Note: Descriptions are shown in the official language in which they were submitted.
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE I)E CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST ~.E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional vohxmes please contact the Canadian Patent Oi~ice.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
1
GALECTIN 11
FIELD OF THE INVENTION
The present invention relates to a novel galectin. More specifically, isolated
nucleic
acid molecules are provided encoding human galectin 11. Galectin 11
polypeptides are also
provided, as are vectors, host cells, recombinant methods for producing the
same, and
antibodies to galectin 11 polypeptides. The invention further relates to
screening methods for
identifying agonists and antagonists of galectin 11 activity. Also provided
are diagnostic
l0 methods for detecting cell growth disorders and therapeutic methods for
cell growth disorders,
including autoimmune diseases, cancer, and inflammatory diseases.
BACKGROUND OF THE INVENTION
Lectins are proteins that bind to specific carbohydrate structures and can
thus
recognize particular glycoconjugates. Barondes et al., J. Biol. Chem.
269(33):20807-20810
(1994). Galectins are members of a family of ~3-galactoside-binding lectins
with related amino
acid sequences (For review see, Barondes et al., Cell 76:597-598 (1994);
Barondes et al., J.
Biol. Chem. 269(33):20807-20810 (1994)). Although a large number of
glycoproteins
containing (3-galactoside sugars are produced by the cell, only a few will
bind to known
galectins in vitro. Such apparent binding specificity suggests a highly
specific functional role
for the galectins.
Galectin 1 (conventionally termed LGALSl for lectin, g~alactoside-binding,
soluble -1,
but which is also known as: L-14-1, L-14, RL-14.5, galaptin, MGBP, GBP, BHL,
CHA,
HBP, HPL, HLBP 14, rIML-1) is a homodimer with a subunit molecular mass of
14,500
Daltons. Galectin 1 is expressed abundantly in smooth and skeletal muscle, and
to a lesser
extent in many other cell types (Couraud et al., J. Biol. Chem. 264:1310-1316
(1989).
Galectin 1 is thought to specifically bind laminin, a highly
polylactosaminated cellular
glycoprotein, as well as the highly polylactosaminated lysosome-associated
membrane
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
2
proteins (LAMPs). Galectin 1 has also been shown to bind specifically to a
lactosamine-
containing glycolipid found on olfactory neurons and to integrin a~bl on
skeletal muscle cells.
Other members of the Galectin family have also been reported. Galectin 2 was
originally found in hepatoma and is a homodimer with a subunit molecular mass
of 14,650
Daltons (Gitt et al., J. Biol. Chem. 267:10601-10606 (1992)). Galectin 3
(a.k.a., Mac-2,
EPB, CBP-35, CBP-30, and L-29) is abundant in activated macrophages and
epithelial cells
and is a monomer with an apparent molecular mass between 26,320 and 30,300
Daltons
(Cherayil et al., Proc. Natl. Acad. Sci. USA 87: 7324-7326 (1990)). Galectin 3
has been
observed to bind specifically to laminin, immunoglobulin E and its receptor,
and bacterial
to lipopolysaccharides. Galectin 4 has a molecular mass of 36,300 Daltons and
contains two
carbohydrate-binding domains within a single polypeptide chain (Oda et al., J.
Biol. Chem.
268:5929-5939 (1993)). Galectins 5 and 6 are discussed in Barondes et al.,
Cell 76:597-598
(1994). Human Galectin 7 has a molecular mass of 15,073 Daltons and is found
mainly in
stratified squamous epithelium (Madsen et al., J. Biol. Chem. 270(11):5823-
5829 (1995)).
Animal lectins, in general, often function in modulating cell-cell and cell-
matrix
interactions. Galectin 1 has been shown to either promote or inhibit cell
adhesion depending
upon the cell type in which it is present. Galectin I inhibits cell-matrix
interactions in
skeletal muscle presumably, by galectin 1-mediated disruption of laminin-
integrin a~b~
interactions (Cooper et al., J. Cell Biol. 115:1437-1448 (1991)). In several
non-skeletal
2o muscle cell types, Galectin 1 promotes cell-matrix adhesion possibly by
cross-linking cell
surface and substrate glycoconjugates (Zhou et al., Arch. Bioch. Biophys.
300:6-17 (1993);
Skrincosky et al., Cancer Res. 53:2667-2675 (1993)).
Galectin 1 also participates in regulating cell proliferation (Wells et al.,
Cell 64:91-97
(1991)) and some immune functions (Offner et al., J. Neuroimmunol. 28:177-184
(1990)).
Galectin 1 induces the release of tumor necrosis factor from macrophages
(Kajikawa et al.,
Life Sci. 39:1177-1181 (1986). Galectin 1 has also been demonstrated to have
therapeutic
activity against autoimmune diseases in animal models for experimental
myasthenia gravis,
and experimental autoimmune encephalomyelitis (Levi et al., Eur. J. Immunol.
13:500-507
(1983); and Offner et al., J. Neuroimmunol. 28:177-184 (1990), respectively).
Additionally,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
3
galectin 1 has been shown to regulate immune response by mediating apoptosis
of T cells
(Perillo et al., Nature 378:736-739 (1995)).
Galectin 3 promotes the growth of cells cultured under restrictive culture
conditions
(Yang et al., Proc. Natl. Acad. Sci. USA 93:6737-6742 (June 1996)). Galectin 3
expression in
cells confers resistance to apoptosis which indicates that galectin 3 could be
a cell death
suppresser which interferes in a common pathway of apoptosis. Id. Galectin 3
has also been
observed to function in modulating cell-adhesion, as well as in the activation
of certain
immune cells by cross-linking IgE and IgE receptors.
Recently, a galectin-like antigen designated HOM-HD-21 was found to be highly
l0 expressed in a Hodgkin's Disease cDNA library and another galectin, termed
PCTA-1, was
identified as a specific cell surface marker on human prostate cancer cell
lines and patient-
derived carcinomas.
Thus, galectins have been observed to be involved in the regulation of immune
cell
activity, as well as in such diverse processes as cell adhesion,
proliferation, inflammation,
autoimmunity, and metastasis of tumor cells. Accordingly, there is a need in
the art for the
identification of novel galectins which can serve as useful tools in the
development of
therapeutics and diagnostics for regulating immune response, inflammatory
disease and
cancer.
2o SUMMARY OF THE INVENTION
The present invention provides isolated nucleic acid molecules comprising, or
alternatively consisting of, a polynucleotide encoding the galectin 11
polypeptide having the
amino acid sequence shown in Figure 1 (SEQ ID N0:2), the amino acid sequence
encoded by
the cDNA clone deposited in a bacterial host as ATCC Deposit Number 209053, on
May 16,
1997, and fragments, variants, derivatives, and analogs thereof.
The present invention also provides isolated nucleic acid molecules comprising
a
polynucleotide encoding the galectin 11 polypeptide having the amino acid
sequence shown in
Figure 6 (SEQ ID N0:14), referred to herein sometimes as "Galectin-l la" and
fragments,
variants, derivatives, and analogs thereof.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
4
The present invention also provides isolated nucleic acid molecules comprising
a
polynucleotide encoding the galectin 11 polypeptide having the amino acid
sequence shown in
Figures 6 and 8 (SEQ ID N0:16), referred to herein sometimes as "Galectin-I 1
~i", and
fragments, variants, derivatives, and analogs thereof.
The galectin 11 of Figure 1 (SEQ ID NOS:1 and 2), the galectin 11 a of Figure
6 (SEQ
ID NOS:24 and 25), and the galectin 11 (3 of Figures 6-8 (SEQ ID NOS:26 and
27) are often
referred to herein collectively as, e.g., "galectin 11."
The galectin 11 polynucleotide of Figure 1 (SEQ ID NO:1), the galectin 11a
polynucleotide of Figure 6 (SEQ ID N0:24), and the galectin 11 (3
polynucleotide of Figure 7
l0 (SEQ ID N0:26) are often referred to herein collectively as, e.g.,
"galectin 11
polynucleotides."
The present invention also relates to recombinant vectors which include the
isolated
nucleic acid molecules of the invention, and to host cells containing the
recombinant vectors,
as well as to methods of making such vectors and host cells and for using them
for production
of galectin 11 polypeptides by recombinant techniques.
The invention further provides isolated galectin 11 polypeptides, including
galectin 11
of SEQ ID N0:2 and galectin 11 a and (3, having an amino acid sequence encoded
by a
polynucleotide described herein and antibodies which bind these polypeptides.
The galectin
11 polypeptide of Figure I (SEQ ID N0:2), the galectin l la polypeptide of
Figure 6 (SEQ
2o ID N0:25), and the galectin 11(3 polypeptide of Figure 7 (SEQ ID N0:27) are
often referred
to herein collectively as, e.g., "galectin 11 polypeptides."
The present invention also provides screening methods for identifying
compounds
capable of enhancing or inhibiting a cellular response, such as, for example,
apoptosis, induced
by galectin 11. Generally, these methods involve contacting galectin 11, the
candidate
compound, and a cell which expresses a galectin 11 ligand, assaying a cellular
response
resulting from the binding of galectin 11 with the ligand, and comparing the
cellular response
to a standard, the standard being assayed when contact of galectin 11 and the
galectin 11
ligand is made in the absence of the candidate compound; whereby, an increased
cellular
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
response over the standard indicates that the compound is an agonist and a
decreased cellular
response over the standard indicates that the compound is an antagonist.
In another aspect, a screening assay for agonists and antagonists is provided
which
involves determining the effect a candidate compound has on galectin 11
binding to a (3-
5 galactoside sugar. In particular, the method involves contacting a ~3-
galactoside sugar with a
galectin 11 polypeptide and a candidate compound and determining whether
galectin 11
binding to the (3-galactoside sugar is increased or decreased due to the
presence of the
candidate compound.
The invention also provides diagnostic methods useful during diagnosis of
disorders
l0 associated with elevated, decreased, or otherwise aberrant expression of
galectin 11.
The invention further provides for methods for treating an individual in need
of an
increased level of galectin 11 activity in the body comprising, administering
to such an
individual a composition comprising a therapeutically effective amount of an
isolated galectin
11 polypeptide, fragment, variant, derivative, or analog of the invention, or
an agonist thereof.
In another embodiment, the invention provides for methods for treating an
individual
in need of a decreased level of galectin 11 activity in the body comprising,
administering to
such an individual a composition comprising a therapeutically effective amount
of a galectin
11 fragment, variant, derivative, analog or antibody of the invention or
galectin 11 antagonist.
2o BRIEF DESCRIPTION OF THE FIGURES
Figure 1 shows the nucleotide sequence (SEQ ID NO:1 ) and deduced amino acid
sequence (SEQ ID N0:2) of galectin 11. The protein has a deduced molecular
mass of about
14.8 kDa. The complementary strand of the nucleotide sequence of SEQ ID NO:1
is shown
in SEQ ID N0:12.
Figure 2 shows the regions of similarity between the amino acid sequences of
the
galectin 11 protein (HJACE54), rat galectin 5 (SEQ ID N0:3), and human
galectin 8 (SEQ ID
N0:4). Identical amino acids shared between the galectins are shaded, while
conservative
amino acid changes are boxed. By examining the regions of amino acids shaded
and/or boxed,
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
6
the skilled artisan can readily identify conserved domains between the two
polypeptides.
These conserved domains are preferred embodiments of the present invention.
Figure 3 shows structural and functional features of galectin 11 (SEQ ID N0:2)
predicted using the default parameters of the indicated computer programs.
Alpha, beta, turn
and coil regions; hydrophilicity and hydrophobicity; amphipathic regions;
flexible regions;
antigenic index and surface probability are shown. In the Antigenic Index -
Jameson-Wolf
graph, the positive peaks indicate locations of the highly antigenic regions
of the galectin 11
protein, i.e., regions from which epitope-bearing peptides of the invention
can be obtained.
The domains defined by these graphs are contemplated by the present invention,
including for
1o example, amino acid residues 65-70 and 118-124 in Figure 1 (SEQ ID N0:2),
which
correspond to the shown highly antigenic regions of the galectin 11
polypeptide.
The data presented in Figure 3 are also represented in tabular form in Table
I. The
columns are labeled with the headings "Res", "Position", and Roman Numerals I-
XIII. The
column headings refer to the following features of the amino acid sequence
presented in Figure
3, and Table I: "Res": amino acid residue of SEQ ID N0:2 and Figure 1;
"Position": position
of the corresponding residue within SEQ ID N0:2 and Figures 1; I: Alpha,
Regions -
Garnier-Robson; II: Alpha, Regions - Chou-Fasman; III: Beta, Regions - Garnier-
Robson; IV:
Beta, Regions - Chou-Fasman; V: Turn, Regions - Garnier-Robson; VI: Turn,
Regions -
Chou-Fasman; VII: Coil, Regions - Garnier-Robson; VIII: Hydrophilicity Plot -
2o Kyte-Doolittle; IX: Alpha, Amphipathic Regions - Eisenberg; X: Beta,
Amphipathic Regions
- Eisenberg; XI: Flexible Regions - Karplus-Schulz; XII: Antigenic Index -
Jameson-Wolf; and
XIII: Surface Probability Plot - Emini.
Figure 4. Structure of human galectin 11 gene. The human galectin 11 gene is
located
on chromosome 11. This figure shows the structure of the region of chromosome
11
containing the galectin 11 gene and discloses the number of nucleotides
corresponding to the
transcribed (shaded) and untranscribed (open) portions of this region of the
chromosome.
The human galectin 11 gene contains 5 exons. The translation initiation site
is located on the
second exon. The nucleotide numbering identified in exons designated by roman
numerals
correspond to that presented in Figure 1 (SEQ ID NO:1).
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
7
Figure SA is a bar graph showing that transfection of Jurkat cells with a
galectin 11
expression construct (pEF-Legll) induces apoptosis of transfected cells.
Shaded bars
represent % apoptosis of Jurkat cells that have been transfected with the
galectin I1
expression construct, whereas open bars represent % apoptosis of Jurkat cells
that have been
transfected with the pEF control vector. Apoptosis was measured by two-color
cytometry
using mitoTraeker Red.
Figure SB is a bar graph showing the survival of GFP positive cells that have
been
successfully transfected, 4 days after transfection. The survival of the
transfected cells was
examined after co-transfection with either the control vector (pEFl), or the
galectin 11
to expression vector (pEF-Legl1). There were about 4 times more surviving GFP
positive cells
after transfection with pEFl than with pEF-Legl 1.
Figure 6 shows the nucleotide sequence (SEQ ID N0:24) and deduced amino acid
sequence (SEQ ID N0:25) of the complete galectin I 1 a cDNA and protein,
respectively.
Figure 7 is a schematic showing the relative positions of the 8 exons which
comprise
the galectin-11 gene. Also shown is the difference created by alternative
splicing between
galectin-11 a and galectin-11 (3 (galectin-11 a being 7 nucleotides longer at
the 5' terminus of
exon 2) resulting in divergent N-termini between the variants.
Figure 8 shows the difference between the polypeptide sequences of galectin-l
la and
galectin-11 (3. The complete nucleotide and amino acid sequences of galectin-
11 (3 are shown in
2o the sequence listing as SEQ ID NOS: 26 and 27, respectively.
DETAILED DESCRIPTION
The present invention provides isolated nucleic acid molecules comprising a
polynucleotide encoding a galectin 11 polypeptide having the amino acid
sequence shown in
Figure 1 (SEQ ID N0:2), Figure 6 (SEQ ID N0:25), or Figures 6 and 8 (SEQ ID
N0:27)
which were determined by sequencing cloned cDNAs. The nucleotide sequence
shown in
Figure 1 (SEQ ID NO:1 ) was obtained by sequencing the HJACE54 plasmid which
was
deposited on May 16, 1997 at the American Type Culture Collection, 10801
University
Boulevard, Manassas, Virginia, and given accession number 209053. The galectin
11
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
8
polypeptides of the present invention share sequence homology with rat
galectin 5, chicken
galectin 3, and human galectin 8 gene products (see, e.g., Figure 2; SEQ ID
NOS: 3-4).
The invention further provides for fragments, variants, derivatives and
analogs of
galectin 11 polynucleotides and polypeptides encoded thereby, and antibodies
which bind
these polypeptides.
Definitions
The following definitions are provided to facilitate understanding of certain
terms used
frequently herein.
"Functional activity" or "biological activity" refers to galectin 11
polypeptides,
fragments, derivatives, variants, and analogs, exhibiting activity similar,
but not necessarily
identical to, an activity of a galectin 11 polypeptide, including mature
forms, as measured in a
particular biological assay, with or without dose dependency. In the case
where dose
dependency does exist, it need not be identical to that of the galectin 11
polypeptide, but
rather substantially similar to the dose-dependence in a given activity as
compared to the
galectin 11 polypeptide (i.e., the candidate polypeptide will exhibit greater
activity or not
more than about 25-fold less and, preferably, not more than about tenfold less
activity, and
most preferably, not more than about three-fold less activity relative to the
galectin 11
polypeptide.) Such functional activities include, but are not limited to,
biological activity
(such as, for example, the ability to bind a (3-galactoside sugar, the ability
to agglutinate
trypsin-treated rabbit erythrocytes and/or to induce apoptosis), antigenicity
(ability to bind
or compete with a galectin 11 polypeptide for binding to an anti-galectin 11
antibody),
immunogenicity (ability to generate antibody which binds to a galectin 11
polypeptide), the
ability to form dimers with galectin 11 polypeptides of the invention, and the
ability to bind
to other galectins and/or a receptor or ligand for galectin 11.
Polynucleotides encoding
polypeptides having galectin 11 functional or biological activity, and the
complementary
strand of these polynucleotides are also encompassed by the invention.
"Polynucleotide" generally refers to any polyribonucleotide or
polydeoxyribonucleotide, which may be unmodified RNA or DNA, or modified RNA
or
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
9
DNA. "Polynucleotides" include, without limitation single- and double-stranded
DNA,
DNA that is a mixture of single- and double-stranded regions, single- and
double-stranded
RNA, and RNA that is mixture of single- and double-stranded regions, hybrid
molecules
comprising DNA and RNA that may be single-stranded or, more typically, double-
stranded
or a mixture of single- and double-stranded regions. In addition,
"polynucleotide" refers to
triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term
polynucleotide also includes DNAs or RNAs containing one or more modified
bases and
DNAs or RNAs with backbones modified for stability or for other reasons.
"Modified"
bases include, for example, tritylated bases and unusual bases such as
inosine. A variety of
to modifications have been made to DNA and RNA; thus, "polynucleotide"
embraces
chemically, enzymatically or metabolically modified forms of polynucleotides
as typically
found in nature, as well as the chemical forms of DNA and RNA characteristic
of viruses and
cells. "Polynucleotide" also embraces relatively short polynucleotides, often
referred to as
oligonucleotides.
"Polypeptide" refers to any peptide or protein comprising two or more amino
acids
joined to each other by peptide bonds or modified peptide bonds, i.e., peptide
isosteres.
"Polypeptide" refers to both short chains, commonly referred to as peptides,
oligopeptides or
oligomers, and to longer chains, generally referred to as proteins.
Polypeptides may contain
amino acids other than the 20 gene-encoded amino acids. "Polypeptides" include
amino acid
zo sequences modified either by natural processes, such as posttranslational
processing, or by
chemical modification techniques which are well known in the art. Such
modifications are
well described in basic texts and in more detailed monographs, as well as in a
voluminous
research literature. Modifications can occur anywhere in a polypeptide,
including the peptide
backbone, the amino acid side-chains and the amino or carboxyl termini. It
will be appreciated
that the same type of modification may be present in the same or varying
degrees at several
sites in a given galectin 11 polypeptide. Also, a given galectin 11
polypeptide may contain
many types of modifications. Galectin 11 polypeptides may be branched as a
result of
ubiquitination, and they may be cyclic, with or without branching. Cyclic,
branched and
branched cyclic polypeptides may result from posttranslation natural processes
or may be
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
made by synthetic methods. Modifications include acetylation, acylation, ADP-
ribosylation,
amidation, covalent attachment of flavin, covalent attachment of a heme
moiety, covalent
attachment of a nucleotide or nucleotide derivative, covalent attachment of a
lipid or lipid
derivative, covalent attachment of phosphotidylinositol, cross-linking,
cyclization, disulfide
5 bond formation, demethylation, formation of covalent cross-links, formation
of cysteine,
formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation,
GPI anchor
formation, hydroxylation, iodination, methylation, myristoylation, oxidation,
proteolytic
processing, phosphorylation, prenylation, racemization, selenoylation,
sulfation, transfer-
RNA mediated addition of amino acids to proteins such as arginylation, and
ubiquitination.
10 (See, for instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd
Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993 and Wold, F.,
Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12
in
POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C.
Johnson, Ed., Academic Press, New York, 1983; Seifter et al., "Analysis for
protein
is modifications and nonprotein cofactors", Meth Enzymol 182:626-646 (1990)
and Rattan et
al., "Protein Synthesis: Posttranslational Modifications and Aging", Ann NY
Acad Sci
663:48-62 (1992).)
"Variant" as the term is used herein, is a polynucleotide or polypeptide that
differs
from a reference polynucleotide or polypeptide respectively, but retains
functional or
2o biological activity of galectin 11. A typical variant of a polynucleotide
differs in nucleotide
sequence from another, reference polynucleotide. Changes in the nucleotide
sequence of the
variant may or may not alter the amino acid sequence of a polypeptide encoded
by the
reference polynucleotide. Nucleotide changes may result in amino acid
substitutions,
additions, deletions, fusions and truncations in the polypeptide encoded by
the reference
2s sequence, as discussed below. A typical variant of a polypeptide differs in
amino acid
sequence from another, reference polypeptide. Generally, differences are
limited so that the
sequences of the reference polypeptide and the variant are closely similar
overall and, in many
regions, identical. A variant and reference polypeptide may differ in amino
acid sequence by
one or more substitutions, additions, deletions in any combination. A
substituted or inserted
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
11
amino acid residue may or may not be one encoded by the genetic code. A
variant of a
polynucleotide or polypeptide may be a naturally occurring such as an allelic
variant, or it
may be a variant that is not known to occur naturally. Non-naturally occurring
variants of
polynucleotides and polypeptides may be made by mutagenesis techniques or by
direct
synthesis.
"Antibodies" as used herein includes polyclonal and monoclonal antibodies,
chimeric,
single chain, and humanized antibodies, as well as Fab fragments, including
the products of an
Fab or other immunoglobulin expression library.
l0 Nucleic Acid Molecules
The galectin 11 nucleotide sequence identified as SEQ ID NO:1 was assembled
from
partially homologous ("overlapping") sequences obtained from the deposited
clone. The
overlapping sequences were assembled into a single contiguous sequence of high
redundancy
resulting in a final sequence identified as SEQ ID NO:1.
Therefore, SEQ ID NO:1 and the translated SEQ ID N0:2 are sufficiently
accurate
and otherwise suitable for a variety of uses well known in the art and
described further below.
For instance, SEQ ID NO: l is useful for designing nucleic acid hybridization
probes that will
detect nucleic acid sequences contained in SEQ ID NO:1 or the cDNA contained
in the
deposited clone. These probes will also hybridize to nucleic acid molecules in
biological
samples, thereby enabling a variety of forensic and diagnostic methods of the
invention.
Similarly, polypeptides identified from SEQ ID N0:2 may be used, for example,
to generate
antibodies which bind specifically to proteins galectin 11.
Further, unless otherwise indicated, all nucleotide sequences determined by
sequencing
a DNA molecule herein were determined using an automated DNA sequencer (such
as the
Model 373 from Applied Biosystems, Inc.), and all amino acid sequences of
polypeptides
encoded by DNA molecules determined herein were predicted by translation of a
DNA
sequence determined as above. Therefore, as is known in the art for any DNA
sequence
determined by this automated approach, any nucleotide sequence determined
herein may
contain some errors. Nucleotide sequences determined by automation are
typically at least
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
12
about 90% identical, more typically at least about 95% to at least about 99.9%
identical to
the actual nucleotide sequence of the sequenced DNA molecule. The actual
sequence can be
more precisely determined by other approaches including manual DNA sequencing
methods
well known in the art. As is also known in the art, a single insertion or
deletion in a
determined nucleotide sequence compared to the actual sequence will cause a
frame shift in
translation of the nucleotide sequence such that the predicted amino acid
sequence encoded by
a determined nucleotide sequence will be completely different from the amino
acid sequence
actually encoded by the sequenced DNA molecule, beginning at the point of such
an insertion
or deletion.
1 o Accordingly, for those applications requiring precision in the nucleotide
sequence or
the amino acid sequence, the present invention provides not only the generated
nucleotide
sequence identified as SEQ ID NO:1 and the predicted translated amino acid
sequence
identified as SEQ ID N0:2, but also a sample of plasmid DNA containing a human
cDNA of
galectin 11 deposited with the ATCC. The nucleotide sequence of the deposited
galectin 11
clone can readily be determined by sequencing the deposited clone in
accordance with known
methods. The predicted galectin 11 amino acid sequence can then be verified
from such
deposits. Moreover, the amino acid sequence of the protein encoded by the
deposited clone
can also be directly determined by peptide sequencing or by expressing the
protein in a
suitable host cell containing the deposited human galectin 11 cDNA, collecting
the protein,
2o and determining its sequence.
Using the information provided herein, such as the nucleotide sequence in
Figure l, a
nucleic acid molecule of the present invention encoding a galectin 11
polypeptide may be
obtained using standard cloning and screening procedures, such as those for
cloning cDNAs
using mRNA as starting material. Illustrative of the invention, the nucleic
acid molecule
described in Figure 1 (SEQ ID NO:1) was discovered in a eDNA library derived
from G1
phase Jurkat T-cells. This gene was also identified in cDNA libraries
generated from human
neutrophil and human infant adrenal gland. Polynucleotides of the invention
can also be
obtained from natural sources such as mRNA or genomic DNA using techniques
known in the
art, or can be chemically synthesized using techniques known in the art.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
13
The human galectin 11 gene is located on chromosome 11 and contains 5 exons
(see,
e.g., Figure 4). The nucleotide sequence of the galectin 11 cDNA of Figure 1
(SEQ ID NO: l )
is 865 nucleotides in length (830 nucleotides discounting the poly A tail of
the cDNA) which
encodes a predicted open reading frame of 133 amino acid residues. There is a
predicted
initiation codon at nucleotides 49-51 of the nucleotide sequence depicted in
Figure 1 (SEQ ID
NO:l), located on the second exon of the gene. The galectin 11 protein shown
in Figure 1
(SEQ ID N0:2) shares homology with the translation product of rat galectin 5,
chicken
galectin 3, and human galectin 8 (see, e.g., Figure 2). Additionally, as
further discussed below,
galectin 11 induces apoptosis of transfected T-cells (see Example 5 and
Figures SA and SB).
to These findings indicate that galectin 11 functions in a manner similar to
other previously
characterized galectins and therefore, that galectin 11 is important in the
regulation of cell
growth disorders, autoimmune diseases, cancer, and inflammatory diseases.
The nucleotide sequence of the galectin 11 cDNA of Figure 6 (SEQ ID N0:24) is
1337
nucleotides in length. This is one of two alternatively spliced forms of
galectin lland is
referred to as galectin l l a. The other form, galectin 11 (3, differs only in
the loss of 7
nucleotides (nucleotides 136-142 as shown in Figure 6 (SEQ ID N0:24)). See
Figure 7. The
sequence of galectin 11 (3 is shown in the sequence listing as SEQ ID N0:26.
The resulting
translation products of these splice variants are believed to differ only at
the N-terminus.
The amino acid sequences of galectin 1 la and (3 are shown in the sequence
listing as SEQ ID
2o NOS:25 and 27, respectively. The differences between the two proteins are
highlighted in
Figure 8.
The galectin 11 polypeptide is comprised of two carbohydrate binding domains
(CARD domains) separated by a linker sequence. The first carbohydrate binding
domain
consists of the first 121 amino acid residues of galectin-l la (SEQ ID N0:25)
and the first
142 amino acids of galectin 11 (3 (SEQ ID N0:27). The 29 amino acid residues
following the
first CARD domain is the linker sequence. Finally, the last 125 amino acid
residues in each
protein is the C-terminal CARD domain. Preferred polypeptides of the invention
comprise
either an N-terminal or C-terminal CARD domain. Polynucleotides encoding such
polypeptides are also provided.
CA 02371611 2001-10-19
WO 00/63221 PCT/LIS00/10714
14
Also provided in the present invention are allelic variants, orthologs, and/or
species
homologs. Procedures known in the art can be used to obtain full-length genes,
allelic
variants, splice variants, full-length coding portions, orthologs, and/or
species homologs of
genes corresponding to SEQ ID NO:1-2, 24-25, 26-27, or the deposited clone,
using
information from the sequences disclosed herein or the clones deposited with
the ATCC. For
example, allelic variants and/or species homologs may be isolated and
identified by making
suitable probes or primers from the sequences provided herein and screening a
suitable nucleic
acid source for allelic variants and/or the desired homologue.
As one of ordinary skill would appreciate, due to the possibilities of
sequencing errors
to discussed above, as well as the variability of processing sites for
different known proteins,
the predicted galectin 11 polypeptide encoded by the deposited cDNA comprises
about 133
amino acid residues, but may be anywhere in the range of 125-150 amino acids.
As indicated, nucleic acid molecules of the present invention may be in the
form of
RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and
genomic
DNA obtained by cloning or produced synthetically. The DNA may be double-
stranded or
single-stranded. Single-stranded DNA or RNA may be the coding strand, also
known as the
sense strand, or it may be the non-coding strand, also referred to as the
complementary or
anti-sense strand.
By "isolated" nucleic acid molecules) is intended a nucleic acid molecule, DNA
or
2o RNA, which has been removed from its native environment (e.g., the natural
environment if it
is naturally occurring), and thus is altered "by the hand of man" from its
natural state. For
example, recombinant DNA molecules contained in a vector are considered
isolated for the
purposes of the present invention. Further examples of isolated DNA molecules
include
recombinant DNA molecules maintained in heterologous host cells or purified
(partially or
substantially) DNA molecules in solution. Isolated RNA molecules include in
vivo or in vitro
RNA transcripts of the DNA molecules of the present invention. Isolated
nucleic acid
molecules according to the present invention further include such molecules
produced
synthetically. In a specific embodiment, "isolated" nucleic acid molecules of
the invention
comprise all or a portion of the coding region of galectin 11, as disclosed in
Figure 1 (SEQ ID
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
NO:1) or galectin 1 la as disclosed in Figure 6 (SEQ ID N0:24), or galectin 11
~3 as disclosed
in SEQ ID N0:26. The term "isolated" does not refer to genomic or cDNA
libraries, whole
cell total or mRNA preparations, genomic DNA preparations (including those
separated by
electrophoresis and transferred onto blots), sheared whole cell genomic DNA
preparations or
5 other compositions where the art demonstrates no distinguishing features of
the
polynucleotide/sequences of the present invention.
Isolated nucleic acid molecules of the present invention include DNA molecules
comprising an open reading frame (ORF) or a portion of an ORF shown in Figure
1 or 6 (SEQ
ID N0:1, 24, or 26); and DNA molecules which comprise a sequence substantially
different
10 from those described above, but which due to the degeneracy of the genetic
code, still encode
the galectin 11 protein. Of course, the genetic code is well known in the art.
Thus, it would
be routine for one skilled in the art to generate such degenerate variants.
In specific embodiments, the invention provides isolated nucleic acid
molecules
encoding the full length galectin 11 polypeptide depicted in Figure 1 (SEQ ID
N0:2), and
15 galectin 11 nucleic acid molecules encoding the galectin 11 polypeptide
sequence encoded by
the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 209053,
on May
16, 1997. In a further embodiment, nucleic acid molecules are provided
encoding the full
length galectin 11 polypeptide lacking the N-terminal methionine. The
invention further
provides an isolated nucleic acid molecule having the nucleotide sequence
shown in Figure 1
(SEQ ID NO:1) or the nucleotide sequence of the galectin 11 cDNA contained in
the
above-described deposited clone, or a nucleic acid molecule having a sequence
complementary
to one of the above sequences. Such isolated molecules, particularly DNA
molecules, have
uses which include, but are not limited to, probes for gene mapping by in situ
hybridization
with chromosomes, and for detecting expression of the galectin 11 gene in
human tissue, for
instance, by Northern blot analysis. The invention further provides a
polynucleotide
encoding a polypeptide comprising the full-length amino acid sequence shown as
SEQ ID
N0:25 or 27, with or without an N-terminal methoinine.
In specific embodiments, the polynucleotides of the invention are at least 15,
at least
30, at least 50, at least 100, at least 125, at least 500, or at least 1000
continuous nucleotides
CA 02371611 2001-10-19
WO 00/63221 PCT/IJS00/10714
16
but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb,
7.5kb, 5 kb, 2.5 kb,
2.0 kb, or 1 kb, in length. In a further embodiment, polynucleotides of the
invention comprise
a portion of the coding sequences, as disclosed herein, but do not comprise
all or a portion of
any intron. In another embodiment, the polynucleotides comprising coding
sequences do not
contain coding sequences of a genomic flanking gene (i.e., 5' or 3' to the
galectin 11 gene of
interest on chromosome II). In other embodiments, the polynucleotides of the
invention do
not contain the coding sequence of more than 1000, 500, 250, 100, 50, 25, 20,
15, 10, 5, 4, 3,
2, or 1 genomic flanking gene(s).
The present invention is further directed to fragments of the isolated nucleic
acid
l0 molecules described herein. By a fragment of an isolated nucleic acid
molecule having the
nucleotide sequence of the deposited cDNA, the nucleotide sequence shown in
Figures 1 and
6 (SEQ ID NOS:1, 24, and 26), or the complementary strand thereto, is intended
fragments of
at least about 15 nt, and more preferably at least about 20 nt, still more
preferably at least
about 30 nt, and even more preferably, at least about 40 nt in length. By a
fragment at least
20 nt in length, for example, is intended fragments which include 20 or more
contiguous bases
from the nucleotide sequence of the deposited cDNA or the nucleotide sequence
as shown in
Figure 1 (SEQ ID NO:1) or the cDNA shown in Figure 6 (SEQ ID NOS:24 and 26) or
the
complementary strand thereto. Also encompassed by the invention are DNA
fragments
comprising 50, 100, 150, 200, 250, 300, 350, 365, 370, 375, 380, 400, 450,
500, 550, 600,
650, 700, 750, 800, 850 contiguous nucleotides of the sequence shown in Figure
1 (SEQ ID
NO:1), the strand complementary thereto, or contained in the deposited clone.
The present
invention also encompasses fragments corresponding to most, if not all, of the
nucleotide
sequence of the deposited cDNA or as shown in Figure 1 (SEQ ID NO:1) or the
complimentary strand thereto. In further embodiments, the polynucleotide
fragments of the
invention comprise a sequence which encodes amino acids 1-14, 1-20, 1-40, 1-
66, 2-67, 3-8,
3-67, 5-108, 5-128, 10-17, 10-20, 12-16, 13-20, 13-68, 14-67, 23-40, 20-50, 40-
108, 41-60,
47-61, 47-108, 47-128, 50-100, 61-80, 65-108, 65-128, 66-108, 76-88, 81-100,
88-108, 88-
128, 95-101, 101-133, 108-120, 114-128, and/or 114-128 of the amino acid
sequence depicted
in Figure 1 (SEQ ID N0:2). In preferred embodiments, polynucleotide fragments
of the
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
17
invention encode a polypeptide which demonstrates a galectin 11 functional
activity.
Fragments of the invention have numerous uses which include, but are not
limited to,
diagnostic probes and primers as discussed herein.
Preferred nucleic acid fragments of the present invention include nucleic acid
molecules
encoding epitope-bearing portions of the galectin 11 protein. In particular,
such nucleic acid
fragments of the present invention include nucleic acid molecules encoding: a
polypeptide
comprising amino acid residues from about 65-70 and 118-124 in Figure 1 (SEQ
ID N0:2).
The inventors have determined that the above polypeptide fragments are
antigenic regions of
the galectin 11 protein. Methods for determining other such epitope-bearing
portions of the
galectin 11 protein are described in detail below.
In other embodiments, the invention provides an isolated nucleic acid molecule
comprising, or alternatively consisting of, a polynucleotide which hybridizes
under stringent
hybridization conditions to all or a portion of a galectin 11 polynucleotides
(including
fragments) described herein, the complementary strand thereof, the cDNA clone
contained in
ATCC Deposit No. 209053, on May 16, 1997, or fragments thereof. By "stringent
hybridization conditions" is intended overnight incubation at 42°C in a
solution comprising:
50% formamide, 5X SSC (750 mM NaCI, 75mM trisodium citrate), 50 mM sodium
phosphate (pH 7.6), 5X Denhardt's solution, 10% dextran sulfate, and 20 ~g/ml
denatured,
sheared salmon sperm DNA, followed by washing the filters in 0.1 X SSC at
65°C.
Also contemplated are nucleic acid molecules that hybridize to the galectin 11
polynucleotides under lower stringency hybridization conditions. Changes in
the stringency
of hybridization and signal detection are primarily accomplished through the
manipulation of
formamide concentration (lower percentages of formamide result in lowered
stringency); salt
conditions, or temperature. For example, lower stringency conditions include
an overnight
incubation at 37 degree C in a solution comprising 6X SSPE (20X SSPE = 3M
NaCI; 0.2M
NaHZP04; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 ug/ml salmon sperm
blocking DNA; followed by washes at 50 degree C with 1XSSPE, 0.1% SDS. In
addition, to
achieve even lower stringency, washes performed following stringent
hybridization can be
done at higher salt concentrations (e.g. SX SSC).
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
18
Note that variations in the above conditions may be accomplished through the
inclusion and/or substitution of alternate blocking reagents used to suppress
background in
hybridization experiments. Typical blocking reagents include Denhardt's
reagent, BLOTTO,
heparin, denatured salmon sperm DNA, and commercially available proprietary
formulations.
The inclusion of specific blocking reagents may require modification of the
hybridization
conditions described above, due to problems with compatibility.
By a polynucleotide which hybridizes to a portion of a polynucleotide is
intended a
polynucleotide (either DNA or RNA) hybridizing to at least about 15
nucleotides (nt), and
more preferably at least about 20, still more preferably at least about 30,
50, 60, 75, 100, 150,
175, 200, 250, 300, 350 nt preferable about 30-70 nt, or 80-150 nucleotides,
or the entire
length of the reference polynucleotide. By a portion of a polynucleotide of at
least "20 nt in
length", for example, is intended 20 or more contiguous nucleotides from the
nucleotide
sequence of the reference polynucleotide (e:g., the deposited cDNA or the
nucleotide
sequence as depicted in Figure 1 (SEQ ID NO:1). In specific embodiments, the
polynucleotide hybridizes to nucleotides 0-20, 0-25, 0-30, 0-50, 51-100, 80-
100, 101-200,
201-300, 301-400, 401-450, 451-500, 501-550, 551-600, 601-700, 701-750, 751-
780, and/or
780-820 of the nucleotide sequence disclosed in Figure 1 (SEQ ID NO:1 ). In
other specific
embodiments, the polynucleotide hybridizes to a nucleotide sequence which
encodes amino
acid residues 1-14, 10-20, 20-50, 50-100, 100-133 of the amino acid sequence
depicted in
Figure 1 (SEQ ID N0:2). In specific embodiments, the polynucleotide hybridizes
to
nucleotides 1-20, 1-25, 1-30, 1-50, 51-100, 80-100, 101-200, 201-300, 301-400,
401-450,
451-500, 501-550, 551-600, 601-700, 701-750, 751-800, 801-850, 851-900, 901-
950, 951-
1,000, 1,001-1050, 1,051-1,100, 1,101-1,150, 1,151-1,200, 1,201-1,250, and/or
1,251-1,337
of the nucleotide sequence disclosed in SEQ ID N0:24. In other specific
embodiments, the
polynucleotide hybridizes to a nucleotide sequence which encodes amino acid
residues 1-14,
10-20, 20-50, 50-100, 100-130, 130-160, 160-210, 210-240 and/or 240-275 of the
amino acid
sequence depicted in SEQ ID N0:25. In specific embodiments, the polynucleotide
hybridizes
to nucleotides 1-20, 1-25, 1-30, 1-50, 51-100, 80-100, 101-200, 201-300, 301-
400, 401-450,
451-500, 501-550, 551-600, 601-700, 701-750, 751-800, 801-850, 851-900, 901-
950, 951-
CA 02371611 2001-10-19
WO 00/63221 PCT/C1S00/10714
19
1,000, 1,001-1050, 1,051-1,100, 1,101-1,150, 1,151-1,200, 1,201-1,250, and/or
1,251-1,330
of the nucleotide sequence disclosed in Figure SEQ ID N0:26. In other specific
embodiments, the polynucleotide hybridizes to a nucleotide sequence which
encodes amino
acid residues 1-14, 10-20, 20-50, 50-100, 100-130, 130-160, 160-210, 210-240,
240-270
and/or 270-296 of the amino acid sequence depicted in SEQ ID N0:27. These
polynucleotides have uses which include, but are not limited to, diagnostic
probes and
primers, as discussed above and in more detail below.
Of course, a polynucleotide which hybridizes only to a poly A sequence (such
as the
3' terminal poly(A) tract of the galectin 11 cDNA shown in Figure 1 (SEQ ID
NO:1), Figure
l0 6 (SEQ ID N0:24) or SEQ ID N0:26 or to a complementary stretch of T (or U)
residues,
would not be included in a polynucleotide of the invention used to hybridize
to a portion of a
nucleic acid of the invention, since such a polynucleotide would hybridize to
any nucleic acid
molecule containing a poly (A) stretch or the complement thereof (e.g.,
practically any
double-stranded cDNA clone generated using an oligo-dT primer).
As indicated, nucleic acid molecules of the present invention which encode a
galectin
11 polypeptide may include, but are not limited to, those encoding the amino
acid sequence of
the polypeptide, by itself; the coding sequence for the polypeptide and
additional sequences,
such as those encoding an amino acid leader or secretory sequence, such as a
pre-, or pro- or
prepro- protein sequence; the coding sequence of the polypeptide, with or
without the
2o aforementioned additional coding sequences, together with additional, non-
coding sequences,
including for example, but not limited to, introns and non-coding 5' and 3'
sequences, such as
the transcribed, non-translated sequences that play a role in transcription,
mRNA processing,
including splicing and polyadenylation signals, for example - ribosome binding
and stability
of mRNA; an additional coding sequence which codes for additional amino acids,
such as
those which provide additional functionalities. Thus, the sequence encoding
the polypeptide
may be fused to a marker sequence, such as a sequence encoding a peptide which
facilitates
purification of the fused polypeptide. In certain preferred embodiments of
this aspect of the
invention, the marker amino acid sequence is a hexa-histidine peptide, such as
the tag
provided in a pQE vector (Qiagen, Inc.), among others, many of which are
commercially
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824
(1989), for
instance, hexa-histidine provides for convenient purification of the fusion
protein. The
"HA" tag is another peptide useful for purification which corresponds to an
epitope derived
from the influenza hemagglutinin protein, which has been described by Wilson
et al., Cell
5 37:767-778 (1984). As discussed below, other such fusion proteins include
the galectin 11
fused to Fc at the N- or C-terminus.
The present invention is also directed to polynucleotide fragments of the
polynucleotides of the invention. In the present invention, a "polynucleotide
fragment" refers
to a short polynucleotide having a nucleic acid sequence which: is a portion
of that contained
1o in a deposited clone, or encoding the polypeptide encoded by the cDNA in a
deposited clone;
is a portion of that shown in SEQ ID NO:1, 24, or 26 or the complementary
strand thereto,
or is a portion of a polynucleotide sequence encoding the polypeptide of SEQ
ID N0:2, 25,
or 27. The nucleotide fragments of the invention are preferably at least about
15 nt, and more
preferably at least about 20 nt, still more preferably at least about 30 nt,
and even more
15 preferably, at least about 40 nt, at least about 50 nt, at least about 75
nt, or at least about 150
nt in length. A fragment "at least 20 nt in length," for example, is intended
to include 20 or
more contiguous bases from the cDNA sequence contained in a deposited clone or
the
nucleotide sequence shown in SEQ ID NO:1, 24, or 26. In this context "about"
includes the
particularly recited value, a value larger or smaller by several (5, 4, 3, 2,
or 1) nucleotides, at
2o either terminus or at both termini. These nucleotide fragments have uses
that include, but are
not limited to, as diagnostic probes and primers as discussed herein. Of
course, larger
fragments (e.g., 50, 150, 500, 600, 2000 nucleotides) are preferred.
Moreover, representative examples of polynucleotide fragments of the
invention,
include, for example, fragments comprising, or alternatively consisting of, a
sequence from
about nucleotide number 1-48, 49-99, 100-150, 151-201, 202-252, 253-303, 304-
354, 355
405, 406-450, 451-501, and 502 to the end of SEQ ID NO:1, or the complementary
strand
thereto, or the cDNA contained in the deposited clone. In this context "about"
includes the
particularly recited ranges, and ranges larger or smaller by several (5, 4, 3,
2, or 1 ) nucleotides,
at either terminus or at both termini. Preferably, these fragments encode a
polypeptide which
CA 02371611 2001-10-19
WO 00163221 PCT/US00/10714
21
has biological activity. More preferably, these polynucleotides can be used as
probes or
primers as discussed herein. Polynucleotides which hybridize to these nucleic
acid molecules
under stringent hybridization conditions or lower stringency conditions are
also encompassed
by the invention, as are polypeptides encoded by these polynucleotides.
The exact formulation, route of administration and dosage of the compounds of
the
invention to be administrated can be chosen by the individual physician in
view of the
patient's condition (see e.g., Fingl et al., 1975, in "The Pharmacological
Basis of
Therapeutics." Ch. 1 p. 1). Other methods will be known to the skilled artisan
and are within
the scope of the invention.
to However, many polynucleotide sequences, such as EST sequences, are publicly
available and accessible through sequence databases. Some of these sequences
are related to
SEQ ID NO:1 and may have been publicly available prior to conception of the
present
invention. Preferably, such related polynucleotides are specifically excluded
from the scope
of the present invention. To list every related sequence would be cumbersome.
Accordingly,
preferably excluded from the present invention are one or more polynucleotides
comprising a
nucleotide sequence described by the general formula of a-b, where a is any
integer between 1
to 851 of SEQ ID NO:1, b is an integer of 15 to 865, where both a and b
correspond to the
positions of nucleotide residues shown in SEQ ID NO:1, and where the b is
greater than or
equal to a + 14.
2o The present invention further relates to variants of the nucleic acid
molecules of the
present invention, which encode a portion (i.e., fragments), analogs or
derivatives of the
galectin 11 protein. Variants may occur naturally, such as a natural allelic
variant. By an
"allelic variant" is intended one of several alternate forms of a gene
occupying a given locus
on a chromosome of an organism. Genes Il, Lewin, B., ed., John Wiley & Sons,
New York
(1985). Non-naturally occurring variants may be produced using art-known
mutagenesis
techniques.
Such variants include those produced by nucleotide substitutions, deletions or
additions which may involve one or more nucleotides Particularly preferred are
variants in
which the nucleotide sequence encoding 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14 15, 20, 25,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
22
30, 35, 40, 50, or, 20-15, 15-10, 10-5 1-5, 1-3, or 1-2 amino acids of a
polypeptide of the
invention are substituted, deleted, or added in any combination. The variants
may be altered
in coding regions, non-coding regions, or both. Alterations in the coding
regions may produce
conservative or non-conservative amino acid substitutions, deletions or
additions. Especially
preferred among these are silent substitutions, additions and deletion, which
do not alter the
properties and activities of the galectin 11 protein or portions thereof. Also
especially
preferred in this regard are conservative substitutions.
Further embodiments of the invention include isolated nucleic acid molecules
comprising a polynucleotide having a nucleotide sequence at least 75%, 80%,
85%, or 90%
to identical, and more preferably at least 95%, 96%, 97%, 98% or 99% or 98-99%
identical to
(a) a nucleotide encoding amino acids 1 to 133 of SEQ ID N0:2; (b) a
nucleotide encoding
amino acids 2 to 133 of SEQ ID N0:2; (c) a nucleotide sequence of the galectin
11
polypeptide encoded by the cDNA contained in ATCC Deposit No. 209053; (d) a
nucleotide
encoding amino acids 1 to 275 of SEQ ID N0:25; (e) a nucleotide encoding amino
acids 1 to
296 of SEQ ID N0:27; (f) a nucleotide encoding amino acid residues 1 to 121 of
SEQ ID
N0:25; (g) a nucleotide encoding amino acid residues 1 to 142 of SEQ ID N0:27;
(h) a
nucleotide encoding amino acids 2 to 275 of SEQ ID N0:25; (i) a nucleotide
encoding amino
acid residues 2 to 296 of SEQ ID N0:27; (j) a nucleotide encoding amino acids
151 to 275 of
SEQ ID N0:25; or (k) fragments and other polynucleotide sequences of the
invention as
described herein. Polynucleotides which hybridize to these nucleic acid
molecules under
stringent hybridization conditions or lower stringency conditions are also
encompassed by
the invention, as are polypeptides encoded by these polynucleotides.
By a polynucleotide having a nucleotide sequence at least, for example, 95%
"identical" to a reference nucleotide sequence encoding a galectin 11
polypeptide of the
present invention is intended that the nucleotide sequence of the
polynucleotide is identical to
the reference sequence except that the polynucleotide sequence may include up
to five
nucleotide mismatches per each 100 nucleotides of the reference nucleotide
sequence encoding
the galectin 11 polypeptide. In other words, to obtain a polynucleotide having
a nucleotide
sequence at least 95% identical to a reference nucleotide sequence, up to 5%
of the
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
23
nucleotides in the reference sequence may be deleted or substituted with
another nucleotide,
or a number of nucleotides up to 5% of the total nucleotides in the reference
sequence may be
inserted into the reference sequence. These mutations of the reference
sequence may occur at
the 5' or 3' terminal positions of the reference nucleotide sequence or
anywhere between
those terminal positions, interspersed either individually among nucleotides
in the reference
sequence or in one or more contiguous groups within the reference sequence.
The query
sequence may be an entire sequence shown of SEQ ID NO:1, the ORF (open reading
frame),
or any fragment specified as described herein.
As a practical matter, whether any particular nucleic acid molecule is at
least 75%,
l0 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to, for instance,
the nucleotide
sequence shown in SEQ ID NOS: 1, 24, and 26 or to the nucleotides sequence of
the
deposited cDNA clone can be determined conventionally using known computer
programs,
such as, for example, the Bestfit program (Wisconsin Sequence Analysis
Package, Version 8
for Unix, Genetics Computer Group, University Research Park, 575 Science
Drive, Madison,
WI 53711. Bestfit uses the local homology algorithm of Smith and Waterman,
Advances in
Applied Mathematics 2: 482-489 (1981), to find the best segment of homology
between two
sequences. When using Bestfit or any other sequence alignment program to
determine
whether a particular sequence is, for instance, 95% identical to a reference
sequence according
to the present invention, the parameters are set, of course, such that the
percentage of
identity is calculated over the full length of the reference nucleotide
sequence and that gaps in
homology of up to 5% of the total number of nucleotides in the reference
sequence are
allowed.
A preferred method for determining the best overall match between a query
sequence
(a sequence of the present invention) and a subject sequence, also referred to
as a global
sequence alignment, is determined using the FASTDB computer program based on
the
algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245 ( 1990)). In a
sequence alignment
the query and subject sequences are both DNA sequences. An RNA sequence can be
compared by converting U's to T's. The result of said global sequence
alignment is in percent
identity. Preferred parameters used in a FASTDB alignment of DNA sequences to
calculate
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
24
percent identify are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=l, Joining
Penalty=30,
Randomization Group Length=0, Cutoff Score=1, Gap Penalty=5, Gap Size Penalty
0.05,
Window Size=500 or the length of the subject nucleotide sequence, whichever is
shorter.
According to this embodiment, if the subject sequence is shorter than the
query
sequence because of 5' or 3' deletions, not because of internal deletions, a
manual correction is
made to the results to take into consideration the fact that the FASTDB
program does not
account for 5' and 3' truncations of the subject sequence when calculating
percent identity.
For subject sequences truncated at the S' or 3' ends, relative to the query
sequence, the
percent identity is corrected by calculating the number of bases of the query
sequence that are
l0 5' and 3' of the subject sequence, which are not matched/aligned, as a
percent of the total bases
of the query sequence. A determination of whether a nucleotide is
matched/aligned is
determined by results of the FASTDB sequence alignment. This percentage is
then
subtracted from the percent identity, calculated by the above FASTDB program
using the
specified parameters, to arrive at a final percent identity score. This
corrected score is what
is used for the purposes of this embodiment. Only bases outside the 5' and 3'
bases of the
subject sequence, as displayed by the FASTDB alignment, which are not
matched/aligned
with the query sequence, are calculated for the purposes of manually adjusting
the percent
identity score.
For example, a 90 base subject sequence is aligned to a 100 base query
sequence to
determine percent identity. The deletions occur at the 5' end of the subject
sequence and
therefore, the FASTDB alignment does not show a matched/alignment of the first
10 bases at
5' end. The 10 unpaired bases represent 10% of the sequence (number of bases
at the 5' and
3' ends not matched/total number of bases in the query sequence) so 10% is
subtracted from
the percent identity score calculated by the FASTDB program. If the remaining
90 bases
were perfectly matched the final percent identity would be 90%. In another
example, a 90
base subject sequence is compared with a 100 base query sequence. This time
the deletions
are internal deletions so that there are no bases on the 5' or 3' of the
subject sequence which
are not matched/aligned with the query. In this case the percent identity
calculated by
FASTDB is not manually corrected. Once again, only bases 5' and 3' of the
subject sequence
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10?14
which are not matched/aligned with the query sequence are manually corrected
for. No other
manual corrections are made for the purposes of this embodiment.
The galectin 11 variants may contain alterations in the coding regions, non-
coding
regions, or both. Especially preferred are polynucleotide variants containing
alterations which
5 produce silent substitutions, additions, or deletions, but do not alter the
properties or
activities of the encoded polypeptide. Nucleotide variants produced by silent
substitutions
due to the degeneracy of the genetic code are preferred. Moreover, variants in
which 5-10, 1-
5, or 1-2 amino acids are substituted, deleted, or added in any combination
are also preferred.
Galectin 11 polynucleotide variants can be produced for a variety of reasons,
e.g., to optimize
10 codon expression for a particular host (change codons in the human mRNA to
those preferred
by a bacterial host such as E. coli).
Naturally occurring galectin 11 variants are called "allelic variants," and
refer to one of
several alternate forms of a gene occupying a given locus on a chromosome of
an organism.
(Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).) These allelic
variants can
15 vary at either the polynucleotide and/or polypeptide level and are included
in the present
invention. Alternatively, non-naturally occurring variants may be produced by
mutagenesis
techniques or by direct synthesis.
Using known methods of protein engineering and recombinant DNA technology,
variants may be generated to improve or alter the characteristics of the
galectin 11
20 polypeptides. For instance, one or more amino acids can be deleted from the
N-terminus or
C-terminus of the secreted protein without substantial loss of biological
function. The
authors of Ron et al., J. Biol. Chem. 268: 2984-2988 (1993), reported variant
KGF proteins
having heparin binding activity even after deleting 3, 8, or 27 amino-terminal
amino acid
residues. Similarly, Interferon gamma exhibited up to ten times higher
activity after deleting
25 8-10 amino acid residues from the carboxy terminus of this protein. (Dobeli
et al., J.
Biotechnology 7:199-216 (1988).)
Moreover, ample evidence demonstrates that variants often retain a biological
activity
similar to that of the naturally occurring protein. For example, Gayle and
coworkers (J. Biol.
Chem 268:22105-22111 (1993)) conducted extensive mutational analysis of human
cytokine
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
26
IL-la. They used random mutagenesis to generate over 3,500 individual IL-la
mutants that
averaged 2.5 amino acid changes per variant over the entire length of the
molecule. Multiple
mutations were examined at every possible amino acid position. The
investigators found that
"[m]ost of the molecule could be altered with little effect on either [binding
or biological
activity]." (See, Abstract.) In fact, only 23 unique amino acid sequences, out
of more than
3,500 nucleotide sequences examined, produced a protein that significantly
differed in activity
from wild-type.
Furthermore, even if deleting one or more amino acids from the N-terminus or C
terminus of a polypeptide results in modification or loss of one or more
biological functions,
l0 other biological activities may still be retained. For example, the ability
of a deletion variant
to induce andlor to bind antibodies which recognize the secreted form will
likely be retained
when less than the majority of the residues of the secreted form are removed
from the N-
terminus or C-terminus. Whether a particular polypeptide lacking N- or C-
terminal residues
of a protein retains such immunogenic activities can readily be determined by
routine methods
described herein and otherwise known in the art.
Thus, the invention further includes galectin 11 polypeptide variants which
show
substantial biological activity. Such variants include deletions, insertions,
inversions,
repeats, and substitutions selected according to general rules known in the
art so as have little
effect on activity.
2o The present application is directed to nucleic acid molecules at least 75%,
80%, 85%,
90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences
disclosed
herein (e.g., nucleic acid sequence shown in Figures 1 or 6 (SEQ ID NO:I, 24,
or 26), nucleic
acid sequence of the deposited cDNA clone, and nucleic acid sequences encoding
a
polypeptide having the amino acid sequence of an N and/or C terminal deletion
disclosed
below as m-n of SEQ ID N0:2, 25, or 27), irrespective of whether they encode a
polypeptide
having galectin 11 functional activity. This is because even where a
particular nucleic acid
molecule does not encode a polypeptide having galectin 11 functional activity,
one of skill in
the art would still know how to use the nucleic acid molecule, for instance,
as a hybridization
probe or a polymerase chain reaction (PCR) primer. Uses of the nucleic acid
molecules of the
CA 02371611 2001-10-19
WO 00/63221 PCT/USOO110714
27
present invention that do not encode a polypeptide having galectin 11
functional activity
include, inter alia, (1) isolating the galectin 11 gene or allelic or splice
variants thereof in a
cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase
chromosomal spreads to
provide precise chromosomal location of the galectin 11 gene, as described in
Verma et al.,
Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York
(1988);
(3) use in linkage analysis as a marker for chromosome 11; and (4) Northern
Blot analysis for
detecting galectin 11 mRNA expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least 75%,
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid
sequence
1o disclosed herein, shown in Figures 1 or 6 (SEQ ID NO:1, 24, or 26), nucleic
acid sequence of
the deposited cDNA clone, the nucleic acid encoding the polypeptide shown in
Figure 1 or 6
(SEQ ID N0:2, 25, or 27), and fragments thereof, which do, in fact, encode a
polypeptide
having galectin 11 functional activity. By "a polypeptide having galectin 11
functional
activity" is intended polypeptides exhibiting activity similar, but not
necessarily identical, to
a functional activity of the galectin 11 protein of the invention (e.g.,
complete (full-length)
galactin 11, and mature galactin 11), as measured in a particular assay. For
example, galectin
11 protein activity can be measured using a (3-galactoside sugar (e.g.,
thiodigalactoside or
lactose) binding assay, an assay for apoptosis and/or an assay for
agglutination of trypsin-
treated rabbit erythrocytes, as further described below.
Of course, due to the degeneracy of the genetic code, one of ordinary skill in
the art
will immediately recognize that a large number of the nucleic acid molecules
having a sequence
at least 75%, 80%, 85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99% identical to the
nucleic
acid sequence of the deposited cDNA, the nucleic acid sequence shown in Figure
1 or 6 (SEQ
ID NO:1, 24, or 26), the nucleic acid encoding the polypeptide shown in Figure
1 or 6 (SEQ
ID N0:2, 25, or 27), or fragment thereof, will encode "a polypeptide having
galectin 11
functional activity". In fact, since numerous degenerate variants of these
nucleotide sequences
encode the same polypeptide, this will be clear to the skilled artisan even
without performing
the above described comparison assay. It will be further recognized in the art
that, for such
nucleic acid molecules that are not degenerate variants, a reasonable number
will also encode a
CA 02371611 2001-10-19
WO 00163221 PCT/US00/10714
28
polypeptide having galectin 11 activity. This is because the skilled artisan
is fully aware of
amino acid substitutions that are either less likely or not likely to
significantly effect protein
function (e.g., replacing one aliphatic amino acid with a second aliphatic
amino acid), as
further described below.
For example, guidance concerning how to make phenotypically silent amino acid
substitutions is provided in Bowie et al., Deciphering the Message in Protein
Sequences:
Tolerance to Amino Acid Substitutions, Science 247:1306-1310 (1990), wherein
the authors
indicate that proteins are surprisingly tolerant of amino acid substitutions.
The first strategy exploits the tolerance of amino acid substitutions by
natural
to selection during the process of evolution. By comparing amino acid
sequences in different
species, conserved amino acids can be identified. These conserved amino acids
are likely
important for protein function. In contrast, the amino acid positions where
substitutions
have been tolerated by natural selection indicates that these positions are
not critical for
protein function. Thus, positions tolerating amino acid substitution could be
modified while
still maintaining biological activity of the protein.
The second strategy uses genetic engineering to introduce amino acid changes
at
specific positions of a cloned gene to identify regions critical for protein
function. For
example, site directed mutagenesis or alanine-scanning mutagenesis
(introduction of single
alanine mutations at every residue in the molecule) can be used. (Cunningham
and Wells,
2o Science 244:1081-1085 (1989).) The resulting mutant molecules can then be
tested for
biological activity.
As the authors state, these two strategies have revealed that proteins are
surprisingly
tolerant of amino acid substitutions. The authors further indicate which amino
acid changes
are likely to be permissive at certain amino acid positions in the protein.
For example, most
buried (within the tertiary structure of the protein) amino acid residues
require nonpolar side
chains, whereas few features of surface side chains are generally conserved.
Moreover,
tolerated conservative amino acid substitutions involve replacement of the
aliphatic or
hydrophobic amino acids Ala, Val, Leu and Ile; replacement of the hydroxyl
residues Ser and
Thr; replacement of the acidic residues Asp and Glu; replacement of the amide
residues Asn
CA 02371611 2001-10-19
WO 00/63221 PCT/LJS00110714
29
and Gln, replacement of the basic residues Lys, Arg, and His; replacement of
the aromatic
residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids
Ala, Ser, Thr,
Met, and Gly.
For example, site directed changes at the amino acid level of galectin 11 of
Figure 1
(SEQ ID N0:2) can be made by replacing a particular amino acid with a
conservative amino
acid. Preferred conservative mutations include: M 1 replaced with A, G, I, L,
S, T, or V; S2
replaced with A, G, I, L, T, M, or V; R4 replaced with H, or K; LS replaced
with A, G, I, S,
T, M, or V; E6 replaced with D; V7 replaced with A, G, I, L, S, T, or M; S10
replaced with
A, G, I, L, T, M, or V; H11 replaced with K, or R; A12 replaced with G, I, L,
S, T, M, or V;
1o L13 replaced with A, G, I, S, T, M, or V; Q15 replaced with N; G16 replaced
with A, I, L, S,
T, M, or V; L17 replaced with A, G, I, S, T, M, or V; S18 replaced with A, G,
I, L, T, M, or
V; G20 replaced with A, I, L, S, T, M, or V; Q21 replaced with N; V22 replaced
with A, G, I,
L, S, T, or M; I23 replaced with A, G, L, S, T, M, or V; I24 replaced with A,
G, L, S, T, M,
or V; V25 replaced with A, G, I, L, S, T, or M; R26 replaced with H, or K; G27
replaced with
A, I, L, S, T, M, or V; L28 replaced with A, G, I, S, T, M, or V; V29 replaced
with A, G, I, L,
S, T, or M; L30 replaced with A, G, I, S, T, M, or V; Q31 replaced with N; E32
replaced
with D; K34 replaced with H, or R; H35 replaced with K, or R; F36 replaced
with W, or Y;
T37 replaced with A, G, I, L, S, M, or V; V38 replaced with A, G, I, L, S, T,
or M; S39
replaced with A, G, I, L, T, M, or V; L40 replaced with A, G, I, S, T, M, or
V; R41 replaced
2o with H, or K; D42 replaced with E; Q43 replaced with N; A44 replaced with
G, I, L, S, T, M,
or V; A45 replaced with G, I, L, S, T, M, or V; H46 replaced with K, or R; A47
replaced with
G, I, L, S, T, M, or V; V49 replaced with A, G, I, L, S, T, or M; T50 replaced
with A, G, I, L,
S, M, or V; L51 replaced with A, G, I, S, T, M, or V; R52 replaced with H, or
K; A53
replaced with G, I, L, S, T, M, or V; S54 replaced with A, G, I, L, T, M, or
V; F55 replaced
with W, or Y; A56 replaced with G, I, L, S, T, M, or V; D57 replaced with E;
R58 replaced
with H, or K; T59 replaced with A, G, I, L, S, M, or V; L60 replaced with A,
G, I, S, T, M,
or V; A61 replaced with G, I, L, S, T, M, or V; W62 replaced with F, or Y; I63
replaced with
A, G, L, S, T, M, or V; S64 replaced with A, G, I, L, T, M, or V; R65 replaced
with H, or K;
W66 replaced with F, or Y; G67 replaced with A, I, L, S, T, M, or V; Q68
replaced with N;
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
K69 replaced with H, or R; K70 replaced with H, or R; L71 replaced with A, G,
I, S, T, M ,
or V; I72 replaced with A, G, L, S, T, M, or V; S73 replaced with A, G, I, L,
T, M, or V; A74
replaced with G, I, L, S, T, M, or V; F76 replaced with W, or Y; L77 replaced
with A, G, I, S,
T, M, or V; F78 replaced with W, or Y; Y79 replaced with F, or W; Q81 replaced
with N;
5 R82 replaced with H, or K; F83 replaced with W, or Y; F84 replaced with W,
or Y; E85
replaced with D; V86 replaced with A, G, I, L, S, T, or M; L87 replaced with
A, G, I, S, T,
M, or V; L88 replaced with A, G, I, S, T, M, or V; L89 replaced with A, G, I,
S, T, M, or V;
F90 replaced with W, or Y; Q91 replaced with N; E92 replaced with D; G93
replaced with A,
I, L, S, T, M, or V; G94 replaced with A, I, L, S, T, M, or V; L95 replaced
with A, G, I, S, T,
to M, or V; K96 replaced with H, or R; L97 replaced with A, G, I, S, T, M, or
V; A98 replaced
with G, I, L, S, T, M, or V; L99 replaced with A, G, I, S, T, M, or V; N100
replaced with Q;
6101 replaced with A, I, L, S, T, M, or V; Q102 replaced with N; 6103 replaced
with A, I,
L, S, T, M, or V; L104 replaced with A, G, I, S, T, M, or V; 6105 replaced
with A, I, L, S, T,
M, or V; A106 replaced with G, I, L, S, T, M, or V; T107 replaced with A, G,
I, L, S, M, or
15 V; S108 replaced with A, G, I, L, T, M, or V; M109 replaced with A, G, I,
L, S, T, or V;
N110 replaced with Q; Q111 replaced with N; Q112 replaced with N; A113
replaced with G,
I, L, S, T, M, or V; Ll 14 replaced with A, G, I, S, T, M, or V; E115 replaced
with D; Q116
replaced with N; L117 replaced with A, G, I, S, T, M, or V; 8118 replaced with
H, or K;
E119 replaced with D; L120 replaced with A, G, I, S, T, M, or V; 8121 replaced
with H, or
2o K; I122 replaced with A, G, L, S, T, M, or V; 5123 replaced with A, G, I,
L, T, M, or V;
6124 replaced with A, I, L, S, T, M, or V; S125 replaced with A, G, I, L, T,
M, or V; V126
replaced with A, G, I, L, S, T, or M; Q127 replaced with N; L128 replaced with
A, G, I, S, T,
M, or V; Y129 replaced with F, or W; V131 replaced with A, G, I, L, S, T, or
M; H132
replaced with K, or R; and/or S133 replaced with A, G, I, L, T, M, or V.
