 1910 base pair fragment was ligated into the
plasmid pCMV-RE-AKI which had been cut with Bgl-II and filled in with
E. coli Klenow fragment DNA polymerase. Recombinant plasmids were
screened for insert orientation and sequenced through the ligated
junctions. The plasmid pCMV-RE-AKI is derived from plasmid pCMVIE-
AKI-DHFR (Whang , Y., Silberklang, M., Morgan, A., Munshi, S., Lenny,
A.B., Ellis, R.W., and Kieff, E. (1987) J. Virol., 61, 1796-1807) by removing
an EcoRI fragment containing the DHFR and Neomycin markers. Five
copies of the fos promoter serum response element were inserted as
described previously (Jones, R.E., Defeo-Jones, D., McAvoy, E.M., Vuocolo,
G.A., Wegrzyn, R.J., Haskell, K.M. and Oliff, A. (1991) Oncogene, 6, 745-
751) to create plasmid pCMV-RE-AKI.
The plasmid pGEM7zf(-)/SEAP was constructed as follows. The SEAP
gene was PCRed, in two segments from a human placenta cDNA library
(Clontech) using the following oligos.
Sense strand N-terminal SEAP : 5'
GAGAGGGAATTCGGGCCCTTCCTGCAT
GCTGCTGCTGCTGCTGCTGCTGGGC 3' (SEQ.ID.N0.:3)
Antisense strand N-terminal SEAP: 5'
GAGAGAGCTCGAGGTTAACCCGGGT
GCGCGGCGTCGGTGGT 3' (SEQ.ID.N0.:4)
Sense strand C-terminal SEAP: 5'
GAGAGAGTCTAGAGTTAACCCGTGGTCC
CCGCGTTGCTTCCT 3' (SEfg,I.ID.N0.:5)
- 111 -
CA 02348703 2001-04-27
PCT/US99I24948
WO 00/25788
Antisense strand C-terminal SEAP: 5'
GA.AGAGGAAGCTTGGTACCGCCACTG
GGCTGTAGGTGGTGGCT 3' (SEQ.ID.N0.:6)
The N-terminal oligos (SEQ.ID.NO.: 4 and SE(a.ID.NO.: 5) were used
to generate a 1560 by N-terminal PCR product that contained EcoRI
and Hpal restriction sites at the ends. The Antisense N-terminal
oligo (SEQ.ID.NO.: 4) introduces an internal translation STOP codon
within the SEAP gene along with the Hpal site. The C-terminal oligos
(SEQ.ID.NO.: 5 and SEQ.ID.NO.: 6) were used to amplify a 412 by
C-terminal PCR product containing Hpal and HindIII restriction sites.
The sense strand C-terminal oligo (SEQ.ID.NO.: 5) introduces the
internal STOP codon as well as the Hpal site. Next, the N-terminal
amplicon was digested with EcoRI and Hpal while the C-terminal
amplicon was digested with Hpal and HindIII. The two fragments
comprising each end of the SEAP gene were isolated by electro-
phoresing the digest in an agarose gel and isolating the 1560 and 412 base
pair fragments. These two fragments were then co-ligated into the vector
pGEM7zf(-) (Promega) which had been restriction digested with EcoRI
and HindIII and isolated on an agarose gel. The resulting clone,
pGEM7zf(-)/SEAP contains the coding sequence for the SEAP gene from
amino acids.
Construction of a constitutivel ex ressin ar.r~r la~u=~~ --.-
An expression plasmid constitutively expressing the SEAP
protein was created by placing the sequence encoding a truncated SEAP
gene downstream of the cytomegalovirus (CMS IE-1 promoter. The
expression plasmid also includes the CMV intron A region 5' to the SEAP
gene as well as the 3' untranslated region of the bovine growth hormone
gene 3' to the SEAP gene.
The plasmid pCMVIE-AKI-DHFR (Whang et al, 1987)
containing the CMV immediate early promoter was cut with EcoRI
generating two fragments. The vector fragment was isolated by agarose
electrophoresis and religated. The resulting plasmid is named pCMV-
- 112 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
AKI. Next, the cytomegalovirus intron A nucleotide sequence was
inserted downstream of the CMV IE1 promter in pCMV-AKI. The intron
A sequence was isolated from a genomic clone bank and subcloned into
pBR322 to generate plasmid pl6T-286. The intron A sequence was
mutated at nucleotide 1856 (nucleotide numbering as
in Chapman, B.S., Thayer, R.M., Vincent, K.A. and Haigwood, N.L.,
Nuc.Acids Res. 19, 3979-3986) to remove a SacI restriction site using site
directed mutagenesis. The mutated intron A sequence was PCRed from
the plasmid p 16T-287 using the following oligos.
