Note: Descriptions are shown in the official language in which they were submitted.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
HUMAN VANILLOID RECEPTOR GENE
RELATED APPLICATIONS
This application claims priority to U.S. Application Serial Number 09/191,139
filed
November 13, 1998.
TECHNICAL FIELD
The invention relates generally to polynucleotide sequences and polypeptide
sequences
encoded therefrom, more specifically, to vanilloid receptor genes and
polypeptides encoded
therefrom as well as methods which utilize these polypeptides for identifying
compounds which
modulate vanilloid receptors in human tissues.
BACKGROUND OF THE INVENTION
Vanilloid receptors are a class of ligand-gated ion channels defined by the
natural
ligands capsaicin, the active ingredient of hot peppers from plants of the
genus Capsium and
resiniferitoxin (RTX), an ultrapotent capsaicin analog found in the latex of
Euphorbia
resinifera (Holzer, Pharmacol. Rev. 43:143-201 [1991]). These receptors are
involved in a
variety of physiological processes including nociception, inflammation,
regulation of body
temperature, cardiovascular and bronchial systems, reflex bladder function and
gastric
mucosal defense mechanisms (Capsaicin in the study of pain, Wood ed., 1993,
Academic
Press).
The vanilloid receptor has been characterized as a canon permeable ion channel
with
the permeability of di- and mono-valent canons being Ca2+ > Mg2+ > K+ > Na+
(Bevan
and Szolcsanyl, Trends Pharmacol. 11:330-333 [1990]). Activation of neuronal
vanilloid
receptors by capsaicin results in initial excitation resulting in pain
perception while
prolonged exposure results in analgesic effects most likely through a
desensitization process
(Szallasi, Gen. Pharmac. 25:223-243 [1994]). This biphasic response is
characteristic for
the other physiological responses to capsaicin, first described for
thermoregulation in the
hypothalamus (Jancso-Gabor et al., J. Physiol. 208:449-459 [1970]). The rat
vanilloid
receptor VR1 has been cloned (Caterina et al., Nature 389:816-824 [1997]).
Because of capsaicin's role in physiological processes, it would be useful to
identify
compounds, which modulate the activity of a human vanilloid receptor and/or
its analogs.
However, efforts to identify such compounds have been hampered by the lack of
readily
available human vanilloid receptors or cell lines expressing the human
vanilloid receptor
gene for use in screening assays. Although the rat vanilloid receptor is
thought to be
expressed exclusively in sensory neurons, human sensory neuron tissue is
extremely
difficult to obtain. Furthermore, no cell lines have been reported which
endogenously
express the human vanilloid receptor gene. Thus, there is a need for a simple,
easy and cost
effective means to obtain large quantities of human vanilloid receptors and/or
a cell line
which expresses such receptors.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
2
The present invention solves this problem by providing reagents, such as human
vanilloid receptors, polynucleotides (and polymorphic variants thereof) which
encode for
human vanilloid receptors and recombinant expression systems for large-scale
production of
said receptors. The invention also provides methodologies, such as assays, for
identifying
compounds which modulate the activity of human vanilloid receptors. Thus, the
invention
provides high throughput screening assays to identify new vanilloid receptor
ligands for the
treatment of various disease states including neuropathic pain, inflammation,
arthritis,
rhinitis, pruritus, bladder dysfunction, cluster headache, wound healing and
psoriasis.
SUMMARY OF THE INVENTION
The present invention provides an isolated or purified polynucleotide
comprising a
nucleotide sequence which encodes a human vanilloid receptor and fragments or
complements
thereof. Preferably, the nucleotide sequence is SEQ ID NO:1 or fragments
thereof. More
preferably, the nucleotide sequence is SEQ ID NO:I from about nucleotide
position 435 to
about nucleotide position 3050. The invention further provides a
polynucleotide comprising a
nucleotide sequence which encodes a human vanilloid receptor having the
sequence of SEQ ID
N0:3.
In another aspect, the polynucleotide can be produced by recombinant
techniques. A
recombinant molecule comprises a nucleotide sequence that encodes a human
vanilloid receptor
and is contained within an expression vector. The expression vector may be
either a
prokaryotic or a eukaryotic vector. Preferred expression vectors are pCIneo
and pACSG2. In a
more preferred embodiment, the nucleotide sequence which encodes a human
vanilloid receptor
has the sequence SEQ ID NO:1 from about nucleotide position 435 to about
nucleotide position
3050.
The present invention further provides a host cell transformed with said
vector. The
host cell is either a prokaryotic or eukaryotic cell.
The present invention also provides a polypeptide of a human vanilloid
receptor or
fragments thereof. In a preferred embodiment, the polypeptide has the amino
acid sequence
SEQ ID N0:3. The polypeptide can be produced by recombinant technology and
provided in
purified form.
In another aspect, the invention provides a method for producing a polypeptide
which
contains at least one human vanilloid receptor epitope, wherein the method
comprises
incubating host cells transformed with an expression vector comprising a
nucleotide sequence
which encodes a human vanilloid receptor. Preferably, the expression vector
comprises a
nucleotide sequence having the sequence SEQ ID NO:1 and fragments and
complements
thereof. More preferably, the nucleotide sequence has the sequence SEQ ID NO:1
from about
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
nucleotide position 435 to about nucleotide position 3050. Even more
preferably, the
nucleotide sequence encodes a human vanilloid receptor having sequence SEQ ID
N0:3.
In another aspect, the invention provides a method for identifying compounds
that
modulate vanilloid receptor activity, comprising the steps of: (a) providing a
host cell that
S expresses the vanilloid receptor polypeptide; (b) mixing a test compound
with the cell; and (c)
measuring either (i) the effect of the test compound on the cell expressing
the receptor, or (ii)
the binding of the test compound to the cell or to the receptor. The host cell
of the method is
either a prokaryotic or eukaryotic cell. Preferably in the method, the
measurement of step
(c)(ii) is performed by measuring a signal generated by a signal-generating
compound or by
measuring a signal generated by a radiolabeled ion, a fluorescent probe or an
electrical current.
In yet another aspect, the invention provides a method for identifying a
cytoprotective
compound, comprising the steps of: (a) providing a cell that expresses a
vanilloid receptor
polypeptide or fragment thereof; (b) combining a test compound with the cell;
and (c)
monitoring the cell or cellular function for an indication of cytotoxicity.
The host cell of the
method is either a prokaryotic or eukaryotic cell. Preferably, the method
comprises providing a
cell which has an expression vector comprising a polynucleotide having the
nucleotide
sequence SEQ ID NO:1 from about nucleotide position 435 to about nucleotide
position 3050
operably linked to control sequences that direct the transcription of the
polynucleotide whereby
the polynucleotide is expressed in a host cell. More preferably, one of the
control sequences
comprises an inducible promotor . Even more preferably, the cell is maintained
in the presence
of a substance which minimizes or blocks a cytotoxic effect on the cell.
In yet another aspect, the invention provides a method of treating an
individual having a
condition associated with vanilloid receptor modulation, comprising
administering to the
individual an effective amount of a compound that controls the gene expression
of vanilloid
receptor, in a pharmaceutically acceptable excipient.
In yet another embodiment, the invention provides a monoclonal antibody or a
polyclonal antibody which specifically binds to human vanilloid receptor
having amino acid
sequence SEQ ID N0:3 or fragments thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 shows the alignment (default parameters of the FRAMEALIGN Program,
Wisconsin Sequence Analysis Package, Version 9, Genetics Computer Group,
Madison, WI)
between the consensus sequence (upper line) of the overlapping human Incyte
ESTs 1427917
(nt 1-227) and 3460342 (nt 32-270) with the corresponding amino acid sequence
of the rat
vanilloid receptor (bottom line, Caterina et al., 1997, supra). In this
Figure, the upper line
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
4
corresponds to nucleotides 1696-1966 of SEQ ID N0:7. The bottom line
corresponds to amino
acid residues 500-589 of SEQ ID N0:4.
FIG. 2 shows the alignment (default parameters of the GAP Program, Wisconsin
Sequence Analysis Package, Version 9, Genetics Computer Group, Madison, WI)
between
cDNA sequences of the human vanilloid receptor (hVRI, top line, SEQ ID N0:7)
and rat
vanilloid receptor 1 (rVRI, bottom line, SEQ ID N0:2, Catering et al., 1997,
supra). Vertical
lines between the two sequences indicate identical nucleotides at those
positions. Methionine
initiation codons (ATG) and stop codons (TGA in top strand and TAA in bottom
strand) are
boxed. The DNA sequence identity of the rat cDNA from nucleotides (nt) 44-2730
and the
human cDNA from nt 163-2874 is 82%.
FIG. 3 shows the multiple alignment (default parameters of the Pileup and
Pretty
Programs, Wisconsin Sequence Analysis Package, Version 10, Genetics Computer
Group,
Madison, WI) of the amino acid sequences of the hVRI (SEQ ID N0:8), rVHI (SEQ
ID N0:4,
Catering et al., 1997, supra), human vanilloid receptor-like protein (hVR2,
Catering et al.,
Nature 398:436-441 1999, SEQ ID NO:15) and human vanilloid receptor 3 (hVR3,
SEQ ID
N0:3). The consensus sequence identifies any identical amino acid position
shared by these 4
proteins. Boxed regions indicate the ankaryn repeats (position 239-270, 294-
317 and 370-403),
potential transmembrane domains (positions 471-493, 519-540, 555-574, 579-597,
621-640 and
703-730) and the poor-loop region (position 671-691).
FIG. 4 shows the polymorphic regions of the human vanilloid receptor
determined by
direct sequencing of the PCR product of human small intestine RNA. The
SequencherTM
chromatogram tracings (SequencherTM Version 3.0, Gene Codes Corp., Ann Arbor,
MI) are
shown with arrows identifying the double peaks consistent with polymorphic
positions. Nt
position 1605 contains either a C or a T while nt position 1952 contains an A
or a G.
FIG. 5 shows the GAP analysis of hVRI (bottom sequence, positions 301-3410 of
SEQ
ID N0:7) and hVR3 (top sequence, positions 1-3055 of SEQ ID NO:1) DNA
sequences.
FIG. 6 shows the GAP analysis of the derived amino acid sequences of hVRI
(bottom
sequence) and hVR3 (top sequence), SEQ ID NOs:8 and 3 respectively.
FIG. 7 shows a graphical representation of expression of hVRl and hVR3 by
quantitative RT-PCR (ABI Prism 7700) of total RNA isolated from human adrenal
gland (lane
1), brain (lane 2), cerebellum (lane 3), fetal brain (lane 4), fetal liver
(lane 5), heart (lane 6),
kidney (lane 7), liver (lane 8), lung (lane 9), mammary gland (lane 10),
pancreas (lane 11),
placenta (lane 12), prostate (lane 13), salivary gland (lane 14), skeletal
muscle (lane 15), small
intestine (lane 16), spleen (lane 17), stomach (lane 18), testes (lane 19),
thymus (lane 20),
trachea (lane 21), uterus (lane 22), DRG (lane 23), bladder (lane 24) and
HEK293 cells (lane
25) using primers specific for hVRl and hVR3. The hatched bars represent
samples from an
additional experiment.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
FIG. 8 shows the nucleotide sequence (SEQ ID NO:1 ) of human vanilloid
receptor 3
and deduced amino acid sequence (SEQ ID N0:3).
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides isolated and purified polynucleotides that
encode a
human vanilloid receptor, fragments thereof, expression vectors containing
those
polynucleotides, host cells transformed with those expression vectors, a
process for making a
human vanilloid receptor using those polynucleotides and vectors, and isolated
and purified
recombinant human vanilloid receptor and polypeptide fragments thereof.
Portions of the nucleic acid sequences disclosed herein are useful as primers
for the
reverse transcription of RNA or for the amplification of cDNA; or as probes to
determine the
presence of certain cDNA sequences in test samples. Also disclosed are nucleic
acid sequences
which permit the production of encoded polypeptide sequences which are useful
as standards or
reagents in diagnostic immunoassays, targets for pharmaceutical screening
assays and/or as
components or target sites for various therapies. Isolation of sequences from
cther portions of
the vanilloid receptor gene can be accomplished by utilizing probes or PCR
primers derived
from these nucleic acid sequences, thus allowing additional probes and
polypeptides of the
genome of interest to be established.
The present invention also provides methods for assaying a test sample for
products of a
human vanilloid receptor gene, which comprises making cDNA from mRNA in the
test sample,
and detecting the cDNA as an indication of the presence of a human vanilloid
receptor gene.
The method may include an amplification step, wherein portions of the cDNA
corresponding to
the gene or fragment thereof is amplified. Methods also are provided for
assaying for the
translation products of mRNAs. Test samples which may be assayed by the
methods provided
herein include tissues, cells, body fluids and secretions. The present
invention also provides
reagents such as oligonucleotide primers and polypeptides which are useful in
performing these
methods. For example, the invention provides monoclonal and polyclonal
antibodies directed
against at least one epitope contained within the polypeptide sequences of the
invention which
are useful for diagnostic tests and for screening for diseases or conditions
associated with
abnormal vanilloid receptor production.
Although the physiological manifestations of abnormal vanilloid receptor
expression are
as yet unknown in humans or other mammals, we postulate that the vanilloid
receptor may play
a pathological role resulting from its abnormal expression. For example,
Caterina et al. have
shown that HEK293 cells transfected with the vanilloid receptor are killed
within several hours
of continuous exposure to capsaicin. Therefore, it is reasonable to postulate
that the presence of
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
6
vanilloid receptor in certain body fluids where it is not normally found may
be indicative of a
disease state, the further progression of which could be monitored by assaying
for vanilloid
receptor in such fluids. A similar role is seen for myelin basic protein (MBP)
which in the
normal physiological state is a membrane bound protein and therefore not found
in body fluids,
but in disease states such as multiple sclerosis, it is released into cerebral
spinal fluid.
Furthermore, the presence of a polynucleotide or fragment thereof which
encodes vanilloid
receptor in tissues or body fluids where it is unexpected, may also be
indicative of a disease
condition, in the case, for example, where the disease was manifest by
cellular degeneration.
Thus, the reagents and methods described herein may enable the identification
of certain
markers as indicative of abnormal vanilloid receptor expression and the
information obtained
therefrom may aid in the diagnosis, staging, monitoring, prognosis and/or
therapy of diseases or
conditions which may be associated with such expression. Test methods include,
for example,
probe assays which utilize the sequences) provided herein and which also may
utilize nucleic
acid amplification methods such as the polymerase chain reaction (PCR), the
ligase chain
reaction (LCR); and hybridization. In addition, the nucleotide sequences
provided herein
contain open reading frames from which an immunogenic epitope may be found.
Preferably,
such an epitope is unique to the disease state or condition associated with
the vanilloid receptor
gene. The uniqueness of the epitope may be determined by its immunological
reactivity with
the polypeptide product encoded by such gene, and lack of immunological
reactivity with
tissues) from non-diseased patients. Methods for determining immunological
reactivity are
well-known and include but are not limited to, for example, radioimmunoassay
(RIA), enzyme-
linked immunosorbent assay (ELISA), hemagglutination (HA), fluorescence
polarization
immunoassay (FPIA); chemiluminescent immunoassay (CLIA), and others; several
examples
of suitable methods are described herein.
Definitions
All patents, patent applications and publications cited herein, whether supra
or
infra, are hereby incorporated by reference in their entirety.
As used in this specification and the appended claims, the singular forms " a"
, " an" ,
and "the" include plural references unless the content clearly dictates
otherwise.
Unless otherwise stated, the following terms shall have the following
meanings:
"Purified product" refers to a preparation of the product, which has been
isolated from
the cellular constituents with which the product is normally associated, and
from other types of
cells, which may be present in the sample of interest.
The term "isolated" means that the material is removed from its original
environment
(e.g., the natural environment if it is naturally occurring). For example, a
naturally occurring
polynucleotide or polypeptide present in a living animal is not isolated, but
the same
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
7
polynucleotide or DNA or polypeptide, which is separated from some or all of
the coexisting
materials in the natural system, is isolated. Such a polynucleotide could be
part of a vector
and/or such a polynucleotide or polypeptide could be part of a composition,
and still be isolated
in that the vector or composition is not part of its natural environment.
The term "polynucleotide" as used herein means a polymeric form of nucleotides
of any
length, either ribonucleotides or deoxyribonucleotides. This term refers only
to the primary
structure of the molecule. Thus, the term includes double- and single-stranded
DNA, as well
as, double- and single-stranded RNA. It also includes modifications, such as
methylation or
capping, and unmodified forms of the polynucleotide.
A "vanilloid receptor variant" refers to an isolated vanilloid receptor
polynucleotide
sequence having at least 83%, more preferably, at least 90% and even more
preferably, at least
95% global sequence identity over a length of a vanilloid receptor
polynucleotide, to vanilloid
receptor polynucleotides disclosed herein. "Percent identity" is determined
using the default
parameters of the GAP program, Wisconsin Sequence Analysis Package, Version 9,
Genetics
1 S Computer Group, Madison, WI).
A "polynucleotide fragment derived from" a designated sequence refers to a
polynucleotide sequence which is comprised of a sequence of approximately at
least about 6
nucleotides, is preferably at least about 8 nucleotides, is more preferably at
least about 10, is
more preferably at least about 12 nucleotides, is more preferably at least
about 15 and even
more preferably is at least about 20 nucleotides corresponding, i.e.,
identical to or
complementary to, a region of the designated nucleotide sequence. The sequence
may be
complementary to or identical to a sequence which is unique to a particular
polynucleotide
sequence as determined by techniques known in the art. Comparisons to
sequences in
databanks, for example, can be used as a method to surmise the uniqueness of a
designated
sequence. Regions from which sequences may be derived include but are not
limited to regions
encoding specific epitopes, as well as non-translated and/or non-transcribed
regions.
The derived polynucleotide will not necessarily be derived physically from the
nucleotide sequence of interest under study, but may be generated in any
manner, including but
not limited to chemical synthesis, replication, reverse transcription or
transcription, which is
based on the information provided by the sequence of bases in the regions)
from which the
polynucleotide is derived; as such, it may represent either a sense or an
antisense orientation of
the original polynucleotide. In addition, combinations of regions
corresponding to that of the
designated sequence may be modified in ways known in the art to be consistent
with an
intended use.
When referring to a nucleic acid fragment, such a fragment is considered to
"selectively hybridize" or to "selectively bind" to a polynucleotide or
variants thereof
disclosed herein, if, within the linear range of detection, the hybridization
results in a
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
stronger signal relative to the signal that results from hybridization of the
fragment to an
equal amount of a second polynucleotide. A signal which is "stronger" than
another is one
which is measurable over the other by the particular method of detection.
Methods for
hybridizing and detecting polynucleotides are well known to those of ordinary
skill in the
art.
Also, when referring to a nucleic acid fragment, such a fragment is considered
to
hybridize under selective hybridization conditions if it selectively
hybridizes under (i)
typical hybridization and wash conditions, such as those described, for
example, in
Sambrook, et al., Molecular Cloning: A Laboratory Manual, second edition,
(1989), Cold
Spring Harbor, N.Y. and Nucleic Acid Hybridization: A Practical Approach,
editors B.D.
Hames and S.J. Higgins, (1985) Oxford; Washington D.C.; IRL Press), where
preferred
hybridization conditions are those of lesser stringency and more preferred,
higher
stringency; or (ii) standard PCR conditions (Saiki, R.K. et al. (1988)
Science. 239:487-491)
or "touch-down" PCR conditions (Roux, K.H., (1994), Biotechiques, 16:812-814).
"A sequence corresponding to a cDNA" means that the sequence contains a
polynucleotide sequence that is identical to or complementary to a sequence in
the designated
DNA. The degree (or "percent") of identity or complementarity to the cDNA will
be
approximately 50% or greater, will preferably be at least about 70% or
greater, and more
preferably will be at least about 90% or greater. The sequence that
corresponds will be at least
about 50 nucleotides in length, will preferably be about 60 nucleotides in
length, and more
preferably, will be at least about 70 nucleotides in length. The
correspondence between the
gene or gene fragment of interest and the cDNA can be determined by methods
known in the
art, and include, for example, a direct comparison of the sequenced material
with the cDNAs
described, or hybridization and digestion with single strand nucleases,
followed by size
determination of the digested fragments.
"Purified polynucleotide" refers to a polynucleotide of interest or fragment
thereof
which is essentially free, i.e., contains less than about 50%, preferably less
than about 70%, and
more preferably, less than about 90% of the protein with which the
polynucleotide is naturally
associated. Techniques for purifying polynucleotides of interest are well-
known in the art and
include, for example, disruption of the cell containing the polynucleotide
with a chaotropic
agent and separation of the polynucleotide(s) and proteins by ion-exchange
chromatography,
affinity chromatography and sedimentation according to density. Thus,
"purified polypeptide"
means a polypeptide of interest or fragment thereof which is essentially free,
that is, contains
less than about 50%, preferably less than about 70%, and more preferably, less
than about 90%
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
9
of cellular components with which the polypeptide of interest is naturally
associated. Methods
for purifying are known in the art.
The term "probe" denotes a defined nucleic acid segment (or nucleotide analog
segment, i.e., peptide nucleic acid analog (PNA) or morpholino analog (MA)
which can be used
to identify specific DNA or RNA present in samples bearing the complementary
sequence.
The term "primer" denotes a specific oligonucleotide sequence complementary to
a
target nucleotide sequence and used to hybridize to the target nucleotide
sequence and serve as
an initiation point for nucleotide polymerization catalyzed by either DNA
polymerase or
reverse transcriptase.
"Polypeptide" as used herein indicates a molecular chain of amino acids and
does not
refer to a specific length of the product. Thus, peptides, oligopeptides and
proteins are included
within the definition of polypeptide. This term, however, is not intended to
refer to post-
expression modifications of the polypeptide, for example, glycosylations,
acetylations,
phosphorylations and the like.
A "recombinant polypeptide" as used herein means at least a polypeptide which
by
virtue of its origin or manipulation is not associated with all or a portion
of the polypeptide with
which it is associated in nature and/or is linked to a polypeptide other than
that to which it is
linked in nature. A recombinant or derived polypeptide is not necessarily
translated from a
designated nucleic acid sequence. It also may be generated in any manner,
including chemical
synthesis or expression of a recombinant expression system.
