Note: Descriptions are shown in the official language in which they were submitted.
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
Adenovirus Vectors. Packaqing Cell Lines. Compositions and Methods for
Preparation and Use
This application is a continuation-in-part of U.S. Application 09/423,783
filed
November 12, 1999 and claims the benefit of the filing date of U.S.
Provisional
Application 60/115,920 filed January 14, 1999.
This invention was made with U.S. government support under NIH Grant No.
HL 54352. The government has certain rights in the invention.
The present invention relates to gene therapy, especially to adenovirus-based
gene therapy. In particular, novel packaging cell lines are disclosed, for use
in
facilitating the development of high-capacity and targeted vectors. High-
capacity
adenovirus vectors are also disclosed herein, as are related compositions,
kits, and
methods of preparation and use of the disclosed vectors, cell lines and kits.
Enhanced transfer of DNA conjugates into cells has been achieved with
adenovirus, a human DNA virus which readily infects epithelial cells (Horwitz,
"Adenoviridae and Their Replication", in Virology, Fields and Knipe, eds.,
Raven
Press, NY (1990) pp. 1679-1740).
There is a need in the art to obtain Adenovirus vectors capable of
incorporating large segments of foreign DNA and capable of being targeted to
specific cells, as well as to obtain cell lines which can package such
adenovirus-
gene deficient vectors or targeted vectors. These needs, as well as others,
are
met by the invention.
This invention utilizes recombinant adenovirus constructs which duplicate the
cell receptor binding and DNA delivery properties of intact adenovirus virions
and
thus represents an improved method for gene therapy and cell targeting as well
as
for antisense-based antiviral therapy.
In contrast to the disadvantages of using intact adenovirus, modified
adenovirus vectors requiring a helper plasmid or virus, or so-called
replication-
deficient adenovirus in the art, the use of recombinant adenovirus-derived
vectors
according to one aspect of the present invention provides certain advantages
for
gene delivery. First, the Ad-derived vectors of the present invention possess
all of
the functional properties required for gene therapy including binding to
epithelial
cell receptors and penetration of endocytic vesicles. Therapeutic viral
vectors of
the present invention may also be engineered to target the receptors of and
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
- 2-
achieve penetration of non-epithelial cells; means of engineering viral
vectors to
accomplish these ends are described in detail herein below.
Second, the vectors of the present invention have deletions of substantial
portions of the Ad genome, which not only limits the ability of the Ad-derived
vectors to "spread" to other host cells or tissues, but allows significant
amounts of
"foreign" (or non-native) nucleic acids to be incorporated into the viral
genome
without interfering with the reproduction and packaging of the viral genome.
Therefore, the vectors of the present invention are ideal for use in a wide
variety of
therapeutic applications.
Third, while the vectors disclosed herein are safe for use as therapeutic
agents in the treatment of a variety of human afflictions, some of these
vectors do
not require the presence of any "helpers" for propagation and packaging,
largely
because of the novel cell lines in which they are reproduced. Such cell lines -
-
referred to herein as packaging cell lines -- comprise yet another aspect of
the
invention.
To reduce the frequency of contamination with wild-type adenovirus, it is
desirable to improve either the viral vector or the cell line to reduce the
probability
of recombination. For example, an adenovirus from a group with less homology
to
the group C viruses may be used to engineer recombinant viruses with little
propensity for recombination with the Ad5 sequence contained in the packaging
lines. The invention describes the preparation of packaging cells lines which
stably expresses adenovirus proteins or polypeptides. These cell lines are
useful
for complementing viral vectors bearing deletions of regulatory and/or
structural
genes, irrespective of the serotype from which such a vector was derived.
It is also contemplated that the constructs and methods of the present
invention will support the design and engineering of chimeric viral vectors
which
express amino acid residue sequences derived from two or more Ad serotypes.
Thus, unlike methods and constructs available prior to the advent of the
present
disclosure, this invention allows the greatest possible flexibility in the
design and
preparation of useful viral vectors and cell lines which support their
construction
and propagation -- all with a decreased risk of recombining with wild-type Ad
to
produce potentially-harmful recombinants.
In part, the present invention discloses a simpler, alternative means of
reducing the recombination between viral and cellular sequences than those
discussed in the art. One such means is to increase the size of the deletion
in the
recombinant virus and thereby reduce the extent of shared sequences between
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 3-
that virus and any Ad genes present in a packaging cell line e.g., the Ad5
genes in
293 cells, or the various Ad genes in the novel cell lines of the present
invention.
Deletions of all or portions of structural genes of the adenovirus have been
considered undesirable because of the anticipated deleterious effects such
deletions would have on viral reproduction and packaging. Indeed, the use of
"helper" viruses or plasmids has often been recommended when using Ad-derived
vectors containing large deletions in structural protein sequences precisely
for this
reason.
Contrary to what has been suggested in the art, however, this invention
discloses the preparation, propagation and use of recombinant Ad-derived
vectors
having deletions of all or part of various gene sequences encoding Ad
structural
proteins, both as a way of reducing the risk of wild-type adenovirus
contamination
in virus preparations, as a way of allowing foreign DNA to be packaged in such
vectors for a variety of diagnostic and therapeutic applications and as a way
of
targeting an adenovirus vector to a specific cell type.
The invention further discloses a wide variety of nucleic acid sequences and
viral vectors. Thus, in one embodiment, the invention discloses a nucleic acid
sequence encoding any one of the adenovirus fiber proteins mentioned in the
specification, polypeptides or fragments thereof -- including, without
limitation,
those that include deletions or other mutations; those that are chimeric; and
those
that have linkers, foreign amino acid residues, or other molecules attached
for
various purposes as disclosed herein. Nucleic acid sequences encoding various
other adenovirus structural and/or regulatory proteins or polypeptides are
also
within the scope of the present invention.
In various embodiments, the adenovirus is a Group C adenovirus selected
from serotypes 1, 2, 5 or 6; while in other embodiments, adenovirus selected
from
other serotypes, such as for example Ad37 (subgroup D) are useful as disclosed
herein.
The invention is also directed to an isolated nucleic acid molecule comprising
an adenovirus tripartite leader (TPL) nucleotide sequence, said TPL nucleotide
sequence comprising (a) first and second different TPL exons or (b) first,
second
and third same or different TPL exons, said TPL exons selected from the group
consisting of complete TPL exon 1, partial TPL exon 1, complete TPL exon 2 and
complete TPL exon 3, wherein said isolated nucleic acid molecule may not
comprise the nucleic acid sequence consisting of partial TPL exon 1, complete
TPL
exon 2 and complete TPL exon 3. A preferable embodiment of the invention may
further comprise an intron operatively linked to the TPL, wherein said intron
also
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 4-
contains requisite processing signals for the intron's removal. Another
preferable
embodiment of the invention is directed to the isolated nucleic acid molecule
wherein said TPL nucleotide sequence consists essentially of complete TPL exon
1
operatively linked to complete TPL exon 2 operatively linked to complete TPL
exon
3. A related embodiment may further include an intron and appropriate
processing
signals. Additional embodiments of the invention are directed to nucleic acid
molecules contained in plasmids selected from the group; consisting of pCLF,
pDV60, pDV67, pDV69, pDV80 and PDV90. Packaging cell lines and adenovirus
particles containing the nucleic acids described above are also included in
the
invention.
The invention is further directed to methods for producing an adenovirus
vector particle containing a helper-independent fiberless recombinant
adenovirus
vector genome comprising providing a) a packaging cell line which complements
replication and packaging of said genome and b) a helper-independent fiberless
recombinant adenovirus vector genome which is deficient in expressing
sufficient
functional fiber protein to support assembly of fiber-containing particles.
The
genome is introduced into the cell line. Additional embodiments of the
invention
may also include the following steps; a) growing the cell line produced under
conditions for producing particles; and/or b) harvesting an adenovirus vector
particle containing said helper-independent fiberless recombinant adenovirus
vector genome. The method may also include a cell line that expresses a fiber
protein and complements a fiber mutation in the vector.
The invention is also directed to an adenovirus vector packaging cell line
comprising a stably integrated nucleic acid molecule as described above, an
operatively-linked promoter and a nucleic acid sequence which encodes an
adenovirus structural protein, wherein said TPL sequence consists essentially
of a
first TPL exon operatively linked to a complete second TPL exon operatively
linked
to a complete third TPL exon, wherein said packaging cell comprises an
isolated
nucleic acid molecule comprising an adenovirus tripartite leader (TPL)
nucleotide,
said TPL nucleotide sequence comprising (a) first and second different TPL
exons
or (b) first, second and third different TPL exons, said TPL exons selected
from the
group consisting of complete TPL exon 1, partial TPL exon 1, complete TPL exon
2
and complete TPL exon 3 and, wherein said isolated nucleic acid molecule may
not
comprise the nucleic acid sequence consisting of partial TPL exon 1, complete
TPL
exon 2 and complete TPL exon 3. Preferably, the cell line may have a complete
first TPL exon. Another embodiment of the invention comprises adenovirus
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
- 5-
structural protein, such as adenovirus fiber protein or a chimeric protein
which
includes an adenovirus fiber protein tail domain.
The invention is further directed to a recombinant adenovirus particle
comprising a recombinant adenovirus vector genome wherein said genome:(a)
does not encode or does not express sufficient adenovirus fiber protein to
support
packaging of a fiber-containing adenovirus particle without complementation of
said fiber gene, and (b) encodes an adenovirus packaging signal and inverted
terminal repeats containing adenovirus origin of replication. The invention is
also
directed to a helper-independent fiberless recombinant adenovirus vector
genome
comprising genes which (a) encode all adenovirus structural gene products but
do
not express sufficient adenovirus fiber protein to package a fiber-containing
adenovirus particle without complementation of said fiber gene or said genome
lacks at least the fibre gene and (b) encodes an exogenous protein. Either of
the
above embodiments may substitute a helper-dependent for a helper-independent
recombinant adenovirus vector genome. In a preferable embodiment, no fiber
protein is expressed. In yet another embodiment of the invention, the
recombinant
adenovirus particle fails to express sufficient fiber protein to allow fiber
incorporation into the particle such that the particle can use the fiber
pathway for
infection.
The invention is further directed to a method for producing an adenovirus
vector particle containing a helper-independent fiberless recombinant
adenovirus
vector genome, said method comprising providing a packaging cell line which
complements replication and packaging of said genome and a helper-independent
fiberless recombinant adenovirus vector genome which is deficient in
expressing
sufficient functional fiber protein to support assembly of fiber-containing
particles,
wherein said packaging cell comprises an isolated nucleic acid molecule
comprising an adenovirus tripartite leader (TPL) nucleotide, said TPL
nucleotide
sequence comprising (a) first and second different TPL exons or (b) first,
second
and third different TPL exons, said TPL exons selected from the group
consisting
of complete TPL exon 1, partial TPL exon 1, complete TPL exon 2 and complete
TPL exon 3 and, wherein said isolated nucleic acid molecule may not comprise
the
nucleic acid sequence consisting of partial TPL exon 1, complete TPL exon 2
and
complete TPL exon and harvesting said adenovirus particles produced by said
cell
line.. In a preferable embodiment the adenovirus particle further comprises an
exogenous protein or a modified fiber protein. The method may also comprise a
step of coating a particle (i.e. providing fiber protein in any way) with an
adenovirus
fiber protein.
WO-00/42208 cA 02359795 2001-07-12 pCT/EP00/00265
- 6-
Another aspect of the invention is directed to a method for pseudotyping
recombinant viral vectors comprising complementing a missing fiber gene of a
helper-independent fiberless recombinant adenovirus vector genome by
expressing in packaging cells a fiber gene from a different adenoviral
serotype
than said recombinant adenovirus vector, thereby pseudotyping said vector. An
additional embodiment of the invention is directed to the method for
pseudotyping
recombinant viral vectors comprising: a) providing a packaging cell line for
propagating a fiber gene deleted recombinant adenovirus vector, b) introducing
into said cell line a helper-independent fiberless recombinant adenovirus
vector
genome, and c) complementing the missing fiber gene by expression in the cells
of
a fiber gene from a different adenoviral serotype thereby pseudotyping the
vector.
The invention is further directed to a method for specifically targeting an
adenovirus vector to a cell of choice comprising introducing a helper-
independent
or helper-dependent fiberless recombinant adenovirus vector genome into a
packaging cell line for producing a fiber gene-deleted adenovirus vector and
providing, wherein said gene for a missing fiber protein is complemented with
a
gene for a desired modification for targeting the vector to a cell of choice
The invention is further directed to a method for producing a modified
adenovirus comprising providing in vitro an exogenous fiber protein to a
fiberless
adenovirus. Additional embodiments of the invention may provide any
combination
of all of the following steps such that the invention be directed to a method
for
producing a modified adenovirus comprising: a) providing a packaging cell line
for
producing a fiberless adenovirus vector, b) introducing into said cell line a
helper-
independent fiberless or helper-dependent fiberless recombinant adenovirus
vector
genome, c) growing and harvesting a fiberless adenovirus, d) maintaining the
fiberless adenovirus in any suitable buffer, and e) providing exogenous fiber,
wherein said fiber may be a modified fiber, to the fiberless adenovirus by
adding
conditioned media or a soluble fiber preparation or a fiber in any suitable
buffer to
a virus preparation thereby producing the modified adenovirus.
The invention is further directed to a method for producing a modified
adenovirus comprising providing a packaging cell line for producing a helper-
dependent fiberless adenovirus vector genome and providing a helper virus
vector,
wherein said cell line complements at least a deficient fiber protein gene,
thereby
producing the modified adenovirus. Another aspect of the invention is directed
to
a method for producing a modified adenovirus comprising: a) providing a
packaging cell line for producing a fiberless adenovirus vector, b)
introducing into
said cell line a helper dependent fiberless recombinant adenovirus vector
genome
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
_ 7_
and a fiberless helper virus vector, c) growing and harvesting a fiberless
adenovirus, and d)maintaining the fiberless adenovirus in infectious media,
and e)
providing exogenous fiber to the fiberless adenovirus by adding conditioned
media
or a soluble fiber preparation to a virus preparation thereby producing the
modified
adenovirus.
Additional aspects of the invention are directed to hybrid Ad/AAV vectors and
to new helper-dependent vectors used with fiberless adenovirus vectors.
The invention is also directed to a method for delivering a heterologous gene
to an EBV-infected B cells comprising infecting said B cells with a
pseudotyped
Ad5(3gal.~ F particle or other fiber-deleted adenovirus particle, said
particle having
a chimeric fiber with the receptor-binding knob domain of the adenovirus type
3
fiber.
The invention is also directed to an isolated nucleic acid comprising a post-
transcriptional regulatory element (PRE) and a TPL. Preferably the PRE is the
woodchuck hepatitis virus PRE (WPRE).
The invention is further directed to a composition for preparing a therapeutic
vector, said composition comprising a plasmid comprising an adenovirus genome
lacking a nucleotide sequence encoding a fiber protein or a genome that is
incapable of expressing sufficient fiber to result in packaging.
Another aspect of the invention is directed to a method of delivering a
heterologous gene to a human or any animal comprising providing an exogenous
gene to a target cell comprising contacting said cell in vivo or ex vivo with
an
amount of a recombinant adenovirus particle sufficient to infect said cell.
The invention is also directed to A method for producing a gutless adenoviral
vector particle comprising: a) delivering a helper adenovirus vector genome to
an
adenovirus vector packaging cell, wherein said helper adenovirus vector genome
lacks any gene encoding adenovirus fiber protein or lacks the ability to
encode
sufficient adenovirus fiber protein to produce an adenoviral vector comprising
fiber
protein in the absence of complemetation by said packing cell and wherein said
packaging cell comprises the nucleic acid molecule of claim 2 operably linked
to a
promoter and to an adenoviral fiber protein or to a chimeric protein that
includes an
adenovirus fiber protein tail domain; (b) delivering a gutless adenovirus
vector
genome to said packaging cell; and (c) recovering the gutless adenoviral
vector
particle produced by said cell.
Another aspect of the invention is directed to a helper adenovirus particle
comprising an adenovirus vector genome that does not encode or does not
express sufficient adenovirus fiber protein to support packaging of a fiber-
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
_ g_
containing adenovirus particle without complementation of said fiber gene,
wherein
said genome has a mutation in its packaging sequence that renders said genome
substantially incapable of being packaged. Packaging sequence are those
sequences are those sequences involved in packaging the viral particle.
The invention is further directed to a helper adenovirus particle comprising
an
adenovirus vector genome with recombinase sites flanking its packaging
sequence, wherein said vector genome does not encode or does not express
sufficient adenovirus fiber protein to support packaging of a fiber-containing
adenovirus particle without complementation of said fiber gene.
The invention is also directed to an adenovirus particle comprising a gutless
adenoviral vector genome and a fiberless capsid, as well as an adenovirus
particle
comprising a gutless adenoviral vector genome and a capsid comprising a
modified
fiber protein.
Another aspect of the invention is directed to a packaging cell for the
production of a fiberless or fiber-modified gutless adenovirus particle
comprising an
adenovirus vector complementing plasmid and a nucleotide sequence encoding a
recombinase, wherein said complementing plasmid comprises the nucleic acid
molecule of claim 2 operably linked to a promoter and to a nucleotide sequence
encoding an adenoviral fiber protein or a chimeric adenoviral fiber protein.
Preferably the cell line may comprise a recombinase. In an embodiment of the
invention the recombinase may be Cre.
In another embodiment of the invention, the fiber-deleted adenovirus vectors
of the invention and the fiber-complementing adenovirus packaging cells of the
invention are used to produce a gutless adenovirus vector particle. Such
particle
comprises a gutless adenoviral vector genome in an adenoviral capsid. The
fiber
proteins of the capsid may be wild-type fiber, or the modified fiber proteins
disclosed herein. Alternatively, such particle may have a fiberless capsid as
disclosed herein. Preferably, the gutless genome contains at least one
heterologous gene as described herein. As used herein, the term "gutless
adenoviral vector genome" means an adenoviral vector genome from which all of
the viral genes have been deleted..
The invention also discloses systems or kits for use in any of the
aforementioned methods. The systems or kits may contain any appropriate
combination of the within-described vectors, plasmids, cell lines, virus
particles and
additional therapeutic agents as disclosed. Preferably, each such kit or
system
includes a quantity of the appropriate therapeutic substance or sequence
sufficient
for at least one administration, and instructions for administration and use.
Thus,
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
_ g_
one system further comprises an effective amount of a therapeutic agent which
enhances the therapeutic effect of the therapeutic viral vector-containing
composition. Another variation discloses that the composition and the
therapeutic
agent are each included in a separate receptacle or container.
It will also be appreciated that any combination of the preceding elements
may also be efficacious as described herein, and that all related methods are
also
within the scope of the present invention.
< Figure 1 is a schematic diagram of the entire adenoviral E4 transcriptional
unit with the open reading frames (ORF) indicated by blocked segments along
with
the promoter and terminator sequences. The location of primers for amplifying
specific portions of E4 are also indicated as further described in Example 1A.
Figure 2 is a schematic map of plasmid pE4/Hygro as further described in
Example 1 B.
Figure 3 is a schematic map of plasmid pCDNA3/Fiber as further described
in Example 1 B.
Figure 4 is a schematic map of plasmid pCLF as further described in
Example 1 B.
Figure 5 is a photograph of a Southern blot showing the presence of intact
adenovirus E4 3.1 kilobase (kb) insert in the 211 cell line as further
described in
Example 1 C.
Figure 6 is an autoradiograph showing labeled fiber protein
immunoprecipitated from cells and electrophoresed under native and denaturing
electrophoresis conditions as described in Example 1 C. The 293 cells lack
fiber
while the sublines 211 A, 211 B and 211 R contain fiber protein detectable in
functional trimerized form and denatured monomeric form.
Figure 7 is a schematic map of plasmid pDEX/E1 as further described in
Example 1 D.
Figure 8 is a schematic map of plasmid pE1/Fiber as further described in
Example 1 F1.
Figure 9 is a schematic map of plasmid pE4/Fiber as further described in
Example 1 F2).
Figure 10 is a schematic illustration of linearized pD E1 Bb gal delivery
plasmids for use in cotransfection and recombination to form a recombinant
adenoviral vector having multiple adenoviral gene deletions. The plasmids and
recombination event are more fully described in Example 2A.
CA 02359795 2001-07-12 pCT~P00/00265
WO 00/42208
- 10-
Figure 11 is a schematic of plasmid p11.3 as further described in Example
2A used in the construction of pDV44 delivery plasmid.
Figure 12 is a schematic of plasmid 8.2.
Figure 13 shows the trimeric structure of the recombinant fiber. 293, 211A,
211 B, or 211 R cells as indicated were metabolically labeled with
[35S)methionine,
soluble protein extracts prepared, and fiber was immunoprecipitated. A portion
of
the precipitated protein was electrophoresed on an 8% SDS-PAGE gel under
either
semi-native or denaturing conditions. The positions of trimeric (T) and
monomeric
(M) fiber are indicated. As a control for electrophoretic conditions,
recombinant
Ad2 fiber produced in baculovirus-infected cells was run under identical
conditions
and stained with Coomassie blue. Figure 14 shows the complementation of a
fiber mutant adenovirus by fiber-producing cells. The cell lines indicated
(2x106
cells per sample) were infected with the temperature-sensitive fiber mutant
adenovirus H5ts142 at 10 PFU/cell and incubated at either the permissive
(32.5°C,
stippled bars) or the restrictive (39.5°C, solid bars) temperature. 48
hours post-
infection, virus was isolated by freeze-thaw lysis and yields determined by
fluorescent focus assay on SW480 cells. Each value represents the mean of
duplicate samples, and the data shown is representative of multiple
experiments.
Figure 15 shows the incorporation of the recombinant Ad5 fiber into Ad3
particles. In Figure 15A, the alignment of the N-terminal (penton base-
binding)
domains of fiber proteins from several different adenovirus serotypes is
shown.
From top to bottom, the five different serotypes are listed as SEQ ID NOs 21-
25. In
Figure 15B, type 3 adenovirus was propagated in 293, 211 B, or 211 R cells as
indicated and purified by two sequential CsCI centrifugations. 10 Ng of the
purified
viral particles was then electrophoresed under denaturing conditions and
transferred to a PVDF membrane. Ad5 fiber was detected with a polyclonal
rabbit
antibody raised against recombinant Ad2 fiber. As a positive control for
detection,
400 ng of wild-type Ad2 was run in the lane marked "Ad2". Under these
conditions,
the mobilities of the Ad2 and Ad5 fibers are indistinguishable and the
antibody
reacts with both proteins.
Figure 16 shows the fiber deletion in pDV44 and the genomic structures of
the AdS.[igal.~F and AdS.[igal.wt vectors: Figure 16A shows pDV44 that was
constructed by removing the fiber gene and residual E3 sequences (nt
30819:32743 of AD5) from pBHGlO. Figures 16B shows viruses constructed by
cotransfection of either pBHGlO or pDV44 with p0ElB[3gal. Both are E1/E3
deleted Ad5 vectors, and AdS.[igaI.OF has the additional fiber (L5) deletion
as in
pDV44.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 11-
Figure 17 shows the analysis of the viral chromosomes. Figure 17A shows
the predicted EcoRl restriction maps of Ad5.~3gal.wt and AdS.(igaI.OF. The 5.9
kb
fragment at the right end of the AdS.agal.wt genome is reduced to 4.0 kb by
the
deletion of fiber sequences in Ad5.~3gaI.OF. Figure 17B shows an ethidium
bromide-stained gel of EcoRl-digested viral DNA. Figure 17C shows a Southern
blot of the gel as described in Example 2 probed either with labeled fiber or
E4
sequences.
Figure 18 shows the analysis of vertex proteins in the viral particles. 293
(non-fiber expressing) or 211 B (fiber-expressing) cells were infected with
AdS.~igal.wt ('wt') or with AdS.~igaI.OF('OF') and the resulting viral
particles were
purified on CsCI gradients. 10 Ng of purified virions was then electrophoresed
on
5-16% gradient gels and Western blotted. Proteins were detected with
polyclonal
anti-fiber or anti-penton base antibodies.
Figure 19 shows the infectivity of Ad particles on THP-1 monocytic cells.
Figure 19A shows THP-1 cells that were infected with AdS.(3gal.wt or with
fiberless
AdS.~igaI.OF at 100,000 particles/cell. Forty-eight hours after infection,
cells were
fixed and stained with X-gal and the fraction of infected cells was determined
by
light microscopy. Figure 19B shows cells that were infected with 1000
particles per
cell of AdS.~igal.wt or with 100,000 particles/cell of AdS.(3gaI.OF. As
indicated, cells
were pretreated with 100 pg/ml of recombinant penton base or with 20 Ng/ml of
recombinant Ad2 fiber.
Figure 20 shows a schematic of improved fiber-complementing cell lines,
633 and 644 as further described in the Examples.
Figures 21 and 22 illustrates pseudotyping of fiberless particles with fiber
proteins and infectivity data as further described in the Examples.
Figure 23 shows the Clal to Bglll fragment of AdS.
Figure 24 shows the plasmid pGRES-2/EBV
Figure 25 shows the plasmid pGRES-E1.
Figure 26 shows the plasmid pSE280-E2 BamHl-Smal.
Figure 27. The fiber-deleted adenovirus vector AdS.bgaI.DF was grown in
cells expressing either no fiber (293; 'AdS.bgaI.DF/0'), the Ad5 fiber (633;
'AdS.bgaI.DF/5F'), or the Ad37 fiber with modifications as described in the
text
(705; 'AdS.bgaI.DF/37F') and CsCI-purified. 10 pg of the purified particles
were
electrophoresed and transferred to a nylon membrane. As controls, 10 Ng of
wild-
type Ad37 or the fiber gene-containing vector AdS.bgal.wt or a sample of
purified
recombinant Ad37 fiber knob were also run. The blot was probed with polyclonal
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 12-
antisera against recombinant Ad37 fiber or Ad2 fiber proteins. As a loading
control, the same filter was reprobed with an antibody against the Ad2 penton
base
(the anti-Ad2 sera cross-recognized the very similar Ad5 fiber and Ad5 penton
base proteins).
Figure 28 shows PCR analysis for fiber presence.
Figure 29 shows the transduction efficiency for fiberless virus with and
without soluble fiber.
Figure 30 shows the transduction efficiency of ADSBgF- on HDF cell line
with the presence of different amounts of 633 conditioned media.
To reduce the frequency of contamination with wild-type adenovirus, it is
considered desirable to improve either the viral vector or the cell line to
reduce the
probability of recombination. For example, an adenovirus from a group with
less
homology to the group C viruses may be used to engineer recombinant viruses
with little propensity for recombination with the Ad5 sequence in 293 cells.
Similarly, an epithelial cell line -- e.g. the cell line known as 293 -- may
be used or
further modified according to within-disclosed methods which stably expresses
adenovirus proteins or polypeptides from Ad3 and/or proteins or polypeptides
from
another non-group-C or group C serotype; such a cell line would be useful to
support adenovirus-derived viral vectors bearing deletions of regulatory
and/or
structural genes, irrespective of the serotype from which such a vector was
derived.
It is also contemplated that the constructs and methods of the present
invention will support the design and engineering of chimeric viral vectors
which
express amino acid residue sequences derived from two or more Ad serotypes.
Thus, unlike methods and constructs available prior to the advent of the
present
disclosure, this invention allows the greatest possible flexibility in the
design and
preparation of useful viral vectors and cell lines which support their
construction
and propagation -- all with a decreased risk of recombining with wild-type Ad
to
produce potentially-harmful recombinants.
In part, the present invention discloses a simpler, alternative means of
reducing the recombination between viral and cellular sequences than those
discussed in the art. One such means is to increase the size of the deletion
in the
recombinant virus and thereby reduce the extent of shared sequences between
that
virus and any Ad genes present in a packaging cell line -- e.g., the Ad5 genes
in
293 cells, or the various Ad genes in the novel cell lines of the present
invention.
CA 02359795 2001-07-12 PC'T/EP00/00265
WO 00/42208
- 13-
Therefore, the present invention makes it feasible to engineer and produce
novel viral vectors that are able to package and deliver significantly larger
foreign
nucleic acid sequences for efficacious use in a variety of therapeutic
applications,
without endangering the subject to whom they are administered, due to their
impaired ability to self-replicate in non-complementing cell lines. Due to the
fact
that "helper" viruses or plasmids need not be used in conjunction with many of
the
viral vectors of the present invention, those vectors of the present invention
are
also simpler to use than those previously described in the art.
In order to provide a clearer understanding of the specification and claims,
the following definitions are provided.
Adenoviral Vector or Ad-Derived Vector. Any adenovirus-derived plasmid,
genome or virus into which a foreign DNA may be inserted or expressed. This
term
may also be used interchangeably with "viral vector." This "type" of vector
may be
utilized to carry nucleotide sequences encoding therapeutic proteins or
polypeptides to specific cells or cell types in a subject in need of
treatment, as
described further herein below.
Amino Acid Residue: An amino acid formed upon chemical digestion
(hydrolysis) of a polypeptide at its peptide linkages. The amino acid residues
described herein are preferably in the "L" isomeric form. However, residues in
the
"D" isomeric form can be substituted for any L-amino acid residue, as long as
the
desired functional property is retained by the polypeptide. NH2 refers to the
free
amino group present at the amino terminus of a polypeptide. COOH refers to the
free carboxy group present at the carboxyl terminus of a polypeptide. Standard
polypeptide nomenclature described in J. Biol. Chem., 243:3552-59 (1969) and
adopted at 37 C.F.R. ~ ~ 1.821 - 1.822 is used.
It should be noted that all amino acid residue sequences represented herein
by formulae have a left to right orientation in the conventional direction of
amino-terminus to carboxyl-terminus. In addition, the phrase "amino acid
residue"
is broadly defined to include the amino acids listed in the Table of
Correspondence
and modified and unusual amino acids, such as those referred to in 37 C.F.R. ~
~
1.821-1.822, and incorporated herein by reference. Furthermore, it should be
noted that a dash at the beginning or end of an amino acid residue sequence
indicates a peptide bond to a further sequence of one or more amino acid
residues
or to an amino-terminal group such as NH2 or to a carboxyl-terminal group such
as
COOH.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 14-
Complementing Plasmid: This term is generally used herein to
describe plasmid vectors used to deliver particular nucleotide sequences into
a
packaging cell line, with the intent of having said sequences stably integrate
into
the cellular genome.
Delivery Plasmid: This term is generally used herein to describe a
plasmid vector that carries or delivers nucleotide sequences in or into a cell
line
(e.g., a packaging cell line) for the purpose of propagating therapeutic viral
vectors
of the present invention.
DNA Homolog: A nucleic acid having a preselected conserved nucleotide
sequence and a sequence encoding a preferred polypeptide according to the
present invention, where the nucleic acid is substantial homologous to a named
preferred embodiment. By the term "substantially homologous" is meant having
at
least 80%, preferably at least 90%, most preferably at least 95% homology
therewith.
The terms "homology" and "identity" are often used interchangeably. In this
regard, percent homology or identity may be determined, for example, by
comparing sequence information using a GAP computer program. The GAP
program utilizes the alignment method of Needleman and Wunsch (J. Mol. Biol.
48:443 (1970), as revised by Smith and Waterman (Adv. Appl. Math. 2:482
(1981).
Briefly, the GAP program defines similarity as the number of aligned symbols
(i.e.,
nucleotides or amino acids) which are similar, divided by the total number of
symbols in the shorter of the two sequences. The preferred default parameters
for
the GAP program may include: (1) a unary comparison matrix (containing a value
of 1 for identities and 0 for non-identities) and the weighted comparison
matrix of
Gribskov and Burgess, Nucl. Acids Res. 14:6745 (1986), as described by
Schwartz
and Dayhoff, eds., ATLAS OF PROTEIN SEQUENCE AND STRUCTURE, National
Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for
each
gap and an additional 0.10 penalty for each symbol in each gap; and (3) no
penalty
for end gaps.
Whether any two nucleic acid molecules have nucleotide sequences that
are at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% "identical" can be
determined using known computer algorithms such as the "FAST A" program, using
for example, the default parameters as in Pearson and Lipman, Proc. Natl.
Acad.
Sci. USA 85:2444 (1988). Alternatively the BLAST function of the National
Center
for Biotechnology Information database may be used to determine identity
In general, sequences are aligned so that the highest order match is
obtained. "Identity" per se has an art-recognized meaning and can be
calculated
CA 02359795 2001-07-12 PCT/EP00/00265
WO 00/42208
- 15-
using published techniques. (See, e.g.: Computational Molecular Biology, Lesk,
A.M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics
and
Genome Projects, Smith, D.W., ed., Academic Press, New York, 1993; Computer
Analysis of Sequence Data, Part I, Griffin, A.M., and Griffin, H.G., eds.,
Humana
Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje,
G.,
Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and
Devereux, J., eds., M Stockton Press, New York, 1991). While there exist a
number of methods to measure identity between two polynucleotide or
polypeptide
sequences, the term "identity" is well known to skilled artisans (Carillo, H.
& Lipton,
D., SIAM J Applied Math 48:1073 (1988)). Methods commonly employed to
determine identity or similarity between two sequences include, but are not
limited
to, those disclosed in Guide to Huge Computers, Martin J. Bishop, ed.,
Academic
Press, San Diego, 1994, and Carillo, H. & Lipton, D., SIAM J Applied Math
48:1073
(1988). Methods to determine identity and similarity are codified in computer
programs. Preferred computer program methods to determine identity and
similarity between two sequences include, but are not limited to, GCG program
package (Devereux, J., et al., Nucleic Acids Research 12(1):387 (1984)),
BLASTP,
BLASTN, FASTA (Atschul, S.F., et al., J Molec Bio1215:403 (1990)).
Therefore, as used herein, the term "identity" represents a comparison
between a test and a reference polypeptide or polynucleotide. For example, a
test
polypeptide may be defined as any polypeptide that is 90% or more identical to
a
reference polypeptide. As used herein, the term at least "90% identical to"
refers
to percent identities from 90 to 99.99 relative to the reference polypeptides.
Identity at a level of 90% or more is indicative of the fact that, assuming
for
exemplification purposes a test and reference polynucleotide length of 100
amino
acids are compared. No more than 10% (i.e., 10 out of 100) amino acids in the
test
polypeptide differs from that of the reference polypeptides. Similar
comparisons
may be made between a test and reference polynucleotides. Such differences may
be represented as point mutations randomly distributed over the entire length
of an
amino acid sequence or they may be clustered in one or more locations of
varying
length up to the maximum allowable, e.g. 10/100 amino acid difference
(approximately 90% identity). Differences are defined as nucleic acid or amino
acid substitutions, or deletions.
An embodiment of the invention may use polynucleotides at least 90% or
95% identical to those encoding the TPL nucleic acid sequences. A further
embodiment of the invention may include those polynucleotides that encode a
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 16-
polypeptide of interest that are at least 95% identical when the variation in
such a
polynucleotide is due to more than merely degenerate changes.
Expression or Delivery Vector.' Any plasmid or virus into which a foreign
DNA may be inserted for expression in a suitable host cell -- i.e., the
protein or
polypeptide encoded by the DNA is synthesized in the host cell's system.
Vectors
capable of directing the expression of DNA segments (genes) encoding one or
more proteins are referred to herein as "expression vectors." Also included
are
vectors which allow cloning of cDNA (complementary DNA) from mRNAs produced
using reverse transcriptase.
Foreign Gene: This term is used to identify a DNA molecule not present in
the exact orientation and position as the counterpart DNA molecule found in
wild-
type adenovirus. It may also refer to a DNA molecule from another organism or
species (i.e., exogenous) or from another Ad serotype.
Gene: A nucleic acid whose nucleotide sequence encodes an RNA or
polypeptide. A gene can be either RNA or DNA. Genes may include regions
preceding and following the coding region (leader and trailer) as well as
intervening sequences (introns) between individual coding segments (exons).
Isolated: This term is used to indicate a nucleic acid or polypeptide
sequence separated from the genetic environment from which the sequences were
obtained. It may also mean altered from the natural state. For example, a
polynucleotide or a polypeptide naturally present in a living animal is not
"isolated,"
but the same polynucleotide or polypeptide separated from the coexisting
materials
of its natural state is "isolated", as the term is employed herein. Thus, a
polypeptide or polynucleotide produced and/or contained within a recombinant
host
cell is considered isolated for purposes of the present invention. Also
intended as
an "isolated polypeptide" or an "isolated polynucleotide" are polypeptides or
polynucleotides that have been purified, partially or substantially, from a
recombinant host cell or from a native source. For example, a recombinantly
produced version of a compounds can be substantially purified by the one-step
method described in Smith and Johnson, Gene 6731-40 (1988). The terms
isolated and purified are sometimes used interchangeably.
By "isolated" is meant that the DNA is free of the coding sequences of those
genes that, in the naturally-occurring genome of the organism (if any) from
which
the DNA of the invention is derived, immediately flank the gene encoding the
DNA
of the invention. The isolated DNA may be single-stranded or double-stranded,
and may be genomic DNA, cDNA, recombinant hybrid DNA, or synthetic DNA. It
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 17-
may be identical to a native DNA sequence, or may differ from such sequence by
the deletion, addition, or substitution of one or more nucleotides.
Isolated or purified as it refers to preparations made from biological cells
or
hosts should be understood to mean any cell extract containing the indicated
DNA
or protein including a crude extract of the DNA or protein of interest. For
example,
in the case of a protein, a purified preparation can be obtained following an
individual technique or a series of preparative or biochemical techniques and
the
DNA or protein of interest can be present at various degrees of purity in
these
preparations. The procedures may include for example, but are not limited to,
ammonium sulfate fractionation, gel filtration, ion exchange change
chromatography, affinity chromatography, density gradient centrifugation and
electrophoresis.
A preparation of DNA or protein that is "pure" or "isolated" should be
understood to mean a preparation free from naturally occurring materials with
which such DNA or protein is normally associated in nature. "Essentially pure"
should be understood to mean a "highly" purified preparation that contains at
least
95% of the DNA or protein of interest.
A cell extract that contains the DNA or protein of interest should be
understood to mean a homogenate preparation or cell-free preparation obtained
from cells that express the protein or contain the DNA of interest. The term
"cell
extract" is intended to include culture media, especially spent culture media
from
which the cells have been removed.
Packaging Cell line: A packaging cell line is a cell line that provides a
missing gene product or its equivalent.
Particle: The adenovirus (Ad) particle is relatively complex and may be
resolved into various substructures. The particle is the minimal structural or
functional unit of a virus. A virus can refer to a single particle, a stock of
particles
or a viral genome.
Penton: The terms "penton" or "penton complex" are preferentially used
herein to designate a complex of penton base and fiber. The term "penton" may
also be used to indicate penton base, as well as penton complex. The meaning
of
the term "penton" alone should be clear from the context within which it is
used.
Plasmid: An autonomous self-replicating extrachromosomal circular DNA
Post-transcriptional Regulatory Element (PRE) is a regulatory element found
in viral or cellular messenger RNA that is not spliced, i.e. intronless
messages.
Examples include, but are not limited to, human hepatitis virus, woodchuck
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
hepatitis virus, the TK gene and mouse histone gene. The PRE may be placed
before a polyA sequence and after a heterologous DNA sequence.
Pseudotyping: This term as generally used herein describes the production
of adenoviral vectors having modified capsid protein or capsid proteins from a
different serotype than the serotype of the vector itself. One example, is the
production of an adenovirus 5 vector particle containing a chimeric Ad3/Ad5
fiber
protein. This may be accomplished by producing the adenoviral vector in
packaging cell lines expressing different fiber proteins.
Promoter.' Useful promoters according to the present invention may be
inducible or constitutive. Inducible promoters will initiate transcription
only in the
presence of an additional molecule; constitutive promoters, on the other hand,
do
not require the presence of any additional molecule to regulate gene
expression.
A regulatable or inducible promoter may also be described as a promoter
wherein
the rate of RNA polymerase binding and initiation is modulated by external
stimuli.
Such stimuli include various compounds or compositions, light, heat, stress,
chemical energy sources, and the like. Inducible, suppressible and repressible
promoters are considered regulatable promoters.
Receptor: Receptor is a term used herein to indicate a biologically active
molecule that specifically binds to (or with) other molecules. The term
"receptor
protein" may be used to more specifically indicate the proteinaceous nature of
a
specific receptor.
Recombinant. As used herein, the term is intended to refer to any progeny
formed as the result of genetic engineering. This may also be used to describe
a
virus formed by recombination of plasmids in a packaging cell.
Transgene or Therapeutic Nucleotide Sequence: As described and claimed
herein, such a sequence includes DNA and RNA sequences encoding an RNA or
polypeptide. Such sequences may be "native" or naturally-derived sequences;
they may also be "non-native" or "foreign" sequences which are naturally- or
recombinantly-derived. The term "transgene," which may be used interchangeably
herein with the term "therapeutic nucleotide sequence," is often used to
describe a
heterologous or foreign (exogenous) gene that is carried by a viral vector and
transduced into a host cell.
Therefore, therapeutic nucleotide sequences may also include antisense
sequences or nucleotide sequences which may be transcribed into antisense
sequences. Therapeutic nucleotide sequences (or transgenes) further comprise
sequences which function to produce a desired effect in the cell or cell
nucleus
into which said therapeutic sequences are delivered. For example, a
therapeutic
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
_ 19_
nucleotide sequence may encode a functional protein intended for delivery into
a
cell which is unable to produce that functional protein.
Adenovirus
Fiber plays a crucial role in adenovirus infection by attaching the virus to a
specific receptor on the cell surface. The fiber is an elongated protein which
exists as a trimer of three identical polypeptides (polypeptide IV) of 582
amino
acids in length. An adenovirus fiber consists of three domains: an N-terminal
tail
domain that interacts with penton base; a shaft composed of variable numbers
of
repeats of a 15-amino-acid segment that forms beta-sheet and beta-bends; and a
knob at the C-terminus ("head domain") that contains the type-specific antigen
and
is responsible for binding to the cell surface receptor. The gene encoding the
fiber protein from Ad2 has been expressed in human cells and has been shown to
be correctly assembled into trimers, glycosylated and transported to the
nucleus.
(See, e.g., Hong and Engler, Virology 185: 758-761, 1991 ). Thus, alteration
of the
fiber in recombinant Ad vectors can lead to alteration in gene delivery. This
has
great utility for a variety of gene therapy applications and is one of the
objects of
the present invention.
Hexon, penton and fiber capsomeres are the major components on the
surface of the virion. Their constituent polypeptides, nos. II, III and IV,
contain
tyrosine residues that are exposed on the surface of the virion and can be
labeled
-- e.g., by iodination of intact particles.
The 35,000+ base pair (bp) genome of adenovirus type 2 has been
sequenced and the predicted amino acid sequences of the major coat proteins
(hexon, fiber and penton base) have been described. (See, e.g., Neumann et
al.,
Gene 69: 153-157 (1988); Herisse et al., Nuc. Acids Res. 9: 4023-4041 (1981 );
Roberts et al., J. Biol. Chem. 259: 13968-13975 (1984); Kinloch et al., J.
Biol.
Chem. 259: 6431-6436 (1984); and Chroboczek etal., Virol. 161: 549-554, 1987).
The sequence of Ad5 DNA was completed more recently; its sequence
includes a total of 35,935 bp. Portions of many other adenovirus genomes have
also been sequenced. It is presently understood that the upper packaging limit
for
adenovirus virions is about 105% of the wild-type genome length. (See, e.g.,
Bett,
et al., J. Virol. 67(10): 5911-21, 1993). Thus, for Ad2 and AdS, this would be
an
upper packaging limit of about 38kb of DNA.
Adenovirus DNA also includes inverted terminal repeat sequences (ITRs)
ranging in size from about 100 to 150 bp, depending on the serotype. The
inverted repeats enable single strands of viral DNA to circularize by base-
pairing
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 20-
of their terminal sequences, and the resulting base-paired "panhandle"
structures
required for replication of the viral DNA.
For efficient packaging, the ITRs and the packaging signal (a few hundred
by in length) comprise the "minimum requirement" for replication and packaging
of
a genomic nucleic acid into an adenovirus particle. Helper-dependent vectors
lacking all viral ORFs but including these essential cis elements (the ITRs
and
contiguous packaging sequence) have been constructed, but the virions package
less efficiently that the helper and package as multimers part of the time,
which
suggests that the virus may "want" to package a fuller DNA complement (see,
e.g.,
Fisher, et al., Virology 217 11-22, 1996).
The viral vectors of the present invention may retain their ability to express
the genome packaged within -- i.e., they may retain their "infectivity" --
they do not
act as infectious agents, however, to the extent that they cause disease in
the
subjects to whom they are administered for therapeutic purposes.
It is to be appreciated that Ad vectors have several distinct advantages
over other viral vectors in the art. For example, recombination of such
vectors is
rare; there are no known associations of human malignancies with adenoviral
infections despite common human infection with adenoviruses; the genome may
be manipulated to accommodate foreign genes of a fairly substantial size; and
host proliferation is not required for expression of adenoviral proteins.
An extension of this invention is that the Ad-derived viral vectors disclosed
herein may be used to target and deliver genes into specific cells by
incorporating
the attachment sequence for other receptors (such as CD4) onto the fiber
protein
by recombinant DNA techniques, thus producing a chimeric molecule. This should
result in the ability to target and deliver genes into a wide range of cell
types with
the advantage of evading recognition by the host's immune system. The within-
disclosed delivery systems thus provide for increased flexibility in gene
design to
enable gene delivery into proliferating and nonproliferating cell types.
For example, U.S. Patent Nos. 5,756,086 and 5,543,328 as well as,
W095/26412 and WO 98/44121 and Krasnykh, et al. (J. Virol. 70: 6839-46, 1996)
describe modifications that may be made to the adenovirus fiber protein. Such
modifications are useful in altering the targeting mechanism and specificity
of
adenovirus and could readily be utilized in conjunction with the constructs of
the
present invention to target the novel viral vectors disclosed herein to
different
receptors and different cells. Moreover, modifications to fiber protein which
alter
its tropism may permit greater control over the localization of viral vectors
in
therapeutic applications.
WO 00/42208 CA 02359795 2001-07-12 pC'T~P00/00265
- 21-
Similarly, incorporation of various structural proteins into cell lines of the
present invention, whether or not those proteins are modified, is also
contemplated by the present invention. Thus, for example, modified penton base
polypeptides such as those described in Wickham, et al. (J. Virol. 70: 6831-8,
1996) may have therapeutic utility when used according to the within-disclosed
methods.
While some of the Examples appearing below specifically recite fiber
proteins, polypeptides, and fragments thereof, it is expressly provided herein
that
other structural and non-structural Ad proteins and polypeptides (e.g.,
regulatory
proteins and polypeptides) may be used as components of the various disclosed
vectors and cell lines. Moreover, chimeric molecules comprised of proteins,
polypeptides, and/or fragments thereof which are derived from different Ad
serotypes may be used in any of the within-disclosed methods, constructs and
compositions. Similarly, recombinant DNA sequences of the present invention
may be prepared using nucleic acid sequences derived from different Ad
serotypes, in order to design useful constructs with broad applicability, as
disclosed and claimed herein.
It should also be appreciated that, while the members of Group C or Group
D adenovirus - i.e., Ad serotypes 1, 2, 5, 6 or 37 -- are specifically recited
in
various examples herein, the present invention is in no way limited to those
serotypes alone. In view of the fact that the adenovirus serotypes are all
closely-
related in structure and functionality, therapeutic viral vectors, packaging
cell
lines, and plasmids of the present invention may be constructed from
components
of any and all Ad serotypes -- and the within-disclosed methods of making and
using the various constructs and cell lines of the present invention apply to
all of
said serotypes.
The family of Adenoviridae includes many members with at least 47 known
serotypes of human adenovirus (Ad1-Ad47) (Shenk, Virology, Chapter 67, in
Fields et aL, eds. Lippincott-Raven, Philadelphia, 1996,) as well as members
of
the genus Mastadenovirus including human, simian, bovine, equine, porcine,
ovine, canine and opossum viruses, and members of the Aviadenovirus genus,
including bird viruses, e.g. CELO. Thus it is contemplated that the disclosed
inventions can be applied to any adenovirus species, and the invention need
not
be so limited. One of skill in the art would have knowledge of the different
adenoviruses as evidenced by (Shenk, Virology, Chapter 67, in Fields et al.,
eds.
Lippincott-Raven, Philadelphia, 1996,) which is herein incorporated by
reference.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 22-
Packaging Cell Lines A. Adenovirus Complementation Genetics
The first generation of recombinant adenoviral vectors currently available
typically have a deletion in the first viral early gene region which is
generally
referred to as E1, which comprises the E1 a and E1 b regions. (These regions
span genetic map units 1.30 to 9.24.) Figure 3 in chapter 67 of Fields
Virology,
3d Ed. (Fields et al. eds, Lippincott-Raven Publ., Philadelphia, 1996, p.
2116)
illustrates a transcription and translation map of adenovirus type 2 (Ad2).
Deletion of the viral E1 region renders the recombinant adenovirus
defective for replication and incapable of producing infectious viral
particles in
subsequently-infected target cells. Thus, to generate E1-deleted adenovirus
genome replication and to produce virus particles requires a system of
complementation which provides the missing E1 gene product. E1
complementation is typically provided by a cell line expressing E1, such as
the
human embryonic kidney packaging cell line, i.e. an epithelial cell line,
called 293.
Cell line 293 contains the E1 region of adenovirus, which provides E1 gene
region
products to "support" the growth of E1-deleted virus in the cell line (see,
e.g.,
Graham et al., J. Gen. Virol. 36: 59-71, 1977). Additionally, cell lines that
may be
usable for production of defective adenovirus having a portion of the
adenovirus
E4 region have been reported (WO 96/22378). Multiply deficient adenoviral
vectors and complementing cell lines have also been described (WO 95/34671,
U.S. Patent No. 5,994,106). Nevertheless, inherent problems exist concerning
first-generation recombinant adenoviruses.
B. Adenovirus Particle Packaging Cell Lines
Packaging cell lines disclosed herein support viral vectors with deletions of
major portions of the viral genome, without the need for helper viruses.
Additionally, the invention provides novel cell lines and helper viruses for
use with
helper-dependent vectors.
Thus, in one embodiment of the present invention, a packaging cell line is
disclosed having DNA sequences stably integrated into the cellular genome
wherein the DNA sequences encode one or more adenovirus regulatory and/or
structural polypeptides which complement the genes deleted or mutated in the
adenovirus vector genome to be replicated and packaged.
In another embodiment, the packaging cell line expresses one or more
adenovirus structural proteins, polypeptides, or fragments thereof, wherein
said
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
- 23-
structural protein is selected from the group consisting of penton base,
hexon,
fiber, polypeptide Illa, polypeptide V, polypeptide VI, polypeptide VII,
polypeptide
VIII, and biologically active fragments thereof.
In one variation, the sequences are constitutively expressed; in another,
one or more sequences is under the control of a regulatable promoter. In a
preferred embodiment expression is constitutive. In various preferred
embodiments, the polypeptides expressed by the DNA sequences are biologically
active.
In a further and preferred embodiment the packaging cell line of the present
invention supports the production of a viral vector. In a preferred embodiment
the
viral vector is a therapeutic vector.
The present invention also discloses a packaging cell line which
complements a viral vector having a deletion or mutation of a DNA sequence
encoding an adenovirus structural protein, regulatory polypeptides E1A and E1
B,
and/or one or more of the following regulatory proteins or polypeptides: E2A,
E2B, E3, E4, L4, or fragments thereof.
Various useful packaging cells are contemplated which complement
adenovirus. In one aspect of the present invention, each DNA sequence is
introduced into the genome of the within-disclosed cell lines via a separate
complementing plasmid. In other embodiments, two or more DNA sequences
were introduced into the genome via a single complementing plasmid. In one
variation, the complementing plasmid comprises a DNA sequence encoding
adenovirus fiber protein, polypeptide or fragment thereof. An example of a
useful
complementing plasmid according to the present invention is a plasmid having
the
characteristics of pCLF (for deposit details, see Example 3)
One embodiment discloses a packaging cell useful in the preparation of
recombinant adenovirus viral vectors comprising a delivery plasmid comprising
an
adenovirus genome lacking a nucleotide sequence encoding fiber. In one
variation, the delivery plasmid further comprises a nucleotide sequence
encoding
a foreign polypeptide. A preferred delivery plasmid is pDV44, pE1 B gal, or
pE1 spi B. In another variation, the cell further comprises a complementing
plasmid containing a nucleotide sequence encoding fiber, the plasmid being
stably
integrated into the cellular genome of the cell.
In one embodiment, a composition comprises a cell containing first and
second delivery plasmids wherein a first delivery plasmid comprises an
adenovirus genome lacking a nucleotide sequence encoding fiber and incapable
of directing the packaging of new viral particles in the absence of a second
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 24-
delivery plasmid, and a second delivery plasmid comprises an adenoviral genome
capable of directing the packaging of new viral particles in the presence of
the first
delivery plasmid.
In another variation, the first and second delivery plasmids interact within
the cell to produce a therapeutic viral vector. In yet another variation, the
cell
further comprises a complementing plasmid containing a nucleotide sequence
encoding fiber, the plasmid being stably integrated into the cellular genome
of the
cell. In still another, the first or second delivery plasmid further comprises
a
nucleotide sequence encoding a foreign polypeptide. In various embodiments,
the
polypeptide is a therapeutic molecule.
Another embodiment discloses a composition as before, wherein the first
delivery plasmid lacks adenovirus packaging signal sequences. In another
aspect, the second delivery plasmid contains a LacZ reporter construct. In
another variation, the second delivery plasmid further lacks a nucleotide
sequence
encoding an adenovirus regulatory protein. In one variation, the regulatory
protein
is E1. In one embodiment of the above-noted compositions, the complementing
plasmid has the characteristics of pCLF.
In another embodiment, a composition is disclosed wherein the first delivery
plasmid lacks a nucleotide sequence encoding an adenovirus structural protein
and the second delivery plasmid lacks a nucleotide sequence encoding
adenovirus E1 protein. In another, the first delivery plasmid lacks a
nucleotide
sequence encoding adenovirus E4 protein and the second delivery plasmid lacks
a nucleotide sequence encoding adenovirus E1 protein. In still another, the
cell
contains at least one complementing plasmid encoding an adenoviral regulatory
protein and a structural protein.
In one preferred variation of the present invention, a packaging cell line
expresses fiber protein. In one embodiment, the fiber protein has been
modified
to include a non-native amino acid residue sequence which targets a specific
receptor, but which does not disrupt trimer formation or transport of fiber
into the
nucleus. In another variation, the non-native amino acid residue sequence
alters
the binding specificity of the fiber for a targeted cell type. In still
another
embodiment, the structural protein is fiber comprising amino acid residue
sequences from more than one adenovirus serotype. As disclosed herein, the.
nucleotide sequences encoding fiber protein or polypeptide need not be
modified
solely at one or both termini; fiber protein -- and indeed, any of the
adenovirus
structural proteins, as taught herein -- may be modified "internally" as well
as at
the termini.
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
- 25-
In one variation, the non-native amino acid residue sequence is coupled to
the carboxyl terminus of the fiber. In yet another, the non-native amino acid
residue sequence further includes a linker sequence. Alternatively, the fiber
protein further comprises a ligand coupled to the linker. A suitable ligand
may be
selected from the group consisting of ligands that specifically bind to a cell
surface
receptor and ligands that can be used to couple other proteins or nucleic acid
molecules. Typically, any of the packaging cell lines of this invention may
have a
DNA sequence encoding all or part of a fiber protein -- including modified or
chimeric proteins -- stably integrated into the genome.
In various aspects of the present invention, a packaging cell line of the
present invention is derived from a procaryotic cell line; in another, it is
derived
from a eucaryotic cell line. While various embodiments suggest the use of
mammalian cells, and more particularly, epithelial cell lines, a variety of
other,
non-epithelial cell lines are used in various embodiments. Thus, while various
embodiments disclose the use of a cell line selected from the group consisting
of
293, A549, W 162, HeLa, Vero, 211, and 211 A cell lines, it is understood that
various other cell lines are likewise contemplated for use as disclosed
herein.
Therapeutic Viral Vectors and Related Systems
A. Nucleic Acid Segments
A therapeutic viral vector or composition of the present invention comprises
a nucleotide sequence, nucleic acid molecule or segment as described herein.
Typically, the nucleic acid molecule or molecule encodes a protein or
polypeptide
molecule -- or a biologically active fragment thereof -- which may be used for
therapeutic applications. A nucleotide sequence may further comprise an
enhancer element or a promoter located 3' or 5' to and controlling the
expression of
such a therapeutic nucleotide sequence or gene.
A subject nucleotide sequence consists of a nucleic acid molecule that
comprises at least 2 different operatively linked DNA segments. The DNA can be
manipulated and amplified by PCR as described herein and by using standard
techniques, such as those described in Molecular Cloning: A Laboratory Manual,
2nd Ed., Sambrook et al., eds., Cold Spring Harbor, New York (1989).
Typically, to
produce a nucleotide sequence of the present invention, the sequence encoding
the selected polypeptide and the promoter or enhancer are operatively linked
to a
DNA molecule capable of autonomous replication in a cell either in vivo or in
vitro.
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
- 26-
By operatively linking the enhancer element or promoter and the nucleotide
sequence to the vector, the attached segments are replicated along with the
vector
sequences.
Thus, a recombinant DNA molecule (rDNA) of the present invention is a
hybrid DNA molecule comprising at least 2 nucleotide sequences not normally
found together in nature. In various preferred embodiments, one of the
sequences
is a sequence encoding an Ad-derived polypeptide, protein, or fragment
thereof.
Stated another way, a nucleotide sequence of the present invention is one that
encodes an expressible protein, polypeptide or fragment thereof, and it may
further
include an active constitutive or regulatable (e.g. inducible) promoter
sequence.
A nucleotide sequence of the present invention is optimally from about 20
base pairs to about 40,000 base pairs in length. Preferably the nucleotide
sequence is from about 50 by to about 38,000 by in length. In various
embodiments, the nucleotide sequence is of sufficient length to encode one or
more adenovirus proteins or functional polypeptide portions thereof. Since
individual Ad polypeptides vary in length from about 19 amino acid residues to
about 967 amino acid residues, corresponding nucleotide sequences will range
from about 50 by up to about 3000 bp, depending on the number and size of
individual polypeptide-encoding sequences that are "replaced" in the viral
vectors
by therapeutic nucleotide sequences of the present invention.
1. Tripartite Leader (TPL) Nucleic Acid Sequences
In one aspect of the invention, it has been discovered that expression of
adenovirus late proteins such as the structural proteins in a packaging cell
line
according to the present invention is substantially improved when the
expression
cassette present on the complementing plasmid or in the packaging cell line's
genome contains an adenovirus tripartite leader (TPL) nucleic acid sequence.
Thus, the invention contemplates a nucleic acid molecule comprising a TPL
nucleotide sequence. Preferably, the TPL nucleotide sequence may be
operatively
linked to an intron containing RNA processing signals (such as for example,
splice
donor or splice acceptor sites) suitable for expression in the packaging cell
line.
Most preferably, the intron contains a splice donor site and a splice acceptor
site.
Alternatively, the TPL nucleotide sequence may not comprise an intron.
In one embodiment, a subject nucleic acid molecule of this invention is
isolated, i.e., separated from the genetic environment from which the
component
sequences were obtained. Thus, molecular cloning of fragments of a gene will
WO 00/42208 CA 02359795 2001-07-12 pC'T~P00/00265
- 27-
produce an isolated nucleic acid, as will the chemical synthesis of an
oligonucleotide to build a nucleic acid molecule.
The intron useful in the present invention is any nucleotide sequence which
functions in the packaging cell line to provide RNA processing signals, as are
well
known in the art, including splicing signals. Introns have been well
characterized
from a large number of structural genes, and therefor the invention should not
be
considered as limited. Well characterized and preferred introns include a
native
intron 1 from adenovirus, such as Ad5's TPL intron 1; others include the SV40
VP
intron; the rabbit beta-globin intron, and synthetic intron constructs. See,
for
example, Petitclerc et al., J. Biothechnol., 40:169, 1995, and Choi et al.,
Mol. Cell.
Biol., 11:3070, 1991.
The TPL nucleotide sequence comprises either (a) first and second TPL
exons or (b) first, second and third TPL exons, where each TPL exon in the
sequence is selected from the group consisting of complete TPL exon 1, partial
TPL exon 1, complete TPL exon 2 and complete TPL exon 3. A complete exon is
one which contains the complete nucleic acid sequence based on the sequence
found in the wild type viral genome. Preferably the TPL exons are from Ad2,
Ad3,
AdS, Ad7 and the like, however, they may come from any Ad serotype, as
described herein. A preferred partial TPL exon 1 is described in the Examples.
The use of a TPL with a partial exon 1 has been reported (W098/13499).
The intron and the TPL exons can be operatively linked in a variety of
configurations to provide a functional TPL nucleotide sequence, although in
some
embodiments of the invention, an intron may not be a part of the construct.
