Note: Descriptions are shown in the official language in which they were submitted.
CA 02356446 2001-06-19
WO 00/39305 PCT/US98/27301
Pyruva>~e Carboxylase from
C~Yynebacterium glutamicum
s STATEMENT OF GOVEiRNMENT
RIGHTS IN THE INVEl'VTIDN
Part of the work performed during development of this invention utilized
U.S. Government funds. The U.S. Government has certain rights in this
invention.
BACKGROUND OF THE .l'NYENTIDN
Field of the Invention
The present invention relates to a Corynebacterium gl utamicum pyruvate
carboxylase protein and to polynucleotides encodir~.g this protein.
Background Information
Pyruvate carboxylate is an important anaplerotic enzyme replenishing
oxaloacetate consumed for biosynthesis during grov~~th, or lysine and glutamic
acid
production in industrial fermentations.
The two-step reaction mechanism catalyzed by pyruvate carboxylase is
shown below:
Mg2+acetyl-CoA
MgATP + I-IC03 + ENZ-biotin , MgAI)P + pi + ENZ-biotin-CO2 ( 1 )
ENZ-biotin-CO2+ pyruvate -~- ENZ-biotin + oxaioacetate (2)
Tn reaction (1 } the ATP-dependent biotin carboxylase domain carboxylates
a biotin prosthetic group linked to a specif c lysine residue in the biotin-
carboxyl-carrier
protein (BCCP) domain. Acetyl-coenzyme A activates reaction ( 1 ) by
increasing the rate
CA 02356446 2001-06-19
WO 00/39305 PCT/US98/27301
2
of bicarbonate-dependent ATP cleavage. In reaction (2}, the BCCP domain
donates the
CO~ to pyruvate in a reaction catalyzed by the tran scarboxylase domain
(Attwaod, P.V.,
Int. .l. Biochem. Cell. Bial. 27:231-249 (1995)}.
Pruvate carboxylase genes have been cloned and sequenced from:
Rlzizobium etli (Dunn, M.F., et al., J. Bacteriol. 17&:5960-5970 (1996)),
Bacillus
stearothermophilus (ICondo, H., et al., Gene 11:47-SO (I997), Bacildzrs
suhtillis
(Genbank accession no. Z9702S), Mycobacterium tuberculosis (Genbank accession
no.
Z83018), and Metharrobacterium thernroazrtotrophicum (Mukhopadhyay, B., J.
Biol.
Chem. 273:5 I SS-S 166 ( I 998). Pyruvate carbo:xylase activity has been
measured
previously in Brevibacterium lactoferrnentzrm (Tc>saka, O., et al., Agric.
Biol. Chem.
=13:1 S 13-1 S 19 (1979)} and Coryhebacter~iurn glutarnicum (Peters-Wendisch,
P.G., et al.,
Microbiology 1-13:1095-1103 (1997)).
Previous research has indicated that the yield and productivity of the
aspartate family of amino acids depends critically on the carbon flux through
anaplerotic
IS pathways (Vallino, J.J., & Stephanopoulos, G., Biotechnol. Bioeng. 41:633-
646 ( I993)).
On the basis of the metabolite balances, it can be shown that the rate of
lysine production
is less than or equal to the rate of oxaloacetate synthesis via the
anaplerotic pathways.
SUMMARY OF THE a!NVENTION
The present invention provides isolated nucleic acid molecules
comprising a polynucleotide encoding a pyruvate carboxylase polypeptide having
the amino acid sequence in Figure I (SEQ ID I\f0:2) or the amino acid sequence
encoded by the cosmid clone deposited in a bacterial host as ATCC Deposit
Number . The nucleotide sequence determined by sequencing the deposited
pyruvate carboxylase cosmid clone, which is shown in Figure 1 (SEQ ID NO:1),
contains an open reading frame encoding a polypeptide of 1140 amino acid
residues
which has a deduced molecular weight of about 123.6 kDa. The 1140 amino acid
sequence of the predicted pyruvate carboxyiase protein is shown in Figure 1
and in
SEQ ID N0:2.
Thus, one aspect of the invention provides an isolated nucleic acid
molecule comprising a polynucleotide having a nucleotide sequence selected
from
CA 02356446 2001-06-19
WO 00/39305 PCT/US98/27301
3
the group consisting of: (a) a nucleotide sequence encoding the pyruvate
carboxylase polypeptide having the complete .amino acid sequence in SEQ ID
N0:2; {b) a nucleotide sequence encoding the hyruvate carboxylase polypeptide
having the complete amino acid sequence encoded by the cosmid clone contained
S in ATCC Deposit No. ; and (c) a nucleotide sequence complementary to any
of the nucleotide sequences in (a) or (b) above.
Further embodiments of the invention include isolated nucleic acid
molecules that comprise a polynucIeatide having a nucleotide sequence at least
90%
identical, and more preferably at least 95%, 97%., 98% or 99% identical, to
any of
the nucleotide sequences in {a), (b) or (c) above, or a polynucleotide which
hybridizes under stringent hybridization conditions to a polynucleotide having
a
nucleotide sequence identical to a nucleotide sequence in (a), (b) or {c),
above. The
polynucleotide which hybridizes does not hybridize under stringent
hybridization
conditions to a polynucleotide having a nucleotide sequence consisting of only
A
residues or of only T residues.
The present invention also relates to recombinant vectors which include
the isolated nucleic acid molecules of the present invention and to host cells
containing the recombinant vectors, as well as to methods of making such
vectors
and host cells and fox using them for production of pyruvate carboxylase
polypeptides or peptides by recombinant techniques.
The invention further provides an isolated pyruvate carboxyiase
polypeptide having amino acid sequence selected from the group consisting of:
(a)
the amino acid sequence of the pyruvate carboxyl<~se poIypeptide having the
amino
acid sequence shown in Figure I (SEQ ID N0:2); and (b) the amino acid sequence
2S of the pyruvate carboxylase polypeptide having the complete amino acid
sequence
encoded by the cosmid clone contained in A'lf CC Deposit No. The
polypeptides of the present invention also include polypeptides having an
amino
acid sequence with at least 90% similarity, more preferably at least 95%
similarity
to those described in {a) or (b) above, as well as polypeptides having an
amino acid
sequence at least 70% identical, more preferably at least 90% identical, and
still
more preferably 95%, 97%, 98% or 99% identical to those above.
CA 02356446 2001-06-19
WO 00/39305 4 PCTNS98/27301
BRIEF DESCRIPTION' OF THE DRA WINGS
Figure 1 shows the nucleotide (SEQ ID NO:1 ) and deduced amino acid
(SEQ ID N0:2) sequences ofthe complete pyruv,ate carboxylase protein
determined
by sequencing of the DNA clone contained in ATCC Deposit No. The
protein has sequence of about 1140 amino acid residues and a deduced molecular
weight of about 123.6 kDa.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides isolated nucleic acid molecules
comprising a polynucleotide encoding the pyruvate carboxylase protein having
the
amino acid sequence shown in Figure 1 (SEQ ID N0:2) which was determined by
sequencing a cloned cosmid. The pyruvate carboxylase protein of the present
IS invention shares sequence homology with M. tuberculosis and human pyruvate
carboxylase proteins. The nucleotide sequence shown in Figure 1 (SEQ ID NO:1)
was obtained by sequencing cosmid III F 10 encoding a pyruvate carbaxylase
polypeptide, which was deposited on ~ at the American Type Culture Collection,
10801 University Blvd., Manassas, VA 201 I 0-2.209, and given accession number
Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using an automated DNA
sequencer (such as the ABI Prism 377), and all amino acid sequences of
polypeptides encoded by DNA molecules determined herein were predicted by
translation of a DNA sequence determined as above. Therefore, as is known in
the
art for any DNA sequence determined by this automated approach, any nucleotide
sequence determined herein may contain some errors. Nucleotide sequences
determined by automation are typically at least about 90% identical, more
typically
at least about 95% to at least about 99.9% identical to the actual nucleotide
CA 02356446 2001-06-19
WO 00/39305 5 PCT/US98/27301
sequence of the sequenced DNA molecule. The actual sequence can be more
precisely determined by other approaches including manual DNA sequencing
methods well known in the art. As is also known in the art, a single insertion
or
deletion in a determined nucleotide sequence compared to the actual sequence
will
cause a frame shift in translation of the nucleotide sequence such that the
predicted
amino acid sequence encoded by a determined nucleotide sequence will be
completely different from the amino acid sequence actually encoded by the
sequenced DNA molecule, beginning at the point of such an insertion or
deletion.
Unless otherwise indicated, each "nucleotide sequence" set forth herein
is presented as a sequence of deoxyribonucleotides (abbreviated A, G , C and
T).
However, by "nucleotide sequence" of a nuciei.c acid molecule or
polynucleotide
is intended, for a DNA molecule or polynucleotide, a sequence of
deoxyribonucleotides, and for an RNA molecule or polynucleotide, the
corresponding sequence of ribonucleotides (A, ~G, C and U) where each
thymidine
1S deoxynucleotide (T) in the specified deoxynucleotide sequence in is
replaced by the
ribonucleotide uridine (U). For instance, reference to an RNA molecule having
the
sequence of SEQ ID NO:l set forth using deoxyribonucleotide abbreviations is
intended to indicate an RNA molecule having a sequence in which each
deoxynucleotide A, G or C of SEQ ID I\f0:1 has been replaced by the
corresponding ribonucleatide A, G or C, and each deoxynucleotide T has been
replaced by a ribonucleotide U.