25 Using these same principles, similar conservative substitutions can be made
in the
polypeptide of SEQ ID N0:25 or 27.
The resulting constructs can be routinely screened for activities or functions
described
throughout the specification and known in the art. Preferably, the resulting
constructs have
an increased and/or a decreased galectin 11 activity or function, while the
remaining galectin 11
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
31
activities or functions are maintained. More preferably, the resulting
constructs have more
than one increased and/or decreased galectin 11 activity or function, while
the remaining
galectin 11 activities or functions are maintained.
Besides conservative amino acid substitution, variants of galectin 11 include
(i)
substitutions with one or more of the non-conserved amino acid residues, where
the
substituted amino acid residues may or may not be one encoded by the genetic
code, or (ii)
substitution with one or more of amino acid residues having a substituent
group, or (iii) fusion
of the mature polypeptide with another compound, such as a compound to
increase the
stability and/or solubility of the polypeptide (for example, polyethylene
glycol), or (iv)
to fusion of the polypeptide with additional amino acids, such as, for
example, an IgG Fc fusion
region peptide, or leader or secretory sequence, or a sequence facilitating
purification. Such
variant polypeptides are deemed to be within the scope of those skilled in the
art from the
teachings herein.
For example, galectin 11 polypeptide variants containing amino acid
substitutions of
charged amino acids with other charged or neutral amino acids may produce
proteins with
improved characteristics, such as less aggregation. Aggregation of
pharmaceutical
formulations both reduces activity and increases clearance due to the
aggregate's immunogenic
activity. (Pinckard et al., Clin. Exp. Immunol. 2:331-340 (1967); Robbins et
al., Diabetes 36:
838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems
10:307-377
(1993).)
For example, preferred non-conservative substitutions of galectin 11 of Figure
1 (SEQ
ID N0:2) include: M1 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S2
replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; P3 replaced with D, E, H, K, R, A, G,
I, L, S, T, M, V,
N, Q, F, W, Y, or C; R4 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C;
L5 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E6 replaced with H, K,
R, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; V7 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C;
P8 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C;
C9 replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; S10 replaced with
D, E, H, K, R,
N, Q, F, W, Y, P, or C; Hl 1 replaced with D, E, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, P, or
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
32
C; A12 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L13 replaced with
D, E, H, K, R,
N, Q, F, W, Y, P, or C; P 14 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W,
Y, or C; Q 15 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P,
or C; G 16
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L 17 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; S 18 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P
19 replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; G20 replaced with
D, E, H, K, R,
N, Q, F, W, Y, P, or C; Q21 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, F, W, Y, P,
or C; V22 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I23 replaced
with D, E, H, K,
R, N, Q, F, W, Y, P, or C; 124 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; V25
1o replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R26 replaced with D,
E, A, G, I, L, S, T,
M, V, N, Q, F, W, Y, P, or C; G27 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; L28
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V29 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; L30 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q31
replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; E32 replaced with H,
K, R, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; P33 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V,
N, Q, F, W, Y, or C; K34 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C;
H35 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F36
replaced with D,
E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T37 replaced with D, E, H,
K, R, N, Q, F,
W, Y, P, or C; V38 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S39
replaced with D,
2o E, H, K, R, N, Q, F, W, Y, P, or C; L40 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C;
R41 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D42
replaced with H,
K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q43 replaced with D, E,
H, K, R, A, G,
I, L, S, T, M, V, F, W, Y, P, or C; A44 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C;
A45 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H46 replaced with D,
E, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; A47 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C;
P48 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C;
V49 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; T50 replaced with D, E, H, K, R,
N, Q, F, W, Y,
P, or C; L51 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R52 replaced
with D, E, A,
G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A53 replaced with D, E, H, K, R,
N, Q, F, W, Y,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
33
P, or C; S54 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F55 replaced
with D, E, H,
K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; A56 replaced with D, E, H, K, R,
N, Q, F W Y
> > >
P, or C; D57 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P,
or C; R58
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T59
replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; L60 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C;
A61 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; W62 replaced with D,
E, H, K, R,
N, Q, A, G, I, L, S, T, M, V, P, or C; I63 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C;
S64 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R65 replaced with D,
E, A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; W66 replaced with D, E, H, K, R, N, Q, A,
G, I, L, S, T,
io M, V, P, or C; G67 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q68
replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K69 replaced with D,
E, A, G, I, L, S,
T, M, V, N, Q, F, W, Y, P, or C; K70 replaced with D, E, A, G, I, L, S, T, M,
V, N, Q, F, W,
Y, P, or C; L71 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I72
replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; S73 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C;
A74 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P75 replaced with D,
E, H, K, R,
A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; F76 replaced with D, E, H, K, R,
N, Q, A, G, I,
L, S, T, M, V, P, or C; L77 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; F78 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Y79 replaced with
D, E, H, K, R,
N, Q, A, G, I, L, S, T, M, V, P, or C; P80 replaced with D, E, H, K, R, A, G,
I, L, S, T, M, V,
2o N, Q, F, W, Y, or C; Q81 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, F, W, Y, P, or
C; R82 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F83
replaced with
D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; F84 replaced with D, E,
H, K, R, N, Q,
A, G, I, L, S, T, M, V, P, or C; E85 replaced with H, K, R, A, G, I, L, S, T,
M, V, N, Q, F,
W, Y, P, or C; V86 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L87
replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L88 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C;
L89 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F90 replaced with D,
E, H, K, R, N,
Q, A, G, I, L, S, T, M, V, P, or C; Q91 replaced with D, E, H, K, R, A, G, I,
L, S, T, M, V, F,
W, Y, P, or C; E92 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W,
Y, P, or C; G93
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G94 replaced with D, E,
H, K, R, N, Q,
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
34
F, W, Y, P, or C; L95 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K96
replaced with
D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L97 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; A98 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L99
replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; N100 replaced with D, E, H, K, R, A, G,
I, L, S, T, M,
V, F, W, Y, P, or C; 6101 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
Q102
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; 6103
replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; L104 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C;
6105 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A106 replaced with
D, E, H, K, R,
N, Q, F, W, Y, P, or C; T107 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; S108
to replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M109 replaced with D,
E, H, K, R, N,
Q, F, W, Y, P, or C; N110 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or
C; Q111 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C;
Q112 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; A113 replaced
with D, E, H, K,
R, N, Q, F, W, Y, P, or C; L114 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; E115
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q 116
replaced with D,
E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; L117 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; Rl 18 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C;
E119 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
L120 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; 8121 replaced with D, E, A, G, I,
L, S, T, M, V,
2o N, Q, F, W, Y, P, or C; I122 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; 5123
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; 6124 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; S 125 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V
126 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q127 replaced with D, E, H, K, R,
A, G, I, L, S,
T, M, V, F, W, Y, P, or C; L128 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C; Y129
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; C130
replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; V 131 replaced with D,
E, H, K, R, N, Q,
F, W, Y, P, or C; H132 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W,
Y, P, or C;
and S133 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C. Using these same
principles,
CA 02371611 2001-10-19
WO 00!63221 PCT/US00110714
similar non-conservative substitutions can be made in the polypeptide of SEQ
ID N0:25 or
27.
The resulting constructs can be routinely screened for activities or functions
described
throughout the specification and known in the art. Preferably, the resulting
constructs have
5 an increased and/or decreased galectin 11 activity or function, while the
remaining galectin 11
activities or functions are maintained. More preferably, the resulting
constructs have more
than one increased and/or decreased galectin 11 activity or function, while
the remaining
galectin 11 activities or functions are maintained.
Additionally, more than one amino acid (e.g., 2, 3, 4, 5, 6, 7, 8, 9 and 10)
can be
1o replaced with the substituted amino acids as described above (either
conservative or
nonconservative). The substituted amino acids can occur in the full length,
mature, or
proprotein form of galectin 11 protein, as well as the N- and C- terminal
deletion mutants,
having the general formula m-n, [m'-n', m'-nZ, m'-n3, m2-n', m2-n2, mz-
n3°, m3-nl, m3-n2 and
m3-n3].
15 A further embodiment of the invention relates to a polypeptide which
comprises the
amino acid sequence of a galectin 11 polypeptide having an amino acid sequence
which
contains at least one amino acid substitution, but not more than 50 amino acid
substitutions,
even more preferably, not more than 40 amino acid substitutions, still more
preferably, not
more than 30 amino acid substitutions, and still even more preferably, not
more than 20
20 amino acid substitutions. Of course, in order of ever-increasing
preference, it is highly
preferable for a polypeptide to have an amino acid sequence which comprises
the amino acid
sequence of a galectin 11 polypeptide, which contains at least one, but not
more than 10, 9, 8,
7, 6, 5, 4, 3, 2 or 1 amino acid substitutions. In specific embodiments, the
number of
additions, substitutions, and/or deletions in the amino acid sequence of SEQ
ID NOS: 2, 25,
25 or 27 or fragments thereof (e.g., the mature form andlor other fragments
described herein), is
1-5, 5-10, 5-25, 5-50, 10-50 or 50-150, conservative amino acid substitutions
are preferable.
Vectors, Host Cells and Protein Production
CA 02371611 2001-10-19
WO 00!63221 PCT/US00l10714
36
The present invention also relates to vectors which include the isolated DNA
molecules of the present invention, host cells which are genetically
engineered with the
polynucleotides and/or recombinant vectors of the invention, and the
production of galectin
11 polypeptides and fragments, variants, derivatives, and analogs thereof, by
recombinant
techniques.
Galectin 11 polynucleotides may be joined to a vector containing a selectable
marker
for propagation in a host. Generally, a plasmid vector is introduced in a
precipitate, such as a
calcium phosphate precipitate, or in a complex with a charged lipid. If the
vector is a virus, it
may be packaged in vitro using an appropriate packaging cell line and then
transduced into
l0 host cells.
In one embodiment, the DNA of the invention is operatively associated with an
appropriate heterologous regulatory element (e.g., promoter or enhancer), such
as the phage
lambda PL promoter, the E. coli lac, trp and tac promoters, the SV40 early and
late promoters
and promoters of retroviral LTRs, to name a few. Other suitable promoters and
enhancers
will be known to the skilled artisan.
In embodiments in which vectors contain expression constructs, these
constructs will
further contain sites for transcription initiation, termination and, in the
transcribed region, a
ribosome binding site for translation. The coding portion of the transcripts
expressed by the
constructs will preferably include a translation initiating at the beginning
and a termination
codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide
to be
translated.
As indicated, the expression vectors will preferably include at least one
selectable
marker. Such markers include dihydrofolate reductase or 6418 neomycin
resistance for
eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance
genes for culturing
in E. coli and other bacteria. Representative examples of appropriate hosts
include, but are
not limited to, bacterial cells, such as E. coli, Streptococccrs
staphylococci, Bacillus subtilis,
Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast
cells; insect cells
such as Drosophila S2 and Spodoptera Sf7 cells; animal cells such as CHO, COS,
HeLa,
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
37
C127, 3T3, BHK, HEK293, and Bowes melanoma cells; and plant cells. Appropriate
culture
mediums and conditions for the above-described host cells are known in the
art.
Selection of appropriate vectors and promoters for expression in a host cell
is a well
known procedure and the requisite techniques for expression vector
construction,
introduction of the vector into the host, and expression in the host are
routine skills in the art.
A great variety of expression vectors can be used to express galectin 11
polypeptides and
fragments, variants, derivatives, and analogs of the invention. Such vectors
include
chromosomal, episomal and virus-derived vectors e.g., vectors derived from
bacterial
plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal
elements, from
to viruses. such as baculoviruses, papova viruses, such as SV40, vaccinia
viruses, adenoviruses,
fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived
from
combinations thereof, such as those derived from plasmid and bacteriophage
genetic elements,
such as cosmids and phagemids, all may be used for expression in accordance
with this aspect
of the present invention. Generally, any vector suitable to maintain,
propagate or express
polynucleotides to express a polypeptide in a host may be used. The
appropriate nucleotide
sequence may be inserted into an expression vector system by any of a variety
of known
technique, such as for example, those set forth in Ausubel et al., eds., 1989,
Current Protocols
in Molecular Biology, Green Publishing Associates, Inc., and John Wiley &
Sons, inc., New
York.
Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9,
available from Qiagen; pBS vectors, Phagescript vectors, Bluescript vectors,
pNHBA,
pNHl6a, pNHl8A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3,
pKK233-3, pDR540, pRITS available from Pharmacia. Among preferred eukaryotic
vectors
are pWLNEO, pSV2CAT, pOG44, pXTI and pSG available from Stratagene; and pSVK3,
pBPV, pMSG and pSVL available from Pharmacia. Other suitable vectors will be
readily
apparent to the skilled artisan.
The present invention also relates to host cells containing the vector
constructs
discussed herein, and additionally encompasses host cells containing
nucleotide sequences of
the invention that are operably associated with one or more heterologous
control regions (e.g.,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
38
promoters and/or enhancers) using techniques known in the art. As discussed
above, the host
cell can be a higher eukaryotic cell, such as a mammalian cell (e.g., a human
derived cell), or a
lower eukaryotic cell, such as a yeast cell, or the host cell can be a
prokaryotic cell, such as a
bacterial cell. The host strain may be chosen which modulates the expression
of the inserted
gene sequences, or modifies and processes the gene product in the specific
fashion desired.
Expression from certain promoters can be elevated in the presence of certain
inducers; thus
expression of the genetically engineered polypeptide may be controlled.
Furthermore,
different host cells have characteristics and specific mechanisms for the
translational and
post-translational processing and modification (e.g., glycosylation,
phosphorylation,
to cleavage) of proteins. Appropriate cell lines can be chosen to ensure the
desired
modifications and processing of the foreign protein expressed.
For secretion of the translated protein into the lumen of the endoplasmic
reticulum,
into the periplasmic space or into the extracellular environment, appropriate
secretion signals
may be incorporated into the desired polypeptide using techniques known in the
art. These
signals may be endogenous to the polypeptide or they may be heterologous
signals.
Introduction of the construct into the host cell can be effected by calcium
phosphate
transfection, DEAF-dextran mediated transfection, cationic lipid-mediated
transfection,
electroporation, transduction, infection or other methods. Such methods are
described in
many standard laboratory manuals, such as Davis et al., Basic Methods In
Molecular Biology
2o (1986). It is specifically contemplated that galectin 11 polypeptides may
in fact be expressed
by a host cell lacking a recombinant vector.
The polypeptide may be expressed in a modified form, such as a fusion protein
(comprising the polypeptide joined via a peptide bond to a heterologous
protein sequence (of
a different protein)), and may include not only secretion signals, but also
additional
heterologous functional regions. For instance, a region of additional amino
acids, particularly
charged amino acids, may be added to the N-terminus of the polypeptide to
improve stability
and persistence in the host cell, during purification, or during subsequent
handling and storage.
Also, peptide moieties may be added to the polypeptide to facilitate
purification. Such
regions may be removed prior to final preparation of the polypeptide. The
addition of
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
39
peptide moieties to polypeptides to engender secretion or excretion, to
improve stability and
to facilitate purification, among others, are familiar and routine techniques
in the art.
Alternatively, such a fusion protein can be made by protein synthetic
techniques, e.g., by use
of a peptide synthesizer.
A preferred fusion protein comprises a heterologous region from immunoglobulin
that
is useful to solubilize proteins. For example, EP-A-O 464 533 (Canadian
counterpart
2045869) discloses fusion proteins comprising various portions of constant
region of
immunoglobulin molecules together with another human protein or part thereof.
In many
cases, the Fc part in a fusion protein is thoroughly advantageous for use in
therapy and
l0 diagnosis and thus results, for example, in improved pharmacokinetic
properties (EP-A 0232
262). On the other hand, for some uses it would be desirable to be able to
delete the Fc part
after the fusion protein has been expressed, detected and purified in the
advantageous manner
described. This is the case when Fc portion proves to be a hindrance to use in
therapy and
diagnosis, for example when the fusion protein is to be used as antigen for
immunizations. In
drug discovery, for example, human proteins, such as, hILS- has been fused
with Fc portions
for the purpose of high-throughput screening assays to identify antagonists of
hIL-5. See,
Bennett et al., J. Md. Recog. 8:52-58 (1995) and Johanson et al., J. Biol.
Chem.
270(16):9459-9471 (1995).
The galectin 1 I protein can be recovered and purified from recombinant cell
cultures
2o by well-known methods including ammonium sulfate or ethanol precipitation,
acid extraction,
anion or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic
interaction chromatography, affinity chromatography, hydroxylapatite
chromatography and
lectin chromatography. Most preferably, high performance liquid chromatography
("HPLC")
is employed for purification.
Polypeptides of the present invention include naturally purified products,
products of
chemical synthetic procedures, and products produced by recombinant techniques
from a
prokaryotic or eukaryotic host, including, for example, bacterial, yeast,
plant, insect, teleost,
avian, and mammalian cells. Depending upon the host employed in a recombinant
production
procedure, the polypeptides of the present invention may be glycosylated or
may be
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
non-glycosylated. In addition, polypeptides of the invention may also include
an initial
modified methionine residue or may be missing an initial methionine residue,
in some cases as
a result of host-mediated processes. Thus, it is well known in the art that
the N-terminal
methionine encoded by the translation initiation codon generally is removed
with high
5 efficiency from any protein after translation in all eukaryotic cells. While
the N-terminal
methionine on most proteins also is efficiently removed in most prokaryotes,
for some
proteins, this prokaryotic removal process is inefficient, depending on the
nature of the amino
acid to which the N-terminal methionine is covalently linked.
In addition to encompassing host cells containing the vector constructs
discussed
1o herein, the invention also encompasses primary, secondary, and immortalized
host cells of
vertebrate origin, particularly mammalian origin, that have been engineered to
delete or replace
endogenous genetic material (e.g., galectin 11 coding sequence), andlor to
include genetic
material (e.g., heterologous polynucleotide sequences) that is operably
associated with
galectin 11 polynucleotides of the invention, and which activates, alters,
and/or amplifies
15 endogenous galectin 11 polynucleotides. For example, techniques known in
the art may be
used to operably associate heterologous control regions (e.g., promoter and/or
enhancer) and
endogenous galectin 11 polynucleotide sequences via homologous recombination,
resulting in
the formation of a new transcription unit (see, e.g., U.S. Patent No.
5,641,670, issued June
24, 1997; U.S. Patent No. 5,733,761, issued March 31, 1998; International
Publication No.
2o WO 96/29411, published September 26, 1996; International Publication No. WO
94/12650,
published August 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-
8935 (1989); and
Zijlstra et al., Nature 342:435-438 (1989), the disclosures of each of which
are incorporated
by reference in their entireties).
In addition, polypeptides of the invention can be chemically synthesized using
25 techniques known in the art (e.g., see Creighton, 1983, Proteins:
Structures and Molecular
Principles, W.H. Freeman & Co., N.Y., and Hunkapiller et al., Nature, 310:105-
111 (1984)).
For example, a polypeptide corresponding to a fragment of a galectin 11
polypeptide can be
synthesized by use of a peptide synthesizer. Furthermore, if desired,
nonclassical amino
acids or chemical amino acid analogs can be introduced as a substitution or
addition into the
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
41
galectin 11 polypeptide sequence. Non-classical amino acids include, but are
not limited to,
to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-amino
isobutyric
acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino
hexanoic acid,
Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine,
norvaline,
hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-
butylglycine, t-
butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids,
designer amino
acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl amino
acids, and
amino acid analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L
(levorotary).
to The invention encompasses galectin 11 polypeptides which are differentially
modified
during or after translation, e.g., by glycosylation, acetylation,
phosphorylation, amidation,
derivatization by known protecting/blocking groups, proteolytic cleavage,
linkage to an
antibody molecule or other cellular ligand, etc. Any of numerous chemical
modifications may
be carried out by known techniques, including but not limited, to specific
chemical cleavage
by cyanogen bromide, trypsin, chymotrypsin, papain, VS protease, NaBH4;
acetylation,
formylation, oxidation, reduction; metabolic synthesis in the presence of
tunicamycin; etc.
Additional post-translational modifications encompassed by the invention
include, for
example, e.g., N-linked or O-linked carbohydrate chains, processing of N-
terminal or
C-terminal ends), attachment of chemical moieties to the amino acid backbone,
chemical
modifications of N-linked or O-linked carbohydrate chains, and addition or
deletion of an
N-terminal methionine residue as a result of procaryotic host cell expression.
The
polypeptides may also be modified with a detectable label, such as an
enzymatic, fluorescent,
isotopic or affinity label to allow for detection and isolation of the
protein.
Also provided by the invention are chemically modified derivatives of the
polypeptides of the invention which may provide additional advantages such as
increased
solubility, stability and circulating time of the polypeptide, or decreased
immunogenicity (see
U.S. Patent No. 4,179,337). The chemical moieties for derivitization may be
selected from
water soluble polymers such as polyethylene glycol, ethylene glycol/propylene
glycol
copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The
CA 02371611 2001-10-19
WO 00/63221 PCT/USOO110714
42
polypeptides may be modified at random positions within the molecule, or at
predetermined
positions within the molecule and may include one, two, three or more attached
chemical
moieties.
The polymer may be of any molecular weight, and may be branched or unbranched.
For polyethylene glycol, the preferred molecular weight is between about 1 kDa
and about
100 kDa (the term "about" indicating that in preparations of polyethylene
glycol, some
molecules will weigh more, some less, than the stated molecular weight) for
ease in handling
and manufacturing. Other sizes may be used, depending on the desired
therapeutic profile
(e.g., the duration of sustained release desired, the effects, if any on
biological activity, the
l0 ease in handling, the degree or lack of antigenicity and other known
effects of the
polyethylene glycol to a therapeutic protein or analog). For example, the
polyethylene glycol
may have an average molecular weight of about 200, 500, 1000, 1500, 2000,
2500, 3000,
3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500,
10,000,
10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500,
15,000, 15,500,
16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, 20,000,
25,000, 30,000,
35,000, 40,000, 50,000, 55,000, 60,000, 65,000, 70,000, 75,000, 80,000,
85,000, 90,000,
95,000, or 100,000 kDa.
As noted above, the polyethylene glycol may have a branched structure.
Branched
polyethylene glycols are described, for example, in U.S. Patent No. 5,643,575;
Morpurgo et
al., Appl. Biochem. Biotechnol. 56:59-72 (1996); Vorobjev et al., Nucleosides
Nucleotides
18:2745-2750 (1999); and Caliceti et al., Bioconjug. Chem. 10:638-646 (1999),
the disclosures
of each of which are incorporated herein by reference.
The polyethylene glycol molecules (or other chemical moieties) should be
attached to
the protein with consideration of effects on functional or antigenic domains
of the protein.
There are a number of attachment methods available to those skilled in the
art, e.g., EP 0 401
384, herein incorporated by reference (coupling PEG to G-CSF), see also Malik
et al., Exp.
Hematol. 20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl
chloride). For
example, polyethylene glycol may be covalently bound through amino acid
residues via a
reactive group, such as, a free amino or carboxyl group. Reactive groups are
those to which
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
43
an activated polyethylene glycol molecule may be bound. The amino acid
residues having a
free amino group may include lysine residues and the N-terminal amino acid
residues; those
having a free carboxyl group may include aspartic acid residues glutamic acid
residues and the
C-terminal amino acid residue. Sulfhydryl groups may also be used as a
reactive group for
attaching the polyethylene glycol molecules. Preferred for therapeutic
purposes is
attachment at an amino group, such as attachment at the N-terminus or lysine
group.
As suggested above, polyethylene glycol may be attached to proteins via
linkage to
any of a number of amino acid residues. For example, polyethylene glycol can
be linked to a
proteins via covalent bonds to lysine, histidine, aspartic acid, glutamic
acid, or cysteine
to residues. One or more reaction chemistries may be employed to attach
polyethylene glycol
to specific amino acid residues (e.g., lysine, histidine, aspartic acid,
glutamic acid, or cysteine)
of the protein or to more than one type of amino acid residue (e.g., lysine,
histidine, aspartic
acid, glutamic acid, cysteine and combinations thereof) of the protein.
One may specifically desire proteins chemically modified at the N-terminus.
Using
polyethylene glycol as an illustration of the present composition, one may
select from a
variety of polyethylene glycol molecules (by molecular weight, branching,
etc.), the
proportion of polyethylene glycol molecules to protein (polypeptide) molecules
in the
reaction mix, the type of pegylation reaction to be performed, and the method
of obtaining the
selected N-terminally pegylated protein. The method of obtaining the N-
terminally pegylated
2o preparation (i.e., separating this moiety from other monopegylated moieties
if necessary)
may be by purification of the N-terminally pegylated material from a
population of pegylated
protein molecules. Selective proteins chemically modified at the N-terminus
modification
may be accomplished by reductive alkylation which exploits differential
reactivity of different
types of primary amino groups (lysine versus the N-terminal) available for
derivatization in a
particular protein. Under the appropriate reaction conditions, substantially
selective
derivatization of the protein at the N-terminus with a carbonyl group
containing polymer is
achieved.
As indicated above, pegylation of the proteins of the invention may be
accomplished
by any number of means. For example, polyethylene glycol may be attached to
the protein
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
44
either directly or by an intervening linker. Linkerless systems for attaching
polyethylene
glycol to proteins are described in Delgado et al., Crit. Rev. Thera. Drug
Carrier Sys. 9:249-
304 (1992); Francis et al., Intern. J. ofHematol. 68:1-18 (1998); U.S. Patent
No. 4,002,531;
U.S. Patent No. 5,349,052; WO 95/06058; and WO 98/32466, the disclosures of
each of
which are incorporated herein by reference.
One system for attaching polyethylene glycol directly to amino acid residues
of
proteins without an intervening linker employs tresylated MPEG, which is
produced by the
modification of monmethoxy polyethylene glycol (MPEG) using tresylchloride
(C1SOZCHZCF3). Upon reaction of protein with tresylated MPEG, polyethylene
glycol is
1o directly attached to amine groups of the protein. Thus, the invention
includes protein-
polyethylene glycol conjugates produced by reacting proteins of the invention
with a
polyethylene glycol molecule having a 2,2,2-trifluoreothane sulphonyl group.
Polyethylene glycol can also be attached to proteins using a number of
different
intervening linkers. For example, U.S. Patent No. 5,612,460, the entire
disclosure of which is
incorporated herein by reference, discloses urethane linkers for connecting
polyethylene
glycol to proteins. Protein-polyethylene glycol conjugates wherein the
polyethylene glycol is
attached to the protein by a linker can also be produced by reaction of
proteins with
compounds such as MPEG-succinimidylsuccinate, MPEG activated with
1,1'-carbonyldiimidazole, MPEG-2,4,5-trichloropenylcarbonate, MPEG-p-
2o nitrophenolcarbonate, and various MPEG-succinate derivatives. A number
additional
polyethylene glycol derivatives and reaction chemistries for attaching
polyethylene glycol to
proteins are described in WO 98/32466, the entire disclosure of which is
incorporated herein
by reference. Pegylated protein products produced using the reaction
chemistries set out
herein are included within the scope of the invention.
The number of polyethylene glycol moieties attached to each protein of the
invention (i.e.,
the degree of substitution) may also vary. For example, the pegylated proteins
of the
invention may be linked, on average, to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15,
17, 20, or more
polyethylene glycol molecules. Similarly, the average degree of substitution
within ranges
such as 1-3, 2-4, 3-5, 4-6, 5-7, 6-8, 7-9, 8-10, 9-11, 10-12, 11-13, 12-14, 13-
15, 14-16, 15-17,
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
16-18, 17-19, or 18-20 polyethylene glycol moieties per protein molecule.
Methods for
determining the degree of substitution are discussed, for example, in Delgado
et al., Crit. Rev.
Thera. Drug Carrier Sys. 9:249-304 (1992).
The galectin 11 polypeptides of the invention may be in monomers or multimers
(i.e.,
5 dimers, trimers, tetramers and higher multimers). Accordingly, the present
invention relates
to monomers and multimers of the galectin 11 polypeptides of the invention,
their
preparation, and compositions (preferably, Therapeutics) containing them. In
specific
embodiments, the polypeptides of the invention are monomers, dimers, trimers
or tetramers.
In additional embodiments, the multimers of the invention are at least dimers,
at least trimers,
to or at least tetramers.
Multimers encompassed by the invention may be homomers or heteromers. As used
herein, the term homomer, refers to a multimer containing only polypeptides
corresponding
to the amino acid sequence of SEQ ID N0:2, or alternatively SEQ ID N0:25 or
27, or
encoded by the cDNA contained in the deposited clone (including fragments,
variants, splice
15 variants, and fusion proteins, corresponding to these as described herein).
These homomers
may contain galectin 11 polypeptides having identical or different amino acid
sequences. In a
specific embodiment, a homomer of the invention is a multimer containing only
galectin 11
polypeptides having an identical amino acid sequence. In another specific
embodiment, a
homomer of the invention is a multimer containing galectin 11 polypeptides
having different
20 amino acid sequences. In specific embodiments, the multimer of the
invention is a homodimer
(e.g., containing galectin 11 polypeptides having identical or different amino
acid sequences)
or a homotrimer (e.g., containing galectin 11 polypeptides having identical
and/or different
amino acid sequences). In additional embodiments, the homomeric multimer of
the invention
is at least a homodimer, at least a homotrimer, or at least a homotetramer.
25 As used herein, the term heteromer refers to a multimer containing one or
more
heterologous polypeptides (i.e., polypeptides of different proteins) in
addition to the galectin
11 polypeptides of the invention. In a specific embodiment, the multimer of
the invention is
a heterodimer, a heterotrimer, or a heterotetramer. In additional embodiments,
the heteromeric
CA 02371611 2001-10-19
WO 00/63221 PCT/USOO110714
46
multimer of the invention is at least a heterodimer, at least a heterotrimer,
or at least a
heterotetramer.
Multimers of the invention may be the result of hydrophobic, hydrophilic,
ionic
and/or covalent associations and/or may be indirectly linked, by for example,
liposome
formation. Thus, in one embodiment, multimers of the invention, such as, for
example,
homodimers or homotrimers, are formed when polypeptides of the invention
contact one
another in solution. In another embodiment, heteromultimers of the invention,
such as, for
example, heterotrimers or heterotetramers, are formed when polypeptides of the
invention
contact antibodies to the polypeptides of the invention (including antibodies
to the
l0 heterologous polypeptide sequence in a fusion protein of the invention) in
solution. In other
embodiments, multimers of the invention are formed by covalent associations
with and/or
between the galectin 11 polypeptides of the invention. Such covalent
associations may
involve one or more amino acid residues contained in the polypeptide sequence
(e.g., that
recited in SEQ ID N0:2, 25, or 27, or contained in the polypeptide encoded by
the clone
HJACE54). In one instance, the covalent associations are cross-linking between
cysteine
residues located within the polypeptide sequences which interact in the native
(i.e., naturally
occurring) polypeptide. In another instance, the covalent associations are the
consequence of
chemical or recombinant manipulation. Alternatively, such covalent
associations may involve
one or more amino acid residues contained in the heterologous polypeptide
sequence in a
2o galectin 11 fusion protein. In one example, covalent associations are
between the
heterologous sequence contained in a fusion protein of the invention (see,
e.g., US Patent
Number 5,478,925). In a specific example, the covalent associations are
between the
heterologous sequence contained in a galectin 11-Fc fusion protein of the
invention (as
described herein). In another specific example, covalent associations of
fusion proteins of the
invention are between heterologous polypeptide sequence from another protein
that is
capable of forming covalently associated multimers, such as for example,
oseteoprotegerin
(see, e.g., International Publication NO: WO 98/49305, the contents of which
are herein
incorporated by reference in its entirety). In another embodiment, two or more
polypeptides
of the invention are joined through peptide linkers. Examples include those
peptide linkers
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
47
described in U.S. Pat. No. 5,073,627 (hereby incorporated by reference).
Proteins comprising
multiple polypeptides of the invention separated by peptide linkers may be
produced using
conventional recombinant DNA technology.
Another method for preparing multimer polypeptides of the invention involves
use
of polypeptides of the invention fused to a leucine zipper or isoleucine
zipper polypeptide
sequence. Leucine zipper and isoleucine zipper domains are polypeptides that
promote
multimerization of the proteins in which they are found. Leucine zippers were
originally
identified in several DNA-binding proteins (Landschulz et al., Science
240:1759, (1988)), and
have since been found in a variety of different proteins. Among the known
leucine zippers
to are naturally occurnng peptides and derivatives thereof that dimerize or
trimerize. Examples
of leucine zipper domains suitable for producing soluble multimeric proteins
of the invention
are those described in PCT application WO 94!10308, hereby incorporated by
reference.
Recombinant fusion proteins comprising a polypeptide of the invention fused to
a
polypeptide sequence that dimerizes or trimerizes in solution are expressed in
suitable host
cells, and the resulting soluble multimeric fusion protein is recovered from
the culture
supernatant using techniques known in the art.
Trimeric polypeptides of the invention may offer the advantage of enhanced
biological activity. Preferred leucine zipper moieties and isoleucine moieties
are those that
preferentially form trimers. One example is a leucine zipper derived from lung
surfactant
protein D (SPD), as described in Hoppe et al. (FEBS Letters 344:191, (1994))
and in U.S.
patent application Ser. No. 08/446,922, hereby incorporated by reference.
Other peptides
derived from naturally occurring trimeric proteins may be employed in
preparing trimeric
polypeptides of the invention.
In further preferred embodiments, Galectin 11 polynucleotides of the invention
are fused to a
polynucleotide encoding a "FLAG" polypeptide. Thus, a galectin 11-FLAG fusion
protein is
encompassed by the present invention. The FLAG antigenic polypeptide may be
fused to an
galectin 11 polypeptide of the invention at either or both the amino or the
carboxy terminus. In
preferred embodiments, a galectin 11-FLAG fusion protein is expressed from a
pFLAG-CMV-5a or
a pFLAG-CMV-1 expression vector (available from Sigma, St. Louis, MO, USA).
See, Andersson,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
48
S., et al., J. Biol. Chem. 264:8222-29 (1989); Thomsen, D. R., et al., Proc.
Natl. Acad. Sci. USA,
81:659-63 (1984); and Kozak, M., Nature 308:241 (1984) (each ofwhich is hereby
incorporated by
reference). In further preferred embodiments, a galectin 11-FLAG fusion
protein is detectable by
anti-FLAG monoclonal antibodies (also available from Sigma).
The multimers of the invention may be generated using chemical techniques
known in
the art. For example, polypeptides desired to be contained in the multimers of
the invention
may be chemically cross-linked using linker molecules and linker molecule
length optimization
techniques known in the art (see, e.g., US Patent Number 5,478,925, which is
herein
incorporated by reference in its entirety). Additionally, multimers of the
invention may be
to generated using techniques known in the art to form one or more inter-
molecule cross-links
between the cysteine residues located within the sequence of the polypeptides
desired to be
contained in the multimer (see, e.g., US Patent Number 5,478,925, which is
herein
incorporated by reference in its entirety). Further, polypeptides of the
invention may be
routinely modified by the addition of cysteine or biotin to the C terminus or
N-terminus of
the polypeptide and techniques known in the art may be applied to generate
multimers
containing one or more of these modified polypeptides (see, e.g., US Patent
Number
5,478,925, which is herein incorporated by reference in its entirety).
Additionally, techniques
known in the art may be applied to generate liposomes containing the
polypeptide
components desired to be contained in the multimer of the invention (see,
e.g., US Patent
2o Number 5,478,925, which is herein incorporated by reference in its
entirety).
Alternatively, multimers of the invention may be generated using genetic
engineering
techniques known in the art. In one embodiment, polypeptides contained in
multimers of the
invention are produced recombinantly using fusion protein technology described
herein or
otherwise known in the art (see, e.g., US Patent Number 5,478,925, which is
herein
incorporated by reference in its entirety). In a specific embodiment,
polynucleotides coding
for a homodimer of the invention are generated by ligating a polynucleotide
sequence encoding
a polypeptide of the invention to a sequence encoding a linker polypeptide and
then further
to a synthetic polynucleotide encoding the translated product of the
polypeptide in the
reverse orientation from the original C-terminus to the N-terminus (lacking
the leader
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
49
sequence) (see, e.g., US Patent Number 5,478,925, which is herein incorporated
by reference
in its entirety). In another embodiment, recombinant techniques described
herein or otherwise
known in the art are applied to generate recombinant polypeptides of the
invention which
contain a transmembrane domain (or hyrophobic or signal peptide) and which can
be
incorporated by membrane reconstitution techniques into liposomes (see, e.g.,
US Patent
Number 5,478,925, which is herein incorporated by reference in its entirety).
Galectin 11 Polypeptides and Fragments
The invention further provides an isolated galectin 11 polypeptide having the
amino
to acid sequence encoded by the deposited cDNA, the amino acid sequence
depicted in Figure 1
(amino acid residues 1-133 of SEQ ID N0:2), the amino acid sequence depicted
in Figure 1
less the amino terminal methionine (amino acid residues 2-133 of SEQ ID N0:2),
polypeptides which are encoded by a polynucleotide that hybridizes under
stringent
hybridization conditions to a polynucleotide sequence encoding a polypeptide
having the
amino acid sequence depicted in Figure 1 (SEQ ID N0:2) and/or contained in the
deposited
clone, and fragments, variants, derivatives and analogs of these polypeptides.
The polypeptides of the present invention are preferably provided in an
isolated
form. By "isolated polypeptide" is intended a polypeptide removed from its
native
environment. Thus, a polypeptide produced andlor contained within a
recombinant host cell
2o is considered isolated for purposes of the present invention. Also intended
as an "isolated
polypeptide" are polypeptides that have been purified, partially or
substantially, from a
recombinant host cell. For example, a recombinantly produced version of the
galectin 11
polypeptide can be substantially purified by the one-step method described in
Smith and
Johnson, Gene 67:31-40 (1988).
It will be recognized in the art that some amino acid sequences of the
galectin 11
polypeptide can be varied without significant effect of the structure or
function of the
protein. If such differences in sequence are contemplated, it should be
remembered that there
will be critical areas on the protein which determine activity.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
Thus, the invention further includes variations of the galectin 11 polypeptide
which
show substantial galectin 11 polypeptide functional activity or which include
regions of
galectin 11 protein such as the protein portions discussed below. Such mutants
include
deletions, insertions, inversions, repeats, and type substitutions.
5 As indicated above, guidance concerning which amino acid changes are likely
to be
phenotypically silent can be found in Bowie et al., Deciphering the Message in
Protein
Sequences: Tolerance to Amino Acid Substitutions, Science 247:1306-1310
(1990). Thus, a
fragment, variant, derivative, or analog of the polypeptide of Figure 1 or 6
(SEQ ID N0:2, 25,
or 27), or that encoded by the deposited cDNA, include (i) one in which at
least one or more
to of the amino acid residues are substituted with a conserved or non-
conserved amino acid
residue (preferably a conserved amino acid residue(s), and more preferably at
least one but
less than ten conserved amino acid residues) and such substituted amino acid
residue may or
may not be one encoded by the genetic code, or (ii) one in which one or more
of the amino
acid residues includes a substituent group, or (iii) one in which the mature
polypeptide is
15 fused with another compound, such as a compound to increase the half life
of the
polypeptide (for example, polyethylene glycol), or (iv) one in which the
additional amino
acids are fused to the mature polypeptide, such as an IgG Fc fusion region
peptide or leader
or secretory sequence or a sequence which is employed for purification of the
mature
polypeptide or a proprotein sequence. Such fragments, variants, derivatives
and analogs are
2o deemed to be within the scope of those skilled in the art from the
teachings herein.
Of particular interest are substitutions of one or more charged amino acids
with other
charged amino acid and with neutral or negatively charged amino acids. The
latter results in
proteins with reduced positive charge to improve the characteristics of the
galectin 11 protein.
The prevention of aggregation is highly desirable. Aggregation of proteins not
only results in
25 a loss of activity but can also be problematic when preparing
pharmaceutical formulations,
because they can be immunogenic (Pinckard et al., Clin. Exp. Immunol. 2:331-
340 (1967);
Robbins et al., Diabetes 36:838-845 (1987); Cleland et al., Crit. Rev.
Therapeutic Drug
Carrier Systems 10:307-377 (1993)).
CA 02371611 2001-10-19
WO 00/63221 PCT/USDD/10714
51
As indicated, changes are preferably of a minor nature, such as conservative
amino
acid substitutions that do not significantly affect the folding or activity of
the protein (see
Table 2).
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
52
TABLE 2. Conservative Amino Acid Substitutions
Aromatic Phenylalanine
Tryptophan
Tyrosine
Hydrophobic Leucine
Isoleucine
Valine
Polar ~ Glutamine
Asparagine
Basic Arginine
Lysine
Histidine
Acidic Aspartic Acid
Glutamic Acid
Small Alanine
Serine
Threonine
Methionine
Glycine
In the specific embodiments, the number of additions, substitutions and/or
deletions in
the amino acid sequence of Figure 1 or 6 (SEQ ID N0:2, 25, or 27) andlor any
of the
polypeptide fragments described herein is 50, 40, 35, 30, 25, 20, 15, 14, 13,
12, 11, 10, 9, 8,
7, 6, 5, 4, 3, 2, or 1, or 15-20, IS-10, 5-10, 1-5, 1-3, or 1-2.
Amino acid residues of the galectin I 1 polypeptide, fragment, variant,
derivative, or
analog of the present invention that are essential for function can be
identified by methods
l0 known in the art, such as site-directed mutagenesis or alanine-scanning
mutagenesis
(Cunningham and Wells, Science 244:1081-1085 (1989)). The latter procedure
introduces
single alanine mutations at every residue in the molecule. The resulting
mutant molecules are
then tested for biological activity or fiznctional activity, such as, receptor
binding, (3-
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
53
galactoside (e.g., thiodigalactoside or lactose) binding, the ability to
agglutinate trypsin-
treated rabbit erythrocytes, or the ability in vitro or in vivo to induce
apoptosis. Sites that
are critical for ligand-receptor binding can also be determined by structural
analysis such as
crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith
et al., J. Mol.
Biol. 224:899-904 (1992) and de Vos et al., Science 255:306-312 (1992)).
The present invention also encompasses polypeptides which are at least 75%,
80%,
85%, 90%, 92%, 95%, 96%, 97%, 98%, or 99%, or, 97-99% identical to the
polypeptides
described above. By a polypeptide having an amino acid sequence at least, for
example, 95%
"identical" to a reference amino acid sequence of a galectin 11 polypeptide is
intended that the
to amino acid sequence of the polypeptide is identical to the reference
sequence except that the
polypeptide sequence may include up to five amino acid alterations per each
100 amino acids
of the reference amino acid of the galectin 11 polypeptide. In other words, to
obtain a
polypeptide having an amino acid sequence at least 95% identical to a
reference amino acid
sequence, up to 5% of the amino acid residues in the reference sequence may be
deleted or
substituted with another amino acid, or a number of amino acids up to 5% of
the total amino
acid residues in the reference sequence may be inserted into the reference
sequence. These
alterations of the reference sequence may occur at the amino or carboxy
terminal positions of
the reference amino acid sequence or anywhere between those terminal
positions, interspersed
either individually among residues in the reference sequence or in one or more
contiguous
groups within the reference sequence.
As a practical matter, whether any particular polypeptide is at least 75%,
80%, 85%,
90%, 92%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid
sequence
shown in Figure 1 or 6 (SEQ ID N0:2, 25, or 27), the amino acid sequence
encoded by
deposited cDNA clone, or fragments thereof, can be determined conventionally
using known
computer programs such the Bestfit program (Wisconsin Sequence Analysis
Package, Version
8 for Unix, Genetics Computer Group, University Research Park, 575 Science
Drive,
Madison, WI 53711. When using Bestfit or any other sequence alignment program
to
determine whether a particular sequence is, for instance, 95% identical to a
reference sequence
according to the present invention, the parameters are set, of course, such
that the percentage
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
54
of identity is calculated over the full length of the reference amino acid
sequence and that gaps
in homology of up to 5% of the total number of amino acid residues in the
reference sequence
are allowed.
In another embodiment, the identity between a reference (query) sequence (a
sequence
of the present invention) and a subject sequence, also referred to as a global
sequence
alignment, is determined using the FASTDB computer program based on the
algorithm of
Brutlag et al. (Comp. App. Biosci. 6:237-245 ( 1990)). Preferred parameters
used in a
FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1,
Joining Penalty=20, Randomization Group Length=0, Cutoff Score=1, Window
to Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500
or the
length of the subject amino acid sequence, whichever is shorter. According to
this
embodiment, if the subject sequence is shorter than the query sequence due to
N- or C-
terminal deletions, not because of internal deletions, a manual correction is
made to the results
to take into consideration the fact that the FASTDB program does not account
for N- and C-
terminal truncations of the subject sequence when calculating global percent
identity. For
subject sequences truncated at the N- and C-termini, relative to the query
sequence, the
percent identity is corrected by calculating the number of residues of the
query sequence that
are N- and C-terminal of the subject sequence, which are not matched/aligned
with a
corresponding subject residue, as a percent of the total bases of the query
sequence. A
2o determination of whether a residue is matchedlaligned is determined by
results of the
FASTDB sequence alignment. This percentage is then subtracted from the percent
identity,
calculated by the above FASTDB program using the specified parameters, to
arnve at a final
percent identity score. This final percent identity score is what is used for
the purposes of
this embodiment. Only residues to the N- and C-termini of the subject
sequence, which are
not matched/aligned with the query sequence, are considered for the purposes
of manually
adjusting the percent identity score. That is, only query residue positions
outside the
farthest N- and C-terminal residues of the subject sequence. For example, a 90
amino acid
residue subject sequence is aligned with a 100 residue query sequence to
determine percent
identity. The deletion occurs at the N-terminus of the subject sequence and
therefore, the
CA 02371611 2001-10-19
WO 00!63221 PCT/US00110714
FASTDB alignment does not show a matchinglalignment of the first 10 residues
at the N-
terminus. The 10 unpaired residues represent 10% of the sequence (number of
residues at the
N- and C- termini not matched/total number of residues in the query sequence)
so 10% is
subtracted from the percent identity score calculated by the FASTDB program.
If the
5 remaining 90 residues were perfectly matched the final percent identity
would be 90%. In
another example, a 90 residue subject sequence is compared with a 100 residue
query
sequence. This time the deletions are internal deletions so there are no
residues at the N- or
C-termini of the subject sequence which are not matched/aligned with the
query. In this case
the percent identity calculated by FASTDB is not manually corrected. Once
again, only
to residue positions outside the N- and C-terminal ends of the subject
sequence, as displayed in
the FASTDB alignment, which are not matched/aligned with the query sequence
are manually
corrected for. No other manual corrections are made for the purposes of this
embodiment.
The polypeptides of the present invention have uses which include, but are not
limited to, molecular weight marker on SDS-PAGE gels or on molecular sieve gel
filtration
15 columns using methods well known to those of skill in the art.
The present invention also encompasses fragments of the above-described
polypeptides of the invention. In specific embodiments, these fragments are at
least 20, 25,
30, 40, 50, 75, 90, 100, 110, 120, 125, or 130 amino acid residues in length.
In the present invention, a "polypeptide fragment" refers to an amino acid
sequence
2o which is a portion of that contained in SEQ ID N0:2, 25, or 27 or encoded
by the cDNA
contained in the deposited clone. Protein (polypeptide) fragments may be "free-
standing," or
comprised within a larger polypeptide of which the fragment forms a part or
region, most
preferably as a single continuous region. Representative examples of
polypeptide fragments
of the invention, include, for example, fragments comprising, or alternatively
consisting of,
25 from about amino acid number 1-20, 21-40, 41-60, 61-80, 81-100, 101-120, or
121 to the end
of the coding region. Moreover, polypeptide fragments can be about 20, 30, 40,
50, 60, 70,
80, 90, 100, 110, 120, or 130 amino acids in length. In this context "about"
includes the
particularly recited ranges or values, and ranges or values larger or smaller
by several (5, 4, 3,
CA 02371611 2001-10-19
WO 00!63221 PCT/US00110714
56
2, or 1) amino acids, at either extreme or at both extremes. Polynucleotides
encoding these
polypeptides are also encompassed by the invention.
Even if deletion of one or more amino acids from the N-terminus of a protein
results in
modification of loss of one or more biological functions of the protein, other
functional
activities (e.g., biological activities, ability to multimerize, ability to
bind galectin 11 ligand)
may still be retained. For example, the ability of shortened galectin 11
muteins to induce
and/or bind to antibodies which recognize the complete or mature forms of the
polypeptides
generally will be retained when less than the majority of the residues of the
complete or
mature polypeptide are removed from the N-terminus. Whether a particular
polypeptide
to lacking N-terminal residues of a complete polypeptide retains such
immunologic activities can
readily be determined by routine methods described herein and otherwise known
in the art. It
is not unlikely that an galectin 11 mutein with a large number of deleted N-
terminal amino acid
residues may retain some biological or immunogenic activities. In fact,
peptides composed of
as few as six galectin 11 amino acid residues may often evoke an immune
response.
Accordingly, polypeptide fragments include the secreted galectin 11 protein as
well as
the mature form. Further preferred polypeptide fragments include the secreted
galectin 11
protein or the mature form having a continuous series of deleted residues from
the amino or
the carboxy terminus, or both. For example, any number of amino acids, ranging
from 1-60,
can be deleted from the amino terminus of either the secreted galectin 11
polypeptide or the
2o mature form. Similarly, any number of amino acids, ranging from 1-30, can
be deleted from
the carboxy terminus of the secreted galectin 11 protein or mature form.
Furthermore, any
combination of the above amino and carboxy terminus deletions are preferred.
Similarly,
polynucleotides encoding these polypeptide fragments are also preferred.
In one embodiment, the present invention further provides polypeptides having
one
or more residues deleted from the amino terminus of the amino acid sequence of
the galectin
11 polypeptide depicted in Figure 1 or 6 (SEQ ID N0:2, 25, or 27) or encoded
by the cDNA
of the deposited clone. Particularly, in one embodiment, N-terminal deletions
of the galectin
11 polypeptide can be described by the general formula m to 133, where m is a
integer from 1
to 128 corresponding to the position of amino acid residue identified in SEQ
ID N0:2 and
CA 02371611 2001-10-19
WO 00/63221 PCTIUSOD/10714
57
preferably, corresponds to one of the N-terminal amino acid residues
identified in the N-
terminal deletions specified herein. In specific embodiments, N-terminal
deletions of the
galectin 11 polypeptide of the invention comprise, or alternatively consist
of, amino acid
residues: S-2 to S-133; P-3 to S-133; R-4 to S-133; L-5 to S-133; E-6 to S-
133; V-7 to S-133;
P-8 to S-133; C-9 to S-133; S-10 to S-133; H-11 to S-133; A-12 to S-133; L-13
to S-133; P-
14 to S-133; Q-15 to S-133; G-16 to S-133; L-17 to S-133; S-18 to S-133; P-19
to S-133; G-
20 to S-133; Q-21 to S-133; V-22 to S-133; I-23 to S-133; I-24 to S-133; V-25
to S-133; R-26
to S-133; G-27 to S-133; L-28 to S-133; V-29 to S-133; L-30 to S-133; Q-31 to
S-133; E-32
to S-133; P-33 to S-133; K-34 to S-133; H-35 to S-133; F-36 to S-133; T-37 to
S-133; V-38
1o to S-133; S-39 to S-133; L-40 to S-133; R-41 to S-133; D-42 to S-133; Q-43
to S-133; A-44
to S-133; A-45 to S-133; H-46 to S-133; A-47 to S-133; P-48 to S-133; V-49 to
S-133; T-50
to S-133; L-51 to S-133; R-52 to S-133; A-53 to S-133; S-54 to S-133; F-55 to
S-133; A-56
to S-133; D-57 to S-133; R-58 to S-133; T-59 to S-133; L-60 to S-133; A-61 to
S-133; W-62
to S-133; I-63 to S-133; S-64 to S-133; R-65 to S-133; W-66 to S-133; G-67 to
S-133; Q-68
to S-133; K-69 to S-133; K-70 to S-133; L-71 to S-133; I-72 to S-133; S-73 to
S-133; A-74 to
S-133; P-75 to S-133; F-76 to S-133; L-77 to S-133; F-78 to S-133; Y-79 to S-
133; P-80 to 5-
133; Q-81 to S-133; R-82 to S-133; F-83 to S-133; F-84 to S-133; E-85 to S-
133; V-86 to 5-
133; L-87 to S-133; L-88 to S-133; L-89 to 5-133; F-90 to S-133; Q-91 to S-
133; E-92 to S-
133; G-93 to S-133; G-94 to S-133; L-95 to S-133; K-96 to S-133; L-97 to S-
133; A-98 to S-
133; L-99 to S-133; N-100 to S-133; G-101 to S-133; Q-102 to S-133; G-103 to S-
133; L-104
to S-133; G-105 to S-133; A-106 to S-133; T-107 to S-133; S-108 to S-133; M-
109 to S-133;
N-110 to S-133; Q-111 to S-133; Q-112 to S-133; A-113 to S-133; L-114 to S-
133; E-115 to
S-133; Q-116 to S-133; L-117 to S-133; R-118 to S-133; E-119 to S-133; L-120
to S-133; 8-
121 to S-133; I-122 to S-133; S-123 to S-133; G-124 to S-133; S-125 to S-133;
V-126 to S-
133; Q-127 to S-133; and L-128 to S-133 of SEQ ID N0:2. Polynucleotides
encoding these
polypeptides are also encompassed by the invention.
Also as mentioned above, even if deletion of one or more amino acids from the
C-terminus of a protein results in modification of loss of one or more
biological functions of
the protein, other functional activities (e.g., biological activities, ability
to multimerize, ability
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
58
to bind galectin 11 ligand) may still be retained. For example the ability of
the shortened
galectin 11 mutein to induce and/or bind to antibodies which recognize the
complete or mature
forms of the polypeptide generally will be retained when less than the
majority of the
residues of the complete or mature polypeptide are removed from the C-
terminus. Whether a
particular polypeptide lacking C-terminal residues of a complete polypeptide
retains such
immunologic activities can readily be determined by routine methods described
herein and
otherwise known in the art. It is not unlikely that an galectin 11 mutein with
a large number
of deleted C-terminal amino acid residues may retain some biological or
immunogenic
activities. In fact, peptides composed of as few as six galectin 11 amino acid
residues may
to often evoke an immune response.
Accordingly, further embodiments of the invention are directed to C-terminal
deletions
of the galectin 11 polypeptide described by the general formula 1 to n, where
n is an integer
from 6 to 132 corresponding to the position of amino acid residue identified
in SEQ ID N0:2
and preferably, corresponds to one of the C-terminal amino acid residues
identified in the C-
terminal deletions specified herein. In specific embodiments, C terminal
deletions of the
galectin 11 polypeptide of the invention comprise, or alternatively, consist
of, amino acid
residues: M-1 to H-132; M-1 to V-131; M-1 to C-130; M-1 to Y-129; M-1 to L-
128; M-1 to
Q-127; M-1 to V-126; M-1 to S-125; M-1 to G-124; M-1 to S-123; M-1 to I-122; M-
1 to 8-
121; M-1 to L-120; M-1 to E-119; M-1 to R-118; M-1 to L-117; M-1 to Q-116; M-1
to E-
115; M-1 to L-114; M-1 to A-113; M-1 to Q-112; M-1 to Q-111; M-1 to N-110; M-1
to M-
109; M-1 to S-108; M-1 to T-107; M-1 to A-106; M-1 to G-105; M-1 to L-104; M-1
to 6-
103; M-1 to Q-102; M-1 to G-101; M-1 to N-100; M-1 to L-99; M-1 to A-98; M-1
to L-97;
M-1 to K-96; M-1 to L-95; M-1 to G-94; M-1 to G-93; M-1 to E-92; M-1 to Q-91;
M-1 to
F-90; M-1 to L-89; M-1 to L-88; M-1 to L-87; M-1 to V-86; M-1 to E-85; M-1 to
F-84; M-
1 to F-83; M-1 to R-82; M-1 to Q-81; M-1 to P-80; M-1 to Y-79; M-1 to F-78; M-
1 to L-
77; M-1 to F-76; M-1 to P-75; M-1 to A-74; M-1 to S-73; M-1 to I-72; M-1 to L-
71; M-1
to K-70; M-1 to K-69; M-1 to Q-68; M-1 to G-67; M-1 to W-66; M-1 to R-65; M-1
to S-
64; M-1 to I-63; M-1 to W-62; M-1 to A-61; M-1 to L-60; M-1 to T-59; M-1 to R-
58; M-1
to D-57; M-1 to A-56; M-1 to F-55; M-1 to S-54; M-1 to A-53; M-1 to R-52; M-1
to L-51;
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
59
M-1 to T-50; M-1 to V-49; M-1 to P-48; M-1 to A-47; M-1 to H-46; M-1 to A-45;
M-1 to
A-44; M-1 to Q-43; M-1 to D-42; M-1 to R-41; M-1 to L-40; M-1 to S-39; M-1 to
V-38;
M-1 to T-37; M-1 to F-36; M-1 to H-35; M-1 to K-34; M-1 to P-33; M-1 to E-32;
M-1 to
Q-31; M-1 to L-30; M-1 to V-29; M-1 to L-28; M-1 to G-27; M-1 to R-26; M-1 to
V-25;
M-1 to I-24; M-1 to I-23; M-1 to V-22; M-1 to Q-21; M-1 to G-20; M-1 to P-19;
M-1 to S-
18; M-1 to L-17; M-1 to G-16; M-1 to Q-15; M-1 to P-14; M-1 to L-13; M-1 to A-
12; M-1
to H-11; M-1 to S-10; M-1 to C-9; M-1 to P-8; M-1 to V-7; and M-1 to E-6 of
SEQ ID
N0:2. Polynucleotides encoding these polypeptides are also encompassed by the
invention.
In addition, any of the above listed N- or C-terminal deletions can be
combined to
produce a N- and C-terminal deleted galectin 11 polypeptide. The invention
also provides
polypeptides having one or more amino acids deleted from both the amino and
the carboxyl
termini, which may be described generally as having residues m-n of SEQ ID
N0:2, where n
and m are integers as described above. Polynucleotides encoding these
polypeptides are also
encompassed by the invention.
In preferred embodiments, the polypeptides of the invention comprise, or
alternatively, consist of, amino acid residues: M-1 to L-40; M-1 to W-66; P-3
to L-40; L-5 to
L-40; L-5 to S-108; L-5 to L-128; P-3 to L-128; L-5 to L-128; L-5 to G-124; C-
9 to C-130; L-
13 to L-40; P-14 to L-40; L-40 to S-108; A-47 to S-108; A-47 to L-128; R-65 to
S-108; R-65
to L-128; L-88 to S-108; L-88 to L-128; S-108 to L-120; or L-114 to L-128 of
SEQ ID N0:2.
2o Polynucleotides encoding these polypeptides are also encompassed by the
invention.
Also included are a nucleotide sequence encoding a polypeptide consisting of a
portion of the complete galectin 11 amino acid sequence encoded by the cDNA
clone
contained in ATCC Deposit No. 209053, where this portion excludes any integer
of amino
acid residues from 1 to about 123 amino acids from the amino terminus of the
complete amino
acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 209053,
or any
integer of amino acid residues from 1 to about 123 amino acids from the
carboxy terminus, or
any combination of the above amino terminal and carboxy terminal deletions, of
the complete
amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
209053.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
Polynucleotides encoding all of the above deletion mutant polypeptide forms
also are
provided.
The present application is also directed to proteins containing polypeptides
at least
80%, 85%, 90%, 92%, 95%, 96%, 97%, 98% or 99% identical to the galectin 11
polypeptide
5 sequence set forth herein m-n. In preferred embodiments, the application is
directed to
proteins containing polypeptides at least 80%, 85%, 90%, 92%, 95%, 96%, 97%,
98% or
99% identical to polypeptides having the amino acid sequence of the specific
galectin 11 N-
and C-terminal deletions recited herein. Polynucleotides encoding these
polypeptides are also
encompassed by the invention.
l0 Additional preferred polypeptide fragments comprise, or alternatively
consist of, the
amino acid sequence of residues: M-1 to Q-15; S-2 to G-16; P-3 to L-17; R-4 to
S-18; L-5 to
P-19; E-6 to G-20; V-7 to Q-21; P-8 to V-22; C-9 to I-23; S-10 to I-24; H-11
to V-25; A-12
to R-26; L-13 to G-27; P-14 to L-28; Q-15 to V-29; G-16 to L-30; L-17 to Q-31;
S-18 to E-
32; P-19 to P-33; G-20 to K-34; Q-21 to H-35; V-22 to F-36; I-23 to T-37; I-24
to V-38; V-
15 25 to S-39; R-26 to L-40; G-27 to R-41; L-28 to D-42; V-29 to Q-43; L-30 to
A-44; Q-31 to
A-45; E-32 to H-46; P-33 to A-47; K-34 to P-48; H-35 to V-49; F-36 to T-50; T-
37 to L-51;
V-38 to R-52; S-39 to A-53; L-40 to S-54; R-41 to F-55; D-42 to A-56; Q-43 to
D-57; A-44
to R-58; A-45 to T-59; H-46 to L-60; A-47 to A-61; P-48 to W-62; V-49 to I-63;
T-50 to S-
64; L-51 to R-65; R-52 to W-66; A-53 to G-67; S-54 to Q-68; F-55 to K-69; A-56
to K-70;
2o D-57 to L-71; R-58 to I-72; T-59 to S-73; L-60 to A-74; A-61 to P-75; W-62
to F-76; I-63 to
L-77; S-64 to F-78; R-65 to Y-79; W-66 to P-80; G-67 to Q-81; Q-68 to R-82; K-
69 to F-83;
K-70 to F-84; L-71 to E-85; I-72 to V-86; S-73 to L-87; A-74 to L-88; P-75 to
L-89; F-76 to
F-90; L-77 to Q-91; F-78 to E-92; Y-79 to G-93; P-80 to G-94; Q-81 to L-95; R-
82 to K-96;
F-83 to L-97; F-84 to A-98; E-85 to L-99; V-86 to N-100; L-87 to G-101; L-88
to Q-102; L-
25 89 to G-103; F-90 to L-104; Q-91 to G-105; E-92 to A-106; G-93 to T-107; G-
94 to S-108;
L-95 to M-109; K-96 to N-110; L-97 to Q-111; A-98 to Q-112; L-99 to A-113; N-
100 to L-
114; G-101 to E-115; Q-102 to Q-116; G-103 to L-117; L-104 to R-118; G-105 to
E-119; A-
106 to L-120; T-107 to R-121; S-108 to I-122; M-109 to S-123; N-110 to G-124;
Q-111 to
S-125; Q-112 to V-126; A-113 to Q-127; L-114 to L-128; E-115 to Y-129; Q-116
to C-130;
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
61
L-117 to V-131; R-118 to H-132; and E-119 to S-133 of SEQ ID N0:2. These
polypeptide
fragments may retain the biological activity of galectin 11 polypeptides of
the invention
and/or may be useful to generate or screen for antibodies, as described
further below.
Polynucleotides encoding these polypeptide fragments are also encompassed by
the
invention.
