Note: Descriptions are shown in the official language in which they were submitted.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
FUSION PROTEINS COMPRISING A FRAGMENT OF A CHAPERON POLYPEPTIDE
The present invention relates to chaperone polypeptides which are active in
the folding
and maintenance of structural integrity of other proteins and the use thereof
as fusion
partners to assist in the expression of polypeptides in expression systems.
The invention
also relates to nucleic acids encoding chaperone polypeptides and fusion
proteins as
described, vectors comprising these nucleic acids, and host cells modified
with the nucleic
acids or vectors so as to express the fusion protein(s).
Chaperones are in general known to be large multisubunit protein assemblies
essential in
mediating polypeptide chain folding in a variety of cellular compartments.
Families of
chaperones have been identified, for example the chaperonin hsp60 family
otherwise
known as the cpn60 class of proteins are expressed constitutively and there
are examples
1 ~ to be found in the bacterial cytoplasm (GroEL), in endosymbiotically
derived
mitochondria (hsp60) and in chloroplasts (Rubisco binding protein). Another
chaperone
family is designated TF55/TCP1 and found in the thermophilic archaea and the
evolutionarily connected eukaryotic cytosol. A comparison of amino acid
sequence data
has shown that there is at least 50% sequence identity between chaperones
found in
prokaryotes, mitochondria and chloroplasts (Ellis R J and Van der Vies S M
(1991) Ann
Rev Biochem 60: 321-347).
A typical chaperonin is GroEL which is a member of the hsp60 family of heat
shock
proteins. GroEL is a tetradecamer wherein each monomeric subunit (cpn60m) has
a
2~ molecular weight of approximately 57kD. The tetradecamer facilitates the in
vitro folding
of a number of proteins which would otherwise misfold or aggregate and
precipitate. The
structure of GroEL from E. coli has been established through X-ray
crystallographic
studies as reported by Braig K et al (1994) Nature 371: 578-586. The bolo
protein is
cylindrical, consisting of two seven-membered rings that form a large central
cavity which
according to Ellis R J and Hartl F U (1996) FASEB Journal 10: 20-26 is
generally
considered to be essential for activity. Some small proteins have been
demonstrated to
fold from their denatured states when bound to GroEL (Gray T E and Fersht A R
(1993) J
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
7
Mol Biol 232: 1197-1207; Hunt J F et al (1996) Nature 379: 37-4~; Weissman J S
et al
(1996) Cell 84: 481-490; Mayhew M et al (1996) Nature 379: 420-426: Corrales F
J and
Fersht A R (1995) Proc Nat Acad Sci 92: 5326-5330) and it has been argued that
a cage-
like structure is necessary to sequester partly folded or assembled proteins
(Ellis R J and
Hartl F U (1996) supra.
The entire amino acid sequence of E. coli GroEL is also known (see Braig K et
al (1994)
supra) and three domains have been ascribed to each cpn60m of the holo
chaperonin
(tetradecamer): These are the intermediate (amino acid residues 1-~, 134-190.
377-408
and 524-548), equatorial (residues 6-133 and 409-523) and apical (residues 191-
376)
domains.
Monomers of GroEL have been induced by urea or pressure, but they are inactive
and
have to reassociate to form the central cavity in order to facilitate the
refolding of
rhodanese -(Mendoza J A et al ( 1994) J Biol Chem 269: 2447-2451; Ybarra J and
Horowitz P M (1995) J Biol Chem 270: 22962-22967).