The term "synthetic peptide" as used herein means a polymeric form of amino
acids of
any length, which may be chemically synthesized by methods well-known to those
of ordinary
skill in the art. These synthetic peptides are useful in various applications.
A vanilloid receptor polypeptide, as used herein, refers to polypeptide having
at least
87%, more preferably at least 90%, and even more preferably at least 95%
global sequence
identity over a length of a vanilloid receptor polypeptide, to vanilloid
receptor polypeptides
disclosed herein. A most preferred vanilloid receptor polypeptide is SEQ ID
N0:3. Two other
preferred vanilloid receptor polypeptides have essentially identical sequences
to SEQ ID N0:3
with the exception that in one preferred polypeptide, at residue 469,
threonine is replaced by
isoleucine and in the second preferred polypeptide, at residue 586, isoleucine
is replaced with
valine.
A "polypeptide or amino acid sequence derived from" a designated nucleic acid
sequence refers to a polypeptide having an amino acid sequence identical to
that of a
polypeptide encoded in the sequence or a portion thereof wherein the portion
consists of at least
3 to 5 amino acids, and more preferably at least 8 to 10 amino acids, and even
more preferably
15 to 20 amino acids, or which is immunologically identifiable with a
polypeptide encoded in
the sequence.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
As used herein, the term "identity" refers to an exact nucleotide to
nucleotide or amino
acid to amino acid correspondence of two polynucleotides or polypeptide
sequences,
respectively. The term "similarity" means the exact amino acid to amino acid
comparison of
two or more polypeptides at the appropriate place, where amino acids are
identical or possess
5 similar chemical and/or physical properties such as charge or
hydrophobicity. A so-termed
"percent similarity" can be determined between the compared polypeptide
sequences. Further,
the polypeptide or amino acid sequence may preferably have at least 90%
similarity, more
preferably about 95% similarity and most preferably about 98% similarity to a
polypeptide or
amino acid sequence of a human vanilloid receptor.
10 The percent identity of two sequences, whether nucleic acid or peptide
sequences, is the
number of exact matches between two aligned sequences divided by the length of
the shorter
sequences and multiplied by 100. An approximate alignment for nucleic acid
sequences is
provided by the local homology algorithm of Smith and Waterman, Advances in
Applied
Mathematics 2:482-489 (1981). This algorithm can be extended to use with
peptide sequences
using the scoring matrix developed by Schwartz, R.M., and Dayhoff, M.O.
Matrices for
detecting distant relationships, (in) Atlas of Protein Sequence and Structure,
5 supp1.3:353-358,
(Nat. Biomed. Res. Found., Washington D.C.), 1978. and normalized by Gribskov,
Nucl. Acids
Res. 14(6):6745-6763 (1986). An implementation of this algorithm for nucleic
acid and
peptide sequences is provided by the Genetics Computer Group (Madison, WI) in
their GAP
utility application. The default parameters for this method are described in
the Wisconsin
Sequence analysis Package, Program Manual, Version 9 (available from Genetics
Computer
Group, Madison, WI). Other equally suitable programs for calculating the
percent identity or
similarity between sequences are generally known in the art.
Other techniques for determining nucleic acid and amino acid sequence identity
also are
well known in the art and include determining the nucleotide sequence of the
mRNA for that
gene (usually via a cDNA intermediate) and determining the amino acid sequence
encoded
therein, and comparing this to a second amino acid sequence.
"Recombinant host cells " "host cells " "cells " "cell lines " "cell cultures
" and other
> > > > >
such terms denoting microorganisms or higher eukaryotic cell lines cultured as
unicellular
entities refer to cells which can be, or have been, used as recipients for
recombinant vector or
other transferred DNA, and include the original progeny of the original cell
which has been
transfected.
As used herein "replicon" means any genetic element, such as a plasmid, a
chromosome
or a virus, that behaves as an autonomous unit of polynucleotide replication
within a cell.
A "vector" is a replicon in which another polynucleotide segment is attached,
such as to
bring about the replication and/or expression of the attached segment.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
11
The term "control sequence" refers to polynucleotide sequences which are
necessary to
effect the expression of coding sequences to which they are ligated. The
nature of such control
sequences differs depending upon the host organism. In prokaryotes, such
control sequences
generally include promoter, ribosomal binding site and terminators; in
eukaryotes, such control
S sequences generally include promoters, terminators and, in some instances,
enhancers. The
term "control sequence" thus is intended to include at a minimum all
components whose
presence is necessary for expression, and also may include additional
components whose
presence is advantageous, for example, leader sequences.
"Operably linked" refers to a situation wherein the components described are
in a
relationship permitting them to function in their intended manner. Thus, for
example, a control
sequence "operably linked" to a coding sequence is ligated in such a manner
that expression of
the coding sequence is achieved under conditions compatible with the control
sequences.
The term "open reading frame" or "ORF" refers to a region of a polynucleotide
sequence which encodes a polypeptide; this region may represent a portion of a
coding
sequence or a total coding sequence.
A "coding sequence" is a polynucleotide sequence which is transcribed into
mRNA and
translated into a polypeptide when placed under the control of appropriate
regulatory
sequences. The boundaries of the coding sequence are determined by a
translation start codon
at the 5' -terminus and a translation stop codon at the 3' -terminus. A coding
sequence can
include, but is not limited to, mRNA, cDNA, and recombinant polynucleotide
sequences.
The term "sense strand" or "plus strand" (or "+") as used herein denotes a
nucleic acid
that contains the sequence that encodes the polypeptide. The term "antisense
strand" or
"minus strand" (or "-") denotes a nucleic acid that contains a sequence that
is complementary
to that of the "plus" strand.
An "Expressed Sequence Tag" or "EST" refers to the partial sequence of a cDNA
insert which has been made by reverse transcription of mRNA extracted from a
tissue, followed
by insertion into a vector.
A "transcript image" refers to a table or list giving the quantitative
distribution of ESTs
in a library and represents the genes active in the tissue from which the
library was made.
The term "immunologically identifiable with/as" refers to the presence of
epitope(s) and
polypeptide(s) which also are present in and are unique to the designated
polypeptide(s).
Immunological identity may be determined by antibody binding and/or
competition in binding.
These techniques are known to those of ordinary skill in the art and also are
described herein.
The uniqueness of an epitope also can be surmised by computer searches of
known data banks,
such as GenBank, for the polynucleotide sequences which encode the epitope,
and by amino
acid sequence comparisons with other known proteins.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
12
As used herein, "epitope" means an antigenic determinant of a polypeptide.
Conceivably, an epitope can comprise three amino acids in a spatial
conformation which is
unique to the epitope. Generally, an epitope consists of at least five such
amino acids, and
more usually, it consists of at least eight to ten amino acids. Methods of
examining spatial
conformation are known in the art and include, for example, x-ray
crystallography and two-
dimensional nuclear magnetic resonance.
A "conformational epitope" is an epitope that is comprised of specific
juxtaposition of
amino acids in an immunologically recognizable structure, such amino acids
being present on
the same polypeptide in a contiguous or non-contiguous order or present on
different
polypeptides.
A polypeptide is "immunologically reactive" with an antibody when it binds to
an
antibody due to antibody recognition of a specific epitope contained within
the polypeptide.
Immunological reactivity may be determined by antibody binding, more
particularly by the
kinetics of antibody binding, and/or by competition in binding using as
competitors) a known
polypeptide(s) containing an epitope against which the antibody is directed.
The methods for
determining whether a polypeptide is immunologically reactive with an antibody
are known in
the art.
As used herein, the term "immunogenic polypeptide containing an epitope of
interest"
means naturally occurring polypeptides of interest or fragments thereof, as
well as polypeptides
prepared by other means, for example, by chemical synthesis or the expression
of the
polypeptide in a recombinant organism.
The terms "transformation" refers to the insertion of an exogenous
polynucleotide into a
prokaryotic or yeast host cell, irrespective of the method used for the
insertion. Generally, the
term "transfection" is used with respect to insertion of an exogenous
polynucleotide into a
eukaryotic host cell. The processes for achieving transformation and/or
transfection are well
known to those of ordinary skill in the art and include such techniques as
direct uptake,
transduction, f mating and electroporation. The exogenous polynucleotide may
be maintained
as a non-integrated vector, for example, a plasmid, or alternatively, may be
integrated into the
host genome.
"Treatment" refers to prophylaxis and/or therapy.
The term "individual" as used herein refers to vertebrates, particularly
members of the
mammalian species and includes but is not limited to domestic animals, sports
animals,
primates and humans; more particularly the term refers to humans.
The term "test sample" refers to a component of an individual's body which is
the
source of the analyte (also referred to "target" or "marker" ). These
components include
antibodies and antigens and are well known in the art. These test samples
include biological
samples which can be tested by the methods of the present invention described
herein and
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
13
include human and animal body fluids such as whole blood, serum, plasma,
cerebrospinal fluid,
urine, lymph fluids, and various external secretions of the respiratory,
intestinal and genitor-
urinary tracts, tears, saliva, milk, white blood cells, myelomas and the like;
biological fluids
such as cell culture supernatants; fixed tissue specimens; and fixed cell
specimens.
"PNA" denotes a "peptide nucleic acid analog" which may be utilized in a
procedure
such as an assay described herein to determine the presence of a target. "MA"
denotes a
"morpholino analog" which may be utilized in a procedure such as an assay
described herein to
determine the presence of a target. See, for example, U.S. Patent No.
5,378,841, which is
incorporated herein by reference. PNAs are neutrally charged moieties which
can be directed
against RNA targets or DNA. PNA probes used in assays in place of, for
example, the DNA
probes of the present invention, offer advantages not achievable when DNA
probes are used.
These advantages include manufacturability, large scale labeling,
reproducibility, stability,
insensitivity to changes in ionic strength and resistance to enzymatic
degradation which is
present in methods utilizing DNA or RNA. These PNAs can be labeled with such
signal
generating compounds as fluorescein, radionucleotides, chemiluminescent
compounds, and the
like. PNAs or other nucleic acid analogs such as MAs thus can be used in assay
methods in
place of DNA or RNA. Although assays are described herein utilizing DNA
probes, it is within
the scope of the routineer that PNAs or MAs can be substituted for RNA or DNA
with
appropriate changes if and as needed in assay reagents.
"Analyte," as used herein, is the substance to be detected which may be
present in the
test sample. The analyte can be any substance for which there exists a
naturally occurring
specific binding member (such as, an antibody), or for which a specific
binding member can be
prepared. Thus, an analyte is a substance that can bind to one or more
specific binding
members in an assay. "Analyte" also includes any antigenic substances,
haptens, antibodies,
and combinations thereof. As a member of a specific binding pair, the analyte
can be detected
by means of naturally occurring specific binding partners (pairs) such as the
use of intrinsic
factor protein as a member of a specific binding pair for the determination of
Vitamin B 12, the
use of folate-binding protein to determine folic acid, or the use of a lectin
as a member of a
specific binding pair for the determination of a carbohydrate. The analyte can
include a protein,
a peptide, an amino acid, a nucleotide target, and the like.
The present invention provides assays which utilize specific binding members.
A
"specific binding member," as used herein, is a member of a specific binding
pair. That is, two
different molecules where one of the molecules through chemical or physical
means
specifically binds to the second molecule. Therefore, in addition to antigen
and antibody
specific binding pairs of common immunoassays, other specific binding pairs
can include biotin
and avidin, carbohydrates and lectins, complementary nucleotide sequences,
effector and
receptor molecules, cofactors and enzymes, enzyme inhibitors and enzymes, and
the like.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
14
Furthermore, specific binding pairs can include members that are analogs of
the original
specific binding members, for example, an analyte-analog. Immunoreactive
specific binding
members include antigens, antigen fragments, antibodies and antibody
fragments, both
monoclonal and polyclonal, and complexes thereof, including those formed by
recombinant
DNA molecules.
The term "hapten," as used herein, refers to a partial antigen or non-protein
binding
member which is capable of binding to an antibody, but which is not capable of
eliciting
antibody formation unless coupled to a carrier protein.
A "capture reagent," as used herein, refers to an unlabeled specific binding
member
which is specific either for the analyte as in a sandwich assay, for the
indicator reagent or
analyte as in a competitive assay, or for an ancillary specific binding
member, which itself is
specific for the analyte, as in an indirect assay. The capture reagent can be
directly or indirectly
bound to a solid phase material before the performance of the assay or during
the performance
of the assay, thereby enabling the separation of immobilized complexes from
the test sample.
The "indicator reagent" comprises a "signal-generating compound" (" label" )
which is
capable of generating and generates a measurable signal detectable by external
means,
conjugated (" attached" ) to a specific binding member. The indicator reagent
can be a member
of any specific binding pair including hapten-anti-hapten systems such as
biotin or anti-biotin,
avidin or biotin, a carbohydrate or a lectin, a complementary nucleotide
sequence, an effector or
a receptor molecule, an enzyme cofactor and an enzyme, an enzyme inhibitor or
an enzyme,
and the like. An immunoreactive specific binding member can be an antibody, an
antigen, or
an antibody/antigen complex that is capable of binding either to polypeptide
of interest as in a
sandwich assay, to the capture reagent as in a competitive assay, or to the
ancillary specific
binding member as in an indirect assay. When describing probes and probe
assays, the term
"reporter molecule" may be used. A reporter molecule comprises a signal
generating
compound as described hereinabove conjugated to a specific binding member of a
specific
binding pair, such as carbazol or adamantane.
The various "signal-generating compounds" (labels) contemplated include
chromogens,
catalysts such as enzymes, luminescent compounds such as fluorescein and
rhodamine,
chemiluminescent compounds such as dioxetanes, acridiniums, phenanthridiniums
and luminol,
radioactive elements, and direct visual labels. Examples of enzymes include
alkaline
phosphatase, horseradish peroxidase, beta-galactosidase, and the like. The
selection of a
particular label is not critical, but it will be capable of producing a signal
either by itself or in
conjunction with one or more additional substances.
"Solid phases" ("solid supports") are known to those in the art and include
the walls of
wells of a reaction tray, test tubes, polystyrene beads, magnetic beads,
nitrocellulose strips,
membranes, microparticles such as latex particles, sheep (or other animal) red
blood cells, and
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
Duracytes~ (red blood cells "fixed" by pyruvic aldehyde and formaldehyde,
available from
Abbott Laboratories, Abbott Park, IL) and others. The "solid phase" is not
critical and can be
selected by one skilled in the art. Thus, latex particles, microparticles,
magnetic or non-
magnetic beads, membranes, plastic tubes, walls of microtiter wells, glass or
silicon chips,
5 sheep (or other suitable animal's) red blood cells and Duracytes~ are all
suitable examples.
Suitable methods for immobilizing peptides on solid phases include ionic,
hydrophobic,
covalent interactions and the like. A "solid phase", as used herein, refers to
any material which
is insoluble, or can be made insoluble by a subsequent reaction. The solid
phase can be chosen
for its intrinsic ability to attract and immobilize the capture reagent.
Alternatively, the solid
10 phase can retain an additional receptor which has the ability to attract
and immobilize the
capture reagent. The additional receptor can include a charged substance that
is oppositely
charged with respect to the capture reagent itself or to a charged substance
conjugated to the
capture reagent. As yet another alternative, the receptor molecule can be any
specific binding
member which is immobilized upon (attached to) the solid phase and which has
the ability to
15 immobilize the capture reagent through a specific binding reaction. The
receptor molecule
enables the indirect binding of the capture reagent to a solid phase material
before the
performance of the assay or during the performance of the assay. The solid
phase thus can be a
plastic, derivatized plastic, magnetic or non-magnetic metal, glass or silicon
surface of a test
tube, microtiter well, sheet, bead, microparticle, chip, sheep (or other
suitable animal's) red
blood cells, Duracytes~ and other configurations known to those of ordinary
skill in the art.
It is contemplated and within the scope of the present invention that the
solid phase also
can comprise any suitable porous material with sufficient porosity to allow
access by detection
antibodies and a suitable surface affinity to bind antigens. Microporous
structure generally are
preferred, but materials with gel structure in the hydrated state may be used
as well. Such
useful solid supports include but are not limited to nitrocellulose and nylon.
It is contemplated
that such porous solid supports described herein preferably are in the form of
sheets of
thickness from about 0.01 to 0.5 mm, preferably about O.lmm. The pore size may
vary within
wide limits, and preferably is from about 0.025 to 15 microns, especially from
about 0.15 to 15
microns. The surface of such supports may be activated by chemical processes
which cause
covalent linkage of the antigen or antibody to the support. The irreversible
binding of the
antigen or antibody is obtained, however, in general, by adsorption on the
porous material by
poorly understood hydrophobic forces. Other suitable solid supports are known
in the art.
Reagents
The present invention provides reagents such as polynucleotide sequences
derived from
a human vanilloid receptor gene, polypeptides encoded therein, and antibodies
produced from
these polypeptides. The present invention also provides reagents such as
oligonucleotide
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
16
fragments derived from the disclosed polynucleotides and nucleic acid
sequences
complementary to these polynucleotides. For example, selected vanilloid
receptor-derived
polynucleotides can be used in the methods described herein for the detection
of normal or
altered gene expression.
The present invention also provides methods, in particular, recombinant
methodologies
using polynucleotide sequences disclosed herein, for making human vanilloid
receptors in high
yield as well as methods to identify compounds which modulate (i.e. activate
or repress) the
activity of such receptors. The polypeptides and polynucleotides of the
present invention are
preferably provided in an isolated form, and preferably purified.
Furthermore, the polynucleotides disclosed herein, their complementary
sequences or
fragments of either can be used in assays to detect, amplify or quantify
genes, cDNAs or
mRNAs encoding human vanilloid receptor. They also can be used to identify an
entire or
partial coding region which encodes for a vanilloid receptor polypeptide. They
further can be
provided in individual containers in the form of a kit for assays, or provided
as individual
compositions. If provided in a kit for assays, other suitable reagents such as
buffers, conjugates
and the like may be included.
The polynucleotide(s) may be in the form of mRNA or DNA. Polynucleotides in
the
form of DNA, cDNA, genomic DNA, and synthetic DNA are within the scope of the
present
invention. The DNA may be double-stranded or single-stranded, and if single
stranded may be
the coding (sense) strand or non-coding (antisense) strand. The coding
sequence which
encodes the polypeptide may be identical to the coding sequence provided
herein or may be a
different coding sequence which coding sequence, as a result of the redundancy
or degeneracy
of the genetic code, encodes the same polypeptide as the DNA provided herein.
This polynucleotide may include only the coding sequence for the polypeptide,
or the
coding sequence for the polypeptide and additional coding sequence such as a
leader or
secretory sequence or a proprotein sequence, or the coding sequence for the
polypeptide (and
optionally additional coding sequence) and non-coding sequence, such as a non-
coding
sequence 5' and/or 3' of the coding sequence for the polypeptide.
In addition, the invention includes variant polynucleotides containing
modifications
such as polynucleotide deletions, substitutions or additions; and any
polypeptide modification
resulting from the variant polynucleotide sequence. A polynucleotide of the
present invention
also may have a coding sequence which is a naturally occurring allelic variant
of the coding
sequence provided herein.
In addition, the coding sequence for the polypeptide may be fused in the same
reading
frame to a polynucleotide sequence which aids in expression and secretion of a
polypeptide
from a host cell, for example, a leader sequence which functions as a
secretory sequence for
controlling transport of a polypeptide from the cell. The polypeptide having a
leader sequence
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
17
is a preprotein and may have the leader sequence cleaved by the host cell to
form the form of
the polypeptide. The polynucleotides may also encode for a proprotein which is
the protein
plus additional 5' amino acid residues. A protein having a prosequence is a
proprotein and may
in some cases be an inactive form of the protein. Once the prosequence is
cleaved an active
protein remains. Thus, the polynucleotide of the present invention may encode
for a protein, or
for a protein having a prosequence or for a protein having both a presequence
(leader sequence)
and a prosequence.
The polynucleotides of the present invention may also have the coding sequence
fused
in frame to a marker sequence which allows for purification of the polypeptide
of the present
invention. The marker sequence may be a hexa-histidine tag supplied by a
pProExl (Life
Technologies, Gaithersburg, MD) vector to provide for purification of the
polypeptide fused to
the marker in the case of a bacterial host, or, for example, the marker
sequence may be a
hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The
HA tag
corresponds to an epitope derived from the influenza hemagglutinin protein.
See, for example,
I. Wilson, et al., Cell 37:767 (1984).
It is contemplated that polynucleotides which encode a human vanilloid
receptor will be
considered to hybridize to the sequences provided herein if there is at least
60%, more
-preferably at least 70% and even more preferably at least 80%, identity
between the
polynucleotide and the sequence.
The present invention further provides human vanilloid receptor polypeptides
which
have the deduced amino acid sequences as provided herein, as well as
fragments, analogs and
derivatives of such polypeptides. The polypeptides of the present invention
may be
recombinant polypeptides, natural purified polypeptides or synthetic
polypeptides. The
polypeptides, fragments, derivatives or analogs of the human vanilloid
receptor may be those in
which one or more of the amino acid residues is substituted with a conserved
or non-conserved
amino acid residue (preferably a conserved amino acid residue) and such
substituted amino acid
residue may or may not be one encoded by the genetic code; or it may be one in
which one or
more of the amino acid residues includes a substituent group; or it may be one
in which the
polypeptide is fused with another compound, such as a compound to increase the
half life of the
polypeptide (for example, polyethylene glycol); or it may be one in which the
additional amino
acids are fused to the polypeptide, such as a leader or secretory sequence or
a sequence which is
employed for purification of the polypeptide or a proprotein sequence.
