Note: Descriptions are shown in the official language in which they were submitted.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
HUMAN HAIRLESS GENE PROTEIN AND USES THEREOF
This application is a continuation-in-part of Provisional
Application No. 60/073,043, filed January 29, 1998, the
contents of which are hereby incorporated by reference.
Throughout this application, various references are referred
to within parentheses. Disclosures of these publications in
their entireties are hereby incorporated by reference into
this application in order to more fully describe the state
of the art as known to those skilled therein as of the date
of the invention described and claimed herein.
Background of the Invention
Human Hair Follicle Development. The human hair follicle is
a dynamic structure which generates hair through a complex
and highly regulated cycle of growth and remodeling. Hardy,
1992, Trends Genet. 8:159; Rosenquist and Martin, 1996, Dev.
Dynamics 205:379. During embryogenesis, the follicle is
initially formed as a downgrowth of the overlying surface
ectoderm in response to an initial dermal message to the
ectoderm dictating the formation of an appendage. Next, it
has been speculated that an epidermal message passes from
the epithelial cells in the follicle bud to an underlying
cluster of dermal mesenchymal cells, known as dermal papilla
cells. The dermal papilla functions as the signaling center
which plays a central role in regulating the subsequent
development and activity of the hair follicle. Finally, a
second dermal message is transmitted from the dermal papilla
cells to the overlying epithelial cells of the hair plug,
now known as the "hair matrix," stimulating them to divide
rapidly, to form the mature hair follicle. Id.
As the follicle develops, morphologically, it appears as a
bulbous structure with a rounded base (the hair bulb) from
CA 02362320 2001-07-30
WO 99/38965 PGT/US99/02128
-2-
which a long neck extends upward that connects it to the
skin surface. The hair bulb surrounds the underlying dermal
papilla, and contains a highly proliferative cell
population, the hair matrix, whose progeny are gradually
displaced upward toward the surface. As they traverse the
keratogenous zone at the top of the hair bulb at the base of
the neck, the cells begin to differentiate into at least six
different cell types that are organized in concentric
layers. The three innermost layers form the medullary,
cortical and cuticular layers of the emerging hair, and the
three sequentially more peripheral outer layers form the
inner root sheath, which extends part of the distance up and
is shed into the neck of the follicle. As the hair
elongates, it passes through the skin surface, through the
pilary canal. Id.
Hair Growth Cycle. Hair growth is typically described as
having three distinct phases. In the first phase, known as
anagen, the follicle is generated and a new hair grows.
During the second stage, known as catagen, the follicle
enters the stage where elongation ceases and the follicle
regresses because the matrix cells stop proliferating. At
this "catagen" stage, the lower, transient, half of the
follicle is eliminated as a result of terminal
differentiation and keratinization, and programmed cell
death. Rosenquist and Martin, 1996, Dev. Dynamics 205:379.
Also during catagen, although the dermal papilla remains
intact, it undergoes several remodeling events, including
degradation of the elaborate extracellular matrix which is
deposited during anagen. At the close of catagen, the hair
is only loosely anchored in a matrix of keratin, with the
dermal papilla located just below. The catagen stage occurs
at a genetically predetermined time which is specific for
each hair type in a species. The third stage, known as
telogen, is characterized by the follicle entering a
quiescent phase, during which the hair is usually shed.
CA 02362320 2001-07-30
WO 99/38965 - 3 _ PCT/US99/02128
When a new hair cycle is initiated, it is thought that a
signal from the dermal papilla stimulates the stem cells,
which are thought to reside in the permanent portion of the
follicle, to undergo a phase of downward proliferation and
genesis of a new bulbous base containing matrix cells which
then surround the dermal papilla. As the new anagen stage
progresses, these hair matrix cells produce a new hair, and
the cycle begins again. Each follicle appears to be under
l0 completely asynchronous control, resulting in a continuum of
follicles in anagen, catagen, and telogen phases in adjacent
follicles, leading to a relatively homogeneous, uniform hair
or coat distribution. Hardy, 1992, Trends Genet. 8:159;
Rosenquist and Martin, 1996, Dev. Dynamics 205:379.
Despite this descriptive understanding of the hair cycle,
currently very little is known about the molecular control
of the signals that regulate progression through this cycle.
Notwithstanding this lack of knowledge with respect to the
molecular control of the signals responsible for hair
growth, it is clear that at least some potentially
influential regulatory molecules may play a role. For
example, a knock-out mouse with targeted ablation of the
fibroblast growth factor 5 (FGFS) gene provides evidence
that FGF5 is an inhibitor of hair elongation. Specifically,
it has been observed that the knock-out mouse has an
increase in hair length due to an increase in the time that
follicles remain in anagen. The FGF5 gene was also deleted
in the naturally occurring mouse model, angora. to determine
the effect FGFS expression on hair growth and development.
Hebert, et al., 1994, Cell 78:1017.
Another member of the FGF family, FGF7 or keratinocyte
growth factor, was disrupted by gene targeting, and the
resultant mouse had hair with a =greasy matted appearance,
similar in phenotype to the rough mouse. Guo, et al., 1996,
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-4-
Genes & Devel. 10:165. A transgenic mouse was engineered
which disrupted the spatial and temporal expression of the
lymphoid enhancer factor 1 (LEF1) gene, a transcription
factor that binds to the promoter region of 13 out of 13
published hair keratin promoters. It was shown that
disruption of this potential master regulator of hair
keratin transcription led to defects in the positioning and
angling of the hair follicles, a process previously assumed,
though never proven, to be under mesenchymal control. Zhou,
et al., 1995, Genes & Devel. 9:700. More recently, a
mutation in the mouse desmoglein 3 gene (dsg3) was found to
be the cause of the naturally occurring mouse, balding.
Koch, et al., 1997, J Cell Biol. 137:1091. The congenital
alopecia and athymia in the nude mouse results from
mutations in the whn gene (winged-helix-nude,Hfh 11°°), which
encodes a forkhead/winged helix transcription factor with
restricted expression in thymus and skin. Nehls, et al.,
1994, Nature 372:103; Segre, et al., 1995, Genomics 28:549;
Huth, et al. 1997, Immunogenetics 45:282; Hofmann, et al.,
1998, Genomics 52:197; Schorpp, et al., 1997, Immunogenetics
46:509. In addition to the complexity of the signaling
pathways, in sheep, there are over 100 distinct structural
proteins synthesized by the hair cortex and cuticle cells
which produce the keratinized structure of the wool fiber.
Hardy, 1992, Trends Genet. 8:159. Despite these examples of
recent progress in murine models, the control and molecular
complexity of the hair follicle and its cyclic progressions
in humans is only beginning to be understood.
The Alopecias: The Hereditary Nature Of Hair Loss. There
are several forms of hereditary human hair loss, known
collectively as alopecias, which may represent a
dysregulation of the hair cycle. The molecular basis of the
alopecias, however, is unknown. Rook and Dawber, 1991,
Diseases of the Hair and Scalp (Blackwell Press, Oxford, UK,
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
_5_
ed. 2,) pp. 136-166. The most common form of hair loss, known
as androgenetic alopecia (male pattern baldness) is believed
by some to represent a dominantly inherited allele affecting
800 of the population. Bergfeld, 1995, Am. J. Med.
98:955-98S. Alopecia areata is a common dermatologic
disease affecting approximately 2.5 million individuals in
the U.S., which presents with round, patchy hair loss on the
scalp and has been postulated to have an underlying
autoimmune component to its pathomechenism. Rook and Dawber,
1991, Diseases of the Hair and Scalp (Blackwell Press,
Oxford, UK, ed. 2,) pp. 136-166; Bergfeld, 1995, Am. J. Med.
98:955-985. Alopecia areata can progress to involve hair
loss of the entire scalp, and is referred to as alopecia
totalis. Alopecia universalis is the term for the most
extreme example of disease progression, resulting in complete
absence of scalp and body hair. Id. It is clear that
alopecia areata is a "complex" genetic disorder resulting
from more than one gene. In addition to these putative
"autoimmune" forms of alopecia, a simple, recessively
inherited form also exists, known as "congenital alopecia
universalis or "congenital atrichia". The precise etiology
of this disorder is unknown, and prior to the present
invention, no autoantigen or causative gene has been
identified. Muller et al., 1980, Br. J. Dermatol. 102:609.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-6-
Summary of the Invention
The present invention provides an isolated nucleic acid which
encodes a wildtype human hairless protein. The present
invention further provides an isolated nucleic acid which
encodes mutant human hairless proteins. The present
invention further provides an isolated wildtype human
hairless protein and also provides an isolated mutant human
hairless protein.
In addition, the present invention provides a method of
isolating a nucleic acid encoding a wildtype human hairless-
related protein in a sample containing nucleic acid
comprising (a) contacting the nucleic acid in the sample with
the nucleic acid probe provided herein, under conditions
permissive to the formation of a hybridization complex
between the nucleic acid probe and the nucleic acid; (b)
isolating the complex formed; and (c) separating the nucleic
acid probe and the nucleic acid, thereby isolating the
nucleic acid encoding a wildtype human hairless protein in
the sample.
Further, the present invention provides a method for
identifying a compound which is capable of enhancing or
inhibiting expression of a human hairless protein comprising:
(a) contacting a cell which expresses the human hairless
protein in a cell and the compound; (b) determining the level
of expression of the human hairless protein in the cell; and
(c) comparing the level of expression of the human hairless
protein determined in step (b) with the level determined in
the absence of the compound, thereby identifying a compound
capable of inhibiting or enhancing expression of the human
hairless protein.
The present invention also provides a method for identifying
a binding compound which is capable of forming a complex with
a human hairless protein comprising: (a) contacting the human
hairless protein and the compound; and (b) determining the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
formation of a complex between the human hairless protein and
the compound, thereby identifying a binding compound which
is capable of forming a complex with a human hairless
protein.
The present invention additionally provides a method for
identifying an inhibitory compound which is capable of
interfering the capacity of a human hairless protein to form
a complex with the binding compound comprising: (a)
contacting the complex and the compound; (b) measuring the
level of the complex; and (c) comparing the level of complex
in the presence of the compound with the amount of the
complex in the absence of the complex, a reduction in level
of complex thereby identifying an inhibitory compound which
is capable interfering the capacity of a human hairless
protein to form a complex with the binding compound.
Also, the present invention provides a transgenic non-human
animal comprising a nucleic acid encoding a human hairless
protein (wildtype or mutant).
Further still, the present invention provides a method for
identifying whether a compound is capable of ameliorating a
human hairless condition in an animal comprising: (a)
administering the compound to a transgenic animal wherein the
animal exhibits a human hairless condition; (b) determining
the level of expression of the protein of human hairless
protein (wildtype or mutant); and (c) comparing the level
expression of the human hairless protein (wildtype or mutant)
determined in step (b) with the level of expression
determined in the animal in the absence of the compound so
as to identify whether the compound is capable of
ameliorating the human hairless condition in the animal.
The present invention also further provides a transgenic non-
human knockout animal whose cells do not express a gene
encoding the human hairless protein (wildtype or mutant).
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
_g_
This invention further provides a method for identifying a
compound capable of restoring normal phenotype to the animal
provided herein comprising (a) administering the compound to
the animal, wherein the animal exhibits a human hairless
condition; (b) comparing the exhibition of the condition in
the animal in the presence of the compound with the
exhibition of the condition in the animal in the absence of
the compound so as to identify whether the compound is
capable of restoring normal phenotype to the animal.
This invention also provides a pharmaceutical composition
which comprises a compound identified by the methods
disclosed herein and a pharmaceutically acceptable carrier.
The present invention additionally provides a method for
treating a human hairless condition in a subject comprising
administering to the subject an amount of the pharmaceutical
composition disclosed herein, effective to treat the human
hairless condition in the subject.
The present invention also provides an antibody which binds
specifically to the human hairless protein (wildtype or
mutant) or portion thereof. The present invention provides
a cell producing the antibody provided herein. The present
invention further provides a method of identifying the human
hairless protein (wildtype or mutant) in a sample comprising
(a) contacting the sample with the antibody provided herein
under conditions permissive to the formation of a complex
between the antibody and the protein; (b) determining the
amount of complex formed; and (c) comparing the amount of
complex formed with the amount of complex formed in the
absence of the sample, the presence of an increased amount
of complex formed in the presence of the sample indicating
identification of the protein in the sample.
Finally, the present invention provides a method of
inhibiting hair growth, comprising administering to the
subject an amount of the pharmaceutical composition provided
CA 02362320 2001-07-30
WO 99/38965 PCT/LTS99/02128
_g_
herein, effective to inhibit hair growth in the subject.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-10-
Brief Description of the Figures for the First Series of
Experiments
Figure 1
The pedigree of the Alopecia universalis (AU) family
over six generations. Black circles and squares
represent affected females and males, respectively, and
figures with a black dot at the center represent
heterozygous carriers. The grey shaded box beneath the
pedigree characters indicates the haplotype on
chromosome 8p that cosegregates with the disease. The
order of the markers is indicated in the lower right
corner.
Figures 2A-2C
Clinical presentation of the congenital alopecia
universalis phenotype (A) Note the complete absence of
hair over the entire scalp of an affected individual
(V-11 in Figure 1). (B) The eyebrows, eyelashes and
facial hair are completely missing. (C) Histopathology
of a scalp biopsy from the same individual revealed a
markedly reduced number of hair follicles and those
present were found to be dilated and without hairs
(lower left). Note the absence of an inflammatory
infiltrate. (D) Clinical presentation of a child with
congenital alopecia and T-cell immunodeficiency. Note
the complete absence of frontal scalp hair, eyebrows
and eyelashes in this five year old young girl (left
panel). Scalp hair is completely missing on the entire
head (right panel).
Figure 3A-3B
(A) The lod score calculations for the linkage of AU to
chromosome 8p12 markers for the congenital alopecia
universalis family. (B) Comparison of the linkage
interval defined in the congenital alopecia universalis
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-11-
family with the location of the human hairless (hr)
gene (right) established by radiation hybrid mapping.
By linkage analysis, the locus of the gene in the AU
family was predicted to lie within the 6-cM interval
defined by the markers D8S258 and D851739 (left). By
radiation hybrid mapping, the hairless gene was
predicted to lie within the 19-cM interval between the
markers D8D280 and D8S278 (right), thus making it a
strong candidate gene in the congenital alopecia
universalis family.
Figures 4A-4C
(A). Sequence comparison of human (H) (Seq.ID.No.:4),
mouse (M) (Seq.ID.No.:S) and rat (R) hairless
(Seq.ID.No.:3). Areas shaded in black represent
regions of complete homology, those shaded in grey,
represent conservative amino acid substitutions, and
areas in white represent nonconservative substitutions.
The homology of human hairless compared with mouse and
rat was 84% and 83% respectively. The conserved six-
cysteine motif is indicated by asterisks beneath the
sequence. The human sequence represents 5eq.ID.No.:3.
(B) Northern blot analysis of human hairless (hr) in
poly(A)+ mRNA from eight different tissues, revealing
a ~5 kb message (arrow). Lanes 1 to 8 show heart,
brain, placenta, lung, liver skeletal muscle, kidney,
and pancreas, respectively. Substantial expression is
noted only in the brain (lane 2), with trace expression
' elsewhere (lanes 1 and 3 to 8). (C) Northern blot
analysis of human hairless in poly (A)+ mRNA from
culture fibroblasts derived from hair-bearing skin
reveals the same size hairless message (arrow).
Figure 5A-5C
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-12-
Mutation analysis of exon 15 of the human hairless gene
in the congenital alopecia universalis family. (A) The
wild-type sequence contains a homozygous A (arrow) at
the first base of a threonine codon (ACA). (H)
Sequence analysis of heterozygous carriers in the
congenital alopecia universalis family reveals the
presence of a G as well as the wild-type A at this
position (arrow). (C) Sequencing of all affected
individuals in the congenital alopecia universalis
family reveals a homozygous mutant G at this position
(arrow), resulting in the substitution of threonine by
alanine (GCA).
Figures 6
The nucleic acid sequence of nucleic acid encoding
human hairless wildtype protein (Seq.ID.No.:l and
Seq.ID.No.:2).
Brief Description of the Figures for the Second Series of
Experiments
Figure 7A-7B
(A) Pedigree of the family shown with disease
associated haplotypes. Filled circles and diamonds
indicate affected females and individuals of unknown
gender, respectively, and half-filled circles and
squares represent heterozygous carriers of the
mutation. Double are indicative of a consanguineous
union. Haplotypes are listed vertically beneath each
character from whom DNA was available. The disease-
associated haplotype is framed in a grey box beneath
each figure, and the order of the markers with respect
to the whn gene is given in the box at the lower right.
Mutation status with respect to the whn gene was scored
as 1=wild-type allele; 2-mutant R255X allele.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-13-
Recombination events ir~ individual IV-6 are indicated
by arrows on either side of the haplotypes. (B) The lod
score calculations for the linkage to the whn gene
mutation.
Figure 8A-8D
(A)Sequence analysis of a nonsense mutation in exon 5
of the whn gene. The upper panel reveals the
homozygous wild-type whn sequence in exon 5, from an
unrelated, unaffected control individual. The middle
panel contains DNA sequence from a heterozygous carrier
of the mutation R255X. Note the double T+C peak
directly beneath the arrow. The lower panel represents
the homozygous mutant R255X sequence. Note the
presence of the mutant T only beneath the arrow,
leading to a C-to-T transition and a substitution of an
arginine residue by a nonsense mutation CGA-to-TGA,
possibly due to spontaneous demethylation at the CpG
dinucleotide. (B) Confirmation of the mutation by
restriction enzyme digestion. The mutation introduced
a new restriction site for Bsrl, and after digestion
of the 184 by PCR product containing exon 5, the
product generated from the mutant allele should cleave
into two bands of 120 and 64 by in size. The
clinically unaffected parents and brother revealed
three bands of 184 bp, 120 bp, and 64 by (lanes 1, 2
and 6, upper panel), indicating that they were
heterozygous carriers of the mutation R255X. Both
patients revealed only the two digested bands of 120 by
and 64 by in size (lanes 3 and 4), consistent with the
presence of the mutation in the homozygous state. (C)
Evidence for long-term engraftment of the BMT. Gender
determination of the family members revealed a
genotypically XX pattern of an undigested 300 by band
in the mother (lane 1) and affected patients !lanes 3
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-14-
and 4), and a genotypically XY pattern consisting of
the 300 by band and two additional bands of 216 and 84
bp, indicative of the Y chromosome in the brother (lane
2) and the father (lane 6). Lane 5 contains peripheral
blood leukocyte from the patient after BMT,
demonstrating an XY genotype and the presence of the
normal whn allele, providing evidence for fraternal
chimerism and persistence of the graft. (D) Sequence
analysis of the hairless gene (Top) the wildtype
sequence of exon 3 (Middle) Sequence analysis of a
heterozygous carrier (Bottom) The 22-by deletion in the
homozygous state in an affected individual. The arrow
and bar above the wildtype sequence in the top panel
represent the sequence that is deleted in the
homozygous state in the patient in the bottom panel.
Figure 9A-9D
Expression of whn in different human tissu-es. (A)
Hybridization of the dot blot with a probe specific for
human whn revealed a strong signal in only three tissue
sources: Adult thymus (dot E5), fetal thymus (dot G6)
and human genomic control DNA (dot H8). (B)
Hybridization of the human immune system northern blot
revealed expression only in lane 3 containing thymus
RNA. Lane 1 contains spleen mRNA; lane 2, lymph node:
lane 4, peripheral blood leukocyte; lane 5, bone
marrow; and lane 6, fetal liver. (C) Hybridization of
the human multiple tissue northern blot revealed
expression only in lane 2 containing thymus RNA. Lane
1 contains spleen mRNA; lane 3, prostrate; lane 4,
testis lane 5, ovary lane 6, small intestine; lane 7,
colon without mucosa; and lane 8, peripheral blood
leukocyte. (D) Northern analysis of skin fibroblasts
(lane 1) and epidermal keratinocytes (lane 2) reveals
strong expression of whn in keratinocytes and
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-15-
negligible expression in fibroblasts (upper panel),
despite marked overloading of the fibroblast mRNA in
lane 1 as ascertained by GAPDH signal as internal
control (lower panel). There is a faint, minor
transcript present in the keratinocyte RNA that is not
observed in thymus RNA.
