Note: Descriptions are shown in the official language in which they were submitted.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
1
HIV IMMUNOGENIC COMPOSITIONS AND METHODS
BACKGROUND INFORMATION
This invention relates to Acquired
Immunodeficiency Syndrome (AIDS) and, more specifically,
to immunogenic compositions for use in preventing and
treating AIDS.
More than 30 million people world wide are now
infected with the human immunodeficiency virus (HIV), the
virus responsible for AIDS. About 900 of HIV infected
individuals live in developing countries, including sub-
Saharan Africa and parts of South-East Asia, although the
HIV epidemic is rapidly spreading throughout the world.
Anti-viral therapeutic drugs that reduce viral burden and
slow the progression to AIDS have recently become
available. However,, these drugs are prohibitively
expensive for use in developing nations. Thus, there
remains an urgent need to develop effective preventative
and therapeutic vaccines to curtail the global AIDS
epidemic.
To date, HIV has proven a difficult target for
effective vaccine development. Because of the propensity
of HIV to rapidly mutate, there are now numerous strains
predominating in different parts of the world whose
epitopes differ. Additionally, in a particular infected
individual, an HIV virus car. escape from the control of
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
2
the host immune system by developing mutations in an
epitope. There remains a need to develop improved HIV
vaccines that stimulate the immune system to recognize a
broad spectrum of conserved epitopes, including epitopes
from the p24 core antigen.
During the 1990's, more than 30 different
candidate HIV-1 vaccines entered human clinical trials.
These vaccines elicit various humoral and cellular immune
responses, which differ in type and strength depending on
the particular vaccine components. There remains a need
to develop HIV vaccine compositions that strongly elicit
the particular immune responses correlated with
protection against HIV infection.
The nature of protective HIV immune responses
has been addressed through studies of individuals who
have remained uninfected despite repeated exposure to
HIV, or who have been infected with HIV for many years
without developing AIDS. These studies have shown that
immune responses of the T helper 1 (Thl) type correlate
well with protection against HIV infection and subsequent
disease progression. Besides antigen-specific Th1
responses, CD8+ cytotoxic T cell responses are considered
important in preventing initial HIV infection and disease
progression. During an effective anti-viral immune
response, activated CD8+ T cells directly kill virus-
infected cells and secrete cytokines with antiviral
activity.
The ~3-chemokine system also appears to be
important in protection against initial HIV infection and
disease progression. Infection of immune cells by most
primary isolates of HIV requires interaction of the virus
with CCRS, whose normal biological role is as the
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
3
principal receptor for the (3-chemokines RANTES, MIP-la
and MIP-(3. Genetic polymorphisms resulting in decreased
expression of the CCR5 receptor have been shown to
provide resistance to HIV infection. Additionally, a
significant correlation between (3-chemokine levels and
resistance to HIV infection, both in exposed individuals
and in cultured cells, has been demonstrated. It has
been suggested that (3-chemokines may block HIV
infectivity by several mechanisms, including competing
with or interfering with HIV binding to CCR5, and
downregulating surface CCR5.
Because of the importance of (3-chemokines in
preventing initial HIV infection and disease progression,
an effective HIV immunogenic composition should induce
high levels of (3-chemokine production, both prior to
infection and in response to infectious virus. However,
HIV immunogenic compositions capable of inducing high
levels of ~i-chemokine production have not been described.
In particular, immunogenic compositions which stimulate
high levels of ~3-chemokine production, induce HIV-
specific Thl cellular and humoral immune responses, and
induce HIV-specific cytotoxic activity, have not been
described.
Compositions that elicit certain types of HIV-
specific immune responses may not elicit other important
protective responses. For example, Deml et al., Clin.
Chem. Lab. Med. 37:199-204 (1999), describes a vaccine
containing an HIV-1 gp160 envelope antigen, an
immunostimulatory DNA sequence and alum adjuvant, which,
despite inducing an antigen-specific Thl-type cytokine
response, was incapable of inducing an antigen-specific
cytotoxic T lymphocyte response. Furthermore, a vaccine
containing only envelope antigens would not be expected
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
4
to induce an immune response against the more highly
conserved core proteins of HIV.
Thus, there exists a need for immunogenic
compositions and methods that will prevent HIV infection
as well as slow progression to AIDS in infected
individuals. Ideally, such compositions and methods will
elicit potent Thl cellular and humoral immune responses
specific for conserved HIV epitopes, elicit HIV-specific
cytotoxic T lymphocyte activity, and stimulate production
of high levels of (3-chemokines. Such vaccines could be
used to prevent maternal transmission of HIV, for
vaccination of newborns, children and high-risk
individuals, and for vaccination of infected individuals.
Such vaccines could also be used in combination with
I5 other HIV therapies, including protease inhibitors. The
present invention satisfies this need and provides
related advantages as well.
SUMMARY OF THE INVENTION
The invention provides immunogenic compositions
which enhance ~-chemokine levels in a mammal. The
immunogenic compositions contain an HIV antigen, an
isolated nucleic acid molecule containing an
immunostimulatory sequence (ISS) and an adjuvant. The
HIV antigen can be a whole-killed HIV virus devoid of
outer envelope protein gp120. Alternatively, the HIV
antigen can be a whole-killed HIV virus, or a p24
antigen.
In the immunogenic compositions of the
invention, the isolated nucleic acid molecule containing
an ISS can be an oligodeoxynucleotide. The isolated
nucleic acid molecule containing an ISS can contain two
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
or more CpG sequences. Exemplary ISS-containing nucleic
acid molecules contain the motif 5'-Cytosine, Guanine,
Pyrimidine, Pyrimidine-3'. The isolated nucleic acid
molecule can contain a phosphorothioate backbone. The
5 isolated nucleic acid molecule can be conjugated to the
HIV antigen.
In the immunogenic compositions of the
invention, the adjuvant can be suitable for
administration to a human. An exemplary adjuvant is
Incomplete Freund's Adjuvant.
The immunogenic compositions of the invention
can further enhance HIV-specific IgG2b antibody
production in a mammal. The immunogenic compositions of
the invention can also enhance an HIV-specific cytotoxic
T lymphocyte response in a mammal.
Also provided are kits, which contain an HIV
antigen, an isolated nucleic acid molecule containing an
immunostimulatory sequence (ISS) and an adjuvant. The
components of the kits, when combined, produce the
immunogenic compositions of the invention.
The invention also provides methods of making
the immunogenic compositions, by combining an HIV
antigen, an isolated nucleic acid molecule containing an
immunostimulatory sequence (ISS) and an adjuvant. The
components can be combined ex vivo or in vivo to arrive
at the immunogenic compositions.
The invention also provides a method of
immunizing a mammal, by enhancing ~-chemokine production
in the mammal by administering to the mammal an
immunogenic composition containing an HIV antigen, an
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
6
isolated nucleic acid molecule containing an
immunostimulatory sequence (ISS) and an adjuvant. Also
provided is a method of inhibiting AIDS, by enhancing ~-
chemokine production in the mammal by administering to
the mammal an immunogenic composition containing an HIV
antigen, an isolated nucleic acid molecule containing an
immunostimulatory sequence (ISS) and an adjuvant. In the
methods of the invention, the mammal can be a primate,
such as a human, or a rodent. In certain embodiments of
the method, the primate is a pregnant mother or an
infant. A human can be HIV seronegative or HIV
seropositive. The immunogenic compositions can
advantageously be administered to the mammal two or more
times.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures lA and 1B show control and antigen-
stimulated interferon-y (IFN-Y) production for indicated
treatment groups.
Figures 2A and 2B show production of total IgG,
IgGl and IgG2 isotypes for indicated treatment groups.
Figures 3A and 3B show control and antigen-
stimulated RANTES production for indicated treatment
groups.
