Note: Descriptions are shown in the official language in which they were submitted.
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
TITLE
BIS-AMINO ACID SULFONAMIDES CONTAINING N-TERMINALLY A SUBSTITUTED BENZYL GROUP
AS HIY PROTEASE INHIBITORS
FIELD OF THE INVENTION
This invention relates generally to bas-amino acid sulfonamides containing
substituted benzyl amines useful as HIV protease inhibitors, pharmaceutical
compositions
and diagnostic kits comprising the same, and methods of using the same for
treating viral
infection or as assay standards or reagents.
BACKGROUND OF THE INVENTION
Two distinct retroviruses, human immunodeficiency virus (HIV) typ~l (H1V-I) or
type-2 (HIV-2), have been etiologically linked to the immunosuppressive
disease, acquired
immunodeficiency syndrome (AIDS). HIV seropositive individuals are initially
asymptomatic but typically develop AIDS related complex (ARC) followed by
AIDS.
Affected individuals exhibit severe immunosuppression which predisposes them
to
debilitating and ultimately fatal opportunistic infections.
The disease AIDS is the end result of an HIV-1 or HIV-2 virus following its
own
complex life cycle. The virion life cycle begins with the virion attaching
itself to the host
human T-4 lymphocyte immune cell through the bonding of a glycoprotein on the
surface
of the virion's protective coat with the CD4 glycoprotein on the lymphocyte
cell. Once
attached, the virion sheds its glycoprotein coat, penetrates into the membrane
of the host
cell, and uncoats its RNA. The virion enzyme, reverse transcriptase, directs
the process of
transcribing the RNA into single-stranded DNA. The viral RNA is degraded and a
second
DNA strand is created. The now double-stranded DNA is integrated into the
human cell's
genes and those genes are used for virus reproduction.
At this point, RNA polymerise transcribes the integrated DNA into viral RNA.
The viral RNA is translated into the precursor gag pol fusion polyprotein. The
polyprotein is then cleaved by the HIV protease enzyme to yield the mature
viral proteins.
Thus, H1V protease is responsible for regulating a cascade of cleavage events
that lead to
the virus particle's maturing into a virus that is capable of full
infectivity.
The typical human immune system response, killing the invading virion, is
taxed
because the vinzs infects and kills the immune system's T cells. In addition,
viral reverse
transcriptase, the enzyme used in making a new virion particle, is not very
specific, and
causes transcription mistakes that result in continually changed glycoproteins
on the
surface of the viral protective coat. This lack of specificity decreases the
immune system's
effectiveness because antibodies specifically produced against one
glycoprotein may be
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
useless against another, hence reducing the number of antibodies available to
fight the
virus. The virus continues to reproduce while the immune response system
continues to
weaken. Eventually, the HIV largely holds free reign over the body's immune
system,
allowing opportunistic infections to set in and without the administration of
antiviraI
agents, immunomodulators, or both, death may result.
There are at least three critical points in the virus's life cycle which have
been
identified as possible targets for antiviral drugs: (I) the initial attachment
of the virion to
the T-4 lymphocyte or macrophage site, (2) the transcription of viral RNA to
viral DNA
(reverse transcriptase, RT), and (3) the processing of gag-pol protein by HIV
protease.
I O The genomes of retroviruses encode a protease that is responsible for the
proteolytic processing of one or more polyprotein precursors such as thepol
and gag gene
products. See Wellink, Arch. Virol. 98 I ( 1988). Retroviral proteases most
commonly
process the gag precursor into the core proteins, and also process the pol
precursor into
reverse transcriptase and retroviral protease.
The correct processing of the precursor polyproteins by the retroviral
protease is
necessary for the assembly of the infectious virions. It has been shown that
in vitro
mutagenesis that produces protease-defective virus leads to the production of
immature
core forms which lack infectivity. See Crawford et al., J. Virol. 53 899
(1985); Katoh et
al., Virology 145 280 ( 1985). Therefore, retroviral protease inhibition
provides an
attractive target for antiviral therapy. See Mitsuya, Nature 325 775 ( 1987).
As evidenced by the protease inhibitors presently marketed and in clinical
trials, a
wide variety of compounds have been studied as potential HIV protease
inhibitors. One
core, hydroxyethylamino-sulfonamides, has received significant attention. For
example,
PCT Applications W094/05639, W094/04492, W095/06030, and W096/28464
generically describe sulfonamides of the formula:
R~N~N ~S Ra
R, _ H
OH
and methods of preparing them. Though some of the present compounds appear to
fall
within the generic descriptions of some of the above publications, they are
not specifically
disclosed, suggested, or claimed therein.
Even with the current success of protease inhibitors, it has been found that
HIV
patients can become resistant to a single protease inhibitor. Thus, it is
desirable to develop
additional protease inhibitors to further combat HIV infection.
2
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
SUMMARY OF THE INVENTION
Accordingly, one object of the present invention is to provide novrel protease
inhibitors.
It is another object of the present invention to provide a novel method for
treating
HIV infection which comprises administering to a host in need of such
treatment a
therapeutically effective amount of at least one of the compounds of the
present invention
or a pharmaceutically acceptable salt form thereof.
It is another object of the present invention to provide a novel method for
treating
HIV infection which comprises administering to a host in need thereof a
therapeutically
effective combination of (a) one of the compounds of the present invention and
(b) one or
more compounds selected form the group consisting of HIV reverse transcriptase
inhibitors and HIV protease inhibitors.
It is another object of the present invention to provide pharmaceutical
compositions with protease inhibiting activity comprising a pharmaceutically
acceptable
carrier and a therapeutically effective amount of at least one of the
compounds of the
present invention or a pharmaceutically acceptable salt form thereof.
It is another object of the present invention to provide a method of
inhibiting HIV
present in a body fluid sample which comprises treating the body fluid sample
with an
effective amount of a compound of the present invention.
It is another object of the present invention to provide a kit or container
containing
at least one of the compounds of the present invention in an amount effective
for use as a
standard or reagent in a test or assay for determining the ability of a
potential
pharmaceutical to inhibit HIV protease, HIV growth, or both.
These and other objects, which will become apparent during the following
detailed
description, have been achieved by the inventors' discovery that compounds of
formula
(I):
i
H g
~ v~s~ 3
R %~ H U H OH R
R2
wherein R~, R2, and R3 are defined below, stereoisomeric forms, mixtures of
stereoisomeric forms, or pharmaceutically acceptable salt forms thereof, are
effective
protease inhibitors.
3
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
( 1 ] Thus, in a first embodiment, the present invention provides a novel
compound of
Formula I:
H O
\
R~ l / H O
R2~
s
or a pharmaceutically acceptable salt form thereof, wherein:
R1 is F;
R2 is F or H; and,
R3 is selected from the group: 4-aminophenyl, 3-aminophenyl, 2,3-
dihydrobenzofuran-s-
yl, and 1,3-benzodioxol-s-yl.
Is
[2] In a preferred embodiment, the present invention provides a novel compound
of
Formula II:
/I
F \ N N\/tN AS R3
/ H O H OH
R2 ~ '1~
II.
[3] In a more preferred embodiment, the present invention provides a novel
compound of
Formula IIa:
v
H
F \ N~IV N N-S~R3
I / H O H OH
2s Ila.
q
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
[4] In an even more preferred embodiment, the present invention provides a
novel
compound of Formula IIa, wherein:
S
R3 is 3-aminophenyl.
[5] In another even more preferred embodiment, the present invention provides
a novel
compound of Formula IIa, wherein:
R3 is 4-aminophenyl.
[6] In another even more preferred embodiment, the present invention provides
a novel
compound of Formula IIa, wherein:
R3 is 2,3-dihydrobenzofuran-S-yl or 1,3-benzodioxol-S-yl.
[7] In another more preferred embodiment, the present invention provides a
novel
compound of Formula IIb:
H~ v0'~ ~O
F I % H~N H N~S~R3
OH
F
IIb.
[8] In another even more preferred embodiment, the present invention provides
a novel
compound of Formula IIb, wherein:
R3 is 3-aminophenyl.
5
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
[9] In another even more preferred embodiment, the present invention provides
a novel
compound of Formula IIb, wherein:
R3 is 4-aminophenyl.
[ 10] In another even more preferred embodiment, the present invention
provides a novel
compound of Formula IIb, wherein:
R3 is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-S-yl.
[ 1 1 ] In another more preferred embodiment, the present invention provides a
novel
compound of Formula IIc:
H~ O ~ Ow .O
F ~ N~N~N N'S'R3
i H O H OH
F
IIc.
[ 12] In another even more preferred embodiment, the present invention
provides a novel
compound of Formula IIc, wherein:
R3 is 3-aminophenyl.
