Note: Descriptions are shown in the official language in which they were submitted.
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
Array and method for anal~sint~ nucleic acid sequences.
The present invention relates to arrays -.For analysing nucleic acid sequences
and to methods for analysing nucleic acid sequences using such an array.
In particular, the invention relates to arrays and methods for determining
whether a specific nucleic acid sequence is present or absent in a nucleic
acid sequence
or mixture of nucleic acid sequences.
More in particular, the invention relates to an array and a method for
determining the presence or absence, in genom~ic DNA or a sample of
restriction
fragments derived from genomic DNA, of sequences corresponding to unique
restriction fragments that can serve as genetic marJkers, such as AFLP-
markers.
The invention further relates to a method for preparing such an array, in
particular in the form of a high density array for the detection of biological
molecules,
herein referred to as a "biochip".
A number of methods for analyzing nucleic acid sequences are known. In
general, these methods comprise immobilization of the sequences to be
analysed, for
instance by blotting; hybridization of the sequences with a labeled DNA- or
RNA-
probe; stringency washes to remove non-hybridized material; followed by
detection of
those sequences that have hybridized with the probe.
Such techniques are often corned out after prior amplification -such as by
PCR- of the starting nucleic acid sequences, usually a mixture of restriction
fragments
from a genomic DNA. The resulting mixture of annplified fragments is then
separated,
for instance on the basis of differences in length or molecular weight, such
as by gel-
electroforesis, and then visualised, i.e. by blotting followed by
hybridization. The
resulting pattern of bands is referred to as a DNA jEngerprint.
Usually in DNA fingerprinting, fmge;rprints of closely related species,
subspecies, varieties, cultivars, races or individuals are compared. Such
related
fingerprints can be identical or very similar, i.e. contain a Iarge number of
corresponding -and therefore Less informative- bands.
Differences between two related fingerprints are referred to as "DNA
polymorphisms". These are DNA fragments (i.e. bands) which are unique in or
for a
CA 02352476 2001-05-29
WO 00/34518 PC'1'IlVL99/00743
2
fingerprint and/or for a subset of fingerprints. The presence or absence of
such
polymorphic bands, or the pattern thereof, can lie used as a genetic marker,
i.e. to
identify a specif c species, subspecies, variety, cultivar, race or
individual, to establish
the presence or absence of a specific inheritable trait, of a gene, or to
determine the
state of a disease.
For a fiu~ther discussion and definitions of DNA-fingerprinting, DNA typing,
DNA polymorphisms, genotyping, PCR and similar techniques, reference is made
to
the discussion of the prior art in EP-0 534 858 A1, incorporated herein by
reference.
'The abovementioned hybridization-based techniques require at least some
prior knowledge of the sequence to be analysed, :i.e. sufficient to provide a
probe that
can hybridize with the desired sequence(s). Such a probe must also be
sufficiently
selective to afford informative results. For instance, when analysing a plant
genome, a
probe that hybridizes with the "repeated" sequen<;es within the genome will
generally
not provide any useful results, as such repeated sequences preclude typing
unique
polymorphisms.
A DNA-fingerprinting technique which requires no prior knowledge of the
sequence to be analysed is described in the European patent application 0 534
858 by
applicant, incorporated herein by reference. This technique, called selective
restriction
fragment amplification or AFLP, in general comprises the steps of:
(a) digesting a nucleic acid, in particular a DNA, with one or more specific
restriction endonucleases, to fragment sad DNA into a corresponding series
of restriction fragments;
(b) ligating the restriction fragments thus obtained with at least one double
stranded synthetic oligonucleotide adapter, one end of which is compatible
with one or both of the ends of the rest°iction fragments, to thereby
produce
tagged restriction fragments of the starting DNA;
(c) contacting said tagged restriction fragments under hybridizing conditions
with
at least one oligonucleotide primer;
(d) amplifying said tagged restriction fragrr~ent hybridized with said primers
by
PCR or a similar technique so as to cause further elongation of the hybridized
primers along the restriction fragments of the starting DNA to which said
CA 02352476 2001-05-29
WO 00/34518 PCTINL99100743
3
primers hybridized; and
(e) identifying or recovering the amplified or elongated DNA fragment thus
obtained.
The thus amplified DNA-fragments can then be analysed and/or visualised,
for instance by means of gel-electrophoresis, to provide a genetic fingerprint
showing
bands corresponding to those restriction fragments that have been linked to
the adapter,
recognized by the primer, and therefore amplified during the amplification
step.
The AFLP-fingerprint thus obtained provides information on the specific
restriction site pattern of the starting DNA. By comparing AFLP-fingerprints
from
related individuals, bands which are unique for each fingerprint can be
identified. These
polymorfisms are referred to as "AFLP-markers", and can again be used to
identify a
specific individual, cultivar, race, variety, subspecies or species, and/or to
establish the
presence or absence of a specific inherited trait, gene or disease state.
AFLP thus requires no prior knowledge of the DNA sequence to be analysed,
nor prior identification of suitable probes and/or tlhe construction of a gene
library from
the starting DNA.
For a further description of AFLP, its advantages, its embodiments, as well as
the techniques, enzymes, adapters, primers and. fiu~ther compounds and tools
used
therein, reference is made to EP-A-0 534 858 aJnd co-pending European
applications
98.202.5496 and 98.202.4515, all by applicant and incorporated herein by
reference.
Also, in the description hereinbelow, the definitions given in paragraph 5.1
of EP-0 534
858 will be used, unless indicated otherwise.
Although AFLP is generally less time-consuming than hybridisation-based
techniques, it still suffers from the disadvantage that the amplified
fragments have to be
2S separated (i.e. by gel-electrophoresis) and visualized (i.e. by generation
of a
fingerprint). These are very elaborate and time consuming procedures, which
require
special apparatus, such as electrophoresis and auto-radiography equipment.
Thereafter,
the fingerprints have to be analysed -nowadays generally performed by
"reading" the
fingerprint into a computer- to identify the pol;ymorphic bands. Generally,
this also
requires to use of a known reference sample run at the same time in a parallel
lane of
the gel.
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
4
Because of these factors, AFLP can only be carried out in sufficiently
equipped laboratories: Even so, it may take several days until results are
obtained, even
when routine tests following known protocols arcs carried out, such as on
species or
individuals of which the genome and/or relevant AFLP-markers are generally
known.
S A first aim of the invention is therefore to simplify these procedures, i.e.
to
provide a technique for analysing nucleic acid sequences which no longer
requires the
use of gel-electrophoresis and/or autoradiography.
This is achieved by providing a carrier-bound array of nucleic acid fragments,
which can be used to analyse a sample of nucleic acid(s), such as a mixture of
amplified restriction fragments of genomic DNA, by contacting the sample with
the
array under hybridizing conditions. This array-based detection can be used
instead of
gelectrophoresis/autoradiography, in particular for routine, high throughput
genotyping.
The invention further provides a method for preparing such an array. In
theory, this could be carried out by generating a sufficient number of
conventional
hybridization probes and binding them to a suitable carrier. This, however, is
not
practical for a number of reasons. For one, all i;hese probes must be
identified and
prepared beforehand, essentially one at a time. This would make it very time
consuming to prepare an array comprising a sufficiently large number of
different
probes; i.e. in the range of 1000-100.000 for the micro-array's disclosed
herein.
Also, these probes would have to be selective. if, for instance, all
restriction
fragments from a starting genomic DNA were to be used as probes on an array,
large
parts of the array would not be informative, as th.e sequences bound thereto
would be
too abundant in the nucleic acid sequences) to be: analysed. Also, the sheer
number of
fragments obtained by restricting a genornic DNA would make it too time-
consuming
to prepare or analyse (i.e. "read") such an array.
The invention also solves this problem, in that it allows -during the
preparation of nucleic acid sequences for use in tile array- to select only,
or essentially
only, those sequences that correspond to fragm.entsJbands of interest, i.e. to
select
genetic markers. The invention also allows - simultaneously - the
identification and
preparation of a large number of such informative fragments, and to
selectively prepare
and purify these fragments in amounts sufficient for binding to the earner.
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
According to the invention, this is carried aut by analysing the genomic DNA
of two or more related individuals using AFLP, identifying polymorphisms
("AFLP-
markers") within the genome, amplifying and isolating the nucleic acid
sequences
corresponding to these AFLP-markers, and binding the amplified sequences to
specific
5 areas of a carrier, thus providing an array comsprising essentially only
nucleic acid
sequences that correspond to AFLP-markers.
This array can then be used to analyse a. sample of nucleic acid(s) -such as a
genomic DNA or restriction fragments thereof derived from the same or a
genetically
related individual, by contacting the sample with the array under hybridizing
conditions. The nucleic acid sequences) to be ans~lysed will then (only)
hybridize with
those parts of the array that carry an essentially homologous sequence, i.e.
the same
AFLP-marker, or at least a sequence with a high .degree of homology with the
marker.
Thus, by analysing to which parts of the array (i.e. to which AFLP-markers)
the nucleic
acid sequences) to be analysed has or have hybri~~ized, the presence of
absence of said
marker in the sample can be established.
In other words, the invention makes it possible to test a sample of nucleic
acids) directly for the presence of a Iarge number of polymorphic fragments or
bands -
i.e. as many as are bound to the carrier- without the need of generating and
analysing a
DNA-fingerprint.
The invention also makes it possible to test simultaneously for a large number
of "unrelated" markers (i.e. markers which can normally not be detected in a
single
AFLP-reaction or fingerprint} by incorporating 'these different markers into a
single
array.
Other objects and advantages of the irmention will become clear from the
description hereinbelow.
H. Himmelbauer et al., Mammalian Genome 9, 611-616 (1998) describe a
method for the identification and mapping .of polymorphic markers, using "a
mod f catio~ of the AFLP technique" called the "IRS PCR system". According to
this
method, genomic (mouse) DNA is restricted using a single restriction enzyme
(Sacl or
BamHn, amplified in a PCR using adapters and primers, after which the
arnplicons
thus obtained are hybridized with a gridded genomic library (BAC-clones) to
identify
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
6
strain-specific differences. Positive clones can then be used to generate
genotyping
information, i.e. by hybridizing fragment mixtures derived from individuals of
a
backcross population against the positive clones, or by amplifying individual
clones for
hybridization against the complex fragment mixtures derived from individuals
pf a
backcross population.
In the invention, compared to the method of Himmelbauer, the markers are
generated by restricting with tvvo restriction enzymes, i.e. a rare and a
frequent cutter.
Also, the invention does not require the prep~~ration of a BAC-library, nor of
a
subsequent hybridization against a backcross.
Also, Himmelbauer et al. do not suggest: to use the IRS-PCR- derived clones
in an array. The array used by Himmelbauer, <~ high density spotted filter
grid of
genomic BAC-clones, is prepared using conventional complex probe
hybridization.
Also, this array is not (and cannot be) used to acan a DNA sample directly for
the
presence of markers. Instead, this grid is used in the identification of
markers (i.e. by
fiuther hybridisation with a backcross), which markers are then used for
genome
mapping.
The art also describes oligonucleotide arrays, vide for instance WO 97127317,
WO 97/22720, WO 97/43450; EP 0 799 897, EP 0 785 280, WO 97/31256, WO
97/27317 and WO 98/08083.
Such arrays, which include the Genechips~ array, the Affyrnetrix DNA chip
and the VLSIPS~ array, can have nucleotide densities of more than 100-10.000
per
cm2 or more and are generally prepared by "buil.ding up" the oligonucleotides
on the
solid support using sequential solid phase nucleic acid synthesis techniques.
However,
as this is difficult and time-consuming, even when using automated equipment,
there is
a practical limit to the size of the oligonucleotides on the array, i.e. of
about 100
nucleotides, usually about 10-50 nucleotides, usually without variation in
size. The use
of such small oligonucleotides can lead to a relatively large occurrence of
mismatch
events, which reduces selectivity and increases thc; background noise.
Because of this, these known arrays generally require several of the attached
oligonucleotides to detect a target sequence. Also, they do not directly
provide data on
the presence of specific markers, but require sub:>tantive analysis of the
signal pattern,
CA 02352476 2001-05-29
WO 00134518 PC'~'/NL99/00743
7
usually by comparison to known results or a reference using sophisticated
computer
algorithms.
In a first aspect, the present invention relates to an array for analysing a
nucleic acid sequence or a mixture of nucleic acid. sequences, comprising:
a) a carrier; and
b) at least two different nucleic acid sequences bound to said earner, in
which
each of the nucleic acid sequences bound to the carrier comprises at least a
nucleic acid sequence that corresponds to the sequence of a restriction
fragment obtainable by restricting a gen,omic DNA with at least one frequent
cutter restriction enzyme and at least one; rare cutter restriction enzyme.
More particular, the invention relates to~ such an array in which at least
50%,
preferably at least 70%, more preferably at iea<.~t 90% of the nucleic acid
sequences
bound to the carrier comprise the sequence of a restriction fragment that
corresponds to
an AFLP-marker.
In a further aspect the invention relates to a method for providing an array
of
nucleic acid sequences bound to a carrier, comprising the steps of
a) identifying an AFLP-marker;
b) providing a nucleic acid sequence treat comprises a restriction fragment
sequence corresponding to said AFLP-marker;
c) attaching the nucleic acid sequence to the carrier; and
d) repeating steps a) to c) for different AFI,P markers to build up an array.
More particularly, the invention relates to such a method comprising the steps
of:
a) identifying a polymorphic band in an Al~ LP-fingerprint;
b) isolating a nucleic acid sequence from said polymorphic band;
c) optionally further amplifying, purifying and/or modifying the nucleic acid
sequence; and
d) attaching the nucleic acid sequence to tree carrier.
e) repeating steps a) to d) for different polytnorphic bands to build up an
array.