For
example, the intron can be positioned between any of TPL exons 1, 2 or 3, and
the
exons can be in any order of first and second, or first/second/third. The
intron can
also be placed preceding the first TPL exon or following the last TPL exon. In
a
preferred embodiment, complete TPL exon 1 is operatively linked to complete
TPL
exon 2 operatively linked to complete TPL exon 3. In a preferred variation,
adenovirus TPL intron 1 is positioned between complete TPL exon 1 and complete
TPL exon 2. It may also be possible to use analogous translational regulators
from
other viral systems such as rabiesvirus.
A preferred "complete" TPL nucleic acid molecule containing complete TPL
exons 1, 2 and 3 with adenovirus intron 1 inserted between exons 1 and 2 has a
nucleotide sequence shown in SEQ ID NO: 32. A preferred "partial" TPL nucleic
acid molecule containing partial TPL exon 1 and complete TPL exons 2 and 3 in
that order has a nucleotide sequence shown in SEQ ID NO: 26. The construction
of these preferred TPL nucleotide sequences is described in the Examples.
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 28-
Thus, preferred expression cassettes and complementing plasmids for
expressing adenovirus structural genes, particularly fiber protein, contain an
adenovirus TPt_ nucleotide sequence as described herein. Preferred packaging
cell lines containing the subject nucleic acid molecules also contain a TPL
nucleotide sequence of the invention.
2. Complementing Plasmids
The invention describes in a related embodiment nucleic acid molecules and
nucleotide sequences, typically in the form of DNA plasmid vectors, which are
capable of expression of an adenovirus structural protein or regulatory
protein.
Because these expression plasmids are used to complement the defective genes
of a recombinant adenovirus vector genome of this invention, the plasmids are
referred to as complementing or complementation plasmids.
The complementing plasmid contains an expression cassette, a nucleotide
sequence capable of expressing a protein product off the gene encoded by the
nucleotide sequence. Expression cassettes are described in more detail herein,
but typically contain a promoter and a structural gene operatively linked to
the
promoter and whose expression is controlled by the promoter. A preferred
complementing plasmid further includes a TPL nucleotide sequence described
herein to enhance expression of the structural gene product when used in the
context of adenovirus genome replication and packaging.
In one embodiment, a complementing plasmid comprises a promoter
nucleotide sequence operatively linked to a nucleotide sequence encoding an
adenovirus structural polypeptide. The adenovirus structural polypeptide is
selected from the group consisting of penton base; hexon; fiber; polypeptide
Illa;
polypeptide V; polypeptide VI; polypeptide VII; polypeptide VIII; and
biologically
active fragments thereof. In another variation, a complementing plasmid
further
comprises a nucleotide sequence encoding a first adenovirus regulatory
polypeptide, a nucleotide sequence encoding a second regulatory polypeptide, a
nucleotide sequence encoding a third regulatory polypeptide; or any
combination
of the foregoing.
The present invention also discloses a complementing plasmid comprising a
promoter nucleotide sequence operatively linked to a nucleotide sequence
encoding an adenovirus structural protein, polypeptide or fragment thereof and
a
nucleotide sequence encoding an adenovirus regulatory protein, polypeptide or
fragment thereof. In one variation, the early region polypeptide is E4; in
another,
WO 00/42208 CA 02359795 2001-07-12 pCT~, P00/00265
- 29-
the plasmid comprises pE4/Hygro. In still another variation, the early region
polypeptides are E1 and E4.
In another aspect of the present invention, the complementing plasmid used
to transform a cell line of the present invention further comprises a DNA
sequence
encoding an adenovirus regulatory protein, polypeptide or fragment thereof. In
one
variation, the regulatory protein is selected from the group consisting of
E1A, E1 B,
E2A, E2B, E3, E4 and L4 (also referred to as "the 100K protein"); an exemplary
complementing plasmid has the characteristics of is pE4/Hygro (for deposit
details,
see the Examples). In another aspect, the complementing plasmid used to
transform a cell line of the present invention further comprises a DNA
sequence
encoding two or more of the above mentioned adenovirus regulatory proteins,
polypeptides or fragments thereof.
Preferred complementing plasmids include pCLF, pDV60, pDV61, pDV67,
pDV69, pDV80, pDV90 and the like plasmids described in the Examples. The
nucleic acid sequence of particularly preferred complementing plasmids are
shown
in SEQ ID NO: 43 for pDV60, SEQ ID NO: 44 for pDV67, SEQ ID NO: 47 for
pDV69, SEQ ID NO: 64 for pDV80 and SEQ ID NO: 65 for pDV90.
3. Nucleic Acid Molecule Synthesis
A nucleic acid molecule comprising synthetic oligonucleotide sequences of
the present invention can be prepared using any suitable method, such as, the
phosphotriester or phosphodiester methods. See Narang et al., Meth. Enzymol.,
68:90, (1979); U.S. Patent No. 4,356,270; and Brown et al., Meth. Enzymol.,
68:109, (1979).
For oligonucleotide sequences in which a family of variants is preferred, the
synthesis of the family members can be conducted simultaneously in a single
reaction vessel, or can be synthesized independently and later admixed in
preselected molar ratios. For simultaneous synthesis, the nucleotide residues
that
are conserved at preselected positions of the sequence of the family member
can
be introduced in a chemical synthesis protocol simultaneously to the variants
by
the addition of a single preselected nucleotide precursor to the solid phase
oligonucleotide reaction admixture when that position number of the
oligonucleotide is being chemically added to the growing oligonucleotide
polymer.
The addition of nucleotide residues to those positions in the sequence that
vary
can be introduced simultaneously by the addition of amounts, preferably
equimolar
amounts, of multiple preselected nucleotide precursors to the solid phase
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 30-
oligonucleotide reaction admixture during chemical synthesis. For example,
where
all four possible natural nucleotides (A,T,G and C) are to be added at a
preselected position, their precursors are added to the oligonucleotide
synthesis
reaction at that step to simultaneously form four variants.
This manner of simultaneous synthesis of a family of related
oligonucleotides has been previously described for the preparation of
"Degenerate
Oligonucleotides" by Ausubel et al. (Current Protocols in Molecular Biology,
Suppl.
8. p.2.11.7, John Wiley & Sons, Inc., New York ,1991), and can readily be
applied
to the preparation of the therapeutic oligonucleotide compositions described
herein.
Nucleotide bases other than the common four nucleotides (A,T,G or C), or
the RNA equivalent nucleotide uracil (U), can also be used in the present
invention. For example, it is well known that inosine (I) is capable of
hybridizing
with A, T and G, but not C. Examples of other useful nucleotide analogs are
known
in the art and may be found referred to in 37 C.F.R. ~1.822.
Thus, where all four common nucleotides are to occupy a single position of
a family of oligonucleotides, that is, where the preselected nucleotide
sequence is
designed to contain oligonucleotides that can hybridize to four sequences that
vary
at one position, several different oligonucleotide structures are
contemplated. The
composition can contain four members, where a preselected position contains
A,T,G or C. Alternatively, a composition can contain two nucleotide sequence
members, where a preselected position contains I or C, and has the capacity
the
hybridize at that position to all four possible common nucleotides. Finally,
other
nucleotides may be included at the preselected position that have the capacity
to
hybridize in a non-destabilizing manner with more than one of the common
nucleotides ~n a manner similar to inosine.
Similarly, larger nucleic acid molecules can be constructed in synthetic
oligonucleotide pieces, and assembled by complementary hybridization and
ligation, as is well known.
B. Adenovirus Expression Vector Systems
One key component of the present invention for producing gene therapy
reagents comprised of recombinant adenovirus particles is the recombinant
adenovirus vector genome which is encapsulated in the virus particle and which
expresses exogenous genes in a gene therapy setting. Thus, the components of
an recombinant adenovirus vector genome include the ability to express
selected
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 31-
adenovirus structural genes, to express a desired exogenous protein, and to
contain sufficient replication and packaging signals that the genome is
packaged
into a gene delivery vector particle. The preferred replication signal is an
adenovirus inverted terminal repeat containing an adenovirus origin of
replication,
as is well known and described herein.
According to the present invention, a preferred recombinant adenovirus
vector genome is "helper independent" which means the genome can replicate and
be packaged without the help of a second, complementing helper virus. Instead,
the complementation is provided by a packaging cell line of the present
invention.
Additional embodiments of the invention, however, are drawn to a vector genome
referred to as "gutless" which is "helper dependent."
In a preferred embodiment, the adenovirus vector genome does not encode
a functional adenovirus fiber protein. A non-functional fiber gene refers to a
deletion, mutation or other modification to the adenovirus fiber gene such
that the
gene does not express any or insufficient adenovirus fiber protein to package
a
fiber-containing adenovirus particle without complementation of the fiber gene
by a
complementing plasmid or packaging cell line. Such a genome is referred to as
a
"fiberless" genome, not to be confused with a fiberless particle.
Alternatively, a
fiber protein may be encoded but is insufficiently expressed to result in a
fiber
containing particle.
Thus, the invention describes a helper-independent fiberless recombinant
adenovirus vector genome comprising genes which (a) express all adenovirus
structural gene products but express insufficient adenovirus fiber protein to
package a fiber-containing adenovirus particle without complementation of said
fiber gene, (b) express an exogenous protein, and (c) contains an adenovirus
packaging signal and inverted terminal repeats containing adenovirus origin of
replication.
The introduction of exogenous DNA into eucaryotic cells has become one of
the most powerful tools of the molecular biologist. The term "exogenous"
encompasses any therapeutic composition of this invention which is
administered
by the therapeutic methods of this invention. Thus, "exogenous" may also be
referred to herein as "foreign," "non-native," and the like. The methods of
this
invention preferably require efficient delivery of the DNA into the nucleus of
the
recipient cell and subsequent identification of cells that are expressing the
foreign
DNA.
The adenovirus vector genome is propagated in the laboratory in the form of
rDNA plasmids containing the genome, and upon introduction into an appropriate
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 32-
host, the viral genetic elements provide for viral genome replication and
packaging
rather than plasmid-based propagation. Exemplary methods for preparing an Ad-
vector genome are described in the Examples.
A widely-used plasmid is pBR322, a vector whose nucleotide sequence and
endonuclease cleavage sites are well known. Various other useful plasmid
vectors are described in the Examples that follow.
A nucleic acid vector of the present invention comprises a nucleic acid
(preferably DNA) molecule capable of autonomous replication in a cell and to
which a DNA segment, e.g., a gene or polynucleotide, can be operatively linked
so
as to bring about replication of the attached segment. In the present
invention, one
of the nucleotide segments to be operatively linked to vector sequences
encodes at
least a portion of a therapeutic nucleic acid molecule -- in effect, a nucleic
acid
sequence that encodes one or more therapeutic proteins or polypeptides, or
fragments thereof.
As one of skill in the art will note, in various embodiments of the present
invention, different "types" of vectors are disclosed. For example, one "type"
of
vector is used to deliver particular nucleotide sequences into a packaging
cell line,
with the intent of having said sequences stably integrate into the cellular
genome;
these "types" of vectors are generally identified herein as complementing
plasmids.
A further "type" of vector described herein carries or delivers nucleotide
sequences
in or into a cell line (e.g., a packaging cell line) for the purpose of
propagating
therapeutic viral vectors of the present invention; hence, these vectors are
generally referred to herein as delivery plasmids. A third "type" of vector
described
herein is utilized to carry nucleotide sequences encoding therapeutic proteins
or
polypeptides to specific cells or cell types in a subject in need of
treatment; these
vectors are generally identified herein as therapeutic viral vectors or Ad-
derived
vectors and are in the form of a virus particle encapsulating a viral nucleic
acid
containing an expression cassette nucleic acid sequence for expressing the
therapeutic gene.
1. Nucleic Acid Gene Expression Cassettes
In various embodiments, a peptide-coding sequence of the therapeutic gene
is inserted into an expression vector and expressed; however, it is also
feasible to
construct an expression vector which also includes some non-coding sequences
as
well. Preferably, however, non-coding sequences are excluded. Alternatively, a
nucleotide sequence for a soluble form of a polypeptide may be utilized.
Another
preferred therapeutic viral vector includes a nucleotide sequence encoding at
least
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 33-
a portion of a therapeutic nucleotide sequence operatively linked to the
expression
vector for expression of the coding sequence in the therapeutic nucleotide
sequence.
As used herein with regard to DNA sequences or segments, the phrase
"operatively linked" generally means the sequences or segments have been
covalently joined into one piece of DNA, whether in single or double stranded
form.
The choice of viral vector into which a therapeutic nucleotide sequence of
this invention is operatively linked depends directly, as is well known in the
art, on
the functional properties desired, e.g., vector replication and protein
expression,
and the host cell to be transformed -- these being limitations inherent in the
art of
constructing recombinant DNA molecules. Although certain adenovirus serotypes
are recited herein in the form of specific examples, it should be understood
that the
present invention contemplates the use of any adenovirus serotype, including
hybrids and derivatives thereof. As one will observe, it is not unusual or
outside
the scope of the present invention to utilize nucleotide and/or amino acid
residue
sequences of two or more serotypes in constructs, compositions and methods of
the invention.
A translatable nucleotide sequence is a linear series of nucleotides that
provide an uninterrupted series of at least 8 codons that encode a polypeptide
in
one reading frame. Preferably, the nucleotide sequence is a DNA sequence. The
vector itself may be of any suitable type, such as a viral vector (RNA or
DNA),
naked straight-chain or circular DNA, or a vesicle or envelope containing the
nucleic acid material and any polypeptides that are to be inserted into the
cell.
2. Promoters
As noted elsewhere herein, an expression nucleic acid in an Ad-derived
vector of the present invention may also include a promoter sequence.
In general, promoters are DNA segments that contain a DNA sequence that
controls the expression of a gene located 3' or downstream of the promoter.
The
promoter is the DNA sequence to which RNA polymerase specifically binds and
initiates RNA synthesis (transcription) of that gene, typically located 3' of
the
promoter: A promoter also includes DNA sequences which direct the initiation
of
transcription, including those to which RNA polymerase specifically binds. If
more
than one nucleic acid sequence encoding a particular polypeptide or protein is
included in a therapeutic viral vector or nucleotide sequence, more than one
promoter or enhancer element may be included, particularly if that would
enhance
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 34-
efficiency of expression. For purposes of the present invention, regulatable
(inducible) as well as constitutive promoters may be used, either on separate
vectors or on the same vector.
Both constitutive and regulatable (often called "inducible") promoters are
useful in constructs and methods of the present invention. For example, some
useful regulatable promoters are those of the CREB-regulated gene family and
include inhibin, gonadotropin, cytochrome c, glucagon, and the like. (See,
e.g.,
published International App. No. W096/14061.
A regulatable or inducible promoter may be described as a promoter
wherein the rate of RNA polymerase binding and initiation is modulated by
external
stimuli. (See U.S. Patent Nos. 5,750,396 and 5,998,205). Such stimuli include
various compounds or compositions, light, heat, stress, chemical energy
sources,
and the like. Inducible, suppressible and repressible promoters are considered
regulatable promoters.
Regulatable promoters may also include tissue-specific promoters. Tissue-
specific promoters direct the expression of the gene to which they are
operably
linked to a specific cell type. Tissue-specific promoters cause the gene
located 3'
of it to be expressed predominantly, if not exclusively, in the specific cells
where
the promoter expressed its endogenous gene. Typically, it appears that if a
tissue-specific promoter expresses the gene located 3' of it at all, then it
is
expressed appropriately in the correct cell types (see, e.g., Palmiter et al.,
Ann.
Rev. Genet. 20: 465-499, 1986).
When a tissue-specific promoter controls the expression of a gene, that
gene will be expressed in a small number of tissues or cell types rather than
in
substantially all tissues and cell types. Examples of tissue-specific
promoters
include the immunoglobulin promoter described by Brinster et al., Nature 306:
332-336 (1983) and Storb et al.; Nature 310: 238-231 (1984); the elastase-I
promoter described by Swift et al., Cell 38: 639-646 (1984); the globin
promoter
described by Townes et al., Mol. Cell. Biol. 5: 1977-1983 (1985), and Magram
ef
al., Mol. Cell. Biol. 9: 4581-4584 (1989), the insulin promoter described by
Bucchini
et al., PNAS USA, 83: 2511-2515 (1986) and Edwards et al., Cell 58: 161
(1989);
the immunoglobulin promoter described by Ruscon et al., Nature 314: 330-334
(1985) and Grosscheld et al., Cell 38: 647-658 (1984); the alpha actin
promoter
described by Shani, MoL Cell. Biol. 6: 2624-2631 (1986); the alpha crystalline
promoter described by Overbeek et al., PNAS USA 82: 7815-7819 (1985); the
prolactin promoter described by Crenshaw et al., Genes and Development 3:
959-972 (1989); the propiomelanocortin promoter described by Tremblay et al.,
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 35-
PNAS USA 85: 8890-8894 (1988); the beta-thyroid stimulating hormone (BTSH)
promoter described by Tatsumi et al., Nippon Rinsho 47: 2213-2220 (1989); the
mouse mammary tumor virus (MMTV) promoter described by Muller et al., Cell 54:
105 (1988); the albumin promoter described by Palmiter et al., Ann. Rev.
Genet.
20: 465-499 (1986); the keratin promoter described by Vassar et al., PNAS USA
86: 8565-8569 (1989); the osteonectin promoter described by McVey et al., J.
Biol.
Chem. 263: 11,111-11,116 ( 1988); the prostate-specific promoter described by
Allison et al., Mol. Cell. Biol. 9: 2254-2257 (1989); the opsin promoter
described by
Nathans et al., PNAS USA 81: 4851-4855 (1984); the olfactory marker protein
promoter described by Danciger et al., PNAS USA 86: 8565-8569 (1989); the
neuron-specific enolase (NSE) promoter described by Forss-Pelter et al., J.
Neurosci. Res. 16: 141-151 (1986); the L-7 promoter described by Sutcliffe,
Trends
in Genetics 3: 73-76 (1987) and the protamine 1 promoter described Peschon et
al., Ann. Ne~nr York Acad. Sci. 564: 186-197 (1989) and Braun et al., Genes
and
Development 3: 793-802 (1989).
3. Adenovirus Vectors
Although adenovirus consists of many proteins, not all adenovirus proteins
are required for assembly of a recombinant adenovirus particle (vector) of
this
invention. Thus, deletion of the appropriate genes from a recombinant Ad
vector as
taught herein will thus allow the vector to accommodate even larger "foreign"
DNA
segments. Thus, if the sequences encoding one or more adenovirus polypeptides
or proteins are supplanted by a recombinant nucleotide sequence of the present
invention, the length of the recombinant sequence can conceivably extend
nearly
to the packaging limit of the relevant adenovirus-derived vector.
In view of the fact that preferred embodiments disclosed herein are helper-
independent Ad-derived vectors, the entire wild-type Ad genome cannot be
completely supplanted by recombinant nucleic acid molecules without
transforming
such a vector into a vector requiring "help" of some kind. However, most of
the Ad-
derived vectors of the present invention do not depend on a helper virus;
instead,
the vectors of the present invention are propagated in cell lines stably
expressing
proteins or polypeptides that have been removed from said vectors to allow the
addition of "foreign" DNA into the vectors. In various disclosed embodiments,
specific early region and structural polypeptides are deleted from the vectors
of the
present invention, thereby enabling the vectors to accommodate recombinant
nucleic acid sequences (or cassettes) of various lengths. For example, Ad-
derived
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 36-
vectors of the present invention may easily include 12 kb or more of foreign
(or
"therapeutic") DNA sequences.
Thus, adenovirus viral vectors are also disclosed which comprise nucleotide
sequences encoding a packaging signal and a foreign protein or polypeptide,
wherein the nucleotide sequence encoding an adenovirus structural protein has
been deleted.
In one variation, the nucleotide sequence encoding the foreign protein or
polypeptide is a DNA molecule up to about 3 kb in length; in another, the
nucleotide sequence encoding the foreign protein or polypeptide is a DNA
molecule up to about 9.5 kb in length; in still another, the nucleotide
sequence
encoding the foreign protein or polypeptide is a DNA molecule up to about 12.5
kb
in length. Nucleotide sequences of intermediate lengths are also contemplated
by
the present invention, as are sequences in excess of 12.5 kb.
The invention also discloses viral vectors wherein the sequence encoding a
foreign protein or polypeptide is a sequence encoding an anti-tumor agent, a
tumor
suppressor protein, a suicide protein, or a fragment or functional equivalent
thereof. In one variation, nucleotide sequences encoding one or more
regulatory
proteins have also been deleted from the vector. In another, the regulatory
proteins are selected from the group consisting of E1A, E1 B, E2A, E2B, E3,
E4,
and L4 (100K protein).
A wide variety of therapeutic viral vectors are also embodiments of the
present invention. In one embodiment, a therapeutic viral vector is disclosed
which
lacks a DNA sequence encoding fiber protein, or a portion thereof. In another
variation, a therapeutic viral vector may further or alternatively comprise
deletion of
a DNA sequence encoding one or more regulatory proteins, polypeptides, or
fragments thereof. In various embodiments, foreign DNA sequences are inserted
in place of the DNA sequence encoding fiber protein in the viral vectors of
the
present invention. In other embodiments, the therapeutic viral vectors further
comprise foreign DNA sequences inserted in place of the DNA sequences
encoding one or more regulatory proteins, polypeptides, or fragments thereof,
and/or one or more structural proteins, polypeptides, or fragments thereof.
The present invention further discloses a number of viral vectors. In one
variation, a viral vector comprises a deletion or mutation of a DNA sequence
encoding an adenovirus structural protein, polypeptide, or fragment thereof. A
vector may further comprise deletion or mutation of the DNA sequences encoding
regulatory polypeptides E1 A and E1 B; and it may still further comprise
deletion or
mutation of the DNA sequence encoding one or more of the following regulatory
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 37-
proteins or polypeptides: E2A, E2B, E3, E4, L4, or fragments thereof. In
another
variation, in a viral vector of the present invention, the structural protein
comprises
fiber. Any combination of the foregoing is also contemplated by the present
invention. The viral vectors of the present invention are suitable for the
preparation of pharmaceutical compositions comprising any of the therapeutic
viral
vectors disclosed herein -- including combinations thereof -- are also
disclosed
herein. A further use of the viral vectors of the present invention is for
targeting
specific cells in a cell population comprising different cell types.
Yet another variation discloses that a foreign DNA sequence encoding one
or more foreign proteins, polypeptides or fragments thereof has been inserted
in
place of any of the deletions in the therapeutic viral vector. In one
embodiment,
the foreign DNA encodes a tumor-suppressor protein or a biologically active
fragment thereof. In another embodiment, the foreign DNA encodes a suicide
protein or a biologically active fragment thereof.
The invention further contemplates that a viral vector comprises a foreign
DNA sequence encoding one or more foreign proteins, polypeptides or fragments
thereof wherein said DNA sequence has been inserted in place of any structural
and/or regulatory proteins (or portions thereof) that have been deleted. Thus,
in
one embodiment, the foreign DNA encodes a therapeutic molecule such as a
tumor-suppressor protein; a suicide protein; a cystic fibrosis transmembrane
conductance regulator (CFTR) protein; or a biologically active fragment of any
of
them.
The therapeutic (or foreign) nucleotide sequence can be a gene or gene
fragment that encodes a protein or polypeptide -- or a biologically active
fragment
thereof. (See, e.g., Crystal, et al., Nature Genetics 8: 42-51 (1994); Zabner,
et al.,
Cell 75: 207-216 (1993); Knowles, et al., NEJM 333(13): 823-831 (1995); and
Rosenfeld, et al., Cell 68: 143-155 (1992).
It is further contemplated that a therapeutic protein or polypeptide
expressed by a therapeutic viral vector of the present invention may be used
in
conjunction with another therapeutic agent when appropriate -- e.g., a
thymidine
kinase metabolite may be used in conjunction with the gene encoding thymidine
kinase and its gene product -- in order to be even more effective.
Alternatively, a therapeutic viral vector can include a DNA or RNA
oligonucleotide sequence that exhibits therapeutic activity without needing to
be
translated into a polypeptide product before exerting a therapeutic effect.
Examples of the latter include antisense oligonucleotides that will inhibit
the
transcription of deleterious genes or ribozymes that act as site-specific
WO 00/42208 CA 02359795 2001-07-12
PCT/EP00/00265
- 38-
ribonucleases for cleaving selected mutated gene sequences. In another
variation,
a therapeutic nucleotide sequence of the present invention may comprise a DNA
construct capable of generating therapeutic nucleotide molecules, including
ribozymes and antisense DNA, in high copy numbers in target cells, as
described
in published PCT application No. WO 92/06693 (the disclosure of which is
incorporated herein by reference). Other preferred therapeutic nucleotide
sequences according to the present invention are capable of delivering HIV
antisense oligonucleotides to latently-infected T cells via CD4. Similarly,
delivery
of Epstein-Barr Virus (EBV) EBNa-1 antisense oligonucleotides to B cells via
CR2
is capable of effecting therapeutic results.
A preferred recombinant adenovirus vector genome is based on the vector
described in the Examples and designated AdS.~igaI.OF. This vector is a helper
independent, fiberless vector genome which can host, upon insertion, an
exogenous gene for expression of an exogenous or therapeutic protein. The
genome of AdS.~igaI.OF has a nucleotide sequence shown in SEQ ID NO: 27. A
virus particle containing AdS.~gaI.OF vector genome has been prepared as
described in the Examples and is deposited with the ATCC as Accession No. VR-
2636
The Ad5.~3gaI.OF genome nucleic acid can be manipulated to contain any
exogenous gene in place of the beta-galactosidase gene present in the
construct,
as described herein.
Construction of Therapeutic Viral Vectors for Gene Delivery
A. Adenovirus Particles
Various methods of making and using the vectors, plasmids, cell lines and
other compositions and constructs of the present invention are also disclosed
herein. The following methods are considered exemplary and not limiting.
Thus, in one variation, the invention discloses a method of constructing
therapeutic viral vectors, comprising introducing a delivery plasmid into an
Ad fiber-
expressing complementing cell line, wherein the DNA sequence encoding Ad fiber
protein has been deleted from the delivery plasmid. In one variation, the
delivery
plasmid further includes a DNA sequence encoding a foreign protein,
polypeptide,
or fragment thereof. In other embodiments, a combination of pDV44 and
p~E1 B~3gal or a similar construct such as, for example, that found in pDV44,
p0E1 B~3gal or the equivalent.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 39-
A recombinant adenovirus particle may be produced with a fiber protein, or it
may be produced without a fiber protein ("fiberless particle") according to
the
present invention. Where the particle is made without fiber, such as by
passaging
the fiberless viral vector genome, e.g., AdS.~igaI.OF in the 293 cells, a
fiberless
genome is replicated and packaged in a fiberless particle. In contrast, where
the
fiberless genome Ad5.~3gaI.OF is passaged in the 211 B or other fiber
expressing
cells, a fiberless genome is replicated and packaged into a fiber-containing
particle.
Recombinant adenovirus particles may be made such that they include no
fiber proteins, modified fiber proteins or other exogenous proteins. They may
also
be produced in systems using either helper-independent or helper-dependent
adenovirus recombinant genomes, i.e. with or without helper viruses.
B. Targeting of Particles to Tissues - Virus Trophism
A preferred viral vector particle in which therapeutic nucleotide compositions
of this invention are present is derived from adenovirus (Ad). As taught
herein,
viral vector particles of this invention may be designed and constructed in
such a
way that they specifically target a preselected recipient cell type, depending
on the
nature of therapy one seeks to administer. Methods of making and using
therapeutic viral vectors that target specific cells are further described in
the
Examples that follow.
Novel vectors, viral particles or compositions may also be designed and
prepared to preferentially target cells that might not otherwise be targeted
by wild-
type adenovirus virions. For example, in order to target non-epithelial cells,
one
following the teachings of the present _ specification may be able to prepare
a
therapeutic vector particle including a nucleotide sequence encoding a foreign
protein, polypeptide or other ligand directed to a non-epithelial cell or to a
different
receptor than that generally targeted by a particular adenovirus. Examples of
useful ligands directed to specific receptors (identified in parentheses)
include the
V3 loop of HIV gp120 (CD4); transferring (transferrin receptor); LDL,
apolipoprotein
B100, apolipoprotein E (LDL receptors); and deglycosylated proteins
(asialoglycoprotein receptor). Various useful ligands which may be added to
adenovirus fiber -- and methods for preparing and attaching same -- are set
forth in
U.S. Patent Nos. 5,756,086 and 5,543,328.
In yet another embodiment, the non-native amino acid residue sequence is
incorporated into the fiber amino acid residue sequence at a location other
than
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 40-
one of the fiber termini. Alternatively, the non-native amino acid residue
sequence
alters the binding specificity of the fiber for a targeted cell type. In other
embodiments, the linker sequence alters the binding specificity of the fiber
for a
targeted cell type. The expressed fiber may, in various embodiments, bind to a
specific targeted cell type not usually targeted by adenovirus and/or may
comprise
amino acid residue sequences from more than one adenovirus serotype.
Useful ligands may be encoded by a foreign nucleotide sequence contained
within a viral vector of the present invention, or may be linked to proteins
or
polypeptides, include antibodies and attachment sequences, as well as
receptors
themselves. For example, antibodies to cell receptor molecules such as
integrins
and the like, MHC Class I and Class II, asialoglycoprotein receptor,
transferrin
receptors, LDL receptors, CD4, and CR2 are but a few which are useful
according
to the present invention. It is also understood that the ligands typically
bound by
receptors, as well as analogs to those ligands, may be used as cellular
targeting
agents, as disclosed herein.
Therapeutic Methods
The recombinant adenovirus vectors of the present invention, typically in the
form of an adenovirus particle encapsulating a recombinant adenovirus vector
genome containing an expression cassette for expressing a therapeutic gene,
are
particularly suited for gene therapy. Thus, various therapeutic methods are
contemplated by the present invention.
For example, it has now been discovered that Ad-derived viral vectors are
capable of delivering a therapeutic nucleotide sequence to a specific cell or
tissue,
based on the tissue tropism of the particle, thereby expanding and enhancing
treatment options available in numerous conditions in which more conventional
therapies are of limited efficacy. Accordingly, methods of gene therapy
utilizing a
recombinant adenovirus particle containing a modified fiber or chimeric fiber
which
targets a preselected tissue, as described herein, is within the scope of the
invention. Vector particles are typically purified and then an effective
amount is
administered in vivo or ex vivo (in vitro)into the subject.
For in vitro or ex vivo gene transfer, administration is often accomplished by
first isolating a selected cell population from a patient such as lung
epithelial cells,
lymphocytes and the like followed by in vitro or ex vivo gene transfer of the
therapeutic compositions of this invention and the replacement of the cells
into the
patient. In vivo therapy is also contemplated, e.g., via the administration of
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 41-
therapeutic compositions of this invention by various delivery means. For
example,
aerosol administration and administration via subcutaneous, intravenous,
intraperitoneal, intramuscular, ocular means and the like are also within the
scope
of the present invention.
Other gene-delivery methods are also useful in conjunction with the
methods, compositions and constructs of the present invention; see, e.g.,
published International Application No. WO 95/11984.
The present invention also contemplates various methods of targeting
specific cells -- e.g., cells in a subject in need of diagnosis and/or
treatment. As
discussed herein, the present invention contemplates that the viral vectors
and
compositions of the present invention may be directed to specific receptors or
cells,
for the ultimate purpose of delivering those vectors and compositions to
specific
cells or cell types. The viral vectors and constructs of the present invention
are
particularly useful in this regard.
In general, adenovirus attachment and uptake into cells are separate but
cooperative events that result from the interaction of distinct viral coat
proteins with
a receptor for attachment and av integrin receptors for internalization.
Adenovirus
attachment to the cell surface via the fiber coat proteins has been discovered
to be
dissociable and distinct from the subsequent step of internalization, and the
present invention is able to take advantage of and function in conjunction
with
these differing receptors.
The invention also discloses methods of transforming a pathologic
hyperproliferative mammalian cell comprising contacting the cell with any of
the
vectors described herein. In another embodiment, methods of infecting a
mammalian target cell with a viral vector containing a preselected foreign
nucleotide sequence are disclosed. One such variation comprises the following
steps: (a) infecting the target cell with a viral vector of the present
invention, the
viral vector carrying a preselected foreign nucleotide sequence; and (b)
expressing
the foreign nucleotide sequence in the targeted cell.
The invention also encompasses mammalian target cells infected with a
preselected foreign nucleotide sequence produced by the methods disclosed
herein. In one variation, the target cells are selected from the group
consisting of
replicating, slow-replicating and non-replicating human cells.
Methods of treating an acquired or hereditary disease are also disclosed.
One method comprises (a) administering a pharmaceutically acceptable dose of a
viral vector to a target cell, wherein the vector comprises a preselected
therapeutic
nucleotide sequence; and (b) expressing the therapeutic sequence in the target
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
- 42-
cell for a time period sufficient to ameliorate the acquired or hereditary
disease in
the cell. Method of gene therapy comprising administering to a subject an
effective
amount of a therapeutic viral vector produced by a packaging cell line of the
present invention are also disclosed.
Also contemplated by the present invention are various methods of inhibiting
the proliferation of a tumor in a subject comprising administering an
effective
amount of a therapeutic viral vector of the present invention under suitable
conditions to the subject. In one variation, the gene encodes an anti-tumor
agent.
In another variation, the agent is a tumor-suppressor gene. In still another
embodiment, the agent is a suicide gene or a functional equivalent thereof. In
another variation, the vector is administered via intra-tumoral injection.
A composition of this invention may be used prophylactically or
therapeutically in vivo to disrupt HIV infection and mechanisms of action by
inhibiting gene expression or activation, via delivery of antisense HIV
sequences or
ribozymes to T cells or monocytes. Using methods of the present invention, one
may target therapeutic viral vectors as disclosed herein to specific cells and
tissues, including hematopoietic cells, as infection of such cells appears to
be
mediated by distinct integrins to which viral vectors of the present invention
may
readily be targeted. (See, e.g., Huang, et al., J. Virol. 70: 4502-8, 1996).
Other useful therapeutic nucleotide sequences include antisense nucleotide
sequences complementary to EBV EBNa-1 gene. Use of such therapeutic
sequences may remediate or prevent latent infection of B cells with EBV. As
discussed herein and in the Examples below, targeting and delivery may be
accomplished via the use of various ligands, receptors, and other appropriate
targeting agents.
Thus, in one embodiment, a therapeutic method of the present invention
comprises contacting the cells of a subject infected with EBV or HIV with a
therapeutically effective amount of a pharmaceutically acceptable composition
comprising a therapeutic nucleotide sequence of this invention. In a related
embodiment, the contacting involves introducing the therapeutic nucleotide
sequence composition into cells having an EBV or HIV-mediated infection.
Methods of gene therapy are well known in the art (see, e.g., Larrick and
Burck, Gene Therapy: Application of Molecular Biology, Elsevier Science Publ.
Co., Inc., New York, NY (1991 ); Kriegler, Gene Transfer and Expression: A
Laboratory Manual, W. H. Freeman and Company, New York, 1990). The term
"subject" should be understood to include any animal -- particularly mammalian
--
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 43-
patient, such as any murine, rat, bovine, porcine, canine, feline, equine,
ursine, or
human patient.
When the foreign gene carried in the vector encodes a tumor suppressor
gene or another anti-tumor protein, the vector is useful to treat or reduce
hyperproliferative cells in a subject, to inhibit tumor proliferation in a
subject or to
ameliorate a particular, related pathology.
The present invention also contemplates methods of depleting suitable
samples of pathologic mammalian hyperproliferative cells contaminating
hematopoietic precursors during bone marrow reconstitution via the
introduction of
a wild-type tumor suppressor gene into the cell preparation using a vector of
this
invention. As used herein, a suitable sample is defined as a heterogeneous
cell
preparation obtained from a patient, e.g., a mixed population of cells
containing
both phenotypically normal and pathogenic cells.
Administration includes -- but is not limited to -- the introduction of
therapeutic agents of the present invention into a cell or subject via various
means,
including direct injection, intravenously, intraperitoneally, via intra-tumor
injection,
via aerosols, or topically. Therapeutic agents as disclosed herein may also be
combined for administration of an effective amount of the agents with a
pharmaceutically-acceptable carrier, as described herein.
As used herein, "effective amount" generally means the amount of vector
particle (or proteins produced/released thereby) which achieves a positive
outcome
in the subject to whom the vector is administered. The total volume
administered
will necessarily vary depending on the mode of administration, as those of
skill in
the relevant art will appreciate, and dosages may vary as well.
The dose of a biologic vector (particle) is somewhat complex and may be
described in terms of the concentration (in plaque-forming units per
milliliter
(pfu/ml)), the total dose (in pfus), or the estimated number of particles
administered
per cell (the estimated multiplicity of infection or MOI). Thus, if a vector
is
administered via infusion -- say, across nasal epithelium -- at a constant
total
volume, the respective concentration, etc. may be described as follows:
W~ 00/42208 CA 02359795 2001-07-12
PCT/EP00/00265
- 44-
In general, when recombinant adenoviral vector particles are administered
via infusion across the nasal epithelium (e.g. an area of nasal epithelium
containing 2 x 10' cells,) administered amounts producing an estimated MOI
(multiplicity of infection) of about 10 or greater are much more effective
than lower
Concentration Volume Dose Estimated
fu/ml ml ~fu~ MOI
107 2 2 x 107 1
108 2 2 x 108 10
109 2 2 x 109 100
1010 2 2 x 1010 1000
Table 2
dosages. (See, e.g., Knowles, et al., New Eng. J. Med. 333: 823-831, 1995).
Similarly, when direct injection is the preferred treatment modality -- e.g.,
direct
injection of a viral vector into a tumor -- doses of 1 x 109 pfu or greater
are
generally preferred. (See, e.g., published International App. No. W095/11984.)
Thus, depending on the mode of administration, an effective amount
administered in a single dose preferably contains from about 106 to about 1015
infectious units. A typical course of treatment would be one such dose per day
over a period of five days. As those of skill in the art will appreciate, an
effective
amount may vary depending on (1) the pathology or other condition to be
treated,
(2) the status and sensitivity of the patient, and (3) various other factors
well known
to those of skill in the art, such as the patient's tolerance to other courses
of
treatment that may have been applied previously. Thus, those of skill in the
art
may easily and precisely determine effective amounts of the agents/vectors of
the
present invention which may be administered to a particular patient, based on
their
understanding of and evaluation of such factors.
The present invention also contemplates methods of ameliorating
pathologies characterized by hyperproliferative cells or genetic defects in a
subject,
by administering to the subject an effective amount of a vector as described
herein.
Such vectors preferably contain a foreign gene encoding a gene product (e.g.
polypeptide or protein) having the ability to ameliorate the pathology, under
suitable conditions. As used herein, the term "genetic defect" means any
disease,
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 45-
condition or abnormality which results from inherited factors, e.g.
Huntington's
Disease, Tay-Sachs Disease, or Sickle Cell Disease.
The present invention further provides methods for reducing the proliferation
of tumor cells in a subject by introducing into the tumor mass an effective
amount of
an adenoviral expression vector containing an anti-tumor gene other than a
tumor
suppressor gene. The anti-tumor gene can encode, for example, thymidine kinase
(TK). An effective amount of a therapeutic agent is then administered to the
subject; the therapeutic agent, in the presence of the anti-tumor gene, is
toxic to
the cell.
Using thymidine kinase as exemplary, the therapeutic agent is a thymidine
kinase metabolite such as ganciclovir (GCV), 6-methoxypurine arabinonucleoside
(araM), or a functional equivalent thereof. Both the thymidine kinase gene and
the
thymidine kinase substrate must be used concurrently in order to exert a toxic
effect on the host cell. In the presence of the TK gene, GCV is phosphorylated
and
becomes a potent inhibitor of DNA synthesis, whereas araM is converted to the
cytotoxic anabolite araATP. Thus, the precise method of action or synergism is
not
relevant to therapeutic efficacy; what is relevant is the fact that the
concurrent use
of appropriate genes and therapeutic agents may effectively ameliorate a
specific
disease condition.
Another useful example contemplates use of a vector of the present
invention which expresses the enzyme cytosine deaminase. Such a vector could
be used in conjunction with administration of the drug 5-fluorouracil (Austin
and
Huber, Mol. Pharm. 43: 380-387, 1993) or the recently-described E. coli Deo
gene
in combination with 6-methyl-purine-2'-deoxyribonucleoside (Sorscher et al.,
Gene
Therapy 1: 233-238, 1994).
As with the use of the tumor suppressor genes described previously, the use
of other anti-tumor genes, either alone or in combination with the appropriate
therapeutic agent, provides a treatment for the uncontrolled cell growth or
proliferation characteristic of tumors and malignancies. Thus, the present
invention
provides therapies to halt the uncontrolled cellular growth in a patient,
thereby
alleviating the symptoms or the disease or cachexia present in the patient.
The
effect of this treatment includes, but is not limited to, prolonged survival
time of the
patient, reduction in tumor mass or burden, apoptosis of tumor cells, or the
reduction in the number of circulating tumor cells. Means of quantifying the
beneficial effects of this therapy are well known to those of skill in the
art.
The present invention provides a recombinant adenovirus expression vector
characterized by the partial or total deletion of one or more adenoviral
structural
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 46-
protein genes, such as the gene encoding fiber, which allows the vector to
accommodate a therapeutic, foreign nucleic acid sequence encoding a functional
foreign polypeptide, protein, or biologically active fragment thereof. A
therapeutic
gene sequence may be introduced into a tumor mass by combining the adenoviral
expression vector with a suitable pharmaceutically acceptable carrier.
Introduction
can be accomplished, for example, via direct injection of the recombinant Ad
vector
into the tumor mass.
A method of tumor-specific delivery of a tumor-suppressor gene is
accomplished by contacting target tissue in a subject with an effective amount
of a
recombinant Ad-derived vector of this invention. In the case of anti-tumor
therapy,
the gene is intended to encode an anti-tumor agent, such as a functional tumor
suppressor gene product or suicide gene product. The term "contacting" is
intended to encompass any delivery method for the efficient transfer of the
vector,
such as via intra-tumoral injection.
In another example, adenovirus vectors of the present invention can be used
to transfer genes to central nervous system (CNS) tumors in vivo.
The present invention also contemplates methods for determining the
efficacy of the within-disclosed therapeutic compositions and methods. One
such
method for confirming efficacy utilizes the human/SCID (severe combined
immunodeficient) mouse model of EBV-induced LPD (lymphoproliferative disease)
to ascertain whether EBV-antisense therapeutic nucleotide sequences block
tumor
formation. (See, e.g., Pisa, et al., Blood 79: 173-179 (1992); Rowe, et al.,
Curr.
Top. MicrobioL Immunol. 166: 325 (1990); and Cannon, et aL, J. Clin. Invest.
85:
1333-1337 (1990).
Finally, the use of Ad vectors of the present invention to prepare
medicaments for the treatment, therapy and/or diagnosis of various diseases is
also contemplated by this invention. Moreover, other anti-tumor genes may be
used in combination with the corresponding therapeutic agent to reduce the
proliferation of tumor cells. Such other gene-and-therapeutic-agent
combinations
are known to those of skill in the art and may be applied as taught herein.
A. Therapeutic Compositions
In various alternative embodiments of the present invention, therapeutic
sequences and compositions useful for practicing the therapeutic methods
described herein are contemplated. Therapeutic compositions of the present
invention may contain a physiologically tolerable carrier together with one or
more
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 47-
therapeutic nucleotide sequences of this invention, dissolved or dispersed
therein
as an active ingredient. In a preferred embodiment, the composition is not
immunogenic or otherwise able to cause undesirable side effects when
administered to a subject for therapeutic purposes.
As used herein, the terms "pharmaceutically acceptable," "physiologically
tolerable" and grammatical variations thereof, as they refer to compositions,
carriers, diluents and reagents, are used interchangeably and represent that
the
materials are capable of administration to or upon a subject -- e.g., a mammal
--
without the production of undesirable physiological effects such as nausea,
dizziness, gastric upset and the like.
For example, the present invention comprises therapeutic compositions
useful in the specific targeting of epithelial or non-epithelial cells as well
as in
delivering a therapeutic nucleotide sequence to those cells. Therapeutic
compositions designed to preferentially target to epithelial cells may
comprise a
recombinant adenovirus-derived vector particle including a therapeutic
nucleotide
sequence. As described herein, a number of adenovirus-derived moieties are
described, including particles lacking fiber, particles that contain wild type
adenovirus fiber, and particles that contain modified or chimeric fiber, each
type
providing a different tissue tropism to the particle.
The preparation of a pharmacological composition that contains active
ingredients dissolved or dispersed therein is well understood in the art.
Typically
such compositions are prepared as injectables -- either as liquid solutions or
suspensions -- however, solid forms suitable for solution or suspension in
liquid
prior to use can also be prepared. A preparation can also be emulsified, or
formulated into suppositories, ointments, creams, dermal patches, or the like,
depending on the desired route of administration.
Physiologically tolerable carriers are well known in the art. Exemplary of
liquid carriers are sterile aqueous solutions that contain no materials in
addition to
the active ingredients and water, or contain a buffer such as sodium phosphate
at
physiological pH value, physiological saline or both, such as phosphate-
buffered
saline. Still further, aqueous carriers can contain more than one buffer salt,
as well
as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol
and other solutes.
Liquid compositions can also contain liquid phases in addition to and to the
exclusion of water. Exemplary of such additional liquid phases are glycerin,
vegetable oils such as cottonseed oil, and water-oil emulsions.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 48-
A therapeutic composition typically contains an amount of a therapeutic
material, i.e., a nucleotide sequence or adenovirus vector particle of the
present
invention, sufficient to deliver a therapeutically effective amount to the
target
tissue, typically an amount of at least 0.1 weight percent to about 90 weight
percent
of therapeutic material per weight of total therapeutic composition. A weight
percent is a ratio by weight of therapeutic material, e.g., a nucleotide
sequence, to
total composition. Thus, for example, 0.1 weight percent is 0.1 grams of DNA
segment per 100 grams of total composition.
Other Applications
The cell lines, viral vectors and methods of the present invention may also
be used for purposes other than the direct administration of therapeutic
nucleotide
sequences. In one such application, the production of large quantities of
biologically active proteins or polypeptides in cells transfected with the
within-
disclosed viral vectors is contemplated herein. For example, human
lymphoblastoid cells may be transfected with a viral vector of the present
invention
carrying a human hematopoietic growth factor such as the gene for
erythropoietin
(EPO); cells so transfected are thus able to produce biologically active EPO.
(See,
e.g., Lopez et al., Gene 148: 285-91, 1994).
Various other applications and uses of the within-described methods, cell
lines, plasmids, vectors, and compositions of the present invention shall
become
apparent upon closer examination of the Examples that follow.
The following examples are intended to illustrate, but not limit, the present
invention. As such, the following description provides details of the manner
in
which particular embodiments of the present invention may be made and used.
This description, while exemplary of the present invention, is not to be
construed
as specifically limiting the invention. Variations and equivalents, now known
or
later developed, which would be within the understanding and technical
competence of one skilled in this art are to be considered as falling within
the
scope of this invention.
Example 1
Preparation of Adenovirus Packaging Cell Lines
CA 02359795 2001-07-12 PCT/EP00/00265
WO 00/42208
- 49-
Cell lines that are commonly used for growing adenovirus are useful as host
cells for the preparation of adenovirus packaging cell lines. Preferred cells
include
293 cells, an adenovirus-transformed human embryonic kidney cell line obtained
from the ATCC, having Accession Number CRL 1573; HeLa, a human epithelial
carcinoma cell line (ATCC Accession Number CCL-2); A549, a human lung
carcinoma cell line (ATCC Accession Number CCL 1889); and the like epithelial-
derived cell lines. As a result of the adenovirus transformation, the 293
cells
contain the E1 early region regulatory gene. All cells were maintained in
complete
DMEM + 10% fetal calf serum unless otherwise noted.
The cell lines of this invention allow for the production and propagation of
novel adenovirus-based gene delivery vectors having deletions in preselected
gene regions, that are obtained by cellular complementation of adenoviral
genes.
To provide the desired complementation of such deleted adenoviral genomes in
order to generate a novel viral vector of the present invention, plasmid
vectors that
contain preselected functional units were designed as described herein. Such
units include but are not limited to E1 early region, E4 and the viral fiber
gene. The
preparation of plasmids providing such complementation, thereby being
"complementary plasmids or constructs," that are stably inserted into host
cell
chromosomes are described below.
A. Preparation of an E4-Expressing Plasmid for Complementation
of E4-Gene-Deleted Adenoviruses
The viral E4 regulatory region contains a single transcription unit which is
alternately spliced to produce several different mRNAs. The E4-expressing
plasmid prepared as described herein and used to transfect the 293 cell line
contains the entire E4 transcriptional unit as shown in Figure 1. A DNA
fragment
extending from 175 nucleotides upstream of the E4 transcriptional start site
including the natural E4 promoter to 153 nucleotides downstream of the E4
polyadenylation signal including the natural E4 terminator signal,
corresponding to
nucleotides 32667-35780 of the adenovirus type 5 (hereinafter referred to as
Ad5)
genome as described in Chroboczek et al. (Virol., 186:280-285 (1992), GenBank
Accession Number M73260), was amplified from Ad5 genomic DNA, obtained from
the ATCC, via the polymerase chain reaction (PCR). Sequences of the primers
used were 5'CGGTACACAGAATTCAGGAGACACAACTCC3' (forward or 5' primer
referred to as E4L) (SEQ ID NO: 1) and
5'GCCTGGATCCGGGAAGTTACGTAACGTGGGAAAAC3' (SEQ ID NO: 2)
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 50-
(backward or 3' primer referred to as E4R). To facilitate cloning of the PCR
fragment, these oligonucleotides were designed to create novel sites for the
restriction enzymes EcoRl and BamHl, respectively, as indicated with
underlined
nucleotides. DNA was amplified via PCR using 30 cycles of 92 C for 1 minute,
50
C for 1 minute, and 72 C for 3 minutes resulting in amplified full-length E4
gene
products.
The amplified DNA E4 products were then digested with EcoRl and BamHl
for cloning into the compatible sites of pBluescript/SK+ by standard
techniques to
create the plasmid pBS/E4. A 2603 base pair (bp) cassette including the herpes
simplex virus thymidine kinase promoter, the hygromycin resistance gene, and
the
thymidine kinase polyadenylation signal was excised from the plasmid pMEP4
(Invitrogen, San Diego, CA) by digestion with Fspl followed by addition of
BamHl
linkers (5'CGCGGATCCGCG3') (SEQ ID NO: 3) for subsequent digestion with
BamHl to isolate the hygromycin-containing fragment. The isolated BamHl-
modified fragment was then cloned into the BamHl site of pBS/E4 containing the
E4 region to create the plasmid pE4/Hygro containing 8710 by (Figure 2). The
pE4/Hygro plasmid has been deposited with the ATCC as described in Example 3.
The complete nucleotide sequence of pE4/Hygro is listed in SEQ ID NO: 4.
Position number 1 of the linearized vector corresponds to approximately the
middle
portion of the pBS/SK+ backbone as shown in Figure 2 as a thin line between
the
3' BamHl site in the hygromycin insert and the 3' EcoRl site in the E4 insert.
The 5'
and 3' ends of the E4 gene are located at respective nucleotide positions 3820
and
707 of SEQ ID NO: 4 while the 5' and 3' ends of the hygromycin insert are
located
at respective nucleotide positions 3830 and 6470. In the clone that was
selected
for use, the E4 and hygromycin resistance genes were divergently transcribed.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 51-
B. Preparation of a Fiber-Expressing Plasmid for
Complementation of Fiber-Gene-Deleted Adenoviruses
To prepare a fiber-encoding construct, primers were designed to amplify the
fiber coding region from Ad5 genomic DNA with the addition of unique BamHl and
Notl sites at the 5' and 3' ends of the fragment, respectively. The Ad5
nucleotide
sequence is available with the GenBank Accession Number M18369. The 5' and 3'
primers had the respective nucleotide sequences of
5'ATGGGATCCAAGATGAAGCGCGCAAGACCG3' (SEQ ID NO: 5) and
5'CATAACGCGGCCGCTTCTTTATTCTTGGGC3' (SEQ ID NO: 6), where the
inserted BamHl and Notl sites are indicated by underlining. The 5' primer also
contained a nucleotide substitution 3 nucleotides 5' of the second ATG codon
(C to
A) that is the initiation site. The nucleotide substitution was included so as
to
improve the consensus for initiation of fiber protein translation.
The amplified DNA fragment was inserted into the BamHl and Notl sites of
pcDNA3 (Invitrogen) to create the plasmid designated pCDNA3/Fiber having 7148
bp, the plasmid map of which is shown in Figure 3. The parent plasmid
contained
the CMV promoter, the bovine growth hormone (BHG) terminator and the gene for
conferring neomycin resistance. The viral sequence included in this construct
corresponds to nucleotides 31040-32791 of the Ad5 genome.
The complete nucleotide sequence of pCDNA3/Fiber is listed in SEQ ID NO:
7 where the nucleotide position 1 corresponds to approximately the middle of
the
pcDNA3 vector sequence. The 5' and 3' ends of the fiber gene are located at
respective nucleotide positions 916 with ATG and 2661 with TAA.
To enhance expression of fiber protein by the constitutive CMV promoter
provided by the pcDNA vector, a Bglll fragment containing the tripartite
leader
(TPL) of adenovirus type 5 was excised from pRD112a (Sheay et al.,
BioTechniques, 15:856-862 (1993) and inserted into the BamHl site of
pCDNA3/Fiber to create the plasmid pCLF having 7469 bp, the plasmid map of
which is shown in Figure 4. The adenovirus tripartite leader sequence, present
at
the 5' end of all major late adenoviral mRNAs as described by Logan et al.,
Proc.
Natl. Acad. Sci., USA, 81:3655-3659 (1984) and Berkner, BioTechniques, 6:616-
629 (1988), also referred to as a "partial TPL" since it contains a partial
exon 1,
shows correspondence with the Ad5 leader sequence having three spatially
separated exons corresponding to nucleotide positions 6081-6089 (the 3' end of
the first leader segment), 7111-7182 (the entire second leader segment), and
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 52-
9644-9845 (the third leader segment and sequence downstream of that segment).
The corresponding cDNA sequence of the partial tripartite leader sequence
present
in pCLF is listed in SEQ ID NO: 8 bordered by BamHl/Bglll 5' and 3' sites at
respective nucleotide positions 907-912 to 1228-1233. The nucleotide sequence
of an isolated partial TPL of the present invention is also listed separately
as SEQ
ID NO: 26 with the noted 5' and 3' restriction sites and with the following
nucleotide
regions identified: 1-6 nt Bglll site; 1-18 nt polylinker; 19-27 nt last 9 nt
of the first
leader segment (exon 1 ); 28-99 nt second leader segment (exon 2); 100-187 nt
third leader segment (exon 3); 188-301 nt contains the nt sequence immediately
following the third leader in the genome with an unknown function; and 322-327
nt
Bglll site.
The pCLF plasmid has been deposited with the ATCC as described in
Example 3. The complete nucleotide sequence of pCLF is listed in SEQ ID NO: 8
where the nucleotide position 1 corresponds to approximately the middle of the
pcDNA3 parent vector sequence. The 5' and 3 ends of the Ad5 fiber gene are
located at respective nucleotide positions 1237-1239 with ATG and 2980-2982
with
TAA. The rest of the vector construct has been previously described above.
C. Generation of an Adenovirus Packaging Cell Line Carrying
Plasmids Encoding Functional E4 and Fiber Proteins
The 293 cell line was selected for preparing the first adenovirus packaging
line as it already contains the E1 gene as prepared by Graham et al., J. Gen.
Virol.,
36:59-74 (1977) and as further characterized by Spector, Virol., 130:533-538
(1983). Before electroporation, 293 cells were grown in RPMI medium + 10%
fetal
calf serum. Four x 106 cells were electroporated with 20 Ng each of pE4/Hygro
DNA and pCLF DNA using a BioRad GenePulser and settings of 300 V, 25 NF.
DNA for electroporation was prepared using the Qiagen system according to the
manufacturer's instructions (Bio-Rad, Richmond, CA).
Following electroporation, cells were split into fresh complete DMEM + 10%
fetal calf serum containing 200 pg/ml Hygromycin B (Sigma, St. Louis, MO).
From expanded colonies, genomic DNA was isolated using the
"MICROTURBOGEN" system (Invitrogen) according to manufacturer's instructions.
The presence of integrated E4 DNA was assessed by PCR using the primer pair
E4R and ORF6L (5'TGCTTAAGCGGCCGCGAAGGAGA AGTCC3') (SEQ ID NO:
9), the latter of which is a 5' forward primer near adenovirus 5 open reading
frame
6. Refer to Figure 1 for position of the primers relative to the E4 genes.
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
- 53-
One clone, designated 211, was selected exhibiting altered growth
properties relative to that seen in parent cell line 293. The 211 clone
contained the
expected product, indicating the presence of inserted DNA corresponding to
most,
if not all, of the E4 fragment contained in the pE4/Hygro plasmid. The 211
cell line
has been deposited with the ATCC as described in Example 3. This line was
further evaluated by amplification using the primer pair E4UE4R described
above,
and a product corresponding to the full-length E4 insert was detected. Genomic
Southern blotting was performed on DNA restricted with EcoRl and BamHl. The E4
fragment was then detected at approximately one copy/genome compared to
standards with the EcoRl/BamHl E4 fragment as cloned into pBS/E4 for use as a
labeled probe with the Genius system according to manufacturer's instructions
(Boehringer Mannheim, Indianapolis, IN). In DNA from the 211 cell line, the
expected labeled internal fragment pE4/Hygro hybridized with the isolated E4
sequences. In addition, the probe hybridized to a larger fragment which may be
the result of a second insertion event (Figure 5).
Although the 211 cell line was not selected by neomycin resistance, thus
indicating the absence of fiber gene, to confirm the lack of fiber gene, the
211 cell
line was analyzed for expression of fiber protein by indirect
immunofluorescence
with an anti-fiber polyclonal antibody and a FITC-labeled anti-rabbit IgG
(KPL) as
secondary. No immunoreactivity was detected. Therefore, to generate 211 clones
containing recombinant fiber genes, the 211 clone was expanded by growing in
RPMI medium and subjected to additional electroporation with the fiber-
encoding
pCLF plasmid as described above.
Following electroporation, cells were plated in DMEM + 10% fetal calf serum
and colonies were selected with 200 Ng/ml 6418 (Gibco, Gaithersburg, MD).
Positive cell lines remained hygromycin resistant. These candidate sublines of
211
were then screened for fiber protein expression by indirect immunofluorescence
as
described above. The three sublines screened, 211 A, 211 B and 211 R, along
with
a number of other sublines, all exhibited nuclear staining qualitatively
comparable
to the positive control of 293 cells infected with AdRSV~gal (1 pfu/cell) and
stained
24 hours post-infection.
Lines positive for nuclear staining in this assay were then subjected to
Western blot analysis under denaturing conditions using the same antibody.
Several lines in which the antibody detected a protein of the expected
molecular
weight (62 kd for the Ad5 fiber protein) were selected for further study
including
211 A, 211 B and 211 R. The 211 A cell line has been deposited with ATCC as
described in Example 3.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 54-
Immunoprecipitation analysis using soluble nuclear extracts from these three
cell lines and a seminative electrophoresis system demonstrated that the fiber
protein expressed is in the functional trimeric form characteristic of the
native fiber
protein as shown in Figure 6. The predicted molecular weight of a trimerized
fiber
is 186 kd. The lane marked 293 lacks fiber while the sublines contain
detectable
fiber. Under denaturing conditions, the trimeric form was destroyed resulting
in
detectable fiber monomers as shown in Figure 6. Those clones containing
endogenous E1, newly expressed recombinant E4 and fiber proteins were selected
for use in complementing adenovirus gene delivery vectors having the
corresponding adenoviral genes deleted as described in Example 2.
D. Preparation of an E1-Expressing Plasmid for
Complementation of E1-Gene-Deleted Adenoviruses
In order to prepare adenoviral packaging cell lines other than those based
on the E1-gene containing 293 cell line as described in Example 1C above,
plasmid vectors containing E1 alone or in various combinations with E4 and
fiber
genes are constructed as described below.
The region of the adenovirus genome containing the E1 a and E1 b gene is
amplified from viral genomic DNA by PCR as previously described. The primers
used are E1 L, the 5' or forward primer, and E1 R, the 3' or backward primer,
having
the respective nucleotide sequences 5'CCG AGCTAGC GACTGAAAATGAG3'
(SEQ ID NO: 10) and 5'CCTCTCGAG AGACAGC AAGACAC3' (SEQ ID NO: 11 ).
The E1 L and E1 R primers include the respective restriction sites Nhel and
Xhol as
indicated by the underlines. The sites are used to clone the amplified E1 gene
fragment into the Nhel/Xhol sites in pMAM commercially available from Clontech
(Palo Alto, CA) to form the plasmid pDEX/E1 having 11152 bp, the plasmid map
of
which is shown in Figure 7.