Thus, a polypeptide of the present invention may have an amino acid sequence
that is
identical to that of the naturally occurring polypeptide or that is different
by minor variations
due to one or more amino acid substitutions. The variation may be a
"conservative change"
typically in the range of about 1 to 5 amino acids, wherein the substituted
amino acid has
similar structural or chemical properties, e.g., replacement of leucine with
isoleucine or
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
18
threonine with serine. In contrast, variations may include nonconservative
changes, eg,
replacement of a glycine with a tryptophan. Similar minor variations may also
include amino
acid deletions or insertions, or both. Guidance in determining which and how
many amino acid
residues may be substituted, inserted or deleted without changing biological
or immunological
activity may be found using computer programs well known in the art, for
example,
DNASTAR software (DNASTAR Inc., Madison, WI).
A human vanilloid polypeptide is believed to be substantially encoded by or
within SEQ
ID NO:1 or SEQ ID N0:7. The minimum polypeptide sequence necessary for ligand
binding,
however, can be determined by routine methods. The sequence, for example, may
be truncated
at either end by treating an appropriate expression vector with an exonuclease
(after cleavage at
the 5' or 3' end of the coding sequence) to remove any desired number of base
pairs. The
resulting coding polynucleotide is then expressed and the sequence determined.
In this manner
the binding activity may be correlated with the amino acid sequence: a limited
series of such
experiments (removing progressively greater numbers of base pairs) determines
the minimum
internal sequence necessary for ligand-binding activity.
The vanilloid receptor polypeptides may be naturally purified products
expressed from a
high expressing cell line, or produced by recombinant techniques from a
prokaryotic or
eukaryotic host (for example, by bacterial, yeast, higher plant, insect and
mammalian cells in
culture) as described above. Depending upon the host employed in a recombinant
production
procedure, the polypeptides of the present invention may be glycosylated with
mammalian or
other eukaryotic carbohydrates or may be non-glycosylated. 'The polypeptides
of the invention
may also include an initial methionine amino acid residue. Alternatively, the
polypeptides of
the invention can be synthetically produced by conventional peptide
synthesizers or produced
by cell-free translation systems using RNAs derived from the DNA constructs of
the present
invention.
The present invention also provides an antibody produced by using a purified
vanilloid
receptor gene polypeptide of which at least a portion of the polypeptide is
encoded by a
vanilloid receptor gene polynucleotide selected from the polynucleotides
provided herein.
These antibodies may be used in the methods provided herein for the detection
of vanilloid
receptor polypeptides in test samples. The antibody also may be used for
therapeutic purposes,
for example, in neutralizing the activity of a vanilloid receptor polypeptide
in conditions
associated with its altered or abnormal expression. The antibody may also be
used to detect an
accessory protein or proteins by immunoprecipitation of protein complexes.
Probe Assays
The sequences provided herein may be used to produce probes which can be used
in
assays for the detection of nucleic acids in test samples. For example, such
probes can be used
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
19
in Fluorescent In Situ Hybridization (FISH) technology to perform chromosomal
analysis, and
used to identify vanilloid receptor structural alterations in the chromosomes,
such as deletions
or translocations that are visible from chromosome spreads or detectable using
PCR-generated
and/or allele specific oligonucleotide probes, allele specific amplification
or by direct
sequencing. Probes also can be labeled with radioisotopes, directly- or
indirectly- detectable
haptens, or fluorescent molecules, and utilized for in situ hybridization
studies to evaluate the
mRNA expression of the gene comprising the polynucleotide in fixed tissue
specimens or cells.
The probes may be designed from conserved nucleotide regions of the
polynucleotides
of interest or from non-conserved nucleotide regions of the polynucleotide of
interest. The
design of such probes for optimization in assays is within the skill of the
routineer. Generally,
nucleic acid probes are developed from non-conserved or unique regions when
maximum
specificity is desired, and nucleic acid probes are developed from conserved
regions when
assaying for nucleotide regions that are closely related to, for example,
different members of a
multigene family or in related species like mouse and man.
The polymerise chain reaction (PCR) is a technique for amplifying a desired
nucleic
acid sequence (target) contained in a nucleic acid or mixture thereof. In PCR,
a pair of primers
are employed in excess to hybridize at the outside ends of complementary
strands of the target
nucleic acid. The primers are each extended by a polymerise using the target
nucleic acid as a
template. The extension products become target sequences themselves, following
dissociation
from the original target strand. New primers then hybridize to the target
sequences and are
extended by a polymerise, and the cycle is repeated to geometrically increase
the number of
target sequence molecules. PCR is disclosed in U.S. patents 4,683,195 and
4,683,202.
The Ligase Chain Reaction (LCR) is an alternate method for nucleic acid
amplification.
In LCR, probe pairs are used which include two primary (first and second) and
two secondary
(third and fourth) probes, all of which are employed in molar excess to a
target. The first probe
hybridizes to a first segment of the target strand and the second probe
hybridizes to a second
segment of the target strand, the first and second segments being contiguous
so that the primary
probes abut one another in 5' phosphate-3'hydroxyl relationship, and so that a
ligase can
covalently fuse or ligate the two probes into a fused product. In addition, a
third (secondary)
probe can hybridize to a portion of the first probe and a fourth (secondary)
probe can hybridize
to a portion of the second probe in a similar abutting fashion. Of course, if
the target is initially
double stranded, the secondary probes also will hybridize to the target
complement in the first
instance. Once the ligated strand of primary probes is separated from the
target strand, it will
hybridize with the third and fourth probes which can be ligated to form a
complementary,
secondary ligated product. It is important to realize that the ligated
products are functionally
equivalent to either the target or its complement. By repeated cycles of
hybridization and
ligation, amplification of the target sequence is achieved. This technique is
described more
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
completely in EP-A- 320 308 to K. Backman published June 16, 1989 and EP-A-439
182 to K.
Backman et al., published July 31, 1991, both of which are incorporated herein
by reference.
For amplification of mRNAs, it is within the scope of the present invention to
reverse
transcribe mRNA into cDNA followed by polymerise chain reaction (RT-PCR); or,
to use a
5 single enzyme for both steps as described in U.S. Patent No. 5,322,770, or
reverse transcribe
mRNA into cDNA followed by asymmetric gap ligase chain reaction (RT-AGLCR) as
described by R. L. Marshall, et al., PCR Methods and Applications 4: 80-84
(1994).
Other known amplification methods which can be utilized herein include but are
not
limited to the so-called "NASBA" or "3SR" technique described in PNAS USA
87:1874-1878
10 (1990) and also described in Nature 350 (No. 6313):91-92 (1991); Q-beta
amplification as
described in published European Patent Application (EPA) No. 4544610; strand
displacement
amplification (as described in G. T. Walker et al., Clin. Chem. 42:9-13
(1996)) and European
Patent Application No. 684315; and target mediated amplification, as described
by PCT
Publication WO 9322461.
15 In one embodiment, the present invention generally comprises the steps of
contacting a
test sample suspected of containing a target polynucleotide sequence with
amplification
reaction reagents comprising an amplification primer, and a detection probe
that can hybridize
with an internal region of the amplicon sequences. Probes and primers employed
according to
the method herein provided are labeled with capture and detection labels
wherein probes are
20 labeled with one type of label and primers are labeled with the other type
of label.
Additionally, the primers and probes are selected such that the probe sequence
has a lower melt
temperature than the primer sequences. The amplification reagents, detection
reagents and test
sample are placed under amplification conditions whereby, in the presence of
target sequence,
copies of the target sequence (an amplicon) are produced. In the usual case,
the amplicon is
double stranded because primers are provided to amplify a target sequence and
its
complementary strand. The double stranded amplicon then is thermally denatured
to produce
single stranded amplicon members. Upon formation of the single stranded
amplicon members,
the mixture is cooled to allow the formation of complexes between the probes
and single
stranded amplicon members.
As the single stranded amplicon sequences and probe sequences are cooled, the
probe
sequences preferentially bind the single stranded amplicon members. This
finding is
counterintuitive given that the probe sequences are generally selected to be
shorter than the
primer sequences and therefore have a lower melt temperature than the primers.
Accordingly,
the melt temperature of the amplicon produced by the primers should also have
a higher melt
temperature than the probes. Thus, as the mixture is cooled, the re-formation
of the double
stranded amplicon is expected. As previously stated, however, this is not the
case. Probes have
been found to preferentially bind the single stranded amplicon members.
Moreover, this
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
21
preference of probe/single stranded amplicon binding exists even when the
primer sequences
are added in excess of the probes.
After the probe/single stranded amplicon member hybrids are formed, they are
detected.
Standard heterogeneous assay formats are suitable for detecting the hybrids
using the detection
labels and capture labels present on the primers and probes. The hybrids can
be bound to a
solid phase reagent by virtue of the capture label and detected by virtue of
the detection label.
In cases where the detection label is directly detectable, the presence of the
hybrids on the solid
phase can be detected by causing the label to produce a detectable signal, if
necessary, and
detecting the signal. In cases where the label is not directly detectable, the
captured hybrids can
be contacted with a conjugate, which generally comprises a binding member
attached to a
directly detectable label. The conjugate becomes bound to the complexes and
the conjugates
presence on the complexes can be detected with the directly detectable label.
Thus, the
presence of the hybrids on the solid phase reagent can be determined. Those
skilled in the art
will recognize that wash steps may be employed to wash away unhybridized
amplicon or probe
as well as unbound conjugate.
A test sample is typically anything suspected of containing a target sequence.
Test
samples can be prepared using methodologies.well known in the art such as by
obtaining a
specimen from an individual and, if necessary, disrupting any cells contained
therein to release
target nucleic acids. The target sequence is either double stranded or single
stranded. In the
case where PCR is employed in this method, the ends of the target sequences
are usually
known. In cases where LCR or a modification thereof is employed in the
preferred method, the
entire target sequence is usually known. Typically, the target sequence is a
nucleic acid
sequence such as, for example, RNA or DNA.
Generally, two primers which are complementary to a portion of a target strand
and its
complement are employed in PCR. For LCR, four probes, two of which are
complementary to
a target sequence and two of which are similarly complementary to the targets
complement, are
generally employed. While the amplification primers initiate amplification of
the target
sequence, in some cases, the detection (or hybridization) probe is not
involved in amplification.
Detection probes are generally nucleic acid sequences or uncharged nucleic
acid analogs such
as, for example, peptide nucleic acids which are disclosed in International
Patent Application
WO 92/20702; morpholino analogs which are described in U.S. Patents Nos
5,185,444,
5,034,506, and 5,142,047; and the like. Depending upon the type of label
carried by the probe,
the probe is employed to capture or detect the amplicon generated by the
amplification reaction.
The probe is not involved in amplification of the target sequence and
therefore may have to be
rendered "non-extendable" in that additional dNTPs cannot be added to the
probe. In and of
themselves analogs usually are non-extendable and nucleic acid probes can be
rendered non-
extendable by modifying the 3' end of the probe such that the hydroxyl group
is no longer
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
22
capable of participating in elongation. For example, the 3' end of the probe
can be
functionalized with the capture or detection label to thereby consume or
otherwise block the
hydroxyl group. Alternatively, the 3' hydroxyl group simply can be cleaved,
replaced or
modified. U.S. Patent Application Serial No. 07/049,061 filed April 19, 1993
describes
modifications which can be used to render a probe non-extendable.
While the length of the primers and probes can vary, the probe sequences are
selected such that they have a lower melt temperature than the primer
sequences. Hence,
the primer sequences are generally longer than the probe sequences. Typically,
the primer
sequences are in the range of between 20 and 50 nucleotides long, more
typically in the
range of between 20 and 30 nucleotides long. The typical probe is in the range
of between
10 and 25 nucleotides long.
Alternatively, a probe may be involved in the amplifying a target sequence,
via a
process known as "nested PCR" . In nested PCR, the probe has characteristics,
which are
similar to those of the first and second primers normally used for
amplification (such as
length, melting temperature etc.), and as such, may itself serve as a primer
in an
amplification reaction. Generally in nested PCR, a first pair of primers (P 1
and P2) are
employed to form primary extension products. One of the primary primers (for
example,
P1) may optionally be a capture primer (i.e. linked to a member of a first
reactive pair),
whereas the other primary primer (P2) is not. A secondary extension product is
then formed
using a probe (P 1') and a probe (P2') which may also have a capture type
label (such as a
member of a second reactive pair) or a detection label at its 5' end. The
probes are
complementary to and hybridize at a site on the template near or adjacent the
site where the
3' termini of P 1 and P2 would hybridize if still in solution. Alternatively,
a secondary
extension product can be formed using the P 1 primer with the probe (P2') or
the P2 primer
with the probe (P 1 ~) sometimes referred to as "hemi-nested PCR" . Thus, a
labeled
primer/probe set generates a secondary product which is shorter than the
primary extension
product. Furthermore, the secondary product may be detected either on the
basis of its size
or via its labeled ends (by detection methodologies well known to those of
ordinary skill in
the art). In this process, probe and primers are generally employed in
equivalent
concentrations.
Various methods for synthesizing primers and probes are well known in the art.
Similarly, methods for attaching labels to primers or probes are also well
known in the art.
For example, it is a matter of routine to synthesize desired nucleic acid
primers or probes
using conventional nucleotide phosphoramidite chemistry and instruments
available from
Applied Biosystems, Inc., (Foster City, CA), Dupont (Wilmington, DE), or
Milligen
(Bedford, MA). Many methods have been described for labeling oligonucleotides
such as
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
23
the primers or probes of the present invention. Enzo Biochemical (New York,
NY) and
CLONTECH (Palo Alto, CA) both have described and commercialized probe labeling
techniques. For example, a primary amine can be attached to a 3' oligo
terminus using 3'-
Amine-ON CPGTM (CLONTECH). Similarly, a primary amine can be attached to a 5'
oligo
terminus using Aminomodifier II~ (CLONTECH). The amines can be reacted to
various
haptens using conventional activation and linking chemistries. In addition,
copending
applications US. Serial Nos. 625,566, filed December 11, 1990 and 630,908,
filed
December 20, 1990, teach methods for labeling probes at their 5' and 3'
termini,
respectively. Publications W092/10505, published 25 June 1992 and WO 92/11388
published 9 July 1992 teach methods for labeling probes at their 5' and 3'
ends,
respectively. According to one known method for labeling an oligonucleotide, a
label-
phosphoramidite reagent is prepared and used to add the label to the
oligonucleotide during
its synthesis. See, for example, N.T. Thuong et al., Tet. Letters 29(46):5905-
5908 (1988);
or J. S. Cohen et al., published U.S. Patent Application 07/246,688 (NTIS
ORDER No.
PAT-APPL-7-246,688) (1989). Preferably, probes are labeled at their 3' and 5'
ends.
Capture labels are carried by the primers or probes and can be a specific
binding
member which forms a binding pair with the solid phase reagent's specific
binding member. It
will be understood, of course that the primer or probe itself may serve as the
capture label. For
example, in the case where a solid phase reagent's binding member is a nucleic
acid sequence, it
may be selected such that it binds a complementary portion of the primer or
probe to thereby
immobilize the primer or probe to the solid phase. In cases where the probe
itself serves as the
binding member, those skilled in the art will recognize that the probe will
contain a sequence or
"tail" that is not complementary to the single stranded amplicon members. In
the case where
the primer itself serves as the capture label, at least a portion of the
primer will be free to
hybridize with a nucleic acid on a solid phase because the probe is selected
such that it is not
fully complementary to the primer sequence.
Another method provided by the present invention comprises contacting a test
sample
with a plurality of polynucleotides wherein at least one polynucleotide is
provided herein,
hybridizing the test sample with the plurality of polynucleotides and
detecting the hybridization
complexes. The hybridization complexes are identified and quantified to
compile a profile
which is indicative of vanilloid receptor expression. Expressed RNA sequences
may further be
detected by reverse transcription and amplification of the DNA product by
procedures well-
known in the art, including polymerase chain reaction (PCR).
Drug Screening and Gene Therapy.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
24
The present invention also encompasses the use of gene therapy methods for the
introduction of antisense vanilloid receptor gene derived molecules such as
polynucleotides or
oligonucleotides of the present invention into patients with conditions
associated with abnormal
expression of polynucleotides related to vanilloid receptor. These molecules,
including
antisense RNA and DNA fragments and ribozymes, are designed to inhibit the
translation of a
vanilloid receptor mRNA, and may be used therapeutically in the treatment of
conditions
associated with altered or abnormal expression of a vanilloid receptor
polynucleotide.
Alternatively, the oligonucleotides described above can be delivered to cells
by
procedures in the art such that the antisense RNA or DNA may be expressed in
vivo to inhibit
production of a vanilloid receptor polypeptide in the manner described above.
Antisense
constructs to vanilloid receptor polynucleotides, therefore, reverse the
action of vanilloid
receptor transcripts.
The present invention also provides a method of screening a plurality of
compounds for
specific binding to a human vanilloid receptor polypeptide, or any fragment
thereof, to identify
at least one compound which specifically binds a human vanilloid receptor
polypeptide. Such a
method comprises the steps of providing at least one compound; combining the
vanilloid
receptor polypeptide with each compound under suitable conditions for a time
sufficient to
allow binding; and detecting a vanilloid receptor polypeptide binding to each
compound. Such
a method permits the identification of vanilloid receptor binding compounds
which modulate
(i.e. repress or activate) the activity of a vanilloid receptor.
Antisense technology can be used to control gene expression through triple-
helix
formation or antisense DNA or RNA, both of which methods are based on binding
of a
polynucleotide to DNA or RNA. For example, the 5' coding portion of the
polynucleotide
sequence, which encodes for the polypeptide of the present invention, is used
to design an
antisense RNA oligonucleotide of from 10 to 40 base pairs in length. A DNA
oligonucleotide
is designed to be complementary to a region of the gene involved in
transcription, thereby
preventing transcription and the production of vanilloid receptor derived
polypeptide. For
triple helix, see, for example, Lee et al., Nucl. Acids Res. 6:3073 (1979);
Cooney et al., Science
241:456 (1988); and Dervan et al., Science 251:1360 (1991) The antisense RNA
oligonucleotide hybridizes to the mRNA in vivo and either blocks translation
of an mRNA
molecule into the vanilloid receptor polypeptide or alters the transport or
stability of the
mRNA. For antisense, see, for example, Okano, J. Neurochem. 56:560 (1991); and
"Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression", CRC Press,
Boca Raton,
Fla. (1988). Antisense oligonucleotides act with greater efficacy when
modified to contain
artificial internucleotide linkages which render the molecule resistant to
nucleolytic cleavage.
Such artificial internucleotide linkages include but are not limited to
methylphosphonate,
phosphorothiolate and phosphoroamydate internucleotide linkages.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
The polypeptide or peptide fragment employed in such a test may either be free
in
solution, affixed to a solid support, borne on a cell surface or located
intracellularly. One
method of drug screening utilizes eukaryotic or prokaryotic host cells which
are stably
transformed with recombinant nucleic acids which can express the polypeptide
or peptide
fragment. Drugs may be screened against such transformed cells in competitive
binding assays.
For example, the formation of complexes between a polypeptide and the agent
being tested can
be measured in either viable or fixed cells.
The present invention thus provides methods of screening for drugs or any
other agent
which, upon binding to a vanilloid receptor, improves a condition or disease
state. These
10 methods comprise contacting the drug with a vanilloid receptor polypeptide
or fragment thereof
and assaying for the presence of a complex between the agent and the
polypeptide. In
competitive binding assays, a labeled agent, which is known to bind to the
receptor, typically is
used. After suitable incubation, free (or uncomplexed) agent is separated from
that present in
bound form, and the amount of free or uncomplexed label is a measure of the
ability of the test
15 agent or drug to bind to receptor polypeptide.
The present invention also encompasses the use of competitive drug screening
assays in
which neutralizing antibodies capable of binding receptor polypeptide
specifically campete
with a test drug for binding to the receptor polypeptide or fragment thereof.
In this manner, the
antibodies can be used to detect the presence of any polypeptide in the test
sample which shares
20 one or more antigenic determinants with a polypeptide provided herein.
Another technique for drug screening provides high throughput screening for
compounds having suitable binding affinity to at least one receptor
polypeptide disclosed
herein. Briefly, large numbers of different small molecule test compounds or
peptides are
synthesized on a solid phase, such as plastic beads or some other surface. The
test compounds
25 are reacted with receptor polypeptide and washed. Test compounds thus bound
to the solid
phase are detected by methods well known in the art. Purified receptor
polypeptide can also be
coated directly onto plates for use in the drug screening techniques described
herein. In
addition, non-neutralizing antibodies can be used to capture the receptor
polypeptide and
immobilize it on the solid support. See, for example, EP 84/03564, published
on September 13,
1984.
The goal of rational drug design is to produce structural analogs of
biologically active
polypeptides of interest or of the small molecules including agonists,
antagonists, or inhibitors
with which they interact. Such structural analogs can be used to fashion drugs
which are more
active or stable forms of the drug or which enhance or interfere with the
function of the receptor
polypeptide in vivo. (See, J. Hodgson, Bio/Technolo~y 9:19-21 (1991).
For example, in one approach, the three-dimensional structure of a receptor
polypeptide,
or of a receptor polypeptide-inhibitor complex, is determined by x-ray
crystallography, by
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
26
computer modeling or, most typically, by a combination of the two approaches.
Both the shape
and charges of the receptor polypeptide must be ascertained to elucidate the
structure and to
determine active sites) of the molecule. Less often, useful information
regarding the structure
of a polypeptide may be gained by modeling based on the structure of
homologous proteins. In
both cases, relevant structural information is used to design analogous
polypeptide-like
molecules or to identify efficient inhibitors.
Useful examples of rational drug design may include molecules which have
improved
activity or stability as shown by S. Braxton et al., Biochemistry 31:7796-7801
(1992), or which
act as inhibitors, agonists, or antagonists of native peptides as shown by S.
B. P. Athauda et al.,
J Biochem. (Tokyo) 113 (6):742-746 (1993).
It also is possible to isolate a target-specific antibody, selected by an
assay as described
hereinabove, and then to determine its crystal structure. In principle this
approach yields a
pharmacophore upon which subsequent drug design can be based. It further is
possible to
bypass protein crystallography altogether by generating anti-idiotypic
antibodies ("anti-ids") to
a functional, pharmacologically active antibody. As a mirror image of a mirror
image, the
binding site of the anti-id is an analog of the original receptor. The anti-id
then could be used
to identify and isolate peptides from banks of chemically or biologically
produced peptides.