Figure l0A-lOD
Whn mRNA expression in normal human scalp skin. In
l0 situ hybridization with a digoxigenin-labeled whn
complementary RNA probe in sections of paraffin
embedded skin samples. (A) In interfollicular
epidermis, whn mRNA is concentrated in the basal
keratinocytes and the suprabasal cell layers of the
spinous compartment. It declines gradually with
keratinocyte differentiation and is prominently reduced
or absent in upper spinous cells and in granular cell
layer. (B) The sweat gland (SW) epithelium and
proliferating cells of the sebaceous gland (SG)
epithelium are always whn mRNA positive. In the distal
portion of the anagen hair follicle epithelium, whn
mRNA expression is localized to the basal cell layer of
the outer root sheath (ORS)(arrow). (C)The innermost
cell layer of the ORS is always highly whn mRNA
positive (arrows). (D) In the proximal portion of the
hair bulb, whn mRNA is localized to the differentiating
cells of the hair matrix (HM) and the innermost ORS
cell layer (arrowhead), while the dermal papilla (DP)
fibroblasts and inner root sheath (arrow) remain whn
mRNA negative.
Figure 11
Summary of existing mutations in the human hairless
gene, consisting of missense, nonsense and deletion
mutations. Ahmad, 1998, Science 279:720-724; Ahmad,
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-16-
1998, Am. J. Hum. Genet. 63:,984-991; Ahmad, 1998,
Human. Genet. 63:984-991.
Figure 12A-12B
Antibodies which bind specifically to the human
hairless protein. (A) Total protein lysates of 293T
cells transiently transfected with either control
plasmid or plasmid containing the Hr cDNA FLAG-tagged
at the amino-terminus, were used in immuno
precipitation experiments using either anti-FLAG
antibodies or an Hr immune serum. Immuno precipitates
were separated by SDS-PAGE and immunoblot analysis was
done using anti-FLAG antibodies. Both the anti-FLAG
and Hr immune serum are able to specifically immuno
precipitate Hr proteins. (B) Total protein lysates of
293T cells transiently transfected with either control
plasmid or plasmid containing the Hr cDNA, were
separated by SDS-PAGE. Immunoblot analysis was done
using 4 serial dilutions of either pre-immune serum or
an immune serum generated against the Hr protein. The
Hr immune serum specifically detects a 122kD protein,
which corresponds to the predicted molecular weight of
the Hr protein.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-17-
Detailed Description of the Invention
The present invention provides an isolated nucleic acid which
encodes a wildtype human hairless protein. The present
invention further provides an isolated nucleic acid which
encodes a mutant human hairless protein. The present
invention further provides an isolated wildtype human
hairless protein and also provides isolated mutant human
hairless proteins.
In an embodiment of this invention the nucleic acid is DNA.
In another embodiment of this invention, the nucleic acid is
RNA. In still another embodiment the nucleic acid is cDNA.
In yet another embodiment, the nucleic acid is genomic DNA.
In an embodiment of the invention the nucleic acid comprises
a nucleic acid having a sequence substantially the same as
the sequence designated SEQ. ID. No.: 1. In still another
embodiment, the nucleic acid comprises a nucleic acid
(Seq.ID.No.:2) having the sequence of SEQ. ID. No.: 1 except
a G to A transition occurs at the first base of a threonine
(T) residue at position 1022 (ACA) converting the threonine
residue to an alanine (A) residue as indicated for the human
sequence (H) in Figure 1. In another embodiment, the nucleic
acid comprises a nucleic acid having a sequence substantially
the same as the sequence designated SEQ. ID. No.: 1 and
wherein a nucleotide transition occurs at a threonine (T)
residue at position 1022 (ACA) converting the threonine
residue to an alanine (A) residue as indicated for the human
sequence (H) in Figure 1. In still another embodiment, the
nucleic acid comprises a nucleic acid having a sequence
substantially the same as the sequence designated SEQ. ID.
No.: 1 and wherein a nucleotide transition occurs at a
threonine (T) residue at position 1022 (ACA) converting the
threonine to a different amino acid residue. In a final
embodiment, the nucleic acid comprises a nucleic acid having
a sequence substantially the same as the sequence designated
SEQ. ID. No. 1 wherein the nucleotide transition occurs at
a residue for hairlessness converting the amino acid residue
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-18-
in the region to a different amino acid.
An embodiment of this invention is a vector comprising the
nucleic acid molecule. In an embodiment of this invention,
the vector is a virus, cosmid, yeast artificial chromosome
(YAC),bacterial artificial chromosome (BAC), bacteriophage
or a plasmid. An embodiment of this invention is a host
vector system for the production of a human hairless protein
which comprises the vector in a suitable host. In an
embodiment of this invention, the suitable host is a
bacterial cell or a eukaryotic cell. In an embodiment of
this invention, the suitable host is a mammalian cell, yeast
or insect cell.
Another embodiment of the present invention is a nucleic acid
probe comprising a nucleic acid of at least 11 nucleotides
capable of specifically hybridizing with a unique sequence
of nucleotides within the nucleic acid encoding wildtype or
mutant human hairless protein. In an embodiment -of this
invention, the nucleic acid probe is DNA or RNA. In another
embodiment of this invention, the nucleic acid is in the
antisense orientation to the coding strand of the nucleic
acid encoding the mutant or wildtype human hairless protein.
Another embodiment of the present invention is the isolated
human hairless wildtype protein having substantially the same
amino acid sequence as the human amino acid sequence shown
in Figure 4 and designated herein as SEQ.ID.NO.: 3.
Yet another embodiment of the present invention is the
isolated human hairless mutant protein having substantially
the same amino acid sequence as the human amino acid sequence
shown in Figure 4 except the threonine (T) at position 1022
is replaced by alanine (A) and is designated herein as
SEQ.ID.NO.: 4. In another embodiment of this invention, the
protein having substantially the same amino acid sequence as
the human amino acid sequence (H) shown in Figure 4
(SEQ.ID.NO.: 3). Yet another embodiment, is the protein
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-19-
having substantially the same amino, acid sequence as the
human amino acid sequence (H) shown in Figure 4 (SEQUENCE ID
NO.: 3) except the threonine (T) at position 1022 is replaced
by alanine (A) and is designated herein as SEQ.ID.NO.: 4.
Still another embodiment is the protein having substantially
the same amino acid sequence as the human amino acid sequence
(H) shown in Figure 4 (SEQUENCE ID NO.: 3) except the
threonine (T) at position 1022 is replaced by an amino acid
other than alanine.
In addition, the present invention provides a method of
isolating a nucleic acid encoding a wildtype human hairless-
related protein in a sample containing nucleic acid
comprising (a) contacting the nucleic acid in the sample with
the nucleic acid probe provided herein, under conditions
permissive to the formation of a hybridization complex
between the nucleic acid probe and the nucleic acid; (b)
isolating the complex formed; and (c) separating the nucleic
acid probe and the nucleic acid from the isolated complex
resulting from step (b), thereby isolating the nucleic acid
encoding a wildtype human hairless-related protein in the
sample.
In another embodiment, the isolated wildtype human whn
protein has a homozygous arginine to a premature termination
codon transition (C-to-T) at nucleotide position 792 leading
to a mutation at amino acid position 255 of the protein.
An embodiment of this invention .is further comprising (a)
amplifying the nucleic acid in the sample under conditions
permissive to polymerase chain reaction; and (b) detecting
the presence of a polymerase chain reaction product, the
presence of polymerase chain reaction product identifying the
presence of a nucleic acid encoding a human hairless-related
protein in the sample. An embodiment of this invention is
the nucleic acid isolated by this method. Yet another
embodiment is the detection of the polymerase chain reaction
product which comprises contacting the nucleic acid molecule
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-20-
from the sample with the nucleic acid probe described herein,
wherein the nucleic acid probe is labeled with a detectable
marker. Still another embodiment of this invention is
wherein the detectable marker is a radiolabeled molecule, a
fluorescent molecule, an enzyme, a ligand, or a magnetic
bead.
Further, the present invention provides a method for
identifying a compound which is capable of enhancing or
inhibiting expression of a human hairless protein comprising:
(a) contacting a cell which expresses the human hairless
protein in a cell and the compound; (b) determining the level
of expression of the human hairless protein in the cell; and
(c) comparing the level of expression of the human hairless
protein determined in step (b) with the level determined in
the absence of the compound, thereby identifying a compound
capable of inhibiting or enhancing expression of the human
hairless protein.
In embodiment of this invention, step (a) comprises
contacting a nucleic acid which expresses the human hairless
protein in a cell-free expression system and the compound.
An embodiment of this invention is a compound, not previously
known, identified by this method. According to an embodiment
of this invention, the cell is a dermal papilla cell, an
epithelial cell, a follicle cell, a hair matrix cell, a hair
bulb cell, a keratinocyte, an epidermal keratinocyte, a
fibroblast, a cuticle cell, a medullary cell, a cortical cell
or a thymic cell. According to an embodiment of this
invention, the compound is a peptide, a peptidomimetic, a
nucleic acid, a polymer, or a small molecule. In one
embodiment of this invention, the compound is bound to a
solid support.
The present invention also provides a method for identifying
a binding compound which is capable of forming a complex with
a human hairless protein comprising: (a) contacting the human
hairless protein and the compound; and (b) determining the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-21-
formation of a complex between the human hairless protein and
the compound, thereby identifying a binding compound which
is capable of forming a complex with a human hairless
protein.
An embodiment of this invention is a compound, not previously
known, identified by this method, capable of forming a
complex with a human hairless protein.
The present invention additionally provides a method for
identifying an inhibitory compound which is capable of
interfering the capacity of a human hairless protein to form
a complex with the binding compound comprising: (a)
contacting the complex and the compound; (b) measuring the
level of the complex; and (c) comparing the level of complex
in the presence of the compound with the amount of the
complex in the absence of the complex, a reduction in level
of complex thereby identifying an inhibitory compound which
is capable interfering the capacity of a human hairless
protein to form a complex with the binding compound.
An embodiment of this invention is a compound, not previously
known, identified by the method described, capable of
interfering with the capacity of a human hairless protein to
form a complex with the identified binding compound.
Also, the present invention provides a transgenic non-human
animal comprising a nucleic acid encoding wildtype or mutant
human hairless protein. An embodiment of this invention is
a transgenic non-human animal whose somatic and germ cells
contain and express a gene encoding the human hairless
protein (wildtype or mutant) or the whn protein, the gene
having been introduced into the animal or an ancestor of the
animal at an embryonic stage and wherein the gene may be
operably linked to an inducible promoter element. In one
embodiment of this invention, the animal is a mouse.
Further still, the present invention provides a method for
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-22-
identifying whether a compound is capable of ameliorating a
human hairless condition in an animal comprising: (a)
administering the compound to a transgenic animal wherein the
animal exhibits a human hairless condition; (b) determining
the level of expression of the protein of human hairless
protein (wildtype or mutant); and (c) comparing the level
expression of the human hairless protein (wildtype or mutant)
determined in step (b) with the level of expression
determined in the animal in the absence of the compound so
l0 as to identify whether the compound is capable of
ameliorating the human hairless condition in the animal.
An embodiment of this invention is a compound, not previously
known, identified by this method, capable of ameliorating a
human hairless condition in an animal. In embodiment of
this invention, the human hairless condition is Androgenetic
Alopecia (male pattern baldness), Alopecia Areata , Alopecia
Totalis, Alopecia Universalis, Congenital Alopecia
Universalis or Congenital Alopecia and Severe- T-Cell
Immunodeficiency.
The present invention also further provides a transgenic non-
human knockout animal whose cells do not express a gene
encoding a mutant or wildtype human hairless protein. An
embodiment of this invention is a transgenic non-human
knockout animal whose somatic and germ cells do not express
a gene encoding the human hairless protein (wildtype or
mutant), the genes) having been deleted or incapacitated in
the animal or an ancestor of the animal at an embryonic
stage. In an embodiment of this invention, the animal is a
mouse.
This invention further provides a method for identifying a
compound capable of restoring normal phenotype to the animal
provided herein comprising (a) administering the compound to
the animal, wherein the animal exhibits a human hairless
condition; (b) comparing the exhibition of the condition in
the animal in the presence of the compound with the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-23-
exhibition of the condition in the animal in the absence of
the compound so as to identify whether the compound is
capable of restoring normal phenotype to the animal. An
embodiment of this invention is a compound, not previously
known, identified by this method capable of restoring normal
phenotype to the animal. In an embodiment of this invention,
the human hairless condition is Androgenetic Alopecia (male
pattern baldness), Alopecia Areata, Alopecia Totalis,
Alopecia Universalis, Congenital Alopecia Universalis or
Congenital Alopecia and Severe T-Cell Immunodeficiency.
This invention also provides a pharmaceutical composition
which comprises a compound identified by the methods
disclosed herein and a pharmaceutically acceptable carrier.
In an embodiment of this invention, the carrier is a diluent,
an aerosol, a topical carrier, an aqueous solution, a
nonaqueous solution or a solid carrier.
The present invention additionally provides a method for
treating a human hairless condition in a subject comprising
administering to the subject an amount of the pharmaceutical
composition disclosed herein, effective to treat the human
hairless condition in the subject. According to an
embodiment of this invention, the human hairless condition
is Androgenetic Alopecia (male pattern baldness), Alopecia
Areata, Alopecia Totalis or Alopecia Universalis, Congenital
Alopecia Universalis or Congenital Alopecia and Severe T-Cell
Immunodeficiency.
The present invention also provides an antibody which binds
specifically to the human hairless protein (wildtype or
mutant) or portion thereof. The present invention provides
a cell producing the antibody provided herein. The present
invention further provides a method of identifying the human
hairless protein (wildtype or mutant) in a sample comprising
(a) contacting the sample with the antibody provided herein
under conditions permissive to the formation of a complex
between the antibody and the protein; (b) determining the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-24-
amount of complex formed; and (c) comparing the amount of
complex formed with the amount of complex formed in the
absence of the sample, the presence of an increased amount
of complex formed in the presence of the sample indicating
identification of the protein in the sample. According to
one embodiment of this invention, the antibody is human or
mouse. According to an embodiment of this invention, the
antibody is a monoclonal antibody. An embodiment of this
invention also provides a cell producing the antibody which
binds specifically to a mutant or wildtype human hairless
protein. An embodiment of this invention further provides
a method of method of identifying a mutant or wildtype human
hairless protein comprising: (a) contacting the sample with
the antibody under conditions permissive to the formation of
a complex between the antibody and the protein;(b)
determining the amount of complex formed; and (c) comparing
the amount of complex formed with the amount of complex
formed in the absence of the sample, the presence of an
increased amount of complex formed in the presence of the
sample indicating identification of the protein in the
sample.
Finally, the present invention provides a method of
inhibiting hair growth, comprising administering to the
subject an amount of the pharmaceutical composition provided
herein, effective to inhibit hair growth in the subject.
As used herein, the term "human hairless protein" shall mean
polypeptides encoded by the human polypeptide sequence marked
(H) set forth in Figure 4 and designated herein as
Seq.ID.No.:3 and any polypeptide which possesses substantial
amino acid homology with said polypeptides.
As used herein, the term "human hairless polynucleotide"
shall mean: (1) polynucleotides encoded by the polynucleotide
sequence set forth in Figure 6 and designated herein as
Seq.ID.No.:l, (2) any polynucleotide sequence which encodes
for a human hairless protein or (3) any polynucleotide
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-25-
sequence which hybridizes to the polynucleotide sequences of
(1) and (2), above, under stringent hybridization conditions.
As used herein, "stringent hybridization conditions" are
those hybridizing conditions that (1) employ low ionic
strength and high temperature for washing, for example, 0.015
M NaCl/0.0015M sodium citrate/0.1% SDS at 50°C; (2) employ
during hybridization a denaturing agent such as formamide,
for example, 50% (vol/vol) formamide with 0.1% bovine serum
albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/ 50mM sodium
phosphate buffer at pH 6.5 with 750 mM NaCl, 75 mM sodium
citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75
M NaCl, 0.075 M sodium citrate) 5 x Denhardt's solution,
sonicated salmon sperm DNA (50 g/ml), 0.1% SDS, and 10%
dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC and
0.1% SDS.
As used herein, "substantial amino acid homology" shall mean
molecules having a sequence homology of approximately 85% or
more, preferably greater than or equal to 90% and more
preferably greater than or equal to 95%.
The present invention relates to the human polypeptide and
polynucleotide molecules and sequences which correspond to
a factor implicated in the development of the hair follicle
and in the hair cycle. This factor, designated the human
hairless protein, and specifically, the expression of mutated
forms of this factor, are related to abnormal hair growth,
including alopecias.
3.0
The present invention is further directed to methods for
manipulating the expression of the human hairless protein to
interrupt the hair cycle, either by manipulating hair
follicle development or one of the stages of the hair growth
cycle. Such methods may be useful to inhibit hair growth.
In one embodiment of the invention, methods and compositions
which rely upon the manipulation of the signal peptide which
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-26-
corresponds to the human hairless protein. In the preferred
methods and compositions, the compositions are applied
topically to the area in which hair growth is sought to be
regulated.
The practice of the present invention may include expression
of biologically active human hairless protein. In order to
express a biologically active human hairless, the nucleotide
sequence coding for the protein, or a functional equivalent
may be inserted into an appropriate expression vector, i.e.,
a vector which contains the necessary elements for the
transcription and translation of the inserted coding
sequence.
More specifically, methods which are well known to those
skilled in the art can be used to construct expression
vectors containing the human hairless sequence and
appropriate transcriptional/translational control signals.
These methods include in vitro recombinant DNA techniques,
synthetic techniques and in vivo recombination/genetic
recombination. See e.g., the techniques described in
Maniatis et al., 1989, Molecular Cloning A Laboratory Manual,
Cold Spring Harbor Laboratory, N.Y. and Ausubel et al., 1989,
Current Protocols in Molecular Biology, Greene Publishing
Associates and Wiley Interscience, N.Y.
A variety of host-expression vector systems may be utilized
to express the human hairless coding sequence. These include
but are not limited to microorganisms such as bacteria
transformed with recombinant bacteriophage DNA, plasmid DNA
or cosmid DNA expression vectors containing the human
hairless coding sequence; yeast transformed with recombinant
yeast expression vectors containing the human hairless coding
sequences insect cell systems infected with recombinant virus
expression vectors (e. g., baculovirus) containing the Human
hairless coding sequence; plant cell systems infected with
CA 02362320 2001-07-30
WO 99/38965 _ 2 ~ - PCT/US99/02128
recombinant virus expression vectors (e. g.. cauliflower
mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed
with recombinant plasmid expression vectors (e.g., Ti
plasmid) containing the Human hairless coding sequence; or
animal cell systems infected with recombinant virus
expression vectors (e. g., adenovirus, vaccinia virus, human
tumor cells (including HT-1080)) including cell lines
engineered to contain multiple copies of the Human hairless
DNA either stably amplified (CHO/dhfr) or unstably amplified
in double-minute chromosomes (e. g., murine cell lines).
The expression elements of these systems vary in their
strength and specificities. Depending on the host/vector
system utilized, any of a number of suitable transcription
and translation elements, including constitutive and
inducible promoters, may be used in the expression vector.
For example, when cloning in bacterial systems, inducible
promoters such as pL of bacteriophage (plac, ptrp, ptac
(ptrp-lac hybrid promoter) and the like may be used; when
cloning in insect cell systems, promoters such as the
baculovirus polyhedrin promoter may be used; when cloning in
plant cell systems, promoters derived from the genome of
plant cells (e.g., heat shock promoters; the promoter for the
small subunit of RUBISCO; the promoter for the chlorophyll
a/b binding protein) or from plant viruses (e.g., the 355 RNA
promoter of CaMV; the coat protein promoter of TMV) may be
used; when cloning in mammalian cell systems, promoters
derived from the genome of mammalian cells (e. g.,
metallothionein promoter) or from mammalian viruses (e. g.,
the adenovirus late promoter; the vaccinia virus 7.5Ii
promoter) may be used; when generating cell lines that
contain multiple copies of the Human hairless DNA SV40-, BPV-
and EBV-based vectors may be used with an appropriate
selectable marker.