The complete nucleotide sequence of pDEX/E1 is listed in SEO ID NO: 12
where the nucleotide position 1 corresponds to approximately 1454 nucleotides
from the 3' end of the pMAM backbone vector sequence. The pDEX/E1 plasmid
includes nucleotides 552 to 4090 of the adenovirus genome positioned
downstream (beginning at nucleotide position 1460 and ending at 4998 in the
pDEX/E1 plasmid) of the glucocorticoid-inducible mouse mammary tumor virus
(MMTV) promoter of pMAM. The pMAM vector contains the E. coli gpt gene that
allows stable transfectants to be isolated using
CA 02359795 2001-07-12 PC'T/EP00/00265
WO 00/42208
- 55-
hypoxanthine/aminopterin/thymidine (HAT) selection. The pMAM backbone
occupies nucleotide positions 1-1454 and 5005-11152 of SEQ ID NO: 12.
E. Generation of an Adenovirus Packaging Cell Line Carrying
Plasmids Encoding Functional E1, and Fiber Proteins
To create separate adenovirus packaging cell lines equivalent to that of the
211 sublines, 211 A, 211 B and 211 R, as described in Example 1 C, alternative
cell
lines lacking adenoviral genomes are selected for transfection with the
plasmid
constructs as described below. Acceptable host cells include A549, Hela, Vero
and the like cell lines as described in Example 1. The selected cell line is
transfected with the separate plasmids, pDEX/EI and pCLF, respectively for
expressing E1, and fiber complementary proteins. Following transfection
procedures as previously described, clones containing stable insertions of the
two
plasmids are isolated by selection with neomycin and HAT. Integration of full-
length copy of the E1 gene is assessed by PCR amplification from genomic DNA
using the primer set E1 L/E1 R , as described above. Functional insertion of
the
fiber gene is assayed by staining with the anti-fiber antibody as previously
described.
The resultant stably integrated cell line is then used as a packaging cell
system to complement adenoviral gene delivery vectors having the corresponding
adenoviral gene deletions as described in Example 2.
F. Preparation of a Plasmid Containing Two or More Adenoviral
Genes for Complementing Gene-Deleted
Adenoviruses
The methods described in the preceding Examples rely on the use of two
plasmids, pE4/Hygro and pCLF, or, pCLF and pDEX/E1 for generating adenoviral
cell packaging systems. In alternative embodiments contemplated for use with
the
methods of this invention, complementing plasmids containing two or more
adenoviral genes for expressing of encoded proteins in various combinations
are
also prepared as described below. The resultant plasmids are then used in
various
cell systems with delivery plasmids having the corresponding adenoviral gene
deletions. The selection of packaging cell, content of the delivery plasmids
and
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 56-
content of the complementing plasmids for use in generating recombinant
adenovirus viral vectors of this invention thus depends on whether other
adenoviral
genes are deleted along with the adenoviral fiber gene, and, if so, which
ones.
1. Preparation of a Complementing Plasmid Containing Fiber
and E1 Adenoviral Genes
A DNA fragment containing sequences for the CMV promoter, adenovirus
tripartite leader, fiber gene and bovine growth hormone terminator is
amplified from
pCLF prepared in Example 1 B using the forward primer
5'GACGGATCGGGAGATCTCC3' (SEQ ID NO: 13), that anneals to the nucleotides
1-19 of the pCDNA3 vector backbone in pCLF, and the backward primer
5'CCGCCTCAGAAGCCATAGAGCC3' (SEO ID NO: 14) that anneals to
nucleotides 1278-1257 of the pCDNA3 vector backbone. The fragment is amplified
as previously described and then cloned into the pDEX/E1 plasmid, prepared in
Example 1 D. For cloning in the DNA fragment, the pDEX/E1 vector is first
digested
with Ndel, that cuts at a unique site in the pMAM vector backbone in pDEX/E1,
then the ends are repaired by treatment with bacteriophage T4 polymerase and
dNTPs.
The resulting plasmid containing E1 and fiber genes, designated pE1/Fiber,
provides both dexamethasone-inducible E1 function as described for DEX/E1 and
expression of Ad5 fiber protein as described above. A schematic plasmid map of
pE1/Fiber, having 14455 bp, is shown in Figure 8.
The complete nucleotide sequence of pE1/Fiber is listed in SEQ ID NO: 15
where the nucleotide position 1 corresponds to approximately to 1459
nucleotides
from the 3' end of the parent vector pMAM sequence. The 5' and 3 ends of the
Ad5
E1 gene are located at respective nucleotide positions 1460 and 4998 followed
by
pMAM backbone and then separated from the Ad5 fiber from pCLF by the filled-in
blunt ended Ndel site. The 5' and 3' ends of the pCLF fiber gene fragment are
located at respective nucleotide positions 10922-14223 containing elements as
previously described for pCLF.
The resultant pE1/Fiber plasmid is then used to complement one or more
delivery plasmids expressing E1 and fiber.
The pE1/Fiber construct is then used to transfect a selected host cell as
described in Example 1 E to generate stable chromosomal insertions preformed
as
previously described followed by selection on HAT medium. The stable cells are
then used as packaging cells as described in Example 2.
WO 00/42208 CA 02359795 2001-07-12 pCT~, P00/00265
- 57-
2. Preparation of a Complementing Plasmid Containing E4
and Fiber Adenoviral Genes
pCLF prepared as described in Example 1 B is partially digested with Bglll to
cut only at the site in the pCDNA3 backbone. The pE4/Hygro plasmid prepared in
Example 1A is digested with BamHl to produce a fragment containing E4. The E4
fragment is then inserted into the BamHl site of pCLF to form plasmid
pE4/Fiber.
The resultant plasmid provides expression of the fiber gene as described for
pCLF
and E4 function as described for pE4/Hygro.
A schematic plasmid map of pE4/Fiber, having 10610 bp, is shown in Figure
9. The complete nucleotide sequence of pE4/Fiber is listed in SEQ ID NO: 16
where the nucleotide position 1 corresponds to approximately 14 by from the 3'
end
of the parent vector pCDNA3 backbone sequence. The 5' and 3 ends of the Ad5
E4 gene are located at respective nucleotide positions 21 and 3149 followed by
fused Bglll/BamHl sites and pCDNA3 backbone including the CMV promoter again
followed by Bglll/BamHl sites. The adenovirus leader sequence begins at
nucleotide position 4051 and extends to 4366 followed by fused BamHl/Bglll
sites
and the 5' and 3' ends of the fiber gene located at respective nucleotide
positions
4372 and 6124.
Stable chromosonal insertions of pE4/Fiber in host cells are obtained as
described above.
Example 2
Preparation of Adenoviral Gene Delivery Vectors
Using Adenoviral Packaging Cell Lines
Adenoviral delivery vectors of this invention are prepared to separately lack
the combinations of E1/fiber and E4/fiber. Such vectors are more replication-
defective than those previously in use due to the absence of multiple viral
genes.
A preferred adenoviral delivery vector of this invention that is replication
competent
but only via a non-fiber means is one that only lacks the fiber gene but
contains the
remaining functional adenoviral regulatory and structural genes. Furthermore,
the
adenovirus delivery vectors of this invention have a higher capacity for
insertion of
foreign DNA.
WO 00/42208 CA 02359795 2001-07-12 pCT~, P00/00265
- 58-
A. Preparation of Adenoviral Gene Delivery Vectors Having
Specific Gene Deletions and Methods of Use
To construct the E1/ fiber deleted viral vector containing the LacZ reporter
gene construct, two new plasmids were constructed. The plasmid p~ E1 B~igal
was
constructed as follows. A DNA fragment containing the SV40 regulatory
sequences and E. coli a-galactosidase gene was isolated from pSVagal (Promega)
by digesting with Vspl, filling the overhanging ends by treatment with Klenow
fragment of DNA polymerase I in the presence of dNTP's and digesting with Bam
H1. The resulting fragment was cloned into the EcoRV and BamHl sites in the
polylinker of p0 E1 spi B (Microbix Biosystems, Hamilton, Ontario) to form
p~E1 B~3gal that therefore contained the left end of the adenovirus genome
with the
Ela region replaced by the LacZ cassette (nucleotides 6690 to 4151 ) of
pSV~3gal.
Plasmid DNA may be prepared by the alkaline lysis method as described by
Birnboim and Doly, Nuc. Acids Res., 7:1513-1523 (1978) or by the Quiagen
method according to the manufacturer's instruction, from transformed cells
used to
expand the plasmid DNA was then purified by CsCI-ethidium bromide density
gradient centrifugation. Alternatively, plasmid DNAs may be purified from E.
coli by
standard methods known in the art (e.g. see Sambrook et al.)
The second plasmid (pDV44), prepared as described herein, is derived from
pBHGlO, a vector prepared as described by Bett et al., Proc. Natl. Acad. Sci.,
USA,
91:8802-8806 (1994), now described in International Application Publication
Number WO 9500655, with methodology well known to one of ordinary skill in the
art and also is commercially available from Microbix, which contains an Ad5
genome with the packaging signals at the left end deleted and the E3 region
(nucleotides 28133:30818) replaced by a linker with a unique site for the
restriction
enzyme Pacl. An 11.9 kb BamHl fragment, which contains the right end of the
adenovirus genome, is isolated from pBHGlO and cloned into the BamHl site of
pBS/SK(+) to create plasmid p11.3 having approximately 14,658 bp. A schematic
of the plasmid map is shown in Figure 13. The p11.3 plasmid was then digested
with Pacl and Sall to remove the fiber, E4, and inverted terminal repeat (ITR)
sequences.
This fragment was replaced with a 3,4 kb fragment containing the ITR
segments and the E4 gene which was generated by PCR amplification from
pBHGlO using the following ofigonucleotide sequences (5' TGTACACCG
GATCCGGCGCACACC3' SEQ ID NO: 17) and (5'CACAACGAGCTC
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 59-
AATTAATTAATTGCCACATCCTC3' SEQ ID NO: 18). These primers incorporated
sites for Pacl and BamHl. Cloning this fragment into the Pacl and blunt ended
Sall
sites of the p11.3 backbone resulted in a substitution of the fused ITRs, E4
region
and fiber gene present in pBHGlO, by the ITRs and E4 region alone. The
resultant
p11.3 plasmid containing the ITR and E4 regions, now called plasmid pDV43a,
was
then digested with BamHl. This BamHl fragment was then used to replace a
BamHl fragment in pBHGlO thereby creating pDV44 in a pBHGlO backbone.
In an alternative approach to preparing pDV44 with an additional subcloning
step to facilitate the incorporation of restriction cloning sites, the
following cloning
procedure was performed. pDV44 as above was constructed by removing the fiber
gene and some of the residual E3 sequences from pBHGlO (Microbix Biosystems).
As above, to simplify manipulations, the 11.9 kb BamHl fragment including the
rightmost part of the Ad5 genome was removed from pBHGlO and inserted into
pBS/SK. The resulting plasmid was termed p11.3. The 3.4 kb DNA fragment
corresponding to the E4 region and both ITRs of adenovirus type 5 was
amplified
as described above from pBHGlO using the oligonucleotides listed above and
subcloned into the vector pCR2.1 (Invitrogen) to create pDV42. This step is
the
additional cloning step to facilitate the incorporation of a Sall restriction
site.
pDV42 was then digested with Pacl, which cuts at a unique site (bold type) in
one
of the PCR primers, and with Sall, which cuts at a unique site in the pCR2.1
polylinker. This fragment was used to replace the corresponding Pacl/Xhol
fragment of p11.3 (the pBS polylinker adjacent to the Ad DNA fragment contains
a
unique Xhol site), creating pDV43. Finally, pDV44 was constructed by replacing
the 11.9 kb BamHl fragment of pBHGlO by the analogous BamHl fragment of
pDV43. As generated in the first procedure, pDV44 therefore differs from
pBHGlO
by the deletion of Ad5 nucleotides 30819:32743 (residual E3 sequences and all
but
the 3'-most 41 nucleotides of the fiber open reading frame).
Thus, to summarize, the cloning procedures described above result in the
production of a fiber-deleted Ad5 genomic plasmid (pDV44) that was constructed
by removing the fiber gene and some of the residual E3 sequences from pBHGlO
(Figure 16A). pDV44 contains a wild-type E4 region, but only the last 41
nucleotides of the fiber ORF (this sequence was retained to avoid affecting
expression of the adjacent E4 transcription unit). Both pBHGlO and pDV44
contain
unpackageable Ad5 genomes, and must be rescued by cotransfection and
subsequent homologous recombination with DNA carrying functional packaging
signals. In order to generate vectors marked with a reporter gene, either
pDV44 or
pBHGlO was cotransfected with p0E1Bf3gal, which contains the left end of the
Ad5
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 60-
genome with an SV40-driven f3-galactosidase reporter gene inserted in place of
the
E1 region.
In general, and as described below, the method for virus production by
recombination of plasmids followed by complementation in cell culture involves
the
isolation of recombinant viruses by cotransfection of any one of the
adenovirus
packaging cell systems prepared in Example 1, namely 211 A, 211 B, 211 R,
A549,
Vero cells, and the like, with plasmids carrying sequences corresponding to
viral
gene delivery vectors.
A selected cell line is plated in dishes and cotransfected with pDV44 and
p0E1 Bf3gal using the calcium phosphate method as described by Bett et al.,
Proc.
Natl. Acad. Sci., USA, 91:8802-8806 (1994). Recombination between the
overlapping adenovirus sequences in the two plasmids leads to the creation of
a
full-length viral chromosome where pDV44 and p~E1 Bf3gal recombine to form a
recombinant adenovirus vector having multiple deletions. The deletion of E1
and
of the fiber gene from the viral chromosome is compensated for by the
sequences
integrated into the packaging cell genome, and infectious virus particles are
produced. The plaques thus generated are isolated and stocks of the
recombinant
virus are produced by standard methods.
A pDV44-derived virus is expected to be replication-defective due to the
fiber deletion, so that the cells in which it is grown must complement this
defect.
The 211 B cell line (a derivative of 293 cells which expresses the wild-type
(wt) AD5
fiber and is equivalent to 211A on deposit with ATCC as described in Example
3)
was used for rescue and propagation of the virus described here. pDV44 and
p0E1 Bf3gal were cotransfected into 211 B cells, and the monolayers were
observed
for evidence of cytopathic effect (CPE). Briefly, for virus construction,
cells were
transfected with the indicated plasmids using the Gibco Calcium Phosphate
Transfection system according to the manufacturer's instructions and observed
daily for evidence of CPE.
One of a total of 58 transfected dishes showed evidence of spreading cell
death at day 15. A crude freeze-thaw lysate was prepared from these cells and
the
resulting virus (termed Ad5.f3gaI.OF) was plaque purified twice and then
expanded.
To prepare purified viral preparations, cells were infected with the indicated
Ad and
observed for completion of CPE. Briefly, at day zero, 211 B cells were plated
in
DMEM plus 10% fetal calf serum at approximately 1 X 10' cells/150 cm2 flask or
equivalent density. At day one, the medium was replaced with one half the
original
volume of fresh DMEM containing the indicated Ad, in this case Ad5.f3gal.~F,
at
approximately 100 particles/cell. At day two, an equal volume of medium was
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 61-
added to each flask and the cells were observed for CPE. Two to five days
after
infection, cells were collected and virus isolated by lysis via four rapid
freeze-thaw
cycles. Virus was then purified by centrifugation on preformed 15-40% CsCI
gradients (111,000 x g for three hours at 4°C). The bands were
harvested,
dialyzed into storage buffer (10 mM Tris-pH 8.1, 0.9% NaCI, and 10% glycerol),
aliquoted and stored at - 70°C. Purified Ad5.f3gaI.OF virus particles
containing
human adenovirus Ad5.f3gal. OFgenome (described further below) have been
deposited with the ATCC on January 15, 1999 as further described in Example 3.
For viral titering, as necessary in the below Examples, Ad preparations were
titered by plaque assay on 211 B cells. Cells were plated on polylysine-coated
6
well plates at 1.5 x 106 cells/well. Duplicate dilutions of virus stock were
added to
the plates in 1 ml/well of complete DMEM. After a five hour incubation at
37°C,
virus was removed and the wells overlaid with 2 ml of 0.6% low-melting agarose
in
Medium 199 (Gibco). An additional 1 ml of overlay was added at five day
intervals.
As a control, the first-generation virus Ad5.f3 gal.wt, which is identical to
Ad5.f3gal. ~F except for the fiber deletion, was constructed by cotransfection
of
pBHGlO and p~E1 Bf3gal (Figure 16B). In contrast to the low efficiency of
recovery
of the fiberless genome (1/58 dishes), all of 9 dishes cotransfected with p0E1
Bf3gal
and pBHGlO produced virus.
In a preferred embodiment of this invention as more fully described herein
and below, a delivery plasmid is prepared that does not require the above-
described recombination events to prepare a viral vector having a fiber gene
deletion. In one embodiment, a single delivery plasmid containing all the
adenoviral genome necessary for packaging but lacking the fiber gene is
prepared
from plasmid pFG140 containing full-length Ad5 that is commercially available
from
Microbix. The resultant delivery plasmid referred to as pFG140-f is then used
with
pCLF stably integrated cells as described above to prepare a viral vector
lacking
fiber. In a preferred aspect of this invention, the fiber gene is replaced
with a
therapeutic gene of interest for preparing a therapeutic delivery adenoviral
vector.
Other embodiments including production of fiberless vector with a complete TPL
are described in Example 5.
Vectors for the delivery of any desired gene and preferably a therapeutic
gene are prepared by cloning the gene of interest into the multiple cloning
sites in
the polylinker of commercially available p0E1 sp1 B (Microbix Biosystems), in
an
analogous manner as performed for preparing p E1 B~3gal as described above.
The
same cotransfection and recombination procedure is then followed as described
herein to obtain viral gene delivery vectors as further discussed in later
Examples.
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 62-
1. Characterization of the Ad5.~3gaI.~F Genome
To confirm that the vector genomes had the expected structures and that the
fiber gene was absent from the Ad5.f3gal.~F chromosome, the DNA isolated from
viral particles was analyzed. Briefly, purified viral DNA was obtained by
adding 10
~I of 10 mg/ml proteinase K, 40 pl of 0.5 M EDTA and 50 NI of 10% SDS to 800
pl
of adenovirus-containing culture supernatant. The suspension was then
incubated
at 55C for 60 minutes. The solution was then extracted once with
400 NI of a 24:1 mixture of chloroform:isoamyl alcohol. The aqueous phase was
then removed and precipitated with sodium acetate/ethanol. The pellet was
washed once with 70% ethanol and lightly dried. The pellet was then suspended
in
40 pl of 10 mM Tris-HCI, pH 8.0, 1 mM EDTA. Genomic DNA from both
Ad5.f3gal.wt and AdS.~gaI.OF produced the expected restriction patterns
(Figure
17A) following digestion with either EcoRl (Figure 17B) or with Ndel (data not
shown). Southern blotting, performed with standard methods, with labeled fiber
DNA as a probe demonstrated the presence of fiber sequence in Ad5.f3gal.wt but
not in Ad5.f3gal. OF DNA (Figure 17C). As a positive control, the blot was
stripped
and reprobed with labeled E4 sequence. Fiber and E4 sequences were detected
by using labeled inserts from pCLF and pE4/Hygro, respectively. As expected,
E4
signal was readily detectable in both genomes at equal intensities (Figure
17C).
The complete nucleotide sequence of AdS.~igaI.BF is presented in SEQ ID
NO: 27 and is contained in the virus particle on deposit with ATCC.
2. Characterization of the Fiberless Adenovirus AdS.~igaI.OF
To verify that Ad5.f3gal.~F was fiber-defective, 293 cells (which are
permissive for growth of E1-deleted Ad vectors but do not express fiber) were
infected with Ad5.f3gal. OF or with AdS.(3gal.wt. Twenty-four hours post
infection,
the cells were stained with polyclonal antibodies directed either against
fiber or
against the penton base protein. Cells infected with either virus were stained
by
the anti-penton base antibody, while only cells infected with the AdS.(3gal.wt
control
virus reacted with the anti-fiber antibody. This confirms that the fiber-
deleted Ad
mutant does not direct the synthesis of fiber protein.
3. Growth of the Fiber-Deleted AdS.~igaI.OF Vector in
Complementing Cells
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
- 63-
AdS.~igaI.OF was found to readily be propagated in 211 B cells. As assayed
by protein concentration, CsCI-purified stocks of either AdS.~igaI.OF or
Ad5.f3gal.wt
contained similar numbers of viral particles (Table 1 ), and the particles
appeared to
band normally on CsCI gradients. However, infectivity of the AdS.~igaI.OF
particles
was lower than the Ad5.f3gal.wt control, as indicated by an increased
particle/PFU
ratio (Table 1 ). This is likely due to a reduced amount of fiber protein
incorporated
into mutant particles during growth in the
CA 02359795 2001-07-12
WO '00/42208 PCT/EP00/00265
-64-
Virus CsCI- Cell Particles/PFU/ml ParticleFiber source
purifiedline mla /PFU
preen ratio
AdS.(3gal.wt1 211 7.4 x 7.5 x 10 Ad
10"
B 10' chromosom
a
2 211 3.0 x 5.0 x 60 Ad
10" 10y
B chromosom
a
AdS.(3gaI.OF3 211 7.7 x 3.5 x 2200 Packaging
10" 10
B cells
4 211 1.9 x 2.3 x 808 Packaging
10'2 109
B cells
5 293 4.5 x 9.5 x 47400 None
10" 106
6 293 3.4 x 3.5 x 9700 None
10" 10'
aCalculated from viral protein concentration (1 ug of protein = 4 x 109
particles).
bAssayed by plaguing on 211 B cells.
Table 3
*Particle numbers and infectious titers of representative adenovirus preps.
Each
line represents a single CsCI-purified preparation of the indicated virus.
Particle numbers
were calculated from viral protein concentration (1 Ng protein = 4 x 109
particles). Pfu was
assayed by plaguing on 211 B cells (see above).
211 B cells (see below). AdS.~igaI.OF was also found to plaque more slowly
than the
control virus. When plated on 211 B cells, Ad5.f3gal.wt plaques appeared
within 5-7
days, while plaques of Ad5.~3gaI.OF continued to appear until as much as 15-18
days post infection. Despite their slower formation, the morphology of
AdS.~igaI.OF
plaques was essentially normal.
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
-65-
4. Production of Fiberless Ad5.f3gal. OF Particles
As AdS.~igaI.OF represents a true fiber null mutation and its stocks are free
of
helper virus, the fiber mutant phenotype was readily investigated. A single
round of
growth in cells (such as 293) which do not produce fiber generating a
homogeneous
preparation of fiberless Ad allowed for the determination of whether such
particles
would be stable and/or infectious. Either Ad5.f3gal.wt or AdS.~igal.~F was
grown in
293 or 211 B cells, and the resulting particles purified on CsCI gradients as
previously described. Ad5.~3gaI.OF particles were readily produced in 293
cells at
approximately the same level as the control virus and behaved similarly on the
gradients, indicating that there was not a gross defect in morphogenesis of
fiberless
capsids (Table 1 ).
As shown in Figure 18, particles of either virus contained similar amounts of
penton base regardless of the cell type in which they were grown. This
demonstrated that fiber is not required for assembly of the penton base
complex into
virions. However, as predicted, the AdS.~igal.~F particles produced in 293
cells did
not contain fiber protein. 211 B-grown AdS.~igaI.OF also contained less fiber
than
the Ad5.f3gal.wt control virus (Figure 18). Importantly, the infectivities of
the
different viral preparations on epithelial cells (Table 1 ) correlated with
the amount of
fiber protein present. The fiberless Ad particles were several thousand-fold
less
infectious than the first-generation vector control on a per-particle basis,
while
infectivity of 211 B-grown AdS.~gaI.~F was only 50-100 fold less than that of
Ad5.f3gal.wt. These studies confirmed fiber's crucial role in
infection of epithelial cells via CAR binding.
5. Composition and Structure of the Fiberless Ad5.f3gal.
OF Particles
The proteins contained in particles of 293-grown Ad5.~3gaI.OF were compared
to those in AdS.Bgal.wt, to determine whether proteolysis or particle assembly
was
defective in this fiber null mutant (data not shown). The overall pattern of
proteins in
the fiberless particles was observed to be quite similar to that of a first-
generation
vector, with the exception of reduced intensity of the composite band
resulting from
both proteins Illa and IV (fiber) (data not shown). The fiberless particles
also had a
reduced level of protein VII. Although substantial amounts of uncleaved
precursors
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
-66-
to proteins VI, VII, and VIII were not seen, it is possible that the low-
molecular weight
bands migrating ahead of protein VII represent either aberrantly cleaved viral
proteins or their breakdown products.
Cryo-electron microscopy was used to more closely examine the structure of
the 293 grown AdS.~gaI.OF and of Ad5(3gal.wt. The fiber, which consists of an
extended stalk with a knob at the end, was faintly visible in favorable
orientations of
wild-type Ad5 particles, but not in images of the fiberless particles (data
not shown).
Filamentous material likely corresponding to free viral DNA was seen in
micrographs
of fiberless particles. This material was also present in micrographs of the
first-generation control virus, albeit at much lower levels.
Three-dimensional image reconstructions of fiberless and wild-type particles
at ~20 ~ resolution showed similar sizes and overall features, with the
exception that
fiberless particles lacked density corresponding to the fiber protein. The
densities
corresponding to other capsid proteins, including penton base and proteins
Illa, VI,
and IX, were comparable in the two structures. This confirms that absence of
fiber
does not prevent assembly of these components into virions. The fiber was
truncated in the wild-type structure as only the lower portion of its flexible
shaft
follows icosahedral symmetry. The RGD protrusions on the fiberless penton base
were angled slightly inward relative to those of the wild-type structure.
Another
difference between the two penton base proteins was that there is a ~30 ~
diameter
depression in the fiberless penton base around the five-fold axis where the
fiber
would normally sit. The Ad5 reconstructions confirm that capsid assembly,
including addition of penton base to the vertices, is able to proceed in the
complete
absence of fiber.
6. Integrin-Dependent Infectivity of Fiberless AdS.(3gal. OF
Particles
While attachment via the viral fiber protein is a critical step in the
infection of
epithelial cells, an alternative pathway for infection of certain
hematopoietic cells has
been described. In this case, penton base mediates both binding to the cells
(via f32
integrins) and internalization (through interaction with av integrins).
Particles lacking
fiber might therefore be expected to be competent for infection of these
cells, even
though on a per-particle basis they are several thousand-fold less infectious
than
normal Ad vectors on epithelial cells.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-67-
To investigate this, THP-1 monocytic cells were infected with Ad5.f3gal.wt or
with AdS.(3gaI.OF grown in the absence of fiber. Infection of THP-1 cells was
assayed by infecting 2 x 105 cells at the indicated m.o.i. in 0.5 ml of
complete RPMI.
Forty-eight hours post-infection, the cells were fixed with glutaraldehyde and
stained
with X-gal, and the percentage of stained cells was determined by light
microscopy.
The results of the infection assay showed that the fiberless particles were
only a few-fold less infectious than first-generation Ad on THP-1 cells
(Figure 19A).
In contrast to this, very large differences were seen in plaquing efficiency
on
epithelial (211 B) cells (Table 1 ). Infection of THP-1 cells by either
Ad5.~3gaI.OF or
Ad5.f3gal.wt was not blocked by an excess of soluble recombinant fiber
protein, but
could be inhibited by the addition of recombinant penton base (Figure 19B).
These
results indicate that the fiberless Ad particles use a fiber-independent
pathway to
infect these cells. Furthermore, the lack of fiber protein did not prevent
AdS.~igaI.OF
from internalizing into the cells and delivering its genome to the nucleus,
demonstrating that fiberless particles are properly assembled and are capable
of
uncoating.
The foregoing results with the recombinant viruses thus produced indicates
that they can be used as gene delivery tools both in cultured cells and in
vivo as
described more fully in the Examples. For example, for studies of the
effectiveness
and relative immunogenicity of multiply-deleted vectors, virus particles are
produced
by growth in the packaging lines described in Example 1 and are purified by
CsCI
gradient centrifugation. Following titering, virus particles are administered
to mice
via systemic or local injection or by aerosol delivery to lung. The LacZ
reporter gene
allows the number and type of cells which are successfully transduced to be
evaluated. The duration of transgene expression is evaluated in order to
determine
the long-term effectiveness of treatment with multiply-deleted recombinant
adenoviruses relative to the standard technologies which have been used in
clinical
trials to date. The immune response to the improved vectors described here is
determined by assessing parameters such as inflammation, production of
cytotoxic T
lymphocytes directed against the vector, and the nature and magnitude of the
antibody response directed against viral proteins.
Versions of the vectors which contain therapeutic genes such as CFTR for
treatment of cystic fibrosis or tumor suppressor genes for cancer treatment
are
evaluated in the animal system for safety and efficiency of gene transfer and
expression. Following this evaluation, they are used as experimental
therapeutic
agents in human clinical trials.
WO 00/42208 CA 02359795 2001-07-12
PCT/EP00/00265
-68-
B. Retargeting of Adenoviral Gene Delivery Vectors by Producing
Viral Particles Containing Different or Altered Fiber Proteins
As the specificity of adenovirus binding to target cells is largely determined
by
the fiber protein, viral particles that incorporate modified fiber proteins or
fiber
proteins from different adenoviral serotypes (pseudotyped vectors) have
different
specificities. Thus, the methods of expression of the native Ad5 fiber protein
in
adenovirus packaging cells as described above is also applicable to production
of
different fiber proteins.
In one aspect of invention, chimeric fiber proteins are produced according to
the methods of Stevenson et al., J. Virol., 69:2850-2857 (1995). The authors
showed that the determinants for fiber receptor binding activity are located
in the
head domain of the fiber and that isolated head domain is capable of
trimerization
and binding to cellular receptors. The head domains of adenovirus type 3 (Ad3)
and
Ad5 were exchanged in order to produce chimeric fiber proteins. Similar
constructs
for encoding chimeric fiber proteins for use in the methods of this invention
are
contemplated. Thus, instead of the using the intact Ad5 fiber-encoding
construct
prepared in Example 1 as a complementing viral vector in adenoviral packaging
cells, the constructs described herein are used to transfect cells along with
E4
and/or E1-encoding constructs.
Briefly, full-length Ad5 and Ad3 fiber genes were amplified from purified
adenovirus genomic DNA as a template. The Ad5 and Ad3 nucleotides sequences
are available with the respective GenBank Accession Numbers M18369 and
M12411. Oligonucleotide primers are designed to amplify the entire coding
sequence of the full-length fiber genes, starting from the start codon, ATG,
and
ending with the termination codon TAA. For cloning purposes, the 5' and 3'
primers
contain the respective restriction sites BamHl and Notl for cloning into pcDNA
plasmid as described in Example 1A. PCR is performed as described above.
The resultant products are then used to construct chimeric fiber constructs by
PCR gene overlap extension, as described by Horton et al., BioTechniques,
8:525-
535 (1990). The Ad5 fiber tail and shaft regions (STS; the nucleotide region
encoding amino acid residue positions 1 to 403) are connected to the Ad3 fiber
head
region (3H; the nucleotide region encoding amino acid residue positions 136 to
319)
to form the 5TS3H fiber chimera. Conversely, the Ad3 fiber tail and shaft
regions
(3TS; the nucleotide region encoding amino acid residues positions 1 to 135)
are
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-69-
connected to the Ad5 fiber head region (5H; the nucleotide region encoding the
amino acid residue positions 404 to 581 ) to form the 3TS5H fiber chimera. The
fusions are made at the conserved TLWT (SEQ ID NO: 19) sequence at the fiber
shaft-head junction.
The resultant chimeric fiber PCR products are then digested with BamHl and
Notl for separate directional ligation into a similarly digested pcDNA 3.1.
The TPL
sequence is then subcloned into the BamHl as described in Example 1 A for
preparing an expression vector for subsequent transfection into 211 cells as
described above or into the alternative packaging cell systems as previously
described. The resultant chimeric fiber construct-containing adenoviral
packaging
cell lines are then used to complement adenoviral delivery vectors as
previously
described. Other fiber chimeric constructs are obtained using a similar
approach
with the various adenovirus serotypes known.
In an alternative embodiment, the methods of this invention contemplate the
use of the modified proteins including novel epitopes as described by Michael
et al.,
Gene Therapy, 2:660-668 (1995) and in International Publication WO 95/26412.
Both publications describe the construction of a cell-type specific
therapeutic viral
vector having a new binding specificity incorporated into the virus concurrent
with
the destruction of the endogenous viral binding specificity. In particular,
the authors
described the production of an adenoviral vector encoding a gastrin releasing
peptide (GRP) at the 3' end of the coding sequence of the Ad5 fiber gene. The
resulting fiber-GRP fusion protein was expressed and shown to assemble
functional
fiber trimers that were correctly transported to the nucleus of HeLa cells
following
synthesis.
Based on the teachings in the paper and International Publication, similar
constructs are contemplated for use in the complementing adenoviral packaging
cell
systems of this invention for generating new adenoviral gene delivery vectors
that
are targetable, replication-deficient and less immunogenic. Heterologous
ligands
contemplated for use herein to redirect fiber specificity range from as few as
10
amino acids in size to large globular structures, some of which necessitate
the
addition of a spacer region so as to reduce or preclude steric hindrance of
the
heterologous ligand with the fiber or prevent trimerization of the fiber
protein. The
ligands are inserted at the end or within the linker region. Preferred ligands
include
those that target specific cell receptors or those that are used for coupling
to other
moieties such as biotin and avidin.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-70-
A preferred spacer includes a short 12 amino acid peptide linker composed of
a series of serines and alanine flanked by a proline residue at each end. One
of
ordinary skill in the art is familiar with the preparation of linkers to
accomplish
sufficient protein presentation and for altering the binding specificity of
the fiber
protein without compromising the cellular events that follow viral
internalization.
Moreover, within the context of this invention, preparation of modified fibers
having
ligands positioned internally within the fiber protein and at the carboxy
terminus as
described below are contemplated for use with the methods described herein.
The preparation of a fiber having a heterologous binding ligand is prepared
essentially as described in the above-cited paper. Briefly, for the ligand of
choice,
site-directed mutagenesis is used to insert the coding sequence for a linker
into the
3' end of the Ad5 fiber construct in pCLF as prepared in Example 1.
The 3' or antisense or mutagenic oligonucleotide encodes a preferred linker
sequence of ProSerAlaSerAlaSerAlaSerAlaProGIySer (SEQ ID NO: 20) followed by
a unique restriction site and two stop codons, respectively, to allow the
insertion of a
coding sequence for a selected heterologous ligand and to ensure proper
translation
termination. Flanking this linker sequence, the mutagenic oligonucloetide
contains
sequences that overlap with the vector sequence and allo its incorporation
into the
construct. Following mutagenesis of the pCLF sequence adding the linker and
stop
codon sequences, a nucleotide sequence encoding a preselected ligand is
obtained,
linkers corresponding to the unique restriction site in the modified construct
are
attached and then the sequence is cloned into linearized corresponding
restriction
site. The resultant fiber-ligand construct is then used to transfect 211 or
the
alternative cell packaging systems previously described to produce
complementing
viral vector packaging systems for use with the methods of this invention.
In a further embodiment, intact fiber genes from different Ad serotypes are
expressed by 211 cells or an alternative packaging system as previously
described.
A gene encoding the fiber protein of interest is first cloned to create a
plasmid
analogous to pCLF, and stable cell lines producing the fiber protein are
generated
as described above for Ad5 fiber. The adenovirus vector described which lacks
the
fiber gene is then propagated in the cell line producing the fiber protein
relevant for
the purpose at hand. As the only fiber gene present is the one in the
packaging
cells, the adenoviruses produced contain only the fiber protein of interest
and
therefore have the binding specificity conferred by the complementing protein.
Such
viral particles are used in studies such as those described above to determine
their
properties in experimental animal systems.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-71 -
Example 3
Deposit of Materials
The following cell lines and plasmids have been deposited on September 25,
1996, with the American Type Culture Collection, 10801 University Blvd,
Manassas,
Virginia, USA (ATCC) under the provisions of the Budapest Treaty on the
International Recognition of the Deposit of Microorganisms for the Purpose of
Patent
Procedure and the Regulations thereunder (Budapest Treaty):Plasmid pE4/Hygro
(accession number 97739), Plasmid pCLF (accession number 97737), 211 Cell Line
(accession number CRL-12193) and 211A Cel! Line (accession number CRL-12194)
The following virus, AdS.[igaL~F , deposit was deposited on January 15,
1999, with the ATCC as listed above and provided with accession number VR2636.
Additionally, plasmids pDV60, pDV67, pDV69, pDV80 and pDV90 were also
deposited at the ATCC on 5 January, 2000 and provided with accession numbers
PTA-1144, PTA-1145, PTA-1146, PTA-1147 and PTA-1148 respectively.
Example 4
Complementation of Fiber-Defective and Fiber-Modified Virus
The native fiber protein is a homotrimer (Henry L.J. et al., J. Virol.
68:5239-5246 (1994)), and trimerization is essential for assembly of the
penton/fiber
complex (Novelli A et al., J. Bivl. Chem. 266.9299-9303 (i 991 )). To assess
the
multimeric structure of the recombinant fiber protein produced by the cell
fines, cells
were labeled with 50 NCi/ml [35S] Translabel (ICN) for two hours at
37°C, lysed in
RIPA buffer, and fiber protein was immunoprecipitated as described (Harlow E
et a.,
Antibodies. Cold Spring Harbour Laboratory, Cold Spring Harbor (1988). Immune
complexes were collected on Protein A-Sepharose beads (Pierce), extensively
washed with RIPA buffer, and incubated at room temperature in 0.1 M
triethylamine,
pH 11.5 to release bound fiber protein. A portion of th~ precipitated fiber
was
electrophoresed on a 8% SDS-PAGE gel under denaturing (1 % SDS in loading
buffer, samples boiled for 5 minutes) or semi-native (0.1% SDS in loading
buffer,
samples not heated) conditions.
As seen in Fig. 13, lines 211 A, 2i i B, and 211 R, but not the control 293
cells,
expressed an immunologically reactive protein which migrated at the predicted
molecular weight for trimer (186 kD) under seminative conditions and for
monomer
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-72-
(62 kD) under denaturing conditions. The behavior of the precipitated fiber
was
indistinguishable from that of purified baculovirus-produced recombinant Ad2
fiber
(Wickham T et aL, Cell 73:309-319 (1993)) (the 58 kD Ad2 and 62 kD Ad5 fibers
have very similar mobilities under these conditions).
To determine whether the fiber-expressing lines could support the growth of a
fiber-defective adenovirus, we performed one-step growth experiments using the
temperature-sensitive fiber mutant Ad H5ts142 (the gift of Harold Ginsberg).
At the
restrictive temperature (39.5°C), this mutant produces an
underglycoslyated fiber
protein which is not incorporated into mature virions (Chee-Sheung C. C et
al., J.
Virol42: 932-950 (1982)). This results in the accumulation of non-infectious
viral
particles. We asked whether the recombinant fiber protein expressed by our
cell
lines could complement the H5ts142 defect and rescue viral growth.
Cell lines 293, 211 A, 211 B and 211 R (2 x 106 cells/sample) were infected
with
H5ts142 at 10 pfu/cell. 48 hours later, cells were detached with 25 mM EDTA
and
virus was harvested by four rapid freeze-thaw cycles. Debris was removed by a
10
minute spin at 1500 x g, and viral titers determined by fluorescent focus
assay (Thiel
J.F et al., Proc. Soc. Exp. Biol. Med. 125:892-895 (1967)) on SW480 cells with
a
polyclonal anti-penton base Ab (Wickham T et al., Cell 73:309-319 (1993)). As
shown in Fig. 14, the fiber mutant virus replicated to high titers in 293
cells at 32.5°C
(the permissive temperature), but to a much lower extent at the restrictive
temperature of 39.5°C. The fiber-producing packaging lines 211 A, 211
B, or 211 R
supported virus production at 39°C to levels within two- to three-fold
of those seen at
the permissive temperature in 293 cells, indicating that these cells provided
partial
complementation of the fiber defect.
Interestingly, virus yields from the fiber-producing cell lines were also
somewhat higher than those from 293 cells at 32.5°C (the 'permissive'
temperature).
This suggests that fiber produced by the ts142 virus may be partially
defective even
at the permissive temperature. Alternatively, a non-specific increase in
adenoviral
titer could result when viruses are grown in the packaging cells, by a
mechanism not
involving fiber complementation. However, it was found that viruses with wild
type
fiber genes (such as Ad.RSV~3gal) replicate to identical levels either in our
packaging lines or in 293 cells (data not shown). Taken together, these
results
demonstrate that the observed increase in H5ts142 growth is due to specific
complementation of the fiber mutation.
Even in the fiber-expressing cell lines, the fiber mutant grows to higher
titers at
32°C than at 39.5°C. This incomplete complementation may be due
to the
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
- 73 -
packaging lines' expression of fiber at a level somewhat below that seen in a
wild-
type infection (data not shown). A recent study reported an E4-deleted vector
which
coincidentally reduced fiber protein expression, resulting in a large
reduction in the
titer of virus produced (Brough et al., J. Virol. 70:6497-6501 (1996)).
Another
possibility is that the defective ts142 fiber protein produced at the
restrictive
temperature might form complexes with some of the wild type protein produced
by
the cells and prevent its assembly into particles.
Although the fiber proteins of different Ad serotypes differ in the length of
their
shaft domains and in their receptor-binding knob domains, the N-terminal
regions
responsible for interaction with the viral penton base are highly conserved
Arnberg
N et aL, Virology 227.239-244 (1997)) (Figure 15A). This suggests that fibers
from
many viral serotypes, with their different cell-binding specificities, may be
amenable
for use in producing gene delivery vectors.
In order to determine whether the recombinant Ad5 fiber produced by the
packaging cells could be incorporated into particles of another adenovirus
serotype,
adenovirus type 3 was grown either in fiber-producing cell lines or in 293
cells. Viral
particles were purified by two sequential centrifugations (3 h at 111,000 x g)
on
preformed 15-40% CsCI gradients to remove soluble cellular proteins and then
dialyzed extensively against 10 mM Tris-HCI, pH 8.1, 150 mM NaCI, 10%
glycerol.
Ad5 fiber protein was detected by immunoblotting using the polyclonal anti-
fiber
serum, followed by detection with a horseradish peroxidase-conjugated goat
anti-
rabbit antibody (Kirkegaard and Perry Laboratories) and the ECL
chemiluminescence substrate (Amersham). The purified Ad3 particles contained
Ad5 fiber protein after a single passage through a fiber-expressing cell line
but not
after passage through 293 cells
(Figure 15B). Previous work has demonstrated that Ad2 fiber is capable of
interacting in vitro with Ad3 penton base (Fender et al., Nature Biotech.15:52-
56
(1997)), and our result demonstrates that the type 5 fiber protein produced by
the
cells is capable of assembling into complete Ad3 particles.
A vector based on Ad5 but containing the gene for the Ad7 fiber protein has
been described (Gall J. et al., J. Virol. 70:2116-2123 (1996)), as well as Ads
containing chimeric fiber genes (Krasnykh et al., J. Virol. 70:6839-6846
(1996) and
Stevenson et al., J. Virol. 69.2850-2857 (1995)). Chimeric Ad5/Ad3 vectors
have
also been reported (Stevenson, S. et al., J. ViroL 71:4782-4790, (1997).
Addition of a
short peptide linker to the fiber in order to confer binding to a different
cellular
protein has also been reported (Michael etal., Gene Therapy2:660-668 (1995).
By
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-74-
using packaging technology such as that presented here, Ad vectors equipped
with
different fiber proteins may be produced simply by growth in cells expressing
the
fiber of interest, without the time-consuming step of generating a new vector
genome
for each application.
Replacing or modifying the fiber gene in the vector chromosome would also
require that the new fiber protein bind a receptor on the surface of the cells
it which it
is to be grown. The packaging cell approach will allow the generation of Ad
particles
containing a fiber which can no longer bind to its host cells, by a single
round of
growth in cells expressing the desired fiber gene. This will greatly expand
the
repertoire of fiber proteins which can be incorporated into particles, as well
as
simplifying the process of retargeting gene delivery vectors.
Finally, a novel fiber-independent pathway of infection has recently been
described in hematopoietic cells, in which penton base provides the initial
virus-cell
interaction by binding to integrin amb2 (Huang S. et al., J. Virol 70: 4502-
4508
(1996)). This suggests that viral particles lacking fiber protein may be
useful in
targeting gene delivery to specific cell types via this pathway.
Example 5
Preparation of Alternative TPLs
The present invention contemplates the use of tripartite leader sequences
(TPLs) that are useful in enhancing the expression of complementing adenoviral
proteins, particularly fiber protein, for use in preparing an adenoviral gene
delivery
vector. One preferred TPL is the complete Ad5 tripartite leader contained in
complementing vectors such as pDV67 and pDV69, both of which are prepared as
described below. The complete Ad5 TPL was constructed by assembling PCR
fragments. First, the third TPL exon (exon 3) (nt 9644-9731 of the Ad5 genome)
was
amplified from Ad5 genomic DNA using the synthetic oligonucleotide primers
5'CTCAACAATTGTGGATCCGTACTCC3'(SEQ ID NO: 28) and
5'GTGCTCAGCAGATCTTGCGACTGTG3' (SEQ ID NO: 29). The resulting product
was cloned to the BamHl and Bglll sites of p~E1 Sp1 a (Microbix Biosystems)
using
novel sites in the primers (shown in bold) to create plasmid pDV52. A fragment
corresponding to the first TPL exon (exon 1 ), the natural first intron
(intron 1 ), and
the second TPL exon (exon 2) (Ad5 nt 6049-7182) was then amplified using
primers
5'GGCGCGTTCGGATCCACTCTCTTCC3' (SEQ ID N0:30) and 5'CTA
CATGCTAGGCAGATCTCGTTCGGAG3' (SEQ ID NO: 31), and cloned into the
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-75-
BamHl site of pDV52 (again using novel sites in the primers) to create pDV55.
This plasmid contains a 1.2 kb BamHl/Bglll fragment consisting of the first
TPL exon,
the natural first intron, and the fused second and third TPL exons. The
nucleotide
sequence of the complete TPL containing the noted 5' and 3' restriction sites
is
shown in SEQ ID NO: 32 with the following nucleotide regions identified: 1-6
nt
BamHl site; 7-47 nt first leader segment (exon 1 ); 48-1068 nt natural first
intron
(intron 1 ); 1069-1140 nt second leader segment (exon 2); 1141-1146 nt fused
BamHl
and Bglll sites; 1147-1234 nt third leader segment (exon 3); and 1235-1240 nt
Bglll
site.
TPLs fragments containing two of the three exons, exons in non-native order,
or containing either the first or second TPL intron are also constructed for
use in
preparing complementing plasmids for use in the methods of the present
invention.
Briefly, DNA fragments containing any combination of 2 TPL exons can be
constructed as follows: Exon 1 is amplified from genomic DNA as prepared above
by using the oligonucleotides 5'GGCGCGTTCGGATCCACTCTCTTCC3'(SEQ ID
NO: 33) and 5'GGGAGTAGATCTCCCAACAG3' (SEQ ID NO: 34). Exon 2 is
similarly amplified from the same genomic DNA using oligonucleotides
5'CCCTTTTTTTTGGATCCCTCGCGG3' (SEQ ID NO: 35) and
5'CTACATGCTAGGCAGATCTCGTTCGGAG3' (SEQ ID NO: 36). Exon 3 is
amplified using the oligonucleotides 5'CTCAACAATTGTTGGATCCGTACTCC3'
(SEQ ID NO: 37) and 5'GTGCTCAGCAGATCTTGCGACTGTG3' (SEQ ID NO: 38).
The amplified exons are ligated together in any desired number and/or order by
virtue of the unique BamHl and Bglll restriction sites (bold) in the primers
for
subsequent ligation into a construct analogous to pDV67, prepared as described
below, for expression of viral structural genes.
Similarly, a fragment consisting of the first TPL exon (exon 1), the native
first
intron (intron 1 ), and the second TPL exon (exon 2) is produced by
amplification
from Ad5 genomic DNA with the oligonucleotide pair 5'GGCGCGTTCGGATCC
ACTCTCTTCC3' (SEQ ID NO: 39) and 5'CTACATGCTAGGCAGATCT
CGTTCGGAG3' (SEQ ID NO: 40). Finally, a fragment consisting of the second TPL
exon (exon 2), the native second intron (intron 2), and the third TPL exon
(exon 3) is
produced by amplification using the oligonucleotides 5'CCCTTTTTTTTGGATCC
CTCGCGG3' (SEQ ID NO: 41) and 5'GTGCTCAGCAGATCTTGCGACTGTG3'
(SEQ ID NO: 42). Either of the intron-containing fragments are used either
alone or
in combination with another TPL fragments) in constructs analogous to pDV67.
Introns in addition to adenoviral intron 1 used herein that have been shown to
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-76-
increase the expression of recombinant proteins when included in expression
constructs include SV40 VP1 intron, rabbit (i-globin intron among others. The
use of
these alternative intron sequences are contemplated for use in preparing a TPL
in
the present invention.
Example 6
Preparation and Use of Adenoviral Packaging Cell Lines
Containing Plasmids Containing Alternative TPLs
Plasmids were first constructed as described below that contained TPLs are
described above. The resultant plasmids containing different selectable
markers
such as neomycin or zeocin were then used to prepare stable cell lines for use
as
complementing vectors for preparing adenoviral vectors for use in the present
invention. In a preferred embodiment, the resulting cell lines represent
improvements over preexisting fiber-complementing cell lines in that fiber
expression
is enhanced with the use of alternative TPLs.
A. pDV60
pDV60 was constructed by inserting this TPL cassette of SEQ ID NO: 32 into
the BamHl site upstream of the Ad5 fiber gene in pcDNA3/Fiber, a neomycin
selectable plasmid, prepared as described in Example 1 and also as described
by
Von Seggern et al., J. Gen Virol., 79: 1461 (1998). The nucleotide sequence of
pDV60 is listed in SEQ ID NO: 43.
B. pDV61
To construct pDV61, an Asp718/Notl fragment containing the CMV promoter,
partial Ad5 TPL, wildtype Ad5 fiber gene, and bovine growth hormone terminator
was transferred from pCLF, prepared as described in Example 1 and also as
described by Von Seggern et al., J. Gen Virol., 79: 1461 (1998), to a zeocin
selectable cloning vector referred to as pCDNA3.1/Zeo (+) (commercially
available
from Invitrogen and the sequence is also available).
C. pDV67
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
_77_
In an analogous process, pDV67 containing complete TPL was constructed by
transferring an Asp 718/Xbal fragment from pDV60 to the pcDNA3.1/Zeo(+)
backbone. The nucleotide sequence of pDV67 is listed in SEQ ID NO: 44.
D. pDV69
To prepare pDV69 containing a modified fiber protein, the chimeric Ad3/Ad5
fiber gene was amplified from pGEM5TS3H (Stevenson et al., J. Virol., 69:
2850-2857, 1995)) using the primers 5'ATGGGAT
CAAGATGAAGCGCGCAAGACCG3' (SEQ ID NO: 45) and
5'CACTATAGCGGCCGCATTCTCAGTCATCTT3' (SEQ ID NO: 46), and cloned to
the BamHl and Notl sites of pcDNA3.1/Zeo(+) via novel BamHl and Notl sites
engineered into the primers to create pDV68. Finally, the complete TPL
fragment
described above was then added to the unique BamH1 site of pDV68 to create
pDV69. The nucleotide sequence of pDV69 is listed in SEQ ID NO: 47.
E. Preparation of Stable Adenovirus Packaging Cell Lines
E1-2a S8 cells are derivatives of the A549 lung carcinoma line (ATCC # CCL
185) with chromosomal insertions of the plasmids pGRES-2.E1 (also referred to
as
GRES-E1-SV40-Hygro construct and listed in SEQ ID NO: 48) and pMNeoE2a-3.1
(also referred to as MMTV-E2a-SV40-Neo construct and listed in SEQ ID NO: 49),
which provide complementation of the adenoviral E1 and E2a functions,
respectively. This line and its derivatives were grown in Richter's modified
medium
(BioWhitaker) + 10% FCS. E1-2a S8 cells were electroporated as previously
described (Von Seggern et al., J. Gen Virol., 79: 1461 (1998)) with pDV6l,
pDV67,
or with pDV69, and stable lines were selected with zeocin (600 Ng/ml). The
cell line
generated with pDV61 is designated 601. The cell line generated with pDV67 is
designated 633 while that generated with pDV69 is designated 644. Candidate
clones were evaluated by immunofluorescent staining with a polyclonal antibody
raised against the Ad2 fiber. Lines expressing the highest level of fiber
protein were
further characterized.
For the S8 cell complementing cell lines, to induce E1 expression, 0.3 NM of
dexamethasone was added to cell cultures 16-24 hours prior to challenge with
virus
for optimal growth kinetics. For preparing viral plaques, 5 X 105 cells/well
in 6 well
plates are prepared and pre-induced with the same concentration of
dexamethasone
CA 02359795 2001-07-12 pCT~, P00/00265
WO 00/42208
-78-
the day prior to infection with 0.5 NM included at a final concentration in
the agar
overlay after infection.
F. Development of Cell Lines for Complementation of E1%E2a- Vectors
This example shows the construction of S.8 cells
The Adenovirus 5 genome was digested with Scal enzyme, separated on an
agarose gel, and the 6,095 by fragment comprising the left end of the virus
genome
was isolated. The complete Adenovirus 5 genome is registered as Genbank
accession #M73260, incorporated herein by reference, and the virus is
available
from the American Type Culture Collection, Manassas, Virginia, U.S.A., under
accession number VR-5. The Scal 6,095 by fragment was digested further with
Clal
at by 917 and Bglll at by 3,328. The resulting 2,411 by Clal to Bglll fragment
was
purified from an agarose gel and ligated into the superlinker shuttle plasmid
pSE280
(Invitrogen, San Diego, CA), which was digested with Clal and Bglll, to form
pSE280-E. (Figure 23).
Polymerase chain reaction (PCR) was performed to synthesize DNA encoding
an Xhol and Sall restriction site contiguous with Adenovirus 5 DNA by 552
through
924. The primers which were employed were as follows:
5' end, Ad5 by 552-585:
5'-GTCACTCGAGGACTCGGTC-GACTGAAAATGAGACATATTATCTGCCACGGAC
C-3' (SEQ ID NO: 66)
3' end, Ad5 by 922-891:
5'-CGAGATCGATCACCTCCGGTAGAAGGTTTGGCATAG-3' (SEQ ID NO: 67)
This amplified DNA fragment (sometimes hereinafter referred to as Fragment
A) then was digested with Xhol and Clal, which cleaves at the native Clal site
(bp
917), and ligated to the Xhol and Clal sites of pSE280-E, thus reconstituting
the 5(
end of the E1 region beginning 8 by upstream of the ATG codon.
PCR then was performed to amplify Adenovirus 5 DNA from by 3,323 through
4,090 contiguous with an EcoRl restriction site. The primers which were
employed
were as follows:
5' end, Ad5 by 3323-3360:
5'-CATGAAGATCTGGAAGGTGCTGAGGTACGATGAGACC-3' (SEQ ID NO: 68)
3' end, Ad5 by 4090-4060:
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
_ 79 _
5'-GCGACTTAAGCAGTCAGCTG-AGACAGCAAGACACTTGCTTGATCCAAATCC-3
' (SEQ ID NO: 69)
This amplified DNA fragment (sometimes hereinafter referred to as Fragment
B) was digested with Bglll, thereby cutting at the Adenovirus 5 Bglll site (bp
3,382)
and EcoRl, and ligated to the Bglll and EcoRl sites of pSE280-AE to
reconstruct the
complete E1 a and E1 b region from Adenovirus 5 by 552 through 4,090. The
resulting plasmid is referred to as pSE280-E1 (Figure 23).
A construct containing the intact E1 alb region under the control of the
synthetic
promoter GRE5 was prepared as follows. The intact E1 a/b region was excised
from
pSE280-E1, which was modified previously to contain a BamHl site 3' to the E1
gene, by digesting with Xhol and BamHl. The Xhol to BamHl fragment containing
the
E1a/b fragment was cloned into the unique Xhol and BamHl sites of pGRES-2/EBV
(Figure 4, U.S. Biochemicals, Cleveland, Ohio) to form pGRES-E1 (Figure 24).
Bacterial transformants containing the final construct were identified.
Plasmid
DNA was prepared and purified by banding in CsTFA prior to use for
transfection of
cells.
Construction of plasmid including Adenovirus 5 E2A sequence.
The Adenovirus 5 genome was digested with BamHl and Spel, which cut at by
21,562 and 27,080, respectively. Fragments were separated on an agarose gel
and
the 5,518 by BamHl to Spel fragment was isolated. The 5,518 by BamHl to Spel
fragment was digested further with Smal, which cuts at by 23,912. The
resulting
2,350 by BamHl to Smal fragment was purified from an agarose gel, and ligated
into
the superlinker shuttle plasmid pSE280, and digested with BamHl and Smal to
form
pSE280-E2 BamHl-Smal (Figure 26).
PCR then was performed to amplify Adenovirus 5 DNA from the Smal site at by
23,912 through 24,730 contiguous with Nhel and EcoRl restriction sites. The
primers which were employed were as follows:
5' end, Ad5 by 24,732-24,708:
5'-CACGAATTCGTCAGCGCTTCTCGTCGCGTCCAAGACCC-3' (SEQ ID NO: 70)
3' end, Ad5 by 23,912-23,934:
5'-CACCCCGGGGAGGCGGCGGCGACGGGGACGGG-3' (SEQ ID NO: 71 )
This amplified DNA fragment was digested with Smal and EcoRl, and ligated to
the Smal and EcoRl sites of pSE280-E2 Bam-Sma to reconstruct the complete E2a
region from Ad5 by 24,730 through 21,562. The resulting construct is pSE280-
E2a.
(Figure 27.)
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
-80-
In order to convert the BamHl site at the 3' end of E2a to a Sall site, the
E2a
region was excised from pSE280-E2a by cutting with BamHl and Nhel, and
recloned
into the unique BamHl and Nhel sites of pSE280. (Figure 6.) Subsequently, the
E2a region was excised from this construction with Nhel and Sall in order to
clone
into the Nhel and Sall sites of the pMAMneo (Clonetech, Palo Alto, CA)
multiple
cloning site in a 5' to 3' orientation, respectively. The resulting construct
is
pMAMneo E2a. (Figure 27).
Bacterial transformants containing the final pMAMneo-E2a were identified.
Plasmid DNA was prepared and purified by banding in CsTFA. Circular plasmid
DNA was linearized at the Xmnl site within the ampicillin resistance gene of
pMAMneo-E2a, and further purified by the phenol/chloroform extraction and
ethanol
precipitation prior to use for transfection of cells.
Transfection and selection of cells.
In general, this process involved the sequential introduction, by calcium
phosphate precipitation, or other means of DNA delivery, of two plasmid
constructions each with a different viral gene, into a single tissue culture
cell. The
cells were transfected with a first construct and selected for expression of
the
associated drug resistance gene to establish stable integrants. Individual
cell clones
were established and assayed for function of the introduced viral gene.
Appropriate
candidate clones then were transfected with a second construct including a
second
viral gene and a second selectable marker. Transfected cells then were
selected to
establish stable integrants of the second construct, and cell clones were
established.
Cell clones were assayed for functional expression of both viral genes.
In order to determine the most suitable cell lines for the above-mentioned
transfections, sequential transfections and selections were carried out with
the
following parental cell types:
A549 (ATCC Accession No. CCL-185);
Hep-2 (ATCC Accession No. CCL-23); or
KB (ATCC Accession No. CCL-17).
Appropriate selection conditions were established for both 6418 and
hygromycin B for all three cell lines by standard kill curve determination.
Transfection of cell lines with plasmids including E1 and E2a regions.
pMAMNeo-E2a was linearized with Xmnl with the AmpR gene, introduced into
cells by transfection, and cells were selected for stable integration of this
plasmid by
6418 selection until drug resistant colonies arose. The clones were isolated
and
screened for E2a expression by staining for E2a protein with a polyclonal
antiserum,
WO 00/42208 CA 02359795 2001-07-12 pCT~, P00/00265
-81 -
and visualizing by immunofluorescence. E2a function was screened by
complementation of the temperature-sensitive mutant Ad5ts125 virus which
contains
a temperature-sensitive mutation in the E2a gene. (Van Der Vliet, et al., J.
Virology,
Vol. 15, pgs. 348-354 (1975)). Positive clones expressing the E2a gene were
identified and used for transfection with the 7 kb EcoRV to Xmnl fragment from
pGRES-E1 (Figure 5), which contains the GRE5 promoted E1 alb region plus the
hygromycinR gene. Cells were selected for hygromycin resistance and assayed
for
E1 a/b expression by staining with a monoclonal antibody for the E1 protein
(Oncogene Sciences, Uniondale; N.Y.). E1 function was assayed by ability to
complement an E1-deleted vector. At this point, expression and function of E2a
was
verified as described above, thus establishing the expression of both E1a/b
and E2a
in the positive cell clones.
One of the transfected A549 cell lines showed good E1 a/b and E2a expression
and was selected for further characterization. It was designated the S8 cell
line.