to
Sense strand: 5' GGCAGAGCTCGTTTAGTGAACCGTCAG 3'
(SEQ.ID.NO.: 7)
Antisense strand: 5' GAGAGATCTCAAGGACGGTGACTGCAG 3'
(SEQ.ID.N0.:8)
These two oligos generate a 991 base pair fragment
with a SacI site incorporated by the sense oligo and a Bgl-II fragment
incorporated by the antisense oligo. The PCR fragment is trimmed with
SacI and Bgl-II and isolated on an agarose gel. The vector pCMV-AKI is
cut with SacI and Bgl-II and the larger vector fragment isolated by
agarose gel electrophoresis. The two gel isolated fragments are ligated at
their respective SacI and Bgl-II sites to create plasmid pCMV-AKI-InA.
The DNA sequence encoding the truncated SEAP gene
is inserted into the pCMV-AKI-InA plasmid at the Bgl-II site of the vector.
The SEAP gene is cut out of plasmid pGEM7zf(-)/SEAP (described above)
using EcoRI and HindIII. The fragment is filled in with Klenow DNA
polymerase and the 1970 base pair fragment isolated from the vector
fragment by agarose gel electrophoresis. The pCMV-AKI-InA vector is
prepared by digesting with Bgl-II and filling in the ends with Klenow
DNA polymerase. The final construct is generated by blunt end ligating
the SEAP fragment into the pCMV-AKI-InA vector. Transformants were
screened for the proper insert and then mapped
- 113 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
for restriction fragment orientation. Properly oriented recombinant
constructs were sequenced across the cloning junctions to verify the
correct sequence. The resulting plasmid, named pCMV-SEAP,
contains a modified SEAP sequence downstream of the cytomegalovirus
immediately early promoter IE-I and intron A sequence and upstream of
the bovine growth hormone poly-A sequence. The plasmid expresses
SEAP in a constitutive manner when transfected into mammalian cells.
Cloning of a Myristylated viral-H=ras expressionplasmid
A DNA fragment containing viral-H-rczs can be PCRed from
plasmid "H-1" (Ellis R. et al. J. Virol. 36, 408, 1980) or "HB-11 (deposited
in the ATCC under Budapest Treaty on August 27, 1997,
and designated ATCC 209,218) using the following oligos.
Sense strand:
5'TCTCCTCGAGGCCACCATGGGGAGTAGCAAGAGCAAGCCTAAGGAC
CCCAGCCAGCGCCGGATGACAGAATACAAGCTTGTGGTGG3'.
(SEQ.ID.NO.: 9)
Antisense:
5'CACATCTAGATCAGGACAGCACAGACTTGCAGC3'.
(SEQ.ID.NO.: 10)
A sequence encoding the first 15 aminoacids of the v-src
gene, containing a myristylation site, is incorporated into the sense strand
oligo. The sense strand oligo also optimizes the 'Kozak' translation
initiation sequence immediately 5' to the ATG start site.
To prevent prenylation at the viral-ras C-terminus, cysteine 186 would be
mutated to a serine by substituting a G residue for a C residue in the C-
terminal antisense oligo. The PCR primer oligos introduce an XhoI site at
the 5' end and a XbaI site at the 3'end. The XhoI-XbaI fragment can be
ligated into the mammalian expression plasmid pCI (Promega) cut with
XhoI and XbaI. This results in a plasmid in which the recombinant myr-
viral-H-ras gene is constitutively transcribed from
the CMV promoter of the pCI vector.
- 114 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
Cloning of a viral-H-ras-CULL expression plasmid
A viral-H-ras clone with a C-terminal sequence encoding the
amino acids CVLL can be cloned from the plasmid "H-1" (Ellis R.
et al. J. Virol. 36, 408, 1980) or "HB-11 (deposited in the ATCC under
Budapest Treaty on August 27, 1997, and designated ATCC 209,218) by
PCR using the following oligos.
Sense strand:
5'TCTCCTCGAGGCCACCATGACAGAATACAAGCTTGTGGTGG-3'
(SEQ.ID.N0.:11}
Antisense strand:
5'CACTCTAGACTGGTGTCAGAGCAGCACACACTTGCAGC-3'
(SEQ.ID.NO.: 12)
The sense strand oligo optimizes the 'Kozak' sequence and
adds an XhoI site. The antisense strand mutates serine 189 to leucine
and adds an XbaI site. The PCR fragment can be trimmed with XhoI and
XbaI and ligated into the XhoI-XbaI cut vector pCI (Promega). This
results in a plasmid in which the mutated viral-H-ras-CVLL gene
is constitutively transcribed from the CMV promoter of the pCI vector.
