Language selection

Search

Patent 2362929 Summary

Third-party information liability

Some of the information on this Web page has been provided by external sources. The Government of Canada is not responsible for the accuracy, reliability or currency of the information supplied by external sources. Users wishing to rely upon this information should consult directly with the source of the information. Content provided by external sources is not subject to official languages, privacy and accessibility requirements.

Claims and Abstract availability

Any discrepancies in the text and image of the Claims and Abstract are due to differing posting times. Text of the Claims and Abstract are posted:

  • At the time the application is open to public inspection;
  • At the time of issue of the patent (grant).
(12) Patent Application: (11) CA 2362929
(54) English Title: TUMOR NECROSIS FACTOR RECEPTORS 6.ALPHA. AND 6.BETA.
(54) French Title: RECEPTEURS DU FACTEUR DE NECROSE TUMORALE 6 ALPHA ET 6 BETA
Status: Dead
Bibliographic Data
(51) International Patent Classification (IPC):
  • C12N 15/28 (2006.01)
  • A61K 38/17 (2006.01)
  • A61K 38/19 (2006.01)
  • A61K 48/00 (2006.01)
  • C07K 14/715 (2006.01)
  • C07K 16/28 (2006.01)
  • C12N 15/12 (2006.01)
(72) Inventors :
  • GENTZ, REINER L. (United States of America)
  • NI, JIAN (United States of America)
  • EBNER, REINHARD (United States of America)
  • YU, GUO-LIANG (United States of America)
  • RUBEN, STEVEN M. (United States of America)
  • FENG, PING (United States of America)
(73) Owners :
  • HUMAN GENOME SCIENCES, INC. (United States of America)
(71) Applicants :
  • HUMAN GENOME SCIENCES, INC. (United States of America)
(74) Agent: MBM INTELLECTUAL PROPERTY LAW LLP
(74) Associate agent:
(45) Issued:
(86) PCT Filing Date: 2000-03-03
(87) Open to Public Inspection: 2000-09-08
Examination requested: 2005-02-04
Availability of licence: N/A
(25) Language of filing: English

Patent Cooperation Treaty (PCT): Yes
(86) PCT Filing Number: PCT/US2000/005686
(87) International Publication Number: WO2000/052028
(85) National Entry: 2001-08-16

(30) Application Priority Data:
Application No. Country/Territory Date
60/121,774 United States of America 1999-03-04
60/124,092 United States of America 1999-03-12
60/131,279 United States of America 1999-04-27
60/131,964 United States of America 1999-04-30
60/146,371 United States of America 1999-08-02
60/168,235 United States of America 1999-12-01

Abstracts

English Abstract




The present invention relates to novel Tumor Necrosis Factor Receptor
proteins. In particular, isolated nucleic acid molecules are provided encoding
the human TNFR-6.alpha. and -6.beta. proteins. TNFR-6.alpha. and -6.beta.
polypeptides are also provided as are vectors, host cells and recombinant
methods for producing the same. The invention further relates to screening
methods for identifying agonists and antagonists of TNFR-6.alpha. and -6.beta.
activity. Also provided are diagnostic methods for detecting immune system-
related disorders and therapeutic methods for treating immune system-related
disorders.


French Abstract

La présente invention concerne de nouvelles protéines réceptrices du facteur de nécrose tumorale (protéines TNFR). En particulier, elle se rapporte à des molécules d'acide nucléique isolées codant les protéines TNFR 6.alpha. et 6.beta.. L'invention concerne également des polypeptides TNFR 6.alpha. et 6.beta. ainsi que des vecteurs, de cellules hôtes et des procédés de recombinaison pour les produire. En outre, l'invention porte sur des méthodes de sélection utilisées pour identifier les agonistes et les antagonistes de l'activité des TNFR 6.alpha. et 6.beta.. L'invention porte également sur des méthodes diagnostiques utilisées pour déceler les troubles liés au système immunitaire ainsi que sur des moyens thérapeutiques permettant de traiter ces troubles.

Claims

Note: Claims are shown in the official language in which they were submitted.





283

What Is Claimed Is:

1. ~An isolated nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence at least 80%, 85%, 90%, or 95% identical to a sequence
selected from the
group consisting of:
(a) a nucleotide sequence encoding a TNFR polypeptide having the complete
amino
acid sequence in SEQ ID NO:2 or 4 or as encoded by a cDNA clone contained in
ATCC
Deposit No. 97810 or 97809;
(b) a nucleotide sequence encoding a mature TNFR polypeptide having an amino
acid
sequence at positions 31-300 or 31-170 in SEQ ID NO:2 or 4, respectively, or
as encoded by
the cDNA clone contained in the ATCC Deposit No. 97810 or 97809;
(c) a nucleotide sequence encoding the soluble extracellular domain of a TNFR
polypeptide having the amino acid sequence at positions 31-283 or 31-166 of
SEQ ID NOS:2
and 4, respectively; and
(d) a nucleotide sequence complementary to any of the nucleotide sequences in
(a), (b)
or (c) above.

2. The nucleic acid molecule of claim 1 wherein said polynucleotide has a
complete nucleotide sequence selected from the group consisting of SEQ ID NO:
1 and SEQ
ID NO:3.

3. The nucleic acid molecule of claim 1 wherein said polynucleotide has a
nucleotide sequence which encodes a TNFR polypeptide having a complete amino
acid
sequence selected from the group consisting of SEQ ID NO:2 and SEQ ID NO:4.

4. The nucleic acid molecule of claim 1 wherein said polynucleotide has a
nucleotide sequence encoding the mature form of a TNFR polypeptide having an
amino acid
sequence from about 31 to about 300 in SEQ ID NO:2 or from about 31 to about
170 in SEQ
ID NO:4.



284

5. ~The nucleic acid molecule of claim 1 wherein said polynucleotide has a
nucleotide sequence encoding the soluble extracellular domain of a TNFR
polypeptide having
the amino acid sequence from about 31 to about 283 in SEQ ID NO:2 or from
about 31 to
about 166 of SEQ ID NO:4.

6. ~An isolated nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence at least 80%, 85%, 90%, or 95% identical to a sequence
selected from the
group consisting of:
(a) ~a nucleotide sequence encoding a polypeptide comprising the amino acid
sequence of residues m-300 of SEQ ID NO:2, where n is an integer in the range
of 1-49;
(b) ~a nucleotide sequence encoding a polypeptide comprising the amino acid
sequence of residues n-170 of SEQ ID NO:4, where n is an integer in the range
of 1-49;
(c) ~a nucleotide sequence encoding a polypeptide comprising the amino acid
sequence of residues 1-y of SEQ ID NO:2, where y is an integer in the range of
193-300;
(d) ~a nucleotide sequence encoding a polypeptide comprising the amino acid
sequence of residues 1-z of SEQ ID NO:4, where z is an integer in the range of
132-170; and
(e) ~a nucleotide sequence encoding a polypeptide having the amino acid
sequence
consisting of residues m-y of SEQ ID NO:2 or n-z of SEQ ID NO:4 as m, n, y and
z are
defined in (a), (b), (c) and (d), above.

7. ~An isolated nucleic acid molecule comprising a polynucleotide having a
nucleotide sequence at least 80%, 85%, 90%, or 95% identical to a sequence
selected from the
group consisting of:
(a) ~a nucleotide sequence encoding a polypeptide consisting of a portion of a
complete TNFR amino acid sequence encoded by a cDNA clone contained in ATCC
Deposit
No. 97810 or 97809 wherein said portion excludes from 1 to about 48 amino
acids from the
amino terminus of said complete amino acid sequence encoded by the cDNA clone
contained
in ATCC Deposit No. 97810 and 97809;
(b) ~a nucleotide sequence encoding a polypeptide consisting of a portion of a
complete TNFR amino acid sequence encoded by a cDNA clone contained in ATCC
Deposit
No. 97810 or 97809 wherein said portion excludes from 1 to about 107 and from
1 to about



285

38 amino acids from the carboxy terminus of said complete amino acid sequence
encoded by
the cDNA clone contained in ATCC Deposit No. 97810 and 97809, respectively;
and
(c) a nucleotide sequence encoding a polypeptide consisting of a portion of a
complete
TNFR amino acid sequence encoded by the cDNA clone contained in ATCC Deposit
No.
97810 or 97809, wherein said portion includes a combination of any of the
amino terminal
and carboxy terminal deletions for the respective clones in (a) and (b),
above.

8. The nucleic acid molecule of claim 1 wherein said polynucleotide has the
complete nucleotide sequence of the cDNA clone contained in ATCC Deposit No.
97810 or
97809.

9. The nucleic acid molecule of claim 1 wherein said polynucleotide has the
nucleotide sequence encoding a TNFR polypeptide having the complete amino acid
sequence
encoded by the cDNA clone contained in ATCC Deposit No. 97810 or 97809.

10. The nucleic acid molecule of claim 1 wherein said polynucleotide has the
nucleotide sequence encoding a mature TNFR polypeptide having the amino acid
sequence
encoded by the cDNA clone contained in ATCC Deposit No. 97810 or 97809.

11. An isolated nucleic acid molecule comprising a polynucleotide which
hybridizes under stringent hybridization conditions to a polynucleotide having
a nucleotide
sequence identical to a nucleotide sequence in (a), (b), (c) or (d) of claim 1
wherein said
polynucleotide which hybridizes does not hybridize under stringent
hybridization conditions
to a polynucleotide having a nucleotide sequence consisting of only A residues
or of only T
residues.

12. An isolated nucleic acid molecule comprising a polynucleotide which
encodes
the amino acid sequence of an epitope-bearing portion of a TNFR polypeptide
having an
amino acid sequence in (a), (b), (c) or (d) of claim 1.



286

13. The isolated nucleic acid molecule of claim 12, which encodes an
epitope-bearing portion of a TNFR polypeptide comprising amino acid residues
selected
from the group consisting of: from about Ala-31 to about Thr-46 in SEQ ID
NO:2, from
about Phe-57 to about Thr-117 in SEQ ID NO:2, from about Cys-132 to about Thr-
175 in
SEQ ID NO:2, from about Gly-185 to about Thr-194 in SEQ ID NO:2, from about
Val-205
to about Asp-217 in SEQ ID NO:2, from about Pro-239 to about Leu-264 in SEQ ID
NO:2,
and from about Ala-283 to about Pro-298 in SEQ ID NO:2, from about Ala-31 to
about Thr-
46 in SEQ ID NO:4, from about Phe-57 to about Gln-80 in SEQ ID NO:4, from
about Glu-86
to about His-106 in SEQ ID NO:4, from about Thr-108 to about Phe-119 in SEQ ID
NO:4,
from about His-129 to about Val-138 in SEQ ID NO:4, and from about Gly-142 to
about
Pro-166 in SEQ ID NO:4.

14. A method for making a recombinant vector comprising inserting an isolated
nucleic acid molecule of claim 1 into a vector.

15. A recombinant vector produced by the method of claim 14.

16. A method of making a recombinant host cell comprising introducing the
recombinant vector of claim 15 into a host cell.

17. A recombinant host cell produced by the method of claim 16.

18. A recombinant method for producing a TNFR polypeptide, comprising
culturing the recombinant host cell of claim 17 under conditions such that
said polypeptide is
expressed and recovering said polypeptide.

19. An isolated TNFR polypeptide comprising an amino acid sequence at least
80%, 85%, 90%, or 95% identical to a sequence selected from the group
consisting of:
(a) the amino acid sequence of a full-length TNFR polypeptide having the
complete amino acid sequence shown in SEQ ID NO:2 or 4, or as encoded by a
cDNA clone
contained in ATCC Deposit No. 97810 or 97809;



287

(b) the amino acid sequence of a mature TNFR polypeptide having the amino acid
sequence at positions 31-300 in SEQ ID NO:2 or 31-170 in SEQ ID NO:4, or as
encoded by a
cDNA clone contained in ATCC Deposit No. 97810 or 97809; or
(c) the amino acid sequence of a soluble extracellular domain of a TNFR
polypeptide having the amino acid sequence at positions 31 to 283 in SEQ ID
NO:2 or 31 to
166 in SEQ ID NO:4, or as encoded by the cDNA clone contained in ATCC Deposit
No.
97810 or 97809.

20. An isolated polypeptide comprising an epitope-bearing portion of the TNFR
protein, wherein said portion is selected from the group consisting of a
polypeptide
comprising amino acid residues: from about Ala-31 to about Thr-46 in SEQ ID
NO:2, from
about Phe-57 to about Thr-117 in SEQ ID NO:2, from about Cys-132 to about Thr-
175 in
SEQ ID NO:2, from about Gly-185 to about Thr-194 in SEQ ID NO:2, from about
Val-205
to about Asp-217 in SEQ ID NO:2, from about Pro-239 to about Leu-264 in SEQ ID
NO:2,
and from about Ala-283 to about Pro-298 in SEQ ID NO:2, from about Ala-31 to
about Thr-
46 in SEQ ID NO:4, from about Phe-57 to about Gln-80 in SEQ ID NO:4, from
about Glu-86
to about His-106 in SEQ ID NO:4, from about Thr-108 to about Phe-119 in SEQ ID
NO:4,
from about His-129 to about Val-138 in SEQ ID NO:4, and from about Gly-142 to
about
Pro-166 in SEQ ID NO:4.

21. An isolated antibody that binds specifically to a TNFR polypeptide of
claim
19.

22. A method of treating a patient in need of TNFR polypeptide activity
comprising administering to the patient the TNFR polypeptide of claim 19.

23. A method of treating a patient in need of TNFR polypeptide activity
comprising administering to the patient a nucleic acid of claim 1.

Description

Note: Descriptions are shown in the official language in which they were submitted.




CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
TUMOR NECROSIS FACTOR RECEPTORS 6a & 6(3
Field of the Invention
The present invention relates to novel human genes encoding
polypeptides which are members of the TNF receptor family. More
specifically, isolated nucleic acid molecules are provided encoding human
polypeptides named tumor necrosis factor receptor-6a & -6(3 hereinafter
sometimes referred to as "TNFR-6a, & TNFR-6(3" or generically as "TNFR
polypeptides". TNFR polypeptides are also provided, as are vectors, host
cells and recombinant methods for producing the same. The invention further
1 o relates to screening methods for identifying agonists and antagonists of
TNFR polypeptide activity. Also provided are diagnostic and therapeutic
methods utilizing such compositions.
Background of the Invention
Many biological actions, for instance, response to certain stimuli and
natural biological processes, are controlled by factors, such as cytokines.
Many cytokines act through receptors by engaging the receptor and producing
an intra-cellular response.
For example, tumor necrosis factors (TNF) alpha and beta are
cytokines which act through TNF receptors to regulate numerous biological
2o processes, including protection against infection and induction of shock
and
inflammatory disease. The TNF molecules belong to the "TNF-ligand"
superfamily, and act together with their receptors or counter-ligands, the
"TNF-receptor" superfamily. So far, nine members of the TNF ligand
superfamily have been identified and ten members of the TNF-receptor
superfamily have been characterized.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
Among the ligands there are included TNF-a, lymphotoxin-a (LT-a,
also known as TNF-(3), LT-(3 (found in complex heterotrimer LT-a2-~3 ),
Fast, CD40L, CD27L, CD30L, 4-1BBL, OX40L and nerve growth factor
(NGF). The superfamily of TNF receptors includes the p55TNF receptor,
p75TNF receptor, TNF receptor-related protein, FAS antigen or APO-l,
CD40, CD27, CD30, 4-1BB, OX40, low affinity p75 and NGF-receptor
(Meager, A., Biologicals, 22:291-295 (1994)).
Many members of the TNF-ligand superfamily are expressed by
activated T-cells, implying that they are necessary for T-cell interactions
with
other cell types which underlie cell ontogeny and functions. (Meager, A.,
supra).
Considerable insight into the essential functions of several members of
the TNF receptor family has been gained from the identification and creation
of mutants that abolish the expression of these proteins. For example,
naturally occurring mutations in the FAS antigen and its ligand cause
lymphoproliferative disease (Watanabe-Fukunaga, R., et al., Nature 356:314
( 1992)), perhaps reflecting a failure of programmed cell death. Mutations of
the CD40 ligand cause an X-linked immunodeficiency state characterized by
high levels of immunoglobulin M and low levels of immunoglobulin G in
2o plasma, indicating faulty T-cell-dependent B-cell activation (Allen, R.C.
et al.,
Science 259:990 (1993)). Targeted mutations of the low affinity nerve growth
factor receptor cause a disorder characterized by faulty sensory innovation of
peripheral structures (Lee, K.F. et al., Cell 69:737 (1992)).
TNF and LT-a are capable of binding to two TNF receptors (the 55-
and 75-kd TNF receptors). A large number of biological effects elicited by
TNF and LT-a, acting through their receptors, include hemorrhagic necrosis of
transplanted tumors, cytotoxicity, a role in endotoxic shock, inflammation,
immunoregulation, proliferation and anti-viral responses, as well as
protection



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
3
against the deleterious effects of ionizing radiation. TNF and LT-a are
involved in the pathogenesis of a wide range of diseases, including endotoxic
shock, cerebral malaria, tumors, autoimmune disease, AIDS and graft-host
rejection (Beutler, B. and Von Huffel, C., Science 264:667-668 (1994)).
Mutations in the p55 Receptor cause increased susceptibility to microbial
infection.
Moreover, an about 80 amino acid domain near the C-terminus of
TNFRI (p55) and Fas was reported as the "death domain," which is
responsible for transducing signals for programmed cell death (Tartaglia et
al.,
1o Cell 74:845 (1993)). Apoptosis, or programmed cell death, is a physiologic
process essential to the normal development and homeostasis of multicellular
organisms (H. Steller, Science 267, 1445-1449 (1995)). Derangements of
apoptosis contribute to the pathogenesis of several human diseases including
cancer, neurodegenerative disorders, and acquired immune deficiency syndrome
(C.B. Thompson, Science 267, 1456-1462 (1995)). Recently, much attention
has focused on the signal transduction and biological function of two cell
surface death receptors, Fas/APO-1 and TNFR-1 (J.L. Cleveland, J.N. Ihle,
Cell 81, 479-482 (1995); A. Fraser, G. Evan, Cell 85, 781-784 (1996); S.
Nagata, P. Golstein, Science 267, 1449-56 ( 1995)). Both are members of the
2o TNF receptor family which also include TNFR-2, low affinity NGFR, CD40,
and CD30, among others (C.A. Smith, et al., Science 248, 1019-23 (1990); M
Tewari, V.M. Dixit, in Modular Texts in Molecular and Cell Biology M.
Purton, Heldin, Carl, Ed. (Chapman and Hall, London, 1995). While family
members are defined by the presence of cysteine-rich repeats in their
extracellular domains, Fas/APO-1 and TNFR-1 also share a region of
intracellular homology, appropriately designated the "death domain", which is
distantly related to the Drosophila suicide gene, reaper (P. Golstein, D.
Marguet, V. Depraetere, Cell 81, 185-6 (1995); K. White et al., Science 264,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
4
677-83 ( 1994)). This shared death domain suggests that both receptors
interact with a related set of signal transducing molecules that, until
recently,
remained unidentified. Activation of Fas/APO-1 recruits the death
domain-containing adapter molecule FADD/MORT 1 (A.M. Chinnaiyan, K.
O'Rourke, M. Tewari, V. M. Dixit, Cell 81, 505-12 ( 1995); M. P. Boldin, et
al., J. Biol Chem 270, 7795-8 ( 1995); F.C. Kischkel, et al., EMBO 14, 5579-
5588 (1995)), which in turn binds and presumably activates FLICE/MACH1,
a member of the ICE/CED-3 family of pro-apoptotic proteases (M. Muzio et
al., Cell 85, 817-827 (1996); M.P. Boldin, T.M. Goncharov, Y.V. Goltsev, D.
1o Wallach, Cell 85, 803-815 (1996)). While the central role of Fas/APO-1 is
to
trigger cell death, TNFR-1 can signal an array of diverse biological
activities-many of which stem from its ability to activate NF-kB (L.A.
Tartaglia, D.V. Goeddel, Immunol Today 13, 151-3 (1992)). Accordingly,
TNFR-1 recruits the multivalent adapter molecule TRADD, which like
FADD, also contains a death domain (H. Hsu, J. Xiong, D.V. Goeddel, Cell
81, 495-504 (1995); H. Hsu, H.-B. Shu, M.-P. Pan, D.V. Goeddel, Cell 84,
299-308 ( 1996)). Through its associations with a number of signaling
molecules including FADD, TRAF2, and RIP, TRADD can signal both
apoptosis and NF-kB activation (H. Hsu, H.-B. Shu, M.-P. Pan, D.V.
2o Goeddel, Cell 84, 299-308 (1996); H. Hsu, J. Huang, H.-B. Shu, V. Baichwal,
D.V. Goeddel, Immunity 4, 387-396 (1996)).
The effects of TNF family ligands and TNF family receptors are varied
and influence numerous functions, both normal and abnormal, in the biological
processes of the mammalian system. There is a clear need, therefore, for
identification and characterization of such receptors and ligands that
influence
biological activity, both normally and in disease states. In particular, there
is a
need to isolate and characterize novel members of the TNF receptor family.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
Summary of the Invention
The present invention provides isolated nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide encoding at least
a
portion of a TNFR (i.e., TNFR-6a or TNFR-6(3 polypeptide) having the
complete amino acid sequences shown in SEQ ID NOS:2 and 4, respectively,
or the complete amino acid sequence encoded by a cDNA clone deposited as
plasmid DNA as ATCC Deposit Number 97810 and 97809, respectively. The
nucleotide sequence determined by sequencing the deposited TNFR-6 alpha
and TNFR-6 beta clones, which are shown in Figures 1 and 2 (SEQ ID NOS:1
l0 and 3, respectively), contain open reading frames encoding complete
polypeptides of 300 and 170 amino acid residues, respectively, including an
initiation codon encoding an N-terminal methionine at nucleotide positions 25-
27 and 73-75 in SEQ ID NOS: 1 and 3, respectively.
The TNFR proteins of the present invention share sequence homology
with other TNF receptors. Splice variants TNFR-6 alpha and TNFR-6 beta
show the highest degree of sequence homology with the translation products
of the human mRNAs for TNFR-I and -II (Figure 3) (SEQ ID NOS:S and 6,
respectively) also including multiple conserved cysteine rich domains.
The TNFR-6 alpha and TNFR-6 beta polypeptides have predicted
leader sequences of 30 amino acids each; and the amino acid sequence of the
predicted mature TNFR-6 alpha and TNFR-6 beta polypeptides are also
shown in Figures 1 and 2 as amino acid residues 31-300 (SEQ ID N0:2) and
31-170 (SEQ ID N0:4), respectively.
Thus, one aspect of the invention provides an isolated nucleic acid
molecule comprising, or alternatively consisting of, a polynucleotide having a
nucleotide sequence selected from the group consisting o~ (a) a nucleotide
sequence encoding a TNFR polypeptide having the complete amino acid
sequence in SEQ ID N0:2 or 4, or as encoded by the cDNA clone contained in



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
ATCC Deposit No. 97810 or 97809; (b) a nucleotide sequence encoding a
mature TNFR polypeptide having the amino acid sequence at positions 31-
300 in SEQ ID N0:2, or 31-170 in SEQ ID N0:4, or as encoded by the cDNA
clone contained in ATCC Deposit No. 97810 or 97809; (c) a nucleotide
sequence encoding a soluble extracellular domain of a TNFR polypeptide
having the amino acid sequence at positions 31 to 283 in SEQ ID N0:2 or 31
to 166 in SEQ ID N0:4, or as encoded by the cDNA clone contained in the
ATCC Deposit No. 97810 or 97809; (d) a nucleotide sequence encoding a
fragment of a TNFR polypeptide having the amino acid sequence at positions
31 to 283 in SEQ ID N0:2 or 31 to 166 in SEQ ID N0:4, or as encoded by the
cDNA clone contained in the ATCC Deposit No. 97810 or 97809 wherein
said fragment has TNFR-6a and/or TNFR-6(3 functional activity; and (e) a
nucleotide sequence complementary to any of the nucleotide sequences in (a),
(b), (c), or (d) above.
Further embodiments of the invention include isolated nucleic acid
molecules that comprise, or alternatively consist of, a polynucleotide having
a
nucleotide sequence at least 90% identical, and more preferably at least 80%,
85%, 90%, 92%, or 95%, 96%, 97%, 98% or 99% identical, to any of the
nucleotide sequences in (a), (b), (c), (d) and (e) above, or a polynucleotide
2o which hybridizes under stringent hybridization conditions to a
polynucleotide
in (a), (b), (c), (d), or (e) above. This polynucleotide which hybridizes does
not hybridize under stringent hybridization conditions to a polynucleotide
having a nucleotide sequence consisting of only A residues or of only T
residues. An additional nucleic acid embodiment of the invention relates to an
isolated nucleic acid molecule comprising, or alternatively consisting of, a
polynucleotide which encodes the amino acid sequence of an epitope-bearing
portion of a TNFR polypeptide having an amino acid sequence in (a), (b), (c),
or (d) above.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
7
The present invention also relates to recombinant vectors, which
include the isolated nucleic acid molecules of the present invention, and to
host
cells containing the recombinant vectors, as well as to methods of making such
vectors and host cells and for using them for production of TNFR
polypeptides or peptides by recombinant techniques.
The invention further provides an isolated TNFR polypeptide
comprising an amino acid sequence selected from the group consisting of: (a)
the amino acid sequence of a full-length TNFR polypeptide having the
complete amino acid sequence shown in SEQ ID N0:2 or 4 or as encoded by
1o the cDNA clone contained in ATCC Deposit No. 97810 or 97809; (b) the
amino acid sequence of a mature TNFR polypeptide having the amino acid
sequence at positions 31-300 in SEQ ID N0:2, or 31-170 in SEQ ID N0:4, or
as encoded by the cDNA clone contained in ATCC Deposit No. 97810 or
97809; (c) the amino acid sequence of a soluble extracellular domain of a TNFR
polypeptide having the amino acid sequence at positions 31 to 283 in SEQ ID
N0:2 or 31 to 166 in SEQ ID N0:4, or as encoded by the cDNA clone
contained in ATCC Deposit No. 97810 or 97809; or (d) the amino acid
sequence of a fragment of the TNFR polypeptide having the amino acid
sequence at positions 31 to 283 in SEQ ID N0:2 or 31 to 166 in SEQ ID
2o N0:4, or as encoded by the cDNA clone contained in ATCC Deposit No.
97810 or 97809, wherein said fragment has has TNFR-6a and/or TNFR-6(3
functional activity.
The polypeptides of the present invention also include polypeptides
having an amino acid sequence at least 80% identical, more preferably at least
85% identical, and still more preferably 90%, 92%, 95%, 96%, 97%, 98% or
99% identical to those described in (a), (b), (c) or (d) above, as well as
polypeptides having an amino acid sequence with at least 90% similarity, and
more preferably at least 80%, 85%, 90%, 92%, or 95% similarity, to those
above.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
An additional embodiment of this aspect of the invention relates to a
peptide or polypeptide which comprises the amino acid sequence of an
epitope-bearing portion of a TNFR polypeptide having an amino acid
sequence described in (a), (b), (c) or (d), above. Peptides or polypeptides
having the amino acid sequence of an epitope-bearing portion of a TNFR
polypeptide of the invention include portions of such polypeptides with at
least six or seven, preferably at least nine, and more preferably at least
about
30 amino acids to about 50 amino acids, although epitope-bearing
polypeptides of any length up to and including the entire amino acid sequence
to of a polypeptide of the invention described above also are included in the
invention.
In another embodiment, the invention provides an isolated antibody
that binds specifically to a TNFR polypeptide having an amino acid sequence
described in (a), (b), (c) or (d) above. The invention further provides
methods
for isolating antibodies that bind specifically to a TNFR polypeptide having
an amino acid sequence as described herein. Such antibodies are useful
diagnostically or therapeutically as described below.
Tumor Necrosis Factor (TNF) family ligands are known to be among
the most pleiotropic cytokines, inducing a large number of cellular responses,
2o including cytotoxicity, anti-viral activity, immunoregulatory activities,
and the
transcriptional regulation of several genes. The invention also provides for
pharmaceutical compositions comprising TNFR polypeptides, particularly
human TNFR polypeptides, which may be employed, for instance, to treat
infectious disease including HIV infection, endotoxic shock, cancer,
autoimmune diseases, graft vs. host disease, acute graft rejection, chronic
graft
rejection, neurodegenerative disorders, myelodysplastic syndromes, ischemic
injury (e.g., ischemic cardiac injury), toxin-induced liver disease, septic
shock,
cachexia and anorexia. Methods of treating individuals in need of TNFR
polypeptides are also provided.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
9
The invention further provides compositions comprising a TNFR
polynucleotide or a TNFR polypeptide for administration to cells in vitro, to
cells ex vivo and to cells in vivo, or to a multicellular organism. In certain
particularly preferred embodiments of this aspect of the invention, the
compositions comprise a TNFR polynucleotide for expression of a TNFR
polypeptide in a host organism for treatment of disease. Particularly
preferred
in this regard is expression in a human patient for treatment of a dysfunction
associated with aberrant endogenous activity of a TNFR polypeptide.
In another aspect, a screening assay for agonists and antagonists is
to provided which involves determining the effect a candidate compound has on
TNFR polypeptide binding to a TNF-family ligand. In particular, the method
involves contacting the TNF-family ligand with a TNFR polypeptide and a
candidate compound and determining whether TNFR polypeptide binding to
the TNF-family ligand is increased or decreased due to the presence of the
candidate compound. In this assay, an increase in binding of a TNFR
polypeptide over the standard binding indicates that the candidate compound
is an agonist of TNFR polypeptide binding activity and a decrease in TNFR
polypeptide binding compared to the standard indicates that the compound is
an antagonist of TNFR polypeptide binding activity.
2o TNFR-6 alpha and TNFR-6 beta are expressed in endothelial cells,
keratinocytes, normal prostate and prostate tumor tissue. For a number of
disorders of these tissues or cells, particularly of the immune system,
significantly higher or lower levels of TNFR gene expression may be detected
in certain tissues (e.g., cancerous tissues) or bodily fluids (e.g., serum,
plasma,
urine, synovial fluid or spinal fluid) taken from an individual having such a
disorder, relative to a "standard" TNFR gene expression level, i.e., the TNFR
expression leveh in healthy tissue from an individual not having the immune
system disorder. Thus, the invention provides a diagnostic method useful
during diagnosis of such a disorder, which involves: (a) assaying TNFR gene



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
expression level in cells or body fluid of an individual; (b) comparing the
TNFR gene expression level with a standard TNFR gene expression level,
whereby an increase or decrease in the assayed TNFR gene expression level
compared to the standard expression level is indicative of disorder in the
immune system.
An additional aspect of the invention is related to a method for treating
an individual in need of an increased level of TNFR polypeptide activity in
the
body comprising administering to such an individual a composition comprising
a therapeutically effective amount of an isolated TNFR polypeptide of the
10 invention or an agonist thereof.
A still further aspect of the invention is related to a method for treating
an individual in need of a decreased level of TNFR polypeptide activity in the
body comprising, administering to such an individual a composition
comprising a therapeutically effective amount of a TNFR antagonist.
Preferred antagonists for use in the present invention are TNFR-specific
antibodies.
Brief Description of the Figures
Figure 1 shows the nucleotide sequence (SEQ ID NO: I ) and deduced
amino acid sequence (SEQ ID N0:2) of TNFR-6a. The initial 30 amino acids
(underlined) are the putative leader sequence.
Figure 2 shows the nucleotide sequence (SEQ ID N0:3) and deduced
amino acid sequence (SEQ ID N0:4) of TNFR-6(3. The initial 30 amino acids
(underlined) are the putative leader sequence.
Figure 3 shows an alignment created by the Clustal method using the
Megaline program in the DNAstar suite comparing the amino acid sequences
of TNFR-6a ("TNFR-6 alpha" (SEQ ID N0:2)), and TNFR-6(3 ("TNFR-
6beta" (SEQ ID N0:4)) with other TNF receptors, as follows: TNFRI (SEQ



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
ID N0:5); TNFR2 (SEQ ID N0:6); NGFR (SEQ ID N0:7); LTbR (SEQ ID
N0:8); FAS (SEQ ID N0:9); CD27 (SEQ ID NO:10); CD30 (SEQ ID
NO:11); CD40 (SEQ ID N0:12); 4-1BB (SEQ ID N0:13); OX40 (SEQ ID
N0:14); VC22 (SEQ ID N0:15); and CRMB (SEQ ID N0:16).
Figures 4 and 5 show separate analyses of the TNFR-6 alpha and
TNFR-6 beta amino acid sequences, respectively. Alpha, beta, turn and coil
regions; hydrophilicity; amphipathic regions; flexible regions; antigenic
index
and surface probability are shown, as predicted for the amino acid sequence of
SEQ ID N0:2 and SEQ ID N0:4, respectively, using the default parameters of
the recited computer programs. In the "Antigenic Index - Jameson-Wolf'
graph, which indicates the location of the highly antigenic regions of TNFR-6a
and TNFR-6(3, i.e., regions from which epitope-bearing peptides of the
invention may be obtained. Antigenic regions of TNFR-6a, incude from about
Ala-31 to about Thr-46, from about Phe-57 to about Thr-117, from about
Cys-132 to about Thr-175, from about Gly-185 to about Thr-194, from about
Val-205 to about Asp-217, from about Pro-239 to about Leu-264, and from
about Ala-283 to about Pro-298 (SEQ ID N0:2). Antigenic regions of TNFR-
6(3, include from about Ala-31 to about Thr-46, from about Phe-57 to about
Gln-80, from about Glu-86 to about His-106, from about Thr-108 to about
2o Phe-119, from about His-129 to about Val-138, and from about Gly-142 to
about Pro-166 (SEQ ID N0:4). These polypeptide fragments have been
determined to bear antigenic epitopes of the TNFR-6 alpha and TNFR-6 beta
polypeptides by the analysis of the Jameson-Wolf antigenic index.
The data presented in Figures 4 and 5 are also represented in tabular
form in Tables I and II, respectively. The columns are labeled with the
headings "Res", "Position", and Roman Numerals I-XIV. The column headings
refer to the following features of the amino acid sequence presented in Figure
4, (Table I) and Figure 5 (Table II): "Res": amino acid residue of SEQ ID



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
12
N0:2 (Figure 1 ) or SEQ ID N0:4 (Figure 2); "Position": position of the
corresponding residue within of SEQ ID N0:2 (Figure 1 ) or SEQ ID N0:4
(Figure 2); I: Alpha, Regions - Gamier-Robson; II: Alpha, Regions -
Chou-Fasman; III: Beta, Regions - Garnier-Robson; IV: Beta, Regions -
Chou-Fasman; V: Turn, Regions - Gamier-Robson; VI: Turn, Regions -
Chou-Fasman; VII: Coil, Regions - Gamier-Robson; VIII: Hydrophilicity Plot
- Kyte-Doolittle; IX: Hydrophobicity Plot - Hopp-Woods; X: Alpha,
Amphipathic Regions - Eisenberg; XI: Beta, Amphipathic Regions - Eisenberg;
XII: Flexible Regions - Karplus-Schulz; XIII: Antigenic Index = Jameson-Wolf;
to and XIV: Surface Probability Plot - Emini.
Figure 6 shows the nucleotide sequences of HELDI06R (SEQ ID
N0:17) and HCEOW38R (SEQ ID N0:18) which are related to SEQ ID
NOS:1 and 3.
Figures 7A-B show TNFR6 alpha blocking of Fas ligand mediated cell
death. Jurkat T-cells were treated with a combination of Fas ligand and TNFR
6 alpha Fc receptor for 16 hours. To measure the levels of viable cells after
treatment, cells were incubated for 5 hours with 10% ALOMAR blue and
examined spectrophotometrically at OD 570nm-630nm. All samples were
tested in triplicate. TNFR6 alpha-Fc appears to block Fas ligand mediated
2o apoptosis of Jurkat cells in a dose dependent manner as effectively as Fas
ligand.
Detailed Description
The present invention provides isolated nucleic acid molecules
comprising, or alternatively consisting of, a polynucleotide encoding a TNFR-
6a or -6(3 polypeptide, generically "TNFR polypeptide(s)" having the amino
acid sequence shown in SEQ ID NOS:2 and 4, respectively, which were
determined by sequencing cloned cDNAs. The nucleotide sequences shown in



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
13
Figures 1 and 2 (SEQ ID NOS:1 and 3) were obtained by sequencing the
HPHAE52 and HTPCH84 clones, respectively, which were deposited on
November 22, 1996 at the American Type Culture Collection, 10801
University Boulevard, Manassas, Virginia 20110-2209 and given accession
numbers ATCC 97810 and 97809, respectively. The deposited clones are
contained in the pBluescript SK(-) plasmid (Stratagene, La Jolla, CA).
The TNFR-6 alpha and TNFR-6 beta proteins of the present invention
are splice variants which share an identical nucleotide and amino acid
sequence
over the N-terminal 142 residues of the respective proteins. The amino acid
to sequences of these proteins are about 23% similar to and share multiple
conserved cysteine rich domains with the translation product of the human
TNFR-2 mRNA (Figure 3) (SEQ ID N0:6). Importantly, these proteins share
substantial sequence similarity over a polypeptide sequence including four
repeated cysteine rich motifs with significant intersubunit homology. TNFR-2
is thought to exclusively mediate human T-cell proliferation by TNF (PCT
WO/94/09137).
Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using an automated DNA
2o sequencer (such as the Model 373 from Applied Biosystems, Inc., Foster
City, CA), and all amino acid sequences of polypeptides encoded by DNA
molecules determined herein were predicted by translation of a DNA sequence
determined as above. Therefore, as is known in the art for any DNA sequence
determined by this automated approach, any nucleotide sequence determined
herein may contain some errors. Nucleotide sequences determined by
automation are typically at least about 90% identical, more typically at least
about 95% to at least about 99.9% identical to the actual nucleotide sequence
of the sequenced DNA molecule. The actual sequence can be more precisely



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
14
determined by other approaches including manual DNA sequencing methods
well known in the art. As is also known in the art, a single insertion or
deletion in a determined nucleotide sequence compared to the actual sequence
will cause a frame shift in translation of the nucleotide sequence such that
the
predicted amino acid sequence encoded by a determined nucleotide sequence
will be completely different from the amino acid sequence actually encoded by
the sequenced DNA molecule, beginning at the point of such an insertion or
deletion.
By "nucleotide sequence" of a nucleic acid molecule or polynucleotide
1 o is intended, for a DNA molecule or polynucleotide, a sequence of
deoxyribonucleotides, and for an RNA molecule or polynucleotide, the
corresponding sequence of ribonucleotides (A, G, C and U), where each
thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide
sequence is replaced by the ribonucleotide uridine (U).
Using the information provided herein, such as the nucleotide
sequences in Figures 1 and 2 (SEQ ID NOS:1 and 3), a nucleic acid molecule of
the present invention encoding a TNFR polypeptide may be obtained using
standard cloning and screening procedures, such as those for cloning cDNAs
using mRNA as starting material. Illustrative of the invention, the TNFR-6a
2o and TNFR-6(3 clones (Figures 1 and 2, respectively) were identified in cDNA
libraries from the following tissues: endothelial cells, keratinocytes, normal
prostate tissue, and prostate tumor tissue.
The determined nucleotide sequences of the TNFR cDNAs of Figures
1 and 2 (SEQ ID NOS:1 and 3) contain open reading frames encoding proteins
of 300 and 170 amino acid residues, with an initiation codon at nucleotide
positions 25-27 and 73-75 of the nucleotide sequences in Figures 1 and 2
(SEQ ID NOS:1 and 3), respectively.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
The open reading frames of the TNFR-6a and TNFR-6(3 genes share
sequence homology with the translation product of the human mRNA for
TNFR-2, including the soluble extracellular domain of about residues 31-283 of
SEQ ID N0:2 and 31-166 of SEQ ID N0:4, respectively.
As one of ordinary skill would appreciate, due to the possibilities of
sequencing errors discussed above, the actual complete TNFR polypeptides
encoded by the deposited cDNAs, which comprise about 300 and 170 amino
acids, may be somewhat longer or shorter. More generally, the actual open
reading frames may be anywhere in the range of ~20 amino acids, more likely
1 o in the range of ~10 amino acids, of that predicted from the first
methionine
codon from the N-terminus shown in Figures 1 and 2 (SEQ ID NOS:1 and 3),
which is in-frame with the translated sequences shown in each respective
figure. It will further be appreciated that, depending on the analytical
criteria
used for identifying various functional domains, the exact "address" of the
15 extracellular and transmembrane domains) of the TNFR polypeptides may
differ slightly from the predicted positions above. For example, the exact
location of the extracellular domain or antigenic regions in SEQ ID N0:2 and
SEQ ID N0:4 may vary slightly (e.g., the address may "shift" by about 1 to
about 20 residues, more likely about 1 to about 5 residues) depending on the
2o criteria used to define the domains and antigenic regions. In any event, as
discussed further below, the invention further provides polypeptides having
various residues deleted from the N-terminus of the complete polypeptide,
including polypeptides lacking one or more amino acids from the N-terminus
of the extracellular domain described herein, which constitute soluble forms
of
the extracellular domains of the TNFR-6a and TNFR-6(3 proteins.
The amino acid sequences of the complete TNFR proteins include a
leader sequence and a mature protein, as shown in SEQ ID NOS:2 and 4.
More in particular, the present invention provides nucleic acid molecules



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
16
encoding mature forms of the TNFR proteins. Thus, according to the signal
hypothesis, once export of the growing protein chain across the rough
endoplasmic reticulum has been initiated, proteins secreted by mammalian cells
have a signal or secretory leader sequence which is cleaved from the complete
polypeptide to produce a secreted "mature" form of the protein. Most
mammalian cells and even insect cells cleave secreted proteins with the same
specificity. However, in some cases, cleavage of a secreted protein is not
entirely uniform, which results in two or more mature species of the protein.
Further, it has long been known that the cleavage specificity of a secreted
protein is ultimately determined by the primary structure of the complete
protein, that is, it is inherent in the amino acid sequence of the polypeptide
Therefore, the present invention provides a nucleotide sequence encoding a
mature TNFR polypeptide having the amino acid sequence encoded by a
cDNA clone identified as ATCC Deposit No. 97810 or 97809. By the
"mature TNFR polypeptides having the amino acid sequence encoded by a
cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97810,
or 97809" is meant the mature forms) of the protein produced by expression
in a mammalian cell (e.g., COS cells, as described below) of the complete open
reading frame encoded by the human DNA sequence of the clone contained in
2o the deposited vector.
In addition, methods for predicting whether a protein has a secretory
leader as well as the cleavage point for that leader sequence are available.
For
instance, the method of McGeoch (Virus Res. 3:271-286 (1985)) uses the
information from a short N-terminal charged region and a subsequent
uncharged region of the complete (uncleaved) protein. The method of von
Heinje (Nucleic Acids Res. 14:4683-4690 (1986)) uses the information from the
residues surrounding the cleavage site, typically residues -13 to +2 where +1
indicates the amino terminus of the mature protein. The accuracy of predicting
the cleavage points of known mammalian secretory proteins for each of these



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
17
methods is in the range of 75-80% (von Heinje, supra). However, the two
methods do not always produce the same predicted cleavage points) for a
given protein.
In the present case, the deduced amino acid sequence of the complete
TNFR polypeptides were analyzed by a computer program "PSORT",
available from Dr. Kenta Nakai of the Institute for Chemical Research, Kyoto
University (see K. Nakai and M. Kanehisa, Genomics 14: 897-911 ( 1992)),
which is an expert system for predicting the cellular location of a protein
based
on the amino acid sequence. As part of this computational prediction of
1o localization, the methods of McGeoch and von Heinje are incorporated. The
analysis of the TNFR amino acid sequences by this program provided the
following results: TNFR-6a & TNFR-6(3 encode mature polypeptides having
the amino acid sequences of residues 31-300 and 31-170 of SEQ ID NOS:2 and
4, respectively.
In certain preferred embodiments, TNFR-6a & TNFR-6(3 encode
mature polypeptides having the amino acid sequences of residues 31-299 and
31-169 of SEQ ID NOS:2 and 4, respectively.
As indicated, nucleic acid molecules of the present invention may be in
the form of RNA, such as mRNA, or in the form of DNA, including, for
2o instance, cDNA and genomic DNA obtained by cloning or produced
synthetically. The DNA may be double-stranded or single-stranded.
Single-stranded DNA or RNA may be the coding strand, also known as the
sense strand, or it may be the non-coding strand, also referred to as the
anti-sense strand.
By "isolated" nucleic acid molecules) is intended a nucleic acid
molecule, DNA or RNA, which has been removed from its native environment
For example, recombinant DNA molecules contained in a vector are considered
isolated for the purposes of the present invention. Further examples of



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
18
isolated DNA molecules include recombinant DNA molecules maintained in
heterologous host cells or purified (partially or substantially) DNA molecules
in solution. Isolated RNA molecules include in vivo or in vitro RNA
transcripts of the DNA molecules of the present invention. However, a
nucleic acid contained in a clone that is a member of a mixed clone library
(e.g.,
a genomic or cDNA library) and that has not been isolated from other clones of
the library (e.g., in the form of a homogeneous solution containing the clone
without other members of the library) or a chromosome isolated or removed
from a cell or a cell lysate (e.g., a "chromosome spread", as in a karyotype),
is
to not "isolated" for the purposes of this invention. As discussed further
herein,
isolated nucleic acid molecules according to the present invention may be
produced naturally, recombinantly, or synthetically.
Isolated nucleic acid molecules of the present invention include DNA
molecules comprising an open reading frame (ORF) with an initiation codon at
positions 25-27 and 73-75 of the nucleotide sequences shown in SEQ ID
NOS:1 and 3, respectively.
Also included are DNA molecules comprising the coding sequence for
the predicted mature TNFR polypeptides shown at positions 3I-300 and 31-
170 of SEQ ID NOS:2 and 4, respectively.
2o Also included are DNA molecules comprising the coding sequence for
the predicted mature TNFR polypeptides shown at positions 31-299 and 31-
169 of SEQ ID NOS:2 and 4, respectively.
In addition, isolated nucleic acid molecules of the invention include
DNA molecules which comprise a sequence substantially different from those
described above but which, due to the degeneracy of the genetic code, still
encode a TNFR protein. Of course, the genetic code and species-specific
codon preferences are well known in the art. Thus, it would be routine for one
skilled in the art to generate the degenerate variants described above, for
instance, to optimize codon expression for a particular host (e.g., change



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
19
codons in the human mRNA to those preferred by a bacterial host such as E.
coli).
In another aspect, the invention provides isolated nucleic acid
molecules encoding a TNFR polypeptide having an amino acid sequence
encoded by the cDNA clone contained in the plasmid deposited as ATCC
Deposit No. 97810 or 97809. Preferably, this nucleic acid molecule will
encode the mature polypeptide encoded by the above-described deposited
cDNA clone.
The invention further provides an isolated nucleic acid molecule having
to the nucleotide sequence shown in Figure 1 or 2 (SEQ ID NO:1 or 3) or the
nucleotide sequence of the TNFR cDNAs contained in the above-described
deposited clones, or a nucleic acid molecule having a sequence complementary
to one of the above sequences. Such isolated molecules,.particularly DNA
molecules, are useful, for example, as probes for gene mapping by in situ
hybridization with chromosomes, and for detecting expression of the TNFR
genes in human tissue, for instance, by Northern blot analysis.
The present invention is further directed to nucleic acid molecules
encoding portions of the nucleotide sequences described herein as well as to
fragments of the isolated nucleic acid molecules described herein. In
particular,
the invention provides polynucleotides having a nucleotide sequence
representing the portion of SEQ ID NO:1 or 3 which consist of positions 25-
924 and 73-582 of SEQ ID NOS:1 and 3, respectively. Also contemplated are
polynucleotides encoding TNFR polypeptides which lack an amino terminal
methionine such polynucleotides having a nucleotide sequence representing the
portion of SEQ ID NOS:1 and 3 which consist of positions 28-924 and 76-
582, respectively. Polypeptides encoded by such polynucleotides are also
provided, such polypeptides comprising an amino acid sequence at positions
2-300 and 2-170 of SEQ ID NOS:2 and 4, respectively.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
In addition, the invention provides nucleic acid molecules having
nucleotide sequences related to extensive portions of SEQ ID NOS:l and 3 as
follows: HELDI06R (SEQ ID N0:17) and HCEOW38R (SEQ ID N0:18) are
related to both SEQ ID NOS:1 and 3. Preferred are polynucleotide fragments
5 of SEQ ID NOS:I and 3 which are not SEQ ID N0:17 or 18 or subfragments
of either SEQ ID N0:17 or 18. The sequences of HELDI06R and
HCEOW38R are shown in Figure 6.
More generally, by a fragment of an isolated nucleic acid molecule
having the nucleotide sequence of the deposited cDNA or the nucleotide
10 sequence shown in Figures 1 or 2 (SEQ ID NOS:1 or 3) is intended fragments
at least about 15 nt, and more preferably at least about 20 nt, still more
preferably at least about 30 nt, and even more preferably, at least about 40
nt
in length. These fragments have numerous uses, which include, but are not
limited to, as diagnostic probes and primers as discussed herein. Of course,
15 larger fragments 50-300 nt in length are also useful according to the
present
invention as are fragments corresponding to most, if not all, of the
nucleotide
sequence of the deposited cDNAs or as shown in Figures 1 and 2 (SEQ ID
NOS:1 and 3). Especially preferred are fragments comprising at least 500
nucleotides which are at least 80%, 85%, 90%, 92%, or 95% identical to 500
20 contiguous nucleotides shown in SEQ ID NO:1. By a fragment at least about
20 nt in length, for example, is intended fragments which include 20 or more
contiguous bases from the nucleotide sequence of a deposited cDNA or the
nucleotide sequence as shown in Figures 1 and 2 (SEQ ID NOS:1 and 3). In
this context "about" includes the particularly recited size, and those sizes
that
are larger or smaller by several (5, 4, 3, 2, or 1 ) nucleotides, at either
terminus
or at both termini. Preferred nucleic acid fragments of the present invention
include nucleic acid molecules encoding epitope-bearing portions of the TNFR
polypeptides as identified in Figures 4 and 5 and described in more detail
below.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
21
Representative examples of TNFR-6a nucleic acid fragments of the
invention include, for example, fragments that comprise, or alternatively,
consist of, a sequence from about nucleotide 1 to about nucleotide 25, about
nucleotide 26 to about nucleotide 75, about nucleotide 76 to about nucleotide
114, about nucleotide 115 to about nucleotide 162, about nucleotide 163 to
about nucleotide 216, about nucleotide 217 to about nucleotide 267, about
nucleotide 268 to about nucleotide 318, about nucleotide 319 to about
nucleotide 369, about nucleotide 370 to about nucleotide 420, about nucleotide
421 to about nucleotide 471, about nucleotide 472 to about nucleotide 522,
to about nucleotide 523 to about nucleotide 573, about nucleotide 574 to about
nucleotide 625, about nucleotide 626 to about nucleotide 675, about nucleotide
676 to about nucleotide 714, about nucleotide 715 to about nucleotide 765,
about nucleotide 766 to about nucleotide 816, about nucleotide 817 to about
nucleotide 867, about nucleotide 868 to about nucleotide 924, about nucleotide
925 to about nucleotide 975 of SEQ ID NO:1, or the complementary strand
thereto, or the cDNA contained in the plasmid deposited as ATCC Deposit
No. 97810. In this context "about" includes the particularly recited ranges,
and
those ranges that are larger or smaller by several (5, 4, 3, 2, or 1 )
nucleotides, at
either terminus or at both termini.
2o In specific embodiments, the nucleic acid fragments of the invention
comprise, or alternatively, consist of, a polynucleotide sequence encoding
amino acid residues 100 to 150, 150 to 200, 200 to 300, 220 to 300, 240 to
300, 250 to 300, 260 to 300, and/or 280 to 300, of SEQ ID N0:2, or the
complementary strand thereto. Polynucleotides that hybridize to these
polynucleotide fragments are also encompassed by the invention.
Representative examples of TNFR--6(3 nucleic acid fragments of the
invention include, for example, fragments that comprise, or alternatively,
consist of, a sequence from about nucleotide 1 to about nucleotide 36, about



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
22
nucleotide 37 to about nucleotide 72, about nucleotide 73 to about nucleotide
123, about nucleotide 124 to about nucleotide 175, about nucleotide 176 to
about nucleotide 216, about nucleotide 217 to about nucleotide 267, about
nucleotide 268 to about nucleotide 318, about nucleotide 319 to about
nucleotide 369, about nucleotide 370 to about nucleotide 420, about nucleotide
421 to about nucleotide 471, about nucleotide 472 to about nucleotide 522,
about nucleotide 523 to about nucleotide 582, about nucleotide 583 to about
nucleotide 622, about nucleotide 623 to about nucleotide 682, about nucleotide
683 to about nucleotide 750, about nucleotide 751 to about nucleotide 800,
about nucleotide 801 to about nucleotide 850, about nucleotide 851 to about
nucleotide 900, about nucleotide 901 to about nucleotide 950, about nucleotide
951 to about nucleotide 1000, about nucleotide 1001 to about nucleotide 1050,
about nucleotide 1051 to about nucleotide 1100, about nucleotide 1101 to
about nucleotide 1150, about nucleotide 1151 to about nucleotide 1200, about
nucleotide 1201 to about nucleotide 1250, about nucleotide 1251 to about
nucleotide 13000, about nucleotide 1301 to about nucleotide 1350, about
nucleotide 1351 to about nucleotide 1400, about nucleotide1401 to about
nucleotide 1450, about nucleotide 1451 to about nucleotide 1500, about
nucleotide 1501 to about nucleotide 1550, about nucleotide 1551 to about
nucleotide 1600 about nucleotide 1601 to about nucleotide 1650, about
nucleotide 1651 to about nucleotide 1667 of SEQ ID N0:3, or the
complementary strand thereto, or the cDNA contained in the plasmid
deposited as ATCC Deposit No. 97809. In this context "about" includes the
particularly recited ranges, and those ranges that arelarger or smaller by
several
(5, 4, 3, 2, or 1 ) nucleotides, at either terminus or at both termini.
In specific embodiments, the nucleic acid fragments of the invention
comprise, or alternatively, consist of, a polynucleotide sequence encoding
amino acid residues 50 to 100, 100 to 170, 110 to 170, 130 to 170, 140 to 170,
150 to 170, and/or 160 to 170, of SEQ ID N0:4, or the complementary strand



CA 02362929 2001-08-16
WO 00/52028 PCT/LJS00/05686
23
thereto. Polynucleotides that hybridize to these polynucleotide fragments are
also encompassed by the invention.
Preferably, the polynucleotide fragments of the invention encode a
polypeptide which demonstrates a TNFR-6a and/or TNFR-6(3 functional
activity. By a polypeptide demonstrating "functional activity" is meant, a
polypeptide capable of displaying one or more known functional activities
associated with a complete (full-length) or mature TNFR-6a and/or TNFR -6(3
polypeptide. Such functional activities include, but are not limited to,
biological activity (e.g., inhibition or reduction of Fast mediated apoptosis,
inhibition or reduction of AIM-II mediated apoptosis), antigenicity [ability
to
bind (or compete with a TNFR-6a and/or TNFR -6(3 polypeptide for binding)
to an anti-TNFR-6a antibody and/or anti-TNFR -6(3 antibody],
immunogenicity (ability to generate antibody which binds to a TNFR-6a
and/or TNFR -6~3 polypeptide), ability to form multimers with TNFR-6a
and/or TNFR -6(3 polypeptides of the invention, and ability to bind to a
receptor or ligand for a TNFR-6a and/or TNFR -6(3 polypeptide (e.g., Fas
ligand and/or AIM-II (International application publication number WO
97/3491 l, published September 25, 1997)) .
The functional activity of TNFR-6a and/or TNFR -6~ polypeptides,
and fragments, variants derivatives, and analogs thereof, can be assayed by
various methods.
For example, in one embodiment where one is assaying for the ability
to bind or compete with complete (full-length) or mature TNFR-6a and/or
TNFR-6(3 polypeptide for binding to anti-TNFR-6a and/or anti-TNFR-6(3
antibody, various immunoassays known in the art can be used, including but
not limited to, competitive and non-competitive assay systems using
techniques such as radioimmunoassays, ELISA (enzyme linked



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
24
immunosorbent assay), "sandwich" immunoassays, immunoradiometric
assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ
immunoassays (using colloidal gold, enzyme or radioisotope labels, for
example), western blots, precipitation reactions, agglutination assays (e.g.,
gel
agglutination assays, hemagglutination assays), complement fixation assays,
immunofluorescence assays, protein A assays, and immunoelectrophoresis
assays, etc. In one embodiment, antibody binding is detected by detecting a
label on the primary antibody. In another embodiment, the primary antibody
is detected by detecting binding of a secondary antibody or reagent to the
1 o primary antibody. In a further embodiment, the secondary antibody is
labelled. Many means are known in the art for detecting binding in an
immunoassay and are within the scope of the present invention.
In another embodiment, where a TNF-ligand is identified (e.g., Fas
Ligand and/or AIM-II (International application publication number WO
97/34911, published September 25, 1997)), or the ability of a polypeptide
fragment, variant or derivative of the invention to multimerize is being
evaluated, binding can be assayed, e.g., by means well-known in the art, such
as, for example, reducing and non-reducing gel chromatography, protein
affinity chromatography, and affinity blotting. See generally, Phizicky, E.,
et
al., Microbiol. Rev. 59:94-123 (1995). In another embodiment, physiological
correlates of TNFR-6a and/or TNFR -6(3 binding to its substrates (signal
transduction) can be assayed.
In addition, assays described herein (e.g., see Examples 7 -9) and
otherwise known in the art may routinely be applied or modified to measure
the ability of TNFR-6a and/or TNFR -6(3 polypeptides and fragments,
variants derivatives and analogs thereof, to elicit TNFR-6a and/or TNFR-6(3
related biological activity (e.g., to inhibit or reduce Fast mediated
apoptosis in



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
vitro or in vivo, or to inhibit or reduce AIM-II mediated apoptosis in vitro
or
in vivo).
For example, the ability of TNFR polypeptides of the invention to
reduce or block Fast mediated apoptosis can be assayed using a Fas
5 expressing T-cell line, such as Jurkat. In this assay, Jurkat cells treated
with
soluble Fast undergo apoptosis. Pretreatment of cells with TNFR and/or
TNFR agonists prior to addition of Fast protects cells from undergoing
apoptosis and results in a reduced level of apoptosis when compared to that
observed when the same concentration of soluble Fast is contacted with the
to same concentration of the Fas expressing cells in the absence of the TNFR
polypeptide or TNFR agonist. Alternatively mixing of the Fast protein with
TNFR and/or TNFR agonist will also block the ability of Fast to bind the
Jurkat cells and mediate apoptosis (see, e.g., Example 9).
In contrast, TNFR antagonists of the invention block TNFR mediated
15 inhibition of Fast mediated apoptosis. Accordingly, TNFR antagonists of the
invention can be assayed, for example, by combining the mature TNFR
(known to bind FasL), the TNFR antagonist to be tested, and soluble Fast,
and contacting this combination with the Fas expressing cell line. TNFR
antagonists reduce or block TNFR mediated inhibition of Fast mediated
2o apoptosis. Accordingly, Fas expressing T cells contacted with mature TNFR,
TNFR antagonist and soluble Fast exhibit elevated apoptosis levels when
compared with the same concentration of Fas expressing cells that have been
contacted with the same concentrations of mature TNFR and Fast in the
absence of the TNFR antagonist.
25 Apoptosis can be measured, for example, by increased staining with
Annexin, which selectively binds apoptotic cells. In another example, the
decrease in cell numbers due to apoptosis can be detected by a decrease in
ALOMAR blue staining which detects viable cells.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
26
Other methods will be known to the skilled artisan and are within the
scope of the invention.
In additional embodiments, the polynucleotides of the invention encode
functional attributes of TNFR-6a and/or TNFR -6(3. Preferred embodiments
of the invention in this regard include fragments that comprise alpha-helix
and
alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet
forming regions ("beta-regions"), turn and turn-forming regions
("turn-regions"), coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic
1o regions, flexible regions, surface-forming regions and high antigenic index
regions of TNFR-6a and/or TNFR -6(3 polypeptides.
Certain preferred regions in this regard are set out in Figure 4 (Table I)
and Figure 5 (Table II). The data presented in Figures 4 and Figure 5 and that
presented in Table I and Table II, respectively, merely present a different
format of the same results obtained when the amino acid sequence of SEQ ID
NO:2 and the amino acid sequence of SEQ ID N0:4 is analyzed using the
default parameters of the DNA*STAR computer algorithm.
The above-mentioned preferred regions set out in Figure 4 (Table I) and
Figure 5 (Table II) include, but are not limited to, regions of the
2o aforementioned types identified by analysis of the amino acid sequence set
out
in Figure 1 and Figure 2. As set out in Figure 4 (Table I) and Figure 5 (Table
II), such preferred regions include Gamier-Robson alpha-regions, beta-regions,
turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and
coil-regions, Kyte-Doolittle hydrophilic regions, Eisenberg alpha- and
beta-amphipathic regions, Karplus-Schulz flexible regions, Emini
surface-forming regions and Jameson-Wolf regions of high antigenic index.
Among highly preferred polynucleotides in this regard are those that encode
polypeptides comprising regions of TNFR-6_ and/or TNFR-6(3 that combine



CA 02362929 2001-08-16
WO 00/52028 PCT/i1S00/05686
27
several structural features, such as several (e.g., 1, 2, 3 , or 4) of the
features
set out above.
Additionally, the data presented in columns VIII, IX, XIII, and XIV of
Tables I and II can routinely be used to determine regions of TNFR-6_ which
exhibit a high degree of potential for antigenicity. Regions of high
antigenicity are
determined from the data presented in columns VIII, IX, XIII, and/or XIV by
choosing values which represent regions of the polypeptide which are likely to
be
exposed on the surface of the polypeptide in an environment in which antigen
recognition may occur in the process of initiation of an immune response.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
28
Table I
Res Position I II III N V VI VII VIII IX X XI XII XIII XN
Met 1 . . B . . . . 0.06 0.09* . . -0.100.60


Ar'; 2 . . B . . . . 0.10 -0.34* . . 0.500.82


Ala 3 . B . . . 0.28 -0.34* . . 0.500.63


Leu 4 A . . . 0.32 -0.34* . . 0.500.99


Glu 5 A . . . . . . -0.10 -0.53* . F 0.950.50


Gly 6 . . . . . T C 0.20 0.16* . F 0.450.41


Pro 7 . . . . T T . -0.72 0.04* . F 0.650.66


Gly 8 . . . . T T . -0.94 0.04. . F 0.650.32


Leu 9 A . . . . T . -0.80 0.73. . . -0.200.26


Ser 10 A A . . . . -1.61 0.87. . . -0.600.09


Leu 11 . A B . . . . -2.12 1.13 . . -0.600.08


Leu 12 . A B . . . . -2.72 1.34. . . -0.600.07


Cys 13 . A B . . . . -2.97 1.34. . . -0.600.04


Leu 14 . A B . -2.97 1.46. . . -0.600.05


Val 15 . A B . . . -2.88 1'.46. . . -0.600.05


Leu 16 . A B . . . . -2.66 1.20. . . -0.600.15


Ala 17 . A B . . . -2.66 1.13. . . -0.600.18


Leu 18 . A B . . . . -2.80 1.13. . . -0.600.20


Pro 19 A A . . . . . -2.20 1.17. . . -0.600.20


Ala 20 . A B . . . . -2.20 0.91. . . -0.600.31


Leu 21 . A B . . . . -1.60 1.06. * . -0.600.28


Leu 22 . A B . . . . -1.60 0.80. . . -0.600.28


Pro 23 . A B . . . . -1.64 0.87. * . -0.600.28


Val 24 . . B . . . . -1.32 1.01. * . -0.400.25


Pro 25 . . B . . . . -1.08 0.33* . . -0.100.60


Ala 26 . . B B . . . -1.12 0.07. . . -0.300.38


Val 27 . . B B . . . -0.90 0.29* * . -0.300.38


Arg 28 . . B B . . . -0.69 0.14* * . -0.300.25


Gly 29 . . B B . . . -0.14 -0.29* * . 0.300.43


Val 30 . . B B . . . -0.14 -0.30* * . 0.300.83


Ala 31 . . B B . . . 0.13 -0.51* * . 0.600.66


Glu 32 . . B . . . . 0.74 -0.03* * F 0.650.96


Thr 33 . . B . . T . 0.42 0.30* * F 0.402.02


Pro 34 . . . . T T . 0.48 0.09* * F 0.803.10


Thr 3 . . . . T T . I .44 0.50* . F 0.501.88
5


Tyr 36 . . . . . T C 2.03 0.50* . . 0.152.55


Pro 37 . . . . T . . 1.44 0.01* . . 0.452.76


Trp 3 . A . . . . C I .76 0.09* . . 0.051.93
8


Arg 3 . A B . . . . 1.66 -0.40* . F 0.602.13
9


Asp 40 A A . . . . . 1.62 -0.67* . F 0.901.99


Ala 41 . A . . . . C 1.87 -0.67* . F 1.101.87


Glu 42 A A . . . . . 2.19 -1.59* * F 0.901.66


Thr 43 A A . . . . . 1.67 -1.59* . F 0.901.94


Gly 44 . A . . T . . 0.70 -0.90* . F 1.301.59


Glu 45 A A . . . . . 0.03 -0.76* * F 0.750.68


Arg 46 A A . . . . . 0.03 -0.19* . F 0.450.25


Leu 47 A A . . . . . 0.03 -0.17* . . 0.300.26


Val 48 . A B . . . . -0.32 -0.20. . . 0.300.26


Cys 49 . A B . . . . -0.19 0.37. . . -0.300.07


Ala 50 . A B . . . . -0.40 0.80. . . -0.600.13


Gln 51 . A B . . . . -0.86 0.54. . . -0.600.28


Cys 52 . A B . . . . -0.36 0.33. . . -0.300.51


Pro 53 . . . . . T C -0.20 0.24. . F 0.450.73


Pro 54 . . . . T T . -0.39 0.53. . F 0.350.36


Gly 55 . . . . T T . 0.20 0.77* . F 0.350.50


Thr 56 . . B . . T . 0.31 0.60. . F -0.050.56





CA 02362929 2001-08-16
WO 00/52028 PCT/LJS00/05686
29
Table
I


Res I II III N V VI VII VIII IX X XI XIIXIIIXN
Position



Phe 57 . . B B . . . 0.77 0.17* F -0.150.71


Val 58 . B B . . . 0.31 0.17* . 0.191.12


Gln 59 . . B B . . 0.63 0.31* . F 0.530.41


Arg 60 . . B . T . 1.09 -0.17* F 1 0
87 94


Pro 61 . . B . . T . 1.40 -0.96* . F . .
. 2.662.47


Cys 62 . . . . T T . 1.80 -1.60* F 3.402.38
~


Arg 63 . . . T T . 2.44 -1.61* F 3.061.63
~


Arg 64 . . . . T . . 2.13 -1.19* F 2.771.63
.


Asp 65 . . . T . . 1.71 -1.13* F 2 4
. 68 39


Ser 66 . . T T . 1.26 -1.21 F . .
~ ~ 2.793.24


Pro 67 . . . T T . I.SR -0.64 F 2.550.89
.


Thr 68 . . . . T T . 1.26 -0.21. F 2.500
~ 52


Thr 69 . . . T T . 0.48 0.21 F 1.65.
. . 0.61


Cys 70 . . . . T . . 0.27 0.40 F 1 0
14 21


Gly 71 . . . . T T . 0.36 0.40* * F . .
1.330
22


Pro 72 . . . T T . 0.68 0.34* F 1.62.
~ 24
0


Cys 73 . . . T C 0.96 -0.14* F 2.01.
. 0
88


Pro 74 . . . . T C 1.02 -0.21* F 2.40.
1
21


Pro 75 . . . . T T . 1.38 0.11* * F 1 .
76 1
23


Arg 76 . . . T T . 1.72 0.17* * F . .
1.523
30


His 77 . . B . . T . 1.23 0.00* * F 0.88.
3.70


Tyr 78 . . B . . T . 1.61 0.36* * 0.492
~ 07


Thr 79 . . B . . . . 1.82 0.84* . -0.25.
1
11


Gln 80 . . B . . . . 1.79 1.24* * -0 .
25 1
31


Phe 81 . . . . T . . 0.87 1.50* * ~ . .
0.151.31


Trp 82 . . . . T . . 0.90 1.43* 0.000.75


Asn 83 . A . . T . . 1.26 0.94* . . -0.200
75


Tyr 84 . A . . T . . 0.90 0.54* * -0.05.
~ 1.70


Leu 85 . A . . T . . 1.01 0.33* * 0 0
38 87


Glu 86 . A . . T . . 1.47 -0.59* * . .
1.711.05


Arg 87 . A . . T . . 1.09 -0.23. * 1.691
~ 05


Cys 88 . . . . T T . 1.09 -0.41. * 2.22.
~ 0.69


Arg 89 . . . . T T . 0.48 -0.70 * 2.8064
. 0


Tyr 90 . . . . T T . 0.48 -0.06. * 2 .
22 0
24


Cys 91 . . . . T T . -0.190.63. * . . .
1.040.37


Asn 92 . . B B . . . -0.640.63. * . -0.040
10


Val 93 . . B B . . . 0.02 1.06. * -0.32.
. 0
06


Leu 94 . . B B . . . 0.02 0.30. . -0.30.
~ 0.21


Cys 95 . . B . . T . 0.27 -0.27 0 25
. 70 0


Gly 96 . . . . . T C 0.93 -0.67. F . .
1.350
59


Glu 97 A . . . . T . 0.93 -1.31. . F 1.30.
1.24


Arg 98 A . . . . T . 1.20 -2.00. * F 1.304
00


Glu 99 A A . . . . . 2.12 -2.07, * F 0.90.
4
08


Glu 100 A A . . . . . 2.20 -2.50. * F 0 .
90 4
61


Glu 101 A A . . . . . 1.88 -2.00. * F . .
0.902
38


Ala 102 A A . . . . . 1.84 -1.43. . F 0.75.
0
74


Arg 103 A A . . . . . 1.14 -0.93. 0.60.
0
58


Ala 104 A A . . . . . 0.83 -0.43. * 0.30.
0
34


Cys 105 A A . . . . . 0.80 0.06. * -0 .
30 0
48


His 106 A A . . . . . 0.80 0.06* * . .
. -0.300
34


Ala 107 A A . . . . . 1.50 0.46* * -0.60.
~ 0
53


Thr 108 A A . . . . . 0.80 -0.04* * 0.45.
. 1
95


His 109 . A . . T . . 0.72 -0.11* . 1.13.
1
45


Asn I10 . A . . T . . 1.50 -0.04* . 1 .
26 0
77


Arg 111 . A . . T . . 0.87 -0.54. * . . .
1.991
04


Ala 112 . A . . T . . 1.57 -0.46. * . 1.82.
0.41





CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
Table
I (continued)


Res ositionI II IIIIV V VI VII VIIIIX X XI XII XIIIXN
P


5 '


Cys 113 . . . . T T . 1.57-0.96 * 2.800.50
.


Arg 114 . B . . T . 1.26-0.87 * . 2.120.37
*


Cys 115 . . . T T 0.56-0.44 * 1.940.36
*


Arg 116 . . . T T . -0.26-0.16 * 1 0
. 66 58


10 Thr 117 . A . B T . . -0.260.06 * F . .
0.530.26


Gly 118 . A . B T . . 0.380.56 * -0.200.49
.


Phe 119 . A B B . . . -0.320.49 * -0.600.34
.


Phe 120 . A B B . . -0.000.99 * -0.600.24
.


Ala 12l A A . B . . . -0.810.93 * -0 0
. 60 24


15 His 122 A A . . . . . -1.171.29 . . .
. -0.600.24


AIa 123 A A . . . -1.631.07 * -0.600.15
.


Gly 124 A A . . . . . -0.930.97 * -0.600.12
.


Phe 125 A A . . . . -0.270.47 . -0.600
. 15


Cys 126 A A . . . . -0.270:47 * -0 .
. 60 0
20


20 Leu 127 A A . . . -0.530.47 . . .
. -0.600
21


Glu 128 A A . . . -0.610.43 . -0.60.
. 0.32


His 129 . . . . T T . -0.480.21 . 0.500
. 32


Ala 130 . . . . T T 0.010.07 . 0.63.
. 0.61


Ser 131 . . . . T T . 0.33-0.19 . 1 0
. 36 54


25 Cys 132 . . . . . T C 0.560.24 . ~ . .
. 0.690.39


Pro 133 . . . . . T C 0.210.24 . F 0.970
39


Pro 134 . . . . T T . -0.610.17 . F 1.30.
. 0.29


Gly 135 . . . . T T . -0.910.43 . F 0.870.40
.


Ala 136 . . B . . T . -1.200.54 . 0 0
. 19 18


30 G l 13 . . B B . . . -0.740.61 . . .
y 7 . -0.340.12


Val 138 . . B B . . . -0.880.61 . . -0.470.19
.


Ile 139 . . B B . . . -0.980.61 . . -0.600.18
.


Ala 140 . . B B . . . -0.840.60 . . -0.600.27
.


Pro 141 . . B . . . -0.560.60 . F -0 0
. 25 55


Gly 142 . . . . T . . -0.210.34 . F . .
. 0.881.06


Thr 143 . . . . . T C 0.640.06 . F 1.161.82
.


Pro 144 . . . . . T C 1.22-0.04 . F 2.041.89
.


Ser 145 . . . . T T . 1.810.01 . F 1.922
. 76


Gln 146 . . . . T T . 1.36-0.01 . F 2 .
. 80 31
3


Asn 147 . . . . T T . 1.700.07 . F . .
. 1.921.15


Thr 148 . . . . T T . 1.800.04 . F 1.641
. 48


Gln 149 . . . . T T . 1.340.09 . F 1.36.
. 1
32


Cys 150 . . B . . T . 1.430.26 F 0.53.
. 0
44


Gln 151 . . B . . . . 1.220.29 . F 0 .
. 05 0
47


Pro 152 . . B . . . . 0.880.23 * F . .
. 0.050
42


Cys 153 . . B . . . . 0.880.26 * F 0.05.
. 0.78


Pro 154 . . B . . T . 0.180.17 * F 0.250.65
.


