Note: Descriptions are shown in the official language in which they were submitted.
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
COMPOSITIONS AND METHODS FOR THE TREATMENT OF IMMUNE RELATED DISEASES
Field of the Invention
The present invention relates to compositions and methods for the diagnosis
and treatment of immune
related diseases.
Backeround of the Invention
Immune related and inflammatory diseases are the manifestation or consequence
of fairly complex,
often multiple interconnected biological pathways which in normal physiology
are critical to respond to insult
or injury, initiate repair from insult or injury, and mount innate and
acquired defense against foreign organisms.
Disease or pathology occurs when these normal physiological pathways cause
additional insult or injury either
as directly related to the intensity of the response, as a consequence of
abnormal regulation or excessive
stimulation, as a reaction to self, or as a combination of these.
Though the eenesis of these diseases often involves multistep pathways and
ofren multiple different
biological systems/pathways, intervention at critical points in one or more of
these pathways can have an
ameliorative or therapeutic effect. Therapeutic intervention can occur by
either antagonism of a detrimental
processipathway or stimulation of a beneficial processipathway.
Many immune related diseases are known and have been extensively studied. Such
diseases include
immune-mediated inflammatory diseases, non-immune-mediated inflammatory
diseases, infectious diseases,
itttmunodeficiency diseases. neoplasia, etc.
T lymphocytes (T cells) are an important component of a mammalian immune
response. T cells
recognize antigens which are associated with a self molecule encoded by genes
within the major
histocompatibility complex (MHC). The antigen may be displayed together with
MHC molecules on the
surface of antigen presenting cells, virus infected cells, cancer cells,
grafts, etc. The T cell system eliminates
these altered cells which pose a health threat to the host mammal. T cells
include helper T cells and cvtotoxic
T cells. Helper T cells proliferate extensively following recognition of an
antigen -MHC complex on an
antigen presenting cell. Helper T cells also secrete a variety of cytokines,
i.e., lymphokines, which play a
central role in the activation of B cells, cytotoxic T cells and a variety of
other cells which participate in the
immune response.
A central event in both humoral and cell mediated immune responses is the
activation and clonal
expansion of helper T cells. Helper T cell activation is initiated by the
interaction of the T cell receptor (TCR)
- CD3 complex with an antigen-MHC on the surface of an antigen presenting
cell. This interaction mediates a
cascade of biochemical events that induce the resting helper T cell to enter a
cell cycle (the GO to G1
transition) and results in the expression of a high affinity receptor for IL-2
and sometimes IL-4. The activated
T cell progresses through the cycle proliferating and differentiating into
memory cells or effector cells.
Ia addition to the signals mediated through the TCR, activation of T cells
involves additional
costimulation induced by cytokines released by the antigen presenting cell or
through interactions with
membrane bound molecules on the antigen presenting cell and the T cell. The
cytokines IL-l and IL-6 have
been shown to provide a costimulatory signal. Also, the interaction between
the B7 molecule expressed on the
1
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT'1US00/05841
surface of an antigen presenting cell and CD28 and CTLA-4 molecules expressed
on the T cell surface effect t
cell activation. Activated T cells express an increased number of cellular
adhesion molecules, such as ICAM-
l, integrins, VLA-4, LFA-l, CD56, etc.
T-cell proliferation in a mixed lymphocyte culture or mixed lymphocyte
reaction (MLR) is an
established indication of the ability of a compound to stimulate the immune
system. In many ttnmune
responses. inflammatory cells infiltrate the site of injury or infection. /lie
migrating cells may be neutrophilic,
eosinophilic, monocytic or lymphocytic as can be determined by histologic
examination of the affected tissues.
Current Protocols in Immunology, ed. John E. Coligan, 1994. John Wiley & Sons,
Inc.
Immune related diseases can be treated by suppressing the immune response.
Using neutralizing
antibodies chat inhibit molecules having immune stimulatory acuviry would be
beneficial in the treatment of
immune-mediated and inflammatory diseases. Molecules which inhibit the immune
response can be utilized
(proteins directly or via the use of antibody agonists) to inhibit the immune
response and thus ameliorate
immune related disease.
I S Summary of the Invention
The present invention concerns compositions and methods for the diagnosis and
treatment of immune
related disease in mammals. including humans. The present invention is based
on the identification of proteins
(including agonist and antagonist antibodies) which either stimulate or
inhibit the immune response in
mammals. Immune related diseases can be treated by suppressing or enhancing
the immune response.
Molecules that enhance the immune response stimulate or potentiate the immune
response to an antigen.
Molecules which stimulate the immune response can be used therapeutically
where enhancement of the
immune response would be beneficial. Such stimulatory molecules can also be
inhibited where suppression of
the immune response would be of value.
Neutralizing antibodies are examples of molecules that inhibit molecules
having immune stimulatory
acuviry and which would be beneticial in the treatment of immune related and
inflammatory diseases.
Molecules which inhibit the immune response can also be utilized (proteins
directly or via the use of antibody
agonistsl to inhibit the immune response and thus ameliorate immune related
disease.
Accordingly, the PRO polypeptides and anti-PRO antibodies and fragments
thereof are useful for the
diagnosis and/or treatment (including prevention) of immune related diseases.
Antibodies which bind to
stimulatory proteins are useful to suppress the immune system and the immune
response. Antibodies which
bind to inhibitory proteins are useful to stimulate the immune system and the
immune response. The PRO
polypeptides and anti-PRO antibodies also useful to prepare medicines and
medicaments for the treatment of
immune related and inflammatory diseases.
In one embodiment, the invention provides for isolated nucleic acid molecules
comprising nucleotide
sequences that encodes a PRO polypeptide.
In one aspect, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least
about 80% nucleic acid sequence identity, alternatively at least about 81%
nucleic acid identity, alternatively at
least about 82% nucleic acid sequence identity, alternatively at least about
83% nucleic acid sequence identity,
alternatively at Least about 84% nucleic acid sequence identity, alternatively
at least about 85% nucleic acid
sequence identity, alternatively at least about 86% nucleic acid sequence
identity, alternatively at least about
2
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTlUS00/05841
87% nucleic acid sequence identity, alternatively at least about 88°,o
nucleic acid sequence identity,
alternativelv at least about 89% nucleic acid sequence identity, alternatively
at least about 90% nucleic acid
sequence identity, alternatively at least about 91% nucleic acid sequence
identity, alternatively at least about
92% nucleic acid sequence identity, alternatively at least about 93% nucleic
acid sequence identity,
alternatively at least about 94°~~ nucleic acid sequence identity,
alternatively at least about 95% nucleic acid
sequence identity, alternatively at least about 96% nucleic acid sequence
identity, alternatively at least about
97% nucleic acid sequence identity, alternatively at least about 98% nucleic
acid sequence identity and
alternatively at least about 99% nucleic acid sequence identity to (a) a DNA
molecule encoding a PRO
polypeptide having a full-length amino acid sequence as disclosed herein. an
amino acid sequence lacking the
signal peptide as disclosed herein, an extracellular domain of a transmembrane
protein. with or without the
signal peptide, as disclosed herein or any other specifically defined fragment
of the full-length amino acid
sequence as disclosed herein, or (b) the complement of the DNA molecule of
(a).
In other aspects, the isolated nucleic acid molecule comprises a nucleotide
sequence having at least
about 80°,'° nucleic acid sequence identity, alternatively at
least about 81°,o nucleic acid sequence identity,
1, alternatively at least about 82°r. nucleic acid sequence identity.
alternatively at least about 83°ro nucleic acid
sequence identity. alternatively at feast about 84"-a nucleic acid sequence
identity. alternatively at least about
85% nucleic acid sequence identity, alternatively at least about 86°ro
nucleic acid sequence identity,
alternatively at least about 87°,-S, nucleic acid sequence identity.
alternatively at least about 88°.'° nucleic acid
sequence identity, alternatively at least about 89% nucleic acid sequence
identity, alternatively at least about
90% nucleic acid sequence identity, alternatively at least about 91°.'o
nucleic acid sequence identity,
alternatively at least about 92°,r° nucleic acid sequence
identity, alternatively at least about 93% nucleic acid
sequence identity, alternatively at least about 94% nucleic acid sequence
identity, alternatively at least about
95% nucleic acid sequence identity, alternatively at least about 96% nucleic
acid sequence identity,
alternatively at least about 97°,'b nucleic acid sequence identity,
alternatively at least about 98% nucleic acid
sequence identity. alternatively at least about 99% nucleic acid sequence
identity to (a) a DNA molecule
comprising the coding sequence of a full-leneth PRO polvpepude cDNA as
disclosed herein. the coding
sequence of a PRO polypeptide lacking the signal peptide as disclosed herein,
the coding sequence of an
extracellular domain of a transmembrane PRO polypeptide. with or without the
signal peptide, as disclosed
herein or the coding sequence of any other specifically defined fragment of
the full-length amino acid sequence
as disclosed herein, or (b) the complement of the DNA molecule of (a).
In a further aspect, the invention concerns an isolated nucleic acid molecule
comprising a nucleotide
sequence having at least about 80% nucleic acid sequence identity,
alternatively at least about 81% nucleic acid
sequence identity, alternatively at least about 82% nucleic acid sequence
identity, alternatively at least about
83% nucleic acid sequence identity, alternatively at least about 84% nucleic
acid sequence identity,
alternatively at least about 85% nucleic acid sequence identity, alternatively
at least about 86% nucleic acid
sequence identity, alternatively at least about 87% nucleic acid sequence
identity, alternatively at least about
88% nucleic acid sequence identity, alternatively at least about 89% nucleic
acid sequence identity,
alternatively at least about 90% nucleic acid sequence identity, alternatively
at least about 91% nucleic acid
sequence identity, alternatively at least about 92% nucleic acid sequence
identity, alternatively at least about
93% nucleic acid sequence identity, alternatively at least about 94% nucleic
acid sequence identity,
3
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTIUS00/05841
alternatively at least about 95% nucleic acid sequence identity. alternatively
at least about 96% nucleic acid
sequence identity, alternatively at least about 97% nucleic acid sequence
identity, alternatively at least about
98% nucleic acid sequence identity, alternatively at least about 99% nucleic
acid sequence identity to (a) a
DNA molecule that encodes the same mature polypeptide encoded by any of the
human protein cDNAs
deposited with the ATCC as disclosed herein, or (b) the complement of the DNA
molecule of (a).
In another aspect, the invention provides for isolated nucleic acid molecule
comprising a nucleotide
sequence encoding a PRO polypeptide with is either transmembrane domain-
deleted or transmembrane
domain-inactivated, or is complementary to such encoding nucleotide sequence.
wherein the transmembrane
domains) of such polvpeptides are disclosed herein. Therefore, soluble
extracellular domains of the herein
described PRO polypeptides are contemplated.
Another embodiment is directed to fragments of a PRO polypeptide coding
sequence, or the
complement thereof. that may find use as, for example. hybridization probes,
for encoding fragments of a PRO
polvpeptide that may optionally encode a polypeptide comprising a binding site
for an anti-PRO polypeptide
antibody or as antisense oligonucleotide probes. Such nucleic acid fragments
are usually at least about 20
nucleotides in length. alternatively at least about 30 nucleotides in length,
alternatively at least about 40
nucleotides in length, altemattvely at least about 50 nucleotides in length,
alternatively at least about 60
nucleotides in length. alternatively at least about 70 nucleotides in length.
alternatively at least about 80
nucleotides in length. alternatively at least about 90 nucleotides in length,
alternatively at least about 100
nucleotides in length. alternatively at least about l 10 nucleotides in
length. alternatively at least about 120
nucleotides in length, alternatively at least about l30 nucleotides in length,
alternatively at least about 140
nucleotides in length, alternatively at least about 150 nucleotides in length,
alternatively at least about 160
nucleotides in length, alternatively at least about 170 nucleotides in length.
alternatively at least about 180
nucleotides in length, alternatively at least about 190 nucleotides in length,
alternatively at least about 200
nucleotides in length, alternatively at least about 250 nucleotides in length,
alternatively at least about 300
nucleotides in length, alternatively at least about 350 nucleotides in length,
alternatively at least about 400
nucleotides in length, alternatively at least about 450 nucleotides in length.
alternatively at least about 500
nucleotides in length, alternatively at least about 600 nucleotides in length,
alternatively at least about 700
nucleotides in length, alternatively at least about 800 nucleotides in length,
alternatively at least about 900
nucleotides in length, alternatively at least about 1000 nucleotides in
length, alternatively at least about 1500
nucleotide in length, alternatively at least about 2000 nucleotides in length,
alternatively at least about 2500
nucleotide in length, alternatively at least about 3000 nucleotide in length,
alternatively at least about 4000
nucleotide in length, alternatively at least about 5000 nucleotides in length,
or more, wherein in this context the
term "about" means the referenced nucleotide sequence length plus or minus 10%
of that referenced length. It
is noted that novel fragments of a nucleotide sequence encoding the respective
PRO polypeptide may be
determined in a routine mattner by aligning the respective nucleotide encoding
a PRO polypeptide with other
known nucleotide sequences using any of a number of well known sequence
alignment programs and
determining which nucleotide sequence fragments) are novel. All such
nucleotide sequences encoding the
respective PRO polypeptides are contemplated herein. Also contemplated are the
nucleotide molecules which
encode fragments of the PRO polypeptides, preferably those polypeptide
fragments that comprise a binding site
for an anti-PRO polypeptide antibody.
4
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTJUS00/05841
In another embodiment. the invention provides isolated PRO polvpeptides
encoded by any of the
isolated nucleic acid sequences hereinabove identified.
In a certain aspect, the invention concerns an isolated PRO polypeptide.
comprising an amino acid
sequence having at least about 80% amino acid sequence identity, alternatively
at least about 81% amino acid
sequence identity, alternatively at least about 82°,'° amino
acid sequence identity, alternatively at least about
83% amino acid sequence identity, alternatively at least about 84°.o
amino acid sequence identity, alternatively
at least about 85% amino acid sequence identity, alternatively at least about
86% amino acid sequence identity,
altetnativelv at least about 87% amino acid sequence identity, alternatively
at least about 88% amino acid
sequence identity. alternatively at least about 89% amino acid sequence
identity, alternatively at least about
90% amino acid sequence identity, alternatively at least about 91% amino acid
sequence identity, alternatively
at least about 92% amino acid sequence identity, alternatively at Least about
93% amino acid sequence identity,
alternatively at least about 94% amino acid sequence identity, alternatively
at least about 95°,'° amino acid
sequence identity, alternatively at least about 96% amino acid sequence
identity, alternatively at least about
97% amino acid sequence identity, alternatively at least about 98% amino acid
sequence identity, alternatively
I S at least about 99°% amino acid sequence identity to a PRO
polvpeptide having a full-length amino acid
sequence as disclosed herein. an amino acid sequence lacking the signal
peptide as disclosed herein. an
extracellular domain of a transmembrane protein. with or without the signal
peptide, as disclosed herein or any
other specifically defined fiagment of the full-length amino acid sequence as
disclosed herein.
In a further aspect, the invention concerns an isolated PRO polypeptide
comprising an amino acid
sequence having at least about 80% amino acid sequence identity, alternatively
at least about 81% amino acid
sequence identity, alternatively at least about 82% amino acid sequence
identity, alternatively at least about
83% amino acid sequence identity, alternatively at least about 84% amino acid
sequence identity, alternatively
at least about 85% amino acid sequence identity, alternatively at least about
86% amino acid sequence identity,
alternatively at least about 87°,~ amino acid sequence identity,
alternatively at least about 88% amino acid
sequence identity. alternatively at least about 89'% amino acid sequence
identity, alternatively at least about
90% amino acid sequence identity, altemanvelv at least about 91°,~
amino acid sequence identity, alternatively
at least about 92°,o amino acid sequence identity, alternatively at
least about 93°io amino acid sequence identity,
alternatively at least about 94% amino acid sequence identity, alternatively
at least about 95% amino acid
sequence identity, alternatively at least about 96% amino acid sequence
identity, alternatively at least about
97% amino acid sequence identity, alternatively at least about 98% amino acid
sequence identity, alternatively
at least about 99% amino acid sequence identity to an amino acid sequence
encoded by any of the human
protein cDNAs deposited with the ATCC as disclosed herein.
In a further aspect, the invention concerns an isolated PRO polypeptide
comprising an amino acid
sequence scoring at least about 80°,'o positives, alternatively at
least about 81% positives, alternatively at least
about 82°o positives, alternatively at least about 83% positives,
alternatively at least about 84% positives,
alternatively at least about 85% positives, alternatively at least about 86%
positives, alternatively at least about
87% positives, alternatively at least about 88% positives, alternatively at
least about 89% positives,
alternatively at least about 90% positives, alternatively at least about 91%
positives. alternatively at least about
92% positives, alternatively at least about 93% positives, alternatively at
least about 94% positives,
alternatively at least about 95% positives, alternatively at least about 96%
positives, alternatively at least about
5
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
97% positives, alternatively at least about 98% positives, alternatively at
least about 99°,% positives when
compared with the amino acid sequence of a PRO polypeptide having a full-
length amino acid sequence as
disclosed herein, an amino acid sequence lacking the signal peptide as
disclosed herein, an extracellular
domain of a transmembrane protein, with or without the signal peptide. as
disclosed herein or any other
specifically defined fragment of the full-length amino acid sequence as
disclosed herein.
In a specific aspect, the invention provides an isolated PRO polypeptide
without the N-terminal signal
sequence and~or the initiating methionine and is encoded by a nucleotide
sequence that encodes such an amino
acid sequence as hereinbefore described. Processes for producing the same are
also herein described. wherein
those processes comprise culturing a host cell comprising a vector which
comprises the appropriate encoding
nucleic acid molecule under conditions suitable for expression of the PRO
polypeptide and recovering the same
from the cell culture.
In another aspect, the invention provides an isolated PRO polypeptide which is
either transmembrane-
deleted or transmembrane domain-inactivated. Processes for producing the same
are also herein described.
wherein those processes comprise culturing a host cell comprising a vector
which comprises the appropriate
l5 encoding nucleic acid molecule under conditions suitable for expression of
the PRO polvpeptide and
recovering the PRO polypeptide from the cell culture.
In another embodiment, the invention provides vectors comprising DNA encoding
any of the PRO
polypeptides. Host cells comprising any such vector are also provided. By way
of example, the host cells may
be CHO cells, E'. coli or yeast. A process for producing any of the herein
described polypeptides is further
provided and comprises culturing host cells under conditions suitable for
expression of the desired
polypeptides and recovering the desired polypeptide from the cell culture.
In other embodiments, the invention provides chimeric molecules comprising any
of the herein
described polypeptides fused to a heterologous polypeptide or amino acid
sequence. Examples of such
chimeric molecules comprise any of the herein described polypeptides fused to
an epitope tag sequence or a Fc
region of an immunoglobulin.
In yet other embodiments, the invention provides oligonucleotide probes useful
for isolating genomic
and cDNA nucleotide sequences or as antisense probes, wherein those probes may
be derived from any of the
above or below described nucleotide sequences.
In yet another embodiment, the invention concerns agonists and antagonists of
the PRO polypeptides.
that mimic or inhibit one or more functions or activities of the PRO
polypeptides. In a particular embodiment,
the agonist or antagonist is an antibody that binds to the PRO polypeptides or
a small molecule.
In another embodiment, the invention provides an antibody which specifically
binds to any of the
above or below described polypeptides. Optionally, the antibody is a
monoclonal antibody, humanized
antibody, antibody fragment or single-chain antibody. In one aspect, the
present invention concerns an isolated
antibody which binds a PRO polypeptide. In another aspect, the antibody mimics
the activity of a PRO
polypeptide (an agonist antibody) or conversely the antibody inhibits or
neutralizes the activity of a PRO
polypeptide (an antagonist antibody). In another aspect, the antibody is a
monoclonal antibody, which
preferably has nonhuman complementarily determining region (CDR) residues and
human framework region
(FR) residues. The antibody may be labeled and may be immobilized on a solid
support. In a further aspect,
the antibody is an antibody fragment, a monoclonal antibody, a single-chain
antibody, or an anti-idiotypic
6
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTlUS00/05841
antibody.
In a further embodiment. the invention concerns a method of identifying
agonists or antagonists to a
PRO polypeptide which comprises contacting the PRO polypeptide with a
candidate molecule and monitoring
a biological activity mediated by said PRO polypeptide, Preferably, the PRO
polypeptide is a native sequence
PRO polypeptide.
In another embodiment. the invention concerns a composition of matter
containing PRO polypeptide
or an agonist or antagonist antibody which binds the polypeptide in admixture
with a carrier or excipient. In
one aspect, the composition contains a therapeutically effective amount of the
peptide or antibody. In another
aspect, when the composition contains an immune stimulating molecule, the
composition is useful for: (a)
increasing infiltration of inflammatory cells into a tissue of a mammal in
need thereof. (b) stimulating or
enhancing an immune response in a mammal in need thereof, or (c) increasing
the proliferation of T-
lymphocvtes in a mammal in need thereof in response to an antigen. In a
further aspect, when the composition
contains an immune inhibiting molecule, the composition is useful for: (a)
decreasing infiltration of
inflammatory cells into a tissue of a mammal in need thereof. (b) inhibiting
or reducing an immune response
in a mammal in need thereot: or Ic) decreasing the proliferation of T-
lymphocytes in a mammal in need thereof
in response to an antigen. In another aspect, the composition contains a
lurther active ingredient. which may,
for example, be a further antibody or a cytotoxic or chemotherapeutic agent.
Preferably. the composition is
sterile.
In another embodiment, the invention concerns the use of the polypeptides and
antibodies of the
invention to prepare a composition or medicament which has the uses described
above.
In a further embodiment. the invention concerns nucleic acid encoding an anti-
PR0200, anti-PR0204,
anti-PR0212. anti-PR0216, anti-PR0226, anti-PR0240, anti-PR0235, anti-PR0245,
anti-PR0172, anti-
PR0273, anti-PR0272, anti-PR0332, anti-PR0526, anti-PR0701, anti-PR0361, anti-
PR0362, anti-PR0363,
anti-PR0364, anti-PR0356, anti-PR0531. anti-PR0533, anti-PR01083, anti-PR0865.
anti-PR0770, anti-
PR0769, anti-PR0788. anti-PR01114, anti-PR01007, anti-PROI 184, anti-PR01031.
anti-PR01346, anti-
PRO115~, anti-PR01250, anu-PR01312, anti-PROI 192. anti-PR012-16, anti-
PR01283. anti-PROI 195. anti-
PR01343, anti-PR01418. anu-PR01387, anti-PR01410, anti-PR01917, anti-PR01868,
anti-PR0205, anu-
PR021, anti-PR0269, anti-PR0344, anti-PR0333, anti-PR0381, anti-PR0720, anti-
PR0866, anti-PR0840,
anti-PR0982, anti-PR0836, anti-PR01159, anti-PR01358, anti-PR01325, anti-
PR01338, anti-PR01434,
anti-PR04333, anti-PR04302, anti-PR04430 or anti-PR05727 antibody, and vectors
and recombinant host
cells comprising such nucleic acid. In a still further embodiment, the
invention concerns a method for
producing such an antibody by culturing a host cell transformed with nucleic
acid encoding the antibody under
conditions such that the antibody is expressed. and recovering the antibody
from the cell culture.
In a further embodiment, the invention concerns an isolated nucleic acid
molecule chat hybridizes to
the a nucleic acid molecule encoding a PRO polypeptide, or the complement
thereof. The nucleic acid
preferably is DNA, and hybridization preferably occurs under stringent
conditions. Such nucleic acid
molecules can act as antisense molecules of the amplified genes identified
herein, which, in turn, can find use
in the modulation of the respective amplified genes, or as antisense primers
in amplification reactions.
Fttrthetmore, such sequences can be used as part of ribozyme and/or triple
helix sequence which, in turn, may
be used in regulation of the amplified genes.
7
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
In another embodiment, the invention concerns a method for determining the
presence of a PRO
polypeptide comprising exposing a cell suspected of containing and/or
expressing the polypeptide to an anti-
PR0200, anti-PR0204, anti-PR0212. anti-PR0216. anti-PR0226, anti-PR0240, anti-
PR0235, anti-PR0245,
anti-PR0172, anti-PR0273, anti-PR0272, anti-PR0332, anti-PR0526, anti-PR0701,
anti-PR0361, anti-
s PR0362, anti-PR0363, anti-PR0364, anti-PR0356, anti-PR0531, anti-PR0533,
anti-PR01083, anti-PR0865,
anti-PR0770, anti-PR0769, anti-PR0788. anti-PROI I 14, anti-PR01007, anti-
PR01184, anti-PR01031, anti-
PR01346, anti-PR01155, anti-PR01250. anti-PR01312, anti-PR01192, anti-PR01246,
anti-PR01283, anti-
PR01195, anti-PR01343. anti-PR01418, anti-PR01387, anti-PR01410. anti-PR01917,
anti-PROI868, anti-
PR0205, anti-PR021. anti-PR0269, anti-PR0344, anti-PR0333, anti-PR0381, anti-
PR0720, anti-PR0866,
anti-PR0840, anti-PR0982, anti-PR0836. anti-PR01159, anti-PR01358, anti-
PR01325. anti-PR01338. anti-
PR01434, anti-PR04333, anti-PR04302, anti-PR04430 or anti-PR05727 antibody and
determining binding
of the antibody to the cell.
In yet another embodiment, the present invention concerns a method of
diagnosing an immune related
disease in a mammal, comprising detecting the levei of expression of a gene
encoding a PRO polypeptide (a) in
a test sample of tissue cells obtained trom the mammal, and (b) in a control
sample of knowm normal tissue
cells of the same cell n~pe. wherein a hieher or lower expression level in the
test sample as compared to the
control sample indicates the presence of immune related disease in the mammal
from which the test tissue cells
were obtained.
In another embodiment, the present invention concerns a method of diagnosing
an immune disease in
a mammal, comprising (a) contacting an anti-PRO polypeptide antibody with a
test sample of tissue cells
obtained from the mammal, and (b) detecting the formation of a complex between
the antibody and the
respective PRO polypeptide. respectively, in the test sample; wherein the
fotzrtation of said complex is
indicative of the presence or absence of said disease. The detection may be
qualitative or quantitative, and may
be performed in comparison with monitoring the complex formation in a control
sample of known normal
tissue cells of the same cell type. A larger quantin~ of complexes formed in
the test sample indicates the
presence or absence of an immune disease in the mammal from which the test
tissue cells were obtained. The
antibody preferably carries a detectable label. Complex formation can be
monitored. for example, by light
microscopy, flow cytometry, fluorimetry, or other techniques known in the art.
The test sample is usually
obtained from an individual suspected of having a deficiency or abnormality of
the immune system.
In another embodiment, the present invention concerns a diagnostic kit,
containing an anti-PR0200.
anti-PR0204, anti-PR0212, anti-PR0216, anti-PR0226. anti-PR0240, anti-PR0235,
anti-PR0245, anti-
PR0172, anti-PR0273, anti-PR0272, anti-PR0332, anti-PR0526, anti-PR0701, anti-
PR0361, anti-PR0362,
anti-PR0363, anti-PR0364, anti-PR0356. anti-PR0531, anti-PR0533, anti-PR01083,
anti-PR0865, anti-
PR0770, anti-PR0769, anti-PR0788, anti-PR01114, anti-PR01007, anti-PROll84,
anti-PR01031, anti-
PR01346. anti-PR01155, anti-PR01250, anti-PR01312. anti-PR01192, anti-PR01246,
anti-PR01283, anti-
PR01195, anti-PR01343, anti-PR01418, anti-PR01387, anti-PR01410, anti-PR01917.
anti-PR01868, anti-
PR0205, anti-PR021, anti-PR0269, anti-PR0344, anti-PR0333, anti-PR0381, anti-
PR0720, anti-PR0866,
anti-PR0840, anti-PR0982, anti-PR0836, anti-PR01159, anti-PR01358, anti-
PR01325, anti-PR01338, anti-
PR01434, anti-PR04333, anti-PR04302, anti-PR04430 or anti-PR05727 antibody and
a carrier (e.g., a
buffer) in suitable packaging. The kit preferably contains instructions for
using the antibody to detect the PRO
8
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/USOOI05841
polypeptide.
In a further embodiment. the invention concerns an article of manufacture.
comprising:
a container;
an instruction on the container; and
a composition comprising an active agent contained within the container;
wherein the composition is
effective for stimulating or inhibiting an immune response in a mammal, the
instruction on the container
indicates that the composition can be used to treat an immune related disease,
and the active agent in the
composition is an agent stimulating or inhibiting the expression and/or
activity of the PRO polypeptide. In a
preferred aspect, the active agent is a PR0200. PR0204, PR0212. PR0216,
PR0226. PR0240, PR0235.
PR0245, PROi72, PR0273, PR0272, PR0332, PR0526. PR0701, PR0361. PR0362.
PR0363, PR0364,
PR0356, PR0531, PR0533, PR01083, PR0865. PR0770, PR0769, PR0788. PR01114.
PR01007,
PR01184, PR01031. PR01346, PR01155. PR01250, PR01312, PROI 192. PR01246,
PR01283. PR01195.
PR01343, PR01418, PR01387, PR01410, PR01917, PR01868, PR0205. PR021, PR0269,
PR0344,
PR0333, PR0381, PR0720, PR0866. PR0840, PR0982. PR0836, PR01159, PR01358,
PR01325.
PR01338. PR01434. PR04333. PR04302. PR04430 or PR05727 polypeptide or an anti-
PR0200, ann-
PR0204, anti-PR0212. anti-PR0216. anu-PR0226. anti-PR0240, anti-PR0235, anti-
PR0245, anti-PR0172.
anti-PR0273. anti-PR0272, anti-PR0332. anti-PR0526, anti-PR0701. anu-PR0361,
anti-PR0362. anti-
PR0363. anti-PR0364, anti-PR0356, anti-PR0531, anti-PR0533, anti-PR01083, anti-
PR0865. anti-PR0770.
anti-PR0769, anti-PR0788, anti-PR01114, anti-PRO1007, anti-PR01184, anti-
PR01031, anti-PR01346,
anti-PR01155, anti-PR01250. anti-PR01312, anti-PR01192, anti-PR01246, anti-
PR01283, anti-PR01195,
anti-PR01343, anti-PR01418, anti-PR01387, anti-PR01410, anti-PR01917, anti-
PR01868, anti-PR0205,
anti-PR021. anti-PR0269, anti-PR0344, anti-PR0333. anti-PR0381. anti-PR0720,
anti-PR0866, anti-
PR0840. anti-PR0982. anti-PR0836, anti-PR01159, anti-PR01358. anti-PR01325,
anti-PR01338, anti-
PR01434, anti-PR04333, anti-PR04302. anti-PR04430 or anti-PR05727 antibody.
A further embodiment is a method for identifying a compound capable of
inhibiting the expression
and/or activity of a PRO polypeptide by contacting a candidate compound with a
PRO polvpeptide under
conditions and for a time sufficient to allow these two components to
.interact. In a specific aspect. either the
candidate compound or the PRO polypeptide is immobilized on a solid support.
In another aspect, the non-
immobilized component carries a detectable label.
Another embodiment of the present invention is directed to the use of a PRO
polypeptide, or an
agonist or antagonist thereof as hereinbefore described, or an anti-PRO
antibody, for the preparation of a
medicament useful in the treatment of a condition which is responsive to the
PRO polypeptide, an agonist or
antagonist thereof or an anti-PRO antibody.
Brief Description of the Drawines
Figure 1 shows DNA29101-1276 (SEQ ID NO:1).
Figure 2 shows the native sequence PR0200 polypeptide I1NQ174 (SEQ ID N0:2).
Figure 3 shows DNA3087I-1157 (SEQ ID NO:11).
Figure 4 shows the native sequence partial length PR0204 polypeptide LTNQ178
(SEQ ID N0:12) .
Figure ~ shows DNA30942-1134 (SEQ ID N0:13).
9
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PC'T/US00/05841
Figure 6 shows the native sequence PR0212 polypeptide UNQ I 86 (SEQ ID N0:14).
Figure 7 shows DNA33087-1158 (SEQ ID N0:18).
Figure 8 shows the native sequence PR0216 polypeptide UNQ190 (SEQ ID N0:19).
Figure 9 shows DNA33460-I 166 (SEQ ID N0:20).
Figure 10 shows the native sequence PR0226 polypeptide UNQ200 (SEQ ID N0:21).
Figure 1 1 shows DNA34387-1 138 (SEQ ID N0:25).
Figure 12 shows the native sequence PR0240 polypeptide UNQ214 (SEQ ID N0:26).
Figure 13 shows DNA35558-1167 (SEQ ID N0:30).
Figure 14 shows the native sequence PR0235 polypeptide UNQ209 (SEQ ID N0:31).
Figure l5 shows DNA35638-I 141 (SEQ ID N0:35).
Figure 16 shows the native sequence PR0245 polypeptide UNQ219 (SEQ ID N0:36).
Figure 17 shows DNA35916-( 161 (SEQ ID N0:40).
Figure 18 shows the native sequence PR0172 polypeptide UNQ 146 (SEQ ID N0:41
).
Figure 19 shows DNA39523-1192 (SEQ ID N0:45).
Figure 20 shows the native sequence PR0273 polypeptide UNQ240 (SEQ ID N0:46).
Figure 21 chows DNA40620-1 183 (SEQ ID N0:50).
Figure 22 shows the native sequence PR0272 polypepude UNQ239 (SEQ ID N0:51).
Figure 23 shows DNA40982-1235 (SEQ ID N0:56).
Figure 24 shows the native sequence PR0332 polypeptide UNQ293 (SEQ ID N0:57).
Figure 25 shows DNA44184-1319 (SEQ ID N0:61).
Figure 26 shows the native sequence PR0526 polypeptide UNQ330 (SEQ ID N0:62).
Figure 27 shows DNA44205-1285 (SEQ ID N0:66).
Figure 28 shows the native sequence PR0701 polypeptide UNQ365 (SEQ ID N0:67).
Figure 29 shows DNA45410-1250 (SEQ ID N0:71).
Figure 30 shows the native sequence PR0361 polypeptide UNQ316 (SEQ ID N0:72).
Figure 31 shows DNA45416-1251 (SEQ ID N0:79).
Figure 32 shows the native sequence PR0362 polvpeptide UNQ317 (SEQ ID N0:80).
Figure 33 shows DNA45419-1252 (SEQ ID N0:86).
Figure 34 shows the native sequence PR0363 polypeptide UNQ318 (SEQ ID N0:87).
Figure 35 shows DNA47365-1206 (SEQ ID N0:91).
Figure 36 shows the native sequence PR0364 polypeptide UNQ319 (SEQ ID N0:92).
Figure 37 shows DNA47470-I 130 (SEQ ID NO:101 ).
Figure 38 shows the native sequence PR0356 polypeptide LJNQ313 (SEQ ID
N0:102).
Figure 39 shows DNA48314-1320 (SEQ ID N0:106).
Figure 40 shows the native sequence PR0531 polypeptide I1NQ332 (SEQ ID
N0:107).
Figure 41 shows DNA49435-1219 (SEQ ID NO:111).
Figure 42 shows the native sequence PR0533 polypeptide LJNQ334 (SEQ ID
N0:112).
Figure 43 shows DNA50921-1458 (SEQ ID N0:116).
Figure 44 shows the native sequence PR01083 polypeptide LJNQ540 (SEQ ID
N0:117).
Figure 45 shows DNA53974-1401 (SEQ ID N0:123).
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00105841
Figure 46 shows the native sequence PR0865 polypeptide UNQ434 (SEQ ID N0:124).
Figure 47 shows DNA54228-1366 (SEQ ID N0:133).
Figure 48 shows the native sequence PR0770 polypeptide LNQ408 (SEQ ID N0:134).
Figure 49 shows DNA54231-1366 (SEQ ID N0:139).
Figure 50 shows the native sequence PR0769 polypeptide UNQ407 (SEQ ID N0:140).
Figure 51 shows DNA56405-1357 (SEQ ID N0:141).
Figure 52 shows the native sequence PR0788 polypeptide UNQ430 (SEQ ID N0:142).
Figure 53 shows DNA57033-1403 (SEQ ID N0:143).
Figure S4 shows the native sequence PROI 114 polypeptide UNQ557 (SEQ ID
N0:144).
Figure 55 shows DNA57690-1374 (SEQ ID N0:145).
Figure 56 shows the native sequence PR01007 polypeptide UNQ491 (SEQ ID
N0:146).
Figure 57 shows DNA59220-1514 (SEQ ID N0:147).
Figure 58 shows the native sequence PRO1 184 polypeptide UNQ598 (SEQ ID
N0:148).
Figure 59 shows DNA59294-1381 (SEQ ID N0:149).
Figure 60 shows the native sequence PR01031 polypeptide UNQ516 (SEQ ID
N0:150).
Figure 61 shows DNA59776-1600 (SEQ ID N0:151).
Figure 62 shows the native sequence PR01346 polypeptide UNQ701 (SEQ ID
N0:152).
Figure 63 shows DNA59849-1504 (SEQ ID N0:156).
Figure 64 shows the native sequence PRO115S polypeptide UNQ585 (SEQ ID
N0:157).
Figure 65 shows DNA60775-1532 (SEQ ID N0:158).
Figure 66 shows the native sequence PR01250 polypeptide UNQ633 (SEQ ID
N0:159).
Figure 67 shows DNA61873-1574 (SEQ ID N0:160).
Figure 68 shows the native sequence PR01312 polypeptide UNQ678 (SEQ ID N0:161
).
Figure 69 SNOWS DNA62814-1 S21 (SEQ ID N0:162).
Figure 70 shows the native sequence PR01192 polypepude UNQ606 (SEQ ID N0:163).
Figure 71 shows DNA6488S-1529 (SEQ ID N0:167).
Figure 72 shows the native sequence 1'R01246 polypeptide UNQ630 (SEQ ID
N0:168).
Figure 73 shows DNA65404-1551 (SEQ ID N0:169).
Figure 74 shows the native sequence PR01283 polypeptide UNQ653 (SEQ ID
N0:170).
Figure 75 shows DNA65412-1523 (SEQ ID N0:177).
Figure 76 shows the native sequence PR01195 polypeptide UNQ608 (SEQ ID
N0:178).
Figure 77 shows DNA66675-1587 (SEQ ID N0:179).
Figure 78 shows the native sequence PR01343 polypeptide UNQ698 (SEQ ID
N0:180).
Figure 79 shows DNA68864-1629 (SEQ ID N0:184).
Figure 80 shows the native sequence PR01418 polypeptide UNQ732 (SEQ ID
N0:185).
Figure 81 shows DNA68872-1620 (SEQ ID N0:186).
Figure 82 shows the native sequence PR01387 polypeptide LJNQ722 (SEQ ID
N0:187).
Figure 83 shows DNA68874-1622 (SEQ ID N0:188).
Figure 84 shows the native sequence PR01410 polypeptide UNQ728 (SEQ ID
N0:189).
Figure 85 shows DNA76400-2528 (SEQ ID N0:190).
11
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTIUS00/05841
Figure 86 shows the native sequence PR01917 polypeptide L1NQ900 (SEQ ID
N0:191).
Figure 87 shows DNA77624-2S 15 (SEQ ID N0:192).
Figure 88 shows the native sequence PR01868 polvpeptide (1NQ8S9 (SEQ ID
N0:193).
Figure 89 shows DNA30868-1156 (SEQ ID N0:228).
Figure 90 shows the partial native sequence PR020S polypeptide LINQ179 (SEQ ID
N0:229).
Figure 91 shows DNA36638-1056 (SEQ ID N0:230).
Figure 92 shows the native sequence PR021 polvpeptide UNQ21 (SEQ ID N0:231).
Figure 93 shows DNA38260-1180 (SEQ ID N0:232).
Figure 94 shows the native sequence PR0269 polypeptide L1NQ236 (SEQ ID
N0:233).
Figure 9S shows DNA40S92-1242 (SEQ ID N0:240).
Figure 96 shows the native sequence PR0344 polypeptide LJNQ303 (SEQ ID N0:241
).
Figure 97 shows DNA41374-1312 (SEQ ID N0:248).
Figure 9R shows the partial length native sequence PR0333 polvpeptide LJNQ294
(SEQ ID N0:249).
Figure 99 shows DNA44194-1317 (SEQ ID N0:250).
1 S Figure 100 shows the native sequence PR0381 polvpeptide CJNQ322 (SEQ ID
N0:251 ).
Figure 101 shows DNAS3S17-1366 (SEQ ID N0:255).
Figure 102 chows the native sequence PR0720 polypeptide tINQ388 (SEQ ID
N0:256).
Figure 103 shows DNAS3971-1359 (SEQ ID N0:257).
Figure 104 shows the native sequence PR0866 polypeptide LJNQ43S (SEQ ID
N0:258).
Figure lOS shows DNAS3987-1438 (SEQ ID N0:266).
Figure 106 shows the native sequence PR0840 polypeptide UNQ433 (SEQ ID
N0:267).
Figure 107 shows DNAS7700-1408 (SEQ ID N0:268).
Figure 108 shows the native sequence PR0982 polypeptide LJNQ483 (SEQ ID
N0:269).
Figure 109 SNOWS DNAS9620-1463 (SEQ ID N0:270).
Figure I f 0 shows the native sequence PR0836 polypeptide LJNQS4S (SEQ
IDN0:271 ).
Figure 1 l 1 SNOWS DNA60627-1 508 (SEQ ID N0:272).
Figure 1 12 shows the native sequence PROI 159 polvpeptide LINQS89 (SEQ ID
N0:273).
Figure 113 shows DNA64890-1612 (SEQ ID N0:274).
Figure I 14 shows the native sequence PR013S8 polypeptide UNQ707 (SEQ ID
N0:275).
Figure 1 IS shows DNA666S9-1593 (SEQ ID N0:276).
Figure 116 shows the native sequence PRO 1325 polypeptide LTNQ685 (SEQ ID
N0:277).
Figure I 17 shows DNA66667-IS96 (SEQ ID N0:278).
Figure 118 shows the native sequence PR01338 polypeptide LJNQ693 (SEQ ID
N0:279).
Figure 119 shows DNA68818-2536 (SEQ ID N0:280).
3S Figure 120 shows the native sequence PR01434 polypeptide UNQ739 (SEQ ID
N0:281).
Figure 121 shows DNA84210-2576 (SEQ ID N0:28S).
Figure 122 shows the native sequence PR04333 polypeptide LTNQ1888 (SEQ ID
N0:286).
Figure 123 shows DNA92218-2554 (SEQ ID N0:292).
Figure 124 shows the native sequence PR04302 polypeptide IJNQ1866 (SEQ ID
N0:293).
Figure 125 shows DNA96878-2626 (SEQ ID N0:294).
12
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
Figure 126 shows the native sequence PR04430 polvpeptide L1NQ 1947 (SEQ ID
N0:295).
Figure 127 shows DNA98853-1739 (SEQ ID N0:296).
Figure 128 shows the native sequence PR05727 polvpeptide UNQ2448 (SEQ ID
N0:297).
Detailed Description of the Preferred Embodiments
I. Definitions
The terms "PRO polypeptide(s)" and "PRO" as used herein and when immediately
followed by a
numerical designation refer to various polypeptides, wherein the complete
designation (i.e.. "PRO/number" or
more particularly. PR0200. PR0204, PR0212, PR0216, PR0226, PR0240. PR0235.
PR0245. PR0172,
l0 PR0273, PR0272, PR0332. PR0526. PR0701, PR0361, PR0362. PR0363, PR0364,
PR0356. PR0531,
PR0533, PR01083, PR0865, PR0770, PR0769, PR0788, PR01114, PR01007, PR01184,
PR01031,
PR01346, PRO1 I55, PR01250, PR01312, PR01192, PR01246, PR01283. PRO( 195.
PR01343. PR01418,
PR01387, PR01410, PR01917. PR01868, PR0205, PR021, PR0269, PR03-I4. PR0333.
PR0381. PR0720,
PR0866. PR0840, PR0982, PR0836, PR01159, PR01358, PR01325, PR01338, PR01434.
PR04333,
l5 PR04302. PR04430 or fR05727) refer to particular polvpeptide sequences as
described herein. The tetTrts
"PRO/number poiypeptide" and "PROinumber" wherein the term "number" is
provided as an actual numerical
designation Ie.~., as described above) as used herein encompass native
sequence polypeptides and polypeptide
variants (which are further defined herein). The PRO polypeptides described
herein may be isolated from a
variety of sources, such as from human tissue types or from another source. or
prepared by recombinant or
20 synthetic methods.
A "native sequence PRO polypeptide(s)" comprises a polypeptide having the same
amino acid
sequence as the corresponding PRO polypeptide derived from nature. Such native
sequence PRO/number
polypeptides can be isolated from nature or can be produced by recombinant or
synthetic means. The tetTrt
"native sequence PRO polypeptide(s)" specifically encompasses naturally-
occurring truncated or secreted
25 forms of the specific PRO/number polypeptide (e.~., an extracellular domain
sequence), naturally-occurring
variant forms Ie.L>., alternatively vpliced forms) and naturally-occurring
allelic variants of the polvpeptide. In
various embodiments of the invention, the native sequence PRO polypeptides
disclosed herein are mature or
full-length native sequence polvpeptides comprising the full-length amino
acids sequences shown in the
accompanying figures. Start and stop codons are shown in bold font and
underlined in the figures. However,
30 while the PRO/number polypeptides disclosed in the accompanying figures are
shown to begin with
methionine residues designated herein as amino acid position 1 in the figures,
it is conceivable and possible
that other methionine residues located either upstream or downstream from the
amino acid position 1 in the
figures may be employed as the starting amino acid residue for the PRO
polypeptides.
The "PRO polypeptide(s) extracellular domain" or "ECD" refers to a form of the
said polypeptide
35 which is essentially free of the transmembrane and cytoplasmic domains.
Ordinarily, a PRO polypeptide ECD
will have less than I% of such transmembrane and/or cytoplasmic domains and
preferably, will have less than
0.5% of such domains. It will be understood that any transmembrane domains
identified for the PRO
polypeptides of the present invention are identified pursuant to criteria
routinely employed in the art for
identifying that type of hydrophobic domain. The exact boundaries of a
transmembrane domain may vary but
40 most likely by no more than about 5 amino acids at either end of the domain
as initially identified herein.
13
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Optionally, therefore, an extracellular domain of a PRO polypeptide may
contain from about S or fewer amino
acids on either side of the transmembrane domairuextracellular domain boundary
as identified in the Examples
or specification and such polypeptides. with or without the associated signal
peptide, and nucleic acid encoding
them. are contemplated by the present invention.
The approximate location of the "signal peptides" of the various PRO/number
PRO polypeptides
disclosed herein are shown in the present specification and/or the
accompanying figures. It is noted, however,
that the C-terminal boundary of a signal peptide may vary, but most likely by
no more than about ~ amino
acids on either side of the signal peptide C-terminal boundary as initially
identified herein, wherein the C-
terminal boundary of the signal peptide may be identified pursuant to criteria
routinely employed in the art for
f0 identifying thamtype of amino acid sequence element (e.g., Nielsen ec al.,
Prot. Eng. _L0:1-6 (1997) and von
Heinje et al., Nucl. Acids. Res. 14:4683-4690 ( 1986)). Moreover, it is also
recognized that, in some cases,
cleavage of a signal sequence from a secreted polypeptide is not entirely
uniform. resulting in more than one
secreted species. These mature polypeptides, where the signal peptide is
cleaved within no more than about 5
amino acids on either side of the C-terminal boundary of the signal peptide as
identified herein, and the
1 ~ polynucleotides encoding them. are contemplated by the present invention.
A "PRO polypeptide vanant", "PRO/number variant" or "PRO variant" means an
active PRO
polypeptide as defined herein (e.g., belowl having at least about RO°o
amino acid sequence identity with a full-
length native sequence PRO polypeptide sequence as disclosed herein, a PRO
polypeptide sequence lacking the
signal peptide as disclosed herein, an extracellular domain of a PRO
polypeptide, with or without the signal
20 peptide. as disclosed herein or any other fragment of a full-length PRO
polypeptide sequence as disclosed
herein. Such PRO polypeptide variants include, for instance, polypeptides
wherein one or more amino acid
residues are added, or deleted, at the N- or C-terminus of the full-length
native amino acid sequence.
Ordinarily, a PRO polypeptide variant will have at least about 80% amino acid
sequence identity, alternatively
at least about 81°,o amino acid sequence identity, alternatively at
least about 82°,o amino acid sequence identity,
25 alternatively at least about 83°,o amino acid sequence identity,
altemativelv at least about 84% amino acid
sequence identiy~. alternatively at least about RS°.~ amino acid
sequence identity. alternatively at least about
86% amino acid sequence identity, alternatively at least about R7°,~
amino acid sequence identity, alternatively
at least about 88% amino acid sequence identity, alternatively at least about
89% amino acid sequence identity,
alternatively at least about 90% amino acid sequence identity, alternatively
at least about 91°,o amino acid
30 sequence identity, alternatively at least about 92% amino acid sequence
identity, alternatively at least about
93% amino acid sequence identity, alternatively at least about 94% amino acid
sequence identity, alternatively
at least about 95% amino acid sequence identity, alternatively at least about
96% amino acid sequence identity,
alternatively at least about 97% amino acid sequence identity, alternatively
at least about 98% amino acid
sequence identity, alternatively at least about 99% amino acid sequence
identity with a full-length native
35 sequence PRO polypeptide sequence as disclosed herein. a PRO polypeptide
sequence lacking the signal
peptide as disclosed herein, an extracellular domain of a PRO polypeptide,
with or without the signal peptide,
as disclosed herein or any other specifically defined fragment of a full-
length PRO polypeptide sequence as
disclosed herein. Ordinarily, PRO polypeptide variants are at least about 10
amino acids in length,
alternatively at least about 20 amino acids in length, alternatively at least
about 30 amino acids in length,
40 alternatively at least about 40 amino acids in length, alternatively at
least about 50 amino acids in length,
14
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
alternatively at least about 60 amino acids in length, alternatively at least
about 70 amino acids in length,
alternatively at least about 80 amino acids in length, alternatively at least
about 90 amino acids in length,
alternatively at least about 100 amino acids in length, alternatively at least
about 150 amino acids in length,
alternatively at least about 200 amino acids in length, alternatively at least
about 300 amino acids in length,
alternatively at least about 400 amino acids on length, alternatively at least
about 500 amino acids in length,
alternatively at least about 600 amino acids in length, alternatively at least
about 700 amino acids in length,
alternatively at least about 800 amino acids in length, alternatively at least
about 900 amino acids in length,
alternatively at least about 1000 amino acids in length, alternatively at
least bout 1200 amino acids in length,
alternatively at least about 1400 amino acids in length, alternatively at
least about IS00 amino acids in length
or more.
"Percent (%) amino acid sequence identity" with respect to the PRO polypeptide
sequences identified
herein is defined as the percentage of amino acid residues in a candidate
sequence that are identical with the
amino acid residues in the specific PRO/number polypeptide sequence, after
aligning the sequences and
introducing gaps, if necessary, to achieve the maximum percent sequence
identity, and not considering any
1 ~ conservative substitutions as part of the sequence identity. Alignment for
purposes of determining percent
amino acid sequence identity can be achieved in vanous ways that are within
the skill in the art, for instance,
using publicly available computer software such as BLAST, BLAST-2. ALIGN or
Megalign (DNASTAR)
software. Those skilled in the an can detetlrtine appropriate parameters for
measuring alignment. including
any algorithms needed to achieve maximal alignment over the full length of the
sequences being compared.
For purposes herein, however. °,o amino acid sequence identity values
are generated using the sequence
comparison computer program ALIGN-2, wherein the complete source code for the
ALIGN-2 program is
provided in Table 1 below. The ALIGN-2 sequence comparison computer program
was authored by
Genentech. Inc. and the source code shown in Tables 1 below has been filed
with user documentation in the
U.S. Copyright Office, Washington D.C., 20559, where it is registered under
U.S. Copyright Registration No.
TXU510087. Tlte ALIGN-2 program is publicly available through Genentech. Inc..
South San Francisco,
California or may be compiled from the source code provided in Table 1 below.
The ALIGN-2 program
should be compiled for use on a UNIX operating system, preferably digital UNIX
V4.0D. All sequence
comparison parameters are set by the ALIGN-2 program and do not vary.
In situations where ALIGN-2 is employed for amino acid sequence comparisons,
the % amino acid
sequence identity of a given amino acid sequence .A to, with, or against a
given amino acid sequence B (which
can alternatively be phrased as a given amino acid sequence A that has or
comprises a certain % amino acid
sequence identity to, with, or against a given amino acid sequence B) is
calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
ALIGN-2 in that program's alignment of A and B, and where Y is the total
number of amino acid residues in
B. It will be appreciated that where the length of amino acid sequence A is
not equal to the length of amino
acid sequence B, the % amino acid sequence identity of A to B will not equal
the % amino acid sequence
identity of B to A. As examples of % amino acid sequence identity calculations
using this method, Tables 2
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
and 3 demonstrate how to calculate the °,'o amino acid sequence
identity of the amino acid sequence designated
"Comparison Protein" to the amino acid sequence designated "PRO", wherein
"PRO" represents the amino
acid sequence of a hypothetical PRO/number polypeptide of interest,
"Comparison Protein" represents the
amino acid sequence of a polypeptide against which the "PRO" polypeptide of
interest is being compared. and
"~C, "Y" and "Z" each represent different hypothetical amino acid residues.
Unless specifically stated otherwise, all % amino acid sequence identity
values used herein are
obtained as described in the immediately preceding paragraph using the ALIGN-2
computer program.
However, °,o amino acid sequence identity values may also be obtained
as described below by using the WU-
BLAST-2 computer program (Altschul et al.. Methods in Enymolo~v _266:460-480
(1996)). Most of the WU-
BLAST-2 searc-h parameters are set to the default values. Those not set to
default values, i.e., the adjustable
parameters, are set with the following values: overlap span = 1, overlap
fraction = 0.125, word threshold (T) _
1 I, and scoring matrix = BLOSUM62. When WU-BLAST-2 is employed, a °,'o
amino acid sequence identity
value is determined by dividing (a) the number of matching identical amino
acid residues between the amino
acid sequence of the PRO polypeptide of interest having a sequence derived
from the native sequence PRO
f 5 polypepude and the comparison amino acid sequence of interest (i.e., the
sequence against which the PRO
polypeptide is being compared - which may be a PRO polypeptide variant) as
determined by WU-BLAST-2 by
(b) the total number of amino acid residues of the PRO polypeptide of
interest. For example, in the statement
"a polypeptide composing an amino acid sequence A which has or having at least
80% amino acid sequence
identity to the amino acid sequence B", the amino acid sequence A is the
comparison amino acid sequence of
interest and the amino acid sequence B is the amino acid sequence of the PRO
polypeptide of interest.
Percent amino acid sequence identity may also be determined using the sequence
comparison program
NCBI-BLAST2 (Altschul et al., Nucleic .Acids Rea. 25:3389-3402 ( 1997)). The
NCBI-BLAST2 sequence
comparison program may be downloaded from "http://www.ncbi.nlm.gov" or
otherwise obtained from the
National Institute of Health. Bethesda, MD. NCBI-BLAST2 uses several search
parameters, wherein all of
those search parameters are set to default values including, for example,
unmask = yes, strand = all, expected
occurrences = 10. minimum low complexity length = I ~i3, multi-pass e-value =
0.01, constant for mufti-pass =
25. dropoff for f-tnal gapped alignment = ?s and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is employed for amino acid sequence
comparisons, the % amino
acid sequence identity of a given amino acid sequence A to, with, or against a
given amino acid sequence B
(which can alternatively be phrased as a given amino acid sequence A that has
or comprises a certain °io amino
acid sequence identity to, with, or against a given amino acid sequence B) is
calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by
the sequence alignment program
NCBI-BLAST2 in that program's alignment of A and B, and where Y is the total
number of amino acid
residues in B. It will be appreciated that where the length of amino acid
sequence A is not equal to the length
of amino acid sequence B, the % amino acid sequence identity of A to B will
not equal the % amino acid
sequence identity of B to A.
16
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
"PRO variant polynucleotide" or "PRO variant nucleic acid sequence" means a
nucleic acid molecule
which encodes an active PRO polypeptide as defined below and which has at
least about 80% nucleic acid
sequence identity with a nucleotide sequence encoding: ( 1 ) a full-length
native sequence PRO polypeptide as
disclosed herein; (2) a full-length native sequence PRO poivpeptide lacking
the signal peptide as disclosed
herein; (3) an extracellular domain of a PRO polypeptide, with or without the
signal peptide, as disclosed
herein or (4) any other fragment of a full-length PRO polypeptide sequence as
disclosed herein. Ordinarily, a
PRO polypeptide variant polynucleotide will have at least about 80% nucleic
acid sequence identity,
alternatively at least about 81 % nucleic acid sequence identity,
alternatively at least about 82% nucleic acid
sequence identity, alternatively at least about 83°,'° nucleic
acid sequence identity, alternatively at least about
IO 84% nucleic acid sequence identity, alternatively at least about 85%
nucleic acid sequence identity,
alternatively at least about 86% nucleic acid sequence identity, alternatively
at least about 87% nucleic acid
sequence identity. alternatively at least about 88% nucleic acid sequence
identity, alternatively at least about
89% nucleic acid sequence identity, alternatively at least about 90% nucleic
acid sequence identity,
alternatively at least about 91 % nucleic acid sequence identity,
alternatively at least about 92°% nucleic acid
sequence identity, alternatively at least about 93°,~ nucleic acid
sequence identity. alternatively at least about
94°o nucleic acid sequence identity, alternatively at least about
9~°,% nucleic acid sequence identity.
alternatively at least about 96% nucleic acid sequence identin~, alternatively
at least about 97°~4~ nucleic acid
sequence identity, alternatively at least about 98°,o nucleic acid
sequence identity, alternatively at least about
99% nucleic acid sequence identity with ( 1 ) a nucleic acid sequence encoding
a full-length native sequence
PRO polypeptide sequence as disclosed herein, (2) a full-length native
sequence PRO polypeptide sequence
lacking the signal peptide as disclosed herein, (3) an extracellular domain of
a PRO polypeptide sequence. with
or without the signal sequence, as disclosed herein or (4) any other fragment
of a full-length PRO polypeptide
on sequence as disclosed herein. Variants do not encompass the native
nucleotide sequence.
Ordinarily. PRO polypeptide variant polynucleotides are at least about 30
nucleotides in Length.
alternatively at least about 60 nucleotides in length. alternanvely at least
about 90 nucleotides in length,
alternatively at least about 120 nucleotides in length. alternatively at least
about 150 nucleotides in length,
altemauvely at least about 180 nucleotides in length, alternatively at least
about 210 nucleotides in length.
alternatively at least about 240 nucleotides in length, alternatively at feast
about 270 nucleotides in length,
alternatively at least about 300 nucleotides in length, alternatively at least
about 450 nucleotides in length,
alternatively at least about 500 nucleotides in length, alternatively at least
about 600 nucleotides in length,
alternatively at least about 700 nucleotides in length, alternatively at least
about 800 nucleotides in length,
alternatively at least about 900 nucleotides in length, alternatively at least
about 1000 nucleotides in length,
alternatively at least about 1200 nucleotides in length, alternatively at
least about 1400 nucleotides in length,
alternatively at least about 1600 nucleotides in length, alternatively at
least about 1800 nucleotides in length,
alternatively at least about 2000 nucleotides in length, alternatively at
least about 2500 nucleotides in length,
alternatively at least about 3000 nucleotides in length, alternatively at
least about 3500 nucleotides in length,
alternatively at least about 4000 nucleotides, alternatively at least about
5000 nucleotides or more.
"Percent (%) nucleic acid sequence identity" with respect to PRO-encoding
nucleic acid sequences
identified herein is defined as the percentage of nucleotides in a candidate
sequence that are identical with the
nucleotides in the PRO nucleic acid sequence of interest, after aligning the
sequences and introducing gaps, if
17
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
necessary, to achieve the maximum percent sequence identity. Alignment for
purposes of determining percent
nucleic acid sequence identity can be achieved in various ways that are within
the skill in the art, for instance,
using publicly available computer software such as BLAST, BLAST-2, ALIGN or
Megalign (DNASTAR)
software. For purposes herein, however, °,'° nucleic acid
sequence identity values are generated using the
sequence comparison computer program ALIGN-2, wherein the complete source code
for the ALIGN-2
program is provided in Table I below. The ALIGN-2 sequence comparison computer
program was authored
by Genentech. Inc. and the source code shown in Table 1 below has been filed
with user documentation in the
U.S. Copyright Office, Washington D.C., 20559, where it is registered under
U.S. Copyright Registration No.
TXU510087. The ALIGN-2 program is publicly available through Genentech. Inc..
South San Francisco,
California or may be compiled from the source code provided in Table 1 below.
The ALIGN-2 program
should be compiled for use on a UNIX operating system, preferably digital UMX
V4.OD. All sequence
comparison parameters are set by the ALIGN-2 program and do not vary.