Cloning of c-H-ras-Leu61 expression plasmid
The human c-H-ras gene can be PCRed from a human
cerebral cortex cDNA library (Clontech) using the following
oligonucleotide primers.
Sense strand:
5'-GAGAGAATTCGCCACCATGACGGAATATAAGCTGGTGG-3'
(SEQ.ID.N0.:13)
Antisense strand:
5'-GAGAGTCGACGCGTCAGGAGAGCACACACTTGC-3' (SEQ.ID.NO.:
14)
The primers will amplify a c-H-ras encoding DNA fragment
with the primers contributing an optimized 'Kozak' translation start
sequence, an EcoRI site at the N-terminus and
- 115 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
a Sal I stite at the C-terminal end. After trimming the ends of the
PCR product with EcoRI and Sal I, the c-H-ras fragment can be
ligated ligated into an EcoRI -Sal I cut mutagenesis vector pAlter-1
(Promega). Mutation of glutamine-61 to a leucine can be accomplished
using the manufacturer's protocols and the following oligonucleotide:
5'-CCGCCGGCCTGGAGGAGTACAG-3' (SEQ.ID.NO.: 15)
After selection and sequencing for the correct nucleotide
substitution, the mutated c-H-ras-Leu61 can be excised from the pAlter-1
vector, using EcoRI and Sal I, and be directly ligated into the vector pCI
(Promega) which has been digested with EcoRI and Sal I. The new
recombinant plasmid will constitutively transcribe c-H-ras-Leu61 from the
CMV promoter of the p CI vector.
20
Clonin~of a c-N-ras-Val-12 expression plasmid
The human c-N-ras gene can be PCRed from a human
cerebral cortex cDNA library (Clontech) using the following
oligonucleotide primers.
Sense strand:
5'-GAGAGAATTCGCCACCATGACTGAGTACAA.ACTGGTGG-3'
(SEQ.ID.NO.: 16)
Antisense strand:
5'-GAGAGTCGACTTGTTACATCACCACACATGGC-3' (SEQ.ID.N0.:17)
The primers will amplify a c-N-ras encoding DNA fragment
with the primers contributing an optimized 'Kozak' translation start
sequence, an EcoRI site at the N-terminus and a Sal I stite at the C-
terminal end. After trimming the ends of the PCR product with EcoRI
and Sal I, the c-N-ras fragment can be ligated into an EcoRI -Sal I cut
mutagenesis vector pAlter-1 (Promega). Mutation of glycine-12 to a valine
can be accomplished using the manufacturer's protocols and the following
oligonucleotide:
5'-GTTGGAGCAGTTGGTGTTGGG-3' (SEQ.ID.NO.: 18)
- 116 -
CA 02348703 2001-04-27
WO 00/25'188 PCT/US99/24948
After selection and sequencing for the correct nucleotide
substitution, the mutated c-N-ras-Val-12 can be excised from the pAlter-1
vector, using EcoRI and Sal I, and be directly ligated into the vector pCI
(Promega) which has been digested with EcoRI and Sal I. The new
recombinant plasmid will constitutively transcribe c-N-ras-Val-12 from
the CMV promoter of the pCI vector.
Cloning of a c-K-ras-Val-12 expression plasmid
The human c-K-ras gene can be PCRed from a human
cerebral cortex cDNA library (Clontech) using the following
oligonucleotide primers.
Sense strand:
5'-GAGAGGTACCGCCACCATGACTGAATATAAACTTGTGG-3'
(SEQ.ID.NO.: 19)
Antisense strand:
5'-CTCTGTCGACGTATTTACATAATTACACACTTTGTC-3'
(SEQ.ID.N0.:20)
The primers will amplify a c-K-ras encoding DNA
fragment with the primers contributing an optimized 'Kozak' translation
start sequence, a KpnI site at the N-terminus and a Sal I site at the C-
terminal end. After trimming the ends of the PCR product with Kpn I and
Sal I, the c-K-ras fragment can be ligated into a KpnI -Sal I cut
mutagenesis vector pAlter-1 (Promega}. Mutation of cysteine-12 to a
valine can be accomplished using the manufacturer's protocols and the
following oligonucleotide:
5'-GTAGTTGGAGCTGTTGGCGTAGGC-3' (SEQ.ID.N0.:21)
After selection and sequencing for the correct nucleotide
substitution, the mutated c-K-ras-Val-12 can be excised from the pAlter-1
vector, using KpnI and Sal I, and be directly ligated into the vector pCI
(Promega) which has been digested with KpnI and Sal I. The new
- 117 -
CA 02348703 2001-04-27
WO 00/25788 PCTNS99/24948
recombinant plasmid will constitutively transcribe c-K-ras-Val-12 from
the CMV promoter of the pCI vector.