[13] In another even more preferred embodiment, the present invention provides
a novel
compound of Formula IIc, wherein:
R3 is 4-aminophenyl.
[ 14] In another even more preferred embodiment, the present invention
provides a novel
compound of Formula IIc, wherein:
6
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
R3 is 2,3-dihydrobenzofuran-5-yl or 1,3-benzodioxol-5-yl.
[ 15] In another preferred embodiment, the present invention provides a novel
compound
of Formula III:
v O
w N N~N ~S~ 3
N R
H O ~ H OH
R2
III.
[ 16) In another more preferred embodiment, the present invention provides a
novel
compound of Formula IIIa:
w N N~N vvS O 3
~ N. .R
i H cJ H OH
F
IIIa.
[ 17] In another preferred embodiment, the present invention provides a novel
compound
of Formula IV:
v Ct O
N~II Nv 'N N S~R3
~H~ H pH
F R2
IV.
[ 18) In another more preferred embodiment, the present invention provides a
novel
compound of Formula IVa:
7
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
O
~s p
. . Rs
O OH
F
IVa.
S In another embodiment, the present invention provides a novel
pharniaceutical
composition comprising a pharmaceutically acceptable carrier and a
therapeutically
effective amount of a compound of formula I or pharmaceutically acceptable
salt form
thereo f.
In another embodiment, the present invention provides a novel method for
treating
HIV infection which comprises administering to a host in need of such
treatment a
therapeutically effective amount of a compound of formula I or
pharmaceutically
acceptable salt form thereof.
1S
In another embodiment, the present invention provides a novel method of
treating
HIV infection which comprises administering, in combination, to a host in need
thereof a
therapeutically effective amount of:
(a) a compound of formula I; and,
(b) at least one compound selected from the group consisting of HIV reverse
transcriptase inhibitors and HIV protease inhibitors.
2S In another preferred embodiment, the reverse transcriptase inhibitor is
selected
from the group AZT, ddC, ddI, d4T, 3TC, delavirdine, efavirenz, nevirapine, Ro
18,893,
trovirdine, MKC-442, HBY 097, ACT, UC-781, UC-782, RD4-2025, and MEN 10979,
and the protease inhibitor is selected from the group saquinavir, ritonavir,
indinavir,
amprenavir, nelfuiavir, palinavir, BMS-232623, GS3333, KNI-413, KNI-272, LG-
71350,
CGP-bl7SS, PD 173606, PD 177298, PD 178390, PD I78392, U-140690, and ABT-378.
8
CA 02353088 2001-05-29
WO 00/42060 PCTNS00/00820
In an even more preferred embodiment, the reverse transcriptase inhibitor is
selected from the group AZT, efavirenz, and 3TC and the protease inhibitor is
selected
from the group saquinavir, ritonavir, nelfinavir, and indinavir.
In a still further preferred ebodiment, the reverse transcriptase inhibitor is
AZT.
In another still further preferred embodiment, the protease inhibitor is
ritonavir.
In another preferred embodiment, component (b) is a HIV reverse transcriptase
inhibitor and a HIV protease inhibitor.
In another preferred embodiment, component (b) is two different HIV reverse
transcriptase inhibitors.
In another embodiment, the present invention provides a pharmaceutical
composition useful for the treatment of HIV infection, which comprises a
therapeutically
effective amount of:
(a) a compound of formula I; and,
(b) at least one compound selected from the group consisting of HIV reverse
transcriptase inhibitors and HIV protease inhibitors, in one or more sterile
containers.
In another embodiment, the present invention provides a novel method of
inhibiting HIV present in a body fluid sample which comprises treating the
body fluid
sample with an effective amount of a compound of formula I.
In a ninth embodiment, the present invention to provides a novel a kit or
container
comprising a compound of formula I in an amount effective for use as a
standard or
reagent in a test or assay for determining the ability of a potential
pharmaceutical to inhibit
HIV protease, HIV growth, or both.
9
CA 02353088 2001-05-29
WO 00/42060 PCTNSOOl00820
DEFINITIONS
As used herein, the following terms and expressions have the indicated
meanings.
It will be appreciated that the compounds of the present invention contain
asymmetrically
substituted carbon atoms, and may be isolated in optically active or racemic
forms. It is
well known in the art how to prepare optically active forms, such as by
resolution of
racemic forms or by synthesis, from optically active starting materials. All
chiral,
diastereomeric, racemic forms and all geometric isomeric forms of a structure
are
intended, unless the specific stereochemistry or isomer form is specifically
indicated.
The processes of the present invention are contemplated to be practiced on at
least
a multigram scale, kilogram scale, multikilogram scale, or industrial scale.
Multigram
scale, as used herein, is preferably the scale wherein at /east one starting
material is present
in 10 grams or more, more preferably at least 50 grams or more, even more
preferably at
least 100 grams or more. Multikilogram scale, as used herein, is intended to
mean the
scale wherein more than one kilogram of at least one starting material is
used. Industrial
scale as used herein is intended to mean a scale which is other than a
laboratory scale and
which is sufficient to supply product sufficient for either clinical tests or
distribution to
consumers.
The present invention is intended to include all isotopes of atoms occurring
on the
present compounds. Isotopes include those atoms having the same atomic number
but
different mass numbers. By way of general example and without limitation,
isotopes of
hydrogen include tritium and deuterium. Isotopes of carbon include C-13 and C-
14.
As used herein, "HIV reverse transcriptase inhibitor" is intended to refer to
both
nucleoside and non-nucleoside inhibitors of HIV reverse transcriptase (RT).
Examples of
nucleoside RT inhibitors include, but are not limited to, AZT, ddC, ddI, d4T,
and 3TC.
Examples of non-nucleoside RT inhibitors include, but are not limited to,
delavirdine
(Pharmacia and Upjohn, U90152S), efavirenz (DuPont), nevirapine (Boehringer
Ingelheim), Ro 18,893 (Roche), trovirdine (Lilly), MKC-442 (Triangle), HBY 097
(Hoechst), HBY 1293 (Hoechst), ACT (Korean Research Institute), UC-781 (Raga
Institute), UC-782 (Raga Institute), RD4-2025 (Tosoh Co. Ltd.), and MEN 10979
(Menarini Farmaceutici).
As used herein, "HIV protease inhibitor" is intended to refer to compounds
which
inhibit HIV protease. Examples include, but are not limited, saquinavir
(Roche,
Ro31-8959), ritonavir (Abbott, ABT-538), indinavir (Merck, MK-639), amprenavir
(Vertex/Glaxo Wellcome), nelfinavir (Agouron, AG-1343), palinavir (Boehringer
Ingelheim), BMS-232623 (Bristol-Myers Squibb), GS3333 (Gilead Sciences), KNI-
413
(Japan Energy), KNI-272 (Japan Energy), LCi-71350 (LG Chemical), CGP-61755
(Ciba-Geigy), PD 173606 (Parka Davis), PD 1772.98 (Parka Davis), PD 178390
(Parka
CA 02353088 2001-05-29
WO 00/42060 ~ PCTNS00/00820
Davis), PD 178392 (Parke Davis), tipranavir (Pharmacia and Upjohn, U-140690),
DMP-
450 (DuPont) and ABT-378.
As used herein, "pharmaceutically acceptable salts" refer to derivatives of
the
disclosed compounds wherein the parent compound is modified by making acid or
base
salts thereof. Examples of pharmaceutically acceptable salts include, but are
not limited
to, mineral or organic acid salts of basic residues such as amines; alkali or
organic salts of
acidic residues such as carboxylic acids; and the like. The pharmaceutically
acceptable
salts include the conventional non-toxic salts or the quaternary ammonium
salts of the
parent compound formed, for example, from non-toxic inorganic or organic
acids. For
example, such conventional non-toxic salts include those derived from
inorganic acids
such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric and
the like; and
the salts prepared from organic acids such as acetic, propionic, succinic,
glycolic, stearic,
lactic, malic, tartaric, citric, ascorbic, pamoic, malefic, hydroxymaleic,
phenylacetic,
glutamic, benzoic, salicylic, sulfanilic, 2-acetoxybenzoic, fumaric,
toluenesulfonic,
I S methanesulfonic, ethane disulfonic, oxalic, isethionic, and the like.
The pharmaceutically acceptable salts of the present invention can be
synthesized
from the parent compound which contains a basic or acidic moiety by
conventional
chemical methods. Generally, such salts can be prepared by reacting the free
acid or base
forms of these compounds with a stoichiometric amount of the appropriate base
or acid in
water or in an organic solvent, or in a mixture of the two; generally,
nonaqueous media
like ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are
preferred. Lists of
suitable salts are found in Remington's Pharmaceutical Sciences, 17th ed.,
Mack
Publishing Company, Easton, PA, 1985, p. 1418, the disclosure of which is
hereby
incorporated by reference.
