Note: Descriptions are shown in the official language in which they were submitted.
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
METHOD FOR REDUCING PHYTATE IN CANOLA MEAL USING GENETIC
MANIPULATION INVOLVING MYO-INOSITOL 1-PHOSPHATE SYNTHASE GENE
BACKGROUND OF THE INVENTION
S
The use of canola meal as an acceptable protein source in the animal feed
industry is
severely limited by the presence in the meal of undesirable seed contents such
as
glucosinolates, phytates, phenolics and hull. Phytate is a significant
component of canola
seeds, comprising up to 10% by weight of the seed. Phytic acid is the
hexaphosphate
derivative of myo-inositol. The presence of phytate has been linked to such
symptoms as loss
of appetite, reduced litter size and increase in the number of stillborn pups
in rats. These
effects have been attributed to the zinc-binding ability of phytic acid. The
reduction of
phytate in canola protein preparations has, to date, been difficult. Hence
modification of its
biosynthetic pathway to reduce its accumulation and enhance protein or oil
synthesis in its
place would be very significant in terms of the economic value of canola.
SUMMARY OF THE INVENTION
An aim of the present invention is to limit the utilization of myo-inositol as
a starting
material for phytic acid synthesis. This is complicated by the fact that myo-
inositol is a
crucial biological substrate, the presence of which is essential for the
growth and
multiplication of all living cells. In plants, for example, in addition to its
participation in cell
wall biogenesis, where myo-inositol furnishes a carbon source for uronides and
pentoses, it is
also present in phosphoinositides of plant cell membranes, as well as other
complex plant
lipids including glycophosphoceramides. Additionally, in some of its
phosphorylated forms it
acts as important second messengers in signal transduction pathways in
eukaryotes. It is also
a precursor of other naturally occurring inositol isomers and many of these as
well as myo-
inositol are distributed as methyl ethers in a species specific pattern
throughout the plant
kingdom.
In view of the vital role myo-inositol plays in plants, limiting its supply to
the cell can
be expected to promote reorganization of priorities within the cell, with
possibly unforeseen
consequences. Myo-inositol pathways leading to critical cell components or
functions may be
expected to proceed at the expense of other pathways that are of no direct and
immediate
consequence to the well-being of the plant during its life cycle. Phytic acid
synthesis is an
example of such a "futile" pathway since phytic acid is a storage substance
that does not take
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
part in any of the essential pathways during plant growth and development. It
therefore
seemed possible to us that, by limiting the availability of myo-inositol I-
phosphate synthase,
lesser amounts of glucose 6-phosphate would be converted to myo-inositol
thereby leading to
a lower rate of phytic acid synthesis. It can be seen that a difficult balance
has to be struck
between over-limiting the production of myo-inositol thereby threatening
critical pathways
and under-limiting the production of myo-inositol with little consequent
economic benefit.
The basic approach to limiting the rate of conversion of glucose 6-phosphate
to myo
inositol 1-phosphate in Brassica na us was to prepare a mRNA transcript for
the enzyme
responsible for this step from B. napes and then to introduce a recombinant
version of this
gene into Brassica plants by, for example, A~robacterium-mediated
transformation in two
different orientations (sense, for cosuppression, and antisense). Two
particular types of
constructs were produced containing either the 35S promoter or the seed-
specific napin
promoter. Integration of the construct into the genome was confirmed by
Southern blot
analysis. Phytic acid analysis showed reduction in levels of around 30 % to 50
% for antisense
1 S and cosuppression transgenic plants.
The invention provides a nucleotide sequence of SEQ ID NO 1 or an allelic
variant or
a fragment thereof or a genetic equivalent thereof according to the degeneracy
of the genetic
code coding for a peptide having a Brassica myo-inositol 1-phosphate synthase
activity.
In preferred embodiments the nucleotide sequence, variant or fragment of the
invention
is in combination with a promoter sequence in reading frame alignment
(preferably antisense)
therewith.
The invention also provides a myo-inositol 1-phosphate synthase-active peptide
sequence encoded by the nucleotide sequence of the invention. The invention
also provides
cells (preferably Brassica, especially B. napes cells) transformed with a
nucleotide sequence
of the invention. The invention further provides plants, multicellular
fragments of such plants
and seeds of such plants transformed with a nucleotide of the invention, the
plant ,
multicellular fragment or seed having reduced myo-inositol 1-phosphate
synthase activity
such that there is reduced phytate present in the plant, multicellular
fragment or seed. The
multicellular fragment is preferably in the form of a seed meal.
The invention also provides a method for reducing phytate in Brassica which
comprises
limiting the availability of myo-inositol 1-phosphate synthase in said
Brassica with one of one
of a myo-inositol 1-phosphate synthase antisense sequence and a myo-inositol 1-
phosphate
synthase cosuppression sequence to give a reduced amount of translatable myo-
inositol 1-
phosphate synthase thereby reducing phytate in said Brassica. Preferably the
Brassica is
2
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
Brassica na~us. The invention also provides a method for reducing phytate in
Brassica,
which method comprises growing a Brassica plant comprising one of a myo-
inositol 1-
phosphate synthase antisense sequence and a myo-inositol 1-phosphate synthase
cosuppression sequence thereby yielding a reduced amount of myo-inositol 1-
phosphate
synthase and consequently reduced phytate in said Brassica.
DESCRIPTION OF THE SEQUENCE LISTING
SEQ ID NO: 1 shows the nucleotide sequence of a myo-inositol 1-phosphate
synthase gene of
Brassica na us.