Using the information provided herein, such as the nucleotide sequence
in Figure l, a nucleic acid molecule of the present invention encoding a
pyruvate
carboxylase polypeptide may be obtained using standard cloning and screening
procedures, such as those for cloning DNAs using mRNA as starting material.
The
pyruvate carboxylase protein shown in Figure 1 (SEQ ID N0:2) is about 63%
identical to M. tuberculosis and 44% identical to human. As one of ordinary
skill
would appreciate, due to the possibilities of sequencing errors discussed
above. as
well as the variability of cleavage sites for leaders in different known
proteins, the
actual pyruvate carboxylase polypeptide encoded by the deposited cosmid
comprises about 1140 amino acids, but may be anywhere in the range of 1133-
1147
amino acids.
CA 02356446 2001-06-19
WO 00139305 PCT/US98/27301
6
As indicated, nucleic acid molecules of the present invention may be in
the form of RNA, such as mRNA, or in the form of DNA, including, for instance,
cDNA and genomic DNA obtained by cloning or produced synthetically. The DNA
may be double-stranded or single-stranded, Single-stranded DNA or RNA may be
the coding strand, also known as the sense strand, or it may be the non-coding
strand, also referred to as the anti-sense strand.
By "isolated" nucleic acid molecule{s) is intended a nucleic acid
molecule, DNA or RNA, which has been removed from its native environment. For
example, recombinant DNA molecules contained in a vector are considered
isolated
for the purposes of the present invention. Further examples of isolated DNA
molecules include recombinant DNA molecules maintained in heterologous host
cells or purified (partially or substantially) DNA molecules in solution.
Isolated
RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules
of the present invention. Isolated nucleic acid molecules according to the
present
invention further include such molecules produced synthetically.
Isolated nucleic acid molecules of the present invention include DNA
molecules comprising an open reading frame (ORF) with an initiation colon at
positions 199-201 of the nucleotide sequence shown in Figure 1 (SEQ ID NO: l
);
DNA molecules comprising the coding sequence for the pyruvate carboxylase
protein shown in Figure 1 and SEQ ID N0:2; and DNA molecules which comprise
a sequence substantially different from those described above but which, due
to the
degeneracy of the genetic code, still encode the ~pyruvate carboxylase
protein. Of
course, the genetic code is well known in the art. Thus, it would be routine
for one
skilled in the art to generate the degenerate variants described above.
In another aspect, the invention provides isolated nucleic acid molecules
encoding the pyruvate carboxylase polypeptide having an amino acid sequence
encoded by the cosmid clone deposited as ATCC Deposit No. Preferably,
this nucleic acid molecule will encode the pol;ypeptide encoded by the above-
described deposited clone. The invention further provides an isolated nucleic
acid
molecule having the nucleotide sequence shown in Figure 1 (SEQ ID NO:1 ) or
the
nucleotide sequence of the pyruvate carboxylase DNA contained in the above-
described deposited clone, or nucleic acid molecule having a sequence
CA 02356446 2001-06-19
WO OD/39305 PCT/US98/27301
7
complementary to one of the above sequences.
In another aspect, the invention provides an isolated nucleic acid
molecule comprising a polynucleotide which hybridizes under stringent
hybridization conditions to a portion of the polynucleotide in a nucleic acid
molecule ofthe invention described above, for instance, the cosmid clone
contained
in ATCC Deposit By "stringent hybridization conditions" is intended
overnight incubation at 42°C in a solution comprising: 50% formamide,
Sx SSG
(150 mM NaCI, lSmM trisodium citrate), ~0 mM sodium phosphate (pH7.6), Sx
Denhardt's solution, 10% dextran sulfate, and 20 pg/ml denatured, sheared
salmon
i0 sperm DNA, followed by washing the filters in O.lx SSC at about
6S°C. By a
polynucleotide which hybridizes to a "portion" of a polynucleotide is intended
a
polynucleotide (either DNA or RNA) hybridizing to at least about 15
nucleotides
(nt), and more preferably at least about 20 nt, stilll more preferably at
least about 30
nt, and even more preferably about 30-70 nt of thf: reference polynucleotide.
These
are useful as diagnostic probes and primers.
Of course, polynucleotides hybridizing to a larger portion of the reference
polynucleotide (e.g., the deposited cosmid clone), for instance, a portion 50-
750 nt
in length, or even to the entire length of the reference polynucleotide, also
useful
as probes according to the present invention, as a:re polynucleotides
corresponding
to most, if not all; of the nucleotide sequence of the deposited DNA or the
nucleotide sequence as shown in Figure 1 (SEQ ID NO:1). By a portion of a
polynucleotide of "at least 20 nt in length," for example, is intended 20 or
more
contiguous nucleotides from the nucleotide sequence of the reference
polynueleotide, (e.g., the deposited DNA or the nucleotide sequence as shown
in
Figure 1 (SEQ ID NO:1 }). As indicated, such portions are useful
diagnostically
either as a probe according to conventional DNA hybridization techniques or as
primers for amplification of a target sequence by the polymerase chain
reaction
(PCR), as described, for instance, in Molecular Cloning, A Labonato~y Manual,
2nd. edition, edited by Sambrook, J., Fritsch, E. h. and Maniatis, T., (1989),
Cold
Spring Harbor Laboratory Press, the entire disclosure of which is hereby
incorporated herein by reference.
Since a pyruvate carboxylase cosmid clone has been deposited and its
CA 02356446 2001-06-19
WO 00/39305 g PCT/US98/2'7301
determined nucleotide sequence is provided in Fiigure 1 (SEQ ID NO:1 ),
generating
polynucleotides which hybridize to a portion of the pyruvate carboxylase DNA
molecule would be routine to the skilled artisan. For example, restriction
endonuclease cleavage or shearing by sonication of the pyruvate carboxylase
cosmid clone could easily be used to generate DNA portions of various sizes
which
are polynucleotides that hybridize to a portion of the pyruvate carboxylase
DNA
molecule. Alternatively, the hybridizing polynucleotides of the present
invention
could be generated synthetically according to known techniques.
As indicated; nucleic acid molecules of the present invention which
encode the pyruvate carboxylase protein polypeptide may include, but are not
limited to those encoding the amino acid sequence ofthe polypeptide, by
itself; the
coding sequence for the polypeptide and additional sequences, such as a pre-,
or
pro- or prepro- protein sequence; the coding sequence of the polypeptide, with
or
without the aforementioned additional coding sequences, together with
additional,
non-coding sequences, including for example, but not limited to introns and
non-
coding 5' and 3' sequences, such as the transcribed, non-translated sequences
that
play a role in transcription, mRNA processing - including splicing and
polyadenylation signals, for example - ribosome: binding and stability of
mRNA;
an additional coding sequence which codes for additional amino acids, such as
those which provide additional functionalities. Thus, the sequence encoding
the
polypeptide may be fused to a marker sequence, such as a sequence encoding a
peptide which facilitates purification of the fused polypeptide. In certain
preferred
embodiments of this aspect of the invention, the marker amino acid sequence is
a
hexa-histidine peptide, such as the tag provided in a, pQE vector (Qiagen,
Inc.),
2S among others, many of which are commercially available. As described in
Gentz
et al., Proc. Natl. Acad. Sci., USA 86:821-824 {I989), for instance, hexa-
histidine
provides for convenient purif ration of the fusion protein. The "HA" tag is
another
peptide useful for purification which corresponds to an epitope derived from
the
influenza hemagglutinin protein, which has been described by Wilson et al.,
Cell
37: 767 (1984).
The present invention further relates to variants of the nucleic acid
molecules of the present invention, which encode portions, analogs or
derivatives
CA 02356446 2001-06-19
WO 00/39305 9 PCT/US98/27301
of the pyruvate carboxylase protein. Variants may occur naturally, such as a
natural
allelic variant. By an "allelic variant" is intended one of several alternate
forms of
a gene occupying a given locus on a chromosome of an organism. Genes ll,
Lewin,
ed. Non-naturally occurring variants rnay be produced using art-known
mutagenesis techniques.
Such variants include those produced by nucleotide substitutions,
deletions or additions. The substitutions, deletions or additions may involve
one
or more nucleotides. The variants may be altered III coding or non-coding
regions
or both. Alterations in the coding regions may produce conservative or non-
conservative amino acid substitutions, deletions or additions. Especially
preferred
among these are silent substitutions, additions and deletions, which do not
alter the
properties and activities of the pyruvate carbox;ylase protein or portions
thereof.
Also especially preferred in this regard are conservative substitutions. Most
highly
preferred are nucleic acid molecules encoding t:he pyruvate carboxylase
protein
having the amino acid sequence shown in Figure: 1 (SEQ ID N0:2).
Also preferred are mutants or variants whereby preferably pyruvate
carboxylase is expressed 2 to 20 fold higher than its expression in C'.
glutanaicum as well
as feedback inhibition mutants.