G. Preparation of Adenoviral Vectors Containing Ad5.~3gaI.~F Genome in
S8 Improved Fiber-Complementing Cell Lines
To prepare adenoviral vectors containing AdS.~gaI.OF in S8 cells containing
alternative forms of TPL for enhancing the expression of fiber proteins, the
protocol
as described in Example 2 for preparing AdS.~igaI.OF in 211 B cells was
followed
with the exception of pretreatment with 0.3 pM dexamethasone for 24 hours as
described above. Thus, viral particles with the wildtype Ad5 fiber protein on
their
surface and containing the fiberless AdS.~gaI.OF genome were produced in 633
cells. Particles produced in 644 cells also contained the fiberless
AdS.agaI.OF
genome, but had the chimeric 5T3H fiber protein, with the Ad3 fiber knob, on
their
surface.
The preparation of the cell lines and demonstration of stable nuclear
expression of either wild-type Ad5 fiber protein or chimeric Ad5/Ad3 protein
is shown
in Figure 20. In the figure, schematic diagrams are presented of the
constructs used
to generate the cell lines as well as immunofluorescence results indicating
the
presence of expressed fiber protein in the nucleus of the cells. An indirect
immunofluorescence assay of A549 based cell lines which stably express the
different Ad fibers is shown. Line 633 expresses the native Ad5 fiber protein
and line
644 expresses a chimeric fiber protein with the tail and shaft domains of the
Ad5
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-82-
protein and the knob domain of the Ad3 fiber. Previous work (Stevenson et al.,
1996)
showed that a virus containing this protein had the tropism expected for Ad3.
Thus, these viral preparations, prepared as described herein and in Example 2,
are useful for targeting delivery of Ad5.~3gaI.OF fiberless genome with either
wild-
type or modified fibers, embodiments of which uses have been previously
discussed
and as further exemplified with the pseudotyping and infectivity results
described in
Example 7.
Example 7
Pseudotyping and Infectivity of Recombinant Adenoviral Vectors
Produced with Improved Fiber-Complementing Cell Lines
A. Pseudotyping of Ad5.~3gaI.OF
To verify that adenoviral vectors were produced had altered tropisms, viral
particles were purified from either 633 (expressing wilt type Ad5 fiber) or
644 cells
(expressing the chimeric Ad5/Ad3 fiber) l0p.g of the purified particles were
Western
blotted and probed with a polyclonal rabbit antibody against the Ad2 fiber
(which
detects both the Ad5 and chimeric 5T3H fiber proteins.). Equal amounts of
purified
Ad.~igal.wt or Av9LacZ ( which has the chimeric fiber gene in the viral
chromosome)
were run as controls. The results are shown in Figure 21 where both fiber
proteins
were detectable confirming pseudotyping.
B. Infectivity of Cells with 633 or 644 Generated Virus Particles
The cell lines, 633 or 644, prepared as described above, were infected with
the
indicated number of particles/cell of Ad5.~3gaI.OF and virus particles
produced.
Virus was then used to infect, as previously described, selected cell lines as
shown
in Figure 22, including 211 B, MRC-5 human fibroblasts, A-10 rat aortic
endothelial
cells, and THP-1 human monocytic cells. Unbound virus was removed by washing
the cells and the cells were further incubated at 37°C for 48 hours.
Cells were then
fixed with glutaraldehyde and stained with X-gal. The percentage of stained
cells
was then determined by light microscopy where all experiments were done in
triplicate.
The results shown in Figure 22 indicate that adenoviral vectors could be
retargeted by pseudotyping using packaging cell lines expressing different
fiber
CA 02359795 2001-07-12
WO b0/42208 PCT/EP00/00265
-83-
proteins. The data marked with "none" indicates virus grown in 293 cells and
lacking
fiber, while "Ad5" indicates virus prepared in 633 cells (containing the wild
type fiber)
and Ad3 indicates virus prepared in 644 cells (containing the chimeric 5T3H
fiber.)
Particles containing either fiber were equally infectious on 211 B cells,
while MRC-5
fibroblasts and THP-1 cells were more readily infected by virus containing the
chimeric fiber. The A-10 rat endothelial cells were more readily infected by
particles
containing the wildtype Ad5 fiber protein.
Example 8
Targeted Gene Delivery Using Viral Vector
Particles Lacking Fiber Protein
An alternative mode of entry for adenoviral infection of hematopoietic cells
has been described by Huang, et al., J. Virol., 69:2257-2263 (1995) which does
not
involve the fiber protein-host cell receptor interaction. As infection of most
other cell
types does require the presence of fiber protein, vector particles which lack
fiber
may preferentially infect hematopoietic cells, such as monocytes or
macrophages.
To produce a fiber-free adenovirus vector particle, a vector lacking the fiber
gene as described above in Example 2A but containing a gene of interest for
delivery is amplified by growth in cells which do not produce a fiber protein,
such as
the 211 cells prepared in Example 1 or 293 or S8 cells as described herein,
thereby
producing large numbers of particles lacking fiber protein. The recovered
fiber-free
viral particles are then used to deliver the inserted gene of interest
following the
methods of this invention via targeting mechanisms provided by other regions
of the
adenoviral vector, i.e., via the native penton base.
A. Construction of an Adenovirus Vector Deleted for E1, E3,
and Fiber, and Carrying a Therapeutic Gene of Interest
A general method of constructing a fiber-deleted Ad vector containing a
therapeutic gene of interest (in this example, the Herpes Simplex Virus
Thymidine
Kinase (TK) gene) is described here. Linear viral DNA is isolated from a
preparation of AdS.~igaI.OF particles. This DNA is digested with the
restriction
enzyme Clal, which removes the leftmost viral sequences including the left
ITR, the
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-84-
packaging signals, and part of the SV40-driven ~3-galactosidase gene. The
large
Clal fragment with the remainder of the fiber-deleted viral genome is then
isolated by
centrifugation on a sodium chloride or sucrose gradient. The plasmid
pAdShuttIeTK,
which contains the left part of the Ad chromosome with an RSV-driven TK gene
inserted in place of the E1 region, is linearized by digestion with Notl. The
nucleotide sequence of the pAdShuttIeTK is shown in SEQ ID NO: 50. The large
Clal fragment of AdS.~gaI.OF and the linearized pAdShuttIeTK are cotransfected
into 211 B cells, and an infectious adenovirus genome is generated by
homologous
recombination. A virus deleted for E1, E3, and fiber that contains the TK
cassette in
the place of the E1 deletion is thus recovered. A virus containing any desired
therapeutic gene of interest can be created in this manner by replacing the TK
gene
of the example with the gene of interest.
An alternative method of constructing a fiber-deleted genome containing a
therapeutic gene (in this example the retinal degeneration-slow (RDS) gene
driven
by the CMV immediate early promoter) is described here. RDS is a protein
expressed in photoreceptors, and essential for their proper development and
functioning. RDS mutations have been implicated in retinal degenerative
disorders,
and transfer of the wildtype RDS gene by means of an Ad vector provides an
avenue
towards treating such disorders.
A plasmid (pDV50) analogous to p0E1 B~gal but containing a CMV-driven
RDS gene was constructed as follows. First, a fragment containing the CMV
promoter and enhancer was excised from pCHaMIEP by digestion with Hindlll,
filling
the overhanging ends with the large fragment of E. coli DNA polymerase 1,
ligation
of BamHl linkers (5'CGCGGATCCCG3' SEO ID NO: 51) to the blunt ends, and
digesting with BamHl. The resulting fragment was then ligated into the BamHl
site
of p0E1 sp1 a (Mikrobix) to create pDV45. A fragment containing the SV40
polyadenylation signal was amplified from pSV~3gal (Promega) using the
oligonucleotides 5'CTGACAAACTCAGATCTTGTTTATTG3' (SEQ ID NO: 51 ) and
5'GTCGACTCTAGAGGATCCAGA3' (SEQ ID NO: 52). This fragment was ligated
into the Bglll site of pDV45 to create pDV46, using the unique BamHl and Bglll
sites
(bold type) in the primers. Finally, the human RDS open reading frame was
amplified from the plasmid pRDS-T7 using the oligonucleotides 5'CCGGACTCT
AGATGGCAACCATGGCGCTAC3' (SEQ ID NO: 53) and 5'GGA
GGGGAAGCTTGGCCCTCAGCCAGCCTCT3' (SEQ ID NO: 54). This fragment
was inserted into the Hindlll and Xbal sites of pDV46, again using unique
restriction
sites in the primers, to create pDV50. pDV50 therefore contains a cassette
CA 02359795 2001-07-12
WO b0/42208 PCT/EP00/00265
-85-
consisting of the CMV promoter, the RDS open reading frame, and the SV40
terminator sequences inserted in place of the Ad5 E1 region.
In a manner analogous to the construction of Ad5.~3gaI.OF , pDV50 and
pDV44 are then co-transfected into 211 B cells, and an infectious Ad genome
(AdS.RDS.OF) is recovered. A fiber-deleted Ad vector containing any desired
gene
to be expressed can be constructed by replacing the RDS gene of this example
with
the gene of interest.
Example 9
Transient Transcomplementation
Human adenovirus type 5 (Ad5) is being developed as a vector for gene
therapy. Its ability to deliver therapeutic genes to cells is mediated by the
interaction
of the adenoviral fiber protein with the coxsackievirus-adenoviral receptor
(CAR).
Because a wide-range of cells express CAR, it can be difficult to use
adenoviruses
to deliver genes to specific cell types. One way to address this is to target
the virus
to a particular cell type by genetically altering the fiber. However, the
genetic
manipulations involved in cloning and production of the viruses with altered
fibers
can be time-consuming. Thus it would be a significant advancement in the field
of
adenoviral gene therapy to have a more streamlined system for testing modified
fiber
genes. An in vitro system has thus been developed that involves infection of
tissue
culture cells with a fiber-deleted Ad and transient co-transfection with a
plasmid
directing fiber expression. This system allows one to produce and evaluate
such
modified fibers in the context of a viral particle easily and quickly. In
addition this
system can be envisioned to actually produce therapeutic quantities of
adenoviral
vectors with modified fiber proteins, with such fibers having a new tropism
added by
insertion of a desired ligand into the fiber gene. These fibers may also have
the
natural tropism (i.e. binding to CAR) ablated.
Plasmids used were pDV60 and pDV55, prepared as described herein.
pDV60 is an pcDNA3.1-based expression plasmid that contains the CMV promoter,
Ad5 tripartite leader, an intron, and the Ad5 fiber gene sequence. pDV55
contains
no fiber gene and serves as the negative control. Ad5.~3gaI.~F and 211 B are
described above. 293T cells are identical to 293 cells except they express an
integrated SV40 large T antigen gene. HDF cells are human diploid fibroblasts.
293T cells express CAR and o~, integrins; HDF cells express a~, integrins but
no
CAR. Transfections with fiber expression plasmids were performed with
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-86-
Lipofectamine (GIBCO-BRL) using 20mg DNA and 50m1 Lipofectamine per l5cm
dish. Cells were maintained in DMEM supplemented with 10% fetal bovine serum.
The fiber deletion mutation of AdS.~gaI.OF is complemented in traps by
passaging virions through 211 B, a cell line that stably expresses functional
Ad5
fiber. The present system was designed to complement Ad5.~3gaI.OF by modified
fibers expressed from transfected episomal plasmids in 293T cells. The result
is a
simplified and rapid method to incorporate modified fibers on a viral particle
containing the Ad5.~3gaI.OF genome that does not require propagation of the
virus.
The feasibility of transcomplementation of AdS.~igaI.OF with episomal
fiber-expressing plasmids was demonstrated in the following experiment. 293T
cells
were transfected with one of two plasmids: pDV55, which expresses no fiber or
pDV60, which expresses wildtype Ad5 fiber. Fiber expression persists for at
least
six days, suggesting that the plasmid is stable as an episome for this amount
of time
Twenty-four hours after transfection, these cells were infected at 2000
particles/cell
with AdS.~gaI.~F passaged through 211 B cells. Seventy-two hours later, a
crude
viral lysate (CVL) was generated by exposing the cells to five freeze-thaw
cycles.
Viral particles were purified by cesium chloride gradient centrifugation. The
resulting
virions incorporated the fiber expressed from the episomal plasmid, as
confirmed by
Western blots performed with an antibody specific to the Ad5 fiber.
To demonstrate the functionality of these virions, the transduction efficiency
was tested. The virions containing no fiber (pDV55) or wildtype fiber (pDV60)
were
applied to monolayers of 293T and HDF cells at different multiplicity of
infection
(MOTs). 293T cells express CAR and a a"'integrins; HDF cells express a"
integrins
but no CAR. After 2 days, the cells were fixed and stained with X-gal to
detect the
~galactosidase reporter gene activity. The results showed low transduction
efficiency for the pDV55-complemented virions in both cell lines. As expected,
the
pDV60-complemented virions transduced 293T cells to a high degree but did not
transduce HDF cells, indicating that functional fiber proteins had been
expressed
from the episomal plasmids and incorporated into the virions. This
transduction
efficiency was comparable to or better than that of Ad5.~3gaI.OF virions
passaged
through the 211 B cells.
Episomal plasmid transcomplementation system is suitable for quickly
expressing and evaluating the properties of modified fibers in the context of
a viral
particle. Episomal plasmid transcomplementation will also be of great utility
for
quickly evaluating a bank of modified fibers for other binding properties,
including
novel tropism and the ablation of the native tropism. In addition to the rapid
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-87-
generation and testing of large numbers of modified fibers, there are other
advantages to the AdS.~igaI.OF transcomplementation system in terms of
production
and safety. Episomal plasmid transcomplementation has the inherent advantage
over transcomplementation in that it is not necessary to make a stable cell
line for
every modified fiber with which you want to complement AdS.~igaI.OF . Because
the
AdS.~igaI.OF is deleted in E1, E3 and fiber, there is an additional gene
deletion
compared to other first generation vectors. This makes Ad5.~3gaI.OF more
replication defective and presumably safer. In addition, the presence of the
fiber
gene deletion decreases the opportunity to generate replication-competent
virus via
recombination in the packaging cells. In terms of production a single Ad
vector prep
could be retargeted to any number of different cell types simply by
transfecting the
cells with the appropriate fiber-expression construct.
Example 10
Adenoviral Gene Delivery Vectors Containing the
Ad37 Fiber Protein
Adenovirus type 37 (subgroup D) has been associated with infections of the
eye
and genital tract, and may be useful for targeting these tissues or other
mucous
membranes, as well as other cell types. The tropism of Ad37 is due to the
binding
preference of its fiber protein, which binds to an as yet-unidentified
receptor located
on the surface of cells including Chang C, conjunctival epithelial cell line
(Huang et
al., J. Virology 73(4):2798-2802 (1999)). As this fiber directs viral
infection to cell
types different than those infected by AdS, it is likely to provide a method
for
targeting gene delivery. This example describes construction of packaging cell
lines
expressing the Ad37 fiber protein, and their use in generating particles of a
fiber-
deleted Ad vector (such as AdS.~igaI.OF ) containing this fiber protein. The
fiber
protein is attached to the viral capsid by binding to the penton base protein
through
its N-terminus, and the Ad37 fiber was modified in order to make its N-
terminal
sequence more closely match that of the Ad5 protein to ensure that it would
efficiently bind the Ad5 penton base in these vectors.
1. Construction of an Expression Plasmid for the Ad37 Fiber Protein
(pDV80)
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-88-
This plasmid uses the same regulatory elements as contained in pDV60,
pDV67, and pDV69 to express the Ad37 fiber in packaging lines, and was
constructed in two steps. First, the Ad37 fiber open reading frame was
amplified
from Ad37 genomic DNA (obtained from the ATCC - accession number VR-
929)using the synthetic oligonucleotides primers L37 (5' TGT CTT GGA TCC AAG
ATG AAG CGC GCC CGC CCC AGC GAA GAT GAC TTC 3') (SEQ ID NO: 56) and
37FR (5' AAA CAC GGC GGC CGC TCT TTC ATT CTT G 3') (SEQ ID NO: 57). L37
contains nucleotides that differ from the Ad37 genomic sequence in order to
add an
unique Bam H1 site (bold in the above sequence) and create point mutations to
make the N-terminal sequence of the fiber more closely match that of the Ad6
protein (underlined in the above sequence; the start codon is italicized).
37FR
incorporates changes to create a unique Not 1 site (bold). The PCR product was
inserted into the Bam H1 and Not 1 sites of pCDNA3.izeo(+) (Invitrogen) to
create
pDV78. The correct sequence of the Ad37 fiber gene, including the predicted
changes, was confirmed by sequencing.
Second, a 1.2 kb Bam H1/Bgl II fragment containing an adenovirus type 5
tripartite leader was excised from pDV55 (DVS 1999) and inserted into the Bam
H1
site of pDV78 to create pDV80 (SEQ ID N0:64)
2. Isolation of Cell Lines Expressing the Ad37 Fiber Protein
pDV80 DNA was purified using the Qiagen method and electroporated into
the adenovirus-complementing cell line E1-2a S8 (Gorziglia et al., J. Virology
70(5):4173-4178 (1996)) as previously described (Von Seggern, et al., J. Gen.
Virol.
79:1461-1418), and stable clones were selected with 600 Ng/ml zeocin
(Invitrogen).
Clones were expanded and screened for fiber expression by indirect
immunofluorescence using a rabbit polyclonal antibody directed against the
Ad37
fiber. Two clones (lines 705 and 731) that expressed the protein at a
uniformly high
level were selected for further study.
3. Production of Pseudotyped Ad Vector Particles
To generate vector particles equipped ('pseudotyped') with the Ad37 fiber
protein, the Ad37 fiber-expressing 705 cells were infected (approximately 1000
particles/cell) with AdS.~igaI.OF or with AdS.GFP.OF.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-89-
AdS.~gaI.OF is prepared as previously described. AdS.GFP.OF was
constructed by recombination in bacteria using a modification of the method of
(He,
et al., PNAS 95:2509-2514 (1998)). First, a fiber-deleted genomic plasmid was
constructed by removing the fiber gene from pAdEasyl (He, et al., PNAS 95:2509-
2514 (1998)). pDV43 (Von Seggern, et al., J. Virol. 73:1601-1608 (1999)) was
digested with Pac 1, the ends blunted by treatment with the large fragment of
E. coli
DNA polymerase and dNTPs, and the product re-ligated. The resulting plasmid,
pDV76, is identical to pDV43 except for loss of the Pac 1 site and contains
the right
end of the Ad5 genome with E3 and fiber deletions. A 4.2 kb fragment was
amplified
from pDV76 using the oligonucleotides primers 5' CGC GCT GAC TCT TA GGA
CTA GTT TC 3' (SEQ ID NO: 58) (including the unique Spe 1 site in the Ad5
genome, bold) and 5' GCG CTT AAT TAA CAT CAT CAA TAA TAT ACC TTA TTT T
3' (SEQ ID NO: 59) (including a novel Pac 1 site (bold) adjacent to the right
Ad5
ITR). This PCR fragment therefore contains nucleotides 27,082 to 35,935 of the
Ad5
genome with a deletion of nucleotides 28133 to 32743 (the E3 and fiber genes),
and
was used to replace the corresponding Spe 1/Pac 1 fragment of PAdEasyl to
create
pDV77.
E. coli strain BJ5183 was electroporated with a mixture of pDV77 and Pme 1-
linearized pAdTrack as described (He et al., 1998), and DNA was isolated from
kanamycin-resistant colonies. The resulting plasmid, pDV83, contains a
complete
E1-, E3-, and fiber-deleted Ad5 genome with a CMV-driven GFP reporter gene
inserted at the site of the E1 deletion. The full-length Ad chromosome was
isolated
by Pac 1 digestion, and transfected to the E1- and fiber-complementing 633
cells
(Von Seggern et al., J. Virol January 2000). The recovered virus was then
plaque
purified by plating on 633 cells and stocks were prepared.
Ad5-pseudotyped particles were generated by virus growth in 633 cells, which
express the wild type Ad5 fiber protein. Viral particles were isolated and
purified
over CsCI gradients as previously described (Von Seggern et al., J. Virol.
73:1601-
1608, 1999). For analysis of viral proteins, ten Ng of the purified particles
were
electrophoresed on 8-16% gradient gels and the protein transferred to nylon
membranes. The blot was then probed with rabbit polyclonal antibodies raised
against recombinant Ad37 fiber or Ad5 fiber or penton base proteins expressed
in
baculovirus-infected cells (Figure 27).
Example 11
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-90-
Construction of a Fiber Expression Construct Containing a Post-
Transcriptional Regulatory Element
Previous studies have shown that mRNA transcribed from the woodchuck
hepatitis virus (WHV) genome contains an element (the WHV post-transcriptional
regulatory element, or WPRE) which can increase expression of a protein
encoded
by the mRNA via a post-transcriptional mechanism (Loeb et al., Human Gene
Therapy 10:2295-2305 (1999)). The WPRE has also been shown to enhance
expression of transgenes delivered by retroviral vectors. (Zufferey, R. et
al., J. Virol.
73:2886-2892 (1999)). This example describes the construction of a fiber
expression construct (pDV90) containing a WPRE as well as the promoter and TPL
sequences as contained in pDV67.
A plasmid (pBS/WPRE) which contains the WPRE was obtained from Dr.
Thomas Hope, Salk Institute. Digestion of pBS/WPRE with CIa1 releases a 600 by
fragment containing the WPRE (nt 193-1684 of the WHV genome.) Following CIa1
digestion, the ends of this fragment were filled by treatment with the large
fragment
of E, coli DNA polymerase 1 in the presence of dNTPs to render them blunt.
pDV67
DNA was digested with Xba1 (which cuts at a unique site in the transcribed
region
downstream of the Ad5 fiber open reading frame) and the ends filled by the
same
treatment. The filled WPRE fragment was then ligated into the filled Xba 1
site of
pDV67 to create pDV90 (SEQ ID NO: 65). The sequence is found at GenBank
accession no. J04514 (entire genome) in Zufferey, R. et al., J. Virol. 73:2886-
2892
(1999).
pDV90 was electroporated into E1-2a SS cells and stable clones expressing
fiber isolated as described previously for pDV80.
Example 12
Construction of an Ad5 Fiber Protein with Heterologous
Peptide Sequences Inserted in the HI Loop
The receptor-binding knob domain of the Ad5 fiber protein contains several
surface loops which are attractive candidates for the insertion of
heterologous
peptide sequence, as an additional ligand for vector targeting. This example
describes the construction of a fiber gene which encodes a fiber protein
containing a
6 amino acid peptide linker in the HI loop, and retains the ability to
trimerize. The
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-91 -
modified gene also contains a unique novel restriction site at the position of
the
linker insertion to facilitate addition of the targeting ligand into the HI
loop.
The Ad5 fiber gene was amplified from Ad5 genomic DNA (ATCC accession
number VR-5) using the primers Fiber ATG (5' TGA AGC GCG CAA GAC CGT CTG
AAG 3') (SEQ ID NO: 60) and Fiber TAA (5' CAT AAC ACT GCA GAT TCT TTA
TTC TTG G 3') (SEQ ID NO: 61 ), and cloned to the Nde1 (filled with the large
fragment of E. coli DNA polymerase 1 in the presence of dNTPs) and Pst 1 sites
of
pT7-7 using a unique Pst 1 site (bold) in the 'Fiber TAA' oligo. The resulting
plasmid, pT7/fiber, was digested with Xba 1 and Pst 1 to excise the fiber
gene, which
was then cloned into the Pst 1 and Xba 1 sites of pUC119 to create pUC/fiber.
This
pUC-derived plasmid contains an origin for single-stranded DNA replication and
can
therefore be used to create template DNA for site-directed mutagenesis.
Site-directed mutagenesis was carried out according to the method of Kunkel
(T.A. Kunkel, PNAS 82:488-492 (1985)) using the oligonucleotide primer T542
(5'
GGT ACA CAG GAA ACA GGA GGT TCC GGA GGT GGA GGA GAC ACA ACT CC
3') (SEQ ID NO: 62). This results in the addition of 18 new bases (underlined)
encoding the sequence Gly Gly Ser Gly Gly Gly (SEQ ID NO: 63), with a novel
BspEi site (bold) for the addition of further sequences. The inserted sequence
is
between Thr542 and GIy543 of the Ad5 fiber protein, in the HI loop. The
modified
plasmid is termed pDVl4.
Finally, the modified fiber gene was excised from pDVl4 by digestion with Pst
1 and Xba 1 and cloned into the Pst 1 and Xba 1 sites of pGEM3Z (Promega) to
create pDVl8. In vitro transcription/translation experiments with pDVl8 (using
the
TNTT"" kit, Promega) demonstrated that the modified fiber gene encoded a
protein
which was capable of trimerizing.
Alternatively an Ad5 fiber open reading frame (ORF) is amplified from Ad5
genomic DNA (wildtype Ad5 was purchased from the ATCC) using the
oligonucleotides 5' ATG GGA TCC AAG ATG AAG CGC GCA AGA CCG 3' (SEQ ID
NO: 72) and 5' CAT AAC CTG CAG GAT TCT TTA TTC TTG GGC 3' (SEQ ID N0:,73)
and inserted into the BamM and Psf 1 sites of pGEM-3Zf(+) (Promega Inc.,
Madison, WI) via novel restriction sites (bold type) designed into the
primers. The 5'
oligonucleotide also contains a G to A change 3 nucleotides 5' of the initial
ATG
codon (underlined), designed to improve the consensus for translation
initiation.
Site-directed mutagenesis is performed by the method of Kunkel (Proc. Nat.
Acad. Sci. 82:488-492 (1985)), using the synthetic oligonucleotide 5' GGT ACA
CAG
GAA ACA GGA GGT TCC GGA GGT GGA GGA GAC ACA ACT CC 3' ((SEQ ID
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-92-
NO: 74). This operation introduced sequence (bold type) encoding 6 novel amino
acids (Gly Gly Ser Gly Gly Gly) immediately following Threonine 542 of the Ad5
fiber, and including a unique restriction site for the insertion of further
heterologous
sequences (underlined). The resulting plasmid (pDVl8A) contains the modified
fiber gene under the control of the T7 promoter in the parental pGEM-3Zf(+)
and
can be used for in vitro transcription/translation reactions to produce
labeled fiber
protein.
Example 13
Use of the Fiber Expression System to Retarget
('Pseudotype') Hybrid Ad/AAV Vectors
Adenoviral vectors which lack essentially all Ad genes ('helper-dependent' or
'gutless' vectors) have recently been developed. In a modification of this
idea,
vectors ('hybrid' vectors) which contain an adeno-associated virus (AAV) or
retroviral
genome have been generated. As AAV and retroviral genomes integrate into the
chromosome of the target cells, the hybrid Ad/AAV or Ad/retroviral vectors
have the
potential to provide very long-term gene expression.
Lieber et al., (J. Virol. 73(11):9314-9324) describe an Ad vector (Ad.AAV1)
which contains an AAV vector genome (a transgene insert flanked by the AAV
inverted terminal repeats) inserted into the E1 region. When 293 cells are
infected
by Ad.AAV1, recombination between the AAV sequences generates a minimal Ad
chromosome which carries the Ad inverted terminal repeats and packaging signal
flanking the AAV vector genome. This chromosome cannot direct the synthesis of
Ad proteins, but can be packaged into Ad vector particles. The remaining
unrecombined Ad chromosomes provide the Ad structural proteins in trans, and
both
the full-length and minimal genomes are packaged into particles. The particles
carrying the minimal Ad/AAV hybrid vector are then isolated by CsCI
centrifugation.
These particles have the capsid structure of adenovirus, and infect cells
using
the efficient fiber- and penton base-mediated pathway used by Ad. Following
infection, the hybrid genome is able to integrate into the cell's chromosomes
by
virtue of its AAV sequences. In this example, the AAV vector genome is
inserted
into the E1 region of a fiber-deleted vector, and the resulting vector is
grown in
packaging lines expressing either the Ad5 or Ad37 fiber proteins. The
particles
recovered therefore have the tropisms expected from the respective fiber
proteins
combined with the ability to integrate their AAV genome into target cells.
Such
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-93-
pseudotyping should be possible with any of a number of modified fiber
proteins, as
for the fiber-deleted vectors already described by us.
The Ad vector is constructed in a manner analogous to that described for
AdS.(igaI.OF , by recombination between pAd.AAV1 (Lieber et al. J. Virol.
73:9314-
9324, 1999) and pDV44 (as described earlier in the specification.) pAd.AAV1
carries an MLV promoter-driven secreted alkaline phosphatase gene (SEAP) as a
reporter, and an SV40-driven neomycin phosphotransferase (neo) gene to allow
the
selection of cells stable transduced by the AAV cassette. The resulting vector
(Ad.AAVI.OF) has the AAV vector cassette of Ad.AAV1 inserted into the E1
region
of a genome with the fiber deletion of AdS.~gaI.OF . Growth of Ad.AAVI.~F in
633
cells results in particles carrying the AAV genome and the Ad5 fiber, and
which have
the tropism associated with AdS. Growth of Ad.AAVI.OF in 705 cells produces
particles bearing the Ad37 fiber and therefore having its associated different
tropism.
Tropism is evaluated by infecting Chang C cells (which express the Ad37
receptor) and A549 cells which do not express this protein but do express the
Ad5
receptor (CAR). The extent of infection is monitored by assaying alkaline
phosphatase expression, and the fraction of cells stable transduced is assayed
by
selection with neomycin. By using purified recombinant Ad5 or Ad37 fiber
proteins
as competitors during infection, the usage of the expected receptors by the
pseudotyped particles is evaluated.
Example 14
Use of the Fiber Expression System to Retarget
('Pseudotype') Helper-dependent Ad Vectors
Gutted Ad vectors are those from which most or all viral genes have been
deleted. They are grown by co-infection of the producing cells with a "helper"
virus
(such as using an E1-deleted Ad vector). The helper virus traps-complements
the
missing Ad functions, including production of the viral structural proteins
needed for
particle assembly. In one embodiment of this invention, the helper virus is a
fiber-
deleted Ad (such as that described in Von Seggern et al., J. Virol. 73:1601-
1608
(1999)). The vector is prepared in a fiber expressing cell line such as has
been
previously described by Von Seggern et al., J. Gen. Virol. 79:1461-1468
(1998), Von
Seggern ef al., J. Virol. 74:354-362 (2000). All the necessary Ad proteins
except
fiber are provided by the fiber-deleted helper virus, and the particles are
equipped
with the particular fiber expressed by the host cells. A concern with gutted
vectors
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-94-
has been contamination of a vector preparation with residual helper virus. As
the
helper virus in one aspect of this invention is deleted for both E1 and for
fiber, it is
more replication defective and therefore safer than those currently used.
A helper adenovirus vector gename and a gutless adenoviral vector genome
are delivered to the packaging cells of the invention. The cells are
maintained under
standard cell maintenance or growth conditions, whereby the helper vector
genome
and the packaging cell together provide the complementing proteins for the
packaging of the adenoviral vector particle. Such gutless adenoviral vector
particles
are recovered by standard techniques. The helper vector genome may be
delivered
in the form of a plasmid or similar construct by standard transfection
techniques, or it
may be delivered through infection by a viral particle containing the genome.
Such
viral particle is commonly called a helper virus. Similarly, the gutless
adenoviral
vector genome may be delivered to the cell by transfection or viral infection.
The helper virus genome is preferably the fiberless adenovirus vector genome
as disclosed herein. Preferably, such genome also lacks the genes encoding the
adenovirus EiA and E1B proteins. More preferably, the genome further lacks the
adenovirus genes encoding the adenovirus E3 proteins. Alternatively, the genes
encoding such proteins may be present but mutated so that they do not encode
functional E1 A, E1 B and E3 proteins. Furthermore, such vector genome may not
encode other functional early proteins, such as E2A, E2B, and E4 proteins.
Alternatively, the genes encoding such other early proteins may be present but
mutated so that they do not encode functional proteins.
The helper virus genome is used in conjunction with the packaging cell of the
invention. As disclosed elsewhere herein, the packaging cell also provides
proteins
necessary for the complementation of the gutless vector so that an adenovirus
particle containing the gutless vector genome may be produced. Thus, the
packaging cell can provide wild-type or modified fiber protein as described
herein.
Alternatively, the cell could package a fiberless particle which could be used
by itself
or to which exogenously provided fiber could be added as described elsewhere
herein.
1n producing the gutless vectors, the helper virus genome is also packaged,
thereby producing helper virus. In order the minimize the amount of helper
virus
produced and maximize the amount of gutless vector particles produced, it is
preferable to delete or otherwise modify the packaging sequence in the helper
virus
genome, so that packaging of the genome is prevented or limited. Since the
gutless
vector genome will have a packaging sequence, it will be preferentially
packaged.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-95-
One way to do this is to mutate the packaging sequence by deleting one or more
of
the nucleotides comprising the sequence or otherwise mutating the sequence to
inactivate or hamper the packaging function. An alternative approach is to
engineer
the helper genome so that recombinase target sites flank the packaging
sequence
and to provide a recombinase in the packaging cell. The action of recombinase
on
such sites results in the removal of the packaging sequence from the helper
virus
genome. Preferably, the recombinase is provided by a nucleotide sequence in
the
packaging cell that encodes the recombinase. Most preferably, such sequence is
stably integrated into the genome of the packaging cell. Various kinds of
recombinase are known by those skilled in the art. The preferred recombinase
is
Cre recombinase, which operates on so-called lox sites, which are engineered
on
either side of the packaging sequence as discussed above. Further information
about the use of Cr~-IoxP recombination is found in U.S. Pat. No. 5,919,676
and
Morsy and Caskey, Molecular Medicine Today, Jan. 1999, pgs. 18-24, both
incorporated herein by reference.
This example demonstrates how the fiber-expressing packaging lines can be
used to generate pseudotyped particles of helper-dependent or'gutless' vectors
with
altered tropisms. As the gutless vectors lack many or all Ad genes, they must
be
grown as mixed cultures in the presence of a helper virus which can provide
the
missing functions. To date, such helper viruses have provided all Ad functions
except E1, and E1 is complemented by growth in 293 cells or the equivalent.
The
resulting virus particles are harvested, and the helper virus is typically
removed by
CsCI gradient centrifugation (the vector chromosome is generally shorter than
the
helper chromosome, resulting in a difference in buoyant density between the
two
particles).
An example of a gutless vector is pAdeRSVDys (Haecker et al., Human Gene
Therapy 71907-1914 (1996)). This plasmid contains a full-length human
dystrophin
cDNA driven by the RSV promoter and flanked by Ad inverted terminal repeats
and
packaging signals. 293 cells are infected with a first-generation Ad which
serves as
a helper virus, and then transfected with purified pAd~RSVDys DNA. Both the
helper Ad genome and the pAdORSVDys DNA are replicated as Ad chromosomes,
and packaged into particles using the viral proteins produced by the helper
virus.
Particles are isolated and the pAd~RSVDys-containing particles separated from
the
helper by virtue of their smaller genome size and therefore different density
on CsCI
gradients.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-96-
To generate pseudotyped particles containing the pAdORSVDys genome, the
vector is grown in either 633 or 705 cells and Ad5.~3gal.OF is used as a
helper virus.
As in the published method, both the AdS.(igaLOF and AdORSVDys genomes
replicate and are packaged into particles. The AdS.~gaI.OF h~lper provides all
the
essential Ad proteins except fiber, and the fiber protein is that produced by
the cells
(Ad5 fiber in 633 cells and Ad37 fiber in the case of 705 cells). The
particles
containing AdaRSVDys genomes are then isolated by centrifugation.
Tropism is evaluated by infecting Chang C cells (which express the Ad37
receptor) and A549 cells which do not express this protein but do express the
natural
Ad5 receptor (CAR). The extent of infection is assessed by immunofluorescence
staining of the infected cells with an anti-dystrophin antibody. By using
purified
recombinant Ad5 and Ad37 fiber proteins as competitors during infection, the
usage
of the expected receptors by the pseudotyped particles is evaluated.
Example 15
Targeting EBV Infected B Cells
There are a number of cell types, such as EBV-transformed B-lymphocytes,
that are involved in human disease which are not transducible using standard
Ad
vectors. To address this problem 'pseudotyped' AdS.(igaL~F particles
containing
either the wildtype Ad5 fiber protein or a chimeric fiber with the receptor-
binding
knob domain of the adenovirus type 3 (Ad3) fiber were generated. (Von Seggem
et
al., J. Virol. January, 2000). The strategy used for targeting the B-cells
should be
broadly applicable for targeting gene delivery to other specific cell types.
Cells and Viruses. THP-1, MRC-5, FaDu, and A-10 cells were purchased
from the ATCC. 211 B is a 293-derived cell line that expresses the wild-type
Ad5
fiber protein (Von Seggem et al., J. Gen. Virol. 79:1461-1468 (1998)). E1- 2a
(Gorziglia et al., J. Virvl. 70:4173-4178 (1996)) is an A549-derived cell line
which
complements adenoviral E1 and E2a functions. The JR, TO, and TL LCL lines were
established as described (Huang et aL, Proc. Natl. Acad. Sci. 94:8156-8161
(1997)
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
_97_
by EBV infection of lymphocytes from three normal donors. THP-1 and all LCL
lines
were maintained in RPMI 1640 medium (Gibco) + 10% fetal calf serum (FCS)
(Hyclone). 211 B, MRC-5, and A-10 cells were grown in DMEM + 10% FCS. E1-2a
and its derivatives were grown in Richter's modified medium (BioWhitaker) +
10%
FCS. Peripheral blood mononuclear cells were isolated from normal human blood
(General Clinical Research Center, Scripps Clinic) by sedimentation on Ficoll-
Paque
(Pharmacia) per the manufacturer's instructions. Wild type Ad2 and Ad3 were
purchased from the ATCC. Construction of AdS.~igal.wt and AdS.~igal.~F (Von
Seggern et al., J. Virol. 73:1601-1608 (1999)) has been previously described.
Av1 LacZ4 (Mitttereder et al., J. Virol. 70:7498-7509 (1996)) is a first-
generation Ad5
vector containing an RSV-driven a-galactosidase reporter gene. Av9LacZ4
(Stevenson et al., J. Virol. 71:4782-4790 (1997)) is identical to Av1 LacZ4
except that
the fiber gene in the vector chromosome was replaced by a recombinant gene
encoding a chimeric fiber protein with the receptor-binding domain of the Ad3
fiber
(Stevenson et al., J. virol. 69:2850-2857 (1995)). Accession numbers for the
above
are as follows. THP-1: TIB-202, MRC-5: CCL-171, FaDu: HTB-43, A-10: CRL-1476,
Ad2: VR-846, Ad3: VR-3.
DNA constructs. The complete Ad5 tripartite leader contained in pDV67 and
pDV69 was constructed by assembly of PCR fragments. pDV55 was constructed
similar to Example 5. This plasmid contains a 1.2 kb Bam HIlBgI II fragment
consisting of the first TPL exon, the natural first intron, and the fused
second and
third TPL exons. Finally, pDV60 was constructed by inserting this TPL cassette
into
the Bam HI site upstream of the Ad5 fiber gene in pcDNA3/Fiber (Von Seggern et
al., J. Gen. Virol. 79:1461-1468 (1998)). pDV61 and pDV67 were then
constructed
similar to example 6.
The chimeric Ad3/Ad5 fiber gene was amplified from pGEM5T3H (Stevenson
et al., J.Virol. 69:2850-2857 (1995) using the primers 5' ATG GGA TCC AAG ATG
AAG CGC GCA AGA CCG 3'(SEQ ID NO: 75) and 5' CAC TAT AGC GGC CGC ATT
CTC AGT CAT CTT 3' (SEQ ID N0:76) , and cloned to the Bam HI and Not I sites
of
pcDNA3.1/Zeo(+) via novel Bam HI and Not I sites (bold) engineered into the
primers to create pDV68. Finally, the complete TPL fragment described above
was
then added to the unique Bam HI site of this plasmid to create pDV69.
Construction of Stable Cell Lines. E1-2a cells were electroporated as
previously described (Von Seggern et al., J. Gen. Virol. 79:1461-1468 (1998))
with
pDV61, pDV67, or pDV69, and stable lines were selected with 600 Ng/ml Zeocin
(Invitrogen). Candidate clones were evaluated by immunofluorescence (Von
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-98-
Seggern et al., J. Gen. Virol. 79:1461-1468 (1998)) using a polyclonal
antibody
generated against the Ad2 fiber (Wickham et al., Cell 73:309-319 (1993). Those
lines expressing the highest level of nuclear fiber expression were further
characterized. Line 601 and 633 were produced by transfection of pDV61 and
pDV67, respectively, and therefore express the wildtype Ad5 fiber. Line 644
contains pDV69 and expresses the chimeric 5T3H fiber.
Virus Growth and Analysis. Adenovirus stocks were prepared in the indicated
cell lines, and plaque-titered on 633 cells essentially as described (Von
Seggern et
al., J. Virol. 73:1601-1608 (1999)). E1-2a cells (Gorziglia et al., J. Virol.
70:4173-
4178 (1996). and their derivatives contain a dexamethasone-inducible construct
for
complementation of Ela. 601, 633, or 644 cells were therefore treated with 0.3
uM
dexamethasone for 24 hours prior to infection, and 0.5 NM dexamethasone was
included in the overlay for plaque assays. Protein concentration of viral
preparations was determined using the BioRad Protein Assay (BioRad) with
purified
bovine serum albumin as a standard. Particle number was calculated using the
formula 1 Ng protein = 4 x 109 viral particles. Western blotting was performed
as
described (Von Seggern et al., J. Gen. Virol. 79:1461-1468 (1998)) using
polyclonal
rabbit antibodies raised against either the Ad2 (Wickham et al., Cell 73:309-
319
(1993) or Ad3 fibers (Stevenson et al., J. Virol. 71:4782-4790 (1997).
Determination of infection and binding to receptor was performed using
methods known to those of skill in the art. 2 x 105 cells in a total volume of
200 NI
were incubated with the indicated Ad preparation for three hours at 37
°C. Cells
were then washed twice with fresh medium, and returned to 37 °C. Two
days later,
cells were fixed and stained with X-gal and counted by light microscopy as
described
(Von Seggern et al., J. Virol. 73:1601-1608 (1999)). For competition assays,
cells
were pre-incubated on ice for one hour with either recombinant Ad3 fiber (10
Nglml)
purified from baculovirus or with a crude baculovirus lysate (100 Ng/ml)
containing
the recombinant Ad2 fiber protein (Wickham et al., Cell 73:309-319 (1997)).
Expression of oW integrins on cell surfaces was assayed by FACS assay using
monoclonal antibodies (the gift of David Cheresh, TSRI) against either a"~33
(LM609)
or a"~35 (P1 F6) as previously described (Huang et al., Proc. Natl. Acad. Sci.
USA
94:8156-8161 (1997)). For virus binding assays, CsCI-purified Ad2 or Ad3 was
labeled with '251 using lodogen tubes (Pierce). Free iodine was removed by
filtration
with a PD-10 Sephadex column (Pharmacia). Cells (1 x 106 cells in a volume of
200
NI either with or without a 100-fold excess of unlabeled virus) were rocked at
4 °C for
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-99-
two hours with 1 x 106 cpm of the labeled virus, washed three times with PBS
and
counted.
Altered in vitro tropism and infection of B lymphoid cell lines.
Experiments with genetically modified viruses showed that a number of
different cell types are more readily infected through interaction with the
Ad3
receptor than by the CAR-dependent pathway used by Ad5 (Stevenson et al., J.
Virol. 71:4782-4790 (1997)). In order to further evaluate the pseudotyping
system,
the ability of AdS.~igaI.OF carrying either the Ad5 or chimeric 5T3H fibers to
infect
several cell lines was assayed: FaDu (a head and neck tumor line), THP-1
monocytic cells, and MRC-5 fibroblasts were assayed. Consistent with the
previous
studies (Stevenson et al., J. Virol. 71:4782-4790 (1997)), use of the chimeric
Ad5/Ad3 fiber protein increased infection of all of these lines at equal
particle/cell
ratios. In contrast, the rat smooth muscle cell line A-10 was infected
somewhat more
readily by Ad5- than by Ad3-pseudotyped particles.
Gene delivery to EBV-infected B cells could allow the development of
therapies for a variety of lymphoproliferative disorders. For example, ex vivo
purging
of donor marrow to eliminate infected cells could reduce the risk of EBV-
associated
lymphoproliferative disease, and EBV-induced malignancies such as AIDS-
associated lymphoma are also potential targets. However, neither B cells nor
EBV-
transformed lymphoblastoid cell lines (LCLs) are efficiently infected by Ad5-
based
vectors. As the tropism of Ad3-pseudotyped particles appeared to be somewhat
broader, it was asked whether EBV-infected LCLs could be infected using this
system. The ability of Ad3-pseudotyped particles to infect LCLs generated by
EBV
infection of lymphocytes from three different normal human donors was tested.
In
agreement with previous reports, there was little or no infection of these by
particles
carrying the Ad5 fiber. In contrast, virus particles equipped with the
chimeric fiber
protein were able to efficiently infect all of these lines. At equal
particle/cell ratios,
all LCLs examined were at least 10-fold more infectible using the Ad3
receptor.
Further studies were performed to correlate the efficiency of infection with
the
level of attachment and internalization receptors expressed by the cells. The
three
LCL lines tested all bound very low levels of radiolabeled Ad2 particles,
indicating
that they expressed little or no CAR. In contrast, all three were able to
specifically
bind labeled Ad3 particles. This result suggested that fiber receptor
distribution was
largely responsible for the increased infection of these cells by Ad3-
pseudotyped
particles. Selective gene delivery to EBV infected cells. The results above
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
-100-
suggested that the minority of EBV-infected B cells present in donor marrow or
peripheral blood would be preferentially infected by vectors using the Ad3
receptor.
To test this hypothesis, a mixing experiment with normal uninfected peripheral
blood
mononuclear cells (PBMCs) and EBV-infected cells was performed. JR-LCL cells
were mixed at varying ratios with PBMCs isolated from a normal human donor,
and
the mixture was then infected with AdS.~igal.~F particles containing the 5T3H
fiber
protein. No infection of normal PBMCs alone was detected. Moreover, the
percent
of total cells infected increased with the fraction of JR cells added. These
experiments indicate that EBV-infected cells can be selectively infected in
vitro by
relatively short (3 hours) exposure to a retargeted Ad vector.
Example i6
Production of Adenovirus Vectors by Addition of Exogenous Fiber
The production of fiberless viruses by growth in a complementing cell line
may result in a preparation that also contains contaminating fiber genome
resulting
from recombination in the complementing cell lines. This disadvantage is
eliminated
by addition of exogenous fiber to a fiberless adenovirus vector.
Production of fiberless virus by standard methods may include a two-step
preparation protocol. This has been described in the earlier examples and is
briefly
described here again as follows:
Step I - amplification of fiber containing fiberless virus (AdS/F-/F+ or
AdS.agaI.OF - fiberless, but there is fiber on the surface, not encoded in
genome)
on 211 B cell line (which stably expresses fiber), followed by CsCI-
purification and
characterization.
Step II - preparation of virus particles lacking fiber (AdSF-) by infection of
S.8
cell line with Ad5/F-/F+, followed by CsCI purification and characterization.
This
produces a large stock of particles which do not contain fiber.
Step 1 is necessary because the infection efficiency of fiberless virus is
extremely low, e.g. the dose of 20,000 particles/cell of Ad5/~ig F- gives only
10%
infected cells.
Contrary to the above, the production of fiberless virus by addition of
exogenous fiber involves only a one-step protocol. The fiberless virus is
amplified
using the S.8 cell line with addition of exogenous fiber into infection media.
The
WO 00/42208 CA 02359795 2001-07-12 PCT/EP00/00265
- 101 -
amount of exogenous fiber necessary for production is very low, no more than
75ng
of purified fiber required per roller bottle. If desired the process may be
followed by
CsCI purification. As mentioned above, one advantage to this protocol is that
it
should provide no chance for recombination of adenovector during preparation.
A 10 roller bottle (RB) preparation of fiberless virus was made using the
above two-step procedure. The yield of adenovector was 6.6x10'2 particles -
total
Ad/~igalF-. A 1 RB preparation of fiberless adenovector was also made from the
same initial material using a one-step procedure with exogenous fiber. The
total
yield was 2.5x10" particles - Ad5~galF- (one step procedure).
DNA was isolated from both preparations and a PCR assay for fiber
contamination was performed. (Figure 28). The PCR assay was developed for
detection of very low amounts of fiber contamination, as low as 10-'$g. PCR
assay
showed much lower contamination for the preparation which was done by adding
exogenous fiber (10-'Sg one-step procedure) vs. 10-$ two-step procedure).
Therefore, less contamination was obtained by simpler one-step approach.
Experiments were done using soluble purified fiber which does not have His-
taq on the end (AdSFiber = 5F) and with His-taq on the end (AdSFiber His =
5FHis).
These experiments showed that addition of AdSFiber can dramatically increase
transduction efficiency of fiberless adenovector by simply adding it
exogenously to a
fiberless vector. The presence of the His tag on the AdSFiberHis doesn't have
any
effect.
The results of these experiments suggest that the fiber is self-assembling
with
the fiberless vector. This self-assembled virus can then infect cell through
the
normal entry pathway. (Figure 29) Also, an experiment was done using
conditioned
media from 633 cell line, which can stably express fiber. A Western blot
analysis for
633 condition media, showed that soluble fiber was present in the media during
the
period of cultivation of this cell line. Presence of soluble fiber in the
media gives the
possibility to increase transduction efficiency of fiberless adenovector on
the HDF
cell line. (Figure 30) Because the HDF cell line doesn't have a CAR-receptor,
it is
especially difficult to transduce this particular cell line, not only with
fiberless vector,
but also with regular fiber containing adenovector. Different amounts of 633
conditioned media (250N1, 500N1 or 10001) were added to infectious media
during
the incubation period with fiberless adenovector.
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-102-
This experiment also showed a role of soluble fiber in the process of cell
entry. The conclusion is that by adding any fiber (wild-type, mutated, with
ligand
fusions) as long as on has the wild-type shaft (or region necessary to bind
penton)
one can retarget fiberless vector with any genome inside (gutless, oncolytic,
expressing any transgene, etc.) to any cell type that your fiber is specific
to. The
advantage of this approach is that one does not have to make vectors with each
new
ligand. Just one fiberless vector need be made that can then be used to make
different backbones by adding an exogenous "targetable" fiber off the shelf.
The foregoing specification, including the specific embodiments and
examples, is intended to be illustrative of the present invention and is not
to be taken
as limiting. Numerous other variations and modifications can be effected
without
departing from the true spirit and scope of the present invention. All
publications,
patents and patent applications cited herein are incorporated by reference in
their
entirety into the present disclosure.