In bacterial systems, a number of expression vectors may be
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-28-
advantageously selected depending upon the use intended for
the expressed Human hairless. For example, when large
quantities of Human hairless for screening purposes, vectors
which direct the expression of high levels of fusion protein
products that are readily purified may be desirable. Such
vectors include but are not limited to the E. coli expression
vector pUR278 (Ruther et al., 1983, EMBO J. 2:1791), in which
the Human hairless coding sequence may be ligated into the
vector in frame with the lac Z coding region so that a hybrid
AS-lac Z protein is produced; pIN vectors (Inouye & Inouye,
1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster,
1989, J. Biol. Chem. 264:5503-5509); and the like. pGEX
vectors may also be used to express foreign polypeptides as
fusion proteins with glutathione S-transferase (GST). In
general, such fusion proteins are soluble and can easily be
purified from lysed cells by adsorption to
glutathione-agarose beads followed by elution in the presence
of free glutathione. The pGEX vectors are designed to
include thrombin or factor Xa protease cleavage sites so that
the cloned polypeptide of interest can be released from the
GST moiety.
In yeast, a number of vectors containing constitutive or
inducible promoters may be used. For a review see, Current
Protocols in Molecular Biology, Vol. 2, 1988, Ed. Ausubel et
al., Greene Publish. Assoc. & Wiley Interscience, Ch. 13;
Grant et al., 1987, Expression and Secretion Vectors for
Yeast, in Methods in Enzymology, Eds. Wu & Grossman, 1987,
Acad. Press, N.Y., Vol. 153, pp. 516-544; Glover, 1986, DNA
Cloning, Vol. II, IRL Press, Wash., D.C., Ch. 3; Bitter,
1987, Heterologous Gene Expression in Yeast, Methods in
Enzymology, Eds. Berger & Kimmel, Acad. Press, N.Y., Vol.
152, pp. 673-684; and The Molecular Biology of the Yeast
Saccharomyces, 1982, Eds. Strathern et al., Cold Spring
Harbor Press, Vols. I and II.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-29-
In cases where plant expression vectors are used, the
expression of the Human hairless coding sequence may be
driven by any of a number of promoters. For example, viral
promoters such as the 35-S RNA and 19S RNA promoters of CaMV
(Brisson et al., 1984, Nature 310:511-514), or the coat
protein promoter of TMV (Takamatsu et al., 1987, EMBO J.
6:307-311) may be used; alternatively, plant promoters such
as the small subunit of RUBISCO (Coruzzi et al., 1984, EMBO
J. 3:1671-1680; Broglie et al., 1984, Science 224:838-843);
or heat shock promoters, e.g., soybean hspl7.5-E or hspl7.3-B
(Gurley et al., 1986, Mol. Cell. Biol. 6:559-565) may be
used. These constructs can be introduced into plant cells
using Ti plasmids, Ri plasmids, plant virus vectors, direct
DNA transformation, microinjection, electroporation, etc.
For reviews of such techniques see, for example, Weissbach
& Weissbach, 1988, Methods for Plant Molecular Biology,
Academic Press, NY, Section VIII, pp. 421-463; and Grierson
& Corey, 1988, Plant Molecular Biology, 2d Ed., Blackie,
London, Ch. 7-9.
An alternative expression system which could be used to
express Human hairless is an insect system. In one such
system, baculovirus may be used as a vector to express
foreign genes . The virus then grows in the insect cells .
The Human hairless coding sequence may be cloned into
non-essential regions (for example the polyhedrin gene) of
the virus and placed under control of a Baculovirus promoter.
These recombinant viruses are then used to infect insect
cells in which the inserted gene is expressed. (E.g., see
Smith et al., 1983, J. Viol. 46:584; Smith, U.S. Patent No.
4,215,051).
In mammalian host cells, a number of viral based expression
systems may be utilized. In cases where an adenovirus is
used as an expression vector, the Human hairless coding
sequence may be ligated to an adenovirus
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-30-
transcription/translation control complex, e.g., the late
promoter and tripartite leader sequence. This chimeric gene
may then be inserted in the adenovirus genome by in vitro or
in vivo recombination. Insertion in a non-essential region
of the viral genome (e.g., region E1 or E3) will result in
a recombinant virus that is viable and capable of expressing
Human hairless in infected hosts. See e.g., Logan & Shenk,
1984, Proc. Natl. Acad. Sci. (USA) 81:3655-3659.
Alternatively, the vaccinia 7.5K promoter may be used. See,
e.g., Mackett et al., 1982, Proc. Natl. Acad. Sci. (USA)
79:7415-7419; Mackett et al., 1984, J. Virol. 49:857-864;
Panicali et al., 1982, Proc. Natl. Acad. Sci. 79:4927-4931.
In another embodiment, the Human hairless sequence is
expressed in human tumor cells, such as HT-1080, which have
been stably transfected with calcium phosphate precipitation
and a neomycin resistance gene.
Specific initiation signals may also be required for
efficient translation of inserted Human hairless coding
sequences. These signals include the ATG initiation codon
and adjacent sequences. In cases where the entire Human
hairless gene, including its own initiation codon and
adjacent sequences, is inserted into the appropriate
expression vector, no additional translational control
signals may be needed. However, in cases where only a
portion of the Human hairless coding sequence is inserted,
exogenous translational control signals, including the ATG
initiation codon, must be provided. Furthermore, the
initiation codon must be in phase with the reading frame of
the Human hairless coding sequence to ensure translation of
the entire insert. These exogenous translational control
signals and initiation codons can be of a variety of origins,
both natural and synthetic. The efficiency of expression may
be enhanced by the inclusion of appropriate transcription
enhancer elements, transcription terminators, etc. See e.g.,
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-31-
Bitter et al., 1987, Methods in Enzymol. 153:516-544.
In addition, a host cell strain may be chosen which modulates
the expression of the inserted sequences, or modifies and
processes the gene product in the specific fashion desired.
Such modifications (e. g., glycosylation) and processing
(e.g., cleavage) of protein products may be important for the
function of the protein. Different host cells have
characteristic and specific mechanisms for the
post-translational processing and modification of proteins.
Appropriate cells lines or host systems can be chosen to
ensure the correct modification and processing of the foreign
protein expressed. To this end, eukaryotic host cells which
possess the cellular machinery for proper processing of the
primary transcript, glycosylation, and phosphorylation of the
gene product may be used. Such mammalian host cells include
but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293,
WI38, HT-1080 etc.
For long-term, high-yield production of recombinant proteins,
stable expression is preferred. For example, cell lines
which stably express Human hairless may be engineered.
Rather than using expression vectors which contain viral
origins of replication, host cells can be transformed with
Human hairless DNA controlled by appropriate expression
control elements (e. g., promoter, enhancer, sequences,
transcription terminators, polyadenylation sites, etc.), and
a selectable marker. Following the introduction of foreign
DNA, engineered cells may be allowed to grow for 1-2 days in
3D an enriched media, and then are switched to a selective
media. The selectable marker in the recombinant plasmid
confers resistance to the selection and allows cells to
stably integrate the plasmid into their chromosomes and grow
to form foci which in turn can be cloned and expanded into
cell lines.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-32-
A number of selection systems may be used, including but not
limited to the herpes simplex virus thymidine kinase (Wigler,
et al., 1977, Cell 11:223), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc.
Natl. Acad. Sci. USA 48:2026), and adenine
phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817)
genes can be employed in tk-, hgprt or aprt cells,
respectively. Also, antimetabolite resistance can be used
as the basis of selection for dhfr, which confers resistance
to methotrexate (Wigler, et al., 1980, Proc. Natl. Acad. Sci.
USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA
78:1527); gpt, which confers resistance to mycophenolic acid
(Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072);
neo, which confers resistance to the aminoglycoside G-418
(Colberre-Garapin, et al., 1981, J. Mol. Biol. 150:1); and
hygro, which confers resistance to hygromycin (Santerre, et
al., 1984, Gene 30:147) genes. Recently, additional
selectable genes have been described, namely trpB, which
allows cells to utilize indole in place of tryptophan; hisD,
which allows cells to utilize histinol in place of histidine
(Hartman & Mulligan, 1988, Proc. Natl. Acad. Sci. USA
85:8047), and ODC (ornithine decarboxylase) which confers
resistance to the ornithine decarboxylase inhibitor,
2-(difluoromethyl)-DL-ornithine, DEMO (McConlogue, 1987, In:
Current Communications in Molecular Biology, Cold Spring
Harbor Laboratory ed.).
In the practice of the present invention, a transgenic animal
may be generated. One means available for generating a
transgenic animal, with a mouse as an example, is as follows:
Female mice are mated, and the resulting fertilized eggs are
dissected out of their oviducts. The eggs are stored in an
appropriate medium such as M2 medium (Hogan B. et al.
Manipulating the Mouse Embryo, A Laboratory Manual, Cold
Spring Harbor Laboratory (1986)). DNA or cDNA encoding a
vertebrate hairless protein is purified from a vector by
CA 02362320 2001-07-30
WO 99/38965 - 3 3 - PCT/LTS99/02128
methods well known in the art. Inducible promoters may be
fused with the coding region of the DNA to provide an
experimental means to regulate expression of the trans-gene.
Alternatively or in addition, tissue specific regulatory
elements may be fused with the coding region to permit
tissue-specific expression of the trans-gene. The DNA, in
an appropriately buffered solution, is put into a
microinjection needle (which may be made from capillary
tubing using a pipet pulley) and the egg to be injected is
put in a depression slide. The needle is inserted into the
pronucleus of the egg, and the DNA solution is injected. The
injected egg is then transferred into the oviduct of a
pseudopregnant mouse (a mouse stimulated by the appropriate
hormones to maintain pregnancy but which is not actually
pregnant), where it proceeds to the uterus, implants, and
develops to term. As noted above, microinjection is not the
only method for inserting DNA into the egg cell, and is used
here only for exemplary purposes.
In the practice of any of the methods of the invention or
preparation of any of the pharmaceutical compositions an
"therapeutically effective amount" is an amount which is
capable of inhibiting hairlessness or T-cell deficiency.
Accordingly, the effective amount will vary with the subject
being treated, as well as the condition to be treated. For
the purposes of this invention, the methods of administration
are to include, but are not limited to, administration
cutaneously, subcutaneously, intravenously, parenterally,
orally, topically, or by aerosol._
As used herein, the term "suitable pharmaceutically
acceptable carrier" encompasses any of the standard
pharmaceutically accepted carriers, such as phosphate
buffered saline solution, water, emulsions such as an
oil/water emulsion or a triglyceride emulsion, various types
of wetting agents, tablets, coated tablets and capsules. An
example of an acceptable triglyceride emulsion useful in
intravenous and intraperitoneal administration of the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-34-
compounds is the triglyceride emulsion commercially known as
Intralipid~.
Typically such carriers contain excipients such as starch,
milk, sugar, certain types of clay, gelatin, stearic acid,
talc, vegetable fats or oils, gums, glycols, or other known
excipients. Such carriers may also include flavor and color
additives or other ingredients.
This invention also provides for pharmaceutical compositions
capable of inhibiting neurotoxicity together with suitable
diluents, preservatives, solubilizers, emulsifiers, adjuvants
and/or carriers. Such compositions are liquids or
lyophilized or otherwise dried formulations and include
diluents of various buffer content (e. g., Tris-HC1., acetate,
phosphate), pH and ionic strength, additives such as albumin
or gelatin to prevent absorption to surfaces, detergents
(e. g., Tween 20, Tween 80, Pluronic F68, bile acid salts),
solubilizing agents (e. g., glycerol, polyethylene glycerol),
anti-oxidants (e. g., ascorbic acid, sodium metabisulfite),
preservatives (e. g., Thimerosal, benzyl alcohol, parabens),
bulking substances or tonicity modifiers (e. g., lactose,
mannitol), covalent attachment of polymers such as
polyethylene glycol to the compound, complexation with metal
ions, or incorporation of the compound into or onto
particulate preparations of polymeric compounds such as
polylactic acid, polglycolic acid, hydrogels, etc, or onto
liposomes, micro emulsions, micelles, unilamellar or multi
lamellar vesicles, erythrocyte ghosts, or spheroplasts. Such
compositions will influence the physical state, solubility,
stability, rate of in vivo release, and rate of in vivo
clearance of the compound or composition.
Controlled or sustained release compositions include
formulation in lipophilic depots (e. g., fatty acids, waxes,
oils). Also comprehended by the invention are particulate
compositions coated with polymers (e.g., poloxamers or
poloxamines) and the compound coupled to antibodies directed
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-35-
against tissue-specific receptors, ligands or antigens or
coupled to ligands of tissue-specific receptors. Other
embodiments of the compositions of the invention incorporate
particulate forms protective coatings, protease inhibitors
or permeation enhancers for various routes of administration,
including parenteral, pulmonary, nasal and oral.
When administered, compounds are often cleared rapidly from
the circulation and may therefore elicit relatively short-
lived pharmacological activity. Consequently, frequent
injections of relatively large doses of bioactive compounds
may by required to sustain therapeutic efficacy. Compounds
modified by the covalent attachment of water-soluble polymers
such as polyethylene glycol, copolymers of polyethylene
glycol and polypropylene glycol, carboxymethyl cellulose,
dextran, polyvinyl alcohol, polyvinylpyrrolidone or
polyproline are known to exhibit substantially longer half-
lives in blood following intravenous injection than do the
corresponding unmodified compounds (Abuchowski et al., 1981;
Newmark et al., 1982; and Katre et al., 1987). Such
modifications may also increase the compound's solubility in
aqueous solution, eliminate aggregation, enhance the physical
and chemical stability of the compound, and greatly reduce
the immunogenicity and reactivity of the compound. As a
result, the desired in vivo biological activity may be
achieved by the administration of such polymer-compound
adducts less frequently or in lower doses than with the
unmodified compound.
Attachment of polyethylene glycol (PEG) to compounds is
particularly useful because PEG has very low toxicity in
mammals (Carpenter et al., 1971). For example, a PEG adduct
of adenosine deaminase was approved in the United States for
use in humans for the treatment of severe combined
immunodeficiency syndrome. A second advantage afforded by
the conjugation of PEG is that of effectively reducing the
immunogenicity and antigenicity of heterologous compounds.
For example, a PEG adduct of a human protein might be useful
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-36
for the treatment of disease in other mammalian species
without the risk of triggering a severe immune response. The
carrier includes a microencapsulation device so as to reduce
or prevent an host immune response against the compound or
against cells which may produce the compound. The compound
of the present invention may also be delivered
microencapsulated in a membrane, such as a liposome.
Polymers such as PEG may be conveniently attached to one or
more reactive amino acid residues in a protein such as the
alpha-amino group of the amino terminal amino acid, the
epsilon amino groups of lysine side chains, the sulfhydryl
groups of cysteine side chains, the carboxyl groups of
aspartyl and glutamyl side chains, the alpha-carboxyl group
of the carboxy-terminal amino acid, tyrosine side chains, or
to activated derivatives of glycosyl chains attached to
certain asparagine, serine or threonine residues.
Numerous activated forms of PEG suitable for direct reaction
with proteins have been described. Useful PEG reagents for
reaction with protein amino groups include active esters of
carboxylic acid or carbonate derivatives, particularly those
in which the leaving groups are N-hydroxysuccinimide, p-
nitrophenol, imidazole or 1-hydroxy-2-nitrobenzene-4-
sulfonate. PEG derivatives containing maleimido or
haloacetyl groups are useful reagents for the modification
of protein free sulfhydryl groups. Likewise, PEG reagents
containing amino hydrazine or hydrazide groups are useful for
reaction with aldehydes generated_by periodate oxidation of
carbohydrate groups in proteins.
This invention is illustrated by examples set forth in the
Experimental Details section which follows. This section is
provided to aid in an understanding of the invention but is
not intended to, and should not be construed to, limit in any
way the invention as set forth in the claims which follow
thereafter.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-37-
EXPERIMENTAL DETAILS
First Series of Experiments
Example 1: Identification of the human hairless gene. In an
effort to understand the molecular basis of an inherited form
of congenital alopecia universalis, a Pakistani kindred with
congenital alopecia universalis segregating as a single
abnormality without associated ectodermal defects was
identified and studied. This kindred was comprised of 4
affected males and 7 affected females (Figure 1). At birth,
the hair usually appears normal on the scalp, but never
regrows after ritual shaving usually performed a week after
birth. Skin biopsy from the scalp of an affected person
revealed very few hair follicles, dilated, and without hairs.
Affected persons are born completely devoid of eyebrows and
eyelashes, and never develop axillary and pubic hair. The
pedigree is strongly suggestive of autosomal recessive
inheritance, and various consanguineous loops account for all
affected persons being homozygous for the abnormal allele.
Locus determination. To identify the alopecia locus
segregating in this family, a genome wide search for linkage
was initiated using the homozygosity mapping approach.
Sheffield, et al., 1995, Curr. Opin Genet. Devel. 5:335.
During the initial screening, DNA samples from four affected
individuals (IV-22, V-2, V-11, and VI-2 in Figure 4) were
genotyped using 386 highly polymorphic microsatellite markers
spaced at 10 cM intervals (Research Genetics, Inc.). More
specifically, blood samples were collected from 36 members
of the congenital alopecia universalis family, according to
local informed consent procedures. DNA was isolated
according to standard techniques. J. Sambrook, E.G. Fritsch,
T. Maniatis, Molecular Cloning, A Laboratory Manual, (Cold
Spring Harbor Laboratory, Cold Spring Harbor, NY, ed. 2,
1989). Florescent automated genotyping for the genome-wide
linkage search was carried out using 386 markers covering the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-38-
genome at approximately 10 cM intervals. In the course of
this screen, 13 genomic regions were found to be homozygous
for three to four affected individuals, each of these were
tested further in 32 additional family members, and twelve
of these were excluded. One marker, D8S136 on chromosome
8p12, was found to be homozygous in all 7 affected
individuals. Further analysis with markers from this region
resulted in the identification of homozygosity in all
affected individuals for the markers D8S1786 and D8S298.
Refined and more extensive screening of all regions showing
homozygosity in affected and unaffected family members was
carried out using primers obtained from Research Genetics,
Inc., or in the Genome Data Base. Analysis of microsatellite
markers consisted of end-labeling one primer using (33p dATP,
a PCR reaction consisting of 7 minutes at 95°C, 1 minute,
55°C, 1 minute; 72°C, 1 minute; and electrophoresis in a 60
polyacrylamide gel (Sequa-gel, Action Scientific).
Microsatellite markers were visualized by exposure of-the gel
to autoradiography, and genotypes were assigned by visual
inspection. Allele patterns obtained with the markers D8S136
and D8S1786 indicated that these two markers are placed very
close to each other on chromosome8p12. Using the FASTLINK
3.0 package, a maximum two point LOD score of 6.19 at zero
recombination gene was achieved with the marker D8S298, as
set forth at Table 1:
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-39-
TABLE 1
Lod Scores For Linkage To
Chromosome 8p12 Markers
Recombination Factors
Locus 0 0.01 0.05 0:1 0.2 0.3 0.4
D8S258 a 2.57 2.85 2.63 1.87 1.01 0.32
D8S298 6.19 6.04 5.45 4.70 3.16 1.65 0.47
D8S1786 4.92 4.83 4.43 3.92 2.87 1.79 0.76
D8S1739 a 1.74 2.64 2.61 1.92 1.00 0.22
Statistical calculations for linkage analysis were carried
out using the computer program FASTLINK version 3. OP
(Schaffer, 1996, Hum Hered. 46:226), which enables all
inbreeding loops in the family to be retained, and the
capability for two point analysis. Autosomal recessive with
complete penetrance was assumed using a disease allele
frequency of 0.0001. LOD score was calculated using equal
allele frequencies, and setting the frequency of the allele
segregating with the disease at 0.9, to obtain results under
the most stringent model. Multipoint analysis was not
possible due to the large number of inbreeding loops and
complexity of the pedigree. The results indicate that the
alopecia gene in this family mapped to chromosome 8p12.
Recombinant haplotypes observed in individuals IV-2 and IV-7
placed the alopecia locus within a 6 cM interval between the
distal and proximal markers, D8S258 and D8S1739,
respectively (FIG. 3) with no obvious candidate genes in
this interval.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-40-
Cloning of human hairless.