In a yet ,another aspcect; the starting :DNA used to generate the restriction
fragments that are bound to the carrier are not derived from genomic DNA, but
from at
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
8
Ieast one cDNA. Generally, an array according to this aspect of the invention
comprises:
a) a carrier; and
b) at least two different nucleic acid sequences bound to said carrier; in
which
S each of the nucleic acid sequences bound to the carrier comprises at least a
nucleic acid sequence that correspondls to the sequence of a restriction
fragment obtainable by restricting at least one cDNA with at least one
frequent
cutter restriction enzyme and at least one rare cutter restriction enzyme.
A method of the invention for preparing such a cDNA-based array generally
comprises the steps of:
a) providing a nucleic acid sequence that comprises at least one restriction
fragment that has been derived from at Ie:ast one cDNA.
b) attaching the nucleic acid sequence to thf; carrier; and
c) repeating steps a) and b) for different cDNA-derived restriction fragments
to
build up an array.
More particularly, the invention relates t~o such a method comprising the
steps
of
a) analysing at least one cDNA using AFLP-methodology to provide a cDNA
AFLP-fingerprint, said fingerprint corruprising at least one, and usually a
plurality, of bands;
b) isalating from at least one of said bands <~.t Ieast one nucleic acid
sequence;
c) optionally further amplifying, purifyin~; and/or modifying the nucleic acid
sequence; and
d) attaching the nucleic acid sequence to the Garner.
e) repeating steps a) to d) for different bands and/or for different cDNAs to
build
up an array.
In yet another aspect, the invention relates to method for analysing a nucleic
acid (sequence) or a mixture of nucleic acids (nucleic acid sequences),
comprising
contacting said nucleic acid or mixture with an an°ay as described
herein.
Other aspects and embodiments of the :invention will become clear from the
description and experimental part hereinbelow.
CA 02352476 2001-05-29
WO 00/34518 PCTINL99/00743
9
In the description, the nucleic acid sequences bound to the carrier will be
indicated as "Array-bound Nucleic Acid Sequehce(s)" or "ANAS", and the
restriction
fragments present therein will be indicated as "restriction Fragment
Sequence(s)" or
"RFS". Usually, each Array-bound Nucleic Acicl Sequences will comprise {only)
one
S Restriction Fragment Sequence, and optionally further nucleic acid sequences
or
structural elements as described below, bound to the Restriction Fragment
Sequence.
When Array-bound Nucleic Acid Sequences are :referred to hereinbelow as
"different",
it means that these Array-bound Nucleic Acid Sequences contain different
Restriction
Fragment Sequences.
The array preferably comprises at least 10, more specifically at least 100,
more
preferably at least 1000 different Array-bound Nucleic Acid Sequences. For a
"high-
density array" or "micro-array", the total number of Array-bound Nucleic Acid
Sequences will be in the region of 100 - i 00.000.
These Array-bound Nucleic Acid Sequences will generally be bound to the
carrier in such a way that each Array-bound Nucleic Acid Sequence is attached
to, and
corresponds with, a specific, distinct part of the carrier, so as to form an
independently
detectable area on the carrier, such as a spot or band. This makes it possible
to "read"
the array by scanning (i.e. visually or otherwise) the areas to which the
Array-bound
Nucleic Acid Sequence (i.e. the marker) of interest is attached.
Preferably, the Array-bound Nucleic Acrid Sequences are bound to the earner
in accordance with a predetermined, regularly di:~tributed pattern, in which
for instance
related Array-bound Nucleic Acid Sequence (ii.e. related markers) can be
grouped
together, i.e. in one or more lines, columns, rows., squares, rectangles, etc,
preferably in
an "adressable" form. This further facilitates analysis of the array.
The density of the different Array-bound Nucleic Acid Sequences will
generally be in the region of 1-100,000 different markerslcm2, usually 5-
50,000
markers/cm2, generally between 10-10,000 markers/cm2.
In general, each of the Array-bound Nucleic Acid Sequences on the array will
correspond to a specific polymorphic band or marker, i.e. as derived from an
AFLP-
fingerprint of genomic DNA of a specific individual. Usually, the array will
comprise
sets of one or more of such markers taken from a single fingerprint, or at
least taken
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
from fingerprints of a single individual.
Often, the array will be build up of one or more of such individual sets, each
taken from an AFLP-fingerprint of a different but related individual. By
"related
individuals" is meant herein that these individuals are such that useful or
desired
5 information can be obtained by comparing their DNA-fingerprints, more
specifically
their AFLP-fingerprints. Usually, this means that 'these individuals share or
have related
inherited properties or traits (including genetic. markers) and/or have
nucleic acid
sequences in their genome (such as genes) whiclh are the same or related. In
practice,
related individuals will usually stem from the same family, genus, species,
subspecies,
10 variety, cultivar or race, depending upon the purpose of the comparison.
In the array's of the invention, the markers taken from one individual, and
the
sets of markers taken from related individuals, will usually be arranged on
the array in a
predetermined, regular pattern.
Usually, the markers will be derived from a limited number of related
individuals, which have been selected in such <~, way that they represent the
genetic
diversity within the group of interest (i.e. family, genus, species,
subspecies, cultivar,
race or variety) in the best possible way. This sf;lected set of individuals
is called the
"genotyping collection".
Preferably the array will contain a maj ority or even all the markers from a
genotyping collection that are characteristic for the presence or absence of
the one or
more traits or properties of interest. For instance, an array rnay contain all
or most
markers characteristic for the dominant, the recessive and any or all allelic
forms of one
or more genes or traits of interest, as may be present within different
individuals from
the same family, genus or species.
An array of the invention can {also) contain sets of markers that correspond
to
different (i.e. genetically unrelated) traits or propf:rties, and such an
array can be used to
analyse an individual (genome) for the presence of absence of all these
properties
simultaneously. However, such unrelated markers will usually still have 'been
obtained
from within one genotyping collection, i.e. fro:m individuals belonging to the
same
family, genus or preferably species, i.e. so as to provide -for instance- a
"maize-array",
a "tomato-array", a "wheat-array" etc..
CA 02352476 2001-05-29
WO 00134518 PCT/NL99l00743
11
In one embodiment, the AFLP-markers ;present on the array have been taken
from or will be representative of different subspecies, varieties, cultivars,
lines or races
of the same species.
An array of the invention can also contain markers representative of a certain
genetic state of an individual, such as the presence or absence of a disease
state, i.e. of
oncagenes and of genetically determined diseases.
As already mentioned above, besides arrays based on restriction fragments
derived from genomic DNA - e.g. based on polymorphic fragments/genetic markers
-
the invention also provides arrays based on (restriction fragments derived
from) cDNA.
According to this aspect of the invention, the RFS present in the ANAS will
be a restriction fragment obtained by restricting at least one cDNA with at
least one
restriction enzyme, and preferably with at least one frequent cutter
restriction enzyme
and at least one rare cutter restriction enzyme as described herein.
Usually, prior to attachment to the array, the cDNA-derived restriction
fragments thus obtained are amplified, preferably using AFLP. Such AFLP-
amplification of cDNA is generally referred to ass "cDNA-AFLP" and can be
carried
out essentially as described above for the AFLP-aunplification of genomic DNA
and/or
by using any cDNA-AFLP protocol known per se, to provide a cDNA-derived AFLP-
fingerprint.
One or more of the bands from this c:DNA-AFLP fingerprint may then be
isolated from the gel and bound to the array, e.g. after re-amplification
and/or
incorporation into an ANAS, essentially as descrilbed for the genomic DNA.
This may be carried out for different bands obtained from the same cDNA,
and/or for bands from one or more different cDl'JAs. Also, the one or cDNAs
used to
provide the RFS may be obtained from (mRNA.s derived from) one individual (
e.g.
from different cells, parts, tissues or organs) ancfor from two or more
individuals, e.g.
individuals belonging to same race, variety, species, genus, family etc..,
with the same
or different phenotypical characteristics. Also, the cDNAs may be obtained
from
(mRNA derived from) healthy individuals andlor from diseased individuals;
and/or
from individuals at different stages of development.
Furthermore, although the genomic DNA based arrays and the cDNA based
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
12
arrays are discussed separately hereinabove, it wi:Ll be clear to the skilled
person that an
array of the invention may also contain both one or more restriction fragments
derived
from genomic DNA as well as one or more restriction fragments derived from
cDNA.
Although preferably, each Array-bound Nucleic Acid Sequence on the array
will correspond to a polymozphic band of interest ( i.e. a marker) or an
informative
cDNA-derived band, the presence on the array of some non or less informative
Array-
bound Nucleic Acid Sequences (for instance corresponding to non-polymorphic
bands
or to markers that are too abundant to provide useful information) is not
excluded.
However, these will preferably constitute less than 50%, preferably less than
30%,
more preferably less than 10% of all Array-bound Nucleic Acid Sequences
present on
the array. It is also included that some or most of the Array-bound Nucleic
Acid
Sequences may be informative for one specific application or genome, but not
for
another. However, preferably 95-100% of alI Array-bound Nucleic Acid Sequences
will correspond to or contain an AFLP-marker.
The manner in which the Array-bom:~d Nucleic Acid Sequences and the
Restriction Fragment Sequences are obtained is further described in the
Experimental
Part below.
In general, the Restriction Fragment Sequences axe characterized in that they
are obtainableiobtained by cutting a starting DNA, usually a genomic DNA or
cDNA,
with at least one "frequent cutter" restriction enzyme and at least one "rare
cutter"
restriction enzyme. These fragments are then bound to adapters and amplified
using
(usually selective) primers. The thus amplified fragments are visualized in a
DNA-
fmgerprint, and polymorphic bands are identified, i.e. by comparison with the
fmgerprint(s) of one or more related individuals or to a database. The
restriction
fragments present in these polyrnorphic bands are then individually isolated
(by cutting
them out from the gel) and optionally further :purified and/or amplified,
after which
they are attached to a specific, distinct area of the carrier, optionally
after modification
of carrier surface andlor of the fragment to allow or promote such attachment.
Therefore, generally speaking, the invention uses AFLP-methodology both to
select and to prepare (i.e. to amplify and to isolate) the nucleic acid
sequences to be
attached to the array, and to do so simultaneously. The use of AFLP in the
invention
CA 02352476 2001-05-29
WO 00/34518 PCTlNL99/00743
13
also makes it possible to identify and prepare, at the same time, markers from
related
individuals (i.e. from one genotyping collectiion) i.e. by running parallel
AFLP-
reactions and visualizing these reactions in adjacent lanes of the same gel.
In this way, a
micro-array containing a large number of m~~rkers and/or containing all
relevant
markers from a genotyping collection can be build up very efficiently.
As in AFLP, two different restriction enzymes are used to digest the starting
(genomic) DNA, i.e. the "frequent cutter", which serves the purpose of
reducing the
size of the restriction fragments to a range of sizes which are amplified
efficiently, and
the "rare cutter'° which serves the purpose of targeting rare
sequences. For both,
reference is made to EP-A-0 534 858 and EP-A: 0 721 987 by applicant,
incorporated
herein by reference.
Examples of suitable frequent cutter en;_rymes are Msel and Taql. Examples of
commercially available rare cutters are PstI, HpaII, MspI, CIaI, HhaI, EcoRII,
BstBI,
HinPl, MaeII, BbvI, PvuII, XmaI, SmaI, NciI, .AvaI, HaeII, San, Xhol and
PvuII, of
which PstI, HpaII, MspI, CIaI, EcoRiI, BstBI, Hi~nP 1 and MaeII are preferred.
The AFLP-reaction will usually be carried out following known protocols, for
which reference is made to EP-A-0 534 858, incorporated herein by reference.
The Restriction Fragment Sequence {v~rith the AFLP-adapters) will generally
have a size that can be detected as an individual lband in an AFLP-
fingerprint, i.e. in the
range of 50 - 1200 base pairs. It will be clc;ar that, as the Restriction
Fragment
Sequence are separated by gel-electrophoresis, they will be of different
sizes.
Also, it may be possible to use as the Restriction Fragment Sequence only a
part of a restriction fragment obtained aslfrom a. band in the AFLP
fingerprint. Such a
partial sequence may for instance be obtained by (further) restricting the
restriction
fragments) isolated from the AFLP gel with one or more restriction enzymes,
i.e.
usually with other restriction enzymes than the one or two orginally used to
generate
the restriction fragments from the starting genomic or cDNA, including but not
limited
to synthesized oligonucleotides based and/or dlerived thereof. For this
purpose, any
desired and/or pre-determined restriction enzyme; or enzyme combinatian may be
used;
suitable restriction enzymes include, but are not limited to, the frequent
cutters and rare
cutters mentioned above, IIS-type restriction enzymes.
CA 02352476 2001-05-29
WO 00/34518 PC'1'/NL99l00743
14
in general, such a partial sequence generated by (further) restricting the
restriction fragments obtained from the AFLP gel may have any suitable size,
up to the
size of the original restriction fragment (i.e. when no recognition site for
the restriction
enzyme used is present in the restriction fragment). Usually, however, these
partial
sequences will be smaller than the restriction fra~~nents, i.e. the range of
10 -100 base
pairs.
The use of such smaller, but still specific, partial sequences may have some
advantages, such as avoiding cross-hybridi2;ation between sequences showing
homologous regions. Also, for the purposes o~f the description herein, such
partial
sequences should be considered as encompassed within the term "Restriction
Fragment
Sequence" as used herein.
Preferably, the Array-bound Nucleic Acid Sequence comprises single-
stranded DNA; although the use of double-stranded DNA as Array-bound Nucleic
Acid
Sequences is also within the scope of the invention.
The Array-bound Nucleic Acid Sequence will at least comprise one (and
usually only one} Restriction Fragment Sequence, and can further contain other
sequences or structural elements, often at the ends) of the Restriction
Fragment
Sequence-sequence. These include AFLP-adapter sequences (one or two) andlor
other
nucleic acid sequences, as well as groups or functionalities that can be used
for
attaching the Array-bound Nucleic Acid Sequen<;e to the array (hereinbelow
referred to
as "binding elements").