Figure 4A shows a comparison of IFN-Y
production following treatment with two different
immunostimuatory sequences.
Figure 4B shows a comparison of IFN-y
production following treatment with two different
immunostimuatory sequences.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
7
Figure 5A shows HIV antigen-stimulated IFN-Y
production from peripheral blood mononuclear cells.
Figure 5B shows HIV antigen-stimulated IFN-Y
production from CD4+ cells.
Figure 5C shows HIV antigen-stimulated IFN-Y
production from CD8+ cells.
Figure 6A shows production of total anti-p24
IgG for indicated treatment groups.
Figure 6B shows production of anti-p24 IgGl and
IgG2 isotypes for indicated treatment groups.
Figure 7A shows control and antigen-stimulated
IFN-y production for different treatment groups.
Figure 7B shows control and antigen-stimulated
RANTES production for different treatment groups.
I5 Figure 7C shows production of total anti-p24
IgG for different treatment groups.
Figure 7D shows production of anti-p24 IgGl and
IgG2 isotypes for different treatment groups.
Figure 7E shows T cell proliferative responses
to HIV antigens for different treatment groups.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides immunogenic HIV
compositions containing an HIV antigen, an isolated
nucleic acid molecule containing an immunostimulatory
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
8
sequence, and an adjuvant. Also provided are kits
containing the components of such compositions, for use
together. The invention also provides methods of
immunizing a mammal with such compositions, or with the
components of such compositions, so as to enhance
production of (3-chemokines in the immunized mammal.
Advantageously, the compositions of the invention can
also induce potent Thl immune responses against a broad
spectrum of HIV epitopes, and provide a strong HIV-
specific cytotoxic T lymphocyte response. Thus, the
immunogenic compositions of the invention are useful for
preventing HIV infection and slowing progression to AIDS
in infected individuals.
As used herein, the term "HIV" refers to all
forms, subtypes and variations of the HIV virus, and is
synonymous with the older terms HTLVIII and LAV. Various
cell lines permanently infected with the HIV virus have
been developed and deposited with the ATCC, including
those having accession numbers CCL 214, TIB 161, CRL 1552
and CRL 8543, all of which are described in U.S. Pat. No.
4,725,669 and Gallo, Scientific American 256:46 (1987).
As used herein, the term "whole-killed HIV
virus" refers to an intact, inactivated HIV virus.
As used herein, the term "outer envelope
protein" refers to that portion of the membrane
glycoprotein of a retrovirus which protrudes beyond the
membrane, as opposed to the transmembrane protein, gp4l.
As used herein, the term "HIV virus devoid of
outer envelope proteins" refers to a preparation of HIV
particles or HIV gene products devoid of the outer
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
9
envelope protein gp120, but contains the more genetically
conserved parts of the virus (eg. p24 and gp41).
As used herein, the term "HIV p24 antigen"
refers to the gene product of the gag region of HIV,
characterized as having an apparent relative molecular
weight of about 24,000 daltons designated p24. The term
"HIV p24 antigen" also refers to modifications and
fragments of p24 having the immunological activity of
p24. Those skilled in the art can determine appropriate
modifications of p24, such as additions, deletions or
substitutions of natural amino acids or amino acid
analogs, that serve, for example, to increase its
stability or bioavailability or facilitate its
purification, without destroying its immunological
acitivity. Likewise, those skilled in the art can
determine appropriate fragments of p24 having the
immunological activity of p24. An immunologically active
fragment of p24 can have from 6 residues from the
polypeptide up to the full length polypeptide minus one
amino acid.
As used herein, the term "immunostimulatory
sequence" or "ISS" refers to a nucleotide sequence
containing an unmethylated CpG motif that is capable of
enhancing the immune response in a mammal when
administered in combination with an antigen.
Immunostimulatory sequences are described, for example,
in PCT publication WO 98/55495.
As ISS can contain, for example, at least one
sequence consisting of 5'-Cytosine, Guanine, Pyrimidine,
Pyrimidine-3'. For example, the sequence 5'-CGTT-3' is
found in two copies in the sequence designated SEQ ID
N0:1, described in Example I, and one copy each of the
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
sequence 5'-CGTT-3' and the sequence 5'-CGCT-3' are found
in the sequence designated SEQ ID N0:4, described in
Example IV.
An ISS can contain the hexameric motif 5'-
5 Purine, Purine, Cytosine, Guanine, Pyrimidine,
Pyrimidine-3', such as the motif 5'-GACGTT-3', two copies
of which are found in the nucleotide sequence designated
SEQ ID N0:1. An ISS can also contain, for example,
either the octameric motif 5'-Purine, Purine, Cytosine,
10 Guanine, Pyrimidine, Pyrimidine, Cytosine, Cytosine-3' or
5'-Purine, Purine, Cytosine, Guanine, Pyrimidine,
Pyrimidine, Cytosine, Guanine-3', such as the sequence
5'-AACGTTCG-3'. An exemplary isolated nucleic acid
molecule containing the ISS motif 5'-AACGTTCG -3' has the
nucleotide sequence designated SEQ ID N0:2, as described
in Example I.
An ISS can contain more than one unmethylated
CpG motif, such as two or more CpG motifs. An exemplary
isolated nucleic acid molecule containing two CpG motifs
has the nucleotide sequence designated SEQ ID N0:1 or the
sequence designated SEQ ID N0:2, described in Example I,
below. An exemplary isolated nucleic acid molecule
containing three unmethylated CpG motifs has the
nucleotide sequence designated SEQ ID N0:4, as described
in Example IV. SEQ ID N0:4 also contains two copies of
the hexameric motif 5'-Purine, Pyrimidine, Cytosine,
Guanine, Pyrimidine, Pyrimidine-3', namely both the
sequence 5'-GTCGCT-3' and the sequence 5'-GTCGTT-3'.
As used herein, the term "nucleic acid molecule
containing an ISS" refers to a linear, circular or
branched single- or double-stranded DNA or RNA nucleic
acid that contains an immunostimulatory sequence. The
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
11
term "isolated," with reference to a nucleic acid
molecule containing an ISS, is intended to distinguish
the ISS-containing nucleic acid molecule from an ISS that
may naturally be present in a whole-killed HIV virus
preparation. A nucleic acid molecule containing an ISS
can contain multiple ISSs. The ISSs can be adjacent
within the nucleic acid molecule, or they can be
separated by additional nucleotide bases within the
nucleic acid molecule. Such a nucleic acid molecule can
be of any length greater than 6 bases or base pairs, and
is preferably greater than about 15 bases or base pairs,
such as greater than about 20 bases or base pairs, and
can be several kb in length.
A nucleic acid molecule containing an ISS can
be, for example, a synthetic oligonucleotide, a naturally
occurring nucleic acid molecule of any species, or a
vector. A nucleic acid molecule containing an ISS can
contain either natural or modified nucleotides or natural
or unnatural nucleotide linkages. Modifications known in
the art, include, for example, modifications of the 3'OH
or 5'OH group, modifications of the nucleotide base,
modifications of the sugar component, and modifications
of the phosphate group. An unnatural nucleotide linkage
can be, for example, a phosphorothioate linkage in place
of a phosphodiester linkage, which increases the
resistance of the nucleic acid molecule to nuclease
degradation. Various modifications and linkages are
described, for example, in PCT publication WO 98/55495.
