Note: Descriptions are shown in the official language in which they were submitted.
WO 00/50454 PCT/US00/04732
ANDROGEN-INDUCED SUPPRESSOR OF CELL PROLIFERATION
AND USES THEREOF
Government Sponsored Research
This work was supported in part by PHS NIH grant CA-55574.
Background of the Invention
Among men, carcinoma of the prostate is the second most common cancer and the
second most common cause of death from cancer in the United States. Each year
over
130,000 men are diagnosed with prostate cancer and over 30,000 will die from
the disease
(( 1992) MMWR 41:459). Typically, 61 % of all deaths from prostate cancer
occur within
five years of diagnosis and 88% within ten years (Smart (1997) Cancer 80:1835-
1844).
Moreover, despite the availability of risk assessment tools, the optimal
therapy for treating
prostate cancer remains controversial (Small ( 1998) Drugs Aging 13:71-81 ).
For example,
although certain markers of prostate cancer progression such as prostate-
specific antigen
(PSA) have proven valuable in the diagnosis and management of prostate cancer,
as
currently used, PSA is insufficiently sensitive and specific for early
detection or staging of
the malignancy (Daher et al. (1998) Clin. Chem. Lab. Med. 36:671-681).
In addition, in some patients with metastatic disease of the prostate, hormone
therapy
(e.g., antiandrogen, estrogen, etc.) is frequently used. However, many
patients on hormone
therapy develop hormone resistance and the management of hormone refractory
disease is a
major clinical problem (Ismail et al. (1997) Tech. Urol. 3:16-24). The death
of patients
from prostate cancer is related to the development of clones of cells capable
of multiplying
and metastasizing without androgen stimulation. To date, efforts to suppress
these cells
have been of limited success (Mewling (1996) Eur. Urol. Suppl. 2:69-74). This
is in part
due to the fact that the initial events in the development of prostate cancer
are not well
understood.
Normally, cell numbers in the prostate gland are regulated by androgens
through
separate pathways that include a) inhibition of cell death (apoptosis), b)
induction of cell
proliferation (Step-1), and c) inhibition of cell proliferation (Step-2,
proliferation shutoff).
In normal tissue, the apoptotic and proliferative activities are minimal and
apparently, Step-
CA 02363605 2001-08-23
w0 00/50454 PCT/US00/04732 -
-2-
2 (inhibition of cell proliferation) maintains the integrity of the tissue.
Prostate cancer cells
evolve when this circuitry fails in the initial or early phases in prostate
cancer.
Summary of the Invention
A hope for managing prostate cancer lies in the earlier detection of the
disease using
improved diagnostic indicators, and developing markers that will allow for the
more
efficient and strategic use of hormone therapy, preferably in concert with
improvements in
the quality of life for patients with prostate cancer.
To this end, a novel androgen-induced tumor suppressor gene termed "Androgen
Shutoff Gene 3" (AS3) has 'been discovered. This gene has a role in inhibiting
cell
proliferation and use as a marker for the efficient diagnosis and treatment of
prostate cancer.
The present invention is based, at least in part, on the discovery of a novel
androgen-
induced tumor suppressor, referred to herein as "Androgen Shutoff Gene 3" or
"AS3"
nucleic acid and protein molecules. The AS3 molecules of the present invention
are useful
as targets for developing modulating agents of cell proliferation,
particularly cells of the
prostate. Accordingly, in one aspect, this invention provides isolated nucleic
acid molecules
encoding AS3 proteins or biologically active portions thereof, as well as
nucleic acid
fragments suitable as primers or hybridization probes for the detection of AS3-
encoding
nucleic acids.
In one embodiment, an AS3 nucleic acid molecule of the invention is at least
50%,
55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or more identical to the
nucleotide
sequence (e.g., to the entire length of the nucleotide sequence) shown in SEQ
ID NO:1 or 3.
In a preferred embodiment, the isolated nucleic acid molecule includes the
nucleotide sequence shown SEQ ID NO:1 or 3, or a complement thereof. In
another
embodiment, the nucleic acid molecule includes SEQ ID N0:3 and nucleotides 66-
4238 of
SEQ ID NO: l .
In another embodiment, an AS3 nucleic acid molecule includes a nucleotide
sequence encoding a protein having an amino acid sequence sufficiently
homologous to the
amino acid sequence of SEQ ID N0:2. In a preferred embodiment, an AS3 nucleic
acid
molecule includes a nucleotide sequence encoding a protein having an amino
acid sequence
at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-3-
homologous to the entire length of the amino acid sequence ofSEQ ID N0:2. In a
related
embodiment, the nucleic acid encodes a polypeptide fragment having at least
1391 amino
acid residues of the amino acid sequence shown in SEQ ID NO: 2.
In another preferred embodiment, an isolated nucleic acid molecule encodes the
amino acid sequence of human AS3. In yet another preferred embodiment, the
nucleic acid
molecule includes a nucleotide sequence encoding a protein having the 1391
amino acid
sequence of SEQ ID N0:2.
Another embodiment of the invention features nucleic acid molecules,
preferably
AS3 nucleic acid molecules, which specifically detect AS3 nucleic acid
molecules relative
to nucleic acid molecules encoding non-AS3 proteins. For example, in one
embodiment,
such a nucleic acid molecule is at least 100-250, 250-300, 300-350, 350-400,
400-450, 450-
500, 500-550, or 550-600 or more nucleotides in length and hybridizes under
stringent
conditions to a nucleic acid molecule comprising the nucleotide sequence shown
in SEQ ID
NO:1, or a complement thereof. In a related embodiment, the nucleic acid
molecule can
further contain a nucleotide sequence encoding a heterologous polypeptide.
In a related embodiment, the nucleic acid molecules are at least 15 (e.g.,
contiguous)
nucleotides in length and hybridize under stringent conditions to nucleotides
1-5253 of SEQ
ID NO:1.
In other preferred embodiments, the nucleic acid molecule encodes a naturally
occurring allelic variant of a polypeptide comprising the amino acid sequence
of SEQ ID
N0:2, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule
comprising
SEQ ID NO:1 or 3 under stringent conditions.
Another embodiment of the invention provides an isolated nucleic acid molecule
which is antisense to an AS3 nucleic acid molecule, e.g., the coding strand of
an AS3
nucleic acid molecule.
Another aspect of the invention provides a vector comprising an AS3 nucleic
acid
molecule. In certain embodiments, the vector is a recombinant expression
vector. In
another embodiment, the invention provides a host cell containing a vector of
the invention.
In yet another embodiment, the invention provides a host cell containing a
nucleic acid
molecule of the invention. The invention also provides a method for producing
a protein,
preferably an AS3 protein, by culturing in a suitable medium, a host cell,
e.g., a mammalian
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-4-
host cell such as a non-human mammalian cell, of the invention containing a
recombinant
expression vector, such that the protein is produced.
Another aspect of this invention features isolated or recombinant AS3 proteins
and
polypeptides. In one embodiment, the isolated protein, preferably an AS3
protein has an
amino acid sequence at least about 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%,
85%, 90%,
95%, 98% or more homologous to the amino acid sequence of SEQ ID N0:2.
In another embodiment, the invention features fragments of the AS3 protein
having
the amino acid sequence of SEQ ID N0:2, wherein the fragment comprises at
least 15
amino acids (e.g., contiguous amino acids) of the amino acid sequence of SEQ
ID N0:2. In
another embodiment, the protein, preferably an AS3 protein, has the amino acid
sequence of
SEQ ID N0:2, respectively.
In another embodiment, the invention features an isolated protein, preferably
an AS3
protein, which is encoded by a nucleic acid molecule consisting of a
nucleotide sequence at
least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more
homologous to a nucleotide sequence of SEQ ID NO:1 or 3, or a complement
thereof. This
invention further features an isolated protein, preferably an AS3 protein,
which is encoded
by a nucleic acid molecule consisting of a nucleotide sequence which
hybridizes under
stringent hybridization conditions to a nucleic acid molecule comprising the
nucleotide
sequence of SEQ ID NO:1 or 3, or a complement thereof.
The proteins of the present invention or portions thereof, e.g., biologically
active
portions thereof, can be operatively linked to a non-AS3 polypeptide (e.g.,
heterologous
amino acid sequences) to form fusion proteins. The invention further features
antibodies,
such as monoclonal or polyclonal antibodies, that specifically bind proteins
of the invention,
preferably AS3 proteins.
In another aspect, the present invention provides a method for detecting the
presence
of an AS3 polypeptide in a biological sample by contacting the biological
sample with a
compound capable of detecting an AS3 polypeptide. In one embodiment of this
invention,
the compound is an antibody. In another embodiment of this invention, a kit is
featured that
contains a compound that selectively binds to the polypeptide and instructions
for use.
In another aspect, the present invention features a method for detecting the
presence
of an AS3 nucleic acid in a biological sample by contacting the biological
sample with a
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-5-
nucleic acid probe or primer that selectively hybridizes to an AS3 molecule of
the invention
and indicating the presence of such a molecule. In other embodiments of this
invention, the
nucleic acid in the biological sample is RNA. In another embodiment of the
invention, a kit
is provided comprising at least one reagent that binds a nucleic acid and
instructions for use.
In another aspect, the invention provides for a method for identifying a
compound
that binds to an AS3 polypeptide or fragment by detecting direct binding of
the compound,
binding using a competition assay, or binding using an AS3 activity.
In yet another aspect, the invention provides a method for identifying a
compound
that modulates the activity of an AS3 polypeptide or fragment by contacting
such a
polypeptide or cell expressing such a polypeptide and determining the effect
of the test
compound on the activity of the polypeptide.
In another aspect, the invention provides a method for modulating AS3 activity
comprising contacting a cell capable of expressing AS3 with a compound that
modulates
AS3 activity such that AS3 activity in the cell is modulated. In one
embodiment, the agent
inhibits AS3 activity. In another embodiment, the agent stimulates AS3
activity. In one
embodiment, the compound modulates expression of AS3 by modulating
transcription of an
AS3 gene or translation of an AS3 mRNA.
In another aspect, the invention features a transgenic animal generated from a
cell
genetically engineered to lack nucleic acid encoding an AS3 polypeptide, where
the
transgenic animal lacks expression of the AS3 polypeptide.
In a related aspect, the invention features a transgenic animal generated from
a cell
that contains a substantially pure nucleic acid encoding a AS3 polypeptide,
where the
nucleic acid is expressed in the transgenic animal.
In another aspect, the invention features a method of identifying a compound
that
modulates cell proliferation. The method includes: (a) providing a cell that
has an AS3
gene; (b) contacting the cell with a candidate compound; and (c) monitoring
expression of
the AS3 gene, where an alteration in the level of expression of the AS3 gene
indicates the
presence of a compound which modulates cell proliferation. In one preferred
embodiment
of this aspect, the alteration that is an increase indicates the compound is
inhibiting cell
proliferation, and the alteration that is a decrease indicates the compound is
increasing cell
proliferation
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-6-
In a related aspect, the invention features another method of identifying a
compound
that is able to modulate cell proliferation that includes: (a) providing a
cell including a
reporter gene operably linked to a promoter from an AS3 gene; (b) contacting
the cell with a
candidate compound; and (c) measuring expression of the reporter gene, where a
change in
the expression in response to the candidate compound identifies a compound
that is able to
modulate cell proliferation. In one preferred embodiment of this aspect, the
alteration that is
an increase indicates the compound is inhibiting cell proliferation.
In another aspect, the invention features a method of inhibiting the
proliferation of a
cell by administering an amount of AS3 polypeptide or fragment thereof
sufficient to inhibit
cell proliferation.
In related aspects, the invention includes methods of decreasing cell
proliferation by
either providing a transgene encoding a AS3 polypeptide or fragment thereof to
a cell of an
animal such that the transgene is positioned for expression in the cell; or by
administering to
the cell a compound which increases AS3 biological activity in a cell. In
preferred
embodiments, AS3 is from a mammal, the cell being treated is in a mammal, and
the
mammal has been diagnosed with a condition involving cell proliferation such
as cancer
(e.g., prostate cancer).
In two other aspects, the invention features methods of diagnosing a mammal
for the
presence of disease involving altered cell proliferation or an increased
likelihood of
developing a disease involving altered cell proliferation. The methods include
isolating a
sample of nucleic acid from the mammal and determining whether the nucleic
acid includes
a AS3 mutation, where the presence of a mutation is an indication that the
animal has a cell
proliferation disease or an increased likelihood of developing a disease
involving cell
proliferation; or measuring AS3 gene expression in a sample from an animal to
be
diagnosed, where an alteration in the expression or activity relative to a
sample from an
unaffected mammal is an indication that the mammal has a disease involving
cell
proliferation or increased likelihood of developing such a disease. In
preferred
embodiments, AS3 gene expression is measured by assaying the amount of AS3
polypeptide
or AS3 biological activity in the sample (e.g., the AS3 polypeptide is
measured by
immunological methods), or AS3 gene expression is measured by assaying the
amount of
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
AS3 RNA in the sample. In other preferred embodiments, the mammal is a human
and the
method may be performed after or during hormone therapy (e.g., androgen
therapy).
In another aspect, the invention features a kit for diagnosing a mammal for
the
presence of a disease involving altered cell proliferation or an increased
likelihood of
developing a disease involving altered cell proliferation that includes a
substantially pure
antibody that specifically binds a AS3 polypeptide. Another such kit includes
material for
measuring AS3 RNA (e.g., a probe). In a preferred embodiment, the material is
a nucleic
acid probe.
In a yet another aspect, the invention features a method of obtaining a AS3
polypeptide, including: (a) providing a cell with DNA encoding a AS3
polypeptide, the
DNA being positioned for expression in the cell; (b) culturing the cell under
conditions for
expressing the DNA; and (c) isolating the AS3 polypeptide.
In a related aspect, the invention features a method of isolating an AS3 gene
or
portion thereof having sequence identity to human AS3. The method includes
amplifying
by polymerase chain reaction the AS3 gene or portion thereof using
oligonucleotide primers
wherein the primers (a) are each greater than 15 nucleotides in length; (b)
each have regions
of complementarity to opposite DNA strands in a region of the nucleotide
sequence
provided in SEQ ID NO: l; and (c) optionally contain sequences capable of
producing
restriction endonuclease cut sites in the amplified product; and isolating the
AS3 gene or
portion thereof.
In another aspect of the invention, the invention features a method for
detecting if a
subject is at increased risk for developing prostate cancer including the
steps of (a) detecting
the presence of an AS3 nucleic acid or polypeptide and (b) observing whether
or not a
subject has reduced or absent AS3 levels as compared to a standard, e.g.,
normal age
matched control, wherein said reduced or absent AS3 levels indicate that the
subject is at an
increased risk for developing prostate cancer. In a related embodiment, the
invention
features a kit that contains at least one reagent for detecting the presence
of an AS3
molecule.
In another aspect, the invention provides a method of prognosis for prostate
cancer
by obtaining a biological sample from the subject, measuring AS3 levels,
correlating those
levels with a control, and determining a prognosis based on whether the
subject's AS3 levels
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
_g_
are above average or below average. In related embodiments, the method may be
performed
during or after hormone therapy (e.g., androgen therapy) and employs an
antibody or nucleic
acid probe to an AS3 molecule. .
In even another aspect, the invention features a method for the treatment of
prostate
cancer comprising identifying a subject with prostate cancer or about to have
prostate
cancer, administering a hormone therapy, and determining if the subject
exhibits a change in
AS3 levels. In preferred embodiments, the invention provides a method for
identifying
subjects that exhibit increased AS3 levels after receiving hormone as
responsive to hormone
therapy and further, as candidates for intermittent hormone therapy. In other
preferred
embodiments, the hormone therapy is an androgen therapy, the subject is a
human, and the
method for measuring includes measuring AS3 nucleic acid or polypeptide levels
is
performed with an antibody or nucleic acid probe or primer.
Other features and advantages of the invention will be apparent from the
following
detailed description and claims.
Brief Description of the Drawings
Figure 1 depicts the cDNA sequence and predicted amino acid sequence of human
AS3. The nucleotide sequence corresponds to 1 to 5253 of SEQ ID NO: 1. The
amino acid
sequence corresponds to amino acids 1 to 1391 of SEQ ID NO: 2. The coding
region
without the 5' and 3' untranslated regions of the human AS3 gene is shown in
SEQ ID NO:
3. Numbers on the left indicate positions in base pairs. The amino acid
sequence of the
open reading frame is depicted under the coding strand. Numbers on the right
indicate amino
acid positions. Destabilizing signals found in the untranslated regions of AS3
are underlined
and the polyadenylation signal and cleavage site are at base pair positions
5228-5233 and
5249-5253, respectively.
Figure 2 depicts the N-terminal leucine repeat structure of the AS3
polypeptide.
Numbers above the AS3 sequence indicate the positions of the blocks where
uninterrupted
leucine (or isoleucine, valine) heptades occur.
Figure 3 depicts sequence comparisons of the putative Mg-nucleotide
triphosphate
binding subdomains of AS3 with corresponding subdomains of various protein
kinases. The
boxes represent the Hanks' conserved subdomains, as indicated above each box.
The top
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-9-
lines within the boxes show the consensus (3-strand, loop, and a,-helical
secondary structure
elements. The numbers in the second lines indicate the positions of the
corresponding
conformations in the AS3 sequence. The actual AS3 motifs are shown in the
third line.
Hanks' conserved subdomains from protein kinases of close similarity are
represented in the
lines below the AS3 sequence. The names of the kinases are indicated in
parentheses.
Identical residues are highlighted. In the Mg-ATP binding loop, the "x" and
lower case
letters indicate non-conserved amino acids.
Figure 4 depicts the genomic, cosmid, and exon maps of the AS3 cDNA. The
chromosomal panel represents a 1 megabase (Mb) genomic region around BRCA2.
Boxes
with CG numbers are genomic areas where expression of transcripts were
detected. The
centromer is at the left. The P 1 artificial chromosome (PAC) PAC26H23
(Accession No.:
284467) overlaps with cosmid 267p19 (Accession No .: 275889), which, in turn,
overlaps
with PAC49J10 (Accession No.: 284572). Numbers below the PAC and cosmid lines
indicate positions within the genomic clone. The scale above the exon map
indicates the
genomic distance in thousands of base pairs. In the exon panel, black boxes
represent the
exons, while the numbers above them indicate exon numbers. In the mRNA panel,
the
numbers indicate nucleotide positions.
Figure S depicts the genomic and cDNA positions of exons in the AS3
transcript.
Asterisks represent the exon-intron boundaries. The area between asterisks
represents the
exons. Exon sequences are in upper case, the numbers represent cDNA positions.
Lower
case letters are intron sequences. Numbers of the first exon indicate
positions in
PAC26H23. Numbers in parenthesis refer to positions on cosmid 267p19, while
numbers in
brackets refer to PAC49J10 positions.
Figure 6. depicts the cDNA sequence and predicted amino acid sequence of human
AS3 having an additional 84 base pairs of untranslated 5' sequence as compared
to the
sequence presented in Fig. 1. The nucleotide sequence corresponds to 1 to 5337
of SEQ ID
NO: 4. The amino acid sequence shown corresponds to amino acids 1 to 1391 of
SEQ ID
NO: 2. The coding region without the 5' and 3' untranslated regions of the
human AS3
gene is shown in SEQ ID NO: 3. Numbers on the left indicate positions in base
pairs. The
amino acid sequence of the open reading frame is depicted under the coding
strand.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-10-
Numbers on the right indicate amino acid positions. Destabilizing signals
found in the
untranslated regions of AS3 are underlined and the polyadenylation signal and
cleavage
signal are at base pair positions 5312-5317 and 5333-5337, respectively.
Detailed Description of the Invention
The present invention is based, at least in part, on the discovery of a novel
molecule
referred to herein as "Androgen Shutoff Gene 3" or "AS3" nucleic acid and
protein
molecules, which play a role in hormone-induced inhibition of cell
proliferation. In one
embodiment, the AS3 molecules are capable of modulating cell proliferation,
e.g., cancer.
In a preferred embodiment, the AS3 molecules are expressed in cells of the
prostate and/or
function in the cells of the prostate. In another preferred embodiment, the
AS3 molecules
are expressed in prostate cells when exposed to a hormone, e.g., an androgen,
and inhibit
cell proliferation.
The AS3 gene was cloned from a subtracted library made from a human prostate
carcinoma cell line induced to undergo growth arrest using androgen.
Androgens regulate prostate cell numbers and cell proliferation by three major
mechanisms: a) inhibition of cell death (apoptosis), b) induction of cell
proliferation (Step-
1), and c) inhibition of cell proliferation (proliferative shutoff, Step-2)
(Isaacs (1985)
Prostate 5:545-557; Bruchovsky et al. (1975) Vit. & Horm. 33:61-102;
Sonnenschein et al.,
(1989) Cancer Res. 49:3474-3481). Androgens affect epithelial and stromal cell
types
which, in turn, interact in the prostate (Hayward et al., (1997) Brit. J.
Urol. Suppl. 2: 18-26).
The human prostate LNCaP-FGC cell line that exhibits hormone responsiveness
and is used
extensively for endocrine and molecular studies (Sonnenschein et al., (1989)
Cancer Res.
49:3474-3481; Horoszewicz et al., (1983) Cancer Res. 43:1809-1818; Soto et
al., (1995)
Oncology Res. 7: 545-558) was employed herein. Proliferation is inhibited in
these cells by
sex steroid-stripped (charcoal-dextran treated) human serum (CDHuS)
(Sonnenschein et al.,
(1989) Cancer Res. 49:3474-3481). Low androgen concentrations cancel this
inhibition
(Step-1) and at higher levels, androgens induce an irreversible proliferative
shutoff (Step-2)
(Sonnenschein et al., (1989) Cancer Res. 49:3474-3481; Soto et al., (1995)
Oncology Res.
7: 545-558). During the shutoff period, these cells remain in the Go/Gl phase
of the cell
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-11-
cycle. Prostate specific antigen (PSA) induction, however, is still dependent
on androgens
in these postmitotic cells (Soto et al., (1995) Oncology Res. 7: 545-558).
To dissect androgen-mediated cell-cycle events, several androgen target cell
lines
that express only one of the steps of the androgen regulated proliferative
response were
generated. Two LNCaP variants were isolated: the LNCaP-TAC variant which
expresses
Step-1 only, and the LNCaP-TJA variant, which is resistant to the inhibitory
effect of both
CD serum and androgens (Soto et al., (1995) Oncology Res. 7: 545-558). LNCaP-
LNO
cells, established by Horoszewicz et al., proliferate maximally in the
presence of CDHuS,
express an androgen-induced proliferative shutoff, and undergo Go/GI arrest
(Step-2) at high
androgen concentrations (Horoszewicz et al., (1983) Cancer Res. 43:1809-1818;
Soto et al.,
(1995) Oncology Res. 7: 545-558). In addition to these human prostate cells, a
new model
to demonstrate the shutoff effect in another cell type was developed by stable
transfection of
a wild type androgen-receptor construct into breast carcinoma MCF-7 cells.
These MCF7-
AR1 cells are also able to evoke a proliferative shutoff in response to
androgens (Szelei et
al., (1997) Endocrinology 138: 1406-1412).
Using a differential subtractive amplification procedure, a set of genes
induced in the
proliferative shutoff response (Step-2) (Wang et al., (1991) Proc. Natl. Acad.
Sci. USA 88:
11505-11509) was identified. In particular, a gene involved in this
regulation, AS3
(androgen shutoff gene 3), that shows high expression in the early regulatory
phase of
androgen-induced proliferative shutoff in cell culture and in the prostates of
castrated rats
was identified.
The AS3 gene encodes a polypeptide of 1391-residues and has a molecular weight
of
about 186 kD. It has coiled-coil structures that usually participate in
protein-protein
interactions, a perfect leucine-zipper that suggests DNA binding, nuclear
localization motifs,
proline- and serine-rich domains, unique C-terminal acidic-basic repeats, and
ATP- and
DNA-binding motifs.
The transcript has 34 exons in a 200,000 by region on chromosome 13q12-q13,
downstream of the breast cancer susceptibility gene BRCA2, and centromeric to
the
retinoblastoma (Rbl) locus. This area is subject to frequent allelic losses in
cancers, and is
believed to carry a number of cryptic suppressor genes.
WO 00/50454 PCT/US00/04732
-12-
The AS3 gene is involved in the regulation of androgen-induced proliferative
arrest
in human prostate cells. Accordingly, the AS3 molecules described below serve
as useful
diagnostic markers or therapeutic agents to control conditions of aberrant
cell proliferation,
such as cancer (e.g., cancer of the prostate).
In one embodiment, the present invention is directed at human AS3, however,
AS3
family members are also intended to be within the scope of the invention. The
term
"family" when referring to the protein and nucleic acid molecules of the
invention is
intended to mean two or more proteins or nucleic acid molecules having a
common
structural domain or motif and having sufficient amino acid or nucleotide
sequence
homology as defined herein. Such family members can be naturally or non-
naturally
occurring and can be from either the same or different species. For example, a
family can
contain a first protein of human origin, as well as other, distinct proteins
of human origin or
alternatively, can contain homologues of non-human origin. Members of a family
may also
have common functional characteristics.
To identify the presence of important domains in a given polypeptide, and make
the
determination that a protein of interest has a particular profile, the amino
acid sequence of
the protein can be searched against several databases as described in Example
3. Using
these tools, a number of important domains within the AS3 polypeptide have
been identified
and these results are set forth in Figures 2 and 3 and further described in
Example 3.
Isolated proteins of the present invention, preferably AS3 proteins, have an
amino acid
sequence sufficiently homologous to the amino acid sequence of SEQ ID N0:2 or
are encoded
by a nucleotide sequence sufficiently homologous to SEQ ID NO: l or 3. As used
herein, the
term "sufficiently homologous" refers to a first amino acid or nucleotide
sequence which
contains a sufficient or minimum number of identical or equivalent (e.g., an
amino acid residue
which has a similar side chain) amino acid residues or nucleotides to a second
amino acid or
nucleotide sequence such that the first and second amino acid or nucleotide
sequences share
common structural domains or motifs and/or a common functional activity. For
example,
amino acid or nucleotide sequences which share common structural domains have
at least 30%,
40%, or 50% homology, preferably 60% homology, more preferably 70%-80%, and
even more
preferably 90-95% homology across the amino acid sequences of the domains and
contain at
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-13-
least one and preferably two structural domains or motifs, are defined herein
as sufficiently
homologous. Furthermore, amino acid or nucleotide sequences which share at
least 30%, 40%,
or 50%, preferably 60%, more preferably 70-80%, or 90-95% homology and share a
common
functional activity are defined herein as sufficiently homologous.
As used interchangeably herein, an "AS3 activity", "biological activity of
AS3" or
"functional activity of AS3", refers to an activity exerted by an AS3 protein,
polypeptide or
nucleic acid molecule on an AS3 responsive cell or on an AS3 protein
substrate, as
determined in vivo, or in vitro, according to standard techniques. In one
embodiment, an
AS3 activity is a direct activity, such as an association with an AS3-target
molecule. As
used herein, a "target molecule" or "binding partner" is a molecule with which
an AS3
protein binds or interacts in nature, such that AS3-mediated function is
achieved. An AS3
target molecule can be a non-AS3 molecule or an AS3 protein or polypeptide of
the present
invention. Alternatively, an AS3 activity is an indirect activity, such as
modulating cell
cycle events. Preferably, an AS3 activity is the ability to modulate androgen-
mediated cell
proliferation.
Accordingly, another embodiment of the invention features isolated AS3
proteins
and polypeptides having an AS3 activity. Preferred proteins are AS3 proteins
encoded by a
nucleic acid molecule having a nucleotide sequence which hybridizes under
stringent
hybridization conditions to a nucleic acid molecule comprising the nucleotide
sequence of
SEQ ID NO:1 or 3.
The nucleotide sequence of the isolated human AS3 cDNA and the predicted amino
acid sequence of the human AS3 polypeptide are shown in Figure 1 and in SEQ ID
NOs: l
and 2, respectively. A plasmid containing the nucleotide sequence encoding
human AS3
was deposited with the American Type Culture Collection (ATCC), 10801
University
Boulevard, Manassas, VA 20110-2209, on and assigned Accession Number
This deposit will be maintained under the terms of the Budapest Treaty on the
International
Recognition of the Deposit of Microorganisms for the Purposes of Patent
Procedure. This
deposit was made merely as a convenience for those of skill in the art and is
not an
admission that a deposit is required under 35 U.S.C. ~112.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
- 14-
The human AS3 gene, which is approximately 5253 nucleotides in length, encodes
a
protein having a molecular weight of approximately 186 kD and which is
approximately
1391 amino acid residues in length.
Various aspects of the invention are described in further detail in the
following
subsections:
I. Isolated Nucleic Acid Molecules
One aspect of the invention pertains to isolated nucleic acid molecules that
encode
AS3 proteins or biologically active portions thereof, as well as nucleic acid
fragments
sufficient for use as hybridization probes to identify AS3-encoding nucleic
acid molecules
(e.g., AS3 mRNA) and fragments for use as PCR primers for the amplification or
mutation
of AS3 nucleic acid molecules. As used herein, the term "nucleic acid
molecule" is intended
to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g.,
mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The
nucleic
acid molecule can be single-stranded or double-stranded, but preferably is
double-stranded
DNA.
The term "isolated nucleic acid molecule" includes nucleic acid molecules
which are
separated from other nucleic acid molecules which are present in the natural
source of the
nucleic acid. For example, with regards to genomic DNA, the term "isolated"
includes
nucleic acid molecules which are separated from the chromosome with which the
genomic
DNA is naturally associated. Preferably, an "isolated" nucleic acid is free of
sequences
which naturally flank the nucleic acid (i.e., sequences located at the 5' and
3' ends of the
nucleic acid) in the genomic DNA of the organism from which the nucleic acid
is derived.
For example, in various embodiments, the isolated AS3 nucleic acid molecule
can contain
less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide
sequences which
naturally flank the nucleic acid molecule in genomic DNA of the cell from
which the nucleic
acid is derived (see Fig. 4). Moreover, an "isolated" nucleic acid molecule,
such as a cDNA
molecule, can be substantially free of other cellular material, or culture
medium when
produced by recombinant techniques, or substantially free of chemical
precursors or other
chemicals when chemically synthesized.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-15-
A nucleic acid molecule of the present invention, e.g., a nucleic acid
molecule
having the nucleotide sequence of SEQ ID NO:1 or 3, or a portion thereof, can
be isolated
using standard molecular biology techniques and the sequence information
provided herein.
Using all or portion of the nucleic acid sequence of SEQ ID NO:1 or 3, as a
hybridization
probe, AS3 nucleic acid molecules can be isolated using standard hybridization
and cloning
techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis,
T. Molecular
Cloning. A Laboratory Manual. 2nd, ed , Cold Spring Harbor Laboratory, Cold
Spring
Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). In a related
embodiment, the
invention features an AS3 nucleic acid molecule having the sequence of SEQ ID
NO: 4 (see
Fig. 6) which is identical to the AS3 sequence provided in SEQ ID NO:1 (see
Fig. 1) except
for an additional 84 base pairs at the 5' end of the molecule. One skilled in
the art would
recognize that this additional untranslated 5' sequence may indicate that an
alternative start
site for the beginning of transcription of the AS3 mRNA molecule may exist.
Moreover, a nucleic acid molecule encompassing all or a portion of SEQ ID NO:
l or
3 can be isolated by the polymerase chain reaction (PCR) using synthetic
oligonucleotide
primers designed based upon the sequence of SEQ ID NO:1 or 3.
A nucleic acid of the invention can be amplified using cDNA, mRNA or
alternatively, genomic DNA, as a template and appropriate oligonucleotide
primers
according to standard PCR amplification techniques. The nucleic acid so
amplified can be
cloned into an appropriate vector and characterized by DNA sequence analysis.
Furthermore, oligonucleotides corresponding to AS3 nucleotide sequences can be
prepared
by standard synthetic techniques, e.g., using an automated DNA synthesizer.
In a preferred embodiment, an isolated nucleic acid molecule of the invention
comprises the nucleotide sequence shown in SEQ ID NO:1. The sequence of SEQ ID
NO:1
corresponds to the human AS3 cDNA. This cDNA comprises sequences encoding the
human AS3 protein (i.e., "the coding region", from nucleotides 66-4238), as
well as 5'
untranslated sequences (nucleotides 1-65) and 3' untranslated sequences
(nucleotides 4239-
5253). Alternatively, the nucleic acid molecule can comprise only the coding
region of SEQ
ID NO:1 (e.g., nucleotides 66-4238, corresponding to SEQ ID N0:3).