The adapter sequences will usually be present at the ends) of the Array-bound
Nucleic Acid Sequence, and may be the adapters used in the AFLP-reaction with
which
the original genomic DNA as amplif ed, andlor used to amplify the sample to be
analysed. However, they preferably contain (adapter) sequences different
thereto, for
the reasons given in the Experimental Part below.
The adapters may also have been modified to contain groups or functionalities
that can be used for attaching the Array-bound Nucleic Acid Sequence to the
array, so
as to make the adapter into a binding element.
The binding elements may be present at: the ends) of the Restriction Fragment
Sequences (i.e. replacing the adapters) but may also be present in or on the
Restriction
CA 02352476 2001-05-29
WO 00/34518 PCTI1~IL99/00743
Fragment Sequence iitself, depending upon the technique used for binding the
Array-
bound Nucleic Acid Sequence to the array, as further described below.
The carrier for the array may be any solid material to which nucleic acid
sequences can be attached, including porous, fibrous, woven and non-woven
materials,
5 as well as composite materials. Also, semi-solid materials such as gels or
matrices (for
instance as used in chromatography) may be used., although this is not
preferred.
Suitable carriers include, but are not limited to, those made of plastics,
resins,
polysaccharides, silica or silica-based materials, functionalized glass,
modified silicon,
carbon, metals, inorganic glasses, membranes, nylon, natural fibers such as
silk, wool
10 and cotton, and poYymer materials such as polystyrene, polyethylene glycol
tetra-
phthalate, polyvinyl acetate, polyvinyl chloride, polyvinyl pyrrolidone,
polyacrylo-
nitrile, polymethyl methacrylate, polytetrafluoroethylene, butyl rubber,
styrenebuta-
diene rubber, natural rubber, polyethylene, poliypropylene,
(poly)tetrafluoroethylene,
(poly)vinylidenefluoride, polycarbonate and polymethylpentene. Further
suitable
15 support materials are mentioned fox instance mentioned in US-A-5,427,779,
WO
97/22720, WO 97/43450, WO 97/31256, WO 97/27317 and EP 0 799 897.
Preferred carnet materials are glass and silicon.
Preferably, the carrier will have an essentially flat, rectangular shape, with
the
Array-bound Nucleic Acid Sequences bound to one surface thereof. 1-Iowever,
any
other suitable two- or three-dimensional form may also be used, such as a
disc, a sphere
or beads, or materials or structures that allow a liiquid medium containing
the sample to
be analysed to pass or flow through the carrier, such as columns, tubes or
capiliairies,
as well as (macro)porous-, web- or membrane-type structures, including the
flow-
through genosensor devices referred to in WO 97/22720.
The size of the array, as well as of the individual areas corresponding to
each
of the different Array-bound Nucleic Acid Sequences, may vary, depending upon
the
total amount of Array-hound Nucleic Acid Sequence, as well as the intended
method
for analysing the array.
For an array that is to be inspected visually, the total array and the
separate
areas thereon will be of such a size that they can be seen and distinguished
with the
naked eye or through a microscope, i.e. in the range of 1 to 500 cm2 for the
total array,
CA 02352476 2001-05-29
WO 00/34518 PCT/NI,99/00743
I6
and 0.01 to 0,1 cm2 for the individual areas.
Arrays that are analysed using other types of (usually automated} scannitng
equipment may be of smaller size, and are preferably in the form of high-
density or
micro-arrays, i.e. in the range of 1 - IO cm2 for th.e total array, 0.001 -
0.1 cm2 for the
S individual areas. This allows hybridization to be carried out in a small
volume on a
small sample, or even the use of flow-through tec)~miques.
The Array-bound Nucleic Acid Sequences may be bound to the carrier in any
manner known per se, and the specific technique used will mainly depend upon
the
carrier used. Binding may be at the 3'-end, at the S'-end, or somewhere else
on the
Restriction Fragment Sequence/Array-bound Nucleic Acid Sequence, as
appropriate.
Preferably, the Array-bound Nucleic Acid Sequence will be covalently bonded
to the array; i.e. by a suitable chemical technique. As mentioned above, for
this
purpose, the Array-bound Nucleic Acid Sequence andlor the carrier may be
modified to
carry one or more binding groups or elements. For instance, the surface of the
carrier
I S may be activated to carry one or more groups such as carboxy, amino;
hydroxy, etc..
Suitable methods for attaching the Array-bound Nucleic Acid Sequences to
the carrier will be clear to the skilled person. In general, any method for
attaching a
nucleic acid to a solid support can be used, including the methods described
in US-A-
5,427,779; US-A-4,973,493; US-A-4,979,959; US-A-5,002,5$2; US-A-5,217,492; US-
A-S,S2S,041; US-A-5,263,992; WO 97/46313 and WO 97122720, as well as the
references cited therein.
As an example of covalent attachment, coupling can proceed using
photoreactive groups such as N-oxy-succinimide, in which either the Array-
bound
Nucleic Acid Sequence is derivatized with a photoreactive group and attached
to the
2S surface, or the surface is first treated with a photoreactive group,
followed by applica-
tion of the Array-bound Nucleic Acid Sequence, for instance in N-terminal
amino-
modified form. A suitable protocol, following the general method described in
Amos et
al., Surface Modification of Polymers by Photochemical Immobilization, The
17th
Annual Meeting of the Society of Biomaterials, May 1991, Scottsdale AZ, given
in
WO 97/46313, incorporated herein by reference.
Other covalent binding techniques involve the use of 3'-aminopropanol-groups
CA 02352476 2001-05-29
WO 00/34518 PC'~'/NL99/00743
17
or epoxysilane-amine chemistry, for instance as described in WO 97/22720, also
incorporated herein by reference.
An example of a strong, but non-cov~~lent binding technique involves the
attachment of a biotinylated Array-bound Nucleic; Acid Sequence onto a carrier
coated
with streptavidin.
In order to create small, distinct, adressable areas of each of the Array-
bound
Nucleic Acid Sequence on the array, masking techniques or known
xnicrodispensing
techniques may be used, for instance as described in WO 97/46313 and W~
97122720.
After attachment of the Array-bound Nucleic Acid Sequences to the carrier,
the array will generally be ready for use.
In a further aspect, the invention relates to a method for analysing a nucleic
acid sample using the array of the invention. In general, this method
comprises
contacting the sample to be analysed with the array under hybridizing
conditions, so
that the one or more of the nucleic acid sequencE:(s) present in the sample
may bind to
the one or more of the Array-bound Nucleic Acid Sequences on the array, more
specifically with the Restriction Fragment Sequences present in the Array-
bound
Nucleic Acid Sequence. This method is described in more detail in the
Experimental
Part below.
Usually, a nucleic acid sequence or mixture will be analysed that is suspected
to comprise at least one sequence or fragment that corresponds to a
Restriction
Fragment Sequence ~i.e. an AFLP-marker) presc;nt on the array used. In this
context,
"corresponds" means a sequence homology of at least 70%, more preferably at
least
85%, specifically 95%-100%.
In general, the method of the invention is based on the hybridisation of
sequences in the sample to be analysed with floe Restriction Fragment
Sequence. In
other words, in the invention, the target sample is probed directly with the
pre-selected
sequences/markers of interest, so that a positive hybridization event or
signal is directly
indicative of the presence of said marker in the target sample. Also, as these
markers
are unique sequences with low abundance in the target genome, generally a high
selectivity can be obtained,
Also, in a highly preferred embodiment. of the invention, in analysing a
target
CA 02352476 2001-05-29
WO 00134518 PCTINL99/00743
18
genome, said genomic DNA is subjected to "AFL:P" prior to hybridisation to the
array,
in which by "AFLP" in this context is more generally meant that the starting
DNA is
cut using at least one restriction enzyme and then ~unplified using adapters
and primers,
of which at least one contains at least one selective base at the 3'-end. This
leads to a
S further reduction of sample complexity, giving less background noise:
Even more preferably, in the AFLP amplification prior to hybridization, the
same frequent cutter and rare cutter are used as were used in generating (at
least some
o~ the Restriction Fragment Sequence, and most preferably a similar protocol
is
followed, using the same (selective) primers. In this way, the amplified
sample will
contain, and essentially only contain, fragments that exactly correspond to
the
Restriction Fragment Sequence on the array (i.e. besides further non-
polymorphic
fragments that are not expected to hybridize ~avith (the RFS on) the array).
This
improves specificity and reliability even further.
Suitable hybridisation conditions (i.e. buffers used, salt strength,
temperature,
1 S duration) can be selected by the skilled person, on the basis of
experience or optionally
after some preliminary experiments. These conditions may vary, depending on
factors
such the Array-bound Nucleic Acid Sequences present on the array (size of the
Restriction Fragment Sequence, CG-content etc.), and the sample to be
analysed.
Suitable hybridisation conditions are for instance described in Sambrook et
al.,
Molecular Cloning: A Laboratory mahual, (1989) 2nd. Ed. Cold Spring Harbour,
N.Y.;
Berger and Kimmel, "Guide to Molecular Cloning Techniques", Methods in
Enzymolo~", (1987), Volume 152, Academic Press Inc., San Diego, CA; Young and
Davis (1983) Proc. Natl. Acad. Sci. (USA) 80: 1194; Laboratory Techniques in
Biochemistry and Molecular Biology, Vo1.24, Hybridization with Nucleic Acid
Probes,
P. Thijssen, ed., Elsevier, N.Y: (1993), as well as WO 97/43450. EP-A-0 799
897, WO
97/27317, WO 92/10092, WO 95/1195, WO 97/22720 and US-A-5,424,186, all
incorporated herein by reference.
Suitable hybridisation conditions comprise temperatures between 25-
70°C,
preferably 35-65°C, a duration of between 1 minute and 30 hours,
preferably about 30
minutes to 2 hours, and using known hybridization buffers, such as salt-, Tris-
or
citrate- contaning buffers, etc., and may for example vary from 6X SSPE-T at
about
CA 02352476 2001-05-29
WO 00!34518 PCT/NL99/00743
19
40°C to 1X SSPE-T at 37°C down to as low as 0.2,SX SSPE-T at 37-
50°C.
The hybridisation conditions are preferably chosen such that only those
nucleic acid sequences in the target sample that have more than 70%,
preferably more
than 80%, more preferably more than 90% homology, and in particular 95-100%
S homology with the Restriction Fragment Sequences, will hybridize with the
Array-
bound Nucleic Acid Sequence. These will generally be "moderate" or preferably
"stringent" hybridisation conditions. Such stringent conditions can be as
described in
EP 0 799 897.
After hybridization, the array is washed to remove unwanted compounds, in
particular any nucleic acid sequences not hybridized with the Array-bound
Nucleic
Acid Sequences on the array. Thereafter, the array is analysed to determine to
which
areas on the array (i.e. to which Array-bound Nucleic Acid
Sequences/Restriction
Fragment Sequences) the nucleic acid sequE,nce(s) from the sample hasll~ave
hybridized. These area's will generally be detected as a positive signal
indicating the
presence of the marker in the sample.
The analysis of the array may be carric;d out in any manner known per se,
including optical techniques, spectroscopy, chemical techniques, biochemical
techniques, fotochemical techniques, electrical techniques, light scattering
techniques,
colorimetric techniques, radiography techniques, etc., as Long as they can
indicate the
presence of a hybridization event. Suitable techniques are for instance
described in WO
97/27317, WO 97/22720, WO 97143450, EP 0 7!~9 897, WO 97/31256, WO 97/27317
and WO 98/08083.
Usually, a technique using detectable labels will be used. Such a label will
generally be attached to the nucleic acid sequence{s) to be analysed, so that -
after
hybridization with the array- those areas of the array which show the presence
of the
label correspond to a positive hybridization event.
Suitable labels are for instance described in WO 97/27317, WO 97/22720,
WO 97/43450, EP 0 799 897, WO 97131256, WO 97/27317 and WO 98/08083 and
include fluorescent labels, phosphorescent labels, chemoluminescent labels,
bioluminescent labels, chemical labels, biochemical labels such as enzyncies,
biological
labels such as biotin/streptavidin, radioisotopes, spin or resonance labels,
metal colloids
CA 02352476 2001-05-29
WO 00/34518 PCT/1~IL99/00743
such as gold, magnetic beads, chromogens, dyes, and similar labels.
These labels may be incorporated irnto the target nucleic acids during
amplification, for instance by using labelled primers or nucleotides. .Also,
primers or
nucleotides carrying binding groups to which a label subsequently may be
attached can
5 be used in the amplification reaction.
Alternatively, the target nucleic acids many be end-labelled after
amplification,
for instance as described in WO 97/27317. Furthermore, so-called "indirect"
labels may
be used, which are joined to the target sequence/Array-bound Nucleic Acid
Sequence-
duplex after hybridisation, again as for instance described in WO 97127317.
10 Detection and optionally recording of positive signals on the array is
carried
out in a manner known per se, usually depending on whether a label is used,
and if so,
the type thereof. For instance, the array may be; inspected visually or by
(confocal)
microscopy; by spectroscopy; using photographic; film, electronic detectors or
a CCD
camera; by colorimetric or (bio)chemical assay; or by any other suitable
method, for
15 which again reference is made to WO 97127317, WO 97/22720, WO 97/43450, EP
0
799 897, WO 97/31256, WO 97/27317 and 'i~JO 98/08083. Automated scanning
equipment based upon such techniques may also be used.
Optionally, the relative intensity or absolute magnitude of a positive
hybridisation signal for a binding site on the array may be used as a relative
indication
20 ar an absolute measure of the amount of the corresponding fragment present
in the
original sample, for instance as described in WO 98/08083.
The analysis of the hybridization (pattern) to the array may as such provide
useful results, i.e. show the presence or absence ~of a genetic marker or
genetic trait of
interest, identify an individual, or otherwise provide information on the
individual
analysed, such as to which strain, variety, cultivar or race it belongs. It
may also directly
indicate the presence or absence of a disease state.
Optionally, the data obtained from "reading" the array may also be processed
further, i.e. by comparing it to references, to earlier results or to a
database, optionally
using computer algorithms.