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-1-
SEQUENCE LISTING
<110> Novartis Ag
The SCRIPPS RESEARCH INSTITUTE
<120> ADENOVIRUS VECTORS, PACKAGING CELL LINES, COMPOSITIONS,
AND METHODS FOR PREPARATION AND USE
<130> 1294.0010001
<140>
<141>
<160> 76
<170> PatentIn Ver. 2.1
<210> 1
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 1
cggtacacag aattcaggag acacaactcc 30
<210> 2
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 2
gcctggatcc gggaagttac gtaacgtggg aaaac 35
<210> 3
<211> 12
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: linker
<900> 3
cgcggatccg cg 12
<210> 9
<211> 8710
<212> DNA
<213> Artificial Sequence
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-2-
<220>
<223> Description of Artificial Sequence: plasmid
<400> 4
cacctaaatt gtaagcgtta atattttgtt aaaattcgcg ttaaattttt gttaaatcag 60
ctcatttttt aaccaatagg ccgaaatcgg caaaatccct tataaatcaa aagaatagac 120
cgagataggg ttgagtgttg ttccagtttg gaacaagagt ccactattaa agaacgtgga 180
ctccaacgtc aaagggcgaa aaaccgtcta tcagggcgat ggcccactac gtgaaccatc 240
accctaatca agttttttgg ggtcgaggtg ccgtaaagca ctaaatcgga accctaaagg 300
gagcccccga tttagagctt gacggggaaa gccggcgaac gtggcgagaa aggaagggaa 360
gaaagcgaaa ggagcgggcg ctagggcgct ggcaagtgta gcggtcacgc tgcgcgtaac 420
caccacaccc gccgcgctta atgcgccgct acagggcgcg tcccattcgc cattcaggct 480
gcgcaactgt tgggaagggc gatcggtgcg ggcctcttcg ctattacgcc agctggcgaa 540
agggggatgt gctgcaaggc gattaagttg ggtaacgcca gggttttccc agtcacgacg 600
ttgtaaaacg acggccagtg aattgtaata cgactcacta tagggcgaat tgggtaccgg 660
gccccccctc gaggtcgacg gtatcgataa gcttgatatc gaattcagga gacacaactc 720
caagtgcata ctctatgtca ttttcatggg actggtctgg ccacaactac attaatgaaa 780
tatttgccac atcctcttac actttttcat acattgccca agaataaaga atcgtttgtg 840
ttatgtttca acgtgtttat ttttcaattg cagaaaattt caagtcattt ttcattcagt 900
agtatagccc caccaccaca tagcttatac agatcaccgt accttaatca aactcacaga 960
accctagtat tcaacctgcc acctccctcc caacacacag agtacacagt cctttctccc 1020
cggctggcct taaaaagcat catatcatgg gtaacagaca tattcttagg tgttatattc 1080
cacacggttt cctgtcgagc caaacgctca tcagtgatat taataaactc cccgggcagc 1140
tcacttaagt tcatgtcgct gtccagctgc tgagccacag gctgctgtcc aacttgcggt 1200
tgcttaacgg gcggcgaagg agaagtccac gcctacatgg gggtagagtc ataatcgtgc 1260
atcaggatag ggcggtggtg ctgcagcagc gcgcgaataa actgctgccg ccgccgctcc 1320
gtcctgcagg aatacaacat ggcagtggtc tcctcagcga tgattcgcac cgcccgcagc 1380
ataaggcgcc ttgtcctccg ggcacagcag cgcaccctga tctcacttaa atcagcacag 1440
taactgcagc acagcaccac aatattgttc aaaatcccac agtgcaaggc gctgtatcca 1500
aagctcatgg cggggaccac agaacccacg tggccatcat accacaagcg caggtagatt 1560
aagtggcgac ccctcataaa cacgctggac ataaacatta cctcttttgg catgttgtaa 1620
ttcaccacct cccggtacca tataaacctc tgattaaaca tggcgccatc caccaccatc 1680
ctaaaccagc tggccaaaac ctgcccgccg gctatacact gcagggaacc gggactggaa 1740
caatgacagt ggagagccca ggactcgtaa ccatggatca tcatgctcgt catgatatca 1800
atgttggcac aacacaggca cacgtgcata cacttcctca ggattacaag ctcctcccgc 1860
gttagaacca tatcccaggg aacaacccat tcctgaatca gcgtaaatcc cacactgcag 1920
ggaagacctc gcacgtaact cacgttgtgc attgtcaaag tgttacattc gggcagcagc 1980
ggatgatcct ccagtatggt agcgcgggtt tctgtctcaa aaggaggtag acgatcccta 2040
ctgtacggag tgcgccgaga caaccgagat cgtgttggtc gtagtgtcat gccaaatgga 2100
acgccggacg tagtcatatt tcctgaagca aaaccaggtg cgggcgtgac aaacagatct 2160
gcgtctccgg tctcgccgct tagatcgctc tgtgtagtag ttgtagtata tccactctct 2220
caaagcatcc aggcgccccc tggcttcggg ttctatgtaa actccttcat gcgccgctgc 2280
cctgataaca tccaccaccg cagaataagc cacacccagc caacctacac attcgttctg 2340
cgagtcacac acgggaggag cgggaagagc tggaagaacc atgttttttt ttttattcca 2400
aaagattatc caaaacctca aaatgaagat ctattaagtg aacgcgctcc cctccggtgg 2460
cgtggtcaaa ctctacagcc aaagaacaga taatggcatt tgtaagatgt tgcacaatgg 2520
cttccaaaag gcaaacggcc ctcacgtcca agtggacgta aaggctaaac ccttcagggt 2580
gaatctcctc tataaacatt ccagcacctt caaccatgcc caaataattc tcatctcgcc 2640
accttctcaa tatatctcta agcaaatccc gaatattaag tccggccatt gtaaaaatct 2700
gctccagagc gccctccacc ttcagcctca agcagcgaat catgattgca aaaattcagg 2760
ttcctcacag acctgtataa gattcaaaag cggaacatta acaaaaatac cgcgatcccg 2820
taggtccctt cgcagggcca gctgaacata atcgtgcagg tctgcacgga ccagcgcggc 2880
cacttccccg ccaggaacct tgacaaaaga acccacactg attatgacac gcatactcgg 2940
agctatgcta accagcgtag ccccgatgta agctttgttg catgggcggc gatataaaat 3000
gcaaggtgct gctcaaaaaa tcaggcaaag cctcgcgcaa aaaagaaagc acatcgtagt 3060
catgctcatg cagataaagg caggtaagct ccggaaccac cacagaaaaa gacaccattt 3120
ttctctcaaa catgtctgcg ggtttctgca taaacacaaa ataaaataac aaaaaaacat 3180
ttaaacatta gaagcctgtc ttacaacagg aaaaacaacc cttataagca taagacggac 3240
tacggccatg ccggcgtgac cgtaaaaaaa ctggtcaccg tgattaaaaa gcaccaccga 3300
cagctcctcg gtcatgtccg gagtcataat gtaagactcg gtaaacacat caggttgatt 3360
catcggtcag tgctaaaaag cgaccgaaat agcccggggg aatacatacc cgcaggcgta 3420
gagacaacat tacagccccc ataggaggta taacaaaatt aataggagag aaaaacacat 3480
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-3-
aaacacctga aaaaccctcc tgcctaggca aaatagcacc ctcccgctcc agaacaacat 3540
acagcgcttc acagcggcag cctaacagtc agccttacca gtaaaaaaga aaacctatta 3600
aaaaaacacc actcgacacg gcaccagctc aatcagtcac agtgtaaaaa agggccaagt 3660
gcagagcgag tatatatagg actaaaaaat gacgtaacgg ttaaagtcca caaaaaacac 3720
ccagaaaacc gcacgcgaac ctacgcccag aaacgaaagc caaaaaaccc acaacttcct 3780
caaatcgtca cttccgtttt cccacgttac gtaacttccc ggatccgcgg cattcacagt 3840
tctccgcaag aattgattgg ctccaattct tggagtggtg aatccgttag cgaggtgccg 3900
ccggcttcca ttcaggtcga ggtggcccgg ctccatgcac cgcgacgcaa cgcggggagg 3960
cagacaaggt atagggcggc gcctacaatc catgccaacc cgttccatgt gctcgccgag 4020
gcggcataaa tcgccgtgac gatcagcggt ccagtgatcg aagttaggct ggtaagagcc 4080
gcgagcgatc cttgaagctg tccctgatgg tcgtcatcta cctgcctgga cagcatggcc 4140
tgcaacgcgg gcatcccgat gccgccggaa gcgagaagaa tcataatggg gaaggccatc 4200
cagcctcgcg tcgcgaacgc cagcaagacg tagcccagcg cgtcggccgc catgccctgc 4260
ttcatccccg tggcccgttg ctcgcgtttg ctggcggtgt ccccggaaga aatatatttg 4320
catgtcttta gttctatgat gacacaaacc ccgcccagcg tcttgtcatt ggcgaattcg 4380
aacacgcaga tgcagtcggg gcggcgcggt cccaggtcca cttcgcatat taaggtgacg 4440
cgtgtggcct cgaacaccga gcgaccctgc agcgacccgc ttaacagcgt caacagcgtg 4500
ccgcagatcc cgggcaatga gatatgaaaa agcctgaact caccgcgacg tctgtcgaga 4560
agtttctgat cgaaaagttc gacagcgtct ccgacctgat gcagctctcg gagggcgaag 4620
aatctcgtgc tttcagcttc gatgtaggag ggcgtggata tgtcctgcgg gtaaatagct 4680
gcgccgatgg tttctacaaa gatcgttatg tttatcggca ctttgcatcg gccgcgctcc 4740
cgattccgga agtgcttgac attggggaat tcagcgagag cctgacctat tgcatctccc 4800
gccgtgcaca gggtgtcacg ttgcaagacc tgcctgaaac cgaactgccc gctgttctgc 4860
agccggtcgc ggaggccatg gatgcgatcg ctgcggccga tcttagccag acgagcgggt 4920
tcggcccatt cggaccgcaa ggaatcggtc aatacactac atggcgtgat ttcatatgcg 4980
cgattgctga tccccatgtg tatcactggc aaactgtgat ggacgacacc gtcagtgcgt 5040
ccgtcgcgca ggctctcgat gagctgatgc tttgggccga ggactgcccc gaagtccggc 5100
acctcgtgca cgcggatttc ggctccaaca atgtcctgac ggacaatggc cgcataacag 5160
cggtcattga ctggagcgag gcgatgttcg gggattccca atacgaggtc gccaacatct 5220
tcttctggag gccgtggttg gcttgtatgg agcagcagac gcgctacttc gagcggaggc 5280
atccggagct tgcaggatcg ccgcggctcc gggcgtatat gctccgcatt ggtcttgacc 5340
aactctatca gagcttggtt gacggcaatt tcgatgatgc agcttgggcg cagggtcgat 540 0
gcgacgcaat cgtccgatcc ggagccggga ctgtcgggcg tacacaaatc gcccgcagaa 5460
gcgcggccgt ctggaccgat ggctgtgtag aagtactcgc cgatagtgga aaccgacgcc 5520
ccagcactcg tccgagggca aaggaatagg ggagatgggg gaggctaact gaaacacgga 5580
aggagacaat accggaagga acccgcgcta tgacggcaat aaaaagacag aataaaacgc 5640
acgggtgttg ggtcgtttgt tcataaacgc ggggttcggt cccagggctg gcactctgtc 5700
gataccccac cgagacccca ttggggccaa tacgcccgcg tttcttcctt ttccccaccc 5760
caccccccaa gttcgggtga aggcccaggg ctcgcagcca acgtcggggc ggcaggccct 5820
gccatagcca ctggccccgt gggttaggga cggggtcccc catggggaat ggtttatggt 5880
tcgtgggggt tattattttg ggcgttgcgt ggggtctggt ccacgactgg actgagcaga 5940
cagacccatg gtttttggat ggcctgggca tggaccgcat gtactggcgc gacacgaaca 6000
ccgggcgtct gtggctgcca aacacccccg acccccaaaa accaccgcgc ggatttctgg 6060
cgcccagtgc cgtcgaccgg tcatggctgc gccccgacac ccgccaacac ccgctgacgc 610
gccctgacgg gcttgtctgc tcccggcatc cgcttacaga caagctgtga ccgtctccgg 6180
gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgaggc agccggatca 6240
taatcagcca taccacattt gtagaggttt tacttgcttt aaaaaacctc cccacctccc 6300
cctgaacctg aaacataaaa tgaatgcaat tgttgttgtt aacttgttta ttgcagctta 6360
taatggttac aaataaagca atagcatcac aaatttcaca aataaagcat ttttttcact 6420
gcattctagt tgtggtttgt ccaaactcat caatgtatct tatcatgtct ggatccacta 6480
gttctagagc ggccgccacc gcggtggagc tccagctttt gttcccttta gtgagggtta 6540
atttcgagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg ttatccgctc 6600
acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg tgcctaatga 6660
gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc gggaaacctg 6720
tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt gcgtattggg 6780
cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct gcggcgagcg 6840
gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga taacgcagga 6900
aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg 6960
gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg ctcaagtcag 7020
aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg aagctccctc 7080
gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt tctcccttcg 7140
ggaagcgtgg cgctttctca tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt 7200
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc 7260
ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact ggcagcagcc 7320
actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg 7380
tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct gctgaagcca 7440
gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac cgctggtagc 7500
ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat 7560
cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg ttaagggatt 7620
ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta aaaatgaagt 7680
tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca atgcttaatc 7740
agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc ctgactcccc 7800
gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc tgcaatgata 7860
ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc agccggaagg 7920
gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat taattgttgc 7980
cgggaagcta, gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt tgccattgct 8040
acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc cggttcccaa 8100
cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag ctccttcggt 8160
cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt tatggcagca 8220
ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac tggtgagtac 8280
tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg cccggcgtca 8340
atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat tggaaaacgt 8400
tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc gatgtaaccc 8460
actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc tygggtgagca 8520
aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa atgttgaata 8580
ctcatactct tcctttttca atattattga agcatttatc agggttattg tctcatgagc 8640
ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg cacatttccc 8700
8710
cgaaaagtgc
<210> 5
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 5 30
atgggatcca agatgaagcg cgcaagaccg
<210> 6
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 6 30
cataacgcgg ccgcttcttt attcttgggc
<210> 7
<211> 7198
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 7
gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60
gccatagcca ctggccccgt gggttaggga cggggtcccc catggggaa
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-5-
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gcttggtacc 900
gagctcggat ccaagatgaa gcgcgcaaga ccgtctgaag ataccttcaa ccccgtgtat 960
ccatatgaca cggaaaccgg tcctccaac.t gtgccttttc ttactcctcc ctttgtatcc 1020
cccaatgggt ttcaagagag tccccctggg gtactctctt tgcgcctatc cgaacctcta 1080
gttacctcca atggcatgct tgcgctcaaa atgggcaacg gcctctctct ggacgaggcc 1140
ggcaacctta cctcccaaaa tgtaaccact gtgagcccac ctctcaaaaa aaccaagtca 1200
aacataaacc tggaaatatc tgcacccctc acagttacct cagaagccct aactgtggct 1260
gccgccgcac ctctaatggt cgcgggcaac acactcacca tgcaatcaca ggccccgcta 1320
accgtgcacg actccaaact tagcattgcc acccaaggac ccctcacagt gtcagaagga 1380
aagctagccc tgcaaacatc aggccccctc accaccaccg atagcagtac ccttactatc 1440
actgcctcac cccctctaac tactgccact ggtagcttgg gcattgactt gaaagagccc 1500
atttatacac aaaatggaaa actaggacta aagtacgggg ctcctttgca tgtaacagac 1560
gacctaaaca ctttgaccgt agcaactggt ccaggtgtga ctattaataa tacttccttg 1620
caaactaaag ttactggagc cttgggtttt gattcacaag gcaatatgca acttaatgta 1680
gcaggaggac taaggattga ttctcaaaac agacgcctta tacttgatgt tagttatccg 1740
tttgatgctc aaaaccaact aaatctaaga ctaggacagg gccctctttt tataaactca 1800
gcccacaact tggatattaa ctacaacaaa ggcctttact tgtttacagc ttcaaacaat 1860
tccaaaaagc ttgaggttaa cctaagcact gccaaggggt tgatgtttga cgctacagcc 1920
atagccatta atgcaggaga tgggcttgaa tttggttcac ctaatgcacc aaacacaaat 1980
cccctcaaaa caaaaattgg ccatggccta gaatttgatt caaacaaggc tatggttcct 2040
aaactaggaa ctggccttag ttttgacagc acaggtgcca ttacagtagg aaacaaaaat 2100
aatgataagc taactttgtg gaccacacca gctccatctc ctaactgtag actaaatgca 2160
gagaaagatg ctaaactcac tttggtctta acaaaatgtg gcagtcaaat acttgctaca 2220
gtttcagttt tggctgttaa aggcagtttg gctccaatat ctggaacagt tcaaagtgct 2280
catcttatta taagatttga cgaaaatgga gtgctactaa acaattcctt cctggaccca 2340
gaatattgga actttagaaa tggagatctt actgaaggca cagcctatac aaacgctgtt 2400
ggatttatgc ctaacctatc agcttatcca aaatctcacg gtaaaactgc caaaagtaac 2460
attgtcagtc aagtttactt aaacggagac aaaactaaac ctgtaacact aaccattaca 2520
ctaaacggta cacaggaaac aggagacaca actccaagtg catactctat gtcattttca 2580
tgggactggt ctggccacaa ctacattaat gaaatatttg ccacatcctc ttacactttt 2640
tcatacattg cccaagaata aagaagcggc cgctcgagca tgcatctaga gggccctatt 2700
ctatagtgtc acctaaatgc tagagctcgc tgatcagcct cgactgtgcc ttctagttgc 2760
cagccatctg ttgtttgccc ctcccccgtg ccttccttga ccctggaagg tgccactccc 2820
actgtccttt cctaataaaa tgaggaaatt gcatcgcatt gtctgagtag gtgtcattct 2880
attctggggg gtggggtggg gcaggacagc aagggggagg attgggaaga caatagcagg 2940
catgctgggg atgcggtggg ctctatggct tctgaggcgg aaagaaccag ctggggctct 3000
agggggtatc cccacgcgcc ctgtagcggc gcattaagcg cggcgggtgt ggtggttacg 3060'
cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg ctcctttcgc tttcttccct 3120
tcctttctcg ccacgttcgc cggctttccc cgtcaagctc taaatcgggg catcccttta 3180
gggttccgat ttagtgcttt acggcacctc gaccccaaaa aacttgatta gggtgatggt 3240
tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc ctttgacgtt ggagtccacg 3300
ttctttaata gtggactctt gttccaaact ggaacaacac tcaaccctat ctcggtctat 3360
tcttttgatt tataagggat tttggggatt tcggcctatt ggttaaaaaa tgagctgatt 3420
taacaaaaat ttaacgcgaa ttaattctgt ggaatgtgtg tcagttaggg tgtggaaagt 3480
ccccaggctc cccaggcagg cagaagtatg caaagcatgc atctcaatta gtcagcaacc 3540
aggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat 3600
tagtcagcaa ccatagtccc gcccctaact ccgcccatcc cgcccctaac tccgcccagt 3660
tccgcccatt ctccgcccca tggctgacta atttttttta tttatgcaga ggccgaggcc 3720
gcctctgcct ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt 3780
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-6-
tgcaaaaagc tcccgggagc ttgtatatcc attttcggat ctgatcaaga gacaggatga 3840
ggatcgtttc gcatgattga acaagatgga ttgcacgcag gttctccggc cgcttgggtg 3900
gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga tgccgccgtg 3960
ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct gtccggtgcc 4020
ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac gggcgttcct 4080
tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct attgggcgaa 4140
gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt atccatcatg 4200
gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt cgaccaccaa 4260
gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt cgatcaggat 4320
gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag gctcaaggcg 4380
cgcatgcccg acggcgagga tctcgtcgtg acccatggcg atgcctgctt gccgaatatc 4440
atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg tgtggcggac 4500
cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg cggcgaatgg 4560
gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg catcgccttc 4620
tatcgccttc ttgacgagtt cttctgagcg ggactctggg gttcgaaatg accgaccaag 4680
cgacgcccaa cctgccatca cgagatttcg attccaccgc cgccttctat gaaaggttgg 4740
gcttcggaat cgttttccgg gacgccggct ggatgatcct ccagcgcggg gatctcatgc 4800
tggagttctt cgcccacccc aacttgttta ttgcagctta taatggttac aaataaagca 4860
atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt 4920
ccaaactcat caatgtatct tatcatgtct gtataccgtc gacctctagc tagagcttgg 4980
cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca 5040
acatacgagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg agctaactca 5100
cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc 5160
attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgctt 5220
cctcgctcac tgactcgctg cgctcggtcg ttcggctgcg gcgagcggta tcagctcact 5280
caaaggcggt aatacggtta tccacagaat caggggataa cgcaggaaag aacatgtgag 5340
caaaaggcca gcaaaaggcc aggaaccgta aaaaggccgc gttgctggcg tttttccata 5400
ggctccgccc ccctgacgag catcacaaaa atcgacgctc aagtcagagg tggcgaaacc 5460
cgacaggact ataaagatac caggcgtttc cccctggaag ctccctcgtg cgctctcctg 5520
ttccgaccct gccgcttacc ggatacctgt ccgcctttct cccttcggga agcgtggcgc 5580
tttctcaatg ctcacgctgt aggtatctca gttcggtgta ggtcgttcgc tccaagctgg 5640
gctgtgtgca cgaacccccc gttcagcccg accgctgcgc cttatccggt aactatcgtc 5700
ttgagtccaa cccggtaaga cacgacttat cgccactggc agcagccact ggtaacagga 5760
ttagcagagc gaggtatgta ggcggtgcta cagagttctt gaagtggtgg cctaactacg 5820
gctacactag aaggacagta tttggtatct gcgctctgct gaagccagtt accttcggaa 5880
aaagagttgg tagctcttga tccggcaaac aaaccaccgc tggtagcggt ggtttttttg 5940
tttgcaagca gcagattacg cgcagaaaaa aaggatctca agaagatcct ttgatctttt 6000
ctacggggtc tgacgctcag tggaacgaaa actcacgtta agggattttg gtcatgagat 6060
tatcaaaaag gatcttcacc tagatccttt taaattaaaa atgaagtttt aaatcaatct 6120
aaagtatata tgagtaaact tggtctgaca gttaccaatg cttaatcagt gaggcaccta 6180
tctcagcgat ctgtctattt cgttcatcca tagttgcctg actccccgtc gtgtagataa 6240
ctacgatacg ggagggctta ccatctggcc ccagtgctgc aatgataccg cgagacccac 6300
gctcaccggc tccagattta tcagcaataa accagccagc cggaagggcc ga,gcgcagaa 6360
gtggtcctgc aactttatcc gcctccatcc agtctattaa ttgttgccgg gaagctagag 6420
taagtagttc gccagttaat agtttgcgca acgttgttgc cattgctaca ggcatcgtgg 6480
tgtcacgctc gtcgtttggt atggcttcat tcagctccgg ttcccaacga tcaaggcgag 6540
ttacatgatc ccccatgttg tgcaaaaaag cggttagctc cttcggtcct ccgatcgttg 6600
tcagaagtaa gttggccgca gtgttatcac tcatggttat ggcagcactg cataattctc 6660
ttactgtcat gccatccgta agatgctttt ctgtgactgg tgagtactca accaagtcat 6720
tctgagaata gtgtatgcgg cgaccgagtt gctcttgccc ggcgtcaata cgggataata 6780
ccgcgccaca tagcagaact ttaaaagtgc tcatcattgg aaaacgttct tcggggcgaa 6840
aactctcaag gatcttaccg ctgttgagat ccagttcgat gtaacccact cgtgcaccca 6900
actgatcttc agcatctttt actttcacca gcgtttctgg gtgagcaaaa acaggaaggc 6960
aaaatgccgc aaaaaaggga ataagggcga cacggaaatg ttgaatactc atactcttcc 7020
tttttcaata ttattgaagc atttatcagg gttattgtct catgagcgga tacatatttg 7080
aatgtattta gaaaaataaa caaatagggg ttccgcgcac atttccccga aaagtgccac 7140_
7148
ctgacgtc
<210> 8
<211> 7469
<212> DNA
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
_7_
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 8
gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggac tatttacggt aaactgccca cttggcag~c gcctgggtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatgg catt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gcttggtacc 900
gagctcggat ctgaattcga gctcgctgtt gggctcgcgg ttgaggacaa actcttcgcg 960
gtctttccag tactcttgga tcggaaaccc gtcggcctcc gaacggtact ccgccaccga 1020
gggacctgag cgagtccgca tcgaccggat cggaaaacct ctcgagaaag gcgtctaacc 1080
agtcacagtc gcaaggtagg ctgagcaccg tggcgggcgg cagcgggtgg cggtcggggt 1140
tgtttctggc ggaggtgctg ctgatgatgt aattaaagta ggcggtcttg agacggcgga 1200
tggtcgaggt gaggtgtggc aggcttgaga tccaagatga agcgcgcaag accgtctgaa 1260
gataccttca accccgtgta tccatatgac acggaaaccg gtcctccaac tgtgcctttt 1320
cttactcctc cctttgtatc ccccaatggg tttcaagaga gtccccctgg ggtactctct 1380
ttgcgcctat ccgaacctct agttacctcc aatggcatgc ttgcgctcaa aatgggcaac 1440
ggcctctctc tggacgaggc cggcaacctt acctcccaaa atgtaaccac tgtgagccca 1500
cctctcaaaa aaaccaagtc aaacataaac ctggaaatat ctgcacccct cacagttacc 1560
tcagaagccc taactgtggc tgccgccgca cctctaatgg tcgcgggcaa cacactcacc 1620
atgcaatcac aggccccgct aaccgtgcac gactccaaac ttagcattgc cacccaagga 1680
cccctcacag tgtcagaagg aaagctagcc ctgcaaacat caggccccct caccaccacc 1740
gatagcagta cccttactat cactgcctca ccccctctaa ctactgccac tggtagcttg 1800
ggcattgact tgaaagagcc catttataca caaaatggaa aactaggact aaagtacggg 1860
gctcctttgc atgtaacaga cgacctaaac actttgaccg tagcaactgg tccaggtgtg 1920
actattaata atacttcctt gcaaactaaa gttactggag ccttgggttt tgattcacaa 1980
ggcaatatgc aacttaatgt agcaggagga ctaaggattg attctcaaaa cagacgcctt 2040
atacttgatg ttagttatcc gtttgatgct caaaaccaac taaatctaag actaggacag 2100
ggccctcttt ttataaactc agcccacaac ttggatatta actacaacaa aggcctttac 2160
ttgtttacag cttcaaacaa ttccaaaaag cttgaggtta acctaagcac tgccaagggg 2220
ttgatgtttg acgctacagc catagccatt aatgcaggag atgggcttga atttggttca 2280
cctaatgcac caaacacaaa tcccctcaaa acaaaaattg gccatggcct agaatttgat 2340
tcaaacaagg ctatggttcc taaactagga actggcctta gttttgacag cacaggtgcc 2900
attacagtag gaaacaaaaa taatgataag ctaactttgt ggaccacacc agctccatct 2460
cctaactgta gactaaatgc agagaaagat gctaaactca ctttggtctt aacaaaatgt 2520
ggcagtcaaa tacttgctac agtttcagtt ttggctgtta aaggcagttt ggctccaata 2580
tctggaacag ttcaaagtgc tcatcttatt ataagatttg acgaaaatgg agtgctacta 2640
aacaattcct tcctggaccc agaatattgg aactttagaa atggagatct tactgaaggc 2700
acagcctata caaacgctgt tggatttatg cctaacctat cagcttatcc aaaatctcac 2760
ggtaaaactg ccaaaagtaa cattgtcagt caagtttact taaacggaga caaaactaaa 2820
cctgtaacac taaccattac actaaacggt acacaggaaa caggagacac aactccaagt 2880
gcatactcta tgtcattttc atgggactgg tctggccaca actacattaa tgaaatattt 2940
gccacatcct cttacacttt ttcatacatt gcccaagaat aaagaagcgg ccgctcgagc 3000_
atgcatctag agggccctat tctatagtgt cacctaaatg ctagagctcg ctgatcagcc 3060
tcgactgtgc cttctagttg ccagccatct gttgtttgcc cctcccccgt gccttccttg 3120
accctggaag gtgccactcc cactgtcctt tcctaataaa atgaggaaat tgcatcgcat 3180
tgtctgagta ggtgtcattc tattctgggg ggtggg9tgg ggcaggacag caagggggag 3240
gattgggaag acaatagcag gcatgctggg gatgcggtgg gctctatggc ttctgaggcg 3300
gaaagaacca gctggggctc tagggggtat ccccacgcgc cctgtagcgg cgcattaagc 3360
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
_g_
gcggcgggtg tggtggttac gcgcagcgtg accgctacac ttgccagcgc cctagcgccc 3420
gctcctttcg ctttcttccc ttcctttctc gccacgttcg ccggctttcc ccgtcaagct 3480
ctaaatcggg gcatcccttt agggttccga tttagtgctt tacggcacct cgaccccaaa 3540
aaacttgatt agggtgatgg ttcacgtagt gggccatcgc cctgatagac ggtttttcgc 3600
cctttgacgt tggagtccac gttctttaat agtggactct tgttccaaac tggaacaaca 3660
ctcaacccta tctcggtcta ttcttttgat ttataaggga ttttggggat ttcggcctat 3720
tggttaaaaa atgagctgat ttaacaaaaa tttaacgcga attaattctg tggaatgtgt 3780
gtcagttagg gtgtggaaag tccccaggct ccccaggcag gcagaagtat gcaaagcatg 3840
catctcaatt agtcagcaac caggtgtgga aagtccccag gctccccagc aggcagaagt 3900
atgcaaagca tgcatctcaa ttagtcagca accatagtcc cgcccctaac tccgcccatc 3960
ccgcccctaa ctccgcccag ttccgcccat tctccgcccc atggctgact aatttttttt 4020
atttatgcag aggccgaggc cgcctctgcc tctgagctat tccagaagta gtgaggaggc 4080
ttttttggag gcctaggctt ttgcaaaaag ctcccgggag cttgtatatc cattttcgga 4140
tctgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg attgcacgca 4200
ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca acagacaatc 4260
ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt tctttttgtc 4320
aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg aggcagcgcg gctatcgtgg 4380
ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg 4440
gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatctca ccttgctcct 4500
gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct tgatccggct 4560
acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac tcggatggaa 4620
gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc c~ccagccgaa 4680
ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg atctcgtcgt gacccatggc 4740
gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt catcgactgt 4800
ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg tgatattgct 4860
gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc 4920
gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgagc gggactctgg 4980
ggttcgaaat gaccgaccaa gcgacgccca acctgccatc acgagatttc gattccaccg 5040
ccgccttcta tgaaaggttg ggcttcggaa tcgttttccg ggacgccggc tggatgatcc 5100
tccagcgcgg ggatctcatg ctggagttct tcgcccaccc caacttgttt attgcagctt 5160
ataatggtta caaataaagc aatagcatca caaatttcac aaataaagca tttttttcac 5220
tgcattctag ttgtggtttg tccaaactca tcaatgtatc ttatcatgtc tgtataccgt 5280
cgacctctag ctagagcttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt 5340
atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg 5400
cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg 5460
gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc 5520
gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc 5580
ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata 5640
acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 5700
cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 5760
caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 5820
gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 5880
tcccttcggg aagcgtggcg ctttctcaat gctcacgctg taggtatctc agttcggtgt 5940
aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 6000
ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 6060
cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 6120
tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc 6180
tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 6240
ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 6300
aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt 6360
aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa 6420
aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat 6480
gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct 6590
gactccccgt cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg 6600
caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag 6660
ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta 6720_
attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg 6780
ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg 6840
gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct 6900
ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta 6960
tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg 7020
gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc 7080
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-9-
cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg 7140
gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga 7200
tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg 7260
ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat 7320
gttgaatact catactcttc ctttttcaat attattgaag catttatcag ggttattgtc 7380
tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca 7440
catttccccg aaaagtgcca cctgacgtc 7469
<210> 9
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 9
tgcttaagcg gccgcgaagg agaagtcc 28
<210> 10 v
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 10
ccgagctagc gactgaaaat gag 23
<210> 11
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 11
cctctcgaga gacagcaaga cac 23
<210> 12
<211> 11152
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 12
aagcttgggc agaaatggtt gaactcccga gagtgtccta cacctagggg agaagcagcc 60
aaggggttgt ttcccaccaa ggacgacccg tctgcgcaca aacggatgag cccatcagac 120
aaagacatat tcattctctg ctgcaaactt ggcatagctc tgctttgcct ggggctattg 180
ggggaagttg cggttcgtgc tcgcagggct ctcacccttg actcttttaa tagctcttct 240
gtgcaagatt acaatctaaa caattcggag aactcgacct tcctcctgag gcaaggacca 300
cagccaactt cctcttacaa gccgcatcga ttttgtcctt cagaaataga aataagaatg 360
cttgctaaaa attatatttt taccaataag accaatccaa taggtagatt attagttact 420
atgttaagaa atgaatcatt atcttttagt actattttta ctcaaattca gaagttagaa 480
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-10-
atgggaatag aaaatagaaa gagacgctca acctcaattg aagaacaggt gcaaggacta 540
ttgaccacag gcctagaagt aaaaaaggga aaaaagagtg tttttgtcaa aataggagac 600
aggtggtggc aaccagggac ttatagggga ccttacatct acagaccaac agatgccccc 660
ttaccatata caggaagata tgacttaaat tgggataggt gggttacagt caatggctat 720
aaagtgttat atagatccct cccttttcgt gaaagactcg ccagagctag acctccttgg 780
tgtatgttgt ctcaagaaga aaaagacgac atgaaacaac aggtacatga ttatatttat 840
ctaggaacag gaatgcactt ttggggaaag attttccata ccaaggaggg gacagtggct 900
ggactaatag aacattattc tgcaaaaact catggcatga gttattatga atagccttta 960
ttggcccaac cttgcggttc ccagggctta agtaagtttt tggttacaaa ctgttcttaa 1020
aacgaggatg tgagacaagt ggtttcctga cttggtttgg tatcaaaggt tctgatctga 1080
gctctgagtg ttctattttc ctatgttctt ttggaattta tccaaatctt atgtaaatgc 1140
ttatgtaaac caagatataa aagagtgctg attttttgag taaacttgca acagtcctaa 1200
cattcacctc ttgtgtgttt gtgtctgttc gccatcccgt ctccgctcgt cacttatcct 1260
tcactttcca gagggtcccc ccgcagaccc cggcgaccct caggtcggcc gactgcggca 1320
gctggcgccc gaacagggac cctcggataa gtgacccttg tctctatttc tactatttgg 1380
tgtttgtctt gtattgtctc tttcttgtct ggctatcatc acaagagcgg aacggactca 1440
ccatagggac caagctagcg actgaaaatg agacatatta tctgccacgg aggtgttatt 1500
accgaagaaa tggccgccag tcttttggac cagctgatcg aagaggtact ggctgataat 1560
cttccacctc ctagccattt tgaaccacct acccttcacg aactgtatga tttagacgtg 1620
acggcccccg aagatcccaa cgaggaggcg gtttcgcaga tttttcccga ctctgtaatg 1680
ttggcggtgc aggaagggat tgacttactc acttttccgc cggcgcccgg ttctccggag 1740
ccgcctcacc tttcccggca gcccgagcag ccggagcaga gagccttggg ~ccggtttct 1800
atgccaaacc ttgtaccgga ggtgatcgat cttacctgcc acgaggctgg ctttccaccc 1860
agtgacgacg aggatgaaga gggtgaggag tttgtgttag attatgtgga gcaccccggg 1920
cacggttgca ggtcttgtca ttatcaccgg aggaatacgg gggacccaga tattatgtgt 1980
tcgctttgct atatgaggac ctgtggcatg tttgtctaca gtaagtgaaa attatgggca 2040
gtgggtgata gagtggtggg tttggtgtgg taattttttt tttaattttt acagttttgt 2100
ggtttaaaga attttgtatt gtgatttttt taaaaggtcc tgtgtctgaa cctgagcctg 2160
agcccgagcc agaaccggag cctgcaagac ctacccgccg tcctaaaatg gcgcctgcta 2220
tcctgagacg cccgacatca cctgtgtcta gagaatgcaa tagtagtacg gatagctgtg 2280
actccggtcc ttctaacaca cctcctgaga tacacccggt ggtcccgctg tgccccatta 2340
aaccagttgc cgtgagagtt ggtgggcgtc gccaggctgt ggaatgtatc gaggacttgc 2400
ttaacgagcc tgggcaacct ttggacttga gctgtaaacg ccccaggcca taaggtgtaa 2460
acctgtgatt gcgtgtgtgg ttaacgcctt tgtttgctga atgagttgat gtaagtttaa 2520
taaagggtga gataatgttt aacttgcatg gcgtgttaaa tggggcgggg cttaaagggt 2580
atataatgcg ccgtgggcta atcttggtta catctgacct catggaggct tgggagtgtt 2640
tggaagattt ttctgctgtg.cgtaacttgc tggaacagag ctctaacagt acctcttggt 2700
tttggaggtt tctgtggggc tcatcccagg caaagttagt ctgcagaatt aaggaggatt 2760
acaagtggga atttgaagag cttttgaaat cctgtggtga gctgtttgat tctttgaatc 2820
tgggtcacca ggcgcttttc caagagaagg tcatcaagac tttggatttt tccacaccgg 2880
ggcgcgctgc ggctgctgtt gcttttttga gttttataaa ggataaatgg agcgaagaaa 2940
cccatctgag cggggggtac ctgctggatt ttctggccat gcatctgtgg agagcggttg 3000
tgagacacaa gaatcgcctg ctactgttgt cttccgtccg cccggcgata ataccgacgg 3060
aggagcagca gcagcagcag gaggaagcca ggcggcggcg gcaggagcag agcccatgga 3120
acccgagagc cggcctggac cctcgggaat gaatgttgta caggtggctg aactgtatcc 3180
agaactgaga cgcattttga caattacaga ggatgggcag gggctaaagg gggtaaagag 3240
ggagcggggg gcttg'tgagg ctacagagga ggctaggaat ctagctttta gcttaatgac 3300
cagacaccgt cctgagtgta ttacttttca acagatcaag gataattgcg ctaatgagct 3360
tgatctgctg gcgcagaagt attccataga gcagctgacc acttactggc tgcagccagg 3420
ggatgatttt gaggaggcta ttagggtata tgcaaaggtg gcacttaggc cagattgcaa 3480
gtacaagatc agcaaacttg taaatatcag gaattgttgc tacatttctg ggaacggggc 3540
cgaggtggag atagatacgg aggatagggt ggcctttaga tgtagcatga taaatatgtg 3600
gccgggggtg cttggcatgg acggggtggt tattatgaat gtaaggttta ctggccccaa 3660
ttttagcggt acggttttcc tggccaatac caaccttatc ctacacggtg taagcttcta 3720
tgggtttaac aatacctgtg tggaagcctg gaccgatgta agggttcggg gctgtgcctt 3780
ttactgctgc tggaaggggg tggtgtgtcg ccccaaaagc agggcttcaa ttaagaaatg 3840
cctctttgaa aggtgtacct tgggtatcct gtctgagggt aactccaggg tgcgccacaa 3900
tgtggcctcc gactgtggtt gcttcatgct agtgaaaagc gtggctgtga ttaagcataa 3960
catggtatgt ggcaactgcg aggacagggc ctctcagatg ctgacctgct cggacggcaa 4020
ctgtcacctg ctgaagacca ttcacgtagc cagccactct cgcaaggcct ggccagtgtt 4080
tgagcataac atactgaccc gctgttcctt gcatttgggt aacaggaggg gggtgttcct 4140
accttaccaa tgcaatttga gtcacactaa gatattgctt gagcccgaga gcatgtccaa 4200
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-11-
ggtgaacctg aacggggtgt ttgacatgac catgaagatc tggaaggtgc tgaggtacga 4260
tgagacccgc accaggtgca gaccctgcga gtgtggcggt aaacatatta ggaaccagcc 4320
tgtgatgctg gatgtgaccg aggagctgag gcccgatcac ttggtgctgg cctgcacccg 9380
cgctgagttt ggctctagcg atgaagatac agattgaggt actgaaatgt gtgggcgtgg 4440
cttaagggtg ggaaagaata tataaggtgg gggtcttatg tagttttgta tctgttttgc 4500
agcagccgcc gccgccatga gcaccaactc gtttgatgga agcattgtga gctcatattt 4560
gacaacgcgc atgcccccat gggccggggt gcgtcagaat gtgatgggct ccagcattga 4620
tggtcgcccc gtcctgcccg caaactctac taccttgacc tacgagaccg tgtctggaac 4680
gccgttggag actgcagcct ccgccgccgc ttcagccgct gcagccaccg cccgcgggat 4740
tgtgactgac tttgctttcc tgagcccgct tgcaagcagt gcagcttccc gttcatccgc 4800
ccgcgatgac aagttgacgg ctcttttggc acaattggat tctttgaccc gggaacttaa 4860
tgtcgtttct cagcagctgt tggatctgcg ccagcaggtt tctgccctga aggcttcctc 4920
ccctcccaat gcggtttaaa acataaataa aaaaccagac tctgtttgga tttggatcaa 4980
gcaagtgtct tgctgtctct cgagggatct ttgtgaagga accttacttc tgtggtgtga 5040
cataattgga caaactacct acagagattt aaagctctaa ggtaaatata aaatttttaa 5100
gtgtataatg tgttaaacta ctgattctaa ttgtttgtgt attttagatt ccaacctatg 5160
gaactgatga atgggagcag tggtggaatg cctttaatga ggaaaacctg ttttgctcag 5220
aagaaatgcc atctagtgat gatgaggcta ctgctgactc tcaacattct actcctccaa 5280
aaaagaagag aaaggtagaa gaccccaagg actttccttc agaattgcta agttttttga 5340
gtcatgctgt gtttagtaat agaactcttg cttgctttgc tatttacacc acaaaggaaa 5400
aagctgcact gctatacaag aaaattatgg aaaaatattc tgtaaccttt ataagtaggc 5460
ataacagtta taatcataac atactgtttt ttcttactcc acacaggcat ~gagtgtctg 5520
ctattaataa ctatgctcaa aaattgtgta cctttagctt tttaatttgt aaaggggtta 5580
ataaggaata tttgatgtat agtgccttga ctagagatca taatcagcca taccacattt 5640
gtagaggttt tacttgcttt aaaaaacctc ccacacctcc ccctgaacct gaaacataaa 5700
atgaatgcaa ttgttgttgt taacttgttt attgcagctt ataatggtta caaataaagc 5760
aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg 5820
tccaaactca tcaatgtatc ttatcatgtc tggatccggc tgtggaatgt gtgtcagtta 5880
gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat 5990
tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc 6000
atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta 6060
actccgccca gttccgccca ttctccgccc catggctgac taattttttt tatttatgca 6120
gaggccgagg ccgcctcggc ctctgagcta ttccagaagt agtgaggagg cttttttgga 6180
ggcctaggct tttgcaaaaa gcttggacac aagacaggct tgcgagatat gtttgagaat 6240
accactttat cccgcgtcag ggagaggcag tgcgtaaaaa gacgcggact catgtgaaat 6300
actggttttt agtgcgccag atctctataa tctcgcgcaa cctattttcc cctcgaacac 6360
tttttaagcc gtagataaac aggctgggac acttcacatg agcgaaaaat acatcgtcac 6420
ctgggacatg ttgcagatcc atgcacgtaa actcgcaagc cgactgatgc cttctgaaca 6480
atggaaaggc attattgccg taagccgtgg cggtctggta ccgggtgcgt tactggcgcg 6540
tgaactgggt attcgtcatg tcgataccgt ttgtatttcc agctacgatc acgacaacca 6600
gcgcgagctt aaagtgctga aacgcgcaga aggcgatggc gaaggcttca tcgttattga 6660
tgacctggtg gataccggtg gtactgcggt tgcgattcgt gaaatgtatc caaaagcgca 6720
ctttgtcacc atcttcgcaa aaccggctgg tcgtccgctg gttgatgact atgttgttga 6780
tatcccgcaa gatacctgga ttgaacagcc gtgggatatg ggcgtcgtat tcgtcccgcc 6840
aatctccggt cgctaatctt ttcaacgcct ggcactgccg ggcgttgttc tttttaactt 6900
caggcgggtt acaatagttt ccagtaagta ttctggaggc tgcatccatg acacaggcaa 6960
acctgagcga aaccctgttc aaaccccgct ttaaacatcc tgaaacctcg acgctagtcc 7020
gccgctttaa tcacggcgca caaccgcctg tgcagtcggc ccttgatggt aaaaccatcc 7080
ctcactggta tcgcatgatt aaccgtctga tgtggatctg gcgcggcatt gacccacgcg 7140
aaatcctcga cgtccaggca cgtattgtga tgagcgatgc cgaacgtacc gacgatgatt 7200
tatacgatac ggtgattggc taccgtggcg gcaactggat ttatgagtgg gccccggatc 7260
tttgtgaagg aaccttactt ctgtggtgtg acataattgg acaaactacc tacagagatt 7320
taaagctcta aggtaaatat aaaattttta agtgtataat gtgttaaact actgattcta 7380
attgtttgtg tattttagat tccaacctat ggaactgatg aatgggagca gtggtggaat 7490
gcctttaatg aggaaaacct gttttgctca gaagaaatgc catctagtga tgatgaggct 7500
actgctgact ctcaacattc tactcctcca aaaaagaaga gaaaggtaga agaccccaag 7560
gactttcctt cagaattgct aagttttttg agtcatgctg tgtttagtaa tagaactctt 7620
gcttgctttg ctatttacac cacaaaggaa aaagctgcac tgctatacaa gaaaattatg 7680
gaaaaatatt ctgtaacctt tataagtagg cataacagtt ataatcataa catactgttt 7740
tttcttactc cacacaggca tagagtgtct gctattaata actatgctca aaaattgtgt 7800
acctttagct ttttaatttg taaaggggtt aataaggaat atttgatgta tagtgccttg 7860
actagagatc ataatcagcc ataccacatt tgtagaggtt ttacttgctt taaaaaacct 7920
CA 02359795 2001-07-12 pCT~, P00/00265
WO 00/42208
-12-
cccacacctc cccctgaacc tgaaacataa aatgaatgca attgttgttg ttaacttgtt 7980
tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc 8040
atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt 8100
ctggatcccc aggaagctcc tctgtgtcct cataaaccct aacctcctct acttgagagg 8160
acattccaat cataggctgc ccatccaccc tctgtgtcct cctgttaatt aggtcactta 8220
acaaaaagga aattgggtag gggtttttca cagaccgctt tctaagggta attttaaaat 8280
atctgggaag tcccttccac tgctgtgttc cagaagtgtt ggtaaacagc ccacaaatgt 8340'
caacagcaga aacatacaag ctgtcagctt tgcacaaggg cccaacaccc tgctcatcaa 8400
gaagcactgt ggttgctgtg ttagtaatgt gcaaaacagg aggcacattt tccccacctg 8460
tgtaggttcc aaaatatcta gtgttttcat ttttacttgg atcaggaacc cagcactcca 8520
ctggataagc attatcctta tccaaaacag ccttgtggtc agtgttcatc tgctgactgt 8580
caactgtagc attttttggg gttacagttt gagcaggata tttggtcctg tagtttgcta 8640
acacaccctg cagctccaaa ggttccccac caacagcaaa aaaatgaaaa tttgaccctt 8700
gaatgggttt tccagcacca ttttcatgag ttttttgtgt ccctgaatgc aagtttaaca 8760
tagcagttac cccaataacc tcagttttaa cagtaacagc ttcccacatc aaaatatttc 8820
cacaggttaa gtcctcattt aaattaggca aaggaattct tgaagacgaa agggcctcgt 8880
gatacgccta tttttatagg ttaatgtcat gataataatg gtttcttaga cgtcaggtgg 8940
cacttttcgg ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa 9000
tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa 9060
gagtatgagt attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct 9120
tcctgttttt gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg 9180
tgcacgagtg ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg 9240
ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt 9300
atcccgtgtt gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga 9360
cttggttgag tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga 9420
attatgcagt gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac 9480
gatcggagga ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg 9540
ccttgatcgt tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac 9600
gatgcctgca gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct 9660
agcttcccgg caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct 9720
gcgctcggcc cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg 9780
gtctcgcggt atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat 9840
ctacacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg 9900
tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat 9960
tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct 10020
catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa 10080
gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa 10140
aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc 10200
gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta 10260
gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct 10320
gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg 10380
atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag 10440
cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc 10500
cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg 10560
agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt 10620
tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg 10680
gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca 10740
catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg 10800
agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc 10860
ggaagagcgc ctgatgcggt attttctcct tacgcatctg tgcggtattt cacaccgcat 10920
atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagt atacactccg 10980
ctatcgctac gtgactgggt catggctgcg ccccgacacc cgccaacacc cgctgacgcg 11040
ccctgacggg cttgtctgct cccggcatcc gcttacagac aagctgtgac cgtctccggg 11100
agctgcatgt gtcagaggtt ttcaccgtca tcaccgaaac gcgcgaggca gc 11152
<210> 13
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-13-
<223> Description of Artificial Sequence: primer
<400> 13
gacggatcgg gagatctcc 19
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 19
ccgcctcaga agccatagag cc 22
<210> 15
<211> 14455
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 15
aagcttgggc agaaatggtt gaactcccga gagtgtccta cacctagggg agaagcagcc 60
aaggggttgt ttcccaccaa ggacgacccg tctgcgcaca aacggatgag cccatcagac 120
aaagacatat tcattctctg ctgcaaactt ggcatagctc tgctttgcct ggggctattg 180
ggggaagttg cggttcgtgc tcgcagggct ctcacccttg actcttttaa tagctcttct 240
gtgcaagatt acaatctaaa caattcggag aactcgacct tcctcctgag gcaaggacca 300
cagccaactt cctcttacaa gccgcatcga ttttgtcctt cagaaataga aataagaatg 360
cttgctaaaa attatatttt taccaataag accaatccaa taggtagatt ~ttagttact 420
atgttaagaa atgaatcatt atcttttagt actattttta ctcaaattca gaagttagaa 480
atgggaatag aaaatagaaa gagacgctca acctcaattg aagaacaggt gcaaggacta 540
ttgaccacag gcctagaagt aaaaaaggga aaaaagagtg tttttgtcaa aataggagac 600
aggtggtggc aaccagggac ttatagggga ccttacatct acagaccaac agatgccccc 660
ttaccatata caggaagata tgacttaaat tgggataggt gggttacagt caatggctat 720
aaagtgttat atagatccct cccttttcgt gaaagactcg ccagagctag acctccttgg 780
tgtatgttgt ctcaagaaga aaaagacgac atgaaacaac aggtacatga ttatatttat 840
ctaggaacag ,gaatgcactt ttggggaaag attttccata ccaaggaggg gacagtggct 900
ggactaatag aacattattc tgcaaaaact catggcatga gttattatga atagccttta 960
ttggcccaac cttgcggttc ccagggctta agtaagtttt tggttacaaa ctgttcttaa 1020
aacgaggatg tgagacaagt ggtttcctga cttggtttgg tatcaaaggt tctgatctga 1080
gctctgagtg ttctattttc ctatgttctt ttggaattta tccaaatctt atgtaaatgc 1140
ttatgtaaac caagatataa aagagtgctg attttttgag taaacttgca acagtcctaa 1200
cattcacctc ttgtgtgttt gtgtctgttc gccatcccgt ctccgctcgt cacttatcct 1260
tcactttcca gagggtcccc ccgcagaccc cggcgaccct caggtcggcc gactgcggca 1320
gctggcgccc gaacagggac cctcggataa gtgacccttg tctctatttc tactatttgg 1380
tgtttgtctt gtattgtctc tttcttgtct ggctatcatc acaagagcgg aacggactca 1440
ccatagggac caagctagcg actgaaaatg agacatatta tctgccacgg aggtgttatt 1500
accgaagaaa tggccgccag tcttttggac cagctgatcg aagaggtact ggctgataat 1560
cttccacctc ctagccattt tgaaccacct acccttcacg aactgtatga tttagacgtg 1620
acggcccccg aagatcccaa cgaggaggcg gtttcgcaga tttttcccga ctctgtaatg 1680
ttggcggtgc aggaagggat tgacttactc acttttccgc cggcgcccgg ttctccggag 1740_
ccgcctcacc tttcccggca gcccgagcag ccggagcaga gagccttggg tccggtttct 1800
atgccaaacc ttgtaccgga ggtgatcgat cttacctgcc acgaggctgg ctttccaccc 1860
agtgacgacg aggatgaaga gggtgaggag tttgtgttag attatgtgga gcaccccggg 1920
cacggttgca_ggtcttgtca ttatcaccgg aggaatacgg gggacccaga tattatgtgt 1980
tcgctttgct atatgaggac ctgtggcatg tttgtctaca gtaagtgaaa attatgggca 2040
gtgggtgata gagtggtggg tttggtgtgg taattttttt tttaattttt acagttttgt 2100
CA 02359795 2001-07-12 pCT~P00/00265
WO 00/42208
-14-
ggtttaaaga attttgtatt gtgatttttt taaaaggtcc tgtgtctgaa cctgagcctg 2160
agcccgagcc agaaccggag cctgcaagac ctacccgccg tcctaaaatg gcgcctgcta 2220
tcctgagacg cccgacatca cctgtgtcta gagaatgcaa tagtagtacg gatagctgtg 2280
actccggtcc ttctaacaca cctcctgaga tacacccggt ggtcccgctg tgccccatta 2340
aaccagttgc cgtgagagtt ggtgggcgtc gccaggctgt ggaatgtatc gaggacttgc 2400
ttaacgagcc tgggcaacct ttggacttga gctgtaaacg ccccaggcca taaggtgtaa 2460
acctgtgatt gcgtgtgtgg ttaacgcctt tgtttgctga atgagttgat gtaagtttaa 2520
taaagggtga gataatgttt aacttgcatg gcgtgttaaa tggggcgggg cttaaagggt 2580
atataatgcg ccgtgggcta atcttggtta catctgacct-catggaggct tgggagtgtt 2640
tggaagattt ttctgctgtg cgtaacttgc tggaacagag ctctaacagt acctcttggt 2700
tttggaggtt tctgtggggc tcatcccagg caaagttagt ctgcagaatt aaggaggatt 2760
acaagtggga atttgaagag cttttgaaat cctgtggtga gctgtttgat tctttgaatc 2820
tgggtcacca ggcgcttttc caagagaagg tcatcaagac tttggatttt tccacaccgg 2880
ggcgcgctgc ggctgctgtt gcttttttga gttttataaa ggataaatgg agcgaagaaa 2940
cccatctgag cggggggtac ctgctggatt ttctggccat gcatctgtgg agagcggttg 3000
tgagacacaa gaatcgcctg ctactgttgt cttccgtccg cccggcgata ataccgacgg 3060
aggagcagca gcagcagcag gaggaagcca ggcggcggcg gcaggagcag agcccatgga 3120
acccgagagc cggcctggac cctcgggaat gaatgttgta caggtggctg aactgtatcc 3180
agaactgaga cgcattttga caattacaga ggatgggcag gggctaaagg gggtaaagag 3240
ggagcggggg gcttgtgagg ctacagagga ggctaggaat ctagctttta gcttaatgac 3300
cagacaccgt cctgagtgta ttacttttca acagatcaag gataattgcg ctaatgagct 3360
tgatctgctg gcgcagaagt attccataga gcagctgacc acttactggc ~gcagccagg 3420
ggatgatttt gaggaggcta ttagggtata tgcaaaggtg gcacttaggc cagattgcaa 3480
gtacaagatc agcaaacttg taaatatcag gaattgttgc tacatttctg ggaacggggc 3540
cgaggtggag atagatacgg aggatagggt ggcctttaga tgtagcatga taaatatgtg 3600
gccgggggtg cttggcatgg acggggtggt tattatgaat gtaaggttta ctggccccaa 3660
ttttagcggt acggttttcc tggccaatac caaccttatc ctacacggtg taagcttcta 3720
tgggtttaac aatacctgtg tggaagcctg gaccgatgta agggttcggg gctgtgcctt 3780
ttactgctgc tggaaggggg tggtgtgtcg ccccaaaagc agggcttcaa ttaagaaatg 3840
cctctttgaa aggtgtacct tgggtatcct gtctgagggt aactccaggg tgcgccacaa 3900
tgtggcctcc gactgtggtt gcttcatgct agtgaaaagc gtggctgtga ttaagcataa 3960
catggtatgt ggcaactgcg aggacagggc ctctcagatg ctgacctgct cggacggcaa 4020
ctgtcacctg ctgaagacca ttcacgtagc cagccactct cgcaaggcct ggccagtgtt 4080
tgagcataac atactgaccc gctgttcctt gcatttgggt aacaggaggg gggtgttcct 4140
accttaccaa tgcaatttga gtcacactaa gatattgctt gagcccgaga gcatgtccaa 4200
ggtgaacctg aacggggtgt ttgacatgac catgaagatc tggaaggtgc tgaggtacga 4260
tgagacccgc accaggtgca gaccctgcga gtgtggcggt aaacatatta ggaaccagcc 4320
tgtgatgctg gatgtgaccg aggagctgag gcccgatcac ttggtgctgg cctgcacccg 9380
cgctgagttt ggctctagcg atgaagatac agattgaggt actgaaatgt gtgggcgtgg 4440
cttaagggtg.ggaaagaata tataaggtgg gggtcttatg tagttttgta tctgttttgc 4500
agcagccgcc gccgccatga gcaccaactc gtttgatgga agcattgtga gctcatattt 4560
gacaacgcgc atgcccccat gggccggggt gcgtcagaat gtgatgggct ccagcattga 4620
tggtcgcccc gtcctgcccg caaactctac taccttgacc tacgagaccg tgtctggaac 4680
gccgttggag actgcagcct ccgccgccgc ttcagccgct gcagccaccg cccgcgggat 4740
tgtgactgac tttgctttcc tgagcccgct tgcaagcagt gcagcttccc gttcatccgc 4800
ccgcgatgac aagttgacgg ctcttttggc acaattggat tctttgaccc gggaacttaa 4860
tgtcgtttct cagcagctgt tggatctgcg ccagcaggtt tctgccctga aggcttcctc 4920
ccctcccaat gcggtttaaa acataaataa aaaaccagac tctgtttgga tttggatcaa 4980
gcaagtgtct tgctgtctct cgagggatct ttgtgaagga accttacttc tgtggtgtga 5040
cataattgga caaactacct acagagattt aaagctctaa ggtaaatata aaatttttaa 5100
gtgtataatg tgttaaacta ctgattctaa ttgtttgtgt attttagatt ccaacctatg 5160
gaactgatga atgggagcag tggtggaatg cctttaatga ggaaaacctg ttttgctcag 5220
aagaaatgcc atctagtgat gatgaggcta ctgctgactc tcaacattct actcctccaa 5280
aaaagaagag aaaggtagaa gaccccaagg actttccttc agaattgcta agttttttga 5340
gtcatgctgt gtttagtaat agaactcttg cttgctttgc tatttacacc acaaaggaaa 5400
aagctgcact gctatacaag aaaattatgg aaaaatattc tgtaaccttt ataagtaggc 5460
ataacagtta taatcataac atactgtttt ttcttactcc acacaggcat agagtgtctg 5520
ctattaataa ctatgctcaa aaattgtgta cctttagctt tttaatttgt aaaggggtta 5580
ataaggaata tttgatgtat agtgccttga ctagagatca taatcagcca taccacattt 5640
gtagaggttt tacttgcttt aaaaaacctc ccacacctcc ccctgaacct gaaacataaa 5700
atgaatgcaa ttgttgttgt taacttgttt attgcagctt ataatggtta caaataaagc 5760
aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg 5820
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-15-
tccaaactca tcaatgtatc ttatcatgtc tggatccggc tgtggaatgt gtgtcagtta 5880
gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat 5940
tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc 6000
atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta 6060
actccgccca gttccgccca ttctccgccc catggctgac taattttttt tatttatgca 6120
,gaggccgagg ccgcctcggc ctctgagcta ttccagaagt agtgaggagg cttttttgga 6180
ggcctaggct tttgcaaaaa gcttggacac aagacaggct tgcgagatat gtttgagaat 6240
accactttat cccgcgtcag ggagaggcag tgcgtaaaaa gacgcggact catgtgaaat 6300
actcjgttttt agtgcgccag atctctataa tctcgcgcaa cctattttcc cctcgaacac 6360
tttttaagcc gtagataaac aggctgggac acttcacatg agcgaaaaat acatcgtcac 6420
ctgggacatg ttgcagatcc atgcacgtaa actcgcaagc cgactgatgc cttctgaaca 6480
atggaaaggc attattgccg taagccgtgg cggtctggta ccgggtgcgt tactggcgcg 6540
tgaactgggt attcgtcatg tcgataccgt ttgtatttcc agctacgatc acgacaacca 6600
gcgcgagctt aaagtgctga aacgcgcaga aggcgatggc gaaggcttca tcgttattga 6660
tgacctggtg gataccggtg gtactgcggt tgcgattcgt gaaatgtatc caaaagcgca 6720
ctttgtcacc atcttcgcaa aaccggctgg tcgtccgctg gttgatgact atgttgttga 6780
tatcccgcaa gatacctgga ttgaacagcc gtgggatatg ggcgtcgtat tcgtcccgcc 6840
aatctccggt cgctaatctt ttcaacgcct ggcactgccg ggcgttgttc tttttaactt 6900
caggcgggtt acaatagttt ccagtaagta ttctggaggc tgcatccatg acacaggcaa 6960
acctgagcga aaccctgttc aaaccccgct ttaaacatcc tgaaacctcg acgctagtcc 7020
gccgctttaa tcacggcgca caaccgcctg tgcagtcggc ccttgatggt aaaaccatcc 7080
ctcactggta tcgcatgatt aaccgtctga tgtggatctg gcgcggcatt ~acccacgcg 7140
aaatcctcga cgtccaggca cgtattgtga tgagcgatgc cgaacgtacc gacgatgatt 7200
tatacgatac ggtgattggc taccgtggcg gcaactggat ttatgagtgg gccccggatc 7260
tttgtgaagg aaccttactt ctgtggtgtg acataattgg acaaactacc tacagagatt 7320
taaagctcta aggtaaatat aaaattttta agtgtataat gtgttaaact actgattcta 7380
attgtttgtg tattttagat tccaacctat ggaactgatg aatgggagca gtggtggaat 7440
gcctttaatg aggaaaacct gttttgctca gaagaaatgc catctagtga tgatgaggct 7500
actgctgact ctcaacattc tactcctcca aaaaagaaga gaaaggtaga agaccccaag 7560
gactttcctt cagaattgct aagttttttg agtcatgctg tgtttagtaa tagaactctt 7620
gcttgctttg ctatttacac cacaaaggaa aaagctgcac tgctatacaa gaaaattatg 7680
gaaaaatatt ctgtaacctt tataagtagg cataacagtt ataatcataa catactgttt 7740
tttcttactc cacacaggca tagagtgtct gctattaata actatgctca aaaattgtgt 7800
acctttagct ttttaatttg taaaggggtt aataaggaat atttgatgta tagtgccttg 7860
actagagatc ataatcagcc ataccacatt tgtagaggtt ttacttgctt taaaaaacct 7920
cccacacctc cccctgaacc tgaaacataa aatgaatgca attgttgttg ttaacttgtt 7980
tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc 8040
atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt 8100
ctggatcccc aggaagctcc tctgtgtcct cataaaccct aacctcctct acttgagagg 8160
acattccaat cataggctgc ccatccaccc tctgtgtcct cctgttaatt aggtcactta 8220
acaaaaagga aattgggtag gggtttttca cagaccgctt tctaagggta attttaaaat 8280
atctgggaag tcccttccac tgctgtgttc cagaagtgtt ggtaaacagc ccacaaatgt 8340
caacagcaga aacatacaag ctgtcagctt tgcacaaggg cccaacaccc tgctcatcaa 8400
gaagcactgt ggttgctgtg ttagtaatgt gcaaaacagg aggcacattt tccccacctg 8460
tgtaggttcc aaaatatcta gtgttttcat ttttacttgg atcaggaacc cagcactcca 8520
ctggataagc attatcctta tccaaaacag ccttgtggtc agtgttcatc tgctgactgt 8580
caactgtagc attttttggg gttacagttt gagcaggata tttggtcctg tagtttgcta 8640
acacaccctg cagctccaaa ggttccccac caacagcaaa aaaatgaaaa tttgaccctt 8700
gaatgggttt tccagcacca ttttcatgag ttttttgtgt ccctgaatgc aagtttaaca 8760
tagcagttac cccaataacc tcagttttaa cagtaacagc ttcccacatc aaaatatttc 8820
cacaggttaa gtcctcattt aaattaggca aaggaattct tgaagacgaa agggcctcgt 8880
gatacgccta tttttatagg ttaatgtcat gataataatg gtttcttaga cgtcaggtgg 8940