SEAP assay
Human C33A cells (human epitheial carcenoma - ATTC
collection) are seeded in lOcm tissue culture plates in DMEM + 10% fetal
calf serum + 1X Pen/Strep + 1X glutamine + 1X NEAR. Cells are grown
at 37oC in a 5% C02 atmosphere until they reach 50 -80% of confluency.
The transient transfection is performed by the CaP04
method (Sambrook et al., 1989). Thus, expression plasmids for H-ras,
N-ras, K-ras, Myr-ras or H-ras-CVLL are co-precipitated with the DSE-
SEAP reporter construct. For lOcm plates 6001 of CaCl2 -DNA solution is
added dropwise while vortexing to 6001 of 2X HBS buffer to give 1.2m1 of
precipitate solution. (see recipes below). This is allowed to sit at room
temperature for 20 to 30 minutes. While the precipitate is forming, the
media on the C33A cells is replaced with DMEM (minus phenol red; Gibco
cat. # 31053-028)+ 0.5% charcoal stripped calf serum + 1X (Pen/Strep,
Glutamine and nonessential aminoacids). The CaP04-DNA precipitate is
added dropwise to the cells and the plate rocked gently to distribute. DNA
uptake is allowed to proceed for 5-6 hrs at 37oC under a 5% C02
atmosphere.
Following the DNA incubation period, the cells are washed
with PBS and trypsinized with lml of 0.05% trypsin. The 1 ml of
trypsinized cells is diluted into 10m1 of phenol red free DMEM + 0.2%
charcoal stripped calf serum + 1X (Pen/Strep, Glutamine and NEAR ).
Transfected cells are plated in a 96 well microtiter plate (100p1/well)
to which drug, diluted in media, has already been added in a volume of
100,1. The final volume per well is 2001 with each drug concentration
repeated in triplicate over a range of half log steps.
Incubation of cells and test compound or composition is for 36
hrs at 37o under C02. At the end of the incubation period, cells are
examined microscopically for evidence of cell distress. Next, 1001 of
media containing the secreted alkaline phosphatase is removed from each
well and transferred to a microtube array for heat treatment at 65°C
for 1
- 118 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
hr to inactivate endogenous alkaline phosphatases (but not the heat stable
secreted phosphatase).
The heat treated media is assayed for alkaline phosphatase
by a luminescence assay using the luminescence reagent CSPD~0
(Tropix, Bedford, Mass.). A volume of 50 ~1 media is combined with 200 ~1
of CSPD cocktail and incubated for 60 minutes at room temperature.
Luminesence is monitored using an ML2200 microplate luminometer
(Dynatech). Luminescence reflects the level of activation of the fos
reporter construct stimulated by the transiently expressed protein.
DNA-CaP04 nrecinitate for lOcm. plate of cells
Ras expression plasmid (lpg/~1) IO~cI
DSE-SEAP Plasmid (l~g/~,l) 2~,1
Sheared Calf Thymus DNA (l~.g/~.l) 8~1
2M CaCl2 741
dH20 5061
2X HBS Buffer
280mM NaCI
lOmM KCl
l.SmM Na2HP04 2H20
l2mM dextrose
50mM HEPES
Final~pH = 7.05
Luminesence Buffer (26m1)
Assay Buffer 20m1
Emerald ReagentTM (Tropix) 2.5m1
100mM homoarginine 2.5m1
CSPD Reagent~ (Tropix) I.OmI
Assay Buffer
Add 0.05M Na2C03 to 0.05M NaHC03 to obtain pH 9.5.
Make 1mM in MgCl2
- 119 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
EXAMPLE 8
The processing assays employed in this example and in
Example 9 are modifications of that described by DeClue et al [Cancer
Research 51, 712-717, 1991].