The isolated peptides then can act as the pharmacophore (that is, a prototype
pharmaceutical
drug).
A sufficient amount of a recombinant receptor polypeptide of the present
invention may
be made available to perform analytical studies such as X-ray crystallography.
In addition,
knowledge of the polypeptide amino acid sequence which are derivable from the
nucleic acid
sequence provided herein will provide guidance to those employing computer
modeling
techniques in place of or in addition to x-ray crystallography.
Antibodies specific to a human vanilloid receptor polypeptide may further be
used to
inhibit its biological action by binding to the receptor polypeptide. In this
manner, the
antibodies may be used in therapy, for example, to treat disorders involving
capsaicin-sensitive
ion channels.
Further, such antibodies can detect the presence or absence of a human
vanilloid
receptor polypeptide and, therefore, are useful as diagnostic markers for the
diagnosis of
disorders involving vanilloid receptors. The present invention also is
directed to antagonists
and inhibitors of the receptor polypeptides of the present invention. The
antagonists and
inhibitors are those which inhibit or eliminate the function of the
polypeptide. Thus, for
example, an antagonist may bind to a receptor polypeptide of the present
invention and inhibit
or eliminate its function.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
27
The antagonists and inhibitors may be employed as a composition with a
pharmaceutically acceptable carrier, including but not limited to saline,
buffered saline,
dextrose, water, glycerol, ethanol and combinations thereof.
Recombinant Technolo~y.
The present invention provides vectors which include polynucleotides of the
present
invention, host cells which are genetically engineered with vectors of the
present invention and
the production of polypeptides of the present invention by recombinant
techniques. Such
methods comprise culturing the host cells under conditions suitable for the
expression of a
human vanilloid receptor polynucleotide and recovering the polypeptide
produced therefrom
from the cell culture.
a. Host Cells
In one embodiment, the present invention provides host cells containing a
recombinant
construct as described below. The host cell can be a higher eukaryotic cell,
such as a
mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or a
prokaryotic cell, such as a
bacterial cell. Representative examples of appropriate hosts include bacterial
cells, such as E.
coli, Bacillus subtilis, Salmonella tXphimurium; and various species within
the genera
Pseudomonas, Streptomyces, and Staphylococcus, although others may also be
employed as a
routine matter of choice; fungal cells, such as yeast; insect cells such as
Drosophila and Sue;
animal cells such as CHO, COS or Bowes melanoma; plant cells, etc. The
selection of an
appropriate host is deemed to be within the scope of those skilled in the art
from the teachings
provided herein.
Host cells are genetically engineered (transduced or transformed or
transfected) with the
vectors of this invention which may be a cloning vector or an expression
vector. The
engineered host cells can be cultured in conventional nutrient media modified
as appropriate for
activating promoters, selecting transformants or amplifying a vanilloid
receptor gene. The
culture conditions, such as temperature, pH and the like, are those previously
used with the host
cell selected for expression, and will be apparent to the ordinarily skilled
artisan.
b. Vectors and Expression Systems
The present invention also includes recombinant constructs comprising one or
more of
the sequences as broadly described above. The constructs comprise a vector,
such as a plasmid
or viral vector, into which a sequence of the invention has been inserted, in
a forward or reverse
orientation. Such vectors include chromosomal, non-chromosomal and synthetic
DNA
sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; yeast
plasmids; vectors
derived from combinations of plasmids and phage DNA, and viral DNA such as
vaccinia,
adenovirus, fowl pox virus, and pseudorabies. In a preferred embodiment, a
construct
comprises an expression vector (as described below). Large numbers of suitable
plasmids and
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
28
vectors are known to those of skill in the art, and are commercially
available. The following
vectors are provided by way of example: (a) Bacterial: pBR322 (ATCC 37017);
pGEMl
(Promega Biotec, Madison, WI), pUC, pSPORTI and pProExl (Life Technologies,
Gaithersburg, MD); pQE70, pQE60, pQE-9 (Qiagen); pBs, phagescript, psiX174,
pBluescript
SK, pBsKS, pNHBa, pNHl6a, pNHl8a, pNH46a (Stratagene); pTrc99A, pKK223-3,
pKK233-
3, pDR540, pRITS, and pGEX4T (Pharmacia Fine Chemicals, Uppsala, Sweden); and
(b)
Eukaryotic: pWLneo, pSV2cat, pOG44, pXTI, pSG (Stratagene); pSVK3, pBPV, pMSG,
pSVL (Pharmacia); pcDNA3.l (Invitrogen). Other appropriate cloning and
expression vectors
for use with prokaryotic and eukaryotic hosts are described by Sambrook et
al., supra.
Generally however, any plasmid or vector may be used as long as it is
replicable and viable in a
host.
In a preferred embodiment, the construct is an expression vector which also
comprises
regulatory sequences operably linked to the sequence of interest, to direct
mRNA synthesis and
polypeptide production. Regulatory sequences known to operate in prokaryotic
and/or
eukaryotic cells include inducible and non-inducible promoters for regulating
mRNA
transcription, ribosome binding sites for translation initiation, stop codons
for translation
termination and transcription terminators and/or polyadenylation signals. In
addition, an
expression vector may include appropriate sequences for amplifying expression
(such as a
dihydrofolate reductase gene).
Promoter regions may be selected from any desired gene but preferably from one
which
is highly expressed. Particular named bacterial promoters include lacZ, gpt,
lambda P sub R, P
sub L and trp. Eukaryotic promoters include cytomegalovirus (CMV) immediate
early, herpes
simplex virus (HSV) thymidine kinase, early and late SV40, LTRs from
retroviruses, mouse
metallothionein-I, prion protein and neuronal specific enolase (NSE).
Selection of the
appropriate promoter is well within the level of ordinary skill in the art. In
addition, a
recombinant expression vector will include an origin of replication and
selectable marker (such
as a gene conferring resistance to an antibiotic (e.g. neomycin,
chloramphenicol or ampicillin)
or a reporter gene (e.g. luciferase)) which permit selection of stably
transformed or transfected
host cells.
In a preferred prokaryotic or yeast expression vector, a heterologous
structural sequence
(i.e. a polynucleotide of the present invention) is assembled in appropriate
phase with
translation initiation and termination sequences, and preferably, a leader
sequence capable of
directing secretion of translated protein into the periplasmic space or
extracellular medium.
Optionally, the heterologous sequence will encode a fusion protein including
an N-terminal
identification peptide imparting desired characteristics, e.g., stabilization
or simplified
purification of expressed recombinant product.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
29
Preferred eukaryotic expression vectors will also comprise an origin of
replication, a
suitable promoter operably linked to a sequence of interest and also any
necessary translation
enhancing sequence, polyadenylation site, splice donor and acceptor sites,
transcriptional
termination sequences, and 5' flanking nontranscribed sequences. DNA sequences
derived
from the SV40 viral genome, for example, SV40 origin, early promoter,
enhancer, splice, and
polyadenylation sites may be used to provide the required nontranscribed
genetic elements.
Such vectors may also include an enhancer sequence to increase transcription
of a gene.
Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp,
that act on a
promoter to increase its transcription rate. Examples include the SV40
enhancer on the late
side of the replication origin (bp 100 to 270), a cytomegalovirus early
promoter enhancer, a
polyoma enhancer on the late side of the replication origin, and adenovirus
enhancers.
i. Vector construction
The appropriate DNA sequence may be inserted into a vector by a variety of
procedures.
Generally, site-specific DNA cleavage is performed by treating the DNA with
suitable
restriction enzymes under conditions which are generally specified by the
manufacturer of these
commercially available enzymes. Usually, about 1 microgram (pg) of plasmid or
DNA
sequence is cleaved by 1 unit of enzyme in about 20 microliters (pL) of buffer
solution by
incubation at 37°C for 1 to 2 hours. After incubation with the
restriction enzyme, protein is
removed by phenol/chloroform extraction and the DNA recovered by precipitation
with
ethanol. The cleaved fragments may be separated using polyacrylamide or
agarose gel
electrophoresis, according to methods known by the routine practitioner. (See
Sambrook et al.,
supra).
Ligations are performed using standard buffer and temperature conditions and
with a
ligase (such as T4 DNA ligase) and ATP. Sticky end ligations require less ATP
and less ligase
than blunt end ligations. When vector fragments are used as part of a ligation
mixture, the
vector fragment often is treated with bacterial alkaline phosphatase (BAP) or
calf intestinal
alkaline phosphatase (CIAP) to remove the 5'-phosphate and thus prevent
religation of the
vector. Alternatively, restriction enzyme digestion of unwanted fragments can
be used to
prevent ligation. Ligation mixtures are transformed into suitable cloning
hosts such as E. coli
and successful transformants selected by methods including antibiotic
resistance, and then
screened for the correct construct.
ii. Transformation/Transfection
Transformation or transfection of an appropriate host with a construct of the
invention,
such that the host produces recombinant polypeptides, may also be performed in
a variety of
ways. For example, a construct may be introduced into a host cell by calcium
chloride
transformation, lithium chloride or calcium phosphate transfection, DEAF-
Dextran mediated
transfection, or electroporation. These and other methods for
transforming/transfecting host
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
cells are well known to routine practitioners (see L. Davis et al., "Basic
Methods in Molecular
Biology", 2nd edition, Appleton and Lang, Paramount Publishing, East Norwalk,
CT (1994)).
iii. Recovery of Expressed Proteins from Recombinant Host Cells
Following transformation or transfection of a suitable host strain and growth
of the host
5 strain to an appropriate cell density, the selected promoter is derepressed
by appropriate means
(e.g., temperature shift or chemical induction), and cells are cultured for an
additional period.
Cells are typically harvested by centrifugation, disrupted by physical or
chemical means (to
release intracellular protein) and the resulting crude extract retained for
further purification.
Microbial cells employed in expression of proteins can be disrupted by any
convenient method,
10 including freeze-thaw cycling, sonication, mechanical disruption, or use of
cell lysing agents;
such methods are well-known to the ordinary artisan. When the expressed
protein has been
secreted, it can be purified directly from the supernatant of harvested cells.
Vanilloid receptor polypeptide is recovered and purified from the supernatant
or crude
extract by known methods including ammonium sulfate or ethanol precipitation,
acid
15 extraction, affinity chromatography, anion or cation exchange
chromatography,
phosphocellulose chromatography, hydrophobic interaction chromatography,
hydroxyapatite
chromatography or lectin chromatography. It is preferred to have low
concentrations
(approximately 0.1-5 mM) of calcium ion present during purification (Price, et
al., J. Biol.
Chem. 244:917 ( 1969)). Protein refolding steps can be used, as necessary, in
completing
20 configuration of the protein. Finally, high performance liquid
chromatography (HPLC) can be
employed for final purification steps.
An alternative method for the production of large amounts of secreted protein
involves
the transformation of mammalian embryos and the recovery of the recombinant
protein from
milk produced by transgenic cows, goats, sheep, etc. Polypeptides and closely
related
25 molecules may be expressed recombinantly in such a way as to facilitate
protein purification.
One approach involves expression of a chimeric protein which includes one or
more additional
polypeptide domains not naturally present on human polypeptides. Such
purification-
facilitating domains include, but are not limited to, metal-chelating peptides
such as histidine-
tryptophan domains that allow purification on immobilized metals, protein A
domains that
30 allow purification on immobilized immunoglobulin, and the domain utilized
in the FLAGS
extension/affinity purification system (Immunex Corp, Seattle, WA). The
inclusion of a
cleavable linker sequence such as Factor XA or enterokinase from Invitrogen
(San Diego, CA)
between the polypeptide sequence and the purification domain may be useful for
recovering the
polypeptide.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
31
Immunoassays.
The polypeptides including their fragments or derivatives or analogs thereof
of the
present invention, or cells expressing them, can be used in a variety of
assays, many of which
are described herein, for the detection of antibodies to a human vanilloid
receptor. They also
can be used as an immunogen to produce antibodies. These antibodies can be,
for example,
polyclonal or monoclonal antibodies, chimeric, single chain and humanized
antibodies, as well
as Fab fragments, or the product of an Fab expression library. Various
procedures known in the
art may be used for the production of such antibodies and fragments.
For example, antibodies generated against a polypeptide corresponding to a
sequence of
the present invention can be obtained by direct injection of the polypeptide
into an animal or by
administering the polypeptide to an animal such as a mouse, rabbit, chicken,
or goat. A mouse,
rabbit or goat is preferred. The antibody so obtained then will bind the
polypeptide itself. In
this manner, even a sequence encoding only a fragment of the polypeptide can
be used to
generate antibodies that bind the native polypeptide. Such antibodies can then
be used to
isolate the polypeptide from test samples such as tissue suspected of
containing that
polypeptide. For preparation of monoclonal antibodies, any technique which
provides
antibodies produced by continuous cell line cultures can be used. Examples
include the
hybridoma technique as described by Kohler and Milstein, Nature 256: 495-497
(1975), the
trioma technique, the human B-cell hybridoma technique as described by Kozbor
et al., Immun.
Today 4: 72 (1983), and the EBV-hybridoma technique to produce human
monoclonal
antibodies as described by Cole, et al., in Monoclonal Antibodies and Cancer
Therapy, Alan R.
Liss, Inc, New York, NY, pp. 77-96 (1985). Techniques described for the
production of single
chain antibodies can be adapted to produce single chain antibodies to
immunogenic polypeptide
products of this invention. See, for example, U.S. Pat. No. 4,946,778, which
is incorporated
herein by reference.
Various assay formats may utilize the antibodies of the present invention,
including
"sandwich" immunoassays and probe assays. For example, the monoclonal
antibodies or
fragment thereof of the present invention can be employed in various assay
systems to
determine the presence, if any, of a vanilloid receptor derived polypeptide in
a test sample. For
example, in a first assay format, a polyclonal or monoclonal antibody or
fragment thereof, or a
combination of these antibodies, which has been coated on a solid phase, is
contacted with a
test sample, to form a first mixture. This first mixture is incubated for a
time and under
conditions sufficient to form antigen/antibody complexes. Then, an indicator
reagent
comprising a monoclonal or a polyclonal antibody or a fragment thereof, or a
combination of
these antibodies, to which a signal generating compound has been attached, is
contacted with
the antigen/antibody complexes to form a second mixture. This second mixture
then is
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
32
incubated for a time and under conditions sufficient to form
antibody/antigen/antibody
complexes. The presence of a vanilloid receptor derived polypeptide antigen
present in the test
sample and captured on the solid phase, if any, is determined by detecting the
measurable
signal generated by the signal generating compound. The amount of vanilloid
receptor derived
polypeptide antigen present in the test sample is proportional to the signal
generated.
Or, a polyclonal or monoclonal vanilloid receptor derived polypeptide antibody
or
fragment thereof, or a combination of these antibodies which is bound to a
solid support, the
test sample and an indicator reagent comprising a monoclonal or polyclonal
antibody or
fragments thereof, which specifically binds to a vanilloid receptor derived
polypeptide antigen,
or a combination of these antibodies to which a signal generating compound is
attached, are
contacted to form a mixture. This mixture is incubated for a time and under
conditions
sufficient to form antibody/antigen/antibody complexes. The presence, if any,
of a vanilloid
receptor derived polypeptide present in the test sample and captured on the
solid phase is
determined by detecting the measurable signal generated by the signal
generating compound.
The amount of vanilloid receptor derived polypeptide proteins present in the
test sample is
proportional to the signal generated.
In another assay format, one or a combination of at least two monoclonal
antibodies of
the invention can be employed as a competitive probe for the detection of
antibodies to a
vanilloid receptor derived polypeptide protein. For example, vanilloid
receptor derived
polypeptide proteins such as the recombinant antigens disclosed herein, either
alone or in
combination, are coated on a solid phase. A test sample suspected of
containing antibody to a
vanilloid receptor derived polypeptide antigen then is incubated with an
indicator reagent
comprising a signal generating compound and at least one monoclonal antibody
of the
invention for a time and under conditions sufficient to form antigen/antibody
complexes of
either the test sample and indicator reagent bound to the solid phase or the
indicator reagent
bound to the solid phase. The reduction in binding of the monoclonal antibody
to the solid
phase can be quantitatively measured.
In yet another detection method, each of the monoclonal or polyclonal
antibodies of the
present invention can be employed in the detection of vanilloid receptor
derived polypeptide
antigens in fixed tissue sections, as well as fixed cells by
immunohistochemical analysis.
Cytochemical analysis wherein these antibodies are labeled directly (with, for
example,
fluorescein, colloidal gold, horseradish peroxidase, alkaline phosphatase,
etc.) or are labeled by
using secondary labeled anti-species antibodies (with various labels as
exemplified herein) to
track the histopathology of disease also are within the scope of the present
invention.
In addition, these monoclonal antibodies can be bound to matrices similar to
CNBr-
activated Sepharose and used for the affinity purification of specific
vanilloid receptor derived
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
33
polypeptide proteins from cell cultures or biological tissues such as to
purify recombinant and
native vanilloid receptor derived polypeptide antigens and proteins.
The monoclonal antibodies of the invention can also be used for the generation
of
chimeric antibodies for therapeutic use, or other similar applications.
The monoclonal antibodies or fragments thereof can be provided individually to
detect
vanilloid receptor derived polypeptide antigens. Combinations of the
monoclonal antibodies
(and fragments thereof) provided herein also may be used together as
components in a mixture
or "cocktail" of at least one vanilloid receptor derived polypeptide antibody
of the invention
with antibodies to other vanilloid receptor derived polypeptide regions, each
having different
binding specificities. Thus, this cocktail can include the monoclonal
antibodies which are
directed to different antigenic determinants of vanilloid receptor derived
polypeptide proteins.
The polyclonal antibody or fragment thereof which can be used in the assay
formats
should specifically bind to a vanilloid receptor derived polypeptide region or
other vanilloid
receptor derived polypeptide protein used in the assay. The polyclonal
antibody used is
preferably of mammalian origin (such as from human, goat, rabbit or sheep).
Most preferably,
the polyclonal antibody is rabbit polyclonal anti-vanilloid receptor derived
polypeptide
antibody. The polyclonal antibodies used in the assays can be used either
alone or as a cocktail
of polyclonal antibodies.
It is contemplated and within the scope of the present invention that a
vanilloid receptor
derived polypeptide may be detectable in assays by use of a recombinant
antigen as well as by
use of a synthetic peptide or purified peptide, which contains an amino acid
sequence of a
vanilloid receptor derived polypeptide. It also is within the scope of the
present invention that
different synthetic, recombinant or purified peptides identifying different
epitopes of a vanilloid
receptor derived polypeptide can be used in combination in an assay to
diagnose, evaluate, or
prognose conditions associated with abnormal vanilloid receptor production. In
this case, these
peptides can be coated onto one solid phase, or each separate peptide may be
coated on separate
solid phases, such as microparticles, and then combined to form a mixture of
peptides which
can be later used in assays. Furthermore, it is contemplated that multiple
peptides which define
epitopes from different polypeptides may be used in combination to make a
diagnosis,
evaluation, or prognosis of abnormal vanilloid receptor production. To
accomplish this,
peptides coated on solid phases or labeled with detectable labels are allowed
to compete with
peptides from a patient sample for a limited amount of antibody. A reduction
in binding of the
synthetic, recombinant, or purified peptides to the antibody (or antibodies)
is an indication of
the presence of vanilloid receptor -secreted polypeptides in the patient
sample where it may not
be expected (for example, in cerebral spinal fluid). Such variations of assay
formats are known
to those of ordinary skill in the art.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
34
In another assay format, the presence of antibody and/or antigen to vanilloid
receptor
derived polypeptide can be detected in a simultaneous assay, as follows. A
test sample is
simultaneously contacted with a capture reagent of a first analyte, wherein
said capture reagent
comprises a first binding member specific for a first analyte attached to a
solid phase and a
capture reagent for a second analyte, wherein said capture reagent comprises a
first binding
member for a second analyte attached to a second solid phase, to thereby form
a mixture. This
mixture is incubated for a time and under conditions sufficient to form
capture reagent/first
analyte and capture reagent/second analyte complexes. These so-formed
complexes then are
contacted with an indicator reagent comprising a member of a binding pair
specific for the first
analyte labeled with a signal generating compound and an indicator reagent
comprising a
member of a binding pair specific for the second analyte labeled with a signal
generating
compound to form a second mixture. This second mixture is incubated for a time
and under
conditions sufficient to form capture reagent/first analyte/indicator reagent
complexes and
capture reagent/second analyte/indicator reagent complexes. The presence of
one or more
analytes is determined by detecting a signal generated in connection with the
complexes formed
on either or both solid phases as an indication of the presence of one or more
analytes in the test
sample. In this assay format, recombinant antigens derived from human
expression systems
may be utilized as well as monoclonal antibodies produced from the proteins
derived from the
mammalian expression systems as disclosed herein. Such assay systems are
described in
greater detail in EP Publication No. 0473065.
In yet other assay formats, the polypeptides disclosed herein may be utilized
to detect
the presence of anti- vanilloid receptor derived polypeptide in test samples.
For example, a test
sample is incubated with a solid phase to which at least one recombinant
protein has been
attached. These are reacted for a time and under conditions sufficient to form
antigen/antibody
complexes. Following incubation, the antigen/antibody complex is detected.
Indicator reagents
may be used to facilitate detection, depending upon the assay system chosen.
In another assay
format, a test sample is contacted with a solid phase to which a recombinant
protein produced
as described herein is attached and also is contacted with a monoclonal or
polyclonal antibody
specific for the protein, which preferably has been labeled with an indicator
reagent. After
incubation for a time and under conditions sufficient for antibody/antigen
complexes to form,
the solid phase is separated from the free phase, and the label is detected in
either the solid or
free phase as an indication of the presence of a vanilloid receptor derived
polypeptide antibody.
Other assay formats utilizing the recombinant antigens disclosed herein are
contemplated.