In another preferred embodiment, an isolated nucleic acid molecule of the
invention
comprises a nucleic acid molecule which is a complement of the nucleotide
sequence shown
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
- 16-
in SEQ ID NO:1 or 3, or a portion of any of these nucleotide sequences. A
nucleic acid
molecule which is complementary to the nucleotide sequence shown in SEQ ID NO:
l or 3,
is one which is sufficiently complementary to the nucleotide sequence shown in
SEQ ID
NO:l or 3, such that it can hybridize to the nucleotide sequence shown in SEQ
ID NO:1 or
3, thereby forming a stable duplex.
In still another preferred embodiment, an isolated nucleic acid molecule of
the
present invention comprises a nucleotide sequence which is at least about 50%,
55%, 60%,
65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the entire length
of the
nucleotide sequence shown in SEQ ID NO:1 or 3, or a portion of any of these
nucleotide
sequences.
Moreover, the nucleic acid molecule of the invention can comprise only a
portion of
the nucleic acid sequence of SEQ ID NO:1 or 3, for example, a fragment which
can be used
as a probe or primer or a fragment encoding a portion of an AS3 protein, e.g.,
a biologically
active portion of an AS3 protein. The nucleotide sequence determined from the
cloning of
the AS3 gene allows for the generation of probes and primers designed for use
in identifying
and/or cloning other AS3 family members, as well as AS3 homologues from other
species.
The probe/primer typically comprises substantially purified oligonucleotide.
The
oligonucleotide typically comprises a region of nucleotide sequence that
hybridizes under
stringent conditions to at least about 12 or 15, preferably about 20 or 25,
more preferably
about 30, 35, 40, 45, 50, 55, 60, 65, or 75 consecutive nucleotides of a sense
sequence of
SEQ ID NO:1 or 3, of an anti-sense sequence of SEQ ID NO:1 or 3, or of a
naturally
occurring allelic variant or mutant of SEQ ID NO:1 or 3. In an exemplary
embodiment, a
nucleic acid molecule of the present invention comprises a nucleotide sequence
which is
greater than 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450,
450-500,
500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900, 900-
950, 950-
1000, or more nucleotides in length and hybridizes under stringent
hybridization conditions
to a nucleic acid molecule of SEQ ID NO: 1 or 3.
Probes based on the AS3 nucleotide sequences can be used to detect transcripts
or
genomic sequences encoding the same or homologous proteins. In preferred
embodiments,
the probe further comprises a label group attached thereto, e.g.; the label
group can be a
radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such
probes can
WO 00/50454 PCT/US00/04732 -
-17-
be used as a part of a diagnostic test kit for identifying cells or tissue
which misexpress an
AS3 protein, such as by measuring a level of an AS3-encoding nucleic acid in a
sample of
cells from a subject e.g., detecting AS3 mRNA levels or determining whether a
genomic
AS3 gene has been mutated or deleted.
A nucleic acid fragment encoding a "biologically active portion of an AS3
protein"
can be prepared by isolating a portion of the nucleotide sequence of SEQ ID
NO: 1 or 3,
which encodes a polypeptide having an AS3 biological activity (the biological
activities of
the AS3 proteins are described herein), expressing the encoded portion of the
AS3 protein
(e.g., by recombinant expression in vitro) and assessing the activity of the
encoded portion
of the AS3 protein.
The invention further encompasses nucleic acid molecules that differ from the
nucleotide sequence shown in SEQ ID NO:1 or 3, due to degeneracy of the
genetic code and
thus encode the same AS3 proteins as those encoded by the nucleotide sequence
shown in
SEQ ID NO:1 or 3. In another embodiment, an isolated nucleic acid molecule of
the
invention has a nucleotide sequence encoding a protein having an amino acid
sequence
shown in SEQ ID N0:2.
In addition to the AS3 nucleotide sequences shown in SEQ ID NO:1 or 3, it will
be
appreciated by those skilled in the art that DNA sequence polymorphisms that
lead to
changes in the amino acid sequences of the AS3 proteins may exist within a
population (e.g.,
the human population). Such genetic polymorphism in the AS3 genes may exist
among
individuals within a population due to natural allelic variation. As used
herein, the terms
"gene" and "recombinant gene" refer to nucleic acid molecules which include an
open
reading frame encoding an AS3 protein, preferably a mammalian AS3 protein, and
can
further include non-coding regulatory sequences, and introns.
Allelic variants of human AS3 include both functional and non-functional AS3
proteins. Functional allelic variants are naturally occurring amino acid
sequence variants of
the human AS3 protein that maintain the ability to modulate cell
proliferation, e.g.,
androgen-induced changes in cell proliferation. Functional allelic variants
will typically
contain only conservative substitution of one or more amino acids of SEQ ID
N0:2 or
substitution, deletion or insertion of non-critical residues in non-critical
regions of the
protein.
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-18-
Non-functional allelic variants are naturally occurring amino acid sequence
variants
of the human AS3 protein that do not have the ability to modulate cell
proliferation, for
example, hormone-induced changes in cell proliferation. Non-functional allelic
variants will
typically contain a non-conservative substitution, a deletion, or insertion or
premature
truncation of the amino acid sequence of SEQ ID N0:2 or a substitution,
insertion or
deletion in critical residues or critical regions.
The present invention further provides non-human orthologues of the human AS3
protein. Orthologues of the human AS3 protein are proteins that are isolated
from non-
human organisms and possess the same AS3 ability to modulate cell
proliferation, for
example, hormone-induced changes in cell proliferation. Orthologues of the
human AS3
protein can readily be identified as comprising an amino acid sequence that is
substantially
homologous to SEQ ID N0:2.
Moreover, nucleic acid molecules encoding other AS3 family members and, thus,
which have a nucleotide sequence which differs from the AS3 sequences of SEQ
ID NO:1
or 3, are intended to be within the scope of the invention. For example,
another AS3 cDNA
can be identified based on the nucleotide sequence of human AS3. Moreover,
nucleic acid
molecules encoding AS3 proteins from different species, and which, thus, have
a nucleotide
sequence which differs from the AS3 sequences of SEQ ID NO:1 or 3, are
intended to be
within the scope of the invention. For example, a mouse AS3 cDNA can be
identified based
on the nucleotide sequence of a human AS3.
Nucleic acid molecules corresponding to natural allelic variants and
homologues of
the AS3 cDNAs of the invention can be isolated based on their homology to the
AS3 nucleic
acids disclosed herein using the cDNAs disclosed herein, or a portion thereof,
as a
hybridization probe according to standard hybridization techniques under
stringent
hybridization conditions. Nucleic acid molecules corresponding to natural
allelic variants
and homologues of the AS3 cDNAs of the invention can further be isolated by
mapping to
the same chromosome or locus as the AS3 gene.
Accordingly, in another embodiment, an isolated nucleic acid molecule of the
invention is at least 15, 20, 25, 30 or more nucleotides in length and
hybridizes under
stringent conditions to the nucleic acid molecule comprising the nucleotide
sequence of SEQ
ID NO:1 or 3. In other embodiment, the nucleic acid is at least 30, 50, 100,
150, 200, 250,
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-19-
253, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, or 950
nucleotides in
length. As used herein, the term "hybridizes under stringent conditions" is
intended to
describe conditions for hybridization and washing under which nucleotide
sequences at least
60% homologous to each other typically remain hybridized to each other.
Preferably, the
conditions are such that sequences at least about 70%, more preferably at
least about 80%,
even more preferably at least about 85% or 90% homologous to each other
typically remain
hybridized to each other. Such stringent conditions are known to those skilled
in the art and
can be found in Current Protocols in Molecular Biology, John Wiley & Sons,
N.Y. (1989),
6.3.1-6.3.6. A preferred, non-limiting example of stringent hybridization
conditions are
hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45C,
followed by one or
more washes in 0.2 X SSC, 0.1% SDS at 50°C, preferably at 55°C,
more preferably at 60°
C, and even more preferably at 65°C. Preferably, an isolated nucleic
acid molecule of the
invention that hybridizes under stringent conditions to the sequence of SEQ ID
NO:1 or 3
corresponds to a naturally-occurring nucleic acid molecule. As used herein, a
"naturally-
occurring" nucleic acid molecule refers to an RNA or DNA molecule having a
nucleotide
sequence that occurs in nature (e.g., encodes a natural protein).
In addition to naturally-occurring allelic variants of the AS3 sequences that
may exist
in the population, the skilled artisan will further appreciate that changes
can be introduced by
mutation into the nucleotide sequences of SEQ ID NO:1 or 3, thereby leading to
changes in
the amino acid sequence of the encoded AS3 proteins, without altering the
functional ability
of the AS3 proteins. For example, nucleotide substitutions leading to amino
acid
substitutions at "non-essential" amino acid residues can be made in the
sequence of SEQ ID
NO:1 or 3. A "non-essential" amino acid residue is a residue that can be
altered from the
wild-type sequence of AS3 (e.g., the sequence of SEQ ID N0:2) without altering
the
biological activity, whereas an "essential" amino acid residue is required for
biological
activity. For example, amino acid residues that are conserved among the AS3
proteins of the
present invention, e.g., those present in the heptad repeat or kinase domains,
are predicted to
be particularly recalcitrant to alteration. Furthermore, additional amino acid
residues that are
conserved between the AS3 proteins of the present invention and other members
of the ASIC
family are not likely to be amenable to alteration.
CA 02363605 2001-08-23
WO 00/50454 PCTNS00/04732
-20-
Accordingly, another aspect of the invention pertains to nucleic acid
molecules
encoding AS3 proteins that contain changes in amino acid residues that are not
essential for
activity. Such AS3 proteins differ in amino acid sequence from SEQ ID N0:2,
yet retain
biological activity. In one embodiment, the isolated nucleic acid molecule
comprises a
nucleotide sequence encoding a protein, wherein the protein comprises an amino
acid
sequence at least about 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%,
98%
or more homologous to SEQ ID N0:2.
An isolated nucleic acid molecule encoding an AS3 protein homologous to the
protein of SEQ ID N0:2 can be created by introducing one or more nucleotide
substitutions,
additions or deletions into the nucleotide sequence of SEQ ID NO:1 or 3, such
that one or
more amino acid substitutions, additions or deletions are introduced into the
encoded protein.
Mutations can be introduced into SEQ ID NO:1 or 3, by standard techniques,
such as site-
directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative
amino acid
substitutions are made at one or more predicted non-essential amino acid
residues. A
"conservative amino acid substitution" is one in which the amino acid residue
is replaced
with an amino acid residue having a similar side chain. Families of amino acid
residues
having similar side chains have been defined in the art. These families
include amino acids
with basic side chains (e.g., lysine, arginine, histidine), acidic side chains
(e.g., aspartic acid,
glutamic acid), uncharged polar side chains (e.g., glycine, asparagine,
glutamine, serine,
threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine,
leucine, isoleucine,
proline, phenylalanine, methionine, tryptophan), beta-branched side chains
(e.g., threonine,
valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine,
tryptophan,
histidine). Thus, a predicted nonessential amino acid residue in an AS3
protein is preferably
replaced with another amino acid residue from the same side chain family.
Alternatively, in
another embodiment, mutations can be introduced randomly along all or part of
an AS3
coding sequence, such as by saturation mutagenesis, and the resultant mutants
can be
screened for AS3 biological activity to identify mutants that retain activity.
Following
mutagenesis of SEQ ID NO: 1 or 3, the encoded protein can be expressed
recombinantly and
the activity of the protein can be determined.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-21 -
In a preferred embodiment, a mutant AS3 protein can be assayed for the ability
to
ability to modulate cell proliferation, for example, hormone-induced changes
in cell
proliferation.
In addition to the nucleic acid molecules encoding AS3 proteins described
above,
another aspect of the invention pertains to isolated nucleic acid molecules
which are
antisense thereto. An "antisense" nucleic acid comprises a nucleotide sequence
which is
complementary to a "sense" nucleic acid encoding a protein, e.g.,
complementary to the
coding strand of a double-stranded cDNA molecule or complementary to an mRNA
sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense
nucleic acid.
The antisense nucleic acid can be complementary to an entire AS3 coding
strand, or to only a
portion thereof. In one embodiment, an antisense nucleic acid molecule is
antisense to a
"coding region" of the coding strand of a nucleotide sequence encoding AS3.
The term
"coding region" refers to the region of the nucleotide sequence comprising
codons which are
translated into amino acid residues (e.g., the coding region of human AS3
corresponds to
SEQ ID N0:3). In another embodiment, the antisense nucleic acid molecule is
antisense to a
"noncoding region" of the coding strand of a nucleotide sequence encoding AS3.
The term
"noncoding region" refers to 5' and 3' sequences which flank the coding region
that are not
translated into amino acids (i.e., also referred to as 5' and 3' untranslated
regions).
Given the coding strand sequences encoding AS3 disclosed herein (e.g., SEQ ID
N0:3), antisense nucleic acids of the invention can be designed according to
the rules of
Watson and Crick base pairing. The antisense nucleic acid molecule can be
complementary
to the entire coding region of AS3 mRNA, but more preferably is an
oligonucleotide which is
antisense to only a portion of the coding or noncoding region of AS3 mRNA. For
example,
the antisense oligonucleotide can be complementary to the region surrounding
the translation
start site of AS3 mRNA. An antisense oligonucleotide can be, for example,
about 5, 10, 15,
20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid
of the invention
can be constructed using chemical synthesis and enzymatic ligation reactions
using
procedures known in the art. For example, an antisense nucleic acid (e.g., an
antisense
oligonucleotide) can be chemically synthesized using naturally occurring
nucleotides or
variously modified nucleotides designed to increase the biological stability
of the molecules
or to increase the physical stability of the duplex formed between the
antisense and sense
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-22-
nucleic acids, e.g., phosphorothioate derivatives and acridine substituted
nucleotides can be
used. Examples of modified nucleotides which can be used to generate the
antisense nucleic
acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine,
xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-
carboxymethylaminomethyl-
2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-
galactosylqueosine,
inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-
dimethylguanine, 2-
methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-
adenine, 7-
methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-
mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-
N6-
isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine, 2-
thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-
methyluracil, uracil-5-
oxyacetic acid methylester, uracil-5-oxyacetic acid (v), ~-methyl-2-
thiouracil, 3-(3-amino-3-
N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the
antisense
nucleic acid can be produced biologically using an expression vector into
which a nucleic
acid has been subcloned in an antisense orientation (i.e., RNA transcribed
from the inserted
nucleic acid will be of an antisense orientation to a target nucleic acid of
interest, described
further in the following subsection).
The antisense nucleic acid molecules of the invention are typically
administered to a
subject or generated in situ such that they hybridize with or bind to cellular
mRNA and/or
genomic DNA encoding an AS3 protein to thereby inhibit expression of the
protein, e.g., by
inhibiting transcription and/or translation. The hybridization can be by
conventional
nucleotide complementarity to form a stable duplex, or, for example, in the
case of an
antisense nucleic acid molecule which binds to DNA duplexes, through specific
interactions
in the major groove of the double helix. An example of a route of
administration of
antisense nucleic acid molecules of the invention include direct injection at
a tissue site.
Alternatively, antisense nucleic acid molecules can be modified to target
selected cells and
then administered systemically. For example, for systemic administration,
antisense
molecules can be modified such that they specifically bind to receptors or
antigens
expressed on a selected cell surface, e.g., by linking the antisense nucleic
acid molecules to
peptides or antibodies which bind to cell surface receptors or antigens. The
antisense
nucleic acid molecules can also be delivered to cells using the vectors
described herein. To
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
- 23 -
achieve sufficient intracellular concentrations of the antisense molecules,
vector constructs
in which the antisense nucleic acid molecule is placed under the control of a
strong pol II or
pol III promoter are preferred.
In yet another embodiment, the antisense nucleic acid molecule of the
invention is an
a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms
specific
double-stranded hybrids with complementary RNA in which, contrary to the usual
(3-units,
the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids.
Res. 15:6625-
6641 ). The antisense nucleic acid molecule can also comprise a 2'-o-
methylribonucleotide
(moue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA
analogue
(moue et al. (1987) FEBSLett. 215:327-330).
In still another embodiment, an antisense nucleic acid of the invention is a
ribozyme.
Ribozymes are catalytic RNA molecules with ribonuclease activity which are
capable of
cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a
complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described
in
Haselhoff and Gerlach (1988) Nature 334:585-591)) can be used to catalytically
cleave AS3
mRNA transcripts to thereby inhibit translation of AS3 mRNA. A ribozyme having
specificity for an AS3-encoding nucleic acid can be designed based upon the
nucleotide
sequence of an AS3 cDNA disclosed herein (i.e., SEQ ID NO:1 or 3). For
example, a
derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the
nucleotide
sequence of the active site is complementary to the nucleotide sequence to be
cleaved in an
AS3-encoding mRNA. See, e.g., Cech et al. U.S. Patent No. 4,987,071; and Cech
et al. U.S.
Patent No. 5,116,742. Alternatively, AS3 mRNA can be used to select a
catalytic RNA
having a specific ribonuclease activity from a pool of RNA molecules. See,
e.g., Bartel, D.
and Szostak, J.W. (1993) Science 261:1411-1418.
Alternatively, AS3 gene expression can be inhibited by targeting nucleotide
sequences complementary to the regulatory region of the AS3 (e.g., the AS3
promoter
and/or enhancers) to form triple helical structures that prevent transcription
of the AS3 gene
in target cells. See generally, Helene, C. (1991) Anticancer Drug Des.
6(6):569-84; Helene,
C. et al. (1992) Ann. N Y. Acad. Sci. 660:27-36; and Maher, L.J. (1992)
Bioassays
14(12):807-15.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-24-
In yet another embodiment, the AS3 nucleic acid molecules of the present
invention
can be modified at the base moiety, sugar moiety or phosphate backbone to
improve, e.g.,
the stability, hybridization, or solubility of the molecule. For example, the
deoxyribose
phosphate backbone of the nucleic acid molecules can be modified to generate
peptide
nucleic acids (see Hyrup B. et al. (1996) Bioorganic & Medicinal Chemistry 4
(1): 5-23).
As used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic
acid mimics,
e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a
pseudopeptide backbone and only the four natural nucleobases are retained. The
neutral
backbone of PNAs has been shown to allow for specific hybridization to DNA and
RNA
under conditions of low ionic strength. The synthesis of PNA oligomers can be
performed
using standard solid phase peptide synthesis protocols as described in Hyrup
B. et al. (1996)
supra; Perry-O'Keefe et al. Proc. Natl. Acad. Sci. 93: 14670-675.
PNAs of AS3 nucleic acid molecules can be used in therapeutic and diagnostic
applications. For example, PNAs can be used as antisense or antigene agents
for sequence-
specific modulation of gene expression by, for example, inducing transcription
or translation
arrest or inhibiting replication. PNAs of AS3 nucleic acid molecules can also
be used in the
analysis of single base pair mutations in a gene, (e.g., by PNA-directed PCR
clamping); as
'artificial restriction enzymes' when used in combination with other enzymes,
(e.g., S1
nucleases (Hyrup B. (1996) supra)); or as probes or primers for DNA sequencing
or
hybridization (Hyrup B. et al. ( 1996) supra; Perry-O'Keefe supra).
In another embodiment, PNAs of AS3 can be modified, (e.g., to enhance their
stability or cellular uptake), by attaching lipophilic or other helper groups
to PNA, by the
formation of PNA-DNA chimeras, or by the use of liposomes or other techniques
of drug
delivery known in the art. For example, PNA-DNA chimeras of AS3 nucleic acid
molecules
can be generated which may combine the advantageous properties of PNA and DNA.
Such
chimeras allow DNA recognition enzymes, (e.g., RNAse H and DNA polymerases),
to
interact with the DNA portion while the PNA portion would provide high binding
affinity
and specificity. PNA-DNA chimeras can be linked using linkers of appropriate
lengths
selected in terms of base stacking, number of bonds between the nucleobases,
and
orientation (Hyrup B. (1996) supra). The synthesis of PNA-DNA chimeras can be
performed as described in Hyrup B. (1996) supra and Finn P.J. et al. (1996)
Nucleic Acids
WO 00/50454 PCT/US00/04732 -
- 25 -
Res. 24 (17): 3357-63. For example, a DNA chain can be synthesized on a solid
support
using standard phosphoramidite coupling chemistry and modified nucleoside
analogs, e.g.,
5'-(4-methoxytrityl)amino-5'-deoxy-thymidine phosphoramidite, can be used as a
between
the PNA and the 5' end of DNA (Mag, M. et al. (1989) Nucleic Acid Res. 17:
5973-88).
PNA monomers are then coupled in a stepwise manner to produce a chimeric
molecule with
a 5' PNA segment and a 3' DNA segment (Finn P.J. et al. (1996) supra).
Alternatively,
chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA
segment
(Peterser, K.H. et al. (1975) Bioorganic Med. Chem. Lett. 5: 1119-11124).
In other embodiments, the oligonucleotide may include other appended groups
such
as peptides (e.g., for targeting host cell receptors in vivo), or agents
facilitating transport
across the cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad.
Sci. USA
86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci. USA 84:648-652;
PCT
Publication No. W088/09810) or the blood-brain barrier (see, e.g., PCT
Publication No.
W089/10134). In addition, oligonucleotides can be modified with hybridization-
triggered
cleavage agents (See, e.g., Krol et al. (1988) Bio-Techniques 6:958-976) or
intercalating
agents. (See, e.g., Zon (1988) Pharm. Res. 5:539-549). To this end, the
oligonucleotide
may be conjugated to another molecule, (e.g., a peptide, hybridization
triggered cross-
linking agent, transport agent, or hybridization-triggered cleavage agent).
II. Isolated AS3 Proteins
One aspect of the invention pertains to isolated AS3 proteins, and
biologically active
portions thereof, as well as polypeptide fragments suitable for use as
immunogens to raise
anti-AS3 antibodies. In one embodiment, native AS3 proteins can be isolated
from cells or
tissue sources by an appropriate purification scheme using standard protein
purification
techniques. In another embodiment, AS3 proteins are produced by recombinant
DNA
techniques. Alternative to recombinant expression, an AS3 protein or
polypeptide can be
synthesized chemically using standard peptide synthesis techniques.
An "isolated" or "purified" protein or biologically active portion thereof is
substantially free of cellular material or other contaminating proteins from
the cell or tissue
source from which the AS3 protein is derived, or substantially free from
chemical precursors
or other chemicals when chemically synthesized. The language "substantially
free of
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-26-
cellular material" includes preparations of AS3 protein in which the protein
is separated
from cellular components of the cells from which it is isolated or
recombinantly produced.
In one embodiment, the language "substantially free of cellular material"
includes
preparations of AS3 protein having less than about 30% (by dry weight) of non-
AS3 protein
(also referred to herein as a "contaminating protein"), more preferably less
than about 20%
of non-AS3 protein, still more preferably less than about 10% of non-AS3
protein, and most
preferably less than about 5% non-AS3 protein. When the AS3 protein or
biologically
active portion thereof is recombinantly produced, it is also preferably
substantially free of
culture medium, i.e., culture medium represents less than about 20%, more
preferably less
than about 10%, and most preferably less than about 5% of the volume of the
protein
preparation.
The language "substantially free of chemical precursors or other chemicals"
includes
preparations of AS3 protein in which the protein is separated from chemical
precursors or
other chemicals which are involved in the synthesis of the protein. In one
embodiment, the
language "substantially free of chemical precursors or other chemicals"
includes
preparations of AS3 protein having less than about 30% (by dry weight) of
chemical
precursors or non-AS3 chemicals, more preferably less than about 20% chemical
precursors
or non-AS3 chemicals, still more preferably less than about 10% chemical
precursors or
non-AS3 chemicals, and most preferably less than about 5% chemical precursors
or non-
AS3 chemicals.
As used herein, a "biologically active portion" of an AS3 protein includes a
fragment
of an AS3 protein which participates in an interaction between an AS3 molecule
and a non-
AS3 molecule. Biologically active portions of an AS3 protein include peptides
comprising
amino acid sequences sufficiently homologous to or derived from the amino acid
sequence
of the AS3 protein, e.g., the amino acid sequence shown in SEQ ID N0:2, which
include
less amino acids than the full length AS3 proteins, and exhibit at least one
activity of an AS3
protein. Typically, biologically active portions comprise a domain or motif
with at least one
activity of the AS3 protein, e.g., the ability to modulate cell proliferation.
A biologically
active portion of an AS3 protein can be a polypeptide which is, for example,
10, 25, 50, 100,
200 or more amino acids in length. Biologically active portions of an AS3
protein can be
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-27-
used as targets for developing agents which modulate an AS3 mediated activity,
e.g., cell
proliferation.
In one embodiment, a biologically active portion of an AS3 protein comprises
at
least one heptad repeat. It is to be understood that a preferred biologically
active portion of
an AS3 protein of the present invention may contain two, three, four, or five
heptad repeats.
As used herein, the term "heptad repeat" includes a protein domain which
contains either a
leucine or similar hydrophobic residue (e.g., isoleucine, valine, or tyrosine)
in every seventh
position over a stretch of at least 20-30 amino acid residues, more preferably
at least 20-25
amino acid residues, and most preferably at least 22 amino acid residues.
Typically, the
heptad repeat is uninterrupted, and can participate in protein-protein
interactions. The
leucine-zipper motif of DNA binding proteins is a specific subclass of this
general pattern
and is encompassed by the above term. Leucine zipper domains are described in,
for
example, Landschultz et al. (1988) Science 240: 1759-1764, the contents of
which are
incorporated herein by reference. Amino acid residues 55-161, 196-217, 241-
277, 319-355,
and 375-404 of the AS3 protein all comprise heptad repeats.
In another embodiment, a biologically active portion of an AS3 protein
comprises a
least one kinase-related domain. It is understood that a preferred
biologically active portion
of an AS3 protein of the present invention may contain two, three, four, five,
six, seven,
eight, or nine kinase-related domains. As used herein, the term "kinase-
related domain"
includes a polypeptide consensus motif having high homology to a known protein
kinase
catalytic domain as described in Hanks et ul. (1988) Meth. Enzymol. 200:38-62
(the
contents of which are incorporated herein by reference). In particular, a
kinase-related
domain is any one of the nine consensus motifs or related sequences set forth
in Fig. 3.
In another embodiment, a biologically active portion of an AS3 protein can
have
kinase activity. As referred to herein, "kinase activity" is an activity
associated with a
protein or polypeptide which is capable of modulating its own phosphorylation
state or the
phosphorylation state of another protein or polypeptide. Proteins with kinase
activity play a
role in signaling pathways associated with cellular growth.
Moreover, other biologically active portions, in which other regions of the
protein are
deleted, can be prepared by recombinant techniques and evaluated for one or
more of the
functional activities of a native AS3 protein.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-28-
In a preferred embodiment, the AS3 protein has an amino acid sequence shown in
SEQ ID N0:2: In other embodiments, the AS3 protein is substantially homologous
to SEQ
ID N0:2, and retains the functional activity of the protein of SEQ ID N0:2,
yet differs in
amino acid sequence due to natural allelic variation or mutagenesis, as
described in detail in
subsection I above. Accordingly, in another embodiment, the AS3 protein is a
protein
which comprises an amino acid sequence at least about 45%, 50%, 55%, 60%, 65%,
70%,
75%, 80%, 85%, 90%, 95%, 98% or more homologous to SEQ ID N0:2.
To determine the percent identity of two amino acid sequences or of two
nucleic acid
sequences, the sequences are aligned for optimal comparison purposes (e.g.,
gaps can be
introduced in one or both of a first and a second amino acid or nucleic acid
sequence for
optimal alignment and non-homologous sequences can be disregarded for
comparison
purposes). In a preferred embodiment, the length of a reference sequence
aligned for
comparison purposes is at least 30%, preferably at least 40%, more preferably
at least 50%,
even more preferably at least 60%, and even more preferably at least 70%, 80%,
or 90% of
the length of the reference sequence (e.g., when aligning a second sequence to
the AS3
amino acid sequence of SEQ ID NO: 2 having 400 amino acid residues, at least
80,
preferably at least 100, more preferably at least 120, even more preferably at
least 140, and
even more preferably at least 150, 200, 300, or 400 amino acid residues are
aligned). The
amino acid residues or nucleotides at corresponding amino acid positions or
nucleotide
positions are then compared. When a position in the first sequence is occupied
by the same
amino acid residue or nucleotide as the corresponding position in the second
sequence, then
the molecules are identical at that position (as used herein amino acid or
nucleic acid
"identity" is equivalent to amino acid or nucleic acid "homology"). The
percent identity
between the two sequences is a function of the number of identical positions
shared by the
sequences, taking into account the number of gaps, and the length of each gap,
which need
to be introduced for optimal alignment of the two sequences.
The comparison of sequences and determination of percent identity between two
sequences can be accomplished using a mathematical algorithm. In a preferred
embodiment,
the percent identity between two amino acid sequences is determined using the
Needleman
and Wunsch (J. Mol. Biol. (48):444-453 (1970)) algorithm which has been
incorporated into
the GAP program in the GCG software package (available at http://www.gcg.com),
using
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-29-
either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12,
10, 8, 6, or
4 and a length weight of 1, 2, 3, 4, 5, or 6. In yet another preferred
embodiment, the percent
identity between two nucleotide sequences is determined using the GAP program
in the
GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP
matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2,
3, 4, 5, or 6. In
another embodiment, the percent identity between two amino acid or nucleotide
sequences is
determined using the algorithm of E. Meyers and W. Miller (Comput. Appl.
Biosci., 4:11-17
(1988)) which has been incorporated into the ALIGN program (version 2.0),
using a
PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of
4.
The nucleic acid and protein sequences of the present invention can further be
used
as a "query sequence" to perform a search against public databases to, for
example, identify
other family members or related sequences. Such searches can be performed
using the
NBLAST and XBLAST programs (version 2.0) of Altschul, et al. ( 1990) J. Mol.
Biol.
215:403-10. BLAST nucleotide searches can be performed with the NBLAST
program,
score = 100, wordlength = 12 to obtain nucleotide sequences homologous to AS3
nucleic
acid molecules of the invention. BLAST protein searches can be performed with
the
XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences
homologous
to AS3 protein molecules of the invention. To obtain gapped alignments for
comparison
purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997)
Nucleic
Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs,
the
default parameters of the respective programs (e.g., XBLAST and NBLAST) can be
used.
See http://www.ncbi.nlm.nih.gov.
The invention also provides AS3 chimeric or fusion proteins. As used herein,
an
AS3 "chimeric protein" or "fusion protein" comprises an AS3 polypeptide
operatively linked
to a non-AS3 polypeptide. An "AS3 polypeptide" refers to a polypeptide having
an amino
acid sequence corresponding to AS3, whereas a "non-AS3 polypeptide" refers to
a
polypeptide having an amino acid sequence corresponding to a protein which is
not
substantially homologous to the AS3 protein, e.g., a protein which is
different from the AS3
protein and which is derived from the same or a different organism. Within an
AS3 fusion
protein the AS3 polypeptide can correspond to all or a portion of an AS3
protein. In a
preferred embodiment, an AS3 fusion protein comprises at least one
biologically active
WO 00/50454 PCT/US00/04732
-30-
portion of an AS3 protein. In another preferred embodiment, an AS3 fusion
protein
comprises at least two biologically active portions of an AS3 protein. Within
the fusion
protein, the term "operatively linked" is intended to indicate that the AS3
polypeptide and
the non-AS3 polypeptide are fused in-frame to each other. The non-AS3
polypeptide can be
fused to the N-terminus or C-terminus of the AS3 polypeptide.
For example, in one embodiment, the fusion protein is a GST-AS3 fusion protein
in
which the AS3 sequences are fused to the C-terminus of the GST sequences. Such
fusion
proteins can facilitate the purification of recombinant AS3.
In another embodiment, the fusion protein is an AS3 protein containing a
heterologous signal sequence at its N-terminus. In certain host cells (e.g.,
mammalian host
cells), expression and/or secretion of AS3 can be increased through use of a
heterologous
signal sequence.
The AS3 fusion proteins of the invention can be incorporated into
pharmaceutical
compositions and administered to a subject in vivo. The AS3 fusion proteins
can be used to
affect the bioavailability of an AS3 substrate. Use of AS3 fusion proteins may
be useful
therapeutically for the treatment of disorders caused by, for example, (i)
aberrant
modification or mutation of a gene encoding an AS3 protein; (ii) mis-
regulation of the AS3
gene; and (iii) aberrant post-translational modification of an AS3 protein.
Moreover, the AS3-fusion proteins of the invention can be used as immunogens
to
produce anti-AS3 antibodies in a subject, to purify AS3 ligands and in
screening assays to
identify molecules which inhibit the interaction of AS3 with an AS3 substrate.