SEQ ID NO: 2 show the amino acid sequence of my-inositol 1-phosphate synthase
of
Brassica napus.
SEQ ID NO: 3 shows the myo-inositol 1-phosphate synthase right primer used in
the
examples.
SEQ ID NO: 4 shows the myo-inositol 1-phosphate synthase left primer used in
the
examples.
SEQ ID NO: 5 shows a sequence comprising the myo-inositol 1-phosphate synthase
(mips)
promoter sequence used in the examples.
DESCRIPTION OF THE DRAWINGS
Figure 1 shows the nucleotide sequence of the Brassica na us myo-inositol 1-
phosphate
synthase of the invention.
DETAILED DESCRIPTION OF THE INVENTION
As used herein, the term "functional fragments" when used to modify a specific
gene or
gene product means a less than full length portion of the gene or gene product
which retains
substantially all of the biological function associated with the full length
gene or gene product
to which it relates. To determine whether a fragment of a particular gene or
gene product is a
3
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
functional fragment, fragments are generated by well-known nucleolytic or
proteolytic
techniques or by the polymerise chain reaction and the fragments tested for
the described
biological function.
As used herein, a coding sequence is "operably linked to" another coding
sequence when
S RNA polymerise will transcribe the two coding sequences into a single mRNA,
which is then
translated into a single polypeptide having amino acids derived from both
coding sequences. The
coding sequences need not be contiguous to one another so long as the
expressed sequence is
ultimately processed to produce the desired protein.
As used herein, "recombinant" polypeptides refer to polypeptides produced by
recombinant DNA techniques; i.e., produced from cells transformed by an
exogenous DNA
construct encoding the desired polypeptide. "Synthetic" polypeptides are those
prepared by
chemical synthesis.
As used herein, a "replicon" is any genetic element (e.g., plasmid,
chromosome, virus)
that functions as an autonomous unit of DNA replication in vivo; i.e., capable
of replication
under its own control.
As used herein, a "vector" is a replicon, such as a plasmid, phage, or cosmid,
to which
another DNA segment may be attached so as to bring about the replication of
the attached
segment.
As used herein, a "reference" gene refers to the wild type gene sequence of
the invention
and is understood to include the various sequence polymorphisms that exist,
wherein nucleotide
substitutions in the gene sequence exist, but do not affect the essential
function of the gene
product.
As used herein, a "mutant" gene refers sequences different from the reference
gene
wherein nucleotide substitutions and/or deletions and/or insertions result in
perturbation of the
essential function of the gene product.
As used herein, a DNA "coding sequence of" or a "nucleotide sequence encoding"
a
particular protein, is a DNA sequence which is transcribed and translated into
a polypeptide
when placed under the control of appropriate regulatory sequences.
As used herein, a "promoter sequence" is a DNA regulatory region capable of
binding
RNA polymerise in a cell and initiating transcription of a downstream (3'
direction) coding
sequence. For purposes of defining the present invention, the promoter
sequence is bound at its
3' terminus by a translation start codon (e.g., ATG) of a coding sequence and
extends upstream
(5' direction) to include the minimum number of bases or elements necessary to
initiate
transcription at levels detectable above background. Within the promoter
sequence will be found
4
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
a transcription initiation site (conveniently defined by mapping with nuclease
S1), as well as
protein binding domains (consensus sequences) responsible for the binding of
RNA polymerase.
Eukaryotic promoters will often, but not always, contain "TATA" boxes and
"CAT" boxes.
Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10
and -35
consensussequences.
As used herein, DNA "control sequences" refers collectively to promoter
sequences,
ribosome binding sites, polyadenylation signals, transcription termination
sequences, upstream
regulatory domains, enhancers and the like, which collectively provide for the
expression (i.e.,
the transcription and translation) of a coding sequence in a host cell.
As used herein, a control sequence "directs the expression" of a coding
sequence in a cell
when RNA polymerase will bind the promoter sequence and transcribe the coding
sequence into
mRNA, which is then translated into the polypeptide encoded by the coding
sequence.
As used herein, a "host cell" is a cell which has been transformed or
transfected, or is
capable of transformation or transfection by an exogenous DNA sequence.
As used herein, a cell has been "transformed" by exogenous DNA when such
exogenous
DNA has been introduced inside the cell membrane. Exogenous DNA may or may not
be
integrated (covalently linked) into chromosomal DNA making up the genome of
the cell. In
prokaryotes and yeasts, for example, the exogenous DNA may be maintained on an
episomal
element, such as a plasmid. With respect to eukaryotic cells, a stably
transformed or transfected
cell is one in which the exogenous DNA has become integrated into the
chromosome so that it
is inherited by daughter cells through chromosome replication. This stability
is demonstrated by
the ability of the eukaryotic cell to establish cell lines or clones comprised
of a population of
daughter cells containing the exogenous DNA.
As used herein, "transfection" or "transfected" refers to a process by which
cells take up
foreign DNA and integrate that foreign DNA into their chromosome. Transfection
can be
accomplished, for example, by various techniques in which cells take up DNA
(e.g., calcium
phosphate precipitation, electroporation, assimilation of liposomes, etc.) or
by infection, in
which viruses are used to transfer DNA into cells.
As used herein, a "target cell" is a cell that is selectively transfected over
other cell types
(or cell lines).
As used herein, a "clone" is a population of cells derived from a single cell
or common
ancestor by mitosis. A "cell line" is a clone of a primary cell that is
capable of stable growth in
vitro for many generations.