In another embodiment, the present invention further provides polypeptides
having
one or more residues deleted from the amino terminus of the amino acid
sequence of the
galectin 11 polypeptide depicted in SEQ ID N0:25 or encoded by the cDNA of the
deposited clone. Particularly, in one embodiment, N-terminal deletions of the
galectin 11
polypeptide can be described by the general formula m to 275, where m is a
integer from 2 to
270 corresponding to the position of amino acid residue identified in SEQ ID
N0:25 and
preferably, corresponds to one of the N-terminal amino acid residues
identified in the N-
terminal deletions specified herein. In specific embodiments, N-terminal
deletions of the
galectin 11 polypeptide of the invention comprise, or alternatively consist
of, amino acid
residues: V-2 to S-275; M-3 to S-275; L-4 to S-275; Q-5 to S-275; G-6 to S-
275; V-7 to S-
275; V-8 to S-275; P-9 to S-275; L-10 to S-275; D-11 to S-275; A-12 to S-275;
H-13 to S-
275; R-14 to S-275; F-15 to S-275; Q-16 to S-275; V-17 to S-275; D-18 to S-
275; F-19 to S-
275; Q-20 to S-275; C-21 to S-275; G-22 to S-275; C-23 to S-275; S-24 to S-
275; L-25 to S-
275; C-26 to S-275; P-27 to S-275; R-28 to S-275; P-29 to S-275; D-30 to S-
275; I-31 to S-
275; A-32 to S-275; F-33 to S-275; H-34 to S-275; F-35 to S-275; N-36 to S-
275; P-37 to S-
275; R-38 to S-275; F-39 to S-275; H-40 to S-275; T-41 to S-275; T-42 to S-
275; K-43 to S-
275; P-44 to S-275; H-45 to S-275; V-46 to S-275; I-47 to S-275; C-48 to S-
275; N-49 to S-
275; T-50 to S-275; L-51 to S-275; H-52 to S-275; G-53 to S-275; G-54 to S-
275; R-55 to 5-
275; W-56 to S-275; Q-57 to S-275; R-58 to S-275; E-59 to S-275; A-60 to S-
275; R-61 to S-
275; W-62 to S-275; P-63 to S-275; H-64 to S-275; L-65 to S-275; A-66 to S-
275; L-67 to S-
275; R-68 to S-275; R-69 to S-275; G-70 to S-275; S-71 to S-275; S-72 to S-
275; F-73 to S-
275; L-74 to S-275; I-75 to S-275; L-76 to S-275; F-77 to S-275; L-78 to S-
275; F-79 to S-
275; G-80 to S-275; N-81 to S-275; E-82 to S-275; E-83 to S-275; V-84 to S-
275; K-85 to S-
275; V-86 to S-275; S-87 to S-275; V-88 to S-275; N-89 to S-275; G-90 to S-
275; Q-91 to S-
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
62
275; H-92 to S-275; F-93 to S-275; L-94 to S-275; H-95 to S-275; F-96 to S-
275; R-97 to S-
275; Y-98 to S-275; R-99 to S-275; L-100 to S-275; P-101 to S-275; L-102 to S-
275; S-103 to
S-275; H-104 to S-275; V-105 to S-275; D-106 to S-275; T-107 to S-275; L-108
to S-275; 6-
109 to S-275; I-110 to S-275; F-111 to S-275; G-112 to S-275; D-113 to S-275;
I-114 to S-
275; L-115 to S-275; V-116 to S-275; E-117 to S-275; A-118 to S-275; V-119 to
S-275; G-
120 to S-275; F-121 to S-275; L-122 to S-275; N-123 to S-275; I-124 to S-275;
N-125 to S-
275; P-126 to S-275; F-127 to S-275; V-128 to S-275; E-129 to S-275; G-130 to
S-275; S-131
to S-275; R-132 to S-275; E-133 to S-275; Y-134 to S-275; P-135 to S-275; A-
136 to S-275;
G-137 to S-275; H-138 to S-275; P-139 to S-275; F-140 to S-275; L-141 to S-
275; L-142 to
to S-275; M-143 to S-275; S-144 to S-275; P-145 to S-275; R-146 to S-275; L-
147 to S-275; E-
148 to S-275; V-149 to S-275; P-150 to S-275; C-151 to S-275; 5-152 to S-275;
H-153 to 5-
275; A-154 to S-275; L-155 to S-275; P-156 to S-275; Q-157 to S-275; G-158 to
S-275; L-
159 to S-275; S-160 to S-275; P-161 to S-275; G-162 to S-275; Q-163 to S-275;
V-164 to S-
275; I-165 to S-275; I-166 to S-275; V-167 to S-275; R-168 to S-275; G-169 to
S-275; L-170
to S-275; V-171 to S-275; L-172 to S-275; Q-173 to S-275; E-174 to S-275; P-
175 to S-275;
K-176 to S-275; H-177 to S-275; F-178 to S-275; T-179 to S-275; V-180 to S-
275; S-181 to
S-275; L-182 to S-275; R-183 to S-275; D-184 to S-275; Q-185 to S-275; A-186
to S-275; A-
187 to S-275; H-188 to S-275; A-189 toS-275; P-190 to S-275; V-191 to S-275; T-
192 to S-
275; L-193 toS-275; R-194 to S-275; A-195 to S-275; S-196 to S-275; F-197 to S-
275; A-198
to S-275; D-199 to S-275; R-200 to S-275; T-201 toS-275; L-202 to S-275; A-203
to S-275;
W-204 to S-275; I-205 toS-275; S-206 to S-275; R-207 to S-275; W-208 to S-275;
G-209 to
S-275; Q-210 to S-275; K-211 to S-275; K-212 to S-275; L-213 to S-275; I-214
to S-275; S-
215 to S-275; A-216 to S-275; P-217 to S-275; F-218 to S-275; L-219 to S-275;
F-220 to S-
275; Y-221 to S-275; P-222 to S-275; Q-223 to S-275; R-224 to S-275; F-225 to
S-275; F-
226 to S-275; E-227 to S-275; V-228 to S-275; L-229 to S-275; L-230 to S-275;
L-231 to S-
275; F-232 to S-275; Q-233 to S-275; E-234 to S-275; G-235 to S-275; G-236 to
S-275; L-
237 to S-275; K-238 to S-275; L-239 to S-275; A-240 to S-275; L-241 to S-275;
N-242 to S-
275; G-243 to S-275; Q-244 to S-275; G-245 to S-275; L-246 to S-275; G-247 to
S-275; A-
248 to S-275; T-249 to S-275; S-250 to S-275; M-251 to S-275; N-252 to S-275;
Q-253 to S-
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
63
275; Q-254 to S-275; A-255 to S-275; L-256 to S-275; E-257 to S-275; Q-258 to
S-275; L-
259 to S-275; R-260 to S-275; E-261 to S-275; L-262 to S-275; R-263 to S-275;
I-264 to S-
275; S-265 to S-275; G-266 to S-275; S-267 to S-275; V-268 to S-275; Q-269 to
S-275; and
L-270 to S-275 of SEQ ID N0:25. Polynucleotides encoding such polypeptides are
also
encompassed by the invention.
Further embodiments of the invention are directed to C-terminal deletions of
the
galectin 11 polypeptide described by the general formula 1 to n, where n is an
integer from 6
to 275 corresponding to the position of amino acid residue identified in SEQ
ID NO:25 and
preferably, corresponds to one of the C-terminal amino acid residues
identified in the C-
to terminal deletions specified herein. In specific embodiments, C terminal
deletions of the
galectin 11 polypeptide of the invention comprise, or alternatively, consist
of, amino acid
residues: M-1 to H-274; M-1 to V-273; M-I toC-272; M-1 to Y-271; M-1 to L-270;
M-1 to
Q-269; M-1 to V-268; M-1 to S-267; M-1 to G-266; M-1 to S-265; M-1 to I-264; M-
1 to 8-
263; M-1 to L-262; M-1 to E-261; M-1 to R-260; M-1 to L-259; M-1 to Q-258; M-1
to E-
257; M-1 to L-256; M-I to A-255; M-1 to Q-254; M-1 to Q-253; M-1 to N-252; M-1
to M-
251; M-1 to S-250; M-1 to T-249; M-1 to A-248; M-1 to G-247; M-I to L-246; M-1
to 6-
245; M-1 to Q-244; M-1 to G-243; M-1 to N-242; M-1 to L-241; M-1 to A-240; M-1
to L-
239; M-1 to K-238; M-1 to L-237; M-1 to G-236; M-1 to G-235; M-1 to E-234; M-1
to Q-
233; M-1 to F-232; M-1 to L-231; M-1 to L-230; M-1 to L-229; M-1 to V-228; M-1
to E-
227; M-1 to F-226; M-1 to F-225; M-1 to R-224; M-1 to Q-223; M-1 to P-222; M-1
to Y-
221; M-1 to F-220; M-1 to L-219; M-1 to F-218; M-1 to P-217; M-1 to A-216; M-1
to S-
215; M-1 to I-214; M-1 to L-213; M-I to K-212; M-1 to K-211; M-1 to Q-210; M-1
to 6-
209; M-1 to W-208; M-1 to R-207; M-1 to S-206; M-1 to I-205; M-1 to W-204; M-1
to A-
203; M-1 to L-202; M-1 to T-201; M-1 to R-200; M-1 to D-199; M-1 to A-198; M-1
to F-
197; M-I to S-196; M-1 to A-195; M-1 to R-194; M-1 to L-193; M-1 to T-192; M-1
to V-
191; M-1 to P-190; M-1 to A-189; M-1 to H-188; M-1 to A-187; M-1 to A-186; M-1
to Q-
185; M-1 to D-184; M-1 to R-183; M-1 to L-182; M-1 to S-181; M-1 to V-180; M-1
to T-
179; M-1 to F-178; M-1 to H-177; M-1 to K-176; M-1 to P-175; M-1 to E-174; M-1
to Q-
173; M-1 to L-172; M-1 to V-171; M-1 to L-170; M-1 to G-169; M-1 to R-168; M-1
to V-
CA 02371611 2001-10-19
WO 00/63221 PCT/CIS00/10714
64
167; M-1 to I-166; M-1 to I-165; M-1 to V-164; M-1 to Q-163; M-1 to G-162; M-1
to P-
161; M-1 to S-160; M-1 to L-159; M-1 to G-158; M-1 to Q-157; M-1 to P-156; M-1
to L-
155; M-1 to A-154; M-1 to H-153; M-1 to S-152; M-1 to C-151; M-1 to P-150; M-1
to V-
149; M-1 to E-148; M-1 to L-147; M-I to R-146; M-1 to P-145; M-1 to S-144; M-I
to M-
143; M-1 to L-142; M-1 to L-141; M-1 to F-140; M-1 to P-139; M-1 to H-138; M-1
to G-
137; M-1 to A-136; M-1 to P-135; M-1 to E-133; M-1 to R-132;
to Y-134; M-1 M-1 to S-
131; M-1 to G-130; M-1 to E-129; M-1 to F-127; M-1 to P-126;
to V-128; M-1 M-1 to N-
125; M-1 to I-124; M-1 to N-123; M-1 to F-121; M-1 to G-120;
to L-122; M-1 M-1 to V-
119; M-1 to A-118; M-1 to E-117; M-1 to L-115; M-1 to I-114;
to V-116; M-1 M-1 to D-
113; M-1 to G-112; M-1 to F-111; to G-109; M-1 to L-108;
M-1 to I-110; M-1 M-1 to T-
107; M-1 to D-106; M-1 to V-105; M-1 to H-104; M-1 to S-103; M-1 to L-102; M-1
to P-
101; M-1 to L-100; M-1 to R-99; M-1 to Y-98; M-1 to R-97; M-1 to F-96; M-I to
H-95;
M-1 to L-94; M-1 to F-93; M-1 to H-92; M-1 to Q-91; M-1 to G-90; M-1 to N-89;
M-1 to
V-88; M-1 to S-87; M-1 to V-86; M-1 to K-85; M-1 to V-84; M-1 to E-83; M-1 to
E-82; M-
1 to N-81; M-1 to G-80; M-1 to F-79; M-1 to L-78; M-1 to F-77; M-1 to L-76; M-
1 to I-75;
M-1 to L-74; M-1 to F-73; M-1 to S-72; M-1 to S-71; M-1 to G-70; M-1 to R-69;
M-I to
R-68; M-1 to L-67; M-1 to A-66; M-I to L-65; M-1 to H-64; M-1 to P-63; M-1 to
W-62;
M-1 to R-61; M-1 to A-60; M-1 to E-59; M-1 to R-58; M-1 to Q-57; M-1 to W-56;
M-1 to
R-55; M-1 to G-54; M-1 to G-53; M-1 to H-52; M-1 to L-51; M-1 to T-50; M-1 to
N-49;
2o M-1 to C-48; M-1 to I-47; M-1 to V-46; M-1 to H-45; M-1 to P-44; M-1 to K-
43; M-1 to
T-42; M-1 to T-41; M-1 to H-40; M-1 to F-39; M-1 to R-38; M-1 to P-37; M-I to
N-36;
M-1 to F-35; M-1 to H-34; M-1 to F-33; M-1 to A-32; M-1 to I-31; M-1 to D-30;
M-I to
P-29; M-1 to R-28; M-1 to P-27; M-1 to C-26; M-1 to L-25; M-1 to S-24; M-1 to
C-23; M-
1 to G-22; M-1 to C-21; M-1 to Q-20; M-1 to F-19; M-1 to D-18; M-1 to V-17; M-
I to Q-
16; M-1 to F-15; M-1 to R-14; M-1 to H-13; M-1 to A-12; M-1 to D-11; M-1 to L-
10; M-1
to P-9; M-1 to V-8; M-1 toV-7; and M-1 to G-6 all of SEQ ID N0:25.
Polynucleotides
encoding such polypeptides are also encompassed by the invention.
Further embodiments of the invention are directed to polypeptide fragments
comprising, or alternatively, consisting of, amino acids described by the
general formula m to
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
n, where m and n correspond to any one of the amino acid residues specified
above for these
symbols, respectively. Polynucleotides encoding these polypeptides are also
encompassed
by the invention.
In yet another embodiment, the present invention further provides polypeptides
5 having one or more residues deleted from the amino terminus of the amino
acid sequence of
the galectin 11 polypeptide depicted in SEQ ID N0:27. Particularly, in one
embodiment, N-
terminal deletions of the galectin 11 polypeptide can be described by the
general formula m to
296, where m is an integer from 2 to 291 corresponding to the position of
amino acid residue
identified in SEQ ID N0:27 and preferably, corresponds to one of the N-
terminal amino acid
l0 residues identified in the N-terminal deletions specified herein. In
specific embodiments, N-
terminal deletions of the galectin 11 polypeptide of the invention comprise,
or alternatively
consist of, amino acid residues: S-2 to S-296; F-3 to S-296; F-4 to S-296; S-S
to S-296; C-6 to
S-296; S-7 to S-296; G-8 to S-296; G-9 to S-296; S-10 to S-296; L-11 to S-296;
C-12 to S-
296; H-13 to S-296; D-14 to 5-296; D-15 to S-296; F-16 to S-296; W-17 to S-
296; R-18 to S-
15 296; P-19 to S-296; A-20 to S-296; C-21 to S-296; R-22 to S-296; Q-23 to S-
296; D-24 to S-
296; G-25 to S-296; H-26 to S-296; A-27 to S-296; A-28 to S-296; R-29 to S-
296; S-30 to S-
296; G-31 to S-296; P-32 to S-296; S-33 to S-296; R-34 to S-296; C-35 to S-
296; T-36 to 5-
296; Q-37 to S-296; V-38 to S-296; D-39 to S-296; F-40 to S-296; Q-41 to S-
296; C-42 to 5-
296; G-43 to S-296; C-44 to S-296; S-45 to S-296; L-46 to S-296; C-47 to S-
296; P-48 to S-
20 296; R-49 to S-296; P-50 to S-296; D-51 to S-296; I-52 to S-296; A-53 to S-
296; F-54 to S-
296; H-55 to S-296; F-56 to S-296; N-57 to S-296; P-58 to S-296; R-59 to S-
296; F-60 to S-
296; H-61 to S-296; T-62 to S-296; T-63 to S-296; K-64 to S-296; P-65 to S-
296; H-66 to 5-
296; V-67 to S-296; I-68 to S-296; C-69 to S-296; N-70 to S-296; T-71 to S-
296; L-72 to 5-
296; H-?3 to S-296; G-74 to S-296; G-75 to S-296; R-76 to S-296; W-77 to S-
296; Q-78 to S-
25 296; R-79 to S-296; E-80 to S-296; A-81 to S-296; R-82 to S-296; W-83 to S-
296; P-84 to S-
296; H-85 to S-296; L-86 to S-296; A-87 to S-296; L-88 to S-296; R-89 to S-
296; R-90 to 5-
296; G-91 to S-296; S-92 to S-296; S-93 to S-296; F-94 to S-296; L-95 to S-
296; I-96 to S-
296; L-97 to S-296; F-98 to S-296; L-99 to S-296; F-100 to S-296; G-101 to S-
296; N-102 to
S-296; E-103 to S-296; E-104 to S-296; V-105 to S-296; K-106 to S-296; V-107
to S-296; S-
CA 02371611 2001-10-19
WO 00163221 PCTlUS00110714
66
108 to S-296; V-109 to S-296; N-110 to S-296; G-111 to S-296; Q-112 to S-296;
H-113 to S-
296; F-114 to S-296; L-115 to S-296; H-116 to S-296; F-117 to S-296; R-118 to
S-296; Y-
119 to S-296; R-120 to S-296; L-121 to S-296; P-122 to S-296; L-123 to S-296;
S-124 to 5-
296; H-125 to S-296; V-126 to S-296; D-127 to S-296; T-128 to S-296; L-129 to
S-296; G-
130 to S-296; I-131 to S-296; F-132 to S-296; G-133 to S-296; D-134 to S-296;
I-135 to S-
296; L-136 to S-296; V-137 to S-296; E-138 to S-296; A-139 to S-296; V-140 to
5-296; 6-
141 to S-296; F-142 to S-296; L-143 to S-296; N-144 to S-296; I-145 to S-296;
N-146 to 5-
296; P-147 to S-296; F-148 to S-296; V-149 to S-296; E-150 to S-296; G-151 to
S-296; S-152
to S-296; R-153 to S-296; E-154 to S-296; Y-155 to S-296; P-156 to S-296; A-
157 to S-296;
G-158 to S-296; H-159 to 5-296; P-160 to S-296; F-161 to S-296; L-162 to S-
296; L-163 to
S-296; M-164 to S-296; S-165 to S-296; P-166 to S-296; R-167 to S-296; L-168
to S-296; E-
169 to S-296; V-170 to S-296; P-171 to S-296; C-172 to S-296; S-173 to S-296;
H-174 to S-
296; A-175 to S-296; L-176 to S-296; P-177 to S-296; Q-178 to S-296; G-179 to
S-296; L-
180 to S-296; S-181 to S-296; P-182 to S-296; G-183 to S-296; Q-184 to S-296;
V-185 to S-
296; I-186 to S-296; I-187 to S-296; V-188 to S-296; R-189 to S-296; G-190 to
S-296; L-191
to S-296; V-192 to S-296; L-193 to S-296; Q-194 to S-296; E-195 to S-296; P-
196 to S-296;
K-197 to S-296; H-198 to S-296; F-199 to S-296; T-200 to S-296; V-201 to S-
296; S-202 to
S-296; L-203 to S-296; R-204 to S-296; D-205 to S-296; Q-206 to S-296; A-207
to S-296; A-
208 to S-296; H-209 to S-296; A-210 to S-296; P-211 to S-296; V-212 to 5-296;
T-213 to S-
296; L-214 to S-296; R-215 to S-296; A-216 to S-296; S-217 to S-296; F-218 to
S-296; A-
219 to S-296; D-220 to S-296; R-221 to S-296; T-222 to S-296; L-223 to S-296;
A-224 to S-
296; W-225 to S-296; I-226 to S-296; S-227 to S-296; R-228 to S-296; W-229 to
S-296; 6-
230 to S-296; Q-231 to S-296; K-232 to S-296; K-233 to S-296; L-234 to S-296;
I-235 to 5-
296; S-236 to S-296; A-237 to S-296; P-238 to S-296; F-239 to S-296; L-240 to
S-296; F-241
to S-296; Y-242 to S-296; P-243 to S-296; Q-244 to S-296; R-245 to S-296; F-
246 to S-296;
F-247 to S-296; E-248 to S-296; V-249 to S-296; L-250 to S-296; L-251 to S-
296; L-252 to 5-
296; F-253 to S-296; Q-254 to S-296; E-255 to S-296; G-256 to S-296; G-257 to
S-296; L-
258 to S-296; K-259 to S-296; L-260 to S-296; A-261 to S-296; L-262 to S-296;
N-263 to S-
296; G-264 to S-296; Q-265 to S-296; G-266 to S-296; L-267 to S-296; G-268 to
S-296; A-
CA 02371611 2001-10-19
WO 00163221 PCTlUS00/10714
67
269 to S-296; T-270 to S-296; S-271 to S-296; M-272 to S-296; N-273 to S-296;
Q-274 to 5-
296; Q-275 to S-296; A-276 to S-296; L-277 to S-296; E-278 to S-296; Q-279 to
S-296; L-
280 to S-296; R-281 to S-296; E-282 to S-296; L-283 to S-296; R-284 to S-296;
I-285 to S-
296; S-286 to S-296; G-287 to S-296; S-288 to S-296; V-289 to S-296; Q-290 to
S-296; L-291
to S-296; of SEQ ID N0:27. Polynucleotides encoding such polypeptides are also
provided.
Further embodiments of the invention are directed to C-terminal deletions of
the
galectin 11 polypeptide described by the general formula 1 to n, where n is an
integer from 6
to 295 corresponding to the position of amino acid residue identified in SEQ
ID N0:27 and
preferably, corresponds to one of the C-terminal amino acid residues
identified in the C-
1 o terminal deletions specified herein. In specific embodiments, C terminal
deletions of the
galectin 11 polypeptide of the invention comprise, or alternatively, consist
of, amino acid
residues: M-1 to H-295; M-1 to V-294; M-1 toC-293; M-1 to Y-292; M-1 to L-291;
M-1 to
Q-290; M-1 to V-289;M-1 to S-288; M-1 to G-287; M-1 to S-286; M-1 to I-285; M-
1 toR-
284; M-1 to L-283; M-1 to E-282; M-1 to R-281; M-1 to L-280; M-1 to Q-279; M-1
to E-
278; M-1 to L-277; M-1 to A-276; M-1 to Q-275; M-1 to Q-274; M-1 to N-273; M-1
to M-
272; M-1 to S-271; M-1 to T-270; M-1 to A-269; M-1 to G-268; M-1 to L-267; M-1
to 6-
266; M-1 to Q-265; M-1 to G-264; M-1 to N-263; M-1 to L 262; M-1 to A-261; M-1
to L-
260; M-1 to K-259; M-1 to L-258; M-1 to G-257; M-1 to G-256; M-1 to E-255; M-1
to Q-
254; M-1 to F-253; M-1 to L-252; M-1 to L-251; M-1 to L-250; M-1 to V-249; M-1
to E-
248; M-1 to F-247; M-1 to F-246; M-1 to R-245; M-1 to Q-244; M-1 to P-243; M-1
to Y-
242; M-1 to F-241; M-1 to L-240; M-1 to F-239; M-1 to P-238; M-1 to A-237; M-1
to S-
236; M-1 to I-235; M-1 to L-234; M-1 to K-233; M-1 to K-232; M-1 to Q-231; M-1
to 6-
230; M-1 to W-229; M-1 to R-228; M-1 to S-227; M-1 to I-226; M-1 to W-225; M-1
to A-
224; M-1 to L-223; M-1 to T-222; M-1 to R-221; M-1 to D-220; M-1 to A-219; M-1
to F-
z5 218; M-1 to S-217; M-1 to A-216; M-1 to R-215; M-1 to L-214; M-1 to T-213;
M-1 to V-
212; M-1 to P-211; M-1 to A-210; M-1 to H-209; M-1 to A-208; M-1 to A-207; M-1
to Q-
206; M-1 to D-205; M-1 to R-204; M-1 to L-203; M-1 to S-202; M-1 to V-201; M-1
to T-
200; M-1 to F-199; M-1 to H-198; M-1 to K-197; M-1 to P-196; M-1 to E-195; M-1
to Q-
194; M-1 to L-193; M-1 to V-192; M-1 to L-191; M-1 to G-190; M-1 to R-189; M-1
to V-
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
68
188; M-1 to I-187; M-1 to I-186; M-1 to V-185; M-1 to Q-184; M-1 to G-183; M-1
to P-
182; M-1 to S-181; M-1 to L-180; M-1 to G-179; M-1 to Q-178; M-1 to P-177; M-1
to L-
176; M-1 to A-175; M-1 to H-174; M-1 to S-173; M-1 to C-172; M-1 to P-171; M-1
to V-
170; M-I to E-169; M-1 to L-168; M-1 to R-167; M-1 to P-166; M-1 to S-165; M-1
to M-
s 164; M-1 to L-163; M-1 to L-162; M-1 to F-161; M-1 to P-160; M-1 to H-159; M-
1 to G-
158; M-1 to A-157; M-1 to P-156; M-I to Y-155; M-1 to E-154; M-1 to R-153; M-1
to 5-
152; M-1 to G-151; M-1 to E-150; M-1 to V-149; M-1 to F-148; M-1 to P-147; M-1
to N-
146; M-1 to I-145; M-1 to N-144; M-1 to L-143; M-1 to F-142; M-1 to G-141; M-1
to V-
140; M-1 to A-139; M-I to E-138; M-1 to V-137; M-1 to L-136; M-1 to I-135; M-1
to D-
l0 134; M-1 to G-133; M-1 to F-132; M-1 to I-131; M-1 to G-130; M-1 to L-129;
M-1 to T-
128; M-1 to D-127; M-1 to V-126; M-1 to H-125; M-1 to S-124; M-1 to L-123; M-1
to P-
122; M-1 to L-121; M-1 to R-120; M-1 to Y-119; M-1 to R-118; M-I to F-117; M-1
to H-
116; M-1 to L-115; M-1 to F-114; M-1 to H-113; M-1 to Q-112; M-1 to G-111; M-1
to N-
110; M-I to V-109; M-1 to S-108; M-1 to V-107; M-1 to K-106; M-1 to V-105; M-1
to E-
1s 104; M-1 to E-103; M-1 to N-102; M-1 to G-101; M-1 to F-100; M-1 to L-99; M-
1 to F-98;
M-1 to L-97; M-1 to I-96; M-1 to L-95; M-1 to F-94; M-1 to S-93; M-1 to S-92;
M-1 to G-
91; M-1 to R-90; M-1 to R-89; M-1 to L-88; M-1 to A-87; M-1 to L-86; M-1 to H-
85; M-1
to P-84; M-1 to W-83; M-1 to R-82; M-1 to A-81; M-1 to E-80; M-1 to R-79; M-I
to Q-78;
M-1 to W-77; M-1 to R-76; M-1 to G-75; M-I to G-74; M-1 to H-73; M-1 to L-72;
M-1 to
2o T-71; M-1 to N-70; M-1 to C-69; M-1 to I-68; M-1 to V-67; M-1 to H-66; M-1
to P-65; M-
1 to K-64; M-1 to T-63; M-1 to T-62; M-1 to H-61; M-1 to F-60; M-1 to R-59; M-
1 to P-
58; M-1 to N-57; M-1 to F-56; M-1 to H-55; M-1 to F-54; M-I to A-53; M-1 to I-
52; M-1
to D-51; M-1 to P-50; M-1 to R-49; M-1 to P-48; M-1 to C-47; M-1 to L-46; M-1
to S-45;
M-1 to C-44; M-1 to G-43; M-1 to C-42; M-1 to Q-41; M-1 to F-40; M-1 to D-39;
M-1 to
25 V-38; M-1 to Q-37; M-1 to T-36; M-1 to C-35; M-1 to R-34; M-1 to S-33; M-1
to P-32;
M-1 to G-31; M-1 to S-30; M-1 to R-29; M-1 to A-28; M-1 to A-27; M-1 to H-26;
M-1 to
G-25; M-1 to D-24; M-1 to Q-23; M-1 to R-22; M-1 to C-21; M-1 to A-20; M-1 to
P-19;
M-1 to R-18; M-1 to W-17; M-1 to F-16; M-1 to D-15; M-1 to D-14; M-1 to H-13;
M-1 to
C-12; M-1 to L-11; M-1 to S-10; M-1 to G-9; M-1 to G-8; M-1 to S-7; M-1 to C-
6, all of
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
69
SEQ ID N0:27. Polynucleotides encoding such polypeptides are also encompassed
by the
invention.
Further embodiments of the invention are directed to polypeptide fragments
comprising, or alternatively, consisting of, amino acids described by the
general formula m to
n, where m and n correspond to any one of the amino acid residues specified
above for these
symbols, respectively. Polynucleotides encoding these polypeptides are also
encompassed
by the invention.
Figure 2 provides a comparison of the galectin 11 polypeptide with other
galectins.
Identical amino acids shared between the galectins are shaded, while
conservative amino acid
1o changes are boxed. By examining the regions of amino acids shaded andlor
boxed, the skilled
artisan can readily identify conserved domains between the two polypeptides.
The amino
acid sequences falling within these conserved, shaded and/or boxed domains are
contained in
the preferred polypeptide fragments of the invention. Similar analyses for the
full-length
galectin-1 la and (3 is deemed to be within the skill of the ordinary artisan
given the teachings
provided herein.
Representative examples of polypeptide residue fragments of the invention
including,
for example, fragments from about amino acid number 1-20, 1-66, 5-108, 5-128,
21-40, 40-
108, 41-60, 47-108, 47-128, 61-80, 65-108, 65-128, 81-100, 88-108, 88-128, 108-
120; 114-
128; and 101 to the end of the galectin 11 polypeptide depicted in Figure 1
(SEQ ID N0:2).
2o In this context, "about" includes the particularly recited ranges larger or
smaller by several , 5,
4, 3, 2, or 1 amino acid at either end or at both extremes. Representative
examples of
polypeptide residue fragments of the invention including, for example,
fragments from about
amino acid number 1-20, 1-66, 5-108, 5-128, 21-40, 40- 108, 41-60, 47-108, 47-
128, 61-80,
65-108, 65-128, 81-100, 88-108, 88-128, 108-120; 114-128; 129-150; 145-175;
170-200;
195-225; 220-250; and 245-275 of SEQ ID N0:25. Additional representative
examples of
polypeptide residue fragments of the invention including, for example,
fragments from about
amino acid number 1-20, 1-66, 5-108, 5-128, 21-40, 40- 108, 41-60, 47-108, 47-
128, 61-80,
65-108, 65-128, 81-100, 88-108, 88-128, 108-120; 114-128; 129-150; 145-175;
170-200;
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
195-225; 220-250; 245-275; and 270-296 of SEQ ID N0:27. Polypeptides
comprising such
amino acid sequences are provided as well as polynucleotides encoding such
polypeptides.
Preferably, the polynucleotide fragments of the invention encode a polypeptide
which
demonstrates a galectin 11 functional activity. By a polypeptide demonstrating
a galectin 11
5 "functional activity" is meant, a polypeptide capable of displaying one or
more known
functional activities associated with a full-length (complete) galectin 11
protein. Such
functional activities include, but are not limited to, biological activity,
antigenicity [ability to
bind (or compete with a galectin 11 polypeptide for binding) to an anti-
galectin 11 antibody],
immunogenicity (ability to generate antibody which binds to a galectin 11
polypeptide),
1o ability to form multimers with galectin 11 polypeptides of the invention.
Among the especially preferred fragments of the invention are fragments
characterized
by structural or functional attributes of galectin 11. Such fragments include
amino acid
residues that comprise alpha-helix and alpha-helix forming regions ("alpha-
regions"), beta-
sheet and beta-sheet-forming regions ("beta-regions"), turn and turn-forming
regions ("turn-
15 regions"), coil and coil-forming regions ("coil-regions"), hydrophilic
regions, hydrophobic
regions, alpha amphipathic regions, beta amphipathic regions, surface forming
regions, and
high antigenic index regions (i.e., having an antigenic region of three or
more contiguous amino
acid residues each of which having an antigenic index of greater than or equal
to 1.5) of galectin
11. Certain preferred regions are those set out in Figure 3 and include, but
are not limited to,
2o regions of the aforementioned types identified by analysis of the amino
acid sequence
depicted in Figure 1 (SEQ ID N0:2), such preferred regions include; Gamier-
Robson
predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Chou-
Fasman predicted
alpha-regions, beta-regions, turn-regions, and coil-regions; Kyte-Doolittle
predicted
hydrophilic and hydrophobic regions; Eisenberg alpha and beta amphipathic
regions; Emini
25 surface-forming regions; and Jameson-Wolf high antigenic index regions, as
predicted using the
default parameters of these computer programs. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
In additional embodiments, the polynucleotides of the invention encode
functional
attributes of galectin 11. Preferred embodiments of the invention in this
regard include
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
71
fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-
regions"),
beta-sheet and beta-sheet forming regions ("beta-regions"), turn and turn-
forming regions
("turn-regions"), coil and coil-forming regions ("coil-regions"), hydrophilic
regions,
hydrophobic regions, alpha amphipathic regions, beta amphipathic regions,
flexible regions,
surface-forming regions and high antigenic index regions of galectin 11.
The data representing the structural or functional attributes of galectin 11
set forth in
Figure 1 and/or Table I, as described above, was generated using the various
modules and
algorithms of the DNA*STAR set on default parameters. In a preferred
embodiment, the
data presented in columns VIII, XII, and XIII of Table I can be used to
determine regions of
to galectin 11 which exhibit a high degree of potential for antigenicity.
Regions of high
antigenicity are determined from the data presented in columns VIII, XII,
andlor XIII by
choosing values which represent regions of the polypeptide which are likely to
be exposed on
the surface of the polypeptide in an environment in which antigen recognition
may occur in
the process of initiation of an immune response.
Certain preferred regions in these regards are set out in Figure 3, but may,
as shown in
Table I, be represented or identified by using tabular representations of the
data presented in
Figure 3. The DNA*STAR computer algorithm used to generate Figure 3 (set on
the original
default parameters) was used to present the data in Figure 3 in a tabular
format (See Table I).
The tabular format of the data in Figure 3 may be used to easily determine
specific boundaries
of a preferred region.
The above-mentioned preferred regions set out in Figure 3 and in Table I
include, but
are not limited to, regions of the aforementioned types identified by analysis
of the amino
acid sequence set out in Figure 1. As set out in Figure 3 and in Table I, such
preferred regions
include Gamier-Robson alpha-regions, beta-regions, turn-regions, and coil-
regions,
Chou-Fasman alpha-regions, beta-regions, and turn-regions, Kyte-Doolittle
hydrophilic
regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz
flexible regions,
Emini surface-forming regions and Jameson-Wolf regions of high antigenic
index.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
72
TABLE
I
Res I II III N V VI VIIVIII IX X XI XII
Position XIII
Met 1 . . B . . . . 0.13 . * . 0.65
1.50
Ser 2 . . . . . T C 0.52 . * . 0.90
0.97
Pro 3 . . B . . T . 0.06 . * . 0.85
1.32
Arg 4 . . . . T T . 0.23 . * . 1.10
0.99
Leu 5 A . . . . T . -0.04. * . 0.85
1.14
Glu 6 . . B . . . . 0.26 . * . 0.50
0.39
Val 7 . . B . . T . 0.52 . * . 0.70
0.27
10Pro 8 . . B . . T . 0.14 * * . 0.10
0.45
Cys 9 . . . . T T . -0.78* * . D.50
0.26
Ser 10 . . B . . T . -0.18. . . -0.20
0.29
His I . . B . . . . -0.18. . . -0.40
1 0.29
Ala 12 . . B . . . . 0.33 . . . -0.40
0.93
I5Leu 13 . . B . . . . -0.27* . . -0.10
0.69
Pro 14 . . . T T . O.10 * . F 0.35
0.42
Gln 15 . . T T . 0.19 * . F 0.35
0.55
Gly 16 . T T . -0.12* . F 0.50
1.04
Leu 17 . . . T C 0.47 . . F 0.45
0.66
20Ser 18 . . . . . T C 0.42 * . F 0.45
0.66
Pro 19 . . . . . T C -0.26* . F 0.45
0.50
Gly 20 . . B . . T . -1.14. . F -0.05
0.42
Gln 21 . . B . . T . -1.66* . F -0.05
0.22
Val 22 . . B B . . . -0.73* . . -0.60
0.1
1
25Ile 23 . . B B . . . -0.78* . . -0.60
0.21
Ile 24 . . B B . . . -1.38. . . -0.60
0.12
Val 25 . . B B . . . -1.89. . . -0.60
0.13
Arg 26 . . B B . -2.70. . . -0.60
0.14
Gly 2 . . B B . -1.84. . . -0.60
7 0.17
30Leu 28 . B B . -0.96. . . -0.60
0.39
Val 29 . . B B . . -0.28* . . 0.30
0.34
Leu 30 A . B . . . 0.62 * * . -0.30
0.54
Gln 31 A B . . . 0.48 * . F 0.60
1.30
Glu 32 . B B . . . 0.12 * . F 0.60
2.39
35Pro 33 A . . . . . . 0.62 . . F 0.80
2.51
Lys 34 A . . B . . . 0.62 * . F 0.60
2.09
His 35 A . . B . . . 1.13 * . . 0.30
0.89
Phe 36 . . B B . . . 0.32 * * . -0.30
0.78
Thr 3 . . B B . . . 0.43 * * . -0.60
7 0.32
40Val 3 . . B B . . . 0.64 * * . -0.60
8 0.46
Ser 39 A A . . . 0.60 * * . 0.30
0.89
Leu 40 A A . . 0.04 . * . 0.45
1.07
Arg 41 A A . . . . 0.16 . * . 0.45
1.45
Asp 42 A A . . . . 0.43 . * . 0.75
1.09
45Gln 43 A A . . . . . 0.70 . * . 0.45
1.80
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
73
Table I (continued)
Res I II III IV V VI VII VIIIIX X XI XII
Position XIII
Ala 44 A A . . . 0.79 . * . 0.60
0.93
Ala 45 A A . . . 0.74 . * . 0.30
0.86
His 46 A A . . . . 0.32 . * . -0.60
0.37
Ala 47 . A B . . . . -0.49 . * . -0.60
0.53
Pro 48 . A B . . . . -0.38 . * . -0.60
0.43
Val 49 A A . . . , . -0.38 . * . -0.30
0.62
Thr 50 A A . . . . . -0.09 . * . -0.30
0.62
Leu 51 . A B . . . . -0.76 . * . -0.30
0.54
Arg 52 . A B . . . . -0.76 . * . -0.60
0.63
Ala 53 A A . . . . . -0.54 . * . -0.30
0.44
Ser 54 A A . . . . . 0.42 . * 0.30
0.89
Phe 55 A A . . . . . 0.42 . * 0.60
0.89
Ala 56 A A . . . . . 0.42 . * 0.45
1.27
Asp 57 A A . . . . -0.28 . * F 0.45
0.78
Arg 58 A A . . . . 0.02 * . F 0.45
0.91
Thr 59 A A . . -0.57 * . . -0.30
0.95
Leu 60 A A . . . . -0.17 * . . -0.30
0.40
Ala 61 A A . . . . 0.53 * . . -0.60
0.27
Trp 62 A A . . . . . 0.24 * . . -0.60
0.37
Ile 63 A A . . . . . -0.21 * . . -0.26
0.47
Ser 64 A . . . . T . 0.10 * . . 0.48
0.46
Arg 65 . . . T T . 0.96 * . . 1.22
0.76
Trp 66 . . . . T T . 1.59 * . F 2.76
2.17
Gly 67 . . . . T T . 1.07 * . F 3.40
3.24
Gln 68 . A . . T . 1.07 * F 2.66
1.36
Lys 69 . A . . T . 1.07 * . F 1.27
0.91
Lys 70 . A B . . . 0.37 * . F 1.28
1.23
Leu 71 . A B . . . . 0.44 . F 0.79
0.72
Ile 72 . A B . 0.09 . . . 0.30
0.55
Ser 73 . B . . -0.72 . . . -0.40
0.24
Ala 74 B . . . -1.47 * . . -0.40
0.24
Pro 75 B B . . . -t.76 . . . -0.60
0.30
Phe 76 . . B B . . . -1.16 . . . -0.60
0.35
Leu 77 . . B B . . . -0.27 . * . -0.60
0.53
Phe 78 . . B B . . . 0.14 * . . -0.60
0.59
Tyr 79 . . B . . T . 0.03 * . . -0.05
1.35
Pro 80 . . . . . T C -0.46 * . F 0.30
1.41
Gln 81 . . . . T T . 0.24 * . F 0.50
1.41
Arg 82 A . . . . T . 0.20 * . F 0.40
1.56
Phe 83 A A . . . 0.09 * . . -0.30
0.75
Phe 84 A A . . . -0.48 * . . -0.30
0.36
Glu 85 A A . . . . . -1.08 * . . -0.60
0.15
CA 02371611 2001-10-19
WO 00/63221 PCT/C1S00/10714
?4
Table I (continued)
Res I II III IV VI VIIVIII IX X XI XII XIII
Position V
Val 86 A A . . . . . -1.78* . . -0.60 0.14
Leu 87 A A . . . . . -1.89* . . -0.60 0.14
Leu 88 A A . . . . . -1.19* . . -0.60 0.14
Leu 89 A A . . . . . -0.83. . . -0.60 0.33
Phe 90 A A . . . . -1.18. . . -0.60 0.40
Gln 91 A . . . . T . -1.13* . F -0.05 0.48
Glu 92 A . . . . T . -0.28* * F -0.05 0.48
10Gly 93 A . . . . T . -0.28. . F 1.00 1.11
Gly 94 A . . . . T . -0.06. * F 0.85 0.53
Leu 95 A A . . . . . -0.17* * F 0.45 0.31
Lys 96 A A . . . . . -0.17* * . -0.60 0.26
Leu 97 . A B . . . . -0.51* * . -0.30 0.42
15Ala 98 . A B . . . . -0.17. * . -0.30 0.50
Leu 99 . A B . . . . -0.17. * . -0.30 0.43
Asn 100 . A B . . . . -0.17. * F -0.45 0.52
Gly 101 . . B . . T . -0.56. * F -0.05 0.43
Gln 102 , . B . . T C -0.33. * F 0.15 0.51
20Gly 103 . . . . . T C -0.06. . F 0.45 0.32
Leu 104 . . . . T C 0.46 . . F 0.45 0.47
Gly 105 . . . . . . C -0.14. . F 0.25 0.36
Ala 106 . . B . . . . 0.20 . . F -0.25 0.36
Thr 107 . . B . . . . 0.20 . . F -0.25 0.71
25Ser 108 . . B . . T . 0.54 . . F 0.40 1.23
Met 109 . . B . . T . 0.77 . . F 0.40 2.12
Asn 110 A . . . . T . 0.30 * . F 0.40 1.48
Gln 111 A . . . . T . 0.89 * . F 0.25 0.91
Gln 112 A A . . . . . 1.20 * F 0.60 1.60
30Ala 113 A A . . . . . 0.69 * * F 0.60 1.72
Leu 114 A A . . . . 1.40 * . F -0.15 0.82
Glu 115 A A . . . . . 1.40 * . . 0.30 0.93
Gln 116 A A . . . . . 0.59 * . F 0.90 1.59
Leu 117 A A . . . . . 0.70 * * F 0.90 1.59
35Arg 118 A A . . . . . 0.40 * * F 1.15 1.79
Glu 119 A A . . . . . 0.91 * * . 1.10 0.73
Leu 120 A A . . . . . 0.57 * * . 1.50 1.18
Arg 121 . A . . T . . 0.27 * * . 2.00 0.60
Ile 122 . . . . T T . 0.22 * * F 2.50 0.46
40Ser 123 . . . . T T . 0.11 * * F 1.65 0.42
Gly 124 . . . . T T . -0.70. * F 2.00 0.37
Ser 125 . . . . T T . -0.13. * F 0.85 0.43
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
Table I (continued)
Res Position II III IV V VI VII VIII IX XI XII
I X XIII
Val 126 . . B B . . . -0.91 . * . -0.35
0.50
Gln 127 . . B B . . . -0.88 . * . -0.60
0.27
5 Leu 128 . . B B . . . -0.61 . . . -0.60
0.15
Tyr 129 . . B B . . . -0.57 . . . -0.60
0.28
Cys 130 . . B B . . -0.66 . . . -0.60
0.21
Val 131 . . B B . . -0.19 . . . -0.60
0.33
His 132 . . B B . . . -0.58 . . . -0.60
0.27
10 Ser 133 . B B . . . -0.16 . . . -0.30
. 0.65
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
76
Figure 2 provides a comparison of the galectin 11 polypeptide with other
galectins.
Identical amino acids shared between the galectins are shaded, while
conservative amino acid
changes are boxed. By examining the regions of amino acids shaded and/or
boxed, the skilled
artisan can readily identify conserved domains between the two polypeptides.
The amino
acid sequences falling within these conserved, shaded and/or boxed domains are
contained in
the preferred polypeptide fragments of the invention.
Among highly preferred fragments in this regard are those that comprise
regions of
galectin 11 that combine several structural features, such as several of the
features set out
above.
Other preferred polypeptide fragments are biologically active galectin 11
fragments.
Biologically active fragments are those exhibiting activity similar, but not
necessarily identical,
to an activity of the galectin 11 polypeptide. The biological activity of the
fragments may
include an improved desired activity, or a decreased undesirable activity.
Polynucleotides
encoding these polypeptide fragments are also encompassed by the invention.
Representative examples of polypeptide residue fragments of the invention
including,
for example, fragments from about amino acid number 1-20, 1-66, 5-108, 5-128,
21-40, 40-
108, 41-60, 47-108, 47-128, 61-80, 65-108, 65-128, 81-100, 88-108, 88-128, 108-
120; 114-
128; and 101 to the end of the galectin 11 polypeptide depicted in Figure I
(SEQ ID N0:2).
In this context, "about" includes the particularly recited ranges larger or
smaller by several, 5,
4, 3, 2, or I amino acid at either end or at both extremes.
As one of skill in the art will appreciate, galectin 11 polypeptides of the
present
invention such as, for example, epitope-bearing fragments of galectin 11, can
be combined
with parts of the constant domain of immunoglobulins (IgG), resulting in
chimeric
polypeptides. Fusion proteins that have a disulfide-linked dimeric structure
due to the IgG
part can also be more efficient in binding and neutralizing other molecules
than the monomeric
galectin 11 protein or protein fragment alone (Fountoulakis et al., J.
Biochem. 270:3958-3964
( 1995)).
As one of skill in the art will appreciate, and as discussed above, the
polypeptides of
the present invention comprising an immunogenic or antigenic epitope can be
fused to other
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
77
polypeptide sequences. For example, the polypeptides of the present invention
may be
fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or
portions thereof
(CH1, CH2, CH3, or any combination thereof and portions thereof) resulting in
chimeric
polypeptides. Such fusion proteins may facilitate purification and may
increase half life in
vivo. This has been shown for chimeric proteins consisting of the first two
domains of the
human CD4-polypeptide and various domains of the constant regions of the heavy
or light
chains of mammalian immunoglobulins. See, e.g., EP 394,827; Traunecker et al.,
Nature,
331:84-86 (1988). Enhanced delivery of an antigen across the epithelial barner
to the immune
system has been demonstrated for antigens (e.g., insulin) conjugated to an
FcRn binding
partner such as IgG or Fc fragments (see, e.g., PCT Publications WO 96/22024 _
and WO
99/04813). IgG Fusion proteins that have a disulfide-linked dimerie structure
due to the IgG
portion desulfide bonds have also been found to be more efficient in binding
and neutralizing
other molecules than monomeric polypeptides or fragments thereof alone. See,
e.g.,
Fountoulakis et al., J. Biochem., 270:3958-3964 (1995). Nucleic acids encoding
the above
epitopes can also be recombined with a gene of interest as an epitope tag
(e.g., the
hemagglutinin ("HA") tag or flag tag) to aid in detection and purification of
the expressed
polypeptide. For example, a system described by Janknecht et al. allows for
the ready
purification of non-denatured fusion proteins expressed in human cell lines
(Janknecht et al.,
1991, Proe. Natl. Acad. Sei. USA 88:8972- 897). In this system, the gene of
interest is
subcloned into a vaccinia recombination plasmid such that the open reading
frame of the gene
is translationally fused to an amino-terminal tag consisting of six histidine
residues. The tag
serves as a matrix binding domain for the fusion protein. Extracts from cells
infected with the
recombinant vaccinia virus are loaded onto Ni2+ nitriloacetic acid-agarose
column and
histidine-tagged proteins can be selectively eluted with imidazole-containing
buffers.
Additional fusion proteins of the invention may be generated through the
techniques
of gene-shuffling, motif shuffling, exon-shuffling, and/or codon-shuffling
(collectively referred
to as "DNA shuffling"). DNA shuffling may be employed to modulate the
activities of
polypeptides of the invention, such methods can be used to generate
polypeptides with
altered activity, as well as agonists and antagonists of the polypeptides.
See, generally, U.S.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
78
Patent Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and
Patten et al.,
Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol.
16(2):76-82
(1998); Hansson, et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo and
Blasco,
Biotechniques 24(2):308- 13 (1998) (each of these patents and publications are
hereby
incorporated by reference in its entirety). In one embodiment, alteration of
polynucleotides
corresponding to SEQ ID NO:1 and the polypeptides encoded by these
polynucleotides may
be achieved by DNA shuffling. DNA shuffling involves the assembly of two or
more DNA
segments by homologous or site-specific recombination to generate variation in
the
polynucleotide sequence. In another embodiment, polynucleotides of the
invention, or the
1o encoded polypeptides, may be altered by being subjected to random
mutagenesis by error-
prone PCR, random nucleotide insertion or other methods prior to
recombination. In another
embodiment, one or more components, motifs, sections, parts, domains,
fragments, etc., of a
polynucleotide encoding a polypeptide of the invention may be recombined with
one or more
components, motifs, sections, parts, domains, fragments, etc. of one or more
heterologous
molecules.
Polypeptides of the invention include polypeptides encoded by polynucleotides
that
hybridize (e.g., under stringent hybridization conditions) to the
polynucleotide sequence
depicted in Figure 1 (SEQ ID NO:1), the complementary strand thereto, and/or
the nucleotide
sequence contained in the deposited clone. In specific embodiments, the
polypeptides of the
2o invention have galectin 11 functional and/or biological activity.
Assays for Galectin 11 Functional Activity
The functional and/or biological activity of galectin 11 polypeptides,
fragments,
variants, derivatives and analogs of the invention can be assayed by various
methods.
Far example, in one embodiment, where one is assaying for the ability to bind
or
compete with galectin 11 polypeptide for binding to anti-galectin 11 antibody,
various
immunoassays known in the art can be used, including, but not limited to,
competitive and
non-competitive assay systems using techniques such as radioimmunoassays,
ELISA,
"sandwich" immunoassays, immunoradiometric assays, and diffusion precipitin
reactions,
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
79
immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or
radioisotope
labels, for example), western blots, precipitation reactions, agglutination
assays (e.g., gel
agglutination assays, hemagglutination assays), complement fixation assays,
immunofluorescence assays, protein A assays, and immunoelectrophoresis assays,
etc.
Many means are known in the art for detecting binding in an immunoassay and
are within the
scope of the present invention.
In another embodiment, the ability of galectin 11 polypeptides, fragments,
variants,
derivatives and analogs of the invention to bind (3-galactoside sugars may be
determined using,
or routinely modifying, assays known in the art. For example, lactose binding
activity of the
to expressed galectin 11 polypeptides and fragments, variants, derivatives, or
analogs thereof,
may be assayed by immunodectection of in situ binding activity to asialofetuin
(Sigma)
immobilized on nitrocellulose (Amersham) (Madsen et al., J. Biol. Chem.
270(11):5823-5829
(1995)). For example, in one assay, thirty dug of asialofetuin dissolved in 3
pl of water is
spotted on a 1-cm2 strip of nitrocellulose. The nitrocellulose pieces are then
placed in a 24-
well tissue culture plant and incubated overnight in buffer B (58 mM NAzHP04,
18 mM
KHZP04, 75 mM NaCI, 2 mM EDTA, and 3% BSA, pH 7.2) with constant agitation at
22°C.
Following incubation, the blocking medium is aspirated and the nitrocellulose
pieces are
washed three times in buffer A (58 mM NazHP04 18 mM KH22P04, 75 mM NaCI, 2 mM
EDTA, 4 mM (3-mercaptoethanol and 0.2% BSA, pH 7.2). Cell extracts
(preferably, COS
cells) are prepared containing 1% BSA and either with or without 150 mM
lactose (105 pl of
primary extract, 15 pl of 10% BSA in buffer A and either 30 pl of 0.75 M
lactose in buffer A
or 30 ql of buffer A). The immobilized asialofetuin is incubated with the
extracts for 2 h and
washed 5 times in buffer A. The nitrocellulose pieces are then fixed in 2%
formalin in PBS
(58 mM Na2HP04, 18 mM KHZP04, 75 mM NaCI, 2 mM EDTA pH 7.2) for 1 h to prevent
loss of bound galectin 11. Following extensive washing in PBS the pieces are
incubated with a
rabbit anti-galectin 11. Polyclonal serum (generated using techniques known in
the art)
diluted 1:100 in PBS for 2h at 22°C. The pieces are then washed in PBS
and incubated with
peroxidase-labeled goat anti-rabbit antibodies (DAKO). Following incubation
for 2h at 22°C,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
the pieces are washed in PBS and the substrate is added. Nitrocellulose pieces
are incubated
until the color developed and the reaction is stopped by washing in distilled
water.
The ability of galectin 11 polypeptides, fragments, variants, derivatives and
analogs of
the invention to agglutinate trypsin-treated rabbit erythrocytes can routinely
be assayed using
5 techniques known in the art.
The ability of the galectin 11 polypeptides, fragments, variants, derivatives
and
analogs of the invention to induce apoptosis of T-cells may be determined
using, or routinely
modifying, techniques described herein (see e.g., Example 5) or otherwise
known in the art.
See e.g., Perillo et al., Nature 378:736-739 (1995); Chinnaiyan et al., Cell
81:505-512 (1995);
1o Boldin et al., J. Biol. Chem. 270:7795-7798 (1995); Kischkel et al., EMBO
J. 14:5579-5585
(1995); Chinnaiyan et al., J. Biol. Chem. 271:4961-4965 (1996); the contents
of each of
which is herein incorporated by reference in its entirety).
The galectin 11 polynucleotides and polypeptides, and fragments, variants
derivatives
and analogs thereof; and antibodies, agonists and antagonists thereto; can be
tested in vivo for
15 the desired therapeutic or prophylactic activity. For example, such
compounds can be tested
in suitable animal model systems prior to testing in humans. Such animal
models include, but
are not limited to, rats, mice, chickens, cows, monkeys, rabbits, etc. Such
testing may also be
utilized to routinely determine dosage for delivery to human patients. For in
vivo testing
prior to administration to human, any animal model system known in the art may
be used
20 (see, for example, Levi et al., Eur. J. Imun. 13:500-507 (1983); and Offner
et al., J.
Neuroimmunol 28:177-184 (1990)). For example, an animal model useful for the
study of the
treatment of human MS is experimental allergic encephalomyelitis (EAE). EAE is
an
experimentally induced disease that shares many of the same clinical and
pathological
symptoms of MS (Martin et al., Ann. Rev. Immunol. 10:153-187 (1992); Hafler et
al.,
25 Immunology Today 10:104-107 (1989)). Several studies in rodents have shown
that, similar
to MS, CD4+ T cells participate in the pathophysiology of EAE, Traugott et
al., Cellular
Immunology 91:240-254 (1985); Ben-Nun, Eur. J. Immunol. 11:195-199 (1981);
Pettinel et
al., J. Immunol. 127:1420-1423 (1981). EAE can be induced in certain strains
of mice by
immunization with myelin in an adjuvant. The immunization activates CD4+ T
cells specific
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
81
for myelin basic protein (MBP) and proteolipid (PLP), Bernard et al., J.
Immunol. 114:1537-
1540 (1975); Chou et al., J. Immunol. 130:2183-2186 (1983); Kurchroo et al.,
J. Immunol.
148:3776-3782 (1992). The activated T cells enter the central nervous system
and their local
action causes both the anatomic pathology and clinical signs, e.g., ascending
hind limb paresis
leading to paralysis, of the disease. As discussed above, the galectin 1 has
been demonstrated
to suppress clinical and histological signs of experimental autoimmune
encephalomyelitis in
rats (Offner et al., J. Neuroimmunol. 28:177-184 (1990)).
Another model system that may be utilized to both study the role of the
polypeptides, variants, derivatives and analogs of the invention as a
suppresser of immune
to responses, and to determine effective dosages for doing so, is experimental
autoimmune
myasthenia gravis (EAMG) in rabbits. EAMG is an autoimmune disease induced by
immunization with the purified acetylcholine receptor protein (AChR) and is
considered to be
a good model for the human disease myasthenia gravis. As further discussed
above, galectin 1
has been demonstrated to have a prophylactic and therapeutic action on
experimental
autoimmune myasthenia gravis in rabbits (Levi et al., Eur. J. Immunol. 13:500-
507 (1983)).
Other art known model assays that may be used to determine the desired
therapeutic
or prophylactic activity of compounds of the invention (e.g., as a suppresser
of immune
responses) include, but are not limited to, T-cell proliferation in mixed
lymphocyte reaction
assays (an art-accepted model for allogeneic graft rejection), and marine
allograft models
2o known in the art.
Assays described herein or otherwise known in the art may be applied to
routinely
determine which galectin 11 polypeptides, fragments, variants, derivatives and
analogs of the
invention demonstrate galectin 11 functional activity and the optimal
concentration at which
these compounds demonstrate this activity. These assays may additionally be
utilized to
identify molecules which enhance (agonists) or suppress (antagonists) galectin
11 functional
activity.
Epitopes
CA 02371611 2001-10-19
WO 00/63221 PCTlCIS00/10714
82
The present invention encompasses polypeptides comprising, or alternatively
consisting of, an epitope of the polypeptide having an amino acid sequence of
SEQ ID N0:2,
25, or 27, or an epitope of the polypeptide sequence encoded by a
polynucleotide sequence
contained in ATCC Deposit No: 209053 or encoded by a polynucleotide that
hybridizes to
the complement of the sequence of SEQ ID NO:1, 24, or 26 or contained in ATCC
Deposit
No: 209053 under stringent hybridization conditions or lower stringency
hybridization
conditions as defined supra. The present invention further encompasses
polynucleotide
sequences encoding an epitope of a polypeptide sequence of the invention (such
as, for
example, the sequence disclosed in SEQ ID NO:1, 24, or 26), polynucleotide
sequences of
to the complementary strand of a polynucleotide sequence encoding an epitope
of the
invention, and polynucleotide sequences which hybridize to the complementary
strand under
stringent hybridization conditions or lower stringency hybridization
conditions defined
supra.
The term "epitopes," as used herein, refers to portions of a polypeptide
having
antigenic or immunogenic activity in an animal, preferably a mammal, and most
preferably in
a human. In a preferred embodiment, the present invention encompasses a
polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An
"immunogenic epitope," as used herein, is defined as a portion of a protein
that elicits an
antibody response in an animal, as determined by any method known in the art,
for example,
2o by the methods for generating antibodies described infra. (See, for
example, Geysen et al.,
Proc. Natl. Acad. Sci. USA 81:3998- 4002 (1983)). The term "antigenic
epitope," as used
herein, is defined as a portion of a protein to which an antibody can
immunospecifically bind
its antigen as determined by any method well known in the art, for example, by
the
immunoassays described herein. Immunospecific binding excludes non-specific
binding but
does not necessarily exclude cross- reactivity with other antigens. Antigenic
epitopes need
not necessarily be immunogenic.
Fragments which function as epitopes may be produced by any conventional
means.
(See, e.g., Houghten, Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985), further
described in
U.S. Patent No. 4,631,211).
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
83
Antigenic epitope-bearing peptides and polypeptides of the invention are
therefore
useful, for example, to raise antibodies, including monoclonal antibodies,
that bind specifically
to a polypeptide of the invention. Preferred antigenic epitopes include the
antigenic epitopes
disclosed herein, as well as any combination of two, three, four, five or more
of these
antigenic epitopes. Antigenic epitopes can be used as the target molecules in
immunoassays.
(See, for instance, Wilson et al., Cell 37:767-778 (1984); Sutcliffe et al.,
Science 219:660-666
(1983)).
Similarly, immunogenic epitopes can be used, for example, to induce antibodies
according to methods well known in the art. (See, for instance, Sutcliffe et
al., supra; Wilson
1o et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910-914; and
Bittle et al., J. Gen.
Virol. 66:2347-2354 (1985). Preferred immunogenic epitopes include the
immunogenic
epitopes disclosed herein, as well as any combination of two, three, four,
five or more of
these immunogenic epitopes. The polypeptides comprising one or more
immunogenic
epitopes may be presented for eliciting an antibody response together with a
Garner protein,
such as an albumin, to an animal system (such as rabbit or mouse), or, if the
polypeptide is of
sufficient length (at least about 25 amino acids), the polypeptide may be
presented without a
carrier. However, immunogenic epitopes comprising as few as 8 to 10 amino
acids have been
shown to be sufficient to raise antibodies capable of binding to, at the very
least, linear
epitopes in a denatured polypeptide (e.g., in Western blotting).
2o Antigenic epitope-bearing peptides and polypeptides of the invention
preferably
contain a sequence of at least 7, 9, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100,
110 or 120
contiguous amino acid residues of the amino acid sequence depicted in Figure 1
or 6 (SEQ ID
N0:2, 25, or 27). In the present invention, antigenic epitopes preferably
contain a sequence
of at least 4, at least 5, at least 6, at least 7, more preferably at least 8,
at least 9, at least 10,
at least 11, at least 12, at least 13, at least 14, at least 15, at least 20,
at least 25, at least 30,
at least 40, at least 50, and, most preferably, between about 15 to about 30
amino acids.
Preferred polypeptides comprising immunogenic or antigenic epitopes are at
least 10, 15, 20,
25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid
residues in length.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
84
Additional non-exclusive preferred antigenic epitopes include the antigenic
epitopes disclosed
herein, as well as portions thereof.
Non-limiting examples of antigenic polypeptides or peptides that can be used
to
generate galectin 11-specific antibodies include: a polypeptide comprising
amino acid residues
from about 65-70 and 118-124 in Figure 1 (SEQ ID N0:2). As indicated above,
the inventors
have determined that the above polypeptide fragments are antigenic regions of
the galectin 11
protein.
The epitope-bearing peptides and polypeptides of the invention may be produced
by
any conventional means. See generally, Houghten, R. A., Proc. Natl. Acad. Sci.
USA
82:5131-5135 (1985). This Simultaneous Multiple Peptide Synthesis (SMPS)
process is
further described in U.S. Patent No. 4,631,211 to Houghten et al. (1986).
Epitope-bearing polypeptides of the present invention may be used to induce
antibodies according to methods well known in the art including, but not
limited to, in vivo
immunization, in vitro immunization, and phage display methods. See, e.g.,
Sutcliffe et al.,
supra; Wilson et al., supra, and Bittle et al., J. Gen. Virol., 66:2347-2354
(1985). If in vivo
immunization is used, animals may be immunized with free peptide; however,
anti-peptide
antibody titer may be boosted by coupling the peptide to a macromolecular
carrier, such as
keyhole limpet hemacyanin (KLH) or tetanus toxoid. For instance, peptides
containing
cysteine residues may be coupled to a carrier using a linker such as
maleimidobenzoyl- N-
2o hydroxysuccinimide ester (MBS), while other peptides may be coupled to
carriers using a
more general linking agent such as glutaraldehyde. Animals such as rabbits,
rats and mice are
immunized with either free or Garner- coupled peptides, for instance, by
intraperitoneal
andlor intradermal injection of emulsions containing about 100 pg of peptide
or carrier
protein and Freund's adjuvant or any other adjuvant known for stimulating an
immune
response. Several booster injections may be needed, for instance, at intervals
of about two
weeks, to provide a useful titer of anti-peptide antibody which can be
detected, for example,
by ELISA assay using free peptide adsorbed to a solid surface. The titer of
anti-peptide
antibodies in serum from an immunized animal may be increased by selection of
anti-peptide
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
antibodies, for instance, by adsorption to the peptide on a solid support and
elution of the
selected antibodies according to methods well known in the art.
Antibodies
5 Further polypeptides of the invention relate to antibodies and T-cell
antigen receptors
(TCR) which immunospecifically bind a polypeptide, polypeptide fragment, or
variant of
SEQ ID N0:2, and/or an epitope, of the present invention (as determined by
immunoassays
well known in the art for assaying specific antibody-antigen binding).
Antibodies of the
invention include, but are not limited to, polyclonal, monoclonal,
multispecific, human,
1o humanized or chimeric antibodies, single chain antibodies, Fab fragments,
F(ab') fragments,
fragments produced by a Fab expression library, anti-idiotypic (anti-Id)
antibodies
(including, e.g., anti-Id antibodies to antibodies of the invention), and
epitope-binding
fragments of any of the above. The term "antibody," as used herein, refers to
immunoglobulin
molecules and immunologically active portions of immunoglobulin molecules,
i.e., molecules
15 that contain an antigen binding site that immunospecifically binds an
antigen. The
immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE,
IgM, IgD, IgA
and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass of
immunoglobulin
molecule.
Most preferably the antibodies are human antigen-binding antibody fragments of
the
2o present invention and include, but are not limited to, Fab, Fab' and
F(ab')2, Fd, single-chain
Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments
comprising
either a VL or VH domain. Antigen-binding antibody fragments, including single-
chain
antibodies, may comprise the variable regions) alone or in combination with
the entirety or a
portion of the following: hinge region, CH1, CH2, and CH3 domains. Also
included in the
25 invention are antigen-binding fragments also comprising any combination of
variable regions)
with a hinge region, CH1, CH2, and CH3 domains. The antibodies of the
invention may be
from any animal origin including birds and mammals. Preferably, the antibodies
are human,
murine (e.g., mouse and rat), donkey, ship rabbit, goat, guinea pig, camel,
horse, or chicken.
As used herein, "human" antibodies include antibodies having the amino acid
sequence of a
30 human immunoglobulin and include antibodies isolated from human
immunoglobulin libraries
CA 02371611 2001-10-19
WO 00/63221 PCT/1JS00/10714
86
or from animals transgenic for one or more human immunoglobulin and that do
not express
endogenous immunoglobulins, as described infra and, for example in, U.S.
Patent No.
5,939,598 by Kucherlapati et al.
The antibodies of the present invention may be monospecific, bispecific,
trispecific or
of greater multispecificity. Multispecific antibodies may be specific for
different epitopes of
a polypeptide of the present invention or may be specific for both a
polypeptide of the
present invention as well as for a heterologous epitope, such as a
heterologous polypeptide
or solid support material. See, e.g., PCT publications WO 93/17715; WO
92/08802; WO
91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Patent
Nos.
4,474,893; 4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J.
Immunol.
148:1547-1553 (1992).
Antibodies of the present invention may be described or specified in terms of
the
epitope(s) or portions) of a polypeptide of the present invention which they
recognize or
specifically bind. The epitope(s) or polypeptide portions) may be specified as
described
herein, e.g., by N-terminal and C-terminal positions, by size in contiguous
amino acid
residues, or listed in the Tables and Figures. Preferred epitopes of the
invention include:
amino acids 65-70 and 118-124 of SEQ ID N0:2, as well as polynucleotides that
encode
these epitopes. Antibodies which specifically bind any epitope or polypeptide
of the
present invention may also be excluded. Therefore, the present invention
includes antibodies
2o that specifically bind polypeptides of the present invention, and allows
for the exclusion of
the same.
Antibodies of the present invention may also be described or specified in
terms of
their cross-reactivity. Antibodies that do not bind any other analog,
ortholog, or homolog of a
polypeptide of the present invention are included. Antibodies that bind
polypeptides with at
least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least
70%, at least 65%,
at least 60%, at least 55%, and at least 50% identity (as calculated using
methods known in
the art and described herein) to a polypeptide of the present invention are
also included in the
present invention. In specific embodiments, antibodies of the present
invention cross-react
with murine, rat and/or rabbit homologs of human proteins and the
corresponding epitopes
CA 02371611 2001-10-19
WO 00/63221 PCT/L1S00/10714
87
thereof. Antibodies that do not bind polypeptides with less than 95%, less
than 90%, less
than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less
than 60%, less
than 55%, and less than 50% identity (as calculated using methods known in the
art and
described herein) to a polypeptide of the present invention are also included
in the present
invention. In a specific embodiment, the above-described cross-reactivity is
with respect to
any single specific antigenic or immunogenic polypeptide, or combinations) of
2, 3, 4, 5, or
more of the specific antigenic and/or immunogenic polypeptides disclosed
herein. Further
included in the present invention are antibodies which bind polypeptides
encoded by
polynucleotides which hybridize to a polynucleotide of the present invention
under stringent
1o hybridization conditions (as described herein). Antibodies of the present
invention may also
be described or specified in terms of their binding affinity to a polypeptide
of the invention.
Preferred binding affinities include those with a dissociation constant or Kd
less than 5 X 10-2
M, 10-z M, 5 X 10'3 M, 10-3 M, 5 X 10-4 M, 10-4 M, 5 X 10-5 M, 10-5 M, 5 X 10-
6 M, 10-
6M, 5 X 10-~ M, 10' M, 5 X 10-g M, 10-$ M, 5 X 10-9 M, 10-9 M, 5 X 10-'
° M, 10-' ° M, 5 X
10-" M, 10-" M, 5 X 10-' Z M, ' °-' z M, 5 X 10-' 3 M, 10-' 3 M, 5 X 10-
' 4 M, 10-' 4 M, 5 X 10-
's M, or 10-' S M.
The invention also provides antibodies that competitively inhibit binding of
an
antibody to an epitope of the invention as determined by any method known in
the art for
determining competitive binding, for example, the immunoassays described
herein. In
2o preferred embodiments, the antibody competitively inhibits binding to the
epitope by at least
95%, at least 90%, at least 85 %, at least 80%, at least 75%, at least 70%, at
least 60%, or at
least 50%.