Pro 155 . . . . T T . 0.540.56 * F 0.350.36
.


Gly 156 . . . . T T . -0.040.51 * F 0 0
. 35 91


Thr 157 . . B . . T . -0.130.44 . F . .
. -0.050
59


Phe 158 . . B . . . . 0.230.40 . F -0.25.
. 0.51


Ser 159 . . B . . . . 0.140.36 . F 0.390
. 70


Ala 160 . . B . . . . 0.060.31 . F 0.73.
. 0.65


Ser 161 . . . . . T C 0.100.21 . F 1 1
. 62 00


Ser 162 . . . . . T C 0.41-0.19 . F . .
. 2.561
00


Ser 163 . . . . T T . 1.11-0.57 F 3.40.
. 1.72


Ser 164 . . . . T T . 0.74-0.67 . F 3.062
. 22


Ser 165 . . . T . . 1.33-0.49 . F 2.07.
. 0
89


Glu 166 . . . . T . . 1.42-0.47 . F 1 .
. 88 1
15


Gln 167 . . . . T . . 1.69-0.43 . F . .
. 1.821.32


Cys 168 . . . . T . . 2.10-0.31 . F 1.761.34
.





CA 02362929 2001-08-16
WO 00/52028 PCT/LJS00/05686
31
Table
I (continued)


Res osition1 II III N V VI VII VIII IX X XI XIlXIII XN
P



Gln 169 . . B . . . . 2.40 -0.70. . F 1.94 1.52


Pro 170 . . . . T . . 2.03 -0.30. . F 2.32 1.41


His 171 . . . . T T . 1.72 -0.13. . F 2.80 1.41


Arg 172 . . . . T T . 1.13 -0.21. . F 2.52 1.18


Asn 173 . . . . T T . 0.99 -0.11* . . 1.94 0.77


Cys 174 . . B . . T . 0.64 0.14. . 0.66 0.47


Thr 175 . A B . . . . 0.04 0.07. . . -0.020.24


Ala 176 . A B . . . . -0.510.76* . -0.600.12


Leu 177 . A B . . . . -1.430.86* . -0.600.23


Gly 178 . A B . . . -1.430.97. * . -0.600.13


Leu 179 . A B . . . . -1.620.89. * . -0.600.21


Ala 180 . A B . . . . -1.521.03. * . -0.600.19


Leu 181 A B . . . . -1.280.77. * -0.600.29


Asn 182 . A B . . . . -0.770.77 * . -0.600.35


Val 183 . . B . . T . -0.720.47. * F -0.050.46


Pro 184 . . . . . T C -0.210.36. * F 0.73 0.75


Gly 185 . . . T T 0.34 0.06. * F 1.21 0.63


Ser 186 . . . T T 1.16 0.16. * F 1.64 1.15


Ser 187 . . . . . T C 0.84 -0.49. F 2.32 1.24


Ser 188 . . . . T T . 0.89 -0.43. . F 2.80 1.81


His 189 . . B . . T . 0.43 -0.17. . F 2.12 I.11


Asp 190 . . . . T T . 0.47 0.01. . F 1.49 0.45


Thr 191 . . B . . . . 0.47 0.11. . F 0.61 0.48


Leu 192 . . B . . . . 0.10 0.11. . . 0.18 0.47


Cys 193 . . B . . T . 0.09 0.19. . . 0.10 0.15


Thr 194 . . B . . T . -0.220.67. . . -0.200.15


Ser 195 . . B . . T . -0.920.61* . F -0.050.18


Cys 196 . . B . . T . -0.820.71. . F -0.050.29


Thr 197 . . . . T . . -0.820.57. F 0.15 0.31


Gly 198 . . . . T . . -0.460.77. . . 0.00 0.19


Phe 199 . . B . . . . -0.460.77. * . -0.400.48


Pro 200 . . B . . . . -0.040.69* * . -0.400.48


Leu 201 . . B . . . . -0.230.20* * . -0.100.96


Ser 202 . . B . . . , -0.130.41* * F 0.02 0.82


Thr 203 . . B . . . . -0.130.06. * F 0.59 0.82


Arg 204 . . . . . . C -0.020.06. * F 1.06 0.99


Val 205 . . . . . T C 0.19 -0.13. * F 2.13 0.74


Pro 206 . . . . . T C I.00 -0.51. * F 2.70 0.89


Gly 207 . . . . . T C 0.63 -I.00. * F 2.43 0.79


Ala 208 A . . . . T . 0.94 -0.43. * F 1.66 0.57


Glu 209 A A . . . . . 0.94 -1.07. * F 1.29 0.64


Glu 210 A A . . . . . 1.21 -1.50* . F 1.17 1.26


Cys 211 A A . . . . . 0.57 -1.43* . F 0.90 1.26


Glu 212 A A . . . . . 0.02 -1.29* * F 0.75 0.54


Arg 213 A A . . . . . 0.61 -0.60* * . 0.60 0.22


Ala 214 A A . . . . . -0.09-0.60* * . 0.60 0.68


Val 215 A A . . . . . -0.94-0.39* * . 0.30 0.34


Ile 216 A A . . . . . -0.870.26* * . -0.300.13


Asp 217 A A . . . . . -1.570.76* * . -0.600.13


Phe 218 A A . . . . . -1.681.04* * . -0.600.15


Val 219 A A . . . . . -1.090.80. . . -0.600.37


Ala 220 A A . . . . . -1.120.11. . . -0.300.37


Phe 221 A A . . . . . -0.530.80. * . -0.600.30


Gln 222 A A . . . . . -1.420.40. * . -0.600.54


Asp 223 A A . . . . . -0.680.44. . F -0.450.38


Ile 224 A A . . . . . 0.29 -0.06. . F 0.45 0.87





CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
32
Table I (continued)
Res Position I II III IV V VI VII VIII IJC X Xl XII XIII XIV
Ser 225 A A . . . . 0.07 -0.84. . F 0.75 0.99


Ile 226 A A . . . . . 0.77 -0.56* . F 0.75 0.49


Lys 227 A A . . . . 0.88 -0.16* * F 0.60 1.20


Arg 228 A A . . . . . 0.07 -0.84* * F 0.90 1.76


Leu 229 A A . . . . . 0.14 -0.54* . F 0 07
90 2


Gln 230 A A . . . . . 0.44 -0.54* . F . .
0.75 0.85


Arg 231 . A B . . . . 0.74 -0.14* . 0.30 0.76


Leu 232 A A . . . . . -0.110.36 * . -0.300.93


Leu 233 . A B . . . -0.220.36 * * . -0.300.44


Gln 234 . A B . . . . -0.00-0.04* . 0 0
30 39


Ala 235 . A B . . . . -0.210.46 * . . . .
-0.600.48


Leu 236 . A B . . . -0.320.20 * * . -0.300.89


Glu 237 . A B . . . . 0.14 -0.49. . 0.30 0.89


Ala 238 . . B . . T 0.67 -0.46 F 0.85 0.88
~ .


Pro 239 . . . . T T . 0.32 -0.04 F 1 1
. . ~ 40 12


Glu 240 . . . T T . 0.70 -0.30 F . .
. . 1.25 0.64


Gly 241 . . . . T T . 1.20 0.13 F 0.65 0.98


Tip 242 . . . . T 0.99 0.11 * . F 0.45 0.91


Gly 243 . . . . . C 1.69 0.11 * * F 0.59 0.81


Pro 244 . . . . . . C 1.31 0.11 * * F 1 1
08 61


Thr 245 . . . . . T C 0.97 0.19 * . F . .
1.62 1
55


Pro 246 . . . . . T C 1.42 -0.30* . F 2.56 .
1.55


Arg 247 . . . . T T . 1.12 -0.73* F 3.40 1.96


AIa 248 . . . . . T C 0.88 -0.66* . F 2.86 1
37


Gly 249 A A . . . . . 0.28 -0.64* * F 1 .
77 0
90


Arg 250 A A . . . . . 0.59 -0.39* * . .
0.98 0.38


A1a 251 A A . . . . . -0.010.01 * * . 0.04 0.65


Ala 252 A A . . . . . -0.080.20 * * -0.300.54


Leu 253 A A . . . . . -0.30-0.23* * . 0.30 0.55


Gln 254 A A . . . . . 0.16 0.46 . * -0 0
60 45


Leu 255 A A . . . . . 0.16 -0.04. * . . .
0.30 0.87


Lys 256 A A . . . . . 0.86 -0.54. * 0.75 2.07


Leu 257 A A . . . . . 0.63 -1.23. * F 0.90 2.34


Arg 258 A A . . . . . 1.13 -0.94* * F 0.90 2.34


Arg 259 . A B . . . . 1.13 -1.14* * F 0 1
90 69


Arg 260 . A B . . . . 1.13 -1.14* * F . .
0.90 3.55


Leu 261 . A B . . . . 0.28 -1.14* * F 0.90 1.49


Thr 262 . A B . . . . 0.74 -0.46* * F 0.45 0.63


Glu 263 . A B . . . . 0.04 -0.03* * . 0.30 0.32


Leu 264 . A B . . . -0.070.47 * . -0 0
60 39


Leu 265 . A B . . . . -0.180.19 . * . . .
. -0.300.47


Gly 266 A A . . . . . 0.29 -0.30. . 0.30 0.45


Ala 267 A . . . . T . 0.01 0.13 F 0.25 0
54


Gln 268 A . . . . T . -0.80-0.06. . F 0.85 .
0.66


Asp 269 A . . . . T . -0.80-0.06. F 0 55
85 0


Gly 270 A . . . . T . -0.840.20 * * . .
0.10 0
45


Ala 271 A A . . . . . -0.390.34 * * . -0.30.
0
19


Leu 272 . A B . . . . -0.61-0.06* * 0.30 .
. 0
23


Leu 273 . A B . . . . -1.420.63 * * -0.60.
0.19


Val 274 A A . . . . . -1.420.89 * * -0 0
60 15


Arg 275 A A . . . . . -1.670.79 * * . . .
~ -0.600.32


Leu 276 A A . . . . . -1.890.60 * * -0.600.40


Leu 277 A A . . . . . -0.970.60 * * . -0.600
44


Gln 278 A A . . . . . -1.01-0.04* * 0.30 .
. 0
44


Ala 279 A A . . . . . -0.740.60 * * -0 .
60 40
0


Leu 280 A A . . . . . -0.740.41 * * . . .
-0.600.49





CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
33
Table I (continued)


Res Position1 II III N V Vl VII VIII I~C X XI XIIXIII XIV



Arg 281 . A B . . -0.53 -0.27* . 0.30 0.55


Val 282 A B . 0.07 -0.06* . 0.30 0.54


Ala 283 . A B . . -0.28 -0.13* . 0.72 1.01


Arg 284 A B . . . . -0.50 -0.39* . 0 0
84 51


Met 285 . . B . T . 0.31 0.30 * . .
0.91 0.57


Pro 286 . . . . . T C 0.31 -0.34. * F 2.13 0.97


Gly 287 . . . . T C 0.87 -0.84* * F 2.70 0.97


Leu 288 A T 0.60 -0.46* * F 2.08 1.32


Glu 289 A . . . . . . 0.60 -0.43* * F 1.46 0
63


IS Arg 290 A . . . . . 1.20 -0.86* * F 1.64 .
1.25


Ser 291 A . . . . 1.52 -1.29* * F 1.37 2.62


Val 292 A . . . . . . 1.17 -1.97* * F 1.10 2.97


Arg 293 A . . . 1.17 -1.19* * F 1.10 1.31


Glu 294 A . . 0.96 -0.50* * F 0.65 0
81


Arg 295 A . . . -0.01 -0.46* * F 0.80 .
1.68


Phe 296 B 0.26 -0.46 * 0.50 0.64


Leu 297 . . B . . . 0.72 0.04 * -0.100.50


Pro 298 A . . . , 0.22 0.47 * . -0.400.33


Val 299 A . . . -0.17 0.90* . -0 0
40 48


His 300 A . . . . . . -0.67 0.54 . . . .
-0.400.75





CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
34
Table II
Res Position I Il III N V VI VII VIII IX X XI XII XIII XIV
Met 1 . B . . 0.06 0.09 * . -0.100.60


Arg 2 . B . . . 0.10 -0.34* . . 0.50 0.82


Ala 3 . . B . . 0.28 -0.34* 0.50 0.63


Leu 4 . . B . . . . 0.32 -0.34. . 0.50 0.99


Glu 5 . . B . . -0.10-0.53. . F 95 0
0 50


IO Gly 6 . . . . . T C 0.20 0.16 * . F . .
0.45 0.41


Pro 7 . . . . T T . -0.720.04 * F 0.65 0.66
~


Gly 8 . . . . T T . -0.940.04 F 0.65 0.32


Leu 9 . . B . . T . -0.800.73 . . . -0.200.26


Ser 10 . A B . . . . -1.610.87 . -0 0
60 09


Leu II . A B . . . . -2.121.13 . . . .
-0.600.08


Leu 12 . A B . . . -2.721.34 . -0.600.07


Cys 13 . A B . . . . -2.971.34 . -0.600.04


Leu 14 . A B . . . . -2.971.46 . . . -0.600.05


Val 15 A B . . . -2.88t.46 . . -0 0
60 05


Leu 16 . A B . . . . -2.661.20 . . . .
-0.600.15


Ala 17 . A B . . -2.661.13 . . -0.600.18


Leu 18 . A B . . . . -2.801.13 . -0.600.20


Pro 19 . A B . . . -2.201.17 . -0.600.20


Ala 20 . A B . . . -2.200.91 . -0 0
60 31


Leu 21 . A B . . . -1.601.06 . * . .
-0.600.28


Leu 22 . A B . . . . -1.600.80 . . -0.600.28


Pro 23 . A B . . . . -1.640.87 . * . -0.600.28


Val 24 . . B . . . . -1.321.01 . * -0.400.25


Pro 25 . . B . . . . -1.080.33 . . -0 0
10 60


Ala 26 . . B B . . . -1.120.07 . . . . .
-0.300.38


Val 27 . . B B . . . -0.900.29 * * . -0.300.38


Arg 28 . . B B . . . -0.690.14 * * -0.300.25
.


Gly 29 . . B B . . . -0.14-0.29* * 0.30 0.43
.


Val 30 . . B B . . . -0.14-0.30* * 0 0
30 83


Ala 31 . . B B . . . 0.13 -0.51* * . . .
0.60 0.66


Glu 32 . . B . . . . 0.74 -0.03* * F 0.65 0.96


Thr 33 . . B . . T . 0.42 0.30 * * F 0.40 2.02


Pro 34 . . . . T T . 0.48 0.09 * * F 0.80 3.10


Thr 3 5 . . . T T . 1.44 0.50 * F 0 I
. . 50 88


Tyr 36 . . . . . T C 2.03 0.50 * . .
. 0.15 2.55


Pro 37 . . . . T . . 1.44 0.01 * . 0.45 2.76
.


Trp 3 8 A . . . . C 1.76 0.09 * . 0.05 1.93
.


Arg 3 9 A B . . . . 1.66 -0.40* . F 0.60 2.13
.


Asp 40 . A . . . . C 1.62 -0.67* . F 1 1
10 99


Ala 41 . A . . . . C 1.87 -0.67* * F . .
1.10 1.87


Glu 42 . A . . . . C 2.19 -1.59* * F 1.10 1.66


Thr 43 . A . . T . . 1.67 -1.59* F 1.30 1.94


Gly 44 . A . . T . . 0.70 -0.90* . F 1.30 1.59


Glu 45 . A . . T . . 0.03 -0.76* * F 1 0
15 68


Arg 46 . A . . T . . 0.03 -0.19* . F . .
0.85 0.25


Leu 47 . A B . . . . 0.03 -0.17* . 0.30 0.26


Val 48 . A B . . . . -0.32-0.20. . 0.30 0.26


Cys 49 . A B . . . . -0.190.37 . . -0.300.07


Ala 50 . A B . . . . -0.400.80 . . . -0 0
60 13


Gln 51 . A B . . . . -0.860.54 . . . . .
-0.600.28


Cys 52 . A B . . . . -0.360.33 . . -0.300.51


Pro 53 . . . . . T C -0.200.24 . . F 0.45 0.73


Pro 54 . . . . T T . -0.390.53 F 0.35 0.36
~


Gly 55 . . . . T T . 0.20 0.77 * F 0 50
35 0


Thr 56 . . B . . T . 0.31 0.60 . . F . .
-0.050.56





CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
Table
II
(continued)


Res ositionI II III N V V'I VII VIII IX X XI XIIXIIIXN
P


5


Phe S7 . . B B . . 0.77 0.17* F -0.150.71


Val 58 . B B . . . 0.31 0.17* . . 0.191.12


Gln 59 . . B B . . . 0.63 0.31* F 0.530.41


Art 60 . . B . . T . 1.09 -0.17* F 1.870
~ 94


10 Pro 61 . . B . . T . 1.40 -0.96* F 2.66.
2.47


Cys 62 . . . . T T . 1.80 -1.60* . F 3.402.38


Arg 63 . . . . T T . 2.44 -1.61* . F 3.061.63


Arg 64 . . . . T . . 2.13 -1.19* . F 2.771.63


Asp 6S . . . . T . . 1.71 -1.13* F 2 4
. 68 39


15 Ser 66 . . . T T . 1.26 -1.21. F . .
2.793.24


Pro 67 . . . . T T . 1.58 -0.64 . F 2.550.89


Thr 68 . . . . T T . 1.26 -0.21. . F 2.500.52


Thr 69 . . . . T T . 0.48 0.21 . F 1.650.61


Cys 70 . . . . T . 0.27 0.40 . F 1 0
14 21


20 Gly 71 . . . T T . 0.36 0.40. * F . .
1.330.22


Pro 72 . . . . T T . 0.68 0.34 * F 1.620.24


Cys 73 . . . . T C 0.96 -0.14* F 2.010.88


Pro 74 . . . . . T C 1.02 -0.21* . F 2.401.21


Pro 7S . . . . T T . 1.38 0.11* * F 1 1
76 23


25 Arg 76 . . . . T T . 1.72 0.17* * F . .
1.523.30


His 77 . . B . . T . 1.23 0.00* * F 0.883.70


Tyr 78 . . B . . T . 1.61 0.36* * . 0.492.07


Thr 79 . . B . . . . 1.82 0.84* * . -0.251.11


Gln 80 . . B . . . 1.79 1.24* * . -0 1
25 31


30 Phe 81 . . . . T . . 0.87 1.50* * . . .
0.151.31


Trp 82 . . . . T . . 0.90 1.43* . . 0.000.75


Asn 83 . A . . T . . 1.26 0.94* . -0.200.75


Tyr 84 . A . . T . . 0.90 0.54* * . -0.051.70


Leu 85 . A . . T . . 1.01 0.33* * 0 0
. 38 87


35 Glu 86 . A . . T . . 1.47 -0.59* * . .
~ 1.711.05


Arg 8 . A . . T . . 1.09 -0.23. * 1.691.05
7 .


Cys 88 . . . . T T . 1.09 -0.41. * 2.220.69
~


Arg 89 . . . . T T . 0.48 -0.70. * 2.800.64
.


Tyr 90 . . . . T T . 0.48 -0.06. * 2 0
22 24


Cys 91 . . . . T T . -0.190.63. * . . .
1.040.37


Asn 92 . . B B . . -0.640.63. * . -0.040.10


Val 93 . . B B . . . 0.02 1.06. * . -0.020.06


Leu 94 . . B B . . . 0.02 0.30. . . 0.300.21


Cys 95 . . B . . T . 0.27 -0.27 1 0
60 25


Gly 96 . . . . . T C 0.93 -0.67. . F . .
2.550.59


Glu 97 . . . . . T C 0.93 -1.31. . F 3.001.24


Arg 98 A . . . . T . 1.20 -2.00. * F 2.504.00


Glu 99 A A . . . . . 2.12 -2.07. * F 1.804.08


Glu 100 A A . . . . . 2.20 -2.50. * F 1 4
50 61


Glu 101 A A . . . . . 1.88 -2.00. * F . .
1.202.38


Ala 102 A A . . . . . 1.84 -1.43. . F 0.750.74


Arg 103 A A . . . . . 1.14 -0.93. . . 0.600.58


Ala 104 A A . . . . 0.83 -0.43. * . 0.300.34


Cys 105 A A . . . . . 0.80 0.06. * -0 0
30 48


His 106 A A . . . . . 0.80 0.06* * . . .
-0.300.34


Ala 107 . A . . T . . 1.50 0.46* * -0.20O.S3
.


Thr 108 . A . . T . . 0.80 -0.04* * 0.851.95
.


His 109 . A . . T . . 0.72 -0.11* . 1.131.45
.


Asn 110 . A . . T . . 1.50 -0.04* 1 0
26 77


Arg 111 . A . . T . . 0.87 -0.54. * . . .
1.991.04


Ala 112 . A . . T . 1.57 -0.46 * . 1.820.41





CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
36
Table II (continued)
Res Position I II III N V VI VII VIII IX X XI XII XIII XN
Cys 113 . . . T T . 1.57 -0.96. * . 2.80 0.50
.


Arg 114 . B . . T . 1.26 -0.87. * . 2.12 0.37
.


Cys 115 . . . T T . 0.56 -0.44* * . 1.94 0.36
.


Arg 116 . . . T T . -0.26-0.16. * . 1.66 0.58
.


Thr 117 A . B T . . -0.260.06 . * F 0.53 0.26
.


Gly I18 A . B T . 0.38 0.56 . * . -0.200.49
.


Phe 119 A B B . . . -0.320.49 . * . -0.600.34
.


Phe 120 A B B . . . -0.000.99 . * . -0.600.24


Ala 121 A B B . . . -0.810.93 . * . -0.600.24
.


His 122 A . . . . C -1.171.29 * -0.400.24
.


Ala 123 A . . . . C -1.631.07 . * . -0.400.15
.


G l 124 A . . T . -0.930.97 . * . -0.200.12
y .


Phe 125 A . . T . -0.270.47 . . -0.200.15
.


Cys 126 A . . T . -0.270.47 . * . -0.200.20
.


Leu 127 A B . . . -0.530.47 . . . -0.600.21
.


Glu 128 A B . T . . -0.610.43 . -0.200.32
.


His 129 . . . T T -0.480.21 . . . 0.50 0.32
.


Ala 130 . T T 0.01 0.07 . . . 0.63 0.61
.


Ser 131 . . T T 0.33 -0.19. . . 1.36 0.54
.


Cys 132 . . . . T C 0.56 0.24 . 0.69 0.39
.


Pro 133 . . . . T C 0.21 0.24 . . F 0.97 0.39
.


Pro 134 . . . T T . -0.610.17 . . F 1.30 0.29
.


Gly 135 . . . T T . -0.910.43 . . F 0.87 0.40
.


Ala 136 . B . . T . -1.200.54 . . 0.19 0.18
.


G l 13 7 . B B . . . -0.740.61 . -0.340.12
y .


Val 138 . B B . . . -0.880.61 . . . -0.470.19
.


Ile 139 . B B . . . -0.670.61 . . . -0.600.18
.


Ala 140 . B . . T . -0.620.11 . . . 0.10 0.32
.


Pro 141 . B . . T . -0.320.07 . . F 0.25 0.58
.


Gly 142 . . . . T C -0.570.34 * * F 0.45 0.86
.


Glu 143 . . . . T C 0.40 0.16 * * F 0.45 0.86
.


Ser 144 . B . . . . 0.94 -0.34* * F 0.80 1.10
.


Trp 145 . . . T . . 1.19 -0.34* * F 1.20 1.10
.


Ala 146 . B . . T . 0.81 -0.34* * F 0.85 0.63
.


Arg 147 . . . T T . 0.94 0.16 * * F 0.65 0.47
.


Gly 148 . . . T T . 1.06 0.20 . * F 0.65 0.69
.


Gly 149 . . . . T C 1.06 -0.71. . F 1.84 1.35
.


Ala 150 . . . . . C 1.00 -0.83. . F 1.83 0.92
.


Pro 1 S . . . . C 1.24 -0.40. * F 1.87 0.92
1 .


Arg 152 . . . T T . 1.24 -0.40 F 2.61 0.92
.


Ser 153 . . . T T . 1.70 -0.83* . F 3.40 1.78
.


Gly 154 . . . T T . 1.38 -1.33* * F 3.06 2.26
.


Gly 155 . . . T T . 1.62 -1.19* * F 2.57 0.62
.


Arg 156 . . . T . . 1.94 -0.76* * F 2.26 0.46
.


Arg 157 . . . T . . 1.49 -1.14* * F 2.15 0.90
.


Cys 158 . B . . . . 1.79 -1.14* * F 1.64 0.90
.


Gly 159 . . . T T . 1.28 -1.17* * F 2.47 0.80
.


Arg 160 . B . . T . 1.03 -0.53* * F 2.30 0.30
.


Gly 161 . B . . T . 0.58 -0.03* * F 1.77 0.57
.


Gln 162 . B . . T . 0.26 -0.17* * F 1.54 0.57
.


Val 163 . B . . . . 0.62 -0.17. * F 1.11 0.45
.


Ala 164 . B . . . . 0.16 0.21 . * F 0.28 0.61
.


Gly 165 . B . . T . -0.540.47 . * F -0.050.29
.


Pro 166 . B . . T . -0.410.57 . . F -0.050.40
.


Ser 167 . . . . T C -0.800.36 F 0.45 0.61
.


Leu 168 . B . . T . -0.330.29 . . . 0.10 0.78
.


Ala 169 . B . . . . -0.130.29 . . . -0.100.65
.


Pro 170 . B . . . . -0.180.29 . . . -0.100.62
.





CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
37
Additional preferred nucleic acid fragments of the present invention
comprise, or alternatively consist of, nucleic acid molecules encoding one or
more epitope-bearing portions of TNFR-6a and/or TNFR-6(3. In particular,
such nucleic acid fragments of the present invention include nucleic acid
molecules encoding: a polypeptide comprising, or alternatively consisting of,
amino acid residues from about Phe-57 to about Thr-117, from about Cys-132
to about Thr-175, from about Gly-185 to about Thr-194, from about Val-205
to about Asp-217, from about Pro-239 to about Leu-264, and/or from about
Ala-283 to about Pro-298 in SEQ ID N0:2. In additional embodiments,
to nucleic acid fragments of the present invention comprise, or alternatively
consist of nucleic acid molecules encoding one or more epitpope bearing
portions of TNFR-6(3 from about Ala-31 to about Thr-46, from about Phe-57
to about Gln-80, from about Glu-86 to about His-106, from about Thr-108 to
about Phe-119, from about His-129 to about Val-138, and/or from about Gly-
142 to about Pro-166 in SEQ ID N0:4. In this context "about" includes the
particularly recited ranges and rangers larger or smaller by several (5, 4, 3,
2, or
1 ) amino acids at either terminus or at both termini. These polypeptide
fragments have been determined to bear antigenic epitopes of the TNFR-6a
and TNFR-6(3 polypeptides respectively, by the analysis of the Jameson-
2o Wolf antigenic index, as shown in Figures 4 and 5, above. Further,
polypeptide
fragments which bear antigenic epitopes of TNFR-6a and/or TNFR-6(3 may
be easily determined by one of skill in the art using the above-described
analysis of the Jameson-Wolf antigenic index, as shown in Figures 4 and 5.
Methods for determining other such epitope-bearing portions of TNFR-6a
and/or TNFR-6(3 are described in detail below.
In specific embodiments, the nucleic acids of the invention are less than
100000 kb, 50000 kb, 10000 kb, 1000 kb, 500 kb, 400 kb, 350 kb, 300 kb, 250



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
38
kb, 200 kb, 175 kb, 150 kb, 125 kb, 100 kb, 75 kb, 50 kb, 40 kb, 30 kb, 25 kb,
20 kb, 15 kb, 10 kb, 7.5 kb, or 5 kb in length.
In further embodiments, nucleic acids of the invention comprise at least
15, at least 30, at least 50, at least 100, or at least 250, at least 500, or
at least
1000 contiguous nucleotides of TNFR coding sequence, but consist of less
than or equal to 1000 kb, 500 kb, 250 kb, 200 kb, 150 kb, 100 kb, 75 kb, 50
kb, 30 kb, 25 kb, 20 kb, 15 kb, 10 kb, or 5 kb of genomic DNA that flanks the
5' or 3' coding nucleotide sequence set forth in Figure 1 (SEQ ID NO:1 ) or
Figure 2 (SEQ ID N0:3). In further embodiments, nucleic acids of the
l0 invention comprise at least 15, at least 30, at least 50, at least 100, or
at least
250, at least 500, or at least 1000 contiguous nucleotides of TNFR coding
sequence, but do not comprise all or a portion of any TNFR intron. In another
embodiment, the nucleic acid comprising TNFR coding sequence does not
contain coding sequences of a genomic flanking gene (i.e., 5' or 3' to the
TNFR
gene in the genome). In other embodiments, the nucleic acids of the invention
do not contain the coding sequence of more than 1000, 500, 250, 100, 50, 25,
20, 15, 10, 5, 4, 3, 2, or 1 genomic flanking gene(s).
In another aspect, the invention provides an isolated nucleic acid
molecule comprising, or alternatively consisting of, a polynucleotide which
hybridizes under stringent hybridization conditions to a portion of the
polynucleotide in a nucleic acid molecule of the invention described above,
for
instance, the cDNA contained in the plasmid deposited as ATCC Deposit No.
97810 or 97809, or a fragment of the polynucleotide sequence disclosed in
Figure 1 and/or Figure 2. By "stringent hybridization conditions" is intended
overnight incubation at 42° C in a solution comprising: 50% formamide,
5x
SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM sodium phosphate
(pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 ~g/ml denatured,
sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at
about 65° C.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
39
By a polynucleotide which hybridizes to a "portion" of a
polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing
to at least about 15 nucleotides (nt), and more preferably at least about 20
nt,
still more preferably at least about 30 nt, and even more preferably about
30-70 (e.g., 50) nt of the reference polynucleotide. These have uses that
include, but are not limited to, as diagnostic probes and primers as discussed
above and in more detail below.
By a portion of a polynucleotide of "at least about 20 nt in length," for
example, is intended 20 or more contiguous nucleotides from the nucleotide
to sequence of the reference polynucleotide (e.g., a deposited cDNA or a
nucleotide sequence as shown in Figure 1 or 2 (SEQ ID NO:1 or 3)). In this
context "about" includes the particularly recited size, and those sizes that
are
larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either
terminus or at
both termini. Of course, a polynucleotide which hybridizes only to a poly A
sequence (such as the 3' terminal poly(A) tract of a TNFR cDNA, or to a
complementary stretch of T (or U) residues, would not be included in a
polynucleotide of the invention used to hybridize to a portion of a nucleic
acid
of the invention, since such a polynucleotide would hybridize to any nucleic
acid molecule containing a poly (A) stretch or the complement thereof (e.g.,
2o practically any double-stranded cDNA clone that has been generated using
oligo dT as a primer).
As indicated, nucleic acid molecules of the present invention which
encode a TNFR polypeptide may include, but are not limited to, those
encoding the amino acid sequence of the mature polypeptide, by itself; and the
coding sequence for the mature polypeptide and additional sequences, such as
those encoding the about 26-35 amino acid leader or secretory sequence, such
as a pre-, or pro- or prepro- protein sequence; the coding sequence of the
mature polypeptide, with or without the aforementioned additional coding
sequences.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
Also encoded by nucleic acids of the invention are the above protein
sequences together with additional, non-coding sequences, including for
example, but not limited to introns and non-coding 5' and 3' sequences, such
as the transcribed, non-translated sequences that play a role in
transcription,
5 mRNA processing, including splicing and polyadenylation signals, for example
- ribosome binding and stability of mRNA; an additional coding sequence
which codes for additional amino acids, such as those which provide additional
functionalities.
Thus, the sequence encoding the polypeptide may be fused to a marker
10 sequence, such as a sequence encoding a peptide which facilitates
purification
of the fused polypeptide. In certain preferred embodiments of this aspect of
the invention, the marker amino acid sequence is a hexa-histidine peptide,
such
as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue,
Chatsworth, CA, 91311 ), among others, many of which are commercially
15 available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-
824
(1989), for instance, hexa-histidine provides for convenient purification of
the
fusion protein. The "HA" tag is another peptide useful for purification which
corresponds to an epitope derived from the influenza hemagglutinin protein,
which has been described by Wilson et al., Cell 37: 767 (1984). As discussed
20 below, other such fusion proteins include a TNFR-6cc or TNFR-6(3 fused to
Fc at the N- or C-terminus.
The present invention further relates to variants of the nucleic acid
molecules of the present invention, which encode portions, analogs or
derivatives of a TNFR polypeptide. Variants may occur naturally, such as a
25 natural allelic variant. By an "allelic variant" is intended one of several
alternate forms of a gene occupying a given locus on a chromosome of an
organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).
Non-naturally occurring variants may be produced using art-known
mutagenesis techniques which include, but are not limited to oligonucleotide



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
41
mediated mutagenesis, alanine scanning, PCR mutagenesis, site directed
mutagenesis (see e.g., Carter et al., Nucl. Acids Res. 13:4331 (1986); and
Zoller et al., Nucl. Acids Res. 10:6487 (1982)), cassette mutagenesis (see
e.g.,
Wells et al., Gene 34:315 (1985)), restriction selection mutagenesis (see
e.g.,
Wells et al., Philos. Traps. R. Soc. London SerA 317:415 ( 1986)).
Thus, the invention also encompasses TNFR variants (e.g., derivatives
and analogs) that have one or more amino acid residues deleted, added, or
substituted to generate TNFR polypeptides that are better suited for
expression, scale up, etc., in the host cells chosen. For example, cysteine
residues can be deleted or substituted with another amino acid residue in
order
to eliminate disulfide bridges; N-linked glycosylation sites can be altered or
eliminated to achieve, for example, expression of a homogeneous product that
is more easily recovered and purified from yeast hosts which are known to
hyperglycosylate N-linked sites. To this end, a variety of amino acid
substitutions at one or both of the first or third amino acid positions on any
one or more of the glycosylation recognition sequences in the TNFR
polypeptides of the invention, and/or an amino acid deletion at the second
position of any one or more such recognition sequences will prevent
glycosylation of the TNFR at the modified tripeptide sequence (see, e.g.,
Miyajimo et al., EMBO J 5(6):1193-97). Additionally, one or more of the
amino acid residues of the polypeptides of the invention (e.g., arginine and
lysine residues) may be deleted or substituted with another residue to
eliminate undesired processing by proteases such as, for example, furins or
kexins. For example, polypeptides of the invention containing carboxy
terminal TNFR polypeptide sequences may have the amino acid residue
corresponding to the arginine residue at position 290 and/or 295 of SEQ ID
N0:2 deleted or substituted with another residue.
Variants of the invention include those produced by nucleotide
substitutions, deletions or additions. The substitutions, deletions or
additions



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
42
may involve one or more nucleotides. The variants may be altered in coding
regions, non-coding regions, or both. Alterations in the coding regions may
produce conservative or non-conservative amino acid substitutions, deletions
or additions. Especially preferred among these are silent substitutions,
additions and deletions, which do not alter the properties and activities of
the
TNFR polypeptide or portions thereof. Also especially preferred in this
regard are conservative substitutions.
Highly preferred are nucleic acid molecules encoding a mature protein
having an amino acid sequence shown in SEQ ID NOS:2 and 4 or the mature
l0 TNFR polypeptide sequences encoded by the cDNA clone contained in the
plasmid deposited as ATCC Deposit No. 97810 or ATCC Deposit No.
97809.
Further embodiments include an isolated nucleic acid molecule
comprising, or alternatively consisting of, a polynucleotide having a
nucleotide
sequence at least 90% identical, and more preferably at least 80%, 85%, 90%,
92%, or 95%, 96%, 97%, 98% or 99% identical to a polynucleotide selected
from the group consisting o~ (a) a nucleotide sequence encoding a TNFR
polypeptide having the complete amino acid sequence in SEQ ID N0:2 or 4,
or as encoded by the cDNA clone contained in the plasmid deposited as
ATCC Deposit No. 97810 or 97809; (b) a nucleotide sequence encoding a
mature TNFR polypeptide having an amino acid sequence at positions 31-300
or 31-170 in SEQ ID N0:2 or 4, respectively, or as encoded by the cDNA
clone contained in the plasmid deposited as ATCC Deposit No. 97810 or
97809; (c) a nucleotide sequence encoding a soluble extracellular domain of a
TNFR polypeptide having the amino acid sequence at positions 31-283 and
31-166 of SEQ ID NOS:2 and 4, respectively; (d) a nucleotide sequence
encoding a fragment of the TNFR polypeptide having the complete amino acid
sequence in SEQ ID N0:2 or 4, or as encoded by the cDNA clone contained in
the plasmid deposited as ATCC Deposit No. 97810 or 97809, wherein the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
43
fragment has TNFR-6a and/or TNFR-G(3 functional activity; and (e) a
nucleotide sequence complementary to any of the nucleotide sequences in (a),
(b), (c) or (d) above. Polypeptides encoded by the polynucleotides are also
encompassed by the invention.
Further embodiments of the invention include isolated nucleic acid
molecules that comprise a polynucleotide having a nucleotide sequence at least
90% identical, and more preferably at least 80%, 85%, 90%, 92%, or 95%,
96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a),
(b), (c), (d), or (e), above, or a polynucleotide which hybridizes under
stringent
1o hybridization conditions to a polynucleotide in (a), (b), (c), (d), or (e),
above.
This polynucleotide which hybridizes does not hybridize under stringent
hybridization conditions to a polynucleotide having a nucleotide sequence
consisting of only A residues or of only T residues. An additional nucleic
acid
embodiment of the invention relates to an isolated nucleic acid molecule
15 comprising, or alternatively consisting of, a polynucleotide which encodes
the
amino acid sequence of an epitope-bearing portion of a TNFR polypeptide
having an amino acid sequence in (a), (b), (c), (d), or (e), above.
By a polynucleotide having a nucleotide sequence at least, for example,
95% "identical" to a reference nucleotide sequence encoding a TNFR
20 polypeptide is intended that the nucleotide sequence of the polynucleotide
is
identical to the reference sequence except that the polynucleotide sequence
may include up to five point mutations per each 100 nucleotides of the
reference nucleotide sequence encoding the TNFR polypeptide. In other
words, to obtain a polynucleotide having a nucleotide sequence at least 80%,
25 85%, 90%, 92%, or 95% identical to a reference nucleotide sequence, up to
5%
of the nucleotides in the reference sequence may be deleted or substituted
with
another nucleotide, or a number of nucleotides up to 5% of the total
nucleotides in the reference sequence may be inserted into the reference
sequence. These mutations of the reference sequence may occur at the 5' or 3'



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
44
terminal positions of the reference nucleotide sequence or anywhere between
those terminal positions, interspersed either individually among nucleotides
in
the reference sequence or in one or more contiguous groups within the
reference sequence. The reference sequence may be the entire TNFR-6a
and/or TNFR -6(3 encoding sequence shown in Figures 1 (SEQ ID NO:1 and 2)
and Figure 2 (SEQ ID N0:3 and 4) or any fragment, variant, derivative or
analog thereof, as described herein.
As a practical matter, whether any particular nucleic acid molecule is at
least 90%, 95%, 96%, 97%, 98% or 99% identical to. for instance. a nucleotide
l0 sequence shown in Figure 1 or 2, or to the nucleotides sequence contained
in
one or both of the deposited cDNA clones can be determined conventionally
using known computer programs such as the Bestfit program (Wisconsin
Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group,
University Research Park, 575 Science Drive, Madison, WI 53711). Bestfit
uses the local homology algorithm of Smith and Waterman, Advances in
Applied Mathematics 2:482-489 (1981), to find the best segment of homology
between two sequences. When using Bestfit or any other sequence alignment
program to determine whether a particular sequence is, for instance, 95%
identical to a reference sequence according to the present invention, the
2o parameters are set, of course, such that the percentage of identity is
calculated
over the full length of the reference nucleotide sequence and that gaps in
homology of up to 5% of the total number of nucleotides in the reference
sequence are allowed. The reference (query) sequence may be the entire
TNFR encoding nucleotide sequence shown in Figure 1 (SEQ ID NO: l ), Figure
2 (SEQ ID N0:3) or any TNFR-6a and/or TNFR-6(3 polynucleotide
fragment (e.g,. a polynucleotide encoding the amino acid sequence of any of
the
N or C terminal deletions described herein), variant, derivative or analog, as
described herein.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
In a specific embodiment, the identity between a reference (query)
sequence (a sequence of the present invention) and a subject sequence, also
referred to as a global sequence alignment, is determined using the FASTDB
computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci.
5 6:237-245 (1990)). Preferred parameters used in a FASTDB alignment of
DNA sequences to calculate percent identity are: Matrix=Unitary, k-tuple=4,
Mismatch Penalty=1, Joining Penalty=30, Randomization Group Length=0,
Cutoff Score=1, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or
the length of the subject nucleotide sequence, whichever is shorter. According
10 to this embodiment, if the subject sequence is shorter than the query
sequence
because of 5' or 3' deletions, not because of internal deletions, a manual
correction is made to the results to take into consideration the fact that the
FASTDB program does not account for 5' and 3' truncations of the subject
sequence when calculating percent identity. For subject sequences truncated at
15 the 5' or 3' ends, relative to the query sequence, the percent identity is
corrected by calculating the number of bases of the query sequence that are 5'
and 3' of the subject sequence, which are not matched/aligned, as a percent of
the total bases of the query sequence. A determination of whether a nucleotide
is matched/aligned is determined by results of the FASTDB sequence
2o alignment. This percentage is then subtracted from the percent identity,
calculated by the above FASTDB program using the specified parameters, to
arrive at a final percent identity score. This corrected score is what is used
for
the purposes of this embodiment. Only bases outside the 5' and 3' bases of
the subject sequence, as displayed by the FASTDB alignment, which are not
25 matched/aligned with the query sequence, are calculated for the purposes of
manually adjusting the percent identity score. For example, a 90 base subject
sequence is aligned to a 100 base query sequence to determine percent
identity.
The deletions occur at the 5' end of the subject sequence and therefore, the
FASTDB alignment does not show a matched/alignment of the first 10 bases at



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
46
5' end. The 10 unpaired bases represent 10% of the sequence (number of
bases at the 5' and 3' ends not matched/total number of bases in the query
sequence) so 10% is subtracted from the percent identity score calculated by
the FASTDB program. If the remaining 90 bases were perfectly matched the
final percent identity would be 90%. In another example, a 90 base subject
sequence is compared with a 100 base query sequence. This time the deletions
are internal deletions so that there are no bases on the 5' or 3' of the
subject
sequence which are not matched/aligned with the query. In this case the
percent identity calculated by FASTDB is not manually corrected. Once
again, only bases 5' and 3' of the subject sequence which are not
matched/aligned with the query sequence are manually corrected for. No other
manual corrections are made for the purposes of this embodiment.
The present application is directed to nucleic acid molecules at least
90%, 95%, 96%, 97%, 98% or 99% identical to a nucleic acid sequence shown
in Figure 1 or 2 (SEQ ID NO:1 or 3), to the nucleic acid sequence of a
deposited cDNA and/or to a nucleic acid sequence otherwise disclosed herein
(e.g., encoding polypeptide having the amino acid sequence of a N and/or C
terminal deletion disclosed herein, such as, for example, a nucleic acid
molecule
encoding amino acids Val-30 to His-300 of SEQ ID N0:2), irrespective of
whether they encode a polypeptide having TNFR functional activity. This is
because even where a particular nucleic acid molecule does not encode a
polypeptide having TNFR functional activity, one of skill in the art would
still
know how to use the nucleic acid molecule, for instance, as a hybridization
probe or a polymerase chain reaction (PCR) primer. Uses of the nucleic acid
molecules of the present invention that do not encode a polypeptide having
TNFR functional activity include, inter alia, ( 1 ) isolating a TNFR gene or
allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g.,
"FISH") to metaphase chromosomal spreads to provide precise chromosomal
location of the TNFR gene, as described in Verma et al., Human



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
47
Chromosomes: A Manual of Basic Technigues, Pergamon Press, New York
( 1988); and Northern Blot analysis for detecting TNFR mRNA expression in
specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least
90%, 95%, 96%, 97%, 98% or 99% identical to a nucleic acid sequence shown
in Figure 1 or 2 (SEQ ID NOS:1 or 3) or to the nucleic acid sequence of the
cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97810
or ATCC Deposit No. 97809, and/or to a nucleic acid sequence otherwise
disclosed herein (e.g., encoding polypeptide having the amino acid sequence of
a N and/or C terminal deletion disclosed herein), which do, in fact, encode
polypeptides having TNFR (i.e., TNFR-6a and/or TNFR-6(3) protein
functional activity. By "a polypeptide having TNFR functional activity" is
intended polypeptides exhibiting activity similar, but not necessarily
identical,
to an activity of a TNFR-6a and/or TNFR-6(3 protein of the invention (e.g.,
complete (full-length), mature, and extracellular domain as measured, for
example, in a particular immunoassay or biological assay. For example,
TNFR-6a and/or TNFR-6(3 activity can be measured by determining the
ability of a TNFR-6a and/or TNFR-6(3 polypeptide to bind a TNFR-6a
and/or -6(3 ligand (e.g., Fas Ligand and/or AIM-II (International application
publication number WO 97/34911, published September 25, 1997). In another
example, TNFR-6a and/or TNFR-6(3 functional activity is measured by
determining the ability of a polypeptide, such as cognate ligand which is free
or expressed on a cell surface, to induce apoptosis.
The TNF family ligands induce various cellular responses by binding to
TNF-family receptors, including the TNFR-6a and TNFR-6(3 of the present
invention. Cells which express the TNFR proteins are believed to have a
potent cellular response to TNFR-I receptor ligands including B lymphocytes
(CD 19+), both CD4 and CD8+ T lymphocytes, monocytes and endothelial



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
48
cells. By a "cellular response to a TNF-family ligand" is intended any
genotypic, phenotypic, and/or morphological change to a cell, cell line,
tissue,
tissue culture or patient that is induced by a TNF-family ligand. As
indicated,
such cellular responses include not only normal physiological responses to
TNF-family ligands, but also diseases associated with increased cell
proliferation or the inhibition of increased cell proliferation, such as by
the
inhibition of apoptosis.
Screening assays for the forgoing are known in the art. One such
screening assay involves the use of cells which express the receptor (for
example, transfected CHO cells) in a system which measures extracellular pH
changes caused by receptor activation, for example, as described in Science
246:181-296 (October 1989). For example, a TNF-family ligand may be
contacted with a cell which expresses the mature form of the receptor
polypeptide of the present invention and a second messenger response, e.g.,
signal transduction or pH changes, may be measured to determine whether the
TNFR polypeptide is active.
Of course, due to the degeneracy of the genetic code, one of ordinary
skill in the art will immediately recognize that a large number of the nucleic
acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99%
identical to the nucleic acid sequence of the cDNA clone deposited as ATCC
Deposit No. 97810 or 97809, the nucleic acid sequence shown in Figure 1 or 2
(SEQ ID NO:1 and 3), or fragments thereof, will encode a polypeptide "having
TNFR protein functional activity." In fact, since degenerate variants of these
nucleotide sequences all encode the same polypeptide, this will be clear to
the
skilled artisan even without performing the above described comparison assay.
It will be further recognized in the art that, for such nucleic acid molecules
that
are not degenerate variants, a reasonable number will also encode a
polypeptide having TNFR protein functional activity. This is because the
skilled artisan is fully aware of amino acid substitutions that are either
less



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
49
likely or not likely to significantly effect protein function (e.g., replacing
one
aliphatic amino acid with a second aliphatic amino acid), as further described
below.
Vectors and Host Cells
The present invention also relates to vectors which include the isolated
nucleic acid molecules of the present invention, host cells which are
genetically
engineered with the recombinant vectors, or which are otherwise engineered to
produce the polypeptides of the invention, and the production. of TNFR
polypeptides, or fragments thereof, by recombinant techniques.
In one embodiment, the polynucleotides of the invention are joined to a
vector (e.g., a cloning or expression vector). The vector may be, for example,
a
phage, plasmid, viral or retroviral vector. Retroviral vectors may be
replication
competent or replication defective. In the latter case, viral propagation
generally will occur only in complementing host cells. Generally, a plasmid
vector is introduced in a precipitate, such as a calcium phosphate
precipitate,
or in a complex with a charged lipid. If the vector is a virus, it may be
packaged in vitro using an appropriate packaging cell line and then transduced
into host cells.
Generally, recombinant expression vectors will include origins of
2o replication and selectable markers permitting transformation of the host
cell,
e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene,
and a
promoter derived from a highly-expressed gene to direct transcription of a
downstream structural sequence. Such promoters can be derived from operons
encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), a-
factor, acid phosphatase, or heat shock proteins, among others. The
expression constructs will further contain sites for transcription initiation,
termination and, in the transcribed region, a ribosome binding site for
translation. The coding portion of the transcripts expressed by the constructs



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
will preferably include a translation initiating codon at the beginning and a
termination codon (UAA, UGA or UAG) appropriately positioned at the end
of the polypeptide to be translated. The heterologous structural sequence is
assembled in appropriate phase with translation initiation and termination
5 sequences, and preferably, a leader sequence capable of directing secretion
of
translated protein into the periplasmic space or extracellular medium.
Optionally, the heterologous sequence can encode a fusion protein including an
N-terminal identification peptide imparting desired characteristics, for
example, stabilization or simplified purification of expressed recombinant
10 product.
In one embodiment, the DNA of the invention is operatively associated
with an appropriate heterologous regulatory element (e.g., promoter or
enhancer), such as, the phage lambda PL promoter, the E. coli lac, trp, phoA,
and tac promoters, the SV40 early and late promoters and promoters of
15 retroviral LTRs, to name a few. Other suitable promoters will be known to
the skilled artisan.
As indicated, the expression vectors will preferably include at least one
selectable marker. Such markers include dihydrofolate reductase, 6418 or
neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or
20 ampicillin resistance genes for culturing in E. coli and other bacteria.
Representative examples of appropriate hosts include, but are not limited to,
bacterial cells, such as E. coli, Streptomyces and Salmonella typhimacrium
cells;
fungal cells, such as yeast cells; insect cells such as Drosophila S2 and
Spodoptera Sf~ cells; animal cells such as CHO, COS, 293 and Bowes
25 melanoma cells; and plant cells. Appropriate culture mediums and conditions
for the above-described host cells are known in the art.
The host cell can be a higher eukaryotic cell, such as a mammalian cell
(e.g., a human derived cell), or a lower eukaryotic cell, such as a yeast
cell, or
the host cell can be a prokaryotic cell, such as a bacterial cell. The host
strain



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
51
may be chosen which modulates the expression of the inserted gene sequences,
or modifies and processes the gene product in the specific fashion desired.
Expression from certain promoters can be elevated in the presence of certain
inducers; thus expression of the genetically engineered polypeptide may be
controlled. Furthermore, different host cells have characteristics and
specific
mechanisms for the translational and post-translational processing and
modification (e.g., phosphorylation, cleavage) of proteins. Appropriate cell
lines can be chosen to ensure the desired modifications and processing of the
foreign protein expressed. Selection of appropriate vectors and promoters for
l0 expression in a host cell is a well known procedure and the requisite
techniques
for expression vector construction, introduction of the vector into the host
and
expression in the host are routine skills in the art.
Useful expression vectors for bacterial use are constructed by inserting
a structural DNA sequence encoding a desired protein together with suitable
translation initiation and termination signals in operable reading phase with
a
functional promoter. The vector will comprise one or more phenotypic
selectable markers and an origin of replication to ensure maintenance of the
vector and to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for transformation include E. coli, Bacillus subtilis,
Salmonella typhimurium, and various species within the genera Pseudomonas,
Streptomyces, and Staphylococcus, although others may also be employed as a
matter of choice. As a representative, but nonlimiting example, useful
expression vectors for bacterial use can comprise a selectable marker and
bacterial origin of replication derived from commercially available plasmids
comprising genetic elements of the well known cloning vector pBR322 (ATCC
37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia
Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison, WI,
USA). These pBR322 "backbone" sections are combined with an appropriate
promoter and the structural sequence to be expressed. Among vectors



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
52
preferred for use in bacteria include pHE4-5 (ATCC Accession No. 209311;
and variations thereof), pQE70, pQE60 and pQE-9, available from QIAGEN,
Inc., supra; pBS vectors, Phagescript vectors, Bluescript vectors, pNHBA,
pNHl6a, pNHl8A, pNH46A, available from Stratagene; and ptrc99a,
pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia. Among
preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI and
pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available
from Pharmacia. Other suitable vectors will be readily apparent to the skilled
artisan.
Following transformation of a suitable host strain and growth of the
host strain to an appropriate cell density, the selected promoter is induced
by
appropriate means (e.g., temperature shift or chemical induction) and cells
are
cultured for an additional period. Cells are typically harvested by
centrifugation, disrupted by physical or chemical means, and the resulting
crude extract retained for further purification.
Microbial cells employed in expression of proteins can be disrupted by
any convenient method, including freeze-thaw cycling, sonication, mechanical
disruption, or use of cell lysing agents, such methods are well know to those
skilled in the art.
Transcription of the DNA encoding the polypeptides of the present
invention by higher eukaryotes is increased by inserting an enhancer sequence
into the vector. Enhancers are cis-acting elements of DNA, usually about from
10 to 300 by that act on a promoter to increase its transcription. Examples
including the SV40 enhancer on the late side of the replication origin by 100
to
270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the
late side of the replication origin, and adenovirus enhancers.
Various mammalian cell culture systems can also be employed to
express recombinant protein. Examples of mammalian expression systems
include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
53
(Cell 23:175 ( 1981 )), and other cell lines capable of expressing a
compatible
vector, for example, the C 127, 3T3, CHO, HeLa and BHK cell lines.
Mammalian expression vectors will comprise an origin of replication, a
suitable
promoter and enhancer, and also any necessary ribosome binding sites,
polyadenylation site, splice donor and acceptor sites, transcriptional
termination sequences, and 5' flanking nontranscribed sequences. DNA
sequences derived from the SV40 splice, and polyadenylation sites may be
used to provide the required nontranscribed genetic elements.
Introduction of the vector construct into the host cell can be effected
1 o by techniques known in the art which include, but are not limited to,
calcium
phosphate transfection, DEAE-dextran mediated transfection, cationic
lipid-mediated transfection, electroporation, transduction, infection or other
methods. Such methods are described in many standard laboratory manuals,
such as Davis et al., Basic Methods In Molecular Biology (1986).
In addition to encompassing host cells containing the vector constructs
discussed herein, the invention also encompasses primary, secondary, and
immortalized host cells of vertebrate origin, particularly mammalian origin,
that
have been engineered to delete or replace endogenous genetic material (e.g.,
TNFR coding sequence), and/or to include genetic material (e.g., heterologous
polynucleotide sequences) that is operably associated with TNFR
polynucleotides of the invention, and which activates, alters, and/or
amplifies
endogenous TNFR polynucleotides. For example, techniques known in the art
may be used to operably associate heterologous control regions (e.g., promoter
and/or enhancer) and endogenous TNFR polynucleotide sequences via
homologous recombination (see, e.g., U.S. Patent No. 5,641,670, issued June
24, 1997; International application publication number WO 96/29411,
published September 26, 1996; International application publication number
WO 94/12650, published August 4, 1994; Koller et al., Proc. Natl. Acad. Sci.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
54
USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989), the
disclosures of each of which are incorporated by reference in their
entireties).
The host cells described infra can be used in a conventional manner to
produce the gene product encoded by the recombinant sequence.
Alternatively, cell-free translation systems can also be employed to produce
the polypeptides of the invention using RNAs derived from the DNA
constructs of the present invention.
The polypeptide of the invention may be expressed or synthesized in a
modified form, such as a fusion protein (comprising the polypeptide joined via
a peptide bond to a heterologous protein sequence (of a different protein),
e.g.,
the signal peptide of CK-beta8 (amino acids -21 to -1 of the CK-_8 sequence
disclosed in published PCT application PCT/LTS95/09058; filed 6/23/95) or the
signal peptide of stanniocalcin (See ATCC Accession No. 75652, deposited
January 25, 1994)), and may include not only secretion signals, but also
additional heterologous functional regions. Such a fusion protein can be made
by ligating polynucleotides of the invention and the desired nucleic acid
sequence encoding the desired amino acid sequence to each other, by methods
known in the art, in the proper reading frame, and expressing the fusion
protein product by methods known in the art. Alternatively, such a fusion
2o protein can be made by protein synthetic techniques, e.g., by use of a
peptide
synthesizer. Thus, for instance, a region of additional amino acids,
particularly
charged amino acids, may be added to the N-terminus of the polypeptide to
improve stability and persistence in the host cell, during purification, or
during
subsequent handling and storage. Also, peptide moieties may be added to the
polypeptide to facilitate purification. Such regions may be removed prior to
final preparation of the polypeptide. The addition of peptide moieties to
polypeptides to engender secretion or excretion, to improve stability and to
facilitate purification, among others, are familiar and routine techniques in
the
art.



CA 02362929 2001-08-16
WO 00/52028 PCT/LTS00/05686
A preferred fusion protein comprises a heterologous region from
immunoglobulin that is useful to stabilize and purify proteins. For example,
EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins
comprising various portions of constant region of immunoglobulin molecules
5 together with another human protein or part thereof. In many cases, the Fc
part in a fusion protein is thoroughly advantageous for use in therapy and
diagnosis and thus results, for example, in improved pharmacokinetic
properties (EP-A 0232 262). On the other hand, for some uses it would be
desirable to be able to delete the Fc part after the fusion protein has been
10 expressed, detected and purified in the advantageous manner described. This
is
the case when Fc portion proves to be a hindrance to use in therapy and
diagnosis, for example when the fusion protein is to be used as antigen for
immunizations. In drug discovery, for example, human proteins, such as hIL-5
has been fused with Fc portions for the purpose of high-throughput screening
15 assays to identify antagonists of hIL-5. See, D. Bennett et al., J.
Molecular
Recognition 8:52-58 (1995) and K. Johanson et al., J. Biol. Chem
270:9459-9471 (1995). In another example, preferred fusion proteins of the
invention comprise a portion of an immunoglobulin light chain (i.e., a portion
of a kappa or lambda light chain). In specific embodiments the fusion proteins
20 of the invention comprise a portion of the constant region of a kappa or
lambda light chain.
Proteins of the present invention include: products purified from
natural sources, including bodily fluids, tissues and cells, whether directly
isolated or cultured; products of chemical synthetic procedures; and products
25 produced by recombinant techniques from a prokaryotic or eukaryotic host,
including, for example, bacterial, yeast, higher plant, insect and mammalian
cells. Depending upon the host employed in a recombinant production
procedure, the polypeptides of the present invention may be glycosylated or
may be non-glycosylated. In addition, polypeptides of the invention may also



CA 02362929 2001-08-16
WO 00/52028 PCT/iJS00/05686
56
include an initial modified methionine residue, in some cases as a result of
host-mediated processes.
Proteins of the invention can be chemically synthesized using
techniques known in the art (e.g., see Creighton, 1983, Proteins: Structures
and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller, M., et
al., Nature 310:105-111 (1984)). For example, a peptide corresponding to a
fragment of the complete TNFR (i.e., TNFR-6a and/or TNFR-6(3)
polypeptides of the invention can be synthesized by use of a peptide
synthesizer. Furthermore, if desired, nonclassical amino acids or chemical
1 o amino acid analogs can be introduced as a substitution or addition into
the
TNFR polypeptide sequence. Non-classical amino acids include, but are not
limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric
acid, a-amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid,
g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino
propionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine,
citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine,
phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer
amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl
amino acids, and amino acid analogs in general. Furthermore, the amino acid
2o can be D (dextrorotary) or L (levorotary).
The TNFR-6 alpha and/or TNFR-6 beta proteins may be modified by
either natural processes, such as posttranslational processing, or by chemical
modification techniques which are well known in the art. It will be
appreciated
that the same type of modification may be present in the same or varying
degrees at several sites in a given TNFR-6 alpha and/or TNFR-6 beta protein.
Also, a given TNFR-6 alpha and/or TNFR-6 beta protein may contain many
types of modifications. TNFR-6 alpha and/or TNFR-6 beta proteins may be
branched , for example, as a result of ubiquitination, and they may be cyclic,
with or without branching. Cyclic, branched, and branched cyclic TNFR-6



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
57
alpha and/or TNFR-6 beta proteins may result from posttranslation natural
processes or may be made by synthetic methods. Modifications include
acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of
flavin, covalent attachment of a heme moiety, covalent attachment of a
nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid
derivative, covalent attachment of phosphotidylinositol, cross-linking,
cyclization, disulfide bond formation, demethylation, formation of covalent
cross-links, formation of cysteine, formation of pyroglutamate, formylation,
gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation,
iodination, methylation, myristoylation, oxidation, pegylation, proteolytic
processing, phosphorylation, prenylation, racemization, selenoylation,
sulfation, transfer-RNA mediated addition of amino acids to proteins such as
arginylation, and ubiquitination. (See, for instance, PROTEINS -
STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E.
Creighton, W. H. Freeman and Company, New York (1993); POST-
TRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C.
Johnson, Ed., Academic Press, New York, pgs. 1-12 (1983); Seifter et al., Meth
Enzymol 182:626-646 (1990); Rattan et al., Ann NYAcad Sci 663:48-62
(1992).)
The invention encompasses TNFR-hoc and/or TNFR-6(3 proteins
which are differentially modified during or after translation, e.g., by
glycosylation, acetylation, phosphorylation, amidation, derivatization by
known protecting/blocking groups, proteolytic cleavage, linkage to an antibody
molecule or other cellular ligand, etc. Any of numerous chemical modifications
may be carried out by known techniques, including but not limited to, specific
chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8
protease, NaBH4, acetylation, formylation, oxidation, reduction, metabolic
synthesis in the presence of tunicamycin; etc.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
58
Additional post-translational modifications encompassed by the
invention include, for example, e.g., N-linked or O-linked carbohydrate
chains,
processing of N-terminal or C-terminal ends), attachment of chemical moieties
to the amino acid backbone, chemical modifications of N-linked or O-linked
carbohydrate chains, and addition or deletion of an N-terminal methionine
residue as a result of procaryotic host cell expression. The polypeptides may
also be modified with a detectable label, such as an enzymatic, fluorescent,
isotopic or affinity label to allow for detection and isolation of the
protein.
Also provided by the invention are chemically modified derivatives of
l0 TNFR-6a and/or TNFR-6(3 which may provide additional advantages such as
increased solubility, stability and circulating time of the polypeptide, or
decreased immunogenicity (see US Patent Number 4,179,337). The chemical
moieties for derivitization may be selected from water soluble polymers such
as polyethylene glycol, ethylene glycol/propylene glycol copolymers,
carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The
polypeptides may be modified at random positions within the molecule, or at
predetermined positions within the molecule and may include one, two, three
or more attached chemical moieties.
The polymer may be of any molecular weight, and may be branched or
2o unbranched. For polyethylene glycol, the preferred molecular weight is
between about 1 kDa and about 100 kDa (the term "about" indicating that in
preparations of polyethylene glycol, some molecules will weigh more, some
less, than the stated molecular weight) for ease in handling and
manufacturing.
Other sizes may be used, depending on the desired therapeutic profile (e.g.,
the
duration of sustained release desired, the effects, if any on biological
activity,
the ease in handling, the degree or lack of antigenicity and other known
effects
of the polyethylene glycol to a therapeutic protein or analog). For example,
the
polyethylene glycol may have an average molecular weight of about 200, 500,
1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
59
7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000,
12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500,
17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000, 25,000, 30,000,
35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000,
85,000, 90,000, 95,000, or 100,000 kDa.
As noted above, the polyethylene glycol may have a branched
structure. Branched polyethylene glycols are described, for example, in U.S.
Patent No. 5,643,575; Morpurgo et al., Appl. Biochem. Biotechnol. 56:59-72
( 1996); Vorobjev et al., Nucleosides Nucleotides 18:2745-2750 ( 1999); and
l0 Caliceti et al., Bioconjug. Chem. 10:638-646 (1999), the disclosures of
each of
which are incorporated herein by reference.
The polyethylene glycol molecules (or other chemical moieties) should
be attached to the protein with consideration of effects on functional or
antigenic domains of the protein. There are a number of attachment methods
available to those skilled in the art, e.g., EP 0 401 384, herein incorporated
by
reference (coupling PEG to G-CSF), see also Malik et al., Exp. Hematol.
20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl chloride).
For example, polyethylene glycol may be covalently bound through amino acid
residues via a reactive group, such as, a free amino or carboxyl group.
Reactive
groups are those to which an activated polyethylene glycol molecule may be
bound. The amino acid residues having a free amino group may include lysine
residues and the N-terminal amino acid residues; those having a free carboxyl
group may include aspartic acid residues glutamic acid residues and the
C-terminal amino acid residue. Sulfhydryl groups may also be used as a
reactive group for attaching the polyethylene glycol molecules. Preferred for
therapeutic purposes is attachment at an amino group, such as attachment at
the N-terminus or lysine group.
As suggested above, polyethylene glycol may be attached to proteins
via linkage to any of a number of amino acid residues. For example,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
polyethylene glycol can be linked to a proteins via covalent bonds to lysine,
histidine, aspartic acid, glutamic acid, or cysteine residues. One or more
reaction chemistries may be employed to attach polyethylene glycol to
specific amino acid residues (e.g., lysine, histidine, aspartic acid, glutamic
acid,
5 or cysteine) of the protein or to more than one type of amino acid residue
(e.g.,
lysine, histidine, aspartic acid, glutamic acid, cysteine and combinations
thereof) of the protein.
One may specifically desire proteins chemically modified at the
N-terminus. Using polyethylene glycol as an illustration of the present
1o composition, one may select from a variety of polyethylene glycol molecules
(by molecular weight, branching, etc.), the proportion of polyethylene glycol
molecules to protein (or peptide) molecules in the reaction mix, the type of
pegylation reaction to be performed, and the method of obtaining the selected
N-terminally pegylated protein. The method of obtaining the N-terminally
15 pegylated preparation (i.e., separating this moiety from other
monopegylated
moieties if necessary) may be by purification of the N-terminally pegylated
material from a population of pegylated protein molecules. Selective proteins
chemically modified at the N-terminus modification may be accomplished by
reductive alkylation which exploits differential reactivity of different types
of
2o primary amino groups (lysine versus the N-terminal) available for
derivatization in a particular protein. Under the appropriate reaction
conditions, substantially selective derivatization of the protein at the
N-terminus with a carbonyl group containing polymer is achieved.
As indicated above, pegylation of the proteins of the invention may be
25 accomplished by any number of means. For example, polyethylene glycol
may be attached to the protein either directly or by an intervening linker.
Linkerless systems for attaching polyethylene glycol to proteins are described
in Delgado et al., Crit. Rev. Thera. Drug Carrier Sys. 9:249-304 (1992);
Francis et al., Intern. J. ofHematol. 68:1-18 (1998); U.S. Patent No.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
61
4,002,531; U.S. Patent No. 5,349,052; WO 95/06058; and WO 98/32466, the
disclosures of each of which are incorporated herein by reference.
One system for attaching polyethylene glycol directly to amino acid
residues of proteins without an intervening linker employs tresylated MPEG,
which is produced by the modification of monmethoxy polyethylene glycol
(MPEG) using tresylchloride (C1SOZCHZCF3). Upon reaction of protein with
tresylated MPEG, polyethylene glycol is directly attached to amine groups of
the protein. Thus, the invention includes protein-polyethylene glycol
conjugates produced by reacting proteins of the invention with a polyethylene
glycol molecule having a 2,2,2-trifluoreothane sulphonyl group.
Polyethylene glycol can also be attached to proteins using a number of
different intervening linkers. For example, U.S. Patent No. 5,612,460, the
entire disclosure of which is incorporated herein by reference, discloses
urethane linkers for connecting polyethylene glycol to proteins. Protein-
polyethylene glycol conjugates wherein the polyethylene glycol is attached to
the protein by a linker can also be produced by reaction of proteins with
compounds such as MPEG-succinimidylsuccinate, MPEG activated with
1,1'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate, MPEG-p-
nitrophenolcarbonate, and various MPEG-succinate derivatives. A number
additional polyethylene glycol derivatives and reaction chemistries for
attaching polyethylene glycol to proteins are described in WO 98/32466, the
entire disclosure of which is incorporated herein by reference. Pegylated
protein products produced using the reaction chemistries set out herein are
included within the scope of the invention.
The number of polyethylene glycol moieties attached to each protein
of the invention (i.e., the degree of substitution) may also vary. For
example,
the pegylated proteins of the invention may be linked, on average, to l, 2, 3,
4,
5, 6, 7, 8, 9, 10, 12, 15, 17, 20, or more polyethylene glycol molecules.
Similarly, the average degree of substitution within ranges such as 1-3, 2-4,
3-



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
62
5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-15, 14-16, 15-17,
16-
18, 17-19, or 18-20 polyethylene glycol moieties per protein molecule.
Methods for determining the degree of substitution are discussed, for example,
in Delgado et al., Crit. Rev. Theca. Drug Carrier Sys. 9:249-304 ( 1992).
The TNFR proteins can be recovered and purified by known methods
which include, but are not limited to, ammonium sulfate or ethanol
precipitation, acid extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction chromatography,
affinity chromatography, hydroxylapatite chromatography and lectin
1 o chromatography. Most preferably, high performance liquid chromatography
("HPLC") is employed for purification.
TNFR Proteins
The invention further provides for the proteins containing polypeptide
sequences encoded by the polynucleotides of the invention.
The TNFR proteins of the invention may be in monomers or multimers
(i.e., dimers, trimers, tetramers, and higher multimers). Accordingly, the
present invention relates to monomers and multimers of the TNFR proteins of
the invention, their preparation, and compositions (preferably, pharmaceutical
2o compositions) containing them. In specific embodiments, the polypeptides of
the invention are monomers, dimers, trimers or tetramers. In additional
embodiments, the multimers of the invention are at least dimers, at least
trimers, or at least tetramers.
Multimers encompassed by the invention may be homomers or
heteromers. As used herein, the term homomer, refers to a multimer containing
only TNFR proteins of the invention (including TNFR fragments, variants,
and fusion proteins, as described herein). These homomers may contain



CA 02362929 2001-08-16
WO 00/52028 PCT/LJS00/05686
63
TNFR proteins having identical or different polypeptide sequences. In a
specific embodiment, a homomer of the invention is a multimer containing only
TNFR proteins having an identical polypeptide sequence. In another specific
embodiment, a homomer of the invention is a multimer containing TNFR
proteins having different polypeptide sequences. In specific embodiments, the
multimer of the invention is a homodimer (e.g., containing TNFR proteins
having identical or different polypeptide sequences) or a homotrimer (e.g.,
containing TNFR proteins having identical or different polypeptide
sequences). In additional embodiments, the homomeric multimer of the
invention is at least a homodimer, at least a homotrimer, or at least a
homotetramer.
As used herein, the term heteromer refers to a multimer containing
heterologous proteins (i.e., proteins containing only polypeptide sequences
that do not correspond to a polypeptide sequences encoded by the TNFR
gene) in addition to the TNFR proteins of the invention. In a specific
embodiment, the multimer of the invention is a heterodimer, a heterotrimer, or
a heterotetramer. In additional embodiments, the heteromeric multimer of the
invention is at least a heterodimer, at least a heterotrimer, or at least a
heterotetramer.
Multimers of the invention may be the result of hydrophobic,
hydrophilic, ionic and/or covalent associations and/or may be indirectly
linked,
by for example, liposome formation. Thus, in one embodiment, multimers of
the invention, such as, for example, homodimers or homotrimers, are formed
when proteins of the invention contact one another in solution. In another
embodiment, heteromultimers of the invention, such as, for example,
heterotrimers or heterotetramers, are formed when proteins of the invention
contact antibodies to the polypeptides of the invention (including antibodies
to the heterologous polypeptide sequence in a fusion protein of the invention)
in solution. In other embodiments, multimers of the invention are formed by



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
64
covalent associations with and/or between the TNFR proteins of the
invention. Such covalent associations may involve one or more amino acid
residues contained in the polypeptide sequence of the protein ( e.g., the
polypeptide sequence recited in SEQ ID N0:2 or SEQ ID N0:4, contained in
the polypeptide encoded by the cDNA clone contained in ATCC Deposit No.
97810), contained in the polypeptide encoded by the cDNA clone contained in
ATCC Deposit No. 97809). In one instance, the covalent associations are
cross-linking between cysteine residues located within the polypeptide
sequences of the proteins which interact in the native (i.e., naturally
occurring)
polypeptide. In another instance, the covalent associations are the
consequence of chemical or recombinant manipulation. Alternatively, such
covalent associations may involve one or more amino acid residues contained
in the heterologous polypeptide sequence in a TNFR fusion protein. In one
example, covalent associations are between the heterologous sequence
contained in a fusion protein of the invention (see, e.g., US Patent Number
5,478,925). In a specific example, the covalent associations are between the
heterologous sequence contained in a TNFR-Fc fusion protein of the invention
(as described herein). In another specific example, covalent associations of
fusion proteins of the invention are between heterologous polypeptide
2o sequences from another TNF family ligand/receptor member that is capable of
forming covalently associated multimers, such as for example, oseteoprotegerin
(see, e.g., International application publication number WO 98/49305, the
contents of which are herein incorporated by reference in its entirety). In
another embodiment, two or more TR6-alpha and/or TR6-beta polypeptides
of the invention are joined through peptide linkers. Examples include those
peptide linkers described in U.S. Pat. No. 5,073,627 (hereby incorporated by
reference). Proteins comprising multiple TR6-alpha and/or TR6-beta
polypeptides separated by peptide linkers may be produced using
conventional recombinant DNA technology.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
Another method for preparing multimer TR6-alpha and/or TR6-beta
polypeptides of the invention involves use of TR6-alpha and/or TR6-beta
polypeptides fused to a leucine zipper or isoleucine zipper polypeptide
sequence. Leucine zipper and isoleucine zipper domains are polypeptides that
5 promote multimerization of the proteins in which they are found. Leucine
zippers were originally identified in several DNA-binding proteins
(Landschulz et al., Science 240:1759, (1988)), and have since been found in a
variety of different proteins. Among the known leucine zippers are naturally
occurring peptides and derivatives thereof that dimerize or trimerize.
10 Examples of leucine zipper domains suitable for producing soluble
multimeric
TR6-alpha andlor TR6-beta proteins are those described in PCT application
WO 94/10308, hereby incorporated by reference. Recombinant fusion
proteins comprising a soluble TR6-alpha and/or TR6-beta polypeptide fused
to a peptide that dimerizes or trimerizes in solution are expressed in
suitable
15 host cells, and the resulting soluble multimeric TR6-alpha and/or TR6-beta
is
recovered from the culture supernatant using techniques known in the art.
Certain members of the TNF family of proteins are believed to exist in
trimeric form (Beutler and Huffel, Science 264:667, 1994; Banner et al., Cell
73:431, 1993). Thus, trimeric TR6-alpha and/or TR6-beta may offer the
2o advantage of enhanced biological activity. Preferred leucine zipper
moieties are
those that preferentially form trimers. One example is a leucine zipper
derived
from lung surfactant protein D (SPD), as described in Hoppe et al. (FEBS
Letters 344:191, (1994)) and in U.S. patent application Ser. No. 08/446,922,
hereby incorporated by reference. Other peptides derived from naturally
25 occurring trimeric proteins may be employed in preparing trimeric TR6-alpha
and/or TR6-beta.
In further preferred embodiments, TR6-alpha or TR6-beta
polynucleotides of the invention are fused to a polynucleotide encoding a
"FLAG" polypeptide. Thus, a TR6-alpha-FLAG or a TR6-beta-FLAG