A hairless mouse has been previously reported, as set forth
in Brooke, 1924, J. Hered. 15:173. This mouse was studied
as a potential model for human alopecias. To this end, work
was conducted to clone the human homolog of hairless using
PCR primers based on the available murine cDNA sequence
(GenBank accession #Z32675), as reported in Cachon-Gonzalez
et al., 1994, Proc. Natl. Acad Sci. U.S.A., 91:7717. RT-PCR
amplification of a segment corresponding to exons 13-18 in
the murine sequence using human skin fibroblast mRNA as
template was performed, and delineated the corresponding
intron/exon borders in the human sequence. More
specifically, for RT-PCR of human hairless cDNA sequences,
total RNA was extracted from cultured skin fibroblasts from
a control individual according to standard methods, as set
forth in Sambrook, et al., 1989, Molecular Cloning, A
Laboratory Manual, (Cold Spring Harbor Laboratory, Bold
Spring Harbor, NY ed. 2, 1989). Human hairless mRNAs were
reverse transcribed with MMLV reverse transcriptase (Gibco,
BRL), using an oligo-dT primer (Pharmacia). PCR was carried
out using the following primers, constructed on the basis of
the mouse hairless sequence (GenBank #z32675): sense:
5'TGAGGGCTCTGTCCTCCTGC3' (Seq.ID.No.:7); antisense
5'GCTGGCTCCCTGGTGGTAGA3' (Seq.ID.No.:6). PCR conditions
were 95°C, 5 minutes, followed by 35 cycles of 95 C, 1
minute; 55°C, 1 minute; 72°C, 1 minute, using AmpliTaq Gold
DNA polymerase (Perkin-Elmer). Following direct sequencing
of the human cDNA, exon-based primers were designed and used
to amplify genomic DNA sequences at both the 5' donor and 3'
acceptor splice junctions. The human hairless sequence has
been deposited in GenBank and accorded accession number
AF039196.
The human and murine amino acid sequences in this region
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-41-
were 89o homologous, and the exon sizes were well conserved.
The murine hairless gene resides on mouse chromosome 14
(Cachon-Gonzalez, et al., 1994, Proc. Natl. Acad Sci.
U.S.A., 91:7717), which shares synteny with the human
chromosomes 8p and 14q, among others.
To determine the precise chromosomal localization of the
human homolog of hairless, radiation hybrid mapping using
the Genebridge 4 panel consisting 93 radiation induced
human-hamster cell hybrids (Research Genetics, Inc.), placed
the human homolog of the mouse hairless gene on chromosome
8p, between the polymorphic markers, D8S280 and D278,
spanning a 19 cM region (FIG. 4). A portion of human
hairless intron 13 was PCR amplified and used for radiation
hybrid mapping using the G3 panel, by Research Genetics,
Inc. Primers were as follows: sense:
5'TATGTCACCAAGGGCCAGCC3' (Seq.ID.No.: 8): and antisense:
5'TCAGGGTAGGGGGTCATGCC3' (Seq.ID.No.: 9). PCR conditions
were 95°C, 5 minutes, followed by 35 cycles of 95 C, 1
minute; 55°C, 1 minutes 72 °C, 1 minute, using AmpliTaq Gold
DNA polymerase (Perkin-Elmer). PCR primers specifically
amplified human hairless, and did not cross-hybridize with
the hamster DNA used in the radiation hybrid panel.
The amino acid and nucleic acid sequences identified by the
methods set forth above are set forth in Figures 4 and 6
respectively.
Relationship of human hairless to Alopecia
Data provides that the 6 cM candidate region obtained for
the congenital alopecia universalis gene by linkage analysis
with flanking markers D8S258 and D8S1739, lies between
markers D8S280 and D8S278 based on the Genome Data Base, the
Center for Medical Genetics and the radiation hybrid map
constructed by the Human Genome Mapping Center at Stanford
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-42
University (SHGC). Based on this genomic co-localization,
its was contemplated that the human hairless gene became a
major candidate gene responsible for congenital alopecia
universalis in this family, and the search for a mutation
was initiated.
The sequence contained within exon 15 revealed a homozygous
A-to-G transition in all affected individuals, which was not
present in the heterozygous state in obligate carriers
within the family, and not found in unaffected family
members. The G-to-A transition occurred at the first base of
a threonine residue (ACA), leading to a missense mutation
and converting it to an alanine residue (GCA). The mutation
created a new cleavage site for the restriction endonuclease
Hgal (GACGC), which was used to confirm the presence of the
mutation in genomic DNA, in addition to direct sequencing.
PCR primers were designed to amplify individual exons from
genomic DNA, and each exon was directly sequenced from
affected individuals and compared to unaffected, unrelated
controls. Primers for specific amplification of exon 15
were: sense: 5'AGTGCCAGGATTACAGGCGT 3' (Seq.ID.No.: 10); and
antisense: 5'CTGAGGAGGAAAGAGCGCTC3' (Seq.ID.No.: 11); to
generate a PCR fragment. PCR fragments were purified on
Centriflex columns (ACGT, Inc.) and sequenced directly using
POP-6 polymer on an ABI Prism 310 Automated Sequencer
(Perkin-Elmer). The mutation was verified by restriction
endonucleases digestion using Hgal, according to the
manufacturer's specifications (New England Biolabs).
To verify that the missense mutation was not a normal
polymorphic variant, the mutation was screened for by a
combination of heteroduplex analysis. Ganguly, et al., 1993,
Proc Natl. Acad Sci. USA 90:10325. Direct sequencing and
restriction digestion in a control population consisting of
142 unrelated, unaffected individuals, 87 of whom were of
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-43-
Pakistani origin. No evidence was found for the mutant
allele in 284 unrelated, unaffected alleles, 174 were
ethnically matched for the congenital alopecia universalis
family. The absence of the mutant allele in control
individuals, together with the non-conservative nature of
the amino acid substitution, strongly suggests that this
mutation in the human hairless gene underlies the AU
phenotype in this family.
The hairless mouse hrlhr, was first described in the
literature in 1924 (Brooke, 1924, J. Hered. 15:173), and was
later found to have arisen from spontaneous integration of
an endogenous murine leukemia provirus into intron 6 of the
hr gene (Stove, et al., 1988, Cell 54:383), resulting in
aberrant splicing and only about 5o normal mRNA transcripts
present in hr/hr mice. Cachon-Gonzalez, et al., 1994, Proc.
Natl. Acad Sci. U.S.A., 91:7717. The protein encoded by the
hr gene contains a single zinc finger domain, and is
therefore thought to function as a transcription factor
(Id.), with structural homology to the GATA family (Arceci,
et al., 1993, Mol. Cell. Biol. 13:2235) and to TSGA, a gene
expressed in rat testis (Morrissey, et al., 1980, J.
Immunol. 125:1558). In addition to the total body hair loss
bearing striking resemblance congenital alopecia
universalis, the hr/hr mouse exhibits a number of phenotypic
effects no observed in the AU family, including defective
differentiation of thymocytes (i~d.), as well as a unique
sensitivity to UV and chemically induced skin tumors
(Gallagher, et al., 1984, J. Invest. Dermatol. 83:169).
Surprisingly, hr is not expressed in thymus, yet it is
highly expressed in the cerebellum of developing post-natal
rat brain, where its significance remains unknown. Thompson,
1996, J. Neurosci. 16:7832. hr is directly induced by
thyroid hormone receptor, which regulates its expression in
CNS development, but not in skin. Thompson, et al., 1997,
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-44-
Proc. Natl. Acad. Sci. U.S.A. 94:8526. The phenotypic
restriction of the human hr mutation to the hair follicle in
congenital alopecia universalis family members may reflect
the phenomenon of tissue-specific sensitivity of mutations
in transcription factor genes described in other disorders,
in which there exists a propensity for malfunction in some
target organs, and not in others, thus not reflecting the
complete expression pattern of the gene. Semeza, 1994, Hum
Mutat. 3, 180 (1994); Latchman, 1996, New Engl. J. Med.
28:334; Engelkamp and van Heyningen, 1996, Curr. Opin Genet.
Dev. 6:334. The segregation of the congenital alopecia
universalis mutation in a recessive fashion in the family
suggests that the mutant allele does not function through
haplo-insufficiency, nor does it elicit a dominant-negative
effect, since heterozygous carriers appear unaffected.
Instead, it is proposed that in congenital alopecia
universalis, this mutation disrupts a potential activation
domain with restricted specificity in the skin, whereas the
hr/hr mouse displays a more pleiotropic defect due to the
near absence of hr mRNA and protein.
Example 2: Antibodies specific for the human hairless
protein.
Antibodies which bind to the Human hairless protein are
prepared using an intact polypeptide or fragments containing
small peptides of interest as the immunizing antigen. The
polypeptide or a peptide used to immunize an animal can be
derived from translated cDNA or chemical synthesis which can
' be conjugated to a carrier protein, if desired. Such
commonly used carriers which are chemically coupled to the
peptide include keyhole limpet hemocyanin (KLH),
thyroglobulin, bovine serum albumin (BSA), and tetanus
toxid. The coupled peptide is then used to immunize the
animal (e. g., a mouse, a rat or a rabbit).
If desired, polyclonal or monoclonal antibodies can be
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-45-
further purified, for example, by binding to and elution
from a matrix to which the polypeptide or a peptide to which
the antibodies were raised is bound. Those of skill in the
art will know of various techniques common in the immunology
arts for purification and/or concentration of polyclonal
antibodies, as well as monoclonal antibodies (See for
example, Coligan, et al, Unit 9, Current Protocols in
Immunology, Wiley Interscience, 1994, incorporated herein by
reference) .
It is also possible to use the anti-idiotype technology to
produce monoclonal antibodies which mimic an epitope. For
example, an anti-idiotypic monoclonal antibody made to a
first monoclonal antibody will have a binding domain in the
hypervariable region which is the "image" of the epitope
bound by the first monoclonal antibody.
More recently, techniques to make humanized and human
antibodies to proteins have been described and are useful to
the production of antibodies to an Human hairless protein.
For example, methods for obtaining human or humanized
antibodies may also be used to obtain antibodies of the
present invention. Such methods are described in, for
example, EP 7655172, EP 671951, US 5,565,332, and EP 616640.
For example, antibodies may be generated by using a
computer-selected peptide such as amino acids of hairless
mouse having identity with at least 12 human hairless amino
acids.
PCR techniques may also be used to subclone an EcoRl/Notl
fragment corresponding to exons 13-19 of hairless into the
EcoRl/Notl site of pGEX4T. This permits the production of
copious quantities of the carboxyterminus of hairless in E.
Coli. Protein then may be purified using affinity
chromatography, and the GST tag will be cleaved from
hairless by thrombin. The protein will be purified, and
injected into rabbits.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-46-
The carboxy-terminal region of the Human hairless protein
into an E. Coli may also be subcloned and an expression
vector, allowing the expression of a recombinant fusion
protein between the Human hairless protein and a GST tag
identified. The presence of the GST tag allows the easy
purification of the protein by affinity chromatography.
Nilsson et al, 1985, EMBOJ, 4, 4,1075. The GST tag will
then be removed with thrombin, and the resultant untagged
Human hairless protein will be injected into rabbits. Sera
will be by Vdestern analysis against E. Coli expressed
protein and extracts prepared from normal and mutant mice.
Example 3: Identification Of Regulatory Sequences and Targets
of Human hairless protein.
To identify factors that modulate the expression of the
Human hairless protein gene in normal fibroblasts,
keratinocytes and other types of skin and hair follicle
cells, the minimal 5' upstream regions of the Human
hairless protein promoter required for faithful and abundant
expression in mouse dermal keratinocytes may be identified.
These regions can then be used to identify, clone and
characterize transacting factors that bind to these regions.
More specifically, methods which are well known to those
skilled in the art may be used to obstruct vectors
containing various segments of the Human hairless protein
promoter cloned 5' upstream of a reporter gene, such as beta
galactosidase. Transgenic mice may be constructed that
possess these DNAs, and sequences that confer appropriate
epidermal expression to the beta galactosidase reporter gene
will be identified. Byrne et al., Development 120,2369
(1994). Based on these results, trans-acting factors that
bind these sequences and activate expression will be
identified and cloned using standard gel shift, DNA
footprinting, DNA mutagenesis, transfection and screening
techniques. Leask et al., Genes and Development 4, 1985
(1990); the techniques described in Maniatis, et al., 1989,
Molecular Cloning a Laboratory Manual, Cold Spring Harbor
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-47-
Laboratory, N.Y. and Ausubel et al., 1989, Current Protocols
in Molecular Biology, Greene Publishing Associates and Wiley
Interscience, N.Y.
To identify genes upregulated or downregulated by the Human
hairless protein and are candidates for a diffusible protein
expressed in skin cells that induces hair follicle
formation, subtractive DNA hybridization and differential
display techniques may used, as well as CASTing to look for
the hairless DNA binding site, and use this to identify new
genes, followed by analysis of these cDNAs in vitro and in
vivo.
For example, fibroblasts and keratinocytes from wild-type
and hairless (hr/hr) mice may be cultured. Using standard
procedures, RNA will be extracted, cDNA will be prepared
from these sources and cDNAs from mutant tissue will be
removed from wild-type tissue. Chomezynski an Sacchi. 1987,
Anal. Biochem. 162,156; the techniques described in Maniatis
et al., 1989, Molecular Cloning a Laboratory Manual, Cold
Spring Harbor Laboratory, N.Y. and Ausubel et al., 1989,
Current Protocols in Molecular Biology, Greene Publishing
Associates and Wiley Interscience, N.Y. Alternatively,
messages present in significantly higher abundance in wild-
type tissue will be identified by differential display Liang
and Pardee, eds., 1997. Differential Display Methods and
Protocols, Human Press, Totowa, N.J. Messages present only
or predominantly in wild-type fibroblasts will be selected
for further analysis. Tissue restricted expression of the
proteins encoded by these cDNAs will be verified by Northern
blotting and in situ hybridization. Functionally of these
proteins will be determined by expressing them into mutant
fibroblasts, either in vitro or in vivo, for example using
adenoviral expression vectors. Kashiwagi et al., 1997,
Development Biology 189,22. Following identification of
those nucleotides which encode proteins that rescue the
hr/hr phenotype, and are therefore downstream targets of the
Human hairless protein and necessary for its function, such
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-48-
proteins and nucleotides will be assayed further.
Example 4: Antisense Regulation of Human hairless protein
Activity
A therapeutic approach using antisense to human hairless can
be used to directly interfere with the translation of Human
hairless protein messenger RNA into protein is possible.
For example, antisense nucleic acid or ribozymes could be
used to bind to the Human hairless protein mRNA or to cleave
it. Antisense RNA or DNA molecules bind specifically with
a targeted gene's RNA message, interrupting the expression
of that gene's protein product. See, Weintraub, Scientific
American, 262:40, 1990. The antisense molecule binds to the
messenger RNA forming a double stranded molecule which
cannot be translated by the cell. Antisense
oligonucleotides of about 15-25 nucleotides are preferred
since they are easily synthesized and have an inhibitory
effect just like antisense RNA molecules. Molecular analogs
of oligonucleotide may also be used for this purpose and
have the added advantages of stability, distribution or
limited toxicity that are advantageous in a pharmaceutical
product. In addition, chemically reactive groups, such as
iron-linked ologonucleodtide, causing cleavage of the RNA at
the site of hybridization. These and other uses of
antisense methods to inhibit the in Vitro translation of
genes are well known in the art (Marcus-Sakura, Anal.,
Biochem, 172:289, 1988).
Delivery of antisense therapies and the like can be achieved
using a recombinant expression vector such as a chimeric
virus or a colloidal dispersion system. Various viral
vectors which can be utilized for gene therapy as taught
herein include adenovirus, herpes virus, vaccinia, or,
preferable, an RNA virus such as a retrovirus. Preferably,
the retroviral vectors is a derivative of a murine or avian
retrovirus. Examples retroviral vectors in which a single
foreign gene can be inserted include, but are not limited
to: Moloney murine leukemia virus (MoMuLV). Harvey murine
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-49-
sarcoma virus (HaMuSV), murine mammary tumor virus (MuMTV),
an dRous Sarcoma Virus (RSV). A number of additional
retroviral vectors can incorporate multiple genes. All of
these vectors can transfer or incorporate a gene for a
selectable marker so that transduced cells can be identified
and generated. By inserting a polynucleotide sequence of
interest into the viral vector, along with another gene
which encodes the ligand for a receptor on a desired
specific target cell, for example, can make the vector
target specific. Retroviral vectors can be made target
specific by inserting, for example, a polynucleotide
encoding a protein or proteins such that the desired ligand
is expressed on the surface of the viral vector. Such
ligand may be glycolipid carbohydrate or protein in nature.
Preferred targeting may also be accomplished by using an
antibody to target the retroviral vector. Those of skill in
the art will know of, or can readily ascertain without undue
experimentation, specific polynucleotide sequences which can
be inserted into the retroviral genome to allow target
specific delivery of the retroviral vector containing the
antisense polynucleotide.
Since recombinant retroviruses are typically replication
defective, they require assistance in order to produce
infectious vector particles. This assistance can be
provided, for example, by using helper cell lines that
contain plasmids encoding all of the structural genes of the
retrovirus under the control of regulatory sequences within
the LTR. These plasmids are missing a nucleotide sequence
which enables the packaging mechanism to recognize an RNA
transcript for encapsulation. Helper cell lines which have
deletions of the packaging signal may used. These cell
lines produce empty virions, since no genome is packaged.
If a retroviral vector is introduced into such cells in
which packaging signal is intact, but the structural genes
are replaced by other genes of interest, the vector can be
packaged and vector virion produced.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-50-
Alternatively, NIH 3T3 or other tissue culture cells can be
directly transfected with plasmids encoding the retroviral
structural genes gag, pol and env, by conventional calcium
phosphate transfection. These cells are then transfected
with the vector plasmid containing the genes of interest.
The resulting cells release the retroviral vector into the
culture medium.
With respect to colloidal dispersion systems as a method for
accomplishing targeted delivery of an antisense
polynucleotides, these systems include macromolecule
complexes, nanocapsules, microspheres, beads, and lipid-
based systems including oil-in-water emulsions, micelles,
mixed micelles, and liposomes. The preferred colloidal
system of this invention is a liposome. Liposomes are
artificial membrane vesicles which are useful as delivery
vehicles in Vitro and in vivo. It has been shown that large
unilamellar vesicles (LW), which range in size from 0.2-4.0
um can encapsulate a substantial percentage of an aqueous
buffer containing large macromolecules. RNA, DNA and intact
virions can be encapsulated within the aqueous interior and
be delivered to cells in a biologically active form (Fraley,
et al., Trends Biochem. Sci., 6:77, 1981). In addition to
mammalian cells, liposomes have been used for delivery of
polynucleotides in plant, yeast and bacterial cells. In
order for a liposome to be an efficient gene transfer
vehicle, the following characteristics should be present:
(1) encapsulation of the genes of interest with high
efficiency while not comprising their biological activity;
(2) preferential and substantial binding to a target cell in
comparison to non-target cells; (3) delivery of the aqueous
contents of the vesicle to the target cell cytoplasm at high
efficiency; and (4) accurate and effective expression of
genetic information CMannino, et al., Biotechniques, 6_:682,
1988) .
The composition of the liposome is usually a combination of
phospholipids, particularly high-phase-transition-
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-51-
temperature phospholipids, usually in combination with
steroids, especially cholesterol. Other phospholipids or
other lipids may also be used. The physical characteristics
of liposomes depend on pH, ionic strength, and the presence
of divalent cations. Examples of lipids useful in liposome
production include phosphatidyl compounds, such as
phosphatidylglycerol, phosphatidylcholine,
phosphatidyiserine, phosphatidylethanolamine, sphingolipids,
cerebrosides, and gangliosides. Particularly useful are
diacylphosphatidylglycerols, where the lipid moiety contains
from 14-18 carbon atoms, particularly from 16-18 carbon
atoms, and is saturated. Illustrative phospholipids include
egg phosphatidylcholine, dipalmitoylphosphatidycholine and
distearoylphosphatidylcholine.
The targeting of liposomes has been classified based on
anatomical and mechanistic factors. Anatomical
classification is based on the level of selectivity, for
example, organ-specific, cell-specific, and organelle-
specific. Mechanistic targeting can be distinguished based
upon whether it is passive or active. Passive targeting
utilizes the natural tendency of liposomes to distribute to
cells of the reticulo-endothelial system (RES) in organs
which contain sinusoidal capillaries. Active targeting, on
the other hand, involves alteration of the liposome by
coupling the liposome to a specific ligand such as a
monoclonal antibody, sugar, glycolipid, or protein, or by
changing the composition or size of the liposome in order to
achieve targeting to organs or cells types other that the
naturally occurring sites of localization.