These include contacting a test sample with a solid phase to which at least
one antigen from a
first source has been attached, incubating the solid phase and test sample for
a time and under
conditions sufficient to form antigen/antibody complexes, and then contacting
the solid phase
with a labeled antigen, which antigen is derived from a second source
different from the first
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
source. For example, a recombinant protein derived from a first source such as
E. coli is used
as a capture antigen on a solid phase, a test sample is added to the so-
prepared solid phase, and
a recombinant protein derived from a different source (i.e., non-E. coli) is
utilized as a part of
an indicator reagent. Likewise, combinations of a recombinant antigen on a
solid phase and
5 synthetic peptide in the indicator phase also are possible. Any assay format
which utilizes an
antigen specific for a vanilloid receptor derived polypeptide from a first
source as the capture
antigen and an antigen specific for vanilloid receptor derived polypeptide
from a different
second source are contemplated. Thus, various combinations of recombinant
antigens, as well
as the use of synthetic peptides, purified proteins, and the like, are within
the scope of this
10 invention. Assays such as this and others are described in U.S. Patent No.
5,254,458, which
enjoys common ownership and is incorporated herein by reference.
Other embodiments which utilize various other solid phases also are
contemplated and
are within the scope of this invention. For example, ion capture procedures
for immobilizing
an immobilizable reaction complex with a negatively charged polymer (described
in EP
15 publication 0326100 and EP publication No. 0406473), can be employed
according to the
present invention to effect a fast solution-phase immunochemical reaction. An
immobilizable
immune complex is separated from the rest of the reaction mixture by ionic
interactions
between the negatively charged poly-anion/immune complex and the previously
treated,
positively charged porous matrix and detected by using various signal
generating systems
20 previously described, including those described in chemiluminescent signal
measurements as
described in EPO Publication No. 0 273,115.
Also, the methods of the present invention can be adapted for use in systems
which
utilize microparticle technology including in automated and semi-automated
systems wherein
the solid phase comprises a microparticle (magnetic or non-magnetic). Such
systems include
25 those described in published EPO applications Nos. EP 0 425 633 and EP 0
424 634,
respectively.
The use of scanning probe microscopy (SPM) for immunoassays also is a
technology to
which the monoclonal antibodies of the present invention are easily adaptable.
In scanning
probe microscopy, in particular in atomic force microscopy, the capture phase,
for example, at
30 least one of the monoclonal antibodies of the invention, is adhered to a
solid phase and a
scanning probe microscope is utilized to detect antigen/antibody complexes
which may be
present on the surface of the solid phase. The use of scanning tunneling
microscopy eliminates
the need for labels which normally must be utilized in many immunoassay
systems to detect
antigen/antibody complexes. The use of SPM to monitor specific binding
reactions can occur
35 in many ways. In one embodiment, one member of a specific binding partner
(analyte specific
substance which is the monoclonal antibody of the invention) is attached to a
surface suitable
for scanning. The attachment of the analyte specific substance may be by
adsorption to a test
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
36
piece which comprises a solid phase of a plastic or metal surface, following
methods known to
those of ordinary skill in the art. Or, covalent attachment of a specific
binding partner (analyte
specific substance) to a test piece which test piece comprises a solid phase
of derivatized
plastic, metal, silicon, or glass may be utilized. Covalent attachment methods
are known to
those skilled in the art and include a variety of means to irreversibly link
specific binding
partners to the test piece. If the test piece is silicon or glass, the surface
must be activated prior
to attaching the specific binding partner. Also, polyelectrolyte interactions
may be used to
immobilize a specific binding partner on a surface of a test piece by using
techniques and
chemistries. The preferred method of attachment is by covalent means.
Following attachment
of a specific binding member, the surface may be further treated with
materials such as serum,
proteins, or other blocking agents to minimize non-specific binding. The
surface also may be
scanned either at the site of manufacture or point of use to verify its
suitability for assay
purposes. The scanning process is not anticipated to alter the specific
binding properties of the
test piece.
While the present invention discloses the preference for the use of solid
phases, it is
contemplated that the reagents such as antibodies, proteins and peptides of
the present invention
can be utilized in non-solid phase assay systems. These assay systems are
known to those
skilled in the art, and are considered to be within the scope of the present
invention.
It is contemplated that the reagent employed for the assay can be provided in
the form
of a test kit with one or more containers such as vials or bottles, with each
container containing
a separate reagent such as a probe, primer, monoclonal antibody or a cocktail
of monoclonal
antibodies, or a polypeptide (either recombinant or synthetic) employed in the
assay. Other
components such as buffers, controls, and the like, known to those of ordinary
skill in art, may
be included in such test kits. It also is contemplated to provide test kits
which have means for
collecting test samples comprising accessible body fluids, e.g. blood, urine,
saliva, and stool.
Such collection means include lancets and absorbent paper or cloth for
collecting and
stabilizing blood; swabs for collecting and stabilizing saliva; cups for
collecting and stabilizing
urine or stool samples. Collection materials, papers, cloths, swabs, cups and
the like, may
optionally be treated to avoid denaturation or irreversible adsorption of the
sample. The
collection materials also may be treated with or contain preservatives,
stabilizers or
antimicrobial agents to help maintain the integrity of the specimens. Test
kits designed for the
collection, stabilization, and preservation of test specimens obtained by
surgery or needle
biopsy are also useful. It is contemplated that all kits may be configured in
two components;
one component for collection and transport of the specimen, and the other
component for the
analysis of the specimen. Further, kits for the collection, stabilization, and
preservation of test
specimens may be configured for use by untrained personnel and may be
available in the open
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
37
market for use at home with subsequent transportation to a laboratory for
analysis of the test
sample.
The present invention will now be described by way of examples, which are
meant to
illustrate, but not to limit, the scope of the present invention. All
references to the literature,
including patents, patent applications and scientific publications, both
hereinafter and above,
are incorporated by reference in their entirety.
EXAMPLES
Example 1: Isolation of Full Length cDNA Clones of Human Vanilloid receptor
(hVRI)
The amino acid sequence for the rat vanilloid receptor (Caterina et al.,
(1997) supra)
was used to search the LifeSeqTM human expression database (Incyte
Pharmaceuticals, Inc.,
Palo Alto, CA) for human vanilloid receptor (hVR) sequences. A search
performed with the rat
sequence (using both BLAST and Smith Waterman algorithms) identified two
overlapping
ESTs (1427917 and 3460342) highly homologous to the rat sequence. These two
ESTs
overlapped to form a consensus sequence of 270 nt; 1427917 contained the DNA
sequence
from position 1-227 while 3460342 contained the DNA sequence from position 32-
270. The
consensus sequence derived from the two ESTs was compared with the published
rat VR1
amino acid sequence (SEQ ID N0:4) using the GCG FRAMEALIGN program (FIG. 1)
and
showed 89 % identity.
PCR primers were prepared from the consensus sequence of ESTs 1427917 and
3460342 to clone the full length gene by RACE PCR (Frohman, MA ( 1991 )
Methods
Enzymology 218:340-362). Two antisense RACE primers corresponding to
nucleotide (nt)
positions 59-86 and 120-140 from the aligned ESTs (1755 to 1782 and 1816-1836
of SEQ ID
N0:7 respectively) were used to prime a human small intestine cDNA library and
PCR
products were isolated according to the manufacturer's instructions (Marathon
Ready cDNA,
CLONTECH). cDNAs were obtained which extended 1 kb upstream of the primers. An
additional RACE primer was synthesized from the 5'- region of this PCR product
(corresponding to nucleotides 855-883 of SEQ ID N0:7) and used to extend the
cDNA clones
upstream of the translation initiation codon. The sequences down stream of the
EST consensus
sequence were determined by DNA sequence analysis of the two Incyte clones.
The final
nucleic acid consensus sequence termed hVRI, (SEQ ID N0:7) and deduced amino
acid
sequence, (SEQ ID N0:8) were aligned using the GAP Program (Genetics Computer
Group,
Version 9, University of Wisconsin) with the rat gene and polypeptide
sequences (SEQ ID
NOs:2 and 4, respectively) and shown to have a DNA sequence identity of 82%
(GAP Program,
FIG. 2) and an amino acid sequence identity of 86% (GAP Program, FIG. 3). As
shown in
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
38
FIG. 3, the amino acid sequence from positions 100-800 of SEQ ID N0:8 is 91 %
identical to
the rat gene product illustrating the sequence divergence at the amino
terminal and carboxy
terminal ends of the protein.
PCR primers were designed to amplify the hVRI coding sequence while
maintaining
the relatively good Kozak consensus sequence for translation (an "A" at
position -3 relative to
the translation start site) and to provide flanking restriction enzyme sites
for subsequent cloning
into an expression vector. The sequence of the primers is shown below:
5' Mlu Cap Rec TTTAAACGCGTAGGATGAAGAAATGGAGC (SEQ ID NO:S)
Mlu 1 start
3' Sal Cap Rec TATATTGTCGACGTCCTCACTTCTCCCCG (SEQ ID N0:6)
Sall stop
The hVRI open reading frame was amplified by PCR using CLONTECH (Palo Alto,
CA) human small intestine cDNA as a template and Pfu polymerase (Stratagene~,
I,a Jolla, CA)
to ensure a high fidelity product. The resulting PCR product was approximately
2500 by in
length. The PCR product was digested with Mlul and Sall and cloned into the
pCIneo
mammalian expression vector (Promega) at the Mlul and Sall sites. In addition,
the PCR
product from the human intestine cDNA was sequenced directly.
DNA sequencing of individual clones following transfection of the ligated PCR
insert
and the vector revealed three forms of the hVRl gene product. Clone hVRI-1 was
identical to
SEQ ID N0:7 while hVRI-5 and hVRI-13 each contained two nucleotide
substitutions which
resulted in amino acid changes in the translation product. Clone hVRI-5
contained a both a C
to G substitution at position 1144 (designated C 1144G) and a C to T
substitution at position
1605 (C1605T) in SEQ ID N0:7. Clone hVRI-13 contained both a G1325T
substitution and
an A1952G substitution. The direct sequencing of the PCR product consistently
identified two
peaks at positions 1144, 1605 and 1952 (see FIG. 4) suggesting that these
variations represent
polymorphic gene products. In contrast, only a single peak was found at
positions 1325
suggesting that these substitutions were likely to be cloning artifacts. The
artifact change at nt
position 1325 for clone hVRl-13 was corrected by site specific mutagenesis
using the
QuickChangeTM Site-Directed Mutagenesis Kit following the protocols of the
manufacturer
(Stratagene~) and resulted in clones hVRI-13.1.
The polymorphic changes also resulted in amino acid changes in the hVRI
protein.
Specifically, the polymorphic variations at nucleotide positions 1144 and 1605
in clone hVRI-5
resulted two amino acid substitutions at position 315 (a methionine rather
than an isoleucine)
and 469 (an isoleucine rather than a threonine) of SEQ ID N0:8 whereas in
clone hVRI-13.1,
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
39
the variation at nucleotide position 1952 resulted in a protein containing a
valine in place of
isoleucine at amino acid position 586 of SEQ ID N0:8.
Example 2: Additional Vanilloid Recepotor Homologs.
The Incyte and dbEST data bases were further searched using Blast and Smith-
Waterman algorithms for homologies using the rat and human VR1 amino acid
sequences. An
additional Incyte EST (1682513) was found with homology in the proposed poor-
loop region
of rVRl (Catering et al., 1997, supra). Sequencing clone 1682513 and
subsequent RACE
cloning from kidney cDNA libraries identified a 3599 cDNA sequence (SEQ ID
NO:1)
containing an open reading frame (position 435-3050) coding for an 871 amino
acid protein
(SEQ ID N0:3) which we termed hVR3.
An alignment of hVR3 with hVRl, rVRI and hVRLI (Catering et al, Nature
398:436-441 1999) using the GCG Pileup program with default parameters shows
significant homology of hVR3 with the other ion channel members (FIG. 3).
Particularly
significant homology is found in the following structural domains all four
sequences (i.e.
hVR-l, rVR-l, hVR-2 and hVR-3):
a) three ankaryn repeat domains, at position 239-270, 294-317 and 370-403 in
of FIG. 3
b) six hydrophobic regions consistent .with transmembrane domains, positions
471-493,
519-540, 555-574, 579-597, 621-640 and 703-730
b) homology in the poor-loop region thought to mediate ion transport, position
671-691
The GAP analysis of hVRI (bottom sequence) and hVR3 (top sequence) DNA
sequences (SEQ ID NOs:7 and 1 respectively) showed 55% sequence identity (FIG.
5) while
the GAP analysis of the derived amino acid sequences of hVRI (bottom sequence)
and hVR3
(top sequence), SEQ ID NOs:8 and 3 respectively, showed 46% sequence identity
(FIG. 6).
Example 3: Quantitative RT-PCR.
Tissue distribution of hVRI and hVR3 were determined by quantitative PCR (Q-
PCR)
using the ABI Prism 7700 following the recommendations of the manufacturer (PE-
Applied
Biosystems, Foster City, CA). The version of Q-PCR we utilized is referred to
as TaqMan
PCR.
In TaqMan PCR, a pair of amplification primers that hybridize to the target at
sequence
defined positions are utilized. In addition, a nucleic acid probe (labeled
with a fluorophore and
quencher molecule at either end, the TaqMan primer) is utilized that
hybridizes to the target at a
position between the two primers and preferably adjacent to one of the
primers.
Importantly, this probe has a melting temperature that is significantly higher
(8-10°C)
than that of the primers. After the addition of the appropriate reagents
(thermostable
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
polymerise, dNTPs, buffer, Mg2+) thermal cycling is begun and as in
traditional PCR, the
product doubles or nearly doubles each round in exponential fashion. Because
the probe has a
high melting temperature, during the course of the amplification reaction the
polymerise
encounters the probe bound tightly to the target at each
hybridization/extension phase. The
polymerise has a 5'-3' nuclease activity that proceeds to degrade the
obstruction and thereby
release the fluorophore from the adjacent quencher molecule. After release,
the fluorophore can
be directly measured via laser excitation at the appropriate wave length.
Consequently, the
release of the probe fluorophore is directly linked to amplification and
quantitative results can
be generated by comparison to the amplification of appropriate standards of
known
10 ~ concentration.
The amplification primers and nucleic acid probe used in Q-PCR were as
follows:
Primer Sequence SEQ ID NO:
orwar ~ - 1 I.;HHh 1 1 L-J
everse AG~CTTGTAGTCA-3' SEQ ID NO:10-
aq an CA - Q ID
orwar CCACGA~AT-3' SEQ ID N0:12-
everse G-3' - - Q ID N
aq an ATCAA~I'GTACTGCTGCG(i(iACA-3' SEQ ID NO:14
The hVRI amplification primers corresponded to nucleotide positions 2102-2122
of SEQ ID
N0:7 for the forward primer and nucleotide positions 2161-2183 of SEQ ID N0:7
for the
15 reverse primer. The TaqMan primer corresponded to the reverse complement of
nucleotide
positions 2132-2159 of SEQ ID N0:7. The hVR3 forward, reverse and Taqman
primers
correspond to positions 1761-1780, 1826-1842 and 1795-1818 of SEQ ID NO:1
respectively.
Ten pg total RNA was mixed with 5 pL of 50 ng/pL random hexamers in a final
volume of 59
pL water, heated at 70° C for 10 min and placed on ice. The samples
were adjusted to 20 mM
20 Tris, pH 8.4, SO mM KCI, 3 mM MgCl2, 10 mM DTT, 0.5 mM dNTP and 800 units
Superscript~ II RT (Gibco BRL) in a 100 pL total volume and incubated at
25° C for 10 min.,
then 42° C for 50 min followed by 70° C for 10 min. and the
samples were placed on ice. The
samples were then incubated with 8 units of RNase H at 37° C for 20
min. The cDNA was
purified and desalted by filtration on a Chromaspin column (CLONTECH) in TE
and the
25 samples quantified by OD260. The Q-PCR reactions used 10 ng of cDNA
template per 50 pL
reaction containing 1 X PCR bufferII with 600 nM ROX (PE-Applied Biosystems),
5 mM
MgCl2 and 1.25 units Amplitaq Gold (PE-Applied Biosystems). The samples were
incubated
at 95° C for 10 min. followed by 40 cycles of 95° C for 15 sec
and 60° C for 1 min. Copy
number was estimated by a dilution of plasmid DNA containing hVRI or hVR3 and
the cDNA
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
41
samples were normalized with Q-PCR reactions using 28S rRNA specific primers.
The hVRI
and hVR3 RNA were expressed in relatively low amounts in all of the RNA
samples tested
(FIG. 7A and B). The hVRI RNA was most abundant in brain, dorasal root
ganglion (DRG),
bladder, testes, and kidney while hVR3 was most abundant in kidney and
bladder.
Example 4: Northern blotting assays.
Alternatively, or in addition to performing quantitative RT-PCR described in
Example
2, the well known technique of Northern blotting provides for the detection of
messenger RNA
and gives a reasonable estimation of its size and steady-state level in a
particular tissue
(Sambrook et al., supra). A Northern blotting assay may be performed as
follows: Multiple
Tissue Northern Blots are purchased from CLONTECH and probed with a vanilloid
receptor
cDNA fragment including all or part of SEQ ID NO:1. This fragment is labeled
with oc-32P-
dCTP by random priming using a commercial labeling kit (Stratagene~) to a
specific activity of
1.1 x 109 cpm/ug DNA. The blots (membranes) are prehybridized at 60 °C
for 1 hour in
Express Hyb solution (supplied with the kit) and hybridized (also in Express
Hyb solution) at
the same temperature for two hours in the presence of denatured probe at 2 x
106 cpm/mL.
After washing the blots twice in 2 x SSC + 0.5% SDS (20 min each wash), and
twice under
stringent conditions (0.1 x SSC + 0.01% SDS, 50 °C, 20 min. each wash),
the filters are
exposed to a phosphorimager screen.
Example 5: Ribonuclease Protection Assay
Alternatively, instead of or in addition to performing a Northern blot as
described in
Example 3, a ribonuclease protection assay may be performed as follows:
A. Labeling of Complementary RNA (cRNA) Hybridization Probes. Labeled sense
and antisense riboprobes are transcribed from the EST sequence, which contains
an RNA
polymerise promoter such as SP6 or T7. The sequence may be from a vector
containing the
appropriate EST insert or from a PCR-generated product of the insert using PCR
primers which
incorporate an RNA polymerise promoter sequence. The transcripts are prepared
in a 20 ~L
reaction volume containing 1 pg of DNA template, 2 ~L of 100 mM
dithiothreitol, 0.8 ~L of
RNasin (10-40U), 500 pM each of ATP, CTP, GTP, 5 ~L (alpha32P) UTP or 100-500
~M
biotinylated UTP, and 1 ~L of RNA polymerise in transcription buffer (40 mM
Tris-HCI, pH
7.5, 6 mM MgCl2, 2 mM spermidine HCI, 5 mM NaCI). Following incubation at
37°C for one
hour, the transcripts are treated with DNase I (15 U) for an additional 30 min
to digest the
template. The probes then are isolated by spin columns, salt precipitation or
electrophoresis
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
42
techniques which are well-known in the art. Finally, the probes are dissolved
in lysis buffer (5
M guanidine thiocyanate, 0.1 M EDTA, pH 7.0).
B. Hybridization of Labeled Probe to Target. Approximately 20 ~g of extracted
total
cellular RNA, prepared as described in Sambrook, et al. supra, is placed in 10
~L of lysis
buffer and mixed with either (i) 1 x105 cpm of radioactively labeled probe or
(ii) 250 pg of
non-isotopically labeled probe, each in 2 pL of lysis buffer. The mixture then
is incubated at
60°C for 5 min and hybridized overnight at room temperature. See, T.
Kaabache et al., Anal.
Biochem. 232: 225-230 (1995).
C. RNase Di.-esg tion. Hybridizations are terminated by incubation with 380 pL
of a
solution containing 40 pg/mL RNase A and 625 U/mL RNase T1 in 1 mM EDTA, 300
mM
NaCI, 30 mM Tris-HCl pH 7.4 for 45-60 min at room temperature. RNase digestion
then is
terminated by the addition of 60 pL of proteinase-K (1.7 mg/mL) containing
3.3% SDS,
followed by incubation for 30 min at 37°C. The digested mixture then is
extracted with
phenol:chloroform:isoamyl alcohol to remove protein. The mRNA:cRNA hybrids are
precipitated from the aqueous phase by the addition 4 ~g yeast tRNA and 800 pL
of ethanol,
and incubation at -80°C for 30 min. The precipitates are collected by
centrifugation.
D. Fragment Analysis. The precipitates are dissolved in 5 pL of denaturing gel
loading
dye (80% formamide, 10 mM EDTA, pH 8.0, 1 mg/mL xylene cyanol, 1 mg/mL
bromophenol
blue) and electrophoresed in 6 % polyacrylamide TBE, 8 M urea denaturing gels.
The gels are
dried under vacuum and autoradiographed. Quantification can be performed by
comparing the
counts obtained from the test samples to a calibration curve that was
generated by utilizing
calibrators that are the sense strand. In cases where non-isotopic labels are
used, hybrids are
transferred from the gels to membranes (nylon or nitrocellulose) by blotting
and then analyzed
using detection systems that employ streptavidin alkaline phosphatase
conjugates and
chemiluminesence or chemifluoresence reagents. Again, expression of an mRNA
which is
detectable by the labeled probe in a particular tissue suggests that vanilloid
receptor is produced
in that tissue.
Example 6: Identification of Additional Members of the Vanilloid Receptor
Family.
The Northern blot method described in Example 3 supra can detect distinct
messages
only if they have large differences in sizes (more than 100 to 200
nucleotides); small
differences in message size (such as those arising from alternative splicing
in the coding region)
are not detected by this method. Instead, other strategies are used to detect
possible variants of
vanilloid receptor message and determine their steady-state levels. Splice
variants in the coding
region can be detected by RT-PCR using primers designed to give products of
small size.