As used herein, a "heterologous" region of a DNA construct is an identifiable
segment of
5
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
DNA within or attached to another DNA molecule that is not found in
association with the other
molecule in nature. Thus, when the heterologous region encodes a gene, the
gene will usually
be flanked by DNA that does not flank the gene in the genome of the source.
Another example
of a heterologous coding sequence is a construct where the coding sequence
itself is not found
in nature (e.g., synthetic sequences having codons different from the native
gene). Allelic
variation or naturally occurring mutational events do not give rise to a
heterologous region of
DNA, as used herein.
An aspect of the present invention is isolated polynucleotides encoding a
protein including
substantially similar sequences and functional fragments. Isolated
polynucleotide sequences are
substantially similar if they are capable of hybridizing under moderately
stringent conditions to
SEQ ID NO:1 or they encode DNA sequences which are degenerate to SEQ ID NO:1
or are
degenerate to those sequences capable of hybridizing under moderately
stringent conditions to
SEQ ID NO:1.
Moderately stringent conditions is a term understood by the skilled artisan
and has been
described in, for example, Sambrook et al. Molecular Cloning: A Laboratory
Manual, 2nd
edition, Vol. 1, pp. 101-104, Cold Spring Harbor Laboratory Press (1989). An
exemplary
hybridization protocol using moderately stringent conditions is as follows.
Nitrocellulose filters
are prehybridized at 65° C. in a solution containing 6× SSPE,
5× Denhardt's
solution (10 g Ficoll, 10 g BSA and 10 g polyvinylpyrrolidone per litre
solution), 0.05% SDS
and 100 ,ug/ml tRNA. Hybridization probes are labelled, preferably
radiolabelled (e.g., using
the Bios TAG-IT® kit). Hybridization is then carried out for approximately
18 hours at
65° C. The filters are then washed twice in a solution of 2× SSC
and 0.5 % SDS at
room temperature for 15 minutes. Subsequently, the filters are washed at
58° C.,
air-dried and exposed to X-ray film overnight at -70° C. with an
intensifying screen.
Degenerate DNA sequences encode the same amino acid sequence as SEQ ID N0:2 or
the proteins encoded by that sequence capable of hybridizing under moderately
stringent
conditions to SEQ ID NO: l, but have variations) in the nucleotide coding
sequences because
of the degeneracy of the genetic code. For example, the degenerate codons UUC
and UUU both
code for the amino acid phenylalanine, whereas the four codons GGX all code
for glycine.
Alternatively, substantially similar sequences are defined as those sequences
in which
about 70 % , preferably about 80 % and most preferably about 90 % , of the
nucleotides or amino
acids match over a defined length of the molecule. As used herein,
substantially similar refers
to the sequences having similar identity to the sequences of the instant
invention. Thus nucleotide
sequences that are substantially the same can be identified by hybridization
or by sequence
6
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
comparison. Protein sequences that are substantially the same can be
identified by techniques
such as proteolytic digestion, gel electrophoresis and/or microsequencing.
Embodiments of the isolated polynucleotides of the invention include DNA,
genomic DNA
and RNA, preferably of Brassica origin. A method for isolating a nucleic acid
molecule encoding
a protein is to probe a genomic or cDNA library with a natural or artificially
designed probe
using art recognized procedures. See, e.g., "Current Protocols in Molecular
Biology", Ausubel
et al. (eds. ) Greene Publishing Association and John Wiley Interscience, New
York, 1989,1992.
The ordinarily skilled artisan will appreciate that SEQ ID NO:1 or fragments
thereof comprising
at least 15 contiguous nucleotides are particularly useful probes. It is also
appreciated that such
probes can be and are preferably labelled with an analytically detectable
reagent to facilitate
identification of the probe. Useful reagents include, but are not limited to,
radioisotopes,
fluorescent dyes or enzymes capable of catalysing the formation of a
detectable product. The
probes would enable the ordinarily skilled artisan to isolate complementary
copies of genomic
DNA, cDNA or RNA polynucleotides encoding proteins from Brassica or other
plant sources
or to screen such sources for related sequences, e.g., additional members of
the family, type
and/or subtype, including transcriptional regulatory and control elements as
well as other
stability, processing, translation and tissue specificity-determining regions
from 5' and/or 3'
regions relative to the coding sequences disclosed herein, all without undue
experimentation.
Another aspect of the invention is functional polypeptides encoded by the
polynucleotides
of the invention. An embodiment of a functional polypeptide of the invention
is the Brassica
protein having the amino acid sequence set forth in SEQ ID N0:2.
Another aspect of the invention is a method for preparing essentially pure
Brassica protein.
Yet another aspect is the Brassica protein produced by the preparation method
of the invention.
This protein has the amino acid sequence listed in SEQ ID N0:2 and includes
variants with a
substantially similar amino acid sequence that have the same function. The
proteins of this
invention can be made by recombinant genetic engineering techniques by
culturing a
recombinant host cell containing a vector encoding the polynucleotides of the
invention under
conditions promoting the expression of the protein and recovery thereof.