Preferably, an AS3 chimeric or fusion protein of the invention is produced by
standard recombinant DNA techniques. For example, DNA fragments coding for the
different polypeptide sequences are ligated together in-frame in accordance
with
conventional techniques, for example by employing blunt-ended or stagger-ended
termini
for ligation, restriction enzyme digestion to provide for appropriate termini,
filling-in of
cohesive ends as appropriate, alkaline phosphatase treatment to avoid
undesirable joining,
and enzymatic ligation. In another embodiment, the fusion gene can be
synthesized by
conventional techniques including automated DNA synthesizers. Alternatively,
PCR
amplification of gene fragments can be carried out using anchor primers which
give rise to
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-31 -
complementary overhangs between two consecutive gene fragments which can
subsequently
be annealed and reamplified to generate a chimeric gene sequence (see, for
example,
Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons:
1992).
Moreover, many expression vectors are commercially available that already
encode a fusion
moiety (e.g., a GST polypeptide). An AS3-encoding nucleic acid can be cloned
into such an
expression vector such that the fusion moiety is linked in-frame to the AS3
protein.
The present invention also pertains to variants of the AS3 proteins which
function as
either AS3 agonists (mimetics) or as AS3 antagonists. Variants of the AS3
proteins can be
generated by mutagenesis, e.g., discrete point mutation or truncation of an
AS3 protein. An
agonist of the AS3 proteins can retain substantially the same, or a subset, of
the biological
activities of the naturally occurring form of an AS3 protein. An antagonist of
an AS3
protein can inhibit one or more of the activities of the naturally occurring
form of the AS3
protein by, for example, competitively modulating an AS3-mediated activity of
an AS3
protein. Thus, specific biological effects can be elicited by treatment with a
variant of
limited function. In one embodiment, treatment of a subject with a variant
having a subset
of the biological activities of the naturally occurring form of the protein
has fewer side
effects in a subject relative to treatment with the naturally occurring form
of the AS3
protein.
In one embodiment, variants of an AS3 protein which function as either AS3
agonists (mimetics) or as AS3 antagonists can be identified by screening
combinatorial
libraries of mutants, e.g., truncation mutants, of an AS3 protein for AS3
protein agonist or
antagonist activity. In one embodiment, a variegated library of AS3 variants
is generated by
combinatorial mutagenesis at the nucleic acid level and is encoded by a
variegated gene
library. A variegated library of AS3 variants can be produced by, for example,
enzymatically ligating a mixture of synthetic oligonucleotides into gene
sequences such that
a degenerate set of potential AS3 sequences is expressible as individual
polypeptides, or
alternatively, as a set of larger fusion proteins (e.g., for phage display)
containing the set of
AS3 sequences therein. There are a variety of methods which can be used to
produce
libraries of potential AS3 variants from a degenerate oligonucleotide
sequence. Chemical
synthesis of a degenerate gene sequence can be performed in an automatic DNA
synthesizer,
and the synthetic gene then ligated into an appropriate expression vector. Use
of a
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-32-
degenerate set of genes allows for the provision, in one mixture, of all of
the sequences
encoding the desired set of potential AS3 sequences. Methods for synthesizing
degenerate
oligonucleotides are known in the art (see, e.g., Narang, S.A. (1983)
Tetrahedron 39:3;
Itakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984)
Science 198:1056; Ike
et al. (1983) Nucleic Acid Res. 11:477.
In addition, libraries of fragments of an AS3 protein coding sequence can be
used to
generate a variegated population of AS3 fragments for screening and subsequent
selection of
variants of an AS3 protein. In one embodiment, a library of coding sequence
fragments can
be generated by treating a double stranded PCR fragment of an AS3 coding
sequence with a
nuclease under conditions wherein nicking occurs only about once per molecule,
denaturing
the double stranded DNA, renaturing the DNA to form double stranded DNA which
can
include sense/antisense pairs from different nicked products, removing single
stranded
portions from reformed duplexes by treatment with S 1 nuclease, and ligating
the resulting
fragment library into an expression vector. By this method, an expression
library can be
derived which encodes N-terminal, C-terminal and internal fragments of various
sizes of the
AS3 protein.
Several techniques are known in the art for screening gene products of
combinatorial
libraries made by point mutations or truncation, and for screening cDNA
libraries for gene
products having a selected property. Such techniques are adaptable for rapid
screening of
the gene libraries generated by the combinatorial mutagenesis of AS3 proteins.
The most
widely used techniques, which are amenable to high through-put analysis, for
screening
large gene libraries typically include cloning the gene library into
replicable expression
vectors, transforming appropriate cells with the resulting library of vectors,
and expressing
the combinatorial genes under conditions in which detection of a desired
activity facilitates
isolation of the vector encoding the gene whose product was detected.
Recrusive ensemble
mutagenesis (REM), a new technique which enhances the frequency of functional
mutants in
the libraries, can be used in combination with the screening assays to
identify AS3 variants
(Arkin and Yourvan (1992) Proc. Natl. Acad. Sci. USA 89:7811-7815; Delgrave et
al.
(1993) Protein Engineering 6(3):327-331).
In one embodiment, cell based assays can be exploited to analyze a variegated
AS3
library. For example, a library of expression vectors can be transfected into
a cell line, e.g.,
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-33-
a neuronal cell line, which ordinarily responds to a particular ligand in an
AS3-dependent
manner. The transfected cells are then contacted with the ligand and the
effect of expression
of the mutant on signaling by the ligand can be detected, e.g., by measuring
intracellular
calcium, potassium, or sodium concentration, neuronal membrane depolarization,
or the
activity of an AS3-regulated transcription factor. Plasmid DNA can then be
recovered from
the cells which score for inhibition, or alternatively, potentiation of
signaling by the ligand,
and the individual clones further characterized.
III Anti-AS3 Antibodies
An isolated AS3 protein, or a portion or fragment thereof, can be used as an
immunogen to generate antibodies that bind AS3 using standard techniques for
polyclonal
and monoclonal antibody preparation. A full-length AS3 protein can be used or,
alternatively, the invention provides antigenic peptide fragments of AS3 for
use as
immunogens. The antigenic peptide of AS3 comprises at least 8 amino acid
residues of the
amino acid sequence shown in SEQ ID N0:2 and encompasses an epitope of AS3
such that
an antibody raised against the peptide forms a specific immune complex with
AS3.
Preferably, the antigenic peptide comprises at least 10 amino acid residues,
more preferably
at least 15 amino acid residues, even more preferably at least 20 amino acid
residues, and
most preferably at least 30 amino acid residues.
Preferred epitopes encompassed by the antigenic peptide are regions of AS3
that are
located on the surface of the protein, e.g., hydrophilic regions, as well as
regions with high
antigenicity (see, for example, Figure 2).
An AS3 immunogen typically is used to prepare antibodies by immunizing a
suitable
subject, (e.g., rabbit, goat, mouse or other mammal) with the immunogen. An
appropriate
immunogenic preparation can contain, for example, recombinantly expressed AS3
protein or
a chemically synthesized AS3 polypeptide. The preparation can further include
an adjuvant,
such as Freund's complete or incomplete adjuvant, or similar immunostimulatory
agent.
Immunization of a suitable subject with an immunogenic AS3 preparation induces
a
polyclonal anti-AS3 antibody response.
Accordingly, another aspect of the invention pertains to anti-AS3 antibodies.
The
term "antibody" as used herein refers to immunoglobulin molecules and
immunologically
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-34-
active portions of immunoglobulin molecules, i.e., molecules that contain an
antigen binding
site which specifically binds (immunoreacts with) an antigen, such as AS3.
Examples of
immunologically active portions of immunoglobulin molecules include Flab) and
F(ab')2
fragments which can be generated by treating the antibody with an enzyme such
as pepsin.
The invention provides polyclonal and monoclonal antibodies that bind AS3. The
term
"monoclonal antibody" or "monoclonal antibody composition", as used herein,
refers to a
population of antibody molecules that contain only one species of an antigen
binding site
capable of immunoreacting with a particular epitope of AS3. A monoclonal
antibody
composition thus typically displays a single binding affinity for a particular
AS3 protein
with which it immunoreacts.
Polyclonal anti-AS3 antibodies can be prepared as described above by
immunizing a
suitable subject with an AS3 immunogen. The anti-AS3 antibody titer in the
immunized
subject can be monitored over time by standard techniques, such as with an
enzyme linked
immunosorbent assay (ELISA) using immobilized AS3. If desired, the antibody
molecules
directed against AS3 can be isolated from the mammal (e.g., from the blood)
and further
purified by well known techniques, such as protein A chromatography to obtain
the IgG
fraction. At an appropriate time after immunization, e.g., when the anti-AS3
antibody titers
are highest, antibody-producing cells can be obtained from the subject and
used to prepare
monoclonal antibodies by standard techniques, such as the hybridoma technique
originally
described by Kohler and Milstein ( 1975) Nature 256:495-497) (see also, Brown
et al. ( 1981 )
J. Immunol. 127:539-46; Brown et al. (1980) J. Biol. Chem .255:4980-83; Yeh et
al. (1976)
Proc. Natl. Acad. Sci. USA 76:2927-31; and Yeh et al. (1982) Int. J. Cancer
29:269-75), the
more recent human B cell hybridoma technique (Kozbor et al. (1983) Immunol
Today 4:72),
the EBV-hybridoma technique (Cole et al. (1985), Monoclonal Antibodies and
Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma techniques. The technology
for producing
monoclonal antibody hybridomas is well known (see generally R. H. Kenneth, in
Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum
Publishing
Corp., New York, New York (1980); E. A. Lerner (1981) Yale J. Biol. Med.,
54:387-402; M.
L. Gefter et al. (1977) Somatic Cell Genet. 3:231-36). Briefly, an immortal
cell line
(typically a myeloma) is fused to lymphocytes (typically splenocytes) from a
mammal
immunized with an AS3 immunogen as described above, and the culture
supernatants of the
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
- 35 -
resulting hybridoma cells are screened to identify a hybridoma producing a
monoclonal
antibody that binds AS3.
Any of the many well known protocols used for fusing lymphocytes and
immortalized cell lines can be applied for the purpose of generating an anti-
AS3 monoclonal
antibody (see, e.g., G. Galfre et al. (1977) Nature 266:55052; Gefter et al.
Somatic Cell
Genet., cited supra; Lerner, Yale J. Biol. Med., cited supra; Kenneth,
Monoclonal
Antibodies, cited supra). Moreover, the ordinarily skilled worker will
appreciate that there
are many variations of such methods which also would be useful. Typically, the
immortal
cell line (e.g., a myeloma cell line) is derived from the same mammalian
species as the
lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes
from a
mouse immunized with an immunogenic preparation of the present invention with
an
immortalized mouse cell line. Preferred immortal cell lines are mouse myeloma
cell lines
that are sensitive to culture medium containing hypoxanthine, aminopterin and
thymidine
("HAT medium"). Any of a number of myeloma cell lines can be used as a fusion
partner
according to standard techniques, e.g., the P3-NS1/1-Ag4-1, P3-x63-Ag8.653 or
Sp2/O-
Agl4 myeloma lines. These myeloma lines are available from ATCC. Typically,
HAT-
sensitive mouse myeloma cells are fused to mouse splenocytes using
polyethylene glycol
("PEG"). Hybridoma cells resulting from the fusion are then selected using HAT
medium,
which kills unfused and unproductively fused myeloma cells (unfused
splenocytes die after
several days because they are not transformed). Hybridoma cells producing a
monoclonal
antibody of the invention are detected by screening the hybridoma culture
supernatants for
antibodies that bind AS3, e.g., using a standard ELISA assay.
Alternative to preparing monoclonal antibody-secreting hybridomas, a
monoclonal
anti-AS3 antibody can be identified and isolated by screening a recombinant
combinatorial
immunoglobulin library (e.g., an antibody phage display library) with AS3 to
thereby isolate
immunoglobulin library members that bind AS3. Kits for generating and
screening phage
display libraries are commercially available (e.g., the Pharmacia Recombinant
Phage
Antibody System, Catalog No. 27-9400-O 1; and the Stratagene SurfZAPTM Phage
Display
Kit, Catalog No. 240612). Additionally, examples of methods and reagents
particularly
amenable for use in generating and screening antibody display library can be
found in, for
example, Ladner et al. U.S. Patent No. 5,223,409; Kang et al. PCT
International Publication
WO 00/50454 PCT/US00/04732 -
-36-
No. WO 92/18619; Dower et al. PCT International Publication No. WO 91/17271;
Winter et
al. PCT International Publication WO 92/20791; Markland et al. PCT
International
Publication No. WO 92/15679; Breitling et al. PCT International Publication WO
93/01288;
McCafferty et al. PCT International Publication No. WO 92/01047; Garrard et
al. PCT
International Publication No. WO 92/09690; Ladner et al. PCT International
Publication No.
WO 90/02809; Fuchs et al. (1991) BiolTechnology 9:1370-1372; Hay et al. (1992)
Hum.
Antibod. Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281;
Griffiths et al.
(1993) EMBO J 12:725-734; Hawkins et al. (1992) J. Mol. Biol. 226:889-896;
Clarkson et
al. (1991) Nature 352:624-628; Gram et al. (1992) Proc. Natl. Acad Sci. USA
89:3576-
3580; Garrad et al. (1991) BiolTechnology 9:1373-1377; Hoogenboom et al.
(1991) Nuc.
Acid Res. 19:4133-4137; Barbas et al. (1991) Proc. Natl. Acad Sci. USA 88:7978-
7982; and
McCafferty et al. Nature (1990) 348:552-554.
Additionally, recombinant anti-AS3 antibodies, such as chimeric and humanized
monoclonal antibodies, comprising both human and non-human portions, which can
be
made using standard recombinant DNA techniques, are within the scope of the
invention.
Such chimeric and humanized monoclonal antibodies can be produced by
recombinant DNA
techniques known in the art, for example using methods described in Robinson
et al.
International Application No. PCT/L1S86/02269; Akira, et al. European Patent
Application
184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al.
European
Patent Application 173,494; Neuberger et al. PCT International Publication No.
WO
86/01533; Cabilly et al. U.S. Patent No. 4,816,567; Cabilly et al. European
Patent
Application 125,023; Better et al. (1988) Science 240:1041-1043; Liu et al.
(1987) Proc.
Natl. Acad Sci. USA 84:3439-3443; Liu et al. (1987) J. Immunol. 139:3521-3526;
Sun et al.
(1987) Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al. (1987) Canc.
Res. 47:999-
1005; Wood et al. (1985) Nature 314:446-449; and Shaw et al. (1988) J. Natl.
Cancer Inst.
80:1553-1559); Morrison, S. L. (1985) Science 229:1202-1207; Oi et al. (1986)
BioTechniques 4:214; Winter U.S. Patent 5,225,539; Jones et al. (1986) Nature
321:552-
525; Verhoeyan et al. (1988) Science 239:1534; and Beidler et al. (1988) J.
Immunol.
141:4053-4060.
An anti-AS3 antibody (e.g., monoclonal antibody) can be used to isolate AS3 by
standard techniques, such as affinity chromatography or immunoprecipitation.
An anti-AS3
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-37-
antibody can facilitate the purification of natural AS3 from cells and of
recombinantly
produced AS3 expressed in host cells. Moreover, an anti-AS3 antibody can be
used to
detect AS3 protein (e.g., in a cellular lysate or cell supernatant) in order
to evaluate the
abundance and pattern of expression of the AS3 protein. Anti-AS3 antibodies
can be used
diagnostically to monitor protein levels in tissue as part of a clinical
testing procedure, e.g.,
to, for example, determine the efficacy of a given treatment regimen.
Detection can be
facilitated by coupling (i.e., physically linking) the antibody to a
detectable substance.
Examples of detectable substances include various enzymes, prosthetic groups,
fluorescent
materials, luminescent materials, bioluminescent materials, and radioactive
materials.
Examples of suitable enzymes include horseradish peroxidase, alkaline
phosphatase, -
galactosidase, or acetylcholinesterase; examples of suitable prosthetic group
complexes
include streptavidin/biotin and avidin/biotin; examples of suitable
fluorescent materials
include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine,
dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an
example of a
luminescent material includes luminol; examples of bioluminescent materials
include
luciferase, luciferin, and aequorin, and examples of suitable radioactive
material include
125I~ 1311 35S or 3H.
IV. Recombinant Expression Vectors
Another aspect of the invention pertains to vectors, preferably expression
vectors,
containing a nucleic acid encoding an AS3 protein (or a portion thereof). As
used herein,
the term "vector" refers to a nucleic acid molecule capable of transporting
another nucleic
acid to which it has been linked. One type of vector is a "plasmid", which
refers to a
circular double stranded DNA loop into which additional DNA segments can be
ligated.
Another type of vector is a viral vector, wherein additional DNA segments can
be ligated
into the viral genome. Certain vectors are capable of autonomous replication
in a host cell
into which they are introduced (e.g., bacterial vectors having a bacterial
origin of replication
and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian
vectors)
are integrated into the genome of a host cell upon introduction into the host
cell, and thereby
are replicated along with the host genome. Moreover, certain vectors are
capable of
directing the expression of genes to which they are operatively linked. Such
vectors are
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-38-
referred to herein as "expression vectors". In general, expression vectors of
utility in
recombinant DNA techniques are often in the form of plasmids. In the present
specification,
"plasmid" and "vector" can be used interchangeably as the plasmid is the most
commonly
used form of vector. However, the invention is intended to include such other
forms of
expression vectors, such as viral vectors (e.g., replication defective
retroviruses,
adenoviruses and adeno-associated viruses), which serve equivalent functions.
The recombinant expression vectors of the invention comprise a nucleic acid of
the
invention in a form suitable for expression of the nucleic acid in a host
cell, which means
that the recombinant expression vectors include one or more regulatory
sequences, selected
on the basis of the host cells to be used for expression, which is operatively
linked to the
nucleic acid sequence to be expressed. Within a recombinant expression vector,
"operably
linked" is intended to mean that the nucleotide sequence of interest is linked
to the
regulatory sequences) in a manner which allows for expression of the
nucleotide sequence
(e.g., in an in vitro transcription/translation system or in a host cell when
the vector is
introduced into the host cell). The term "regulatory sequence" is intended to
include
promoters, enhancers and other expression control elements (e.g.,
polyadenylation signals).
Such regulatory sequences are described, for example, in Goeddel; Gene
Expression
Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).
Regulatory sequences include those which direct constitutive expression of a
nucleotide
sequence in many types of host cells and those which direct expression of the
nucleotide
sequence only in certain host cells (e.g., tissue-specific regulatory
sequences). It will be
appreciated by those skilled in the art that the design of the expression
vector can depend on
such factors as the choice of the host cell to be transformed, the level of
expression of
protein desired, and the like. The expression vectors of the invention can be
introduced into
host cells to thereby produce proteins or peptides, including fusion proteins
or peptides,
encoded by nucleic acids as described herein (e.g., AS3 proteins, mutant forms
of AS3
proteins, fusion proteins, and the like).
The recombinant expression vectors of the invention can be designed for
expression
of AS3 proteins in prokaryotic or eukaryotic cells. For example, AS3 proteins
can be
expressed in bacterial cells such as E. coli, insect cells (using baculovirus
expression
vectors) yeast cells or mammalian cells. Suitable host cells are discussed
further in
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-39-
Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic
Press, San
Diego, CA (1990). Alternatively, the recombinant expression vector can be
transcribed and
translated in vitro, for example using T7 promoter regulatory sequences and T7
polymerase.
Expression of proteins in prokaryotes is most often carried out in E. coli
with vectors
containing constitutive or inducible promoters directing the expression of
either fusion or
non-fusion proteins. Fusion vectors add a number of amino acids to a protein
encoded
therein, usually to the amino terminus of the recombinant protein. Such fusion
vectors
typically serve three purposes: 1) to increase expression of recombinant
protein; 2) to
increase the solubility of the recombinant protein; and 3) to aid in the
purification of the
recombinant protein by acting as a ligand in affinity purification. Often, in
fusion
expression vectors, a proteolytic cleavage site is introduced at the junction
of the fusion
moiety and the recombinant protein to enable separation of the recombinant
protein from the
fusion moiety subsequent to purification of the fusion protein. Such enzymes,
and their
cognate recognition sequences, include Factor Xa, thrombin and enterokinase.
Typical
fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, D.B. and
Johnson,
K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, MA) and pRITS
(Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST),
maltose E binding
protein, or protein A, respectively, to the target recombinant protein.
Purified fusion proteins can be utilized in AS3 activity assays, (e.g., direct
assays or
competitive assays described in detail below), or to generate antibodies
specific for AS3
proteins, for example. In a preferred embodiment, an AS3 fusion protein
expressed in a
retroviral expression vector of the present invention can be utilized to
infect bone marrow
cells which are subsequently transplanted into irradiated recipients. The
pathology of the
subject recipient is then examined after sufficient time has passed (e.g., six
(6) weeks).
Examples of suitable inducible non-fusion E. coli expression vectors include
pTrc
(Amann et al., (1988) Gene 69:301-315) and pET 1 ld (Studier et al., Gene
Expression
Technology: Methods in Enzymology 185, Academic Press, San Diego, California (
1990)
60-89). Target gene expression from the pTrc vector relies on host RNA
polymerase
transcription from a hybrid trp-lac fusion promoter. Target gene expression
from the pET
l ld vector relies on transcription from a T7 gnl0-lac fusion promoter
mediated by a
coexpressed viral RNA polymerase (T7 gnl). This viral polymerase is supplied
by host
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-40-
strains BL21(DE3) or HMS174(DE3) from a resident prophage harboring a T7 gnl
gene
under the transcriptional control of the lacUV 5 promoter.
One strategy to maximize recombinant protein expression in E. coli is to
express the
protein in a host bacteria with an impaired capacity to proteolytically cleave
the recombinant
protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185,
Academic Press, San Diego, California (1990) 119-128). Another strategy is to
alter the
nucleic acid sequence of the nucleic acid to be inserted into an expression
vector so that the
individual codons for each amino acid are those preferentially utilized in E.
coli (Wada et
al., (1992) Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid
sequences of
the invention can be carried out by standard DNA synthesis techniques.
In another embodiment, the AS3 expression vector is a yeast expression vector.
Examples of vectors for expression in yeast S. cerivisae include pYepSecl
(Baldari, et al.,
(1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-
943),
pJRY88 (Schultz et al., (1987) Gene 54:113-123), pYES2 (Invitrogen
Corporation, San
Diego, CA), and picZ (InVitrogen Corp, San Diego, CA).
Alternatively, AS3 proteins can be expressed in insect cells using baculovirus
expression vectors. Baculovirus vectors available for expression of proteins
in cultured
insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al. (1983)
Mol. Cell Biol.
3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-
39).
In yet another embodiment, a nucleic acid of the invention is expressed in
mammalian cells using a mammalian expression vector. Examples of mammalian
expression vectors include pCDM8 (Seed, B. (1987) Nature 329:840) and pMT2PC
(Kaufman et al. (1987) EMBO J. 6:187-195). When used in mammalian cells, the
expression
vector's control functions are often provided by viral regulatory elements.
For example,
commonly used promoters are derived from polyoma, Adenovirus 2,
cytomegalovirus and
Simian Virus 40. For other suitable expression systems for both prokaryotic
and eukaryotic
cells see chapters 16 and 17 of Sambrook, J., Fritsh, E. F., and Maniatis, T.
Molecular
Cloning.' A Laboratory Manual. 2nd, ed , Cold Spring Harbor Laboratory, Cold
Spring
Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
In another embodiment, the recombinant mammalian expression vector is capable
of
directing expression of the nucleic acid preferentially in a particular cell
type (e.g., tissue-
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-41 -
specific regulatory elements are used to express the nucleic acid). Tissue-
specific regulatory
elements are known in the art. Non-limiting examples of suitable tissue-
specific promoters
include the prostate specific promoter (Gotoh et al. ( 1998) J. Urol. 60:220-
229) albumin
promoter (liver-specific; Pinkert et al. (1987) Genes Dev. 1:268-277),
lymphoid-specific
promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular
promoters of
T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and
immunoglobulins
(Banerji et al. (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-
748),
neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle
(1989)
Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas-specific promoters (Edlund
et al.
(1985) Science 230:912-916), and mammary gland-specific promoters (e.g., milk
whey
promoter; U.S. Patent No. 4,873,316 and European Application Publication No.
264,166).
Developmentally-regulated promoters are also encompassed, for example the
murine hox
promoters (Kessel and Gruss (1990) Science 249:374-379) and the a,-fetoprotein
promoter
(Campes and Tilghman (1989) Genes Dev. 3:537-546).
The invention further provides a recombinant expression vector comprising a
DNA
molecule of the invention cloned into the expression vector in an antisense
orientation. That
is, the DNA molecule is operatively linked to a regulatory sequence in a
manner which
allows for expression (by transcription of the DNA molecule) of an RNA
molecule which is
antisense to AS3 mRNA. Regulatory sequences operatively linked to a nucleic
acid cloned
in the antisense orientation can be chosen which direct the continuous
expression of the
antisense RNA molecule in a variety of cell types, for instance viral
promoters and/or
enhancers, or regulatory sequences can be chosen which direct constitutive,
tissue specific or
cell type specific expression of antisense RNA. The antisense expression
vector can be in
the form of a recombinant plasmid, phagemid or attenuated virus in which
antisense nucleic
acids are produced under the control of a high efficiency regulatory region,
the activity of
which can be determined by the cell type into which the vector is introduced.
For a
discussion of the regulation of gene expression using antisense genes see
Weintraub, H. et
al:, Antisense RNA as a molecular tool for genetic analysis, Reviews - Trends
in Genetics,
Vol. 1(1) 1986.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
- 42 -
V. Host Cells
Another aspect of the invention pertains to host cells into which an AS3
nucleic acid
molecule of the invention is introduced, e.g., an AS3 nucleic acid molecule
within a
recombinant expression vector or an AS3 nucleic acid molecule containing
sequences which
allow it to homologously recombine into a specific site of the host cell's
genome. The terms
"host cell" and "recombinant host cell" are used interchangeably herein. It is
understood
that such terms refer not only to the particular subject cell but to the
progeny or potential
progeny of such a cell. Because certain modifications may occur in succeeding
generations
due to either mutation or environmental influences, such progeny may not, in
fact, be
identical to the parent cell, but are still included within the scope of the
term as used herein.
A host cell can be any prokaryotic or eukaryotic cell. For example, an AS3
protein
can be expressed in bacterial cells such as E. coli, insect cells, yeast or
mammalian cells
(such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host
cells are
known to those skilled in the art.
Vector DNA can be introduced into prokaryotic or eukaryotic cells via
conventional
transformation or transfection techniques. As used herein, the terms
"transformation" and
"transfection" are intended to refer to a variety of art-recognized techniques
for introducing
foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate
or calcium
chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or
electroporation. Suitable methods for transforming or transfecting host cells
can be found in
Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold
Spring Harbor
Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY,
1989), and
other laboratory manuals.
For stable transfection of mammalian cells, it is known that, depending upon
the
expression vector and transfection technique used, only a small fraction of
cells may
integrate the foreign DNA into their genome. In order to identify and select
these integrants,
a gene that encodes a selectable marker (e.g., resistance to antibiotics) is
generally
introduced into the host cells along with the gene of interest. Preferred
selectable markers
include those which confer resistance to drugs, such as 6418, hygromycin and
methotrexate.
Nucleic acid encoding a selectable marker can be introduced into a host cell
on the same
vector as that encoding an AS3 protein or can be introduced on a separate
vector. Cells
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
- 43 -
stably transfected with the introduced nucleic acid can be identified by drug
selection (e.g.,
cells that have incorporated the selectable marker gene will survive, while
the other cells
die).
A host cell of the invention, such as a prokaryotic or eukaryotic host cell in
culture,
can be used to produce (i.e., express) an AS3 protein. Accordingly, the
invention further
provides methods for producing an AS3 protein using the host cells of the
invention. In one
embodiment, the method comprises culturing the host cell of the invention
(into which a
recombinant expression vector encoding an AS3 protein has been introduced) in
a suitable
medium such that an AS3 protein is produced. In another embodiment, the method
further
comprises isolating an AS3 protein from the medium or the host cell.
VI. Transgenic Animals
The host cells of the invention can also be used to produce non-human
transgenic
animals. For example, in one embodiment, a host cell of the invention is a
fertilized oocyte
or an embryonic stem cell into which AS3-coding sequences have been
introduced. Such
host cells can then be used to create non-human transgenic animals in which
exogenous AS3
sequences have been introduced into their genome or homologous recombinant
animals in
which endogenous AS3 sequences have been altered. Such animals are useful for
studying
the function and/or activity of an AS3 and for identifying and/or evaluating
modulators of
AS3 activity. As used herein, a "transgenic animal" is a non-human animal,
preferably a
mammal, more preferably a rodent such as a rat or mouse, in which one or more
of the cells
of the animal includes a transgene. Other examples of transgenic animals
include non-
human primates, sheep, dogs, cows, goats, chickens, amphibians, and the like.
A transgene
is exogenous DNA which is integrated into the genome of a cell from which a
transgenic
animal develops and which remains in the genome of the mature animal, thereby
directing
the expression of an encoded gene product in one or more cell types or tissues
of the
transgenic animal. As used herein, a "homologous recombinant animal" is a non-
human
animal, preferably a mammal, more preferably a mouse, in which an endogenous
AS3 gene
has been altered by homologous recombination between the endogenous gene and
an
exogenous DNA molecule introduced into a cell of the animal, e.g., an
embryonic cell of the
animal, prior to development of the animal.
CA 02363605 2001-08-23
WO 00/50454 PCT/OS00/04732 -
-44-
A transgenic animal of the invention can be created by introducing an AS3-
encoding
nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by
microinjection, retroviral
infection, and allowing the oocyte to develop in a pseudopregnant female
foster animal. The
AS3 cDNA sequence of SEQ ID NO:1 can be introduced as a transgene into the
genome of
a non-human animal. Alternatively, a nonhuman homologue of a human AS3 gene,
such as
a mouse or rat AS3 gene, can be used as a transgene. Alternatively, an AS3
gene
homologue, such as another AS3 family member, can be isolated based on
hybridization to
the AS3 cDNA sequences of SEQ ID NO:1 or 3 (described further in subsection I
above)
and used as a transgene. Intronic sequences and polyadenylation signals can
also be
included in the transgene to increase the efficiency of expression of the
transgene. A tissue-
specific regulatory sequences) can be operably linked to an AS3 transgene to
direct
expression of an AS3 protein to particular cells. Methods for generating
transgenic animals
via embryo manipulation and microinjection, particularly animals such as mice,
have
become conventional in the art and are described, for example, in U.S. Patent
Nos.
4,736,866 and 4,870,009, both by Leder et al., U.S. Patent No. 4,873,191 by
Wagner et al.
and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor
Laboratory Press,
Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of
other
transgenic animals. A transgenic founder animal can be identified based upon
the presence
of an AS3 transgene in its genome and/or expression of AS3 mRNA in tissues or
cells of the
animals. A transgenic founder animal can then be used to breed additional
animals carrying
the transgene. Moreover, transgenic animals carrying a transgene encoding an
AS3 protein
can further be bred to other transgenic animals carrying other transgenes.
To create a homologous recombinant animal, a vector is prepared which contains
at
least a portion of an AS3 gene into which a deletion, addition or substitution
has been
introduced to thereby alter, e.g., functionally disrupt, the AS3 gene. The AS3
gene can be a
human gene (e.g., the cDNA of SEQ ID N0:3), but more preferably, is a non-
human
homologue of a human AS3 gene (e.g., a cDNA isolated by stringent
hybridization with the
nucleotide sequence of SEQ ID NO:1 ). For example, a mouse AS3 gene can be
used to
construct a homologous recombination nucleic acid molecule, e.g., a vector,
suitable for
altering an endogenous AS3 gene in the mouse genome. In a preferred
embodiment, the
homologous recombination nucleic acid molecule is designed such that, upon
homologous
WO 00/50454 PCT/US00/04732
- 45 -
recombination, the endogenous AS3 gene is functionally disrupted (i.e., no
longer encodes a
functional protein; also referred to as a "knock out" vector). Alternatively,
the homologous
recombination nucleic acid molecule can be designed such that, upon homologous
recombination, the endogenous AS3 gene is mutated or otherwise altered but
still encodes
functional protein (e.g., the upstream regulatory region can be altered to
thereby alter the
expression of the endogenous AS3 protein). In the homologous recombination
nucleic acid
molecule, the altered portion of the AS3 gene is flanked at its 5' and 3' ends
by additional
nucleic acid sequence of the AS3 gene to allow for homologous recombination to
occur
between the exogenous AS3 gene carried by the homologous recombination nucleic
acid
molecule and an endogenous AS3 gene in a cell, e.g., an embryonic stem cell.