Further embodiments of the invention include isolated nucleic acid
molecules comprising a poiynucleotide having a :nucleotide sequence at least
90%
identical, and more preferably at least 95%, 97°r6, 98% or 99%
identical to (a) a
nucleotide sequence encoding the pyruvate carboxylase polypeptide having the
complete amino acid sequence in SEQ ID NO:2; (b) a nucleotide sequence
encoding the pyruvate carboxylase polypeptide :having the complete amino acid
sequence encoded by the cosmid clone contained in ATCC Deposit No. ; or
{c) a nucleotide sequence complementary to any of the nucleotide sequences in
(a)
or (b).
By a polynucleotide having a nucleotide sequence at least, for example,
95% "identical" to a reference nucleotide sequence encoding a pyruvate
carboxylase
polypeptide is intended that the nucleotide sequence of the polynucleotide is
identical to the reference sequence except that tlxe poiynucleotide sequence
may
include up to five point mutations per each 100 nucleotides of the reference
CA 02356446 2001-06-19
WO 00/39305 1~ PCT/US98/27301
nucleotide sequence encoding the pyruvate carboxylase polypeptide. In other
words, to obtain a polynucleotide having a nucleotide sequence at least 95%
identical to a reference nucleotide sequence, up to 5% of the nucleotides in
the
reference sequence may be deleted or substituted with another nucleotide, or a
number of nucleotides up to 5% of the total nucleotides in the reference
sequence
may be inserted into the reference sequence. 'These mutations of the reference
sequence may occur at the 5' or 3' terminal positions of the reference
nucleotide
sequence or anywhere between those terminal positions, interspersed either
individually among nucleotides in the reference sequence or in one or more
contiguous groups within the reference sequenec:.
As a practical matter, whether any particular nucleic acid molecule is at
least 90%, 95%, 97%, 98% or 99% identical to, for instance, the nucleotide
sequence shown in Figure 1 or to the nucleotides sequence of the deposited
cosmid
clone can be determined conventionally using known computer programs such as
the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics Computer Group, University Research Park, 575 Science Drive, Madison,
WI 5371 i). Bestfit uses the local homology algorithm of Smith and Waterman
(Advances in Applied Mathematics 2: 482-489 ( 1981 )) to find the best segment
of
homology between two sequences. When using Bestfit or any other sequence
alignment program to determine whether a particular sequence is, for instance,
95%
identical to a reference sequence according to the present invention, the
parameters
are set, of course, such that the percentage of identity is calculated over
the full
length of the reference nucleotide sequence and that gaps in homology of up to
5%
of the total number of nucleotides in the reference sequence are allowed.
The present application is directed to nucleic acid molecules at least 90%,
95%, 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1
(SEQ ID NO: l ) or to the nucleic acid sequence of the deposited DNA,
irrespective
of whether they encode a polypeptide having pyruvate carboxylase activity.
This
is because, even where a particular nucleic acid molecule does not encode a
polypeptide having pyruvate carboxylase activity,, one of skill in the art
would still
know how to use the nucleic acid molecule, for instance, as a hybridization
probe
or a polymerase chain reaction (PCR) primer.
CA 02356446 2001-06-19
WO 00139305 11 PCTIUS98/27301
Preferred, however, are nucleic acid molecules having sequences at least
90%, 95%, 97%, 98% or 99% identical to the nucleic acid sequence shown in
Figure I (SEQ ID NO:1 } or to the nucleic acid sequence of the deposited DNA
which do, in fact, encode a polypeptide having pyruvate earboxylase protein
activity. By "a polypeptide having pyruvate carboxylase activity" is intended
polypeptides exhibiting activity similar, but not necessarily identical, to an
activity
of the pyruvate carboxylase protein of the invention as measured in a
particular
biological assay.
Of course, due to the degeneracy of the genetic code, one of ordinary
skill in the art will immediately recognize that a large number of the nucleic
acid
molecules having a sequence at least 90%, 95%, '97%, 98%, or 99% identical to
the
nucleic acid sequence of the deposited DNA or the nucleic acid sequence shown
in
Figure l (SEQ ID NO; I } will encode a polypeptide "having pyruvate
carboxylase
protein activity." In fact, since degenerate variants ofthese nucleotide
sequences all
encode the same polypeptide, this will be clear to the skilled artisan even
without
performing the above described comparison assay. It will be further recognized
in
the art that, for such nucleic acid molecules that are not degenerate
variants, a
reasonable number will also encode a polypeptide having pyruvate carboxylase
protein activity. This is because the skilled artisan is fully aware of amino
acid
substitutions that are either less likely or not likely to significantly
effect protein
function (e.g.; replacing one aliphatic amino acid with a second aliphatic
amino
acid).
For example, guidance concerning how to make phenotypically silent
amino acid substitutions is provided in Bowie, 3. U., et crl., "Deciphering
the
Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science
27:1306-1310 (1990), wherein the authors irrdicate that there are two main
approaches for studying the tolerance of an amino acid sequence to change. The
first method relies on the process of evolution, in which mutations are either
accepted or rejected by natural selection. The second approach uses genetic
engineering to introduce amino acid changes at specific positions of a cloned
gene
and selections or screens to identify sequences that maintain functionality.
As the
authors state, these studies have revealed that proteins are surprisingly
tolerant of
CA 02356446 2001-06-19
WO 00139305 I2 PCT/US98127301
amino acid substitutions. The authors further indicate which amino acid
changes
are likely to be permissive at a certain position c>f the protein. For
example, most
buried amino acid residues require nonpolar side chains, whereas few features
of
surface side chains are generally conserved. ~'Jther such phenotypicaIly
silent
substitutions are described in Bowie, J.U., et cri'., szrpra, and the
references cited
therein.
hectors ajzd Host Cells
The present invention also relates to vectors which include the isolated
IO DNA molecules of the present invention, host cells which are genetically
engineered with the recombinant vectors, and the production of pyruvate
carboxylase polypeptides or portions thereof by recombinant techniques.
Recombinant constructs may be introduced into host cells using well
known techniques such as infection, transduction, transfection, transvection,
conjugation, electroporation and transformation. The vector may be, far
example,
a phage, plasmid, viral ar retroviral vector.
The polynucleotides may be joined to a vector containing a selectable
marker for propagation in a host. Generally, a frlasmid vector is introduced
in a
precipitate, such as a calcium phosphate precipitate, or in a complex with a
charged
lipid. If the vector is a virus, it may be packaged in vitro using an
appropriate
packaging cell line and then transduced into host cells.
Preferred are vectors comprising cis-acting control regions to the
polynucleotide of interest. Appropriate trans-acting factors may be supplied
by the
host, supplied by a complementing vector or supplied by the vector itself upon
introduction into the host.
In certain preferred embodiments in this regard, the vectors provide for
specific expression, which may be inducible and/or cell type-specific.
Particularly
preferred among such vectors are those inducible by environmental factors that
are
easy to manipulate, such as temperature and nutrient additives.
Expression vectors useful in the present invention include chromosomal-,
episomal- and virus-derived vectors, e.g., vectors derived from bacterial
plasmids,
bacteriophage, yeast episomes, yeast chromosomal elements, viruses such as
CA 02356446 2001-06-19
WO 00/39305 13 PCT/US98/27301
baculoviruses, papova viruses, vaccinia viruses, adenoviruses, fowl pox
viruses.
pseudorabies viruses and retroviruses, and vectors derived from combinations
thereof such as cosmids and phagemids.
The DNA insert should be operatively lil~ked to an appropriate promoter.
S such as the phage lambda PL promoter, the E. coli lac, trp and tcrc
promoters. the
SV40 early and late promoters and promoters of retroviral LTRs, to name a
fe'v.
Other suitable promoters will be known to the skilled artisan. The expression
constructs will further contain sites for transcription initiation.
termination and. in
the transcribed region, a ribosome binding site for translation. The coding
portion
of the mature transcripts expressed by the constructs will include a
translation
initiating codon (AUG or GUG) at the beginning and a termination codon
appropriately positioned at the end of the polype:ptide to be translated.
As indicated, the expression vectors will preferably include at least one
selectable marker. Such markers include dihydrofolate reductase or neomycin
resistance for eukaryotic cell culture and tetracycline, ampicillin,
chloramphenicol
or kanamycin resistance genes for culturing in E. coli and other bacteria.
Representative examples of appropriate hosts include bacterial cells, such as
E. coli,
C. glutanZicum, Streptomyces and Salmonella typ,~rimurium cells: fungal cells,
such
as yeast cells. Appropriate culture media and conditions for the above-
described
host cells are known in the art.
Among vectors preferred for use in bacteria include pA2, pQE70, pQE60
and pQE-9, available from Qiagen; pBS vectors.. Phagescript vectors,.
Bluescript
vectors, pNHBA, pNHl6a, pNHl8A, pNH46A, available from Stratagene; and
ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia.
Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI and
pSG available from Stratagene; and pSVK3, pB:PV, pMSG and pSVL available
from Pharmacia. Other suitable vectors will be. readily apparent to the
skilled
artisan.