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
66
fusion protein is encompassed by the present invention. The FLAG antigenic
polypeptide may be fused to a TR6-alpha or a TR6-beta polypeptide of the
invention at either or both the amino or the carboxy terminus. In preferred
embodiments, a TR6-alpha-FLAG or a TR6-beta-FLAG fusion protein is
expressed from a pFLAG-CMV-Sa or a pFLAG-CMV-1 expression vector
(available from Sigma, St. Louis, MO, USA). See, Andersson, S., et al., J.
Biol.
Chem. 264:8222-29 (1989); Thomsen, D. R., et al., Proc. Natl. Acad. Sci. USA,
81:659-63 (1984); and Kozak, M., Nature 308:241 (1984) (each of which is
hereby incorporated by reference). In further preferred embodiments, a TR6-
I o alpha-FLAG or a TR6-beta-FLAG fusion protein is detectable by anti-FLAG
monoclonal antibodies (also available from Sigma).
The multimers of the invention may be generated using chemical
techniques known in the art. For example, proteins desired to be contained in
the multimers of the invention may be chemically cross-linked using linker
molecules and linker molecule length optimization techniques known in the art
(see, e.g., US Patent Number 5,478,925, which is herein incorporated by
reference in its entirety). Additionally, multimers of the invention may be
generated using techniques known in the art to form one or more inter-molecule
cross-links between the cysteine residues located within the polypeptide
sequence of the proteins desired to be contained in the multimer (see, e.g.,
US
Patent Number 5,478,925, which is herein incorporated by reference in its
entirety). Further, proteins of the invention may be routinely modified by the
addition of cysteine or biotin to the C terminus or N-terminus of the
polypeptide sequence of the protein and techniques known in the art may be
applied to generate multimers containing one or more of these modified
proteins (see, e.g., US Patent Number 5,478,925, which is herein incorporated
by reference in its entirety). Additionally, techniques known in the art may
be
applied to generate liposomes containing the protein components desired to be
contained in the multimer of the invention (see, e.g., US Patent Number



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
67
5,478,925, which is herein incorporated by reference in its entirety).
Alternatively, multimers of the invention may be generated using
genetic engineering techniques known in the art. In one embodiment, proteins
contained in multimers of the invention are produced recombinantly using
fusion protein technology described herein or otherwise known in the art (see,
e.g., US Patent Number 5,478,925, which is herein incorporated by reference
in its entirety). In a specific embodiment, polynucleotides coding for a
homodimer of the invention are generated by ligating a polynucleotide
sequence encoding a polypeptide of the invention to a sequence encoding a
linker polypeptide and then further to a synthetic polynucleotide encoding the
translated product of the polypeptide in the reverse orientation from the
original C-terminus to the N-terminus (lacking the leader sequence) (see,
e.g.,
US Patent Number 5,478,925, which is herein incorporated by reference in its
entirety). In another embodiment, recombinant techniques described herein or
otherwise known in the art are applied to generate recombinant polypeptides
of the invention which contain a transmembrane domain and which can be
incorporated by membrane reconstitution techniques into liposomes (see, e.g.,
US Patent Number 5,478,925, which is herein incorporated by reference in its
entirety).
In one embodiment, the invention provides isolated TNFR proteins
comprising, or alternatively, consisting of, the amino acid sequence of the
complete (full-length) TNFR polypeptide encoded by the cDNA contained in
ATCC Deposit No. 97810, the amino acid sequence of the complete (full-
length) TNFR polypeptide encoded by the cDNA contained in ATCC
Deposit No. 97809, the amino acid sequence of the complete TNFR-6a
polypeptide disclosed in Figure 1 (SEQ ID N0:2), the amino acid sequence of
the complete TNFR-6(3 polypeptide disclosed in Figure 2 (SEQ ID N0:4), or
a portion of the above polypeptides.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
68
In another embodiment, the invention provides isolated TNFR
proteins comprising, or alternatively consisting of, the amino acid sequence
of
the mature TNFR polypeptide encoded by the cDNA contained in ATCC
Deposit No. 97810, the amino acid sequence of the mature TNFR
polypeptide encoded by the cDNA contained in ATCC Deposit No. 97809,
amino acid residues 31 to 300 of the TNFR-6a sequence disclosed in Figure 1
(SEQ ID N0:2), amino acid residues 31 to 170 of the TNFR-6(3 sequence
disclosed in Figure2 (SEQ ID N0:4), or a portion (i.e., fragment) of the above
polypeptides.
to Polypeptide fragments of the present invention include polypeptides
comprising or alternatively, consisting of, an amino acid sequence contained
in
SEQ ID N0:2, an amino acid sequence contained in SEQ ID N0:4, an amino
acid sequence encoded by the cDNA plasmid deposited as ATCC Deposit No.
97810, an amino acid sequence encoded by the cDNA plasmid deposited as
ATCC Deposit No. 97809, or an amino acid sequence encoded by a nucleic
acid which hybridizes (e.g., under stringent hybridization conditions) to the
nucleotide sequence of the cDNA contained in ATCC Deposit No. 97810
and/or 97809, or shown in Figures 1 and/or 2 (SEQ ID NO:1 and SEQ ID
N0:3, respectively) or the complementary strand thereto. Polynucleotides
that hybridize to these polynucleotide fragments are also encompassed by the
invention. Protein fragments may be "free-standing," or comprised within a
larger polypeptide of which the fragment forms a part or region, most
preferably as a single continuous region. Representative examples of
polypeptide fragments of the invention, include, for example, fragments that
comprise or alternatively, consist of from amino acid residues: 1 to 31, 32 to
50, 51 to 100, 101 to 150, 151 to 200, 201 to 250, and/or 251 to 300 of SEQ
ID N0:2. Additional representative examples of polypeptide fragments of the
invention include polypeptide fragments that comprise, or alternatively,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
69
consist of from amino acids 1 to 31, 32 to 70, 70 to 100, 100 to 125, 126 to
150, and/or 151 to 170 of SEQ ID N0:4. Moreover, polypeptide fragments
can be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140,
150,
175 or 200 amino acids in length. Polynucleotides encoding these polypeptides
are also encompassed by the invention.
In specific embodiments, polypeptide fragments of the invention
comprise, or alternatively consist of, amino acid residues: 100 to 150, 150 to
200, 200 to 300, 210 to 300, 220 to 300, 230 to 300, 240 to 300, 250 to 300,
260 to 300, 270 to 300, 280 to 300, and/or 290 to 300 as depicted in Figure 1
(SEQ ID N0:2). Polynucleotides encoding these polypeptides are also
encompassed by the invention.
TNFR comprises two domains having different structural and
functional properties. The amino terminal domain spanning residues 30 to 196
of SEQ ID N0:2 shows homology to other members of the TNFR family,
through conservation of four cysteine rich domains characteristic of TNFR
families. Amino acid sequences contained in each of the four domains include
amino acid residues 34 to 70, 73 to 113, 115 to 150, and 153 to 193, of SEQ
ID N0:2, respectively. The carboxy terminal domain, spanning amino acid
residues 197 to 300 of SEQ ID N0:2, has no significant homology to any
known sequences. Unlike a number of other TNF receptor family members,
TNFR appears to be exclusively a secreted protein and does not appear to be
synthesized as a membrane associated form. While the amino terminal domain
of TNFR appears to be required for biological activity of TNFR, the carboxy-
terminal domain appears to be important for multimerization of TNFR.
In one embodiment, the polypeptides of the invention comprise, or
alternatively consist of, amino acid residues 34 to 70, 73 to 113, 115 to 150,
and 153 to 193, and/or 30-196 of SEQ ID N0:2. Polynucleotides encoding
these polypeptides are also encompassed by the invention.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
In another embodiment, the polypeptides of the invention comprise, or
alternatively consist of, amino acid residues 197 to 240, 241 to 270, 271-300,
andlor 197 to 300 of SEQ ID N0:2. Polynucleotides encoding these
polypeptides are also encompassed by the invention. Since these polypeptide
5 sequences are believed to be associated with multimerization of TNFR,
proteins having one or more of these polypeptide sequences would be
expected to form dimers, trimers and higher multimers, which may have
advantageous properties, such as, increased binding affinity, greater
stability,
and longer circulating half life compared to monomeric forms. In a specific
to embodiment, the invention provides for fusion proteins comprising fusions
of
one or more of the above polypeptides to a heterologous sequence of a cell
signaling molecule, such as a receptor, an extracellular domain thereof, and
an
active fragment, derivative, or analog of a receptor or an extracellular
domain.
In a preferred embodiment, heterologous sequences are selected from the
15 family of TNR-like receptors. Such sequences preferably include functional
extracellular ligand binding domains and lack functional transmembrane and/or
cytoplasmic domains. Such fusion proteins are useful for detecting molecules
which interact with the fused heterologous sequences and thereby identifying
potential new receptors and ligands. The fusion proteins are also useful for
20 treatment of a variety of disorders, for example, those related to receptor
binding. In one embodiment, fusion proteins of the invention comprising
TNF/TNFR and TNF receptor/TNFR sequences are used to treat TNF and
TNF receptor mediated disorders, such as, inflammation, autoimmune
diseases, cancer, and disorders associated with excessive or alternatively,
25 reduced apoptosis.
Additional embodiments TNFR polypeptide fragments comprising, or
alternatively, consisting of, functional regions of polypeptides of the
invention, such as the Gamier-Robson alpha-regions, beta-regions,
turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and



CA 02362929 2001-08-16
WO 00/52028 PCT/i1S00/05686
71
coil-regions, Kyte-Doolittle hydrophilic regions, Eisenberg alpha- and
beta-amphipathic regions, Karplus-Schulz flexible regions, Emini
surface-forming regions and Jameson-Wolf regions of high antigenic index set
out in Figure 4 (Table I) and Figure 5 (Table 2) and as described herein. In a
preferred embodiment, the polypeptide fragments of the invention are
antigenic. The data presented in columns VIII, IX, XIII, and XIV of Tables I
and II can be used to routinely determine regions of TNFR which exhibit a high
degree of potential for antigenicity. Regions of high antigenicity are
determined from the data presented in columns VIII, IX, XIII, and/or XIV by
l0 choosing values which represent regions of the polypeptide which are likely
to
be exposed on the surface of the polypeptide in an environment in which
antigen recognition may occur in the process of initiation of an immune
response. Among highly preferred fragments of the invention are those that
comprise regions of TNFR that combine several structural features, such as
several (e.g., 1, 2, 3 or 4) of the features set out above. Polynucleotides
encoding these polypeptides are also encompassed by the invention.
The present invention encompasses polypeptides comprising, or
alternatively consisting of, an epitope of the polypeptide having an amino
acid
sequence of SEQ ID NOS:2 and 4, respectively, or an epitope of the polypeptide
2o sequence encoded by a polynucleotide sequence contained in deposited clone
ATCC Deposit Number 97810 and 97809, respectively, or encoded by a
polynucleotide that hybridizes to the complement of the sequence of SEQ ID
NOS:1 and 3, respectively, or contained in deposited clone ATCC Deposit
Number 97810 and 97809, respectively, under stringent hybridization conditions
or lower stringency hybridization conditions as defined supra. The present
invention further encompasses polynucleotide sequences encoding an epitope of
a
polypeptide sequence of the invention (such as, for example, the sequence
disclosed in SEQ ID NOS:1 and/or 3), polynucleotide sequences of the
complementary strand of a polynucleotide sequence encoding an epitope of the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
72
invention, and polynucleotide sequences which hybridize to the complementary
strand under stringent hybridization conditions or lower stringency
hybridization
conditions defined supra.
The term "epitopes," as used herein, refers to portions of a polypeptide
having antigenic or immunogenic activity in an animal, preferably a mammal,
and
most preferably in a human. In a preferred embodiment, the present invention
encompasses a polypeptide comprising an epitope, as well as the polynucleotide
encoding this polypeptide. An "immunogenic epitope," as used herein, is
defined
as a portion of a protein that elicits an antibody response in an animal, as
l0 determined by any method known in the art, for example, by the methods for
generating antibodies described infra. (See, for example, Geysen et al., Proc.
Natl.
Acad. Sci. USA 81:3998-4002 (1983)). The term "antigenic epitope," as used
herein, is defined as a portion of a protein to which an antibody can
immunospecifically bind its antigen as determined by any method well known in
the art, for example, by the immunoassays described herein. Immunospecific
binding excludes non-specific binding but does not necessarily exclude cross-
reactivity with other antigens. Antigenic epitopes need not necessarily be
immunogenic.
Non-limiting examples of antigenic polypeptides or peptides that can be
used to generate TNFR-specific antibodies include: a polypeptide comprising,
or
alternatively consisting of, amino acid residues from about Ala-31 to about
Thr-
46, from about Phe-57 to about Thr-117, from about Cys-132 to about Thr-175,
from about Gly-185 to about Thr-194, from about Val-205 to about Asp-217,
from about Pro-239 to about Leu-264, and from about Ala-283 to about Pro-298
in SEQ ID N0:2; and from about Ala-31 to about Thr-46, from about Phe-57 to
about Gln-80, from about Glu-86 to about His-106, from about Thr-108 to about
Phe-119, from about His-129 to about Val-138, and from about Gly-142 to about
Pro-166 in SEQ ID N0:4. These polypeptide fragments have been determined to
bear antigenic epitopes of the TNFR-6 alpha and TNFR-6 beta polypeptides



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
73
respectively, by the analysis of the Jameson-Wolf antigenic index, as shown in
Figures 4 and 5, above.
Fragments that function as epitopes may be produced by any conventional
means. (See, e.g., Houghten, Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985),
further described in U.S. Patent No. 4,631,211).
In the present invention, antigenic epitopes preferably contain a sequence
of at least 4, at least 5, at least 6, at least 7, more preferably at least 8,
at least 9, at
least 10, at least 15, at least 20, at least 25, and, most preferably, between
about
to about 30 amino acids. Preferred polypeptides comprising immunogenic or
to antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60,
65, 70, 75,
80, 85, 90, 95, or 100 amino acid residues in length. Antigenic epitopes are
useful,
for example, to raise antibodies, including monoclonal antibodies, that
specifically
bind the epitope. Antigenic epitopes can be used as the target molecules in
immunoassays. (See, for instance, Wilson et al., Cell 37:767-778 (1984);
Sutcliffe
15 et al., Science 219:660-666 (1983)).
Similarly, immunogenic epitopes can be used, for example, to induce
antibodies according to methods well known in the art. (See, for instance,
Sutcliffe
et al., supra; Wilson et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA
82:910-
914; and Bittle et al., J. Gen. Virol. 66:2347-2354 (1985). The polypeptides
comprising one or more immunogenic epitopes may be presented for eliciting an
antibody response together with a carrier protein, such as an albumin, to an
animal
system (such as, for example, rabbit or mouse), or, if the polypeptide is of
sufficient length (at least about 25 amino acids), the polypeptide may be
presented without a carrier. However, immunogenic epitopes comprising as few
as 8 to 10 amino acids have been shown to be sufficient to raise antibodies
capable
of binding to, at the very least, linear epitopes in a denatured polypeptide
(e.g., in
Western blotting).
Epitope-bearing polypeptides of the present invention may be used to
induce antibodies according to methods well known in the art including, but
not



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
74
limited to, in vivo immunization, in vitro immunization, and phage display
methods. See, e.g., Sutcliffe et al., supra; Wilson et al., supra, and Bittle
et al., J.
Gen. Virol., 66:2347-2354 (1985). If in vivo immunization is used, animals may
be immunized with free peptide; however, anti-peptide antibody titer may be
boosted by coupling the peptide to a macromolecular earner, such as keyhole
limpet hemacyanin (KLH) or tetanus toxoid. For instance, peptides containing
cysteine residues may be coupled to a carrier using a linker such as
maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), while other peptides may
be coupled to carriers using a more general linking agent such as
glutaraldehyde.
l0 Animals such as, for example, rabbits, rats, and mice are immunized with
either
free or carrier-coupled peptides, for instance, by intraperitoneal and/or
intradermal
injection of emulsions containing about 100 micrograms of peptide or carrier
protein and Freund's adjuvant or any other adjuvant known for stimulating an
immune response. Several booster injections may be needed, for instance, at
intervals of about two weeks, to provide a useful titer of anti-peptide
antibody
that can be detected, for example, by ELISA assay using free peptide adsorbed
to
a solid surface. The titer of anti-peptide antibodies in serum from an
immunized
animal may be increased by selection of anti-peptide antibodies, for instance,
by
adsorption to the peptide on a solid support and elution of the selected
antibodies
2o according to methods well known in the art.
As one of skill in the art will appreciate, and as discussed above, the
polypeptides of the present invention comprising an immunogenic or antigenic
epitope can be fused to other polypeptide sequences. For example, the
polypeptides of the present invention may be fused with the constant domain of
immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CH1, CH2, CH3, or
any combination thereof and portions thereof) resulting in chimeric
polypeptides.
Such fusion proteins may facilitate purification and may increase half life in
vivo.
This has been shown for chimeric proteins consisting of the first two domains
of
the human CD4-polypeptide and various domains of the constant regions of the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
heavy or light chains of mammalian immunoglobulins. See, e.g., EP 394,827;
Traunecker et al., Nature, 331:84-86 ( 1988). IgG Fusion proteins that have a
disulfide-linked dimeric structure due to the IgG portion desulfide bonds have
also
been found to be more efficient in binding and neutralizing other molecules
than
5 monomeric polypeptides or fragments thereof alone. See, e.g., Fountoulakis
et al.,
J. Biochem., 270:3958-3964 (1995). Nucleic acids encoding the above epitopes
can also be recombined with a gene of interest as an epitope tag (e.g., the
hemagglutinin ("HA") tag or flag tag) to aid in detection and purification of
the
expressed polypeptide. For example, a system described by Janknecht et al.
1 o allows for the ready purification of non-denatured fusion proteins
expressed in
human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972-
897). In this system, the gene of interest is subcloned into a vaccinia
recombination plasmid such that the open reading frame of the gene is
translationally fused to an amino-terminal tag consisting of six histidine
residues.
15 The tag serves as a matrix-binding domain for the fusion protein. Extracts
from
cells infected with the recombinant vaccinia virus are loaded onto Ni''+
nitriloacetic
acid-agarose column and histidine-tagged proteins can be selectively eluted
with
imidazole-containing buffers.
The techniques of gene-shuffling, motif shuffling, exon-shuffling, and/or
2o codon-shuffling (collectively referred to as "DNA shuffling") may be
employed to
modulate the activities of TR6-alpha and/or TR6-beta thereby effectively
generating agonists and antagonists of TR6-alpha and/or TR6-beta. See
generally,
U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,837,458,
and
Patten, P. A., et al., Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, S.
25 Trends Biotechnol. 16(2):76-82 (1998); Hansson, L. O., et al., J. Mol.
Biol.
287:265-76 (1999); and Lorenzo, M. M. and Blasco, R. Biotechniques 24(2):308-
13 ( 1998) (each of these patents and publications are hereby incorporated by
reference). In one embodiment, alteration of TR6-alpha and/or TR6-beta
polynucleotides and corresponding polypeptides may be achieved by DNA



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
76
shuffling. DNA shuffling involves the assembly of two or more DNA segments
into a desired TR6-alpha and/or TR6-beta molecule by homologous, or site-
specific, recombination. In another embodiment, TR6-alpha and/or TR6-beta
polynucleotides and corresponding polypeptides may be alterred by being
subjected to random mutagenesis by error-prone PCR, random nucleotide
insertion or other methods prior to recombination. In another embodiment, one
or
more components, motifs, sections, parts, domains, fragments, etc., of TR6-
alpha
and/or TR6-beta may be recombined with one or more components, motifs,
sections, parts, domains, fragments, etc. of one or more heterologous
molecules.
In preferred embodiments, the heterologous molecules are TNF-alph, TNF-beta,
lymphotoxin-alpha, lymphotoxin-beta, FAS ligand, APRIL. In further preferred
embodiments, the heterologous molecules are any member of the TNF family.
Additionally, the techniques of gene-shuffling, motif shuffling, exon-
shuffling, and/or codon-shuffling (collectively referred to as "DNA
shuffling")
may be employed to modulate the activities of TNFR thereby effectively
generating agonists and antagonists of TNFR. See generally, U.S. Patent Nos.
5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,837,458, and Patten et al.,
Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol.
16(2):76-82 (1998); Hansson et al., J. Mol. Biol. 287:265-76 (1999); and
Lorenzo and Blasco, Biotechniques 24(2):308-13 (1998) (each of these patents
and publications are hereby incorporated by reference). In one embodiment,
alteration of TNFR polynucleotides and corresponding polypeptides may be
achieved by DNA shuffling. DNA shuffling involves the assembly of two or
more DNA segments into a desired TNFR molecule by homologous, or site-
specific, recombination. In another embodiment, TNFR polynucleotides and
corresponding polypeptides may be altered by being subjected to random
mutagenesis by error-prone PCR, random nucleotide insertion or other
methods prior to recombination. In another embodiment, one or more
components, motifs, sections, parts, domains, fragments, etc., of TNFR may



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
77
be recombined with one or more components, motifs, sections, parts, domains,
fragments, etc. of one or more heterologous molecules. In preferred
embodiments, the heterologous molecules are include, but are not limited to,
TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta
(found in complex heterotrimer LT-alpha2-beta), OPGL, Fast, CD27L,
CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International
Publication No. WO 96/14328), TRAIL, AIM-II (International Publication
No. WO 97!34911), APRIL (J. Exp. Med. 188(6):1185-1190), endokine-alpha
(International Publication No. WO 98/07880), neutrokine alpha (International
Publication No.W098/18921), TR6 (International Publication No. WO
98/30694), OPG, OX40, and nerve growth factor (NGF), and soluble forms of
Fas, CD30, CD27, CD40 and 4-IBB, TR2 (International Publication No. WO
96/34095), DR3 (International Publication No. WO 97/33904), DR4
(International Publication No. WO 98/32856), TR5 (International Publication
No. WO 98/30693), TR7 (International Publication No. WO 98/41629),
TRANK, TR9 (International Publication No. WO 98/56892), TR10
(International Publication No. WO 98/54202), 312C2 (International
Publication No. WO 98/06842), and TR12, and soluble forms CD154, CD70,
and CD 153. In further preferred embodiments, the heterologous molecules are
2o any member of the TNF family.
To improve or alter the characteristics of a TNFR polypeptide,
protein engineering may be employed. Recombinant DNA technology known
to those skilled in the art can be used to create novel mutant proteins or
"muteins" including single or multiple amino acid substitutions, deletions,
additions or fusion proteins. Such modified polypeptides can show, e.g.,
enhanced activity or increased stability. In addition, they may be purified in
higher yields and show better solubility than the corresponding natural
polypeptide, at least under certain purification and storage conditions. For
instance, for many proteins, including the extracellular domain of a membrane



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
78
associated protein or the mature forms) of a secreted protein, it is known in
the art that one or more amino acids may be deleted from the N-terminus or C-
terminus without substantial loss of biological function. For instance, Ron et
al., J. Biol. Chem., 268:2984-2988 (1993) reported modified KGF proteins
that had heparin binding activity even if 3, 8, or 27 amino-terminal amino
acid
residues were missing.
In the present case, since the proteins of the invention are members of
the TNFR polypeptide family, deletions of N-terminal amino acids up to the
Cysteine at position 49 of SEQ ID NOS:2 and 4 (TNFR-6 alpha and TNFR-6
1o beta) may retain some biological activity such as, for example regulation
of
cellular proliferation and apoptosis (e.g., of lymphoid cells), ability to
bind Fas
ligand (FasL), and ability to bind AIM-II. Polypeptides having further N-
terminal deletions including the Cys-49 residue in SEQ ID NOS:2 and 4, would
not be expected to retain such biological activities because it is known that
these residues in a TNFR-related polypeptide are required for forming a
disulfide bridge to provide structural stability which is needed for
receptor/ligand binding and signal transduction. However, even if deletion of
one or more amino acids from the N-terminus of a protein results in
modification of loss of one or more biological functions of the protein, other
functional activities may still be retained. Thus, the ability of the
shortened
protein to induce and/or bind to antibodies which recognize the complete or
mature TNFR or extracellular domain of TNFR protein generally will be
retained when less than the majority of the residues of the complete TNFR,
mature TNFR, or extracellular domain of TNFR are removed from the
N-terminus. Whether a particular polypeptide lacking N-terminal residues of a
complete protein retains such immunologic activities can readily be determined
by routine methods described herein and otherwise known in the art.
Accordingly, the present invention further provides polypeptides
comprising. or alternatively consisting of, one or more residues deleted from



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
79
the amino terminus of the amino acid sequence of the TNFR shown in SEQ ID
NOS:2 and 4, up to the cysteine residue at position number 49, and
polynucleotides encoding such polypeptides. In particular, the present
invention provides TNFR polypeptides comprising, or alternatively consisting
of, the amino acid sequence of residues m-300 of Figure 1 (SEQ ID N0:2)
and/or residues n-170 of Figure 2 (SEQ ID N0:4), where m and n are integers
in the range of 1-49 and where 49 is the position of the first cysteine
residue
from the N-terminus of the complete TNFR-6a and TNFR-6(3 polypeptides
(shown in SEQ ID NOS:2 and 4, respectively) believed to be required for
to activity of the TNFR-6a and TNFR-6(3 proteins.
More in particular, the invention provides polynucleotides encoding
polypeptides having (i.e., comprising) or alternatively consisting of, the
amino
acid sequence of a member selected from the group consisting of residues: 1-
300, 2-300, 3-300, 4-300, 5-300, 6-300, 7-300, 8-300, 9-300, 10-300, 11-300,
12-300, 13-300, 14-300, 15-300, 16-300, 17-300, 18-300, 19-300, 20-300, 21-
300, 22-300, 23-300, 24-300, 25-300, 26-300, 27-300, 28-300, 29-300, 30-
300, 31-300, 32-300, 33-300, 34-300, 35-300, 36-300, 37-300, 38-300, 39-
300, 40-300, 41-300, 42-300, 43-300, 44-300, 45-300, 46-300, 47-300, 48-
300, and 49-300 of SEQ ID N0:2; and 1-170, 2-170, 3-170, 4-170, 5-170, 6-
170, 7-170, 8-170, 9-170, 10-170, 11-170, 12-170, 13-170, 14-170, 15-170,
16-170, 17-170, 18-170, 19-170, 20-170, 21-170, 22-170, 23-170, 24-170, 25-
170, 26-170, 27-170, 28-170, 29-170, 30-170, 31-170, 32-170, 33-170, 34-
170, 35-170, 36-170, 37-170, 38-170, 39-170, 40-170, 41-170, 42-170, 43-
170, 44-170, 45-170, 46-170, 47-170, 48-170, and 49-170 of SEQ ID N0:4.
Polypeptides encoded by these polynucleotide fragments are also
encompassed by the invention.
In a specific embodiment, the invention provides polynucleotides
encoding polypeptides comprising, or alternatively consisting of, the amino



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
acid sequence of a member selected from the group consisting of residues: Val-
30 to His-300 of SEQ ID N0:2. Polypeptides encoded by these
polynucleotide fragments are also encompassed by the invention.
In other specific embodiments, the invention provides
5 polynucleotides encoding polypeptides comprising, or alternatively
consisting of, the amino acid sequence of a member selected from the group
consisting of residues: P-23 to H-300, and/or P-34 to H-300 of SEQ ID
N0:2. Polypeptides encoded by these polynucleotides are also
encompassed by the invention.
10 As mentioned above, even if deletion of one or more amino acids from
the N-terminus of a protein results in modification of loss of one or more
biological functions of the protein, other functional activities (e.g.,
biological
activities) may still be retained. Thus, the ability of shortened TNFR
muteins to induce and/or bind to antibodies which recognize the complete or
15 mature forms of the polypeptides generally will be retained when less than
the majority of the residues of the complete or mature polypeptide are
removed from the N-terminus. Whether a particular polypeptide lacking
N-terminal residues of a complete polypeptide retains such immunologic
activities can readily be determined by routine methods described herein and
20 otherwise known in the art. It is not unlikely that a TNFR mutein with a
large number of deleted N-terminal amino acid residues may retain some
biological or immunogenic activities. In fact, peptides composed of as few as
six TNFR amino acid residues may often evoke an immune response.
Accordingly, the present invention further provides polypeptides
25 having one or more residues deleted from the amino terminus of the TNFR-
6a amino acid sequence shown in Figure 1 (i.e., SEQ ID N0:2), up to the
arginine residue at position number 295 and polynucleotides encoding such
polypeptides. In particular, the present invention provides polypeptides
comprising or alternatively consisting of, the amino acid of residues n'-300
of



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
81
Figure 1 (SEQ ID N0:2), where n' is an integer from 49 to 295,
corresponding to the position of the amino acid residue in Figure 1 (SEQ ID
N0:2).
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence of a member selected from the group consisting of residues of C-49
to H-300; A-50 to H-300; Q-51 to H-300; C-52 to H-300; P-53 to H-300;
P-54 to H-300; G-55 to H-300; T-56 to H-300; F-57 to H-300; V-58 to
H-300; Q-59 to H-300; R-60 to H-300; P-61 to H-300; C-62 to H-300; R-63
1o to H-300; R-64 to H-300; D-65 to H-300; S-66 to H-300; P-67 to H-300;
T-68 to H-300; T-69 to H-300; C-70 to H-300; G-71 to H-300; P-72 to
H-300; C-73 to H-300; P-74 to H-300; P-75 to H-300; R-76 to H-300; H-77
to H-300; Y-78 to H-300; T-79 to H-300; Q-80 to H-300; F-81 to H-300;
W-82 to H-300; N-83 to H-300; Y-84 to H-300; L-85 to H-300; E-86 to
H-300; R-87 to H-300; C-88 to H-300; R-89 to H-300; Y-90 to H-300; C-91
to H-300; N-92 to H-300; V-93 to H-300; L-94 to H-300; C-95 to H-300;
G-96 to H-300; E-97 to H-300; R-98 to H-300; E-99 to H-300; E-100 to
H-300; E-101 to H-300; A-102 to H-300; R-103 to H-300; A-104 to H-300;
C-105 to H-300; H-106 to H-300; A-107 to H-300; T-108 to H-300; H-109
2o to H-300; N-110 to H-300; R-111 to H-300; A-112 to H-300; C-113 to
H-300; R-114 to H-300; C-115 to H-300; R-116 to H-300; T-117 to H-300;
G-118 to H-300; F-119 to H-300; F-120 to H-300; A-121 to H-300; H-122
to H-300; A-123 to H-300; G-124 to H-300; F-125 to H-300; C-126 to
H-300; L-127 to H-300; E-128 to H-300; H-129 to H-300; A-130 to H-300;
2s S-131 to H-300; C-132 to H-300; P-133 to H-300; P-134 to H-300; G-135 to
H-300; A-136 to H-300; G-137 to H-300; V-138 to H-300; I-139 to H-300;
A-140 to H-300; P-141 to H-300; G-142 to H-300; T-143 to H-300; P-144
to H-300; S-145 to H-300; Q-146 to H-300; N-147 to H-300; T-148 to
H-300; Q-149 to H-300; C-150 to H-300; Q-151 to H-300; P-152 to H-300;



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
82
C-153 to H-300; P-154 to H-300; P-155 to H-300; G-156 to H-300; T-157
to H-300; F-158 to H-300; S-159 to H-300; A-160 to H-300; S-161 to
H-300; S-162 to H-300; S-163 to H-300; S-I64 to H-300; S-165 to H-300;
E-166 to H-300; Q-167 to H-300; C-168 to H-300; Q-169 to H-300; P-170
to H-300; H-171 to H-300; R-172 to H-300; N-173 to H-300; C-174 to
H-300; T-175 to H-300; A-176 to H-300; L-177 to H-300; G-178 to H-300;
L-179 to H-300; A-180 to H-300; L-181 to H-300; N-182 to H-300; V-183
to H-300; P-184 to H-300; G-185 to H-300; S-186 to H-300; S-187 to
H-300; S-188 to H-300; H-189 to H-300; D-190 to H-300; T-I91 to H-300;
to L-192 to H-300; C-193 to H-300; T-194 to H-300; S-195 to H-300; C-196 to
H-300; T-I97 to H-300; G-198 to H-300; F-199 to H-300; P-200 to H-300;
L-201 to H-300; S-202 to H-300; T-203 to H-300; R-204 to H-300; V-205 to
H-300; P-206 to H-300; G-207 to H-300; A-208 to H-300; E-209 to H-300;
E-210 to H-300; C-211 to H-300; E-212 to H-300; R-213 to H-300; A-214
to H-300; V-215 to H-300; I-216 to H-300; D-217 to H-300; F-218 to
H-300; V-2I9 to H-300; A-220 to H-300; F-221 to H-300; Q-222 to H-300;
D-223 to H-300; I-224 to H-300; S-225 to H-300; I-226 to H-300; K-227 to
H-300; R-228 to H-300; L-229 to H-300; Q-230 to H-300; R-231 to H-300;
L-232 to H-300; L-233 to H-300; Q-234 to H-300; A-235 to H-300; L-236
2o to H-300; E-237 to H-300; A-238 to H-300; P-239 to H-300; E-240 to
H-300; G-241 to H-300; W-242 to H-300; G-243 to H-300; P-244 to H-300;
T-245 to H-300; P-246 to H-300; R-247 to H-300; A-248 to H-300; G-249
to H-300; R-250 to H-300; A-251 to H-300; A-252 to H-300; L-253 to
H-300; Q-254 to H-300; L-255 to H-300; K-256 to H-300; L-257 to H-300;
R-258 to H-300; R-259 to H-300; R-260 to H-300; L-261 to H-300; T-262
to H-300; E-263 to H-300; L-264 to H-300; L-265 to H-300; G-266 to
H-300; A-267 to H-300; Q-268 to H-300; D-269 to H-300; G-270 to H-300;
A-271 to H-300; L-272 to H-300; L-273 to H-300; V-274 to H-300; R-275
to H-300; L-276 to H-300; L-277 to H-300; Q-278 to H-300; A-279 to



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
83
H-300; L-280 to H-300; R-281 to H-300; V-282 to H-300; A-283 to H-300;
R-284 to H-300; M-285 to H-300; P-286 to H-300; G-287 to H-300; L-288
to H-300; E-289 to H-300; R-290 to H-300; S-291 to H-300; V-292 to
H-300; R-293 to H-300; E-294 to H-300; and R-295 to H-300 of the TNFR-
6a sequence shown in Figure 1 (SEQ ID N0:2). Polypeptides encoded by
these polynucleotide fragments are also encompassed by the invention.
Similarly, many examples of biologically functional C-terminal deletion
muteins are known. For instance, interferon gamma shows up to ten times
higher activities by deleting 8-10 amino acid residues from the carboxy
l0 terminus of the protein (Dobeli et al., J. Biotechnology 7:199-216 (1988)).
In
the present case, since the protein of the invention is a member of the TNFR
polypeptide family, deletions of C-terminal amino acids up to the cysteine at
position 193 and 132 of SEQ ID NOS:2 and 4, respectively, may retain some
functional activity, such as, for example, a biological activity (such as, for
example, regulation of proliferation and apoptosis (e.g., of lymphoid cells,
ability to bind Fas ligand, and ability to bind AIM-II)). Polypeptides having
further C-terminal deletions including the cysteines at positions 193 and 132
of SEQ ID NOS:2 and 4, respectively, would not be expected to retain such
biological activities because it is known that these residues in TNF receptor-
2o related polypeptides are required for forming disulfide bridges to provide
structural stability which is needed for receptor binding.
However, even if deletion of one or more amino acids from the C-
terminus of a protein results in modification or loss of one or more
biological
functions of the protein, other functional activities (e.g., biological
activities,
the ability to multimerize, and the ability to bind ligand (e.g., Fas ligand
and
AIM-II)) may still be retained. Thus, the ability of the shortened protein to
induce and/or bind to antibodies which recognize the complete or mature form
of the protein generally will be retained when less than the majority of the
residues of the complete or mature form protein are removed from the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
84
C-terminus. Whether a particular polypeptide lacking C-terminal residues of a
complete protein retains such immunologic activities can readily be determined
by routine methods described herein and otherwise known in the art.
Accordingly, the present invention further provides polypeptides
having one or more residues from the carboxy terminus of the amino acid
sequence of TNFR-6 alpha and T'NFR-6 beta shown in SEQ ID NOS:2 and 4
up to the cysteine at position 193 and 132 of SEQ ID NOS:2 and 4,
respectively, and polynucleotides encoding such polypeptides. In particular,
the present invention provides polypeptides comprising, or alternatively
consisting of, the amino acid sequence of a member selected from the group
consisting of residues 1-y and 1-z of the amino acid sequence in SEQ ID
NOS:2 and 4, respectively, where y is any integer in the range of 193-300 and
z is any integer in the range of 132-170. Polynucleotides encoding these
polypeptides also are provided.
In certain preferred embodiments, the present invention provides
polypeptides comprising, or alternatively, consisting of, the amino acid
sequence of a member selected from the group consisting of residues 1-y' and
1-z' of the amino acid sequence in SEQ ID NOS:2 and 4, respectively, where
y' is any integer in the range of 193-299 and z' is any integer in the range
of
132-169. Polynucleotides encoding these polypeptides also are provided.
In additional preferred specific embodiments, the present invention
provides polypeptides comprising, or alternatively consisting of, the amino
acid sequence of a member selected from the group consisting of residues
Pro-23 to His-300, Val-30 to His-300, and Pro-34 to His-300 of SEQ ID N0:2
and polypeptides having the amino acid sequence of a member selected from
the group consisting of residues Pro-23 to Pro-170, Val-30 to Pro-170, and
Pro-34 to His-Pro-170 of SEQ ID N0:4. As described herein, these
polypeptides may be fused to heterologous polypeptide sequences.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
Polynucleotides encoding these polypeptides and these fusion polypeptides
are also provided.
The invention also provides polypeptides having one or more amino
acids deleted from both the amino and the carboxyl termini, which may be
5 described generally as having residues m-y of SEQ ID N0:2 and n-z of SEQ
ID N0:4, where m, n, y and z are integers as described above.
Also as mentioned above, even if deletion of one or more amino acids
from the C-terminus of a protein results in modification or loss of one or
more biological functions of the protein, other functional activities (e.g.,
l0 biological activities, the ability to form homomultimers, and the ability
to
bind ligand (e.g., Fas ligand and AIM-II)) may still be retained. For example,
the ability of the shortened TNFR mutein to induce and/or bind to antibodies
which recognize the complete or mature forms of the polypeptide generally
will be retained when less than the majority of the residues of the complete
or
15 mature polypeptide are removed from the C-terminus. Whether a particular
polypeptide lacking C-terminal residues of a complete polypeptide retains
such immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art. It is not unlikely that a
TNFR mutein with a large number of deleted C-terminal amino acid residues
20 may retain some biological or immunogenic activities. In fact, peptides
composed of as few as six TNFR amino acid residues may often evoke an
immune response.
Accordingly, the present invention further provides polypeptides
having one or more residues deleted from the carboxy terminus of the amino
25 acid sequence of the TNFR polypeptide shown in Figure 1 (SEQ ID N0:2),
up to the glycine residue at position number 6, and polynucleotides encoding
such polypeptides. In particular, the present invention provides
polypeptides comprising, or alternatively consisting of, the amino acid
sequence of residues 1-ml of Figure 1 (i.e., SEQ ID N0:2), where ml is an



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
86
integer from 6 to 299, corresponding to the position of the amino acid residue
in Figure 1 (SEQ ID N0:2).
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence of a member selected from the group consisting of residues M-1 to
V-299; M-1 to P-298; M-1 to L-297; M-1 to F-296; M-1 to R-295; M-1 to
E-294; M-1 to R-293; M-1 to V-292; M-1 to S-291; M-1 to R-290; M-1 to
E-289; M-1 to L-288; M-1 to G-287; M-1 to P-286; M-1 to M-285; M-1 to
R-284; M-1 to A-283; M-1 to V-282; M-1 to R-281; M-1 to L-280; M-1 to
A-279; M-1 to Q-278; M-1 to L-277; M-1 to L-276; M-1 to R-275; M-1 to
V-274; M-1 to L-273; M-1 to L-272; M-1 to A-271; M-1 to G-270; M-1 to
D-269; M-1 to Q-268; M-1 to A-267; M-1 to G-266; M-1 to L-265; M-1 to
L-264; M-1 to E-263; M-1 to T-262; M-1 to L-261; M-1 to R-260; M-1 to
R-259; M-1 to R-258; M-1 to L-257; M-1 to K-256; M-1 to L-255; M-1 to
Q-254; M-1 to L-253; M-1 to A-252; M-1 to A-251; M-1 to R-250; M-1 to
G-249; M-1 to A-248; M-1 to R-247; M-1 to P-246; M-1 to T-245; M-1 to
P-244; M-1 to G-243; M-1 to W-242; M-1 to G-241; M-1 to E-240; M-1 to
P-239; M-1 to A-238; M-1 to E-237; M-1 to L-236; M-1 to A-235; M-1 to
Q-234; M-1 to L-233; M-1 to L-232; M-1 to R-231; M-1 to Q-230; M-1 to
2o L-229; M-1 to R-228; M-1 to K-227; M-1 to I-226; M-1 to S-225; M-1 to
I-224; M-1 to D-223; M-1 to Q-222; M-1 to F-221; M-1 to A-220; M-1 to
V-219; M-1 to F-218; M-1 to D-217; M-1 to I-216; M-1 to V-215; M-1 to
A-214; M-1 to R-213; M-1 to E-212; M-1 to C-211; M-1 to E-210; M-1 to
E-209; M-1 to A-208; M-1 to G-207; M-1 to P-206; M-1 to V-205; M-1 to
R-204; M-1 to T-203; M-1 to S-202; M-1 to L-201; M-1 to P-200; M-1 to
F-199; M-1 to G-198; M-1 to T-197; M-1 to C-196; M-1 to S-195; M-1 to
T-194; M-1 to C-193; M-1 to L-192; M-1 to T-191; M-1 to D-190; M-1 to
H-189; M-1 to S-188; M-1 to S-187; M-1 to S-186; M-1 to G-185; M-1 to
P-184; M-1 to V-183; M-1 to N-182; M-1 to L-181; M-1 to A-180; M-1 to



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
87
L-179; M-1 to G-178; M-1 to L-177; M-1 to A-176; M-1 to T-175; M-1 to
C-174; M-l to N-173; M-I to R-172; M-1 to H-171; M-1 to P-170; M-1 to
Q-169; M-1 to C-168; M-1 to Q-167; M-1 to E-166; M-1 to S-165; M-1 to
S-164; M-1 to S-163; M-1 to S-162; M-1 to S-161; M-1 to A-160; M-1 to
S-159; M-1 to F-158; M-I to T-157; M-1 to G-156; M-1 to P-155; M-1 to
P-154; M-1 to C-153; M-I to P-152; M-1 to Q-151; M-1 to C-150; M-1 to
Q-149; M-1 to T-148; M-1 to N-147; M-1 to Q-146; M-1 to S-145; M-1 to
P-144; M-1 to T-143; M-1 to G-142; M-1 to P-141; M-1 to A-140; M-1 to
I-139; M-1 to V-138; M-1 to G-137; M-1 to A-136; M-1 to G-135; M-1 to
1o P-134; M-1 to P-133; M-1 to C-132; M-1 to S-131; M-1 to A-130; M-1 to
H-129; M-1 to E-128; M-1 to L-127; M-I to C-126; M-1 to F-125; M-1 to
G-124; M-1 to A-123; M-1 to H-122; M-1 to A-121; M-1 to F-120; M-1 to
F-119; M-1 to G-118; M-1 to T-117; M-1 to R-116; M-1 to C-115; M-1 to
R-114; M-I to C-113; M-1 to A-112; M-1 to R-I I 1; M-1 to N-110; M-1 to
H-109; M-1 to T-108; M-1 to A-107; M-1 to H-106; M-1 to C-105; M-1 to
A-104; M-1 to R-103; M-1 to A-102; M-1 to E-101; M-1 to E-100; M-1 to
E-99; M-1 to R-98; M-1 to E-97; M-1 to G-96; M-1 to C-95; M-1 to L-94;
M-1 to V-93; M-1 to N-92; M-1 to C-91; M-1 to Y-90; M-I to R-89; M-1
to C-88; M-1 to R-87; M-1 to E-86; M-I to L-85; M-1 to Y-84; M-1 to
2o N-83; M-1 to W-82; M-1 to F-81; M-1 to Q-80; M-1 to T-79; M-1 to Y-78;
M-1 to H-77; M-1 to R-76; M-1 to P-75; M-1 to P-74; M-1 to C-73; M-1
to P-72; M-1 to G-71; M-1 to C-70; M-1 to T-69; M-1 to T-68; M-1 to
P-67; M-1 to S-66; M-1 to D-65; M-1 to R-64; M-I to R-63; M-1 to C-62;
M-1 to P-61; M-1 to R-60; M-I to Q-59; M-1 to V-58; M-1 to F-57; M-1
to T-56; M-1 to G-55; M-1 to P-54; M-1 to P-53; M-1 to C-52; M-1 to
Q-51; M-I to A-50; M-1 to C-49; M-1 to V-48; M-1 to L-47; M-1 to R-46;
M-1 to E-45; M-1 to G-44; M-1 to T-43; M-1 to E-42; M-1 to A-41; M-1
to D-40; M-1 to R-39; M-1 to W-38; M-1 to P-37; M-1 to Y-36; M-1 to
T-35; M-1 to P-34; M-1 to T-33; M-1 to E-32; M-1 to A-31; M-1 to V-30;



CA 02362929 2001-08-16
WO 00/52028 PCT/iJS00/05686
88
M-1 to G-29; M-1 to R-28; M-1 to V-27; M-1 to A-26; M-1 to P-25; M-1
to V-24; M-1 to P-23; M-1 to L-22; M-1 to L-21; M-1 to A-20; M-1 to
P-19; M-1 to L-18; M-1 to A-17; M-1 to L-16; M-1 to V-15; M-1 to L-14;
M-1 to C-13; M-1 to L-12; M-1 to L-11; M-1 to S-10; M-1 to L-9; M-1 to
G-8; M-1 to P-7; and M-1 to G-6 of the sequence of the TFNR sequence
shown in Figure 1 (SEQ ID N0:2). Polypeptides encoded by these
polynucleotide fragments are also encompassed by the invention.
In specific embodiments, the invention provides polynucleotides
encoding polypeptides comprising or alternatively consisting of the amino acid
sequence of a member selected from the group consisting of residues: M-1 to
A-271, M-1 to Q-254 and/or M-1 to F-221 of SEQ ID N0:2. Polypeptides
encoded by these polynucleotide fragments are also encompassed by the
invention.
The invention also provides polypeptides having one or more amino
acids deleted from both the amino and the carboxyl termini of a TNFR
polypeptide, which may be described generally as having residues nl-m' of
Figure 1 (i.e., SEQ ID N0:2), where n' and ml are integers as described
above.
In additional embodiments, the present invention provides
2o polypeptides comprising. or alternatively consisting of, the amino acid
sequence of residues 30-m3 of Figure 1 (i.e., SEQ ID N0:2), where m3 is an
integer from 36 to 299, corresponding to the position of the amino acid
residue in Figure 1 (SEQ ID N0:2). For example, the invention provides
polynucleotides encoding polypeptides comprising, or alternatively
consisting of, the amino acid sequence of a member selected from the group
consisting of residues V-30 to V-299; V-30 to P-298; V-30 to L-297; V-30 to
F-296; V-30 to R-295; V-30 to E-294; V-30 to R-293; V-30 to V-292; V-30
to S-291; V-30 to R-290; V-30 to E-289; V-30 to L-288; V-30 to G-287; V-
to P-286; V-30 to M-285; V-30 to R-284; V-30 to A-283; V-30 to V-282;



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
89
V-30 to R-281; V-30 to L-280; V-30 to A-279; V-30 to Q-278; V-30 to
L-277; V-30 to L-276; V-30 to R-275; V-30 to V-274; V-30 to L-273; V-30
to L-272; V-30 to A-271; V-30 to G-270; V-30 to D-269; V-30 to Q-268; V-
30 to A-267; V-30 to G-266; V-30 to L-265; V-30 to L-264; V-30 to E-263;
V-30 to T-262; V-30 to L-261; V-30 to R-260; V-30 to R-259; V-30 to
R-258; V-30 to L-257; V-30 to K-256; V-30 to L-255; V-30 to Q-254; V-30
to L-253; V-30 to A-252; V-30 to A-251; V-30 to R-250; V-30 to G-249; V-
30 to A-248; V-30 to R-247; V-30 to P-246; V-30 to T-245; V-30 to P-244;
V-30 to G-243; V-30 to W-242; V-30 to G-241; V-30 to E-240; V-30 to
1o P-239; V-30 to A-238; V-30 to E-237; V-30 to L-236; V-30 to A-235; V=30
to Q-234; V-30 to L-233; V-30 to L-232; V-30 to R-231; V-30 to Q-230; V-
30 to L-229; V-30 to R-228; V-30 to K-227; V-30 to I-226; V-30 to S-225;
V-30 to I-224; V-30 to D-223; V-30 to Q-222; V-30 to F-221; V-30 to
A-220; V-30 to V-219; V-30 to F-218; V-30 to D-217; V-30 to I-216; V-30
to V-215; V-30 to A-214; V-30 to R-213; V-30 to E-212; V-30 to C-211; V-
30 to E-210; V-30 to E-209; V-30 to A-208; V-30 to G-207; V-30 to P-206;
V-30 to V-205; V-30 to R-204; V-30 to T-203; V-30 to S-202; V-30 to
L-201; V-30 to P-200; V-30 to F-199; V-30 to G-198; V-30 to T-197; V-30
to C-196; V-30 to S-195; V-30 to T-194; V-30 to C-193; V-30 to L-192; V-
30 to T-191; V-30 to D-190; V-30 to H-189; V-30 to S-188; V-30 to S-187;
V-30 to S-186; V-30 to G-185; V-30 to P-184; V-30 to V-183; V-30 to
N-182; V-30 to L-181; V-30 to A-180; V-30 to L-179; V-30 to G-178; V-30
to L-177; V-30 to A-176; V-30 to T-175; V-30 to C-174; V-30 to N-173; V-
to R-172; V-30 to H-171; V-30 to P-170; V-30 to Q-169; V-30 to C-168;
25 V-30 to Q-167; V-30 to E-166; V-30 to S-165; V-30 to S-164; V-30 to S-163;
V-30 to S-162; V-30 to S-161; V-30 to A-160; V-30 to S-159; V-30 to F-158;
V-30 to T-157; V-30 to G-156; V-30 to P-155; V-30 to P-154; V-30 to
C-153; V-30 to P-152; V-30 to Q-151; V-30 to C-150; V-30 to Q-149; V-30
to T-148; V-30 to N-147; V-30 to Q-146; V-30 to S-145; V-30 to P-144; V-



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
30 to T-143; V-30 to G-142; V-30 to P-141; V-30 to A-140; V-30 to I-139;
V-30 to V-138; V-30 to G-137; V-30 to A-136; V-30 to G-135; V-30 to
P-134; V-30 to P-133; V-30 to C-132; V-30 to S-131; V-30 to A-130; V-30
to H-129; V-30 to E-128; V-30 to L-127; V-30 to C-126; V-30 to F-125; V-
5 30 to G-124; V-30 to A-123; V-30 to H-122; V-30 to A-121; V-30 to F-120;
V-30 to F-119; V-30 to G-118; V-30 to T-117; V-30 to R-116; V-30 to
C-115; V-30 to R-114; V-30 to C-113; V-30 to A-112; V-30 to R-111; V-30
to N-110; V-30 to H-109; V-30 to T-108; V-30 to A-107; V-30 to H-106; V-
30 to C-105; V-30 to A-104; V-30 to R-103; V-30 to A-102; V=30 to E-101;
1o V-30 to E-100; V-30 to E-99; V-30 to R-98; V-30 to E-97; V-30 to G-96; V-
30 to C-95; V-30 to L-94; V-30 to V-93; V-30 to N-92; V-30 to C-91; V-30
to Y-90; V-30 to R-89; V-30 to C-88; V-30 to R-87; V-30 to E-86; V-30 to
L-85; V-30 to Y-84; V-30 to N-83; V-30 to W-82; V-30 to F-81; V-30 to
Q-80; V-30 to T-79; V-30 to Y-78; V-30 to H-77; V-30 to R-76; V-30 to
15 P-75; V-30 to P-74; V-30 to C-73; V-30 to P-72; V-30 to G-71; V-30 to
C-70; V-30 to T-69; V-30 to T-68; V-30 to P-67; V-30 to S-66; V-30 to
D-65; V-30 to R-64; V-30 to R-63; V-30 to C-62; V-30 to P-61; V-30 to
R-60; V-30 to Q-59; V-30 to V-58; V-30 to F-57; V-30 to T-56; V-30 to
G-55; V-30 to P-54; V-30 to P-53; V-30 to C-52; V-30 to Q-51; V-30 to
20 A-50; V-30 to C-49; V-30 to V-48; V-30 to L-47; V-30 to R-46; V-30 to
E-45; V-30 to G-44; V-30 to T-43; V-30 to E-42; V-30 to A-41; V-30 to
D-40; V-30 to R-39; V-30 to W-38; V-30 to P-37; and V-30 to Y-36 of the
sequence of the TFNR sequence shown in Figure 1 (SEQ ID N0:2).
Polypeptides encoded by these polynucleotide fragments are also
25 encompassed by the invention. In specific embodiments, the invention
provides polynucleotides encoding polypeptides comprising or alternatively
consisting of the amino acid sequence of a member selected from the group
consisting of residues: V-30 to A-271, V-30 to Q-254 and/or V-30 to F-221
of SEQ ID N0:2. Polypeptides encoded by these polynucleotides are also



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
91
encompassed by the invention. The present application is also directed to
polynucleotides or polypeptides comprising, or alternatively, consisting of, a
polynucleotide or polypeptide sequence at least 80%, 85%, 90%, 92%, 95%,
96%, 97%, 98% or 99% identical to a polypeptide or polypeptide sequence
described above, respectively. The present invention also encompasses the
above polynucleotide or polypeptide sequences fused to a heterologous
polynucleotide or polypeptide sequence, respectively.
With respect to fragments of TNFR-6(3, as mentioned above, even if
deletion of one or more amino acids from the N-terminus of a protein results
1o in modification of loss of one or more biological functions of the protein,
other functional activities (e.g., biological activities, the ability to
multimerize,
the ability to bind ligand (e.g., Fas ligand and/or AIM-II)) may still be
retained. For example, the ability of shortened TNFR muteins to induce
and/or bind to antibodies which recognize the complete or mature forms of
the polypeptides generally will be retained when less than the majority of the
residues of the complete or mature polypeptide are removed from the
N-terminus. Whether a particular polypeptide lacking N-terminal residues of
a complete polypeptide retains such immunologic activities can readily be
determined by routine methods described herein and otherwise known in the
art. It is not unlikely that a TNFR mutein with a large number of deleted
N-terminal amino acid residues may retain some biological or immunogenic
activities. In fact, peptides composed of as few as six TNFR amino acid
residues may often evoke an immune response.
Accordingly, the present invention further provides polypeptides
comprising, or alternatively, consisting of, one or more residues deleted from
the amino terminus of the TNFR-6(3 amino acid sequence shown in Figure 2
(i.e., SEQ ID N0:4), up to the glycine residue at position number 165 and
polynucleotides encoding such polypeptides. In particular, the present



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
92
invention provides polypeptides comprising, or alternatively consisting of,
the amino acid sequence of residues n2-170 of Figure 2 (SEQ ID N0:4),
where nz is an integer from 2 to 165, corresponding to the position of the
amino acid residue in Figure 2 (SEQ ID N0:4).
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence of a member selected from the group consisting of residues of R-2
to P-170; A-3 to P-170; L-4 to P-170; E-5 to P-170; G-6 to P-170; P-7 to
P-170; G-8 to P-170; L-9 to P-170; S-10 to P-170; L-11 to P-170; L-12 to
1o P-170; C-13 to P-170; L-14 to P-170; V-15 to P-170; L-16 to P-170; A-17 to
P-170; L-18 to P-170; P-19 to P-170; A-20 to P-170; L-21 to P-170; L-22 to
P-170; P-23 to P-170; V-24 to P-170; P-25 to P-170; A-26 to P-170; V-27 to
P-170; R-28 to P-170; G-29 to P-170; V-30 to P-170; A-31 to P-170; E-32 to
P-170; T-33 to P-170; P-34 to P-170; T-35 to P-170; Y-36 to P-170; P-37 to
P-170; W-38 to P-170; R-39 to P-170; D-40 to P-170; A-41 to P-170; E-42
to P-170; T-43 to P-170; G-44 to P-170; E-45 to P-170; R-46 to P-170; L-47
to P-170; V-48 to P-170; C-49 to P-170; A-50 to P-170; Q-51 to P-170;
C-52 to P-170; P-53 to P-170; P-54 to P-170; G-55 to P-170; T-56 to P-170;
F-57 to P-170; V-58 to P-170; Q-59 to P-170; R-60 to P-170; P-61 to P-170;
2o C-62 to P-170; R-63 to P-170; R-64 to P-170; D-65 to P-170; S-66 to P-170;
P-67 to P-170; T-68 to P-170; T-69 to P-170; C-70 to P-170; G-71 to P-170;
P-72 to P-170; C-73 to P-170; P-74 to P-170; P-75 to P-170; R-76 to P-170;
H-77 to P-170; Y-78 to P-170; T-79 to P-170; Q-80 to P-170; F-81 to P-170;
W-82 to P-170; N-83 to P-170; Y-84 to P-170; L-85 to P-170; E-86 to
P-170; R-87 to P-170; C-88 to P-170; R-89 to P-170; Y-90 to P-170; C-91 to
P-170; N-92 to P-170; V-93 to P-170; L-94 to P-170; C-95 to P-170; G-96 to
P-170; E-97 to P-170; R-98 to P-170; E-99 to P-170; E-100 to P-170; E-101
to P-170; A-102 to P-170; R-103 to P-170; A-104 to P-170; C-105 to P-170;
H-106 to P-170; A-107 to P-170; T-108 to P-170; H-109 to P-170; N-110 to



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
93
P-170; R-111 to P-170; A-112 to P-170; C-113 to P-170; R-114 to P-170;
C-115 to P-170; R-116 to P-170; T-117 to P-170; G-118 to P-170; F-119 to
P-170; F-120 to P-170; A-121 to P-170; H-122 to P-170; A-123 to P-170;
G-124 to P-170; F-125 to P-170; C-126 to P-170; L-127 to P-170; E-128 to
P-170; H-129 to P-170; A-130 to P-170; S-131 to P-170; C-132 to P-170;
P-133 to P-170; P-134 to P-170; G-135 to P-170; A-136 to P-170; G-137 to
P-170; V-138 to P-170; I-139 to P-170; A-140 to P-170; P-141 to P-170;
G-142 to P-170; E-143 to P-170; S-144 to P-170; W-145 to P-170; A-146 to
P-170; R-147 to P-170; G-148 to P-170; G-149 to P-170; A-150 to P-170;
1o P-151 to P-170; R-152 to P-170; S-153 to P-170; G-154 to P-170; G-155 to
P-170; R-156 to P-170; R-157 to P-170; C-158 to P-170; G-159 to P-170;
R-160 to P-170; G-161 to P-170; Q-162 to P-170; V-163 to P-170; A-164 to
P-170; and G-165 to P-170 of the TNFR-6(3 sequence shown in Figure 2
(SEQ ID N0:4). Polypeptides encoded by these polynucleotide fragments
are also encompassed by the invention.
Also as mentioned above, even if deletion of one or more amino acids
from the C-terminus of a protein results in modification of loss of one or
more biological functions of the protein, other functional activities (e.g.,
biological activities, the ability to multimerize, ability to bind ligand
(e.g., Fas
2o ligand and/or AIM-II) may still be retained. For example, the ability of
the
shortened TNFR-6(3 mutein to induce and/or bind to antibodies which
recognize the complete or mature forms of the polypeptide generally will be
retained when less than the majority of the residues of the complete or
mature polypeptide are removed from the C-terminus. Whether a particular
polypeptide lacking C-terminal residues of a complete polypeptide retains
such immunologic activities can readily be determined by routine methods
described herein and otherwise known in the art. It is not unlikely that a
TNFR-6(3 mutein with a large number of deleted C-terminal amino acid



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
94
residues may retain some biological or immunogenic activities. In fact,
peptides composed of as few as six TNFR-6(3 amino acid residues may often
evoke an immune response.
Accordingly, the present invention further provides polypeptides
comprising, or alternatively consisting of one or more residues deleted from
the carboxy terminus of the amino acid sequence of the TNFR-6(3
polypeptide shown in Figure 2 (SEQ ID N0:4), up to the glycine residue at
position number 6, and polynucleotides encoding such polypeptides. In
particular, the present invention provides polypeptides comprising , or
l0 alternatively consisting of, the amino acid sequence of residues 1-m' of
Figure
2 (i.e., SEQ ID N0:2), where mz is an integer from 6 to 169, corresponding to
the position of the amino acid residue in Figure 2 (SEQ ID N0:4).
More in particular, the invention provides polynucleotides encoding
polypeptides comprising, or alternatively consisting of, the amino acid
sequence of a member selected from the group consisting of residues M-1 to
A-169; M-1 to L-168; M-1 to S-167; M-1 to P-166; M-1 to G-165; M-1 to
A-164; M-1 to V-163; M-1 to Q-162; M-1 to G-161; M-1 to R-160; M-1 to
G-159; M-1 to C-158; M-1 to R-157; M-1 to R-156; M-1 to G-155; M-1 to
G-154; M-1 to S-153; M-1 to R-152; M-1 to P-151; M-1 to A-150; M-1 to
2o G-149; M-1 to G-148; M-1 to R-147; M-1 to A-146; M-1 to W-145; M-1 to
S-144; M-1 to E-143; M-1 to G-142; M-1 to P-141; M-1 to A-140; M-1 to
I-139; M-1 to V-138; M-1 to G-137; M-1 to A-136; M-1 to G-135; M-1 to
P-134; M-1 to P-133; M-1 to C-132; M-1 to S-131; M-1 to A-130; M-1 to
H-129; M-1 to E-128; M-1 to L-127; M-1 to C-126; M-1 to F-125; M-1 to
G-124; M-1 to A-123; M-1 to H-122; M-1 to A-121; M-1 to F-120; M-1 to
F-119; M-1 to G-118; M-1 to T-117; M-1 to R-116; M-1 to C-115; M-1 to
R-114; M-1 to C-113; M-1 to A-112; M-1 to R-111; M-1 to N-110; M-1 to
H-109; M-1 to T-108; M-1 to A-107; M-1 to H-106; M-1 to C-105; M-1 to



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
A-104; M-1 to R-103; M-1 to A-102; M-1 to E-101; M-1 to E-100; M-1 to
E-99; M-1 to R-98; M-1 to E-97; M-1 to G-96; M-1 to C-95; M-1 to L-94;
M-1 to V-93; M-1 to N-92; M-1 to C-91; M-1 to Y-90; M-1 to R-89; M-1
to C-88; M-1 to R-87; M-1 to E-86; M-1 to L-85; M-1 to Y-84; M-1 to
5 N-83; M-1 to W-82; M-1 to F-81; M-1 to Q-80; M-1 to T-79; M-1 to Y-78;
M-1 to H-77; M-1 to R-76; M-1 to P-75; M-1 to P-74; M-1 to C-73; M-1
to P-72; M-1 to G-71; M-1 to C-70; M-1 to T-69; M-1 to T-68; M-1 to
P-67; M-1 to S-66; M-1 to D-65; M-1 to R-64; M-1 to R-63; M-1 to C-62;
M-1 to P-61; M-1 to R-60; M-1 to Q-59; M-1 to V-58; M-1 to F-57; M-1
10 to T-56; M-1 to G-55; M-1 to P-54; M-1 to P-53; M-1 to C-52; M-1 to
Q-51; M-1 to A-50; M-1 to C-49; M-1 to V-48; M-1 to L-47; M-1 to R-46;
M-1 to E-45 ; M-1 to G-44; M-1 to T-43 ; M-1 to E-42; M-1 to A-41; M-1
to D-40; M-1 to R-3 9; M-1 to W-3 8; M-1 to P-3 7; M-1 to Y-3 6; M-1 to
T-35; M-1 to P-34; M-1 to T-33; M-1 to E-32; M-1 to A-31; M-1 to V-30;
15 M-1 to G-29; M-1 to R-28; M-1 to V-27; M-1 to A-26; M-1 to P-25; M-1
to V-24; M-1 to P-23; M-1 to L-22; M-1 to L-21; M-1 to A-20; M-1 to
P-19; M-1 to L-18; M-1 to A-17; M-1 to L-16; M-1 to V-15; M-1 to L-14;
M-1 to C-13; M-1 to L-12; M-1 to L-1 l; M-1 to S-10; M-1 to L-9; M-1 to
G-8; M-1 to P-7; and M-1 to G-6 of the sequence of the TNFR-6(3 shown in
2o Figure 2 (SEQ ID N0:4). Polypeptides encoded by these polynucleotide
fragments are also encompassed by the invention.
The invention also provides polypeptides comprising. or alternatively
consisting of, one or more amino acids deleted from both the amino and the
carboxyl termini of a TNFR-6(3 polypeptide, which may be described
25 generally as having residues n2-m2 of Figure 2 (i.e., SEQ ID N0:4), where
n2
and mz are integers as described above.
The present application is also directed to nucleic acid molecules
comprising, or alternatively, consisting of, a polynucleotide sequence at
least



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
96
90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the polynucleotide
sequence encoding a TNFR polypeptide set forth herein as m-y, n-z, nl-m',
30-m3, and/or n2-mz. In preferred embodiments, the application is directed to
nucleic acid molecules comprising, or alternatively, consisting of, a
polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%, 98% or 99%
identical to the polynucleotide sequences encoding polypeptides having the
amino acid sequence of the specific N- and C-terminal deletions recited
herein. The present invention also encompasses the above polynucleotide
sequences fused to a heterologous polynucleotide sequence. Pblypeptides
1o encoded by these nucleic acids and/or polynucleotide sequences are also
encompassed by the invention.
Also included are a nucleotide sequence encoding a polypeptide
consisting of a portion of a complete TNFR amino acid sequence encoded by a
cDNA clone contained in ATCC Deposit No. 97810, or 97809, where this
portion excludes from 1 to about 49 amino acids from the amino terminus of
the complete amino acid sequence encoded by the cDNA clone contained in
ATCC Deposit No. 97810 and 97809, respectively, or from 1 to about 107 or
58 amino acids from the carboxy terminus of the complete amino acid sequence
encoded by the cDNA clone contained in ATCC Deposit No. 97810 and
97809, respectively, or any combination of the above amino terminal and
carboxy terminal deletions, of the complete amino acid sequence encoded by
the cDNA clone contained in ATCC Deposit No. 97810 or 97809.
Polypeptides encoded by all of the above polynucleotides are also
encompassed by the invention.
In addition to terminal deletion forms of the protein discussed above, it
also will be recognized by one of ordinary skill in the art that some amino
acid
sequences of the TNFR polypeptides can be varied without significant effect
on the structure or function of the proteins. If such differences in sequence
are



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
97
contemplated, it should be remembered that there will be critical areas on the
protein which determine activity.
Thus, the invention further includes variations of the TNFR
polypeptides which show substantial TNFR polypeptide functional activity
(e.g., immunogenic activity, biological activity) or which include regions of
TNFR protein such as the protein portions discussed below. Such mutants
include deletions, insertions, inversions, repeats, and type substitutions
selected according to general rules known in the art so as have little effect
on
activity. For example, guidance concerning how to make phenotypically silent
amino acid substitutions is provided in Bowie, J. U. et al., "Deciphering the
Message in Protein Sequences: Tolerance to Amino Acid Substitutions,"
Science 247:1306-1310 (1990), wherein the authors indicate that there are two
main approaches for studying the tolerance of an amino acid sequence to
change. The first method relies on the process of evolution, in which
mutations are either accepted or rejected by natural selection. The second
approach uses genetic engineering to introduce amino acid changes at specific
positions of a cloned gene and selections or screens to identify sequences
that
maintain functionality. As the authors state, these studies have revealed that
proteins are surprisingly tolerant of amino acid substitutions. The authors
further indicate which amino acid changes are likely to be permissive at a
certain position of the protein. For example, most buried amino acid residues
require nonpolar side chains, whereas few features of surface side chains are
generally conserved. Other such phenotypically silent substitutions are
described in Bowie, J. U. et al., supra, and the references cited therein.
Typically seen as conservative substitutions are the replacements, one for
another, among the aliphatic amino acids Ala, Val, Leu and Ile; interchange of
the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and
Glu, substitution between the amide residues Asn and Gln, exchange of the
basic residues Lys and Arg and replacements among the aromatic residues Phe,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
98
Tyr. Thus, the fragment, derivative or analog of the polypeptide of SEQ ID
N0:2, 4 or 6, or that encoded by a deposited cDNA, may be (i) one in which
one or more of the amino acid residues are substituted with a conserved or
non-conserved amino acid residue (preferably a conserved amino acid residue)
and such substituted amino acid residue may or may not be one encoded by
the genetic code, or (ii) one in which one or more of the amino acid residues
includes a substituent group, or (iii) one in which the mature or soluble
extracellular polypeptide is fused with another compound, such as a
compound to increase the half life of the polypeptide (for example,
polyethylene glycol), or (iv) one in which the additional amino acids (such
as,
for example, an IgG Fc peptide fusion and/or an immunoglobulin light chain
constant region peptide), a leader or secretory sequence, or a sequence which
is
employed for purification of the TNFR polypeptide) are fused to a TNFR
polypeptide described herein. Such fragments, derivatives and analogs are
deemed to be within the scope of those skilled in the art from the teachings
herein.
Thus, the TNFR of the present invention may include one or more
amino acid substitutions, deletions or additions, either from natural
mutations
or human manipulation. As indicated, changes are preferably of a minor
nature, such as conservative amino acid substitutions that do not
significantly
affect the folding or activity of the protein (see Table III).
TABLE III. Conservative Amino Acid Substitutions.
Aromatic Phenylalanine
Tryptophan
Tyrosine
Hydrophobic Leucine
Isoleucine
Valine



CA 02362929 2001-08-16
WO 00/52028 PCTNS00/05686
99
Polar ~ Glutamine
Asparagine
Basic Arginine
Lysine
Histidine
Acidic ~ Aspartic Acid
Glutamic Acid
Small Alanine
Serine
Threonine
Methionine
Glycine
Amino acids in the TNFR proteins of the present invention that are
essential for function can be identified by methods known in the art, such as
site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and
Wells, Science 244:1081-1085 (1989)). The latter procedure introduces single
alanine mutations at every residue in the molecule. The resulting mutant
molecules are then tested for functional activity such as, for example,
ligand/receptor (e.g., Fas ligand and/or AIM-II) receptor binding or in vitro
or
in vitro proliferative activity.
to Of special interest are substitutions of charged amino acids with other
charged or neutral amino acids which may produce proteins with highly
desirable improved characteristics, such as less aggregation. Aggregation may
not only reduce activity but also be problematic when preparing
pharmaceutical formulations, because aggregates can be immunogenic (Pinckard
et al., Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36: 838-

845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377 (1993).
Replacement of amino acids can also change the selectivity of the
binding of a ligand to cell surface receptors. For example, Ostade et al.,
Nature



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
100
361:266-268 (1993) describes certain mutations resulting in selective binding
of TNF-a to only one of the two known types of TNF receptors. Sites that
are critical for ligand-receptor binding can also be determined by structural
analysis such as crystallization, nuclear magnetic resonance or photoaffinity
labeling (Smith et al., J. Mol. Biol. 224:899-904 ( 1992) and de Vos et
al.Science
255:306-312 (1992)).
Since TNFR-6 alpha and TNFR-6 beta are members of the TNF
receptor-related protein family, to modulate rather than completely eliminate
biological activities of TNFR preferably mutations are made in sequences
l0 encoding amino acids in the TNFR conserved extracellular domain, more
preferably in residues within this region which are not conserved among
members of the TNF receptor family. Also forming part of the present
invention are isolated polynucleotides comprising nucleic acid sequences which
encode the above TNFR mutants.
The polypeptides of the present invention are preferably provided in
an isolated form, and preferably are substantially purified. A recombinantly
produced version of the TNFR polypeptides can be substantially purified by
the one-step method described in Smith and Johnson, Gene 67:31-40 (1988).
Polypeptides of the invention also can be purified from natural or recombinant
2o sources using anti-TNFR-6 alpha and TNFR-6 beta antibodies of the invention
in methods which are well known in the art of protein purification.
The invention further provides isolated TNFR polypeptides
comprising an amino acid sequence selected from the group consisting of: (a)
the amino acid sequence of a full-length TNFR polypeptide having the
complete amino acid sequence shown in SEQ ID N0:2 or 4 or as encoded by
the cDNA clone contained in the plasmid deposited as ATCC Deposit No.
97810 or 97809; (b) the amino acid sequence of a mature TNFR polypeptide
having the amino acid sequence at positions 31-300 in SEQ ID N0:2 or 31-170



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
101
in SEQ ID N0:4, or as encoded by the cDNA clone contained in the plasmid
deposited as ATCC Deposit No. 97810 or 97809; or (c) the amino acid
sequence of a soluble extracellular domain of a TNFR polypeptide having the
amino acid sequence at positions 31 to 283 in SEQ ID N0:2 or 31 to 166 in
SEQ ID N0:4, or as encoded by the cDNA clone contained in the plasmid
deposited as ATCC Deposit No. 97810 or 97809.
Further polypeptides of the present invention include polypeptides
which have at least 90% similarity, more preferably at least 80%, 85%, 90%,
92%, or 95% similarity, and still more preferably at least 96%, 97%, 98% or
99% similarity to those described above. The polypeptides of the invention
also comprise those which are at least 80% identical, more preferably at least
85%, 90%, 92% or 95% identical, still more preferably at least 96%, 97%,
98% or 99% identical to the polypeptide encoded by the deposited cDNA
(ATCC Deposit Nos. 97810 or 97809) or to the polypeptide of SEQ ID N0:2
or 4, and also include portions of such polypeptides with at least 30 amino
acids and more preferably at least 50 amino acids.
By "% similarity" for two polypeptides is intended a similarity score
produced by comparing the amino acid sequences of the two polypeptides
using the Bestfit program (Wisconsin Sequence Analysis Package, Version 8
for Unix, Genetics Computer Group, University Research Park, 575 Science
Drive, Madison, WI 53711) and the default settings for determining similarity
Bestfit uses the local homology algorithm of Smith and Waterman (Advances
in Applied Mathematics 2:482-489, 1981 ) to find the best segment of
similarity between two sequences.
By a polypeptide having an amino acid sequence at least, for example,
95% "identical" to a reference amino acid sequence of a TNFR polypeptide is
intended that the amino acid sequence of the polypeptide is identical to the
reference sequence except that the polypeptide sequence may include up to



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
102
five amino acid alterations per each 100 amino acids of the reference amino
acid
of the TNFR polypeptide. In other words, to obtain a polypeptide having an
amino acid sequence at least 80%, 85%, 90%, or 95% identical to a reference
amino acid sequence, up to 5% of the amino acid residues in the reference
sequence may be deleted or substituted with another amino acid, or a number
of amino acids up to 5% of the total amino acid residues in the reference
sequence may be inserted into the reference sequence. These alterations of the
reference sequence may occur at the amino or carboxy terminal positions of the
reference amino acid sequence or anywhere between those terminal positions,
interspersed either individually among residues in the reference sequence or
in
one or more contiguous groups within the reference sequence.
As a practical matter, whether any particular polypeptide is at least
80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to, for instance,
the amino acid sequence shown in SEQ ID N0:2 or 4, or to an amino acid
sequence encoded by the cDNA contained in the deposits having ATCC
Deposit No. 97810, or 97809, or fragments thereof (e.g., the sequence of any
of the polypeptides corresponding to N or C terminal deletions of TNFR, as
described herein (e.g., the polypeptide having the sequence of amino acids 30
to 300 of SEQ ID N0:2)) can be determined conventionally using known
2o computer programs such the Bestfit program (Wisconsin Sequence Analysis
Package, Version 8 for Unix, Genetics Computer Group, University Research
Park, 575 Science Drive, Madison, WI 53711). When using Bestfit or any
other sequence alignment program to determine whether a particular sequence
is, for instance, 95% identical to a reference sequence according to the
present
invention, the parameters are set, of course, such that the percentage of
identity is calculated over the full length of the reference amino acid
sequence
and that gaps in homology of up to 5% of the total number of amino acid
residues in the reference sequence are allowed.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
103
In a specific embodiment, the identity between a reference (query)
sequence (a sequence of the present invention) and a subject sequence, also
referred to as a global sequence alignment, is determined using the FASTDB
computer program based on the algorithm of Brutlag et al.(Comp. App. Biosci.
6:237-245 (1990)). Preferred parameters used in a FASTDB amino acid
alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=I, Joining
Penalty=20, Randomization Group Length=0, Cutoff Score=1, Window
Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window
Size=500 or the length of the subject amino acid sequence, whichever is
to shorter. According to this embodiment, if the subject sequence is shorter
than
the query sequence due to N- or C-terminal deletions, not because of internal
deletions, a manual correction is made to the results to take into
consideration
the fact that the FASTDB program does not account for N- and C-terminal
truncations of the subject sequence when calculating global percent identity.
For subject sequences truncated at the N- and C-termini, relative to the query
sequence, the percent identity is corrected by calculating the number of
residues of the query sequence that are N- and C-terminal of the subject
sequence, which are not matched/aligned with a corresponding subject residue,
as a percent of the total bases of the query sequence. A determination of
whether a residue is matched/aligned is determined by results of the FASTDB
sequence alignment. This percentage is then subtracted from the percent
identity, calculated by the above FASTDB program using the specified
parameters, to arrive at a final percent identity score. This final percent
identity score is what is used for the purposes of this embodiment. Only
residues to the N- and C-termini of the subject sequence, which are not
matched/aligned with the query sequence, are considered for the purposes of
manually adjusting the percent identity score. That is, only query residue
positions outside the farthest N- and C-terminal residues of the subject
sequence. For example, a 90 amino acid residue subject sequence is aligned



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
104
with a 100 residue query sequence to determine percent identity. The deletion
occurs at the N-terminus of the subject sequence and therefore, the FASTDB
alignment does not show a matching/alignment of the first 10 residues at the N-

terminus. The 10 unpaired residues represent 10% of the sequence (number of
residues at the N- and C- termini not matched/total number of residues in the
query sequence) so 10% is subtracted from the percent identity score
calculated by the FASTDB program. If the remaining 90 residues were
perfectly matched the final percent identity would be 90%. In another
example, a 90 residue subject sequence is compared with a 100 residue query
l0 sequence. This time the deletions are internal deletions so there are no
residues
at the N- or C-termini of the subject sequence which are not matched/aligned
with the query. In this case the percent identity calculated by FASTDB is not
manually corrected. Once again, only residue positions outside the N- and C-
terminal ends of the subject sequence, as displayed in the FASTDB alignment,
which are not matched/aligned with the query sequence are manually corrected
for. No other manual corrections are made for the purposes of this
embodiment.
The polypeptide of the present invention have uses which include, but
are not limited to, as molecular weight markers on SDS-PAGE gels or on
molecular sieve gel filtration columns using methods well known to those of
skill in the art. As described in detail below, the polypeptides of the
present
invention can also be used to raise polyclonal and monoclonal antibodies,
which are useful in assays for detecting TNFR protein expression as described
below or as agonists and antagonists capable of enhancing or inhibiting TNFR
protein function. Further, such polypeptides can be used in the yeast
two-hybrid system to "capture" TNFR protein binding proteins which are
also candidate agonists and antagonists according to the present invention.
The yeast two hybrid system is described in Fields and Song, Nature
340:245-246 (1989).