cacttttcgg ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa 9000
tatgtatccg ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa 9060
gagtatgagt attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct 9120
tcctgttttt gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg 9180
tgcacgagtg ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg 9240
ccccgaagaa cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt 9300
atcccgtgtt gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga 9360
cttggttgag tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga 9420
attatgcagt gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac 9480
gatcggagga ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg 9540
WO 00/42208 cA 02359795 2001-07-12 pCT/EP00/00265
-16-
ccttgatcgt tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac 9600
gatgcctgca gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct 9660
agcttcccgg caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct 9720
gcgctcggcc cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg 9780
gtctcgcggt atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat 9840
ctacacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg 9900
tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat 9960
tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct 10020
catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa 10080
gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa 10140
aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc 10200
gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta 10260
gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct 10320
gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg 10380
atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag 10440
cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc 10500
cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg 10560
agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt 10620
tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg 10680
gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca 10740
catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg 10800
agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga ~cgaggaagc 10860
ggaagagcgc ctgatgcggt attttctcct tacgcatctg tgcggtattt cacaccgcat 10920
accgcctcag aagccataga gcccaccgca tccccagcat gcctgctatt gtcttcccaa 10980
tcctccccct tgctgtcctg ccccacccca ccccccagaa tagaatgaca cctactcaga 11040
caatgcgatg caatttcctc attttattag gaaaggacag tgggagtggc accttccagg 11100
gtcaaggaag gcacggggga ggggcaaaca acagatggct ggcaactaga aggcacagtc 11160
gaggctgatc agcgagctct agcatttagg tgacactata gaatagggcc ctctagatgc 11220
atgctcgagc ggccgcttct ttattcttgg gcaatgtatg aaaaagtgta agaggatgtg 11280
gcaaatattt cattaatgta gttgtggcca gaccagtccc atgaaaatga catagagtat 11340
gcacttggag ttgtgtctcc tgtttcctgt gtaccgttta gtgtaatggt tagtgttaca 11400
ggtttagttt tgtctccgtt taagtaaact tgactgacaa tgttactttt ggcagtttta 11460
ccgtgagatt ttggataagc tgataggtta ggcataaatc caacagcgtt tgtataggct 11520
gtgccttcag taagatctcc atttctaaag ttccaatatt ctgggtccag gaaggaattg 11580
tttagtagca ctccattttc gtcaaatctt ataataagat gagcactttg aactgttcca 11640
gatattggag ccaaactgcc tttaacagcc aaaactgaaa ctgtagcaag tatttgactg 11700
ccacattttg ttaagaccaa agtgagttta gcatctttct ctgcatttag tctacagtta 11760
ggagatggag ctggtgtggt ccacaaagtt agcttatcat tatttttgtt tcctactgta 11820
atggcacctg tgctgtcaaa actaaggcca gttcctagtt taggaaccat agccttgttt 11880
gaatcaaatt ctaggccatg gccaattttt gttttgaggg gatttgtgtt tggtgcatta 11990
ggtgaaccaa attcaagccc atctcctgca ttaatggcta tggctgtagc gtcaaacatc 12000
aaccccttgg cagtgcttag gttaacctca agctttttgg aattgtttga agctgtaaac 12060
aagtaaaggc ctttgttgta gttaatatcc aagttgtggg ctgagtttat aaaaagaggg 12120
ccctgtccta gtcttagatt tagttggttt tgagcatcaa acggataact aacatcaagt 12180
ataaggcgtc tgttttgaga atcaatcctt agtcctcctg ctacattaag ttgcatattg 12240
ccttgtgaat caaaacccaa ggctccagta actttagttt gcaaggaagt attattaata 12300
gtcacacctg gaccagttgc tacggtcaaa gtgtttaggt cgtctgttac atgcaaagga 12360
gccccgtact ttagtcctag ttttccattt tgtgtataaa tgggctcttt caagtcaatg 12420
cccaagctac cagtggcagt agttagaggg ggtgaggcag tgatagtaag ggtactgcta 12480
tcggtggtgg tgagggggcc tgatgtttgc agggctagct ttccttctga cactgtgagg 12540
ggtccttggg tggcaatgct aagtttggag tcgtgcacgg ttagcggggc ctgtgattgc 12600
atggtgagtg tgttgcccgc gaccattaga ggtgcggcgg cagccacagt tagggcttct 12660
gaggtaactg tgaggggtgc agatatttcc aggtttatgt ttgacttggt ttttttgaga 12720
ggtgggctca cagtggttac attttgggag gtaaggttgc cggcctcgtc cagagagagg 12780
ccgttgccca ttttgagcgc aagcatgcca ttggaggtaa ctagaggttc ggataggcgc 12840
aaagagagta ccccaggggg actctcttga aacccattgg gggatacaaa gggaggagta 12900
agaaaaggca cagttggagg accggtttcc gtgtcatatg gatacacggg gttgaaggta 12960
tcttcagacg gtcttgcgcg cttcatcttg gatctcaagc ctgccacacc tcacctcgac 13020
catccgccgt ctcaagaccg cctactttaa ttacatcatc agcagcacct ccgccagaaa 13080
caaccccgac cgccacccgc tgccgcccgc cacggtgctc agcctacctt gcgactgtga 13140
ctggttagac gcctttctcg agaggttttc cgatccggtc gatgcggact cgctcaggtc 13200
cctcggtggc ggagtaccgt tcggaggccg acgggtttcc gatccaagag tactggaaag 13260
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-17-
accgcgaaga gtttgtcctc aaccgcgagc ccaacagcga gctcgaattc agatccgagc 13320
tcggtaccaa gcttgggtct ccctatagtg agtcgtatta atttcgataa gccagtaagc 13380
agtgggttct ctagttagcc agagagctct gcttatatag acctcccacc gtacacgcct 13440
accgcccatt tgcgtcaatg gggcggagtt gttacgacat tttggaaagt cccgttgatt 13500
ttggtgccaa aacaaactcc cattgacgtc aatggggtgg agacttggaa atccccgtga 13560
gtcaaaccgc tatccacgcc cattgatgta ctgccaaaac cgcatcacca tggtaatagc 13620
gatgactaat acgtagatgt actgccaagt aggaaagtcc cataaggtca tgtactgggc 13680
ataatgccag gcgggccatt taccgtcatt gacgtcaata gggggcgtac ttggcatatg 13740
atacacttga tgtactgcca agtgggcagt ttaccgtaaa tagtccaccc attgacgtca 13800
atggaaagtc cctattggcg ttactatggg aacatacgtc attattgacg tcaatgggcg 13860
ggggtcgttg ggcggtcagc caggcgggcc atttaccgta agttatgtaa cgcggaactc 13920
catatatggg ctatgaacta atgaccccgt aattgattac tattaataac tagtcaataa 13980
tcaatgtcaa cgcgtatatc tggcccgtac atcgcgaagc agcgcaaaac gcctaaccct 14040
aagcagattc ttcatgcaat tgtcggtcaa gccttgcctt gttgtagctt aaattttgct 14100
cgcgcactac tcagcgacct ccaacacaca agcagggagc agatactggc ttaactatgc 14160
ggcatcagag cagattgtac tgagagtcga ccatagggga tcgggagatc tcccgatccg 14220
tctatggtgc actctcagta caatctgctc tgatgccgca tagttaagcc agtatacact 14280
ccgctatcgc tacgtgactg ggtcatggct gcgccccgac acccgccaac acccgctgac 14340
gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc 14400
gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag gcagc 14455
<210> 16
<211> 10610
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 16
gacggatcgg gagatccgcg cggtacacag aattcaggag acacaactcc aagtgcatac 60
tctatgtcat tttcatggga ctggtctggc cacaactaca ttaatgaaat atttgccaca 120
tcctcttaca ctttttcata cattgcccaa gaataaagaa tcgtttgtgt tatgtttcaa 180
cgtgtttatt tttcaattgc agaaaatttc aagtcatttt tcattcagta gtatagcccc 240
accaccacat agcttataca gatcaccgta ccttaatcaa actcacagaa ccctagtatt 300
caacctgcca cctccctccc aacacacaga gtacacagtc ctttctcccc ggctggcctt 360
aaaaagcatc atatcatggg taacagacat attcttaggt gttatattcc acacggtttc 420
ctgtcgagcc aaacgctcat cagtgatatt aataaactcc ccgggcagct cacttaagtt 480
catgtcgctg tccagctgct gagccacagg ctgctgtcca acttgcggtt gcttaacggg 540
cggcgaagga gaagtccacg cctacatggg ggtagagtca taatcgtgca tcaggatagg 600
gcggtggtgc tgcagcagcg cgcgaataaa ctgctgccgc cgccgctccg tcctgcagga 660
atacaacatg gcagtggtct cctcagcgat gattcgcacc gcccgcagca taaggcgcct 720
tgtcctccgg gcacagcagc gcaccctgat ctcacttaaa tcagcacagt aactgcagca 780
cagcaccaca atattgttca aaatcccaca gtgcaaggcg ctgtatccaa agctcatggc 840
ggggaccaca gaacccacgt ggccatcata ccacaagcgc aggtagatta agtggcgacc 900
cctcataaac acgctggaca taaacattac ctcttttggc atgttgtaat tcaccacctc 960
ccggtaccat ataaacctct gattaaacat ggcgccatcc accaccatcc taaaccagct 1020
ggccaaaacc tgcccgccgg ctatacactg cagggaaccg ggactggaac aatgacagtg 1080
gagagcccag gactcgtaac catggatcat catgctcgtc atgatatcaa tgttggcaca 1140
acacaggcac acgtgcatac acttcctcag gattacaagc tcctcccgcg ttagaaccat 1200
atcccaggga acaacccatt cctgaatcag cgtaaatccc acactgcagg gaagacctcg 1260
cacgtaactc acgttgtgca ttgtcaaagt gttacattcg ggcagcagcg gatgatcctc 1320
cagtatggta gcgcgggttt ctgtctcaaa aggaggtaga cgatccctac tgtacggagt 1380
gcgccgagac aaccgagatc gtgttggtcg tagtgtcatg ccaaatggaa cgccggacgt 1440
agtcatattt cctgaagcaa aaccaggtgc gggcgtgaca aacagatctg cgtctccggt 1500
ctcgccgctt agatcgctct gtgtagtagt tgtagtatat ccactctctc aaagcatcca 1560
ggcgccccct ggcttcgggt tctatgtaaa ctccttcatg cgccgctgcc ctgataacat 1620
ccaccaccgc agaataagcc acacccagcc aacctacaca ttcgttctgc gagtcacaca 1680
cgggaggagc gggaagagct ggaagaacca tgtttttttt tttattccaa aagattatcc 1740
aaaacctcaa aatgaagatc tattaagtga acgcgctccc ctccggtggc gtggtcaaac 1800
tctacagcca aagaacagat aatggcattt gtaagatgtt gcacaatggc ttccaaaagg 1860
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-18-
caaacggccc tcacgtccaa gtggacgtaa aggctaaacc cttcagggtg aatctcctct 1920
ataaacattc cagcaccttc aaccatgccc aaataattct catctcgcca ccttctcaat 1980
atatctctaa gcaaatcccg aatattaagt ccggccattg taaaaatctg ctccagagcg 2040
ccctccacct tcagcctcaa gcagcgaatc atgattgcaa aaattcaggt tcctcacaga.2100
cctgtataag attcaaaagc ggaacattaa caaaaatacc gcgatcccgt aggtcccttc 2160
gcagggccag ctgaacataa tcgtgcaggt ctgcacggac cagcgcggcc acttccccgc 2220
caggaacctt gacaaaagaa cccacactga ttatgacacg catactcgga gctatgctaa 2280
ccagcgtagc cccgatgtaa gctttgttgc atgggcggcg atataaaatg caaggtgctg 2340
ctcaaaaaat caggcaaagc ctcgcgcaaa aaagaaagca catcgtagtc atgctcatgc 2400
agataaaggc aggtaagctc cggaaccacc acagaaaaag acaccatttt tctctcaaac 2960
atgtctgcgg gtttctgcat aaacacaaaa taaaataaca aaaaaacatt taaacattag 2520
aagcctgtct tacaacagga aaaacaaccc ttataagcat aagacggact acggccatgc 2580
cggcgtgacc gtaaaaaaac tggtcaccgt gattaaaaag caccaccgac agctcctcgg 2640
tcatgtccgg agtcataatg taagactcgg taaacacatc aggttgattc atcggtcagt 2700
gctaaaaagc gaccgaaata gcccggggga atacataccc gcaggcgtag agacaacatt 2760
acagccccca taggaggtat aacaaaatta ataggagaga aaaacacata aacacctgaa 2820
aaaccctcct gcctaggcaa aatagcaccc tcccgctcca gaacaacata cagcgcttca 2880
cagcggcagc ctaacagtca gccttaccag taaaaaagaa aacctattaa aaaaacacca 2940
ctcgacacgg caccagctca atcagtcaca gtgtaaaaaa gggccaagtg cagagcgagt 3000
atatatagga ctaaaaaatg acgtaacggt taaagtccac aaaaaacacc cagaaaaccg 3060
cacgcgaacc tacgcccaga aacgaaagcc aaaaaaccca caacttcctc aaatcgtcac 3120
ttccgttttc ccacgttacg taacttcccg gatcctctcc cgatccccta ~ggtcgactc 3180
tcagtacaat ctgctctgat gccgcatagt taagccagta tctgctccct gcttgtgtgt 3240
tggaggtcgc tgagtagtgc gcgagcaaaa tttaagctac aacaaggcaa ggcttgaccg 3300
acaattgcat gaagaatctg cttagggtta ggcgttttgc gctgcttcgc gatgtacggg 3360
ccagatatac gcgttgacat tgattattga ctagttatta atagtaatca attacggggt 3420
cattagttca tagcccatat atggagttcc gcgttacata acttacggta aatggcccgc 3480
ctggctgacc gcccaacgac ccccgcccat tgacgtcaat aatgacgtat gttcccatag 3540
taacgccaat agggactttc cattgacgtc aatgggtgga ctatttacgg taaactgccc 3600
acttggcagt acatcaagtg tatcatatgc caagtacgcc ccctattgac gtcaatgacg 3660
gtaaatggcc cgcctggcat tatgcccagt acatgacctt atgggacttt cctacttggc 3720
agtacatcta cgtattagtc atcgctatta ccatggtgat gcggttttgg cagtacatca 3780
atgggcgtgg atagcggttt gactcacggg gatttccaag tctccacccc attgacgtca 3840
atgggagttt gttttggcac caaaatcaac gggactttcc aaaatgtcgt aacaactccg 3900
ccccattgac gcaaatgggc ggtaggcgtg tacggtggga ggtctatata agcagagctc 3960
tctggctaac tagagaaccc actgcttact ggcttatcga aattaatacg actcactata 4020
gggagaccca agcttggtac cgagctcgga tctgaattcg agctcgctgt tgggctcgcg 4080
gttgaggaca aactcttcgc ggtctttcca gtactcttgg atcggaaacc cgtcggcctc 4140
cgaacggtac tccgccaccg agggacctga gcgagtccgc atcgaccgga tcggaaaacc 4200
tctcgagaaa ggcgtctaac cagtcacagt cgcaaggtag gctgagcacc gtggcgggcg 4260
gcagcgggtg gcggtcgggg ttgtttctgg cggaggtgct gctgatgatg taattaaagt 4320
aggcggtctt gagacggcgg atggtcgagg tgaggtgtgg caggcttgag atccaagatg 4380
aagcgcgcaa gaccgtctga agataccttc aaccccgtgt atccatatga cacggaaacc 4440
ggtcctccaa ctgtgccttt tcttactcct ccctttgtat cccccaatgg gtttcaagag 4500
agtccccctg gggtactctc tttgcgccta tccgaacctc tagttacctc caatggcatg 4560
cttgcgctca aaatgggcaa cggcctctct ctggacgagg ccggcaacct tacctcccaa 4620
aatgtaacca ctgtgagccc acctctcaaa aaaaccaagt caaacataaa cctggaaata 4680
tctgcacccc tcacagttac ctcagaagcc ctaactgtgg ctgccgccgc acctctaatg 4740
gtcgcgggca acacactcac catgcaatca caggccccgc taaccgtgca cgactccaaa 4800
cttagcattg ccacccaagg acccctcaca gtgtcagaag gaaagctagc cctgcaaaca 9860
tcaggccccc tcaccaccac cgatagcagt acccttacta tcactgcctc accccctcta 4920
actactgcca ctggtagctt gggcattgac ttgaaagagc ccatttatac acaaaatgga 4980
aaactaggac taaagtacgg ggctcctttg catgtaacag acgacctaaa cactttgacc 5040
gtagcaactg gtccaggtgt gactattaat aatacttcct tgcaaactaa agttactgga 5100
gccttgggtt ttgattcaca aggcaatatg caacttaatg tagcaggagg actaaggatt 5160
gattctcaaa acagacgcct tatacttgat gttagttatc cgtttgatgc tcaaaaccaa 5220
ctaaatctaa gactaggaca gggccctctt tttataaact cagcccacaa cttggatatt 5280
aactacaaca aaggccttta cttgtttaca gcttcaaaca attccaaaaa gcttgaggtt 5340
aacctaagca ctgccaaggg gttgatgttt gacgctacag ccatagccat taatgcagga 5400
gatgggcttg aatttggttc acctaatgca ccaaacacaa atcccctcaa aacaaaaatt 5460
ggccatggcc tagaatttga ttcaaacaag gctatggttc ctaaactagg aactggcctt 5520
agttttgaca gcacaggtgc cattacagta ggaaacaaaa ataatgataa gctaactttg 5580
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-19-
tggaccacac cagctccatc tcctaactgt agactaaatg cagagaaaga tgctaaactc 5640
actttggtct taacaaaatg tggcagtcaa atacttgcta cagtttcagt tttggctgtt 5700
aaaggcagtt tggctccaat atctggaaca gttcaaagtg ctcatcttat tataagattt 5760
gacgaaaatg gagtgctact aaacaattcc ttcctggacc cagaatattg gaactttaga 5820
aatggagatc ttactgaagg cacagcctat acaaacgctg ttggatttat gcctaaccta 5880
tcagcttatc caaaatctca cggtaaaact gccaaaagta acattgtcag tcaagtttac 5940
ttaaacggag acaaaactaa acctgtaaca ctaaccatta cactaaacgg tacacaggaa 6000
acaggagaca caactccaag tgcatactct atgtcatttt catgggactg gtctggccac 6060
aactacatta atgaaatatt tgccacatcc tcttacactt tttcatacat tgcccaagaa 6120
taaagaagcg gccgctcgag catgcatcta gagggcccta ttctatagtg tcacctaaat 6180
gctagagctc gctgatcagc ctcgactgtg ccttctagtt gccagccatc tgttgtttgc 6240
ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct ttcctaataa 6300
aatgaggaaa.ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg gggtggggtg 6360
gggcaggaca gcaaggggga ggattgggaa gacaatagca ggcatgctgg ggatgcggtg 6420
ggctctatgg cttctgaggc ggaaagaacc agctggggct ctagggggta tccccacgcg 6480
ccctgtagcg gcgcattaag cgcggcgggt gtggtggtta cgcgcagcgt gaccgctaca 6540
cttgccagcg ccctagcgcc cgctcctttc gctttcttcc cttcctttct cgccacgttc 6600
gccggctttc cccgtcaagc tctaaatcgg ggcatccctt tagggttccg atttagtgct 6660
ttacggcacc tcgaccccaa aaaacttgat tagggtgatg gttcacgtag tgggccatcg 6720
ccctgataga cggtttttcg ccctttgacg ttggagtcca cgttctttaa tagtggactc 6780
ttgttccaaa ctggaacaac actcaaccct atctcggtct attcttttga tttataaggg 6840
attttgggga tttcggccta ttggttaaaa aatgagctga tttaacaaaa ~tttaacgcg 6900
aattaattct gtggaatgtg tgtcagttag ggtgtggaaa gtccccaggc tccccaggca 6960
ggcagaagta tgcaaagcat gcatctcaat tagtcagcaa ccaggtgtgg aaagtcccca 7020
ggctccccag caggcagaag tatgcaaagc atgcatctca attagtcagc aaccatagtc 7080
ccgcccctaa ctccgcccat cccgccccta actccgccca gttccgccca ttctccgccc 7140
catggctgac taattttttt tatttatgca gaggccgagg ccgcctctgc ctctgagcta 7200
ttccagaagt agtgaggagg cttttttgga ggcctaggct tttgcaaaaa gctcccggga 7260
gcttgtatat ccattttcgg atctgatcaa gagacaggat gaggatcgtt tcgcatgatt 7320
gaacaagatg gattgcacgc aggttctccg gccgcttggg tggagaggct attcggctat 7380
gactgggcac aacagacaat cggctgctct gatgccgccg tgttccggct gtcagcgcag 7440
gggcgcccgg ttctttttgt caagaccgac ctgtccggtg ccctgaatga actgcaggac 7500
gaggcagcgc ggctatcgtg gctggccacg acgggcgttc cttgcgcagc tgtgctcgac 7560
gttgtcactg aagcgggaag ggactggctg ctattgggcg aagtgccggg gcaggatctc 7620
ctgtcatctc accttgctcc tgccgagaaa gtatccatca tggctgatgc aatgcggcgg 7680
ctgcatacgc ttgatccggc tacctgccca ttcgaccacc aagcgaaaca tcgcatcgag 7740
cgagcacgta ctcggatgga agccggtctt gtcgatcagg atgatctgga cgaagagcat 7800
caggggctcg cgccagccga actgttcgcc aggctcaagg cgcgcatgcc cgacggcgag 7860
gatctcgtcg tgacccatgg cgatgcctgc ttgccgaata tcatggtgga aaatggccgc 7920
ttttctggat tcatcgactg tggccggctg ggtgtggcgg accgctatca ggacatagcg 7980
ttggctaccc gtgatattgc tgaagagctt ggcggcgaat gggctgaccg cttcctcgtg 8040
ctttacggta tcgccgctcc cgattcgcag cgcatcgcct tctatcgcct tcttgacgag 8100
ttcttctgag cgggactctg gggttcgaaa tgaccgacca agcgacgccc aacctgccat 8160
cacgagattt cgattccacc gccgccttct atgaaaggtt gggcttcgga atcgttttcc 8220
gggacgccgg ctggatgatc ctccagcgcg gggatctcat gctggagttc ttcgcccacc 8280
ccaacttgtt tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca 8340
caaataaagc atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat 8400
cttatcatgt ctgtataccg tcgacctcta gctagagctt ggcgtaatca tggtcatagc 8460
tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca 8520
taaagtgtaa agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct 8580
cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 8640
gcgcggggag aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc 8700
tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt 8760
tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg 8820
ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg 8880
agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat 8940
accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta 9000
ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa tgctcacgct 9060
gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc 9120
ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa 9180
gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg 9290
taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag 9300
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-20-
tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt 9360
gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta 9420
cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc 9480
agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca 9540
cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa 9600
cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat 9660
ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct 9720
taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt 9780
tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat 9840
ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta 9900
atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg 9960
gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt 10020
tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg 10080
cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg 10140
taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc 10200
ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa 10260
ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac 10320
cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt 10380
ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg 10440
gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa 10500
gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata 10560
aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc Y 10610
<210> 17
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 17
tgtacaccgg atccggcgca cacc 24
<210> 18
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
<400> 18
cacaacgagc tcaattaatt aattgccaca tcctc 35
<210> 19
<211> 4
<212> PRT
<213> adenovirus
<400> 19
Thr Leu Trp Thr
1
<210> 20
<211> 12
<212> PRT
<213> adenovirus
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-21-
<400> 20
Pro Ser SerAla SerAlaSer AlaPro GlySer
Ala
1 5 10
<210> 21
<211> 44
<212> PRT
<213> adenovirus
<400> 21
Met Lys AlaArg ProSerGlu AspThr PheAsn Pro Val Tyr
Arg Pro
1 5 10 15
Tyr Asp GluThr GlyProPro ThrVal ProPhe Leu Thr Pro
Thr Pro
20 25 30
Phe Val ProAsn GlyPheGln GluSer ProPro
Ser
35 40
<210> 22
<211> 43
<212> PRT
<213> adenovirus
<400> 22
Met Ala Lys Arg Ala Leu ThrSer Phe Asn Pro Val
Arg Ser Tyr Pro
1 5 10 15
Tyr Glu Asp Glu Ser Ser HisPro Phe Ile Asn Pro
Ser Gln Gly Phe
20 25 30
Ile Ser Pro Asp Gly Thr SerPro Asn
Phe Gln
35 40
<210> 23
<211> 43
<212> PRT
<213> adenovirus
<400> 23
Met Ser Lys Arg Leu Arg Val Glu Asp Asp Phe Asn Pro Val Tyr Pro
1 5 10 15
Tyr Gly Tyr Ala Arg Asn Gln Asn Ile Pro Phe Leu Thr Pro Pro Phe
20 25 30
Val Ser Ser Asp Gly Phe Lys Asn Phe Pro Pro
35 40
<210> 24
<211> 42
<212> PRT
<213> adenovirus
<400> 24
Met Lys Arg Ala Arg Phe Glu Asp Asp Phe Asn Pro Val Tyr Pro Tyr
1 5 10 15
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-22-
Glu His Tyr Asn Pro Leu Asp Ile Pro Phe Ile Thr Pro Pro Phe Ala
20 ~ 25 30
Ser Ser Asn Gly Leu Gln Glu Lys Pro Pro
35 40
<210> 25
<211> 42
<212> PRT
<213> adenovirus
<400> 25
Met Lys Arg Thr Arg Ile Glu Asp Asp Phe Asn Pro Val Tyr Pro Tyr
1 ' S 10 15
Asp Thr Ser Ser Thr Pro Ser Ile Pro Tyr Val Ala Pro Pro Phe Val
20 25 30
Ser Ser Asp Gly Leu Gln Glu Asn Pro Pro
35 40
<210> 26
<211> 327
<212> DNA
<213> adenovirus
<400> 26
agatctgaat tcgagctcgc tgttgggctc gcggttgagg acaaactctt cgcggtcttt 60
ccagtactct tggatcggaa acccgtcggc ctccgaacgg tactccgcca ccgagggacc 120
tgagcgagtc cgcatcgacc ggatcggaaa acctctcgag aaaggcgtct aaccagtcac 180
agtcgcaagg taggctgagc accgtggcgg gcggcagcgg gtggcggtcg gggttgtttc 240
tggcggaggt gctgctgatg atgtaattaa agtaggcggt cttgagacgg cggatggtcg 300
aggtgaggtg tggcaggctt gagatct 327
<210> 27
<211> 32480
<212> DNA
<213> adenovirus
<400> 27
catcatcaat aatatacctt attttggatt gaagccaata tgataatgag ggggtggagt 60
ttgtgacgtg gcgcggggcg tgggaacggg gcgggtgacg tagtagtgtg gcggaagtgt 120
gatgttgcaa gtgtggcgga acacatgtaa gcgacggatg tggcaaaagt gacgtttttg 180
gtgtgcgccg gtgtacacag gaagtgacaa ttttcgcgcg gttttaggcg gatgttgtag 240
taaatttggg cgtaaccgag taagatttgg ccattttcgc gggaaaactg aataagagga 300
agtgaaatct gaataatttt gtgttactca tagcgcgtaa tctctagcat cgatgtcgac 360
aagcttgaat tcgattaatg tgagttagct cactcattag gcaccccagg ctttacactt 420
tatgcttccg gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa 480
cagctatgac catgattacg aattcggcgc agcaccatgg cctgaaataa cctctgaaag 540
aggaacttgg ttaggtacct tctgaggcgg aaagaaccag ctgtggaatg tgtgtcagtt 600
agggtgtgga aagtccccag gctccccagc aggcagaagt atgcaaagca tgcatctcaa 660
ttagtcagca accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag 720
catgcatctc aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct 780
aactccgccc agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc 840
agaggccgag gccgcctcgg cctctgagct attccagaag tagtgaggag gcttttttgg 900
aggcctaggc ttttgcaaaa agcttgggat ctctataatc tcgcgcaacc tattttcccc 960
tcgaacactt tttaagccgt agataaacag gctgggacac ttcacatgag cgaaaaatac 1020
atcgtcacct gggacatgtt gcagatccat gcacgtaaac tcgcaagccg actgatgcct 1080
tctgaacaat ggaaaggcat tattgccgta agccgtggcg gtctggtacc ggtgggtgaa 1140
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-23-
gaccagaaac agcacctcga actgagccgc gatattgccc agcgtttcaa cgcgctgtat 1200
ggcgagatcg atcccgtcgt tttacaacgt cgtgactggg aaaaccctgg cgttacccaa 1260
cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga agaggcccgc 1320
accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatggcgctt tgcctggttt 1380
ccggcaccag aagcggtgcc ggaaagctgg ctggagtgcg atcttcctga ggccgatact 1440
gtcgtcgtcc cctcaaactg gcagatgcac ggttacgatg cgcccatcta caccaacgta 1500
acctatccca ttacggtcaa tccgccgttt gttcccacgg agaatccgac gggttgttac 1560
tcgctcacat ttaatgttga tgaaagctgg ctacaggaag gccagacgcg aattattttt 1620
gatggcgtta actcggcgtt tcatctgtgg tgcaacgggc gctgggtcgg ttacggccag 1680
gacagtcgtt tgccgtctga atttgacctg agcgcatttt tacgcgccgg agaaaaccgc 1740
ctcgcggtga tggtgctgcg ttggagtgac ggcagttatc tggaagatca ggatatgtgg 1800
cggatgagcg gcattttccg tgacgtctcg ttgctgcata aaccgactac acaaatcagc 1860
gatttccatg ttgccactcg ctttaatgat gatttcagcc gcgctgtact ggaggctgaa 1920
gttcagatgt gcggcgagtt gcgtgactac ctacgggtaa cagtttcttt atggcagggt 1980
gaaacgcagg tcgccagcgg caccgcgcct ttcggcggtg aaattatcga tgagcgtggt 2040
ggttatgccg atcgcgtcac actacgtctg aacgtcgaaa acccgaaact gtggagcgcc 2100
gaaatcccga atctctatcg tgcggtggtt gaactgcaca ccgccgacgg cacgctgatt 2160
gaagcagaag cctgcgatgt cggtttccgc gaggtgcgga ttgaaaatgg tctgctgctg 2220
ctgaacggca agccgttgct gattcgaggc gttaaccgtc acgagcatca tcctctgcat 2280
ggtcaggtca tggatgagca gacgatggtg caggatatcc tgctgatgaa gcagaacaac 2340
tttaacgccg tgcgctgttc gcattatccg aaccatccgc tgtggtacac gctgtgcgac 2400
cgctacggcc tgtatgtggt ggatgaagcc aatattgaaa cccacggcat ggtgccaatg 2460
aatcgtctga ccgatgatcc gcgctggcta ccggcgatga gcgaacgcgt aacgcgaatg 2520
gtgcagcgcg atcgtaatca cccgagtgtg atcatctggt cgctggggaa tgaatcaggc 2580
cacggcgcta atcacgacgc gctgtatcgc tggatcaaat ctgtcgatcc ttcccgcccg 2640
gtgcagtatg aaggcggcgg agccgacacc acggccaccg atattatttg cccgatgtac 2700
gcgcgcgtgg atgaagacca gcccttcccg gctgtgccga aatggtccat caaaaaatgg 2760
ctttcgctac ctggagagac gcgcccgctg atcctttgcg aatacgccca cgcgatgggt 2820
aacagtcttg gcggtttcgc taaatactgg caggcgtttc gtcagtatcc ccgtttacag 2880
ggcggcttcg tctgggactg ggtggatcag tcgctgatta aatatgatga aaacggcaac 2940
ccgtggtcgg cttacggcgg tgattttggc gatacgccga acgatcgcca gttctgtatg 3000
aacggtctgg tctttgccga ccgcacgccg catccagcgc.tgacggaagc aaaacaccag 3060
cagcagtttt tccagttccg tttatccggg caa3ccatcg aagtgaccag cgaatacctg 3120
ttccgtcata gcgataacga gctcctgcac tggatggtgg cgctggatgg taagccgctg 3180
gcaagcggtg aagtgcctct ggatgtcgct ccacaaggta aacagttgat tgaactgcct 3240
gaactaccgc agccggagag cgccgggcaa ctctggctca cagtacgcgt agtgcaaccg 3300
aacgcgaccg catggtcaga agccgggcac atcagcgcct ggcagcagtg gcgtctggcg 3360
gaaaacctca gtgtgacgct ccccgccgcg tcccacgcca tcccgcatct gaccaccagc 3420
gaaatggatt tttgcatcga gctgggtaat aagcgttggc aatttaaccg ccagtcaggc 3480
tttctttcac agatgtggat tggcgataaa aaacaactgc tgacgccgct gcgcgatcag 3540
ttcacccgtg caccgctgga taacgacatt ggcgtaagtg aagcgacccg cattgaccct 3600
aacgcctggg tcgaacgctg gaaggcggcg ggccattacc aggccgaagc agcgttgttg 3660
cagtgcacgg cagatacact tgctgatgcg gtgctgatta cgaccgctca cgcgtggcag 3720
catcagggga aaaccttatt tatcagccgg aaaacctacc ggattgatgg tagtggtcaa 3780
atggcgatta ccgttgatgt tgaagtggcg agcgatacac cgcatccggc gcggattggc 3840
ctgaactgcc agctggcgca ggtagcagag cgggtaaact ggctcggatt agggccgcaa 390b
gaaaactatc ccgaccgcct tactgccgcc tgttttgacc gctgggatct gccattgtca 3960
gacatgtata ccccgtacgt cttcccgagc gaaaacggtc tgcgctgcgg gacgcgcgaa 4020
ttgaattatg gcccacacca gtggcgcggc gacttccagt tcaacatcag ccgctacagt 4080
caacagcaac tgatggaaac cagccatcgc catctgctgc acgcggaaga aggcacatgg 4140
ctgaatatcg acggtttcca tatggggatt ggtggcgacg actcctggag cccgtcagta 4200
tcggcggaat tccagctgag cgccggtcgc taccattacc agttggtctg gtgtcaaaaa 4260
taataataac cgggcaggcc atgtctgccc gtatttcgcg taaggaaatc cattatgtac 4320
tatttaaaaa acacaaactt ttggatgttc ggtttattct ttttctttta cttttttatc 4380
atgggagcct acttcccgtt tttcccgatt tggctacatg acatcaacca tatcagcaaa 4440
agtgatacgg gtattatttt tgccgctatt tctctgttct cgctattatt ccaaccgctg 4500
tttggtctgc tttctgacaa actcggaact tgtttattgc agcttataat ggttacaaat 4560
aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat tctagttgtg 4620
gtttgtccaa actcatcaat gtatcttatc atgtctggat ccagatctgg gcgtggctta 4680
agggtgggaa agaatatata aggtgggggt cttatgtagt tttgtatctg ttttgcagca 4740
gccgccgccg ccatgagcac caactcgttt gatggaagca ttgtgagctc atatttgaca 4800
acgcgcatgc ccccatgggc cggggtgcgt cagaatgtga tgggctccag cattgatggt 4860
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-24-
cgccccgtcc tgcccgcaaa ctctactacc ttgacctacg agaccgtgtc tggaacgccg 4920
ttggagactg cagcctccgc cgccgcttca gccgctgcag ccaccgcccg cgggattgtg 4980
actgactttg ctttcctgag cccgcttgca agcagtgcag cttcccgttc atccgcccgc 5040
gatgacaagt tgacggctct tttggcacaa ttggattctt tgacccggga acttaatgtc 5100
gtttctcagc agctgttgga tctgcgccag caggtttctg ccctgaaggc ttcctcccct 5160
cccaatgcgg tttaaaacat aaataaaaaa ccagactctg tttggatttg gatcaagcaa 5220
gtgtcttgct gtctttattt aggggttttg cgcgcgcggt aggcccggga ccagcggtct 5280
cggtcgttga gggtcctgtg tattttttcc aggacgtggt aaaggtgact ctggatgttc 5340
agatacatgg gcataagccc gtctctgggg tggaggtagc accactgcag agcttcatgc 5400
tgcggggtgg tgttgtagat gatccagtcg tagcaggagc gctgggcgtg gtgcctaaaa 5460
atgtctttca gtagcaagct gattgccagg ggcaggccct tggtgtaagt gtttacaaag 5520
cggttaagct gggatgggtg catacgtggg gatatgagat gcatcttgga ctgtattttt 5580
aggttggcta tgttcccagc catatccctc cggggattca tgttgtgcag aaccaccagc 5640
acagtgtatc cggtgcactt gggaaatttg tcatgtagct tagaaggaaa tgcgtggaag 5700
aacttggaga cgcccttgtg acctccaaga ttttccatgc attcgtccat aatgatggca 5760
atgggcccac gggcggcggc ctgggcgaag atatttctgg gatcactaac gtcatagttg 5820
tgttccagga tgagatcgtc ataggccatt tttacaaagc gcgggcggag ggtgccagac 5880
tgcggtataa tggttccatc cggcccaggg gcgtagttac cctcacagat ttgcatttcc 5940
cacgctttga gttcagatgg ggggatcatg tctacctgcg gggcgatgaa gaaaacggtt 6000
tccggggtag gggagatcag ctgggaagaa agcaggttcc tgagcagctg cgacttaccg 6060
cagccggtgg gcccgtaaat cacacctatt accgggtgca actggtagtt aagagagctg 6120
cagctgccgt catccctgag caggggggcc acttcgttaa gcatgtccct gactcgcatg 6180
ttttccctga ccaaatccgc cagaaggcgc tcgccgccca gcgatagcag ttcttgcaag 6240
gaagcaaagt ttttcaacgg tttgagaccg tccgccgtag gcatgctttt gagcgtttga 6300
ccaagcagtt ccaggcggtc ccacagctcg gtcacctgct ctacggcatc tcgatccagc 6360
atatctcctc gtttcgcggg ttggggcggc tttcgctgta cggcagtagt cggtgctcgt 6420
ccagacgggc cagggtcatg tctttccacg ggcgcagggt cctcgtcagc gtagtctggg 6480
tcacggtgaa ggggtgcgct ccgggctgcg cgctggccag ggtgcgcttg aggctggtcc 6540
tgctggtgct gaagcgctgc cggtcttcgc cctgcgcgtc ggccaggtag catttgacca 6600
tggtgtcata gtccagcccc tccgcggcgt ggcccttggc gcgcagcttg cccttggagg 6660
aggcgccgca cgaggggcag tgcagacttt tgagggcgta gagcttgggc gcgagaaata 6720
ccgattccgg ggagtaggca tccgcgccgc aggccccgca gacggtctcg cattccacga 6780
gccaggtgag ctctggccgt tcggggtcaa aaaccaggtt tcccccatgc tttttgatgc 6840
gtttcttacc tctggtttcc atgagccggt gtccacgctc ggtgacgaaa aggctgtccg 6900
tgtccccgta tacagacttg agaggcctgt cctcgagcgg tgttccgcgg tcctcctcgt 6960
atagaaactc ggaccactct gagacaaagg ctcgcgtcca ggccagcacg aaggaggcta 7020
agtgggaggg gtagcggtcg ttgtccacta gggggtccac tcgctccagg gtgtgaagac 7080
acatgtcgcc ctcttcggca tcaaggaagg tgattggttt gtaggtgtag gccacgtgac 7140
cgggtgttcc tgaagggggg ctataaaagg gggtgggggc gcgttcgtcc tcactctctt 7200
ccgcatcgct gtctgcgagg gccagctgtt ggggtgagta ctccctctga aaagcgggca 7260
tgacttctgc gctaagattg tcagtttcca aaaacgagga ggatttgata ttcacctggc 7320
ccgcggtgat gcctttgagg gtggccgcat ccatctggtc agaaaagaca atctttttgt 7380
tgtcaagctt ggtggcaaac gacccgtaga gggcgttgga cagcaacttg gcgatggagc 7440
gcagggtttg gtttttgtcg cgatcggcgc gctccttggc cgcgatgttt agctgcacgt 7500
attcgcgcgc aacgcaccgc cattcgggaa agacggtggt gcgctcgtcg ggcaccaggt 7560
gcacgcgcca accgcggttg tgcagggtga caaggtcaac gctggtggct acctctccgc 7620
gtaggcgctc gttggtccag cagaggcggc cgcccttgcg cgagcagaat ggcggtaggg 7680
ggtctagctg cgtctcgtcc ggggggtctg cgtccacggt aaagaccccg ggcagcaggc 7740
gcgcgtcgaa gtagtctatc ttgcatcctt gcaagtctag cgcctgctgc catgcgcggg 7800
cggcaagcgc gcgctcgtat gggttgagtg ggggacccca tggcatgggg tgggtgagcg 7860
cggaggcgta catgccgcaa atgtcgtaaa cgtagagggg ctctctgagt attccaagat 7920
atgtagggta gcatcttcca ccgcggatgc tggcgcgcac gtaatcgtat agttcgtgcg 7980
agggagcgag gaggtcggga ccgaggttgc tacgggcggg ctgctctgct cggaagacta 8040
tctgcctgaa gatggcatgt gagttggatg atatggttgg acgctggaag acgttgaagc 8100
tggcgtctgt gagacctacc gcgtcacgca cgaaggaggc gtaggagtcg cgcagcttgt 8160
tgaccagctc ggcggtgacc tgcacgtcta gggcgcagta gtccagggtt tccttgatga 8220
tgtcatactt atcctgtccc ttttttttcc acagctcgcg gttgaggaca aactcttcgc 8280
ggtctttcca gtactcttgg atcggaaacc cgtcggcctc cgaacggtaa gagcctagca 8340
tgtagaactg gttgacggcc tggtaggcgc agcatccctt ttctacgggt agcgcgtatg 8900
cctgcgcggc cttccggagc gaggtgtggg tgagcgcaaa ggtgtccctg accatgactt 8460
tgaggtactg gtatttgaag tcagtgtcgt cgcatccgcc ctgctcccag agcaaaaagt 8520
ccgtgcgctt tttggaacgc ggatttggca gggcgaaggt gacatcgttg aagagtatct 8580
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-25-
ttcccgcgcg aggcataaag ttgcgtgtga tgcggaaggg tcccggcacc tcggaacggt 8640
tgttaattac ctgggcggcg agcacgatct cgtcaaagcc gttgatgttg tggcccacaa 8700
tgtaaagttc caagaagcgc gggatgccct tgatggaagg caatttttta agttcctcgt 8760
aggtgagctc ttcaggggag ctgagcccgt gctctgaaag ggcccagtct gcaagatgag 8820
ggttggaagc gacgaatgag ctccacaggt cacgggccat tagcatttgc aggtggtcgc 8880
gaaaggtcct aaactggcga cctatggcca ttttttctgg ggtgatgcag tagaaggtaa 8940
gcgggtcttg ttcccagcgg tcccatccaa ggttcgcggc taggtctcgc gcggcagtca 9000
ctagaggctc atctccgccg aacttcatga ccagcatgaa gggcacgagc tgcttcccaa 9060
aggcccccat ccaagtatag gtctctacat cgtaggtgac aaagagacgc tcggtgcgag 9120
gatgcgagcc gatcgggaag aactggatct cccgccacca attggaggag tggctattga 9180
tgtggtgaaa gtagaagtcc ctgcgacggg ccgaacactc gtgctggctt ttgtaaaaac 9240
gtgcgcagta ctggcagcgg tgcacgggct gtacatcctg cacgaggttg acctgacgac 9300
cgcgcacaag gaagcagagt gggaatttga gcccctcgcc tggcgggttt ggctggtggt 9360
cttctactt~ ggctgcttgt ccttgaccgt ctggctgctc gaggggagtt acggtggatc 9420
ggaccaccac gccgcgcgag cccaaagtcc agatgtccgc gcgcggcggt cggagcttga 9480
tgacaacatc gcgcagatgg gagctgtcca tggtctggag ctcccgcggc gtcaggtcag 9540
gcgggagctc ctgcaggttt acctcgcata gacgggtcag ggcgcgggct agatccaggt 9600
gatacctaat ttccaggggc tggttggtgg cggcgtcgat ggcttgcaag aggccgcatc 9660
cccgcggcgc gactacggta ccgcgcggcg ggcggtgggc cgcgggggtg tccttggatg 9720
atgcatctaa aagcggtgac gcgggcgagc ccccggaggt agggggggct ccggacccgc 9780
cgggagaggg ggcaggggca cgtcggcgcc gcgcgcgggc aggagctggt gctgcgcgcg 9840
taggttgctg gcgaacgcga cgacgcggcg gttgatctcc tgaatctggc gcctctgcgt 9900
gaagacgacg ggcccggtga gcttgagcct gaaagagagt tcgacagaat caatttcggt 9960
gtcgttgacg gcggcctggc gcaaaatctc ctgcacgtct cctgagttgt cttgataggc 10020
gatctcggcc atgaactgct cgatctcttc ctcctggaga tctccgcgtc cggctcgctc 10080
cacggtggcg gcgaggtcgt tggaaatgcg ggccatgagc tgcgagaagg cgttgaggcc 10140
tccctcgttc cagacgcggc tgtagaccac gcccccttcg gcatcgcggg cgcgcatgac 10200
cacctgcgcg agattgagct ccacgtgccg ggcgaagacg gcgtagtttc gcaggcgctg 10260
aaagaggtag ttgagggtgg tggcggtgtg ttctgccacg aagaagtaca taacccagcg 10320
tcgcaacgtg gattcgttga tatcccccaa ggcctcaagg cgctccatgg cctcgtagaa 10380
gtccacggcg aagttgaaaa actgggagtt gcgcgccgac acggttaact cctcctccag 10940
aagacggatg agctcggcga cagtgtcgcg cacctcgcgc tcaaaggcta caggggcctc 10500
ttcttcttct tcaatctcct cttccataag ggcctcccct tcttcttctt ctggcggcgg 10560
tgggggaggg gggacacggc ggcgacgacg gcgcaccggg aggcggtcga caaagcgctc 10620
gatcatctcc ccgcggcgac ggcgcatggt ctcggtgacg gcgcggccgt tctcgcgggg 10680
gcgcagttgg aagacgccgc ccgtcatgtc ccggttatgg gttggcgggg ggctgccatg 10740
cggcagggat acggcgctaa cgatgcatct caacaattgt tgtgtaggta ctccgccgcc 10800
gagggacctg agcgagtccg catcgaccgg atcggaaaac ctctcgagaa aggcgtctaa 10860
ccagtcacag tcgcaaggta ggctgagcac cgtggcgggc ggcagcgggc ggcggtcggg 10920
gttgtttctg gcggaggtgc tgctgatgat gtaattaaag taggcggtct tgagacggcg 10980
gatggtcgac agaagcacca tgtccttggg tccggcctgc tgaatgcgca ggcggtcggc 11040
catgccccag gcttcgtttt gacatcggcg caggtctttg tagtagtctt gcatgagcct 11100
ttctaccggc acttcttctt ctccttcctc ttgtcctgca tctcttgcat ctatcgctgc 11160
ggcggcggcg gagtttggcc gtaggtggcg ccctcttcct cccatgcgtg tgaccccgaa 11220
gcccctcatc ggctgaagca gggctaggtc ggcgacaacg cgctcggcta atatggcctg 11280
ctgcacctgc gtgagggtag actggaagtc atccatgtcc acaaagcggt ggtatgcgcc 11340
cgtgttgatg gtgtaagtgc agttggccat aacggaccag ttaacggtct ggtgacccgg 11400
ctgcgagagc tcggtgtacc tgagacgcga gtaagccctc gagtcaaata cgtagtcgtt 11460
gcaagtccgc accaggtact ggtatcccac caaaaagtgc ggcggcggct ggcggtagag 11520
gggccagcgt agggtggccg gggctccggg ggcgagatct tccaacataa ggcgatgata 11580
tccgtagatg tacctggaca tccaggtgat gccggcggcg gtggtggagg cgcgcggaaa 11640
gtcgcggacg cggttccaga tgttgcgcag cggcaaaaag tgctccatgg tcgggacgct 11700
ctggccggtc aggcgcgcgc aatcgttgac gctctagacc gtgcaaaagg agagcctgta 11760
agcgggcact cttccgtggt ctggtggata aattcgcaag ggtatcatgg cggacgaccg 11820
gggttcgagc cccgtatccg gccgtccgcc gtgatccatg cggttaccgc ccgcgtgtcg 11880
aacccaggtg tgcgacgtca gacaacgggg gagtgctcct tttggcttcc ttccaggcgc 11940
ggcggctgct gcgctagctt ttttggccac tggccgcgcg cagcgtaagc ggttaggctg 12000
gaaagcgaaa gcattaagtg gctcgctccc tgtagccgga gggttatttt ccaagggttg 12060
agtcgcggga cccccggttc gagtctcgga ccggccggac tgcggcgaac gggggtttgc 12120
ctccccgtca tgcaagaccc cgcttgcaaa ttcctccgga aacagggacg agcccctttt 12180
ttgcttttcc cagatgcatc cggtgctgcg gcagatgcgc ccccctcctc agcagcggca 12240
agagcaagag cagcggcaga catgcagggc accctcccct cctcctaccg cgtcaggagg 12300
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-26-
ggcgacatcc gcggttgacg cggcagcaga tggtgattac gaacccccgc ggcgccgggc 12360
ccggcactac ctggacttgg aggagggcga gggcctggcg cggctaggag cgccctctcc 12420
tgagcggtac ccaagggtgc agctgaagcg tgatacgcgt gaggcgtacg tgccgcggca 12480
gaacctgttt cgcgaccgcg agggagagga gcccgaggag atgcgggatc gaaagttcca 12590
cgcagggcgc gagctgcggc atggcctgaa tcgcgagcgg ttgctgcgcg aggaggactt 12600
tgagcccgac gcgcgaaccg ggattagtcc cgcgcgcgca cacgtggcgg ccgccgacct 12660
ggtaaccgca tacgagcaga cggtgaacca ggagattaac tttcaaaaaa gctttaacaa 12720
ccacgtgcgt acgcttgtgg cgcgcgagga ggtggctata ggactgatgc atctgtggga 12780
ctttgtaagc gcgctggagc aaaacccaaa tagcaagccg ctcatggcgc agctgttcct'12840
tatagtgcag cacagcaggg acaacgaggc attcagggat gcgctgctaa acatagtaga 12900
gcccgagggc cgctggctgc tcgatttgat aaacatcctg cagagcatag tggtgcagga 12960
gcgcagcttg agcctggctg acaaggtggc cgccatcaac tattccatgc ttagcctggg 13020
caagttttac gcccgcaaga tataccatac cccttacgtt cccatagaca aggaggtaaa 13080
gatcgagggg ttctacatgc gcatggcgct gaaggtgctt accttgagcg acgacctggg 13140
cgtttatcgc aacgagcgca tccacaaggc cgtgagcgtg agccggcggc gcgagctcag 13200
cgaccgcgag ctgatgcaca gcctgcaaag ggccctggct ggcacgggca gcggcgatag 13260
agaggccgag tcctactttg acgcgggcgc tgacctgcgc tgggccccaa gccgacgcgc 13320
cctggaggca gctggggccg gacctgggct ggcggtggca cccgcgcgcg ctggcaacgt 13380
cggcggcgtg gaggaatatg acgaggacga tgagtacgag ccagaggacg gcgagtacta 13440
agcggtgatg tttctgatca gatgatgcaa gacgcaacgg acccggcggt gcgggcggcg 13500
ctgcagagcc agccgtccgg ccttaactcc acggacgact ggcgccaggt catggaccgc 13560
atcatgtcgc tgactgcgcg caatcctgac gcgttccggc agcagccgca ggccaaccgg 13620
ctctccgcaa ttctggaagc ggtggtcccg gcgcgcgcaa accccacgca cgagaaggtg 13680
ctggcgatcg taaacgcgct ggccgaaaac agggccatcc ggcccgacga ggccggcctg 13740
gtctacgacg cgctgcttca gcgcgtggct cgttacaaca gcggcaacgt gcagaccaac 13800
ctggaccggc tggtggggga tgtgcgcgag gccgtggcgc agcgtgagcg cgcgcagcag 13860
cagggcaacc tgggctccat ggttgcacta aacgccttcc tgagtacaca gcccgccaac 13920
gtgccgcggg gacaggagga ctacaccaac tttgtgagcg cactgcggct aatggtgact 13980
gagacaccgc aaagtgaggt gtaccagtct gggccagact attttttcca gaccagtaga 14040
caaggcctgc agaccgtaaa cctgagccag gctttcaaaa acttgcaggg gctgtggggg 14100
gtgcgggctc ccacaggcga ccgcgcgacc gtgtctagct tgctgacgcc caactcgcgc 14160
ctgttgctgc tgctaatagc gcccttcacg gacagtggca gcgtgtcccg ggacacatac 14220
ctaggtcact tgctgacact gtaccgcgag gccataggtc aggcgcatgt ggacgagcat 14280
actttccagg agattacaag tgtcagccgc gcgctggggc aggaggacac gggcagcctg 14340
gaggcaaccc taaactacct gctgaccaac cggcggcaga agatcccctc gttgcacagt 14400
ttaaacagcg aggaggagcg cattttgcgc tacgtgcagc agagcgtgag ccttaacctg 14460
atgcgcgacg gggtaacgcc cagcgtggcg ctggacatga ccgcgcgcaa catggaaccg 14520
ggcatgtatg cctcaaaccg gccgtttatc aaccgcctaa tggactactt gcatcgcgcg 14580
gccgccgtga accccgagta tttcaccaat gccatcttga acccgcactg gctaccgccc 14640
cctggtttct acaccggggg attcgaggtg cccgagggta acgatggatt cctctgggac 14700
gacatagacg acagcgtgtt ttccccgcaa ccgcagaccc tgctagagtt gcaacagcgc 14760
gagcaggcag aggcggcgct gcgaaaggaa agcttccgca ggccaagcag cttgtccgat 14820
ctaggcgctg cggccccgcg gtcagatgct agtagcccat ttccaagctt gatagggtct 14880
cttaccagca ctcgcaccac ccgcccgcgc ctgctgggcg aggaggagta cctaaacaac 14910
tcgctgctgc agccgcagcg cgaaaaaaac ctgcctccgg catttcccaa caacgggata 15000
gagagcctag tggacaagat gagtagatgg aagacgtacg cgcaggagca cagggacgtg 15060
ccaggcccgc gcccgcccac ccgtcgtcaa aggcacgacc gtcagcgggg tctggtgtgg 15120
gaggacgatg actcggcaga cgacagcagc gtcctggatt tgggagggag tggcaacccg 15180
tttgcgcacc ttcgccccag gctggggaga atgttttaaa aaaaaaaaag catgatgcaa 15240
aataaaaaac tcaccaaggc catggcaccg agcgttggtt ttcttgtatt ccccttagta 15300
tgcggcgcgc ggcgatgtat gaggaaggtc ctcctccctc ctacgagagt gtggtgagcg 15360
cggcgccagt ggcggcggcg ctgggttctc ccttcgatgc tcccctggac ccgccgtttg 15420
tgcctccgcg gtacctgcgg cctaccgggg ggagaaacag catccgttac tctgagttgg 15480
cacccctatt cgacaccacc cgtgtgtacc tggtggacaa caagtcaacg gatgtggcat 15540
ccctgaacta ccagaacgac cacagcaact ttctgaccac ggtcattcaa aacaatgact 15600
acagcccggg ggaggcaagc acacagacca tcaatcttga cgaccggtcg cactggggcg 15660
gcgacctgaa aaccatcctg cataccaaca tgccaaatgt gaacgagttc atgtttacca 15720
ataagtttaa ggcgcgggtg atggtgtcgc gcttgcctac taaggacaat caggtggagc 15780
tgaaatacga gtgggtggag ttcacgctgc ccgagggcaa ctactccgag accatgacca 15840
tagaccttat gaacaacgcg atcgtggagc actacttgaa agtgggcaga cagaacgggg 15900
ttctggaaag cgacatcggg gtaaagtttg acacccgcaa cttcagactg gggtttgacc 15960
ccgtcactgg tcttgtcatg cctggggtat atacaaacga agccttccat ccagacatca 16020
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-27-
ttttgctgcc aggatgcggg gtggacttca cccacagccg cctgagcaac ttgttgggca 16080
tccgcaagcg gcaacccttc caggagggct ttaggatcac ctacgatgat ctggagggtg 16140
gtaacattcc cgcactgttg gatgtggacg cctaccaggc gagcttgaaa gatgacaccg 16200
aacagggcgg gggtggcgca ggcggcagca acagcagtgg cagcggcgcg gaagagaact 16260
ccaacgcggc agccgcggca atgcagccgg tggaggacat gaacgatcat gccattcgcg 16320
gcgacacctt tgccacacgg gctgaggaga agcgcgctga ggccgaagca gcggccgaag 16380
ctgccgcccc cgctgcgcaa cccgaggtcg agaagcctca gaagaaaccg gtgatcaaac 16440
ccctgacaga ggacagcaag aaacgcagtt acaacctaat aagcaatgac agcaccttca 16500
cccagtaccg cagctggtac cttgcataca actacggcga ccctcagacc ggaatccgct 16560
catggaccct gctttgcact cctgacgtaa cctgcggctc ggagcaggtc tactggtcgt 16620
tgccagacat gatgcaagac cccgtgacct tccgctccac gcgccagatc agcaactttc 16680
cggtggtggg cgccgagctg ttgcccgtgc actccaagag cttctacaac gaccaggccg 16740
tctactccca actcatccgc cagtttacct ctctgaccca cgtgttcaat cgctttcccg 16800
agaaccagat tttggcgcgc ccgccagccc ccaccatcac caccgtcagt gaaaacgttc 16860
ctgctctca~ agatcacggg acgctaccgc tgcgcaacag catcggagga gtccagcgag 16920
tgaccattac tgacgccaga cgccgcacct gcccctacgt ttacaaggcc ctgggcatag 16980
tctcgccgcg cgtcctatcg agccgcactt tttgagcaag catgtccatc cttatatcgc 17040
ccagcaataa cacaggctgg ggcctgcgct tcccaagcaa gatgtttggc ggggccaaga 17100
agcgctccga ccaacaccca gtgcgcgtgc gcgggcacta ccgcgcgccc tggggcgcgc 17160
acaaacgcgg ccgcactggg cgcaccaccg tcgatgacgc catcgacgcg gtggtggagg 17220
aggcgcgcaa ctacacgccc acgccgccac cagtgtccac agtggacgcg gccattcaga 17280
ccgtggtgcg cggagcccgg cgctatgcta aaatgaagag acggcggagg ~gcgtagcac 17340
gtcgccaccg ccgccgaccc ggcactgccg cccaacgcgc ggcggcggcc ctgcttaacc 17400
gcgcacgtcg caccggccga cgggcggcca tgcgggccgc tcgaaggctg gccgcgggta 17460
ttgtcactgt gccccccagg tccaggcgac gagcggccgc cgcagcagcc gcggccatta 17520
gtgctatgac tcagggtcgc aggggcaacg tgtattgggt gcgcgactcg gttagcggcc 17580
tgcgcgtgcc cgtgcgcacc cgccccccgc gcaactagat tgcaagaaaa aactacttag 17640
actcgtactg ttgtatgtat -ccagcggcgg cggcgcgcaa cgaagctatg tccaagcgca 17700
aaatcaaaga agagatgctc caggtcatcg cgccggagat ctatggcccc ccgaagaagg 17760
aagagcagga ttacaagccc cgaaagctaa agcgggtcaa aaagaaaaag aaagatgatg 17820
atgatgaact tgacgacgag gtggaactgc tgcacgctac cgcgcccagg cgacgggtac 17880
agtggaaagg tcgacgcgta aaacgtgttt tgcgacccgg caccaccgta gtctttacgc 17940
ccggtgagcg ctccacccgc acctacaagc gcgtgtatga tgaggtgtac ggcgacgagg 18000
acctgcttga gcaggccaac gagcgcctcg gggagtttgc ctacggaaag cggcataagg 18060
acatgctggc gttgccgctg gacgagggca acccaacacc tagcctaaag cccgtaacac 18120
tgcagcaggt gctgcccgcg cttgcaccgt ccgaagaaaa gcgcggccta aagcgcgagt 18180
ctggtgactt ggcacccacc gtgcagctga tggtacccaa gcgccagcga ctggaagatg 18240
tcttggaaaa aatgaccgtg gaacctgggc tggagcccga ggtccgcgtg cggccaatca 18300
agcaggtggc gccgggactg ggcgtgcaga ccgtggacgt tcagataccc actaccagta 18360
gcaccagtat tgccaccgcc acagagggca tggagacaca aacgtccccg gttgcctcag 18420
cggtggcgga tgccgcggtg caggcggtcg ctgcggccgc gtccaagacc tctacggagg 18480
tgcaaacgga cccgtggatg tttcgcgttt cagccccccg gcgcccgcgc ggttcgagga 18540
agtacggcgc cgccagcgcg ctactgcccg aatatgccct acatccttcc attgcgccta 18600
cccccggcta tcgtggctac acctaccgcc ccagaagacg agcaactacc cgacgccgaa 18660
ccaccactgg aacccgccgc cgccgtcgcc gtcgccagcc cgtgctggcc ccgatttccg 18720
tgcgcagggt ggctcgcgaa ggaggcagga ccctggtgct gccaacagcg cgctaccacc 18780
ccagcatcgt ttaaaagccg gtctttgtgg ttcttgcaga tatggccctc acctgccgcc 18840
tccgtttccc ggtgccggga ttccgaggaa gaatgcaccg taggaggggc atggccggcc 18900
acggcctgac gggcggcatg cgtcgtgcgc accaccggcg gcggcgcgcg tcgcaccgtc 18960
gcatgcgcgg cggtatcctg cccctcctta ttccactgat cgccgcggcg attggcgccg 19020
tgcccggaat tgcatccgtg gccttgcagg cgcagagaca ctgattaaaa acaagttgca 19080
tgtggaaaaa tcaaaataaa aagtctggac tctcacgctc gcttggtcct gtaactattt 19140
tgtagaatgg aagacatcaa ctttgcgtct ctggccccgc gacacggctc gcgcccgttc 19200
atgggaaact ggcaagatat cggcaccagc aatatgagcg gtggcgcctt cagctggggc 19260
tcgctgtgga gcggcattaa aaatttcggt tccaccgtta agaactatgg cagcaaggcc 19320
tggaacagca gcacaggcca gatgctgagg gataagttga aagagcaaaa tttccaacaa 19380
aaggtggtag atggcctggc ctctggcatt agcggggtgg tggacctggc caaccaggca 19440
gtgcaaaata agattaacag taagcttgat ccccgccctc ccgtagagga gcctccaccg 19500
gccgtggaga cagtgtctcc agaggggcgt ggcgaaaagc gtccgcgccc cgacagggaa 19560
gaaactctgg tgacgcaaat agacgagcct ccctcgtacg aggaggcact aaagcaaggc 19620
ctgcccacca cccgtcccat cgcgcccatg gctaccggag tgctgggcca gcacacaccc 19680
gtaacgctgg acctgcctcc ccccgccgac acccagcaga aacctgtgct gccaggcccg 19740
caagttttac gcccgcaaga tataccatac cccttacgtt cccatagaca aggaggtaaa
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-28-
accgccgttg ttgtaacccg tcctagccgc gcgtccctgc gccgcgccgc cagcggtccg 19800
cgatcgttgc ggcccgtagc cagtggcaac tggcaaagca cactgaacag catcgtgggt 19860
ctgggggtgc aatccctgaa gcgccgacga tgcttctgaa tagctaacgt gtcgtatgtg 19920
tgtcatgtat gcgtccatgt cgccgccaga ggagctgctg agccgccgcg cgcccgcttt 19980
ccaagatggc taccccttcg atgatgccgc agtggtctta catgcacatc tcgggccagg 20040
acgcctcgga gtacctgagc cccgggctgg tgcagtttgc ccgcgccacc gagacgtact 20100
tcagcctgaa taacaagttt agaaacccca cggtggcgcc tacgcacgac gtgaccacag 20160
accggtccca gcgtttgacg ctgcggttca tccctgtgga ccgtgaggat actgcgtact 20220
cgtacaaggc gcggttcacc ctagctgtgg gtgataaccg tgtgctggac atggcttcca 20280
cgtactttga catccgcggc gtgctggaca ggggccctac ttttaagccc tactctggca 20340
ctgcctacaa cgccctggct cccaagggtg ccccaaatcc ttgcgaatgg gatgaagctg 20400
ctactgctct tgaaataaac ctagaagaag aggacgatga caacgaagac gaagtagacg 20460
agcaagctga gcagcaaaaa actcacgtat ttgggcaggc gccttattct ggtataaata 20520
ttacaaagga gggtattcaa ataggtgtcg aaggtcaaac acctaaatat gccgataaaa 20580
catttcaacc tgaacctcaa ataggagaat ctcagtggta cgaaactgaa attaatcatg 20640
cagctgggag agtccttaaa aagactaccc caatgaaacc atgttacggt tcatatgcaa 20700
aacccacaaa tgaaaatgga gggcaaggca ttcttgtaaa gcaacaaaat ggaaagctag 20760
aaagtcaagt ggaaatgcaa tttttctcaa ctactgaggc gaccgcaggc aatggtgata 20820
acttgactcc taaagtggta ttgtacagtg aagatgtaga tatagaaacc ccagacactc 20880
atatttctta catgcccact attaaggaag gtaactcacg agaactaatg ggccaacaat 20940
ctatgcccaa caggcctaat tacattgctt ttagggacaa ttttattggt ctaatgtatt 21000
acaacagcac gggtaatatg ggtgttctgg cgggccaagc atcgcagttg aatgctgttg 21060
tagatttgca agacagaaac acagagcttt cataccagct tttgcttgat tccattggtg 21120
atagaaccag gtacttttct atgtggaatc aggctgttga cagctatgat ccagatgtta 21180
gaattattga aaatcatgga actgaagatg aacttccaaa ttactgcttt ccactgggag 21240
gtgtgattaa tacagagact cttaccaagg taaaacctaa aacaggtcag gaaaatggat 21300
gggaaaaaga tgctacagaa ttttcagata aaaatgaaat aagagttgga aataattttg 21360
ccatggaaat caatctaaat gccaacctgt ggagaaattt cctgtactcc aacatagcgc 21420
tgtatttgcc cgacaagcta aagtacagtc cttccaacgt aaaaatttct gataacccaa 21480
acacctacga ctacatgaac aagcgagtgg tggctcccgg gttagtggac tgctacatta 21540
accttggagc acgctggtcc cttgactata tggacaacgt caacccattt aaccaccacc 21600
gcaatgctgg cctgcgctac cgctcaatgt tgctgggcaa tggtcgctat gtgcccttcc 21660
acatccaggt gcctcagaag ttctttgcca ttaaaaacct ccttctcctg ccgggctcat 21720
acacctacga gtggaacttc aggaaggatg ttaacatggt tctgcagagc tccctaggaa 21780
atgacctaag ggttgacgga gccagcatta agtttgatag catttgcctt tacgccacct 21840
tcttccccat ggcccacaac accgcctcca cgcttgaggc catgcttaga aacgacacca 21900
acgaccagtc ctttaacgac tatctctccg ccgccaacat gctctaccct atacccgcca 21960
acgctaccaa cgtgcccata tccatcccct cccgcaactg ggcggctttc cgcggctggg 22020
ccttcacgcg ccttaagact aaggaaaccc catcactggg ctcgggctac gacccttatt 22080
acacctactc tggctctata ccctacctag atggaacctt ttacctcaac cacaccttta 22140
agaaggtggc cattaccttt gactcttctg tcagctggcc tggcaatgac cgcctgctta 22200
cccccaacga gtttgaaatt aagcgctcag ttgacgggga gggttacaac gttgcccagt 22260
gtaacatgac caaagactgg ttcctggtac aaatgctagc taactacaac attggctacc 22320
agggcttcta tatcccagag agctacaagg accgcatgta ctccttcttt agaaacttcc 22380
agcccatgag ccgtcaggtg gtggatgata ctaaatacaa ggactaccaa caggtgggca 22440
tcctacacca acacaacaac tctggatttg ttggctacct tgcccccacc atgcgcgaag 22500
gacaggccta ccctgctaac ttcccctatc cgcttatagg caagaccgca gttgacagca 22560
ttacccagaa aaagtttctt tgcgatcgca ccctttggcg catcccattc tccagtaact 22620
ttatgtccat gggcgcactc acagacctgg gccaaaacct tctctacgcc aactccgccc 22680
acgcgctaga catgactttt gaggtggatc ccatggacga gcccaccctt ctttatgttt 22740
tgtttgaagt ctttgacgtg gtccgtgtgc accggccgca ccgcggcgtc atcgaaaccg 22800
tgtacctgcg cacgcccttc tcggccggca acgccacaac ataaagaagc aagcaacatc 22860
aacaacagct gccgccatgg gctccagtga gcaggaactg aaagccattg tcaaagatct 22920
tggttgtggg ccatattttt tgggcaccta tgacaagcgc tttccaggct ttgtttctcc 22980
acacaagctc gcctgcgcca tagtcaatac ggccggtcgc gagactgggg gcgtacactg 23040
gatggccttt gcctggaacc cgcactcaaa aacatgctac ctctttgagc cctttggctt 23100
ttctgaccag cgactcaagc aggtttacca gtttgagtac gagtcactcc tgcgccgtag 23160
cgccattgct tcttcccccg accgctgtat aacgctggaa aagtccaccc aaagcgtaca 23220
ggggcccaac tcggccgcct gtggactatt ctgctgcatg tttctccacg cctttgccaa 23280
ctggccccaa actcccatgg atcacaaccc caccatgaac cttattaccg gggtacccaa 23340
ctccatgctc aacagtcccc aggtacagcc caccctgcgt cgcaaccagg aacagctcta 23400
cagcttcctg gagcgccact cgccctactt ccgcagccac agtgcgcaga ttaggagcgc 23460
CA 02359795 2001-07-12 PCT~,P00/00265
WO 00/42208
-29-
cacttctttt tgtcacttga aaaacatgta aaaataatgt actagagaca ctttcaataa 23520
aggcaaatgc ttttatttgt acactctcgg gtgattattt acccccaccc ttgccgtctg 23580
cgccgtttaa aaatcaaagg ggttctgccg cgcatcgcta tgcgccactg gcagggacac 23640
gttgcgatac tggtgtttag tgctccactt aaactcaggc acaaccatcc gcggcagctc 23700
ggtgaagttt tcactccaca ggctgcgcac catcaccaac gcgtttagca ggtcgggcgc 23760
cgatatcttg aagtcgcagt tggggcctcc gccctgcgcg cgcgagttgc gatacacagg 23820
gttgcagcac tggaacacta tcagcgccgg gtggtgcacg ctggccagca cgctcttgtc 23880
ggagatcaga tccgcgtcca ggtcctccgc gttgctcagg gcgaacggag tcaactttgg 23940
tagctgcctt cccaaaaagg gcgcgtgccc aggctttgag ttgcactcgc accgtagtgg 24000
catcaaaagg tgaccgtgcc cggtctgggc .gttaggatac agcgcctgca taaaagcctt 24060
gatctgctta aaagccacct gagcctttgc gccttcagag aagaacatgc cgcaagactt 24120
gccggaaaac tgattggccg gacaggccgc gtcgtgcacg cagcaccttg cgtcggtgtt 24180
ggagatctgc accacatttc ggccccaccg gttcttcacg atcttggcct tgctagactg 24240
ctccttcagc gcgcgctgcc cgttttcgct cgtcacatcc atttcaatca cgtgctcctt 24300
atttatcata atgcttccgt gtagacactt aagctcgcct tcgatctcag cgcagcggtg 24360
cagccacaac gcgcagcccg tgggctcgtg atgcttgtag gtcacctctg caaacgactg 24420
caggtacgcc tgcaggaatc gccccatcat cgtcacaaag gtcttgttgc tggtgaaggt 24480
cagctgcaac ccgcggtgct cctcgttcag ccaggtcttg catacggccg ccagagcttc 24540
cacttggtca ggcagtagtt tgaagttcgc ctttagatcg ttatccacgt ggtacttgtc 24600
catcagcgcg cgcgcagcct ccatgccctt ctcccacgca gacacgatcg gcacactcag 24660
cgggttcatc accgtaattt cactttccgc ttcgctgggc tcttcctctt cctcttgcgt 24720
ccgcatacca cgcgccactg ggtcgtcttc attcagccgc cgcactgtgc c~cttacctcc 24780
tttgccatgc ttgattagca ccggtgggtt gctgaaaccc accatttgta gcgccacatc 24840
ttctctttct tcctcgctgt ccacgattac ctctggtgat ggcgggcgct cgggcttggg 24900
agaagggcgc ttctttttct tcttgggcgc aatggccaaa tccgccgccg aggtcgatgg 24960