Variants in the 3' UTR can also be detected by RT-PCR. In RT-PCR, the forward
primer is
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
43
chosen in a region of the ORF that is common to all message variants known so
far, as close as
possible to the stop codon. The reverse primer is an oligo-dT anchored with a
dinucleotide for
the specificity. Since the first nucleotide of the anchor can be A, C, or G,
and the second
nucleotide can be either A, C, G, or T, a combination of 12 anchored reverse
primers are
needed. Each reverse primer is thus used with the unique forward primer, in 12
different
reactions. The PCR products are then run in an agarose gel and detected by UV
fluorescence
after ethidium bromide staining. Because of its high sensitivity and
specificity, this method
allows the detection of even small size and sequence variations in the 3' UTR.
Sequence
variations at the 5' end of the mRNA can be found using the RACE-PCR technique
with
similar sensitivity of detecting variant products.
Example 7: Dot Blot/Slot Blot
Dot and slot blot assays are quick methods to evaluate the presence of a
specific nucleic
acid sequence in a complex mix of nucleic acid.
Up to 20 ~g of RNA is mixed in 50 ~L of 50% formamide, 7% formaldehyde, 1X
SSC,
and allowed to incubate 15 min at 68°C and cooled on ice. Then, 100 ~L
of 20X SSC is added
to the R~~1A mixture and loaded onto a vacuum-manifold apparatus that has a
prepared
nitrocellulose or nylon membrane. The membrane is soaked in water, 20X SSC for
1 hour,
placed on two sheets of 20X SSC prewet Whatman #3 filter paper, and inserted
into a slot blot
or dot blot vacuum manifold apparatus. The slot blot is analyzed with probes
prepared and
labeled as in Example 4 supra.
Other methods and buffers not specifically detailed for Examples 3-5 are
described in
Sambrook et al., supra.
Example 8: In Situ Hybridization
This method is useful to directly detect specific target nucleic acid
sequences in cells
using detectable nucleic acid hybridization probes.
Tissues are prepared with cross-linking fixatives agents such as
paraformaldehyde or
glutaraldehyde for maximum cellular RNA retention. See, L. Angerer et al.,
Methods in Cell
Biol. 35: 37-71 (1991). Briefly, the tissue is placed in greater than 5
volumes of 1%
glutaraldehyde in 50 mM sodium phosphate, pH 7.5 at 4°C for 30 min. The
solution is changed
with fresh solution for a further 30 min fixing. The fixing solution should
have an osmolality
of approximately 0.375% NaCI. The tissue is washed once in isotonic NaCI to
remove the
phosphate.
The fixed tissues then are embedded in paraffin, as follows. The tissue is
dehydrated
through a series of ethanol concentrations for 15 min each: 50% twice, 70%
twice, 85%, 90%
and 100% twice. The tissue next is soaked in two changes of xylene for 20 min
each at room
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
44
temperature; then it is soaked in two changes of 1 xylene: l paraffin for 20
min each at 60°C;
and then it is soaked in three final changes in paraffin for 15 min each.
The tissue next is cut in 5 pm sections using a standard microtome and placed
on a slide
previously treated with the tissue adhesive 3-aminopropyltriethoxysilane.
Paraffin is removed from the tissue by two 10 min xylene soaks and rehydrated
in a
series of ethanol concentrations; 99% twice, 95%, 85%, 70%, 50%, 30% and
distilled water
twice. The sections are pre-treated with 0.2 M HCl for 10 min and
permeabilized with 2 pg/mL
Proteinase-K at 37°C for 15 min.
Labeled riboprobes transcribed from the pSPORTI plasmid containing fragments
of
vanilloid receptor cDNA are hybridized to the prepared tissue sections and
hybridized
overnight at 56°C in 3X standard saline extract and 50% formamide.
Excess probe is removed
by washing in 2X standard saline citrate and 50% formamide followed by
digestion with 100
pg/mL RNase A at 37°C for 30 min. Fluorescence probe is visualized by
illumination with UV
light under a microscope. Fluorescence in the cytoplasm is indicative of mRNA
production.
Fluorescence in the nucleus detects the presence of genomic material.
Alternatively, the
sections can be visualized by autoradiography.
Example 9: Bacterial Expression and Purification of Human Vanilloid Receptor
A. Construction of Expression Vectors containing DNA Fragments Encoding hVR3:
DNA fragments encoding hVR3 (containing all or part of SEQ ID NO:1) are
generated by PCR
for introduction into a prokaryotic expression vector such as pProExI, (Life
Technologies,
Gaithersburg, MD) using hVR-3 as template DNA. The primers are designed to
allow the
inframe insertion of the vanilloid receptor fragment with the prokaryotic
translation initiation
and His tagged regions. After amplification, the PCR products are digested
with appropriate
restriction enzymes, and ligated into pProExI, (previously digested with the
same restriction
enzymes) using standard ligation techniques (see J. Sambrook, et al. supra). E
coli DHSoc
cells are then transformed with the ligation mixtures and selected on medium
containing
ampicillin. Plasmid DNAs are prepared from individual clones and subjected to
restriction
enzyme analysis to confirm that the hVR3 inserts are in the proper
orientation.
B. Purification of His-tagged hVR3: In the pProExI expression system, a
desired
protein is produced with a tag of six histidine residues fused upstream of the
protein.
Accordingly, the pProExI vectors containing the cloned hVR3 genes or gene
fragments thereof
are expected to produce fusion proteins of his-tagged hVR3 which could be
purified by affinity
chromatography to a nickel-conjugated resin. To produce the fusion proteins
for purification,
recombinant bacteria are grown overnight in Luria broth containing 50 pg/mL
ampicillin (LB +
amp) on a rotary shaker at 225 rpm, at 37°C and used to inoculate fresh
LB + amp (300 mL) at
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
a 1:10 dilution. The fresh cultures are incubated, with shaking at 225 rpm, at
37°C for 1 hour,
induced with isopropyl f3-D-thiogalactopyranoside (IPTG, 1 mM) and re-
incubated for an
additional 3 hours. Cultures are then centrifuged at 5,000 g to pellet the
bacteria. Pellets are
resuspended in 10 mL of lysis buffer (50 mM sodium phosphate (pH 8.0), 0.3 M
NaCI, 1 mM
phenylmethylsulfonyl fluoride (PMSF), and 0.2 mM benzamidine) containing 1 %
TRITON-
X100 at 4°C and sonicated on ice until greater than 90% of the cells
are lysed (as determined by
OD590). After sonication, cell debris and unlysed cells are removed by
centrifugation at
10,000 g for 10 minutes at 4°C. The resulting supernatant is loaded
onto a 3 mL bed volume
nickle-nitro-triacetic acid column (Ni-NTA,.QIAGEN, Chatsworth, CA) pre-
equilibrated with
10 10 bed volumes of lysis buffer containing 0.1% TRITON-X100: The column is
sequentially
washed with 10 bed volumes of wash buffer (50 mM sodium phosphate, pH 6.0, 0.3
M NaCI,
and 0.1% TRITON-X100) and 10 bed volumes of 50 mM imidazole in the same buffer
(to
remove non-specifically bound proteins). The his-tagged vanilloid receptor
fusion proteins are
eluted from the column with a total of 5 bed volumes of wash buffer containing
0.2 M
15 imidazole and collected as 2 mL fractions. The purity of each eluted fusion
protein is assessed
after SDS-PAGE on a 13.5% gel stained with Coomassie blue. The protein
concentration is
determined by absorbance at 280nm after determining the relative extinction
coefficients for
each of the recombinant fusion proteins or by using the bicinchoninic acid
procedure (BCA
Protein Assay, Pierce).
Example 10: Expression of hVR3 in Eukaryotic Cells
Expression of hVR3 in mammalian cells was achieved by lipofection using the
Lipofectamine Plus Reagent (Gibco BRL). HEK 293 cells (S x 106) were plated
into 10 cm
culture dishes (Falcon 1005) in antibiotic free media (Dulbecco's Modified
Eagle's Medium
(DMEM) supplemented with 2 mM Glutamine and 10% fetal bovine serum (FBS),
Gibco BRL,
Gaithersburg, MD) in a humidified atmosphere containing 5% C02 at 37°C
and grown
overnight to approximately 70-80% confluence. Following media replacement (8
mL of the
antibiotic free medium), the cells were incubated with a mixture of DNA and
Lipofectamine
PLUS Reagent (17 pg DNA, 147 pL PLUS Reagent, 42 pL lipofectamine) diluted
into 2.1
mLs of serum-free media and incubated for three-four hours. An additional 8
mLs of antibiotic
free medium was then added and the cells were incubated overnight. For
transient assays, the
cells were replated into 96 well plates at 1 x 105 cells /well and channel
activity was measured
the following day (see example 10). For stable cell lines, the neomycin-
resistant cells were
selected with 800 pg/mL Geneticin (Gibco BRL) and the media was replaced
frequently to
remove dead cells and debris. Individual colonies were obtained by clonal
selection, a
technique well known in the art.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
46
Example 11: Functional Analysis of hVR3 in Eukaryotic Cells
A. Functional characterization by FLIPR analysis: A fluorescent imaging plate
reader
(FLIPR, Molecular Devices, Sunnyvale CA) is used to assay changes in
intracellular calcium in
cells pre-loaded with the calcium sensitive dye Fluo-3 AM (Molecular Probes,
Eugene,
Oregon). Either transiently transfected HEK 293 cells or stably transfected
subclones of these
cells are grown to confluence in black-walled 96-well tissue culture plates in
complete medium
(antibiotic free medium described in Example 9 + 1% antibiotic/antimycotic
(Gibco BRL)+ 200
pg/mL Geneticin). A Fluo-3 AM solution is prepared by dispersing 40 pL of a 1
mg/mL stock
Fluo-3/DMSO solution into 10 mL Dulbecco's phosphate-buffered saline (D-PBS).
The
growth medium is replaced with the Fluo-3 solution and the cells are incubated
in the dark at
room temperature for 1 hr. The cells are washed gently 3 times with D-PBS
using a Denley
Cellwash instrument resulting in a final volume of 100 ~L D-PBS per well.
Three different plates are loaded into the FLIPR for the assay: (1) the washed
HEK 293
cell plate; (2) a plate containing D-PBS or vanilloid receptor antagonist at 4
times the desired
concentration; and (3) a plate containing D-PBS or vanilloid receptor agonists
at 4 times the
desired concentration. The cells are assayed in FLIPR as follows. All
pipetting steps are
performed by the FLIPR's built-in pipetting armature: 50 pL from the
antagonist/D-PBS plate
is added to the cell plate 10 seconds after the start of the analysis and
incubated for 5 min
followed by the addition of 50 pL from the agonist plate and incubation for an
additional 10
min. The FLIPR instrument collected fluorescence data throughout the course of
the analysis.
B. Functional characterization using Xenopus oocytes expression: Xenopus
oocytes
are used for expression of hVR3 and measuring electrophysiological responses
essentially as
described by Briggs et al. (Neuropharmacology. 1995 Jun;34(6):583-590 [1995]).
Female
Xenopus Ic~vis frogs are obtained from Nasco (Fort Atkinson, WI) and are
maintained and
treated using standard protocols approved by Abbott's Institutional Animal
Care and Use
Committee. Frogs are anesthetized with tricaine (0.28%) and sacrificed by
decapitation and
pithing. Ovaries are removed and placed in low-Ca2+ Barth's solution (87.5 mM
NaCI, 2.5 mM
KCI, 1 mM MgCl2, and 10 mM Na-HEPES buffer, final pH 7.55). Sections of the
ovaries can
be maintained at 4°C for up to three weeks for additional oocyte
preparations.
For each oocyte isolation, several ovary lobes are taken, opened using blunt
dissection,
rinsed in low-Caz+ Barth's solution, and incubated in collagenase (Type lA,
Sigma Chemical
Co., St. Louis, MO; 2 mg/mL in low-Ca2+ Barth's solution) for 1-2 hours at
room temperature.
Defolliculation is completed manually. The isolated oocytes are maintained at
17-18°C in
normal Barth's solution (90 mM NaCI, 1 mM KCI, 0.66 mM NaN03, 2.4 mM NaHC03,
0.74
mM CaCl2, 0.82 mM MgCl2, 2.5 mM sodium-pyruvate, 10 mM Na-HEPES buffer (final
pH
7.55), 100 U/ml penicillin and 100 ~g/ml streptomycin). Oocytes are injected
with 50 ng (50
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
47
nL of 1 ~g/uL) hVR3 RNA within 24 hours of their preparation, and are used
within 2-7 days
after injection.
Recordings are made using two-electrode voltage clamp in a virtual-ground
configuration (Geneclamp 500 amplifier, Axon Instruments, Foster City, CA).
Electrodes are
made from borosilicate glass (1.5 mM o.d., 1.17 mm i.d.) and are filled with
120 mM KCI. The
impedance of the current-passing electrode is determined. Voltage as well as
current are
recorded to monitor the quality of the voltage clamp and voltage losses are
kept below 2 mV.
Experiments are performed in OR2 solution containing 90 mM NaCI, 2.5 mM KCI,
2.5
mM CaClz, 1 mM MgClz, and 5 mM Na-HEPES buffer, final pH 7.4. The recording
chamber
(RCS/18, Warner Instruments, Hamden, CT) is perfused at 3 mL/min. Capsaicin is
applied for
a precisely controlled time using a push/pull applicator positioned to within
300-400 um from
the oocyte and a solenoid valve controlled by the data acquisition system
(Digidata 1200 A/D
board and pClamp 6 software; Axon Instruments). Antagonists (capsazepine) are
superfused in
the bathing solution for > 3 minutes prior to testing agonist (capsaicin) in
the presence of
antagonist. Both antagonist and agonist are present in the ligand applicator
so that the
concentration of antagonist remains constant during agonist application.
C. Functional characterization using whole cell patch clamping of transfected
mammalian cells: HEK-293 cells stably transfected with hVR3 are maintained in
the same
culture medium as used for FLIPR measurements, but are plated onto glass
coverslips in 24-
well culture dishes and are used at low cell-density so that recordings so
that recordings can be
made from individual cells. Whole-cell patch-clamp recordings are made using
standard
techniques (Axopatch 2008 amplifier, Digidata 1200 A/D board and pClamp 6
software; Axon
Instruments). Electrodes are made from Corning 7052 glass (1.65 mm o.d., 1.1
mm i.d.;
Warner Instrument Corp., Hamden, CT) and have resistances of 1-4 MS2. The
external (bath)
solution contains 145 mM NaCI, 5 mM KCI, 2 mM CaCl2, 1 mM MgClz, 10 mM
dextrose, and
10 mM Na-HEPES buffer (final pH 7.4, 310 mOsm). The internal (pipette)
solution contains
130 mM K-aspartate, 10 mM KCI, 10 mM K-BAPTA (Ca2+ chelator), 2 mM Mg-ATP, and
10
mM K-HEPES buffer (final pH 7.3, 280 mOsm).
Agonists and antagonists are applied to the recorded cell using a DAD-12
computer-
controlled micro-superfusion system (ALA Scientific, Westbury, NY). Responses
typically are
recorded at a holding potential of -60 mV and are normalized to the response
to 1 uM capsaicin
as a standard to correct for variance of receptor expression from cell to
cell. A protocol is
devised wherein a compound can be tested in the midst of the standard 1 uM
capsaicin
application. After applying capsaicin for 20 seconds to determine the standard
response, the
micro-superfusion is switched immediately to the test compound (e.g.,
different concentration
of capsaicin, or different agonist, or antagonist in the presence of
capsaicin) for 20 seconds,
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
48
followed immediately by 1 uM capsaicin again for 20 seconds to test
reversibility of the test
compound, and finally back to normal bath solution.
Example 12: Production of Synthetic Peptides of human vanilloid receptor
Synthetic peptide sequences (15-25 amino acids) are selected from the hVR3
sequence
(SEQ ID N0:8). Peptides are synthesized on an ABI Peptide Synthesizer
(available from
Applied Biosystems, Foster City, CA), Model 431A, using standard reagents and
conditions
known in the art for solid phase peptide synthesis (see for example, Stewart,
J.M., and Young,
D.J., Solid Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, 1963).
Briefly, a
peptide sequence is generated on a resin (such as chloromethyl-polystyrene-
divinylbenzene) by
the sequential coupling of one or more amino acids or suitably protected amino
acids to a
growing peptide chain. Cleavage of the peptide from the resin and final
deprotection of the
peptide are achieved by adding the resin to 20 mL trifluoroacetic acid (TFA),
0.3 mL water, 0.2
mL ethanedithiol, 0.2 mL thioanisole and 100 mg phenol, and stirring at room
temperature for
1.5 hours. The resin then is filtered by suction and the peptide obtained by
precipitation of the
TFA solution with ether, followed by filtration. Each peptide is purified via
reverse-phase
preparative HPLC using a water/acetonitrile/0.1 % TFA gradient and
lyophilized. The product
is confirmed by mass spectrometry.
Example 13: Production of Polyclonal Antibodies to human vanilloid receptor.
A. Preparation of Immunizing Anti ,ens: Purified synthetic peptides are
prepared as
described in Example 10. To generate antigens for immunization, the purified
peptides are
conjugated to Keyhole Limpet Hemocyanin (KLH) and bovine serum albumin (BSA)
using an
Imject Activated Immunogen Conjugation Kit (Pierce, Rockford, Il) in
accordance with the
manufacturer's instructions.
B. Immunization Protocol: Polyclonal antisera are generated using the protocol
of the
Berkeley Antibody Company (Berkeley, CA). Before receiving the first
immunization, a
sample of preimmune blood (5 mL) is drawn from each of at least 2 rabbits.
Afterward, each
rabbit is injected subcutaneously with an aliquot of KLH-conjugated peptide
(200-500 fig) in
Complete Freunds Adjuvant. After 21 days, the immune response is boosted with
a second
subcutaneous injection of KLH-conjugated peptide (100-250 fig) in Incomplete
Freund's
Adjuvant. Blood (50 mL) is collected on day 31 and serum tested for reactivity
to BSA-
coupled peptide using an enzyme linked immunoadsorbant assay (ELISA).
Subsequent boosts
with KLH-conjugated peptide are given on days 42, 63 and 84 (post injection
#1) and
production bleeds (50 mL) drawn on days 52, 73 and 94 for testing by ELISA in
the manner
described. Serum is then stored at -20°C until further use.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
49
Example 14: Inhibition of endogenous vanilloid receptor expression.
Antisense RNA or DNA is a strategy currently widely used to reduce or
completely
block the endogenous synthesis of proteins . The antisense molecule can be an
oligonucleotide
targeted to a particular region of the endogenous message, or can be
transcribed from an
expression vector in which the cDNA for the target gene is ligated in the
antisense orientation.
In the case of vanilloid receptor, multiple antisense molecules (20-30 nt) are
made spanning the
complete mRNA and inhibition is measured by the reduction in steady state
vanilloid receptor
RNA levels in transfected cells using quantitative RT-PCR (Example 2). The
oligonucleotides
are ranked by their ability to inhibit expression and the best are used in
further experiments.
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
1
SEQUENCE LISTING
<110> Abbott Laboratories
Masters, Jeffrey N.
Vos, Melissa H.