The
additional flanking AS3 nucleic acid sequence is of sufficient length for
successful
homologous recombination with the endogenous gene. Typically, several
kilobases of
flanking DNA (both at the 5' and 3' ends) are included in the homologous
recombination
nucleic acid molecule (see, e.g., Thomas, K.R. and Capecchi, M. R. (1987) Cell
51:503 for a
description of homologous recombination vectors). The homologous recombination
nucleic
acid molecule is introduced into a cell, e.g., an embryonic stem cell line
(e.g., by
electroporation) and cells in which the introduced AS3 gene has homologously
recombined
with the endogenous AS3 gene are selected (see e.g., Li, E. et al. (1992) Cell
69:915). The
selected cells can then injected into a blastocyst of an animal (e.g., a
mouse) to form
aggregation chimeras (see e.g., Bradley, A. in Teratocarcinomas and Embryonic
Stem Cells:
A Practical Approach, E.J. Robertson, ed. (IRL, Oxford, 1987) pp. 113-152). A
chimeric
embryo can then be implanted into a suitable pseudopregnant female foster
animal and the
embryo brought to term. Progeny harboring the homologously recombined DNA in
their
germ cells can be used to breed animals in which all cells of the animal
contain the
homologously recombined DNA by germline transmission of the transgene. Methods
for
constructing homologous recombination nucleic acid molecules, e.g., vectors,
or
homologous recombinant animals are described further in Bradley, A. (1991)
Current
Opinion in Biotechnology 2:823-829 and in PCT International Publication Nos.:
WO
90/11354 by Le Mouellec et al.; WO 91/01140 by Smithies et al.; WO 92/0968 by
Zijlstra et
al.; and WO 93/04169 by Berns et al.
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-46-
In another embodiment, transgenic non-humans animals can be produced which
contain selected systems which allow for regulated expression of the
transgene. One
example of such a system is the crelloxP recombinase system of bacteriophage
P1. For a
description of the c~elloxP recombinase system, see, e.g., Lakso et al. (1992)
Proc. Natl.
Acad. Sci. USA 89:6232-6236. Another example of a recombinase system is the
FLP
recombinase system of Saccharomyces cerevisiae (O'Gorman et al. ( 1991 )
Science
251:1351-1355. If a crelloxP recombinase system is used to regulate expression
of the
transgene, animals containing transgenes encoding both the Cre recombinase and
a selected
protein are required. Such animals can be provided through the construction of
"double"
transgenic animals, e.g., by mating two transgenic animals, one containing a
transgene
encoding a selected protein and the other containing a transgene encoding a
recombinase.
Clones of the non-human transgenic animals described herein can also be
produced
according to the methods described in Wilmut, I. et al. (1997) Nature 385:810-
813 and PCT
International Publication Nos. WO 97/07668 and WO 97/07669. In brief, a cell,
e.g., a
somatic cell, from the transgenic animal can be isolated and induced to exit
the growth cycle
and enter Go phase. The quiescent cell can then be fused, e.g., through the
use of electrical
pulses, to an enucleated oocyte from an animal of the same species from which
the quiescent
cell is isolated. The reconstructed oocyte is then cultured such that it
develops to morula or
blastocyte and then transferred to pseudopregnant female foster animal. The
offspring borne
of this female foster animal will be a clone of the animal from which the
cell, e.g., the
somatic cell, is isolated.
VII. Pharmaceutical Compositions
The AS3 nucleic acid molecules, fragments of AS3 proteins, and anti-AS3
antibodies (also referred to herein as "active compounds") of the invention
can be
incorporated into pharmaceutical compositions suitable for administration.
Such
compositions typically comprise the nucleic acid molecule, protein, or
antibody and a
pharmaceutically acceptable carrier. As used herein the language
"pharmaceutically
acceptable carrier" is intended to include any and all solvents, dispersion
media, coatings,
antibacterial and antifungal agents, isotonic and absorption delaying agents,
and the like,
compatible with pharmaceutical administration. The use of such media and
agents for
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
_47_
pharmaceutically active substances is well known in the art. Except insofar as
any
conventional media or agent is incompatible with the active compound, use
thereof in the
compositions is contemplated. Supplementary active compounds can also be
incorporated
into the compositions.
A pharmaceutical composition of the invention is formulated to be compatible
with
its intended route of administration. Examples of routes of administration
include
parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g.,
inhalation), transdermal
(topical), transmucosal, and rectal administration. Solutions or suspensions
used for
parenteral, intradermal, or subcutaneous application can include the following
components:
a sterile diluent such as water for injection, saline solution, fixed oils,
polyethylene glycols,
glycerine, propylene glycol or other synthetic solvents; antibacterial agents
such as benzyl
alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium
bisulfate; chelating
agents such as ethylenediaminetetraacetic acid; buffers such as acetates,
citrates or
phosphates and agents for the adjustment of tonicity such as sodium chloride
or dextrose.
pH can be adjusted with acids or bases, such as hydrochloric acid or sodium
hydroxide. The
parenteral preparation can be enclosed in ampoules, disposable syringes or
multiple dose
vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile
aqueous
solutions (where water soluble) or dispersions and sterile powders for the
extemporaneous
preparation of sterile injectable solutions or dispersion. For intravenous
administration,
suitable carriers include physiological saline, bacteriostatic water,
Cremophor ELTM (BASF,
Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the
composition must be
sterile and should be fluid to the extent that easy syringability exists. It
must be stable under
the conditions of manufacture and storage and must be preserved against the
contaminating
action of microorganisms such as bacteria and fungi. The carrier can be a
solvent or
dispersion medium containing, for example, water, ethanol, polyol (for
example, glycerol,
propylene glycol, and liquid polyetheylene glycol, and the like), and suitable
mixtures
thereof. The proper fluidity can be maintained, for example, by the use of a
coating such as
lecithin, by the maintenance of the required particle size in the case of
dispersion and by the
use of surfactants. Prevention of the action of microorganisms can be achieved
by various
antibacterial and antifungal agents, for example, parabens, chlorobutanol,
phenol, ascorbic
WO 00/50454 PCT/US00/04732 -
- 48 -
acid, thimerosal, and the like. In many cases, it will be preferable to
include isotonic agents,
for example, sugaxs, polyalcohols such as manitol, sorbitol, sodium chloride
in the
composition. Prolonged absorption of the injectable compositions can be
brought about by
including in the composition an agent which delays absorption, for example,
aluminum
monostearate and gelatin.
Sterile injectable solutions can be prepared by incorporating the active
compound
(e.g., a fragment of an AS3 protein or an anti-AS3 antibody) in the required
amount in an
appropriate solvent with one or a combination of ingredients enumerated above,
as required,
followed by filtered sterilization. Generally, dispersions are prepared by
incorporating the
active compound into a sterile vehicle which contains a basic dispersion
medium and the
required other ingredients from those enumerated above. In the case of sterile
powders for
the preparation of sterile injectable solutions, the preferred methods of
preparation are
vacuum drying and freeze-drying which yields a powder of the active ingredient
plus any
additional desired ingredient from a previously sterile-filtered solution
thereof.
Oral compositions generally include an inert diluent or an edible carrier.
They can
be enclosed in gelatin capsules or compressed into tablets. For the purpose of
oral
therapeutic administration, the active compound can be incorporated with
excipients and
used in the form of tablets, troches, or capsules. oral compositions can also
be prepared
using a fluid carrier for use as a mouthwash, wherein the compound in the
fluid carrier is
applied orally and swished and expectorated or swallowed. Pharmaceutically
compatible
binding agents, and/or adjuvant materials can be included as part of the
composition. The
tablets, pills, capsules, troches and the like can contain any of the
following ingredients, or
compounds of a similar nature: a binder such as microcrystalline cellulose,
gum tragacanth
or gelatin; an excipient such as starch or lactose, a disintegrating agent
such as alginic acid,
Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes;
a glidant such
as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin;
or a flavoring
agent such as peppermint, methyl salicylate, or orange flavoring.
For administration by inhalation, the compounds are delivered in the form of
an
aerosol spray from pressured container or dispenser which contains a suitable
propellant,
e.g., a gas such as carbon dioxide, or a nebulizer.
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-49-
Systemic administration can also be by transmucosal or transdermal means. For
transmucosal or transdermal administration, penetrants appropriate to the
barrier to.be
permeated are used in the formulation. Such penetrants are generally known in
the art, and
include, for example, for transmucosal administration, detergents, bile salts,
and fusidic acid
derivatives. Transmucosal administration can be accomplished through the use
of nasal
sprays or suppositories. For transdermal administration, the active compounds
are
formulated into ointments, salves, gels, or creams as generally known in the
art.
The compounds can also be prepared in the form of suppositories (e.g., with
conventional suppository bases such as cocoa butter and other glycerides) or
retention
enemas for rectal delivery.
In one embodiment, the active compounds are prepared with carriers that will
protect
the compound against rapid elimination from the body, such as a controlled
release
formulation, including implants and microencapsulated delivery systems.
Biodegradable,
biocompatible polymers can be used, such as ethylene vinyl acetate,
polyanhydrides,
polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for
preparation of
such formulations will be apparent to those skilled in the art. The materials
can also be
obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
Liposomal
suspensions (including liposomes targeted to infected cells with monoclonal
antibodies to
viral antigens) can also be used as pharmaceutically acceptable carriers.
These can be
prepared according to methods known to those skilled in the art, for example,
as described in
U.S. Patent No. 4,522,811.
It is especially advantageous to formulate oral or parenteral compositions in
dosage
unit form for ease of administration and uniformity of dosage. Dosage unit
form as used
herein refers to physically discrete units suited as unitary dosages for the
subject to be
treated; each unit containing a predetermined quantity of active compound
calculated to
produce the desired therapeutic effect in association with the required
pharmaceutical
carrier. The specification for the dosage unit forms of the invention are
dictated by and
directly dependent on the unique characteristics of the active compound and
the particular
therapeutic effect to be achieved, and the limitations inherent in the art of
compounding such
an active compound for the treatment of individuals.
WO 00/50454 PCT/US00/04732
-50-
Toxicity and therapeutic efficacy of such compounds can be determined by
standard
pharmaceutical procedures in cell cultures or experimental animals, e.g., for
determining the
LD50 (the dose lethal to 50% of the population) and the ED50 (the dose
therapeutically
effective in 50% of the population). The dose ratio between toxic and
therapeutic effects is
the therapeutic index and it can be expressed as the ratio LD50/ED50.
Compounds which
exhibit large therapeutic indices are preferred. While compounds that exhibit
toxic side
effects may be used, care should be taken to design a delivery system that
targets such
compounds to the site of affected tissue in order to minimize potential damage
to uninfected
cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used
in
formulating a range of dosage for use in humans. The dosage of such compounds
lies
preferably within a range of circulating concentrations that include the ED50
with little or
no toxicity. The dosage may vary within this range depending upon the dosage
form
employed and the route of administration utilized. For any compound used in
the method of
the invention, the therapeutically effective dose can be estimated initially
from cell culture
assays. A dose may be formulated in animal models to achieve a circulating
plasma
concentration range that includes the IC50 (i.e., the concentration of the
test compound
which achieves a half maximal inhibition of symptoms) as determined in cell
culture. Such
information can be used to more accurately determine useful doses in humans.
Levels in
plasma may be measured, for example, by high performance liquid
chromatography.
VIII. Gene Therapy
The nucleic acid molecules of the invention can be inserted into vectors and
used as
gene therapy vectors. Gene therapy vectors can be delivered to a subject by,
for example,
intravenous injection, local administration (see U.S. Patent 5,328,470) or by
stereotactic
injection (see e.g., Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91:3054-
3057). The
pharmaceutical preparation of the gene therapy vector can include the gene
therapy vector in
an acceptable diluent, or can comprise a slow release matrix in which the gene
delivery
vehicle is imbedded. Alternatively, where the complete gene delivery vector
can be
produced intact from recombinant cells, e.g., retroviral vectors, the
pharmaceutical
preparation can include one or more cells which produce the gene delivery
system.
CA 02363605 2001-08-23
Wb 00/50454 PCT/US00/04732 -
-51-
The pharmaceutical compositions can be included in a container, pack, or
dispenser
together with instructions for administration.
IX. Uses and Methods of the Invention
The nucleic acid molecules, proteins, protein homologues, and antibodies
described
herein can be used in one or more of the following methods: a) screening
assays; b)
predictive medicine (e.g., diagnostic assays, prognostic assays, monitoring
clinical trials,
and pharmacogenetics); and c) methods of treatment (e.g., therapeutic and
prophylactic). As
described herein, an AS3 protein of the invention modulates the arrest of cell
proliferation,
preferably hormone-mediated cell proliferation.
Thus, the isolated nucleic acid molecules of the invention can be used, for
example,
to express AS3 protein (e.g., via a recombinant expression vector in a host
cell in gene
therapy applications), to detect AS3 mRNA (e.g., in a biological sample) or a
genetic
alteration in an AS3 gene, and to modulate AS3 activity, as described further
below. The
AS3 nucleic acid molecules can be used to treat disorders characterized by
insufficient
production of AS3. The AS3 proteins can be used to screen for naturally
occurring AS3
substrates, to screen for drugs or compounds which modulate AS3 activity, as
well as to
treat disorders characterized by insufficient production of AS3 protein or
production of AS3
protein forms which have decreased, aberrant or unwanted activity compared to
AS3 wild
type protein (e.g., excessive cell proliferation). Moreover, the anti-AS3
antibodies of the
invention can be used to detect and isolate AS3 proteins, regulate the
bioavailability of AS3
proteins, and modulate AS3 activity.
IX, A, Screening Assays
The invention provides a method (also referred to herein as a "screening
assay") for
identifying modulators, i.e., candidate or test compounds or agents (e.g.,
peptides,
peptidomimetics, small molecules or other drugs) which bind to AS3 proteins,
have a
stimulatory or inhibitory effect on, for example, AS3 expression or AS3
activity, or have a
stimulatory or inhibitory effect on, for example, the expression or activity
of AS3 substrate.
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-52-
In one embodiment, the invention provides assays for screening candidate or
test
compounds which are substrates of an AS3 protein or polypeptide or
biologically active
portion thereof. In another embodiment, the invention provides assays for
screening
candidate or test compounds which bind to or modulate the activity of an AS3
protein or
polypeptide or biologically active portion thereof. The test compounds of the
present
invention can be obtained using any of the numerous approaches in
combinatorial library
methods known in the art, including: biological libraries; spatially
addressable parallel solid
phase or solution phase libraries; synthetic library methods requiring
deconvolution; the
'one-bead one-compound' library method; and synthetic library methods using
affinity
chromatography selection. The biological library approach is limited to
peptide libraries,
while the other four approaches are applicable to peptide, non-peptide
oligomer or small
molecule libraries of compounds (Lam, K.S. (1997) Anticancer Drug Des.
12:145).
Examples of methods for the synthesis of molecular libraries can be found in
the art,
for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909;
Erb et al.
(1994) Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994). J. Mecl
Chem.
37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew.
Chem. Int. Ed.
Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and
in Gallop et
al. (1994) J. Med. Chem. 37:1233.
Libraries of compounds may be presented in solution (e.g., Houghten (1992)
Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips
(Fodor
(1993) Nature 364:555-556), bacteria (Ladner USP 5,223,409), spores (Ladner
USP '409),
plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89:1865-1869) or on phage
(Scott and
Smith (1990) Science 249:386-390); (Devlin (1990) Science 249:404-406);
(Cwirla et al.
(1990) Proc. Natl. Acad. Sci. 87:6378-6382); (Felici (1991) J. Mol. Biol.
222:301-310);
(Ladner supra. ).
In one embodiment, an assay is a cell-based assay in which a cell which
expresses an
AS3 protein or biologically active portion thereof is contacted with a test
compound and the
ability of the test compound to modulate AS3 activity is determined.
Determining the
ability of the test compound to modulate AS3 activity can be determined by
monitoring, for
example, changes in cell using standard techniques.
WO 00/50454 PCT/US00/04732 -
-53-
In another embodiment, an assay of the present invention is a cell-free assay
in
which an AS3 protein or biologically active portion thereof is contacted with
a test
compound and the ability of the.test compound to bind to the AS3 protein or
biologically
active portion thereof is determined. Preferred biologically active portions
of the AS3
proteins to be used in assays of the present invention include fragments which
participate in
interactions with non-AS3 molecules, e.g., fragments with high surface
probability scores
(see, for example, Figure 2). Binding of the test compound to the AS3 protein
can be
determined either directly or indirectly as described above. In a preferred
embodiment, the
assay includes contacting the AS3 protein or biologically active portion
thereof with a
known compound which binds AS3 to form an assay mixture, contacting the assay
mixture
with a test compound, and determining the ability of the test compound to
interact with an
AS3 protein, wherein determining the ability of the test compound to interact
with an AS3
protein comprises determining the ability of the test compound to
preferentially bind to AS3
or biologically active portion thereof as compared to the known compound.
In yet another embodiment, the cell-free assay involves contacting an AS3
protein or
biologically active portion thereof with a known compound which binds the AS3
protein to
form an assay mixture, contacting the assay mixture with a test compound, and
determining
the ability of the test compound to interact with the AS3 protein, wherein
determining the
ability of the test compound to interact with the AS3 protein comprises
determining the
ability of the AS3 protein to preferentially bind to or modulate the activity
of an AS3 target
molecule.
In more than one embodiment of the above assay methods of the present
invention, it
may be desirable to immobilize AS3 to facilitate separation of proteins that
interact with
AS3, as well as to accommodate automation of the assay. Binding of a test
compound to an
AS3 protein, or interaction of an AS3 protein with a target molecule in the
presence and
absence of a candidate compound, can be accomplished in any vessel suitable
for containing
the reactants. Examples of such vessels include microtitre plates, test tubes,
and micro-
centrifuge tubes. In one embodiment, a fusion protein can be provided which
adds a domain
that allows one or both of the proteins to be bound to a matrix. For example,
glutathione-S-
transferase/ AS3 fusion proteins or glutathione-S-transferase/target fusion
proteins can be
adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, MO) or
glutathione
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-54-
derivatized microtitre plates, which are then combined with the test compound
or the test
compound and either the non-adsorbed target protein or AS3 protein, and the
mixture
incubated under conditions conducive to complex formation (e.g., at
physiological
conditions for salt and pH). Following incubation, the beads or microtitre
plate wells are
washed to remove any unbound components, the matrix immobilized in the case of
beads,
complex determined either directly or indirectly, for example, as described
above.
Alternatively, the complexes can be dissociated from the matrix, and the level
of AS3
binding or activity determined using standard techniques.
Other techniques for immobilizing proteins on matrices can also be used in the
screening assays of the invention. For example, either an AS3 protein or an
AS3 target
molecule can be immobilized utilizing conjugation of biotin and streptavidin.
Biotinylated
AS3 protein or target molecules can be prepared from biotin-NHS (N-hydroxy-
succinimide)
using techniques known in the art (e.g., biotinylation kit, Pierce Chemicals,
Rockford, IL),
and immobilized in the wells of streptavidin-coated 96 well plates (Pierce
Chemical).
Alternatively, antibodies reactive with AS3 protein or target molecules but
which do not
interfere with binding of the AS3 protein to its target molecule can be
derivatized to the
wells of the plate, and unbound target or AS3 protein trapped in the wells by
antibody
conjugation. Methods for detecting such complexes, in addition to those
described above
for the GST-immobilized complexes, include immunodetection of complexes using
antibodies reactive with the AS3 protein or target molecule, as well as enzyme-
linked assays
which rely on detecting an enzymatic activity associated with the AS3 protein
or target
molecule.
In another embodiment, modulators of AS3 expression are identified in a method
wherein a cell is contacted with a candidate compound and the expression of
AS3 mRNA or
protein in the cell is determined. The level of expression of AS3 mRNA or
protein in the
presence of the candidate compound is compared to the level of expression of
AS3 mRNA
or protein in the absence of the candidate compound. The candidate compound
can then be
identified as a modulator of AS3 expression based on this comparison. For
example, when
expression of AS3 mRNA or protein is greater (statistically significantly
greater) in the
presence of the candidate compound than in its absence, the candidate compound
is
identified as a stimulator of AS3 mRNA or protein expression. Alternatively,
when
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-55-
expression of AS3 mRNA or protein is less (statistically significantly less)
in the presence of
the candidate compound than in its absence, the candidate compound is
identified as an
inhibitor of AS3 mRNA or protein expression. This assay may be further
modified to
include the presence of a hormone, e.g., an androgen or an anti-androgen. The
level of AS3
mRNA or protein expression in the cells can be determined by methods described
herein for
detecting AS3 mRNA or protein.
In yet another aspect of the invention, the AS3 proteins can be used as "bait
proteins"
in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Patent No.
5,283,317; Zervos et
al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-
12054; Bartel et
al. (1993) Biotechniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693-
1696; and
Brent W094/10300), to identify other proteins, which bind to or interact with
AS3 ("AS3-
binding proteins" or "AS3-by") and are involved in AS3 activity. Such AS3-
binding
proteins are also likely to be involved in the propagation of signals by the
AS3 proteins or
AS3 targets as, for example, downstream elements of an AS3-mediated signaling
pathway.
Alternatively, such AS3-binding proteins are likely to be AS3 inhibitors.
The two-hybrid system is based on the modular nature of most transcription
factors,
which consist of separable DNA-binding and activation domains. Briefly, the
assay utilizes
two different DNA constructs. In one construct, the gene that codes for an AS3
protein is
fused to a gene encoding the DNA binding domain of a known transcription
factor (e.g.,
GAL-4). In the other construct, a DNA sequence, from a library of DNA
sequences, that
encodes an unidentified protein ("prey" or "sample") is fused to a gene that
codes for the
activation domain of the known transcription factor. If the "bait" and the
"prey" proteins are
able to interact, in vivo, forming an AS3-dependent complex, the DNA-binding
and
activation domains of the transcription factor are brought into close
proximity. This
proximity allows transcription of a reporter gene (e.g., LacZ) which is
operably linked to a
transcriptional regulatory site responsive to the transcription factor.
Expression of the
reporter gene can be detected and cell colonies containing the functional
transcription factor
can be isolated and used to obtain the cloned gene which encodes the protein
which interacts
with the AS3 protein.
In another aspect, the invention pertains to a combination of two or more of
the
assays described herein. For example, a modulating agent can be identified
using a cell-
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-56-
based or a cell free assay, and the ability of the agent to modulate the
activity of an AS3
protein can be confirmed in vivo, e.g., in an animal such as an animal model
for pain.
This invention further pertains to novel agents identified by the above-
described
screening assays. Accordingly, it is within the scope of this invention to
further use an agent
identified as described herein in an appropriate animal model. For example, an
agent
identified as described herein (e.g., an AS3 modulating agent, an antisense
AS3 nucleic acid
molecule, an AS3-specific antibody, or an AS3-binding partner) can be used in
an animal
model to determine the efficacy, toxicity, or side effects of treatment with
such an agent.
Alternatively, an agent identified as described herein can be used in an
animal model to
determine the mechanism of action of such an agent. Furthermore, this
invention pertains to
uses of novel agents identified by the above-described screening assays for
treatments as
described herein.
IX, B, Detection Assays
Portions or fragments of the cDNA sequences identified herein (and the
corresponding complete gene sequences) can be used in numerous ways as
polynucleotide
reagents. For example, these sequences can be used to: (i) map their
respective genes on a
chromosome; and, thus, locate gene regions associated with genetic disease;
(ii) identify an
individual from a minute biological sample (tissue typing); and (iii) aid in
forensic
identification of a biological sample. These applications are described in the
subsections
below.
IX, B, 1., Chromosome Mapping
Once the sequence (or a portion of the sequence) of a gene has been isolated,
this
sequence can be used to map the location of the gene on a chromosome. This
process is
called chromosome mapping. Accordingly, portions or fragments of the AS3
nucleotide
sequences, described herein, can be used to map the location of the AS3 genes
on a
chromosome as described in Example 4. The mapping of the AS3 sequences to
chromosomes is an important step in correlating these sequences with genes
associated with
disease.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-57-
Moreover, differences in the DNA sequences between individuals affected and
unaffected with a disease associated with the AS3 gene, can be determined. If
a mutation is
observed in some or all of the affected individuals but not in any unaffected
individuals,
then the mutation is likely to be the causative agent of the particular
disease. Comparison of
affected and unaffected individuals generally involves first looking for
structural alterations
in the chromosomes, such as deletions or translocations that are visible from
chromosome
spreads or detectable using PCR based on that DNA sequence. Ultimately,
complete
sequencing of genes from several individuals can be performed to confirm the
presence of a
mutation and to distinguish mutations from polymorphisms.
IX, B, 2., Tissue Typing
The AS3 sequences of the present invention can also be used to identify
individuals
from minute biological samples. The United States military, for example, is
considering the
use of restriction fragment length polymorphism (RFLP) for identification of
its personnel.
In this technique, an individual's genomic DNA is digested with one or more
restriction
enzymes, and probed on a Southern blot to yield unique bands for
identification. This
method does not suffer from the current limitations of "Dog Tags" which can be
lost,
switched, or stolen, making positive identification difficult. The sequences
of the present
invention are useful as additional DNA markers for RFLP (described in U.S.
Patent
5,272,057).
Furthermore, the sequences of the present invention can be used to provide an
alternative technique which determines the actual base-by-base DNA sequence of
selected
portions of an individual's genome. Thus, the AS3 nucleotide sequences
described herein
can be used to prepare two PCR primers from the 5' and 3' ends of the
sequences. These
primers can then be used to amplify an individual's DNA and subsequently
sequence it.
Panels of corresponding DNA sequences from individuals, prepared in this
manner,
can provide unique individual identifications, as each individual will have a
unique set of
such DNA sequences due to allelic differences. The sequences of the present
invention can
be used to obtain such identification sequences from individuals and from
tissue. The AS3
nucleotide sequences of the invention uniquely represent portions of the human
genome.
Allelic variation occurs to some degree in the coding regions of these
sequences, and to a
WO 00/50454 PCT/US00/04732
-58-
greater degree in the noncoding regions. It is estimated that allelic
variation between
individual humans occurs with a frequency of about once per each 500 bases.
Each of the
sequences described herein can,.to some degree, be used as a standard against
which DNA
from an individual can be compared for identification purposes. Because
greater numbers of
polymorphisms occur in the noncoding regions, fewer sequences are necessary to
differentiate individuals. The noncoding sequences of SEQ ID NO: l can
comfortably
provide positive individual identification with a panel of perhaps 10 to 1,000
primers which
each yield a noncoding amplified sequence of 100 bases. If predicted coding
sequences,
such as those in SEQ ID N0:3 are used, a more appropriate number of primers
for positive
individual identification would be 500-2,000.
If a panel of reagents from AS3 nucleotide sequences described herein is used
to
generate a unique identification database for an individual, those same
reagents can later be
used to identify tissue from that individual. Using the unique identification
database,
positive identification of the individual, living or dead, can be made from
extremely small
tissue samples.
IX, B, 3., Use of Partial AS3 Sequences in Forensic Biology
DNA-based identification techniques can also be used in forensic biology.
Forensic
biology is a scientific field employing genetic typing of biological evidence
found at a crime
scene as a means for positively identifying, for example, a perpetrator of a
crime. To make
such an identification, PCR technology can be used to amplify DNA sequences
taken from
very small biological samples such as tissues, e.g., hair or skin, or body
fluids, e.g., blood,
saliva, or semen found at a crime scene. The amplified sequence can then be
compared to a
standard, thereby allowing identification of the origin of the biological
sample..
The sequences of the present invention can be used to provide polynucleotide
reagents, e.g., PCR primers, targeted to specific loci in the human genome,
which can
enhance the reliability of DNA-based forensic identifications by, for example,
providing
another "identification marker" (i.e. another DNA sequence that is unique to a
particular
individual). As mentioned above, actual base sequence information can be used
for
identification as an accurate alternative to patterns formed by restriction
enzyme generated
fragments. Sequences targeted to noncoding regions of SEQ ID NO:1 are
particularly
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-59-
appropriate for this use as greater numbers of polymorphisms occur in the
noncoding
regions, making it easier to differentiate individuals using this technique.
Examples of
polynucleotide reagents include.the AS3 nucleotide sequences or portions
thereof, e.g.,
fragments derived from the noncoding regions of SEQ ID NO:1 having a length of
at least
20 bases, preferably at least 30 bases.
The AS3 nucleotide sequences described herein can further be used to provide
polynucleotide reagents, e.g., labeled or labelable probes which can be used
in, for example,
an in situ hybridization technique, to identify a specific tissue, e.g., brain
tissue. This can be
very useful in cases where a forensic pathologist is presented with a tissue
of unknown
origin. Panels of such AS3 probes can be used to identify tissue by species
and/or by organ
type.
In a similar fashion, these reagents, e.g., AS3 primers or probes can be used
to screen
tissue culture for contamination (i.e. screen for the presence of a mixture of
different types
of cells in a culture).
IX, C, Predictive Medicine
The present invention also pertains to the field of predictive medicine in
which
diagnostic assays, prognostic assays, and monitoring clinical trials are used
for prognostic
(predictive) purposes to thereby treat an individual prophylactically.
Accordingly, one
aspect of the present invention.relates to diagnostic assays for determining
AS3 protein
and/or nucleic acid expression as well as AS3 activity, in the context of a
biological sample
(e.g., blood, serum, cells, tissue) to thereby determine whether an individual
is afflicted with
a disease or disorder, or is at risk of developing a disorder, associated with
aberrant or
reduced AS3 expression or activity. The invention also provides for prognostic
(or
predictive) assays for determining whether an individual is at risk of
developing a disorder
associated with AS3 protein, nucleic acid expression or activity. For example,
mutations in
an AS3 gene can be assayed in a biological sample. Such assays can be used for
prognostic
or predictive purpose to thereby prophylactically treat an individual prior to
the onset of a
disorder characterized by or associated with AS3 protein, nucleic acid
expression, or
activity.
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-60-
Another aspect of the invention pertains to monitoring the influence of agents
(e.g.,
drugs, compounds) on the expression or activity of AS3 in clinical trials.
These and other agents are described in further detail in the following
sections and in
Examples 4 and 5.
IX, C, 1., Diagnostic Assays
An exemplary method for detecting the presence or absence of AS3 protein or
nucleic acid in a biological sample involves obtaining a biological sample
from a test subject
and contacting the biological sample with a compound or an agent capable of
detecting AS3
protein or nucleic acid (e.g., mRNA, genomic DNA) that encodes AS3 protein
such that the
presence of AS3 protein or nucleic acid is detected in the biological sample.
A preferred
agent for detecting AS3 mRNA or genomic DNA is a labeled nucleic acid probe
capable of
hybridizing to AS3 mRNA or genomic DNA. The nucleic acid probe can be, for
example, a
full-length AS3 nucleic acid, such as the nucleic acid of SEQ ID NO:1 or 3, or
a portion
thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500
nucleotides in
length and sufficient to specifically hybridize under stringent conditions to
AS3 mRNA or
genomic DNA. Other suitable probes for use in the diagnostic assays of the
invention are
described herein.
A preferred agent for detecting AS3 protein is an antibody capable of binding
to AS3
protein, preferably an antibody with a detectable label. Antibodies can be
polyclonal, or
more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g.,
Fab or
F(ab')2) can be used. The term "labeled", with regard to the probe or
antibody, is intended
to encompass direct labeling of the probe or antibody by coupling (i.e.,
physically linking) a
detectable substance to the probe or antibody, as well as indirect labeling of
the probe or
antibody by reactivity with another reagent that is directly labeled. Examples
of indirect
labeling include detection of a primary antibody using a fluorescently labeled
secondary
antibody and end-labeling of a DNA probe with biotin such that it can be
detected with
fluorescently labeled streptavidin. The term "biological sample" is intended
to include
tissues, cells and biological fluids isolated from a subject, as well as
tissues, cells and fluids
present within a subject. That is, the detection method of the invention can
be used to detect
AS3 mRNA, protein, or genomic DNA in a biological sample in vitro as well as
in vivo. For
WO 00/50454 PCT/US00/04732
-61 -
example, in vitro techniques for detection of AS3 mRNA include Northern
hybridizations
and in situ hybridizations. In vitro techniques for detection of AS3 protein
include enzyme
linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and
immunofluorescence. In vitro techniques for detection of AS3 genomic DNA
include
Southern hybridizations.
In one embodiment, the biological sample contains protein molecules from the
test
subject. Alternatively, the biological sample can contain mRNA molecules from
the test
subject or genomic DNA molecules from the test subject. A preferred biological
sample is a
tissue or cell sample isolated by conventional means from a subject.