ccgcgggctg ggtgtgcgcg gcaccagcgc gtcttgtgat gagtcttcct cgtcctcgga 25020
ctcgatacgc cgcctcatcc gcttttttgg gggcgcccgg ggaggcggcg gcgacgggga 25080
cggggacgac acgtcctcca tggttggggg acgtcgcgcc gcaccgcgtc cgcgctcggg 25140
ggtggtttcg cgctgctcct cttcccgact ggccatttcc ttctcctata ggcagaaaaa 25200
gatcatggag tcagtcgaga agaaggacag cctaaccgcc ccctctgagt tcgccaccac 25260
cgcctccacc gatgccgcca acgcgcctac caccttcccc gtcgaggcac ccccgcttga 25320
ggaggaggaa gtgattatcg agcaggaccc aggttttgta agcgaagacg acgaggaccg 25380
ctcagtacca acagaggata aaaagcaaga ccaggacaac gcagaggcaa acgaggaaca 25440
agtcgggcgg ggggacgaaa ggcatggcga ctacctagat gtgggagacg acgtgctgtt 25500
gaagcatctg cagcgccagt gcgccattat ctgcgacgcg ttgcaagagc gcagcgatgt 25560
gcccctcgcc atagcggatg tcagccttgc ctacgaacgc cacctattct caccgcgcgt 25620
accccccaaa cgccaagaaa acggcacatg cgagcccaac ccgcgcctca acttctaccc 25680
cgtatttgcc gtgccagagg tgcttgccac ctatcacatc tttttccaaa actgcaagat 25740
acccctatcc tgccgtgcca accgcagccg agcggacaag cagctggcct tgcggcaggg 25800
cgctgtcata cctgatatcg cctcgctcaa cgaagtgcca aaaatctttg agggtcttgg 25860
acgcgacgag aagcgcgcgg caaacgctct gcaacaggaa aacagcgaaa atgaaagtca 25920
ctctggagtg ttggtggaac tcgagggtga caacgcgcgc ctagccgtac taaaacgcag 25980
catcgaggtc acccactttg cctacccggc acttaaccta ccccccaagg tcatgagcac 26040
agtcatgagt gagctgatcg tgcgccgtgc gcagcccctg gagagggatg caaatttgca 26100
agaacaaaca gaggagggcc tacccgcagt tggcgacgag cagctagcgc gctggcttca 26160
aacgcgcgag cctgccgact tggaggagcg acgcaaacta atgatggccg cagtgctcgt 26220
taccgtggag cttgagtgca tgcagcggtt ctttgctgac ccggagatgc agcgcaagct 26280
agaggaaaca ttgcactaca cctttcgaca gggctacgta cgccaggcct gcaagatctc 26340
caacgtggag ctctgcaacc tggtctccta ccttggaatt ttgcacgaaa accgccttgg 26400
gcaaaacgtg cttcattcca cgctcaaggg cgaggcgcgc cgcgactacg tccgcgactg 26460
cgtttactta tttctatgct acacctgg~a gacggccatg ggcgtttggc agcagtgctt 26520
ggaggagtgc aacctcaagg agctgcagaa actgctaaag caaaacttga aggacctatg 26580
gacggccttc aacgagcgct ccgtggccgc gcacctggcg gacatcattt tccccgaacg 26690
cctgcttaaa accctgcaac agggtctgcc agacttcacc agtcaaagca tgttgcagaa 26700
ctttaggaac tttatcctag agcgctcagg aatcttgccc gccacctgct gtgcacttcc 26760
tagcgacttt gtgcccatta agtaccgcga atgccctccg ccgctttggg gccactgcta 26820
ccttctgcag ctagccaact accttgccta ccactctgac ataatggaag acgtgagcgg 26880
tgacggtcta ctggagtgtc actgtcgctg caacctatgc accccgcacc gctccctggt 26940
ttgcaattcg cagctgctta acgaaagtca aattatcggt acctttgagc tgcagggtcc 27000
ctcgcctgac gaaaagtccg cggctccggg gttgaaactc actccggggc tgtggacgtc 27060
ggcttacctt cgcaaatttg tacctgagga ctaccacgcc cacgagatta ggttctacga 27120
agaccaatcc cgcccgccaa atgcggagct taccgcctgc gtcattaccc agggccacat 27180
CA 02359795 2001-07-12 pCT~P00/00265
WO 00/42208
-30-
tcttggccaa ttgcaagcca tcaacaaagc ccgccaagag tttctgctac gaaagggacg 27240
gggggtttac ttggaccccc agtccggcga ggagctcaac ccaatccccc cgccgccgca 27300
gccctatcag cagcagccgc gggcccttgc ttcccaggat ggcacccaaa aagaagctgc 27360
agctgccgcc gccacccacg gacgaggagg aatactggga cagtcaggca gaggaggttt 27420
tggacgagga ggaggaggac atgatggaag actgggagag cctagacgag gaagcttccg 27480
aggtcgaaga ggtgtcagac gaaacaccgt caccctcggt cgcattcccc tcgccggcgc 27540
cccagaaatc ggcaaccggt tccagcatgg ctacaacctc cgctcctcag gcgccgccgg 27600
cactgcccgt tcgccgaccc aaccgtagat gggacaccac tggaaccagg gccggtaagt 27660
ccaagcagcc gccgccgtta gcccaagagc aacaacagcg ccaaggctac cgctcatggc 27720
gcgggcacaa gaacgccata gttgcttgct tgcaagactg tgggggcaac atctccttcg 27780
cccgccgctt tcttctctac catcacggcg tggccttccc ccgtaacatc ctgcattact 27840
accgtcatct ctacagccca tactgcaccg gcggcagcgg cagcggcagc aacagcagcg 27900
gccacacaga agcaaaggcg accggatagc aagactctga caaagcccaa gaaatccaca 27960
gcggcggcag cagcaggagg aggagcgctg cgtctggcgc ccaacgaacc cgtatcgacc 28020
cgcgagctta gaaacaggat ttttcccact ctgtatgcta tatttcaaca gagcaggggc 28080
caagaacaag agctgaaaat aaaaaacagg tctctgcgat ccctcacccg cagctgcctg 28140
tatcacaaaa gcgaagatca gcttcggcgc acgctggaag acgcggaggc tctcttcagt 28200
aaatactgcg cgctgactct taaggactag tttcgcgccc tttctcaaat ttaagcgcga 28260
aaactacgtc atctccagcg gccacacccg gcgccagcac ctgtcgtcag cgccattatg 28320
agcaaggaaa ttcccacgcc ctacatgtgg agttaccagc cacaaatggg acttgcggct 28380
ggagctgccc aagactactc aacccgaata aactacatga gcgcgggacc ccacatgata 28490
tcccgggtca acggaatccg cgcccaccga aaccgaattc tcttggaaca ggcggctatt 28500
accaccacac ctcgtaataa ccttaatccc cgtagttggc ccgctgccct c~gtgtaccag 28560
gaaagtcccg ctcccaccac tgtggtactt cccagagacg cccaggccga agttcagatg 28620
actaactcag gggcgcagct tgcgggcggc tttcgtcaca gggtgcggtc gcccgggcag 28680
ggtataactc acctgacaat cagagggcga ggtattcagc tcaacgacga gtcggtgagc 28740
tcctcgcttg gtctccgtcc ggacgggaca tttcagatcg gcggcgccgg ccgtccttca 28800
ttcacgcctc gtcaggcaat cctaactctg cagacctcgt cctctgagcc gcgctctgga 28860
ggcattggaa ctctgcaatt tattgaggag tttgtgccat cggtctactt taaccccttc 28920
tcgggacctc ccggccacta tccggatcaa tttattccta actttgacgc ggtaaaggac 28980
tcggcggacg gctacgactg aatgttaagt ggagaggcag agcaactgcg cctgaaacac 29040
ctggtccact gtcgccgcca caagtgcttt gcccgcgact ccggtgagtt ttgctacttt 29100
gaattgcccg aggatcatat cgagggcccg gcgcacggcg tccggcttac cgcccaggga 29160
gagcttgccc gtagcctgat tcgggagttt acccagcgcc ccctgctagt tgagcgggac 29220
aggggaccct gtgttctcac tgtgatttgc aactgtccta accttggatt acatcaagat 29280
ttaattaatt gccacatcct cttacacttt ttcatacatt gcccaagaat aaagaatcgt 29340
ttgtgttatg tttcaacgtg tttatttttc aattgcagaa aatttcaagt catttttcat 29400
tcagtagtat agccccacca ccacatagct tatacagatc accgtacctt aatcaaactc 29460
acagaaccct agtattcaac ctgccacctc cctcccaaca cacagagtac acagtccttt 29520
ctccccggct ggccttaaaa agcatcatat catgggtaac agacatattc ttaggtgtta 29580
tattccacac ggtttcctgt cgagccaaac gctcatcagt gatattaata aactccccgg 29640
gcagctcact taagttcatg tcgctgtcca gctgctgagc cacaggctgc tgtccaactt 29700
gcggttgctt aacgggcggc gaaggagaag tccacgccta catgggggta gagtcataat 29760
cgtgcatcag gatagggcgg tggtgctgca gcagcgcgcg aataaactgc tgccgccgcc 29820
gctccgtcct gcaggaatac aacatggcag tggtctcctc agcgatgatt cgcaccgccc 29880
gcagcataag gcgccttgtc ctccgggcac agcagcgcac cctgatctca cttaaatcag 29940
cacagtaact gcagcacagc accacaatat tgttcaaaat cccacagtgc aaggcgctgt 30000
atccaaagct catggcgggg accacagaac ccacgtggcc atcataccac aagcgcaggt 30060
agattaagtg gcgacccctc ataaacacgc tggacataaa cattacctct tttggcatgt 30120
tgtaattcac cacctcccgg taccatataa acctctgatt aaacatggcg ccatccacca 30180
ccatcctaaa ccagctggcc aaaacctgcc cgccggctat acactgcagg gaaccgggac 30240
tggaacaatg acagtggaga gcccaggact cgtaaccatg gatcatcatg ctcgtcatga 30300
tatcaatgtt ggcacaacac aggcacacgt gcatacactt cctcaggatt acaagctcct 30360
cccgcgttag aaccatatcc cagggaacaa cccattcctg aatcagcgta aatcccacac 30920
tgcagggaag acctcgcacg taactcacgt tgtgcattgt caaagtgtta cattcgggca 30480
gcagcggatg atcctccagt atggtagcgc gggtttctgt ctcaaaagga ggtagacgat 30540
ccctactgta cggagtgcgc cgagacaacc gagatcgtgt tggtcgtagt gtcatgccaa 3060b
atggaacgcc ggacgtagtc atatttcctg aagcaaaacc aggtgcgggc gtgacaaaca 30660
gatctgcgtc tccggtctcg ccgcttagat cgctctgtgt agtagttgta gtatatccac 30720
tctctcaaag catccaggcg ccccctggct tcgggttcta tgtaaactcc ttcatgcgcc 30780
gctgccctga taacatccac caccgcagaa taagccacac ccagccaacc tacacattcg 30840
ttctgcgagt cacacacggg aggagcggga agagctggaa gaaccatgtt ttttttttta 30900
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-31-
ttccaaaaga ttatccaaaa cctcaaaatg aagatctatt aagtgaacgc gctcccctcc 30960
ggtggcgtgg tcaaactcta cagccaaaga acagataatg gcatttgtaa gatgttgcac 31020
aatggcttcc aaaaggcaaa cggccctcac~gtccaagtgg acgtaaaggc taaacccttc 31080
agggtgaatc tcctctataa acattccagc accttcaacc atgcccaaat aattctcatc 31140
tcgccacctt ctcaatatat ctctaagcaa atcccgaata ttaagtccgg ccattgtaaa 31200
aatctgctcc agagcgccct ccaccttcag cctcaagcag cgaatcatga ttgcaaaaat 31260
tcaggttcct cacagacctg tataagattc aaaagcggaa cattaacaaa aataccgcga 31320
tcccgtaggt cccttcgcag ggccagctga acataatcgt gcaggtctgc acggaccagc 31380
gcggccactt ccccgccagg aaccttgaca aaagaaccca cactgattat gacacgcata 31440
ctcggagcta tgctaaccag cgtagccccg atgtaagctt tgttgcatgg gcggcgatat 31500
aaaatgcaag gtgctgctca aaaaatcagg caaagcctcg cgcaaaaaag aaagcacatc 31560
gtagtcatgc tcatgcagat aaaggcaggt aagctccgga accaccacag aaaaagacac 31620
catttttctc tcaaacatgt ctgcgggttt ctgcataaac acaaaataaa ataacaaaaa 31680
aacatttaaa cattagaagc ctgtcttaca acaggaaaaa caacccttat aagcataaga 31740
cggactacgg ccatgccggc gtgaccgtaa aaaaactggt caccgtgatt aaaaagcacc 31800
accgacagct cctcggtcat gtccggagtc ataatgtaag actcggtaaa cacatcaggt 31860
tgattcatcg gtcagtgcta aaaagcgacc gaaatagccc gggggaatac atacccgcag 31920
gcgtagagac aacattacag cccccatagg aggtataaca aaattaatag gagagaaaaa 31980
cacataaaca cctgaaaaac cctcctgcct aggcaaaata gcaccctccc gctccagaac 32040
aacatacagc gcttcacagc ggcagcctaa cagtcagcct taccagtaaa aaagaaaacc 32100
tattaaaaaa acaccactcg acacggcacc agctcaatca gtcacagtgt aaaaaagggc 32160
caagtgcaga gcgagtatat ataggactaa aaaatgacgt aacggttaaa gtccacaaaa 32220
aacacccaga aaaccgcacg cgaacctacg cccagaaacg aaagccaaaa aacccacaac 32280
ttcctcaaat cgtcacttcc gttttcccac gttacgtaac ttcccatttt aagaaaacta 32340
caattcccaa cacatacaag ttactccgcc ctaaaaccta cgtcacccgc cccgttccca 32400
cgccccgcgc cacgtcacaa actccacccc ctcattatca tattggcttc aatccaaaat 32460
aaggtatatt attgatgatg 32480
<210> 28
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 28
ctcaacaatt gtggatccgt actcc 25
<210> 29
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 29
gtgctcagca gatcttgcga ctgtg 25
<210> 30
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 30
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-32-
ggcgcgttcg gatccactct cttcc 25
<210> 31
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 31
ctacatgcta ggcagatctc gttcggag 28
<210> 32
<211> 1240
<212> DNA
<213> adenovirus
<400> 32
ggatccactc tcttccgcat cgctgtctgc gagggccagc tgttggggtg ~gtactccct 60
ctgaaaagcg ggcatgactt ctgcgctaag attgtcagtt tccaaaaacg ~ggaggattt 120
gatattcacc tggcccgcgg tgatgccttt gagggtggcc gcatccatct ggtcagaaaa 180
gacaatcttt ttgttgtcaa gcttggtggc aaacgacccg tagagggcgt tggacagcaa 240
cttggcgatg gagcgcaggg tttggttttt gtcgcgatcg gcgcgctcct tggccgcgat 300
gtttagctgc acgtattcgc gcgcaacgca ccgccattcg ggaaagacgg tggtgcgctc 360
gtcgggcacc aggtgcacgc gccaaccgcg gttgtgcagg gtgacaaggt caacgctggt 420
ggctacctct ccgcgtaggc gctcgttggt ccagcagagg cggccgccct tgcgcgagca 480
gaatggcggt agggggtcta gctgcgtctc gtccgggggg tctgcgtcca cggtaaagac 540
cccgggcagc aggcgcgcgt cgaagtagtc tatcttgcat ccttgcaagt ctagcgcctg 600
ctgccatgcg cgggcggcaa gcgcgcgctc gtatgggttg agtgggggac cccatggcat 660
ggggtgggtg agcgcggagg cgtacatgcc gcaaatgtcg taaacgtaga ggggctctct 720
gagtattcca agatatgtag ggtagcatct tccaccgcgg atgctggcgc gcacgtaatc 780
gtatagttcg tgcgagggag cgaggaggtc gggaccgagg ttgctacggg cgggctgctc 840
tgctcggaag actatctgcc tgaagatggc atgtgagttg gatgatatgg ttggacgctg 900
gaagacgttg aagctggcgt ctgtgagacc taccgcgtca cgcacgaagg aggcgtagga 960
gtcgcgcagc ttgttgacca gctcggcggt gacctgcacg tctagggcgc agtagtccag 1020
ggtttccttg atgatgtcat acttatcctg tccctttttt ttccacagct cgcggttgag 1080
gacaaactct tcgcggtctt tccagtactc ttggatcgga aacccgtcgg cctccgaacg 1140
agatccgtac tccgccgccg agggacctga gcgagtccgc atcgaccgga tcggaaaacc 1200
tctcgagaaa ggcgtctaac cagtcacagt cgcaagatct 1240
<210> 33
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 33
ggcgcgttcg gatccactct cttcc 25
<210> 34
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
WO 00/42208 CA 02359795 2001-07-12 pCT~, P00/00265
-33-
<223> Description of Artificial Sequence: primer
<900> 34
gggagtagat ctcccaacag 20
<210> 35
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 35
cccttttttt tggatccctc gcgg 24
<210> 36
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 36
ctacatgcta ggcagatctc gttcggag 28
<210> 37
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<900> 37
ctcaacaatt gttggatccg tactcc 26
<210> 38
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<900> 38
gtgctcagca gatcttgcga ctgtg 25
<210> 39
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-34-
<400> 39
ggcgcgttcg gatccactct cttcc 25
<210> 40
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 40
ctacatgcta ggcagatctc gttcggag 28
<210> 41
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 41
cccttttttt tggatccctc gcgg 29
<210> 42
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 42
gtgctcagca gatcttgcga ctgtg 25
<210> 43
<211> 8383
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 43
gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 920
attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-3 5-
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gcttggtacc 900
gagctcggat ccactctctt ccgcatcgct gtctgcgagg gccagctgtt ggggtgagta 960
ctccctctga aaagcgggca tgacttctgc gctaagattg tcagtttcca aaaacgagga 1020
ggatttgata ttcacctggc ccgcggtgat gcctttgagg gtggccgcat ccatctggtc 1080
agaaaagaca atctttttgt tgtcaagctt ggtggcaaac gacccgtaga gggcgttgga 1140
cagcaacttg gcgatggagc gcagggtttg gtttttgtcg cgatcggcgc gctccttggc 1200
cgcgatgttt agctgcacgt attcgcgcgc aacgcaccgc cattcgggaa agacggtggt 1260
gcgctcgtcg ggcaccaggt gcacgcgcca accgcggttg tgcagggtga caaggtcaac 1320
gctggtggct acctctccgc gtaggcgctc gttggtccag cagaggcggc cgcccttgcg 1380
cgagcagaat ggcggtaggg ggtctagctg cgtctcgtcc ggggggtctg cgtccacggt 1440
aaagaccccg ggcagcaggc gcgcgtcgaa gtagtctatc ttgcatcctt gcaagtctag 1500
cgcctgctgc catgcgcggg cggcaagcgc gcgctcgtat gggttgagtg ggggacccca 1560
tggcatgggg tgggtgagcg cggaggcgta catgccgcaa atgtcgtaaa cgtagagggg 1620
ctctctgagt attccaagat atgtagggta gcatcttcca ccgcggatgc tggcgcgcac 1680
gtaatcgtat agttcgtgcg agggagcgag gaggtcggga ccgaggttgc tacgggcggg 1740
ctgctctgct cggaagacta tctgcctgaa gatggcatgt gagttggatg atatggttgg 1800
acgctggaag acgttgaagc tggcgtctgt gagacctacc gcgtcacgca cgaaggaggc 1860
gtaggagtcg cgcagcttgt tgaccagctc ggcggtgacc tgcacgtcta gggcgcagta 1920
gtccagggtt tccttgatga tgtcatactt atcctgtccc ttttttttcc acagctcgcg 1980
gttgaggaca aactcttcgc ggtctttcca gtactcttgg atcggaaacc cgtcggcctc 2040
cgaacgagat ccgtactccg ccgccgaggg acctgagcga gtccgcatcg accggatcgg 2100
aaaacctctc gagaaaggcg tctaaccagt cacagtcgca agatccaaga tgaagcgcgc 2160
aagaccgtct gaagatacct tcaaccccgt gtatccatat gacacggaaa ccggtcctcc 2220
aactgtgcct tttcttactc ctccctttgt atcccccaat gggtttcaag agagtccccc 2280
tggggtactc tctttgcgcc tatccgaacc tctagttacc tccaatggca tgcttgcgct 2340
caaaatgggc aacggcctct ctctggacga ggccggcaac cttacctccc aaaatgtaac 2400
cactgtgagc ccacctctca aaaaaaccaa gtcaaacata aacctggaaa tatctgcacc 2460
cctcacagtt acctcagaag ccctaactgt ggctgccgcc gcacctctaa tggtcgcggg 2520
caacacactc accatgcaat cacaggcccc gctaaccgtg cacgactcca aacttagcat 2580
tgccacccaa ggacccctca cagtgtcaga aggaaagcta gccctgcaaa catcaggccc 2640
cctcaccacc accgatagca gtacccttac tatcactgcc tcaccccctc taactactgc 2700
cactggtagc ttgggcattg acttgaaaga gcccatttat acacaaaatg gaaaactagg 2760
actaaagtac ggggctcctt tgcatgtaac agacgaccta aacactttga ccgtagcaac 2820
tggtccaggt gtgactatta ataatacttc cttgcaaact aaagttactg gagccttggg 2880
ttttgattca caaggcaata tgcaacttaa tgtagcagga ggactaagga ttgattctca 2940
aaacagacgc cttatacttg atgttagtta tccgtttgat gctcaaaacc aactaaatct 3000
aagactagga cagggccctc tttttataaa ctcagcccac aacttggata ttaactacaa 3060
caaaggcctt tacttgttta cagcttcaaa caattccaaa aagcttgagg ttaacctaag 3120
cactgccaag gggttgatgt ttgacgctac agccatagcc attaatgcag gagatgggct 3180
tgaatttggt tcacctaatg caccaaacac aaatcccctc aaaacaaaaa ttggccatgg 3240
cctagaattt gattcaaaca aggctatggt tcctaaacta ggaactggcc ttagttttga 3300
cagcacaggt gccattacag taggaaacaa aaataatgat aagctaactt tgtggaccac 3360
accagctcca tctcctaact gtagactaaa tgcagagaaa gatgctaaac tcactttggt 3420
cttaacaaaa tgtggcagtc aaatacttgc tacagtttca gttttggctg ttaaaggcag 3480
tttggctcca atatctggaa cagttcaaag tgctcatctt attataagat ttgacgaaaa 3540
tggagtgcta ctaaacaatt ccttcctgga cccagaatat tggaacttta gaaatggaga 3600
tcttactgaa ggcacagcct atacaaacgc tgttggattt atgcctaacc tatcagctta 3660
tccaaaatct cacggtaaaa ctgccaaaag taacattgtc agtcaagttt acttaaacgg 3720
agacaaaact aaacctgtaa cactaaccat tacactaaac ggtacacagg aaacaggaga 3780
cacaactcca agtgcatact ctatgtcatt ttcatgggac tggtctggcc acaactacat 3840
taatgaaata tttgccacat cctcttacac tttttcatac attgcccaag aataaaagaa 3900
gcggccgctc gagcatgcat ctagagggcc ctattctata gtgtcaccta aatgctagag 3960
ctcgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt tgcccctccc 4020
ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa taaaatgagg 4080
aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg gtggggcagg 4140_
acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg gtgggctcta 4200
tggcttctga ggcggaaaga accagctggg gctctagggg gtatccccac gcgccctgta 4260
gcggcgcatt aagcgcggcg ggtgtggtgg ttacgcgcag cgtgaccgct acacttgcca 4320
gcgccctagc gcccgctcct ttcgctttct tcccttcctt tctcgccacg ttcgccggct 4380
ttccccgtca agctctaaat cggggcatcc ctttagggtt ccgatttagt gctttacggc 4440
acctcgaccc caaaaaactt gattagggtg atggttcacg tagtgggcca tcgccctgat 4500
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-36-
agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga ctcttgttcc 4560
aaactggaac aacactcaac cctatctcgg tctattcttt tgatttataa gggattttgg 4620
ggatttcggc ctattggtta aaaaatgagc tgatttaaca aaaatttaac gcgaattaat 4680
tctgtggaat gtgtgtcagt tagggtgtgg aaagtcccca ggctccccag gcaggcagaa 4740
gtatgcaaag catgcatctc aattagtcag caaccaggtg tggaaagtcc ccaggctccc 4800
cagcaggcag aagtatgcaa agcatgcatc tcaattagtc agcaaccata gtcccgcccc 9860
taactccgcc catcccgccc ctaactccgc ccagttccgc ccattctccg ccccatggct 4920
gactaatttt ttttatttat gcagaggccg aggccgcctc tgcctctgag ctattccaga 4980
agtagtgagg aggctttttt ggaggcctag gcttttgcaa aaagctcccg ggagcttgta 5040
tatccatttt cggatctgat caagagacag gatgaggatc gtttcgcatg attgaacaag 5100
atggattgca cgcaggttct ccggccgctt gggtggagag gctattcggc tatgactggg 5160
cacaacagac aatcggctgc tctgatgccg ccgtgttccg gctgtcagcg caggggcgcc 5220
cggttctttt tgtcaagacc gacctgtccg gtgccctgaa tgaactgcag gacgaggcag 5280
cgcggctatc gtggctggcc acgacgggcg ttccttgcgc agctgtgctc gacgttgtca 5340
ctgaagcggg aagggactgg ctgctattgg gcgaagtgcc ggggcaggat ctcctgtcat 5400
ctcaccttgc tcctgccgag aaagtatcca tcatggctga tgcaatgcgg cggctgcata 5460
cgcttgatcc ggctacctgc ccattcgacc accaagcgaa acatcgcatc gagcgagcac 5520
gtactcggat ggaagccggt cttgtcgatc aggatgatct ggacgaagag catcaggggc 5580
tcgcgccagc cgaactgttc gccaggctca aggcgcgcat gcccgacggc gaggatctcg 5640
tcgtgaccca tggcgatgcc tgcttgccga atatcatggt ggaaaatggc cgcttttctg 5700
gattcatcga ctgtggccgg ctgggtgtgg cggaccgcta tcaggacata gcgttggcta 5760
cccgtgatat tgctgaagag cttggcggcg aatgggctga ccgcttcctc gtgctttacg 5820
gtatcgccgc tcccgattcg cagcgcatcg ccttctatcg ccttcttgac gagttcttct 5880
gagcgggact ctggggttcg aaatgaccga ccaagcgacg cccaacctgc catcacgaga 5940
tttcgattcc accgccgcct tctatgaaag gttgggcttc ggaatcgttt tccgggacgc 6000
cggctggatg atcctccagc gcggggatct catgctggag ttcttcgccc accccaactt 6060
gtttattgca gcttataatg gttacaaata aagcaatagc atcacaaatt tcacaaataa 6120
agcatttttt tcactgcatt ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca 6180
tgtctgtata ccgtcgacct ctagctagag cttggcgtaa tcatggtcat agctgtttcc 6240
tgtgtgaaat tgttatccgc tcacaattcc acacaacata cgagccggaa gcataaagtg 6300
taaagcctgg ggtgcctaat gagtgagcta actcacatta attgcgttgc gctcactgcc 6360
cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc aacgcgcggg 6420
gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact cgctgcgctc 6480
ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac ggttatccac 6540
agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa aggccaggaa 6600
ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg acgagcatca 6660
caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa gataccaggc 6720
gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc ttaccggata 6780
cctgtccgcc tttctccctt cgggaagcgt ggcgctttct caatgctcac gctgtaggta 6840
tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac cccccgttca 6900
gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg taagacacga 6960
cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt atgtaggcgg 7020
tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga cagtatttgg 7080
tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct cttgatccgg 7140
caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga ttacgcgcag 7200
aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg ctcagtggaa 7260
cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct tcacctagat 7320
ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt aaacttggtc 7380
tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc tatttcgttc 7440
atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg gcttaccatc 7500
tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag atttatcagc 7560
aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt tatccgcctc 7620
catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag ttaatagttt 7680
gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt ttggtatggc 7740
ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca tgttgtgcaa 7800
aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg ccgcagtgtt 7860_
atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat ccgtaagatg 7920
cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta tgcggcgacc 7980
gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca gaactttaaa 8040
agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct taccgctgtt 8100
gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat cttttacttt 8160
caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa agggaataag 8220
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-3 7-
ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt gaagcattta 8280
tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa ataaacaaat 8340
aggggttccg cgcacatttc cccgaaaagt gccacctgac gtc 8383
<210> 44
<211> 7960
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 44
gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 980
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gtttaaactt aagcttggta ccgagctcgg atccactctc ttccgcatcg ctgtctgcga 960
gggccagctg ttggggtgag tactccctct gaaaagcggg catgacttct gcgctaagat 1020
tgtcagtttc caaaaacgag gaggatttga tattcacctg gcccgcggtg atgcctttga 1080
gggtggccgc atccatctgg tcagaaaaga caatcttttt gttgtcaagc ttggtggcaa 1140
acgacccgta gagggcgttg gacagcaact tggcgatgga gcgcagggtt tggtttttgt 1200
cgcgatcggc gcgctccttg gccgcgatgt ttagctgcac gtattcgcgc gcaacgcacc 1260
gccattcggg aaagacggtg gtgcgctcgt cgggcaccag gtgcacgcgc caaccgcggt 1320
tgtgcagggt gacaaggtca acgctggtgg ctacctctcc gcgtaggcgc tcgttggtcc 1380
agcagaggcg gccgcccttg cgcgagcaga atggcggtag ggggtctagc tgcgtctcgt 1440
ccggggggtc tgcgtccacg gtaaagaccc cgggcagcag gcgcgcgtcg aagtagtcta 1500
tcttgcatcc ttgcaagtct agcgcctgct gccatgcgcg ggcggcaagc gcgcgctcgt 1560
atgggttgag tgggggaccc catggcatgg ggtgggtgag cgcggaggcg tacatgccgc 1620
aaatgtcgta aacgtagagg ggctctctga gtattccaag atatgtaggg tagcatcttc 1680
caccgcggat gctggcgcgc acgtaatcgt atagttcgtg cgagggagcg aggaggtcgg 1740
gaccgaggtt gctacgggcg ggctgctctg ctcggaagac tatctgcctg aagatggcat 1800
gtgagttgga tgatatggtt ggacgctgga agacgttgaa gctggcgtct gtgagaccta 1860
ccgcgtcacg cacgaaggag gcgtaggagt cgcgcagctt gttgaccagc tcggcggtga 1920
cctgcacgtc tagggcgcag tagtccaggg tttccttgat gatgtcatac ttatcctgtc 1980
cctttttttt ccacagctcg cggttgagga caaactcttc gcggtctttc cagtactctt 2040
ggatcggaaa cccgtcggcc tccgaacgag atccgtactc cgccgccgag ggacctgagc 2100
gagtccgcat cgaccggatc ggaaaacctc tcgagaaagg cgtctaacca gtcacagtcg 2160
caagatccaa gatgaagcgc gcaagaccgt ctgaagatac cttcaacccc gtgtatccat 2220
atgacacgga aaccggtcct ccaactgtgc cttttcttac tcctcccttt gtatccccca 2280
atgggtttca agagagtccc cctggggtac tctctttgcg cctatccgaa cctctagtta 2340
cctccaatgg catgcttgcg ctcaaaatgg gcaacggcct ctctctggac gaggccggca 2400
accttacctc ccaaaatgta accactgtga gcccacctct caaaaaaacc aagtcaaaca 2460
taaacctgga aatatctgca cccctcacag ttacctcaga agccctaact gtggctgccg 2520_
ccgcacctct aatggtcgcg ggcaacacac tcaccatgca atcacaggcc ccgctaaccg 2580
tgcacgactc caaacttagc attgccaccc aaggacccct cacagtgtca gaaggaaagc 2640
tagccctgca aacatcaggc cccctcacca ccaccgatag cagtaccctt actatcactg 2700
cctcaccccc tctaactact gccactggta gcttgggcat tgacttgaaa gagcccattt 2760
atacacaaaa tggaaaacta ggactaaagt acggggctcc tttgcatgta acagacgacc 2820
taaacacttt gaccgtagca actggtccag gtgtgactat taataatact tccttgcaaa 2880
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-3 8-
ctaaagttac tggagccttg ggttttgatt cacaaggcaa tatgcaactt aatgtagcag 2940
gaggactaag gattgattct caaaacagac gccttatact tgatgttagt tatccgtttg 3000
atgctcaaaa ccaactaaat ctaagactag gacagggccc tctttttata aactcagccc 3060
acaacttgga tattaactac aacaaaggcc tttacttgtt tacagcttca aacaattcca 3120
aaaagcttga ggttaaccta agcactgcca aggggttgat gtttgacgct acagccatag 3180
ccattaatgc aggagatggg cttgaatttg gttcacctaa tgcaccaaac acaaatcccc 3240
tcaaaacaaa aattggccat ggcctagaat ttgattcaaa caaggctatg gttcctaaac 3300
taggaactgg ccttagtttt gacagcacag gtgccattac agtaggaaac aaaaataatg 3360
ataagctaac tttgtggacc acaccagctc catctcctaa ctgtagacta aatgcagaga 3420
aagatgctaa actcactttg gtcttaacaa aatgtggcag tcaaatactt gctacagttt 3480
cagttttggc tgttaaaggc agtttggctc caatatctgg aacagttcaa agtgctcatc 3540
ttattataag atttgacgaa aatggagtgc tactaaacaa ttccttcctg gacccagaat 3600
attggaactt tagaaatgga gatcttactg aaggcacagc ctatacaaac gctgttggat 3660
ttatgcctaa cctatcagct tatccaaaat ctcacggtaa aactgccaaa agtaacattg 3720
tcagtcaagt ttacttaaac ggagacaaaa ctaaacctgt aacactaacc attacactaa 3780
acggtacaca ggaaacagga gacacaactc caagtgcata ctctatgtca ttttcatggg 3840
actggtctgg ccacaactac attaatgaaa tatttgccac atcctcttac actttttcat 3900
acattgccca agaataaaag aagcggccgc tcgagtctag agggcccgtt taaacccgct 3960
gatcagcctc gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc 4020
cttccttgac cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg 4080
catcgcattg tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca 4140
agggggagga ttgggaagac aatagcaggc atgctgggga tgcggtgggc,tctatggctt 4200
ctgaggcgga aagaaccagc tggggctcta gggggtatcc ccacgcgccc tgtagcggcg 4260
cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc 4320
tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc 4380
gtcaagctct aaatcggggc atccctttag ggttccgatt tagtgcttta cggcacctcg 4440
accccaaaaa acttgattag ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg 4500
tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 4560
gaacaacact caaccctatc tcggtctatt cttttgattt ataagggatt ttggggattt 4620
cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat taattctgtg 4680
gaatgtgtgt cagttagggt gtggaaagtc cccaggctcc ccaggcaggc agaagtatgc 4740
aaagcatgca tctcaattag tcagcaacca ggtgtggaaa gtccccaggc tccccagcag 4800
gcagaagtat gcaaagcatg catctcaatt agtcagcaac catagtcccg cccctaactc 9860
cgcccatccc gcccctaact ccgcccagtt ccgcccattc tccgccccat ggctgactaa 4920
ttttttttat ttatgcagag gccgaggccg cctctgcctc tgagctattc cagaagtagt 4980
gaggaggctt ttttggaggc ctaggctttt gcaaaaagct cccgggagct tgtatatcca 5040
ttttcggatc tgatcagcac gtgttgacaa ttaatcatcg gcatagtata tcggcatagt 5100
ataatacgac aaggtgagga actaaaccat ggccaagttg accagtgccg ttccggtgct 5160
caccgcgcgc gacgtcgccg gagcggtcga gttctggacc gaccggctcg ggttctcccg 5220
ggacttcgtg gaggacgact tcgccggtgt ggtccgggac gacgtgaccc tgttcatcag 5280
cgcggtccag gaccaggtgg tgccggacaa caccctggcc tgggtgtggg tgcgcggcct 5340
ggacgagctg tacgccgagt ggtcggaggt cgtgtccacg aacttccggg acgcctccgg 5400
gccggccatg accgagatcg gcgagcagcc gtgggggcgg gagttcgccc tgcgcgaccc 5460
ggccggcaac tgcgtgcact tcgtggccga ggagcaggac tgacacgtgc tacgagattt 5520
cgattccacc gccgccttct atgaaaggtt gggcttcgga atcgttttcc gggacgccgg 5580
ctggatgatc ctccagcgcg gggatctcat gctggagttc ttcgcccacc ccaacttgtt 5640
tattgcagct tataatggtt acaaataaag caatagcatc acaaatttca caaataaagc 5700
atttttttca ctgcattcta gttgtggttt gtccaaactc atcaatgtat cttatcatgt 5760
ctgtataccg tcgacctcta gctagagctt ggcgtaatca tggtcatagc tgtttcctgt 5820
gtgaaattgt tatccgctca caattccaca caacatacga gccggaagca taaagtgtaa 5880
agcctggggt gcctaatgag tgagctaact cacattaatt gcgttgcgct cactgcccgc 5940
tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac gcgcggggag 6000
aggcggtttg cgtattgggc gctcttccgc ttcctcgctc actgactcgc tgcgctcggt 6060
cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg gtaatacggt tatccacaga 6120
atcaggggat aacgcaggaa agaacatgtg agcaaaaggc cagcaaaagg ccaggaaccg 6180
taaaaaggcc gcgttgctgg cgtttttcca taggctccgc ccccctgacg agcatcacaa 6240_
aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga ctataaagat accaggcgtt 6300
tccccctgga agctccctcg tgcgctctcc tgttccgacc ctgccgctta ccggatacct 6360
gtccgccttt ctcccttcgg gaagcgtggc gctttctcaa tgctcacgct gtaggtatct 6420
cagttcggtg taggtcgttc gctccaagct gggctgtgtg cacgaacccc ccgttcagcc 6480
cgaccgctgc gccttatccg gtaactatcg tcttgagtcc aacccggtaa gacacgactt 6540
atcgccactg gcagcagcca ctggtaacag gattagcaga gcgaggtatg taggcggtgc 6600
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-39-
tacagagttc ttgaagtggt ggcctaacta cggctacact agaaggacag tatttggtat 6660
ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt ggtagctctt gatccggcaa 6720
acaaaccacc gctggtagcg gtggtttttt tgtttgcaag cagcagatta cgcgcagaaa 6780
aaaaggatct caagaagatc ctttgatctt ttctacgggg tctgacgctc agtggaacga 6840
aaactcacgt taagggattt tggtcatgag attatcaaaa aggatcttca cctagatcct 6900
tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata tatgagtaaa cttggtctga 6960
cagttaccaa tgcttaatca gtgaggcacc tatctcagcg atctgtctat ttcgttcatc 7020
catagttgcc tgactccccg tcgtgtagat aactacgata cgggagggct taccatctgg 7080
ccccagtgct gcaatgatac cgcgagaccc acgctcaccg gctccagatt tatcagcaat 7140
aaaccagcca gccggaaggg ccgagcgcag aagtggtcct gcaactttat ccgcctccat 7200
ccagtctatt aattgttgcc gggaagctag agtaagtagt tcgccagtta atagtttgcg 7260
caacgttgtt gccattgcta caggcatcgt ggtgtcacgc tcgtcgtttg gtatggcttc 7320
attcagctcc ggttcccaac gatcaaggcg agttacatga tcccccatgt tgtgcaaaaa 7380
agcggttagc tccttcggtc ctccgatcgt tgtcagaagt aagttggccg cagtgttatc 7440
actcatggtt atggcagcac tgcataattc tcttactgtc atgccatccg taagatgctt 7500
ttctgtgact ggtgagtact caaccaagtc attctgagaa tagtgtatgc ggcgaccgag 7560
ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca catagcagaa ctttaaaagt 7620
gctcatcatt ggaaaacgtt cttcggggcg aaaactctca aggatcttac cgctgttgag 7680
atccagttcg atgtaaccca ctcgtgcacc caactgatct tcagcatctt ttactttcac 7740
cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc gcaaaaaagg gaataagggc 7800
gacacggaaa tgttgaatac tcatactctt cctttttcaa tattattgaa gcatttatca 7860
gggttattgt ctcatgagcg gatacatatt tgaatgtatt tagaaaaata aacaaatagg 7920
ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc ~ 7960
<210> 45
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 45
atgggatcca agatgaagcg cgcaagaccg 30
<210> 46
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<900> 46
cactatagcg gccgcattct cagtcatctt 30
<210> 47
<211> 7989
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<900> 47
gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-40-
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgcccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
ctgcttactg gcttatcgaa attaatacga ctcactatag ggagacccaa gctggctagc 900
gtttaaactt aagcttggta ccgagctcgg atccactctc ttccgcatcg ctgtctgcga 960
gggccagctg ttggggtgag tactccctct gaaaagcggg catgacttct gcgctaagat 1020
tgtcagtttc caaaaacgag gaggatttga tattcacctg gcccgcggtg atgcctttga 1080
gggtggccgc atccatctgg tcagaaaaga caatcttttt gttgtcaagc ttggtggcaa 1140
acgacccgta gagggcgttg gacagcaact tggcgatgga gcgcagggtt tggtttttgt 1200
cgcgatcggc gcgctccttg gccgcgatgt ttagctgcac gtattcgcgc gcaacgcacc 1260
gccattcggg aaagacggtg gtgcgctcgt cgggcaccag gtgcacgcgc caaccgcggt 1320
tgtgcagggt gacaaggtca acgctggtgg ctacctctcc gcgtaggcgc tcgttggtcc 1380
agcagaggcg gccgcccttg cgcgagcaga atggcggtag ggggtctagc tgcgtctcgt 1440
ccggggggtc tgcgtccacg gtaaagaccc cgggcagcag gcgcgcgtcg aagtagtcta 1500
tcttgcatcc ttgcaagtct agcgcctgct gccatgcgcg ggcggcaagc gcgcgctcgt 1560
atgggttgag tgggggaccc catggcatgg ggtgggtgag cgcggaggcg t~acatgccgc 1620
aaatgtcgta aacgtagagg ggctctctga gtattccaag atatgtaggg tagcatcttc 1680
caccgcggat gctggcgcgc acgtaatcgt atagttcgtg cgagggagcg aggaggtcgg 1740
gaccgaggtt gctacgggcg ggctgctctg ctcggaagac tatctgcctg aagatggcat 1800
gtgagttgga tgatatggtt ggacgctgga agacgttgaa gctggcgtct gtgagaccta 1860
ccgcgtcacg cacgaaggag gcgtaggagt cgcgcagctt gttgaccagc tcggcggtga 1920
cctgcacgtc tagggcgcag tagtccaggg tttccttgat gatgtcatac ttatcctgtc 1980
cctttttttt ccacagctcg cggttgagga caaactcttc gcggtctttc cagtactctt 2040
ggatcggaaa cccgtcggcc tccgaacgag atccgtactc cgccgccgag ggacctgagc 2100
gagtccgcat cgaccggatc ggaaaacctc tcgagaaagg cgtctaacca gtcacagtcg 2160
caagatccaa gatgaagcgc gcaagaccgt ctgaagatac cttcaacccc gtgtatccat 2220
atgacacgga aaccggtcct ccaactgtgc cttttcttac tcctcccttt gtatccccca 2280
atgggtttca agagagtccc cctggggtac tctctttgcg cctatccgaa cctctagtta 2340
cctccaatgg catgcttgcg ctcaaaatgg gcaacggcct ctctctggac gaggccggca 2400
accttacctc ccaaaatgta accactgtga gcccacctct caaaaaaacc aagtcaaaca 2460
taaacctgga aatatctgca cccctcacag ttacctcaga agccctaact gtggctgccg 2520
ccgcacctct aatggtcgcg ggcaacacac tcaccatgca atcacaggcc ccgctaaccg 2580
tgcacgactc caaacttagc attgccaccc aaggacccct cacagtgtca gaaggaaagc 2640
tagccctgca aacatcaggc cccctcacca ccaccgatag cagtaccctt actatcactg 2700
cctcaccccc tctaactact gccactggta gcttgggcat tgacttgaaa gagcccattt 2760
atacacaaaa tggaaaacta ggactaaagt acggggctcc tttgcatgta acagacgacc 2820
taaacacttt gaccgtagca actggtccag gtgtgactat taataatact tccttgcaaa 2880
ctaaagttac tggagccttg ggttttgatt cacaaggcaa tatgcaactt aatgtagcag 2940
gaggactaag gattgattct caaaacagac gccttatact tgatgttagt tatccgtttg 3000
atgctcaaaa ccaactaaat ctaagactag gacagggccc tctttttata aactcagccc 3060
acaacttgga tattaactac aacaaaggcc tttacttgtt tacagcttca aacaattcca 3120
aaaagcttga ggttaaccta agcactgcca aggggttgat gtttgacgct acagccatag~3180
ccattaatgc aggagatggg cttgaatttg gttcacctaa tgcaccaaac acaaatcccc 3240
tcaaaacaaa aattggccat ggcctagaat ttgattcaaa caaggctatg gttcctaaac 3300
taggaactgg ccttagtttt gacagcacag gtgccattac agtaggaaac aaaaataatg 3360
ataagctaac tttgtggacc ggtccaaaac cagaagccaa ctgcataatt gaatacggga 3420
aacaaaaccc agatagcaaa ctaactttaa tccttgtaaa aaatggagga attgttaatg 3480
gatatgtaac gctaatggga gcctcagact acgttaacac cttatttaaa aacaaaaatg 3540
tctccattaa tgtagaacta tactttgatg ccactggtca tatattacca gactcatctt 3600
ctcttaaaac agatctagaa ctaaaataca agcaaaccgc tgactttagt gcaagaggtt 3660
ttatgccaag tactacagcg tatccatttg tccttcctaa tgcgggaaca cataatgaaa 3720
attatatttt tggtcaatgc tactacaaag caagcgatgg tgcccttttt ccgttggaag 3780
ttactgttat gcttaataaa cgcctgccag atagtcgcac atcctatgtt atgacttttt 3840
tatggtcctt gaatgctggt ctagctccag aaactactca ggcaaccctc ataacctccc 3900
catttacctt ttcctatatt agagaagatg actgattttt aagaagcggc cgctcgagtc 3960
CA 02359795 2001-07-12 pCT~, p00/00265
WO 00/42208
-41-
tagagggccc gtttaaaccc gctgatcagc ctcgactgtg ccttctagtt gccagccatc 4020
tgttgtttgc ccctcccccg tgccttcctt gaccctggaa ggtgccactc ccactgtcct 4080
ttcctaataa aatgaggaaa ttgcatcgca ttgtctgagt aggtgtcatt ctattctggg 4140
gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca ggcatgctgg 4200
ggatgcggtg ggctctatgg cttctgaggc ggaaagaacc snccntagct ggggctctag 4260
ggggtatccc cacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 4320
cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 4380
ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcggggca tccctttagg 4440
gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 4500
acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 4560
ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 4620
ttttgattta taagggattt tggggatttc ggcctattgg ttaaaaaatg agctgattta 4680
acaaaaattt aacgcgaatt aattctgtgg aatgtgtgtc agttagggtg tggaaagtcc 4740
ccaggctccc caggcaggca gaagtatgca aagcatgcat ctcaattagt cagcaaccag 4800
gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc atctcaatta 4860
gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc cgcccagttc 4920
cgcccattct ccgccccatg gctgactaat tttttttatt tatgcagagg ccgaggccgc 4980
ctctgcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc taggcttttg 5040
caaaaagctc ccgggagctt gtatatccat tttcggatct gatcagcacg tgttgacaat 5100
taatcatcgg catagtatat cggcatagta taatacgaca aggtgaggaa ctaaaccatg 5160
gccaagttga ccagtgccgt tccggtgctc accgcgcgcg acgtcgccgg agcggtcgag 5220
ttctggaccg accggctcgg gttctcccgg gacttcgtgg aggacgactt Cgccggtgtg 5280
gtccgggacg acgtgaccct gttcatcagc gcggtccagg accaggtggt gccggacaac 5340
accctggcct gggtgtgggt gcgcggcctg gacgagctgt acgccgagtg gtcggaggtc 5400
gtgtccacga acttccggga cgcctccggg ccggccatga ccgagatcgg cgagcagccg 5460
tgggggcggg agttcgccct gcgcgacccg gccggcaact gcgtgcactt cgtggccgag 5520
gagcaggact gacacgtgct acgagatttc gattccaccg ccgccttcta tgaaaggttg 5580
ggcttcggaa tcgttttccg ggacgccggc tggatgatcc tccagcgcgg ggatctcatg 5640
ctggagttct tcgcccaccc caacttgttt attgcagctt ataatggtta caaataaagc 5700
aatagcatca caaatttcac aaataaagca tttttttcac tgcattctag ttgtggtttg 5760
tccaaactca tcaatgtatc ttatcatgtc tgtataccgt cgacctctag ctagagcttg 5820
gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac 5880
aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc 5940
acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 6000
cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct 6060
tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac 6120
tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga 6180
gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat 6240
aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac 6300
ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct 6360
gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg 6420
ctttctcaat gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg 6480
ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt 6540
cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg 6600
attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac 6660
ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga 6720
aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt 6780
gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt 6840
tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga 6900
ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc 6960
taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct 7020
atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata 7080
actacgatac gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca 7140
cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga 7200
agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga 7260
gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg 7320
gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga 7380
gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt 7440
gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct 7500
cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca 7560
ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat 7620
accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 7680
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-42-
aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc 7740
aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg 7800
caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc 7860
ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt 7920
gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca 7980
cctgacgtc 7989
<210> 48
<211> 7607
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 48
tctagaagat ccgctgtaca ggatgttcta gctactttat tagatccgct gtacaggatg 60
ttctagctac tttattagat ccgctgtaca ggatgttcta gctactttat tagatccgct 120
gtacaggatg ttctagctac tttattagat ccgtgtacag gatgttctag ctactttatt 180
agatcgatct cctggccgtt cggggtcaaa aaccaggttt ggctataaaa gggggtgggg 240
gcgcgttcgt cctcactctc ttccgcatcg ctgtctgcga gggccaggat ~gatcctgag 300
aacttcaggg tgagtttggg gacccttgat tgttctttct ttttcgctat ~gtaaaattc 360
atgttatatg gagggggcaa agttttcagg gtgttgttta gaatgggaag atgtcccttg 420
tatcaccatg gaccctcatg ataattttgt ttctttcact ttctactctg ttgacaacca 480
ttgtctcctc ttattttctt ttcattttct gtaacttttt cgttaaactt tagcttgcat 540
ttgtaacgaa tttttaaatt cacttttgtt tatttgtcag attgtaagta ctttctctaa 600
tcactttttt ttcaaggcaa tcagggtata ttatattgta cttcagcaca gttttagaga 660
acaattgtta taattaaatg ataaggtaga atatttctgc atataaattc tggctggcgt 720
ggaaatattc ttattggtag aaacaactac atcctggtca tcatcctgcc tttctcttta 780
tggttacaat gatatacact gtttgagatg aggataaaat actctgagtc caaaccgggc 840
ccctctgcta accatgttca tgccttcttc tttttcctac agctcctggg caacgtgctg 900
gttattgtgc tgtctcatca ttttggcaaa gaattagatc taagcttctg cagctcgagg 960
actcggtcga ctgaaaatga gacatattat ctgccacgga ggtgttatta ccgaagaaat 1020
ggccgccagt cttttggacc agctgatcga agaggtactg gctgataatc ttccacctcc 1080
tagccatttt gaaccaccta cccttcacga actgtatgat ttagacgtga cggcccccga 1140
agatcccaac gaggaggcgg tttcgcagat ttttcccgac tctgtaatgt tggcggtgca 1200
ggaagggatt gacttactca cttttccgcc ggcgcccggt tctccggagc cgcctcacct 1260
ttcccggcag cccgagcagc cggagcagag agccttgggt ccggtttcta tgccaaacct 1320
tgtaccggag gtgatcgatc ttacctgcca cgaggctggc tttccaccca gtgacgacga 1380
ggatgaagag ggtgaggagt ttgtgttaga ttatgtggag caccccgggc acggttgcag 1440
gtcttgtcat tatcaccgga ggaatacggg ggacccagat attatgtgtt cgctttgcta 1500
tatgaggacc tgtggcatgt ttgtctacag taagtgaaaa ttatgggcag tgggtgatag 1560
agtggtgggt ttggtgtggt aatttttttt ttaattttta cagttttgtg gtttaaagaa 1620
ttttgtattg tgattttttt aaaaggtcct gtgtctgaac ctgagcctga gcccgagcca 1680
gaaccggagc ctgcaagacc tacccgccgt cctaaaatgg cgcctgctat cctgagacgc 1740
ccgacatcac ctgtgtctag agaatgcaat agtagtacgg atagctgtga ctccggtcct 1800
tctaacacac ctcctgagat acacccggtg gtcccgctgt gccccattaa accagttgcc 1860
gtgagagttg gtgggcgtcg ccaggctgtg gaatgtatcg aggacttgct taacgagcct 1920
gggcaacctt tggacttgag ctgtaaacgc cccaggccat aaggtgtaaa cctgtgattg 1980
cgtgtgtggt taacgccttt gtttgctgaa tgagttgatg taagtttaat aaagggtgag 2040
ataatgttta acttgcatgg cgtgttaaat ggggcggggc ttaaagggta tataatgcgc 2100
cgtgggctaa tcttggttac atctgacctc atggaggctt gggagtgttt ggaagatttt 2160
tctgctgtgc gtaacttgct ggaacagagc tctaacagta cctcttggtt ttggaggttt 2220
ctgtggggct catcccaggc aaagttagtc tgcagaatta aggaggatta caagtgggaa 2280
tttgaagagc ttttgaaatc ctgtggtgag ctgtttgatt ctttgaatct gggtcaccag 2340
gcgcttttcc aagagaaggt catcaagact ttggattttt ccacaccggg gcgcgctgcg 2400
gctgctgttg cttttttgag ttttataaag gataaatgga gcgaagaaac ccatctgagc 2460
ggggggtacc tgctggattt tctggccatg catctgtgga gagcggttgt gagacacaag 2520
aatcgcctgc tactgttgtc ttccgtccgc ccggcgataa taccgacgga ggagcagcag 2580
cagcagcagg aggaagccag gcggcggcgg caggagcaga gcccatggaa cccgagagcc 2640
ggcctggacc ctcgggaatg aatgttgtac aggtggctga actgtatcca gaactgagac 2700
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-43-
gcattttgac aattacagag gatgggcagg ggctaaaggg ggtaaagagg gagcgggggg 2760
cttgtgaggc tacagaggag gctaggaatc tagcttttag cttaatgacc agacaccgtc 2820
ctgagtgtat tacttttcaa cagatcaagg ataattgcgc taatgagctt gatctgctgg 2880
cgcagaagta ttccatagag cagctgacca cttactggct gcagccaggg gatgattttg 2940
aggaggctat tagggtatat gcaaaggtgg cacttaggcc agattgcaag tacaagatca 3000
gcaaacttgt aaatatcagg aattgttgct acatttctgg gaacggggcc gaggtggaga 3060
tagatacgga ggatagggtg gcctttagat gtagcatgat aaatatgtgg ccgggggtgc 3120
ttggcatgga cggggtggtt attatgaatg taaggtttac tggccccaat tttagcggta 3180
cggttttcct ggccaatacc aaccttatcc tacacggtgt aagcttctat gggtttaaca 3240
atacctgtgt ggaagcctgg accgatgtaa gggttcgggg ctgtgccttt tactgctgct 3300
ggaagggggt ggtgtgtcgc cccaaaagca gggcttcaat taagaaatgc ctctttgaaa 3360
ggtgtacctt gggtatcctg tctgagggta actccagggt gcgccacaat gtggcctccg 3420
actgtggttg cttcatgcta gtgaaaagcg tggctgtgat taagcataac atggtatgtg 3480
gcaactgcga ggacagggcc tctcagatgc tgacctgctc ggacggcaac tgtcacctgc 3540
tgaagaccat tcacgtagcc agccactctc gcaaggcctg gccagtgttt gagcataaca 3600
tactgacccg ctgttccttg catttgggta acaggagggg ggtgttccta ccttaccaat 3660
gcaatttgag tca.cactaag atattgcttg agcccgagag catgtccaag gtgaacctga.3720
acggggtgtt tgacatgacc atgaagatct ggaaggtgct gaggtacgat gagacccgca 3780
ccaggtgcag accctgcgag tgtggcggta aacatattag gaaccagcct gtgat.gctgg 3840
atgtgaccga ggagctgagg cccgatcact tggtgctggc ctgcacccgc gctgagtttg 3900
gctctagcga tgaagataca gattgaggta ctgaaatgtg tgggcgtggc ttaagggtgg 3960
gaaagaatat ataaggtggg ggtcttatgt agttttgtat ctgttttgca c~cagccgccg 9020
ccgccatgag caccaactcg tttgatggaa gcattgtgag ctcatatttg acaacgcgca 4080
tgcccccatg ggccggggtg cgtcagaatg tgatgggctc cagcattgat ggtcgccccg 4140
tcctgcccgc aaactctact accttgacct acgagaccgt gtctggaacg ccgttggaga 4200
ctgcagcctc cgccgccgct tcagccgctg cagccaccgc ccgcgggatt gtgactgact 4260
ttgctttcct gagcccgctt gcaagcagtg cagcttcccg ttcatccgcc cgcgatgaca 4320
agttgacggc tcttttggca caattggatt ctttgacccg ggaacttaat gtcgtttctc 4380
agcagctgtt ggatctgcgc cagcaggttt ctgccctgaa ggcttcctcc cctcccaatg 4440
cggtttaaaa cataaataaa aaaccagact ctgtttggat ttggatcaag caagtgtctt 4500
gctgtctcag ctgactgctt aagtcgcaag ccgaattgga tccaattcgg atcgatctta 4560
ttaaagcaga acttgtttat tgcagcttat aatggttaca aataaagcaa tagcatcaca 4620
aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc caaactcatc 4680
aatgtatctt atcatgtctg gtcgactcta gactcttccg cttcctcgct cactgactcg 4740
ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg 4800
ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag 4860
gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac 4920
gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga 4980
taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt 5040
accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc 5100
tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 5160
cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta 5220
agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat 5280
gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca 5340
gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct 5400
tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt 5460
acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct 5520
cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc 5580
acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa 5640
acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta 5700
tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc 5760
ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat 5820
ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta 5880
tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt 5940
aatagtttgc gcaacgttgt tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt 6000
ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg atcccccatg 6060
ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc 6120
gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc 6180
gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga atagtgtatg 6240
cggcgaccga gttgctcttg cccggcgtca atacgggata ataccgcgcc acatagcaga 6300
actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc aaggatctta 6360
ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc ttcagcatct 6420
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-44-
tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag 6480
ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca atattattga 6540
agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat 6600
aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgacgt ctaagaaacc 6660
attattatca tgacattaac ctataaaaat aggcgtatca cgaggcccct ttcgtctcgc 6720
gcgtttcggt gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc 6780
ttgtctgtaa gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg 6840
cgggtgtcgg ggctggctta actatgcggc atcagagcag attgtactga gagtgcacca 6900
tatgcggtgt gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggaaattgta 6960
agcgttaata ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac 7020
caataggccg aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg 7080
agtgttgttc cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa 7140
gggcgaaaaa ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt 7200
tttttggggt cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt 7260
agagcttgac~ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga 7320
gcgggcgcta gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc 7380
gcgcttaatg cgccgctaca gggcgcgtcc cattcgccat tcaggctgcg caactgttgg 7440
gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc tggcgaaagg gggatgtgct 7500
gcaaggcgat taagttgggt aacgccaggg ttttcccagt cacgacgttg taaaacgacg 7560
gccagtgaat tgtaatacga ctcactatag ggcgaattaa ttcgggg 7607
<210> 49
<211> 11600
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 49
gaattccgca ttgcagagat attgtattta agtgcctagc tcgatacaat aaacgccatt 60
tgaccattca ccacattggt gtgcacctcc aagcttgggc agaaatggtt gaactcccga 120
gagtgtccta cacctagggg agaagcagcc aaggggttgt ttcccaccaa ggacgacccg 180
tctgcgcaca aacggatgag cccatcagac aaagacatat tcattctctg ctgcaaactt 240
ggcatagctc tgctttgcct ggggctattg ggggaagttg cggttcgtgc tcgcagggct 300
ctcacccttg actcttttaa tagctcttct gtgcaagatt acaatctaaa caattcggag 360
aactcgacct tcctcctgag gcaaggacca cagccaactt cctcttacaa gccgcatcga 420
ttttgtcctt cagaaataga aataagaatg cttgctaaaa attatatttt taccaataag 480
accaatccaa taggtagatt attagttact atgttaagaa atgaatcatt atcttttagt 540
actattttta ctcaaattca gaagttagaa atgggaatag aaaatagaaa gagacgctca 600
acctcaattg aagaacaggt gcaaggacta ttgaccacag gcctagaagt aaaaaaggga 660
aaaaagagtg tttttgtcaa aataggagac aggtggtggc aaccagggac ttatagggga 720
ccttacatct acagaccaac agatgccccc ttaccatata caggaagata tgacttaaat 780
tgggataggt gggttacagt caatggctat aaagtgttat atagatccct cccttttcgt 840
gaaagactcg ccagagctag acctccttgg tgtatgttgt ctcaagaaga aaaagacgac 900
atgaaacaac aggtacatga ttatatttat ctaggaacag gaatgcactt ttggggaaag 960
attttccata ccaaggaggg gacagtggct ggactaatag aacattattc tgcaaaaact 1020
catggcatga gttattatga atagccttta ttggcccaac cttgcggttc ccagggctta 1080
agtaagtttt tggttacaaa ctgttcttaa aacgaggatg tgagacaagt ggtttcctga 1140
cttggtttgg tatcaaaggt tctgatctga gctctgagtg ttctattttc ctatgttctt 1200
ttggaattta tccaaatctt atgtaaatgc ttatgtaaac caagatataa aagagtgctg 1260
attttttgag taaacttgca acagtcctaa cattcacctc ttgtgtgttt gtgtctgttc 1320
gccatcccgt ctccgctcgt cacttatcct tcactttcca gagggtcccc ccgcagaccc 1380
cggcgaccct caggtcggcc gactgcggca gctggcgccc gaacagggac cctcggataa 1440
gtgacccttg tctctatttc tactatttgg tgtttgtctt gtattgtctc tttcttgtct 1500
ggctatcatc acaagagcgg aacggactca ccatagggac caagctagcg cttctcgtcg 1560
cgtccaagac cctcaaagat ttttggcact tcgttgagcg aggcgatatc aggtatgaca 1620
gcgccctgcc gcaaggccag ctgcttgtcc gctcggctgc ggttggcacg gcaggatagg 1680
ggtatcttgc agttttggaa aaagatgtga taggtggcaa gcacctctgg cacggcaaat 1740
acggggtaga agttgaggcg cgggttgggc tcgcatgtgc cgttttcttg gcgtttgggg 1800
ggtacgcgcg gtgagaatag gtggcgttcg taggcaaggc tgacatccgc tatggcgagg 1860
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-45-
ggcacatcgc tgcgctcttg caacgcgtcg cagataatgg cgcactggcg ctgcagatgc 1920
ttcaacagca cgtcgtctcc cacatctagg tagtcgccat gcctttcgtc cccccgcccg 1980
acttgttcct cgtttgcctc tgcgttgtcc tggtcttgct ttttatcctc tgttggtact 2040
gagcggtcct cgtcgtcttc gcttacaaaa cctgggtcct gctcgataat cacttcctcc 2100
tcctcaagcg ggggtgcctc gacggggaag gtggtaggcg cgttggcggc atcggtggag 2160
gcggtggtgg cgaactcaga gggggcggtt aggctgtcct tcttctcgac tgactccatg 2220
atctttttct gcctatagga gaaggaaatg gccagtcggg aagaggagca gcgcgaaacc 2280
acccccgagc gcggacgcgg tgcggcgcga cgtcccccaa ccatggagga cgtgtcgtcc 2340
ccgtccccgt cgccgccgcc tccccgggcg cccccaaaaa agcggatgag gcggcgtatc 2400
gagtccgagg acgaggaaga ctcatcacaa gacgcgctgg tgccgcgcac acccagcccg 2460
cggccatcga cctcggcggc ggatttggcc attgcgccca agaagaaaaa gaagcgccct 2520
tctcccaagc ccgagcgccc gccatcacca gaggtaatcg tggacagcga ggaagaaaga 2580
gaagatgtgg cgctacaaat ggtgggtttc agcaacccac cggtgctaat caagcatggc 2640
aaaggaggta agcgcacagt gcggcggctg aatgaagacg acccagtggc gcgtggtatg 2700
cggacgcaag aggaagagga agagcccagc gaagcggaaa gtgaaattac ggtgatgaac 2760
ccgctgagtg tgccgatcgt gtctgcgtgg gagaagggca tggaggctgc gcgcgcgctg 2820
atggacaagt accacgtgga taacgatcta aaggcgaact tcaaactact gcctgaccaa 2880
gtggaagctc tggcggccgt atgcaagacc tggctgaacg aggagcaccg cgggttgcag 2940
ctgaccttca ccagcaacaa gacctttgtg acgatgatgg ggcgattcct gcaggcgtac 3000.