As used herein, the term "adjuvant" refers to a
substance which, when added to an immunogenic agent,
nonspecifically enhances or potentiates an immune
response to the agent in the recipient host upon exposure
to the mixture. Adjuvants can include, for example,
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
12
oil-in-water emulsions, water-in oil elmulsions, alum
(aluminum salts), liposomes and microparticles, such as
polysytrene, starch, polyphosphazene and
polylactide/polyglycosides. Adjuvants can also include,
for example, squalene mixtures (SAF-I), muramyl peptide,
saponin derivatives, mycobacterium cell wall
preparations, monophosphoryl lipid A, mycolic acid
derivatives, nonionic block copolymer surfactants, Quil
A, cholera toxin B subunit, polyphosphazene and
derivatives, and immunostimulating complexes (ISCOMs)
such as those described by Takahashi et al. (1990) Nature
344:873-875. For veterinary use and for production of
antibodies in animals, mitogenic components of Freund's
adjuvant (both complete and incomplete) can be used. In
humans, Incomplete Freund's Adjuvant (IFA) is a preferred
adjuvant. Various appropriate adjuvants are well known
in the art and are reviewed, for example, by Warren and
Chedid, CRC Critical Reviews in Immunoloay 8:83 (1988).
As used herein, "AIDS" refers to the
symptomatic phase of HIV infection, and includes both
Acquired Immune Deficiency Syndrome (commonly known as
AIDS) and "ARC," or AIDS-Related Complex, as described by
Adler, Brit. Med. J. 294: 1145 (1987). The immunological
and clinical manifestations of AIDS are well known in the
art and include, for example, opportunistic infections
and cancers resulting from immune deficiency.
As used herein, the term ~~inhibiting AIDS"
refers to a beneficial prophylactic or therapeutic effect
of the immunogenic composition in relation to HIV
infection or AIDS symptoms. Such beneficial effects
include, for example, preventing initial infection of an
individual exposed to HIV; reducing viral burden in an
individual infected with HIV; prolonging the asymptomatic
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
13
phase of HIV infection; increasing overall health or
quality of life in an individual with AIDS; and
prolonging life expectency of an individual with AIDS. A
clinician can compare the effect of immunization with the
patient's condition prior to treatment, or with the
expected condition of an untreated patient, to determine
whether the treatment is effective in inhibiting AIDS.
As used herein, the term "~-chemokine" refers
to a member of a class of small, chemoattractive
polypeptides that includes RANTES, macrophage
inflammatory protein-1(3 (MIP-lei) and macrophage
inflammatory protein-la (MIP-la). The physical and
functional properties of (3-chemokines are well known in
the art.
As used herein, the term "enhances," with
respect to an immune response such as (3-chemokine
production, IgG2b production or cytotoxic T lymphocyte
activity, is intended to mean that the immunogenic
composition elicits a greater immune response than does a
composition containing any two of the three components of
the immunogenic composition, administered in the same
amounts and following the same immunization schedule. As
disclosed herein, the components of the immunogenic
compositions of the invention can act in synergy. For
example, the immunogenic compositions of the invention
can enhance ~-chemokine production by eliciting
production of a higher concentration of ~-chemokine than
would be expected by adding the effects of pairwise
combinations of components of the immunogenic
composition.
The ~3-chemokine production that is enhanced can
be either "HIV-specific ~-chemokine production," which
CA 02372960 2004-06-17
' -
WO 00/67787 PCT/US00/1'.!495
14
refers to production of a ~3-chemokine in response to
stimulation of T cells with an HIV antigen.
Alternatively, or additionally, the ~i-chemokine
production that is enhanced can be "non-specific (3-
chemokine production," which refers to production of a ~i-
chemokine in the absence of stimulation of T cells oaith
an HIV antigen.
As used herein, the term "kit" refers to
components packaged or marked for use together. For
r
example, a kit can contain an HIV antigen, an ISS and an
adjuvant in three separate containers. Alternatively, a
kit can contain any two components in one container, and
a third component and any additional components in one or
more separate containers. Optionally, a kit further
contains instructions for combining the components so as
to formulate an immunogenic composition suitable for
administration to a mammal.
The invention provides an immunogenic
composition containing an HIV antigen, a nucleic acid
molecule containing an immunostimulatory sequence (ISS),
and an adjuvant. The immunogenic composition enhances ~i-
chemokine production in a mammal administered the
composition.
In one embodiment, the HIV antigen in the
immunogenic composition is a whole-killed HIV virus,
which can be prepared by methods known in the art. for
example, HIV virus can be prepared by culture from a
specimen of peripheral blood of infected individuals. In
an exemplary method of culturing HIV virus, mononuclear
cells from peripheral blood (e.g. lymphocytes) can be
obtained by layering a specimen of heparinized venous
blood over a Ficoll-Hypaque~density gradient and
* Trademark
U~ 000 ~ %4~:.
03-04.-200 i
CA 02372960 2001-10-30
1
centrifuging the specimen. The mononuclear cells are
then collected, activated, as with phytohemagglutinin for
two to three days, and cultured in an appropriate medium,
preferably supplemented with interleukin 2. The virus
can be detected either by an assay for reverse
transcriptase, by an antigen capture assay for.p24, by
immunofluorescence or by electron microscopy to detect
the presence of viral particles in cells, all of which
are methods well-known to those skilled in the art.
Methods for isolating whole-killed HIV
- particles are described, for example, in Richieri et al.,
Vaccine 16:119-129 (1998), and U.S. Patent Nos. 5,661,023
and 5,256,767. In one embodiment, the HIV virus is an
HZ321 isolate from an individual infected in Zaire in
1976, which is described in Choi et al., AIDS Res. Hu,~
~etroyiruses 13:357-361 (1997) . HZ321 is the designation
of an HIV-1 isolate having the env nucleotide sequence set forth
in GenBank Accession number M15896.
various methods are known in the art for
rendering a virus non-infectious (see, for example
Hanson, MEDICAL VIROLOGY II (1983), de la Maza and
Peterson, eds., Elsevier,). For example, the virus can
be inactivated by treatment with chemicals or by physical
_. conditions such as heat or irradiation. Preferably, the
virus is treated with an agent or agents that maintain
the immunogenic properties of the virus. For example,
the virus can be treated with beta-propiolactone or gamma
radiation, or both beta-propiolactone and gamma
radiation, at dosages and for times sufficient to
inactivate the virus.
In another embodiment, the HIV antigen in the
immunogenic composition is a whole-killed HIV virus
devoid of,outer envelope proteins, which can be prepared
by methods known in the art. In order to prepare whole-
AMENDED SHEET
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
16
killed virus devoid of outer envelope proteins, the
isolated virus is treated so as to remove the outer
envelope proteins. Such removal is preferably
accomplished by repeated freezing and thawing of the
virus in conjunction with physical methods which cause
the swelling and contraction of the viral particles,
although other physical or non-physical methods, such as
sonication, can also be employed alone or in combination.
In yet another embodiment, the HIV antigen in
the immunogenic composition is a substantially purified
gene product of HIV. Such gene products include those
products encoded by the gag genes (p55, p39, p24, p17 and
pl5), the pol genes (p66/p51 and p31-34) and the
transmembrane glycoprotein gp4l. These gene products may
be used alone or in combination with other HIV antigens.
The substantially purified gene product of HIV
can be a substantially purified HIV p24 antigen. p24 can
be substantially purified from the virus by biochemical
methods known in the art, or can be produced by cloning
and expressing the appropriate gene in a host organism
such as bacterial, fungal or mammalian cells, by methods
well known in the art. Alternatively, p24 antigen, or a
modification or fragment thereof that retains the
immunological activity of p24, can be synthesized, using
methods well known in the art, such as automated peptide
synthesis. Determination of whether a modification or
fragment of p24 retains the immunological activity of p24
can be made, for example, by immunizing a mammal and
comparing the immune responses so generated, or testing
the ability of the modification or fragment to compete
with p24 for binding to a p24 antibody.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
17
The immunogenic compositions of the invention
also contain an isolated nucleic acid molecule having at
least one immunostimulatory sequence (ISS). The HIV
antigen and the nucleic acid molecule can be mixed
together, or can be conjugated by either a covalent or
non-covalent linkage. Methods of conjugating antigens
and nucleic acid molecules are known in the art, and
exemplary methods are described in PCT publication WO
98/55495.