In another embodiment, the methods further involve obtaining a control
biological
sample from a control subject, contacting the control sample with a compound
or agent
capable of detecting AS3 protein, mRNA, or genomic DNA, such that the presence
of AS3
protein, mRNA or genomic DNA is detected in the biological sample, and
comparing the
presence of AS3 protein, mRNA or genomic DNA in the control sample with the
presence
of AS3 protein, mRNA or genomic DNA in the test sample.
The invention also encompasses kits for detecting the presence of AS3 in a
biological sample. For example, the kit can comprise a labeled compound or
agent capable
of detecting AS3 protein or mRNA in a biological sample; means for determining
the
amount of AS3 in the sample; and means for comparing the amount of AS3 in the
sample
with a standard. The compound or agent can be packaged in a suitable
container. The kit
can further comprise instructions for using the kit to detect AS3 protein or
nucleic acid.
IX, C, 2., Prognostic Assays
The diagnostic methods described herein can furthermore be utilized to
identify
subjects having or at risk of developing a disease or disorder associated with
aberrant AS3
expression or activity. As used herein, the term "aberrant" includes an AS3
expression or
activity which deviates from the wild type AS3 expression or activity.
Aberrant expression
or activity includes increased or decreased expression or activity, as well as
expression or
activity which does not follow the wild type developmental pattern of
expression or the
subcellular pattern of expression. For example, aberrant AS3 expression or
activity is
intended to include the cases in which a mutation in the AS3 gene causes the
AS3 gene to be
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-62-
under-expressed or over-expressed and situations in which such mutations
result in a non-
functional AS3 protein or a protein which does not function in a wild-type
fashion, e.g., a
protein which does not interact with an AS3 ligand or one which interacts with
a non-AS3
ligand.
The assays described herein, such as the preceding diagnostic assays or the
following
assays, can be utilized to identify a subject having or at risk of developing
a malignancy
associated with a misregulation in AS3 protein activity or nucleic acid
expression, such as a
prostate cancer. Thus, the present invention provides a method for identifying
a disease or
disorder associated with aberrant AS3 expression or activity in which a test
sample is
obtained from a subject and AS3 protein or nucleic acid (e.g., mRNA or genomic
DNA) is
detected, wherein the presence of AS3 protein or nucleic acid is diagnostic
for a subject
having or at risk of developing a disease or disorder associated with aberrant
or unwanted
AS3 expression or activity. As used herein, a "test sample" refers to a
biological sample
obtained from a subject of interest. For example, a test sample can be a cell,
tissue, or
biological fluid containing a cell.
Furthermore, the prognostic assays described herein can be used to determine
whether a subject can be administered an agent (e.g., an agonist, antagonist,
peptidomimetic,
protein, peptide, nucleic acid, small molecule, or other drug candidate, such
as a hormone,
e.g., an androgen) to treat a disease or disorder associated with aberrant AS3
expression or
activity. For example, such methods can be used to determine whether a subject
can be
effectively treated with an agent for aberrant cell proliferation, e.g.,
cancer of the prostate.
The methods of the invention can also be used to detect genetic alterations in
an AS3
gene, thereby determining if a subject with the altered gene is at risk for a
disorder
characterized by misregulation in AS3 protein activity or nucleic acid
expression, such as a
proliferative disorder, e.g., cancer. In preferred embodiments, the methods
include
detecting, in a sample of cells from the subject, the presence or absence of a
genetic
alteration characterized by at least one of an alteration affecting the
integrity of a gene
encoding an AS3-protein, or the mis-expression of the AS3 gene. For example,
such genetic
alterations can be detected by ascertaining the existence of at least one of 1
) a deletion of
one or more nucleotides from an AS3 gene; 2) an addition of one or more
nucleotides to an
AS3 gene; 3) a substitution of one or more nucleotides of an AS3 gene, 4) a
chromosomal
WO 00/50454 PCT/US00/04732 -
- 63 -
rearrangement of an AS3 gene; 5) an alteration in the level of a messenger RNA
transcript of
an AS3 gene, 6) aberrant modification of an AS3 gene, such as of the
methylation pattern of
the genomic DNA, 7) the presence of a non-wild type splicing pattern of a
messenger RNA
transcript of an AS3 gene, 8) a non-wild type level of an AS3-protein, 9)
allelic loss of an
AS3 gene, and 10) inappropriate post-translational modification of an AS3-
protein. As
described herein, there are a large number of assays known in the art which
can be used for
detecting alterations in an AS3 gene. A preferred biological sample is a cell,
tissue, or
biological fluid containing a cell, isolated by conventional means from a
subject.
In certain embodiments, detection of the alteration involves the use of a
probe/primer
in a polymerase chain reaction (PCR) (see, e.g., U.S. Patent Nos. 4,683,195
and 4,683,202),
such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain
reaction (LCR) (see,
e.g., Landegran et al. (1988) Science 241:1077-1080; and Nakazawa et al.
(1994) Proc. Natl.
Acad. Sci. USA 91:360-364), the latter of which can be particularly useful for
detecting point
mutations in the AS3-gene (see Abravaya et al. (1995) Nucleic Acids Re.s
.23:675-682).
This method can include the steps of collecting a sample of cells from a
subject. isolating
nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample.
contacting the
nucleic acid sample with one or more primers which specifically hybridize to
an AS3 gene
under conditions such that hybridization and amplification of the AS3-gene (if
present)
occurs, and detecting the presence or absence of an amplification product, or
detecting the
size of the amplification product and comparing the length to a control
sample. It is
anticipated that PCR and/or LCR may be desirable to use as a preliminary
amplification step
in conjunction with any of the techniques used for detecting mutations
described herein.
Alternative amplification methods include: self sustained sequence replication
(Guatelli, J.C. et al., (1990) Proc. Natl. Acad Sci. USA 87:1874-1878),
transcriptional
amplification system (Kwoh, D.Y. et al., (1989) Proc. Natl. Acad. Sci. USA
86:1173-1177),
Q-Beta Replicase (Lizardi, P.M. et al. (1988) Bio-Technology 6:1197), or any
other nucleic
acid amplification method, followed by the detection of the amplified
molecules using
techniques well known to those of skill in the art. These detection schemes
are especially
useful for the detection of nucleic acid molecules if such molecules are
present in very low
numbers.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-64-
In an alternative embodiment, mutations in an AS3 gene from a sample cell can
be
identified by alterations in restriction enzyme cleavage patterns. For
example, sample and
control DNA is isolated, amplified (optionally), digested with one or more
restriction
endonucleases, and fragment length sizes are determined by gel electrophoresis
and
compared. Differences in fragment length sizes between sample and control DNA
indicates
mutations in the sample DNA. Moreover, the use of sequence specific ribozymes
(see, for
example, U.S. Patent No. 5,498,531) can be used to score for the presence of
specific
mutations by development or loss of a ribozyme cleavage site.
In other embodiments, genetic mutations in AS3 can be identified by
hybridizing a
sample and control nucleic acids, e.g., DNA or RNA, to high density arrays
containing
hundreds or thousands of oligonucleotides probes (Cronin, M.T. et al. (1996)
Human
Mutation 7: 244-255; Kozal, M.J. et al. (1996) Nature Medicine 2: 753-759).
For example,
genetic mutations in AS3 can be identified in two dimensional arrays
containing light-
generated DNA probes as described in Cronin, M.T. et al. supra. Briefly, a
first
hybridization array of probes can be used to scan through long stretches of
DNA in a sample
and control to identify base changes between the sequences by making linear
arrays of
sequential overlapping probes. This step allows the identification of point
mutations. This
step is followed by a second hybridization array that allows the
characterization of specific
mutations by using smaller, specialized probe arrays complementary to all
variants or
mutations detected. Each mutation array is composed of parallel probe sets,
one
complementary to the wild-type gene and the other complementary to the mutant
gene.
In yet another embodiment, any of a variety of sequencing reactions known in
the art
can be used to directly sequence the AS3 gene and detect mutations by
comparing the
sequence of the sample AS3 with the corresponding wild-type (control)
sequence.
Examples of sequencing reactions include those based on techniques developed
by Maxam
and Gilbert ((1977) Proc. Natl. Acad. Sci. USA 74:560) or Sanger ((1977) Proc.
Natl. Acad.
Sci. USA 74:5463). It is also contemplated that any of a variety of automated
sequencing
procedures can be utilized when performing the diagnostic assays ((1995)
Biotechniques
19:448), including sequencing by mass spectrometry (see, e.g., PCT
International
Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36:127-162;
and
Griffin et al. (1993) Appl. Biochem. Biotechnol. 38:147-159).
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-65-
Other methods for detecting mutations in the AS3 gene include methods in which
protection from cleavage agents is used to detect mismatched bases in RNA/RNA
or
RNA/DNA heteroduplexes (Myers et al. (1985) Science 230:1242). In general, the
art
technique of "mismatch cleavage" starts by providing heteroduplexes of formed
by
hybridizing (labeled) RNA or DNA containing the wild-type AS3 sequence with
potentially
mutant RNA or DNA obtained from a tissue sample. The double-stranded duplexes
are
treated with an agent which cleaves single-stranded regions of the duplex such
as which will
exist due to basepair mismatches between the control and sample strands. For
instance,
RNA/DNA duplexes can be treated with RNAse and DNNDNA hybrids treated with S 1
nuclease to enzymatically digesting the mismatched regions. In other
embodiments, either
DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium
tetroxide
and with piperidine in order to digest mismatched regions. After digestion of
the
mismatched regions, the resulting material is then separated by size on
denaturing
polyacrylamide gels to determine the site of mutation. See, for example,
Cotton et al.
1S (1988) Proc. Natl Acad Sci USA 85:4397; Saleeba et al. (1992) Methods
Enzymol. 217:286
295. In a preferred embodiment, the control DNA or RNA can be labeled for
detection.
In still another embodiment, the mismatch cleavage reaction employs one or
more
proteins that recognize mismatched base pairs in double-stranded DNA (so
called "DNA
mismatch repair" enzymes) in defined systems for detecting and mapping point
mutations in
AS3 cDNAs obtained from samples of cells. For example, the mutt enzyme of E.
coli
cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells
cleaves
T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662). According
to an
exemplary embodiment, a probe based on an AS3 sequence, e.g., a wild-type AS3
sequence, is hybridized to a cDNA or other DNA product from a test cell(s).
The duplex is
treated with a DNA mismatch repair enzyme, and the cleavage products, if any,
can be
detected from electrophoresis protocols or the like. See, for example, U.S.
Patent No.
5,459,039.
In other embodiments, alterations in electrophoretic mobility will be used to
identify
mutations in AS3 genes. For example, single strand conformation polymorphism
(SSCP)
may be used to detect differences in electrophoretic mobility between mutant
and wild type
nucleic acids (Orita et al. (1989) Proc Natl. Acad. Sci USA: 86:2766, see also
Cotton (1993)
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-66-
Mutat. Res. 285:125-144; and Hayashi (1992) Genet. Anal. Tech. Appl. 9:73-79).
Single-
stranded DNA fragments of sample and control AS3 nucleic acids will be
denatured and
allowed to renature. The secondary structure of single-stranded nucleic acids
varies
according to sequence, the resulting alteration in electrophoretic mobility
enables the
detection of even a single base change. The DNA fragments may be labeled or
detected
with labeled probes. The sensitivity of the assay may be enhanced by using RNA
(rather
than DNA), in which the secondary structure is more sensitive to a change in
sequence. In a
preferred embodiment; the subject method utilizes heteroduplex analysis to
separate double
stranded heteroduplex molecules on the basis of changes in electrophoretic
mobility (Keen
et al. (1991) Trends Genet 7:5).
In yet another embodiment the movement of mutant or wild-type fragments in
polyacrylamide gels containing a gradient of denaturant is assayed using
denaturing gradient
gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313:495). When DGGE is
used as
the method of analysis, DNA will be modified to insure that it does not
completely denature,
for example by adding a GC clamp of approximately 40 by of high-melting GC-
rich DNA
by PCR. In a further embodiment, a temperature gradient is used in place of a
denaturing
gradient to identify differences in the mobility of control and sample DNA
(Rosenbaum and
Reissner (1987) Biophys Chem 265:12753).
Examples of other techniques for detecting point mutations include, but are
not
limited to, selective oligonucleotide hybridization, selective amplification,
or selective
primer extension. For example, oligonucleotide primers may be prepared in
which the
known mutation is placed centrally and then hybridized to target DNA under
conditions
which permit hybridization only if a perfect match is found (Saiki et al.
(1986) Nature
324:163); Saiki et al. (1989) Proc. Natl Acad. Sci USA 86:6230). Such allele
specific
oligonucleotides are hybridized to PCR amplified target DNA or a number of
different
mutations when the oligonucleotides are attached to the hybridizing membrane
and
hybridized with labeled target DNA.
Alternatively, allele specific amplification technology which depends on
selective
PCR amplification may be used in conjunction with the instant invention.
Oligonucleotides
used as primers for specific amplification may carry the mutation of interest
in the center of
the molecule (so that amplification depends on differential hybridization)
(Gibbs et al. ( 1989)
CA 02363605 2001-08-23
W~ 00/50454 PCT/US00/04732 -
-67-
Nucleic Acids Res. 17:2437-2448) or at the extreme 3' end of one primer where,
under
appropriate conditions, mismatch can prevent, or reduce polymerase extension
(Prossner
(1993) Tibtech 11:238). In addition it may be desirable to introduce a novel
restriction site in
the region of the mutation to create cleavage-based detection (Gasparini et
al. ( 1992) Mol.
Cell Probes 6:1 ). It is anticipated that in certain embodiments amplification
may also be
performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad.
Sci USA
88:189). In such cases, ligation will occur only if there is a perfect match
at the 3' end of the
5' sequence making it possible to detect the presence of a known mutation at a
specific site by
looking for the presence or absence of amplification.
The methods described herein may be performed, for example, by utilizing pre-
packaged diagnostic kits comprising at least one probe nucleic acid or
antibody reagent
described herein, which may be conveniently used, e.g., in clinical settings
to diagnose
patients exhibiting symptoms or family history of a disease or illness
involving an AS3
gene.
Furthermore, any cell type or tissue in which AS3 is expressed, e.g., prostate
tissue,
may be utilized in the prognostic assays described herein.
IX, C, 3., Monitoring of Effects During Clinical Trials
Monitoring the influence of agents (e.g., hormone therapy) on the expression
or
activity of an AS3 protein (e.g., the modulation of cell proliferation) can be
applied not only
in basic drug screening, but also in clinical trials. For example, the
effectiveness of an agent
determined by a screening assay as described herein to increase AS3 gene
expression,
protein levels, or upregulate AS3 activity, can be monitored in clinical
trials of subjects
exhibiting decreased AS3 gene expression, protein levels, or downregulated AS3
activity.
Alternatively, the effectiveness of an agent determined by a screening assay
to decrease AS3
gene expression, protein levels, or downregulate AS3 activity, can be
monitored in clinical
trials of subjects exhibiting increased AS3 gene expression, protein levels,
or upregulated
AS3 activity. In such clinical trials, the expression or activity of an AS3
gene, and
preferably, other genes (e.g., prostate-specific antigen (PSA)) that have been
implicated in,
for example, an AS3-associated disorder can be used as a "read out" or markers
of the
phenotype of a particular cell.
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-68-
For example, and not by way of limitation, genes, including AS3, that are
modulated
in cells by treatment with an agent (e.g., compound, drug or hormone) which
modulates AS3
activity (e.g., identified in a screening assay as described herein) can be
identified. Thus, to
study the effect of agents on cell proliferation modulated by AS3, for
example, in a clinical
trial, cells can be isolated and RNA prepared and analyzed for the levels of
expression of
AS3 and other genes implicated in the AS3-associated disorder. The levels of
gene
expression (e.g., a gene expression pattern) can be quantified by northern
blot analysis or
RT-PCR, as described herein; or alternatively by measuring the amount of
protein produced,
by one of the methods as described herein, or by measuring the levels of
activity of AS3 or
other genes. In this way, the gene expression pattern can serve as a marker,
indicative of the
physiological response of the cells to the agent. Accordingly, this response
state may be
determined before, and at various points during treatment of the individual
with the agent or
may be used to determine when treatment is appropriate.
In a preferred embodiment, the present invention provides a method for
monitoring
the effectiveness of treatment of a subject with an agent (e.g., an agonist,
antagonist,
peptidomimetic, protein, peptide, nucleic acid. small molecule, or other drug
candidate, e.g.,
a hormone, identified by the screening assays described herein) including the
steps of (i)
obtaining a pre-administration sample from a subject prior to administration
of the agent; (ii)
detecting the level of expression of an AS3 protein, mRNA, or genomic DNA in
the
preadministration sample; (iii) obtaining one or more post-administration
samples from the
subject; (iv) detecting the level of expression or activity of the AS3
protein, mRNA, or
genomic DNA in the post-administration samples; (v) comparing the level of
expression or
activity of the AS3 protein, mRNA, or genomic DNA in the pre-administration
sample with
the AS3 protein, mRNA, or genomic DNA in the post administration sample or
samples;
and (vi) altering the administration of the agent to the subject accordingly.
For example,
increased administration of the agent may be desirable to increase the
expression or activity
of AS3 to higher levels than detected, i.e., to increase the effectiveness of
the agent.
Alternatively, decreased administration of the agent may be desirable to
decrease expression
or activity of AS3 to lower levels than detected, i.e. to decrease the
effectiveness of the
agent. According to such an embodiment, AS3 expression or activity may be used
as an
WO 00/50454 PCT/US00/04732
-69-
indicator of the effectiveness of an agent, even in the absence of an
observable phenotypic
response.
IX, D., Methods of Treatment
The present invention provides for both prophylactic and therapeutic methods
of
treating a subject at risk of (or susceptible to) a disorder or having a
disorder associated with
aberrant AS3 expression or activity. With regards to both prophylactic and
therapeutic
methods of treatment, such treatments may be specifically tailored or
modified, based on
knowledge obtained from the field of pharmacogenomics. "Pharmacogenomics", as
used
herein, refers to the application of genomics technologies such as gene
sequencing,
statistical genetics, and gene expression analysis to drugs in clinical
development and on the
market. More specifically, the term refers to the study of how a patient's
genes determine
his or her response to a drug (e.g., a patient's "drug response phenotype", or
"drug response
genotype".) Thus, another aspect of the invention provides methods for
tailoring an
individual's prophylactic or therapeutic treatment with either the AS3
molecules of the
present invention or AS3 modulators according to that individual's drug
response genotype.
Pharmacogenomics allows a clinician or physician to target prophylactic or
therapeutic
treatments to patients who will most benefit from the treatment and to avoid
treatment of
patients who will experience toxic drug-related side effects.
IX, D., 1., Prophylactic Methods
In one aspect, the invention provides a method for preventing in a subject, a
disease
or condition associated with an aberrant AS3 expression or activity, by
administering to the
subject an AS3 molecule or an agent which modulates AS3 expression or at least
AS3
activity. Subjects at risk for a disease (e.g., prostate cancer) which is
caused or contributed
to by aberrant AS3 expression or activity can be identified by, for example,
any or a
combination of diagnostic or prognostic assays as described herein.
Administration of a
prophylactic agent can occur prior to the manifestation of symptoms
characteristic of the
AS3 aberrancy, such that a disease or disorder is prevented or, alternatively,
delayed in its
progression. Depending on the type of AS3 aberrancy, for example, an AS3
molecule, AS3
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-70-
agonist (e.g., hormone therapy), or AS3 antagonist agent can be used for
treating the subject.
The appropriate agent can be determined based on screening assays described
herein.
IX, D., 2., Therapeutic Methods
Another aspect of the invention pertains to methods of modulating AS3
expression
or activity for therapeutic purposes. Accordingly, in an exemplary embodiment,
the
modulatory method of the invention involves contacting a cell with an AS3
molecule or
agent that modulates AS3 protein activity associated with cell (e.g., cell
proliferation). An
agent that modulates AS3 protein activity can be an agent as described herein,
such as a
nucleic acid or a protein, a naturally-occurring target molecule of an AS3
protein (e.g., an
AS3 substrate), an AS3 antibody, an AS3 agonist or antagonist, a
peptidomimetic of an AS3
agonist or antagonist, or other small molecule (e.g., hormone, such as an
androgen). In one
embodiment, the agent stimulates one or more AS3 activities. Examples of such
stimulatory
agents include androgen therapy or a nucleic acid molecule encoding AS3 that
has been
introduced into the cell. These modulatory methods can be performed in vitro
(e.g., by
culturing the cell with the agent) or, alternatively, in vivo (e.g., by
administering the agent to
a subject). As such, the present invention provides methods of treating an
individual
afflicted with a cell proliferative disease (e.g., prostate cancer) or
disorder characterized by
aberrant or reduced expression or activity of an AS3 protein or nucleic acid
molecule. In
one embodiment, the method involves administering an agent (e.g., an agent
identified by a
screening assay or a hormone such as androgen as described herein), or
combination of
agents that modulates AS3 expression or activity.
Stimulation of AS3 activity is desirable in situations in which AS3 is
abnormally
downregulated and/or in which increased AS3 activity is likely to have a
beneficial effect.
For example, stimulation of AS3 activity is desirable in a cell proliferative
disease such as
prostate cancer and increasing AS3 activity is likely to have a beneficial
effect. Moreover,
the ability to detect androgen-induced AS3 expression in a patient is an
indication that the
patient is responsive to hormone and therefore a candidate for intermittent
hormone therapy.
As used herein, the term "intermittent hormone therapy" or "intermittent
hormone
treatment" includes a treatment regime wherein a patient is treated with a
hormone, such as
an androgen, for a period of time and then withdrawn from such treatment for a
period of
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-71 -
time. This intermittent administration of hormone shall be, at least in part,
determined by an
analysis of the patients AS3 levels as described herein.
IX, D, 3., Pharmacogenomics
The AS3 molecules of the present invention, as well as agents, or modulators
which
have a stimulatory or inhibitory effect on AS3 activity (e.g., AS3 gene
expression) as
identified by a screening assay described herein can be administered to
individuals to treat
(prophylactically or therapeutically) AS3-associated disorders (e.g., cell
proliferation)
associated with aberrant or reduced AS3 activity. In conjunction with such
treatment,
pharmacogenomics (i.e., the study of the relationship between an individual's
genotype and
that individual's response to a foreign compound or drug) may be considered.
Differences in
metabolism of therapeutics can lead to severe toxicity or therapeutic failure
by altering the
relation between dose and blood concentration of the pharmacologically active
drug. Thus,
a physician or clinician may consider applying knowledge obtained in relevant
1 ~ pharmacogenomics studies in determining whether to administer an AS3
molecule or AS3
modulator as well as tailoring the dosage and/or therapeutic regimen of
treatment with an
AS3 molecule or AS3 modulator.
Pharmacogenomics deals with clinically significant hereditary variations in
the
response to drugs due to altered drug disposition and abnormal action in
affected persons.
See, for example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol. Physiol.
23(10-11)
:983-985 and Linder, M.W. et al. (1997) Clin. Chem. 43(2):254-266. In general,
two types
of pharmacogenetic conditions can be differentiated. Genetic conditions
transmitted as a
single factor altering the way drugs act on the body (altered drug action) or
genetic
conditions transmitted as single factors altering the way the body acts on
drugs (altered drug
metabolism). These pharmacogenetic conditions can occur either as rare genetic
defects or
as naturally-occurring polymorphisms. For example, glucose-6-phosphate
dehydrogenase
deficiency (G6PD) is a common inherited enzymopathy in which the main clinical
complication is haemolysis after ingestion of oxidant drugs (anti-malarials,
sulfonamides,
analgesics, nitrofurans) and consumption of fava beans.
One pharmacogenomics approach to identifying genes that predict drug response,
known as "a genome-wide association", relies primarily on a high-resolution
map of the
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-72-
human genome consisting of already known gene-related markers (e.g., a "bi-
allelic" gene
marker map which consists of 60,000-100,000 polymorphic or variable sites on
the human
genome, each of which has two.variants.) Such a high-resolution genetic map
can be
compared to a map of the genome of each of a statistically significant number
of patients
taking part in a Phase II/III drug trial to identify markers associated with a
particular
observed drug response or side effect. Alternatively, such a high resolution
map can be
generated from a combination of some ten-million known single nucleotide
polymorphisms
(SNPs) in the human genome. As used herein, a "SNP" is a common alteration
that occurs
in a single nucleotide base in a stretch of DNA. For example, a SNP may occur
once per
every 1000 bases of DNA. A SNP may be involved in a disease process, however,
the vast
majority may not be disease-associated. Given a genetic map based on the
occurrence of
such SNPs, individuals can be grouped into genetic categories depending on a
particular
pattern of SNPs in their individual genome. In such a manner, treatment
regimens can be
tailored to groups of genetically similar individuals, taking into account
traits that may be
common among such genetically similar individuals.
Alternatively, a method termed the "candidate gene approach", can be utilized
to
identify genes that predict drug response. According to this method, if a gene
that encodes a
drugs target is known (e.g., an AS3 protein of the present invention), all
common variants of
that gene can be fairly easily identified in the population and it can be
determined if having
one version of the gene versus another is associated with a particular drug
response.
As an illustrative embodiment, the activity of drug metabolizing enzymes is a
major
determinant of both the intensity and duration of drug action. The discovery
of genetic
polymorphisms of drug metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT
2) and
cytochrome P450 enzymes CYP2D6 and CYP2C 19) has provided an explanation as to
why
some patients do not obtain the expected drug effects or show exaggerated drug
response
and serious toxicity after taking the standard and safe dose of a drug. These
polymorphisms
are expressed in two phenotypes in the population, the extensive metabolizer
(EM) and poor
metabolizer (PM). The prevalence of PM is different among different
populations. For
example, the gene coding for CYP2D6 is highly polymorphic and several
mutations have
been identified in PM, which all lead to the absence of functional CYP2D6.
Poor
metabolizers of CYP2D6 and CYP2C 19 quite frequently experience exaggerated
drug
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
- 73 -
response and side effects when they receive standard doses. If a metabolite is
the active
therapeutic moiety, PM show no therapeutic response, as demonstrated for the
analgesic
effect of codeine mediated by its CYP2D6-formed metabolite morphine. The other
extreme
are the so called ultra-rapid metabolizers who do not respond to standard
doses. Recently,
the molecular basis of ultra-rapid metabolism has been identified to be due to
CYP2D6 gene
amplification.
Alternatively, a method termed the "gene expression profiling", can be
utilized to
identify genes that predict drug response. For example, the gene expression of
an animal
dosed with a drug (e.g., an AS3 molecule or AS3 modulator of the present
invention) can
give an indication whether gene pathways related to toxicity have been turned
on.
Information generated from more than one of the above pharmacogenomics
approaches can be used to determine appropriate dosage and treatment regimens
for
prophylactic or therapeutic treatment an individual. This knowledge, when
applied to
dosing or drug selection, can avoid adverse reactions or therapeutic failure
and thus enhance
therapeutic or prophylactic efficiency when treating a subject with an AS3
molecule or AS3
modulator, such as a modulator identified by one of the exemplary screening
assays
described herein.
This invention is further illustrated by the following examples which should
not be
construed as limiting. The contents of all references, patents and published
patent
applications cited throughout this application are incorporated herein by
reference.
EXAMPLE 1.
ISOLATION AND CLONING OF HUMAN AS3
In this example, the isolation and cloning of the gene encoding human AS3 is
described.
To isolate a cDNA encoding an inhibitor of prostate cancer progression, the
LNCaP-
FGC cell line established from a metastatic lymph node from a patient with
prostate
adenocarcinoma (Horoszewicz et al., (1983) Cancer Res. 43:1809-1818) was
utilized. This
cell line and related cell lines derived therefrom were cultured as previously
described (Soto
et al., (1995) Oncology Res. 7: 545-558; Soto et al., (1991) J. Steroid
Biochem. 23: 87-94).
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-74-
In addition, to isolate a gene expressed at the proliferative shutoff point
(i.e., Step 2),
a subtractive strategy was used whereby the proliferation of LNCaP-FGC cells
was arrested
using two different treatments, namely, CD serum (i.e., androgen free serum)
and high
androgen concentrations. This selective approach takes advantage of the fact
that the cells
were equally arrested at the G1 stage of the cell cycle by different
mechanisms (Soto et al.,
(1995) Oncology Res. 7: 545-558).
Moreover, since regulatory mRNAs are frequently expressed at low copy numbers,
a
protocol was adopted using repeated PCR cycles to selectively amplify these
sequences.
The final subtracted pool, therefore, was enriched to represent high ranking
regulatory
elements in the androgen-induced proliferative shutoff (Step-2).
Briefly, androgen-specific, low-abundance regulatory mRNA sequences expressed
during the proliferative shutoff, were selected using the Wang-Brown approach
(Wang et
al., (1991) Proc. Natl. Acad. Sci. USA 88: 11505-11509). Short fragments of
cDNAs were
amplified first: then three cycles of subtractions and amplifications between
the control and
proliferation arrested cDNAs resulted in sequence pools that were
differentially expressed
(Geck et al., (1997) J. Steroid Biochem. Mol. Biol. 63: 211-218). LNCaP-FGC
cells were
treated with 30 nM 81881 to generate proliferative shutoff. 81881
(methyltrienolone) is a
synthetic, non-metabolized androgen (Roussell-UCLAF, Romainville, France).
Exposure to
androgen for 24 hours was required to commit LNCaP-FGC cells to an
irreversible
proliferative shutoff (Geck et al., (1997) J. Steroid Biochem. Mol. Biol. 63:
211-218). It was
concluded that at this point, the genes responsible for the shutoff were
highly induced.
LNCaP-FGC cells reversibly arrested by CDHuS were considered as the shutoff
negative
control; they were harvested after three days of CDHuS treatment. Total RNA
was prepared
by the acidic guanidinium-thiocyanate method and polyA+ RNA was purified by
using the
FastTrack kit (Invitrogen, San Diego, CA) (Chomczinsky et al., (1987) Anal.
Biochem. 162:
156-159).
Double-stranded cDNA pools from 81881-treated cells (R cDNA) and CDHuS-
treated cells (CD cDNA) were synthesized using the Copy Kit (Invitrogen), with
oligo-dT
priming. After Alul and Rsal digestions and adaptor ligations, the constructs
were PCR-
amplified (GeneAmp Kit, Perkin Elmer, Foster City, CA). The amplified CD cDNA
were
digested with Eco RI, photobiotinylated (driver cDNA) and hybridized at 20-
fold molar
WO 00/50454 PCT/US00/04732 -
-75-
excess to an aliquot of non-biotinylated R cDNA. The hybridized non-specific
sequences
were eliminated by subsequent Streptavidin chromatography. After 3 cycles of
selection,
the amplified expressed sequence tag (EST) pool of the androgen-induced
shutoff AS (R
cDNA pool minus CD cDNA pool) sequences was digested with EcoRl, cloned into
the
BlueScript SK vector (Stratagene, La Jolla, CA) and transformed into E. coli
(OneShot
strain, Invitrogen).
Isolation of unique cDNAs from the differentially expressed sequence pool was
performed as follows. Recombinants were collected randomly from the shutoff
positive AS
pool of the Wang-Brown differential library and were plated. Using the labeled
CD- and R-
subtracted (CD cDNA pool minus R cDNA pool), PCR-amplified DNA master mixes as
S
probes, double hybridizations revealed 11 and 14 clones that were present
exclusively in the
CD and R clone sets, respectively (Geck et al., (1997) J. Steroid Biochem.
Mol. Biol. 63:
211-218). Multiple cross-hybridizations identified ten unique inserts.
To sequence the identified EST fragments, PCR sequencing reactions were
performed using the dsDNA Sequencing System (Life Technologies, Gaithersburg,
MD).
The EST DNA sequences were tested for homology to known DNA sequences using
the
PASTA and BLAST (National Center for Biotechnology Information, Bethesda, MD)
programs. Five inserts were found with no match in GenBank (Geck et al.,
(1997) J. Steroid
Biochem. Mol. Biol. 63: 211-218;. For further analysis, the mRNA with the
highest
induction in shutoff positive LNCaP-FGC cells (AS3, >5-6-fold of the 5.3 kb
mRNA, and
>3-4-fold of the 8 kb isoform) was selected.
To isolate the full length AS3 cDNA sequence, a 262 by AS3 tag sequence was
utilized to design nested primer pairs to amplify the full length cDNA
sequence from a
cDNA library. The cDNA libraries were generated by Human Genome Sciences
(Rockville,
MD), using polyA+ mRNA preparations from androgen-treated or CDHuS-treated
proliferation-arrested LNCaP-FGC cells. The Lambda ZAPII (UniZAP) phage was
used as
vector carrying EcoRl and Xhol cloning sites. The PCR reaction was designed to
amplify
the cloned unknown cDNA segments between the known tag sequence and the
flanking
vector sequences. Since the orientation of the tag sequence was not known,
both ends of the
insert were amplified in both directions. The vector primers used were
commercially
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-76-
available sequencing primers: M 13 Reverse and T3 primers at the EcoRl site,
and M 13-20
and T7 primers at the Xhol site.