In situations where ALIGN-2 is employed for nucleic acid sequence comparisons.
the % nucleic acid
sequence identity of a given nucleic acid sequence C to, with. or against a
given nucleic acid sequence D
I 5 ( which can alternatively be phrased as a given nucleic acid sequence C
that has or comprises a certain
nucleic acid sequence identin,~ to. with, or against a. eiven nucleic acid
sequence D) is calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the
sequence alietunent program ALIGN-
2 in that program's alignment of C and D, and where Z is the total number of
nucieotides in D. It will be
appreciated that where the length of nucleic acid sequence C is not equal to
the length of nucleic acid sequence
D, the °,'° nucleic acid sequence identity of C to D will not
equal the °,% nucleic acid sequence identity of D to C.
As examples of % nucleic acid sequence identity calculations, Tables 4 and 5,
demonstrate how to calculate
the % nucleic acid sequence identity of the nucleic acid sequence designated
"Comparison DNA" to the
nucleic acid sequence designated "PRO-DNA", wherein "PRO-DNA" represents a
hypothetical PRO
polypeptide - encoding nucleic acid sequence of interest, "Comparison DNA"
represents the nucleotide
sequence of a nucleic acid molecule against which the "PRO-DNA" nucleic acid
molecule of interest is being
compared, and "N", "L" and "V" each represent different hypothetical
nucleotides.
Unless specifically stated otherwise, all % nucleic acid sequence identity
values used herein are
obtained as described in the immediately preceding paragraph using the ALIGN-2
computer program.
However, % nucleic acid sequence identity values may also be obtained as
described below by using the WU-
BLAST-2 computer program (Altschul et al., Methods in Enn~molo,~t~ _266:460-
480 (1996)). Most of the WU-
BLAST-2 search parameters are set to the default values. Those not set to
default values, i.e., the adjustable
parameters, are set with the following values: overlap span = I, overlap
fraction = 0.125, word threshold (T) _
11, and scoring matrix = BLOSUM62. When WU-BLAST-2 is empioyed, a % nucleic
acid sequence identity
value is determined by dividing (a) the number of matching identical
nucleotides between the nucleic acid
sequence of the PRO polypeptide - encoding nucleic acid molecule of interest
having a sequence derived from
the native sequence PRO polypeptide - encoding nucleic acid (i.e., the
reference sequence) and the comparison
nucleic acid molecule of interest (i.e., the sequence against which the PRO
polypeptide - encoding nucleic acid
18
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
molecule of interest is being compared - which may be a PRO variant
polynucieotide) as determined by WU-
BLAST-2 by (b) the total number of nucieotides of the PRO reference sequence.
For example, in the statement
"an isolated nucleic acid molecule comprising a nucleic acid sequence A which
has or having at least 80%
nucleic acid sequence identity to the nucleic acid sequence B", the nucleic
acid sequence A is the comparison
nucleic acid molecule of interest and the nucleic acid sequence B is the
nucleic acid sequence of the PRO
polypeptide - encoding nucleic acid molecule of interest.
Percent nucleic acid sequence identity may also be determined using the
sequence comparison
program NCBI-BLAST2 (Altschul et ul., Nucleic Acids Res. _25:3389-3402
(1997)). The NCBI-BLAST2
sequence comparison program may be downloaded from
"http:/iwww.ncbi.nlm.nih.gov" or otherwise obtained
from the National Institute of Heath, Bethesda. MD. NCBI-BLAST2 uses several
search parameters, wherein
all of those search parameters are set to default values including, for
example, unmask = yes, strand = all.
expected occurrences = 10, minimum low complexity length = 15!5. mufti-pass e-
value = 0.01, constant for
mufti-pass = 25. dropoff for final gapped alignment = 25 and scorine matrix =
BLOSUM62.
In situations where NCBI-BLAST2 is employed for sequence comparisons. the %
nucleic acid
l5 sequence identity of a given nucleic acid sequence C to. with, or against a
given nucleic acid sequence D
(which can alternatively be phrased as a given nucleic acid sequence C that
has or comprises a certain
nucleic acid sequence identity to. with, or against a Liven nucleic acid
sequence D) is calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the
sequence alignment program NCBI
BLAST2 in that program's alignment of C and D, and where Z is the total number
of nucleotides in D. It will
be appreciated that where the length of nucleic acid sequence C is not equal
to the length of nucleic acid
sequence D, the % nucleic acid sequence identity of C to D will not equal the
°,o nucleic acid sequence identity
of D to C.
In other embodiments, PRO variant polvnucleotides art nucleic acid molecules
that encode an active
PRO polvpeptide and which arc capable of hybridizing, preferably under
stringent hybridization and wash
conditions, to nucleotide sequences encoding a full-length PRO polypeptides as
disclosed herein. PRO variant
polypeptides may be those that are encoded by a PRO variant polynucleotide.
The term "positives", in the context of sequence comparison performed as
described above, includes
residues in the sequences compared that are not identical but have similar
properties (e.g., as a result of
conservative substitutions, see Table 6 below). For purposes herein. the
°.6 value of positives is determined by
dividing (a) the number of amino acid residues scoring a positive value
between the PRO polypeptide sequence
of interest having a sequence derived from a native sequence PRO polypeptide
and the comparison amino acid
sequence of interest (i.e., the amino acid sequence against which the PRO
polypeptide sequence is being
compared) as determined in the BLOSUM62 matrix of WU-BLAST-2 by (b) the total
number of amino acid
residues of the PRO polypeptide of interest.
Unless specifically stated otherwise, the % value of positives is calculated
as described in the
immediately preceding paragraph. However. in the context of the amino acid
sequence identity comparisons
performed as described for ALIGN-2 and NCBI-BLAST-2 above, includes amino acid
residues in the
19
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
sequences compared that are not only identical, but also those that have
similar properties. Amino acid
residues that score a positive value to an amino acid residue of interest are
those that are either identical to the
amino acid residue of interest or are a preferred substitution (as defined in
Table I below) of the amino acid
residue of interest.
For amino acid sequence comparisons using ALIGN-2 or NCBI-BLAST2. the % value
of positives of
a given amino acid sequence A to, with. or against a given amino acid sequence
B (which can alternatively be
phrased as a given amino acid sequence A that has or comprises a certain
°,o positives to. with, or against a
given amino acid sequence B) is calculated as follows:
100 times the fraction X/Y
where Y is the number of amino acid residues scoring a positive value as
defined above by the sequence
alignment program ALIGN-2 or NCBI-BLAST2 in that program's alignment of A and
B, and where Y is the
total number of amino acid residues in B. It will be appreciated that where
the length of amino acid sequence
A is not equal to the length of amino acid sequence B. the °'o
positives of A to B will not equal the "o positives
of B to A.
"Isolated," when used to describe the various polypeptides disclosed herein.
means polypeptide that
has been tdentifed and separated and/or recovered from a component of its
natural environment. Contaminant
components of its natural environment are materials that would typically
interfere with diagnostic or
therapeutic uses for the polypeptide, and may include enzymes, hormones, and
other proteinaceous or non-
proteinaceous solutes. In preferred embodiments, the polypeptide will be
purified (1) to a degree sufficient to
obtain at least 15 residues of N-terminal or internal amino acid sequence by
use of a spinning cup sequenator.
or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions
using Coomassie blue or,
preferably. silver stain. Isolated polypeptide includes polypeptide in .sia~
within recombinant cells, since at
least one component of the PRO polypeptide in us natural environment will not
be present. Ordinarily,
however. isolated polypeptidc will be prepared by at least one purification
step.
An "isolated" PRO polypeptidc - encoding nucleic acid or other polypeptide-
encoding nucleic acid is
a nucleic acid molecule that is identified and separated from at least one
contaminant nucleic acid molecule
with which it is ordinarily associated in the natural source of the
polypeptide-encoding nucleic acid. An
isolated polypeptide-encoding nucleic acid molecule is other than in the
context or setting in which it is found
in nature. Isolated polypeptide - encoding nucleic acids therefore are
distinguished from the polypeptide -
encoding nucleic acid molecule existing in natural cells. However, an isolated
PRO polypeptide - encoding
nucleic acid molecule includes the same contained in cells that ordinarily
express the specific polypeptide
where, for example, the nucleic acid molecule is in a chromosomal location
different from that of natural cells.
'The term "control sequences" refers to DNA sequences necessary for the
expression of an operably
linked coding sequence in a particular host organism. The control sequences
that are suitable for prokaryotes,
for example, include a promoter, optionally an operator sequence, and a
ribosome binding site. Eukaryotic
cells are known to utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional
relationship with another nucleic
acid sequence. For example, DNA for a presequence or secretory leader is
operably linked to DNA for a
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00153758 PCTIUS00105841
polypeptide if it is expressed as a preprotein that participates in the
secretion of the polypeptide: a promoter or
enhancer is operably linked to a coding sequence if it affects the
transcription of the sequence: or a ribosome
binding site is operably linked to a coding sequence if it is positioned so as
to facilitate translation. Generally,
"operably linked" means that the DNA sequences being linked are contiguous.
and, in the case of a secretory
leader, contiguous and in reading phase. However, enhancers do not have to be
contiguous. Linking is
accomplished by ligation at convenient restriction sites. If such sites do not
exist, the synthetic oligonucleotide
adaptors or linkers are used in accordance with conventional practice.
"Stringency" of hybridization reactions is readily determinable by one of
ordinary skill in the art, and
generally is an empirical calculation dependent upon probe length, washing
temperature. and salt
concentration. In general, longer probes require higher temperatures for
proper annealing, while shorter probes
need lower temperatures. Hybridization generally depends on the ability of
denatured DNA to reanneal when
complementary strands are present in an environment below their melting
temperature. The higher the degree
of desired homology between the probe and hybridizable sequence, the higher
the relative temperature which
can be used. As a result, it follows that higher relative temperatures would
tend to make the reaction
I S conditions more stnneent. while lower temperatures less so. For additional
details and explanation of
stringency of hybridization reactions, see Ausubel et ul.. Current Protocols
in .~Llolect~lar Biology, Wiley
Intersctcnce Publishers. ( 1995).
"Stringent conditions" or "high stringency conditions." as defined herein, may
be identified by those
that: ( 1 ) employ low ionic strength and high temperature for washing, for
example 0.015 M sodium
chloride,~0.0015 M sodium citrate/0.1% sodium dodecyi sulfate at ~0°C;
(2) employ during hybridization a
denaturing agent, such as fotmamide, for example, 50°,0 (viv) formamide
with 0.1°,% bovine serum
albumirv0.l% Ficoll/0.1°.o polyvinylpyrrolidone/50 mM sodium phosphate
buffer at pH 6.5 with 750 mM
sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ
50°,o formamide, 5 x SSC (0.75 M NaCI. 0.075
M sodium citrate). 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate,
5 x Denhardt's solution.
sonicated salmon sperm DNA (SO ltgiml). 0.1°o SDS, and 10°,~
dextran sulfate at 42°C, with washes at 42°C in
0.2 x SSC (sodium chlorideisodium citrate) and ~0°,o fotmamide at
»°C, followed bv_ a hieh-strineencv_ wash
consisting of 0.1 x SSC containing EDTA at ~5°C.
"Moderately stringent conditions" may be identified as described by Sambrook
et al., Molecular
Cloning: A Laboraton~ Manual. New York: Cold Spring Harbor Press, 1989, and
include the use of washing
solution and hybridization conditions (e.s., temperature, ionic strength and
%SDS) less stringent that those
described above. An example of moderately stringent conditions is overnight
incubation at 37°C in a solution
comprising: 20% formamide. ~ x SSC ( 150 mM NaCI, 15 mM trisodium citrate), 50
mM sodium phosphate
(pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 Itg/mL
denatured sheared salmon sperm DNA,
followed by washing the filters in 1 x SSC at about 37-50°C. The
skilled artisan will recognize how to adjust
the temperature. ionic strength, etc., as necessary to accommodate factors
such as probe length and the like.
"Antibodies" (Abs) and "immunoglobulins" (Igs) are glycoproteins having the
same general structural
characteristics. While antibodies exhibit binding specificity to a specific
antigen, immtmoglobulins include
both antibodies and other antibody-like molecules which lack antigen
specificity. Polypeptides of the latter
kind are, for example, produced at low levels by the lymph system and at
increased levels by myelomas. The
term "antibody" is used in the broadest sense and specifically covers, without
limitation, intact monoclonal
21
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00105841
antibodies (including agonist, antagonist and neutralizing antibodies),
polyclonal antibodies, multispecific
antibodies (e.g., bispecific antibodies) formed from at least two intact
antibodies, single chain antibodies
binding the epitopes specific to the PRO polypeptide and antibody fragments so
long as they exhibit the desired
biological activity. An anti-PR0200, anti-PR0204, anti-PR0212, anti-PR0216,
anti-PR0226, anti-PR0240,
anti-PR0235, anti-PR0245, anti-PR0172. anti-PR0273, anti-PR0272, anti-PR0332.
anti-PR0526, anti-
PR0701, anti-PR0361, anti-PR0362, anti-PR0363. anti-PR0364, anti-PR0356, anti-
PR0531, anti-PR0533,
anti-PROI083, anti-PR0865, anti-PR0770. anti-PR0769, anti-PR0788, anti-
PR01114, anti-PR01007. anti-
PR01184, anti-PR01031, anti-PR01346, anti-PR01155, anti-PR01250, anti-PR01312,
anti-PR01192. anti-
PR012-l6, anti-PR01283, anti-PR01195, anti-PR01343, anti-PR01418, anti-
PR01387. anti-PR01410, anti-
PR01917, anti=PR01868, anti-PR0205, anti-PR021. anti-PR0269, anti-PR0344, anti-
PR0333, anti-PR0381,
anti-PR0720, anti-PR0866, anti-PR0840, anti-PR0982. anti-PR0836, anti-PR01159,
anti-PR01358, anti-
PR01325, anti-PR01338, anti-PR0143.~. anti-PR04333, anti-PR04302, anti-PR04430
or anti-PR05727
antibody is an antibody which immunologically binds to a PR0200. PR0204.
PR0212, PR0216. PR0226,
PR0240. PR0235. PR0245, PR0172, PR0273. PR0272. PR0332, PR0526, PR0701,
PR0361. PR0362.
PR0363. PR036-1. PR0356. PR0531, PR0533, PROIOg_>. PR0865. PR0770. PR0769,
PR0788, PRO11 l~i.
PROlU07. PROI 18-~. fR01031, PR013=16. PR01155, PR01250. PR01312. PR01192.
PR012-16. PR01283,
PR01195. PR01343, PR01418. PR01387, PR01410, PR01917, PR01868, PR0205. PR021.
PR0269.
PR034.1, PR0333, PR0381, PR0720. PR0866, PR0840, PR0982. PR0836. PR01159.
PR01358, fR01325.
PR01338, PR01434, PR04333, PR04302. PR04430 or PR05727, respectively,
polypeptide. The antibody
may bind to any domain of the PRO polypeptide which may be contacted by the
antibody. For example, the
antibody may bind to any extracellular domain of the polypeptide and when the
entire polypeptide is secreted.
to any domain on the polypeptide which is available to the antibody for
binding.
"Native antibodies" and "native immunoglobulins" are usually heterotetrameric
glycoproteins of about
150,000 daltons. composed of two identical light (L) chains and two identical
heavy (H) chains. Each light
chain is linked to a heave chain by one covalent disulfide bond, while the
number of disulfide linl:aees varies
among the heave chains of different immunoelobulin isotopes. Each heave and
light chain alsohas'regularly
spaced incrachain disulfide bridges. Each heave chain has at one end a
variable domain ( V") followed by a
number of constant domains. Each light chain has a variable domain at one end
(V~) and a constant domain at
its other end: the constant domain of the light chain is aligned with the
first constant domain of the heavy
chain. and the light-chain variable domain is aligned with the variable domain
of the heavy chain. Particular
amino acid residues are believed to form an interface between the light- and
heavy-chain variable domains.
The term "variable" refers to the fact that certain portions of the variable
domains differ extensively in
sequence among antibodies and are used in the binding and specificity of each
particular antibody for its
particular antigen. However, the variability is not evenly distributed
throughout the variable domains of
antibodies. It is concentrated in three or four segments called
"complementarily-detetirtining regions" (CDRs)
or "hypervariable regions" in both in the light-chain and the heavy-chain
variable domains. The more highly
conserved portions of variable domains are called the framework (FR). The
variable domains of native heavy
and light chains each comprise four or five FR regions, largely adopting a (3-
sheet configuration, connected by
the CDRs, which form loops connecting, and in some cases forming part of, the
(i-sheet structure. The CDRs
in each chain are held together in close proximity by the FR regions and, with
the CDRs from the other chain.
22
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
contribute to the formation of the antigen-binding site of antibodies see
Kabat et al.. NIH Publ. No.91-3242,
Vol. I, pages 647-669 ( I 991 )). There are at least two techniques for
determining the extent of the CDRs: ( 1 )
An approach based on the extent of cross-species sequence variability (i.e..
Kabat et al., Sequences of Proteins
of Immunological Interest (National Institute of Health, Bethesda. MD); and
(2) an approach based on
crystallographic studies of antigen-antibody complexes (Chothia, C. et al.,
(1989), Nature _342: 877).
Moreover, CDR's can also be defined using a hybrid approach incorporating the
residues identified by both of
the previous techniques. The constant domains are not involved directly in
binding an antibody to an antigen,
but exhibit various effector functions, such as participation of the antibody
in antibody-dependent cellular
toxicity.
"Antibody fragments" comprise a portion of an intact antibody, preferably the
antigen binding or
variable region of the intact antibody. Examples of antibody fragments include
Fab. Fab', F(ab'),, and Fv
fragments: diabodies: linear antibodies (Zapata et al., Protein Eng. _8
((0):1057-1062 [1995]); single-chain
antibody molecules: and multispecific antibodies formed from antibody
fragments.
Papain digestion of antibodies produces two identical antigen- binding
ti~agments, called "Fab"
I S t~agments, each with a single antigen-binding site. and a residual "Fc"
fragment, whose name ret7ects its ability
to crystallize readily. Pepsin treatment gelds an (=(ab')~ fragment that has
two antigen-combining sites and is
still capable of cross-linking antigen.
"Fv" is the minimum antibody fragment which contains a complete antigen-
recognition and binding
site. This region consists of a dimer of one heavy- and one light-chain
variable domain in tight. non-covalent
association. It is in this configuration that the three CDRs of each variable
domain interact to define an
antigen-binding site on the surface of the VH-VL dimer. Collectively, the six
CDRs confer antigen-binding
specificity to the antibody. However, even a single variable domain (or half
of an Fv comprising only three
CDRs specific for an antigen) has the ability to recognize and bind antigen,
although at a lower affinity than
the entire binding site.
The Fab fragment also contains the constant domain of the light chain and the
first constant domain
(CH1) of the heavy chain. Fab' fragments differ from Fab fragments by the
addition of a few residues at the
carboxy terminus of the heave chain CHl domain including one or more cysteines
from the antibody hinge
region. Fab'-SH is the designation herein for Fab' in which the cysteine
residues) of the constant domains bear
a free thiol group. F(ab')2 antibody fragments originally were produced as
pairs of Fab' fragments which have
hinge cysteines between them. Other chemical couplings of antibody fragments
are also known.
The "light chains" of antibodies (immunoglobulins) from any vertebrate species
can be assigned to
one of two clearly distinct types, called kappa (tc) and lambda (7~), based on
the amino acid sequences of their
constant domains.
Depending on the amino acid sequence of the constant domain of their heavy
chains,
immunoglobulins can be assigned to different classes. There are five major
classes of immunoglobulins: IgA,
IgD, IgE, IgG, and IgM, and several of these may be further divided into
subclasses (isotypes), e.g., IgG 1,
IgG2, IgG3, IgG4, IgA, and IgA2. The heavy-chain constant domains that
correspond to the different classes
of immunoglobulins are called a, b, e, y, and p, respectively. The subunit
structures and three-dimensional
configurations of different classes of immunoglobulins are well known.
23
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PC1'/US00/05841
The term "monoclonal antibody" as used herein refers to an antibody obtained
from a population of
substantially homogeneous antibodies, i.e., the individual antibodies
comprising the population are identical
except for possible naturally occurring mutations that may be present in minor
amounts. Monoclonal
antibodies are highly specific, being directed against a single antigenic
site. Furthermore, in contrast to
conventional (polyclonal) antibody preparations which typically include
different antibodies directed against
different determinants (epitopes), each monoclonal antibody is directed
against a single determinant on the
antigen. In addition to their specificity, the monoclonal antibodies are
advantageous in that they are
synthesized by the hybridoma culture, uncontaminated by other immunoglobulins.
The modifier "monoclonal"
indicates the character of the antibody as being obtained from a substantially
homogeneous population of
antibodies, and is not to be construed as requiring production of the antibody
by any particular method. For
example, the monoclonal antibodies to be used in accordance with the present
invention may be made by the
hybridoma method first described by Kohler et al., Nature, _256: 495 [1975],
or may be made by recombinant
DNA methods (see, e.g., U.S. Patent No. 4,816,567). The "monoclonal
antibodies" may also be isolated from
phage antibody libraries using the techniques described in Clackson et ul..
Nature, _352:624-628 [1991] and
Marks et ul.. J. afol. Binl.. 22?:581-597 (1991), for example. See also U.S
Patent Nos. 5.750,373, 5,571.698,
5.403,484 and 5.223,409 which describe the preparation of antibodies using
phagemid and phage vectors.
The monoclonal antibodies herein specifically include "chimeric" antibodies
(immunoglobulins) in
which a portion of the heavy and/or tight chain is identical with or
homologous to corresponding sequences in
antibodies derived from a particular species or belonging to a particular
antibody class or subclass. while the
remainder of the chains) is identical with or homologous to corresponding
sequences in antibodies derived
from another species or belonging to another antibody class or subclass, as
well as fragments of such
antibodies, so long as they exhibit the desired biological activity (U.S.
Patent No. 4,816,567; Motrison et al.,
Proc. Natl. Acad. Sci. L'S-l, 81:6851-6855 (1984)).
"Humanized" forms of non-human (e~.y., murine) antibodies are chimeric
immunoelobulins.
immunoglobulin chains or Icagments thereof (such as Fv, Fab, Fab'. Flab'h or
other antieen-bindine
subsequences of antibodiest which contain minimal sequence derived from non-
human immunoeiobulin. For
the most pan. humanized antibodies are human immunoglobulins (recipient
antibody) in which residues from a
complementatzry-determining region (CDR) of the recipient are replaced by
residues from a CDR of a non-
human species (donor antibody) such as mouse, rat or rabbit having the desired
specificity, affinity, and
capacity. In some instances. Fv framework region (FR) residues of the human
immunoglobulin are replaced by
corresponding non-human residues. Furthermore, humanized antibodies may
comprise residues which are
found neither in the recipient antibody nor in the imported CDR or framework
sequences. These modifications
are made to further refine and maximize antibody perfotirtance. In general,
the humanized antibody will
comprise substantially all of at least one. and typically two, variable
domains, in which all or substantially all
of the CDR regions correspond to those of a non-human immunoglobulin and all
or substantially all of the FR
regions are those of a human immunoglobulin sequence. The humanized antibody
optimally also will
comprise at least a portion of an immunogiobulin constant region (Fc),
typically that of a human
immunoglobulin. For further details, see Jones et al., Nature, _321:522-525
(1986); Reichmann et al., Nature,
332:323-329 [1988]; and Presta, Curr. Op. Strttct. Biol., _2:593-596 (1992).
The humanized antibody includes a
"primatized"antibody where the antigen-binding region of the antibody is
derived from an antibody produced
24
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/0584t
by immunizing macaque monkeys with the antigen of interest. Antibodies
containing residues from Old World
monkeys are also possible within the invention. See, for example, U.S. Patent
Nos. 5,658,570; 5,693,780;
5,681,722; 5,750,105; and 5,756,096.
Antibodies and fragments thereof in this invention also include "affinity
matured" antibodies in which
an antibody is altered to change the amino acid sequence of one or more of the
CDR regions and/or the
framework regions to alter the affinity of the antibody or fragment thereof
for the antigen to which it binds.
Affinity maturation may result in an increase or in a decrease in the affmitv
of the matured antibody for the
antigen relative to the starting antibody. Typically, the starting antibody
will be a humanized, human. chimeric
or murine antibody and the affinity matured antibody will have a higher
affinity than the starting antibody.
During the maturation process. one or more of the amino acid residues in the
CDRs or in the framework
regions are changed to a different residue using any standard method. Suitable
methods include point
mutations using well known cassette mutagenesis methods (Wells et al., 1985.
Gene _34:315) or oligonucleotide
mediated mutagenesis methods (Zoller et al., 1987, Nucleic Acids Res. _10:6487-
6504). Affinity maturation
may also be perfotitted using known selection methods in which many mutations
are produced and mutants
having the desired affinity are selected from a pool or library of mutants
based on improved affinity for the
antigen or ligand. Known phage display techniques can be conveniently used in
this approach. See. for
example, U.S. 5,750,373; U.S. 5,223,409, erc.
Human antibodies are also with in the scope of the antibodies of the
invention. Human antibodies can
be produced using various techniques known in the art, including phage display
libraries [Hoogenboom and
Winter. J. ;Llol. Biol., 227:381 ( 1991 ); Marks et ul., J. ~'llol. Biol.,
_222:581 ( 1991 )]. The techniques of Cole et
al. and Boerner et al. are also available for the preparation of human
monoclonal antibodies (Cole et al.,
Monoclonal Antibodies and Cuncer Therapy, Alan R. Liss. p. 77 ( 1985); Boerner
et al., J. Immurrol., _147
x:86-95 (1991); U. S. 5,750, 373]. Similarly, human antibodies can be made by
introducing of human
immunoelobulin loci into transgenic animals, ~.g., mice in which the
endogenous immunoglobulin genes have
been partially or completely inactivated. Upon challenge, human antibody
production is obsen~ed. which
closely resembles that seen in humans in all respects. including gene
rearrangement, assembly, and antibody
repertoire. This approach is described. for example, in U.S. Patent Nos.
5,45,807; 5.545,806; J,J69,825:
5,625,126; 5,633,425; 5,661,016, and in the following scientific publications:
Marks et al., BiolTcclrnologv _10.
779-783 (1992); Lonberg et al.. Nature 368 856-859 (1994); Morrison, Nature
_368, 812-13 (1994); Fishwild
et al., Nature Biotechnolo~~ 14, 845-51 ( 1996); Neuberger, tVature
Biotechnology _14, 826 ( 1996): Lonberg and
Huszar. Intern. Rev. Immunol. 13 65-93 ( 1995).
"Single-chain Fv" or "sFv" antibody fragments comprise the VH and V~ domains
of antibody, wherein
these domains are present in a single polypeptide chain. Preferably, the Fv
polypeptide further comprises a
polypeptide linker between the VH and VL domains which enables the sFv to form
the desired structure for
antigen binding. For a review of sFv see Pluckthun in The Pharmacology
ojMonoclonal Antibodies, vol. 113,
Rosenburg and Moore gds., Springer-Verlag, New York, pp. 269-315 ( 1994).
The term "diabodies" refers to small antibody fragments with two antigen-
binding sites, which
fragments comprise a heavy-chain variable domain (VH) connected to a light-
chain variable domain (VL) in
the same polypeptide chain (VH - VL). By using a linker that is too short to
allow pairing between the two
domains on the same chain, the domains are forced to pair with the
complementary domains of another chain
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTNS00/05841
and create two antigen-binding sites. Diabodies are described more fully in.
for example, EP 404.097: WO
93/11161: and Hollinger er al.. Proc. Natl. Acad. Sci. USA, 90:6444-6448 (
1993).
The word "label" when used herein refers to a detectable compound or
composition which is
conjugated directly or indirectly to the compound, c.g., antibody or
polypeptide, so as to generate a "labelled"
compound. The label may be detectable by itself (e.g., radioisotope labels or
fluorescent labels) or, in the case
of an enzymatic label, may catalyze chemical alteration of a substrate
compound or composition which is
detectable.
By "solid phase" is meant a non-aqueous matrix to which the compound of the
present invention can
adhere. Examples of solid phases encompassed herein include those formed
partially or entirely of Mass (e.g.,
controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides,
polystyrene, polyvinyl alcohol and
silicones. In certain embodiments, depending on the context. the solid phase
can comprise the well of an assay
plate: in others it is a purification column (e.g., an affinity chromatography
column). This term also includes a
discontinuous solid phase of discrete particles, such as those described in
U.S. Patent No. 4.275.149.
The term "immune related disease" means a disease in which a component of the
immune system of a
1 ~ mammal causes, mediates or otherwise contributes to a morbidity in the
mammal. Also included are diseases
in which stimulation or inten~ention of the immune response has an
ameliorative effect on progression of the
disease. Included within this term are immune-mediated inflammatory diseases.
non-immune-mediated
inflammatory diseases, infectious diseases. immunodeficiency diseases,
neoplasia. etc.
The term "T cell mediated" disease means a disease in which T cells directly
or indirectly mediate or
otherwise contribute to a morbidity in a mammal. The T cell mediated disease
may be associated with cell
mediated effects, lymphokine mediated effects, etc., and even effects
associated with'B cells if the B cells are
stimulated. for example, by the lymphokines secreted by T cells.
Examples of immune-related and inflammatory diseases, some of which are immune
or T cell
mediated, which can be treated according to the invention include systemic
lupus erythematosis, rheumatoid
arthritis. juvenile chronic arthritis, spondyloarthropathies, systemic
sclerosis Iscleroderma). idiopathic
inflammaton~ myopathies ldermatomyositis. polymyositis), Sjogren's syndrome,
systemic vasculitis,
sarcoidosis, autoimmune hemolytic anemia t immune pancvtopenia, paroxysmal
nocturnal hemoglobinuria),
autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura. immune-
mediated thrombocytopenia),
thyroiditis (Grave's disease, Hashimoto's thyroiditis, juvenile lymphocytic
thyroiditis, atrophic thyroiditis),
diabetes mellitus. immune-mediated renal disease (glomerulonephritis,
tubulointerstitial nephritis),
demyelinating diseases of the central and peripheral nervous systems such as
multiple sclerosis, idiopathic
demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic
inflammatory demyelinating
polyneuropathy, hepatobiliary diseases such as infectious hepatitis (hepatitis
A, B, C, D, E and other non-
hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary
cirrhosis, granulomatous hepatitis.
and sclerosing cholangitis, inflammatory bowel disease (ulcerative colitis:
Crohn's disease), gluten-sensitive
enteropathy, and Whipple's disease, autoimmune or immune-mediated skin
diseases including bullous skin
diseases, erythema multiforme and contact dermatitis, psoriasis, allergic
diseases such as asthma, allergic
rhinitis, atopic dermatitis, food hypersensitivity and urticaria, immunologic
diseases of the lung such as
eosinophiIic pnetunonias, idiopathic pulmonary fibrosis and hypersensitivity
pnetunonitis, transplantation
associated diseases including graft rejection and graft -versus-host-disease.
Infectious diseases including viral
26
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
diseases such as AIDS (HIV infection). hepatitis A. B, C, D, and E, herpes.
etc., bacterial infections, fungal
infections, protozoal infections and parasitic infections.
"Treatment" is an intervention performed with the intention of preventing the
development or altering
the pathology of a disorder. Accordingly, "treatment" refers to both
therapeutic treatment and prophylactic or
preventative measures. Those in need of treatment include those already with
the disorder as well as those in
which the disorder is to be prevented. In treatment of an immune related
disease. a therapeutic agent may
directly decrease or increase the magnitude of response of a component of the
immune response, or render the
disease more susceptible to treatment by other therapeutic agents, e.g.,
antibiotics. antifungals, anti-
inflammatory agents, chemotherapeutics. etc.
The term "effective amount" is at least the minimum concentration or amount of
a PRO polypeptide
and/or agonisvantagonist which causes, induces or results in either a
detectable improvement in a component
of the immune response in mammals as measured in an in vitro assay. For
example, an increase or decrease in
the proliferation of T-cells and/or vascular permeability as measured in
Examples provided herein.
Furthermore, a "therapeutically effective amount" is the minimum concentration
or amount of a PRO
polypeptide and/or aeonisvantaeonist which would be effective in at least
attenuating a patholoey f increasing
or decreasing as the case may bc) a component of the immune response in
mammals, the results of which
effects a treatment as defined in the previous paragraph.
"Chronic" administration refers to administration of the agents) in a
continuous mode as opposed to
an acute mode. so as to maintain the initial therapeutic effect (activity) for
an extended period of time.
"Intermittent" administration is treatment that is not consecutively done
without interruption. but rather is
cyclic in nature.
The "pathology" of an immune related disease includes all phenomena that
compromise the well-
being of the patient. This includes, without limitation, abnormal or
uncontrollable cell growth. antibody
production. auto-antibody production. complement production and activation,
interference with the norntal
functionine of neighborins cells. release of cytokines or other secretory
products at abnormal levels.
suppression or aggravation of anv intlammatorv or immunoloeical response.
infiltration of inflammaton- cells
(neutrophilic. eosinophilic. monocytic, lymphocync) into tissue spaces, etc.
"Mammal" for purposes of treatment refers to any animal classified as a
mammal. including humans.
domestic and farm animals, and zoo, sports, or pet animals, such as dogs,
horses, cattle. pigs, apes. hamsters,
ferrets, cats, etc. Preferably, the mammal is human.
Administration "in combination with" one or more further therapeutic agents
includes simultaneous
(concurrent) and consecutive administration in any order.
"Carriers" as used herein include phamttaceutically acceptable carriers,
excipients, or stabilizers which
are nontoxic to the cell or mammal being exposed thereto at the dosages and
concentrations employed. Often
the physiologically acceptable carrier is an aqueous pH buffered solution.
Examples of physiologically
acceptable carriers include buffers such as phosphate, citrate, and other
organic acids; antioxidants including
ascorbic acid; low molecular weight (less than about 10 residues) polypeptide;
proteins, such as serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpytrolidone; amino acids such as
glycine, gIutamine, asparagine, arginine or lysine; monosaccharides,
disaccharides, and other carbohydrates
including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar
alcohols such as mannitol or
27
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
sorbitol; salt-forming counterions such as sodium; andior nonionic surfactants
such as TWEENTM,
polyethylene glycol (PEG), and PLURONICSTM.
The term "cvtotoxic agent" as used herein refers to a substance that inhibits
or prevents the function of
cells and/or causes destruction of cells. The term is intended to include
radioactive isotopes (e.g., It't, It2s, Yeo
and Re~BG), chemotherapeutic agents, and toxins such as enzymatically active
toxins of bacterial. fungal, plant
or animal origin, or fragments thereof.
A "chemotherapeutic agent" is a chemical compound useful in the treatment of
cancer. Examples of
chemotherapeutic agents include adriamycin, doxorubicin. epirubicin. 5-
fluorouracil, cytosine arabinoside
("Ara-C"), cyclophosphamide. thiotepa, busulfan, cytoxin. taxoids. e.g..
paclitaxel (Taxol. Bristol-Myers
Squibb Oncology, Princeton. NJ), and doxetaxel (Taxotere. Rhone-Poulenc Rorer,
Antony. France), toxotere.
methotrexate, cisplatin, melphalan. vinblastine, bleomycin. etoposide,
ifosfamide, mitomycin C. mitoxantrone.
vincristine, vinorelbine, carboplatin, teniposide. daunomycin. carminomycin,
aminopterin. dactinomycin,
mitomycins, esperamicins (see U.S. Pat. No. 4,675,187), melphalan and other
related nitrogen mustards. Also
included in this definition are hormonal agents that act to reculate or
inhibit hormone action on tumors such as
tamoxifen and onapristone.
A "growh inhibitory agent" when used herein refer to a compound or composition
which inhibits
growth of a cell. especially cancer cell overexpressing any of the genes
identified herein. either in airrn or in
viuo. Thus, the growth inhibitory agent is one which significantly reduces the
percentage of cells
overexpressing such genes in S phase. Examples of growth inhibitory agents
include agents that block cell
cycle progression (at a place other than S phase), such as agents that induce
G1 arrest and M-phase arrest.
Classical M-phase blockers include the vincas (vincristine and vinblastine),
taxol, and topo II inhibitors such as
doxorubicin, epirubicin, daunorubicin. etoposide, and bleomycin. Those agents
that arrest G i also spill over
into S-phase arrest, for example, DNA aikylating agents such as tamoxifen,
prednisone, dacarbazine.
mechlorethamine, cisplatin. methotrexate, 5-fluorouracil, and ara-C. Further
information can be found in The
;tlolecular Basis o/ Cancer, Mendelsohn and Israel. gds., Chapter 1, entitled
"Cell cycle reculation. oncogens,
and antineoplastic drugs" by Murakami ur crl. (WB Saunders: Philadelphia.
1995), especially p. 13.
The term "cytokine" is a generic term for proteins released by one cell
population which act on
another cell as intercellular mediators. Examples of such cytokines are
lymphokines, monokines, and
traditional polypeptide hormones. Included among the cvtokines are growth
hormone such as human growth
hormone, N-methionyl human growth hormone, and bovine growth hormone:
parathyroid hormone; thyroxine:
insulut; proinsuIin; relaxin; prorelaxin: glycoprotein hormones such as
follicle stimulating hormone (FSH),
thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic
growth factor; fibroblast growth
factor: prolactin; placental lactogen; tumor necrosis factor-a and -~3;
mullerian-inhibiting substance: mouse
gonadotropin-associated peptide; inhibin: activin; vascular endothelial growth
factor; integrirt; thrombopoietin
(TPO); nerve growth factors such as NGF-p; platelet-growth factor;
transforming growth factors (TGFs) such
as TGF-a and TGF- (3; insulin-like growth factor-I and -II; erythropoietin
(EPO); osteoinductive factors;
interferons such as interferon- a, -Vii, and -y; colony stimulating factors
(CSFs) such as macrophage-CSF (M-
CSF); granulocvte-macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF);
interleukins (ILs) such as IL-
1, IL-la, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12; a
tumor necrosis factor such as TNP-a or
TNF-p; and other polypeptide factors including LIF and kit ligand (KL). As
used herein. the term cytokine
28
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
includes proteins from natural sources or from recombinant cell culture arid
biologically active equivalents of
the native sequence cytokines.
The term "epitope tagged" when used herein refers to a chimeric polypeptide
comprising a PRO
polypeptide fused to a "tag polypeptide". The tag polypeptide has enough
residues to provide an epitope
against which an antibody can be made, yet is short enough such that it does
not interfere with activity of the
polypeptide to which it is fused. The tag polypeptide preferably also is
fairly unique so that the antibody does
not substantially cross-react with other epitopes. Suitable tag polypeptides
generally have at least six amino
acid residues and usually between about 8 and 50 amino acid residues
(preferably, between about 10 and 20
amino acid residues).
"Active° or "activity" in the context of variants of the PRO
polypeptide refers to forms) of proteins of
the invention which retain the biologic and/or the ability to induce the
production of an antibody against an
antigenic epitope possessed by the PRO polypeptide. More specifically,
"biological activity" refers to a
biological function (either inhibitory or stimulatory) caused by a native
sequence or naturally-occurring PRO
polypeptide. Even more specifically, "biological activity" in the context of
an antibody or another molecule
IS that can be identified by the screening assays disclosed herein Ic~.g., an
organic or inorganic small molecule.
peptide, mc.l can be the ability of such molecules to induce or inhibit
infiltration of inflammaton~ cells into a
tissue, to stimulate or inhibit T-cell proliferation or activation. to
stimulate or inhibit cytokine release by cells
or to increase or decrease vascular permeability. Another specific biological
activity is the increased vascular
permeability or the inhibition thereof.
The term "antagonist" is used in the broadest sense, and includes any molecule
that partially or fully
blocks, inhibits. or neutralizes a biological activity of a native sequence
PRO polypeptide disclosed herein. In
a similar manner, the term "agonist" is used in the broadest sense and
includes anv molecule that mimics or
amplifies a biological activity of a native sequence PRO polypeptide disclosed
herein. Suitable agonist or
antagonist molecules specifically include agonist or antagonist antibodies or
antibody fragments. fragments or
amino acid sequence variants of native PRO polypeptides, peptides, small
organic molecules. etc. Methods for
identifying agonists or antagonists of a PRO polypeptide may comprise
contacting a PRO polvpeptide with a
candidate aeonist or antagonist molecule and measuring a detectable change in
one or more biological
activities normally associated with the same.
A "small molecule" is defined herein to have a molecular weight below about
600 daltons, and is
generally an organic compound.
A "liposome" is a small vesicle composed of various types of lipids,
phospholipids and/or surfactant
which is useful for delivery of a drug (optionally including a
chemotherapeutic agent) to a mammal. The
components of the liposome are commonly arranged in a bilayer formation,
similar to the lipid arrangement of
biological membranes.
As used herein, the term "immunoadhesin" designates antibody-like molecules
which combine the
binding specificity of a heterologous protein (an "adhesin") with the effector
functions of immunoglobulin
constant domains. Structurally, the immunoadhesins comprise a fusion of an
amino acid sequence with the
desired binding specificity which is other than the antigen recognition and
binding site of an antibody (i.e., is
"heterologous"), and an immunoglobulin constant domain sequence. The adhesin
part of an immunoadhesin
molecule typically is a contiguous amino acid sequence comprising at least the
binding site of a receptor or a
29
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
ligand. The immunoglobulin constant domain sequence in the immunoadhesin may
be obtained from any
immunoglobulin, such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including
IgA-1 and IgA-2), IgE, IgD
or IgM.
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 1
/*
*
C-C
increased
from
12
to
15
S *
Z
is
average
of
EQ
*
B
is
average
of
ND
* h with stop is M: stop-stop = 0: J (joker) match
matc = 0
*/
Ndefine_M -8 /* value of a match with a stop */
int _day[26][26] _ {
/* A B C D E F G H I J K L M N O P Q R S T U V W X
Y Z */
/* { 2, 0.-2. 0. 0.-4, l.-1,-1, 0.-I,-2.-1, O. M. 1,
A 0.-2, 1, I, 0, 0.-6. 0.-3. 0},
*/
/* { 0, 3.-4, 3. 2,-S, 0. 1.-2. 0. 0.-3,-2. 2. M.-1,
B 1. 0, 0, 0, 0.-2.-S. 0,-3, 1},
*/
/* {-2,-4;15,-S.-S.-4,-3.-3.-2. 0.-S,-6.-S.-4, M.-3,-S.-4,
C 0,-2, 0,-2.-8. 0, 0,-S},
*/
/* { 0, 3,-S. 4, 3,-6, 1. 1,-2, 0, 0.-4.-3, 2, M,-1,
D 2.-1, 0. 0. 0.-2.-7, 0.-4, 2},
*/
/* { 0, 2,-S. 3. 4,-5. 0. 1.-2. 0, 0,-3.-2, I, M.-1.
E 2.-1. 0. 0, 0,-Z,-7, 0.-4. 3},
*/
/* {-4,-5.-4.-6.-S, 9,-5.-2. I. 0,-5. 2, 0.-4,_M.-5.-5,-4,-3.-3.
F 0,-1. 0. 0. 7.-S},
*/
/* { 1, 0,-3, I. 0,-5, S.-2.-3. 0.-2.-4,-3, O, M,-l.-1.-3,
G 1, 0, 0,-1,-7, 0,-5. 0},
*/
/* {-l, 1.-3. I, I.-2,-2. 6.-2, 0. 0.-2,-2. 2, M. 0.
H 3, 2,-1.-1. 0,-2,-3, 0. 0. 2}.
*/
/* {-1,-2.-2.-2.-2, l.-3,-2. S. 0.-2. 2. ~.-2. M.-2.-2,-2,-I.
I 0. 0. 4.-S. 0,-1.-2}.
*/
/* { 0. 0, 0. 0. 0. 0. 0. 0. 0, 0. 0, 0. 0. 0. M. 0.
J 0. 0. 0, 0. 0. 0. 0. 0. 0. 0},
*1
/* {-1. 0.-5. 0. 0.-S.-?. 0.-2. 0, S.-3. 0. 1 M.-1.
K I. 3. 0, 0, 0.-2,-3. 0.-4, 0}.
*/
~* {-2,-3.-6,-.l,-3. 2.-4.-2. 2, 0.-3. 6. .i.-3, M.-3.-2.-3.-3,-1.
L 0. ~.-Z. 0.-l.-2}.
*%
/* {-I.-2.-S,-3.-2Ø-3.-2. 2. 0Ø 4, 6,-2. ,M.-2.-I.
M 0.-2.-1. 0. 2.-.S. 0,-2.-I}.
*1
/* { 0. 2.--1. ~. l.-4. 0. 2.-2. 0. l.-3.-2. 2._:vL-I.
N 1. 0. 1. 0. 0.-2.--t. 0.-2. 1}.
*/
/* {_M. M. M. M. D1. M. M. M. M. M. M. 14. M. M. 0.
O M. M. M. M. M. M.
*/ .'vt.
M._M,
M}.
M.
/* _
P _
*/ _
_
{ 1,-l,-3.-1.-1.-S.-1, 0.-2. 0.-l.-3.-2,-1. M. 6.
0. 0, 1, 0, 0.-1.-6. 0,-5. 0},
/* { 0. I,-S. 2. 2,-S.-1. 3,-2, 0, I.-2,-I, 1. M. 0,
Q 4. I,-1.-I. 0.-Z,-S. 0.-4. 3}.
*/
/* {-2. 0.-4,-l.-1.-4,-3. 2,-2, 0. 3,-3. 0. O, M. 0.
R 1. 6, 0.-1, 0.-2. 2. 0.-4, 0}.
*/
/* { 1, 0. 0. 0. 0,-3, 1.-1.-I, 0. 0,-3,-2, l._M. 1.-1.
S 0. 2, 1, 0,-1,-2. 0,-3. 0},
*/
/* { l, 0,-2. 0. 0,-3. 0,-1, 0. 0, 0.-1.-1, 0, M, 0.-1,-1.
T 1, 3, 0. 0,-5. 0.-3. 0},
*/
/* { 0, 0. 0. 0. 0. 0. 0, 0. 0. 0. 0, 0, 0. O. M. 0.
U 0. 0. 0. 0. 0, 0, 0, 0. 0, 0},
*/
/* { 0.-2,-Z.-2.-2.-1,-1.-2, 4. 0,-2. 2. ~.-2 M,-1.-2.-2,-1,
V 0, 0, 4.-6. 0,-2,-2},
*/
3S /* {-6,-5.-8.-7,-7, 0.-7,-3.-S, 0.-3.-2.--1,-4, M,-6,-S.
W Z,-2.-5. 0.-6,17. 0, 0,-6},
*/
/* { 0. 0. 0. 0. 0, 0. 0. 0. 0. 0, 0, 0. 0. 0. M. 0.
X 0. 0. 0. 0, 0, 0, 0. 0, 0. 0},
*/
/* {-3.-3. 0.-~i.-4. 7,-S, 0.-1. 0.-4,-I.-2.-2, M.-S.-4.--i.-3.-3.
Y 0.-2. 0. 0.10.-4}.
*/
/* { 0. 1.-S, 2. 3,-S. 0. 2.-2, 0. 0.-2,-1. l, M. 0.
Z 3. 0. 0. 0. 0.-2,-6. 0,-4. 4}
*/ _
}.
4S
SO
Page 1 of day.h
31
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 1 (cony)
/*
*/
Ninclude h>
<stdio.
.. Ninclude .h >
<
ctype
lJdefineMAXJMP ; * max jumps in a diag
16 */
lfdefineMAXGAP 24 /* don't continue to penalize
gaps larger than this */
IldetineJi~IPS1024 * max jmps in an path */
xdefineMX 4 /* save if there's at least
MX-1 bases since last jmp
*/
tldefineDMAT3 /* value of matchine bases
*/
NdefineDMIS0 /* penalty for mismatched
bases */
NdefineDINSO8 /* penalty for a gap */
lJdefineDINS11 /* penalty per base */
NdefinePINSO8 /* penalty for a gap */
NdefinePINS14 /* penalty per residue */
struct
jmp
{
shortn(MAXJMP);
; * size
of jmp
(neg for
dely) */
unsigned
short
x[MAXJMP):
'*
base
no.
of
jmp
in
seq
x
*1
}v /* limits seq to 2' 16 -1
*/
stntctne
di {
int score; /* score at last jmp *!
longoffset: /* offset of prey block
*/
shortijmp; /* current jmp index */
struct /* list of jmps */
jmp
Jp:
}:
struct
path
{
int spc; /* number of leading spaces
*/
shortn(1MPS):/* jmp (gap) */
size of
int x[JMPS): mp (last elem before gap)
/* loc *1
of j
};
char *ofile; /* output file name */
char *namex[2): /* seq names: getseqs()
*/
char *prog: /* prog name for err msgs
*/
-t0char *seqx(2); i* seqs: getseqsi J */
int dmax: ; * best diag: nwl ) */
int dmax0: /* final disk *!
int dna; /* set if dna: main() */
int endgaps; /* set if penalizing end
gaps */
u~t gapx, gapy;/* total gaps in seqs */
int len0, lenl;/* seq lens */
int ngapx, ngapy;/* total size of gaps */
int stnax; /* max score: nw() *1
int *xbm: /* bitmap for matching */
long offset; /* current offset in jmp
file */
structdiag*dx; /* holds diagonals */
structpathpp[2J; /* holds path for seqs *l
char *calloc(). *index(), *strcpyp;
*malloc(),
char *getseq(), );
*g calloc(
32
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
Table 1 (cony)
I* Needleman-Wunsch alignment program
* usage: props file 1 filet
* where tllel and tile2 are two dna or two protein sequences.
* The sequences can be in upper- or lower-case an may contain ambiguity
* Any lines beginning with '; , ' > ' or ' < ' are ignored
* Max file length is 65535 (limited by unsigned short x in the jmp struct)
* A sequence with 1/3 or more of its elements ACGTU is assumed to he DNA
* Output is in the file "align.out"
*
* The program may create a tmp file in /tmp to hold info about traceback.
* Original version developed under BSD 4.3 on a vax 8650
*1
f/inciude "nw.h"
Jtinclude "dav.h"
static ~bval[26] _ {
1,14,2.13,0Ø4,11,0.0,12,0,3,15.0,0,0,5.6.8.8.7,9Ø10,0
};
static ~~bval(26] _ {
1. 21(1 < <l'D'-'A'))~(1 < <l'N'-'A')). 4. 8. 16. 32. 64.
128. 256. OxFFFFFFF. l « 10. 1 « I 1. 1 « 12. 1 « l3, f « 14.
2S 1«l5, I«16. I«17, 1«l8, !«l9. f«20. 1«21. 1«32.
1 < <23. 1 < <24. l < <25~(1 < <('E'-'A'))I(1 < <('Q'-'A'))
};
main(ac. av)
main
int ac;
char *av(];
{
prop = av(O];
3S if (ac != 3) {
Cprintt(stderr."usage: ~~s filel filet\n", prop);
fprintf(stderr."where tilel and tile2 are two dna or two protein
sequences.\n");
fprintt(stderr. "The sequences can he in upper- or lower-case\n");
fprintt(stdcrr."Any lines beginning with ':' or ' <' are ignored\n");
fprintftstderr."Output is in the tile \"align.oun"',n");
exit( 1 );
}
namex(O] = av[ l ];
namex( I ] = av[2];
seqx[0] = getseq(namex(0], &len0);
seqx[ 1 ] = getseq(namex[ 1 ]. &lenl );
xbm = (dna)? dbval : pbval;
endgaps = 0; /* 1 to penalize endgaps */
ofile = "align.out"; /* output file */
nwU: /* fill in the matrix, get the possible jmps */
readjmpsp; /* get the actual jmps */
printQ; /* print scats, alignment */
cleanup(0): /* unlink any imp files */
33
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
Table I (coot')
/* do the alignment, return best score: main()
* dna: values in Filch and Smith. PNAS. 80. 1382-1386, 1983
* pro: PAM 250 values
* When scores are equal, we prefer mismatches to any gap, prefer
* a new gap to extending an ongoing gap, and prefer a gap in seqx
* to a gap in seq y.
*I
nw( )
nw
{
char *px. *py; /* seqs and ptrs */
*ndely, *dely; * keep track of dely */
int ndelx, deli; /* keep track of delx *I
mt *tmp: /* for swapping row0, cowl */
int mis; /* score for each type */
~t ins0, insl; /* insertion penalties */
register id: /* diagonal index */
register ij; I* jmp index *I
register *col0. *col l; ; * score for curr, last row */
register xx, yy; /* index into seqs */
dx = tstruct dice *)g calloct "to eel diaLS". LenO+lenl +l, sizeoftstruct
dice)):
ndely = ~ int *)g calloc( "to bet ndely", len I + I , sizeof(int ));
dely = tint ')g calloct "to get dely". lenl + l, sizeof(int)):
col0 = (int *)g c:alloc("to get col0", lenl +1, sizeof(int));
col l = f int *lg calloc("to get col l ", len l + 1, sizeof(int));
ins0 = (dual'? DINSO : PINSO:
insl = (dnal'? DINS1 : PINS1;
smax = -10000:
if (endgaps) {
for (col0(0] = dely[0] _ -ins0, yy = l; yy < = lenl; yy++) {
col0(YYl = dely[YYl = col0(YY-ll - insl:
ndely(YYl = YY:
col0[0] = 0; /* Watertnan Bull Math Biol 84 */
else
for (yy = t: yy < = lenl; yy++)
defy[yy] _ -ins0;
1* fill in match matrix
s/
for (px = seqx[0], xx = 1; xx < = IenO; px++, xx++) {
/* initialize first entry in col
*/
if (endgaps) {
if (xx = = 1 )
coil[0] = delx = -(ins0+insl);
else
coll(O] = delx = col0[0] - insl:
ndelx = xx;
else {
coll[O] = 0;
delx = -ins0;
ndelx = 0;
34
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 1 (coot')
...nw
for (py = seqx[1], yy = 1; yy < = lenl; py++, yy++) {
mis = col0(yy-1];
if (dna)
mis +_ (xbm[*px-'A']&xbm[*py-'A'])'? DMAT : DMIS:
else
mis += day[*px-'A'][*py-'A'J:
/* update penalty for del in x seq:
* favor new del over ongong del
* ignore MAXGAP if weighting endgaps
*/
if (endgaps ~ ~ ndely(yyJ < MAXGAP) {
if (col0[yyJ - ins0 > = dely(yy]) {
dely(yy] = col0[yy) - (ins0 + ins();
ndely[yy) = 1:
} else {
dely[yYl -= ins(:
ndely[yy)++;
}
} else {
if 1co10[yy] - (ins0+insl i > = dely[yYl) {
dely(YYI = colOlYYI - ~insU tins();
ndely[yy) = I;
} else
ndely[yyJ++:
}
/* update penalty for dcl in y seq;
* favor new del over ongong del
*/
if (endgaps J ~ ndelx < MAXGAP) {
if (coll(yy-I J - ins0 > = delx) {
delx = coll[yy-l ] - (ins0+insl);
ndelx = I:
} else {
delx -= ins(:
ndelx+ +
} '
} else {
if (col I[yy-I J - nins0+insl ) > = delx) {
delx = cull[yy-I] - (ins0+insl);
ndelx = 1;
} eLse
ndelx+ +
}
/* pick the maximum score: we're favoring
* mis over any del and deli over dely
*/
60
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
Table 1 (coot')
id=xx-yy+lenl-1;
...nw
if (mis > = delx && mis > = defy[yy])
coil
[yy] = mis;
else if (delx > = defy[yy]) {
coi l [yy] = delx;
ij = dx(id].ijmp:
if (dx(id].jp.n[0] && (!dna ~ ~ (ndelx > = MAXJMP
8c8c xx > dx[id].jp.x[ij]+MX) ~ ~ mis > dx[id].score+DINSO)) {
dx[id].ijmp++;
if (++ij > = MAXJMP) {
writejmps( id);
ij = dx[idJ.ijmp = 0:
dx[id].offset = offset:
offset + = sizeof(struct jmp) + sizeof(offset);
}
}
dx[id].jp.n[ij] = ndelx:
dx(idJ.jp.x(ijJ = xx;
dx[id).score = delx:
}
else {
coll(yy) = defy[yy]:
ij = dx(id].ijmp:
if (dx[idJ.jp.n[0] && (!dna ~ j (ndely(yYl > = 11AXJMP
&& xx > dx[id].jp.x[ijJ+MX) ~ ~ mis > dx(idJ.score+DINSO)) {
dx(id].ijmp++:
if (++ij > = MAXJMP) {
writejmpsl id);
ij = dx(idJ.ijmp = 0:
dx[id].offset = offset:
offset += sizeof(struct jmp) + sizeof(off'set):
}
}
dx(idJ.jp.n[ij] _ -ndely[yY):
dx[idJ.jp.x[ijJ = xx;
dx[id].score = defy[yy];
if (xx == IenO && yy < lent) {
/* fast cot
*r
if (endgaps)
coil[yy] -= ins0+insl*(lenl-yy);
if (coi l [yy] > smax) {
smax = coll(yy];
dmax = id;
}
}
if (endgaps && xx < IenO)
cull[yy-1] -= ins0+insl*(IenO-xx):
if (coil[yy-I] > smax) {
stnax = coil[yy-I];
dmax = id;
tmp = col0; col0 = coi l; cot l = tmp;
}
(void) free((char *)ndely);
(void) free((char *)dely);
(void) free((char *)col0);
(void) free((char *)coll);
}
nw.c
36
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00153758 PCT/US00105841
Table 1 (coot')
/*
* print() -- only routine visible outside this module
* static:
* getmat() -- trace back best path. count matches: print()
* pr align() -- print alignment of described in array p(]: print()
* dumpblock() -- dump a block of lines with numbers. stars: pr align()
* nums() _- put out a number line: dumpblock()
* putline() -- put out a line (name, [num]. seq. [num]): dumpblock()
* stars() - -put a line of stars: dumpblock()
* stripnamet ) -- strip any path and prefix from a seqname
*/
Itinctude "nw. h"
Ndefine SPC 3
#define P LINE 256 /* maximum output line */
Ndetine P SPC 3 /* space between name or num and seq */
extern day[26][26];
int oleo: /* set output line length *;
FILE *fx: /* output tile *!
print()
print
{
int Ix, ly, tirstgap, lastgap; !* overlap */
if ((fx = fopen(ofile. "w")) _ = p) {
fprintf(stderr,"°ls: can't write %s\n", prog, ofile):
cleanup(l);
fprintf(fx. " < first sequence: %s (length = od)\n", namex(O], len0):
fprintf(fx. " < second sequence: % s (length = od)\n", namex( 1 ], lenl );
oleo = 60;
Ix = IenO;
ly = lenl;
tirstgap = lastgap = 0:
if (dmax < lenl - 1) { !* leading gap in x *;
pp[0].spc = tirstgap = lenl - dmax - l;
IY _-_ PP(0l.sPc:
else if (dmax > lenl - t) { /* leading gap in y */
pp[I].spc = firstgap = dmax - (lenl - I);
Ix -= pp(1].spc;
if (dmax0 < len0 - 1) { /* trailing gap in x */
lastgap = IenO - dmax0 -1;
lx -= lastgap;
else if (dmax0 > len0 - 1) { /* trailing gap in y */
lastgap = dmax0 - (len0 - 1);
ly -= lastgap;
getmat(ix, ly, firstgap, lastgap);
pr alignQ;
37
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PC1'/US00/0584t
Table I (cony)
/*
* trace back the best path, count matches
*/
static
getmat(lx, ly, tirstgap, lastgap)
int Ix, ly; 1* "core" (minus endgaps) */
int 6rstgap, lastgap; /* leading trailing overlap */
{
int nm. i0, il, siz0, sizl:
char outx[32];
double pct;
register n0, nl;
register char *pp, *p 1;
/* get total matches, score
*/
i0=ii =siz0=sizl =0;
p0 = seqx[0] + pp[1].spc:
pl = seqx(1] + pp(0].spc;
n0 = pp[1].spc + I;
nl = pp[0].spc + l:
nm = 0:
while ( *p0 && *p i ) {
if (siz0) {
pl ++;
nl ++;
siz0--;
}
else if (sizi ) {
p0++;
n0++;
S1Z1--;
}
else {
if (xbm[ *p0-' A' ]&xbm[ *p 1-' A' ])
nm++;
if (n0++ _=pp[0].x[i0])
siz0 = pp[0].n(i0++];
if(nl+,- -= pp[1[.x(il])
sizl = pp(lJ.n[ii++];
p0++;
pl ++;
}
}
/* pct homology:
* if penalizing endgaps, base is the shorter seq
* else, !mock off overhangs and take shorter care
*/
if (endgaps)
Ix = (IenO < leni)'? IenO : lenl;
else
Ix = (ix < ly)? Ix : ly;
pct = 100.*(double)nmi(double)Ix;
fprintf(fx. "\n");
fprintf(fx, " < % d match% s in an overlap of % d: % .2f percent
similariryln",
ttm, (tun = = 1 )? "" . "es", lx, pct);
38
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
Table I (coot')
fprintf(fx, " < gaps in first sequence: %d", gapx/; ...getmat
if (gapx) {
(void) sprintf(outx. " (%d %s%sl",
ngapx, (dna)'? "base": "residue", (ngapx == 1 )'? "": "s"):
fprintf(fx."%s", outx);
fprintf(fx, ", gaps in second sequence: % d", gapyj;
if (gapY) {
(void) sprintf(outx, " ( od %s%s)",
ngapy. (dna)'? "base": "residue", (ngapy = = 1 )? "": "s");
fprintf(fx,"%s", outx);
j
if (dna)
- fprintf(fx,
"\n<score: %d (match = ~d. mismatch = %od, gap penalty = od + %d per base>\n".
smax, DMAT, DMIS. DINSO, DINS1);
else
fprintf(fx,
"\n<score: ~d (Dayhoff PAM 250 matrix, gap penalty = %d + %d per residue)1n",
smax. PINSO, PINS 1 ):
if (endgaps)
fprintf(fx.