K4B-Ras processing inhibition assay
PSN-1 (human pancreatic carcinoma) cells are used for
analysis of protein processing. Subconfluent cells in 100 mm dishes
are fed with 3.5 ml of media (methionine-free RPMI supplemented
with 2% fetal bovine serum or cysteine-free/methionine-free DMEM
supplemented with 0.035 ml of 200 mM glutamine (Gibco), 2% fetal bovine
serum, respectively) containing the desired concentration of
test compound, lovastatin or solvent alone. Cells treated with lovastatin
(5-10 ~M), a compound that blocks Ras processing in cells by inhibiting
a rate-limiting step in the isoprenoid biosynthetic pathway, serve as a
positive control. Test compounds or compositions are prepared as 1000x
concentrated solutions in DMSO to yield a final solvent concentration of
0.1%. Following incubation at 37oC for two hours 204 ~.Ci/mI [35S]Pro-
Mix (Amersham, cell labeling grade) is added.
After introducing the label amino acid mixture, the cells are
incubated at 37oC for an additional period of time (typically 6 to
24 hours). The media is then removed and the cells axe washed once with
cold PBS. The cells are scraped into 1 ml of cold PBS, collected by
centrifugation (10,000 x g for 10 sec at room temperature), and lysed by
vortexing in 1 ml of lysis buffer (1°/ Nonidet P-40, 20 mM HEPES, pH
7.5,
150 mM NaCI, 1 mM EDTA, 0.5% deoxycholate,
0.1% SDS, 1 mM DTT, 10 pg/ml AEBSF, 10 ~.g/ml aprotinin, 2 wg/ml
leupeptin and 2 p.g/ml antipain). The lysate is then centrifuged at 15,000
x g for 10 min at 4oC and the supernatant saved.
For immunoprecipitation of Ki4B-Ras, samples of lysate
supernatant containing equal amounts of protein are utilized. Protein
concentration is determined by the Bradford method utilizing bovine
serum albumin as a standard. The appropriate volume of lysate is
- 120 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
brought to 1 ml with lysis buffer lacking DTT and 8 ~g of the pan Ras
monoclonal antibody, Y13-259, added. The protein/antibody mixture is
incubated on ice at 4oC for 24 hours. The immune complex is collected on
pansorbin (Calbiochem) coated with rabbit antiserum to rat IgG (Cappel)
by tumbling at 4oC for 45 minutes. The pellet is washed 3
times with 1 ml of lysis buffer lacking DTT and protease inhibitors
and resuspended in 100 ~.1 elution buffer (10 mM Tris pH 7.4, 1% SDS).
The Ras is eluted from the beads by heating at 95°C for 5 minutes,
after
which the beads are pelleted by brief centrifugation (15,000 x g for 30 sec.
at room temperature).
The supernatant is added to 1 ml of Dilution Buffer
0.1% Triton X-100, 5 mM EDTA, 50 mM NaCI, 10 mM Tris pH
7.4) with 2 ~g Kirsten-ras specific monoclonal antibody, c-K-ras Ab-1
(Calbiochem). The second protein/antibody mixture is incubated on ice
at 4oC for 1-2 hours. The immune complex is collected on pansorbin
(Calbiochem) coated with rabbit antiserum to rat IgG (Cappel) by
tumbling at 4oC for 45 minutes. The pellet is washed 3 times with 1
ml of lysis buffer lacking DTT and protease inhibitors and resuspended in
Laemmli sample buffer. The Ras is eluted from the beads by heating at
95°C for 5 minutes, after which the beads are pelleted by brief
centrifugation. The supernatant is subjected to SDS-PAGE on a 12%
acrylamide gel (bis-acrylamide:acrylamide, 1:100), and the Ras visualized
by fluorography.
hDJ nrocessin~ inhibition assay
PSN-1 cells are seeded in 24-well assay plates. For
each compound to be tested, the cells are treated with a minimum
of seven concentrations in half log steps. The final solvent (DMSO)
concentration is 0.1%. A vehicle-only control is included on each
assay plate. The cells are treated for 24 hours at 37°C / 5% CO2.
The growth media is then aspirated and the samples are
washed with PBS. The cells are lysed with SDS-PAGE sample buffer
containing 5% 2-mercaptoethanol and heated to 95°C for 5 minutes. After
- 121 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
cooling on ice for 10 minutes, a mixture of nucleases is added to reduce
viscosity of the samples.
The plates are incubated on ice for another 10 minutes.
The samples are loaded onto pre-cast 8% acrylamide gels and
electrophoresed at 15 mA/gel for 3-4 hours. The samples are then
transferred from the gels to PVDF membranes by Western blotting.
The membranes are blocked for at least 1 hour in buffer
containing 2% nonfat dry milk. The membranes are then treated with
a monoclonal antibody to HDJ-2 (Neomarkers Cat. # MS-225), washed,
and treated with an alkaline phosphatase-conjugated secondary antibody.
The membranes are then treated with a fluorescent detection reagent and
scanned on a phosphorimager.