The phrase "pharmaceutically acceptable" is employed herein to refer to those
compounds, materials, compositions, and/or dosage forms which are, within the
scope of
sound medical judgment, suitable for use in contact with the tissues of human
beings and
animals without excessive toxicity, irritation, allergic response, or other
problem or
complication commensurate with a reasonable benefit/risk ratio.
"Prodrugs" are intended to include any covalently bonded carriers which
release
the active parent drug according t~ formula (I) or other formulas or compounds
of the
present invention in vivn when such prodrug is administered to a mammalian
subject.
Prodrugs of a compound of the present invention, for example formula (I), are
prepared by
modifying functional groups present in the compound in such a way that the
modifications
are cleaved, either in routine manipulation or in vivo, to the parent
compound. Prodrugs
include compounds of the present invention wherein the hydroxy or amino group
is
bonded to any group that, when the prodrug is administered to a mammalian
subject,
cleaves to form a free hydroxyl or free amino, respectively. Examples of
prodrugs include,
CA 02353088 2001-05-29
WO OOI42060 PCT/US00/00820
but are not limited to, acetate, formate and benzoate derivatives of alcohol
and amine
functional groups in the compounds of the present invention, and the like.
"Stable compound" and "stable structure" are meant to indicate a compound that
is
sufficiently robust to survive isolation to a useful degree of purity from a
reaction mixture,
and formulation into an efficacious therapeutic agent. Only stable compounds
are
contempleted by the present invention.
"Substituted" is intended to indicate that one or more hydrogens on the atom
indicated in the expression using "substituted" is replaced with a selection
from the
indicated group(s), provided that the indicated atom's normal valency is not
exceeded, and
that the substitution results in a stable compound. When a substituent is keto
(i.e., =O)
group, then 2 hydrogens on the atom are replaced.
"Therapeutically effective amount" is intended to include an amount of a
compound of the present invention or an amount of the combination of compounds
claimed effective to inhibit HIV infection or treat the symptoms of HIV
infection in a host.
The combination of compounds is preferably a synergistic combination. Synergy,
as
described for example by Chou and Talalay, Adv. Enzyme Regul. 22:27-55 (1984),
occurs
when the effect (in this case, inhibition of HIV replication) of the compounds
when
administered in combination is greater than the additive effect of the
compounds when
administered alone as a single agent. In general, a synergistic effect is most
clearly
demonstrated at suboptimal concentrations of the compounds. Synergy can be in
terms of
lower cytotoxicity, increased antiviral effect, or some other beneficial
effect of the
combination compared with the individual components.
One diastereomer of a compound of Formula I may display superior activity
compared with the other. When required, separation of the racemic material can
be
achieved by HPLC using a chiral column or by a resolution using a resolving
agent such as
camphonic chloride as in Thomas J. Tucker, et al, J. Med. Chem. 1994, 37, 2437-
2444. A
chiral compound of Formula I may also be directly synthesized using a chiral
catalyst or a
chiral ligand, e.g. Mark A. Huffman, et al, J. Org. Chem. 1995, 60, 1590-1594.
Other features of the invention will become apparent in the course of the
following
descriptions of exemplary embodiments which are given for illustration ofthe
invention
and are not intended to be limiting thereof.
Examples
Abbreviations used in the Examples are defined as follows: "°C" for
degrees
Celsius, "d" for doublet, "dd" for doublet of doublets, "eq" for equivalent or
equivalents,
"g" for gram or grams, "mg" for milligram or milligrams, '°mL" for
milliliter or milliliters,
"H" for hydrogen or hydrogens, "hr" for hour or hours, "m°' for
multiplet, "M" for molar,
"min°' for minute or minutes, "MHz" for megahertz, "MS" for mass
spectroscopy, "nmr" or
12
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
"NMR" for nuclear magnetic resonance spectroscopy, "t" for triplet, and "TLC"
for thin
layer chromatography.
Example 1
O
N NH ~ O
OH
~ ~Oxalate
1A 18
~i
° ° ~ o
\ °~N .~
H N N~O
_ H
OH
1C 1D
O
O O O
H2Nv 'N N' _O C N~N N
> = H _ H
OH -"~ O ~ OH
1F
O
H
> C N v _H NH
OH
~HCI
1G
13
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
H
lI N _ H N~S 1 / N02
O ~ OH
1H
H~ ~' o, P
H~N _ H N~S ' / N02
O ~ OH
F
11
H OJJ,,~~
~NV ' ,S
H [[ _ H N / NH2
O ~ OH
F
~2HC1
1B To a solution of N-[3(S)-[N,N-bis{phenylmethyl)amino]-2(R)-hydroxy-4-
phenylbutyl]-N-isobutylamine~oxalic acid salt lA (127.6 g, 2S1 mmol) in
toluene (1 L),
water (500 mL) and CHZC12 (400 mL) was added NaOH (SO% aqueous, 44.5 g). After
stirring 10 min the reaction mixture was extracted with toluene. The combined
organic
layers were washed with brine, dried (MgS04) and the solvent was removed under
reduced
pressure. The residue was taken up in THF ( 1 L), cooled to 0 °C, and
was treated with
triethylamine {28.1 S g, 278 mmol) and di-tert-butyl dicarbonate {55.23 g, 2S3
mmol). The
solution was warmed to room temperature and was stirred overnight. The solvent
was
removed under reduced pressure and the residue was taken up in EtOAc ( 1 L),
washed
with water, S% citric acid, water, saturated NaHC03, brine, and was dried
(MgS04). The
solvent was removed under reduced pressure to give the carbamate I B which was
used
directly without further purification. CIMS (NH3) m/z: S 17 (M+H+, l00%)
1S
1C To a solution of crude 1B (2S 1 mrnol possible) in methanol (S00 mL) was
added
palladium hydroxide on carbon (20%, 10 g). The suspension was placed in a parr
bottle
and was charged with hydrogen (SS psi). After shaking overnight the reaction
mixture was
filtered through Celite and the solvent was removed under reduced pressure.
The resulting
solid was recrystallized (EtOAc/hexane) to give the amine 1C as a white solid
(56.6 g,
67% (2 steps)): CIMS (NH3) m/z: 337 (M+H+, I00%)
14
CA 02353088 2001-05-29
WO 00/42060 PCT/"~JS00/00820
1D To a solution of N-carbobenzyloxy-L-tert-leucine (47.5 g, 179 mmoI) in DMF
(250
mL) at 0 °C was added N-hydroxybenzotriazole (38.6 g, 285 mmol) and EDC
(35.7 g, 186
mmol). After stirring 1.5 hours the solution was added to a suspension of 1C
(56.6 g, 167
mmol) and 4-methylmorpholine (52.9 g, 521 mmol) in DMF (200 mL). The reaction
mixture was allowed to warm to room temperature. After stirring overnight N,N-
dimethylethylenediamine (4 mL) was added, the solution was stirred 1.5 hours
and the
solvent was removed under reduced pressure. The residue was taken up in EtOAc
( 1 L),
washed with water, S% citric acid, water, saturated NaHC03, brine, and was
dried
(MgS04). The solvent was removed under reduced pressure to give 1D (97.5 g,
100%)
I 0 which was used without further purification. CIMS (NH3) m/z: 584 (M+H+,
100%)
lE To a solution of ID (97.5 g, 167 mmol) in methanol (300 mL) was added
palladium
hydroxide on carbon (20%, 10 g). The suspension was placed in a part bottle
and was
charged with hydrogen (SSpsi). After shaking overnight the reaction mixture
was filtered
through Celite and the solvent was removed under reduced pressure. The
resulting solid
was recrystallized (EtOAc/hexane) to give the amine lE as a white solid (72.8
g, 97%):
CIMS (NH3} m/z: 450 (M+H+, 100%)
IF To a solution of amine lE (43.8 g, 97.6 mmol) in EtOAc (400 mL} and water
(270
mL) was added KHC03 (27.7 g, 276 mmol) and cloroacetyl chloride (12.4 g, 111
mmol).