The isolated polynucleotides, particularly the DNAs, can be introduced into
expression
vectors by operatively linking the DNA to the necessary expression control
regions, e.g.,
regulatory regions, required for gene expression. The vectors can be
introduced into an
appropriate host cell such as a prokaryotic, e.g., bacterial, or eukaryotic,
e.g., yeast or plant cell
by methods well known in the art. See Ausubel et al., supra. The coding
sequences for the
desired proteins, having been prepared or isolated, can be cloned into any
suitable vector or
7
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
replicon. Numerous cloning vectors are known to those of skill in the art and
the selection of an
appropriate cloning vector is a matter of choice. Examples of recombinant DNA
vectors for
cloning and host cells which they can transform include, but are not limited
to, the bacteriophage
lambda. (E. coli), pBR322 (E. coli), pACYC177 (E. coli), pGEX4T-3 (E. coli ,
pKT230
(gram-negative bacteria), pGV 1106 (gram-negative bacteria), pLAFRl (gram-
negative bacteria),
pME290 (non-E.coli gram-negative bacteria), pHVl4 (E. coli and Bacillus
subtlilis), pBD9
(Bacillus , pIJ61 (Streptomyces), pUC6 (Streptomyces), YIpS (Saccharomvces)
and YCpl9
(Saccharom~). See generally, "DNA Cloning": Vols. I & II, Glover et al. ed.
IRL Press
Oxford (1985) (1987); and T. Maniatis et al. ("Molecular Cloning" Cold Spring
Harbor
Laboratory (1982).
The gene can be placed under the control of control elements such as a
promoter,
ribosome binding site (for bacterial expression) and, optionally, an operator,
so that the DNA
sequence encoding the desired protein is transcribed into RNA in the host cell
transformed by
a vector containing the expression construct. The coding sequence may or may
not contain a
signal peptide or leader sequence. The proteins of the present invention can
be expressed using,
for example, the E. coli tac promoter or the protein A gene (spa) promoter and
signal sequence.
Leader sequences can be removed by the bacterial host in post-translational
processing. See,
e.g., U.S. Pat. Nos. 4,431,739; 4,425,437 and 4,338,397.
In addition to control sequences, it may be desirable to add regulatory
sequences which
allow for regulation of the expression of the protein sequences relative to
the growth of the host
cell. Regulatory sequences are known to those of skill in the art. Exemplary
are those which
cause the expression of a gene to be turned on or off in response to a
chemical or physical
stimulus, including the presence of a regulatory compound or to various
temperature or
metabolic conditions. Other types of regulatory elements may also be present
in the vector, for
example, enhancer sequences.
An expression vector is constructed so that the particular coding sequence is
located in the
vector with the appropriate regulatory sequences, the positioning and
orientation of the coding
sequence with respect to the control sequences being such that the coding
sequence is transcribed
under the "control" of the control sequences, i.e., RNA polymerase which binds
to the DNA
molecule at the control sequences transcribes the coding sequence.
Modification of the sequences
encoding the particular antigen of interest may be desirable to achieve this
end. For example,
in some cases it may be necessary to modify the sequence so that it may be
attached to the
control sequences with the appropriate orientation; i.e., to maintain the
reading frame. The
control sequences and other regulatory sequences may be ligated to the coding
sequence prior
8
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
to insertion into a vector, such as the cloning vectors described above.
Alternatively, the coding
sequence can be cloned directly into an expression vector which already
contains the control
sequences and an appropriate restriction site.
In some cases, it may be desirable to produce mutants or analogues of Brassica
protein.
S Mutants or analogues may be prepared by the deletion of a portion of the
sequence encoding the
protein, by insertion of a sequence, and/or by substitution of one or more
nucleotides within the
sequence. Techniques for modifying nucleotide sequences, such as site-directed
mutagenesis, are
well known to those skilled in the art. See, e.g., T. Maniatis et al., supra;
"DNA Cloning,"
Vols. I and II, supra; and "Nucleic Acid Hybridization", supra.
Depending on the expression system and host selected, the proteins of the
present
invention are produced by growing host cells transformed by an expression
vector described
above under conditions whereby the protein of interest is expressed. Preferred
plant cells include
Brassica cells. If the expression system secretes the protein into growth
media, the protein can
be purified directly from the media. If the protein is not secreted, it is
isolated from cell lysates
or recovered from the cell membrane fraction. The selection of the appropriate
growth
conditions and recovery methods are within the skill of the art.
An alternative method to identify proteins of the present invention is by
constructing gene
libraries, using the resulting clones to transform E. coli and pooling and
screening individual
colonies.
The proteins of the present invention may also be produced by chemical
synthesis such
as solid phase peptide synthesis on an automated peptide synthesizer, using
known amino acid
sequences or amino acid sequences derived from the DNA sequence of the genes
of interest.
Such methods are known to those skilled in the art.
Another aspect of the invention is antisense oligonucleotides comprising a
sequence which
is capable of binding to the polynucleotides of the invention. Synthetic
oligonucleotides or related
antisense chemical structural analogs can be designed to recognize,
specifically bind to and
prevent transcription of a target nucleic acid encoding protein by those of
ordinary skill in the
art. See generally, Cohen, J. S., Trends in Pharm. Sci., 10, 435(1989) and
Weintraub, H. M.,
Scientific American, January (1990) at page 40.By "antisense" RNA is meant a
complementary
RNA sequence that binds to and blocks the transcription of a naturally
occurring sense
messenger RNA molecule.
By "cosuppression" is meant the phenomenon of native gene silencing as a
result of attempting
to over-express the same gene, by recombinant DNA, in its original host plant
(from which the
gene has been isolated). In the case of this invention the myo-inositol 1-
phosphate (mips) gene
9
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
was isolated from Brassica na us and was re-introduced back into B. napus by
A~robacterium
tumefasciens transformation.
Defining appropriate hybridization conditions is within the skill of the art.
See, e.g.,
"Current Protocols in Mol. Biol." Vol. I & II, Wiley Interscience. Ausbel et
al. (eds.) (1992).