Antibodies of the present invention may act as agonists or antagonists of the
polypeptides of the present invention. For example, the present invention
includes
antibodies which disrupt the receptor/ligand interactions with the
polypeptides of the
invention either partially or fully. Preferrably, antibodies of the present
invention bind an
antigenic epitope disclosed herein, or a portion thereof. The invention
features both receptor-
specific antibodies and ligand-specific antibodies. The invention also
features receptor-
specific antibodies which do not prevent ligand binding but prevent receptor
activation.
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
88
Receptor activation (i.e., signaling) may be determined by techniques
described herein or
otherwise known in the art. For example, receptor activation can be determined
by detecting
the phosphorylation (e.g., tyrosine or serine/threonine) of the receptor or
its substrate by
immunoprecipitation followed by western blot analysis (for example, as
described supra). In
specific embodiments, antibodies are provided that inhibit ligand activity or
receptor activity
by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at
least 70%, at least
60%, or at least 50% of the activity in absence of the antibody.
The invention also features receptor-specific antibodies which both prevent
ligand
binding and receptor activation as well as antibodies that recognize the
receptor-ligand
to complex, and, preferably, do not specifically recognize the unbound
receptor or the unbound
ligand. Likewise, included in the invention are neutralizing antibodies which
bind the ligand
and prevent binding of the ligand to the receptor, as well as antibodies which
bind the ligand,
thereby preventing receptor activation, but do not prevent the ligand from
binding the
receptor. Further included in the invention are antibodies which activate the
receptor. These
antibodies may act as receptor agonists, i.e., potentiate or activate either
all or a subset of the
biological activities of the ligand-mediated receptor activation, for example,
by inducing
dimerization of the receptor. The antibodies may be specified as agonists,
antagonists or
inverse agonists for biological activities comprising the specific biological
activities of the
peptides of the invention disclosed herein. The above antibody agonists can be
made using
methods known in the art. See, e.g., PCT publication WO 96/40281; U.S. Patent
No.
5,811,097; Deng et al., Blood 92(6):1981-1988 (1998); Chen et al., Cancer Res.
58(16):3668-
3678 (1998); Harrop et al., J. Immunol. 161(4):1786-1794 (1998); Zhu et al.,
Cancer Res.
58(15):3209-3214 (1998); Yoon et al., J. Immunol. 160(7):3170-3179 (1998);
Prat et al., J.
Cell. Sci. 111(Pt2):237-247 (1998); Pitard et al., J. Immunol. Methods
205(2):177-190
(1997); Liautard et al., Cytokine 9(4):233-241 (1997); Carlson et al., J.
Biol. Chem.
272(17):11295-11301 (1997); Taryman et al., Neuron 14(4):755-762 (1995);
Muller et al.,
Structure 6(9):1153-1167 (1998); Bartunek et al., Cytokine 8(1):14-20 (1996)
(which are all
incorporated by reference herein in their entireties).
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
89
Antibodies of the present invention may be used, for example, but not limited
to, to
purify, detect, and target the polypeptides of the present invention,
including both in vitro
and in vivo diagnostic and therapeutic methods. For example, the antibodies
have use in
immunoassays for qualitatively and quantitatively measuring levels of the
polypeptides of
the present invention in biological samples. See, e.g., Harlow et al.,
Antibodies: A Laboratory
Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by
reference
herein in its entirety).
As discussed in more detail below, the antibodies of the present invention may
be
used either alone or in combination with other compositions. The antibodies
may further be
to recombinantly fused to a heterologous polypeptide at the N- or C-terminus
or chemically
conjugated (including covalently and non-covalently conjugations) to
polypeptides or other
compositions. For example, antibodies of the present invention may be
recombinantly fused
or conjugated to molecules useful as labels in detection assays and effector
molecules such as
heterologous polypeptides, drugs, radionuclides, or toxins. See, e.g., PCT
publications WO
92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP 396,387.
The antibodies of the invention include derivatives that are modified, i.e, by
the
covalent attachment of any type of molecule to the antibody such that covalent
attachment
does not prevent the antibody from generating an anti-idiotypic response. For
example, but
not by way of limitation, the antibody derivatives include antibodies that
have been modified,
2o e.g., by glycosylation, acetylation, pegylation, phosphylation, amidation,
derivatization by
known protecting/blocking groups, proteolytic cleavage, linkage to a cellular
ligand or other
protein, etc. Any of numerous chemical modifications may be carried out by
known
techniques, including, but not limited to specific chemical cleavage,
acetylation, formylation,
metabolic synthesis of tunicamycin, etc. Additionally, the derivative may
contain one or
more non-classical amino acids.
The antibodies of the present invention may be generated by any suitable
method
known in the art. Polyclonal antibodies to an antigen-of interest can be
produced by various
procedures well known in the art. For example, a polypeptide of the invention
can be
administered to various host animals including, but not limited to, rabbits,
mice, rats, etc. to
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
induce the production of sera containing polyclonal antibodies specific for
the antigen.
Various adjuvants may be used to increase the immunological response,
depending on the host
species, and include but are not limited to, Freund's (complete and
incomplete), mineral gels
such as aluminum hydroxide, surface active substances such as lysolecithin,
pluronic polyols,
5 polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and
potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and
corynebacterium parvum. Such adjuvants are also well known in the art.
Monoclonal antibodies can be prepared using a wide variety of techniques known
in
the art including the use of hybridoma, recombinant, and phage display
technologies, or a
1o combination thereof. For example, monoclonal antibodies can be produced
using hybridoma
techniques including those known in the art and taught, for example, in Harlow
et al.,
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed.
1988);
Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681
(Elsevier,
N.Y., 1981) (said references incorporated by reference in their entireties).
The term
15 "monoclonal antibody" as used herein is not limited to antibodies produced
through
hybridoma technology. The term "monoclonal antibody" refers to an antibody
that is
derived from a single clone, including any eukaryotic, prokaryotic, or phage
clone, and not the
method by which it is produced.
Methods for producing and screening for specific antibodies using hybridoma
2o technology are routine and well known in the art and are discussed in
detail in the Examples.
In a non-limiting example, mice can be immunized with a polypeptide of the
invention or a
cell expressing such peptide. Once an immune response is detected, e.g.,
antibodies specific
for the antigen are detected in the mouse serum, the mouse spleen is harvested
and
splenocytes isolated. The splenocytes are then fused by well known techniques
to any
25 suitable myeloma cells, for example cells from cell line SP20 available
from the ATCC.
Hybridomas are selected and cloned by limited dilution. The hybridoma clones
are then
assayed by methods known in the art for cells that secrete antibodies capable
of binding a
polypeptide of the invention. Ascites fluid, which generally contains high
levels of
antibodies, can be generated by immunizing mice with positive hybridoma
clones.
CA 02371611 2001-10-19
WO 00/63221 PCTIUS00/10714
91
Accordingly, the present invention provides methods of generating monoclonal
antibodies as well as antibodies produced by the method comprising culturing a
hybridoma
cell secreting an antibody of the invention wherein, preferably, the hybridoma
is generated by
fusing splenocytes isolated from a mouse immunized with an antigen of the
invention with
myeloma cells and then screening the hybridomas resulting from the fusion for
hybridoma
clones that secrete an antibody able to bind a polypeptide of the invention.
Antibody fragments which recognize specific epitopes may be generated by known
techniques. For example, Fab and F(ab')2 fragments of the invention may be
produced by
proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain
(to produce
to Fab fragments) or pepsin (to produce F(ab')2 fragments). F(ab')2 fragments
contain the
variable region, the light chain constant region and the CH 1 domain of the
heavy chain.
For example, the antibodies of the present invention can also be generated
using
various phage display methods known in the art. In phage display methods,
functional
antibody domains are displayed on the surface of phage particles which carry
the
polynucleotide sequences encoding them. In a particular embodiment, such phage
can be
utilized to display antigen binding domains expressed from a repertoire or
combinatorial
antibody library (e.g., human or murine). Phage expressing an antigen binding
domain that
binds the antigen of interest can be selected or identified with antigen,
e.g., using labeled
antigen or antigen bound or captured to a solid surface or bead. Phage used in
these methods
are typically filamentous phage including fd and M 13 binding domains
expressed from phage
with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused
to either the
phage gene III or gene VIII protein. Examples of phage display methods that
can be used to
make the antibodies of the present invention include those disclosed in
Brinkman et al., J.
Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-
186
(1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et
al., Gene 187 9-18
(1997); Burton et al., Advances in Immunology 57:191-280 (1994); PCT
application No.
PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO
92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Patent Nos.
5,698,426;
5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698;
5,427,908;
CA 02371611 2001-10-19
WO 00163221 PCT/US00l10714
92
5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is
incorporated
herein by reference in its entirety.
As described in the above references, after phage selection, the antibody
coding
regions from the phage can be isolated and used to generate whole antibodies,
including human
antibodies, or any other desired antigen binding fragment, and expressed in
any desired host,
including mammalian cells, insect cells, plant cells, yeast, and bacteria,
e.g., as described in
detail below. For example, techniques to recombinantly produce Fab, Fab' and
F(ab')2
fragments can also be employed using methods known in the art such as those
disclosed in
PCT publication WO 92/22324; Mullinax et al., BioTechniques 12(6):864-869
(1992); and
1o Sawai et al., AJRI 34:26-34 (1995); and Better et al., Science 240:1041-
1043 (1988) (said
references incorporated by reference in their entireties).
Examples of techniques which can be used to produce single-chain Fvs and
antibodies
include those described in U.S. Patents 4,946,778 and 5,258,498; Huston et
al., Methods in
Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993); and Skerra
et al.,
Science 240:1038-1040 (1988). For some uses, including in vivo use of
antibodies in humans
and in vitro detection assays, it may be preferable to use chimeric,
humanized, or human
antibodies. A chimeric antibody is a molecule in which different portions of
the antibody are
derived from different animal species, such as antibodies having a variable
region derived from
a marine monoclonal antibody and a human immunoglobulin constant region.
Methods for
2o producing chimeric antibodies are known in the art. See e.g., Morrison,
Science 229:1202
(1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J.
Immunol. Methods
125:191-202; U.S. Patent Nos. 5,807,715; 4,816,567; and 4,816397, which are
incorporated
herein by reference in their entirety. Humanized antibodies are antibody
molecules from
non-human species antibody that binds the desired antigen having one or more
complementarity determining regions (CDRs) from the non-human species and a
framework
regions from a human immunoglobulin molecule. Often, framework residues in the
human
framework regions will be substituted with the corresponding residue from the
CDR donor
antibody to alter, preferably improve, antigen binding. These framework
substitutions are
identified by methods well known in the art, e.g., by modeling of the
interactions of the CDR
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
93
and framework residues to identify framework residues important for antigen
binding and
sequence comparison to identify unusual framework residues at particular
positions. (See,
e.g., Queen et al., U.S. Patent No. 5,585,089; Riechmann et al., Nature
332:323 (1988), which
are incorporated herein by reference in their entireties.) Antibodies can be
humanized using a
variety of techniques known in the art including, for example, CDR-grafting
(EP 239,400;
PCT publication WO 91/09967; U.S. Patent Nos. 5,225,539; 5,530,101; and
5,585,089),
veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology
28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814
(1994); Roguska.
et al., PNAS 91:969-973 (1994)), and chain shuffling (U.S. Patent No.
5,565,332).
l0 Completely human antibodies are particularly desirable for therapeutic
treatment of
human patients. Human antibodies can be made by a variety of methods known in
the art
including phage display methods described above using antibody libraries
derived from human
immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and 4,716,111;
and PCT
publications WO 98/46645, WO 98/50433, WO 98124893, WO 98/16654, WO 96/34096,
WO 96/33735, and WO 91/10741; each of which is incorporated herein by
reference in its
entirety.
Human antibodies can also be produced using transgenic mice which are
incapable of
expressing functional endogenous immunoglobulins, but which can express human
immunoglobulin genes. For example, the human heavy and light chain
immunoglobulin gene
2o complexes may be introduced randomly or by homologous recombination into
mouse
embryonic stem cells. Alternatively, the human variable region, constant
region, and
diversity region may be introduced into mouse embryonic stem cells in addition
to the human
heavy and light chain genes. The mouse heavy and light chain immunoglobulin
genes may be
rendered non-functional separately or simultaneously with the introduction of
human
immunoglobulin loci by homologous recombination. In particular, homozygous
deletion of
the JH region prevents endogenous antibody production. The modified embryonic
stem cells
are expanded and microinjected into blastocysts to produce chimeric mice. The
chimeric mice
are then bred to produce homozygous offspring which express human antibodies.
The
transgenic mice are immunized in the normal fashion with a selected antigen,
e.g., all or a
CA 02371611 2001-10-19
WO 00/63221 PCTNS00/10714
94
portion of a polypeptide of the invention. Monoclonal antibodies directed
against the
antigen can be obtained from the immunized, transgenic mice using conventional
hybridoma
technology. The human immunoglobulin transgenes harbored by the transgenic
mice rearrange
during B cell differentiation, and subsequently undergo class switching and
somatic mutation.
Thus, using such a technique, it is possible to produce therapeutically useful
IgG, IgA, IgM
and IgE antibodies. For an overview of this technology for producing human
antibodies, see
Lonberg and Huszar, Int. Rev. Immunol. 13:65-93 (1995). For a detailed
discussion of this
technology for producing human antibodies and human monoclonal antibodies and
protocols
for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO
92/01047; WO
l0 96/34096; WO 96133735; European Patent No. 0 598 877; U.S. Patent Nos.
5,413,923;
5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793;
5,916,771;
and 5,939,598, which are incorporated by reference herein in their entirety.
In addition,
companies such as Abgenix, Inc. (Freemont, CA) and Genpharm (San Jose, CA) can
be
engaged to provide human antibodies directed against a selected antigen using
technology
similar to that described above.
Completely human antibodies which recognize a selected epitope can be
generated
using a technique referred to as "guided selection." In this approach a
selected non-human
monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of
a completely
human antibody recognizing the same epitope. (Jespers et al., Biotechnology
12:899-903
(1988)).
Further, antibodies to the polypeptides of the invention can, in turn, be
utilized to
generate anti-idiotype antibodies that "mimic" polypeptides of the invention
using techniques
well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J.
7(5):437-444;
(1989) and Nissinoff, J. Immunol. 147(8):2429-2438 (1991)). For example,
antibodies which
bind to and competitively inhibit polypeptide multimerization and/or binding
of a
polypeptide of the invention to a ligand can be used to generate anti-
idiotypes that "mimic"
the polypeptide multimerization and/or binding domain and, as a consequence,
bind to and
neutralize polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab fragments of
such anti-idiotypes can be used in therapeutic regimens to neutralize
polypeptide ligand. For
CA 02371611 2001-10-19
WO 00163221 PCT/1JS00/10714
example, such anti-idiotypic antibodies can be used to bind a polypeptide of
the invention
and/or to bind its ligands/receptors, and thereby block its biological
activity.
The polypeptides of the invention and their fragments, variants, derivatives
or
analogs, or cells expressing them, can also be used as immunogens to produce
antibodies
5 immunospecific for galectin 11 polypeptide of the invention. The term
"immunospecific"
means that the antibodies have substantially greater affinity for the
polypeptides of the
invention than their affinity for other related polypeptides in the prior art.
The term "antibody" (Ab) or "monoclonal antibody" (mAb) as used herein is
meant to
include intact molecules as well as fragments thereof (such as, for example,
Fab, and F(ab')Z
to fragments) which are capable ofbinding an antigen. Fab, Fab', and F (ab')Z
fragments lack the
Fc fragment of intact antibody, clear more rapidly from the circulation, and
may have less
non-specific tissue binding of an intact antibody (Wahl et al., J. Nucl. Med.
24:316-325
(1983)).
Antibodies according to the present invention may be prepared by any of a
variety of
15 standard methods using galectin 11 immunogens of the present invention. For
example,
antibodies generated against full-length galectin 11 polypeptides can be
obtained by
administering the polypeptides or epitope-bearing fragments, variants,
derivatives, analogs, or
cells, to an animal, preferably a nonhuman, using routine protocols. For
preparation of
monoclonal antibodies, any technique which provides antibodies produced by
continuous cell
20 line cultures can be used. Examples include the hybridoma technique (Kohler
et al., Nature
256:495-497 (1975)), the trioma technique, the human B-cell hybridoma
technique (Kozbor et
al., Immunology Today 4:72 (1983)) and the EBV-hybridoma technique (Cole et
al.,
MONOCLONAL ANTIBODIES AND CANCER THERAPY, pp. 77-96, Alan R. Liss,
Inc., 1985). Additionally, techniques for the production of single chain
antibodies (U.S.
25 Patent No. 4,946,778) can also be adapted to produce single chain
antibodies to
polypeptides of the invention. Also, transgenic mice, or other organisms
including other
mammals, may be used to express humanized antibodies.
Antibodies of the invention can be used in methods known in the art relating
to the
localization and activity of the polypeptide sequences of the invention, e.g.,
for imaging these
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
96
polypeptides, measuring levels thereof in appropriate physiological samples,
etc. The
antibodies also have use in immunoassays and in therapeutics as agonists and
antagonists of
galectin 11. Additionally, the antibodies of the invention may be employed to
isolate or to
identify clones expressing the polypeptide or to purify the polypeptides by
affinity
chromatography.
Polynucleotides Encoding Antibodies
The invention further provides polynucleotides comprising a nucleotide
sequence
encoding an antibody of the invention and fragments thereof. The invention
also
to . encompasses polynucleotides that hybridize under stringent or lower
stringency
hybridization conditions, e.g., as defined supra, to polynucleotides that
encode an antibody,
preferably, that specifically binds to a polypeptide of the invention,
preferably, an antibody
that binds to a polypeptide having the amino acid sequence of SEQ ID N0:2.
The polynucleotides may be obtained, and the nucleotide sequence of the
polynucleotides determined, by any method known in the art. For example, if
the nucleotide
sequence of the antibody is known, a polynucleotide encoding the antibody may
be
assembled from chemically synthesized oligonucleotides (e.g., as described in
Kutmeier et al.,
BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of
overlapping
oligonucleotides containing portions of the sequence encoding the antibody,
annealing and
ligating of those oligonucleotides, and then amplification of the ligated
oligonucleotides by
PCR.
Alternatively, a polynucleotide encoding an antibody may be generated from
nucleic
acid from a suitable source. If a clone containing a nucleic acid encoding a
particular antibody
is not available, but the sequence of the antibody molecule is known, a
nucleic acid encoding
the immunoglobulin may be chemically synthesized or obtained from a suitable
source (e.g.,
an antibody cDNA library, or a cDNA library generated from, or nucleic acid,
preferably poly
A+ RNA, isolated from, any tissue or cells expressing the antibody, such as
hybridoma cells
selected to express an antibody of the invention) by PCR amplification using
synthetic
primers hybridizable to the 3' and 5' ends of the sequence or by cloning using
an
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
97
oligonucleotide probe specific for the particular gene sequence to identify,
e.g., a cDNA clone
from a cDNA library that encodes the antibody. Amplified nucleic acids
generated by PCR
may then be cloned into replicable cloning vectors using any method well known
in the art.
Once the nucleotide sequence and corresponding amino acid sequence of the
antibody
is determined, the nucleotide sequence of the antibody may be manipulated
using methods
well known in the art for the manipulation of nucleotide sequences, e.g.,
recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example, the
techniques described in
Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold
Spring Harbor
Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds., 1998, Current
Protocols in
1o Molecular Biology, John Wiley & Sons, NY, which are both incorporated by
reference herein
in their entireties), to generate antibodies having a different amino acid
sequence, for example
to create amino acid substitutions, deletions, and/or insertions.
In a specific embodiment, the amino acid sequence of the heavy and/or light
chain
variable domains may be inspected to identify the sequences of the
complementarity
determining regions (CDRs) by methods that are well know in the art, e.g., by
comparison to
known amino acid sequences of other heavy and light chain variable regions to
determine the
regions of sequence hypervariability. Using routine recombinant DNA
techniques, one or
more of the CDRs may be inserted within framework regions, e.g., into human
framework
regions to humanize a non-human antibody, as described supra. The framework
regions may
2o be naturally occurring or consensus framework regions, and preferably human
framework
regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479 (1998) for a
listing of human
framework regions). Preferably, the polynucleotide generated by the
combination of the
framework regions and CDRs encodes an antibody that specifically binds a
polypeptide of
the invention. Preferably, as discussed supra, one or more amino acid
substitutions may be
made within the framework regions, and, preferably, the amino acid
substitutions improve
binding of the antibody to its antigen. Additionally, such methods may be used
to make
amino acid substitutions or deletions of one or more variable region cysteine
residues
participating in an intrachain disulfide bond to generate antibody molecules
lacking one or
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
98
more intrachain disulfide bonds. Other alterations to the polynucleotide are
encompassed by
the present invention and within the skill of the art.
In addition, techniques developed for the production of "chimeric antibodies"
(Morrison et al., Proc. Natl. Acad. Sci. 81:851-855 (1984); Neuberger et al.,
Nature 312:604
608 (1984); Takeda et al., Nature 314:452-454 (1985)) by splicing genes from a
mouse
antibody molecule of appropriate antigen specificity together with genes from
a human
antibody molecule of appropriate biological activity can be used. As described
supra, a
chimeric antibody is a molecule in which different portions are derived from
different animal
species, such as those having a variable region derived from a marine mAb and
a human
1o immunoglobulin constant region, e.g., humanized antibodies.
Alternatively, techniques described for the production of single chain
antibodies (U.S.
Patent No. 4,946,778; Bird, Science 242:423- 42 ( 1988); Huston et al., Proc.
Natl. Acad. Sci.
USA 85:5879-5883 (1988); and Ward et al., Nature 334:544-54 (1989)) can be
adapted to
produce single chain antibodies. Single chain antibodies are formed by linking
the heavy and
light chain fragments of the Fv region via an amino acid bridge, resulting in
a single chain
polypeptide. Techniques for the assembly of functional Fv fragments in E. coli
may also be
used (Skerra et al., Science 242:1038- 1041 (1988)).
Methods of Producing Antibodies
2o The antibodies of the invention can be produced by any method known in the
art for
the synthesis of antibodies, in particular, by chemical synthesis or
preferably, by
recombinant expression techniques.
Recombinant expression of an antibody of the invention, or fragment,
derivative or
analog thereof, (e.g., a heavy or light chain of an antibody of the invention
or a single chain
antibody of the invention), requires construction of an expression vector
containing a
polynucleotide that encodes the antibody. Once a polynucleotide encoding an
antibody
molecule or a heavy or light chain of an antibody, or portion thereof
(preferably containing
the heavy or light chain variable domain), of the invention has been obtained,
the vector for
the production of the antibody molecule may be produced by recombinant DNA
technology
CA 02371611 2001-10-19
WO 00!63221 PCT/USOO110714
99
using techniques well known in the art. Thus, methods for preparing a protein
by expressing
a polynucleotide containing an antibody encoding nucleotide sequence are
described herein.
Methods which are well known to those skilled in the art can be used to
construct expression
vectors containing antibody coding sequences and appropriate transcriptional
and
translational control signals. These methods include, for example, in vitro
recombinant DNA
techniques, synthetic techniques, and in vivo genetic recombination. The
invention, thus,
provides replicable vectors comprising a nucleotide sequence encoding an
antibody molecule
of the invention, or a heavy or light chain thereof, or a heavy or light chain
variable domain,
operably linked to a promoter. Such vectors may include the nucleotide
sequence encoding
to the constant region of the antibody molecule (see, e.g., PCT Publication WO
86/05807; PCT
Publication WO 89/01036; and U.S. Patent No. 5,122,464) and the variable
domain of the
antibody may be cloned into such a vector for expression of the entire heavy
or light chain.
The expression vector is transferred to a host cell by conventional techniques
and the
transfected cells are then cultured by conventional techniques to produce an
antibody of the
invention. Thus, the invention includes host cells containing a polynucleotide
encoding an
antibody of the invention, or a heavy or light chain thereof, or a single
chain antibody of the
invention, operably linked to a heterologous promoter. In preferred
embodiments for the
expression of double-chained antibodies, vectors encoding both the heavy and
light chains
may be co-expressed in the host cell for expression of the entire
immunoglobulin molecule, as
2o detailed below.
A variety of host-expression vector systems may be utilized to express the
antibody
molecules of the invention. Such host-expression systems represent vehicles by
which the
coding sequences of interest may be produced and subsequently purified, but
also represent
cells which may, when transformed or transfected with the appropriate
nucleotide coding
sequences, express an antibody molecule of the invention in situ. These
include but are not
limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis)
transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors
containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia)
transformed with
recombinant yeast expression vectors containing antibody coding sequences;
insect cell
CA 02371611 2001-10-19
WO 00/63221 PCT/USOO110714
100
systems infected with recombinant virus expression vectors (e.g., baculovirus)
containing
antibody coding sequences; plant cell systems infected with recombinant virus
expression
vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed
with recombinant plasmid expression vectors (e.g., Ti plasmid) containing
antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells)
harboring
recombinant expression constructs containing promoters derived from the genome
of
mammalian cells (e.g., metallothionein promoter) or from mammalian viruses
(e.g., the
adenovirus late promoter; the vaccinia virus 7.SK promoter). Preferably,
bacterial cells such
as Escherichia coli, and more preferably, eukaryotic cells, especially for the
expression of
whole recombinant antibody molecule, are used for the expression of a
recombinant antibody
molecule. For example, mammalian cells such as Chinese hamster ovary cells
(CHO), in
conjunction with a vector such as the major intermediate early gene promoter
element from
human cytomegalovirus is an effective expression system for antibodies
(Foecking et al., Gene
45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).
In bacterial systems, a number of expression vectors may be advantageously
selected
depending upon the use intended for the antibody molecule being expressed. For
example,
when a large quantity of such a protein is to be produced, for the generation
of pharmaceutical
compositions of an antibody molecule, vectors which direct the expression of
high levels of
fusion protein products that are readily purified may be desirable. Such
vectors include, but
are not limited, to the E. coli expression vector pUR278 (Ruther et al., EMBO
J. 2:1791
(1983)), in which the antibody coding sequence may be ligated individually
into the vector in
frame with the lac Z coding region so that a fusion protein is produced; pIN
vectors (Inouye
& Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster, J.
Biol. Chem.
24:5503-5509 (1989)); and the like. pGEX vectors may also be used to express
foreign
polypeptides as fusion proteins with glutathione S-transferase (GST). In
general, such fusion
proteins are soluble and can easily be purified from lysed cells by adsorption
and binding to
matrix glutathione-agarose beads followed by elution in the presence of free
glutathione. The
pGEX vectors are designed to include thrombin or factor Xa protease cleavage
sites so that
the cloned target gene product can be released from the GST moiety.
CA 02371611 2001-10-19
WO 00/63221 PCT/LTS00/10714
101
In an insect system, Autographs californica nuclear polyhedrosis virus (AcNPV)
is
used as a vector to express foreign genes. The virus grows in Spodoptera
frugiperda cells.
The antibody coding sequence may be cloned individually into non-essential
regions (for
example the polyhedrin gene) of the virus and placed under control of an AcNPV
promoter
(for example the polyhedrin promoter).
In mammalian host cells, a number of viral-based expression systems may be
utilized.
In cases where an adenovirus is used as an expression vector, the antibody
coding sequence
of interest may be ligated to an adenovirus transcription/translation control
complex, e.g., the
late promoter and tripartite leader sequence. This chimeric gene may then be
inserted in the
l0 adenovirus genome by in vitro or in vivo recombination. Insertion in a non-
essential region of
the viral genome (e.g., region E1 or E3) will result in a recombinant virus
that is viable and
capable of expressing the antibody molecule in infected hosts. (e.g., see
Logan & Shenk,
Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Specific initiation signals may
also be
required for efficient translation of inserted antibody coding sequences.
These signals include
the ATG initiation codon and adjacent sequences. Furthermore, the initiation
codon must be
in phase with the reading frame of the desired coding sequence to ensure
translation of the
entire insert. These exogenous translational control signals and initiation
codons can be of a
variety of origins, both natural and synthetic. The efficiency of expression
may be enhanced
by the inclusion of appropriate transcription enhancer elements, transcription
terminators,
etc. (see Bittner et al., Methods in Enzymol. 153:51-544 (1987)).
In addition, a host cell strain may be chosen which modulates the expression
of the
inserted sequences, or modifies and processes the gene product in the specific
fashion
desired. Such modifications (e.g., glycosylation) and processing (e.g.,
cleavage) of protein
products may be important for the function of the protein. Different host
cells have
characteristic and specific mechanisms for the post-translational processing
and modification
of proteins and gene products. Appropriate cell lines or host systems can be
chosen to
ensure the correct modification and processing of the foreign protein
expressed. To this end,
eukaryotic host cells which possess the cellular machinery for proper
processing of the
primary transcript, glycosylation, and phosphorylation of the gene product may
be used.
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
102
Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela,
COS,
MDCK, 293, 3T3, WI38, and in particular, breast cancer cell lines such as, for
example,
BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such
as, for
example, CRL7030 and Hs578Bst.
For long-term, high-yield production of recombinant proteins, stable
expression is
preferred. For example, cell lines which stably express the antibody molecule
may be
engineered. Rather than using expression vectors which contain viral origins
of replication,
host cells can be transformed with DNA controlled by appropriate expression
control
elements (e.g., promoter, enhancer, sequences, transcription terminators,
polyadenylation
sites, etc.), and a selectable marker. Following the introduction of the
foreign DNA,
engineered cells may be allowed to grow for 1-2 days in an enriched media, and
then are
switched to a selective media. The selectable marker in the recombinant
plasmid confers
resistance to the selection and allows cells to stably integrate the plasmid
into their
chromosomes and grow to form foci which in turn can be cloned and expanded
into cell lines.
This method may advantageously be used to engineer cell lines which express
the antibody
molecule. Such engineered cell lines may be particularly useful in screening
and evaluation of
compounds that interact directly or indirectly with the antibody molecule.
A number of selection systems may be used, including but not limited to the
herpes
simplex virus thymidine kinase (Wigler et al., Cell 11:223 (1977)),
hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA
48:202
(1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22:817
(1980)) genes can
be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite
resistance can be
used as the basis of selection for the following genes: dhfr, which confers
resistance to
methotrexate (Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et
al., Proc. Natl.
Acad. Sci. USA 78:1527 (1981)); gpt, which confers resistance to mycophenolic
acid
(Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); neo, which
confers resistance
to the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu,
Biotherapy 3:87-
95 (1991); Tolstoshev, Arm. Rev. Pharmacol. Toxicol. 32:573-596 (1993);
Mulligan, Science
260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217
(1993);
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
103
May, 1993, TIB TECH 11(5):155-215); and hygro, which confers resistance to
hygromycin
(Santerre et al., Gene 30:147 (1984)). Methods commonly known in the art of
recombinant
DNA technology may be routinely applied to select the desired recombinant
clone, and such
methods are described, for example, in Ausubel et al. (eds.), Current
Protocols in Molecular
Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression,
A
Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13,
Dracopoli et al.
(eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994);
Colberre-
Garapin et al., J. Mol. Biol. 150:1 (1981), which are incorporated by
reference herein in their
entireties.
l0 The expression levels of an antibody molecule can be increased by vector
amplification (for a review, see Bebbington and Hentschel, The use of vectors
based on gene
amplification for the expression of cloned genes in mammalian cells in DNA
cloning, Vol.3.
(Academic Press, New York, 1987)). When a marker in the vector system
expressing
antibody is amplifiable, increase in the level of inhibitor present in culture
of host cell will
increase the number of copies of the marker gene. Since the amplified region
is associated
with the antibody gene, production of the antibody will also increase (Grouse
et al., Mol.
Cell. Biol. 3:257 (1983)).
The host cell may be co-transfected with two expression vectors of the
invention, the
first vector encoding a heavy chain derived polypeptide and the second vector
encoding a light
2o chain derived polypeptide. The two vectors may contain identical selectable
markers which
enable equal expression of heavy and light chain polypeptides. Alternatively,
a single vector
may be used which encodes, and is capable of expressing, both heavy and light
chain
polypeptides. In such situations, the light chain should be placed before the
heavy chain to
avoid an excess of toxic free heavy chain (Proudfoot, Nature 322:52 (1986);
Kohler, Proc.
Natl. Acad. Sci. USA 77:2197 (1980)). The coding sequences for the heavy and
light chains
may comprise cDNA or genomic DNA.
Once an antibody molecule of the invention has been produced by an animal,
chemically synthesized, or recombinantly expressed, it may be purified by any
method
known in the art for purification of an immunoglobulin molecule, for example,
by
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
104
chromatography (e.g., ion exchange, affinity, particularly by affinity for the
specific antigen
after Protein A, and sizing column chromatography), centrifugation,
differential solubility, or
by any other standard technique for the purification of proteins. In addition,
the antibodies of
the present invention or fragments thereof can be fused to heterologous
polypeptide
sequences described herein or otherwise known in the art, to facilitate
purification.
The present invention encompasses antibodies recombinantly fused or chemically
conjugated (including both covalently and non-covalently conjugations) to a
polypeptide (or
portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100
amino acids of the
polypeptide) of the present invention to generate fusion proteins. The fusion
does not
to necessarily need to be direct, but may occur through linker sequences. The
antibodies may be
specific for antigens other than polypeptides (or portion thereof, preferably
at least 10, 20,
30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the
present invention.
For example, antibodies may be used to target the polypeptides of the present
invention to
particular cell types, either in vitro or in vivo, by fusing or conjugating
the polypeptides of
the present invention to antibodies specific for particular cell surface
receptors. Antibodies
fused or conjugated to the polypeptides of the present invention may also be
used in in vitro
immunoassays and purification methods using methods known in the art. See
e.g., Harbor et
al., supra, and PCT publication WO 93/21232; EP 439,095; Naramura et al.,
Immunol. Lett.
39:91-99 (1994); U.S. Patent 5,474,981; Gillies et al., PNAS 89:1428-1432
(1992); Fell et al.,
2o J. Immunol. 146:2446-2452(1991), which are incorporated by reference in
their entireties.
The present invention further includes compositions comprising the
polypeptides of
the present invention fused or conjugated to antibody domains other than the
variable regions.
For example, the polypeptides of the present invention may be fused or
conjugated to an
antibody Fc region, or portion thereof. The antibody portion fused to a
polypeptide of the
present invention may comprise the constant region, hinge region, CH1 domain,
CH2
domain, and CH3 domain or any combination of whole domains or portions
thereof. The
polypeptides may also be fused or conjugated to the above antibody portions to
form
multimers. For example, Fc portions fused to the polypeptides of the present
invention can
form dimers through disulfide bonding between the Fc portions. Higher
multimeric forms can
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
105
be made by fusing the polypeptides to portions of IgA and IgM. Methods for
fusing or
conjugating the polypeptides of the present invention to antibody portions are
known in the
art. See, e.g., U.S. Patent Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053;
5,447,851;
5,112,946; EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570;
Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et
al., J.
Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad. Sci. USA
89:11337-
11341 ( 1992) (said references incorporated by reference in their entireties).
As discussed, supra, the polypeptides corresponding to a polypeptide,
polypeptide
fragment, or a variant of SEQ ID N0:2 may be fused or conjugated to the above
antibody
l0 portions to increase the in vivo half life of the polypeptides or for use
in immunoassays using
methods known in the art. Further, the polypeptides corresponding to SEQ ID
N0:2, 25, or
27 may be fused or conjugated to the above antibody portions to facilitate
purification. One
reported example describes chimeric proteins consisting of the first two
domains of the
human CD4-polypeptide and various domains of the constant regions of the heavy
or light
chains of mammalian immunoglobulins. (EP 394,827; Traunecker et al., Nature
331:84-86
(1988). The polypeptides of the present invention fused or conjugated to an
antibody
having disulfide- linked dimeric structures (due to the IgG) may also be more
efficient in
binding and neutralizing other molecules, than the monomeric secreted protein
or protein
fragment alone. (Fountoulakis et al., J. Biochem. 270:3958-3964 (1995)). In
many cases, the
2o Fc part in a fusion protein is beneficial in therapy and diagnosis, and
thus can result in, for
example, improved pharmacokinetic properties. (EP A 232,262). Alternatively,
deleting the
Fc part after the fusion protein has been expressed, detected, and purified,
would be desired.
For example, the Fc portion may hinder therapy and diagnosis if the fusion
protein is used as
an antigen for immunizations. In drug discovery, for example, human proteins,
such as hIL-5,
have been fused with Fc portions for the purpose of high-throughput screening
assays to
identify antagonists of hIL-5. (See, Bennett et al., J. Molecular Recognition
8:52-58 (1995);
Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
Moreover, the antibodies or fragments thereof of the present invention can be
fused to
marker sequences, such as a peptide to facilitate purification. In preferred
embodiments, the
CA 02371611 2001-10-19
WO 00/63221 PCT/CTS00/10714
106
marker amino acid sequence is a hexa-histidine peptide, such as the tag
provided in a pQE
vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others,
many of
which are commercially available. As described in Gentz et al., Proc. Natl.
Acad. Sci. USA
86:821-824 (1989), for instance, hexa-histidine provides for convenient
purification of the
fusion protein. Other peptide tags useful for purification include, but are
not limited to, the
"HA" tag, which corresponds to an epitope derived from the influenza
hemagglutinin protein
(Wilson et al., Cell 37:767 (1984)) and the "flag" tag.
The present invention further encompasses antibodies or fragments thereof
conjugated
to a diagnostic or therapeutic agent. The antibodies can be used
diagnostically to, for
to example, monitor the development or progression of a tumor as part of a
clinical testing
procedure to, e.g., determine the efficacy of a given treatment regimen.
Detection can be
facilitated by coupling the antibody to a detectable substance. Examples of
detectable
substances include various enzymes, prosthetic groups, fluorescent materials,
luminescent
materials, bioluminescent materials, radioactive materials, positron emitting
metals using
various positron emission tomographies, and nonradioactive paramagnetic metal
ions. The
detectable substance may be coupled or conjugated either directly to the
antibody (or
fragment thereof) or indirectly, through an intermediate (such as, for
example, a linker known
in the art) using techniques known in the art. See, for example, U.S. Patent
No. 4,741,900 for
metal ions which can be conjugated to antibodies for use as diagnostics
according to the
2o present invention. Examples of suitable enzymes include horseradish
peroxidase, alkaline
phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable
prosthetic
group complexes include streptavidin/biotin and avidin/biotin; examples of
suitable
fluorescent materials include umbelliferone, fluorescein, fluorescein
isothiocyanate,
rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example
of a luminescent material includes luminol; examples of bioluminescent
materials include
luciferase, luciferin, and aequorin; and examples of suitable radioactive
materials include
radioisotopes such as iodine ('3'I, 'zSI, 'z3I, 'z'I), carbon ('4C), sulfur
(35S), tritium (3H),
indium ("5"'In, "3mIn, "zln, "'In), and technetium (99Tc, 99mTc), thallium
(z°'Ti), gallium
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
107
(6gGa, 67Ga), palladium (lo3Pd), molybdenum (99Mo), xenon (IS3Xe), fluorine
(I$F), 153Sm,
177Lu~ ls9Gd~ 149Pm 140La' 175~rb~ 166H~' 90Y' 47s~' 186Re 188Re 142Pr' 105~~
and 97IZu.
Further, an antibody or fragment thereof may be conjugated to a therapeutic
moiety
such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic
agent or a radioactive
metal ion, e.g., alpha-emitters such as, for example, 213Bi. A cytotoxin or
cytotoxic agent
includes any agent that is detrimental to cells. Examples include paclitaxol,
cytochalasin B,
gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide,
vincristine,
vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione,
mitoxantrone,
mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine,
to lidocaine, propranolol, and puromycin and analogs or homologs thereof.
Therapeutic agents
include, but are not limited to, antimetabolites (e.g., methotrexate, 6-
mercaptopurine, 6-
thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g.,
mechlorethamine,
thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU),
cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and
cis-
is dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g.,
daunorubicin (formerly
daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly
actinomycin),
bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
vincristine
and vinblastine).
The conjugates of the invention can be used for modifying a given biological
response,
zo the therapeutic agent or drug moiety is not to be construed as limited to
classical chemical
therapeutic agents. For example, the drug moiety may be a protein or
polypeptide
possessing a desired biological activity. Such proteins may include, for
example, a toxin such
as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such
as tumor necrosis
factor, a-interferon, 13-interferon, nerve growth factor, platelet derived
growth factor, tissue
25 plasminogen activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I
(See,
International Publication No. WO 97/33899), AIM II (See, International
Publication No. WO
97/34911), Fas Ligand (Takahashi et al., Int. Immunol., 6:1567-1574 (1994)),
VEGI (See,
International Publication No. WO 99/23105), a thrombotic agent or an anti-
angiogenic agent,
e.g., angiostatin or endostatin; or, biological response modifiers such as,
for example,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
108
lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL-2"), interleukin-6
("IL-6"),
granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte
colony
stimulating factor ("G-CSF"), or other growth factors.
Antibodies may also be attached to solid supports, which are particularly
useful for
immunoassays or purification of the target antigen. Such solid supports
include, but are not
limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or
polypropylene.
Techniques for conjugating such therapeutic moiety to antibodies are well
known, see,
e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In
Cancer
to Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al.
(eds.), pp. 243-56
(Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery",
in Controlled
Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker,
Inc. 1987);
Thorpe, "Antibody Garners Of Cytotoxic Agents In Cancer Therapy: A Review", in
Monoclonal Antibodies'84: Biological And Clinical Applications, Pinchera et
al. (eds.), pp.
475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic
Use Of
Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer
Detection
And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and
Thorpe et al.,
"The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev.
62:119-58 (1982).
Alternatively, an antibody can be conjugated to a second antibody to form an
antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980,
which is
incorporated herein by reference in its entirety.
An antibody, with or without a therapeutic moiety conjugated to it,
administered
alone or in combination with cytotoxic factors) and/or cytokine(s) can be used
as a
therapeutic.
Immunophenotyping
The antibodies of the invention may be utilized for immunophenotyping of cell
lines
and biological samples. The translation product of the gene of the present
invention may be
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
109
useful as a cell specific marker, or more specifically as a cellular marker
that is differentially
expressed at various stages of differentiation andlor maturation of particular
cell types.
Monoclonal antibodies directed against a specific epitope, or combination of
epitopes, will
allow for the screening of cellular populations expressing the marker. Various
techniques can
be utilized using monoclonal antibodies to screen for cellular populations
expressing the
marker(s), and include magnetic separation using antibody-coated magnetic
beads, "panning"
with antibody attached to a solid matrix (i.e., plate), and flow cytometry
(See, e.g., U.S.
Patent 5,985,660; and Morrison et al., Cell, 96:737-49 (1999)).
These techniques allow for the screening of particular populations of cells,
such as
l0 might be found with hematological malignancies (i.e. minimal residual
disease (MRD) in acute
leukemic patients) and "non-self' cells in transplantations to prevent Graft-
versus-Host
Disease (GVHD). Alternatively, these techniques allow for the screening of
hematopoietic
stem and progenitor cells capable of undergoing proliferation and/or
differentiation, as might
be found in human umbilical cord blood.
Assays For Antibody Binding
The antibodies of the invention may be assayed for immunospecific binding by
any
method known in the art. The immunoassays which can be used include but are
not limited to
competitive and non-competitive assay systems using techniques such as western
blots,
radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich"
immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion
precipitin
reactions, immunodiffusion assays, agglutination assays, complement-fixation
assays,
immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to
name
but a few. Such assays are routine and well known in the art (see, e.g.,
Ausubel et al, eds,
1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc.,
New York,
which is incorporated by reference herein in its entirety). Exemplary
immunoassays are
described briefly below (but are not intended by way of limitation).
Immunoprecipitation protocols generally comprise lysing a population of cells
in a
lysis buffer such as RIPA buffer (1% NP-40 or Triton X- 100, 1% sodium
deoxycholate,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
110
0.1 % SDS, 0.15 M NaCI, 0.01 M sodium phosphate at pH 7.2, 1 % Trasylol)
supplemented
with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium
vanadate), adding the antibody of interest to the cell lysate, incubating for
a period of time
(e.g., 1-4 hours) at 4° C, adding protein A and/or protein G sepharose
beads to the cell lysate,
incubating for about an hour or more at 4° C, washing the beads in
lysis buffer and
resuspending the beads in SDS/sample buffer. The ability of the antibody of
interest to
immunoprecipitate a particular antigen can be assessed by, e.g., western blot
analysis. One
of skill in the art would be knowledgeable as to the parameters that can be
modified to
increase the binding of the antibody to an antigen and decrease the background
(e.g., pre-
l0 clearing the cell lysate with sepharose beads). For further discussion
regarding
immunoprecipitation protocols see, e.g., Ausubel et al, eds, 1994, Current
Protocols in
Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.
Western blot analysis generally comprises preparing protein samples,
electrophoresis
of the protein samples in a polyacrylamide gel (e.g., 8%- 20% SDS-PAGE
depending on the
molecular weight of the antigen), transferring the protein sample from the
polyacrylamide gel
to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in
blocking
solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in
washing buffer
(e.g., PBS-Tween 20), blocking the membrane with primary antibody (the
antibody of
interest) diluted in blocking buffer, washing the membrane in washing buffer,
blocking the
membrane with a secondary antibody (which recognizes the primary antibody,
e.g., an anti-
human antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or
allcaline phosphatase) or radioactive molecule (e.g., 3zP or ~ZSI) diluted in
blocking buffer,
washing the membrane in wash buffer, and detecting the presence of the
antigen. One of skill
in the art would be knowledgeable as to the parameters that can be modified to
increase the
signal detected and to reduce the background noise. For further discussion
regarding western
blot protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology,
Vol. 1, John Wiley & Sons, Inc., New York at 10.8.1.
ELISAs comprise preparing antigen, coating the well of a 96 well microtiter
plate with
the antigen, adding the antibody of interest conjugated to a detectable
compound such as an
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
I11
enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to
the well and
incubating for a period of time, and detecting the presence of the antigen. In
ELISAs the
antibody of interest does not have to be conjugated to a detectable compound;
instead, a
second antibody (which recognizes the antibody of interest) conjugated to a
detectable
compound may be added to the well. Further, instead of coating the well with
the antigen,
the antibody may be coated to the well. In this case, a second antibody
conjugated to a
detectable compound may be added following the addition of the antigen of
interest to the
coated well. One of skill in the art would be knowledgeable as to the
parameters that can be
modified to increase the signal detected as well as other variations of ELISAs
known in the
art. For further discussion regarding ELISAs see, e.g., Ausubel et al, eds,
1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
11.2.1.
The binding affinity of an antibody to an antigen and the off rate of an
antibody-
antigen interaction can be determined by competitive binding assays. One
example of a
competitive binding assay is a radioimmunoassay comprising the incubation of
labeled antigen
(e.g., 3H or ~ZSI) with the antibody of interest in the presence of increasing
amounts of
unlabeled antigen, and the detection of the antibody bound to the labeled
antigen. The
affinity of the antibody of interest for a particular antigen and the binding
off rates can be
determined from the data by scatchard plot analysis. Competition with a second
antibody
can also be determined using radioimmunoassays. In this case, the antigen is
incubated with
antibody of interest conjugated to a labeled compound (e.g., 3H or izsl) in
the presence of
increasing amounts of an unlabeled second antibody. Other suitable radioactive
materials
include, but are not limited to, radioisotopes such as iodine (~31I, ~z51,
iz3h izil) carbon (14C),
sulfur (35S), tritium (3H), indium (~ ~ SmIn, 1 i3mln, ~ ~zln, ~ 1 ~ ln), and
technetium (99Tc, 99mTc),
thallium (z°~Ti), gallium (68Ga, 6~Ga), palladium (~°3Pd),
molybdenum (99Mo), xenon (133Xe),
fluorine (~aF) ~s3Sm mLu is9Gd ~49Pm i4oLa l5yb 166Ho 9oY 4~Sc ~s6Re ~ssRe
iazpr
> > > > > > > > > > > > >
ios~~ and 9~Ru.
Therapeutic Uses
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
112
The present invention is further directed to antibody-based therapies which
involve
administering antibodies of the invention to an animal, preferably a mammal,
and most
preferably a human, patient for treating one or more of the disclosed
diseases, disorders, or
conditions. Therapeutic compounds of the invention include, but are not
limited to,
antibodies of the invention (including fragments, analogs and derivatives
thereof as described
herein) and nucleic acids encoding antibodies of the invention (including
fragments, analogs
and derivatives thereof and anti-idiotypic antibodies as described herein).
The antibodies of
the invention can be used to treat, inhibit or prevent diseases, disorders or
conditions
associated with aberrant expression andlor activity of a polypeptide of the
invention,
including, but not limited to, any one or more of the diseases, disorders, or
conditions
described herein. The treatment and/or prevention of diseases, disorders, or
conditions
associated with aberrant expression and/or activity of a polypeptide of the
invention
includes, but is not limited to, alleviating symptoms associated with those
diseases, disorders
or conditions. Antibodies of the invention may be provided in pharmaceutically
acceptable
compositions as known in the art or as described herein.
A summary of the ways in which the antibodies of the present invention may be
used
therapeutically includes binding polynucleotides or polypeptides of the
present invention
locally or systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated
by complement (CDC) or by effector cells (ADCC). Some of these approaches are
described
in more detail below. Armed with the teachings provided herein, one of
ordinary skill in the
art will know how to use the antibodies of the present invention for
diagnostic, monitoring or
therapeutic purposes without undue experimentation.
The antibodies of this invention may be advantageously utilized in combination
with
other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic
growth
factors (such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to
increase the number or
activity of effector cells which interact with the antibodies.
The antibodies of the invention may be administered alone or in combination
with
other types of treatments (e.g., radiation therapy, chemotherapy, hormonal
therapy,
immunotherapy and anti-tumor agents). Generally, administration of products of
a species
CA 02371611 2001-10-19
WO 00163221 PCT/US00/10?14
113
origin or species reactivity (in the case of antibodies) that is the same
species as that of the
patient is preferred. Thus, in a preferred embodiment, human antibodies,
fragments
derivatives, analogs, or nucleic acids, are administered to a human patient
for therapy or
prophylaxis.
It is preferred to use high affinity and/or potent in vivo inhibiting and/or
neutralizing
antibodies against polypeptides or polynucleotides of the present invention,
fragments or
regions thereof, for both immunoassays directed to and therapy of disorders
related to
polynucleotides or polypeptides, including fragments thereof, of the present
invention. Such
antibodies, fragments, or regions, will preferably have an affinity for
polynucleotides or
to polypeptides of the invention, including fragments thereof. Preferred
binding affinities include
those with a dissociation constant or Kd less than 5 X 10-Z M, 10-Z M, 5 X 10-
3 M, 10-3 M,
5 X 10-4 M, 10-4 M, 5 X 10-5 M, 10-5 M, 5 X 106 M, 10-6 M, 5 X 10-~ M, 10-~ M,
5 X 10-$
M, 10-$ M, 5 X 109 M, 10-9 M, 5 X 10-1° M, 10-'° M, 5 X 10-" M,
10-'~ M, 5 X 10-~Z M,
10-1z M, 5 X 10-3 M, 10-13 M, 5 X 10-~4 M, 10-~4 M, 5 X 10-~5 M, and 10-15 M.
Gene Therapy
In a specific embodiment, nucleic acids comprising sequences encoding
antibodies or
functional derivatives thereof, are administered to treat, inhibit or prevent
a disease or
disorder associated with aberrant expression and/or activity of a polypeptide
of the invention,
2o by way of gene therapy. Gene therapy refers to therapy performed by the
administration to
a subject of an expressed or expressible nucleic acid. In this embodiment of
the invention, the
nucleic acids produce their encoded protein that mediates a therapeutic
effect.
Any of the methods for gene therapy available in the art can be used according
to the
present invention. Exemplary methods are described below.
For general reviews of the methods of gene therapy, see Goldspiel et al.,
Clinical
Pharmacy 12:488-505 (1993); Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev,
Ann.
Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932
(1993); and
Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May, TIBTECH
11(5):155-
215 (1993). Methods commonly known in the art of recombinant DNA technology
which can
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
114
be used are described in Ausubel et al. (eds.), Current Protocols in Molecular
Biology, John
Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A
Laboratory
Manual, Stockton Press, NY (1990).
In a preferred aspect, the compound comprises nucleic acid sequences encoding
an
antibody, said nucleic acid sequences being part of expression vectors that
express the
antibody or fragments or chimeric proteins or heavy or light chains thereof in
a suitable host.
In particular, such nucleic acid sequences have promoters operably linked to
the antibody
coding region, said promoter being inducible or constitutive, and, optionally,
tissue- specific.
In another particular embodiment, nucleic acid molecules are used in which the
antibody
to coding sequences and any other desired sequences are flanked by regions
that promote
homologous recombination at a desired site in the genome, thus providing for
intrachromosomal expression of the antibody encoding nucleic acids (Koller and
Smithies,
Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al., Nature
342:435-438 (1989).
In specific embodiments, the expressed antibody molecule is a single chain
antibody;
alternatively, the nucleic acid sequences include sequences encoding both the
heavy and light
chains, or fragments thereof, of the antibody.
Delivery of the nucleic acids into a patient may be either direct, in which
case the
patient is directly exposed to the nucleic acid or nucleic acid- carrying
vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in vitro, then
transplanted into
2o the patient. These two approaches are known, respectively, as in vivo or ex
vivo gene
therapy.
In a specific embodiment, the nucleic acid sequences are directly administered
in vivo,
where it is expressed to produce the encoded product. This can be accomplished
by any of
numerous methods known in the art, e.g., by constructing them as part of an
appropriate
nucleic acid expression vector and administering it so that they become
intracellular, e.g., by
infection using defective or attenuated retrovirals or other viral vectors
(see U.S. Patent No.
4,980,286), or by direct injection of naked DNA, or by use of microparticle
bombardment
(e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface
receptors or
transfecting agents, encapsulation in liposomes, microparticles, or
microcapsules, or by
CA 02371611 2001-10-19
WO 00163221 PCT/US00I10714
115
administering them in linkage to a peptide which is known to enter the
nucleus, by
administering it in linkage to a ligand subject to receptor-mediated
endocytosis (see, e.g., Wu
and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to target cell
types
specifically expressing the receptors), etc. In another embodiment, nucleic
acid-ligand
complexes can be formed in which the ligand comprises a fusogenic viral
peptide to disrupt
endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet
another
embodiment, the nucleic acid can be targeted in vivo for cell specific uptake
and expression,
by targeting a specific receptor (see, e.g., PCT Publications WO 92106180; WO
92/22635;
W092/20316; W093/14188, WO 93/20221). Alternatively, the nucleic acid can be
l0 introduced intracellularly and incorporated within host cell DNA for
expression; by
homologous recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935
(1989); Zijlstra et al., Nature 342:435-438 (1989)).
In a specific embodiment, viral vectors that contains nucleic acid sequences
encoding
an antibody of the invention are used. For example, a retroviral vector can be
used (see
Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors
contain the
components necessary for the correct packaging of the viral genome and
integration into the
host cell DNA. The nucleic acid sequences encoding the antibody to be used in
gene therapy
are cloned into one or more vectors, which facilitates delivery of the gene
into a patient.
More detail about retroviral vectors can be found in Boesen et al., Biotherapy
6:291-302
(1994), which describes the use of a retroviral vector to deliver the mdrl
gene to
hematopoietic stem cells in order to make the stem cells more resistant to
chemotherapy.
Other references illustrating the use of retroviral vectors in gene therapy
are: Clowes et al., J.
Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994);
Salmons and
Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr.
Opin.
in Genetics and Devel. 3:110-114 (1993).
Adenoviruses are other viral vectors that can be used in gene therapy.
Adenoviruses
are especially attractive vehicles for delivering genes to respiratory
epithelia. Adenoviruses
naturally infect respiratory epithelia where they cause a mild disease. Other
targets for
adenovirus-based delivery systems are liver, the central nervous system,
endothelial cells,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
116
and muscle. Adenoviruses have the advantage of being capable of infecting non-
dividing cells.
Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503
(1993)
present a review of adenovirus-based gene therapy. Bout et al., Human Gene
Therapy 5:3-
(1994) demonstrated the use of adenovirus vectors to transfer genes to the
respiratory
5 epithelia of rhesus monkeys. Other instances of the use of adenoviruses in
gene therapy can
be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al.,
Cell 68:143- 155
(1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT
Publication W094/12649;
and Wang, et al., Gene Therapy 2:775-783 (1995). In a preferred embodiment,
adenovirus
vectors are used.
10 Adeno-associated virus (AAV) has also been proposed for use in gene therapy
(Walsh
et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Patent No.
5,436,146).
Another approach to gene therapy involves transferring a gene to cells in
tissue culture
by such methods as electroporation, lipofection, calcium phosphate mediated
transfection, or
viral infection. Usually, the method of transfer includes the transfer of a
selectable marker to
the cells. The cells are then placed under selection to isolate those cells
that have taken up
and are expressing the transferred gene. Those cells are then delivered to a
patient.
In this embodiment, the nucleic acid is introduced into a cell prior to
administration in
vivo of the resulting recombinant cell. Such introduction can be carried out
by any method
known in the art, including but not limited to transfection, electroporation,
microinjection,
infection with a viral or bacteriophage vector containing the nucleic acid
sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer,
spheroplast
fusion, etc. Numerous techniques are known in the art for the introduction of
foreign genes
into cells (see, e.g., Loeffler and Behr, Metb. Enzymol. 217:599-618 (1993);
Cohen et al.,
Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther. 29:69-92m (1985) and
may be
used in accordance with the present invention, provided that the necessary
developmental
and physiological functions of the recipient cells are not disrupted. The
technique should
provide for the stable transfer of the nucleic acid to the cell, so that the
nucleic acid is
expressible by the cell and preferably heritable and expressible by its cell
progeny.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
117
The resulting recombinant cells can be delivered to a patient by various
methods
known in the art. Recombinant blood cells (e.g., hematopoietic stem or
progenitor cells) are
preferably administered intravenously. The amount of cells envisioned for use
depends on
the desired effect, patient state, etc., and can be determined by one skilled
in the art.
Cells into which a nucleic acid can be introduced for purposes of gene therapy
encompass any desired, available cell type, and include but are not limited to
epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes;
blood cells such as
Tlymphocytes, Blymphocytes, monocytes, macrophages, neutrophils, eosinophils,
megakaryocytes, granulocytes; various stem or progenitor cells, in particular
hematopoietic
to stem or progenitor cells, e.g., as obtained from bone marrow, umbilical
cord blood, peripheral
blood, fetal liver, etc.
In a preferred embodiment, the cell used for gene therapy is autologous to the
patient.
In an embodiment in which recombinant cells are used in gene therapy, nucleic
acid
sequences encoding an antibody are introduced into the cells such that they
are expressible
by the cells or their progeny, and the recombinant cells are then administered
in vivo for
therapeutic effect. In a specific embodiment, stem or progenitor cells are
used. Any stem
and/or progenitor cells which can be isolated and maintained in vitro can
potentially be used in
accordance with this embodiment of the present invention (see e.g. PCT
Publication WO
94/08598; Stemple and Anderson, Cell 71:973-985 (1992); Rheinwald, Meth. Cell
Bio.
21A:229 (1980); and Pittelkow and Scott, Mayo Clinic Proc. 61:771 (1986)).
In a specific embodiment, the nucleic acid to be introduced for purposes of
gene
therapy comprises an inducible promoter operably linked to the coding region,
such that
expression of the nucleic acid is controllable by controlling the presence or
absence of the
appropriate inducer of transcription. Demonstration of Therapeutic or
Prophylactic
Activity
The compounds or pharmaceutical compositions of the invention are preferably
tested
in vitro, and then in vivo for the desired therapeutic or prophylactic
activity, prior to use in
humans. For example, in vitro assays to demonstrate the therapeutic or
prophylactic utility
of a compound or pharmaceutical composition include, the effect of a compound
on a cell line
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
118
or a patient tissue sample. The effect of the compound or composition on the
cell line andlor
tissue sample can be determined utilizing techniques known to those of skill
in the art
including, but not limited to, rosette formation assays and cell lysis assays.
In accordance
with the invention, in vitro assays which can be used to determine whether
administration of
a specific compound is indicated, include in vitro cell culture assays in
which a patient tissue
sample is grown in culture, and exposed to or otherwise administered a
compound, and the
effect of such compound upon the tissue sample is observed.
Diagnosis and Prognosis
to It is believed that certain tissues in mammals with certain diseases (e.g.,
autoimmune
diseases which include, but are not limited to, lupus erythematosus (SLE),
rheumatoid
arthritis (RA), insulin-dependent diabetes, multiple sclerosis (MS), giant
cell arteritis,
polyarteritis nodosa, myasthenia gravis, scleroderma, and graft versus host
disease; graft
rejection; mammalian cancers which include, but are not limited, to, melanoma,
renal
astrocytoma, Hodgkin's disease, breast, ovarian, prostate, bone, liver, lung,
pancreatic, and
spleenic cancers; inflammatory diseases; asthma; and allergeic diseases)
express significantly
altered (e.g., enhanced or decreased) levels of the galectin 11 polypeptide
and mRNA
encoding the galectin 11 polypeptide when compared to a corresponding
"standard" mammal,
i.e., a mammal of the same species not having the disease. Further, it is
believed that altered
levels of the galectin 11 polypeptide can be detected in certain body fluids
(e.g., sera, plasma,
urine, and spinal fluid) from mammals with the disorder when compared to sera
from
mammals of the same species not having the disorder. Thus, the invention
provides a
diagnostic method useful during diagnosis, which involves assaying the
expression level of the
gene encoding the galectin 11 polypeptide in mammalian cells or body fluid and
comparing the
gene expression level with a standard galectin 11 gene expression level,
whereby an increase or
decrease in the gene expression level over the standard is indicative of the
disease.
Where a diagnosis has already been made according to conventional methods, the
present invention is useful as a prognostic indicator, whereby patients
exhibiting altered
CA 02371611 2001-10-19
WO 00163221 PCT/US00/10714
119
galectin 11 gene expression will experience a worse clinical outcome relative
to patients
expressing the gene at a normal level.
By "assaying" the expression level of the gene encoding the galectin 11
polypeptide"
is intended qualitatively or quantitatively measuring or estimating the level
of the galectin 11
polypeptide or the level of the mRNA encoding the galectin 11 polypeptide in a
first
biological sample either directly (e.g., by determining or estimating absolute
polypeptide or
mRNA level) or relatively (e.g., by comparing to the galectin 11 polypeptide
level or mRNA
level in a second biological sample).
Nucleic acids for diagnosis may be obtained from a biological sample of a
subject, such
to as from blood, urine, saliva, tissue biopsy or autopsy material, using
techniques known in the
art. The genomic DNA may be used directly for detection or may be amplified
enzymatically
by using PCR or other amplification techniques prior to analysis. RNA or cDNA
may also
be used in similar fashion. Deletions and insertions can be detected by a
change in size of the
amplified product in comparison to the normal genotype. Point mutations can be
identified
by hybridizing amplified DNA to labeled galectin 11 nucleotide sequences.
Perfectly matched
sequences can be distinguished from mismatched duplexes by RNase digestion or
by
differences in melting temperatures. DNA sequence differences may also be
detected by
alterations in electrophoretic mobility of DNA fragments in gels, with or
without denaturing
agents, or by direct DNA sequencing (see, e.g., Myers et al., Science 230:1242
(1985)).
Sequence changes at specific locations may also be revealed by nuclease
protection assays,
such as RNase and S1 protection or the chemical cleavage method (see Cotton et
al., Proc.
Natl. Acad. Sci. USA 85:4397-4401 (1985)). In another embodiment, an array of
oligonucleotides probes comprising galectin 11 polynucleotide sequences or
fragments
thereof, can be constructed to conduct efficient screening of e.g., genetic
mutations. Array
technology methods are well known and have general applicability and can be
used to address
a variety of questions in molecular genetics including gene expression,
genetic linkage, and
genetic variability (see for example, Chee et al., Science 274:610-613
(1996)).
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
120
The diagnostic assays offer a process for diagnosing or determining a
susceptibility to
specific diseases through detection of mutation in the galectin 11 gene by the
methods
described.
In addition, specific diseases can be diagnosed by methods comprising
determining
from a sample derived from a subject an abnormally decreased or increased
level of galectin 11
polypeptide or mRNA. Decreased or increased expression can be measured at the
RNA level
using any of the methods well known in the art, which include, but are not
limited to,
Northern blot analysis, (Harada et al., Cell 63:303-312 (1990), 51 nuclease
mapping (Fijita et
al., Cell 49:357-367 (1987)), RNAse protection, the polymerase chain reaction
(PCR),
to reverse transcription in combination with the polymerase chain reaction (RT-
PCR) (Makino
et al., Technique 2:295-301 (1990), reverse transcription in combination with
the ligase chain
reaction (RT-LCR) and other hybridization methods.
Assaying galectin 11 polypeptide levels in a biological sample can be by any
techniques known in the art, which include, but are not limited to,
radioimmunoassays,
competitive-binding assays, Western Blot analysis and enzyme linked
immunosorbent assays
(ELISAs) and other antibody-based techniques. For example, galectin 11
polypeptide
expression in tissues can be studied with classical immunohistological methods
(Jalkanen et
al., J. Cell. Biol. 101:976-985 (1985); Jalkanen et al., J. Cell. Biol.
105:3087-3096 (1987)).
Suitable labels are known in the art and include enzyme labels, such as,
Glucose
oxidase, and radioisotopes, such as iodine (1311, lash lZ3h 121I), carbon
('4C), sulfur (35S),
tritium (3H), indium ('lSmln, tl3mln, llzln, 11'In), and technetium (99Tc,
99mTc), thallium (2°1Ti),
gallium (68Ga, 67Ga), palladium (losPd), molybdenum (99Mo), xenon (133Xe),
fluorine (1gF),
u3Sm 177Lu ls9Gd la9Pm laoLa ns~ 166Ho 9oY a7Sc ls6Re lasRe la2Pr lost 97Ru.
> > > > a v a a ~ a a > > >
luminescent labels, such as luminol; and fluorescent labels, such as
fluorescein and rhodamine,
and biotin.
Thus in another aspect, the present invention relates to a diagnostic kit for
a disease or
susceptibility to a disease which comprises:
(a) a galectin 11 polynucleotide, preferably the nucleotide sequence of SEQ ID
NO:1,
24, or 26, or a fragment thereof ;
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
121
(b) a nucleotide sequence complementary to that of (a);
(c) a galectin 11 polypeptide of the invention, preferably the polypeptide of
SEQ ID
N0:2, 25, or 27 or a fragment thereof; or
(d) an antibody to a galectin 11 polypeptide of the invention, preferably to
the
polypeptide of SEQ ID NO: 2, 25, or 27.
It will be appreciated that in any such kit, (a), (b), (c) or (d) may comprise
a
substantial component.