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
105
Transgenics
The proteins of the invention can also be expressed in transgenic
animals. Animals of any species, including, but not limited to, mice, rats,
rabbits, hamsters, guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-
human primates, e.g., baboons, monkeys, and chimpanzees may be used to
generate transgenic animals. In a specific embodiment, techniques described
herein or otherwise known in the art, are used to express polypeptides of the
invention in humans, as part of a gene therapy protocol.
Any technique known in the art may be used to introduce the transgene
(i.e., polynucleotides of the invention) into animals to produce the founder
lines of transgenic animals. Such techniques include, but are not limited to,
pronuclear microinjection (Paterson et al., Appl. Microbiol. Biotechnol.
40:691-
698 (1994); Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et
al., Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S. Pat. No.
4,873,191 (1989)); retrovirus mediated gene transfer into germ lines (Van der
Putten et al., Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts
or
embryos; gene targeting in embryonic stem cells (Thompson et al., Cell
56:313-321 (1989)); electroporation of cells or embryos (Lo, Mol Cell. Biol.
3:1803-1814 (1983)); introduction of the polynucleotides of the invention
usW g a gene gun (see, e.g., Ulmer et al., Science 259:1745 (1993);
introducing
nucleic acid constructs into embryonic pleuripotent stem cells and
transferring
the stem cells back into the blastocyst; and sperm-mediated gene transfer
(Lavitrano et al., Cell 57:717-723 (1989)); etc. For a review of such
techniques, see Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171-229
(1989), which is incorporated by reference herein in its entirety. See also,
U.S.
Patent No. 5,464,764 (Capecchi, et al., Positive-Negative Selection Methods
and Vectors); U.S. Patent No. 5,631,153 (Capecchi, et al., Cells and Non-



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
106
Human Organisms Containing Predetermined Genomic Modifications and
Positive-Negative Selection Methods and Vectors for Making Same); U.S.
Patent No. 4,736,866 (Leder, et al., Transgenic Non-Human Animals); and
U.S. Patent No. 4,873,191 (Wagner, et al., Genetic Transformation of
Zygotes); each of which is hereby incorporated by reference in its entirety.
Further, the contents of each of the documents recited in this paragraph is
herein incorporated by reference in its entirety.
Any technique known in the art may be used to produce transgenic
clones containing polynucleotides of the invention, for example; nuclear
transfer into enucleated oocytes of nuclei from cultured embryonic, fetal, or
adult cells induced to quiescence (Campell et al., Nature 380:64-66 (1996);
Wilmut et al., Nature 385:810-813 (1997)), each of which is herein
incorporated by reference in its entirety).
The present invention provides for transgenic animals that carry the
transgene in all their cells, as well as animals which carry the transgene in
some, but not all their cells, i.e., mosaic animals or chimeric animals. The
transgene may be integrated as a single transgene or as multiple copies such
as
in concatamers, e.g., head-to-head tandems or head-to-tail tandems. The
transgene may also be selectively introduced into and activated in a
particular
cell type by following, for example, the teaching of Lasko et al. (Lasko et
al.,
Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)). The regulatory sequences
required for such a cell-type specific activation will depend upon the
particular
cell type of interest, and will be apparent to those of skill in the art. When
it
is desired that the polynucleotide transgene be integrated into the
chromosomal
site of the endogenous gene, gene targeting is preferred. Briefly, when such a
technique is to be utilized, vectors containing some nucleotide sequences
homologous to the endogenous gene are designed for the purpose of
integrating, via homologous recombination with chromosomal sequences, into
and disrupting the function of the nucleotide sequence of the endogenous gene.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
107
The transgene may also be selectively introduced into a particular cell type,
thus inactivating the endogenous gene in only that cell type, by following,
for
example, the teaching of Gu et al. (Science 265:103-106 (1994)). The
regulatory sequences required for such a cell-type specific inactivation will
depend upon the particular cell type of interest, and will be apparent to
those
of skill in the art. The contents of each of the documents recited in this
paragraph is herein incorporated by reference in its entirety.
Once transgenic animals have been generated, the expression of the
recombinant gene may be assayed utilizing standard techniques: Initial
screening may be accomplished by Southern blot analysis or PCR techniques
to analyze animal tissues to verify that integration of the transgene has
taken
place. The level of mRNA expression of the transgene in the tissues of the
transgenic animals may also be assessed using techniques which include, but
are not limited to, Northern blot analysis of tissue samples obtained from the
animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-
PCR).
Samples of transgenic gene-expressing tissue may also be evaluated
immunocytochemically or immunohistochemically using antibodies specific for
the transgene product.
Once the founder animals are produced, they may be bred, inbred,
outbred, or crossbred to produce colonies of the particular animal. Examples
of such breeding strategies include, but are not limited to: outbreeding of
founder animals with more than one integration site in order to establish
separate lines; inbreeding of separate lines in order to produce compound
transgenics that express the transgene at higher levels because of the effects
of
additive expression of each transgene; crossing of heterozygous transgenic
animals to produce animals homozygous for a given integration site in order to
both augment expression and eliminate the need for screening of animals by
DNA analysis; crossing of separate homozygous lines to produce compound
heterozygous or homozygous lines; and breeding to place the transgene on a



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
108
distinct background that is appropriate for an experimental model of interest.
Transgenic and "knock-out" animals of the invention have uses which
include, but are not limited to, animal model systems useful in elaborating
the
biological function of TNFR polypeptides, studying conditions and/or
disorders associated with aberrant TNFR expression, and in screening for
compounds effective in ameliorating such conditions and/or disorders.
In further embodiments of the invention, cells that are genetically
engineered to express the proteins of the invention, or alternatively, that
are
genetically engineered not to express the proteins of the invention (e.g.,
to knockouts) are administered to a patient in vivo. Such cells may be
obtained
from the patient (i.e., animal, including human) or an MHC compatible donor
and can include, but are not limited to fibroblasts, bone marrow cells, blood
cells (e.g., lymphocytes), adipocytes, muscle cells, endothelial cells, etc.
The
cells are genetically engineered in vitro using recombinant DNA techniques to
introduce the coding sequence of polypeptides of the invention into the cells,
or alternatively, to disrupt the coding sequence and/or endogenous regulatory
sequence associated with the polypeptides of the invention, e.g., by
transduction (using viral vectors, and preferably vectors that integrate the
transgene into the cell genome) or transfection procedures, including, but not
limited to, the use of plasmids, cosmids, YACs, naked DNA, electroporation,
liposomes, etc. The coding sequence of the polypeptides of the invention can
be placed under the control of a strong constitutive or inducible promoter or
promoter/enhancer to achieve expression, and preferably secretion, of the
polypeptides of the invention. The engineered cells which express and
preferably secrete the polypeptides of the invention can be introduced into
the
patient systemically, e.g., in the circulation, or intraperitoneally.
Alternatively, the cells can be incorporated into a matrix and implanted in
the
body, e.g., genetically engineered fibroblasts can be implanted as part of a
skin
graft; genetically engineered endothelial cells can be implanted as part of a



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
109
lymphatic or vascular graft. (See, for example, Anderson et aI.US Patent No.
5,399,349; and Mulligan & Wilson, US Patent No. 5,460,959, each of which is
incorporated by reference herein in its entirety).
When the cells to be administered are non-autologous or non-MHC
compatible cells, they can be administered using well known techniques which
prevent the development of a host immune response against the introduced
cells. For example, the cells may be introduced in an encapsulated form which,
while allowing for an exchange of components with the immediate extracellular
environment, does not allow the introduced cells to be recognized by the host
l0 immune system.
Antibodies
The present invention further relates to antibodies and T-cell antigen
receptors (TCR) which immunospecifically bind a polypeptide, preferably an
epitope, of the present invention (as determined by immunoassays well known in
the art for assaying specific antibody-antigen binding). Antibodies of the
invention include, but are not limited to, polyclonal, monoclonal,
multispecific,
human, humanized or chimeric antibodies, single chain antibodies, Fab
fragments,
F(ab') fragments, fragments produced by a Fab expression library, anti-
idiotypic
(anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the
invention), and epitope-binding fragments of any of the above. The term
"antibody," as used herein, refers to immunoglobulin molecules and
immunologically active portions of immunoglobulin molecules, i.e., molecules
that
contain an antigen binding site that immunospecifically binds an antigen. The
immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE,
IgM, IgD, IgA and IgY), class (e.g., IgGI, IgG2, IgG3, IgG4, IgAl and IgA2) or
subclass of immunoglobulin molecule.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
110
Most preferably the antibodies are human antigen-binding antibody
fragments of the present invention and include, but are not limited to, Fab,
Fab'
and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-
linked
Fvs (sdFv) and fragments comprising either a VL or VH domain. Antigen-binding
antibody fragments, including single-chain antibodies, may comprise the
variable
regions) alone or in combination with the entirety or a portion of the
following:
hinge region, CH1, CH2, and CH3 domains. Also included in the invention are
antigen-binding fragments also comprising any combination of variable regions)
with a hinge region, CH1, CH2, and CH3 domains. The antibodies of the
to invention may be from any animal origin including birds and mammals.
Preferably, the antibodies are human, murine, donkey, ship rabbit, goat,
guinea
pig, camel, horse, or chicken. As used herein, "human" antibodies include
antibodies having the amino acid sequence of a human immunoglobulin and
include
antibodies isolated from human immunoglobulin libraries or from animals
transgenic for one or more human immunoglobulin and that do not express
endogenous immunoglobulins, as described infra and, for example in, U.S.
Patent
No. 5,939,598 by Kucherlapati et al.
The antibodies of the present invention may be monospecific, bispecific,
trispecific or of greater multispecificity. Multispecific antibodies may be
specific
2o for different epitopes of a polypeptide of the present invention or may be
specific
for both a polypeptide of the present invention as well as for a heterologous
epitope, such as a heterologous polypeptide or solid support material. See,
e.g.,
PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793;
Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Patent Nos. 4,474,893;
4,714,681;
4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol. 148:1547-1553
( 1992).
Antibodies of the present invention may be described or specified in terms
of the epitope(s) or portions) of a polypeptide of the present invention that
they
recognize or specifically bind. The epitope(s) or polypeptide portions) may be



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
specified as described herein, e.g., by N-terminal and C-terminal positions,
by size
in contiguous amino acid residues, or listed in the Tables and Figures.
Antibodies
that specifically bind any epitope or polypeptide of the present invention may
also be excluded. Therefore, the present invention includes antibodies that
specifically bind polypeptides of the present invention, and allows for the
exclusion of the same.
Antibodies of the present invention may also be described or specified in
terms of their cross-reactivity. Antibodies that do not bind any other analog,
ortholog, or homolog of a polypeptide of the present invention are included.
1o Antibodies that bind polypeptides with at least 95%, at least 90%, at least
85%,
at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least
55%,
and at least 50% identity (as calculated using methods known in the art and
described herein) to a polypeptide of the present invention are also included
in the
present invention. Antibodies that do not bind polypeptides with less than
95%,
less than 90%, less than 85%, less than 80%, less than 75%, less than 70%,
less
than 65%, less than 60%, less than 55%, and less than 50% identity (as
calculated
using methods known in the art and described herein) to a polypeptide of the
present invention are also included in the present invention. Further included
in
the present invention are antibodies that bind polypeptides encoded by
2o polynucleotides which hybridize to a polynucleotide of the present
invention
under stringent hybridization conditions (as described herein). Antibodies of
the
present invention may also be described or specified in terms of their binding
affinity to a polypeptide of the invention. Preferred binding affinities
include
those with a dissociation constant or Kd less than 5X10-ZM, 10-2M, 5X10-3M,
10~3M, SX10-4M, 10-4M, 5X10-SM, 10-SM, 5X10-6M, 10-6M, 5X10-'M, 10-'M,
5X10-8M, 10-8M, 5X10-9M, 10-9M, 5X10-'°M, 10-'°M, 5X10-"M, 10-
"M,
5X10-'2M, 10-'ZM, 5X10-'3M, 10-'3M, 5X10~'4M, 10-'4M, 5X10-'SM, and 10'
'SM.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
112
The invention also provides antibodies that competitively inhibit binding
of an antibody to an epitope of the invention as determined by any method
known in the art for determining competitive binding, for example, the
immunoassays described herein. In preferred embodiments, the antibody
competitively inhibits binding to the epitope by at least 90%, at least 80%,
at
least 70%, at least 60%, or at least 50%.
Antibodies of the present invention may act as agonists or antagonists of
the polypeptides of the present invention. For example, the present invention
includes antibodies which disrupt the receptor/ligand interactions with the
l0 polypeptides of the invention either partially or fully. The invention
features
both receptor-specific antibodies and ligand-specific antibodies. The
invention
also features receptor-specific antibodies which do not prevent ligand binding
but
prevent receptor activation. Receptor activation (i.e., signaling) may be
determined by techniques described herein or otherwise known in the art. For
example, receptor activation can be determined by detecting the
phosphorylation
(e.g., tyrosine or serine/threonine) of the receptor or its substrate by
immunoprecipitation followed by western blot analysis (for example, as
described
supra). In specific embodiments, antibodies are provided that inhibit ligand
or
receptor activity by at least 90%, at least 80%, at least 70%, at least 60%,
or at
least 50% of the activity in absence of the antibody.
The invention also features receptor-specific antibodies which both
prevent ligand binding and receptor activation as well as antibodies that
recognize
the receptor-ligand complex, and, preferably, do not specifically recognize
the
unbound receptor or the unbound ligand. Likewise, included in the invention
are
neutralizing antibodies which bind the ligand and prevent binding of the
ligand to
the receptor, as well as antibodies which bind the ligand, thereby preventing
receptor activation, but do not prevent the ligand from binding the receptor.
Further included in the invention are antibodies which activate the receptor.
These antibodies may act as receptor agonists, i.e., potentiate or activate
either all



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
113
or a subset of the biological activities of the ligand-mediated receptor
activation.
The antibodies may be specified as agonists, antagonists or inverse agonists
for
biological activities comprising the specific biological activities of the
peptides of
the invention disclosed herein. The above antibody agonists can be made using
methods known in the art. See, e.g., PCT publication WO 96/40281; U.S. Patent
No. 5,811,097; Deng et al., Blood 92(6):1981-1988 (1998); Chen, et al., Cancer
Res. 58(16):3668-3678 (1998); Harrop et al., J. Immunol. 161(4):1786-1794
(1998); Zhu et al., Cancer Res. 58(15):3209-3214 (1998); Yoon, et al., J.
Immunol. 160(7):3170-3179 (1998); Prat et al., J. Cell. Sci. 111(Pt2):237-247
(1998); Pitard et al., J. Immunol. Methods 205(2):177-190 (1997); Liautard et
al.,
Cytokine 9(4):233-241 (1997); Carlson et al., J. Biol. Chem. 272(17):11295-
11301 (1997); Taryman et al., Neuron 14(4):755-762 (1995); Muller et al.,
Structure 6(9):1153-1167 (1998); Bartunek et al., Cytokine 8(1):14-20 (1996)
(which are all incorporated by reference herein in their entireties).
Antibodies of the present invention may be used, for example, but not
limited to, to purify, detect, and target the polypeptides of the present
invention,
including both in vitro and in vivo diagnostic and therapeutic methods. For
example, the antibodies have use in immunoassays for qualitatively and
quantitatively measuring levels of the polypeptides of the present invention
in
2o biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory
Manual,
(Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by reference
herein in its entirety).
As discussed in more detail below, the antibodies of the present invention
may be used either alone or in combination with other compositions. The
antibodies may further be recombinantly fused to a heterologous polypeptide at
the N- or C-terminus or chemically conjugated (including covalently and non-
covalently conjugations) to polypeptides or other compositions. For example,
antibodies of the present invention may be recombinantly fused or conjugated
to
molecules useful as labels in detection assays and effector molecules such as



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
114
heterologous polypeptides, drugs, or toxins. See, e.g., PCT publications WO
92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP
396,387.
The antibodies of the invention include derivatives that are modified, i.e,
by the covalent attachment of any type of molecule to the antibody such that
covalent attachment does not prevent the antibody from generating an anti-
idiotypic response. For example, but not by way of limitation, the antibody
derivatives include antibodies that have been modified, e.g., by
glycosylation,
acetylation, pegylation, phosphylation, amidation, derivatization by known
1 o protecting/blocking groups, proteolytic cleavage, linkage to a cellular
ligand or
other protein, etc. Any of numerous chemical modifications may be carned out
by known techniques, including, but not limited to specific chemical cleavage,
acetylation, formylation, metabolic synthesis of tunicamycin, etc.
Additionally,
the derivative may contain one or more non-classical amino acids.
The antibodies of the present invention may be generated by any suitable
method known in the art. Polyclonal antibodies to an antigen-of interest can
be
produced by various procedures well known in the art. For example, a
polypeptide of the invention can be administered to various host animals
including, but not limited to, rabbits, mice, rats, etc. to induce the
production of
sera containing polyclonal antibodies specific for the antigen. Various
adjuvants
may be used to increase the immunological response, depending on the host
species, and include but are not limited to, Freund's (complete and
incomplete),
mineral gels such as aluminum hydroxide, surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole
limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such
as BCG (bacille Calmette-Guerin) and corynebacterium parvum. Such adjuvants
are also well known in the art.
Monoclonal antibodies can be prepared using a wide variety of techniques
known in the art including the use of hybridoma, recombinant, and phage
display



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
115
technologies, or a combination thereof. For example, monoclonal antibodies can
be
produced using hybridoma techniques including those known in the art and
taught,
for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring
Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal
Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981) (said
references incorporated by reference in their entireties). The term
"monoclonal
antibody" as used herein is not limited to antibodies produced through
hybridoma
technology. The term "monoclonal antibody" refers to an antibody that is
derived
from a single clone, including any eukaryotic, prokaryotic, or phage clone,
and not
to the method by which it is produced.
Methods for producing and screening for specific antibodies using
hybridoma technology are routine and well-known in the art and are discussed
in
detail in Example 11. Briefly, mice can be immunized with a polypeptide of the
invention or a cell expressing such peptide. Once an immune response is
detected,
e.g., antibodies specific for the antigen are detected in the mouse serum, the
mouse
spleen is harvested and splenocytes isolated. The splenocytes are then fused
by
well-known techniques to any suitable myeloma cells, for example cells from
cell
line SP20 available from the ATCC. Hybridomas are selected and cloned by
limited dilution. The hybridoma clones are then assayed by methods known in
2o the art for cells that secrete antibodies capable of binding a polypeptide
of the
invention. Ascites fluid, which generally contains high levels of antibodies,
can be
generated by immunizing mice with positive hybridoma clones.
Accordingly, the present invention provides methods of generating
monoclonal antibodies as well as antibodies produced by the method comprising
culturing a hybridoma cell secreting an antibody of the invention wherein,
preferably, the hybridoma is generated by fusing splenocytes isolated from a
mouse immunized with an antigen of the invention with myeloma cells and then
screening the hybridomas resulting from the fusion for hybridoma clones that
secrete an antibody able to bind a polypeptide of the invention.



CA 02362929 2001-08-16
WO 00/52028 PCT/~JS00/05686
116
Antibody fragments that recognize specific epitopes may be generated by
known techniques. For example, Fab and F(ab')2 fragments of the invention may
be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes
such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2
fragments). F(ab')2 fragments contain the variable region, the light chain
constant
region and the CH 1 domain of the heavy chain.
For example, the antibodies of the present invention can also be generated
using various phage display methods known in the art. In phage display
methods,
functional antibody domains are displayed on the surface of phage particles
which
to carry the polynucleotide sequences encoding them. In a particular, such
phage can
be utilized to display antigen-binding domains expressed from a repertoire or
combinatorial antibody library (e.g., human or murine). Phage expressing an
antigen binding domain that binds the antigen of interest can be selected or
identified with antigen, e.g., using labeled antigen or antigen bound or
captured to a
solid surface or bead. Phage used in these methods are typically filamentous
phage including fd and M 13 binding domains expressed from phage with Fab, Fv
or disulfide stabilized Fv antibody domains recombinantly fused to either the
phage gene III or gene VIII protein. Examples of phage display methods that
can
be used to make the antibodies of the present invention include those
disclosed in
2o Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J.
Immunol.
Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol. 24:952-958
( 1994); Persic et al., Gene 187 9-18 ( 1997); Burton et al., Advances in
Immunology 57:191-280 (1994); PCT application No. PCT/GB91/01134; PCT
publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO
93/11236; WO 95/15982; WO 95/20401; and U.S. Patent Nos. 5,698,426;
5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698;
5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of
which is incorporated herein by reference in its entirety.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
117
As described in the above references, after phage selection, the antibody
coding regions from the phage can be isolated and used to generate whole
antibodies, including human antibodies, or any other desired antigen binding
fragment, and expressed in any desired host, including mammalian cells, insect
cells, plant cells, yeast, and bacteria, e.g., as described in detail below.
For
example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments
can
also be employed using methods known in the art such as those disclosed in PCT
publication WO 92/22324; Mullinax et al., BioTechniques 12(6):864-869 (1992);
and Sawai et al., AJRI 34:26-34 (1995); and Better et al., Science 240:1041-
1043
l0 (1988) (said references incorporated by reference in their entireties).
Examples of techniques which can be used to produce single-chain Fvs and
antibodies include those described in U.S. Patents 4,946,778 and 5,258,498;
Huston et al., Methods in Enzymology 203:46-88 ( 1991 ); Shu et al., PNAS
90:7995-7999 (1993); and Skerra et al., Science 240:1038-1040 (1988). For some
uses, including in vivo use of antibodies in humans and in vitro detection
assays, it
may be preferable to use chimeric, humanized, or human antibodies. A chimeric
antibody is a molecule in which different portions of the antibody are derived
from different animal species, such as antibodies having a variable region
derived
from a murine monoclonal antibody and a human immunoglobulin constant region.
Methods for producing chimeric antibodies are known in the art. See e.g.,
Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986);
Gillies
et al., (1989) J. Immunol. Methods 125:191-202; U.S. Patent Nos. 5,807,715;
4,816,567; and 4,816397, which are incorporated herein by reference in their
entireties. Humanized antibodies are antibody molecules from non-human species
antibody that binds the desired antigen having one or more complementarity
determining regions (CDRs) from the non-human species and framework regions
from a human immunoglobulin molecule. Often, framework residues in the human
framework regions will be substituted with the corresponding residue from the
CDR donor antibody to alter, preferably improve, antigen binding. These



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
118
framework substitutions are identified by methods well known in the art, e.g.,
by
modeling of the interactions of the CDR and framework residues to identify
framework residues important for antigen binding and sequence comparison to
identify unusual framework residues at particular positions. (See, e.g., Queen
et
al.; U.S. Patent No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which
are incorporated herein by reference in their entireties.) Antibodies can be
humanized using a variety of techniques known in the art including, for
example,
CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Patent Nos.
5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing (EP 592,106; EP
519,596; Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et
al.,
Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973
(1994)), and chain shuffling (U.S. Patent No. 5,565,332).
Completely human antibodies are particularly desirable for therapeutic
treatment of human patients. Human antibodies can be made by a variety of
methods known in the art including phage display methods described above using
antibody libraries derived from human immunoglobulin sequences. See also, U.S.
Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO
98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO
91/10741; each of which is incorporated herein by reference in its entirety.
2o Human antibodies can also be produced using transgenic mice which are
incapable of expressing functional endogenous immunoglobulins, but which can
express human immunoglobulin genes. For example, the human heavy and light
chain immunoglobulin gene complexes may be introduced randomly or by
homologous recombination into mouse embryonic stem cells. Alternatively, the
human variable region, constant region, and diversity region may be introduced
into mouse embryonic stem cells in addition to the human heavy and light chain
genes. The mouse heavy and light chain immunoglobulin genes may be rendered
non-functional separately or simultaneously with the introduction of human
immunoglobulin loci by homologous recombination. In particular, homozygous



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
119
deletion of the JH region prevents endogenous antibody production. The
modified embryonic stem cells are expanded and microinjected into blastocysts
to
produce chimeric mice. The chimeric mice are then bred to produce homozygous
offspring that express human antibodies. The transgenic mice are immunized in
the normal fashion with a selected antigen, e.g., all or a portion of a
polypeptide of
the invention. Monoclonal antibodies directed against the antigen can be
obtained
from the immunized, transgenic mice using conventional hybridoma technology.
The human immunoglobulin transgenes harbored by the transgenic mice rearrange
during B cell differentiation, and subsequently undergo class switching and
l0 somatic mutation. Thus, using such a technique, it is possible to produce
therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of
this
technology for producing human antibodies, see Lonberg and Huszar (1995, Int.
Rev. Immunol. 13:65-93). For a detailed discussion of this technology for
producing human antibodies and human monoclonal antibodies and protocols for
producing such antibodies, see, e.g., PCT publications WO 98/24893; WO
96/34096; WO 96/33735; U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425;
5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,598, which are
incorporated by reference herein in their entirety. In addition, companies
such as
Abgenix, Inc. (Freemont, CA) and Genpharm (San Jose, CA) can be engaged to
2o provide human antibodies directed against a selected antigen using
technology
similar to that described above.
Completely human antibodies which recognize a selected epitope can be
generated using a technique referred to as "guided selection." In this
approach a
selected non-human monoclonal antibody, e.g., a mouse antibody, is used to
guide
the selection of a completely human antibody recognizing the same epitope.
(Jespers et al., Biotechnology 12:899-903 (1988)).
Further, antibodies to the polypeptides of the invention can, in turn, be
utilized to
generate anti-idiotype antibodies that "mimic" polypeptides of the invention
using
techniques well known to those skilled in the art. (See, e.g., Greenspan &
Bona,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
120
FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol. 147(8):2429-2438
( 1991 )). For example, antibodies which bind to and competitively inhibit
polypeptide multimerization and/or binding of a polypeptide of the invention
to a
ligand can be used to generate anti-idiotypes that "mimic" the polypeptide
multimerization and/or binding domain and, as a consequence, bind to and
neutralize polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab
fragments of such anti-idiotypes can be used in therapeutic regimens to
neutralize
polypeptide ligand. For example, such anti-idiotypic antibodies can be used to
bind a polypeptide of the invention and/or to bind its ligands/receptors, and
thereby block TNFR mediated inhibition of apoptosis.
Polynucleotides Encoding Antibodies.
The invention further provides polynucleotides comprising a nucleotide
sequence encoding an antibody of the invention and fragments thereof. The
invention also encompasses polynucleotides that hybridize under stringent or
lower stringency hybridization conditions, e.g., as defined supra, to
polynucleotides that encode an antibody, preferably, that specifically binds
to a
polypeptide of the invention, preferably, an antibody that binds to a
polypeptide
having the amino acid sequence of SEQ ID N0:2 or 4.
2o The polynucleotides may be obtained, and the nucleotide sequence of the
polynucleotides determined, by any method known in the art. For example, if
the
nucleotide sequence of the antibody is known, a polynucleotide encoding the
antibody may be assembled from chemically synthesized oligonucleotides (e.g.,
as
described in Kutmeier et al., BioTechniques 17:242 ( 1994)), which, briefly,
involves the synthesis of overlapping oligonucleotides containing portions of
the
sequence encoding the antibody, annealing and ligation of those
oligonucleotides,
and then amplification of the ligated oligonucleotides by PCR.
Alternatively, a polynucleotide encoding an antibody may be generated
from nucleic acid from a suitable source. If a clone containing a nucleic acid



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
121
encoding a particular antibody is not available, but the sequence of the
antibody
molecule is known, a nucleic acid encoding the immunoglobulin may be obtained
from a suitable source (e.g., an antibody cDNA library, or a cDNA library
generated from, or nucleic acid, preferably poly A+ RNA isolated from, any
tissue or cells expressing the antibody, such as hybridoma cells selected to
express
an antibody of the invention) by PCR amplification using synthetic primers
hybridizable to the 3' and 5' ends of the sequence or by cloning using an
oligonucleotide probe specific for the particular gene sequence to identify,
e.g., a
cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic
acids generated by PCR may then be cloned into replicable cloning vectors
using
any method well known in the art.
Once the nucleotide sequence and corresponding amino acid sequence of
the antibody is determined, the nucleotide sequence of the antibody may be
manipulated using methods well known in the art for the manipulation of
nucleotide sequences, e.g., recombinant DNA techniques, site directed
mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook
et
al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds., 1998, Current
Protocols in Molecular Biology, John Wiley & Sons, NY, which are both
2o incorporated by reference herein in their entireties ), to generate
antibodies having
a different amino acid sequence, for example to create amino acid
substitutions,
deletions, and/or insertions.
In a specific embodiment, the amino acid sequence of the heavy and/or
light chain variable domains may be inspected to identify the sequences of the
complementarity determining regions (CDRs) by methods that are well know in
the art, e.g., by comparison to known amino acid sequences of other heavy and
light chain variable regions to determine the regions of sequence
hypervariability.
Using routine recombinant DNA techniques, one or more of the CDRs may be
inserted within framework regions, e.g., into human framework regions to



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
122
humanize a non-human antibody, as described supra. The framework regions
may be naturally occurring or consensus framework regions, and preferably
human
framework regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479
(1998) for
a listing of human framework regions). Preferably, the polynucleotide
generated
by the combination of the framework regions and CDRs encodes an antibody that
specifically binds a polypeptide of the invention. Preferably, as discussed
supra,
one or more amino acid substitutions may be made within the framework regions,
and, preferably, the amino acid substitutions improve binding of the antibody
to
its antigen. Additionally, such methods may be used to make amino acid
1 o substitutions or deletions of one or more variable region cysteine
residues
participating in an intrachain disulfide bond to generate antibody molecules
lacking one or more intrachain disulfide bonds. Other alterations to the
polynucleotide are encompassed by the present invention and within the skill
of
the art.
In addition, techniques developed for the production of "chimeric
antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci. 81:851-855;
Neuberger
et al., 1984, Nature 312:604-608; Takeda et al., 1985, Nature 314:452-454) by
splicing genes from a mouse antibody molecule of appropriate antigen
specificity
together with genes from a human antibody molecule of appropriate biological
2o activity can be used. As described supra, a chimeric antibody is a molecule
in
which different portions are derived from different animal species, such as
those
having a variable region derived from a murine mAb and a human immunoglobulin
constant region, e.g., humanized antibodies.
Alternatively, techniques described for the production of single chain
antibodies (U.S. Patent No. 4,694,778; Bird, 1988, Science 242:423- 42; Huston
et
al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al., 1989,
Nature
334:544-54) can be adapted to produce single chain antibodies. Single chain
antibodies are formed by linking the heavy and light chain fragments of the Fv
region via an amino acid bridge, resulting in a single chain polypeptide.



CA 02362929 2001-08-16
WO 00/52028 PCT/iJS00/05686
123
Techniques for the assembly of functional Fv fragments in E. coli may also be
used (Skerra et al., 1988, Science 242:1038- 1041).
Methods of Producing Antibodies
The antibodies of the invention can be produced by any method known in
the art for the synthesis of antibodies, in particular, by chemical synthesis
or
preferably, by recombinant expression techniques.
Recombinant expression of an antibody of the invention, or fragment,
derivative or analog thereof, e.g., a heavy or light chain of an antibody of
the
l0 invention, requires construction of an expression vector containing a
polynucleotide that encodes the antibody. Once a polynucleotide encoding an
antibody molecule or a heavy or light chain of an antibody, or portion thereof
(preferably containing the heavy or light chain variable domain), of the
invention
has been obtained, the vector for the production of the antibody molecule may
be
produced by recombinant DNA technology using techniques well known in the
art. Thus, methods for preparing a protein by expressing a polynucleotide
containing an antibody encoding nucleotide sequence are described herein.
Methods which are well known to those skilled in the art can be used to
construct
expression vectors containing antibody coding sequences and appropriate
transcriptional and translational control signals. These methods include, for
example, in vitro recombinant DNA techniques, synthetic techniques, and in
vivo
genetic recombination. The invention, thus, provides replicable vectors
comprising a nucleotide sequence encoding an antibody molecule of the
invention,
or a heavy or light chain thereof, or a heavy or light chain variable domain,
operably linked to a promoter. Such vectors may include the nucleotide
sequence
encoding the constant region of the antibody molecule (see, e.g., PCT
Publication
WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464)
and the variable domain of the antibody may be cloned into such a vector for
expression of the entire heavy or light chain.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
124
The expression vector is transferred to a host cell by conventional
techniques and the transfected cells are then cultured by conventional
techniques
to produce an antibody of the invention. Thus, the invention includes host
cells
containing a polynucleotide encoding an antibody of the invention, or a heavy
or
light chain thereof, operably linked to a heterologous promoter. In preferred
embodiments for the expression of double-chained antibodies, vectors encoding
both the heavy and light chains may be co-expressed in the host cell for
expression
of the entire immunoglobulin molecule, as detailed below.
A variety of host-expression vector systems may be utilized to express
the antibody molecules of the invention. Such host-expression systems
represent
vehicles by which the coding sequences of interest may be produced and
subsequently purified, but also represent cells which may, when transformed or
transfected with the appropriate nucleotide coding sequences, express an
antibody
molecule of the invention in situ. These include but are not limited to
is microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed
with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression
vectors containing antibody coding sequences; yeast (e.g., Saccharomyces,
Pichia)
transformed with recombinant yeast expression vectors containing antibody
coding sequences; insect cell systems infected with recombinant virus
expression
vectors (e.g., baculovirus) containing antibody coding sequences; plant cell
systems infected with recombinant virus expression vectors (e.g., cauliflower
mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with
recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody
coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3
cells) harboring recombinant expression constructs containing promoters
derived
from the genome of mammalian cells (e.g., metallothionein promoter) or from
mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.SK
promoter). Preferably, bacterial cells such as Escherichia coli, and more
preferably, eukaryotic cells, especially for the expression of whole
recombinant



CA 02362929 2001-08-16
WO 00/52028 PCT/IJS00/05686
125
antibody molecule, are used for the expression of a recombinant antibody
molecule. For example, mammalian cells such as Chinese hamster ovary cells
(CHO), in conjunction with a vector such as the major intermediate early gene
promoter element from human cytomegalovirus is an effective expression system
for antibodies (Foecking et al., 1986, Gene 45:101; Cockett et al., 1990,
Bio/Technology 8:2).
In bacterial systems, a number of expression vectors may be
advantageously selected depending upon the use intended for the antibody
molecule being expressed. For example, when a large quantity of such a protein
is
to be produced, for the generation of pharmaceutical compositions of an
antibody
molecule, vectors which direct the expression of high levels of fusion protein
products that are readily purified may be desirable. Such vectors include, but
are
not limited, to the E. coli expression vector pUR278 (Ruther et al., 1983,
EMBO
J. 2:1791 ), in which the antibody coding sequence may be ligated individually
into
the vector in frame with the lac Z coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-
3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 24:5503-5509); and the like.
pGEX vectors may also be used to express foreign polypeptides as fusion
proteins with glutathione S-transferase (GST). In general, such fusion
proteins are
soluble and can easily be purified from lysed cells by adsorption and binding
to a
matrix glutathione-agarose beads followed by elution in the presence of free
glutathione. The pGEX vectors are designed to include thrombin or factor Xa
protease cleavage sites so that the cloned target gene product can be released
from
the GST moiety.
In an insect system, Autographa californica nuclear polyhedrosis virus
(AcNPV) is used as a vector to express foreign genes. The virus grows in
Spodoptera frugiperda cells. The antibody coding sequence may be cloned
individually into non-essential regions (for example the polyhedrin gene) of
the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
126
virus and placed under control of an AcNPV promoter (for example the
polyhedrin promoter).
In mammalian host cells, a number of viral-based expression systems may
be utilized. In cases where an adenovirus is used as an expression vector, the
antibody coding sequence of interest may be ligated to an adenovirus
transcription/translation control complex, e.g., the late promoter and
tripartite
leader sequence. This chimeric gene may then be inserted in the adenovirus
genome by in vitro or in vivo recombination. Insertion in a non- essential
region of
the viral genome (e.g., region E1 or E3) will result in a recombinant virus
that is
viable and capable of expressing the antibody molecule in infected hosts.
(e.g.,
see Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81:355-359). Specific
initiation signals may also be required for efficient translation of inserted
antibody
coding sequences. These signals include the ATG initiation codon and adjacent
sequences. Furthermore, the initiation codon must be in phase with the reading
frame of the desired coding sequence to ensure translation of the entire
insert.
These exogenous translational control signals and initiation codons can be of
a
variety of origins, both natural and synthetic. The efficiency of expression
may
be enhanced by the inclusion of appropriate transcription enhancer elements,
transcription terminators, etc. (see Bittner et al., 1987, Methods in Enzymol.
2o 153:51-544).
In addition, a host cell strain may be chosen which modulates the
expression of the inserted sequences, or modifies and processes the gene
product
in the specific fashion desired. Such modifications (e.g., glycosylation) and
processing (e.g., cleavage) of protein products may be important for the
function
of the protein. Different host cells have characteristic and specific
mechanisms for
the post-translational processing and modification of proteins and gene
products.
Appropriate cell lines or host systems can be chosen to ensure the correct
modification and processing of the foreign protein expressed. To this end,
eukaryotic host cells which possess the cellular machinery for proper
processing



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
127
of the primary transcript, glycosylation, and phosphorylation of the gene
product may be used. Such mammalian host cells include but are not limited to
CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38, and in particular,
breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and
T47D, and normal mammary gland cell line such as, for example, CRL7030 and
Hs578Bst.
For long-term, high-yield production of recombinant proteins, stable
expression is preferred. For example, cell lines which stably express the
antibody
molecule may be engineered. Rather than using expression vectors which contain
1o viral origins of replication, host cells can be transformed with DNA
controlled by
appropriate expression control elements (e.g., promoter, enhancer, sequences,
transcription terminators, polyadenylation sites, etc.), and a selectable
marker.
Following the introduction of the foreign DNA, engineered cells may be allowed
to
grow for 1-2 days in an enriched media, and then are switched to a selective
media. The selectable marker in the recombinant plasmid confers resistance to
the
selection and allows cells to stably integrate the plasmid into their
chromosomes
and grow to form foci which in turn can be cloned and expanded into cell
lines.
This method may advantageously be used to engineer cell lines which express
the
antibody molecule. Such engineered cell lines may be particularly useful in
2o screening and evaluation of compounds that interact directly or indirectly
with
the antibody molecule.
A number of selection systems may be used, including but not limited to
the herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223),
hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 192,
Proc. Natl. Acad. Sci. USA 48:202), and adenine phosphoribosyltransferase
(Lowy et al., 1980, Cell 22:817) genes can be employed in tk-, hgprt- or aprt-
cells, respectively. Also, antimetabolite resistance can be used as the basis
of
selection for the following genes: dhfr, which confers resistance to
methotrexate
(Wigler et al., 1980, Natl. Acad. Sci. USA 77:357; O'Hare et al., 1981, Proc.
Natl.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
128
Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid
(Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which
confers
resistance to the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and
Wu, 1991, Biotherapy 3:87-95; Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol.
32:573-596; Mulligan, 1993, Science 260:926-932; and Morgan and Anderson,
1993, Ann. Rev. Biochem. 62:191-217; May, 1993, TIB TECH 11(5):155-215);
and hygro, which confers resistance to hygromycin (Santerre et al., 1984, Gene
30:147). Methods commonly known in the art of recombinant DNA technology
which can be used are described in Ausubel et al. (eds.), 1993, Current
Protocols
in Molecular Biology, John Wiley & Sons, NY; Kriegler, 1990, Gene Transfer and
Expression, A Laboratory Manual, Stockton Press, NY; and in Chapters 12 and
13, Dracopoli et al. (eds), 1994, Current Protocols in Human Genetics, John
Wiley & Sons, NY.; Colberre-Garapin et al., 1981, J. Mol. Biol. 150:1, which
are
incorporated by reference herein in their entireties.
The expression levels of an antibody molecule can be increased by vector
amplification (for a review, see Bebbington and Hentschel, The use of vectors
based on gene amplification for the expression of cloned genes in mammalian
cells
in DNA cloning, Vol.3. (Academic Press, New York, 1987)). When a marker in
the vector system expressing antibody is amplifiable, increase in the level of
inhibitor present in culture of host cell will increase the number of copies
of the
marker gene. Since the amplified region is associated with the antibody gene,
production of the antibody will also increase (Grouse et al., 1983, Mol. Cell.
Biol.
3:257).
The host cell may be co-transfected with two expression vectors of the
invention, the first vector encoding a heavy chain derived polypeptide and the
second vector encoding a light chain derived polypeptide. The two vectors may
contain identical selectable markers which enable equal expression of heavy
and
light chain polypeptides. Alternatively, a single vector may be used which
encodes both heavy and light chain polypeptides. In such situations, the light



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
129
chain should be placed before the heavy chain to avoid an excess of toxic free
heavy chain (Proudfoot, 1986, Nature 322:52; Kohler, 1980, Proc. Natl. Acad.
Sci. USA 77:2197). The coding sequences for the heavy and light chains may
comprise cDNA or genomic DNA.
Once an antibody molecule of the invention has been recombinantly
expressed, it may be purified by any method known in the art for purification
of
an immunoglobulin molecule, for example, by chromatography (e.g., ion
exchange,
affinity, particularly by affinity for the specific antigen after Protein A,
and
sizing column chromatography), centrifugation, differential solubility, or by
any
other standard technique for the purification of proteins.
Antibody conjugates
The present invention encompasses antibodies recombinantly fused or
chemically conjugated (including both covalently and non-covalently
conjugations) to a polypeptide (or portion thereof, preferably at least 10, 20
or 50
amino acids of the polypeptide) of the present invention to generate fusion
proteins. The fusion does not necessarily need to be direct, but may occur
through linker sequences. The antibodies may be specific for antigens other
than
polypeptides (or portion thereof, preferably at least 10, 20 or 50 amino acids
of
the polypeptide) of the present invention. For example, antibodies may be used
to target the polypeptides of the present invention to particular cell types,
either
in vitro or in vivo, by fusing or conjugating the polypeptides of the present
invention to antibodies specific for particular cell surface receptors.
Antibodies
fused or conjugated to the polypeptides of the present invention may also be
used in in vitro immunoassays and purification methods using methods known in
the art. See e.g., Harbor et al., supra, and PCT publication WO 93/21232; EP
439,095; Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Patent
5,474,981;
Gillies et al., PNAS 89:1428-1432 (1992); Fell et al., J. Immunol. 146:2446-
2452( 1991 ), which are incorporated by reference in their entireties.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
130
The present invention further includes compositions comprising the
polypeptides of the present invention fused or conjugated to antibody domains
other than the variable regions. For example, the polypeptides of the present
invention may be fused or conjugated to an antibody Fc region, or portion
thereof. The antibody portion fused to a polypeptide of the present invention
may comprise the constant region, hinge region, CH 1 domain, CH2 domain, and
CH3 domain or any combination of whole domains or portions thereof. The
polypeptides may also be fused or conjugated to the above antibody portions to
form multimers. For example, Fc portions fused to the polypeptides of the
present invention can form dimers through disulfide bonding between the Fc
portions. Higher multimeric forms can be made by fusing the polypeptides to
portions of IgA and IgM. Methods for fusing or conjugating the polypeptides of
the present invention to antibody portions are known in the art. See, e.g.,
U.S.
Patent Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946;
EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570;
Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et
al., J. Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad. Sci.
USA
89:11337- 11341(1992) (said references incorporated by reference in their
entireties).
As discussed, supra, the polypeptides of the present invention may be
fused or conjugated to the above antibody portions to increase the in vivo
half life
of the polypeptides or for use in immunoassays using methods known in the art.
Further, the polypeptides of the present invention may be fused or conjugated
to
the above antibody portions to facilitate purification. One reported example
describes chimeric proteins consisting of the first two domains of the human
CD4-polypeptide and various domains of the constant regions of the heavy or
light chains of mammalian immunoglobulins. (EP 394,827; Traunecker et al.,
Nature 331:84-86 (1988). The polypeptides of the present invention fused or
conjugated to an antibody having disulfide- linked dimeric structures (due to
the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
131
IgG) may also be more efficient in binding and neutralizing other molecules,
than
the monomeric secreted protein or protein fragment alone. (Fountoulakis et
al., J.
Biochem. 270:3958-3964 (1995)). In many cases, the Fc part in a fusion protein
is beneficial in therapy and diagnosis, and thus can result in, for example,
improved pharmacokinetic properties. (EP A 232,262). Alternatively, deleting
the Fc part after the fusion protein has been expressed, detected, and
purified,
would be desired. For example, the Fc portion may hinder therapy and diagnosis
if the fusion protein is used as an antigen for immunizations. In drug
discovery,
for example, human proteins, such as hIL-5, have been fused W ith Fc portions
for
l0 the purpose of high-throughput screening assays to identify antagonists of
hIL-5.
(See, D. Bennett et al., J. Molecular Recognition 8:52-58 (1995); K. Johanson
et
al., J. Biol. Chem. 270:9459-9471 ( 1995)0.
Moreover, the antibodies or fragments thereof of the present invention can
be fused to marker sequences, such as a peptide to facilitates their
purification.
In preferred embodiments, the marker amino acid sequence is a hexa-histidine
peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton
Avenue, Chatsworth, CA, 91311), among others, many of which are commercially
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824
(1989), for instance, hexa-histidine provides for convenient purification of
the
fusion protein. Other peptide tags useful for purification include, but are
not
limited to, the "HA" tag, which corresponds to an epitope derived from the
influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984)) and the
"flag"
tag.
The present invention further encompasses antibodies or fragments thereof
conjugated to a diagnostic or therapeutic agent. The antibodies can be used
diagnostically to, for example, monitor the development or progression of a
tumor
as part of a clinical testing procedure to, e.g., determine the efficacy of a
given
treatment regimen. Detection can be facilitated by coupling the antibody to a
detectable substance. Examples of detectable substances include various



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
132
enzymes, prosthetic groups, fluorescent materials, luminescent materials,
bioluminescent materials, radioactive materials, positron emitting metals
using
various positron emission tomographies, and nonradioactive paramagnetic metal
ions. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be
conjugated to antibodies for use as diagnostics according to the present
invention.
Examples of suitable enzymes include horseradish peroxidase, alkaline
phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable
prosthetic group complexes include streptavidin/biotin and avidin/biotin;
examples of suitable fluorescent materials include umbelliferone, fluorescein,
fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein,
dansyl
chloride or phycoerythrin; an example of a luminescent material includes
luminol;
examples of bioluminescent materials include luciferase, luciferin, and
aequorin;
and examples of suitable radioactive material include'ZSI,'3'I, "'In or 99Tc.
Further, an antibody or fragment thereof may be conjugated to a
therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent,
a
therapeutic agent or a radioactive metal ion. A cytotoxin or cytotoxic agent
includes any agent that is detrimental to cells. Examples include paclitaxol,
cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide,
tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin,
dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-
dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine,
propranolol,
and puromycin and analogs or homologs thereof. Therapeutic agents include, but
are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-
thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and
lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol,
streptozotocin, mitomycin C, and cis- dichlorodiamine platinum (II) (DDP)
cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and
doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin),
bleomycin,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
133
mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine
and vinblastine).
The conjugates of the invention can be used for modifying a given
biological response, the therapeutic agent or drug moiety is not to be
construed as
limited to classical chemical therapeutic agents. For example, the drug moiety
may
be a protein or polypeptide possessing a desired biological activity. Such
proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas
exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, a-
interferon,
13-interferon, nerve growth factor, platelet derived growth factor, tissue
l0 plasminogen activator, a thrombotic agent or an anti- angiogenic agent,
e.g.;
angiostatin or endostatin; or, biological response modifiers such as, for
example,
lymphokines, interleukin-1 ("IL-1 "), interleukin-2 ("IL-2"), interleukin-6
("IL-6"),
granulocyte macrophase colony stimulating factor ("GM-CSF"), granulocyte
colony stimulating factor ("G-CSF"), or other growth factors.
Antibodies may also be attached to solid supports, which are particularly
useful for immunoassays or purification of the target antigen. Such solid
supports include, but are not limited to, glass, cellulose, polyacrylamide,
nylon,
polystyrene, polyvinyl chloride or polypropylene.
Techniques for conjugating such therapeutic moiety to antibodies are well
known, see, e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of
Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy,
Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et
al.,
"Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.),
Robinson
et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thorpe, "Antibody
Carriers
Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies
'84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506
(1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of
Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For
Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic



CA 02362929 2001-08-16
WO 00/52028 PCT/L1S00/05686
134
Press 1985), and Thorpe et al., "The Preparation And Cytotoxic Properties Of
Antibody-Toxin Conjugates", Immunol. Rev. 62:119-58 (1982).
Alternatively, an antibody can be conjugated to a second antibody to form
an antibody heteroconjugate as described by Segal in U.S. Patent No.
4,676,980,
which is incorporated herein by reference in its entirety.
An antibody, with or without a therapeutic moiety conjugated to it,
administered alone or in combination with cytotoxic factors) and/or
cytokine(s)
can be used as a therapeutic.
1o Assays For Antibody Binding
The antibodies of the invention may be assayed for immunospecific
binding by any method known in the art. The immunoassays which can be used
include but are not limited to competitive and non-competitive assay systems
using techniques such as western blots, radioimmunoassays, ELISA (enzyme
linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation
assays, precipitin reactions, gel diffusion precipitin reactions,
immunodiffusion
assays, agglutination assays, complement-fixation assays, immunoradiometric
assays, fluorescent immunoassays, protein A immunoassays, to name but a few.
Such assays are routine and well known in the art (see, e.g., Ausubel et al,
eds,
1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc.,
New York, which is incorporated by reference herein in its entirety).
Exemplary
immunoassays are described briefly below (but are not intended by way of
limitation).
Immunoprecipitation protocols generally comprise lysing a population of
cells in a lysis buffer such as RIPA buffer ( 1 % NP-40 or Triton X- 100, 1
sodium deoxycholate, 0.1% SDS, 0.15 M NaCI, 0.01 M sodium phosphate at pH
7.2, 1 % Trasylol) supplemented with protein phosphatase and/or protease
inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody
of interest to the cell lysate, incubating for a period of time (e.g., 1-4
hours) at 4°



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
135
C, adding protein A and/or protein G sepharose beads to the cell lysate,
incubating for about an hour or more at 4° C, washing the beads in
lysis buffer
and resuspending the beads in SDS/sample buffer. The ability of the antibody
of
interest to immunoprecipitate a particular antigen can be assessed by, e.g.,
western blot analysis. One of skill in the art would be knowledgeable as to
the
parameters that can be modified to increase the binding of the antibody to an
antigen and decrease the background (e.g., pre-clearing the cell lysate with
sepharose beads). For further discussion regarding immunoprecipitation
protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular
l0 Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.
Western blot analysis generally comprises preparing protein samples,
electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%- 20%
SDS-PAGE depending on the molecular weight of the antigen), transferring the
protein sample from the polyacrylamide gel to a membrane such as
nitrocellulose;
PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3%
BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-Tween
20), blocking the membrane with primary antibody (the antibody of interest)
diluted in blocking buffer, washing the membrane in washing buffer, blocking
the
membrane with a secondary antibody (which recognizes the primary antibody,
2o e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g.,
horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g.,
32P
or 125I) diluted in blocking buffer, washing the membrane in wash buffer, and
detecting the presence of the antigen. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase the signal
detected and to reduce the background noise. For further discussion regarding
western blot protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols
in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.8.1.
ELISAs comprise preparing antigen, coating the well of a 96 well
microtiter plate with the antigen, adding the antibody of interest conjugated
to a



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
136
detectable compound such as an enzymatic substrate (e.g., horseradish
peroxidase
or alkaline phosphatase) to the well and incubating for a period of time, and
detecting the presence of the antigen. In ELISAs the antibody of interest does
not
have to be conjugated to a detectable compound; instead, a second antibody
(which recognizes the antibody of interest) conjugated to a detectable
compound
may be added to the well. Further, instead of coating the well with the
antigen,
the antibody may be coated to the well. In this case, a second antibody
conjugated to a detectable compound may be added following the addition of the
antigen of interest to the coated well. One of skill in the art would be
knowledgeable as to the parameters that can be modified to increase the signal
detected as well as other variations of ELISAs known in the art. For further
discussion regarding ELISAs see, e.g., Ausubel et al, eds, 1994, Current
Protocols
in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 11.2.1.
The binding affinity of an antibody to an antigen and the off rate of an
antibody-antigen interaction can be determined by competitive binding assays.
One example of a competitive binding assay is a radioimmunoassay comprising
the incubation of labeled antigen (e.g., 3H or 125I) with the antibody of
interest in
the presence of increasing amounts of unlabeled antigen, and the detection of
the
antibody bound to the labeled antigen. The affinity of the antibody of
interest for
2o a particular antigen and the binding off rates can be determined ftom the
data by
scatchard plot analysis. Competition with a second antibody can also be
determined using radioimmunoassays. In this case, the antigen is incubated
with
antibody of interest is conjugated to a labeled compound (e.g., 3H or 125I) in
the
presence of increasing amounts of an unlabeled second antibody.
Therapeutic Uses
The present invention is further directed to antibody-based therapies
which involve administering antibodies of the invention to an animal,
preferably a
mammal, and most preferably a human, patient for treating one or more of the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
137
described disorders. Therapeutic compounds of the invention include, but are
not
limited to, antibodies of the invention (including fragments, analogs and
derivatives
thereof as described herein) and nucleic acids encoding antibodies of the
invention
(including fragments, analogs and derivatives thereof as described herein).
The
antibodies of the invention can be used to treat or prevent diseases and
disorders
associated with aberrant expression and/or activity of a polypeptide of the
invention, including, but not limited to, diseases and/or disorders such as
autoimmune diseases and/or deficiencies, as discussed herein. The treatment
and/or prevention of diseases and disorders associated with aberrant
expression
l0 and/or activity of a polypeptide of the invention includes, but is not
limited to,
alleviating symptoms associated with those diseases and disorders. Antibodies
of
the invention may be provided in pharmaceutically acceptable compositions as
known in the art or as described herein.
A summary of the ways in which the antibodies of the present invention
may be used therapeutically includes binding polynucleotides or polypeptides
of
the present invention locally or systemically in the body or by direct
cytotoxicity
of the antibody, e.g. as mediated by complement (CDC) or by effector cells
(ADCC). Some of these approaches are described in more detail below. Armed
with the teachings provided herein, one of ordinary skill in the art will know
how
to use the antibodies of the present invention for diagnostic, monitoring or
therapeutic purposes without undue experimentation.
The antibodies of this invention may be advantageously utilized in
combination with other monoclonal or chimeric antibodies, or with lymphokines
or hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7), for
example,
which serve to increase the number or activity of effector cells which
interact
with the antibodies.
The antibodies of the invention may be administered alone or in
combination with other types of treatments (e.g., radiation therapy,
chemotherapy, hormonal therapy, immunotherapy and anti-tumor agents).



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
138
Generally, administration of products of a species origin or species
reactivity (in
the case of antibodies) that is the same species as that of the patient is
preferred.
Thus, in a preferred embodiment, human antibodies, fragments derivatives,
analogs, or nucleic acids, are administered to a human patient for therapy or
prophylaxis.
It is preferred to use high affinity and/or potent in vivo inhibiting and/or
neutralizing antibodies against polypeptides or polynucleotides of the present
invention, fragments or regions thereof, for both immunoassays directed to and
therapy of disorders related to polynucleotides or polypeptides, including
fragments thereof, of the present invention. Such antibodies, fragments, or
regions, will preferably have an affinity for polynucleotides or polypeptides,
including fragments thereof. Preferred binding affinities include those with a
dissociation constant or Kd less than 5 X 10-6 M, 10-6 M, 5 X 10-7 M, 10-7 M,
5 X 10-8 M, 10-8 M, 5 X 10-9 M, 10-9 M, 5 X 10-10 M, 10-10 M, 5 X 10-11
M, 10-11 M, 5 X 10-12 M, 10-12 M, 5 X 10-13 M, 10- 13 M, 5 X 10-14 M, 10-
14 M, 5 X 10-15 M, and 10-15 M.
Gene Therapy
In a specific embodiment, nucleic acids comprising sequences encoding
antibodies or functional derivatives thereof, are administered to treat,
inhibit or
prevent a disease or disorder associated with aberrant expression and/or
activity of
a polypeptide of the invention, by way of gene therapy. Gene therapy refers to
therapy performed by the administration to a subject of an expressed or
expressible nucleic acid. In this embodiment of the invention, the nucleic
acids
produce their encoded protein that mediates a therapeutic effect.
Any of the methods for gene therapy available in the art can be used
according to the present invention. Exemplary methods are described below.
For general reviews of the methods of gene therapy, see Goldspiel et al.,
1993, Clinical Pharmacy 12:488-505; Wu and Wu, 1991, Biotherapy 3:87-95;



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
139
Tolstoshev, 1993, Ann. Rev. Pharmacol. Toxicol. 32:573-596; Mulligan, 1993,
Science 260:926-932; and Morgan and Anderson, 1993, Ann. Rev. Biochem.
62:191-217; May, 1993, TIBTECH 11(5):155-215). Methods commonly known
in the art of recombinant DNA technology which can be used are described in
Ausubel et al. (eds.), 1993, Current Protocols in Molecular Biology, John
Wiley &
Sons, NY; and Kriegler, 1990, Gene Transfer and Expression, A Laboratory
Manual, Stockton Press, NY.
In a preferred aspect, the compound comprises nucleic acid sequences
encoding an antibody, said nucleic acid sequences being part of expression
vectors
l0 that express the antibody or fragments or chimeric proteins or heavy or
light
chains thereof in a suitable host. In particular, such nucleic acid sequences
have
promoters operably linked to the antibody coding region, said promoter being
inducible or constitutive, and, optionally, tissue- specific. In another
particular
embodiment, nucleic acid molecules are used in which the antibody coding
sequences and any other desired sequences are flanked by regions that promote
homologous recombination at a desired site in the genome, thus providing for
intrachromosomal expression of the antibody nucleic acids (Koller and
Smithies,
1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al., 1989, Nature
342:435-438). In specific embodiments, the expressed antibody molecule is a
2o single chain antibody; alternatively, the nucleic acid sequences include
sequences
encoding both the heavy and light chains, or fragments thereof, of the
antibody.
Delivery of the nucleic acids into a patient may be either direct, in which
case the patient is directly exposed to the nucleic acid or nucleic acid-
carrying
vectors, or indirect, in which case, cells are first transformed with the
nucleic acids
in vitro, then transplanted into the patient. These two approaches are known,
respectively, as in vivo or ex vivo gene therapy.
In a specific embodiment, the nucleic acid sequences are directly
administered in vivo, where it is expressed to produce the encoded product.
This
can be accomplished by any of numerous methods known in the art, e.g., by



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
140
constructing them as part of an appropriate nucleic acid expression vector and
administering it so that they become intracellular, e.g., by infection using
defective
or attenuated retrovirals or other viral vectors (see U.S. Patent No.
4,980,286), or
by direct injection of naked DNA, or by use of microparticle bombardment
(e.g., a
gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors
or
transfecting agents, encapsulation in liposomes, microparticles, or
microcapsules,
or by administering them in linkage to a peptide which is known to enter the
nucleus, by administering it in linkage to a ligand subject to receptor-
mediated
endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-4432) (which
can be used to target cell types specifically expressing the receptors), etc.
In
another embodiment, nucleic acid-ligand complexes can be formed in which the
ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the
nucleic acid to avoid lysosomal degradation. In yet another embodiment, the
nucleic acid can be targeted in vivo for cell specific uptake and expression,
by
targeting a specific receptor (see, e.g., PCT Publications WO 92/06180 dated
April 16, 1992 (Wu et al.); WO 92/22635 dated December 23, 1992 (Wilson et
al.); W092/20316 dated November 26, 1992 (Findeis et al.); W093/14188 dated
July 22, 1993 (Clarke et al.), WO 93/20221 dated October 14, 1993 (Young)).
Alternatively, the nucleic acid can be introduced intracellularly and
incorporated
within host cell DNA for expression, by homologous recombination (Koller and
Smithies, 1989, Proc. Natl. Acad. Sci. USA 86:8932-8935; Zijlstra et al.,
1989,
Nature 342:435-438).
In a specific embodiment, viral vectors that contains nucleic acid sequences
encoding an antibody of the invention are used. For example, a retroviral
vector
can be used (see Miller et al., 1993, Meth. Enzymol. 217:581-599). These
retroviral vectors have been to delete retroviral sequences that are not
necessary
for packaging of the viral genome and integration into host cell DNA. The
nucleic
acid sequences encoding the antibody to be used in gene therapy are cloned
into
one or more vectors, which facilitates delivery of the gene into a patient.
More



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
141
detail about retroviral vectors can be found in Boesen et al., 1994,
Biotherapy
6:291-302, which describes the use of a retroviral vector to deliver the mdrl
gene
to hematopoietic stem cells in order to make the stem cells more resistant to
chemotherapy. Other references illustrating the use of retroviral vectors in
gene
therapy are: Clowes et al., 1994, J. Clin. Invest. 93:644-651; Kiem et al.,
1994,
Blood 83:1467-1473; Salmons and Gunzberg, 1993, Human Gene Therapy 4:129-
141; and Grossman and Wilson, 1993, Curr. Opin. in Genetics and Devel. 3:110-
114.
Adenoviruses are other viral vectors that can be used in gene therapy.
to Adenoviruses are especially attractive vehicles for delivering genes to
respiratory
epithelia. Adenoviruses naturally infect respiratory epithelia where they
cause a
mild disease. Other targets for adenovirus-based delivery systems are liver,
the
central nervous system, endothelial cells, and muscle. Adenoviruses have the
advantage of being capable of infecting non-dividing cells. Kozarsky and
Wilson,
1993, Current Opinion in Genetics and Development 3:499-503 present a review
of adenovirus-based gene therapy. Bout et al., 1994, Human Gene Therapy 5:3-
10 demonstrated the use of adenovirus vectors to transfer genes to the
respiratory
epithelia of rhesus monkeys. Other instances of the use of adenoviruses in
gene
therapy can be found in Rosenfeld et al., 1991, Science 252:431-434; Rosenfeld
et
2o al., 1992, Cell 68:143- 155; Mastrangeli et al., 1993, J. Clin. Invest.
91:225-234;
PCT Publication W094/12649; and Wang, et al., 1995, Gene Therapy 2:775-783.
In a preferred embodiment, adenovirus vectors are used.
Adeno-associated virus (AAV) has also been proposed for use in gene
therapy (Walsh et al., 1993, Proc. Soc. Exp. Biol. Med. 204:289-300; U.S.
Patent
No. 5,436,146).
Another approach to gene therapy involves transferring a gene to cells in
tissue culture by such methods as electroporation, lipofection, calcium
phosphate
mediated transfection, or viral infection. Usually, the method of transfer
includes
the transfer of a selectable marker to the cells. The cells are then placed
under



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
142
selection to isolate those cells that have taken up and are expressing the
transferred gene. Those cells are then delivered to a patient.
In this embodiment, the nucleic acid is introduced into a cell prior to
administration in vivo of the resulting recombinant cell. Such introduction
can be
s carried out by any method known in the art, including but not limited to
transfection, electroporation, microinjection, infection with a viral or
bacteriophage vector containing the nucleic acid sequences, cell fusion,
chromosome-mediated gene transfer, microcell-mediated gene transfer,
spheroplast fusion, etc. Numerous techniques are known in the art for the
to introduction of foreign genes into cells (see, e.g., Loeffler and Behr,
1993, Meth.
Enzymol. 217:599-618; Cohen et al., 1993, Meth. Enzymol. 217:618-644; Cline,
1985, Pharmac. Ther. 29:69-92) and may be used in accordance with the present
invention, provided that the necessary developmental and physiological
functions
of the recipient cells are not disrupted. The technique should provide for the
15 stable transfer of the nucleic acid to the cell, so that the nucleic acid
is expressible
by the cell and preferably heritable and expressible by its cell progeny.
The resulting recombinant cells can be delivered to a patient by various
methods known in the art. Recombinant blood cells (e.g., hematopoietic stem or
progenitor cells) are preferably administered intravenously. The amount of
cells
2o envisioned for use depends on the desired effect, patient state, etc., and
can be
determined by one skilled in the art.
Cells into which a nucleic acid can be introduced for purposes of gene
therapy encompass any desired, available cell type, and include but are not
limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts,
muscle cells,
25 hepatocytes; blood cells such as Tlymphocytes, Blymphocytes, monocytes,
macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various
stem or progenitor cells, in particular hematopoietic stem or progenitor
cells, e.g.,
as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal
liver,
etc.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
143
In a preferred embodiment, the cell used for gene therapy is autologous to
the patient.
In an embodiment in which recombinant cells are used in gene therapy,
nucleic acid sequences encoding an antibody are introduced into the cells such
that
they are expressible by the cells or their progeny, and the recombinant cells
are
then administered in vivo for therapeutic effect. In a specific embodiment,
stem
or progenitor cells are used. Any stem and/or progenitor cells which can be
isolated and maintained in vitro can potentially be used in accordance with
this
embodiment of the present invention (see e.g. PCT Publication WO 94/08598,
1o dated April 28, 1994; Stemple and Anderson, 1992, Cell 71:973-985;
Rheinwald,
1980, Meth. Cell Bio. 21A:229; and Pittelkow and Scott, 1986, Mayo Clinic
Proc.
61:771).
In a specific embodiment, the nucleic acid to be introduced for purposes of
gene therapy comprises an inducible promoter operably linked to the coding
region, such that expression of the nucleic acid is controllable by
controlling the
presence or absence of the appropriate inducer of transcription.
Demonstration of Therapeutic or Prophylactic Activity
The compounds or pharmaceutical compositions of the invention are
preferably tested in vitro, and then in vivo for the desired therapeutic or
prophylactic activity, prior to use in humans. For example, in vitro assays to
demonstrate the therapeutic or prophylactic utility of a compound or
pharmaceutical composition include, the effect of a compound on a cell line or
a
patient tissue sample. The effect of the compound or composition on the cell
line
and/or tissue sample can be determined utilizing techniques known to those of
skill in the art including, but not limited to, rosette formation assays and
cell lysis
assays. In accordance with the invention, in vitro assays which can be used to
determine whether administration of a specific compound is indicated, include
in
vitro cell culture assays in which a patient tissue sample is grown in
culture, and



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
144
exposed to or otherwise administered a compound, and the effect of such
compound upon the tissue sample is observed.
Therapeutic/Prophylactic Administration and Composition
The invention provides methods of treatment, inhibition and prophylaxis
by administration to a subject of an effective amount of a compound or
pharmaceutical composition of the invention, preferably an antibody of the
invention. In a preferred aspect, the compound is substantially purified
(e.g.,
substantially free from substances that limit its effect or produce undesired
side-
effects). The subject is preferably an animal, including but not limited to
animals
such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a
mammal,
and most preferably human.
Formulations and methods of administration that can be employed when
the compound comprises a nucleic acid or an immunoglobulin are described
above;
additional appropriate formulations and routes of administration can be
selected
from among those described herein below.
Various delivery systems are known and can be used to administer a
compound of the invention, e.g., encapsulation in liposomes, microparticles,
microcapsules, recombinant cells capable of expressing the compound, receptor-
2o mediated endocytosis (see, e.g., Wu and Wu, 1987, J. Biol. Chem. 262:4429-
4432), construction of a nucleic acid as part of a retroviral or other vector,
etc.
Methods of introduction include but are not limited to intradermal,
intramuscular,
intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral
routes.
The compounds or compositions may be administered by any convenient route,
for example by infusion or bolus injection, by absorption through epithelial
or
mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.)
and
may be administered together with other biologically active agents.
Administration can be systemic or local. In addition, it may be desirable to
introduce the pharmaceutical compounds or compositions of the invention into