GroEL facilitates the folding of a number of proteins by two mechanisms; ( 1 )
it prevents
aggregation by binding to partly folded proteins (Goloubinoff P et al (1989)
Nature 342:
884-889; Zahn R and Pluckthun A (1992) Biochemistry 31: 3249-3255), which then
refold on GroEL -to a native-like state (Zahn R and Pluckthun A (1992)
Biochemistry 31:
3249-3255; Gray T E and Fersht A R (1993) J Mol Biol 232: 1197-1207); and (2)
it
continuously anneals misfolded proteins by unfolding them to a state from
which
refolding can start again (Zahn R et al (1996) Science 271: 642-645). Some
mutations in
2~ the apical domain led to a decrease in polypeptide binding (Fenton W A et
al (1994)
Nature 371: 614-619), suggesting that this domain is involved in the binding
of
polypeptides. Electron microscopy suggests that denatured protein binds to the
inner side
of the apical end of the GroEL-cylinder (Chen S et al (1994) Nature 371: 261-
264). The
equatorial domain has been shown from the 2.4 t~ crystal structure of ATPyS-
ligated
GroEL _(Boisvert D C et al (1996) Nature Structure Biology 3: 170-177) and
mutagenesis
studies (Fenton W A et al (1994) Nature 371: 614-619) to have the nucleotide
binding
sites. Binding and hydrolysis of ATP is cooperative (Bochkareva E S et al
(1992) J Biol
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
-,
Chem 267: 6796-6800: Gray T E and Fersht A R (1991) FEBS Lett 292: 25=1-258),
and
lowers the affinity for polypeptides -(Jackson G S et al (1993) Biochemistry
32: 2554-
2563). Most of the intermolecular contacts between the subunits of GroEL are
between
the equatorial domain. The intermediate domain connects the other two domains,
-transmitting allosteric effects (Braig K et al (1994) Nature 371: 578-586:
Braig K et al
(1995) Nature Struct Biol 2: 1083-1094).
The crystal structure of GroEL shows unusually high B factors for the apical
domain
compared with the equatorial or intermediate domain, and the B factors vary
considerably
within the domain (Braig K et al (1994) Nature 371: 578-586; Braig K et al
(1995) Nature
Struct Biol 2: 1083-1094; Boisvert D C et al (1996) Nature Structure Biology
3: 170-
177). The high overall B factor seems to result from a static disorder within
the
asymmetric unit and probably throughout the crystals of GroEL, and has been
attributed to
rigid-body movements generated by hinge-like J3-sheets in the intermediate
domain.
Regions of high flexibility have also been observed in the 2.8~ structure of
the co-
chaperonin GroES (Hunt J F et al (1996) Nature 379: 37-45). A mobile loop has
been
shown to be directly involved in ADP-dependent binding to the apical domain
(Landry S J
et al (1993) Nature 364: 255-258). Binding of GroES leads to a conformational
change of
GroEL and a concomitant enlargement of the GroEL-cavity (Chen S et al ( 1994)
Nature
371: 261-264), in which the encapsulated polypeptide substrate can refold to a
native-like
state without the danger of aggregation (Martin J et al (1993) Nature 366: 228-
233;
Weissman J S et al (1995) Cell 83: 577-587).
Monomeric forms of GroEL have been induced by site-directed mutagenesis and
expressed and although these bind to rhodanese they do not affect its
refolding (White Z
W et al (1995) J Biol Chem 270: 20404-20409).
Yoshida et al (1993) FEBS 336: 363-367 report that a 34kD proteolyrtic
fragment of E.
coli GroEL which lacks 149 NHZ-terminal residues and ~93 COOH-terminal
residues
(GroEL 150-456) facilitates refolding of denatured rhodanese in the absence of
GroES
and ATP. Although the proteolytic fragment GroEL 150-456 elutes as a monomer
during
gel filtration, it still comprises the apical domain and significant portions
of the
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
4
intermediate and equatorial domains, the latter of which determine the
intersubunit
contacts of GroEL (Braig K et al (1994) supra), thus allowing transient
formation of the
central cavity thereby accounting for the chaperonin activity which is
observed.
In any event. the mode of rhodanese refolding by GroEL 150-4~6 is very
different from
that brought about by the bolo protein; the yield of productive refolding is
low, folding is
rapidly saturated with time, and it is not affected by GroES and ATP.
Efficient release
and folding requires the hydrolysis of ATP (Landry S J et al (1992) Nature 3»:
4~~-=1~7;
Gray T E and Fersht A R (1992) FEBS Lett 282: 2~4-2~8; Jackson G S et al
(1993)
Biochemistry 32: 2~~4-263; Todd M et al (1993) Biochemistry 32: 860-867.)