"<endgaps penalized. leti endeap: ;"~d os%s, right endgap: ',~d %s%s1n",
'S tirstgap, tdna)'? "base" : "residue". (firstgap == 1f? "" . "s",
lastgap, tdnal? '.base" : ..residue". (lastgap == 1)v .,° , ."5,.):
else
fprinttl fx. " < endgaps not penalizedln"):
static ttm: /* matches in core -- for checking */
static Imax: /* lengths of stripped tile names */
static ij(2]; /* jmp index for a path *1
static nc[2]; 1* number at start of current line *1
static tti[2J; /* current elem number -- for gapping */
static siz[2];
static char *ps(2]; /* ptr to current element */
static char *po(2]: /* ptr to next output char slot */
static char out(2][P LINED; i* output line */
static char star[P-LINE]: '* set by starst ) */
I*
* print alicrunent of described in struct path pp[]
*/
static
pr align()
pr align
nn: /* char count */
more:
register i;
for (i = 0, lmax = 0: i < 2: i++) {
nn = stripname(namex(iJ);
if (nn > Imax)
lmax = nn;
nc[i] = 1;
tti[i) = 1;
siz[i] = ij[i] = 0;
ps[i] = seqx[iJ;
po(i] = out[i];
39
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00105841
Table 1 (cony)
for (nn = nm = 0, more = l: more: ) { ,..pr align
for (i = more = 0; i < 2: i++) {
/*
* do we have more of this sequence?
*/
if (1*ps[ij)
continue:
I 0 more+ + ;
if (pp[i].spc) { /* leading space */
*po[i]++ _ ,
pp[i].spc--;
else if (siz(i]) { /* in a gap */
*po[ij++ _ .
siz[i]--:
}
else { /* we're putting a seq element
*/
*Po[il = *Ps(il:
if (islower( *ps[i]))
*ps(i] = u~upper(*ps[ij):
po[i]++;
ps(ij++:
/*
* are we at next gap for this seq?
*/
if (ni[i] _ = pp[i].x(ij[i11) {
/*
* we need to merge all gaps
* at this location
*/
siz[i) = pp(i].n[ij[i]++);
while(ni(i) _=pp[ij.x[ij[i]))
siz[i] += PP(il.n(il[i1++l:
}
ni[i]++:
}
}
if (++nn == oleo ~ ~ !more && nn) {
dumpblock( ):
for (i = 0; i < 2: i++)
po[i] = out(i]:
nn=0:
}
l*
* droop a block of lines, including numbers. scars: pr align()
*J
SS static
dumpblockQ dttmpblock
{
register i;
for(i = 0: i < 2: i++)
"Pofil-_ _ '~0';
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 1 (coot')
(void) putc('\n', fx); ...dumpblock
for (i = 0; i < 2; i++) {
if (*out[i] && (*out[i] I= ' ' I I *(po[i]) ! _ ' ')) {
if (i == 0)
ntuns(i):
if (i == 0 && *out(1])
starsp;
putline(i);
if (i == 0 && *out[ I ])
fprintf(fx, star);
if (i == I)
nums(i);
/*
* put out a number line: dumpblockQ
*/
static
numsl ix )
nums
tot ix: !* index in out] ~ Itoldine seq line */
char nline(P-LINE];
register i, j;
register char *pn. *px. *py;
for(pn = nline. i = 0; i < Imax+P SPC; i++, pn++)
*Pn =
for (i = nc[ix], py = out[ix]; *py; py++, pn++) {
if ( *py = - ' I I *PY = _ -' )
*pn = ,
else {
if (i%10 == 0 I I (i == I && nc[ix] != I)) {
j = (i < 0f? -i : i;
for (px = pn: j; j /= 10, px--j
*px = j%a10 + '0';
if (i < 0)
*Px =
else
*pn _ , '
i++;
*Pn = '\0';
nc(ix] = i:
for (pn = mine; *pn; pn++)
(void) putc(*pn, fx):
(void) putc('1n', fx);
/*
* put out a Iine (name. [num], seq, [num]): dumpblockp
*1
static
putline(ix) putline
int ix;
41
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 1 (coot')
~t ...putline
i:
register char *px;
for (px = namex(ix], i = 0; *px && *px ! _ ':'; px++, i++)
(void) putt(*px. fx);
for (; i < Imax+P SPC: i++)
(void) putt(' ', fx):
/* these count from l:
* ni(] is current element ( from 1 )
* nc(] is number at start of current line
*/
for (px = out[ix]; *px; px++)
(void) putt(*px&Ox7F, fx);
(void) putt('\n', fx);
/*
* put a line of stars tseqs always tn ouy0], out( 1 p: dumpbloci;()
*/
?5 static
stars()
stars
{
int ;;
register char *p0, *pl, cx. *px;
if (!*out[0] ~ ~ (*out[0] _ _ ' ' && *(po[0]) _ _ ' ') ~ ~
! *out( I 1 ~ ~ ( *out[ 1 ] _ _ ~ ' && *(Po[ l ]) _ - ' '))
return;
px = star:
for (i = Imax+P SPC: i: i--)
"px++ _ ,
for (p0 = out[O], pl = ouyl]; *p0 && *pl: p0++, pl++) {
if (isalpha(*p0) && isalpha(*pl)) {
if (xbm( *p0-' A' ]&xbm( *p I -' A' ]) {
cx = '*';
nm++;
else if (!dna && day[*p0-'A'][*pl-'A'i > 0)
cx= .,
else
cx = ,
else
cx = ,
*px++ = cx;
*pz++ _ '1n';
*px = '\0':
42
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 1 (coot')
/*
* strip path or prefix from pn, return fen: pr align()
*%
static
stripname(pn j stripname
char *pn: /* file name tmay be path) */
register char *px, *py;
PY = 0;
for (px = pn: *px: px++)
if(*px =_ '/')
py=px+ I:
if(Py)_
(void) strcpy(pn, py);
return(strlen(pn));
25
35
45
55
43
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PC1'/US00/0584t
Table 1 (coot')
/*
* cleanup() -- cleanup any tmp file
* getseq() -- read in seq, set dna, len, maxlen
S * g calloc() -- calloc() with error checkin
* readjmps() -- get the good jmps, from tmp tile if necessary
* writejmps() -- write a tilled array of jmps to a tmp file: nm )
*/
ltinclude "nw.h"
ftinciude <sys/file.h>
char *jname = "/tmplhomgXXXXXX"; /* tmp tile for jmps */
FILE *fj;
1 S int cleanup(); /* cleanup tmp tile */
long (seek();
/*
* remove any tmp tile if we blow
*/
cleanup(i)
cleanup
int i;
{
if (fj)
2S (void) unlink~jnameJ;
exit(i);
/*
* read, return ptr to sey. set dna. len, maxlen
* skip lines starting with ':', ' <', or ' >'
* seq in upper or lower case
*/
char
getseq(file.len) getseq
char *file: ; * file name */
int *len: ;* seq len */
{
char line[1024j, *pseq;
register char *px, *py;
int natgc. tlen:
FILE *fp;
if ((fp = fopen(file. "r")) _ = 0) {
fprintf(stderr."%s: can't read %s\n", prog, file);
exit( 1 );
}
tlen = natgc = 0:
while (fgets(line, 1024, fp)) {
SO if (*line =- .' ~ ~ *line =_ ' <' I ~ *line =- ' >')
continue:
for (px = line: *px ! _ '\n'; px++)
if (isupper~*px) ~ ~ islower(*px))
tlen++;
}
if ((pseq = malloc((unsigned)hlen+6)>) _ = 0) {
fprintf(stdetr."%s: mallocQ failed to get %d bytes for %s\n", prog, den+6,
file);
ezit(1):
}
pseq[0] = pseq(1] = pseq(2] = pseq[3] _ '\0';
44
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTNS00/05841
Table 1 (cony)
...getseq
py = pseq + 4;
*len = tlen:
rewind(fp);
while (fgets(line. 1024, fp)) {
if (*line =- .' ~ ~ *line =_ ' <' ~ ~ *(ine =- ' >')
continue:
for (px = line: *px ! _ '\n': px++) {
if (isupper(*px))
*PY++ _ *Px:
else if (islower(*px))
*py++ = toupper(*px);
if (index("ATGCU".*(py-1)))
natgc + +
}
*py++ _ '\0':
*PY = '',0':
(void) fclose(fp);
dna = natec > (tlen/3):
return) pseq +4 );
}
char
g calloctmsg, nx. sz) g ~l~
char *msg; /* program. callinc routine */
int nx, sz; /* number and size of elements */
{
char *px. *callocp;
if ((px = ealloc((unsignedlnx. (unsigned)szl) _ = 0)
if (*msg) {
fprintf(stderr. "%s: g calloc() failed %s (n=%d. sz=%d)\n", prog, msg, nx.
szj;
exit( 1 );
j
}
return( px ):
}
/*
* get final jmps from dx] ] or tmp tile. sec pp(J, reset dmax: main( )
*/
readjmps() readjmps
{
int fd = -1:
int siz, i0, i I ;
register i, j, xx;
SO
~(f) {
(void) fclose(fj);
if ((fd = open(jname. O_RDONLY, 0)) < 0) {
fprintf(stderr. % s: can't open() % s\n", prog, jname):
cleanup( 1 );
j
for (i = i0 = il = 0, dmax0 = dmax, xx = len0; ; i++) {
while ( 1 ) {
for (j = dx[dmax].ijmp; j > = 0 g~ dx[dmax].jp.x[jJ > = xx; j--)
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 1 (cont'1
...readjmps
if (j < 0 && dx[dmaxJ.offset && tj) {
(void) Iseeklfd, dx[dmax[.offset, 0);
(voidl read(fd. (char *)&dx(dmaxJ.jp, sizeof(struct jmp));
(void) read(fd. (char *)&dx[dmaxJ.offset, sizeofldx[dmax[.offset));
dx(dmaxj.ijmp = MAXJMP-I;
}
else
break;
}
if (i > = JMPS) {
fprintf(stderr, "%s: too many gaps in alignmentln". prog):
cleanup( 1 ):
_ }
if (j >=0){
siz = dx[dmaxJ.jp.n(j];
xx = dx(dmaxJ.jp.x[j];
dmax += siz;
if (siz < 0) { /* gap in second seq *1
PP(ll.n(iIJ = _~iz:
XX += SIZ:
/*id=xx-yy+lenl-I
*/
ZS
PP[ll.x[itJ = xx-dmax + lenl - l:
gapy + + ;
ngapy -= siz:
/* ignore MAXGAP when doing endgaps */
siz = (-siz < I~IAXGAP ~ ~ cndgaps)Y -siz : MAXGAP:
i1 ++;
}
else if (siz > 0) { /* gap in first seq */
PP(Ol.n(i0j = siz:
PPl0l.x[i0] = xx:
gapx + + ;
ngapx + = siz:
/* ignore PdAXGAP when doing endgaps */
siz = (siz < MAXGAP ~ ~ endgaps)? siz : MAXGAP:
i0++;
}
}
else
break:
}
/* reverse the order of jmps
*/
for (j = 0, i0--; j < i0; j + +, ip--) {
t = PP[01.n(j]: PP[Ol.n~l = PP[01.n[i01: PP[Oj.n(i0] = i:
t = PP(0l.x~j; PP(0l.x~l = PP[Ol.x[i0]; PP(01.x(i0] = i:
}
for (j = 0, il--; j < il: j++, il--) {
t = PP(1].n[j]: PP[Il.n(jl = PP[Il.n[ilj; PP[ll.n[il] = i:
t = PP(ll.xUl; PP[1].X(j) = pp[1].x(ill; PP(lj.x[il] = i:
}
if (fd > = 0)
(void) close(fd);
(void) unlink(jname);
fj = 0;
offset = 0;
}
}
46
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PC'T/US00/05841
Table 1 (coot')
/*
* write a Tilted jmp struct offset of the prey one (if anyj: nwp
*/
writejmps(ix) writejmps
int ix;
{
char *mktemp();
if (!fj) {
if (mlttemp(jname) < 0) {
fprintf(stderr, "','os: can t mktemp() %s\n", prog, jname):
cleanup(1);
}
if ((fj = fopen(jname. "w")) _= 0) {
fprintf(stderr. "%s: can't write %s\n", prog, jname):
exit( 1 ):
}
(void) fwrite((char *1&dx[ix].jp, sizeof(structjmp), l, fj);
(void) fwrite~lchar *1&dx[ix].offset. sizeof(dx(ix].offset). I, tj);
}
30
40
50
60
47
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 2
PRO XXXXXXXXXXXXXXX
(Length = 15 amino acids)
Comparison Protein XXXXXYYYYYYY (Length = 12 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two
Poiypeptide sequences as determined by
,ALIGN-2) divided by (the total number of amino acid residues of the PRO
polypeptide) _
5 divided by (5 = 33.3 %
48
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 3
PRO XXXXXXXXXX (Length = 10 amino acids)
Comparison Protein XXXXXYYYYYYZZYZ (Length = 15 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two
polypeptide sequences as determined by
ALIGN-21 divided by (the total number of amino acid residues of the PRO
polypeptide) _
5 divided by 10 = 50%
49
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Table 4
PRO-DNA NNNNNNNNNNNNNN (Length = 14 nucleotides)
Comparison DNA NNNNNNLLLLLLLLLL (Length = 16 nucleotides)
% nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by ALIGN-2)
divided by (the total number of nucleotides of the PRO-DNA nucleic acid
sequence) _
6 divided by 14 = 42.9%
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTlUS00/05841
Table 5
PRO-DNA NNNNNNNNNNNN (Length = 12 nucleotides)
Comparison DNA NNNNLLLVV (Length = 9 nucleotides)
nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid
sequences as determined by ALIGN-2)
divided by (the total number of nucleotides of the PRO-DNA nucleic acid
sequence) _
4 divided by 12 = 33.3%
51
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
II. Compositions and Methods of the Invention
1. Preparation of the PRO polvpeptides of the invention
The present invention provides newly identified and isolated nucleotide
sequences encoding the
polypeptides in the present application as PRO polypeptides. In particular,
cDNAs encoding various PRO
S polypeptides have been identified and isolated, as disclosed in further
detail in the Examples below. It is noted
that proteins produced in separete expression rounds may be given different
PRO numbers but the UNQ
number is unique for any given DNA and the encoded protein, and will not be
changed. However, for the sake
of simplicity, in the present specification the protein encoded by the full
length native nucleic acid molecules
disclosed herein as well as all further native homologues and variants
included in the foregoing definition of
PRO, will be referred to as "PRO/number" or even "PRO". regardless of their
origin or mode of preparation.
In particular, cDNA encoding a PR0200, PR0204, PR0212, PR0216, PR0226. PR0240,
PR023S,
PR024S. PR0172, PR0273, PR0272, PR0332, PROS26, PR0701, PR0361, PR0362,
PR0363, PR0364,
PR03S6, PROS31. PROS33, PR01083, PR086S, PR0770, PR0769, PR0788. PR01114,
PR01007,
PRO 1184. PRO 1031. PR01346, PRO 1 I SS, PRO 1250, PR01312. PRO I 192,
PR01246, PR01283, PRO 1195,
f S PR013-13. PR01418. PR01387, PRO 1410, PR01917. PRO 1868, PR020S. PR021.
PR0269, PR0344.
PR0333, PR0381, PR0720. PR0866, PR0840. PR0982. PR0836. PRO11S9, PR013S8.
PR0132S,
PR0133S, PR0143-1, PR04333. PR04302, PR04430 and PROS727 polypeptide
(corresponding to UNQ174.
UNQ 178. UNQ 186, UNQ 190, UNQ200. UNQ214, UNQ209, UNQ219, UNQ 146. UNQ240.
UNQ239.
UNQ293. UNQ330. UNQ36S, UNQ316, UNQ317, UNQ318. UNQ319, UNQ313, UNQ332.
UNQ334,
UNQS40. UNQ434, UNQ408, UNQ407, UNQ430, UNQSS7, UNQ49l, UNQS98. UNQ516,
UNQ701,
UNQSBS. UNQ633. UNQ678, UNQ606, UNQ630. UNQ6S3, UNQ608, UNQ698, UNQ732.
UNQ722,
UNQ728. UNQ900, UNQ8S9, UNQ179, UNQ21, UNQ236, UNQ303, UNQ294, UNQ322. UNQ388,
UNQ43S. UNQ433, UNQ483, UNQS4S. UNQS89, UNQ707, UNQ685, UNQ693, UNQ739,
UNQ1888,
UNQ1866. UNQ1947 and UNQ2448, respectively) has been identified and isolated.
as disclosed in further
detail in the Examples below.
In even greater particularin~, the present specitication describes the cDNAs
DNA29101-1276,
DNA30871-1157, DNA309-12-113-1. DNA33087-1158, DNA33~160-1166, DNA34387-1138,
DNA3SS58-
1167, DNA3S638-1141, DNA3S916-1161, DNA39S23-1192, DNA40620-1183. DNA40982-
1235,
DNA44184-1319, DNA4420S-1285. DNA4S410-1250, DNA4S416-1251, DNA4S419-1252,
DNA47365-
1206. DNA47470-1130, DNA48314-1320. DNA4943S-I219, DNAS0921-1458, DNA53974-
1401,
DNAS4228-1366, DNAS4231-1366, DNAS640S-1357, DNAS7033-1403, DNAS7690-1374,
DNAS9220-
1514, DNAS9294-1381, DNAS9776-1600, DNA59849-1504, DNA6077S-1532, DNA61873-
1574,
DNA62814-1521, DNA6488S-1529, DNA6S404-1551, DNA6S412-1523, DNA6667S-1587,
DNA68864-
1629, DNA68872-1620, DNA68874-1622, DNA76400-2528, DNA77624-2515, DNA30868-
I1S6,
3S DNA36638-1056, DNA38260-1180, DNA40S92-1242, DNA41374-1312, DNA44194-1317,
DNAS3S17-
1366, DNA53971-1359, DNAS3987-1438, DNAS7700-1408, DNAS9620-1463, DNA60627-
1508,
DNA64890-1612, DNA666S9-1593, DNA66667-IS96, DNA68818-2536, DNA84210-2576,
DNA92218-
2554, DNA96878-2626, DNA988S3-1739 which encode native sequence PR0200,
PR0204, PR0212,
PR0216, PR0226, PR0240, PR0235, PR024S, PR0172, PR0273, PR0272, PR0332,
PR0526, PR0701,
PR0361, PR0362, PR0363, PR0364, PR03S6, PROS31, PROS33, PR01083, PR086S,
PR0770, PR0769,
52
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTJUS00/0584t
PR0788, PR01114, PR01007. PR01184. PR01031, PR01346, PRO1 ISS. PR012S0.
PR01312. PR01192,
PR01246. PR01283, PR01195. PR01343, PR01418, PR01387, PR01410. PR01917,
PR01868, PR0205,
PR021, PR0269, PR0344, PR0333, PR0381, PR0720, PR0866, PR0840, PR0982, PR0836,
PRO11S9,
PR01358, PR0132S, PR01338, PR01434, PR04333, PR04302, PR04430 and PROS727
polypeptides,
S respectively.
As disclosed in the Examples below, various cDNA clones have been deposited
with the ATCC. The
actual nucleotide sequence of those clones can readily be determined by the
skilled artisan by sequencing of the
deposited clone using routine methods in the act. It is understood that the
sequence of the deposit contains the
correct sequence in the event of a discrepancy between the deposited sequence
and those disclosed herein. The
predicted amino acid sequence can be determined from the nucleotide sequence
using routine skill. For the
PRO polypeptides and encoding nucleic acids described herein, Applicants have
identified what is believed to
be the reading frame best identifiable with the sequence information available
at the time.
B. PRO Polvpeptide Variants
In addition to the full-length native sequence PRO polvpeptides described
herein. it is contemplated
that PRO variants can be prepared. PRO variants can be prepared by introducing
appropriate nucleotide
changes into the PRO DNA. and~or by synthesis of the desired PRO polypeptide.
Those skilled in the art will
appreciate that amino acid changes may alter post-translational processes of
the PRO, such as changing the
number or position of glycosylation sites or altering the membrane anchorine
characteristics.
Variations in the native full-length PRO sequence or in various domains of the
PRO described herein,
can be made, for example, using any of the techniques and guidelines for
conservative and non-conservative
mutations set forth, for instance, in U.S. Patent No. 5,364,934. Variations
may be a substitution, deletion or
insertion of one or more codons encoding the PRO that results in a change in
the amino acid sequence of the
PRO as compared with the native sequence PRO. Optionally the variation is by
substitution of at least one
amino acid with any other amino acid in one or more of the domains of the PRO.
Guidance in deteiTttining
which amino acid residue may be inserted. ,ubstituted or deleted without
adversely affecting the desired
activity may be found by comparing the sequence of the PRO with that of
homoloeous known protein
molecules and minimizine the number of amino acid sequence changes made in
regions of t igh homology.
Amino acid substitutions can be the result of replacing one amino acid with
another amino acid having similar
structural and/or chemical properties, such as the replacement of a leucine
with a serine, i.e., conservative
amino acid replacements. Insertions or deletions may optionally be in the
range of about 1 to 5 amino acids.
The variation allowed may be determined by systematically making insertions,
deletions or substitutions of
amino acids in the sequence and testing the resulting variants for activity
exhibited by the full-length or mature
native sequence.
PRO polypeptide fragments are provided herein. Such fragments may be truncated
at the N-terminus
3S or C-terminus, or may lack internal residues, for example, when compared
with a full length native protein.
Certain fragments lack amino acid residues that are not essential for a
desired biologicai activity of the PRO
polypeptide.
PRO fragments may be prepared by any of a number of conventional techniques.
Desired peptide
fragments may be chemically synthesized. An alternative approach involves
generating PRO fragments by
enzymatic digestion, e.g., by treating the protein with an enzyme known to
cleave proteins at sites defined by
S3
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00153758 PCTYUS00/05841
particular amino acid residues, or by digesting the DNA with suitable
restriction enzymes and isolating the
desired fragment. Yet another suitable technique involves isolating and
amplifying a DNA fragment encoding
a desired polypeptide fragment, by polymerase chain reaction (PCR).
Oligonucleotides that define the desired
termini of the DNA fragment are employed at the ~' and 3' primers in the PCR.
Preferably, PRO polypeptide
fragments share at least one biological and,~or immunological activity with
the native PRO polvpeptide
disclosed herein.
In particular embodiments, conservative substitutions of interest are shown in
Table 6 under the
heading of preferred substitutions. If such substitutions result in a change
in biological activity. then more
substantial changes. denominated exemplary substitutions in Table 6, or as
turther described below in reference
to amino acid classes, are introduced and the products screened.
Table 6
Original Exemplary Preferred
Residue Substitutions Substitutions
.-Vila (A> val; leu; ile val
-~g (R) lys; gln: asn lys
Asn (N) gln: his: lys; arg gln
Asp (D) glu glu
Cys (C) ser ser
Gln (Q) asn asn
Glu (E) asp asp
Gly (G) pro; ala ala
His (H) asn: gln; lys; arg arg
Ile (I) leu: val; met; ala;
phe:
norleucine leu
Leu (L) norleucine: ile; val:
met; ala: phe ile
Lys (K) arg; gln; asn arg
Met (M) leu; phe; ile leu
Phe (F) leu; val; ile; ala; leu
tyr
Pro (P) ala
ala
Ser (S) thr t~
Thr (T) ser ser
Ttp (W) tyr; phe
Tyr (Y) trp; phe; thr; ser phe
Val (V) ile; leu; met; phe;
ala; norleucine leu
Substantial modifications in function or immunological identity of the
invention polypeptide are
accomplished by selecting substitutions that differ significantly in their
effect on maintaining (a) the structure
54
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/0584I
of the polypeptide backbone in the area of the substitution, for example, as a
sheet or helical conformation. (b)
the charge or hydrophobiciry of the molecule at the target site, or (c) the
bulk of the side chain. Naturally
occurring residues are divided into groups based on common side-chain
properties:
( 1 ) hydrophobic: norleucine, met, ala, val, leu, ile;
(2) neutral hydrophilic: cys, ser, thr;
(3) acidic: asp, glu;
(4) basic: asn, gln, his. lys, arg;
(5) residues that influence chain orientation: gly, pro: and
(6) aromatic: trp, tyr, phe.
Non-conservative substitutions will entail exchanging a member of one of these
classes for another
class. Such substituted residues also may be introduced into the conservative
substitution sites or, more
preferably, into the remaining (non-conserved) sites.
The variations can be made using methods known in the art such as
oligonucieotide-mediated (site
directed) mutagenesis. alanine scanning, and PCR mutagenesis. Site-directed
mutagenesis [Carter ct ul.. .VucL
I ~ . I c ids Rrs.. 13:4331 ( 1986); Zoller et ul., :Vucl. Acidr Res.,
_10:6487 ( 1987)]. cassette mutagenesis (V~ells et al.,
Gene, 3-1:315 (1985)], restriction selection mutaeenesis [Wells ct ul.,
Philos. Trues. R. Soc. London Ser.~l.
317:41 ~ ( 1986)) or other known techniques can be performed on the cloned DNA
to produce the PRO variant
variant DNA.
Scanning amino acid analysis can also be employed to identify one or more
amino acids along a
contiguous sequence. Among the preferred scanning amino acids are relatively
small. neutral amino acids.
Such amino acids include alanine, glycine, setine, and cysteine. Alanine is
typically a preferred scanning
amino acid among this group because it eliminates the side-chain beyond the
beta-carbon and is less likely to
alter the main-chain conformation of the variant [Cunningham and Wells,
Science, _244: LORI-1085 (1989)].
Alanine is also typically preferred because it is the most common amino acid.
Further. it is frequently found in
both buried and exposed positions [Creighton. The Proteins. (W.H. Freeman &
Co., N.Y.); Chothia. J. :Lfol.
Biol.. 10:1 (1976)]. If alanine substitution does not yield adequate amounts
of variant, an isoteric amino acid
can be used.
C. Modifications of PRO
Covalent modifications of PRO polypeptides are included within the scope of
this invention. One
type of covalent modification includes reacting targeted amino acid residues
of a PRO polypeptide with an
organic derivatizing agent that is capable of reacting with selected side
chains or the N- or C- terttinal residues
of the PRO. Derivatization with bifunctional agents is useful, for instance,
for crosslinking PRO to a water
insoluble support matrix or surface for use in the method for purifying anti-
PRO antibodies, and vice-versa.
Commonly used crosslinking agents include, e.g., 1,1-bis(diazoaceryl)-2-
phenylethane, glutaraldehyde, N
hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid,
homobifunctional imidoesters,
including disuccinimidyl esters such as 3,3'-
dithiobis(succinimidyipropionate), bifunctional maleimides such as
bis-N-maleimido-I,8-octane and agents such as methyl-3-[(p-
azidophenyl)dithio]propioimidate.
Other modifications include deamidation of glutaminyl and asparaginyl residues
to the corresponding
glutamyl and asparryl residues, respectively, hydroxylation of proline and
lysine, phosphoryiation of hydroxyl
groups of seryl or threonyl residues, methylation of the a-amino groups of
lysine, arginine, and histidine side
SS
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
chains jT.E. Creighton, Prorein.s: Structure and Molecular Properties, W.H.
Freeman & Co., San Francisco.
pp. 79-86 ( 1983)], acerylation of the N-terminal amine. and amidation of any
C-terminal carboxyl group.
Another type of covalent modification of the PRO polypeptide included within
the scope of this
invention comprises altering the native glycosylation pattern of the
polypeptide. "Altering the native
glycosylation pattern" is intended for purposes herein to mean deleting one or
more carbohydrate moieties
found in native sequence PRO polypeptide (either by removing the underlying
glycosylation site or by deleting
the glycosylation by chemical andlor enzymatic means), and/or adding one or
more glycosylation sites that are
not present in the native sequence PRO. In addition, the phrase includes
qualitative changes in the
glycosylation of the native proteins, involving a change in the nature and
proportions of the various
I O carbohydrate moieties present.
Addition of glycosylation sites to the PRO polypeptide may be accomplished by
altering the amino
acid sequence. The alteration may be made, for example, by the addition of; or
substitution by, one or more
serine or threonine residues to the native sequence PRO (for O-linked
glycosylation sites). The PRO amino
acid sequence may optionally be altered through changes at the DNA level,
particularly by mutating the DNA
I S encoding the PRO polypeptide at preselected bases such chat codons are
generated that will translate into the
desired amino acids.
Another means of increasing the number of carbohydrate moieties on the PRO
polypeptide is by
chemical or enzymatic coupling of glycosides to the polypeptide. Such methods
are described in the art, e.g.,
in WO 87,05330 published I 1 September 1987, and in Aplin and Wriston. CRC
Crit. Rev. Bioclrem., pp, 259
20 306 ( I 981 ).
Removal of carbohydrate moieties present on the PRO polypeptide may be
accomplished chemically
or enzvmatically or by mutational substitution of codons encoding for amino
acid residues that serve as targets
for glycosylation. Chemical deglycosylation techniques are known in the an and
described. for instance, by
Hakimuddin, et al., Arch. Biochem. Bioph.vs., _?59:52 (1987) and by Edge et
al.. Anal. Bioclrem., _118:131
25 ( 1981 ). Enzymatic cleavage of carbohydrate moieties on polypeptides can
be achieved by the use of a variety
of endo- and exo-glycosidases as described by Thotakura et ul., ~t~leth.
En~~mol.. _138:350 ( 1987).
Another type of covalent modification of PRO comprises linking the PRO
polypeptide to one of a
variety of nonproteinaceous polymers, u.b~., polyethylene glycol (PEG),
polypropylene glycol, or
polyoxyalkylenes. in the manner set forth in U.S. Patent Nos. 4,f>40,835;
4,496,689; 4,301,144; 4,670,417;
30 4,791,192or4,179,337.
The PRO polypeptides may also be modified in a way to form a chimeric molecule
comprising the
invention poiypeptide fused to another, heterologous polypeptide or amino acid
sequence.
In one embodiment, such a chimeric molecule comprises a fusion of the PRO with
a tag polypeptide
which provides an epitope to which an anti-tag antibody can selectively bind.
The epitope tag is generally
35 placed at the amino- or carboxyl- tetzrtinus of the PRO. The presence of
such epitope-tagged forms of the PRO
polypeptide can be detected using an antibody against the tag polypeptide.
Also, provision of the epitope tag
enables the PRO to be readily purified by affinity purification using an anti-
tag antibody or another type of
affinity matrix that binds to the epitope tag. Various tag polypeptides and
their respective antibodies are well
known in the art. Examples include poly-histidine (poly-his) or poly-histidine-
glycine (poly-his-gly) tags; the
40 flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell.
Biol., 8:2159-2165 (1988)]; the c-myc
56
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00105841
tag and the 8F9, 3C7, 6E10, G4. B7 and 9E10 antibodies thereto [Evan et al..
.llolecularand CelltdarBiology,
5:3610-3616 ( 1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and
its antibody (Paborsky et al.,
Protein Engineering, 3(6):547-553 (1990)]. Other tag polypeptides include the
Flag-peptide [Hopp et al..
BioTechnology, 6:1204-1210 (1988));~the KT3 epitope peptide [Martin et al..
Science, 2_55:192-194 (1992)]; an
a-tubulin epitope peptide [Skinner et al.. J. Biol. Chem.. _266:15163-15166
(1991)]; and the T7 gene l0
protein peptide tag [Lutz-Freyermuth et al., Proc. Natl. Acad. Sci. IlS.4,
_87:6393-6397 (1990)].
In an alternative embodiment. the chimeric molecule may comprise a fusion of
the PRO polypeptide
with an immunoglobulin or a particular region of an immunoglobulin. For a
bivalent form of the chimeric
molecule (also referred to as an "immunoadhesin"), such a fusion could be to
the Fc region of an IeG molecule.
The Ig fusions preferably include the substitution of a soluble (transmembrane
domain deleted or inactivated)
form of an invention polvpeptide in place of at least one variable region
within an Ig molecule. In a
particularly preferred embodiment. the immunoglobulin fusion includes the
hinge, CH2 and CH3, or the hinge,
CHI. CH2 and CH3 regions of an IgG I molecule. For the production of
immunoglobuiin fusions see also US
Patent No. 5,428,130 issued June 27, 1995.
l5 D. Preparation of PRO
The description below relates to primarily to production of PRO by culturing
cells transformed or
transfected with a vector containing PRO nucleic acid. It is. of course,
contemplated that alternative methods.
which are well known in the art. may be employed to prepare PRO. For instance.
the PRO sequence. or
portions thereof: may be produced by direct peptide synthesis using solid-
phase techniques [see, e.g.. Stewart
et al., Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco. CA
(1969); Merrifield, J. :Inr. Chem.
Soc. 85: 2149-2151 ( 1963)]. In aitro protein synthesis may be performed using
manual techniques or by
automation. Automated synthesis may be accomplished, for instance, using an
Applied Biosystems Peptide
Synthesizer (Foster City, CA) using the manufacturer's instructions. Various
portions of the PRO may be
chemically synthesized separately and combined using chemical or enzymatic
methods to produce the full
Z5 length PRO.
1. Isolation of DNA Fncodine the PRO Polvpeptidelel
DNA encoding the PRO may be obtained from a cDNA library prepared from tissue
believed to
possess the polypeptide mRNA and to express it at a detectable level.
Accordingly, human PRO DNA can be
conveniently obtained from a cDNA library prepared from human tissue, such as
described in the Examples.
The PRO-encoding gene may also be obtained from a genomic library,
oligonucieotide synthesis, or other
known synthetic procedures (e.g., automated nucleic acid synthesis).
Libraries can be screened with probes (such as antibodies to the PRO
polypeptide or oligonucleotides
of at least about 20-80 bases) designed to identify the gene of interest or
the protein encoded by it. Screening
the eDNA or genomic library with the selected probe may be conducted using
standard procedures, such as
described in Sambrook et al., Molecular Cloning. A Laboraton.~ Manual (New
York: Cold Spring Harbor
Laboratory Press, 1989). An alternative means to isolate the gene encoding the
PRO polypeptide is to use PCR
methodology [Sambrook et al., supra; Dieffenbach et aL, PCR Primer: A
Laboratory Manual (Cold Spring
Harbor Laboratory Press, 1995)).
The Examples below describe techniques for screening a cDNA library. The
oligonucleotide
sequences selected as probes should be of sufficient length and sufficiently
unambiguous that false positives
57
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
are minimized. The oligonucieotide is preferably labeled such that it can be
detected upon hybridization to
DNA in the library being screened. Methods of labeling are well known in the
art, and include the use of
radiolabels like ''P-labeled ATP, biotinylation or enzyme labeling.
Hybridization conditions. including
moderate stringency and high stringency, are provided in Sambrook et ul.,
supra.
S Sequences identified in such library screening methods can be compared and
aligned to other known
sequences deposited and available in public databases such as GenBank or other
private sequence databases.
Sequence identity (at either the amino acid or nucleotide level) within
defined regions of the molecule or across
the full-length sequence can be determined using methods known in the art and
as described herein.
Nucleic acid having protein coding sequence may be obtained by screening
selected cDNA or
genomic libraries using the deduced amino acid sequence disclosed herein for
the first time, and, if necessary,
using conventional primer extension procedures as described in Sambrook et
al., supra. to detect precursors
and processing intermediates of mRNA that may not have been reverse-
transcribed into cDNA.
2. Selection and Transformation of Host Cells
Host cells are transfected or transformed with expression or cloning vectors
described herein for
1 ~ production of the PRO polypeptides and cultured in conventional nutrient
media modified as appropriate for
inducing promoters, selecting transformants. or amplifying the Lenes encoding
the desired sequences. The
culture conditions, such as media. temperature, pH and the like. can be
selected by the skilled artisan without
undue erperimentation. In general. principles, protocols, and practical
techniques For maximizing the
productivity of cell cultures can be found in Afammuliun Cell Binteclrnologv:
.-1 Practical :Ipproach, M.
Butler, ed. (IRL Press, 1991 ) and Sambrook et al., supra.
Methods of transfection are known to the ordinarily skilled artisan, for
example. CaP04 and
electroporation. Depending on the host cell used, transformation is performed
using standard techniques
appropriate to such cells. The calcium treatment employing calcium chloride,
as described in Sambrook et al.,
szrpra. or electroporation is Generally used for prokaryotes or other cells
that contain substantial cell-wall
barriers. Infection with .4grobacterirnn «rnreiacien.r is used for
transformation of certain plant cells, as
described by Shaw er ul.. Gene. 23: 315 11983) and WO 89i058S9 published 29
June 1989. For mammalian
cells without such cell walls. the calcium phosphate precipitation method of
Graham and van der Eb. t'irology,
52:456-4S7 (1978) can be employed. General aspects of mammalian cell host
system transformations have
been described in U.S. Patent No. 4,399.216. Transformations into yeast are
typically carried out according to
the method of Van Solingen et al., J. Bact., 130:946 (1977) and Nsiao et al.,
Pr-oc. Natl. Acad. Sci. (US.A),
76:3829 ( 1979). However, other methods for introducing DNA into cells, such
as by nuclear microinjection,
electroporation. bacterial protoplast fusion with intact cells, or
polycations, e.g., polybrene, polyornithine, may
also be used. For various techniques for transforming mammalian cells. see
Keown et al.. Methods in
Enzvmolo~, 185:527-S37 (1990) and Mansour et. al.. Nature. _336:348-352
(1988).
Suitable host cells for cloning or expressing the DNA in the vectors herein
include prokaryote, yeast,
or higher eukaryote cells. Suitable prokaryotes include but are not limited to
eubacteria. such as Gram-
negative or Gram-positive organisms, for example, Enterobacteriaceae such as
E. coli. Various E. coli strains
are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E.
coli X1776 (ATCC 31,537); E.
coli strain W3110 (ATCC 27,325) and KS 772 (ATCC 53,635). Other suitable
prokaryotic host cells include
Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Envinia,
Klebsiella, Proteus, Salmonella,
58
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00153758 PCT/US00/05841
e.g., Salmonella typhimtwium. Serratia, e.g., Scrratia marcescans, and
Shigella, as weal as Bacilli such as B.
subtilis and B. licheniformis (e.g., B. lichenifonnis. 41P disclosed in DD
266.710 published 12 April 1989),
Pseudomonas such as P. uenrginosa, and Streptomvces. These examples are
illustrative rather than limiting.
Strain W3110 is one particularly preferred host or parent host because it is a
common host strain for
recombinant DNA product fermentations. Preferably, the host cell secretes
minimal amounts of proteoiytic
enzymes. For example, strain W3110 may be modified to effect a genetic
mutation in the genes encoding
proteins endogenous to the host. with examples of such hosts including E. call
W3110 strain 1A2. which has
the complete genotype ton.4 ; E. call W31 10 strain 9E4, which has the
complete genotype tonA ptrj; E. call
W3110 strain 27C7 (ATCC 55,244). which has the complete genotype tonA ptrj
phoA EIS (argF-luc)l69
degP ompT kan": E. call W3110 strain 37D6, which has the complete genotype
tonA ptr.3 phoA El5 (argF
lac/l69 degP ompT rbs7 ilvG kan'; E, call W3110 strain 40B4, which is strain
37D6 with a non-kanamvcin
resistant degP deletion mutation; and an E. cnli strain having mutant
peripiasmic protease disclosed in U.S.
Patent No. 4,946,783 issued 7 August 1990. Alternatively, in vitro methods of
cloning, e.g., PCR or other
nucleic acid polymerase reactions. are suitable.
I 5 In addition to prokaryotes, eukaryotic microbes such as filamentous fungi
or yeast are suitable clonine
or expression hosts for PRO-encoding vectors. Succharomvces cerevisiae is a
commonly used lower
eukaryotic host microorganism. Others include Sclri~osaccharomvces pombe
(Beach and Nurse. Nutcwe, 2_90:
140 [1981]; EP 139.383 published 2 May 1985): Khryveromvces hosts (U.S. Patent
No. :1.9-13.529: Fleer et al.,
BiolTechnologv, 9:968-975 ( 1991 )) such as, e.g., K.. lactis (MW98-8C,
CBS683, CBS4574: Louvencourt et al..
J. Bacterial.. 154(2):737-742 ( 1983]), K. Jragilis (ATCC 12,424), K.
bulgaricus (ATCC 16.045), K.
wickeramii (ATCC 24.178), K. a~ultii (ATCC 56,500), K. drosophilarum (ATCC
36,906: Van den Berg et al.,
BiolTechnolo~v, 8:135 (1990)), K. tlrennotoleran.s, and K. marxianur; varrowia
(EP 402.226): Piclria pastoris
(EP 183.070; Sreekrishna et al., J Busic Aficrobiol.. _28:265-278 [1988]);
Cundida; Triclroderma reesia (EP
244,234): :Veurospor-a cra.ssa (Case et ul.. Proc. Nutl. Acad. Sci. L'SA,
_76:5259-5263 [ 1979]): Schwanniomvces
such as Schwanncomvces occidentali.s (EP 394.538 published 31 October 1990);
and fllamentous tirnti such as,
e.g., Neuro.spor-cr. Penicillium. Tolvpocludium nV0 91100357 published l0
January 1991), and :l.spergillus
hosts such as.-l. nidulan.s (Ballance et ul.. Bioclrenr. Biophvs. Rcs.
Commern.. _112:284-289 [1983]; Tilburn et
al.. Gene. 26:205-221 (1983]; Melton et ul.. Proc. Nutl. Acad. Sci. USA, _81:
1470-1471 (1984]) and A. niger
(Kelly and Hynes. E.'IIBOJ., 4:475-479 [1985]). Methylotropic yeasts are
suitable herein and include, but are
not limited to, yeast capable of growth on methanol selected from the genera
consisting of Hansenula,
Candida. Kloeckera, Pichia. Saccharnmvces, Torulopsis, and Rhodotorula. A list
of specific species that are
exemplary of this class of yeasts may be found in C. Anthony, The Biochemistry
of Methvlotrophs, 269 ( 1982).
Suitable host cells for the expression of glycosylated PRO polypeptides are
derived from multicellular
organisms. Examples of invertebrate cells include insect cells such as
Drosophila S2 and Spodoptera Sf9, as
well as plant cells. Examples of useful mammalian host cell lines include
Chinese hamster ovary (CHO) and
COS cells. More specific examples include monkey kidney CV1 line transformed
by SV40 (COS-7, ATCC
CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth
in suspension culture,
Graham et al.. J. Gen Viral. 36:59 (1977)); Chinese hamster ovary cells/-DHFR
(CHO, Urlaub and Chasin,
Proc. Natl. Acad. Sci. USA 77:4216 (1980)); mouse sertoli cells (TM4, Mather,
Biol. Reprod. _23:243-251
(1980)); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB
8065); and mouse
59
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00105841
mammary tumor (MMT 060562, ATCC CCL51 ). The selection of the appropriate host
cell is deemed to be
within the skill in the art.
3. Selection and Use of a Reolicable Vector
The nucleic acid (e.g., cDNA or genomic DNA) encoding the PRO polypeptides may
be inserted into
a replicable vector for cloning (amplification of the DNA) or for expression.
Various vectors are publicly
available. The vector may, for example, be in the form of a plasmid, cosmid,
viral particle, phagemid or phage.
The appropriate nucleic acid sequence may be inserted into the vector by a
variety of procedures. In general.
DNA is inserted into an appropriate restriction endonuclease sites) using
techniques known in the art. Vector
components generally include. but are not limited to, one or more of a signal
sequence. an origin of replication,
one or more marker genes. an enhancer element, a promoter, and a transcription
termination sequence.
Construction of suitable vectors containing one or more of these components
employs standard ligation
techniques which are known to the skilled artisan.
The PRO may be produced recombinantly not only directly. but also as a fusion
polypeptide with a
heterologous polvpeptide, which may be a signal sequence or other polypeptide
having a specific cleavage site
l5 at the N-terminus of the mature protein or polypepude. In general. the
signal sequence may be a component of
the vector, or it may be a pan of the PRO-encoding DNA that is inserted into
the vector. The signal sequence
may be a prokaryotic signal sequence selected. for example, from the croup of
the alkaline phosphatase.
penicillinase, lpp, or heat-stable enterotoxin II leaders. For yeast secretion
the signal sequence may be, e.g.,
the yeast invertase leader, alpha factor leader (including Succharomaces and
Khrvveromyces a-factor leaders,
the latter described in U.S. Patent No. 5,010,182), or acid phosphatase
leader, the C. albicans glucoamylase
leader (EP 362.179 published 4 April 1990), or the signal described in WO
90/13646 published 15 November
1990. In mammalian cell expression. mammalian signal sequences may be used to
direct secretion of the
protein. such as signal sequences from secreted polypeptides of the same or
related species. as well as viral
secretorv leaders.
Both expression and cloning vectors contain a nucleic acid sequence that
enables the vector to
replicate in one or more selected host cells. Such sequences are well known
for a variety of bacteria, yeast, and
viruses. The origin of replication from the plasmid pBR322 is suitable for
most Gram-negative bacteria, the 21t
plasmid origin is suitable for yeast, and various viral origins (SV40,
polyoma, adenovirus, VSV or BPV) are
useful for cloning vectors in mammalian cells.
Expression and cloning vectors will typically contain a selection gene, also
termed a selectable
marker. Typical selection genes encode proteins that (a) confer resistance to
antibiotics or other toxins, e.g.,
ampicillin, neomycin, methotrexate, or tetracycline, (b) complement
auxotrophic deficiencies. or (c) supply
critical nutrients not available from complex media, e.g., the gene encoding D-
alanine racemase for Bacilli.
An example of suitable selectable markers for mammalian cells are those that
enable the identification
of cells competent to take up the PRO-encoding nucleic acid, such as DHFR or
thymidine kinase. An
appropriate host cell when wild-type DHFR is employed is the CHO cell line
deficient in DHFR activity,
prepared and propagated as described by Urlaub et al., Proc. Natl. Acad Sci.
USA, _77:4216 (1980). A suitable
selection gene for use in yeast is the trpl gene present in the yeast plasmid
YRp7 [Stinchcomb et al., Nature,
282:39 ( 1979); Kingsman et al., Gene, 7:141 ( 1979); Tschemper et al., Gene,
_10:157 ( 1980)]. The trp 1 gene
provides a selection marker for a mutant strain of yeast lacking the ability
to grow in tryptophan, for example,
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
ATCC No. 44076 or PEP4-1 [Jones, Genetics. 85:12 (1977)].
Expression and cloning vectors usually contain a promoter operably linked to
the PRO-encoding
nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a
variety of potential host cells are
well known. Promoters suitable for use with prokaryotic hosts include the (3-
lactamase and lactose promoter
systems [Chang et al.. Nature. 275:615 ( 1978); Goeddel et al.. Nature,
281:544 ( 1979)], alkaline phosphatase,
a tryptophan (trp) promoter system [Goeddel. N iccleic Acids Res., 8:4057
(1980); EP 36,776], and hybrid
promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA.
80:21-25 (1983)]. Promoters for
use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence
operably linked to the DNA
encodine PRO.
Examples of suitable promoting sequences for use with yeast hosts include the
promoters for 3
phosphoglycerate kinase [Hitzeman et al.. J. Biol. Ckem.. 255:2073 (1980)] or
other glycolytic enzymes [Hess
et al., J :fdv. En~~me Reg., 7:149 (1968); Holland. Biochemistry, 17:4900
(1978)], such as enolase,
glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxyiase,
phospho-fructokinase.
glucose-6-phosphate isomerase. 3-phosphoglycerate mutase. pyruvate kinase.
triosephosphate isomerase.
L S phosphoglucose isomerase, and glucokinase.
Other yeast promoters. which are inducible promoters having the additional
advantage of transcription
controlled by growth conditions, are the promoter regions for alcohol
dehydrogenase 2. isacytochrome C. acid
phosphatase, degradative enzymes associated with nitrogen metabolism,
metallothionein. glyceraldehyde-3-
phosphate dehydrogenase, and enzymes responsible for maltose and galactose
utilization. Suitable vectors and
promoters for use in yeast expression are further described in EP 73,657.
PRO transcription from vectors in mammalian host cells is controlled. for
example, by promoters
obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK
2,211,504 published 5 July
1989), adenovirus (such as Adenovitus 2), bovine papilloma virus. avian
sarcoma virus. cytomegalovirus. a
retrovirus. hepatitis-B virus and Simian Virus 40 (SV40). from heterologous
mammalian promoters. e.,~>., the
actin promoter or an immunoglobulin promoter, and from heat-shock promoters,
provided such promoters are
compatible with the host cell systems.
Transcription of a DNA encoding the PRO polypeptide by higher eukaryotes may
be increased by
inserting an enhancer sequence into the vector. Enhancers are cis-acting
elements of DNA, usually about from
10 to 300 bp, that act on a promoter to increase its transcription. Many
enhancer sequences are now known
from mammalian genes (globin. elastase, albumin. a-fetoprotein, and insulin).
Typically, however. one will
use an etthancer from a eukaryotic cell virus. Examples include the SV40
enhancer on the late side of the
replication origin (bp 100-270), the cytomegalovirus early promoter enhancer,
the polyoma enhancer on the
late side of the replication origin, and adenovirus enhancers. The enhancer
may be spliced into the vector at a
position 5' or 3' to the coding sequence of the PRO polypeptide, but is
preferably located at a site 5' from the
promoter.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant,
animal, human, or
nucleated cells from other multicellular organisms) will also contain
sequences necessary for the termination of
transcription and for stabilizing the mRNA. Such sequences are commonly
available from the 5' and,
occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs.
These regions contain nucleotide
segments transcribed as polyadenyiated fragments in the untranslated portion
of the mRNA encoding PRO.
61
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Still other methods. vectors, and host cells suitable for adaptation to the
synthesis of the PRO
polypeptide in recombinant vertebrate cell culture are described in Gething er
ul., Nature, _293:620-625 (I981);
Mantei et al., Nature, 281:40-46 ( 1979); EP 117,060; and EP 117.058.
4. Detecting Gene Expression
Gene expression may be measured in a sample directly, for example, by
conventional Southern
blotting. Northern blotting to quantitate the transcription of mRNA [Thomas,
Proc. Natl. Acad. Sci. USA,
77:5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridization.
using an appropriately labeled
probe, based on the sequences provided herein. Alternatively, antibodies may
be employed that can recognize
specific duplexes, including DNA duplexes. RNA duplexes. and DNA-RNA hybrid
duplexes or DNA-protein
duplexes. IMe antibodies in turn may be labeled and the assay may be carried
out where the duplex is bound to
a surface, so that upon the formation of duplex on the surface, the presence
of antibody bound to the duplex
can be detected.
Gene expression, alternatively, may be measured by immunological methods. such
as
immunohistochemical staining of cells or tissue sections and assay of cell
culture or body fluids, to quantitate
directly the expression of gene product. Antibodies useful for
immunohistochemical staining and,~or assay of
sample fluids may be either monoclonal or polyclonal. and may be prepared in
any mammal. Conveniently,
the antibodies may be prepared against a native sequence PRO polvpeptide or
against a synthetic peptide based
on the Dir'A sequences provided herein or against exogenous sequence fused to
DNA encoding the PRO
polypeptide and encoding a specific antibody epitope.
5. Purification of Polvneptide
Forms of the PRO may be recovered from culture medium or from host cell
lysates. If membrane
bound, it can be released from the membrane using a suitable detergent
solution (e.g., Triton'°-X 100) or by
enzymatic cleavage. Cells employed in expression of the PRO polypeptide can be
disrupted by various
physical or chemical means. such as freeze-thaw cycling, sonication,
mechanical disruption. or cell lysing
agents.
It may be desired to purify PRO polypeptide from recombinant cell proteins or
polypepudes. The
following procedures arc exemplary of suitable purification procedures: by
fractionation on an ion-exchange
column: ethanol precipitation: reverse phase HPLC; chromatography on silica or
on a canon-exchange resin
such as DEAE; chromatofocusing; SDS-PAGE: ammonium sulfate precipitation; gel
filtration using, for
example. Sephadex G-75; protein A Sepharose columns to remove contaminants
such as IgG; and metal
chelating columns to bind epitope-tagged forms of the PRO polypeptide. Various
methods of protein
purification may be employed and such methods are known in the art and
described for example in Deutscher,
Methods in Enzt~moloy, 182 ( 1990); Scopes, Protein Purification: Principles
and Practice, Springer-Verlag,
New York (1982). The purification steps) selected will depend, for example, on
the nature of the production
process used and the particular PRO polypeptide produced.
E. Tissue Distribution
The location of tissues expressing the PRO can be identified by determining
tnRNA expression in
various human tissues. The location of such genes provides information about
which tissues are most likely to
be affected by the stimulating and inhibiting activities of the PRO
polypeptides. The location of a gene in a
specific tissue also provides sample tissue for the activity blocking assays
discussed below.
62
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/0584i
As noted before. gene expression in various tissues may be measured by
conventional Southern
blotting, Northern blotting to quantitate the transcription of tnRNA (Thomas,
Proc. Natl. Acad Sci. USA,
77:5201-5205 [1980]), dot blotting (DNA analysis), or in situ hybridization,
using an appropriately labeled
probe, based on the sequences provided herein. Alternatively, antibodies may
be employed that can recognize
specific duplexes. including DNA duplexes. RNA duplexes, and DNA-RNA hybrid
duplexes or DNA-protein
duplexes.
Gene expression in various tissues, alternatively, may be measured by
immunological methods. such
as immunohistochemical staining of tissue sections and assay of cell culture
or body fluids, to quantitate
directly the expression of gene product. Antibodies useful for
immunohistochemical staining and/or assay of
sample fluids may be either monoclonal or polyclonal, and may be prepared in
any mammal. Conveniently,
the antibodies may be prepared against a native sequence of a PRO polypeptide
or against a synthetic peptide
based on the DNA sequences encoding the PRO polypeptide or against an
exogenous sequence fused to a DNA
encoding a PRO polypeptide and encoding a specific antibody epitope. General
techniques for generating
antibodies, and special protocols for Northern blotting and in situ
hybridization are provided below.
F. Antibody Bindine Studies
The activav of the PRO polypeptides can be further verified by antibody
bindine studies, in which the
ability of anti-PR0200. anti-PR0204, anti-PR0212. anti-PR0216, anti-PR0226,
anti-PR0240. ante-PR0235,
anti-PR0245, anti-PR0172, anti-PR0273, anu-PR0272, anti-PR0332, anti-PR0526,
anti-PR0701, anti-
PR0361, anti-PR0362, anti-PR0363. anti-PR0364, anti-PR0356, anti-PR0531, anti-
PR0533. anti-PR01083,
anti-PR0865, anti-PR0770, anti-PR0769, anti-PR0788. anti-PR01114, anti-
PR01007, anti-PR01184, anti-
PR01031, anti-PR01346, anti-PRO11S5, anti-PR01250, anti-PR01312, anti-PR01192,
anti-PR01246, anti-
PR01283, anti-PROI 195, anti-PR01343, anti-PR01418, anti-PR01387, anti-
PR01410, anti-PR01917, anti-
PR01868, anti-PR0205, anti-PR021, anti-PR0269, anti-PR0344, anti-PR0333, anti-
PR0381, anti-PR0720,
anti-PR0866, anti-PR0840. anti-PR0982. anti-PR0836, anti-PR01159, anti-
PR01358, anti-PR01325, anti-
PR01338. anti-PROI-134, anti-PR04333, anti-PR04302. anti-PR04430 or anti-
PR05727 antibodies to inhibit
the effect of the PR0200. PR0204. PR0212, PR0216, PR0226. PR0240, PR0235,
PR0245, PR0172.
PR0273. PR0272. PR0332, PR0526. PR0701. PR0361. PR0362, PR0363, PR0364.
PR0356. PR0531.
PR0533, PR01083, PR0865, PR0770, PR0769, PR0788. PR01114, PR01007, PR01184,
PR01031,
PR01346, PROI 155. PR01250, PR01312, PR01192, PR01246, PR01283, PROI 195.
PR01343, PR01418,
PR01387, PRO1410, PR01917, PRO1868, PR0205, PR021, PR0269, PR0344, PR0333,
PR0381, PR0720,
PR0866, PR0840, PR0982, PR0836, PR01159, PR01358, PR01325, PR01338, PR01434,
PR04333,
PR04302, PR04430 or PR05727 polypeptides. respectively, on tissue cells is
tested. Exemplary antibodies
include polyclonal. monoclonal, humanized. bispecific. and heteroconjugate
antibodies, the preparation of
which will be described hereinbelow.
Antibody binding studies may be carried out in any known assay method, such as
competitive binding
assays, direct and indirect sandwich assays, and immunoprecipitation assays.
Zola, Monoclonal Antibodies: A
Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).
Competitive binding assays rely on the ability of a labeled standard to
compete with the test sample
analyte for binding with a limited amount of antibody. The amount of target
protein in the test sample is
inversely proportional to the amount of standard that becomes bound to the
antibodies. To facilitate
63
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/0584I
determining the amount of standard that becomes bound, the antibodies
preferably are insolubilized before or
afrer the competition, so that the standard and analvte that are bound to the
antibodies may conveniently be
separated from the standard and analvte which remain unbound.
Sandwich assays involve the use of two antibodies, each capable of binding to
a different
immunogenic portion, or epitope, of the protein to be detected. In a sandwich
assay, the test sample analyze is
bound by a first antibody which is immobilized on a solid support, and
thereafter a second antibody binds to
the analvte, thus forming an insoluble three-pan complex. See, e.g., US Pat
No. 4,376,110. The second
antibody may itself be labeled with a detectable moiety (direct sandwich
assays) or may be measured using an anti-immunoglobulin antibody that is
labeled with a detectable moiety
(indirect sandwich assay). For example, one type of sandwich assay is an ELISA
assay, in which case the
detectable moiety is an enzyme.
For immunohistochemistry, the tissue sample may be fresh or frozen or may be
embedded in paraffin
and fixed with a preservative such as fotlttalin, for example.
G. Cell-Based Assavs
Cell-based assays and animal models for immune related diseases can be used to
further understand
the relationship benveen the genes and polypeptides identified herein and the
development and pathogenesis of
immune related disease.
In a different approach. cells of a cell type known to be involved in a
particular immune related
disease are transfected with the cDNAs described herein, and the ability of
these cDNAs to stimulate or inhibit
immune function is analyzed. Suitable cells can be transfected with the
desired gene, and monitored for
immune function activity. Such transfected cell lines can then be used to test
the ability of poly- or monoclonal
antibodies or antibody compositions to inhibit or stimulate immune function,
for example to modulate T-cell
proliferation or inflammatory cell infiltration. Cells transfected with the
coding sequences of the genes
identified herein can further be used to identify drug candidates for the
treatment of immune related diseases.
In addition. primary cultures derived from transgenic animals (as described
below) can be used in the
cell-based assays herein, although stable cell lines are preferred. Techniques
to derive continuous cell lines
from transgenic animals are well known in the art (see, e.g., Small et al..
dlol. Cell. Biol. 5: 642-648 [ 1985]).
One suitable cell based assay is the mixed lymphocyte reaction (MLR). Currem
Protocols in
Immunolo~~, unit 3.12; edited by 1 E Coligan, A M Kruisbeek, D H Marglies, E M
Shevach. W Strober,
National Institutes of Health. Published by John Wiley & Sons, Inc. In this
assay, the ability of a test
compound to stimulate or inhibit the proliferation of activated T cells is
assayed. A suspension of responder T
cells is cultured with allogeneic stimulator cells and the proliferation of T
cells is measured by uptake of
tritiated thvmidine. This assay is a general measure of T cell reactivity.
Since the majority of T cells respond
to and produce IL-2 upon activation, differences in responsiveness in this
assay in part reflect differences in IL-
2 production by the responding cells. The MLR results can be verified by a
standard lymphokine (IL-2)
detection assay. Current Protocols in Immunology, above, 3.15, 6.3.
A proliferative T cell response in an MLR assay may be due to direct mitogenic
properties of an
assayed molecule or to external antigen induced activation. Additional
verification of the T cell stimulatory
activity of the PRO polypeptides can be obtained by a costimulation assay. T
cell activation requires an
antigen specific signal mediated through the T-cell receptor (TCR) and a
costimulatory signal mediated
64
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/USOO105841
through a second ligand binding interaction, for example, the B7 (CD80.
CD86)/CD28 binding interaction.