Thus, the invention also provides a diagnostic method useful during diagnosis
of a
disorder, involving measuring the expression level of polynucleotides of the
present invention
l0 in cells or body fluid from an individual and comparing the measured gene
expression level
with a standard level of polynucleotide expression level, whereby an increase
or decrease in
the gene expression level compared to the standard is indicative of a
disorder.
In still another embodiment, the invention includes a kit for analyzing
samples for the
presence of proliferative andlor cancerous polynucleotides derived from a test
subject. In a
general embodiment, the kit includes at least one polynucleotide probe
containing a nucleotide
sequence that will specifically hybridize with a polynucleotide of the present
invention and a
suitable container. In a specific embodiment, the kit includes two
polynucleotide probes
defining an internal region of the polynucleotide of the present invention,
where each probe
has one strand containing a 31'mer-end internal to the region. In a further
embodiment, the
2o probes may be useful as primers for polymerase chain reaction
amplification.
Where a diagnosis of a disorder, has already been made according to
conventional
methods, the present invention is useful as a prognostic indicator, whereby
patients exhibiting
enhanced or depressed polynucleotide of the present invention expression will
experience a
worse clinical outcome relative to patients expressing the gene at a level
nearer the standard
level.
By "measuring the expression level of polynucleotide of the present invention"
is
intended qualitatively or quantitatively measuring or estimating the level of
the polypeptide
of the present invention or the level of the mRNA encoding the polypeptide in
a first
biological sample either directly (e.g., by determining or estimating absolute
protein level or
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
122
mRNA level) or relatively (e.g., by comparing to the polypeptide level or mRNA
level in a
second biological sample). Preferably, the polypeptide level or mRNA level in
the first
biological sample is measured or estimated and compared to a standard
polypeptide level or
mRNA level, the standard being taken from a second biological sample obtained
from an
individual not having the disorder or being determined by averaging levels
from a population
of individuals not having a disorder. As will be appreciated in the art, once
a standard
polypeptide level or mRNA level is known, it can be used repeatedly as a
standard for
comparison.
By "biological sample" is intended any biological sample obtained from an
individual,
1o body fluid, cell line, tissue culture; or other source which contains the
polypeptide of the
present invention or mRNA. As indicated, biological samples include body
fluids (such as
semen, lymph, sera, plasma, urine, synovial fluid and spinal fluid) which
contain the
polypeptide of the present invention, and other tissue sources found to
express the
polypeptide of the present invention. Methods for obtaining tissue biopsies
and body fluids
from mammals are well known in the art. Where the biological sample is to
include mRNA, a
tissue biopsy is the preferred source.
The methods) provided above may preferrably be applied in a diagnostic method
andlor kits in which polynucleotides andlor polypeptides are attached to a
solid support. In
one exemplary method, the support may be a "gene chip" or a "biological chip"
as described
2o in US Patents 5,837,832, 5,874,219, and 5,856,174. Further, such a gene
chip with
polynucleotides of the present invention attached may be used to identify
polymorphisms
between the polynucleotide sequences, with polynucleotides isolated from a
test subject.
The knowledge of such polymorphisms (i.e. their location, as well as, their
existence) would
be beneficial in identifying disease loci for many disorders, including
cancerous diseases and
conditions. Such a method is described in US Patents 5,858,659 and 5,856,104.
The US
Patents referenced supra are hereby incorporated by reference in their
entirety herein.
Screening Assays forgalectin Il Agonists or Antagonists
Aberrancies in galectin 11 expression are responsible for many biological
functions,
3o including many pathologies. Accordingly, it is desirous to fmd compounds
and drugs which
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
123
enhance galectin 11 activity or, alternatively, suppress galectin 11 activity.
The invention
also provides a method of screening compounds to identify those which enhance
or suppress
galectin 11 activity. An agonist is a compound which increases the natural
biological
functions of galectin 11 or which functions in a manner similar to galectin
11, while
s antagonists decrease or eliminate such functions.
Thus, embodiments of the invention are directed to assays designed to identify
compounds that interact with (e.g., bind to) galectin 11 polypeptides of the
invention,
compounds that interfere or enhance the interaction of galectin 11 with its
cognate ligands,
and to compounds which modulate the galectin 11 gene (i.e., modulate the level
of galectin 11
l0 gene expression) or modulate the level of galectin 11 functional or
biological activity. Assays
may also be used to identify compounds which bind galectin 11 gene regulatory
sequences
(e.g., promoter sequences) and which may modulate galectin 11 gene expression.
See e.g.,
Platt, J. Biol. Chem. 269:28558-28562 (1994), which is incorporated herein by
reference in its
entirety.
15 Thus, polypeptides of the invention may be used to assess the binding of
small
molecule substrates and ligands in, for example, cells, cell-free
preparations, chemical libraries,
and natural product mixtures. These substrates and ligands may be natural
substrates and
ligands or may be structural or functional mimetics. See Coligan et al.,
Current Protocols in
Immunology 1(2):Chapter 5 (1991). Further examples of compounds that may be
screened
2o include, but are not limited to, peptides such as, for example soluble
peptides, including but
not limited to, those found: in random peptide libraries (see, e.g., Lam et
al., Nature 354:84-86
(1991)), and combinatorial chemistry-derived molecular libraries made of D-
and L-
configuration amino acid; phosphopeptides (including, but not limited to,
members of
random or partially degenerate, directed phosphopeptide libraries (see e.g.,
Songyang et al.,
25 Cell 72:767-778 (1993)); antibodies (including but not limited to,
monoclonal, humanized,
anti-idiotypic, chimeric or single chain antibodies, and Fab, F(ab')2, and FAB
expression
library fragments, and epitope-binding fragments thereof); and small organic
or inorganic
molecules.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
124
Numerous experimental methods may be used to select and detect compounds that
bind galectin 11 polypeptides of the invention and thereby modulate galectin
11 expression or
activity, including, but not limited to, protein affinity chromotography,
affinity blotting,
immunoprecipitation, cross-linking, and library based methods such as protein
probing, phage
display, the two-hybrid system (Fields and Song, Nature 340:245-246 (1989)),
and modified
versions of the two-hybrid system (Gyuris et al., Cell 75:791-803 (1993);
Zervos et al., Cell
72:223-232 (1993)). See generally, Phizicky et al., Microbiol. Rev. 59:94-123
(1995).
The principle behind assays that identify compounds that bind to galectin 11
polypeptides of the invention involves preparing a reaction mixture of
galectin 11
to polypeptide and test compound under conditions that allow the two
components to interact
and bind, thus forming a complex which can be detected in the reaction mixture
and purified
using techniques known in the art. Accordingly, the assays may simply test
binding of a
candidate compound to galectin 11.
Further, the assays may simply comprise the steps of combining a candidate
compound with a solution containing a galectin 11 polypeptide to form a
mixture, and
determining the ability of galectin 11 contained in this mixture to bind
galectin 11 cognate
ligands (e.g., compounds containing a (3 galactoside sugar and/or molecules
expressed on the
surface of T-cells), to agglutinate trypsin-treated rabbit erythrocytes, or to
induce apoptosis
of T-cells, and comparing this ability with that observed for the galectin 11
polypeptide in
the same or similar solution under the same or similar conditions, but absent
the candidate
compound. The ability of the candidate molecule to interfere with binding of
galectin 11 to
the cognate ligand is reflected in decreased binding of the labeled galectin
11 to the cognate
ligand relative to that in the absence of candidate molecule. Molecules which
interfere with
the ability of galectin 11 to elicit cellular responses (e.g., apoptosis)
resulting from galectin 11
binding to its cognate ligand are antagonists. Molecules that enhance galectin
11 induced
cellular responses when mixed with galectin 11, or which are able to induce a
similar cellular
response in the absence of galectin 11, are agonists.
The galectin 11 polynucleotides, polypeptides, and antibodies of the invention
may
also be used to configure assays for detecting the effect of added compounds
on the
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
125
production of galectin 11 mRNA and protein in cells. For example, an ELISA may
be
constructed for measuring secreted or cell associated levels of galectin 11
protein using
monoclonal and polyclonal antibodies by standard methods known in the art, and
this can be
used to discover agents which may inhibit or enhance the production of
galectin 11 (also
called antagonist or agonist, respectively) from suitably manipulated cells or
tissues.
Standard methods for conducting screening assays are well understood in the
art.
Examples of potential galectin 11 antagonists include antibodies or, in some
cases,
oligonucleotides or proteins which are closely related to the galectin 11 or
its cognate ligand,
e.g., a fragment of galectin 11 or galectin 11 ligand, or small molecules
which bind to the
to cognate ligand, but do not elicit a response, so that the activity of the
galectin 11 is prevented.
Thus in another aspect, the present invention relates to a screening kit for
identifying
agonists, antagonists, ligands, receptors, substrates, enzymes, etc. for
galectin 11
polypeptides; or compounds which decrease or enhance the production of
galectin 1 l, which
compnses:
(a) a galectin 11 polypeptide of the invention, such as, for example, that of
SEQ ID
N0:2, 25, or 27;
(b) a cell expressing a galectin 11 ligand, such as, for example, a T-cell;
(c) a cell membrane expressing a galectin 11 ligand, preferably a membrane of
a T-cell;
(d) a compound containing a (i galactoside sugar; or
(e) antibody to a galectin 11 polypeptide of the invention, preferably that of
SEQ ID
NO: 2, 25, or 27.
It will be appreciated that in any such kit, (a), (b), (c), (d), or (e) may
comprise a
substantial component.
Compounds identified via assays such as those described herein, may be useful,
for
example, in elaborating the biological function of the galectin 11 gene
product and for
regulating cell growth, cell proliferation and differentiation, and apoptosis.
For example,
antibodies against galectin 11 and galectin 11 polypeptides, fragments,
derivatives, variants or
analogs of the invention may be employed to suppress galectin 11 activity to
treat
abnormalities resulting from elevated galectin 11. The combination of these
identified
CA 02371611 2001-10-19
WO 00/63221 PCTNS00/10714
126
compounds with a pharmaceutically acceptable carrier (e.g., as described
herein) and their
administration to treat or prevent growth regulatory and immunomodulatory
disorders,
including, but not limited to, autoimmune diseases, cancer, and inflammatory
diseases, are also
encompassed by the invention.
Prophylactic and Therapeutic Methods
It is to be understood that although the following discussion is specifically
directed to
human patients, the teachings are also applicable to any animal that expresses
galectin 11.
As noted above, galectin 11 shares significant homology with other galectins.
to Additionally, as disclosed herein, galectin 1 l, like galectin 1 induces
apoptosis of T-cell lines.
Further, as discussed above, galectin 1 has been demonstrated to play a role
in regulating cell
proliferation and some immune functions (e.g., therapeutic activity against
autoimmune
diseases in experimental myasthenia gravis and experimental autoimmune
encephalomyelitis
animal model systems). Thus, it is likely that galectin 11, like galectin 1,
is active in
modulating growth regulatory activities (e.g., cell differentiation and/or
cell proliferation) ,
immunomodulatory activity, cell-cell and cell-substrate interactions, and
apoptosis.
Apoptosis, or programmed cell death, is a physiological mechanism involved in
the
deletion of peripheral T lymphocytes of the immune system, and its
dysregulation can lead to
a number of different pathogenic processes. Diseases associated with increased
cell survival,
or the inhibition of apoptosis, that could be treated or detected by galectin
11 polynucleotides
or polypeptides, as well as antagonists or agonists of galectin 11, include
cancers (such as
follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent
tumors,
including, but not limited to colon cancer, cardiac tumors, pancreatic cancer,
melanoma,
retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular
cancer, stomach cancer,
neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma,
osteoclastoma,
osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer,
Kaposi's sarcoma
and ovarian cancer); autoimmune disorders (such as, multiple sclerosis,
Sjogren's syndrome,
Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease,
polymyositis,
systemic lupus erythematosus and immune-related glomerulonephritis and
rheumatoid
CA 02371611 2001-10-19
WO 00!63221 PCT/L1S00/10714
127
arthritis) and viral infections (such as herpes viruses, pox viruses and
adenoviruses),
inflammation, graft v. host disease, acute graft rejection, and chronic graft
rejection. In
preferred embodiments, galectin I I polynucleotides, polypeptides, andlor
antagonists of the
invention are used to inhibit growth, progression, and/or metasis of cancers,
in particular
those listed above.
Additional diseases or conditions associated with increased cell survival that
could be
treated or detected by galectin 11 polynucleotides or polypeptides, or
agonists or antagonists
of galectin 11, include, but are not limited to, progression, and/or
metastases of malignancies
and related disorders such as leukemia (including acute leukemias (e.g., acute
lymphocytic
to leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic,
myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g.,
chronic
myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)),
polycythemia vera,
lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple
myeloma,
Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors
including, but not
limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma,
liposarcoma,
chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma,
lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma,
Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer,
breast
cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell
carcinoma,
2o adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma,
papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma,
bronchogenic
carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma,
choriocarcinoma, seminoma,
embryonal carcinoma, Wilin's tumor, cervical cancer, testicular tumor, lung
carcinoma, small
cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma,
astrocytoma,
medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma,
acoustic
neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma.
Diseases associated with increased apoptosis that could be treated or detected
by
galectin 11 polynucleotides or polypeptides, as well as agonists or
antagonists of galectin 11,
include AIDS; neurodegenerative disorders (such as Alzheimer's disease,
Parkinson's disease,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
128
Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration
and brain tumor
or prior associated disease); autoimmune disorders (such as, multiple
sclerosis, Sjogren's
syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease,
Crohn's disease,
polymyositis, systemic lupus erythematosus and immune-related
glomerulonephritis and
rheumatoid arthritis) myelodysplastic syndromes (such as aplastic anemia),
graft v. host
disease, ischemic injury (such as that caused by myocardial infarction, stroke
and reperfusion
injury), liver injury (e.g., hepatitis related liver injury,
ischemialreperfusion injury, cholestosis
(bile duct injury) and liver cancer); toxin-induced liver disease (such as
that caused by
alcohol), septic shock, cachexia and anorexia.
to Any method which neutralizes or enhances galectin 11 activity can be used
to
modulate growth regulatory activities (e.g., cell proliferation),
immunomodulatory activity,
cell-cell and cell-substrate interactions, and apoptosis.
Galectin 11 polypeptides or polynucleotides (including galectin 11 fragments,
variants, derivatives, and anaologs, and galectin 11 agonists and antagonists
as described
herein) may be useful in treating deficiencies or disorders of the immune
system, by activating
or inhibiting the proliferation, differentiation, or mobilization (chemotaxis)
of immune cells.
Immune cells develop through a process called hematopoiesis, producing myeloid
(platelets,
red blood cells, neutrophils, and macrophages) and lymphoid (B and T
lymphocytes) cells
from pluripotent stem cells. The etiology of these immune deficiencies or
disorders may be
genetic, somatic, such as cancer or some autoimmune disorders, acquired (e.g.,
by
chemotherapy or toxins), or infectious. Moreover, galectin 11 polynucleotides
or
polypeptides can be used as a marker or detector of a particular immune system
disease or
disorder.
Galectin 11 polynucleotides or polypeptides (including galectin 11 fragments,
variants, derivatives, and anaologs, and galectin 11 agonists and antagonists
as described
herein) may be useful in treating or detecting deficiencies or disorders of
hematopoietic cells.
As further discussed below, galectin 11 polypeptides or polynucleotides or
agonists or
antagonists of galectin 11, could be used to increase differentiation and
proliferation of
hematopoietic cells, including the pluripotent stem cells, in an effort to
treat those disorders
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
129
associated with a decrease in certain (or many) types hematopoietic cells.
Examples of
immunologic deficiency syndromes include, but are not limited to: blood
protein disorders
(e.g. agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common
variable
immunodeficiency, Digeorge Syndrome, HIV infection, HTLV-BLV infection,
leukocyte
adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction,
severe
combined immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia,
thrombocytopenia,
or hemoglobinuria.
Moreover, galectin 11 polypeptides or polynucleotides (including galectin 11
fragments, variants, derivatives, and anaologs, and galectin 11 agonists and
antagonists as
described herein) can also be used to modulate hemostatic (the stopping of
bleeding) or
thrombolytic activity (clot formation). For example, by increasing hemostatic
or
thrombolytic activity, galectin 11 polynucleotides or polypeptides could be
used to treat
blood coagulation disorders (e.g., afibrinogenemia, factor deficiencies),
blood platelet disorders
(e.g. thrombocytopenia), or wounds resulting from trauma, surgery, or other
causes.
Alternatively, galectin 11 polynucleotides or polypeptides, or agonists or
antagonists of
galectin 1 l, that can decrease hemostatic or thrombolytic activity could be
used to inhibit or
dissolve clotting. These molecules could be important in the treatment of
heart attacks
(infarction), strokes, or scarring.
Galectin 11 polynucleotides or polypeptides (including galectin 11 fragments,
variants, derivatives, and anaologs), and galectin 11 agonists or antagonists
(as described
herein) may also be useful in treating or detecting autoimmune disorders. As
disclosed herein,
galectin 11 induces apoptosis of T-cell lines (see Example 5, Figures 5A and
5B). Many
autoimmune disorders result from inappropriate recognition of self as foreign
material by
immune cells. This inappropriate recognition results in an immune response
leading to the
destruction of the host tissue. Therefore, the administration of galectin 11
polypeptides or
polynucleotides that can inhibit an immune response, particularly the
proliferation,
differentiation, or chemotaxis of T-cells, may be an effective therapy in
preventing
autoimmune disorders.
CA 02371611 2001-10-19
WO 00163221 PCT/US00110714
130
Examples of autoimmune disorders that can be treated or detected include, but
are not
limited to: Addison's Disease, hemolytic anemia, antiphospholipid syndrome,
rheumatoid
arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis,
Goodpasture's Syndrome,
Graves' Disease, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia,
Bullous
Pemphigoid, Pemphigus, Polyendocrinopathies, Purpura, Reiter's Disease, Stiff
Man
Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune
Pulmonary Inflammation, Guillain-Barre Syndrome, insulin dependent diabetes
mellitis, and
autoimmune inflammatory eye disease.
Similarly, allergic reactions and conditions, such as asthma (particularly
allergic
to asthma) or other respiratory problems, may also be treated by galectin 11
polypeptides or
polynucleotides, or agonists or antagonists of galectin 11. Moreover, these
molecules can be
used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood
group
incompatibility.
Galectin 11 polynucleotides or polypeptides (including galectin 11 fragments,
variants, derivatives, and anaologs, and galectin 11 agonists or antagonists
as described herein)
may also be used to treat and/or prevent organ rejection or graft-versus-host
disease (GVHD).
Organ rejection occurs by host immune cell destruction of the transplanted
tissue through an
immune response. Similarly, an immune response is also involved in GVHD, but,
in this case,
the foreign transplanted immune cells destroy the host tissues. The
administration of galectin
11 polypeptides or polynucleotides, or agonists or antagonists of galectin 11,
that inhibits an
immune response, particularly the proliferation, differentiation, or
chemotaxis of T-cells, may
be an effective therapy in preventing organ rejection or GVHD.
Similarly, galectin 11 polypeptides or polynucleotides (including galectin 11
fragments, variants, derivatives, and anaologs, and galectin 11 agonists or
antagonists as
z5 described herein) may also be used to modulate inflammation. For example,
galectin 11
polypeptides or polynucleotides, or agonists or antagonists of galectin 11,
may inhibit the
proliferation and differentiation of cells involved in an inflammatory
response. These
molecules can be used to treat inflammatory conditions, both chronic and acute
conditions,
including inflammation associated with infection (e.g., septic shock, sepsis,
or systemic
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
131
inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin
lethality,
arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or
chemokine
induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting
from over
production of cytokines (e.g., TNF or IL-1).
Galectin 11 polypeptides or polynucleotides (including galectin 11 fragments,
variants, derivatives, and anaologs, and galectin 11 agonists and antagonists
as described
herein) can be used to treat or detect hyperproliferative disorders, including
neoplasms.
Galectin 11 polypeptides or polynucleotides, or agonists or antagonists of
galectin 1 l, may
inhibit the proliferation of the disorder through direct or indirect
interactions. Alternatively,
to galectin 11 polypeptides or polynucleotides, or agonists or antagonists of
galectin 11, may
proliferate other cells which can inhibit the hyperproliferative disorder.
For example, by increasing an immune response, particularly increasing
antigenic
qualities of the hyperproliferative disorder or by proliferating,
differentiating, or mobilizing
T-cells, hyperproliferative disorders can be treated. This immune response may
be increased
by either enhancing an existing immune response, or by initiating a new immune
response.
Alternatively, decreasing an immune response may also be a method of treating
hyperproliferative disorders, such as a chemotherapeutic agent.
Examples of hyperproliferative disorders that can be treated or detected by
galectin 11
polynucleotides or polypeptides include, but are not limited to, neoplasms
located in the:
2o colon, abdomen, bone, breast, digestive system, liver, pancreas, prostate,
peritoneum,
endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus,
thyroid), eye, head
and neck, nervous (central and peripheral), lymphatic system, pelvic, skin,
soft tissue, spleen,
thoracic, and urogenital.
Similarly, other hyperproliferative disorders can also be treated or detected
by galectin
11 polynucleotides or polypeptides, or agonists or antagonists of galectin 11.
Examples of
such hyperproliferative disorders include, but are not limited to:
hypergammaglobulinemia,
lymphoproliferative disorders, paraproteinemias, purpura, sarcoidosis, Sezary
Syndrome,
Waldenstron's Macroglobulinemia, Gaucher's Disease, histiocytosis, and any
other
hyperproliferative disease, besides neoplasia, located in an organ system
listed above.
CA 02371611 2001-10-19
WO 00/63221 PCT/USOO110714
132
One preferred embodiment utilizes polynucleotides of the present invention to
inhibit
aberrant cellular division, by gene therapy using the present invention,
and/or protein fusions
or fragments thereof.
Thus, the present invention provides a method for treating cell proliferative
disorders
by inserting into an abnormally proliferating cell a polynucleotide of the
present invention,
wherein said polynucleotide represses said expression.
Another embodiment of the present invention provides a method of treating cell-
proliferative disorders in individuals comprising administration of one or
more active gene
copies of the present invention to an abnormally proliferating cell or cells.
In a preferred
to embodiment, polynucleotides of the present invention is a DNA construct
comprising a
recombinant expression vector effective in expressing a DNA sequence encoding
said
polynucleotides. In another preferred embodiment of the present invention, the
DNA
construct encoding the poynucleotides of the present invention is inserted
into cells to be
treated utilizing a retrovirus, or more preferrably an adenoviral vector (See
G J. Nabel, et. al.,
PNAS 1999 96: 324-326, which is hereby incorporated by reference). In a most
preferred
embodiment, the viral vector is defective and will not transform non-
proliferating cells, only
proliferating cells. Moreover, in a preferred embodiment, the polynucleotides
of the present
invention inserted into proliferating cells either alone, or in combination
with or fused to other
polynucleotides, can then be modulated via an external stimulus (i.e.
magnetic, specific small
2o molecule, chemical, or drug administration, etc.), which acts upon the
promoter upstream of
said polynucleotides to induce expression of the encoded protein product. As
such the
beneficial therapeutic affect of the present invention may be expressly
modulated (i.e. to
increase, decrease, or inhibit expression of the present invention) based upon
said external
stimulus.
Polynucleotides of the present invention may be useful in repressing
expression of
oncogenic genes or antigens. By "repressing expression of the oncogenic genes
" is intended
the suppression of the transcription of the gene, the degradation of the gene
transcript (pre-
message RNA), the inhibition of splicing, the destruction of the messenger
RNA, the
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
133
prevention of the post-translational modifications of the protein, the
destruction of the
protein, or the inhibition of the normal function of the protein.
For local administration to abnormally proliferating cells, polynucleotides of
the
present invention may be administered by any method known to those of skill in
the art
including, but not limited to transfection, electroporation, microinjection of
cells, or in
vehicles such as liposomes, lipofectin, or as naked polynucleotides, or any
other method
described throughout the specification. The polynucleotide of the present
invention may be
delivered by known gene delivery systems such as, but not limited to,
retroviral vectors
(Gilboa, J. Virology 44:845 (1982); Hocke, Nature 320:275 (1986); Wilson, et
al., Proc. Natl.
to Acad. Sci. U.S.A. 85:3014), vaccinia virus system (Chakrabarty et al., Mol.
Cell Biol. 5:3403
(1985) or other efficient DNA delivery systems (Yates et al., Nature 313:812
(1985)) known
to those skilled in the art. These references are exemplary only and are
hereby incorporated
by reference. In order to specifically deliver or transfect cells which are
abnormally
proliferating and spare non-dividing cells, it is preferable to utilize a
retrovirus, or adenoviral
(as described in the art and elsewhere herein) delivery system known to those
of skill in the
art. Since host DNA replication is required for retroviral DNA to integrate
and the retrovirus
will be unable to self replicate due to the lack of the retrovirus genes
needed for its life cycle.
Utilizing such a retroviral delivery system for polynucleotides of the present
invention will
target said gene and constructs to abnormally proliferating cells and will
spare the non
2o dividing normal cells.
The polynucleotides of the present invention may be delivered directly to cell
proliferative disorder/disease sites in internal organs, body cavities and the
like by use of
imaging devices used to guide an injecting needle directly to the disease
site. The
polynucleotides of the present invention may also be administered to disease
sites at the time
of surgical intervention.
By "cell proliferative disease" is meant any human or animal disease or
disorder,
affecting any one or any combination of organs, cavities, or body parts, which
is characterized
by single or multiple local abnormal proliferations of cells, groups of cells,
or tissues, whether
benign or malignant.
CA 02371611 2001-10-19
WO 00163221 PCT/US00/10714
134
Any amount of the polynucleotides of the present invention may be administered
as
long as it has a biologically inhibiting effect on the proliferation of the
treated cells.
Moreover, it is possible to administer more than one of the polynucleotide of
the present
invention simultaneously to the same site. By "biologically inhibiting" is
meant partial or
total growth inhibition as well as decreases in the rate of proliferation or
growth of the cells.
The biologically inhibitory dose may be determined by assessing the effects of
the
polynucleotides of the present invention on target malignant or abnormally
proliferating cell
growth in tissue culture, tumor growth in animals and cell cultures, or any
other method
known to one of ordinary skill in the art.
to The present invention is further directed to antibody-based therapies which
involve
administering of anti-polypeptides and anti-polynucleotide antibodies to a
mammalian,
preferably human, patient for treating one or more of the described disorders.
Methods for
producing anti-polypeptides and anti-polynucleotide antibodies polyclonal and
monoclonal
antibodies are described in detail elsewhere herein. Such antibodies may be
provided in
pharmaceutically acceptable compositions as known in the art or as described
herein.
A summary of the ways in which the antibodies of the present invention may be
used
therapeutically includes binding polynucleotides or polypeptides of the
present invention
locally or systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated
by complement (CDC) or by effector cells (ADCC). Some of these approaches are
described
2o in more detail below. Armed with the teachings provided herein, one of
ordinary skill in the
art will know how to use the antibodies of the present invention for
diagnostic, monitoring or
therapeutic purposes without undue experimentation.
In particular, the antibodies, fragments and derivatives of the present
invention are
useful for treating a subject having or developing cell proliferative and/or
differentiation
disorders as described herein. Such treatment comprises administering a single
or multiple
doses of the antibody, or a fragment, derivative, or a conjugate thereof.
The antibodies of this invention may be advantageously utilized in combination
with
other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic
growth
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
135
factors, for example, which serve to increase the number or activity of
effector cells which
interact with the antibodies.
It is preferred to use high affinity and/or potent in vivo inhibiting and/or
neutralizing
antibodies against polypeptides or polynucleotides of the present invention,
fragments or
s regions thereof, for both immunoassays directed to and therapy of disorders
related to
polynucleotides or polypeptides, including fragements thereof, of the present
invention.
Such antibodies, fragments, or regions, will preferably have an affinity for
polynucleotides or
polypeptides, including fragements thereof. Preferred binding affinities
include those with a
dissociation constant or Kd less than 5X10'6M, 10'6M, 5X10'~M, 10-~M, 5X10-8M,
10-$M,
Io 5X10'9M, 10'9M,-5X10''°M, 10-'°M, 5X10'"M, 10-"M, 5X10-'ZM,
10-'ZM, SX10''3M, 10-
'3M, 5X10-'4M, 10-'4M, 5X10-'SM, and 10-'SM.
Moreover, polypeptides of the present invention are useful in inhibiting the
angiogenesis of proliferative cells or tissues, either alone, as a protein
fusion, or in
combination with other polypeptides directly or indirectly, as described
elsewhere herein. In
15 a most preferred embodiment, said anti-angiogenesis effect may be achieved
indirectly, for
example, through the inhibition of hematopoietic, tumor-specific cells, such
as tumor-
associated macrophages (See Joseph IB, et al. J Natl Cancer Inst, 90(21):1648-
53 (1998),
which is hereby incorporated by reference). Antibodies directed to
polypeptides or
polynucleotides of the present invention may also result in inhibition of
angiogenesis directly,
20 or indirectly (See Witte L, et al., Cancer Metastasis Rev. 17(2):155-61
(1998), which is
hereby incorporated by reference)).
Polypeptides, including protein fusions, of the present invention, or
fragments thereof
may be useful in inhibiting proliferative cells or tissues through the
induction of apoptosis.
Said polypeptides may act either directly, or indirectly to induce apoptosis
of proliferative
25 cells and tissues, for example in the activation of a death-domain
receptor, such as tumor
necrosis factor (TNF) receptor-1, CD95 (Fas/APO-1), TNF-receptor-related
apoptosis-
mediated protein (TRAMP) and TNF-related apoptosis-inducing ligand (TRAIL)
receptor-1
and-2 (See Schulze-Osthoff K, et.al., Eur J Biochem 254(3):439-59 (1998),
which is hereby
incorporated by reference). Moreover, in another preferred embodiment of the
present
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
136
invention, said polypeptides may induce apoptosis through other mechanisms,
such as in the
activation of other proteins which will activate apoptosis, or through
stimulating the
expression of said proteins, either alone or in combination with small
molecule drugs or
adjuviants, such as apoptonin, galectins, thioredoxins, antiinflammatory
proteins (See for
example, Mutat Res 400(1-2):447-55 (1998), Med Hypotheses.50(5):423-33 (1998),
Chem
Biol Interact. Apr 24;111-112:23-34 (1998), J Mol Med.76(6):402-12 (1998), Int
J Tissue
React;20(1):3-15 (1998), which are all hereby incorporated by reference).
Polypeptides, including protein fusions to, or fragments thereof, of the
present
invention are useful in inhibiting the metastasis of proliferative cells or
tissues. Inhibition
l0 may occur as a direct result of administering polypeptides, or antibodies
directed to said
polypeptides as described elsewere herein, or indirectly, such as activating
the expression of
proteins known to inhibit metastasis, for example alpha 4 integrins, (See,
e.g., Curr Top
Microbiol Immunol 1998;231:125-41, which is hereby incorporated by reference).
Such
thereapeutic affects of the present invention may be achieved either alone, or
in combination
with small molecule drugs or adjuvants.
In another embodiment, the invention provides a method of delivering
compositions
containing the polypeptides of the invention (e.g., compositions containing
polypeptides or
polypeptide antibodes associated with heterologous polypeptides, heterologous
nucleic acids,
toxins, or prodrugs) to targeted cells expressing the polypeptide of the
present invention.
2o Polypeptides or polypeptide antibodes of the invention may be associated
with with
heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via
hydrophobic,
hydrophilic, ionic and/or covalent interactions.
Polypeptides, protein fusions to, or fragments thereof, of the present
invention are
useful in enhancing the immunogenicity andlor antigenicity of proliferating
cells or tissues,
either directly, such as would occur if the polypeptides of the present
invention 'vaccinated'
the immune response to respond to proliferative antigens and immunogens, or
indirectly, such
as in activating the expression of proteins known to enhance the immune
response (e.g.
chemokines), to said antigens and immunogens.
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
137
Galectin 11 polypeptides or polynucleotides (including galectin 11 fragments,
variants, derivatives, and anaologs, and galectin 11 agonists and antagonists
as described
herein) can be used to treat or detect infectious agents. For example, by
increasing the
immune response, particularly increasing the proliferation and differentiation
of B and/or T
cells, infectious diseases may be treated. The immune response may be
increased by either
enhancing an existing immune response, or by initiating a new immune response.
Alternatively, galectin 11 polypeptides or polynucleotides may also directly
inhibit the
infectious agent, without necessarily eliciting an immune response.
Viruses are one example of an infectious agent that can cause disease or
symptoms
l0 that can be treated or detected by galectin 11 polynueleotides or
polypeptides. Examples of
viruses, include, but are not limited to, the following DNA and RNA viral
families: Arbovirus,
Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae, Bunyaviridae,
Caliciviridae,
Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae
(Hepatitis),
Herpesviridae (such as, Cytomegalovirus, Herpes Simplex, Herpes Zoster),
Mononegavirus
(e.g., Paramyxoviridae, Morbillivirus, Rhabdoviridae), Orthomyxoviridae (e.g.,
Influenza A,
Influenza B, and parainfluenza), Papiloma virus, Papovaviridae, Parvoviridae,
Picornaviridae,
Poxviridae (such as Smallpox or Vaccinia), Reoviridae (e.g., Rotavirus),
Retroviridae (HTLV-I,
HTLV-II, Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses falling
within these families
can cause a variety of diseases or symptoms, including, but not limited to:
arthritis,
2o bronchiollitis, respiratory syncytial virus, encephalitis, eye infections
(e.g., conjunctivitis,
keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active,
Delta), Japanese B
encephalitis, Junin, Chikungunya, Rift Valley fever, yellow fever, meningitis,
opportunistic
infections (e.g., AIDS), pneumonia, Burkitt's Lymphoma, chickenpox,
hemorrhagic fever,
Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia,
Rubella, sexually
transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia.
Galectin 11
polypeptides or polynucleotides, or agonists or antagonists of the invention,
can be used to
treat or detect any of these symptoms or diseases. In specific embodiments,
polynucleotides,
polypeptides, or agonists or antagonists of the invention are used to treat:
meningitis,
Dengue, EBV, and/or hepatitis (e.g., hepatitis B). In an additional specific
embodiment
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
138
polynucleotides, polypeptides, or agonists or antagonists of the invention are
used to treat
patients nonresponsive to one or more other commercially available hepatitis
vaccines. In a
further specific embodiment polynucleotides, polypeptides, or agonists or
antagonists of the
invention are used to treat AIDS.
Similarly, bacterial or fungal agents that can cause disease or symptoms and
that can
be treated or detected by galectin 11 polynucleotides or polypeptides and/or
agonist or
antagonists of the present invention, include, but are not limited to, the
following Gram-
Negative and Gram-positive bacterial families and fungi: Actinomycetales
(e.g.,
Corynebacterium, Mycobacterium, Norcardia), Cryptococcus neoformans,
Aspergillosis,
l0 Bacillaceae (e.g., Anthrax, Clostridium), Bacteroidaceae, Blastomycosis,
Bordetella, Borrelia
(e.g., Borrelia burgdorferi), Brucellosis, Candidiasis, Campylobacter,
Coccidioidomycosis,
Cryptococcosis, Dermatocycoses, E. coli (e.g., Enterotoxigenic E. coli and
Enterohemorrhagic
E. coli), Enterobacteriaceae (Klebsiella, Salmonella (e.g., Salmonella typhi,
and Salmonella
paratyphi), Serratia, Yersinia), Erysipelothrix, Helicobacter, Legionellosis,
Leptospirosis,
Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae,
Neisseriaceae (e.g.,
Acinetobacter, Gonorrhea, Menigococcal), Meisseria meningitides,
Pasteurellacea Infections
(e.g., Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B),
Pasteurella),
Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis, Shigella spp.,
Staphylococcal,
Meningiococcal, Pneumococcal and Streptococcal (e.g., Streptococcus pneumoniae
and Group
B Streptococcus). These bacterial or fungal families can cause the following
diseases or
symptoms, including, but not limited to: bacteremia, endocarditis, eye
infections
(conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections
(e.g., AIDS related
infections), paronychia, prosthesis-related infections, Reiter's Disease,
respiratory tract
infections, such as Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-
Scratch
Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia,
Gonorrhea,
meningitis (e.g., mengitis types A and B), Chlamydia, Syphilis, Diphtheria,
Leprosy,
Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo,
Rheumatic
Fever, Scarlet Fever, sexually transmitted diseases, skin diseases (e.g.,
cellulitis,
dermatocycoses), toxemia, urinary tract infections, wound infections. Galectin
11
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
139
polypeptides or polynucleotides, or agonists or antagonists of the invention,
can be used to
treat or detect any of these symptoms or diseases. In specific embodiments,
polynucleotides,
polypeptides, agonists or antagonists of the invention are used to treat:
tetanus, Diptheria,
botulism, and/or meningitis type B.
Moreover, parasitic agents causing disease or symptoms that can be treated or
detected by galectin 11 polynucleotides or polypeptides, agonists or
antagonists, include, but
not limited to, the following families: Amebiasis, Babesiosis, Coccidiosis,
Cryptosporidiosis,
Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis,
Leishmaniasis,
Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas and Sporozoans
(e.g.,
Plasmodium virax, Plasmodium falciparium, Plasmodium malariae and Plasmodium
ovale).
' These parasites can cause a variety of diseases or symptoms, including, but
not limited to:
Scabies, Trombiculiasis, eye infections, intestinal disease (e.g., dysentery,
giardiasis), liver
disease, lung disease, opportunistic infections (e.g., AIDS related), malaria,
pregnancy
complications, and toxoplasmosis. Galectin 11 polypeptides or polynucleotides,
or agonists
is or antagonists, can be used to treat or detect any of these symptoms or
diseases. In specific
embodiments, polynucleotides, polypeptides, or agonists or antagonists of the
invention are
used to treat malaria.
Preferably, treatment using a polypeptide or polynucleotide and/or agonist or
antagonist of the present invention could either be by administering an
effective amount of a
polypeptide to the patient, or by removing cells from the patient, supplying
the cells with a
polynucleotide of the present invention, and returning the engineered cells to
the patient (ex
vivo therapy). Moreover, the polypeptide or polynucleotide of the present
invention can be
used as an antigen in a vaccine to raise an immune response against infectious
disease.
Galectin 11 polynucleotides or polypeptides (including galectin 11 fragments,
variants, derivatives, and anaologs, and galectin 11 agonists and antagonists
as described
herein) can be used to differentiate, proliferate, and attract cells, leading
to the regeneration of
tissues. (See, Science 276:59-87 (1997).) The regeneration of tissues could be
used to repair,
replace, or protect tissue damaged by congenital defects, trauma (wounds,
bums, incisions, or
ulcers), age, disease (e.g. osteoporosis, osteocarthritis, periodontal
disease, liver failure),
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
140
surgery, including cosmetic plastic surgery, fibrosis, reperfusion injury, or
systemic cytokine
damage.
Tissues that could be regenerated using the present invention include organs
(e.g.,
pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth,
skeletal or cardiac),
vascular (including vascular endothelium), nervous, hematopoietic, and
skeletal (bone,
cartilage, tendon, and ligament) tissue. Preferably, regeneration occurs
without or decreased
scarring. Regeneration also may include angiogenesis.
Moreover, galectin 11 polynucleotides or polypeptides (including galectin 11
fragments, variants, derivatives, and anaologs, and galectin 11 agonists and
antagonists as
to described herein) may increase regeneration of tissues difficult to heal.
For example,
increased tendon/ligament regeneration would quicken recovery time after
damage. Galectin 11
polynucleotides or polypeptides, or agonists or antagonists of the present
invention could
also be used prophylactically in an effort to avoid damage. Specific diseases
that could be
treated include of tendinitis, carpal tunnel syndrome, and other tendon or
ligament defects. A
further example of tissue regeneration of non-healing wounds includes pressure
ulcers, ulcers
associated with vascular insufficiency, surgical, and traumatic wounds.
Similarly, nerve and brain tissue could also be regenerated by using galectin
11
polynucleotides or polypeptides, or agonists or antagonists of the present
invention, to
proliferate and differentiate nerve cells. Diseases that could be treated
using this method
2o include central and peripheral nervous system diseases, neuropathies, or
mechanical and
traumatic disorders (e.g., spinal cord disorders, head trauma, cerebrovascular
disease, and
stoke). Specifically, diseases associated with peripheral nerve injuries,
peripheral neuropathy
(e.g., resulting from chemotherapy or other medical therapies), localized
neuropathies, and
central nervous system diseases (e.g., Alzheimer's disease, Parkinson's
disease, Huntington's
disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome), could all be
treated using
the galectin 11 polynucleotides or polypeptides or agonists or antagonists of
galectin 11.
Galectin 11 polynucleotides or polypeptides, or agonists or antagonists of the
present
invention, may have chemotaxis activity. A chemotaxic molecule attracts or
mobilizes cells
(e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils,
epithelial andJor
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
141
endothelial cells) to a particular site in the body, such as inflammation,
infection, or site of
hyperproliferation. The mobilized cells can then fight off andlor heal the
particular trauma or
abnormality.
Galectin 11 polynucleotides or polypeptides, or agonists or antagonists of the
present invention, may increase chemotaxic activity of particular cells. These
chemotactic
molecules can then be used to treat inflammation, infection,
hyperproliferative disorders, or
any immune system disorder by increasing the number of cells targeted to a
particular location
in the body. For example, chemotaxic molecules can be used to treat wounds and
other
trauma to tissues by attracting immune cells to the injured location.
Chemotactic molecules of
to the present invention can also attract fibroblasts, which can be used to
treat wounds.
It is also contemplated that galectin 11 polynucleotides or polypeptides, or
agonists
or antagonists of the present invention, may inhibit chemotactic activity.
These molecules
could also be used to treat disorders. Thus, galectin 11 polynucleotides or
polypeptides, or
agonists or antagonists of the present invention, could be used as an
inhibitor of chemotaxis.
Nervous system disorders, which can be treated with the galectin 11
compositions of
the invention (e.g., galectin 11 polypeptides, polynucleotides, and/or
agonists or antagonists),
include, but are not limited to, nervous system injuries, and diseases or
disorders which result
in either a disconnection of axons, a diminution or degeneration of neurons,
or demyelination.
Nervous system lesions which may be treated in a patient (including human and
non-human
2o mammalian patients) according to the invention, include but are not limited
to, the following
lesions of either the central (including spinal cord, brain) or peripheral
nervous systems: (1)
ischemic lesions, in which a lack of oxygen in a portion of the nervous system
results in
neuronal injury or death, including cerebral infarction or ischemia, or spinal
cord infarction or
ischemia; (z) traumatic lesions, including lesions caused by physical injury
or associated
z5 with surgery, for example, lesions which sever a portion of the nervous
system, or
compression injuries; (3) malignant lesions, in which a portion of the nervous
system is
destroyed or injured by malignant tissue which is either a nervous system
associated
malignancy or a malignancy derived from non-nervous system tissue; (4)
infectious lesions,
in which a portion of the nervous system is destroyed or injured as a result
of infection, for
CA 02371611 2001-10-19
WO 00/63221 PCT/USOO110714
142
example, by an abscess or associated with infection by human immunodeficiency
virus,
herpes zoster, or herpes simplex virus or with Lyme disease, tuberculosis,
syphilis; (5)
degenerative lesions, in which a portion of the nervous system is destroyed or
injured as a
result of a degenerative process including but not limited to degeneration
associated with
Parkinson's disease, Alzheimer's disease, Huntington's chorea, or amyotrophic
lateral sclerosis
(ALS); (6) lesions associated with nutritional diseases or disorders, in which
a portion of the
nervous system is destroyed or injured by a nutritional disorder or disorder
of metabolism
including but not limited to, vitamin B12 deficiency, folic acid deficiency,
Wernicke disease,
tobacco-alcohol amblyopia, Marchiafava-Bignami disease (primary degeneration
of the corpus
to callosum), and alcoholic. cerebellar degeneration; (7) neurological lesions
associated with
systemic diseases including, but not limited to, diabetes (diabetic
neuropathy, Bell's palsy),
systemic lupus erythematosus, carcinoma, or sarcoidosis; (8) lesions caused by
toxic
substances including alcohol, lead, or particular neurotoxins; and (9)
demyelinated lesions in
which a portion of the nervous system is destroyed or injured by a
demyelinating disease
including, but not limited to, multiple sclerosis, human immunodeficiency
virus-associated
myelopathy, transverse myelopathy or various etiologies, progressive
multifocal
leukoencephalopathy, and central pontine myelinolysis.
In a preferred embodiment, the galectin 11 polypeptides, polynucleotides, or
agonists
or antagonists of the present invention are used to protect neural cells from
the damaging
zo effects of cerebral hypoxia. According to this embodiment, the galectin 11
compositions of
the invention are used to treat or prevent neural cell injury associated with
cerebral hypoxia.
In one aspect of this embodiment, the galectin 11 polypeptides,
polynucleotides, or agonists
or antagonists of the invention are used to treat or prevent neural cell
injury associated with
cerebral ischemia. In another aspect of this embodiment, the galectin 11
polypeptides,
polynucleotides, or agonists or antagonists of the present invention are used
to treat or
prevent neural cell injury associated with cerebral infarction. In another
aspect of this
embodiment, the galectin 11 polypeptides, polynucleotides, or agonists or
antagonists of the
present invention are used to treat or prevent neural cell injury associated
with a stroke. In a
further aspect of this embodiment, the galectin 11 polypeptides,
polynucleotides, or agonists
CA 02371611 2001-10-19
WO 00163221 PCT/USOO110714
143
or antagonists of the present invention are used to treat or prevent neural
cell injury
associated with a heart attack.
The compositions of the invention which are useful for treating or preventing
a
nervous system disorder may be selected by testing for biological activity in
promoting the
survival or differentiation of neurons. For example, and not by way of
limitation, galectin 11
compositions of the invention which elicit any of the following effects may be
useful
according to the invention: (1) increased survival time of neurons in culture;
(2) increased
sprouting of neurons in culture or in vivo; (3) increased production of a
neuron-associated
molecule in culture or in vivo, e.g., choline acetyltransferase or
acetylcholinesterase with
to respect to motor neurons; or (4) decreased symptoms of neuron dysfunction
in vivo. Such
effects may be measured by any method known in the art. In preferred, non-
limiting
embodiments, increased survival of neurons may routinely be measured using a
method set
forth herein or otherwise known in the art, such as, for example, the method
set forth in
Arakawa et al. (J. Neurosci. 10:3507-3515 (1990)); increased sprouting of
neurons may be
detected by methods known in the art, such as, for example, the methods set
forth in
Pestronk et al. (Exp. Neurol. 70:65-82 (1980)) or Brown et al. (Ann. Rev.
Neurosci. 4:17-42
(1981)); increased production of neuron-associated molecules may be measured
by bioassay,
enzymatic assay, antibody binding, Northern blot assay, etc., using techniques
known in the
art and depending on the molecule to be measured; and motor neuron dysfunction
may be
2o measured by assessing the physical manifestation of motor neuron disorder,
e.g., weakness,
motor neuron conduction velocity, or functional disability.
In specific embodiments, motor neuron disorders that may be treated according
to the
invention include, but are not limited to, disorders such as infarction,
infection, exposure to
toxin, trauma, surgical damage, degenerative disease or malignancy that may
affect motor
neurons as well as other components of the nervous system, as well as
disorders that
selectively affect neurons such as amyotrophic lateral sclerosis, and
including, but not limited
to, progressive spinal muscular atrophy, progressive bulbar palsy, primary
lateral sclerosis,
infantile and juvenile muscular atrophy, progressive bulbar paralysis of
childhood (Fazio-
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
144
Londe syndrome), poliomyelitis and the post polio syndrome, and Hereditary
Motorsensory
Neuropathy (Charcot-Marie-Tooth Disease).
Additional examples of neurologic diseases which can be treated or detected
with
polynucleotides, polypeptides, agonists, and/or antagonists of the present
invention include
brain diseases, such as metabolic brain diseases which includes
phenylketonuria such as
maternal phenylketonuria, pyruvate carboxylase deficiency, pyruvate
dehydrogenase complex
deficiency, Wernicke's Encephalopathy, brain edema, brain neoplasms such as
cerebellar
neoplasms which include infratentorial neoplasms, cerebral ventricle neoplasms
such as
choroid plexus neoplasms, hypothalamic neoplasms, supratentorial neoplasms,
caravan
to disease, cerebellar diseases such as cerebellar~ataxia which include
spinocerebellar degeneration
such as ataxia telangiectasia, cerebellar dyssynergia, Friederich's Ataxia,
Machado-Joseph
Disease, olivopontocerebellar atrophy, cerebellar neoplasms such as
infratentorial neoplasms,
diffuse cerebral sclerosis such as encephalitis periaxialis, globoid cell
leukodystrophy,
metachromatic leukodystrophy and subacute sclerosing panencephalitis,
cerebrovascular
disorders (such as carotid artery diseases which include carotid artery
thrombosis, carotid
stenosis and Moyamoya Disease, cerebral amyloid angiopathy, cerebral aneurysm,
cerebral
anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformations,
cerebral artery diseases,
cerebral embolism and thrombosis such as carotid artery thrombosis, sinus
thrombosis and
Wallenberg's Syndrome, cerebral hemorrhage such as epidural hematoma, subdural
hematoma
2o and subarachnoid hemorrhage, cerebral infarction, cerebral ischemia such as
transient cerebral
ischemia, Subclavian Steal Syndrome and vertebrobasilar insufficiency,
vascular dementia such
as multi-infarct dementia, periventricular leukomalacia, vascular headache
such as cluster
headache, migraine, dementia such as AIDS Dementia Complex, presenile dementia
such as
Alzheimer's Disease and Creutzfeldt-Jakob Syndrome, senile dementia such as
Alzheimer's
Disease and progressive supranuclear palsy, vascular dementia such as mufti-
infarct dementia,
encephalitis which include encephalitis periaxialis, viral encephalitis such
as epidemic
encephalitis, Japanese Encephalitis, St. Louis Encephalitis, tick-borne
encephalitis and West
Nile Fever, acute disseminated encephalomyelitis, meningoencephalitis such as
uveomeningoencephalitic syndrome, Postencephalitic Parkinson Disease and
subacute
CA 02371611 2001-10-19
WO 00/63221 PCT/LTS00/10714
145
sclerosing panencephalitis, encephalomalacia such as periventricular
leukomalacia, epilepsy
such as generalized epilepsy which includes infantile spasms, absence
epilepsy, myoclonic
epilepsy which includes MERRF Syndrome, tonic-clonic epilepsy, partial
epilepsy such as
complex partial epilepsy, frontal lobe epilepsy and temporal lobe epilepsy,
post-traumatic
epilepsy, status epilepticus such as Epilepsia Partialis Continua,
Hallervorden-Spatz
Syndrome, hydrocephalus such as Dandy-Walker Syndrome and normal pressure
hydrocephalus, hypothalamic diseases such as hypothalamic neoplasms, cerebral
malaria,
narcolepsy which includes cataplexy, bulbar poliomyelitis, cerebri
pseudotumor, Rett
Syndrome, Reye's Syndrome, thalamic diseases, cerebral toxoplasmosis,
intracranial
to tuberculoma and Zellweger Syndrome, central nervous system infections such
as AIDS
Dementia Complex, Brain Abscess, subdural empyema, encephalomyelitis such as
Equine
Encephalomyelitis, Venezuelan Equine Encephalomyelitis, Necrotizing
Hemorrhagic
Encephalomyelitis, Visna, cerebral malaria, meningitis such as arachnoiditis,
aseptic
meningtitis such as viral meningtitis which includes lymphocytic
choriomeningitis. Bacterial
meningtitis which includes Haemophilus Meningtitis, Listeria Meningtitis,
Meningococcal
Meningtitis such as Waterhouse-Friderichsen Syndrome, Pneumococcal Meningtitis
and
meningeal tuberculosis, fungal meningitis such as Cryptococcal Meningtitis,
subdural
effusion, meningoencephalitis such as uvemeningoencephalitic syndrome,
myelitis such as
transverse myelitis, neurosyphilis such as tabes dorsalis, poliomyelitis which
includes bulbar
poliomyelitis and postpoliomyelitis syndrome, prion diseases (such as
Creutzfeldt-Jakob
Syndrome, Bovine Spongiform Encephalopathy, Gerstmann-Straussler Syndrome,
Kuru,
Scrapie) cerebral toxoplasmosis, central nervous system neoplasms such as
brain neoplasms
that include cerebellear neoplasms such as infratentorial neoplasms, cerebral
ventricle
neoplasms such as choroid plexus neoplasms, hypothalamic neoplasms and
supratentorial
2s neoplasms, meningeal neoplasms, spinal cord neoplasms which include
epidural neoplasms,
demyelinating diseases such as Canavan Diseases, diffuse cerebral sceloris
which includes
adrenoleukodystrophy, encephalitis periaxialis, globoid cell leukodystrophy,
diffuse cerebral
sclerosis such as metachromatic leukodystrophy, allergic encephalomyelitis,
necrotizing
hemorrhagic encephalomyelitis, progressive multifocal leukoencephalopathy,
multiple
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
146
sclerosis, central pontine myelinolysis, transverse myelitis, neuromyelitis
optics, Scrapie,
Swayback, Chronic Fatigue Syndrome, Visna, High Pressure Nervous Syndrome,
Meningism,
spinal cord diseases such as amyotonia congenita, amyotrophic lateral
sclerosis, spinal
muscular atrophy such as Werdnig-Hoffinann Disease, spinal cord compression,
spinal cord
neoplasms such as epidural neoplasms, syringomyelia, Tabes Dorsalis, Stiff Man
Syndrome,
mental retardation such as Angelinan Syndrome, Cri-du-Chat Syndrome, De
Lange's
Syndrome, Down Syndrome, Gangliosidoses such as gangliosidoses G(M1), Sandhoff
Disease, Tay-Sachs Disease, Hartnup Disease, homocystinuria, Laurence-Moon-
Biedl
Syndrome, Lesch-Nyhan Syndrome, Maple Syrup Urine Disease, mucolipidosis such
as
to fucosidosis, neuronal ceroid-lipofuscinosis, oculocerebrorenal syndrome,
phenylketonuria
such as maternal phenylketonuria, Prader-Willi Syndrome, Rett Syndrome,
Rubinstein-Taybi
Syndrome, Tuberous Sclerosis, WAGR Syndrome, nervous system abnormalities such
as
holoprosencephaly, neural tube defects such as anencephaly which includes
hydrangencephaly, Arnold-Chairi Deformity, encephalocele, meningocele,
meningomyelocele,
spinal dysraphism such as spins bifida cystica and spins bifida occults,
hereditary motor and
sensory neuropathies which include Charcot-Marie Disease, Hereditary optic
atrophy,
Refsum's Disease, hereditary spastic paraplegia, Werdnig-Hoffmann Disease,
Hereditary
Sensory and Autonomic Neuropathies such as Congenital Analgesia and Familial
Dysautonomia, Neurologic manifestations (such as agnosia that include
Gerstmann's
2o Syndrome, Amnesia such as retrograde amnesia, apraxia, neurogenic bladder,
cataplexy,
communicative disorders such as hearing disorders that includes deafness,
partial hearing loss,
loudness recruitment and tinnitus, language disorders such as aphasia which
include agraphia,
anomia, broca aphasia, and Wemicke Aphasia, Dyslexia such as Acquired
Dyslexia, language
development disorders, speech disorders such as aphasia which includes anomia,
broca
aphasia and Wernicke Aphasia, articulation disorders, communicative disorders
such as
speech disorders which include dysarthria, echolalia, mutism and stuttering,
voice disorders
such as aphonia and hoarseness, decerebrate state, delirium, fasciculation,
hallucinations,
meningism, movement disorders such as angelman syndrome, ataxia, athetosis,
chorea,
dystonia, hypokinesia, muscle hypotonia, myoclonus, tic, torticollis and
tremor, muscle
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
147
hypertonia such as muscle rigidity such as stiff man syndrome, muscle
spasticity, paralysis
such as facial paralysis which includes Herpes Zoster Oticus, Gastroparesis,
Hemiplegia,
ophthalmoplegia such as diplopia, Duane's Syndrome, Homer's Syndrome, Chronic
progressive external ophthalmoplegia such as Kearns Syndrome, Bulbar
Paralysis, Tropical
Spastic Paraparesis, Paraplegia such as Brown-Sequard Syndrome, quadriplegia,
respiratory
paralysis and vocal cord paralysis, paresis, phantom limb, taste disorders
such as ageusia and
dysgeusia, vision disorders such as amblyopia, blindness, color vision
defects, diplopia,
hemianopsia, scotoma and subnormal vision, sleep disorders such as hypersomnia
which
includes Kleine-Levin Syndrome, insomnia, and somnambulism, spasm such as
trismus,
l0 unconsciousness such as coma, persistent vegetative state and syncope and
vertigo,
neuromuscular diseases such as amyotonia congenita, amyotrophic lateral
sclerosis, Lambert-
Eaton Myasthenic Syndrome, motor neuron disease, muscular atrophy such as
spinal
muscular atrophy, Charcot-Marie Disease and Werdnig-Hoffmann Disease,
Postpoliomyelitis Syndrome, Muscular Dystrophy, Myasthenia Gravis, Myotonia
Atrophica, Myotonia Confenita, Nemaline Myopathy, Familial Periodic Paralysis,
Multiplex
Paramyloclonus, Tropical Spastic Paraparesis and Stiff Man Syndrome,
peripheral nervous
system diseases such as acrodynia, amyloid neuropathies, autonomic nervous
system
diseases such as Adie's Syndrome, Barre-Lieou Syndrome, Familial Dysautonomia,
Horner's
Syndrome, Reflex Sympathetic Dystrophy and Shy-Drager Syndrome, Cranial Nerve
Diseases such as Acoustic Nerve Diseases such as Acoustic Neuroma which
includes
Neurofibromatosis 2, Facial Nerve Diseases such as Facial Neuralgia,Melkersson-
Rosenthal
Syndrome, ocular motility disorders which includes amblyopia, nystagmus,
oculomotor nerve
paralysis, ophthalmoplegia such as Duane's Syndrome, Horner's Syndrome,
Chronic
Progressive External Ophthalmoplegia which includes Kearns Syndrome,
Strabismus such as
Esotropia and Exotropia, Oculomotor Nerve Paralysis, Optic Nerve Diseases such
as Optic
Atrophy which includes Hereditary Optic Atrophy, Optic Disk Drusen, Optic
Neuritis such
as Neuromyelitis Optica, Papilledema, Trigeminal Neuralgia, Vocal Cord
Paralysis,
Demyelinating Diseases such as Neuromyelitis Optica and Swayback, Diabetic
neuropathies
such as diabetic foot, nerve compression syndromes such as carpal tunnel
syndrome, tarsal
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
148
tunnel syndrome, thoracic outlet syndrome such as cervical rib syndrome, ulnar
nerve
compression syndrome, neuralgia such as causalgia, cervico-brachial neuralgia,
facial neuralgia
and trigeminal neuralgia, neuritis such as experimental allergic neuritis,
optic neuritis,
polyneuritis, polyradiculoneuritis and radiculities such as polyradiculitis,
hereditary motor
and sensory neuropathies such as Charcot-Marie Disease, Hereditary Optic
Atrophy,
Refsum's Disease, Hereditary Spastic Paraplegia and Werdnig-Hoffmann Disease,
Hereditary
Sensory and Autonomic Neuropathies which include Congenital Analgesia and
Familial
Dysautonomia, POEMS Syndrome, Sciatica, Gustatory Sweating and Tetany).
In accordance with yet a further aspect of the present invention, there is
provided a
l0 process for utilizing galectin 11 polynucleotides or polypeptides, as well
as agonists or
antagonists of galectin 11, for therapeutic purposes, for example, to
stimulate epithelial cell
proliferation and basal keratinocytes for the purpose of wound healing, and to
stimulate hair
follicle production and healing of dermal wounds. Galectin 11 polynucleotides
or
polypeptides, as well as agonists or antagonists of galectin 11, may be
clinically useful in
stimulating wound healing including surgical wounds, excisional wounds, deep
wounds
involving damage of the dermis and epidermis, eye tissue wounds, dental tissue
wounds, oral
cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial
ulcers, venous stasis
ulcers, burns resulting from heat exposure or chemicals, and other abnormal
wound healing
conditions such as uremia, malnutrition, vitamin deficiencies and
complications associted with
systemic treatment with steroids, radiation therapy and antineoplastic drugs
and
antimetabolites. Galectin 11 polynucleotides or polypeptides, as well as
agonists or
antagonists of galectin 11, could be used to promote dermal reestablishment
subsequent to
dermal loss
Galectin 11 polynucleotides or polypeptides, as well as agonists or
antagonists of
galectin 11, could be used to increase the adherence of skin grafts to a wound
bed and to
stimulate re-epithelialization from the wound bed. The following are types of
grafts that
galectin 11 polynucleotides or polypeptides, agonists or antagonists of
galectin 11, could be
used to increase adherence to a wound bed: autografts, artificial skin,
allografts, autodermic
graft, autoepdennic grafts, avacular grafts, Blair-Brown grafts, bone graft,
brephoplastic
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
149
grafts, cutis graft, delayed graft, dermic graft, epidermic graft, fascia
graft, full thickness graft,
heterologous graft, xenogaft, homologous graft, hyperplastic graft, lamellar
graft, mesh graft,
mucosal graft, Oilier-Thiersch graft, omenpal graft, patch graft, pedicle
graft, penetrating graft,
split skin graft, thick split graft. Galectin 11 polynucleotides or
polypeptides, as well as
agonists or antagonists of galectin 11, can be used to promote skin strength
and to improve
the appearance of aged skin.
It is believed that galectin 1 I polynucleotides or polypeptides, as well as
agonists or
antagonists of galectin 1 l, will also produce changes in hepatocyte
proliferation, and epithelial
cell proliferation in the lung, breast, pancreas, stomach, small intesting,
and large intestine.
to Galectin l l .polynucleotides or polypeptides, as well as agonists or
antagonists of galectin 11,
could promote proliferation of epithelial cells such as sebocytes, hair
follicles, hepatocytes,
type II pneumocytes, mucin-producing goblet cells, and other epithelial cells
and their
progenitors contained within the skin, lung, liver, and gastrointestinal
tract. Galectin 11
polynucleotides or polypeptides, agonists or antagonists of galectin 11, may
promote
proliferation of endothelial cells, keratinocytes, and basal keratinocytes.
Galectin 11 polynucleotides or polypeptides, as well as agonists or
antagonists of
galectin 11, could also be used to reduce the side effects of gut toxicity
that result from
radiation, chemotherapy treatments or viral infections. Galectin 11
polynucleotides or
polypeptides, as well as agonists or antagonists of galectin 11, may have a
cytoprotective
effect on the small intestine mucosa. Galectin 11 polynucleotides or
polypeptides, as well as
agonists or antagonists of galectin 11, may also stimulate healing of
mucositis (mouth ulcers)
that result from chemotherapy and viral infections.
Galectin 11 polynucleotides or polypeptides, as well as agonists or
antagonists of
galectin 11, could further be used in full regeneration of skin in full and
partial thickness skin
defects, including burns, (i.e., repopulation of hair follicles, sweat glands,
and sebaceous
glands), treatment of other skin defects such as psoriasis. Galectin 11
polynucleotides or
polypeptides, as well as agonists or antagonists of galectin 11, could be used
to treat
epidermolysis bullosa, a defect in adherence of the epidermis to the
underlying dennis which
results in frequent, open and painful blisters by accelerating
reepithelialization of these
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
150
lesions. Galectin 11 polynucleotides or polypeptides, as well as agonists or
antagonists of
galectin 11, could also be used to treat gastric and doudenal ulcers and help
heal by scar
formation of the mucosal lining and regeneration of glandular mucosa and
duodenal mucosal
lining more rapidly. Inflamamatory bowel diseases, such as Crohn's disease and
ulcerative
colitis, are diseases which result in destruction of the mucosal surface of
the small or large
intestine, respectively. Thus, galectin 11 polynucleotides or polypeptides, as
well as
agonists or antagonists of galectin 11, could be used to promote the
resurfacing of the mucosal
surface to aid more rapid healing and to prevent progression of inflammatory
bowel disease.
Treatment with galectin 11 polynucleotides or polypeptides, agonists or
antagonists of
1o galectin 1 l, is expected to have a significant effect on the production of
mucus throughout the
gastrointestinal tract and could be used to protect the intestinal mucosa from
injurious
substances that are ingested or following surgery. Galectin 11 polynucleotides
or
polypeptides, as well as agonists or antagonists of galectin 11, could be used
to treat diseases
associate with the under expression of galectin 11.
Moreover, galectin 11 polynucleotides or polypeptides, as well as agonists or
antagonists of galectin 11, could be used to prevent and heal damage to the
lungs due to
various pathological states. A growth factor such as galectin 11
polynucleotides or
polypeptides, as well as agonists or antagonists of galectin 11, which could
stimulate
proliferation and differentiation and promote the repair of alveoli and
brochiolar epithelium to
2o prevent or treat acute or chronic lung damage. For example, emphysema,
which results in the
progressive loss of aveoli, and inhalation injuries, i.e., resulting from
smoke inhalation and
burns, that cause necrosis of the bronchiolar epithelium and alveoli could be
effectively
treated using galectin 11 polynucleotides or polypeptides, agonists or
antagonists of galectin
11. Also, galectin 11 polynucleotides or polypeptides, as well as agonists or
antagonists of
galectin 11, could be used to stimulate the proliferation of and
differentiation of type II
pneumocytes, which may help treat or prevent disease such as hyaline membrane
diseases,
such as infant respiratory distress syndrome and bronchopulmonary displasia,
in premature
infants.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
151
Galectin 11 polynucleotides or polypeptides, as well as agonists or
antagonists of
galectin 11, could stimulate the proliferation and differentiation of
hepatocytes and, thus,
could be used to alleviate or treat liver diseases and pathologies such as
fulminant liver failure
caused by cirrhosis, liver damage caused by viral hepatitis and toxic
substances (i.e.,
acetaminophen, carbon tetraholoride and other hepatotoxins known in the art).
In addition, galectin 11 polynucleotides or polypeptides, as well as agonists
or
antagonists of galectin 11, could be used treat or prevent the onset of
diabetes mellitus. In
patients with newly diagnosed Types I and II diabetes, where some islet cell
function
remains, galectin 11 polynucleotides or polypeptides, as well as agonists or
antagonists of
to galectin 11, could be used to maintain the islet function so as to
alleviate, delay or prevent
permanent manifestation of the disease. Also, galectin 1 I polynucleotides or
polypeptides,
as well as agonists or antagonists of galectin 11, could be used as an
auxiliary in islet cell
transplantation to improve or promote islet cell function.
Galectin 11 polynucleotides or polypeptides, or agonists or antagonists of
galectin 11,
encoding galectin 11 may be used to treat cardiovascular disorders, including
peripheral artery
disease, such as limb ischemia.