Probing technology is well known in the art and it is appreciated that the
size of the probes can
vary widely but it is preferred that the probe be at least 15 nucleotides in
length. It is also
appreciated that such probes can be and are preferably labelled with an
analytically detectable
reagent to facilitate identification of the probe. Useful reagents include but
are not limited to
radioisotopes, fluorescent dyes or enzymes capable of catalysing the formation
of a detectable
product. As a general rule, the more stringent the hybridization conditions
the more closely
related genes will be that are recovered.
Another aspect of the invention is transgenic, non-Brassica plants capable of
expressing
the polynucleotides of the invention in any cell. Transgenic, non-Brassica
plants may be obtained
by transfecting with the polynucleotides of the invention. The resultant
transgenic plant may be
used as a model for the study of gene function or for producing large amounts
of protein for
screening or crystallography purposes. Particularly useful transgenic plants
are those which
display a detectable phenotype associated with the expression of the protein.
Experimental Results
a) Cloning of myo-inositol 1-phosphate synthase (MIPS) gene from B. napus:
A cDNA copy of MIPS gene was isolated from B. na us developing seed by the RT-
PCR method
. RT-PCR was conducted by synthesizing 1 st strand cDNA of MIPS using the 1 st
strand cDNA
synthesis kit (Boehringer Mannheim). Briefly, 1 pg of total RNA from B. napus
developing seeds
was added to 0.5 ml tube containing MIPS-right primer (5'
AAAAAATCTAGAGTGAACACTTGTATTCCAAGATCA 3'), lx RT (reverse transcriptase)
buffer, the four dNTPs, and water. The mixture was incubated at 25° C
for 10 min and was then
placed on ice. Subsequently, 20 U of RT (reverse transcriptase) was added,
mixed very well. The
reaction was initiated by incubating the tube at 42° C for 60 min.
Finally, heating at 95° C for 10
min inactivated the RT enzyme. The product is the 1 st strand of MIPS gene.
For PCR amplification, 5 ~L of 1 st strand cDNA solution was added to 0.5 ml
tube containing lx
Vent polymerise buffer, the four dNTPs, the MIPS-left primer (5'
AA.AAAACCCGGGATGATCGAGAGCTTCAAAGTC 3'), the right primer, and water. The
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
reaction was initiated by addition of 1 U of Vent DNA polymerase, mixed very
well and placed
in a DNA thermal cycler (Perkin Elmer Cetus). Heating at 94° C for 2
min followed by 35 cycle
each of which includes heating at 94° C for 1 min, annealing at
52° C for 1 min and extension at
72° C for 3 min.
The left and right primer (containingXbaland Smal site respectively) were
synthesized according
to the published MIPS DNA sequence of Arabidopsis thaliana (GenBank accession
number
U04876).
At the end of the PCR run, 5 ~L of the reaction solution was loaded on 1.2%
Agarose gel. The
PCR product was purified by PCR purification kit (Promaga) and was then
digested with bothXbal
and Smal. The digested DNA was loaded on gel and the 1.7 Kb fragment was
eluted and purified.
The purified fragment was then cloned into pSPORTl (GIBGOBRL) pre-cut with
bothXbal and
Smal. The clone containing the insert was subjected to full length DNA
sequencing.
Total RNA was extracted from plant tissue by using RNeasy plant total RNA kit
(Qiagen).
b) DNA sequence analysis
DNA sequencing was performed by the DNA Services Lab at PBI using ABI Prism
Dye
Terminator cycle sequencing ready reaction kit with AmpliTaq DNA polymerase
and following
the company's protocol (Perkin Elmer).
These primers as well as those for sequencing were synthesized in an Applied
Biosystems DNA synthesizer.
c) Cloning of MIPS gene in pBI121
The MIPS cDNA was cloned under CamV35S or B. napus napin promoters in both
orientations
( sense or anti-sense) in the plant vector pBI121 (from Clontech). The
constructs were
transferred into A~robacterium tumefaciens strain CV3101: pMP90RK by
electroporation. The
transformants were grown on kanamycin-containing plates and then screened by
PCR
analysis for the presence of the construct. The positive transformants were
used for Brassica
napus transformation. Plant transformation was conducted according to Maloney
et a1,1989
Maloney ,N.M., Walker, J M., and Sharma,K.K. 1989, Plant Cell Reports 8, 238)
11
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
d) Isolation of the MIPS genomic promoter
The genomic MIPS promoter was isolated from B. napes by PCR with a primer
designed to
read beyond the 5' end of the MIPS gene. The DNA sequence of this promoter
probably
extends much beyond the promoter itself. This promoter would be useful for
targeting the
expression of foreign genes to the same location and at the same time (spatial-
and temporal-
mode of expression). In this way more precise deactivation of MIPS gene can be
achieved.
Also, it can be used in any experiments where the desired trait must accompany
the expression
of the native MIPS gene. The sequence including the MIPS promoter(3795 bp)
from B.napus
that we cloned is shown in SEQ ID NO:S.
e) Plant materials:
Brassica napes, Var. Westar, the control and transgenic , plants were grown in
a growth
chamber under a l6hr. light cycle at 20°C, followed by 8hr. darlrness
at 15°C. Phytate levels
were measured and compared for control and transgenic plants. Reductions of
30% to 50% in
phytate levels were found.