Advantageously, the array of the invention can be used to replace conventional
fingerprinting/autoradiography analysis in AFLP. This aspect of the invention
CA 02352476 2001-05-29
WO 00134518 PCT/NL99100743
21
comprises steps (a) - (e) of the general AFLP-method described above, in which
step
(e) is carried out by contacting the (mixture of) amplified or elongated DNA
fragments) obtained instep (d) with an array as described herein.
Compared to conventional fingerprinting~~autoradiography, the use of an array
generally will be faster than using fingerprinting/autoradiography, and
several markers
that would require generating several separate fingerprints could be combined
into a
single array. This makes the arrays of the invention especially suited for
routine and/or
high throughput screening, for instance in plant brf;eding.
Also, the array of the invention can conveniently be provided as a kit of
parts
comprising the array and other components for use with the array, such as
restriction
enzymes, polymerase(s), adapters, primers, buffers, nucleotides, labels or
other
detection agents, containers/packaging and manuals. The array of the invention
may
even be in the form of a hand-held device such as a dipstick.
The array of the invention may be re-usable, usually through regeneration to
remove the hybridized sequences. A kit of the invention may therefore also
contain
agents that can be used for such regeneration.
The array of the invention can be used to analyse any kind of nucleic acid
sequence or mixture of nucleic acid sequences, including, but not limited to,
plant-
derived sequences, animal-derived sequences, human-derived sequences,
microbial
sequences, yeast sequences, sequences from fungi and algi, and viral
sequences,
depending upon the origin of the restriction fral~nent sequences bound to the
array,
including but not limited to whether the restriction fragments bound to the
array are
derived from genomic DNA or cDNA (or both).
Also, the array may be used to analyse DNA sequences, including genomic
DNA, cDNA, structural genes, regulatory sequences and/or parts thereof; as
well as
RNA, including mRNA, optionally by analogous modification of the method given
above.
The nucleic acid sample analysed with i~:he array may be a sample as isolated
directly from a living or dead organism or from tissue or cells. Preferably
however,
prior to hybridisation with the array, the nucleic acid sample is restricted
with one or
more restriction enzymes, preferably the same two restriction enzymes used in
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
22
generating the array, although this is not mandatory.
Also, the nucleic acid sample (or party of it) may be amplified prior to
hybridisation with the array, using any type of suitable amplification
technique,
preferably a PCR-based technique. As already mentioned above, conveniently
AFLP
may be used, preferably using the same adapters .and primers as used in
generating the
array. This not only allows the use of known, re;Iiable protocols, but can
also reduce
sample complexity, thereby improving the signal-to-noise ratio.
However, it should be understood that the array of the invention generally
comprises a set of specific probes/markers bound to a carrier, so that the
array can be
used to probe any nucleic acid sample for the presence of a corresponding
sequence.
This is independant of the form which the nucleic acid sample may take (i.e.
full
genomic DNA, cDNA, or fragments thereof, or whether it has been amplified, and
if
so, by which amplification technique.
It should further be understood that, compared to fingerprinting, the use of
the
array no longer is, or has to be, based on detecting differences in fragment
length, as
sequences of interest can be detected directly. Therefore, the arrays of the
invention,
once prepared, are more broadly applicable than in AFLP only.
Also, although the array of the invention is primarily intended for detection
and analysis, it may also be used to quantitatively prepare or isolate DNA,
RNA or any
fragment thereof, i.e. by releasing the hybridiized sequences from the array
after
removal of unwanted sequences. The sequences thus obtained may then be used or
analysed further, for instance to determine their sequence.
In principle? arrays of the invention can be developed for, and can be used
for,
any purpose for which a polymorphic marker can be used and/or identified. This
includes, but is not limited to, all the uses described in the art for
polymorphic markers
in known DNA-fingerprinting, genotyping, profiling and DNA-identification
techniques. The arrays of the invention are .of course especially suited in
those
applications for which an AFLP-marker can be used and/or identified, including
those
mentioned above and in EP-A-0 534 858 and the co-pending European applications
98.202.5496 and 98.202.4515.
Also, besides the applications already mentioned, a cDNA-based array of the
CA 02352476 2001-05-29
WO 00/34518 PC'9'1NL99/00743
2a
invention can be used for any purpose for which the use of cDNA-AFLP is
envisaged,
including but not limited to applications such as expression profiling,
functional
genomics, and gene mapping. For any of these applications, it is envisaged
that - as
with cDNA AFLP - a cDNA-based array m.ay be used to determine both
qualitatively
S as well as quantitatively - e.g. based on the strength of the hybridisation
signal obtained
with the array - the presence of one or more specific nucleotide sequences in
a starting
sample. These may include both DNA-sequences as well as RNA-sequences,
including
expresssion-dependant RNA sequences such as mRNAs.
Possible fields of use of both the genornic DNA-based as well as the cDNA-
based arrays are for instance plant and animal breeding, variety or cultivar
identification, diagnostic medicine, disei~se diagnosis in plants and animals,
identification of genetically inherited diseasf;s in humans, family
relationship analysis,
forensic science, organ-transplant, microbial and viral typing such as
multiplex testing
for strains of infectious diseases; as well ~~s the study of genetic
inheritance, gene
1 S expression, mutations, oncogenes andlor drug; resistance; or for mRNA
detection.
Arrays ~f the invention may further be developed for and used in any other
application for which known nucleotide arrays are used or envisaged. These
include the
applications mentioned in for example WO 97/27317, WO 97/22720, WO 97/43450,
EP 0 799 897, EP 0 78S 280, WO 97/31256, WO 97/27317 and WO 98/08083.
As already mentioned above, in these applications, it is envisaged that arrays
of the invention can be developed that carry most or even all markers of
interest fox a
specific genotyping collection, such as for a specific species. Other arrays
of the
invention may contain most or all markers necessary to classify an individual
within a
genotyping collection, i.e. as belonging to a certain species, subspecies,
variety,
2S cultivar, race, strain or line, or to study the inheritance of a genetic
trait or property.
Also, an array of the invention may contain sill markers indicative of the
presence, the
absence or the state of a genetically determined or genetically influenced
disease or
disorder, including cancer, oncogenes and oncogenic mutations. Such an array
may
then be used for diagnostic purposes.
Similarly,, it may be possible to provide cDNA-based arrays for any of these
purposes.
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99100743
24
Some non-limiting examples of species of plants, animals and micro-
organisms for which arrays of the invention are particularly envisaged include
humans,
animals such as mouse, rat, pig, etc., plants such as wheat, barley, maize,
tomato,
pepper, lettuce, rice, and micro-organisms such as yeast, bacteria and fungi-
algi.
In a fiu~ther aspect, the invention relates to results and/or data obtainable
by
analysing a nucleic acid or mixture of nucleic acids with an array of the
invention.
These results or data may for instance be in the farm of an image, of a score,
of digital
or analog data, or in another suitable form, and rr~ay optionally be stored on
a suitable
data carrier, including paper, photographic film, computer disc of files, a
database, etc..
This data may be as directly obtained from analysing or scoring the array, or
may have
been processed further.
The invention will now be further illustrated by means of the following non-
limiting Experimental Part, as well as by the enclosed Figures 1-8, which show
(representations of) the results of hybridisations u:;ing micro-arrays of the
invention,
obtained by scanning the arrays using the Genetac; 1000 scanner (Genomic
solutions).
The arrays are irradiated with a Xenon-lamp and the signals axe detected using
a
CCD-camera. Filters for Cy-3 and Cy-5 are used. The scantime is about 180 sec.
More specifically, the Figures show:
- Figure 1: Detection of a mixture of 5 rice +21+3 AFLP markers on an array
containing 20 rice +2/+3 AFLP markers.
- Figure 2: Detection of rice AFLP markers amplified in +2/+3 AFLP reactions
on
an array containing 10 rice +2l+3 AFLP markers.
- Figure 3: Detection of rice AFLP markers arnplified in a +2J+2 AFLP reaction
on an array containing 20 rice +2/+3 AFLP markers.
- Figure 4: Detection of a rice AFLP markers amplified in rice +2l+2 AFLP
reactions on an array containing 20 rice AFL:P markers.
- Figure 5: Detection of maize +2/+3 AFLP markers on an array containing 48
maize +3/+3 AFLP markers
- Figure 6: Detection of +2/+3 AFLP m<~rkers on an array containing 11
Arabidopsis +2I+3 AFLP markers.
- Figure 7: Detection of +21+2 AFLP markers ~on an array containing 21 +1 /+2
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
tomato cDNA-AFLP fragments.
- Figure 8: Detection of rice AFLP markers axriplified in a +21+3 AFLP
reaction
on an array containing 5 rice +2/+3 AFLP markers and 5 sets of oligo's
corresponding to the forward and reverse strands of these 5 rice +2/+3 AFLP
5 markers.
- Figure 9: Schematic representation of the related AFLP-Primer Combinations
("APCs") used in Example I. Fig. 9A: 4 related APCs of the Enzyme Combination
("EC") EcoRT-MscI; Fig. 9B: APC that can be used to simultaneously amplify the
4
APCs of Fig. 9A; Fig. 9C: 16 related APCs oi.-'the EC P.stl-TaqI; Fig. 9D: APC
that
10 can be used to simultaneously amplify the 16 APCs of Fig. 9C.
- Figure 10: Schematic representation of the method used in generating the
Array-
bound Nucleic Acids Sequences ( including the AFLP-amplification);
- Figure 11: Schematic representation of the method for identifying, inlfrom a
plurality of AFLP-fingerprints, poiymorphic bands suitable for use in an array
of
15 the invention, and for "building up" an array from such polymorphic bands;
- Figure 12: Schematic representation of a method for probing a genomic DNA
with
an array of the invention, in which the genomic DNA is restricted and
amplified
using AFLP-methodology prior to contacting 'with the array.
20 Experimental Part.
Example I: Generation of AFLP micro-arrays.
The method for generating the AFLP micro-arrays comprises steps (1) - (9).
Steps {2) - (5) generally follow conventional AFLP-techniques and protocols,
as
25 described in EP-0 J34 858. A number of steps of said method, as well as the
primers/primer combinations used therein, are scluernatically shown in Figures
9-11.
1. Selection of the g_enotypiJng collection.
A limited number of individuals is sele<:ted representing the genetic
diversity
within a specific group in the best possible way. The selected set of
individuals is called
the "genotyping collection".
CA 02352476 2001-05-29
WO 00134518 PCT/NL99/00743
26
The group chosen will be dependant upon the purpose of the array. For
instance, when the array is to be used in breeding, the individuals may be
from different
varieties, lines, strains, cultivars, or races, belonging to the same species.
'The number of different individuals will vary, dependant upon the nature of
the genotyping collection, the diversity in said collection, the number of
markers
desired on the array, etc. Usually; the array will contain the markers from 1
to 10
different individuals.
2 Isolation of eg nomic DNA and preparation of A,FLP template DNA.
Genomic DNA is isolated from the individuals of the genotyping collection
and A.FLP template DNA is prepared of each individual using a certain
Restriction
Enzyme Combination, as shown in Figure 10. This is carried out for each
individual
separately, in a manner known per se, for instance; from AFLP, essentially as
described
in EP-0 534 858.
The Restriction Enzyme Combination will comprise at least one frequent
cutter and at least one rare cutter as described above and will depend on the
genotyping
collection used (i.e. which genus or species.
Suitable Restriction Enzyme Combvlations, i.e. providing informative
polymorphic bands in the final fingerprint, can be selected on the basis of
experience or
after some routine experimentation. Some non-limiting examples include
EcoRTIMseI
or PstIlTagI. Usually, when a Restriction Enzyme Combination is known that
gives
informative results in conventional AFLP-fingerprinting, this combination is
also used
in preparing the array of the invention.
After the genomic DNA has been isolai:ed and restricted with the Restriction
Enzyme Combination, adapters are attached to the resulting fragments to
provide
AFLP-template DNA. Again, conventional AFLP-adapters can be used, essentially
as
described in EP-0 534 858.
3. Amplification.
The DNA templates from each of tlhe individuals from the genotyping
collection are amplified using selective primers.
CA 02352476 2001-05-29
WO 00134518 PCT/NL99J00'743
27
Preferably, a large number of AFLP reactions is performed on the genotyping
collection using a set of "related AFLP-Primer Combinations", hereinbelow
referred to
as "related APCs". The APCs mentioned in this Example are also schematically
shown
in Figures 9A-9D.
$ Related APCs are combinations of selective A,FLP-primers that can be used
with the same Restriction Enzyme Combination and that can be amplified
simultaneously using a corresponding APC with less selective nucleotides,
yielding all
A,FLP fragments from the related APCs at once. Each of the primers that forms
part of
an APC is essentially the same as a conventional A,FLP-primer in that it
contains:
1) a sequence corresponding to (i.e. that can hybridize with) the adapter-
sequence of the template, connected at its 3' end to:
2) a (usually small) sequence that corresponds to the part of the template
sequence that resulted from the cutting of a restriction site in the original
genomic DNA
with the restriction enzyme used and the ligation of the restricted fragment
to the
adapter; and
3) at the 3' end of the primer, a number of so-called selective bases, for
which
further reference is made to EP-0 534 858.
Each primer of an A,PC can be represented schematically as:
5'- AA _ RRR _ NNN. -3'
in which N is a nucleotide corresponding to the adapter sequence, R is a
nucleotide
corresponding to the restriction sequence, N is a. selective nucleotide (the
number of
nucleotides A, R, and N may vary and may be different than shown); or
alternatively as
[adapter] - [restr.enzyme] - NNN
in which [adapter] is the adapter sequence, [restr.enzyme] is the restriction
sequence,
and N is a selective nucleotide.
Each APC will consist of two primers, i~.e. one primer for the rare cutter and
one primer for the frequent cutter. A set of APCs will comprise a number of
such two-
primer APCs.