Among known bacterial promoters suitable for use in the present
invention include the E. coli lacl and IucZ promoters, the T3 and T7
promoters. the
gpt promoter, the lambda PR and PL promoters .and the dp promoter. Suitable
eukaryotic promoters include the CMV immediate early promoter, the HSV
CA 02356446 2001-06-19
WO 00/39305 14 PCT/US98/27301
thymidine kinase promoter, the early and late S'V40 promoters. the promoters
of
retroviral LTRs, such as those of the Rous sarcoma virus (RSV), and
metallothionein promoters, such as the mouse metallothionein-I promoter.
introduction of the construct into the host cell can be effected by calcium
phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-
mediated transfection, electroporation, transduction, infection or other
methods.
Such methods are described in many standard laboratory manuals. such as Davis
et
crl., "Basic Methods in Molecular Biology," (1986).
Transcription of the DNA encoding the polypeptides of the present
invention by higher eulcaryotes may be increased by inserting an enhancer
sequence
into the vector. Enhancers are cis-acting elements of DNA, usually about from
10
to 300 by that act to increase transcriptional activity of a promoter in a
given host
cell-type. Examples of enhancers include the SV~40 enhancer, which is located
on
the late side of the replication origin at by 100 to 270, the cytomegalovirus
early
promoter enhancer, the polyoma enhancer on the late side of the replication
origin,
and adenovirus enhancers.
For secretion of the translated protein into the lumen of the endoplasmic
reticulum, into the peripiasmic space or into the extracellular environment,
appropriate secretion signals may be incorporated into the expressed
polypeptide.
The signals may be endogenous to the polypeptide or they may be heterologous
signals.
The polypeptide may be expressed in a modified form, such as a fusion
protein, and may include not only secretion signals, but also additional
heterologous
functional regions. Thus, for instance, a region of additional amino acids,
particularly charged amino acids, may be added to the N-terminus of the
polypeptide to improve stability and persistence in the host cell, during
purification,
or during subsequent handling and storage. Also, peptide moieties may be added
to the polypeptide to facilitate purification.
The pyruvate carboxylase protein can be recovered and purified from
recombinant cell cultures by well-known methods including ammonium sulfate or
ethanol precipitation, acid extraction, anion or ration exchange
chromatography,
phosphocellulose chromatography, hydrophobic interaction chromatography,
CA 02356446 2001-06-19
WO 00!39305 15 PCT/US98/27301
affinity chromatography, hydroxylapatite chromatography and lectin
chromatography. Most preferably, high performance liquid chromatography
("HPLC") is employed for purification.
Polypeptides of the present invention include naturally purified products,
products of chemical synthetic procedures, and products produced by
recombinant
techniques from a prokaryotic or eukaryotic host; inclfuding, for example,
bacterial, yeast,
higher plant, insect and mammalian cells. Depending upon the host employed in
a
recombinant production procedure, the polypeptidf;s of the present invention
may be
glycosylated or may be non-glycosylated. In addition, polypeptides of the
invention may
also include an initial modified methionine residue, in some cases as a result
of host-
mediated processes.
Pyruvate Carboxylase Polypeptides and Peptides -
The invention further provides an isolated pyruvate carboxylase
polypeptide having the amino acid sequence encodled by the deposited DNA, or
the
amino acid sequence in Figure I (SEQ ID N0:2), or a peptide or polypeptide
comprising a portion of the above polypeptides. The terms "peptide" and
"oligopeptide" are considered synonymous (as is commonly recognized) and each
term can be used interchangeably as the context requires to indicate a chain
of at
least to amino acids coupled by peptidyl linkages. The word "polypeptide" is
used
herein for chains containing more than ten amino acid residues. Ali
oligopeptide
and polypeptide formulas or sequences herein are written from left to right
and in
the direction from amino terminus to carboxy terminus.
It will be recognized in the art that some amino acid sequence of the
pyruvate carboxylase polypeptide can be varied vrithout significant effect on
the
structure or function of the protein. If such differences in sequence are
contemplated, it should be remembered that there will be critical areas on the
protein which determine activity. In general, it is possible to replace
residues which
form the tertiary structure, provided that residues performing a similar
function are
used. In other instances, the type of residue may be completely unimportant if
the
alteration occurs at a non-critical region of the protein.
CA 02356446 2001-06-19
WO 00/39305 I~ PCT/US98/27301
Thus, the invention further includes variations of the pyruvate
carboxylase poiypeptide which show substantial activity or which include
regions
ofpyruvate carboxylase protein such as the protein portions discussed below.
Such
mutants include deletions, insertions. inversions, repeats, and type
substitutions (for
example, substituting one hydrophilic residue: for another, but not strongly
hydrophilic for strongly hydrophobic as a rule). Small changes or such
"neutral"
amino acid substitutions will generally have little effect on activity.
Typically seen as conservative substitutions are the replacements, one for
another, among the aliphatic amino acids Ala, Va~l, Leu and Ile; interchange
of the
IO hydroxyl residues Ser and Thr, exchange of .the acidic residues Asp and
Glu,
substitution between the amide residues Asn and Gln, exchange of the basic
residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.
_ As indicated in detail above, further guidance concerning which amino
acid changes are likely to be phenotypically silent (i.e., are not likely to
have a
significant deleterious effect on a function) can be found in Bowie, J.U., et
al.,
"Deciphering the Message in Protein Sequences: Tolerance to Amino Acid
Substitutions," Science 247.1306-1310 (1990).
The polypeptides of the present invention are preferably provided in an
isolated form, and preferably are substantially purified. A recombinantly
produced
version of the pyruvate carboxylase polypeptide cam be substantially purified
by the
one-step method described in Smith and Johnson., Gene 67:31-40 (1988).
The polypeptides of the present invention include the polypeptide
encoded by the deposited DNA, the polypeptide of SEQ ID N0:2, as well as
polypeptides which have at least 90% similarity, more preferably at least 95%
similarity, and still more preferably at least 97%, 98% or 99% similarity to
those
described above. Furtherpolypeptides ofthepresent invention include
polypeptides
at least 70% identical, more preferably at least 9~D% or 95% identical, still
more
preferably at least 97%, 98% or 99% identical to the poiypeptide encoded by
the
deposited DNA, to the polypeptide of SEQ ID NO:2, and also include portions of
such polypeptides with at least 30 amino acids and more preferably at least 50
amino acids.
By "% similarity" for two polypeptides is intended a similarity score
CA 02356446 2001-06-19
WO 00/39305 1,~ PCT/US9$127301
produced by comparing the amino acid sequences ofthe two polypeptides using
the
Bestfit program {Wisconsin Sequence Analysis Package, Version 8 for Unix,
Genetics Computer Group, University Research Park, 575 Science Drive, Madison,
WI 53711) and the default settings for determining similarity. Bestfit uses
the local
homology algorithm of Smith and Waterman (Advances in Applied Mathematics
2: 482-489, 1981) to find the best segment of similarity between two
sequences.
By a polypeptide having an amino acid sequence at least, for example,
95% "identical" to a reference amino acid sequence of a pyruvate carboxylase
polypeptide is intended that the amino acid sequence of the polypeptide is
identical
to the reference sequence except that the polypeptide sequence may include up
to
five amino acid alterations per each 100 amino acids of the reference amino
acid of
the pyruvate carboxylase polypeptide. In other words, to obtain a polypeptide
having an amino acid sequence at least 95% identical to a reference amino acid
sequence, up to 5% of the amino acid residues in the reference sequence may be
deleted or substituted with another amino acid, or a number of amino acids up
to
5% of the total amino acid residues in the reference sequence may be inserted
into
the reference sequence. These alterations of the reference sequence may occur
at
the amino or carboxy terminal positions of the reference amino acid sequence
or
anywhere between those terminal positions, interspersed either individually
among
residues in the reference sequence or in one or more contiguous groups within
the
reference sequence.
As a practical matter, whether any particular polypeptide is at least 90%,
95%, 97%, 98% or 99% identical to, for instance, 'the amino acid sequence
showm
in Figure 1 {SEQ ID N0:2) or to the amino acid sequence encoded by deposited
2S cosmid clone can be determined conventionally using known computer programs
such the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, 575 Science Drive,
Madison, WI 53711. When using Bestfit or any other sequence alignment program
to determine whether a particular sequence is, far instance, 95% identical to
a
reference sequence according to the present invention, the parameters are set,
of
course, such that the percentage of identity is calculated over the full
length of the
reference amino acid sequence and that gaps in homology of up to 5% of the
total
CA 02356446 2001-06-19
WO 00/39305 ig PCTIUS98/27301
number of amino acid residues in the reference sequence are allowed.
Genetic Fools for Manipulating Corynebacterrum
To make the genetic changes necessary for metabolic engineering in
Corynebacterium, researchers need to be able to identify and clone the genes
that are
involved in the target pathway. They also need methods for altering these
genes to affect
the regulation or level of expression of the enzymes they encode, and for
subsequently
reintroducing the altered genes into Corynebactenitr~;rr to monitor their
effects on amino
acid biosynthesis. Therefore, metabolic engineers must nave at their disposal
an array of
plasmids that can replicate in both Coryrrebacterium and other, more easily
manipulated
hosts, such as E. coli. Also required are a collection of selectable markers
encoding, for
example, antibiotic resistance, well-characterized transcriptional promoters
that permit
regulation of the altered genes, and efficient transformation or conjugation
systems that
allow the plasmids to be inserted into the target Corynebacterium strain.