After stirring 3 hours, EtOAc (1 L) was added and the solution was washed with
water,
5% citric acid, water, saturated NaHC03, brine, and was dried (MgS04). The
solvent was
removed under reduced pressure to give 1F as a white solid (51.0 g, 99%): CIMS
(NH3)
m/z: 526 (M+H+, 100%)
1G To a solution of IF (33.8 g, 64.2 mmoI) in EtOAc (600 mL) was added 4N HCl
in
dioxane (80 mL, 320 mmol) and the reaction mixture was stirred 6 hours. The
solvent was
removed under reduced pressure and the resulting solid was triturated with
cold ether to
give the hydrochloride salt 1G (28.75 g, 97%): CIMS (NH3) m/z: 426 (M+H+,
100%)
1 H To a solution of the salt 1 G (32.0 g, 69.2 mmol) in THF (350 mL) and
water (450
mL) was added KZC03 (56.7 g, 4I 1 mmol) and 4-nitrobenzenesulfonyl chloride
(16.9 g,
76.0 mmoI). After storing 4 hours, water was added and the suspension was
extracted
with EtOAc. The combined organic layers were washed with brine, 5% citric
acid, water,
saturated NaHC03, brine, and was dried (MgS04). The solvent was removed under
reduced pressure and the resulting solid was recrystallized (EtOAc/hexane) to
give the
sulfonamide 1H as a white solid (35.8 g, 85%). CIMS (NH3) m/z: 611 (M+H+,
100%).
IS
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
lI To a solution of the chloride 1H (16.0 g, 26.1 mmol) in THF (200 mL) was
added 3-
fluorobenzylamine (20.0 g, 160 mmol) and the reaction mixture was refluxed
overnight.
The solvent was removed under reduced pressure and the residue was taken up in
EtOAc
and was washed with water, brine, and dried (MgS04). The solvent was removed
under
reduced pressure and the residue was chromatographed (silica gel, 4%
methanol/CHZC12)
to give the amine l I as a white solid ( 16.3 g, 89%). CIMS (NH3) m/z: 700
(M+H+,
I 00%).
1 To a solution of lI (14.6 g, 20.8 mmol) in methanol (500 mL) was added
palladium
hydroxide on carbon (20%, 1.5 g) and the reaction mixture was charged with
hydrogen.
After stirring 3 hours, the mixture was filtered through Celite and the
solvent was removed
under reduced pressure. The residue was chromatographed (silica gel, 5%
methanol/CH2C12) to give the amine as a white solid ( 13.2 g, 95%). To a
solution of the
freebase ( 11.68 g, 17.4 mmol) in ether (300 mL) and EtOAc ( 100 mL) was added
1 N HCl
1 S in ether (37 mL, 37 mmol). The resulting suspension was stirred I S min
and was filtered
to give the bis-hydrochloride salt 1 as a white solid (12.5 g, 96%): CIMS
(NH3) m/z: 670
(M+H+, 100%).
Example 2
F O w
w
1H --~ ~ ~ N~N~N N.S t
H H ~ N02
O ~ OH
F
2A
F O
N ~ ~S O w
.-.~
~ H~ ~H N I / NH2
F O'' ~ OH
~2HC1
2
2A To a solution of the chloride 1H (16.0 g, 26.1 mmol) in THF (200 mL) was
added
3,5-difluorobenzylamine (25.0 g, 174 mmol) and the reaction mixture was
refluxed
overnight. The solvent was removed under reduced pressure and the residue was
taken up
in EtOAc and was washed with water, brine, and dried (MgS04). The solvent was
removed under reduced pressure and the residue was chromatographed (silica
gel, 4%
16
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
methanol/CHZCl2) to give the amine 2A as a white solid ( 1 S.2 g, 8 I %). CIMS
(NH3) m/z:
718 (M+I-I+, 100%).
2 To a solution of 2A ( I S.2 g, 21.2 mmol) in methanol (S00 mL) was added
palladium
S hydroxide on carbon (20%, I.S g) and the reaction mixture was charged with
hydrogen.
After stirring 4 hours, the mixture was filtered through Celite and the
solvent was removed
under reduced pressure. The residue was chromatographed (silica gel, S%
methanol/CH2CI2) to give the amine as a white solid (10.3 g, 71 %). To a
solution of the
freebase in ether (300 mL) and EtOAc (100 mL) was added IN HCl in ether (32
mL, 32
mmol). The resulting suspension was stirred I S min and was filtered to give
the bis
hydrochloride salt 2 as a white solid: CIMS (NH3) m/z: 688 (M+1-1+, 100%).
Example 3
F O \_
1 H ----~ ~ ~ N N~ N ~S~
H ~ H I / N02
O ~ OH
3A
F O \
H
N
H~ H N , / NH2
O ~ OH
F
~2HC1
3
IS
3A To a solution of the chloride 1H (300 mg, 0.49 mmol) in THF (4 mL) was
added 2,5-
difluorobenzylamine (1.2 g, 8.S mmol) and the reaction mixture was refluxed 4
hours.
The reaction mixture was diluted with EtOAc and was washed with water, brine,
and dried
(MgS04). The solvent was removed under reduced pressure and the residue was
chromatographed (silica gel, S% methanol/CHzCl2) to give the amine 3A as a
white solid
(270 mg, 77%). CIMS (NH3) m/z: 7I8 (M+H+, I00%)
3 To a solution of 3A (260 mg, 0.36 mmol) in methanol (2S mL) was added
palladium
hydroxide on carbon (20%, SO mg) and the reaction mixture was charged with
hydrogen.
2S After stirring I hour, the mixture was filtered through Celite and the
solvent was removed
17
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
under reduced pressure. The residue was chromatographed (silica gel, S%
methanol/CHZCIZ) to give the amine as a white solid (226 mg, 91 %). To a
solution of the
freebase in ether (30 mL) and EtOAc { I 0 mL) was added 4N HCl in dioxane (0.2
mL, 0.8
mmol). The resulting suspension was stirred I S min and was filtered to give
the bis-
hydrochloride salt 3 as a white solid: CIMS (NH3) m/z: 688 (M+H+, 100%).
Example 4
F O \
N ~ OSO w
1H -= / \ H ~H N' ~ / NOZ
OH
F
4A
F
H O
O~ ,O
N S
.-; / ~ H~ ~H N' 1 / NH2
IOI ~ OH
F
~2HCI
4
4A To a solution of the chloride 1H (300 mg, 0.49 mmol) in THF (4 mL) was
added 2,6-
difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed 4
hours.
The reaction mixture was diluted with EtOAc and was washed with water, brine,
and dried
(MgS04). The solvent was removed under reduced pressure and the residue was
chromatographed (silica gel, 5% methanol/CH2Clz) to give the amine 4A as a
white solid
1 S (306 mg, 87%). CIMS (NH3) m/z: 718 (M+H+, 100%).
4 To a solution of 4A (295 mg, 0.41 mmol) in methanol (25 mL) was added
palladium
hydroxide on carbon (20%, SO mg) and the reaction mixture was charged with
hydrogen.
After stirring 1 hour, the mixture was filtered through Celite and the solvent
was removed
under reduced pressure. The residue was chromatographed (silica gel, S%
methanol/CHZC12) to give the amine as a white solid (228 mg, 81 %). To a
solution of the
freebase in ether (30 mL) and EtOAc ( 10 mL) was added 4N HCl in dioxane (0.2
mL, 0.8
rnmol). The resulting suspension was stirred I 5 min and was filtered to give
the bis-
hydrochloride salt 4 as a white solid: CIMS (NH3) m/z: b88 (M+H~,
100°,0).
18
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
Example 5
O \ p N02
O' ~
1G > CI~ V 'H N~S 1 /
O ~ OH
5A
> / ~ - H~ \ O" .O N02
~.~ N S~
H II H N I /
O ~ OH
F
5B
H O ~ O' ~O ' NH2
N
/ ~ H ~ H N ~S
F ~ OH
~2HC1
SA To a solution of the salt 1 G (28.8 g, 62.1 mmol) in THF (300 mL) and water
(400
5 mL) was added KzC03 (51.4 g, 370 mmol) and 3-nitrobenzenesulfonyl chloride
(15.14 g,
68.3 mmol). After stirring 4 hours, water was added and the suspension was
extracted
with EtOAc. The combined organic layers were washed with brine, S% citric
acid, water,
saturated NaHC03, brine, and was dried (MgS04). The solvent was removed under
reduced pressure and the resulting solid was triturated with EtOAc and hexane
to give the
I O sulfonamide SA as a white solid (32.1 g, 85°~0}. CIMS (NH3) m/z:
611 (M+H+, 100%).
5B To a solution of the chloride SA (16.0 g, 26.1 mmol) in THF (200 mL) was
added 3-
fluorobenzylamine (17.0 g, 135 mmol) and the reaction mixture was refluxed
overnight.
The solvent was removed under reduced pressure and the residue was taken up in
EtOAc
I 5 and was washed with water, brine, and dried (MgS04). The solvent was
removed under
reduced pressure and the residue was chromatographed (silica gel, 4% methanol/
CH2C12)
to give the amine 5B as a white solid (16.0 g, 87°0). CIMS (NH3) m/z:
700 (M+H+,
100%).