For each sample, the percent of total signal corresponding to
the unprenylated species of HDJ (the slower-migrating species) is
calculated by densitometry. Dose-response curves and IC50 values are
generated using 4-parameter curve fits in SigmaPlot software.
EXAMPLE 9
K4B-Ras processin,~ inhibition assay
PSN-1 (human pancreatic carcinoma) cells are used for
analysis of protein processing. Subconfluent cells in 150 mm dishes
are fed with 20 ml of media (R,PMI supplemented with 15% fetal bovine
serum) containing the desired concentration of test composition, prenyl
protein transferase inhibitor, HMG-CoA reductase inhibitor or solvent
alone. Cells treated with lovastatin (5-10 p.M), a compound that blocks Ras
processing in cells by inhibiting a rate-limiting step in the isoprenoid
biosynthetic pathway, serve as a positive control. Test compounds or
compositions are prepared as 1000x concentrated solutions in DMSO to
yield a final solvent concentration of 0.1%.
The cells are incubated at 37oC for 24 hours, the media is
then removed and the cells are washed twice with cold PBS. The cells are
scraped into 2 ml of cold PBS, collected by centrifugation (10,000
x g for 5 min at 4oC) and frozen at -?0 oC. Cells are lysed by thawing and
addition of lysis buffer (50 mM HEPES, pH 7.2, 50 mM NaCI, 1% CHAPS,
- 122 -
CA 02348703 2001-04-27
PCT/US99/24948
wo oor~s~88
0.7 glml aprotinin, 0.7 ~g~ml leupeptin 300 wg/ml pefabloc, and 0.3 mM
w
EDTA). The lysate is then centrifuged at 100,000 x g for 60 min at 4oC
and the supernatant saved. The supernatant may be subjected to SDS-
PAGE, HPLC analysis, andlor chemical cleavage techniques.
The lysate is applied to a HiTrap-SP (Pharmacia Biotech)
column in buffer A (50 mM HEPES pH 7.2) and resolved by gradient
in buffer A plus 1 M NaCl. Peak fractions containing Ki4B-Ras are
ooled, diluted with an equal volume of water and immunoprecipitated
P
with the pan Ras monoclonal antibody, Y13-259 linked to agarose. The
protein/antibody mixture is incubated at 4oC for 12 hours. The immune
com lex is washed 3 times with PBS , followed by 3 times with water. The
p
Ras is eluted from the beads by either high pH conditions (pH>10) or by
heating at 95°C for 5 minutes, after which the beads are pelleted by
brief
centrifugation. The supernatant may be subjected to SDS-PAGE, HPLC
analysis, and/or chemical cleavage techniques.
EXAMPLE 10
Rat~l processing inhibition assa
Protocol A:
Cells are labeled, incubated and lysed as described in
Example 9.
For immunoprecipitation of Rapl, samples of lysate
supernatant containing equal amounts of protein are utilized. Protein
concentration is determined by the bradford method utilizing bovine
serum albumin as a standard. The appropriate volume of lysate is
brought to 1 ml with lysis buffer lacking DTT and 2 ~g of the Rapl
antibody, RapllKrevl (121) (Santa Cruz Biotech), is added. The
protein/antibody mixture is incubated on ice at 4oC for 1 hour. The
immune complex is collected on pansorbin (Calbiochem) by tumbling
at 4oC for 45 minutes. The pellet is washed 3 times with 1 ml of lysis
buffer lacking DTT and protease inhibitors and resuspended in 100 ~1
elution buffer (10 mM Tris pH 7.4, 1% SDS). The Rapl is eluted from the
- 123 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
beads by heating at 95°C for 5 minutes, after which the beads are
pelleted
by brief centrifugation (15,000 x g for 30 sec. at room temperature).
The supernatant is added to 1 ml of Dilution Buffer (0.1%
Triton X-100, 5 mM EDTA, 50 mM NaCI, 10 mM Tris pH 7.4) with 2 ~g
Rapl antibody, Rapl/Krevl (121) (Santa Cruz Biotech). The second
protein/antibody mixture is incubated on ice at 4oC for 1-2 hours. The
immune complex is collected on pansorbin (Calbiochem) by tumbling
at 4oC for 45 minutes. The pellet is washed 3 times with 1 ml of lysis
buffer lacking DTT and protease inhibitors and resuspended in Laemmli
sample buffer. The Rap1 is eluted from the beads by heating at 95°C for
5
minutes, after which the beads are pelleted by brief centrifugation. The
supernatant is subjected to SDS-PAGE on a 12% acrylamide gel (bis-
acrylamide:acrylamide, 1:100), and the Rapl visualized by ffuorography.