For the PCR reaction, the Expand High Fidelity kit was used and a 1 ~l phage
suspension as template (Boehringer-Mannheim). A 40 cycle amplification in a
Perkin-
Elmer 9600 thermocycler resulted in the production of a 1370 by 5' fragment
and a 3250 by
3' fragment. These PCR products were purified using Qiagen columns, and
sequenced by
automatic sequencing using a primer walking strategy. The sequencing data
showed that the
open reading frame in the 5'end fragment did not have an authentic AUG codon.
To search for the missing 5' end of the transcript, the Prostate Specific
Marathon
Ready cDNA preparation from Clontech was used. Amplifications with the
Clontech
anchored primer and a set of AS3 specific primers resulted in a 419 by
fragment. The DNA
was cloned and sequencing data showed that it carried the N-terminal 118 amino
acids of the
open reading frame. The nucleotide sequence reported herein has been submitted
to
GenBank under the accession number U95825 (see also Geck et al., (1999) J.
Steriod
Biochem. ~.Tol. Biol., 68:41-50).
EXAMPLE 2.
CHARACTERIZATION OF THE AS3 cDNA SEQUENCE
In this example, the features of the AS3 mRNA and cDNA sequences are
described.
Computer analysis of the sequenced 5253 by AS3 cDNA identified a long open
reading frame (Figure 1 ). The initiator methionine is at position 66, the
stop codon was
found at position 4239, and the region codes for a polypeptide of 1391
residues. 'the
initiator is the first AUG codon downstream from the 5' end of the sequence,
and appears in
a strong Kozak-context (Kozak, (1991) J. Biol. Chem. 266:19867-19870; Kozak,
(1991) J.
Cell Biol. 115:887-903). The Northern blot size of the transcript is between
5.3 and 5.5 kb
(Geck et al., (1997) J. Steroid Biochem. Mol. Biol. 63: 211-218) and since the
sequence
reported here has 5253 nucleotides plus the poly-A tail, the 5' end of our
sequence is at or
within a few nucleotides of the 5' physical end, further suggesting that the
initiator is
authentic. The 5' non-coding region is high in GC nucleotides (63.3 %), but it
has no
recognizable secondary structure elements or other sequence features. The 3'
noncoding
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-77-
region has several destabilizing AT-rich elements (underlined in Figure 1 ),
typical of
transcripts claimed to play a role in cell proliferation (Shaw et al., (1986)
Cell 46:659-667,
Chen et al., (1995) Trends Biochem. Sci. 20:465-470). The polyadenylation
signal of the
transcript is 25 by upstream of the consensus GT-rich cleavage site (indicated
in a larger
font in Figure 1 ).
EXAMPLE 3.
CHARACTERIZATION OF THE AS3 POLYPEPTIDE SEQUENCE
In this example, various structural and functional features of the AS3
polypeptide are
described.
Computer analysis of the AS3 open reading frame was performed using the
Translate
program of the Wisconsin Package Version 9.0, Genetics Computer Group (GCG),
Madison, Wisconsin. (3-strand and a-helix structures were calculated by the
Chou-Fasman
1 S method using PepStructure and PepPlot programs. Motif and profile
predictions were
calculated using various programs of the Wisconsin Package, or by using remote
servers
offering sequence analyses of protein functional domains through the Internet.
The
following remote servers were used: PROWEB (http://www.proweb.org); BLOCKS
(http://www.blocks.fhcrc.org); PRODOM (http://www.toulouse.inra.fr/prodom/);
PRINTS
(http://www.biochem.ucl.ac.uk/cgi-bin/attwood/) and the Protein Kinase
Resource
(http://www.sdsc.edu/Kinases/).
Employing the above programs, the expected molecular weight of the AS3
polypeptide is determined as 186 kD. In addition, it's noted that the N-
terminal 400 amino
acid domain is characterized by a unique arrangement of 31 aliphatic residues
(21 of them
are leucines). Every seventh position (with minor variations) is occupied by a
leucine or
similar hydrophobic residues and in the five subdomains shown in Figure 2, the
pattern is
uninterrupted. The arrangement is typical for coiled-coil structures where one
side of the
long a,-helices is hydrophobic and usually participates in protein-protein
interactions (Lupas,
(1996) Trends Biochem. Sci. 22:375-382; Beavil et al., (1992) Proc. Natl.
Acad. Sci. USA
89:753-757). The leucine-zipper motif of DNA binding proteins is a specific
subclass of
WO 00/50454 PCT/US00/04732 -
_78_
this general pattern and the subdomain between positions 196 and 217 in the
AS3 sequence
is a perfect leucine-zipper.
The AS3 polypeptide sequence between positions 400 and 600 has elements of a
conserved Mg-ATP binding domain of various nucleotide triphosphate binding
proteins
including protein kinases. In Figure 3, the AS3 sequence is shown in the
conserved
subdomain arrangements established by Hanks (Hanks et al. , ( 1991 ) Methods
Enzymol.
200:38-62). The conserved (3-strand, a,-helix structures and highly conserved
critical
residues are also indicated, together with the corresponding sequences of
various protein
kinases (Taylor et al., (1992) Annu. Rev. Cell Biol. 8:429-462). Although the
complete
AS3 sequence did not appear to be related to any particular protein kinase or
ATP binding
protein, partial homology within the subdomains was maintained, and probably
indicates
that the domain is functional. Indeed, one feature of the AS3 polypeptide is
the presence of
several relatively well conserved kinase -related domains such as an Mg-
nucleotide
triphosphate binding pocket, as well as elements of the catalytic domain of
several protein
kinases (see Figure 3). Functional analysis of this domain using GST-fusion
constructs
indicates that the fusion construct polypeptide can form a complex resulting
in the
phosphorylation of at least two substrate proteins found in LNCaP-FGC cell
extracts.
In addition to the above-mentioned motifs, the AS3 polypeptide also has a
functional
protein kinase domain located at amino acid residues 474-680 (encoded by
nucleic acids 1420-
2040; see SEQ ID NO: 3). To demonstrate that this region of the AS3
polypeptide has kinase
activity, and is, e.g., capable of phosphorylating cellular substrates, the
nucleic acid encoding
this region was PCR amplified (using a corresponding upstream primer with a
BamHI site and
a corresponding downstream primer with a EcoRI site), digested, purified, and
cloned into
BamHI sites of the bacterial GST-fusion vector pGEX-T2 thereby fusing the AS3
domain to
the C-terminus of GST (thus, the fusion protein is referred to as GST-AS3).
The resultant
construct, encoding a GST-AS3 fusion protein, was then transferred into
bacteria (BL21
protease minus host) which were then induced to express the GST-AS3 fusion
protein.
Bacterial extracts containing the GST/AS3 fusion protein were incubated with
MCF7-AR1 cell
extracts in the presence of 32P-ATP and chromatographed through glutathione-
Sepharose.
Proteins which specifically bound to the GST-AS3 fusion protein were resolved
by SDS-
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-79-
PAGE and autoradiography using standard conditions. Two polypeptides (40 and
120 kDa)
were specifically purified and phosphorylated by the AS3-GST fusion protein
demonstrating
the functional kinase activity of this protein kinase domain of AS3. There was
no 32P-labelled
band observed at 90 kDa (the mass of the AS3-GTS fusion protein) suggesting
that the AS3
kinase domain does not auto-phosphorylate but phosphorylates other proteins
through, e.g., a
docking mechanism.
Furthermore, a putative nuclear localization sequence (NLS)
(KKFTQVLEDDEKIRK) resembling that of the androgen receptor and DNA polymerase-
a was localized at position 547( Zhou et al., (1994) J. Biol. Chem. 269:13115-
13123;
Bouvier et al., (1995 Mol. Biol. Cell 6:1697-1705). Further, the C-terminal
region of the
putative AS3 polypeptide contains several sequence elements that show
similarities to DNA
binding proteins. Motifs and ProfileScan searches in the Wisconsin Package
indicated
helix-loop-helix and Homeo-box signature sequences in the area, and a remote
search on the
BLOCKS server also identified DNA binding block elements in the C-terminal
sequences.
Still further, it is noted a serine-rich domain at position 1139, and a
proline/glycine-rich
domain at the 1284 position were also found. The C-terminal domain (about 200
amino
acids) is highly charged and arranged in unique repeats of seven alternating
acidic and basic
domains.
A BLASTP search performed on the GenBank database resulted in a single high
score similarity with the bimD gene of the eukaryotic organism Aspergillus
nidulans, where
50% of the amino acid sequence was functionally similar in portions of the
coiled-coil
domain and the putative DNA binding domain at the C-terminus. The bimD protein
has a
basic leucine-zipper and a C-terminal charged (acidic) domain, similar to AS3,
and appears
to function as a DNA binding protein (benison et al., (1992) Genetics,
134:1085-1096).
Both the AS3 and the bimD proteins also have nuclear localization consensus
sequences.
Finally, to confirm that the AS3 polypeptide is capable of binding to DNA and
moreover, to elucidate a DNA motif that binds to the DNA recognition sequence
of AS3, an
AS3-GST fusion polypeptide containing the DNA recognition sequence of AS3 was
produced
using a similar approach as used above to assay AS3 kinase activity.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-80-
Briefly, an expression vector was engineered to encode the DNA binding domain
of
AS3 fused to the N-terminus of GST (thus, the fusion protein is referred to as
AS3-GST)
which, when expressed in bacteria, allowed for the production of an AS3-GST
fusion protein
for DNA binding studies. The AS3-GST protein was then purified by affinity
chromatography
as described above. Next, the resultant, purified AS3-GST protein was
incubated with a
mixture of oligonucleotides comprising constant 5' (25 bp) and 3' (25 bp) ends
and randomly
generated middle segments (18 bp) and chromatographed through a glutathione-
Sepharose the
column. To avoid non-specific binding, double stranded poly(dI-dC) (average
length 1800 bp)
was added to the mixture. The AS3-GST fusion protein, together with bound
oligonucleotides, was eluted with glutathione and the bound oligonucleotides
were amplified
by PCR, purified, and subjected to a second round of column chromatography
using AS3-GST
before being PCR amplified and cloned into a TA vector.
Thirty clones were sequenced to assess whether a specific nucleotide sequence
was
recognized by the AS3-GST fusion product. The sequences were compared and
analyzed by
the PILE-UP program of the GCG package. The co-alignment of the sequences
revealed a
pattern of the following putative consensus sequence:
5' C, T, A, [T/A], [T/A], A, G, [C/G], C, C, C, [C/G], G, C, [C/G]), C, A,
[A/T], 3' (SEQ ID
NU: 5)
Interestingly, sequence similarities were found between the putative AS3 DNA
recognition sequence and the NF-kappaB and the Mbpl recognition motifs. In
addition,
similarities within the p27~'" promoter at positions -270, -383, -427, and -
586 were also found
indicating that important gene regulatory elements exist in the cell in which
the AS3 protein
may interact with (Zhang et al., (1997) Biochem. Biophys. Acta., 1353:307-
317). Interestingly,
the transcription factor NF-kappaB, which is involved in the control of
apoptosis, and Mbpl
which is involved in the Gl-S cell cycle transition in yeast, also interact
with similar DNA
motifs (Waddick et al., (1999) Biochem. Pharmacol., 57:9-17; Koch et al.,
(1993) Science,
261:1551-1557).
Accordingly, it was concluded that AS3 is capable of binding to DNA in a
sequence
specific manner and therefore, may function as a transcriptional regulator of
genes involved in
cell growth control.
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-81 -
EXAMPLE 4.
THE AS3 GENOMIC LOCUS AND USE OF AS3 RELATED MOLECULES AS
MARKERS FOR DISEASE
In this example, aspects of the AS3 genomic locus and the use of AS3 related
molecules as markers for disease are described.
A computer homology search in GenBank was performed and identified the AS3
genomic region as residing on chromosome 13q12-q13. This area is represented
by cosmid
267p 19, and on P 1 artificial chromosomes PAC26H23 and PAC49J 10. Consensus
splicing
donor and acceptor sites were identified and the entire exon-intron structure
of the AS3 gene
was resolved comparing the cDNA sequence and the genomic sequence using the
BLAST
program (see Figure 4) (Shapiro et al., (1987) Nucl. Acids Res. 15:7155-7174).
The actual
cosmid and cDNA positions are listed in Figure 4, and the arrangement of exons
is depicted
in Figure 5. The area covers nearly 200,000 by and the average size of the
exons is 100-150
bp.
Interestingly, the AS3 genomic area is centromeric to the RB 1 locus, and
telomeric
to BRCA2. The AS3 gene is transcribed in the same direction as BRCA2, and the
coding
strand is downstream from the breast cancer gene (Couch et al., (1997]
Genomics
36:86-99). On the opposite strand upstream of AS3, three regions were assigned
to cDNAs
of unknown functions. An expressed sequence (CG008) has been assigned to this
area, and
represents a portion of the AS3 transcript (Couch et al., (1997) Genomics
36:86-99). The N
terminal 354 amino acids of the open reading frame are missing in the CG008
sequence in
GenBank. The CG008 open reading frame terminates at amino acid 738 of the AS3
sequence. The sequencing data reported herein and the published genomic
sequence are
identical, confirming the correct sequence of AS3. The extra C at nucleotide
position 1,109
in the CG008 sequence suggests a possible sequencing error that results in a
frame shift and
a stop codon at position 1,152 of the CG008 sequence.
With the above information in hand, it was observed that several
epidemiological studies support a link between breast and prostate cancers
implying shared
genetic suppressor elements in both disease states (Thiessen, (1974) Cancer
34:1102-1107;
Tulinius et al., (1992) Br. Med. J. 305:855-857). For example, studies of
breast cancer
families with high loss of heterogenicity (LOH) in the BRCA2 area showed that
high
W~ 00/50454 PCT/US00/04732 -
-82-
prostate cancer incidence also occurred in 4 out of 5 families examined
(Gudmundsson et
al., (1995) Cancer Res. 55:4830-4832). Further, in the majority of the male
relatives with
prostate cancer in these families (86%), allelic losses in the BRCA2 area were
also detected
with some of these mutations occurring in the region immediately downstream of
the
BRCA2 gene (Gudmundsson et al., (1995) Cancer Res. 55:4830-4832; Van den Berg
et al.,
(1996) Br. J. Cancer 74:1615-1619; Cleton-Jansen et al., (1995) Br. J. Cancer
72:1241-1244).
Moreover, it was noted that putative suppressors in the immediate vicinity of
BRCA2 are not only limited to sex hormone-related cancers. For example, recent
studies on
chronic lymphoid leukemia detected a 1 Mb allelic loss in this region, with no
mutations in
the BRCA2 gene, pointing to a cryptic suppressor next to this gene (Garcia-
Marco et al.,
(1996) Blood 88:1568-1575; Caldas et al., (1997) Proc. Am. Assoc. Cancer Res.
38:191).
As indicated herein, the coding sequence of AS3 lies within this area. Thus,
AS3 (or AS3-
related molecules) may be associated with a number of diseases and conditions
at several
different levels involving, e.g., genomic alterations (including deletions
and/or mutations at
the chromosomal level), altered transcription or transcript production, and/or
altered protein
or protein expression levels. Thus, "AS3 related molecules" include, nucleic
acid fragments
or probes derived from the AS3 genomic locus (or an AS3 cDNA), and AS3 or AS3
related
proteins or protein fragments.
In addition to foregoing, the ability to determine AS3 protein expression
levels, altered
AS3 proteins, and/or AS3 protein expression patterns in, for example,
different tissue samples
(such a biopsy sample from, e.g., the prostate) may be desired. To this end,
several antibodies
have been developed that specifically bind the AS3 polypeptide. Briefly,
computer aided
sequence analysis of the AS3 protein was performed in order to identify
several antigenic areas
of the AS3 protein that were suitable for use as an immunogen. Accordingly,
oligopeptides
corresponding to amino acid residues 711-727 and 1,369-1387 of SEQ ID NO: 4
were
synthesized and used to raise antibodies in, respectively, rabbits and
chickens (egg yolk
immunoglobulin Y). The resultant antibodies were both tested against cellular
extracts derived
from either LNCaP-FGC or MCF7-ARl cells induced with androgen to express AS3
protein
and both antibody preparations recognized a protein band of the expected size
for AS3 protein.
Thus, these antibodies can be used for performing, for example,
immunocytochemistry on
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-83-
various cell samples (e.g., biopsies of the prostate) for various prognostic
and diagnostic
determinations:
Accordingly, it was concluded that the AS3-related molecules and AS3-specific
antibodies disclosed herein are useful prognostic/diagnostic probes for
evaluating diseases
(e.g., the aforementioned cancers) that are associated with, or map to, the
AS3 locus or are
associated with altered AS3 protein expression.
EXAMPLE 5.
USE OF AS3 MOLECULES IN THE TREATMENT OF PROSTATE CANCER
In this example, the use of AS3 as a marker in guiding the appropriate
administration
of hormone therapy for prostate cancer is discussed.
It was determined that expression analysis of the AS3 transcript demonstrated
proliferation arrest-specific induction patterns, starting soon (4-6 h) after
androgen exposure
(Geck et al., (1997) J. Steroid Biochem. Mol. Biol. 63: 211-218). AS3 levels
peaked at 18-
20 h, about 4 h before the commitment for proliferative shutoff was detected,
suggesting that
this gene is a candidate for a shutoff mediator. Furthermore, expression of
the AS3
transcript positively correlated with proliferation arrest as this gene was
expressed only in
shutoff positive cell lines and variants. In addition, LNCaP-FGC cells
proliferated
maximally in CDHuS supplemented with 30 pM R1881 and under these conditions
AS3 was
not expressed. When AS3 was strongly induced in the presence of hormone (i.e.,
0.3-30
nM of R1881), the cells were inhibited from proliferating. An additional
observation that
indicates the AS3 gene codes for an inhibitor of the proliferation of prostate
cells is the
increase of AS3 mRNA levels in the rat prostate when proliferation was
arrested by
prolonged androgen administration. In addition, comparable effects in MCF7-AR1
cells
have been observed. Finally, significant homology between the fungal gene bimD
and AS3
was found. Importantly, it was noted that overexpression of bimD in
Aspergillus nidulans
results in a cell cycle arrest in G1/S phase and observe a similar cell cycle
arrest and
concordant peak expression of AS3 in mammalian cells induced to undergo
androgen-
induced proliferative shutoff (benison et al., (1992) Genetics, 134:1085-1096;
Geck et al.,
(1997) J. Steroid Biochem. Mol. Biol. 63: 211-218).
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-84-
Based on these observations, it was concluded that AS3 expression is a useful
marker of responsiveness of prostate cancer cells to the inhibitory effect of
androgens. In
order to make the tumor regress, avoid reoccurrence, and maintain an
acceptable quality of
life, patients presenting this response may be treated with alternate cycles
of antiandrogens
and androgens. Androgens have a biphasic effect on the normal prostate: an
initial phase of
increased proliferation (Step 1 ) followed by a phase of inhibition (Step 2).
Prior to the invention, prostate cancer has been treated by hormone ablation
(castration, antiandrogens) to take advantage of Step I. Usually after a
significant
regression, the remaining tumor cells become resistant and the tumor and/or
metastases
relapse. The invention avoids this problem by allowing the clinician to
subject patients to an
intermittent therapy. This is based on a classification of patients who have
an increased
chance to be responsive to the intermittent hormone therapy. Patients not
showing AS3
positive cancer cells would then be subjected to alternative therapies
(chemotherapy,
radiation, etc.). In contrast, the protocol for AS3 positive patients would be
to first
administer antiandrogens, to block the proliferative effect and return PSA
levels to normal,
and then to treat the patient with physiological but high doses of androgen to
elicit Step 2.
The invention allows the clinician to confidently assess the initial hormone
dependence of
the tumor (i.e., whether tumor cells express AS3 in response to hormone) and
determine
when to re-expose the patient to hormone. Importantly, the use of intermittent
hormone
therapy allows the clinician to determine exactly when cells are no longer
responding to
hormone such that hormone treatment can be withdrawn before the cells become
refractory
to hormone treatment and untreatable. If the patient develops metastases
capable of being
biopsied, assaying AS3 levels as described herein would allow a renewed
attempt to reduce
the proliferation of those cancer cell by increasing the androgen
concentration of the
treatment. This important aspect of the invention should allow the clinician
to lower the rate
at which clones of cells develop hormone resistance and become capable of
multiplying and
metastasizing without androgen stimulation. Moreover, this new treatment
regime affords a
better quality of life for the patient because, unlike with constant hormone
treatment, sexual
drive and potency are recovered.
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
-85
EXAMPLE 6.
ANTISENSE ASSAY FOR DEMONSTRATING THAT AS3 IS AN ANDROGEN-
INDUCED SUPPRESSOR OF CELL PROLIFERATION
In this example, an inducible antisense assay is provided for demonstrating
that AS3
is an androgen-inducible suppressor of cell proliferation.
To demonstrate androgen-inducible AS3 suppressor activity in a proliferating
cell (i.e.,
proliferative shut off activity), clonal cell lines were derived in which the
presence or absence
of AS3 could be controlled using an inducible AS3 antisense gene. The
prediction was that
cells incubated in the presence of androgen would have reduced levels of
proliferation as
compared to the same cells in the absence of androgen or cells in the presence
of androgen but
in which levels of AS3 had been experimentally ablated. Thus, cells incubated
in the presence
of androgen, but also induced to express antisense AS3 gene transcript which
removes cellular
levels of the AS3, would be predicted to grow like wild type cells because,
even though the
cells were being exposed to androgen, there would be insufficient AS3 to
mediate the
androgen signal reducing cell growth. This is precisely what was observed
(see, e.g., Table 1 ),
thereby demonstrating that AS3 is an androgen-induced suppressor of cell
proliferation.
In order to develop the foregoing novel cell lines in which to demonstrate
that AS3
mediates the androgen-induced shutoff effect, an inducible transgene encoding
an AS3
antisense transcript (or empty vector as a negative control) was genetically
engineered into a
retroviral vector backbone for efficient, stable, integration into cells. In
particular, the AS3
antisense gene was cloned into the Clontech pRevTRE retroviral vector under
the control of
a tetracycline sensitive promoter. The promoter has seven repeats of the
bacterial tet0
operator sequence upstream of the minimal CMV promoter which can be bound by
the
tetracycline transactivator (tTA). The tTA is a fusion protein between the
bacterial
tetracycline repressor and the V 16 herpes virus transactivator. The
tetracycline
transactivator is sensitive for tetracycline such that, in the presence of
tetracycline, the
transactivator cannot bind the tetracycline promoter so the transgene is "off
' and conversely,
in the absence of tetracycline, the gene is "on" (i.e., the Tet-Off system;
see, e.g., Clontech
pRevTRE manual for further details).
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
-86-
To stably introduce the foregoing inducible vectors into cells, the vectors
were first
transfected into a packaging cell line (PT67) under drug selection
(hygromycin). After 2-3
weeks of selection, the surviving packaging cells were used as a source of
supernatants
containing infectious virions containing the inducible transgene.
The supernatants containing the highest amounts of virions were then used to
infect
the STFX1 cell line, a derivative of the MCF7-AR1 that has a tetracycline
transactivator
gene stably integrated. During the cloning and selection procedures, cells
were maintained
in 1 ~g/mL of tetracycline to suppress the expression of the inducible
transgenes.
In order to characterize the cell lines expressing AS3 antisense and the
"control" cell
lines having vector without insert, cells were incubated in the presence
(i.e., the transgene is
off) and absence of tetracycline (i.e., the transgene is on) and, after 36
hours, assayed for
transcript expression using RT-PCR under standard conditions,
To determine the affect of androgen induced AS3 suppression of cellular
growth,
cells lines showing high levels of inducible AS3 antisense expression were
chosen for
further study. Cells were seeded onto coverslips in standard growth medium and
allowed to
grow for 5 days in the presence of 10 ~g/ml tetracycline (hereafter "tet").
Then, the medium
was changed to i) 10 ~g/ml tet, or ii) no tet for 36 hours as indicated in
Table 1. Then,
vehicle or 10 nM of the androgen 81881 was added. Finally, 24 hours later, the
cells were
treated with 10 ~g/ml of bromodeoxyuridine (BrdU) for several hours to measure
the
percent of cells actively proliferating as a function of BrdU incorporation
during DNA
replication. The cells were then fixed, Hoechst stained, and the percent
number of BrdU-
labeled cells was determined using immunocytochemistry (using standard BrdU
labeling
regents and protocols from Boheringer).
As clearly indicated in Table 1, administration of the androgen 81881 results
in a
significant decrease in the number of proliferating cells in S phase (compare
to sample 1
where cells are not treated with androgen) when cellular levels of AS3 are
unaffected
because the transgene vector is empty and uninduced (sample 2), empty and
induced
(sample 4), or encoding AS3 but uninduced (sample 6). In stark contrast, when
AS3 levels
are reduced by antisense expression in the absence of tetracycline, the
androgen Rl 881 no
longer induces a proliferative shutoff (compare sample 8 with sample 6).
CA 02363605 2001-08-23
WO 00/50454 PCT/tJS00/04732
_87_
Table 1. Analysis of the effect of tetracycline and androgen on the percent
BrdU-
labeled nuclei of STFXl cells containing vector only or AS3 antisense
constructs
Sample Treatment % Proliferating Cells (Mean
+I- S.E.)
1 vector, +tet, -A 35.0 +I-1.7
2 vector, +tet, +A 9.4 +I-1.7
3 vector, -tet, -A 36.6 +/-2.7
4 vector, -tet, +A 10.7 +~-0.9
Antisense, +tet, -A 34.7 +~-1.0
6 Antisense, +tet, +A 9.7 +I-0.6
7 Antisense, -tet, -A 32.2 +/-1.5
8 Antisense, -tet, +A 29.1 +I-1.6
5 Vector denotes STFX1 cells expressing empty vector under tetracycline
control. Tetracycline is abbreviated
tet; A denotes 10 nM R1881. Antisense denotes STFX1 cells expressing AS3-
antisense under tetracycline
control. Tetracycline represses the expression of the vector and the AS3
antisense. Each data point represents
the mean of 8-9 low power fields containing about 150-200 cells/field. Data
were analyzed using the Mann-
Whitney test; significance was measured at p<0.001.
This experiment further shows that the expression of the empty vector neither
interferes with the androgen-mediated shutoff, nor results in toxic effects.
Accordingly, it is concluded that androgen induced suppression of cell
proliferation
(or proliferative shutoff) is modulated by AS3 because expression of an AS3
antisense that
reduces cellular levels of AS3 results in the unlinking of androgen-induced
AS3-mediated
suppression of cell growth.
CA 02363605 2001-08-23
WU 00/50454 PCT/US00/04732
_gg_
Equivalents
Those skilled in the art will recognize, or be able to ascertain using no more
than
routine experimentation, many equivalents to the specific embodiments of the
invention
described herein. Such equivalents are intended to be encompassed by the
following claims.
What is claimed:
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
SEQUENCE LISTING
<110> Soto, Ana, et al.