To provide a set of "related A,PCs", the :Last selective base at the 3' end of
the
primer for the frequent cutter, of the primer for the rare cutter, or of the
primers for
both, may be varied to two or more, and preferably all four of the bases A, T,
G and C.
CA 02352476 2001-05-29
WO 00/34518 PC~'ltYL99100743
28
If one of the two primers of an APC is varied to ~~ll four bases, this will
provide a set of
4 APCs; if both of the primers are varied, a set oiF 16 APCs will be obtained.
Examples
of such sets of related AFLP-primer combination's are:
A) a set of 4 related APCs for the Restriction Enzyme Combination EcoRI-
MseI (Figure 9A):
[Adapter] - [EcoRI] - GAC + [Adapter] - [M~~eI] - TCA
[Adapter] - [EcoRI] - GAC + [Adapter] - [M.~~eI] - TCC
[Adapter] - [EcoRI] - GAC + [Adapter] - (M.~~eI] - TCG
[Adapter] - [EcoRIJ - GAC + [Adapter] - [M~eI] - TCT
These APCs can be used with the Restriction Enzyme Combination EcoRI-
MseI and have the selective nucleotides GAC at the EcoRI-primer and the
selective
nucleotides TC at the MseI-primer in common. The AFLP-fragments from these 4
related APCs can be amplified at one with the AI'C
[Adapter] - (EcoRI] - GAC + (Adapter] - [M,seI] - TC (Figure 9B)
B) the 16 related APCs for the Restriction Enzyme Combination PstI-Taql
(Figure 9C):
[Adapter] - [PstI] - CA + [Adapter] - [TaqI] - AGA
[Adapter] - [PstI] - CA + [Adapter] - [TaqI] - AGC
[Adapter] - [PstI] - CA + [Adapter] - (TaqI] - AGG
[Adapter] - [PstI] - CA + [Adapter] - [TaqI] - AGT
[Adapter] - [PstI] - CC + [Adapter] - [Taql] ~- AGA
[Adapter] - [PstI] - CC + [Adapter] - (TaqI] - AGC
[Adapter] - [PstI] - GC + [Adapter] - [TaqI] - AGG
[Adapter] - [PstI] - CC + [Adapter] - [TaqI] - AGT
[Adapter] - [PstI] - CG + [Adapter] - [TaqI] - AGA
[Adapter] - (Pstl] - CG + [Adapter] - [TaqI] - AGC
[Adapter] - [PstI] - CG + [Adapter] - [TaqI] - AGG
(Adapter] - [PstI] - CG + [Adapter] - [TaqI] - AGT
[Adapter] - [PstI] - CT + [Adapter] - [Taql] ~- AGA
[Adapter] - [PstI] - CT + [Adapter] - [TaqI] ~- AGC
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
29
[Adapter] - [PstI] - CT + [Adapter] - [TaqI] - A(~G
[Adapter] - [PstI] - CT + [Adapter] - [Taql] - AtiT
These APCs can be used with the Restriction Enzyme Combination Pstl-TaqI
and have the selective nucleotide C at the PstI-primer and the selective
nucleotides AG
at the TaqI-primer in common. The AFLP-fragments from these 4 related APCs can
be
amplified at once with the APC
[Adapter] - [PstI] - C + [Adapter] - [TaqI] - AG (Figure 9D)
Preferably, in an APC, primers with 1, 2, 3 or 4 selective nucleotides are
used.
More preferably, each APC comprises a combination of two +3-primers, or one +3-
primer and one +2-primer, or two +2 primers.
4. Fingerprinting.
After a suitable set of related APCs has been selected, the restricted genomic
DNA of an individual from the genotyping collection is amplified using one APC
from
the set.
This is carried out for all individuals of th.e genotyping collection, in
separate
amplifications, carried out essentially as described in EP-0 534 858, which
are usually
run simultaniously.
The resulting AFLP reactions, one for each individual of the genotyping
collection, are then analyzed in parallel on sequenciing gels. After
electrophoresis, these
gels are dried on Whatman 3 MM paper and the AFLP fingerprints are visualized,
e.g.
by autoradiography or phospho-imaging.
In this way the AFLP fingerprints of the individuals of the genotyping
collection are displayed side by side on the fingerprint. This is
schematically shown in
Figure 11, in which the AFLP-reactions of a genotyping collection of 4
individuals
(referred to "ind.l" to "ind.4" - and corresponding to the lanes from left to
right in the
gels) have been visualised in the four parallel lanes of each of the gels "pk
1 " to "pk 4"
(in which each gel was generated with a different APC from a set of four
related
APCs).
5. Identification of golymorphic bands.
CA 02352476 2001-05-29
WO 00/34518 PCTINL99/00743
The AFLP fingerprints of the individuals of the genotyping collection are
inspected for AFLP fragments that reveal DNA pol;;~morphisms; such AFLP
fragments
are called "AFLP markers". This is again schematically shown in Figure 11, in
which
each marker has been circled. Bands that are the sanne for each individual
fingerprint
5 are not selected. These bands are then assembled on the array, i.e. as
described
hereinbelow. This method is also exemplified by the method schematically shown
in
Figure 12.
6. Isolation of the AFLP-markers.
10 The AFLP markers are cut out from the gel with the gel piece and the
attached
Whatman 3 MM paper. This is carried out for each marker separately.
7 Purification reamplification and cloning.
The AFLP markers thus identified and separated are eluted from their
15 respected gel pieces and separately reamplified usvlg the AFLP primers
(i.e. the APC)
initially used to generate the AFLP fingerprint from which the AFLP marker is
derived.
Next, the AFLP markers are cloned into appropriately digested plasmid vectors
according to standard procedures.
20 8 Generating an AFLP fragment library.
The procedure of steps 6 and 7 is repeated for the various APCs of a set of
related APCs.
This is again schematically shown in Figure I 1, in which each of the gels pk
I
to pk 4 has been generated using one of the APCa from a set of four (and each
gel
25 contains, in each parallel lane, the fingerprint oic one individual of the
genotyping
collection obtained with the APC used).
In this way an AFLP fragment library is build up containing AFLP markers
identified using the genotyping collection.
CA 02352476 2001-05-29
WO 00/34518 PCTl1VL99/00743
31
EXAMPLE II: Carrier attachment and formation of an array.
The individual AFLP markers of the AFLI? fragment library are attached to a
carrier; many different AFLP fragments are attached to the same carrier. This
is
preferably carried out according to a predetermined pattern, in which for
instance the
markers generated from the genotyping collection with a specific APC are
grouped
together, i.e. as a column as shown in Figure 11.
Also, the markers generated with each of the APCs from the set of related
APCs may be grouped together, to form a set of lines, rows or columns, or a
rectangle,
as is shown in Figure 1 ll .
In this way an array of AFLP markers is created on the carrier. In case of a
high-density array such arrays are called AFLP micro-arrays. Usually, each APC
will
provide about 10-50 markers, depending upon the genotyping collection and the
number of individuals used.
The array thus obtained can then be used to probe the genomic DNA of a
further individual for the presence of the AFLP markers attached to the array,
as further
described in Example III. Usually, this further individual will belong to or
be related to
the genotyping collection used in generating the array, or at least will be
suspected of
containing in its genome one or more of the markers present on the array.
E~;AMPLE IIi: Genotyping using AFLP micro-;arrays.
This procedure uses the AFLP micro-arra3rs obtained as described in Example
I. Such micro-arrays contain a multitude of AFLP markers derived from a
specific
genus. (Tn general AFLP markers will be genus-specific and AFLP markers
generated
from a different genus will usually not be usable for genotyping of
individuals from
other genera).
Genotyping of a specific individual can be performed by investigating the
presence or absence of each AFLP marker of the AFLP micro-array in the
individual
tested. This can for instance be achieved by hybridization of a collection of
AFLP-
fragments from the individual to the AFLP markers attached to the micro-array.
This collection of AFLP fragments is preferably generated from the individual
of interest by AFLP amplification of AFLP template DNA of the individual. The
CA 02352476 2001-05-29
WO OOI34518 PCT/NL99/00743
32
collection of AFLP fragments can be labeled to enable the detection of the
AFLP
fragments hybridized to their counterparts on the AF~LP micro-array.
In general, this procedure comprises the fo3ilowing steps:
1 Isolation of ~enomic DNA and preparation of AFLP template DNA.
Genomic DNA is isolated from the individual tested and AFLP template DNA
is prepared. This is carried out in a manner knavv~n per se, for instance
essentially as
described in EP-0 534 858.
Preferably, the same Restriction Enzyme Combination is used as was used in
f0 generating the template DNA for the array. More preferably, a method
analogous to the
method of step 2 of Example i is used, i.e. followinp~ the same or a similar
protocol.
However, the adapters used are preferably chosen such that they do not
hybridize with the adapter sequences present in the Array-bound Nucleic Acid
Sequences (if any). Such hybridization between the adapter sequences could
give rise to
false-positive signals (i.e. not corresponding to the presence of an AFLP
marker in the
sample to be tested), in particular if low stringency :hybridization
conditions are used.
Ta avoid this., in the preparation of the template DNA to be tested with the
array, different adapters to those used in generating the array may be used.
Alternatively, and preferably, the adapter sequences present in the AFLP
markers
isolated from the gel in step 6 of Example I above are either removed or
replaced by
other adapter sequences prior to attachment of the marker to the array (but
usually after
reamplification of the isolated markers in step 7 o:f Example I). This may be
achieved
during cloning of the AFLP fragments as described in Procedure 7 of Example I.
2. Amplification and labelling.
A single AFLP reaction is performed on the template DNA obtained in step 1,
using an APC that corresponds to the Restriction Enzyme Combination, to
generate the
AFLP fragments speciftc for the APC selected.
Preferably, said APC is further selected to include all APCs from the set of
related APCs used to generate the markers on the AFLP micro-array, or at least
a subset
thereof. Generally, this means that one or both of the primers of said APC
will contain
CA 02352476 2001-05-29
WO 00134518 PCT/1VL99/00743
33
less selective nucleotides than the primers of the set of related APCs.
Usually, the primers of said APC will contain no selective bases on the
positions varied in the primers of the set of "related APCs" used in
generating the array,
as exemplified in step 3 of Example I above. The; remainder of the selective
bases in
primers of said APC will be the same as in the primers of the set of related
APCs, also
as exemplified in step 3 of Example I.
In principle, using said APC, all fragments that have been amplified
separately
with the set of related APCs can be amplified together. Therefore, by using
said APC
on the template DNA of step 1, a mixture of amplified fragments can be
generated that
will contain any marker generated with the set of related APCs, if such a
marker is/was
also present in the genomic DNA to be tested.
For the remainder, the amplification is c~uried out in a manner known per se,
for instance essentially as described in EP-0 534 858, and preferably in a
manner
analogous to step 3 of Example I, i.e. following the; same or a similar
protocol.
During or after amplification, the AFLP fragments are labeled by using end-
labeled AFLP primers, or by internal labeling. Th.e label may be a fluorescent
label, a
radio-active label, or other types of labels suitable :for detection on micro-
arrays.
3. Hybridization with the array.
The labeled AFLP fragments generated 'with the selected APC are used as a
probe in a hybridization to the AFLP fragments on the AFLP micro-array. The
collection of labeled AFLP fragments is called the "AFLP target". AFLP markers
represented on the AFLP micro-array will hybridize to their labeled
counterparts in the
AFLP target, provided that these AFLP markers ~rre present in the individual
selected.
The result is that the AFLP markers on the array that cozxespond to markers
present in
the individual tested will hybridize to their labelled counterparts, and give
a positive
hybridization signal on the array (i.e. show the presence of the label).
AFLP markers on the array that are not present in the individual tested will
not
find corresponding labelled sequences in the amplified sample, and will
therefore not
give a positive signal.
CA 02352476 2001-05-29
WO 00/34518 1'CT/NL99100743
34
4 Scanning,~detection and analysis of the array.
After hybridization, the AFLP micro-array is scanned visually or using
automated equipment. Each spot harboring an AFL,P marker present in the
individual
will show the presence of the Label, spots representing AFLP markers absent in
the
individual will not be labeled. In this way the presence or absence of each
AFLP
marker on the AFLP micro-array in the individual tested can be assessed. These
results
may also be referenced further by comparison to earlier results obtained with
the same
array, or be stored in a database for future reference.
EXAMPLE IV: Procedure for generating AFLI' fragments for use in micro
arrays.
This method generally comprises the steps of
1. Isolation of the fragments from an AFLP gel
2. Reamplification of the isolated fragments using; primers that reconstitute
the
restriction sites
3. Purification and digestion of the reamplified products
4. Cloning of the fragments in pUC vector
5. Validation of the clone fragments by fingerprinting pools of cloned
fragments
(obtained using colony PCR), and comparing tl~e fingerprints thus obtained
with
the original fingerprints used in step I .
1. Isolation of the AFLP fragments from the gel
AFLP reactions are carried out using 10 ng Mse primer and 30 ng primer for
the rare cutter (of which 5 ng is kinased with 33P Y°d-ATP) The AFLP
reactions are
run on standard 4.5% gradient gel. The gel is transferred to Whattman-3MM
paper
and dried. The dried gel is exposed (>oln)with a sensitive photographic film.
The
fragments to be spotted on the micro array are cut out from the gel as a thin
slice
(about I mm) and transferred to 100 p,l TEo>i
CA 02352476 2001-05-29
WO 00134518 PCT/Nl.99/00743
2. Reamt~lification
EcoRI+AlMsel+C fragments are reamplifie;d with the following primers
98L19 and 98L20, that reconstitute the restriction sites.
5 98L19:AGCGGATAACAATTTCACACAGGAT.AGACTGCGTACGAATTCA
M 13 reverse sequence primer X
E01: GACTGCGTACCAATTCA
98L20:CGCCAGGGTTTTCCCAGTCACGACGATGAGTCCTGATTAAC
10 M13 forward sequence primer X
M02: G'rATGAGTCCTGAGTAAC
( 98L19 = SEQ ID no.1 ; E01 = SEQ ID no.2 ; 98I.,20 = SEQ ID no. 3; M02 = SEQ
ID no.4)
I S The PCR reaction mixture is as follows: 5 ql eluate; 150 ng 98L19; 150 ng
98L20; 2 pl 5 mM dNTP's; 5 pl 10 x PCR buffer; 0.2 U Taq polymerase, in a
total
volume of 50 p.l. The PCR profile is as follows: 30 sec. 94°C : 30 sec.
