Note: Descriptions are shown in the official language in which they were submitted.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-1-
THERAPEUTIC APPLICATIONS OF FLINT POLYPEPTIDES
CROSS REFERENCE
This application claims the benefit of U.S. Provisional
Application No. 60/113,407, filed December 22, 1998; PCT
Application No. PCT US99/06797, filed March 30, 1999; and
U.S. Provisional Application filed October 20, 1999.
BACKGROUND OF THE INVENTION
Fast (also called CD95L and APO1L) is expressed on
various cell types and can produce biological responses such
as proliferation, differentiation, immunoregulation,
inflammatory response, cytotoxicity, and apoptosis.
Interestingly, mutations in Fast, the ligand for the TNFR-
family receptor FAS/APO (Suda et al., 1993, Cell 75:1169-78,
are associated with autoimmunity (Fisher et al., 1995, Cell
81:935-46), while overproduction of Fast may be implicated
in drug-induced hepatitis. Fast is expressed in immune-
privileged tissues of the eye, testis, brain and some
tumors. It has also been found in kidney and lung as well
as in activated thymocytes, splenocytes, and T lymphocytes.
Apoptosis plays a central role in both development and
in homeostasis. Cells die by apoptosis in the developing
embryo during morphogenesis or synaptogenesis and in the
adult animal during tissue turnover or at the end of an
immune response. Because the physiological role of
apoptosis is crucial, aberration of this process can be
detrimental. For example, unscheduled apoptosis of certain
brain neurons contributes to disorders such as Alzheimer's
and Parkinson's disease, whereas the failure of dividing
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-2-
cells to initiate apoptosis after sustaining severe DNA
damage contributes to cancer.
Survival signals from the cell's environment and
internal sensors for cellular integrity normally keep a
cell's apoptotic machinery in check. In the event that a
cell loses contact with its surroundings or sustains
irreparable damage, the cell initiates apoptosis. A cell
that simultaneously receives conflicting signals driving or
attenuating its division cycle also triggers apoptosis.
Mammals have evolved yet another mechanism that enables the
organism actively to direct individual cells to self-
destruct. This kind of "instructive" apoptosis is important
especially in the immune system. Death receptors-cell
surface receptors that transmit apoptosis signals initiated
by specific "death ligands" - play a central role in
instructive role apoptosis. These receptors can activate
death caspases within seconds of ligands binding, causing an
apoptotic demise of the cell within hours.
Death receptors belong to the tumor necrosis factor
(TNF) receptor gene superfamily, which is defined by
similar, cysteine-rich extracellular domains. The death
receptors contain in additional a homologous cytoplasmic
sequence termed the "death domain". Death domains typically
enable death receptors to engage the cell's apoptotic
machinery, but in some instances they mediate functions that
are distinct from or even counteract apoptosis.
Fas (also called CD95 or Apol) is a well-characterized
death receptor. Fas and Fas ligand (Fast) play an
important role in apoptosis. Fas L is a homotrimeric
molecule. It is suggested that each Fast timer binds three
Fas molecules. Because death domains have a propensity to
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-3-
associate with one another, Fas ligation leads to clustering
of the receptors' death domains. An adapter protein called
FADD (Fas-associated death domain; also called Mortl) then
binds through its own death domain to the clustered receptor
death domains. FADD also contains a "death effector domain"
that binds to an analogous domain repeated in tandem within
the zymogen form of caspase-8 (also called FLICE, or MACH).
Upon recruitment by FADD, caspase-8 oligomerization drives
its activation through self-cleavage. Caspase-8 then
activates downstream effector caspases such as caspase-9
committing the cell to apoptosis. Ashkenazi A., et al.
"Death Receptors: Signaling and Modulation Science 281,
1305-1308 (August 1998).
Although it triggers apoptosis in T lymphocytes, Fast
is also proinflammatory. Fast has been shown to stimulate
neutrophils, also called polymorphonuclear leukocytes
(PMNs), activation. (Chen J. et at, Science 282: 1714-17
(1998)) Fast-Fas binding has been implicated in clonal
deletions of autoreactive lymphocytes in peripheral lymphoid
tissues and in elimination of autoreactive lymphocyte
populations, thus contributing to homeostasis of the immune
system. However, it has been found that expression of Fast
on myotubes or pancreatic islets of transgenic mice induces
a granulocytic response that accelerates graft rejection
(Allison J. et al., Proc. Natl. Acad. Sci, 94:3943-47 (April
1997); Kang S-M. et al., Nature Medicien, Vol. 3, No. 7,
738-743 (July 1997)).
At least one of the effects of Fast-Fas receptor
binding is apoptosis, which is necessary for homeostasis.
However, sometimes the balance of ligand-receptors binding
is upset in stress, disease or trauma. One of the negative
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-4-
effects of unregulated Fast-Fas binding is runaway or
aberrant apoptosis. Another effect of said binding is the
destruction of healthy cells caused by neutrophils that have
been activated by Fast.
For example, one of the more tragic outcomes of runaway
apoptosis in a specific organ is acute liver failure. Acute
liver failure is characterized by an over-activation of the
apoptotic pathway where there is massive apoptosis of
hepatocytes and hemorrhagic liver changes. Acute liver
failure can happen as a result of viral infections affecting
the liver, bacterial infections affecting the liver,
hepatitis, hepatocellular injury and/or other conditions
where hepatocytes undergo massive apoptosis. One example of
an infection resulting in acute liver failure is bacterium-
induced fulminant hepatitis.
SUMMARY OF THE INVENTION
The invention encompasses an isolated nucleic acid
molecule having the sequence of Figure 1, an isolated
nucleic acid molecule having the sequence of Figure 3,
isolated polypeptide having the sequence of Figure 1, and an
isolated polypeptide having the sequence of Figure 3. The
invention also includes a transgenic mouse comprising a
transgene having the sequence of Figure 1.
According to one aspect of the invention, mFLINT is
provided for use in treating the following conditions: acute
liver failure; inflammation of the liver; abnormal
hepatocyte apoptosis; sepsis; a disorder associated with
inflammation; hepatitis; treating abnormal apoptosis; an
ischemia-associated injury or disorder; injury or disorder
is associated with hypercoagulation, including use with
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-5-
agent selected from the group selected from thrombolytic and
antithrombotic agents, like activated protein C; a
reperfusion-associated injury or disorder; damage to a
cardiac myocyte resulting from abnormal myocardial ischemia;
Type I diabetes; cancer; damage to an innocent bystander
tissue that is induced by a chemotherapeutic agent or
therapeutic irradiation, including bone marrow, intestinal
epithelium, oral cavity epithelium; injury to hematopoietic
progenitor cells that have been exposed to therapeutic
radiation or chemotherapy; cell damage from therapeutic
irradiation or chemotherapy, including damage to intestinal
epithelial cells, hematopoietic progenitor cells, and
peripheral blood cells; aplastic anemias; myelodysplastic
syndromes; and pancytopenic conditions.
According to another aspect of the invention, mFLINT is
provided for use in promoting the growth or differentiation
of hematopoietic progenitor cells and promoting the growth
or differentiation of CD34+ cells.
Further aspects of the invention include formulations,
having mFLINT as an active ingredient that are adapted for
the treatment of the following: acute liver failure;
inflammation of the liver; abnormal hepatocyte apoptosis;
sepsis; a disorder associated with inflammation; hepatitis;
treating abnormal apoptosis; an ischemia-associated injury
or disorder; injury or disorder is associated with
hypercoagulation, including use with agent selected from the
group selected from thrombolytic and antithrombotic agents,
like activated protein C; a reperfusion-associated injury or
disorder; damage to a cardiac myocyte resulting from
abnormal myocardial ischemia; Type I diabetes; cancer;
damage to an innocent bystander tissue that is induced by a
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-6-
chemotherapeutic agent or therapeutic irradiation, including
bone marrow, intestinal epithelium, oral cavity epithelium;
injury to hematopoietic progenitor cells that have been
exposed to therapeutic radiation or chemotherapy; cell
damage from therapeutic irradiation or chemotherapy,
including damage to intestinal epithelial cells,
hematopoietic progenitor cells, and peripheral blood cells;
aplastic anemias; myelodysplastic syndromes; and
pancytopenic conditions.
According to still another aspect of the invention
provides formulations, having mFLINT as an active ingredient
that are adapted for promoting the growth or differentiation
of hematopoietic progenitor cells and promoting the growth
or differentiation of CD34+ cells.
Yet other embodiments of the invention include the use
of mFLINT in the preparation of medicaments useful in
treating the following conditions: acute liver failure;
inflammation of the liver; abnormal hepatocyte apoptosis;
sepsis; a disorder associated with inflammation; hepatitis;
treating abnormal apoptosis; an ischemia-associated injury
or disorder; injury or disorder is associated with
hypercoagulation, including use with agent selected from the
group selected from thrombolytic and antithrombotic agents,
like activated protein C; a reperfusion-associated injury or
disorder; damage to a cardiac myocyte resulting from
abnormal myocardial ischemia; Type I diabetes; cancer;
damage to an innocent bystander tissue that is induced by a
chemotherapeutic agent or therapeutic irradiation, including
bone marrow, intestinal epithelium, oral cavity epithelium;
injury to hematopoietic progenitor cells that have been
exposed to therapeutic radiation or chemotherapy; cell
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
damage from therapeutic irradiation or chemotherapy,
including damage to intestinal epithelial cells,
hematopoietic progenitor cells, and peripheral blood cells;
aplastic anemias; myelodysplastic syndromes; and
pancytopenic conditions.
According to an additional aspect, the invention
include the use of mFLINT in the preparation of medicaments
useful in promoting the growth or differentiation of
hematopoietic progenitor cells and promoting the growth or
differentiation of CD34+ cells.
The present invention encompasses a method for treating
an individual suffering from abnormal hepatocyte apoptosis,
comprising administration of a therapeutically amount of
mFLINT protein to said individual. The invention also
includes a method of treating an individual suffering from a
disorder associated with inflammation, comprising
administration of a therapeutically amount of mFLINT protein
to said individual. Additionally, the invention includes a
method of treating an individual suffering from abnormal
apoptosis, comprising administration of a therapeutically
effective amount of mFLINT protein to said individual.
The present invention further includes the use of
mFLINT to treat a variety of disorders of the liver. In
this regard, the invention encompasses a method of treating
an individual suffering from acute liver failure, comprising
administration of a therapeutically amount of mFLINT protein
to said individual. The invention also includes a method of
treating an individual suffering from inflammation of the
liver, comprising administration of a therapeutically amount
of mFLINT protein to said individual. Another method of the
invention is for treating an individual suffering from
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
_g_
hepatitis, comprising administration of a therapeutically
effective amount of mFLINT protein to said individual.
The invention also encompasses a method of treating an
individual suffering from sepsis, comprising administration
of a therapeutically amount of mFLINT protein to said
individual.
Also included within the present invention is a method
for treating an individual suffering from an ischemia-
associated injury or disorder, comprising administration of
a therapeutically effective amount of mFLINT protein to said
individual. Such an injury or disorder may associated with
hypercoagulation. In this regard, the invention also
includes treating a disorder associated with
hypercoagulation, comprising administration of a
therapeutically effective amount of mFLINT, in combination
with an thrombolytic agent or an antithrombotic agent. One
example of such an antithrombotic agent is activated protein
C.
The invention also includes a method of treating an
individual suffering from a reperfusion-associated injury or
disorder, comprising administration of a therapeutically
effective amount of mFLINT protein to said individual.
The invention further encompasses a method of
preventing damage to a cardiac myocyte in an individual that
has suffered from abnormal myocardial ischemia, comprising
administration of a therapeutically effective amount of
mFLINT protein to said individual.
Also included in the invention is a method of treating
an individual suffering from Type I diabetes, comprising
administration of a therapeutically amount of mFLINT protein
to said individual. Yet another method encompassed by the
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
_g_
present invention is a method of treating an individual
suffering from cancer, comprising administration of a
therapeutically effective amount of mFLINT protein to said
individual.
The invention also includes a method of treating damage
to an innocent bystander tissue that is induced by a
chemotherapeutic agent or therapeutic irradiation, in an
individual treated with said agent or irradiation,
comprising administration of a therapeutically effective
amount of mFLINT to said individual. Such tissues include,
bone marrow and intestinal epithelium, including the
epithelium of the oral cavity.
The invention encompasses method for treating
hematopoietic progenitor cells that have been exposed to
therapeutic radiation or chemotherapy, comprising
administering mFLINT to said cells. Such a method promotes
the recover of hematopoietic progenitor cells from the
adverse effects of therapeutic radiation or chemotherapy.
The invention also includes a method of promoting the growth
or differentiation of a hematopoietic progenitor cell,
comprising administering mFLINT to said cell. The invention
further includes a method of promoting the growth or
differentiation of a CD34+ cell, comprising administering
mFLINT to said cell.
The invention also includes a method for treating
cancer, comprising treating bone marrow cells in vitro with
mFLINT, and administering said cells to said patient,
wherein said administration occurs after said patient has
been treated with therapeutic irradiation or chemotherapy.
The bone marrow cells may be autologous, i.e., from the
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-10-
patient being treated, or heterologous, i.e., from an
individual other the patient.
The invention also encompasses a method of treating
cell damage in a patient who receives therapeutic
irradiation or chemotherapy, comprising administering to
said patient, a therapeutically effective amount of mFLINT
with said irradiation or chemotherapy. The cell damage may
be to an intestinal epithelial cell, a hematopoietic
progenitor cell, or a peripheral blood cell.
The invention also contemplates methods of treating
aplastic anemia, myelodysplastic syndrome or a pancytopenic
condition, comprising administering a therapeutically
effective amount of mFLINT to a patient suffering from
aplastic anemia.
The invention also relates to a method for treating
and/or inhibiting acute respiratory distress syndrome.
The invention also relates to a method for treating
and/or inhibiting ulcerative colitis.
The invention also relates to a method for treating
and/or inhibiting ischemia injury during organ
transplantation.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the combined amino acid and nucleotide
sequences of human FLINT.
Figure 2 shows the combined amino acid and nucleotide
sequences of human FLINT.
Figure 3 shows the combined amino acid and nucleotide
sequences of human mFLINT.
Figure 4 shows the combined amino acid and nucleotide
sequences of human mFLINT.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-11-
Figure 5 compares the performance of mFLINT with other
agents in an animal sepsis model after different times of
LPS administration.
Figure 6, left panel, shows an experiment comparing
mFLiNT with anti-TNF in an animal sepsis model. The right
panel compares a lower dose of mFLINT against anti-TNF in
the same model.
Figure 7 shows an experiment comparing intravenous and
intraperitoneal delivery of mFLINT and anti-TNF in an animal
sepsis model.
Figure 8 shows reduction in B16 melanoma tumor volume
in response to treatment with mFLINT.
Figure 9 shows mFLINT promoted recovery of bone marrow
progenitor cells following irradiation.
Figure 10 shows mFLINT promoted recovery of bone marrow
progenitor cells following treatment with 5-fluorouracil.
DETAILED DESCRIPTION OF THE INVENTION
By employing methods for identifying compounds that
bind Fas ligand, applicants have discovered that human FLINT
polypeptides are capable of disrupting Fast-Fas receptor
interaction. Applicants have discovered methods for
modulating the TNFR proteins and their respective ligand
interactions where such interactions cause or exacerbate
disease and methods for preventing or treating diseases.
As noted above, it is well established that one of the
downstream effects of Fast-Fas receptor binding is
apoptosis. In conditions evidencing abnormal activation of
this pathway, runaway apoptosis results, which is a
contributing factor in the pathology of a variety of
disorders. Yet another downstream effect of Fast-Fas
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-12-
receptor binding is neutrophil activation wherein cells are
destroyed by neutrophils activated by Fast.
Recently, it was discovered that Fast induces in
peritoneal exudate cells (PEC) the processing and release of
IL-1(3 that is responsible for the neutrophil infiltration.
In particular, Miwa K., et al. Nature Medicine, 4(11): 1287-
1292 (Nov. 1998), found that inoculation of tumor cells
expressing Fas ligand into wild-type mice induces a massive
neutrophil infiltration that is, in contrast, suppressed in
IL-la(3 knockout mice. This indicates that Fast has an
inflammatory role. It also suggests that apoptosis may
itself induce inflammation under certain conditions. In
addition, it is known that certain inflammatory factors can
induce the Fas-mediated apoptosis pathway. Thus, it is
likely that Fast acts via two possibly distinct yet related
pathways in exerting its pathological effects.
The inventors discovered that FLINT polypeptides bind
to Fast with at least the same, if not greater, affinity
than the Fas receptor itself. As a result of binding Fast,
FLINT polypeptides can interfere with Fast binding to Fas
receptor and interfere with events downstream. Using
various in vitro and animal models, presented below in the
examples, the inventors have demonstrated the ability of
FLINT polypeptides to prevent Fas-mediated deleterious
effects. It is apparent from these data that FLINT can act
on both the apoptotic and proinflammatory aspects of Fast
activity, which implicates its use in several disease and
injury states discussed below.
Data presented below show that mFLINT inhibits both
Fast apoptosis-inducing activity and proinflammatory
activity. By antagonizing Fast, mFLINT polypeptides can
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-13-
modulate the destruction of healthy cells caused both by
neutrophils activated by Fast and by apoptotic damage
mediated directly by Fast-Fas interaction. Accordingly, the
present methods of treatment utilizing mFLINT are useful in
the treatment and prevention of disorders associated with
the direct apoptotic effects of Fast and/or the damage
mediated by the proinflammatory effects of Fast, whether or
not these represent distinct physiological pathways.
Thus, as characterized generally, the invention relates
to methods preventing or treating conditions caused or
exacerbated by "abnormal apoptosis," in particular,
apoptosis induced by Fas ligand (Fast) and Fas receptor
(Fas) binding (also referred to as Fast-Fas binding). This
invention also relates to methods of preventing or treating
conditions caused by a proinflammatory response, more
particularly, a proinflammatory response caused by Fast
induced neutrophil activation.
Throughout this application, headings are used for
purposes of organizational convenience only, and should not
be construed to limit the subject matter described herein.
I. Definitions
The following definitions are used in the present
application.
As used in this application, the term "FLINT" refers to
any full length FLINT polypeptide. Such a full-length
polypeptide includes the leader sequence, which is amino
acids 1-29 of a FLINT polypeptide. Examples of FLINT
include a protein having the amino acid sequence set forth
in Figure 1, which is a human FLINT, and Figure 2, which is
a human FLINT variant.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-14-
As used in this application, the term "mFLINT" refers
to a mature FLINT, i.e., FLINT which does not have a leader
(also known as signal) peptide. Examples of mFLINT include
a protein having the amino acid sequence set forth in Figure
3, which is the protein of Figure 1 without its leader
peptide, and a protein having the amino acid sequence set
forth in Figure 4, which is the protein of Figure 2 without
amino acids 1-29. Accordingly, an "mFLINT gene" is a
nucleic acid that encodes an mFLINT polypeptide. The
nucleic acids set forth in Figures 3 and 4 are examples of
mFLINT genes according to the present invention.
As used here, with reference to Fast or Fas expression
or interaction, and to any resulting apoptosis, the terms
"inappropriate" and "abnormal" should be read to include any
deviation from normal expression, interaction or apoptosis
levels. Such deviations include temporal, quantitative and
qualitative abnormalities. Fast or Fas "expression" refers
not only transcription, translation and associated events,
but also to any process that results in increased the
availability of active Fast or Fas, such as transport and
cell surface availability/accessibility.
Also as used herein the term "abnormal apoptosis"
refers to excessive and/or improper apoptosis. Typically
abnormal apoptosis is observed in cells and tissues that
have undergone physical, chemical or biological insult.
Such insults include, but are not limited to physical
injury, viral infection, bacterial infection, ischemia,
irradiation, chemotherapy, and the like.
The term ~~fusion protein~~ denotes a hybrid protein
molecule not found in nature comprising a translational
fusion or enzymatic fusion in which two or more different
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-15-
proteins or fragments thereof are covalently linked on a
single polypeptide chain.
"Host cell" refers to any eucaryotic or prokaryotic
cell that is suitable for propagating and/or expressing a
cloned gene contained on a vector that is introduced into
said host cell by, for example, transformation or
transfection, or the like.
The term "inhibit" or "inhibiting" includes the
generally accepted meaning, which includes prohibiting,
preventing, restraining, slowing, stopping, or reversing
progression or severity of a disease or condition.
"Isolated nucleic acid compound" refers to any RNA or
DNA sequence, however constructed or synthesized, which is
locationally distinct from its natural location.
The term "plasmid" refers to an extrachromosomal
genetic element. The plasmids disclosed herein are
commercially available, publicly available on an
unrestricted basis, or can be constructed from readily
available plasmids in accordance with published procedures.
A "primer" is a nucleic acid fragment which functions
as an initiating substrate for enzymatic or synthetic
elongation of, for example, a nucleic acid compound.
The term "promoter" refers to a nucleic acid sequence
that directs transcription, for example, of DNA to RNA. An
inducible promoter is one that is regulatable by
environmental signals, such as carbon source, heat, or metal
ions, for example. A constitutive promoter generally
operates at a constant level and is not regulatable.