Plasmids. Several different plasmids have been isolated and developed for the
introduction and expression of genes in Corynebacterium (Sonnen, H., et al.,
Gene
107:69-74 (1991)}. The majority ofthese were originally identified as small (3-
5 kbp),
cryptic plasmids from C glutamicum, C. callunae, and C lactofermentum. They
fall into
four compatibility groups, exemplified by the plasnaids pCC 1, pBL 1, pHM
1519, and
pGA 1. Shuttle vectors, plasmids that are capable of replicating in both
Corynebacterium
and E. coli, have been developed from these cryptic plasmids by incorporating
elements
from known E. coli plasmids (particularly the CoIEl origin of replication from
pBR322
or pUC 18), as well as antibiotic-resistance markers. A, fifth class of
plasmids that is very
useful for manipulating Co~ynebacterium is based on pNG2, a plasmid originally
isolated
from Corynebacterium di,~htheriae (Serwold-Davis, lt'.M., et al., Proc. Natl.
Acad. Sci.
USA 84:4964-4968 ( 1987)}. This plasmid and its derivatives replicate
efficiently in many
species of corynebacteria, as well as in E. coli. Since the sole origin of
replication in
pNG2 (an element of only 1.8 kbp) functions in both the Gram-positive and Gram-
negative host, there is no need to add an additional ColEl-type element to it.
As a result,
pNG2 derivatives (e.g., pEP2) are much smaller than other Corynebacterium
shuttle
CA 02356446 2001-06-19
WO OOI39305 19 PCT/US98/27301
vectors and are therefore more easily manipulated.
Selectable Markers. Several genes conferring antibiotic resistance have proven
useful for plasmid selection and in other recombinant DNA work in
corynebacteria.
These include the kanamycin resistance determinant from Tn903. a hygromycin
resistance marker isolated from Streptomyces hygr~oscopicus~, a tetracycline
resistance
gene from StreptococcZrs .faecalis, a bleomycin resistance gene from Tn.S, and
a
chloramphenicol resistance marker from Streptomyce.s acrimycini. The ~3-
Iactamase gene
that is employed in many E. toll plasmids such as pBR322 does not confer
ampicillin
IU resistance in Corynebacterium.
Transformation Systems. Several methodshave been devised for introducing
foreign
DNA into Corynebacterium. The earliest method 1:o be employed routinely was
based
on protocols that had been successful for other Grarn-positive species
involving
incubation of spheroplasts in the presence of DNA arid polyethylene glycol
(Yoshihama,
M., et al., J. Bacteriol.162:591-X97 (1985)). While useful, these methods were
generally
inefficient, often yielding fewer than 105 transformants per milligram of DNA.
Electroporation of Corynebacterium spheroplasts has proven to be a much more
efficient
and reliable means of transformation. Spheroplasts are generated by growing
the cells
in rich media containing glycine and/or low concentrations of other inhibitors
of cell wall
biosynthesis, such as isonicotinic acid hydrazide (isoniazid), ampicillin,
penicillin G, or
Tween-80. The spheroplasts are then washed in low-salt buffers containing
glycerol,
concentrated, and mixed with DNA before being subjected to eiectroporation.
Efficiencies as high as 10' transformants per microgram of plasmid DNA have
been
reported with this protocol.
A third method for DNA transfer into corynebacteria involves
transconjugation. This method takes advantage of the promiscuity of E. toll
strains
carrying derivatives of the plasmid RP4. In E. toll., RP4 encodes many
functions that
mediate the conjugal transfer of plasmids from the host strain to other
recipient strains
of E. toll, or even to other species. These "tra functions" mediate piius
formation and
plasmid transfer. RP4 also carries an origin of transfer, oriT, a cis-acting
element that is
recognized by the transfer apparatus that allows the plasmid to be conducted
through the
CA 02356446 2001-06-19
WO 00/39305 2o PCTNS98/2730I
pilus and into the recipient strain. From this system Simon c~t al.
(l3io.~Technology 1:'784-
791 (1985)) have developed a useful transconjugation tool that allows the
transfer of
plasmids from E. coli to Coryuebacteritrna. They relocated the tr-a functions
from RP4
into the E. coli chromosome in a strain called S 17- l . Plasmids carrying the
RP4 oriT can
be mobilized from S 17-I into other recipients very efficiently. Although this
method has
proven useful for introducing replicating plasmids into Corynebacteriuna, it
has proven
even more useful for generating gene disruptions. This is accomplished by
introducing
a selectable marker into a clone of the Corynebacteriurr7 gene that is
targeted for
disruption. This construct is then ligated into an E. coli plasmid that
carries the RP4 oriT
but lacks an origin to support replication in Corwrrebucterium. S17-1 carrying
this
plasmid is then incubated with the recipient strain and the mixture is later
transferred to
a selective medium. Because the plasmid that was introduced is enable to
replicate in
corynebacteria, transconj ugants that express the selectable marker are most
likely to have
undergone a cross-over recombination within the g~enomic DNA.
IS
Restriction-Deficient Strains. Regardless of the transformation system used,
there
is clear precedent in the literature that corynebacteria are able to recognize
E. coli-derived
DNA as foreign and will most often degrade it. This ability has been
attributed to the
Coryrrebacterium restriction and modification system. To overcome this system,
same
transformation and transconjugation protocols call for briefly heating the
recipient strain
prior to transformation. The heat treatment presumably inactivates the enzymes
responsible for the restriction system, allowing the introduced DNA to become
established before the enzymes are turned over. Another strategy far improving
the
efficiency of DNA transfer has been to isolate Coryhebacterium mutants that
are deficient
in the restriction system. These strains will incorporate plasmids that had
been
propagated in E coli with almost the same efficiency as plasmids that had been
propagated in Corynebacterium. In an alternate strategy used to circumvent the
restriction system in Coryrrebacterium, Leblon and coworkers (Reyes, O., et
al., Gene
107:61-68 (1991)) developed an "integron" system for gene disruption.
Integrons are
DNA molecules that have the same restriction/rnodifi cation properties as the
target host's
DNA, carry DNA that is homologous to a portion of the host genome (i.e., a
region of the
genome that is to be disrupted), and are unable to replicate in the host cell.
A cloned gene
CA 02356446 2001-06-19
w0 00/39305 21 PCT/US98/27301
from Corynebacteritrm is first interrupted with a selectable marker in a
plasmid that is
propagated in one Cornynebacterium strain. This construct is then excised from
the
corynebacterial plasmid and self ligated to forni a nan-replicating circular
molecule. This
"integron" is then electroporated into the restrictive host. Modif cation of
the DNA
allows the integron to elude the host restriction system, and recombination
into the host
genome permits expression of the selectable marker°.
Promoters. Reliable transcriptional promoters are required for efficient
expression
of foreign genes in Corynebacterium. For certain experiments, there is also a
need for
regulated promoters whose activity can be induced under specific culture
conditions.
Promoters such as the _ fda, thrC, and hom promoters derived from
Corynebacterium
genes have proven useful for heterologous gene expression. Inducible promoters
from
E. coli, such as P,~,~., and P,r~., which are induced by
isopropylthiogaiactopyranoside
(IPTG) when the lac repressor (lack is present; P,rr, which responds to the
inducer indole
acrylic acid when the trp repressor (trpR} is present; and lambda P,,, which
is repressed
in the presence of the temperature-sensitive lambda repressor (cI857), have
all been used
to modulate gene expression in Corynebacterium.
Gene Identification. With all other genetic tools in place, there still
remains the
challenge of identifying relevant genes from Coryncbacteriurn. In E. coli,
some of the
resources that have been used to isolate genes arf: transducing phage,
transposable
elements, genetic maps of the E. coli chromosome from transduction and
transconjugation experiments, and more recently, complete physical and
sequence maps
of the chromosome. To date, the most successful method for identifying and
recovering
2S genes from Corynebacterium has been to use Corynebacterium genomic DNA to
complement known auxotrophs ofE. coli. In this exercise, libraries of plasmids
carrying
fragments of the Corynebacterium genome are introduced into E. coli strains
that are
deficient in a particular enzyme or function. Transformants that no longer
display the
auxotrophy (e.g., homoserine deficiency) are likely to ~~arry the
complementing gene from
Corynebacterium. This strategy has led to isolation of numerous
Cor~mebacterium genes,
including several from the pathways responsible for synthesis of aspartate-
derived and
aromatic amino acids, intermediary metabolism, and other cellular processes.
One
CA 02356446 2001-06-19
WO 00/39305 22 PCT/US98/27301
limitation to this strategy is that not all genes from Corynebacteriunt will
be expressed
in the E. toll host. Thus, although a gene may be represented in the plasmid
library, it
may be unable to complement the E. toll mutation and therefore would not be
recovered
during selection. Overcoming this limitation, a smaller number of genes have
been
S identified with a similar strategy in which a plasmid library from wild-type
Corynebacterium was used to directly complement mutations in other
Coryrrebacterium
strains. Although this strategy avoids the concern of insufficient gene
expression in the
auxotrophic host, its utility is limited by poor plasrnid-transformation
efficiency in the
auxotrophs. Still other genes have been identified by hybridization with
nucleic acid
probes based upon homologous genes from other species, and direct
amplification of
genes using the polymerase chain reactian and degenerate oligonucleotide
primers.