The surface of the targeted delivery system may be modified
in a variety of ways. In the case of liposomal targeted
delivery system, lipid groups can be incorporated in the
lipid bilayer of the liposome on order to maintain the
targeting ligand in stable association with the liposomal
bilayer. Various linking groups can be used for joining the
lipid chains to the targeting ligand. In general, the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-52-
compounds bound to the surface of the targeted delivery
system to find and "home in" on the desired cells. A ligand
may be any compound of interest which will bind to another
compound, such as growth factor.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-53-
Second Series of Experiments
A number of genetically determined primary T cell
immunodeficiencies have been described in which T lymphocytes
are present in mormal or reduced number, but specific T cell
functions are dysregulated. We studied a family with
congenital alopecia and severe T-cell immunodeficiency, whose
clinical findings were reminiscent of the nude mouse
phenotype. We found suggestive evidence of linkage to the whn
locus on human chromosome 17 (Zmax=1.32) , and identified a
homozygous nonsense mutation in the human whn gene in affected
individuals. The human whn gene encodes a forkhead/winged
helix transcription factor with restricted expression in the
thymus, epidermis, and hair follicle.
In the past several years, extraordinary progress has been
made in understanding the molecular basis of genetic disorders
resulting in primary immunodeficiencies in humans, and in many
cases has provided significant insights into crucial steps of
lymphocyte development and immune system function in general.
Fischer, A., et al. (1997) Annu. Rev. Immunol. 15:93; Kokron,
C.M., et al. (1997)Clin. Immunol. 17:109; Fischer, A. (1996)
Curr. Opin. Immunol. 8:445; Arnaiz-Villena, A., (1992) Immunol
13:259. Severe combined immunodeficiencies (SCID) represent
the most severe group of primary immunodeficiencies, whose
overall frequency is about one in 75,000 births. Fischer, A.,
et al. (1997) Annu. Rev. Immunol. 15:93; Kokron, C.M., et al.
(1997)Clin. Immunol. 17:109; Fischer, A. (1992) Curr. Opin.
Immunol. 8:445; Arnaiz-Villena, A., (1992) Immunol 13:259.
These inherited diseases include a wide spectrum of clinically
and genetically heterogeneous disorders affecting either the
differentiation or the cell activation process. The most
severe form is usually lethal in the first year of life due to
severe immunological impairment and life threatening
infections. In contrast, the clinical course of a few cases
of SCIDs with a predominant qualitative T-cell defect is
milder, and is characterized by a wide range of clinical
features caused either directly or indirectly by the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-54-
underlying disease. The clinical and immunological
heterogeneity of the SCIDs reflects an underlying genetic
heterogeneity. There are currently seven different forms of
SCID that are grouped according to pattern of inheritance,
disease phenotype and in some, the identification of
underlying gene mutations. Fischer, A., et al. (1997) Annu.
Rev. Immunol. 15:93; Kokron, C.M. , et al. (1997) Clin. Immunol.
17:109; Fischer, A. (1996) Curr. Opin. Immunol. 8:445; Arnaiz-
Villena, A., (1992) Immunol 13:259. Mutations in the common
Y-chain gene (Yc) of several cytokine receptors have been
reported in X-linked SCID with (T-)(B+) phenotype, while
mutations in the JAK-3 kinase gene have been described in the
autosomal recessive form. Fischer, A., et al. (1997) Annu.
Rev. Immunol. 15:93; Kokron, C.M. , et al . (1997) Clin. Immunol.
17:109; Fischer, A. (1996) Curr. Opin. Immunol. 8:445; Arnaiz-
Villena, A., (1992) Immunol 13:259; Noguchi, M., et al. (1993)
Cell 73:147; Macchi, P., et al. (1995) 377:65. Evidence is
emerging that these molecules are of critical importance in
either thymic maturation and T-lymphocyte development or cell
activation processes. Boussiotis, V.A., et al. (1994) Science
266:1039; Baird, A.M. (1998) J. Leukoc. Biol. 63:669. Null
mutations in the Rag-1 or Rag-2 genes have been described in
an autosomal recessive SCID with a (T-)(B-) phenotype. Ficher,
A., et al. (1997) Annu. Rev. Immunol. 15:93; Kokron, C.M., et
al. (1997)Clin. Immunol. 17:109; Fischer, A. (1996) Curr.
Opin. Immunol. 8:445; Arnaiz-Villena, A., (1992) Immunol
13:259; Schwartz, K. Et al., (1996) Science 274:97. In all
these forms, natural killer (NK) cells are undetectable.
Recently, partial loss-of-function mutations in the Rag-1 and
Rag-2 genes have been implicated in Omenn syndrome, a leaky
(T-)(B-)SCID phenotype characterized by hypereosinophilia,
erythrodermia, and severe liver disease. Fischer, A., et al.
(1997) Annu. Rev. Immunol. 15:93; Kokron, C.M., et al.
(1997)Clin. Immunol. 17:109; Fischer, A. (1992) Curr. Opin.
Immunol. 8:445; Arnaiz-Villena, A., (1992) Immunol 13:259;
Villa, A., et al. (1998) Cell 93:885; Romagnani, S. (1996)
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
_55_
Clin. Immunol. Immunopathol. 80:225; Romagnani, et al.
(1997)Int. Arch. Aller. Immunol. 113:153. In this form,
lymphocytes are predominatly of the Th2 phenotype and exhibit
a limited usage of the TCR repertoire. Fisher, A., et al.
(1997) Annu. Rev. Immunol. 15:93; Kokron, C.M., et al.
(1997)Clin. Immunol. 17:109; Fischer, A. (1992) Curr. Opin.
Immunol. 8:445; Arnaiz-Villena, A., (1992) Immunol 13:259;
Villa, A., et al. (1998) Cell 93:885; Romagnani, S. (1996)
Clin. Immunol. Immunopathol. 80:225; Romagnani, et al.
(1997)Int. Arch. Aller. Immunol. 113:153. Remarkable progress
has also been made in the study of SCID with predominant T-
cell defect in which T lympnocytes are present in normal or
reduced number, but specific T cell functions) are partially
dysregulated, referred as qualitative disorders. The genetic
bases of relatively few types of these forms of SCID are
known, including partial CD3e expression deficiency and CD3y
subunit expression deficiency. Fischer, A., et al. (1997)
Annu. Rev. Immunol. 15:93; Kokron, C.M. , et al. (1997) Clin.
Immunol. 17:109; Fischer, A. (1992) Curr. Opin. Immunol.
8:445; Arnaiz-Villena, A., (1992) Immunol 13:259; Arnaiz-
Villena, A. Et al., (1992) N. Engl. J. Med. 327:529; Soudais,
C., et al. (1993) Nature Genet. 3:77; Arpaia, E. Et al. (1994)
Cell 76:1.
Alterations in the signal transduction process through the
TCR/CD3 complex(ZAP-70) lead to a SCID phenotype predominantly
affecting CD8= lymphocytes. Fischer, A., et al. (1997) Annu.
Rev. Immunol. 15:93; Kokron, C.M., et al. (1997) Clin. Immunol.
17:109; Fischer, A. (1992) Curr. Opin. Immunol. 8:445; Arnaiz-
Villena, A., (1992) Immunol 13:259; Elder, M.E., et al. (1994)
Science 264:4596; Chan, A.C., et al. (1994) Science 264:4599.
Mutations in the human equivalent of the mouse beige gene
underlie the cytotoxic T lymphocyte and NK deficiency typical
of Chediak-Higashi syndrome. Nagle, D.L., et al. (1996) Nature
Genet. 14:307. However, the molecular basis of many of these
cases remains to be determined.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-56-
Recently, the simultaneous occurence of severe functional T-
cell immunodeficiency, congenital alopecia, and nail dysrophy
(MIM 601705) in two female siblings from a consanguineous
Italian family was reported as a syndrome for the first time.
Pignata, S. (1996) Am. J. Med. Genet. 65:167. At birth, both
children presented with a complete absence of hair and
dystrophic nails, and no thymic shadow was evident in either
child upon X-ray examination. In addition, the first affected
child revealed a striking impairment of T-cell function
shortly after birth, and rapidly developed a clincal phenotype
characterized by erythrodermia, persistent diarrhea, failure
to thrive, and hypereosinphilia, reminiscent of Omenn
syndrome. She died at the age of 12 months of resistent
bronchopneumonia after recurrent infections. The second
affected child also showed immunological abnormalities at the
age of one month, and later, she presented with a severe
impairment of humoral and cell-mediated immunity and suffered
from recurrent respiratory tract infections. At the age of 5
months, the patient received an HLA-identical total bone
marrow transplant (BMT) from her unaffected brother, following
only two doses of antilymphocyte serum, and no
immunosuppressive therapy or immunodepletion by irradiation.
Bone marrow transplantation led to full immunological
reconstitution in the patient, whereas the generalized
alopecia and the nail dystrophy are still present. The
persistence of the generalized alopecia following successful
BMT suggested tha t it was not acquired in nature, but instead
was related to the immunodeficiency. The severe
immunodeficiency in both children was characterized by a
decrease of mature T lymphocytes, mainly due to a low number
of helper T cells, whereas the number of suppressor/cytotoxic
T cells was relatively normal. However, the patients had a
normal number of overall circulating lymphocytes due to the
predominance of mature B-lymphocytes. In contrast to SCID
patients with JAK-3 and Yc mutations, NK cells in both
patients were unaffected. In the two children studied, the T-
cell immunodeficiency was qualitative in nature, in that
peripheral blood T cells failed to undergo mitogen-induced
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
_57_
activation and cell-cycle progression. Pignata, C. Et al.
(1996) Am. J. Med. Genet. 65:167. Although the B cell
machinery arppeared to be intact, insofar as
allohemagglutinins were detected, as expected, B lymphocytes
were unable to produce specific antibodies against T dependent
antigens. Pignata and colleagues recognized that the
association between alopecia and immunodeficiency in their
patients was not serendipitous, and might in fact be related
to a common gene defect. Further, they speculated that the
clinical symptoms in both patients were reminiscent of the
nude mouse phenotype, which is associated with congenital
alopecia and athymia, causing severe immunodeficiency due to
a lack of T-lymphocytes, Flanagan, S.P. (1966) Genet. Res.
8:295; Pantelouris, E. (1968) Nature 217:370; Gershwin, M.E.
(1977) Am. J. Pathol. 89:809; Festing, M.F.W., et al. (1978)
Nature 274:365; Sundberg, J.P. (1994) Handbook of Mouse
Mutations with Skin and Hair Abnormalitites (CRC Press, Boca
Raton) p 379-389, and resulting from mutations in the whn gene
(winged-helix-nude,Hfh 11"°), which encodes a forkhead/winged
helix transcription factor with restricted expression in
thymus and skin. Nehls, et al., 1994, Nature 372:103; Segre,
et al., 1995, Genomics 28:549; Huth, et al. 1997,
Immunogenetics 45:282; Hofmann, et al., 1998, Genomics 52:197;
Schorpp, et al., 1997, Immunogenetics 46:509. Linkage analysis
was performed using microsatellite markers near the human whn
locus chromosome 17, as deduced from the published map of the
syntenic region on mouse chromosome 11. Nehls, et al., 1994,
Nature 372:103; Segre, et al., 1995, Genomics 28:549; Huth, et
al. 1997, Immunogenetics 45:282; Hofmann, et al., 1998,
Genomics 52:197; 5chorpp, et al., 1997, Immunogenetics 46:509.
DNA samples from the original family members from a small
village in southern Italy (Figure 7) were obtained. Each
family member from whom DNA was obtained was examined and the
clinical phenotype of the affected individual is characterized
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-58-
by a severe, complete alopecia involving the scalp, eyebrows
and eyelashes. Four children in a different branch of the
family were reported anamnestically to have been affected with
the same disorder, and died in early childhood. Linkage
analysis was performed using microsatellite markers near the
whn locus on chromosome 17, as deduced from the published map
of the syntenic region on mouse chromosome 11. Blood samples
were also collected from 17 members of the family, according
to local informed consent procedures. DNA was isolated from
PBMCs prepared in TriReagent (Sigma) according to the
manufacturer's recommendations. Screening of all regions of
chromosome 17 showing homozygosity in affected family members
was carried out using primers obtained from Research Genetics,
Inc., or in the Genome Data Base (http:www.gdb). Analysis of
microsatellite markers consisted of end-labeling one primer
using Y33p dATp, a PCR reaction consisting of 7 minutes at 95°
C, followed by 27 cycles of 95° C, 1 minute, 55° C, 1
minute;
72° C, 1 minutes and electrophoresis in a 6% polyacrylamide gel
(Sequa-gel, Action Scientific). Microsatellite markers were
visualized by exposure of the gel to autoradiography, and
genotypes were assigned by visual inspection. DNA was
collected from both patients with congenital alopecia
(Individuals V-2 and V-3 in Figure 7), their brother
(Individual V-1 in Figure 7). For the second born patient,
DNA samples were available from before and after the bone
marrow transplantation. In addition, DNA was collected from
11 unaffected family members in the extended pedigree, which
contained a single consanguinity loop between the paternal
grandfathers of the probands (Figure 7). Genotyping with
three markers, D17S798, D17S1800 and D17S1857, revealed a
homozygous haplotype in both affected patients. Both parents
were heterozygous for the same haplotype, as were several
clinically unaffected relatives (Figure 7). Two point and
multipoint analyses were performed on the markers D17S798,
D17S1857 and D17S1800. The genetic model assumed for the
analysis was a fully penetrant recessive model with a disease
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-59-
allele frequency of 0.0001. Marker allele frequencies were
estimated using founders' alleles. Boehnke, 1991,
Am.J.Hum.Genet. 48:22. Map positions and intermarker
distances were determined using the Marshfield website
(www.marshmed.org/genetics/). All lod scores were calculated
using the LTNKAGE programs ILINK and LINKMAP. Lathrop, et
al., 1984, Proc. Natl. Acad. Sci. USA 81:3443; Schaffer, 1996,
Hum. Hered. 46:226. The maximum two point lod score was 1.32,
observed at both D17S798 and D17S1800. With multipoint
analysis, the lod score at all markers was 1.32, suggestive of
linkage of the disease phenotype in the family with markers
near the whn gene. Multipoint analysis did not improve the
scores at markers D17S798 and D17S1800 as the markers were
already fully informative in this family. The observation of
an unaffected individual with two recombination events allowed
localization of the whn gene within a 10.4 cM interval between
the markers D17S98 and D17S1857 (Figure 7).
Primer pairs were developed to amplify all exons and flanking
splice sites based on the cDNA structure of the human
sequence, Schorpp, et al., 1997, Immunogenetics
46:509,(GenBank accession number Y11739). A mutation
detection strategy was developed based on PCR amplification of
all whn exons. For amplification of exon 5 of the whn gene in
this study, the following primers were used:
Exon 5F: 5'CTTCTGGAGCGCAGGTTGTC3' (Seq.ID.No.:l2)
Exon 5R: 5'TAAATGAAGCTCCCTCTGGC3-' (Seq.ID.No.:l3)
. PCR amplification resulted in a product 184 by in size,
containing 7 by of intron 4, 131 by of exon 5, and 46 by of
intron 5. PCR was carried out on genomic DNA from the
patients, all family members, and the control individuals
according to the following program: 95° C for 5 minutes;
followed by 35 cycles of 95° C for 45 seconds, 53 C for 45
seconds, and 72° C for 1 minute; followed by°72 C for 7
minutes, in a Stratagene RoboCycler Gradient 96 thermal cycler
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-60-
(Stratagene, LaJolla, CA). PCR products were run on a 20
agarose gel and purified in a first step using the High Pure
PCR product purification kit (Boehringer Mannheim). In a
second step, PCR fragments were purified on Edge Centriflex
columns (Edge BioSystems, Gaithersburg, MD) and sequenced
directly with POP-6 polymer using an ABI Prism 310 Genetic
Analyzer from Applied Biosystems Inc. (Perkin Elmer). The
mutation was verified by restriction enzyme digestion using
Bsrl, according to the manufacturer's guidelines (New England
Biolabs). In both patients, direct sequencing analysis of the
PCR fragment containing exon 5 of the whn gene revealed a
homozygous C-to-T transition (figure 8a) at nucleotide
position 792 of the whn cDNA (numbered according to GenBank
#Y11739). This base substitution leads to a nonsense mutation
at amino acid position 255 of the protein, converting an
arginine residue (CAG) to a premature termination codon (TAG),
designated R255X. In addition to direct sequencing analysis,
restriction digestion with the endonuclease Bsr1 was used to
confirm the sequence variation in exon 5 (Figure 8B)(see
method above). Genotyping of the extended family members
revealed eight individuals who are clinically unaffected
heterozygous carriers of the mutation, consistent with the
segregation of the disease-associated haplotype (Figure 7).
The mutation was not identified in 102 unaffected, unrelated
Northern European control individuals, indicating that R255X
is not a common polymorphism. The nonsense mutation
identified in this invention. results in a premature
termination codon (PTC) at amino acid residue 255 of the whn
protein, within exon 5. In general, PTCs result in dramatic
reductions in the steady-state level of cytoplasmic mRNA, due
to nonsense-mediated mRNA decay, Cooper, 1993, Ann. Med.
85:11; Maquat, 1995, RNA 1:453, thereby predicting an absence
of functional protein.
Since the proband's BMT was derived from her brother, the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-61-
leukocyte DNA from the proband and her brother were examined
before and after grafting for the presence of fraternal
chimerism. For determination of the X and Y chromosome
complement of the family members, gender determination was
performed by restriction analysis of simultaneously amplified
ZFX and ZFY sequences as previously described in Chong, et
al., 1993, Hum. Molec. Genet. 2:1187. Genotyping revealed
that the brother was a carrier of the mutant maternal whn
allele and the wild-type paternal whn allele (Figure 7).
Genotyping of the proband before BMT revealed that her
leukocyte DNA was homozygous for the mutant haplotype only
(Figure 7). Four years after BMT, evidence for chimerism in
her leukocyte DNA was ascertained by detection of the
haplotype specific for the wild-type paternal whn allele as
well as the mutant allele. Further, gender determination
using primers specific for the X and Y chromosomes revealed
that prior to the BMT, the proband's peripheral blood
leukocyte DNA (female) was genotypically XX and the brother's
DNA (male) was XY (Figure 8C). After the BMT, however the
proband's leukocyte DNA was found to be xy, providing
evidence for long-term engraftment and expansion of the BMT
graft from the donor brother.
Three independent analyses of mRNA transcripts in a variety of
human tissues were performed to determine the expression of
patterns of whn in a variety of hyman tissues. The Human RNA
Master Dot Blot (#7770-1) containing mRNA from 24 different
human tissues was obtained from Clontech and hybridized using
ExpressHyb solution according to the manufacturer's
recommendations, with a probe spanning 482 by of the whn cDNA
(nucleotides 1185-1646). The Human Multiple Tissue Northern
Blot (MTN) II (#7759-1) containing tug poly A+ mRNA from eight
tissues and the Human Immune System II Multiple Tissue
Northern Blot containing six tissues, were obtained from
Clontech (Palo Alto, CA) and hybridized with a random primed
radiolabelled probe corresponding to nucleotides 18-729 of
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-62-
human whn (GenBank #Y11739). Total RNA was extracted from
cultured Swiss 3T3 mouse manufacturer's instructions (Qiagen
Rneasy Kit, Santa Clarita, CA) and l0ug RNA from cultured
fibroblasts and keratinocytes, Rheinwald and Green, 1975, Cell
6:331; Simon and Green, 1985, Cell 40:677, were
electrophoresed according to standard techniques. Sambrook, et
al., 1989, Molecular Cloning, A Laboratory Manual (Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY, ed. 2). All
northern blots were hybridized with the same probe at 42° C in
50o formamide, and final washes were performed at 65° C in
0.2xSSC, O.lo SDS. In situ hybridization was performed as
previously described, Panteleyev, et al., 1997, J. Invest.
Dermatol. 108:324 in 0.5 a sections of paraffin embedded
normal human scalp skin from a 35 year old female donor.