ctgcagtcgt ttgcagaggt gacctacaag catcacgagc ccacgggctg cgcgttgtgg 3060
ctgcaccgct gcgctgagat cgaaggcgag cttaagtgtc tacacggaag cattatgata 3120
aataaggagc acgtgattga aatggatgtg acgagcgaaa acgggcagcg ~gcgctgaag 3180
gagcagtcta gcaaggccaa gatcgtgaag aaccggtggg gccgaaatgt ggtgcagatc 3240
tccaacaccg acgcaaggtg ctgcgtgcac gacgcggcct gtccggccaa tcagttttcc 3300
ggcaagtctt gcggcatgtt cttctctgaa ggcgcaaagg ctcaggtggc ttttaagcag 3360
atcaaggctt ttatgcaggc gctgtatcct aacgcccaga ccgggcacgg tcaccttttg 3420
atgccactac ggtgcgagtg caactcaaag cctgggcacg cgcccttttt gggaaggcag 3480
ctaccaaagt tgactccgtt cgccctgagc aacgcggagg acctggacgc ggatctgatc 3540
tccgacaaga gcgtgctggc cagcgtgcac cacccggcgc tgatagtgtt ccagtgctgc 3600
aaccctgtgt atcgcaactc gcgcgcgcag ggcggaggcc ccaactgcga cttcaagata 3660
tcggcgcccg acctgctaaa cgcgttggtg atggtgcgca gcctgtggag tgaaaacttc 3720
accgagctgc cgcggatggt tgtgcctgag tttaagtgga gcactaaaca ccagtatcgc 3780
aacgtgtccc tgccagtggc gcatagcgat gcgcggcaga acccctttga tttttaaacg 3840
gcgcagacgg caagggtggg ggtaaataat cacccgagag tgtacaaata aaagcatttg 3900
cctttattga aagtgtctct agtacattat ttttacatgt ttttcaagtg acaaaaagaa 3960
gtggcgctcc taatctgcgc actgtggctg cggaagtagg gcgagtggcg ctccaggaag 4020
ctgtagagct gttcctggtt gcgacgcagg gtgggctgta cctggggact gttgagcatg 4080
gagttgggta ccccggtaat aaggttcatg gtggggttgt gatccatggg agtttggggc 4140
cagttggcaa aggcgtggag aaacatgcag cagaatagtc cacaggcggc cgagttgggc 4200
ccctgtacgc tttgggtgga cttttccagc gttatacagc ggtcggggga agaagcaatg 4260
gcgctacggc gcaggagtga ctcgtactca aactggtaaa cctgcttgag tcgctggtca 4320
gaaaagccaa agggctcaaa gaggtagcat gtttttgagt gcgggttcca ggcaaaggcc 4380
atccagtgta cgcccccagt ctcgcgaccg gccgtattga ctatggcgca ggcgagcttg 4440
tgtggagaaa caaagcctgg aaagcgcttg tcataggtgc ccaaaaaata tggcccacaa 4500
ccaagatctt tgacaatggc tttcagttcc tgctcactgg agcccatggc ggcagctgtt 4560
gttgatgttg cttgcttctt tatgttgtgg cgttgccggc cgagaagggc gtgcgcaggt 4620
acacggtttc gatgacgccg cggtgcggcc ggtgcacacg gaccacgtca aagacttcaa 4680
acaaaacata aagaagggtg ggctcgtcca tgggatccat atatagggcc cgggttataa 9740
ttacctcagg tcgacctcga gggatctttg tgaaggaacc ttacttctgt ggtgtgacat 4800
aattggacaa actacctaca gagatttaaa gctctaaggt aaatataaaa tttttaagtg 4860
tataatgtgt taaactactg attctaattg tttgtgtatt ttagattcca acctatggaa 4920
ctgatgaatg ggagcagtgg tggaatgcct ttaatgagga aaacctgttt tgctcagaag 4980
aaatgccatc tagtgatgat gaggctactg ctgactctca acattctact cctccaaaaa 5040
agaagagaaa ggtagaagac cccaaggact ttccttcaga attgctaagt tttttgagtc 5100
atgctgtgtt tagtaataga actcttgctt gctttgctat ttacaccaca aaggaaaaag 5160
ctgcactgct atacaagaaa attatggaaa aatattctgt aacctttata agtaggcata 5220_
acagttataa tcataacata ctgttttttc ttactccaca caggcataga gtgtctgcta 5280
ttaataacta tgctcaaaaa ttgtgtacct ttagcttttt aatttgtaaa ggggttaata 5340
aggaatattt gatgtatagt gccttgacta gagatcataa tcagccatac cacatttgta 5400
gaggttttac ttgctttaaa aaacctccca cacctccccc tgaacctgaa acataaaatg 5460
aatgcaattg ttgttgttaa cttgtttatt gcagcttata atggttacaa ataaagcaat 5520
agcatcacaa atttcacaaa taaagcattt ttttcactgc attctagttg tggtttgtcc 5580
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-46-
aaactcatca atgtatctta tcatgtctgg atccggctgt ggaatgtgtg tcagttaggg 5640
tgtggaaagt ccccaggctc cccagcaggc agaagtatgc aaagcatgca tctcaattag 5700
tcagcaacca ggtgtggaaa gtccccaggc tccccagcag gcagaagtat gcaaagcatg 5760
catctcaatt agtcagcaac catagtcccg cccctaactc cgcccatccc gcccctaact 5820
ccgcccagtt ccgcccattc tccgccccat ggctgactaa ttttttttat ttatgcagag 5880
gccgaggccg cctcggcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc 5940
ctaggctttt gcaaaaagct tcacgctgcc gcaagcactc agggcgcaag ggctgctaaa 6000
ggaagcggaa cacgtagaaa gccagtccgc agaaacggtg ctgaccccgg atgaatgtca 6060
gctactgggc tatctggaca agggaaaacg caagcgcaaa gagaaagcag gtagcttgca 6120
gtgggcttac atggcgatag ctagactggg cggttttatg gacagcaagc gaaccggaat 6180
tgccagctgg ggcgccctct ggtaaggttg ggaagccctg caaagtaaac tggatggctt 6240
tcttgccgcc aaggatctga tggcgcaggg gatcaagatc tgatcaagag acaggatgag 6300
gatcgtttcg catgattgaa caagatggat tgcacgcagg ttctccggcc gcttgggtgg 6360
agaggctatt cggctatgac tgggcacaac agacaatcgg ctgctctgat gccgccgtgt 6420
tccggctgtc agcgcagggg cgcccggttc tttttgtcaa gaccgacctg tccggtgccc 6980
tgaatgaact gcaggacgag gcagcgcggc tatcgtggct ggccacgacg ggcgttcctt 6540
gcgcagctgt gctcgacgtt gtcactgaag cgggaaggga ctggctgcta ttgggcgaag 6600
tgccggggca ggatctcctg tcatctcacc ttgctcctgc cgagaaagta tccatcatgg 6660
ctgatgcaat gcggcggctg catacgcttg atccggctac ctgcccattc gaccaccaag 6720
cgaaacatcg catcgagcga gcacgtactc ggatggaagc cggtcttgtc gatcaggatg 6780
atctggacga agagcatcag gggctcgcgc cagccgaact gttcgccagg ctcaaggcgc 6840
gcatgcccga cggcgaggat ctcgtcgtga cccatggcga tgcctgcttg ccgaatatca 6900
tggtggaaaa tggccgcttt tctggattca tcgactgtgg ccggctgggt gtggcggacc 6960
gctatcagga catagcgttg gctacccgtg atattgctga agagcttggc ggcgaatggg 7020
ctgaccgctt cctcgtgctt tacggtatcg ccgctcccga ttcgcagcgc atcgccttct 7080
atcgccttct tgacgagttc ttctgagcgg gactctgggg ttcgaaatga ccgaccaagc 7140
gacgcccaac ctgccatcac gagatttcga ttccaccgcc gccttctatg aaaggttggg 7200
cttcggaatc gttttccggg acgccggctg gatgatcctc cagcgcgggg atctcatgct 7260
ggagttcttc gcccaccccg ggctcgatcc cctcgcgagt tggttcagct gctgcctgag 7320
gctggacgac ctcgcggagt tctaccggca gtgcaaatcc gtcggcatcc aggaaaccag 7380
cagcggctat ccgcgcatcc atgcccccga actgcaggag tggggaggca cgatggccgc 7440
tttggtcccg gatctttgtg aaggaacctt acttctgtgg tgtgacataa ttggacaaac 7500
tacctacaga gatttaaagc tctaaggtaa atataaaatt tttaagtgta taatgtgtta 7560
aactactgat tctaattgtt tgtgtatttt agattccaac ctatggaact gatgaatggg 7620
agcagtggtg gaatgccttt aatgaggaaa acctgttttg ctcagaagaa atgccatcta 7680
gtgatgatga ggctactgct gactctcaac attctactcc tccaaaaaag aagagaaagg 7740
tagaagaccc caaggacttt ccttcagaat tgctaagttt tttgagtcat gctgtgttta 7800
gtaatagaac tcttgcttgc tttgctattt acaccacaaa ggaaaaagct gcactgctat 7860
acaagaaaat tatggaaaaa tattctgtaa cctttataag taggcataac agttataatc 7920
ataacatact gttttttctt actccacaca ggcatagagt gtctgctatt aataactatg 7980
ctcaaaaatt gtgtaccttt agctttttaa tttgtaaagg ggttaataag gaatatttga 8040
tgtatagtgc cttgactaga gatcataatc agccatacca catttgtaga ggttttactt 8100
gctttaaaaa acctcccaca cctccccctg aacctgaaac ataaaatgaa tgcaattgtt 8160
gttgttaact tgtttattgc agcttataat ggttacaaat aaagcaatag catcacaaat 8220
ttcacaaata aagcattttt ttcactgcat tctagttgtg gtttgtccaa actcatcaat 8280
gtatcttatc atgtctggat ccccaggaag ctcctctgtg tcctcataaa ccctaacctc 8340
ctctacttga gaggacattc caatcatagg ctgcccatcc accctctgtg tcctcctgtt 8400
aattaggtca cttaacaaaa aggaaattgg gtaggggttt ttcacagacc gctttctaag 8460
ggtaatttta aaatatctgg gaagtccctt ccactgctgt gttccagaag tgttggtaaa 8520
cagcccacaa atgtcaacag cagaaacata caagctgtca gctttgcaca agggcccaac 8580
accctgctca tcaagaagca ctgtggttgc tgtgttagta atgtgcaaaa caggaggcac 8640
attttcccca cctgtgtagg ttccaaaata tctagtgttt tcatttttac ttggatcagg 8700
aacccagcac tccactggat aagcattatc cttatccaaa acagccttgt ggtcagtgtt 8760
catctgctga ctgtcaactg tagcattttt tggggttaca,gtttgagcag gatatttggt 8820
cctgtagttt gctaacacac cctgcagctc caaaggttcc ccaccaacag caaaaaaatg 8880
aaaatttgac ccttgaatgg gttttccagc accattttca tgagtttttt gtgtccctga 8940
atgcaagttt aacatagcag ttaccccaat aacctcagtt ttaacagtaa cagcttccca 9000
catcaaaata tttccacagg ttaagtcctc atttaaatta ggcaaaggaa ttcttgaaga 9060
cgaaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat aatggtttct 9120
tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg tttatttttc 9180
taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat gcttcaataa 9240
tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat tccctttttt 9300
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-47-
gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct 9360
gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag cggtaagatc 9420
cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa agttctgcta 9480
tgtggcgcgg tattatcccg tgttgacgcc gggcaagagc aactcggtcg ccgcatacac 9540
tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct tacggatggc 9600
atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac tgcggccaac 9660
ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca caacatgggg 9720
gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat accaaacgac 9780
gagcgtgaca ccacgatgcc tgcagcaatg gcaacaacgt tgcgcaaact attaactggc 9840
gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc ggataaagtt 9900
gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga 9960
gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg taagccctcc 10020
cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg aaatagacag 10080
atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca 10140
tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc 10200
ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca ctgagcgtca 10260
gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 10320
tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 10380
ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgtcctt 10490
ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 10500
gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 10560
ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ~gggggttcg 10620
tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 10680
ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 10740
agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 10800
agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 10860
gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 10920
tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga taaccgtatt 10980
accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca 11040
gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca tctgtgcggt 11100
atttcacacc gcatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc 11160
cagtatctgc tccctgcttg tgtgttggag gtcgctgagt agtgcgcgag caaaatttaa 11220
gctacaacaa ggcaaggctt gaccgacaat tgcatgaaga atctgcttag ggttaggcgt 11280
tttgcgctgc ttcgcgatgt acgggccaga tatacgcgta tctgagggga ctagggtgtg 11340
tttaggcgaa aagcggggct tcggttgtac gcggttagga gtcccctcag gatatagtag 11400
tttcgctttt gcatagggag ggggaaatgt agtcttatgc aatacacttg tagtcttgca 11460
acatggtaac gatgagttag caacatgcct tacaaggaga gaaaaagcac cgtgcatgcc 11520
gattggtgga agtaaggtgg tacgatcgtg ccttattagg aaggcaacag acgggtctga 11580
catggattgg acgaaccact 11600
<220>
<223> Description of Artificial Sequence: plasmid
<400> 49
<210> 50
<211> 8238
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 50
gcggccgcca tcatcaataa tataccttat tttggattga agccaatatg ataatgaggg 60
ggtggagttt gtgacgtggc gcggggcgtg ggaacggggc gggtgacgta gtagtgtggc 120
ggaagtgtga tgttgcaagt gtggcggaac acatgtaagc gacggatgtg gcaaaagtga 180
cgtttttggt gtgcgccggt gtacacagga agtgacaatt ttcgcgcggt tttaggcgga 240
CA 02359795 2001-07-12 pCT~, P00/00265
WO 00/42208
-48-
tgttgtagta aatttgggcg taaccgagta agatttggcc attttcgcgg gaaaactgaa 300
taagaggaag tgaaatctga ataattttgt gttactcata gcgcgtaata tttgtctagg 360
gccgcgggga ctttgaccgt ttacgtggag actcgcccag ggcgcgcccc gatgtacggg 420
ccagatatac gcgtatctga ggggactagg gtgtgtttag gcgaaaagcg gggcttcggt 480
tgtacgcggt taggagtccc ctcaggatat agtagtttcg cttttgcata gggaggggga 540
aatgtagtct tatgcaatac tcttgtagtc ttgcaacatg gtaacgatga gttagcaaca 600
tgccttacaa ggagagaaaa agcaccgtgc atgccgattg gtggaagtaa ggtggtacga 660
tcgtgcctta ttaggaaggc aacagacggg tctgacatgg attggacgaa ccactgaatt 720
ccgcattgca gagatattgt atttaagtgc ctagctcgat acaataaacg ccatttgacc 780
attcaccaca ttggtgtgca cctccggccc atatggccac tctcttccgc atcgctgtct 840
gcgggggcca gctgttgggc tcgcggttga ggacaaactc ttcgcggtct ttccagtact 900
cttggatcgg aaacccgtcg gcctccgaac ggtactccgc cgccgaggga cctgagcgag 960
tccgcatcga ccggatcgga aaacctctcg agaaaggcgt gtaaccagtc acagtcgctc 1020
tagaactagt ggatcccccg ggctgcagga attcgatgat cttggtggcg tgaaactccc 1080
gcacctcttt ggcaagcgcc ttgtagaagc gcgtatggct tcgtacccct gccatcaaca 1140
cgcgtctgcg ttcgaccagg ctgcgcgttc tcgcggccat agcaaccgac gtacggcgtt 1200
gcgccctcgc cggcagcaag aagccacgga agtccgcctg gagcagaaaa tgcccacgct 1260
actgcgggtt tatatagacg gtcctcacgg gatggggaaa accaccacca cgcaactgct 1320
ggtggccctg ggttcgcgcg acgatatcgt ctacgtaccc gagccgatga cttactggca 1380
ggtgctgggg gcttccgaga caatcgcgaa catctacacc acacaacacc gcctcgacca 1440
gggtgagata tcggccgggg acgcggcggt ggtaatgaca agcgcccaga taacaatggg 1500
catgccttat gccgtgaccg acgccgttct ggctcctcat gtcggggggg aggctgggag 1560
ttcacatgcc ccgcccccgg ccctcaccct catcttcgac cgccatccca tcgccgccct 1620
cctgtgctac ccggccgcgc gataccttat gggcagcatg accccccagg ccgtgctggc 1680
gttcgtggcc ctcatcccgc cgaccttgcc cggcacaaac atcgtgttgg gggcccttcc 1740
ggaggacaga cacatcgacc gcctggccaa acgccagcgc cccggcgagc ggcttgacct 1800
ggctatgctg gccgcgattc gccgcgttta cgggctgctt gccaatacgg tgcggtatct 1860
gcagggcggc gggtcgtggt gggaggattg gggacagctt tcggggacgg ccgtgccgcc 1920
ccagggtgcc gagccccaga gcaacgcggg cccacgaccc catatcgggg acacgttatt 1980
taccctgttt cgggcccccg agttgctggc ccccaacggc gacctgtata acgtgtttgc 2040
ctgggccttg gacgtcttgg ccaaacgcct ccgtcccatg cacgtcttta tcctggatta 2100
cgaccaatcg cccgccggct gccgggacgc cctgctgcaa cttacctccg ggatggtcca 2160
gacccacgtc accaccccag gctccatacc gacgatctgc gacctggcgc gcacgtttgc 2220
ccgggagatg ggggaggcta actgactcga gaagcttggg cccatcgatc aagcttatcg 2280
ataccgtcga aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac 2340
aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat 2400
caatgtatct tatcatgtct ggatccgacc tcggatctgg aaggtgctga ggtacgatga 2460
gacccgcacc aggtgcagac cctgcgagtg tggcggtaaa catattagga accagcctgt 2520
gatgctggat gtgaccgagg agctgaggcc cgatcacttg gtgctggcct gcacccgcgc 2580
tgagtttggc tctagcgatg aagatacaga ttgaggtact gaaatgtgtg ggcgtggctt 2640
aagggtggga aagaatatat aaggtggggg tcttatgtag ttttgtatct gttttgcagc 2700
agccgccgcc gccatgagca ccaactcgtt tgatggaagc attgtgagct catatttgac 2760
aacgcgcatg cccccatggg ccggggtgcg tcagaatgtg atgggctcca gcattgatgg 2820
tcgccccgtc ctgcccgcaa actctactac cttgacctac gagaccgtgt ctggaacgcc 2880
gttggagact gcagcctccg ccgccgcttc agccgctgca gccaccgccc gcgggattgt 2940
gactgacttt gctttcctga gcccgcttgc aagcagtgca gcttcccgtt catccgcccg 3000
cgatgacaag ttgacggctc ttttggcaca attggattct ttgacccggg aacttaatgt 3060
cgtttctcag cagctgttgg atctgcgcca gcaggtttct gccctgaagg cttcctcccc 3120
tcccaatgcg gtttaaaaca taaataaaaa accagactct gtttggattt ggatcaagca 3180
agtgtcttgc tgtctttatt taggggtttt gcgcgcgcgg taggcccggg accagcggtc 3240
tcggtcgttg agggtcctgt gtattttttc caggacgtgg taaaggtgac tctggatgtt 3300
cagatacatg ggcataagcc cgtctctggg gtggaggtag caccactgca gagcttcatg 3360
ctgcggggtg gtgttgtaga tgatccagtc gtagcaggag cgctgggcgt ggtgcctaaa 3420
aatgtctttc agtagcaagc tgattgccag gggcaggccc ttggtgtaag tgtttacaaa 3480
gcggttaagc tgggatgggt gcatacgtgg ggatatgaga tgcatcttgg actgtatttt 3540
taggttggct atgttcccag ccatatccct ccggggattc atgttgtgca gaaccaccag 3600
cacagtgtat ccggtgcact tgggaaattt gtcatgtagc ttagaaggaa atgcgtggaa 3660
gaacttggag acgcccttgt gacctccaag attttccatg cattcgtcca taatgatggc 3720
aatgggccca cgggcggcgg cctgggcgaa gatatttctg ggatcactaa cgtcatagtt 3780
gtgttccagg atgagatcgt cataggccat ttttacaaag cgcgggcgga gggtgccaga 3840
ctgcggtata atggttccat ccggcccagg ggcgtagtta ccctcacaga tttgcatttc 3900
ccacgctttg agttcagatg gggggatcat gtctacctgc ggggcgatga agaaaacggt 3960
WO 00/42208 CA 02359795 2001-07-12 pCT~, P00/00265
-49-
ttccggggta ggggagatca gctgggaaga aagcaggttc ctgagcagct gcgacttacc 4020
gcagccggtg ggcccgtaaa tcacacctat taccggctgc aactggtagt taagagagct 4080
gcagctgccg tcatccctga gcaggggggc cacttcgtta agcatgtccc tgactcgcat 4140
gttttccctg accaaatccg ccagaaggcg ctcgccgccc agcgatagca gttcttgcaa 4200
ggaagcaaag tttttcaacg gtttgagacc gtccgccgta ggcatgcttt tgagcgtttg 4260
accaagcagt tccaggcggt cccacagctc ggtcacctgc tctacggcat ctcgatccag 4320
catatctcct cgtttcgcgg gttggggcgg ctttcgctgt acggcagtag tcggtgctcg 4380
tccagacggg ccagggtcat gtctttccac gggcgcaggg tcctcgtcag cgtagtctgg 4440
gtcacggtga aggggtgcgc tccgggctgc gcgctggcca gggtgcgctt gaggctggtc 4500
ctgctggtgc tgaagcgctg ccggtcttcg ccctgcgcgt cggccaggta gcatttgacc 9560
atggtgtcat agtccagccc ctccgcggcg tggcccttgg cgcgcagctt gcccttggag 4620
gaggcgccgc acgaggggca gtgcagactt ttgagggcgt agagcttggg cgcgagaaat 4680
accgattccg gggagtaggc atccgcgccg caggccccgc agacggtctc gcattccacg 4740
agccaggtga gctctggccg ttcggggtca aaaaccaggt ttcccccatg ctttttgatg 4800
cgtttcttac ctctggtttc catgagccgg tgtccacgct cggtgacgaa aaggctgtcc 4860
gtgtccccgt atacagactt gagaggcctg tcctcgagcg gtgttccgcg gtcctcctcg 4920
tatagaaact cggaccactc tgagacaaag gctcgcgtcc aggccagcac gaaggaggct 4980
aagtgggagg ggtagcggtc gttgtccact agggggtcca ctcgctccag ggtgtgaaga 5040
cacatgtcgc cctcttcggc atcaaggaag gtgattggtt tgtaggtgta ggccacgtga 5100
ccgggtgttc ctgaaggggg gctataaaag ggggtggggg cgcgttcgtc ctcactctct 5160
tccgcatcgc tgtctgcgag ggccagctgt tggggtgagt actccctctg aaaagcgggc 5220
atgacttctg cgctaagatt gtcagtttcc aaaaacgagg aggatttgat ~ttcacctgg 5280
cccgcggtga tgcctttgag ggtggccgca tccatctggt cagaaaagac aatctttttg 5340
ttgtcaagct tcgagggggg gcccggtacc cagcttttgt tccctttagt gagggttaat 5400
tgcgcgcttg gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac 5460
aattccacac aacatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt 5520
gagctaactc acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc 5580
gtgccagctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg 5640
ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt 5700
atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata acgcaggaaa 5760
gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc 5820
gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct caagtcagag 5880
gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa gctccctcgt 5940
gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc tcccttcggg 6000
aagcgtggcg ctttctcata gctcacgctg taggtatctc agttcggtgt aggtcgttcg 6060
ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg ccttatccgg 6120
taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg cagcagccac 6180
tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct tgaagtggtg 6240
gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc tgaagccagt 6300
taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg ctggtagcgg 6360
tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc aagaagatcc 6420
tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt aagggatttt 6480
ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt ttaaattaaa aatgaagttt 6540
taaatcaatc taaagtatat atgagtaaac ttggtctgac agttaccaat gcttaatcag 6600
tgaggcacct atctcagcga tctgtctatt tcgttcatcc atagttgcct gactccccgt 6660
cgtgtagata actacgatac gggagggctt accatctggc cccagtgctg caatgatacc 6720
gcgagaccca cgctcaccgg ctccagattt atcagcaata aaccagccag ccggaagggc 6780
cgagcgcaga agtggtcctg caactttatc cgcctccatc cagtctatta attgttgccg 6840
ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc aacgttgttg ccattgctac 6900
aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg 6960
atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc 7020
tccgatcgtt gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact 7080
gcataattct cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc 7140
aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat 7200
acgggataat accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc 7260
ttcggggcga aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac 7320_
tcgtgcaccc aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa 7380
aacaggaagg caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact 7440
catactcttc ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg 7500
atacatattt gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg 7560
aaaagtgcca cctgacgcgc cctgtagcgg cgcattaagc gcggcgggtg tggtggttac 7620
gcgcagcgtg accgctacac ttgccagcgc cctagcgccc gctcctttcg ctttcttccc 7680
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-50-
ttcctttctc gccacgttcg ccggctttcc ccgtcaagct ctaaatcggg ggctcccttt 7740
agggttccga tttagtgctt tacggcacct cgaccccaaa aaacttgatt agggtgatgg 7800
ttcacgtagt gggccatcgc cctgatagac ggtttttcgc cctttgacgt tggagtccac 7860
gttctttaat agtggactct tgttccaaac tggaacaaca ctcaacccta tctcggtcta 7920
ttcttttgat ttataaggga ttttgcgatt tcggcctatt ggttaaaaaa tgagctgatt 7980
taacaaaaat ttaacgcgaa ttttaacaaa atattaacgc ttacaatttc cattcgccat 8040
tcaggctgcg caactgttgg gaagggcgat cggtgcgggc ctcttcgcta ttacgccagc 8100
tggcgaaagg gggatgtgct gcaaggcgat taagttgggt aacgccaggg ttttcccagt 8160
cacgacgttg taaaacgacg gccagtgagc gcgcgtaata cgactcacta tagggcgaat 8220
tggagctcca ccgcggtg 8238
<210> 51
<211> 11
<212> DNA
<213> adenovirus
<400> 51
cgcggatccc g 11
<210> 52
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 52
ctgacaaact cagatcttgt ttattg 26
<210> 53
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 53
gtcgactcta gaggatccag a 21
<210> 54
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 54
ccggactcta gatggcaacc atggcgctac 30
<210> 55
<211> 31
<212> DNA
<213> Artificial Sequence
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-51-
<220>
<223> Description of Artificial Sequence: primer
<400> 55
ggaggggaag cttggccctc agccagcctc t 31
<210> 56
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 56
tgtcttggat ccaagatgaa gcgcgcccgc cccagcgaag atgacttc 48
<210> 57
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 57
aaacacggcg gccgctcttt cattcttg 28
<210> 58
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 58
cgcgctgact cttaggacta gtttc 25
<210> 59
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 59
gcgcttaatt aacatcatca ataatatacc ttatttt 37
<210> 60
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
WO 00/42208 CA 02359795 2001-07-12
PCT/EP00/00265
-52-
<400> 60
tgaagcgcgc aagaccgtct gaag 24
<210> 61
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 61
cataacactg cagattcttt attcttgg 28
<210> 62
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 62
ggtacacagg aaacaggagg ttccggaggt ggaggagaca caactcc 47
<210> 63
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: synthetic peptide
<400> 63
Gly Gly Ser Gly Gly Gly
1 5
<210> 64
<211> 7231
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 64
ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg cgagcaaaat ttaagctaca 60
acaaggcaag gcttgaccga caattgcatg aagaatctgc ttagggttag gcgttttgcg 120
ctgcttcgcg atgtacgggc cagatatacg cgttgacatt gattattgac tagttattaa 180
tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg cgttacataa 240
cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata 300
atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca atgggtggac 360
tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc 420
cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta 480
tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg 540
cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt 600
ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg ggactttcca 660
aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt acggtgggag 720
WO 00/42208 CA 02359795 2001-07-12 pCT~P00/00265
-53-
gtctatataa gcagagctct ctggctaact agagaaccca ctgcttactg gcttatcgaa 780
attaatacga ctcactatag ggagacccaa gctggctagc gtttaaactt aagcttggta 840
ccgagctcgg atccactctc ttccgcatcg ctgtctgcga gggccagctg ttggggtgag 900
tactccctct gaaaagcggg catgacttct gcgctaagat tgtcagtttc caaaaacgag 960
gaggatttga tattcacctg gcccgcggtg atgcctttga gggtggccgc atccatctgg 1020
tcagaaaaga caat.cttttt gttgtcaagc ttggtggcaa acgacccgta gagggcgttg 1080
gacagcaact tggcgatgga gcgcagggtt tggtttttgt cgcgatcggc gcgctccttg 1140
gccgcgatgt ttagctgcac gtattcgcgc gcaacgcacc gccattcggg aaagacggtg 1200
gtgcgctcgt cgggcaccag gtgcacgcgc caaccgcggt tgtgcagggt gacaaggtca 1260
acgctggtgg ctacctctcc gcgtaggcgc tcgttggtcc agcagaggcg gccgcccttg 1320
cgcgagcaga atggcggtag ggggtctagc tgcgtctcgt ccggggggtc tgcgtccacg 1380
gtaaagaccc cgggcagcag gcgcgcgtcg aagtagtcta tcttgcatcc ttgcaagtct 1440
agcgcctgct gccatgcgcg ggcggcaagc gcgcgctcgt atgggttgag tgggggaccc 1500
catggcatgg ggtgggtgag cgcggaggcg tacatgccgc aaatgtcgta aacgtagagg 1560
ggctctctga gtattccaag atatgtaggg tagcatcttc caccgcggat gctggcgcgc 1620
acgtaatcgt atagttcgtg cgagggagcg aggaggtcgg gaccgaggtt gctacgggcg 1680
ggctgctctg ctcggaagac tatctgcctg aagatggcat gtgagttgga tgatatggtt 1740
ggacgctgga agacgttgaa gctggcgtct gtgagaccta ccgcgtcacg cacgaaggag 1800
gcgtaggagt cgcgcagctt gttgaccagc tcggcggtga cctgcacgtc tagggcgcag 1860
tagtccaggg tttccttgat gatgtcatac ttatcctgtc cctttttttt ccacagctcg 1920
cggttgagga caaactcttc gcggtctttc cagtactctt ggatcggaaa cccgtcggcc 1980
tccgaacgag atccgtactc cgccgccgag ggacctgagc gagtccgcat ~gaccggatc 2040
ggaaaacctc tcgagaaagg cgtctaacca gtcacagtcg caagatccaa gatgaagcgc 2100
gcccgcccca gcgaagatga cttcaacccc gtctacccct atggctacgc gcggaatcag 2160
aatatcccct tcctcactcc cccctttgtc tcctccgatg gattcaaaaa cttcccccct 2220
ggggtactgt cactcaaact ggctgatcca atcaccatta ccaatgggga tgtatccctc 2280
aaggtgggag gtggtctcac tttgcaagat ggaagcctaa ctgtaaaccc taaggctcca 2340
ctgcaagtta atactgataa aaaacttgag cttgcatatg ataatccatt tgaaagtagt 2400
gctaataaac ttagtttaaa agtaggacat ggattaaaag tattagatga aaaaagtgct 2460
gcggggttaa aagatttaat tggcaaactt gtggttttaa caggaaaagg aataggcact 2520
gaaaatttag aaaatacaga tggtagcagc agaggaattg gtataaatgt aagagcaaga 2580
gaagggttga catttgacaa tgatggatac ttggtagcat ggaacccaaa gtatgacacg 2640
cgcacacttt ggacaacacc agacacatct ccaaactgca caattgctca agataaggac 2700
tctaaactca ctttggtact tacaaagtgt ggaagtcaaa tattagctaa tgtgtctttg 2760
attgtggtcg caggaaagta ccacatcata aataataaga caaatccaaa aataaaaagt 2820
tttactatta aactgctatt taataagaac ggagtgcttt tagacaactc aaatcttgga 2880
aaagcttatt ggaactttag aagtggaaat tccaatgttt cgacagctta tgaaaaagca 2940
attggtttta tgcctaattt ggtagcgtat ccaaaaccca gtaattctaa aaaatatgca 3000
agagacatag tttatggaac tatatatctt ggtggaaaac ctgatcagcc agcagtcatt 3060
aaaactacct ttaaccaaga aactggatgt gaatactcta tcacatttaa ctttagttgg 3120
tccaaaacct atgaaaatgt tgaatttgaa accacctctt ttaccttctc ctatattgcc 3180
caagaatgaa agagcggccg ctcgagtcta gagggcccgt ttaaacccgc tgatcagcct 3240
cgactgtgcc ttctagttgc cagccatctg ttgtttgccc ctcccccgtg ccttccttga 3300
ccctggaagg tgccactccc actgtccttt cctaataaaa tgaggaaatt gcatcgcatt 3360
gtctgagtag gtgtcattct attctggggg gtggggtggg gcaggacagc aagggggagg 3420
attgggaaga caatagcagg catgctgggg atgcggtggg ctctatggct tctgaggcgg 3480
aa-agaaccag ctggggctct agggggtatc cccacgcgcc ctgtagcggc gcattaagcg 3540
cggcgggtgt ggtggttacg cgcagcgtga ccgctacact tgccagcgcc ctagcgcccg 3600
ctcctttcgc tttcttccct tcctttctcg,ccacgttcgc cggctttccc cgtcaagctc 3660
taaatcgggg catcccttta gggttccgat ttagtgcttt acggcacctc gaccccaaaa 3720
aacttgatta gggtgatggt tcacgtagtg ggccatcgcc ctgatagacg gtttttcgcc 3780
ctttgacgtt ggagtccacg ttctttaata gtggactctt gttccaaact ggaacaacac 3840
tcaaccctat ctcggtctat tcttttgatt tataagggat tttggggatt tcggcctatt 3900
ggttaaaaaa tgagctgatt taacaaaaat ttaacgcgaa ttaattctgt ggaatgtgtg 3960
tcagttaggg tgtggaaagt ccccaggctc cccaggcagg cagaagtatg caaagcatgc 4020
atctcaatta gtcagcaacc aggtgtggaa agtccccagg ctccccagca ggcagaagta 4080
tgcaaagcat gcatctcaat tagtcagcaa ccatagtccc gcccctaact ccgcccatcc 4140
cgcccctaac tccgcccagt tccgcccatt ctccgcccca tggctgacta atttttttta 4200
tttatgcaga ggccgaggcc gcctctgcct ctgagctatt ccagaagtag tgaggaggct 4260
tttttggagg cctaggcttt tgcaaaaagc tcccgggagc ttgtatatcc attttcggat 4320
ctgatcagca cgtgttgaca attaatcatc ggcatagtat atcggcatag tataatacga 4380
caaggtgagg aactaaacca tggccaagtt gaccagtgcc gttccggtgc tcaccgcgcg 4440
atggtgtcat agtccagccc ctccgcggcg tggcccttgg cgcgcagctt gcccttgga
CA 02359795 2001-07-12 pCT~P00/00265
WO 00/42208
-54-
cgacgtcgcc ggagcggtcg agttctggac cgaccggctc gggttctccc gggacttcgt 4500
ggaggacgac ttcgccggtg tggtccggga cgacgtgacc ctgttcatca gcgcggtcca 4560
ggaccaggtg gtgccggaca acaccctggc ctgggtgtgg gtgcgcggcc tggacgagct 4620
gtacgccgag tggtcggagg tcgtgtccac gaacttccgg gacgcctccg ggccggccat 4680
gaccgagatc ggcgagcagc cgtgggggcg ggagttcgcc ctgcgcgacc cggccggcaa 4740
ctgcgtgcac ttcgtggccg aggagcagga ctgacacgtg ctacgagatt tcgattccac 4800
cgccgccttc tatgaaaggt tgggcttcgg aatcgttttc cgggacgccg gctggatgat 4860
cctccagcgc ggggatctca tgctggagtt cttcgcccac cccaacttgt ttattgcagc 4920
ttataatggt tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc 4980
actgcattct agttgtggtt tgtccaaact catcaatgta tcttatcatg tctgtatacc 5040
gtcgacctct agctagagct tggcgtaatc atggtcatag ctgtttcctg tgtgaaattg 5100
ttatccgctc acaattccac acaacatacg agccggaagc ataaagtgta aagcctgggg 5160
tgcctaatga gtgagctaac tcacattaat tgcgttgcgc tcactgcccg ctttccagtc 5220
gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt 5280
gcgtattggg cgctcttccg cttcctcgct cactgactcg ctgcgctcgg tcgttcggct 5340
gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg ttatccacag aatcagggga 5400
taacgcagga aagaacatgt gagcaaaagg ccagcaaaag gccaggaacc gtaaaaaggc 5460
cgcgttgctg gcgtttttcc ataggctccg cccccctgac gagcatcaca aaaatcgacg 5520
ctcaagtcag aggtggcgaa acccgacagg actataaaga taccaggcgt ttccccctgg 5580
aagctccctc gtgcgctctc ctgttccgac cctgccgctt accggatacc tgtccgcctt 5640
tctcccttcg ggaagcgtgg cgctttctca atgctcacgc tgtaggtatc tcagttcggt 5700
gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc cccgttcagc c~cgaccgctg 5760
cgccttatcc ggtaactatc gtcttgagtc caacccggta agacacgact tatcgccact 5820
ggcagcagcc actggtaaca ggattagcag agcgaggtat gtaggcggtg ctacagagtt 5880
cttgaagtgg tggcctaact acggctacac tagaaggaca gtatttggta tctgcgctct 5940
gctgaagcca gttaccttcg gaaaaagagt tggtagctct tgatccggca aacaaaccac 6000
cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt acgcgcagaa aaaaaggatc 6060
tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg aaaactcacg 6120
ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc ttttaaatta 6180
aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg acagttacca 6240
atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat ccatagttgc 6300
ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg gccccagtgc 6360
tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa taaaccagcc 6420
agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca tccagtctat 6480
taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc gcaacgttgt 6540
tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt cattcagctc 6600
cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa aagcggttag 6660
ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat cactcatggt 6720
tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct tttctgtgac 6780
tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga gttgctcttg 6840
cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag tgctcatcat 6900
tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga gatccagttc 6960
gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca ccagcgtttc 7020
tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg cgacacggaa 7080
atgttgaata ctcatactct tcctttttca atattattga agcatttatc agggttattg 7140
tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag gggttccgcg 7200
cacatttccc cgaaaagtgc cacctgacgt c 7231
<210> 65
<211> 8484
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: plasmid
<400> 65
ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgcg cgagcaaaat ttaagctaca 60
acaaggcaag gcttgaccga caattgcatg aagaatctgc ttagggttag gcgttttgcg 120
ctgcttcgcg atgtacgggc cagatatacg cgttgacatt gattattgac tagttattaa 180
tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg cgttacataa 240
WO 00/42208 CA 02359795 2001-07-12 pCT~, P00/00265
-55-
cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt gacgtcaata 300
atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca atgggtggac 360
tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc aagtacgccc 420
cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta catgacctta 480
tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac catggtgatg 540
cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg atttccaagt 600
ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg ggactttcca 660
aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt acggtgggag 720
gtctatataa gcagagctct ctggctaact agagaaccca ctgcttactg gcttatcgaa 780
attaatacga ctcactatag ggagacccaa gctggctagc gtttaaactt aagcttggta 840
ccgagctcgg atccactctc ttccgcatcg ctgtctgcga gggccagctg ttggggtgag 900
tactccctct gaaaagcggg catgacttct gcgctaagat tgtcagtttc caaaaacgag 960
gaggatttga tattcacctg gcccgcggtg atgcctttga gggtggccgc atccatctgg 1020
tcagaaaaga caatcttttt gttgtcaagc ttggtggcaa acgacccgta gagggcgttg 1080
gacagcaac't tggcgatgga gcgcagggtt tggtttttgt cgcgatcggc gcgctccttg 1140
gccgcgatgt ttagctgcac gtattcgcgc gcaacgcacc gccattcggg aaagacggtg 1200
gtgcgctcgt cgggcaccag gtgcacgcgc caaccgcggt tgtgcagggt gacaaggtca 1260
acgctggtgg ctacctctcc gcgtaggcgc tcgttggtcc agcagaggcg gccgcccttg 1320
cgcgagcaga atggcggtag ggggtctagc tgcgtctcgt ccggggggtc tgcgtccacg 1380
gtaaagaccc cgggcagcag gcgcgcgtcg aagtagtcta tcttgcatcc ttgcaagtct 1440
agcgcctgct gccatgcgcg ggcggcaagc gcgcgctcgt atgggttgag tgggggaccc 1500
catggcatgg ggtgggtgag cgcggaggcg tacatgccgc aaatgtcgta ~acgtagagg 1560
ggctctctga gtattccaag atatgtaggg tagcatcttc caccgcggat gctggcgcgc 1620
acgtaatcgt atagttcgtg cgagggagcg aggaggtcgg gaccgaggtt gctacgggcg 1680
ggctgctctg ctcggaagac tatctgcctg aagatggcat gtgagttgga tgatatggtt 1740
ggacgctgga agacgttgaa gctggcgtct gtgagaccta ccgcgtcacg cacgaaggag 1800
gcgtaggagt cgcgcagctt gttgaccagc tcggcggtga cctgcacgtc tagggcgcag 1860
tagtccaggg tttccttgat gatgtcatac ttatcctgtc cctttttttt ccacagctcg 1920
cggttgagga caaactcttc gcggtctttc cagtactctt ggatcggaaa cccgtcggcc 1980
tccgaacgag atccgtactc cgccgccgag ggacctgagc gagtccgcat cgaccggatc 2040
ggaaaacctc tcgagaaagg cgtctaacca gtcacagtcg caagatccaa gatgaagcgc 2100
gcaagaccgt ctgaagatac cttcaacccc gtgtatccat atgacacgga aaccggtcct 2160
ccaactgtgc cttttcttac tcctcccttt gtatccccca atgggtttca agagagtccc 2220
cctggggtac tctctttgcg cctatccgaa cctctagtta cctccaatgg catgcttgcg 2280
ctcaaaatgg gcaacggcct ctctctggac gaggccggca accttacctc ccaaaatgta 2340
accactgtga gcccacctct caaaaaaacc aagtcaaaca taaacctgga aatatctgca 2400
cccctcacag ttacctcaga agccctaact gtggctgccg ccgcacctct aatggtcgcg 2460
ggcaacacac tcaccatgca atcacaggcc ccgctaaccg tgcacgactc caaacttagc 2520
attgccaccc aaggacccct cacagtgtca gaaggaaagc tagccctgca aacatcaggc 2580
cccctcacca ccaccgatag cagtaccctt actatcactg cctcaccccc tctaactact 2640
gccactggta gcttgggcat tgacttgaaa gagcccattt atacacaaaa tggaaaacta 2700
ggactaaagt acggggctcc tttgcatgta acagacgacc taaacacttt gaccgtagca 2760
actggtccag gtgtgactat taataatact tccttgcaaa ctaaagttac tggagccttg 2820
ggttttgatt cacaaggcaa tatgcaactt aatgtagcag gaggactaag gattgattct 2880
caaaacagac gccttatact tgatgttagt tatccgtttg atgctcaaaa ccaactaaat 2940
ctaagactag gacagggccc tctttttata aactcagccc acaacttgga tattaactac 3000
aacaaaggcc tttacttgtt tacagcttca aacaattcca aaaagcttga ggttaaccta 3060
agcactgcca aggggttgat gtttgacgct acagccatag ccattaatgc aggagatggg 3120
cttgaatttg gttcacctaa tgcaccaaac acaaatcccc tcaaaacaaa aattggccat 3180
ggcctagaat ttgattcaaa caaggctatg gttcctaaac taggaactgg ccttagtttt 3240
gacagcacag gtgccattac agtaggaaac aaaaataatg ataagctaac tttgtggacc 3300
acaccagctc catctcctaa~ctgtagacta aatgcagaga aagatgctaa actcactttg 3360
gtcttaacaa aatgtggcag tcaaatactt gctacagttt cagttttggc tgttaaaggc 3420
agtttggctc caatatctgg aacagttcaa agtgctcatc ttattataag atttgacgaa 3480
aatggagtgc tactaaacaa ttccttcctg gacccagaat attggaactt tagaaatgga 3540
gatcttactg aaggcacagc ctatacaaac gctgttggat ttatgcctaa cctatcagct 3600
tatccaaaat ctcacggtaa aactgccaaa agtaacattg tcagtcaagt ttacttaaac 3660
ggagacaaaa ctaaacctgt aacactaacc attacactaa acggtacaca ggaaacagga 3720
gacacaactc caagtgcata ctctatgtca ttttcatggg actggtctgg ccacaactac 3780
attaatgaaa tatttgccac atcctcttac actttttcat acattgccca agaataaaag 3840
aagcggccgc tcgagtctag cgataatcaa cctctggatt acaaaatttg tgaaagattg 3900
actggtattc ttaactatgt tgctcctttt acgctatgtg gatacgctgc tttaatgcct 3960
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-56-
ttgtatcatg ctattgcttc ccgtatggct ttcattttct cctccttgta taaatcctgg 4020
ttgctgtctc tttatgagga gttgtggccc gttgtcaggc aacgtggcgt ggtgtgcact 4080
gtgtttgctg acgcaacccc cactggttgg ggcattgcca ccacctgtca gctcctttcc 4140
gggactttcg ctttccccct ccctattgcc acggcggaac tcatcgccgc ctgccttgcc 4200
cgctgctgga caggggctcg gctgttgggc actgacaatt ccgtggtgtt gtcggggaag 4260
ctgacgtcct ttccatggct gctcgcctgt gttgccacct ggattctgcg cgggacgtcc 4320
ttctgctacg tcccttcggc cctcaatcca gcggaccttc cttcccgcgg cctgctgccg 4380
gctctgcggc ctcttccgcg tcttcgcctt cgccctcaga cgagtcggat ctccctttgg 4440
gccgcctccc cgcctgatcg ctagagggcc cgtttaaacc cgctgatcag cctcgactgt 4500
gccttctagt tgccagccat ctgttgtttg cccctccccc gtgccttcct tgaccctgga 4560
aggtgccact cccactgtcc tttcctaata aaatgaggaa attgcatcgc attgtctgag 4620
taggtgtcat tctattctgg ggggtggggt ggggcaggac agcaaggggg aggattggga 4680
agacaatagc aggcatgctg gggatgcggt gggctctatg gcttctgagg cggaaagaac 4740
cagctggggc tctagggggt atccccacgc gccctgtagc ggcgcattaa gcgcggcggg 4800
tgtggtggtt acgcgcagcg tgaccgctac acttgccagc gccctagcgc ccgctccttt 4860
cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg 4920
gggcatccct ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga 4980
ttagggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc gccctttgac 5040
gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa cactcaaccc 5100
tatctcggtc tattcttttg atttataagg gattttgggg atttcggcct attggttaaa 5160
aaatgagctg atttaacaaa aatttaacgc gaattaattc tgtggaatgt gtgtcagtta 5220
gggtgtggaa agtccccagg ctccccaggc aggcagaagt atgcaaagca ~gcatctcaa 5280
ttagtcagca accaggtgtg gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag 5340
catgcatctc aattagtcag caaccatagt cccgccccta actccgccca tcccgcccct 5400
aactccgccc agttccgccc attctccgcc ccatggctga ctaatttttt ttatttatgc 5460
agaggccgag gccgcctctg cctctgagct attccagaag tagtgaggag gcttttttgg 5520
aggcctaggc ttttgcaaaa agctcccggg agcttgtata tccattttcg gatctgatca 5580
gcacgtgttg acaattaatc atcggcatag tatatcggca tagtataata cgacaaggtg 5640
aggaactaaa ccatggccaa gttgaccagt gccgttccgg tgctcaccgc gcgcgacgtc 5700
gccggagcgg tcgagttctg gaccgaccgg ctcgggttct cccgggactt cgtggaggac 5760
gacttcgccg gtgtggtccg ggacgacgtg accctgttca tcagcgcggt ccaggaccag 5820
gtggtgccgg acaacaccct ggcctgggtg tgggtgcgcg gcctggacga gctgtacgcc 5880
gagtggtcgg aggtcgtgtc cacgaacttc cgggacgcct ccgggccggc catgaccgag-5940
atcggcgagc agccgtgggg gcgggagttc gccctgcgcg acccggccgg caactgcgtg 6000
cacttcgtgg ccgaggagca ggactgacac gtgctacgag atttcgattc caccgccgcc 6060
ttctatgaaa ggttgggctt cggaatcgtt ttccgggacg ccggctggat gatcctccag 6120
cgcggggatc tcatgctgga gttcttcgcc caccccaact tgtttattgc agcttataat 6180
ggttacaaat aaagcaatag catcacaaat ttcacaaata aagcattttt ttcactgcat 6240'
tctagttgtg gtttgtccaa actcatcaat gtatcttatc atgtctgtat accgtcgacc 6300
tctagctaga gcttggcgta atcatggtca tagctgtttc ctgtgtgaaa ttgttatccg 6360
ctcacaattc cacacaacat acgagccgga agcataaagt gtaaagcctg gggtgcctaa 6420
tgagtgagct aactcacatt aattgcgttg cgctcactgc ccgctttcca gtcgggaaac 6480
ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg ggagaggcgg tttgcgtatt 6540
gggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga 6600
gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca 6660
ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg 6720
ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt 6780
cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc 6840
ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct 6900
tcgggaagcg tggcgctttc tcaatgctca cgctgtaggt atctcagttc ggtgtaggtc 6960
gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta 7020
tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca 7080
gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag 7140
tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag 7200
ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt 7260
agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa 7320
gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg 7380
attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga 7440
agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta ccaatgctta 7500
atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt tgcctgactc 7560
cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag tgctgcaatg 7620
ataccgcgag acccacgctc accggctcca gatttatcag caataaacca gccagccgga 7680
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-57-
agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc tattaattgt 7740
tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt tgttgccatt 78'00
gctacaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag. ctccggttcc 7860
caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt tagctccttc 7920
ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat ggttatggca 7980
gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt gactggtgag 8040
tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc ttgcccggcg 8100
tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat cattggaaaa 8160
cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag ttcgatgtaa 8220
cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt ttctgggtga 8280
gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg gaaatgttga 8340
atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta ttgtctcatg 8400
agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc gcgcacattt 8460
ccccgaaaag tgccacctga cgtc 8484
<210> 66
<211> 53
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 66
gtcactcgag gactcggtcg actgaaaatg agacatatta tctgccacgg acc 53
<210> 67
<211> 36
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 67
cgagatcgat cacctccggt acaaggtttg gcatag 36
<210> 68
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 68
catgaagatc tggaaggtgc tgaggtacga tgagacc 37
<210> 69
<211> 51
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 69
gcgacttaag cagtcagctg agacagcaag acacttgctt gatccaaatc c 51
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-S 8-
<210> 70
<211> 38
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 70
cacgaattcg tcagcgcttc tcgtcgcgtc caagaccc 38
<210> 7I
<211> 32
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 71
caccccgggg aggcggcggc gacggggacg gg 32
<210> 72
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: oligonucleotide
<400> 72
atgggatcca agatgaagcg cgcaagaccg 30
<210> 73
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: oligonucleotide
<400> 73
cataacctgc aggattcttt attcttgggc 30
<210> 74
<211> 47
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: oligonucleotide
<900> 74
ggtacacagg aaacaggagg ttccggaggt ggaggagaca caactcc 47
<210> 75
CA 02359795 2001-07-12
WO 00/42208 PCT/EP00/00265
-59-
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<900> 75
atgggatcca agatgaagcg cgcaagaccg 30
<210> 76
<211> 30
<212> DNA.
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 76
cactatagcg gccgcattct cagtcatctt 30