<120> Human Vanilloid Receptor Gene
<130> 6430.US.P1
<140> US 09/438,997
<141> 1999-11-12
<150> US 09/191,139
<151> 1998-11-13
<160> 16
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 3599
<212> DNA
<213> Homo sapiens
<400> 1
gagccaccca ctgctccagc ctgccccagc tgttccctct gtctgtcctc tctgttttgc 60
agatggggaa actgaggctt aggtcgggga tctagacaat tgggatttaa acccagggac 120
tatccagccc caaagccctt cccaccacac caggtggcct gtcctggggc cagctctgca 180
cacagggcct ggtgcccccg gggtgcttgg gaagtggcag ggcagaggtg ggccctgtgg 240
ctgttctggc tcagcttcta aaacaagagc ctctgctggg ggcagagggg ccgtgaaccc 300
ctgaaatgtt aggcagatac cctgtgggag ctttgttctg ggatgctaag aaccgcttga 360
ggatttaagc tttgccactt tggctccgga gcaagggcag agggctgagc agtgcagacg 420
ggcctggggc aggcatggcg gattccagcg aaggcccccg cgcggggccc ggggaggtgg 480
ctgagctccc cggggatgag agtggcaccc caggtgggga ggcttttcct ctctcctccc 540
tggccaatct gtttgagggg gaggatggct ccctttcgcc ctcaccggct gatgccagtc 600
gccctgctgg cccaggcgat gggcgaccaa atctgcgcat gaagttccag ggcgccttcc 660
gcaagggggt gcccaacccc atcgatctgc tggagtccac cctatatgag tcctcggtgg 720
tgcctgggcc caagaaagca cccatggact cactgtttga ctacggcacc tatcgtcacc 780
actccagtga caacaagagg tggaggaaga agatcataga gaagcagccg cagagcccca 840
aagcccctgc ccctcagccg ccccccatcc tcaaagtctt caaccggcct atcctctttg 900
acatcgtgtc ccggggctcc actgctgacc tggacgggct gctcccattc ttgctgaccc 960
acaagaaacg cctaactgat gaggagtttc gagagccatc tacggggaag acctgcctgc 1020
ccaaggcctt gctgaacctg agcaatggcc gcaacgacac catccctgtg ctgctggaca 1080
tcgcggagcg caccggcaac atgcgggagt tcattaactc gcccttccgt gacatctact 1140
atcgaggtca gacagccctg cacatcgcca ttgagcgtcg ctgcaaacac tacgtggaac 1200
ttctcgtggc ccagggagct gatgtccacg cccaggcccg tgggcgcttc ttccagccca 1260
aggatgaggg gggctacttc tactttgggg agctgcccct gtcgctggct gcctgcacca 1320
accagcccca cattgtcaac tacctgacgg agaaccccca caagaaggcg gacatgcggc 1380
gccaggactc gcgaggcaac acagtgctgc atgcgctggt ggccattgct gacaacaccc 1440
gtgagaacac caagtttgtt accaagatgt acgacctgct gctgctcaag tgtgcccgcc 1500
tcttccccga cagcaacctg gaggccgtgc tcaacaacga cggcctctcg cccctcatga 1560
tggctgccaa gacgggcaag attgggatct ttcagcacat catccggcgg gaggtgacgg 1620
atgaggacac acggcacctg tcccgcaagt tcaaggactg ggcctatggg ccagtgtatt 1680
cctcgcttta tgacctctcc tccctggaca cgtgtgggga agaggcctcc gtgctggaga 1740
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
2
tcctggtgta caacagcaag attgagaacc gccacgagat gctggctgtg gagcccatca 1800
atgaactgct gcgggacaag tggcgcaagt tcggggccgt ctccttctac atcaacgtgg 1860
tctcctacct gtgtgccatg gtcatcttca ctctcaccgc ctactaccag ccgctggagg 1920
gcacaccgcc gtacccttac cgcaccacgg tggactacct gcggctggct ggcgaggtca 1980
ttacgctctt cactggggtc ctgttcttct tcaccaacat caaagacttg ttcatgaaga 2040
aatgccctgg agtgaattct ctcttcattg atggctcctt ccagctgctc tacttcatct 2100
actctgtcct ggtgatcgtc tcagcagccc tctacctggc agggatcgag gcctacctgg 2160
ccgtgatggt ctttgccctg gtcctgggct ggatgaatgc cctttacttc acccgtgggc 2220
tgaagctgac ggggacctat agcatcatga tccagaagat tctcttcaag gaccttttcc 2280
gattcctgct cgtctacttg ctcttcatga tcggctacgc ttcagccctg gtctccctcc 2340
tgaacccgtg tgccaacatg aaggtgtgca atgaggacca gaccaactgc acagtgccca 2400
cttacccctc gtgccgtgac agcgagacct tcagcacctt cctcctggac ctgtttaagc 2460
tgaccatcgg catgggcgac ctggagatgc tgagcagcac caagtacccc gtggtcttca 2520
tcatcctgct ggtgacctac atcatcctca cctttgtgct gctcctcaac atgctcattg 2580
ccctcatggg cgagacagtg ggccaggtct ccaaggagag caagcacatc tggaagctgc 2640
agtgggccac caccatcctg gacattgagc gctccttccc cgtattcctg aggaaggcct 2700
tccgctctgg ggagatggtc accgtgggca agagctcgga cggcactcct gaccgcaggt 2760
ggtgcttcag ggtggatgag gtgaactggt ctcactggaa ccagaacttg ggcatcatca 2820
acgaggaccc gggcaagaat gagacctacc agtattatgg cttctcgcat accgtgggcc 2880
gcctccgcag ggatcgctgg tcctcggtgg taccccgcgt ggtggaactg aacaagaact 2940
cgaacccgga cgaggtggtg gtgcctctgg acagcatggg gaacccccgc tgcgatggcc 3000
accagcaggg ttacccccgc aagtggagga ctgatgacgc cccgctctag ggactgcagc 3060
ccagccccag cttctctgcc cactcatttc tagtccagcc gcatttcagc agtgccttct 3120
ggggtgtccc cccacaccct gctttggccc cagaggcgag ggaccagtgg aggtgccagg 3180
gaggccccag gaccctgtgg tcccctggct ctgcctcccc accctggggt gggggctccc 3240
ggccacctgt cttgctccta tggagtcaca taagccaacg ccagagcccc tccacctcag 3300
gccccagccc ctgcctctcc attatttatt tgctctgctc tcaggaagcg acgtgacccc 3360
tgccccagct ggaacctggc agaggcctta ggaccccgtt ccaagtgcac tgcccggcca 3420
agccccagcc tcagcctgcg cctgagctgc atgcgccacc atttttggca gcgtggcagc 3480
tttgcaaggg gctggggccc tcggcgtggg gccatgcctt ctgtgtgttc tgtagtgtct 3540
gggatttgcc ggtgctcaat aaatgtttat tcattgaaaa aaaaaaaaaa aaaaaaaaa 3599
<210> 2
<211> 2687
<212> DNA
<213> Rattus norvegicus
<400> 2
gctggttgca aattgggcca cagaggatct ggaaaggatg gaacaacggg ctagcttaga 60
ctcagaggag tctgagtccc caccccaaga gaactcctgc ctggaccctc cagacagaga 120
ccctaactgc aagccacctc cagtcaagcc ccacatcttc actaccagga gtcgtacccg 180
gctttttggg aagggtgact cggaggaggc ctctcccctg gactgccctt atgaggaagg 240
cgggctggct tcctgcccta tcatcactgt cagctctgtt ctaactatcc agaggcctgg 300
ggatggacct gccagtgtca ggccgtcatc ccaggactcc gtctccgctg gtgagaagcc 360
cccgaggctc tatgatcgca ggagcatctt cgatgctgtg gctcagagta actgccagga 420
gctggagagc ctgctgccct tcctgcagag gagcaagaag cgcctgactg acagcgagtt 480
caaagaccca gagacaggaa agacctgtct gctaaaagcc atgctcaatc tgcacaatgg 540
gcagaatgac accatcgctc tgctcctgga cgttgcccgg aagacagaca gcctgaagca 600
gtttgtcaat gccagctaca cagacagcta ctacaagggc cagacagcac tgcacattgc 660
cattgaacgg cggaacatga cgctggtgac cctcttggtg gagaatggag cagatgtcca 720
ggctgcggct aacggggact tcttcaagaa aaccaaaggg aggcctggct tctactttgg 780
tgagctgccc ctgtccctgg ctgcgtgcac caaccagctg gccattgtga agttcctgct 840
gcagaactcc tggcagcctg cagacatcag cgcccgggac tcagtgggca acacggtgct 900
tcatgccctg gtggaggtgg cagataacac agttgacaac accaagttcg tgacaagcat 960
gtacaacgag atcttgatcc tgggggccaa actccacccc acgctgaagc tggaagagat 1020
caccaacagg aaggggctca cgccactggc tctggctgct agcagtggga agatcggggt 1080
cttggcctac attctccaga gggagatcca tgaacccgag tgccgacacc tatccaggaa 1140
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
3
gttcaccgaa tgggcctatg ggccagtgca ctcctccctt tatgacctgt cctgcattga 1200
cacctgtgaa aagaactcgg ttctggaggt gatcgcttac agcagcagtg agacccctaa 1260
ccgtcatgac atgcttctcg tggaaccctt gaaccgactc ctacaggaca agtgggacag 1320
atttgtcaag cgcatcttct acttcaactt cttcgtctac tgcttgtata tgatcatctt 1380
caccgcggct gcctactatc ggcctgtgga aggcttgccc ccctataagc tgaaaaacac 1440
cgttggggac tatttccgag tcaccggaga gatcttgtct gtgtcaggag gagtctactt 1500
cttcttccga gggattcaat atttcctgca gaggcgacca tccctcaaga gtttgtttgt 1560
ggacagctac agtgagatac ttttctttgt acagtcgctg ttcatgctgg tgtctgtggt 1620
actgtacttc agccaacgca aggagtatgt ggcttccatg gtgttctccc tggccatggg 1680
ctggaccaac atgctctact atacccgagg attccagcag atgggcatct atgctgtcat 1740
gattgagaag atgatcctca gagacctgtg ccggtttatg ttcgtctacc tcgtgttctt 1800
gtttggattt tccacagctg tggtgacact gattgaggat gggaagaata actctctgcc 1860
tatggagtcc acaccacaca agtgccgggg gtctgcctgc aagccaggta actcttacaa 1920
cagcctgtat tccacatgtc tggagctgtt caagttcacc atcggcatgg gcgacctgga 1980
gttcactgag aactacgact tcaaggctgt cttcatcatc ctgttactgg cctatgtgat 2040
tctcacctac atccttctgc tcaacatgct cattgctctc atgggtgaga ccgtcaacaa 2100
gattgcacaa gagagcaaga acatctggaa gctgcagaga gccatcacca tcctggatac 2160
agagaagagc ttcctgaagt gcatgaggaa ggccttccgc tctggcaagc tgctgcaggt 2220
ggggttcact cctgacggca aggatgacta ccggtggtgt ttcagggtgg acgaggtaaa 2280
ctggactacc tggaacacca atgtgggtat catcaacgag gacccaggca actgtgaggg 2340
cgtcaagcgc accctgagct tctccctgag gtcaggccga gtttcaggga gaaactggaa 2400
gaactttgcc ctggttcccc ttctgaggga tgcaagcact cgagatagac atgccaccca 2460
gcaggaagaa gttcaactga agcattatac gggatccctt aagccagagg atgctgaggt 2520
tttcaaggat tccatggtcc caggggagaa ataatggaca ctatgcaggg atcaatgcgg 2580
ggtctttggg tggtctgctt agggaaccag cagggttgac gttatctggg tccactctgt 2640
gcctgcctag gcacattcct aggacttcgg cgggcctgct gtgggaa ~ 2687
<210> 3
<211> 871
<212> PRT
<213> Homo sapiens
<400> 3
Met Ala Asp Ser Ser Glu Gly Pro Arg Ala Gly Pro Gly Glu Val Ala
1 5 10 15
Glu Leu Pro Gly Asp Glu Ser Gly Thr Pro Gly Gly Glu Ala Phe Pro
20 25 30
Leu Ser Ser Leu Ala Asn Leu Phe Glu Gly Glu Asp Gly Ser Leu Ser
35 40 45
Pro Ser Pro Ala Asp Ala Ser Arg Pro Ala Gly Pro Gly Asp Gly Arg
50 55 60
Pro Asn Leu Arg Met Lys Phe Gln Gly Ala Phe Arg Lys Gly Val Pro
65 70 75 80
Asn Pro Ile Asp Leu Leu Glu Ser Thr Leu Tyr Glu Ser Ser Val Val
85 90 95
Pro Gly Pro Lys Lys Ala Pro Met Asp Ser Leu Phe Asp Tyr Gly Thr
100 105 110
Tyr Arg His His Ser Ser Asp Asn Lys Arg Trp Arg Lys Lys Ile Ile
115 120 125
Glu Lys Gln Pro Gln Ser Pro Lys Ala Pro Ala Pro Gln Pro Pro Pro
130 135 140
Ile Leu Lys Val Phe Asn Arg Pro Ile Leu Phe Asp Ile Val Ser Arg
145 150 155 160
Gly Ser Thr Ala Asp Leu Asp Gly Leu Leu Pro Phe Leu Leu Thr His
165 170 175
Lys Lys Arg Leu Thr Asp Glu Glu Phe Arg Glu Pro Ser Thr Gly Lys
180 185 190
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
4
Thr Cys Leu Pro Lys Ala Leu Leu Asn Leu Ser Asn Gly Arg Asn Asp
195 200 205
Thr Ile Pro Val Leu Leu Asp Ile Ala Glu Arg Thr Gly Asn Met Arg
210 215 220
Glu Phe Ile Asn Ser Pro Phe Arg Asp Ile Tyr Tyr Arg Gly Gln Thr
225 230 235 240
Ala Leu His Ile Ala Ile Glu Arg Arg Cys Lys His Tyr Val Glu Leu
245 250 255
Leu Val Ala Gln Gly Ala Asp Val His Ala Gln Ala Arg Gly Arg Phe
260 265 270
Phe Gln Pro Lys Asp Glu Gly Gly Tyr Phe Tyr Phe Gly Glu Leu Pro
275 280 285
Leu Ser Leu Ala Ala Cys Thr Asn Gln Pro His Ile Val Asn Tyr Leu
290 295 300
Thr Glu Asn Pro His Lys Lys Ala Asp Met Arg Arg Gln Asp Ser Arg
305 310 315 320
Gly Asn Thr Val Leu His Ala Leu Val Ala Ile Ala Asp Asn Thr Arg
325 330 335
Glu Asn Thr Lys Phe Val Thr Lys Met Tyr Asp Leu Leu Leu Leu Lys
340 345 350
Cys Ala Arg Leu Phe Pro Asp Ser Asn Leu Glu Ala Val Leu Asn Asn
355 360 365
Asp Gly Leu Ser Pro Leu Met Met Ala Ala Lys Thr Gly Lys Ile Gly
370 375 380
Ile Phe Gln His Ile Ile Arg Arg Glu Val Thr Asp Glu Asp Thr Arg
385 390 395 400
His Leu Ser Arg Lys Phe Lys Asp Trp Ala Tyr Gly Pro Val Tyr Ser
405 410 415
Ser Leu Tyr Asp Leu Ser Ser Leu Asp Thr Cys Gly Glu Glu Ala Ser
420 425 430
Val Leu Glu Ile Leu Val Tyr Asn Ser Lys Ile Glu Asn Arg His Glu
435 440 445
Met Leu Ala Val Glu Pro Ile Asn Glu Leu Leu Arg Asp Lys Trp Arg
450 455 460
Lys Phe Gly Ala Val Ser Phe Tyr Ile Asn Val Val Ser Tyr Leu Cys
465 470 475 480
Ala Met Val Ile Phe Thr Leu Thr Ala Tyr Tyr Gln Pro Leu Glu Gly
485 490 495
Thr Pro Pro Tyr Pro Tyr Arg Thr Thr Val Asp Tyr Leu Arg Leu Ala
500 505 510
Gly Glu Val Ile Thr Leu Phe Thr Gly Val Leu Phe Phe Phe Thr Asn
515 520 525
Ile Lys Asp Leu Phe Met Lys Lys Cys Pro Gly Val Asn Ser Leu Phe
530 535 540
Ile Asp Gly Ser Phe Gln Leu Leu Tyr Phe Ile Tyr Ser Val Leu Val
545 550 555 560
Ile Val Ser Ala Ala Leu Tyr Leu Ala Gly Ile Glu Ala Tyr Leu Ala
565 570 575
Val Met Val Phe Ala Leu Val Leu Gly Trp Met Asn Ala Leu Tyr Phe
580 585 590
Thr Arg Gly Leu Lys Leu Thr Gly Thr Tyr Ser Ile Met Ile Gln Lys
595 600 605
Ile Leu Phe Lys Asp Leu Phe Arg Phe Leu Leu Val Tyr Leu Leu Phe
610 615 620
Met Ile Gly Tyr Ala Ser Ala Leu Val Ser Leu Leu Asn Pro Cys Ala
625 630 635 640
Asn Met Lys Val Cys Asn Glu Asp Gln Thr Asn Cys Thr Val Pro Thr
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
645 650 655
Tyr Pro Ser Cys Arg Asp Ser Glu Thr Phe Ser Thr Phe Leu Leu Asp
660 665 670
Leu Phe Lys Leu Thr Ile Gly Met Gly Asp Leu Glu Met Leu Ser Ser
675 680 685
Thr Lys Tyr Pro Val Val Phe Ile Ile Leu Leu Val Thr Tyr Ile Ile
690 695 700
Leu Thr Phe Val Leu Leu Leu Asn Met Leu Ile Ala Leu Met Gly Glu
705 710 715 720
Thr Val Gly Gln Val Ser Lys Glu Ser Lys His Ile Trp Lys Leu Gln
725 730 735
Trp Ala Thr Thr Ile Leu Asp Ile Glu Arg Ser Phe Pro Val Phe Leu
740 745 750
Arg Lys Ala Phe Arg Ser Gly Glu Met Val Thr Val Gly Lys Ser Ser
755 760 765
Asp Gly Thr Pro Asp Arg Arg Trp Cys Phe Arg Val Asp Glu Val Asn
770 775 780
Trp Ser His Trp Asn Gln Asn Leu Gly Ile Ile Asn Glu Asp Pro Gly
785 790 795 800
Lys Asn Glu Thr Tyr Gln Tyr Tyr Gly Phe Ser His Thr Val Gly Arg
805 810 815
Leu Arg Arg Asp Arg Trp Ser Ser Val Val Pro Arg Val Val Glu Leu
820 825 830
Asn Lys Asn Ser Asn Pro Asp Glu Val Val Val Pro Leu Asp Ser Met
835 840 845
Gly Asn Pro Arg Cys Asp Gly His Gln Gln Gly Tyr Pro Arg Lys Trp
850 855 860
Arg Thr Asp Asp Ala Pro Leu
865 870
<210> 4
<211> 838
<212> PRT
<213> Rattus norvegicus
<400> 4
Met Glu Gln Arg Ala Ser Leu Asp Ser Glu Glu Ser Glu Ser Pro Pro
1 5 10 15
Gln Glu Asn Ser Cys Leu Asp Pro Pro Asp Arg Asp Pro Asn Cys Lys
20 25 30
Pro Pro Pro Val Lys Pro His Ile Phe Thr Thr Arg Ser Arg Thr Arg
35 40 45
Leu Phe Gly Lys Gly Asp Ser Glu Glu Ala Ser Pro Leu Asp Cys Pro
50 55 60
Tyr Glu Glu Gly Gly Leu Ala Ser Cys Pro Ile Ile Thr Val Ser Ser
65 70 75 80
Val Leu Thr Ile Gln Arg Pro Gly Asp Gly Pro Ala Ser Val Arg Pro
85 90 95
Ser Ser Gln Asp Ser Val Ser Ala Gly Glu Lys Pro Pro Arg Leu Tyr
100 105 110
Asp Arg Arg Ser Ile Phe Asp Ala Val Ala Gln Ser Asn Cys Gln Glu
115 120 125
Leu Glu Ser Leu Leu Pro Phe Leu Gln Arg Ser Lys Lys Arg Leu Thr
130 135 140
Asp Ser Glu Phe Lys Asp Pro Glu Thr Gly Lys Thr Cys Leu Leu Lys
145 150 155 160
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
6,
Ala Met Leu Asn Leu His Asn Gly Gln Asn Asp Thr Ile Ala Leu Leu
165 170 175
Leu Asp Val Ala Arg Lys Thr Asp Ser Leu Lys Gln Phe Val Asn Ala
180 185 190
Ser Tyr Thr Asp Ser Tyr Tyr Lys Gly Gln Thr Ala Leu His Ile Ala
195 200 205
Ile Glu Arg Arg Asn Met Thr Leu Val Thr Leu Leu Val Glu Asn Gly
210 215 220
Ala Asp Val Gln Ala Ala Ala Asn Gly Asp Phe Phe Lys Lys Thr Lys
225 230 235 240
Gly Arg Pro Gly Phe Tyr Phe Gly Glu Leu Pro Leu Ser Leu Ala Ala
245 250 255
Cys Thr Asn Gln Leu Ala Ile Val Lys Phe Leu Leu Gln Asn Ser Trp
260 265 270
Gln Pro Ala Asp Ile Ser Ala Arg Asp Ser Val Gly Asn Thr Val Leu
275 280 285
His Ala Leu Val Glu Val Ala Asp Asn Thr Val Asp Asn Thr Lys Phe
290 295 300
Val Thr Ser Met Tyr Asn Glu Ile Leu Ile Leu Gly Ala Lys Leu His
305 310 315 320
Pro Thr Leu Lys Leu Glu Glu Ile Thr Asn Arg Lys Gly Leu Thr Pro
325 330 335
Leu Ala Leu Ala Ala Ser Ser Gly Lys Ile Gly Val Leu Ala Tyr Ile
340 345 350
Leu Gln Arg Glu Ile His Glu Pro Glu Cys Arg His Leu Ser Arg Lys
355 360 365
Phe Thr Glu Trp Ala Tyr Gly Pro Val His Ser Ser Leu Tyr Asp Leu
370 375 380
Ser Cys Ile Asp Thr Cys Glu Lys Asn Ser Val Leu Glu Val Ile Ala
385 390 395 400
Tyr Ser Ser Ser Glu Thr Pro Asn Arg His Asp Met Leu Leu Val Glu
405 410 415
Pro Leu Asn Arg Leu Leu Gln Asp Lys Trp Asp Arg Phe Val Lys Arg
420 425 430
Ile Phe Tyr Phe Asn Phe Phe Val Tyr Cys Leu Tyr Met Ile Ile Phe
435 440 445
Thr Ala Ala Ala Tyr Tyr Arg Pro Val Glu Gly Leu Pro Pro Tyr Lys
450 455 460
Leu Lys Asn Thr Val Gly Asp Tyr Phe Arg Val Thr Gly Glu Ile Leu
465 470 475 480
Ser Val Ser Gly Gly Val Tyr Phe Phe Phe Arg Gly Ile Gln Tyr Phe
485 490 495
Leu Gln Arg Arg Pro Ser Leu Lys Ser Leu Phe Val Asp Ser Tyr Ser
500 505 510
Glu Ile Leu Phe Phe Val Gln Ser Leu Phe Met Leu Val Ser Val Val
515 520 525
Leu Tyr Phe Ser Gln Arg Lys Glu Tyr Val Ala Ser Met Val Phe Ser
530 535 540
Leu Ala Met Gly Trp Thr Asn Met Leu Tyr Tyr Thr Arg Gly Phe Gln