EP-A-0 650 97~ (NIPPON OIL CO LTD) discloses chaperonin molecules and a method
of refolding denatured proteins using GroEL chaperonin 60 monomers (cpn60m)
obtained
from Thermus thermophilus. The holo-chaperonin was first extracted and then
purified
from the bacterial source according to the method of Taguchi et al (1991) J
Biol Chem
266: 22411-22418. The cpn60m was then produced by treatment of the holo-
chaperonin
with trifluoroacetic acid (TFA) followed by reverse phase (rp) HPLC of the
resulting
denatured protein. A peak fraction containing the approximately 57kD cpn60m
was
obtained. The refolding activity of the cpn60m was assayed in solution by
monitoring the
regain in activity of inactivated rhodanese, which in specific activity terms
amounted to
about only 2~% of the specific activity of the rhodanese prior to
inactivation. When
background spontaneous rhodanese refolding is subtracted then there is only an
approximately 20% refolding activity.
?5 As well as cpn60m, EP-A-0 650 975 also discloses the use of an
approximately SOkD N-
terminal deletion fragment of cpn60m wherein the N-terminal amino acid
residues up to
(but not including) the Thr residue at position 79 are removed by proteolysis.
This SOkD
fragment showed an approximately 35% (about 30% when background is subtracted)
rhodanese refolding activity when in solution.
Taguchi H et al (1994) J Biol Chem 269: 8529-8534 is a scientific report on
which the
invention of EP-A-0 6~0 97~ is based. A transiently formed GroEL tetradecamer
(the
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
holo-chaperonin) was perceived to exist when the chaperonin monomers are
present m
solution. Consequently, the refolding activity of these preparations can be
seen to be
caused by the presence of holo chaperonin, not monomers. To test this, Taguchi
et al
immobilised cpn60m to a chromatographic resin to exclude the possibility of
holo
chaperonin formation. When immobilised and therefore when in truly monomeric
form,
cpn60m exhibited only about 10% rhodanese refolding activity.
The refolding of rhodanese has been a common and convenient assay to determine
chaperonin activity but it has been observed that there are significant
problems with the
assay which cast serious doubt on existing assertions of refolding activity
based on this
assay. The fact is that rhodanese refolds spontaneously in the absence of
molecular
chaperones with the yield of refolded rhodanese increasing progressively as
the rhodanese
concentration decreases (see Taguchi et al ( 1994) supra). The 10% of
rhodanese
refolding activity reported in EP-A-0 6~0 97~ for immobilised (truly
monomeric) cpn60m
is therefore too close to the spontaneous regain of activity by rhodanese to
demonstrate
that any monomeric chaperonin has a refolding activity towards proteins
generally, let
alone cpn60m and rhodanese.
Alconada A and Cuezva J M (1993) TIBS 18: 81-82 suggested that an "internal
fragment"
of GroEL may possess a chaperone activity on the basis of amino acid sequence
similarity
between the altered mRNA stability (ams) gene product (Ams) of E. coli and the
central
part of GroEL. The ams locus is a temperature-sensitive mutation that maps at
23 min on
the E. coli chromosome and results in mRNA with an increased half life. The
ams gene
has been cloned, expressed and shown to complement the ams mutation. The gene
product is a 149-amino acid protein (Ams) with an apparent molecular weight of
l7kD.
Chanda P K et al (1985) J Bacteriol 161: 446-449 found that a l7kD protein
fragment
corresponding to part of the L gene of the groE operon, when expressed in E.
coli ams
mutants restores the wild-type phenotype. This l7kD fragment was suggested as
being an
isolated, functional chaperonin protein module. The amino acid sequences of
three
chaperonins (E. coli GroEL, ribulose bisphosphate carboxylase (RUBPC) subunit-
binding
protein from Triticum aestivum and Saccharomyces cerevisiae mitochondria)
hsp60) were
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
6
compared with the sequence of Ams. Residues 307-423 were found to correspond
substantially bet~~een Ams and GroEL. These residues comprise nearly
equivalent
portions of both the intermediate and apical domains of GroEL.
~ The sequence alignments of Ams protein with the chaperonins noted above
reveals a
striking similarity (98%) between the amino-terminal four-fifths of Ams and
the central
part (approximately one-fifth) of E. coli GroEL chaperonin. The 50% sequence
similarity
between the Ams amino terminal region and the two other chaperonins is in line
with the
reported identity among the chaperonin family. The carboxy-terminal part of
the Ams
protein showed no similarity with chaperonins (<10% homology).
International Patent Application W098/13496, the entire contents of which is
incorporated herein by reference, describes fragments of chaperone molecules.
termed
minichaperones, which are effective in promoting the folding of unfolded or
misfolded
polypeptides. The fragments are monomeric in solution.