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
145
the central nervous system by any suitable route, including intraventricular
and
intrathecal injection; intraventricular injection may be facilitated by an
intraventricular catheter, for example, attached to a reservoir, such as an
Ommaya
reservoir. Pulmonary administration can also be employed, e.g., by use of an
inhaler or nebulizer, and formulation with an aerosolizing agent.
In a specific embodiment, it may be desirable to administer the
pharmaceutical compounds or compositions of the invention locally to the area
in
need of treatment; this may be achieved by, for example, and not by way of
limitation, local infusion during surgery, topical application, e.g., in
conjunction
l0 with a wound dressing after surgery, by injection, by means of a catheter,
by
means of a suppository, or by means of an implant, said implant being of a
porous, non-porous, or gelatinous material, including membranes, such as
sialastic
membranes, or fibers. Preferably, when administering a protein, including an
antibody, of the invention, care must be taken to use materials to which the
protein does not absorb.
In another embodiment, the compound or composition can be delivered in
a vesicle, in particular a liposome (see Langer, 1990, Science 249:1527-1533;
Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer,
Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 365 (1989); Lopez-
2o Berestein, ibid., pp. 317-327; see generally ibid.)
In yet another embodiment, the compound or composition can be delivered
in a controlled release system. In one embodiment, a pump may be used (see
Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201; Buchwald et
al.,
1980, Surgery 88:507; Saudek et al., 1989, N. Engl. J. Med. 321:574). In
another
embodiment, polymeric materials can be used (see Medical Applications of
Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida
(1974); Controlled Drug Bioavailability, Drug Product Design and Performance,
Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., 1983,
Macromol. Sci. Rev. Macromol. Chem. 23:61; see also Levy et al., 1985, Science



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
146
228:190; During et al., 1989, Ann. Neurol. 25:351; Howard et al., 1989,
J.Neurosurg. 71:105). In yet another embodiment, a controlled release system
can
be placed in proximity of the therapeutic target, i.e., the brain, thus
requiring only
a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications
of
Controlled Release, supra, vol. 2, pp. 115-138 (1984)).
Other controlled release systems are discussed in the review by Langer
(1990, Science 249:1527-1533).
In a specific embodiment where the compound of the invention is a nucleic
acid encoding a protein, the nucleic acid can be administered in vivo to
promote
expression of its encoded protein, by constructing it as part of an
appropriate
nucleic acid expression vector and administering it so that it becomes
intracellular,
e.g., by use of a retroviral vector (see U.S. Patent No. 4,980,286), or by
direct
injection, or by use of microparticle bombardment (e.g., a gene gun;
Biolistic,
Dupont), or coating with lipids or cell-surface receptors or transfecting
agents, or
by administering it in linkage to a homeobox- like peptide which is known to
enter
the nucleus (see e.g., Joliot et al., 1991, Proc. Natl. Acad. Sci. USA 88:1864-

1868), etc. Alternatively, a nucleic acid can be introduced intracellularly
and
incorporated within host cell DNA for expression, by homologous recombination.
The present invention also provides pharmaceutical compositions. Such
compositions comprise a therapeutically effective amount of a compound, and a
pharmaceutically acceptable carrier. In a specific embodiment, the term
"pharmaceutically acceptable" means approved by a regulatory agency of the
Federal or a state government or listed in the U.S. Pharmacopeia or other
generally
recognized pharmacopeia for use in animals, and more particularly in humans.
The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with
which
the therapeutic is administered. Such pharmaceutical carriers can be sterile
liquids, such as water and oils, including those of petroleum, animal,
vegetable or
synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and
the
like. Water is a preferred carrier when the pharmaceutical composition is



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
147
administered intravenously. Saline solutions and aqueous dextrose and glycerol
solutions can also be employed as liquid carriers, particularly for injectable
solutions. Suitable pharmaceutical excipients include starch, glucose,
lactose,
sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate,
glycerol
monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene,
glycol,
water, ethanol and the like. The composition, if desired, can also contain
minor
amounts of wetting or emulsifying agents, or pH buffering agents. These
compositions can take the form of solutions, suspensions, emulsion, tablets,
pills,
capsules, powders, sustained-release formulations and the like. The
composition
l0 can be formulated as a suppository, with traditional binders and carriers
such as
triglycerides. Oral formulation can include standard carriers such as
pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium
saccharine, cellulose, magnesium carbonate, etc. Examples of suitable
pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences"
by
E.W. Martin. Such compositions will contain a therapeutically effective amount
of the compound, preferably in purified form, together with a suitable amount
of
carrier so as to provide the form for proper administration to the patient.
The
formulation should suit the mode of administration.
In a preferred embodiment, the composition is formulated in accordance
with routine procedures as a pharmaceutical composition adapted for
intravenous
administration to human beings. Typically, compositions for intravenous
administration are solutions in sterile isotonic aqueous buffer. Where
necessary,
the composition may also include a solubilizing agent and a local anesthetic
such
as lignocaine to ease pain at the site of the injection. Generally, the
ingredients
are supplied either separately or mixed together in unit dosage form, for
example,
as a dry lyophilized powder or water free concentrate in a hermetically sealed
container such as an ampoule or sachette indicating the quantity of active
agent.
Where the composition is to be administered by infusion, it can be dispensed
with an infusion bottle containing sterile pharmaceutical grade water or
saline.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
148
Where the composition is administered by injection, an ampoule of sterile
water
for injection or saline can be provided so that the ingredients may be mixed
prior
to administration.
The compounds of the invention can be formulated as neutral or salt
forms. Pharmaceutically acceptable salts include those formed with anions such
as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric
acids, etc.,
and those formed with canons such as those derived from sodium, potassium,
ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-
ethylamino ethanol, histidine, procaine, etc.
The amount of the compound of the invention which will be effective in
the treatment, inhibition and prevention of a disease or disorder associated
with
aberrant expression and/or activity of a polypeptide of the invention can be
determined by standard clinical techniques. In addition, in vitro assays may
optionally be employed to help identify optimal dosage ranges. The precise
dose
to be employed in the formulation will also depend on the route of
administration, and the seriousness of the disease or disorder, and should be
decided according to the judgment of the practitioner and each patient's
circumstances. Effective doses may be extrapolated from dose-response curves
derived from in vitro or animal model test systems.
For antibodies, the dosage administered to a patient is typically 0.1 mg/kg
to 100 mg/kg of the patient's body weight. Preferably, the dosage administered
to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight,
more
preferably 1 mg/kg to 10 mg/kg of the patient's body weight. Generally, human
antibodies have a longer half life within the human body than antibodies from
other species due to the immune response to the foreign polypeptides. Thus,
lower dosages of human antibodies and less frequent administration is often
possible. Further, the dosage and frequency of administration of antibodies of
the
invention may be reduced by enhancing uptake and tissue penetration (e.g.,
into
the brain) of the antibodies by modifications such as, for example,
lipidation.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
149
The invention also provides a pharmaceutical pack or kit comprising one
or more containers filled with one or more of the ingredients of the
pharmaceutical
compositions of the invention. Optionally associated with such containers) can
be a notice in the form prescribed by a governmental agency regulating the
manufacture, use or sale of pharmaceuticals or biological products, which
notice
reflects approval by the agency of manufacture, use or sale for human
administration.
Diagnosis and Imaging
l0 Labeled antibodies, and derivatives and analogs thereof, which specifically
bind to a polypeptide of interest can be used for diagnostic purposes to
detect,
diagnose, or monitor diseases and/or disorders associated with the aberrant
expression and/or activity of a polypeptide of the invention. The invention
provides for the detection of aberrant expression of a polypeptide of
interest,
comprising (a) assaying the expression of the polypeptide of interest in cells
or
body fluid of an individual using one or more antibodies specific to the
polypeptide interest and (b) comparing the level of gene expression with a
standard gene expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard expression level is
indicative of aberrant expression.
The invention provides a diagnostic assay for diagnosising a disorder,
comprising (a) assaying the expression of the polypeptide of interest in cells
or
body fluid of an individual using one or more antibodies specific to the
polypeptide interest and (b) comparing the level of gene expression with a
standard gene expression level, whereby an increase or decrease in the assayed
polypeptide gene expression level compared to the standard expression level is
indicative of a particular disorder. With respect to cancer, the presence of a
relatively high amount of transcript in biopsied tissue from an individual may
indicate a predisposition for the development of the disease, or may provide a



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
150
means for detecting the disease prior to the appearance of actual clinical
symptoms. A more definitive diagnosis of this type may allow health
professionals to employ preventative measures or aggressive treatment earlier
thereby preventing the development or further progression of the cancer.
Assaying TR6-alpha andlor TR6-beta polypeptide levels in a biological
sample can occur using antibody-based techniques. Antibodies of the invention
can be used to assay protein levels in a biological sample using classical
immunohistological methods known to those of skill in the art (e.g., see
Jalkanen,
M., et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J. Cell .
Biol.
l0 105:3087-3096 (1987)). Other antibody-based methods useful for detecting
protein gene expression include immunoassays, such as the enzyme linked
immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable
antibody assay labels are known in the art and include enzyme labels, such as,
glucose oxidase, and radioisotopes, such as iodine ('3'I,'zsl,'z3I,'z~I),
carbon
('4C), sulfur (3sS), tritium (3H), indium ("smln, "3mln, "zln, "'In), and
technetium
(99TC' 99m-rC), thallium (z°'Ti), gallium (68Ga, 6~Ga), palladium
('°3Pd),
molybdenum (99Mo), xenon ('33Xe), fluorine ('$F),'s3Sm,'~~Lu,'s9Gd,'49Pm,
~4oLa, ms~,b, ~66Ho, 9oI,, 4~Sc, ~$6Re,'BARe,'4zPr,'osRh, 9~Ru; luminescent
labels,
such as luminol; and fluorescent labels, such as fluorescein and rhodamine,
and
biotin.
Techniques known in the art may be applied to label antibodies of the
invention. Such techniques include, but are not limited to, the use of
bifunctional
conjugating agents (see e.g., U.S. Patent Nos. 5,756,065; 5,714,631;
5,696,239;
5,652,361; 5,505,931; 5,489,425; 5,435,990; 5,428,139; 5,342,604; 5,274,119;
4,994,560; and 5,808,003; the contents of each of which are hereby
incorporated
by reference in its entirety).
One aspect of the invention is the detection and diagnosis of a disease or
disorder associated with aberrant expression of a polypeptide of the interest
in an
animal, preferably a mammal and most preferably a human. In one embodiment,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
151
diagnosis comprises: a) administering (for example, parenterally,
subcutaneously,
or intraperitoneally) to a subject an effective amount of a labeled molecule
which
specifically binds to the polypeptide of interest; b) waiting for a time
interval
following the administering for permitting the labeled molecule to
preferentially
concentrate at sites in the subject where the polypeptide is expressed (and
for
unbound labeled molecule to be cleared to background level); c) determining
background level; and d) detecting the labeled molecule in the subject, such
that
detection of labeled molecule above the background level indicates that the
subject
has a particular disease or disorder associated with aberrant expression of
the
to polypeptide of interest. Background level can be determined by various
methods
including, comparing the amount of labeled molecule detected to a standard
value
previously determined for a particular system.
It will be understood in the art that the size of the subject and the imaging
system used will determine the quantity of imaging moiety needed to produce
diagnostic images. In the case of a radioisotope moiety, for a human subject,
the
quantity of radioactivity injected will normally range from about 5 to 20
millicuries of 99mTc. The labeled antibody or antibody fragment will then
preferentially accumulate at the location of cells which contain the specific
protein. In vivo tumor imaging is described in S.W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments."
(Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W.
Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).
Depending on several variables, including the type of label used and the
mode of administration, the time interval following the administration for
permitting the labeled molecule to preferentially concentrate at sites in the
subject
and for unbound labeled molecule to be cleared to background level is 6 to 48
hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time
interval
following administration is 5 to 20 days or 5 to 10 days.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
152
In an embodiment, monitoring of the disease or disorder is carried out by
repeating the method for diagnosing the disease or disease, for example, one
month after initial diagnosis, six months after initial diagnosis, one year
after initial
diagnosis, etc.
Presence of the labeled molecule can be detected in the patient using
methods known in the art for in vivo scanning. These methods depend upon the
type of label used. Skilled artisans will be able to determine the appropriate
method for detecting a particular label. Methods and devices that may be used
in
the diagnostic methods of the invention include, but are not limited to,
computed
1o tomography (CT), whole body scan such as position emission tomography
(PET), magnetic resonance imaging (MRI), and sonography.
In a specific embodiment, the molecule is labeled with a radioisotope and is
detected in the patient using a radiation responsive surgical instrument
(Thurston
et al., U.S. Patent No. 5,441,050). In another embodiment, the molecule is
labeled
with a fluorescent compound and is detected in the patient using a
fluorescence
responsme scanning instrument. In another embodiment, the molecule is labeled
with a positron emitting metal and is detected in the patent using positron
emission-tomography. In yet another embodiment, the molecule is labeled with a
paramagnetic label and is detected in a patient using magnetic resonance
imaging
(MRI).
Kits
The present invention provides kits that can be used in the above methods.
In one embodiment, a kit comprises an antibody of the invention, preferably a
purified antibody, in one or more containers. In a specific embodiment, the
kits of
the present invention contain a substantially isolated polypeptide comprising
an
epitope which is specifically immunoreactive with an antibody included in the
kit.
Preferably, the kits of the present invention further comprise a control
antibody
which does not react with the polypeptide of interest. In another specific



CA 02362929 2001-08-16
WO 00/52028 PCT/iJS00/05686
153
embodiment, the kits of the present invention contain a means for detecting
the
binding of an antibody to a polypeptide of interest (e.g., the antibody may be
conjugated to a detectable substrate such as a fluorescent compound, an
enzymatic substrate, a radioactive compound or a luminescent compound, or a
second antibody which recognizes the first antibody may be conjugated to a
detectable substrate).
In another specific embodiment of the present invention, the kit is a
diagnostic kit for use in screening serum containing antibodies specific
against
proliferative and/or cancerous polynucleotides and polypeptides. Such a kit
may
to include a control antibody that does not react with the polypeptide of
interest.
Such a kit may include a substantially isolated polypeptide antigen comprising
an
epitope which is specifically immunoreactive with at least one anti-
polypeptide
antigen antibody. Further, such a kit includes means for detecting the binding
of
said antibody to the antigen (e.g., the antibody may be conjugated to a
fluorescent
compound such as fluorescein or rhodamine which can be detected by flow
cytometry). In specific embodiments, the kit may include a recombinantly
produced or chemically synthesized polypeptide antigen. The polypeptide
antigen of the kit may also be attached to a solid support.
In a more specific embodiment the detecting means of the above-described
2o kit includes a solid support to which said polypeptide antigen is attached.
Such a
kit may also include a non-attached reporter-labeled anti-human antibody. In
this
embodiment, binding of the antibody to the polypeptide antigen can be detected
by binding of the said reporter-labeled antibody.
In an additional embodiment, the invention includes a diagnostic kit for use
in screening serum containing antigens of the polypeptide of the invention.
The
diagnostic kit includes a substantially isolated antibody specifically
immunoreactive with polypeptide or polynucleotide antigens, and means for
detecting the binding of the polynucleotide or polypeptide antigen. to the
antibody. In one embodiment, the antibody is attached to a solid support. In a



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
154
specific embodiment, the antibody may be a monoclonal antibody. The detecting
means of the kit may include a second, labeled monoclonal antibody.
Alternatively, or in addition, the detecting means may include a labeled,
competing
antigen.
In one diagnostic configuration, test serum is reacted with a solid phase
reagent having a surface-bound antigen obtained by the methods of the present
invention. After binding with specific antigen antibody to the reagent and
removing unbound serum components by washing, the reagent is reacted with
reporter-labeled anti-human antibody to bind reporter to the reagent in
proportion
1 o to the amount of bound anti-antigen antibody on the solid support. The
reagent is
again washed to remove unbound labeled antibody, and the amount of reporter
associated with the reagent is determined. Typically, the reporter is an
enzyme
which is detected by incubating the solid phase in the presence of a suitable
fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).
The solid surface reagent in the above assay is prepared by known
techniques for attaching protein material to solid support material, such as
polymeric beads, dip sticks, 96-well plate or filter material. These
attachment
methods generally include non-specific adsorption of the protein to the
support
or covalent attachment of the protein, typically through a free amine group,
to a
2o chemically reactive group on the solid support, such as an activated
carboxyl,
hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be
used
in conjunction with biotinylated antigen(s).
Thus, the invention provides an assay system or kit for carrying out this
diagnostic method. The kit generally includes a support with surface- bound
recombinant antigens, and a reporter-labeled anti-human antibody for detecting
surface-bound anti-antigen antibody.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
155
Immune System-Related Disorders
Diagnosis
The present inventors have discovered that TNFR-6 alpha and TNFR-
6 beta are expressed in hematopoietic and transformed tissues. For a number
of immune system-related disorders, substantially altered (increased or
decreased) levels of TNFR gene expression can be detected in immune system
tissue or other cells or bodily fluids (e.g., sera and plasma) taken from an
individual having such a disorder, relative to a "standard" TNFR gene
expression level, that is, the TNFR expression level in immune system tissues
or other cells or bodily fluids from an individual not having the immune
system
disorder. Thus, the invention provides a diagnostic method useful during
diagnosis of an immune system disorder, which involves measuring the
expression level of the gene encoding the TNFR protein in immune system
tissue or other cells or body fluid from an individual and comparing the
measured gene expression level with a standard TNFR gene expression level,
whereby an increase or decrease in the gene expression level compared to the
standard is indicative of an immune system disorder.
In particular, it is believed that certain tissues in mammals with cancer
(e.g., colon, breast and lung cancers) have elevated copy numbers of TNFR
genes and/or express significantly elevated levels of the TNFR protein and
mRNA encoding the TNFR when compared to a corresponding "standard"
level. Further, it is believed that elevated levels of the TNFR protein can be
detected in certain cells or body fluids (e.g., sera and plasma) from mammals
with such a cancer when compared to sera from mammals of the same species
not having the cancer.
Thus, the invention provides a diagnostic method useful during
diagnosis of an immune system disorder, including cancers which involves
measuring the expression level of the gene encoding the TNFR protein in



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
156
immune system tissue or other cells or body fluid from an individual and
comparing the measured gene expression level with a standard TNFR gene
expression level, whereby an increase or decrease in the gene expression level
compared to the standard is indicative of an immune system disorder.
Where a diagnosis of a disorder in the immune system including
diagnosis of a tumor has already been made according to conventional methods,
the present invention is useful as a prognostic indicator, whereby patients
exhibiting depressed gene expression will experience a worse clinical outcome
relative to patients expressing the gene at a level nearer the standard level.
By "assaying the expression level of the gene encoding a TNFR
protein" is intended qualitatively or quantitatively measuring or estimating
the
level of the TNFR-6a and/or TNFR-6~3 protein or the level of the mRNA
encoding the TNFR-6a and/or TNFR-6(3 protein in a first biological sample
either directly (e.g., by determining or estimating absolute protein level or
mRNA level) or relatively (e.g., by comparing to the TNFR protein level or
mRNA level in a second biological sample). Preferably, the TNFR protein
level or mRNA level in the first biological sample is measured or estimated
and
compared to a standard TNFR protein level or mRNA level, the standard being
taken from a second biological sample obtained from an individual not having
2o the disorder or being determined by averaging levels from a population of
individuals not having a disorder of the immune system. As will be
appreciated in the art, once standard TNFR protein levels or mRNA levels are
known, they can be used repeatedly as a standard for comparison.
By "biological sample" is intended any biological sample obtained from
an individual, body fluid, cell line, tissue culture, or other source which
contains TNFR protein or mRNA. As indicated, biological samples include
body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid)
which
contain free extracellular domains) (or soluble form(s)) of a TNFR protein,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
157
immune system tissue, and other tissue sources found to express complete
TNFR, mature TNFR, or extracellular domain of a TNFR. Methods for
obtaining tissue biopsies and body fluids from mammals are well known in the
art. Where the biological sample is to include mRNA, a tissue biopsy is the
preferred source.
The invention also contemplates the use of a gene of the present
invention for diagnosing mutations in a TNFR gene. For example, if a
mutation is present in one of the genes of the present invention, conditions
would result from a lack of production of the receptor polypeptides of the
present invention. Further, mutations which enhance receptor polypeptide
activity would lead to diseases associated with an over expression of the
receptor polypeptide, e.g., cancer. Mutations in the genes can be detected by
comparing the sequence of the defective gene with that of a normal one.
Subsequently one can verify that a mutant gene is associated with a disease
condition or the susceptibility to a disease condition. That is, a mutant gene
which leads to the underexpression of the receptor polypeptides of the
present invention would be associated with an inability of TNFR to inhibit
Fas ligand and/or AIM-II mediated apoptosis, and thereby result in irregular
cell proliferation (e.g., tumor growth).
2o Other immune system disorders which may be diagnosed by the
foregoing assays include, but are not limited to, hypersensitivity, allergy,
infectious disease, graft-host disease, Immunodificiency, autoimmune diseases
and the like.
Individuals carrying mutations in the genes of the present invention
may be detected at the DNA level by a variety of techniques. Nucleic acids
used for diagnosis may be obtained from a patient's cells, such as from blood,
urine, saliva and tissue biopsy among other tissues. The genomic DNA may
be used directly for detection or may be amplified enzymatically by using
PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis. RNA or



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
158
cDNA may also be used for the same purpose. As an example, PCR primers
complementary to the nucleic acid of the instant invention can be used to
identify and analyze mutations in the human genes of the present invention.
For example, deletions and insertions can be detected by a change in the size
of
the amplified product in comparison to the normal genotype. Point mutations
can be identified by hybridizing amplified DNA to radiolabeled RNA or
alternatively, radiolabeled antisense DNA sequences of the present invention.
Perfectly matched sequences can be distinguished from mismatched duplexes
by RNase A digestion or by differences in melting temperatures. Such a
l0 diagnostic would be particularly useful for prenatal or even neonatal
testing.
Sequence differences between the reference gene and "mutants" may be
revealed by the direct DNA sequencing method. In addition, cloned DNA
segments may be used as probes to detect specific DNA segments. The
sensitivity of this method is greatly enhanced when combined with PCR. For
example, a sequencing primer used with double stranded PCR product or a
single stranded template molecule generated by a modified PCR product. The
sequence determination is performed by conventional procedures with
radiolabeled nucleotides or by automatic sequencing procedures with
fluorescent tags.
Sequence changes at the specific locations may be revealed by nuclease
protection assays, such as RNase and S 1 protection or the chemical cleavage
method (for example, Cotton et al., PNAS, 85:4397-4401 (1985)).
Assaying TNFR protein levels in a biological sample can occur using
antibody-based techniques. For example, TNFR protein expression in tissues
can be studied with classical immunohistological methods (Jalkanen, M., et
al.,
J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J. Cell . Biol.
105:3087-3096 (1987)). Other antibody-based methods useful for detecting
TNFR gene expression include immunoassays, such as the enzyme linked
immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
159
antibody assay labels are known in the art and include enzyme labels, such as,
glucose oxidase, and radioisotopes, such as iodine (l2sI,'Z~I), carbon ('4C),
sulfur (3sS), tritium (3H), indium ("ZIn), and technetium (99'~'Tc), and
fluorescent labels, such as fluorescein and rhodamine, and biotin.
In addition to assaying TNFR protein levels in a biological sample
obtained from an individual, TNFR proteins can also be detected in vivo by
imaging. Antibody labels or markers for in vivo imaging of TNFR proteins
include those detectable by X-radiography, NMR or ESR. For X-radiography,
suitable labels include radioisotopes such as barium or cesium; which emit
detectable radiation but are not overtly harmful to the subject. Suitable
markers for NMR and ESR include those with a detectable characteristic spin,
such as deuterium, which may be incorporated into the antibody by labeling of
nutrients for the relevant hybridoma.
A TNFR-specific antibody or antibody fragment which has been
labeled with an appropriate detectable imaging moiety , such as a radioisotope
(for example,'3'I, a2ln, 99m.Lc~ (~3~I~ ~zsl~ 123I~ ~Z~I), carbon ('4C),
sulfur (3sS),
tritium (3H), indium ("smln, 113mIn~ l lzln, ~ 1 ~ In), and technetium (99Tc,
99mTc),
thallium (2°'Ti), gallium (68Ga, 6~Ga), palladium ('°3Pd),
molybdenum (99Mo),
xenon ('33Xe), fluorine ('aF),'s3Sm, mLu, ~s9Gd, 149Pm, ~4oLa, ms~,b~ 166Ho,
9°Y, 4~Sc,'$6Re,'$BRe,'42Pr,'osRh, 9~Ru), a radio-opaque substance, or
a
material detectable by nuclear magnetic resonance, is introduced (for example,
parenterally, subcutaneously or intraperitoneally) into the mammal to be
examined for immune system disorder. It will be understood in the art that the
size of the subject and the imaging system used will determine the quantity of
imaging moiety needed to produce diagnostic images. In the case of a
radioisotope moiety, for a human subject, the quantity of radioactivity
injected
will normally range from about 5 to 20 millicuries of 99mTc. The labeled
antibody or antibody fragment will then preferentially accumulate at the
location of cells which contain Neutrokine-alpha protein. In vivo tumor



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
160
imaging is described in S.W. Burchiel et al., "Immunopharmacokinetics of
Radiolabeled Antibodies and Their Fragments" (Chapter 13 in Tumor
Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A.
Rhodes, eds., Masson Publishing Inc. ( 1982)).
Treatment
The Tumor Necrosis Factor (TNF) family ligands are known to be
among the most pleiotropic cytokines, inducing a large number of cellular
responses, including cytotoxicity, anti-viral activity, immunoregulatory
l0 activities, and the transcriptional regulation of several genes (Goeddel,
D.V. et
al., "Tumor Necrosis Factors: Gene Structure and Biological Activities,"
Symp. Quant. Biol. 51:597-609 (1986), Cold Spring Harbor; Beutler, B., and
Cerami, A., Annu. Rev. Biochem. 57:505-518 (1988); Old, L.J., Sci. Am.
258:59-75 (1988); Fiers, W., FEBSLett. 285:199-224 (1991)). The TNF-
family ligands induce such various cellular responses by binding to TNF-
family receptors.
TNFR-6 alpha and/or TNFR-6 beta polynucleotides and polypeptides
of the invention may be used in developing treatments for any disorder
mediated (directly or indirectly) by defective, or insufficient amounts of
TNFR-6 alpha and/or TNFR-6 beta . TNFR-6 alpha and/or TNFR-6 beta
polypeptides may be administered to a patient (e.g., mammal, preferably
human) afflicted with such a disorder. Alternatively, a gene therapy approach
may be applied to treat such disorders. Disclosure herein of TNFR-6 alpha
and/or TNFR-6 beta nucleotide sequences permits the detection of defective
TNFR-6 alpha and/or TNFR-6 beta genes, and the replacement thereof with
normal TNFR-6 alpha and/or TNFR-6 beta -encoding genes. Defective genes
may be detected in in vitro diagnostic assays, and by comparison of a TNFR-6
alpha and/or TNFR-6 beta nucleotide sequence disclosed herein with that of a



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
161
TNFR-6 alpha and/or TNFR-6 beta gene derived from a patient suspected of
harboring a defect in this gene.
In another embodiment, the polypeptides of the present invention are
used as a research tool for studying the biological effects that result from
inhibiting Fas ligand/TNFR-6 alpha and/or TNFR-6 beta and/or AIM-II
interactions on different cell types. TNFR-6 alpha and/or TNFR-6 beta
polypeptides also may be employed in in vitro assays for detecting Fas ligand,
AIM-II, or TNFR-6 alpha and/or TNFR-6 beta or the interactions thereof.
In another embodiment, a purified TNFR-6 alpha and/or TNFR-6 beta
to polypeptide of the invention is used to inhibit binding of Fas ligand
and/or
AIM-II to endogenous cell surface Fas ligand and/or AIM-II receptors. Certain
ligands of the TNF family (of which Fas ligand and AIM-II are members) have
been reported to bind to more than one distinct cell surface receptor protein.
AIM-II likewise is believed to bind multiple cell surface proteins. By binding
Fas ligand and/or AIM-II, soluble TNFR-6 alpha and/or TNFR-6 beta
polypeptides of the present invention may be employed to inhibit the binding
of Fas ligand and/or AIM-II not only to endogenous TNFR-6 alpha and/or
TNFR-6 beta, but also to Fas ligand and AIM-II receptor proteins that are
distinct from TNFR-6 alpha and/or TNFR-6 beta. Thus, in another
embodiment, TNFR-6 alpha andlor TNFR-6 beta is used to inhibit a biological
activity of Fas ligand and/or AIM-II, in in vitro or in vivo procedures. By
inhibiting binding of Fas ligand and/or AIM-II to cell surface receptors, TNFR-

6 alpha and/or TNFR-6 beta polypeptides of the invention also inhibit
biological effects that result from the binding of Fas ligand and/or AIM-II to
endogenous receptors. Various forms of TNFR-6 alpha and/or TNFR-6 beta
may be employed, including, for example, the above-described TNFR-6 alpha
and/or TNFR-6 beta fragments, derivatives, and variants that are capable of
binding Fas ligand and/or AIM-II. In a preferred embodiment, a soluble TNFR-
6 alpha and/or TNFR-6 beta polypeptide of the invention is administered to



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
162
inhibit a biological activity of Fas ligand and/or AIM-II, e.g., to inhibit
Fas
ligand-mediated and/or AIM-II-mediated apoptosis of cells susceptible to such
apoptosis.
In a further embodiment, a TNFR-6 alpha and/or TNFR-6 beta
polypeptide of the invention is administered to a mammal to treat a Fas ligand-

mediated and/or AIM-II-mediated disorder. Such Fas ligand-mediated and/or
AIM-II-mediated (e.g., a human) disorders include conditions caused (directly
or indirectly) or exacerbated by Fas ligand and/or AIM-II.
Cells which express a TNFR polypeptide and have a potent cellular
to response to TNFR-6a and TNFR-6(3 ligands include lymphocytes, endothelial
cells, keratinocytes, and prostate tissue. By "a cellular response to a TNF-
family ligand" is intended any genotypic, phenotypic, and/or morphologic
change to a cell, cell line, tissue, tissue culture or patient that is induced
by a
TNF-family ligand. As indicated, such cellular responses include not only
normal physiological responses to TNF-family ligands, but also diseases
associated with increased apoptosis or the inhibition of apoptosis.
Additionally, as described herein, TNFR polypeptides of the invention bind
Fas ligand and AIM-II and consequently block Fas ligand and AIM-II
mediated apoptosis. Apoptosis-programmed cell death is a physiological
2o mechanism involved in the deletion of B and/or T lymphocytes of the immune
system, and its disregulation can lead to a number of different pathogenic
processes (J.C. Ameisen AIDS 8:1197-1213 (1994); P.H. Kramner et al., Curr.
Opin. Immunol. 6:279-289 (1994)).
Diseases associated with increased cell survival, or the inhibition of
apoptosis, include cancers (such as follicular lymphomas, carcinomas with p53
mutations, and hormone-dependent tumors, including, but not limited to colon
cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma,
glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach
cancer,
neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
163
osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer,
prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune disorders
(such as, multiple sclerosis, Sjogren's syndrome, Grave's disease, Hashimoto's
thyroiditis, autoimmune diabetes, biliary cirrhosis, Behcet's disease, Crohn's
disease, polymyositis, systemic lupus erythematosus and immune-related
glomerulonephritis (e.g., proliferative glomerulonephritis), autoimmune
gastritis, autoimmune thrombocytopenic purpura, and rheumatoid arthritis)
and viral infections (such as herpes viruses, pox viruses and adenoviruses),
inflammation, graft vs. host disease (acute and/or chronic), acute graft
rejection,
to and chronic graft rejection. In preferred embodiments, TNFR
polynucleotides,
polypeptides, and/or antagonists of the invention are used to inhibit growth,
progression, and/or metastasis of cancers, in particular those listed above.
Additional diseases or conditions associated with increased cell survival
include, but are not limited to, progression, and/or metastases of
malignancies
and related disorders such as leukemia (including acute leukemias (e.g., acute
lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic,
promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and
chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and
chronic
lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's
disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's
macroglobulinemia, heavy chain disease, and solid tumors including, but not
limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma,
liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma,
endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma,
synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma,
rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian
cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma,
adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
164
carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct
carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor,
cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma,
bladder carcinoma, epithelial carcinoma, glioma, astrocytoma,
medulloblastoma, craniopharyngioma, ependymoma, pinealoma,
hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma,
melanoma, neuroblastoma, and retinoblastoma.
Diseases associated with increased apoptosis include AIDS;
neurodegenerative disorders (such as Alzheimer's disease, Parkinson's disease,
Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration
and brain tumor or prior associated disease); autoimmune disorders (such as,
multiple sclerosis, Sjogren's syndrome, Grave's disease Hashimoto's
thyroiditis, autoimmune diabetes, biliary cirrhosis, Behcet's disease, Crohn's
disease, polymyositis, systemic lupus erythematosus, immune-related
glomerulonephritis (e.g., proliferative glomerulonephritis), autoimmune
gastritis, thrombocytopenic purpura, and rheumatoid arthritis)
myelodysplastic syndromes (such as aplastic anemia), graft vs. host disease
(acute and/or chronic), ischemic injury (such as ischemic cardiac injury and
that caused by myocardial infarction, stroke and reperfusion injury), liver
injury or disease (e.g., hepatitis related liver injury, cirrhosis,
ischemia/reperfusion injury, cholestosis (bile duct injury) and liver cancer);
toxin-induced liver disease (such as that caused by alcohol), septic shock,
ulcerative colitis, cachexia and anorexia. In preferred embodiments, TNFR
polynucleotides, polypeptides and/or agonists are used to treat or prevent the
diseases and disorders listed above.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used to treat and/or prevent glomerulonephritis.
In a further embodiment, TNFR polynucleotides, polypeptides, or agonists of
the invention are used to treat and/or prevent chronic glomerulonephritis



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
165
and/or cell/tissue damage (e.g., glomerular cell death) and/or medical
conditions
associated with this disease. In a further nonexclusive embodiment, TNFR
polynucleotides, polypeptides, or agonists of the invention are used to treat
and/or prevent proliferative glomerulonephritis and/or cell/tissue damage
(e.g.,
glomerular cell death) and/or medical conditions associated with this disease.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used treat or prevent biliary cirrhosis and/or
medical conditions associated with this disease.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used treat or prevent disease, such as, for
example, alcoholic liver disease and/or medical conditions associated with
this
disease (e.g., cirrhosis).
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used to treat and/or prevent graft vs host
disease
In a specific embodiment TNFR polynucleotides, polypeptides, or agonists of
the invention are used to treat (e.g., reduce) or prevent tissue or cell
damage or
destruction (e.g., lymphoid cell depletion associated with graft vs host
disease)
and/or other medical conditions associated with this disease. In another non
exclusive specific embodiment, the TNFR polynucleotides, polypeptides, or
agonists of the invention are used to treat (e.g., reduce) and/or prevent
diarrhea
during graft vs host disease.
In a specific embodiment, TNFR polynucleotides, polypeptides,
and/or agonists or antagonists of the invention are used to treat and/or
prevent
Sjogren's diesease and/or to reduce tissue/cell damage or destruction (e.g.,
damage or destruction of salivary and/or lacrimal tissues) and/or other
medical
conditions associated with this disease.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used to treat and/or prevent multiple sclerosis
and/or to reduce tissue damage or destruction (such as, for example,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
166
neurological tissue (e.g., CNS tissue) damage or destruction) and/or lesions
or
other medical conditions associated with this disease.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists, including antibody and antibody fragments, of the invention are used
to treat and/or prevent Alzheimer's disease and/or to reduce tissue damage or
destruction (e.g., damage or destruction of neurological tissue or cells)
and/or
medical conditions associated with this disease.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used to treat, prevent Parkinson's disease
and/or
to reduce tissue damage or destruction (e.g., damage or destruction of
neurological tissue or cells, such as, for example neuronal cells) and/or
medical
conditions associated with this disease.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used before, during, immediately after, and/or
after a stroke to treat, prevent, or reduce damage of cells or tissue (such
as, for
example, neurological tissue) and/or medical conditions associated with
stroke.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used to treat, prevent, or reduce ischemic
injury
(such as, for example, ischemic cardiac injury) and/or medical conditions
associated with ischemic injury. In a specific embodiment, TNFR
polynucleotides, polypeptides, or agonists of the invention are used before,
during, immediately after, and/or after a heart attack to treat, prevent, or
reduce
ischemic cardiac injury.
In another specific embodiment, TNFR polynucleotides, polypeptides,
and/or agonists of the invention are used to treat or prevent myelodysplastic
syndromes (MDS) and/or medical conditions associated with MDS.
In another specific embodiment, TNFR polynucleotides, polypeptides,
or agonists of the invention are used to increase circulating blood cell
numbers
in patients suffering from cytopenia, lymphopenia and/or anemia.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
167
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used to treat and/or prevent Hashimoto's
thyroiditis and/or to reduce destruction or damage of tissue or cells (e.g.,
thyroid gland) and/or to treat or prevent medical conditions associated with
this disease.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used to treat (e.g., reduce) and/or prevent
autoimmune gastritis and/or medical conditions associated with this disease.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used to treat and/or prevent ulcerative colitis
and/or cell/tissue damage (e.g., ulceration in the colon) and/or medical
conditions associated with this disease.
In a specific embodiment, TNFR polynucleotides, polypeptides,
and/or agonists or antagonists of the invention are used to treat and/or
prevent
rheumatoid arthritis and/or medical conditions associated with this disease.
Additionally, a number of cancers secrete Fast which binds Fas
positive T cells and kills them. Any cancer which expresses Fast could
therefor be a target for treatment by TNFR and TNFR agonists of the
invention. Such cancers include, but are not limited to, malignant myeloma,
leukemia and lymphoma.
Many of the pathologies associated with HIV are mediated by
apoptosis, including HIV-induced nephropathy and HIV encephalitis. Thus,
in additional preferred embodiments, TNFR polynucleotides, polypeptides,
and/or TNFR agonists of the invention are used to treat or prevent AIDS and
pathologies associated with AIDS. Another embodiment of the present
invention is directed to the use of TNFR-6 alpha and/or TNFR-6 beta to
reduce Fas ligand and/or AIM-II-mediated death of T cells in HIV-infected
patients.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
168
The state of Immunodificiency that defines AIDS is secondary to a
decrease in the number and function of CD4+ T-lymphocytes. Recent reports
estimate the daily loss of CD4+ T cells to be between 3.5 X 10' and 2 X 109
cells (Wei X., et al., Nature 373:117-122 (1995)). One cause of CD4+ T cell
depletion in the setting of HIV infection is believed to be HIV-induced
apoptosis (see, for example, Meyaard et al., Science 257:217-219, (1992);
Groux et al., J Exp. Med., 175:331, (1992); and Oyaizu et al., in Cell
Activation
and Apoptosis in HIV Infection, Andrieu and Lu, Eds., Plenum Press, New
York, 1995, pp. 101-114). Indeed, HIV-induced apoptotic cell death has been
demonstrated not only in vitro but also, more importantly, in infected
individuals (Ameisen, J.C., AIDS 8:1197-1213 (1994) ; Finkel, T.H., and
Banda, N.K., Curr. Opin. Immunol. 6:605-615(1995); Muro-Cacho, C.A. et
al., J. Immunol. 154:5555-5566 (1995)). Furthermore, apoptosis and CD4+ T-
lymphocyte depletion is tightly correlated in different animal models of AIDS
(Brunner, T., et al., Nature 373:441-444 (1995); Gougeon, M.L., et al., AIDS
Res. Hum. Retroviruses 9:553-563 (1993)) and, apoptosis is not observed in
those animal models in which viral replication does not result in AIDS
(Gougeon, M.L. et al., AIDSRes. Hum. Retroviruses 9:553-563 (1993)).
Further data indicates that uninfected but primed or activated T lymphocytes
from HIV-infected individuals undergo apoptosis after encountering the Fas
Ligand. Using monocytic cell lines that result in death following HIV
infection,
it has been demonstrated that infection of U937 cells with HIV results in the
de novo expression of Fas ligand and that Fas ligand mediates HIV-induced
apoptosis (Badley, A.D. et al., J. Virol. 70:199-206 (1996)). Further the
TNF-family ligand was detectable in uninfected macrophages and its
expression was upregulated following HIV infection resulting in selective
killing of uninfected CD4 T-lymphocytes (Badley, A.D et al., J. Virol. 70:199-
206 (1996)). Further, additional studies have implicated Fas-mediated



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
169
apoptosis in loss of T cells in HIV individuals (Katsikis et al., J. Exp. Med.
181:2029-2036, 1995).
Thus, by the invention, a method for treating HIV+ individuals is
provided which involves administering TNFR and/or TNFR agonists of the
present invention to reduce selective killing of CD4 T-lymphocytes. Modes
of administration and dosages are discussed in detail below.
It is also possible that T cell apoptosis occurs through multiple
mechanisms. Further at least some of the T cell death seen in HIV patients
may be mediated by AIM-II. While not wishing to be bound by theory, such
Fas ligand and/or AIM-II-mediated T cell death is believed to occur through
the mechanism known as activation-induced cell death (AICD).
Activated human T cells are induced to undergo programmed cell death
(apoptosis) upon triggering through the CD3/T cell receptor complex, a
process termed activated-induced cell death (AICD). AICD of CD4 T cells
isolated from HIV-Infected asymptomatic individuals has been reported
(Groux et al., supra). Thus, AICD may play a role in the depletion of CD4+ T
cells and the progression to AIDS in HIV-infected individuals. Thus, the
present invention provides a method of inhibiting Fas ligand-mediated and/or
AIM-II-mediated T cell death in HIV patients, comprising administering a
TNFR-6 alpha and/or TNFR-6 beta polypeptide of the invention to the
patients. In one embodiment, the patient is asymptomatic when treatment
with TNFR-6 alpha and/or TNFR-6 beta commences. If desired, prior to
treatment, peripheral blood T cells may be extracted from an HIV patient, and
tested for susceptibility to Fas ligand-mediated and/or AIM-II-mediated cell
death by conventional procedures. In one embodiment, a patient's blood or
plasma is contacted with TNFR-6 alpha and/or TNFR-6 beta ex vivo. The
TNFR-6 alpha and/or TNFR-6 beta may be bound to a suitable
chromatography matrix known in the art by conventional procedures. The
patient's blood or plasma flows through a chromatography column containing



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
170
TNFR-6 alpha and/or TNFR-6 beta polypeptides of the invention bound to
the matrix, before being returned to the patient. The immobilized TNFR-6
alpha and/or TNFR-6 beta binds Fas ligand and/or AIM-II, thus removing Fas
ligand and/or AIM-II protein from the patient's blood.
In additional embodiments a TNFR-6 alpha and/or TNFR-6 beta
polypeptide of the invention may be administered in combination with other
inhibitors of T cell apoptosis. For example, at least some of the T cell death
seen in HIV patients is believed to be mediated by TRAIL (International
application publication number WO 97/01633 hereby incorporated by
reference). Thus, for example, a patient susceptible to both Fas ligand
mediated and TRAIL mediated T cell death may be treated with both an agent
that blocks TRAIL/TRAIL-receptor interactions and an agent that blocks
Fas-ligand/Fas interactions. Suitable agents that may be administered with the
polynucleotides and/or polypeptides of the invention to block binding of
TRAIL to TRAIL receptors include, but are not limited to, soluble TRAIL
receptor polypeptides (e.g., a soluble form of OPG, DR4 (International
application publication number WO 98/32856); TR5 (International application
publication number WO 98/30693); DR5 (International application publication
number WO 98/41629); TR10 (International application publication number
WO 98/54202)); multimeric forms of soluble TRAIL receptor polypeptides;
and TRAIL receptor antibodies that bind the TRAIL receptor without
transducing the biological signal that results in apoptosis, anti-TRAIL
antibodies that block binding of TRAIL to one or more TRAIL receptors, and
muteins of TRAIL that bind TRAIL receptors but do not transduce the
biological signal that results in apoptosis. Preferably, the antibodies
employed
according to this method are monoclonal antibodies.
Suitable agents, which also block binding of Fas-ligand to Fas that may
be administered with the polynucleotides and polypeptides of the present
invention include, but are not limited to, soluble Fas polypeptides;
multimeric



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
171
forms of soluble Fas polypeptides (e.g., dimers of sFas/Fc); anti-Fas
antibodies that bind Fas without transducing the biological signal that
results in
apoptosis; anti-Fas-ligand antibodies that block binding of Fas-ligand to Fas;
and muteins of Fas-ligand that bind Fas but do not transduce the biological
signal that results in apoptosis. Examples of suitable agents for blocking
Fas-L/Fas interactions, including blocking anti-Fas monoclonal antibodies, are
described in International application publication number WO 95/10540,
hereby incorporated by reference.
Suitable agents that may be administered with the polynucleotides
to and/or polypeptides of the invention to block binding of AIM-II to AIM-II
receptors include, but are not limited to, soluble AIM-II receptor
polypeptides (e.g., a soluble form of TR2 (International application
publication number WO 96/34095); LT beta receptor; and TR8 (International
application publication number WO 98/54201 )); multimeric forms of soluble
AIM-II receptor polypeptides; and AIM-II receptor antibodies that bind the
AIM-II receptor without transducing the biological signal that results in
apoptosis, anti-AIM-II antibodies that block binding of AIM-II to one or
more AIM-II receptors, and muteins of AIM-II that bind AIM-II receptors
but do not transduce the biological signal that results in apoptosis.
Preferably,
2o the antibodies employed according to this method are monoclonal antibodies.
In rejection of an allograft, the immune system of the recipient animal
has not previously been primed to respond because the immune system for the
most part is only primed by environmental antigens. Tissues from other
members of the same species have not been presented in the same way that,
for example, viruses and bacteria have been presented. In the case of
allograft
rejection, immunosuppressive regimens are designed to prevent the immune
system from reaching the effector stage. However, the immune profile of
xenograft rejection may resemble disease recurrence more than allograft
rejection. In the case of disease recurrence, the immune system has already



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
172
been activated, as evidenced by destruction of the native islet cells.
Therefore,
in disease recurrence the immune system is already at the effector stage.
Antagonists of the present invention are able to suppress the immune
response to both allografts and xenografts because lymphocytes activated and
differentiated into effector cells will express the TNFR polypeptide, and
thereby are susceptible to compounds which enhance TNFR activity. Thus,
the present invention further provides a method for creating immune privileged
tissues. Antagonist of the invention can further be used in the treatment of
Inflammatory Bowel-Disease.
to TNFR polynucleotides, polypeptides, and agonists of the invention
may also be used to suppress immune responses. In one embodiment, the
TNFR polynucleotides, polypeptides, and agonists of the invention are used
to minimize untoward effects associated with transplantation. In a specific
embodiment, the TNFR polynucleotides, polypeptides, and agonists of the
invention are used to suppress Fas mediated immune responses (e.g., in a
manner similar to an immunosuppressant such as, for example, rapamycin or
cyclosporin). In another specific embodiment, the TNFR polynucleotides,
polypeptides, and agonists of the invention are used to suppress AIM-II
mediated immune responses.
2o Additionally, both graft rejection and graft vs. host disease are in part
triggered by apoptosis. Accordingly, an additional preferred embodiment,
TNFR polynucleotides, polypeptides, and/or TNFR agonists of the invention
are used to treat and prevent and/or reduce graft rejection. In a further
preferred embodiment, TNFR polynucleotides, polypeptides, and/or TNFR
agonists of the invention are used to treat and prevent and/or reduce graft
vs.
host disease.
Additionally, TNFR-6 alpha and/or TNFR-6 beta polypeptides,
polynucleotides, and/or agonists may be used to treat or prevent graft
rejection (e.g., xenograft and allograft rejection (e.g, acute allograft
rejection))



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
173
and/or medical conditions associated with graft rejection. In a specific
embodiment, TNFR-6 alpha and/or TNFR-6 beta polypeptides,
polynucleotides, and/or agonists of the invention are used to treat or prevent
acute allograft rejection and/or medical conditions associated with acute
allograft rejection. In a further specific embodiment, TNFR-6 alpha and/or
TNFR-6 beta polypeptides, polynucleotides, and/or agonists of the invention
are used to treat or prevent acute allograft rejection of a kidney and/or
medical
conditions associated with acute allograft rejection of a kidney.
Fas ligand is a type II membrane protein that induces apoptosis by
to binding to Fas. Fas ligand is expressed in activated T cells, and works as
an
effector of cytotoxic lymphocytes. Molecular and genetic analysis of Fas and
Fas ligand have indicated that mouse lymphoproliferation mutation (lpr) and
generalized lymphoproliferative disease (gld) are mutations of Fas and Fas
ligand respectively. The lpr of gld mice develop lymphadenopathy, and suffer
from autoimmune disease. Based on these phenotypes and other studies, it is
believed that the Fas system is involved in the apoptotic process during T-
cell
development, specifically peripheral clonal deletion or activation-induced
suicide of mature T cells. In addition to the activated lymphocytes, Fas is
expressed in the liver, heart and lung. Administration of agonistic anti-Fas
antibody into mice has been shown to induce apoptosis in the liver and to
quickly kill the mice, causing liver damage. These findings indicate that the
Fas
system plays a role not only in the physiological process of lymphocyte
development, but also in the cytotoxic T-lymphocyte-mediated disease such
as fulminant hepatitis and/or hepatitis resulting from viral infection or
toxic
agents. As discussed herein, TNFR-6 alpha and/or TNFR-6 beta binds Fas
ligand, and thus functions as an antagonist of Fas-ligand mediated activity.
Accordingly, the TNFR-6 alpha and/or TNFR-6 beta polypeptides and/or
polynucleotides of the invention, and/or agonists thereof, may be used to
treat
or prevent lymphoproliferative disorders (e.g., lymphadenopathy and others



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
174
described herein), autoimmune disorders (e.g., autoimmune diabetes, systemic
lupus
erythematosus, Grave's disease, Hashimoto's thyroiditis, immune-related
glomerulonephritis, autoimmune gastritis, autoimmune thrombocytopenic
purpura, multiple sclerosis, rheumatoid arthritis, and others described
herein),
and/or liver disease (e.g., acute and chronic hepatitis, and cirrhosis).
In a specific embodiment TNFR polynucleotides, polypeptides, and/or
agonists or antagonists of the invention is used to treat or prevent hepatitis
and/or tissue/cell damage or destruction and/or medical conditions associated
with hepatitis. In a specific embodiment TNFR polynucleotides,
polypeptides, and/or agonists or antagonists of the invention is used to treat
or
prevent fulminant hepatitis and/or medical conditions associated with
fulminant hepatitis.
In a specific embodiment TNFR polynucleotides, polypeptides, and/or
agonists or antagonists of the invention is used to treat or prevent systemic
lupus erythematosus (SLE) and/or tissue/cell damage or destruction and/or
medical conditions associated with SLE. In a further specific embodiment,
TNFR polynucleotides, polypeptides, and/or agonists or antagonists of the
invention are used to treat or prevent skin lesions in SLE patients.
In a specific embodiment, TNFR polynucleotides, polypeptides,
and/or agonists or antagonists of the invention is used to treat or prevent
insulin-dependent diabetes mellitus and/or tissue/cell damage or destruction
and/or medical conditions associated with insulin-dependent diabetes mellitus.
In a further specific embodiment, TNFR polynucleotides, polypeptides,
and/or agonists or antagonists of the invention are prior to, during, or
immediately after the onset of diabetes to reduce or prevent damage to islet
cells and/or to reduce exogenous insulin requirement.
In a specific embodiment TNFR polynucleotides, polypeptides, and/or
agonists or antagonists of the invention is used to treat or prevent toxic



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
175
epidermal necrolysis (TEN) and/or tissue/cell damage or destruction, and/or
medical conditions associated with TEN. In a further specific embodiment,
TNFR polynucleotides, polypeptides, and/or agonists or antagonists of the
invention is used to treat or prevent Lyell's syndrome.
Hepatitis virus (e.g., Hepatitis B virus and Hepatitis C virus) is a
major causative agent of chronic liver disease. In Hepatitis infection, Fas
expression in hepatocytes is up-regulated in accordance with the severity of
liver inflammation. When Hepatitis virus-specific T cells migrate into
hepatocytes and recognize the viral antigen via the T cell receptor, they
to become activated and express Fas ligand that can transduce the apoptotic
death
signal to Fas-bearing hepatocytes. Thus, the Fas system plays an important
role in liver cell injury by viral hepatitis. Accordingly, in specific
embodiments, the TNFR-6 alpha and/or TNFR-6 beta polypeptides and/or
polynucleotides of the invention and/or agonists or antagonists thereof, are
used to treat or prevent hepatitis resulting from viral infection (e.g.,
infection
resulting form Hepatitis B virus or Hepatitis C virus infection). In one
embodiment, a patient's blood or plasma is contacted with TNFR-6 alpha
and/or TNFR-6 beta polypeptides of the invention ex vivo. The TNFR-6
alpha and/or TNFR-6 beta may be bound to a suitable chromatography matrix
by conventional procedures. According to this embodiment, the patient's
blood or plasma flows through a chromatography column containing TNFR-6
alpha and/or TNFR-6 beta bound to the matrix, before being returned to the
patient. The immobilized TNFR-6 alpha and/or TNFR-6 beta binds Fas-
ligand, thus removing Fas-ligand protein from the patient's blood.
In a specific embodiment, TNFR-6 alpha and/or TNFR-6 beta
polypeptides, polynucleotides, and/or agonists or antagonists of the invention
may be used to treat or prevent renal failure (e.g., chronic renal failure),
and/or
tissue/cell damage or destruction (e.g., tubular epithelial cell deletion)
and/or
medical conditions associated with renal failure.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
176
In a specific embodiment, TNFR-6 alpha and/or TNFR-6 beta
polypeptides, polynucleotides, and/or agonists or antagonists of the invention
may be used to regulate (i.e., stimulate or inhibit) bone growth. In specific
embodiments TNFR-6 alpha and/or TNFR-6 beta polypeptides,
polynucleotides, and/or agonists or antagonists of the invention are used to
stimulate bone growth. Specific diseases or conditions that may be treated or
prevented with the compositions of the invention include, but are not limited
to, bone fractures, and defects, and disorders which result in weakened bones
such as osteoporosis, osteomalacia, and age-related loss of bone mass.
l0 TNFR-6 alpha and/or TNFR-6 beta polypeptides or polynucleotides
encoding TNFR-6 alpha and/or TNFR-6 beta of the invention, and/or agonists
or antagonists thereof may be used to treat or prevent cardiovascular
disorders,
including peripheral artery disease, such as limb ischemia.
Cardiovascular disorders include cardiovascular abnormalities, such as
arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous
malformations, congenital heart defects, pulmonary atresia, and Scimitar
Syndrome. Congenital heart defects include aortic coarctation, cor
triatriatum,
coronary vessel anomalies, crisscross heart, dextrocardia, patent ductus
arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left heart
syndrome, levocardia, tetralogy of fallot, transposition of great vessels,
double
outlet right ventricle, tricuspid atresia, persistent truncus arteriosus, and
heart
septal defects, such as aortopulmonary septal defect, endocardial cushion
defects, Lutembacher's Syndrome, trilogy of Fallot, ventricular heart septal
defects.
Cardiovascular disorders also include heart disease, such as
atherosclerosis, arrhythmias, carcinoid heart disease, high cardiac output,
low
cardiac output, cardiac tamponade, endocarditis (including bacterial), heart
aneurysm, cardiac arrest, congestive heart failure (e.g., chronic congestive
heart
failure), congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
177
heart hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy,
right ventricular hypertrophy, post-infarction heart rupture, ventricular
septal
rupture, heart valve diseases, myocardial diseases, myocardial ischemia,
pericardial effusion, pericarditis (including constrictive and tuberculous),
pneumopericardium, postpericardiotomy syndrome, pulmonary fibrosis,
pulmonary heart disease, rheumatic heart disease, ventricular dysfunction,
hyperemia, cardiovascular pregnancy complications, Scimitar Syndrome,
cardiovascular syphilis, and cardiovascular tuberculosis.
In a specific embodiment, TNFR-6 alpha and/or TNFR-6 beta
to polynucleotides, polypeptides, or agonists of the invention may be used to
treat and/or prevent chronic congestive heart failure and/or medical
conditions
associated chronic congestive heart failure.
In another specific embodiment, TNFR-6 alpha and/or TNFR-6 beta
polynucleotides, polypeptides, or agonists of the invention may be used to
treat and/or prevent pulmonary injury or disease (e.g., pulmonary fibrosis and
chronic obstructive pulmonary diseases, such as, for example, emphysema and
chronic bronchitis), and/or tissue/cell damage or destruction (e.g., alveolar
wall
and/or bronchiolar wall destruction) and/or medical conditions associated with
pulmonary injury or disease.
Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter,
bradycardia, extrasystole, Adams-Stokes Syndrome, bundle-branch block,
sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine
Syndrome, Mahaim-type pre-excitation syndrome, Wolff Parkinson-White
syndrome, sick sinus syndrome, tachycardias, and ventricular fibrillation.
Tachycardias include paroxysmal tachycardia, supraventricular tachycardia,
accelerated idioventricular rhythm, atrioventricular nodal reentry
tachycardia,
ectopic atrial tachycardia, ectopic functional tachycardia, sinoatrial nodal
reentry tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular
tachycardia.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
178
Heart valve disease include aortic valve insufficiency, aortic valve
stenosis, hear murmurs, aortic valve prolapse, mural valve prolapse, tricuspid
valve prolapse, mitral valve insufficiency, mural valve stenosis, pulmonary
atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid
atresia, tricuspid valve insufficiency, and tricuspid valve stenosis.
Myocardial diseases include alcoholic cardiomyopathy, congestive
cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis,
pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas
cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns
to Syndrome, myocardial reperfusion injury, and myocarditis.
Myocardial ischemias include coronary disease, such as angina
pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis,
coronary vasospasm, myocardial infarction and myocardial stunning.
Cardiovascular diseases also include vascular diseases such as
aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-
Lindau Disease, Klippel-Trenaunay-Weber Syndrome, Sturge-Weber
Syndrome, angioneurotic edema, aortic diseases, Takayasu's Arteritis,
aortitis,
Leriche's Syndrome, arterial occlusive diseases, arteritis, enarteritis,
polyarteritis nodosa, cerebrovascular disorders, diabetic angiopathies,
diabetic
2o retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic
veno-occlusive disease, hypertension, hypotension, ischemia, peripheral
vascular diseases, phlebitis, pulmonary veno-occlusive disease, Raynaud's
disease, CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior
vena cava syndrome, telangiectasia, atacia telangiectasia, hereditary
hemorrhagic telangiectasia, varicocele, varicose veins, varicose ulcer,
vasculitis,
and venous insufficiency.
Aneurysms include dissecting aneurysms, false aneurysms, infected
aneurysms, ruptured aneurysms, aortic aneurysms, cerebral aneurysms,
coronary aneurysms, heart aneurysms, and iliac aneurysms.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
179
Arterial occlusive diseases include arteriosclerosis, intermittent
claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular
occlusion, Moyamoya disease, renal artery obstruction, retinal artery
occlusion, and thromboangiitis obliterans.
Cerebrovascular disorders include carotid artery diseases, cerebral
amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral
arteriosclerosis, cerebral arteriovenous malformation, cerebral artery
diseases,
cerebral embolism and thrombosis, carotid artery thrombosis, sinus
thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural hematoma,
1 o subdural hematoma, subaraxhnoid hemorrhage, cerebral infarction, cerebral
ischemia (including transient), subclavian steal syndrome, periventricular
leukomalacia, vascular headache, cluster headache, migraine, and
vertebrobasilar
insufficiency.
Embolisms include air embolisms, amniotic fluid embolisms, cholesterol
15 embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and
thromoboembolisms. Thromboses include coronary thrombosis, hepatic vein
thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus
thrombosis, Wallenberg's syndrome, and thrombophlebitis.
Ischemia includes cerebral ischemia, ischemic colitis, compartment
20 syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion
injuries, and peripheral limb ischemia. Vasculitis includes aortitis,
arteritis,
Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node
syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-
Henoch purpura, allergic cutaneous vasculitis, and Wegener's granulomatosis.
25 In one embodiment, TNFR-6 alpha and/or TNFR-6 beta polypeptides,
polynucleotides and/or agonists or antagonists of the invention are used to
treat or prevent thrombotic microangiopathies. One such disorder is
thrombotic thrombocytopenic purpura (TTP) (Kwaan, H.C., Semin. Hematol.
24:71 (1987); Thompson et al., Blood 80:1890 (1992)). Increasing



CA 02362929 2001-08-16
WO 00/52028 PCT/iJS00/05686
180
TTP-associated mortality rates have been reported by the U.S. Centers for
Disease Control (Torok et al., Am. J. Hematol. 50:84 (1995)). Plasma from
patients afflicted with TTP (including HIV+ and HIV- patients) induces
apoptosis of human endothelial cells of dermal microvascular origin, but not
large vessel origin (Laurence et al., Blood 87:3245 (1996)). Plasma of TTP
patients thus is thought to contain one or more factors that directly or
indirectly induce apoptosis. An anti-Fas blocking antibody has been shown to
reduce TTP plasma-mediated apoptosis of microvascular endothelial cells
(Lawrence et al., Blood 87:3245 ( 1996); hereby incorporated by reference).
1 o Accordingly, Fas ligand present in the serum of TTP patients is likely to
play
a role in inducing apoptosis of microvascular endothelial cells. Another
thrombotic microangiopathy is hemolytic-uremic syndrome (HUS) (Moake,
J.L., Lancet, 343:393, (1994); Melnyk et al., (Arch. Intern. Med., 155:2077,
(1995); Thompson et al., supra). Thus, in one embodiment, the invention is
directed to use of TNFR-6 alpha and/or TNFR-6 beta to treat or prevent the
condition that is often referred to as "adult HUS" (even though it can strike
children as well). A disorder known as childhood/diarrhea-associated HUS
differs in etiology from adult HUS. In another embodiment, conditions
characterized by clotting of small blood vessels may be treated using TNFR-6
2o alpha and/or TNFR-6 beta polypeptides and/or polynucleotides of the
invention. Such conditions include, but are not limited to, those described
herein. For example, cardiac problems seen in about 5-10% of pediatric AIDS
patients are believed to involve clotting of small blood vessels. Breakdown of
the microvasculature in the heart has been reported in multiple sclerosis
patients. As a further example, treatment of systemic lupus erythematosus
(SLE) is contemplated. In one embodiment, a patient's blood or plasma is
contacted with TNFR-6 alpha and/or TNFR-6 beta polypeptides of the
invention ex vivo. The TNFR-6 alpha andlor TNFR-6 beta may be bound to a
suitable chromatography matrix using techniques known in the art. According



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
181
to this embodiment, the patient's blood or plasma flows through a
chromatography column containing TNFR-6 alpha and/or TNFR-6 beta bound
to the matrix, before being returned to the patient. The immobilized TNFR-6
alpha and/or TNFR-6 beta binds Fas ligand and/or AIM-II, thus removing Fas
ligand protein from the patient's blood. Alternatively, TNFR-6 alpha and/or
TNFR-6 beta may be administered in vivo to a patient afflicted with a
thrombotic microangiopathy. In one embodiment, a TNFR-6 alpha and/or
TNFR-6 beta polynucleotide or polypeptide of the invention is administered
to the patient. Thus, the present invention provides a method for treating a
l0 thrombotic microangiopathy, involving use of an effective amount of a TNFR-
6 alpha and/or TNFR-6 beta polypeptide of the invention. A TNFR-6 alpha
and/or TNFR-6 beta polypeptide may be employed in in vivo or ex vivo
procedures, to inhibit Fas ligand-mediated and/or AIM-II-mediated damage to
(e.g., apoptosis of) microvascular endothelial cells.
TNFR-6 alpha and/or TNFR-6 beta polypeptides and polynucleodies
of the invention may be employed in conjunction with other agents useful in
treating a particular disorder. For example, in an in vitro study reported by
Laurence et al. (Blood 87:3245, I 996), some reduction of TTP plasma-mediated
apoptosis of microvascular endothelial cells was achieved by using an anti-Fas
2o blocking antibody, aurintricarboxylic acid, or normal plasma depleted of
cryoprecipitate. Thus, a patient may be treated in combination with an
additional agent that inhibits Fas-ligand-mediated apoptosis of endothelial
cells
such as, for example, an agent described above. In one embodiment, TNFR-6
alpha and/or TNFR-6 beta polypeptides of the invention and an anti-FAS
blocking antibody are administered to a patient afflicted with a disorder
characterized by thrombotic microanglopathy, such as TTP or HUS. Examples
of blocking monoclonal antibodies directed against Fas antigen (CD95) are
described in International Application publication number WO 95/10540,
hereby incorporated by reference.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
182
The naturally occurring balance between endogenous stimulators and
inhibitors of angiogenesis is one in which inhibitory influences predominate.
Rastinejad et al., Cell 56:345-355 (1989). In those rare instances in which
neovascularization occurs under normal physiological conditions, such as
wound healing, organ regeneration, embryonic development, and female
reproductive processes, angiogenesis is stringently regulated and spatially
and
temporally delimited. Under conditions of pathological angiogenesis such as
that characterizing solid tumor growth, these regulatory controls fail.
Unregulated angiogenesis becomes pathologic and sustains progression of
l0 many neoplastic and non-neoplastic diseases. A number of serious diseases
are
dominated by abnormal neovascularization including solid tumor growth and
metastases, arthritis, some types of eye disorders, and psoriasis. See, e.g.,
reviews by Moses et al., Biotech. 9:630-634 ( 1991 ); Folkman et al., N. Engl.
J.
Med., 333:1757-1763 (1995); Auerbach et al., J. Microvasc. Res. 29:401-411
(1985); Folkman, Advances in Cancer Research, eds. Klein and Weinhouse,
Academic Press, New York, pp. 175-203 (1985); Patz, Am. J. Opthalmol.
94:715-743 (1982); and Folkman et al., Science 221:719-725 (1983). In a
number of pathological conditions, the process of angiogenesis contributes to
the disease state. For example, significant data have accumulated which
suggest
2o that the growth of solid tumors is dependent on angiogenesis. Folkman and
Klagsbrun, Science 235:442-447 (1987).
The present invention provides for treatment of diseases or disorders
associated with neovascularization by administration of the TNFR-6 alpha
and/or TNFR-6 beta polynucleotides and/or polypeptides of the invention.
Malignant and metastatic conditions which can be treated with the
polynucleotides and polypeptides of the invention include, but are not limited
to, malignancies, solid tumors, and cancers described herein and otherwise
known in the art (for a review of such disorders, see Fishman et al.,
Medicine,
2d Ed., J. B. Lippincott Co., Philadelphia ( 1985)):



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
183
Ocular disorders associated with neovascularization which can be
treated with the TNFR-6 alpha and/or TNFR-6 beta polynucleotides and
polypeptides of the present invention (including TNFR agonists and/or
antagonists) include, but are not limited to: neovascular glaucoma, diabetic
retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of
prematurity macular degeneration, corneal graft neovascularization, as well as
other eye inflammatory diseases, ocular tumors and diseases associated with
choroidal or iris neovascularization. See, e.g., reviews by Waltman et al.,
Am.
J. Ophthal. 85:704-710 (1978) and Gartner et al., Surv. Ophthal. 22:291-312
(1978).
In another embodiment, TNFR-6 alpha and/or TNFR-6 beta
polypeptides, polynucleotides and/or agonists or antagonists of the invention
are used to stimulate differentiation and/or survival of photoreceptor cells
and/or to treat or prevent diseases, disorders, or conditions associated with
decreased number, differentiation and/or survival of photoreceptor cells.
Additionally, disorders which can be treated with the TNFR-6 alpha
and/or TNFR-6 beta polynucleotides and polypeptides of the present
invention (including TNFR agonist and/or antagonists) include, but are not
limited to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic
2o plaques, delayed wound healing, granulations, hemophilic joints,
hypertrophic
scars, nonunion fractures, Osler-Weber syndrome, pyogenic granuloma,
scleroderma, trachoma, and vascular adhesions.
In additional embodiments, TNFR-6 alpha and/or TNFR-6 beta
polynucleotides, polynucleotides and/or other compositions of the invention
(e.g., anti-TNFR-6 alpha and/or anti-TNFR-6 beta antibodies) are used to treat
or prevent diseases or conditions associated with allergy and/or inflammation.
In a specific embodiment TNFR polynucleotides, polypeptides and/or
agonists or antagonists thereof may be used to treat or prevent thyroid-



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
184
associated opthalmopathy and/or tissue/cell damage or destruction, and/or
medical conditions associated with thyroid-associated opthalmopathy.
In a specific embodiment, TNFR polynucleotides, polypeptides, or
agonists of the invention are used to prolong protein expression after gene
s therapy by inhibiting or reducing elimination of transgene expressing cells.
In further embodiments, the TNFR-6 alpha and/or TNFR-6 beta
polynucleotides and/or polynucleotides, and/or agonists or antagonists
thereof,
are used to promote wound healing.
Polynucleotides and/or polypeptides of the invention and/or agonists
to and/or antagonists thereof are useful in the diagnosis and treatment or
prevention of a wide range of diseases and/or conditions. Such diseases and
conditions include, but are not limited to, cancer (e.g., immune cell related
cancers, breast cancer, prostate cancer, ovarian cancer, follicular lymphoma,
cancer associated with mutation or alteration of p53, brain tumor, bladder
15 cancer, uterocervical cancer, colon cancer, colorectal cancer, non-small
cell
carcinoma of the lung, small cell carcinoma of the lung, stomach cancer,
etc.),
lymphoproliferative disorders (e.g., lymphadenopathy), microbial (e.g., viral,
bacterial, etc.) infection (e.g., HIV-1 infection, HIV-2 infection,
herpesvirus
infection (including, but not limited to, HSV-l, HSV-2, CMV, VZV, HHV-6,
2o HHV-7, EBV), adenovirus infection, poxvirus infection, human papilloma
virus infection, hepatitis infection (e.g., HAV, HBV, HCV, etc.), Helicobacter
pylori infection, invasive Staphylococcia, etc.), parasitic infection,
nephritis,
bone disease (e.g., osteoporosis), atherosclerosis, pain, cardiovascular
disorders (e.g., neovascularization, hypovascularization or reduced
circulation
25 (e.g., ischemic disease (e.g., myocardial infarction, stroke, etc.))),
AIDS,
allergy, inflammation, neurodegenerative disease (e.g., Alzheimer's disease,
Parkinson's disease, amyotrophic lateral sclerosis, pigmentary retinitis,
cerebellar degeneration, etc.), graft rejection (acute and chronic), graft vs.
host
disease, diseases due to osteomyelodysplasia (e.g., aplastic anemia, etc.),
joint



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
185
tissue destruction in rheumatism, liver disease (e.g., acute and chronic
hepatitis, liver injury, and cirrhosis), autoimmune disease (e.g., multiple
sclerosis, rheumatoid arthritis, systemic lupus erythematosus, immune
complex glomerulonephritis, autoimmune diabetes, autoimmune
thrombocytopenic purpura, Grave's disease, Hashimoto's thyroiditis, etc.),
cardiomyopathy (e.g., dilated cardiomyopathy), diabetes, diabetic
complications (e.g., diabetic nephropathy, diabetic neuropathy, diabetic
retinopathy), influenza, asthma, psoriasis, glomerulonephritis, septic shock,
and ulcerative colitis.
1 o Polynucleotides and/or polypeptides of the invention and/or agonists
and/or antagonists thereof are useful in promoting angiogenesis, regulating
hematopoiesis and wound healing (e.g., wounds, burns, and bone fractures).
Polynucleotides and/or polypeptides of the invention and/or agonists
and/or antagonists thereof are also useful as an adjuvant to enhance immune
responsiveness to specific antigen, anti-viral immune responses.
More generally, polynucleotides and/or polypeptides of the invention
and/or agonists and/or antagonists thereof are useful in regulating (i.e.,
elevating
or reducing) immune response. For example, polynucleotides and/or
polypeptides of the invention may be useful in preparation or recovery from
surgery, trauma, radiation therapy, chemotherapy, and transplantation, or may
be used to boost immune response and/or recovery in the elderly and
immunocompromised individuals. Alternatively, polynucleotides and/or
polypeptides of the invention and/or agonists and/or antagonists thereof are
useful as immunosuppressive agents, for example in the treatment or
prevention of autoimmune disorders. In specific embodiments,
polynucleotides and/or polypeptides of the invention are used to treat or
prevent chronic inflammatory, allergic or autoimmune conditions, such as
those described herein or are otherwise known in the art.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
186
In one aspect, the present invention is directed to a method for
enhancing apoptosis induced by a TNF-family ligand, which involves
administering to a patient (preferably a human) a TNFR antagonists (e.g., an
anti-TNFR antibody or TNFR polypeptide fragment). Preferably, the TNFR
antagonist is administered to treat a disease or condition wherein increased
cell
survival is exhibited. Antagonists of the invention include soluble forms of
TNFR and monoclonal antibodies directed against the TNFR polypeptide.
By "antagonist" is intended naturally occurring and synthetic
compounds capable of enhancing or potentiating apoptosis. By "agonist" is
intended naturally occurring and synthetic compounds capable of inhibiting
apoptosis. Whether any candidate "agonist" or "antagonist" of the present
invention can inhibit or enhance apoptosis can be determined using art-known
TNF-family ligand/receptor cellular response assays, including those described
in more detail below.
One such screening procedure involves the use of melanophores which
are transfected to express the receptor of the present invention. Such a
screening technique is described in International application publication
number WO 92/01810, published February 6, 1992. Such an assay may be
employed, for example, for screening for a compound which inhibits (or
2o enhances) activation of the receptor polypeptide of the present invention
by
contacting the melanophore cells which encode the receptor with both a TNF-
family ligand and the candidate antagonist (or agonist). Inhibition or
enhancement of the signal generated by the ligand indicates that the compound
is an antagonist or agonist of the ligand/receptor signaling pathway.
Other screening techniques include the use of cells which express the
receptor (for example, transfected CHO cells) in a system which measures
extracellular pH changes caused by receptor activation, for example, as
described in Science 246:181-296 (October 1989). For example, compounds
may be contacted with a cell which expresses the receptor polypeptide of the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
187
present invention and a second messenger response, e.g., signal transduction
or
pH changes, may be measured to determine whether the potential compound
activates or inhibits the receptor.
Another such screening technique involves introducing RNA encoding
the receptor into Xenopus oocytes to transiently express the receptor. The
receptor oocytes may then be contacted with the receptor ligand and a
compound to be screened, followed by detection of inhibition or activation of
a
calcium signal in the case of screening for compounds which are thought to
inhibit activation of the receptor.
l0 Another screening technique involves expressing in cells a construct
wherein the receptor is linked to a phospholipase C or D. Such cells include
endothelial cells, smooth muscle cells, embryonic kidney cells, etc. The
screening may be accomplished as hereinabove described by detecting
activation of the receptor or inhibition of activation of the receptor from
the
phospholipase signal.
Another method involves screening for compounds which inhibit
activation of the receptor polypeptide of the present invention antagonists by
determining inhibition of binding of labeled ligand to cells which have the
receptor on the surface thereof. Such a method involves transfecting a
2o eukaryotic cell with DNA encoding the receptor such that the cell expresses
the receptor on its surface and contacting the cell with a compound in the
presence of a labeled form of a known ligand. The ligand can be labeled, e.g.,
by radioactivity. The amount of labeled ligand bound to the receptors is
measured, e.g., by measuring radioactivity of the receptors. If the compound
binds to the receptor as determined by a reduction of labeled ligand which
binds to the receptors, the binding of labeled ligand to the receptor is
inhibited.
Further screening assays for agonist and antagonist of the present
invention are described in Tartaglia, L.A., and Goeddel, D.V., J. Biol. Chem.
267(7):4304-4307( 1992):