CD28 crosslinking increases lymphokine secretion by activated T cells. T cell
activation has both negative and
positive controls through the binding of ligands which have a negative or
positive effect. CD28 and CTLA-4
are related glycoproteins in the Ig superfamily which bind to B7. CD28 binding
to B7 has a positive
S costimulation effect of T cell activation; conversely, CTLA-4 binding to B7
has a negative T cell deactivating
effect. Chambers. C. A, and Allison, J. P., Cc~rr. Opin. Immunol. (1997)
9_:396. Schwartz. R. H., Cell (1992)
71:1065; Linsey, P. S. and Ledbetter, J. A., Annu. Rev. Immunol. (1993)
_11:191; June, C. H. et al. ImmunoL
Today (1994) 15:321; Jerkins. M. K., Immunity ( 1994) 1:405. In a
costimulation assay, the PRO polypeptides
are assayed for T cell costimulatory or inhibitory activity.
PRO polypeptides. as well as other compounds of the invention, which are
stimulators (costimulators)
of T cell proliferation and agonists. e.g., agonist antibodies, thereto as
determined by MLR and costimulation
assays, for example, are useful in treating immune related diseases
characterized by poor, suboptimal or
inadequate immune function. These diseases are treated by stimulating the
proliferation and activation of T
cells (and T cell mediated immunity) and enhancing the immune response in a
mammal through administration
I S of a stimulatory compound, such as the stimulating PROpolvpeptides. The
stimulating polypeptide may, for
example. be a PR0200, PR0204, PR0212, PROZ16. PR0226, PR0240. PR0235, PR0245,
PR0172,
PR0273, PR0272, PR0332, PR0526, PR0701. PR0361, PR0362, PR0363, PR0364.
PR0356. PR0531,
PR0533, PR01083, PR0865. PR0770, PR0769, PR0788, PR01114, PR01007, PR01184,
PR01031,
PR01346, PRO1155, PR01250, PR01312. PROI 192, PR01246, PR01283, PR01195,
PR01343, PR01418,
PR01387, PR01410, PR01917, PR01868, PR0205, PR021, PR0269, PR0344, PR0333,
PR0381, PR0720,
PR0866, PR0840. PR0982, PR0836, PR01159, PR01358, PR01325, PR01338, PR01434,
PR04333,
PR04302, PR04430 or PR05727 polypeptide or an agonist antibody thereof.
Direct use of a stimulating compound as in the invention has been validated in
experiments with 4
IBB glycoprotein, a member of the tumor necrosis factor receptor family, which
binds to a ligand (4-iBBL)
expressed on primed T cells and signals T cell activation and growth.
Alderson, M. E. et al., J. Immunol.
(1994)24:2219.
The use of an agonist stimulating compound has also been validated
experimentally. Activation of 4-
IBB by treatment with an agonist anti-4-IBB antibody enhances eradication of
tumors. Hellstrom. I. and
Hellstrom, K. E., Crit. Rev. Immunol. ( 1998) 18:1. Immunoadjuvant therapy for
treatment of tumors, described
in more detail below, is another example of the use of the stimulating
compounds of the invention.
An immune stimulating or enhancing effect can also be achieved by antagonizing
or blocking the
activity of a PRO which has been found to be inhibiting in the MLR assay.
Negating the inhibitory activity of
the compound produces a net stimulatory effect. Suitable antagonistsiblocking
compounds are antibodies or
fragments thereof which recognize and bind to the inhibitory protein, thereby
blocking the effective interaction
of the protein with its receptor and inhibiting signaling through the
receptor. This effect has been validated in
experiments using anti-CTLA-4 antibodies which enhance T cell proliferation,
presumably by removal of the
inhibitory signal caused by CTLA-4 binding. Walunas, T. L. et al, Immunity
(1994) _1:405.
Alternatively, an immune stimulating or enhancing effect can also be achieved
by administration of a
PRO which has vascular permeability enhancing properties. Enhanced vacuolar
permeability would be
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00153758 PCTJUS00105841
beneficial to disorders which can be attenuated by local infiltration of
immune cells (e.g., monocytes,
eosinophils. PMNs) and inflammation.
On the other hand. PRO polvpeptides. as well as other compounds of the
invention, which are direct
inhibitors of T cell proliferationiactivation, lymphokine secretion, and/or
vascular permeability can be directly
used to suppress the immune response. These compounds are useful to reduce the
degree of the immune
response and to treat immune related diseases characterized by a hyperactive,
superoptimal, or autoimmune
response. This use of the compounds of the invention has been validated by the
experiments described above
in which CTLA-4 binding to receptor B7 deactivates T cells. The direct
inhibitory compounds of the invention
function in an analogous manner. The use of compound which suppress vascular
permeability would be
l0 expected to reduce inflammation. Such uses would be beneficial in treating
conditions associated with
excessive inflammation.
Alternatively. compounds, e.g., aneibodies, which bind to stimulating PRO
polypeptides and block the
stimulating effect of these molecules produce a net inhibitory effect and can
be used to suppress the T cell
mediated immune response by inhibiting T cell proliferatiorvactivation and.%or
lymphokine secretion. Blocking
I 5 the stimulating effect of the polvpeptides suppresses the immune response
of the mammal. This use has been
validated in experiments using an anti-IL2 anubody. In these experiments. the
antibody binds to IL2 and
blocks binding of IL2 to its receptor thereby achieving a T cell inhibitory
effect.
H. Animal Models
The results of the cell based in vitro assays can be further verified using in
vivn animal models and
20 assays for T-cell function. A variety of well known animal models can be
used to further understand the role
of the genes identified herein in the development and pathogenesis of immune
related disease, and to test the
efficacy of candidate therapeutic agents, including antibodies. and other
antagonists of the native. polypeptides.
including small molecule antagonists. The in vivo nature of such models makes
them predictive of responses
in human patients. Animal models of immune related diseases include both non-
recombinant and recombinant
25 (transgenic) animals. Non-recombinant animal models include, for example,
rodent, e.g>., murine models.
Such models can be venerated by introducing cells into syngeneic mice using
standard techniques, o.g.,
subcutaneous injection. tail vein injection. spleen implantation.
intraperitoneal implantation, implantation
under the renal capsule, etc.
Grafr-versus-host disease occurs when immunocompetent cells are transplanted
into
30 immunosuppressed or tolerant patients. The donor cells recognize and
respond to host antigens. The response
can vary from life threatening severe inflammation to mild cases of diarrhea
and weight loss. Graft-versus-host
disease models provide a means of assessing T cell reactivity against MHC
antigens and minor transplant
antigens. A suitable procedure is described in detail in Current Protocols in
Immunology, above, unit 4.3.
An animal model for skin allografr rejection is a means of testing the ability
of T cells to mediate in
35 vivo tissue destruction and a measure of their role in transplant
rejection. The most common and accepted
models use murine tail-skin grafts. Repeated experiments have shown that skin
allograft rejection is mediated
by T cells, helper T cells and killer-effector T cells, and not antibodies.
Auchincloss, H. Jr. and Sachs, D. H.,
Fundamental Immunology, 2nd ed., W. E. Paul ed., Raven Press, NY, 1989, 889-
992. A suitable procedure is
described in detail in Current Protocols in Immunology, above, unit 4.4. Other
transplant rejection models
66
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PC'T/US00/05841
which can be used to test the compounds of the invention are the allogeneic
heart transplant models described
by Tanabe, M. et al, Transplantation ( 1994) 58:23 and Tinubu, S. A. et al. J.
Immurrol. ( 1994) 4330-4338.
Animal models for delayed type hypersensitivity provides an assay of cell
mediated immune function
as well. Delayed type hypersensitivity reactions are a T cell mediated in vivo
immune response characterized
by inflammation which does not reach a peak until after a period of time has
elapsed after challenge with an
antigen. These reactions also occur in tissue specific autoimmune diseases
such as multiple sclerosis (MS) and
experimental autoimmune encephalomyelitis (EAE, a model for MS). A suitable
procedure is described in
detail in Current Protocols in Immunologt~, above, unit 4.5.
EAE is a T cell mediated autoimmune disease characterized by T cell and
mononuclear cell
inflammation aitd subsequent demyelination of axons in the central nervous
system. EAE is generally
considered to be a relevant animal model for MS in humans. Bolton. C..
~tTultiple Sclerosis ( 1995) 1:143.
Both acute and relapsing-remitting models have been developed. The compounds
of the invention can be
tested for T cell stimulatory or inhibitory activity against immune mediated
demyelinating disease using the
protocol described in Current Protocols in Immunology, above, units 15.1 and
15.2. See also the models for
1 S myelin disease in which oligodendrocytes or Schwattn cells arc grafted
into the central nervous system as
described in Duncan. 1. D. et al. Molec. ,tfed. Today ( 1997) 554-561.
Contact hypersensitivity is a simple delayed type hypersensitivity in vivo
assay of cell mediated
immune function. In this procedure, cutaneous exposure to exogenous haptens
which gives rise to a delayed
type hypersensitivity reaction which is measured and quantitated. Contact
sensitivity involves an initial
sensitizing phase followed by an elicitation phase. The elicitation phase
occurs when the T lymphocytes
encounter an antigen to which they have had previous contact. Swelling and
inflammation occur, making this
an excellent model of human allergic contact dermatitis. A suitable procedure
is described in detail in Current
Protocols in Immunoloy, Eds. J. E. Cologan, A. M. Kruisbeek, D. H. Margulies,
E. M. Shevach and W.
Strobes. John Wiley & Sons, Inc.. 1994, unit 4.2. See also Grabbe, S. and
Schwarz, T, Immeen. Today l9 (1):
37-44(1998).
An animal model for arthritis is collagen-induced arthritis. This model shares
clinical. histoloeical
and immunoloeical characteristics of human autoimmune rheumatoid arthritis and
is an acceptable model for
human autoimmune arthritis. Mouse and rat models are characterized by
synovitis, erosion of cartilage and
subchondral bone. The compounds of the invention can be tested for activity
against autoimmune arthritis
using the protocols described in Current Protocols in Immunology, above, units
15.5. See also the model using
a monoclonal antibody to CD18 and VLA-4 integrins described in Issekutz, A.C.
et al., Immunology (1996)
88:569.
A model of asthma has been described in which antigen-induced airway hyper-
reactivity, pulmonary
eosinophilia and inflammation are induced by sensitizing an animal with
ovalbumin and then challenging the
animal with the same protein delivered by aerosol. Several animal models
(guinea pig, rat, non-human
primate) show symptoms similar to atopic asthma in humans upon challenge with
aerosol antigens. Murine
models have many of the features of human asthma. Suitable procedures to test
the compounds of the
invention for activity and effectiveness in the treatment of asthma are
described by Wolyniec, W. W. et al, Am.
J. Respir. Cell Mol. Biol. ( 1998) 18:777 and the references cited therein.
67
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Additionally, the compounds of the invention can be tested on animal models
for psoriasis like
diseases. Evidence suggests a T cell pathogenesis for psoriasis. The compounds
of the invention can be tested
in the scid/scid mouse model described by Schon, M. P. et al, Nat. Med. (
1997) _3:183, in which the mice
demonstrate histopathologic skin lesions resembling psoriasis. Another
suitable model is the human skin/scid
mouse chimera prepared as described by Nickoloff. B. J. et al, Am. J. Path. (
1995) _146:580.
Recombinant (transgenic) animal models can be engineered by introducing the
coding portion of the
genes identified herein into the genome of animals of interest, using standard
techniques for producing
transgenic animals. .~rtimals that can serve as a target for transgenic
manipulation include, without limitation,
mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates,
e.g., baboons, chimpanzees and
monkeys. Techniques known in the an to introduce a transgene into such animals
include pronucleic
microinjection (Hoppe and Wanger, U.S. Patent No. 4,873,191); retrovirus-
mediated gene transfer into germ
lines (e.,~., Van der Putten et al., Pr-oc. Nail. Acad. Sci. USA _82. 6148-615
[ 1985]); gene targeting in embryonic
stem cells (Thompson et al., Cell 56, 313-321 [ 1989]); efectroporation of
embryos (Lo. Mol. Ccl.. Biol. _3,
1803-1814 [1983]); sperm-mediated gene transfer (Lavitrano et al., Cell _57.
717-73 [1989]). For review, see,
for example. U.S. Patent No. 4,736,866.
For the purpose of the present invention, transgenic animals include those
that carry the transgene
only in pan of their cells ("mosaic animals"). The transgene can be integrated
either as a single transgene, or in
concatamers, e.~., head-to-head or head-to-tail tandems. Selective
introduction of a transgene into a particular
cell type is also possible by following, for example, the technique of Lasko
et al., Prnc. Nutl. Acud. Sci. USA
R9. 6232-636 ( 1992).
The expression of the transgene in transgenic animals can be monitored by
standard techniques. For
example. Southern blot analysis or PCR amplification can be used to verify the
integration of the transgene.
The level of mRNA expression can then be analyzed using techniques such as in
situ hybridization. Northern
blot analysis. PCR, or immunocytochemistry.
The animals may be further examined for liens of immune disease pathology, for
example by
histoioeical examination to deteiniine infiltration of immune cells into
specific tissues. Blocking experiments
can also be performed in which the transgenic animals are treated with the
compounds of the invention to
determine the extent of the T cell proliferation stimulation or inhibition of
the compounds. In these
experiments. blocking antibodies which bind to the PRO polypeptide, prepared
as described above, are
administered to the animal and the effect on immune function is determined.
Alternatively, "knock out" animals can be constructed which have a defective
or altered gene
encoding a polvpeptide identified herein, as a result of homologous
recombination between the endogenous
gene encoding the polypeptide and altered genomic DNA encoding the same
polypeptide introduced into an
embryonic cell of the animal. For example, cDNA encoding a particular
polypeptide can be used to clone
genomic DNA encoding that polypeptide in accordance with established
techniques. A portion of the genomic
DNA encoding a particular polypeptide can be deleted or replaced with another
gene, such as a gene encoding
a selectable marker which can be used to monitor integration. Typically,
several kilobases of unaltered
flanking DNA (both at the 5' and 3' ends) are included in the vector [see
e.g., Thomas and Capecchi, Cell,
51:503 ( 1987) for a description of homologous recombination vectors). The
vector is introduced into an
embryonic stem cell line (e.g., by electroporation) and cells in which the
introduced DNA has homologously
68
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
recombined with the endogenous DNA are selected [see e.g., Li et al.. Cell.
_69:915 (1992)]. The selected cells
are then injected into a blastocyst of an animal (e.g., a mouse or rat) to
form aggregation chimeras [see e.g.,
Bradley, in Teratocarcinomas and Embn~onic Stem Cells: A Practical Approach,
E. 1. Robertson. ed. (IRL-
Oxford, 1987), pp. 1 13-152]. A chimeric embryo can then be implanted into a
suitable pseudopregnam female
S foster animal and the embryo brought to term to create a "knock out" animal.
Progeny harboring the
homologously recombined DNA in their germ cells can be identified by standard
techniques and used to breed
animals in which all cells of the animal contain the homologously recombined
DNA. Knockout animals can be
characterized for instance, for their ability to defend against certain
pathological conditions and for their
development of pathological conditions due to absence of the polypeptide.
I. ImmunoAdiuvant Therapy
In one embodiment, the immunostimulating compounds of the invention can be
used in
immunoadjuvant therapy for the treatment of tumors (cancer). It is now well
established that T cells recognize
human tumor specific antigens. One group of tumor antigens, encoded by the
MAGE, BAGS and GAGE
families of genes, are silent in all adult normal tissues , but are expressed
in significant amounts in tumors.
such as melanomas, Tune tumors, head and neck tumors, and bladder carcinomas.-
UeSmet. C. ~~t al.. (1996)
Proc. ~\'atl. ,4cud. Sci. L'S-t. 93:7149. It has been shown that costimulation
of T cells induces tumor regression
and an anntumor response both in vitro and in uit~n. Melero, 1. ~~t al.,
lVuture Afedicine ( 1997) _3:682: Kwon. E.
D. et aL. Proc. IVutl. Acud. Sci. US.4 ( 1997) 94: 8099: Lynch, D. H. et al,
Nature Medicine ( 1997) 3:625: Finn.
O. J. and Lotze. M. T., J. Immunol. ( 199R) 21:114. The stimulatory compounds
of the invention can be
administered as adjuvants. alone or together with a growth regulating agent,
cytotoxic acent or
chemotherapeutic agent, to stimulate T cell proliferationiactivation and an
antitumor response to tumor
antigens. The growth regulating, cytotoxic. or chemotherapeutic agent may be
administered in conventional
amounts using known administration regimes. Immunostimuiating activity by the
compounds of the invention
allows reduced amounts of the growth regulating, cytotoxic. or
chemotherapeutic agents thereby potentially
lowering the toxicity to the patient.
J. Screening Assays for Drug Candidates
Screening assays for drug candidates are designed to identify compounds that
bind to or complex with
the polypeptides encoded by the genes identified herein or a biologically
active fragment thereof, or otherwise
interfere with the interaction of the encoded polypeptides with other cellular
proteins. Such screening assays
will include assays amenable to high-throughput screening of chemical
libraries, making them particularly
suitable for identifying small molecule drug candidates. Small molecules
contemplated include synthetic
organic or inorganic compounds, including peptides, preferably soluble
peptides, (poly)peptide-
immunoglobulin fusions, and, in particular, antibodies including. without
limitation, poly- and monoclonal
antibodies and antibody fragments, single-chain antibodies, anti-idiotypic
antibodies, and chimeric or
3S humanized versions of such antibodies or fragments, as well as human
antibodies and antibody fragments. The
assays can be performed in a variety of formats, including protein-protein
binding assays, biochemical
screening assays, immunoassays and cell based assays, which are well
characterized in the art.
All assays are common in that they call for contacting the drug candidate with
a polypeptide encoded
by a nucleic acid identified herein under conditions and for a time sufficient
to allow these two components to
interact.
69
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00I05841
In binding assays. the interaction is binding and the complex formed can be
isolated or detected in the
reaction mixture. In a particular embodiment, the polypeptide encoded by the
gene identified herein or the
drug candidate is immobilized on a solid phase, e.g., on a microtiter plate,
by covalent or non-covalent
attachments. Non-covalent attachment generally is accomplished by coating the
solid surface with a solution
of the polypeptide and drying. Alternatively, an immobilized antibody, c.g., a
monoclonal antibody, specific
for the polypeptide to be immobilized can be used to anchor it to a solid
surface. The assay is performed by
adding the non-immobilized component. which may be labeled by a detectable
label, to the immobilized
component, e.g., the coated surface containing the anchored component. When
the reaction is complete, the
non-reacted components are removed, e.g., by washing, and complexes anchored
on the solid surface are
detected. Wlsen the originally non-immobilized component carries a detectable
label. the detection of label
immobilized on the surface indicates that complexing occurred. Where the
originally non-immobilized
component does not carry a label, complexing can be detected, for example, by
using a labelled antibody
specifically binding the immobilized complex.
If the candidate compound interacts with but does not bind to a particular
protein encoded by a gene
1 ~ identified herein. us interaction with that protein can be assayed by
methods well known for detecting protein
protein interactions. Such assays include traditional approaches, such as.
cross-linking, co
immunoprecipitation, and co-purification through gradients or chromatographic
columns. In addition. protein
protein interactions can be monitored by using a yeast-based genetic system
described by Fields and co
workers [Fields and Song, Nature lGondom 340. 24S-246 ( f 989); Chien et al..
Prnc. A'atl. Acad. Sci. USA _88,
9578-9582 (1991)] as disclosed by Chevray and Nathans, Proc. Nutl. Acad. Sci.
USA _89. 5789-5793 (1991).
Many transcriptional activators, such as yeast GAL4, consist of two physically
discrete modular domains, one
acting as the DNA-binding domain, while the other one functioning as the
transcription activation domain.
The yeast expression system described in the foregoing publications (generally
referred to as the "hvo-hybrid
system") takes advantage of this property, and employs two hybrid proteins.
one in which the target protein is
fused to the DNA-binding domain of GAL4. and another, in which candidate
activating proteins are fused to
the activation domain. The expression of a GAL1-lacZ reporter Gene under
control of a GAL-I-activated
promoter depends on reconstitution of GAL-I activity via protein-protein
interaction. Colonies containing
interacting polypeptides are detected with a chromogenic substrate for [3-
galactosidase. A complete kit
(MATCHMAKERT~) for identifying protein-protein interactions between two
specific proteins using the two
hybrid technique is commercially available from Clontech. This system can also
be extended to map protein
domains involved in specific protein interactions as well as to pinpoint amino
acid residues that are crucial for
these interactions.
In order to find compounds that interfere with the interaction of a gene
identified herein and other
infra- or extracellular components can be tested, a reaction mixture is
usually prepared containing the product
3S of the gene and the infra- or extraceilular component under conditions and
for a time allowing for the
interaction and binding of the two products. To test the ability of a test
compound to inhibit binding, the
reaction is run in the absence and in the presence of the test compound. In
addition, a placebo may be added to
a third reaction mixture, to serve as positive control. The binding (complex
formation) between the test
compound and the infra- or extracellular component present in the mixture is
monitored as described above.
The formation of a complex in the control reactions) but not in the reaction
mixture containing the test
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
compound indicates that the test compound interferes with the interaction of
the test compound and its reaction
partner.
K. Compositions and Methods for the Treatment of Immune Related Diseases
The compositions useful in the treatment of immune related diseases include,
without limitation.
proteins, antibodies, small organic molecules, peptides. phosphopeptides,
antisense and ribozyme molecules.
triple helix molecules, etc. that inhibit or stimulate immune function, for
example, T cell
proliferatiorvactivation, lymphokine release, or immune cell infiltration.
For example, antisense RNA and RIVA molecules act to directly block the
translation of mRNA by
hybridizing to targeted mRNA and preventing protein translation. When
antisense DNA is used.
oligodeoxvribonucleotides derived from the translation initiation site, e.g.,
between about -10 and +10
positions of the target gene nucleotide sequence, are preferred.
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific
cleavage of RNA.
Ribozymes act by sequence-specific hybridization to the complementary target
RNA, followed by
endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential
RNA target can be identified by
Known techniques. For further details see, e.y., Rossi, Current Biology -_t.
469-471 ( 1994). and PCT
publication No. WO 97x33551 (published September l8, 1997).
Nucleic acid molecules in triple helix formation used to inhibit transcription
should be single-stranded
and composed of deoxynucleotides. The base composition of these
oligonucleotides is designed such that it
promotes triple helix formation via Hoogsteen base pairing rules, which
generally require sizeable stretches of
purines or pyrimidines on one strand of a duplex. For further details see,
e.g., PCT publication No. WO
97/33551, supra.
These molecules can be identified by any or any combination of the screening
assays discussed above
and/or by any other screening techniques well known for those skilled in the
art.
L. Antibodies
The present invention further provides anti-PRO antibodies and fragments
thereof which may inhibit
(antagonists) or stimulate lagonistsl T cUl proliferation, eosinophil
infiltration. vascular permeability. etc.
Such anti-PRO antibodies or fragments thereof include polyclonal. monoclonal.
humanized. bispecilic and
heteroconjugate antibodies.
1. Polyclonal Antibodies
The anti-PRO antibodies may comprise polyclonal antibodies. Methods of
preparing polyclonal
antibodies are known to the skilled artisan. Polyclonal antibodies can be
raised in a mammal. for example, by
one or more injections of an immunizing agent and, if desired. an adjuvant.
Typically, the immunizing agent
and/or adjuvant will be injected in the mammal by multiple subcutaneous or
intraperitoneal injections. The
immunizing agent may include the PRO polypeptide or a fusion protein thereof.
It may be useful to conjugate
the immunizing agent to a protein known to be immunogenic in the mammal being
immunized. Examples of
such immunogenic proteins include but are not limited to keyhole limpet
hemocyanin, serum albumin, bovine
thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may
be employed include Freund's
complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic
trehalose dicorynomycolate).
The immunization protocol may be selected by one skilled in the art without
undue experimentation.
2. Monoclonal Antibodies
71
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00153758 PCTNS00/05841
The anti-PRO antibodies may, alternatively. be monoclonal antibodies.
Monoclonal antibodies may
be prepared using hybridoma methods, such as those described by Kohler and
Milstein. Nature, 2_56:495
( 1975). In a hybridoma method. a mouse, hamster, or other appropriate host
animal, is typically immunized
with an immunizing agent to elicit lymphocytes that produce or are capable of
producing antibodies that will
specifically bind to the immunizing agent. Alternatively, the lymphocytes may
be immunized in vitro.
The immunizing agent will typically include the PRO polypeptide or a fusion
protein thereof.
Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of
human origin are desired, or
spleen cells or lymph node cells are used if non-human mammalian sources are
desired. The lymphocytes are
then fused with an immortalized cell line using a suitable fusing agent, such
as polyethylene glycol, to form a
hybridoma cell -[coding. Monoclonal Antibodies: Principles and Practice,
Academic Press, (1986) pp. 59-
103]. Immortalized cell lines are usually transformed mammalian cells,
particularly myeloma cells of rodent,
bovine and human origin. Usually, rat or mouse myeloma cell lines are
employed. The hybridoma cells may
be cultured in a suitable culture medium that preferably contains one or more
substances that inhibit the growth
or survival of the untused, immortalized cells. For example, if the parental
cells lack the enzyme hypoxanthine
guanine phosphonbosyl transferasc (HGPRT or I3PRT), the culture medium for the
hybridomas typically will
include hypoxanthine. aminopterin. and thymidine ("HAT medium"), which
substances prevent the growth of
HGPRT-deficient cells.
Preferred immortalized cell lines are those that fuse efficiently. support
stable high level expression of
antibody by the selected antibody-producing cells, and are sensitive to a
medium such as HAT medium. More
preferred immortalized cell lines are murine myeloma lines, which can be
obtained, for instance, from the Salk
Institute Cell Distribution Center, San Diego, California and the American
Type Culture Collection. Manassas,
Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have
been described for the
production of human monoclonal antibodies [Kozbor. J. Immunol., _133:3001
(1984); Brodeur et al.,
Monoclonal Antibodu Production Techniques and Applications. Marcel Dekker,
Inc.. New York. ( 1987) pp.
51-63].
The culture medium in which the hybridoma cells are cultured can then be
assayed for the presence of
monoclonal antibodies directed against PRO. Preferably, the binding
specificity of monoclonal antibodies
produced by the hybridoma cells is determined by immunoprecipitation or by an
in vitro binding assay, such as
radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such
techniques and assays are
known in the an. The binding affinity of the monoclonal antibody can, for
example, be determined by the
Scatchard analysis of Munson and Pollard, Anal. Biochem.. _107:220 ( 1980).
Afrer the desired hybridoma cells are identified, the clones may be subcloned
by limiting dilution
procedures and grown by standard methods [coding, supra]. Suitable culture
media for this purpose include,
for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
Alternatively, the hybridoma
cells may be grown in vivo as ascites in a mammal.
The monoclonal antibodies secreted by the subclones may be isolated or
purified from the culture
medium or ascites fluid by conventional immunoglobulin purification procedures
such as, for example, protein
A-Sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis, or
affinity chromatography.
The monoclonal antibodies may also be made by recombinant DNA methods, such as
those described
in U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the
invention can be readily
72
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00105841
isolated and sequenced using conventional procedures (e.g., by using
oligonucleotide probes that are capable of
binding specifically to genes encoding the heavy and light chains of murine
antibodies). The hybridoma cells
of the invention serve as a preferred source of such DNA. Once isolated. the
DNA may be placed into
expression vectors, which are then transfected into host cells such as simian
COS cells, Chinese hamster ovary
(CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin
protein, to obtain the synthesis
of monoclonal antibodies in the recombinant host cells. The DNA also may be
modified. for example, by
substituting the coding sequence for human heavy and light chain constant
domains in place of the homologous
mutine sequences [U.S. Patent No. 4,816,567; Motrison et al.. supra) or by
covalently joining to the
immunoglobulin coding sequence all or pan of the coding sequence for a non-
immunoglobulin polypeptide.
Such a non-immunoglobulin polvpeptide can be substituted for the constant
domains of an antibody of the
invention. or can be substituted for the variable domains of one antigen-
combining site of an antibody of the
invention to create a chimeric bivalent antibody.
The antibodies are preferably monovalent antibodies. Methods for preparing
monovalent antibodies
are well known in the an. For example, one method involves recombinant
expression of immunoglobulin light
chain and modified heavy chain. The heavy chain is truncated Leneraliv at any
point in the Fc region so as to
prevent heavy chain crosslinking. Alternatively. the relevant cvsteine
residues are substituted with another
amino acid residue or are deleted so as to prevent crosslinking.
In vitro methods are also suitable for preparing monovalent antibodies.
Digestion of antibodies to
produce fragments thereof, particularly, Fab fragments. can be accomplished
using routine techniques known
in the art.
3. Human and Humanized Antibodies
The anti-PRO antibodies of the invention may further comprise humanized
antibodies or human
antibodies. Humanized forms of non-human (c.g., murine) antibodies are
chimeric immunoglobulins.
immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or
other antigen-binding
2S subsequences of antibodies) which contain minimal sequence derived from non-
human immunoglobulin.
Humanized antibodies include human immunoelobulins (recipient antibody) in
which residues from a
complementan~ detetzrtining region (CDR) of the recipient are replaced by
residues from a CDR of a non-
human species (donor antibody) such as mouse, rat or rabbit having the desired
specificity, affinity and
capacity. In some instances, Fv framework residues of the human immunoglobulin
are replaced by
corresponding non-human residues. Humanized antibodies may also comprise
residues which are found
neither in the recipient antibody nor in the imported CDR or framework
sequences. In general, the humanized
antibody will comprise substantially all of at least one, and typically two,
variable domains, in which all or
substantially all of the CDR regions correspond to those of a non-human
immunoglobulin and all or
substantially all of the FR regions are those of a human immunoglobulin
consensus sequence. The humanized
3S antibody optimally also will comprise at least a portion of an
immunoglobulin constant region (Fc), typically
that of a human immunoglobulin [Jones et al., Nature, _321:522-525 (1986);
Riechmann et al., Nature,
332:323-329 (1988); and Presta, Curr. Op. Struct. Biol.. 2:593-596 (1992)].
Methods for humanizing non-human antibodies are well known in the art.
Generally, a humanized
antibody has one or more amino acid residues introduced into it from a source
which is non-human. These
non-human amino acid residues are often referred to as "import" residues,
which are typically taken from an
73
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00153758 PGTIUS00/Q5841
"import" variable domain. Humanization can be essentially performed following
the method of Winter and
coworkers [Jones et ul., Nature, 321:522-525 (1986); Riechmann et ul., Nature,
_332:323-327 (1988);
Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs
or CDR sequences for the
corresponding sequences of a human antibody. Accordingly, such "humanized"
antibodies are chimeric
antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an
intact human variable domain has
been substituted by the corresponding sequence from a non-human species. In
practice, humanized antibodies
are typically human antibodies in which some CDR residues and possibly some FR
residues are substituted by
residues from analogous sites in rodent antibodies.
Human antibodies can also be produced using various techniques known in the
art, including phage
display libraries[Hoogenboom and Winter. J. ~tTol. Biol., 227:381 (1991);
Marks et al.. J. zffoL Biol.. _222:581
(1991)]. The techniques of Cole et al. and Boerner et al. are also available
for the preparation of human
monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer TMera~v,
Alan R. Liss, p. 77 (1985);
Boerner et al.. J. Immunol.. 147(1):86-95 ( 1991 ); U.S. 5,750, 373].
Similarly, human antibodies can be made
by introducing of human immunoglobulin loci into transgenic animals, c.g.,
mice in which the endogenous
I S immunoglobulin genes have been partially or completely inactivated. Upon
challenge. human antibody
production is observed, which closely resembles that seen in humans in all
respects, including gene
rearrangement. assembly, and antibody repertoire. This approach is described,
for example, in U.S. Patent
Nos. 5.45,807: 5.545,806: 5.569,825: 5,625,126; 5,633,425: 5,661,016, and in
the following scientific
publications: Marks et ul., BiolTechnologz~ 10, 779-783 (1992); Lonberg et
al.. Nature _368: 856-859 (1994);
Morrison. Nature 368. 812-13 ( 1994); Fishwild et ul., Nature Bioteclmolo~v
_l4, 845-51 ( 1996); Neuberger,
Nature Biotechrtolo~v 14, 826 ( 1996); Lonberg and Huszar, Intern. Rev.
Immunol. _13 65-93 ( 1995).
The antibodies may also be affinity matured using known selection and/or
mutagenesis methods as
described above. Preferred affinity matured antibodies have an affinity which
is five times, more preferably 10
times. even more preferably 20 or 30 times greater than the starting antibody
(generally marine. humanized or
human) from which the matured antibody is prepared.
4. Bispecitic Antibodies
Bispecific antibodies arc monoclonal. preferably human or humanized.
antibodies that have binding
specificities for at least two different antigens. In the present case. one of
the binding specificities may be for
the PRO, the other one is for any other antigen. and preferably for a cell-
surface protein or receptor or receptor
subunit.
Methods for making bispecific antibodies are known in the art. Traditionally,
the recombinant
production of bispecific antibodies is based on the coexpression of two
immunoglobulin heavy-chain/light-
chain pairs, where the two heavy chains have different specificities (Milstein
and Cuello. Nature. _305:537-539
[1983]). Because of the random assortment of immunoglobulin heavy and light
chains, these hybridomas
(quadromas) produce a potential mixture of ten different antibody molecules,
of which only one has the correct
bispecific structure. The purification of the correct molecule is usually
accompiished by affinity
chromatography steps. Similar procedures are disclosed in WO 93108829,
published 13 May 1993, and in
Traunecker et al., EMBO J., 10:3655-3659 ( 1991 ).
Antibody variable domains with the desired binding specificities (antibody-
antigen combining sites)
can be fused to immunoglobulin constant domain sequences. The fusion
preferably is with an immunoglobulin
74
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00105841
heavy-chain constant domain, comprising at least pan of the hinge, CI-i2. and
CH3 regions. It is preferred to
have the first heavy-chain constant region (CHI) containing the site necessary
for light-chain binding present
in at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain
fusions and. if desired, the
immunoglobulin light chain, are inserted into separate expression vectors, and
are cotransfected into a suitable
host organism. For further details of generating bispecific antibodies see,
for example, Suresh et aL, Methods
in Enzt~mology, 121:210 ( 1986).
According to another approach described in WO 96/2701 l, the interface between
a pair of antibody
molecules can be engineered to maximize the percentage of heterodimers which
are recovered from
recombinant cell culture. The preferred interface comprises at least a pan of
the CH3 region of an antibody
constant domain. In this method, one or more small amino acid side chains from
the interface of the first
antibody molecule are replaced with larger side chains (e.g., tyrosine or
tryptophan). Compensatory "cavities"
of identical or similar size to the large side chains) are created on the
interface of the second antibody
molecule by replacing large amino acid side chains with smaller ones (e.g.,
alanine or threonine). This
provides a mechanism for increasing the yield of the heterodimer over other
unwanted end-products such as
I S homodimers.
Bispecific antibodies can be prepared as full length antibodies or antibody
fragments Ie.g., F(ab'),
bispecific antibodies). Techniques for generating bispecific antibodies from
antibody fragments have been
described in the literature. For example, bispecific antibodies can be
prepared can be prepared using chemical
linkage. Brennan et ul., Science 229:81 ( 1985) describe a procedure wherein
intact antibodies are
proteolytically cleaved to generate F(ab')= fragments. These tiagments are
reduced in the presence of the
dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and
prevent intermolecular disulfide
formation. The Fab' fragments generated are then converted to
thionitrobenzoate (TNB) derivatives. One of
the Fab'-TNB derivatives is then reconvened to the Fab'-thiol by reduction
with mercaptoethylamine and is
mixed with an equimolar amount of the other Fab'-TNB derivative to form the
bispecific antibody. The
bispecific antibodies produced can be used as agents for the selective
immobilization of enzymes.
Fab' fragments may be directly recovered from E. coli and chemically coupled
to form bispecific
antibodies. Shalaby et ul.. J. E.rp. A~Icd. 175:217-225 ( 1992) describe the
production of a fully humanized
bispecific antibody F(ab'), molecule. Each Fab' fragment was separately
secreted from E. coli and subjected
to directed chemical coupling in vitro to form the bispecific antibody. The
bispecific antibody thus formed was
able to bind to cells overexpressing the ErbB2 receptor and normal human T
cells, as well as trigger the lyric
activity of human cytotoxic lymphocytes against human breast tumor targets.
Various technique for making and isolating bispecific antibody fragments
directly from recombinant
cell culture have also been described. For example, bispecific antibodies have
been produced using leucine
zippers. Kostelny et al.. J. Immunol. 148 (5):1547-1553 (1992). The leucine
zipper peptides from the Fos and
Jun proteins were linked to the Fab' portions of two different antibodies by
gene fusion. The antibody
homodimers were reduced at the hinge region to form monomers and then re-
oxidized to form the antibody
heterodimers. This method can also be utilized for the production of antibody
homodimers. The "diabody"
technology described by Hollinger et al., Proc. Natl. Acad. Sci. USA _90:6444-
6448 (1993) has provided an
alternative mechanism for making bispecific antibody fragments. The fragments
comprise a heavy-chain
variable domain (VH) connected to a light-chain variable domain (V~) by a
linker which is too short to allow
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGTNS00/05841
pairing between the two domains on the same chain. Accordingly, the VH and Vt,
domains of one fragment
are forced to pair with the complementary V~ and VH domains of another
fragment, thereby forming two
antigen-binding sites. Another strategy for making bispecific antibody
fragments by the use of single-chain Fv
(sFv) dimers has also been reported. See. Gruber et al.. J. Immunol. _152:5368
( 1994).
Antibodies with more than two valencies are contemplated. For example,
trispecific antibodies can be
prepared. Tutt et al.. J. Immunol. 147:60 ( 1991 ).
Exemplary bispecific antibodies may bind to two different epitopes on a given
PRO polypepide
herein. Alternatively, an anti-PRO arm may be combined with an arm which binds
to a triggering molecule on
a leukocyte such as a T-cell receptor molecule (e.g., CD2, CD3. CD28, or B7),
or Fc receptors for IgG (FcyR),
such as FcyRI (CD64), FcyRII (CD32) and FcyRIII (CD16) so as to focus cellular
defense mechanisms to the
cell expressing the particular PRO polypeptide. Bispecific antibodies may also
be used to localize cytotoxic
agents to cells which express a particular PRO polypeptide. These antibodies
possess a PRO polypeptide
binding arm and an arm which binds a cytotoxic agent or a radionuclide
chelator, such as EOTUBE, DPTA.
DOTA. or TETA. Another bispecific antibody of interest binds the PRO
polypeptide and further binds tissue
I 5 factor ( TF).
5. Heteroconiueate Antibodies
Heteroconjugate antibodies arc composed of two covalently joined antibodies.
Such antibodies have.
for example, been proposed to target immune system cells to unwanted cells
(U.S. Patent No. 4.676,980), and
for treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. It is
contemplated that the
antibodies may be prepared in vitro using known methods in synthetic protein
chemistry, including those
involving crosslinking agents. For example, immunotoxins may be constructed
using a disulfide exchange
reaction or by forming a thioether bond. Examples of suitable reagents for
this purpose include iminothiolate
and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S.
Patent No. 4.676,980.
6. Effector function eneineerine
It may be desirable to modify the antibody of the invention with respect to
effector function, so as to
enhance the effectiveness of the antibody in treating an immune related
disease, for example. For example
cysteine residueis) may be introduced in the Fc region, thereby allowing
interchain disulfide bond formation in
this region. The homodimeric antibody thus generated may have improved
internalization capability and/or
increased complement-mediated cell killing and antibody-dependent cellular
cytotoxicity (ADCC). See Caron
et al., J. Eap died. 176:1191-1195 (1992) and Shopes, B. J. Immunol. _148:2918-
2922 (1992). Homodimeric
antibodies with enhanced anti-tumor activity may also be prepared using
heterobifunctional cross-linkers as
described in Wolff et al. Cancer Research _53:2560-2565 (1993). Alternatively,
an antibody can be engineered
which has dual Fc regions and may thereby have enhanced complement lysis and
ADCC capabilities. See
Stevenson et al., Anti-Cancer Drug Design 3:219-230 ( 1989).
7. ImmunoconiuQates
The invention also pertains to immunoconjugates comprising an antibody
conjugated to a cytotoxic
agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active
toxin of bacterial, fungal, plant or
animal origin, or fragments thereof), or a radioactive isotope (i.e., a
radioconjugate).
Chemotherapeutic agents useful in the generation of such immunoconjugates have
been described
above. Enzymatically active toxins and fragments thereof which can be used
include diphtheria A chain,
76
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US0010584I
nonbinding active fragments of diphtheria toxin, exotoxin A chain (from
Pseudomonas aeruginosa). ricin A
chain. abrin A chain, modeccin A chain. alpha-sarcin, Aleurites.fordii
proteins, dianthin proteins, Phvtolaca
americana proteins (PAPI, PAPII. and PAP-S), momordica charantia inhibitor,
curcin, crotin, sapaonaria
officinalis inhibitor, gelonin, mitogellin. restrictocin, phenomycin, enomycin
and the tricothecenes. A variety
of radionuclides are available for the production of radioconjugated
antibodies. Examples include zt''Bi, ~3~I,
~ 3 ~ In, 9°Y and ~ s~Re.
Conjugates of the antibody and cytotoxic agent are made using a variety of
bifunctional protein
coupling agents such as N-succinimidyl-3-(2-pytidyldithiol) propionate (SPDP),
iminothiolane (IT),
bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL),
active esters (such as
disuccinimidyl -suberate). aldehydes (such as glutaraldehyde), bis-azido
compounds (such as bis (p-
azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-
diazoniumbenzoyl)-
ethylenediamine), diisocyanates (such as tolyene 2.6-diisocyanate), and bis-
active fluorine compounds (such as
1,S-difluoro-2,4-dinitrobenzene). For example, a ricin immunotoxin can be
prepared as described in Vitetta et
al. , Science 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-
methyldiethyiene
triaminepentaacetic acid (MX-DTPA) is an exemplary chelatine agent for
conjugation of radionucleotide to the
antibody. See W094/11026.
In another embodiment, the antibody may be conjugated to a "receptor" (such
streptavidin) for
utilization in tissue pretargeting wherein the antibody-receptor conjugate is
administered to the patient.
followed by removal of unbound conjugate from the circulation using a clearing
agent and then administration
of a "ligand" (e.g., avidin) which is conjugated to a cytotoxic agent (e.g., a
radionucleotide).
8. Immunoliposomes
The proteins, antibodies, etc. disclosed herein may also be formulated as
immunoliposomes.
Liposomes containing the antibody are prepared by methods known in the art,
such as described in Epstein et
al., Proc. Natl. Acad. Sci. USA. 82:3688 ( 1985): Hwang et al.. Proc. Natl
Acad. Scl. US.4, _77:4030 ( 1980);
and U.S. Pat. Nos. 4,485,045 and 4.544,545. Liposomes with enhanced
circulation time are disclosed in U.S.
Patent No. 5,013.556.
Particularly useful liposomes can be generated by the reverse phase
evaporation method with a lipid
composition comprising phosphatidylcholine. cholesterol and PEG-derivatized
phosphatidylethanolamine
(PEG-PE). Liposomes are extruded through filters of defined pore size to yield
liposomes with the desired
diameter. Fab' fragments of the antibody of the present invention can be
conjugated to the liposomes as
described in Martin er al., J. Biol. Chem. 257: 286-288 ( 1982) via a
disulfide interchange reaction. A
chemotherapeutic agent (such as doxorubicin) may be optionally contained
within the liposome. See Gabizon
et al., J. National Cancer lest. 81 ( 19) 1484 ( 1989).
M. Pharmaceutical Compositions
The active PRO molecules of the invention (e.g., PRO polypeptides, anti-PRO
antibodies, and/or
variants of each) as well as other molecules identified by the screening
assays disclosed above, can be
administered for the treatment of immune related diseases, in the form of
pharmaceutical compositions.
Therapeutic formulations of the active PRO molecule, preferably a polypeptide
or antibody of the
invention, are prepared for storage by mixing the active molecule having the
desired degree of purity with
optional pharmaceutically acceptable carriers. excipients or stabilizers
(Remington's Pharmaceutical Sciences
77
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PC1'/LJS00/05841
16th edition. Osol, A. Ed. [1980]). in the form of lyophilized formulations or
aqueous solutions. Acceptable
carriers, excipients. or stabilizers are nontoxic to recipients at the dosages
and concentrations employed. and
include buffers such as phosphate, citrate, and other organic acids;
antioxidants including ascorbic acid and
methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride;
hexamethonium chloride:
benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol:
allyi parabens such as methyl
or propyl paraben; catechol; resorcinol; cyclohexanol: 3-pentanol; and m-
cresol): low molecular weight (less
than about 10 residues) polypeptides; proteins, such as serum albumin,
gelatin. or immunoelobulins:
hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as
glycine, glutamine. asparagine,
histidine. arginine, or lysine; monosaccharides. disaccharides, and other
carbohydrates including glucose.
mannose. or dextrins; chelating agents such as EDTA; sugars such as sucrose,
mannitol. trehalose or sorbitol;
salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein
complexes): and/or non-ionic
surfactants such as TWEENr"~, PLURONICST~' or polyethylene glycol (PEG).
Compounds identified by the screening assays disclosed herein can be
formulated in an analogous
manner, using standard techniques well known in the art.
I S Lipofections or liposomes can also be used to deliver the PRO molecule
into cells. Where antibody
fragments are used, the smallest inhibitory fragment which specit7cally binds
to the binding domain of the
target protein is preferred. For example, based upon the variable region
sequences of an antibody. peptide
molecules can be designed which retain the ability to bind the target protein
sequence. Such peptides can be
synthesized chemically and/or produced by recombinant DNA technology (see,
e.g.. Marasco et al.. Proc. Natl.
Acad. Sci. USA 90, 7889-7893 [1993]).
The formulation herein may also contain more than one active compound as
necessary for the
particular indication being treated. preferably those with complementary
activities that do not adversely affect
each other. Alternatively, or in addition. the composition may comprise a
cytotoxic agent, cytokine or growth
inhibitory agent. Such molecules are suitably present in combination in
amounts that are effective for the
purpose intended.
The active PRO molecules may also be entrapped in microcapsules prepared, for
example, by
coacen~ation techniques or by interfacial polymerization. for example,
hydroxymethylcellulose or eelatin-
microcapsules and poly-(methylmethacylate) microcapsules, respectively, in
colloidal drug delivery systems
(for example. liposomes, albumin microspheres, microemulsions, nano-particles
and nanocapsules) or in
macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical
Sciences 16th edition. Osol,
A. Ed. ( 1980).
The fotirtulations to be used for in vivo administration must be sterile. This
is readily accomplished
by filtration through sterile filtration membranes.
Sustained-release preparations or the PRO molecules may be prepared. Suitable
examples of
sustained-release preparations include semipermeable matrices of solid
hydrophobic polymers containing the
antibody, which matrices are in the form of shaped articles, e.g., films, or
microcapsules. Examples of
sustained-release matrices include polyesters, hydrogels (for example, poly(2-
hydroxyethyl-methacrylate), or
poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-
glutamic acid and y-ethyl-L
glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-
glycolic acid copolymers such as the
LUPRON DEPOTT~' (injectable microspheres composed of lactic acid-glycolic acid
copolymer and leuprolide
78
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as
ethylene-vinyl acetate and lactic acid-
glycolic acid enable release of molecules for over 100 days, certain hydrogels
release proteins for shorter time
periods. When encapsulated antibodies remain in the body for a long time, they
may denature or aggregate as a
result of exposure to moisture at 37°C, resulting in a loss of
biological activity and possible changes in
immunogenicity. Rational strategies can be devised for stabilization depending
on the mechanism involved.
For example, if the aggregation mechanism is discovered to be intermolecular S-
S bond formation through
thio-disulfide interchange, stabilization may be achieved by modifying
sulfhydryl residues, lyophilizing from
acidic solutions, controlling moisture content, using appropriate additives.
and developing specific polymer
matrix compositions.
N. -Methods of Treatment
It is contemplated that the polypeptides, antibodies and other active
compounds of the present
invention may be used to treat various immune related diseases and conditions,
such as T cell mediated
diseases. including those characterized by infiltration of inflammatory cells
into a tissue, stimulation of T-cell
proliferation. inhibition of T-cell proliferation, increased or decreased
vascular permeability or the inhibition
thereof.
Exemplary conditions or disorders to be treated with the polypeptides,
antibodies and other
compounds of the invention, include, but are not limited to systemic lupus
erythematosis. rheumatoid arthritis,
juvenile chronic arthritis, osteoarthritis, spondyloarthropathies. systemic
sclerosis (scleroderma), idiopathic
inflammatory myopathies (dermatomyositis, polymyositis), Sjogren's syndrome.
systemic vasculitis.
sarcoidosis, autoimmune hemolytic anemia (immune pancytopenia. paroxysmal
nocturnal hemoglobinuria),
autoimmune thrombocytopenia (idiopathic thrombocytopenic purpura, immune-
mediated thrombocytopenia),
thyroiditis (Grave's disease, Hashimoto's thyroiditis. juvenile lymphocvtic
thyroiditis, atrophic thyroiditis),
diabetes mellitus, immune-mediated renal disease (glomerulonephritis,
tubulointerstitial nephritis).
demyelinating diseases of the central and peripheral nervous systems such as
multiple sclerosis. idiopathic
demyelinating polyneuropathy or Guillain-Barre syndrome, and chronic
inflammatory demyelinating
polyneuropathy, hepatobiliary diseases such as infectious hepatitis (hepatitis
A, B, C, D. E and other non-
hepatotropic viruses), autoimmune chronic active hepatitis, primary biliary
cirrhosis, granulomatous hepatitis,
and sclerosing cholangitis, inflammatory bowel disease (ulcerative colitis:
Crohn's disease), gluten-sensitive
enteropathy, and Whipple's disease, autoimmune or immune-mediated skin
diseases including bullous skin
diseases, erythema multiforme and contact dermatitis, psoriasis. allergic
diseases such as asthma, allergic
rhinitis, atopic dermatitis, food hypersensitivity and urticaria. immunologic
diseases of the lung such as
eosinophilic pneumonias, idiopathic pulmonary fibrosis and hypersensitivity
pneumonitis, transplantation
associated diseases including grafr rejection and graft -versus-host-disease.
In systemic lupus erythematosus. the central mediator of disease is the
production of auto-reactive
antibodies to self proteins/tissues and the subsequent generation of immune-
mediated inflammation. antibodies
either directly or indirectly mediate tissue injury. Though T lymphocytes have
not been shown to be directly
involved in tissue damage, T lymphocytes are required for the development of
auto-reactive antibodies. The
genesis of the disease is thus T lymphocyte dependent. Multiple organs and
systems are affected clinically
including kidney, lung, musculoskeletal system, mucocutaneous, eye, central
nervous system, cardiovascular
system, gastrointestinal tract, bone marrow and blood.
79
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Rheumatoid arthritis (RA) is a chronic systemic autoimmune inflammatory
disease that mainly
involves the synovial membrane of multiple joints with resultant injury to the
articular cartilage. The
pathogenesis is T lymphocyte dependent and is associated with the production
of rheumatoid factors, auto-
antibodies directed against self IgG, with the resultant formation of immune
complexes that attain high levels
in joint fluid and blood. These complexes in the joint may induce the marked
infiltrate of lymphocytes and
monocvtes into the synovium and subsequent marked synovial changes; the joint
space/fluid if infiltrated by
similar cells with the addition of numerous neutrophils. Tissues affected are
primarily the joints, often in
symmetrical pattern. However. extra-articular disease also occurs in two major
forms. One form is the
development of extra-articular lesions with ongoing progressive joint disease
and typical lesions of pulmonary
fibrosis, vascuiitis, and cutaneous ulcers. The second form of extra-articular
disease is the so called Felty's
syndrome which occurs late in the RA disease course, sometimes after joint
disease has become quiescent. and
involves the presence of neutropenia. thrombocytopenia and splenomegaly. This
can be accompanied by
vasculitis in multiple organs with formations of infarcts, skin ulcers and
gangrene. Patients often also develop
rheumatoid nodules in the subcutis tissue overlying affected joints; the
nodules late stage have necrotic centers
I S surrounded by a mixed inflammatory cell infiltrate. Other manifestations
which can occur in R.A include:
pericarditis, pleuritis, coronary arteritis. intesutial pneumonitis with
pulmonary fibrosis. keratoconjunctivitis
sicca, and rhematoid nodules.
Juvenile chronic arthritis is a chronic idiopathic inflammatory disease which
begins often at less than
16 years of age. Its phenotype has some similarities to RA; some patients
which are rhematoid factor positive
are classified as juvenile rheumatoid arthritis. The disease is sub-classified
into three major categories:
pauciarticular, polyarticular, and systemic. The arthritis can be severe and
is typically destructive and leads to
joint ankylosis and retarded growth. Other manifestations can include chronic
anterior uveitis and systemic
amyloidosis.
Spondyloarthropathies are a group of disorders with some common clinical
features and the common
a,sociation with the expression of I-iLA-B27 gene product. The disorders
include: ankylosing sponylitis.
Reiter's syndrome (reactive arthritis J, arthritis associated with
inflammatory bowel disease, spondyiitis
associated with psonasis. juvenile onset spondyloarthropathy and
undifferentiated spondyloarthropathy.
Distinguishing features include sacroileitis with or without spondylitis:
inflammatory asymmetric arthritis;
association with HLA-B27 (a serologically detmed allele of the HLA-B locus of
class I MHC); ocular
inflammation, and absence of autoantibodies associated with other rheumatoid
disease. The cell most
implicated as key to induction of the disease is the CD8+ T lymphocyte, a cell
which targets antigen presented
by class I MHC molecules. CD8+ T cells may react against the class I MHC
allele HLA-B27 as if it were a
foreign peptide expressed by MHC class I molecules. It has been hypothesized
that an epitope of HLA-B27
may mimic a bacter7al or other microbial antigenic epitope and thus induce a
CD8+ T cells response.
Systemic sclerosis (scleroderma) has an unknown etiology. A hallmark of the
disease is induration of
the skin: likely this is induced by an active inflammatory process.
Scleroderma can be localized or systemic;
vascular lesions are common and endothelial cell injury in the
microvasculature is an early and important event
in the development of systemic sclerosis: the vascular injury may be immune
mediated. An immunologic basis
is implied by the presence of mononuclear cell infiltrates in the cutaneous
lesions and the presence of anti-
nuclear antibodies in many patients. ICAM-1 is often upregulated on the cell
surface of fibroblasts in skin
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
lesions suggesting that T cell interaction with these cells may have a role in
the pathogenesis of the disease.
Other organs involved include: the gastrointestinal tract: smooth muscle
atrophy and fibrosis resulting in
abnormal peristalsis/motility; kidney: concentric subendothelial intimal
proliferation affecting small arcuate
and interlobular arteries with resultant reduced renal conical blood flow,
results in proteinuria. azotemia and
hypertension; skeletal muscle: atrophy, interstitial fibrosis; inflammation;
lung: interstitial pneumonitis and
interstitial fibrosis; and heart: contraction band necrosis,
scarringifibrosis.
Idiopathic inflammatory myopathies including dermatomyositis, polymyositis and
others are disorders
of chronic muscle inflammation of unknown etiology resulting in muscle
weakness. Muscle
injuryiinllammation is often symmetric and progressive. Autoantibodies are
associated with most forms.
These myositis-specific autoantibodies are directed against and inhibit the
function of components. proteins
and RNA's. involved in protein synthesis.
Sjogren's syndrome is due to immune-mediated inflammation and subsequent
functional destruction
of the tear glands and salivary glands. The disease can be associated with or
accompanied by inflammatory
connective tissue diseases. The disease is associated with autoantibody
production against Ro and La antigens,
both of which are small RNA-protein complexes. Lesions result in
keratoconiunctivitis sicca. xerostomia, with
other manttestations or associations including bilary cirrhosis. peripheral or
sensorv_ neuropathy. and palpable
purpura.
Systemic vasculitis are diseases in which the primary lesion is inflammation
and subsequent damage
to blood vessels which results in ischemiainecrosisidegeneration to tissues
supplied by the affected vessels and
eventual end-organ dysfunction in some cases. Vasculitides can also occur as a
secondary lesion or sequelae to
other immune-inflammatory mediated diseases such as rheumatoid arthritis,
systemic sclerosis. etc.,
particularly in diseases also associated with the formation of immune
complexes. Diseases in the primary
systemic vasculitis group include: systemic necrotizing vasculitis:
polyarteritis nodosa. allergic angiitis and
granulomatosis. polyangiitis: ~Vegener's granulomatosis; lymphomatoid
granulomatosis; and giant cell arteritis.
Miscellaneous vasculitides include: mucocutaneous lymph node syndrome (MLNS or
Kawasaki's disease),
isolated CNS vasculitis. Behet's disease. thromboanginis obliterans (Buerger's
disease) and cutaneous
necrotizing venulitis. The pathogenic mechanism of most of the types of
vasculitis listed is believed to be
primarily due to the deposition of immunoglobulin complexes in the vessel wall
and subsequent induction of
an inflammatory response either via ADCC, complement activation. or both.
Sarcoidosis is a condition of unknown etiology which is characterized by the
presence of epithelioid
granulomas in nearly any tissue in the body; involvement of the lung is most
common. The pathogenesis
involves the persistence of activated macrophages and lymphoid cells at sites
of the disease with subsequent
chronic sequelae resultant from the release of locally and systemically active
products released by these cell
types.
Autoimmune hemolytic anemia including autoimmune hemolytic anemia, immune
pancytopenia. and
paroxysmal noctural hemoglobinuria is a result of production of antibodies
that react with antigens expressed
on the surface of red blood cells (and in some cases other blood cells
including platelets as well) and is a
reflection of the removal of those antibody coated cells via complement
mediated lysis and/or ADCC/Fc-
receptor-mediated mechanisms.
81
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
In autoimmune thrombocytopenia inciuding thrombocytopenic putpura. and immune-
mediated
thrombocytopenia in other clinical settings, platelet destructiorvremoval
occurs as a result of either antibody or
complement attaching to platelets and subsequent removal by~ complement lysis,
ADCC or FC-receptor
mediated mechanisms.
Thyroiditis including Grave's disease. Hashimoto's thyroiditis, juvenile
lymphocytic thyroiditis, and
atrophic thyroiditis, are the result of an autoimmune response against thyroid
antigens with production of
antibodies that react with proteins present in and ofren specific for the
thyroid gland. Experimental models
exist including spontaneous models: rats (BIJF and BB rats) and chickens
(obese chicken strain); inducible
models: immunization of animals with either thyroglobulin. thyroid microsomal
antigen (thyroid peroxidase).
Type I diabetes mellitus or insulin-dependent diabetes is the autoimmune
destruction of pancreatic
islet p cells; this destruction is mediated by auto-antibodies and auto-
reactive T cells. Antibodies to insulin or
the insulin receptor can also produce the phenotype of insulin-non-
responsiveness.
Immune mediated renal diseases, including glomerulonephritis and
tubulointerstitial nephritis. are the
result of antibody or T lymphocyte mediated injury to renal tissue either
directly as a result of the production of
1 ~ autoreactive antibodies or T cells aeainst renal antieens or indirectly as
a result of the deposition of antibodies
and/or immune complexes in the kidney that are reactive against other, non-
renal antigens. Thus other
immune-mediated diseases that result in the formation of immune-complexes can
also induce immune
mediated renal disease as an indirect sequelae. Both direct and indirect
immune mechanisms result in
inflammatory response that producesiinduces lesion development in renal
tissues with resultant organ function
impairment and in some cases progression to renal failure. Both humoral and
cellular immune mechanisms can
be involved in the pathogenesis of lesions.
Demyelinating diseases of the central and peripheral nervous systems.
including Multiple Sclerosis;
idiopathic demyelinating polyneuropathy or Guillain-Barre syndrome; and
Chronic Inflammatory
Demyelinating Polyneuropathy, are believed to have an autoimmune basis and
result in nerve demv_ elination as
a result of damage caused to oligodendrocytes or to myelin directly. In MS
there is evidence to suggest that
disease induction and progression is dependent on T lymphocytes. Multiple
Sclerosis is a demyelinating
disease that is T lymphocyte-dependent and has either a relapsing-remitting
course or a chronic progressive
course. The etiology is unknown: however, viral infections, genetic
predisposition, environment, and
autoimmunity all contribute. Lesions contain infiltrates of predominantly T
lymphocyte mediated. microglial
cells and infiltrating macrophages; CD4+T lymphocytes are the predominant cell
type at lesions. The
mechanism of oligodendrocyte cell death and subsequent demyelination is not
known but is likely T
lymphocyte driven.
Inflammatory and Fibrotic Lung Disease, including Eosinophilic Pneumonias;
Idiopathic Pulmonary
Fibrosis, and Hypersensitivity Pneumonitis may involve a disregulated immune-
inflammatory response.
Inhibition of that response would be of therapeutic benefit.
Autoimmune or Immune-mediated Skin Disease including Bullous Skin Diseases,
Erythema
Multifotme, and Contact Dermatitis are mediated by auto-antibodies, the
genesis of which is T lymphocyte-
dependent.