"Recombinant DNA cloning vector" as used herein refers
to any autonomously replicating agent, including, but not
limited to, plasmids and phages, comprising a DNA molecule
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-16-
to which one or more additional DNA segments can or have
been incorporated.
The term "recombinant DNA expression vector" or
"expression vector" as used herein refers to any recombinant
DNA cloning vector, for example a plasmid or phage, in which
a promoter and other regulatory elements are present thereby
enabling transcription of an inserted DNA, which may encode
a polypeptide.
The term "selectively binding" refers to the ability of
FLINT polypeptides to bind Fast but not TNFOC.
"Substantially pure" used in reference to a peptide or
protein means that said peptide or protein is separated from
other cellular and non-cellular molecules, including other
protein molecules. A substantially pure preparation would
be about at least 85% pure; preferably about at least 95%
pure. A "substantially pure" protein as described herein
could be prepared by a variety of techniques well known to
the skilled artisan, including, for example, the IMAC
protein purification method.
The term "treatment" or "treating" as used herein,
describes the management and care of a patient for the
purpose of combating a disease, condition, or disorder and
includes the administration of FLINT to prevent the onset of
the symptoms or complications, alleviating the symptoms or
complications thereof.
The term "vector" as used herein refers to a nucleic
acid compound used for introducing exogenous or endogenous
DNA into host cells. A vector comprises a nucleotide
sequence which may encode one or more protein molecules.
Plasmids, cosmids, viruses, and bacteriophages, in the
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-17-
natural state or which have undergone recombinant
engineering, are examples of commonly used vectors.
The various restriction enzymes disclosed and described
herein are commercially available and the manner of use of
said enzymes including reaction conditions, cofactors, and
other requirements for activity are well known to one of
ordinary skill in the art. Reaction conditions for
particular enzymes were carried out according to the
manufacturer's recommendation.
II. FLINT binds Fas L and LIGHT
FLINT is a newly identified member of the TNFR
superfamily. This family of receptors mediates a variety of
biological effects of TNF ligands, including but not limited
to cell proliferation, cell differentiation, immune
regulation, inflammatory response, cytotoxicity, and
apoptosis.
The FLINT polypeptide of the present invention is a
soluble receptor comprising extracellular domains. FLINT
polypeptide does not include any transmembrane domains and
is, therefore, soluble. FLINT has also been called OPG3
(osteoprotegrin 3) or TNFRsol. FLINT is believed to be
closely related to TNFR 6a and TNFR 6(3 discussed in
W098/30694 claiming priority to U.S.S.N. 60/035,496 and TR4,
discussed in EP 0861850A1.
Data presented below demonstrate that mFLINT binds to
Fast and to LIGHT in vitro. Fast, as noted, is involved in
triggering both an inflammatory response and in inducing
apoptosis. The biological activity for LIGHT includes, but
is not limited to, cell proliferation. LIGHT is a 29kDa
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-18-
type II transmembrane TNF superfamily member protein
produced by activated T cells. Mauri D.M., Immunity, 8:21
(1998). As with Fast, evidence links LIGHT with neutrophil
infiltration and with apoptosis. Zhai et al., J. Clin.
Investig. 102:1142-51, 1998. Thus, mFLINT-mediated
inhibition of LIGHT activity is expected to be
therapeutically useful substantially as described below for
mFLINT-mediated inhibition of Fast, especially in immune
modulation and cancer therapy.
III. FLINT - Therapeutic Applications
The inventors have discovered that mFLINT prevents in
vitro Fast-induced apoptosis of Jurkat cells. Anti-CD3
antibodies activate these cells and cause them to express
Fast and undergo apoptosis. mFLINT also was effective in
inhibiting in vitro anti-CD3-induced apoptosis of Jurkat
cells, in a dose-dependent manner.
The present invention is applicable to the treatment
and/or inhibition of disorders that may be associated with
an inappropriate or abnormal interaction of Fast with Fas,
because mFLINT prevents this interaction. This
inappropriate interaction may arise, for example, due to
increased expression or availability of Fast and/or Fas.
Since it is known that Fast-Fas interaction induces
apoptosis, the inventive methods further generally apply to
disorders characterized by inappropriate or abnormal
apoptosis.
In another embodiment the present invention relates to
a method of preventing or treating conditions caused or
exacerbated by Fast-Fas binding including Fast-mediated
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-19-
apoptosis and/or a proinflammatory response, more
particularly, a proinflammatory response caused by Fast
induced neutrophil activation.
For instance, mFLINT may be employed in treating Down's
syndrome. Enhanced apoptosis of neuronal cells may be
implicated in Down Syndrome. In this regard, Seidi, et al.,
Neuroscience Lett. 260:9 (1999), reported elevated levels of
Fas protein in the temporal lobe and cerebellum of adult
patients with Down syndrome, suggesting that Fas-associated
apoptosis may be an important feature of neurodegeneration
in Down syndrome. It is expected, therefore, that treatment
of a Down syndrome patient with mFLINT may be effective. In
particular, the present inventors have shown that mFLINT
binds Fast, prevents Fas-Fast binding, and inhibits
apoptosis. Similarly, apoptosis has been linked to
Alzheimer's disease and other neurodegenerative diseases.
Administration of mFLINT is expected to decrease the
enhanced apoptosis associated with Down syndrome,
Alzheimer's disease and other neurodegenerative disorders.
The inventors have tested mFLINT in a variety of model
systems that are indicative of various disease and injury
states. Some exemplary disorders include, but are not
limited to, antibody-dependent cytotoxicity, infection with
human immunodeficiency virus, hemolytic uremic syndrome,
allergies and bronchopulmonary dysplasia. Thus, the
following section discusses diseases and injury states in
the context of corresponding model systems.
The present invention also encompasses the production
of transgenic animals that contain a FLINT transgene. In
particular, the inventors have produced transgenic mice that
produce measurable levels of mFLINT. Animals such as these
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-20-
are useful for assessing the effects of mFLINT on a variety
of disorders, detailed below, such as endotoxin-induced
shock, cerebral ischemia, cardiac reperfusion injury, and
damage induced by cancer therapies, such as therapeutic
irradiation and chemotherapy.
A. Treatment of Liver damage and inflammation with mFLINT
Fast has been implicated in acute liver failure
including but not limited to the damage caused to the liver
in hepatitis. In a mouse model of acute hepatitis,
administration of anti-Fast antibody to mice caused liver
failure induced by apoptosis in hepatocytes and the animals
die within hours. Kondo et al, 1997 Nature Medicine
3(4):409-413. See also Galle et al, J. Exp. Med, November
1995, 182:1223-1230.
Tsuji et al. (1998), Infect. Immun. 65:1892-1898,
describes a model system for bacterially induced fluminant
hepatitis. As detailed below, this system is predictive of
a variety of disorders of the liver and other tissues. In
the method of Tsuji et al., mice were injected with
Propionibacterium acnes, and are subsequently injected with
lipopolysaccharide (LPS). In normal mice, the first
injection causes granuloma formation in the liver, while the
second injection induces massive apoptosis and consequent
liver damage. Tsuji et al. employed this method to
implicate TNFRp55 in granuloma formation, and TNFRp55 and
Fas in apoptosis.
Using a modified version of the animal model of Tsuji
et al., the applicants have found that administration of
mFLINT dramatically improves the survival rate of test
animals. As indicated, many of the disorders treatable
and/or preventable according to the present invention share
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-21-
a Fast-Fas-related etiology. Thus, target diseases
generally involve either a tissue inappropriately (e. g.,
temporally, qualitatively or quantitatively) expressing Fas
or inappropriately coming into contact with Fast while
expressing Fas. Many of these diseases follow a general
pathological model of inappropriate upregulation of Fas,
followed by Fast-mediated induction of apoptosis. The
inappropriate expression of Fas (or Fast) may be induced,
for example, by inflammatory insult, with certain
l0 inflammation-associated cyokines likely inducing expression.
For instance, it is known that the first-phase
mononuclear infiltration results in the secretion of
numerous cytokines, which may result in inappropriate Fas
and/or Fast expression. It is known, for example, that IL-
1 , IL-1 and TNF- can induce Fas expression. This
increased Fas expression may, in effect, sensitize the
affected tissue to Fast-bearing effector cells, like natural
killer cells and cytotoxic T cells. Contact of the FasL-
bearing effectors with Fas-bearing targets induces apoptosis
of the latter. In other words this hepatic injury model is
an in vivo surrogate for certain disease characterized by
(a) inflammatory insult and/or (b) Fast-Fas-mediated
apoptosis and/or necrosis.
Consistent with this model is the pathology of graft
versus host disease (GVHD) which is very common, for
example, in autologous bone marrow transplantation. GVHD
results from the presence of host-reactive T cells that
destroy host tissues, at least in part via Fast-mediated
apoptosis. GVHD is typically divided into two phases,
termed afferent and efferent. The afferent phase is
characterized by recognition of host antigens and
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-22-
proliferation of donor T cells. In efferent phase tissues
like the skin, liver and gastrointestinal tract become
inflamed, and it is characterized by mononuclear cell
infiltration and histopathological damage. Experiments
using Fast-defective mice, in fact, show that Fast plays a
key role in the development of hepatic, cutaneous and
lymphoid organ damage in GVHD. Hence, GVHD follows the
paradigm of inflammatory insult and Fas-mediated apoptosis.
Hashimoto's thyroiditis (HT) also fits this paradigm.
HT results from an autoimmune response against the thyroid
follicular cells. Normal thyrocytes produce Fast and
express negligible levels of Fas. In HT, however, the
resulting inflammation results in IL-1 secretion by
activated macrophages, which then induces the thyrocytes to
produce Fas. This sets up a fatal Fast-Fas autocrine loop
that results in apoptosis.
Similarly, oxidized low density lipoprotein (OxLDL),
associated with atherosclerotic lesions, promotes a chronic
inflammatory response. While the vascular endothelium
normally expresses both Fast and Fas, absent insult by OxLDL
it does not undergo apoptosis. Upon treatment with OxLDL,
however, Fast expression is increased and the endothelial
cells undergo apoptosis.
Chronic renal failure is correlated secretion of IL-1
and TNF- , both of which have been shown to induce Fas
expression in renal tubular epithelial cells. This disorder
is characterized by the depletion of tubular epithelial
cells, via the Fast-Fas apoptosis pathway. Moreover, the
same cytokine-mediated induction of Fas expression in tubule
cells is observed in the endotoxic shock (sepsis) model of
acute renal failure.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-23-
Acute liver failure can be found in viral infections
affecting the liver, bacterial infections affecting the
liver, hepatitis, hepatocellular injury and/or other
conditions where hepatocytes undergo massive apoptosis.
S Galle et al, (J. Exp. Med., November 1995, 182:1223-1230),
for example, found that Fast-Fas mediated cell death played
a role in liver failure in humans. Galle et al. knew that
Fast-Fas mediated apoptosis was a mechanism to eliminate
senescent hepatocytes. For example, it was found in liver
regeneration, during involution of liver after cessation of
treatment with lipophyllic compounds (e. g., phenobarbitol)
and during viral infection. Through experiments they found
that during viral hepatitis, activated T cells attacked
hepatocytes. Fas is constitutively expressed in
hepatocytes. That is, Fast was expressed in T cells upon
activation. It is thought that activated T cells might kill
hepatitis B (HBV) antigen-expressing hepatocytes in an
effort to clear HBV from the liver.
The inventors' success using a modified model of Tsuji
further indicates that mFLINT is useful in treating and
preventing sepsis. Sepsis is characterized by the presence
of one or more pathogenic organisms, or their toxins, in the
blood or tissues. Furthermore, sepsis is characterized by
a systemic inflammatory response to infection that is
associated with and mediated by the activation of a number
of host defense mechanisms including the cytokine network,
leukocytes, and the complement and coagulation/fibrinolysis
systems. See Mesters, et a1. Blood, 88:881 (1996).
It is known that endotoxin(s) induce tissue necrosis
factor (TNF), which in turn induces both an inflammatory
response and Fast, thereby promoting liver failure and
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-24-
death. Attempts to use antibodies drawn to TNF- in
treating sepsis, however, have uniformly failed. This is
likely do to the fact that, aside from its effects on the
pathology of sepsis, TNF- is a more global mediator of
normal immune function. In addition, as demonstrated below
in the examples, TNF inhibitors show little usefulness in
treating post-insult sepsis; rather they are more useful
prophylactically.
Data presented below in the examples confirm that
mFLINT is more effective than TNF inhibitors in promoting
survival in an animal sepsis model. In fact, these data
show that, whereas TNF inhibitors are efficacious only if
used in a pre-treatment protocol (i.e., before
LPS/galactosamine administration), mFLINT may be used in a
post treatment regimen. This is clinically significant
because the patient will virtually always present after
endotoxic exposure. In other words, these data demonstrate
that mFLINT is useful in both preventative and ameliorative
regimens, in marked contrasted to TNF inhibitors.
Minimally, these data indicate that mFLINT may be
administered at a later time in disease progression than
anti-TNF; it is thus expected to avoid the problems that
were encountered with TNF inhibitors in the clinic.
Moreover, these data demonstrate that mFLINT has a
therapeutic effect on at least two levels. Endotoxin in
known to induce TNF, which directly induces both an
inflammatory response and Fast. The data of Tsuji et a1,
supra, indicate that these represent two distinct pathways,
both of which contribute to liver failure and death. In
particular, their data using Fas-deficient mice strongly
suggested that a substantial amount of the damage in their
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-25-
model is done through a Fas-independent, TNF-dependent
pathway. The data presented below, however, demonstrate that
mFLINT, an inhibitor of the Fas-dependent pathway, can
inhibit all damage induced in the model, Fas-dependent or
not. Thus, even if they represent different pathways,
mFLINT can inhibit the damage mediated by both the
inflammatory response and the induction of Fast.
In addition, it is contemplated that mFLINT may be
beneficially used in combination with other agents useful in
treating sepsis. For instance, U.S. Patent No. 5,009,889
demonstrates that activated protein C (aPC) is effective in
treating a baboon sepsis model. Such a model may be
employed to determine appropriate combination treatment
protocols using, for example, mFLINT and aPC. aPC may
prevent the sepsis-associated disseminated intravascular
coagulation and widespread deposition of fibrin in the
microvasculature, which is an early manifestation of
sepsis/septic shock.
Thus, based on the improved survival rate observed in
mFLINT-treated animals, the inventors contemplate that one
or more of the following diseases can be treated with
mFLINT: acute respiratory distress syndrome CARDS); goiter;
heptatocellular injury (viral, bacterial, cancer, trauma);
mononucleosis; mucocites (inflammation of the mucosa);
pancreatitis; periodontal disease/gingivitis; renal failure;
satellite organ failure; systemic inflammatory response
syndrome (SIRS); surgery; vascular bleeds; vascular leak
syndrome; whole organ transplant; multiple organ dysfunction
(MODS); coronary artery bypass grafting; allograft
rejection; transplant rejection; infection (e. g., microbial,
pneumonia, tissue necrotic infection, viral); bone loss in
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-26-
rheumatoid arthritis; Hashimoto's thyroiditis; viruses,
including hepatitis C (HCV), hepatitis B (HBV), Ebola
(hemolytic fever) and Epstein-Barr (EBV); cutaneous
inflammation; psoriasis; inflammatory bowel disease;
ulcerative colitis; Crohn's disease; atherosclerosis; end
stage renal disease; and sepsis.
More particularly, the invention contemplates methods
for treating disorders associated with inflammation. The
skilled artisan will recognize that these disorders include
but are not limited to, GVHD, Hashimoto's thyroiditis, ARDS,
heptatocellular injury (viral, bacterial, cancer, trauma);
mucocites (inflammation of the mucosa); pancreatitis,
periodontal disease/gingivitis; renal failure; satellite
organ failure; systemic inflammatory response syndrome
(SIRS); whole organ transplant; multiple organ dysfunction
(MODS); coronary artery bypass grafting; allograft
rejection; transplant rejection; infection (e. g., microbial,
pneumonia, tissue necrotic infection, viral); rheumatoid
arthritis; viral infections, including hepatitis C (HCV),
hepatitis B (HBV), Ebola (hemolytic fever) and Epstein-Barr
(EBV); cutaneous inflammation; inflammatory bowel disease;
atherosclerosis; and sepsis.
B. Treatment of Ischemia and Reperfusion with mFLINT
Ischemia is characterized by the reduced blood flow to
a tissue, which results in the accumulation of a variety of
toxic metabolites. These metabolites contribute to cell
death resulting from necrosis and/or apoptosis. Perhaps
surprisingly, when a tissue is reperfused, apoptotic damage
is increased. This is likely due to the generation of free
radicals and other toxins through the reaction of ischemia-
induced metabolites with serum components. In any event,
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-27-
studies have shown that the apopototic damage results at
least in part from Fas-mediated pathways. Experiments
presented below demonstrate that mFLINT can be used to block
ischemia/reperfusion injury, likely by inhibiting Fast.
The usefulness of mFLINT compositions in treating or
preventing disorders associated with cerebral ischemia, like
stroke and head trauma, is confirmed by data presented
below. There, a model is presented that uses a live gerbil
model of global stroke. Cerebral ischemia was induced by a
transient occlusion of the common carotid arteries followed
by a treatment of mFLINT or a vehicle control. Data show
that the mFLINT-treated gerbils retained markedly more
living neurons than the vehicle treated control group.
These data are consistent with studies comparing the
extent of infarct brain tissues in mice lacking functional
Fas receptors after a cerebral ischemia insult, which found
that significantly less damage than normal controls.
Rosenbaum, et al., Annals of Neurology, 44(3), 441, 1998. It
is, therefore, anticipated that mFLINT will interfere the
normal signaling process of the Fas receptor in a patient
that has undergone a cerebral ischemia episode thus
protecting the brain tissues from deterioration.
Moreover, Fas-mediated apoptosis has been linked to
ischemia reperfusion injury in a myocardial infarction
model. Kajstura et al., Laboratory investigation 74:86-107
(1996). Thus, the foregoing gerbil model likely is
predictive of generalized ischemia reperfusion injury. In
support of this, the inventors conducted in an in vitro
assay using cardiac myocytes. In particular, cardiomyocytes
were incubated under hypoxia conditions for 8 hours,
followed by 16 hours of culture under normal O2, which
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-28-
mimics the hypoxic conditions found in ischemic cardiac
tissue. Experimental results showed that treating the
cardiomycetes with mFLINT protected the cells against
apoptosis induced by hypoxia. In particular, treatment with
10 ~,g/ml mFLINT resulted in a 90o inhibition of hypoxia-
induced apoptosis. Fast-induced apoptosis of cardiomycetes
also was inhibited by treatment with mFLINT.
Based on the foregoing observations and data, the
inventors contemplate that one or more of the following
diseases can be treated with mFLINT: stroke; spinal cord
ischemia; eclampsia/preeclampsia; reperfusion injury;
myocardial infarction, its acute, subacute and chronic
sequelae and related clinical syndromes, including but not
limited to congestive heart failure. Thus, FLINT is useful
in promoting myocardial salvage and preventing
decompensatory myocardial hypertrophy.
Reperfusion injury may be in a number of tissues and
result from a variety of insults, including the bowel,
burns, cardiac bypass machine injury, hepatic (trauma-
induced), hemolytic fever (Ebola), infant toxicity
(hyperoxia incubators with high 02 content), limb crush lung
injury/ARDS, organ transplant, multiple trauma (e. g. from
car accidents), protection of vascular beds, vascular organ
failure usually present in sepsis and other diseases. These
observations further indicate that mFLINT is useful in the
prevention/attenuation of apoptosis of cardiac myocytes
following acute myocarial infarction, and generally in
preventing damage to cardiac and other tissue due to
hypoxia.
In the case of organ preservation in preparation for
harvesting, for instance, mFLINT is useful prophylactically
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-29-
to prevent the apoptosis associated with ischemia
reperfusion injury to the organ once it is removed from the
donor. In one embodiment of this aspect of the invention,
FLINT is administered to the organ donor prior to harvesting
the organ. After harvesting the organ, FLINT is added to a
suitable medium for transport/storage of the organ.
Alternatively, the harvested organ is perfused with a medium
containing FLINT prior to transplantation into a recipient.
Suitable media for this purpose are known, for example, the
media disclosed in EP 0356367 A2, herein incorporated by
reference. The method may also include treating the
transplant recipient with FLINT prior to and/or after the
transplant surgery.
A typical method involves pre-treating the organ donor
with an effective amount of mFLINT prior to organ
harvesting. Alternatively, or conjunctively, the harvested
organ may be perfused or bathed in a mFLINT-containing
solution. This method may be employed, for example, with
kidney, heart, lung and other organs and tissues.