19
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
To a solution of SB ( 12.0 g, 17.22 mmol) in methanol (400 mL) was added
palladium
hydroxide on carbon (20%, 1.25 g) and the reaction mixture was charged with
hydrogen.
After stirring 3 hours, the mixture was filtered through Celite and the
solvent was removed
under reduced pressure. The residue was chromatographed (silica gel, 5%
5 methanol/CH2C1,) to give the amine as a white solid ( I 1.2 g, 97%). To a
solution of the
freebase in ether (400 mL) and EtOAc (75 mL) was added 1N HCl in ether (36 mL,
36
mmol). The resulting suspension was stirred 1 S min and was filtered to give
the bis-
hydrochloride salt 5 as a white solid. CIMS (NH3) m/z: 670 (M+H+, 100%).
Example 6
i
F H O \ ~~O N02
5A --~ ~ \ N~N~LN N~ w
H O ~ H OH
F
6A
F/ \ N~ \ ~S~ ' NH2
OH N /
F
~2HC1
6
6A To a solution of the chloride SA ( 16.0 g, 26.1 mmol) in THF (200 mL) was
added
3,5-difluorobenzylamine (25.0 g, 174 mmol) and the reaction mixture was
stirred 2 hours
and refluxed overnight. The solvent was removed under reduced pressure and the
residue
was taken up in EtOAc and was washed with water, brine, and dried (MgS04). The
solvent was removed under reduced pressure and the residue was chromatographed
(silica
gel, 3.5% methanol/CH2Cl2) to give the amine 6A as a white solid ( 15.6 g,
83%). CIMS
(NH3) m/z: 718 (M+H+, 100%).
6 To a solution of 6A ( 14.4 g, Z0.0 mmol) in methanol (S00 mL) was added
palladium
hydroxide on carbon (20%, 1.5 g) and the reaction mixture was charged with
hydrogen.
After stirring 4 hours, the mixture was filtered through Celite and the
solvent was removed
under reduced pressure. The residue was chromatographed (silica gel, 5%
methanol/CHzCI2) to give the amine as a white solid ( I 2.5 g, 91 %). To a
solution of the
freebase (9.57 g, 13.9 mmol) in ether (300 mL) was added 1 N HCI in ether (31
n~L, 31
CA 02353088 2001-05-29
WO 00/42060 PC'T/US00/00820
mmol). The resulting suspension was stirred 20 min and was f ltered to give
the bis-
hydrochloride salt 6 as a white solid: (9.9 g, 94%). CIMS (NH3) m/z: 688
(M+H+, 100%):
Example 7
S
N~ \ .S~ w
CI~ v 'N N , / O/ --s
O ~ H OH
p96 7A
N~ v q,S~
N
I' O
O ~ OH
F
~HCI
7
7 To a solution of N-[2R-hydroxy-3-[[(2,3-dihydro2,3-dihydrobenzofuran-5-
yl)sulfonyl](2-methylpropyl)amino)-1 S-(phenylmethyl)propyl)-2S-
[(chloroacetyl)amino)-
3,3-dimethylbutanamide 7A (100 mg, 0.16 mmol) in THF (2 mL) was added 3-
fluorobenzylamine (SSO mg, 4.4 mmol) and the reaction mixture was refluxed 6
hours.
The reaction mixture was diluted with EtOAc and was washed with water (4x),
brine, and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, 5% methanol/CH2CI2) to give the amine as a white
solid (91
I S mg, 79%). To a solution of the freebase (91 mg, 0.13 mmol) in ether (25
mL) was added
4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring 10 min the solvent was
removed
under reduced pressure and the resulting solid was triturated with ether and
filtered to give
the hydrochloride salt 7 as a white solid (72 mg, 65%): CIMS (NH3) m/z: F97
(M+H+,
100%).
21
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
Example 8
F O
H I O~iO
7A > ~ ~ H~N~H N~S ' /
IOI ~ OH
F
~HCI
8
8 To a solution of 7A ( 100 mg, 0.16 mmol) in THF (2 mL) was added 3,5-
difluorobenzylamine (605 mg, 4.2 mmol) and the reaction mixture was refluxed 6
hours.
The reaction mixture was diluted with EtOAc and was washed with water (4x),
brine, and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, 5% methanol/CHZC12) to give the amine as a white
solid (83
mg, 70%). To a solution of the freebase (83 mg, 0.1 1 mmol) in ether (25 mL)
was added
4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirring 10 min the solvent was
removed
under reduced pressure and the resulting solid was triturated with ether and
filtered to give
the hydrochloride salt 8 as a white solid (65 mg, 75%): Anal.
(C37H49N4O6S,FZCIi): Calc:
C, 59.15; H, 6.45; N, 7.47. Found: C, 58.90; H, 6.51; N, 7.21.
Example 9
F
O
> / ~ N~ v OSO w
7A H~ H N. 1 / i
'O' ~ OH
F
~HCI
9
9 To a solution of 7A ( I 00 mg, 0.16 mmol) in THF (2 mL) was added 2,5-
difluorobenzylamine (610 mg, 4.3 mmol) and the reaction mixture was refluxed 6
hours.
The reaction mixture was diluted with EtOAc and was washed with water (4x),
brine, and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, 5% methanol/CH2Clz) to give the amine as a white
solid ( 110
mg, 93%). To a solution of the freebase ( 110 mg, 0.15 mmol) in ether (25 mL)
was added
4N HCI in dioxane (0.05 mL, 0.20 mmol). After stirring 10 min the solvent was
removed
under reduced pressure and the resulting solid was triturated with ether and
filtered to give
the hydrochloride salt 9 as a white solid (76 mg, 64%): CIMS (NH3) m/z: 715
(M+H+,
100%).
22
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
Example 10
F
H O
O~,O
TA - I ~ N~N~N N.S O
O
H O ~ H OH
F
~HCI
S 10 To a solution of 7A ( 100 mg, 0. I 6 mmol) in THF (2 mL) was added 2,6-
difluorobenzylamine (600 mg, 4.2 mmol) and the reaction mixture was refluxed 6
hours.
The reaction mixture was diluted with EtOAc and was washed with water (4x),
brine, and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, 5% methanol/CH2C12) to give the amine as a white
solid ( 103
10 mg, 87%). To a solution of the freebase (103 mg, 0.14 mmol) in ether (25
mL) was added
4N HCl in dioxane (0.05 mL, 0.20 mmol). After stirnng I O min the solvent was
removed
under reduced pressure and the resulting solid was triturated with ether and
filtered to give
the hydrochloride salt 10 as a white solid (82 mg, 76%): CIMS (NH3) m/z: 715
(M+H+,
100%).
IS
Example 11
i
O
N_ ~ ,~ OSO
C v 'N N' ~ ~ -'~'
H
OH
11A
H
I ~ H~N _ H NHS
O ~ OH
F
~HCI
11
1 I To a solution of N-[2R-hydroxy-3-([(1,3-benzodioxol-5-yl)sulfonyl](2-
methylpropyl)amino]-1 S-(phenylmethyl)propyl]-2S-[(chioroacetyl)amino]-3,3-
23
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
dimethylbutanamide 11A (750 mg, 1.23 mmol) in THF (2 mL) was added 3-
fluorobenzylamine ( I .1 g, 8.8 mmol) and the reaction mixture was stirred
overnight. The
reaction mixture was diluted with EtOAc and was washed with water (4x), brine,
and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, S% methanol/CH2Cl2) to give the amine as a white
solid (532
mg, 62%}. To a solution of the freebase (532 mg, 0.76 mmol) in ether (100 mL)
was
added 4N HCl in dioxane (0.22 mL, 0.88 mmol). After stirring 10 min the
solvent was
removed under reduced pressure and the resulting solid was triturated with
ether and
filtered to give the hydrochloride salt 11 as a white solid (417 mg, 75%):
CIMS (NH3)
m/z: 699 (M+H+, 100%).
Example 12
i
F O \
11A '~(
H " H
O ~ OH
F
~HCi
12
IS 12 To a solution of 11A (2.0 g, 3.27 mmoI) in THF (7 mL) was added 3,5-
difluorobenzylamine (2.42 g, 16.9 mmol) and the reaction mixture was refluxed
S hours.
The reaction mixture was diluted with EtOAc and was washed with water (4x),
brine, and
dried (MgSO.~). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, S% methanol/CHyCl2) to give the amine as a white
solid
(2.268, 97%). To a solution of the freebase (1.8 g, 2.51 mmol) in ether (100
mL) was
added 4N HCl in dioxane (0.66 mL, 2.67 mmol). After stirring 10 min the
solvent was
removed under reduced pressure and the resulting solid was triturated with
ether and
filtered to give the bcnzylamine salt 12 as a white solid ( 1.65 g, 87%): CIMS
(NH3) m/z:
717 (M+H+, 100%). Anal. (C36H4~N40~S,FzCI,): Calc: C, 57.40; H, 6.17; N, 7.45.