545 550 555 560
Gln Met Gly Ile Tyr Ala Val Met Ile Glu Lys Met Ile Leu Arg Asp
565 570 575
Leu Cys Arg Phe Met Phe Val Tyr Leu Val Phe Leu Phe Gly Phe Ser
580 585 590
Thr Ala Val Val Thr Leu Ile Glu Asp Gly Lys Asn Asn Ser Leu~Pro
595 600 605
Met Glu Ser Thr Pro His Lys Cys Arg Gly Ser Ala Cys Lys Pro Gly
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
7
610 615 620
Asn Ser Tyr Asn Ser Leu Tyr Ser Thr Cys Leu Glu Leu Phe Lys Phe
625 630 635 640
Thr Ile Gly Met Gly Asp Leu Glu Phe Thr Glu Asn Tyr Asp Phe Lys
645 650 655
Ala Val Phe Ile Ile Leu Leu Leu Ala Tyr Val Ile Leu Thr Tyr Ile
660 665 670
Leu Leu Leu Asn Met Leu Ile Ala Leu Met Gly Glu Thr Val Asn Lys
675 680 685
Ile Ala Gln Glu Ser Lys Asn Ile Trp Lys Leu Gln Arg Ala Ile Thr
690 695 700
Ile Leu Asp Thr Glu Lys Ser Phe Leu Lys Cys Met Arg Lys Ala Phe
705 710 715 720
Arg Ser Gly Lys Leu Leu Gln Val Gly Phe Thr Pro Asp Gly Lys Asp
725 730 735
Asp Tyr Arg Trp Cys Phe Arg Val Asp Glu Val Asn Trp Thr Thr Trp
740 745 750
Asn Thr Asn Val Gly Ile Ile Asn Glu Asp Pro Gly Asn Cys Glu Gly
755 760 765
Val Lys Arg Thr Leu Ser Phe Ser Leu Arg Ser Gly Arg Val Ser Gly
770 775 780
Arg Asn Trp Lys Asn Phe Ala Leu Val Pro Leu Leu Arg Asp Ala Ser
785 790 795 800
Thr Arg Asp Arg His Ala Thr Gln Gln Glu Glu Val Gln Leu Lys His
805 810 815
Tyr Thr Gly Ser Leu Lys Pro Glu Asp Ala Glu Val Phe Lys Asp Ser
820 825 830
Met Val Pro Gly Glu Lys
835
<210> 5
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 5
tttaaacgcg taggatgaag aaatggagc 29
<210> 6
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 6
tatattgtcg acgtcctcac ttctccccg 29
<210> 7
<211> 2712
<212> DNA
<213> Homo sapiens
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
8,
<400> 7
gcaggttgca cactgggcca cagaggatcc agcaaggatg aagaaatgga gcagcacaga 60
cttgggggca gctgcggacc cactccaaaa ggacacctgc ccagaccccc tggatggaga 120
ccctaactcc aggccacctc cagccaagcc ccagctctcc acggccaaga gccgcacccg 180
gctctttggg aagggtgact cggaggaggc tttcccggtg gattgccctc acgaggaagg 240
tgagctggac tcctgcccga ccatcacagt cagccctgtt atcaccatcc agaggccagg 300
agacggcccc accggtgcca ggctgctgtc ccaggactct gtcgccgcca gcaccgagaa 360
gaccctcagg ctctatgatc gcaggagtat ctttgaagcc gttgctcaga ataactgcca 420
ggatctggag agcctgctgc tcttcctgca gaagagcaag aagcacctca cagacaacga 480
gttcaaagac cctgagacag ggaagacctg tctgctgaaa gccatgctca acctgcacga 540
cggacagaac accaccatcc ccctgctcct ggagatcgcg cggcaaacgg acagcctgaa 600
ggagcttgtc aacgccagct acacggacag ctactacaag ggccagacag cactgcacat 660
cgccatcgag agacgcaaca tggccctggt gaccctcctg gtggagaacg gagcagacgt 720
ccaggctgcg gcccatgggg acttctttaa gaaaaccaaa gggcggcctg gattctactt 780
cggtgaactg cccctgtccc tggccgcgtg caccaaccag ctgggcatcg tgaagttcct 840
gctgcagaac tcctggcaga cggccgacat cagcgccagg gactcggtgg gcaacacggt 900
gctgcacgcc ctggtggagg tggccgacaa cacggccgac aacacgaagt ttgtgacgag 960
catgtacaat gagattctga tcctgggggc caaactgcac ccgacgctga agctggagga 1020
gctcaccaac aagaagggaa tgacgccgct ggctctggca gctgggaccg ggaagatcgg 1080
ggtcttggcc tatattctcc agcgggagat ccaggagccc gagtgcaggc acctgtccag 1140
gaagttcacc gagtgggcct acgggcccgt gcactcctcg ctgtacgacc tgtcctgcat 1200
cgacacctgc gagaagaact cggtgctgga ggtgatcgcc tacagcagca gcgagacccc 1260
taatcgccac gacatgctct tggtggagcc gctgaaccga ctcctgcagg acaagtggga 1320
cagattcgtc aagcgcatct tctacttcaa cttcctggtc tactgcctgt acatgatcat 1380
cttcaccatg gctgcctact acaggcccgt ggatggcttg cctcccttta agatggaaaa 1440
aactggagac tatttccgag ttactggaga gatcctgtct gtgttaggag gagtctactt 1500
ctttttccga gggattcagt atttcctgca gaggcggccg tcgatgaaga ccctgtttgt 1560
ggacagctac agtgagatgc ttttctttct gcagtcactg ttcatgctgg ccaccgtggt 1620
gctgtacttc agccacctca aggagtatgt ggcttccatg gtattctccc tggccttggg 1680
ctggaccaac atgctctact acacccgcgg tttccagcag atgggcatct atgccgtcat 1740
gattgagaag atgatcctga gagacctgtg ccgtttcatg tttgtctaca tcgtcttctt 1800
gttcgggttt tccacagcgg tggtgacgct gattgaagac gggaagaatg actccctgcc 1860
gtctgagtcc acgtcgcaca ggtggcgggg gcctgcctgc aggccccccg atagctccta 1920
caacagcctg tactccacct gcctggagct gttcaagttc accatcggca tgggcgacct 1980
ggagttcact gagaactatg acttcaaggc tgtcttcatc atcctgctgc tggcctatgt 2040
aattctcacc tacatcctcc tgctcaacat gctcatcgcc ctcatgggtg agactgtcaa 2100
caagatcgca caggagagca agaacatctg gaagctgcag agagccatca ccatcctgga 2160
cacggagaag agcttcctta agtgcatgag gaaggccttc cgctcaggca agctgctgca 2220
ggtggggtac acacctgatg gcaaggacga ctaccggtgg tgcttcaggg tggacgaggt 2280
gaactggacc acctggaaca ccaacgtggg catcatcaac gaagacccgg gcaactgtga 2340
gggcgtcaag cgcaccctga gcttctccct gcggtcaagc agagtttcag gcagacactg 2400
gaagaacttt gccctggtcc cccttttaag agaggcaagt gctcgagata ggcagtctgc 2460
tcagcccgag gaagtttatc tgcgacagtt ttcagggtct ctgaagccag aggacgctga 2520
ggtcttcaag agtcctgccg cttccgggga gaagtgagga cgtcacgcag acagcactgt 2580
caacactggg ccttaggaga ccccgttgcc acggggggct tgctgaggga acaccagtgc 2640
tctgtcagca gcctggcctg gtctgtgcct gcccagcatg ttcccaaatc tgtgctggac 2700
aagctgtggg as 2712
<210> 8
<211> 839
<212> PRT
<213> Homo Sapiens
<400> 8
Met Lys Lys Trp Ser Ser Thr Asp Leu Gly Ala Ala Ala Asp Pro Leu
1 5 10 15
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
9
Gln Lys Asp Thr Cys Pro Asp Pro Leu Asp Gly Asp Pro Asn Ser Arg
20 25 30
Pro Pro Pro Ala Lys Pro Gln Leu Ser Thr Ala Lys Ser Arg Thr Arg
35 40 45
Leu Phe Gly Lys Gly Asp Ser Glu Glu Ala Phe Pro Val Asp Cys Pro
50 55 60
His Glu Glu Gly Glu Leu Asp Ser Cys Pro Thr Ile Thr Val Ser Pro
65 70 75 80
Val Ile Thr Ile Gln Arg Pro Gly Asp Gly Pro Thr Gly Ala Arg Leu
85 90 95
Leu Ser Gln Asp Ser Val Ala Ala Ser Thr Glu Lys Thr Leu Arg Leu
100 105 110
Tyr Asp Arg Arg Ser Ile Phe Glu Ala Val Ala Gln Asn Asn Cys Gln
115 120 125
Asp Leu Glu Ser Leu Leu Leu Phe Leu Gln Lys Ser Lys Lys His Leu
130 135 140
Thr Asp Asn Glu Phe Lys Asp Pro Glu Thr Gly Lys Thr Cys Leu Leu
145 150 155 160
Lys Ala Met Leu Asn Leu His Asp Gly Gln Asn Thr Thr Ile Pro Leu
165 170 175
Leu Leu Glu Ile Ala Arg Gln Thr Asp Ser Leu Lys Glu Leu Val Asn
180 185 190
Ala Ser Tyr Thr Asp Ser Tyr Tyr Lys Gly Gln Thr Ala Leu His Ile
195 200 205
Ala Ile Glu Arg Arg Asn Met Ala Leu Val Thr Leu Leu Val Glu Asn
210 215 220
Gly Ala Asp Val Gln Ala Ala Ala His Gly Asp Phe Phe Lys Lys Thr
225 230 235 240
Lys Gly Arg Pro Gly Phe Tyr Phe Gly Glu Leu Pro Leu Ser Leu Ala
245 250 255
Ala Cys Thr Asn Gln Leu Gly Ile Val Lys Phe Leu Leu Gln Asn Ser
260 265 270
Trp Gln Thr Ala Asp Ile Ser Ala Arg Asp Ser Val Gly Asn Thr Val
275 280 285
Leu His Ala Leu Val Glu Val Ala Asp Asn Thr Ala Asp Asn Thr Lys
290 295 300
Phe Val Thr Ser Met Tyr Asn Glu Ile Leu Ile Leu Gly Ala Lys Leu
305 310 315 320
His Pro Thr Leu Lys Leu Glu Glu Leu Thr Asn Lys Lys Gly Met Thr
325 330 335
Pro Leu Ala Leu Ala Ala Gly Thr Gly Lys Ile Gly Val Leu Ala Tyr
340 345 350
Ile Leu Gln Arg Glu Ile Gln Glu Pro Glu Cys Arg His Leu Ser Arg
355 360 365
Lys Phe Thr Glu Trp Ala Tyr Gly Pro Val His Ser Ser Leu Tyr Asp
370 375 380
Leu Ser Cys Ile Asp Thr Cys Glu Lys Asn Ser Val Leu Glu Val Ile
385 390 395 400
Ala Tyr Ser Ser Ser Glu Thr Pro Asn Arg His Asp Met Leu Leu Val
405 410 415
Glu Pro Leu Asn Arg Leu Leu Gln Asp Lys Trp Asp Arg Phe Val Lys
420 425 430
Arg Ile Phe Tyr Phe As~n Phe Leu Val Tyr Cys Leu Tyr Met Ile Ile
435 440 445
Phe Thr Met Ala Ala Tyr Tyr Arg Pro Val Asp Gly Leu Pro Pro Phe
450 455 460
Lys Met Glu Lys Thr Gly Asp Tyr Phe Arg Val Thr Gly Glu Ile Leu
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
465 470 475 480
Ser Val Leu Gly Gly Val Tyr Phe Phe Phe Arg Gly Ile Gln Tyr Phe
485 490 495
Leu Gln Arg Arg Pro Ser Met Lys Thr Leu Phe Val Asp Ser Tyr Ser
500 505 510
Glu Met Leu Phe Phe Leu Gln Ser Leu Phe Met Leu Ala Thr Val Val
515 520 525
Leu Tyr Phe Ser His Leu Lys Glu Tyr Val Ala Ser Met Val Phe Ser
530 535 540
Leu Ala Leu Gly Trp Thr Asn Met Leu Tyr Tyr Thr Arg Gly Phe Gln
545 550 555 560
Gln Met Gly Ile Tyr Ala Val Met Ile Glu Lys Met Ile Leu Arg Asp
565 . 570 575
Leu Cys Arg Phe Met Phe Val Tyr Ile Val Phe Leu Phe Gly Phe Ser
580 585 590
Thr Ala Val Val Thr Leu Ile Glu Asp Gly Lys Asn Asp Ser Leu Pro
595 600 605
Ser Glu Ser Thr Ser His Arg Trp Arg Gly Pro Ala Cys Arg Pro Pro
610 615 620
Asp Ser Ser Tyr Asn Ser Leu Tyr Ser Thr Cys Leu Glu Leu Phe Lys
625 630 635 640
Phe Thr Ile Gly Met Gly Asp Leu Glu Phe Thr Glu Asn Tyr Asp Phe
645 650 655
Lys Ala Val Phe Ile Ile Leu Leu Leu Ala Tyr Val Ile Leu Thr Tyr
660 665 670
Ile Leu Leu Leu Asn Met Leu Ile Ala Leu Met Gly Glu Thr Val Asn
675 680 685
Lys Ile Ala Gln Glu Ser Lys Asn Ile Trp Lys Leu Gln Arg Ala Ile
690 695 700
Thr Ile Leu Asp Thr Glu Lys Ser Phe Leu Lys Cys Met Arg Lys Ala
705 710 715 720
Phe Arg Ser Gly Lys Leu Leu Gln Val Gly Tyr Thr Pro Asp Gly Lys
725 730 735
Asp Asp Tyr Arg Trp Cys Phe Arg Val Asp Glu Val Asn Trp Thr Thr
740 745 750
Trp Asn Thr Asn Val Gly Ile Ile Asn Glu Asp Pro Gly Asn Cys Glu
755 760 765
Gly Val Lys Arg Thr Leu Ser Phe Ser Leu Arg Ser Ser Arg Val Ser
770 775 780
Gly Arg His Trp Lys Asn Phe Ala Leu Val Pro Leu Leu Arg Glu Ala
785 790 795 800
Ser Ala Arg Asp Arg Gln Ser Ala Gln Pro Glu Glu Val Tyr Leu Arg
805 810 815
Gln Phe Ser Gly Ser Leu Lys Pro Glu Asp Ala Glu Val Phe Lys Ser
820 825 830
Pro Ala Ala Ser Gly Glu Lys
835
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
11,
<400> 9
tgcctggagc tgttcaagtt c 21
<210> 10
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 10
tgatgaagac agccttgaag tca 23
<210> 11
<211> 28
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 11
agttctcagt gaactccagg tcgcccat 28
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 12
attgagaacc gccacgagat 20
<210> 13
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 13
agacggcccc gaacttg 17
<210> 14
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Primer
<400> 14
ccatcaatga actgctgcgg gaca 24
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
12
<210> 15
<211> 764
<212> PRT
<213> Homo Sapiens
<220>
<221> VARIANT
<222> (670)...(670)
<223> Xaa = Unknown or other at position 670
<400> 15
Met Thr Ser Pro Ser Ser Ser Pro Val Phe Arg Leu Glu Thr Leu Asp
1 5 10 15
Gly Gly Gln Glu Asp Gly Ser Glu Ala Asp Arg Gly Lys Leu Asp Phe
20 25 30
Gly Ser Gly Leu Pro Pro Met Glu Ser Gln Phe Gln Gly Glu Asp Arg
35 40 45
Lys Phe Ala Pro Gln Ile Arg Val Asn Leu Asn Tyr Arg Lys Gly Thr
50 55 60
Gly Ala Ser Gln Pro Asp Pro Asn Arg Phe Asp Arg Asp Arg Leu Phe
65 70 75 80
Asn Ala Val Ser Arg Gly Val Pro Glu Asp Leu Ala Gly Leu Pro Glu
85 90 95
Tyr Leu Ser Lys Thr Ser Lys Tyr Leu Thr Asp Ser Glu Tyr Thr Glu
100 105 110
Gly Ser Thr Gly Lys Thr Cys Leu Met Lys Ala Val Leu Asn Leu Lys
115 120 125
Asp Gly Val Asn Ala Cys Ile Leu Pro Leu Leu Gln Ile Asp Arg Asp
130 135 140
Ser Gly Asn Pro Gln Pro Leu Val Asn Ala Gln Cys Thr Asp Asp Tyr
145 150 155 160
Tyr Arg Gly His Ser Ala Leu His Ile Ala Ile Glu Lys Arg Ser Leu
165 170 175
Gln Cys Val Lys Leu Leu Val Glu Asn Gly Ala Asn Val His Ala Arg
180 185 190
Ala Cys Gly Arg Phe Phe Gln Lys Gly Gln Gly Thr Cys Phe Tyr Phe
195 200 205
Gly Glu Leu Pro Leu Ser Leu Ala Ala Cys Thr Lys Gln Trp Asp Val
210 215 220
Val Ser Tyr Leu Leu Glu Asn Pro His Gln Pro Ala Ser Leu Gln Ala
225 230 235 240
Thr Asp Ser Gln Gly Asn Thr Val Leu His Ala Leu Val Met Ile Ser
245 250 255
Asp Asn Ser Ala Glu Asn Ile Ala Leu Val Thr Ser Met Tyr Asp Gly
260 265 270
Leu Leu Gln Ala Gly Ala Arg Leu Cys Pro Thr Val Gln Leu Glu Asp
275 280 285
Ile Arg Asn Leu Gln Asp Leu Thr Pro Leu Lys Leu Ala Ala Lys Glu
290 295 300
Gly Lys Ile Glu Ile Phe Arg His Ile Leu Gln Arg Glu Phe Ser Gly
305 310 315 320
Leu Ser His Leu Ser Arg Lys Phe Thr Glu Trp Cys Tyr Gly Pro Val
325 330 335
Arg Val Ser Leu Tyr Asp Leu Ala Ser Val Asp Ser Cys Glu Glu Asn
340 345 350
Ser Val Leu Glu Ile Ile Ala Phe His Cys Lys Ser Pro His Arg His
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
13
355 360 365
Arg Met Val Val Leu Glu Pro Leu Asn Lys Leu Leu Gln Ala Lys Trp
370 375 380
Asp Leu Leu Ile Pro Lys Phe Phe Leu Asn Phe Leu Cys Asn Leu Ile
385 390 395 400
Tyr Met Phe Ile Phe Thr Ala Val Ala Tyr His Gln Pro Thr Leu Lys
405 410 415
Lys Gln Ala Ala Pro His Leu Lys Ala Glu Val Gly Asn Ser Met Leu
420 425 430
Leu Thr Gly His Ile Leu Ile Leu Leu Gly Gly Ile Tyr Leu Leu Val
435 440 445
Gly Gln Leu Trp Tyr Phe Trp Arg Arg His Val Phe Ile Trp Ile Ser
450 455 460
Phe Ile Asp Ser Tyr Phe Glu Ile Leu Phe Leu Phe Gln Ala Leu Leu
465 470 475 480
Thr Val Val Ser Gln Val Leu Cys Phe Leu Ala Ile Glu Trp Tyr Leu
485 490 495
Pro Leu Leu Val Ser Ala Leu Val Leu Gly Trp Leu Asn Leu Leu Tyr
500 505 510
Tyr Thr Arg Gly Phe Gln His Thr Gly Ile Tyr Ser Val Met Ile Gln
515 520 525
Lys Val Ile Leu Arg Asp Leu Leu Arg Phe Leu Leu Ile Tyr Leu Val
530 535 540
Phe Leu Phe Gly Phe Ala Val Ala Leu Val Ser Leu Ser Gln Glu Ala
545 550 555 560
Trp Arg Pro Glu Ala Pro Thr Gly Pro Asn Ala Thr Glu Ser Val Gln
565 570 575
Pro Met Glu Gly Gln Glu Asp Glu Gly Asn Gly Ala Gln Tyr Arg Gly
580 585 590
Ile Leu Glu Ala Ser Leu Glu Leu Phe Lys Phe Thr Ile Gly Met Gly
595 600 605
Glu Leu Ala Phe Gln Glu Gln Leu.His Phe Arg Gly Met Val Leu Leu
610 615 620
Leu Leu Leu Ala Tyr Val Leu Leu Thr Tyr Ile Leu Leu Leu Asn Met
625 630 635 640
Leu Ile Ala Leu Met Ser Glu Thr Val Asn Ser Val Ala Thr Asp Ser
645 650 655
Trp Ser Ile Trp Lys Leu Gln Lys Ala Ile Ser Val Leu Xaa Met Glu
660 665 670
Asn Gly Tyr Trp Trp Cys Arg Lys Lys Gln Arg Ala Gly Val Met Leu
675 680 685
Thr Val Gly Thr Lys Pro Asp Gly Ser Pro Asp Glu Arg Trp Cys Phe
690 695 700
Arg Val Glu Glu Val Asn Trp Ala Ser Trp Glu Gln Thr Leu Pro Thr
705 710 715 720
Leu Cys Glu Asp Pro Ser Gly Ala Gly Val Pro Arg Thr Leu Glu Asn
725 ~ 730 735
Pro Val Leu Ala Ser Pro Pro Lys Glu Asp Glu Asp Gly Ala Ser Glu
740 745 750
Glu Asn Tyr Val Pro Val Gln Leu Leu Gln Ser Asn
755 760
<210> 16
<211> 244
<212> PRT
<213> Artificial Sequence
CA 02359955 2001-07-11
WO 01/34805 PCT/US00/31077
14
<220>
<223> Consensus
<400> 16
Arg Phe Val Leu Leu Leu Lys Leu Thr Asp Glu Thr Gly Lys Thr Cys
1 5 10 15
Leu Lys Ala Leu Asn Leu Gly Asn Ile Leu Leu Asn Asp Tyr Tyr Gly
20 25 30
Ala Leu His Ile Ala Ile Glu Arg Val Leu Leu Val Gly Ala Val Ala
35 40 45
Ala Gly Phe Phe Phe Tyr Phe Gly Glu Leu Pro Leu Ser Leu Ala Ala
50 55 60
Cys Thr Gln Va1 Leu Asn Ala Asp Ser Gly Asn Thr Val Leu His Ala
65 70 75 80
Leu Val Asp Asn Asn Val Thr Met Tyr Leu Ala Leu Pro Leu Glu Asn
85 90 95
Pro Leu Ala Ala Gly Lys Ile Ile Arg Glu His Leu Ser Arg Lys Phe
100 105 110
Trp Tyr Gly Pro Val Ser Leu Tyr Asp Leu Asp Cys Glu Ser Val Leu
115 120 125
Glu Arg His Met Glu Pro Asn Leu Leu Lys Trp Phe Asn Met Ile Phe
130 135 140
Thr Ala Tyr Pro Gly Gly Phe Phe Asp Leu Leu Tyr Val Leu Gly Trp
145 150 155 160
Asn Leu Tyr Thr Arg Gly Gly Tyr Met Ile Lys Asp Leu Arg Phe Tyr
165 170 175
Phe Gly Ala Val Leu Leu Leu Phe Lys Thr Ile Gly Met Gly Leu Leu
180 185 190
Leu Tyr Leu Thr Leu Leu Leu Asn Met Leu Ile Ala Leu Met Glu Thr
195 200 205
Val Ser Ile Trp Lys Leu Gln Ala Leu Glu Arg Lys Arg Gly Val Gly
210 215 220
Asp Gly Asp Arg Trp Cys Phe Arg Val Glu Val Asn Trp Trp Glu Asp
225 230 235 240
Pro Thr Val Leu