In another example, mFLINT is useful in treating the
ischemia reperfusion injury associated with thrombus
formation or hypercoagulation. Thus, mFLINT may be
administered in conjunction with thrombolytic agents (e. g.,
urokinase and streptokinase) and/or antithrombotics, like
activated protein C (aPC). U.S. Patent No. 5,350,578
describes the antithrombotic activity of aPC. The baboon
animal model disclosed therein may be used to ascertain a
beneficial dosing regimen for the contemplated combination
therapy. In this regard, it is expected that the following
disorders may be treated with mFLINT, with or without the
addition of aPC: eclampsia and preeclampsia, which are
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-30-
characterized by a state of increased coagulopathy; HELLP
(preeclampsia complicated by thrombocytopenia, hemolysis,
and disturbed liver function), HITS (heparin-induced
thrombocytopenia); disseminated intravascular coagulation
(DIC); burns; and thromboembolic complications that result
from surgery.
As noted above, studies show that a great deal of
apoptotic injury is induced upon reperfusion. This injury
appears to be due at least in part to oxidative damage,
since antioxidants can diminish the injury. Likewise, it
has been found that Vitamin E, an antioxidant, can be used
as a meat preservative, perhaps acting to prevent the same
type of injury, which causes spoilage. Administering
Vitamin E to pigs several days before slaughter has been
shown to increase shelf-life of pork. Hence, it is
contemplated that mFLINT is similarly useful to preserve
tissues and organs. This would be particularly useful for
increasing shelf-life of organs and meats for human
consumption.
C. Treatment of Hematopoietic Disorders with mFLINT
As discussed in this application, mFLINT inhibits
Fas/FasL interaction, thereby preventing apoptosis. As
discussed below, the Fas/FasL interaction has been
implicated in the process of hematopoiesis. Therefore, the
present application contemplates mFLINT-based therapeutic
methods for improving hematological recovery from a variety
of treatments and disorders, including bone marrow
transplantation, chemotherapy, radiotherapy, aplastic
anemia, and myelodysplastic syndrome, pancytopenic
conditions. The present invention also covers the mFLINT-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-31-
based treatment of any clinical condition which requires
expansion of bone marrow cell lineages, alone or in
combination with other hematological growth factors. Such
growth factors include, but are not limited to,
erythropoietin (EPO), FLT-3 ligand, thrombopoietin (TPO),
stem cell factor (SCF), granulocyte colony stimulating
factor (G-CSF), and granulocyte-macrophage colony-
stimulating factor (GM-CSF) .
Autologous and heterologous bone marrow transplantation
are commonly used to treat a multitude of neoplastic
diseases. In autologous transplantation, bone marrow cells
are removed from the patient to be treated, and are cultured
in vitro. Following chemotherapy and/or radiation therapy,
the cells are re-introduced to the patient. In heterologous
transplantation, the bone marrow cells are donated by a
second individual. The chemotherapy or radiotherapy that is
used to treat such diseases results in a dramatic
myelosuppression from damage to the bone marrow compartments
and intestinal epithelium, leaving the patient
immunosuppressed and susceptible to invasion by
microorganisms. The treatment of transplanted bone marrow
cells with hematopoietic cytokines has been shown to result
in improved recovery of the myeloid and erythroid lineages
of the blood, although there typically is toxicity
associated with the use of these cytokines and one cytokine
typically does not enhance recovery of all lineages. Moore,
M.A.S. Blood 78:1 (1991); Metcalf, D. Science 254: 529
(1991) .
Radiation or chemotherapy has been shown to induce
apoptosis of bone marrow cells and intestinal epithelial
cells. The Fas/FasL pathway is known to induce apoptosis in
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-32-
susceptible cells. Recent reports describe the involvement
of Fas/FasL in hematopoiesis. For a review, see Niho, et
al.; Current Opinion in Hematology, 5: 163 (1998). Fas is
expressed on CD34+ progenitor cells and these cells are
susceptible to the apoptotic effects of Fas stimulation.
Nagafuji et al., Blood, 86: 883-889 (1995), Sato et al., Br
J Haematol, 97: 356 (1997). Yamane et al., Eur J Haematol,
58:289 (1997). Moreover, in vitro expansion of
hematopoietic progenitor cells with cytokines has been shown
to upregulate functional Fas expression and it is currently
thought that Fas may play an in vivo role in hematopoietic
homeostasis as a negative regulator. Takenaka et al., Blood,
88: 2871 (1996), Stahnke et al., Exp. Hematol. 26: 844
(1998) .
1. mFLINT and Radiation and Chemotherapy
The inventors have shown that mFLINT improves the
recovery of bone marrow progenitor cells that have been
exposed to irradiation. In particular, mice were
irradiated, and bone marrow cells were removed and cultured
in vitro with the cytokines IL-6 and CSF. The addition of
mFLINT to the culture medium dramatically increased the
recovery of bone marrow progenitor cells, namely progenitors
of erythroid cells, granulocyte-macrophage cells, and
erythroid monocyte megakaryocyte cells. The inventors also
have shown that mFLINT improves the survival of bone marrow
cells that were harvested from mice treated with 5-
fluorouracil (5-FU). Anti-Fast antibody also increased the
survival of the cells taken from 5-FU-treated mice.
The present invention thus encompasses the use of
mFLINT as a radioprotective and/or chemoprotective agent.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-33-
mFLINT is useful for enhancing the in vitro expansion and
maturation of bone marrow progenitor cells prior to
autologous or heterologous transplantation. mFLINT also is
useful for promoting the expansion and maturation of
progenitor cells, after a patient has been treated with
radiation or chemotherapy. In this regard, administration
of mFLINT to a patient is expected to promote the expansion
and maturation of progenitor cells when that patient has
been treated with a cancer therapy (chemo- or radio-
therapy). mFLINT also is expected to promote the expansion
and maturation of progenitor cells in patients treated with
cancer therapy, and myelosuppressive agent, which prevents
cycling of progenitor cells during cancer therapy.
As noted above, cytokines are used, in vitro and in
vivo, to enhance the expansion of erythroid and myeloid cell
lineages in patients receiving cancer therapies. The
present inventors have shown that mFLINT improves the
expansion of cells that are treated with cytokines.
Accordingly, the present invention contemplates the use of
mFLINT, in combination with one or more cytokines, to expand
bone marrow progenitor cells, in vitro and in vivo.
Granulocyte-macrophage colony stimulating factor (GM-CSF) is
used to improve recovery from myelosuppression that results
from chemo- and radio-therapy. Accordingly, the present
invention contemplates the use of a combination of mFLINT
and GM-CSF to improve recovery from myelosuppression.
The inventors also have shown that anti-Fast antibody
also improved the recovery of bone marrow cells from
treatment with 5-FU. Accordingly, the present invention
contemplates the use of anti-Fast to improve recovery of
bone marrow cells, following chemo- or radio-therapy. Such
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-34-
an antibody can be used in vitro to expand bone marrow cells
for heterologous or autologous transplantation. An anti-
FasL antibody also can be administered in vivo to improve
recovery from myelosuppression that results from
chemotherapy, radiation therapy, and/or administration of
myelosuppressive agents.
Systemic administration would be appropriate when
treating patients with mFLINT. As used in this application,
administration of mFLINT "with" chemotherapy or irradiation
encompasses all of the following modes of administration of
mFLINT: (1) pretreatment with mFLINT, followed by
irradiation or chemotherapy; (2) simultaneous administration
of mFLINT and chemo- or radiation therapy; (3) chemotherapy
or irradiation first, followed by mFLINT administration; (4)
mFLINT pretreatment, followed by chemo- or radiation
therapy, followed by administration with mFLINT. The
invention encompasses the use of mFLINT in one or more of
the foregoing modes of treatment.
2. Treatment of peripheral cytopenias
The present invention also contemplates the treatment
of peripheral cytopenias that are associated with
hematopoietic disorders, such as aplastic anemia and
myelodysplastic syndrome. Fas/FasL-mediated apoptosis has
been shown to suppress lymphopoiesis. Yasutomo, et al. J.
Immunol. 157: 1981 (1996). Increased Fas expression is
observed in progenitor cells from patients with aplastic
anemia. Young, N.S., Eur. J. Hematol. 60 (supp): 55(1996).
Increased Fas expression also has been observed in
progenitor cells from patients suffering from
myelodysplastic syndrome.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-35-
Furthermore, Maria, et al. reported that Fas is rapidly
upregulated in early erythroblasts and is expressed at high
levels thorough terminal maturation. Blood 93:796 (1999).
Maria, et al. also reported that immature blood cells are
EPO-dependent and express a functional Fas molecule. In
the presence of Fast-producing mature erythroblasts, the
immature cells undergo apoptosis, unless exposed to high
levels of EPO. Maria, et al. suggest that Fas/FasL system,
in combination with EPO, contribute to erythropoietic
homeostasis.
While not intending the bound to any particular theory,
the reduction in hematopoiesis and resultant cytopenias may
be a direct result of apoptosis, which may in turn be
mediated through upregulation of Fas and Fas ligand. As
described elsewhere in this application, mFLINT inhibits
Fas/FasL binding, inhibiting apoptosis, and mFLINT also
enhanced the growth and maturation of hematopoietic
progenitor cells. Therefore, the use of mFLINT is expected
to suppress apoptosis suffering from hematopoietic
disorders, leading to amelioration of one or more of the
symptoms associated with these disorders. Moreover, because
immature hematopoietic cells are susceptible to Fast-induced
apoptosis, and because individuals suffering from a lack of
differentiated hematopoietic cells, the administration of
mFLINT to such individuals is expected to ameliorate these
maturation defects, by inhibiting Fast-induced apoptosis of
immature hematopoietic cells.
Therapy of individuals suffering from hematopoietic
disorders can be carried out by direct administration of
mFLINT to the affected individual, or by the use of mFLINT
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-36-
in vitro to treat bone marrow cells that are then
transplanted into the diseased individual.
Therapy with mFLINT can be augmented by administration
of EPO and other compounds that promote the growth and/or
maturation of hematopoietic progenitor cells. Cytokines are
known to stimulate the growth of hematopoietic progenitor
cells. Accordingly, the invention also encompasses the use
of a combination of mFLINT and one or more cytokines to
promote growth and differentiation of such progenitor cells
in individuals suffering from diseases such as
thrombocytopenia and myelodysplastic syndrome.
3. Gene Therapy
FLINT also can be used in conjunction with gene
therapy. When hematopoietic progenitor cells are to be
transplanted into an individual, they are transfected with a
suitable transgene, and also are treated with mFLINT,
optionally in combination with one or more cytokines.
Following culturing of the cells, they are transplanted into
an individual. Such gene therapy will be useful in
imparting desirable properties to the blood cells.
D. Protection of Innocent Bystander Tissues with mFLINT
It is well known that many cell-damaging therapies,
such as chemotherapy and therapeutic irradiation used to
treat cancer, cause damage and apoptosis of so-called
"innocent bystander" tissues. As used in this application,
an "innocent bystander" tissue is a non-diseased tissue that
is damaged by pharmacological, radiation or device-assisted
therapies. These tissues include, but are not limited to,
the gastric epithelium (including the epithelium lining the
oral cavity, esophagus, stomach and intestinal tract), the
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-37-
lung epithelium, blood cells (lymphocytes, monocytes, T
cells, B cells, bone marrow cells, hematopoietic progenitor
cells, neutrophils, eosinophils, mast cells, platelets),
renal epithelium, and hair follicles. Many of these tissues
are characterized by rapid growth and/or turnover of their
constituent cells.
"Cell damaging" therapies include, but are not limited
to chemotherapy (e.g. cisplatin, doxorubicin, mitomycin C,
camptothecin, and fluorouracil and other nucleoside
analogs), therapeutic irradiation, laser treatment, and
administration of inhaled toxins (such as bleomycin).
Physical manipulations that are associated with device-
assisted therapies, such as the physical removal of a
blockage from a coronary artery, also can cause damage to
innocent bystander tissue. While these cell-damaging
therapies are useful because they damage and kill diseased
tissue, as noted above, they have the undesirable side
effect of damaging and inducing apoptosis of "innocent
bystander" tissue.
As discussed elsewhere in this application, mFLINT
blocks Fas/FasL interactions. It also has been demonstrated
herein that mFLINT inhibits Fast-induced apoptosis in vitro,
and that mFLINT improved the survival of bone marrow cells
following therapeutic irradiation and chemotherapy.
Therefore, it is an object of the present invention to
ameliorate damage to innocent bystander tissues that is
caused by cell-damaging therapy.
Cancer therapies such as irradiation and chemotherapy
have been shown to induce apoptosis in intestinal epithelial
cells. It is known that many chemotherapeutic agents work
by inducing apoptosis. See, e.g., Micheau, et al. J. Natl.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-38-
Can. Inst. 89:783 (1997). This apoptosis, combined with the
myelosuppression that is induced by irradiation and
chemotherapy, permits massive opportunistic infection.
There currently are no effective therapies for managing the
disruption of intestinal function that is associated with
chemotherapy and therapeutic irradiation. As noted above,
treatment with cytokines has been shown to improve recovery
from myelosuppression, but cytokines can produce undesirable
toxicity.
Therefore, it is expected that mFLINT will ameliorate
damage to the intestinal epithelium that is induced by
irradiation and/or chemotherapy. While not desiring to be
bound to any particular theory, it is expected that mFLINT
will ameliorate this damage by inhibition of apoptosis
and/or inflammation of the intestinal epithelium.
Fas/FasL interactions have been implicated in chronic
gastritis. It has been shown that Fas and Fast expression
are increased in gastric epithelial cells from individuals
suffering from chronic gastritis. See Rudi, et al., J.
Clin. Invest. 102:1506 (1998). Rudi also reported that
Helicobacter-infected gastric epithelial cells have
increased levels of Fast (CD95 ligand) and Fas (CD95
receptor), and that Helicobacter-induced apoptosis was
reduced by blocking Fast with anti-APO-1 antibody. Thus, it
is expected that mFLINT may be effective in inhibiting (i)
gastritis that is induced by Helicobacter and, as mentioned
above, (ii) cell-damaging therapies, such as chemotherapy
and irradiation.
Furthermore, patients receiving high-dose chemotherapy
(HD-CT) are at risk of severe mucositis, which is
characterized by apoptosis and inflammation of the gastric
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-39-
epithelium. Wymenga, et al., Br. J. Cancer 76:1062 (1997)
studied mucositis of in the oral cavity of breast cancer
patients treated with HD-CT. The percentage of viable
epithelial cells appearing in an oral wash increased in
patients treated with HD-CT, suggested a desquamation of the
upper oral mucosal layer. Also, there was a higher
percentage of immature cells in the oral mucosa of the HD-CT
patients.
Other innocent bystander tissues also may benefit from
mFLINT therapy. For example, Fas/FasL-induced apoptosis has
been implicated in bleomycin-induced apoptosis and fibrosis
in lung epithelium. Hagimoto, et al. Am. J. Respir. Cell.
Mol. Biol. 16:91 (1997). That study showed that in alveolar
epithelial cells treated with bleomycin, Fas mRNA was
upregulated, and Fast mRNA was upregulated in infiltrating
lymphocytes. Therefore, the applicants expect that mFLINT
therapy may ameliorate damage in lung tissue, such as
epithelium, that is induced by cell-damaging therapies.
E. Treatment of Cancer with mFLINT
The present inventors have found that administration of
mFLINT to mice causes a reduction in the volume of tumors
that are produced when mice are injected with melanoma
cells. This effect of mFLINT may be mediated through
mFLINT/FasL binding and the consequent inhibition of FasL-
mediated T-cell apoptosis, permitting a T-cell mediated
immune response to facilitate destruction of the tumor. In
this regard, it is known that Fast is expressed in
melanomas, human colorectal cancers, hepatocellular cancers,
astrocytomas and lung cancer. O'Connell, et al. Immunology
Today insert*, Chappell, et a1. Cancer Immunol. Immunother.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-40-
47:65 (1998). It also has been reported that colon cancer
cell lines express Fast and can kill T cells in vitro by
inducing Fast-mediated apoptosis. O'Connell. Therefore,
the melanoma tumors observed in the present application may
express Fast, triggering Fast-mediated death of infiltrating
T-cells that express Fas. However, other mechanisms may
also be responsible for the tumor reduction that has been
demonstrated in the present application.
Based on the success achieved by the present inventors
with mFLINT-mediated reduction of tumor volume, it is
expected that other types of cancer also can be successfully
treated with mFLINT. These cancers include, but are not
limited to, astrocytoma, colon cancer, esophageal cancer,
lung cancer, melanoma and hepatocellular cancer. Other
cancers that can be treated with mFLINT include bladder
cancer and ovarian cancer.
F. Treatment of Autoimmune Disease with mFLINT
Both Type I (insulin-dependent) and Type II (non-
insulin dependent) diabetes are characterized by
hyperglycemia. As used herein, the term "hyperglycemia,"
which is well known in the art, describes a condition
characterized by a blood glucose level that is higher than
that found in a normal human. Normal human fasting blood
glucose levels are less than 110 mg/dL. The Expert
Committee on the Diagnosis and Classification of Diabetes
Mellitus, Diabetes Care, 21 (Suppl. 1), S5-S19 (1992).
Type I insulin-dependent diabetes (IDDM) is a chronic
autoimmune disorder involving destruction of pancreatic
(insulin-producing) (3 cells via the Fast-Fas pathway. It is
likely that this destructive pathway is activated by the
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-41-
inflammatory process. Normal (3 cells do not express Fas,
but Fas is expressed in these cells during insulitis. It is
thus likely that lymphocyte-associated Fast contributes to
the local destruction of these Fas+ cells via a Fast-Fas
interaction. To the extent that mFLINT is useful in
antagonizing this pathway, it is useful in preventing or
treating IDDM.
Multiple sclerosis (MS) is a degenerative inflammatory
demyelinating disease. Fas has be found among the
oligodendrocytes located along the lesion margin and in the
adjacent white matter in both acute and chronic MS, whereas
normal tissue shows little or none. It is likely that this
abnormal expression of Fas is induced by cytokines released
during the inflammatory process. Moreover, Fast-expressing
cells have been co-localized with Fas-expressing apoptotic
oligodendrocytes, suggesting involvement of this pathway in
the pathology of this disease. Lupus, another autoimmune
disease, also can be treated with mFLINT.
G. Treatment of Osteoporosis with mFLINT
Data presented below in the examples indicate that mFLINT is
useful in preventing or treating disorders of bone loss,
like osteoporosis. mFLINT also can be used to inhibit bone
resorption. These data are consistent with data showing the
naturally-occurring secreted member of the TNFR superfamily
was recently reported as having a role in regulating bone
resorption. Simonet et al. Cell 89:309(1997) (termed
osteoprotegrin (OPG); Tsuda et al. Biochem. and Biophys.
Res. Comm. 234:137 (1997) (termed osteoclastogenesis
inhibitory factor (OCIF))), functioning essentially as
inhibitors of differentiation of bone-resorbing osteoclasts.
Consistently, studies have directly linked Fas to osteoblast
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-42-
apoptosis. Jilka et al., 1998, J. Bone & Mineral Res.
13:793-802; Kawakami et al., 1997, J. Bone & Mineral Res.
12:1637-46.
Acute Lung Injury and Acute Respiratory Distress Syndrome
Acute lung injury (ALI) and acute respiratory distress
syndrome CARDS) represent disease entities that differ only
in the severity of the hypoxemia present at diagnosis. A
widely accepted parameter for diagnosis is the Pa02 to Fi02
ratio, according to which ARDS patients manifest a ratio of
less than or equal to 200 mm Hg, whereas ALI patients
exhibit values of less than or equal to 300 mm Hg. ARDS
represents a more severe form of ALI. Numerous mediators are
likely to contribute to the pathogenesis of ARDS/ALI with
neutrophils playing a prominent role. While multiple
precipitating factors are probable in the development of
ARDS, both direct and indirect, the major cause appears to
be sepsis and the systemic inflammatory response syndrome,
accounting for approximately 40% of cases. Mortality in ARDS
is high approximating 40%, with most deaths occurring within
the first 2 to 3 weeks. There is no currently available,
approved pharmacologic therapy for ARDS and treatment at
present is limited to aggressive supportive care.
There is evidence that ARDS may be mediated by soluble
FasL/Fas interaction in humans (Matute-Bello et al., J.
Immunol. 163, 2217-2225, 1999). FLINT, by binding to Fast,
could inhibit Fast-mediated apoptosis of pneumocytes and/or
endothelial cells, thus inhibiting or preventing the
progression from acute inflammatory insult to ALI, and from
ALI to ARDS.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-43-
In one embodiment the present invention relates to the
use of FLINT to treat ALI and/or ARDS comprising the
administration of a therapeutically effective amount of
FLINT to a person in need thereof.
IV. THERAPEUTIC FORMULATIONS OF mFLINT
The mFLINT polypeptide composition will be formulated
and dosed in a fashion consistent with good medical
practice, taking into account the clinical condition of the
individual patient (especially the side effects of treatment
with mFLINT polypeptide alone), the site of delivery of the
mFLINT polypeptide composition, the method of
administration, the scheduling of administration, and other
factors known to practitioners.