Cardiovascular disorders include cardiovascular abnormalities, such as arterio-
arterial
fistula, arteriovenous fistula, cerebral arteriovenous malformations,
congenital heart defects,
pulmonary atresia, and Scimitar Syndrome. Congenital heart defects include
aortic
coarctation, cor triatriatum, coronary vessel anomalies, crisscross heart,
dextrocardia, patent
ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left
heart syndrome,
levocardia, tetralogy of fallot, transposition of great vessels, double outlet
right ventricle,
tricuspid atresia, persistent truncus arteriosus, and heart septal defects,
such as
aortopulmonary septal defect, endocardial cushion defects, Lutembacher's
Syndrome, trilogy
of Fallot, ventricular heart septal defects.
Cardiovascular disorders also include heart disease, such as arrhythmias,
carcinoid
heart disease, high cardiac output, low cardiac output, cardiac tamponade,
endocarditis
(including bacterial), heart aneurysm, cardiac arrest, congestive heart
failure, congestive
cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy,
congestive
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
152
cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy,
post-infarction
heart rupture, ventricular septal rupture, heart valve diseases, myocardial
diseases, myocardial
ischemia, pericardial effusion, pericarditis (including constrictive and
tuberculous),
pneumopericardium, postpericardiotomy syndrome, pulmonary heart disease,
rheumatic
heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy
complications,
Scimitar Syndrome, cardiovascular syphilis, and cardiovascular tuberculosis.
Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter,
bradycardia,
extrasystole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block,
long QT
syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation
l0 syndrome, Wolff Parkinson-White syndrome, sick sinus syndrome,
tachycardias, and
ventricular fibrillation. Tachycardias include paroxysmal tachycardia,
supraventricular
tachycardia, accelerated idioventricular rhythm, atrioventricular nodal
reentry tachycardia,
ectopic atrial tachycardia, ectopic functional tachycardia, sinoatrial nodal
reentry tachycardia,
sinus tachycardia, Torsades de Pointes, and ventricular tachycardia.
Heart valve disease include aortic valve insufficiency, aortic valve stenosis,
hear
murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve
prolapse, mural valve
insufficiency, mural valve stenosis, pulmonary atresia, pulmonary valve
insufficiency,
pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency,
and tricuspid valve
stenosis.
Myocardial diseases include alcoholic cardiomyopathy, congestive
cardiomyopathy,
hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary
subvalvular stenosis,
restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis,
endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion injury, and
myocarditis.
Myocardial ischemias include coronary disease, such as angina pectoris,
coronary
aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm,
myocardial
infarction and myocardial stunning.
Cardiovascular diseases also include vascular diseases such as aneurysms,
angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease,
Klippel-
Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic edema, aortic
diseases,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00l10714
153
Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive
diseases, arteritis,
enarteritis, polyarteritis nodosa, cerebrovascular disorders, diabetic
angiopathies, diabetic
retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic veno-
occlusive
disease, hypertension, hypotension, ischemia, peripheral vascular diseases,
phlebitis,
pulmonary veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal
vein
occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia,
atacia
telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose
veins, varicose ulcer,
vasculitis, and venous insufficiency.
Aneurysms include dissecting aneurysms, false aneurysms, infected aneurysms,
ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms,
heart
aneurysms, and iliac aneurysms.
Arterial occlusive diseases include arteriosclerosis, intermittent
claudication, carotid
stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya
disease, renal
artery obstruction, retinal artery occlusion, and thromboangiitis obliterans.
Cerebrovascular disorders include carotid artery diseases, cerebral amyloid
angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis,
cerebral
arteriovenous malformation, cerebral artery diseases, cerebral embolism and
thrombosis,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral
hemorrhage,
epidural hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral
infarction,
2o cerebral ischemia (including transient), subclavian steal syndrome,
periventricular
leukomalacia, vascular headache, cluster headache, migraine, and
vertebrobasilar insufficiency.
Embolisms include air embolisms, amniotic fluid embolisms, cholesterol
embolisms,
blue toe syndrome, fat embolisms, pulmonary embolisms, and thromoboembolisms.
Thrombosis include coronary thrombosis, hepatic vein thrombosis, retinal vein
occlusion,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and
thrombophlebitis.
Ischemia includes cerebral ischemia, ischemic colitis, compartment syndromes,
anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and
peripheral
limb ischemia. Vasculitis includes aortitis, arteritis, Behcet's Syndrome,
Churg-Strauss
Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
154
hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic cutaneous
vasculitis, and
Wegener's granulomatosis.
Galectin 11 polynucleotides or polypeptides, or agonists or antagonists of
galectin 11,
are especially effective for the treatment of critical limb ischemia and
coronary disease.
Galectin 11 polypeptides may be administered using any method known in the
art,
including, but not limited to, direct needle injection at the delivery site,
intravenous injection,
topical administration, catheter infusion, biolistic injectors, particle
accelerators, gelfoam
sponge depots, other commercially available depot materials, osmotic pumps,
oral or
suppositorial solid pharmaceutical formulations, decanting or topical
applications during
to surgery, aerosol delivery. Such methods are known in the art. Galectin 11
polypeptides may
be administered as part of a Therapeutic, described in more detail below.
Methods of
delivering galectin 11 polynucleotides are described in more detail herein.
The naturally occurnng balance between endogenous stimulators and inhibitors
of
angiogenesis is one in which inhibitory influences predominate. Rastinejad et
al., Cell 56:345
355 (1989). In those rare instances in which neovascularization occurs under
normal
physiological conditions, such as wound healing, organ regeneration, embryonic
development,
and female reproductive processes, angiogenesis is stringently regulated and
spatially and
temporally delimited. Under conditions of pathological angiogenesis such as
that
characterizing solid tumor growth, these regulatory controls fail. Unregulated
angiogenesis
2o becomes pathologic and sustains progression of many neoplastic and non-
neoplastic diseases.
A number of serious diseases are dominated by abnormal neovascularization
including solid
tumor growth and metastases, arthritis, some types of eye disorders, and
psoriasis. See, e.g.,
reviews by Moses et al., Biotech. 9:630-634 (1991); Folkman et al., N. Engl.
J. Med.,
333:1757-1763 (1995); Auerbach et al., J. Microvasc. Res. 29:401-411 (1985);
Folkman,
Advances in Cancer Research, eds. Klein and Weinhouse, Academic Press, New
York, pp.
175-203 (1985); Patz, Am. J. Opthalmol. 94:715-743 (1982); and Folkman et al.,
Science
221:719-725 (1983). In a number of pathological conditions, the process of
angiogenesis
contributes to the disease state. For example, significant data have
accumulated which suggest
that the growth of solid tumors is dependent on angiogenesis. Folkman and
Klagsbrun,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
155
Science 235:442-447 (1987).
The present invention provides for treatment of diseases or disorders
associated with
neovascularization by administration of the polynucleotides andlor
polypeptides of the
invention, as well as agonists or antagonists of the present invention.
Malignant and
metastatic conditions which can be treated with the polynucleotides and
polypeptides, or
agonists or antagonists of the invention include, but are not limited to,
malignancies, solid
tumors, and cancers described herein and otherwise known in the art (for a
review of such
disorders, see Fishman et al., Medicine, 2d Ed., J. B. Lippincott Co.,
Philadelphia
(1985)).Thus, the present invention provides a method of treating an
angiogenesis-related
l0 disease and/or disorder, comprising administering to an individual in need
thereof a
therapeutically effective amount of a polynucleotide, polypeptide, antagonist
and/or agonist
of the invention. For example, polynucleotides, polypeptides, antagonists
and/or agonists of
the present invention may be utilized in a variety of additional methods in
order to
therapeutically treat a cancer or tumor. Cancers which may be treated with
polynucleotides,
polypeptides, antagonists and/or agonists of the present invention include,
but are not limited
to solid tumors, including prostate, lung, breast, ovarian, stomach, pancreas,
larynx,
esophagus, testes, liver, parotid, biliary tract, colon, rectum, cervix,
uterus, endometrium,
kidney, bladder, thyroid cancer; primary tumors and metastases; melanomas;
glioblastoma;
Kaposi's sarcoma; leiomyosarcoma; non- small cell lung cancer; colorectal
cancer; advanced
malignancies; and blood born tumors such as leukemias. For example,
polynucleotides,
polypeptides, antagonists and/or agonists of the present invention may be
delivered topically,
in order to treat cancers such as skin cancer, head and neck tumors, breast
tumors, and
Kaposi's sarcoma.
Within yet other aspects, polynueleotides, polypeptides, antagonists and/or
agonists
of the present invention may be utilized to treat superficial forms of bladder
cancer by, for
example, intravesical administration. Polynucleotides, polypeptides,
antagonists and/or
agonists of the present invention may be delivered directly into the tumor, or
near the tumor
site, via injection or a catheter. Of course, as the artisan of ordinary skill
will appreciate, the
appropriate mode of administration will vary according to the cancer to be
treated. Other
CA 02371611 2001-10-19
WO 00/63221 PCT/C1S00/10714
156
modes of delivery are discussed herein.
Polynucleotides, polypeptides, antagonists and/or agonists of the present
invention
may be useful in treating other disorders, besides cancers, which involve
angiogenesis. These
disorders include, but are not limited to: benign tumors, for example
hemangiomas, acoustic
neuromas, neurofibromas, trachomas, and pyogenic granulomas; artheroscleric
plaques; ocular
angiogenic diseases, for example, diabetic retinopathy, retinopathy of
prematurity, macular
degeneration, corneal graft rejection, neovascular glaucoma, retrolental
fibroplasia, rubeosis,
retinoblastoma, uvietis and Pterygia (abnormal blood vessel growth) of the
eye; rheumatoid
arthritis; psoriasis; delayed wound healing; endometriosis; vasculogenesis;
granulations;
to hypertrophic scars (keloids); nonunion fractures; scleroderma; trachoma;
vascular adhesions;
myocardial angiogenesis; coronary collaterals; cerebral collaterals;
arteriovenous
malformations; ischemic limb angiogenesis; Osler-Webber Syndrome; plaque
neovascularization; telangiectasia; hemophiliac joints; angiofibroma;
fibromuscular dysplasia;
wound granulation; Crohn's disease; and atherosclerosis.
For example, within one aspect of the present invention, methods are provided
for
treating hypertrophic scars and keloids, comprising the step of administering
a
polynucleotide, polypeptide, antagonist and/or agonist of the invention to a
hypertrophic
scar or keloid.
Within one embodiment of the polynucleotides, polypeptides, antagonists and/or
agonists of the present invention are injected directly into a hypertrophic
scar or keloid, in
order to prevent the progression of these lesions. This therapy is of
particular value in the
prophylactic treatment of conditions which are known to result in the
development of
hypertrophic scars and keloids (e.g., burns), and is preferably initiated
after the proliferative
phase has had time to progress (approximately 14 days after the initial
injury), but before
2s hypertrophic scar or keloid development. As noted above, the present
invention also
provides methods for treating neovascular diseases of the eye, including for
example, corneal
neovascularization, neovascular glaucoma, proliferative diabetic retinopathy,
retrolental
fibroplasia and macular degeneration.
Moreover, Ocular disorders associated with neovascularization which can be
treated
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
157
with the polynucleotides and polypeptides of the present invention (including
agonists and/or
antagonists) include, but are not limited to: neovascular glaucoma, diabetic
retinopathy,
retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of prematurity
macular
degeneration, corneal graft neovascularization, as well as other eye
inflammatory diseases,
ocular tumors and diseases associated with choroidal or iris
neovascularization. See, e.g.,
reviews by Waltman et al., Am. J. Ophthal. 85:704-710 (1978) and Gartner et
al., Surv.
Ophthal. 22:291-312 (1978).
Thus, within one aspect of the present invention methods are provided for
treating
neovascular diseases of the eye such as corneal neovascularization (including
corneal graft
to neovascularization), comprising the step of administering to a patient a
therapeutically
effective amount of a compound (as described above) to the cornea, such that
the formation of
blood vessels is inhibited. Briefly, the cornea is a tissue which normally
lacks blood vessels.
In certain pathological conditions however, capillaries may extend into the
cornea from the
pericorneal vascular plexus of the limbus. When the cornea becomes
vascularized, it also
becomes clouded, resulting in a decline in the patient's visual acuity. Visual
loss may become
complete if the cornea completely opacitates. A wide variety of disorders can
result in
corneal neovascularization, including for example, corneal infections (e.g.,
trachoma, herpes
simplex keratitis, leishmaniasis and onchocerciasis), immunological processes
(e.g., graft
rejection and Stevens-Johnson's syndrome), alkali burns, trauma, inflammation
(of any cause),
2o toxic and nutritional deficiency states, and as a complication of wearing
contact lenses.
Within particularly preferred embodiments of the invention, may be prepared
for
topical administration in saline (combined with any of the preservatives and
antimicrobial
agents commonly used in ocular preparations), and administered in eyedrop
form. The
solution or suspension may be prepared in its pure form and administered
several times daily.
Alternatively, anti-angiogenic compositions, prepared as described above, may
also be
administered directly to the cornea. Within preferred embodiments, the anti-
angiogenic
composition is prepared with a muco-adhesive polymer which binds to cornea.
Within
further embodiments, the anti-angiogenic factors or anti-angiogenic
compositions may be
utilized as an adjunct to conventional steroid therapy. Topical therapy may
also be useful
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
158
prophylactically in corneal lesions which are known to have a high probability
of inducing an
angiogenic response (such as chemical burns). In these instances the
treatment, likely in
combination with steroids, may be instituted immediately to help prevent
subsequent
complications.
Within other embodiments, the compounds described above may be injected
directly
into the corneal stroma by an ophthalmologist under microscopic guidance. The
preferred site
of injection may vary with the morphology of the individual lesion, but the
goal of the
administration would be to place the composition at the advancing front of the
vasculature
(i.e., interspersed between the blood vessels and the normal cornea). In most
cases this would
l0 involve perilimbic corneal injection to "protect" the cornea from the
advancing blood vessels.
This method may also be utilized shortly after a corneal insult in order to
prophylactically
prevent corneal neovascularization. In this situation the material could be
injected in the
perilimbic cornea interspersed between the corneal lesion and its undesired
potential limbic
blood supply. Such methods may also be utilized in a similar fashion to
prevent capillary
invasion of transplanted corneas. In a sustained-release form injections might
only be required
2-3 times per year. A steroid could also be added to the injection solution to
reduce
inflammation resulting from the injection itself.
Within another aspect of the present invention, methods are provided for
treating
neovascular glaucoma, comprising the step of administering to a patient a
therapeutically
effective amount of a polynucleotide, polypeptide, antagonist and/or agonist
of the present
invention to the eye, such that the formation of blood vessels is inhibited.
In one
embodiment, the compound may be administered topically to the eye in order to
treat early
forms of neovascular glaucoma. Within other embodiments, the compound may be
implanted
by injection into the region of the anterior chamber angle. Within other
embodiments, the
compound may also be placed in any location such that the compound is
continuously
released into the aqueous humor. Within another aspect of the present
invention, methods are
provided for treating proliferative diabetic retinopathy, comprising the step
of administering
to a patient a therapeutically effective amount of a polynucleotide,
polypeptide, antagonist
and/or agonist to the eyes, such that the formation of blood vessels is
inhibited.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
159
Within particularly preferred embodiments of the invention, proliferative
diabetic
retinopathy may be treated by injection into the aqueous humor or the
vitreous, in order to
increase the local concentration of the polynucleotide, polypeptide,
antagonist and/or agonist
in the retina. Preferably, this treatment should be initiated prior to the
acquisition of severe
disease requiring photocoagulation.
Within another aspect of the present invention, methods are provided for
treating
retrolental fibroplasia, comprising the step of administering to a patient a
therapeutically
effective amount of a polynucleotide, polypeptide, antagonist and/or agonist
of the present
invention to the eye, such that the formation of blood vessels is inhibited.
The compound
to may be administered topically, via intravitreous injection and/or via
intraocular implants.
Additionally, disorders which can be treated with the polynucleotides,
polypeptides,
agonists and/or agonists of the present invention include, but are not limited
to, hemangioma,
arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound
healing,
granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osler-
Weber
syndrome, pyogenic granuloma, scleroderma, trachoma, and vascular adhesions.
Moreover, disorders and/or states, which can be treated with be treated with
the the
polynucleotides, polypeptides, agonists and/or agonists of the present
invention include, but
are not limited to, solid tumors, blood born tumors such as leukemias, tumor
metastasis,
Kaposi's sarcoma, benign tumors, for example hemangiomas, acoustic neuromas,
neurofibromas, trachomas, and pyogenic granulomas, rheumatoid arthritis,
psoriasis, ocular
angiogenic diseases, for example, diabetic retinopathy, retinopathy of
prematurity, macular
degeneration, corneal graft rejection, neovascular glaucoma, retrolental
fibroplasia, rubeosis,
retinoblastoma, and uvietis, delayed wound healing, endometriosis,
vascluogenesis,
granulations, hypertrophic scars (keloids), nonunion fractures, scleroderma,
trachoma,
vascular adhesions, myocardial angiogenesis, coronary collaterals, cerebral
collaterals,
arteriovenous malformations, ischemic limb angiogenesis, Osler-Webber
Syndrome, plaque
neovascularization, telangiectasia, hemophiliac joints, angiofibroma
fibromuscular dysplasia,
wound granulation, Crohn's disease, atherosclerosis, birth control agent by
preventing
vascularization required for embryo implantation controlling menstruation,
diseases that have
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
160
angiogenesis as a pathologic consequence such as cat scratch disease (Rochele
minalia
quintosa), ulcers (Helicobacter pylori), Bartonellosis and bacillary
angiomatosis.
In one aspect of the birth control method, an amount of the compound
sufficient to
block embryo implantation is administered before or after intercourse and
fertilization have
occurred, thus providing an effective method of birth control, possibly a
"morning after"
method. Polynucleotides, polypeptides, agonists and/or agonists of the present
invention
may also be used in controlling menstruation or administered as either a
peritoneal lavage fluid
or for peritoneal implantation in the treatment of endometriosis.
Polynucleotides, polypeptides, agonists and/or agonists of the present
invention may
be incorporated into surgical sutures in order to prevent stitch granulomas.
Polynucleotides, polypeptides, agonists andlor agonists of the present
invention may
be utilized in a wide variety of surgical procedures. For example, within one
aspect of the
present invention a compositions (in the form of, for example, a spray or
film) may be
utilized to coat or spray an area prior to removal of a tumor, in order to
isolate normal
surrounding tissues from malignant tissue, and/or to prevent the spread of
disease to
surrounding tissues. Within other aspects of the present invention,
compositions (e.g., in the
form of a spray) may be delivered via endoscopic procedures in order to coat
tumors, or
inhibit angiogenesis in a desired locale. Within yet other aspects of the
present invention,
surgical meshes which have been coated with anti- angiogenic compositions of
the present
invention may be utilized in any procedure wherein a surgical mesh might be
utilized. For
example, within one embodiment of the invention a surgical mesh laden with an
anti-
angiogenic composition may be utilized during abdominal cancer resection
surgery (e.g.,
subsequent to colon resection) in order to provide support to the structure,
and to release an
amount of the anti-angiogenic factor.
Within further aspects of the present invention, methods are provided for
treating
tumor excision sites, comprising administering a polynucleotide, polypeptide,
agonist andlor
agonist of the present invention to the resection margins of a tumor
subsequent to excision,
such that the local recurrence of cancer and the formation of new blood
vessels at the site is
inhibited. Within one embodiment of the invention, the anti-angiogenic
compound is
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
161
administered directly to the tumor excision site (e.g., applied by swabbing,
brushing or
otherwise coating the resection margins of the tumor with the anti-angiogenic
compound).
Alternatively, the anti-angiogenic compounds may be incorporated into known
surgical pastes
prior to administration. Within particularly preferred embodiments of the
invention, the anti-
angiogenic compounds are applied after hepatic resections for malignancy, and
after
neurosurgical operations.
Within one aspect of the present invention, polynucleotides, polypeptides,
agonists
and/or agonists of the present invention may be administered to the resection
margin of a wide
variety of tumors, including for example, breast, colon, brain and hepatic
tumors. For
l0 example, within one embodiment of the invention, anti-angiogenic compounds
may be
administered to the site of a neurological tumor subsequent to excision, such
that the
formation of new blood vessels at the site are inhibited.
The polynucleotides, polypeptides, agonists and/or agonists of the present
invention
may also be administered along with other anti-angiogenic factors.
Representative examples
of other anti-angiogenic factors include: Anti-Invasive Factor, retinoic acid
and derivatives
thereof, paclitaxel, Suramin, Tissue Inhibitor of Metalloproteinase-1, Tissue
Inhibitor of
Metalloproteinase-2, Plasminogen Activator Inhibitor-1, Plasminogen Activator
Inhibitor-2,
and various forms of the lighter "d group" transition metals.
Lighter "d group" transition metals include, for example, vanadium,
molybdenum,
tungsten, titanium, niobium, and tantalum species. Such transition metal
species may form
transition metal complexes. Suitable complexes of the above-mentioned
transition metal
species include oxo transition metal complexes.
Representative examples of vanadium complexes include oxo vanadium complexes
such as vanadate and vanadyl complexes. Suitable vanadate complexes include
metavanadate
and orthovanadate complexes such as, for example, ammonium metavanadate,
sodium
metavanadate, and sodium orthovanadate. Suitable vanadyl complexes include,
for example,
vanadyl acetylacetonate and vanadyl sulfate including vanadyl sulfate hydrates
such as
vanadyl sulfate mono- and trihydrates.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
162
Representative examples of tungsten and molybdenum complexes also include oxo
complexes. Suitable oxo tungsten complexes include tungstate and tungsten
oxide complexes.
Suitable tungstate complexes include ammonium tungstate, calcium tungstate,
sodium
tungstate dihydrate, and tungstic acid. Suitable tungsten oxides include
tungsten (IV) oxide
and tungsten (VI) oxide. Suitable oxo molybdenum complexes include molybdate,
molybdenum oxide, and molybdenyl complexes. Suitable molybdate complexes
include
ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and
potassium
molybdate and its hydrates. Suitable molybdenum oxides include molybdenum (VI)
oxide,
molybdenum (VI) oxide, and molybdic acid. Suitable molybdenyl complexes
include, for
to example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum
complexes
include hydroxo derivatives derived from, for example, glycerol, tartaric
acid, and sugars.
A wide variety of other anti-angiogenic factors may also be utilized within
the context
of the present invention. Representative examples include platelet factor 4;
protamine
sulphate; sulphated chitin derivatives (prepared from queen crab shells),
(Murata et al.,
Cancer Res. 51:22-26, 1991); Sulphated Polysaccharide Peptidoglycan Complex
(SP- PG)
(the function of this compound may be enhanced by the presence of steroids
such as
estrogen, and tamoxifen citrate); Staurosporine; modulators of matrix
metabolism, including
for example, proline analogs, cishydroxyproline, d,L-3,4-dehydroproline,
Thiaproline,
alpha,alpha-dipyridyl, aminopropionitrile fumarate; 4-propyl-5-(4-pyridinyl)-
2(3H)-
oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-
serum;
ChIMP-3 (Pavloff et al., J. Bio. Chem. 267:17321-17326, 1992); Chymostatin
(Tomkinson et
al., Biochem J. 286:475-480, 1992); Cyclodextrin Tetradecasulfate; Eponemycin;
Camptothecin; Fumagillin (Ingber et al., Nature 348:555-557, 1990); Gold
Sodium Thiomalate
("GST"; Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, 1987);
anticollagenase-serum;
alpha2-antiplasmin (Holmes et al., J. Biol. Chem. 262(4):1659-1664, 1987);
Bisantrene
(National Cancer Institute); Lobenzarit disodium (N-(2)-carboxyphenyl-4-
chloroanthronilic
acid disodium or "CCA"; Takeuchi et al., Agents Actions 36:312-316, 1992);
Thalidomide;
Angostatic steroid; AGM-1470; carboxynaminolmidazole; and metalloproteinase
inhibitors
such as BB94.
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
163
Thus, in one aspect, the present invention is directed to a method for
enhancing
apoptosis, cell proliferation, cell differentiation, or other cell growth
activity regulated by
galectin 11, which involves administering to an individual in need of an
increased level of
galectin 11 functional or biological activity, a therapeutically effective
amount of galectin 11
polypeptide, fragment, variant, derivative, or analog, or an agonist capable
of increasing
galectin 11 mediated cellular responses. In specific embodiments, galectin 11
mediated
signaling is increased to treat a disease wherein decreased apoptosis is
exhibited.
Given the activities modulated by galectin 11, it is readily apparent that a
substantially altered (increased or decreased) level of expression of galectin
11 in an individual
to compared to the standard or "normal" level produces pathological conditions
such as those
described above. It will also be appreciated by one of ordinary skill that the
galectin 11
polypeptides of the invention will exert its modulating activities on any of
its target cells.
Therefore, it will be appreciated that conditions caused by a decrease in the
standard or
normal level of galectin 11 activity in an individual, can be treated by
administration of
galectin 11 protein or an agonist thereof.
In addition to treating diseases associated with elevated or decreased levels
of galectin
11 activity, the invention encompasses methods of administering galectin 11
polypeptides or
polynucleotides (including fragments, variants, derivatives and analogs, and
agonists and
antagonists as described herein) to elevate galectin 11 associated biological
activity.
2o For example, any method which elevates galectin 11 concentration and/or
activity can
be used to stimulate hematopoiesis. Using these methods, the galectin 11
polypeptide and
nucleotide sequences described herein may be used to stimulate hematopoiesis.
In a specific
embodiment, galectin 11 polypeptides and polynucleotides are used in
erythropoietin
therapy, which is directed toward supplementing the oxygen carrying capacity
of blood.
Galectin 11 treatment within the scope of the invention includes, but is not
limited, to
patients generally requiring blood transfusions, such as, for example, trauma
victims, surgical
patients, dialysis patients, and patients with a variety of blood composition-
affecting
disorders, such as hemophilia, cystic fibrosis, pregnancy, menstrual
disorders, early anemia of
prematurity, spinal cord injury, space flight, aging, various neoplastic
disease states, and the
CA 02371611 2001-10-19
WO 00/63221 PCT/USOOI10714
164
like. Examples of patient conditions that require supplementation of the
oxygen carrying
capacity of blood and which are within the scope of this invention, include
but are not limited
to: treatment of blood disorders characterized by low or defective red blood
cell production,
anemia associated with chronic renal failure, stimulation of reticulocyte
response,
development of ferrokinetic effects (such as plasma iron turnover effects and
marrow transit
time effects), erythrocyte mass changes, stimulation of hemoglobin C
synthesis, and
increasing levels of hematocrit in vertebrates. The invention also provides
for treatment to
enhance the oxygen-carrying capacity of an individual, such as for example, an
individual
encountering hypoxic environmental conditions.
The invention also encompasses combining the galectin 11 polypeptides and
polynucleotides described herein with other proposed or conventional
hematopoietic
therapies. Thus, for example, galectin 11 can be combined with compounds that
singly exhibit
erythropoietic stimulatory effects, such as erythropoietin, testosterone,
progenitor cell
stimulators, insulin-like growth factor, prostaglandins, serotonin, cyclic
AMP, prolactin, and
triiodothyzonine. Also encompassed are combinations with compounds generally
used to
treat aplastic anemia, such as methenolene, stanozolol, and nandrolone; to
treat iron-
deficiency anemia, such as iron preparations; to treat malignant anemia, such
as vitamin B 12
and/or folic acid; and to treat hemolytic anemia, such as adrenocortical
steroids, e.g.,
corticoids. See e.g., Resegotti et al., 1981, Panminerva Medica, 23:243-248;
Kurtz, 1982,
2o FEBS Letters, 14a:105-108; McGonigle et al., 1984, Kidney lnt., 25:437-444;
and Pavlovic-
Kantera, 1980, Expt. Hematol., 8(supp. 8) 283-291.
Compounds that enhance the effects of or synergize with erythropoietin are
also
useful as adjuvants herein, and include but are not limited to, adrenergic
agonists, thyroid
hormones, androgens, hepatic erythropoietic factors, erythrotropins, and
erythrogenins, See
for e.g., Dunn, "Current Concepts in Erythropoiesis", John Wiley and Sons
(Chichester,
England, 1983); Weiland et al., 1982, Blut, 44:173-175; Kalmani, 1982, Kidney
Int., 22:383-
391; Shahidi, 1973, New Eng. J. Med., 289:72-80; Urabe et al., 1979, J. Exp.
Med., 149:1314-
1325; Billat et al., 1982, Expt. Hematol., 10:133-140; Naughton et al., 1983,
Acta Haemat,
69:171-179; Cognote et al. in abstract 364, Proceedings 7th Intl. Cong. of
Endocrinology
CA 02371611 2001-10-19
WO 00/63221 PCT/U500/10714
165
(Quebec City, Quebec, July 1-7, 1984); and Rothman et al., 1982, J. Surg.
Oncol., 20:105-
108.
Methods for stimulating hematopoiesis comprise administering a
hematopoietically
effective amount (i.e, an amount which effects the formation of blood cells)
of a
pharmaceutical composition containing galectin 11 to a patient. The galectin
11 is
administered to the patient by any suitable technique, including but not
limited to, parenteral,
sublingual, topical, intrapulmonary and intranasal, and those techniques
further discussed
herein. The pharmaceutical composition optionally contains one or more members
of the
group consisting of erythropoietin, testosterone, progenitor cell stimulators,
insulin-like
to growth factor, prostaglandins, serotonin, cyclic AMP, prolactin,
triiodothyzonine,
methenolene, stanozolol, and nandrolone, iron preparations, vitamin B 12,
folic acid and/or
adrenocortical steroids. The galectin 11 and cotreatment drugs) are suitably
delivered by
separate or by the same administration route, and at the same or at different
times, depending,
e.g., on dosing, the clinical condition of the patient, etc.
For treating abnormal conditions related to an under-expression of galectin 11
and its
activity, or in which elevated or decreased levels of galectin 11 are desired,
several approaches
are available. One approach comprises administering to an individual in need
of an increased
level of galectin 11 in the body, a therapeutically effective amount of an
isolated galectin 11
polypeptide, fragment, variant, derivative or analog of the invention, or a
compound which
2o activates galectin 11, i.e., an agonist as described above, optionally in
combination with a
pharmaceutically acceptable carrier. Alternatively, gene therapy may be
employed to effect
the endogenous production of galectin 11 by the relevant cells in the subject.
For example, a
polynucleotide of the invention may be engineered for expression in a
replication defective
retroviral vector using techniques known in the art. The retroviral expression
construct may
then be isolated and introduced into a packaging cell transduced with a
retroviral plasmid
vector containing RNA encoding a polypeptide of the present invention such
that the
packaging cell now produces infectious viral particles containing the gene of
interest. These
producer cells may be administered to a subject for engineering cells in vivo
and expression of
the polypeptide in vivo. For a overview of gene therapy, see Chapter 20, Gene
Therapy and
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
166
other Molecular Genetic-based Therapeutic Approaches, (and references cited
therein) in
Human Molecular Genetics, T Strachan and A P Read, BIOS Scientific Publishers
Ltd (1996).
Further, treatment can be administered, for example, in the form of gene
replacement
therapy. Specifically, one or more copies of a galectin 11 nucleotide sequence
of the
invention that directs the production of a galectin 11 gene product exhibiting
normal function,
may be inserted into the appropriate cells within a patient or animal subject,
using vectors
which include, but are not limited to, adenovirus, adeno-associated virus,
retrovirus and
herpesvirus vectors, in addition to other particles that introduce DNA into
cells, such as
liposomes and gene activated matrices. Because the galectin 11 gene is
expressed in
1 o neutrophils, such gene replacement techniques should be capable of
delivering galectin 11 gene
sequence to these cells within patients, or, alternatively, should involve
direct administration
of such galectin 11 polynucleotide sequences to the site of the cells in which
the galectin 11
gene sequences are to be expressed. Alternatively, targeted homologous
recombination can be
utilized to correct the defective endogenous galectin 11 gene and/or
regulatory sequences
thereof (e.g., promoter and enhancer sequences), or alternatively, to "turn
on" other dormant
galectin 11 activity in the appropriate tissue or cell type.
Additional methods which may be utilized to increase the overall level of
galectin 11
expression and/or galectin 11 activity include the introduction of appropriate
galectin 11-
expressing cells, preferably autologous cells, into a patient at positions and
in numbers which
2o are sufficient to ameliorate the symptoms of abnormalities in cells growth
regulation. Such
cells may be either recombinant or non-recombinant. Among the cells which can
be
administered to increase the overall level of galectin 11 gene expression in a
patient are normal
cells, which express the galectin 11 gene. Cell-based gene therapy techniques
are well known
to those skilled in the art, see, e.g., Anderson et al., U.S. Patent No.
5,399,349; and Mulligan
& Wilson, U.S. Patent No. 5,460,959.
If the activity of galectin 11 is in excess, several approaches are available
to reduce or
inhibit galectin 11 activity using molecules derived from the polypeptide and
polynucleotide
sequences described above. Accordingly, a further aspect of the invention is
related to a
method for treating an individual in need of a decreased level of galectin 11
activity in the
CA 02371611 2001-10-19
WO 00/63221 PCTNS00/10714
167
body comprising, administering to such an individual a composition comprising
a
therapeutically effective amount of a galectin 11 polypeptide, fragment,
variant, derivative or
analog of the invention which acts as a galectin 11 antagonist, optionally, in
combination with
a pharmaceutically acceptable carrier. Preferably, galectin 11 activity is
decreased to treat a
disease wherein increased apoptosis or other cell growth activity regulated by
galectin 11 is
exhibited. Polypeptides, derivatives, variants and analogs of the invention
which function as
antagonists of galectin 11 can routinely be identified using the assays
described infra and
other techniques known in the art. Preferred antagonists for use in the
present invention are
galectin 11-specific antibodies.
to Thus, one embodiment of the invention comprises administering to a subject
an
inhibitor compound (antagonist), such as for example, an antibody or fragment,
variant,
derivative or analog of the invention, along with a pharmaceutically
acceptable carrier in an
amount effective to suppress (i.e. lower) galectin 11 activity.
In another approach, galectin 11 activity can be reduced or inhibited by
decreasing the
level of galectin 11 gene expression. In specific embodiments, antagonists
according to the
present invention are nucleic acids corresponding to the sequences contained
in SEQ ID
NO:1, or the complementary strand thereof, andlor to nucleotide sequences
contained in the
deposited clone 209053. In one embodiment, this is accomplished through the
use of
antisense sequences, either internally generated, by the organism, or
separately administered
(see, for example, O'Connor, J. Neurochem. (1991) 56:560 in
Oligodeoxynucleotides as
Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
Antisense
technology can be used to control gene expression through antisense DNA or RNA
or through
triple-helix formation. Antisense techniques are discussed, for example, in
Okano, J.
Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of
Gene
Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is
discussed in, for
instance, Lee et al., Nucleic Acids Research 6:3073 (1979); Cooney et al.,
Science 241:456
(1988); and Dervan et al., Science 251:1360 (1991). The methods are based on
binding of a
polynucleotide to a complementary DNA or RNA.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
168
For example, the use of c-myc and c-myb antisense RNA constructs to inhibit
the
growth of the non-lymphocytic leukemia cell line HL-60 and other cell lines
was previously
described. (Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments
were
performed in vitro by incubating cells with the oligoribonucleotide. A similar
procedure for in
vivo use is described in WO 91/15580. Briefly, a pair of oligonucleotides for
a given antisense
RNA is produced as follows: A sequence complimentary to the first 15 bases of
the open
reading frame is flanked by an EcoRl site on the 5 end and a HindIII site on
the 3 end. Next,
the pair of oligonucleotides is heated at 90°C for one minute and then
annealed in 2X ligation
buffer (20mM TRIS HCl pH 7.5, IOmM MgCl2, IOMM dithiothreitol (DTT) and 0.2 mM
to ATP) and then ligated to the EcoRl/Hind III site of the retroviral vector
PMV7 (WO
91/ 15580).
For example, the 5' coding portion of a polynucleotide that encodes galectin
11
polypeptide of the present invention may be used to design an antisense RNA
oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide is
designed to be complementary to a region of the gene involved in transcription
thereby
preventing transcription and the production of the galectin 11 polypeptide.
The antisense
RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of
the mRNA
molecule into polypeptide.
In one embodiment, the galectin 11 antisense nucleic acid of the invention is
produced
2o intracellularly by transcription from an exogenous sequence. For example, a
vector or a
portion thereof, is transcribed, producing an antisense nucleic acid (RNA) of
the invention.
Such a vector would contain a sequence encoding the galectin 11 antisense
nucleic acid. Such a
vector can remain episomal or become chromosomally integrated, as long as it
can be
transcribed to produce the desired antisense RNA. Such vectors can be
constructed by
recombinant DNA technology methods standard in the art. Vectors can be
plasmid, viral, or
others know in the art, used for replication and expression in vertebrate
cells. Expression of
the sequence encoding galectin 11, or fragments thereof, can be by any
promoter known in the
art to act in vertebrate, preferably human cells. Such promoters can be
inducible or
constitutive. Such promoters include, but are not limited to, the SV40 early
promoter region
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
169
(Bernoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the
3' long
terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797
(1980), the herpes
thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445
(1981)), the
regulatory sequences of the metallothionein gene (Brinster et al., Nature
296:39-42 (1982)),
etc.
The antisense nucleic acids of the invention comprise a sequence complementary
to at
least a portion of an RNA transcript of a galectin 11 gene. However, absolute
complementarity, although preferred, is not required. A sequence
"complementary to at least
a portion of an RNA," referred to herein, means a sequence having sufficient
complementarity
to to be able to hybridize with the RNA, forming a stable duplex; in the case
of double stranded
galectin 11 antisense nucleic acids, a single strand of the duplex DNA may
thus be tested, or
triplex formation may be assayed. The ability to hybridize will depend on both
the degree of
complementarity and the length of the antisense nucleic acid. Generally, the
larger the
hybridizing nucleic acid, the more base mismatches with a galectin 11 RNA it
may contain
and still form a stable duplex (or triplex as the case may be). One skilled in
the art can
ascertain a tolerable degree of mismatch by use of standard procedures to
determine the
melting point of the hybridized complex.
Oligonucleotides that are complementary to the 5' end of the message, e.g.,
the 5'
untranslated sequence up to and including the AUG initiation codon, should
work most
2o efficiently at inhibiting translation. However, sequences complementary to
the 3'
untranslated sequences of mRNAs have been shown to be effective at inhibiting
translation of
mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335. Thus,
oligonucleotides complementary to either the 5'- or 3'- non- translated, non-
coding regions of
galectin 11 shown in Figures 1 could be used in an antisense approach to
inhibit translation of
endogenous galectin 11 mRNA. Oligonucleotides complementary to the 5'
untranslated region
of the mRNA should include the complement of the AUG start codon. Antisense
oligonucleotides complementary to mRNA coding regions are less efficient
inhibitors of
translation but could be used in accordance with the invention. Whether
designed to
hybridize to the 5'-, 3'- or coding region of galectin 11 mRNA, antisense
nucleic acids should
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
170
be at least six nucleotides in length, and are preferably oligonucleotides
ranging from 6 to
about 50 nucleotides in length. In specific aspects the oligonucleotide is at
least 10
nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50
nucleotides.
The polynucleotides of the present invention can be DNA or RNA or chimeric
mixtures or derivatives or modified versions thereof, single-stranded or
double-stranded. The
oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate
backbone, for
example, to improve stability of the molecule, hybridization, etc. The
oligonucleotide may
include other appended groups such as peptides (e.g., for targeting host cell
receptors in
vivo), or agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al., 1989,
1o Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc.
Natl. Acad. Sci.
84:648-652; PCT Publication No. W088109810, published December 15, 1988) or
the blood-
brain barrier (see, e.g., PCT Publication No. W089/10134, published April 25,
1988),
hybridization-triggered cleavage agents. (See, e.g., Krol et al., 1988,
BioTechniques 6:958-
976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549).
To this end, the
oligonucleotide may be conjugated to another molecule, e.g., a peptide,
hybridization triggered
cross-linking agent, transport agent, hybridization-triggered cleavage agent,
etc.
The antisense oligonucleotide may comprise at least one modified base moiety
which
is selected from the group including, but not limited to, 5-fluorouracil, 5-
bromouracil,
5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-
adenine,
7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-
D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-
methylthio-N6-
isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-
methyluracil, uracil-
5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-
thiouracil, 3-(3-amino-
3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
CA 02371611 2001-10-19
WO 00/63221 PCT/USOO110714
171
The antisense oligonucleotide may also comprise at least one modified sugar
moiety
selected from the group including, but not limited to, arabinose, 2-
fluoroarabinose, xylulose,
and hexose.
In yet another embodiment, the antisense oligonucleotide comprises at least
one
modified phosphate backbone selected from the group including, but not limited
to, a
phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a
formacetal or
analog thereof.
In yet another embodiment, the antisense oligonucleotide is an a-anomeric
to oligonucleotide. An a-anomeric oligonucleotide forms specific double-
stranded hybrids with
complementary RNA in which, contrary to the usual b-units, the strands run
parallel to each
other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The
oligonucleotide is a 2'-0-
methylribonucleotide (moue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a
chimeric
RNA-DNA analogue (moue et al., 1987, FEBS Lett. 215:327-330).
Polynucleotides of the invention may be synthesized by standard methods known
in
the art, e.g. by use of an automated DNA synthesizer (such as are commercially
available
from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides
may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res.
16:3209),
methylphosphonate oligonucleotides can be prepared by use of controlled pore
glass polymer
2o supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451),
etc.
While antisense nucleotides complementary to the galectin 11 coding region
sequence
could be used, those complementary to the transcribed untranslated region are
most preferred.
Potential galectin 11 antagonists according to the invention also include
catalytic
RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364,
published
October 4, 1990; Sarver et al., Science 247:1222-1225 (1990). While ribozymes
that cleave
mRNA at site specific recognition sequences can be used to destroy galectin I
1 mRNAs, the
use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at
locations dictated by flanking regions that form complementary base pairs with
the target
mRNA. The sole requirement is that the target mRNA have the following sequence
of two
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
172
bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is
well known
in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-
591 (1988).
There are numerous potential hammerhead ribozyme cleavage sites within the
nucleotide
sequence ofgalectin 11 (Figure 1; SEQ ID NO:1). Preferably, the ribozyme is
engineered so
that the cleavage recognition site is located near the 5' end of the galectin
11 xnRNA; i.e., to
increase efficiency and minimize the intracellular accumulation of non-
functional mRNA
transcripts. DNA constructs encoding the ribozyme may be introduced into the
cell in the
same manner as described above for the introduction of antisense encoding DNA.
As in the antisense approach, the ribozymes of the invention can be composed
of
l0 modified oligonucleotides (e.g. for improved stability, targeting, etc.)
and should be delivered
to cells which express galectin 11 in vivo. DNA constructs encoding the
ribozyme may be
introduced into the cell in the same manner as described above for the
introduction of
antisense encoding DNA. A preferred method of delivery involves using a DNA
construct
"encoding" the ribozyme under the control of a strong constitutive promoter,
such as, for
example, pol III or pol II promoter, so that transfected cells will produce
sufficient quantities
of the ribozyme to destroy endogenous galectin 11 messages and inhibit
translation. Since
ribozymes, unlike antisense molecules are catalytic, a lower intracellular
concentration is
required for efficiency.
Endogenous galectin 11 gene expression can also be reduced by inactivating or
"knocking out" the galectin 11 gene or its promoter using targeted homologous
recombination
(e.g., see Smithies et al., Nature 317:330-234 (1985); Thomas et al., Cell
51:503-512 (1987);
Thompson et al., Cell 5:313-321 (1989); each of which is incorporated by
reference herein in
its entirety). Such approach can be adapted for use in humans provided the
recombinant
DNA constructs are directly administered or targeted to the required site in
vivo using
appropriate viral vectors.
Alternatively, endogenous galectin 11 gene expression can be reduced by
targeted
deoxyribonucleotide sequences complementary to the regulatory region of the
galectin 11 gene
(i.e., the galectin 11 promoter and/or enhancers) to form triple helical
structures that prevent
transcription of the galectin 11 gene in target cells in the body, see
generally, Helene et al.,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
173
Ann, N.Y. Acad. Sci. 660:27-36 (1992); Helene, C., Anticancer Drug Des.,
6(6):569-584
(1991); and Maher, L.J., Bioassays 14(12):807-815 (1992)).
In yet another embodiment of the invention, the activity of galectin 11 can be
reduced
using a "dominant negative". To this end, constructs which encode defective
galectin 11, such
as, for example, mutants lacking all or a portion of region of galectin 11
that binds (3
galactosides, can be used in gene therapy approaches to diminish the activity
of galectin 11 on
appropriate target cells. For example, nucleotide sequences that direct host
cell expression of
galectin 11 in which all or a portion of the region of galectin 11 that binds
(3-galactoside is
altered or missing can be introduced into neutrophil cells, or other cells or
tissue which
l0 express galectin 11 (either by in vivo or ex vivo gene therapy methods as
for example,
described herein). Alternatively, targeted homologous recombination can be
utilized to
introduce such deletions or mutations into the subjects endogenous galectin 11
gene in
neutrophils or other cells expressing galectin 11.
Antagonist/agonist compounds may be employed to inhibit the cell growth and
proliferation effects of the polypeptides of the present invention on
neoplastic cells and
tissues, i.e. stimulation of angiogenesis of tumors, and, therefore, retard or
prevent abnormal
cellular growth and proliferation, for example, in tumor formation or growth.
The antagonistlagonist may also be employed to prevent hyper-vascular
diseases, and
prevent the proliferation of epithelial lens cells after extracapsular
cataract surgery.
Prevention of the mitogenic activity of the polypeptides of the present
invention may also be
desirous in cases such as restenosis after balloon angioplasty.
The antagonistlagonist may also be employed to prevent the growth of scar
tissue
during wound healing.
The antagonist/agonist may also be employed to treat the diseases described
herein.
Thus, the invention provides a method of treating disorders or diseases,
including but
not limited to the disorders or diseases listed throughout this application,
associated with
overexpression of a polynucleotide of the present invention by administering
to a patient (a)
an antisense molecule directed to the polynucleotide of the present invention,
and/or (b) a
ribozyme directed to the polynucleotide of the present invention.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
174
Formulation and administration
It will be appreciated that conditions caused by a decrease in the standard or
normal
level of galectin 11 activity in an individual, can be treated by
administration of galectin 11
s polypeptide or fragment, variant, derivative, or analog of the invention or
an agonist thereof.
Thus, the invention further provides a method of treating an individual in
need of an increased
level of galectin 11 activity comprising administering to such an individual a
pharmaceutical
composition comprising an effective amount of an isolated galectin 11
polypeptide or
fragment, variant, derivative, or analog of the invention, such as for
example, the full length
l0 form of the galectin 11, effective to increase the galectin 11 activity
level in such an individual.
The invention provides methods of treatment, inhibition and prophylaxis by
administration to a subject of an effective amount of a compound or
pharmaceutical
composition of the invention, preferably an antibody of the invention. In a
preferred aspect,
the compound is substantially purified (e.g., substantially free from
substances that limit its
15 effect or produce undesired side-effects). The subject is preferably an
animal, including but
not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc.,
and is preferably
a mammal, and most preferably human.
The dosage range required depends on the choice of peptide, the route of
administration, the nature of the formulation, the nature of the subject's
condition, and the
2o judgment of the attending practitioner. As a general proposition, the total
pharmaceutically
effective amount of galectin 11 polypeptide administered parenterally per dose
will be in the
range of about 1 ~ug/kglday to 10 mg/kg/day of patient body weight, although,
as noted above,
this will be subject to therapeutic discretion. More preferably, this dose is
at least 0.01
mg/kg/day, and most preferably for humans this dose is in the range of 0.1-100
mglkg of
25 subject, or between about 0.01 and 1 mg/kg/day. If given continuously, the
galectin 11
polypeptide is typically administered at a dose rate of about 1 gg/kglhour to
about 50
pg/kg~our, either by 1-4 injections per day br by continuous subcutaneous
infusions, for
example, using a mini-pump. An intravenous bag solution may also be employed.
Wide
variations in the needed dosage, however, are to be expected in view of the
variety of
3o compounds available and the differing efficiencies of various routes of
administration. For
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
175
example, oral administration would be expected to require higher dosages than
administration
by intravenous injection. Variations in these dosage levels can be adjusted
using standard
empirical routines for optimization, as is well understood in the art.
Pharmaceutical compositions containing the galectin 11 polypeptides and
polynucleotides of the invention (including fragments, variants, derivatives
or analogs), and
galectin 11 agonists and antagonists may be routinely formulated in
combination with a
pharmaceutically acceptable carrier. By "pharmaceutically acceptable carrier"
is meant a non-
toxic solid, semisolid or liquid filler, diluent, encapsulating material or
formulation auxiliary of
any type. In a specific embodiment, "pharmaceutically acceptable" means
approved by a
l0 regulatory agency of the federal or a state government or listed in the
U.S. Pharmacopeia or
other generally recognized pharmacopeia for use in animals, and more
particularly humans.
Nonlimiting examples of suitable pharmaceutical carriers according to this
embodiment are
provided in "Remington's Pharmaceutical Sciences" by E.W. Martin, and include
sterile
liquids, such as water, saline, buffered saline, glycerol, ethanol, and oils,
including those of
petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean
oil, mineral oil,
sesame oil and the like. Formulation should suit the mode of administration,
and is well
within the skill of the art. For example, water is a preferred carrier when
the pharmaceutical
composition is administered intravenously. Saline solutions and aqueous
dextrose and
glycerol solutions can be employed as liquid carriers, particularly for
injectable solutions.
The invention additionally relates to pharmaceutical packs and kits comprising
one or more
containers filled with one or more of the ingredients of the aforementioned
compositions of
the invention.
Polypeptides and other compounds of the present invention may be administered
alone or in conjunction with other compounds, such as therapeutic compounds.
The
pharmaceutical composition of the invention may be administered orally,
rectally,
parenterally, intracistemally, intravaginally, intraperitoneally, topically
(as by powders,
ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
Preferred forms
of systemic administration of the pharmaceutical compositions include
parenteral injection,
typically by intravenous injection. Other injection routes, such as
subcutaneous,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
176
intramuscular, intrasternal, intraarticular or intraperitoneal, can be used.
Alternative means
for systemic administration include transmucosal and transdermal
administration using
penetrants such as bile salts or fusidic acids or other detergents. In
addition, if properly
formulated in enteric or encapsulated formulations, oral administration may
also be possible.
Administration of these compounds may also be topical and/or localized, in the
form of
salves, pastes, gels and the like.
Polypeptides used in treatment can also be generated endogenously in the
subject, in
treatment modalities often referred to as "gene therapy" as described above.
Thus, for
example, cells from a subject may be engineered with a polynucleotide, such as
a DNA or
to RNA, to encode a polypeptide ex vivo, and for example, by the use of a
retroviral plasmid
vector. The cells are then introduced into the subject.
Formulations and methods of administration that can be employed when the
compound comprises a nucleic acid or an immunoglobulin are described above;
additional
appropriate formulations and routes of administration can be selected from
among those
described herein below.
Various delivery systems are known and can be used to administer a compound of
the
invention, e.g., encapsulation in liposomes, microparticles, microcapsules,
recombinant cells
capable of expressing the compound, receptor-mediated endocytosis (see, e.g.,
Wu and Wu, J.
Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a
retroviral or
other vector, etc. Methods of introduction include but are not limited to
intradermal,
intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal,
epidural, and oral routes.
The compounds or compositions may be administered by any convenient route, for
example
by infusion or bolus injection, by absorption through epithelial or
mucocutaneous linings
(e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be
administered together with
other biologically active agents. Administration can be systemic or local. In
addition, it may
be desirable to introduce the pharmaceutical compounds or compositions of the
invention into
the central nervous system by any suitable route, including intraventricular
and intrathecal
injection; intraventricular injection may be facilitated by an
intraventricular catheter, for
example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary
administration
CA 02371611 2001-10-19
WO 00163221 PCT/US00/10714
177
can also be employed, e.g., by use of an inhaler or nebulizer, and formulation
with an
aerosolizing agent.
In a specific embodiment, it may be desirable to administer the pharmaceutical
compounds or compositions of the invention locally to the area in need of
treatment; this may
be achieved by, for example, and not by way of limitation, local infusion
during surgery,
topical application, e.g., in conjunction with a wound dressing after surgery,
by injection, by
means of a catheter, by means of a suppository, or by means of an implant,
said implant
being of a porous, non-porous, or gelatinous material, including membranes,
such as sialastic
membranes, or fibers. Preferably, when administering a protein, including an
antibody, of the
to invention, care must be taken to use materials to-which the protein does
not absorb.
In another embodiment, the compound or composition can be delivered in a
vesicle, in
particular a liposome (see Larger, Science 249:1527-1533 (1990); Treat et al.,
in Liposomes
in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler
(eds.), Liss,
New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 317-327; see
generally ibid.)
In yet another embodiment, the compound or composition can be delivered in a
controlled release system. In one embodiment, a pump may be used (see Larger,
supra;
Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery
88:507 (1980);
Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment,
polymeric materials
can be used (see Medical Applications of Controlled Release, Larger and Wise
(eds.), CRC
2o Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug
Product Design and
Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and
Peppas, J.,
Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al.,
Science 228:190
(1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J.Neurosurg.
71:105
(1989)). In yet another embodiment, a controlled release system can be placed
in proximity
2s of the therapeutic target, i.e., the brain, thus requiring only a fraction
of the systemic dose
(see, e.g., Goodson, in Medical Applications of Controlled Release, supra,
vol. 2, pp. 115-
138 (1984)).
Other controlled release systems are discussed in the review by Larger
(Science
249:1527-1533 (1990)).
CA 02371611 2001-10-19
WO 00!63221 PCTlUS00/10714
178
In a specific embodiment where the compound of the invention is a nucleic acid
encoding a protein, the nucleic acid can be administered in vivo to promote
expression of its
encoded protein, by constructing it as part of an appropriate nucleic acid
expression vector
and administering it so that it becomes intracellular, e.g., by use of a
retroviral vector (see
U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle
bombardment
(e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface
receptors or
transfecting agents, or by administering it in linkage to a homeobox- like
peptide which is
known to enter the nucleus (see e.g., Joliot et al., Proc. Natl. Acad. Sci.
USA 88:1864-1868
(1991)), etc. Alternatively, a nucleic acid can be introduced intracellularly
and incorporated
to within host cell DNA for expression, by homologous recombination.
The present invention also provides pharmaceutical compositions. Such
compositions comprise a therapeutically effective amount of a compound, and a
pharmaceutically acceptable carrier. In a specific embodiment, the term
"pharmaceutically
acceptable" means approved by a regulatory agency of the Federal or a state
government or
listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for
use in animals,
and more particularly in humans. The term "carrier" refers to a diluent,
adjuvant, excipient,
or vehicle with which the therapeutic is administered. Such pharmaceutical
carriers can be
sterile liquids, such as water and oils, including those of petroleum, animal,
vegetable or
synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and
the like. Water is
2o a preferred carrier when the pharmaceutical composition is administered
intravenously. Saline
solutions and aqueous dextrose and glycerol solutions can also be employed as
liquid carriers,
particularly for injectable solutions. Suitable pharmaceutical excipients
include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel,
sodium stearate, glycerol
monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene,
glycol, water,
ethanol and the like. The composition, if desired, can also contain minor
amounts of wetting
or emulsifying agents, or pH buffering agents. These compositions can take the
form of
solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-
release
formulations and the like. The composition can be formulated as a suppository,
with
traditional binders and carriers such as triglycerides. Oral formulation can
include standard
CA 02371611 2001-10-19
WO 00!63221 PCTlUS00/10714
179
carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium
stearate,
sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable
pharmaceutical
carriers are described in "Remington's Pharmaceutical Sciences" by E.W.
Martin. Such
compositions will contain a therapeutically effective amount of the compound,
preferably in
purified form, together with a suitable amount of carrier so as to provide the
form for proper
administration to the patient. The formulation should suit the mode of
administration.
In a preferred embodiment, the composition is formulated in accordance with
routine
procedures as a pharmaceutical composition adapted for intravenous
administration to
human beings. Typically, compositions for intravenous administration are
solutions in sterile
l0 isotonic aqueous buffer. Where necessary, the composition may also include
a solubilizing
agent and a local anesthetic such as lignocaine to ease pain at the site of
the injection.
Generally, the ingredients are supplied either separately or mixed together in
unit dosage
form, for example, as a dry lyophilized powder or water free concentrate in a
hermetically
sealed container such as an ampoule or sachette indicating the quantity of
active agent. Where
the composition is to be administered by infusion, it can be dispensed with an
infusion bottle
containing sterile pharmaceutical grade water or saline. Where the composition
is
administered by injection, an ampoule of sterile water for injection or saline
can be provided
so that the ingredients may be mixed prior to administration.
The compounds of the invention can be formulated as neutral or salt forms.
Pharmaceutically acceptable salts include those formed with anions such as
those derived
from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those
formed with
cations such as those derived from sodium, potassium, ammonium, calcium,
ferric
hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine,
procaine, etc.
The amount of the compound of the invention which will be effective in the
treatment,
inhibition and prevention of a disease or disorder associated with aberrant
expression and/or
activity of a polypeptide of the invention can be determined by standard
clinical techniques.
In addition, in vitro assays may optionally be employed to help identify
optimal dosage
ranges. The precise dose to be employed in the formulation will also depend on
the route of
administration, and the seriousness of the disease or disorder, and should be
decided according
CA 02371611 2001-10-19
WO 00/63221 PCT/IJS00/10714
180
to the judgment of the practitioner and each patient's circumstances.
Effective doses may be
extrapolated from dose-response curves derived from in vitro or animal model
test systems.
For antibodies, the dosage administered to a patient is typically 0.1 mg/kg to
100
mg/kg of the patient's body weight. Preferably, the dosage administered to a
patient is
between 0.1 mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10
mg/kg of the patient's body weight. Generally, human antibodies have a longer
half life
within the human body than antibodies from other species due to the immune
response to the
foreign polypeptides. Thus, lower dosages of human antibodies and less
frequent
administration is often possible. Further, the dosage and frequency of
administration of
to antibodies of the invention may be reduced by enhancing uptake and tissue
penetration (e.g.,
into the brain) of the antibodies by modifications such as, for example,
lipidation.
The invention also provides a pharmaceutical pack or kit comprising one or
more
containers filled with one or more of the ingredients of the pharmaceutical
compositions of
the invention. Optionally associated with such containers) can be a notice in
the form
prescribed by a governmental agency regulating the manufacture, use or sale of
pharmaceuticals or biological products, which notice reflects approval by the
agency of
manufacture, use or sale for human administration. Diagnosis and Imaging
Labeled antibodies, and derivatives and analogs thereof, which specifically
bind to a
polypeptide of interest can be used for diagnostic purposes to detect,
diagnose, or monitor
diseases and/or disorders associated with the aberrant expression andlor
activity of a
polypeptide of the invention. The invention provides for the detection of
aberrant
expression of a polypeptide of interest, comprising (a) assaying the
expression of the
polypeptide of interest in cells or body fluid of an individual using one or
more antibodies
specific to the polypeptide interest and (b) comparing the level of gene
expression with a
standard gene expression level, whereby an increase or decrease in the assayed
polypeptide
gene expression level compared to the standard expression level is indicative
of aberrant
expression.
The invention provides a diagnostic assay for diagnosing a disorder,
comprising (a)
assaying the expression of the polypeptide of interest in cells or body fluid
of an individual
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
181
using one or more antibodies specific to the polypeptide interest and (b)
comparing the level
of gene expression with a standard gene expression level, whereby an increase
or decrease in
the assayed polypeptide gene expression level compared to the standard
expression level is
indicative of a particular disorder. With respect to cancer, the presence of a
relatively high
amount of transcript in biopsied tissue from an individual may indicate a
predisposition for
the development of the disease, or may provide a means for detecting the
disease prior to the
appearance of actual clinical symptoms. A more definitive diagnosis of this
type may allow
health professionals to employ preventative measures or aggressive treatment
earlier thereby
preventing the development or further progression of the cancer.
to Assaying galectin 11 polypeptide levels in a biological sample can occur
using
antibody-based techniques. For example, galectin 11 polypeptide expression in
tissues can be
studied with classical immunohistological methods (Jalkanen, M., et al., J.
Cell. Biol.
101:976-985 (1985); Jalkanen, M., et al., J. Cell . Biol. 105:3087-3096
(1987)). Other
antibody-based methods useful for detecting galectin 11 polypeptide gene
expression include
immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the
radioimmunoassay (RIA). Suitable antibody assay labels are known in the art
and include
enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine
('3'I,'zSI,'z3I, lz~I),
carbon ('4C), sulfur (35S), tritium (3H), indium ("Smln, "3mln, "zIn, "'In),
and technetium
(99.hc~ 99m.LC), thallium (z°'Ti), gallium (68Ga, 6~Ga), palladium
('°3Pd), molybdenum (99Mo),
2o xenon ('s3Xe) fluorine (isF) ~ssSm mLu ~s9Gd ~49Pm ~aoLa msYb ~66Ho 9a1,
4~Sc ~s6Re
> > > > > > > > > > >
'gBRe,'4zPr,'°SRh, 9~Ru; luminescent labels, such as luminol; and
fluorescent labels, such as
fluorescein and rhodamine, and biotin.
Techniques known in the art may be applied to label antibodies of the
invention. Such
techniques include, but are not limited to, the use of bifunctional
conjugating agents (see e.g.,
U.S. Patent Nos. 5,756,065; 5,714,631; 5,696,239; 5,652,361; 5,505,931;
5,489,425;
5,435,990; 5,428,139; 5,342,604; 5,274,119; 4,994,560; and 5,808,003; the
contents of each
of which are hereby incorporated by reference in its entirety).
One aspect of the invention is the detection and diagnosis of a disease or
disorder
associated with aberrant expression of a polypeptide of interest in an animal,
preferably a
CA 02371611 2001-10-19
WO 00163221 PCT/US00/10714
182
mammal and most preferably a human. In one embodiment, diagnosis comprises: a)
administering (for example, parenterally, subcutaneously, or
intraperitoneally) to a subject an
effective amount of a labeled molecule which specifically binds to the
polypeptide of
interest; b) waiting for a time interval following the administering for
permitting the labeled
molecule to preferentially concentrate at sites in the subject where the
polypeptide is
expressed (and for unbound labeled molecule to be cleared to background
level); c) determining
background level; and d) detecting the labeled molecule in the subject, such
that detection of
labeled molecule above the background level indicates that the subject has a
particular disease
or disorder associated with aberrant expression of the polypeptide of
interest. Background
to level can be determined by various methods including, comparing the amount
of labeled
molecule detected to a standard value previously determined for a particular
system.
A galectin 11 polypeptide-specific antibody or antibody fragment which has
been
labeled with an appropriate detectable imaging moiety, such as a radioisotope
(for example,
~sil uzln 99m~~e~ (isih ~zsh ~z3I~ iz~I)~ carbon ('4C), sulfur (3sS), tritium
(3H), indium ('~sm~~
U3mIn, azIn, ~ ~ ~In), and technetium (99Tc, 99mTc), thallium (z°~Ti),
gallium (68Ga, 6~Ga),
palladium (~°3Pd), molybdenum (99Mo), xenon (~33Xe), fluorine (~8F),
~s3Sm, l~~Lu, ~s9Gd,
ia9Pm~ iaoLa mslb~ 166H~~ 901, a~Sc~ is6Re~ ~ssRe~ ~4zPr~ ~os~~ 9~Ru)~ a radio-
opaque
substance, or a material detectable by nuclear magnetic resonance, is
introduced (for example,
parenterally, subcutaneously or intraperitoneally) into the mammal to be
examined for cell
2o proliferation disorder. It will be understood in the art that the size of
the subject and the
imaging system used will determine the quantity of imaging moiety needed to
produce
diagnostic images. In the case of a radioisotope moiety, for a human subject,
the quantity of
radioactivity injected will normally range from about 5 to 20 millicuries of
~"'Tc. The labeled
antibody or antibody fragment will then preferentially accumulate at the
location of cells
which contain galectin 11 protein. In vivo tumor imaging is described in S.W.
Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments"
(Chapter 13 in
Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A.
Rhodes,
eds., Masson Publishing Inc. (1982)).
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
183
Additionally, to detect galectin 11 ligand, any galectin 11 polypeptide whose
presence
can be detected, can be administered. For example, galectin 11 polypeptides
labeled with a
radio-opaque or other appropriate compound can be administered and visualized
in vivo, as
discussed, above for labeled antibodies. Further such galectin 11 polypeptides
can be utilized
for in vitro diagnostic procedures.
Depending on several variables, including the type of label used and the mode
of
administration, the time interval following the administration for permitting
the labeled
molecule to preferentially concentrate at sites in the subject and for unbound
labeled molecule
to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12
hours. In
to another embodiment the time interval following administration is 5 to 20
days or 5 to 10
days.
In an embodiment, monitoring of the disease or disorder is carried out by
repeating the
method for diagnosing the disease or disease, for example, one month after
initial diagnosis, six
months after initial diagnosis, one year after initial diagnosis, etc.
Presence of the labeled molecule can be detected in the patient using methods
known
in the art for in vivo scanning. These methods depend upon the type of label
used. Skilled
artisans will be able to determine the appropriate method for detecting a
particular label.
Methods and devices that may be used in the diagnostic methods of the
invention include, but
are not limited to, computed tomography (CT), whole body scan such as position
emission
2o tomography (PET), magnetic resonance imaging (MRI), and sonography.
In a specific embodiment, the molecule is labeled with a radioisotope and is
detected in
the patient using a radiation responsive surgical instrument (Thurston et al.,
U.S. Patent No.
5,441,050). In another embodiment, the molecule is labeled with a fluorescent
compound and
is detected in the patient using a fluorescence responsive scanning
instrument. In another
embodiment, the molecule is labeled with a positron emitting metal and is
detected in the
patent using positron emission-tomography. In yet another embodiment, the
molecule is
labeled with a paramagnetic label and is detected in a patient using magnetic
resonance imaging
(MRI).
CA 02371611 2001-10-19
WO 00163221 PCT/US00/10714
184
The present invention provides kits that can be used in the above methods. In
one
embodiment, a kit comprises an antibody of the invention, preferably a
purified antibody, in
one or more containers. In a specific embodiment, the kits of the present
invention contain a
substantially isolated polypeptide comprising an epitope which is specifically
immunoreactive with an antibody included in the kit. Preferably, the kits of
the present
invention further comprise a control antibody which does not react with the
polypeptide of
interest. In another specific embodiment, the kits of the present invention
contain a means
for detecting the binding of an antibody to a polypeptide of interest (e.g.,
the antibody may
be conjugated to a detectable substrate such as a fluorescent compound, an
enzymatic
to substrate, a radioactive compound or a luminescent compound, or a second
antibody which
recognizes the first antibody may be conjugated to a detectable substrate).