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
188
Thus, in a further aspect, a screening method is provided for
determining whether a candidate agonist or antagonist is capable of enhancing
or inhibiting a cellular response to a TNF-family ligand. The method involves
contacting cells which express the TNFR polypeptide with a candidate
compound and a TNF-family ligand, assaying a cellular response, and
comparing the cellular response to a standard cellular response, the standard
being assayed when contact is made with the ligand in absence of the candidate
compound, whereby an increased cellular response over the standard indicates
that the candidate compound is an agonist of the ligand/receptor signaling
to pathway and a decreased cellular response compared to the standard
indicates
that the candidate compound is an antagonist of the ligand/receptor signaling
pathway. By "assaying a cellular response" is intended qualitatively or
quantitatively measuring a cellular response to a candidate compound and/or a
TNF-family ligand (e.g., determining or estimating an increase or decrease in
T
cell proliferation or tritiated thymidine labeling). By the invention, a cell
expressing the TNFR polypeptide can be contacted with either an endogenous
or exogenously administered TNF-family ligand.
Agonist according to the present invention include naturally occurring
and synthetic compounds such as, for example, TNF family ligand peptide
2o fragments, transforming growth factor, neurotransmitters (such as
glutamate,
dopamine, N-methyl-D-aspartate), tumor suppressors (p53), cytolytic T cells
and antimetabolites. Preferred agonists include chemotherapeutic drugs such
as, for example, cisplatin, doxorubicin, bleomycin, cytosine arabinoside,
nitrogen mustard, methotrexate and vincristine. Others include ethanol and -
amyloid peptide. (Science 267:1457-1458 (1995)). Further preferred agonists
include polyclonal and monoclonal antibodies raised against the TNFR
polypeptide, or a fragment thereof. Such agonist antibodies raised against a
TNF-family receptor are disclosed in Tartaglia, L.A., et al., Proc. Natl.
Acad.
Sci. USA 88:9292-9296 (1991); and Tartaglia, L.A., and Goeddel, D.V., J.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
189
Biol. Chen2. 267 (7):4304-4307 (1992) See, also, International application
publication number WO 94/09137.
Antagonists according to the present invention include naturally
occurring and synthetic compounds such as, for example, the CD40 ligand,
neutral amino acids, zinc, estrogen, androgens, viral genes (such as
Adenovirus
EIB, Baculovirus p35 and IAP, Cowpox virus crmA, Epstein-Barr virus
BHRFI, LMP-l, African swine fever virus LMWS-HL, and Herpesvirus yl
34.5), calpain inhibitors, cysteine protease inhibitors, and tumor promoters
(such as PMA, Phenobarbital, and -Hexachlorocyclohexane). Other
l0 antagonists include polyclonal and monoclonal antagonist antibodies raised
against the TNFR polypeptides or a fragment thereof. Such antagonist
antibodies raised against a TNF-family receptor are described in Tartaglia,
L.A., and Goeddel, D.V., J. Biol. Chem. 267(7):4304-4307 (1992) and
Tartaglia, L.A. et al., Cell 73:213-216 (1993). See, also, International
application publication number WO 94/09137.
In specific embodiments, antagonists according to the present invention
are nucleic acids corresponding to the sequences contained in TNFR, or the
complementary strand thereof, and/or to nucleotide sequences contained in the
deposited clones (ATCC Deposit Nos. 97810 and 97809). In one
embodiment, antisense sequence is generated internally by the organism, in
another embodiment, the antisense sequence is separately administered (see,
for example, O'Connor, J., Neurochem. 56:560 (1991) and
Oligodeoxynucleotides as Anitsense Inhibitors of Gene Expression, CRC
Press, Boca Raton, FL (1988). Antisense technology can be used to control
gene expression through antisense DNA or RNA, or through triple-helix
formation. Antisense techniques are discussed for example, in Okano, J.,
Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of
Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation
is discussed in, for instance, Lee et al., Nucleic Acids Research 6:3073
(1979);



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
190
Cooney et al., Science 241:456 ( 1988); and Dervan et al., Science 251:1300
( 1991 ). The methods are based on binding of a polynucleotide to a
complementary DNA or RNA.
For example, the 5' coding portion of a polynucleotide that encodes the
mature polypeptide of the present invention may be used to design an
antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A
DNA oligonucleotide is designed to be complementary to a region of the gene
involved in transcription thereby preventing transcription and the production
of the receptor. The antisense RNA oligonucleotide hybridizes to the mRNA
to in vivo and blocks translation of the mRNA molecule into receptor
polypeptide.
In one embodiment, the TNFR antisense nucleic acid of the invention is
produced intracellularly by transcription from an exogenous sequence. For
example, a vector or a portion thereof, is transcribed, producing an antisense
nucleic acid (RNA) of the invention. Such a vector would contain a sequence
encoding the TNFR antisense nucleic acid. Such a vector can remain episomal
or become chromosomally integrated, as long as it can be transcribed to
produce the desired antisense RNA. Such vectors can be constructed by
recombinant DNA technology methods standard in the art. Vectors can be
plasmid, viral, or others know in the art, used for replication and expression
in
vertebrate cells. Expression of the sequence encoding TNFR, or fragments
thereof, can be by any promoter known in the art to act in vertebrate,
preferably human cells. Such promoters can be inducible or constitutive. Such
promoters include, but are not limited to, the SV40 early promoter region
(Bernoist and Chambon, Nature 29:304-310 (1981), the promoter contained in
the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell
22:787-797 (1980), the herpes thymidine promoter (Wagner et al., Proc. Natl.
Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory sequences of the
metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)), etc.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
191
The antisense nucleic acids of the invention comprise a sequence
complementary to at least a portion of an RNA transcript of a TNFR gene.
However, absolute complementarity, although preferred, is not required. A
sequence "complementary to at least a portion of an RNA," referred to herein,
means a sequence having sufficient complementarity to be able to hybridize
with the RNA, forming a stable duplex; in the case of double stranded TNFR
antisense nucleic acids, a single strand of the duplex DNA may thus be tested,
or triplex formation may be assayed. The ability to hybridize will depend on
both the degree of complementarity and the length of the antisense nucleic
acid
Generally, the larger the hybridizing nucleic acid, the more base mismatches
with a TNFR RNA it may contain and still form a stable duplex (or triplex as
the case may be). One skilled in the art can ascertain a tolerable degree of
mismatch by use of standard procedures to determine the melting point of the
hybridized complex.
Oligonucleotides that are complementary to the 5' end of the message,
e.g., the 5' untranslated sequence up to and including the AUG initiation
codon, should work most efficiently at inhibiting translation. However,
sequences complementary to the 3' untranslated sequences of mRNAs have
been shown to be effective at inhibiting translation of mRNAs as well. See
2o generally, Wagner, R., Nature 372:333-335 (1994). Thus, oligonucleotides
complementary to either the 5'- or 3'- non- translated, non-coding regions of
the TNFR shown in Figures 1 and 2 could be used in an antisense approach to
inhibit translation of endogenous TNFR mRNA. Oligonucleotides
complementary to the 5' untranslated region of the mRNA should include the
complement of the AUG start codon. Antisense oligonucleotides
complementary to mRNA coding regions are less efficient inhibitors of
translation but could be used in accordance with the invention. Whether
designed to hybridize to the 5'-, 3'- or coding region of TNFR mRNA,
antisense nucleic acids should be at least six nucleotides in length, and are



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
192
preferably oligonucleotides ranging from 6 to about 50 nucleotides in length.
In specific aspects the oligonucleotide is at least 10 nucleotides, at least
17
nucleotides, at least 25 nucleotides or at least 50 nucleotides.
The polynucleotides of the invention can be DNA or RNA or chimeric
mixtures or derivatives or modified versions thereof, single-stranded or
double-
stranded. The oligonucleotide can be modified at the base moiety, sugar
moiety, or phosphate backbone, for example, to improve stability of the
molecule, hybridization, etc. The oligonucleotide may include other appended
groups such as peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating transport across the cell membrane (see, e.g., Letsinger
et al.,
Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556 (1989); Lemaitre et al., Proc.
Natl.
Acad. Sci. 84:648-652 (1987); PCT Publication No. W088/09810, published
December 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No.
W089/10134, published April 25, 1988), hybridization-triggered cleavage
agents. (See, e.g., Krol et al., BioTechniques 6:958-976 (1988)) or
intercalating
agents. (See, e.g., Zon, Pharm. Res. 5:539-549 (1988)). To this end, the
oligonucleotide may be conjugated to another molecule, e.g., a peptide,
hybridization triggered cross-linking agent, transport agent, hybridization-
triggered cleavage agent, etc.
The antisense oligonucleotide may comprise at least one modified base
moiety which is selected from the group including, but not limited to,
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine,
xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil,
5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil,
5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
193
5-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6
isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid
(v),
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
The antisense oligonucleotide may also comprise at least one modified
sugar moiety selected from the group including, but not limited to, arabinose,
2-fluoroarabinose, xylulose, and hexose.
In yet another embodiment, the antisense oligonucleotide comprises at
least one modified phosphate backbone selected from the group including, but
not limited to, a phosphorothioate, a phosphorodithioate, a
phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a
methylphosphonate, an alkyl phosphotriester, and a formacetal or analog
thereof.
In yet another embodiment, the antisense oligonucleotide is an
a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms specific
double-stranded hybrids with complementary RNA in which, contrary to the
usual 13-units, the strands run parallel to each other (Gautier et al., Nucl.
Acids
Res. 15:6625-6641 (1987)). The oligonucleotide is a 2ø-0-
methylribonucleotide (moue et al., Nucl. Acids Res. 15:6131-6148 (1987)), or a
chimeric RNA-DNA analogue (moue et al., FEBSLett. 215:327-330 (1987)).
Polynucleotides of the invention may be synthesized by standard
methods known in the art, e.g. by use of an automated DNA synthesizer (such
as are commercially available from Biosearch, Applied Biosystems, etc.). As
examples, phosphorothioate oligonucleotides may be synthesized by the
method of Stein et al. (Nucl. Acids Res. 16:3209 ( 1988)), methylphosphonate
oligonucleotides can be prepared by use of controlled pore glass polymer
supports (Sarin et al., Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451 (1988)),
etc.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
194
While antisense nucleotides complementary to the TNFR coding region
sequence could be used, those complementary to the transcribed untranslated
region are most preferred.
Potential antagonists according to the invention also include catalytic
RNA, or a ribozyme (See, e.g.; International application publication number
WO 90/11364, published October 4, 1990; Sarver et al, Science 247:1222-1225
(1990). While ribozymes that cleave mRNA at site specific recognition
sequences can be used to destroy TNFR mRNAs, the use of hammerhead
ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations
dictated by flanking regions that form complementary base pairs with the
target mRNA. The sole requirement is that the target mRNA have the
following sequence of two bases: 5'-UG-3'. The construction and production
of hammerhead ribozymes is well known in the art and is described more fully
in Haseloff and Gerlach, Nature 334:585-591 (1988). There are numerous
potential hammerhead ribozyme cleavage sites within the nucleotide sequence
of TNFR-6a (Figure 1, SEQ ID NO:1) and TNFR-6(3 (Figure 2, SEQ ID
N0:3). Preferably, the ribozyme is engineered so that the cleavage recognition
site is located near the 5' end of the TNFR mRNA; i.e., to increase efficiency
and minimize the intracellular accumulation of non-functional mRNA
transcripts.
As in the antisense approach, the ribozymes of the invention can be
composed of modified oligonucleotides (e.g. for improved stability, targeting,
etc.) and should be delivered to cells which express TNFR irZ vivo. DNA
constructs encoding the ribozyme may be introduced into the cell in the same
manner as described above for the introduction of antisense encoding DNA. A
preferred method of delivery involves using a DNA construct "encoding" the
ribozyme under the control of a strong constitutive promoter, such as, for
example, pol III or pol II promoter, so that transfected cells will produce
sufficient quantities of the ribozyme to destroy endogenous TNFR messages



CA 02362929 2001-08-16
WO 00/52028 PCT/LTS00/05686
195
and inhibit translation. Since ribozymes unlike antisense molecules, are
catalytic, a lower intracellular concentration is required for efficiency.
Endogenous gene expression can also be reduced by inactivating or
"knocking out" the TNFR gene and/or its promoter using targeted homologous
recombination. (E.g., see Smithies et al., Nature 317:230-234 (1985); Thomas
& Capecchi, Cell 51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989);
each of which is incorporated by reference herein in its entirety). For
example,
a mutant, non-functional polynucleotide of the invention (or a completely
unrelated DNA sequence) flanked by DNA homologous to the endogenous
1 o polynucleotide sequence (either the coding regions or regulatory regions
of the
gene) can be used, with or without a selectable marker and/or a negative
selectable marker, to transfect cells that express polypeptides of the
invention
in vivo. In another embodiment, techniques known in the art are used to
generate knockouts in cells that contain, but do not express the gene of
interest. Insertion of the DNA construct, via targeted homologous
recombination, results in inactivation of the targeted gene. Such approaches
are particularly suited in research and agricultural fields where
modifications to
embryonic stem cells can be used to generate animal offspring with an inactive
targeted gene (e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra).
2o However this approach can be routinely adapted for use in humans provided
the recombinant DNA constructs are directly administered or targeted to the
required site in vivo using appropriate viral vectors that will be apparent to
those of skill in the art. The contents of each of the documents recited in
this
paragraph is herein incorporated by reference in its entirety.
Antibodies according to the present invention may be prepared by any
of a variety of standard methods using TNFR immunogens of the present
invention. Such TNFR immunogens include the TNFR protein shown in
Figures 1 and 2 (SEQ ID N0:2 and SEQ ID N0:4, respectively) (which may



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
196
or may not include a leader sequence) and polypeptide fragments of TNFR
comprising the ligand binding and/or extracellular domains of TNFR.
Polyclonal and monoclonal antibody agonists or antagonists according
to the present invention can be raised according to the methods disclosed
herein and and/or known in the art, such as, for example, those methods
described in Tartaglia and Goeddel, J. Biol. Chem. 267(7):4304-4307(1992);
Tartaglia et al., Cell 73:213-216 (1993), and International application
publication number WO 94/09137 (the contents of each of these three
applications are herein incorporated by reference in their entireties), and
are
to preferably specific to polypeptides of the invention having the amino acid
sequence of SEQ ID N0:2 and/or SEQ ID N0:4. Antibodies according to the
present invention may be prepared by any of a variety of methods described
herein, and known in the art.
Further antagonist according to the present invention include soluble
forms of TNFR, e.g., TNFR fragments that include the ligand binding domain
from the extracellular region of the full length receptor. Such soluble forms
of
the receptor, which may be naturally occurring or synthetic, antagonize TNFR
mediated signaling by competing with the cell surface TNFR for binding to
TNF-family ligands and/or antagonize TNFR mediated inhibition of apoptosis
by, for example, disrupting the ability of TNFR to multimerize and/or to bind
to and thereby neutralize apoptosis inducing ligands, such as, for example,
Fas
ligand and AIM-IL. Thus, soluble forms of the receptor that include the ligand
binding domain are novel cytokines capable of reducing TNFR-mediated
inhibition of tumor necrosis induced by TNF-family ligands. Other such
cytokines are known in the art and include Fas B (a soluble form of the mouse
Fas receptor) that acts physiologically to limit apoptosis induced by Fas
ligand (Hughes, D.P. and Crispe, LN., J. Exp. Med. 182:1395-1401 (1995)).
Proteins and other compounds which bind the extracellular domains are
also candidate agonist and antagonist according to the present invention. Such



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
197
binding compounds can be "captured" using the yeast two-hybrid system
(Fields and Song, Nature 340:245-246 (1989)). A modified version of the yeast
two-hybrid system has been described by Roger Brent and his colleagues
(Gyuris, J. et al., Cell 75:791-803 (1993); Zervos, A.S. et al., Cell 72:223-
232
s (1993)).
By a "TNF-family ligand" is intended naturally occurring, recombinant,
and synthetic ligands that are capable of binding to a member of the TNF
receptor family and inducing the ligand/receptor signaling pathway. Members
of the TNF ligand family include, but are not limited to, the TNFR-6a & -6(3
ligands, TNF-a , lymphotoxin-a (LT-a , also known as TNF-~3 ), LT-(3,
Fast, CD40, CD27, CD30, 4-1BB, OX40, TRAIL, AIM-II, and nerve growth
factor (NGF).
Formulation and Administration
The TNFR polypeptide composition will be formulated and dosed in a
fashion consistent with good medical practice, taking into account the
clinical
condition of the individual patient (especially the side effects of treatment
with TNFR-6a or -6(3 polypeptide alone), the site of delivery of the TNFR
polypeptide composition, the method of administration, the scheduling of
administration, and other factors known to practitioners. The "effective
amount" of TNFR polypeptide for purposes herein is thus determined by
such considerations.
As a general proposition, the total pharmaceutically effective amount
of TNFR polypeptide administered parenterally per dose will be in the range
of about 1 g g/kg/day to 10 mg/kg/day of patient body weight, although, as
noted above, this will be subject to therapeutic discretion. More preferably,
this dose is at least 0.01 mg/kg/day, and most preferably for humans between
about 0.01 and 1 mg/kg/day for the hormone. If given continuously, the TNFR



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
198
polypeptide is typically administered at a dose rate of about 1 ~g/kg/hour to
about 50 qg/kg/hour, either by 1-4 injections per day or by continuous
subcutaneous infusions, for example, using a mini-pump. An intravenous bag
solution may also be employed. The length of treatment needed to observe
changes and the interval following treatment for responses to occur appears to
vary depending on the desired effect.
Effective dosages of the compositions of the present invention to be
administered may be determined through procedures well known to those in
the art which address such parameters as biological half life,
bioavailability,
and toxicity. Such determination is well within the capability of those
skilled
in the art, especially in light of the detailed disclosure provided herein.
Bioexposure of an organism to TNFR-6a or -6(3 polypeptide during
therapy may also play an important role in determining a therapeutically
and/or pharmacologically effective dosing regime. Variations of dosing such as
repeated administrations of a relatively low dose of TNFR-6a or -6~3
polypeptide for a relatively long period of time may have an effect which is
therapeutically and/or pharmacologically distinguishable from that achieved
with repeated administrations of a relatively high dose of TNFR-6a or -6(3
polypeptide for a relatively short period of time.
Using the equivalent surface area dosage conversion factors supplied
by Freireich, E. J., et al. (Cancer Chemotherapy Reports 50(4):219-44 (1966)),
one of ordinary skill in the art is able to conveniently convert data obtained
from the use of TNFR-6a or -6(3 polypeptide in a given experimental system
into an accurate estimation of a pharmaceutically effective amount of TNFR-
6a or -6(3 polypeptide to be administered per dose in another experimental
system. Experimental data obtained through the administration of TNFR6-Fc
in mice (see, for instance, Example 21) may converted through the conversion
factors supplied by Freireich, et al., to accurate estimates of
pharmaceutically



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
199
effective doses of TNFR-6 in rat, monkey, dog, and human. The following
conversion table (Table IV) is a summary of the data provided by Freireich, et
al. Table IV gives approximate factors for converting doses expressed in terms
of mg/kg from one species to an equivalent surface area dose expressed as
mg/kg in another species tabulated.
Table IV. EquivalentSurfaceArea Dosage ConversionFactors.


--TO--


to Mouse Rat Monkey Dog Human


--FROM-- (20g1 (150g) ~3.5kg1 (8kg) (60kg)


Mouse 1 1/2 1/4 1/6 1/12


Rat 2 1 1/2 1/4 1/7


Monkey 4 2 1 3/5 1/3


Dog 6 4 5/3 1 1/2


Human 12 7 3 2 1


Thus, for example, using the conversion factors provided in Table IV, a
dose of 50 mg/kg in the mouse converts to an appropriate dose of 12.5 mg/kg
2o in the monkey because (50 mg/kg) x (1/4) = 12.45 mg/kg. As an additional
example, doses of 0.02, 0.08, 0.8, 2, and 8 mg/kg in the mouse equate to
effect
doses of 1.667 micrograms/kg, 6.67 micrograms/kg, 66.7 micrograms/kg, 166.7
micrograms/kg, and 0.667 mg/kg, respectively, in the human.
TNFR-6 alpha and/or TNFR-6 beta polypeptides of the invention may
be administered using any method known in the art, including, but not limited
to, direct needle injection at the delivery site, intravenous injection,
topical
administration, catheter infusion, biolistic injectors, particle accelerators,
gelfoam sponge depots, other commercially available depot materials, osmotic
pumps, oral or suppositorial solid pharmaceutical formulations, decanting or
3o topical applications during surgery, aerosol delivery. Such methods are
known
in the art. TNFR-6 alpha and/or TNFR-6 polypeptides of the invention may



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
200
be administered as part of a pharmaceutical composition, described in more
detail below. Methods of delivering TNFR-6 alpha and/or TNFR-6 beta
polynucleotides of the invention are known in the art and described in more
detail herein.
Pharmaceutical compositions containing the TNFR of the invention
may be administered orally, rectally, parenterally, intracistemally,
intravaginally, intraperitoneally, topically (as by powders, ointments, drops
or
transdermal patch), bucally, or as an oral or nasal spray. By
"pharmaceutically acceptable carrier" is meant a non-toxic solid, semisolid or
liquid filler, diluent, encapsulating material or formulation auxiliary of any
type. The composition, if desired, can also contain minor amounts of wetting
or emulsifying agents, or pH buffering agents. These compositions can take
the form of solutions, suspensions, emulsion, tablets, pills, capsules,
powders,
sustained-release formulations and the like. The term "parenteral" as used
herein refers to modes of administration which include intravenous,
intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular
injection and infusion.
The TNFR polypeptide is also suitably administered by sustained-
release systems. Suitable examples of sustained-release compositions include
2o suitable polymeric materials (such as, for example, semi-permeable polymer
matrices in the form of shaped articles, e.g., films, or mirocapsules),
suitable
hydrophobic materials (for example as an emulsion in an acceptable oil) or ion
exchange resins, and sparingly soluble derivatives (such as, for example, a
sparingly soluble salt).
Sustained-release matrices include polylactides (U.S. Pat. No.
3,773,919, EP 58,481), copolymers of L-glutamic acid and
gamma-ethyl-L-glutamate (Sidman, U. et al., Biopolymers 22:547-556 (1983)),
poly (2- hydroxyethyl methacrylate) (R. Langer et al., J. Biomed. Mater. Res.
15:167-277 (1981), and R. Langer, Chem. Tech. 12:98-105 (1982)), ethylene



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
201
vinyl acetate (R. Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP
133,988).
Sustained-release compositions also include liposomally entrapped
compositions of the invention (see generally, Langer, Science 249:1527-1533
( 1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and
Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 317 -327 and
353-365 (1989)).. Liposomes containing TNFR polypeptides my be prepared
by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci.
(USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. (USA)
l0 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP
142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and
4,544,545; and EP 102,324. Ordinarily, the liposomes are of the small (about
200-800 Angstroms) unilamellar type in which the lipid content is greater than
about 30 mol. percent cholesterol, the selected proportion being adjusted for
the optimal TNFR polypeptide therapy.
In yet an additional embodiment, the compositions of the invention are
delivered by way of a pump (see Langer, supra; Sefton, CRC Crit. Ref.
Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek
et al., N. Engl. J. Med. 321:574 (1989)).
Other controlled release systems are discussed in the review by Langer
(Science 249:1527-1533 (1990)).
For parenteral administration, in one embodiment, the TNFR
polypeptide is formulated generally by mixing it at the desired degree of
purity, in a unit dosage injectable form (solution, suspension, or emulsion),
with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to
recipients at the dosages and concentrations employed and is compatible with
other ingredients of the formulation. For example, the formulation preferably
does not include oxidizing agents and other compounds that are known to be
deleterious to polypeptides.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
202
Generally, the formulations are prepared by contacting the TNFR
polypeptide uniformly and intimately with liquid carriers or finely divided
solid carriers or both. Then, if necessary, the product is shaped into the
desired formulation. Preferably the carrier is a parenteral carrier, more
preferably a solution that is isotonic with the blood of the recipient.
Examples
of such carrier vehicles include water, saline, Ringer's solution, and
dextrose
solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also
useful herein, as well as liposomes.
The carrier suitably contains minor amounts of additives such as
to substances that enhance isotonicity and chemical stability. Such materials
are
non-toxic to recipients at the dosages and concentrations employed, and
include buffers such as phosphate, citrate, succinate, acetic acid, and other
organic acids or their salts; antioxidants such as ascorbic acid; low
molecular
weight (less than about ten residues) polypeptides, e.g., polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins;
hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as
glycine, glutamic acid, aspartic acid, or arginine; monosaccharides,
disaccharides, and other carbohydrates including cellulose or its derivatives,
glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols
such as mannitol or sorbitol; counterions such as sodium; and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
The TNFR polypeptide is typically formulated in such vehicles at a
concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH
of about 3 to 8. It will be understood that the use of certain of the
foregoing
excipients, carriers, or stabilizers will result in the formation of TNFR
polypeptide salts.
TNFR polypeptides to be used for therapeutic administration must be
sterile. Sterility is readily accomplished by filtration through sterile
filtration
membranes (e.g., 0.2 micron membranes). Therapeutic TNFR polypeptide



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
203
compositions generally are placed into a container having a sterile access
port,
for example, an intravenous solution bag or vial having a stopper pierceable
by
a hypodermic injection needle.
TNFR polypeptides ordinarily will be stored in unit or multi-dose
containers, for example, sealed ampoules or vials, as an aqueous solution or
as
a lyophilized formulation for reconstitution. As an example of a lyophilized
formulation, 10-ml vials are filled with 5 ml of sterile-filtered 1 % (w/v)
aqueous TNFR polypeptide solution, and the resulting mixture is lyophilized.
The infusion solution is prepared by reconstituting the lyophilized TNFR
l0 polypeptide using bacteriostatic Water-for-Injection.
The invention also provides a pharmaceutical pack or kit comprising
one or more containers filled with one or more of the ingredients of the
pharmaceutical compositions of the invention. Associated with such
containers) can be a notice in the form prescribed by a governmental agency
regulating the manufacture, use or sale of pharmaceuticals or biological
products, which notice reflects approval by the agency of manufacture, use or
sale for human administration. In addition, the polypeptides of the present
invention may be employed in conjunction with other therapeutic compounds.
The compositions of the invention may be administered alone or in
combination with other therapeutic agents, including but not limited to,
chemotherapeutic agents, anti-opportunistic infection agents, antivirals,
antibiotics, steroidal and non-steroidal anti-inflammatories,
immunosuppressants, conventional immunotherapeutic agents and cytokines.
Combinations may be administered either concomitantly, e.g., as an admixture,
separately but simultaneously or concurrently; or sequentially. This includes
presentations in which the combined agents are administered together as a
therapeutic mixture, and also procedures in which the combined agents are
administered separately but simultaneously, e.g., as through separate
intravenous lines into the same individual. Administration "in combination"



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
204
further includes the separate administration of one of the compounds or
agents given first, followed by the second.
In one embodiment, the compositions of the invention are administered
in combination with other members of the TNF family. TNF, TNF-related or
TNF-like molecules that may be administered with the compositions of the
invention include, but are not limited to, soluble forms of TNF-alpha,
lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta (found in
complex heterotrimer LT-alpha2-beta), OPGL, CD27L, CD30L, CD40L, 4-
1BBL, DcR3, OX40L, TNF-gamma International application publication
l0 number WO 96/14328), AIM-I (International application publication number
WO 97/33899), AIM-II (International application publication number WO
97/34911), APRIL (J. Exp. Med. 188(6):1185-1190), endokine-alpha
(International Publication No. WO 98/07880), OPG, and neutrokine-alpha
(International application publication number WO 98/18921), TWEAK,
OX40, and nerve growth factor (NGF), and soluble forms of Fas, CD30,
CD27, CD40 and 4-IBB, TR2 (International application publication number
WO 96/34095), DR3 (International Publication No. WO 97/33904), DR4
(International application publication number WO 98/32856), TR5
(International application publication number WO 98/30693), TR7
(International application publication number WO 98/41629), TRANK, TR9
(International application publication number WO 98/56892), TR10
(International application publication number WO 98/54202),31X2
(International application publication number WO 98/06842), and TR12.
Conventional nonspecific immunosuppressive agents, that may be
administered in combination with the compositions of the invention include,
but are not limited to, steroids, cyclosporine, cyclosporine analogs,
cyclophosphamide methylprednisone, prednisone, azathioprine, FK-506, 15-
deoxyspergualin, and other immunosuppressive agents that act by
suppressing the function of responding T cells.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
205
In specific embodiments, compositions of the invention are
administered in combination with immunosuppressants.
Immunosuppressants preparations that may be administered with the
compositions of the invention include, but are not limited to,
ORTHOCLONET"~ (OKT3), SANDIMMUNETM/NEORALT"~/SANGDYAT"~
(cyclosporin), PROGRAFT"~ (tacrolimus), CELLCEPTT"" (mycophenolate),
Azathioprine, glucorticosteroids, and RAPAMUNET"" (sirolimus). In a
specific embodiment, immunosuppressants may be used to prevent rejection
of organ or bone marrow transplantation.
l0 In certain embodiments, compositions of the invention are
administered in combination with antiretroviral agents, nucleoside reverse
transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors,
and/or
protease inhibitors. Nucleoside reverse transcriptase inhibitors that may be
administered in combination with the compositions of the invention, include,
15 but are not limited to, RETROVIRT"" (zidovudine/AZT), VIDEXT""
(didanosine/ddI), HIVIDT"' (zalcitabine/ddC), ZERITT"~ (stavudine/d4T),
EPIVIRT"" (lamivudine/3TC), and COMBIVIRT"' (zidovudine/lamivudine).
Non-nucleoside reverse transcriptase inhibitors that may be administered in
combination with the compositions of the invention, include, but are not
20 limited to, VIRAMUNET"~ (nevirapine), RESCRIPTORT"~ (delavirdine), and
SUSTIVATM (efavirenz). Protease inhibitors that may be administered in
combination with the compositions of the invention, include, but are not
limited to, CRIXIVANT"' (indinavir), NORVIRT"' (ritonavir), INVIRASET"~
(saquinavir), and VIRACEPTT"~ (nelfinavir). In a specific embodiment,
25 antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-
nucleoside reverse transcriptase inhibitors, and/or protease inhibitors may be



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
206
used in any combination with compositions of the invention to treat AIDS
and/or to prevent or treat HIV infection.
In other embodiments, compositions of the invention may be
administered in combination with anti-opportunistic infection agents. Anti-
opportunistic agents that may be administered in combination with the
compositions of the invention, include, but are not limited to,
TRIMETHOPRIM-SULFAMETHOXAZOLET"", DAPSONET"~,
PENTAMIDINETM, ATOVAQUONET"', ISONIAZIDT"', RIFAMPINT"~,
PYRAZINAMIDET"', ETHAMBUTOLT"', RIFABUTINTM,
CLARITHROMYCINT"", AZITHROMYCINT"", GANCICLOVIRT"~,
FOSCARNETT"~, CIDOFOVIRT"", FLUCONAZOLETM,
ITRACONAZOLET"", KETOCONAZOLET"~, ACYCLOVIRT"~,
FAMCICOLVIRT"", PYRIMETHAMINET"", LEUCOVORINT"',
NEUPOGENT"' (filgrastim/G-CSF), and LEUKINETM (sargramostim/GM-
CSF). In a specific embodiment, compositions of the invention are used in
any combination with TRIMETHOPRIM-SULFAMETHOXAZOLET"~,
DAPSONETM, PENTAMIDINETM, and/or ATOVAQUONET"~ to
prophylactically treat or prevent an opportunistic Pneumocystis carinii
pneumonia infection. In another specific embodiment, compositions of the
2o invention are used in any combination with ISONIAZIDT"~, RIFAMPINT"',
PYRAZINAMIDET"~, and/or ETHAMBUTOLT"" to prophylactically treat or
prevent an opportunistic Mycobacterium avium complex infection. In another
specific embodiment, compositions of the invention are used in any
combination with RIFABUTINT"~, CLARITHROMYCINT"", and/or
AZITHROMYCINTM to prophylactically treat or prevent an opportunistic
Mycobacterium tuberculosis infection. In another specific embodiment,
compositions of the invention are used in any combination with



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
207
GANCICLOVIRT"", FOSCARNETT"~, and/or CIDOFOVIRT"' to
prophylactically treat or prevent an opportunistic cytomegalovirus infection.
In another specific embodiment, compositions of the invention are used in any
combination with FLUCONAZOLET"', ITRACONAZOLET"", and/or
KETOCONAZOLET"" to prophylactically treat or prevent an opportunistic
fungal infection. In another specific embodiment, compositions of the
invention are used in any combination with ACYCLOVIRT"" and/or
FAMCICOLVIRT"" to prophylactically treat or prevent an opportunistic
herpes simplex virus type I and/or type II infection. In another specific
embodiment, compositions of the invention are used in any combination with
PYRIMETHAMINET"" and/or LEUCOVORINT"~ to prophylactically treat or
prevent an opportunistic Toxoplasma gondii infection. In another specific
embodiment, compositions of the invention are used in any combination with
LEUCOVORINTM and/or NEUPOGENT"~ to prophylactically treat or prevent
an opportunistic bacterial infection.
In a further embodiment, the compositions of the invention are
administered in combination with an antiviral agent. Antiviral agents that may
be administered with the compositions of the invention include, but are not
limited to, acyclovir, ribavirin, amantadine, and remantidine
2o In a further embodiment, the compositions of the invention are
administered in combination with an antibiotic agent. Antibiotic agents that
may be administered with the compositions of the invention include, but are
not limited to, amoxicillin, aminoglycosides, beta-lactam (glycopeptide), beta-

lactamases, Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin,
ciprofloxacin, erythromycin, fluoroquinolones, macrolides, metronidazole,
penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines,
trimethoprim, trimethoprim-sulfamthoxazole, and vancomycin.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
208
In an additional embodiment, the compositions of the invention are
administered alone or in combination with an anti-inflammatory agent. Anti-
inflammatory agents that may be administered with the compositions of the
invention include, but are not limited to, glucocorticoids and the
nonsteroidal
anti-inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid
derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic
acid derivatives, pyrazoles, pyrazolones, salicylic acid derivatives,
thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-
amino-4-hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome,
1o difenpiramide, ditazol, emorfazone, guaiazulene, nabumetone, nimesulide,
orgotein, oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole,
and tenidap.
In another embodiment, compostions of the invention are administered
in combination with a chemotherapeutic agent. Chemotherapeutic agents that
may be administered with the compositions of the invention include, but are
not limited to, antibiotic derivatives (e.g., doxorubicin, bleomycin,
daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen);
antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine,
interferon
alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine);
cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine
arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine,
mitomycin, busulfan, cis-platin, and vincristine sulfate); hormones (e.g.,
medroxyprogesterone, estramustine phosphate sodium, ethinyl estradiol,
estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol
diphosphate, chlorotrianisene, and testolactone); nitrogen mustard derivatives
(e.g., mephalen, chorambucil, mechlorethamine (nitrogen mustard) and
thiotepa); steroids and combinations (e.g., bethamethasone sodium
phosphate); and others (e.g., dicarbazine, asparaginase, mitotane, vincristine
sulfate, vinblastine sulfate, and etoposide).



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
209
In a specific embodiment, compositions of the invention are
administered in combination with CHOP (cyclophosphamide, doxorubicin,
vincristine, and prednisone) or any combination of the components of CHOP.
In another embodiment, compositions of the invention are administered in
combination with Rituximab. In a further embodiment, compositions of the
invention are administered with Rituxmab and CHOP, or Rituxmab and any
combination of the components of CHOP.
In an additional embodiment, the compositions of the invention are
administered in combination with cytokines. Cytokines that may be
1o administered with the compositions of the invention include, but are not
limited
to, GM-CSF, G-CSF, IL2, IL3, IL4, ILS, IL6, IL7, IL10, IL12, IL13, IL15,
anti-CD40, CD40L, IFN-alpha, IFN-beta, IFN-gamma, TNF-alpha, and T'NF-
beta. In another embodiment, compositions of the invention may be
administered with any interleukin, including, but not limited to, IL-lalpha,
IL-
lbeta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-

13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, and IL-21. In a preferred
embodiment, the compositions of the invention are administered in
combination with TNF-alpha. In another preferred embodiment, the
compositions of the invention are administered in combination with IFN-
2o alpha.
In an additional embodiment, the compositions of the invention are
administered in combination with angiogenic proteins. Angiogenic proteins
that may be administered with the compositions of the invention include, but
are not limited to, Glioma Derived Growth Factor (GDGF), as disclosed in
European Patent Number EP-399816; Platelet Derived Growth Factor-A
(PDGF-A), as disclosed in European Patent Number EP-682110; Platelet
Derived Growth Factor-B (PDGF-B), as disclosed in European Patent
Number EP-282317; Placental Growth Factor (P1GF), as disclosed in
International Publication Number WO 92/06194; Placental Growth Factor-2



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
210
(P1GF-2), as disclosed in Hauser et al., Gorwth Factors, 4:259-268 (1993);
Vascular Endothelial Growth Factor (VEGF), as disclosed in International
Publication Number WO 90/13649; Vascular Endothelial Growth Factor-A
(VEGF-A), as disclosed in European Patent Number EP-506477; Vascular
Endothelial Growth Factor-2 (VEGF-2), as disclosed in International
Publication Number WO 96/39515; Vascular Endothelial Growth Factor B-186
(VEGF-B 186), as disclosed in International Publication Number WO
96/26736; Vascular Endothelial Growth Factor-D (VEGF-D), as disclosed in
International Publication Number WO 98/02543; Vascular Endothelial Growth
Factor-D (VEGF-D), as disclosed in International Publication Number WO
98/07832; and Vascular Endothelial Growth Factor-E (VEGF-E), as disclosed
in German Patent Number DE19639601. The above mentioned references are
incorporated herein by reference herein.
In an additional embodiment, the compositions of the invention are
administered in combination with Fibroblast Growth Factors. Fibroblast
Growth Factors that may be administered with the compositions of the
invention include, but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4,
FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-12, FGF-13,
FGF-14, and FGF-15.
In additional embodiments, the compositions of the invention are administered
in combination with other therapeutic or prophylactic regimens, such as, for
example, radiation therapy.
Chromosome Assays
The nucleic acid molecules of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to and can
hybridize with a particular location on an individual human chromosome.
Moreover, there is a current need for identifying particular sites on the
chromosome. Few chromosome marking reagents based on actual sequence



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
211
data (repeat polymorphisms) are presently available for marking chromosomal
location. The mapping of DNAs to chromosomes according to the present
invention is an important first step in correlating those sequences with genes
associated with disease.
In certain preferred embodiments in this regard, the cDNAs herein
disclosed are used to clone genomic DNA of a TNFR protein gene. This can
be accomplished using a variety of well known techniques and libraries, which
generally are available commercially. The genomic DNA then is used for in
situ chromosome mapping using well known techniques for this purpose.
l0 In addition, in some cases, sequences can be mapped to chromosomes
by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer
analysis of the 3' untranslated region of the gene is used to rapidly select
primers that do not span more than one exon in the genomic DNA, thus
complicating the amplification process. These primers are then used for PCR
screening of somatic cell hybrids containing individual human chromosomes.
Fluorescence in situ hybridization ("FISH") of a cDNA clone to a metaphase
chromosomal spread can be used to provide a precise chromosomal location in
one step. This technique can be used with probes from the cDNA as short as
50 or 60 bp. For a review of this technique, see Verma et al., Human
Chromosomes: A Manual Of Basic Techniques, Pergamon Press, New York
(1988).
Once a sequence has been mapped to a precise chromosomal location,
the physical position of the sequence on the chromosome can be correlated
with genetic map data. Such data are found, for example, in V. McKusick,
Mendelian Inheritance In Man, available on-line through Johns Hopkins
University, Welch Medical Library. The relationship between genes and
diseases that have been mapped to the same chromosomal region are then
identified through linkage analysis (coinheritance of physically adjacent
genes).



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
212
Next, it is necessary to determine the differences in the cDNA or
genomic sequence between affected and unaffected individuals. If a mutation is
observed in some or all of the affected individuals but not in any normal
individuals, then the mutation is likely to be the causative agent of the
disease.
Having generally described the invention, the same will be more readily
understood by reference to the following examples, which are provided by
way of illustration and are not intended as limiting.
Examples
Example 1: Expression and Purification of TNFR-6 alpha and TNFR-6
beta in E. coli
The bacterial expression vector pQE60 is used for bacterial expression
in this example (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311).
pQE60 encodes ampicillin antibiotic resistance ("Ampr") and contains a
bacterial origin of replication ("ori"), an IPTG inducible promoter, a
ribosome
binding site ("RBS"), six codons encoding histidine residues that allow
affinity
purification using nickel-nitrilo-tri-acetic acid ("Ni-NTA") affinity resin
sold
by QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites.
These elements are arranged such that a DNA fragment encoding a
polypeptide may be inserted in such as way as to produce that polypeptide
2o with the six His residues (i.e., a "6 X His tag") covalently linked to the
carboxyl terminus of that polypeptide. However, in this example, the
polypeptide coding sequence is inserted such that translation of the six His
codons is prevented and, therefore, the polypeptide is produced with no 6 X
His tag.
The DNA sequences encoding the desired portions of TNFR-6 alpha
and TNFR-6 beta proteins comprising the mature forms of the TNFR-6 alpha
and TNFR-6 beta amino acid sequences are amplified from the deposited



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
213
cDNA clones using PCR oligonucleotide primers which anneal to the amino
terminal sequences of the desired portions of the TNFR-6a or -6(3 proteins
and to sequences in the deposited constructs 3' to the cDNA coding sequence.
Additional nucleotides containing restriction sites to facilitate cloning in
the
pQE60 vector are added to the 5' and 3' sequences, respectively.
For cloning the mature form of the TNFR-6a protein, the 5' primer
has the sequence 5' CGCCCATGGCAGAAACACCCACCTAC 3' (SEQ ID
NO:19) containing the underlined Ncol restriction site. One of ordinary skill
in the art would appreciate, of course, that the point in the protein coding
1 o sequence where the 5' primer begins may be varied to amplify a desired
portion of the complete protein shorter or longer than the mature form. The 3'
primer has the sequence 5' CGCAAGCTTCTCTTTCAGTGCAAGTG 3'
(SEQ ID N0:20) containing the underlined HindIII restriction site. For cloning
the mature form of the TNFR-6(3 protein, the 5' primer has the sequence of
SEQ ID N0:19 above, and the 3' primer has the sequence 5'
CGCAAGCTTCTCCTCAGCTCCTGCAGTG 3' (SEQ ID N0:21)
containing the underlined HindIII restriction site.
The amplified TNFR-6 alpha and TNFR-6 beta DNA fragments and
the vector pQE60 are digested with Ncol and HindIII and the digested DNAs
2o are then ligated together. Insertion of the TNFR-6 alpha and TNFR-6 beta
DNA into the restricted pQE60 vector places the TNFR-6 alpha and TNFR-6
beta protein coding region including its associated stop codon downstream
from the IPTG-inducible promoter and in-frame with an initiating AUG. The
associated stop codon prevents translation of the six histidine codons
downstream of the insertion point.
The ligation mixture is transformed into competent E. coli cells using
standard procedures such as those described in Sambrook et al., Molecular



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
214
Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY ( 1989). E. coli strain M 15/rep4, containing
multiple copies of the plasmid pREP4, which expresses the lac repressor and
confers kanamycin resistance ("Kanr"), is used in carrying out the
illustrative
example described herein. This strain, which is only one of many that are
suitable for expressing TNFR-6a or -6~3 protein, is available commercially
from QIAGEN, Inc., supra. Transformants are identified by their ability to
grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA
is isolated from resistant colonies and the identity of the cloned DNA
confirmed by restriction analysis, PCR and DNA sequencing.
Clones containing the desired constructs are grown overnight ("O/N")
in liquid culture in LB media supplemented with both ampicillin (100 gg/ml)
and kanamycin (25 gg/ml). The O/N culture is used to inoculate a large
culture, at a dilution of approximately 1:25 to 1:250. The cells are grown to
an
optical density at 600 nm ("OD600") of between 0.4 and 0.6. isopropyl-f3-D-
thiogalactopyranoside ("IPTG") is then added to a final concentration of 1
mM to induce transcription from the lac repressor sensitive promoter, by
inactivating the lacI repressor. Cells subsequently are incubated further for
3
to 4 hours. Cells then are harvested by centrifugation.
2o To purify the TNFR-6 alpha and TNFR-6 beta polypeptide, the cells
are then stirred for 3-4 hours at 4° C in 6M guanidine-HC1, pH 8. The
cell
debris is removed by centrifugation, and the supernatant containing the TNFR-
6 alpha and TNFR-6 beta is dialyzed against 50 mM Na-acetate buffer pH 6,
supplemented with 200 mM NaCI. Alternatively, the protein can be
successfully refolded by dialyzing it against 500 mM NaCI, 20% glycerol, 25
mM Tris/HCl pH 7.4, containing protease inhibitors. After renaturation the
protein can be purified by ion exchange, hydrophobic interaction and size



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
215
exclusion chromatography. Alternatively, an affinity chromatography step
such as an antibody column can be used to obtain pure TNFR-6 alpha and
TNFR-6 beta protein. The purified protein is stored at 4° C or frozen
at -80°
C.
The following alternative method may be used to purify TNFR-6a or -
6(3 expressed in E coli when it is present in the form of inclusion bodies.
Unless otherwise specified, all of the following steps are conducted at 4-
10°C.
Upon completion of the production phase of the E. coli fermentation,
the cell culture is cooled to 4-10°C and the cells are harvested by
continuous
centrifugation at 15,000 rpm (Heraeus Sepatech). On the basis of the expected
yield of protein per unit weight of cell paste and the amount of purified
protein required, an appropriate amount of cell paste, by weight, is suspended
in a buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The
cells are dispersed to a homogeneous suspension using a high shear mixer.
The cells ware then lysed by passing the solution through a
microfluidizer (Microfuidics, Corp. or APV Gaulin, Inc.) twice at 4000-6000
psi. The homogenate is then mixed with NaCI solution to a final concentration
of 0.5 M NaCI, followed by centrifugation at 7000 xg for 15 min. The
resultant pellet is washed again using O.SM NaCI, 100 mM Tris, 50 mM
2o EDTA, pH 7.4.
The resulting washed inclusion bodies are solubilized with 1.5 M
guanidine hydrochloride (GnHCI) for 2-4 hours. After 7000 xg centrifugation
for 15 min., the pellet is discarded and the TNFR-6a or -6(3
polypeptide-containing supernatant is incubated at 4°C overnight to
allow
~~her GnHCI extraction.
Following high speed centrifugation (30,000 xg) to remove insoluble
particles, the GnHCI solubilized protein is refolded by quickly mixing the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
216
GnHCI extract with 20 volumes of buffer containing 50 mM sodium, pH 4.5,
150 mM NaCI, 2 mM EDTA by vigorous stirring. The refolded diluted
protein solution is kept at 4°C without mixing for 12 hours prior to
further
purification steps.
To clarify the refolded TNF receptor polypeptide solution, a
previously prepared tangential filtration unit equipped with 0.16 p,m
membrane filter with appropriate surface area (e.g., Filtron), equilibrated
with
40 mM sodium acetate, pH 6.0 is employed. The filtered sample is loaded
onto a canon exchange resin (e.g., Poros HS-50, Perseptive Biosystems). The
l0 column is washed with 40 mM sodium acetate, pH 6.0 and eluted with 250
mM, 500 mM, 1000 mM, and 1500 mM NaCI in the same buffer, in a
stepwise manner. The absorbance at 280 mm of the effluent is continuously
monitored. Fractions are collected and further analyzed by SDS-PAGE.
Fractions containing the TNF receptor polypeptide are then pooled
15 and mixed with 4 volumes of water. The diluted sample is then loaded onto a
previously prepared set of tandem columns of strong anion (Poros HQ-50,
Perseptive Biosystems) and weak anion (Poros CM-20, Perseptive
Biosystems) exchange resins. The columns are equilibrated with 40 mM
sodium acetate, pH 6Ø Both columns are washed with 40 mM sodium
20 acetate, pH 6.0, 200 mM NaCI. The CM-20 column is then eluted using a 10
column volume linear gradient ranging from 0.2 M NaCI, 50 mM sodium
acetate, pH 6.0 to 1.0 M NaCI, 50 mM sodium acetate, pH 6.5. Fractions are
collected under constant AZBo monitoring of the effluent. Fractions containing
the TNFR-6a or -6(3 polypeptide (determined, for instance, by 16% SDS-
25 PAGE) are then pooled.
The resultant TNF receptor polypeptide exhibits greater than 95%
purity after the above refolding and purification steps. No major contaminant



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
217
bands are observed from Commassie blue stained 16% SDS-PAGE gel when 5
~g of purified protein is loaded. The purified protein is also tested for
endotoxin/LPS contamination, and typically the LPS content is less than 0.1
ng/ml according to LAL assays.
Example 2: Cloning and Expression of TNFR-6 alpha and TNFR-6 beta
proteins in a Baculovirus Expression System
In this illustrative example, the plasmid shuttle vector pA2 is used to
insert the cloned DNA encoding complete protein, including its naturally
associated secretory signal (leader) sequence, into a baculovirus to express
the
to mature TNFR-6cc or -6~3 protein, using standard methods as described in
Summers et al., A Manual of Methods for Baculovirus Vectors and Insect Cell
Culture Procedures, Texas Agricultural Experimental Station Bulletin No.
1555 (1987). This expression vector contains the strong polyhedrin promoter
of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed
by convenient restriction sites such as BamHI, Xba I and Asp718. The
polyadenylation site of the simian virus 40 ("SV40") is used for efficient
polyadenylation. For easy selection of recombinant virus, the plasmid
contains the beta-galactosidase gene from E. coli under control of a weak
Drosophila promoter in the same orientation, followed by the polyadenylation
2o signal of the polyhedrin gene. The inserted genes are flanked on both sides
by
viral sequences for cell-mediated homologous recombination with wild-type
viral DNA to generate a viable virus that express the cloned polynucleotide.
Many other baculovirus vectors could be used in place of the vector
above, such as pAc373, pVL941 and pAcIMI, as one skilled in the art would
readily appreciate, as long as the construct provides appropriately located
signals for transcription, translation, secretion and the like, including a
signal



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
218
peptide and an in-frame AUG as required. Such vectors are described, for
instance, in Luckow et al., Virology 170:31-39 (1989).
The cDNA sequence encoding the full length TNFR-6a or -6(3 protein
in a deposited clone, including the AUG initiation codon and the naturally
associated leader sequence shown in SEQ ID N0:2 or 4 is amplified using PCR
oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.
The 5' primer for TNFR-6 alpha and TNFR-6 beta has the sequence
5'CGCGGATCCGCCATCATGAGGGCGTGGAGGGGCCAG3'(SEQ
ID N0:22) containing the underlined BamHI restriction enzyme site. All of
the previously described primers encode an efficient signal for initiation of
translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol.
196:947-950 (1987). The 3' primer for TNFR-6a has the sequence
5' CGCGGTACCCTCTTTCAGTGCAAGTG 3' (SEQ ID N0:23)
containing the underlined Asp718 restriction site. The 3' primer for TNFR-6(3
has the sequence 5' CGCGGTACCCTCCTCAGCTCCTGCAGTG 3' (SEQ
ID N0:24) containing the underlined Asp718 restriction site.
The amplified fragment is isolated from a 1% agarose gel using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The
fragment then is digested with the appropriate restriction enzyme for each of
2o the primers used, as specified above, and again is purified on a 1 %
agarose gel.
The plasmid is digested with the same restriction enzymes and
optionally, can be dephosphorylated using calf intestinal phosphatase, using
routine procedures known in the art. The DNA is then isolated from a 1%
agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La
Jolla, Ca.).
The fragment and dephosphorylated plasmid are ligated together with
T4 DNA ligase. E. coli HB101 or other suitable E. coli hosts such as XL-1



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
219
Blue (Statagene Cloning Systems, La Jolla, CA) cells are transformed with the
ligation mixture and spread on culture plates. Bacteria are identified that
contain the plasmid with the human TNF receptor gene by digesting DNA
from individual colonies using the enzymes used immediately above and then
analyzing the digestion product by gel electrophoresis. The sequence of the
cloned fragment is confirmed by DNA sequencing. This plasmid is designated
herein pA2-TNFR-6a or pA2TNFR-6(3 (collectively pA2-TNFR).
Five gg of the plasmid pA2-TNFR is co-transfected with 1.0 gg of a
commercially available linearized baculovirus DNA ("BaculoGoldTM
baculovirus DNA", Pharmingen, San Diego, CA), using the lipofection method
described by Felgner et al., Proc. Natl. Acad. Sci. USA 84: 7413-7417 ( 1987).
One p g of BaculoGoldTM virus DNA and 5 p g of the plasmid pA2-TNFR are
mixed in a sterile well of a microtiter plate containing 50 ~ 1 of serum-free
Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards, 10
gl Lipofectin plus 90 ~l Grace's medium are added, mixed and incubated for 15
mW utes at room temperature. Then the transfection mixture is added drop-
wise to Sf~ insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture
plate with 1 ml Grace's medium without serum. The plate is then incubated
for 5 hours at 27° C. The transfection solution is then removed from
the plate
and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is
added. Cultivation is then continued at 27° C for four days.
After four days the supernatant is collected and a plaque assay is
performed, as described by Summers and Smith, supra. An agarose gel with
"Blue Gal" (Life Technologies Inc., Gaithersburg) is used to allow easy
identification and isolation of gal-expressing clones, which produce blue-
stained plaques. (A detailed description of a "plaque assay" of this type can
also be found in the user's guide for insect cell culture and baculovirology



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
220
distributed by Life Technologies Inc., Gaithersburg, page 9-IO). After
appropriate incubation, blue stained plaques are picked with the tip of a
micropipettor (e.g., Eppendorf). The agar containing the recombinant viruses
is then resuspended in a microcentrifuge tube containing 200 ql of Grace's
medium and the suspension containing the recombinant baculovirus is used to
infect Sf~ cells seeded in 35 mm dishes. Four days later the supernatants of
these culture dishes are harvested and then they are stored at 4° C.
To verify the expression of the TNF receptor gene Sf~ cells are grown
in Grace's medium supplemented with I O% heat-inactivated FBS. The cells
are infected with the recombinant baculovirus at a multiplicity of infection
("MOI") of about 2. If radiolabeled proteins are desired, 6 hours later the
medium is removed and is replaced with SF900 II medium minus methionine
and cysteine (available from Life Technologies Inc., Rockville, MD). After 42
hours, 5 ~Ci of 35S-methionine and 5 p.Ci 35S-cysteine (available from
Amersham) are added. The cells are further incubated for 16 hours and then
are harvested by centrifugation. The proteins in the supernatant as well as
the
intracellular proteins are analyzed by SDS-PAGE followed by
autoradiography (if radiolabeled).
Microsequencing of the amino acid sequence of the amino terminus of
purified protein may be used to determine the amino terminal sequence of the
mature form of the TNF receptor protein.
Example 3: Cloning and Expression of TNFR-6 alpha and TNFR-6 beta in
Mammalian Cells
A typical mammalian expression vector contains the promoter element,
which mediates the initiation of transcription of mRNA, the protein coding
sequence, and signals required for the termination of transcription and
polyadenylation of the transcript. Additional elements include enhancers,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
221
Kozak sequences and intervening sequences flanked by donor and acceptor
sites for RNA splicing. Highly efficient transcription can be achieved with
the
early and late promoters from SV40, the long terminal repeats (LTRs) from
Retroviruses, e.g., RSV, HTLVI, HIVI and the early promoter of the
cytomegalovirus (CMV). However, cellular elements can also be used (e.g.,
the human actin promoter). Suitable expression vectors for use in practicing
the present invention include, for example, vectors such as pSVL and pMSG
(Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC
37146) and pBCI2MI (ATCC 67109). Mammalian host cells that could be
l0 used include, human Hela, 293, H9 and Jurkat cells, mouse NIH3T3 and C 127
cells, Cos 1, Cos 7 and CVl, quail QC1-3 cells, mouse L cells and Chinese
hamster ovary (CHO) cells.
Alternatively, the gene can be expressed in stable cell lines that contain
the gene integrated into a chromosome. The co-transfection with a selectable
marker such as dhfr, gpt, neomycin, hygromycin allows the identification and
isolation of the transfected cells.
The transfected gene can also be amplified to express large amounts of
the encoded protein. The DHFR (dihydrofolate reductase) marker is useful to
develop cell lines that carry several hundred or even several thousand copies
of
the gene of interest. Another useful selection marker is the enzyme glutamine
synthase (GS) (Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et
al., BiolTechnology 10:169-175 (1992)). Using these markers, the mammalian
cells are grown in selective medium and the cells with the highest resistance
are
selected. These cell lines contain the amplified genes) integrated into a
chromosome. Chinese hamster ovary (CHO) and NSO cells are often used for
the production of proteins.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
222
The expression vectors pC 1 and pC4 contain the strong promoter
(LTR) of the Rous Sarcoma Virus (Cullen et al., Molecular and Cellular
Biology, 438-447 (March, 1985)) plus a fragment of the CMV-enhancer
(Boshart et al., Cell 41:521-530 (1985)). Multiple cloning sites, e.g., with
the
restriction enzyme cleavage sites BamHI, XbaI and Asp718, facilitate the
cloning of the gene of interest. The vectors contain in addition the 3'
intron,
the polyadenylation and termination signal of the rat preproinsulin gene.
Example 3(a): Cloning and Expression in COS Cells
The expression plasmid, pTNFR-cc-HA and -6(3-HA, is made by
to cloning a portion of the cDNA encoding the mature form of the TNF receptor
protein into the expression vector pcDNAI/Amp or pcDNAIII (which can be
obtained from Invitrogen, Inc.).
The expression vector pcDNAI/amp contains: (1) an E. coli origin of
replication effective for propagation in E. coli and other prokaryotic cells;
(2)
an ampicillin resistance gene for selection of plasmid-containing prokaryotic
cells; (3) an SV40 origin of replication for propagation in eukaryotic cells;
(4) a
CMV promoter, a polylinker, an SV40 intron; (5) several codons encoding a
hemagglutinin fragment (i.e., an "HA" tag to facilitate purification) followed
by
a termination codon and polyadenylation signal arranged so that a cDNA can
be conveniently placed under expression control of the CMV promoter and
operably linked to the SV40 intron and the polyadenylation signal by means of
restriction sites in the polylinker. The HA tag corresponds to an epitope
derived from the influenza hemagglutinin protein described by Wilson et al.,
Cell 37: 767 (1984). The fusion of the HA tag to the target protein allows
easy detection and recovery of the recombinant protein with an antibody that
recognizes the HA epitope. pcDNAIII contains, in addition, the selectable
neomycin marker.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
223
A DNA fragment encoding the complete TNF receptor polypeptide is
cloned into the polylinker region of the vector so that recombinant protein
expression is directed by the CMV promoter. The plasmid construction
strategy is as follows. The TNF receptor cDNA of a deposited clone is
amplified using primers that contain convenient restriction sites, much as
described above for construction of vectors for expression of a TNF receptor
in E. coli. Suitable primers can easily be designed by those of ordinary skill
in
the art.
The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are
l0 digested with Xbal and EcoRI and then ligated. The ligation mixture is
transformed into E. coli strain SURE (available from Stratagene Cloning
Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037), and the
transformed culture is plated on ampicillin media plates which then are
incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is
15 isolated from resistant colonies and examined by restriction analysis or
other
means for the presence of the fragment encoding the TNFR-a and -6(3
polypeptides.
For expression of recombinant TNFR-a and -6(3, COS cells are
transfected with an expression vector, as described above, using DEAE-
2o DEXTRAN, as described, for instance, in Sambrook et al., Molecular
Cloning.'
a Laboratory Manual, Cold Spring Laboratory Press, Cold Spring Harbor,
New York (1989). Cells are incubated under conditions for expression of
TNFR by the vector.
Expression of the pTNFR-a-HA and -6(3-HA fusion protein is
25 detected by radiolabeling and immunoprecipitation, using methods described
in, for example Harlow et al., Antibodies: A Laboratory Manual, 2nd Ed.; Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, New York ( 1988). To



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686-
224
this end, two days after transfection, the cells are labeled by incubation in
media containing 3sS_cysteine for 8 hours. The cells and the media are
collected, and the cells are washed and the lysed with detergent-containing
RIPA buffer: 150 mM NaCI, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC,
50 mM TRIS, pH 7.5, as described by Wilson et al.cited above. Proteins are
precipitated from the cell lysate and from the culture media using an HA-
specific monoclonal antibody. The precipitated proteins then are analyzed by
SDS-PAGE and autoradiography. An expression product of the expected size
is seen in the cell lysate, which is not seen in negative controls.
Example 3(b): Cloning and Expression in CHO Cells
The vector pC4 is used for the expression of TNFR-6 alpha and TNFR-6 beta
polypeptides. Plasmid pC4 is a derivative of the plasmid pSV2-dhfr (ATCC
Accession No. 37146). The plasmid contains the mouse DHFR gene under
control of the SV40 early promoter. Chinese hamster ovary- or other cells
lacking dihydrofolate activity that are transfected with these plasmids can be
selected by growing the cells in a selective medium (alpha minus MEM, Life
Technologies) supplemented with the chemotherapeutic agent methotrexate.
The amplification of the DHFR genes in cells resistant to methotrexate (MTX)
has been well documented (see, e.g., Alt, F. W., Kellems, R. M., Bertino, J.
R.,
and Schimke, R. T., 1978, J. Biol. Chem. 253:1357-1370, Hamlin, J. L. and
Ma, C. 1990, Biochem. et Biophys. Acta, 1097:107-143, Page, M. J. and
Sydenham, M. A. 1991, Biotechnology 9:64-68). Cells grown in increasing
concentrations of MTX develop resistance to the drug by overproducing the
target enzyme, DHFR, as a result of amplification of the DHFR gene. If a
second gene is linked to the DHFR gene, it is usually co-amplified and over-
expressed. It is known in the art that this approach may be used to develop
cell lines carrying more than 1,000 copies of the amplified gene(s).



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
225
Subsequently, when the methotrexate is withdrawn, cell lines are obtained
which contain the amplified gene integrated into one or more chromosomes) of
the host cell.
Plasmid pC4 contains for expressing the gene of interest the strong
promoter of the long terminal repeat (LTR) of the Rouse Sarcoma Virus
(Cullen, et al., Molecular and Cellular Biology, March 1985:438-447) plus a
fragment isolated from the enhancer of the immediate early gene of human
cytomegalovirus (CMV) (Boshart et al., Cell 41:521-530 (1985)).
Downstream of the promoter are the following single restriction enzyme
cleavage sites that allow the integration of the genes: BamHI, Xba I, and
Asp718. Behind these cloning sites the plasmid contains the 3' intron and
polyadenylation site of the rat preproinsulin gene. Other high efficiency
promoters can also be used for the expression, e.g., the human 13-actin
promoter, the SV40 early or late promoters or the long terminal repeats from
other retroviruses, e.g., HIV and HTLVI. Clontech's Tet-Off and Tet-On
gene expression systems and similar systems can be used to express the TNF
receptor polypeptide in a regulated way in mammalian cells (Gossen, M., &
Bujard, H., Proc. Natl. Acad. Sci. USA 89:5547-5551 (1992)). For the
polyadenylation of the mRNA other signals, e.g., from the human growth
2o hormone or globin genes can be used as well. Stable cell lines carrying a
gene of
interest integrated into the chromosomes can also be selected upon co-
transfection with a selectable marker such as gpt, 6418 or hygromycin. It is
advantageous to use more than one selectable marker in the beginning, e.g.,
6418 plus methotrexate.
The plasmid pC4 is digested with the restriction enzymes appropriate for the
specific primers used to amplify the TNF receptor of choice as outlined below
and then dephosphorylated using calf intestinal phosphates by procedures



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
226
known in the art. The vector is then isolated from a 1 % agarose gel.
The DNA sequence encoding the TNF receptor polypeptide is amplified using
PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the
desired portion of the gene. The 5' primer for TNFR-6 alpha and TNFR-6
beta containing the underlined BamHI site, has the following sequence:
5'CGCGGATCCGCCATCATGAGGGCGTGGAGGGGCCAG3'(SEQ
ID N0:22). The 3' primer for TNFR-6a has the sequence
5' CGCGGTACCCTCTTTCAGTGCAAGTG 3' (SEQ ID N0:23)
containing the underlined Asp718 restriction site. The 3' primer for TNFR-6(3
1o has the sequence 5' CGCGGTACCCTCCTCAGCTCCTGCAGTG 3' (SEQ
ID N0:24) containing the underlined Asp718 restriction site.
The amplified fragment is digested with the endonucleases which will cut at
the engineered restriction sites) and then purified again on a 1 % agarose
gel.
The isolated fragment and the dephosphorylated vector are then ligated with
T4 DNA ligase. E. coli HB 101 or XL-1 Blue cells are then transformed and
bacteria are identified that contain the fragment inserted into plasmid pC4
using, for instance, restriction enzyme analysis.
Chinese hamster ovary cells lacking an active DHFR gene are used for
transfection. Five pg of the expression plasmid pC4 is cotransfected with 0.5
pg of the plasmid pSVneo using lipofectin (Felgner et al., supra). The plasmid
pSV2-neo contains a dominant selectable marker, the neo gene from Tn5
encoding an enzyme that confers resistance to a group of antibiotics including
6418. The cells are seeded in alpha minus MEM supplemented with 1 mg/ml
6418. After 2 days, the cells are trypsinized and seeded in hybridoma cloning
plates (Greiner, Germany) in alpha minus MEM supplemented with 10, 25, or
50 ng/ml of metothrexate plus 1 mg/ml 6418. After about 10-14 days single
clones are trypsinized and then seeded in 6-well petri dishes or 10 ml flasks



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
227
using different concentrations of methotrexate (50 nM, 100 nM, 200 nM, 400
nM, 800 nM). Clones growing at the highest concentrations of methotrexate
are then transferred to new 6-well plates containing even higher
concentrations
of methotrexate (1 pM, 2 pM, 5 gM, 10 mM, 20 mM). The same procedure
is repeated until clones are obtained which grow at a concentration of 100 -
200 pM. Expression of the desired gene product is analyzed, for instance, by
SDS-PAGE and Western blot or by reversed phase HPLC analysis.
Example 4: Tissue distribution of TNF receptor mRNA expression
1o Northern blot analysis is carried out to examine TNFR-6a or -6(3 gene
expression in human tissues, using methods described by, among others,
Sambrook et al., cited above. A cDNA probe containing the entire nucleotide
sequence of a TNF receptor protein (SEQ ID NO:1 or 3) is labeled with 3zP
using the rediprimeTM DNA labeling system (Amersham Life Science),
according to manufacturer's instructions. After labeling, the probe is
purified
using a CHROMA SPIN-100TM column (Clontech Laboratories, Inc.),
according to manufacturer's protocol number PT1200-1. The purified labeled
probe is then used to examine various human tissues for TNF receptor mRNA.
Multiple Tissue Northern (MTN) blots containing various human
tissues (H) or human immune system tissues (IM) are obtained from Clontech
and are examined with the labeled probe using ExpressHybTM hybridization
solution (Clontech) according to manufacturer's protocol number PT1190-1.
Following hybridization and washing, the blots are mounted and exposed to
film at -70° C overnight, and films developed according to standard
procedures.
It will be clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and examples. Numerous
modifications and variations of the present invention are possible in light of



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
228
the above teachings and, therefore, are within the scope of the appended
claims.
Example 5: Gene Therapy Using Endogenous TNFR-6 Gene
Another method of gene therapy according to the present invention
involves operably associating the endogenous TNFR (i.e., TNFR-6) sequence
with a promoter via homologous recombination as described, for example, in
U.S. Patent No. 5,641,670, issued June 24, 1997; International application
publication number WO 96/29411, published September 26, 1996;
1o International application publication number WO 94/12650, published August
4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and
Zijlstra et al., Nature 342:435-438 (1989). This method involves the
activation of a gene which is present in the target cells, but which is not
expressed in the cells, or is expressed at a lower level than desired.
Polynucleotide constructs are made which contain a promoter and targeting
sequences, which are homologous to the 5' non-coding sequence of endogenous
TNFR-6, flanking the promoter. The targeting sequence will be sufficiently
near the 5' end of TNFR-5 so the promoter will be operably linked to the
endogenous sequence upon homologous recombination. The promoter and the
2o targeting sequences can be amplified using PCR. Preferably,the amplified
promoter contains distinct restriction enzyme sites on the 5' and 3' ends.
Preferably, the 3' end of the first targeting sequence contains the same
restriction enzyme site as the 5' end of the amplified promoter and the 5' end
of the second targeting sequence contains the same restriction site as the 3'
end
of the amplified promoter.
The amplified promoter and the amplified targeting sequences are
digested with the appropriate restriction enzymes and subsequently treated
with calf intestinal phosphatase. The digested promoter and digested targeting
sequences are added together in the presence of T4 DNA ligase. The resulting



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
229
mixture is maintained under conditions appropriate for ligation of the two
fragments. The construct is size fractionated on an agarose gel then purified
by phenol extraction and ethanol precipitation.
In this Example, the polynucleotide constructs are administered as
naked polynucleotides via electroporation. However, the polynucleotide
constructs may also be administered with transfection-facilitating agents,
such
as liposomes, viral sequences, viral particles, precipitating agents, etc.
Such
methods of delivery are known in the art.
Once the cells are transfected, homologous recombination will take
1 o place which results in the promoter being operably linked to the
endogenous
TNFR-6 sequence. This results in the expression of TNFR-6 in the cell.
Expression may be detected by immunological staining, or any other method
known in the art.
Fibroblasts are obtained from a subject by skin biopsy. The resulting
tissue is placed in DMEM + 10% fetal calf serum. Exponentially growing or
early stationary phase fibroblasts are trypsinized and rinsed from the plastic
surface with nutrient medium. An aliquot of the cell suspension is removed for
counting, and the remaining cells are subjected to centrifugation. The
supernatant is aspirated and the pellet is resuspended in 5 ml of
2o electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCI, 5 mM KCI,
0.7 mM Na2 HP04, 6 mM dextrose). The cells are recentrifuged, the
supernatant aspirated, and the cells resuspended in electroporation buffer
containing 1 mg/ml acetylated bovine serum albumin. The final cell suspension
contains approximately 3X106 cells/ml. Electroporation should be performed
immediately following resuspension.
Plasmid DNA is prepared according to standard techniques. For
example, to construct a plasmid for targeting to the TNFR-6 locus, plasmid
pUC 18 (MBI Fermentas, Amherst, NY) is digested with HindIII. The CMV
promoter is amplified by PCR with an XbaI site on the 5' end and a BamHI



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
230
site on the 3' end. Two TNFR-6 non-coding sequences are amplified via PCR:
one TNFR-6 non-coding sequence (TNFR-6 fragment 1) is amplified with a
HindIII site at the 5' end and an Xba site at the 3' end; the other TNFR-6 non-

coding sequence (TNFR-6 fragment 2) is amplified with a BamHI site at the
5'end and a HindIII site at the 3' end. The CMV promoter and TNFR-6
fragments are digested with the appropriate enzymes (CMV promoter - XbaI
and BamHI; TNFR-6 fragment 1 - Xbal; TNFR-6 fragment 2 - BamHI) and
ligated together. The resulting ligation product is digested with HindIII, and
ligated with the HindIII-digested pUC 18 plasmid.
Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap
(Bio- Rad). The final DNA concentration is generally at least 120 pg/ml. 0.5
ml
of the cell suspension (containing approximately 1.5.X106 cells) is then added
to the cuvette, and the cell suspension and DNA solutions are gently mixed.
Electroporation is performed with a Gene-Pulser apparatus (Bio-Rad).
Capacitance and voltage are set at 960 ~F and 250-300 V, respectively. As
voltage increases, cell survival decreases, but the percentage of surviving
cells
that stably incorporate the introduced DNA into their genome increases
dramatically. Given these parameters, a pulse time of approximately 14-20
mSec should be observed.
2o Electroporated cells are maintained at room temperature for
approximately 5 min, and the contents of the cuvette are then gently removed
with a sterile transfer pipette. The cells are added directly to 10 ml of
prewarmed nutrient media (DMEM with 15% calf serum) in a 10 cm dish and
incubated at 37°C. The following day, the media is aspirated and
replaced
with 10 ml of fresh media and incubated for a further 16-24 hours.
The engineered fibroblasts are then injected into the host, either alone
or after having been grown to confluence on cytodex 3 microcarner beads. The
fibroblasts now produce the protein product. The fibroblasts can then be
introduced into a patient as described above.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
231
Example 6: Effect of TNFR in treating graft-versus-host disease in mice
The invention also encompasses a method for the treatment of
refractory /severe acute GVHD in patients comprising administering to the
patients (preferably human), TNFR polypeptides or TNFR agonists of the
invention.
An analysis of the use of soluble TNFR polypeptides of the invention
(e.g., TNFR-6) to treat graft-versus-host disease (GVHD) is performed
1 o through the use of a C57BL/6 parent into (BALB/c X C57BL/6) F 1 mouse
model. This parent into F1 mouse model is a well-characterized and
reproducible animal model of GVHD in bone marrow transplant patients,
which is well known to one of ordinary skill in the art (see, e.g.,
Gleichemann
et al, Immunol Today 5:324, 1984, which is herein incorporated by reference
in its entirety). Soluble TNFR is expected to bind to Fast and inhibit FasL-
mediated apoptosis, which plays a critical pathogenic role in the hepatic,
cutaneous and lymphoid organ damage observed in this animal model of
GVHD (Baker et al, J. Exp. Med. 183:2645, (1996); Charles et al, J. Immunol.
157:5387, (1996); and Hattori et al, Blood 91:4051, (1998), each of which is
2o herein incorporated by reference in its entirety).
Initiation of the GVHD condition is induced by the intravenous
injection of ~1-3 x 108 spleen cells from C57BL/6 mice into (BALB/c X
C57BL/6) F1 mice (both are available from Jackson Lab, Bar Harbor, Maine).
Groups of 6 to 8 mice receive either 0.1 to 5.0 mg/kg of TNFR or human IgG
isotype control intraperitoneally or intradermally on every other day
following
the injection of spleen cells. The effect of TNFR on liver enzyme release in
the sera, an indicator of liver damage, is analyzed twice per week for at
least 3
weeks. When there is a significant amount of liver enzymes being detected in
human IgG-treated mice, the animals are sacrificed for histological evaluation
of



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
232
the relative degree of tissue damage in the liver, spleen, skin and intestine,
and
for the therapeutic effect TNFR has elicited on these organs.
The ability of TNFR to ameliorate systems associated with
refractory/severe acute GVHD is indicated by a reduction of liver enzyme
release in the sera, tissue damage and/or reduced cachexia, loss of body
weight
and/or lethality when compared to the control.
Finally, TNFR- and human IgG-treated animals undergo a clinical
evaluation every other day to assess cachexia, body weight and lethality.
to TNFR in combination therapy with TNF-a inhibitors may also be
examed in this GVHD murine model.
Example 7: TNFR-6a (DcR3) suppresses AIM II-mediated apoptosis
Background
The members of the tumor necrosis factor (TNF) family are involved in
regulating diverse biological activities such as regulation of cell
proliferation,
differentiation, cell survival, cell death, cytokine production, lymphocyte co-

stimulation, immunoglobulin secretion, and isotype switching (Armitage, R.,
Curr. Opin. Immunol. 6, 407-413 (1994); Tewari, M. et al., Curr. Opin.
2o Genet. Dev. 6, 39-44 (1996)). Receptors in this family share a common
structural motif in their extracellular domains consisting of multiple
cysteine-
rich repeats of approximately 30 to 40 amino acids (Gruss, H.-J., et al.,
Blood
85, 3378-3404 (1995)). While TNFR1, CD95/Fas/APO-1,
DR3/TRAMP/APO-3, DR4/TRAIL-R1/APO-2, DRS/TRAIL-R2, and DR6
receptors contain a conserved intracellular motif of 30 - 40 amino acids
called
death domain, associated with the activation of apoptotic signaling pathways,
other members which contain a low sequence identity in the intracellular
domains, stimulate the transcription factors NF-KB and AP-1 (Armitage, R.,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
233
Curr. Opin. Immunol. 6, 407-413 (1994); Tewari, M. et al., Curr. Opin.
Genet. Dev. 6, 39-44 (1996); Gruss, H.-J. et al., Blood 85, 3378-3404 (1995)).
Most TNF receptors contain functional cytoplasmic domain and they
include TNFR1 (Loetscher, H et al., Cell 61, 351-356 (1990); Schall, T. J., et
al., Cell 61, 361-370 (1990)), TNFR2 (Smith, C. A., et al., Science 248, 1019
1023 (1990)), lymphotoxin (3 receptors (LT(3R) (Baens, M., et al., Genomics
16, 214-218 (1993)), 4-1BB (Kwon, B. S., et al., Proc. Natl. Acad. Sci. USA
86, 1963-1967 (1989)), HVEM/TR2/ATAR (Kwon, B. S., et al., J. Biol.
Chem. 272, 14272-14276 (1997); Montgomery, R. L, et al., Cell 87, 427-436
l0 (1996); Hsu, H., et al., J. Biol. Chem. 272, 13471-13474 (1997)), NGFR
(Johnson, D., et al., Cell 47, 545-554 (1986)), CD27 (Van Lier, R. A., et al.,
J.
Immunol. 139, 1589-1596 (1987)), CD30 (Durkorp, H., et al., Cell 68, 421-
427 (1992)), CD40 (Banchereau, J., et al., Cell 68, 421-427 (1994)), OX40
(Mallett, S., et al., EMBO J. 9, 1063-1068 (1990)), Fas (Itoh, N., et al.,
Cell
66, 233-243 (1991)), DR3/TRAMP (Chinnaiyan, A. M., et al., Science 274,
990-992 (1996)), DR4/TRAIL-R1 (Pan, G., et al.,. Science 276, 111-113
(1996)), DR5/TRAIL-R2 (Pan, G., et al., Science 277, 815-818) (1997), and
RANK (Anderson, D. et al., Nature 390, 175-179 (1997)). Some members of
the TNFR superfamily do not have cytoplasmic domains and are secreted,
such as osteoprotegerin (OPG) (Simmonet, et al., Cell 89, 309-319 (1997)), or
linked to the membrane through a glycophospholipid tail, such as
TRID/DcRI/TRAIL-R3 (Degli-Esposti, M. A., et al., J. Exp. Med. 186,
1165-1170 (1997); Sheridan, J. P., et al., Science 277, 818-821 (1997)). Viral
open reading frames encoding soluble TNFRs have also been identified, such as
SFV-T2 (Smith, C. A., et al., Science 248, 1019-1023 (1990)), Va53 (Howad,
S. T., et al., Virology 180, 633-647 (1991)), G4RG (Hu, F. Q., et al.,
Virology
204, 343-356 (1994)), and crmB (Gruss, H.-J, et al., Blood 85, 3378-3404
(1995)).