Protocol B:
PSN-1 cells are passaged every 3-4 days in lOcm plates,
splitting near-confluent plates 1:20 and 1:40. The day before the assay
is set up, 5x 106 cells are plated on l5cm plates to ensure the same stage
of confluency in each assay. The media for these cells is RPM1 1640
(Gibco), with 15% fetal bovine serum and lx Pen/Strep antibiotic mix.
The day of the assay, cells are collected from the l5cm plates
by trypsinization and diluted to 400,000 cells/ml in media. 0.5m1 of these
diluted cells are added to each well of 24-well plates, for a final cell
number of 200,000 per well. The cells are then grown at 37 C overnight.
The compounds or compositions to be assayed are diluted
in DMSO in 1/2-log dilutions. The range of final concentrations to be
assayed is generally 0.1-100p.M. Four concentrations per compound is
typical. The compounds are diluted so that each concentration is 1000x
of the final concentration (i.e., for a 10~M data point, a lOmM stock of the
compound is needed).
2~.L of each 1000x compound stock is diluted into lml media
to produce a 2X stock of compound. A vehicle control solution (2uL DMSO
to lml media), is utilized. 0.5 ml of the 2X stocks of compound are added
to the cells.
- 124 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
After 24 hours, the media is aspirated from the assay plates.
Each well is rinsed with 1m1 PBS, and the PBS is aspirated. 180~L SDS-
PAGE sample buffer (Novex) containing 5% 2-mercapto-
ethanol is added to each well. The plates are heated to 100°C for 5
minutes using a heat block containing an adapter for assay plates.
The plates are placed on ice. After 10 minutes, 20~,L of an RNAse/
DNase mix is added per well. This mix is 1mg/ml DNaseI (Worthington
Enzymes), 0.25mg/ml Rnase A (Worthington Enzymes), 0.5M Tris-HCl
pH8.0 and 50mM MgCl2. The plate is left on ice for 10 minutes. Samples
are then either loaded on the gel, or stored at -70°C until use.
Each assay plate (usually 3 compounds, each in 4-point
titrations, plus controls) requires one 15-well 14% Novex gel. 251
of each sample is loaded onto the gel. The gel is run at lSmA for about 3.5
hours. It is important to run the gel far enough so that there will
be adequate separation between 2lkd (Rapl) and 29kd (Rab6).
The gels are then transferred to Novex pre-cut PVDF
membranes for 1.5 hours at 30V (constant voltage). Immediately after
transferring, the membranes are blocked overnight in 20m1 Western
blocking buffer (2% nonfat dry milk in Western wash buffer (PBS + 0.1%
Tween-20). If blocked over the weekend, 0.02% sodium azide is added.
The membranes are blocked at 4°C with slow rocking.
The blocking solution is discarded and 20m1 fresh blocking
solution containing the anti Rapla antibody (Santa Cruz Biochemical
SC1482) at 1:1000 (diluted in Western blocking buffer) and the anti
Rab6 antibody (Santa Cruz Biochemical SC310) at 1:5000 (diluted in
Western blocking buffer) are added. The membranes are incubated at
room temperature for 1 hour with mild rocking. The blocking solution is
then discarded and the membrane is washed 3 times with Western wash
buffer for 15 minutes per wash. 20m1 blocking solution containing 1:1000
(diluted in Western blocking buffer) each of two alkaline phosphatase
conjugated antibodies (Alkaline phosphatase conjugated Anti-goat IgG
and Alkaline phosphatase conjugated anti-rabbit IgG [Santa Cruz
Biochemical]) is then added. The membrane is incubated for one hour and
washed 3x as above.
- 125 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
About 2ml per gel of the Amersham ECF detection reagent is '
placed on an overhead transparency (ECF) and the PVDF membranes are
placed face-down onto the detection reagent. This is incubated for one
minute, then the membrane is placed onto a fresh transparency sheet.
The developed transparency sheet is scanned on a
phosphorimager and the Rapla Minimum Inhibitory Concentration is
determined from the lowest concentration of compound or composition
that produces a detectable Rapla Western signal. The Rapla antibody
used recognizes only unprenylated/unprocessed Rapla, so that the
pretence of a detectable Rapla Western signal is indicative of inhibition of
Rapla prenylation.