In another specific embodiment of the present invention, the kit is a
diagnostic kit for
use in screening serum containing antibodies specific against proliferative
and/or cancerous
polynucleotides and polypeptides. Such a kit may include a control antibody
that does not
react with the polypeptide of interest. Such a kit may include a substantially
isolated
polypeptide antigen comprising an epitope which is specifically immunoreactive
with at least
one anti-polypeptide antigen antibody. Further, such a kit includes means for
detecting the
binding of said antibody to the antigen (e.g., the antibody may be conjugated
to a fluorescent
compound such as fluorescein or rhodamine which can be detected by flow
cytometry). In
2o specific embodiments, the kit may include a recombinantly produced or
chemically
synthesized polypeptide antigen. The polypeptide antigen of the kit may also
be attached to
a solid support.
In a more specific embodiment the detecting means of the above-described kit
includes
a solid support to which said polypeptide antigen is attached. Such a kit may
also include a
non-attached reporter-labeled anti-human antibody. In this embodiment, binding
of the
antibody to the polypeptide antigen can be detected by binding of the said
reporter-labeled
antibody.
In an additional embodiment, the invention includes a diagnostic kit for use
in
screening serum containing antigens of the polypeptide of the invention. The
diagnostic kit
CA 02371611 2001-10-19
WO 00!63221 PCTlUS00/10714
185
includes a substantially isolated antibody specifically immunoreactive with
polypeptide or
polynucleotide antigens, and means for detecting the binding of the
polynucleotide or
polypeptide antigen to the antibody. In one embodiment, the antibody is
attached to a solid
support. In a specific embodiment, the antibody may be a monoclonal antibody.
The
detecting means of the kit may include a second, labeled monoclonal antibody.
Alternatively,
or in addition, the detecting means may include a labeled, competing antigen.
In one diagnostic configuration, test serum is reacted with a solid phase
reagent having
a surface-bound antigen obtained by the methods of the present invention.
After binding with
specific antigen antibody to the reagent and removing unbound serum components
by
l0 washing, the reagent is reacted with reporter-labeled anti-human antibody
to bind reporter to
the reagent in proportion to the amount of bound anti-antigen antibody on the
solid support.
The reagent is again washed to remove unbound labeled antibody, and the amount
of reporter
associated with the reagent is determined. Typically, the reporter is an
enzyme which is
detected by incubating the solid phase in the presence of a suitable
fluorometric, luminescent
or colorimetric substrate (Sigma, St. Louis, MO).
The solid surface reagent in the above assay is prepared by known techniques
for
attaching protein material to solid support material, such as polymeric beads,
dip sticks, 96-
well plate or filter material. These attachment methods generally include non-
specific
adsorption of the protein to the support or covalent attachment of the
protein, typically
2o through a free amine group, to a chemically reactive group on the solid
support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin
coated plates can
be used in conjunction with biotinylated antigen(s).
Thus, the invention provides an assay system or kit for carrying out this
diagnostic
method. The kit generally includes a support with surface- bound recombinant
antigens, and a
reporter-labeled anti-human antibody for detecting surface-bound anti-antigen
antibody.
Chromosome Assays
The nucleic acid molecules of the present invention are also valuable for
chromosome
identification. The sequence is specifically targeted to and can hybridize
with a particular
location on human chromosome 11. The mapping of DNAs to chromosomes according
to the
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
186
present invention is an important first step in correlating those sequences
with genes
associated with disease.
Since the galectin 11 gene has been mapped to a precise chromosomal location,
the
physical position of the sequence on the chromosome can be correlated with
genetic map
data. Such data are found, for example, in V. McKusick, Mendelian Inheritance
In Man,
available on-line through Johns Hopkins University, Welch Medical Library. The
relationship between genes and diseases that have been mapped to the same
chromosomal
region are then identified through linkage analysis (coinheritance of
physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic
sequence
to between affected and unaffected individuals. If a mutation is observed in
some or all of the
affected individuals but not in any normal individuals, then the mutation is
likely to be the
causative agent of the disease.
Having generally described the invention, the same will be more readily
understood by
reference to the following examples, which are provided by way of illustration
and are not
intended as limiting.
Examples
Example 1: Expression and Purification of Galectin 11 in E. coli
2o The DNA sequence encoding the galectin 11 protein in the deposited cDNA
clone is
amplified using PCR oligonucleotide primers specific to the amino terminal
sequences of the
galectin 11 protein and to vector sequences 3' to the gene. Additional
nucleotides containing
restriction sites to facilitate cloning are added to the 5' and 3' sequences
respectively.
The 5' galectin 11 oligonucleotide primer has the sequence 5' cgc CCATGG
ATGAGCCCCAGGCTGGAGGTG 3' (SEQ ID N0:23) containing the underlined NcoI
restriction site and nucleotides 49 to 69 of the galectin 11 nucleotide
sequence depicted in
Figure 1 (SEQ ID NO:1 ).
The 3' galectin 11 primer has the sequence 5' cgc AAGCTT
TCAGGAGTGGACACAGTAG 3' (SEQ ID N0:6) containing the underlined HindIII
3o restriction site followed by nucleotides complementary to position 431 to
451 of the galectin
11 nucleotide sequence depicted in Figure 1 (SEQ ID NO:1 ).
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
187
The restriction sites are convenient to restriction enzyme sites in the
bacterial
expression vector pQE60 which are used for bacterial expression in these
examples. (Qiagen,
Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE60 encodes ampicillin
antibiotic
resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an
IPTG inducible
promoter, a ribosome binding site ("RBS"), a 6-His tag and restriction enzyme
sites.
The amplified galectin 11 DNA and the pQE60 vector is digested with NcoI and
HindIII and the digested DNAs are then ligated together. Insertion of the
galectin 11
polypeptide DNA into the restricted pQE60 vector places the galectin 11
polypeptide coding
region downstream of and operably linked to the vector's IPTG-inducible
promoter and in-
l0 frame with an initiating AUG appropriately positioned for translation of
galectin 11.
The ligation mixture is transformed into competent E. coli cells using
standard
procedures. Such procedures are described in Sambrook et al., MOLECULAR
CLONING: A
LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, N.Y. (1989). E. coli strain M151rep4, containing multiple copies of
the plasmid
pREP4, which expresses lac repressor and confers kanamycin resistance
("Kanr"), is used in
carrying out the example described herein. This strain, which is only one of
many that are
suitable for expressing galectin 11 protein, is available commercially from
Qiagen.
Transformants are identified by their ability to grow on LB plates in the
presence of
ampicillin and kanamycin. Plasmid DNA is isolated from resistant colonies and
the identity
of the cloned DNA confirmed by restriction analysis.
Clones containing the desired constructs are grown overnight ( O/N ) in liquid
culture
in LB media supplemented with both ampicillin (100 g,g/ml) and kanamycin (25
pg/ml).
The O/N culture is used to inoculate a large culture, at a dilution of
approximately
1:100 to 1:250. The cells are grown to an optical density at 600nm ("OD600")
of between
0.4 and 0.6. Isopropyl-B-D-thiogalactopyranoside ( IPTG ) is then added to a
final
concentration of 1 mM to induce transcription from lac repressor sensitive
promoters, by
inactivating the lacI repressor. Cells subsequently are incubated further for
3 to 4 hours.
Cells then are harvested by centrifugation and disrupted, by standard methods.
Inclusion
bodies are purified from the disrupted cells using routine collection
techniques, and protein is
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
188
solubilized from the inclusion bodies into 8M urea. The 8M urea solution
containing the
solubilized polypeptide is passed over a PD-10 column in 2X phosphate-buffered
saline
("PBS"), thereby removing the urea, exchanging the buffer and refolding the
protein. The
polypeptide is purified by a further step of chromatography to remove
endotoxin. Then, it is
sterile filtered. The sterile filtered protein preparation was stored in 2X
PBS at a
concentration of 95 p/ml.
Example 2: Cloning and Expression of Galectin 11 protein in a Baculovirus
Expression
System
The cDNA sequence encoding the full length galectin 11 protein in the
deposited clone
is amplified using PCR oligonucleotide primers corresponding to the 5' and 3'
sequences of
the gene:
The 5' galectin 11 oligonucleotide primer has the sequence 5' cgc CCC GGG GCCT
ATGAGCCCCAGGCTGGAGG 3' (SEQ ID N0:7) containing the underlined SmaI
restriction site and nucleotides 49 to 66 of the galectin 11 nucleotide
sequence depicted in
Figure 1 (SEQ ID NO:1).
The 3' Galectin 11 primer has the sequence 5' cgc GGT ACC
TCAGGAGTGGACACAGTAG 3' (SEQ ID N0:8) containing the underlined Asp718
restriction site followed by nucleotides complementary to position 432 to 450
of the galectin
11 nucleotide sequence depicted in Figure 1 (SEQ ID NO:1).
An efficient signal for initiation of translation in eukaryotic cells, as
described by
Kozak, M., J. Mol. Biol. 196: 947-950 (1987) is appropriately located in the
vector portion
of the construct.
The amplified fragment is isolated from a 1 % agarose gel using a commercially
available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment then is
digested with
Xbal and again is purified on a 1% agarose gel. This fragment is designated
herein F2.
The vector pA2-GP is used to express the galectin 11 protein in the
baculovirus
expression system, using standard methods, as described in Summers et al, A
MANUAL OF
METHODS FOR BACULOVIRUS VECTORS AND INSECT CELL CULTURE
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
189
PROCEDURES, Texas Agricultural Experimental Station Bulletin No. 1555 (1987).
This
expression vector contains the strong polyhedrin promoter of the Autographa
californica
nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites.
The signal
peptide of AcMNPV gp67, including the N-terminal methionine, is located just
upstream of a
BamHI site. The polyadenylation site of the simian virus 40 ("SV40") is used
for efficient
polyadenylation. For an easy selection of recombinant virus the beta-
galactosidase gene from
E. coli is inserted in the same orientation as the polyhedrin promoter and is
followed by the
polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are
flanked at both
sides by viral sequences for cell-mediated homologous recombination with wild-
type viral
to DNA to generate viable virus that express the cloned polynucleotide.
Many other baculovirus vectors could be used in place of pA2-GP, such as
pAc373,
pVL941 and pAcIMl provided, as those of skill readily will appreciate, that
construction
provides appropriately located signals for transcription, translation,
trafficking and the like,
such as an in-frame AUG and a signal peptide, as required. Such vectors are
described in
Luckow et al., Virology 170: 31-39, among others.
The plasmid is digested with the restriction enzyme SmaI and Asp718 and then
is
dephosphorylated using calf intestinal phosphatase, using routine procedures
known in the
art. The DNA is then isolated from a 1 % agarose gel using a commercially
available kit
("Geneclean" BIO 101 Inc., La Jolla, Ca.). This vector DNA is designated
herein V2 .
Fragment F2 and the dephosphorylated plasmid V2 are ligated together with T4
DNA
ligase. E. coli HB 101 cells are transformed with ligation mix and spread on
culture plates.
Bacteria are identified that contain the plasmid with the human galectin 11
gene by digesting
DNA from individual colonies using XbaI and then analyzing the digestion
product by gel
electrophoresis. The sequence of the cloned fragment is confirmed by DNA
sequencing. This
plasmid is designated herein pBacgalectin 11.
5 gg of the plasmid pBacgalectin 11 is co-transfected with 1.0 p.g of a
commercially
available linearized baculovirus DNA ("BaculoGold baculovirus DNA",
Pharmingen, San
Diego, CA.), using the lipofection method described by Felgner et al., Proc.
Natl. Acad. Sci.
USA 84: 7413-7417 (1987). leg of BaculoGold virus DNA and 5 pg of the plasmid
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
190
pBacgalectin 11 are mixed in a sterile well of a microtiter plate containing
50 pl of serum-free
Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 ~.1
Lipofectin
plus 90 ~tl Grace's medium are added, mixed and incubated for 15 minutes at
room
temperature. Then the transfection mixture is added drop-wise to Sft3 insect
cells (ATCC
CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium
without serum.
The plate is rocked back and forth to mix the newly added solution. The plate
is then
incubated for 5 hours at 27°C. After 5 hours the transfection solution
is removed from the
plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum
is added.
The plate is put back into an incubator and cultivation is continued at
27°C for four days.
to After four days the supernatant is collected and a plaque assay is
performed, as
described by Summers and Smith, cited above. An agarose gel with "Blue Gal"
(Life
Technologies Inc., Gaithersburg) is used to allow easy identification and
isolation of gal-
expressing clones, which produce blue-stained plaques. (A detailed description
of a "plaque
assay" of this type can also be found in the user's guide for insect cell
culture and
baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-
10).
Four days after serial dilution, the virus is added to the cells. After
appropriate
incubation, blue stained plaques are picked with the tip of an Eppendorf
pipette. The agar
containing the recombinant viruses is then resuspended in an Eppendorf tube
containing 200
~1 of Grace's medium. The agar is removed by a brief centrifugation and the
supernatant
2o containing the recombinant baculovirus is used to infect Sf~3 cells seeded
in 35 mm dishes.
Four days later the supernatants of these culture dishes are harvested and
then they are stored
at 4°C. A clone containing properly inserted hESSB I, II and III is
identified by DNA
analysis including restriction mapping and sequencing. This is designated
herein as V-galectin
11.
Sf~ cells are grown in Grace's medium supplemented with 10% heat-inactivated
FBS.
The cells are infected with the recombinant baculovirus V-galectin 11 at a
multiplicity of
infection ("MOI") of about 2 (about 1 to about 3). Six hours later the medium
is removed and
is replaced with SF900 II medium minus methionine and cysteine (available from
Life
Technologies Inc., Gaithersburg). 42 hours later, 5 pCi of 35S-methionine and
5 pCi
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
191
35S-cysteine (available from Amersham) are added. The cells are further
incubated for 16
hours and then they are harvested by centrifugation, lysed and the labeled
proteins are
visualized by SDS-PAGE and autoradiography.
Example 3: Cloning and Expression in Mammalian Cells
Most of the vectors used for the transient expression of the galectin 11
polypeptide
gene sequence in mammalian cells should carry the SV40 origin of replication.
This allows the
replication of the vector to high copy numbers in cells (e.g. COS cells) which
express the T
antigen required for the initiation of viral DNA synthesis. Any other
mammalian cell line can
l0 also be utilized for this purpose.
A typical mammalian expression vector contains the promoter element, which
mediates the initiation of transcription of mRNA, the protein coding sequence,
and signals
required for the termination of transcription and polyadenylation of the
transcript.
Additional elements include enhancers, Kozak sequences and intervening
sequences flanked
by donor and acceptor sites for RNA splicing. Highly efficient transcription
can be achieved
with the early and late promoters from SV40, the long terminal repeats (LTRs)
from
Retroviruses, e.g. RSV, HTLVI, HIVI and the early promoter of the
cytomegalovirus (CMV).
However, cellular signals can also be used (e.g. human actin promoter).
Suitable expression
vectors for use in practicing the present invention include, for example,
vectors such as pSVL
and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat (ATCC 37152), pSV2dhfr (ATCC
37146) and pBCI2MI (ATCC 67109). Mammalian host cells that could be used
include,
human Hela, 283, H9 and Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos
7 and
CV1, African green monkey cells, quail QC1-3 cells, mouse L cells and Chinese
hamster ovary
cells.
Alternatively, the gene can be expressed in stable cell lines that contain the
gene
integrated into a chromosome. The co-transfection with a selectable marker
such as dhfr, gpt,
neomycin, hygromycin allows the identification and isolation of the
transfected cells.
The transfected gene can also be amplified to express large amounts of the
encoded
protein. The DHFR (dihydrofolate reductase) is a useful marker to develop cell
lines that
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
192
carry several hundred or even several thousand copies of the gene of interest.
Another useful
selection marker is the enzyme glutamine synthase (GS) (Murphy et al., Biochem
J. 227:277-
279 (1991); Bebbington et al., Bio/Technology 10:169-175 (1992)). Using these
markers, the
mammalian cells are grown in selective medium and the cells with the highest
resistance are
selected. These cell lines contain the amplified genes) integrated into a
chromosome. Chinese
hamster ovary (CHO) cells are often used for the production of proteins.
The expression vectors pCl and pC4 contain the strong promoter (LTR) of the
Rous
Sarcoma Virus (Cullen et al., Molecular and Cellular Biology, 438-4470 (March,
1985)) plus
a fragment of the CMV-enhancer (Boshart et al., Cell 41:521-530 (1985)).
Multiple cloning
l0 sites, e.g. with the restriction enzyme cleavage sites BamHI, XbaI and
Asp718, facilitate the
cloning of the gene of interest. The vectors contain in addition the 3 intron,
the
polyadenylation and termination signal of the rat preproinsulin gene.
Example 3(a): Cloning and Expression in COS Cells
The expression plasmid, pgalectin 11, is made by cloning a cDNA encoding
galectin 11
into the expression vector pcDNAI/Amp (which can be obtained from Invitrogen,
Inc.).
The expression vector pcDNAIlamp contains: (1) an E. coli origin of
replication
effective for propagation in E. coli and other prokaryotic cells; (2) an
ampicillin resistance
gene for selection of plasmid-containing prokaryotic cells; (3) an SV40 origin
of replication for
propagation in eukaryotic cells; (4) a CMV promoter, a polylinker, an SV40
intron, and a
polyadenylation signal arranged so that a cDNA conveniently can be placed
under expression
control of the CMV promoter and operably linked to the SV40 intron and the
polyadenylation signal by means of restriction sites in the polylinker.
A DNA fragment encoding the galectin 11 protein and an HA tag fused in frame
to its
3' end is cloned into the polylinker region of the vector so that recombinant
protein
expression is directed by the CMV promoter. The HA tag corresponds to an
epitope derived
from the influenza hemagglutinin protein described by Wilson et al., Cell 37:
767 (1984). The
fusion of the HA tag to the target protein allows easy detection of the
recombinant protein
with an antibody that recognizes the HA epitope.
CA 02371611 2001-10-19
WO 00/63221 PCT/ITS00/10714
193
The plasmid construction strategy is as follows. The galectin 11 cDNA of the
deposited clone is amplified using primers that contain convenient restriction
sites, much as
described above regarding the construction of expression vectors for
expression of galectin 11
in E. coli. To facilitate detection, purification and characterization of the
expressed galectin
1 l, one of the primers contains a hemagglutinin tag ("HA tag") as described
above.
Suitable primers include the following, which are used in this example. The 5'
galectin
11 primer has the sequence 5' cgc CCC GGG gcc atc ATG GCCTATC
ATGAGCCCCAGGCTGGAGG 3' (SEQ ID N0:9) containing the underlined SmaI
restriction enzyme site followed by nucleotide sequence 49 to 66 of Figure 1
(SEQ ID NO:1 ).
The 3' galectin 11 primer has the sequence 5' cgc GGT ACC
TCAGGAGTGGACACAGTAG 3' (SEQ ID N0:8) containing the Asp718 restriction
followed by nucleotides complementary to nucleotides 432 to 450 of the
galectin 11
nucleotide sequence depicted in Figure 1 (SEQ ID NO:1).
The PCR amplified DNA fragment and the vector, pcDNAI/Amp, are digested with
HindIII and XhoI and then ligated. The ligation mixture is transformed into E.
coli strain
SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines
Road, La Jolla,
CA 92037), and the transformed culture is plated on ampicillin media plates
which then are
incubated to allow growth of ampicillin resistant colonies. Plasmid DNA is
isolated from
resistant colonies and examined by restriction analysis and gel sizing for the
presence of the
galectin 11-encoding fragment.
For expression of recombinant galectin 11, COS cells are transfected with an
expression vector, as described above, using DEAE-DEXTRAN, as described, for
instance, in
Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, Cold Spring
Laboratory Press, Cold Spring Harbor, New York (1989). Cells are incubated
under
conditions for expression of galectin 11 by the vector.
Expression of the galectin 11 HA fusion protein is detected by radiolabelling
and
immunoprecipitation, using methods described in, for example Harlow et al.,
ANTIBODIES:
A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York (1988). To this end, two days after transfection, the cells
are labeled by
CA 02371611 2001-10-19
WO 00!63221 PCTlUS00/10714
194
incubation in media containing 35S-cysteine for 8 hours. The cells and the
media are
collected, and the cells are washed and the lysed with detergent-containing
RIPA buffer: 150
mM NaCI, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM TRIS, pH 7.5, as
described by Wilson et al. cited above. Proteins are precipitated from the
cell lysate and from
the culture media using an HA-specific monoclonal antibody. The precipitated
proteins then
are analyzed by SDS-PAGE gels and autoradiography. An expression product of
the
expected size is seen in the cell lysate, which is not seen in negative
controls.
Example 3(b): Cloning and Expression in CHO Cedls The vector pC 1 is used for
the
l0 expression of galectin 11 protein. Plasmid pCl is a derivative of the
plasmid pSV2-dhfr
[ATCC Accession No. 37146]. Both plasmids contain the mouse DHFR gene under
control
of the SV40 early promoter. Chinese hamster ovary- or other cells lacking
dihydrofolate
activity that are transfected with these plasmids can be selected by growing
the cells in a
selective medium (alpha minus MEM, Life Technologies) supplemented with the
chemotherapeutic agent methotrexate. The amplification of the DHFR genes in
cells resistant
to methotrexate (MTX) has been well documented (see, e.g., Alt, F.W., Kellems,
R.M.,
Bertino, J.R., and Schimke, R.T., 1978, J. Biol. Chem. 253:1357-1370, Hamlin,
J.L. and Ma,
C. 1990, Biochem. et Biophys. Acta, 1097:107-143, Page, M.J. and Sydenham,
M.A. 1991,
Biotechnology Vol. 9:64-68). Cells grown in increasing concentrations of MTX
develop
resistance to the drug by overproducing the target enzyme, DHFR, as a result
of amplification
of the DHFR gene. If a second gene is linked to the DHFR gene it is usually co-
amplified and
over-expressed. It is state of the art to develop cell lines carrying more
than 1,000 copies of
the genes. Subsequently, when the methotrexate is withdrawn, cell lines
contain the amplified
gene integrated into the chromosome(s).
Plasmid pCl contains for the expression of the gene of interest a strong
promoter of
the long terminal repeat (LTR) of the Rouse Sarcoma Virus (Cullen, et al.,
Molecular and
Cellular Biology, March 1985:438-4470) plus a fragment isolated from the
enhancer of the
immediate early gene of human cytomegalovirus (CMV) (Boshart et al., Cell
41:521-530,
1985). Downstream of the promoter are the following single restriction enzyme
cleavage
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
195
sites that allow the integration of the genes: BamHI, Pvull, and Nrul. Behind
these cloning
sites the plasmid contains translational stop codons in all three reading
frames followed by
the 3 intron and the polyadenylation site of the rat preproinsulin gene. Other
high efficient
promoters can also be used for the expression, e.g., the human -actin
promoter, the SV40
early or late promoters or the long terminal repeats from other retroviruses,
e.g., HIV and
HTLVI. For the polyadenylation of the mRNA other signals, e.g., from the human
growth
hormone or globin genes can be used as well.
Stable cell lines carrying a gene of interest integrated into the chromosomes
can also be
selected upon co-transfection with a selectable marker such as gpt, 6418 or
hygromycin. It is
l0 advantageous to use more than one selectable marker in the beginning, e.g.,
G418 plus
methotrexate.
The plasmid pC 1 is digested with the restriction enzyme BamHI and then
dephosphorylated using calf intestinal phosphatase by procedures known in the
art. The
vector is then isolated from a 1% agarose gel.
The DNA sequence encoding galectin 11, ATCC Deposit No. 209053 is amplified
using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of
the gene:
The 5' Galectin 11 primer has the sequence 5' cgc CCC GGG gcc atc ATG
GCCTATC ATGAGCCCCAGGCTGGAGG 3' (SEQ ID N0:9) containing the underlined
SmaI restriction enzyme site followed by nucleotide sequence 49-66 of Figure 1
(SEQ ID
2o NO:l). Inserted into an expression vector, as described below, the 5' end
of the amplified
fi-agment encoding human galectin 11 provides an efficient signal peptide. An
efficient signal
for initiation of translation in eukaryotic cells, as described by Kozak, M.,
1. Mol. Biol.
196:947-950 (1987) is appropriately located in the vector portion of the
construct.
The 3' Galectin 11 primer has the sequence 5' cgc GGT ACC
TCAGGAGTGGACACAGTAG 3' (SEQ ID N0:8) containing the Asp718 restriction
followed by nucleotides complementary to nucleotides 432-450 of the galectin
11 nucleotide
sequence depicted in Figure 1 (SEQ ID NO:1).
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
196
The amplified fragments are isolated from a 1 % agarose gel as described above
and
then digested with the endonucleases SmaI and Asp718 and then purified again
on a 1%
agarose gel.
The isolated fragment and the dephosphorylated vector are then ligated with T4
DNA
ligase. E. coli HB 1 O 1 cells are then transformed and bacteria identified
that contained the
plasmid pC 1 inserted in the correct orientation using the restriction enzyme
SmaI. The
sequence of the inserted gene is confirmed by DNA sequencing.
Transfection of CHO-DHFR-cells
l0 Chinese hamster ovary cells lacking an active DHFR enzyme are used for
transfection.
5 pg of the expression plasmid C1 are cotransfected with 0.5 p,g of the
plasmid pSVneo using
the lipofecting method (Felgner et al., supra). The plasmid pSV2-neo contains
a dominant
selectable marker, the gene neo from Tn5 encoding an enzyme that confers
resistance to a
group of antibiotics including 6418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml 6418. After 2 days, the cells are trypsinized and
seeded in
hybridoma cloning plates (Greiner, Germany) and cultivated from 10-14 days.
After this
period, single clones are trypsinized and then seeded in 6-well petri dishes
using different
concentrations of methotrexate (25 nM, 50 nM, 100 nM, 200 nM, 400 nM). Clones
growing
at the highest concentrations of methotrexate are then transferred to new 6-
well plates
2o containing even higher concentrations of methotrexate (500 nM, 1 pM, 2 pM,
5 gM). The
same procedure is repeated until clones grow at a concentration of 100 ~M.
The expression of the desired gene product is analyzed by Western blot
analysis and
SDS-PAGE.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
197
Example 4: Tissue distribution of protein expression
Northern blot analysis is carned out to examine galectin 11 gene expression in
human
tissues, using methods described by, among others, Sambrook et al., cited
above. A cDNA
probe containing the entire nucleotide sequence encoding galectin 11 protein
(SEQ ID NO:1 )
is labeled with 32P using the rediprime DNA labeling system (Amersham Life
Science),
according to manufacturer's instructions. After labeling, the probe is
purified using a
CHROMA SPIN-100 column (Clontech Laboratories, Inc.), according to
manufacturer's
protocol number PT1200-1. The purified labeled probe is then used to examine
various
human tissues for galectin 11 mRNA.
Multiple Tissue Northern (MTN) blots containing various human tissues (H) or
human immune system tissues (IM) are obtained from Clontech and are examined
with
labeled probe using ExpressHyb hybridization solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization and washing,
the blots
are mounted and exposed to film at -70°C overnight, and films developed
according to
standard procedures.
It will be clear that the invention may be practiced otherwise than as
particularly
described in the foregoing description and examples.
Example 5: Galectin 11 induced apoptosis in transfected cells
This example presents data demonstrating that transfection of a constitutive
galectin
11 expression construct into human Jurkat T-cells induces apoptosis of the
transfected cells.
A T cell is a type of lymphocyte, or "white blood cell", that mediates the
cellular
immune response to foreign macromolecule, termed antigens. While T cells are
necessary for
normal mammalian immune responses, in some instances it is desirable to
inhibit their
activation: for example, in some autoimmune diseases, the T cells of a subject
respond to
"self antigens", i.e., macromolecule produced by the subject, rather than
foreign-made
macromolecule, and damage the cells and tissues of the subject. Autoimmune T
cell responses
are found in subjects having systemic lupus erythematosus (SLE), rheumatoid
arthritis (RA),
insulin-dependent diabetes, myasthenia gravis, and multiple sclerosis (MS) and
contribute
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
198
to the pathophysiology of each. T cells also cause graft rejection and graft
versus host
disease (GVHD). Graft rejection is caused by an immune response against the
transplanted
tissues (the graft), which are recognized as "foreign" by T cells of the
recipient (host). Graft
versus host disease is caused by engrafted T cells, which recognize host-made
macromolecule
as "foreign."
Methods
The DNA sequence encoding the galectin 11 protein in the deposited cDNA clone
was
amplified using PCR oligonucleotide primers specific to the amino terminal
sequences of the
galectin 11 protein and to vector sequences 3' to the gene. The 5' galectin 11
oligonucleotide
primer had the sequence 5' CGCCGCCACCATGAGCCCCAGGC 3' (SEQ ID NO:10)
containing nucleotides 49 to 61 of the galectin 11 nucleotide sequence in
Figure 1 (SEQ ID
NO:1). The 3' galectin I1 primer has the sequence 5' GGAATCTAGATCAGGAGTGGAC
3' (SEQ ID NO:11) containing the underlined XbaI restriction site followed by
nucleotide
sequence complementary to position 439 to 450 of the galectin 11 nucleotide
sequence in
Figure 1 (SEQ ID NO:1).
The amplified galectin 11 fragments were isolated from a 1 % agarose gel as
described
above, digested with the endonuclease XbaI, purified again on a 1 % agarose
gel, and ligated
into the multiple cloning site of restricted pEF 1 using T4 DNA ligase.
2o The pEFl vector was generated by replacing the CMV promoter on pIRESlneo
(Clontech) with the human elongation factor 1 a constitutive promoter from pEF-
BOS. The
EFla promoter has been shown to be highly active in a variety of cell types
(data not shown).
This vector also contains a bovine growth hormone poly A signal and a
ampicilin resistance
gene, a ribosome binding site ("RBS"), a 6-His tag and restriction enzyme
sites. This vector
was digested with EcoRI, BamHI, and phosphatase using techniques known in the
art.
Insertion of the isolated galectin 11 fragment into the restricted pEF 1
vector placed
the galectin 11 polypeptide coding region downstream of and operably
associated with the
vector's constitutive elongation factor-1 promoter and in-frame with an
initiating AUG
appropriately positioned for translation of galectin 11. E. coli cells were
then transformed
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
199
with the ligation reaction and those cells containing the desired construct
(pEFLegl1) were
identified using techniques known in the art. Cells containing the pEFLegll
expression
construct were then cultured under known conditions favoring high yield and
the expression
construct was isolated from the bacterial cell culture using techniques known
in the art.
For detection of apoptosis, techniques known in the art were used to
cotransfect
human Jurkat T-cells with the pEFLegl l expression construct together with a
marker plasmid
encoding green fluorescent protein (GFP). The transfected cells were then
stained with
MitoTracker Red (Molecular Probes) to determine the transmembrane potentials
of
mitochondria, and analyzed by two-color flow cytometry. Transfected
populations were
to identified by emission of green fluorescence due to the expression of GFP.
Apoptotic cells
exhibit disrupted mitochondria) transmembrane potential and thus have lower
red fluorescence
emission because of their reduced ability to sequester the dye MitoTracker
Red.
Results
Jurkat cells transfected with the constitutive expression plasmid for
"galectin 11"
underwent significant apoptosis 24h after transfection. Approximately 30% of
"galectin 11"
transfected cells showed reduced mitochondria) transmembrane potential
compared to less
than 10% in cells transfected with the control vector with no insert (pEFl)
(Figure SA).
We also followed the number of GFP positive cells during a 4-day culture
2o period after co-transfection with either the control vector pEFI or the
"galectin 11" expression vector pEFl-Legl 1. There were about 4 times more
surviving GFP positive cells after transfection with pEFI than with pEFI-Legl
1
(Figure SB).
Example 6: Construction of N Terminal and/or C=Terminal Deletioh Mutants
The following general approach may be used to clone a N-terminal or C-terminal
deletion galectin 11 deletion mutant. Generally, two oligonucleotide primers
of about 15-25
nucleotides are derived from the desired 5' and 3' positions of a
polynucleotide of SEQ ID
NO:1. The 5' and 3' positions of the primers are determined based on the
desired galectin 11
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
200
polynucleotide fragment. An initiation and stop codon are added to the 5' and
3' primers
respectively, if necessary, to express the galectin 11 polypeptide fragment
encoded by the
polynucleotide fragment. Preferred galectin 11 polynucleotide fragments are
those encoding
the N-terminal and C-terminal deletion mutants disclosed above in the
"Galectin 11
s Polypeptide and Fragments" section of the Specification.
Additional nucleotides containing restriction sites to facilitate cloning of
the galectin
11 polynucleotide fragment in a desired vector may also be added to the 5' and
3' primer
sequences. The galectin 11 polynucleotide fragment is amplified from genomic
DNA or from
the deposited cDNA clone using the appropriate PCR oligonucleotide primers and
conditions
discussed herein or known in the art. The galectin 11 polypeptide fragments
encoded by the
galectin 11 polynucleotide fragments of the present invention may be expressed
and purified
in the same general manner as the full length polypeptides, although routine
modifications
may be necessary due to the differences in chemical and physical properties
between a
particular fragment and full length polypeptide.
As a means of exemplifying but not limiting the present invention, the
polynucleotide
encoding the galectin 11 polypeptide fragment L-5 to L-128 is amplified and
cloned as
follows: A 5' primer is generated comprising a restriction enzyme site
followed by an
initiation codon in frame with the polynucleotide sequence encoding the N-
terminal portion of
the polypeptide fragment beginning with L-S. A complementary 3' primer is
generated
comprising a restriction enzyme site followed by a stop codon in frame with
the
polynucleotide sequence encoding C-terminal portion of the galectin 11
polypeptide fragment
ending with L-128.
The amplified polynucleotide fragment and the expression vector are digested
with
restriction enzymes which recognize the sites in the primers. The digested
polynucleotides
are then ligated together. The galectin 11 polynucleotide fragment is inserted
into the
restricted expression vector, preferably in a manner which places the galectin
11 polypeptide
fragment coding region downstream from the promoter. The ligation mixture is
transformed
into competent E. coli cells using standard procedures and as described in the
Examples
herein. Plasmid DNA is isolated from resistant colonies and the identity of
the cloned DNA
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
201
confirmed by restriction analysis, PCR and DNA sequencing.
Example 7: Protein Fusions of Galectin 11
Galectin 11 polypeptides are preferably fused to other proteins. These fusion
proteins can be used for a variety of applications. For example, fusion of
galectin 11
polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding
protein
facilitates purification. (See Example 5; see also EP A 394,827; Traunecker,
et al., Nature
331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases
the halflife time
in vivo. Nuclear localization signals fused to galectin 11 polypeptides can
target the protein
l0 to a specific subcellular localization, while covalent heterodimer or
homodimers can increase
or decrease the activity of a fusion protein. Fusion proteins can also create
chimeric
molecules having more than one function. Finally, fusion proteins can increase
solubility
and/or stability of the fused protein compared to the non-fused protein. All
of the types of
fusion proteins described above can be made by modifying the following
protocol, which
outlines the fusion of a polypeptide to an IgG molecule, or the protocol
described in Example
3.
Briefly, the human Fc portion of the IgG molecule can be PCR amplified, using
primers that span the 5' and 3' ends of the sequence described below. These
primers also
should have convenient restriction enzyme sites that will facilitate cloning
into an expression
2o vector, preferably a mammalian expression vector.
For example, if pC4 (Accession No. 209646) is used, the human Fc portion can
be
ligated into the BamHI cloning site. Note that the 3' BamHI site should be
destroyed. Next,
the vector containing the human Fc portion is re-restricted with BamHI,
linearizing the vector,
and galectin 11 polynucleotide, isolated by the PCR protocol described in
Example 1, is
ligated into this BamHI site. Note that the polynucleotide is cloned without a
stop codon,
otherwise a fusion protein will not be produced.
If the naturally occurring signal sequence is used to produce the secreted
protein, pC4
does not need a second signal peptide. Alternatively, if the naturally
occurring signal
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
202
sequence is not used, the vector can be modified to include a heterologous
signal sequence.
(See, e.g., WO 96/34891.)
Human IgG Fc region:
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCA
GCACCTGAATTCGAGGGTGCACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAA
GGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGGTGGTGGACG
TAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGA
GGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTAC
l0 CGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGA
GTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCA
TCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCA
TCCCGGGATGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAG
GCTTCTATCCAAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGA
GAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCC
TCTACAGCAAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTT
CTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCC
TCTCCCTGTCTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT (SEQ
ID N0:13)
Example 8: Production of an Antibody
a) Hybridoma Technology
The antibodies of the present invention can be prepared by a variety of
methods.
(See, Current Protocols, Chapter 2.) As one example of such methods, cells
expressing
galectin 11 are administered to an animal to induce the production of sera
containing
polyclonal antibodies. In a preferred method, a preparation of galectin 11
protein is prepared
and purified to render it substantially free of natural contaminants. Such a
preparation is then
introduced into an animal in order to produce polyclonal antisera of greater
specific activity.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
203
Monoclonal antibodies specific for galectin 11 protein are prepared using
hybridoma
technology. (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J.
Immunol. 6:511
(1976); Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., in:
Monoclonal
Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681 (1981)). In
general, an
animal (preferably a mouse) is immunized with galectin 11 polypeptide or, more
preferably,
with a secreted galectin 11 polypeptide-expressing cell. Such polypeptide-
expressing cells
are cultured in any suitable tissue culture medium, preferably in Earle's
modified Eagle's
medium supplemented with 10% fetal bovine serum (inactivated at about
56°C), and
supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml
of penicillin,
l0 and about 100 ~g/ml of streptomycin.
The splenocytes of such mice are extracted and fused with a suitable myeloma
cell
line. Any suitable myeloma cell line may be employed in accordance with the
present
invention; however, it is preferable to employ the parent myeloma cell line
(SP20), available
from the ATCC. After fusion, the resulting hybridoma cells are selectively
maintained in
1s HAT medium, and then cloned by limiting dilution as described by Wands et
al.
(Gastroenterology 80:225-232 (1981)). The hybridoma cells obtained through
such a
selection are then assayed to identify clones which secrete antibodies capable
of binding the
galectin 11 polypeptide.
Alternatively, additional antibodies capable of binding to galectin 11
polypeptide can
20 be produced in a two-step procedure using anti-idiotypic antibodies. Such a
method makes
use of the fact that antibodies are themselves antigens, and therefore, it is
possible to obtain
an antibody which binds to a second antibody. In accordance with this method,
protein
specific antibodies are used to immunize an animal, preferably a mouse. The
splenocytes of
such an animal are then used to produce hybridoma cells, and the hybridoma
cells are screened
25 to identify clones which produce an antibody whose ability to bind to the
galectin 11 protein-
specific antibody can be blocked by galectin 11. Such antibodies comprise anti-
idiotypic
antibodies to the galectin 11 protein-specific antibody and are used to
immunize an animal to
induce formation of further galectin 11 protein-specific antibodies.
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
204
For in vivo use of antibodies in humans, an antibody is "humanized". Such
antibodies
can be produced using genetic constructs derived from hybridoma cells
producing the
monoclonal antibodies described above. Methods for producing chimeric and
humanized
antibodies are known in the art and are discussed herein. (See, for review,
Morrison, Science
229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Cabilly et al., U.S.
Patent No.
4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494; Neuberger
et al., WO
8601533; Robinson et al., WO 8702671; Boulianne et al., Nature 312:643 (1984);
Neuberger
et al., Nature 314:268 (1985).)
to b) Isolation Of Antibody Fragments Directed Against Galectin 11
Polypeptides From
A Library Of scFvs
Naturally occurring V-genes isolated from human PBLs are constructed into a
library
of antibody fragments which contain reactivities against Galectin 11 to which
the donor may
or may not have been exposed (see e.g., U.S. Patent 5,885,793 incorporated
herein by
reference in its entirety).
Rescue of the Library. A library of scFvs is constructed from the RNA of human
PBLs as described in PCT publication WO 92/01047. To rescue phage displaying
antibody
fragments, approximately 109 E. coli harboring the phagemid are used to
inoculate 50 ml of
2xTY containing 1% glucose and 100 ~g/ml of ampicillin (2xTY-AMP-GLU) and
grown to
2o an O.D. of 0.8 with shaking. Five ml of this culture is used to innoculate
50 ml of 2xTY-
AMP-GLU, 2 x 108 TU of delta gene 3 helper (M 13 delta gene III, see PCT
publication WO
92/01047) are added and the culture incubated at 37°C for 45 minutes
without shaking and
then at 37°C for 45 minutes with shaking. The culture is centrifuged at
4000 r.p.m. for 10
min. and the pellet resuspended in 2 liters of 2xTY containing 100 ~g/ml
ampicillin and 50
z5 ug/ml kanamycin and grown overnight. Phage are prepared as described in PCT
publication
WO 92/01047.
M13 delta gene III is prepared as follows: M13 delta gene III helper phage
does not
encode gene III protein, hence the phage(mid) displaying antibody fragments
have a greater
avidity of binding to antigen. Infectious M13 delta gene III particles are
made by growing the
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
205
helper phage in cells harboring a pUC 19 derivative supplying the wild type
gene III protein
during phage morphogenesis. The culture is incubated for 1 hour at 37°
C without shaking
and then for a further hour at 37°C with shaking. Cells are spun down
(IEC-Centra 8,400
r.p.m. for 10 min), resuspended in 300 ml 2xTY broth containing 100 ~.g
ampicillinlml and 25
~g kanamycin/ml (2xTY-AMP-KAN) and grown overnight, shaking at 37°C.
Phage particles
are purified and concentrated from the culture medium by two PEG-
precipitations (Sambrook
et al., 1990), resuspended in 2 ml PBS and passed through a 0.45 ~m filter
(Minisart NML;
Sartorius) to give a final concentration of approximately 1013 transducing
units/ml
(ampicillin-resistant clones).
to Panning of the Library. Immunotubes (Nunc) are coated overnight in PBS with
4 ml
of either 100 ~g/ml or 10 ~g/ml of a polypeptide of the present invention.
Tubes are blocked
with 2% Marvel-PBS for 2 hours at 37°C and then washed 3 times in PBS.
Approximately
1013 TU of phage is applied to the tube and incubated for 30 minutes at room
temperature
tumbling on an over and under turntable and then left to stand for another 1.5
hours. Tubes
are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS. Phage are
eluted by
adding 1 ml of 100 mM triethylamine and rotating 15 minutes on an under and
over turntable
after which the solution is immediately neutralized with 0.5 ml of 1.OM Tris-
HCI, pH 7.4.
Phage are then used to infect 10 ml of mid-log E. coli TG1 by incubating
eluted phage with
bacteria for 30 minutes at 37°C. The E. coli are then plated on TYE
plates containing 1%
2o glucose and 100 gg/ml ampicillin. The resulting bacterial library is then
rescued with delta
gene 3 helper phage as described above to prepare phage for a subsequent round
of selection.
This process is then repeated for a total of 4 rounds of affinity purification
with tube-
washing increased to 20 times with PBS, 0.1% Tween-20 and 20 times with PBS
for rounds 3
and 4.
Characterization of Binders. Eluted phage from the 3rd and 4th rounds of
selection
are used to infect E. coli HB 2151 and soluble scFv is produced (Marks, et
al., 1991 ) from
single colonies for assay. ELISAs are performed with microtitre plates coated
with either 10
pg/ml of the polypeptide of the present invention in 50 mM bicarbonate pH 9.6.
Clones
positive in ELISA are further characterized by PCR fingerprinting (see, e.g.,
PCT publication
CA 02371611 2001-10-19
WO 00/63221 PCTNS00/10714
206
WO 92/01047) and then by sequencing. These ELISA positive clones may also be
further
characterized by techniques known in the art, such as, for example, epitope
mapping, binding
affinity, receptor signal transduction, ability to block or competitively
inhibit
antibody/antigen binding, and competitive agonistic or antagonistic activity.
Example 9: Production Of Galectin 11 Protein For High-Throughput Screening
Assays
The following protocol produces a supernatant containing galectin 11
polypeptide to
be tested. This supernatant can then be used in the Screening Assays described
in Examples
14-21.
to First, dilute Poly-D-Lysine (644 587 Boehringer-Mannheim) stock solution
(lmg/ml
in PBS) 1:20 in PBS (w/o calcium or magnesium 17-516F Biowhittaker) for a
working
solution of 50ug/ml. Add 200 ul of this solution to each well (24 well plates)
and incubate at
RT for 20 minutes. Be sure to distribute the solution over each well (note: a
12-channel
pipetter may be used with tips on every other channel). Aspirate off the Poly-
D-Lysine
solution and rinse with lml PBS (Phosphate Buffered Saline). The PBS should
remain in the
well until just prior to plating the cells and plates may be poly-lysine
coated in advance for
up to two weeks.
Plate 293T cells (do not carry cells past P+20) at 2 x 105 cells/well in .5m1
DMEM(Dulbecco's Modified Eagle Medium)(with 4.5 G/L glucose and L-glutamine
(12-
604F Biowhittaker))/10% heat inactivated FBS(14-503F Biowhittaker)/lx
Penstrep(17-602E
Biowhittaker). Let the cells grow overnight.
The next day, mix together in a sterile solution basin: 300 ul Lipofectamine
(18324-
012 GibcoBRL) and 5ml Optimem I (31985070 GibcoBRL)/96-well plate. With a
small
volume mufti-channel pipetter, aliquot approximately tug of an expression
vector containing a
polynucleotide insert, produced by the methods described in Examples 8-10,
into an
appropriately labeled 96-well round bottom plate. With a mufti-channel
pipetter, add 50u1 of
the Lipofectamine/Optimem I mixture to each well. Pipette up and down gently
to mix.
Incubate at RT 15-45 minutes. After about 20 minutes, use a mufti-channel
pipetter to add
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
207
150u1 Optimem I to each well. As a control, one plate of vector DNA lacking an
insert
should be transfected with each set of transfections.
Preferably, the transfection should be performed by tag-teaming the following
tasks.
By tag-teaming, hands on time is cut in half, and the cells do not spend too
much time on
PBS. First, person A aspirates off the media from four 24-well plates of
cells, and then
person B rinses each well with .5-lml PBS. Person A then aspirates off PBS
rinse, and
person B, using a 12-channel pipetter with tips on every other channel, adds
the 200u1 of
DNA/Lipofectamine/Optimem I complex to the odd wells first, then to the even
wells, to
each row on the 24-well plates. Incubate at 37 degree C for 6 hours.
to While cells are incubating, prepare appropriate media, either 1%BSA in DMEM
with
Ix penstrep, or HGS CHO-5 media (116.6 mg/L of CaCl2 (anhyd); 0.00130 mg/L
CuS04-
5H20; 0.050 mg/L of Fe(N03)3-9H20; 0.417 mg/L of FeS04-7H20; 311.80 mgJI. of
Kcl;
28.64 mg/L of MgCl2; 48.84 mg/L of MgS04; 6995.50 mg/L of NaCI; 2400.0 mglL of
NaHC03; 62.50 mg/L of NaH2P04-H20; 71.02 m~I, of Na2HP04; .4320 mg~L of ZnS04-
7H20; .002 mg/L of Arachidonic Acid ; 1.022 mg/L of Cholesterol; .070 mgJL of
DL-alpha-
Tocopherol-Acetate; 0.0520 mg/L of Linoleic Acid; 0.010 mg/L of Linolenic
Acid; 0.010 mg/I.
of Myristic Acid; 0.010 mg/L of Oleic Acid; 0.010 mg/L of Palmitric Acid;
0.010 mg/L of
Palmitic Acid; 100 mg/L of Pluronic F-68; 0.010 mg/L of Stearic Acid; 2.20
mglL of Tween
80; 4551 mglL of D-Glucose; 130.85 mg/ml of L- Alanine; 147.50 mg/ml of L-
Arginine-HCL;
7.50 mg/ml of L-Asparagine-H20; 6.65 mg/ml of L-Aspartic Acid; 29.56 mg/ml of
L-Cystine-
2HCL-H20; 31.29 mg/ml of L-Cystine-2HCL; 7.35 mg~ml of L-Glutamic Acid; 365.0
mg~ml
of L-Glutamine; 18.75 mg/ml of Glycine; 52.48 mg/ml of L-Histidine-HCL-H20;
106.97
mg/ml of L-Isoleucine; 111.45 mglml of L-Leucine; 163.75 mg/ml of L-Lysine
HCL; 32.34
mg/ml of L-Methionine; 68.48 mg/ml of L-Phenylalainine; 40.0 mgJml of L-
Proline; 26.25
mglml of L-Serine; 101.05 mg/ml of L-Threonine; 19.22 mg/ml of L-Tryptophan;
91.79 mg/ml
of L-Tryrosine-2Na-2H20; and 99.65 mg/ml of L-Valine; 0.0035 mg/L of Biotin;
3.24 mg/L of
D-Ca Pantothenate; 11.78 mg/L of Choline Chloride; 4.65 mg~L of Folic Acid;
15.60 mg~L of
i-Inositol; 3.02 mg/L of Niacinamide; 3.00 mg/L of Pyridoxal HCL; 0.031 mg/L
of Pyridoxine
HCL; 0.319 mgJL of Riboflavin; 3.1? mg/L of Thiamine HCL; 0.365 mg~L, of
Thymidine;
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
208
0.680 mg/L of Vitamin B12; 25 mM of HEPES Buffer; 2.39 mg/L of Na
Hypoxanthine; 0.105
mg/L of Lipoic Acid; 0.081 mgJL of Sodium Putrescine-2HCL; 55.0 mg/L of Sodium
Pyruvate; 0.0067 mg/L of Sodium Selenite; 20uM of Ethanolamine; 0.122 mg/L of
Ferric
Citrate; 41.70 mg/L of Methyl-B-Cyclodextrin complexed with Linoleic Acid;
33.33 mg/L of
Methyl-B-Cyclodextrin complexed with Oleic Acid; 10 mg/L of Methyl-B-
Cyclodextrin
complexed with Retinal Acetate. Adjust osmolarity to 327 mOsm) with 2mm
glutamine and
lx penstrep. (BSA (81-068-3 Bayer) 100gm dissolved in 1L DMEM for a 10% BSA
stock
solution). Filter the media and collect 50 ul for endotoxin assay in 15m1
polystyrene conical.
The transfection reaction is terminated, preferably by tag-teaming, at the end
of the
1o incubation period. Person A aspirates off the transfection media, while
person B adds l.5ml
appropriate media to each well. Incubate at 37 degree C for 45 or 72 hours
depending on the
media used: 1%BSA for 45 hours or CHO-5 for 72 hours.
On day four, using a 300u1 multichannel pipetter, aliquot 600u1 in one lml
deep well
plate and the remaining supernatant into a 2m1 deep well. The supernatants
from each well
can then be used in the assays described in Examples 11-17.
It is specifically understood that when activity is obtained in any of the
assays
described below using a supernatant, the activity originates from either the
galectin 11
polypeptide directly (e.g., as a secreted protein) or by galectin 11 inducing
expression of
other proteins, which are then secreted into the supernatant. Thus, the
invention further
2o provides a method of identifying the protein in the supernatant
characterized by an activity in
a particular assay.
Example 10: Construction of GAS Reporter Construct
One signal transduction pathway involved in the differentiation and
proliferation of
cells is called the Jaks-STATs pathway. Activated proteins in the Jaks-STATs
pathway
bind to gamma activation site "GAS" elements or interferon-sensitive
responsive element
("ISRE"), located in the promoter of many genes. The binding of a protein to
these elements
alter the expression of the associated gene.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
209
GAS and ISRE elements are recognized by a class of transcription factors
called Signal
Transducers and Activators of Transcription, or "STATs." There are six members
of the
STATs family. Statl and Stat3 are present in many cell types, as is Stat2 (as
response to
IFN-alpha is widespread). Stat4 is more restricted and is not in many cell
types though it has
been found in T helper class I, cells after treatment with IL-12. StatS was
originally called
mammary growth factor, but has been found at higher concentrations in other
cells including
myeloid cells. It can be activated in tissue culture cells by many cytokines.
The STATs are activated to translocate from the cytoplasm to the nucleus upon
tyrosine phosphorylation by a set of kinases known as the Janus Kinase
("Jaks") family.
to Jaks represent a distinct family of soluble tyrosine kinases and include
Tyk2, Jakl, Jak2, and
Jak3. These kinases display significant sequence similarity and are generally
catalytically
inactive in resting cells.
The Jaks are activated by a wide range of receptors summarized in the Table
below.
(Adapted from review by Schidler and Darnell, Ann. Rev. Biochem. 64:621-51
(1995).) A
cytokine receptor family, capable of activating Jaks, is divided into two
groups: (a) Class 1
includes receptors for IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-11, IL-12, IL-
15, Epo, PRL, GH,
G-CSF, GM-CSF, LIF, CNTF, and thrombopoietin; and (b) Class 2 includes IFN-a,
IFN-g,
and IL-10. The Class 1 receptors share a conserved cysteine motif (a set of
four conserved
cysteines and one tryptophan) and a WSXWS motif (a membrane proximal region
encoding
2o Trp-Ser-Xxx-Trp-Ser (SEQ ID NO:S)).
Thus, on binding of a ligand to a receptor, Jaks are activated, which in turn
activate
STATs, which then translocate and bind to GAS elements. This entire process is
encompassed in the Jaks-STATs signal transduction pathway.
Therefore, activation of the Jaks-STATs pathway, reflected by the binding of
the
GAS or the ISRE element, can be used to indicate proteins involved in the
proliferation and
differentiation of cells. For example, growth factors and cytokines are known
to activate the
Jaks-STATs pathway. (See Table below.) Thus, by using GAS elements linked to
reporter
molecules, activators of the Jaks-STATs pathway can be identified.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
210
JAKs STATS GAS(elements) or
ISRE
Lid ~k2 JaklJak2 ak3
J
IFN family
IFN-a1B + + - - 1,2,3ISRE
IFN-g + + - 1 GAS (IRF1>Lys6>IFP)
I1-10 + ? ? - 1,3
gp130 familx
10IL-6 (Pleiotrohic)+ + + ? 1,3 GAS (IRF1>Lys6>IFP)
II-11(Pleiotrohic)? + ? ? 1
3
OnM(Pleiotrohic)? + + ? 1,3
LIF(Pleiotrohic)? + + ? 1,3
CNTF(Plei~trohic)-/+ + + ? 1,3
15G-CSF(Pleiotrohic)? + ? ? 1,3
IL-12(Pleiotrohic)+ - + + 1,3
g-C familX
IL-2 (lymphocytes)- + - + 1,3,5GAS
20IL-4 (lymph/myeloid)- + - + 6 GAS (IRF1 = IFP
Ly6)(IgH)
IL-7 (lymphocytes)- + - + 5 GAS
IL-9 (lymphocytes)- + - + 5 GAS
IL-13 (lymphocyte)- + ? ? 6 GAS
IL-15 ? + ? + 5
25
gp 140 familX
IL-3 (myeloid) - - + - 5 GAS (IRF1>IFPLy6)
IL-5 (myeloid) - - + - 5 GAS
GM-CSF (myeloid)- - + - 5
30
Growth hormone y
famil
GH ? - + - 5
PRL ? +/- + - 1,3,5
EPO ? - + - 5 GAS(B-CAS>IRF1=IFPLy6)
35
Receptor Tyrosine
Kinases
EGF ? + + - 1, GAS (IRF 1 )
3
PDGF ? + + - 1,
3
CSF-1 ? + + - 1,3 GAS (not IRF1)
CA 02371611 2001-10-19
WO 00!63221 PCT/LIS00/10714
211
To construct a synthetic GAS containing promoter element, which is used in the
Biological
Assays described in Examples 11-12, a PCR based strategy is employed to
generate a GAS-
SV40 promoter sequence. The 5' primer contains four tandem copies of the GAS
binding site
found in the IRF1 promoter and previously demonstrated to bind STATs upon
induction
with a range of cytokines (Rothman et al., Immunity 1:457-468 (1994).),
although other GAS
or ISRE elements can be used instead. The 5' primer also contains l8bp of
sequence
complementary to the SV40 early promoter sequence and is flanked with an XhoI
site. The
sequence of the 5' primer is:
5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCGAA
to ATGATTTCCCCGAAATATCTGCCATCTCAATTAG:3' (SEQ ID N0:14)
The downstream primer is complementary to the SV40 promoter and is flanked
with a
Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID N0:15)
PCR amplification is performed using the SV40 promoter template present in the
B
gal:promoter plasmid obtained from Clontech. The resulting PCR fragment is
digested with
XhoI/Hind III and subcloned into BLSK2-. (Stratagene.) Sequencing with forward
and
reverse primers confirms that the insert contains the following sequence:
5':CTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCGAAATG
ATTTCCCCGAAATATCTGCCATCTCAATTAGTCAGCAACCATAGTCCCGCCCC
TAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCC
2o ATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCT
GAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCA
AAAAGCTT:3' (SEQ ID N0:16)
With this GAS promoter element linked to the SV40 promoter, a GAS:SEAP2
reporter construct is next engineered. Here, the reporter molecule is a
secreted alkaline
phosphatase, or "SEAP." Clearly, however, any reporter molecule can be instead
of SEAP,
in this or in any of the other Examples. Well known reporter molecules that
can be used
instead of SEAP include chloramphenicol acetyltransferase (CAT), luciferase,
alkaline
phosphatase, B-galactosidase, green fluorescent protein (GFP), or any protein
detectable by
an antibody.
CA 02371611 2001-10-19
WO 00/63221 PCT/LIS00/10714
212
The above sequence confirmed synthetic GAS-SV40 promoter element is subcloned
into the pSEAP-Promoter vector obtained from Clontech using HindIII and Xhol,
effectively
replacing the SV40 promoter with the amplified GAS:SV40 promoter element, to
create the
GAS-SEAP vector. However, this vector does not contain a neomycin resistance
gene, and
therefore, is not preferred for mammalian expression systems.
Thus, in order to generate mammalian stable cell lines expressing the GAS-SEAP
reporter, the GAS-SEAP cassette is removed from the GAS-SEAP vector using SaII
and NotI,
and inserted into a backbone vector containing the neomycin resistance gene,
such as pGFP-1
(Clontech), using these restriction sites in the multiple cloning site, to
create the GAS-
1o SEAP/Neo vector. Once this vector is transfected into mammalian cells, this
vector can then
be used as a reporter molecule for GAS binding as described in Examples 11-12.
Other constructs can be made using the above description and replacing GAS
with a
different promoter sequence. For example, construction of reporter molecules
containing
NFK-B and EGR promoter sequences are described in Examples 14 and 13. However,
many
other promoters can be substituted using the protocols described in these
Examples. For
instance, SRE, IL-2, NFAT, or Osteocalcin promoters can be substituted, alone
or in
combination (e.g., GAS/NF-KB/EGR, GAS/NF-KB, Il-2/NFAT, or NF-KB/GAS).
Similarly,
other cell lines can be used to test reporter construct activity, such as HELA
(epithelial),
HLTVEC (endothelial), Reh (B-cell), Saos-2 (osteoblast), HUVAC (aortic), or
Cardiomyocyte.
Example 11: High-Throughput Screening Assay for T cell Activity.
The following protocol is used to assess T-cell activity by identifying
factors, and
determining whether supernate containing a polypeptide of the invention
proliferates and/or
differentiates T-cells. T-cell activity is assessed using the GAS/SEAP/Neo
construct
produced in Example 10. Thus, factors that increase SEAP activity indicate the
ability to
activate the Jaks-STATS signal transduction pathway. The T-cell used in this
assay is Jurkat
T-cells (ATCC Accession No. TIB-152), although Molt-3 cells (ATCC Accession
No. CRL-
1552) and Molt-4 cells (ATCC Accession No. CRL-1582) cells can also be used.
CA 02371611 2001-10-19
WO 00163221 PCT/IJS00/10714
213
Jurkat T-cells are lymphoblastic CD4+ Thl helper cells. In order to generate
stable
cell lines, approximately 2 million Jurkat cells are transfected with the GAS-
SEAP/neo vector
using DMRIE-C (Life Technologies)(transfection procedure described below). The
transfected cells are seeded to a density of approximately 20,000 cells per
well and
transfectants resistant to 1 mg/ml genticin selected. Resistant colonies are
expanded and then
tested for their response to increasing concentrations of interferon gamma.
The dose response
of a selected clone is demonstrated.
Specifically, the following protocol will yield sufficient cells for 75 wells
containing
200 ul of cells. Thus, it is either scaled up, or performed in multiple to
generate sufficient
cells for multiple 96 well plates. Jurkat cells are maintained in RPMI + 10%
serum with
1%Pen-Strep. Combine 2.5 mls of OPTI-MEM (Life Technologies) with 10 ug of
plasmid
DNA in a T25 flask. Add 2.5 ml OPTI-MEM containing 50 ul of DMRIE-C and
incubate at
room temperature for 15-45 wins.
During the incubation period, count cell concentration, spin down the required
number
of cells (10' per transfection), and resuspend in OPTI-MEM to a final
concentration of 10'
cells/ml. Then add lml of 1 x 10~ cells in OPTI-MEM to T25 flask and incubate
at 37 degree
C for 6 hrs. After the incubation, add 10 ml of RPMI + 15% serum.P
The Jurkat:GAS-SEAP stable reporter lines are maintained in RPMI + 10% serum,
1
mg/ml Genticin, and 1 % Pen-Strep. These cells are treated with supernatants
containing
galectin 11 polypeptides or galectin 11 induced polypeptides, as produced by
the protocol
described in Example 9.
On the day of treatment with the supernatant, the cells should be washed and
resuspended in fresh RPMI + 10% serum to a density of 500,000 cells per ml.
The exact
number of cells required will depend on the number of supernatants being
screened. For one
96 well plate, approximately 10 million cells (for 10 plates, 100 million
cells) are required.
Transfer the cells to a triangular reservoir boat, in order to dispense the
cells into a 96
well dish, using a 12 channel pipette. Using a 12 channel pipette, transfer
200 ul of cells into
each well (therefore adding 100, 000 cells per well).
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
214
After all the plates have been seeded, 50 ul of the supernatants are
transferred directly
from the 96 well plate containing the supernatants into each well using a 12
channel pipette.
In addition, a dose of exogenous interferon gamma (0.1, 1.0, 10 ng) is added
to wells H9, H10,
and H11 to serve as additional positive controls for the assay.
The 96 well dishes containing Jurkat cells treated with supernatants are
placed in an
incubator for 48 hrs (note: this time is variable between 48-72 hrs). 35 ul
samples from each
well are then transferred to an opaque 96 well plate using a 12 channel
pipette. The opaque
plates should be covered (using sellophene covers) and stored at -20 degree C
until SEAP
assays are performed according to Example 15. The plates containing the
remaining treated
to cells are placed at 4 degree C and serve as a source of material for
repeating the assay on a
specific well if desired.
As a positive control, 100 Unit/ml interferon gamma can be used which is known
to
activate Jurkat T cells. Over 30 fold induction is typically observed in the
positive control
wells.
The above protocol may be used in the generation of both transient, as well
as, stable
transfected cells, which would be apparent to those of skill in the art.
Example 12: High-Throughput Screening Assay Identifying Myeloid Activity
The following protocol is used to assess myeloid activity of galectin 11 by
determining whether galectin 11 proliferates and/or differentiates myeloid
cells. Myeloid cell
activity is assessed using the GAS/SEAP/Neo construct produced in Example 10.
Thus,
factors that increase SEAP activity indicate the ability to activate the Jaks-
STATS signal
transduction pathway. The myeloid cell used in this assay is U937, a pre-
monocyte cell line,
although TF-1, HL60, or KG1 can be used.
To transiently transfect U937 cells with the GAS/SEAP/Neo construct produced
in
Example 10, a DEAF-Dextran method (Kharbanda et. al., 1994, Cell Growth &
Differentiation, 5:259-265) is used. First, harvest 2x10e7 U937 cells and wash
with PBS.
The U937 cells are usually grown in RPMI 1640 medium containing 10% heat-
inactivated
CA 02371611 2001-10-19
WO 00!63221 PCTlUS00/10714
215
fetal bovine serum (FBS) supplemented with 100 units/ml penicillin and 100
mglml
streptomycin.
Next, suspend the cells in 1 ml of 20 mM Tris-HCl (pH 7.4) buffer containing
0.5
mg/ml DEAE-Dextran, 8 ug GAS-SEAP2 plasmid DNA, 140 mM NaCI, 5 mM KCI, 375 uM
Na2HP04.7H20, 1 mM MgCl2, and 675 uM CaCl2. Incubate at 37 degrees C for 45
min.
Wash the cells with RPMI 1640 medium containing 10% FBS and then resuspend in
ml complete medium and incubate at 37 degree C for 36 hr.
The GAS-SEAP/L1937 stable cells are obtained by growing the cells in 400 ug/ml
6418. The 6418-free medium is used for routine growth but every one to two
months, the
to cells should be re-grown in 400 ug/ml 6418 for couple of passages.
These cells are tested by harvesting 1x108 cells (this is enough for ten 96-
well plates
assay) and wash with PBS. Suspend the cells in 200 ml above described growth
medium,
with a final density of 5x105 cells/ml. Plate 200 ul cells per well in the 96-
well plate (or 1x105
cells/well).
Add 50 ul of the supernatant prepared by the protocol described in Example 9.
Incubate at 37 degee C for 48 to 72 hr. As a positive control, 100 Unit/ml
interferon gamma
can be used which is known to activate U937 cells. Over 30 fold induction is
typically
observed in the positive control wells. SEAP assay the supernatant according
to the protocol
described in Example 15.
Example 13: High-Throughput Screening Assay Identifying Neuronal Activity.
When cells undergo differentiation and proliferation, a group of genes are
activated
through many different signal transduction pathways. One of these genes, EGR1
(early
growth response gene 1), is induced in various tissues and cell types upon
activation. The
promoter of EGRI is responsible for such induction. Using the EGRl promoter
linked to
reporter molecules, activation of cells can be assessed by galectin 11.
Particularly, the following protocol is used to assess neuronal activity in PC
12 cell
lines. PC 12 cells (rat phenochromocytoma cells) are known to proliferate
and/or differentiate
by activation with a number of mitogens, such as TPA (tetradecanoyl phorbol
acetate), NGF
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
216
(nerve growth factor), and EGF (epidermal growth factor). The EGR1 gene
expression is
activated during this treatment. Thus, by stably transfecting PC 12 cells with
a construct
containing an EGR promoter linked to SEAP reporter, activation of PC 12 cells
by galectin 11
can be assessed.
The EGR/SEAP reporter construct can be assembled by the following protocol.
The
EGR-1 promoter sequence (-633 to +1)(Sakamoto K et al., Oncogene 6:867-871
(1991)) can
be PCR amplified from human genomic DNA using the following primers:
5' GCGCTCGAGGGATGACAGCGATAGAACCCCGG -3' (SEQ ID N0:17)
5' GCGAAGCTTCGCGACTCCCCGGATCCGCCTC-3' (SEQ ID N0:18)
to Using the GAS:SEAP/Neo vector produced in Example 10, EGR1 amplified
product
can then be inserted into this vector. Linearize the GAS:SEAP/Neo vector using
restriction
enzymes XhoI/HindIII, removing the GAS/SV40 stuffer. Restrict the EGR1
amplified
product with these same enzymes. Ligate the vector and the EGRl promoter.
To prepare 96 well-plates for cell culture, two mls of a coating solution
(1:30 dilution
of collagen type I (Upstate Biotech Inc. Cat#08-115) in 30% ethanol (filter
sterilized)) is
added per one 10 cm plate or 50 ml per well of the 96-well plate, and allowed
to air dry for 2
hr.