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
234
By searching an expressed sequence tag (EST) database, a new member
of the TNFR superfamily was identified, named TNFR-6a, and was
characterized as a soluble cognate ligand for AIM-II and FasL/CD95L. AIM-II
and Fast mediate the apoptosis, which is the most common physiological
form of cell death and occurs during embryonic development, tissue
remodeling, immune regulation and tumor regression.
AIM-II is highly induced in activated T lymphocytes and
macrophages. AIM-II was characterized as a cellular ligand for HVEM/TR2
and LT(3R (Mauri, D. N., et al., Immunity 8, 21-30 (1998)). HVEM/TR2 is a
receptor for herpes simplex virus type 1 (HSV-1) entry into human T
lymphoblasts. Soluble form of HVEM/TR2-Fc and antibodies to HVEM/TR2
were shown to inhibit a mixed lymphocyte reaction, suggesting a role for this
receptor or its ligand in T lymphocyte proliferation (Kwon, B. et al., J.
Biol.
Chem. 272, 14272-14276 (1997); Mauri, D. N., et al., Immunity , 21-30
(1998); Harrop, J. A., et al., J. Immunol. 161, 1786-1794 (1998)). The level
of
LT(3R expression is prominent on epithelial cells but is absent in T and B
lymphocytes. Signaling via LT(3R triggers cell death in some adenocarcinomas
(Browning, J. L., et al., J. Exp. Med. 183, 867-878 (1996)). AIM-II produced
by activated lymphocytes could evoke immune modulation from
hematopoietic cells expressing only HVEM/TR2, and induce apoptosis of
tumor cells, which express both LT(3R and HVEM/TR2 receptors (Zhai, Y., et
al., J. Clin. Invest. 102, 1142-1151 (1998); Harrop, J. A., et al., J. Biol.
Chem. 273, 27548-27556 (1998)).
Fast is one of the major effectors of cytotoxic T lymphocytes and
natural killer cells. It is also involved in the establishment of peripheral
tolerance, in the activation-induced cell death of lymphocytes. Moreover,
expression of Fast in nonlymphoid and tumor cells contributes to the
maintenance of immune privilege of tissues by preventing the infiltration of



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
235
Fas-sensitive lymphocytes (Nagata, S., Cell 88, 355-365 (1997)). Fast is also
processed and shed from the surface of human cell (Schneider, P., et al., J.
Exp. Med. 187, 1205-1213 (1998)).
Here, we demonstrate that TNFR-6a, a new member of the TNFR
superfamily binds AIM-II and Fast. Therefore TNFR-6a, may act as an
inhibitor in AIM-II -induced tumor cell death by blocking AIM-II interaction
with its receptors.
Materials and Methods
Identification and cloning of new members of the TNFR superfamily.
An EST cDNA database, obtained from more than 600 different cDNA
libraries, was screened for sequence homology with the cysteine-rich motif of
the TNFR superfamily, using the blastn and tblastn algorithms. Three EST
clones containing an identical open reading frame whose amino acid sequence
showed significant homology to TNFR-II were identified from cDNA libraries
of human normal prostate and pancreas tumor. A full-length TNFR-6 alpha
cDNA clone encoding an intact N-terminal signal peptide was obtained from a
human normal prostate library.
RT PCR analysis.
2o For RT-PCR analysis, total RNA was isolated using Trizol (GIBCO)
from various human cell lines before and after stimulation with
PMA/Ionomycin or LPS. RNA was converted to cDNA by reverse
transcription and amplified for 35 cycles by PCR. Primers used for
amplification of the TNFR-6 alpha fragment are according to the sequence of
TNFR-6 alpha. (3-actin was used as an internal control for RNA integrity.
PCR products were run on 2% agarose gel, stained with ethidium bromide and
visualized by UV illumination.
Recombinant protein production and purification.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
236
The recombinant TNFR-6 alpha protein was produced with hexa-
histidine at the C-terminus. TNFR-6 alpha-(His) encoding the entire TNFR-6
alpha protein was amplified by PCR. For correctly oriented cloning, a HindIII
site on the 5' end of the forward primer (5'-AGACCCAAGCTTC
CTGCTCCA GCAAGGACCATG-3':SEQ ID N0:25) and a BamHI site on
the 5' end of the reverse primer (5'-
AGACGGGATCCTTAGTGGTGGTGGTGGTGGTGCAC
AGGGAGGAAGCGCTC-3':SEQ ID N0:26) were created. The amplified
fragment was cut with HindIII/BamHI and cloned into mammalian expression
to vector, pCEP4 (Invitrogen). The TNFR-6 alpha-(His)/pCEP4 plasmid was
stably transfected into HEK 293 EBNA cells to generate recombinant TNFR-6
alpha-(His). Serum free culture media from cells transfected TNFR-6 alpha-
(His)/pCEP4 were passed through Ni-column (Novagen). The column eluents
were fractionated by SDS-PAGE and TNFR-6 alpha-(His) was detected by
western blot analysis using the anti-poly(His)6 antibody (Sigma).
Production of HVEM/TR2-Fc, LT~3R-Fc and Flag-tagged soluble
AIM-II (soluble AIM-II) fusion proteins were previously described (Zhai, Y.,
et al., J. Clin. Invest. 102, 1142-1151(1998)). Fc fusion protein-containing
supernatants were filtered and trapped onto protein-G Sepharose beads. Flag-
2o tagged soluble AIM-II proteins were purified with anti-Flag mAb affinity
column.
Immunoprecipitation.
TNFR-6 alpha-(His) was incubated overnight with various Flag-tagged
ligands of TNF superfamily and anti-Flag agarose in binding buffer (150 mM
NaCI, 0.1% NP-40, 0.25% gelatin, 50 mM HEPES, pH 7.4) at 4°C, and
then
precipitated. The bound proteins were resolved by 12.5% SDS-PAGE and
detected by western blot with HRP-conjugated anti-poly(His)6 or anti-human
IgG 1 antibodies.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
237
Cell-binding assay.
For cell-binding assays, HEK 293 EBNA cells were stably transfected
using calcium phosphate method with pCEP4/full sequence of AIM-II cDNA
or pCEP4 vector alone. After selection with Hygromycin B, cells were
harvested with 1mM EDTA in PBS and incubated with TNFR-6 alpha-(His),
HVEM/TR2-Fc, or LT(3R-Fc for 20 minutes on ice. For detecting Fc-fusion
protein, cells were stained with FITC-conjugated goat anti-human IgG. To
detect TNFR-6 alpha binding, cells were stained with anti-poly(His)6 and
FITC conjugated goat anti-mouse IgG consecutively. The cells were analyzed
1o by FACScan (Becton Dickinson).
Cytotoxicity Assay.
Cytotoxicity assays using HT29 cells were carried out as described
previously (Browning, J. L., et al., J. Exp. Med. 183, 867-878 (1996)).
Briefly, 5000 HT29 cells were seeded in 96-well plates with 1% FBS, DMEM
and treated with soluble AIM-II ( 10 ng/ml) and 10 units/ml human
recombinant interferon-'y (IFN-y). Serial dilutions of TNFR-6 alpha-(His) were
added in quadruplicate to microtiter wells. Cells treated with IFN-~ and
soluble
AIM-II were incubated with various amounts of TNFR-6 alpha-(His) for 4
days before the addition of [3H]thymidine for the last 6 h of culture. Cells
2o were harvested, and thymidine incorporation was determined using a liquid
scintillation counter.
Results and Discussion
TNFR-6alpha is a new member- of the TNFR superfamily
TNFR-6 alpha was identified by searching an EST database. Three
clones containing an identical open reading frame were identified from cDNA
libraries of human normal prostate and pancreas tumor. A full-length TNFR-6
alpha cDNA encoding an intact N-terminal signal peptide was obtained from a
human normal prostate library. The open reading frame of TNFR-6 alpha



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
238
encodes 300 amino acids. To determine the N-terminal amino acid sequence of
mature TNFR-6 alpha, hexa-histidine tagged TNFR-6 alpha was expressed in
mammalian cell expression system and the N-terminal amino acid sequence
were determined by peptide sequencing. The N-terminal sequence of the
processed mature TNFR-6 alpha-(His) started from amino acid 30, indicating
that the first 29 amino acids constituted the signal sequence. Therefore, the
mature protein of TNFR-6 alpha was composed of 271 amino acids with no
transmembrane region. There was one potential N-linked glycosylation site
(Asn173) in TNFR-6 alpha. Like OPG (Simmonet, W. et al., Cell 89, 309-319
(1997)), the predicted protein was a soluble, secreted protein and the
recombinant TNFR-6 alpha expressed in mammalian cells was ~40 kD as
estimated on polyacrylamide gel. Alignment of the amino sequences of
TNFR-I, TNFR-II, 4-1BB, TR2/HVEM, LT(3R, TR1/OPG and TNFR-6
alpha illustrated the existence of a potential cysteine-rich motif. TNFR-6
alpha contained two perfect and two imperfect cysteine-rich motifs and its
amino acid sequence was remarkably similar to TR1/OPG amino acid
sequence. TNFR-6 alpha shares ~30% sequence homology with OPG and
TNFR-II.
mRNA expression
We analyzed expression of TNFR-6 alpha mRNA in human multiple
tissues by Northern blot hybridization. Northern blot analyses indicated that
TNFR-6 alpha mRNA was ~1.3 kb in length and was expressed
predominantly in lung tissue and colorectal adenocarcinoma cell line SW480.
RT-PCR analyses were performed to determine the expression patterns of
TNFR-6 alpha in various cell lines. TNFR-6 alpha transcript was detected
weakly in most hematopoietic cell lines. The expression of TNFR-6 alpha was
induced upon activation in Jurkat T leukemia cells. Interestingly, TNFR-6
alpha mRNA was constitutively expressed in endothelial cell line, HUVEC at
high level.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
239
Identification of the ligand for TNFR-6alpha
To identify the ligand for TNFR-6 alpha, several Flag-tagged soluble
proteins of TNF ligand family members were screened for binding to
recombinant TNFR-6 alpha-(His) protein by immuno-precipitation. TNFR-6
alpha-(His) selectively bound AIM-II-Flag and Fast-Flag among Flag-tagged
soluble TNF ligand members tested. This result indicates that TNFR-6 alpha
binds at least two ligands, AIM-II and Fast. AIM-II exhibits significant
sequence homology with the C-terminal receptor-binding domain of Fast
(31 %) but soluble AIM-II is unable to bind to Fas (Mauri, D. N., et al.,
to Immunity 8, 21-30 (1998); Zhai, Y., et al., J. Clin. Invest. 102, 1142-1151
( 1998)). They may have a similar binding epitope for TNFR-6 alpha binding.
Previously, Zhai and Harrop (Zhai, Y., et al., J. Clin. Invest. 102,
1142-1151 (1998); Harrop, J. A., et al., J. Biol. Chem. 273, 27548-27556
( 1998)) reported the biological functions of AIM-II and its possible
mechanisms of action as a ligand for HVEM/TR2 and/or LT(3R. AIM-II is
expressed in activated T cells. AIM-II, in conjunction with serum starvation
or
addition of IFN-'y, inhibits the cell proliferation in tumor cells, MDA-MB-231
and HT29.
To determine whether TNFR-6 alpha might act as an inhibitor to AIM-
2o II interactions with HVEM/TR2 or LT(3R, TNFR-6 alpha-(His) was used as a
competitive inhibitor in AIM-II-HVEM/TR2 interaction. When AIM-II was
immunoprecipitated with HVEM/TR2-Fc in the presence of TNFR-6 alpha-
(His), HVEM/TR2-Fc binding to AIM-II was decreased competitively by
TNFR-6 alpha-(His) but TNFR-6 alpha-(His) binding to AIM-II was not
changed by HVEM/TR2-Fc. Furthermore, the binding of HVEM/TR2-Fc (6
nM) or LT~3R (6 nM) was completely inhibited by 20 nM of TNFR-6 alpha-
(His) protein in immunoprecipitation assays. These results support the notion
that TNFR-6 alpha may act as a strong inhibitor of AIM-II function through



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
240
HVEM/TR2 and LT(3R.
Binding of TNFR-6alpha-(His) to AIM ll-transfected cells
To determine whether TNFR-6 alpha binds to AIM-II expressed on
cell surface, we performed binding assay using AIM-II-transfected HEK 293
EBNA cells by flow cytometry. AIM-II-transfected HEK 293 EBNA cells
were stained significantly by TNFR-6 alpha-(His) as well as by HVEM/TR2-
Fc and LT(3R-Fc. No binding was detected by HVEM/TR2-Fc or LT(3R-Fc on
pCEP4 vector-transfected HEK 293 EBNA cells. Furthermore, control
isotype did not bind to AIM-II-transfected HEK 293 EBNA cells, and any of
1o above fusion proteins did not bind to vector-transfected cells, confirming
the
specificity of these bindings. These bindings indicate that TNFR-6 alpha can
bind to both soluble and membrane-bound forms of AIM-II.
TNFR-6alpha inhibits AIM II-induced cytotoxicity in HT29 cells
Browning et al. (J. Exp. Med. 183, 867-878 (1996)) have shown that
Fas activation leads to rapid cell death (12-24h) whereas LT(3R takes 2-3 days
in induction of apoptosis for colorectal adenocarcinoma cell line, HT29. Zhai
et
al. (J. Clin. Invest. 102, 1142-1151 (1998)) also reported that AIM-II leads
to
the death of the cells expressing both LT(3R and HVEM/TR2 but not the cells
expressing only the LT(3R or HVEM/TR2 receptor. Both HVEM/TR2 and
LT(3R are involved cooperatively in AIM-II-mediated killing of HT29 cells
(Zhai, Y., et al., J. Clin. Invest. 102, 1142-1151(1998)).
To determine whether binding of TNFR-6 alpha inhibits AIM-II-
mediated cytotoxicity, HT29 cells were incubated with 10 ng/ml of soluble
AIM-II and IFN-y (10 U/ml) in the presence of 200 ng/ml of LT(3R-Fc or
TNFR-6 alpha-(His). TNFR-6 alpha-(His) blocked significantly the AIM-II-
mediated cell killing. Cells were also incubated with soluble AIM-II and/or
IFN-y in the presence of varying concentration of TNFR-6 alpha-(His).
TNFR-6 alpha-(His) blocked soluble AIM-II-induced cell death in a dose-



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
241
dependent manner. Taken together, TNFR-6 alpha appears to act as a natural
inhibitor of AIM-II-induced tumor cell killing. The data also suggest that
TNFR-6 alpha contributes to immune evasion of tumors.
AIM-II interaction with HVEM/TR2 and/or LT(3R may trigger the
distinct biological events, such as T cell proliferation, blocking of HVEM-
dependent HSV 1 infection and anti-tumor activity (Mauri, D. N., et al.,
Immunity 8, 21-30 (1998); Zhai, Y., et al., J. Clin. Invest. 102, 1142-1151
(1998); Harrop, J. A., et al., J. Biol. Chem. 273, 27548-27556 (1998)).
TNFR-6 alpha may act as an inhibitor of AIM-II interaction and may play
to diverse roles in different cell types. TNFR-6 alpha may act as a decoy
receptor and contribute to immune evasion both in slow and rapid tumor cell
death, that are mediated by AIM-II and/or Fast mediated apoptosis pathway.
Another possibility is that TNFR-6 alpha may function as a cytokine
to trigger membrane-bound Fast or AIM-II and directly transduce signals
through Fast orAIM-II. Recently Desbarats and Suzuki groups reported that
Fast could itself transduce signals, leading to cell-cycle arrest and cell
death in
CD4+ T cells but cell proliferation in CD8+ T cells (Desbarats, J., et al.,
Nature
medicine 4, 1377-1382 (1998); Suzuki, L, et al.J. Exp. Med. 187, 123-128
( 1998)). Therefore, TNFR-6 alpha may be involved in signaling through Fast
and AIM-II.
HUVEC cells constitutively expressed TNFR-6 alpha in RT-PCR
analysis. AIM-II and Fast have been known to be expressed in activated T
cells. Therefore it is speculated that TNFR-6 alpha and its ligands are
important for interactions between activated T lymphocytes and endothelium.
TNFR-6 alpha may be involved in activated T cell trafficking as well as
endothelial cell survival.
Example 8: Activation-induced Apoptosis Assay



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
242
Activation-induced apoptosis is assayed using SupT-13 T leukemia
cells and is measured by cell cycle analysis. The assay is performed as
follows. SupT-13 cells are maintained in RPMI containing 10% FCS in
logarithmic growth (about 1 x 106). Sup-T13 cells are seeded in wells of a 24
well plate at 0.5 x 106/ml, 1 ml/well. AIM II protein or Fas Ligand protein
(0.01, 0.1, l, 10, 100, 1000 ng/ml) or buffer control is added to the wells
and
the cells are incubated at 37°C for 24 hours in the presence or absence
of the
TNFR polypeptides of the invention. The wells of another 24 well plate are
prepared with or without anti-CD3 antibody by incubating purified BC3 mAb
to at a concentration of 10 ~g/ml in sterile-filtered 0.05M bicarbonate
buffer, pH
9.5 or buffer alone in wells at 0.5 ml/well. The plate is incubated at
4°C
overnight. The wells of antibody coated plates are washed 3 times with sterile
PBS, at 4°C. The treated Sup-T13 cells are transfered to the antibody
coated
wells and incubated for 18 hrs., at 37°C. Apoptosis is measured by cell
cycle
analysis using propidium iodide and flow cytometry. Proliferation of treated
cells is measured by taking a total of 300 ~,l of each treatment well and
delivering in to triplicate wells (100 ~l/well) of 96 well plates. To each
well
add 20 ~,l/well 3H-thymidine (0.5 ~Ci/20 ~,1, 2 Ci/mM) and incubate 18 hr., at
37°C. Harvest and count 3H-thymidine uptake by the cells. This
2o measurement may be used to confirm an effect on apoptosis if observed by
other methods. The positive controls for the assay is Anti-CD3 crosslinking
alone, Fas Ligand alone, and/or AIM-II alone. In addition, profound and
reproducible apoptosis in this line using anti-Fas monoclonal antibody (500
ng/ml in soluble form-IgM mAb) has been demonstrated. The negative control
for the assay is medium or buffer alone. Also, crosslinking with another anti-
CD3 mAB (OKT3) has been shown to have no effect. TNFR agonists
according to the invention will demonstrate a reduced apoptosis when



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
243
compared to the treatment of the Sup-T13 cells with AIM-II or Fas Ligand in
the absence of the TNFR agonist. TNFR antagonists of the invention can be
identified by combining TNFR polypeptides having Fas Ligand or AIM-II
binding affinity (e.g., mature TNFR) with the TNFR polypeptide to be tested
and contacting this combination in solution with AIM-II or Fas Ligand and the
Sup-T13 cells. The negative control for this assay is a mixture containing the
mature TNFR, Sup-T13 cells, and AIM-II or Fas Ligand (Fast) alone.
Samples containing TNFR antagonists of the invention will demonstrate
increased apoptosis when compared to the negative control.
1 o If an effect is observed by cell cycle analysis the cells can be further
stained for the TLTNEL assay for flow cytometry or with Annexin V, using
techniques well known to those skilled in the art.
Example 9: Blocking of Fas ligand Mediated Apoptosis of Jurkat T cells by
TNFR6 alpha-Fc
Methods.
Jurkat T-cells which express the Fas receptor were treated either with
sFas ligand alone or with sFas ligand in combination with Fas-Fc, or TNFR6
2o alpha-Fc (corresponding to the full length TNFR 6 alpha protein (amino
acids
1-300 of SEQ ID N0:2) fused to an Fc domain, as described herein). The sFas
ligand protein utilized was obtained from Alexis Corporation and contains a
FLAG epitope tag at its N-terminus. As it has been demonstrated previously
that cross-linking of Fas ligand utilizing the monoclonal Flag epitope
enhances
significantly the ability of Fas ligand to mediate apoptosis, the Flag
antibody
was included in this study. Specifically, 106 Jurkat cells (RPMI + 5%serum)
were treated with Fas ligand (Alexis) (20ng/ml) and anti-Flag Mab (200ng/ml)
and then incubated at 37°C for 16 hrs. When TNFR6 alpha -Fc was
included in



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
244
the assay, the receptor was preincubated with the Fas ligand and anti-Flag
Mab for 15 mins.
Results
After incubation, cells were harvested, resuspended in PBS and
subjected to Flow Cytometric Analyses (Table V). In the absence of Fas ligand
(FasL), approximately 1% of cells appear to be undergoing apoptosis as
measured by high annexin staining and poor propidium iodide staining (Table
IV). Treatment with soluble Fas ligand alone resulted in an approximate 7-fold
increase in the number of apoptotic cells which as expected could be blocked
in
the presence of Fas-Fc. Similar to Fas-Fc, TNFR6 alpha -Fc was also capable
of blocking Fas mediated apoptosis with the blocking by TNFR6 alpha-Fc
observed in a dose dependent manner over three logarithmic scales (Table V).
The ability of TNFR6 alpha -Fc to block Fas mediated killing of Jurkat cells
was also determined in a cell death assay (Figures 7A-B). In this assay, cells
were again treated with combinations of Fas ligand and TNFR6 alpha-Fc for
16 hrs. To measure the levels of viable cells after treatment, cells were
incubated for 5 hrs with 10% ALOMAR blue and examined
spectrophotometrically at OD 570nm-630nm. Treatment with Fas ligand
resulted in a 50% decrease in cell viability (Figures 7A-B). The decrease in
cell
2o viability can be overcome by either Fas-Fc or TNFR6 alpha -Fc but not TR5-
Fc (Figures 7A-B), confirming the ability of TNFR6 alpha to interfere with
Fas ligand mediated activity. The ability of TNFR6 alpha -Fc at both 100
ng/ml and at 10 ng/ml to block Fas ligand mediated activity in this assay is
statistically different (p < 0.05) than when no TNFR6 alpha -Fc is added
(Figures 7A-B). Furthermore, the ability of TNFR6 alpha -Fc to block Fas
ligand mediated cell death and apoptosis appears to be as efficient with Fas-
Fc
(Table V and Figures 7A-B).



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
245
Table V. FACS Analysis revealing blocking of Fas ligand mediated
apoptosis: 106 Jurkat cells (RPMI + 5% serum) were treated with Fas ligand
(Allexis; 20 ng/ml) and anti-FLAG (200 ng/ml) and then incubated at 37°
C for
16 hours. When Fc receptor was included in the assay, the receptor was
preincubated with the Fas ligand and anti-FLAG Mab for 15 minutes. After
incubation, cells were harvested, resuspended in PBS and subjected to Flow
Cytometric Analyses.
Treatment % Cells undergoing apoptosis
Control (buffer) 1.24
Fast (20 ng) 8.87
Fast (20 ng)+ Fas-Fc (100 ng) 1.78
Fast (20 ng)+ TNFR6 alpha-Fc (100 ng) 1.24
Fast (20 ng)+ TNFR6 alpha-Fc ( 10 ng) 2.79
Fast (20 ng)+ TNFR6 alpha-Fc ( 1 ng) 7.95
Fast (20 ng)+ TNFR6 alpha -Fc (0.1 ng) 8.58
Conclusions.
TNFR6 alpha-Fc appears to block Fas ligand mediated apoptosis of
Jurkat cells in a dose dependent manner as effectively as Fas ligand.
Example 10: Protein Fusions of TNFR-6 alpha and/or TNFR-6 beta
TNFR-6 alpha and/or TNFR-6 beta polypeptides of the invention are
optionally fused to other proteins. These fusion proteins can be used for a
variety of applications. For example, fusion of TNFR-6 alpha and/or TNFR-6
beta polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose
binding protein facilitates purification. (See EP A 394,827; Traunecker, et
al.,
Nature 331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin
3o increases the halflife time in vivo. Nuclear localization signals fused to
TNFR-
6 alpha and/or TNFR-6 beta polypeptides can target the protein to a specific
subcellular localization, while covalent heterodimer or homodimers can
increase



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
246
or decrease the activity of a fusion protein. Fusion proteins can also create
chimeric molecules having more than one function. Finally, fusion proteins can
increase solubility and/or stability of the fused protein compared to the non-
fused protein. All of the types of fusion proteins described above can be made
using techniques known in the art or by using or routinely modifying the
following protocol, which outlines the fusion of a polypeptide to an IgG
molecule.
Briefly, the human Fc portion of the IgG molecule can be PCR
amplified, using primers that span the 5' and 3' ends of the sequence
described
below. These primers also preferably contain convenient restriction enzyme
sites that will facilitate cloning into an expression vector, preferably a
mammalian expression vector.
For example, if the pC4 (Accession No. 209646) expression vector is
used, the human Fc portion can be ligated into the BamHI cloning site. Note
that the 3' BamHI site should be destroyed. Next, the vector containing the
human Fc portion is re-restricted with BamHI, linearizing the vector, and
TNFR-6 alpha and/or TNFR-6 beta polynucleotide, isolated by the PCR
protocol described in Example l, is ligated into this BamHI site. Note that
the
polynucleotide is cloned without a stop codon, otherwise a fusion protein will
2o not be produced.
If the naturally occurring signal sequence is used to produce the
secreted protein, pC4 does not need a second signal peptide. Alternatively, if
the naturally occurring signal sequence is not used, the vector can be
modified
to include a heterologous signal sequence. (See, e.g., International
application
publication number WO 96/34891.)
Human IgG Fc region:
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAATTCGAGGGTGCAC
CGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGG
3O TGGTGGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCA



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
247
AGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACT
GGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCATCTCCA
AAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGG
TCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGG
AGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGG
ACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGC
AGAAGAGCCTCTCCCTGTCTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT
(SEQ ID N0:27)
l0 Example 11: Production of an Antibody
a) Hybridoma Technology
The antibodies of the present invention can be prepared by a variety of
methods. (See, Current Protocols, Chapter 2.) As one example of such methods,
cells expressing TR6-alpha and/or TR6-beta are administered to an animal to
induce the production of sera containing polyclonal antibodies. In a preferred
method, a preparation of TR6-alpha and/or TR6-beta protein is prepared and
purified to render it substantially free of natural contaminants. Such a
preparation
is then introduced into an animal in order to produce polyclonal antisera of
greater
2o specific activity.
Monoclonal antibodies specific for protein TR6-alpha and/or TR6-beta are
prepared using hybridoma technology. (Kohler et al., Nature 256:495 (1975);
Kohler et al., Eur. J. Immunol. 6:511 ( 1976); Kohler et al., Eur. J. Immunol.
6:292
(1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas,
Elsevier, N.Y., pp. 563-681 (1981)). In general, an animal (preferably a
mouse) is
immunized with TR6-alpha and/or TR6-beta polypeptide or, more preferably,
with a secreted TR6-alpha and/or TR6-beta polypeptide-expressing cell. Such
polypeptide-expressing cells are cultured in any suitable tissue culture
medium,
preferably in Earle's modified Eagle's medium supplemented with 10% fetal
3o bovine serum (inactivated at about 56°C), and supplemented with
about 10 g/1 of
nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ~g/ml
of
streptomycin.



CA 02362929 2001-08-16
WO 00/52028 PCT/LTS00/05686
248
The splenocytes of such mice are extracted and fused with a suitable
myeloma cell line. Any suitable myeloma cell line may be employed in
accordance with the present invention; however, it is preferable to employ the
parent myeloma cell line (SP20), available from the ATCC. After fusion, the
resulting hybridoma cells are selectively maintained in HAT medium, and then
cloned by limiting dilution as described by Wands et al. (Gastroenterology
80:225-232 (1981). The hybridoma cells obtained through such a selection are
then assayed to identify clones which secrete antibodies capable of binding
the
TR6-alpha and/or TR6-beta polypeptide.
1o Alternatively, additional antibodies capable of binding to TR6-alpha and/or
TR6-beta polypeptide can be produced in a two-step procedure using anti-
idiotypic antibodies. Such a method makes use of the fact that antibodies are
themselves antigens, and therefore, it is possible to obtain an antibody which
binds to a second antibody. In accordance with this method, protein specific
antibodies are used to immunize an animal, preferably a mouse. The splenocytes
of such an animal are then used to produce hybridoma cells, and the hybridoma
cells are screened to identify clones which produce an antibody whose ability
to
bind to the TR6-alpha and/or TR6-beta protein-specific antibody can be blocked
by TR6-alpha and/or TR6-beta. Such antibodies comprise anti-idiotypic
antibodies to the TR6-alpha and/or TR6-beta protein-specific antibody and are
used to immunize an animal to induce formation of further TR6-alpha and/or TR6-

beta protein-specific antibodies.
For in vivo use of antibodies in humans, an antibody is "humanized".
Such antibodies can be produced using genetic constructs derived from
hybridoma
cells producing the monoclonal antibodies described above. Methods for
producing chimeric and humanized antibodies are known in the art and are
discussed infra. (See, for review, Morrison, Science 229:1202 (1985); Oi et
al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Patent No. 4,816,567;
Taniguchi
et al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533;



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
249
Robinson et al., WO 8702671; Boulianne et al., Nature 312:643 (1984);
Neuberger et al., Nature 314:268 (1985).)
b) Isolation Of Antibody Fragments Directed Against TR6-alpha
and/or TR6-beta From A Library Of scFvs
Naturally occurring V-genes isolated from human PBLs are constructed
into a library of antibody fragments which contain reactivities against TR6-
alpha
and/or TR6-beta to which the donor may or may not have been exposed (see e.g.,
U.S. Patent 5,885,793 incorporated herein by reference in its entirety).
Rescue of the Library. A library of scFvs is constructed from the RNA of
human PBLs as described in PCT publication WO 92/01047. To rescue phage
displaying antibody fragments, approximately 109 E. coli harboring the
phagemid
are used to inoculate 50 ml of 2xTY containing 1 % glucose and 100 ~g/ml of
ampicillin (2xTY-AMP-GLU) and grown to an O.D. of 0.8 with shaking. Five ml
of this culture is used to innoculate 50 ml of 2xTY-AMP-GLU, 2 x 108 TU of
delta gene 3 helper (M13 delta gene III, see PCT publication WO 92/01047) are
added and the culture incubated at 37°C for 45 minutes without shaking
and then
at 37°C for 45 minutes with shaking. The culture is centrifuged at 4000
r.p.m. for
10 min. and the pellet resuspended in 2 liters of 2xTY containing 100 gg/ml
2o ampicillin and 50 ug/ml kanamycin and grown overnight. Phage are prepared
as
described in PCT publication WO 92/01047.
M13 delta gene III is prepared as follows: M13 delta gene III helper phage
does not encode gene III protein, hence the phage(mid) displaying antibody
fragments have a greater avidity of binding to antigen. Infectious M 13 delta
gene
III particles are made by growing the helper phage in cells harboring a pUC 19
derivative supplying the wild type gene III protein during phage
morphogenesis.
The culture is incubated for 1 hour at 37° C without shaking and
then for a
further hour at 37°C with shaking. Cells are spun down (IEC-Centra
8,400 r.p.m.
for 10 min), resuspended in 300 ml 2xTY broth containing 100 pg ampicillin/ml



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
250
and 25 pg kanamycin/ml (2xTY-AMP-KAN) and grown overnight, shaking at
37°C. Phage particles are purified and concentrated from the culture
medium by
two PEG-precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS and
passed through a 0.45 qm filter (Minisart NML; Sartorius) to give a final
concentration of approximately 1013 transducing units/ml (ampicillin-resistant
clones).
Panning of the Library. Immunotubes (Nunc) are coated overnight in PBS
with 4 ml of either 100 ~g/ml or 10 p g/ml of a polypeptide of the present
invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at 37°C and
then
washed 3 times in PBS. Approximately 1013 TU of phage is applied to the tube
and incubated for 30 minutes at room temperature tumbling on an over and under
turntable and then left to stand for another 1.5 hours. Tubes are washed 10
times
with PBS 0.1% Tween-20 and 10 times with PBS. Phage are eluted by adding 1 ml
of 100 mM triethylamine and rotating 15 minutes on an under and over turntable
after which the solution is immediately neutralized with 0.5 ml of 1.OM Tris-
HCI,
pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TG1 by
incubating
eluted phage with bacteria for 30 minutes at 37°C. The E. coli are then
plated on
TYE plates containing 1% glucose and 100 qg/ml ampicillin. The resulting
bacterial library is then rescued with delta gene 3 helper phage as described
above
2o to prepare phage for a subsequent round of selection. This process is then
repeated for a total of 4 rounds of affinity purification with tube-washing
increased to 20 times with PBS, 0.1% Tween-20 and 20 times with PBS for
rounds 3 and 4.
Characterization of Binders. Eluted phage from the 3rd and 4th rounds of
selection are used to infect E. coli HB 2151 and soluble scFv is produced
(Marks,
et al., 1991) from single colonies for assay. ELISAs are performed with
microtitre
plates coated with either 10 pg/ml of the polypeptide of the present invention
in
50 mM bicarbonate pH 9.6. Clones positive in ELISA are further characterized



CA 02362929 2001-08-16
WO 00/52028 PCT/CTS00/05686
251
by PCR fingerprinting (see, e.g., PCT publication WO 92/01047) and then by
sequencing.
Example 12: Method of Determining Alterations in the TNFR-6 alpha
and/or TNFR-6 beta Gene
RNA is isolated from entire families or individual patients presenting
with a phenotype of interest (such as a disease). cDNA is then generated from
these RNA samples using protocols known in the art. (See, Sambrook.) The
cDNA is then used as a template for PCR, employing primers surrounding
1o regions of interest in SEQ ID NO:1. Suggested PCR conditions consist of 35
cycles at 95° C for 30 seconds; 60-120 seconds at 52-58° C; and
60-120
seconds at 70° C, using buffer solutions described in Sidransky, D., et
al.,
Science 252:706 ( 1991 ).
PCR products are then sequenced using primers labeled at their 5' end
with T4 polynucleotide kinase, employing SequiTherm Polymerase.
(Epicentre Technologies). The intron-exon borders of selected exons of
TNFR-6 alpha and/or TNFR-6 beta are also determined and genomic PCR
products analyzed to confirm the results. PCR products harboring suspected
mutations in TNFR-6 alpha and/or TNFR-6 beta is then cloned and sequenced
2o to validate the results of the direct sequencing.
PCR products of TNFR-6 alpha and/or TNFR-6 beta are cloned into
T-tailed vectors as described in Holton, T.A. and Graham, M.W., Nucleic
Acids Research, 19:1156 (1991) and sequenced with T7 polymerase (United
States Biochemical). Affected individuals are identified by mutations in
TNFR-6 alpha and/or TNFR-6 beta not present in unaffected individuals.
Genomic rearrangements are also observed as a method of determining
alterations in the TNFR-6 alpha and/or TNFR-6 beta gene. Genomic clones
isolated using techniques known in the art are nick-translated with
digoxigenindeoxy-uridine 5'-triphosphate (Boehringer Manheim), and FISH



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
252
performed as described in Johnson, et al., Methods Cell Biol. 35:73-99 ( 1991
).
Hybridization with the labeled probe is carried out using a vast excess of
human cot-1 DNA for specific hybridization to the TNFR-6 alpha and/or
TNFR-6 beta genomic locus.
Chromosomes are counterstained with 4,6-diamino-2-phenylidole and
propidium iodide, producing a combination of C- and R-bands. Aligned images
for precise mapping are obtained using a triple-band filter set (Chroma
Technology, Brattleboro, VT) in combination with a cooled charge-coupled
device camera (Photometrics, Tucson; AZ) and variable excitation wavelength
to filters. (Johnson, et al., Genet. Anal. Tech. Appl., 8:75 (1991).) Image
collection, analysis and chromosomal fractional length measurements are
performed using the ISee Graphical Program System. (Inovision Corporation,
Durham, NC.) Chromosome alterations of the genomic region of TNFR-6
alpha and/or TNFR-6 beta (hybridized by the probe) are identified as
insertions, deletions, and translocations. These TNFR-6 alpha and/or TNFR-6
beta alterations are used as a diagnostic marker for an associated disease.
Example 13: Method of Detecting Abnormal Levels of TNFR-6 alpha
and/or TNFR-6 beta in a Biological Sample
2o TNFR-6 alpha and/or TNFR-6 beta polypeptides can be detected in a
biological sample, and if an increased or decreased level of TNFR-6 alpha
and/or TNFR-6 beta is detected, this polypeptide is a marker for a particular
phenotype. Methods of detection are numerous, and thus, it is understood
that one skilled in the art can modify the following assay to fit their
particular
needs.
For example, antibody-sandwich ELISAs are used to detect TNFR-6
alpha and/or TNFR-6 beta in a sample, preferably a biological sample. Wells
of a microtiter plate are coated with specific antibodies to TNFR-6 alpha
and/or TNFR-6 beta, at a final concentration of 0.2 to 10 ug/ml. The



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
253
antibodies are either monoclonal or polyclonal and are produced using
technique known in the art. The wells are blocked so that non-specific binding
of TNFR-6 alpha and/or TNFR-6 beta to the well is reduced.
The coated wells are then incubated for > 2 hours at RT with a sample
containing TNFR-6 alpha and/or TNFR-6 beta. Preferably, serial dilutions of
the sample should be used to validate results. The plates are then washed
three times with deionized or distilled water to remove unbounded TNFR-6
alpha and/or TNFR-6 beta.
Next, 50 ul of specific antibody-alkaline phosphatase conjugate, at a
concentration of 25-400 ng, is added and incubated for 2 hours at room
temperature. The plates are again washed three times with deionized or
distilled water to remove unbounded conjugate.
75 ul of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl
phosphate (NPP) substrate solution is then added to each well and incubated 1
hour at room temperature to allow cleavage of the substrate and flourescence.
The flourescence is measured by a microtiter plate reader. A standard curve is
prepared using the experimental results from serial dilutions of a control
sample with the sample concentration plotted on the X-axis (log scale) and
fluorescence or absorbance on the Y-axis (linear scale). The TNFR-6 alpha
and/or TNFR-6 beta polypeptide concentration in a sample is then
interpolated using the standard curve based on the measured flourescence of
that sample.
Example 14: Method of Treating Decreased Levels of TNFR-6 alpha and/or
TNFR-6 beta
The present invention relates to a method for treating an individual in
need of a decreased level of TNFR-6 alpha and/or TNFR-6 beta biological
activity in the body comprising, administering to such an individual a
composition comprising a therapeutically effective amount of TNFR-6 alpha



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
254
and/or TNFR-6 beta antagonist. Preferred antagonists for use in the present
invention are TNFR-6 alpha and/or TNFR-6 beta-specific antibodies.
Moreover, it will be appreciated that conditions caused by a decrease
in the standard or normal expression level of TNFR-6 alpha and/or TNFR-6
beta in an individual can be treated by administering TNFR-6 alpha and/or
TNFR-6 beta, preferably in a soluble and/or secreted form. Thus, the
invention also provides a method of treatment of an individual in need of an
increased level of TNFR-6 alpha and/or TNFR-6 beta polypeptide comprising
administering to such an individual a pharmaceutical composition comprising
l0 an amount of TNFR-6 alpha and/or TNFR-6 beta to increase the biological
activity level of TNFR-6 alpha and/or TNFR-6 beta in such an individual.
For example, a patient with decreased levels of TNFR-6 alpha and/or
TNFR-6 beta polypeptide receives a daily dose 0.1-100 ug/kg of the
polypeptide for six consecutive days. Preferably, the polypeptide is in a
15 soluble and/or secreted form.
Example I5: Method of Treating Increased Levels of TNFR-6 alpha and/or
TNFR-6 beta
The present invention also relates to a method for treating an individual
20 in need of an increased level of TNFR-6 alpha and/or TNFR-6 beta biological
activity in the body comprising administering to such an individual a
composition comprising a therapeutically effective amount of TNFR-6 alpha
and/or TNFR-6 beta or an agonist thereof.
Antisense technology is used to inhibit production of TNFR-6 alpha
25 and/or TNFR-6 beta. This technology is one example of a method of
decreasing levels of TNFR-6 alpha and/or TNFR-6 beta polypeptide,
preferably a soluble and/or secreted form, due to a variety of etiologies,
such as
cancer.
For example, a patient diagnosed with abnormally increased levels of



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
255
TNFR-6 alpha and/or TNFR-6 beta is administered intravenously antisense
polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg/kg day for 21 days. This
treatment is repeated after a 7-day rest period if the is determined to be
well
tolerated.
Example 16: Method of Treatment Using Gene Therapy - Ex Vivo
One method of gene therapy transplants fibroblasts, which are capable
of expressing soluble and/or mature TNFR-6 alpha and/or TNFR-6 beta
polypeptides, onto a patient. Generally, fibroblasts are obtained from a
subject by skin biopsy. The resulting tissue is placed in tissue-culture
medium
and separated into small pieces. Small chunks of the tissue are placed on a
wet
surface of a tissue culture flask, approximately ten pieces are placed in each
flask. The flask is turned upside down, closed tight and left at room
temperature over night. After 24 hours at room temperature, the flask is
inverted and the chunks of tissue remain fixed to the bottom of the flask and
fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and
streptomycin) is added. The flasks are then incubated at 37 degree C for
approximately one week.
At this time, fresh media is added and subsequently changed every
2o several days. After an additional two weeks in culture, a monolayer of
fibroblasts emerge. The monolayer is trypsinized and scaled into larger
flasks.
pMV-7 (Kirschmeier, P.T. et al., DNA, 7:219-25 (1988)), flanked by
the long terminal repeats of the Moloney murine sarcoma virus, is digested
with EcoRI and HindIII and subsequently treated with calf intestinal
phosphatase. The linear vector is fractionated on agarose gel and purified,
using glass beads.
The cDNA encoding TNFR-6 alpha and/or TNFR-6 beta can be
amplified using PCR primers which correspond to the 5' and 3' end encoding
sequences respectively. Preferably, the 5' primer contains an EcoRI site and



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
256
the 3' primer includes a HindIII site. Equal quantities of the Moloney murine
sarcoma virus linear backbone and the amplified EcoRI and HindIII fragment
are added together, in the presence of T4 DNA ligase. The resulting mixture is
maintained under conditions appropriate for ligation of the two fragments.
The ligation mixture is then used to transform E. coli HB 101, which are then
plated onto agar containing kanamycin for the purpose of confirming that the
vector contains properly inserted TNFR-6 alpha and/or TNFR-6 beta.
The amphotropic pA317 or GP+am I2 packaging cells are grown in
tissue culture to confluent density in Dulbecco's Modified Eagles Medium
(DMEM) with 10% calf serum (CS), penicillin and streptomycin. The MSV
vector containing the TNFR-6 alpha and/or TNFR-6 beta gene is then added to
the media and the packaging cells transduced with the vector. The packaging
cells now produce infectious viral particles containing the TNFR-6 alpha
and/or TNFR-6 beta gene (the packaging cells are now referred to as producer
cells).
Fresh media is added to the transduced producer cells, and
subsequently, the media is harvested from a 10 cm plate of confluent producer
cells. The spent media, containing the infectious viral particles, is filtered
through a millipore filter to remove detached producer cells and this media is
then used to infect fibroblast cells. Media is removed from a sub-confluent
plate of fibroblasts and quickly replaced with the media from the producer
cells. This media is removed and replaced with fresh media. If the titer of
virus is high, then virtually all fibroblasts will be infected and no
selection is
required. If the titer is very low, then it is necessary to use a retroviral
vector
that has a selectable marker, such as neo or his. Once the fibroblasts have
been
efficiently infected, the fibroblasts are analyzed to determine whether TNFR-6
alpha and/or TNFR-6 beta protein is produced.
The engineered fibroblasts are then transplanted onto the host, either
alone or after having been grown to confluence on cytodex 3 microcarrier



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
257
beads.
Example 17: Method of Treatment Using Gene Therapy - In Vivo
Another aspect of the present invention is using in vivo gene therapy
methods to treat disorders, diseases and conditions. The gene therapy method
relates to the introduction of naked nucleic acid (DNA, RNA, and antisense
DNA or RNA) TNFR-6 alpha and/or TNFR-6 beta sequences into an animal
to increase or decrease the expression of the TNFR-6 alpha and/or TNFR-6
beta polypeptide. The TNFR-6 alpha and/or TNFR-6 beta polynucleotide
1o may be operatively linked to a promoter or any other genetic elements
necessary for the expression of the TNFR-6 alpha and/or TNFR-6 beta
polypeptide by the target tissue. Such gene therapy and delivery techniques
and methods are known in the art, see, for example, International Application
publication number W090/11092, International Application publication
number W098/11779; US Patent NO. 5693622, 5705151, 5580859; Tabata H.
et al., Cardiovasc. Res. 35:470-479 (1997); Chao J. et al., Pharmacol. Res.
35:517-522 (1997); Wolff J.A. Neuromuscul. Disord. 7:314-318 (1997);
Schwartz B. et al., Gene Ther. 3:405-411 (1996); Tsurumi Y. et al.,
Circulation
94:3281-3290 (1996) (incorporated herein by reference).
2o The TNFR-6 alpha and/or TNFR-6 beta polynucleotide constructs
may be delivered by any method that delivers injectable materials to the cells
of an animal, such as, injection into the interstitial space of tissues
(heart,
muscle, skin, lung, liver, intestine and the like). The TNFR-6 alpha and/or
TNFR-6 beta polynucleotide constructs can be delivered in a pharmaceutically
acceptable liquid or aqueous carrier.
The term "naked" polynucleotide, DNA or RNA, refers to sequences
that are free from any delivery vehicle that acts to assist, promote, or
facilitate
entry into the cell, including viral sequences, viral particles, liposome
formulations, lipofectin or precipitating agents and the like. However, the



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
258
TNFR-6 alpha and/or TNFR-6 beta polynucleotides may also be delivered in
liposome formulations (such as those taught in Felgner P.L. et al.(1995) Ann.
NYAcad. Sci. 772:126-139 andAbdallah B. et al.(1995) Biol. Cell 85(1):1-7)
which can be prepared by methods well known to those skilled in the art.
The TNFR-6 alpha and/or TNFR-6 beta polynucleotide vector
constructs used in the gene therapy method are preferably constructs that will
not integrate into the host genome nor will they contain sequences that allow
for replication. Any strong promoter known to those skilled in the art can be
used for driving the expression of DNA. Unlike other gene therapies
1o techniques, one major advantage of introducing naked nucleic acid sequences
into target cells is the transitory nature of the polynucleotide synthesis in
the
cells. Studies have shown that non-replicating DNA sequences can be
introduced into cells to provide production of the desired polypeptide for
periods of up to six months.
15 The TNFR-6 alpha and/or TNFR-6 beta polynucleotide construct can
be delivered to the interstitial space of tissues within the an animal,
including
of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart,
lymph,
blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine,
testis,
ovary, uterus, rectum, nervous system, eye, gland, and connective tissue.
2o Interstitial space of the tissues comprises the intercellular fluid,
mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic
fibers in the walls of vessels or chambers, collagen fibers of fibrous
tissues, or
that same matrix within connective tissue ensheathing muscle cells or in the
lacunae of bone. It is similarly the space occupied by the plasma of the
25 circulation and the lymph fluid of the lymphatic channels. Delivery to the
interstitial space of muscle tissue is preferred for the reasons discussed
below.
They may be conveniently delivered by injection into the tissues comprising
these cells. They are preferably delivered to and expressed in persistent, non-

dividing cells which are differentiated, although delivery and expression may
be



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
259
achieved in non-differentiated or less completely differentiated cells, such
as,
for example, stem cells of blood or skin fibroblasts. In vivo muscle cells are
particularly competent in their ability to take up and express
polynucleotides.
For the naked TNFR-6 alpha and/or TNFR-6 beta polynucleotide
injection, an effective dosage amount of DNA or RNA will be in the range of
from about 0.05 g/kg body weight to about 50 mg/kg body weight. Preferably
the dosage will be from about 0.005 mg/kg to about 20 mg/kg and more
preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the artisan
of ordinary skill will appreciate, this dosage will vary according to the
tissue
site of injection. The appropriate and effective dosage of nucleic acid
sequence
can readily be determined by those of ordinary skill in the art and may depend
on the condition being treated and the route of administration. The preferred
route of administration is by the parenteral route of injection into the
interstitial space of tissues. However, other parenteral routes may also be
used, such as, inhalation of an aerosol formulation particularly for delivery
to
lungs or bronchial tissues, throat or mucous membranes of the nose. In
addition, naked TNFR-6 alpha and/or TNFR-6 beta polynucleotide constructs
can be delivered to arteries during angioplasty by the catheter used in the
procedure.
2o The dose response effects of injected TNFR-6 alpha and/or TNFR-6
beta polynucleotide in muscle in vivo is determined as follows. Suitable
TNFR-6 alpha and/or TNFR-6 beta template DNA for production of mRNA
coding for TNFR-6 alpha and/or TNFR-6 beta polypeptide is prepared in
accordance with a standard recombinant DNA methodology. The template
DNA, which may be either circular or linear, is either used as naked DNA or
complexed with liposomes. The quadriceps muscles of mice are then injected
with various amounts of the template DNA.
Five to six week old female and male Balb/C mice are anesthetized by
intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
260
made on the anterior thigh, and the quadriceps muscle is directly visualized.
The TNFR-6 alpha and/or TNFR-6 beta template DNA is injected in 0.1 ml of
carrier in a 1 cc syringe through a 27 gauge needle over one minute,
approximately 0.5 cm from the distal insertion site of the muscle into the
knee
and about 0.2 cm deep. A suture is placed over the injection site for future
localization, and the skin is closed with stainless steel clips.
After an appropriate incubation time (e.g., 7 days) muscle extracts are
prepared by excising the entire quadriceps. Every fifth 15 um cross-section of
the individual quadriceps muscles is histochemically stained for TNFR-6 alpha
and/or TNFR-6 beta protein expression. A time course for TNFR-6 alpha
and/or TNFR-6 beta protein expression may be done in a similar fashion
except that quadriceps from different mice are harvested at different times.
Persistence of TNFR-6 alpha and/or TNFR-6 beta DNA in muscle following
injection may be determined by Southern blot analysis after preparing total
cellular DNA and HIRT supernatants from injected and control mice. The
results of the above experimentation in mice can be use to extrapolate proper
dosages and other treatment parameters in humans and other animals using
TNFR-6 alpha and/or TNFR-6 beta naked DNA.
Example 18: Rescue of Ischemia in Rabbit Lower Limb Model
To study the in vivo effects of TNFR-6 alpha and/or TNFR-6 beta on
ischemia, a rabbit hindlimb ischemia model is created by surgical removal of
one femoral arteries as described previously (Takeshita, S. et al., Am J.
Pathol
147:1649-1660 (1995)). The excision of the femoral artery results in
retrograde propagation of thrombus and occlusion of the external iliac artery.
Consequently, blood flow to the ischemic limb is dependent upon collateral
vessels originating from the internal iliac artery (Takeshita, et al., Am J.
Pathol
147:1649-1660 (1995)). An interval of 10 days is allowed for post-operative
recovery of rabbits and development of endogenous collateral vessels. At 10



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
261
day post-operatively (day 0), after performing a baseline angiogram, the
internal i 1 iac artery of the ischemic limb is transfected with S00 mg naked
TNFR-6 alpha and/or TNFR-6 beta expression plasmid by arterial gene
transfer technology using a hydrogel-coated balloon catheter as described
(Riessen, R. et al., Hum Gene Ther. 4:749-758 (1993); Leclerc, G. et al., J.
Clin. Invest. 90: 936-944 (1992)). When is used in the treatment, a single
bolus of 500 mg protein or control is delivered into the internal iliac artery
of
the ischemic limb over a period of 1 min. through an infusion catheter. On day
30, various parameters are measured in these rabbits: (a) BP ratio - The blood
1o pressure ratio of systolic pressure of the ischemic limb to that of normal
limb;
(b) Blood Flow and Flow Reserve - Resting FL: the blood flow during
undiluted condition and Max FL: the blood flow during fully dilated condition
(also an indirect measure of the blood vessel amount) and Flow Reserve is
reflected by the ratio of max FL: resting FL; (c) Angiographic Score - This is
measured by the angiogram of collateral vessels. A score is determined by the
percentage of circles in an overlaying grid that with crossing opacified
arteries
divided by the total number m the rabbit thigh; (d) Capillary density - The
number of collateral capillaries determined in light microscopic sections
taken
from hindlimbs.
The studies described in this example test activity in TNFR-6 proteins.
However, one skilled in the art could easily modify the exemplified studies to
test the activity of polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TNFR-6 alpha and/or TNFR-6 beta.
Example 19: Diabetic Mouse and Glucocorticoid-Impaired Wound Healing
Models
A. Diabetic db+/db+ Mouse Model.
To demonstrate that TNFR-6 accelerates the healing process, the
genetically diabetic mouse model of wound healing is used. The full thickness



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
262
wound healing model in the db+/db+ mouse is a well characterized, clinically
relevant and reproducible model of impaired wound healing. Healing of the
diabetic wound is dependent on formation of granulation tissue and re-
epithelialization rather than contraction (Gartner, M.H. et al., J. Surg. Res.
52:389 (1992); Greenhalgh, D.G. et al., Am. J. Pathol. 136:1235 (1990)).
The diabetic animals have many of the characteristic features observed
in Type II diabetes mellitus. Homozygous (db+/db+) mice are obese in
comparison to their normal heterozygous (db+/+m) littermates. Mutant
diabetic (db+/db+) mice have a single autosomal recessive mutation on
chromosome 4 (db+) (Coleman et al.Proc. Natl. Acad. Sci. USA 77:283-293
(1982)). Animals show polyphagia, polydipsia and polyuria. Mutant diabetic
mice (db+/db+) have elevated blood glucose, increased or normal insulin
levels,
and suppressed cell-mediated immunity (Mandel et al., J. Immunol. 120:1375
(1978); Debray-Sachs, M. et al., Clin. Exp. Immunol. 51 (1):1-7 (1983); Leiter
et al., Am. J. of Pathol. 114:46-55 (1985)). Peripheral neuropathy, myocardial
complications, and microvascular lesions, basement membrane thickening and
glomerular filtration abnormalities have been described in these animals
(Norido, F. et al., Exp. Neurol. 83(2):221-232 (1984); Robertson et al.,
Diabetes 29(1):60-67 (1980); Giacomelli et al., Lab Invest. 40(4):460-473
(1979); Coleman, D.L., Diabetes 31 (Suppl):1-6 (1982)). These homozygous
diabetic mice develop hyperglycemia that is resistant to insulin analogous to
human type II diabetes (Mandel et al., J. Immunol. 120:1375-1377 (1978)).
The characteristics observed in these animals suggests that healing in
this model may be similar to the healing observed in human diabetes
(Greenhalgh, et al., Am. J. of Pathol. 136:1235-1246 (1990)).
Genetically diabetic female C57BL/KsJ (db+/db+) mice and their non-
diabetic (db+/+m) heterozygous littermates are used in this study (Jackson
Laboratories). The animals are purchased at 6 weeks of age and were 8 weeks
old at the beginning of the study. Animals are individually housed and



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
263
received food and water ad libitum. All manipulations are performed using
aseptic techniques. The experiments are conducted according to the rules and
guidelines of Human Genome Sciences, Inc. Institutional Animal Care and Use
Committee and the Guidelines for the Care and Use of Laboratory Animals.
Wounding protocol is performed according to previously reported
methods (Tsuboi, R. and Riflcin, D.B., J. Exp. Med. 172:245-251 (1990)).
Briefly, on the day of wounding, animals are anesthetized with an
intraperitoneal injection of Avertin (0.01 mg/mL), 2,2,2-tribromoethanol and 2-

methyl-2-butanol dissolved in deionized water. The dorsal region of the
1o animal is shaved and the skin washed with 70% ethanol solution and iodine.
The surgical area is dried with sterile gauze prior to wounding. An 8 mm full-
thickness wound is then created using a Keyes tissue punch. Immediately
following wounding, the surrounding skin is gently stretched to eliminate
wound expansion. The wounds are left open for the duration of the
experiment. Application of the treatment is given topically for 5 consecutive
days commencing on the day of wounding. Prior to treatment, wounds are
gently cleansed with sterile saline and gauze sponges.
Wounds are visually examined and photographed at a fixed distance at
the day of surgery and at two day intervals thereafter. Wound closure is
2o determined by daily measurement on days 1-5 and on day 8. Wounds are
measured horizontally and vertically using a calibrated Jameson caliper.
Wounds are considered healed if granulation tissue is no longer visible and
the
wound is covered by a continuous epithelium.
TNFR-6 alpha and/or TNFR-6 beta is administered using at a range
different doses of TNFR-6 protein, from 4mg to 500mg per wound per day
for 8 days in vehicle. Vehicle control groups received 50mL of vehicle
solution.
Animals are euthanized on day 8 with an intraperitoneal injection of
sodium pentobarbital (300mg/kg). The wounds and surrounding skin are then



CA 02362929 2001-08-16
WO 00/52028 PCT/iJS00/05686
264
harvested for histology and immunohistochemistry. Tissue specimens are
placed in 10% neutral buffered formalin in tissue cassettes between biopsy
sponges for further processing.
Three groups of 10 animals each (5 diabetic and 5 non-diabetic
controls) are evaluated: 1) Vehicle placebo control; 2) TNFR-6 alpha and/or
TNFR-6 beta.
Wound closure is analyzed by measuring the area in the vertical and
horizontal axis and obtaining the total square area of the wound. Contraction
is then estimated by establishing the differences between the initial wound
area
l0 (day 0) and that of post treatment (day 8). The wound area on day 1 was
64mmz, the corresponding size of the dermal punch. Calculations were made
using the following formula:
[Open area on day 8] - [Open area on day 1 ] / [Open area on day 1 ]
Specimens are fixed in 10% buffered formalin and paraffin embedded
blocks are sectioned perpendicular to the wound surface (Smm) and cut using a
Reichert-Jung microtome. Routine hematoxylin-eosin (H&E) staining is
performed on cross-sections of bisected wounds. Histologic examination of
the wounds are used to assess whether the healing process and the
morphologic appearance of the repaired skin is altered by treatment with
TNFR-6. This assessment included verification of the presence of cell
accumulation, inflammatory cells, capillaries, fibroblasts, re-
epithelialization
and epidermal maturity (Greenhalgh, D.G. et al., Am. J. Pathol. 136:1235
(1990)). A calibrated lens micrometer is used by a blinded observer
Tissue sections are also stained immunohistochemically with a
polyclonal rabbit anti-human keratin antibody using ABC Elite detection
system. Human skin is used as a positive tissue control while non-immune
IgG is used as a negative control. Keratinocyte growth is determined by



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
265
evaluating the extent of reepithelialization of the wound using a calibrated
lens
micrometer.
Proliferating cell nuclear antigen/cyclin (PCNA) in skin specimens is
demonstrated by using anti-PCNA antibody (1:50) with an ABC Elite
detection system. Human colon cancer served as a positive tissue control and
human brain tissue is used as a negative tissue control. Each specimen
included a section with omission of the primary antibody and substitution
with non-immune mouse IgG. Ranking of these sections is based on the extent
of proliferation on a scale of 0-8, the lower side of the scale reflecting
slight
proliferation to the higher side reflecting intense proliferation.
Experimental data are analyzed using an unpaired t test. A p value of <
0.05 is considered significant.
B. Steroid Impaired Rat Model
The inhibition of wound healing by steroids has been well documented
in various in vitro and in vivo systems (Wahl, S.M. Glucocorticoids and
Wound healing. In: Anti-Inflammatory Steroid Action: Basic and Clinical
Aspects. 280-302 (1989); Wahl, S.M. et al., J. Immunol. I15: 476-481
(1975); Werb, Z. et al., J. Exp. Med. 147:1684-1694 (1978)). Glucocorticoids
2o retard wound healing by inhibiting angiogenesis, decreasing vascular
permeability (Ebert, R.H., et al., An. Intern. Med. 37:701-705 (1952)),
fibroblast proliferation, and collagen synthesis (Beck, L.S. et al., Growth
Factors. 5: 295-304 (1991); Haynes, B.F. et al., J. Clin. Invest. 61: 703-797
(1978)) and producing a transient reduction of circulating monocytes (Haynes,
B.F., et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, S. M.,
"Glucocorticoids
and wound healing", In: Antiinflammatory Steroid Action: Basic and Clinical
Aspects, Academic Press, New York, pp. 280-302 (1989)). The systemic
administration of steroids to impaired wound healing is a well establish
phenomenon in rats (Beck, L.S. et al., Growth Factors. 5: 295-304 (1991);



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
266
Haynes, B.F., et al., J. Clin. Invest. 61: 703-797 ( 1978); Wahl, S. M.,
"Glucocorticoids and wound healing", In: Antiinflammatory Steroid Action:
Basic and Clinical Aspects, Academic Press, New York, pp. 280-302 ( 1989);
Pierce, G.F. et al., Proc. Natl. Acad. Sci. USA 86: 2229-2233 (1989)).
To demonstrate that TNFR-6 alpha and/or TNFR-6 beta can accelerate
the healing process, the effects of multiple topical applications of TNFR-6 on
full thickness excisional skin wounds in rats in which healing has been
impaired
by the systemic administration of methylprednisolone is assessed.
Young adult male Sprague Dawley rats weighing 250-300 g (Charles
1 o River Laboratories) are used in this example. The animals are purchased at
8
weeks of age and were 9 weeks old at the beginning of the study. The healing
response of rats is impaired by the systemic administration of
methylprednisolone (l7mg/kg/rat intramuscularly) at the time of wounding.
Animals are individually housed and received food and water ad libitum. All
manipulations are performed using aseptic techniques. This study is
conducted according to the rules and guidelines of Human Genome Sciences,
Inc. Institutional Animal Care and Use Committee and the Guidelines for the
Care and Use of Laboratory Animals.
The wounding protocol is followed according to section A, above. On
the day of wounding, animals are anesthetized with an intramuscular injection
of ketamine (50 mg/kg) and xylazine (5 mg/kg). The dorsal region of the animal
is shaved and the skin washed with 70% ethanol and iodine solutions. The
surgical area is dried with sterile gauze prior to wounding. An 8 mm full-
thickness wound is created using a Keyes tissue punch. The wounds are left
open for the duration of the experiment. Applications of the testing materials
are given topically once a day for 7 consecutive days commencing on the day
of wounding and subsequent to methylprednisolone administration. Prior to
treatment, wounds are gently cleansed with sterile saline and gauze sponges.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
267
Wounds are visually examined and photographed at a fixed distance at
the day of wounding and at the end of treatment. Wound closure is determined
by daily measurement on days 1-5 and on day 8. Wounds are measured
horizontally and vertically using a calibrated Jameson caliper. Wounds are
considered healed if granulation tissue was no longer visible and the wound is
covered by a continuous epithelium.
TNFR-6 alpha and/or TNFR-6 beta is administered using at a range
different doses of TNFR-6 protein, from 4mg to 500mg per wound per day
for 8 days in vehicle. Vehicle control groups received 50mL of vehicle
1o solution.
Animals are euthanized on day 8 with an intraperitoneal injection of
sodium pentobarbital (300mg/kg). The wounds and surrounding skin are then
harvested for histology. Tissue specimens are placed in 10% neutral buffered
formalin in tissue cassettes between biopsy sponges for further processing.
Four groups of 10 animals each (5 with methylprednisolone and 5
without glucocorticoid) were evaluated: 1) Untreated group 2) Vehicle placebo
control 3) TNFR-6 treated groups.
Wound closure is analyzed by measuring the area in the vertical and
horizontal axis and obtaining the total area of the wound. Closure is then
2o estimated by establishing the differences between the initial wound area
(day
0) and that of post treatment (day 8). The wound area on day 1 was 64mm2,
the corresponding size of the dermal punch. Calculations were made using the
following formula:
[Open area on day 8] - [Open area on day 1 ] / [Open area on day 1 ]
Specimens are fixed in 10% buffered formalin and paraffin embedded
blocks are sectioned perpendicular to the wound surface (5mm) and cut using
an Olympus microtome. Routine hematoxylin-eosin (H&E) staining was



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
268
performed on cross-sections of bisected wounds. Histologic examination of the
wounds allows assessment of whether the healing process and the morphologic
appearance of the repaired skin was improved by treatment with TNFR-6
alpha and/or TNFR-6 beta. A calibrated lens micrometer is used by a blinded
s observer to determine the distance of the wound gap.
Experimental data are analyzed using an unpaired t test. A p value of <
0.05 is considered significant.
The studies described in this example test activity in TNFR-6 protein.
However, one skilled in the art could easily modify the exemplified studies to
1o test the activity of polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TNFR-6 alpha and/or TNFR-6 beta.
Example 20: Lymphadema Animal Model
The purpose of this experimental approach is to create an appropriate
15 and consistent lymphedema model for testing the therapeutic effects of in
lymphangiogenesis and re-establishment of the lymphatic circulatory system
in the rat hind limb. Effectiveness is measured by swelling volume of the
affected limb, quantification of the amount of lymphatic vasculature, total
blood plasma protein, and histopathology. Acute lymphedema is observed for
20 7-10 days. Perhaps more importantly, the chronic progress of the edema is
followed for up to 3-4 weeks.
Prior to beginning surgery, blood sample is drawn for protein
concentration analysis. Male rats weighing approximately ~350g are dosed
with Pentobarbital. Subsequently, the right legs are shaved from knee to hip.
25 The shaved area is swabbed with gauze soaked in 70% EtOH. Blood is drawn
for serum total protein testing. Circumference and volumetric measurements
are made prior to injecting dye into paws after marking 2 measurement levels
(0.5 cm above heel, at mid-pt of dorsal paw). The intradermal dorsum of both
right and left paws are injected with 0.05 ml of 1% Evan's Blue.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
269
Circumference and volumetric measurements are then made following injection
of dye into paws.
Using the knee joint as a landmark, a mid-leg inguinal incision is made
circumferentially allowing the femoral vessels to be located. Forceps and
hemostats are used to dissect and separate the skin flaps. After locating the
femoral vessels, the lymphatic vessel that runs along side and underneath the
vessels) is located. The main lymphatic vessels in this area are then
electrically coagulated or suture ligated.
Using a microscope, muscles in back of the leg (near the semitendinosis
and adductors) are bluntly dissected. The popliteal lymph node is then
located.
The 2 proximal and 2 distal lymphatic vessels and distal blood supply of the
popliteal node are then and ligated by suturing. The popliteal lymph node,
and any accompanying adipose tissue, is then removed by cutting connective
tissues.
Care is taken to control any mild bleeding resulting from this
procedure. After lymphatics are occluded, the skin flaps are sealed by using
liquid skin (Vetbond) (AJ Buck). The separated skin edges are sealed to the
underlying muscle tissue while leaving a gap of ~0.5 cm around the leg. Skin
also may be anchored by suturing to underlying muscle when necessary.
To avoid infection, animals are housed individually with mesh (no
bedding). Recovering animals are checked daily through the optimal edematous
peak, which typically occurred by day 5-7. The plateau edematous peak are
then observed. To evaluate the intensity of the lymphedema, the
circumference and volumes of 2 designated places on each paw are measured
before operation and daily for 7 days. The effect plasma proteins on
lymphedema is determined and whether protein analysis is a useful testing
perimeter is also investigated. The weights of both control and edematous
limbs are evaluated at 2 places. Analysis is performed in a blind manner.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
270
Circumference Measurements: Under brief gas anesthetic to prevent
limb movement, a cloth tape is used to measure limb circumference.
Measurements are done at the ankle bone and dorsal paw by 2 different people
and the readings are averaged. Readings are taken from both control and
edematous limbs.
Volumetric Measurements: On the day of surgery, animals are
anesthetized with Pentobarbital and are tested prior to surgery. For daily
volumetrics animals are under brief halothane anesthetic (rapid immobilization
and quick recovery), both legs are shaved and equally marked using waterproof
1 o marker on legs. Legs are first dipped in water, then dipped into
instrument to
each marked level then measured by Buxco edema software(Chen/Victor).
Data is recorded by one person, while the other is dipping the limb to marked
area.
Blood-plasma protein measurements: Blood is drawn, spun, and serum
separated prior to surgery and the conclusion to the experiment to measure for
total protein and Ca2+ comparison.
Limb Weight Comparison: After drawing blood, the animal is prepared
for tissue collection. The limbs were amputated using a quillitine, then both
experimental and control legs were cut at the ligature and weighed. A second
2o weighing is done as the tibio-cacaneal joint is disarticulated and the foot
is
weighed.
Histological Preparations: The transverse muscle located behind the
knee (popliteal) area is dissected and arranged in a metal mold, filled with
freezeGel, dipped into cold methylbutane, placed into labeled sample bags at -
80 degree C until sectioning. Upon sectioning, the muscle was observed under
fluorescent microscopy for lymphatics. Other immuno/histological methods
are currently being evaluated.
The studies described in this example test activity in TNFR-6 proteins.
However, one skilled in the art could easily modify the exemplified studies to



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
271
test the activity of polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TNFR-6 alpha and/or TNFR-6 beta.
It will be clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and examples. Numerous
modifications and variations of the present invention are possible in light of
the above teachings and, therefore, are within the scope of the appended
claims.
Example 21: TNFR6-Fc Inhibits Fast mediated toxicity in a ConA Mouse
Model of Liver Injury
The intravenous administration of Concanavalin A to mice activates T
lymphocytes and induces both apoptotic and necrotic cell death of
hepatocytes, mimicking aspects of the pathophysiology of chronic active
hepatitis (Tiegs et al., J. Clin. Invest. 90: 196. (1992)). Fas-Fc protein, a
dimeric form of Fas expected to inhibit Fas ligand activity, has been reported
to reduce liver injury in this model via inhibition of Fas ligand
demonstrating
an involvement of Fas pathway in the pathology (Ksontini et al., J Immunol.;
60(8):4082-4089 (1998)).
Validation of model:



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
272
To validate the ConA mouse model, Con A was administered
intravenously to Balb/c mice at 10, 15, and 20 mg/kg dose of ConA along with
placebo or Fas-Fc at 97.5 micrograms/mouse. 10 Balb/c mice were used per
treatment group. The mice were sacrificed 22 hours after treatment, serum
collected and biochemical analysis performed using a Clinical Chemistry
Analyzer ILAB900 (Instrumentation Laboratory) to determine the levels of
the liver specific transaminases, alanine aminotransferase (ALT) and aspartate
aminotransferase (AST), which are released in the serum upon liver damage
((Tiegs et al., J. Clin. Invest. 90: 196. (1992)). The administration of FasFc
at
1o a dose of 97.5 micrograms/mouse (about 5 mg/kg) was found to significantly
inhibit the elevated liver enzymes at ConA doses of 10 and 15 mg/kg but not at
20 mg/kg (data not shown), thus validating the model.
Balb/C mice were injected intravenously with ConA (15 mg/kg)
together with or without a three log dose of TNFR6-Fc (0.6, 6. 60 ug/mouse).
The TNFR6-Fc fusion protein used in this example corresponds to the full
length TNFR6-alpha polypeptide sequence (amino acids 1-300 of SEQ
IDN0:2) fused to an Fc domain. 10 Balb/c mice were used per treatment
group. The mice were sacrificed 22 hours after treatment and serum levels of
ALT and AST were determined using a Clinical Chemistry Analyzer ILAB900
(Instrumentation Laboratory). The administration of T'NFR6-Fc significantly
inhibited both ALT and AST levels at the highest dose tested (60
micrograms/mouse, 3 mg/kg) by 50% (data not shown). Thus TNFR6-Fc
significantly reduced ConA induced serum AST and ALT in a dose response
fashion.
Effect of TNFR6-Fc on ConA induced apoptotic events in the liver
Since the elevation in serum liver enzyme levels reflects both apoptotic
and non-apoptotic pathways of hepatocyte destruction, a more critical
determination of the extent of liver injury can be derived via direct



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
273
measurement of apoptotic events. Thus apoptosis was analyzed using whole
liver cell suspensions isolated from mice treated with TNFR6-Fc and Con A.
Three independent markers of apoptosis were assessed on the same sample.
These include changes in surface expression of phosphatidylserine,
measurements of DNA damage, and caspase activation.
Balb/C mice were injected intravenously with ConA (15 mg/kg)
together with or without a three log dose of TNFR6-Fc (0.6, 6. 60 ug/mouse).
Cell suspensions were isolated from the livers of 3 mice/group and liver cells
were isolated by placing the intact liver tissue on a 70 p,m cell strainer and
1o teased apart with the stopper of a 5cc syringe using RPMI 1640/10% FBS.
To remove red blood cells and large piece of tissue debris, the filtered cell
suspension was layered over lymphocyte separation medium (density 1.0770
g/ml). The interface layer was collected, washed and the cells were counted.
Prior to FACS analysis, the cell suspension was refiltered over a 40 ~,m
filter.
For measurement of Annexin V binding (an indicator of apoptosis),
cells were first incubated with fluorochrome-conjugated monoclonal antibodies
CD45 CyChrome and B220 or anti-TCR(3 PE (Pharmingen, San Diego, CA).
Cells were washed with binding buffer (Pharmingen) then incubated with
Annexin V FITC (Pharmingen). Stained cells were acquired and analyzed using
2o a Becton Dickinson FACScan (Becton Dickinson, San Jose, CA). Only CD45
positive events were collected. Cells staining brightly for B220 and Annexin V
were considered apoptotic B cells; cells staining brightly for anti-TCR(3 and
Annexin V were considered apoptotic T cells.
The level of DNA degradation (another hallmark of apoptosis) was
determined by Terminal UTP nick-end labeling (TUNEL) which measures this
degradation by using TdT enzyme to add FITC-labeled dUTP to the 3' ends
of nicked DNA using the Apo-DIRECT kit (Pharmingen) according to
manufacturer's directions. Briefly, cells were fixed in 1 % paraformaldhyde,



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
274
washed in PBS and then fixed with ice-cold 70% ethanol. Cells were washed
twice in washing buffer, then incubated with staining solution containing TdT
enzyme and dUTP-FITC at 37°C for one hour. Cells were washed twice with
rinsing buffer, re-suspended in propidium iodide solution and acquired on the
FACScan. For analysis, an electronic gate was set on singlet events, and cells
staining brightly for dUTP-FITC were considered apoptotic cells.
To determine the presence of the active form of caspase-3 (an early
indicator of apoptosis) cells were incubated in IC FIX (BioSource
International, Camarillo, CA), washed twice in PBS, then permeablized with
IC PERM (BioSource). Cells were incubated with 5 ltg rabbit anti-caspase-3
PE (Pharmingen) in IC PERM, washed in IC PERM, then washed twice with
PBS. Cells were acquired on the FACScan and analyzed for PE mean
fluorescence.
For all three indicators of apoptosis, TNFR6-Fc inhibited apoptosis in
livers of mice as compared to mice treated with Con A alone (Table VI). Using
DNA damage as a marker and TUNEL analysis, a dose-dependent trend of
inhibition with TR6-Fc was observed. These data support a role for TNFR6-
Fc in inhibition of apoptosis in ConA-induced hepatitis.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
275
Table VI. Apoptosis of liver cells isolated from TNFR6-Fc-treated mice.'
Percent % Apoptotic Cells measured by:
Annexin Annexin
Treatment Tunel Caspase-3 V/TcR~3 V/B220
Untreated Control - 18.7 2.0 6.1


Con A (15 mg/kg) 24.4 35.2 7.0 12.2
Control


TNFR6-Fc (0.6 p,g/mouse)15.6 22.7 3.5 6.3


TNFR6-Fc (6.0 ~g/mouse)13.6 22.5 2.3 2.9


TNFR6-Fc (60 ~,g/mouse)9.5 20.3 3.0 4.2


'Liver cell suspensions were analyzed for apoptosis using one of three
to independent measures. DNA degradation was measured using TUNEL
staining; caspase activation by the analysis of the active form of caspase-3;
and annexin V staining of surface membrane changes. Cell suspensions
were isolated from the livers of 3 mice/group and pooled. The resulting
pooled suspension was used to perform each analysis. For Annexin-V
staining, only liver CD45+ cells were acquired and Annexin-V staining
assessed on cells costained for B220 or TcR(3.
Conclusion:
The findings that TNFR6-Fc reduced both ConA induced serum
2o AST and ALT levels and ConA induced liver cell apoptosis supports the
therapeutic application of TNFR6-alpha and TNFR6-beta polypeptides of
the invention for the treatment and/or prevention of hepatitis and other



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
276
forms of liver injury.
The entire disclosure of all publications (including patents, patent
applications, journal articles, laboratory manuals, books, or other documents)
cited herein are hereby incorporated by reference.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
277
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule l3bis)
A. The indications made below
relate to the microorganism
referred to in the description


on page S ,line


B. IDENTIFICATIONOFDEPOSTT Further
deposits are identified on an
additional sheet


Nameofdepositaryinstitution American
Type Culture Collection


Address of depositary institution
(including postal code and countw)


10801 University Boulevard


Manassas, Virginia 20110-2209


United States of America


Date of deposit Accession Number


22 November 1996 g~gOg


C. ADDITIONAL INDICATIONSIIeaveblankijnorapplicable)
This information is continued
on an additional sheet



D. DESIGNATED STATES FOR WHICH
INDICATIONS ARE MADE (if the
indications are not forall designated
States)


Europe


In respect to those designations
in which a European Patent is
sought a sample of the deposited


microorganism will be made available
until the publication of the
mention of the grant of the
European patent


or until the date on which application
has been refused or withdrawn
or is deemed to be withdrawn,
only by


the issue of such a sample to
an expert nominated by the person
requesting the sample (Rule
28 (4) EPC).