<120> A NOVEL ANDROGEN-INDUCED SUPPRESSOR OF CELL PROLIFERATION AND USES
THEREOF
<130> MBI-008-1
<140>
<141>
<160> 5
<170> PatentIn Ver. 2.0
<210> 1
<211> 5271
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (66)..(4238)
<400> 1
ccggagagcc ccggagtgag cggagtagcg agtcggcaac ccggaggggt agaaatattt 60
ctgtc atg get cat tca aag act agg acc aat gat gga aaa att aca tat 110
Met Ala His Ser Lys Thr Arg Thr Asn Asp Gly Lys Ile Thr Tyr
1 5 10 15
ccg cct ggg gtc aag gaa ata tca gat aaa ata tct aaa gag gag atg 158
Pro Pro Gly Val Lys Glu Ile Ser Asp Lys Ile Ser Lys Glu Glu Met
20 25 30
gtg aga cga tta aag atg gtt gtg aaa act ttt atg gat atg gac cag 206
Val Arg Arg Leu Lys Met Val Val Lys Thr Phe Met Asp Met Asp Gln
35 40 45
gac tct gaa gaa gaa aag gag ctt tat tta aac cta get tta cat ctt 254
Asp Ser Glu Glu Glu Lys Glu Leu Tyr Leu Asn Leu Ala Leu His Leu
50 55 60
get tca gat ttt ttt ctc aag cat cct ggt aaa gat gtt cgc tta ctg 302
Ala Ser Asp Phe Phe Leu Lys His Pro Gly Lys Asp Val Arg Leu Leu
65 70 75
gta gcc tgc tgc ctt get gat att ttc agg att tat get cct gaa get 350
Val Ala Cys Cys Leu Ala Asp Ile Phe Arg Ile Tyr Ala Pro Glu Ala
80 85 90 95
cct tac aca tcc cct gat aaa cta aag gat ata ttt atg ttt ata aca 398
Pro Tyr Thr Ser Pro Asp Lys Leu Lys Asp Ile Phe Met Phe Ile Thr
100 105 110
aga cag ttg aag ggg cta gag gat aca aag agc cca caa ttc aat agg 446
Arg Gln Leu Lys Gly Leu Glu Asp Thr Lys Ser Pro Gln Phe Asn Arg
115 120 125
tat ttt tat tta ctt gag aac att get tgg gtc aag tca tat aac ata 494
Tyr Phe Tyr Leu Leu Glu Asn Ile Ala Trp Val Lys Ser Tyr Asn Ile
130 135 140
1
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
tgc ttt gag tta gaa gat agc aat gaa att ttc acc cag cta tac aga 542
Cys Phe Glu Leu Glu Asp Ser Asn Glu Ile Phe Thr Gln Leu Tyr Arg
145 150 155
acc tta ttt tca gtt ata aac aat ggc cac aat cag aaa gtc cat atg 590
Thr Leu Phe Ser Val Ile Asn Asn Gly His Asn Gln Lys Val His Met
160 165 170 175
cac atg gta gac ctt atg agc tct att att tgt gaa ggt gat aca gtg 638
His Met Val Asp Leu Met Ser Ser Ile Ile Cys Glu Gly Asp Thr Val
180 185 190
tctcaggagcttttggatacggttttagtaaatctggtacctgetcat 686
SerGlnGluLeuLeuAspThrValLeuValAsnLeuValProAlaHis
195 200 205
aagaatttaaacaagcaagcatatgattt.ggcaaaggetttactgaag 734
LysAsnLeuAsnLysGlnAlaTyrAspLeuAlaLysAlaLeuLeuLys
210 215 220
aggacagetcaagetattgagccatatattaccactttttttaatcag 782
ArgThrAlaGlnAlaIleGluProTyrIleThrThrPhePheAsnGln
225 230 235
gttctgatgcttgggaaaacatctatcagcgatttgtcagagcatgtc 830
ValLeuMetLeuGlyLysThrSerIleSerAspLeuSerGluHisVal
240 245 250 255
tttgacttaattttggagctctacaatattgatagtcatttgctgctc 878
PheAspLeuIleLeuGluLeuTyrAsnIleAspSerHisLeuLeuLeu
260 265 270
tctgttttaccccagcttgaatttaaattaaagagcaatgataatgag 926
SerValLeuProGlnLeuGluPheLysLeuLysSerAsnAspAsnGlu
275 280 285
gagcgcctacaagttgttaaactactggcaaaaatgtttggggcaaag 974
GluArgLeuGlnValValLysLeuLeuAlaLysMetPheGlyAlaLys
290 295 300
gattcagaattggettctcaaaacaagccactttggcagtgctacttg 1022
AspSerGluLeuAlaSerGlnAsnLysProLeuTrpGlnCysTyrLeu
305 310 315
ggcaggtttaatgatatccatgtaccaatccgcctggaatgtgtgaaa 1070
GlyArgPheAsnAspIleHisValProIleArgLeuGluCysValLys
320 325 330 335
tttgetagccattgtctcatgaaccatcctgatttagcaaaagactta 1118
PheAlaSerHisCysLeuMetAsnHisProAspLeuAlaLysAspLeu
340 345 350
acagagtatcttaaagtgaggtcacatgaccctgaggaagetattaga 1166
ThrGluTyrLeuLysValArgSerHisAspProGluGluAlaIleArg
355 360 365
catgatgttattgtgtcaatagttacagetgetaaaaaggatattctt 1214
HisAspValIleValSerIleValThrAlaAlaLysLysAspIleLeu
370 375 380
ctggtcaatgatcacttacttaattttgtgagagagagaacattagac 1262
LeuValAsnAspHisLeuLeuAsnPheValArgGluArgThrLeuAsp
385 390 395
2
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
aaacgatggagagtacgcaaagaagccatgatgggacttgcccaaatt 1310
LysArgTrpArgValArgLysGluAlaMetMetGlyLeuAlaGlnIle
400 405 410 415
tataagaaatatgetttacagtcagcagetggaaaagatgetgcaaaa 1358
TyrLysLysTyrAlaLeuGlnSerAlaAlaGlyLysAspAlaAlaLys
420 425 430
cagatagcatggatcaaagacaaattgctacatatatattatcaaaat 1406
GlnIleAlaTrpIleLysAspLysLeuLeuHisIleTyrTyrGlnAsn
435 440 445
agtattgatgatcgactacttgttgaacggatctttgetcaatacatg 1454
SerIleAspAspArgLeuLeuValGluArgIlePheAlaGlnTyrMet
450 455 460
gtt cct cac aat tta gaa act aca gaa cgg atg aaa tgc tta tat tac 1502
Val Pro His Asn Leu Glu Thr Thr Glu Arg Met Lys Cys Leu Tyr Tyr
465 470 475
ttg tat gcc aca ctg gat tta aat get gtg aaa gca ttg aat gaa atg 1550
Leu Tyr Ala Thr Leu Asp Leu Asn Ala Val Lys Ala Leu Asn Glu Met
480 485 490 495
tgg aaa tgt caa aat ctg ctc cga cat caa gta aag gat ttg ctt gac 1598
Trp Lys Cys Gln Asn Leu Leu Arg His Gln Val Lys Asp Leu Leu Asp
500 505 510
ttg att aag caa ccc aaa aca gat gcc agt gtc aag gcc ata ttt tca 1646
Leu Ile Lys Gln Pro Lys Thr Asp Ala Ser Val Lys Ala Ile Phe Ser
515 520 525
aaa gtg atg gtt att aca aga aat tta cct gat cct ggt aag get cag 1694
Lys Val Met Val Ile Thr Arg Asn Leu Pro Asp Pro Gly Lys Ala Gln
530 535 540
gat ttc atg aag aaa ttc aca cag gtg tta gaa gat gat gag aaa ata 1742
Asp Phe Met Lys Lys Phe Thr Gln Val Leu Glu Asp Asp Glu Lys Ile
545 550 555
aga aag cag tta gaa gta ctt gtt agt cca aca tgc tcc tgc aag cag 1790
Arg Lys Gln Leu Glu Val Leu Val Ser Pro Thr Cys Ser Cys Lys Gln
560 565 570 575
get gaa ggt tgt gtg cgt gaa ata act aag aag ttg ggc aac ccc aaa 1838
Ala Glu Gly Cys Val Arg Glu Ile Thr Lys Lys Leu Gly Asn Pro Lys
580 585 590
cag cct aca aat cct ttc ctg gaa atg atc aag ttt ctc ttg gag agg 1886
Gln Pro Thr Asn Pro Phe Leu Glu Met Ile Lys Phe Leu Leu Glu Arg
595 600 605
ata gca cct gtg cac ata gat acc gaa tct atc agt get ctt att aaa 1934
Ile Ala Pro Val His Ile Asp Thr Glu Ser Ile Ser Ala Leu Ile Lys
610 615 620
caa gtg aac aaa tca ata gat gga aca gca gat gat gaa gat gag ggt 1982
Gln Val Asn Lys Ser Ile Asp Gly Thr Ala Asp Asp Glu Asp Glu Gly
625 630 635
gtt cca act gat caa gcc atc aga gca ggt ctt gaa ctg ctt aag gta 2030
Val Pro Thr Asp Gln Ala Ile Arg Ala Gly Leu Glu Leu Leu Lys Val
640 645 650 655
3
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
ctc tca ttt aca cat ccc atc tca ttt cat tct get gaa aca ttt gaa 2078
Leu Ser Phe Thr His Pro Ile Ser Phe His Ser Ala Glu Thr Phe Glu
660 665 670
tca tta ctg get tgt ctg aaa atg gat gat gaa aaa gta gca gaa get 2126
Ser Leu Leu Ala Cys Leu Lys Met Asp Asp Glu Lys Val Ala Glu Ala
675 680 685
gca cta caa att ttc aaa aac aca gga agc aaa att gaa gag gat ttt 2174
Ala Leu Gln Ile Phe Lys Asn Thr Gly Ser Lys Ile Glu Glu Asp Phe
690 695 700
cca cac atc aga tca gcc ttg ctt cct gtt tta cat cac aaa tct aaa 2222
Pro His Ile Arg Ser Ala Leu Leu Pro Val Leu His His Lys Ser Lys
705 710 715
aaa gga ccc ccc cgt caa gcc aaa tat gcc att cat tgt atc cat gcg 2270
Lys Gly Pro Pro Arg Gln Ala Lys Tyr Ala Ile His Cys Ile His Ala
720 725 730 735
ata ttt tct agt aaa gag acc cag ttt gca cag ata ttt gag cct ctg 2318
Ile Phe Ser Ser Lys Glu Thr Gln Phe Ala Gln Ile Phe Glu Pro Leu
740 745 750
cat aag agc cta gat cca agc aac ctg gaa cat ctc ata aca cca ttg 2366
His Lys Ser Leu Asp Pro Ser Asn Leu Glu His Leu Ile Thr Pro Leu
755 760 765
gtt act att ggt cat att get ctc ctt gca cct gat caa ttt get get 2414
Val Thr Ile Gly His Ile Ala Leu Leu Ala Pro Asp Gln Phe Ala Ala
770 775 780
cct tgg aaa tct tgg gta get act ttc att gtg aaa gat ctt ctc atg 2462
Pro Trp Lys Ser Trp Val Ala Thr Phe Ile Val Lys Asp Leu Leu Met
785 790 795
aat gat cgg ctt cca ggg aaa aag aca act aaa ctt tgg gtt cca gat 2510
Asn Asp Arg Leu Pro Gly Lys Lys Thr Thr Lys Leu Trp Val Pro Asp
800 805 810 815
gaa gaa gta tct cct gag aca atg gtc aaa att cag get att aaa atg 2558
Glu Glu Val Ser Pro Glu Thr Met Val Lys Ile Gln Ala Ile Lys Met
820 825 830
atg gtt cga tgg cta ctt gga atg aaa aat aat cac agt aaa tca gga 2606
Met Val Arg Trp Leu Leu Gly Met Lys Asn Asn His Ser Lys Ser Gly
835 840 845
act tct acc tta aga ttg cta aca aca ata ttg cat agt gat gga gac 2654
Thr Ser Thr Leu Arg Leu Leu Thr Thr Ile Leu His Ser Asp Gly Asp
850 855 g60
ttg aca gaa cag ggg aaa att agt aaa cca gat atg tca cgt ctg aga 2702
Leu Thr Glu Gln Gly Lys Ile Ser Lys Pro Asp Met Ser Arg Leu Arg
865 870 g75
ctt get get ggg agt get att gtg aag ctg gca caa gaa ccc tgt tac 2750
Leu Ala Ala Gly Ser Ala Ile Val Lys Leu Ala Gln Glu Pro Cys Tyr
880 885 890 895
cat gaa atc atc aca tta gaa caa tat cag cta tgt gca tta get atc 2798
His Glu Ile Ile Thr Leu Glu Gln Tyr Gln Leu Cys Ala Leu Ala Ile
900 905 910
4
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
aacgatgaatgctatcaagtaagacaagtgtttgcccagaaacttcac 2846
AsnAspGluCysTyrGlnValArgGlnValPheAlaGlnLysLeuHis
915 920 925
aaaggcctttcccgtttacggcttccacttgagtatatggcaatctgt 2894
LysGlyLeuSerArgLeuArgLeuProLeuGluTyrMetAlaIleCys
930 935 940
gccctttgtgcaaaagatcctgtaaaggagagaagagetcatgetagg 2942
AlaLeuCysAlaLysAspProValLysGluArgArgAlaHisAlaArg
945 950 955
caatgtttggtgaaaaatataaatgtaaggcgggagtatctgaagcag 2990
GlnCysLeuValLysAsnIleAsnValArgArgGluTyrLeuLysGln
960 965 970 975
catgcagetgttagtgaaaaattattgtctcttctaccagagtatgtt 3038
HisAlaAlaValSerGluLysLeuLeuSerLeuLeuProGluTyrVal
980 985 990
gttccatatacaattcaccttttggcacatgacccagattatgtcaaa 3086
ValProTyrThrIleHisLeuLeuAlaHisAspProAspTyrValLys
995 1000 1005
gtacaggatattgaacaacttaaagatgttaaagaatgtctttggttt 3134
ValGlnAspIleGluGlnLeuLysAspValLysGluCysLeuTrpPhe
1010 1015 1020
gttctggaaatattaatggetaaaaatgaaaataacagtcacgetttt 3182
ValLeuGluIleLeuMetAlaLysAsnGluAsnAsnSerHisAlaPhe
1025 1030 1035
atcagaaagatggtagaaaatattaaacaaacaaaagatgcccaagga 3230
IleArgLysMetValGluAsnIleLysGlnThrLysAspAlaGlnGly
1040 1045 1050 1055
ccagatgatgcaaaaatgaatgaaaaactgtacactgtgtgtgatgtt 3278
ProAspAspAlaLysMetAsnGluLysLeuTyrThrValCysAspVal
1060 1065 1070
gccatgaatatcatcatgtcaaagagtactacatacagtttggaatct 3326
AlaMetAsnIleIleMetSerLysSerThrThrTyrSerLeuGluSer
1075 1080 1085
cctaaagacccggtactaccagetcgtttcttcactcaacctgacaag 3374
ProLysAspProValLeuProAlaArgPhePheThrGlnProAspLys
1090 1095 1100
aatttcagtaacaccaaaaattatctgcctcctgaaatgaaatcattt 3422
AsnPheSerAsnThrLysAsnTyrLeuProProGluMetLysSerPhe
1105 1110 1115
ttcactcctggaaaacctaaaacaaccaatgttctaggagetgttaac 3470
PheThrProGlyLysProLysThrThrAsnValLeuGlyAlaValAsn
1120 1125 1130 1135
aagccactttcatcagcaggcaagcaatctcagaccaaatcatcacga 3518
LysProLeuSerSerAlaGlyLysGlnSerGlnThrLysSerSerArg
1140 1145 1150
atggaaactgtaagcaatgcaagcagcagctcaaatccaagctctcct 3566
MetGluThrValSerAsnAlaSerSerSerSerAsnProSerSerPro
1155 1160 1165
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
ggaagaataaaggggagg cttgatagttctgaa atggatcacagtgaa 3614
GlyArgIleLysGlyArg LeuAspSerSerGlu MetAspHisSerGlu
1170 1175 1180
aatgaagattacacaatg tcttcacctttgccg gggaaaaaaagtgac 3662
AsnGluAspTyrThrMet SerSerProLeuPro GlyLysLysSerAsp
1185 1190 1195
aagagagacgactctgat cttgtaaggtctgaa ttggagaagcctaga 3710
LysArgAspAspSerAsp LeuValArgSerGlu LeuGluLysProArg
1200 1205 1210 1215
ggcaggaaaaaaacgccc gtcacagaacaggag gagaaattaggtatg 3758
GlyArgLysLysThrPro ValThrGluGlnGlu GluLysLeuGlyMet
1220 1225 1230
gatgacttgactaagttg gtacaggaacagaaa cctaaaggcagtcag 3806
AspAspLeuThrLysLeu ValGlnGluGlnLys ProLysGlySerGln
1235 1240 1245
cgaagtcggaaaagaggc catacggettcagaa tctgatgaacagcag 3854
ArgSerArgLysArgGly HisThrAlaSerGlu SerAspGluGlnGln
1250 1255 1260
tggcctgaggaaaagagg ctcaaagaagatata ttagaaaatgaagat 3902
TrpProGluGluLysArg LeuLysGluAspIle LeuGluAsnGluAsp
1265 1270 1275
gaacagaatagtccgcca aaaaagggtaaaaga ggccgaccaccaaaa 3950
GluGlnAsnSerProPro LysLysGlyLysArg GlyArgProProLys
1280 1285 1290 1295
cctcttggtggaggtaca ccaaaagaagagcca acaatgaaaacttct 3998
ProLeuGlyGlyGlyThr ProLysGluGluPro ThrMetLysThrSer
1300 1305 1310
aaaaaaggaagcaaaaaa aaatctggacctcca gcaccagaggaggag 4046
LysLysGlySerLysLys LysSerGlyProPro AlaProGluGluGlu
1315 1320 1325
gaagaagaagaaagacaa agtggaaatacggaa cagaagtccaaaagc 4094
GluGluGluGluArgGln SerGlyAsnThrGlu GlnLysSerLysSer
1330 1335 1340
aaacagcaccgagtgtca aggagagcacagcag agagcagaatctcct 4142
LysGlnHisArgValSer ArgArgAlaGlnGln ArgAlaGluSerPro
1345 1350 1355
gaatctagtgcaattgaa tccacacagtccaca ccacagaaaggacga 4190
GluSerSerAlaIleGlu SerThrGlnSerThr ProGlnLysGlyArg
1360 1365 1370 1375
ggaagaccatcaaaaacg ccatcaccatcacaa ccaaaaaaaaatgtg 4238
GlyArgProSerLysThr ProSerProSerGln ProLysLysAsnVal
1380 1385 1390
taagttgtaa atattacatt tcaaaccaat ttcaaattat tttgcaaaag ttcctaaatt 4298
tgtaaacata catattgctg tatttaaatt ccatatattt agccccatta cactaggtac 4358
ggcggcgaag tgctaaaagg gaacggcgat gaacaaatgt aattaataac tttctctgtg 4418
aaagctttgg aaaaatcttt tttttttttt tttttttttg gtcaagcttg aggctgaata 4478
6
WO 00/50454 PCT/C1S00/04732
aagcctttga tgcacaaaat gggactgctg aagagtggac agttggacct tactttggtg 4538
accccataca tttgtggtca catgctttag ccatacacat ggtaacattg actatggagt 4598
cttgtgaaag tgtaatgtgc gatggctatg tagacataaa gaagaaactt gtaaatatct 4658
tttttctttt ttttaatgtt tctgatttct gaagtgcttg tatagctttt atctgcggct 4718
ttaaactgac agtacccgac tgtttattgg atctattgat ttgaaaagaa tttgttagga 4778
tagatcttaa gcagtaatct gtcagtgttt gtatttgtat tttctgcaat tttactgtga 4838
aaaaaaattt gttttcaaca attggtgtca ttttcttgat gtcactattt gttggagagt 4898
taaatggtct cttccctttg tgtatcttac ctagtgttta ctcctgggca cccttaatct 4958
tcagaggtgc taaattgtct gccattacac cagaaggatg cctctgatag gaggacaacc 5018
atgcaaattg tgaaatagtc ctgaagttct tggattactt tacacctcag tattgatttg 5078
tcccagaatt ttctggcctt tcatggcaat gaaaatttta agaagaaaga tttaaagtat 5138
tttaatttta aagagtgtgt tataaaataa tgtactgaat tctttatccc attttatcat 5198
cctttcagtt tttattaatc tactgtatca ataaaattct gtaatttgaa tgagtaaaaa 5258
aaaaaaaaaa aaa 5271
<210> 2
<211> 1391
<212> PRT
<213> Homo Sapiens
<400> 2
Met Ala His Ser Lys Thr Arg Thr Asn Asp Gly Lys Ile Thr Tyr Pro
1 5 10 15
Pro Gly Val Lys Glu Ile Ser Asp Lys Ile Ser Lys Glu Glu Met Val
20 25 30
Arg Arg Leu Lys Met Val Val Lys Thr Phe Met Asp Met Asp Gln Asp
35 40 45
Ser Glu Glu Glu Lys Glu Leu Tyr Leu Asn Leu Ala Leu His Leu Ala
50 55 60
Ser Asp Phe Phe Leu Lys His Pro Gly Lys Asp Val Arg Leu Leu Val
65 70 75 80
Ala Cys Cys Leu Ala Asp Ile Phe Arg Ile Tyr Ala Pro Glu Ala Pro
85 90 95
Tyr Thr Ser Pro Asp Lys Leu Lys Asp Ile Phe Met Phe Ile Thr Arg
100 105 110
Gln Leu Lys Gly Leu Glu Asp Thr Lys Ser Pro Gln Phe.Asn Arg Tyr
115 120 125
Phe Tyr Leu Leu Glu Asn Ile Ala Trp Val Lys Ser Tyr Asn Ile Cys
130 135 140
Phe Glu Leu Glu Asp Ser Asn Glu Ile Phe Thr Gln Leu Tyr Arg Thr
7
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
145 150 155 160
Leu Phe Ser Val Ile Asn Asn Gly His Asn Gln Lys Val His Met His
165 170 175
Met Val Asp Leu Met Ser Ser Ile Ile Cys Glu Gly Asp Thr Val Ser
180 185 190
Gln Glu Leu Leu Asp Thr Val Leu Val Asn Leu Val Pro Ala His Lys
195 200 205
Asn Leu Asn Lys Gln Ala Tyr Asp Leu Ala Lys Ala Leu Leu Lys Arg
210 215 220
Thr Ala Gln Ala Ile Glu Pro Tyr Ile Thr Thr Phe Phe Asn Gln Val
225 230 235 240
Leu Met Leu Gly Lys Thr Ser Ile Ser Asp Leu Ser Glu His Val Phe
245 250 255
Asp Leu Ile Leu Glu Leu Tyr Asn Ile Asp Ser His Leu Leu Leu Ser
260 265 270
Val Leu Pro Gln Leu Glu Phe Lys Leu Lys Ser Asn Asp Asn Glu Glu
275 280 285
Arg Leu Gln Val Val Lys Leu Leu Ala Lys Met Phe Gly Ala Lys Asp
290 295 300
Ser Glu Leu Ala Ser Gln Asn Lys Pro Leu Trp Gln Cys Tyr Leu Gly
305 310 315 320
Arg Phe Asn Asp Ile His Val Pro Ile Arg Leu Glu Cys Val Lys Phe
325 330 335
Ala Ser His Cys Leu Met Asn His Pro Asp Leu Ala Lys Asp Leu Thr
340 345 350
Glu Tyr Leu Lys Val Arg Ser His Asp Pro Glu Glu Ala Ile Arg His
355 360 365
Asp Val Ile Val Ser Ile Val Thr Ala Ala Lys Lys Asp Ile Leu Leu
370 375 380
Val Asn Asp His Leu Leu Asn Phe Val Arg Glu Arg Thr Leu Asp Lys
385 390 395 400
Arg Trp Arg Val Arg Lys Glu Ala Met Met Gly Leu Ala Gln Ile Tyr
405 410 415
Lys Lys Tyr Ala Leu Gln Ser Ala Ala Gly Lys Asp Ala Ala Lys Gln
420 425 430
Ile Ala Trp Ile Lys Asp Lys Leu Leu His Ile Tyr Tyr Gln Asn Ser
435 440 445
Ile Asp Asp Arg Leu Leu Val Glu Arg Ile Phe Ala Gln Tyr Met Val
450 455 460
Pro His Asn Leu Glu Thr Thr Glu Arg Met Lys Cys Leu Tyr Tyr Leu
465 470 475 480
Tyr Ala Thr Leu Asp Leu Asn Ala Val Lys Ala Leu Asn Glu Met Trp
485 490 495
8
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
Lys Cys Gln Asn Leu Leu Arg His Gln Val Lys Asp Leu Leu Asp Leu
500 505 510
Ile Lys Gln Pro Lys Thr Asp Ala Ser Val Lys Ala Ile Phe Ser Lys
515 520 525
Val Met Val Ile Thr Arg Asn Leu Pro Asp Pro Gly Lys Ala Gln Asp
530 535 540
Phe Met Lys Lys Phe Thr Gln Val Leu Glu Asp Asp Glu Lys Ile Arg
545 550 555 560
Lys Gln Leu Glu Val Leu Val Ser Pro Thr Cys Ser Cys Lys Gln Ala
565 570 575
Glu Gly Cys Val Arg Glu Ile Thr Lys Lys Leu Gly Asn Pro Lys Gln
580 585 590
Pro Thr Asn Pro Phe Leu Glu Met Ile Lys Phe Leu Leu Glu Arg Ile
595 600 605
Ala Pro Val His Ile Asp Thr Glu Ser Ile Ser Ala Leu Ile Lys Gln
610 615 620
Val Asn Lys Ser Ile Asp Gly Thr Ala Asp Asp Glu Asp Glu Gly Val
625 630 635 640
Pro Thr Asp Gln Ala Ile Arg Ala Gly Leu Glu Leu Leu Lys Val Leu
645 650 655
Ser Phe Thr His Pro Ile Ser Phe His Ser Ala Glu Thr Phe Glu Ser
660 665 670
Leu Leu Ala Cys Leu Lys Met Asp Asp Glu Lys Val Ala Glu Ala Ala
67S 680 685
Leu Gln Ile Phe Lys Asn Thr Gly Ser Lys Ile Glu Glu Asp Phe Pro
690 695 700
His Ile Arg Ser Ala Leu Leu Pro Val Leu His His Lys Ser Lys Lys
705 710 715 720
Gly Pro Pro Arg Gln Ala Lys Tyr Ala Ile His Cys Ile His Ala Ile
725 730 735
Phe Ser Ser Lys Glu Thr Gln Phe Ala Gln Ile Phe Glu Pro Leu His
740 745 750
Lys Ser Leu Asp Pro Ser Asn Leu Glu His Leu Ile Thr Pro Leu Val
755 760 765
Thr Ile Gly His Ile Ala Leu Leu Ala Pro Asp Gln Phe Ala Ala Pro
770 775 780
Trp Lys Ser Trp Val Ala Thr Phe Ile Val Lys Asp Leu Leu Met Asn
785 790 795 800
Asp Arg Leu Pro Gly Lys Lys Thr Thr Lys Leu Trp Val Pro Asp Glu
805 810 815
Glu Val Ser Pro Glu Thr Met Val Lys Ile Gln Ala Ile Lys Met Met
820 825 830
9
WO 00/50454 PCT/US00/04732
Val Arg Trp Leu Leu Gly Met Lys Asn Asn His Ser Lys Ser Gly Thr
835 840 845
Ser Thr Leu Arg Leu Leu Thr Thr Ile Leu His Ser Asp Gly Asp Leu
850 855 860
Thr Glu Gln Gly Lys Ile Ser Lys Pro Asp Met Ser Arg Leu Arg Leu
865 870 875 880
Ala Ala Gly Ser Ala Ile Val Lys Leu Ala Gln Glu Pro Cys Tyr His
885 890 895
Glu Ile Ile Thr Leu Glu Gln Tyr Gln Leu Cys Ala Leu Ala Ile Asn
900 905 910
Asp Glu Cys Tyr Gln Val Arg Gln Val Phe Ala Gln Lys Leu His Lys
915 920 925
Gly Leu Ser Arg Leu Arg Leu Pro Leu Glu Tyr Met Ala Ile Cys Ala
930 935 940
Leu Cys Ala Lys Asp Pro Val Lys Glu Arg Arg Ala His Ala Arg Gln
945 950 955 960
Cys Leu Val Lys Asn Ile Asn Val Arg Arg Glu Tyr Leu Lys Gln His
965 970 975
Ala Ala Val Ser Glu Lys Leu Leu Ser Leu Leu Pro Glu Tyr Val Val
980 985 990
Pro Tyr Thr Ile His Leu Leu Ala His Asp Pro Asp Tyr Val Lys Val
995 1000 1005
Gln Asp Ile Glu Gln Leu Lys Asp Val Lys Glu Cys Leu Trp Phe Val
1010 1015 1020
Leu Glu Ile Leu Met Ala Lys Asn Glu Asn Asn Ser His Ala Phe Ile
025 1030 1035 104
Arg Lys Met Val Glu Asn Ile Lys Gln Thr Lys Asp Ala Gln Gly Pro
1045 1050 1055
Asp Asp Ala Lys Met Asn Glu Lys Leu Tyr Thr Val Cys Asp Val Ala
1060 1065 1070
Met Asn Ile Ile Met Ser Lys Ser Thr Thr Tyr Ser Leu Glu Ser Pro
1075 1080 1085
Lys Asp Pro Val Leu Pro Ala Arg Phe Phe Thr Gln Pro Asp Lys Asn
1090 1095 1100
Phe Ser Asn Thr Lys Asn Tyr Leu Pro Pro Glu Met Lys Ser Phe Phe
105 1110 1115 112
Thr Pro Gly Lys Pro Lys Thr Thr Asn Val Leu Gly Ala Val Asn Lys
1125 1130 1135
Pro Leu Ser Ser Ala Gly Lys Gln Ser Gln Thr Lys Ser.Ser Arg Met
1140 1145 1150
Glu Thr Val Ser Asn Ala Ser Ser Ser Ser Asn Pro Ser Ser Pro Gly
1155 1160 1165
Arg Ile Lys Gly Arg Leu Asp Ser Ser Glu Met Asp His Ser Glu Asn
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
1170 1176 1190
Glu Asp Tyr Thr Met Ser Ser Pro Leu Pro Gly Lys Lys Ser Asp Lys
185 1190 1195 120
Arg Asp Asp Ser Asp Leu Val Arg Ser Glu Leu Glu Lys Pro Arg Gly
1205 1210 1215
Arg Lys Lys Thr Pro Val Thr Glu Gln Glu Glu Lys Leu Gly Met Asp
1220 1225 1230
Asp Leu Thr Lys Leu Val Gln Glu Gln Lys Pro Lys Gly Ser Gln Arg
1235 1240 1245
Ser Arg Lys Arg Gly His Thr Ala Ser Glu Ser Asp Glu Gln Gln Trp
1250 1255 1260
Pro Glu Glu Lys Arg Leu Lys Glu Asp Ile Leu Glu Asn Glu Asp Glu
265 1270 1275 128
Gln Asn Ser Pro Pro Lys Lys Gly Lys Arg Gly Arg Pro Pro Lys Pro
1285 1290 1295
Leu Gly Gly Gly Thr Pro Lys Glu Glu Pro Thr Met Lys Thr Ser Lys
1300 1305 1310
Lys Gly Ser Lys Lys Lys Ser Gly Pro Pro Ala Pro Glu Glu Glu Glu
1315 1320 1325
Glu Glu Glu Arg Gln Ser Gly Asn Thr Glu Gln Lys Ser Lys Ser Lys
1330 1335 1340
Gln His Arg Val Ser Arg Arg Ala Gln Gln Arg Ala Glu Ser Pro Glu
345 1350 1355 136
Ser Ser Ala Ile Glu Ser Thr Gln Ser Thr Pro Gln Lys Gly Arg Gly
1365 1370 1375
Arg Pro Ser Lys Thr Pro Ser Pro Ser Gln Pro Lys Lys Asn Val
1380 1385 1390
<210> 3
c211> 4173
<212> DNA
<213> Homo sapiens
c220>
<221> CDS
<222> (1)..(4173)
<400> 3
atg get cat tca aag act agg acc aat gat gga aaa att aca tat ccg 48
Met Ala His Ser Lys Thr Arg Thr Asn Asp Gly Lys Ile Thr Tyr Pro
1 5 10 15
cct ggg gtc aag gaa ata tca gat aaa ata tct aaa gag gag atg gtg 96
Pro Gly Val Lys Glu Ile Ser Asp Lys Ile Ser Lys Glu Glu Met Val
20 25 30
aga cga tta aag atg gtt gtg aaa act ttt atg gat atg gac cag gac 144
Arg Arg Leu Lys Met Val Val Lys Thr Phe Met Asp Met Asp Gln Asp
35 40 45
11
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
tctgaagaagaaaaggagctttatttaaacctagetttacatcttget192
SerGluGluGluLysGluLeuTyrLeuAsnLeuAlaLeuHisLeuAla
50 55 60
tcagatttttttctcaagcatcctggtaaagatgttcgcttactggta240
SerAspPhePheLeuLysHisProGlyLysAspValArgLeuLeuVal
65 70 75 80
gcctgctgccttgetgatattttcaggatttatgetcctgaagetcct288
AlaCysCysLeuAlaAspIlePheArgIleTyrAlaProGluAlaPro
85 90 95
tacacatcccctgataaactaaaggatatatttatgtttataacaaga336
TyrThrSerProAspLysLeuLysAspIlePheMetPheIleThrArg
100 105 110
cag ttg aag ggg cta gag gat aca aag agc cca caa ttc aat agg tat 384
Gln Leu Lys Gly Leu Glu Asp Thr Lys Ser Pro Gln Phe Asn Arg Tyr
115 120 125
ttt tat tta ctt gag aac att get tgg gtc aag tca tat aac ata tgc 432
Phe Tyr Leu Leu Glu Asn Ile Ala Trp Val Lys Ser Tyr Asn Ile Cys
130 135 140
ttt gag tta gaa gat agc aat gaa att ttc acc cag cta tac aga acc 480
Phe Glu Leu Glu Asp Ser Asn Glu Ile Phe Thr Gln Leu Tyr Arg Thr
145 150 155 160
tta ttt tca gtt ata aac aat ggc cac aat cag aaa gtc cat atg cac 528
Leu Phe Ser Val Ile Asn Asn Gly His Asn Gln Lys Val His Met His
165 170 175
atg gta gac ctt atg agc tct att att tgt gaa ggt gat aca gtg tct 576
Met Val Asp Leu Met Ser Ser Ile Ile Cys Glu Gly Asp Thr Val Ser
180 185 190
cag gag ctt ttg gat acg gtt tta gta aat ctg gta cct get cat aag 624
Gln Glu Leu Leu Asp Thr Val Leu Val Asn Leu Val Pro Ala His Lys
195 200 205
aat tta aac aag caa gca tat gat ttg gca aag get tta ctg aag agg 672
Asn Leu Asn Lys Gln Ala Tyr Asp Leu Ala Lys Ala Leu Leu Lys Arg