12
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
1/10
SEQUENCE LISTING
<110> Georges, Fawzy
Hussain, Atta A
$ Keller, Wilfred A
<120> Method for Reducing Phytate in Canola Meal Using
Genetic Manipulation Involving myo-Inositol 1-Phosphate
Synthase Gene
<130> Method for reducing phytate in canola
<140> unknown
<141> 2000-05-25
1$
<150> US 60/136,204
<151> 1999-05-26
<160> 4
<170> PatentIn Ver. 2.1
<210> 1
<211> 1781
2$ <212> DNA
<213> Brassica napus
<400> 1
aaaccacaca aactcgattc aattaaaaac cgagaaaaca aaagtctgtt taaaagatgt 60
tcatcgagag cttcaaagtc gagagcccga acgtgaagta cacggagaat gagattcatt 120
cggtgtacga ttacgagacc acggaggtcg ttcacgagaa cgtcaacggt gcttaccagt 180
3$ ggatcgtgaa gcccaaggtt gtcaaatacg atttcaaaac cgacactcgt gtccccaaat 240
taggggttat gcttgttggt tggggaggaa acaatggatc aaccctcacc gctggtgtaa 300
SUBSTITUTE SHEET (RULE 26)
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
2/ 10
ttgccaataa agaaggaatc tcgtgggcga ccaaggacaa ggtgcaacaa gcgaactact 360
tcgggtcgtt aacacaagca tcgtctattc gtgtcggatc ctttaacggt gaagagatgt 420
S
atgccccttt caagagtctc gttccaatgg tgaatccgga tgatgttgtg tttggaggat 480
gggacataag cgatatgaat ttagcagacg cgatgggtag agccaaggtt cttgacattg 540
atctgcagaa acagctcagg ccttacatgg agaacattgt cccactccct gggatctacg 600
accctgattt catcgctgcc aatcaaggct cacgtgccaa caacgtgatc aaaggtacca 660
agaaggaaca agtcgaccaa atcatcaagg acatgaggga gtttaaggag aagaacaagg 720
tggataaggt tgtggttctg tggacggcta acacagagcg ttacagcaat gtgatcgtgg 780
ggctaaacga cactatggag aatcttatga actctgtgga tagggatgag tctgagatct 840
ctccttccac gctttatgct attgcatgtg ttcttgaagg tattcctttc atcaatggaa 900
gccctcagaa cacctttgtt ccgggtctta ttgatttggc tatcaagaac aatgttttga 960
tcggtggaga tgacttcaag agtggtcaaa ccaagatgaa atctgtcttg gttgatttcc 1020
ttgttggtgc aggcatcaag cctacttcaa ttgtgagcta caatcaccta gggaacaacg 1080
atggaatgaa cctctcagct ccacagacat tcagatctaa ggagatctcc aaaagtaatg 1140
tggttgacga tatggttgct agcaacggta tcctcttcga gcccggggaa catccagacc 1200
atgtagttgt catcaagtat gtaccgtatg ttgcagatag caagcgagcc atggatgagt 1260
atacatcaga gatattcatg ggaggcaaga acacaattgt gatgcacaat acctgcgagg 1320
actctctctt agctgctcca atcatcttgg atcttgttct cctcgctgaa atcagcacca 1380
SUBSTITUTE SHEET (RULE 26)
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
3/10
ggattcagtt caaatccgag aaagagggga agtttcattc tttccatcct gtggccacca 1440
aacttagcta tctcaccaag gcaccgctcg tgccgccggg aacaccggtg gttaatgcgc 1500
tgtcgaagca gcgggctatg ctggagaata ttcttagggc gtgtgttggg ctggcgccgg 1560
agaacaatat gatcttggaa tacaagtgaa cacgaagcgt ttaagagtct ttaattagcc 1620
ccaaatataa gacttctgtt tcttgttttt ttttaataaa tgttttaaaa tatgaatgct 1680
tgtgttttca gagatcaaag agcttttaga ttgatctttg tagggtgtga agttaccggt 1740
gtttctagta atccagatgg gctagtataa aaaaaaaaaa a 1781
1$ <210> 2
<211> 510
<212> PRT
<213> Brassica napus
<400> 2
Met Phe Ile Glu Ser Phe Lys Val Glu Ser Pro Asn Val Lys Tyr Thr
1 5 10 15
Glu Asn Glu Ile His Ser Val Tyr Asp Tyr Glu Thr Thr Glu Val Val
2$ 20 25 30
His Glu Asn Val Asn Gly Ala Tyr Gln Trp Ile Val Lys Pro Lys Val
35 40 45
Val Lys Tyr Asp Phe Lys Thr Asp Thr Arg Val Pro Lys Leu Gly Val
50 55 60
Met Leu Val Gly Trp Gly Gly Asn Asn Gly Ser Thr Leu Thr Ala Gly
65 70 75 80
Val Ile Ala Asn Lys Glu Gly Ile Ser Trp Ala Thr Lys Asp Lys Val
85 90 95
SUBSTITUTE SHEET (RULE 26)
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
4/ 10
Gln Gln Ala Asn Tyr Phe Gly Ser Leu Thr Gln Ala Ser Ser Ile Arg
100 105 110
Val Gly Ser Phe Asn Gly Glu Glu Met Tyr Ala Pro Phe Lys Ser Leu
115 120 125
Val Pro Met Val Asn Pro Asp Asp Val Val Phe Gly Gly Trp Asp Ile