A nucleic acid molecule containing an ISS can
be prepared using methods well known in the art
including, for example, oligonucleotide synthesis, PCR,
enzymatic or chemical degradation of larger nucleic acid
molecules, and conventional polynucleotide isolation
procedures. Methods of producing a nucleic acid molecule
containing an ISS, including a nucleic acid molecule
containing one or more modified bases or linkages, are
described, for example, in PCT publication WO 98/55495.
Those skilled in the art can readily determine
whether a particular nucleic acid molecule containing an
ISS is effective in enhancing a desired immune response
in a particular mammal by immunizing a mammal of the same
species, or a species known in the art to exhibit similar
immune responses, with a composition containing a
particular ISS. For example, an optimal ISS to include
in an immunogenic composition for administration to a
human can be determined in either a human or a non-human
primate, such as a baboon, chimpanzee, macaque or monkey.
The immunogenic compositions of the invention
further contain an adjuvant, such as an adjuvant
demonstrated to be safe in humans. An exemplary adjuvant
is Incomplete Freund's Adjuvant (IFA). Another exemplary
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
18
adjuvant contains mycobacterium cell wall components and
monophosphoryl lipid A, such as the commercially
available adjuvant DETOXTr''. Another exemplary adjuvant is
alum. The preparation and formulation of adjuvants in
immunogenic compositions are well known in the art.
Optionally, the immunogenic compositions of the
invention can contain or be formulated together with
other pharmaceutically acceptable ingredients, including
sterile water or physiologically buffered saline. A
pharmaceutically acceptable ingredient can be any
compound that acts, for example, to stabilize,
solubilize, emulsify, buffer or maintain sterility of the
immunogenic composition, which is compatible with
administration to a mammal and does not render the
immunogenic composition ineffective for its intended
purpose. Such ingredients and their uses are well known
in the art.
The invention also provides kits containing an
HIV antigen, an isolated nucleic acid molecule containing
an ISS, and an adjuvant. The components of the kit, when
combined, produce an immunogenic composition which
enhances ~-chemokine levels in a mammal.
The components of the kit can be combined ex
vivo to produce an immunogenic composition containing an
HIV antigen, a nucleic acid molecule containing an ISS
and an adjuvant. Alternatively, any two components can
be combined ex vivo, and administered with a third
component, such that an immunogenic composition forms in
vivo. For example, an HIV antigen can be emulsified in,
dissolved in, mixed with, or adsorbed to an adjuvant and
injected into a mammal, preceded or followed by injection
of the nucleic acid molecule containing the ISS.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
I9
Likewise, each component of the kit can be administered
separately. Those skilled in the art understand that
there are various methods of combining and administering
an HIV antigen, an isolated nucleic acid molecule
containing an ISS, and an adjuvant, so as to enhance (3-
chemokine production in a mammal.
An immunogenic composition of the invention is
effective in enhancing ~i-chemokine production in a mammal
administered the composition. As described in Examples I
and III, below, production of the (3-chemokine RANTES can
be detected and quantitated using an ELISA assay of
supernatants of T cells (such as lymph nodes cells or
peripheral blood cells) from mammals administered the
composition. In order to determine antigen-specific (3-
chemokine production, T cells from an immunized mammal
can be stimulated with HIV antigen in combination with
antigen-presenting thymocytes, and the ~i-chemokine levels
measured in the supernatant. In order to determine non-
specific (3-chemokine production, either T cell
supernatant or a blood or plasma sample from an immunized
mammal can be assayed. Similarly, production of other
chemokines, such as MIP-la and MIP-1(3, can be detected
and quantitated using commercially available ELISA
assays, according to manufacturer's instructions.
An immunogenic composition of the invention can
further be capable of enhancing HIV-specific IgG2b
antibody production in a mammal administered the
composition. As described in Examples II and III, below,
HIV in combination with ISS, or with IFA, stimulate HIV-
specific IgGl antibody production, but not HIV-specific
IgG2b antibody production. In contrast, the immunogenic
compositions of the invention can stimulate potent HIV-
specific IgG2b antibody production. High levels of IgG2b
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
antibodies, which are associated with a Thl type
response, are correlated with protection against HIV
infection and progression to AIDS.
An immunogenic composition of the invention can
5 further be capable of enhancing HIV-specific cytotoxic T
lymphocyte (CTL) responses in a mammal administered the
composition. As described in Example II, below,
an HIV antigen in combination with an adjuvant elicited
low levels of IFN-y production by either CD4+ T cells or
10 CD8+ T cells. However, when an ISS was included in the
composition together with an HIV and an adjuvant, there
was a dose-dependent increase in IFN-y production by both
CD4+ T cells and CD8+ T cells.
IFN-y production by CD4+ T cells is
I5 characterized as a classic Thl-type response. IFN-Y
production by CD8+ T cells, however, is considered to be
a cytotoxic T lymphocyte (CTL) response, and is highly
correlated with cytolytic activity. CTL activity is an
important component of an effective prophylactic or
20 therapeutic anti-HIV immune response. Methods of
determining whether a CTL response is enhanced following
administration of an immunogenic composition of the
invention are well known in the art, and include
cytolytic assays (described, for example, in Deml et al.
supra (1999)), and ELISA and ELISPOT assays for CD8-
specific IFN-Y production (see Examples I and II, below).
The invention also provides a method of
immunizing an individual. The method consists of
enhancing (3-chemokine production in an individual by
administering to a mammal an immunogenic composition
containing an HIV antigen, an isolated nucleic acid
molecule containing an ISS, and an adjuvant. The
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
21
components of the immunogenic composition can be
administered in any order or combination, such that the
immunogenic composition is formed ex vivo or in vivo.
Preferably, the HIV antigen, ISS and adjuvant
are administered simultaneously or at about the same
time, in about the same site. However, administering the
components within several minutes or several hours of
each other can also be effective in providing an
immunogenic composition that enhances ~-chemokine
production. Additionally, administering the components
at different sites in the mammal can also be effective in
providing an immunogenic composition that enhances (3-
chemokine production.
The immunogenic compositions of the invention
can be administered to a human to inhibit AIDS, such as
by preventing initial infection of an individual exposed
to HIV, reducing viral burden in an individual infected
with HIV, prolonging the asymptomatic phase of HIV
infection, increasing overall health or quality of life
in an individual with AIDS, or prolonging life expectency
of an individual with AIDS. As described in Examples I-
III, below, administration to a mammal of an immunogenic
composition containing an HIV antigen, an isolated
nucleic acid molecule containing an immunostimulatory
sequence, and an adjuvant stimulates immune responses
correlated with protection against HIV infection and
progression to AIDS.
In particular, the immunogenic compositions
enhance (3-chemokine production more effectively than
would be expected by combination of any two components of
the immunogenic compositions. Additionally, the
immunogenic compositions promote strong Thl type immune
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
22
responses, including both Thl type cytokines (e.g. IFN-Y)
and Thl type antibody isotypes (e.g. IgG2b). Thus, the
immunogenic compositions of the invention will be
effective as vaccines to prevent HIV infection when
administered to seronegative individuals, and to reduce
viral burden, prolong the asymptomatic phase of
infection, and positively affect the health or lifespan
of a seropositive individual.
Individuals who have been exposed to the HIV
virus usually express in their serum certain antibodies
specific for HIV. Such individuals are termed
"seropositive" for HIV, in contrast to individuals who
are "seronegative." The presence of HIV specific
antibodies can be determined by commercially available
assay systems.