An effective amount of polypeptide results in a
statistically significant modulation of the biological
activity of the selected TNFR family ligand, for example,
Fast or LIGHT. The biological activity for Fast includes,
but is not limited to, apoptosis. The biological activity
for LIGHT includes, but is not limited to, cell
proliferation. LIGHT is a 29 kDa type II transmembrane TNF
superfamily member protein produced by activated T cells.
Mauri d.M., Immunity, 8:21-30, January 1998.
Further, an effective amount may also be determined by
prevention or amelioration of adverse conditions or symptoms
of diseases, injuries or disorders being treated. The
"therapeutically effective amount" of mFLINT polypeptide for
purposes herein is thus determined by such considerations.
It should be noted that mFLINT is an immunomodulator and
that a common observation with such substances is a bell-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-44-
shaped dose-response curve. Such a phenomenon is well known
in the art and it is within the skill of the clinician to
take this into account in adjusting the therapeutically
effective amount of mFLINT accordingly.
As a general proposition, the total pharmaceutically
effective amount of mFLINT polypeptide administered
parenterally per dose will be in the range of about 1
~g/kg/day to 10 mg/kg/day of patient body weight, more
particularly 2-8mg/kg, preferably 2-4mg/kg, most preferred
2.2mg/kg to 3.3 mg/kg and finally 2.5 mg/kg. However, as
noted above, this will be subject to therapeutic discretion.
Preferably, this dose is at least 0.01 mg/kg/day.
If given continuously, the mFLINT polypeptide is
typically administered at a dose rate of about 0.1
~tg/kg/hour to about 50 ~g/kg/hour, either by 1-4 injections
per day or by continuous subcutaneous infusions, for
example, using a mini-pump. An intravenous bag solution may
also be employed. The length of treatment needed to observe
changes and the interval following treatment for responses
to occur appears to vary depending on the desired effect.
Pharmaceutical compositions containing the mFLINT of
the invention may be administered using a variety of modes
that include, but are not limited to, oral, rectal, intra-
cranial, parenteral, intracisternal, intravaginal,
intraperitoneal, topical, transdermal (as by powders,
ointments, drops or transdermal patch), bucally, or as an
oral or nasal spray. By "pharmaceutically acceptable
carrier" is meant a non-toxic solid, semisolid or liquid
filler, diluent, encapsulating material or formulation
auxiliary of any type. The term "parenteral" as used herein
refers to modes of administration which include but are not
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-45-
limited to, intravenous, intramuscular, intraperitoneal,
intrasternal, subcutaneous and intraarticular injection and
infusion. Implants comprising mFLINT also can be used.
The mFLINT polypeptide is also suitably administered by
sustained-release systems. Suitable examples of sustained-
release compositions include semi-permeable polymer matrices
in the form of shaped articles, e.g., films, or
microcapsules. Sustained-release matrices include
polylactides (U. S. Pat. No. 3,773.919, EP 58,481),
copolymers of L-glutamic acid and gamma-ethyl-L-glutamate
(Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly (2-
hydroxyethyl methacrylate) (R.Langer et al., J. Biomed.
Mater. Res. 15:167-277 (1981), and R. Langer, Chem. Tech.
12:98-105 (1982)), ethylene vinyl acetate (R. Langer et al.,
Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988).
Sustained-release mFLINT polypeptide compositions also
include liposomally entrapped mFLINT polypeptides. Liposomes
containing mFLINT polypeptides are prepared by methods known
per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci.
(USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad.
Sci. (USA) 77:4030-4034 (1980); EP 52,322; EP 36,676; EP
88,046; EDP 143,949; EP 142,641; Japanese Pat. Appl. 83-
118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP
102,324. Ordinarily, the liposomes are of the small (about
200-800 Angstroms) unilamellar type in which the lipid
content is greater than about 30 mol. percent cholesterol,
the selected proportion being adjusted for the optimal TNFR
polypeptide therapy.
For parenteral administration, in one embodiment, the
mFLINT polypeptide is formulated generally by mixing it at
the desired degree of purity, in a unit dosage injectable
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-46-
form (solution, suspension, or emulsion), with a
pharmaceutically acceptable carrier, i.e., one that is non-
toxic to recipients at the dosages and concentrations
employed and is compatible with other ingredients of the
formulation. For example, the formulation preferably does
not include oxidizing agents and other compounds that are
known to be deleterious to polypeptides.
Generally, the formulations are prepared by contacting
the mFLINT polypeptide uniformly and intimately with liquid
carriers or finely divided solid carriers or both. Then, if
necessary, the product is shaped into the desired
formulation. Preferably the carrier is a parenteral
carrier, more preferably a solution that is isotonic with
the blood of the recipient. Examples of such carrier
vehicles include water, saline, Ringer's solution, and
dextrose solution. Non-aqueous vehicles such as fixed oils
and ethyl oleate are also useful herein, as well as
liposomes.
The carrier suitably contains minor amounts of
additives such as substances that enhance isotonicity and
chemical stability. Such materials are non-toxic to
recipients at the dosages and concentrations employed, and
include buffers such as phosphate, citrate, succinate,
acetic acid, and other organic acids or their salts;
antioxidants such as ascorbic acid; low molecular weight
(less than about ten residues) polypeptides, e.g.,
polyarginine or tripeptides; proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers
such as polyvinylpyrrolidone; amino acids, such as glycine,
glutamic acid, aspartic acid, or arginine; monosaccharides,
disaccharides, and other carbohydrates including cellulose
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-47-
or its derivatives, glucose, manose, or dextrins; chelating
agents such as EDTA; sugar alcohols such as mannitol or
sorbitol; counterions such as sodium; and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
The mFLINT polypeptide is typically formulated in such
vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml,
preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be
understood that the use of certain of the foregoing
excipients, carriers, or stabilizers will result in the
formation of mFLINT polypeptide salts.
FLINT polypeptides to be used for therapeutic
administration must be sterile. Sterility is readily
accomplished by filtration through sterile filtration
membranes (e. g., 0.2 micron membranes). Therapeutic mFLINT
polypeptide compositions generally are placed into a
container having a sterile access port, for example, an
intravenous solution bag or vial having a stopper pierceable
by a hypodermic injection needle.
FLINT polypeptides ordinarily will be stored in unit or
multi-dose containers, for example, sealed ampoules or
vials, as an aqueous solution or as a lyophilized
formulation for reconstitution. As an example of a
lyophilized formulation, 10-ml vials are filled with 5 ml of
sterile-filtered 1% (w/v) aqueous mFLINT polypeptide
solution, and the resulting mixture is lyophilized. The
infusion solution is prepared by reconstituting the
lyophilized mFLINT polypeptide using bacteriostatic Water-
for-Injection.
The invention also provides a pharmaceutical pack or
kit comprising one or more containers filled with one or
more of the ingredients of the pharmaceutical compositions
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-48-
of the invention. Associated with such containers) can be
a notice in the form prescribed by a governmental agency
regulating the manufacture, use or sale of pharmaceuticals
or biological products, which notice reflects approval by
the agency of manufacture, use or sale for human
administration. In addition, the polypeptides of the
present invention may be employed in conjunction with other
therapeutic compounds.
V. Polypeptide Production Methods
One embodiment of the present invention relates to the
substantially purified polypeptide encoded by a mFLINT gene
or a mFLINT gene.
Skilled artisans will recognize that the polypeptides
of the present invention can be synthesized by a number of
different methods, such as chemical methods well known in
the art, including solid phase peptide synthesis or
recombinant methods. Both methods are described in U.S.
Patent 4,617,149.
The principles of solid phase chemical synthesis of
polypeptides are well known in the art and may be found in
general texts in the area. For example, see H. Dugas and C.
Penney, BIOORGANIC CHEMISTRY (1981) Springer-Verlag, New
York, 54-92. For example, peptides may be synthesized by
solid-phase methodology utilizing an Applied Biosystems 430A
peptide synthesizer (Applied Biosystems, Foster City, CA)
and synthesis cycles supplied by Applied Biosystems.
The polypeptides of the present invention can also be
produced by recombinant DNA methods using the cloned FLINT
gene. Recombinant methods are preferred if a high yield is
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-49-
desired. Expression of the cloned gene can be carried out
in a variety of suitable host cells, well known to those
skilled in the art. For this purpose, the FLINT gene is
introduced into a host cell by any suitable means, well
known to those skilled in the art. While chromosomal
integration of the cloned gene is within the scope of the
present invention, it is preferred that the gene be cloned'
into a suitable extra-chromosomally maintained expression
vector so that the coding region of the FLINT gene is
operably-linked to a constitutive or inducible promoter.
The basic steps in the recombinant production of the
FLINT polypeptide are:
a) constructing a natural, synthetic or semi-synthetic
DNA encoding FLINT polypeptide;
b) integrating said DNA into an expression vector in a
manner suitable for expressing the FLINT polypeptide, either
alone or as a fusion polypeptide;
c) transforming or otherwise introducing said vector
into an appropriate eukaryotic or prokaryotic host cell
forming a recombinant host cell;
d) culturing said recombinant host cell in a manner to
express the FLINT polypeptide; and
e) recovering and substantially purifying the FLINT
polypeptide by any suitable means well known to those
skilled in the art.
1. Expressing Recombinant FLINT Polypeptide in
Prokaryotic and Eukaryotic Host Cells
Prokaryotes may be employed in the production of
recombinant FLINT polypeptide. For example, the Escherichia
coli K12 strain 294 (ATCC No. 31446) is particularly useful
for the prokaryotic expression of foreign polypeptides.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-50-
Other strains of E. coli, bacilli such as Bacillus subtilis,
enterobacteriaceae such as Salmonella typhimurium or
Serratia marcescans, various Pseudomonas species and other
bacteria, such as Streptomyces, may also be employed as host
cells in the cloning and expression of the recombinant
polypeptides of this invention.
Promoter sequences suitable for driving the expression
of genes in prokaryotes include -lactamase [e. g. vector
pGX2907, ATCC 39344, contains a replicon and -lactamase
gene], lactose systems [Chang et al., Nature-(London),
275:615 (1978); Goeddel et al., Nature (London), 281:544
(1979)], alkaline phosphatase, and the tryptophan (trp)
promoter system [vector pATHl (ATCC 37695)], which is
designed to facilitate expression of an open reading frame
as a trpE fusion polypeptide under the control of the trp
promoter. Hybrid promoters such as the tac promoter
(isolatable from plasmid pDR540, ATCC-37282) are also
suitable. Still other bacterial promoters, whose nucleotide
sequences are generally known, may be ligated to DNA
encoding the polypeptide of the instant invention, using
linkers or adapters to supply any required restriction
sites. Promoters for use in bacterial systems also will
contain a Shine-Dalgarno sequence operably-linked to the DNA
encoding the desired polypeptides. These examples are
illustrative rather than limiting.
The polypeptides of this invention may be synthesized
either by direct expression or as a fusion polypeptide
comprising the polypeptide of interest as a translational
fusion with another polypeptide or peptide that may be
removed by enzymatic or chemical cleavage. It often is
observed in the production of certain peptides in
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-51-
recombinant systems that expression as a fusion polypeptide
prolongs the lifespan, increases the yield of the desired
peptide, or provides a convenient means of purifying the
polypeptide. This is particularly relevant when expressing
mammalian polypeptides in prokaryotic hosts. A variety of
peptidases (e.g. enterokinase and thrombin) which cleave a
polypeptide at specific sites or digest the peptides from
the amino or carboxy termini (e.g. diaminopeptidase) of the
peptide chain are known. Furthermore, particular chemicals
(e.g. cyanogen bromide) will cleave a polypeptide chain at
specific sites. The skilled artisan will appreciate the
modifications necessary to the amino acid sequence (and
synthetic or semi-synthetic coding sequence if recombinant
means are employed) to incorporate site-specific internal
cleavage sites. For instance, see P. Carter, "Site Specific
Proteolysis of Fusion Polypeptides", Chapter 13, in PROTEIN
PURIFICATION: FROM MOLECULAR MECHANISMS TO LARGE SCALE
PROCESSES, American Chemical Society, Washington, D.C.
(1990) .
In addition to prokaryotes, a variety of amphibian
expression systems such as frog oocytes, and mammalian cell
systems can be used. The choice of a particular host cell
depends to some extent on the particular expression vector
used. Exemplary mammalian host cells suitable for use in
the present invention include HepG-2 (ATCC HB 8065), CV-1
(ATCC CCL 70), LC-MK2 (ATCC CCL 7.1), 3T3 (ATCC CCL 92),
CHO-K1 (ATCC CCL 61), HeLa (ATCC CCL 2), RPMI8226 (ATCC CCL
155), H4IIEC3 (ATCC CCL 1600), C127I (ATCC CCL 1616), HS-
Sultan (ATCC CCL 1484), and BHK-21 (ATCC CCL 10), for
example.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-52-
A wide variety of vectors are suitable for transforming
mammalian host cells. For example, the pSV2-type vectors
comprise segments of the simian virus 40 (SV40) genome
required for transcription and polyadenylation. A large
number of plasmid pSV2-type vectors have been constructed,
such as pSV2-gpt, pSV2-neo, pSV2-dhfr, pSV2-hyg, and pSV2- -
globin, in which the SV40 promoter drives transcription of
an inserted gene. These vectors are widely available from
sources such as the American Type Culture Collection (ATCC),
12301 Parklawn Drive, Rockville, Maryland, 20852, or the
National Center for Agricultural Utilization Research, 1815
North University Street, Peoria, Illinois 61604-39999.
Promoters suitable for expression in mammalian cells
include the SV40 late promoter, promoters from eukaryotic
genes, such as, for example, the estrogen-inducible chicken
ovalbumin gene, the interferon genes, the glucocorticoid-
inducible tyrosine aminotransferase gene, the thymidine
kinase gene promoter, and the promoters of the major early
and late adenovirus genes.
Plasmid pRSVcat (ATCC 37152) comprises portions of a
long terminal repeat of the Rous Sarcoma virus, a virus
known to infect chickens and other host cells. This long
terminal repeat contains a promoter which is suitable for
use in the vectors of this invention. H. Gorman et al.,
Proc. Nat. Acad. Sci. (USA), 79, 6777 (1982). The plasmid
pMSVi (NRRL B-15929) comprises the long terminal repeats of
the Murine Sarcoma virus, a virus known to infect mouse and
other host cells. The mouse metallothionein promoter has
also been well characterized for use in eukaryotic host
cells and is suitable for use in the present invention.
This promoter is present in the plasmid pdBPV-MMTneo (ATCC
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-53-
37224) which can serve as the starting material for the
construction of other plasmids of the present invention.
Transfection of mammalian cells with vectors can be
performed by a plurality of well known processes including,
but not limited to, protoplast fusion, calcium phosphate co-
precipitation, electroporation and the like. See, e.g.,
Maniatis et al., supra.
Some viruses also make appropriate vectors. Examples
include the adenoviruses, the adeno-associated viruses, the
vaccinia virus, the herpes viruses, the baculoviruses, and
the rous sarcoma virus, as described in U.S. Patent
4,775,624, incorporated herein by reference. For example,
the baculovirus pFastBac-1 (GIBCO/BRL) can be used to infect
a suitable host cell, such as SF9, to produce recombinant
protein.
Eukaryotic microorganisms such as yeast and other fungi
are also suitable host cells. The yeast Saccharomyces
cerevisiae is the preferred eukaryotic microorganism. Other
yeasts such as Kluyveromyces lactis and Pichia pastoris are
also suitable. For expression in Saccharomyces, the plasmid
YRp7 (ATCC-40053), for example, may be used. See, e.g., L.
Stinchcomb et al., Nature, 282, 39 (1979); J. Kingsman et
al., Gene, 7, 141 (1979); S. Tschemper et al., Gene, 10, 157
(1980). Plasmid YRp7 contains the TRP1 gene which provides
a selectable marker for use in a trpl auxotrophic mutant.
Purification of Recombinantlv-Produced FLINT Polvpeptide
An expression vector carrying the cloned FLINT gene is
transformed or transfected into a suitable host cell using
standard methods. Cells that contain the vector are
propagated under conditions suitable for expression of the
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-54-
recombinant FLINT polypeptide. For example, if the
recombinant gene has been placed under the control of an
inducible promoter, suitable growth conditions would
incorporate the appropriate inducer. The recombinantly-
produced polypeptide may be purified from cellular extracts
of transformed cells by any suitable means.
In a preferred process for polypeptide purification,
the FLINT gene is modified at the 5' end to incorporate
several histidine residues at the amino terminus of the
i0 FLINT polypeptide. This "histidine tag" enables a single-
step polypeptide purification method referred to as
"immobilized metal ion affinity chromatography" (IMAC),
essentially as described in U.S. Patent 4,569,794, which
hereby is incorporated by reference. The IMAC method
enables rapid isolation of substantially pure recombinant
FLINT polypeptide starting from a crude extract of cells
that express a modified recombinant polypeptide, as
described above.
Other embodiments of the present invention comprise
isolated nucleic acids that encode Figures 1, 2,3,4. Any of
these nucleic acids may be produced by chemical synthetic
methods. The synthesis of nucleic acids is well known in
the art. See, e.g., E.L. Brown, R. Belagaje, M.J. Ryan, and
H.G. Khorana, Methods in Enzymology, 68:109-151 (1979).
Fragments of the DNA sequence corresponding to a FLINT or an
mFLINT gene could be generated using a conventional DNA
synthesizing apparatus, such as the Model 380A or 380B DNA
synthesizers of Applied Biosystems, Inc. (850 Lincoln Center
Drive, Foster City, CA 94404), using phosphoramidite
chemistry, and thereafter ligating the fragments so as to
reconstitute the entire gene. Alternatively,
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-55-
phosphotriester chemistry may be employed to synthesize
nucleic acids used in this invention. See, for example,
Gait, M.J., ed. OLIGONUCLEOTIDE SYNTHESIS, A PRACTICAL
APPROACH ( 1984 ) .
In an alternative methodology, namely PCR, the DNA
sequences disclosed and described herein, comprising, for
example, Figure 1 can be produced from a plurality of
starting materials. For example, starting with a cDNA
preparation (e. g. cDNA library) derived from tissue that
expresses the FLINT gene, suitable oligonucleotide primers
complementary to Figure 1 or to any sub-region therein, are
prepared as described in U.S. Patent No. 4,889,818. Other
suitable protocols for the PCR are disclosed in PCR
PROTOCOLS: A GUIDE TO METHOD AND APPLICATIONS, Ed. Michael
A. Innis et al., Academic Press, Inc. (1990).
The ribonucleic acids of the present invention may be
prepared via polynucleotide synthetic methodology, discussed
above, or they may be prepared enzymatically, for example,
by using RNA polymerise to transcribe a FLINT DNA template.
The most preferred systems for preparing the ribonucleic
acids of the present invention employ the RNA polymerise
from the bacteriophage T7 or the bacteriophage SP6. These
RNA polymerises are highly specific, requiring the insertion
of bacteriophage-specific sequences at the 5' end of the
template to be transcribed. See Maniatis et al., supra.
This invention also provides nucleic acids, RNA or DNA, that
are complementary to Figures 1-4.
2. Vectors
Another aspect of the present invention relates to
recombinant DNA cloning vectors and expression vectors
comprising the nucleic acids of the present invention.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-56-
The skilled artisan understands that choosing the most
appropriate cloning vector or expression vector depends upon
a number of factors including the availability of
restriction enzyme sites, the type of host cell into which
the vector is to be transfected or transformed, the purpose
of the transfection or transformation (e. g., stable
transformation as an extrachromosomal element, or
integration into the host chromosome), the presence or
absence of readily assayable or selectable markers (e. g.,
antibiotic resistance and metabolic markers of one type and
another), and the number of copies of the gene desired in
the host cell.
Vectors suitable to carry the nucleic acids of the
present invention comprise RNA viruses, DNA viruses, lytic
bacteriophages, lysogenic bacteriophages, stable
bacteriophages, plasmids, viroids, and the like. The most
preferred vectors are plasmids.
When preparing an expression vector the skilled artisan
understands that there are many variables to be considered,
for example, whether to use a constitutive or inducible
promoter. The practitioner also understands that the amount
of nucleic acid or polypeptide to be produced dictates, in
part, the selection of the expression system. Regarding
promoter sequences, inducible promoters are preferred
because they enable high level, regulatable expression of an
operably-linked gene. The skilled artisan will recognize a
number of suitable promoters that respond to a variety of
inducers, for example, carbon source, metal ions, and heat.
Other relevant considerations regarding an expression vector
include whether to include sequences for directing the
localization of a recombinant polypeptide. For example, a
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-57-
sequence encoding a signal peptide preceding the coding
region of a gene is useful for directing the extra-cellular
export of a resulting polypeptide.
The present invention also provides a method for
constructing a recombinant host cell capable of expressing
polypeptides comprising Figures 1-4. This method comprises
transforming or otherwise introducing into a host cell a
recombinant DNA vector that comprises an isolated DNA
sequence as described in any of Figures 1 through 4.