130 135 140
Ser Asp Met Asn Leu Ala Asp Ala Met Gly Arg Ala Lys Val Leu Asp
145 150 155 160
Ile Asp Leu Gln Lys Gln Leu Arg Pro Tyr Met Glu Asn Ile Val Pro
165 170 175
I5
Leu Pro Gly Ile Tyr Asp Pro Asp Phe Ile Ala Ala Asn Gln Gly Ser
180 185 190
Arg Ala Asn Asn Val Ile Lys Gly Thr Lys Lys Glu Gln Val Asp Gln
195 200 205
Ile Ile Lys Asp Met Arg Glu Phe Lys Glu Lys Asn Lys Val Asp Lys
210 215 220
2$ Val Val Val Leu Trp Thr Ala Asn Thr Glu Arg Tyr Ser Asn Val Ile
225 230 235 240
Val Gly Leu Asn Asp Thr Met Glu Asn Leu Met Asn Ser Val Asp Arg
245 250 255
Asp Glu Ser Glu Ile Ser Pro Ser Thr Leu Tyr Ala Ile Ala Cys Val
260 265 270
Leu Glu Gly Ile Pro Phe Ile Asn Gly Ser Pro Gln Asn Thr Phe Val
3$ 275 280 285
SUBSTITUTE SHEET (RULE 26)
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
$/10
Pro Gly Leu Ile Asp Leu Ala Ile Lys Asn Asn Val Leu Ile Gly Gly
290 295 300
Asp Asp Phe Lys Ser Gly Gln Thr Lys Met Lys Ser Val Leu Val Asp
$ 305 310 315 320
Phe Leu Val Gly Ala Gly Ile Lys Pro Thr Ser Ile Val Ser Tyr Asn
325 330 335
His Leu Gly Asn Asn Asp Gly Met Asn Leu Ser Ala Pro Gln Thr Phe
340 345 350
Arg Ser Lys Glu Ile Ser Lys Ser Asn Val Val Asp Asp Met Val Ala
355 360 365
1$
Ser Asn Gly Ile Leu Phe Glu Pro Gly Glu His Pro Asp His Val Val
370 375 380
Val Ile Lys Tyr Val Pro Tyr Val Ala Asp Ser Lys Arg Ala Met Asp
385 390 395 400
Glu Tyr Thr Ser Glu Ile Phe Met Gly Gly Lys Asn Thr Ile Val Met
405 410 415
2$ His Asn Thr Cys Glu Asp Ser Leu Leu Ala Ala Pro Ile Ile Leu Asp
420 425 430
Leu Val Leu Leu Ala Glu Ile Ser Thr Arg Ile Gln Phe Lys Ser Glu
435 440 445
Lys Glu Gly Lys Phe His Ser Phe His Pro Val Ala Thr Lys Leu Ser
450 455 460
Tyr Leu Thr Lys Ala Pro Leu Val Pro Pro Gly Thr Pro Val Val Asn
3$ 465 470 475 480
SUBSTITUTE SHEET (RULE 26)
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
6/10
Ala Leu Ser Lys Gln Arg Ala Met Leu Glu Asn Ile Leu Arg Ala Cys
485 490 495
Val Gly Leu Ala Pro Glu Asn Asn Met Ile Leu Glu Tyr Lys
500 505 510
<210> 3
<211> 36
<212> DNA
<213> Brassica napus
<400> 3
aaaaaatcta gagtgaacac ttgtattcca agatca 36
<210> 4
<211> 33
<212> DNA
<213> Brassica napus
<400> 4
aaaaaacccg ggatgatcga gagcttcaaa gtc 33
<210> 5
<211> 3795
<212> DNA
<213> Brassica napus
<400> 5
taaattctag aacccacccc aaaaccaaaa aaaaactgga ccaaatgtga tgctataagc 60
ctactttaga tgcggaaaat tatggtcctt tacaaagatt tacctccttt agttgggata 120
tatgtggttt atagacgact taagatataa gcagtgtttt catacacgat ttaacccgca 180
SUBSTITUTE SHEET (RULE 26)
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
7/ 10
gtcgaaacgg taaatttggt aaccatatat aatatggttt cgatttaatg aaaaaactca 240
ttaactaaaa atgcaataaa acctaaaaac ccgcaattaa cccgtgaacc gacacatgtt 300
S
gatccagtaa aatcccagaa aaatgtgatt aaacttttca tatacttttt attagtataa 360
aaaattaaat aaactatttg atttgtcata taaagtaaat acattgtatt tatgttatgc 420
attttagttt atgagttttg taatgatcat attaaagtta catttgtgag ttttgaaatt 480
aatatgagat tttaataatt ttagttatat tattataata taactatgta aatagatgaa 540
atctcttttt ttaagtgaaa taggattctc ttacactctc agattttatg taaatatata 600
tatatatata tatatacact aacgtgtgtt gtgcactatt agtctattat aaatgtattt 660
gttaatgtca catactgaag gttagccaaa taaaaatgtc acacggttaa accattttgt 720
aacggttcct cgtttttaat gaataattat atatatgtca taagaatcaa accaatcggt 780
aatgttttgt ttgaattaat tgtaggacca aaataataac taatagtaat aaataggcca 840
aataattttt tgaagtagat ttattaaaac tccttccctt ttaatagtat tgatttctta 900
aatatggaaa ataagtatac ctcgaaatca tcggaaattt tattaaattt atgaatagta 960
gcatcaatta attaaaggat ttataacact gtacgaatct accagtatct ccggataata 1020
catagaaacg tccacgaaga aaccttttat aaaggttgga aaagatttag aaccatttat 1080