PC 12 cells are routinely grown in RPMI-1640 medium (Bio Whittaker) containing
10% horse serum (JRH BIOSCIENCES, Cat. # 12449-78P), 5% heat-inactivated fetal
bovine
serum (FBS) supplemented with 100 units/ml penicillin and 100 ug/ml
streptomycin on a
precoated 10 cm tissue culture dish. One to four split is done every three to
four days. Cells
are removed from the plates by scraping and resuspended with pipetting up and
down for
more than 15 times.
Transfect the EGR/SEAP/Neo construct into PC12 using the Lipofectamine
protocol
described in Example 11. EGR-SEAP/PC12 stable cells are obtained by growing
the cells in
300 ug/ml 6418. The 6418-free medium is used for routine growth but every one
to two
months, the cells should be re-grown in 300 ug/ml 6418 for couple of passages.
To assay for neuronal activity, a 10 cm plate with cells around 70 to 80%
confluent is
screened by removing the old medium. Wash the cells once with PBS (Phosphate
buffered
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
217
saline). Then starve the cells in low serum medium (RPMI-1640 containing 1%
horse serum
and 0.5% FBS with antibiotics) overnight.
The next morning, remove the medium and wash the cells with PBS. Scrape off
the
cells from the plate, suspend the cells well in 2 ml low serum medium. Count
the cell number
and add more low serum medium to reach final cell density as 5x 1 O5 cells/ml.
Add 200 ul of the cell suspension to each well of 96-well plate (equivalent to
1x105
cellslwell). Add 50 ul supernatant produced by Example 9, 37 degree C for 48
to 72 hr. As a
positive control, a growth factor known to activate PC 12 cells through EGR
can be used, such
as 50 ng/ul of Neuronal Growth Factor (NGF). Over fifty-fold induction of SEAP
is
to typically seen in the positive control wells. A SEAP assay of the
supernatant is performed
according to Example 15.
Example 14: High-Throughput Screening Assay for T cell Activity
NF-KB (Nuclear Factor KB) is a transcription factor activated by a wide
variety of
agents including the inflammatory cytokines IL-1 and TNF, CD30 and CD40,
lymphotoxin
alpha and lymphotoxin-beta, by exposure to LPS or thrombin, and by expression
of certain
viral gene products. As a transcription factor, NF-KB regulates the expression
of genes
involved in immune cell activation, control of apoptosis (NF-KB appears to
shield cells from
apoptosis), B and T-cell development, anti-viral and antimicrobial responses,
and multiple
2o stress responses.
In non-stimulated conditions, NF-KB is retained in the cytoplasm with I-KB
(Inhibitor KB). However, upon stimulation, I-KB is phosphorylated and
degraded, causing
NF-KB to shuttle to the nucleus, thereby activating transcription of target
genes. Target
genes activated by NF-KB include IL-2, IL-6, GM-CSF, ICAM-1 and class 1 MHC.
Due to its central role and ability to respond to a range of stimuli, reporter
constructs
utilizing the NF-KB promoter element are used to screen the supernatants
produced in
Example 9. Activators or inhibitors of NF-KB would be useful in treating
diseases. For
example, inhibitors of NF-KB could be used to treat those diseases related to
the acute or
chronic activation of NF-KB, such as rheumatoid arthritis.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00110714
218
To construct a vector containing the NF-KB promoter element, a PCR based
strategy
is employed. The upstream primer contains four tandem copies of the NF-KB
binding site
(GGGGACTTTCCC) (SEQ ID N0:19), 18 by of sequence complementary to the 5' end
of
the SV40 early promoter sequence, and is flanked with an XhoI site:
S':GCGGCCTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGACTT
TCCATCCTGCCATCTCAATTAG:3' (SEQ ID N0:20)
The downstream primer is complementary to the 3' end of the SV40 promoter and
is
flanked with a Hind III site:
5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID N0:21)
1o PCR amplification is performed using the SV40 promoter template present in
the pB-
gal:promoter plasmid obtained from Clontech. The resulting PCR fragment is
digested with
Xhol and Hind III and subcloned into BLSK2-. (Stratagene) Sequencing with the
T7 and T3
primers confirms the insert contains the following sequence:
5':CTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGACTTTCCATC
TGCCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCG
CCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTT
TTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTA
GTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT:3' (SEQ ID
N0:22)
2o Next, replace the SV40 minimal promoter element present in the pSEAP2-
promoter
plasmid (Clontech) with this NF-KB/SV40 fragment using XhoI and HindIII.
However, this
vector does not contain a neomycin resistance gene, and therefore, is not
preferred for
mammalian expression systems.
In order to generate stable mammalian cell lines, the NF-KB/SV40/SEAP cassette
is
removed from the above NF-KB/SEAP vector using restriction enzymes SaII and
NotI, and
inserted into a vector containing neomycin resistance. Particularly, the NF-
KB/SV40/SEAP
cassette was inserted into pGFP-1 (Clontech), replacing the GFP gene, after
restricting
pGFP-1 with SalI and NotI.
CA 02371611 2001-10-19
WO 00/63221 PCTJUS00/10714
219
Once NF-KB/SV40/SEAP/Neo vector is created, stable Jurkat T-cells are created
and
maintained according to the protocol described in Example 11. Similarly, the
method for
assaying supernatants with these stable Jurkat T-cells is also described in
Example 11. As a
positive control, exogenous TNF alpha (0.1,1, 10 ng) is added to wells H9,
H10, and H11,
with a 5-10 fold activation typically observed.
Example 1 S: Assay for SEAP Activity
As a reporter molecule for the assays described in Examples 12 and 13, SEAP
activity
is assayed using the Tropix Phospho-light Kit (Cat. BP-400) according to the
following
l0 general procedure. The Tropix Phospho-light Kit supplies the Dilution,
Assay, and Reaction
Buffers used below.
Prime a dispenser with the 2.Sx Dilution Buffer and dispense 15 ul of 2.Sx
dilution
buffer into Optiplates containing 35 ul of a supernatant. Seal the plates with
a plastic sealer
and incubate at 65 degree C for 30 min. Separate the Optiplates to avoid
uneven heating.
Cool the samples to room temperature for 15 minutes. Empty the dispenser and
prime with the Assay Buffer. Add 50 ml Assay Buffer and incubate at room
temperature 5
min. Empty the dispenser and prime with the Reaction Buffer (see the table
below). Add 50
ul Reaction Buffer and incubate at room temperature for 20 minutes. Since the
intensity of
the chemiluminescent signal is time dependent, and it takes about 10 minutes
to read 5 plates
on luminometer, one should treat 5 plates at each time and start the second
set 10 minutes
later.
Read the relative light unit in the luminometer. Set H12 as blank, and print
the
results. An increase in chemiluminescence indicates reporter activity.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
220
Reaction Buffer Formulation:
# of platesRxn buffer diluentCSPD (ml)
(ml)
60 3
11 65 3.25
12 70 3.5
13 75 3.75
14 80 4
85 4.25
16 90 4.5
17 95 4.75
18 100 5
19 105 5.25
110 5.5
21 115 5.75
22 120 6
23 125 6.25
24 130 6.5
135 6.75
26 140 7
27 145 7.25
28 150 7.5
29 155 7.75
160 8
31 165 8.25
32 170 8.5
33 175 8.75
34 180 9
185 9.25
36 190 9.5
37 195 9.75
38 200 10
39 205 10.25
210 10.5
41 215 10.75
42 220 11
43 225 11.25
44 230 11.5
235 11.75
46 240 12
47 245 12.25
48 250 12.5
49 255 12.75
260 13
Example 16: High-Throughput Screening Assay Identrfy' ing Changes in Small
Molecule
Concentration and Membrane Permeability
5 Binding of a ligand to a receptor is known to alter intracellular levels of
small
molecules, such as calcium, potassium, sodium, and pH, as well as alter
membrane potential.
These alterations can be measured in an assay to identify supernatants which
bind to
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
221
receptors of a particular cell. Although the following protocol describes an
assay for calcium,
this protocol can easily be modified to detect changes in potassium, sodium,
pH, membrane
potential, or any other small molecule which is detectable by a fluorescent
probe.
The following assay uses Fluorometric Imaging Plate Reader ("FLIPR'~ to
measure
changes in fluorescent molecules (Molecular Probes) that bind small molecules.
Clearly, any
fluorescent molecule detecting a small molecule can be used instead of the
calcium fluorescent
molecule, fluo-4 (Molecular Probes, Inc.; catalog no. F-14202), used here.
For adherent cells, seed the cells at 10,000 -20,000 cells/well in a Co-star
black 96-well
plate with clear bottom. The plate is incubated in a COz incubator for 20
hours. The
adherent cells are washed two times in Biotek washer with 200 ul of HBSS
(Hank's Balanced
Salt Solution) leaving 100 ul of buffer after the final wash.
A stock solution of 1 mg/ml fluo-4 is made in 10% pluronic acid DMSO. To load
the
cells with fluo-4 , 50 ul of 12 ug/ml fluo-4 is added to each well. The plate
is incubated at 37
degrees C in a COZ incubator for 60 min. The plate is washed four times in the
Biotek washer
with HBSS leaving 100 ul ofbuffer.
For non-adherent cells, the cells are spun down from culture media. Cells are
re-
suspended to 2-Sx106 cells/ml with HBSS in a 50-ml conical tube. 4 ul of 1
mg/ml fluo-4
solution in 10% pluronic acid DMSO is added to each ml of cell suspension. The
tube is then
placed in a 37 degrees C water bath for 30-60 min. The cells are washed twice
with HBSS,
resuspended to 1x106 cells/ml, and dispensed into a microplate, 100 unwell.
The plate is
centrifuged at 1000 rpm for 5 min. The plate is then washed once in Denley
CellWash with
200 ul, followed by an aspiration step to 100 ul final volume.
For a non-cell based assay, each well contains a fluorescent molecule, such as
fluo-4
The supernatant is added to the well, and a change in fluorescence is
detected.
To measure the fluorescence of intracellular calcium, the FLIPR is set for the
following
parameters: (1) System gain is 300-800 mW; (2) Exposure time is 0.4 second;
(3) Camera
F/stop is F12; (4) Excitation is 488 nm; (5) Emission is 530 nm; and (6)
Sample addition is 50
ul. Increased emission at 530 nm indicates an extracellular signaling event
caused by the a
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
222
molecule, either galectin 11 or a molecule induced by galectin 11, which has
resulted in an
increase in the intracellular Ca++ concentration.
Example 17: High-Throughput Screening Assay Identifying Tyrosine Kinase
Activity
The Protein Tyrosine Kinases (PTK) represent a diverse group of transmembrane
and
cytoplasmic kinases. Within the Receptor Protein Tyrosine Kinase RPTK) group
are
receptors for a range of mitogenic and metabolic growth factors including the
PDGF, FGF,
EGF, NGF, HGF and Insulin receptor subfamilies. In addition there are a large
family of
RPTKs for which the corresponding ligand is unknown. Ligands for RPTKs include
mainly
to secreted small proteins, but also membrane-bound and extracellular matrix
proteins.
Activation of RPTK by ligands involves ligand-mediated receptor dimerization,
resulting in transphosphorylation of the receptor subunits and activation of
the cytoplasmic
tyrosine kinases. The cytoplasmic tyrosine kinases include receptor associated
tyrosine
kinases of the src-family (e.g., src, yes, lck, lyn, fyn) and non-receptor
linked and cytosolic
protein tyrosine kinases, such as the Jak family, members of which mediate
signal
transduction triggered by the cytokine superfamily of receptors (e.g., the
Interleukins,
Interferons, GM-CSF, and Leptin).
Because of the wide range of known factors capable of stimulating tyrosine
kinase
activity, identifying whether galectin 11 or a molecule induced by galectin 11
is capable of
2o activating tyrosine kinase signal transduction pathways is of interest.
Therefore, the
following protocol is designed to identify such molecules capable of
activating the tyrosine
kinase signal transduction pathways.
Seed target cells (e.g., primary keratinocytes) at a density of approximately
25,000
cells per well in a 96 well Loprodyne Silent Screen Plates purchased from
Nalge Nunc
(Naperville, IL). The plates are sterilized with two 30 minute rinses with
100% ethanol,
rinsed with water and dried overnight. Some plates are coated for 2 hr with
100 ml of cell
culture grade type I collagen (50 mglml), gelatin (2%) or polylysine (50
mg/ml), all of which
can be purchased from Sigma Chemicals (St. Louis, MO) or 10% Matrigel
purchased from
Becton Dickinson (Bedford,MA), or calf serum, rinsed with PBS and stored at 4
degree C.
CA 02371611 2001-10-19
WO 00/63221 PCT/USDD/10714
223
Cell growth on these plates is assayed by seeding 5,000 cells/well in growth
medium and
indirect quantitation of cell number through use of alamarBlue as described by
the
manufacturer Alamar Biosciences, Inc. (Sacramento, CA) after 48 hr. Falcon
plate covers
#3071 from Becton Dickinson (Bedford,MA) are used to cover the Loprodyne
Silent Screen
Plates. Falcon Microtest III cell culture plates can also be used in some
proliferation
experiments.
To prepare extracts, A431 cells are seeded onto the nylon membranes of
Loprodyne
plates (20,000/200m1/well) and cultured overnight in complete medium. Cells
are quiesced by
incubation in serum-free basal medium for 24 hr. After 5-20 minutes treatment
with EGF
(60ng/ml) or 50 ul of the supernatant produced in Example 12, the medium was
removed arid
100 ml of extraction buffer ((20 mM HEPES pH 7.5, 0.15 M NaCI, 1% Triton X-
100, 0.1%
SDS, 2 mM Na3V04, 2 mM Na4P2O7 and a cocktail of protease inhibitors (#
1836170)
obtained from Boeheringer Mannheim (Indianapolis, IN) is added to each well
and the plate is
shaken on a rotating shaker for 5 minutes at 4°C. The plate is then
placed in a vacuum
transfer manifold and the extract filtered through the 0.45 mm membrane
bottoms of each well
using house vacuum. Extracts are collected in a 96-well catch/assay plate in
the bottom of
the vacuum manifold and immediately placed on ice. To obtain extracts
clarified by
centrifugation, the content of each well, after detergent solubilization for 5
minutes, is
removed and centrifuged for 15 minutes at 4 degree C at 16,000 x g.
2o Test the filtered extracts for levels of tyrosine kinase activity. Although
many
methods of detecting tyrosine kinase activity are known, one method is
described here.
Generally, the tyrosine kinase activity of a supernatant is evaluated by
determining its
ability to phosphorylate a tyrosine residue on a specific substrate (a
biotinylated peptide).
Biotinylated peptides that can be used for this purpose include PSK1
(corresponding to
amino acids 6-20 of the cell division kinase cdc2-p34) and PSK2 (corresponding
to amino
acids 1-17 of gastrin). Both peptides are substrates for a range of tyrosine
kinases and are
available from Boehringer Mannheim.
The tyrosine kinase reaction is set up by adding the following components in
order.
First, add 10u1 of 5uM Biotinylated Peptide, then l0ul ATP/Mg2+ (5mM ATP/SOmM
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
224
MgCl2), then l0ul of 5x Assay Buffer (40mM imidazole hydrochloride, pH7.3, 40
mM beta
glycerophosphate, 1mM EGTA, 100mM MgCl2, 5 mM MnCl2, 0.5 mglml BSA), then 5ul
of Sodium Vanadate(1mM), and then 5u1 of water. Mix the components gently and
preincubate the reaction mix at 30 degree C for 2 min. Initial the reaction by
adding 10u1 of
the control enzyme or the filtered supernatant.
The tyrosine kinase assay reaction is then terminated by adding 10 ul of 120mm
EDTA and place the reactions on ice.
Tyrosine kinase activity is determined by transferring 50 ul aliquot of
reaction mixture
to a microtiter plate (MTP) module and incubating at 37 degree C for 20 min.
This allows the
1o streptavadin coated 96 well plate to associate with the biotinylated
peptide. Wash the MTP
module with 300u1/well of PBS four times. Next add 75 ul of anti-
phospotyrosine antibody
conjugated to horse radish peroxidase(anti-P-Tyr-POD(0.5u/ml)) to each well
and incubate at
37 degree C for one hour. Wash the well as above.
Next add 100u1 of peroxidase substrate solution (Boehringer Mannheim) and
incubate
at room temperature for at least 5 mins (up to 30 min). Measure the absorbance
of the
sample at 405 nm by using ELISA reader. The level of bound peroxidase activity
is
quantitated using an ELISA reader and reflects the level of tyrosine kinase
activity.
Example 18: High-Throughput Screening Assay Identifying Phosphorylation
Activity
2o As a potential alternative and/or compliment to the assay of protein
tyrosine kinase
activity described in Example 16, an assay which detects activation
(phosphorylation) of
major intracellular signal transduction intermediates can also be used. For
example, as
described below one particular assay can detect tyrosine phosphorylation of
the Erk-1 and
Erk-2 kinases. However, phosphorylation of other molecules, such as Raf, JNK,
p38 MAP,
Map kinase kinase (MEK), MEK kinase, Src, Muscle specific kinase (MuSK), IRAK,
Tec,
and Janus, as well as any other phosphoserine, phosphotyrosine, or
phosphothreonine
molecule, can be detected by substituting these molecules for Erk-1 or Erk-2
in the following
assay.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
225
Specifically, assay plates are made by coating the wells of a 96-well ELISA
plate with
O.lml of protein G (lug/ml) for 2 hr at room temp, (RT). The plates are then
rinsed with
PBS and blocked with 3% BSA/PBS for 1 hr at RT. The protein G plates are then
treated
with 2 commercial monoclonal antibodies ( 1 OOng/well) against Erk-1 and Erk-2
( 1 hr at RT)
(Santa Cruz Biotechnology). (To detect other molecules, this step can easily
be modified by
substituting a monoclonal antibody detecting any of the above described
molecules.) After 3-
5 rinses with PBS, the plates are stored at 4 degree C until use.
A431 cells are seeded at 20,000/well in a 96-well Loprodyne filterplate and
cultured overnight in growth medium. The cells are then starved for 48 hr in
basal medium
(DMEM) and then treated with EGF (6ng/well) or 50 ul of the supernatants
obtained in
Example 9 for 5-20 minutes. The cells are then solubilized and extracts
filtered directly into
the assay plate.
After incubation with the extract for 1 hr at RT, the wells are again rinsed.
As a
positive control, a commercial preparation of MAP kinase (lOng/well) is used
in place of
is A431 extract. Plates are then treated with a commercial polyclonal (rabbit)
antibody (lug/ml)
which specifically recognizes the phosphorylated epitope of the Erk-1 and Erk-
2 kinases (1
hr at RT). This antibody is biotinylated by standard procedures. The bound
polyclonal
antibody is then quantitated by successive incubations with Europium-
streptavidin and
Europium fluorescence enhancing reagent in the Wallac DELFIA instrument (time-
resolved
zo fluorescence). An increased fluorescent signal over background indicates a
phosphorylation
by galectin 11 or a molecule induced by galectin 11.
Example 19: Method of Determining Alterations in the Galectin ll Gene
RNA isolated from entire families or individual patients presenting with a
phenotype
25 of interest (such as a disease) is be isolated. cDNA is then generated from
these RNA
samples using protocols known in the art. (See, Sambrook.) The cDNA is then
used as a
template for PCR, employing primers surrounding regions of interest in SEQ ID
NO:1.
Suggested PCR conditions consist of 35 cycles at 95 degree C for 30 seconds;
60-120 seconds
CA 02371611 2001-10-19
WO 00/63221 PCT/U500/10714
226
at 52-58 degree C; and 60-120 seconds at 70 degree C, using buffer solutions
described in
Sidransky, D., et al., Science 252:706 (1991).
PCR products are then sequenced using primers labeled at their 5' end with T4
polynucleotide kinase, employing SequiTherm Polymerase. (Epicentre
Technologies). The
intron-exon borders of selected exons of galectin 11 is also determined and
genomic PCR
products analyzed to confirm the results. PCR products harboring suspected
mutations in
galectin 11 is then cloned and sequenced to validate the results of the direct
sequencing.
PCR products of galectin 11 are cloned into T-tailed vectors as described in
Holton,
T.A. and Graham, M.W., Nucleic Acids Research, 19:1156 (1991) and sequenced
with T7
1o polymerase (United States Biochemical). Affected individuals are identified
by mutations in
galectin 11 not present in unaffected individuals.
Genomic rearrangements are also observed as a method of determining
alterations in a
gene corresponding to galectin 11. The full length galectin 11 cDNA amplified
according to
Example 1 is nick-translated with digoxigenindeoxy-uridine 5'-triphosphate
(Boehringer
t5 Manheim), and FISH performed as described in Johnson, Cg. et al., Methods
Cell Biol. 35:73-
99 (1991). Hybridization with the labeled probe is carried out using a vast
excess of human
cot-1 DNA for specific hybridization to the galectin 11 genomic locus.
Chromosomes are counterstained with 4,6-diamino-2-phenylidole and propidium
iodide, producing a combination of C- and R-bands. Aligned images for precise
mapping are
20 obtained using a triple-band filter set (Chroma Technology, Brattleboro,
VT) in combination
with a cooled charge-coupled device camera (Photometrics, Tucson, AZ) and
variable
excitation wavelength filters. (Johnson, Cv. et al., Genet. Anal. Tech. Appl.,
8:75 (1991).)
Image collection, analysis and chromosomal fractional length measurements are
performed
using the ISee Graphical Program System. (Inovision Corporation, Durham, NC.)
25 Chromosome alterations of the genomic region of galectin 11 (hybridized by
the probe) are
identified as insertions, deletions, and translocations. These galectin 11
alterations are used as
a diagnostic marker for an associated disease.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
227
Example 20: Method of Detecting Abnormal Levels of Galectin 11 in a Biological
Sample
Galeetin 11 polypeptides can be detected in a biological sample, and if an
increased or
decreased level of galectin 11 is detected, this polypeptide is a marker for a
particular
phenotype. Methods of detection are numerous, and thus, it is understood that
one skilled in
the art can modify the following assay to fit their particular needs.
For example, antibody-sandwich ELISAs are used to detect galeetin 11 in a
sample,
preferably a biological sample. Wells of a microtiter plate are coated with
specific antibodies
to galectin 11, at a final concentration of 0.2 to 10 ug/ml. The antibodies
are either
monoclonal or polyclonal and are produced by the method described in Example
8. The wells
1 o are blocked so that non-specific binding of galectin 11 to the well is
reduced.
The coated wells are then incubated for >2 hours at RT with a sample
containing
galectin 11. Preferably, serial dilutions of the sample should be used to
validate results. The
plates are then washed three times with deionized or distilled water to remove
unbounded
galectin 11.
Next, 50 ul of specific antibody-alkaline phosphatase conjugate, at a
concentration of
25-400 ng, is added and incubated for 2 hours at room temperature. The plates
are again
washed three times with deionized or distilled water to remove unbounded
conjugate.
Add 75 ul of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate
(NPP) substrate solution to each well and incubate 1 hour at room temperature.
Measure the
2o reaction by a microtiter plate reader. Prepare a standard curve, using
serial dilutions of a
control sample, and plot galectin 11 polypeptide concentration on the X-axis
(log scale) and
fluorescence or absorbance of the Y-axis (linear scale). Interpolate the
concentration of the
galectin 11 in the sample using the standard curve.
Example 21: Formulation
The invention also provides methods of treatment and/or prevention of diseases
or
disorders (such as, for example, any one or more of the diseases or disorders
disclosed herein)
by administration to a subject of an effective amount of a Therapeutic. By
therapeutic is
meant a polynucleotides or polypeptides of the invention (including fragments
and variants),
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
228
agonists or antagonists thereof, and/or antibodies thereto, in combination
with a
pharmaceutically acceptable carrier type (e.g., a sterile carrier).
The Therapeutic will be formulated and dosed in a fashion consistent with good
medical practice, taking into account the clinical condition of the individual
patient (especially
the side effects of treatment with the Therapeutic alone), the site of
delivery, the method of
administration, the scheduling of administration, and other factors known to
practitioners.
The "effective amount" for purposes herein is thus determined by such
considerations.
As a general proposition, the total pharmaceutically effective amount of the
Therapeutic administered parenterally per dose will be in the range of about
lug/kglday to 10
l0 mg/kg/day of patient body weight, although, as noted above, this will be
subject to
therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day,
and most
preferably for humans between about 0.01 and 1 mg/kglday for the hormone. If
given
continuously, the Therapeutic is typically administered at a dose rate of
about 1 ug/kglliour to
about 50 ug/kg/hour, either by 1-4 injections per day or by continuous
subcutaneous
infusions, for example, using a mini-pump. An intravenous bag solution may
also be
employed. The length of treatment needed to observe changes and the interval
following
treatment for responses to occur appears to vary depending on the desired
effect.
Therapeutics can be are administered orally, rectally, parenterally,
intracistemally,
intravaginally, intraperitoneally, topically (as by powders, ointments, gels,
drops or
transdermal patch), bucally, or as an oral or nasal spray. "Pharmaceutically
acceptable Garner"
refers to a non-toxic solid, semisolid or liquid filler, diluent,
encapsulating material or
formulation auxiliary of any. The term "parenteral" as used herein refers to
modes of
administration which include intravenous, intramuscular, intraperitoneal,
intrasternal,
subcutaneous and intraarticular injection and infusion.
Therapeutics of the invention are also suitably administered by sustained-
release
systems. Suitable examples of sustained-release Therapeutics are administered
orally,
rectally, parenterally, intracistemally, intravaginally, intraperitoneally,
topically (as by
powders, ointments, gels, drops or transdermal patch), bucally, or as an oral
or nasal spray.
"Pharmaceutically acceptable carrier" refers to a non-toxic solid, semisolid
or liquid filler,
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
229
diluent, encapsulating material or formulation auxiliary of any type. The term
"parenteral" as
used herein refers to modes of administration which include intravenous,
intramuscular,
intraperitoneal, intrasternal, subcutaneous and intraarticular injection and
infusion.
Therapeutics of the invention are also suitably administered by sustained-
release
systems. Suitable examples of sustained-release Therapeutics include suitable
polymeric
materials (such as, for example, semi-permeable polymer matrices in the form
of shaped
articles, e.g., films, or mirocapsules), suitable hydrophobic materials (for
example as an
emulsion in an acceptable oil) or ion exchange resins, and sparingly soluble
derivatives (such
as, for example, a sparingly soluble salt).
to Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919,
EP 58,481),
copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al.,
Biopolymers
22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (Larger et al., J.
Biomed. Mater.
Res. 15:167-277 (1981), and Larger, Chem. Tech. 12:98-105 (1982)), ethylene
vinyl acetate
(Larger et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988).
Sustained-release Therapeutics also include liposomally entrapped Therapeutics
of
the invention (see generally, Larger, Science 249:1527-1533 (1990); Treat et
al., in
Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and
Fidler
(eds.), Liss, New York, pp. 317 -327 and 353-365 (1989)). Liposomes containing
the
Therapeutic are prepared by methods known per se: DE 3,218,121; Epstein et
al., Proc. Natl.
Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad.
Sci.(USA)
77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641;
Japanese
Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324.
Ordinarily,
the liposomes are of the small (about 200-800 Angstroms) unilamellar type in
which the lipid
content is greater than about 30 mol. percent cholesterol, the selected
proportion being
adjusted for the optimal Therapeutic.
In yet an additional embodiment, the Therapeutics of the invention are
delivered by
way of a pump (see Larger, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201
(1987);
Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med.
321:574 (1989)).
CA 02371611 2001-10-19
WO 00/63221 PCTlUS00/10714
230
Other controlled release systems are discussed in the review by Langer
(Science
249:1527-1533 (1990)).
For parenteral administration, in one embodiment, the Therapeutic is
formulated
generally by mixing it at the desired degree of purity, in a unit dosage
injectable form
(solution, suspension, or emulsion), with a pharmaceutically acceptable
carrier, i.e., one that
is non-toxic to recipients at the dosages and concentrations employed and is
compatible with
other ingredients of the formulation. For example, the formulation preferably
does not
include oxidizing agents and other compounds that are known to be deleterious
to the
Therapeutic.
1o Generally, the formulations are prepared by contacting the Therapeutic
uniformly and
intimately with liquid carriers or finely divided solid carriers or both.
Then, if necessary, the
product is shaped into the desired formulation. Preferably the Garner is a
parenteral carrier,
more preferably a solution that is isotonic with the blood of the recipient.
Examples of such
carrier vehicles include water, saline, Ringer's solution, and dextrose
solution. Non-aqueous
vehicles such as fixed oils and ethyl oleate are also useful herein, as well
as liposomes.
The carrier suitably contains minor amounts of additives such as substances
that
enhance isotonicity and chemical stability. Such materials are non-toxic to
recipients at the
dosages and concentrations employed, and include buffers such as phosphate,
citrate,
succinate, acetic acid, and other organic acids or their salts; antioxidants
such as ascorbic acid;
low molecular weight (less than about ten residues) polypeptides, e.g.,
polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins;
hydrophilic
polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic
acid, aspartic
acid, or arginine; monosaccharides, disaccharides, and other carbohydrates
including cellulose
or its derivatives, glucose, manose, or dextrins; chelating agents such as
EDTA; sugar alcohols
such as mannitol or sorbitol; counterions such as sodium; and/or nonionic
surfactants such as
polysorbates, poloxamers, or PEG.
The Therapeutic is typically formulated in such vehicles at a concentration of
about
0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It
will be understood
CA 02371611 2001-10-19
WO 00/63221 PCTJUS00/10714
231
that the use of certain of the foregoing excipients, carriers, or stabilizers
will result in the
formation of polypeptide salts.
Any pharmaceutical used for therapeutic administration can be sterile.
Sterility is
readily accomplished by filtration through sterile filtration membranes (e.g.,
0.2 micron
membranes). Therapeutics generally are placed into a container having a
sterile access port,
for example, an intravenous solution bag or vial having a stopper pierceable
by a hypodermic
injection needle.
Therapeutics ordinarily will be stored in unit or mufti-dose containers, for
example,
sealed ampoules or vials, as an aqueous solution or as a lyophilized
formulation for
to reconstitution. As an example of a lyophilized formulation, 10-ml vials are
filled with 5 ml of
sterile-filtered 1% (wlv) aqueous Therapeutic solution, and the resulting
mixture is
lyophilized. The infusion solution is prepared by reconstituting the
lyophilized Therapeutic
using bacteriostatic Water-for-Injection.
The invention also provides a pharmaceutical pack or kit comprising one or
more
containers filled with one or more of the ingredients of the Therapeutics of
the invention.
Associated with such containers) can be a notice in the form prescribed by a
governmental
agency regulating the manufacture, use or sale of pharmaceuticals or
biological products,
which notice reflects approval by the agency of manufacture, use or sale for
human
administration. In addition, the Therapeutics may be employed in conjunction
with other
2o therapeutic compounds.
The Therapeutics of the invention may be administered alone or in combination
with
adjuvants. Adjuvants that may be administered with the Therapeutics of the
invention
include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-
PE (Biocine
Corp.), QS21 (Genentech, Inc.), BCG, and MPL. In a specific embodiment,
Therapeutics of
the invention are administered in combination with alum. In another specific
embodiment,
Therapeutics of the invention are administered in combination with QS-21.
Further adjuvants
that may be administered with the Therapeutics of the invention include, but
are not limited
to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005,
Aluminum salts, MF-59, and Virosomal adjuvant technology. Vaccines that may be
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
232
administered with the Therapeutics of the invention include, but are not
limited to, vaccines
directed toward protection against MMR (measles, mumps, rubella), polio,
varicella,
tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae B,
whooping cough,
pneumonia, influenza, Lyme's Disease, rotavirus, cholera, yellow fever,
Japanese encephalitis,
poliomyelitis, rabies, typhoid fever, and pertussis. Combinations may be
administered either
concomitantly, e.g., as an admixture, separately but simultaneously or
concurrently; or
sequentially. This includes presentations in which the combined agents are
administered
together as a therapeutic mixture, and also procedures in which the combined
agents are
administered separately but simultaneously, e.g., as through separate
intravenous lines into
1o the same individual. Administration "in combination" further includes the
separate
administration of one of the compounds or agents given first, followed by the
second.
The Therapeutics of the invention may be administered alone or in combination
with
other therapeutic agents. Therapeutic agents that may be administered in
combination with
the Therapeutics of the invention, include but not limited to, other members
of the TNF
family, chemotherapeutic agents, antibiotics, steroidal and non-steroidal anti-
inflammatories,
conventional immunotherapeutic agents, cytokines and/or growth factors.
Combinations may
be administered either concomitantly, e.g., as an admixture, separately but
simultaneously or
concurrently; or sequentially. This includes presentations in which the
combined agents are
administered together as a therapeutic mixture, and also procedures in which
the combined
2o agents are administered separately but simultaneously, e.g., as through
separate intravenous
lines into the same individual. Administration "in combination" further
includes the separate
administration of one of the compounds or agents given first, followed by the
second.
In one embodiment, the Therapeutics of the invention are administered in
combination
with members of the TNF family. TNF, TNF-related or TNF-like molecules that
may be
administered with the Therapeutics of the invention include, but are not
limited to, soluble
forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-
beta
(found in complex heterotrimer LT-alpha2-beta), OPGL, Fast, CD27L, CD30L,
CD40L, 4-
1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO 96/14328), AIM-
I
(International Publication No. WO 97/33899), endokine-alpha (International
Publication No.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
233
WO 98/07880), TR6 (International Publication No. WO 98/30694), OPG, and
neutrokine-
alpha (International Publication No. WO 98/18921, OX40, and nerve growth
factor (NGF),
and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2 (International
Publication No.
WO 96/34095), DR3 (International Publication No. WO 97/33904), DR4
(International
s Publication No. WO 98/32856), TRS (International Publication No. WO
98130693), TR6
(International Publication No. WO 98/30694), TR7 (International Publication
No. WO
98/41629), TRANK, TR9 (International Publication No. WO 98/56892),TR10
(International
Publication No. WO 98/54202), 312C2 (International Publication No. WO
98/06842), and
TR12, and soluble forms CD154, CD70, and CD153.
In certain embodiments, Therapeutics of the invention are administered in
combination with antiretroviral agents, nucleoside reverse transcriptase
inhibitors, non-
nucleoside reverse transcriptase inhibitors, and/or protease inhibitors.
Nucleoside reverse
transcriptase inhibitors that may be administered in combination with the
Therapeutics of
the invention, include, but are not limited to, RETROVIRT"" (zidovudine/AZT),
VIDEXT""
(didanosine/ddI), HIVIDr"' (zalcitabine/ddC), ZERITT"' (stavudine/d4T),
EPIVIRr""
(lamivudine/3TC), and COMBIVIRT"' (zidovudine/lamivudine). Non-nucleoside
reverse
transcriptase inhibitors that may be administered in combination with the
Therapeutics of
the invention, include, but are not limited to, VIRAMUNET"~ (nevirapine),
RESCRIPTORT""
(delavirdine), and SUSTIVAT"' (efavirenz). Protease inhibitors that may be
administered in
combination with the Therapeutics of the invention, include, but are not
limited to,
CRIXIVANT"' (indinavir), NORVIRr"' (ritonavir), INVIRASET"~ (saquinavir), and
VIRACEPTT"' (nelfmavir). In a specific embodiment, antiretroviral agents,
nucleoside reverse
transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors,
and/or protease
inhibitors may be used in any combination with Therapeutics of the invention
to treat AIDS
and/or to prevent or treat HIV infection.
In other embodiments, Therapeutics of the invention may be administered in
combination with anti-opportunistic infection agents. Anti-opportunistic
agents that may be
administered in combination with the Therapeutics of the invention, include,
but are not
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
234
limited to, TRIMETHOPRIM-SULFAMETHOXAZOLET"", DAPSONET"~,
PENTAMIDINET"~, ATOVAQUONET"", ISONIAZIDT"', RIFAMPINT"",
PYRAZINAMIDET"~,ETHAMBUTOLT"', RIFABUTINT"",
CLARITHROMYCINT"',
AZITHROMYCINT"' , GANCICLOVIRT"',FOSCARNETT"~, CIDOFOVIRT"",
FLUCONAZOLET"",ITRACONAZOLET"',KETOCONAZOLET"',ACYCLOVIRT"',
FAMCICOLVIRT"', PYRIMETHAMINET"', LEUCOVORINT"~,NEUPOGENT"'
(filgrastim/G-CSF), and LEUKINET"~ (sargramostim/GM-CSF). In a specific
embodiment,
Therapeutics of the invention are used in any combination with TRIMETHOPRIM-
SULFAMETHOXAZOLET"', DAPSONET"', PENTAMIDINET"', and/or ATOVAQUONET""
l0 to prophylactically treat or prevent an opportunistic Pneumocystis carinii
pneumonia
infection. In another specific embodiment, Therapeutics of the invention are
used in any
combination with ISONIAZIDT"~, RIFAMPINT"', PYRAZINAMIDET"', and/or
ETHAMBUTOLT"" to prophylactically treat or prevent an opportunistic
Mycobacterium
avium complex infection. In another specific embodiment, Therapeutics of the
invention are
used in any combination with RIFABUTINT"~, CLARITHROMYCINT"', and/or
AZITHROMYCINT"~ to prophylactically treat or prevent an opportunistic
Mycobacterium
tuberculosis infection. In another specific embodiment, Therapeutics of the
invention are
used in any combination with GANCICLOVIRT"", FOSCARNETT"", and/or CIDOFOVIRT""
to prophylactically treat or prevent an opportunistic cytomegalovirus
infection. In another
specific embodiment, Therapeutics of the invention are used in any combination
with
FLUCONAZOLET"~, ITRACONAZOLET"~, andlor KETOCONAZOLET"~ to
prophylactically treat or prevent an opportunistic fungal infection. In
another specific
embodiment, Therapeutics of the invention are used in any combination with
ACYCLOVIRT"" and/or FAMCICOLVIRT"' to prophylactically treat or prevent an
opportunistic herpes simplex virus type I andlor type II infection. In another
specific
embodiment, Therapeutics of the invention are used in any combination with
PYRIMETHAMINET"~ and/or LEUCOVORINT"~ to prophylaetically treat or prevent an
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
235
opportunistic Toxoplasma gondii infection. In another specific embodiment,
Therapeutics of
the invention are used in any combination with LEUCOVORINT"' and/or
NEUPOGENT"' to
prophylactically treat or prevent an opportunistic bacterial infection.
In a further embodiment, the Therapeutics of the invention are administered in
combination with an antiviral agent. Antiviral agents that may be administered
with the
Therapeutics of the invention include, but are not limited to, acyclovir,
ribavirin, amantadine,
and remantidine.
In a further embodiment, the Therapeutics of the invention are administered in
combination with an antibiotic agent. Antibiotic agents that may be
administered with the
to Therapeutics of the invention include, but are not limited to, amoxicillin,
beta-lactamases,
aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, Clindamycin,
chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin,
fluoroquinolones, macrolides, metronidazole, penicillins, quinolones,
rifampin, streptomycin,
sulfonamide, tetracyclines, trimethoprim, trimethoprim-sulfamthoxazole, and
vancomycin.
Conventional nonspecific immunosuppressive agents, that may be administered in
combination with the Therapeutics of the invention include, but are not
limited to, steroids,
cyclosporine, cyclosporine analogs, cyclophosphamide methylprednisone,
prednisone,
azathioprine, FK-506, 15-deoxyspergualin, and other immunosuppressive agents
that act by
suppressing the function of responding T cells.
2o In specific embodiments, Therapeutics of the invention are administered in
combination with immunosuppressants. Immunosuppressants preparations that may
be
administered with the Therapeutics of the invention include, but are not
limited to,
.ORTHOCLONET"~ (OKT3), SANDIMMUNET""/NEORALT"~/SANGDYAT"' (cyclosporin),
PROGRAFT"~ (tacrolimus), CELLCEPTT~" (mycophenolate), Azathioprine,
glucorticosteroids, and RAPAMUNET"~ (sirolimus). In a specific embodiment,
immunosuppressants may be used to prevent rejection of organ or bone marrow
transplantation.
In an additional embodiment, Therapeutics of the invention are administered
alone or
in combination with one or more intravenous immune globulin preparations.
Intravenous
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
236
immune globulin preparations that may be administered with the Therapeutics of
the
invention include, but not limited to, GAMMART"', IVEEGAMT"",
SANDOGLOBULINT"',
GAMMAGARD S/DT"~, and GAMIMUNET"". In a specific embodiment, Therapeutics of
the invention are administered in combination with intravenous immune globulin
preparations
in transplantation therapy (e.g., bone marrow transplant).
In an additional embodiment, the Therapeutics of the invention are
administered alone
or in combination with an anti-inflammatory agent. Anti-inflammatory agents
that may be
administered with the Therapeutics of the invention include, but are not
limited to,
glucocorticoids and the nonsteroidal anti-inflammatories, aminoarylcarboxylic
acid
l0 derivatives, arylacetic acid derivatives, arylbutyric acid derivatives,
arylcarboxylic acids,
arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid
derivatives,
thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-
hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome,
difenpiramide, ditazol,
emorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxaceprol,
paranyline, perisoxal,
pifoxime, proquazone, proxazole, and tenidap.
In another embodiment, compostions of the invention are administered in
combination with a chemotherapeutic agent. Chemotherapeutic agents that may be
administered with the Therapeutics of the invention include, but are not
limited to, antibiotic
derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and dactinomycin);
antiestrogens
(e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate,
floxuridine,
interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-
thioguanine); cytotoxic
agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside,
cyclophosphamide,
estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and
vincristine
sulfate); hormones (e.g., medroxyprogesterone, estramustine phosphate sodium,
ethinyl
estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol diphosphate,
chlorotrianisene, and testolactone); nitrogen mustard derivatives (e.g.,
mephalen, chorambucil,
mechlorethamine (nitrogen mustard) and thiotepa); steroids and combinations
(e.g.,
bethamethasone sodium phosphate); and others (e.g., dicarbazine, asparaginase,
mitotane,
vincristine sulfate, vinblastine sulfate, and etoposide).
CA 02371611 2001-10-19
WO 00/63221 PCT/USOOI10714
237
In a specific embodiment, Therapeutics of the invention are administered in
combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and
prednisone) or
any combination of the components of CHOP. In another embodiment, Therapeutics
of the
invention are administered in combination with Rituximab. In a further
embodiment,
Therapeutics of the invention are administered with Rituxmab and CHOP, or
Rituxmab and
any combination of the components of CHOP.
In an additional embodiment, the Therapeutics of the invention are
administered in
combination with cytokines. Cytokines that may be administered with the
Therapeutics of
the invention include, but are not limited to, IL2, IL3, IL4, ILS, IL6, IL7,
IL10, IL12, IL13,
1o IL15, anti-CD40, CD40L, IFN-gamma and TNF-alpha. In another embodiment,
Therapeutics of the invention may be administered with any interleukin,
including, but not
limited to, IL-lalpha, IL-lbeta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-
9, IL-10, IL-11,
IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, and IL-21.
In an additional embodiment, the Therapeutics of the invention are
administered in
combination with angiogenic proteins. Angiogenic proteins that may be
administered with the
Therapeutics of the invention include, but are not limited to, Glioma Derived
Growth Factor
(GDGF), as disclosed in European Patent Number EP-399816; Platelet Derived
Growth
Factor-A (PDGF-A), as disclosed in European Patent Number EP-682110; Platelet
Derived
Growth Factor-B (PDGF-B), as disclosed in European Patent Number EP-282317;
Placental
2o Growth Factor (P1GF), as disclosed in International Publication Number WO
92106194;
Placental Growth Factor-2 (P1GF-2), as disclosed in Hauser et al., Gorwth
Factors, 4:259-268
(1993); Vascular Endothelial Growth Factor (VEGF), as disclosed in
International Publication
Number WO 90113649; Vascular Endothelial Growth Factor-A (VEGF-A), as
disclosed in
European Patent Number EP-506477; Vascular Endothelial Growth Factor-2 (VEGF-
2), as
disclosed in International Publication Number WO 96/39515; Vascular
Endothelial Growth
Factor B (VEGF-3); Vascular Endothelial Growth Factor B-186 (VEGF-B186), as
disclosed
in International Publication Number WO 96/26736; Vascular Endothelial Growth
Factor-D
(VEGF-D), as disclosed in International Publication Number WO 98/02543;
Vascular
Endothelial Growth Factor-D (VEGF-D), as disclosed in International
Publication Number
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
238
WO 98/07832; and Vascular Endothelial Growth Factor-E (VEGF-E), as disclosed
in German
Patent Number DE19639601. The above mentioned references are incorporated
herein by
reference herein.
In an additional embodiment, the Therapeutics of the invention are
administered in
combination with hematopoietic growth factors. Hematopoietic growth factors
that may be
administered with the Therapeutics of the invention include, but are not
limited to,
LEUKINET"" (SARGRAMOSTIMT"") and NEUPOGENTM (FILGRASTIMT"')
In an additional embodiment, the Therapeutics of the invention are
administered in
combination with Fibroblast Growth Factors. Fibroblast Growth Factors that may
be
to administered with the Therapeutics of the invention include, but are not
limited to, FGF-1,
FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-
12,
FGF-13, FGF-14, and FGF-15.
In additional embodiments, the Therapeutics of the invention are administered
in
combination with other therapeutic or prophylactic regimens, such as, for
example, radiation
therapy.
Example 22: Method of Treating Decreased Levels of Galectin 11
The present invention relates to a method for treating an individual in need
of an
increased level of a polypeptide of the invention in the body comprising
administering to such
an individual a composition comprising a therapeutically effective amount of
an agonist of the
invention (including polypeptides of the invention). Moreover, it will be
appreciated that
conditions caused by a decrease in the standard or normal expression level of
galectin 11 in an
individual can be treated by administering a galectin 11 of the present
invention, preferably in
the secreted form. Thus, the invention also provides a method of treatment of
an individual in
need of an increased level of a galectin 11 polypeptide of the present
invention comprising
administering to such an individual a Therapeutic comprising an amount of that
galectin 11 to
increase the activity level of galectin 11 in such an individual.
For example, a patient with decreased levels of galectin 11 polypeptide
receives a
daily dose 0.1-100 ug/kg of the polypeptide for six consecutive days.
Preferably, the
CA 02371611 2001-10-19
WO 00/63221 PCT/LJS00/10714
239
polypeptide is in the secreted form. The exact details of the dosing scheme,
based on
administration and formulation, are provided in Example 20.
Example 23: Method of Treating Increased Levels of Galectin 11
The present invention also relates to a method of treating an individual in
need of a
decreased level of a polypeptide of the invention in the body comprising
administering to
such an individual a composition comprising a therapeutically effective amount
of an
antagonist of the invention (including polypeptides and antibodies of the
invention).
In one example, antisense technology is used to inhibit production of galectin
11. This
1o technology is one example of a method of decreasing levels of galectin 11
polypeptide,
preferably a secreted form, due to a variety of etiologies, such as cancer.
For example, a patient diagnosed with abnormally increased levels of galectin
11 is
administered intravenously antisense polynucleotides at 0.5, 1.0, 1.5, 2.0 and
3.0 mg/kg day
for 21 days. This treatment is repeated after a 7-day rest period if the
treatment was well
tolerated. The formulation of the antisense polynucleotide is provided in
Example 20.
Example 24: Method of Treatment Using Gene Therapy - Ex Vivo
One method of gene therapy transplants fibroblasts, which are capable of
expressing
galectin 11 polypeptides, onto a patient. Generally, fibroblasts are obtained
from a subject
2o by skin biopsy. The resulting tissue is placed in tissue-culture medium and
separated into
small pieces. Small chunks of the tissue are placed on a wet surface of a
tissue culture flask,
approximately ten pieces are placed in each flask. The flask is turned upside
down, closed
tight and left at room temperature over night. After 24 hours at room
temperature, the flask
is inverted and the chunks of tissue remain fixed to the bottom of the flask
and fresh media
(e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin) is added.
The flasks are
then incubated at 37 degree C for approximately one week.
At this time, fresh media is added and subsequently changed every several
days.
After an additional two weeks in culture, a monolayer of fibroblasts emerge.
The monolayer
is trypsinized and scaled into larger flasks.
CA 02371611 2001-10-19
WO 00!63221 PCTlUS00/10714
240
pMV-7 (Kirschmeier, P.T. et al., DNA, 7:219-25 (1988)), flanked by the long
terminal repeats of the Moloney marine sarcoma virus, is digested with EcoRI
and HindIII
and subsequently treated with calf intestinal phosphatase. The linear vector
is fractionated
on agarose gel and purified, using glass beads.
A cDNA of the present invention encoding galectin 11 can be amplified using
PCR
primers which correspond to the 5' and 3' end sequences respectively as set
forth in Example
1. Preferably, the 5' primer contains an EcoRI site and the 3' primer includes
a HindIII site.
Equal quantities of the Moloney marine sarcoma virus linear backbone and the
amplified
EcoRI and HindIII fragment are added together, in the presence of T4 DNA
ligase. The
1o resulting mixture is maintained under conditions appropriate for ligation
of the two fragments.
The ligation mixture is then used to transform bacteria HB101, which are then
plated onto
agar containing kanamycin for the purpose of confirming that the vector
contains properly
inserted galectin 11.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture
to
confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf
serum
(CS), penicillin and streptomycin. The MSV vector containing the galectin 11
gene is then
added to the media and the packaging cells transduced with the vector. The
packaging cells
now produce infectious viral particles containing the galectin 11 gene(the
packaging cells are
now referred to as producer cells).
2o Fresh media is added to the transduced producer cells, and subsequently,
the media is
harvested from a 10 cm plate of confluent producer cells. The spent media,
containing the
infectious viral particles, is filtered through a millipore filter to remove
detached producer
cells and this media is then used to infect fibroblast cells. Media is removed
from a sub-
confluent plate of fibroblasts and quickly replaced with the media from the
producer cells.
This media is removed and replaced with fresh media. If the titer of virus is
high, then
virtually all fibroblasts will be infected and no selection is required. If
the titer is very low,
then it is necessary to use a retroviral vector that has a selectable marker,
such as neo or his.
Once the fibroblasts have been efficiently infected, the fibroblasts are
analyzed to determine
whether galectin 11 protein is produced.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
241
The engineered fibroblasts are then transplanted onto the host, either alone
or after
having been grown to confluence on cytodex 3 microcarrier beads.
Example 25: Gene Therapy Using Endogenous Galectin Il Gene
Another method of gene therapy according to the present invention involves
operably
associating the endogenous galectin 11 sequence with a promoter via homologous
recombination as described, for example, in U.S. Patent No. 5,641,670, issued
June 24, 1997;
International Publication No. WO 96/29411, published September 26, 1996;
International
Publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc.
Natl. Acad. Sci.
to USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989).
This method
involves the activation of a gene which is present in the target cells, but
which is not
expressed in the cells, or is expressed at a lower level than desired.
Polynucleotide constructs are made which contain a promoter and targeting
sequences,
which are homologous to the 5' non-coding sequence of endogenous galectin 11,
flanking the
promoter. The targeting sequence will be sufficiently near the 5' end of
galectin 11 so the
promoter will be operably linked to the endogenous sequence upon homologous
recombination. The promoter and the targeting sequences can be amplified using
PCR.
Preferably, the amplified promoter contains distinct restriction enzyme sites
on the 5' and 3'
ends. Preferably, the 3' end of the first targeting sequence contains the same
restriction
2o enzyme site as the 5' end of the amplified promoter and the 5' end of the
second targeting
sequence contains the same restriction site as the 3' end of the amplified
promoter.
The amplified promoter and the amplified targeting sequences are digested with
the
appropriate restriction enzymes and subsequently treated with calf intestinal
phosphatase.
The digested promoter and digested targeting sequences are added together in
the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation
of the two fragments. The construct is size fractionated on an agarose gel
then purified by
phenol extraction and ethanol precipitation.
In this Example, the polynucleotide constructs are administered as naked
polynucleotides via electroporation. However, the polynucleotide constructs
may also be
CA 02371611 2001-10-19
WO 00!63221 PCT/US00/10714
242
administered with transfection-facilitating agents, such as liposomes, viral
sequences, viral
particles, precipitating agents, etc. Such methods of delivery are known in
the art.
Once the cells are transfected, homologous recombination will take place which
results
in the promoter being operably linked to the endogenous galectin 11 sequence.
This results in
the expression of galectin 11 in the cell. Expression may be detected by
immunological
staining, or any other method known in the art.
Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue
is placed
in DMEM + 10% fetal calf serum. Exponentially growing or early stationary
phase
fibroblasts are trypsinized and rinsed from the plastic surface with nutrient
medium. An
1o aliquot of the cell suspension is removed for counting, and the remaining
cells are subjected to
centrifugation. The supernatant is aspirated and the pellet is resuspended in
5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCI, 5 mM KCI, 0.7 mM Naz
HP04, 6 mM dextrose). The cells are recentrifuged, the supernatant aspirated,
and the cells
resuspended in electroporation buffer containing 1 mg/ml acetylated bovine
serum albumin.
The final cell suspension contains approximately 3X106 cells/ml.
Electroporation should be
performed immediately following resuspension.
Plasmid DNA is prepared according to standard techniques. For example, to
construct a plasmid for targeting to the galectin 11 locus, plasmid pUC 18
(MBI Fermentas,
Amherst, NY) is digested with HindIII. The CMV promoter is amplified by PCR
with an
2o XbaI site on the 5' end and a BamHI site on the 3'end. Two galectin 11 non-
coding sequences
are amplified via PCR: one galectin 11 non-coding sequence (galectin I 1
fragment 1 ) is
amplified with a HindIII site at the 5' end and an Xba site at the 3'end; the
other galectin 11
non-coding sequence (Galectin 11 fragment 2) is amplified with a BamHI site at
the 5'end and
a HindIII site at the 3'end. The CMV promoter and galectin 11 fragments (1 and
2) are
digested with the appropriate enzymes (CMV promoter - XbaI and BamHI; galectin
11
fragment 1 - Xbal; galectin 11 fragment 2 - BamH1) and ligated together. The
resulting
ligation product is digested with HindIII, and ligated with the HindIII-
digested pUCl8
plasmid.
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
243
Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap (Bio-
Rad). The
final DNA concentration is generally at least 120 pg/ml. 0.5 xnl of the cell
suspension
(containing approximately 1.5.X106 cells) is then added to the cuvette, and
the cell
suspension and DNA solutions are gently mixed. Electroporation is performed
with a
Gene-Pulser apparatus (Bio-Rad). Capacitance and voltage are set at 960 pF and
250-300 V,
respectively. As voltage increases, cell survival decreases, but the
percentage of surviving cells
that stably incorporate the introduced DNA into their genome increases
dramatically. Given
these parameters, a pulse time of approximately 14-20 mSec should be observed.
Electroporated cells are maintained at room temperature for approximately 5
min, and
1o the contents of the cuvette are then gently removed with a sterile transfer
pipette. The cells
are added directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf
serum) in a
cm dish and incubated at 37 degree C. The following day, the media is
aspirated and
replaced with 10 ml of fresh media and incubated for a further 16-24 hours.
The engineered fibroblasts are then injected into the host, either alone or
after having
is been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts
now produce the
protein product. The fibroblasts can then be introduced into a patient as
described above.
Example 26: Method of Treatment Using Gene Therapy - In Vivo
Another aspect of the present invention is using in vivo gene therapy methods
to
2o treat disorders, diseases and conditions. The gene therapy method relates
to the introduction
of naked nucleic acid (DNA, RNA, and antisense DNA or RNA) galectin 11
sequences into
an animal to increase or decrease the expression of the galectin 11
polypeptide. The galectin
11 polynucleotide may be operatively linked to a promoter or any other genetic
elements
necessary for the expression of the galectin 11 polypeptide by the target
tissue. Such gene
25 therapy and delivery techniques and methods are known in the art, see, for
example,
W090/11092, W098/11779; U.S. Patent NO. 5693622, 5705151, 5580859; Tabata H.
et al.
(1997) Cardiovasc. Res. 35(3):470-479, Chao J et al. (1997) Pharmacol. Res.
35(6):517-522,
WolffJ.A. (1997) Neuromuscul. Disord. 7(5):314-318, Schwartz B. et al. (1996)
Gene Ther.
CA 02371611 2001-10-19
WO 00/63221 PCTliJS00/10714
244
3(5):405-411, Tsurumi Y. et al. (1996) Circulation 94(12):3281-3290
(incorporated herein by
reference).
The galectin 11 polynucleotide constructs may be delivered by any method that
delivers injectable materials to the cells of an animal, such as, injection
into the interstitial
space of tissues (heart, muscle, skin, lung, liver, intestine and the like).
The galectin 11
polynucleotide constructs can be delivered in a pharmaceutically acceptable
liquid or aqueous
corner.
The term "naked" polynucleotide, DNA or RNA, refers to sequences that are free
from any delivery vehicle that acts to assist, promote, or facilitate entry
into the cell,
to including viral sequences, viral particles, liposome formulations,
lipofectin or precipitating
agents and the like. However, the galectin 11 polynucleotides may also be
delivered in
liposome formulations (such as those taught in Felgner P.L. et al. (1995) Ann.
NY Acad. Sci.
772:126-139 and Abdallah B. et al. (1995) Biol. Cell 85(1):1-7) which can be
prepared by
methods well known to those skilled in the art.
The galectin 11 polynucleotide vector constructs used in the gene therapy
method are
preferably constructs that will not integrate into the host genome nor will
they contain
sequences that allow for replication. Any strong promoter known to those
skilled in the art
can be used for driving the expression of DNA. Unlike other gene therapies
techniques, one
major advantage of introducing naked nucleic acid sequences into target cells
is the transitory
2o nature of the polynucleotide synthesis in the cells. Studies have shown
that non-replicating
DNA sequences can be introduced into cells to provide production of the
desired polypeptide
for periods of up to six months.
The galectin 11 polynucleotide construct can be delivered to the interstitial
space of
tissues within the an animal, including of muscle, skin, brain, lung, liver,
spleen, bone marrow,
thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder,
stomach,
intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, and
connective tissue.
Interstitial space of the tissues comprises the intercellular fluid,
mucopolysaccharide matrix
among the reticular fibers of organ tissues, elastic fibers in the walls of
vessels or chambers,
collagen fibers of fibrous tissues, or that same matrix within connective
tissue ensheathing
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
245
muscle cells or in the lacunae of bone. It is similarly the space occupied by
the plasma of the
circulation and the lymph fluid of the lymphatic channels. Delivery to the
interstitial space
of muscle tissue is preferred for the reasons discussed below. They may be
conveniently
delivered by injection into the tissues comprising these cells. They are
preferably delivered to
and expressed in persistent, non-dividing cells which are differentiated,
although delivery and
expression may be achieved in non-differentiated or less completely
differentiated cells, such
as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells
are particularly
competent in their ability to take up and express polynucleotides.
For the naked galectin 11 polynucleotide injection, an effective dosage amount
of
1o DNA or RNA will be in the range of from about 0.05 glkg body weight to
about 50 mg/kg
body weight. Preferably the dosage will be from about 0.005 mg/kg to about 20
mg/kg and
more preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the
artisan of
ordinary skill will appreciate, this dosage will vary according to the tissue
site of injection.
The appropriate and effective dosage of nucleic acid sequence can readily be
determined by
those of ordinary skill in the art and may depend on the condition being
treated and the route
of administration. The preferred route of administration is by the parenteral
route of injection
into the interstitial space of tissues. However, other parenteral routes may
also be used, such
as, inhalation of an aerosol formulation particularly for delivery to lungs or
bronchial tissues,
throat or mucous membranes of the nose. In addition, naked galectin 11
polynucleotide
2o constructs can be delivered to arteries during angioplasty by the catheter
used in the
procedure.
The dose response effects of injected galectin 11 polynucleotide in muscle in
vivo is
determined as follows. Suitable galectin 11 template DNA for production of
mRNA coding
for galectin 11 polypeptide is prepared in accordance with a standard
recombinant DNA
methodology. The template DNA, which may be either circular or linear, is
either used as
naked DNA or complexed with liposomes. The quadriceps muscles of mice are then
injected
with various amounts of the template DNA.
Five to six week old female and male Balb/C mice are anesthetized by
intraperitoneal
injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is made on the
anterior thigh, and
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
246
the quadriceps muscle is directly visualized. The galectin 11 template DNA is
injected in 0.1
ml of carrier in a 1 cc syringe through a 27 gauge needle over one minute,
approximately 0.5
cm from the distal insertion site of the muscle into the knee and about 0.2 cm
deep. A suture
is placed over the injection site for future localization, and the skin is
closed with stainless
steel clips.
After an appropriate incubation time (e.g., 7 days) muscle extracts are
prepared by
excising the entire quadriceps. Every fifth 15 um cross-section of the
individual quadriceps
muscles is histochemically stained for galectin 11 protein expression. A time
course for
galectin 11 protein expression may be done in a similar fashion except that
quadriceps from
to different mice are harvested at different times. Persistence of galectin 11
DNA in muscle
following injection may be determined by Southern blot analysis after
preparing total cellular
DNA and HIRT supernatants from injected and control mice. The results of the
above
experimentation in mice can be use to extrapolate proper dosages and other
treatment
parameters in humans and other animals using galectin 11 naked DNA.
Example 27: Galectin ll Transgenic Animals.
The galectin 11 polypeptides can also be expressed in transgenic animals.
Animals of
any species, including, but not limited to, mice, rats, rabbits, hamsters,
guinea pigs, pigs,
micro-pigs, goats, sheep, cows and non-human primates, e.g., baboons, monkeys,
and
chimpanzees may be used to generate transgenic animals. In a specific
embodiment,
techniques described herein or otherwise known in the art, are used to express
polypeptides
of the invention in humans, as part of a gene therapy protocol.
Any technique known in the art may be used to introduce the transgene (i.e.,
polynucleotides of the invention) into animals to produce the founder lines of
transgenic
animals. Such techniques include, but are not limited to, pronuclear
microinjection (Paterson
et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994); Carver et al.,
Biotechnology (NY)
I 1:1263-1270 (1993); Wright et al., Biotechnology (NY) 9:830-834 (1991); and
Hoppe et al.,
U.S. Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into germ
lines (Van der
Putten et al., Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts
or embryos;
CA 02371611 2001-10-19
WO 00/63221 PCT/US00/10714
247
gene targeting in embryonic stem cells (Thompson et al., Cell 56:313-321
(1989));
electroporation of cells or embryos (Lo, 1983, Mol Cell. Biol. 3:1803-1814
(1983));
introduction of the polynucleotides of the invention using a gene gun (see,
e.g., Ulmer et al.,
Science 259:1745 (1993); introducing nucleic acid constructs into embryonic
pleuripotent
stem cells and transferring the stem cells back into the blastocyst; and sperm-
mediated gene
transfer (Lavitrano et al., Cell 57:717-723 (1989); etc. For a review of such
techniques, see
Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989), which is
incorporated
by reference herein in its entirety.
Any technique known in the art may be used to produce transgenic clones
containing
to polynucleotides of the invention, for example, nuclear transfer into
enucleated oocytes of
nuclei from cultured embryonic, fetal, or adult cells induced to quiescence
(Campell et al.,
Nature 380:64-66 (1996); Wilmut et al., Nature 385:810-813 (1997)).
The present invention provides for transgenic animals that carry the transgene
in all
their cells, as well as animals which carry the transgene in some, but not all
their cells, i.e.,
mosaic animals or chimeric. The transgene may be integrated as a single
transgene or as
multiple copies such as in concatamers, e.g., head-to-head tandems or head-to-
tail tandems.
The transgene may also be selectively introduced into and activated in a
particular cell type
by following, for example, the teaching of Lasko et al. (Lasko et al., Proc.
Natl. Acad. Sci.
USA 89:6232-6236 (1992)). The regulatory sequences required for such a cell-
type specific
activation will depend upon the particular cell type of interest, and will be
apparent to those
of skill in the art. When it is desired that the polynucleotide transgene be
integrated into the
chromosomal site of the endogenous gene, gene targeting is preferred.
Briefly, when such a technique is to be utilized, vectors containing some
nucleotide
sequences homologous to the endogenous gene are designed for the purpose of
integrating, via
homologous recombination with chromosomal sequences, into and disrupting the
function of
the nucleotide sequence of the endogenous gene. The transgene may also be
selectively
introduced into a particular cell type, thus inactivating the endogenous gene
in only that cell
type, by following, for example, the teaching of Gu et al. (Gu et al., Science
265:103-106
(1994)). The regulatory sequences required for such a cell-type specific
inactivation will
CA 02371611 2001-10-19
WO 00!63221 PCT/US00110714
248
depend upon the particular cell type of interest, and will be apparent to
those of skill in the
art. The contents of each of the documents recited in this paragraph is herein
incorporated by
reference in its entirety.
Any of the galectin 11 polypeptides disclosed throughout this application can
be used
to generate transgenic animals. For example, the DNA encoding galectin 11
protein can be
inserted into a vector using a primer, such as: A 5' primer containing the
underlined SmaI
restriction site shown: 5' cgc CCC GGG GCCT ATGAGCCCCAGGCTGGAGG 3' (SEQ
ID N0:7) and a 3' primer sequence 5' cgc GGT ACC TCAGGAGTGGACACAGTAG 3'
(SEQ ID N0:8) containing the underlined Asp718 restriction site followed by
nucleotides
l0 complementary to position 432 to 450 of the galectin 11 nucleotide sequence
depicted in
Figure 1 (SEQ ID NO:1). Besides these two examples, other fragments of
galectin 11 can also
be inserted into a vector to create transgenics having ubiquitous expression.
Alternatively, polynucleotides of the invention can be inserted in a vector
which
controls tissue specific expression through a tissue specific promoter. For
example, a
construct having a transferrin promoter would express the galectin 11
polypeptide in the liver
of transgenic animals. Therefore, DNA encoding the full length galectin 1 I
protein can also be
inserted into a vector for tissue specific expression using the following
primers: A 5' primer
containing the underlined SmaI restriction site shown: 5' cgc CCC GGG GCCT
ATGAGCCCCAGGCTGGAGG 3' (SEQ ID N0:7) and a 3' primer, containing the
2o underlined Asp 178 restriction site shown: S' cgc GGT ACC
TCAGGAGTGGACACAGTAG 3' (SEQ ID N0:8)
In addition to expressing the polypeptide of the present invention in a
ubiquitous or
tissue specific manner in transgenic animals, it would also be routine for one
skilled in the art
to generate constructs which regulate expression of the polypeptide by a
variety of other
means (for example, developmentally or chemically regulated expression).
Once transgenic animals have been generated, the expression of the recombinant
gene
may be assayed utilizing standard techniques. Initial screening may be
accomplished by
Southern blot analysis or PCR techniques to analyze animal tissues to verify
that integration
of the transgene has taken place. The level of mRNA expression of the
transgene in the
DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPRI~:ND PLUS D'UN TOME.
CECI EST L,E TOME 1 DE 2
NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des
Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.
THIS IS VOLUME 1 OF 2
NOTE: For additional valumes please contact the Canadian Patent Office.