The preferred host cell is any eukaryotic cell that can
accommodate high level expression of an exogenously
introduced gene or polypeptide, and that will incorporate
said polypeptide into its membrane structure. Vectors for
expression are those which comprise any of the sequences of
Figures 1-4. Transformed host cells may be cultured under
conditions well known to skilled artisans such that FLINT or
mFLINT is expressed, thereby producing a recombinant FLINT
or mFLINT polypeptide in the recombinant host cell.
The following examples more fully describe the present
invention. Those skilled in the art will recognize that the
particular reagents, equipment, and procedures described are
merely illustrative and are not intended to limit the
present invention in any manner.
EXAMPLE 1
RT-PCR Amplification of FLINT Gene from mRNA
A FLINT gene is isolated by reverse transcriptase PCR
(RT-PCR) using conventional methods. Total RNA from a
tissue that expresses the FLINT gene, for example, lung, is
prepared using standard methods. First strand FLINT cDNA
synthesis is achieved using a commercially available kit
(SuperScriptT"" System; Life Technologies) by PCR in
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-58-
conjunction with specific primers directed at any suitable
region of Figures 1-4.
Amplification is carried out by adding to the first
strand cDNA (dried under vacuum): 8 ~1 of lOX synthesis
buffer (200 mM Tris-HCl, pH 8.4; 500 mM KCl, 25 mM MgCl2, 1
ug/ul BSA); 68 ~1 distilled water; 1 ~l each of a 10 uM
solution of each primer; and 1 E,tl Taq DNA polymerase (2 to 5
U/~,1). The reaction is heated at 94° C for 5 minutes to
denature the RNA/cDNA hybrid. Then, 15 to 30 cycles of PCR
amplification are performed using any suitable thermal cycle
apparatus. The amplified sample may be analyzed by agarose
gel electrophoresis to check for an appropriately-sized
fragment.
EXAMPLE 2
Production of a Vector for Ex ressin FLINT in a Host Cell
An expression vector suitable for expressing FLINT or
fragment thereof in a variety of prokaryotic host cells,
such as E. coli is easily made. The vector contains an
origin of replication (Ori), an ampicillin resistance gene
(Amp) useful for selecting cells which have incorporated the
vector following a transformation procedure, and further
comprises the T7 promoter and T7 terminator sequences in
operable linkage to a FLINT coding region. Plasmid pETllA
(obtained from Novogen, Madison WI) is a suitable parent
plasmid. pETllA is linearized by restriction with
endonucleases NdeI and BamHI. Linearized pETllA is ligated
to a DNA fragment bearing NdeI and BamHI sticky ends and
comprising the coding region of the FLINT gene as disclosed
by Figures 1-4.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-59-
The FLINT gene used in this construction may be
slightly modified at the 5' end (amino terminus of encoded
polypeptide) in order to simplify purification of the
encoded polypeptide product. For this purpose, an
oligonucleotide encoding 8 histidine residues is inserted
after the ATG start codon. Placement of the histidine
residues at the amino terminus of the encoded polypeptide
serves to enable the IMAC one-step polypeptide purification
procedure.
EXAMPLE 3
Recombinant Expression and Purification of FLINT Polypeptide
An expression vector that carries an open reading frame
(ORF) encoding FLINT or fragment thereof and which ORF is
operably-linked to an expression promoter is transformed
into E. coli BL21 (DE3) (hsdS gal cIts857
indlSam7nin51acUV5-T7gene 1) using standard methods.
Transformants, selected for resistance to ampicillin, are
chosen at random and tested for the presence of the vector
by agarose gel electrophoresis using quick plasmid
preparations. Colonies which contain the vector are grown
in L broth and the polypeptide product encoded by the
vector-borne ORF is purified by immobilized metal ion
affinity chromatography (IMAC), essentially as described in
US Patent 4,569,794.
Briefly, the IMAC column is prepared as follows. A
metal-free chelating resin (e. g., Sepharose 6B IDA,
Pharmacia) is washed in distilled water to remove
preservative substances and infused with a suitable metal
ion [e. g., Ni(II), Co(II), or Cu(II)] by adding a 50mM metal
chloride or metal sulfate aqueous solution until about 75%
of the interstitial spaces of the resin are saturated with
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-60-
colored metal ion. The column is then ready to receive a
crude cellular extract containing the recombinant
polypeptide product.
After removing unbound polypeptides and other materials
by washing the column with any suitable buffer, pH 7.5, the
bound polypeptide is eluted in any suitable buffer at pH
4.3, or preferably with an imidizole-containing buffer at pH
7.5.
~~rn~ur~r.~! a
Tissue Distribution of FLINT mRNA
The presence of FLINT mRNA in a variety of human
tissues was analyzed by Northern analysis. Total RNA from
different tissues or cultured cells was isolated by a
standard guanidine chloride/phenol extraction method, and
poly-A+ RNA was isolated using oligo(dT)-cellulose type 7
(Pharmacies). Electrophoresis of RNA samples was carried out
in formaldehyde followed by capillary transfer to Zeta-
ProbeT"' nylon membranes (Bio-Rad, Hercules, Calif.). Figure
1 was the template for generating probes using a MultiPrimeT""
random priming kit (Amersham, Arlington Heights, I11.). The
efficiency of the labeling reaction was approximately 4 x
101° cpm incorporated per ~g of template. The hybridization
buffer contained 0.5M sodium phosphate, 7o SDS (wt/vol), 1%
BSA (wt/vol), and 1 mM EDTA. Prehybridization was carried
out in hybridization buffer at 65° C for 2 h and 32P-labeled
probe was added and incubation continued overnight. The
filters were washed in Buffer A (40 mM sodium phosphate pH
7.2, 5% SDS [wt/vol], 0.5% BSA [wt/vol], and 1 mM EDTA) at
65° C for 1 h, and then in Buffer B (40 mM sodium phosphate,
pH 7.2, 1% SDS [wt/vol], and 1 mM EDTA) at 65° C for 20
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-61-
minutes. The filters were air-dried and exposed to Kodak X-
OMAT AR film at -80° C with an intensifying screen.
The results showed that FLINT mRNA was present in
numerous tissues, including stomach, spinal cord, lymph
node; trachea, spleen, colon and lung.
ravaferfr Z, C
Production of an Antibody to a Polypeptide
Substantially pure polypeptide or fragment thereof is
isolated from transfected or transformed cells using any of
the well known methods in the art, or by a method
specifically disclosed herein. Concentration of polypeptide
in a final preparation is adjusted, for example, by
filtration through an Amicon filter device such that the
level is about 1 to 5 ug/ml. Monoclonal or polyclonal
antibody can be prepared as follows.
Monoclonal antibody can be prepared from murine
hybridomas according to the method of Kohler and Milstein
(Nature, 256, 495, 1975), or a modified method thereof.
Briefly, a mouse is repetitively inoculated with a few
micrograms of the polypeptide or fragment thereof, or fusion
peptide thereof, over a period of a few weeks. The mouse is
then sacrificed and the antibody producing cells of the
spleen isolated. The spleen cells are fused by means of
polyethylene glycol with mouse myeloma cells. Fused cells
that produce antibody are identified by any suitable
immunoassay, for example, ELISA, as described in E. Engvall,
Meth. Enzymol., 70, 419, 1980.
Polyclonal antiserum can be prepared by well known
methods, as described, for example, by J. Vaitukaitis
et.al., Clin. Endocirnol. Metab. 33, 988 (1971), that
involve immunizing suitable animals with the polypeptides,
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-62-
fragments thereof, or fusion polypeptides thereof, disclosed
herein. Small doses (e. g., nanogram amounts) of antigen
administered at multiple intradermal sites appears to be the
most reliable method.
EXAMPLE 6
Construction of Mammalian FLINT-Flag Expression Vector
To facilitate confirmation of FLINT expression (without
the use of antibodies), a bicistronic expression vector
(pIGl-FLINTF) was constructed by insertion of an "internal
ribosome entry site"/enhanced green fluorescent polypeptide
(IRES/eGFP) PCR fragment into the mammalian expression
vector pGTD (Gerlitz, B. et al., 1993, Biochemical Journal
295:131). This new vector, designated pIGl, contains the
following sequence landmarks: the Ela-responsive GBMT
promoter (D. T. Berg et al., 1993 BioTechniques 14:972; D:T.
Berg et al., 1992 Nucleic Acids Research 20:5485); a unique
Bcll cDNA cloning site; the IRES sequence from
encephalomyocarditis virus (EMCV); the eGFP (Clontech)
coding sequence (Cormack, et al., 1996 Gene 173:33); the
SV40 small "t" antigen splice site/poly-adenylation
sequences; the SV40 early promoter and origin of
replication; the murine dihydrofolate reductase (dhfr)
coding sequence; and the pBR322 ampicillin resistance
marker/origin of replication. The resultant protein had the
Flag sequence attached at the C-terminal end, yielding:
[FLINT] -DYKDDDDK.
Based upon the human FLINT sequence, the following
primers were synthesized: 5'-
TAGGGCTGATCAAGGATGGGCTTCTGGACTTGGGCGGCCCC
TCCGCAGGCGGACCGGGG-3'; and 5'-AGGGGGGCGGCCGCTGATCATCACTT
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-63-
GTCGTCGTCGTCCTTGTAGTCGTGCA CAGGGAGGAAGCGC - 3'. The latter,
reverse primer contains the Flag epitope sequence (positions
24-47, double underline) (Micele, R.M. et al., 1994 J.
Immunol. Methods 167:279). These primers were then used to
PCR amplify the FLINT cDNA. The resultant 1.3 Kb PCR
product was then digested with Bcll (restriction sites
incorporated into primers, underlined above) and ligated
into the unique Bcll site of pIGl to generate the plasmid
pIGl-FLINTF. The human FLINT cDNA orientation and
nucleotide sequence were confirmed by restriction digest and
double stranded sequencing of the insert.
wa~rnr_~ ~
Construction of Mammalian FLINT-non-Flag Expression Vector
In order to generate a non-Flagged expression vector
(pIGl-FLINT), the 24-base DNA sequence encoding the eight
amino acid FLAG epitope was deleted from the pIGl-FLINTF
construct using the Quick Change mutagenesis kit
(Stratagene). A 35-base primer, and its complement, with
identity to the 19-base sequences flanking the FLAG sequence
was synthesized and used for PCR amplification using pIGl-
FLINTF the plasmid as template. The PCR reaction mixture
was digested with Dpnl restriction endonuclease to eliminate
the parental DNA, and the PCR product was transformed into
Epicurean XLI-blue E. coli cells. Sixteen ampicillin-
resistant transformants were picked and the plasmid DNA was
analyzed by restriction digestion. Ten of the 16 gave
results compatible with deletion of the 24-base sequence.
Precise deletion of the 24-base sequence was confirmed by
DNA sequencing of pIG1-FLINT. The nucleotide sequence of
FLINT in this plasmid is shown in Figure 1.
EXAMPLE 8
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-64-
Isolation of a high-producing FLINT clone from AV12 RGT18
transfectants
The recombinant plasmid carrying the FLINT gene (pIGl-
FLINT) encodes resistance to methotrexate. In addition, the
construct contains a gene encoding a fluorescent
polypeptide, GFP, on the same transcript and immediately 3'
to the FLINT gene. Since high level expression of GFP would
require a high level of expression of the FLINT-GFP mRNA,
highly fluorescent clones would have a greater probability
of producing high levels of FLINT. pIGl-FLINT and pIG1-
FLINTF were used to transfect AV12 RGT18 cells. Cells
resistant to 250 nM methotrexate were selected and pooled.
The pool of resistant clones was subjected to fluorescence
assisted cell sorting (FRCS), and cells having fluorescence
values in the top 50 of the population were sorted into a
pool and as single cells. The high fluorescence pools were
subjected to three successive sorting cycles. Pools and
individual clones from the second and third cycles were
analyzed for FLINT production by SDS-PAGE. Pools or clones
expressing FLINT at the highest level judged from Coomassie
staining were used for scale-up and FLINT purification. The
amino acid sequence of the mature FLINT protein that was
produced using this plasmid is shown in Figure 3, called
mFLINT.
wa~rnr_~ o
Large Scale mFLINT Polypeptide Purification
Large scale production of mFLINT was carried out by
first growing stable clones stable pIGl-FLINT-containing
AV12 RGT 18 cells in several 10 liter spinners. After
reaching confluency, cells were further incubated for 2-3
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-65-
more days to secrete maximum amount of FLINT into media.
Media containing mFLINT was adjusted to 0.1% CHAPS and
concentrated in an Amicon ProFlux M12 tangential filtration
system to 350 ml. The concentrated media was centrifuged at
19,000 rpm (43,000 x g) for 15 minutes and passed over a SP-
5PW TSK~GEL column (21.5 mm x 15 cm; TosoHaas) at a flow
rate of 8 ml/min. The column was washed with buffer A(20 mM
MOPS, 0.1% CHAPS, pH 6.5) until the absorbency (280 nm)
returned to baseline and the bound polypeptides were eluted
with a linear gradient from 0.1 M-0.3 M NaCl(in buffer A)
developed over 85 min. Fractions containing mFLINT were
pooled and passed over a (7.5 mm x 7.5 cm) Heparin-5PW TSK-
GEL column equilibrated in buffer B (50 mM Tris, 0.1% CHAPS,
0.3 M NaCl, pH 7.0). The bound polypeptide was eluted with
a linear gradient from 0.3 M-1.0 M NaCl (in buffer B)
developed over 60 min. Fractions containing mFLINT were
pooled and passed over a 1 cm x 15 cm Vydac C4 column
equilibrated with 0.1% TFA/H20. The bound mFLINT was eluted
with a linear gradient from 0-1000 CH3CN/0.1% TFA.
Fractions containing mFLINT were analyzed by SDS-PAGE and
found to be greater than 95% pure and were dialyzed against
8 mM NaP04, 0.5 M NaCl, 10% glycerol, pH 7.4. The N-
terminal sequence of mFLINT was confirmed on the purified
polypeptide. Mass spectral analysis and Endogylcosidase-F
digestion indicates that mFLINT is glycosylated.
EXAMPLE 10
A. Construction of FLINT-Flag and FLINT
Expression Vectors Flag-tagged and native versions of human
FLINT were expressed in baculovirus-infected cells in order
to generate enough recombinant protein for study. The human
FLINT cDNA was engineered for expression as follows. A pIG3
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-66-
(a derivative of pIGl; Gerlitz, B and Grinnell, B. W.,
unpublished data) expression vector containing the cDNA
encoding a FLAG-tagged version of FLINT was cleaved with
XbaI and filled in to create blunt ends. The vector was then
cleaved with SalI. The resulting 918-base pair fragment
containing the coding region was gel-purified and ligated
into the baculovirus vector pFastBac-1 (GIBCO/ BRL) that had
been digested with BamHI, the ends blunted and subsequently
digested with Sall generating the plasmid pBacOPG3Flag. This
construct was designed to express a full-length molecule
(including the 29 NH2-terminal amino acids, which constitute
the signal peptide) and the FLAG tag at the COOH-terminus of
the protein. The expression was under the control of the
baculovirus polyhedrin promoter.
For the construction of a vector to express the native
version of the protein, a 920-base pair XbaI/ HindIII cDNA
fragment encoding the full-length of the protein previously
subcloned into pCDNA3.1 (+/-) [purchased from Invitrogen]
was cleaved with XbaI and HindIII. The fragment was gel-
purified and ligated into the baculovirus vector pFastBac-1
(GIBCO/ BRL) that had been digested with XbaI and HindIII
generating the plasmid pBacOPG3.
B. Generation of Baculoviruses and Protein
Production The two vectors, pBacOPG3Flag and pBacOPG3 were
separately used to generate two recombinant baculoviruses
(vBacOPG3Flag and vBacOPG3) as described by the vendor
(GIBCO/ BRL). Each of the viruses was separately used to
infect SF-9 cells for protein production. The recombinant
proteins were measured in supernatants collected from the
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-67-
infected SF-9 cells by Western-blot and Coomassie stain
analyses.
EXAMPLE 11
FAS Ligand Binding Experiments
g To detect mFLINT interaction with Fast
Dot blot experiment was performed to scan known TNF
ligands that are commercially available TRAIL and Fast for
interaction with mFLINT.
TRAIL (RnD Systems) and Fast (Kamiya Biomedical
Company) were spotted on a nitrocellulose paper and
incubated with purified mFLINT-Flag. mFLINT was washed away
and binding mFLINT was detected using anti Flag antibody.
Both OPG2Fc and mFLINT-Flag were overexpressed and purified
according the examples above. The filter paper was
subsequently blocked for 30 min using 5% nonfat milk in PBS
in room temperature. The nitrocellulose paper was
subsequently mixed with the cell lysate containing Fast-Myc,
and further incubated on a rotator for 1 hour at room
temperature. Secondary and tertiary incubations were
performed with anti-myc antibody and anti-mouse IgG-HRP for
1 hour and 30 minutes respectively. The polypeptide
containing myc epitope was detected by chemiluminescence on
X-ray film which showed that mFLINT bound to Fast
specifically. No appreciable binding was detected with
TNF , TNF , TRAIL, CD40L or TRANCE.
First a baseline experiment was done for the Fas-
FasLigand interaction in vitro. Unless otherwise indicated,
all washing steps use TBST (Tris Buffer Saline with Tween 20
from SIGMA) and were done 3 to 6 times.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-68-
mrecFas (100 ng) was adsorbed on to ELISA plate. Then
the plate was is blocked by TBST plus 0.1% Gelatine.
Thereafter, hFasLigand (Flag-tagged) was added at different
concentrations with a maximum concentration of 300 ng going
down to 1 ng on TBST plus a 0.1% solution containing 1
micrograms/ml of M2 Abs (antiflag antibodies purchased
through Scientific Imaging System division of Kodak). After
washing the plate 6 times, anti-mouse-Abs-HRP (3000
dilution, Bio-Rad) was added to the wells. After washings
three times, visualization enzymatic reaction using ABTS as
a substrate was performed. Unless otherwise noted, an ELISA
reader commercialized by Molecular Devices Corp. (Menlo
Park, California) was used.
The following data were collected:
Fast, ng OD, 405nM
1 .1
5 .2
10 .3
50
100 1.2
500 1.6
FLINT-Fas L binding may be confirmed and specifics of
binding determined (e. g., kinetics, specificity, affinity,
cooperativity, relative binding pattern, concentration)
using real-time biomolecular interaction analysis. This
technology confers the ability to study biomolecular
interactions in real time, without labeling any of the
interactants. In particular, it takes advantage of the
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-69-
optical phenomenon surface plasmon resonance, and detection
depends on changes in the mass concentration of
macromolecules at the biospecific interface. Interactions
are followed in real time, so that kinetic information is
readily derived. In many cases, investigations can be
performed without prior purification of components.
Measurements are accomplished using a BiaCore 2000
instrument. The instrument, accompanying chips,
immobilization and maintenance kits and buffers are obtained
from Biacore AB, Rapsgatan 7, S-754 50 Uppsala, Sweden.
Fast is obtained from Kamiya Biomedical Company, 910
Industry Drive, Seattle, WA 98188, Guanidine Isothiocyanate
Solution from GibcoBRL, and mFLINT is prepared as in
Examples 8 and 9.
Experiments using immobilized Fast loaded with a
solution containing mFLINT. In this experiment, the KD of
the Fast-FLINT interaction was 1.13 X 10-', which is lower
than the Fast binding Fas, which was found to be 1.62 X 10-
'. This is explained by the fact that Fast is a trimer, yet
here Fast monomer was bound. Further experiments utilized
bound FLINT with Fast in solution, allowing for trimer
formation. The resultant KD for FLINT-Fast in these
experiments was 2 orders of magnitude better (i.e., the KD
was lower by two orders of magnitude). This observations
indicate that FLINT should effectively compete with Fas for
Fast binding, which likely explains the therapeutic benefit
observed in experiments detailed below.
FLINT prevents Fas-FasLigand interaction
As above, mrecFas (100 ng) was adsorbed on to ELISA
plate. Again the plate was blocked by TBST and
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-70-
O.l4Gelatine. Thereafter, hFasLigand (Flag-tagged, 30 ng
per each point) in the presence of different mFLINT
concentrations (Maximum concentration 300 ng down to 1 ng)
on TBST plus a 0.1% solution containing 1 microgram/ml of M2
Abs is added to each well. As before, after washing of the
plate, anti-mouse-Abs-HRP (3000 dilution, Bio-Rad) was added
to the wells. After washings, visualization enzymatic
reaction using ABTS as a substrate. was performed. The data
is shown in the following table.
FLINT, ng OD, 405nM
1 0.36
5 0.36
10 0.36
50 0.28
100 0.18
500 0.06
FasLigand binds Fas and mFLINT with different affinities.