Psoriasis is a T lymphocyte-mediated inflammatory disease. Lesions contain
infiltrates of T
lymphocytes, macrophages and antigen processing cells, and some neutrophils.
82
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Allergic diseases, including asthma: allergic rhinitis; atopic dermatitis:
food hypersensitivity; and
urticaria are T lymphocyte dependent. These diseases are predominantly
mediated by T lymphocyte induced
inflammation, IgE mediated-inflammation or a combination of both.
Transplantation associated diseases, including Grafr rejection and Grafr-
Versus-Host-Disease
(GVHD) are T lymphocyte-dependent; inhibition of T lymphocyte function is
ameliorative.
Other diseases in which intervention of the immune and/or inflammatory
response have benefit are infectious
disease including but not limited to viral infection (including but not
limited to AIDS. hepatitis A, B, C, D, E
and herpes) bacterial infection, fungal infections, and protozoal and
parasitic infections (molecules (or
derivativesiagonists) which stimulate the MLR can be utilized therapeutically
to enhance the immune response
l0 to infectious agents), diseases of immunodeficiency
(moleculesiderivativesiagonists) which stimulate the MLR
can be utilized therapeutically to enhance the immune response for conditions
of inherited. acquired, infectious
induced (as in HIV infection). or iatrogenic (i.e., as from chemotherapy)
immunodeficiency), and neoplasia.
It has been demonstrated that some human cancer patients develop an antibody
and/or T lymphocyte
response to antigens on neoplastic cells. It has also been shown in animal
models of neoplasia that
enhancement of the immune response can result in rejection or regression of
that particular neoplasm.
Molecules that enhance the T lymphocyte response in the MLR have utility in
uivo in enhancine the immune
response against neoplasia. Molecules which enhance the T lymphocyte
proliferative response in the MLR (or
small molecule agonists or antibodies that affected the same receptor in an
agonistic fashion) can be used
therapeutically to treat cancer. Molecules that inhibit the lymphocyte
response in the MLR also function in
viao during neoplasia to suppress the immune response to a neoplasm; such
molecules can either be expressed
by the neoplastic cells themselves or their expression can be induced by the
neoplasm in other cells.
Antagonism of such inhibitory molecules (either with antibody, small molecule
antagonists or other means)
enhances immune-mediated tumor rejection.
Additionally, inhibition of molecules with proinflammatory properties may have
therapeutic benefit in
reperfucion injury: stroke; myocardial infarction; atherosclerosis; acute lung
injury: hemotrhaeic shock: burn:
sepsisiseptic shock: acute tubular necrosis; endometriosis: degenerative joint
disease and pancreatic.
The compounds of the present invention, e.b., polypeptides or antibodies. are
administered to a
mammal, preferably a human, in accord with known methods. such as intravenous
administration as a bolus or
by continuous infusion over a period of time, by intramuscular,
intraperitoneal. intracerobrospinal,
subcutaneous, infra-articular, intrasynovial. intrathecal, oral, topical, or
inhalation (intranasal. intrapulmonary)
routes. Intravenous or inhaled administration of polypeptides and antibodies
is preferred.
In immunoadjuvant therapy, other therapeutic regimens, such administration of
an anti-cancer agent,
may be combined with the administration of the proteins, antibodies or
compounds of the instant invention.
For example, the patient to be treated with a the immunoadjuvant of the
invention may also receive an anti-
cancer agent (chemotherapeutic agent) or radiation therapy. Preparation and
dosing schedules for such
chemotherapeutic agents may be used according to manufacturers' instructions
or as determined empirically by
the skilled practitioner. Preparation and dosing schedules for such
chemotherapy are also described in
Cherrrotherapy Service Ed., M.C. Petry, Williams & Wilkins, Baltimore, MD
(1992). The chemotherapeutic
agent may precede. or follow administration of the immunoadjuvant or may be
given simultaneously therewith.
Additionally, an anti-oestrogen compound such as tamoxifen or an anti-
progesterone such as onapristone (see,
83
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
EP 616812) may be given in dosages known for such molecules.
It may be desirable to also administer antibodies aeainst other immune disease
associated or tumor
associated antigens, such as antibodies which bind to CD20, CDI la. CD18.
ErbB2. EGFR, ErbB3, ErbB4, or
vascular endothelial factor (VEGF). Alternatively, or in addition, two or more
antibodies binding the same or
nvo or more different antigens disclosed herein may be coadministered to the
patient. Sometimes, it may be
beneficial to also administer one or more cytokines to the patient. In one
embodiment, the PRO polypeptides
are coadministered with a growth inhibitory agent. For example, the growth
inhibitory agent may be
administered first. followed by a PRO poiypeptide. However, simultaneous
administration or administration
first is also contemplated. Suitable dosages for the growth inhibitory agent
are those presently used and may
be lowered due to the combined action (synergy) of the growth inhibitory agent
and the PRO polypeptide.
For the treatment or reduction in the severity of immune related disease. the
appropriate dosage of an
a compound of the invention will depend on the type of disease to be treated,
as defined above. the severity and
course of the disease, whether the agent is administered for preventive or
therapeutic purposes, previous
therapy, die patient's clinical history and response to the compound. and the
discretion of the attending
physician. The compound is suitably administered to the patient at one time or
over a series of treatments.
For example. depending on the type and severity of the disease. about 1 ftg/kg
to 16 mn.,,ikg (e.g.. 0.1-
mg~kgj of polypeptide or antibody is an initial candidate dosage for
administration to the patient. whether,
for example, by one or more separate administrations, or by continuous
infusion. A typical daily dosage might
range tiom about I pgikg to 100 mgikg or more, depending on the factors
mentioned above. For repeated
20 administrations over several days or longer, depending on the condition,
the treatment is sustained until a
desired suppression of disease symptoms occurs. However, other dosage regimens
may be useful. The
progress of this therapy is easily monitored by conventional techniques and
assays.
O. Articles of Manufacture
In another embodiment of the invention, an article of manufacture containing
materials (e.b~.,
comprising a PRO molecule) useful for the diagnosis or treatment of the
disorders described above is provided.
The article of manutacture comprises a container and an instruction. Suitable
containers include. for example,
bottles. vials. syringes. and test tubes. The containers may be formed from a
variety of materials such as glass
or plastic. The container holds a composition which is effective for
diagnosing or treating the condition and
may have a sterile access port (for example the container may be an
intravenous solution bag or a vial having a
stopper pierceable by a hypodermic injection needle). The active agent in the
composition is usually a
polypeptide or an antibody of the invention. An instruction or label on, or
associated with, the container
indicates that the composition is used for diagnosing or treating the
condition of choice. The article of
manufacture may further comprise a second container comprising a
pharmaceutically-acceptable buffer, such
as phosphate-buffered saline. Ringer's solution and dextrose solution. It may
further include other materials
desirable from a commercial and user standpoint, including other buffers,
diluents. filters, needles, syringes,
and package inserts with instructions for use.
P. Dia~ttosis and Prot?nosis of Immune Related Disease
Cell surface proteins. such as proteins which are overexpressed in certain
immune related diseases, are
excellent targets for drug candidates or disease treatment. The same proteins
along with secreted proteins
encoded by the genes amplified in immune related disease states find
additional use in the diagnosis and
' 84
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PC'T/US00/05841
prognosis of these diseases. For example, antibodies directed against the
protein products of genes amplified
in multiple sclerosis, rheumatoid arthritis, or another immune related
disease. can be used as diagnostics or
prognostics.
For example, antibodies, including antibody fragments, can be used to
qualitatively or quantitatively
detect the expression of proteins encoded by amplified or overexpressed genes
("marker gene products"). The
antibody preferably is equipped with a detectable, e.g., fluorescent label,
and binding can be monitored by light
microscopy, flow cytometry, fluorimetry, or other techniques known in the art.
These techniques are
particularly suitable. if the overexpressed gene encodes a cell surface
protein Such binding assays are
performed essentially as described above.
In situ_detection of antibody binding to the marker gene products can be
performed, for example, by
immunotluorescence or immunoelectron microscopy. For this purpose, a
histological specimen is removed
from the patient. and a labeled antibody is applied to it, preferably by
overlaying the antibody on a biological
sample. This procedure also allows for determining the distribution of the
marker gene product in the tissue
examined. It will be apparent for those skilled in the an that a wide variety
of histological methods are readily
available for in .vuu detection.
The following examples are offered for illustrative purposes only. and are not
intended to limit the
scope of the present invention in any way.
All patent and literature references cited in the present specification are
hereby incorporated by
reference in their entirety.
EXAMPLES
Commercially available reagents referred to in the examples were used
according to manufacturer's
instructions unless otherwise indicated. The source of those cells identified
in the following examples, and
throughout the specification, by ATCC accession numbers is the American Type
Culture Collection, Manassas.
VA. Unless otherwise noted, the present invention uses standard procedures of
recombinant DNA technology,
such as those described hereinabove and in the following textbooks: Sambrook
et al., ;tfoleculur Cloning .9
Laboratnrm A~lanual. Cold Spring Harbor Press N.Y., 1989; Ausubel et ul.,
Current PrntocoLs in A~lolecular
Biology, Green Publishing Associates and Wiley Interscience, N.Y., 1989; Innis
et ul.. PCR Protocols: .4
Guide to ,tfethods and Applications. Academic Press, inc., N.Y., 1990; Harlow
et al., Antibodies: A Laboraton~
,l~lanual. Cold Spring Harbor Press, Cold Spring Harbor, 1988; Gait, M.J.,
Oligonucleotide Synthesis, IRL
Press, Oxford, 1984; R.I. Freshney, Animal Cell Culture, 1987; Coligan et al.,
Current Protocols in
Immunology, 1991.
EXAMPLE 1
Isolation of cDNA clones Encoding Human PR0200, PR0204, PR0212, PR0216.
PR0226, PR0240,
PR0235. PR0245, PR0172, PR0273, PR0272, PR0332, PR0526, PR0701, PR0361,
PR0362, PR0363,
PR0364, PR0356, PR0531, PR0533, PR01083, PR0865, PR0770, PR0769, PR0788,
PR01114, PR01007,
PR01184, PR01031, PR01346, PR01155, PR01250, PR01312, PR01192, PR01246.
PR01283, PR01195,
PR013-13. PR01418, PR01387, PROI410, PR01917, PR01868, PR0205, PR021, PR0269,
PR0344,
PR0333, PR0381, PR0720, PR0866, PR0840, PR0982, PR0836, PR01159, PR01358,
PR01325,
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00153758 PGT/US00105841
PR01338, PR01434. PR04333. PR04302, PR04430 and PR05727 polypeptide.
Various techniques were employed for isolating the cDNA clones described
below. A general
description of the methods employed follows immediately hereafter. whereas the
details relating the specific
sequences isolated is recited separately for each native sequence. It is
understood that the actual sequences of
the PRO polypeptides are those which are contained within or encoded by the
clone deposited with the ATCC -
and that in the in event of any discrepancy between the sequence deposited and
the sequence disclosed herein,
the sequence of the deposit is the true sequence
ECD Homology:
The extracellular domain (ECD) sequences (including the secretion signal
sequence. if any) from
about 950 known secreted proteins from the Swiss-Prot public database were
used to search EST databases.
The EST databases included public EST databases (e.g., GenBank), a private EST
database (LIFESEQ~', Incyte
Pharmaceuticals. Palo Alto, CA), and proprietary ESTs from Genentech. The
search was performed using the
computer program BLAST or BLAST2 [Altschul et ul.. ,LfetGods iu En_umolo~u,
_266: 460-480 ((996)] as a
comparison of the ECD protein sequences to a 6 frame translation of the EST
sequences. Those comparisons
resulting in a BLAST score of 70 (or in some cases, 90) or greater that did
not encode known proteins were
clustered and assembled into consensus DNA sequences with the program "phrap"
(Phil Green. University of
Washington, Seattle, Washington).
Using various ESTs, drawing from both public and private databases, a
consensus DNA sequence was
assembled. Oligonucleotides were then synthesized to identify by PCR a cDNA
library that contained the
sequence of interest and for use as probes to isolate a clone encoding the
particular native sequence PRO
polypeptide identified herein.
In order to screen several libraries for a source of a full-length, native
sequence clone, DNA from the
libraries was screened by PCR amplification with the PCR primer pair
identified below. A positive library was
then used to isolate clones encoding the particular native sequence PRO
polypeptide using the probe
oligonucleotide and one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from various human
tissue libraries.
including, e.g.. fetal lung, fetal liver. fetal brain, small intestine. smooth
muscle cells, etc. The cDNA libraries
used to isolated the cDNA clones were constructed by standard methods using
commercially available reagents
such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo
dT containing a Notl site,
linked with blunt to SaII hemikinased adaptors, cleaved with NotI, sized
appropriately by gel electrophoresis,
and cloned in a defined orientation into a suitable cloning vector (such as
pRKB; pRKSB is a precursor of
pRKSD that does not contain the SfiI site; see, Holmes et al., Science.
_253:1278-1280 (1991)) in the unique
XhoI and NotI sites. The clones were sequenced using known and readily
available methodology.
Amylase yeast screen:
1. Preparation of olieo dT primed cDNA library
mRNA was isolated from various tissues (e.g., such as those indicated above
under the ECD homology
procedure) using reagents and protocols from Invitrogen, San Diego, CA (Fast
Track 2). This RNA was used to
86
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
generate an oligo dT primed cDNA library in the vector pRKSD using reagents
and protocols from Life
Technologies, Gaithersburg, MD (Super Script Plasmid System j. In this
procedure, the double stranded cDNA
was sized to greater than 1000 by and the Sall/NotI Tinkered cDNA was cloned
into XhoI/NotI cleaved vector.
pRKSD is a cloning vector that has an sp6 transcription initiation site
followed by an SfiI restriction edzyme
site preceding the XhoI/NotI cDNA cloning sites.
2. Preparation of random primed cDNA libraty
A secondary cDNA library was generated in order to preferentially represent
the 5' ends of the
primary cDNA clones. Sp6 RNA was generated from the primary library (described
above), and this RNA was
used to generate a random primed cDNA library in the vector pSST-AMY.O using
reagents and protocols from
Life Technologies (Super Script Plasmid System, referenced above). In this
procedure the double stranded
cDNA was sized to 500-1000 bp, Tinkered with blunt to NotI adaptors, cleaved
with SfiI, and cloned into
SfiIMotI cleaved vector. pSST-AMY.O is a cloning vector that has a yeast
alcohol dehydrogenase promoter
preceding the cDNA cloning sites and the mouse amylase sequence (the mature
sequence without the secretion
signal) followed by the yeast alcohol dehydrogenase terminator. after the
cloning sites. Thus. cDNAs cloned
into this vector that are fused in frame with amylase sequence will lead to
the secretion of amylase from
appropriately transfected yeast colonies.
3. Transformation and Detection
DNA from the library described in paragraph 2 above was chilled on ice to
which was added
electrocompetent DH10B bacteria (Life Technologies, 20 ml). The bacteria and
vector mixture was then
electroporated as recommended by the manufacturer. Subsequently, SOC media
(Life Technologies. 1 ml) was
added and the mixture was incubated at 37°C for 30 minutes. The
transfotmants were then plated onto 20
standard 150 mm LB places containing ampicillin and incubated for 16 hours
(37°C). Positive colonies were
scraped off the plates and the DNA was isolated from the bacterial pellet
urine standard protocols, e.g., Cisco-
gradient. The purified DNA was then carried on to the yeast protocols below.
The yeast methods were divided into three categories: ( 1 ) Transformation of
yeast with the
plasmid/cDNA combined vector; (2) Detection and isolation of yeast clones
secreting amylase; and (3) PCR
amplification of the insert directly tcom the yeast colony and purification of
the DNA for sequencing and
further analysis.
The yeast strain used was HD56-SA (ATCC-90785). This strain has the following
genotype: MAT
alpha, ura3-52, leu2-3, leu2-112, his3-11, his3-15, MAL', SUC', GAL.
Preferably, yeast mutants can be
employed that have deficient post-translational pathways. Such mutants may
have translocation deficient
alleles in sec7l, sec72, sec62. with truncated sec71 being most preferred.
Alternatively, antagonists (including
antisense nucleotides and/or ligands) which interfere with the normal
operation of these genes, other proteins
implicated in this post translation pathway (e.g., SEC6lp, SEC72p, SEC62p,
SEC63p, TDJIp or SSAIp-4p) or
the complex formation of these proteins may also be preferably employed in
combination with the amylase-
expressing yeast.
Transformation was performed based on the protocol outlined by Gietz et al.,
Nucl. Acid. Res., 20:1425
( 1992). Transformed cells were then inoculated from agar into YEPD complex
media broth ( 100 ml) and
87
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
grown overnight at 30°C. The YEPD broth was prepared as described in
Kaiser et al., Methods in Yeast
Genetics, Cold Spring Harbor Press, Coid Spring Harbor, NY, p. 207 (1994). The
overnight culture was then
diluted to about 2 x l OG cells/ml (approx. OD~oo = 0.1 ) into fresh YEPD
broth (500 ml) and regrown to 1 x 107
cells/ml (approx. ODboo=0.4-0.5).
The cells were then harvested and prepared for transformation by transfer into
GS3 rotor bottles in a
Sorval GS3 rotor at 5.000 rpm for 5 minutes, the supernatant discarded, and
then resuspended into sterile
water, and centrifuged again in 50 ml falcon tubes at 3,500 rpm in a Beckman
GS-6KR centrifuge. The
supernatant was discarded and the cells were subsequently washed with LiAc/TE
(10 ml, 10 mM Tris-HCI, 1
mM EDTA pH 7.5, 100 mM Li200CCH3), and resuspended into LiAc/TE (2.5 ml).
Transformation took place by mixing the prepared cells (100 Ill) with freshly
denatured single
stranded salmon testes DNA (Lofstrand Labs, Gaithersburg, MD) and transforming
DNA (1 Itg, vol. < 10 Ill)
in microfuge tubes. The mixture was mixed briefly by vortexing, then 40%
PEG/TE (600 Ill, 40% polyethylene
glycol-4000, 10 mM Tris-HCI, 1 mM EDTA, 100 mM Li2Ac, pH 7.5) was added. This
mixture was gently
mixed and incubated at 30°C while agitating for 30 minutes. The cells
were then heat shocked at 42°C for IS
minutes, and the reaction vessel centrifuged in a microfuee at 12,000 rpm for
5-10 seconds, decanted and
resuspended into TE (500 ui. 10 mM Tris-HCI. 1 mM EDTA pH 7.5) followed by
recentrifugation. The cells
were then diluted into TE ( 1 ml) and aliquots (200 Ill) were spread onto the
selective media previously
prepared in 150 mm growth plates (VWR).
Alternatively, instead of multiple small reactions, the transformation was
perfotmted using a single,
large scale reaction. wherein reagent amounts were scaled up accordingly.
The selective media used was a synthetic complete dextrose agar lacking uracil
(SCD-Ura) prepared as
described in Kaiser et al., .'l~ethoda~ in 3'east Generics, Cold Spring Harbor
Press. Cold Spring Harbor, NY, p.
208-210 ( 1994). Transformants were grown at 30°C for 2-3 days.
The detection of colonies secreting amylase was perfotTrted by including red
starch in the selective
growth media. Starch was coupled to the red dye (Reactive Red-120, Sigma) as
per the procedure described
by Biely et al...~lnul. Bioclrenr.. 172:176-179 (1988). The coupled starch was
incorporated into the SCD-Ura
agar plates at a final concentration of 0.15°,~ (wiv). and was buffered
with potassium phosphate to a pH of 7.0
(50-100 mM final concentration).
The positive colonies were picked and streaked across fresh selective media
(onto I50 mm plates) in
order to obtain well isolated and identifiable single colonies. Well isolated
single colonies positive for amylase
secretion were detected by direct incorporation of red starch into buffered
SCD-Ura agar. Positive colonies
were determined by their ability to break down starch resulting in a clear
halo around the positive colony
visualized directly.
Isolation and sequencing by standard techniques identified a yeast EST
fragment which served as the
basis for additional database mining as described below.
4. Assembly
The yeast EST fragment identified above was used to search various expressed
sequence tag (EST )
databases. The EST databases included public EST databases (e.g., GenBank,
Merck/Wash U) and a
proprietary EST DNA database (LIFESEQ'~, Incyte Pharmaceuticals, Palo Alto,
CA). The search was
88
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/USOOf05841
performed using the computer program BLAST or BLAST2 (Altshul et al.. Methods
in Enzvmologv
266:460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame
translation of the EST
sequence. Those comparisons resulting in a BLAST score of 70 (or in some cases
90) or greater that did not
encode known proteins were clustered and assembled into. consensus DNA
sequences with the program
"phrap" (Phil Green, University of Washington, Seattle, Washington).
A consensus DNA sequence was assembled relative to other EST sequences using
phrap. The
consensus DNA sequence was extended using repeated cycles of BLAST and phrap
to extend the consensus
sequence as far as possible using the sources of EST sequences discussed above
as well as EST sequences
proprietary to Genentech.
Based on this consensus sequence, oligonucleotides were synthesized: 1 ) to
identify by PCR a cDNA
library that contained the sequence of interest, and 2) for use as probes to
isolate a clone encoding the
particular PRO polypeptide. In order to screen several libraries for a full-
length clone, DNA from the libraries
was screened by PCR amplification, as per Ausubel et al., Current Protocols in
Molecular Biology, with the
PCR primer pair. A positive library was then used to isolate clones encoding
the gene of interest using the
probe olieonucleotide and one of the primer pairs.
RNA for construction of the cDNA libraries was isolated from various human
tissues. The cDNA
libraries used to isolate the cDNA clones were constructed by standard methods
using commercially available
reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed
with oligo dT containing a
Notl site. linked with blunt to SaII hemikinased adaptors, cleaved with NotI.
sized appropriately by gel
electrophoresis, and cloned in a defined orientation into a suitable cloning
vector (such as pRKB or pRKD;
pRKSB is a precursor of pRKSD that does not contain the SfiI site: Holmes et
al., Science, _253: 1278-1280
( 1991 )) in the unique XhoI and NotI sites.
Signal algorithm:
A proprietary signal sequence finding algorithm developed by Genentech. Inc
was used upon
Expressed Sequence Taes (ESTs) and on clustered and assembled EST fragments
from public (e.g.. GenBank)
and/or private (Lifeseq°, Incyte Pharmaceuticals. Inc., Palo Alto, CA)
databases. Tlte signal sequence
algorithm computes a secretion signal score based on the character of the DNA
nucleotides surrounding the
first and optionally the second methionine codon(s) (ATG) at the S'-end of the
sequence or sequence fragment
under consideration. The nucleotides following the first ATG must code for at
least 35 unambiguous amino
acids without any stop codons. If the first ATG has the required amino acids,
the second is not examined. If
neither meets the requirement, the candidate sequence is not scored. In order
to determine whether the EST
sequence contains an authentic signal sequence. the DNA and corresponding
amino acid sequences
surrounding the ATG codon are scored using a set of seven sensors (evaluation
parameters) known to be
associated with secretion signals.
The above procedure resulted in the identification of EST sequences which were
compared to a
variety of expressed sequence tag (EST) databases which included public EST
databases (e.g., GenBank) and a
proprietary EST DNA database (LIFESEQ'~, Incyte Pharmaceuticals, Palo Alto,
CA). The homology search
was performed using the computer program BLAST or BLAST2 (Altshul et al.,
Methods in Enrymology
266:460-480 (1996)). Those comparisons resulting in a BLAST score of 70 (or in
some cases 90) or greater
89
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/0584I
that did not encode known proteins were clustered and assembled into a
consensus DNA sequence with the
program "phrap" (Phil Green, University of Washington, Seattle, Washington).
This resulted in the
identification of additional EST sequences which either corresponded to full-
length clones, which were
examined and sequenced or served as a template for the creation of cloning
oligonucleotides which were then
used to screen various tissue libraries resulting in isolation of DNA encoding
a native sequence PRO
polypeptide.
A. Isolation of cDNA clones Encodine Human PR0200 (UNQ 174)
Probes based on an expressed sequence tag (EST) identified from the Incyte
Pharmaceuticals database
due to homology with VEGF were used to screen a cDNA library derived from the
human glioma cell line
G61. Screening may be conducted in a manner similar to the procedure disclosed
elsewhere in this application.
In particular, Incvte Clone "INC1302516" was used to generate the following
four probes:
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
S'-ACTTCTCAGTGTCCATAAGGG-3' (SEQ ID N0:3)
5'-GAACTAAAGAGAACCGATACCATTTTCTGGCCAGGTTGTC-3' (SEQ ID N0:4)
5'-CACCACAGCGTTTAACCAGG-3' (SEQ ID NO:S)
5'-ACAACAGGCACAGTTCCCAC-3'
(SEQ ID N0:6)
Nine positives were identified and characterized. Three clones contained the
full coding region and
were identical in sequence. Partial clones were also identified from a fetal
lung library and were identical with
the glioma-derived sequence with the exception of one nucleotide change which
did not alter the encoded
amino acid.
For mammalian protein expression, the entire open reading frame (ORF) was
cloned into a
CMV-based expression vector. An epitope-tag (FLAG, Kodak) and Histidine-tag
(HisB) were inserted
between the ORF and stop codon. UNQ174-His8 and UNQ174-FLAG were transfected
into human embryonic
kidney 293 cells by SuperFect (Qiagen) and pulse-labeled for 3 hours with
[35S]methionine and [35C]cysteine.
Both epitope-tagged proteins co-migrate when 20 microliters of IS-fold
concentrated serum-free conditioned
I S medium were electrophoresed on a polyacrylamide gel (Novex) in sodium
dodecyl sulfate sample buffer
(SDS-PAGE). The UNQ174-IgG expression plasmid was constructed by cloning the
ORF in front of the
human Fc (IgG) sequence.
The UNQ174-IgG plasmid was co-transfected with Baculogold Baculovirus DNA
(Phatmtingenj using
Lipofectin (GibcoBRL) into 105 Sf~ cells grown in Hink's TNM-FH medium (JRH
Biosciences) supplemented
with 10°,o Fetal bovine serum. Cells were incubated for 5 days at
28°C. The supernatant was harvested and
subsequently used for the first viral amplification by infecting Sf~ cells at
an approximate multiplicity of
infection (MOI) of 10. Cells were incubated for 3 days, then supernatant
harvested, and expression of the
recombinant plasmid determined by binding of 1 ml of supernatant to 30 ltl of
Protein-A Sepharose CL-4B
beads (Pharmacia) followed by subsequent SDS-PAGE analysis. The first
amplification supernatant was used
to infect a X00 ml spinner culture of Sf~ cells grown in ESF-921 medium
(Expression Systems LLC) at an
approximate MOI of 0.1. Cells were treated as above. except harvested
supernatant was sterile filtered.
Specific protein was purified by binding to Protein-A Sepharose 4 Fast Flow
(Pharmacia) column.
The entire nucleotide sequence of the identified clone DNA29101 is shown in
Figure 1 (SEQ ID
NO:1 ). Clone DNA29101 (SEQ ID NO:1 ) contains a single open reading frame
with an apparent translation
initiation site at nucleotide residues 285-287 and ending at the stop codon
(TAG) found at nucleotide positions
1320-1322 (Figure 1, SEQ ID NO:1), as indicated by bolded underline. The
predicted PR0200 polypeptide
precursor (i.e., UNQ174, SEQ ID N0:2) is 345 amino acids in length, has a
calculated molecular weight of
39029 daltons, a pI of 6.06 and is shown in Figure 2 (SEQ ID N0:2). Potential
N-glycosylation sites are at
amino acid residues 25. 54 and 254. CUB domains are at amino acid residues 52-
65, 118-125 and 260-273.
A cDNA containing DNA encoding UNQ174 (SEQ ID N0:2) has been deposited with
the ATCC on
March S, 1998 and has been assigned deposit number 209653.
B. Isolation of cDNA clones Encoding Human PR0204 (UNQ178)
An expressed sequence tag (EST) DNA database (LIFESEQ°°, Incyte
Pharmaceuticals, Palo Alto, CA)
was searched and an EST was identified. Human fetal retina cDNA libraries were
screened with PCR
91
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
oligonucleotide primers and confirmed by hybridization with synthetic
oligonucleotide probe which was based
upon the EST sequence.
hybridization probe:
5'-GGCATGCAGCAGCTGGACATTTGCGAGGGCTTTTGCTGGCTG-3' (SEQ ID N0:7)
forward PCR primer:
5'-CTGCTGCAGAGTTGCACGAAC-3'
(SEQ ID N0:8)
reverse PCR primer 1:
S'-CAGTTGTTGTTGTCACAGAGAAG-3'
(SEQ ID N0:9)
reverse PCR primer 2:
5'-AGTTCGTGCAACTCTGCAGCAG-3'
(SEQ ID NO:10)
A cDNA clone was identified and sequenced in entirety. The entire nucleotide
sequence of the
identified clone DNA30871 is shown in Figure 3 (SEQ ID NO:11). Clone DNA30871-
1157 (SEQ ID NO:11)
contains a single open reading frame with an apparent translation initiation
site at nucleotide positions 376-378
and ending at the stop codon (TAA) found at nucleotide positions 1498-1500
(Figure 3; SEQ ID NO:11), as
indicated by bolded underline. The predicted PR0204 polypeptide precursor
(i.e.. UNQ178. SEQ ID N0:12)
is 374 amino acids lone. has a calculated molecular weight of 39,285 daltons.
a pI of 6.06 and is shown in
Figure 4. A cDNA containing DNA encoding UNQ178 (SEQ ID N0:12) has been
deposited with the ATTC
on October 16, 1997 and has been assigned deposit number 209380.
C. Isolation of cDNA clones Encodine Human PR0212 (UNQ186)
Use of the ECD homology procedure described above from a human fetal lung
library resulted in the
identification of the full-length DNA sequence for DNA30942 (Fig. 5; SEQ ID
N0:13) and the derived protein
sequence UNQ I 86 (Fig. 6; SEQ ID N0:14).
The PCR primers (forward and reverse) and probes used in the procedure were
the following:
forward primer: ~'-CACGCTGGTTTCTGCTTGGAG-3' (SEQ ID N0:15)
reverse primer: 5'-AGCTGGTGCACAGGGTGTCATG-3' (SEQ ID N0:16)
hybridization probe: (SEQ ID N0:17)
5'-CCCAGGCACCTTCTCAGCCAGCCAGCAGCTCCAGCTCAGAGCAGTGCCAGCCC-3'
The entire nucleotide sequence of DNA30942 is shown in Figure 5 (SEQ ID
N0:13). Clone
DNA30942 (SEQ ID N0:13) contains a single open reading frame with an apparent
translation initiation site at
nucleotide positions 101-103 and ending at the stop codon (TGA) at positions
1001-1003 (Fig. 5; SEQ ID
N0:13), as indicated in bolded underline. The predicted PR0212 polypeptide
precursor of Fig. 6 (SEQ ID
N0:14) is 300 amino acids long, has a calculated molecular weight of 32680
daltons and a pI of 8.70. It is
believed that the PR0212 sequence of Fig. 6 (SEQ ID N0:14) lacks a
transmembrane domain. It is also
believed that amino acids 1 to 215 of Fig. 6 (SEQ ID N0:14) represents an ECD
which includes four cysteine
rich domains (CRDs). A cDNA clone containing DNA30942 (SEQ ID N0:13) has been
deposited with ATCC
(identified as DNA30942-1134) on September 16, 1997 and has been assigned ATCC
deposit no. 209254.
92
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
D. Isolation of cDNA clones Encoding Human PR0216 (UNQ190)
A procedure analogous to the one above for the isolation of PR0212 can be
employed to isolate
DNA33087 (SEQ ID N0:18) (Figure 7) which encodes the PR0216 polypeptide UNQ190
(SEQ ID
N0:19)(Figure 8).
DNA33087 contains a single open reading frame with an apparent translation
initiation site nucleotide
residues 268-270 and ending at the stop codon (TAG) are residues 1531-1533
(Fig. 7, SEQ ID N0:18), as
indicated by bolded underline. The predicted PR0215 polypeptide precursor
(i.e.. UNQ190, SEQ ID N0:19)
is 421 amino acids long, has a calculated molecular weight of 49492 daltons
and a pI of 5.51 (Fig. 8).
Hydropathy analysis suggests the presence of a signal sequence at amino acid
residues 1 to 20,
tyrosine kinase phosphorylation sites at amino acid residues 268-274 and 300-
306, and N-myristoylation site
residue 230-235, and leucine zippers at residues 146 to 167 and 217 to 238.
Alternatively to traditional
isolation techniques, the DNA sequence is publicly available from GenBank as
accession number AB0001 l4
which encodes Dayhoff protein AB000114 I .
Alternatively still, the sequence is described in Ohno et al.. Biochem.
Biophvs. Res. Common. _228(2):
411-414 (1996). A cDNA clone containing DNA33087 (identified as DNA33087-1158)
has been deposited
with the American Tvpe Culture Collection (ATCC) on September 16, 1997 and has
been assigned ATCC
Dep. No. 209381.
E. Isolation of cDNA clones Encoding Human PR0226 (UNQ200)
Use of the ECD homology procedure described above in a human fetal lung
library resulted in the
identification of the full-length DNA sequence for DNA33460 (Figure 9; SEQ ID
N0:20) and the derived
native sequence protein UNQ200 (SEQ ID N0:21).
DNA33460 contains a single open reading frame with an apparent translation
initiation site at
nucleotide residues 62-64 and ending at the stop codon (TGA) at residues 1391-
1393 (Fig. 9; SEQ ID NO: 20),
as indicated by bolded underline. The predicted PR0226 polvpeptide precursor
(i.e.. UNQ200. SEQ ID
N0:21 ) is 443 amino acids long, has a calculated molecular weight of 49.391
daltons, a pI of 4.82 and is shown
in Figure 10 as UNQ200 (SEQ ID N0:21). A cDNA clones containing DNA33460 (SEQ
ID N0:20),
designated as DNA33460-1166, has been deposited with the ATCC on October 16,
1997 and has been assigned
ATCC deposit number 209376.
The oligonucleotide sequences used in the above procedure were the following:
28722.p (OLI488)
(SEQ ID NO: 22)
5'-TGTGTGGACATAGACGAGTGCCGCTACCGCTACTGCCAGCACCGC-3'
28722.f (OLI489) (SEQ ID NO: 23)
5'-AGGACTGCCATAACTTGCCTG-3'
28722.r (OLI490) (SEQ ID NO: 24)
5'-ATAGGAGTTGAAGCAGCGCTGC-3'
93
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
F. Isolation of cDNA clones Encodine Human PR0240 (UNQ214)
Use of the ECD homology procedure described above in a human fetal liver
library resulted in the
isolation of the full-length DNA sequence for DNA34387 (Figure 11; SEQ ID
N0:25) and the derived native
sequence protein UNQ214 (SEQ ID N0:26).
The entire nucleotide sequence of DNA34387 is shown in Figure 11 (SEQ ID
N0:25). The clone
DNA34387 contains a single open reading frame with an apparent translation
initiation site at nucleotide
positions 12-14 and ending at the stop codon (TGA) at nucleotide positions 699-
701 (Fig. 11; SEQ ID N0:25),
as indicated by bolded underline. The predicted PR0240 polypeptide precursor
(i.e., UNQ214, SEQ ID
N0:26) is 229 amino acids long, has a calculated molecular weight of 24,689
daltons, a pI of 7.83 and is shown
in Figure 12. A cDNA clone containing DNA34387 (SEQ ID N0:25) has been
deposited with ATCC on
September 16, 1997 and is assigned ATCC deposit no. 209260.
The PCR primers (fonvard and reverse) and hybridization probe synthesized for
use in the above-
described procedure were the following:
forward PCR primer: 5'-TCAGCTCCAGACTCTGATACTGCC-3'
(SEQ ID N0:27)
reverse PCR primer: 5'-TGCCTTTCTAGGAGGCAGAGCTCC-3' (SEQ ID N0:28)
hybridization probe:
(SEQ ID N0:29)
5'-GGACCCAGAAATGTGTCCTGAGAATGGATCTTGTGTACCTGATGGTCCAG-3'
G. Isolation of cDNA clones Encodine Human PR0235 (UNQ209)
Use of the ECD homology procedure described above in a human fetal liver
library resulted in the
isolation of the full-length DNA sequence for DNA35558 (Figure l3; SEQ ID
N0:30) and the derived
PR0235 native sequence protein UNQ209 (Fig. 14, SEQ ID N0:31 ).
The entire nucleotide sequence of DNA35558 is shown in Figure 13 (SEQ ID
N0:30). The
DNA35558 clone shown in Figure 13 contains a single open reading frame with an
apparent translation
initiation site at nucleotide positions 667-669 and ending at the stop codon
(TGA) at nucleotide positions 2323
2325, as indicated by bolded underline. The predicted PR0235 polypeptide
precursor (i.e.. UNQ209. SEQ ID
N0:31 ) is 552 amino acids long, has a calculated molecular weight of 61,674
daltons and a pI of 6.95 (Figure
14). A cDNA clone containing DNA35558 has been deposited with ATCC on October
16, 1997 and is
assigned ATCC deposit no. 209374.
The PCR primers (forward and reverse) and hybridization probe synthesized for
use in the above
procedure were:
forward PCR primer: 5'-TGGAATACCGCCTCCTGCAG-3' (SEQ ID N0:32)
reverse PCR primer: 5'-CTTCTGCCCTTTGGAGAAGATGGC-3' (SEQ ID N0:33)
hybridization probe:
5'-GGACTCACTGGCCCAGGCCTTCAATATCACCAGCCAGGACGAT-3' (SEQ ID N0:34)
94
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
H. Isolation of cDNA Clones Encoding Human PR0245 (UNQ219j
Use of the ECD homology procedure described above in a human fetal liver
library resulted in the
isolation of the full-length DNA sequence for DNA35658 (Figure 15, SEQ ID
N0:35) and the derived PR0245
native sequence protein UNQ219 (Figure 16, SEQ ID N0:36).
The PCR primers (forward and reverse) and hybridization probes synthesized for
use with the above-
described method were the following:
forward PCR primer 5'-ATCGTTGTGAAGTTAGTGCCCC-3' (SEQ ID N0:37)
reverse PCR primer 5'-ACCTGCGATATCCAACAGAATTG-3'
(SEQ ID N0:38)
hybridization probe
(SEQ ID N0:39)
5'-GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC-3'
The entire nucleotide sequence of DNA35638 (SEQ ID N0:35) is shown in Figure
15. Clone
DNA35638 contains a single open reading frame with an apparent translation
initiation site at nucleotide
positions 89-91 and ending at the stop codon (TAG) at nucleotide positions
1025-1027 (Fig. 15; SEQ ID
N0:35). The predicted PR0245 polypeptide precursor (i.e., UNQ219, SEQ ID
N0:36) is 312 amino acids
long, has a calculated molecular weight of 34,554 daltons and a pI of 9.39
(Fig. 36). A clone containing
DNA35638 (SEQ ID N0:35), designated as DNA35638-1141, has been deposited with
ATCC on September
16, 1997 and is assigned ATCC deposit no. 209265.
I. Isolation of cDNA clones Encodine Human PR017~ (UNQ146)
Use of the ECD homology procedure described above in a human fetal kidney
library resulted in the
isolation of the full-length DNA sequence for DNA35916 (Fig. 17; SEQ ID N0:40)
and the derived PR0172
native sequence protein UNQ146 (Fig. l8, SEQ ID N0:41).
Clone DNA35916 (SEQ ID N0:40) contains a single open reading frame with an
apparent translation
initiation site at nucleotide positions 38-40 and ending at the stop codon
(TAA) at nucleotide positions 2207
2209, as indicated by bolded underline in Fig. 17. The predicted PR0172
polypeptide precursor (i.e.,
UNQ146; SEQ ID N0:41) is 723 amino acids long, has a calculated molecular
weight of 78.055 daltons and a
pI of 6.17 (Fig. IS). A cDNA clone containing DNA35916 (SEQ ID N0:40) has been
deposited with ATCC
on October 28, 1997 (designated as DNA35916-I 161) and has been assigned ATCC
deposit no. 209419.
The oligonucleotide sequences used in the above procedure were the following:
28765.p (OLI633)
5'-AAATCTGTGAATTGAGTGCCATGGACCTGTTGCGGACGGCCCTTGCTT-3' (SEQ ID N0:42)
28765.f (OLI644)
5'-GGATCTCGAGAACAGCTACTCC-3'
(SEQ ID N0:43)
28765.r (OLI645)
S'-TCGTCCACGTTGTCGTCACATG-3'
(SEQ ID N0:44)
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
J. Isolation of cDNA clones Encodine Human PR0273 (UNQ240)
Use of the ECD homology procedure described above in a human fetal kidney
library resulted in the
isolation of the full-length DNA sequence for DNA39523 (Fig. 19; SEQ ID N0:45)
and the derived PR0273
native sequence protein UNQ240 (Fig. 20, SEQ ID N0:46).
The PCR primers (forward and reverse) and hybridization probe synthesized were
the following:
forward PCR primer: 5'-CAGCGCCCTCCCCATGTCCCTG-3' (SEQ ID N0:47)
reverse PCR primer: 5'-TCCCAACTGGTTTGGAGTTTTCCC-3'
(SEQ ID N0:48)
hybridization probe:
5'-CTCCGGTCAGCATGAGGCTCCTGGCGGCCGCTGCTCCTGCTGCTG-3' (SEQ ID N0:49)
Clone DNA39523 (SEQ ID N0:45) contains a single open reading frame with an
apparent translation
initiation site at nucleotide positions 167-169 and ending at the stop codon
(TAG) at nucleotide positions 500-
502 (Figure 19), as indicated by bolded underline. The predicted PR0273
polypeptide precursor (i.e.,
UNQ240, SEQ ID N0:46) is 11 I amino acids long, has a calculated molecular
weight of 13,078 daltons and a
pI of 10.37 (Figure 20). A cDNA clone including DNA39523 (SEQ ID N0:45) has
been deposited with
ATCC on October 31, 1997 and is assigned ATCC deposit no. 209424.
K. Isolation of cDNA clones Encoding Human PR0272 (UNQ239)
Use of the ECD homology procedure described above in a human fetal lung tissue
in combination
with an in vivo cloning procedure using the probe oligonucleotide and one of
the primer pairs resulted in the
identification of the full length DNA sequence for DNA40620 (Fig. 21, SEQ ID
N0:50) and the derived
PR0272 native sequence protein UNQ239 (SEQ ID N0:51).
The forward and reverse PCR primers and hybridization probes synthesized and
used to isolate the
PR0272 encoding DNA sequences were the following:
forward PCR primer (.fl): 5'-CGCAGGCCCTCATGGCCAGG-3' (SEQ ID N0:52)
forward PCR primer (.f2): 5'-GAAATCCTGGGTAATTGG-3' (SEQ ID N0:53)
reverse PCR primer: 5'-GTGCGCGGTGCTCACAGCTCATC-3' (SEQ ID N0:54)
hybridization probe:
5'-CCCCCCTGAGCGACGCTCCCCCATGATGACGCCCACGGGAACTTC-3' (SEQ ID N0:55)
Clone DNA40620 (SEQ ID N0:50) contains a single open reading frame with an
apparent translation
initiation site at nucleotide positions 35-37 and ending at the stop codon
(TGA) at nucleotide positions 1020
1022 (Figure 21 ), as indicated by bolded underline. The predicted polypeptide
precursor is 328 amino acids
long (Figure 22), has a calculated molecular weight of 37,493 daltons and a pI
of 4.77. A eDNA clone
containing DNA40620 (SEQ ID N0:50) has been deposited with ATCC on October 17,
1997 and is assigned
ATCC deposit no. 209388.
L. Isolation of cDNA clones Encoding Human PR0332 (UNQ293)
Use of the ECD homology procedure described above in a human fetal liver
library resulted
in the identification of the full-length DNA sequence for DNA40982 (Fig. 23,
SEQ ID N0:56) and the derived
PR0332 native sequence protein UNQ293 (Fig. 24, SEQ ID N0:57).
96
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/0584i
The PCR primers (forward and reverse) and hybridization probe synthesized for
use in the above
procedure were:
5'-GCATTGGCCGCGAGACTTTGCC-3' (SEQ ID N0:58)
5'-GCGGCCACGGTCCTTGGAAATG-3' (SEQ ID N0:59)
5'-TGGAGGAGCTCAACCTCAGCTACAACCGCATCACCAGCCCACAGG-3' (SEQ ID N0:60)
The entire nucleotide sequence of DNA40982 (SEQ ID N0:56) is shown in Figure
23. Clone
DNA40982 (SEQ ID N0:56) contains a single open reading frame with an apparent
translation initiation site at
nucleotide positions 342-344 and ending at the stop codon (TAG) at nucleotide
positions 2268-2270, as
indicated in Figure 23 by bolded underline. The predicted PR0332 polypeptide
precursor (i.e., UNQ293, SEQ
ID N0:57, Fig. 24) is 642 amino acids long, and has a calculated molecular
weight of 72,067, and a pI of 6.60.
A eDNA clone containing DNA40982 (SEQ ID N0:56) (designated as DNA40982-1235)
has been deposited
with ATCC on November 7, 1997 and is assigned ATCC deposit no. 209433.
M. Isolation of cDNA clones Encodine Human PR0526 (UNQ330)
Use of the ECD homology procedure described above in a human fetal liver
library resulted in the
identification of the full-length DNA sequence DNA44184 (Fig. 25, SEQ ID
NO:61) and the derived PR0526
native sequence protein UNQ330 (Fig. 26, SEQ ID N0:62).
The PCR primers (forward and reverse) and hybridization probes synthesized
were the following:
forward PCR primer: 5'-TGGCTGCCCTGCAGTACCTCTACC-3' (SEQ ID N0:63)
reverse PCR primer: 5'-CCCTGCAGGTCATTGGCAGCTAGG-3' (SEQ ID N0:64)
hybridization probe:
(SEQ ID N0:65)
S'-AGGCACTGCCTGATGACACCTTCCGCGACCTGGGCAACCTCACAC-3' .
Clone DNA44184 (SEQ ID N0:61 ) contains a single open reading frame with an
apparent translation
initiation site at nucleotide positions 514-516 and ending at the stop codon
(TGA) at nucleotide positions 1933
1935 (Figure 61), as indicated by bolded underline. The predicted PR0526
polypeptide precursor (i.e.,
UNQ330, SEQ ID N0:62) is 473 amino acids long (Figure 62). The UNQ330 (SEQ ID
N0:62) protein shown
in Figure 62 has an estimated molecular weight of about 50708 daltons and a pI
of about 9.28. A cDNA clone
containing DNA44184 has been deposited with the ATCC on 26 March 1998 (under
the designation
DNA44184-1319) and is assigned deposit number 209704.
Analysis of UNQ330 (SEQ ID N0:62) revels that the signal peptide sequence is
at about amino acids
1-26. A leucine zipper pattern is at about amino acids 135-156. A
glycosaminoglycan attachment is at about
amino acids 436-439. N-glycosylation sites are at about amino acids 82-85, 179-
182, 237-240 and 423-426. A
von Willebrand factor (VWF) type C domains) is found at about amino acids 411-
425. The skilled artisan
can understand which nucleotides correspond to these amino acids based on the
sequences provided herein.
N. Isolation of cDNA clones Encodine Human PR0701 (UNQ365)
Use of the ECD homology procedure described above in a human fetal liver
library resulted in the
identification of the full-length DNA sequence DNA44205 (Fig. 27, SEQ ID
N0:66) and the derived PR0526
native sequence protein UNQ365 (Fig. 28, SEQ ID N0:67).
97
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
The PCR primers (forward and reverse) and hybridization probe synthesized for
use in the above
procedure were:
5'-GGCAAGCTACGGAAACGTCATCGTG-3'
(SEQ ID N0:68)
S'-AACCCCCGAGCCAAAAGATGGTCAC-3'
(SEQ ID N0:69)
5'-GTACCGGTGACCAGGCAGCAAAAGGCAACTATGGGCTCCTGGATCAG-3' (SEQ ID N0:70)
Clone DNA44205 (SEQ ID N0:66) contains a single open reading frame (with an
apparent translation
initiation site at nucleotide positions 50-52 and ending at the stop codon
(TAG) at nucleotide positions 2498-
3000, as indicated by bolded underline in Figure 27. The predicted PR0701
polypeptide precursor (i.e., Fig.
28, UNQ365, SEQ ID N0:67) is 816 amino acids long, and has a calculated
molecular weight of 91,794 Da
(pI: 5.88). A cDNA clone containing DNA44205 (SEQ ID N0:66) (designated as
DNA44205-1285) has been
deposited with ATCC on March 31, 1998 and is assigned ATCC deposit no. 209720.
UNQ365 (SEQ ID N0:67) contains a potential signal peptide cleavage site at
about amino acid
position 25. There are potential N-glycosylation sites at about amino acid
positions 83, 511, 716 and 803. The
carboxylesterases type-B signature 2 sequence is at about residues 125 to 135.
Regions homologous with
carboxylesterase type-B are also at about residues ~4-74. 197-212 and 221-261.
A potential transmembrane
region corresponds approximately to amino acids 671 through about 700. Tlte
corresponding nucleic acids can
be routinely determined from the sequences provided herein.
O. Isolation of cDNA clones Encodine Human PR0361 (UNQ316)
Use of the ECD homology procedure described above in combination with an in
uiao cloning
procedure using the probe oligonucleotide and one of the primer pairs in a
human fetal kidney library resulted
in the identification of the full-length DNA sequence DNA45410 (Fig. 29, SEQ
ID N0:71) and the derived
PR0361 native sequence protein UNQ316 (Fig. 30, SEQ ID N0:72).
The forward and reverse PCR primers and a hybridization probe were synthesized
for use in the
above-described method:
forward PCR primer (.fl):
S'-AGGGAGGATTATCCTTGACCTTTGAAGACC-3'
(SEQ ID N0:73)
forward PCR primer (.f2): 5'-GAAGCAAGTGCCCAGCTC-3' (SEQ ID N0:74)
forward PCR primer (.f3): 5'-CGGGTCCCTGCTCTTTGG-3' (SEQ ID N0:75)
reverse PCR primer (.rl): S'-CACCGTAGCTGGGAGCGCACTCAC-3' (SEQ ID N0:76)
reverse PCR primer (.r2): 5'-AGTGTAAGTCAAGCTCCC-3'
(SEQ ID N0:77)
hybridization probe:
5'- GCTTCCTGACACTAAGGCTGTCTGCTAGTCAGAATTGCCTCAAAAAGAG-3' (SEQ ID N0:78)
Clone DNA45410 (SEQ ID N0:71) contains a single open reading frame with an
apparent translation
initiation site at nucleotide positions 226-228 and ending at the stop codon
(TAA) at nucleotide positions 1519-
1521 (Figure 29), as indicated by bolded underline. The predicted PR0361
polypeptide precursor (i.e.,
UNQ316, SEQ ID N0:72) is 431 amino acids long (Figure 30). The native sequence
PR0361 protein shown
in Figure 30 as UNQ316 has an estimated molecular weight of about 46810 and a
pI of about 6.45. In addition,
regions indicative of the arginase family proteins are present at about
residues F3 to V 14 and again at I39 to
T57, while a transmembrane domain exists at about residues P380 to 5409. A
cDNA clone containing
98
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
DNA45410 (SEQ ID N0:71 ) has been deposited with ATCC on February ~, 1998 and
is assigned ATCC
deposit no. 209621.
P. Isolation of cDNA clones Encodine Human PR0362 (UNQ317)
Use of the ECD homology procedure described above in a human fetal brain
library resulted in the
isolation of the full-length DNA sequence DNA45416 (Fig. 31, SEQ ID N0:79) and
the derived PR0362
native sequence protein UNQ317 (Fig. 32, SEQ ID N0:80).
The PCR primers (forward and reverse) and hybridization probe synthesized for
use in the above
procedure were:
forward PCR primer I : 5'-TATCCCTCCAATTGAGCACCCTGG-3' (SEQ ID N0:81 )
forward PCR primer 2: 5'-GTCGGAAGACATCCCAACAAG-3' (SEQ ID N0:82)
reverse PCR primer 1: 5'-CTTCACAATGTCGCTGTGCTGCTC-3' (SEQ ID N0:83)
reverse PCR primer 2: 5'-AGCCAAATCCAGCAGCTGGCTTAC-3'
(SEQ ID N0:84)
hybridization probe:
5'-TGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCTGAT-3' (SEQ ID NO:85)
Clone DNA45416 (SEQ ID N0:79) contains a single open reading frame with an
apparent translation
initiation site at nucleotide positions 119-121 and ending at the stop codon
(TAA) at nucleotide positions 1082-
1084 (Figure 31), as indicated by bolded underline. The predicted PR0362
polypeptide precursor (i.e.,
UNQ317, SEQ ID N0:80) is 321 amino acids long (Figure 32). The UNQ317 protein
(SEQ ID N0:80) shown
in Figure 32 has an estimated molecular weight of about 35,544 daltons and a
pI of about 8.5I. Analysis of the
UNQ317 polypeptide as shown in Figure 32 evidences the presence of a
glycosaminoglycan attachment site at
about amino acid 149 to about amino acid 152 and a transmembrane domain from
about amino acid 276 to
about amino acid 306. A cDNA clone containing DNA45416 (SEQ ID N0:79) has been
deposited with ATCC
on February 5, 1998 and is assigned ATCC deposit no. 209620.
Q. Isolation of cDNA clones Encoding Human PR0363 (UNQ318)
Use of the ECD homology described above in a human fetal kidney library
resulted in the isolation of
the full-length DNA sequence DNA45419 (Fig. 33, SEQ ID N0:86) and the derived
PR0363 native sequence
protein UNQ318 (Fig. 34, SEQ ID N0:87).
The PCR primers (forward and reverse) and hybridization probe synthesized for
use in the above
procedure were:
forward PCR primer:
5'-CCAGTGCACAGCAGGCAACGAAGC-3'
(SEQ ID N0:88)
reverse PCR primer:
5'-ACTAGGCTGTATGCCTGGGTGGGC-3'
(SEQ ID N0:89)
hybridization probe:
5'-GTATGTACAAAGCATCGGCATGGTTGCAGGAGCAGTGACAGGC-3' (SEQ ID N0:90)
99
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Clone DNA45419 (SEQ ID N0:86) contains a single open reading frame with an
apparent translation
initiation site at nucleotide positions 190-192 and ending at the stop codon
(TGA) at nucleotide positions 1309-
1311 (Figure 33), as indicated by bolded underline. The predicted PR0363
polypeptide precursor (i.e.,
UNQ318, SEQ ID N0:87) is 373 amino acids long (Figure 34). The UNQ318 protein
(SEQ ID N0:87) shown
in Figure 34 has an estimated molecular weight of about 41,281 daltons and a
pI of about 8.33. Analysis of the
UNQ318 polypeptide as shown in Figure 34 evidences the presence of a
transmembrane domain at about
amino acid residue 221 to about residue 254. A cDNA clone containing DNA45419
(SEQ ID N0:86) has been
deposited with ATCC on February S, 1998 and is assigned ATCC deposit no.
209616.
R. Isolation of cDNA clones Encodine Human PR0364 (UNQ319)
Use of the ECD homology procedure described above in a human small intestine
library resulted in
the identification of an expressed sequence tag (EST) (Incyte EST No. 3003460)
that encoded a polypeptide
which showed homology to members of the tumor necrosis factor receptor (TNFR)
family of polypeptides.
A consensus DNA sequence was then assembled relative to the Incyte 3003460 EST
in a manner
similar to that used in the ECD homology procedure which resulted in the
isolation of the full-leneth DNA
sequence DNA47365 (Fig. 35, SEQ ID N0:91) and the derived PR0364 native
sequence protein UNQ319
(Fig. 36, SEQ ID N0:92).
The PCR primers (forward and reverse) and hybridization probes synthesized for
use in the above-
described screening procedure were:
forward primer (44825.f1): 5'-CACAGCACGGGGCGATGGG-3'(SEQ ID
PCR N0:93)
forward primer (44825.f2): 5'-GCTCTGCGTTCTGCTCTG-3'(SEQ ID
PCR N0:94)
forward primer (44825.GITR.f):
PCR
5'-GGCACAGCACGGGGCGATGGGCGCGTTT-3' (SEQ ID
N0:95)
reverse rimer (44825.r1): 5'-CTGGTCACTGCCACCTTCCTGCAC-3'(SEQ ID
PCR p N0:96)
reverse rimer 144825.r2): 5'-CGCTGACCCAGGCTGAG-3'(SEQ ID
PCR p N0:97)
reverse
PCR primer
(44825.GITR.r):
5'-GAAGGTCCCCGAGGCACAGTCGATACA-3' (SEQ ID N0:98)
hybridization probe 144825.p I ):
5'-GAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGC-3' (SEQ ID N0:99)
hybridization probe (44825.GITR.p):
5'-AGCCTGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCC-3' (SEQ ID NO:100)
Clone DNA47365 (SEQ ID N0:91 ) contains a single open reading frame with an
apparent translation
initiation site at nucleotide positions 121-123 and ending at the stop codon
(TGA) at nucleotide positions 844-
846 (Figure 35). as indicated by bolded underline. The predicted PR0364
polypeptide precursor (i.e.,
UNQ319, SEQ ID N0:92) is 241 amino acids long (Figure 36). The UNQ319 (SEQ ID
N0:92) protein shown
in Figure 36 has an estimated molecular weight of about 26.000 daltons and a
pI of about 6.34. A potential N-
glycosylation sites exists between amino acids 146 and 149 of the amino acid
sequence shown in Figure 36. A
putative signal sequence is from amino acids 1 to 25 and a potential
transmembrane domain exists between
amino acids 162 to 180 of the sequence shown in Figure 36. A cDNA clone
containing DNA47365
100
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
(designated DNA47365-1206) has been deposited with ATCC on November 7, 1997
and is assigned ATCC
Deposit No. ATCC 209436.
S. Isolation of cDNA clones Encoding Human PR0356 (UNQ313)(NL4)
An expressed sequence tag (EST) DNA database (LIFESEQ"', Incyte
Pharmaceuticals, Palo Alto, CA)
was searched and an EST (#2939340) was identified which showed homology to
human TIE-2 L1 and TIE-2
L2.
Based on the EST, a pair of PCR primers (forward and reverse), and a probe
were synthesized:
NL4,5-1:5'-TTCAGCACCAAGGACAAGGACAATGACAACT-3'
(SEQ ID NO: 103)
NL4,3-1: 5'-TGTGCACACTTGTCCAAGCAGTTGTCATTGTC-3' (SEQ ID NO: 104)
NL4,3-3: 5'-GTAGTACACTCCATTGAGGTTGG-3' (SEQ ID NO: 105).
Oligo dT primed cDNA libraries were prepared from utents mRNA purchased from
Clontech, Inc.
(Palo Alto, CA, USA, catalog # 6537-1) in the vector pRKSD using reagents and
protocols from Life
I S Technologies, Gaithersburg, MD (Super Script Plasmid System). pRKSD is a
cloning vector that has an sp6
transcription initiation site followed by an SfiI restriction enzyme site
preceding the XhoI/NotI cDNA cloning
sites. The cDNA was primed with oligo dT containing a NotI site, linked with
blunt to SaII hemikinased
adaptors, cleaved with NotI, sized to greater than 1000 by appropriately by
gel electrophoresis, and cloned in a
defined orientation into XhoIMotI-cleaved pRKSD.
In order to screen several libraries for a source of a full-length clone, DNA
from the libraries was
screened by PCR amplification with the PCR primer pair identified above. A
positive library was then used to
isolate clones encoding the PR0356 gene using the probe oligonucleotide and
one of the PCR primers.
DNA sequencing of the clones isolated as described above gave a full-length
DNA sequence encoding
the native sequence PR0356 (NL4) (i.e., DNA47470, SEQ ID NO:101) and the
derived PR0356 protein
sequence UNQ313 (SEQ ID N0:102).
The entire nucleotide sequence of DNA47470 is shown in Figure 37 (SEQ ID
NO:101 ). Clone
DNA47470 (SEQ ID NO:101 ) contains a single open reading frame with an
apparent translation initiation site
at nucleotide positions 215-217. and a TAA stop codon at nucleotide positions
1038-1040, as indicated by
bolded underline. The predicted PR0356 polypeptide is 346 amino acids long
(i.e., UNQ313 (SEQ ID
N0:102), has a calculated molecular weight of 40,018 daltons and a pI of 8.19.
A cDNA clone containing
DNA47470 (SEQ ID NO:101) has been deposited with ATCC on October 28, 1997 and
is assigned ATCC
deposit no. 209422.
T. Isolation of cDNA clones Encodine Human PR0531 (UNQ332)
Use of the ECD homology procedure identified above in a human fetal brain
library resulted in the
isolation of the full-length DNA sequence DNA48314 (Fig. 39, SEQ ID N0:106)
and the derived PR0531
native sequence protein UNQ332 (Fig. 40, SEQ ID N0:107) .