210 215 220
aca get caa get att gag cca tat att acc act ttt ttt aat cag gtt 720
Thr Ala Gln Ala Ile Glu Pro Tyr Ile Thr Thr Phe Phe Asn Gln Val
225 230 235 240
ctg atg ctt ggg aaa aca tct atc agc gat ttg tca gag cat gtc ttt 768
Leu Met Leu Gly Lys Thr Ser Ile Ser Asp Leu Ser Glu His Val Phe
245 250 255
gac tta att ttg gag ctc tac aat att gat agt cat ttg ctg ctc tct 816
Asp Leu Ile Leu Glu Leu Tyr Asn Ile Asp Ser His Leu Leu Leu Ser
260 265 270
gtt tta ccc cag ctt gaa ttt aaa tta aag agc aat gat aat gag gag 864
Val Leu Pro Gln Leu Glu Phe Lys Leu Lys Ser Asn Asp Asn Glu Glu
275 280 285
cgc cta caa gtt gtt aaa cta ctg gca aaa atg ttt ggg gca aag gat 912
Arg Leu Gln Val Val Lys Leu Leu Ala Lys Met Phe Gly Ala Lys Asp
290 295 300
12
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
tcagaattggettctcaaaacaagccactttggcagtgctacttgggc 960
SerGluLeuAlaSerGlnAsnLysProLeuTrpGlnCysTyrLeuGly
305 310 315 320
aggtttaatgatatccatgtaccaatccgcctggaatgtgtgaaattt 1008
ArgPheAsnAspIleHisValProIleArgLeuGluCysValLysPhe
325 330 335
getagccattgtctcatgaaccatcctgatttagcaaaagacttaaca 1056
AlaSerHisCysLeuMetAsnHisProAspLeuAlaLysAspLeuThr
340 345 350
gagtatcttaaagtgaggtcacatgaccctgaggaagetattagacat 1104
GluTyrLeuLysValArgSerHisAspProGluGluAlaIleArgHis
355 360 365
gatgttattgtgtcaatagttacagetgetaaaaaggatattcttctg 1152
AspValIleValSerIleValThrAlaAlaLysLysAspIleLeuLeu
370 375 380
gtcaatgatcacttacttaattttgtgagagagagaacattagacaaa 1200
ValAsnAspHisLeuLeuAsnPheValArgGluArgThrLeuAspLys
385 390 395 400
cgatggagagtacgcaaagaagccatgatgggacttgcccaaatttat 1248
ArgTrpArgValArgLysGluAlaMetMetGlyLeuAlaGlnIleTyr
405 410 415
aagaaatatgetttacagtcagcagetggaaaagatgetgcaaaacag 1296
LysLysTyrAlaLeuGlnSerAlaAlaGlyLysAspAlaAlaLysGln
420 425 430
atagcatggatcaaagacaaattgctacatatatattatcaaaatagt 1344
IleAlaTrpIleLysAspLysLeuLeuHisIleTyrTyrGlnAsnSer
435 440 445
attgatgatcgactacttgttgaacggatctttgetcaatacatggtt 1392
IleAspAspArgLeuLeuValGluArgIlePheAlaGlnTyrMetVal
450 455 460
cctcacaatttagaaactacagaacggatgaaatgcttatattacttg 1440
ProHisAsnLeuGluThrThrGluArgMetLysCysLeuTyrTyrLeu
465 470 475 480
tatgccacactggatttaaatgetgtgaaagcattgaatgaaatgtgg 1488
TyrAlaThrLeuAspLeuAsnAlaValLysAlaLeuAsnGluMetTrp
485 490 495
aaatgtcaaaatctgctccgacatcaagtaaaggatttgcttgacttg 1536
LysCysGlnAsnLeuLeuArgHisGlnValLysAspLeuLeuAspLeu
500 505 510
attaagcaacccaaaacagatgccagtgtcaaggccatattttcaaaa 1584
IleLysGlnProLysThrAspAlaSerValLysAlaIlePheSerLys
515 520 525
gtgatggttattacaagaaatttacctgatcctggtaaggetcaggat 1632
ValMetValIleThrArgAsnLeuProAspProGlyLys.AlaGlnAsp
530 535 540
ttcatgaagaaattcacacaggtgttagaagatgatgagaaaataaga 1680
PheMetLysLysPheThrGlnValLeuGluAspAspGluLysIleArg
545 550 555 560
13
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732
aagcagttagaagtacttgttagtccaacatgctcctgcaagcagget1728
LysGlnLeuGluValLeuValSerProThrCysSerCysLysGlnAla
565 570 575
gaaggttgtgtgcgtgaaataactaagaagttgggcaaccccaaacag1776
GluGlyCysValArgGluIleThrLysLysLeuGlyAsnProLysGln
580 585 590
cctacaaatcctttcctggaaatgatcaagtttctcttggagaggata1824
ProThrAsnProPheLeuGluMetIleLysPheLeuLeuGluArgIle
595 600 605
gcacctgtgcacatagataccgaatctatcagtgetcttattaaacaa1872
AlaProValHisIleAspThrGluSerIleSerAlaLeuIleLysGln
610 615 620
gtgaacaaatcaatagatggaacagcagatgatgaagatgagggtgtt1920
ValAsnLysSerIleAspGlyThrAlaAspAspGluAspGluGlyVal
625 630 635 640
ccaactgatcaagccatcagagcaggtcttgaactgcttaaggtactc1968
ProThrAspGlnAlaIleArgAlaGlyLeuGluLeuLeuLysValLeu
645 650 655
tcatttacacatcccatctcatttcattctgetgaaacatttgaatca2016
SerPheThrHisProIleSerPheHisSerAlaGluThrPheGluSer
660 665 670
ttactggettgtctgaaaatggatgatgaaaaagtagcagaagetgca2064
LeuLeuAlaCysLeuLysMetAspAspGluLysValAlaGluAlaAla
675 680 685
ctacaaattttcaaaaacacaggaagcaaaattgaagaggattttcca2112
LeuGlnIlePheLysAsnThrGlySerLysIleGluGluAspPhePro
690 695 700
cacatcagatcagccttgcttcctgttttacatcacaaatctaaaaaa2160
HisIleArgSerAlaLeuLeuProValLeuHisHisLysSerLysLys
705 710 715 720
ggacccccccgtcaagccaaatatgccattcattgtatccatgcgata2208
GlyProProArgGlnAlaLysTyrAlaIleHisCysIleHisAlaIle
725 730 735
ttttctagtaaagagacccagtttgcacagatatttgagcctctgcat2256
PheSerSerLysGluThrGlnPheAlaGlnIlePheGluProLeuHis
740 745' 750
aagagcctagatccaagcaacctggaacatctcataacaccattggtt2304
LysSerLeuAspProSerAsnLeuGluHisLeuIleThrProLeuVal
755 760 765
actattggtcatattgetctccttgcacctgatcaatttgetgetcct2352
ThrIleGlyHisIleAlaLeuLeuAlaProAspGlnPheAlaAlaPro
770 775 780
tggaaatcttgggtagetactttcattgtgaaagatcttctcatgaat2400
TrpLysSerTrpValAlaThrPheIleValLysAspLeuLeuMetAsn
785 790 795 800
gatcggcttccagggaaaaagacaactaaactttgggttccagatgaa2448
AspArgLeuProGlyLysLysThrThrLysLeuTrpValProAspGlu
805 810 B15
14
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
gaagtatctcctgag acaatggtcaaaattcaggetattaaaatgatg 2496
GluValSerProGlu ThrMetValLysIleGlnAlaIleLysMetMet
820 825 830
gttcgatggctactt ggaatgaaaaataatcacagtaaatcaggaact 2544
ValArgTrpLeuLeu GlyMetLysAsnAsnHisSerLysSerGlyThr
835 840 845
tctaccttaagattg ctaacaacaatattgcatagtgatggagacttg 2592
SerThrLeuArgLeu LeuThrThrIleLeuHisSerAspGlyAspLeu
850 855 860
acagaacaggggaaa attagtaaaccagatatgtcacgtctgagactt 2640
ThrGluGlnGlyLys IleSerLysProAspMetSerArgLeuArgLeu
865 870 875 880
getgetgggagtget attgtgaagctggcacaagaaccctgttaccat 2688
AlaAlaGlySerAla IleValLysLeuAlaGlnGluProCysTyrHis
885 890 895
gaaatcatcacatta gaacaatatcagctatgtgcattagetatcaac 2736
GluIleIleThrLeu GluGlnTyrGlnLeuCysAlaLeuAlaIleAsn
900 905 910
gatgaatgctatcaa gtaagacaagtgtttgcccagaaacttcacaaa 2784
AspGluCysTyrGln ValArgGlnValPheAlaGlnLysLeuHisLys
915 920 925
ggcctttcccgttta cggcttccacttgagtatatggcaatctgtgcc 2832
GlyLeuSerArgLeu ArgLeuProLeuGluTyrMetAlaIleCysAla
930 935 940
ctttgtgcaaaagat cctgtaaaggagagaagagetcatgetaggcaa 2880
LeuCysAlaLysAsp ProValLysGluArgArgAlaHisAlaArgGln
945 950 955 960
tgtttggtgaaaaat ataaatgtaaggcgggagtatctgaagcagcat 2928
CysLeuValLysAsn IleAsnValArgArgGluTyrLeuLysGlnHis
965 970 975
gcagetgttagtgaa aaattattgtctcttctaccagagtatgttgtt 2976
AlaAlaValSerGlu LysLeuLeuSerLeuLeuProGluTyrValVal
980 985 990
ccatatacaattcac cttttggcacatgacccagattatgtcaaagta 3024
ProTyrThrIleHis LeuLeuAlaHisAspProAspTyrValLysVal
995 1000 1005
caggatattgaacaa cttaaagatgttaaagaatgtctttggtttgtt 3072
GlnAspIleGluGln LeuLysAspValLysGluCysLeuTrpPheVal
1010 1015 1020
ctggaaatattaatg getaaaaatgaaaataacagtcacgettttatc 3120
LeuGluIleLeuMet AlaLysAsnGluAsnAsnSerHisAlaPheIle
1025 1030 1035 1040
agaaagatggtagaa aatattaaacaaacaaaagatgcccaaggacca 3168
ArgLysMetValGlu AsnIleLysGlnThrLysAspAlaGlnGlyPro
1045 1050 1055
gatgatgcaaaaatg aatgaaaaactgtacactgtgtgtgatgttgcc 3216
AspAspAlaLysMet AsnGluLysLeuTyrThrValCysAspValAla
1060 1065 1070
WO 00/50454 PCT/US00/04732
atg aat atc atc atg tca aag agt act aca tac agt ttg gaa tct cct 3264
Met Asn Ile Ile Met Ser Lys Ser Thr Thr Tyr Ser Leu Glu Ser Pro
1075 1080 1085
aaa gac ccg gta cta cca get cgt ttc ttc act caa cct gac aag aat 3312
Lys Asp Pro Val Leu Pro Ala Arg Phe Phe Thr Gln Pro Asp Lys Asn
1090 1095 1100
ttc agt aac acc aaa aat tat ctg cct cct gaa atg aaa tca ttt ttc 3360
Phe Ser Asn Thr Lys Asn Tyr Leu Pro Pro Glu Met Lys Ser Phe Phe
1105 1110 1115 1120
act cct gga aaa cct aaa aca acc aat gtt cta gga get gtt aac aag 3408
Thr Pro Gly Lys Pro Lys Thr Thr Asn Val Leu Gly Ala Val Asn Lys
1125 1130 1135
cca ctt tca tca gca ggc aag caa tct cag acc aaa tca tca cga atg 3456
Pro Leu Ser Ser Ala Gly Lys Gln Ser Gln Thr Lys Ser Ser Arg Met
1140 1145 1150
gaa act gta agc aat gca agc agc agc tca aat cca agc tct cct gga 3504
Glu Thr Val Ser Asn Ala Ser Ser Ser Ser Asn Pro Ser Ser Pro Gly
1155 1160 1165
aga ata aag ggg agg ctt gat agt tct gaa atg gat cac agt gaa aat 3552
Arg Ile Lys Gly Arg Leu Asp Ser Ser Glu Met Asp His Ser Glu Asn
1170 1175 1180
gaa gat tac aca atg tct tca cct ttg ccg ggg aaa aaa agt gac aag 3600
Glu Asp Tyr Thr Met Ser Ser Pro Leu Pro Gly Lys Lys Ser Asp Lys
1185 1190 1195 1200
aga gac gac tct gat ctt gta agg tct gaa ttg gag aag cct aga ggc 3648
Arg Asp Asp Ser Asp Leu Val Arg Ser Glu Leu Glu Lys Pro Arg Gly
1205 1210 1215
agg aaa aaa acg ccc gtc aca gaa cag gag gag aaa tta ggt atg gat 3696
Arg Lys Lys Thr Pro Val Thr Glu Gln Glu Glu Lys Leu Gly Met Asp
1220 1225 1230
gac ttg act aag ttg gta cag gaa cag aaa cct aaa ggc agt cag cga 3744
Asp Leu Thr Lys Leu Val Gln Glu Gln Lys Pro Lys Gly Ser Gln Arg
1235 1240 1245
agt cgg aaa aga ggc cat acg get tca gaa tct gat gaa cag cag tgg 3792
Ser Arg Lys Arg Gly His Thr Ala Ser Glu Ser Asp Glu Gln Gln Trp
1250 1255 1260
cct gag gaa aag agg ctc aaa gaa gat ata tta gaa aat gaa gat gaa 3840
Pro Glu Glu Lys Arg Leu Lys Glu Asp Ile Leu Glu Asn Glu Asp Glu
1265 1270 1275 1280
cag aat agt ccg cca aaa aag ggt aaa aga ggc cga cca cca aaa cct 3888
Gln Asn Ser Pro Pro Lys Lys Gly Lys Arg Gly Arg Pro Pro Lys Pro
1285 1290 1295
ctt ggt gga ggt aca cca aaa gaa gag cca aca atg aaa act tct aaa 3936
Leu Gly Gly Gly Thr Pro Lys Glu Glu Pro Thr Met Lys.Thr Ser Lys
1300 1305 1310
aaa gga agc aaa aaa aaa tct gga cct cca gca cca gag gag gag gaa 3984
Lys Gly Ser Lys Lys Lys Ser Gly Pro Pro Ala Pro Glu Glu Glu Glu
1315 1320 1325
16
CA 02363605 2001-08-23
CA 02363605 2001-08-23
Wb 00/50454 PCT/US00/04732
gaagaagaaagacaaagtggaaatacggaacagaag tccaaa agcaaa4032
GluGluGluArgGlnSerGlyAsnThrGluGlnLys SerLys SerLys
1330 1335 1340
cagcaccgagtgtcaaggagagcacagcagagagca gaatct cctgaa4080
GlnHisArgValSerArgArgAlaGlnGlnArgAla GluSer ProGlu
1345 1350 1355 1360
tctagtgcaattgaatccacacagtccacaccacag aaagga cgagga4128
SerSerAlaIleGluSerThrGlnSerThrProGln LysGly ArgGly
1365 1370 1375
agaccatcaaaaacgccatcaccatcacaaccaaaa aaaaat gtg 4173
ArgProSerLysThrProSerProSerGlnProLys LysAsn Val
1380 1385 1390
<210> 4
<211> 5355
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (150)..(4322)
<400> 4
cggagaggag gaggaacggc agggctggct gcggaagggg aggggggggg agaaggcgat 60
tggatgcggc ggcggcggcg gatcccggag agccccggag tgagcggagt agcgagtcgg 120
caacccggag gggtagaaat atttctgtc atg get cat tca aag act agg acc 173
Met Ala His Ser Lys Thr Arg Thr
1 5
aat gat gga aaa att aca tat ccg cct ggg gtc aag gaa ata tca gat 221
Asn Asp Gly Lys Ile Thr Tyr Pro Pro Gly Val Lys Glu Ile Ser Asp
15 20
aaa ata tct aaa gag gag atg gtg aga cga tta aag atg gtt gtg aaa 269
Lys Ile Ser Lys Glu Glu Met Val Arg Arg Leu Lys Met Val Val Lys
25 30 35 40
act ttt atg gat atg gac cag gac tct gaa gaa gaa aag gag ctt tat 317
Thr Phe Met Asp Met Asp Gln Asp Ser Glu Glu Glu Lys Glu Leu Tyr
45 50 55
tta aac cta get tta cat ctt get tca gat ttt ttt ctc aag cat cct 365
Leu Asn Leu Ala Leu His Leu Ala Ser Asp Phe Phe Leu Lys His Pro
60 65 70
ggt aaa gat gtt cgc tta ctg gta gcc tgc tgc ctt get gat att ttc 413
Gly Lys Asp Val Arg Leu Leu Val Ala Cys Cys Leu Ala Asp Ile Phe
75 80 85
agg att tat get cct gaa get cct tac aca tcc cct gat aaa cta aag 461
Arg Ile Tyr Ala Pro Glu Ala Pro Tyr Thr Ser Pro Asp Lys Leu Lys
90 95 100
gat ata ttt atg ttt ata aca aga cag ttg aag ggg cta gag gat aca 509
Asp Ile Phe Met Phe Ile Thr Arg Gln Leu Lys Gly Leu Glu Asp Thr
105 110 115 120
aag agc cca caa ttc aat agg tat ttt tat tta ctt gag aac att get 557
17
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
LysSerProGlnPheAsnArg PheTyrLeuLeuGluAsnIleAla
Tyr
125 130 135
tgggtoaagtcatataacatatgctttgagttagaagatagcaatgaa605
TrpValLysSerTyrAsnIleCysPheGluLeuGluAspSerAsnGlu
140 145 150
attttcacccagctatacagaaccttattttcagttataaacaatggc653
IlePheThrGlnLeuTyrArgThrLeuPheSerValIleAsnAsnGly
155 160 165
cacaatcagaaagtccatatgcacatggtagaccttatgagctctatt701
HisAsnGlnLysValHisMetHisMetValAspLeuMetSerSerIle
170 175 180
atttgtgaaggtgatacagtgtctcaggagcttttggatacggtttta749
IleCysGluGlyAspThrValSerGlnGluLeuLeuAspThrValLeu
185 190 195 200
gtaaatctggtacctgetcataagaatttaaacaagcaagcatatgat797
ValAsnLeuValProAlaHisLysAsnLeuAsnLysGlnAlaTyrAsp
205 210 215
ttggcaaaggetttactgaagaggacagetcaagetattgagccatat845
LeuAlaLysAlaLeuLeuLysArgThrAlaGlnAlaIleGluProTyr
220 225 230
attaccactttttttaatcaggttctgatgcttgggaaaacatctatc893
IleThrThrPhePheAsnGlnValLeuMetLeuGlyLysThrSerIle
235 240 245
agcgatttgtcagagcatgtctttgacttaattttggagctctacaat941
SerAspLeuSerGluHisValPheAspLeuIleLeuGluLeuTyrAsn
250 255 260
attgatagtcatttgctgctctctgttttaccccagcttgaatttaaa989
IleAspSerHisLeuLeuLeuSerValLeuProGlnLeuGluPheLys
265 270 275 280
ttaaagagcaatgataatgaggagcgcctacaagttgttaaactactg1037
LeuLysSerAsnAspAsnGluGluArgLeuGlnValValLysLeuLeu
285 290 295
gcaaaaatgtttggggcaaaggattcagaattggettctcaaaacaag1085
AlaLysMetPheGlyAlaLysAspSerGluLeuAlaSerGlnAsnLys
300 305 310
ccactttggcagtgctacttgggcaggtttaatgatatccatgtacca1133
ProLeuTrpGlnCysTyrLeuGlyArgPheAsnAspIleHisValPro
315 320 325
atccgcctggaatgtgtgaaatttgetagccattgtctcatgaaccat1181
IleArgLeuGluCysValLysPheAlaSerHisCysLeuMetAsnHis
330 335 340
cctgatttagcaaaagacttaacagagtatcttaaagtgaggtcacat1229
ProAspLeuAlaLysAspLeuThrGluTyrLeuLysValArgSerHis
345 350 355 360
gaccctgaggaagetattagacatgatgttattgtgtcaatagttaca1277
AspProGluGluAlaIleArgHisAspValIleValSerIleValThr
365 370 3'75
getgetaaaaaggatattcttctggtcaatgatcacttacttaatttt1325
18
WO 00/50454 PC'T/US00/04732 -
AlaAlaLysLysAspIleLeuLeuValAsnAspHisLeuLeuAsnPhe
380 385 390
gtgagagagagaacattagacaaacgatggagagtacgcaaagaagcc 1373
ValArgGluArgThrLeuAspLysArgTrpArgValArgLysGluAla
395 400 405
atgatgggacttgcccaaatttataagaaatatgetttacagtcagca 1421
MetMetGlyLeuAlaGlnIleTyrLysLysTyrAlaLeuGlnSerAla
410 415 420
getggaaaagatgetgcaaaacagatagcatggatcaaagacaaattg 1469
AlaGlyLysAspAlaAlaLysGlnIleAlaTrpIleLysAspLysLeu
425 430 435 440
ctacatatatattatcaaaatagtattgatgatcgactacttgttgaa 1517
LeuHisIleTyrTyrGlnAsnSerIleAspAspArgLeuLeuValGlu
445 450 455
cggatctttgetcaatacatggttcctcacaatttagaaactacagaa 1565
ArgIlePheAlaGlnTyrMetValProHisAsnLeuGluThrThrGlu
460 465 470
cggatgaaatgcttatattacttgtatgccacactggatttaaatget 1613
ArgMetLysCysLeuTyrTyrLeuTyrAlaThrLeuAspLeuAsnAla
475 480 485
gtgaaagcattgaatgaaatgtggaaatgtcaaaatctgctccgacat 1661
ValLysAlaLeuAsnGluMetTrpLysCysGlnAsnLeuLeuArgHis
490 495 500
caagtaaaggatttgcttgacttgattaagcaacccaaaacagatgcc 1709
GlnValLysAspLeuLeuAspLeuIleLysGlnProLysThrAspAla
505 510 515 520
agtgtcaaggccatattttcaaaagtgatggttattacaagaaattta 1757
SerValLysAlaIlePheSerLysValMetValIleThrArgAsnLeu
525 530 535
cctgatcctggtaaggetcaggatttcatgaagaaattcacacaggtg 1805
ProAspProGlyLysAlaGlnAspPheMetLysLysPheThrGlnVal
540 545 550
ttagaagatgatgagaaaataagaaagcagttagaagtacttgttagt 1853
LeuGluAspAspGluLysIleArgLysGlnLeuGluValLeuValSer
555 560 565
ccaacatgctcctgcaagcaggetgaaggttgtgtgcgtgaaataact 1901
ProThrCysSerCysLysGlnAlaGluGlyCysValArgGluIleThr
570 575 580
aagaagttgggcaaccccaaacagcctacaaatcctttcctggaaatg 1949
LysLysLeuGlyAsnProLysGlnProThrAsnProPheLeuGluMet
585 590 595 600
atcaagtttctcttggagaggatagcacctgtgcacatagataccgaa 1997
IleLysPheLeuLeuGluArgIleAlaProValHisIleAspThrGlu
605 610 615
tctatcagtgetcttattaaacaagtgaacaaatcaatagatggaaca 2045
SerIleSerAlaLeuIleLysGlnValAsnLysSerIleAspGlyThr
620 625 630
gcagatgatgaagatgagggtgttccaactgatcaagccatcagagca 2093
19
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCT/US00/04732 -
AlaAspAspGluAspGluGlyValProThrAspGlnAlaIleArgAla
635 640 645
ggtcttgaactgcttaaggtactctcatttacacatcccatctcattt 2141
GlyLeuGluLeuLeuLysValLeuSerPheThrHisProIleSerPhe
650 655 660
cattctgetgaaacatttgaatcattactggettgtctgaaaatggat 2189
HisSerAlaGluThrPheGluSerLeuLeuAlaCysLeuLysMetAsp
665 670 675 680
gatgaaaaagtagcagaagetgcactacaaattttcaaaaacacagga 2237
AspGluLysValAlaGluAlaAlaLeuGlnIlePheLysAsnThrGly
685 690 695
agcaaaattgaagaggattttccacacatcagatcagccttgcttcct 2285
SerLysIleGluGluAspPheProHisIleArgSerAlaLeuLeuPro
700 705 710
gttttacatcacaaatctaaaaaaggacccccccgtcaagccaaatat 2333
ValLeuHisHisLysSerLysLysGlyProProArgGlnAlaLysTyr
715 720 725
gccattcattgtatccatgcgatattttctagtaaagagacccagttt 2381
AlaIleHisCysIleHisAlaIlePheSerSerLysGluThrGlnPhe
730 735 740
gcacagatatttgagcctctgcataagagcctagatccaagcaacctg 2429
AlaGlnIlePheGluProLeuHisLysSerLeuAspProSerAsnLeu
745 750 755 760
gaacatctcataacaccattggttactattggtcatattgetctcctt 2477
GluHisLeuIleThrProLeuValThrIleGlyHisIleAlaLeuLeu
765 770 775
gcacctgatcaatttgetgetccttggaaatcttgggtagetactttc 2525
AlaProAspGlnPheAlaAlaProTrpLysSerTrpValAlaThrPhe
780 785 790
attgtgaaagatcttctcatgaatgatcggcttccagggaaaaagaca 2573
IleValLysAspLeuLeuMetAsnAspArgLeuProGlyLysLysThr
795 800 805
actaaactttgggttccagatgaagaagtatctcctgagacaatggtc 2621
ThrLysLeuTrpValProAspGluGluValSerProGluThrMetVal
810 815 820
aaaattcaggetattaaaatgatggttcgatggctacttggaatgaaa 2669
LysIleGlnAlaIleLysMetMetValArgTrpLeuLeuGlyMetLys
825 830 835 840
aataatcacagtaaatcaggaacttctaccttaagattgctaacaaca 2717
AsnAsnHisSerLysSerGlyThrSerThrLeuArgLeuLeuThrThr
845 850 855
atattgcatagtgatggagacttgacagaacaggggaaaattagtaaa 2765
IleLeuHisSerAspGlyAspLeuThrGluGlnGlyLysIleSerLys
860 865 870
ccagatatgtcacgtctgagacttgetgetgggagtgetattgtgaag 2813
ProAspMetSerArgLeuArgLeuAlaAlaGlySerAlaIleValLys
875 880 gg5
ctggcacaagaaccctgttaccatgaaatcatcacattagaacaatat 2861
WO 00/50454 PCT/US00/04732
LeuAlaGlnGluProCysTyrHisGluIleIleThrLeuGluGlnTyr
890 895 900
cagctatgtgcattagetatcaacgatgaatgctatcaagtaagacaa 2909
GlnLeuCysAlaLeuAlaIleAsnAspGluCysTyrGlnValArgGln
905 910 915 920
gtgtttgcccagaaacttcacaaaggcctttcccgtttacggcttcca 2957
ValPheAlaGlnLysLeuHisLysGlyLeuSerArgLeuArgLeuPro
925 930 935
cttgagtatatggcaatctgtgccctttgtgcaaaagatcctgtaaag 3005
LeuGluTyrMetAlaIleCysAlaLeuCysAlaLysAspProValLys
940 945 950
gagagaagagetcatgetaggcaatgtttggtgaaaaatataaatgta 3053
GluArgArgAlaHisAlaArgGlnCysLeuValLysAsnIleAsnVal
955 960 965
aggcgggagtatctgaagcagcatgcagetgttagtgaaaaattattg 3101
ArgArgGluTyrLeuLysGlnHisAlaAlaValSerGluLysLeuLeu
970 975 980
tctcttctaccagagtatgttgttccatatacaattcaccttttggca 3149
SerLeuLeuProGluTyrValValProTyrThrIleHisLeuLeuAla
985 990 995 1000
catgacccagattatgtcaaagtacaggatattgaacaacttaaagat 3197
HisAspProAspTyrValLysValGlnAspIleGluGlnLeuLysAsp
1005 1010 1015
gttaaagaatgtctttggtttgttctggaaatattaatggetaaaaat 3245
ValLysGluCysLeuTrpPheValLeuGluIleLeuMetAlaLysAsn
1020 1025 1030
gaaaataacagtcacgettttatcagaaagatggtagaaaatattaaa 3293
GluAsnAsnSerHisAlaPheIleArgLysMetValGluAsnIleLys
1035 1040 1045
caaacaaaagatgcccaaggaccagatgatgcaaaaatgaatgaaaaa 3341
GlnThrLysAspAlaGlnGlyProAspAspAlaLysMetAsnGluLys
1050 1055 1060
ctgtacactgtgtgtgatgttgccatgaatatcatcatgtcaaagagt 3389
LeuTyrThrValCysAspValAlaMetAsnIleIleMetSerLysSer
1065 1070 1075 1080
actacatacagtttggaatctcctaaagacccggtactaccagetcgt 3437
ThrThrTyrSerLeuGluSerProLysAspProValLeuProAlaArg
1085 1090 1095
ttcttcactcaacctgacaagaatttcagtaacaccaaaaattatctg 3485
PhePheThrGlnProAspLysAsnPheSerAsnThrLysAsnTyrLeu
1100 1105 1110
cctcctgaaatgaaatcatttttcactcctggaaaacctaaaacaacc 3533
ProProGluMetLysSerPhePheThrProGlyLysProLysThrThr
1115 1120 1125
aatgttctaggagetgttaacaagccactttcatcagcaggcaagcaa 3581
AsnValLeuGlyAlaValAsnLysProLeuSerSerAlaGlyLysGln
1130 1135 1140
tctcagaccaaatcatcacgaatggaaactgtaagcaatgcaagcagc 3629
21
CA 02363605 2001-08-23
CA 02363605 2001-08-23
WO 00/50454 PCTNS00/04732 -
Ser Gln Thr Lys Ser Ser Arg Met Glu Thr Val Ser Asn Ala Ser Ser
1145 1150 1155 1160
agc tca aat cca agc tct cct gga aga ata aag ggg agg ctt gat agt 3677
Ser Ser Asn Pro Ser Ser Pro Gly Arg Ile Lys Gly Arg Leu Asp Ser
1165 1170 1175
tct gaa atg gat cac agt gaa aat gaa gat tac aca atg tct tca cct 3725
Ser Glu Met Asp His Ser Glu Asn Glu Asp Tyr Thr Met Ser Ser Pro
1180 1185 1190
ttg ccg ggg aaa aaa agt gac aag aga gac gac tct gat ctt gta agg 3773
Leu Pro Gly Lys Lys Ser Asp Lys Arg Asp Asp Ser Asp Leu Val Arg
1195 1200 1205
tct gaa ttg gag aag cct aga ggc agg aaa aaa acg ccc gtc aca gaa 3821
Ser Glu Leu Glu Lys Pro Arg Gly Arg Lys Lys Thr Pro Val Thr Glu
1210 1215 1220
cag gag gag aaa tta ggt atg gat gac ttg act aag ttg gta cag gaa 3869
Gln Glu Glu Lys Leu Gly Met Asp Asp Leu Thr Lys Leu Val Gln Glu
1225 1230 1235 1240
cag aaa cct aaa ggc agt cag cga agt cgg aaa aga ggc cat acg get 3917
Gln Lys Pro Lys Gly Ser Gln Arg Ser Arg Lys Arg Gly His Thr Ala
1245 1250 1255
tca gaa tct gat gaa cag cag tgg cct gag gaa aag agg ctc aaa gaa 3965
Ser Glu Ser Asp Glu Gln Gln Trp Pro Glu Glu Lys Arg Leu Lys Glu
1260 1265 1270
gat ata tta gaa aat gaa gat gaa cag aat agt ccg cca aaa aag ggt 4013
Asp Ile Leu Glu Asn Glu Asp Glu Gln Asn Ser Pro Pro Lys Lys Gly
1275 1280 1285
aaa aga ggc cga cca cca aaa cct ctt ggt gga ggt aca cca aaa gaa 4061
Lys Arg Gly Arg Pro Pro Lys Pro Leu Gly Gly Gly Thr Pro Lys Glu
1290 1295 1300
gag cca aca atg aaa act tct aaa aaa gga agc aaa aaa aaa tct gga 4109
Glu Pro Thr Met Lys Thr Ser Lys Lys Gly Ser Lys Lys Lys Ser Gly
1305 1310 1315 1320
cct cca gca cca gag gag gag gaa gaa gaa gaa aga caa agt gga aat 4157
Pro Pro Ala Pro Glu Glu Glu Glu Glu Glu Glu Arg Gln Ser Gly Asn
1325 1330 1335
acg gaa cag aag tcc aaa agc aaa cag cac cga gtg tca agg aga gca 4205
Thr Glu Gln Lys Ser Lys Ser Lys Gln His Arg Val Ser Arg Arg Ala
1340 1345 1350
cag cag aga gca gaa tct cct gaa tct agt gca att gaa tcc aca cag 4253
Gln Gln Arg Ala Glu Ser Pro Glu Ser Ser Ala Ile Glu Ser Thr Gln
1355 1360 1365
tcc aca cca cag aaa gga cga gga aga cca tca aaa acg cca tca cca 4301
Ser Thr Pro Gln Lys Gly Arg Gly Arg Pro Ser Lys Thr Pro Ser Pro
1370 1375 1380
tca caa cca aaa aaa aat gtg taagttgtaa atattacatt tcaaaccaat 4352
Ser Gln Pro Lys Lys Asn Val
1385 1390
ttcaaattat tttgcaaaag ttcctaaatt tgtaaacata catattgctg tatttaaatt 4412
22
WO 00/50454 PCT/US00/04732
ccatatattt agccccatta cactaggtac ggcggcgaag tgctaaaagg gaacggcgat 4472
gaacaaatgt aattaataac tttctctgtg aaagctttgg aaaaatcttt tttttttttt 4532
tttttttttg gtcaagcttg aggctgaata aagcctttga tgcacaaaat gggactgctg 4592
aagagtggac agttggacct tactttggtg accccataca tttgtggtca catgctttag 4652
ccatacacat ggtaacattg actatggagt cttgtgaaag tgtaatgtgc gatggctatg 4712
tagacataaa gaagaaactt gtaaatatct tttttctttt ttttaatgtt tctgatttct 4772
gaagtgcttg tatagctttt atctgcggct ttaaactgac agtacccgac tgtttattgg 4832
atctattgat ttgaaaagaa tttgttagga tagatcttaa gcagtaatct gtcagtgttt 4892
gtatttgtat tttctgcaat tttactgtga aaaaaaattt gttttcaaca attggtgtca 4952
ttttcttgat gtcactattt gttggagagt taaatggtct cttccctttg tgtatcttac 5012
ctagtgttta ctcctgggca cccttaatct tcagaggtgc taaattgtct gccattacac 5072
cagaaggatg cctctgatag gaggacaacc atgcaaattg tgaaatagtc ctgaagttct 5132
tggattactt tacacctcag tattgatttg tcccagaatt ttctggcctt tcatggcaat 5192
gaaaatttta agaagaaaga tttaaagtat tttaatttta aagagtgtgt tataaaataa 5252
tgtactgaat tctttatccc attttatcat cctttcagtt tttattaatc tactgtatca 5312
ataaaattct gtaatttgaa tgagtaaaaa aaaaaaaaaa aaa 5355
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Consensus
Sequence
<400> 5
ctawwagscc csgcscaw lg
23
CA 02363605 2001-08-23