FLINT and Fas (100 ng of each) were adsorbed on to an
ELISA plate. hFasLigand (Flag-tagged) was added at
different concentrations to a maximum concentration of 300
ng down to 0.1 ng on TBST plus a 0.1% solution containing 1
microgram/ml of M2 Abs. After washing of the plate, anti-
mouse-Abs-HRP (1:3000 dilution, Bio-Rad) was added to the
wells. After washings, visualization enzymatic reaction
using ABTS as a substrate was performed. The table below
shows the data.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-71-
Fast, ng FLINT OD Fas OD, 405nM
0.1 0 0
0.5 0 0
__ 1.0 .02 0
5.0 .04 .O1
.12 .03
50 .28 .045
100 .78 .18
EXAMPLE 12
Measurina the effect of mFLINT on anti-CD3 induced Jurkat
apoptosis
5 Non-tissue treated 24 well plates (Decton Dickinson,
Mansfield, MA) were coated with 0.5 ml of 1 ug/ml anti-CD3
(Farmingen) in PBS for 90 min at 37 °C. The plate was
washed once with PBS. 1 ml of 1 X 106 cell/ml was seated in
each well with or without following treatment: 10 ~M DEVD-
10 cmk, 1 ug OPG2-Fc, 1 or 2 ug of mFLINT and 1 ug anti Fast
Ab. mFLINT was made according to Examples 8 and 9.
Cells were incubated overnight at 37 °C incubator and
cells were then stained by Annexin V and PI staining.
Apotosis was analyzed by flow cytometer (FRCS). Cell
apoptosis was indicated by positive staining with Annexin V.
Control Jurkat 6.97
Jurkat + anti Fas 59.28
Jurkat + antiCD3 46.32
Jurkat + antiCD3 + DEVDcmk 30.80
Jurkat + antiCD3 + mFLINT (lug) 27.77
Jurkat + antiCD3 + OPG2-Fc (lug) 45.78
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-72-
Jurkat + antiCD3 + mFLINT (tug) 18.67
Jurkat + antiCD3 + antiFasL Ab 24.05
EXAMPLE 13
Measuring the effect of mFLINT on recombinant Fast induced
Jurkat cells apoptosis
One milliliter of 1 x 106 cell/ml was added into each
well of 24 well tissue culture plate and treated with
following reagents: soluble Fas L (200 ng), Fas L plus 1 ug
mFLINT, Fas L plus 1 ug OPG2-Fc, Trail (200 ng), Trail plus
1 ug mFLINT. Cells were incubated overnight at 37 °C and
then stained with Annexin V and PI. Cell apoptosis was
analyzed by flow cytometer (FRCS). mFLINT was made
according to Examples 8 and 9.
Control Jurkat 3.23
Jurkat +Fast (200ng/ml) 67.39
Jurkat + (200ng/ml) 3.3
+ anti Fast (1 ug)
Fast
Ab
Jurkat +Fast (200ng/ml) + mFLINT 3.32
( 1 ug)
Jurkat +Fast (200ng/ml) + mFLINT 4.6
( 1 ug )
Jurkat +Fast (200ng/ml) + 70.58
OPG2(1ug)
Jurkat +Fast (200ng/ml) + 69.58
OPG2(lug)
Jurkat +TRAIL (200ng/ml) 17.47
Jurkat +TRAIL (200ng/ml) 17.43
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
_73_
EXAMPLE 14
Measuring the effect of mFLINT in a dose-dependent manner on
anti-CD3 induced Jurkat apoptosis
The same steps for plate coating and cell treatment set
out i.n Example 13 were followed except a different amount of
mFLINT was added into each well. mFLINT was made according
to Examples 8 and 9. The following table indicates the
amounts added:
Jurkat cells (Control) 5.33
Jurkat cells + anti CD3 27.49
Jurkat cells + anti CD3 + anti Fast 12.74
neutralization Ab
Jurkat cells + anti CD3 + OPG2-Fc 26.24
4ug
Jurkat cells + anti CD3 + mFLINT/PG3 14.68
3000ng
Jurkat cells + anti CD3 + mFLINT 17.02
2000ng
Ju.rkat cells + anti CD3 + mFLINT 24.29
1000ng
Jurkat cells + anti CD3 + mFLINT 27.48
500ng
Jurkat cells + anti CD3 + mFLINT 28.93
250ng
Jurkat cells + anti CD3 + mFLINT 29.4
125ng
Jurkat cells + anti CD3 + mFLINT 28.99
62.5ng
Jurkat cells + anti CD3 + mFLINT 28.21
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-74-
31.25ng
Jurkat cells + anti CD3 + mFLINT 28.80
15.625ng
EXAMPLE 15
Measuring the effect of human mFLINT on murine Fasl-mediated
apoptosis using mouse T cell hybridoma cells (LTT cells)
(Annexin V assay)
FLINT was made according to Examples 8 and 9.
LTT,2,14,11 cells (LTT cells), see Glasebrook,
Eur.J.Immunol. 17: 1561-65 (1987), were used in this Annexin
V assay. On the first day, a 96 well plate was coated with
anti-CD3 (2C11) at a serial dilutions. On the second day,
100,000 LTT cells were added, in 50 ~,1 of medium per well,
along with 50 ~1 of medium to the control wells and 50 ~1 of
medium containing:
Group 1. solubleFas (sFas)(FasFc, mouse), with a final
concentration of 1 ~g/ml
Group 2. mFLINT (human), with a final concentration of
1 ug/ml
Group 3. anti-Fast (mouse), with a final concentration
of 1 ug/ml.
These then were incubated overnight, at 37° C, in 5%
CO2 .
On the following day (Day 3), the cells were collected
from each well, washed and labeled with Annexin V and PI,
following Flow cytometry analysis.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-75-
Anti Contr SFas FLINT Anti-
CD3 0l % % Fast
Annexin V Annexin V o
Annexin V Positive Positive Annexin V
Positive Positive
1 96.42 56.66 34.41 53.46
0.33 94.48 47.28 35.89 39.21
0.11 91.27 41.08 33.24 32.54
0 19.74 23.14 26.47 17.54
EXAMPLE 16
Measuring the effect of human mFLINT on murine Fasl-mediated
apoptosis using mouse T cell hybridoma cells (LTT cells
(Cytotoxicity Assay)
The same steps as in Example 16 were followed on Day 1
and Day 2. On Day 3 20u1 of MTS solution (Promega) was
added to the cells which were then incubated at 37°C for 2
hours. Using a plate reader, the absorbances at 490nm
wavelength were collected.
Anti- s-Fas FLINT Anti- Contr
CD3 cons. (1 (1 Fast of
( ~,g/ml ) ~g/ml ) ) ~.g/ml )
0 1.774 1.691 2.01 1.534
0.0014 1.968 1.923 2.134 1.614
0.004 1.929 1.982 2.147 1.653
0.012 1.779 2.006 2.108 1.284
0.037 1.777 2.006 1.988 0.834
0.11 1.638 1.874 1.956 0.733
0.33 1.624 1.671 1.978 0.648
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-76-
1 1.459 1.581 1.887 0.664
EXAMPLE 17
LIGHT Binding experiments
To confirm the dot blot binding between LIGHT and
mFLINT, 293 cells were transiently transfected with LIGHT
expression construct overnight. On the next day, cells were
detached and incubated with mFLINT-Flag on ice. The Flag
epitope was subsequently detected by anti-Flag conjugated
with fluorochrome and the cells population that shows
specific binding with mFLINT was detected by flow cytometer.
As a control we used vector transfected cells. To make sure
that the binding was specific, a competition assay with 10
fold access of untagged mFLINT was performed.
More particularly, 6 well dishes of cells were
transfected as above. Both vector and m-LIGHT expressing
cells were provided. Cells were detached from the plates by
vigorous pipetting with a P100 Pipettor. Then, in PBS/BSA,
0.1%, cells were exposed to one of the following
combinations, set forth in a-d.
a. GST/flag, mFLINT/flag, or HVEM at 20 nM;
b. FLINT/flag at 20 nM + GST/flag or mFLINT or HVEM at
200 nM;
c. FLINT/flag at 20 nM + HVEM + anti-human FAS ligand
at 200 nM;
d. anti-human FAS ligand-biotin at 1 g/ml
Cells were incubated on ice for 30 minutes and washed
with PBS/BSA, 0.1%. Cells then were exposed either to anti-
human IgG-biotin, 1 g/ml (for detection of HVEM), or to M2-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
_77-
biotin, 2 ~g/ml (for detection of flag conjugates). Cells
were incubated on ice for 30 minutes and washed with
PBS/BSA, 0.1%. Thereafter, cells were exposed to
streptavidin Alexa 488 (SIGMA) at a 1:1000 dilution. Again,
cells were incubated on ice for 30 minutes and washed with
PBS/BSA, 0.1%. Cells were analyzed using a FACSORT flow
cytometer (Decton Dickinson) to determine binding.
The cell surface binding assay using flow cytometer
confirmed that peaks shifted only when LIGHT expressing
cells were stained with mFLINT-Flag was used (data not
shown). There was no shift in the control cells when
stained with mFLINT-Flag. The shifted peak was completely
reversed to baseline peak when the cells were preincubated
with 10 fold excess of non tagged mFLINT thereby
preoccupying all the binding sites for mFLINT-Flag.
EXAMPLE 18
In vivo testing of mFLINT for treatment of Liver Damage
Using mice, a model of liver damage was induced using a
modification of the methods set out in Tsuji H., et al,
1997, Infection and Immunity, 65(5):1892-1898. mFLINT was
made according to Examples 8 and 9.
Specifically, the activity of the polypeptides of the
present invention against acute inflammation and apoptosis
was determined using the following procedure. Briefly,
BALB/c mice (Harlan) per each experimental group were given
intravenous injections (the lateral tail vein) of 6 mg of
D(+)-Galactosamine (Sigma, 39F-0539) in 100 ~l of PBS
(GIBCO-BRL) and 3 ~g of Lipopolysaccharide B E.coli 026: B6
(LPS) (Difco, 3920-25-2) in 100 ~,1 of PBS. The LPS was
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
_78_
administered, via i.v. injection, 5 minutes after the
galactosamine, which was administered i.v. After LPS
challenge, the animals were injected intraperitoneally with
mFLINT (200 fig), Hamster IgG (500 fig, Cappel, 30926), mAb
against murine TNF, TN3-19.12 (500 fig, Sheehan K.C.F. et al
J. Immunol. 1989. 142: 3884), and Anti-mouse Fas Ligand (500
fig, PharMingen, M024301) at 0, 2, 4, 6 hour-point
respectively. The survival rates of the mice were
determined 24 and 48 hours after LPS injection.
In mice challenged with 3 ~g of LPS after IP injection
of 200 ~.g mFLINT polypeptide (FLINT) had a positive effect
on animal survival. When mFLINT was administered 2 hours
post-challenge, 100% of the animals survived; at 4 hours
post- challenge, 730 of the animals survived; at 6 hours
post-challenge, 60% of the animals survived. In contrast,
administration of anti-TNFoc at 4 hours post-challenge
protected only 10% of the animals.
Figure 5 compares the effects of administering 200 ~g
mFLINT, i.v., and other molecules before and after challenge
with LPS/GalN. When administered 2 hours before LPS/GalN,
both anti-TNF and mFLINT treatment resulted in 100% survival
of mice. 80% of mice treated with anti-Fast survived, and
about 300 of mice treated with IgG survived.
In contrast, when anti-TNF was administered 4 hours
after LPS/GalN, less than 10% of the animals survived at 48
hours. Surprisingly, 800 of the animals survived when
treated with mFLINT, at 4 hours after LPS/GalN treatment.
Administration of anti-Fast at 4 hours after LPS/GalN
treatment also resulted in 80% survival. IgG had
essentially no effect on survival, with only about 20 of the
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-79-
animals surviving. Therefore, mFLINT is effective at
treating late-stage disease.
Figure 6 shows that when 400 ug of mFLINT was
administered i.p. to mice, 2 hours before challenge with LPS
and GalN, 100% of the animals were alive 48 hours after
LPS/GalN dosing. If 400 ug of anti-TNF was given i.p. two
hours before LPS/GalN challenge, about 95% of the animals
survived to 48 hours. In contrast, only 20% of those
animals not treated with mFLINT survived 48 hours.
Administration of IgG two hours before LPS/GalN only
increased the survival rate to 30%.
Figure 6 shows that lowering the dose of mFLINT to 50
ug still had a protective effect. 48 hours after LPS/GalN
administration, about 70% of the animals survived to 48
hours, compared with 0% survival of non-treated animals.
Figure 7 shows that the effect of 100 g mFLINT on
survival is the same, whether given ip or iv, 12 or 2 hours
before LPS/GalN administration. When mFLINT is given 4
hours after LPS/GalN administration, iv administration
results in 100% survival, and IP administration results in
80% survival. This Figure also shows the dose/response
relationship of the 4-hour post-LPS/GalN dose, given iv. 50
ug gave 80% survival, 10 ug gave 40% survival, 5 ug gave 20%
survival and 1 ug gave only about 2o survival.
EXAMPLE 19
This example demonstrates the usefulness of mFLINT
in the treatment of cerebral ischemia, which is clinically
relevant in stroke, head trauma and other similar disorders.
Adult male gerbils (70 to 80 g body weight, Charles
River Laboratories, Wilmington, MA) were anesthetized by
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-80-
i.p. injections of sodium pentobarbital (Nembutal) 40 mg/kg,
and additional i.p. injections of 10 mg/kg when necessary
to maintain a surgical plane of anesthesia. Animals were
placed on a thermostatically controlled heating blanket to
maintain body temperature at 37 °C. The ventral surface
of the neck was exposed, the fur shaved, and the skin
cleaned with 2% iodine solution.
After the pre-surgical preparation, a midline incision
was made, and the skin opened. The sternohyoid muscles
were divided to exposed and isolate the common carotid
arteries (CCA) for clamping. Sterilized aneurysm clips
(blade with 0.15 mm, closing force ~10 gm) was secured by
means of a sterilized clip applier on both left and right
CCA for 5 minutes. The clamps were then removed and the
patency of the arteries checked visually. The wound in the
neck was closed by surgical suture.
Immediately following the cerebral ischemia procedure
and while the gerbil was still unconscious, the fur on the
dorsal surface of the head was shaved and the skin cleaned
with 2% iodine solution. Under surgical anesthesia, the
gerbil s head was secured in a stable position by means of a
stereotaxic apparatus (SA) and a midline incision was made
to expose the skull. At a position 1 mm lateral and 1 mm
posterior to the bregma, as guided by the vernier scale of
the SA, the skull was thinned by a dental drill equipped
with a drill bit of 0.5 mm in diameter. The thinned area
was punctured with a microsyringe equipped with a 27-guage
blunt needle inserted 3 mm deep for a bolus injection of 5
ul (0.63 mg/ml )of mFLINT in phosphate buffer saline (PBS).
mFLINT was made according to Examples 8 and 9.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-81-
After the bolus injection, the syringe needle was
exchanged for an infusion cannula [3 mm in length] of a
brain infusion assembly connected to an Alzet osmotic pump
(Alza Corp., Palo Alto, CA) which reservior was placed under
the skin on the shoulder of the gerbil. The infusion
cannula was anchored on the surface of the skull using
dental cement. The wound was closed by surgical suture.
The Alzet osmotic pump containing mFLINT solution (0.63
mg/ml) or PBS delivered continuously at a rate of 1 ul/h for
3 days. Gerbils were allowed to survive for 5 days (the
surgery day was taken as day zero).
On the fifth day of survival, the gerbils were
sacrificed in a C02 chamber. Thoracotomy was performed for
transcardiac perfusion of saline for 3 minutes and
formaldehyde for 2 minutes. The brains were removed for
histological processing following a standard procedure
commonly adapted in the field. Coronal sections were
obtained at approx. 1.7 mm posterior to the bregma. After
staining with Cresyl violet, the sections were viewed under
a microscope at 40x magnification for cell counter
quantification of the intact hippocampal neurons along the
dorsal CA1 regions (0.5 mm in length) of both hemispheres.
Data were analyzed by Student t-Test and the Wilcoxon
ranking test.
Results showed that mFLINT had a significant effect on
neuronal survival compared to vehicle (p=0.0039 in t-Test;
p=0.0037 in Wilcoxon Rank Sums) and was indistinguishable
from normal controls.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-82-
EXAMPLE 20
TREATMENT GROUPS: Number of
Animals
CONTROLS 10
FLINT (50 10
~.g/injection)iv, days
4-13
OPG2 (50 ~g/injection)iv, 10
days 4-13
TOTAL: 30
mice
For the experiment, a single cell suspension of B16
melanoma cells was prepared from a brie of donor tumors.
Tumor cells (2 x 106) were implanted subcutaneously in a
hind-leg of Male C57B1 mice from Taconic Farms on day 0.
Treatment was initiated on day 4. mFLINT or OPG2 was
administered by intravenous injection into a tail vein once
daily on days 4 through 13 for a total of 10 injections.
mFLINT was made according to Examples 8 and 9. An overview
of the protocol is shown above.
Tumor response was monitored by tumor volume
measurements as determined by caliper measurements of two
dimensions of the tumors on days 4, 8, 11, 17, 21, 25, 30
and 34. Tumor volume was calculated as a hemi-ellipsoid.
The animals were weighed on the same schedule described
above.
The control tumors reached a volume of 500 mm3 on day
17.4 ~ 0.3 and 1000 mm3 on day 21.1 ~ 0.3. The tumors of
the animals treated with mFLINT reached a volume of 500 mm3
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-83-
on day 19.3 ~ 0.3 and reached 1000 mm3 on day 23.0 ~ 0.4.
The tumors of the animals treated with OPG2 reached a volume
of 500 mm3 on day 185. ~ 0.4 and reached 1000 mm3 on day
22.2 ~ 0.4. Therefore, the tumor growth delay produced by
mFLINT was 1.8 days and the tumor growth delay produced by
OPG2 was 1.1 days. These data are shown graphically in
Figure 8. As shown in Figure 8, tumor volume after 20 days
was approximately 730 mm3 in mFLINT-treated mice, but the
tumor volume of control mice was approximately 1000 mm3.
There was no indication of toxicity from administration of
mFLINT or OPG2 as evidenced by weight loss in the animals.
EXAMPLE 21
Thirty NOD mice 6 weeks of age are purchased from
Jackson Laboratories (Bar Harbor, Maine). The mice are
housed three to a cage and given free access to food (Purina
5001) and water. After one week of acclimatization, the mice
are bled by tail snip, and blood glucose and plasma insulin
are measured. Blood glucose is measured by tail snip without
anesthetic using a Precision G blood glucose analyzer
(Medisense Inc., Bedford, MA). Plasma insulin is measured by
a RIA kit (Linco Inc., St. Louis, MO.). The mice are then
arbitrarily placed into three groups, control, mFLINT-
injected, and OPG2-injected. Following assigning of the mice
to groups, body weight and blood glucose are determined once
weekly. Beginning at the onset of overt diabetes (blood
glucose >200mg%; ~14 weeks of age) mice are injected once
daily intraperitoneally with either mFLINT (50 ~.g/day) or
OPG2 (50 ~,g/day) diluted in PBS. Control mice are injected
with an equal volume of PBS. After 2 weeks of injection,
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-84-
mice are anesthetized by inhalation anesthesia (carbon
dioxide) and blood is removed by cardiac puncture for
measurement of glucose and insulin. Additionally, the
pancreas is harvested by the Animal Studies Support Team and
fixed in zinc-formalin for 24 hours for subsequent
histochemical analysis of (3 cell integrity (hematoxolin and
eosin) and immunohistochemical staining for insulin (George
Sanduskys laboratory). mFLINT is made according to Examples
8 and 9.
EXAMPLE 22
This example demonstrates that mFLINT inhibits
apoptosis is an in vitro model that mimics ischemia
reperfusion injury. These date indicate that mFLINT is
useful in preventing and treating such injury.
Ventricular cardiomyocytes were isolated from the
hearts of 1-3 day-old neonatal rats by trypsin digestion and
non-myocytes were eliminated by pre-plating. Primary
cultures were plated in special-coated 96-well plates in
serum-free medium.
Hypoxia was induced by incubating cultures in glucose-
free and oxygen-free (5% Co2 and 95% NZ) for 8 hours.
Reperfusion was mimicked by a 16 hour incubation in glucose-
containing medium under normal oxygen conditions. At the
end of this incubation, cardiomyocyte apoptosis was measured
by the cytoplasmic nucleosome-associated DNA ELISA method.
Test samples were incubated with mFLINT (2 g/ml or 5 g/ml)
and control samples with Z-YVAD-fmk (50 M), a commercial
caspase inhibitor. Duplicate experiments showed
essentially complete inhibition of hypoxia/reperfusion-
induced apoptosis. mFLINT was made according to Examples 8
and 9.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-85-
To confirm these data and to query whether the observed
inhibition was Fas-mediated, cardiomyocyte apoptosis was
induced by incubation with soluble Fast, and apoptosis was
measured as above. In these experiments, apoptosis was
inhibited either by anti-Fas neutralizing antibody (1 g/ml)
or mFLINT (10 g/ml). These experiments confirmed that
mFLINT inhibits apoptosis, and indicated that it does so, at
least in part, by inhibiting the Fast-Fas apoptotic pathway.
EXAMPLE 23
Murine Osteoclast Differentiation Assa
The co-culture method of Takahashi et al.
(Endocrinology 123:2600 1988) was modified as described in
Galvin et al. (Endocrinology 137:2457 1996) and used to
study the effects of various agents on osteoclast
differentiation. mFLINT was made according to Examples 8
and 9.