Transposable Elements. Transposable elements .are extremely powerful tools in
gene
identif cation because they couple mutagenesis with gene recovery. Unlike
classical
mutagenesis techniques, which generate point mutations or small deletions
within a gene,
when transposable elements insert within a gene they form large disruptions,
thereby
"tagging" the altered gene for easier identification. A number of transposable
elements
have been found to transpose in Corynebacterium. 'Transposons found in the
plasmids
pTP 10 of C. xerosis and pNG2 of C. diphtheriae have been shown to transpose
in C.
glutamicum and confer resistance to erythromycin. A group from the Mitsubishi
Chemical Company in Japan developed a series of artificial transposons from an
insertion
sequence, IS3 I 831, that they discovered in C. glutanticum (Vertes, A.A.,
etal., Mol. Gen.
Genet. 2:15:397-405 (1994)). After inserting a selectable marker between the
inverted
repeats ofIS3I831, these researchers were able to introduce the resulting
transposon into
C. glutamicum strains on an E. toll plasmid (unable to replicate in
Coryraebacterium) via
electroporation. They found that the selectable marker had inserted into the
genome of
the target cell at a frequency of approximately 4 x i 0~ mutants/ug DNA. The
use of such
transposons to generate Corynebacterium auxotrophs has led to the isolation of
several
genes responsible for amino acid biosynthesis, as well as other functions in
corynebacteria.
Transducing Phage. Transducing phage have been used in other systems for
mapping
CA 02356446 2001-06-19
WO 00/39305 23 PCT/US98/2'1301
genetic loci and for isolating genes. In 1976, researchers at Ajinomoto Co. in
Japan
surveyed 1 SO strains of characterized and uncharacterized strains of glutamic
acid-
producing coryneform bacteria to identify phage that might be useful for
transduction
(Mornose, H., et al., J. Gen. Appl. Microbiol. Reo. 1n5:243-2S2 (1995)). Of 24
different
phage isolates recovered from this screen, only three were able to transduce a
trp marker
from a trp+ donor to a trp recipient with any appreciable frequency, although
even this
efficiency was only i 0'' or less. These researchers were able to improve
transduction
efficiency slightly by including 4 mM cyclic adenosine monophosphate (CAMP) or
1.2
M magnesium chloride. Several different researchers have attempted to develop
reliable
transduction methods by isolating coynephages from sources such as
contaminated
industrial fermentations, soil, and animal waste. ,Although mam~ nhane have
hPPn
isolated and characterized, few have been associated with transduction, and an
opportunity still exists to develop a reliable, high-efficiency transduction
system for
general use with the glutamic acid-producing bacteria.
EXAMPLES
The following protocols and experimental details acre referenced in the
examples that
follow.
Bacterial strai~a a~:rl Rlasmids
C. glutamicum 21253 (hom-; lysine overproducer) was used for the preparation
of
chromosomal DNA. Escherichia coli DHSa (hsdR~, recA-) (Hanahan, D., J. Mol.
Biol.
166:SS7-580 (1983)) was used fortransformations. Plasmid pCR2. t TOPO
(lnvitrogen)
was used for cloning polymerase chain reaction (PCR.) products. The plasmid
pRR8S0
was constructed in this study and contained an 8S0-by PCR fragment cloned in
the
pCR2.l TOPO plasrnid.
CA 02356446 2001-06-19
WO 00/39305 24 PCT1US98/27301
Media and cttlture conditions
E. coli strains were grown in Luria-Bertani (LB) medium at 37°C
(Sambrook, J.,
et al., Molecular' cloning: a laboratory rnuntral, 2nd edn., Cold Spring
Harbor
S Laboratory, Cold Spring Harbor, NY ( i 989)). C. glutamictrm was grown in LB
medium
at 30°C. Where noted, ampicillin was used at the following
concentrations: 100 ~glmI
in plates and 50 ~g/ml in liquid culture.
DNA mattipttlations
Genomic DNA was isolated from C glutarrzicum as described by Tomioka et al.
(Tomioka, N., et al., Mol. Ger~. Genet. 184:359-363 (:1981 )). PCR fragments
were cloned
into the pCR2.1 TOPO vector following the manufacturer's instructions. Cosmid
and
plasmid DNA were prepared using Qiaprep spin columns and DNA was extracted
from
agarose gels with the Qiaex kit (Qiagen): For large-scale high-purity
preparation of
cosmid DNA for sequencing, the Promega Wizard kit was used (Promega). Standard
techniques were used for transformation of E. coli and agarose gel
electrophoresis
(Sambrook, J., et al., Molecular cloning a laboratory manual, 2nd edn., Cold
Spring
Harbor Laboratory, Cold Spring Harbor, NY (1989)). Restriction enzymes were
purchased from Boehringer Mannheim or New England Biolabs.
Cosmid library
The cosmid library used was constructed by cloning C. glutarnicum chromosomal
DNA into the Supercos vector (Stratagene).
Polymerase Clrain Reaction (PCR)
PCR was performed using the Boehringer Manunheim PCR core kit following the
manufacturer's instructions. When PCR was performed on Coryrzebacterium
chromosomal DNA, about 1 ug DNA was used in each reaction. The forward primer
used was
5'GTCTTCATCGAGATGAATCCGCG3' and the reverse primer used was
CA 02356446 2001-06-19
WO 00/39305 ~5 PCTIUS98/27301
5'CGCAGCGCCACATCGTAAGTCGC3' for the PCR reaction.
Dot blot analysis
Dot blots containing DNA from cosmids identified in this study and the probe
as
a positive control were prepared using the S&S (SchI~eicher & Schiill)
minifold apparatus.
An 850-by fragment encoding a portion of the C. gh~~tamicum pyruvate
carboxylate gene
was used as the probe. The probe was labeled with digoxigenin-l l-dUTP
(Boehringer
Mannheim) in a randomly primed DNA-labeling reaction as described by the
manufacturer. Hybridization, washing and colorimetric detection of the dot
blots were
done with the Genius system from Boehringer following the protocols in their
user's
guide for filter hybridization. The initial hybridization with the 291 cosmids
was carried
out at 65 °C overnight and washes were performed at the hybridization
temperature. For
the 17 cosmids that were used in the second screen, 'the hybridization was
carried out at
65 °C, but for only 8 h, and the time of exposure to the film was
decreased.
Detection of biotin-coy:tai~ti~tg proteins by Western blotting
Cell extracts from C. glutamicum were prepared as described by Jetten and
Sinskey
(Jetten, M.S.M., & Sinskey, A.J., FEMSMicrobiol. l,ett. 111:183-188 (1993)).
Proteins
in cell extracts were separated in sodium dodecyl sulfate (SDS}17.5%
polyacrylamide gels
in a BioRad mini gel apparatus and were electroblotted onto nitro-cellulose,
using the
BioRad mini transblot apparatus described by Towbin et al. (Towbin, H., et
al., Proc.
Natl. Acad. Sci. USA 76:4350-4354 (1979)). Biotinylated proteins were detected
using
avidin-conjugated alkaline phosphatase from BioRad and 5-bromo-4-chloro-3-
indoyiphosphate-p-toludine saltlnitroblue tetrazolium chloride from Schleicher
& Schiill.
DNA seguencing
Automated DNA sequencing was performed by the MIT Biopolymers facility
employing an ABI Prism 377 DNA sequencer.
CA 02356446 2001-06-19
WO 00/39305 26 PCT/US98/27301
Segtience attalysis
The program DNA Strider Version 1.0 (In stitut de Recherche Fondamentale,
France) was used to invert, complement and translate the DNA sequence, and
find open-
s reading frames in the sequence. The BLAST program (Altschul, S.F., et al.,
.I. Mol. Biol.
215:403-410 (1990)) from the National Center for Biotechnology Information
(NCBI)
was employed to compare protein and DNA sequences. Homology searches in
proteins
were done using the MACAW software (NCBI). PCR primers were designed with the
aid of the Primer Premier software from Biosoft International. The compute
pI/MW tool
on the ExPasy molecular biology server (University of Geneva) was used to
predict the
molecular mass and pI of the deduced amino acid sf;quence.
Example l: Western blotting to detect biotinylated enzymes
Since pyruvate carboxylate is known to contain biotin, Western blotting was
used
to detect the production of biotinylated proteins by C. glutamicurn. Two
biotinylated
proteins were detected in extracts prepared from cells grown in LB medium,
(data not
shown) consistent with previous reports. One band, located at approximately 80
kDa, has
been identified as the biotin-carboxyl-carrier domain (BCCP) of the acetyl-CoA
carboxylase (lager, W., et al., Arch. Microbiol. 166: ~~6-$2 (1996)). The
second band, at
120 kDa, is believed to be the pyruvate carboxylase enzyme, as these proteins
are in the
range 113-130 kDa (Attwood, P.V., I»1. J. Biochenz Cell. Bivl. 27:231-249
(1995)).