At the present time, serological tests to
detect the presence of antibodies to the virus are the
most widely used method of determining infection. Such
methods can, however, result in both false negatives, as
where an individual has contracted the virus but not yet
mounted an immune response, and in false positives, as
where a fetus may acquire the antibodies, but not the
virus from the mother. Where serological tests provide
an indication of infection, it may be necessary to
consider all those who test seropositive as in fact,
being infected. Further, certain of those individuals
who are found to be seronegative may in fact be treated
as being infected if certain other indications of
infection, such as contact with a known carrier, are
satisfied.
The immunogenic compositions of the invention
can be administered to an individual who is HIV
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
23
seronegative or seropositive. In a seropositive
individual, it may be desirable to administer the
composition as part of a treatment regimen that includes
treatment with anti-viral agents, such as protease
inhibitors. Anti-viral agents and their uses in
treatment regimens are well known in the art, and an
appropriate regimen for a particular individual can be
determined by a skilled clinician.
As shown in Example IV, below, administration
of the immunogenic compositions of the invention to a
primate fetus or to a primate neonate resulted in the
generation of a strong anti-HIV immune response,
indicating that the immune systems of fetuses and infants
are capable of mounting an immune response to such
compositions which should protect the child from HIV
infection or progression to AIDS. Accordingly, the
immunogenic compositions of the invention can be
administered to an HIV-infected pregnant mother to
prevent HIV transmission to the fetus, or to a fetus, an
infant, a child or an adult as either a prophylactic or
therapeutic vaccine.
The dose of the immunogenic composition, or
components thereof, to be administered in the methods of
the invention is selected so as to be effective in
stimulating the desired immune responses. Generally, an
immunogenic composition formulated for a single
administration contains between about 1 to 200 ug of
protein. Preferably, an immunogenic composition contains
about 100 ug of protein for administration to a primate,
such as a human. As shown in Example IV, below, about
100 ~g of HIV antigen in an immunogenic composition
elicits a strong immune response in a primate. As shown
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
24
in Examples I-III, below, about 10 ug of HIV antigen is
suitable for administration to a rodent.
The immunogenic composition can further contain
from about 0.1 ug/ml to about 1 mg/ml of an isolated
nucleic acid molecule containing an ISS sequence, such as
about 1 ug/ml, about 10 ug/ml, or about 100 ug/ml. As
shown in Example I, below, a ratio of at least 5:1 by
weight of nucleic acid molecule to HIV antigen was more
effective than lower ratios for eliciting immune
responses. In rodents, an effective amount of an
oligonucleotide containing an ISS in an immunogenic
composition is from 5 ug to greater than 50 ug, such as
about 100 fig. In primates, about 500 ug of an
oligonucleotide containing an ISS is suitable in an
immunogenic composition. Those skilled in the art can
readily determine an appropriate amount of ISS to elicit
a desired immune response.
As with all immunogenic compositions, the
immunologically effective amounts of the components must
be determined empirically, but can be based, for example,
on immunologically effective amounts in animal models,
such as rodents and non-human primates. Factors to be
considered include the antigenicity, the formulation
(e.g. volume, type of adjuvant), the route of
administration, the number of immunizing doses to be
administered, the physical condition, weight and age of
the individual, and the like. Such factors are well
known in the vaccine art and it is well within the skill
of immunologists to make such determinations without
undue experimentation.
The immunogenic compositions of the invention
can be administered locally or systemically by any method
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
known in the art, including, but not limited to,
intramuscular, intradermal, intravenous, subcutaneous,
intraperitoneal, intranasal, oral or other mucosal
routes. The immunogenic compositions can be administered
5 in a suitable, nontoxic pharmaceutical carrier, or can be
formulated in microcapsules or as a sustained release
implant. The immunogenic compositions of the invention
can be administered multiple times, if desired, in order
to sustain the desired immune response. The appropriate
10 route, formulation and immunization schedule can be
determined by those skilled in the art.
It is understood that modifications which do
not substantially affect the activity of the various
embodiments of this invention are also included within
15 the definition of the invention provided herein.
Accordingly, the following examples are intended to
illustrate but not limit the present invention.
EXAMPhE I
Elicitation of cytokine, antibody and chemokine
20 responses by HIV immunogenic compositions
This example shows that immunogenic
compositions containing an HIV antigen, an
immunostimulatory nucleic acid molecule and an adjuvant,
are potent stimulators of IFN-y production (a Thl
25 cytokine), antibody responses and ~-chemokine production
in a mammal. In particular, ~i-chemokine production is
enhanced to a greater extent than would be expected from
the additive effects of any two components in the
composition. Therefore, immunogenic compositions
containing an HIV antigen, an immunostimulatory nucleic
acid molecule and an adjuvant mediate potent immune
responses of the types that are important in protecting
CA 02372960 2004-06-17
WO 00/67787 PCT/USOOI1d495
26
against HIV infection and disease progression, indicating
that these compositions will be effective prophylactic
and therapeutic vaccines.
Materials and Methods
0ligodeoxynucleotides. ODN (oligodeoxynucleotides) used
in this study were purchased from Retrogen (San Diego,
California). They were phosphorothioate-modified to
increase resistance to nuclease degradation. The ODN
sequences with the corresponding CpG or non-CpG motifs
are underlined in Table 1.
Table 1
ODN Sequence Motif SEQ ID
182 6 5' TCCATGACGTTCCTGACGTT 3' CpG 1
Oct 5' TGACTGTGAACGTTCGAGATGA 3' CpG 2
1745 5' TCCAATGAGCTTCCTGAGTCT 3' non-CpG
Immunizations. The HIV-1 antigen was prepared from virus
particles obtained from cultures of a chronically
infected Hut 78 with a Zairian virus isolate (HZ321)
which,has been characterized as subtype "M," containing
an en v Algag G recombinant virus (Choi et al., su ra
(1997)). The gp120 was depleted during the two-step
purification process. The antigen was inactivated by the
addition of ~i-propiolactone and gamma irradiation at 50
kGy. Western blot and HPLC analysis showed undetectable
levels of gp120 in the preparation of this antigen (Prior
et al., Pharm. Tech. 19:30-52 (1995)). For in vitro
experiments, native p24 was preferentially lysed from
purified HIV-1 antigen with 2~ triton~X-I00 and then
purified with Pharmacia Sepharose Fast Flow S resin.
Chromatography was carried out at pH = 5.0 and p24 was
* Trademark
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
27
eluted with linear salt gradient. Purity of the final
product was estimated to be >99o by both SDS (sodium
dodecyl sulfate) electrophoresis and reverse phase high
pressure liquid chromatography. The ODN was added to the
diluted HIV-1 antigen in a volume of at least 50 of the
final volume.
CFA (complete Freund's adjuvant) was prepared
by resuspending mycobacterium tuberculosis H37RA (DIFCO,
Detroit, Michigan) at 10 mg/ml in IFA (DIFCO, Detroit,
Michigan). IFA or ISA 51~ was formulated by adding one
part of the surfactant Montanide 80 (high purity mannide
monoleate, Seppie, Paris) to nine parts of Drakeol 6 VR
light mineral oil (Panreco, Karnes City, Pennsylvania).
The gp120-depleted HIV-1 antigen was diluted in PBS to
200/.cg/ml and emulsified with equal volumes of CFA or IFA
with or without ODN.