Male Balb/C mice (4-8 weeks old) were euthanized with
C02, the femurs removed, and the marrow flushed out of the
femurs with growth medium. Bone marrow cells were pelleted
by centrifugation at 500 x g for 6 min. and resuspended in
the growth medium (RPMI 1640 plus 5% heat inactivated fetal
bovine-serum and 1% antibiotic-antimycotic solution). The
marrow population (5 x 104 cells/cm2) was seeded in tissue
culture dishes in which BALL cells (a stable cell line
derived from neonatal mouse calvariae, 1.5 x 104 cells/cmz)
had been plated 2 h prior to addition of bone marrow. The
cells were cultured for 7 days in a humidified incubator at
37°C with 5% C02 with medium changes on days 3 and 5.
Cultures were treated with or without 10-$M 1,25-(OH)2D3 on
days 0, 3, and 5. In addition, the cells were treated with
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-86-
or without secreted mFLINT protein purified from the
conditioned medium of cells transfected with mFLINT gene
(Figure 1). Following 7 days of culture, the cells in 24-
well cluster dishes were fixed with formalin (3.7o for 10
min) and then stained for tartrate-resistant acid
phosphatase (TRAP) using a modification of the method
described by Graves, L and Jilka RL, J Cell Physiology
145:102 1990. The number of osteoclasts (TRAP-positive
cells containing 3 or more nuclei) was quantitated. Results
are reported in the following Table.
Table
FLINT (ng ml) Osteoclasts well
0.00 145.50 ~ 7.33
0.01 40.50 2.39*
0.10 65.50 3.33*
1.00 g7.50 3.10*
10.00 170.17 8.26
100.00 335.00 8.90*
a - Each value represents the mean and
standard error of 6 wells.
*p<0.05 compared to control group
EXAMPLE 24
Porcine Osteoclast Differentiation Assay
Neonatal pigs (aged 1-5 days) were euthanized with CO2,
the appendages were rinsed with 70% ethanol, the soft
tissues were removed, and the humeri, radii, ulnae, femora,
tibiae and fibulae were excised. The long bones were placed
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
_87_
in ice-cold calcium and magnesium-free Hank s balanced salt
solution (CMF-HBSS, Gibco BRL) and cleaned of all soft
tissues. The bones were split longitudinally and the
endosteal surfaces were scraped to remove both the marrow
and trabecular bone. The suspension of trabecular bone
particles and marrow cells was agitated by vigorous shaking
and passed through a 200 mm and then 100 mm sieve. Cells
were centrifuged at 500 x g for 10 minutes at 4°C, the
pellet was resuspended in CMF-HBSS, and then separated on a
Ficoll-Paque gradient (Pharmacia, Piscataway, NJ). The
mononuclear cell fraction from the gradient was washed twice
in CMF-HBSS and passed through a 35 mm sieve. The cells
were suspended in growth medium consisting of a-MEM (pH 7.2,
which was modified to contain 8.3 mM NaHC03 (Gibco BRL,
Grand Island, NY)), 10% heat-inactivated fetal bovine serum
(FBS, Hyclone, Logan, UT) and 2% antibiotic/antimycotic
solution (Gibco BRL, Grand Island, NY) and seeded onto
tissue culture dishes at a density of 1 x 106 cells/cm2. A
typical marrow cell yield was between 1-2 x 109
cells/animal, which varied with the size of the animal. The
cells were incubated at 37°C in a humid incubator with 5%
CO2. After 24-48 h, nonadherent cells were removed and
seeded in either 24-well cluster dishes at a density of 7.5
x 105 cells/cm2 in growth medium which did or did not
contain 10-8 M 1,25-(OH)2D3 (Biomol, Plymouth Meeting, PA)
and mFLINT protein (obtained as in Examples 8 and 9).
Cells were cultured for up to 10 days with medium changes
every 48-72 h with growth medium that did or did not contain
1,25-(OH)2D3 and mFLINT. Following 5 days of culture, the
cells were fixed with formalin (3.7% for 10 min) and then
stained for tartrate-resistant acid phosphatase (TRAP) as in
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
_88-
Example 6. The number of osteoclasts (TRAP-positive cells
containing 3 or more nuclei) was quantitated. Results are
reported in the following table.
Table
FLINT (ng ml) Osteoclasts well
0.00 214.83 + 14.22
0.01 68.83 + 6.28*
0.10 176.17 + 23.01
1.00 228.50 + 17.26
10.00 228.50 + 29.29
100.00 382.33 + 26.59*
a Each value represents the mean and
standard error of 6 wells.
*p<0.05 compared to control group
EXAMPLE 25
In vitro Treatment with mFLINT
FLINT was made according to Examples 8 and 9 and used
in the following experiments.
A -Bone marrow cells from irradiated mice- This
experiment was designed to determine whether mFLINT could
improve the recovery of murine hematopoietic progenitor
cells from irradiation, by forcing in vitro expansion with
hematopoietic cytokines. Mice were injected with 3 mg of 5-
flouro-uracil, i.p., and four days later, femurs were
removed and flushed to isolate bone marrow (BM) cells. 1 x
106 BM cells were seeded in each well of a 24 well tray in
triplicate in Iscoves modified dulbeccos media (IMDM)+ 100
FBS and were stimulated for 3 days with the cytokines stem
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
_89_
cell factor (SCF) and IL-6, in the presence or absence of
mFLINT (1 ug/ml). After a 3-day in vitro expansion period,
x 103 cells were plated out in triplicate for the CFU
assay.
5 Bone marrow cells incubated with mFLINT had
significantly increased numbers of CFUs compared to cells
that were not treated with mFLINT. Figure 9 shows the CFU
colonies/3 x 106 stimulated BM cells. These results suggest
that mFLINT protected progenitor cells from apoptosis, and
increased the number of viable cells that were able to form
colonies. The Figure shows results for the following colony
forming units- erythroid cells(CFU-E)(control - 15,000
colonies; mFLINT-treated - 33,000 colonies)(p<0.003) -
granulocyte macrophage cells (CFU-GM) (control -- 8,000;
mFLINT-treated - 15,000) (p < 0.039); and the more
primitive, granulocyte erythroid monocyte megakaryocyte
cells (CFU-GEMM)(control - 750; mFLINT-treated-3,000)
(p<0.007). p numbers show significant differences, as
calculated by Student's T-test.
B- Bone marrow cells from mice treated with a
chemotherapeutic agent -- This experiment was designed to
demonstrate that mFLINT or anti-Fast antibody can improve
the recovery of murine hematopoietic progenitor cells that
have been exposed to a chemotherapeutic agent, following in
vitro expansion with hematopoietic cytokines. 2 x 106 bone
marrow cells, from 5-FU treated mice, were seeded in each
well of a 24 well tray in triplicate in IMDM media + 10% FBS
and were stimulated for 3 days with SCF and IL-6, and with
one of the following compounds:
1) mFLINT (lug/ml)
2) anti-Fast (lug/ml)
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-90-
3) Fast (0.15 ug/ml)
4) Control - no additions
Following a 3 day in vitro expansion period with
cytokines, viable cells are counted and used to set up a CFU
assay. If mFLINT or anti-Fast antibody protects progenitor
cells from apoptosis, one would expect a greater number of
colonies in these groups for the CFU assay. Results are
shown in Fig. 10, which shows the bone marrow cell count
(x1000). The values were: control cells: 3,300; FasL-
treated cells: 3,000; anti-Fast-treated cells: 4,200;
mFLINT-treated cells: 4,900.
C- CD34+ cells - This experiment is designed to
determine whether mFLINT or anti-Fast antibody can improve
the recovery of progenitor cells from purified human CD34+
progenitor cells. Purified human CD34+ cells (1 x 106/ml )
are stimulated with 100 U/ml of human IL-6 and 100 ng/ml of
human SCF, with or without mFLINT or anti-Fast antibody for
3 days in vitro to expand progenitor cells. Following this
expansion and treatment, cells are counted and a CFU assay
is conducted.
EXAMPLE 26
TRANSGENIC FLINT MICE
A - Preparation of Transgenic Mice
This example demonstrates the construction of
transgenic mice expressing FLINT. These animals express
significant levels of FLINT, yet demonstrate no adverse
effects, which indicates that FLINT has a favorable toxicity
profile. These animals are also useful in further
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-91-
delineating useful treatment protocols for the conditions
set out above.
Transgene construction. Polymerase chain reaction
(PCR) primers were synthesized and used to amplify the fused
FLINT-FLAG DNA sequences from plasmid pIGl-FLINTF, described
above. The 5' primer, 5'-GAAGATCTTCTTTGATC
AAGGATGGGCTTCTGGACTT-3', a BglII restriction site and
the 3' primer, 5'-GGACTAGTCCTGATCATCACTTGTCGTCGTCGTCCTT-3',
contained an SpeI restriction enzyme site. These were used
to amplify the entire FLINT and FLAG coding region. The
amplified 1.1 kb fragment was ligated into the multiple
cloning site of plasmid pMTmcs2 generating plasmid pMTmcs2-
FLINT (6.7 kb). See Fox et al, Eur. J. Pharmacol. 308:195
(1996) .
The FLINT gene fragment was excised from pMTmcs2-FLINT
by BglII and Spel digestion and gel-purified. This fragment
then was blunted with Klenow enzyme and ligated into the
Klenow-blunted MluI site of plasmid pLIV.7, provided by John
Taylor of the J. David Gladstone Institutes. See Fan et
al., Proc. Nat'1 Acad. Sci. 91:8724 (1994). Resultant
plasmid pLIV7-FLINT also contains the apo E gene promoter/5'
flanking region and an hepatic enhancer sequences called the
"hepatic control region" (HCR). For microinjection into
embryos, a 7.0 kb DNA fragment encompassing the Apo E gene
promoter-FLINT/FLAG-HCR fusion gene was excised from plasmid
pLIV7-FLINT by digestion with SalI and SpeI and purified by
gel electrophoresis and glass bead extraction.
Transgenic animal development. Transgenic mice were
generated using established techniques described, for
example, by Hogan, B. et al. (1986) MANIPULATING THE MOUSE
EMBRYO: A LABORATORY MANUAL, Cold Spring Harbor Laboratory
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-92-
(Cold Spring Harbor, NY), as modified by Fox and Solter,
Molec. Cell. Biol. 8: 5470 (1988). Briefly, the 7.0 kb DNA
fragment encompassing the Apo E gene promoter-FLINT-HCR
fusion gene was microinjected into the male pronuclei of
newly fertilized one-cell-stage embryos (zygotes) of the
FVB/N strain. The embryos were cultured in vitro overnight
to allow development to the two-cell-stage. Two-cell embryos
were then transplanted into the oviducts of pseudopregnant
CD-1 strain mice to allow development to term. To test for
l0 the presence of the transgene in the newborn mice, a small
piece of toe was removed from each animal and digested with
proteinase K to release the nucleic acids. A sample of the
toe extract was subsequently subjected to PCR analysis using
human FLINT-specific primers to identify transgene-
containing mice. Five founder transgenic mice were
identified as containing a FLINT transgene and were
designated 6494, 7262, 7353, 7653 and 7659. Each of these
founders was bred to produce stable lines of transgenics.
Line 6494 has been extensively characterized for
transgene expression and pathology. Broad tissue expression
was detected in line 6494 progeny by Northern blot, RT-PCR
(TaqMan), Western blot and immunohistochemical analysis and
was highest in the liver and kidney. High levels of FLINT
protein were detected in the circulation of line 6494 mice
by ELISA assay; founder level = 490 ng/ml; progeny levels
ranged from 285-1360 ng/ml (n=6). No endogenous FLINT was
detected by these analyses. No significant histopathologic
findings were detected in 5 week or 8 week old 6494 progeny.
Preliminary blood chemistry analysis suggested that
triglyceride levels may be elevated in 6494 mice. The
animals had no observable abnormalities.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-93-
B-Protection of mice from irradiation- This experiment
is designed to evaluate whether transgenic FLINT mice are
protected from the adverse effects of radiation. Lethally
irradiate 18 transgenic and 18 non-transgenic mice with 850
cGy. Give no bone marrow transplant to 8 of the 18 mice per
group. Of these 8 mice, use 5 as a control for radiation
induced death and 3 for histological analysis of the
intestinal mucosa and bone marrow compartments at 3 days
post-irradiation.
Transplant the remaining 10 mice per group with 3 x 104
bone marrow cells from normal non-transgenic donors. Since
the liver is not damaged by irradiation, the FLINT
transgenic mice should still be able to produce FLINT
protein systemically. This bone marrow cell dose typically
results in about 50% survival at 30 days for wild type
animals that have been irradiated as described herein.
Obtain 50-100 ~tl of blood by tail bleed on days 7, 15, 21,
and 30 days post-transplant and perform hematological
analysis to monitor recovery of peripheral blood (n = 10
mice per group; total of 20 mice). The hematological
analysis will include a white blood cell count (WBC), red
blood cell count (RBC), hematocrit, and blood smear
microscopy to determine numbers of lymphocytes, neutrophils,
eosinophils, platelets, mast cells and monocytes in the
blood. Measure survival of mice and recovery of peripheral
blood cells.
It is expected that, because FLINT prevents apoptosis
of expanding progenitor cells and/or enhances recovery of
intestinal epithelium from radiation-induced damage, there
will be a difference between the two groups in survival,
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-94-
histology of gut epithelium and bone marrow, and recovery of
peripheral blood cells.
C-Protection of mice from chemotherapy- This experiment
is designed to determine the effects of combining FLINT and
GM-CSF administration on the recovery of progenitor cells
from myelosuppression that is induced by sub-lethal
irradiation and chemotherapy. In particular, this experiment
examines whether white blood cell recovery, from a
combination of chemotherapy and sublethal irradiation, is
improved in transgenic FLINT mice. On example of such a
chemotherapy regimen is treatment with carboplatin.
Administer 500 cGY of irradiation 4 hours following a
single intraperitoneal injection of carboplatin (1.2
mg/mouse) to 15 transgenic and 15 control mice. This
regimen induces severe myelosuppression with prolonged
thrombocytopenia and severe anemia. Leonard et al., Blood,
83: 1499 (1994). Every day for 12 days, beginning 24 hours
after irradiation, 10 ~g/kg body weight of recombinant
murine rmGM-CSF is injected i.p. to promote recovery of WBC
count. Mayer et al., J. Inf. Diseases 163: 584 (1991),
Gamba-Vitalo et al., 1991, Blood Cells 17: 193 (1991).
Blood is collected by tail bleed every 7 days up to day 30
and a complete hematological analysis is conducted. The
hematological analysis will include a white blood cell count
(WBC), red blood cell count (RBC), hematocrit, and blood
smear microscopy to determine numbers of lymphocytes,
neutrophils, eosinophils, platelets, mast cells and
monocytes in the blood. On days 12 and 20, 3 mice from each
group are sacrificed. From these mice, spleen cellularity
and bone marrow cellularity are analyzed. Also, the bone
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-95-
marrow cells are pooled and used to set up CFU assays to
examine progenitor content.
D- FLINT effects on peripheral mobilization of
progenitor cells- This experiment is designed to test for
testing peripheral mobilization of progenitor cells. To
test for peripheral mobilization of progenitor cells, FLINT
transgenic and control mice are treated with 3 mg of 5-FU
i.p. and 4 days later, either CFU assays will be set up from
isolated bone marrow cells, or 100ng of GM-CSF will be
administered i.p. every day for 3 days followed by
determination of bone marrow cellularity and progenitor
content by CFU assays. The protocols for transplantation
are described above in Example B. Applications for gene
therapy would be to improve the recovery of progenitor cells
following stimulation with cytokines either in vivo, or in
vitro, for transduction with retrovirus, as described above.
EXAMPLE 27
Use of FLINT to Treat ALI Patient
A 55 year-old male presents to the emergency department
unconscious. His family states that he was being treated as
an outpatient for bronchitis for the past few days but
worsened despite antibiotics. He has no relevant past
history and his only medication was a third generation oral
cephalosporin. Physical examination reveals an obtunded,
cyanotic male who is hypotensive, tachypneic, and
tachycardic, and who has bilateral lung congestion
consistent with pulmonary edema. There is no evidence of
congestive heart failure. Tests reveal hypoxemia (based on
Pa02/Fi02) and bilateral lung infiltrates without
cardiomegaly, consistent with a diagnosis of acute lung
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
-96-
injury. Based on the history it is concluded that the lung
injury was a direct result of community-acquired pneumonia,
and that the patient met the hypoxemia criteria for ALI
within the last 12 hours. Ventilation measures include use
of PEEP and low tidal volume. As soon as adequate
oxygenation is confirmed, treatment with FLINT is initiated
in the ER as an iv bolus of 2.5 mg/kg, followed by a
continuous infusion of 0.1 mg/minute. FLINT along with
aggressive supportive measures (e. g., positive ventilation,
intravenous fluids, pressors, and nutritional support) are
continued for four days in the ICU, at which time the FLINT
is discontinued. Over the following 3 days, the patient
begins to recover and is extubated on Day 8. He has an
uneventful recovery and 6 months following discharge has no
evidence of residual lung disease by blood gas and
spirometry.