- 126 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
EXAMPLE 11
In vivo tumor growth inhibition assay (nude mouse)
In vivo efficacy as an inhibitor of the growth of cancer cells
may be confirmed by several protocols well known in the art. Examples of
such in vivo efficacy studies are described by N. E. Kohl et al. (Nature
Medicine, 1:792-797 (I995)) and N. E. Kohl et al. (Proc. Nat. Acad. Sci.
U.S.A., 91:9141-9145 (1994)).
Rodent fibroblasts transformed with oncogenically mutated
human Ha-ras or Ki-ras (106 cells/animal in 1 ml of DMEM salts)
are injected subcutaneously into the left flank of 8-12 week old female
nude mice (Harlan) on day 0. The mice in each oncogene group are
randomly assigned to a vehicle, compound or combination treatment
group. Animals are dosed subcutaneously starting on day 1 and daily for
the duration of the experiment. Alternatively, the test combination
composition or prenyl-protein transferase inhibitor may be administered
by a continuous infusion pump. Compound, compound combination or
vehicle is delivered in a total volume of 0.1 ml. Tumors are excised and
weighed when all of the vehicle-treated animals exhibited lesions of
0.5 - 1.0 cm in diameter, typically 11-15 days after the cells were injected.
The average weight of the tumors in each treatment group
for each cell line is calculated.
- 127 -
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
SEQUENCE LISTING
<110> Bergman, Jeffrey M.
<120> Inhibitors Of Prenyl-Protein Transferase
<130> 20289
<150> 60/101,177
<151> 1998-10-29
<160> 21
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 4
<212> PRT
<213> Homosapien
<400> 1
Cys Val Leu Ser
1
<210> 2
<211> 15
<212> PRT
<213> Homosapien
<400> 2
Gly Lys Lys Lys Lys Lys Lys Ser Lys Thr Lys Cys Val Ile Met
1 5 10 15
<210> 3
<211> 52
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 3
gagagggaat tcgggccctt cctgcatgct gctgctgctg ctgctgctgg gc 52
<210> 4
<211> 41
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
-1-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
<400> 4
gagagagctcgaggttaacccgggtgcgcg gcgtcggtgg t 41
<210> 5
<211> 42
<212> DNA
<213> ArtificialSequence
<220>
<223> completelysynthesized
<400> 5
gagagagtctagagttaacccgtggtcccc gcgttgcttc ct 42
<210> 6
<211> 43
<212> DNA
<213> ArtificialSequence
<220>
<223> completelysynthesized
<400> 6
gaagaggaag 43
cttggtaccg
ccactgggct
gtaggtggtg
get
<210> 7
<211> 27
<212> DNA
<213> ArtificialSequence
<220>
<223> completelysynthesized
<400> 7
ggcagagctc 27
gtttagtgaa
ccgtcag
<210> 8
<211> 27
<212> DNA
<213> ArtificialSequence
<220>
<223> completelysynthesized
<400> 8
gagagatctc 27
aaggacggtg
actgcag
<210> 9
<211> 86
<212> DNA
<213> ArtificialSequence
<220>
-2-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
<223> completely synthesized
<400> 9
tctcctcgag gccaccatgg ggagtagcaa gagcaagcct aaggacccca gccagcgccg 60
gatgacagaa tacaagcttg tggtgg 86
<210> 10
<211> 33
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 10
cacatctaga tcaggacagc acagacttgc agc 33
<210> 11
<211> 41
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 11
tctcctcgag gccaccatga cagaatacaa gcttgtggtg g 41
<210> 12
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 12
cactctagac tggtgtcaga gcagcacaca cttgcagc 38
<210> 13
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 13
gagagaattc gccaccatga cggaatataa gctggtgg 38
<210> 14
<211> 33
<212> DNA
<213> Artificial Sequence
-3-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
<220>
<223> completely synthesized
<400> 14
gagagtcgac gcgtcaggag agcacacact tgc 33
<210> 15
<211> 22
<212> DNA
<2I3> Artificial Sequence
<220>
<223> completely synthesized
<400> 15
ccgccggcct ggaggagtac ag 22
<210> 16
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 16
gagagaattc gccaccatga ctgagtacaa actggtgg 3g
<210> 17
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 17
gagagtcgac ttgttacatc accacacatg gc 32
<210> 18
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 18
gttggagcag ttggtgttgg g 21
<210> 19
<211> 38
-4-
CA 02348703 2001-04-27
WO 00/25788 PCT/US99/24948
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 19
gagaggtacc gccaccatga ctgaatataa acttgtgg 3g
<210> 20
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 20
ctctgtcgac gtatttacat aattacacac tttgtc 36
<210> 21
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> completely synthesized
<400> 21
gtagttggag ctgttggcgt aggc 24
-5-