Example 2: PCR and cloning
C. glutamicum pyruvate carboxylase gene was cloned on the basis ofthe homology
ofhighly conserved regions in previously cloned genes. Pyruvate earboxylase
genes from
thirteen organisms were examined and primers corresponding to an ATP-binding
submotif conserved in pyruvate carboxylases and tlae region close to the
pyruvate-binding
motif {Table 1 ) were designed. Where the amino acids were different the
primers were
designed on the basis of M. tuberculosis becausf: of its close relationship to
C.
glutamicum. An 850-by fragment was amplified from C. glutamicun? genomic DNA
using the PCR and cloned in the pCR2.1 TOPO vector of Invitrogen to construct
plasmid
CA 02356446 2001-06-19
WO 00/39305 ~7 PCTIUS98/2~301
pRR850. Primers were also designed based on the conserved biotin-binding site
and
pyruvate-binding site (data not shown).
Example 3: Isolating a cosmirl cor:taiuiug the C. glutanzicur~: pyruvate
carboaylase
S get:e
The 850-base-pair fragment containing a portion of the C. glutamicum pyruvate
carboxylase gene was used to probe a C. glutamica.~m genomic library. In the
first round
of screening, 17 out of 291 cosmids in a dot blot appeared positive. A second
round of
screening was performed on these 17 cosmids, using; the same probe but more
stringent
hybridization conditions, yielding four cosmids with a positive signal. To
confirm that
these cosmids indeed contained the pyruvate carboxyl;ase gene, PCR was
performed using
the four positive cosmids as templates and the same primers used to make the
probe. An
850-by fragment was amplified from all four positive cosmids; designated
IIIF10, IIE9,
I5 IIIG7 and IIIB7.
Organism Conserved Conserved
region A region B
Caenorhabditis elegafzs YFIEVNAR ATFDVSM
Aedes aegypti YFIEVNAR ATFDVAL
Mycobacterlunz tuberculosisVFIEMNPR ATYDVAL
Bacillus stearothermophilus YF1EVNP'R ATFDVAY
Pichia pastoris YFIEINPR ATFDVSM
Mus musculus YFIEVNSR ATFDVAM
Rattus norvegicus YFIEVNSR ATFDVAM
2S Saccharomyces cerevisiae YFIEINPR ATFDVAM
1
Saccharomyces cerevisiae 2 YFIEINPR ATFDVAM
Rhizabium etli YFIEVNPR ATFDVSM
Honao sapiens YFIEVNSR ATFDVAM
Schizosaccharonryces pombe YFIEINPF; ATFDVSM
Table 1 Pyruvate carboxylase sequences from 13 organisms (obtained from
GenBank)
were aligned using the MACAW software. Two highly conserved regions were
selected
and oliganucleotide primers were designed on the basis ofthe Mycobacterium
tuberculosis
DNA sequence corresponding to these regions. The forward primer was based on
the
3S DNA sequence corresponding to conserved region A and the reverse primer was
based on
the DNA sequence corresponding to conserved region B.
CA 02356446 2001-06-19
WO 00/39305 2g PCT/US98127301
Example 4: Sequencing strategy
The 850-by insert of plasmid pRR850 was sequenced using the M13 forward and
M 13 reverse primers. On the basis of this sequence, primers Begrev 1 and
Endforl were
designed and used to sequence outwards from the beginning and the end of the
850-by
portion of the pyruvate carboxylase gene. Cosmid III FI O was used as the
sequencing
template. The sequencing was continued by designing new primers (Table 2) and
"walking" across the gene.
Exanrple S: Seqttence analysis
3637 by of cosmid III F10 were sequenced. A 3420-by open reading frame was
identif ed, which is predicted to encode a protein of I I40 amino acids. The
deduced
protein is 63% identical to M. tuberculosis pyruvate carboxylase and 44%
identical to
human pyruvate carboxylase, and the C. glutamicum gene pc was named on the
basis of
this homology. The deduced protein has a predicted pI of 5.4 and molecular
mass of
123.6 kDa, which is similar to the subunit molecular mass of 120 kDa estimated
by
SDS/polyacrylamide gel electrophoresis. Upstream of the starting methionine
there
appears to be a consensus ribosome binding-site AAGGAA. The predicted
translational
start site, based on homology to the M. tuberculosis sequence, is a GTG colon,
as has
been observed in other bacterial sequences (Stryer, L., Biochemistry, 3rd
edn., Freeman,
NY (1988); Keilhauer, C., et al., J. Bacteriol. 17.1:5595-5603 (1993)). The
DNA
sequence has been submitted to GenBank and has bef:n assigned the accession
number
AF038548.
The amino-terminal segment of the C. glutatnicunr pyruvate carboxylase
contains
the hexapeptide GGGGRG, which matches the GGGCT(R/K)G sequence that is found
in
all biotin-binding proteins and is believed to be an ATP-binding site (Fry,
D.C., et al.,
Proc. Natl. Acad. Sci. USA 83:907-911 (1986); Post, L.E., et al., J. Biol.
Chem.
265:7742-7747 ( 1990)). A second region that is proposed to be involved in ATP
binding
and is present in biotin-dependent carboxylases and carbamyphosphate
synthetase (Lim,
F., et al., J. Bivl. Chem. 263:11493-11497 (1988)) is conserved in the C.
glutamicum
sequence. The predicted C. glutamicum pyruvate carboxylase protein also
contains a
CA 02356446 2001-06-19
WO 00139305 ~9 PCT/US98/27301
putative pyruvate-binding motif, FLFEDPWDR, which is conserved in the
transcarboxyiase domains of Mycabacteriunr, Rhizobiarn? and human pyruvate
carhoxylases (Dunn, M.F., et al., J. Bacteriol. 178:5960-5970 (T996)).
Tryptophan
fluorescence studies with transcarboxylase have shown that the Trp residue
present in this
motif is involved in pyruvate binding (Kumer, G.K., et al., Biochemistry
27:5978-5983
( 1988)). The carboxy-terminal segment of the enzyme contains a putative
biotin-binding
site, AMKM, which is identical to those found in other pyruvate carboxylases
as well as
the biotin-carboxyl-cawier protein (BCCP) domains of other biotin-dependent
enzymes.
Primer name Primer sequence (5'~-3'}
Begrev 1 TTCACCAGGTCCACCTCG
Endforl CGTCGCAAAGCTGACTCC
Begrev2 GATGCTTCTGTTCiCTAATTTGC
Endfor2 GGCCATTAAGGATATGGCTG
Begrev3 GCGGTGGAATGATCCCCGA
Endfor3 ACCGCACTGGGCCTTGCG
Endfor4 TCGCCGCTTCGGCAACAC
Table 2 DNA sequences of the primers used to obtain the sequence of the
pyruvate
carboxylase gene in the cosm id IIIF 10
Previous studies have shown that phosphoerrolpyruvate carboxylase (ppc) is not
the
main anaplerotic enzyme for C. glutamicum, since its absence does not affect
lysine
production {Gubler, M., et al., Appl. Microbiol. Biotc~chrrol. =10:857-863
(1994); Peters-
Wendisch, P.G., et al., Microbiol. Lett. 112:269-279 (1993)). Moreover, a
number of
studies have indicated the presence of a pyruvate-carboxylating enzyme,
employing' "'C-
labeling experiments and NMR and GC-MS analysis (Park, S.M., et al., Applied
Microbiol. Biotechnol. 47:430-440 (1997b); Peters-Wendisch, P.G., et al.,
Arch.
Microbiol. 165:387-396 ( 1996)), or enzymatic assays with cell free extracts
(Tosaka, O.,
Agric. Biol. Chem. 43:1513-1519 (1979)) and permeable cells (Peters-Wendisch,
P.G.,
et al., Microbiol. I =13:1095-1103 ( 1997)). Very low pyruvate carboxylation
activity were
detected in cell-free extracts, but this activity was noiuncoupled from a very
high ATP
background. It is highly probable that the activity measured is due to
reversible
gluconeogenic enzymes, such as oxaloacetate decarboxylase and malic enzyme.
The
presence of pyruvate carboxylase in C. glutamicum makes it highly unlikely
that the
CA 02356446 2001-06-19
WO 00/39305 30 PCT/US98/2730I
gluconeogenic enzymes mentioned above can serve the anaplerotic needs of this
strain.
The deduced amino acid sequence of the C glutamicum pyruvate carboxylase gene
has significant similarity to the pyruvate carboxyIase sequences from a
diverse group of
organisms. It contains a biotin carboxylase domain in its N-terminal region, a
BCCP
domain in its C-terminal region, and a transcarboxylase domain with a binding
site
specific for pyruvate in its central region. The C. glutamicunr pyruvate
carboxylase
protein showed strong homology to M. tuberculosis and the human pyruvate
carboxylase
(Wexler, LD., et al., Biochim. Biophys. Acta 1227:46-52 (1994)).
There are precedents to finding that C. glutamiczrm contains more than one
enzyme
to perform the anaplerotic function of regenerating oxaloacetate. Pseudomonas
citronellolis, Pseudomonas fluorscens, Azotobacter vinelandii and Thiobacill
ors hovellus
contain both ppc and pyruvate carboxylase {~'B:rien, R. W., et al., J. Biol.
Chem.
2~2: I257-1263 ( 1977); Scrutton, M.C. and Taylor, B.L., Arch. Biochem.
Biophys.
164:641-654 ( 1974); Milrad de Forchetti, S.R., & Cazullo, J.J., J. Gen.