Found: C, 57.25; H, 6.25; N, 7.24.
24
CA 02353088 2001-05-29
WO 00/42060 PCT/LJS00/00820
Example 13
F
O
11A -----~ ~ ~ N~ N~N N SO 1 ~
~O
O ~ OH
F
~HCI
13
13 To a solution of 11A (750 mg, 1.23 mmol) in THF (2 mL) was added 2,5-
difluorobenzylamine (1.2 g, 8.5 mmol) and the reaction mixture was refluxed 6
hours.
The reaction mixture was diluted with EtOAc and was washed with water (4x),
brine, and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, S% methanol/CH2C12) to give the amine as a white
solid (702
mg, 80%). To a solution of the freebase (702 mg, 0.98 mmol) in ether ( 100 mL)
and
EtOAc (25 mL) was added 4N HCl in dioxane (0.3 mL, I .2 mmol). After stirring
I O min
the solvent was removed under reduced pressure and the resulting solid was
triturated with
ether and filtered to give the hydrochloride salt 13 as a white solid (586 mg,
79%): CIMS
(NI-I3) m/z: 717 (M+H+, I00%).
I S Example 14
i
F O \
11A ---~ / ~ N N~ N v N S O ' ~
O ~ H OH
F
~HCI
14
14 To a solution of 11A (750 mg, 1.23 mmol) in THF (2 mL) was added 2,6-
difluorobenzylamine ( 1.2 g, 8.3 mmol) and the reaction mixture was refluxed 6
hours.
The reaction mixture was diluted with EtOAc and was washed with water (4x),
brine, and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, 5% methanol/CH2C12) to give the amine as a white
solid (7I7
mg, 81 %). To a solution of the freebase (7I 7 mg, I .00 mmol) in ether ( I 00
mL) was
added 4N HCl in dioxane (0.3 mL, 1.2 mmol). After stirring 10 min the solvent
was
removed under reduced pressure and the resulting solid was triturated with
ether and
filtered to give the hydrochloride salt 14 as a white solid (663 mg, 88%):
CIMS (NH3)
m/z: 717 (M+H+~ I00%).
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
Example 15
H O
11A > F
O
F
~HCI
5 15 To a solution of 11A (750 mg, 1.23 mmol) in THF (2 mL) was added 3,4-
difluorobenzylamine ( 1.2 g, 8.3 mmol) and the reaction mixture was refluxed 3
hours.
The reaction mixture was diluted with EtOAc and was washed with water (4x),
brine, and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, S% methanol/CHZCIz) to give the amine as a white
solid (760
10 mg, 86%). To a solution of the freebase (760 mg, 1.46 mmol) in ether ( 100
mL) was
added 4N HCl in dioxane {0.3 mL, 1.2 mmol). After stirring 10 min the
resulting solid
was filtered to give the hydrochloride salt 15 as a white solid (730 mg, 91
%): CIMS (NH3)
m/z: 717 (M+H+, 100%).
1 S Example 16
~i
o ~ 00
H ,, ~,
11A -> F / ~ H~N~H N~S 1 /
O ~ OH
F
~HCI
16
16 To a solution of 11A (750 mg, 1.23 mmol) in THF (2 mL) was added 2,4-
difluorobenzylamine ( 1.2 g, 8.3 mmol) and the reaction mixture was refluxed 6
hours.
The reaction mixture was diluted with EtOAc and was washed with water (4x),
brine, and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, 5% methanol/CH2C12) to give the amine as a white
solid (693
mg, 79%). To a solution of the freebase (693 mg, 0.97 mmol) in ether ( 100 mL)
was
added 4N HCI in dioxane (0.3 mL, 1.2 mmol). After stirring 10 min the
resulting solid
was filtered to give the hydrochloride salt 16 as a white solid (638 mg, 88%):
C'IMS (NH3)
m/z: 717 (M+H+, 100%).
~N sp
OH
26
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
Example 17
H
11A ->
H
~HCI
17
17 To a solution of 11A (500 mg, 0.82 mmol) in THF (2 mL} was added 4-
fluorobenzylamine ( 1.0 g, 8.0 mmol) and the reaction mixture was stirred
overnight. The
reaction mixture was diluted with EtOAc and was washed with water (4x), brine,
and
dried (MgS04). The solvent was removed under reduced pressure and the residue
was
chromatographed (silica gel, 5% methanol/CH2C12) to give the amine as a white
solid (470
mg, 82%). To a solution of the freebase (400 mg, 0.57 mmol) in ether (30 mL)
was added
4N HC1 in dioxane (0.18 mL, 0.7 mmol). After stirring 1 S min the resulting
solid was
filtered to give the hydrochloride salt 17 as a white solid (413 mg, 98%):
CIMS (NH3)
m/z: 699 (M+H+, 100%).
27
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
Utility
The compounds of formula I possess HIV protease inhibitory activity and are
therefore useful as antiviral agents for the treatment of HIV infection and
associated
diseases. The compounds of formula I possess HIV protease inhibitory activity
and are
effective as inhibitors of HIV growth. The ability of the compounds of the
present
invention to inhibit viral growth or infectivity is demonstrated in standard
assay of viral
growth or infectivity, for example, using the assay described below.
The compounds of formula I of the present invention are also useful for the
inhibition of HIV in an ex vivo sample containing HIV or expected to be
exposed to HIV.
Thus, the compounds of the present invention may be used to inhibit HIV
present in a
body fluid sample (for example, a serum or semen sample) which contains or is
suspected
to contain or be exposed to HIV.
The compounds provided by this invention are also useful as standard or
reference
compounds for use in tests or assays for determining the ability of an agent
to inhibit viral
1 S clone replication and/or HIV protease, for example in a pharmaceutical
research program.
Thus, the compounds of the present invention may be used as a control or
reference
compound in such assays and as a quality control standard. The compounds of
the present
invention may be provided in a commercial kit or container for use as such
standard or
reference compound.
Since the compounds of the present invention exhibit specificity for HIV
protease,
the compounds of the present invention may also be useful as diagnostic
reagents in
diagnostic assays for the detection of HIV protease. Thus, inhibition of the
protease
activity in an assay (such as the assays described herein) by a compound of
the present
invention would be indicative of the presence of HIV protease and HIV virus.
As used herein "pg" denotes microgram, "mg" denotes milligram, "g" denotes
gram, "pL" denotes microliter, "mL" denotes milliliter, "L" denotes liter,
"nM"denotes
nanomolar, "uM" denotes micromolar, "mM" denotes millimolar, "M" denotes molar
and
"nm" denotes nanometer. "Sigma" stands for the Sigma-Aldrich Corp. of St.
Louis, MO.
HIV RNA Assay
DNA Plasmids and in vitro RNA transcripts:
Plasmid pDAB 72 containing both gag and pol sequences of BH 10 (bp 113 I 816)
cloned into PTZ 19R was prepared according to Erickson-Viitanen et al. AIDS
Research
and Human Retroviruses 1989, 5, 577. The plasmid was linearized with Bam HI
prior to
the generation of in vitro RNA transcripts using the Riboprobe Gemini system
II kit
(Promega) with T7 RNA polymerase. Synthesized RNA was purified by treatment
with
RNase free DNAse (Promega), phenol-chloroform extraction, and ethanol
precipitation.
28
CA 02353088 2001-05-29
WO 00/42060 PC'T/US00/00820
RNA transcripts were dissolved in water, and stored at -70°C. The
concentration of RNA
was determined from the A260.
Probes:
S Biotinylated capture probes were purified by HPLC after synthesis on an
Applied
Biosystems (Foster City, CA) DNA synthesizer by addition of biotin to the 5'
teaninal end
of the oligonucleotide, using the biotin-phosphoramidite reagent of Cocuzza,
Tet. Lett.
1989, 30, 6287. The gag biotinylated capture probe (S-biotin-
CTAGCTCCCTGCTTGCCCATACTA 3') was complementary to nucleotides 889-912 of
HXB2 and the poI biotinylated capture probe (S'-biotin -
CCCTATCATTTTTGGTTTCCAT 3' ) was complementary to nucleotides 2374-2395 of
HXB2. Alkaline phosphatase conjugated oligonucleotides used as reporter probes
were
prepared by Syngene (San Diego, CA.). The pol reporter probe (5'
CTGTCTTACTTTGATAAAACCTC 3') was complementary to nucleotides 2403-2425 of
1 S HXB2. The gag reporter probe (5' CCCAGTATTTGTCTACAGCCTTCT 3') was
complementary to nucleotides 950-973 of HXB2. All nucleotide positions are
those of the
GenBank Genetic Sequence Data Bank as accessed through the Genetics Computer
Group
Sequence Analysis Software Package (Devereau Nucleic Acids research 1984, 72,
387).