The PCR primers (forward and reverse) and hybridization probe synthesized
were:
forward PCR primer: 5'-CTGAGAACGCGCCTGAAACTGTG-3'
(SEQ ID N0:108)
reverse PCR primer: 5'-AGCGTTGTCATTGACATCGGCG-3'
(SEQ ID N0:109)
101
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
hybridization probe: (SEQ ID NO:110)
5'-TTAGTTGCTCCATTCAGGAGGATCTACCCTTCCTCCTGAAATCCGCGGAA-3'
Clone DNA48314 (SEQ ID N0:106) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 171-173 and ending at the
stop codon (TGA) at nucleotide
S positions 2565-2567 (Figure 39), as indicated by bolded underline. The
predicted PR0531 polypeptide
precursor (i.e., UNQ332, SEQ ID N0:107) is 789 amino acids tong. The UNQ332
protein (SEQ ID N0:107)
shown in Figure 39 has an estimated molecular weight of about 87552 daltons
and a pI of about 4.84. A clone
containing DNA48314 (SEQ ID N0:106) has been deposited with the ATCC on 26
March 1998, and has been
assigned deposit number 209702.
Analysis of the UNQ332 amino acid sequence of SEQ ID N0:107 reveals a cadherin
extracellular
repeated domain signature at about amino acids 122-132, 231-241, 336-346, 439-
449 and 549-559. An
ATP/GTP-binding site motif A (P-loop) is found at about amino acids 285-292 of
SEQ ID N0:107. N
glycosylation sites are found at least at about amino acids 567-570, 786-790,
418-421 and 336-339, the signal
peptide is at about amino acids 1-26, and the transmembrane domain is at about
amino acids 685-712 of SEQ
ID N0:107.
U. Isolation of cDNA clones Encodine Human PR0533 (UNQ334)
The EST sequence accession number AF007268, a murine fibroblast growth factor
(FGF-15) was
used to search various public EST databases (e.g., GenBank. Dayhoff, etc.).
The search was performed using
the computer program BLAST or BLAST2 [Altschul et al., Methods in Enwmology,
266:460-480 ( 1996)) as a
comparison of the ECD protein sequences to a 6 frame translation of the EST
sequences. The search resulted
in the identification of GenBank EST AA220994, which has been identified as
stratagene NT2 neuronal
precursor 937230.
Based on this sequence, oligonucleotides were synthesized: I ) to identify by
PCR a cDNA library that
contained the sequence of interest. and 2) for use as probes to isolate a
clone of the full-length coding
sequence. In order to screen several libraries for a source of a full-length
clone. DNA tiom the libraries was
screened by PCR amplification. as per Ausubel et al.. Current Protocols in
Molecular Biolog3~, with the PCR
primer pair. A positive library was then used to isolate clones encoding the
PR0533 gene of interest by an in
vivo cloning procedure using the probe oligonucleotide and one of the PCR
primers.
RNA for construction of the cDNA libraries was isolated from human fetal
retina. The eDNA
libraries used to isolated the cDNA clones were constructed by standard
methods using commercially available
reagents (e.g., Invitrogen, San Diego, CA; Clontech, etc.) The cDNA was primed
with oligo dT containing a
NotI site, linked with blunt to SaII hemikinased adaptors, cleaved with NotI,
sized appropriately by gel
electrophoresis, and cloned in a defined orientation into a suitable cloning
vector (such as pRKB or pRKD;
pRKSB is a precursor of pRKSD that does not contain the SfiI site; Holmes et
al., Science. _253: 1278-1280
(1991 )) in the unique XhoI and NotI sites.
A eDNA clone was sequenced in its entirety. The full length nucleotide
sequence DNA49435 (SEQ
ID NO:111) is shown in Figure 41. Clone DNA49435 (SEQ ID NO:11 I) contains a
single open reading frame
with an apparent translation initiation site at nucleotide positions 464-466
and ending at the stop codon (TAA)
at nucleotide positions 649-651, as indicated by bolded underline in Fig. 41.
The predicted PR0533
102
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
polypeptide precursor (i.e., UNQ334, SEQ ID N0:112) is 216 amino acids long,
has a calculated molecular
weight of 24,003 daltons and a pI of 6.99. Clone DNA49435-1219 has been
deposited with ATCC (under the
designation DNA49435-1219) on November 21, 1997 and is assigned ATCC deposit
no. 209480.
The oligonucleotide sequences used in the above procedure were the following:
S FGFlS.f: 5'-ATCCGCCCAGATGGCTACAATGTGTA-3'
(SEQ ID NO:1 I3)
FGFlS.p: 5'-GCCTCCCGGTCTCCCTGAGCAGTGCCAAACAGCGGCAGTGTA-3' (SEQ ID NO:I14)
FGF 1 S.r: 5'-CCAGTCCGGTGACAAGCCCAAA-3'
(SEQ ID NO:115)
V. Isolation of eDNA clones Encodin Human PR01083 (UNQ540)
Use of the amylase yeast screen procedure described above on tissue isolated
from human fetal
kidney tissue resulted in an EST sequence which served as the template for the
creation of the
oligonucleotides below and screening as described above in a human fetal
kidney library resulted in the
isolation of the full length DNA sequence DNA50921 (Fig. 43, SEQ ID NO: I 16)
and the derived PR01083
native sequence protein UNQ540 (SEQ ID N0:117).
The PCR primers (forward and reverse) and hybridization probes synthesized for
use in the above
procedure were the following:
forward primer: (43422.f1): 5'-GGCATTGGAGCAGTGCTGGGTG-3' (SEQ ID NO:I 18)
forward primer: (43422.f2): 5'-AGAGCAACTCAGACAGCG-3' (SEQ ID NO: I 19)
reverse primer: (43422.r1 ): 5'-TGGAGGCCTAGATGCGGCTGGACG-3' (SEQ ID N0:120)
reverse primer: (43422.r2): 5'-CGAGGAGACCATCAGCAC-3' (SEQ ID N0:121)
hybridization probe: (43422.p1): (SEQ ID N0:122)
5'-CCCAAACATCCTGCTTCTGCAACCACTTGACCTACTTTGCAGTGC-3'
Clone DNA50921 (SEQ ID N0:116) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 154-156 and ending at the
stop codon (TAG) at nucleotide
positions 2233-2235 (Figure 43). as indicated by bolded underline. The
predicted PR01083 polypeptide
precursor (i.e., UNQ540, SEQ ID N0:117, Figure 44) is 693 amino acids long.
The UNQ540 (SEQ ID
N0:117) protein shown in Figure 44 has an estimated molecular weight of about
77738 and a pI of about
8.87. A clone containing DNA50921 has been deposited with the ATCC on May 12,
1998 and has been
assigned deposit number 209859.
Analysis of the amino acid sequence UNQ540 (SEQ ID N0:117) reveals the
putative signal peptide is
at about amino acids 1-25, transmembrane domains are at about amino acids 382-
398, 402-420, 445-468, 473-
491, 519-537, 568-590 and 634-657, a microbodies C-terminal targeting signal
at about amino acids 691-693,
cAMP- and cGMP-dependent protein kinase phosphorylation sites at about amino
acids 198-201 and 370-373,
N-glycosylation sites at about amino acids 39-42, 148-151, 171-174, 234-237,
303-306, 324-227 and 341-344
and a G-protein coupled receptor family domain at about amino acids 475-504.
W. Isolation of cDNA clones Encoding Human PR0865 (UNQ434)
103
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Use of the amylase yeast screen procedure described above on tissue isolated
from human fetal kidney
tissue resulted in an EST sequence which served as the template for the
creation of the oligonucleotides below
and screening as described above in a human fetal kidney library resulted in
the isolation of the full length
DNA sequence DNAS3974 (Fig. 45, SEQ ID N0:123) and the derived PR0865 native
sequence protein
UNQ434 (SEQ ID N0:124).
The PCR primers (forward and reverse) and hybridization probes synthesized for
use in the above
procedure were the following:
forward primer: (4861S.f1): S'-AAGCTGCCGGAGCTGCAATG-3' (SEQ ID N0:12S)
forward primer: (48615.f2): 5'-TTGCTTCTTAATCCTGAGCGC-3' (SEQ ID N0:126)
forward primer: (4861S.f3): S'-AAAGGAGGACTTTCGACTGC-3' (SEQ ID N0:127)
reverse primer: (4861S.r1): S'-AGAGATTCATCCACTGCTCCAAGTCG-3' (SEQ ID N0:128)
reverse primer: (4861S.r2): S'-TGTCCAGAAACAGGCACATATCAGC-3' (SEQ ID N0:129)
hybridization probe: (43422.p1): (SEQ ID N0:130)
S'-AGACAGCGGCACAGAGGTGCTTCTGCCAGGTTAGTGGTTACTTGGATGAT-3'
1S Clone DNA53974 (SEQ ID N0:123) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 173-17S and ending at the
stop codon (TAA) at nucleotide
positions IS77-1579 (Figure 4S), as indicated by bolded underline. The
predicted PR086S polypeptide
precursor (i.e., UNQ86S, SEQ ID N0:124) is 468 amino acids long. The UNQ434
(SEQ ID NO: I24) protein
shown in Figure 46 has an estimated molecular weight of about 54,393 and a pI
of about 5.63. A clone
containing DNAS3974 (SEQ ID N0:123) has been deposited with the ATCC on April
14, 1998 and has been
assigned deposit number 209774.
Analysis of the amino acid sequence UNQ434 (SEQ ID N0:124) reveals the
putative signal peptide at
about amino acid residues I-23, potential N-glycosylation sites at about amino
acids residue 280 and at about
384, a potential amidation site from about amino acid residue 94 to about
residue 97, glycosaminoglycan
2S attachment sites from about amino acid residue 20 to about 23 and from
about residue 223 to about residue
226. an aminotransferase class-V pytidoxyl-phosphate amino acid sequence block
from about amino acid
residue ? 16 to about residue 222 and an amino acid sequence block similar to
that found in the interleukin-7
protein from about amino acid residue 338 to about residue 343.
X. Isolation of cDNA clones Encodine Human PR0770 (UNQ408)
A public expressed sequence tag (EST) DNA database (Merck/Washington
University) was searched
with the full-length murine m-FIZZ1 DNA (DNA53517), and an EST, designated
AA524300 was identified,
which showed homology with the m-FIZZ/ DNA.
The full-length clone corresponding to the EST AAS24300 was purchased from
Incyte (Incyte
3S Pharmaceuticals, Palo Alto, CA) and sequenced in entirety.
The entire nucleotide sequence of the resulting PR0770-encoding full-length
clone is shown in
Figure 47. This full-length clone, designated DNAS4228 (SEQ ID N0:133),
contains a single open reading
frame with an apparent translation initiation site at nucleotide positions 100-
102 (Fig.47; SEQ ID N0:133) and
ending at the stop codon (TGA) at residues 433-435, as indicated by bolded
underline. The predicted PR0770
polypeptide precursor (including a putative signal sequence of 20 amino acids)
(i.e., UNQ408, SEQ ID
104
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCTlUS00/05841
N0:134) is 111 amino acids long, has a calculated molecular weight of 11,730
daltons and a pI of 7.82. Based
upon its homology to m-FIZZ1 (50%, using the ALIGN software), the protein is
believed to be the human
homolog of m-FIZZ1, and has been designated h-FIZZ1. A cDNA clone containing
DNA54228 (SEQ ID
N0:133) has been deposited with ATCC and is assigned ATCC deposit no. 209801.
Identification and cloning of m-FIZZ1 (DNA53517)
Mouse asthma mode! Female Balb/C mice, 6 to 8 weeks of age, were separated
into two
experimental groups: controls and asthmatics. The asthmatic group was
immunized intraperitoneally with 10
Itg ovalbumin t I mg alum, while the control group was not. Two weeks later,
mice were exposed daily to an
aerosol of 10 mglml ovalbumin in PBS aerosolized with a UltraNeb nebulizer
(DeVilbiss) at the rate of 2
ml/min for 30 min each day, for 7 consecutive days. One day after the last
aerosol challenge, whole blood,
serum and bronchoalveolar lavage (BAL) samples were collected and the lungs
were harvested and preserved
for histological examination, immuno-histochemistry and in situ hybridization.
Gel electrophoresis of BAL samplesExamination of the BAL samples by gel
electrophoresis on a 16%
Tricine gel shows that a low molecular weight protein is expressed in the BAL
samples from asthmatic mice
but not in the BAL samples from control mice. This low m~IPrml:,r ,x,P;"t,r
."."~P;., ,.,~~ .A...,,o,r .,, ~r~~, .,..a
was seen to co-migrate with a 8300 Dalton marker protein.
Partial protein sequence The protein of interest was transferred upon a PVDF
membrane and
sequenced by Edman degradation. This sequence served as a template for the
preparation of various cloning
oligos as described below.
Partial cDNA sequence We designed r<vo degenerate oligonucleotide PCR primers
corresponding
to the putative DNA sequence for the first 7 and the last 7 amino acids of the
partial protein sequence..
Oligo #1:
5'-ACA AAC GCG TGA YGA RAC NAT HGA RAT-3' (SEQ ID N0:135)
Oligo # 2:
5'-TGG TGC ATG CGG RTA RTT NGC NGG RTT-3' (SEQ ID N0:136)
cDNA prepared from the lungs of normal mice was used as a template for the PCR
reaction which
yielded an 88 by product. This 88 by product contained 54 known base pairs,
encoding the PCR primers. and
34 novel base pairs, and encoded another partial mFIZZ-I sequence.
Full length cDNA clone This second partial sequence was used to design primers
which were
ultimately successful in obtaining the full length FIZZ clone (DNA53517) by RT-
PCR of mouse lung poly(A)T
RNA.
Oligo #3:
5'-ACA AAC GCG TGC TGG AGA ATA AGG TCA AGG-3' (SEQ ID N0:137)
This oligo was used as an RT-PCR primer in combination with 5' and 3'
amplimers from Clontech.
Oligo #4:
5'-ACT AAC GCG TAG GCT AAG GAA CTT CTT GCC-3' (SEQ ID NO: 138)
This oligo was used as an RT-PCR primer in combination with oligo d(T).
Y. Isolation of cDNA clones Encoding Human PR0769 (UNQ407)
105
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
A public expressed sequence tag (EST) DNA databases (Merck/Washington
University) was searched
with the full-length murine m-FIZZ1 DNA (DNA 53517) described above and the
EST W42069 was
identified.
The full-length clones corresponding to the EST fragment W42069 was obtained
from Incyte
S Pharmaceuticals (Palo Alto, California), and sequenced in the entirety,
which ultimately resulted in the
identification of the full length nucleotide sequence DNAS4231 (SEQ ID
N0:139).
The nucleotide sequence corresponding to the full length, native sequence
PR0769 clone is shown in .
Figure 49. This clone, designated DNA 54231 (SEQ ID N0:139) contains a single
open reading frame with an
apparent translation initiation site at nucleotide positions 7S-77 and ending
at the stop codon (TGA) at residues
417-419, as indicated by bolded underline (Fig. 49). The predicted PR0769
polypeptide precursor (including a
signal sequence of 10 amino acids)(i.e., UNQ407, SEQ ID N0:140) is I 14 amino
acids long, has a calculated
molecular weight of 12,492 daltons and a pI of 8.19. Based on its homology to
m-FIZZ/ (34%, using the
ALIGN software) the protein was designated m-FIZZ3. A clone containing
DNAS4231 (designated
DNAS4231-1366) has been deposited with ATCC on April 23, 1998 and has been
assigned ATCC deposit no.
209802.
Z. Isolation of cDNA clones Encodine Human PR0788 (UNQ430)
Use of the ECD homology procedure identified above resulted in the
identification of the partial
length EST sequence 2777282. Further analysis of the corresponding full-length
sequence resulted in the
identification of DNAS640S (SEQ ID NO:l4l) and the derived native sequence
PR0788 protein UNQ430
(SEQ ID N0:142).
Clone DNAS640S (SEQ ID N0:141 ) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 84-86 and ending at the
stop codon (TAG) at nucleotide
positions 4S9-461 (Figure 51 ), as indicated by bolded underline. The
predicted native sequence PR0788
polypeptide precursor (i.e., UNQ430, SEQ ID N0:142) is 125 amino acids long
(Figure S2). has a calculated
molecular weight of 13.115 daltons and a pI of 5.90. The UNQ430 (SEQ ID
N0:142) protein shown in Figure
S2 has an estimated molecular weight of about 13115 and a pI of about 5.90. A
clone containing DNAS640S
(SEQ ID N0:142) has been deposited with the ATCC on May 6, 1998 and has been
assigned deposit
number209849. In the event of a discrepancy in the nucleotide sequence of the
deposit and the sequences
disclosed herein, it is understood that the deposited clone contains the
correct sequence. It is further
understood that the methodology of sequencing for the sequences provided
herein are based on known
sequencing techniques.
Analysis of UNQ430 (SEQ ID NO:S2) shown in Figure 52 reveals a signal peptide
at about amino
acids 1-17 and an N-glycosylation site is at about amino acids 46.
AA. Isolation of eDNA clones Encodine Human PR01114 (UNQ557)
Use of the amylase yeast screen procedure described above on tissue isolated
from human fetal
kidney tissue resulted in an EST sequence which served as the template for the
creation of the
oligonucleotides below and screening as described above in a human breast
carcinoma library resulted in the
106
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758
PCT/US00/05841
isolation of the full length DNA sequence DNA57033 (Fig. 53, SEQ ID N0:143)
and the derived PR01114
native sequence protein UNQ557 (Fig. ~4, SEQ ID N0:144).
The PCR primers used in the isolation screen described in the previous
paragraph were:
forward primer: (48466.f1 ): S'-AGGCTTCGCTGCGACTAGACCTC-3' (SEQ ID N0:145)
reverse primer: (48466.r1): 5'-CCAGGTCGGGTAAGGATGGTTGAG-3' (SEQ ID N0:146)
hybridization probe: 48466.p 1 ):
5'-TTTCTACGCATTGATTCCATGTTTGCTCACAGATGAAGTGGCCATTCTGC-3' (SEQ ID N0:147)
Clone DNA57033 (SEQ ID N0:143) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 250-252 and ending at the
stop codon (TAG) found at
nucleotide positions I 183-I 185 (Figure 53, SEQ ID N0:143), as indicated by
bolded underline. The predicted
PR01114 polypeptide precursor (i.e., UNQ557, SEQ ID N0:144) is 311 amino acids
long, has a calculated
molecular weight of approximately 35,076 daltons and an estimated p1 of
approximately 5.04. Analysis of the
full-length PR01114 sequence shown in Figure 54 (SEQ ID N0:144) evidences the
presence of the following:
a signal peptide from about amino acid 1 to about amino acid 29, a
transmembrane domain from about amino
acid 230 to about amino acid 255, potential N-glycosylation sites from about
amino acid 40 to about amino
acid 43 and from about amino acid 134 to about amino acid 137, an amino acid
sequence block having
homology to tissue factor proteins from about amino acid 92 to about amino
acid 119 and an amino acid
sequence block having homology to integrin alpha chain proteins from about
amino acid 232 to about amino
acid 262. A cDNA clone containing DNA57033 (SEQ ID N0:143) has been deposited
with ATCC on May
27, 1998 and is assigned ATCC deposit no. 209905.
AB. Isolation of cDNA clones Encodine Human PRO 1007 (UNQ491 )
Use of the ECD homology procedure described above resulted in the
identification of an EST
sequence designated Merck EST T70513, which was derived from human liver
tissue (clone 83012 from
library 341 ) was further examined. The cocTesponding full-length clone was
further examined and sequenced,
resulting in the isolation of the full-length DNA sequence DNA57690 (Fig. 55,
SEQ ID N0:145) and the
derived PR01007 native sequence protein UNQ491 (Fig. 56, SEQ ID N0:146).
Clone DNA57690 (SEQ ID N0:145) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 16-18 and ending at the
stop codon (TGA) at nucleotide
positions 1054-1056 (Figure 55), as indicated by bolded underline. The
predicted PR01007 polypeptide
precursor (i.e., UNQ491, SEQ ID N0:146) is 346 amino acids long (Figure 56),
has a calculated molecular
weight of 35,971 daltons and a pI of 8.17. The UNQ491 (SEQ ID N0:146) protein
shown in Figure 56 has an
estimated molecular weight of about 35971 daltons and a pI of about 8.17. A
cDNA clone containing
DNA57690 (SEQ ID N0:145) has been deposited with the ATCC on 9 June 1998, and
has been assigned
deposit number 209950.
Analysis of the amino acid sequence of UNQ491 (SEQ ID N0:146) reveals the
putative signal peptide
at about amino acid residues I-30, a transmembrane domain at about amino acid
residues 325-346, N-
glycosylation sites at about amino acid residues 118, 129, 163, 176, 183 and
227 and a Ly-6/u-Par domain
proteins at about amino acid residues 17-36 and 209-222. The corresponding
nucleotides of the amino acids
presented herein can be routinely determined given the sequences provided
herein.
107
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
AC. Isolation of cDNA clones Encoding Human PR01184 (UNQ598)
Use of the signal algorithm procedure described above resulted in the
identification of Incyte EST
1428374 which was derived from an ileum tissue library (39, SINTBSTO1).
Further examination of the full
S length clone corresponding to this sequence resulted in the isolation of the
full-length DNA59220 (Fig. 57,
SEQ ID N0:147) and the derived PR01184 native sequence protein UNQ598 (Fig.
58, SEQ ID N0:148).
UNQ598 (SEQ ID N0:148), as shown in Figure 58 exhibits an apparent translation
initiation site at
nucleotide positions 106-108 and ending at the stop codon (TGA) found at
nucleotide positions 532-534, as
indicated by bolded underline. The predicted PR01184 polypeptide precursor
(i.e., UNQ598, SEQ ID
N0:148) is 142 amino acids long, has a calculated molecular weight of
approximately 15690 daltons and an
estimated pI of approximately 9.64. Analysis of UNQ598 (SEQ ID N0:148)
evidences the presence of a signal
peptide at about amino acids 1-38. A cDNA clone containing DNA59220 (SEQ ID
N0:147) has been
deposited with the ATCC on 9 June 1998, and has been assigned deposit number
209962. It is understood that
the deposited clone has the actual sequences and that representations are
presented herein.
AD. Isolation of cDNA clones Encodine Human PR01031 (UNQ516)
Use of the ECD homology procedure described above resulted in the
identification of the EST
sequence Merck W74558 (clone 344649). Ttie corresponding full-length clone was
examined and sequenced
resulting in the isolation of DNA sequencing gave the full-length DNA sequence
DNA59294 (Fig. 59, SEQ ID
N0:149) and the derived PR01031 native sequence protein UNQ516 (Fig. 60. SEQ
ID NO:150).
Clone DNA59294 (SEQ ID N0:149) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 42-44 and ending at the
stop codon (TGA) at nucleotide
positions 582-584 (Figure 59), as indicated by bolded underline. The predicted
PR01031 polypeptide
precursor (i.e., UNQ516, SEQ ID NO:150) is 180 amino acids long (Figure 60).
The UNQ516 protein shown
in Figure 60 has an estimated molecular weight of about 20437 and a pI of
about 9.58. Clone DNA59294
(SEQ ID N0:149) has been deposited with the ATCC on May 14, 1998 and has been
assigned deposit number
209866. Regarding the sequence, it is understood that the deposited clone
contains the correct sequence, and
the sequences provided herein are based on known sequencing techniques.
Analysis of the amino acid sequence of UNQS 16 (SEQ ID NO:150) reveals the
putative signal peptide
at about amino acid residues 1-20, an N-glycosylation site is at about amino
acid residue 75. A region having
sequence identity with IL-17 is at about amino acid residues 96-180. The
corresponding nucleotides can be
routinely determined given the sequences provided herein.
AE. Isolation of cDNA clones Encodine Human PR01346 (UNQ701)
Use of the ECD homology procedure described above in a human fetal kidney
library resulted in the
isolation of the full-length DNA sequence DNA59776 (Fig. 61, SEQ ID NO:151)
and the derived PR01346
native sequence protein UNQ701 (Fig. 62, SEQ ID N0:152).
The PCR primers (forward and reverse) and hybridization probe used in the
isolation of DNA59776
(SEQ ID NO:151 ) were the following:
forward PCR primer (45668.f1): 5'-CACACGTCCAACCTCAATGGGCAG-3' (SEQ ID N0:153)
108
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
reverse PCR primer (45668.r1 ): 5'-GACCAGCAGGGCCAAGGACAAGG-3' (SEQ ID N0:154)
hybridization probe (45668.p 1 ):
(SEQ ID N0:155)
S'-GTTCTCTGAGATGAAGATCCGGCCGGTCCGGGAGTACCGCTTAG-3'
Clone DNA59776 (SEQ ID N0:151 ) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 1-3 (ATG), and an apparent
stop codon (TAG) at nucleotide
positions 1384-1386 (TAG). The predicted PR01346 polypeptide precursor (i.e.,
UNQ701, SEQ ID N0:152)
is 461 amino acids long. The protein contains an apparent type II
transmembrane domain at amino acid
positions from about 31 to about 50, fibrinogen beta and gamma chains C-
terminal domain signature at about
amino acid positions 409-421 and a leucine zipper patterns at about amino acid
positions 140-161, 147-168,
154-175 and 161-182.
A cDNA clone containing DNAS9776, designated as DNA59776-1600, has been
deposited with
ATCC on August 18, 1998 and is assigned ATCC deposit no. 203128. The UNQ701
(SEQ ID N0:152)
protein shown in Figure 62 has an estimated molecular weight of about 50744
daltons and a pI of about 6.38.
AF. Isolation of cDNA clones Encoding Human PROI 15S (UNQ585)
Use of the signal algorithm procedure described above resulted in the
identification of Incyte EST
2858870 which was derived from an ileum tissue library (39, SININOT03).
Further examination of the full
length clone corresponding to this sequence resulted in the isolation of the
full-length DNA sequence
DNA59849 (Fig. 63, SEQ ID N0:156) and the derived PRO11S5 native sequence
protein UNQ585 (Fig. 64,
SEQ ID N0:157).
The UNQ585 (SEQ ID N0:157) polypeptide shown in Figure 64 contains a single
open reading frame
with an apparent translation initiation site at nucleotide positions IS8-160
and ending at the stop codon (TAA)
found at nucleotide positions 563-565, as indicated by bolded underline. The
predicted PR01155 polypeptide
precursor (i.e., UNQ585. SEQ ID N0:157) is 135 amino acids long, and signal
peptide appears at about amino
acids residues 1 to about 18, a leucine zipper pattern appears at about amino
acid residues 43 to 64 and a
tachykinin family signature appears at about amino acid residues 86 to about
91. UNQS85 (SEQ ID N0:157)
has a calculated molecular weight of approximately 14833 daltons and an
estimated pI of approximately 9.78.
A cDNA clone containing DNA59849 (SEQ ID N0:156), designated as DNA59849-1504,
has been deposited
with ATCC on June 16, 1998 and is assigned ATCC deposit no. 209986.
AG. Isolation of cDNA clones Encoding Human PR01250 (UNQ633)
Use of the signal algorithm procedure described above resulted in the
identification of an EST cluster
sequence from the Incyte database, designated Incyte EST cluster sequence no.
56523. This sequence was then
compared to a variety of various EST databases as described under the signal
algorithm procedure above, and
further resulted in the identification of Incyte EST 3371784. Further
examination and sequencing of the full-
length clone corresponding to this EST sequence resulted in the isolation of
the full-length DNA sequence
DNA60775 (Fig. 65, SEQ ID N0:158) and the derived PR01250 native sequence
protein UNQ633 (Fig. 66,
SEQ ID N0:159).
Clone DNA60775 (SEQ ID N0:158) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 74-76 and ending at the
stop codon (TAG) at nucleotide
109
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/USOO10584I
positions 2291-2293 (Figure 65). The predicted PR01250 polypeptide precursor
(i.e., UNQ633, SEQ ID
N0:159) is 739 amino acids long (Figure 66). The UNQ633 (SEQ ID N0:159)
protein shown in Figure 66 has
an estimated molecular weight of about 82,263 daltons and a pI of about 7.55.
Analysis of LJNQ633 (SEQ ID
N0:159) evidences the presence of the following: a type II transmembrane
domain from about amino acid
residues 61 to about 80, a putative AMP-binding domain signature sequence from
about amino acid residue
314 to about 325, and potential N-glycosylation sites from about amino acid
residues 102 to about 105, from
about amino acid residues 588 to about 591 and from about amino acid residues
619 to about 622. A cDNA
clone containing DNA60775 (SEQ ID N0:158) has been deposited with the ATCC on
September l, 1998 and
is assigned ATCC deposit no. 203173.
AH. Isolation of cDNA clones Encodine Human PR01312 (UNQ678)
An EST (DNA55773) was identified in a human fetal kidney cDNA library using a
yeast screen, that
preferentially represents the 5' ends of the primary cDNA clones. Based on the
DNA55773 sequence.
oligonucleotides were synthesized for use as probes to isolate the full-length
DNA sequence DNA61873 (Fig.
67. SEQ ID N0:160) and the derived PRO 1312 native sequence UNQ678 (SEQ ID
N0:161 ).
The full length DNA61873 clone shown in Figures 67 (SEQ ID N0:160) contains a
single open
reading frame with an apparent translation initiation site at about nucleotide
positions 7-9 and ending at the
stop codon (TGA) found at about nucleotide positions 643-645, as indicated by
bolded underline. The
predicted PR01312 polypeptide precursor (i.e., UNQ678, SEQ ID N0:161) is 212
amino acids long. UNQ678
(SEQ ID N0:161 ) has a calculated molecular weight of approximately 24,024
daltons and an estimated pI of
approximately 6.26. Other features include a signal peptide at about amino
acids 1-14; a transmembrane
domain at about amino acids 141-160, and potential N-glycosylation sites at
about amino acids 76-79 and 93-
96. A clone containing DNA61873 (SEQ ID N0:160) has been deposited with the
ATCC on August 18. 1998,
under the designation DNA61873-1312, and has been assigned deposit number
203132.
AI. Isolation of cDNA clones Encodine Human PR01192 (UNQ606)
Use of the ECD homology procedure described above in a human fetal liver
library resulted in the
isolation of the full-length DNA sequence DNA62814 (Fig. 69, SEQ ID N0:162)
and the derived PR01192
native sequence protein UNQ606 (Fig. 70, SEQ ID N0:163).
The PCR primers (forward and reverse) and hybridization probe used in the
isolation of DNA62814
(SEQ ID N0:162) were the following:
forward PCR primer (35924.f1): 5'-CCGAGGCCATCTAGAGGCCAGAGC-3' (SEQ ID N0:164)
reverse PCR primer (35924.r1 ): 5'-ACAGGCAGAGCCAATGGCCAGAGC-3' (SEQ ID
N0:165).
hybridization probe (35924.p1):
(SEQ ID N0:166).
S'-GAGAGGACTGCGGGAGTTTGGGACCTTTGTGCAGACGTGCTCATG-3'
Clone DNA62814 (Fig. 69, SEQ ID N0:162) contains a single open reading frame
with an apparent
translation initiation site at nucleotide positions 121-123, and an apparent
stop codon (TAA) at nucleotide
positions 766-768, as indicated by bolded underline. The predicted PR01192
polypeptide precursor (i.e.,
UNQ606, SEQ ID N0:163) is 215 amino acids long. The UNQ606 (SEQ ID N0:163)
polypeptide precursor
shown in Figure 70 has a signal peptide at about amino acids I-21; a
transmembrane domain at about amino
110
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
acids 153-176; potential N-glycosylation sites at about amino acids 39-42 and
118-121; and homology with
myelin PO proteins at about amino acids 27-68 and 99-128. The UNQ606 (SEQ ID
N0:163) shown in Figure
70 has an estimated molecular weight of about 24,484 Daltons and a pI of about
6.98.
A cDNA clone containing DNA62814 (SEQ ID N0:162), designated as DNA62814-1521,
was
deposited with the ATCC on August 4, 1998, and is assigned ATCC deposit no.
203093.
AJ. Isolation of cDNA clones Encoding Human PRO 1246 (UNQ630)
Use of the signal algorithm procedure described above resulted in the
identification of an EST cluster
sequence from the Incyte database, designated Incyte EST cluster sequence no.
56853. This sequence was then
compared to a variety of various EST databases as described under the signal
algorithm procedure above, and
further resulted in the identification of Incyte EST 2481345. Further
examination and sequencing of the full-
length clone corresponding to this EST sequence resulted in the isolation of
the full-length DNA sequence
DNA64885 (Fig. 71, SEQ ID N0:167) and the derived PR01246 native sequence
protein UNQ630 (Fig. 72,
SEQ ID N0:168).
Clone DNA64885 (SEQ ID N0:167) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions I 19-121 and ending at the
stop codon (TGA) at nucleotide
positions 1727-1729 (Figure 71), as indicated by bolded underline. The
predicted PR01246 polypeptide
precursor (i.e., UNQ630, SEQ ID N0:168) is 536 amino acids long (Figure 72),
has an estimated molecular
weight of about 61,450 daltons and a pI of about 9.17. Analysis of UNQ630
(Fig. 72, SEQ ID N0:168) reveals
the following: a signal peptide from about amino acid 1 to about amino acid
15, potential N-glycosylation sites
from about amino acid 108 to about amino acid I 1 I, from about amino acid 166
to about amino acid 169, from
about amino acid 193 to about amino acid 196, from about amino acid 262 to
about amino acid 265, from
about amino acid 375 to about amino acid 378, from about amino acid 413 to
about amino acid 416 and from
about amino acid 498 to about amino acid 501 and amino acid sequence blocks
having homology to sulfatase
proteins from about amino acid 286 to about amino acid 315, from about amino
acid 359 to about amino acid
369 and from about amino acid 78 to about amino acid 97. A cDNA containing
DNA64885 (SEQ ID
N0:167), designated DNA64885-1529, has been deposited with ATCC on November 3,
1998 and is assigned
ATCC deposit no. 203457.
AK. Isolation of cDNA clones Encoding Human PR01283 (UNQ653)
Use of the ECD homology procedure described above in a human breast tumor
tissue library resulted
in the isolation of the full-length DNA sequence DNA65404 (Fig. 73, SEQ ID
N0:169) and the derived
PR01283 native sequence protein UNQ653 (Fig. 74, SEQ ID N0:170).
The PCR primers (forward and reverse) and hybridization probes used in the
isolation of DNA65404
(SEQ ID N0:169) were the following:
forward PCR primer (28753.f1S'-GGAGATGAAGACCCTGTTCCTG-3'(SEQ ID
): N0:171
)
forward PCR primer (28753.f11S'-GGAGATGAAGACCCTGTTCCTGGGTG-3'(SEQ ID
): N0:172)
reverse PCR primer (28753.r1):S'-GTCCTCCGGAAAGTCCTTATC-3' (SEQ ID
N0:173)
reverse PCR primer (28753.r11):5'-GCCTAGTGTTCGGGAACGCAGCTTC-3'(SEQ ID
N0:174)
hybridization probe
(28753.p I ): (SEQ ID
N0:175)
111
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/0584t
5'-CAGGGACCTGGTACGTGAAGGCCATGGTGGTCGATAAGGACTTTCCGGAG-3'
hybridization probe (28753.p11): (SEQ ID N0:176)
S'-CTGTCCTTCACCCTGGAGGAGGAGGATATCACAGGGACCTGGTAC-3'
Clone DNA65404 (SEQ ID N0:169) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 4S-47 and ending at the
stop codon (TAG) at nucleotide
positions 555-557 (Figure 73), as indicated by bolded underline. The predicted
PR01283 polypeptide
precursor (i.e., UNQ653, SEQ ID N0:170) is 170 amino acids long (Figure 74).
The UNQ653 (SEQ ID
N0:170) protein shown in Figure 74 has an estimated molecular weight of about
19,457 daltons and a pI of
about 9.10. Analysis of the UNQ653 (SEQ ID N0:170) evidences the presence of
the following: a signal
peptide from about amino acid 1 to about amino acid 17. A cDNA clone
containing DNA65404 (SEQ ID
N0:169), designated DNA65404-1551, has been deposited with ATCC on September
9, 1998 and is assigned
ATCC deposit no. 203244.
AL. Isolation of cDNA clones Encodine Human PROI 195 (UNQ608)
Use of the signal algorithm procedure described above resulted in the
identification of an EST cluster
sequence 32204 from the Incyte database. This sequence was then compared to a
variety of various EST
databases as described under the signal algorithm procedure above, and further
resulted in the identification of
Incyte EST352980. Further examination and sequencing of the full-length clone
corresponding to this EST
sequence resulted in the isolation of the full-length DNA sequence DNA65412
(Fig. 75, SEQ ID N0:177) and
the derived PR01195 native sequence protein UNQ608 (Fig. 76, SEQ ID N0:178).
The full length clone DNA65412 (SEQ ID N0:177) contains a single open reading
frame with an
apparent translation initiation site at nucleotide positions 58-60 and ending
at the stop codon (TAG) found at
nucleotide positions 511-513 (Figure 75), as indicate by bolded underline. The
predicted PR01195
polypeptide precursor (i.e., UNQ608, Figure 76, SEQ ID N0:178) is 151 amino
acids long, has a calculated
molecular weight of 17.227 daltons and a pI of 5.33. Analysis of UNQ608 (SEQ
ID N0:178) reveals a signal
sequence at about amino acids 1-22. a calculated molecular weight of
approximately 17277 daltons and an
estimated pI of approximately 5.33. A cDNA clone containing DNA65412 (SEQ ID
N0:177), designated as
DNA65412-1523, was deposited with the ATCC on August 4, 1998 and is assigned
ATCC deposit no. 203094.
AM. Isolation of cDNA clones Encoding Human PR01343 (UNQ698)
Use of the amylase yeast screen procedure described above on tissue isolated
from human smooth
muscle cell tissue resulted in an EST sequence which served as the template
for the creation of the
oligonucleotides below and screening as described above in a human smooth
muscle cell tissue library
resulted in the isolation of the full length DNA sequence DNA66675 (Fig. 77,
SEQ ID N0:179) and the
derived PR01343 native sequence protein UNQ698 (Fig. 78, SEQ ID N0:180).
The oligonucleotide probes employed were as follows:
forward PCR primer (48921.f1) S'-CAATATGCATCTTGCACGTCTGG-3' (SEQ ID N0:181)
reverse PCR primer (48921.r1) 5'-AAGCTTCTCTGCTTCCTTTCCTGC-3' (SEQ ID N0:182)
hybridization probe (48921.p 1 )
S'-TGACCCCATTGAGAAGGTCATTGAAGGGATCAACCGAGGGCTG-3' (SEQ ID N0:183)
112
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/0584I
The full length clone DNA66675 (SEQ ID N0:179) contains a single open reading
frame with an
apparent translation initiation site at nucleotide positions 71-73, and a stop
signal (TAA) at nucleotide positions
812-814 (Figure 77), as indicated by bolded underline. The predicted PR01343
polypeptide precursor (i.e..
UNQ698, SEQ ID N0:180, Fig. 78) is 247 amino acids long, has a calculated
molecular weight of
approximately 25,335 daltons and an estimated pI of approximately 7Ø
Analysis of the UNQ698 sequence
shown in Figure 78 (SEQ ID N0:180) evidences the presence of the following: a
signal peptide from about
amino acid I to about amino acid 25 and a homologous region to
circumsporozoite repeats from about amino
acid 35 to about amino acid 225. A cDNA clone containing DNA66675 (SEQ ID
N0:179), designated
DNA666?5-1587, has been deposited with ATCC on September 22, 1998 and is
assigned ATCC deposit no.
203282.
Alternatively, a comparison of the yeast EST sequence isolated from the
amylase screen above was
screened against various EST databases, both public and private (e.g., see ECD
homology procedure, above)
resulting in the identification of Incyte EST clone no. 4701148. Further
analysis and sequencing of the
corresponding full-length clone resulted in isolation of the DNA66675 sequence
(SEQ ID N0:179) shown in
I S Figure 77.
AN. Isolation of cDNA clones Encodine Human PR01418 (UNQ732)
Use of the signal altorithm procedure described above resulted in the
identification of an EST cluster
sequence 10698 (Incyte cluster 121480). This sequence was then compared to a
variety of various EST
databases (including those derived from a placenta tissue library) as
described under the signal algorithm
procedure above, and further resulted in the identification of Incyte
EST1306026. Further examination and
sequencing of the full-length clone corresponding to this EST sequence
resulted in the isolation of the full-
length DNA sequence DNA68864 (Fig. 79, SEQ ID N0:184) and the derived PR01418
native sequence
protein UNQ732 (Fig. 80, SEQ ID N0:185).
The full length clone shown in Figure 79 (DNA68864, SEQ ID N0:184) contains a
single open
reading frame with an apparent translation initiation site at nucleotide
positions 138-140 and ending at the stop
codon (TAA) found at nucleotide positions 1188-1190, as indicated by bolded
underline. The predicted
PR01418 polypeptide precursor (i.e., UNQ732, SEQ ID N0:185) is 350 amino acids
long with a signal
peptide at about amino acids 1-19, a calculated molecular weight of
approximately 39003 daltons and an
estimated pI of approximately 5.59. A eDNA clone containing DNA68864 (SEQ ID
N0:184), designated as
DNA68864-1629 was deposited with the ATCC on September 22, 1998 and is
assigned ATCC deposit no.
203276.
AO. Isolation of cDNA clones Encodine Human PRO 1387 (UNQ722)
Use of the signal algorithm procedure described above resulted in the
identification of an EST cluster
sequence 10298. This sequence was then compared to a variety of various EST
databases as described under
the signal algorithm procedure above, and further resulted in the
identification of Incyte EST3507924. Further
examination and sequencing of the full-length clone corresponding to this EST
sequence resulted in the
isolation of the full-length DNA sequence DNA68872 (Fig. 81, SEQ ID N0:186)
and the derived PR01387
native sequence protein UNQ722 (Fig. 82, SEQ ID N0:187).
113
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Clone DNA68872 (SEQ ID N0:186) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 76-78 and ending at the
stop codon (TGA) at nucleotide
positions 1258-1260 (Figure 81), as indicated by bolded underline. The
predicted PR01387 polypeptide
precursor (i.e., UNQ722, SEQ ID N0:187) is 394 amino acids long. The UNQ722
(SEQ ID N0:187) protein
shown in Figure 82 has an estimated molecular weight of about 44,339 daltons
and a pI of about 7.10.
UNQ722 (SEQ ID N0:187) further contains a signal peptide from about amino acid
residues I to about residue
19, a transmembrane domain from about residue 275 to about residue 296,
potential N-glycosylation sites at
about residues 76, 231. 302, 307 and 376 and amino acid sequence blocks having
homology to myelin p0
protein from about amino acid residue 210 to about residue 239 and from about
amino acid residue 92 to about
residue 121. A cDNA clone containing DNA68872, designated as DNA68872-1620,
has been deposited with
the ATCC on August 25, 1998 and is assigned ATCC deposit no. 203160.
AP. Isolation of cDNA clones Encodine Human PR01410 (UNQ7~8)
Use of the signal algorithm procedure described above resulted in the
identification of an EST cluster
IS sequence 98502. This sequence was then compared to a variety of various EST
databases as described under
the signal algorithm procedure above. and further resulted in the
identification of Incyte EST1257046. Further
examination and sequencing of the full-length clone corresponding to this EST
sequence resulted in the
isolation of the full-length DNA sequence DNA68874 (Fig. 83, SEQ ID N0:188)
and the derived PR01387
native sequence protein UNQ728 (Fig. 84, SEQ ID N0:189).
Clone DNA68874 (SEQ ID N0:188) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 152-154 and ending at the
stop codon (TGA) at nucleotide
positions 866-868 (Figure 83), as indicated by bolded underline. The predicted
PR01410 polypeptide
precursor (i.e., UNQ728, SEQ ID N0:189) is 238 amino acids long (Figure 84).
The UNQ728 protein (SEQ
ID N0:189) shown in Figure 84 has an estimated molecular weight of about
25,262 daltons and a pI of about
6.44, a signal peptide from about amino acid residue I to about residue 20, a
transmembrane domain from
about amino acid residue 194 to about residue 220 and a potential N-
glycosylation site at about amino acid
residue 132. A clone containing DNA68874 (SEQ ID N0:188) has been deposited
with ATCC on September
22, 1998 and is assigned ATCC deposit no. 203277.
AQ. Isolation of cDNA clones Encodine Human PR01917 (UN 900)
Use of the signal algorithm procedure described above resulted in the
identification of an EST cluster
sequence 85496. This sequence was then compared to a variety of various EST
databases as described under
the signal algorithm procedure above, and further resulted in the
identification of Incyte EST3255033. This
EST was derived from an ovarian tumor library. Further examination and
sequencing of the full-length clone
corresponding to this EST sequence resulted in the isolation of the full-
length DNA sequence DNA76400 (Fig.
85, SEQ ID N0:190) and the derived PRO 1917 native sequence protein UNQ900
(Fig. 86, SEQ ID N0:191 ).
The full length clone DNA76400 (SEQ ID N0:190) shown in Figure 85 contains a
single open
reading frame with an apparent translation initiation site at nucleotide
positions 6 to 9 and ending at the stop
codon (TGA) found at nucleotide positions 1467 to 1469 as indicated by bolded
underline. The predicted
PR01917 polypeptide precursor (i.e., UNQ900, SEQ ID N0:191) is 487 amino acids
long. UNQ900 (SEQ ID
114
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
N0:191) has a calculated molecular weight of approximately 55,051 daltons and
an estimated pI of
approximately 8.14. Additional features include: a signal peptide at about
amino acid residues 1-30; potential
N-glycosylation sites at about amino acid residues 242 and 481, protein kinase
C phosphorylation sites at about
amino acid residues 95-97, 182-184, and 427-429: N-myristoylation sites at
about amino acid residues 107-
112, 113-118, 117-122, 118-123, and 128-133; and an endoplasmic reticulum
targeting sequence at about
amino acid residues 484-487.
AR. Isolation of cDNA clones Encodine Human PR01868 (UNQ859)
Use of the ECD homology procedure described above in a human fetal liver
library resulted in the
identification of EST clone no. 2994689. Further analysis and sequencing of
the corresponding full-length
clone resulted in the isolation of DNA77624 (Fig. 87, SEQ ID N0:192) and the
derived PR01868 native
sequence protein UNQ859 (Fig. 88, SEQ ID N0:193 j.
Clone DNA77624 (Fig. 88, SEQ ID N0:193) contains a single open reading frame
with an apparent
translation initiation site at nucleotide positions 51-53 and ending at the
stop codon (TGA) at nucleotide
positions 981-983, as indicated by bolded underline. The predicted PR01868
polypeptide precursor (i.e..
UNQ859, SEQ ID NO:193, Fig. 89) is 310 amino acids long. The UNQ859 (SEQ ID
N0:193) protein shown
in Figure 89 has an estimated molecular weight of about 35.020 daltons and a
pI of about 7.90, a
transmembrane domain from about amino acid residue 243 to about residue 263.
potential N-glycosylation
sites at about amino acid residues 104 and 192, a cAMP- and cGMP-dependent
protein kinase phosphorylation
site from about amino acid residues 107 to about residue 110, casein kinase II
phosphorylation sites from about
amino acid residues 106 to about residue 109 and from about amino acid residue
296 to about residue 299, a
tyrosine kinase phosphorylation site from about amino acid residue 69 to about
residue 77 and potential N-
myristolation sites from about amino acid residue 26 to about residue 31, from
about residue 215 to about
residue 220, from about residue 226 to about residue 231, from about residue
243 to about residue 248, from
about residue 244 to about residue 249 and liom about residue 262 to about
residue 267. A cDNA clone
containing DNA77624 (SEQ ID N0:193) has been deposited with ATCC on December
22, 1998 and is
assigned ATCC deposit no 203553.
AS. Isolation of cDNA clones Encodine Human PR0205 (UNQ179)
Use of the ECD procedure above resulted in the identification of an EST
sequence derived from a
human retinal library. Additional effort to identify the full length clone
using an in vitro cloning procedure
were unable to identify another PR0205 encoding DNA sequence.
DNA sequence encoding other polypeptide of substantial homology to the UNQ179
(SEQ ID
N0:229) polypeptide of Figure 90 may be found as GenBank submissions
AB033089_1 and HSM802147_1.
Clone DNA30868 (SEQ ID N0:89) contains what is believed to be an incomplete
open reading frame
with an apparent translation initiation site at nucleotide positions 405-407
as indicated by bolded underline in
Figure 89. The predicted partial length PR01868 polypeptide precursor (i.e.,
UNQ179, SEQ ID N0:229) is
343 amino acids long, has a calculated molecular weight of 39285 daltons and a
pI of 6.06.
115
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Analysis of the UNQ179 (SEQ ID N0:229) shown in Figure 90 reveals a signal
peptide at about
amino acid residues 1 to 20, an N-glycosylation site at about amino acid
residues 318-322, tyrosine kinase
phosphorylation sites at about amino acids residues 21-29 and 211-220, N-
myristolation sites at about residues
63-69, 83-89 and 317-323 and a prokaryotic membrane lipoprotein lipid
attachment site at about residues 260-
271. A cDNA clone containing DNA30868 (SEQ ID N0:228) has been deposited with
the ATCC on March 2,
2000 under the designation DNA30868-1156 and has been assigned ATCC deposit
no.
AT. Isolation of cDNA clones Encodine Murine PR021 (UNQ21 )
The isolation of DNA36638 (Fig. 91, SEQ ID N0:230), which encodes the native
sequence PR021
polypeptide UNQ21 (Fig. 92, SEQ ID N0:231) has been previously described in
U.S.P. 5,955,420. Additional
cloning and characterizing information can be found in Schneider et al., Cell
_54 (6): 787-93 ( 1988) and in
Manfioletti et al., Mol Cell Biol. 13 (8): 4976-85 (1993).
Clone DNA36638 contains a single open reading frame with an apparent
translation initiation site at
nucleotide residues 168-170 and ending at the stop codon (TAG) at nucleotide
residues 2187-2189 (Figure 91),
as indicated by bolded underline. The predicted PR021 polypeptide precursor l
i.e.. UNQ21, SEQ ID N0:231 )
is 673 amino acids long, has a calculated molecular weight of 74,512 daltons
and a pI of 5.45. A cDNA clone
containing DNA36638 has been deposited with the ATCC under the designation
DNA36638-1056 on
November 12, 1997 and has been assigned ATCC deposit number 209456.
Analysis of the UNQ21 polypeptide of Figure 92 (SEQ ID N0:231 ) reveals a
signal sequence at about
amino acid residues I-27, a transmembrane domain at about amino acid residues
619-635, N-glycosylation
sites at about residues 417-421 and 488-492, N-myristolation sites at about
amino acid residues 126-132, 135
141, 146-152, 173-179, 214-220, 253-259, 346-352, 374-380, 440-446, 479-485,
497-503, 517-523, 612-618,
aspartic acid and asparagine hydroxylation sites at about amino acid residues
130-142, 168-180, 209-221 and
248-260, a vitamin K-dependent carboxylation domain and an EGF-like domain
cysteine pattern signature at
about amino acid residues 139-151.
AU. Isolation of cDNA clones EncodinL Human PR0269 (UNQ~36)
Use of the ECD homology procedure described above in a human fetal kidney
library in combination
with an in vitro cloning procedure using the probe oligonucleotide and one of
the primer pairs below resulted
in the identification of the full length DNA sequence DNA38260 (Fig. 93, SEQ
ID N0:232) and the derived
PR0269 native sequence protein UNQ236 (Fig. 94, SEQ ID N0:233).
The forward and reverse PCR primers and the hybridization probe used were the
following:
forward PCR primer (.fl ): (SEQ ID N0:234)
5'-TGGAAGGAGATGCGATGCCACCTG -3'
forward PCR primer (.f2):
(SEQ ID N0:235)
S'-TGACCAGTGGGGAAGGACAG-3'
forward PCR primer (.f3): (SEQ ID N0:236)
5'-ACAGAGCAGAGGGTGCCTTG-3'
reverse PCR primer (.rl):
(SEQ ID N0:237)
5'-TCAGGGACAAGTGGTGTCTCTCCC-3'
116
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
reverse PCR primer(.r2): (SEQ ID N0:238)
5'-TCAGGGAAGGAGTGTGCAGTTCTG-3'
hybridization probe: (SEQ ID N0:239)
5'-ACAGCTCCCGATCTCAGTTACTTGCATCGCGGACGAAATCGGCGCTCGCT-3'
Clone DNA38260 (SEQ ID N0:232) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 314-316 and ending at the
stop codon (TAG) at nucleotide
positions 1784-1786 (Fig. 93), as indicated by bolded underline. The predicted
PR0269 polypeptidc precursor
is 490 amino acids long (i.e., UNQ236, Fig. 94, SEQ ID N0:233), has a
calculated molecular weight of 51,636
daltons and a pI of 6.29. A cDNA clone containing DNA38260 (SEQ ID N0:232) has
been deposited with
ATCC on October 17, 1997 and is assigned ATCC deposit no. 209397.
Analysis of the UNQ236 polypeptide of Figure 94 (SEQ ID N0:223) reveals a
signal sequence at
about amino acid residues 1-16, a transmembrane domain at about residues 399-
418, N-glycosylation sites at
about amino acid residues 189-193 and 381-385, a glycosaminoglycan attachment
site at about amino acid
residues 289-293, cAMP- and cGMP-dependent protein kinase phosphorylation
sites at about amino acid
residues 98-102 and 434-438, N-myristolation sites about amino acid residues
30-36, 35-41. 58-64. 59-65, 121-
127, 151-157, 185-191. 209-215. 267-273, 350-356, 374-380, 453-459, 463-469
and 477-483 and an aspartic
acid and asparagine hydroxylation site at about amino acid residues 262-274.
AV. Isolation of cDNA Encodine Human PR0344 (UNQ303)
Use of the ECD homology procedure described above in a human fetal kidney
library in combination
with an in vitro cloning procedure using the probe oligonucleotide and one of
the primer pairs below resulted
in the identification of the full length DNA sequence DNA40592 (Fig. 95, SEQ
ID N0:240) and the derived
PR0344 native sequence protein UNQ303 (Fig. 96, SEQ ID N0:241 ).
The forward and reverse PCR primers and the hybridization probe used were the
following:
forward PCR primer (34398.f1): (SEQ ID N0:242)
5'-TACAGGCCCAGTCAGGACCAGGGG-;'
forward PCR primer (34398.f2): (SEQ ID N0:243)
5'-AGCCAGCCTCGCTCTCGG-3'
forward PCR primer (34398.f3): (SEQ ID N0:244)
5'-GTCTGCGATCAGGTCTGG-3'
reverse PCR primer (34398.r1): (SEQ ID N0:245)
5'-GAAAGAGGCAATGGATTCGC-3'
reverse PCR primer (34398.r2): (SEQ ID N0:246)
5'-GACTTACACTTGCCAGCACAGCAC-3'
hybridization probe (34398.p 1 ):
(SEQ ID N0:247)
5'-GGAGCACCACCAACTGGAGGGTCCGGAGTAGCGAGCGCCCCGAAG-3'
Clone DNA40592 (SEQ ID N0:240) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 227-229 and ending at the
stop codon (TAG) at nucleotide
positions 956-958 (Figure 95). The predicted PR0344 polypeptide precursor
(i.e., UNQ303, SEQ ID N0:241)
is 243 amino acids long (Figure 96), has a calculated molecular weight of
25,298 daltons and a pI of 6.44.
117
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Analysis of the UNQ303 polypeptide of Figure 96 (SEQ ID N0:241 ) reveals a
signal peptide at about amino
acid residue 1-15, N-myristolation sites at about amino acid residues 1 I-17.
68-74, and 216-222 and a cell
attachment site at about amino acid residues 77-80. A cDNA clone containing
DNA40592 (SEQ ID N0:240)
has been deposited with ATCC on November 21, 1997 and is assigned ATCC deposit
no. 209492.
AX. Isolation of cDNA clones Encodine Human PR0333 (UNQ294)
Use of the ECD homology procedure in combination with an in vivo cloning
procedure resulted in the
identification of the partial length sequence DNA41374 (SEQ ID N0:248, Figure
97).
Clone DNA41374 (SEQ ID N0:248) contains an incomplete open reading frame with
an apparent
translation termination site (i.e., stop codon, TGA) at nucleotide residues
1185-1187, as indicated in bolded
underline. The predicted partial length PR0333 polypeptide (i.c., UNQ294, SEQ
ID N0:249) is 394 amino
acids long, a calculate molecular weight of 43,725 daltons and a pI of 8.36.
Analysis of the UNQ294 (SEQ ID N0:249) polypeptide of Figure 98 reveals a
signal sequence at
about amino acid residues 1-14, a transmembrane domain at about residues 359-
376, N-mvristoylation sites at
about amino acid residues 166-172. 206-212, 217-223, 246-252, 308-314, 312-
318, 361-367 and an
immunoglobulin and major histocompatibility complex proteins signature at
amino acid residues 315-323. A
cDNA clone containing DNA41374 has been deposited with the ATCC on and as
assiened
ATCC deposit number
AY. Isolation of cDNA clones Encodine Human PR0381 (UNQ322)
Use of the ECD homology procedure described above in a human fetal kidney
library resulted in the
identification of the full length DNA sequence DNA44194 (Fig. 99, SEQ ID
N0:250) and the derived PR0381
native sequence protein UNQ322 (Fig. 100. SEQ ID N0:251).
The forward and reverse PCR primers and the hybridization probe used were the
following:
Forward PCR primer (39651.f1): (SEQ ID N0:252)
5'-CTTTCCTTGCTTCAGCAACATGAGGC-3'
Reverse PCR primer (39651.r1 ): (SEQ ID N0:253)
S'-GCCCAGAGCAGGAGGAATGATGAGC-3'
hybridization probe (39651.p 1 ):
(SEQ ID N0:254)
5'-GTGGAACGCGGTCTTGACTCTGTTCGTCACTTCTTTGATTGGGGCTTTG-3'
Clone DNA44194 (SEQ ID N0:250) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 174-176 and ending at the
stop codon (TAG) at nucleotide
positions 807-809 (Fig. 99), as indicated by bolded underline. The predicted
PR0381 polypeptide precursor
(i.e.. UNQ322, Fig. 100, SEQ ID N0:251) is 211 amino acids long, has a
calculated molecular weight of
24,172 daltons and has a pI of 5.99. The UNQ322 (SEQ ID N0:251) protein shown
in Figure 100 has the
following features: a signal peptide from about amino acid residues 1 to about
20, a potential N-glycosylation
site at about amino acid residue 156, potential casein kinase phosphorylation
sites from about amino acid
residues 143 to about 146, about residues 156 to about 159, about residues 178
to about 181, about residues
200 to about 203, an endoplasmic reticulum targeting sequence from about amino
acid residues 78 to about 114
and from about residues 118 to about 131, EF-hand calcium binding domain from
about amino acid residues
118
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
140 to about 159, and an S-100/ICaBP type calcium binding domain from about
amino acid residues 183 to
about 203. A cDNA clone containing DNA44194 (SEQ ID N0:250) has been deposited
with the ATCC on
April 28. 1998 and is assigned deposit number 209808.
AZ. Isolation of cDNA clones Encoding Murine PR0720 (UNQ388)
The preparation of DNA53517 (SEQ ID N0:255) is described above under "X.
Isolation of cDNA
clones Encoding Human PR0770 (UNQ408)." Clone DNA53517 (SEQ ID N0:255)
contains a single open
reading frame with an apparent translation initiation site at nucleotide
residues 36-38 and ending at the stop
codon (TAA) at 369-371 (Figure 101 ), as indicated by bolded underline. The
predicted PR0720 polypeptide
precursor (i.e., UNQ388, SEQ ID N0:256) is 1 11 amino acids long (Figure 102),
has a calculated molecular
weight of 11,936 daltons and a pI of 5.21.
Analysis of the UNQ388 (SEQ ID N0:256) polypeptide of Figure 102 reveals a
signal sequence at
about amino acid residues 1-23, N-myristolation sites at about amino acids
residues 70-76 and 75-81 and
prokaryotic membrane lipoprotein lipid attachment sites at 66-77 and 68-79. A
cDNA clone containing
DNA53517 (SEQ ID N0:255) has been deposited with the ATCC on April 23. 1998
and is assigned deposit
number 209802.
BA. Isolation of cDNA clones Encodine Human PR0866 (UNQ435)
Use of the ECD homology procedure described above in a human fetal kidney
library resulted in the
identification of the full length DNA sequence DNA53971 (Fig. 103, SEQ ID
N0:257) and the derived
PR0866 native sequence protein UNQ435 (Fig. 104. SEQ ID N0:258).