gcgttaatta cttgatttaa tccgtttctg aacacttttc acacagacta aaaaaagagc 1140
agaaatatac ggtaagttgt tattaaatta tatttttctg accaaaagta ttttagataa 1200
ataaaattat ttataaaatc aatgcagttt acaataaatt ttcagttgaa agtaagtata 1260
SUBSTITUTE SHEET (RULE 26)
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
8/10
atttgcattg aaattgtaaa ttgacatttt ttgtgtaaca aaaaaaaaag caagaataat 1320
cacttgtcat agaacagtgg gagtatgata aaaactaatt ataaatgttc agacatatgt 1380
aagcttgtag attcaagtat ggtatagagc tcgacttcgg tcgtctcgag ctcgaactcg 1440
ccaaggtcga gatgcccgga ctcatggctt gccgtaccga gttcggccca tctcagccct 1500
tcaaaggcga tagaatcacc ggatctctcc acatgaccat ccaaaccgac gtcctcatcg 1560
agaccctaac cgccctcggc gctgaagtca gatggtgctc ctgcaacatc gtctacagaa 1620
gaagcctcct ccgattgtcg tgattcgctc aagtaaaagg agaaagcagc ggagagagga 1680
agagggtcgg accataaccc taattcccaa aatcacgagt cgattcgagg gtctggtggc 1740
gatgggtcgt cgaggtcggt ttcggttgcg gagagtgtcg tgtttggtaa agagaaggac 1800
tttaacggtg gaatgaacag agagctcgat ggcagtgaaa gcgtggtttc gttagtgcct 1860
tgtcgaagct ctggattgga gccatcatcc aaggtggttt cctcgcttgg agggacgacg 1920
cgctcgcgtg gaggccgtgg cgtgagaaga tcggattgca tgttcgagtt gtggttccgg 1980
2$ gagatggagg ctaccacaga tctgtcgtcg ccggcttttc tccggggggt ggaggctcct 2040
tcagctccgc cgacgccggt tcaagttccc gggaaaggga gtcttcctta gatttacctt 2100
cgcccggttt ggtgaacgga attgccggat gctttcatag atccgcgctg ccgatgagaa 2160
acccgaagct tttgggttaa ggttactatt gttcgtttag tgcgaaacta gaagtggtta 2220
ctgtctaggt ggttctgggt cagggcggag gagttctcgg tttgatgatg aagctctctg 2280
ctgaggtgaa gttggtcaag tcaacaatta ggtgattatc gatacgcacg tctagggttt 2340
taagcggttc aaaggcggag atgatctcgt gtttcgattg atctcttccg cgtgttgaca 2400
SUBSTITUTE SHEET (RULE 26)
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
9/ 10
gtgcgggtag tggttggaag tttggttgtg tcgggggata tctcgatggt ttgagaaaga 2460
cctccgacat gatgtaaaag caaggaaaat agtctccggg gtgtgaaggt ggtcatgtgc 2520
cttaagccgc cggcaagtgg tttcctattt ccttttctat gtatttttta aggcttccaa 2580
tcttagtttc ttgcgtttaa gtcaagttgg ggttcgggtt tgttggataa agtttcttcg 2640
tcgtaggacg atggaagcta tccggagtaa aggttgttgc ttgagcgaag cctcctcctt 2700
tggtcctcgt attgaattct ggcggatgag atctcggtat cgattgattc tctctgacat 2760
taggcggtcc tgggaggttt ggcgttcgtg gtgaaaaagg tgaggagtct atgggctccg 2820
1$
gtgaagcgta gtgaatcgat aggcgattct aaggtggttg ttgagttggt gcggttcgcg 2880
tgaaggcggc cgacatcacc ctttctctct tgggccggtg tagccttgtc ggcttacggt 2940
ttcgtttgtt tttgtttggt tgcccgttta gtgttgtggg cttttgtatt tgggcttcgg 3000
ccattgggct tggcccgtaa cttttaataa aataataact tgacggaaaa aaaaaaaaaa 3060
aaagcttgta gattcataat tcacgtgtca aagcaagtca acaagactcc acgggaccca 3120
actcaacgaa gacaaagagt caaaaaaacg gtcagacatt gttttcaaac gaccgttaat 3180
tagccacgtt agttactaca cgctccatct ctggaacgtg acatccaccc agaatatgtg 3240
gcagctaaat gtggtgtgtg tttacttcac tctcgttttt ttcgtaactg agaaacaact 3300
gtcgctaact aactgtaacg gagacaatgt ccgaaacact gtcgttttac tgattgagta 3360
acggaagtaa ctaacgtccc ccaccttgtt cgagcacctt caacaaaaaa atgtgggtcc 3420
gagaagacaa tccgacaaaa ctttgctatt gaaaaaacga cgccacgtgt atggtccagg 3480
SUBSTITUTE SHEET (RULE 26)
CA 02375071 2001-11-23
WO 00/73473 PCT/CA00/00612
10/10
gctccgacgt gtcacacttt ttctctccgc gcctctcacg tgcgagaccc ctccctcaca 3540
cgtatgattc actattagcc atcaacgaag tcgctcacat gcattggcta aagagggtcc 3600
accaaccact gagaccacgc cacgtgtctc ctctccctcg cgctcttttt ctataaatag 3660
cgctccattt aagagaagct caaacccaca caaactcgat tcaattaaaa accgagaaaa 3720
caaaagtctg tttaaaagat gttcatcgag agcttcaaag tcgagagccc gaacgtgaag 3780
tacacggaga atgag 3795
SUBSTITUTE SHEET (RULE 26)