The reporter probes were prepared as 0.5 p.M stocks in 2 x SSC (0.3 M NaCI,
0.03 M
sodium citrate), 0.05 M Tris pH 8.8, 1 mg/mL BSA. The biotinylated capture
probes were
prepared as 100 pM stocks in water.
Streptavidin coated plates:
Streptavidin coated plates were obtained from Du Pont Biotechnology Systems
(Boston, MA).
Cells and virus stocks:
MT-2 and MT-4 cells were maintained in RPMI 1640 supplemented with 5% fetal
calf serum (FCS) for MT-2 cells or 10% FCS for MT-4 cells, 2 mM L-glutamine
and SO
pg/mL gentamycin, all from Gibco. HIV 1 RF was propagated in MT-4 cells in the
same
medium. Virus stocks were prepared approximately 10 days after acute infection
of MT-4
cells and stored as aliquots at -70°C. Infectious titers of HIV-1(RF)
stocks were 1-3 x 107
PFU (plaque forming units)/mL as measured by plaque assay on MT 2 cells (see
below).
Each aliquot of virus stock used for infection was thawed only once.
For evaluation of antiviral efficacy, cells to be infected were subcultured
one day
prior to infection. On the day of infection, cells were resuspended at 5 x 1
OS cells/mL in
RPMI 1640, 5% FCS for bulk infections or at 2 x 106/mL in Dulbecco's modified
Eagles
29
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
medium with 5% FCS for infection in microtiter plates. Virus was added and
culture
continued for 3 days at 37°C.
HIV RNA assay:
Cell lysates or purified RNA in 3 M or 5 M GED were mixed with S M GED and
capture probe to a final guanidinium isothiocyanate concentration of 3 M and a
final biotin
oligonucleotide concentration of 30 nM. Hybridization was carned out in sealed
U
bottom 96 well tissue culture plates (Nunc or Costar) for 16-20 hours at
37°C. RNA
hybridization reactions were diluted three-fold with deionized water to a
final guanidinium
isothiocyanate concentration of 1 M and aliquots ( 150 uL) were transferred to
streptavidin
coated microtiter plates wells. Binding of capture probe and capture probe-RNA
hybrid to
the immobilized streptavidin was allowed to proceed for 2 hours at room
temperature,
after which the plates were washed 6 times with DuPont ELISA plate wash buffer
(phosphate buffered saline(PBS), 0.05% Tween 20.) A second hybridization of
reporter
1 S probe to the immobilized complex of capture probe and hybridized target
RNA was
carried out in the washed streptavidin coated well by addition of 120 pl of a
hybridization
cocktail containing 4 X SSC, 0.66% Triton X 100, 6.66% deionized formamide, 1
mg/mL
BSA and 5 nM reporter probe. After hybridization for one hour at 37°C,
the plate was
again washed 6 times. Immobilized alkaline phosphatase activity was detected
by addition
of 100 pL of 0.2 mM 4-methylumbelliferyl phosphate (MUBP, JBL Scientific) in
buffer b (2.5 M diethanolamine pH 8.9 (JBL Scientific), 10 mM MgCl2, 5 mM zinc
acetate dehydrate and 5 mM N hydroxyethyl-ethylene-diamine-triacetic acid).
The plates
were incubated at 37°C. Fluorescence at 450 nM was measured using a
microplate
fluorometer (Dynateck) exciting at 365 nM.
Microplate based compound evaluation in HIV-1 infected MT-2 cells:
Compounds to be evaluated were dissolved in DMSO and diluted in culture
medium to twice the highest concentration to be tested and a maximum DMSO
concentration of 2%. Further three-fold serial dilutions of the compound in
culture
medium were perfornied directly in U bottom microtiter plates (Nunc). After
compound
dilution, MT-2 cells (50 uL) were added to a final concentration of S x 105
per mL ( 1 x
105 per well). Cells were incubated with compounds for 30 minutes at
37°C in a C02
incubator. For evaluation of antiviral potency, an appropriate dilution of HIV-
1 (RF) virus
stock (50 pL) was added to culture wells containing cells and dilutions of the
test
compounds. The final volume in each well was 200 pL. Eight wells per plate
were left
uninfected with 50 pL of medium added in place of virus, while eight wells
were infected
in the absence of any antiviral compound. For evaluation of compound toxicity,
parallel
plates were cultured without virus infection.
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
After 3 days of culture at 37°C in a humidified chamber inside a C02
incubator, all
but 25 pL of medium/well v~:~as removed from the HIV infected plates. Thirty
seven pL of
M GED containing biotinylated capture probe was added to the settled cells and
remaining medium in each well to a final concentration of 3 M GED and 30 nM
capture
S probe. Hybridization of the capture probe to HIV RNA in the cell lysate was
carried out in
the same microplate well used for virus culture by sealing the plate with a
plate sealer
(Costar), and incubating for 16-20 hrs in a 37°C incubator. Distilled
water was then
added to each well to dilute the hybridization reaction three-fold and I 50 pL
of this diluted
mixture was transferred to a streptavidin coated microtiter plate. HIV RNA was
quantitated as described above. A standard curve, prepared by adding known
amounts of
pDAB 72 in vitro RNA transcript to wells containing lysed uninfected cells,
was run on
each microtiter plate in order to determine the amount of viral RNA made
during the
infection.
In order to standardize the virus inoculum used in the evaluation of compounds
for
I 5 antiviral activity, dilutions of virus were selected which resulted in an
IC90 value
(concentration of compound required to reduce the HIV RNA level by 90%) for
dideoxycytidine (ddC) of 0.2 pg/mL. IC90 values of other antiviral compounds,
both
more and less potent than ddC, were reproducible using several stocks of HIV-I
(RF)
when this procedure was followed. This concentration of virus corresponded to
~3 x 105
PFU (measured by plaque assay on MT 2 cells) per assay well and typically
produced
approximately 75% of the maximum viral RNA level achievable at any virus
inoculum.
For the HIV RNA assay, IC90 values were determined from the percent reduction
of net
signal (signal from infected cell samples minus signal from uninfected cell
samples) in the
RNA assay relative to the net signal from infected, untreated cells on the
same culture
plate (average of eight wells). Valid performance of individual infection and
RNA assay
tests was judged according to three criteria. It was required that the virus
infection should
result in an RNA assay signal equal to or greater than the signal generated
from 2 ng of
pDAB 72 in vitro RNA transcript. The IC90 for ddC, determined in each assay
run,
should be between 0.1 and 0.3 pg/mL. Finally, the plateau level of viral RNA
produced by
an effective protease inhibitor should be less than 10% of the level achieved
in an
uninhibited infection. A compound was considered active if its lC9p was found
to be less
than 1 ~tM.
For antiviral potency tests, all manipulations in microtiter plates, following
the
initial addition of 2X concentrated compound solution to a single row of
wells, were
performed using a Perkin Elmer/Cetus ProPette.
31
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
Dosage and Formulation
The antiviral compounds of this invention can be administered as treatment for
viral infections by any means that produces contact of the active agent with
the agent's site
of action, i.e., the viral protease, in the body of a mammal. They can be
administered by
any conventional means available for use in conjunction with pharmaceuticals,
either as
individual therapeutic agents or in a combination of therapeutic agents. They
can be
administered alone, but preferably are administered with a pharmaceutical
carrier selected
on the basis of the chosen route of administration and standard pharmaceutical
practice.
The dosage administered will, of course, vary depending upon known factors,
such
as the pharmacodynamic characteristics of the particular agent and its mode
and route of
administration; the age, health and weight of the recipient; the nature and
extent of the
symptoms; the kind of concurrent treatment; the frequency of treatment; and
the effect
desired. A daily dosage of active ingredient can be expected to be about 0.001
to about
1000 milligrams per kilogram of body weight, with the preferred dose being
about 0.1 to
about 30 mg/kg.
Dosage forms of compositions suitable for administration contain from about 1
mg
to about 100 mg of active ingredient per unit. In these pharmaceutical
compositions the
active ingredient will ordinarily be present in an amount of about 0.5-95% by
weight based
on the total weight of the composition. The active ingredient can be
administered orally in
solid dosage forms, such as capsules, tablets and powders, or in liquid dosage
forms, such
as elixirs, syrups and suspensions. It can also be administered parenterally,
in sterile liquid
dosage forms.
Gelatin capsules contain the active ingredient and powdered carriers, such as
lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and
the like.