56°C : I min.
72°C, for 30 cycles.
Pstl+AlMseI+C fragments are reamplifiecl with primers 98/L88 and 98/L20
98L88:AGCGGATAACAATTTCACACAGGAT'AGACTGCGTACCTGCAGA
MI3 reverse sequence primer X
PO1 GACTGCGTACATGCAGA
X
Ps01 GACTGCGTACCTGCAGA
( 98L88 = SEQ ID no.5 ; PO1 = SEQ ID no.6 ; PsOI = SEQ ID no.7) or optionally
with 98L89/98L20.
98L89:AGCGGATAACAATTTCACACAGGA'fAGACTGCGTACCTGC
MI3 reverse sequence primer X
P00: GACTGCGTACATGCAG
( 98L89 = SEQ ID no.8 ; P00 = SEQ ID no.9)
CA 02352476 2001-05-29
WO OOI34518 PCT/Nl.99/00743
36
3 Purification and digestion of the reamplified frat~rnents
The PCR-reactions are purified using a Qiaquick 96-well PCR centrifugation
kit (Qiagen) according to the manufacturers protocol.
The elution step is carried out using 80 pl e.lution buffer, to a final volume
of
about 50 ~,1. The elution volume is collected on a nnicrotiter plate. The
purified
PCR-products are restricted by adding SU rare cutter enzyme, SU Msel to a
total
volume of 74 ~l lx RL+, and the mixture is incub2~ted for 2 hours at
37°C. After the
restrictionldigestion, the DNA (on the microtiter plate) is precipitated with
isopropanol by adding 7.5 pl 3M NaOAc, 85 pl isopropanol, and the mixture .is
kept
IO at room temperature for 15 min and then centrifuged for 45 min (3500 rpm).
Excess isopropanol is removed and the microtiter plates are again
centrifugated (10
sec. at 1000 rpm). The pellet (not visible) is taken up in 15 pl TEo>i, and a
3 p.l
aliquot thereof is checked on the 2% agarose gel.
4. Clonin;~ of the ream~alified fragments
The ligation reaction is carried out in the following mixture: 7 ~.l
reamplification product (in PCR base); 8 ~,1 Iigatio~n mixture; I00 ng PstI-
or
EcoRI/NdeI-restricted, gel-purified pUC 18; 3 ~,1 S:X RL+ ;1.5 p,l 10 mM ATP;
1 U Ta
DNA Ligase to a total volume of 8 p.l. The mixture is incubated (o/n) at room
temperature.
The transformation (in PCR base) is carried out as follows. 7.5 N,1 ligation
reaction is kept on ice, 50 p.l frozen competent D~fSa cells are added (on
ice), and
the mixture is incubated for 30 min. (on ice). The mixture is then subjected
to a heat
shock (42°C) during 90 sec and kept on ice for 2 ruin, after which 200
p,l TY
medium is added, and the mixture is allowed to recover (1 hour at
37°C). 200 pl of
the mixture is plated on TY+carbeniciline agar plate and incubated (o/n) at
37°C.
CA 02352476 2001-05-29
WO 00/34518 PCTINL99/00743
37
Reamplification and validation of the cloned fra_glments
The following reamplification primers are 'used:
- rare cutter side: 98L58: GGAAACAGCTATGACCATGATTAC (pUC 18
primer, SEQ ID no.l0)
5 - NdeI side: 98L55 GATTGTACTGAGAGTGCACCTTAAC (pUC 18 primer,
with reconstituted MseI site, only for Mse+C, SEQ ID no.l l).
For each clone fragment 3 different clones and inoculated into 10 E,il TY,
followed by incubation (o/n) at 37°C. E. coli cells are transferred to
96-wells plate
with 50 pl TEo>i per well, and 5 p,l is transferred to PCR base. The PCR base
is
incubated at 95°C during 5 min, after which 45 ~,il PCR mixture is
added, which
comprises: 75 ng primer 98L58; 75 ng primer 98L,55; 2 pl 5 mM dNTP's; 5 pl l
OX
PCR buffer; 0.25 pl Taq polymerase; 0.85 pl 10 rng/ml BSA, to a total volume
of 45
ul. The PCR profile is as follows: 25 sec. 94°C; 30 sec. 56°C; I
min. 72°C;
for 30 cycles. 5 p,I of the mixture is checked on the gel.
For each APC from which a fragment is obtained, 3 pools are made: Pool A
contains fragment 1, 4, 7, 10 ...; Pool B contains ~:ragment 2, 5, 8, 11 ...;
Pool C
contains fragment 3, fi, 9, 12 .... For each clone 5 ~l colony PCR material is
pooled,
and 5 pl of each pool us used for a template preparation (standard AFLP
template).
The template is checked by standard AFLP reaction of 1/10 diluted pool
template, the fingerprint of which is compared to the fingerprint from which
the
original fragments were obtained.
EXAMPLE V: Protocols for detecting AFLP fragments using micro arrays.
Preparing the micro arrays
The micro arrays are prepared using DNA, probes that are synthesized via
"colony PCR" using pUCl8 specific primers. For preparing the arrays, DNA
solutions at a concentration of about 0.5 p,g/p.l are used. Diluted colony PCR
material
is used for routine synthesis of probe DNA.
1. Amplification of the probes
To synthesize as much DNA as possible in a small a volume as possible, an
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
38
adaptation of a conventional PCR protocol is used (increased amounts of
primer,
dNTP's and MgClz are added). The PCR mixture is as follows: 5 pl 1 /400
preamp;
6.3 ul primer 1 {SO ngJp,l); 6.3 ~,1 primer 2 (50 ng/~~l); 8.4 ~,l dNTP (5
mM); 3.36 ~1
MgClz (25 mM); 10.5 ~.1 PCR buffer (10x); 0.525 ~u,i Taq DNA Polymerase (S
UI~.1);
Ha0 to 105 ~1 final volume. The PCR profile is as follows: 30 sec.
94°C; 30 sec. 55
°C; 1 min. 72°C; 30 cycles; PE 9600 MODE. The ;gel reference is
2.5 ~.1 PCR on 2%
agarose gel. The following primers are used: Standard: 98L55 + 98L58; with
5'NHz:
98L59 (NHz) + 98L58 NHz; with 5' Cy-3 and internal NHz: 98L59 (Cy-3, NHz) +
98L58 (Cy-3, NHz).
On the basis of 315 ng of each primer, theoretically 8 ~,g product can be
formed in the reaction in a 105 ul PCR (assuming an average fragment length of
250
by and that all primer is used). For a PCR efficiency of 80%, 6.4 ~g product
will be
synthesized. Thus, for 50 ~,1 product at a concentration of about 0.5 ~CgJ~,I,
3 PCR
reactions of 105 p,l are necessary.
i5
2. Precipitation of PCR reactions:
The precipitation of the PCR reactions is c,nTied out as follows. To 3x 105 pl
PCR reaction + 31.5 pl (1/10 volume) 3M NaAc is added 346 pl (1 volume) 2-
propanol, and the mixture is kept for 30 min at -20°C. The mixture is
then
centrifuged (30 nun, 13000 rpm, 4°C) and the pellet is washed with 100
p,170%
EtOH. The mixture is then again centrifuged (10 vain, 13000 rpm, RT) and the
pellet
is dried to air, dissolved in 25 ~.l Hz0 and 25 pl D:MSO is added. As a gel
reference
0.5 p,l on 2% agarose gel is used.
3. Preparation of the arrays
To prepare ("print") the arrays a GMS 4I7 arrayer (Genetic Microsystems) is
used. Such an arrayer can be configured according; to a variety of variables.
In
preliminary tests, a number of standard settings are used, making the lay-out
of all
arrays comparable. A good means for localizing the spots is the use of
labelled
primers -in particular Cy-3 or Cy-5-primers- for rriaking the probes. This
makes the
position of the printed sequences ("spots") clearly visible on the scans of
the arrays
CA 02352476 2001-05-29
WO 00/34518 PCTINL99/00743
39
and serves as a control to monitor deposition and binding to the array.The
slides used
were EMS Poly-L-lysine slides {Electron Microscopy Scienses, Washington).
Printing of the slides is carried out as follows:
a) Position of the slides:
- Piece of "matted glass" on the slides on the left side {against the clamp).
- Press slides well together.
b) Position of the microtiter plates:
- A1 coordinate of the plates left side front yin the plate holders.
c) Settings arrayer:
1 x spotting X = 3 Y = I 5, dupla X = 7.4 Y ~= 1 S
Sx spotting X = 3 Y = 19, duplo X = 7.4 Y ~= 19
spot spacing: 300 pm - 350 ~.un.
To limit the evaporation of the probe DNA's, the microtiter plates can be kept
above a bath of warm vbrater.
4. Processing of the arrays
During the processing of the arrays, DNA is adhered to the glass carrier and
denaturated, depending upon the type of slide and t;he coating. The processing
of
EMS Poiy-L-lysine slides is carried out as described by P. Brown
(httw//cmgxn stanfard edu/pbrown/p.roioco.ls/3,_pos;t,~rocess.ht~n.ll:
The slide is rehydrated on top of a hot water bath for 1 minute, so that the
slide becomes fogged, and snap dried on a heated cooking plate (about 3 sec.).
The
slide is then rehydrated far 10 sec, UV cross-linked at 65 mJ (Amersham UV
crosslinker at 650 x 100 p,J), and incubated for I S-20 min in blocking
solution (in a
glass tray), with gentle agitation. The blocking solution comprises 325 ml 1-
methyl-
2-pyrrolidone (100 ml); 6 g succinic anhydride (1.8 g) and 15 ml sodium borate
(pH
8.0) (4.6 mI). The slides are washed for 2 min. in fia0 (95°C); washed
for I min. in
96% ethanol; and dried for S min. by centrifugation in a tabletop centrifuge
at 1000
rpm.
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99i00743
5 Labeling of the target reactions
For the labeling of the target DNA several methods can be used.
Hereinbelow, a labeling method will be used in which Cy-3 or Cy-5 labelled
dCTP
molecules are enzymatically incorporated into the target DNA using Klenow DNA
5 polymerase.
The PCR reaction was as follows: PCR reaction: 5 ~.l 1/400 preamp or 5 pl 1:
I0 AFLP template; 6.3 pl primer 1 (50 ng/~l); 6.3 ~u.l primer 2 (50 ng/~cl);
3.36 ~,1
MgCl2 (25 mM); 8.4 p,l dNTP (5 mM); I0.5 pl Pcr buffer (lOx); 0.525 p.l Taq
DNA
Polymerise (5 M/~,1); and Ha0 until 105 ~.I final volume. The PCR profile is
10 dependent upon the AFLP extension reaction. If only one selective
nucleotide is
used, a stable profile is used, e.g.. 30 sec. 55°C; 1 min. 72°C;
for 30 cycles, PE 9600
MODE. With more than one selective nucleotide, a standard AFLP profile (with
touch down) is used, e.g 30 sec. 94°C; 30 sec. 65°C I cycle; 1
min. 72°C; followed
by lowering of the annealings temp, with 0.7°C during 12 cycles (in
total 13 cycles
15 touch down); 30 sec. 95°C; 30 sec. 56°C - 23 cycles; 1 min.
72°C
The target reaction is precipitated as follows. 10 ~,l (1/10 volume) 3 M NaAc
is added to 100 pl target PCR reaction: 110 ~,1 (1 volume) 2-propanol is
added, and
the mixture is kept for 30 min at -20°C. The mixture is then
centrifuged ( 30 min at
13000 rpm and 4°C) and the pellet is washed with 100 ~l 70% EtOH,
followed by
20 centrifugation (10 min at 13000 rpm and RT). The pellet is then dried to
ambient air
and taken up in 10 ~,l HaO.
The preparation of labeled taxget DNA using Klenow DNA Polymerise was
carried out as follows. 'To 5 ~,l target DNA (about :3-6 pg AFLP reaction) and
2.5 ~,1
AFLP primer (1 p,g/~Cl) is added H20 to a total volnrne of 20 ~.1, and the
mixture is
25 kept for 5 min. at 95°C and then cooled to room temperature. Then
are added: 5 ~1
dCTP with Cy-3 or Cy-5 label (0.5 mM); 1 pl 5 mM of each of dATP, dGTP, dTTP;
5 ~,l 10x T4 buffex; 2.5 ~,l Kienow DNA Pol (8u/~,l) and 16.5 ul HaO, and the
mixture is incubated for 2 hours at 37°C
The labeled target reactions are purified using a Qiaquick column, according
30 to the manufacturer's instructions. The elution is in 50 ~1 elution buffer.
CA 02352476 2001-05-29
WO 00134518 PCTINL99100743
41
\The pellet, which must be clearly stained, is dissolved in in 18 ~,1 Ha0 for
Klenow
target or in 15 ~,l Ha0 fox Mirus target.
8. Hybridisation
The denaturation of labeled target is carried out by adding 1.5 p,l
denaturation
buffer D1 (3M NaOH), after which the mixture is kept at room temperature for 5
min, and then place on iced, upon which 1.5 pl neutralisation buffer N1 (1M
Tris pH
7.3, 3M HCl) is added.
Subsequently, 18 ~l 2x hybridization buffer (preheated), comprising 4x SSC,
5x Denhardt, 0.5% SDS, is added at 60°C, after which the hybridization
is started by,
with a pipet, adding 30 ~.l target solution to the slide, next to the array.
A the cover glass (24x50 mm) is placed in position (wathout air bubbles), and
the
slides are incubated (o/n) at 45°C in a single incubation chamber ( in
which case 2
drops 10 ~13x SSC are added) or in a large incubai:otion tank containing
water.