The forward and reverse PCR primers and the hybridization probe used were the
following:
Forward PCR primer (44708.f1): (SEQ ID N0:259)
S'-CAGCACTGCCAGGGGAAGAGGG-3'
Forward PCR primer (44708.f2): (SEQ ID N0:260)
5'-CAGGACTCGCTACGTCCG-3'
Forward PCR primer (44708.f3): (SEQ ID N0:261 )
5'-CAGCCCCTTCTCCTCCTTTCTCCC-3'
Reverse PCR primer (44708.r1): (SEQ ID N0:262)
5'-GCAGTTATCAGGGACGCACTCAGCC-3'
Reverse PCR primer (44706.r2): (SEQ ID N0:263)
S'-CCAGCGAGAGGCAGATAG-3'
Reverse PCR primer (44706.r3): (SEQ ID N0:264)
5'-CGGTCACCGTGTCCTGCGGGATG-3'
hybridization probe (44708.p1): (SEQ ID N0:265)
5'-CAGCCCCTTCTCCTCCTTTCTCCCACGTCCTATCTGCCTCTC-3'
The clone DNA53971 (SEQ ID N0:257) contains a single open reading frame with
an apparent
translational initiation site at nucleotide positions 275-277 and ending at
the stop codon (TAA) at nucleotide
positions 1268-1270 (Figure 103), as indicated by bolded underline. The
predicted native sequence PR0866
polypeptide precursor (i.e., LTNQ435, SEQ ID N0:258) is 331 amino acids
(Figure 104), has a calculated
119
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
molecular weight of 35,844 daltons and a pI of 5.45. The UNQ435 (SEQ ID
N0:258) protein shown tn rtgure
104 has an estimated molecular weight of about 35,844 daltons and a pI of
about 5.45. Further analysis reveals
a signal peptide from about amino acid residue 1 to about residue 26,
glycosaminoglycan attachment sites at
about amino acid residues 131-135, cAMP- and cGMP-dependent protein kinase
phosphorylation sites at about
S amino acid residues 144-148 and N-myristoylation sites at amino acid
residues 26-32, 74-80, 132-138, 134-
140, 190-196, 287-293 and 290-296. A cDNA clone containing DNA53971 (SEQ ID
N0:257) has been
deposited with the ATCC on April 6, 1998 and is assigned deposit no. 209750.
BB. Isolation of cDNA clones Encodine Human PR0840 (UNQ433)
The use of a yeast screen procedure on tissue isolated from a human thyroid
library resulted in an EST
sequence which served as the template for the creation of PCR oligonucleotides
which ultimately resulted in
the isolation of DNAS3987 (SEQ ID N0:266, Figure 105) and the derived PR0840
native sequence protein
UNQ433 (SEQ ID N0:267, Figure 106).
A nucleotide sequence encoding a polypeptide of substantial homology with
UNQ433 (SEQ ID
l5 N0:267) of Figure 106 is also available from GenBank as accession number
HEEPSSARC I.
DNA53987 (SEQ ID N0:266) as shown in Figure 105 contains an open reading frame
with a
translation initiation site at about nucleotide residues 18-20 and ending at
the stop codon (TGA) at nucleotide
residues 1329-1331, as indicated by bolded underline. The second methionine
codon at nucleotide residues 90-
92 could possibly also be the actual translation initiation site -
alternatively, this codes for an internal
methionine. The predicted PR0840 polypeptide (i.e., the longer translation)
has been termed UNQ433 (SEQ
ID N0:267) and is 437 amino acids long (Figure 106), has a calculated
molecular weight of 49,851 daltons and
a pI of 6.47.
A cDNA clone containing DNAS3987 (SEQ ID N0:266) has been deposited with the
ATCC on May
12, 1998 under ATCC deposit number 209858.
Analysis of the UNQ433 polypeptide of Figure 106 (SEQ ID N0:267) reveals a
signal sequence at
about amino acid residues 1--16, a transmembrane domain at about amino acid
residues 319-338, an N-
glycosylation site at about residues 200-204, a cAMP and cGMP-dependent
protein kinase phosphorylation
sites at amino acid residues 23-27, tyrosine kinase phosphorylation sites at
amino acid residues 43-52 and N-
myristolylation sites at residues 17-23, 112-118, 116-122 and 185-191.
BC. Isolation of cDNA clones Encodine Human PR0982 (UNQ483)
Use of the signal algorithm procedure described above resulted in the
identification of an EST cluster
sequence no. 43715. This sequence was then compared to a variety of various
EST databases as described
under the signal algorithm procedure above, and further resulted in the
identification of Merck EST No.
AA024389. The full-length clone corresponding to this EST resulted in the
identification of the full-length
sequence DNA57700 (Fig. 107, SEQ ID N0:268) and the derived PR0982 native
sequence protein UNQ483
(Fig. 108, SEQ ID N0:269).
The DNA57700 sequence of Figure 107 (SEQ ID N0:268) contains a single open
reading frame with
an apparent translation initiation site at nucleotide positions 26-28 and
ending at the stop codon (TAA) found at
nucleotide positions 401-403, as indicated by bolded underline. The prediced
PR0982 polypeptide precursor
120
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
(i.e., UNQ982, SEQ ID N0:191) is 124 amino acids in length, has a calculated
molecular wetgnt of
approximately 14.198 daltons and an estimated pI of approximately 9.01 (Fig.
108). Further analysis of the
UNQ483 (SEQ ID N0:269) polypeptide of Figure 108 reveals a signal peptide from
about amino acid residues
1 to about 21 and potential anaphylatoxin domain from about amino acid residue
1 to about residue 59. A
cDNA clone containing DNA57700 (SEQ ID N0:268) was deposited with the ATCC on
January 12, 1999 and
is assigned ATCC deposit No. 203583.
BD. Isolation of cDNA clones Encodine Human PR0836 (UNQ545)
Use of the signal algorithm procedure described above resulted in the
identification of EST clusters
which were then compared to a variety of various EST databases as described
under the signal algorithm
procedure above. and further resulted in the identification of Incyte EST
2610075, an EST derived from colon
tumor tissue. The full-length clone corresponding to this EST resulted in the
identification of the full-length
sequence DNA59620 (Fig. 109, SEQ ID N0:270) and the derived PR0836 native
sequence protein UNQ545
(Fig. 110, SEQ ID N0:271).
The nucleotide sequence DNA59620 (SEQ ID N0:270) shown in Figure 109 contains
a single open
reading frame with an apparent translation initiation site at nucleotide
positions 65-67 and ending at the stop
codon (TGA) at nucleotide positions 1448-1450 (Fig. 109), as indicated by
bolded underline. The predicted
PR0836 polypeptide precursor (i.e., UNQ545, Fig. 110, SEQ ID N0:271) is 461
amino acids in length.
UNQ545 (SEQ ID N0:271 ) shown in Figure 1 10 has an estimated molecular weight
of about 52,085 daltons
and a pI of about 5.36. Further analysis reveals a signal peptide at about
amino acid residues 1 to about 29, N-
glycosylation sites at about amino acid residues 193 and 236 and N-
myristoylation sites at about residues 15,
19, 234, 251, 402 and 451, a domain conserved in the YJL126wiYLR351c/yhcX
family of proteins at about
amino acid residues 364 to about 372, and a region having sequence identity
with SLS 1 protein at about amino
acid residues 68 to about 340.
A cDNA clone containing DNA59620 (SEQ ID N0:270) has been deposited with the
ATCC on 16 June 1998
and is assigned deposit number 209989.
BE. Isolation of cDNA clones Encodine Human PRO1 159 (UNQ589)
Use of the signal algorithm procedure described above resulted in the
identification of EST cluster
sequence 77245, which was then compared to a variety of various EST databases
as described under the signal
algorithm procedure above, and further resulted in the identification of
Incyte EST no. 376776. Analysis of the
full-length clone corresponding to this EST resulted in the identification of
the full-length sequence
DNA60627 (Fig. 11 l, SEQ ID N0:272) and the derived PR01159 native sequence
protein UNQ589 (Fig. 112,
SEQ ID N0:273).
Clone DNA60627 (SEQ ID N0:272) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 92-94 and ending at the
stop codon (TAG) at nucleotide
positions 362-364 (Figure 1 I 1 ), as indicated by bolded underline. The
predicted PR01159 polypeptide
precursor (i.e., UNQ589, SEQ ID N0:273) is 90 amino acids long (Figure 112).
The UNQ589 (SEQ ID
N0:273) protein shown in Figure I 12 has an estimated molecular weight of
about 9,840 daltons and a pI of
about 10.13.
121
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Analysis of the UNQ589 (SEQ ID N0:273) sequence shown in Figure I 12 evidences
the presence of
the following: a signal peptide from about amino acid residue I to about
residue 15 and a potential N-
glycosylation site at about amino acid residue 38. Clone DNA60627 (SEQ ID
N0:272) has been deposited
with ATCC on August 4, 1998 and is assigned ATCC deposit no. 203092.
BF. Isolation of cDNA clones Encodine Human PRO 1358 (UNQ707)
Use of the signal algorithm procedure described above resulted in the
identification of an EST cluster
sequence, which was then compared to a variety of various EST databases as
described under the signal
algorithm procedure above, and further resulted in the identification of
Incyte EST 088718, a fragment derived
from a liver tissue library. Analysis of the full-length clone corresponding
to the EST resulted in the
identification of the full-length sequence DNA64890 (Fig. 113, SEQ ID N0:274)
and the derived PR01358
native sequence protein UNQ707 (Fig. 114, SEQ ID N0:275).
The DNA64890 (SEQ ID Iv'0:274) clone shown in Figure 113 contains a single
open reading frame
with an apparent translation initiation site at nucleotide positions 86
through 88 and ending at the stop codon
(TAA) found at nucleotide positions 1418 through 1420 (Figure 1 13). as
indicated by bolded underline. The
predicted PR01358 polypeptide precursor (i.e., UNQ707, SEQ ID N0:275) is 444
amino acids long. and a
signal peptide is at about amino acid residues I-18. UNQ707 (SEQ ID N0:275)
has a calculated molecular
weight of approximately 50719 daltons and an estimated pI of approximately
8.82. A cDNA clone containing
DNA64890 (SEQ ID N0:274), designated as DNA64890-1612, was deposited with the
ATCC on August l8,
1998 and is assigned ATCC deposit no. 203131.
BG. Isolation of cDNA clones Encodine Human PR013'S (UNQ685)
Use of the signal algorithm procedure described above resulted in the
identification of the EST cluster
sequence no. 139524, which was then compared to a variety of various EST
databases as described under the
signal algorithm procedure above, and further resulted in the identification
of Incyte EST 3744079. Analysis
of the full-length clone correspondine to the EST resulted in the
identification of the full-length sequence
DNA66659 (Fig. 115, SEQ ID N0:276) and the derived PR01325 native sequence
protein UNQ685 (Fig. 116,
SEQ ID N0:277).
Clone DNA66659 (Fig. 115, SEQ ID N0:276) contains a single open reading frame
with an apparent
translation initiation site at nucleotide positions 51-53 and ending at the
stop codon (TAG) at nucleotide
positions 2547-2549, as indicated by bolded underline. The predicted PR01325
polypeptide precursor (i.e.,
UNQ685, SEQ ID N0:227) is 832 amino acids long. The UNQ685 (SEQ ID N0:227)
protein shown in Figure
116 has an estimated molecular weight of about 94,454 daltons and a pI of
about 6.94. Further analysis of
UNQ685 (SEQ IDN0:227) reveals: a signal peptide from about amino acid 1 to
about amino acid 18,
transmembrane domains from about amino acid 292 to about amino acid 317, from
about amino acid 451 to
about amino acid 470, from about amino acid 501 to about amino acid 520, from
about amino acid 607 to
about amino acid 627 from about amino acid 751 to about amino acid 770, a
leucine zipper pattern sequence
from about amino acid 497 to about amino acid 518 and potential N-
glycosylation sites from about amino acid
27 to about amino acid 30, from about amino acid 54 to about amino acid 57,
from about amino acid 60 to
about amino acid 63, from about amino acid position 123 to about amino acid
position 126, from about amino
122
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
acid position 141 to about amino acid position 144, from about amino acid
position 165 to about amino acid
position 168, from about amino acid position 364 to about amino acid position
367, from about amino acid
position 476 to about amino acid position 479, from about amino acid position
496 to about amino acid
position 499, from about amino acid position 572 to about amino acid position
575, from about amino acid
position 603 to about amino acid position 606 and from about amino acid
position 699 to about amino acid
position 702. A cDNA clone containing DNA66659 (SEQ ID N0:276)) has been
deposited with ATCC on
September 22, 1998 and is assigned ATCC deposit no. 203269.
BH. Isolation of cDNA clones Encoding Human PR01338 (UNQ693)
The use of yeast screens resulted in EST sequences which were then compared to
various public and
private EST databases in a manner similar to that described above under ECD
homology resulted in the
identification of Incyte EST2615184, an EST derived from cholecystitis gall
bladder tissue. Analysis of the
corresponding full-length sequence ultimately resulted in the isolation of
DNA66667 (SEQ ID N0:278, Figure
117) and the derived PR01338 native sequence protein UNQ693 (SEQ ID N0:279,
Figure I 18).
DNA66667 (SEQ ID N0:278) as shown in Figure 117 contains a single open reading
frame with a
translation initiation site at about nucleotide residues 115-117 and ending at
the stop codon (TAA) at
nucleotide positions 2263-2265, as indicated by bolded underline. The
predicted PR01338 polypeptide
precursor (i.c~., UNQ693, SEQ ID N0:118) is 716 amino acids in length (Figure
118), has a calculated
molecular weight of 80,716 daltons and a pI of 6.06.
Analysis of the UNQ693 polypeptide (SEQ ID N0:278) of Figure 118 reveals a
signal sequence at
about amino acid residues 1 to 25, a transmembrane domain at about amino acid
residues 629-648, N-
glycosylation sites at about amino acid residues 69-73, 96-100, 106-110, 117-
121, 385-389, 517-521. 582-586
and 611-615, a tyrosine kinase phosphorylation site at about residues 573-582
and N-mv_ risto_vlation sites at
about amino acid residues 16-22, 224-230, 464-470, 637-643 and 698-704.
A cDNA containing DNA66667 (SEQ ID N0:278) has been deposited with the ATCC
under the
designation DNA66667-1596 on September 22. 1998 and has been assigned ATCC
deposit number 203267.
BI. Isolation of cDNA clones Encodine Human PR01434 (UNQ739)
Use of ECD homology procedure described above in a human retina tissue library
resulted in the
identification of the full-length DNA sequence DNA68818 (Fig. 119, SEQ ID
N0:280) and the derived
PR01434 native sequence protein UNQ739 (Fig. 120, SEQ ID N0:281).
The PCR primers (forward and reverse) and hybridization probe synthesized in
this procedure were
the following:
forward PCR primer:
5'-GAGGTGTCGCTGTGAAGCCAACGG-3' (SEQ ID N0:282)
reverse PCR primer:
5'-CGCTCGATTCTCCATGTGCCTTCC-3'
(SEQ ID N0:283)
hybridization probe:
(SEQ ID N0:284)
5'-GACGGAGTGTGTGGACCCTGTGTACGAGCCTGATCAGTGCTGTCC-3'
123
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Clone DNA68818 (SEQ ID N0:280) contains a single open reading frame with an
apparent
translation initiation site at nucleotide positions 581-583 and ending at the
stop codon (TAG) at nucleotide
positions 1556-1558 (Figure 119), as indicated by bolded underline. The
predicted PR01434 polypeptide
precursor (i.e., LJNQ739, SEQ ID N0:281) is 325 amino acids long (Figure 120).
The UNQ739 (SEQ ID
N0:281 ) protein shown in Figure 120 has an estimated molecular weight of
about 35,296 daltons and a pI of
about 5.37. Further analysis reveals a signal sequence at about amino acid
residues 1-27, a glycosaminoglycan
attachment site at about amino acid residues 80-84. M-myristoylation sites at
about amino acid residues 10-16,
102-108, 103-109, a cell attachment sequence at about amino acid residues 114-
117 and an EGF-like domain
cysterne pattern signature at about amino acid residues 176-188.
A clone containing DNA68818 (SEQ ID N0:280) has been deposited with ATCC under
the
designation DNA68818-2536 on February 9, 1999 and is assigned ATCC deposit no.
203657.
BJ. Isolation of cDNA clones Encodine Human PR04333 (LJNQ1888)
An expressed sequence tag (EST) DNA database (LIFESEQ~', Incyte
Pharmaceuticals, Palo Alto, CA)
was searched in a manner similar to that described above under the ECD
homology procedure described above
and an EST was identified which showed homology to lymphotoxin-beta receptor.
The EST served as the template to create oligonucleotide primers and probes to
screen a human fetal
kidney library in a manner similar to that described above under the ECD
homology procedure.
The oligonucleotides created for the above procedure were the following:
forward PCR primer: (SEQ ID N0:287)
5'-GCAAGAATTCAGGGATCGGTCTGG-3'
probe: (SEQ ID N0:288)
5'-CTGTGTTCCCTGCAACCAGTGTGGGCCAGGCATGG AGTTGTCTAAGG-3'
reverse:
(SEQ ID N0:289)
5'-AGATGGCATCACTG GTGGCTGAAC-3'
forward:
(SEQ ID N0:290)
5'-CAGAAGGCAAATTGTTCAGCCACCAG-3'
reverse: (SEQ ID N0:291 )
5'-ACAGTTTCCAGACCGATCCCTGAATTC-3'
The result was the isolation of the full-length DNA sequence DNA84210 (SEQ ID
N0:285, Figure
121). The DNA84210 (SEQ ID N0:28S) clone depicted in Figure 121 contains a
single open reading frame
with an apparent translation initiation site at nucleotide positions 185-187,
and a stop codon (TAA) at
nucleotide positions 1436-1438, as indicated by bolded underline. The
predicted PR04333 polypeptide
precursor (i.e., IJNQ1888, SEQ ID N0:286) is 417 amino acids long. The
LJNQ1888 protein (SEQ ID
N0:286) shown in Figure 121 has an estimated molecular weight of about 45305
daltons and a pI of about
5.12.
Analysis of the IJNQ1888 polypeptide (SEQ ID N0:286) of Figure 121 reveals a
signal peptide at
about amino acid residues 1-25, a transmembrane domain at about residues 169-
192, N-glycosylation sites
about residues 105-109, 214-218, 319-323, 350-354, 368-372, 379-383, cAMP- and
cGMP-dependent protein
kinase phosphorylation sites at about residues 200-204 and 238-242, a tyrosine
kinase phosphorylation site at
124
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
about residues 207-214, an N-mytistoylation site at about residues 55-61, 215-
218 and 270-276, a prokaryotic
membrane lipoprotein lipid attachment site at about residues 259-270 and a
TNFR/NGFR family cysteine-rich
region at about residues 89-96.
A cDNA clone containing DNA84210 (SEQ ID N0:285), designated as DNA84210-2576,
has been
deposited with ATCC on March 2, 1999 and is assigned ATCC deposit no. 203818.
BK. Isolation of cDNA clones Encoding Human PR04302 (UNQ1866)
Use of the amylase screen procedure described above on tissue isolated from
human tissue resulted in
an EST sequence which was then compared against various EST databases to
create a consensus sequence by a
methodology as described above under the amylase yeast screen procedure and/or
the ECD homology
procedure. Further analysis of this consensus sequence resulted in the
identification of Incyte EST no.
2408081H1. Analysis of the full-length clones corresponding to EST no.
2408081H1 resulted in the isolation
of the full length native sequence clones DNA92218 (SEQ ID N0:292) and the
derived PR04302 full-length
native sequence protein UNQ1866 (SEQ ID N0:293).
The full length clone DNA92218 (SEQ ID N0:292) shown in Figure 123 has a
single open reading
frame with an apparent translational initiation site at nucleotide positions
174-176 and a stop signal (TAG) at
nucleotide positions 768-770, as indicated by bolded underline. The predicted
PR04302 polypeptide precursor
(i.e., UNQ1866, SEQ ID N0:293) is 198 amino acids long, has a calculated
molecular weight of approximately
22,285 daltons and an estimated pI of approximately 9.35. Analysis of UNQ1866
(Fig. 124, SEQ ID N0:293)
reveals a signal peptide from about amino acid residue 1 to about residue 23,
a transmembrane domain from
about amino acid residue 111 to about residue 130, a cAMP and cGMP-dependent
protein kinase
phosphorylation sites at residues 26-30. casein kinase II phosphorylation
sites at residues 44-47 and 58-61, a
tyrosine kinase phosphorylation site at residues 36-43 and N-myristoylation
sites at residues 124-130, 144-150
and 189-195.
A eDNA clone containing DNA92218 (SEQ ID N0:292), designated DNA92218-2554,
was
deposited with the ATCC on March 9, 1999 and has been assigned deposit number
203834.
BL. Isolation of cDNA clones Encoding Human PR04430 (UNQ 1947)
Use of the signal algorithm procedure described above resulted in the
identification of an EST cluster
sequence, which was then compared to a variety of various EST databases as
described under the signal
algorithm procedure above, and further resulted in the identification of a
consensus sequence. Further analysis
of the consensus sequence resulted in the identification of the full-length
sequence DNA96878 (Fig. 125, SEQ
ID N0:294) and the derived PR04430 native sequence protein UNQ1947 (Fig. 126,
SEQ ID N0:295).
The native sequence DNA sequence DNA96878 (SEQ ID N0:294) shown in Figure 125
contains a
single open reading frame with an apparent translation initiation site at
nucleotide positions 56-58 and ending
at the stop codon (TGA) found at nucleotide positions 431-433, as indicated by
bolded underline. The
predicted PR04430 polypeptide precursor (UNQ1947, Fig. 126, SEQ ID N0:295) is
125 amino acids long.
The UNQ4430 protein (SEQ ID N0:295) of Figure 126 has a calculated molecular
weight of approximately
13821 daltons and an estimated pI of approximately 8.6. Further analysis
reveals the presence of a signal
sequence at about amino acid residues 1 to about 18, N-glycosylation sites at
about residues 77-80 and again at
125
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/LTS00/05841
about residues 88-91, a casein kinase II phosphorylation sire at about
residues 67-70, an N-myristoylation site
at about residues 84-89 and a Lys-6/u-PAR domain at about residues 85-98.
A clone containing DNA96878 (SEQ ID N0:294), designated DNA96878-2626, was
deposited with
the ATCC on May 4, 1999 and is assigned ATCC deposit no. 23-PTA.
BM. Isolation of cDNA clones Encodine Human PR05727 (LJNQ2448)
Various known TNF-receptors were used to screen public and private EST
databases (e.g., see ECD
homology procedure, above) resulting in the identification Incyte clone 509151
IH. This EST sequence, which
was derived from uterine tumor tissue, then served as a template for the
construction of the cloning oligos
indicated below which were then used to identify by PCR a human thymus cDNA
library that contained the
sequence of interest. These oligonucleotides were:
Forward primer (509-1 ):
5'-GAGGGGGCTGGGTGAGATGTG-3'
(SEQ ID N0:298)
Reverse primer (509-4AS):
I S 5'-TGCTTTTGTACCTGCGAGGAGG-3' (SEQ ID N0:299)
To isolate the DNA sequence encoding the full-length DNA98853 polypeptide. an
inverse long
distance PCR procedure was carried out (Figure 129). The PCR primers generally
ranged from 20 to 30
nucleotides. For inverse long distance PCR, primer pairs were designed in such
a way that the S' to 3' direction
of each primer pointed away from each other.
A pair of inverse long distance PCR primers for cloning DNA98853 were sv_
nthesized:
Primer 1 (left primer) (509-PS):
5'-pCATGGTGGGAAGGCCGGTAACG-3' (SEQ ID N0:300)
Primer 2 (right primer) (509-P6):
5'-pGATTGCCAAGAAAATGAGTACTGGGACC-3' (SEQ ID N0:301 )
In the inverse long distance PCR reaction. the template is the plasmid cDNA
library. As a result, the
PCR products contain the entire vector sequence in the middle with insert
sequences of interest at both ends.
After the PCR reaction, the PCR mirture was treated with Dpn I which digests
only the template plasmids,
followed by agarose gel purification of PCR products of larger than the size
of the library cloning vector.
Since the primers used in the inverse long distance PCR were also 5'-
phosphorylated, the purified products
were then self ligated and transformed into E.coli competent cells. Colonies
were screened by PCR using 5'
vector primer and proper gene specific primer to identify clones with larger
5' sequence. Plasmids prepared
from positive clones were sequenced. If necessary, the process could be
repeated to obtain more 5' sequences
based on new sequence obtained from the previous round.
The purpose of inverse long distance PCR is to obtain the complete sequence of
the gene of interest.
The clone containing the full length coding region was then obtained by
conventional PCR.
The primer pair used to clone the full length coding region of DNA98853 (SEQ
ID N0:296) were the
following:
Forward primer (Cla-MD-509):
5'-GGAGGATCGATACCATGGATTGCCAAGAAAATGAG-3'
(SEQ ID N0:302)
Reverse primer (509.TAA.not):
126
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
5'-GGAGGAGCGGCCGCTTAAGGGCTGGGAACTTCAAAGGGCAC-3' (SEQ ID N0:303)
For cloning purposes, a Cla I site and a Not I site were included in the
forward primer and reverse
primer respectively.
To ensure the accuracy of the PCR products, independent PCR reactions were
performed and several
cloned products were sequenced.
DNA sequencing of the clones isolated as described above gave the full-length
DNA sequence for
DNA98853 (SEQ ID N0:296, Figure 127) and the derived PR05727 native sequence
protein LJNQ2448 (SEQ
ID N0:297, Figure 128).
Clone DNA98853 (SEQ ID N0:296) contains a single open reading frame with an
apparent
translation initiation site at nucieotide positions 1-3 and ending at the stop
codon (TAA) at nucleotide positions
901-903 (Figure 127), as indicated by bolded underline. The predicted PR05727
polypeptide precursor (i.e.,
LJNQ2448, SEQ ID N0:297) is 299 amino acids long (Figure 128), has a
calculated molecular weight of
32,929 daltons and a pI of 4.95. The UNQ2448 polvpeptide (SEQ ID N0:297) shown
in Figure 128 has an
estimated molecular weight of about 3.3 kilodaltons and a pI of about 4.72. A
potential N-glycosyiation site
IS exists between amino acids 74 and 77 of the amino acid sequence shown in
Figure 128. A potential N-
myristoylation site exists between amino acids 24 and 29 of the amino acid
sequence shown in Figure 128.
Potential casein kinase II phosphorylation sites exist between amino acids 123-
126, 185-188, 200-203, 252-
255, 257-260, 271-274, and 283-286 of the amino acid sequence shown in Figure
128. A potential
transmembrane domain exists between amino acids 137 to 158 of the sequence
shown in Figure 128. It is
presently believed that the polypeptide does not include a signal sequence.
A cDNA clone containing DNA98853 (SEQ ID N0:296, designated DNA98853-1739, has
been
deposited with ATCC on April 6, 1999 and is assigned ATTC Deposit No. April 6,
1999.
EXAMPLE 2
Stimulatory Activity in Mixed Lvmohocvte Reaction IMLR) Assay (no 24)
This example shows that the polvpeptides of the invention are active as a
stimulator of the
proliferation of stimulated T-lymphocytes. Compounds which stimulate
proliferation of lymphocytes are
useful therapeutically where enhancement of an immune response is beneficial.
A therapeutic agent may take
the form of antagonists of the polypeptide of the invention, for example,
murine-human chimer7c, humanized
or human antibodies against the polypeptide.
The basic protocol for this assay is described in Current Protocols in
Immunology, unit 3.12; edited
by J. E. Coligan, A. M. Kruisbeek, D. H. Marglies, E. M. Shevach, W. Strober,
National Institutes of Health,
Published by John Wiley & Sons, Inc.
More specifically, in one assay variant, peripheral blood mononuclear cells
(PBMC) are isolated from
mammalian individuals, for example a human volunteer, by leukopheresis (one
donor will supply stimulator
PBMCs, the other donor will supply responder PBMCs). If desired, the cells are
frozen in fetal bovine serum
and DMSO after isolation. Frozen cells may be thawed overnight in assay media
(37°C, 5% C02 )and then
washed and resuspended to 3 x 106 cells/ml of assay media (RPMI; 10% fetal
bovine serum, 1%
penicillin/streptomycin, I % glutamine, 1 % HEPES, 1 % non-essential amino
acids, 1 % pyruvate).
127
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
The stimulator PBMCs are prepared by irradiating the cells (about 3000 Rads).
The assay is prepared
by plating in triplicate wells a mixture of: 100p.1 of test sample diluted to
1% or to 0.1%; 50 ltl of irradiated
stimulator cells and 50 ~1 of responder PBMC cells. 100 microliters of cell
culture media or 100 microliter of
CD4-IgG is used as the control. The wells are then incubated at 37°C,
5% C02 for 4 days. On day S and each
S well is pulsed with tritiated thymidine ( 1.0 mC/well; Amersham). After 6
hours the cells are washed 3 times
and then the uptake of the label is evaluated.
In another variant of this assay, PBMCs are isolated from the spleens of
Balb/c mice and C57B6 mice.
The cells are teased from freshly harvested spleens in assay media (RPMI;10%
fetal bovine serum, 1%
penicillin/streptomycin, 1% glutamine, 1% HEPES, 1% non-essential amino acids.
I% pyruvate) and the
PBMCs are isolated by overlaying these cells over Lympholyte M (Organon
Teknika), centrifuging at 2000
rpm for 20 minutes, collecting and washing the mononuclear cell layer in assay
media and resuspending the
cells to 1 x 107 cellslml of assay media. The assay is then conducted as
described above. The results of this
assay for compounds of the invention are shown below. Positive increases over
control are considered positive
with increases of greater than or equal to 180% being preferred. However. any
value greater than control
I S indicates a stimulatory effect for the test protein.
Table 7
PRO PRO Concentration Percent Increase
Over Control
PR0356 0.1 % 133.8
PR0356 0.1% 208.9
PR0356 1.0% 251.6
PR0356 I .0% 332.1
PR0273 12.4 nM I 12
PR0273 124 nM 192.7
PR0769 23.86 nM 76.3
PR0769 238.6 rtM 226
PR01184 16.88 nM 81.6
PR01184 168.82 nM 194.4
PR01346 3.34 nM 86.6
PR01346 33.41 nM 188.5
PR01246 0.07 nM 145
PR01246 0.7 nM 180.9
PR0269 0. I % 122.4
PR0269 I %
194.1
PR0344 0.1% 148.6
PR0344 1 % 259.9
PR0333 0.1 % 187.8
PR0333 1 % 220
PR0381 14.5 nM 87.3
PR0381 14.5 nM 135.4
128
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGT/US00/05841
PR0381 145 nM 248.1
PR0381 145 nM 290.8
PR0533 0.06 nM 163
PR0533 0.61 nM 382.9
PR0720 0.1 nM 198.4
PR0720 1.0 nM 293.5
PR0866 0.1 nM 131.8
PR0866 1.04 nM 223.2
EXAMPLE 3
Hairless Guinea pig Proinflammatorv AsSa (no 32)
This assay is designed to determine whether the PRO polypeptides show the
ability to induce vascular
permeability. Polypeptides testing positive in this assay are expected to be
useful for the therapeutic treatment
of conditions which would benefit from enhanced vascular permeability
including, for example, conditions
which may benefit from enhanced local immune system cell infiltration.
Hairless guinea pigs weighing 350 grams or more were anesthetized with
Ketamine (75-80 mg/kg)
and 5 mgikg Xylazine intramuscularly. Test samples containing the PRO
polypeptide or a physiological buffer
without the test polypeptide are injected into skin on the back of the test
animals with 100 ltl per injection site
intradermally. There were approximately 16-24 injection sites per animal. One
ml of Evans blue dye (1% in
PBS) is then injected intracardially. Skin vascular permeability responses to
the compounds (i.e., blemishes at
the injection sites of injection) are visually scored by measuring the
diameter (in tnm) of blue-colored leaks
from the site of injection at I, 6 and/or 24 hours post administration of the
test materials. The mm diameter of
blueness at the site of injection is observed and recorded as well as the
severity of the vascular leakage for
values scoring above 4 standard deviations over the same animal control.
Blemishes of at least 5 mm in
diameter are considered positive for the assay when testing purified proteins,
being indicative of the ability to
induce vascular leakage or permeability. A response greater than 7 mm diameter
is considered positive for
conditioned media samples. Human VEGF is used as a positive control, inducing
a response of 4-8 mm
diameter at 0.1 ltg/ 100 Itl., and 1 S-23 mm diam. at I ltg/ 100 Itl.
The tested polypeptide are diluted to 1% of the initial stock solution. UNQ
585 was diluted into 10
mM HEPES/140 mM NaCI/4% mannitol/I mg/ml BSA pH 6.8, while LJNQ334 was diluted
into 140 mM
NaCI, 10 mM Hepes, 4% Mannitol pH 7.4.
Table 8
LJNQ polvpeptide Stock solution concentrationTime hr dialation
(mm)
PRO1155 20,384 nM 1 6
PRO1155 20,384 nM 6 6
PR0533 1024 nM 1 5.4
PR0533 1024 nM 6 7
PR021 22,000 nM 1 2.0
PR021 22,000 nM 6 14.0
129
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PGTlUS00/05841
EXAMPLE 4
Skin Vascular Permeability Assay (no.64)
This assay shows that certain PRO polypeptides stimulate an immune response
and induce
inflammation by inducing mononuclear cell, eosinophil and PMN infiltration at
the site of injection of the
animal. This skin vascular permeability assay is conducted as follows.
Hairless guinea pigs weighing 350
grams or more are anesthetized with ketamine (75-80 mg/Kg) and 5 mg/Kg
Xylazine intramuscularly (IM). A
sample of purified PRO polypeptide or a conditioned media test sample is
injected intradermally onto the backs
of the test animals with 100 uL per injection site. It is possible to have
about 10-30, preferably about 16-24,
injection sites per animal. One mL of Evans blue dye ( I % in physiologic
buffered saline) is injected
intracardially. Blemishes at the injection sites are then measured (mm
diameter) at Ihr, 6 hrs and 24 hrs post
injection. Animals were sacrificed at 6 hrs after injection. Each skin
injection site is biopsied and fixed in
paraformaldehyde. The skins are then prepared for histopathalogic evaluation.
Each site is evaluated for
inflammatory cell infiltration into the skin. Sites with visible inflammatory
cell inflammation are scored as
positive. Inflammatory cells may be neutrophilic. eosinophilic, monocytic or
lymphocytic
l5 At least a minimal perivascular infiltrate at the injection site is scored
as positive, no infiltrate at the
site of injection is scored as negative.
Table 9
Time (hrs Infiltrate
PR0172 24
positive
PR0200 24
positive
PR0200 24
positive
PR0216 24
positive
PR0272 24
positive
PR0362 24
positive
PRO 1007 24
positive
PRO 1031 24
positive
PRO 1283 24 positive
PRO 1343 24
positive
PR01358 6
positive
PR01325 6
positive
PR01434 24
positive
PR04333 6
positive
EXAMPLE 5
Inhibitory Activity in Mixed Lymphocyte Reaction (MLR) Assay (no 67)
This example shows that one or more of the PRO polypeptides are active as
inhibitors of the
proliferation of stimulated T-lymphocytes. Compounds which inhibit
proliferation of lymphocytes are useful
therapeutically where suppression of an immune response is beneficial.
130
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
The basic protocol for this assay is described in Current Protocols in
Immunology, unit 3.12; edited
by J. E. Coligan, A. M. Kruisbeek, D. H. Marglies, E. M. Shevach, W. Strober,
National Institutes of Health,
Published by John Wiley & Sons, Inc.
More specifically, in one assay variant, peripheral blood mononuclear cells
(PBMC) are isolated from
mammalian individuals, for example a human volunteer, by leukopheresis (one
donor will supply stimulator
PBMCs, the other donor will supply responder PBMCs). If desired, the cells are
frozen in fetal bovine serum
and DMSO after isolation. Frozen cells may be thawed overnight in assay media
(37°C, 5% CO~) and then
washed and resuspended to 3x106 cells/ml of assay media (RPMI; 10% fetal
bovine serum, 1%
penicillinistreptomycin, I% glutamine, 1°o HEPES, 1% non-essential
amino acids, 1% pyruvate). The
stimulator PBMCs are prepared by irradiating the cells (about 3000 Rads).
The assay is prepared by plating in triplicate wells a mixture of
100:1 of test sample diluted to 1 % or to 0.1 %,
50 :1 of irradiated stimulator cells, and
SO :1 of responder PBMC cells.
100 microliters of cell culture media or 100 microliter of CD4-IgG is used as
the control. The wells are then
incubated at 37°C, 5% CO~ for 4 days. On day 5, each well is pulsed
with tritiated thymidine ( 1.0 mC/well;
Amersham). After 6 hours the cells are washed 3 times and then the uptake of
the label is evaluated.
In another variant of this assay, PBMCs are isolated from the spleens of
Balb/c mice and C57B6 mice.
The cells are teased from freshly harvested spleens in assay media (RPMI; 10%
fetal bovine serum, 1%
penicillin/streptomycin. I% glutamine, 1% HEPES, I% non-essential amino acids,
1% pytuvate) and the
PBMCs are isolated by overlaying these cells over Lympholyte M (Organon
Teknika), centrifuging at 2000
rpm for 20 minutes, collecting and washing the mononuclear cell layer in assay
media and resuspending the
cells to 1 x 10' cells/ml of assay media. The assay is then conducted as
described above.
Any decreases below control is considered to be a positive result for an
inhibitory compound, with
decreases of less than or equal to 80% being preferred. However, any value
less than control indicates an
inhibitory effect for the test protein.
Table 10
PRO PRO Concentration Percent Decrease
Below Control
PR0204 0.1% 86
PR0204 1.0% 35
PR0212 0.59 nM 0
PR0212 5.9 nM 52.6
PR0212 0.87 nM 82.7
PR0212 8.7 nM 66
PR0212 1.9 nM 81.6
PR0212 19 nM 61.5
PR0212 0.46 nM 66.1
PR0212 4.6 nM 59.5
PR0212 2.1 ~ 0
131
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
PR0212 2.1 nM 116.2
PR0212 21 ~ 0
PR0212 21 nM 62.2
PR0216 0.13 nM 74.3
PR0216 1.3 nM 63.3
PR0226 0.12 nM 67,9
PR0226 1.2 nM 40.6
PR0235 0 nM 83.6
PR0235 0.02 nM 69.7
PR0240 5.3 nM 68.2
PR0240 53 nM 68.2
PR0240 35 nM 72.2
PR0240 350 nM (~
PR0245 19.1 nM 53
I PR0245 191 nM 54
S
PR0245 0.93 nM 71.8
PR0245 0.93 nM 80.9
PR0245 9.3 nM 49.6
PR0245 9.3 nM 51.9
PR0273 31.46 nM g 1
PR0273 314.56 nM 67
PR0332 0.35 nM 74.2
PR0332 3.5 nM 68
PR0332 0.35 nM 20.2
PR0332 3.5 nM 61.2
PR0361 1.5 nM 63.2
PR0361 15 nM
64.7
PR0363 8.6 nM 76.9
PR0363 g6 ~
63.6
PR0363 8.6 nM 64.4
PR0363 g6 ~
2.1
PR0364 0.31 nM 68.1
PR0364 3.1 nM 67.4
PR0364 1.7 nM 92.8
PR0364 17 nM 68.4
PR0364 1.7 iiM 94.2
PR0364 17 nM 63.3
PR0526 0.12 nM 68.5
PR0526 1.2 nM 62.5
PR0531 0.2 nM 66.1
132
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00l05841
PR0531 2 nM 54.3
PR0531 0.2 nM 70.4
PR0531 2 nM 68.4
PR0701 0.74 nM 72.5
PR0701 0.74 nM 90.2
PR0701 7.4 nM 64.8
PR0701 7.4 nM 69
PR0770 0.69 nM 65.8
PR0770 6.9 nM 67.4
PR0788 12.96 nM 88.4
PR0788 129.6 nM 57.7
PR0788 2.9 nM 64.4
PR0788 29 nM 67.4
PR0865 0.27 nM 67.9
PR0865 2.7 nM 63.7
PR01083 7.1 nM 80.5
PR01083 71 nM 63.7
PR01083 7.1 nM 40.9
PR01083 71 nM 65
PRO1 I 14 0,37 nM 44.9
PR01114 3.7 nM 42.4
PR01192 12.1 nM 31.6
PR01192 121 nM 32.6
PRO/ 195 0.5 nM 67
PR01195 S nM 66.8
PR01250 0.05 nM 75.4
PR01250 0.5 nM 57.2
PR01250 0.05 nM 94.6
PR01250 0.5 nM 61.2
PR01312 8.5 nM 52
PR01312 85 nM 49.3
PR01312 14.2 nM 73.1
PR01312 142 nM 62.9
PR01287 0.8 nM 79.1
PR01387 8 nM 52.3
PR01410 4 nM 89
PR01410 40 nM (~,g
PR01418 6.4 nM 67.7
PR01418 6.4 nM 81.1
PR01418 64 nM 56.3
133
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
PR01418 64 nM 64.9
PR01868 39.4 nM 65.8
PR01868 394 ttM SO
PR01917 2.1 ttlvl 70.7
S PR01917 2.1 nM 82.5
PR01917 21 nM 60.7
PR01917 21 nM 62.6
PR020S 0.7 nM 71.5
PR020S 7 nM 3.S
PR0840 24.4 nM 137.2
PR0982 244 nM 58.9
PR0836 2.5 nM 60.7
PR0836 2S nM 60.6
PRO 11 S9 11.06 nM 80.4
l PRO I 159 1 10.55 nM 57.6
S
PRO11S9 11.06 nM 81.9
PROI 1 S9 1 10.55 nM 46.2
PR01338 0.14 nM 80.7
PR01338 1.4 nM 65.5
PR04302 13.56 nM I 15.8
PR04302 135.57 nM 2.4
PR04430 24.2 nM 55.9
PR04430 242 nM 49.9
PROS727 19.6 nM 69.2
2S PR05727 196 nM 54.5
EXAMPLE 6
In situ Hybridization
In situ hybridization is a powerful and versatile technique for the detection
and localization of nucleic
acid sequences within cell or tissue preparations. It may be useful, for
example, to identify sites of gene
expression, analyze the tissue distribution of transcription, identify and
localize viral infection, follow changes
in specific mRNA synthesis and aid in chromosome mapping.
In situ hybridization was performed following an optimized version of the
protocol by Lu and Gillett,
Cell Vision I: 169-176 (1994), using PCR-generated 33P-labeled riboprobes.
Briefly, formalin-fixed,
3S paraffin-embedded human tissues were sectioned, deparaffinized,
deproteinated in proteinase K (20 g/ml) for
15 minutes at 37°C, and further processed for in situ hybridization as
described by Lu and Gillett, supra. A
~33p~ ~p_labeled antisense riboprobe was generated from a PCR product and
hybridized at SS°C overnight.
The slides were dipped in Kodak NTB2 nuclear track emulsion and exposed for 4
weeks.
33p-Riboprobe synthesis
134
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
6.0 ltl (125 mCi) of 33P-UTP (Amersham BF 1002, SA<2000 Ciimmol) were speed
vac dried. To
each tube containing dried33P-UTP, the following ingredients were added: 2.0
ltl Sx transcription buffer, 1.0
~1 DTT ( 100 mM); 2.0 ltl NTP mix (2.5 mM : I 0 ltl; each of 10 mM GTP, CTP &
ATP + 10 ltl H20); 1.0 1tI
UTP (SO 1tM); 1.0 ltl Rnasin; 1.0 ~tl DNA template ( l ltg); 1.0 ltl H20.
The tubes were incubated at 37°C for one hour. 1.0 1tL RQ1 DNase were
added, followed by
incubation at 37°C for 15 minutes. 90 1tL TE (10 mM Tris pH 7.6/1mM
EDTA pH 8.0) were added, and the
mixture was pipetted onto DE81 paper. The remaining solution was loaded in a
Microcon-50 ultrafiltration
unit, and spun using program 10 (6 minutes). The filtration unit was inverted
over a second tube and spun
using program 2 (3 minutes). After the final recovery spin, 100 1tL TE were
added. 1 ftL of the final product
was pipetted on DE81 paper and counted in 6 ml of Biofluor II.
The probe was run on a TBE/urea gel. 1-3 1tL of the probe or 5 1tL of RNA Mrk
III were added to 3
1tL of loading buffer. After heating on a 95°C heat block for three
minutes, the gel was immediately placed on
ice. The wells of eel were flushed, the sample loaded, and run at 180-250
volts for 45 minutes. The gel was
wrapped in saran wrap and exposed to XAR film with an intensifying screen in -
70°C freezer one hour to
I S overnieht.
33p-Hybridization
Pretreatment ojfi~o~cn scction.c The slides were removed from the freezer,
placed on aluminum
trays and thawed at room temperature for 5 minutes. The trays were placed in
55°C incubator for five minutes
to reduce condensation. The slides were faxed for 10 minutes in 4%
parafotittaldehyde on ice in the fume
hood, and washed in 0.5 x SSC for 5 minutes, at room temperature (25 ml 20 x
SSC + 975 ml SQ H20). After
deproteination in 0.5 ltgiml proteinase K for IO minutes at 37°C
(12.S1tL of 10 mgiml stock in 250 ml
prewarmed RNase-free RNAse buffer), the sections were washed in 0.5 x SSC for
10 minutes at room
temperature. The sections were dehydrated in 70%, 95%, 100% ethanol. 2 minutes
each.
Pretreatment o/~araffiu-embedded.sectinn.s The slides were deparaffinized,
placed in SQ HBO, and
?5 rinsed twice in ? x SSC at room temperature. for 5 minutes each time. The
sections were deproteinated in 20
ltgiml proteinase K (500 1tL of 10 mgiml in 250 ml RNase-free RNase buffer;
37C, IS minutes ) - human
embryo, or 8 x proteinase K (100 1tL in 250 ml Rnase buffer, 37°C, 30
minutes) - fotmalin tissues.
Subsequent rinsing in 0.5 x SSC and dehydration were performed as described
above.
Prehybridization The slides were laid out in plastic box lined with Box buffer
(4 x SSC, 50%
formamide) - saturated filter paper. The tissue was covered with 50 ItL of
hybridization buffer (3.75g Dextran
Sulfate + 6 ml SQ H20), vortexed and heated in the microwave for 2 minutes
with the cap loosened. After
cooling on ice, 18.75 ml formamide, 3.75 ml 20 x SSC and 9 ml SQ H20 were
added, the tissue was vortexed
well, and incubated at 42°C for I-4 hours.
Hybridization I.0 x 106 cp. probe and 1.0 1tL RNA (50 mg/ml stock) per slide
were heated at
95°C for 3 minutes. The slides were cooled on ice, and 48 1tL
hybridization buffer were added per slide. After
vortexing, 50 1tL 33P mix were added to 50 1tL prehybridization on slide. The
slides were incubated overnight
at SSC.
135
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO OOI53758 PCT/US00/05841
Washes Washing was done 2x 10 minutes with 2xSSC, EDTA at room temperature
(400 ml 20 x SSC
+ 16 ml 0.25M EDTA, V~4L), followed by RNaseA treatment at 37°C for 30
minutes (SOO 1tL of 10 mg/ml in
250 ml Rnase buffer - 20 Itg/ml), The slides were washed 2x 10 minutes with 2
x SSC, EDTA at room
temperature. The stringency wash conditions were as follows: 2 hours at
55°C, 0.1 x SSC, EDTA (20 ml 20 x
SSC + 16 ml EDTA, V~4L).
Alternatively, multi-tissue blots containing poly A+ RNA (2 ltg per lane) from
various human tissues
were purchased from Clontech (Palo Alto, CA). DNA probes were labeled with [a-
32P]dCTP by random
priming DNA labeling Beads (Phatmacia Biotech). Hybridization was performed
with Expresshyb (Clontech)
at 68°C for 1 hr. The blots were then washed with 2X SSC/0.05% SDS
solution at room temperature for 40
min, followed by washes in O.1X SSC/0.1%SDS solution at SS°C for 40 min
with one chanee of fresh solution.
The blots were exposed in a phosphorimager.
DNA 29101 (VEGFB9)
DNA29101 (SEQ ID NO: f ) was examine in three separate in .situ studies
wherein the following probes were
IS used:
VEGFB9-pl (SEQ ID N0:194):
S'-GGATTCTAATACGACTCACTATAGGGCGGCGGAATCCAACCTGAGTAG-3'
VEGFB9-p2 (SEQ ID N0:195):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GCG GCT ATC CTC CTG TGC TC-3'
IS97-029:
Expression observed in the developing lower fetal limb bones at the edge of
the cartilagenous anlage
(i.e., around the outside edge); in developing tendons, in vascular smooth
muscle and in cells embracing
developing skeletal muscle myocytes and myotubes. Expression also observed in
the following tissues:
epiphyseal growth plate: lymph nodes - marginal sinus: thymus - subcapsular
region of the thymic cortex.
possibly representing either the subcapsular epithelial cells or the
proliferating, double negative, thymocytes that are found in this region;
tracheal smooth muscle: brain
(cerebral cortex) - focal expression in cortical neurones; small intestine -
smooth muscle; thyroid - thyroid
epithelium; liver - ductal plates; stomach - mural smooth muscle; fetal skin -
basal layer of squamous
epithelium: placenta - interstitial cells in trophoblastic villi; spinal cord -
no expression except in wall of
arteries and veins. No expression was observed in the spleen and adrenals.
The above expression pattern suggests that DNA29101 may be involved in cell
differentiation
/proliferation.
IS97-037:
Expression in superovulated rat ovaries were negative in all sections with
both antisense and sense
probes. Either the message is not expressed in this model, or the human probe
does not cross react with rat.
IS97-087.
136
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00105841
High expression levers were observed at the following sites: chimp ovary -
granulosa cells of
maturing follicles, lower intensity signal observed over thecal cells; chimp
parathyroid - high expression over
chief cells; human fetal testis - moderate expression over stromal cells
surrounding developing tubules; human
fetal lung - high expression over chondrocytes in developing bronchial tree,
and low level expression over
branching bronchial epithelium.
Fetal tissues examined (E12-E16 weeks) include: placenta, umbilical cord,
liver, kidney, adrenals,
thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine,
spleen, thymus, pancreas, brain, eye,
spinal cord, body wall, pelvis and lower limb. Adult tissues examined include
liver, kidney, adrenal,
myocardium, aorta, spleen, lymph node, pancreas, lung, skin. cerebral cortex
(tm), hippocampus(tm),
cerebellum(rm), penis, eye, bladder, stomach, gastric carcinoma, colon,
colonic carcinoma and
chondrosarcoma. Also examined were acetaminophen induced liver injury and
hepatic cirrhosis
DNA30871:
IS97-l)d4: In fetal tissues. strong signals were observed over neurones in
fetal cerebral cortex, spinal cord.
spinal ganglia as well as enteric neurones in the wall of the fetal stomach.
Sitnal also observed over cells
around the root of the aorta (possibly the conducting system), adrenal
medulla, mesenchymal cells in
neurovascular bundle, renal parenchyma and cells lying between skeletal muscle
myocytes. All other fetal
tissues negative.
No expression was observed in adult tissue. Fetal tissues (12-16 weeks)
examined include: placenta,
umbilical cord. liver, kidney, adrenals, thyroid, lungs, heart, great vessels,
esophagus, stomach, small intestine,
spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower
limb. Adult tissues examined
include: liver, kidney, adrenal, myocardium, aorta, spleen. lymph node,
pancreas. lung and skin.
The probes used in the above analysis were the following:
DNA30871-pl (SEQ ID N0:196):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CCG TCT CCT CCT GTC CTC-3'
DNA30871-p2 (SEQ ID N0:197):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCT CGG CAT CTT CGT CAC ATT-3'
DNA30942:
DNA30942 (SEQ ID N0:13) was examined in four separate in situ studies
(including two in the diseased tissue
study of Example 7 using the following probes:
DNA30942-pl (SEQ ID N0:198)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC TCG CTG CTG TGC CTG GTG TTG-3'
DNA30942-p2: (SEQ ID N0:199)
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCG CTG CAG CCT CTT GAT GGA-3'
IS97-043:
137
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
No expression was observed in fetal tissues. The fetal tissues examined
included: placenta, umbilical
cord, brain, spinal cord, eye, optic nerve, trachea, lung, heart, thymus,
liver, spleen, esophagus, small intestine,
pancreas, adrenal, thyroid, body wall and lower limb.
No expression was observed in adult tissues. The adult tissues examined
included liver. kidney, adrenal,
S myocardium, aorta, spleen, lymph node, pancreas, lung and skin.
DNA33087 ~IS97-OSI):
In fetal tissue, expression of DNA33087 (SEQ ID N0:18) was observed in
osteoblasts at alI sites of
enchondral and periosteal new bone formation, the developing pulmonary
arterial and aortic trunks. The fetal
tissues examined included: placenta, umbilical cord, brain, spinal cord, eye,
optic nerve, trachea, lung, heart,
thymus, liver, spleen, esophagus. small intestine, pancreas, adrenal, thyroid,
body wall and lower limb.
No expression was observed in the adult tissues examined including: Liver,
kidney, adrenal,
myocardium, aorta, spleen, lymph node. pancreas, lung and skin.
The probable role in control of bone matrix deposition and or osteoblast
growth.
All adult tissues in the multiblock were positive for beta-actin.
The probes used in this procedure were the following:
DNA33087-p 1 (SEQ ID N0:200):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCC GAG TGT TTT CCA AGA-3'
DNA33087-p2 (SEQ IDN0:201):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CAA GTT TAC TAG CCC ATC CAT-3'
DNA33087-p3 (SEQ ID N0:202):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC TGG ATG GGC TAG TAA ACT TGA-3'
DNA33087-p4 (SEQ ID N0:203):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCC TTC TGC TCC TTC TTG TT-3'
DNA3.i387 ~IS97-109):
The expression pattern of DNA34387 (SEQ ID N0:25) was observed in fetal and
adult human tissues at the
following sites:
Fetal - thyroid epithelium. small intestinal epithelium, gonad, pancreatic
epithelium, hepatocytes in liver and
renal tubules. Expression also seen in vascular tissue in developing long
bones.
Adult - Moderate signal in placental cytotrophoblast, renal tubular
epithelium, bladder epithelium, parathyroid
and epithelial tumors.
The fetal (E12-E16 weeks) tissues examined included: placenta, umbilical cord,
liver, kidney, adrenals,
thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine,
spleen, thymus, pancreas, brain, eye,
spinal cord, body wall, pelvis and lower limb.
The adult human tissues examined: kidney (normal and end-stage), adrenal,
myocardium, aorta, spleen, lymph
node, gall bladder, pancreas, lung, skin, eye (inc. retina), prostate,
bladder, liver (normal, cirrhotic, acute
failure).
The non-human primate tissues examined included the following:
138
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/0584t
Chimp tissues: Salivary gland, stomach, thyroid, parathyroid, skin, thymus,
ovary, lymph node.
Rhesus Monkey Tissues: Cerebral cortex, hippocampus, cerebellum, penis.
The probes used in this procedure were the following:
DNA34387-pl (SEQ ID N0:206):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCG AGA TAT GCA CCC AAT GTC-3'
DNA34387-p2 (SEQ ID N0:207):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TCC CAG AAT CCC GAA GAA CA-3'
DNA35638:
IS97-078:
Expression of DNA35638 (SEQ ID N0:35) was observed in the endothelium lining a
subset of fetal and
placental vessels. Endothelial expression was confined to these tissue blocks.
Expression also observed over
intermediate trophoblast cells of placenta.
The fetal tissues examined (E12-E16 weeks) included: placenta, umbilical cord,
liver, kidney,
adrenals. thyroid, lungs. heart, great vessels, esophagus, stomach, small
intestine, spleen. thymus, pancreas.
brain, eye, spinal cord. body wall. pelvis and lower limb.
The adult tissues examined included: liver, kidney, adrenal, myocardium,
aorta, spleen, lymph node, pancreas,
lung, skin, cerebral cortex (rm), hippocampus(mtt), cerebellum(rm), penis,
eye, bladder, stomach. gastric
carcinoma, colon, colonic carcinoma, thyroid (chimp), parathyroid (chimp)
ovary (chimp) and chondrosarcoma. Also examined was tissue derived from
acetaminophen induced liver
injury and hepatic cirrhosis.
The oligos used for the above procedure were the following:
DNA35638-pl (SEQ ID N0:208):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GGG AAG ATG GCG AGG AGG AG-3'
DNA35638-p2 (SEQ ID N0:209):
5'-CTA TGA AAT TAA CCC TCA CT.A AAG GGA CCA AGG CCA CAA ACG GAA ATC-3'
DNA39523:
The following probes were used in the in situ studies below:
DNA39523-pl (SEQ ID N0:210):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AGC GCA CGG CCA CAG ACA-3'
DNA39523-p2 (SEQ ID N0:211):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GAC CCT GCG CTT CTC GTT CCA-3'
198-051:
DNA39523 (SEQ ID N0:45) in normal human skin (neonatal foreskin) and adult
psoriatic skin both
exhibited specific strong expression in the epithelial cells of the stratum
basale - the single layer along the
basement membrane which is the progenitor for all of the overlying epidermal
cells in the skin.
There was no expression in epidermal cells in the overlying layers (stratum
spinosum, straum
granulosum, etc.). The intensity of the signal was slightly increased in
psoriatic skin. Expression was also
139
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
apparent in the dermis (the connective tissue immediately underlying the
epidermis) of both normal and
psoriatic skin. Expression here was most apparent in spindle shape cells
within the collagen matrix - the
stromal fibroblasts.
In the brain, sections of cerebrum had strong specific expression in a subset
of supe~cial cortical
neurons - a distinct pattern suggestive of a specific population of cortex
neurons.
In inflamed and normal bowel: Normal human large bowel and bowel with either
Crohns's disease or
ulcerative colitis had specific moderate to strong expression in a multifocal
pattern within the lamina propria of
villi. The cells labeled by in situ were spindloid stromal cells best
delineated as
fibroblasts. There was no expression by intestinal epithelial cells and there
was no apparent increased
expression (intensity or frequency) in diseased bowel. Specifically there was
also no correlation of expression
and lesions in the inflamed bowel.
In human fetal kidney, there was specific weak to moderate expression in
multifocal developing
tubules; expression was in the tubular epithelium in these foci.
The expression of DNA39523 (SEQ ID N0:45) in the skin and specific
localization to the basal
epithelial cells of the epidermis cells suggests a potential role in
differentiationimaintenance of the basal
epidermal cells. This expression pattern in combination with the fact that
expression occurs in cells that are
directly adjacent to the basement lamina, suggests that the cells regulate
trafficking of leukocytes into the
epidermis. As a result DNA39523 (SEQ ID N0:45) may be a constitutively
expressed signal for the
trafficking of dendriticiLangerhan cells or lymphocytes into the epidermis.
Such trafficking is a normal
physiologic event that occurs in normal skin and is thought to be involved in
immunosurveillance of the skin.
The expression of DNA39523 (SEQ ID N0:45) in inflammatory bowel disease was
not increased
from normal tissue, and there was no correlation of its expression to
inflammatory lesions. Similarly, its
expression in the basal epidermal cells in psoriatic skin lesions was
equivalent to or only slightly greater than
that seen in normal neonatal skin (but age-matched control adult skin was not
available at the time of the
study).
IS97-! 28:
The expression of DNA39523 (SEQ ID N0:45) was observed in the epithelium of
mouse embryo skin
as well as the basal epithelium and derntis of human fetal skin. The basal
epithelial pegs of the squamous
mucosa of the chimp tongue are also positive. Expression was also observed in
a subset of cells in developing
glometuli of fetal kidney, adult renal tubules, and over "thyroidized"
epithelium in end-stage renal disease.
However, low expression was also seen in a renal cell carcinoma, probably over
the epithelial cells.
Expression was also observed in the stromal cells both ( 1 ) at low levels in
fetal lung, and (2) in the apical
portion of gastric glands. High expression was indicated in the lamina propria
of the fetal small intestinal villi,
normal colonic mucosa and over stromal cells in a colonic carcinoma. Strong
expression occurred in benign
connective tissue cells in the hylanized stroma of a sarcoma. Expression also
occurred in stromal cells in the
placental villi and the splenic red pulp. In the brain, expression occurred in
cortical neurones.
DNA39523 (SEQ ID N0:45) was also expressed in the connective tissue
surrounding developing
bones and over nerve sheath cells in the fetus.
140
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
The fetal tissues examined (E 12-E 16 weeks) included: placenta, umbilical
cord, liver, kidney,
adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small
intestine, spleen, thymus, pancreas,
brain, eye, spinal cord, body wall, pelvis and lower limb. The adult tissues
examined included: liver, kidney,
adrenal, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral
cortex (rm), hippocampus(m1),
S eye, stomach, gastric carcinoma, colon, colonic carcinoma, thyroid (chimp),
parathyroid (chimp) ovary (chimp)
and chondrosarcoma. Also examined included acetaminophen induced liver injury
and hepatic cirrhosis.
IS98-092:
The expression of DNA39523 (SEQ ID N0:45) was present in many cells in the
outer layers (I and II)
of the monkey cerebral cortex. A small subset of cells in the deeper cortical
layers also expressed mRNA for
the chemokine homolog. Scattered cells within the molecular layers of the
hippocampus and bordering the
inner edge of the dentate gyros showed expression of DNA39523 (SEQ ID N0:45).
No expression was
detected within the cerebellar cortex. Expression of DNA39523 (SEQ ID N0:45)
was not observed in
infarcted brain, where cell death has occurred in the regions where the
chemokine homolog normally is
expressed. DNA39523 (SEQ ID N0:45) could possibly serve as a marker of a
subset of neurons of outer
layers of the cerebral cortex and could possibly reveal neuronal migration
disorders. Abnormal neuronal
migration is a possible cause of some seizure disorders and schizophrenia.