Briefly, deparaffinized and deproteinized sections were
acetylated in acetic anhydride solution (EM Science,
Gibbstown, NJ) and then dehydrated. Prehybridiza~ion was
performed in humidified chambers at 50°C with a mixture
containing 50% deionized formamide (EM Science, Gibbstown,
NJ). Hybridization with 50 ng/section of freshly denatured
cRNA probes was performed at 50 C for 17h in the same
humidified chambers. The cRNA probe for whn was synthesized
from genomic DNA using sequences contained within exon 8 of
the human whn cDNA (GenBank #Y11739). The forward primer (nt
1284-1305) was 5'CTCTCCCCACCACTGCACTCACT3' (Seq.ID.No.:l4) and
the reverse primer (nt 1597-1618) was
5'TCCAGGTCAGTGCCAAGGTCTC3' (Seq.TD.No.:lS). The human whn
. sense-probe was used as a negative control. Sections were
washed after hybridization at 50 C under high stringency
conditions for 5h. Prior to immunodetection of the in situ
hybridization signal, the slides where incubated with normal
sheep serum (Sigma, St. Louis, M0, USA) in the presence of
levamisol (Sigma, St. Louis, M0, USA) and blocking solution
(DIG Nucleic Acid Detection Kit, Boehringer-Mannheim,
Mannheim, FRG). Incubation with sheep alkaline phosphatase
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-63-
labeled anti-digoxigenin antibodies (DIG Nucleic Acid
Detection Kit, Boehringer-Mannheim, Mannheim, FRG) was
performed for 3 hours in humidified chambers at room
temperature. The slides were stained by incubation in
nitroblue tetrazolium and 8-chloroindolylphosphate solution
(Boehringer-Mannheim, Mannheim, FRG) for 16-20h in complete
darkness at room temperature. After short washing, the
sections were mounted in Kaiser's glycerol gelatin (Merck,
Darmstadt, FRG).
Using dot blot hybridization analysis of 24 different human
tissues, whn was prominently expressed only in fetal and adult
thymus, and was essentially negative in all other tissues
(Figure 9B). Northern analysis was performed using a multiple
immune tissue blot (six tissues), and a standard multiple
tissue blot (eight tissues), and once again, whn expression
was observed only in the thymus (Figure 9B,C), confirming and
extending the expression pattern previously reported. Schroop,
et al., 1997, Immunogenetics 46:509. Northern analysis using
mRNA from cultured fibroblasts and keratinocytes (Figure 9D)
revealed whn expression abundantly expressed in epidermal
keratinocytes (Figure 9D). Localization of whn expression
within normal skin was performed by in situ hybridization
studies. Consistent with the northern analysis, whn mRNA is
restricted to the epidermis, and no expression is observed in
the dermis (Figure l0A). The basal keratinocytes and the
proximal layers of epidermal spinous compartment are highly
positive, while in the upper spinous layer, whn expression
gradually declines. Therefore, whn expression spans the
transition from proliferation to terminal differentiation and
decreases during later stages of the differentiation program.
In the sebaceous glands, whn mRNA-positive staining was
observed in the thin layer of proliferating reserve cells, but
not in the differentiating sebocytes (Figure lOB), and the
sweat gland epithelium was moderately whn-positive (Figure
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-64-
1 OB ) .
In the hair follicle, whn expression was sharply demarcated in
several epithelial cell populations, while the dermal papilla
fibroblasts were always whn mRNA-negative. The most prominent
whn mRNA expression was localized in the hair matrix above the
level of Auber, and in the innermost cell layer of the outer
root sheath (ORS). The line of Auber separates two different
matrix cell populations: the lower portion, which contains the
undifferentiated proliferating keratinocytes, and the upper
portion (or precortex), which consists mainly of
differentiating cells. Abell, 1993, in Disorders of hair
growth, E.A. Olsen, Ed. (McGraw-Hill, Inc.) 1-19. The matrix
below the level of Auber is whn mRNA-negative, while the
differentiating cells above this line are mainly positive with
the exception of melanocyte-containing zone just above the
dermal papilla (Figure lOC). In addition to differentiating
matrix cells, we found prominent whn expression in the
specific ORS cell layer directly adjacent to the inner root
sheath (IRS) (Figures lOB-D) and designated as the "companion
layer" or the "innermost cells of the outer root sheath". Ito,
1986, Arch. Dermatol.Res. 279:112; Orwin, 1971, Avst. J. Biol.
Sci. 24:989. This keratinocyte layer is characterized by a
unique differentiation pathway, and is morphologically and
immunologically distinct from the other ORS keratinocytes,
however, its function and origin are still a subject of
controversy. Rothnagel and Roop, 1995, J.Invest. Dermatol.
104:42S; Panteleyev, et al., 1997, J. Invest. Dermatol.
108:324. Weak whn expression was found also in the basal
keratinocytes of the upper ORS portion starting from the level
of sebaceous gland (Figure lOB). In the upper hair follicle
infundibulum, this zone of whn expression merges with the whn-
positive basal keratinocytes of the interfollicular epidermis.
The IRS was whn-negative in both the proximal (Figure lOD) and
cornified (Figures 10B,C) portions. Collectively, the
patterns of whn expression revealed that in the hair matrix,
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-65-
whn is expressed in differentiating cells; in the
interfollicular epidermis, whn is expressed in both the
proliferating and differentiating compartments; and in the
sebaceous gland, whn is expressed in proliferating cells only.
These findings are similar with those for whn expression in
mouse interfollicular epidermis and hair follicle. Taken
together, the identification of a pathogenetic mutation in the
human whn gene in a family with congenital alopecia with T-
cell immunodeficiency, and the localization of whn expression
to the two human tissues involved in the disease phenotype,
strongly implicate whn mutations in the pathogenesis of this
disorder.
The protein encoded by the human, mouse and rat nude gene
encodes a member of the forkhead/winged helix class of
transcription factors, which are developmentally regulated,
and direct tissue-and cell-type specific transcription and
cell fate decisions. Lai, et al., 1993, Proc. Natl.
Acad.Sci.USA 90:10421; Kaufmann and Knochel, 1996, Mech. Dev.
57:3. The hallmark of this group of transcription factors is
a highly conserved DNA binding domain, encompassing a region
of about 110 amino acids containing a modified helix-turn-
helix motif, first identified in the Drosophila gene forkhead
and in rat hepatocyte nuclear factor 3(HNF-3). In the human,
mouse and rat whn proteins, which are approximately 850
identical, the DNA binding domain spanning amino acid residues
271 to 362, is encoded by exons 5, 6 and 7. Similar to other
winged helix proteins, the whn proteins contain an
evolutionarily conserved and functionally indispensable acidic
transcriptional activation domain, located in the C-terminus
of the protein. This transactivation domain extends from
residues 509 to 563, and is encoded by exons 8 and 9.
Schuddekopf, et al., 1996, Proc. Natl. Acad. Sci. USA 93:9661;
Schlake, et al., 1997, Proc. Natl. Acad. Sci. USA 94:3842.
The nonsense mutation in the family under study resides in
exon 5, upstream of both the DNA-binding and the
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-66-
transactivation domain of whn gene s consist o eight coding
exons and utilization of two alternative first (non-coding)
exons in a tissue-specific manner. Heterologous reporter
assays have demonstrated promoter activity upstream of both
first exons, and although both promoters are active in the
skin at variable levels, only the upstream promoter is active
in the thymus, suggesting that whn may be subject to complex
cell-type specific transcriptional regulation. Schorpp, et
al., 1997, Immunogenetics 46:509. Whn othologs are highly
conserved through evolution, and have been cloned from eight
different species, including human, mouse, rat, pufferfish,
zebrafish, shark, lamprey and amphioxus. The extent of
homology correlates with evolutionary distance, yet the
conservation between the two most distant relatives, human and
amphioxus, is nearly 80o identical at the amino acid level,
demonstrating a remarkable degree of conservation over more
than 500 million evolutionary years. The function of whn in
agnathans (lamprey) and cephalochordates (amphioxus), which do
not have hair nor a thymus, and bony fish (zebrafish and
pufferfish), which do not have hair but do have a thymus, is
currently unknown, however, it may perform a similar function
in diverse types of epithelia through vertebrate evolution.
In mammals, whn is expressed specifically in the epithelial
cells of the skin and thymus, where it appears to play a
critical role in maintaining the balance between growth and
differentiation, Nehls, et al.-, 1996, Science 272:886;
Brissette, et al., 1996, Genes & Dev. 10:2212, since mutations
at the nude locus disrupt both hair growth and thymic
development. The main function of the thymus is to generate
and select a diverse repertoire of T cells which display self-
tolerance and restriction to the host's major
histocompatability complex. Recent evidence has underscored
the importance of the thymic microenvironment in determining
the T cell repertoire, since both positive and negative
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-67-
selection of developing T cells depends on cell-cell
interactions with the thymic epithelium. In athymic nude mice
and transgenic Hfh 11°° knock-out mice, the defect has been
localized to the thymic microenvironment rather than to and
intrinsic defect in the developing T cells themselves. Whn is
not required for initial formation of the epithelial
primordium of the thymus before the entry of lymphocyte
progenitors, however, the subsequent differentiation of
precursor cells into subcapsular, cortical, and medullary
epithelial cells of the mature thymus is critically dependent
on whn expression. Since whn expression persists in thymic
epithelial cells throughout life, it may be required not only
for the initiation of differentiation but also for maintenance
of the differentiated phenotype. For these reasons, it has
been speculated that the human whn gene might be a good
candidate gene for human thymomas and for human thymic
dysplasia disorders, such as Nezelof syndrome.
Similar to the thymus, the formation and maintenance of the
epidermis and hair follicle also requires a balance between
epithelial growth and differentiation. Although nude mice
appear to be completely naked, the dermis actually contains a
normal number of hair follicles compared to a wild-type mouse,
however, the follicles are abnormal and incompletely
developed. Kopf-Maier, et al., 1990, Acta Anat. 139:178.
Although the number and cycling pattern of hair bulbs is
normal, impaired keratinization of_the hair follicles leads to
short, bent hairs that only rarely emerge from the epidermis.
Mouse mutations have become an important genetic tool for the
identification of specific human genes encoding diseases with
clinical features resembling those observed in mutant mice, in
particular, for visible phenotypes affecting the fur coat and
skin of mice. Sundber and King, 1996, Invest. Dermatol.
106:368; Copeland, et al., 1993, Science 262. The mapping of
inherited human alopecia (MIM 203655) to chromosome 8p21,
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-68-
using insights provided by the hairless mouse model, enabled
cloning of the human hairless gene and identification of
mutations in several families with atrichia. The discovery of
a human alopecia with mutations in the whn gene extends the
body of evidence implicating single genes in hair cycle
regulation. Sundberg, J.P. and King, L.E. (1996)
J.Invest.Dermatol. 106:368; Copeland, N.G. (1993) Science 262;
Nothen, M., et. al. (1998) Am.J.Hum.Genet. 62:386.
While the forkhead/winged helix class of transcription factors
has been widely studied using mutatioforkhead/winged helix
gene was only recently reported. Mutations in the human
thyroid transcription factor 2 gene (TTF-2) were identified in
a syndrome characterized by thyroid agenesis, cleft palate,
bifid epiglottis and spiky hair. Not unlike the athymia
observed in the nude phenotype, this disorder results from a
complete or partial failure of thyroid gland development.
TTF-2 is expressed during the descent of the thyroid
primordium from the pharyngeal pouches, then disappears with
the onset of thyrocyte differentiation, and reappears later
during organogenesis. Clifton-Bligh, R.J. et. al. (1998)
Nature Genet. 19:399. Patients treated with thyroxine
replacement have normal physical growth, sexual development
and pituitary function. The observation of phenotypic
correction by a simple pharmacologic intervention raises the
possibility of modulation of the nude phenotype by exogenous
genetic and/or cellular therapies. In support of this notion,
therapeutic rescue of the alopecia phenotype in nude mice was
recently accomplished using systemic cyclosporin A, Swada, M.,
et al. (1987) Am.J.Pathol. 56:684, and intraperitoneal or
subcutaneous administration of recombinant KGF, Danilenko,
D.M., et al. (1995) Am.J.Pathol. 147:145, presumably by
stimulating proliferation of the hair matrix cells and
normalizing the keritinization defect. No correction the T
cell deficiency was reported in these mice. In addition,
transgenic insertion of a cosmid clone containing the wild-
type whn gene into fertilized Hfhll°°/Hfhll°° eggs
also
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
-69-
corrected the alopecia phenotype of the resulting mouse, but
not the athymic phenotype, suggesting that the upstream
thymus-specific whn promoter may not have been present in the
cosmid clone. Kurooka, H., et al. (1995) J.Exp.Med. 181:1223.
In contrast, transgenic expression of IL-7 in nude mice
restored significant populations of T cells, however, also
failed to rescue the alopecia phenotype. Rich, B.E. and Leder,
P. (1995) J.Exp.Med. 181:1223.
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
SEQUENCE LISTING
<110> The Trustees of Columbia University of the City of
<120> Human Hairless Gene, Protein and Uses Thereof
<130> 55642-A-PCT
<140> Not Yet known
<141> 1999-Ol-29
<160> 15
<170> PatentIn Ver. 2.0
<210> 1
<211> 3567
<212> DNA
<213> Homosapien
<400> 1
atggagagta cgcccagctt cctgaagggc accccaacct gggagaagac ggccccagag 60
aacggcatcg tgagacagga gcccggcagc ccgcctcgag atggactgca ccatgggccg 120