Eight to twelve weeks old Lewis rats from
Charles Rivers (Wilmington, Massachusetts), maintained in
a pathogen-free facility, were injected intradermally in
the hind footpad with 100,u1 of emulsion. Each animal
received l0,ug of the inactivated HIV-1 antigen in either
CFA (n=6), IFA (n=6), 50 ug ISS (n=3), or IFA plus 50 ug
ISS (n=6). Two weeks later, the animals were boosted
subcutaneously in the base of the tail using the same
regimen, except that the animals primed with HIV-1
antigen in CFA were instead boosted with HIV-1 antigen in
IFA. Rats were primed and boosted with HIV-1 antigen in
the presence of the ODN 1826, which contains an ISS, or
ODN 1745, which does not contain an ISS. On day 28, the
animals were sacrificed for cytokine, chemokine, and
antibody analysis. For ISS dose response studies, n=3
for all groups.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
28
ELISA for antigen-specific antibody. Whole blood was
collected from immunized animals by heart puncture at the
end of the study. The SST tubes were centrifuged at
800 rpm for 20 minutes. Sera were aliquoted and stored
at -20°C until assayed. PVC plates (polychlorinated
biphenyl plates, Falcon, Oxnard, California) were coated
with native p24 diluted in PBS at l,ug/ml and stored at
4°C overnight. Plates were blocked by adding 200,u1 per
well of 4o BSA in PBS for 1 hour. Sera were diluted in
to BSA in PBS at 1:100 followed by four-fold serial
dilution. 1001 of diluted sera were added in duplicate
and incubated at room temperature for 2 hours. Plates
were washed with 0.050 Tween 20 in PBS three times and
blotted dry. The detecting secondary antibodies (goat
anti-rat IgG biotin, goat anti-rat IgGl biotin or goat
anti-rat IgG2a biotin, Zymed, San Francisco, California)
were diluted in to BSA in PBS. 1001 of diluted
secondary antibody was added to each well and incubated
at room temperature for another hour. After washing
excess secondary antibody, strep-avidin-biotin-HRP
(Pierce, Rockford, Illinois) were added at 50,u1 per well
and incubated for 30 minutes. Plates were washed with
0.050 Tween 20 in PBS three times. ABTS substrate
(KPL, Gaithersburg, Maryland) was added until a
bluish-green color developed. The reaction was stopped
by the addition of to SDS and the plate was read at
absorbance 405 nm.
The antibody response reported as 50o antibody
titer was the reciprocal of the dilution equal to 500 of
the maximum binding (highest optical reading) for every
given sample. The absorbance value (OD @ 405 nm) was
plotted against antibody dilution in a log scale,
yielding a sigmoidal dose response curve. 500 of the
maximum binding was calculated by multiplying the highest
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
29
OD by 0.5. The 50o value was located on the curve and
the corresponding x-axis value was reported as the
antibody dilution.
ELISA Assay for Cytokine and Chemokine Anaylsis. The
draining lymph nodes (superficial inguinal and popliteal)
were isolated from immunized animals two weeks after the
boost. Single cell suspensions from these lymph nodes
were prepared by mechanical dissociation using sterile 70
,um mesh screen. T cells were purified from lymph node
cells by the panning method. Briefly, petri dishes (100
x 15mm) were pre-coated with 20/.cg/ml of rabbit anti-rat
IgG (Rockland, San Francisco, California) for 45 minutes
at room temperature. The petri dishes were washed twice
with ice cold PBS and once with ice cold 2o human AB
serum in PBS. 1x10' lymph node cells were added to
pre-washed plates and incubated at 4°C for 90 minutes.
The non-adherent cells (enriched T cells) were then
collected and transferred into sterile 50-ml conical
tubes. The plates were washed twice and combined with
the non-adherent cells. The cells were then centrifuged
and cell pellets resuspended in complete media at
4x106cells/ml (5o human AB serum in RPMI 1640, with
mM hepes, 2mM L-glutamine, 100 ug streptomycin and
5x10-6M (3-mercaptoethanol ) .
25 Gamma-irradiated thymocytes from a naive Lewis
rat were used as antigen presenting cells. 2x105 enriched
T cells and 5x105 thymocytes were added to each well of a
96-round bottom plate. The HIV-1 antigen and native p24
were diluted in complete media at 10/.cg/ml while con A was
diluted to 5/.cg/ml. 100/,cl of each antigen or T cell
mitogen were added in triplicates. The plates were
incubated at 5o CO~, 37°C for 72 hours. Supernatants were
harvested and stored at -70°C until assayed. The samples
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
were assayed for IL-4, IFN-Y and RANTES using
commercially available kits (Biosource, Camarillo,
California) specific for rat cytokines and chemokines.
Statistical methods. The Mann-Whitney U nonparametric
5 statistic was utilized to compare groups. All p values
are two tailed.
Results
As shown in Figure lA, administration of
envelope-depleted HIV-1 in combination with IFA and ISS
10 (ODN 1826) was a more potent inducer of both HIV-1
antigen-stimulated and p24 antigen-stimulated IFN-y
production than HIV-1 in CFA (p=.002), HIV-1 in IFA, or
HIV-1 in ISS (p=.02). Increased production of
unstimulated IFN-Y (control) was also observed following
15 administration of envelope-depleted HIV-1 in combination
with IFA and ISS. Unexpectedly, administration of HIV-1
in combination with IFA and ISS resulted in IFN-y
production that was several times greater than the
additive effects of HIV-1 in IFA alone or HIV-1 in ISS
20 alone. Of note, the level of cytokine secreted after
HIV-1 stimulation was higher than after p24 stimulation,
due to the presence of multiple T cell epitopes in the
whole HIV-1 antigen.
Complete Freund's Adjuvant (CFA) is currently
25 the most potent adjuvant known for stimulating cell-
mediated immune responses. However, CFA is not an
appropriate adjuvant for use in humans because of safety
issues. As shown in Figure lA, HIV in CFA induced
unstimulated and HIV-stimulated IFN-Y production more
30 effectively than HIV in IFA alone or HIV in ISS alone,
but not as well as HIV in the combination of IFA and ISS.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
31
Thus, the discovery of the superior effects of the
combination of ISS and IFA for use in an HIV immunogenic
composition provides for safe and effective vaccines for
human therapy.
To examine the dose-related immune response to
IFN-y, Lewis rats were immunized with the inactivated
gp120-depleted HIV-1 antigen emulsified in IFA containing
different concentrations of CpG ODN 1826 (50, 25 and 5 ug
per rat). The highest production of antigen-stimulated
IFN-Y was obtained using 50 ug of CpG ODN 1826, as shown
in Figure 1B.
To examine whether CpG ODN could also boost the
antibody response to an HIV-1 antigen, sera were assayed
for total IgG and Th2 isotype (IgG1 and IgG2a) antibody
responses to p24 antigen. As shown in Figure 2A, anti-
p24 total IgG responses were strongly enhanced and
comparable in both the HIV in CFA and HIV in IFA/ISS
groups of animals. Administration of HIV-1 in
combination with IFA and ISS resulted in total p24
antibody production that was greater than the additive
effects of HIV-1 in IFA alone or ISS alone, and almost as
great as HIV-1 in CFA. The IgGl and IgG2a responses were
comparable among animals immunized with HIV-1 antigen in
CFA, IFA or IFA/ISS. As shown in Figure 2B, the antibody
response was dependent on the dose of ISS.
Production of the ~i-chemokine RANTES in
response to immunization was then examined. As shown in
Figure 3A, both unstimulated and antigen-stimulated cells
from the HIV/IFA/ISS group showed enhanced production of
RANTES, to a level comparable with the HIV in CFA group,
and significantly higher than the HIV/IFA group (p=.002)
or HIV/ISS group (p=.02). Unexpectedly, administration
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
32
of HIV-1 in combination with IFA and ISS resulted in both
unstimulated and antigen-stimulated RANTES production
that was greater than the additive effects of HIV-1 in
IFA alone or HIV-1 in ISS alone. As shown in Figure 3B,
both unstimulated and antigen-stimulated RANTES
production was dependent on the dose of ISS.
In none of the groups was production observed
of antigen-induced IL-4, a Th2 type cytokine. The
control sequence (1745) did not stimulate IFN-y, RANTES,
or p24 antibody.