E. SEPARATE FURNISHING OFINDICATIONS(Ieaveblankifnorapplicable)


The indications listed below
mll be submoted to the International
Bureau later Ispecifwhegeneralnamreojtbeindicotiorue
g
"accession
"


.
.,
Number of Deposit
)



- For receiving Office use only For International Bureau use only
This sheet was received with the international application ~ This sheet was
received by the International Bureau on:
Authorized officer " Authorized officer
Form PCT/RO/134 (July 1992)



CA 02362929 2001-08-16
WO 00/52028 PCT/US00105686
278
CANADA
The applicant requests that, until either a Canadian patent has been issued on
the basis of an
application or the application has been refused, or is abandoned and no longer
subject to
reinstatement, or is withdrawn, the Commissioner of Patents only authorizes
the furnishing of
a sample of the deposited biological material referred to in the application
to an independent
expert nominated by the Commissioner, the applicant must, by a written
statement, inform
the International Bureau accordingly before completion of technical
preparations for
publication of the international application.
NORWAY
The applicant hereby requests that the application has been laid open to
public inspection (by
the Norwegian Patent Office), or has been finally decided upon by the
Norwegian Patent
Office without having been laid open inspection, the furnishing of a sample
shall only be
effected to an expert in the art. The request to this effect shall be filed by
the applicant with
the Norwegian Patent Office not later than at the time when the application is
made available
to the public under Sections 22 and 33(3) of the Norwegian Patents Act. If
such a request has
been filed by the applicant, any request made by a third party for the
furnishing of a sample
shall indicate the expert to be used. That expert may be any person entered on
the list of
recognized experts drawn up by the Norwegian Patent Office or any person
approved by the
applicant in the individual case.
AUSTRALIA
The applicant hereby gives notice that the furnishing of a sample of a
microorganism shall
only be effected prior to the grant of a patent, or prior to the lapsing,
refusal or withdrawal of
the application, to a person who is a skilled addressee without an interest in
the invention
(Regulation 3.25(3) of the Australian Patents Regulations).
FINLAND
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the National Board of Patents and Regulations), or has been
finally decided
upon by the National Board of Patents and Registration without having been
laid open to
public inspection, the furnishing of a sample shall only be effected to an
expert in the art.
UNITED KINGDOM
The applicant hereby requests that the furnishing of a sample of a
microorganism shall only
be made available to an expert. The request to this effect must be filed by
the applicant with
the International Bureau before the completion of the technical preparations
for the
international publication of the application.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
279
Page 2
DENMARK
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the Danish Patent Office), or has been finally decided upon by
the Danish
Patent office without having been laid open to public inspection, the
furnishing of a sample
shall only be effected to an expert in the art. The request to this effect
shall be filed by the
applicant with the Danish Patent Office not later that at the time when the
application is made
available to the public under Sections 22 and 33(3) of the Danish Patents Act.
If such a
request has been filed by the applicant, any request made by a third party for
the furnishing of
a sample shall indicate the expert to be used. That expert may be any person
entered on a list
of recognized experts drawn up by the Danish Patent Office or any person by
the applicant in
the individual case.
SWEDEN
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the Swedish Patent Office), or has been finally decided upon by
the Swedish
Patent Office without having been laid open to public inspection, the
furnishing of a sample
shall only be effected to an expert in the art. The request to this effect
shall be filed by the
applicant with the International Bureau before the expiration of 16 months
from the priority
date (preferably on the Form PCT/RO/134 reproduced in annex Z of Volume I of
the PCT
Applicant's Guide). If such a request has been filed by the applicant any
request made by a
third party for the furnishing of a sample shall indicate the expert to be
used. That expert may
be any person entered on a list of recognized experts drawn up by the Swedish
Patent Office
or any person approved by a applicant in the individual case.
NETHERLANDS
The applicant hereby requests that until the date of a grant of a Netherlands
patent or until the
date on which the application is refused or withdrawn or lapsed, the
microorganism shall be
made available as provided in the 31F(1) of the Patent Rules only by the issue
of a sample to
an expert. The request to this effect must be furnished by the applicant with
the Netherlands
Industrial Property Office before the date on which the application is made
available to the
public under Section 22C or Section 25 of the Patents Act of the Kingdom of
the
Netherlands, whichever of the two dates occurs earlier.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
280
INDICATIONS RELATING TO A DEPOSTI'ED MICROORGANISM
(PCT Rule l3bis)
r1. The indications made below
relate to the microorganism
referred to in the description


on page 5 ,line 7


B. IDE1VT'IFICATIONOFDEPOSTf
Further deposits are identified
on an additional sheet


Nameofdepositaryinstitution
American Type Culture COIlectfOn


Address of depositary institution
(including postal code and
counrw)


10801 University Boulevard


Manassas, Virginia 20110-2209


United States of America


Date of deposit Accession Number


22 November 1996 97810


C. ADDITIONAL INDICATIONSlleave
blank if not applicable) This
information is continued on
an additional sheet



D. DESIGNATED STATES FOR WHICH
INDICATIONS ARE MADE(ifthe
indications arenotforalldesignatedStates)


Europe


In respect to those designations
in which a European Patent
is sought a sample of the deposited


microorganism will be made available
until the publication of the
mention of the grant of the
European patent


or until the date on which application
has been refused or withdrawn
or is deemed to be withdrawn,
only by


the issue of such a sample to
an expert nominated by the
person requesting the sample
(Rule 28 (4) EPC).


E. SEPARATE FURNISHING OF INDICATIONSfleaveblankifnotapplicable)


The indications listed below
will be submitted to the International
Bureau later Ispecifwhegeneral
narureoftheindicationse.g
'Accession
"


..
Number of Deposit
)



For receiving Office use only ForIntemational Bureau use only
This sheet was received with the international application ~ This sheet was
received by the International Bureau on:
Authorized officer " Authorized officer
Forth PCT/RO/134 (luly 199?)



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
281
CANADA
The applicant requests that, until either a Canadian patent has been issued on
the basis of an
application or the application has been refused, or is abandoned and no longer
subject to
reinstatement, or is withdrawn, the Commissioner of Patents only authorizes
the furnishing of
a sample of the deposited biological material referred to in the application
to an independent
expert nominated by the Commissioner, the applicant must, by a written
statement, inform
the International Bureau accordingly before completion of technical
preparations for
publication of the international application.
NORWAY
The applicant hereby requests that the application has been laid open to
public inspection (by
the Norwegian Patent Office), or has been finally decided upon by the
Norwegian Patent
Office without having been laid open inspection, the furnishing of a sample
shall only be
effected to an expert in the art. The request to this effect shall be filed by
the applicant with
the Norwegian Patent Office not later than at the time when the application is
made available
to the public under Sections 22 and 33(3) of the Norwegian Patents Act. If
such a request has
been filed by the applicant, any request made by a third party for the
furnishing of a sample
shall indicate the expert to be used. That expert may be any person entered on
the list of
recognized experts drawn up by the Norwegian Patent Office or any person
approved by the
applicant in the individual case.
AUSTRALIA
The applicant hereby gives notice that the furnishing of a sample of a
microorganism shall
only be effected prior to the grant of a patent, or prior to the lapsing,
refusal or withdrawal of
the application, to a person who is a skilled addressee without an interest in
the invention
(Regulation 3.25(3) of the Australian Patents Regulations).
FINLAND
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the National Board of Patents and Regulations), or has been
finally decided
upon by the National Board of Patents and Registration without having been
laid open to
public inspection, the furnishing of a sample shall only be effected to an
expert in the art.
UNITED KINGDOM
The applicant hereby requests that the furnishing of a sample of a
microorganism shall only
be made available to an expert. The request to this effect must be filed by
the applicant with
the International Bureau before the completion of the technical preparations
for the
international publication of the application.



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
282
Page 2
DENMARK
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the Danish Patent Office), or has been finally decided upon by
the Danish
Patent office without having been laid open to public inspection, the
furnishing of a sample
shall only be effected to an expert in the art. The request to this effect
shall be filed by the
applicant with the Danish Patent Office not later that at the time when the
application is made
available to the public under Sections 22 and 33(3) of the Danish Patents Act.
If such a
request has been filed by the applicant, any request made by a third party for
the furnishing of
a sample shall indicate the expert to be used. That expert may be any person
entered on a list
of recognized experts drawn up by the Danish Patent Office or any person by
the applicant in
the individual case.
SWEDEN
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the Swedish Patent Office), or has been finally decided upon by
the Swedish
Patent Office without having been laid open to public inspection, the
furnishing of a sample
shall only be effected to an expert in the art. The request to this effect
shall be filed by the
applicant with the International Bureau before the expiration of 16 months
from the priority
date (preferably on the Form PCT/RO/134 reproduced in annex Z of Volume I of
the PCT
Applicant's Guide). If such a request has been filed by the applicant any
request made by a
third party for the furnishing of a sample shall indicate the expert to be
used. That expert may
be any person entered on a list of recognized experts drawn up by the Swedish
Patent Office
or any person approved by a applicant in the individual case.
NETHERLANDS
The applicant hereby requests that until the date of a grant of a Netherlands
patent or until the
date on which the application is refused or withdrawn or lapsed, the
microorganism shall be
made available as provided in the 31F(1 ) of the Patent Rules only by the
issue of a sample to
an expert. The request to this effect must be furnished by the applicant with
the Netherlands
Industrial Property Office before the date on which the application is made
available to the
public under Section 22C or Section 25 of the Patents Act of the Kingdom of
the
Netherlands, whichever of the two dates occurs earlier.



CA 02362929 2001-08-16
FOR THE PURPOSES OF INFORMATION ONLY
Codes used to identify States party to the PCT on the front pages of pamphlets
publishing international applications under the PCT.
AL Albania ES Spain LS Lesotho SI Slovenia


AM Armenia FI Finland LT Lithuania SK Slovakia


AT Austria FR France LU Luxembourg SN Senegal


AU Australia GA Gabon LV Latvia SZ Swaziland


AZ Azerbaijan GB United KingdomMC Monaco TD Chad


BA Bosnia and GE Georgia MD Republic of TG Togo
Herzegovina Moldova


BB Barbados GH Ghana MG Madagascar TJ Tajikistan


BE Belgium GN Guinea MK The former TM Turkmenistan
Yugoslav


BF Burkina Faso GR Greece Republic of TR Turkey
Macedonia


BG Bulgaria HU Hungary ML Mali TT Trinidad
and Tobago


BJ Benin IE Ireland MN Mongolia UA Ukraine


BR Brazil IL Israel MR Mauritania UG Uganda


BY Belarus IS Iceland MW Malawi US United States
of America


CA Canada IT Italy MX Mexico UZ Uzbekistan


CF Central AfricanJP Japan NE Niger VN Viet Nam
Republic


CG Congo KE Kenya NL Netherlands YU Yugoslavia


CH Switzerland KG Kyrgyzstan NO Norway ZW Zimbabwe


CI CBte d'IvoireKP Democratic NZ New Zealand
People's


CM Cameroon Republic PL Poland
of Korea


CN China KR Republic PT Portugal
of Korea


CU Cuba KZ Kazakstan RO Romania


CZ Czech RepublicLC Saint Lucia RU Russian Federation


DE Germany LI LiechtensteinSD Sudan


DK Denmark LK Sri Lanka SE Sweden


EE Estonia LR Liberia SG Singapore





CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
1
SEQUENCE LISTING
<110> Human Genome Sciences, Inc.
<120> Tumor Necrosis Factor Receptors 6 Alpha and 6 Beta
<130> PF454P1.PCT
<140> Unassigned
<141> 2000-03-03
<150> 60/121,774
<151> 1999-03-04
<150> 60/124,092
<151> 1999-03-12
<150> 60/131,279
<151> 1999-04-27
<150> 60/131,964
<151> 1999-04-30
<150> 60/146,371
<151> 1999-08-02
<150> 60/168,235
<151> 1999-12-01
<160> 27
<170> PatentIn Ver. 2.1
<210> 1
<211> 1077
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (25)..(924)
<400> 1
gctctccctg ctccagcaag gacc atg agg gcg ctg gag ggg cca ggc ctg 51
Met Arg Ala Leu Glu Gly Pro Gly Leu
1 5
tcg ctg ctg tgc ctg gtg ttg gcg ctg cct gcc ctg ctg ccg gtg ccg 99
Ser Leu Leu Cys Leu Val Leu Ala Leu Pro Ala Leu Leu Pro Val Pro
15 20 25
get gta cgc gga gtg gca gaa aca ccc acc tac ccc tgg cgg gac gca 147
Ala Val Arg Gly Val Ala Glu Thr Pro Thr Tyr Pro Trp Arg Asp Ala
30 35 40
gag aca ggg gag cgg ctg gtg tgc gcc cag tgc ccc cca ggc acc ttt 195
Glu Thr Gly Glu Arg Leu Val Cys Ala Gln Cys Pro Pro Gly Thr Phe
45 50 55



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
2
gtg cag cgg ccg tgc cgc cga gac agc ccc acg acg tgt ggc ccg tgt 243
Val Gln Arg Pro Cys Arg Arg Asp Ser Pro Thr Thr Cys Gly Pro Cys
60 65 70
cca ccg cgc cac tac acg cag ttc tgg aac tac ctg gag cgc tgc cgc 291
Pro Pro Arg His Tyr Thr Gln Phe Trp Asn Tyr Leu Glu Arg Cys Arg
75 80 85
tac tgc aac gtc ctc tgc ggg gag cgt gag gag gag gca cgg get tgc 339
Tyr Cys Asn Val Leu Cys Gly Glu Arg Glu Glu Glu Ala Arg Ala Cys
90 95 100 105
cac gcc acc cac aac cgt gcc tgc cgc tgc cgc acc ggc ttc ttc gcg 387
His Ala Thr His Asn Arg Ala Cys Arg Cys Arg Thr Gly Phe Phe Ala
110 115 120
cac get ggt ttc tgc ttg gag cac gca tcg tgt cca cct ggt gcc ggc 435
His Ala Gly Phe Cys Leu Glu His Ala Ser Cys Pro Pro Gly Aia Gly
125 130 135
gtg att gcc ccg ggc acc ccc agc cag aac acg cag tgc cag ccg tgc 483
Val Ile Ala Pro Gly Thr Pro Ser Gln Asn Thr Gln Cys Gln Pro Cys
140 145 150
ccc cca ggc acc ttc tca gcc agc agc tcc agc tca gag cag tgc cag 531
Pro Pro Gly Thr Phe Ser Ala Ser Ser Ser Ser Ser Glu Gln Cys Gln
155 160 165
ccc cac cgc aac tgc acg gcc ctg ggc ctg gcc ctc aat gtg cca ggc 579
Pro His Arg Asn Cys Thr Ala Leu Gly Leu Ala Leu Asn Val Pro Gly
170 175 180 185
tct tcc tcc cat gac acc ctg tgc acc agc tgc act ggc ttc ccc ctc 627
Ser Ser Ser His Asp Thr Leu Cys Thr Ser Cys Thr Gly Phe Pro Leu
190 195 200
agc acc agg gta cca gga get gag gag tgt gag cgt gcc gtc atc gac 675
Ser Thr Arg Val Pro Gly Ala Glu Glu Cys Glu Arg Ala Val Ile Asp
205 210 215
ttt gtg get ttc cag gac atc tcc atc aag agg ctg cag cgg ctg ctg 723
Phe Val Ala Phe Gln Asp Ile Ser Ile Lys Arg Leu Gln Arg Leu Leu
220 225 230
cag gcc ctc gag gcc ccg gag ggc tgg ggt ccg aca cca agg gcg ggc 771
Gln Ala Leu Glu Ala Pro Glu Gly Trp Gly Pro Thr Pro Arg Ala Gly
235 240 245
cgc gcg gcc ttg cag ctg aag ctg cgt cgg cgg ctc acg gag ctc ctg 819
Arg Ala Ala Leu Gln Leu Lys Leu Arg Arg Arg Leu Thr Glu Leu Leu
250 255 260 265
ggg gcg cag gac ggg gcg ctg ctg gtg cgg ctg ctg cag gcg ctg cgc 867
Gly Ala Gln Asp Gly Ala Leu Leu Val Arg Leu Leu Gln Ala Leu Arg
270 275 280
gtg gcc agg atg ccc ggg ctg gag cgg agc gtc cgt gag cgc ttc ctc 915
Val Ala Arg Met Pro Gly Leu Glu Arg Ser Val Arg Glu Arg Phe Leu
285 290 295



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
3
cct gtg cac tgatcctggc cccctcttat ttattctaca tccttggcac 964
Pro Val His
300
cccacttgca ctgaaagagg ctttttttta aatagaagaa atgaggtttc ttaaagctta 1024
tttttataaa gctttttcat aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa 1077
<210> 2
<211> 300
<212> PRT
<213> Homo Sapiens
<400> 2
Met Arg Ala Leu Glu Gly Pro Gly Leu Ser Leu Leu Cys Leu Val Leu
1 5 10 15
Ala Leu Pro Ala Leu Leu Pro Val Pro Ala Val Arg Gly Val Ala Glu
20 25 30
Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu Arg Leu Val
35 40 45
Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro Cys Arg Arg
50 55 60
Asp Ser Pro Thr Thr Cys Gly Pro Cys Pro Pro Arg His Tyr Thr Gln
65 70 75 80
Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Asn Val Leu Cys Gly
85 90 95
Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His Asn Arg Ala
100 105 110
Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe Cys Leu Glu
115 120 125
His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro Gly Thr Pro
130 135 140
Ser Gln Asn Thr Gln Cys Gln Pro Cys Pro Pro Gly Thr Phe Ser Ala
145 150 155 160
Ser Ser Ser Ser Ser Glu Gln Cys Gln Pro His Arg Asn Cys Thr Ala
165 170 175
Leu Gly Leu Ala Leu Asn Val Pro Gly Ser Ser Ser His Asp Thr Leu
180 185 190
Cys Thr Ser Cys Thr Gly Phe Pro Leu Ser Thr Arg Val Pro Gly Ala
195 200 205
Glu Glu Cys Glu Arg Ala Val Ile Asp Phe Val Ala Phe Gln Asp Ile
210 215 220
Ser Ile Lys Arg Leu Gln Arg Leu Leu Gln Ala Leu Glu Ala Pro Glu



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
4
225 230 235 240
Gly Trp Gly Pro Thr Pro Arg Ala Gly Arg Ala Ala Leu Gln Leu Lys
245 250 255
Leu Arg Arg Arg Leu Thr Glu Leu Leu Gly Ala Gln Asp Gly Ala Leu
260 265 270
Leu Val Arg Leu Leu Gln Ala Leu Arg Val Ala Arg Met Pro Gly Leu
275 280 285
Glu Arg Ser Val Arg Glu Arg Phe Leu Pro Val His
290 295 300
<210> 3
<211> 1667
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (73)..(582)
<400> 3
tggcatgtcg gtcaggcaca gcagggtcct gtgtccgcgc tgagccgcgc tctccctgct 60
ccagcaagga cc atg agg gcg ctg gag ggg cca ggc ctg tcg ctg ctg tgc 111
Met Arg Ala Leu Glu Gly Pro Gly Leu Ser Leu Leu Cys
1 5 10
ctg gtg ttg gcg ctg cct gcc ctg ctg ccg gtg ccg get gta cgc gga 159
Leu Val Leu Ala Leu Pro Ala Leu Leu Pro Val Pro Ala Val Arg Gly
15 20 25
gtg gca gaa aca ccc acc tac ccc tgg cgg gac gca gag aca ggg gag 207
Val Ala Glu Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu
30 35 40 45
cgg ctg gtg tgc gcc cag tgc ccc cca ggc acc ttt gtg cag cgg ccg 255
Arg Leu Val Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro
50 55 60
tgc cgc cga gac agc ccc acg acg tgt ggc ccg tgt cca ccg cgc cac 303
Cys Arg Arg Asp Ser Pro Thr Thr Cys Gly Pro Cys Pro Pro Arg His
65 70 75
tac acg cag ttc tgg aac tac ctg gag cgc tgc cgc tac tgc aac gtc 351
Tyr Thr Gln Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Asn Val
80 85 90
ctc tgc ggg gag cgt gag gag gag gca cgg get tgc cac gcc acc cac 399
Leu Cys Gly Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His
95 100 105
aac cgt gcc tgc cgc tgc cgc acc ggc ttc ttc gcg cac get ggt ttc 447
Asn Arg Ala Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe
110 115 120 125



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
tgc ttg gag cac gca tcg tgt cca cct ggt gcc ggc gtg att gcc ccg 495
Cys Leu Glu His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro
130 135 140
ggt gag agc tgg gcg agg gga ggg gcc ccc agg agt ggt ggc cgg agg 543
Gly Glu Ser Trp Ala Arg Gly Gly Ala Pro Arg Ser Gly Gly Arg Arg
145 150 ~ 155
tgt ggc agg ggt cag gtt get ggt ccc agc ctt gca ccc tgagctagga 592
Cys Gly Arg Gly Gln Val Ala Gly Pro Ser Leu Ala Pro
160 165 170
caccagttcc cctgaccctg ttcttccctc ctggctgcag gcacccccag ccagaacacg 652
cagtgccagc cgtgcccccc aggcaccttc tcagccagca gctccagctc agagcagtgc 712
cagccccacc gcaactgcac ggccctgggc ctggccctca atgtgccagg ctcttcctcc 772
catgacaccc tgtgcaccag ctgcactggc ttccccctca gcaccagggt accaggtgag 832
ccagaggcct gagggggcag cacactgcag gccaggccca cttgtgccct cactcctgcc 892
cctgcacgtg catctagcct gaggcatgcc agctggctct gggaaggggc cacagtggat 952
ttgaggggtc aggggtccct ccactagatc cccaccaagt ctgccctctc aggggtggct 1012
gagaatttgg atctgagcca gggcacagcc tcccctggag agctctggga aagtgggcag 1072
caatctccta actgcccgag gggaaggtgg ctggctcctc tgacacgggg aaaccgaggc 1132
ctgatggtaa ctctcctaac tgcctgagag gaaggtggct gcctcctctg acatggggaa 1192
accgaggccc aatgttaacc actgttgaga agtcacaggg ggaagtgacc cccttaacat 1252
caagtcaggt ccggtccatc tgcaggtccc aactcgcccc ttccgatggc ccaggagccc 1312
caagcccttg cctgggcccc cttgcctctt gcagccaagg tccgagtggc cgctcctgcc 1372
ccctaggcct ttgctccagc tctctgaccg aaggctcctg ccccttctcc agtccccatc 1432
gttgcactgc cctctccagc acggctcact gcacagggat ttctctctcc tgcaaacccc 1492
ccgagtgggg cccagaaagc agggtacctg gcagcccccg ccagtgtgtg tgggtgaaat 1552
gatcggaccg ctgcctcccc accccactgc aggagctgag gagtgtgagc gtgccgtcat 1612
cgactttgtg gctttccagg acatctccat caagaggagc ggctgctgca ggccc 1667
<210> 4
<211> 170
<212> PRT
<213> Homo sapiens
<400> 4
Met Arg Ala Leu Glu Gly Pro Gly Leu Ser Leu Leu Cys Leu Val Leu
1 5 10 15



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
6
Ala Leu Pro Ala Leu Leu Pro Val Pro Ala Val Arg Gly Val Ala Glu
20 25 30
Thr Pro Thr Tyr Pro Trp Arg Asp Ala Glu Thr Gly Glu Arg Leu Val
35 40 45
Cys Ala Gln Cys Pro Pro Gly Thr Phe Val Gln Arg Pro Cys Arg Arg
50 55 60
Asp Ser Pro Thr Thr Cys Gly Pro Cys Pro Pro Arg His Tyr Thr Gln
65 70 75 80
Phe Trp Asn Tyr Leu Glu Arg Cys Arg Tyr Cys Asn Val Leu Cys Gly
85 90 95
Glu Arg Glu Glu Glu Ala Arg Ala Cys His Ala Thr His Asn Arg Ala
100 105 110
Cys Arg Cys Arg Thr Gly Phe Phe Ala His Ala Gly Phe Cys Leu Glu
115 120 125
His Ala Ser Cys Pro Pro Gly Ala Gly Val Ile Ala Pro Gly Glu Ser
130 135 140
Trp Ala Arg Gly Gly Ala Pro Arg Ser Gly Gly Arg Arg Cys Gly Arg
145 150 155 160
Gly Gln Val Ala Gly Pro Ser Leu Ala Pro
165 170
<210> 5
<211> 455
<212> PRT
<213> Homo Sapiens
<400> 5
Met Gly Leu Ser Thr Val Pro Asp Leu Leu Leu Pro Leu Val Leu Leu
10 15
Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly Leu Val Pro
20 25 30
His Leu Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gln Gly Lys
35 40 45
Tyr Ile His Pro Gln Asn Asn Ser Ile Cys Cys Thr Lys Cys His Lys
50 55 60
Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp Thr Asp
65 70 75 80
Cys Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala Ser Glu Asn His Leu
85 90 95
Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu Met Gly Gln Val
100 105 110



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
7
Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg
115 120 125
Lys Asn Gln Tyr Arg His Tyr Trp Ser Glu Asn Leu Phe Gln Cys Phe
130 135 140
Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu
145 150 155 160
Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly Phe Phe Leu Arg Glu
165 170 175
Asn Glu Cys Val Ser Cys Ser Asn Cys Lys Lys Ser Leu Glu Cys Thr
180 185 190
Lys Leu Cys Leu Pro Gln Ile Glu Asn Val Lys Gly Thr Glu Asp Ser
195 200 205
Gly Thr Thr Val Leu Leu Pro Leu Val Ile Phe Phe Gly Leu Cys Leu
210 215 220
Leu Ser Leu Leu Phe Ile Gly Leu Met Tyr Arg Tyr Gln Arg Trp Lys
225 230 235 240
Ser Lys Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro Glu Lys Glu
245 250 255
Gly Glu Leu Glu Gly Thr Thr Thr Lys Pro Leu Ala Pro Asn Pro Ser
260 265 270
Phe Ser Pro Thr Pro Gly Phe Thr Pro Thr Leu Gly Phe Ser Pro Val
275 280 285
Pro Ser Ser Thr Phe Thr Ser Ser Ser Thr Tyr Thr Pro Gly Asp Cys
290 295 300
Pro Asn Phe Ala Ala Pro Arg Arg Glu Val Ala Pro Pro Tyr Gln Gly
305 310 315 320
Ala Asp Pro Ile Leu Ala Thr Ala Leu Ala Ser Asp Pro Ile Pro Asn
325 330 335
Pro Leu Gln Lys Trp Glu Asp Ser Ala His Lys Pro Gln Ser Leu Asp
340 345 350
Thr Asp Asp Pro Ala Thr Leu Tyr Ala Val Val Glu Asn Val Pro Pro
355 360 365
Leu Arg Trp Lys Glu Phe Val Arg Arg Leu Gly Leu Ser Asp His Glu
370 375 380
Ile Asp Arg Leu Glu Leu Gln Asn Gly Arg Cys Leu Arg Glu Ala Gln
385 390 395 400
Tyr Ser Met Leu Ala Thr Trp Arg Arg Arg Thr Pro Arg Arg Glu Ala
405 410 415
Thr Leu Glu Leu Leu Gly Arg Val Leu Arg Asp Met Asp Leu Leu Gly
420 425 430



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
8
Cys Leu Glu Asp Ile Glu Glu Ala Leu Cys Gly Pro Ala Ala Leu Pro
435 440 445
Pro Ala Pro Ser Leu Leu Arg
450 455
<210> 6
<211> 461
<212> PRT
<213> Homo sapiens
<400> 6
Met Ala Pro Val Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu
1 5 10 15
Trp Ala Ala Ala His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr
20 25 30
Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln
35 40 45
Thr Ala Gln Met Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys
50 55 60
Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp
65 70 75 80
Ser Thr Tyr Thr Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys
85 90 95
Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg
100 105 110
Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu
115 120 125
Ser Lys Gln Glu Gly Cys Arg Leu Cys Ala Pro Leu Arg Lys Cys Arg
130 135 140
Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val Val
145 150 155 160
Cys Lys Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr
165 170 175
Asp Ile Cys Arg Pro His Gln Ile Cys Asn Val Val Ala Ile Pro Gly
180 185 190
Asn Ala Ser Arg Asp Ala Val Cys Thr Ser Thr Ser Pro Thr Arg Ser
195 200 205
Met Ala Pro Gly Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser
210 215 220
Gln His Thr Gln Pro Thr Pro Glu Pro Ser Thr Ala Pro Ser Thr Ser
225 230 235 240



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
9
Phe Leu Leu Pro Met Gly Pro Ser Pro Pro Ala Glu Gly Ser Thr Gly
245 250 255
Asp Phe Ala Leu Pro Val Gly Leu Ile Val Gly Val Thr Ala Leu Gly
260 265 270
Leu Leu Ile Ile Gly Val Val Asn Cys Val Ile Met Thr Gln Val Lys
275 280 285
Lys Lys Pro Leu Cys Leu Gln Arg Glu Ala Lys Val Pro His Leu Pro
290 295 300
Ala Asp Lys Ala Arg Gly Thr Gln Gly Pro Glu Gln Gln His Leu Leu
305 310 315 320
Ile Thr Ala Pro Ser Ser Ser Ser Ser Ser Leu Glu Ser Ser Ala Ser
325 330 335
Ala Leu Asp Arg Arg Ala Pro Thr Arg Asn Gln Pro Gln Ala Pro Gly
340 345 350
Val Glu Ala Ser Gly Ala Gly Glu Ala Arg Ala Ser Thr Gly Ser Ser
355 360 365
Asp Ser Ser Pro Gly Gly His Gly Thr Gln Val Asn Val Thr Cys Ile
370 375 380
Val Asn Val Cys Ser Ser Ser Asp His Ser Ser Gln Cys Ser Ser Gln
385 390 395 400
Ala Ser Ser Thr Met Gly Asp Thr Asp Ser Ser Pro Ser Glu Ser Pro
405 410 415
Lys Asp Glu Gln Val Pro Phe Ser Lys Glu Glu Cys Ala Phe Arg Ser
420 425 430
Gln Leu Glu Thr Pro Glu Thr Leu Leu Gly Ser Thr Glu Glu Lys Pro
435 440 445
Leu Pro Leu Gly Val Pro Asp Ala Gly Met Lys Pro Ser
450 455 460
<210> 7
<211> 427
<212> PRT
<213> Homo Sapiens
<400> 7
Met Gly Ala Gly Ala Thr Gly Arg Ala Met Asp Gly Pro Arg Leu Leu
1 5 10 15
Leu Leu Leu Leu Leu Gly Val Ser Leu Gly Gly Ala Lys Glu Ala Cys
20 25 30
Pro Thr Gly Leu Tyr Thr His Ser Gly Glu Cys Cys Lys Ala Cys Asn
35 40 45
Leu Gly Glu Gly Val Ala Gln Pro Cys Gly Ala Asn Gln Thr Val Cys



CA 02362929 2001-08-16
WO 00/52028 PCT/LJS00/05686
50 55 60
Glu Pro Cys Leu Asp Ser Val Thr Phe Ser Asp Val Val Ser Ala Thr
65 70 75 80
Glu Pro Cys Lys Pro Cys Thr Glu Cys Val Gly Leu Gln Ser Met Ser
85 90 95
Ala Pro Cys Val Glu Ala Asp Asp Ala Val Cys Arg Cys Ala Tyr Gly
100 105 110
Tyr Tyr Gln Asp Glu Thr Thr Gly Arg Cys Glu Ala Cys Arg Val Cys
115 120 125
Glu Ala Gly Ser Gly Leu Val Phe Ser Cys Gln Asp Lys Gln Asn Thr
130 135 140
Val Cys Glu Glu Cys Pro Asp Gly Thr Tyr Ser Asp Glu Ala Asn His
145 150 155 160
Val Asp Pro Cys Leu Pro Cys Thr Val Cys Glu Asp Thr Glu Arg Gln
165 170 175
Leu Arg Glu Cys Thr Arg Trp Ala Asp Ala Glu Cys Glu Glu Ile Pro
180 185 190
Gly Arg Trp Ile Thr Arg Ser Thr Pro Pro Glu Gly Ser Asp Ser Thr
195 200 205
Ala Pro Ser Thr Gln Glu Pro Glu Ala Pro Pro Glu Gln Asp Leu Ile
210 215 220
Ala Ser Thr Val Ala Gly Val Val Thr Thr Val Met Gly Ser Ser Gln
225 230 235 240
Pro Val Val Thr Arg Gly Thr Thr Asp Asn Leu Ile Pro Val Tyr Cys
245 250 255
Ser Ile Leu Ala Ala Val Val Val Gly Leu Val Ala Tyr Ile Ala Phe
260 265 270
Lys Arg Trp Asn Ser Cys Lys Gln Asn Lys Gln Gly Ala Asn Ser Arg
275 280 285
Pro Val Asn Gln Thr Pro Pro Pro Glu Gly Glu Lys Leu His Ser Asp
290 295 300
Ser Gly Ile Ser Val Asp Ser Gln Ser Leu His Asp Gln Gln Pro His
305 310 315 320
Thr Gln Thr Ala Ser Gly Gln Ala Leu Lys Gly Asp Gly Gly Leu Tyr
325 330 335
Ser Ser Leu Pro Pro Ala Lys Arg Glu Glu Val Glu Lys Leu Leu Asn
340 345 350
Gly Ser Ala Gly Asp Thr Trp Arg His Leu Ala Gly Glu Leu Gly Tyr
355 360 365



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
11
Gln Pro Glu His Ile Asp Ser Phe Thr His Glu Ala Cys Pro Val Arg
370 375 380
Ala Leu Leu Ala Ser Trp Ala Thr Gln Asp Ser Ala Thr Leu Asp Ala
385 390 395 400
Leu Leu Ala Ala Leu Arg Arg Ile Gln Arg Ala Asp Leu Val Glu Ser
405 410 415
Leu Cys Ser Glu Ser Thr Ala Thr Ser Pro Val
420 425
<210> 8
<211> 415
<212> PRT
<213> Homo sapiens
<400> 8
Met Arg Leu Pro Arg Ala Ser Ser Pro Cys Gly Leu Ala Trp Gly Pro
1 5 10 15
Leu Leu Leu Gly Leu Ser Gly Leu Leu Val Ala Ser Gln Pro Gln Leu
20 25 30
Val Pro Pro Tyr Arg Ile Glu Asn Gln Thr Cys Trp Asp Gln Asp Lys
35 40 45
Glu Tyr Tyr Glu Pro Met His Asp Val Cys Cys Ser Arg Cys Pro Pro
50 55 60
Gly Glu Phe Val Phe Ala Val Cys Ser Arg Ser Gln Asp Thr Val Cys
65 70 75 80
Lys Thr Cys Pro His Asn Ser Tyr Asn Glu His Trp Asn His Leu Ser
85 90 95
Thr Cys Gln Leu Cys Arg Pro Cys Asp Ile Val Leu Gly Phe Glu Glu
100 105 110
Val Ala Pro Cys Thr Ser Asp Arg Lys Ala Glu Cys Arg Cys Gln Pro
115 120 125
Gly Met Ser Cys Val Tyr Leu Asp Asn Glu Cys Val His Cys Glu Glu
130 135 140
Glu Arg Leu Val Leu Cys Gln Pro Gly Thr Glu Ala Glu Val Thr Asp
145 150 155 160
Glu Ile Met Asp Thr Asp Val Asn Cys Val Pro Cys Lys Pro Gly His
165 170 175
Phe Gln Asn Thr Ser Ser Pro Arg Ala Arg Cys Gln Pro His Thr Arg
180 185 190
Cys Glu Ile Gln Gly Leu Val Glu Ala Ala Pro Gly Thr Ser Tyr Ser
195 200 205
Asp Thr Ile Cys Lys Asn Pro Pro Glu Pro Gly Ala Met Leu Leu Leu



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
12
210 215 220
Ala Ile Leu Leu Ser Leu Val Leu Phe Leu Leu Phe Thr Thr Val Leu
225 230 235 240
Ala Cys Ala Trp Met Arg His Pro Ser Leu Cys Arg Lys Leu Gly Thr
245 250 255
Leu Leu Lys Arg His Pro Glu Gly Glu Glu Ser Pro Pro Cys Pro Ala
260 265 270
Pro Arg Ala Asp Pro His Phe Pro Asp Leu Ala Glu Pro Leu Leu Pro
275 280 285
Met Ser Gly Asp Leu Ser Pro Ser Pro Ala Gly Pro Pro Thr Ala Pro
290 295 300
Ser Leu Glu Glu Val Val Leu Gln Gln Gln Ser Pro Leu Val Gln Ala
305 310 315 320
Arg Glu Leu Glu Ala Glu Pro Gly Glu His Gly Gln Val Ala His Gly
325 330 335
Ala Asn Gly Ile His Val Thr Gly Gly Ser Val Thr Val Thr Gly Asn
340 345 350
Ile Tyr Ile Tyr Asn Gly Pro Val Leu Gly Gly Thr Arg Gly Pro Gly
355 360 365
Asp Pro Pro Ala Pro Pro Glu Pro Pro Tyr Pro Thr Pro Glu Glu Gly
370 375 380
Ala Pro Gly Pro Ser Glu Leu Ser Thr Pro Tyr Gln Glu Asp Gly Lys
385 390 395 400
Ala Trp His Leu Ala Glu Thr Glu Thr Leu Gly Cys Gln Asp Leu
405 410 415
<210> 9
<211> 335
<212> PRT
<213> Homo sapiens
<400> 9
Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala
1 5 10 15
Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser
20 25 30
Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn
35 40 45
Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro
50 55 60
Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro
65 70 75 80



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
13
Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His
85 90 95
Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly
100 105 110
Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg
115 120 125
Cys Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp
130 135 140
Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr
145 150 155 160
Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp
165 170 175
Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg
180 185 190
Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly
195 200 205
Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu
210 215 220
Ser Asp Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met
225 230 235 240
Thr Leu Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu
245 250 255
Ala Lys Ile Asp Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu
260 265 270
Gln Lys Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys
275 280 285
Glu Ala Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys
290 295 300
Thr Leu Ala Glu Lys Ile Gln Thr Ile Ile Leu Lys Asp Ile Thr Ser
305 310 315 320
Asp Ser Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val
325 330 335
<210> 10
<211> 260
<212> PRT
<213> Homo sapiens
<400> 10
Met Ala Arg Pro His Pro Trp Trp Leu Cys Val Leu Gly Thr Leu Val
1 5 10 15



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
14
Gly Leu Ser Ala Thr Pro Ala Pro Lys Ser Cys Pro Glu Arg His Tyr
20 25 30
Trp Ala Gln Gly Lys Leu Cys Cys Gln Met Cys Glu Pro Gly Thr Phe
35 40 45
Leu Val Lys Asp Cys Asp Gln His Arg Lys Ala Ala Gln Cys Asp Pro
50 55 60
Cys Ile Pro Gly Val Ser Phe Ser Pro Asp His His Thr Arg Pro His
65 70 75 80
Cys Glu Ser Cys Arg His Cys Asn Ser Gly Leu Leu Val Arg Asn Cys
85 90 95
Thr Ile Thr Ala Asn Ala Glu Cys Ala Cys Arg Asn Gly Trp Gln Cys
100 105 110
Arg Asp Lys Glu Cys Thr Glu Cys Asp Pro Leu Pro Asn Pro Ser Leu
115 120 125
Thr Ala Arg Ser Ser Gln Ala Leu Ser Pro His Pro Gln Pro Thr His
130 135 140
Leu Pro Tyr Val Ser Glu Met Leu Glu Ala Arg Thr Ala Gly His Met
145 150 155 160
Gln Thr Leu Ala Asp Phe Arg Gln Leu Pro Ala Arg Thr Leu Ser Thr
165 170 175
His Trp Pro Pro Gln Arg Ser Leu Cys Ser Ser Asp Phe Ile Arg Ile
180 185 190
Leu Val Ile Phe Ser Gly Met Phe Leu Val Phe Thr Leu Ala Gly Ala
195 200 205
Leu Phe Leu His Gln Arg Arg Lys Tyr Arg Ser Asn Lys Gly Glu Ser
210 215 220
Pro Val Glu Pro Ala Glu Pro Cys Arg Tyr Ser Cys Pro Arg Glu Glu
225 230 235 240
Glu Gly Ser Thr Ile Pro Ile Gln Glu Asp Tyr Arg Lys Pro Glu Pro
245 250 255
Ala Cys Ser Pro
260
<210> 11
<211> 595
<212> PRT
<213> Homo sapiens
<400> 11
Met Arg Val Leu Leu Ala Ala Leu Gly Leu Leu Phe Leu Gly Ala Leu
1 5 10 15
Arg Ala Phe Pro Gln Asp Arg Pro Phe Glu Asp Thr Cys His Gly Asn



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
20 25 30
Pro Ser His Tyr Tyr Asp Lys Ala Val Arg Arg Cys Cys Tyr Arg Cys
35 40 45
Pro Met Gly Leu Phe Pro Thr Gln Gln Cys Pro Gln Arg Pro Thr Asp
50 55 60
Cys Arg Lys Gln Cys Glu Pro Asp Tyr Tyr Leu Asp Glu Ala Asp Arg
65 70 75 80
Cys Thr Ala Cys Val Thr Cys Ser Arg Asp Asp Leu Val Glu Lys Thr
85 90 95
Pro Cys Ala Trp Asn Ser Ser Arg Val Cys Glu Cys Arg Pro Gly Met
100 105 110
Phe Cys Ser Thr Ser Ala Val Asn Ser Cys Ala Arg Cys Phe Phe His
115 120 125
Ser Val Cys Pro Ala Gly Met Ile Val Lys Phe Pro Gly Thr Ala Gln
130 135 140
Lys Asn Thr Val Cys Glu Pro Ala Ser Pro Gly Val Ser Pro Ala Cys
145 150 155 160
Ala Ser Pro Glu Asn Cys Lys Glu Pro Ser Ser Gly Thr Ile Pro Gln
165 170 175
Ala Lys Pro Thr Pro Val Ser Pro Ala Thr Ser Ser Ala Ser Thr Met
180 185 190
Pro Val Arg Gly Gly Thr Arg Leu Ala Gln Glu Ala Ala Ser Lys Leu
195 200 205
Thr Arg Ala Pro Asp Ser Pro Ser Ser Val Gly Arg Pro Ser Ser Asp
210 215 220
Pro Gly Leu Ser Pro Thr Gln Pro Cys Pro Glu Gly Ser Gly Asp Cys
225 230 235 240
Arg Lys Gln Cys Glu Pro Asp Tyr Tyr Leu Asp Glu Ala Gly Arg Cys
245 250 255
Thr Ala Cys Val Ser Cys Ser Arg Asp Asp Leu Val Glu Lys Thr Pro
260 265 270
Cys Ala Trp Asn Ser Ser Arg Thr Cys Glu Cys Arg Pro Gly Met Ile
275 280 285
Cys Ala Thr Ser Ala Thr Asn Ser Cys Ala Arg Cys Val Pro Tyr Pro
290 295 300
Ile Cys Ala Ala Glu Thr Val Thr Lys Pro Gln Asp Met Ala Glu Lys
305 310 315 320
Asp Thr Thr Phe Glu Ala Pro Pro Leu Gly Thr Gln Pro Asp Cys Asn
325 330 335



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
16
Pro Thr Pro Glu Asn Gly Glu Ala Pro Ala Ser Thr Ser Pro Thr Gln
340 345 350
Ser Leu Leu Val Asp Ser Gln Ala Ser Lys Thr Leu Pro Ile Pro Thr
355 360 365
Ser Ala Pro Val Ala Leu Ser Ser Thr Gly Lys Pro Val Leu Asp Ala
370 375 380
Gly Pro Val Leu Phe Trp Val Ile Leu Val Leu Val Val Val Val Gly
385 390 395 400
Ser Ser Ala Phe Leu Leu Cys His Arg Arg Ala Cys Arg Lys Arg Ile
405 410 415
Arg Gln Lys Leu His Leu Cys Tyr Pro Val Gln Thr Ser Gln Pro Lys
420 425 430
Leu Glu Leu Val Asp Ser Arg Pro Arg Arg Ser Ser Thr Gln Leu Arg
435 440 445
Ser Gly Ala Ser Val Thr Glu Pro Val Ala Glu Glu Arg Gly Leu Met
450 455 460
Ser Gln Pro Leu Met Glu Thr Cys His Ser Val Gly Ala Ala Tyr Leu
465 470 475 480
Glu Ser Leu Pro Leu Gln Asp Ala Ser Pro Ala Gly Gly Pro Ser Ser
485 490 495
Pro Arg Asp Leu Pro Glu Pro Arg Val Ser Thr Glu His Thr Asn Asn
500 505 510
Lys Ile Glu Lys Ile Tyr Ile Met Lys Ala Asp Thr Val Ile Val Gly
515 520 525
Thr Val Lys Ala Glu Leu Pro Glu Gly Arg Gly Leu Ala Gly Pro Ala
530 535 540
Glu Pro Glu Leu Glu Glu Glu Leu Glu Ala Asp His Thr Pro His Tyr
545 550 555 560
Pro Glu Gln Glu Thr Glu Pro Pro Leu Gly Ser Cys Ser Asp Val Met
565 570 575
Leu Ser Val Glu Glu Glu Gly Lys Glu Asp Pro Leu Pro Thr Ala Ala
580 585 590
Ser Gly Lys
595
<210> 12
<211> 277
<212> PRT
<213> Homo Sapiens
<400> 12
Met Val Arg Leu Pro Leu Gln Cys Val Leu Trp Gly Cys Leu Leu Thr



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
17
1 5 10 15
Ala Val His Pro Glu Pro Pro Thr Ala Cys Arg Glu Lys Gln Tyr Leu
20 25 30
Ile Asn Ser Gln Cys Cys Ser Leu Cys Gln Pro Gly Gln Lys Leu Val
35 40 45
Ser Asp Cys Thr Glu Phe Thr Glu Thr Glu Cys Leu Pro Cys Gly Glu
50 55 60
Ser Glu Phe Leu Asp Thr Trp Asn Arg Glu Thr His Cys His Gln His
65 70 75 80
Lys Tyr Cys Asp Pro Asn Leu Gly Leu Arg Val Gln Gln Lys Gly Thr
85 90 95
Ser Glu Thr Asp Thr Ile Cys Thr Cys Glu Glu Gly Trp His Cys Thr
100 105 110
Ser Glu Ala Cys Glu Ser Cys Val Leu His Arg Ser Cys Ser Pro Gly
115 120 125
Phe Gly Val Lys Gln Ile Ala Thr Gly Val Ser Asp Thr Ile Cys Glu
130 135 140
Pro Cys Pro Val Gly Phe Phe Ser Asn Val Ser Ser Ala Phe Glu Lys
145 150 155 160
Cys His Pro Trp Thr Ser Cys Glu Thr Lys Asp Leu Val Val Gln Gln
165 170 175
Ala Gly Thr Asn Lys Thr Asp Val Val Cys Gly Pro Gln Asp Arg Leu
180 185 190
Arg Ala Leu Val Val Ile Pro Ile Ile Phe Gly Ile Leu Phe Ala Ile
195 200 205
Leu Leu Val Leu Val Phe Ile Lys Lys Val Ala Lys Lys Pro Thr Asn
210 215 220
Lys Ala Pro His Pro Lys Gln Glu Pro Gln Glu Ile Asn Phe Pro Asp
225 230 235 240
Asp Leu Pro Gly Ser Asn Thr Ala Ala Pro Val Gln Glu Thr Leu His
245 250 255
Gly Cys Gln Pro Val Thr Gln Glu Asp Gly Lys Glu Ser Arg Ile Ser
260 265 270
Val Gln Glu Arg Gln
275
<210> 13
<211> 255
<212> PRT
<213> Homo sapiens



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
18
<400> 13
Met Gly Asn Ser Cys Tyr Asn Ile Val Ala Thr Leu Leu Leu Val Leu
1 5 10 15
Asn Phe Glu Arg Thr Arg Ser Leu Gln Asp Pro Cys Ser Asn Cys Pro
20 25 30
Ala Gly Thr Phe Cys Asp Asn Asn Arg Asn Gln Ile Cys Ser Pro Cys
35 40 45
Pro Pro Asn Ser Phe Ser Ser Ala Gly Gly Gln Arg Thr Cys Asp Ile
50 55 60
Cys Arg Gln Cys Lys Gly Val Phe Arg Thr Arg Lys Glu Cys Ser Ser
65 70 75 80
Thr Ser Asn Ala Glu Cys Asp Cys Thr Pro Gly Phe His Cys Leu Gly
85 90 95
Ala Gly Cys Ser Met Cys Glu Gln Asp Cys Lys Gln Gly Gln Glu Leu
100 105 110
Thr Lys Lys Gly Cys Lys Asp Cys Cys Phe Gly Thr Phe Asn Asp Gln
115 120 125
Lys Arg Gly Ile Cys Arg Pro Trp Thr Asn Cys Ser Leu Asp Gly Lys
130 135 140
Ser Val Leu Val Asn Gly Thr Lys Glu Arg Asp Val Val Cys Gly Pro
145 150 155 160
Ser Pro Ala Asp Leu Ser Pro Gly Ala Ser Ser Val Thr Pro Pro Ala
165 170 175
Pro Ala Arg Glu Pro Gly His Ser Pro Gln Ile Ile Ser Phe Phe Leu
180 185 190
Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu Leu Phe Phe Leu Thr Leu
195 200 205
Arg Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe
210 215 220
Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly
225 230 235 240
Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu
245 250 255
<210> 14
<211> 277
<212> PRT
<213> Homo sapiens
<400> 14
Met Cys Val Gly Ala Arg Arg Leu Gly Arg Gly Pro Cys Ala Ala Leu
1 5 10 15



CA 02362929 2001-08-16
WO 00/52028 PCT/iJS00/05686
19
Leu Leu Leu Gly Leu Gly Leu Ser Thr Val Thr Gly Leu His Cys Val
20 25 30
Gly Asp Thr Tyr Pro Ser Asn Asp Arg Cys Cys His Glu Cys Arg Pro
35 40 45
Gly Asn Gly Met Val Ser Arg Cys Ser Arg Ser Gln Asn Thr Val Cys
50 55 60
Arg Pro Cys Gly Pro Gly Phe Tyr Asn Asp Val Val Ser Ser Lys Pro
65 70 75 80
Cys Lys Pro Cys Thr Trp Cys Asn Leu Arg Ser Gly Ser Glu Arg Lys
85 90 95
Gln Leu Cys Thr Ala Thr Gln Asp Thr Val Cys Arg Cys Arg Ala Gly
100 105 110
Thr Gln Pro Leu Asp Ser Tyr Lys Pro Gly Val Asp Cys Ala Pro Cys
115 120 125
Pro Pro Gly His Phe Ser Pro Gly Asp Asn Gln Ala Cys Lys Pro Trp
130 135 140
Thr Asn Cys Thr Leu Ala Gly Lys His Thr Leu Gln Pro Ala Ser Asn
145 150 155 160
Ser Ser Asp Ala Ile Cys Glu Asp Arg Asp Pro Pro Ala Thr Gln Pro
165 170 175
Gln Glu Thr Gln Gly Pro Pro Ala Arg Pro Ile Thr Val Gln Pro Thr
180 185 190
Glu Ala Trp Pro Arg Thr Ser Gln Gly Pro Ser Thr Arg Pro Val Glu
195 200 205
Val Pro Gly Gly Arg Ala Val Ala Ala Ile Leu Gly Leu Gly Leu Val
210 215 220
Leu Gly Leu Leu Gly Pro Leu Ala Ile Leu Leu Ala Leu Tyr Leu Leu
225 230 235 240
Arg Arg Asp Gln Arg Leu Pro Pro Asp Ala His Lys Pro Pro Gly Gly
245 250 255
Gly Ser Phe Arg Thr Pro Ile Gln Glu Glu Gln Ala Asp Ala His Ser
260 265 270
Thr Leu Ala Lys Ile
275
<210> 15
<211> 349
<212> PRT
<213> Homo Sapiens
<400> 15
Met Lys Ser Val Leu Tyr Leu Tyr Ile Leu Phe Leu Ser Cys Ile Ile



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
1 5 10 15
Ile Asn Gly Arg Asp Ala Ala Pro Tyr Thr Pro Pro Asn Gly Lys Cys
20 25 30
Lys Asp Thr Glu Tyr Lys Arg His Asn Leu Cys Cys Leu Ser Cys Pro
35 40 45
Pro Gly Thr Tyr Ala Ser Arg Leu Cys Asp Ser Lys Thr Asn Thr Gln
50 55 60
Cys Thr Pro Cys Gly Ser Gly Thr Phe Thr Ser Arg Asn Asn His Leu
65 70 75 80
Pro Ala Cys Leu Ser Cys Asn Gly Arg Cys Asn Ser Asn Gln Val Glu
85 90 95
Thr Arg Ser Cys Asn Thr Thr His Asn Arg Ile Cys Glu Cys Ser Pro
100 105 110
Gly Tyr Tyr Cys Leu Leu Lys Gly Ser Ser Gly Cys Lys Ala Cys Val
115 120 125
Ser Gln Thr Lys Cys Gly Ile Gly Tyr Gly Val Ser Gly His Thr Ser
130 135 140
Val Gly Asp Val Ile Cys Ser Pro Cys Gly Phe Gly Thr Tyr Ser His
145 150 155 160
Thr Val Ser Ser Ala Asp Lys Cys Glu Pro Val Pro Asn Asn Thr Phe
165 170 175
Asn Tyr Ile Asp Val Glu Ile Thr Leu Tyr Pro Val Asn Asp Thr Ser
180 185 190
Cys Thr Arg Thr Thr Thr Thr Gly Leu Ser Glu Ser Ile Leu Thr Ser
195 200 205
Glu Leu Thr Ile Thr Met Asn His Thr Asp Cys Asn Pro Val Phe Arg
210 215 220
Glu Glu Tyr Phe Ser Val Leu Asn Lys Val Ala Thr Ser Gly Phe Phe
225 230 235 240
Thr Gly Glu Asn Arg Tyr Gln Asn Ile Ser Lys Val Cys Thr Leu Asn
245 250 255
Phe Glu Ile Lys Cys Asn Asn Lys Gly Ser Ser Phe Lys Gln Leu Thr
260 265 270
Lys Ala Lys Asn Asp Asp Gly Met Met Ser His Ser Glu Thr Val Thr
275 280 285
Leu Ala Gly Asp Cys Leu Ser Ser Val Asp Ile Tyr Ile Leu Tyr Ser
290 295 300
Asn Thr Asn Ala Gln Asp Tyr Glu Thr Asp Thr Ile Ser Tyr Arg Val
305 310 315 320



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
21
Gly Asn Val Leu Asp Asp Asp Ser His Met Pro Gly Ser Cys Asn Ile
325 330 335
His Lys Pro Ile Thr Asn Ser Lys Pro Thr Arg Phe Leu
340 345
<210>
16


<211>
355


<212>
PRT


<213> Sapiens
Homo


<400>
16


Met Lys Tyr Leu Leu LeuLeu Ser Cys IleIle
Ser Ile Leu Ile Ile


1 5 10 15


Asn Ser Ile Pro His ProSer Asn Gly CysLys
Asp Thr Glu Lys Asp


20 25 30


Asn Glu Lys His His CysCys Leu Ser ProPro
Tyr Arg Leu Cys Gly


35 40 45


Thr Tyr Ala Ser Arg Leu Cys Asp Ser Lys Thr Asn Thr Asn Thr Gln
50 55 60
Cys Thr Pro Cys Ala Ser Asp Thr Phe Thr Ser Arg Asn Asn His Leu
65 70 75 80
Pro Ala Cys Leu Ser Cys Asn Gly Arg Cys Asp Ser Asn Gln Val Glu
85 90 95
Thr Arg Ser Cys Asn Thr Thr His Asn Arg Ile Cys Asp Cys Ala Pro
100 105 110
Gly Tyr Tyr Cys Phe Leu Lys Gly Ser Ser Gly Cys Lys Ala Cys Val
115 120 125
Ser Gln Thr Lys Cys Gly Ile Gly Tyr Gly Val Ser Gly His Thr Pro
130 135 140
Thr Gly Asp Val Val Cys Ser Pro Cys Gly Leu Gly Thr Tyr Ser His
145 150 155 160
Thr Val Ser Ser Val Asp Lys Cys Glu Pro Val Pro Ser Asn Thr Phe
165 170 175
Asn Tyr Ile Asp Val Glu Ile Asn Leu Tyr Pro Val Asn Asp Thr Ser
180 185 190
Cys Thr Arg Thr Thr Thr Thr Gly Leu Ser Glu Ser Ile Ser Thr Ser
195 200 205
Glu Leu Thr Ile Thr Met Asn His Lys Asp Cys Asp Pro Val Phe Arg
210 215 220
Asn Gly Tyr Phe Ser Val Leu Asn Glu Val Ala Thr Ser Gly Phe Phe
225 230 235 240
Thr Gly Gln Asn Arg Tyr Gln Asn Ile Ser Lys Val Cys Thr Leu Asn



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
22
245 250 255
Phe Glu Ile Lys Cys Asn Asn Lys Asp Ser Tyr Ser Ser Ser Lys Gln
260 265 270
Leu Thr Lys Thr Lys Asn Asp Asp Asp Ser Ile Met Pro His Ser Glu
275 280 285
Ser Val Thr Leu Val Gly Asp Cys Leu Ser Ser Val Asp Ile Tyr Ile
290 295 300
Leu Tyr Ser Asn Thr Asn Thr Gln Asp Tyr Glu Thr Asp Thr Ile Ser
305 310 315 320
Tyr His Val Gly Asn Val Leu Asp Val Asp Ser His Met Pro Gly Arg
325 330 335
Cys Asp Thr His Lys Leu Ile Thr Asn Ser Asn Ser Gln Tyr Pro Thr
340 345 350
His Phe Leu
355
<210> 17
<211> 497
<212> DNA
<213> Homo sapiens
<220>
<221> misc_feature
<222> (20)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (41)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (159)..(160)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (163)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (180)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (204)
<223> n equals a, t, g, or c



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
23
<220>
<221> misc_feature
<222> (206)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (211)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (229)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (246)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (275)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (320)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (328)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (351)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (370)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (376)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (389)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (392)
<223> n equals a, t, g, or c



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
24
<220>
<221> misc_feature
<222> (400)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (405)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (419)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (435)..(436)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (444)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (458)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (464)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (472)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (480)..(482)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (484)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (494)
<223> n equals a, t, g, or c
<400> 17
ggcacgagca gggtcctgtn tccgccctga gccgcgctct ncctgctcca gcaaggacca 60
tgagggcgct ggaggggcca ggcctgtcgc tgctgtcctg gtgttggcgc tgcctgccct 120



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
gctgccggtg ccggctgtac gcggagtggc agaaacacnn acntacccct ggcgggacgn 180
agagacaggg gagcggctgg tgtntnccca ntgcccccag gcacctttnt gcagcggccg 240
tgccgncgag acagccccac gacgtgtggc ccgtntccac cgcgccacta cacgcattct 300
ggaactacct ggagcgctgn ccttactnca acgtcctctg cggggagcgt naggaggagg 360
cacgggtttn ccacgncaac cacaaccgng gnttaccgtn gccgnaccgg tttcttcgng 420
gcaagttggt ttttnntttg gagnaaggat tcgtgttnca attnattgac gnagtgattn 480
nncncgggaa actnaaa 497
<210> 18
<211> 191
<212> DNA
<213> Homo Sapiens
<220>
<221> misc_feature
<222> (42)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (106)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (125)
<223> n equals a, t, g, or c
<220>
<221> misc_feature
<222> (188)
<223> n equals a, t, g, or c
<400> 18
cgcaactgca cggccctggg actggccctc aatgtgccag gntcttcctc ccatgacacc 60
ctgtgcacca gctgcactgg cttccccctc agcaccaggg taccangagc tgaggagtgt 120
gagcntgccg tcatcgactt tttggctttc caggacatct ccatcaagag gctgcagcgg 180
ctgctcangc c 191
<210> 19
<211> 26
<212> DNA
<213> Homo sapiens
<400> 19
cgcccatggc agaaacaccc acctac 26
<210> 20
<211> 26
<212> DNA
<213> Homo Sapiens
<400> 20
cgcaagcttc tctttcagtg caagtg 26



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
26
<210> 21
<211> 28
<212> DNA
<213> Homo Sapiens
<400> 21
cgcaagcttc tcctcagctc ctgcagtg 2g
<210> 22
<211> 36
<212> DNA
<213> Homo Sapiens
<400> 22
cgcggatccg ccatcatgag ggcgtggagg ggccag 36
<210> 23
<211> 26
<212> DNA
<213> Homo Sapiens
<400> 23
cgcggtaccc tctttcagtg caagtg 26
<210> 24
<211> 28
<212> DNA
<213> Homo Sapiens
<400> 24
cgcggtaccc tcctcagctc ctgcagtg 2g
<210> 25
<211> 33
<212> DNA
<213> Homo Sapiens
<400> 25
agacccaagc ttcctgctcc agcaaggacc atg 33
<210> 26
<211> 50
<212> DNA
<213> Homo Sapiens
<400> 26
agacgggatc cttagtggtg gtggtggtgg tgcacaggga ggaagcgctc 50
<210> 27
<211> 733
<212> DNA
<213> Homo sapiens



CA 02362929 2001-08-16
WO 00/52028 PCT/US00/05686
27
<400> 27
gggatccgga gcccaaatct tctgacaaaa ctcacacatg cccaccgtgc ccagcacctg 60
aattcgaggg tgcaccgtca gtcttcctct tccccccaaa acccaaggac accctcatga 120
tctcccggac tcctgaggtc acatgcgtgg tggtggacgt aagccacgaa gaccctgagg 180
tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca aagccgcggg 240
aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg caccaggact 300
ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca acccccatcg 360
agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac accctgcccc 420
catcccggga tgagctgacc aagaaccagg tcagcctgac ctgcctggtc aaaggcttct 480
atccaagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac aactacaaga 540
ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag ctcaccgtgg 600
acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat gaggctctgc 660
acaaccacta cacgcagaag agcctctccc tgtctccggg taaatgagtg cgacggccgc 720
gactctagag gat
733

Representative Drawing

Sorry, the representative drawing for patent document number 2362929 was not found.

Administrative Status

For a clearer understanding of the status of the application/patent presented on this page, the site Disclaimer , as well as the definitions for Patent , Administrative Status , Maintenance Fee  and Payment History  should be consulted.

Administrative Status

Title Date
Forecasted Issue Date Unavailable
(86) PCT Filing Date 2000-03-03
(87) PCT Publication Date 2000-09-08
(85) National Entry 2001-08-16
Examination Requested 2005-02-04
Dead Application 2007-03-05

Abandonment History

Abandonment Date Reason Reinstatement Date
2006-03-03 FAILURE TO PAY APPLICATION MAINTENANCE FEE

Payment History

Fee Type Anniversary Year Due Date Amount Paid Paid Date
Application Fee $300.00 2001-08-16
Maintenance Fee - Application - New Act 2 2002-03-04 $100.00 2002-02-22
Registration of a document - section 124 $100.00 2002-06-04
Registration of a document - section 124 $100.00 2002-06-04
Registration of a document - section 124 $100.00 2002-06-04
Maintenance Fee - Application - New Act 3 2003-03-03 $100.00 2003-02-26
Maintenance Fee - Application - New Act 4 2004-03-03 $100.00 2004-02-25
Request for Examination $800.00 2005-02-04
Maintenance Fee - Application - New Act 5 2005-03-03 $200.00 2005-03-01
Owners on Record

Note: Records showing the ownership history in alphabetical order.

Current Owners on Record
HUMAN GENOME SCIENCES, INC.
Past Owners on Record
EBNER, REINHARD
FENG, PING
GENTZ, REINER L.
NI, JIAN
RUBEN, STEVEN M.
YU, GUO-LIANG
Past Owners that do not appear in the "Owners on Record" listing will appear in other documentation within the application.
Documents

To view selected files, please enter reCAPTCHA code :



To view images, click a link in the Document Description column. To download the documents, select one or more checkboxes in the first column and then click the "Download Selected in PDF format (Zip Archive)" or the "Download Selected as Single PDF" button.

List of published and non-published patent-specific documents on the CPD .

If you have any difficulty accessing content, you can call the Client Service Centre at 1-866-997-1936 or send them an e-mail at CIPO Client Service Centre.


Document
Description 
Date
(yyyy-mm-dd) 
Number of pages   Size of Image (KB) 
Description 2001-08-16 310 13,685
Abstract 2001-08-16 1 60
Claims 2001-08-16 5 191
Drawings 2001-08-16 13 373
Cover Page 2002-01-04 1 36
PCT 2001-08-16 4 175
Assignment 2001-08-16 3 100
Correspondence 2001-12-27 1 24
Correspondence 2002-01-18 1 27
Correspondence 2002-02-19 1 37
Assignment 2002-06-04 10 339
PCT 2001-08-17 4 181
Assignment 2009-08-10 20 998
Prosecution-Amendment 2005-02-04 1 33

Biological Sequence Listings

Choose a BSL submission then click the "Download BSL" button to download the file.

If you have any difficulty accessing content, you can call the Client Service Centre at 1-866-997-1936 or send them an e-mail at CIPO Client Service Centre.

Please note that files with extensions .pep and .seq that were created by CIPO as working files might be incomplete and are not to be considered official communication.

No BSL files available.