ctgtgcctgg gagagcctgc tcccttttgg aggggcgtcc tgagcacccc agactcctgg 180
cttccccctg gcttccccca gggccccaag gacatgctcc cacttgtgga gggcgagggc 240
ccccagaatg gggagaggaa ggtcaactgg ctgggcagca aagagggact gcgctggaag 300
gaggccatgc ttacccatcc gctggcattc tgcgggccag cgtgcccacc tcgctgtggc 360
cccctgatgc ctgagcatag tggtggccat ctcaagagtg accctgtggc cttccggccc 420
tggcactgcc ctttccttct ggagaccaag atcctggagc gagctccctt ctgggtgccc 480
acctgcttgc caccctacct agtgtctggc ctgcccccag agcatccatg tgactggccc 540
ctgaccccgc acccctgggt atactccggg ggccagccca aagtgccctc tgccttcagc 600
ttaggcagca agggctttta ctacaaggat ccgagcattc ccaggttggc aaaggagccc 660
ttggcagctg cggaacctgg gttgtttggc ttaaactctg gtgggcacct gcagagagcc 720
ggggaggccg aacgcccttc actgcaccag agggatggag agatgggagc tggccggcag 780
cagaatcctt gcccgctctt cctggggcag ccagacactg tgecctggac ctcctggccc 840
gcttgtcecc caggccttgt tcatactctt ggcaacgtct gggctgggcc aggcgatggg 900
aaccttgggt accagctggg gccaccagca acaccaaggt gcccctctcc tgagccgcct 960
gtcacccagc ggggctgctg ttcatcctac ccacccacta aaggtgggga tcttggccct 1020
tgtgggaagt gccaggaggg cctggagggg ggtgccagtg gagccagcga acccagcgag 1080
gaagtgaaca aggcctctgg ccccagggcc tgtcccccca gccaccacac caagctgaag 1140
aagacatggc tcacacggca ctcggagcag tttgaatgtc cacgcggctg ccctgaggtc 1200
gaggagaggc cggttgctcg gctccgggcc ctcaaaaggg caggcagccc cgaggtccag 1260
ggagcaatgg gcagtccagc ccccaagcgg ccaccggacc ctttcccagg cactgcagaa 1320
cagggggctg ggggtttgca ggaggtgcgg gacacatcga tagggaacaa ggatgtggac 1380
tcgggacagc atgatgagca gaaaggaccc caagatggcc aggccagtct ccaggacccg 1440
ggacttcagg acataccatg cctggctctc cctgcaaaac tggctcaatg ccaaagttgt 1500
gcccaggcag ctggagaggg aggagggcac gcctgccact ctcagcaagt gcggagatcg 1560
cctctgggag gggagctgca gcaggaggaa gacacagcca ccaactccag ctctgaggaa 1620
1
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
ggcccagggt ccggccctga cagccggctc agcacaggcc tcgccaagca cctgctcagt 1680
ggtttggggg accgactgtg ccgcctgctg cggagggagc gggaggccct ggcttgggcc 1740
caacgggaaa gccaagggcc agccgtgaca gaggacagcc caggcattcc acgctgctgc 1800
agccgttgcc accatggact cttcaacacc cactggcgat gtccccgctg cagccaccgg 1860
ctgtgtgtgg cctgtggtcg tgtggcaggc actgggcggg ccagggagaa agcaggcttt 1920
caggagcagt ccgcggagga gtgcacgcag gaggccgggc acgctgcctg ttccctgatg 1980
ctgacccagt ttgtctccag ccaggctttg gcagagctga gcactgcaat gcaccaggtc 2040
tgggtcaagt ttgatatccg ggggcactgc ccctgccaag ctgatgcccg ggtatgggcc 2100
cccggggatg caggccagca gaaggaatca acacagaaaa cgcccccaac tccacaacct 2160
tcctgcaatg gcgacaccca caggaccaag agcatcaaag aggagacccc cgattccgct 2220
gagaccccag cagaggaccg tgctggccga gggcccctgc cttgtccttc tctctgcgaa 2280
ctgctggctt ctaccgcggt caaactctgc ttggggcatg agcggataca catggccttc 2340
gcccccgtca ctccggccct gcccagtgat gaccgcatca ccaacatcct ggacagcatt 2400
atcgcacagg tggtggaacg gaagatccag gagaaagccc tggggccggg gcttcgagct 2460
ggcccgggtc tgcgcaaggg cctgggcctg cccctctctc cagtgcggcc ccggctgcct 2520
cccccagggg ctttgctgtg gctgcaggag ccccagcctt gccctcggcg tggcttccac 2580
ctcttccagg agcactggag gcagggccag cctgtgttgg tgtcagggat ccaaaggaca 2640
ttgcagggca acctgtgggg gacagaagct cttggggcac ttggaggcca ggtgcaggcg 2700
ctgagccccc tcggacctcc ccagcccagc agcctgggca gcacaacatt ctgggagggc 2760
ttctcctggc ctgagcttcg cccaaagtca gacgagggct ctgtcctcct gctgcaccga 2820
gctttggggg atgaggacac cagcagggtg gagaacctag ctgccagtct gccacttccg 2880
gagtactgcg ccctccatgg aaaactcaac ctggcttcct acctcccacc gggccttgcc 2940
ctgcgtccac tggagcccca gctctgggca gcctatggtg tgagcccgca ccggggacac 3000
ctggggacca agaacctctg tgtggaggtg gccgacctgg tcagcatcct ggtgcatgcc 3060
gacacaccac tgcctgcctg gcaccgggca cagaaagact tcctttcagg cctggacggg 3120
gaggggctct ggtctccggg cagccaggtc agcactgtgt ggcacgtgtt ccgggcacag 3180
gacgcccagc gcatccgccg ctttctccag atggtgtgcc cggccggggc aggcgccctg 3240
gagcctggcg ccccaggcag ctgctacctg gatgcagggc tgcggcggcg cctgcgggag 3300
gagtggggcg tgagctgctg gaccctgctc caggcccccg gagaggccgt gctggtgcct 3360
gcaggggctc cccaccaggt gcagggcctg gtgagcacag tcagcgtcac tcagcacttc 3420
ctctcccctg agacctctgc cctctctgct cagctctgcc accagggacc cagccttccc 3480
cctgactgcc acctgcttta tgcccagatg gactgggctg tgttccaagc agtgaaggtg 3540
gccgtgggga cattacagga ggccaaa 3567
<210>2
<211>1189
<212>PRT
<213>Homosapien
<400> 2
Met Glu Ser Thr Pro Ser Phe Leu Lys Gly Thr Pro Thr Trp Glu Lys
1 5 10 15
Thr Ala Pro Glu Asn Gly Ile Val Arg Gln Glu Pro Gly Ser Pro Pro
20 25 30
Arg Asp Gly Leu His His Gly Pro Leu Cys Leu Gly Glu Pro Ala Pro
35 40 45
2
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Phe Trp Arg Gly Val Leu Ser Thr Pro Asp Ser Trp Leu Pro Pro Gly
50 55 60
Phe Pro Gln Gly Pro Lys Asp Met Leu Pro Leu Val Glu Gly Glu Gly
65 70 75 80
Pro Gln Asn Gly Glu Arg Lys Val Asn Trp Leu Gly Ser Lys Glu Gly
85 90 95
Leu Arg Trp Lys Glu Ala Met Leu Thr His Pro Leu Ala Phe Cys Gly
100 105 110
Pro Ala Cys Pro Pro Arg Cys Gly Pro Leu Met Pro Glu His Ser Gly
115 120 125
Gly His Leu Lys Ser Asp Pro Val Ala Phe Arg Pro Trp His Cys Pro
130 135 140
Phe Leu Leu Glu Thr Lys Ile Leu Glu Arg Ala Pro Phe Trp Val Pro
145 150 155 160
Thr Cys Leu Pro Pro Tyr Leu Val Ser Gly Leu Pro Pro Glu His Pro
165 170 175
Cys Asp Trp Pro Leu Thr Pro His Pro Trp Val Tyr Ser Gly Gly Gln _
180 185 190
Pro Lys Val Fro Ser Ala Phe Ser Leu Gly Ser Lys Gly Phe Tyr Tyr
195 200 205
Lys Asp Pro Ser Ile Pro Arg Leu Ala Lys Glu Pro Leu Ala Ala Ala
210 215 220
Glu Pro Gly Leu Phe Gly Leu Asn Ser Gly Gly His Leu Gln Arg Ala
225 230 235 240
Gly Glu Ala Glu Arg Pro Ser Leu His Gln Arg Asp Gly Glu Met Gly
245 250 255
Ala Gly Arg Gln Gln Asn Pro Cys Pro Leu Phe Leu Gly Gln Pro Asp
260 265 270
Thr Val Pro Trp Thr Ser Trp Pro Ala Cys Pro Pro Gly Leu Val His
275 280 285
Thr Leu Gly Asn Val Trp Ala Gly Pro Gly Asp Gly Asn Leu Gly Tyr
290 295 300
3
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Gln Leu Gly Pro Pro Ala Thr Pro Arg Cys Pro Ser Pro Glu Pro Pro
305 310 315 320
Val Thr Gln Arg Gly Cys Cys Ser Ser Tyr Pro Pro Thr Lys Gly Gly
325 330 335
Asp Leu Gly Pro Cys Gly Lys Cys Gln Glu Gly Leu Glu Gly Gly Ala
340 345 350
Ser Gly Ala Ser Glu Pro Ser Glu Glu Val Asn Lys Ala Ser Gly Pro
355 360 365
Arg Ala Cys Pro Pro Ser His His Thr Lys Leu Lys Lys Thr Trp Leu
370 375 380
Thr Arg His Ser Glu Gln Phe Glu Cys Pro Arg Gly Cys Pro Glu Val
385 390 395 400
Glu Glu Arg Pro Val Ala Arg Leu Arg Ala Leu Lys Arg Ala Gly Ser
405 410 415
Pro Glu Val Gln Gly Ala Met Gly Ser Pro Ala Pro Lys Arg Pro Pro
420 425 430
Asp Pro Phe Pro Gly Thr Ala Glu Gln Gly Ala Gly Gly Leu Gln Glu
435 440 445
Val Arg Asp Thr Ser Ile Gly Asn Lys Asp Val Asp Ser Gly Gln His
450 455 460
Asp Glu Gln Lys Gly Pro Gln Asp Gly Gln Ala Ser Leu Gln Asp Pro
465 470 475 480
Gly Leu Gln Asp Ile Pro Cys Leu Ala Leu Pro Ala Lys Leu Ala Gln
485 490 495
Cys Gln Ser Cys Ala Gln Ala Ala Gly Glu Gly Gly Gly His Ala Cys
500 505 510
His Ser Gln Gln Val Arg Arg Ser Pro Leu Gly Gly Glu Leu Gln Gln
515 520 525
Glu Glu Asp Thr Ala Thr Asn Ser Ser Ser Glu Glu Gly Pro Gly Ser
530 535 540
Gly Pro Asp Ser Arg Leu Ser Thr Gly Leu Ala Lys His Leu Leu Ser
545 550 555 560
4
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Gly Leu Gly Asp Arg Leu Cys Arg Leu Leu Arg Arg Glu Arg Glu Ala
565 570 575
Leu Ala Trp Ala Gln Arg Glu Ser Gln Gly Pro Ala Val Thr Glu Asp
580 585 590
Ser Pro Gly Ile Pro Arg Cys Cys Ser Arg Cys His His Gly Leu Phe
595 600 605
Asn Thr His Trp Arg Cys Pro Arg Cys Ser His Arg Leu Cys Val Ala
610 615 620
Cys Gly Arg Val Ala Gly Thr Gly Arg Ala Arg Glu Lys Ala Gly Phe
625 630 635 640
Gln Glu Gln Ser Ala Glu Glu Cys Thr Gln Glu Ala Gly His Ala Ala
645 650 655
Cys Ser Leu Met Leu Thr Gln Phe Val Ser Ser Gln Ala Leu Ala Glu
660 665 670
Leu Ser Thr Ala Met His Gln Val Trp Val Lys Phe Asp Ile Arg Gly
675 680 685
His Cys Pro Cys Gln Ala Asp Ala Arg Val Trp Ala Pro Gly Asp Ala
690 695 700
Gly Gln Gln Lys Glu Ser Thr Gln Lys Thr Pro Pro Thr Pro Gln Pro
705 710 715 720
Ser Cys Asn Gly Asp Thr His Arg Thr Lys Ser Ile Lys Glu Glu Thr
725 730 735
Pro Asp Ser Ala Glu Thr Pro Ala Glu Asp Arg Ala Gly Arg Gly Pro
740 745 750
Leu Pro Cys Pro Ser Leu Cys Glu Leu Leu Ala Ser Thr Ala Val Lys
755 760 765
Leu Cys Leu Gly His Glu Arg Ile His Met Ala Phe Ala Pro Val Thr
770 775 780
Pro Ala Leu Pro Ser Asp Asp Arg Ile Thr Asn Ile Leu Asp Ser Ile
785 790 ~ 795 800
Ile Ala Gln Val Val Glu Arg Lys Ile Gln Glu Lys Ala Leu Gly Pro
805 810 815
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Gly Leu Arg Ala Gly Pro Gly Leu Arg Lys Gly Leu Gly Leu Pro Leu
820 825 830
Ser Pro Val Arg Pro Arg Leu Pro Pro Pro Gly Ala Leu Leu Trp Leu
835 840 845
Gln Glu Pro Gln Pro Cys Pro Arg Arg Gly Phe His Leu Phe Gln Glu
850 855 860
His Trp Arg Gln Gly Gln Pro Val Leu Val Ser Gly Ile Gln Arg Thr
865 870 875 880
Leu Gln Gly Asn Leu Trp Gly Thr Glu Ala Leu Gly Ala Leu Gly Gly
885 890 895
Gln Val Gln Ala Leu Ser Pro Leu Gly Pro Pro Gln Pro Ser Ser Leu
900 905 910
Gly Ser Thr Thr Phe Trp Glu Gly Phe Ser Trp Pro Glu Leu Arg Pro
915 920 925
Lys Ser Asp Glu Gly Ser Val Leu Leu Leu His Arg Ala Leu Gly Asp
930 935 940
Glu Asp Thr Ser Arg Val Glu Asn Leu Ala Ala Ser Leu Pro Leu Pro
945 950 955 960
Glu Tyr Cys Ala Leu His Gly Lys Leu Asn Leu Ala Ser Tyr Leu Pro
965 970 975
Pro Gly Leu Ala Leu Arg Pro Leu Glu Pro Gln Leu Trp Ala Ala Tyr
980 985 990
Gly Val Ser Pro His Arg Gly His Leu Gly Thr Lys Asn Leu Cys Val
995 1000 1005
Glu Val Ala Asp Leu Val Ser Ile Leu Val His Ala Asp Thr Pro Leu
1010 1015 1020
Pro Ala Trp His Arg Ala Gln Lys Asp Phe Leu Ser Gly Leu Asp Gly
1025 1030 1035 1040
Glu Gly Leu Trp Ser Pro Gly Ser Gln Val Ser Thr Val Trp His Val
1045 1050 1055
Phe Arg Ala Gln Asp Ala Gln Arg Ile Arg Arg Phe Leu Gln Met Val
1060 1065 1070
6
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Cys Pro Ala Gly Ala Gly Ala Leu Glu Pro Gly Ala Pro Gly Ser Cys
1075 1080 1085
Tyr Leu Asp Ala Gly Leu Arg Arg Arg Leu Arg Glu Glu Trp Gly Val
1090 1095 1100
Ser Cys Trp Thr Leu Leu Gln Ala Pro Gly Glu Ala Val Leu Val Pro
1105 1110 1115 1120
Ala Gly Ala Pro His Gln Val Gln Gly Leu Val Ser Thr Val Ser Val
1125 1130 1135
Thr Gln His Phe Leu Ser Pro Glu Thr Ser Ala Leu Ser Ala Gln Leu
1140 1145 1150
Cys His Gln Gly Pro Ser Leu Pro Pro Asp Cys His Leu Leu Tyr Ala
1155 1160 1165
Gln Met Asp Trp Ala Val Phe Gln Ala Val Lys Val Ala Val Gly Thr
1170 1175 1180
Leu Gln Glu Ala Lys
1185
<210> 3
<211> 1206
<212> PRT
<213> rat
<400> 3
Met Gly Leu Arg Ser Ser Cys Phe Val Leu Thr Leu Gln Asp Pro Pro
1 5 10 15
Leu Gly Glu Pro His Glu Gly Arg Arg Val Met Glu Ser Met Pro Ser
20 25 30
Phe Leu Lys Asp Thr Pro Ala Trp Glu Lys Thr Ala Pro Val Asn Gly
35 40 45
Ile Val Gly Gln Glu Pro Gly Thr Ser Pro Gln Asp Gly Leu His His
50 55 60
Gly Ala Leu Cys Leu Gly Glu Pro Val Pro Phe Trp Arg Gly Val Leu
65 70 75 80
Ser Ala Pro Asp Ser Trp Leu Pro Pro Gly Phe Leu Gln Gly Pro Lys
7
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
85 90 95
Asp Thr Leu Ser Val Val Glu Gly Glu Gly Ser Arg Asn Gly Glu Arg
100 105 110
Lys Ala Asn Trp Leu Gly Ser Lys Glu Gly Leu Arg Trp Lys Glu Ala
115 120 125
Met Leu Ala His Pro Leu Ala Phe Cys Gly Pro Ala Cys Pro Pro Arg
130 135 140
Tyr Gly Pro Leu Ile Pro Glu His Ser Ser Gly His Pro Lys Ser Asp
145 150 155 160
Pro Val Ala Phe Arg Pro Leu His Cys Pro Phe Leu Leu Glu Thr Lys
165 170 175
Ile Leu Glu Arg Ala Pro Phe Trp Val Pro Thr Cys Leu Pro Pro Tyr
180 185 190
Leu Met Ser Ser Leu Pro Pro Glu Arg Ser Tyr Asp Trp Pro Leu Ala
195 200 205
Pro Ser Pro Trp Val Tyr Ser Gly Ser Gln Pro Lys Val Pro Ser Ala
210 215 220
Phe Ser Leu Gly Ser Lys Gly Phe Tyr His Lys Asp Pro Asn Ile Leu
225 230 235 240
Arg Pro Ala Lys Glu Pro Leu Ala Ala Ser Glu Ser Gly Met Leu Gly
245 250 255
Leu Ala Pro Gly Gly His Leu Gln Gln Ala Cys Asp Ala Glu Gly Pro
260 265 270
Ser Leu His Gln Arg Asp Gly Glu Thr Gly Ala Gly Arg Gln Gln Asn
275 280 285
Leu Cys Pro Val Phe Leu Gly Tyr Pro Asp Thr Val Pro Arg Thr Pro
290 295 300
Trp Pro Ser Cys Pro Pro Gly Leu Val His Thr Leu Gly Asn Val Trp
305 310 315 320
Ala Gly Pro Gly Ser Asn Ser Phe Gly Tyr Gln Leu Gly Pro Pro Val
325 330 335
Thr Pro Arg Cys Pro Ser Pro Gly Pro Pro Thr Pro Pro Gly Gly Cys
8
CA 02362320 2001-07-30
WO 99/38965 PCT/CTS99/02128
340 345 350
Cys Ser Ser His Leu Pro Ala Arg Glu Gly Asp Pro Gly Pro Cys Arg
355 360 365
Lys Cys Gln Asp Ser Pro Glu Gly Ser Ser Ser Gly Pro Gly Glu Ser
370 375 380
Ser Glu Glu Arg Asn Lys Ala Gly Ser Arg Ala Ser Pro Pro Ser His
385 390 395 400
His Thr Lys Leu Lys Lys Thr Trp Leu Thr Arg His Ser Glu Gln Phe
405 410 415
Glu Cys Pro Gly Gly Cys Pro Gly Lys Gly Glu Ser Pro Ala Thr Gly
420 425 430
Leu Arg Ala Leu Lys Arg Ala Gly Ser Pro Glu Val Gln Gly Ala Arg
435 440 445
Gly Pro Ala Pro Lys Arg Pro Ser His Thr Phe Pro Gly Thr Gly Arg
450 455 460
Gln Gly Ala Arg Ala Trp Gln Glu Thr Pro Glu Thr Ser Thr Gly Ser
465 470 475 480
Lys Ala Glu Ala Gln Gln Gln Glu Glu Gln Arg Gly Pro Arg Asp Gly
485 490 495
Arg Ile Arg Leu Arg Glu Ser Arg Leu Glu Asp Thr Ser Cys Gln His
500 505 510
His Leu Ala Gly Val Thr Gln Cys Pro Ser Cys Val Gln Ala Ala Gly
515 520 525
Glu Val Glu Ile Leu Thr Ser His Ser Gln Lys Ser His Lys Leu Pro
530 535 540
Leu Glu Glu Lys Pro Leu Glu Glu Asp Ser Cys Ala Thr Ser Glu Glu
545 550 555 560
Gly Gly Gly Ser Ser Pro Glu Ala Ser Ile Asn Lys Gly Leu Ala Lys
565 570 575
His Leu Leu Ser Gly Leu Gly Asp Arg Leu Cys Arg Leu Leu Arg Lys
580 585 590
Glu Arg Glu Ala Leu Ala Trp Ala Gln Arg Glu Gly Gln Gly Pro Ala
9
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
595 600 605
Met Thr Glu Asp Ser Pro Gly Ile Pro His Cys Cys Ser Arg Cys His
610 615 620
His Gly Leu Phe Asn Thr His Trp Arg Cys Ser His Cys Ser His Arg
625 630 635 640
Leu Cys Val Ala Cys Gly Arg Ile Ala Gly Ala Gly Lys Asn Arg Glu
645 650 655
Lys Thr Gly Ser Arg Glu Gln Arg Thr Asp Asp Cys Ala Gln Glu Ala
660 665 670
Gly His Ala Ala Cys Ser Leu Ile Leu Thr Gln Phe Val Ser Ser Gln
675 680 685
Ala Leu Ala Glu Leu Ser Thr Val Met His Gln Val Trp Ala Lys Phe
690 695 700
Asp Ile Arg Gly His Cys Phe Cys Gln Val Asp Ala Arg Val Trp Ala
705 710 715 720
Pro Gly Asp Gly Gly Gln Gln Lys Glu Pro Thr Glu Lys Thr Pro Pro
725 730 735
Ala Pro Gln Leu Ser Cys Asn Gly Asp Ser Asn Arg Thr Lys Asp Ile
740 745 750
Lys Glu Glu Thr Pro Asp Ser Thr Glu Ser Pro Ala Glu Asp Arg Ala
755 760 765
Gly Arg Ser Pro Leu Pro Cys Pro Ser Leu Cys Glu Leu Leu Ala Ser
770 775 780
Thr Ala Val Lys Leu Cys Leu Gly His Glu Arg Ile His Met Ala Phe
785 790 795 800
Ala Pro Val Thr Pro Ala Leu Pro Ser Asp Asp Arg Ile Thr Asn Ile
805 810 815
Leu Asp Ser Ile Ile Ala Gln Val Val Glu Arg Lys Ile Gln Glu Lys
820 825 830
Ala Leu Gly Pro Gly Leu Arg Ala Gly Ser Gly Leu Arg Lys Gly Leu
835 840 845
Ser Leu Pro Leu Ser Pro Val Arg Thr Gln Leu Ser Pro Pro Gly Ala
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
850 855 860