IS98-128:
DNA39523 (SEQ ID N0:45) showed intriguing and specific patterns of
hybridization within postnatal
day (P)10 and adult mouse brains. In one sagittal section of P10 mouse brain,
strong signal was observed
scattered within the molecular layer of the hippocampus and inner edges of the
dentate gyros. Cells in the
ZS presubiculum were moderately labeled; the signal extended in a strong band
through outer layers of the
retrosplenial comes to the occipital cortex, where the signal diminished to
background levels. A small set of
positive neurons were detected in deeper regions of P 10 motor cortex; neurons
in outer layers of P 10 cortex did
not exhibit signal above background levels. Moderate hybridization signal was
also detected in the inferior
colliculus. Chemokine homolog signal in the adult mouse brain was evaluated in
three coronal sections at
different levels. Strong signal was detected in the septum and in scattered
neurons in the pontine nuclei and
motor root of the trigeminal nerve; moderate signal was seen in the molecular
layers of the hippocampus and
outer layers of the retrosplenial cortex.
IS99-027:
Bolekine (also known as BRAK - the chemokine to which DNA39523 (SEQ ID N0:45)
bear
significant homology) belongs to a chemokine subgroup characterized by a cys-x-
cys (CXC) motif and absence
of an amino-terirtinal glu-leu-arg (ELR). Non-ELR CXC chemokines (includingSDF-
1, IP10, Mig and PF4) are
chemotactic for subsets of leukocytes including B and T lymphocytes. They also
have angiostatic activity.
DNA39523 (SEQ ID N0:45) was detected in Postnatal day (P) 1 mouse brain,
bolekine signal was
detected in the hippocampus (stratum lacunosum moleculare and hilus of the
dentate gyros) and anterior
141
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
olfactory nucleus, but not in the developing cerebral cortex or cerebellum. By
P10, signal is present tn a subset
of cells in layers 1 R, 2 of the cerebral cortex. A small population of cells
in the deeper layers also express
DNA39523 (SEQ IDN0:45). The pattern in the hippocampus resembled the P1 brain.
Weak signal is present in
the cerebellum, especially lobules IX and X. Signal is also present in the
dorsal striatum and colliculi.
In the adult mouse brain, bolekine-positive cells were difficult to detect in
the adult cerebral cortex,
but signal is present in the anterior olfactory nucleus and hippocampus. In
ischemic mouse brains, however,
bolekine signal is induced in the penumbra.
In the developing cerebral cortex, bolekine expression correlates with final
stages of neuronal
migration and the establishment of axonal projections and synaptogenesis.
Other CXC chemokines have roles
in neuronal migration and patterning in the central nervous system (SDF-1) and
modulation of neuronal
activity (IL-8 and GRO-a).
Bolekine expression is induced in ischemic -reperfusion injury in the brain.
but not in other
inflammatory states.
DNA47365 ~IS97-I d?!: In fetal tissues, the expression of DNA47635 (SEQ ID
N0:91 ) was obsen~ed in the
fascia lining the anterior surface of the vertebral body. There is expression
over the fetal retina. Low level
expression over fetal neurones.
The following probes were used in the above analysis:
DNA47365-pl (SEQ ID N0:214):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AAC CCG AGC ATG GCA CAG CAC-3'
DNA47365-p2 (SEQ ID N0:215):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TCT CCC AGC CGC CCC TTC TC-3'
DNA49435 (IS97-136):
Moderate expression of DNA49435 (SEQ ID NO:111) was observed over cortical
neurones in the
fetal brain. Expression was also present over the inner aspect of the fetal
retina. possible expression in the
developing lens. Expression was seen over fetal skin, cartilage, small
intestine, placental villi and umbilical
cord. In adult tissues there is an extremely high level of expression over the
gallbladder epithelium. Moderate
expression of DNA49435 (SEEQ ID NO: I 1 I ) was seen over the adult kidney,
gastric and colonic epithelia.
The human fetal tissues examined (E12-E16 weeks) included: placenta, umbilical
cord, liver, kidney,
adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small
intestine, spleen, thymus, pancreas,
brain, eye, spinal cord, body wall, pelvis, testis and lower limb. The adult
human tissues examined included:
kidney (normal and end-stage), adrenal, spleen, lymph node. pancreas, lung,
eye (inc. retina), bladder, liver
(normal, cirrhotic, acute failure).
The non-human primate tissues examined included the adrenal glands from chimp
tissues and the
cerebral cortex, hippocampus and cerebellum of rhesus monkey tissues.
The probes used in the above analysis were the following:
DNA49435-pl (SEQ ID N0:218):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC GGA TCC TGG CCG GCC TCT G-3'
DNA49435-p2 (SEQ ID N0:219):
142
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GCC CGG GCA TGG TCT CAG TTA-3'
DNA54228 (IS98-I05):
Expression of DNA54228 (SEQ ID N0:133) was observed in bone spicules: fetal
metaphyseal bone,
S fetal calvarium (skull) and bone tissue in human neoplasia (osteosarcoma and
chondrosarcoma). There is weak
but consistent signal in small bone spicules in the metaphysis of fetal bone
and in ossified spicules in a
chondrosarcoma and an osteosarcoma. No signal was detected in human lung,
liver, thymus, kidney, thyroid,
brain, spleen, fetal tissues including adrenal, brain, cartilage, lung, liver,
intestine, gonad, heart and skin.
The probes used in the above procedure were the following:
hmDETI-pl (SEQ ID N0:220):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC ACC ACC ACC CAG GAG C-3'
hmDETI-p2 (SEQ IDN0:221):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AAT GAA GTG GGA CGT TTG AGT-3'
DNA54228-pl (SEQ ID N0:222):
~'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTT CTT TCC TTC ACC ACC ACC-3'
DNA54228-p2 (SEQ ID N0:223):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TCT GCC TTG GCT TTT GAC AC-3'
DNA54231 (mFIZZ3):
IS98-070:
DNA54231 (SEQ ID N0:139) showed a moderate signal that is specific to
adipocytes. This signal
was present in mesenteric fat and in interstitial fat in the neck around the
trachea. The expression pattern
appears to be specific for adult fat.
IS98-109:
The expression of DNA54231 (SEQ ID N0:139) was specific to adipocytes and was
present wherever
such cells were found which in this study included the peritoneal mesentery,
perirenal fat in the renal pelvis,
and the mammary fat pad. There was no expression in any other cell type in
normal murine brain, liver,
kidney, mammary gland, pancreas, spleen, pancreas, bone marrow, stomach,
duodenum, jejunum, ileum, colon.
cecum, testis, skin, or lung.
The selective distribution of this molecule to adipocytes suggests a role in
either fat metabolism or the
productionigenesis of adipocytes, either of which is important in obesity.
The probes used for the above procedure were the following:
DNA54231-pl (SEQ ID N0:224):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGA GGG GGA CAG GAG CTA ATA-3'
DNA54231-p2 (SEQ ID N0:225):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GTC CCA CGA GCC ACA GG-3'
DNA59294 (IS98-138):
143
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
DNA 59294 (SEQ ID N0:149) was evaluated in a panel consisting of normal adult
and tetat tissues
and tissues with inflammation; predominantly chronic lymphocytic inflammation.
In summary, the expression
was specific to muscle, certain types of smooth muscle in the adult and in
skeletal and smooth muscle in the
human fetus. The expression in adult human was in smooth muscle of tubular
organs evaluated including
colon and gall bladder. There was no expression in the smooth muscle of
vessels or bronchi. No adult human
skeletal muscle was evaluated. In fetal tissues there was moderate to high
diffuse expression in skeletal muscle
the axial skeleton and limbs. There was weak expression in the smooth muscle
of the intestinal wall but no
expression in cardiac muscle.
In adult tissues, the colon showed a low level of diffuse expression in the
smooth muscle (tunica
muscularis) in 5 specimens with chronic inflammatory bowel disease. In the
gall bladder, there was weak to
low level expression in the smooth muscle of the gall bladder.
In fetal human tissues, there was moderate diffuse expression in skeletal
muscle and weak to low
expression in smooth muscle. However expression was not detected in the fetal
heart or any other fetal organ
including liver, spleen, CNS, kidney, gut, lung.
The additional human tissues tested with no detectable expression included:
Tune with chronic
granulomatous inflammation and chronic bronchitis (~ patients), peripheral
nerve, prostate, heart, placenta.
liver (disease multiblock including acetomihopin induced injury and
cirrhosis), brain (cerebrum and
cerebellum), tonsil (reactive hyperplasia), peripheral lymph node, thymus.
The probes used in the above procedure were the following:
626.p1 (SEQ ID N0:226):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CGG AAT GGA CTG GCC TCA CAA-3'
626.p2 (SEQ ID N0:227):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AGG ATG GTC TCG GGC TGC TG-3'
DNA30868 (IS97-044)
DNA30868 expression was found in the following fetal tissues: spinal cord.
autonomic ganglia,
enteric nerves, sacral plexus. peripheral and cranial nerves.
The fetal tissues examined were the following: Placenta, umbilical cord,
liver, kidney, adrenals, thyroid, lungs,
heart, great vessels, esophagus, stomach, small intestine, spleen, thymus,
pancreas, brain, eye, spinal cord,
body wall, pelvis and lower limb.
The adult tissues examined included: Liver, kidney, adrenal, myocardium,
aorta, spleen, lymph node, pancreas,
lung and skin.
The probes used for the above procedure were the following:
DNA30868.p1 (C111-G): (SEQ ID N0:304)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC AGA GAC AGG GCA AGC AGA ATG-3'
DNA30868.p2 (C111-H):
(SEQ ID N0:305)
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GAA GGG GAT GAC TGG AGG AAC-3'
DNA53517:
IS98-070:
144
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
DNA53517 (SEQ ID N0:255) expression in the normal adult murine lung was
patchy, with expression in a
subset of mucosal epithelial cell in the large airway (bronchi/bronchioles).
There is also expression within the
rare discrete cells in the submucosal interstitium adjacent to the large
airways. These cells, typically I-3 within
a positive focus, are adjacent to large vessels and may represent smooth
muscle cells, peripheral nerves or
Schwann cells, or lymphatics.
In the murine adult lung with allergic inflammation (eosinophilic, lymphocytic
vasculitis,
bronchiolitis and pneumonitis), there was diffuse strong expression in all
mucosal epithelial cells of all of the
large airways (bronchi/bronchioles) of the lung. There was also strong
expression in discrete cells that
represent a subset of epithelial cells that line the alveoli; these cells are
type II pneumocytes. There is also
expression, as in normal lung, present within rare discrete cells in the
submucosal interstitium adjacent to the
large airways.
In normal adult murine small and large intestine, there is strong expression
within multifocal few
discrete single cells that are present in the submucosa. the tunica muscularis
and the mesentery. The cells that
express the signal are almost always associated with nerve, vein, artery
triads within these areas. These cells
I S are spindle shaped and may be either a peripheral nerves. Schwann cells
associated with such nerves or some type of support cell associated with
vessel or lymphatics. Interestingly,
there is no expression within identifiable myenteric plexi that are present
within the tunica muscularis.
In inflamed large bowel (from an ILIOR KO mouse) the pattern of expression is
similar but
expression level is significantly decreased.
IS98-093:
The distribution of DNA53715 (SEQ ID N0:255) was further evaluated in a broad
screen of normal
murine tissues. In normal lung, expression is variable but when present was
restricted to murine bronchial
epithelial cells and type II alveolar cells in the lung. There is a marked
increase in expression in these cells in
inflamed lung (allergic inflammation with bronchial mucosal
hypertrophy/hyperplasia: asthma model). The
expression of DNA53715 (SEQ ID N0:255) in the bowel is most prominent in the
colon and is present in few
discrete cells within the submucosa and mucosa muscularis, the thin. well
vascularized tissue layer between the
muscle wall of the bowel and the mucosa proper. The exact identity of these
cells has not been delineated,
however, their spindloid morphology and close association to capillaries and
small vessels in the submucosa
suggest the following possibilities: a subset of vascular pericytes or non-
myelinated nerve fibers.
The expression of DNA53715 (SEQ ID N0:255) in discrete cells in the bowel
submucosa was
restricted to the colon and was not seen in sections of jejunum. ileum,
proximal duodenum or stomach.
Expression was not detected in the following normal murine tissues: liver,
kidney, spleen, bone marrow, lung,
pancreas, stomach, proximal duodenum, jejunum, ileum, brain, skin, testis, or
mammary glands.
It is possible that DNA53715 (SEQ ID N0:255) has a role in enhancing or
stimulating mucosal
immunity in the lung.
The probes used for the above procedure were the following:
DNA53517.p1 (C301-P):
(SEQ ID N0:308)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CCC AGG ATG CCA ACT TTG A-3'
DNA53517.p2 (C301-Q):
(SEQ ID N0:309)
145
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00105841
S'-CTA TGA AAT TAA CCC TCA CTA AAG GGA AGG AGG CCC ATC TGT TCA TAG-3'
EXAMPLE 7
In situ Hybridization in Cells and Diseased Tissues
The in situ hybridization method of Example 6 is used to determine gene
expression, analyze the
tissue distribution of transcription, and follow changes in specific mRNA
synthesis for the genes/DNAs and the
proteins of the invention in diseased tissues isolated from human individuals
suffering from a specific disease.
These results show more specifically where in diseased tissues the genes of
the invention are expressed and are
more predictive of the particular localization of the therapeutic effect of
the inhibitory or stimulatory
compounds of the invention (and agonists or antagonists thereof) in a disease.
Hybridization is performed
according to the method of Example 6 using one or more of the following tissue
and cell samples:
(a) lymphocytes and antigen presenting cells (dendritic cells, Langherhans
cells. macrophages and
monocytes, NK cells);
(b) lymphoid tissues: normal and reactive lymph node, thymus, Bronchial
Associated Lymphoid
Tissues. (BALT). Mucosal Associated Lymphoid Tissues (MALT);
(c) human disease tissues:
~ Synovium and joint of patients with Arthritis and Degenerative Joint
Disease;
~ Colon from patients with Inflammatory Bowel Disease including Ulcerative
Colitis and
Crohns' disease:
~ Skin lesions from Psoriasis and other forms of dermatitis;
~ Lung tissue including BALT and tissue lymph nodes from chronic and acute
bronchitis,
pneumonia, pneumonitis, pleuritis;
~ Lung tissue including BALT and tissue lymph nodes from Asthma;
~ nasal and sinus tissue from patients with rhinitis or sinusitis;
~ Brain and Spinal cord from Multiple Sclerosis. Alzheimer's Disease and
Stroke:
~ Kidney from Nephritis. Glomerulonephritis and Systemic Lupus Erythematosis;
~ Liver from Infectious and non-infectious Hepatitis and acetaminophen-induced
liver cirrhosis;
~ Tissues from Neoplasms/Cancer.
Expression is observed in one or more cell or tissue samples indicating
localization of the therapeutic
effect of the compounds of the invention (and agonists or antagonists thereof)
in the disease associated with the
cell or tissue sample.
The sequences of the oligonucleotides used, where expression overlaps with the
non-diseased tissue
distribution reported earlier is recited in Example 6.
DNA30942:
IS98-OZI: Expression was observed in mononuclear phagocytes in the normal
chimp thymus, as well as in a
gastric carcinoma (1/I) colorectal cancer (1/1), breast cancer (2/5) and a
lung cancer (1/4). Expressed by
malignant cells in an osteosarcoma and a poorly differentiated liposarcoma.
Possible signal in the malignant
cells of a testicular teratoma and breast cancers (1/S). In one of the lung
cancers scattered signal is seen over a
146
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
high endothelial venule within pulmonary lymphoid tissue. The fetal tissues
examined (E12-E16 weeks)
included: placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs,
heart, great vessels, esophagus,
stomach. small intestine, spleen, thymus, pancreas, brain, eye, spinal cord,
body wall, pelvis and lower limb.
The adult human tissues examined included: liver, kidney, adrenal, myocardium,
aorta, spleen, lung, skin,
chondrosarcoma, eye, stomach, gastric carcinoma, colon, colonic carcinoma,
renal cell carcinoma, prostate,
bladder mucosa and gall bladder. Also examined was tissue derived from
acetaminophen induced liver injury
and hepatic cirrhosis. The rhesus tissues examined include: cerebral cortex
(tm), hippocampus(rm). The
chimp tissues examined included: thyroid, parathyroid, ovary, nerve, tongue,
thymus. adrenal, gastric mucosa
and salivary gland.
IS98-085: Expression was observed in eight adenocarcinomas and seven squamous
lung carcinomas. Actins
were strongly positive in all tumors, indicating that all are suitable for in
situ hybridization analysis.
Expression of DNA30942 was observed in 6 of the tumors as follows:
6727-95 / squamous carcinoma - Strongly expressed over neoplastic epithelium;
9558-95 / squamous carcinoma - Expression over neoplastic epithelium;
12235-95 i adenocarcinoma - Expression over in situ and infiltrating tumor
cells:
6545-95 & 4187-96 i squamous carcinomas - Expression over cells in tumor
stroma, no expression seen over
tumor cells:
12954-94 i squamous carcinoma - possible weak expression over stromal cells.
IS99-I 11:
The in situ expression of DNA30942 (SEQ ID N0:13) was evaluated numerous
chronic inflammatory
conditions and lymphoid organs. In summary, DNA30942 (SEQ ID N0:13) was
strongly expressed in high
endothelial venules (HEV) in the tonsil, hilar lymph node, bronchial mucosal-
associated lymphoid tissue
(BALT) in chronic asthma, patchy expression in colonic mucosa and weak
inconsistent expression in gut-
mucosal associated lymphoid tissues (GALT) HEV.
In lymphoid tissues, there was observed strong specific expression in single
sections of tonsil, hilar
lymph node, bronchial mucosal-associated lymphoid tissue BALT) in a case of
chronic asthma, and in gut
mucosal associated lymphoid tissues in sections of IBD (GALT/MALT). In each of
these lymphoid organs
expression specifically was present in high-endothelial venules (HEV).
In tissue in a chronic asthmatic lung, additionally to expression in BALT
HEVs, specific expression
was observed in small capillaries lined with high or reactive swollen
endothelial cells in the submucosa of
inflamed bronchi. This region was not intimately associated with BALT but was
specific to the submucosal
site for inflammatory cell trafficking to the bronchi. There was a significant
submucosal infiltrate of
eosinophils in these areas. In other sections of diseased lung (COPD and
chronic interstitial pneumonia) there
was not any expression of DNA30942 (SEQ ID N0:13), these sections had some
artifact (loss of tissue from
slide).
In psoriatic tissue, there was weak expression in some small dermal
capillaries in psoriatic plaques. In
tonsilar tissue, additional to expression in HEVs associated with follicles,
there was also strong expression
within the reticulated tonsillar crypt epithelium. Expression here was also in
vessels in the small infra-epithelial
147
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
capillaries present. Expression was also within some of the epithelial cells.
This is an important
immunological site and is involved with antigen presentation and may play a
role in tolerance induction.
In tissue isolated from patients suffering from Crohns' Disease and ulcerative
colitis, colonal
expression was present in the mucosa with patchy distribution in some but not
in all cases. Expression in HEV
in GALT was present as a significantly weaker signal than seen in other
lymphoid tissues and was not
consistently present even in sections where there was strong but patchy
expression in the mucosa.
In tissue isolated from acetaminophen induced liver injury and cirrhosis,
there was weak expression in
small capillaries within areas in the portal tracts with chronic lymphocytic
inflammation.
DNA33460 (IS98-015:
The expression of DNA33460 (SEQ ID N0:20) was observed over cells in loose
connective tissue
immediately adjacent to developing extra ocular muscle in the fetal eye.
Moderate expression over sofr-tissue
sarcoma. The fetal tissues examined (E12-E16 weeks) included: placenta,
umbilical cord, liver. kidney,
adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach. small
intestine, spleen, thymus, pancreas,
brain. eye, spinal cord, body wall. pelvis and lower limb. The adult tissues
examined included the liver.
kidney, renal cell carcinoma, adrenal, aorta, spleen, lymph node, pancreas,
lung, myocardium. skin. cerebral
cortex (rm), hippocampus (rm), cerebellum (rm), bladder, prostate. stomach,
gastric carcinoma. colon, colonic
carcinoma, thyroid (chimp), parathyroid (chimp) ovary (chimp) and
chondrosarcoma. Also examined was
tissue extracted from acetaminophen induced liver injury and hepatic
cirrhosis.
The probes used in this procedure were the following:
DNA33460-p 1 (SEQ ID N0:204):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CAG CAC TGC CGG GAT GTC AAC-3'
DNA33460-p2 (SEQ ID N0:205):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA GTT TGG GCC TCG GAG CAC TG-3'
DNA3~1387 IIS98-083):
Expression observed in lung cancer tumors and was positive in all eight
squamous carcinomas and in
6/8 adenocarcinomas. Expression levels are low to moderate in the
adenocarcinomas and very strong in the
squamous carcinomas. No expression was seen in the tumor stroma, alveoli or
normal respiratory epithelium.
Possible low level expression in the lymph nodes.
Expression was observed in lung cancer. The gene was amplified in Taqman
analysis of a lung tumor
panel. Expression was observed in eight squamous carcinomas and in 6/8
adenocarcinomas. Expression was
seen in in situ and infiltrating components. Expression levels were low to
moderate in the adenocarcinomas. In
general expression was higher in the squamous carcinomas and in two the
expression was strong. Possible low
level expression in lymph nodes.
DNA35638:
IS98-124:
This study examined the expression of DNA35638 (SEQ ID N0:35) in inflamed
human tissues
(psoriasis, IBD, inflamed kidney, inflamed lung, hepatitis (liver block),
normal tonsil, adult and chimp
148
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
multiblocks) DNA35638 (SEQ ID N0:35) has been shown elsewhere in this
application to have
immunostimulatory (enhances T lymphocyte proliferation in the MLR and
costimulation) and proinflarnmatory
properties (induces a neutrophil infiltrate in vivo).
'This study evaluated the differential expression of this molecule in vessels
of inflamed human tissues
as compared to non-inflamed tissues. In summary, expression was present in the
endothelium/intima of large
vessels in the lung afflicted with chronic inflammation, in the superficial
dermal vessels of the psoriatic skin, in
arterioles in a specimen of chronic sclerosing nephritis, and in capillaries
including the perifollucular sinuses of
tonsil. DNA35638 (SEQ ID N0:35) was not expressed (as detectable by this
methodology) in normal skin
(human foreskin specimens), normal lung, inflamed (8 IBD specimens) or normal
large bowel, chronically
inflamed or cirrhotic liver, normal adult cardiac tissue, or adrenal gland.
DNA39523:
198-052:
DNA39523 (SEQ ID N0:45) in normal human skin (neonatal foreskin) and adult
psoriatic skin both
exhibited specific strong expression in the epithelial cells of the stratum
basale - the single layer along the
basement membrane which is the progenitor for all of the overlying epidermal
cells in the skin.
There was no expression in epidermal cells in the overlying layers (stratum
spinosum, straum
granulosum, etc.). The intensity of the signal was slightly increased in
psoriatic skin. Expression was also
apparent in the dermis (the connective tissue immediately underlying the
epidermis) of both normal and
psoriatic skin. Expression here was most apparent in spindle shape cells
within the collagen matrix - the
stromal fibroblasts.
In inflamed and normal bowel: Normal human large bowel and bowel with either
Crohns's disease or
ulcerative colitis had specific moderate to strong expression in a multifocal
pattern within the lamina propria of
villi. The cells labeled by in situ were spindloid stromal cells best
delineated as
fibroblasts. There was no expression by intestinal epithelial cells and there
was no apparent increased
expression (intensity or frequency) in diseased bowel. Specifically there was
also no correlation of expression
and lesions in the inflamed bowel.
The expression of DNA39523 (SEQ ID N0:45) in the skin and specific
localization to the basal
epithelial cells of the epidermis cells suggests a potential role in
differentiationimaintenance of the basal
epidetzrtal cells. This expression pattern in combination with the fact that
expression occurs in cells that are
directly adjacent to the basement lamina, suggests that the cells regulate
trafficking of leukocytes into the
epidermis. As a result DNA39523 (SEQ ID N0:45) may be a constitutively
expressed signal for the
trafficking of dendriticiLangerhan cells or lymphocytes into the epidermis.
Such trafficking is a normal
physiologic event that occurs in normal skin and is thought to be involved in
immunosurveillance of the skin.
The expression of DNA39523 (SEQ ID N0:45) in inflammatory bowel disease was
not increased
from normal tissue, and there was no correlation of its expression to
inflammatory lesions. Similarly, its
expression in the basal epidermal cells in psoriatic skin lesions was
equivalent to or only slightly greater than
that seen in normal neonatal skin (but age-matched control adult skin was not
available at the time of the
study).
149
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
DNA45416 (IS98-140):
The expression of DNA45416 (SEQ ID N0:79) was evaluated in a variety of human
and non-human
primate tissues and was found to be highly specific. Expression was present
only in alveolar macrophages in
the lung and in Kupffer cells of the hepatic sinusoids. Expression in these
cells was significantly increased
S when these distinct cell populations were activated. Though these two
subpopulations of tissue macrophages
are located in different organs, they have similar biological fiznctions. Both
types of these phagocytes act as
biological filters to remove material from the blood stream or airways
including pathogens, senescent cells and
proteins and both are capable of secreting a wide variety of important
proinflammatory cytokines.
In inflamed lung (7 patient samples) expression was prominent in reactive
alveolar macrophage cell
populations defined as large, pale often vacuolated cells present singly or in
aggregates within alveoli and was
weak to negative in normal. non-reactive macrophages (single scattered cells
of normal size). Expression in
alveolar macrophages was increased during inflammation when these cells were
both increased in numbers and
size (activated). Despite the presence of histocytes in areas of interstitial
inflammation and peribronchial
lymphoid hyperplasia in these tissues, expression was restricted to alveolar
macrophages. Many of the
inflamed lungs also had some degree of suppurative inflammation: expression
was not present in neutrophilic
granulocytes.
In liver, there was strong expression in reactive/activated Kupffer cells in
livers with acute
centrilobular necrosis (acetaminophen toxicity) or fairly marked periportal
inflammation. However there was
weak or no expression in Kupffer cells in normal liver or in liver with only
mild inflammation or mild to
moderate lobular hypetplasiaihvpertrophy. Thus, as in the lung, there was
increased expression in
acivated/reactive cells.
There was no expression of this molecule in histiocytes/macrophages present in
inflamed bowel,
hyperplastic/reactive tonsil or normal lymph node. The lack of expression in
these tissues which all contained
histiocytic inflammation or resident macrophage populations strongly supports
restricted expression to the
unique macrophage subset populations defined as alveolar macrophage and
hepatic Kupffer cells. However.
the expression of DNA454216 (SEQ ID N0:79) spleen or bone marrow was not
available for evaluation.
Human tissues evaluated which had no detectable expression included:
Inflammatory Bowel disease
(7 patient samples with moderate to severe disease), tonsil with reactive
hyperplasia, peripheral lymph node,
psoriatic skin (2 patient samples with mild to moderate disease), heart.
peripheral nerve. Chimp tissues
evaluated which had no detectable expression included: tongue, stomach,
thymus.
The probes used for the above studies were the following:
628.p1 (SEQ ID N0:212):
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CAA GCC CAC AGT GAC AA-3'
628.p2 (SEQ ID N0:213):
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA CCT CCA CAT TTC CTG CCA GTA-3'
DNA41374:
IS 98-077:
DNA41374 (SEQ ID N0:248) was expressed in thymic T lymphocytes
150
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Summary: In numerous tissues evaluated there expression was only detected as
weak diffuse expression in
thymic T lymphocytes. The limited distribution pattern suggests expression by
T lymphocytes or cells closely
associated with T lymphocytes such as antigen presenting cells (dendritic cell
populations, etc). In inflamed
human tissue with significant lymphocytic inflammation and presence of
reactive follicle formation
S (inflammatory bowel disease and chronic lymphocytic
interstitial pneumoniaibronchitis) there was no detectable expression in areas
which contained significant
numbers of T lymphocytes. The tissues tested for which there was no detectable
expression included: human
normal tissues: placenta, lung, spleen, adrenal gland, skin, kidney, eye,
liver;
human diseased tissue: liver disease: chronic hepatitis, chronic cholangitis,
acute centrilobular necrosis
(acetaminophen toxicity); Neoplasia (tumor multiblock): osteosarcoma, squamous
cell carcinoma: human fetal
tissues: brain, spinal cord. lung, heart, kidney, axial and limb
musculoskeleton vessels, umbilical cord: non
human primate: tongue, thyroid gland, parathyroid gland, stomach, salivary
gland.
IS98-125.
l5 DNA4137-1 (SEQ ID N0:248) has low level expression in non-human primate
thymus and in human
tonsil in T lymphocyte specific regions. Tlie limited distribution pattern
suggests expression by T lymphocytes
or cells closely associated with T lymphocytes such as antigen presenting
cells (dendritic cell populations. etc).
In inflamed tissue with significant lymphocytic inflammation and presence of
reactive follicle formation
(inflammatory bowel disease and chronic lymphocytic interstitial
pneumoniaibronchitis) there was no
detectable expression in areas which likely contain significant numbers of T
lymphocytes.
Inflamed lung: (chronic lymphocytic and granulomatous pneumonitis): weak to
negative signal in the
interstitium compared to the control sense probe. There was weak expression in
normal chimp thymus (human
thymus not available) and in human tonsil. In the latter the expression was
predominantly in T lymphocyte
areas of this structure including the perifollicular marginal zone and in the
paracortex.
There was no detectable expression in the following human tissues:
inflammatory bowel disease (8
patient specimensi, chronically inflamed and normal lung (6 patient
specimens). chronic sclerosing nephritis
( 1 ), chronically and acutely inflamed and cirrhotic liver ( 10 specimen
multiblock), normal and psoriatic skin.
peripheral lymph node (non-reactive).
The probes used for the above procedures were the following:
41374.p1 (C337-G):
(SEQ ID N0:306)
5'-GGA TTC TAA TAC GAC TCA CTA TAG GGC CTC CAC AGA ACC TCG CCA TCA-3'
4I374.p2 (C337-H):
(SEQ ID N0:307)
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA TGG GGC AAG ACT CAC AAG CAG-3'
DNA53517:
IS98-070:
DNA53517 (SEQ ID N0:255) expression in the normal adult murine lung was
patchy, with
expression in a subset of mucosal epithelial cell in the large airway
(bronchi/bronchioles). There is also
expression within the rare discrete cells in the submucosal interstitium
adjacent to the large airways. These
151
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
cells, typically 1-3 within a positive focus, are adjacent to large vessels
and may represent smooth muscle cells,
peripheral nerves or Schwann cells, or lymphatics.
In the murine adult lung with allergic inflammation (eosinophilic, lymphocvtic
vasculitis,.
bronchiolitis and pneumonitis), there was diffuse strong expression in all
mucosal epithelial cells of all of the
large airways (bronchvbronchioles) of the lung. There was also strong
expression in discrete cells that
represent a subset of epithelial cells that line the alveoli; these cells are
type II pneumocvtes. There is also
expression, as in normal lung, present within rare discrete cells in the
submucosal interstitium adjacent to the
large airways.
In normal adult murine small and large intestine. there is strong expression
within multifocal few
discrete single cells that are present in the submucosa, the tunica muscularis
and the mesentery. The cells that
express the signal are almost always associated with nerve, vein, artery
triads within these areas. These cells
are spindle shaped and may be either a peripheral nerves, Schwann cells
associated with such nerves or some type of support cell associated with
vessel or lymphatics. Interestingly,
there is no expression within identifiable mventeric plexi that are present
within the tunica muscularis.
In inflamed large bowel (from an IL10R KO mouse) the pattern of expression is
similar but
expression level is significantly decreased.
IS98-135:
DNA53 715 (SEQ ID N0:255, mouse FIZZ-1) was used as a detection probe in the
following human
tissues: gastric carcinoma, inflamed lung (3 patients) (vessels, alveoli.
large airways and mucous glands),
aorta, heart, placenta and gall bladder.
Expression of mouse DNA53715 (SEQ ID N0:255) was present in normal mouse lung
in farce airway
epithelium and had marked increased expression in inflamed murine lung (airway
epithelium. type II alveolar
pneumocvtes). It was also expressed in discrete cells in the submucosa of the
large bowel alone vascular
channels.
DNA84210:
The following probes were used in the in situ studies indicated below:
84210.p 1 (F-79619):
(SEQ ID N0:310)
5'-GGA TTC TAA TAC GAC TCA CTr1 TAG GGC GCG GTC GCA GGA CAT TCA GTA-3'
84210.p2 (F-79620):
(SEQ ID N0:311 )
5'-CTA TGA AAT TAA CCC TCA CTA AAG GGA ACT CTT TGG GTT CCA GCA CAC-3'
DNA84210 (SEQ ID N0:285) is expressed in fetal kidney, primarily in developing
glomeculi and
tubules of the cortical zone and also weakly in fetal lung and spinal cord.
There is also expression in stromal
cells adjacent to developing cartilage and bone. In adult tissues, weak
expression is seen in normal bronchial
epithelium, in one (adenocarcinoma) of five lung tumors (2 squamous and 3
adenocarcinomas) and in a
chondrosarcoma. There is possibly expression in the skin and its appendages,
however, the section is folded
and difficult to evaluate.
IS99-102:
152
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
Expression of DNA84210 (SEQ ID N0:285) in malignant melanoma. lung tumor,
colon tumor, cell
pellet, mouse tissues, fetal tissues.
Expression of DNA84210 (SEQ ID N0:285) is seen in several adult (neoplastic
and non-neoplastic)
and fetal tissues. As far as normal adult tissues are concerned. DNA84210 (SEQ
ID N0:285) is seen in the
epidermis of skin (mostly in basally located cells) and in skin appendages,
such as hair follicles and sebaceous
glands associated with them. Expression is also seen in bronchial epithelium
and submucosal bronchial glands.
In human fetal tissues, expression of DNA84210 (SEQ ID N0:285) is seen in skin
and skin appendages, lung,
renal cortex and pancreatic ducts. It is also seen in mesenchymal cells
adjacent to developing bone and
cartilage. There is no hybridization signal seen in mouse embryos. Expression
of DNA84210 (SEQ ID
N0:285) is seen in one of six colorectal adenocarcinomas (weak), 2 of 3 lung
adenocarcinomas (one shows
strong, but very focal expression. one is very weakly positive), 0 of 3 lung
squamous cell carcinomas and 1 of
1 chondrosarcomas (weak). Expression is also seen in 5 of 5 malignant
melanomas, the intensity of expression
ranges from very weak to strong. These sections also demonstrate expression of
DNA84210 (SEQ ID N0:285)
in normal epidermis and skin appendages.
EXAMPLE 8
Use of the PRO ~olvpePtides as a hybridization probe
The following method describes use of a nucleotide sequence encoding the PRO
polypeptides as a
hybridization probe.
DNA comprising the coding sequence of full-length or mature PRO polypeptides
is employed as a
probe to screen for homologous DNAs (such as those encoding naturally-
occurring variants) in human tissue
cDNA libraries or human tissue genomic libraries.
Hybridization and washing of filters containing either library DNAs is
performed under the following
high strineency conditions. Hybridization of radiolabeled PRO - derived probe
(e.b, PR0200. PR0204.
PR021?, PR0216. PR0226, PR0240, PR0235, PR0245, PR0172. PR0273, PR0272.
PR0332. PR0526,
PR0701, PR0361, PR0362. PR0363. PR0364, PR0356. PR0531, PR0533. PR01083,
PR0865. PR0770.
PR0769, PR0788. PRO1114. PR01007, fR01184. PR01031. PR01346. PRO11~5. PR012~0.
PR01312.
PR01192. PR01246, PR012S3, PROI 195. PR01343. PR01418, PR01387, PR01410,
PR01917. PR01868,
PR0205, PR021, PR0269, PR0344, PR0333, PR0381, PR0720, PR0866, PR0840, PR0982.
PR0836,
PR01159, PR01358. PR01325, PR01338, PR01434, PR04333, PR04302, PR04430 or
PR05727) to the
filters is performed in a solution of 50".o formamide, ~x SSC, 0.1% SDS. 0.1%
sodium pyrophosphate, 50 mM
sodium phosphate, pH 6.8. 2x Denhardt's solution, and 10% dextran sulfate at
42°C for 20 hours. Washing of
the filters is performed in an aqueous solution of O.lx SSC and 0.1°o
SDS at 42°C.
DNAs having a desired sequence identity with the DNA encoding full-length
native sequence PRO
polypeptide can then be identified urine standard techniques known in the art.
EXAMPLE 9
Expression of the PRO polvpeptide in E coli
This example illustrates preparation of an unglycosylated form of the PRO
polypeptides by
153
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
recombinant expression in E. coli.
The DNA sequence encoding the PRO polypeptide is initially amplified using
selected PCR primers.
The primers should contain restriction enzyme sites which correspond to the
restriction enzyme sites on the
selected expression vector. A variety of expression vectors may be employed.
An example of a suitable vector
is pBR322 (derived from E. coli; see Bolivar et al.. Gene, _2:95 (1977)) which
contains genes for ampicillin and
tetracycline resistance. The vector is digested with restriction enzyme and
dephosphorylated. The PCR
amplified sequences are then ligated into the vector. The vector will
preferably include sequences which
encode for an antibiotic resistance gene, a trp promoter. a polyhis leader
(including the first six STII codons,
polyhis sequence. and enterokinase cleavage site), the PRO polypeptide coding
region. lambda transcriptional
terminator, and an argU gene.
The ligation mixture is then used to transform a selected E. co/i strain urine
the methods described in
Sambrook et uL, supra. Transformants are identified by their ability to grow
on LB plates and antibiotic
resistant colonies are then selected. Plasmid DNA can be isolated and
confirmed by restriction analysis and
DNA sequencing.
I 5 Selected clones can be crown ovemtght in liquid culture medium such as LB
broth supplemented with
antibiotics. The overnight culture may subsequently be used to inoculate a
lar~~er scale culture. Thr cells arc
then crown to a desired optical densiy-, during which the expression promoter
is turned on.
After culturing the cells for several more hour, the cells can be harvested by
centrifucation. Tlte cell
pellet obtained by the centrifugation can be solubilized using various agents
known in the art, and the
solubilized PRO polypeptide protein can then be purified using a metal
chclating column under conditions that
allow tight binding of the protein.
The PRO polypeptides may also be expressed in E. coli in a poly-His tagged
form. urine the following
procedure. Tlte DNA encoding a PRO polypeptide is initially amplified using
selected PCR primers. The
primers contain restriction enzyme sites which correspond to the restriction
enzyme sites on the selected
expression vector, and other useful sequences providing for efficient and
reliable translation initiation, rapid
purification on a metal chelation column. and proteolvtic removal with
enterokinase. The PCR-amplified.
poly-His taeged sequences are then ligated into an expression vector, which is
used to transform an E. coli host
based on strain 52 (W3110 tuhA(tonA) Ion galE rpoHts(htpKts) clpP(laclq).
Transformants are first grown in
LB containing 50 mgiml carbenicillin at 30'C with shaking until an O.D.600 of
3-S is reached. Cultures are
then diluted 50-100 fold into CRAP media (prepared by mixing 3.57 g (NH4)2504,
0.71 g sodium
citrate~2H20. 1.07 g KC1. 5.36 g Difco yeast extract, 5.36 g Sheffield hycase
SF in 500 mL water, as well as
110 mM MPOS, pH 7.3. O.SS% (w/v) glucose and 7 mM MgS04) and grown for
approximately 20-30 hours at
30'C with shaking. Samples are removed to verify expression by SDS-PAGE
analysis, and the bulk culture is
centrifuged to pellet the cells. Cell pellets are frozen until purification
and refolding.
E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets) is resuspended in
10 volumes (w/v) in 7 M
guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium
tetrathionate is added to make final
concentrations of O.IM and 0.02 M, respectively, and the solution is stirred
overnight at 4°C. This step results
in a denatured protein with all cysteine residues blocked by sulfitolization.
The solution is centrifuged at
40,000 rpm in a Beckman Ultracentifuge for 30 min. The supernatant is diluted
with 3-5 volumes of metal
chelate column buffer (6 M guanidine, 20 mM This, pH 7.4) and filtered through
0.22 micron filters to clarify.
154
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00153758 PCT/US00/05841
Depending on condition the clarified extract is loaded onto a S ml Qiagen Ni-
NTA metal chelate column
equilibrated in the metal chelate column buffer. The column is washed with
additional buffer containing 50
mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein is eluted with
buffer containing 250 mM
imidazole. Fractions containing the desired protein was pooled and stored at
4°C. Protein concentration is
estimated by its absorbance at 280 nm using the calculated extinction
coefficient based on its amino acid
sequence.
The proteins are refolded by diluting sample slowly into freshly prepared
refolding buffer consisting of:
20 mM Tris, pH 8.6. 0.3 M NaCI, 2.5 M urea, ~ mM cysteine. 20 mM glycine and 1
mM EDTA. Refolding
volumes are chosen so that the final protein concentration is between 50 to
100 microgramsiml. The refolding
solution is stirred gently at 4°C for 12-36 hours. The refolding
reaction is quenched by the addition of TFA to
a final concentration of 0.4% (pH of approximately 3). Before further
purification of the protein. the solution
is filtered through a 0.22 micron filter and acetonitrile is added to 2-10%
final concentration. The refolded
protein is chromatographed on a Poros RI/H reversed phase column using a
mobile buffer of 0.1% TFA with
elution with a gradient of acetonitrile from 10 to 80%. Aliquots of fractions
with A280 absorbance are
I S analyzed on SDS polyacrvlamide eels and fractions containine homogeneous
refolded protein are pooled.
Generally. the properly refolded species of most proteins are eluted at the
lowest concentrations of acetonitrile
since those species are the most compact with their hydrophobic interiors
shielded from interaction with the
reversed phase resin. Aggregated species are usually eluted at higher
acetonitrile concentrations. In addition
to resolving misfoldcd forms of proteins from the desired form, the reversed
phase step also removes endotoxin
from the samples.
Fractions containing the desired folded PRO polypeptide proteins are pooled
and the acetonitrile
removed using a gentle stream of nitrogen directed at the solution. Proteins
are formulated into 20 mM Hepes,
pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or by gel
filtration using G25 Superfine
(Pharmacial resins equilibrated in the formulation buffer and sterile
filtered.
EXAMPLE 10
Expression of the PRO polvpeptides in mammalian cells
This example illustrates preparation of a potentially glycosylated form of the
PRO polypeptide in
recombinant expression in mammalian cells.
The vector. pRKS (see EP 307,247, published March 15, 1989), is employed as
the expression vector.
Optionally, the PRO DNA is ligated into pRKS with selected restriction enzymes
to allow insertion of the
respective PRO DNA using ligation methods such as described in Sambrook et
al., supra. The resulting vector
is called, for example, pRKS-PRO.
In one embodiment, the selected host cells may be 293 cells. Human 293 cells
(ATCC CCL 1573) are
grown to confluence in tissue culture plates in medium such as DMEM
supplemented with fetal calf serum and
optionally, nutrient components and/or antibiotics. About 10 ltg of the pRKS-
PRO DNA is mixed with about 1
ltg DNA encoding the VARNA gene [Thimmappaya et al., Cell, 31:543 (1982)] and
dissolved in 500 uL of 1
mM Tris-HCI, 0.1 mM EDTA, 0.227 M CaCh. To this mixture is added, dropwise,
500 ~tL of 50 mM HEPES
(pH 7.35), 280 mM NaCI, 1.5 mM NaP04, and a precipitate is allowed to form for
10 minutes at 25°C. The
precipitate is suspended and added to the 293 cells and allowed to settle for
about four hours at 37°C. The
155
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for
30 seconds. The 293 cells are
then washed with serum free medium, fresh medium is added and the cells are
incubated for about 5 days.
Approximately 24 hours after the transfections, the culture medium is removed
and replaced with
culture medium (alone) or culture medium containing 200 uCi/ml ;SS-cysteine
and 200 uCi/ml ASS-methionine.
S After a 12 hour incubation, the conditioned medium is collected,
concentrated on a spin filter, and loaded onto
a 1 S% SDS gel. The processed gel may be dried and exposed to film for a
selected period of time to reveal the
presence of the polypeptide of the invention polypeptide. The cultures
containing transfected cells may
undergo further incubation (in serum free medium) and the medium is tested in
selected bioassays.
In an alternative technique, pRKS-PRO may be introduced into 293 cells
transiently using the dextran
l0 sulfate method described by Somparyrac et al., Proc. Natl. Acad. Sci.,
_12:7S7S (1981). 293 cells are crown to
maximal density in a spinner flask and 700 ttg ARKS-PRO is added. The cells
are first concentrated from the
spinner flask by centrifugation and washed with PBS. The DNA-dextran
precipitate is incubated on the cell
pellet for four hours. The cells are treated with 20% glycerol for 90 seconds,
washed with tissue culture
medium. and re-introduced into the spinner tlask containing tissue culture
medium, S ltg/ml bovine insulin and
I S 0.1 ue.~ml bovine transterrin. After about four days, the conditioned
media is centrituced and filtered to
remove cells and debris. Tlie sample containing the expressed polypeptide of
the invention can then be
concentrated and purified by any selected method. such as dialysis and.%or
column chromatography.
In another embodiment, the polypeptides of the invention can be expressed in
CHO cells. The pRKS
PRO can be transfected into CHO cells using known reagents such as CaP04 or
DEAF-dextran. As described
20 above, the cell cultures can be incubated. and the medium repiaced with
culture medium (alone) or medium
containing a radiolabel such as 'SS-methionine. After detetittining the
presence of a polypeptide of the
invention polypeptide. the culture medium may be replaced with serum free
medium. Preferably. the cultures
are incubated for about 6 days, and then the conditioned medium is harvested.
The medium containine the
expressed polypeptide of the invention can then be concentrated and purified
by any selected method.
2S Epitope-tae~ed polvpeptide of the invention may also be expressed in host
CHO cells. The DNA
encoding the desired polvpeptide of the invention may be subcloned out of the
ARKS vector. The subclone
insert can undergo PCR to fuse in frame woh a selected epitope tag such as a
poly-his tae into a Baculovitus
expression vector. The poly-his tagged polvpeptide of the invention insert can
then be subcloned into a SV40
driven vector containing a selection marker such as DHFR for selection of
stable clones. Finally, the CHO
30 cells can be transfected (as described above) with the SV40 driven vector.
Labeling may be performed, as
described above, to verify expression. Tlte culture medium containing the
expressed poly-His tagged
polypeptide of the invention can then be concentrated and purified by any
selected method, such as by Niz~-
chelate affinity chromatography.
156
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
EXAMPLE 11
Expression of PRO in Yeast
The following method describes recombinant expression of PRO in yeast.
First, yeast expression vectors are constructed for intracellular production
or secretion of the PRO
polypeptide from the ADH2/GAPDH promoter. DNA encoding a polypeptide of the
invention and the
promoter is inserted into suitable restriction enzyme sites in the selected
plasmid to direct intracellular
expression of the PRO. For secretion, DNA encoding the PRO can be cloned into
the selected plasmid,
together with DNA encoding the .ADH2/GAPDH promoter, a native sequence PRO
signal peptide or other
mammalian signal peptide, or, for example, a yeast alpha-factor or invertase
secretory signal/leader sequence.
and linker sequences (if needed) for expression of the polypeptide of the
invention.
Yeast cells. such as yeast strain AB l 10, can then be transformed with the
expression plasmids
described above and cultured in selected femrtentation media. Ttte transformed
yeast supernatants can be
analyzed by precipitation with 10% ttichloroacetic acid and separation by SDS-
PAGE, followed by staining of
the gels with Coomassie Blue stain.
Recombinant PRO can subsequently be isolated and purified by removing the
yeast cells from the
fermentation medium by centrifugation and then concentrating the medium using
selected cartridge tillers. The
concentrate containing the polvpeptide of the invention may further be
purified using selected column
chromatography resins.
EXAMPLE 12
Expression of PRO in Baculovirus-Infected Insect Cells
The following method describes recombinant expression of PRO in Baculovirus-
infected insect cells.
The sequence coding for PRO is fused upstream of an epitope tag contained
within a baculovirus
expression vector. Such epitope tags include poly-his tags and immunoglobulin
tags (like Fc regions of IgG).
A variety of plasmids may be employed. including plasmids derived from
commercially available plasmids
such as pVL1393 (Novagen). Briefly. the sequence encoding a polypepude of the
invention or the desired
portion of the coding sequence of the DNA encoding a PRO polypeptide [such as
the sequence encoding the
extracellular domain of a transmembrane protein or the sequence encoding the
mature protein if the protein is
extracellular] is amplified by PCR with primers complementary to the 5' and 3'
regions. The 5' primer may
incorporate flanking (selected) restriction enzyme sites. The product is then
digested with those selected
restriction enzymes and subcloned into the expression vector.
Recombinant baculovirus is generated by co-transfecting the above plasmid and
BaculoGoIdTV' virus
DNA (Phatmtingen) into Spodoptera ~ior~iperda ("Sft7") cells (ATCC CRL 1711)
using lipofectin
(commercially available from GIBCO-BRL). After 4 - 5 days of incubation at
28°C, the released viruses are
harvested and used for further amplifications. Viral infection and protein
expression are performed as
described by O'Reilley et al., Baculovirtrs expression vectors: A Laboratory
Manual, Oxford: Oxford
University Press ( 1994).
Expressed poly-his tagged polypeptide of the invention can then be purified,
for example, by Ni2+
chelate affinity chromatography as follows. Extracts are prepared from
recombinant virus-infected Sf~ cells as
described by Rupert et al.. Nature, 362:175-179 (1993). Briefly, Sf9 cells are
washed, resuspended in
157
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
sonication buffer (25 mL Hepes, pH 7.9: 12.5 mM MgCh; 0.1 mM EDT:; 10%
glycerol: 0.1°,~o NP-40; 0.4 M
KCl), and sonicated twice for 20 seconds on ice. The sonicates are cleared by
centrifugation, and the
supernatant is diluted 50-fold in loading buffer (SO mM phosphate, 300 mM
NaCI. 10% glycerol, pH 7.8) and
filtered through a 0.45 um filter. A Niz+-NTA agarose column (commercially
available from Qiagen) is
S prepared with a bed volume of 5 mL, washed with 25 mL of water and
equilibrated with 25 mL of loading
buffer. The filtered cell extract is loaded onto the column at 0.5 mL per
minute. The column is washed to
baseline A,BO with loading buffer, at which point fraction collection is
started. Next, the column is washed with
a secondary wash buffer (50 mM phosphate: 300 mM NaCI, 10% glycerol. pH 6.0),
which elutes
nonspecifically bound protein. After reaching A~$o baseline again, the column
is developed with a 0 to 500
mM Imidazole gradient in the secondary wash buffer. One mL fractions are
collected and analyzed by SDS-
PAGE and silver staining or Western blot with Ni''-NTA-conjugated to alkaline
phosphatase ('Qiagen).
Fractions containing the eluted His,o-tagged- polypeptide of the invention are
pooled and dialyzed against
loading buffer.
Alternatively, purification of the IgG tagged (or Fc tagged) PRO polvpeptide
can be performed using
I S known chromatotraphv techniques, including for instance. Protein A or
protein G column chromatography.
EXAMPLE 13
Preparation of Antibodies that Bind PRO
This example illustrates preparation of monoclonal antibodies which can
specifically bind the
polypeptides of the invention.
Techniques for producing the monoclonal antibodies are known in the art and
are described, for
instance. in Goding, supra. Immunogens that may be employed include the
purified polypeptide of the
invention itself. fusion proteins containing the respective polypeptide of the
invention, and cells
expressing recombinant polypeptide of the invention on the cell surface.
Selection of the immunogen can be
made by the skilled artisan without undue experimentation.
Mice. such as Balbic, arc immunized with the polvpeptide of the invention
immunogen emulsified in
complete Frcund's adjuvant and injected subcutaneously or intraperitoneally in
an amount from 1-100
micrograms. Alternatively, the immunogen is emulsified in MPL-TDM adjuvant
(Ribi Immunochemical
Research. Hamilton. MT) and injected into the animal's hind foot pads. The
immunized mice are then boosted
10 to 12 days later with additional immunogen emulsified in the selected
adjuvant. Thereafrer, for several
weeks. the mice may also be boosted with additional immunization injections.
Serum samples may be
periodically obtained from the mice by retro-orbital bleeding for testing in
ELISA assays to detect antibodies
specific to the respective polypeptide of the invention.
After a suitable antibody titer has been detected, the animals "positive" for
antibodies can be injected
with a final intravenous injection of the respective polypeptide of the
invention. Three to four days later, the
mice are sacrificed and the spleen cells are harvested. The spleen cells are
then fused (using 35% polyethylene
glycol) to a selected murine myeloma cell line such as P3X63AgU.l, available
from ATCC, No. CRL 1597.
The fusions generate hybridoma cells which can then be plated in 96 well
tissue culture plates containing HAT
(hypoxanthine, aminopterin, and thymidine) medium to inhibit proliferation of
non-fused cells, myeloma
hybrids, and spleen cell hybrids.
158
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
The hybtidoma cells are screened in an ELISA for reactivity against the
respective poivpeptide of the
invention. Determination of "positive" hybridoma cells secreting the desired
monoclonal antibodies against the
polypeptides of the invention is within the skill in the art.
The positive hybridoma cells can be injected intraperitoneally into syngeneic
Balb/c mice to produce
ascites containing the anti-PR0200, anti-PR0204, anti-PR0212, anti-PR0216,
anti-PR0226, anti-PR0240,
anti-PR0235. anti-PR0245, anti-PR0172, anti-PR0273, anti-PR0272, anti-PR0332,
anti-PR0526, anti
PR0701, anti-PR0361, anti-PR0362. anti-PR0363, anti-PR0364, anti-PR0356, anti-
PR0531, anti-PR0533,
anti-PR01083. anti-PR0865, anti-PR0770, anti-PR0769, anti-PR0788, anti-
PR01114. anti-PR01007, anti
PR01184, anti-PR01031, anti-PR01346, anti-PR01155, anti-PR01250, anti-PR01312,
anti-PR01192, anti
PR01246, anti-PR01283, anti-PR01195, anti-PR01343, anti-PR01418, anti-PR01387,
anti-PR01410, anti-
PR01917, anti-PR01868, anti-PR0205, anti-PR021. anti-PR0269, anti-PR0344, anti-
PR0333, anti-PR0381,
anti-PR0720, anti-PR0866, anti-PR0840, anti-PR0982, anti-PR0836, anti-PR01159,
anti-PR01358, anti-
PR01325, anti-PR01338, anti-PR01434, anti-PR04333, anti-PR04302, anti-PR04430
or anti-PR05727
monoclonal antibodies. Alternatively, the hybridoma cells can be grown in
tissue culture flasks or roller
bottles. Purification of the monoclonal antibodies produced in the ascites can
be accomplished using
ammonium sulfate precipitation. followed by gel exclusion chromatography.
Alternatively, affinity
chromatography based upon binding of antibody to protein A or protein G can be
empioyed.
Deposit of Material
The following materials have been deposited with the American Type Culture
Collection. 10801
University Blvd.. Manassas, VA 20110-2209, USA (ATCC):
Material ~ PRO ATCC # ATCC Deposit
Date
DNA29101-1276174 200 209653 March 5, 1998
25DNA30871-1157178 204 209380 October 16,
1997
DNA30942-1 186 ' 209254 September
134 12 16. 1997
DNA33087-1158190 216 209381 October 16,
1997
DNA33460-1166200 226 209376 October 16,
1997
DNA34387-1133214 240 209260 September
16, 1997
30DNA35558-1167209 235 209374 October 16,
1997
DNA35638-1141219 245 209265 September
16, 1997
DNA35916-1161146 172 209419 October 28,
1997
DNA39523-1192240 273 209424 October 31,
1997
DNA40620-I 239 272 209388 October 17,
183 1997
35DNA40982-1235293 332 209433 November 17,
1997
DNA44184-1319330 526 209704 March 26,
1998
DNA44205-1285365 701 209720 March 31,
1998
DNA45410-1250316 361 209621 Febniary 5,
1998
DNA45416-1251317 362 209620 February 5,
1998
40DNA45419-1252318 363 209616 February 5,
1998
159
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
DNA47365-1206319 364 209436 November 7,
1997
DNA47470-1130313 356 209422 October 28,
1997
DNA48314-1320332 531 209702 March 26. 1998
DNA49435-1219334 533 209480 November 21,
1997
S DNA50921-1458540 1083 209859 May 12, 1998
DNA53974-1401434 865 209774 April 14, 1998
DNA54228-1366408 770 209801 Apri123, 1998
DNA54231-1366407 769 209802 April 23, 1998
DNA56405-1357430 788 209849 May 6, 1998
DNA57033-1403557 1114 209905 May 27, 1998
DNA57690-1374491 1007 209950 June 9, 1998
DNA59220-1514598 1184 209962 June 9, 1998
DNAS9294-1381516 1031 209866 May 14, 1998
DNA59776-1600701 1346 203128 August l8,
1998
DNA59849-1504585 1155 209986 June 16, 1998
DNA60775-1532633 1250 203173 September l,
1998
DNA61873-1574678 1312 203132 August l8.
1998
DNA62814-1521606 1192 203093 August 4, 1998
DNA64885-1529630 1246 203457 November 3,
1998
DNA65404-1551653 1283 203244 September 9,
1998
DNA65412-1523608 1195 203094 August 4, 1998
DNA66675-1587698 1343 203282 September 22,
1998
DNA68864-1629732 1418 203276 September 22,
1998
DNA68872-1620722 1387 203160 August 25.
1998
DNA68874-1622728 1410 203277 September 22.
1998
DNA76-100-2528900 t '_03573 lanuarv 12.
917 1999
DNA77624-2515859 1868 203553 December 22,
1998
DNA30868-1156179 205 ------ March 2, 2000
DNA36638-105621 21 209456 November 12,
1997
DNA38260-1180236 269 209397 October 17,
1997
DNA40592-1242303 344 209492 November 21,
1997
DNA41374-1312294 333 ------_ ___~______
DNA44194-1317322 381 209808 Apri128, 1998
DNA53517-1366388 720 209802 Apri123.1998
DNA53971-1359435 866 209750 April7, 1998
DNA53987-1438433 840 209858 May 12, 1998
DNA57700-1408483 982 203583 January 12,
1999
DNA59620-1463545 836 209989 June 16, 1998
DNA60627-1508589 1159 203092 August 4, 1998
DNA64890-1612707 1358 203131 August 18,
1998
160
SUBSTITUTE SHEET (RULE 26)
CA 02362427 2001-08-17
WO 00/53758 PCT/US00/05841
DNA66659-1593 685 1325 203269 September
22, 1998
DNA66667-1596 693 1338 203267 September
22, 1998
DNA68818-2536 739 1434 203657 February 9,
1999
DNA84210-2576 1888 4333 203818 March 2, 1999
DNA92218-25541866 4302 203834 March 9, 1999
DNA96878-2626 1947 4430 23-PTA May S, 1999
DNA98853-1739 2448 5727 203906 April6, 1999
These deposits was made under the provisions of the Budapest Treaty on the
International
Recognition of the Deposit of Microorganisms for the Purpose of Patent
Procedure and the Regulations
thereunder (Budapest Treaty). This assures maintenance of a viable culture of
the deposit for 30 years from the
date of deposit. The deposit will be made available by ATCC under the terms of
the Budapest Treaty, and
subject to an agreement bettveen Genentech, Inc. and ATCC, which assures
permanent and unrestricted
availability of the progeny of the culture of the deposit to the public upon
issuance of the pertinent U.S. patent
I S or upon laying open to the public of anv U.S. or foreign patent
application, whichever comes first. and assures
availability of the progeny to one determined by~ the U.S. Commissioner of
Patents and Trademarks to be
entitled thereto according to 35 USC 122 and the Commissioner's rules pursuant
thereto (including 37 CFR
1.14 with particular reference to 886 OG 638).
The assignee of the present application has agreed that if a culture of the
materials on deposit should
die or be lost or destroyed when cultivated under suitable conditions, the
materials will be promptly replaced
on notification with another of the same. Availability of the deposited
material is not to be construed as a
license to practice the invention in contravention of the rights granted under
the authority of any government in
accordance with its patent laws.
The foregoing written specification is considered to be sufficient to enable
one skilled in the art to
practice the invention. The present invention is not to be limited in scope by
the construct deposited. since the
deposited embodiment is intended as a single illustration of certain aspects
of the invention and any constructs
that are functionally equivalent are within the scope of this invention. Tlte
deposit of material herein does not
constitute an admission that the written description herein contained is
inadequate to enable the practice of any
aspect of the invention, including the best mode thereof, nor is it to be
construed as limiting the scope of the
claims to the specific illustrations that it represents. Indeed, various
modifications of the invention in addition
to those shown and described herein will become apparent to those skilled in
the art from the foregoing
description and fall within the scope of the appended claims.
161
SUBSTITUTE SHEET (RULE 26)