Similar diluents can be used to make compressed tablets. Both tablets and
capsules can be
manufactured as sustained release products to provide for continuous release
of
medication over a period of hours. Compressed tablets can be sugar coated or
film coated
to mask any unpleasant taste and protect the tablet from the atmosphere, or
enteric coated
for selective disintegration in the gastrointestinal tract. Liquid dosage
forms for oral
administration can contain coloring and flavoring to increase patient
acceptance.
In general, water, a suitable oil, saline, aqueous dextrose (glucose), and
related
sugar solutions and glycols such as propylene glycol or polyethylene glycols
are suitable
carriers for parenteral solutions. Solutions for parenteral administration
preferably coataia
a water soluble salt of the active ingredient, suitable stabilizing agents,
and if necessary,
buffer substances. Antioxidizing agents such as sodium bisulfate, sodium
sulfite, or
ascorbic acid, either alone or combined, are suitable stabilizing agents. Also
used are
citric acid and its salts, and sodium EDTA. In addition, parenteral solutions
can contain
preservatives, such as benzalkonium chloride, methyl- or propyhparaben and
32
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
chlorobutanol. Suitable pharmaceutical carriers are described in Remington's
Pharmaceutical Sciences, supra, a standard reference text in this field.
Useful pharmaceutical dosage-forms for administration of the compounds of this
invention can be illustrated as follows:
S
Capsules
A large number of unit capsules can be prepared by filling standard two-piece
hard
gelatin capsules each with I 00 mg of powdered active ingredient, 1 SO mg of
lactose, 50
mg of cellulose, and 6 mg magnesium stearic.
Soft Gelatin Capsules
A mixture of active ingredient in a digestible oil such as soybean oil,
cottonseed oil
or olive oil can be prepared and injected by means of a positive displacement
pump into
gelatin to form soft gelatin capsules containing 100 mg of the active
ingredient. The
1 S capsules should then be washed and dried.
Tablets
A large number of tablets can be prepared by conventional procedures so that
the
dosage unit is 100 mg of active ingredient, 0.2 mg of colloidal silicon
dioxide, 5
milligrams of magnesium stearate, 275 mg of microcrystalline cellulose, 1 I mg
of starch
and 98.8 mg of lactose. Appropriate coatings may be applied to increase
palatability or
delay absorption.
Suspension
An aqueous suspension can be prepared for oral administration so that each 5
mL
contain 25 mg of finely divided active ingredient, 200 mg of sodium
carboxymethyl
cellulose, 5 mg of sodium benzoate, I .0 g of sorbitol solution, U.S.P., and
0.025 mg of
vanillin.
Injectable
A parenteral composition suitable for administration by injection can be
prepared
by stirring I .S% by weight of active ingredient in 10% by volume propylene
glycol and
water. The solution is sterilized by commonly used techni4ues.
Combination of components (a) and (b)
Each therapeutic agent component of this invention can independently be in any
dosage form, such as those described above, and can also be administered in
various ways,
as described above. In the following description component (b) is to be
understood to
33
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
represent one or more agents as described previously. Thus, if components (a)
and (b) are
to be treated the same or independently, each agent of component (b) may also
be treated
the same or independently.
Components (a) and (b) of the present invention may be formulated together, in
a
single dosage unit (that is, combined together in one capsule, tablet, powder,
or liquid,
etc.) as a combination product. When component (a) and (b) are not formulated
together
in a single dosage unit, the component (a) may be administered at the same
time as
component (b) or in any order; for example component (a) of this invention may
be
administered first, followed by administration of component (b), or they may
be
administered in the revserse order. If component (b) contains more that one
agent, e.g.,
one RT inhibitor and one protease inhibitor, these agents may be administered
together or
in any order. When not administered at the same time, preferably the
administration of
component (a) and (b) occurs less than about one hour apart. Preferably, the
route of
administration of component (a) and (b) is oral. The terms oral agent, oral
inhibitor, oral
compound, or the like, as used herein, denote compounds which may be orally
administered. Although it is preferable that component (a) and component (b)
both be
administered by the same route (that is, for example, both orally) or dosage
form, if
desired, they may each be administered by different routes (that is, for
example, one
component of the combination product may be administered orally, and another
component may be administered intravenously) or dosage forms.
As is appreciated by a medical practitioner skilled in the art, the dosage of
the
combination therapy of the invention may vary depending upon various factors
such as the
pharmacodynamic characteristics of the particular agent and its mode and route
of
administration, the age, health and weight of the recipient, the nature and
extent of the
symptoms, the kind of concurrent treatment, the frequency of treatment, and
the effect
desired, as described above.
The proper dosage of components (a) and (b) of the present invention will be
readily ascertainable by a medical practitioner skilled in the art, based upon
the present
disclosure. By way of general guidance, typically a daily dosage may be about
100
milligrams to about 1.5 grams of each component. If component (b) represents
more than
one compound, then typically a daily dosage may be about 100 milligrams to
about 1.5
grams of each agent of component (b). By way of general guidance, when the
compounds
of component (a) and component (b) are administered in combination, the dosage
amount
of each component may be reduced by about '7480% relative to the usual dosage
of the
component when it is administered alone as a single agent for the treatment of
HIV
infection, in view of the synergistic effect of the combination.
The combination products of this invention may be formulated such that,
although
the active ingredients are combined in a single dosage unit, the physical
contact between
34
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
the active ingredients is minimized. In order to minimize contact, for
example, where the
product is orally administered, one active ingredient may be enteric coated.
By enteric
coating one of the active ingredients, it is possible not only to minimize the
contact
between the combined active ingredients, but also, it is possible to control
the release of
one of these components in the gastrointestinal tract such that one of these
components is
not released in the stomach but rather is released in the intestines. Another
embodiment of
this invention where oral administration is desired provides for a combination
product
wherein one of the active ingredients is coated with a sustained-release
material which
effects a sustained-release throughout the gastrointestinal tract and also
serves to minimize
physical contact between the combined active ingredients. Furthermore, the
sustained-released component can be additionally enteric coated such that the
release of
this component occurs only in the intestine. Still another approach would
involve the
formulation of a combination product in which the one component is coated with
a
sustained and/or enteric release polymer, and the other component is also
coated with a
1 S polymer such as a lowviscosity grade of hydroxypropyl methylcellulose or
other
appropriate materials as known in the art, in order to further separate the
active
components. The polymer coating serves to form an additional barner to
interaction with
the other component. In each formulation wherein contact is prevented between
components (a) and (b) via a coating or some other material, contact may also
be
prevented between the individual agents of component (b).
Dosage forms of the combination products of the present invention wherein one
active ingredient is enteric coated can be in the form of tablets such that
the enteric coated
component and the other active ingredient are blended together and then
compressed into a
tablet or such that the enteric coated component is compressed into one tablet
layer and the
other active ingredient is compressed into an additional layer. Optionally, in
order to
further separate the two layers, one or more placebo layers may be present
such that the
placebo layer is between the layers of active ingredients. In addition, dosage
forms of the
present invention can be in the form of capsules wherein one active ingredient
is
compressed into a tablet or in the form of a plurality of microtablets,
particles, granules or
non-perils, which are then enteric coated. These enteric coated microtablets,
particles,
granules or non-perils are then placed into a capsule or compressed into a
capsule along
with a granulation of the other active ingredient.
These as welt as other ways of minimizing contact between the components of
combination products of the present invention, whether administered in a
single dosage
form or administered in separate forms but at the same time or concurrently by
the same
manner, will be readily apparent to those skilled in the art, based on the
present disclosure.
Pharmaceutical kits useful for the treatment of HIV infection, which comprise
a
therapeutically effective amount of a pharmaceutical composition comprising a
compound
CA 02353088 2001-05-29
WO 00/42060 PCT/US00/00820
of component (a) and one or more compounds of component (b), in one or more
sterile
containers, are also within the ambit of the present invention. Sterilization
of the container
may be carried out using conventional sterilization methodology well known to
those
skilled in the art. Component (a) and component {b) may be in the same sterile
container
or in separate sterile containers. The sterile containers of materials may
comprise separate
containers, or one or more mufti-part containers, as desired. Component (a)
and
component (b), may be separate, or physically combined into a single dosage
form or unit
as described above. Such kits may further include, if desired, one or more of
various
conventional pharmaceutical kit components, such as for example, one or more
pharmaceutically acceptable carriers, additional vials for mixing the
components, etc., as
will be readily apparent to those skilled in the art. Instructions, either as
inserts or as
labels, indicating quantities of the components to be administered, guidelines
for
administration, and/or guidelines for mixing the components, may also be
included in the
kit.
Obviously, numerous modifications and variations of the present invention are
possible in light of the above teachings. It is therefore to be understood
that within the
scope of the appended claims, the invention may be practiced otherwise than as
specifically described herein.
36