Leu Leu Trp Leu Gln Glu Pro Arg Pro Lys His Gly Phe Arg Leu Phe
865 870 875 880
Gln Glu His Trp Arg Gln Gly Gln Pro Val Leu Val Ser Gly Ile Gln
885 890 895
Lys Thr Leu Arg Leu Ser Leu Trp Gly Met Glu Ala Leu Gly Thr Leu
900 905 910
Gly Gly Gln Val Gln Thr Leu Thr Ala Leu Gly Pro Pro Gln Pro Thr
915 920 925
Ser Leu Asp Ser Thr Ala Phe Trp Lys Gly Phe Ser His Pro Glu Ala
930 935 940
Arg Pro Lys Leu Asp Glu Gly Ser Val Leu Leu Leu His Arg Pro Leu
945 950 955 960
Gly Asp Lys Asp Glu Ser Arg Val Glu Asn Leu Ala Ser Ser Leu Pro
965 970 975
Leu Pro Glu Tyr Cys Ala His Gln Gly Lys Leu Asn Leu Ala Ser Tyr
980 985 990
Leu Pro Leu Gly Leu Thr Leu His Pro Leu Glu Pro Gln Leu Trp Ala
995 1000 1005
Ala Tyr Gly Val Asn Ser His Arg Gly His Leu Gly Thr Lys Asn Leu
1010 1015 1020
Cys Val Glu Val Ser Asp Leu Ile Ser Ile Leu Val His Ala Glu Ala
1025 1030 1035 1040
Gln Leu Pro Pro Trp Tyr Arg Ala Gln Lys Asp Phe Leu Ser Gly Leu
1045 1050 1055
Asp Gly Glu Gly Leu Trp Ser Pro Gly Ser Gln Thr Ser Thr Val Trp
1060 1065 1070
His Val Phe Arg Ala Gln Asp Ala Gln Arg Ile Arg Arg Phe Leu Gln
1075 1080 1085
Met Val Cys Pro Ala Gly Ala Gly Thr Leu Glu Pro Gly Ala Pro Gly
1090 1095 1100
Ser Cys Tyr Leu Asp Ser Gly Leu Arg Arg Arg Leu Arg Glu Glu Trp
11
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
1105 1110 1115 1120
Gly Val Ser Cys Trp Thr Leu Leu Gln Ala Pro Gly Glu Ala Val Leu
1125 1130 1135
Val Pro Ala Gly Ala Pro His Gln Val Gln Gly Leu Val Ser Thr Ile
1140 1145 1150
Ser Val Thr Gln His Phe Leu Ser Pro Glu Thr Ser Ala Leu Ser Ala
1155 1160 1165
Gln Leu Cys His Gln Gly Ala Ser Leu Pro Pro Asp His Arg Met Leu
1170 1175 1180
Tyr Ala Gln Met Asp Arg Ala Val Gln Ala Val Lys Val Ala Val Gly
1185 1190 1195 1200
Thr Leu Gln Glu Ala Lys
1205
<210> 4
<211> 1189
<212> PRT
<213> Homosapien
<400> 4
Met Glu Ser Thr Pro Ser Phe Leu Lys Gly Thr Pro Thr Trp Glu Lys
1 5 10 15
Thr Ala Pro Glu Asn Gly Ile Val Arg Gln Glu Pro Gly Ser Pro Pro
20 25 30
Arg Asp Gly Leu His His Gly Pro Leu Cys Leu Gly Glu Pro Ala Pro
35 40 45
Phe Trp Arg Gly Val Leu Ser Thr Pro Asp Ser Trp Leu Pro Pro Gly
50 55 60
Phe Pro Gln Gly Pro Lys Asp Met Leu Pro Leu Val Glu Gly Glu Gly
65 70 75 80
Pro Gln Asn Gly Glu Arg Lys Val Asn Trp Leu Gly Ser Lys Glu Gly
85 90 95
Leu Arg Trp Lys Glu Ala Met Leu Thr His Pro Leu Ala Phe Cys Gly
100 105 110
12
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Pro Ala Cys Pro Pro Arg Cys Gly Pro Leu Met Pro Glu His Ser Gly
115 120 125
Gly His Leu Lys Ser Asp Pro Val Ala Phe Arg Pro Trp His Cys Pro
130 135 140
Phe Leu Leu Glu Thr Lys Ile Leu Glu Arg Ala Pro Phe Trp Val Pro
145 150 155 160
Thr Cys Leu Pro Pro Tyr Leu Val Ser Gly Leu Pro Pro Glu His Pro
165 170 175
Cys Asp Trp Pro Leu Thr Pro His Pro Trp Val Tyr Ser Gly Gly Gln
180 185 190
Pro Lys Val Pro Ser Ala Phe Ser Leu Gly Ser Lys Gly Phe Tyr Tyr
195 200 205
Lys Asp Pro Ser Ile Pro Arg Leu Ala Lys Glu Pro Leu Ala Ala Ala
210 215 220
Glu Pro Gly Leu Phe Gly Leu Asn Ser Gly Gly His Leu Gln Arg Ala
225 230 235 240
Gly Glu Ala Glu Arg Pro Ser Leu His Gln Arg Asp Gly Glu Met Gly
245 250 255
Ala Gly Arg Gln Gln Asn Pro Cys Pro Leu Phe Leu Gly Gln Pro Asp
260 265 270
Thr Val Pro Trp Thr Ser Trp Pro Ala Cys Pro Pro Gly Leu Val His
275 280 285
Thr Leu Gly Asn Val Trp Ala Gly Pro Gly Asp Gly Asn Leu Gly Tyr
290 295 300
Gln Leu Gly Pro Pro Ala Thr Pro Arg Cys Pro Ser Pro Glu Pro Pro
305 310 315 320
Val Thr Gln Arg Gly Cys Cys Ser Ser Tyr Pro Pro Thr Lys Gly Gly
325 330 335
Asp Leu Gly Pro Cys Gly Lys Cys Gln Glu Gly Leu Glu Gly Gly Ala
340 345 350
Ser Gly Ala Ser Glu Pro Ser Glu Glu Val Asn Lys Ala Ser Gly Pro
355 360 365
13
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Arg Ala Cys Pro Pro Ser His His Thr Lys Leu Lys Lys Thr Trp Leu
370 375 380
Thr Arg His Ser Glu Gln Phe Glu Cys Pro Arg Gly Cys Pro Glu Val
385 390 395 400
Glu Glu Arg Pro Val Ala Arg Leu Arg Ala Leu Lys Arg Ala Gly Ser
405 410 415
Pro Glu Val Gln Gly Ala Met Gly Ser Pro Ala Pro Lys Arg Pro Pro
420 425 430
Asp Pro Phe Pro Gly Thr Ala Glu Gln Gly Ala Gly Gly Leu Gln Glu
435 440 445
Val Arg Asp Thr Ser Ile Gly Asn Lys Asp Val Asp Ser Gly Gln His
450 455 460
Asp Glu Gln Lys Gly Pro Gln Asp Gly Gln Ala Ser Leu Gln Asp Pro
465 470 475 480
Gly Leu Gln Asp Ile Pro Cys Leu Ala Leu Pro Ala Lys Leu Ala Gln
485 490 495
Cys Gln Ser Cys Ala Gln Ala Ala Gly Glu Gly Gly Gly His Ala Cys
500 505 510
His Ser Gln Gln Val Arg Arg Ser Pro Leu Gly Gly Glu Leu Gln Gln
515 520 525
Glu Glu Asp Thr Ala Thr Asn Ser Ser Ser Glu Glu Gly Pro Gly Ser
530 535 540
Gly Pro Asp Ser Arg Leu Ser Thr Gly Leu Ala Lys His Leu Leu Ser
545 550 555 560
Gly Leu Gly Asp Arg Leu Cys Arg Leu Leu Arg Arg Glu Arg Glu Ala
565 570 575
Leu Ala Trp Ala Gln Arg Glu Ser Gln Gly Pro Ala Val Thr Glu Asp
580 585 590
Ser Pro Gly Ile Pro Arg Cys Cys Ser Arg Cys His His Gly Leu Phe
595 600 605
Asn Thr His Trp Arg Cys Pro Arg Cys Ser His Arg Leu Cys Val Ala
610 615 620
14
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Cys Gly Arg Val Ala Gly Thr Gly Arg Ala Arg Glu Lys Ala Gly Phe
625 630 635 640
Gln Glu Gln Ser Ala Glu Glu Cys Thr Gln Glu Ala Gly His Ala Ala
645 650 655
Cys Ser Leu Met Leu Thr Gln Phe Val Ser Ser Gln Ala Leu Ala Glu
660 665 670
Leu Ser Thr Ala Met His Gln Val Trp Val Lys Phe Asp Ile Arg Gly
675 680 685
His Cys Pro Cys Gln Ala Asp Ala Arg Val Trp Ala Pro Gly Asp Ala
690 695 700
Gly Gln Gln Lys Glu Ser Thr Gln Lys Thr Pro Pro Thr Pro Gln Pro
705 710 715 720
Ser Cys Asn Gly Asp Thr His Arg Thr Lys Ser Ile Lys Glu Glu Thr
725 730 735
Pro Asp Ser Ala Glu Thr Pro Ala Glu Asp Arg Ala Gly Arg Gly Pro
740 745 750
Leu Pro Cys Pro Ser Leu Cys Glu Leu Leu Ala Ser Thr Ala Val Lys
755 760 765
Leu Cys Leu Gly His Glu Arg Ile His Met Ala Phe Ala Pro Val Thr
770 775 780
Pro Ala Leu Pro Ser Asp Asp Arg Ile Thr Asn Ile Leu Asp Ser Ile
785 790 795 800
Ile Ala Gln Val Val Glu Arg Lys Ile Gln Glu Lys Ala Leu Gly Pro
805 810 815
Gly Leu Arg Ala Gly Pro Gly Leu Arg Lys Gly Leu Gly Leu Pro Leu
820 825 830
Ser Pro Val Arg Pro Arg Leu Pro Pro Pro Gly Ala Leu Leu Trp Leu
835 840 845
Gln Glu Pro Gln Pro Cys Pro Arg Arg Gly Phe His Leu Phe Gln Glu
850 855 860
His Trp Arg Gln Gly Gln Pro Val Leu Val Ser Gly Ile Gln Arg Thr
865 870 875 880
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Leu Gln Gly Asn Leu Trp Gly Thr Glu Ala Leu Gly Ala Leu Gly Gly
885 890 895
Gln Val Gln Ala Leu Ser Pro Leu Gly Pro Pro Gln Pro Ser Ser Leu
900 905 910
Gly Ser Thr Thr Phe Trp Glu Gly Phe Ser Trp Pro Glu Leu Arg Pro
915 920 925
Lys Ser Asp Glu Gly Ser Val Leu Leu Leu His Arg Ala Leu Gly Asp
930 935 940
Glu Asp Thr Ser Arg Val Glu Asn Leu Ala Ala Ser Leu Pro Leu Pro
945 950 955 960
Glu Tyr Cys Ala Leu His Gly Lys Leu Asn Leu Ala Ser Tyr Leu Pro
965 970 975
Pro Gly Leu Ala Leu Arg Pro Leu Glu Pro Gln Leu Trp Ala Ala Tyr
980 985 990
Gly Val Ser Pro His Arg Gly His Leu Gly Thr Lys Asn Leu Cys Val
995 1000 1005
Glu Val Ala Asp Leu Val Ser Ile Leu Val His Ala Asp Thr Pro Leu
1010 1015 1020
Pro Ala Trp His Arg Ala Gln Lys Asp Phe Leu Ser Gly Leu Asp Gly
1025 1030 1035 1040
Glu Gly Leu Trp Ser Pro Gly Ser Gln Val Ser Thr Val Trp His Val
1045 1050 1055
Phe Arg Ala Gln Asp Ala Gln Arg Ile Arg Arg Phe Leu Gln Met Val
1060 1065 1070
Cys Pro Ala Gly Ala Gly Ala Leu Glu Pro Gly Ala Pro Gly Ser Cys
1075 1080 1085
Tyr Leu Asp Ala Gly Leu Arg Arg Arg Leu Arg Glu Glu Trp Gly Val
1090 1095 1100
Ser Cys Trp Thr Leu Leu Gln Ala Pro Gly Glu Ala Val Leu Val Pro
1105 1110 1115 1120
Ala Gly Ala Pro His Gln Val Gln Gly Leu Val Ser Thr Val Ser Val
1125 1130 1135
16
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Thr Gln His Phe Leu Ser Pro Glu Thr Ser Ala Leu Ser Ala Gln Leu
1140 1145 1150
Cys His Gln Gly Pro Ser Leu Pro Pro Asp Cys His Leu Leu Tyr Ala
1155 1160 1165
Gln Met Asp Trp Ala Val Phe Gln Ala Val Lys Val Ala Val Gly Thr
1170 1175 1180
Leu Gln Glu Ala Lys
1185
<210> 5
<211> 1182
<212> PRT
<213> mouse
<400> 5
Met Glu Ser Met Pro Ser Phe Leu Lys Asp Thr Pro Ala Trp Glu Lys
1 5 10 15
Thr Ala Pro Val Asn Gly Ile Val Gly Gln Glu Pro Gly Thr Ser Pro
20 25 30
Gln Asp Gly Leu Arg His Gly Ala Leu Cys Leu Gly Glu Pro Ala Pro
35 40 45
Phe Trp Arg Gly Val Leu Ser Thr Pro Asp Ser Trp Leu Pro Pro Gly
50 55 60
Phe Leu Gln Gly Pro Lys Asp Thr Leu Ser Leu Val Glu Gly Glu Gly
65 70 75 80
Pro Arg Asn Gly Glu Arg Lys Gly Ser Trp Leu Gly Gly Lys Glu Gly
85 90 95
Leu Arg Trp Lys Glu Ala Met Leu Ala His Pro Leu Ala Phe Cys Gly
100 105 110
Pro Ala Cys Pro Pro Arg Tyr Gly Pro Leu Ile Pro Glu His Ser Gly
115 120 125
Gly His Pro Lys Ser Asp Pro Val Ala Phe Arg Pro Leu His Cys Pro
130 135 140
Phe Leu Leu Glu Thr Lys Ile Leu Glu Arg Ala Pro Phe Trp Val Pro
145 150 155 160
17
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Thr Cys Leu Pro Pro Tyr Leu Met Ser Ser Leu Pro Pro Glu Arg Pro
165 170 175
Tyr Asp Trp Pro Leu Ala Pro Asn Pro Trp Val Tyr Ser Gly Ser Gln
180 185 190
Pro Lys Val Pro Ser Ala Phe Gly Leu Gly Ser Lys Gly Phe Tyr His
195 200 205
Lys Asp Pro Asn Ile Leu Arg Pro Ala Lys Glu Pro Leu Ala Glu Ser
210 215 220
Gly Met Leu Gly Leu Ala Pro Gly Gly His Leu Gln Gln Ala Cys Glu
225 230 235 240
Ser Glu Gly Pro Ser Leu His Gln Arg Asp Gly Glu Thr Gly Ala Gly
245 250 255
Arg Gln Gln Asn Leu Cys Pro Val Phe Leu Gly Tyr Pro Asp Thr Val
260 265 270
Pro Arg Ala Pro Trp Pro Ser Cys Pro Pro Gly Leu Val His Ser Leu
275 280 285
Gly Asn Ile Trp Ala Gly Pro Gly Ser Asn Ser Leu Gly Tyr Gln Leu
290 295 300
Gly Pro Pro Ala Thr Pro Arg Cys Pro Ser Pro Gly Pro Pro Thr Pro
305 310 315 320
Pro Gly Gly Cys Cys Ser Ser His Leu Pro Ala Arg Glu Gly Asp Leu
325 330 335
Gly Pro Cys Arg Lys Cys Gln Asp Ser Pro Glu Gly Gly Ser Ser Gly
340 345 350
Pro Gly Glu Ser Ser Glu Glu Arg Asn Lys Ala Asp Ser Arg Ala Cys
355 360 365
Pro Pro Ser His His Thr Lys Leu Lys Lys Thr Trp Leu Thr Arg His
370 375 380
Ser Glu Gln Phe Glu Cys Pro Gly Gly Cys Ser Gly Lys Glu Glu Ser
385 390 395 400
Ser Ala Thr Gly Leu Arg Ala Leu Lys Arg Ala Gly Ser Pro Glu Val
405 410 415
18
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Gln Gly Ala Ser Arg Gly Pro Ala Pro Lys Arg Pro Ser His Pro Phe
420 425 430
Pro Gly Thr Gly Arg Gln Gly Ala Arg Ala Trp Gln Glu Thr Pro Glu
435 440 445
Thr Ile Ile Gly Ser Lys Ala Glu Ala Glu Gln Gln Glu Glu Gln Arg
450 455 460
Gly Pro Arg Asp Gly Arg Ile Arg Leu Gln Glu Ser Arg Leu Val Asp
465 470 475 480
Thr Ser Cys Gln His His Leu Ala Gly Val Thr Gln Cys Gln Ser Cys
485 490 495
Val Gln Ala Ala Gly Glu Val Gly Val Leu Thr Gly His Ser Gln Lys
500 505 510
Ser Arg Arg Ser Pro Leu Glu Glu Lys Gln Leu Glu Glu Glu Asp Ser
515 520 525
Ser Ala Thr Ser Glu Glu Gly Gly Gly Gly Pro Gly Pro Glu Ala Ser
530 535 540
Leu Asn Lys Gly Leu Ala Lys His Leu Leu Ser Gly Leu Gly Asp Arg
545 550 555 560
Leu Cys Arg Leu Leu Arg Lys Glu Arg Glu Ala Leu Ala Trp Ala Gln
565 570 575
Arg Glu Gly Gln Gly Pro Ala Met Thr Glu Asp Ser Pro Gly Ile Pro
580 585 590
His Cys Cys Ser Arg Cys His His Gly Leu Phe Asn Thr His Trp Arg
595 600 605
Cys Ser His Cys Ser His Arg Leu Cys Val Ala Cys Gly Arg Ile A7.a
610 615 620
Gly Ala Gly Lys Asn Arg Glu Lys Thr Gly Ser Gln Glu Gln His Thr
625 630 635 640
Asp Asp Cys Ala Gln Glu Ala Gly His Ala Ala Cys Ser Leu Ile Leu
645 650 655
Thr Gln Phe Val Ser Ser Gln Ala Leu Ala Glu Leu Ser Thr Val Met
660 665 670
19
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
His Gln Val Trp Ala Lys Phe Asp Ile Arg Gly His Cys Phe Cys Gln
675 680 685
Val Asp Ala Arg Val Trp Ala Pro Gly Asp Gly Gly Gln Gln Lys Glu
690 695 700
Pro Thr Glu Lys Thr Pro Pro Thr Pro Gln Pro Ser Cys Asn Gly Asp
705 710 715 720
Ser Asn Arg Thr Lys Asp Ile Lys Glu Glu Thr Pro Asp Ser Thr Glu
725 730 735
Ser Pro Ala Glu Asp Gly Ala Gly Arg Ser Pro Leu Pro Cys Pro Ser
740 745 750
Leu Cys Glu Leu Leu Ala Ser Thr Ala Val Lys Leu Cys Leu Gly His
755 760 765
Asp Arg Ile His Met Ala Phe Ala Pro Val Thr Pro Ala Leu Pro Ser
770 775 780
Asp Asp Arg Ile Thr Asn Ile Leu Asp Ser Ile Ile Ala Gln Val Val
785 790 795 800
Glu Arg Lys Ile Gln Glu Lys Ala Leu Gly Pro Gly Leu Arg Ala Gly
805 810 815
Ser Gly Leu Arg Lys Gly Leu Ser Leu Pro Leu Ser Pro Val Arg Thr
820 825 830
Arg Leu Ser Pro Pro Gly Ala Leu Leu Trp Leu Gln Glu Pro Arg Pro
835 840 845
Lys His Gly Phe His Leu Phe Gln Glu His Trp Arg Gln Gly Gln Pro
850 855 860
Val Leu Val Ser Gly Ile Gln Lys Thr Leu Arg Leu Ser Leu Trp Gly
865 870 875 880
Met Glu Ala Leu Gly Thr Leu Gly Gly Gln Val Gln Thr Leu Thr Ala
885 890 895
Leu Gly Pro Pro Gln Pro Thr Asn Leu Asp Ser Thr Ala Phe Trp Glu
900 905 910
Gly Phe Ser His Pro Glu Thr Arg Pro Lys Leu Asp Glu Gly Ser Val
915 920 925
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
Leu Leu Leu His Arg Thr Leu Gly Asp Lys Asp Ala Ser Arg Val Gln
930 935 940
Asn Leu Ala Ser Ser Leu Pro Leu Pro Glu Tyr Cys Ala His Gln Gly
945 950 955 960
Lys Leu Asn Leu Ala Ser Tyr Leu Pro Leu Gly Leu Thr Leu His Pro
965 970 975
Leu Glu Pro Gln Leu Trp Ala Ala Tyr Gly Val Asn Ser His Arg Gly
980 985 990
His Leu Gly Thr Lys Asn Leu Cys Val Glu Val Ser Asp Leu Ile Ser
995 1000 1005
Ile Leu Val His Ala Glu Ala Gln Leu Pro Pro Trp Tyr Arg Ala Gln
1010 1015 1020
Lys Asp Phe Leu Ser Gly Leu Asp Gly Glu Gly Leu Trp Ser Pro Gly
1025 1030 1035 1040
Ser Gln Thr Ser Thr Val Trp His Val Phe Arg Ala Gln Asp Ala Gln
1045 1050 1055
Arg Ile Arg Arg Phe Leu Gln Met Val Cys Pro Ala Gly Ala Gly Thr
1060 loss 1070
Leu Glu Pro Gly Ala Pro Gly Ser Cys Tyr Leu Asp Ala Gly Leu Arg
1075 1080 1085
Arg Arg Leu Arg Glu Glu Trp Gly Val Ser Cys Trp Thr Leu Leu Gln
1090 1095 1100
Ala Pro Gly Glu Ala Val Leu Val Pro Ala Gly Ala Pro His Gln Val
1105 1110 1115 1120
Gln Gly Leu Val Ser Thr Ile Ser Val Thr Gln His Phe Leu Ser Pro
1125 1130 1135
Glu Thr Ser Ala Leu Ser Ala Gln Leu Tyr His Gln Gly Ala Ser Leu
1140 1145 1150
Pro Pro Asp His Arg Met Leu Tyr Ala Gln Met Asp Arg Ala Val Phe
1155 1160 1165
Gln Ala Val Lys Ala Ala Val Gly Ala Leu Gln Glu Ala Lys
1170 1175 1180
21
CA 02362320 2001-07-30
WO 99/38965 PCT/US99/02128
<210> 6
<211> 20
<212> DNA
<213> mouse
<400> 6
tgagggctct gtcctcctgc 20
<210> 7
<211> 20
<212> DNA
<213> mouse
<400> 7
gctggctccc tggtggtaga 20
<210> 8
<211> 20
<212> DNA
<213> Homosapien
<400> 8
tatgtcacca agggccagcc 20
<210> 9
<211> 20
<212> DNA
<213> Homosapien
<400> 9
tcagggtagg gggtcatgcc 20
<210> 10
<211> 20
<212> DNA
<213> Homosapien
<400> 10
agtgccagga ttacaggcgt 20
<210> 11
<211> 20
<212> DNA
<213> Homosapien
<400> 11
22
CA 02362320 2001-07-30
WO 99/38965 PCT/CTS99/02128
ctgaggagga aagagcgctc 20
<210>12
<211>20
<212>DNA
<213>Homosapien
<400> 12
cttctggagc gcaggttgtc 20
<210> 13
<211> 20
<212> DNA
<213> Homosapien
<400> 13
taaatgaagc tccctctggc 20
<210> 14
<211> 23
<212> DNA
<213> Homosapien
<400> 14
ctctccccac cactgcactc act 23
<210> 15
<211> 22
<212> DNA
<213> Homosapien
<400> 15
tccaggtcag tgccaaggtc tc 22
23