The hybridizations are washed by rinsing with 4x SSC 0.1% SDS
(45°C);
incubating for about 5 min in 2x SSC 0.1% SDS (4~5°C); incubating for 5
min Ix
SSC 0.1% SDS (RT); incubating for 5 min in 0.5x SSC 0.1% SDS (RT); incubate
for
2 min in 0.5x SSC (RT); followed by centrifugation for 10 min (500 rpm) in a
tabletop centrifuge.
9. Scanning
The arrays are scanned using the Genetac 1000 scanner (Genomic solutions).
The arrays are irradiated with a Xenon-lamp and tl;ie signals are detected
using a
CCD-camera. Filters f~r Cy-3 and Cy-5 are used. 7.'he scantime is about 180
sec.
EXAMPLE VI: Detection of AFLP markers on microarrays.
EXAMPLE VI-1: Detection of a mixture of 5 rice +2/+3 AFLP markers on an array
containing 20 rice +2/+3 AFLP markers.
An array of 20 rice +2/+3 AFLP markers probes) was prepared from cloned
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
42
AFLP markers generated using restriction enzymes EcoRI and MseI and parental
lines IR20 and 6383. The AFLP marker name, AFLP primer combination (PC)
used, estimated mobility (size in basepairs) and the. parental origin of these
20 AFLP
markers are:
PC Size (b.p.) Parent Line
1. E11/M47 145 IR20
2. E11/M50 342 IR20
3. El 1/M50 173 IR20
4. El1/M50 I43 IR20
5. E I 1/M50 l 0 I IR20
6. El1/M49 583 IR20
7. E11/M49 243 IR20
8. E I 1 /M49 210 IR20
9. E 11 /M49 200 IR20
10. E 11 /M49 196 IR20
11. E11/M47 160 6383
12. E11/M50 214 6383
13. EI1/M49 342 6383
14. EIl/M49 299 6383
15 . E 11 /1VI49 273 63 83
16 Ell/1VI49 247 6383
17. E 11 /M49 194 63 83
18. E11/M49 159 6383
19. E11/M49 149 6383
20. E 11 /M49 146 63 83
CA 02352476 2001-05-29
WO 00!34518 PCT/NL99/00743
43
The of sequences the +2/+3 AFLP primers used to generate these 20 AFLP markers
are:
EcoRl El l: 5'-GACTGCGTACCAATTCA.A-3' (SEQ ID na.l2)
Msel M47: 5'-GATGAGTCCTGAGTAACAA-3' (SEQ ID no.l3)
M49: 5'-GATGAGTCCTGAGTAACAG-3' {SEQ ID no.l4)
M50: 5'-GATGAGTCCTGAGTAACAT-:3' {SEQ ID no. i 5)
The AFLP reactions used to isolate the 20 A~FLP +21+3 makers were
generated and resolved on sequence gels using the :>tandard procedure (Vos et
al.,
Nucleic Acids Research 23; 4407-4414, 1995 and ~'sP 0 534 858). The AFLP
markers were excised from a sequencing gel after transfer to Whatmann paper,
followed by drying and exposure to X-ray film to visualize the fingerprint
pattern and
reamplified using primers
5'-AGCGGATAACAATTTCACACAGGATAGA.CTGCGTACGA.ATTCA-3'
(SEQ ID no.l6) and
5'-CGCCAGGGTTTTCCCAGTCACGACGATG.AGTCCTGATTAAC-3' (SEQ ID
no. i 7) as described in the protocol.
After cutting with EcoRI and MseI and purification using Qiagen PCR
purification kits (Qiagen) the restricted AFLP mark;er fragments were cloned
in
plasmid vector digested with EcoRI and NdeI. After transformation to E. toll,
recombinant clones were va.Iidated for the correct size insert by AFLP
fingerprint
analysis of pooled amplified clone inserts. The insE;rts of clones with
validated inserts
were sequenced using a standard dye terminator cycle sequencing kit (ABI)
according to standard protocols supplied by the manufacturer.
Insert DNAs of individual validated clones were amplified from bacterial
stocks by PCR using either unlabelled vector primers or Cy3-labelled vector
primers
as described (see protocol enclosed) and the PCR reactions were precipated
using n-
propanol and sodiumbicarbonate according to star.~dard procedures. DNAs were
resuspended in 50% DMSO to a final concentation of around 500 nanograms per
microliter.
Microarrays were prepared by depositing ire duplo around 250 picoliters (1
CA 02352476 2001-05-29
WO 00/34518 PCTINL99100743
44
time spotting) of either the unlabelled or the Cy3-labelled DNA solutions onto
an
EMS poly-L-lysine slide, (Electron Microscopy Scienses, Washington) using a
GMS417 microarrayer (Genetic Microsystems; Woburn, MA}. The slide was
processed according to standard procedures (sea protocol enclosed) and
hybridized
overnight at 45 °C temparature with a mixture of 5 AFLP markers
(target} named 8,
10, 15, 17, and 19 as indicated above, after labelling with Cy5 dye (Amersham
Pharmacia Biotec) by Klenow enzyme according to standard procedures (see
protocol
enclosed). After washing according to the protccol, the slide was scanned at
the Cy3
channel for 300 seconds (Figure 1B) and at the Cy-~5 channel in the automatic
exposure mode ("auto"; Figure 1 C) using a Genetac1000 microarray slide
scanner
(Genomic Solutions, Ann Arbor, MI).
The superimposed image of both channels i.s shown in Figure 1 A with
annotation to facilitate interpretation of the spotting pattern. Figure 1
shows:
1) uniform deposition of all AFLP probes (red, green or yellow signal of all
probes
on false-color image after hybridization).
2} specific hybridization to the 5 expected AFLP probes 8, 10, 15, I7 and 19
{Cy5
channel, green on false-color image; in combination with Cy3-labelled
fragments
yellow on false-color image).
3} no hybridization to the remaining 1 S AFLP probes 1, 2, 3, 4, S, 6, 7, 9,
11, 12,
13, 14, 16, 18 and 20):
EXAMPLE VI-2: Detection of rice AFLP markers am-plified in +2/+3 AFLP
reactions on an arraycontainin 10 rice +2/+3 AFLP markers.
An array containing 10 rice AFLP markers (probes) was prepared exactly as
described in Example VI-1. The array was processed as described and hybridized
with a target consisting of a mixture of a Cy5-labelled AFLP +2/+3 reaction
(target)
derived from parental line 6383 and IR20, prepared with AFLP primers El 1 and
M49. With this primer combination, parental line aR20 is known to contain AFLP
markers 6, 8 and 10 and line 6383 is known to contain AFLP markers 14, 16, 18
and
20 as described in Example VI-I. The array was washed according to the
conditions
as described in Example VI-1 or protocols refered to in Example VI-I.
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
Following washing, images were taken at the Cy3 (Figure 2B) and Cy5
{Figure 2C) channels as described in Example VI-1 and the two images were
superimposed electronically (Figure 2A). Figure 2 is annotated to facilitate
interpretation of the spotting pattern and shows:
5 1 ) uniform deposition of all AFLP probes (red, green or yellow signal of
all probes
on false-color image after hybridization).
2) specific hybridization of the IR20 and 6383 AF'LP markers 6, 8, 10, 14, 16,
18
and 20; CyS, green signal on false-color image hybridized to unlabelled probes
and green/yellow signal on false-color image hybridized to Cy3 labelled
probes).
10 3) no hybridization of to the remaining AFLP markers 2, 4 and I2; Cy3, red
signal
on false-color image).
EXAMPLE VI-3. Detection of rice AFLP marker:> am,~lified in a +2/+2 AFLP
reaction on an arra~ontainin 20 rice +2l+3 AFLP markers.
15 An array containing 20 rice AFLP markers (probes) was prepared exactly as
described in Example VI-1. The array was processed as described and hybridized
using a Cy5-labelled AFLP +2/+2 reaction (target) derived from parental line
6383,
prepared with AFLP primers E11 and M15: 5'-GA,TGAGTCCTGAGTAACA-3'
(SEQ ID no.18). This parental line is known to contain AFLP markers with names
20 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20 as described in Example VI-1. The
array was
washed according to the conditions as described ire Example VI-1 or protocols
refered to in Example VI-1.
Following washing, images were taken at the Cy3 (Figure 3B) and Cy5
(Figure 3C) channels as described in EXAMPLE VI-1 and the two images were
25 superimposed electronically (Figure 3A). The superimposed image is shown in
Figure 3A with annotation to facilitate interpretation of the spotting
pattern. Figure 3
shows:
I) uniform deposition of all AFLP probes (red, g~.~een or yellow on false-
color
image}.
30 2} specific hybridization to the AFLP markers in positions 11, 12, 13, 14,
15, 16, 17,
18, 19 and 20 (CyS; green signal on false-color image; in combination with Cy3
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99100743
46
labelled AFLP probes yellow signal on false-color image)
3) (cross)-hybridization to the IR20 derived AFLP probes in positions 2 and 3
(CyS;
green signal on false color image), probably due to co-amplification of AFLP
fragments with sequence similarity to IR20 markers in positions A2 and A3 with
S AFLP primer combinations E111M1S from 6383 AFLP template.
4) no hybridization to remaining eight IR20-derived AFLP probes 1, 4, S, 6, 7,
8, 9
and 10.
EXAMPLE VI-4. Detection of a rice AFLP markers amplified in rice +2/+2 AFLP
reactions on an array containing 20 rice AFLP markers.
An array containing 20 rice AFLP markers (probes) was prepared exactly as
described in Example VI-1. The array was processed as described and hybridized
with a target consisting of a mixture of a Cy3-labelled AFLP +2/+2 reaction
(target)
derived from parental line IR20, prepared with AFI:,P primers E 11 and M 1 S,
and a
1S CyS-labelled AFLP +2/+2 reaction derived from p~~rental line 6383, also
prepared
with primer combination E1 l and M1S (for primer sequences see Example VI-2).
The parental line IR20 is known to contain AFLP markers 1, 2, 3, 4, S, 6, 7,
8, 9 and
10 and 6383 is known to contain AFLP markers 1 l, 12, 13, 14, 1S, 16, 17, 18,
19 and
as described in Example VI-1. The array was washed according to the conditions
20 as described in Example VI-1 or protocols referred to in Example VI-1.
Following washing, images were taken at the Cy3 (Figure 4B) and CyS
(Figure 4C) channels both at 180 seconds exposure; time and the two images
were
superimposed electronically (Figure 4A). The superimposed image of both
channels
is shown in Figure 4A with annotation to facilitate interpretation of the
spotting
2S pattern. Figure 4 shows:
1 ) uniform deposition of all AFLP probes (red, green or yellow on false-color
image
after hybridization).
2) specific hybridization of IR20 AFLP markers :l , 4, 6, 7, 9 and 10; Cy3,
red on
false-color image).
3} specific hybridization of 6383 AFLP markers 'I 1, 14, 1S, 17 and 20; CyS,
green
on false-color image).
CA 02352476 2001-05-29
WO OOI34518 PCT1NL99/00743
47
4) Hybridization of both IR20 and 6383 AFLP markers 2, 3, I2, 13 and 18;
yellow
on false-color image).
5) No hybridization to probes 5, 8, 16 and 19.
EXAMPLE VI-5. Detention of maize +2/+3 AFLP markers on an array containing
48 maize +3/+3 AFLP markers
An array of 48 maize +2/+3 AFLP markers (probes) was prepared from
cloned AFLP markers generated using restriction enzymes EcoRI and MseI and
parental Iines B73, Mol7, F2, Co255, DK105 and A7. The AFLP marker name,
AFLP primer combination (PC) used, estimated mobility (size in basepairs) and
the
parental origin of these 48 AFLP markers are:
AFLP Marker Size Parent Line
PC (bp)
Name
AI E331M50 596 Mol?'
A2 E33/M50 588 Mol7,Co~255
A3 E33/M50 580 B73,A7
A4 E33/M50 566 B73,Mo17,Co255,A7
AS E33/M50 526 B73,Mo17,~Co255
A6 E331M50 503 F2,DK105
A7 E33/M50 459 DK10S
A8 E33/M50 453 B73,DK105
A9 E33/M50 447 B73,Mo17,Co25.'>,DK105,A7
A10 E33/M50 434 Mo17,F2,C:o25S,
All E33/M50 424 F2,Co25'.i,A7
A12 E33/M50 416 B73,Mo17,F2,Co255,DK105,A7
C1 E33/M50 308 Mo17,F2,C:o255
C2 E33/M50 304 B73,Mo17,F2,Co255,DK105,A7
C3 E33/MS0 292 B73,Mo17,F2,DK105,A7
C4 E33/M50 290 B73,Mo17,F2,Co255,DK105,A7
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99/00743
48
C5 E33/M50 280 B73,Mo17,A7
C6 E33/M50 274 Mo17,F2,Co25:5,DK105
C7 E33/M50 269 DK10S
C8 E33/M50 264 B73,Mo17,F2.,DK105
C9 E33/M50 262 Mol7,Co:Z55
C10 E331M50 258 B73,A'l
C11 E33/M50 255 F2
C12 E33/M50 252 B73,Mo17,Co255,DKlO5,A7
E1 E33/M50 205 Moll
E2 E33/M50 204 F2
E3 E33/M50 202 B73,Mo17,A7
E4 E33/M50 201 F2
ES E33/M50 196 B73,Co2;55
E6 E33/M50 18I B73,A'7
E7 E33/M50 179 Moll
E8 E33/M50 171 DkIO_'~
E9 E33/M50 169 B73,A'7
E10 E33IM50 168 F2
E11 E33/M50 167 B73,F2,,A.7
E12 E33IMS0 161 F2
G1 E33/M50 131 Moll
G2 E33/M50 128 F2,DK10:>,A7
G3 E33/M50 127 B73,Mo17,F2,Co255
G4 E33IM50 124 B73,Mo17,Co255,DK105
GS E33/M50 121 B73
G6 E33/M50 113 Mo17,A7
G7 E33/M50 113 B73,DK105,A7
G8 E33/M50 111 A7
G9 E33/M50 109 F2,Co255
G10 E33/M50 109 Mo17,F2,C:o255
CA 02352476 2001-05-29
WO 00/34518 PCTINL99100743
49
G11 E33/M50 106 B73,Mo17,F2,DK105,A7
G12 E33/M50 103 B73,F2,Co255,I)K105,A7
The sequences the +2/+3 AFLP primers used to generate these 48 AFLP
markers are:
E33: EcoRf: 5' GACTGCGTACCAATTCAAG-3' (SEQ ID no:l9)
M50: Msel: 5'GATGAGTCCTGAGTAACAT-3' (SEQ ID no.20)
The AFLP reactions used to isolate the 48 A~FLP +3/+3 makers were
generated, excised, reamplified, purified, cloned and validated as described
in the
protocol of Example VI-1. The inserts of clones witch validated inserts were
sequenced using a standard dye terminator cycle sequencing kit (ABI) according
to
standard protocols supplied by the manufacturer.