Microbiol. 93:75-
8I (1976); Chaxles, A.M., & Wilier, D.W., Can. J. Microbiol. 30:532-539
{1984)). Zea
mays contains three isozymes of ppc (Toh, H., et al., Plant Cell Environ.
17:31-43
(1994)) and Saccharomyces cerevisiae contains two isozymes of pyruvate
carboxylase
(Brewster, N.K., et al., Arch. Biochem. Biophys. 31.T :62-71 ( 1994)), .each
differentially
regulated. With the present discovery of the existence of a pyruvate
carboxyIase gene in
C. glutamicum, the number of enzymes that can interconvert phosphoenolpyruvate
{PEP),
oxaloacetate and pyruvate in this strain rises to six. This presence of all
six enzymes in
one organism has not been reported previously. P. citronellalis contains a set
of five
enzymes that interconvert oxaloacetate, PEP and pyrtzvate, namely pyruvate
kinase, PEP
synthetase, PEP carboxylase, oxaloacetate decarboxylase and pyruvate
carboxylase
(O'Brien, R.W., et al., J Biol. Chem. 252:1257-1263 (1977)). Azotobacter
contains all
of the above enzymes except PEP synthetase (Scrutton, M.C., & Taylor, B.L.,
Arch.
Biochem. Biophys. 164:641-654 {1974)).
The presence in G glutamicum of the six metabolically related enzymes suggests
that the regulation of these enzymes through effectors is important.
Biochemical and
genetic study of all six enzymes in coordination with other downstream
activities may
Iead to the elucidation of the exact procedures necessary for maximizing the
production
of primary metabolites by this industrially important organism.
CA 02356446 2001-06-19
WO 00139305 31 PCT/US98/27301
Example 6: Construction of a pyrrtvate ctrrboxylase mutant
The entire reading frame from nucleotide 180 to nucleotide 3630 of the
pyruvate
carboxylase DNA was amplified using PCR. The oligonucleotide primers used for
the
S PCR were designed to remove the SaII site within the coding sequence by
silent
mutagenesis and introduce EcoRV and SaII sites upstream and downstream,
respectively,
of the open reading frame. The PCR product was digested with EcoRV and SaII
and
cloned into the vector pBluescript. The resulting pllasmid is pPCBluescript.
To obtain
a plasmid-borne disruption of pyc, a derivative of pPCBluescript was
constructed in
which the middle portion of the pyc gene was deleted and replaced with the tsr
gene,
which encodes resistance to the antibiotic thiostrepton. The RP4 naob element
was then
inserted into the plasmid, yielding pAL240. This plasmid can be conjugally
transferred
into Corynebacterium, but it is then unable to replicate because it has only a
CoIE 1 origin
of replication. pAL240 was transferred from E. c;oli S 17-1 into C. glutamicum
via
transconjugation, and transconjugants were selected on medium containing
thiostrepton
and nalidixic acid.
After the drug resistance phenotype of each l:ransconjugant was confirmed, the
transconj ugants were tested for their ability to grow o:n different carbon
sources. Because
pAL240 cannot replicate in C. glutamictrm, the only cells which will survive
should be
those whose genomes have undergone recombination with the plasmid. Several
candidates were identified with the proper set of phenotypes: they are
resistant to
thiostrepton and nalidixic acid, grow well on minimal plates containing
glucose or acetate
as the sole carbon source, and grow poorly or not a.t all on minimal plates
containing
lactate as the sole carbon source. Southern hybridization and PCR-based assays
are used
to confirm whether there is only one copy of the pyruvate carboxylase gene in
the
genome and that it is disrupted with the thiostre:pton resistance marker.
Lysine
production and the production of biotinylated proteins by this strain is
examined, and the
~pyc strain as a negative control in activity assays and as a host strain for
complementation tests.
CA 02356446 2001-06-19
WO 00/39305 32 PCT/US98/27301
Exanrple 7: Development of an overexpressing strain
In order to test the hypothesis that increased levels of pyruvate carboxylase
will lead to increased production of lysine, it is necessary to construct
strains in which
S expression of the pyruvate carboxylase gene is under the control of an
inducible
promoter.
The vector pAPE 12, which has the NG~; origin of replication and a multiple
cloning site downstream of the IPTG-controlled tnc promoter, was used as an
expression
vector in C. glutamicum. A derivative of pAPEl2 was constructed which
contained the
IO pyruvate carboxylase gene downstream of Ptrc. The pyc gene was excised from
pPCBluescript using SaII and XbaI and ligated into pAPE 12 which had been
cleaved with
the same enzymes, forming pLW305. The pyruvate carboxylase gene present in
PCBIuescript (and hence in pLW305) has the wild type GTG start colon, and the
SaII
restriction site present near the 5' end of the wild type gene was eliminated
by the
IS introduction of a one base silent mutation during amplification of the
pyruvate
carboxylase gene.
pLW305 and pAPEl2 was electroporated into several other
Corynebacterium genetic backgrounds.
Because the pyruvate carboxylase gene in pLW305 has a GTG start colon
20 and carries some intervening DNA between the trc: promoter and the start
colon, a
pyruvate carboxylase overexpression plasmid, pXL 1, was designed that
eliminates those
shortcomings. The S' end of the gene was amplified from pLW30~ with
oliganucleotide
primers that simultaneously change the GTG start codan to ATG and introduce a
BspLUl 1-I restriction site, which is compatible with NcoI. The PCR product
was then
2S cut with BspLUl I-I and AfeI, and ligated into the 7.'i kb backbone
obtained by partial
digest of pLW305 with NcvI followed by complete cutting with AfeI. Two
independent
sets of ligations and transformations have yielded pui:ative pXL 1 clones.
Example 8: Fermentation results
It has been shown that the level of pyruvate carboxylase activity varies
greatly with the carbon source used when the gene is expressed from its native
C.
CA 02356446 2001-06-19
WO 00/39305 33 PCT/US98/27301
glutamicum promoter. Therefore, production of pyruvate carboxylase in strains
grown
on these carbon sources was examined.
The strains NRRL B-11474, NRRL B-11474 (pLW305), and NRRL B-
I 1474 Llpyc candidate 35 were cultured in flasks on minimal medium for NRRL B-
11474
S with two different sources of carbon: glucose or lactate. The results on
growth and amino
acid production are presented below.
glucose lactate
biomasslysine Y lys/glcbiomass lysine Y lys/lac
(g/1) (g/1) (g/g) (g/1) (g/1) (g/g)
NRRLB- 6.7~ 5.00.7 0.21 3 1.7 0.12
11474 0.2
NRRL B- 7.3 5.3 ~ 0.22 4 2.5 0.1 ~
t 0.2
11474 0.2
(pLW305}
dpyc #35 1.1 0 0 0 ~ 0 0
NRRL B-11474 and pLW305 show the same behavior on glucose. Both
strains produce the same amount of biomass and lysine. On lactate the strains
also have
similar yield of lysine. NRRL B-11474 (pLW305) consumed all of the lactate in
the
medium ( 17g/1) whereas the wild type NRRL B- I 1474 consumed 40% less lactate
during
the same period of time. The NRRL B-I 1474 was calculated to consume lactate
at a rate
of 0.37 g lactate/hour, whereas the NRRL B-1I474~ (pLW305) strain consumed
this
substrate at a rate of 0.65 g lactate/hour.
The NRRL B-11474 ~pyc doesn't grow on lactate, which is consistent with
the expected phenotype. lts growth on glucose is very low and the strain does
not
produce lysine. Kinetic studies are conducted to characterize further the
behavior of
these strains.
Example 9: Visuali2atior: of biatinylated proteins
Pyruvate carboxyiase contains biotin. 7.'herefore, it should be possible to
detect the accumulation of this enzyme by monitoring the appearance of
specific
CA 02356446 2001-06-19
WO OU1393(?5 34 PCTIUS98/27301
biotinylated products in cells.
Example !0: Electroplroretic gels
To detect biotinylated proteins in electrophoretic gels, a commercially
available streptavidin linked to alkaline phosphatase was used. Crude protein
lysates
from induced and uninduced cultures of E. coli D,'~ISa or NRRI, B-I 1474
harboring
pAPEl2 or pLW305 and separated the proteins on duplicate 7.5% polyacrylamide
denaturing electrophoretic gels. One gel of each pair is stained with
Coomassie Brilliant
I0 Blue to visualize all proteins and ensure equal levels ~of protein were
loaded in each lane.
The other gels are treated with the streptavidin-alkalime phosphatase reagent,
which binds
to biotinylated proteins. The location of these proteins can then be
visualized by
providing alkaline phosphatase with a colorimetric substrate, 5-bromo-4-chloro-
3-indolyl
phosphate (BCIP}. As reported by others, two major biotinylated proteins were
detected.
15 The higher molecular weight species (approx. I20 kDa) has been shown to be
pyruvate
carboxyIase, and the lower molecular weight species (approx. 60 kDa) is the
biotinylated
subunit of acetyl-CoA carboxylase.
20 All publications mentioned hereinabove are hereby incorporated in their
entirety by reference.
While the foregoing invention has been described in some detail for
purposes of clarity and understanding, it well be appreciated by one skilled
in the art from
a reading of this disclosure that various changes in form and detail can be
made without
2S departing from the true scope of the invention and appended claims.