Cytokine and chemokine production was compared
with compositions containing two oligonucleotides
containing different immunostimulatory sequences. As
shown in Figure 4A, immunogenic compositions containing
HIV-1 antigen and IFA with either ODN 1826 (SEQ ID NO:1)
or ODN Oct (SEQ ID N0:2) induced antigen-stimulated IFN-y
production to a greater extent than compositions
containing HIV-1 antigen and IFA, or HIV-1 antigen and
CFA. Furthermore, as shown in Figure 4B, immunogenic
compositions containing HIV-1 antigen and IFA with either
ODN Oct or ODN 1826 induced unstimulated and antigen-
stimulated RANTES production to a greater extent than
compositions containing HIV-1 antigen and IFA, or HIV-1
antigen and CFA.
Thus, the immunogenic compositions of the
invention can be used to enhance ~-chemokine production
in an individual. Because of the strong correlation
between (3-chemokine levels and protection from HIV
infection and disease progression, the compositions of
the invention will be more effective than other described
compositions for inhibiting AIDS.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
33
EXAMPLE II
Elicitation of CD4 and CD8 immune responses
by HIV immunodenic compositions
This example shows the induction of potent CD4
and CD8 HIV-specific Thl type immune responses following
immunization with an immunogenic composition containing
an HIV antigen, a nucleic acid containing an
immunostimulatory sequence and an adjuvant. Antigen-
specific responses by CD8+, cytotoxic T lymphocytes are
an important factor in preventing initial HIV infection
and disease progression. Thus, this example provides
further evidence that the immunogenic compositions of the
invention are effective prophylactic and therapeutic
vaccines.
Materials and Methods
HIV antigen, ISS (ODN 1826) and IFA were
prepared essentially as described in Example I. Lewis
rats were immunized essentially as described in Example
I, and sacrificed at day 28 for ELISPOT and p24 antibody
analysis. p24 antibody analysis was performed
essentially as described in Example I.
ELISPOT for gamma-interferon from bulk and purified T
cell populations. Single cell suspensions were prepared
from spleens of the immunized rats by mincing and
pressing through a sterile fine mesh nylon screen in RPMI
1640 (Hyclone, Logan, Utah). The splenocytes were
purified by ficoll gradient centrifugation. CD4 and CD8
cells were isolated by magnetic bead depletion. 2x10
cells were stained with 5ug of either mouse anti-rat CD4
(clone: OX-35, Pharmingen, San Diego, California) or
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
34
mouse anti-rat CD8 (clone: OX-8, Pharmingen, San Diego,
California). Cells were incubated on ice for 30 minutes
and washed with ice cold 2o Human AB serum in PBS. Pre-
washed Dynabeads (DYNAL, Oslo, Norway) coated with goat
anti-mouse IgG were added to the cell suspension and
incubated at 4°C for 20 minutes with constant mixing.
Purified CD4, CD8 and non-depleted splenocytes
were resuspended in complete media (5o inactivated Human
AB serum in RPMI 1640, Pen-strep, L-glutamine and ~-ME)
at 5x106 cells/ml and used for ELISPOT assay to enumerate
the individual IFN-y secreting cells. Briefly, 96 well
nitrocellulose bottom microtiter plates (Millipore Co.,
Bedford, U.K.) were coated with 400 ngs per well of mouse
anti-rat IFN-Y (clone: DB-l, Biosource, Camarillo,
California). After overnight incubation at 4°C, plates
were washed with sterile PBS and blocked with 5o human AB
serum in RPMI 1640 containing pen-strep, L-glutamine and
I3-ME) for 1 hour at room temperature. Plates were washed
with sterile PBS and 5x105 per well of splenocytes
(purified CD4, purified CD8 or non-depleted) were added
in triplicate and incubated overnight at 37°C and 5o C02.
Cells were cultured with media, OVA (Chicken Egg
Ovalbumin, Sigma-Aldrich, St. Louis, Missouri), native
p24 or gp120-depleted HIV-1 antigen. CD4 purified and
CD8 purified splenocytes were assayed in complete media
containing 20 units/ml of recombinant rat IL-2
(Pharmingen, San Diego, CA).
After washing unbound cells, 400 ng per well of
the polyclonal rabbit anti-rat IFN-y were added and
incubated at room temperature for 2 hours, then washed
and stained with goat anti-rabbit IgG biotin (Zymed, San
Francisco, California). After extensive washes with
sterile PBS, avidin alkaline phosphatase complex (Sigma-
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
Aldrich, St. Louis, MO) was added and incubated for
another hour at room temperature. The spots were
developed by adding chromogenic alkaline phosphate
substrate (Sigma, St. Louis, MO) and the IFN-y cells were
5 counted using a dissection microscope (X 40) with a
highlight 3000 light source (Olympus, Lake Success, NY).
Statistical Methods. The Mann-Whitney U nonparametric
statistic was utilized to compare groups. The Spearman
rank correlation was performed to examine relationships
10 between CD4 and CD8 gamma interferon production. All p
values are two tailed.
Results
The production of IFN-y by non-depleted
splenocytes, and by purified CD4+ or purified CD8+
15 populations, was examined. IFN-y production by CD4+
cells is a characteristic Thl immune response, whereas
IFN-y production by CD8+ cells is a correlate of
cytotoxic T lymphocyte (CTL) cytolytic activity.
The frequency of IFN-y producing cells
20 increased with dose of ISS in non-depleted splenocytes in
response to either whole-killed, gp120-depleted HIV (the
immunizing antigen) or purified p24 antigen (see
Figure 5A). The highest frequency of cytokine producing
cells was observed with the combination of 100 ug of ISS
25 with HIV-1 in IFA, for both HIV-1 and p24 antigen
stimulated cells (p=0.03 when compared the HIV in IFA
group).
The purified CD4+ T cell population also
30 exhibited a dose-dependent increase in the frequency of
cells expressing IFN-y in response to HIV and p24
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
36
antigens, with the greatest frequency being at the 100 ug
dose of ISS when combined with HIV-1 in IFA (p=0.03 when
compared the HIV in IFA group)(see Figure 5B).
Furthermore, the purified CD8+ population also exhibited
a dose-dependent increase in the frequency of cells
expressing IFN-Y in response to HIV and p24 antigens,
with the greatest frequency being at the 100 ug dose of
ISS when combined with HIV-1 in IFA (p=0.03 when compared
the HIV in IFA group)(see Figure 5C). None of the
animals produced IFN-y secreting cells when stimulated
with OVA, an irrelevant protein antigen.
Of note, the frequency of IFN-Y producing CD8+
T cells was generally lower than the frequency of CD4+ T
cells expressing IFN-y. There was a strong correlation
between the generation of IFN-y between CD4+ T cells and
CD8+ T cells with both HIV antigen stimulation (r=0.80,
p=0.002) and for p24 antigen stimulation (r=0.79,
p=0.003).
The results shown in Figures 5A, B and C thus
demonstrate that the immunogenic compositions of the
invention elicit Thl and cytotoxic T lymphocyte
responses, both of which are correlated with protection
from initial HIV infection and progression to AIDS.
Finally, total IgG, IgGl and IgG2b specific for
p24 was examined. As shown in Figure 6A, the addition of
ISS at all doses to HIV in IFA increased anti-p24
antibody response (total IgG) compared to HIV in IFA,
although a dose response was not evident. Specifically,
the addition of ISS to HIV in IFA favored the production
of IgG2b antibody (a Thl type response) compared to HIV
in IFA, which induced only IgGl subtype antibody (a Th2
type response), as shown in Figure 6B.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
37
In summary, the data in this Example show that
an immunogenic composition containing an HIV antigen, an
ISS and an adjuvant can be used to generate potent HIV-
specific CD4 and CD8 HIV-specific immune responses. The
induction of CD4 T helper cells may be pivotal for
generation of CD8 effector cells. CD8 T cells can serve
as effectors against HIV virus by several mechanisms,
including direct cytolytic (CTL) activity, as well as
through the release of antiviral suppressive factors,
such as ~-chemokines and other less well-characterized
factors. These results contrast with results reported by
Deml et al., supra (1999), who showed that a combination
of HIV envelope gp160 antigen, an ISS and an adjuvant did
not induce HIV- specific CTL activity. Accordingly, the
compositions described herein are superior to other
described compositions for use as HIV vaccines.