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
SEQUENCE LISTING
<110> ELI LILLY AND COMPANY
<120> THERAPEUTIC APPLICATIONS OF FLINT POLYPEPTIDES
<130> X-12915A
<150> US 09/280,567
<151> 1999-03-30
<160> 13
<170> PatentIn Ver. 2.0
<210> 1
<211> 900
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)..(900)
<400>
1
atgagg gcgctg gaggggcca ggcctgtcg ctgctgtgc ctggtgttg 48
MetArg AlaLeu GluGlyPro GlyLeuSer LeuLeuCys LeuValLeu
1 5 10 15
gcgctg cctgcc ctgctgccg gtgccgget gtacgcgga gtggcagaa 96
AlaLeu ProAla LeuLeuPro ValProAla ValArgGly ValAlaGlu
20 25 30
acaccc acctac ccctggcgg gacgcagag acaggggag cggctggtg 144
ThrPro ThrTyr ProTrpArg AspAlaGlu ThrGlyGlu ArgLeuVal
35 40 45
tgcgcc cagtgc cccccaggc acctttgtg cagcggccg tgccgccga 192
CysAla GlnCys ProProGly ThrPheVal GlnArgPro CysArgArg
50 55 60
gacagc cccacg acgtgtggc ccgtgtcca ccgcgccac tacacgcag 240
AspSer ProThr ThrCysGly ProCysPro ProArgHis TyrThrGln
65 70 75 80
ttctgg aactac ctggagcgc tgccgctac tgcaacgtc ctctgcggg 288
PheTrp AsnTyr LeuGluArg CysArgTyr CysAsnVal LeuCysGly
85 90 95
gag cgt gag gag gag gca cgg get tgc cac gcc acc cac aac cgt gcc 336
Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His Asn Arg Ala
100 105 110
tgc cgc tgc cgc acc ggc ttc ttc gcg cac get ggt ttc tgc ttg gag 384
Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe Cys Leu Glu
115 120 125
-1-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
cac gca tcg tgt cca cct ggt gcc ggc gtg att gcc ccg ggc acc ccc 432
His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro Gly Thr Pro
130 135 140
agc cag aac acg cag tgc cag ccg tgc ccc cca ggc acc ttc tca gcc 480
Ser Gln Asn Thr Gln Cys Gln Pro Cys Pro Pro Gly Thr Phe Ser Ala
145 150 155 160
agc agc tcc agc tca gag cag tgc cag ccc cac cgc aac tgc acg gcc 528
Ser Ser Ser Ser Ser Glu Gln Cys Gln Pro His Arg Asn Cys Thr Ala
165 170 175
ctg ggc ctg gcc ctc aat gtg cca ggc tct tcc tcc cat gac acc ctg 576
Leu Gly Leu Ala Leu Asn Val Pro Gly Ser Ser Ser His Asp Thr Leu
180 185 190
tgc acc agc tgc act ggc ttc ccc ctc agc acc agg gta cca gga get 624
Cys Thr Ser Cys Thr Gly Phe Pro Leu Ser Thr Arg Val Pro Gly Ala
195 200 205
gag gag tgt gag cgt gcc gtc atc gac ttt gtg get ttc cag gac atc 672
Glu Glu Cys Glu Arg Ala Val Ile Asp Phe Val Ala Phe Gln Asp Ile
210 215 220
tcc atc aag agg ctg cag cgg ctg ctg cag gcc ctc gag gcc ccg gag 720
Ser Ile Lys Arg Leu Gln Arg Leu Leu Gln Ala Leu Glu Ala Pro Glu
225 230 235 240
ggc tgg ggt ccg aca cca agg gcg ggc cgc gcg gcc ttg cag ctg aag 768
Gly Trp Gly Pro Thr Pro Arg Ala Gly Arg Ala Ala Leu Gln Leu Lys
245 250 255
ctg cgt cgg cgg ctc acg gag ctc ctg ggg gcg cag gac ggg gcg ctg 816
Leu Arg Arg Arg Leu Thr Glu Leu Leu Gly Ala Gln Asp Gly Ala Leu
260 265 270
ctg gtg cgg ctg ctg cag gcg ctg cgc gtg gcc agg atg ccc ggg ctg 864
Leu Val Arg Leu Leu Gln Ala Leu Arg Val Ala Arg Met Pro Gly Leu
275 280 285
gag cgg agc gtc cgt gag cgc ttc ctc cct gtg cac 900
Glu Arg Ser Val Arg Glu Arg Phe Leu Pro Val His
290 295 300
<210> 2
<211> 300
<212> PRT
<213> Homo Sapiens
<400> 2
Met Arg Ala Leu Glu Gly Pro Gly Leu Ser Leu Leu Cys Leu Val Leu
1 5 10 15
Ala Leu Pro Ala Leu Leu Pro Val Pro Ala Val Arg Gly Val Ala Glu
20 25 30
-2-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu Arg Leu Val
35 40 45
Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro Cys Arg Arg
50 55 60
Asp Ser Pro Thr Thr Cys Gly Pro Cys Pro Pro Arg His Tyr Thr Gln
65 70 75 80
Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Asn Val Leu Cys Gly
85 90 95
Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His Asn Arg Ala
100 105 110
Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe Cys Leu Glu
115 120 125
His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro Gly Thr Pro
130 135 140
Ser Gln Asn Thr Gln Cys Gln Pro Cys Pro Pro Gly Thr Phe Ser Ala
145 150 155 160
Ser Ser Ser Ser Ser Glu Gln Cys Gln Pro His Arg Asn Cys Thr Ala
165 170 175
Leu Gly Leu Ala Leu Asn Val Pro Gly Ser Ser Ser His Asp Thr Leu
180 185 190
Cys Thr Ser Cys Thr Gly Phe Pro Leu Ser Thr Arg Val Pro Gly Ala
195 200 205
Glu Glu Cys Glu Arg Ala Val Ile Asp Phe Val Ala Phe Gln Asp Ile
210 215 220
Ser Ile Lys Arg Leu Gln Arg Leu Leu Gln Ala Leu Glu Ala Pro Glu
225 230 235 240
Gly Trp Gly Pro Thr Pro Arg Ala Gly Arg Ala Ala Leu Gln Leu Lys
245 250 255
Leu Arg Arg Arg Leu Thr Glu Leu Leu Gly Ala Gln Asp Gly Ala Leu
260 265 270
Leu Val Arg Leu Leu Gln Ala Leu Arg Val Ala Arg Met Pro Gly Leu
275 280 285
Glu Arg Ser Val Arg Glu Arg Phe Leu Pro Val His
290 295 300
<210> 3
<211> 936
<212> DNA
<213> Homo Sapiens
-3-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
<220>
<221> CDS
<222> (25)..(924)
<400> 3
gctctccctg ctccagcaag gacc atg agg gcg ctg gag ggg cca ggc ctg 51
Met Arg Ala Leu Glu Gly Pro Gly Leu
1 5
tcg ctg ctg tgc ctg gtg ttg gcg ctg cct gcc ctg ctg ccg gtg ccg 99
Ser Leu Leu Cys Leu Val Leu Ala Leu Pro Ala Leu Leu Pro Val Pro
15 20 25
get gta cgc gga gtg gca gaa aca ccc acc tac ccc tgg cgg gac gca 147
Ala Val Arg Gly Val Ala Glu Thr Pro Thr Tyr Pro Trp Arg Asp Ala
30 35 40
gag aca ggg gag cgg ctg gtg tgc gcc cag tgc ccc cca ggc acc ttt 195
Glu Thr Gly Glu Arg Leu Val Cys Ala Gln Cys Pro Pro Gly Thr Phe
45 50 55
gtg cag cgg ccg tgc cgc cga gac agc ccc acg acg tgt ggc ccg tgt 243
Val Gln Arg Pro Cys Arg Arg Asp Ser Pro Thr Thr Cys Gly Pro Cys
60 65 70
cca ccg cgc cac tac acg cag ttc tgg aac tac ctg gag cgc tgc cgc 291
Pro Pro Arg His Tyr Thr Gln Phe Trp Asn Tyr Leu Glu Arg Cys Arg
75 80 85
tac tgc aac gtc ctc tgc ggg gag cgt gag gag gag gca cgg get tgc 339
Tyr Cys Asn Val Leu Cys Gly Glu Arg Glu Glu Glu Ala Arg Ala Cys
90 95 100 105
cac gcc acc cac aac cgt gcc tgc cgc tgc cgc acc ggc ttc ttc gcg 387
His Ala Thr His Asn Arg Ala Cys Arg Cys Arg Thr Gly Phe Phe Ala
110 115 120
cac get ggt ttc tgc ttg gag cac gca tcg tgt cca cct ggt gcc ggc 435
His Ala Gly Phe Cys Leu Glu His Ala Ser Cys Pro Pro Gly Ala Gly
125 130 135
gtg att gcc ccg ggc acc ccc agc cag aac acg cag tgc cag ccg tgc 483
Val Ile Ala Pro Gly Thr Pro Ser Gln Asn Thr Gln Cys Gln Pro Cys
140 145 150
ccc cca ggc acc ttc tca gcc agc agc tcc agc tca gag cag tgc cag 531
Pro Pro Gly Thr Phe Ser Ala Ser Ser Ser Ser Ser Glu Gln Cys Gln
155 160 165
ccc cac cgc aac tgc acg gcc ctg ggc ctg gcc ctc att gtg cca ggc 579
Pro His Arg Asn Cys Thr Ala Leu Gly Leu Ala Leu Ile Val Pro Gly
170 175 180 185
tct tcc tcc cat gac acc ctg tgc acc agc tgc act ggc ttc ccc ctc 627
Ser Ser Ser His Asp Thr Leu Cys Thr Ser Cys Thr Gly Phe Pro Leu
190 195 200
-4-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
agc acc agg gta cca gga get gag gag tgt gag cgt gcc gtc atc gac 675
Ser Thr Arg Val Pro Gly Ala Glu Glu Cys Glu Arg Ala Val Ile Asp
205 210 215
ttt gtg get ttc cag gac atc tcc atc aag agg ctg cag cgg ctg ctg 723
Phe Val Ala Phe Gln Asp Ile Ser Ile Lys Arg Leu Gln Arg Leu Leu
220 225 230
cag gcc ctc gag gcc ccg gag ggc tgg get ccg aca cca agg gcg ggc 771
Gln Ala Leu Glu Ala Pro Glu Gly Trp Ala Pro Thr Pro Arg Ala Gly
235 240 245
cgc gcg gcc ttg cag ctg aag ctg cgt cgg cgg ctc acg gag ctc ctg 819
Arg Ala Ala Leu Gln Leu Lys Leu Arg Arg Arg Leu Thr Glu Leu Leu
250 255 260 265
ggg gcg cag gac ggg gcg ctg ctg gtg cgg ctg ctg cag gcg ctg cgc 867
Gly Ala Gln Asp Gly Ala Leu Leu Val Arg Leu Leu Gln Ala Leu Arg
270 275 280
gtg gcc agg atg ccc ggg ctg gag cgg agc gtc cgt gag cgc ttc ctc 915
Val Ala Arg Met Pro Gly Leu Glu Arg Ser Val Arg Glu Arg Phe Leu
285 290 295
cct gtg cac tgatcctggc cc 936
Pro Val His
300
<210> 4
<211> 300
<212> PRT
<213> Homo Sapiens
<400> 4
Met Arg Ala Leu Glu Gly Pro Gly Leu Ser Leu Leu Cys Leu Val Leu
1 5 10 15
Ala Leu Pro Ala Leu Leu Pro Val Pro Ala Val Arg Gly Val Ala Glu
20 25 30
Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu Arg Leu Val
35 40 45
Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro Cys Arg Arg
50 55 60
Asp Ser Pro Thr Thr Cys Gly Pro Cys Pro Pro Arg His Tyr Thr Gln
65 70 75 80
Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Asn Val Leu Cys Gly
85 90 95
Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His Asn Arg Ala
100 105 110
Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe Cys Leu Glu
-5-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
115 120 125
His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro Gly Thr Pro
130 135 140
Ser Gln Asn Thr Gln Cys Gln Pro Cys Pro Pro Gly Thr Phe Ser Ala
145 150 155 160
Ser Ser Ser Ser Ser Glu Gln Cys Gln Pro His Arg Asn Cys Thr Ala
165 170 175
Leu Gly Leu Ala Leu Ile Val Pro Gly Ser Ser Ser His Asp Thr Leu
180 185 190
Cys Thr Ser Cys Thr Gly Phe Pro Leu Ser Thr Arg Val Pro Gly Ala
195 200 205
Glu Glu Cys Glu Arg Ala Val Ile Asp Phe Val Ala Phe Gln Asp Ile
210 215 220
Ser Ile Lys Arg Leu Gln Arg Leu Leu Gln Ala Leu Glu Ala Pro Glu
225 230 235 240
Gly Trp Ala Pro Thr Pro Arg Ala Gly Arg Ala Ala Leu Gln Leu Lys
245 250 255
Leu Arg Arg Arg Leu Thr Glu Leu Leu Gly Ala Gln Asp Gly Ala Leu
260 265 270
Leu Val Arg Leu Leu Gln Ala Leu Arg Val Ala Arg Met Pro Gly Leu
275 280 285
Glu Arg Ser Val Arg Glu Arg Phe Leu Pro Val His
290 295 300
<210> 5
<211> 813
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)..(813)
<400> 5
gtg gca gaa aca ccc acc tac ccc tgg cgg gac gca gag aca ggg gag 48
Val Ala Glu Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu
1 5 10 15
cgg ctg gtg tgc gcc cag tgc ccc cca ggc acc ttt gtg cag cgg ccg 96
Arg Leu Val Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro
20 25 30
tgc cgc cga gac agc ccc acg acg tgt ggc ccg tgt cca ccg cgc cac 144
Cys Arg Arg Asp Ser Pro Thr Thr Cys Gly Pro Cys Pro Pro Arg His
35 40 45
-6-
CA 02358508 2001-06-21
WO 00/37094 PCTNS99/30734
tac acg cag ttc tgg aac tac ctg gag cgc tgc cgc tac tgc aac gtc 192
Tyr Thr Gln Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Asn Val
50 55 60
ctc tgc ggg gag cgt gag gag gag gca cgg get tgc cac gcc acc cac 240
Leu Cys Gly Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His
65 70 75 80
aac cgt gcc tgc cgc tgc cgc acc ggc ttc ttc gcg cac get ggt ttc 288
Asn Arg Ala Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe
85 90 95
tgc ttg gag cac gca tcg tgt cca cct ggt gcc ggc gtg att gcc ccg 336
Cys Leu Glu His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro
100 105 110
ggc acc ccc agc cag aac acg cag tgc cag ccg tgc ccc cca ggc acc 384
Gly Thr Pro Ser Gln Asn Thr Gln Cys Gln Pro Cys Pro Pro Gly Thr
115 120 125
ttc tca gcc agc agc tcc agc tca gag cag tgc cag ccc cac cgc aac 432
Phe Ser Ala Ser Ser Ser Ser Ser Glu Gln Cys Gln Pro His Arg Asn
130 135 140
tgc acg gcc ctg ggc ctg gcc ctc aat gtg cca ggc tct tcc tec cat 480
Cys Thr Ala Leu Gly Leu Ala Leu Asn Val Pro Gly Ser Ser Ser His
145 150 155 160
gac acc ctg tgc acc agc tgc act ggc ttc ccc ctc agc acc agg gta 528
Asp Thr Leu Cys Thr Ser Cys Thr Gly Phe Pro Leu Ser Thr Arg Val
165 170 175
cca gga get gag gag tgt gag cgt gcc gtc atc gac ttt gtg get ttc 576
Pro Gly Ala Glu Glu Cys Glu Arg Ala Val Ile Asp Phe Val Ala Phe
180 185 190
cag gac atc tcc atc aag agg ctg cag cgg ctg ctg cag gcc ctc gag 624
Gln Asp Ile Ser Ile Lys Arg Leu Gln Arg Leu Leu Gln Ala Leu Glu
195 200 205
gcc ccg gag ggc tgg ggt ccg aca cca agg gcg ggc cgc gcg gcc ttg 672
Ala Pro Glu Gly Trp Gly Pro Thr Pro Arg Ala Gly Arg Ala Ala Leu
210 215 220
cag ctg aag ctg cgt cgg cgg ctc acg gag ctc ctg ggg gcg cag gac 720
Gln Leu Lys Leu Arg Arg Arg Leu Thr Glu Leu Leu Gly Ala Gln Asp
225 230 235 240
ggg gcg ctg ctg gtg cgg ctg ctg cag gcg ctg cgc gtg gcc agg atg 768
Gly Ala Leu Leu Val Arg Leu Leu Gln Ala Leu Arg Val Ala Arg Met
245 250 255
ccc ggg ctg gag cgg agc gtc cgt gag cgc ttc ctc cct gtg cac 813
Pro Gly Leu Glu Arg Ser Val Arg Glu Arg Phe Leu Pro Val His
260 265 270
_7_
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
<210> 6
<211> 271
<212> PRT
<213> Homo sapiens
<400> 6
Val Ala Glu Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu
1 5 10 15
Arg Leu Val Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro
20 25 30
Cys Arg Arg Asp Ser Pro Thr Thr Cys Gly Pro Cys Pro Pro Arg His
35 40 45
Tyr Thr Gln Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Asn Val
50 55 60
Leu Cys Gly Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His
65 70 75 80
Asn Arg Ala Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe
85 90 95
Cys Leu Glu His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro
100 105 110
Gly Thr Pro Ser Gln Asn Thr Gln Cys Gln Pro Cys Pro Pro Gly Thr
115 120 125
Phe Ser Ala Ser Ser Ser Ser Ser Glu Gln Cys Gln Pro His Arg Asn
130 135 140
Cys Thr Ala Leu Gly Leu Ala Leu Asn Val Pro Gly Ser Ser Ser His
145 150 155 160
Asp Thr Leu Cys Thr Ser Cys Thr Gly Phe Pro Leu Ser Thr Arg Val
165 170 175
Pro Gly Ala Glu Glu Cys Glu Arg Ala Val Ile Asp Phe Val Ala Phe
180 185 190
Gln Asp Ile Ser Ile Lys Arg Leu Gln Arg Leu Leu Gln Ala Leu Glu
195 200 205
Ala Pro Glu Gly Trp Gly Pro Thr Pro Arg Ala Gly Arg Ala Ala Leu
210 215 220
Gln Leu Lys Leu Arg Arg Arg Leu Thr Glu Leu Leu Gly Ala Gln Asp
225 230 235 240
Gly Ala Leu Leu Val Arg Leu Leu Gln Ala Leu Arg Val Ala Arg Met
245 250 255
Pro Gly Leu Glu Arg Ser Val Arg Glu Arg Phe Leu Pro Val His
260 265 270
_g_
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
<210> 7
<211> 825
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1)..(813)
<400> 7
gtg gca gaa aca ccc acc tac ccc tgg cgg gac gca gag aca ggg gag 48
Val Ala Glu Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu
1 5 10 15
cgg ctg gtg tgc gcc cag tgc ccc cca ggc acc ttt gtg cag cgg ccg 96
Arg Leu Val Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro
20 25 30
tgc cgc cga gac agc ccc acg acg tgt ggc ccg tgt cca ccg cgc cac 144
Cys Arg Arg Asp Ser Pro Thr Thr Cys Gly Pro Cys Pro Pro Arg His
35 40 45
tac acg cag ttc tgg aac tac ctg gag cgc tgc cgc tac tgc aac gtc 192
Tyr Thr Gln Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Asn Val
50 55 60
ctc tgc ggg gag cgt gag gag gag gca cgg get tgc cac gcc acc cac 240
Leu Cys Gly Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His
65 70 75 80
aac cgt gcc tgc cgc tgc cgc acc ggc ttc ttc gcg cac get ggt ttc 288
Asn Arg Ala Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe
85 90 95
tgc ttg gag cac gca tcg tgt cca cct ggt gcc ggc gtg att gcc ccg 336
Cys Leu Glu His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro
100 105 110
ggc acc ccc agc cag aac acg cag tgc cag ccg tgc ccc cca ggc acc 384
Gly Thr Pro Ser Gln Asn Thr Gln Cys Gln Pro Cys Pro Pro Gly Thr
115 120 125
ttc tca gcc agc agc tcc agc tca gag cag tgc cag ccc cac cgc aac 432
Phe Ser Ala Ser Ser Ser Ser Ser Glu Gln Cys Gln Pro His Arg Asn
130 135 140
tgc acg gcc ctg ggc ctg gcc ctc aat gtg cca ggc tct tcc tcc cat 480
Cys Thr Ala Leu Gly Leu Ala Leu Asn Val Pro Gly Ser Ser Ser His
145 150 155 160
gac acc ctg tgc acc agc tgc act ggc ttc ccc ctc agc acc agg gta 528
Asp Thr Leu Cys Thr Ser Cys Thr Gly Phe Pro Leu Ser Thr Arg Val
165 170 175
cca gga get gag gag tgt gag cgt gcc gtc atc gac ttt gtg get ttc 576
_g_
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
ProGly AlaGlu GluCysGlu ArgAlaVal IleAspPheVal AlaPhe
180 185 190
caggac atctcc atcaagagg ctgcagcgg ctgctgcaggcc ctcgag 624
GlnAsp IleSer IleLysArg LeuGlnArg LeuLeuGlnAla LeuGlu
195 200 205
gccccg gagggc tgggetccg acaccaagg gcgggccgcgcg gccttg 672
AlaPro GluGly TrpAlaPro ThrProArg AlaGlyArgAla AlaLeu
210 215 220
cagctg aagctg cgtcggcgg ctcacggag ctcctgggggcg caggac 720
GlnLeu LysLeu ArgArgArg LeuThrGlu LeuLeuGlyAla GlnAsp
225 230 235 240
ggggcg ctgctg gtgcggctg ctgcaggcg ctgcgcgtggcc aggatg 768
GlyAla LeuLeu ValArgLeu LeuGlnAla LeuArgValAla ArgMet
245 250 255
cccggg ctggag cggagcgtc cgtgagcgc ttcctccctgtg cac 813
ProGly LeuGlu ArgSerVal ArgGluArg PheLeuProVal His
260 265 270
tgatcctggc cc 825
<210> 8
<211> 271
<212> PRT
<213> Homo sapiens
<400> 8
Val Ala Glu Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu
1 5 10 15
Arg Leu Val Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro
20 25 30
Cys Arg Arg Asp Ser Pro Thr Thr Cys Gly Pro Cys Pro Pro Arg His
35 40 45
Tyr Thr Gln Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Asn Val
50 55 60
Leu Cys Gly Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His
65 70 75 80
Asn Arg Ala Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe
85 90 95
Cys Leu Glu His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro
100 105 110
Gly Thr Pro Ser Gln Asn Thr Gln Cys Gln Pro Cys Pro Pro Gly Thr
115 120 125
Phe Ser Ala Ser Ser Ser Ser Ser Glu Gln Cys Gln Pro His Arg Asn
-10-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
130 135 140
Cys Thr Ala Leu Gly Leu Ala Leu Asn Val Pro Gly Ser Ser Ser His
145 150 155 160
Asp Thr Leu Cys Thr Ser Cys Thr Gly Phe Pro Leu Ser Thr Arg Val
165 170 175
Pro Gly Ala Glu Glu Cys Glu Arg Ala Val Ile Asp Phe Val Ala Phe
180 185 190
Gln Asp Ile Ser Ile Lys Arg Leu Gln Arg Leu Leu Gln Ala Leu Glu
195 200 205
Ala Pro Glu Gly Trp Ala Pro Thr Pro Arg Ala Gly Arg Ala Ala Leu
210 215 220
Gln Leu Lys Leu Arg Arg Arg Leu Thr Glu Leu Leu Gly Ala Gln Asp
225 230 235 240
Gly Ala Leu Leu Val Arg Leu Leu Gln Ala Leu Arg Val Ala Arg Met
245 250 255
Pro Gly Leu Glu Arg Ser Val Arg Glu Arg Phe Leu Pro Val His
260 265 270
<210> 9
<211> 8
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Polypeptide
<400> 9
Asp Tyr Lys Asp Asp Asp Asp Lys
1 5
<210> 10
<211> 59
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 10
tagggctgat caaggatggg cttctggact tgggcggccc ctccgcaggc ggaccgggg 59
<210> 11
<211> 66
<212> DNA
<213> Artificial Sequence
-11-
CA 02358508 2001-06-21
WO 00/37094 PCT/US99/30734
<220>
<223> Description of Artificial Sequence: Primer
<400> 11
aggggggcgg ccgctgatca tcacttgtcg tcgtcgtcct tgtagtcgtg cacagggagg 60
aagcgc 66
<210> 12
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 12
gaagatcttc tttgatcaag gatgggcttc tggactt 37
<210> 13
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 13
ggactagtcc tgatcatcac ttgtcgtcgt cgtcctt 37
-12-