Insert DNAs of individual validated clones 'were amplified from bacterial
stocks by PCR using either unlabelled vector primers or Cy3-labelled vector
primers
as described in Example VI-1.
PCR reactions were precipitated and dissolved as described in the protocol of
Example VI-1. Microarrays were prepared by depositing in duplo axound 250
picoliters (1 time spotting) or 1250 picoliters (5 times spotting) of either
the
unlabelled or the Cy3-labelled DNA solutions, processed and hybridized
according to
the protocol of Example VI-1. The target was a mixture of complete +2/+3
E33/M50
AFLP reactions of the parental lines B73 and F2, after labeling the B73 DNA
with
Cy5 dye (Amersham Pharmacia Biotec), and the F2 DNA with Cy3, by Klenow
enzyme according to standard procedures (see protocol enclosed). After washing
according to the protocol, the slide was scanned at the Cy5 and Cy3 channels
for 180
seconds each using a Genetac1000 microarray slide; scanner (Genomic Solutions,
Ann Arbor, MI).
The superimposed image of both channels is shown in Figure 5 with
annotation to facilitate interpretation of the spotting; pattern. Figure 5
shows:
1 ) uniform deposition of all AFLP probes (red, green or yellow signal of all
probes
on false-color image after hybridization).
CA 02352476 2001-05-29
WO 00/34518 PC'1'/1~TL99100743
2) specific hybridizatian of B73 target to expected AFLP probes A3, C5, E9, El
1,
G7, C 10, and E6 (Cy5 channel, green on false-color image);
3) Specific hybridisation of F2 target to expected AFLP probes A6, A8, Al l,
G7
and G10 (Cy3 channel, red on false-color image:);
5 4) Specific co-hybridization of B73 and F2 targets to expected probes A12,
C3, C4,
C8 and G12 (Cy5 and Cy3 channels, yellow on false-color image);
5) Strong non-specific cross-hybridisation to probEa A9, C7, G5, A8, C2, C6, C
12,
E8 and G8;
6) Weak non-specific cross-hybridisation to probes AI, El, G1, G12, A2, .A4
and
10 A10;
7) No hybridisation to probes C1, C11, G3, E2, E4, E10, E12, G2 and G4;
8) Specific lack of hybridization to the AFLP probes A1, A9, E1 and G6.
EXAMPLE IV-6. Detection of +2/+3 AFLP markers on an array cantaining'l l
15 arabidopsis +2/+3 AFLP markers.
Arrays of 11 Arabidopsis +2/+3 AFLP markers (probes) were prepared from
cloned AFLP markers generated using restriction enzymes EcoRI and MseI and
parental lines Columbia and Landsberg erecta. 'Che AFLP marker name, AFLP
primer combination (PC) used, estimated mobility (size in basepairs) and the
20 parental origin of these 11 AFLP markers are:
AFLP marker name PC Size (basepairs)
Parent Line
1. A3 E11/M62 560 Columbia.
25 2. AS E11/M62 512 Columbia.
3. A7 E 11/M62 426 Landsberg er.
4. A9 EI 1/M62 357 Landsberg er.
5. A 11 E 11 /M62 306 Landsberg er.
6. C1 E11IM62 274 Columbia.
30 7. C3 El1/M62 271 Columbia.
8. CS El 1/M62 207 Landsberg er.
CA 02352476 2001-05-29
WO 00/34518 PCT/1YL99100743
51
9. C7 E11/M62 171 Columbia.
I0. C9 El1/M62 163 Columbia.
11. C 11 E 11 /M62 153 Columbia.
The sequences of the +2/+3 AFLP primers used to generate these 11 AFLP
markers are:
E11: EcoRl: 5'-GACTGCGTACCAATTCAA-3' {SEQ ID no.21)
M62: lllsel: 5'-GATGAGTCCTGAGTAACTT-3' (SEQ ID no.22)
The method used to generate the 11 AFLP -~2/+3 markers and the preparation
and processing of the arrays containing these 11 Arabidopsis AFLP markers is
as
described in Example VI-I or protocols refered to in Example VI-1.
The arrays were hybridized with targets consisting of a Cy5-labelled AFLP
+2/+3 reaction derived Colombia or Landsberg erecta, which were prepared as
described in Example I. The AFLP used to generated the labelled target were
E11: 5'-
GACTGCGTACCAATTCAA-3' (SEQ ID no.23 )
and M62: 5'-GATGAGTCCTGAGTAACTT-3' (SEQ ID no.24). With this primer
combination, the parental line Columbia is known to contain the AFLP markers
A3,
A5, C 1, C3, C7, C9 and C 1 I and parental line Landsberg erecta is known to
contain
the AFLP markers A7, A9, A1 i and C5.
The array was washed according to the conaditians discribed in Example VI-1
or protocols refered to in Example VI-1. Folowing washing, images of the array
were
taken at the Cy3 and Cy5 channels with a 180 second exposure time for both
channels and the images were superimposed, as described in Example VI-1
(Figure
6). Figure 6A shows:
1) Specific hybridization of the Columbia AFLP markers A3, A5, C1, C3, C7, C9
and C I I (green signals on false-color image).
2) An anonymous Cy3,-labeled AFLP fragment at position A1 which marks the
start
position of the array (red signal on false-color image)
Figure 6B shows:
I) Specific hybridization of the Landsberg erecta AFLP markers A7, A9, AI 1
and
C5; (green signal on false-color image).
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99I00743
52
2) An anonymous Cy3-labeled AFLP fragment at position A1 which marks the start
position of the array (red signal on false-color image).
EXAMPLE g 21
VI-7. +1/+2
Detection
of
+2/+2
AFLP
markera
on
an
array
containin
tomato
cDNA-AFLP
fragments.
Arrays of 21 tomato cDNA fragments;
+11+2 (probes)
were prepared
from
cloned
cDNA-AFLP
fragments
using
restriction
en~:ymes
EcoRl
en
Msel
and
tomato
line
52201.
cDNA-AFLP reactions dlescribed (Vos
were carried out et al. Nucleic
as
Acids Research 23: 440'7-4414
and European Patent
Application EP 0534858).
AFLP marker name PC Size (basepairs) Parent
Line
1. B1 EOlIMI6 357 52201
2. B3 EO11M16 346 52201
3. BS EOI/M16 336 52201
4. B7 E01/M16 301 52201
5. B9 EO1/M16 284 52201
6. B 11 EO 1 /M 267 52201
16
7. Dl EOl/Ml6 175 52201
g, D3 E01/M16 159 52201
9. DS EO1/M16 136 52201
10. D7 E011M16 128 . 52201
I 1. D9 E01 /M 122 52201
16
12. DI1 E01/M16 110 52201
13. F3 E01/M17 310 52201
14. FS E01/Ml7 264 52201
15. F7 EOl/M17 259 52201
I 6. F9 E01IM 17 23 8 52201
17. F11 E01/M17 208 52201
18. H3 E01/M17 139 52201
CA 02352476 2001-05-29
WO 00/34518 PCT/NL99100743
53
19. HS E01/M17 I31 52201
20. H9 E01 /M 17 114 52201
21. H11 EO1/M17 103 52201
The sequences of the +1l+2 AFLP primers generate these
cased to cDNA-
AFLP fragments are:
EcoRI: EOI : S'-GACTGCGTACCAATTCA-3' (SEQ ID no. 25)
Msel: M16: 5'-GATGAGTCCTGAGTAAC;C-3' {SEQ ID no.26)
Msel: M17: 5'-GATGAGTCCTGAGTAAC;G-3' (SEQ ID no.27)
The cDNA-AFLP reactions used to isolate the 21 +1/+2 fragments were
generated and resolved on sequence gels using the :>tandard procedure. Arrays
were
prepared according to the procedures described in F?XAMPLE VI-1. cDNA-AFLP
fragments were spotted in dupla as described in Example VI-1.
The slides were processed according to standard procedures (see protocol
enclosed) and hybridised overnight at 45°C temperature with Cy3-labeled
+2/+3
AFLP reactions (targets) of the following six tomato lines:
1. Lycopersicon Esculentum (L. esc.) accession Moneyberg
2. L. Peruvianum accession LA1708
3. L. Hirsutum 61209
4. L. Chmielevski LA1848
5. L. Pimpinellifolium LA722
6. L .Pennelli LA716
The sequences of the AFLP primers involved are E12 {5'-
GACTGCGTACCAATTCAC-3', SEQ ID no. 28) and MI6 (sequence given above,
SEQ ID no.26). Labelling with Cy3 dye {Amersha~n Pharmacia Biotec) by Klenow
enzyme was carried out according to standard procedures as described in
Example
VI-I . After washing according to the protocol, the slides were scanned at the
Cy3
channel in the automatic exposure mode using a Genetac1000 microarray slide
scanner. The images of all six hybridisations are shown in Figure 7 (A-F) with
CA 02352476 2001-05-29
WO 00134518 PCTlNL99100743
54
annotation to facilitate interpretation of the spotting pattern. Figure 7
shows:
I) Hybridisation of all lines with cDNA-AFLP probes BS and BI 1.
2) Hybridisation of L. esc. Moneyberg, L. Hirsuturn, L. Pimpinellifalium, L.
Pennelli
with cDNA-AFLP probe D7 {circled).
3) No hybridisation of L: Peruvianum, L. Chmielevski with cDNA-AFLP probe D7.
4) Signal of Cy3-labelled anonymous cDNA-AFLl' fragments deposited at
positions
B 1 and H I 1 to serve as a marker for the position of the array on the slide.
EXAMPLE VI-8: Detection of rice AFLP markers amplified in a +2/+3 AFLP
reaction on an array containing 5 rice +2/+3 AFLP rmarkers and 5 sets of
oligo's
corresponding to these 5 rice +21+3 AFLP markers.
An array containing 5 rice AFLP markers (~~robes) labeled with Cy3 and 5
sets of oligo's corresponding to these AFLP markers was prepared as described
in
Example VI-1 using 5 of the AFLP markers as described in Example VI-I. The
oligo
sets, consisting of 2 complementary oligo's, corresponding to these AFLP
markers
are stated below.
AFLP markernumber Forward oligo name Reverse oligo name
2 99f03 994
4 99f07 998
6 99f11 99f12
8 99f69 99f70
10 99f19 99f20
Oligoname Oligo sequence
99fl~3 5'-GTCCTCATCAAGTAATAGTCAG-3' (SEQ ID no.29)
99f04 S'-CTGACTATTACTTGATGAGGAC-3' (SEQ ID no.30)
99fl~7 S'-CTTGATCAGGAAGACTTTAC',TC-3' (SEQ ID no.31
)
998 5'-GAGTA.AAGTCTTCCTGATCA,AG-3' (SEQ ID no.32)
99f1 5'-CTTCATTTATCCTCGATACA'FG-3' (SEQ ID no.33)
I
99f12 5'-CATGTATCGAGGATAAATGAAG-3' (SEQ ID no.34)
CA 02352476 2001-05-29
WO 00134518 PC'rINL99100743
SS
99f69 S'-GGCAATGCAAGTAGATACTT'C-3' (SEQ ID no.3S)
99f70 S'-GAAGTATCTACTTGCATTGCC-3 (SEQ ID no.36)
99f19 S'-CAGTGTGCTAGTTGATTCCAG-3' (SEQ ID no.37)
99f20 S'-CTGGAATCAACTAGCACACT'G-3' {SEQ ID no.38}
S
The array was processed as described and hybridized with a target, consisting
of a mixture of equal volumes of CyS-labelled AFL,P +2/+3 reactions (target)
derived
from the parental lines IR20 and 6383, prepared with AFLP primers El l and
M49.
Thus in the labeled target one of the strands of the AFLP +2/+3 reaction
fragments is
labeled with CyS. The mixture of parental lines IR2;0 and 6383 is known to
contain
AFLP markers 6, 8 and 10 as described in Example; VI-1. The array was washed
according to the conditions as described in Example VI-1 or protocols referred
to in
Example VI-1.
Following washing, images were taken at tl!~e Cy3 (Figure 8B} and CyS
1 S (Figure 8C) channels both at 180 seconds exposure time and the two images
were
superimposed electronically (Figure 8A). The superimposed image of both
channels
is shown in Figure 8A with annotation to facilitate interpretation of the
spotting
pattern. Figure 8 shows:
1 ) uniform deposition of all AFLP probes (red, green or yellow on false-color
image
after hybridization).
2) specific hybridization to AFLP markers 6, 8 and 10; CyS, green on false-
color
image).
3) specific hybridization to reverse sequence oligo's corresponding to the
unlabeled
strand of the AFLP markers 6, 8 and 10; CyS; green on false-color image).
2S 4) No hybridisation to the forward sequence oligo's corresponding to the
labeled
strand of the AFLP markers 6, 8 and 10.
S) No hybridization to AFLP markers or oligo's corresponding to AFLP markers 2
and 4.