EXAMPLE III
Comparison of immune responses elicited by different
immunoctenic compositions and immunization schedules
This example shows that a nucleic acid
containing an ISS is more effective in eliciting
protective immune responses, including RANTES production
and HIV-specific IgG2b antibody production, when
administered simultaneously with an HIV antigen and an
adjuvant than when used to prime the mammal one week
prior to administration of the antigen and adjuvant.
This example also shows that a composition containing an
HIV antigen, an ISS and an adjuvant promotes antigen-
dependent lymphocyte proliferation more effectively than
a composition containing only HIV and IFA.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
38
Materials and methods
HIV antigen, ISS (ODN 1826) and IFA were
prepared essentially as described in Example I. Lewis
rats (three per group) were immunized at day 7 and, where
indicated, primed at day 0, with the compositions shown
in Table 2.
Table 2
Grou Day 0 Day
A ISS HIV-1
B HIV-1
C ISS HIV-1/IFA
HIV-1/IFA
E HIV-1/IFA/ISS
Animals were sacrificed at day 21 for cytokine,
chemokine and antibody analysis, essentially as described
in Example I, as well as for analysis of lymphocyte
proliferation.
Lymphocyte proliferation assay. Single cell suspensions
were prepared from the draining lymph nodes of immunized
animals. B cells were depleted from the lymph node cells
by panning. Briefly, lymph node cells were incubated
with anti-rat IgG pre-coated petri dishes for 90 minutes.
The non-adherent cells (enriched T cells) were collected
and resuspended in complete tissue culture media at 4x106
cells/ml. The enriched T cells were cultured with p24 or
HIV-1 antigen in the presence of y-irradiated thymocytes
at 37°C, 5o C0~ for 40-48 hours. Samples were pulsed with
tritiated thymidine and incubated for another 16 hours.
Cells were harvested and tritiated thymidine
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
39
incorporation was counted using a I3-scintillation
counter.
Results
As shown in Figure 7A, T cells from animals
primed with ISS and subsequently boosted with HIV-1 in
IFA (Group C), animals immunized with HIV-1 in IFA, and
animals immunized with a combination of HIV-1, IFA and
ISS (Group E), exhibited increased IFN-y production in
response to whole-killed, gp120-depleted HIV (the
immunizing antigen) and a lesser increase in IFN-Y
production in response to purified p24 antigen.
However, as shown in Figure 7B, only T cells
from animals immunized with a combination of HIV-1, IFA
and ISS (Group E) showed high levels of either non-
stimulated (media), or HIV-stimulated RANTES production.
RANTES production from animals of Group E was several
fold higher than from animals primed with ISS, then
boosted one week later with HIV-1 in IFA (Group C).
Serum levels of total IgG, IgGl and IgG2b
specific for p24 antigen were also examined. As shown in
Figure 7C, animals immunized with a combination of HIV-1,
IFA and ISS (Group E) showed the highest levels of total
IgG. Unexpectedly, whereas animals not receiving ISS
(Group D) and animals primed with ISS (Group C) produced
primarily IgGl (Th2-type) antibodies, animals immunized
with a combination of HIV-l, IFA and ISS (Group E)
produced primarily IgG2b (Thl-type) antibodies (see
Figure 7D).
T cell proliferative responses to p24 antigen
and gp120-depleted HIV were also measured. As shown in
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
Figure 7E, T cells from animals immunized with a
combination of HIV-l, IFA and ISS (Group E) proliferated
more strongly in response to either gp120-depleted HIV or
p24 antigen than did T cells from animals primed with ISS
5 then administered HIV-1 in IFA one week later (Group C),
or from animals administered only HIV-1 in IFA (Group D).
Thus, the immunogenic compositions of the
invention effectively elicit HIV-specific Thl cytokine
(IFN-y) and humoral responses (IgG2 antibodies), and
10 enhance both non-specific and HIV-specific (3-chemokine
production. These responses to the immunogenic
compositions correlate with strong HIV-specific T
lymphocyte proliferative responses.
EXAMPLE IV
15 Immunization of a primate with an
HIV immunogenic composition
This example shows that immunogenic
compositions containing an HIV antigen, an isolated
nucleic acid molecule containing an ISS and an adjuvant
20 are effective in enhancing HIV-specific immune responses
in primates.
Three baboon fetuses were injected in utero
with an immunogenic composition containing gp120-depleted
HIV-1 (100 ug total protein, equivalent to 10 p24 units)
25 in IFA with 500 ug of the ISS designated ODN 2006. The
sequence of ODN 2006 is 5'-TCGTCGCTGTTGTCGTTTCTT-3' (SEQ
ID N0:4). Four weeks later, the fetuses were boosted
using the same regimen.
CA 02372960 2001-10-30
WO 00/67787 PCT/US00/12495
41
Peripheral blood mononuclear cells from the
neonatal baboons were collected, and proliferative
responses to p24 and HIV-1 antigen were assayed. As
shown in Table 3, in all three animals, the HIV-1
stimulation index, which is the ratio of T cell
proliferation (-~H incorporation) in response to antigen to
T cell proliferation without antigen, was indicative of a
strong immune response (i.e. stimulation index >3). Two
baboon fetuses injected in utero and boosted as neonates
showed similar results.
Table 3
Baboon HIV-1 Stimulation Index
6533 13.3
5924 5.87
6683 15.1
Production of HIV-specific antibodies,
cytokines and ~i-chemokines are also measured in the same
baboons. These results show that the types of immune
responses elicited by the immunogenic compositions
described in Examples I-III, above, for rodents, are also
elicited in primates.
These results demonstrate that the HIV
immunogenic compositions and methods of the invention are
effective in primates in stimulating HIV-specific immune
responses. Furthermore, these results demonstrate that
fetuses and infants are able to elicit strong HIV immune
responses to the immunogenic compositions of the
invention, indicating that these compositions will be
useful for preventing maternal transmission of HIV and as
pediatric vaccines.
CA 02372960 2004-06-17
WO 00/67787 PCTIUS00/12495
42
Although the invention has been described with
reference to the disclosed embodiments, those skilled in
the art will readily appreciate that the specific
experiments detailed are only illustrative of the
invention. It should be understood that various
modifications can be made without departing from the
spirit of the invention. Accordingly, the invention is
limited only by the following claims.
CA 02372960 2001-10-30
SEQUENCE LISTING
<110> The Immune Response Corporation
<120> HIV Immunogenic Compositions and Methods
<130> 08-892893CA
<140>
<141> 2000-05-05
<150> US 60/132,762
<151> 1999-05-06
<150> US 60/150,667
<151> 1999-08-25
<150> PCT/US00/12495
<151> 2000-05-05
<160> 4
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> phosphorothioate-modified synthetic
oligodeoxynucleotide
<400> 1
tccatgacgt tcctgacgtt 20
<210> 2
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> phosphorothioate-modified synthetic
oligodeoxynucleotide
<400> 2
tgactgtgaa cgttcgagat ga 22
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> phosphorothioate-modified synthetic
-1-
i ;i
CA 02372960 2002-06-03
'-
oligodeoxynucleotide
<400> 3
tccaatgagc ttcctgagtc t 21
<210> 4
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> phosphorothioate-modified synthetic
oligodeoxynucleotide
<400> 4
tcgtcgctgt tgtcgtttct t 21
- 2 -