Recombinant DNA technology has allowed industry to produce . many proteins of
commercial importance. Proteins are produced in a wide variety of expression
systems
which are based on, for example, bacterial, yeast, insect, plant and mammalian
cells. one
of the problems associated with the production of proteins by recombinant
means is that
host cells contain enzymes which degrade proteins and the presence of such
enzymes
present particular difficulties in the production of small polypeptides.
Moreover,
polypeptides produced by recombinant DNA technology are frequently at least
partially
incorrectly folded, such that yields of biologically active molecules vary
according to the
ability of the expression system to promote correct folding. This can moreover
be
problematic in the production of polypeptides destined for chemical and
physical analysis,
for which structural homogeneity is highly relevant.
One approach to overcoming such difficulties is to express a recombinant
protein of
interest in the form of a fusion protein. DNA encoding the protein of interest
is fused in-
frame to a fusion partner protein and the resulting fusion is expressed.
Often, a linker
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
7
sequence encoding a protease cleavage site between the two parts of the fusion
is included
to allow cleavage of the fusion after it has been recovered from its host
cell.
The fusion partner protein is often one which may be recovered and purified by
some
form of highly specific affinity purification means. Examples of such proteins
are well
known in the art and include. for example, glutathione-S-transferase, maltose
binding
protein and ~3-lactamase.
However these fusion partner proteins are all relatively large and thus have a
number of
disadvantages. For example, it is essential to remove them before any
meaningful
procedure may be carried out on the protein of interest, since they are too
large to enable it
to function with any degree of independence. Many small polypeptides are still
thus made
by chemical synthesis.
Summary of the Invention
The present invention provides fusion proteins which incorporate chaperone
fragments as
fusion partners to promote high yield expression of correctly folded
polypeptides in
biological expression systems. It has been observed that consistently higher
yields of
recombinantly expressed polypeptides are obtained if the proteins are
expressed as fusions
with a chaperone fragment.
According to a first aspect of the invention, therefore, there is provided a
fusion protein
comprising:
a) a first region comprising a fragment of a chaperone polypeptide; and
b) a second region not naturally associated with the first region comprising a
polypeptide sequence of interest.
The term "fusion protein" is used in accordance with its ordinary meaning in
the art and
refers to a single protein which is comprised of two or more regions which are
derived
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
8
from different sources. Typically, a fusion protein is two proteins fused
together by way
of in-frame fusion of their respective nucleic acid coding sequences.
A "chaperone fragment", as referred to herein. is any fragment of a molecular
chaperone
which possesses the ability to promote the folding of a polypeptide in vivo or
in vitro.
Preferred fragments are described in International patent application
W098/13496,
incorporated herein by reference. Especially preferred are fragments 191-37~,
191-34~
and 193-335 of GroEL. Advantageously, the GroEL is E. coli GroEL, as further
described below.
The fusion protein according to the invention, in addition to the chaperone
fragment,
includes a desired polypeptide. The desired polypeptide is typically a
polypeptide which
it is desired to express by recombinant DNA techniques; it is expressed as a
fusion with
the chaperone fragment in order to increase the yield of correctly folded
product, in
accordance with the present invention. Many polypeptides may be expressed as
fusion
proteins according to the present invention. However, the expression of
smaller
polypeptides, up to about 250 amino acids in length, is preferred. Preferably,
the
polypeptides are between about 5 and about 100 amino acids in length.
Advantageously, the polypeptide is a eukaryotic polypeptide, such as a
mammalian
polypeptide.
Preferably, the fusion protein according to the invention comprises a
cleavable linker
between the first and second regions thereof. The linker, which is typically a
polypeptide
chain cleavable by a protease, or by other means suitable for effecting
polypeptide
cleavage, may be cleaved after production of the fusion protein in order to
facilitate
recovery of the desired polypeptide.
Moreover, in the event that the fusion protein comprises the chaperone
fragment and the
desired polypeptide as separate chains, held together otherwise than by a
peptide bond, the
cleavable linker may comprise an alternative cleavable site, such as a
disulphide bond.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
9
Preferably. the chaperone fragment is located N-terminal to the desired
polypeptide in the
fusion protein. Advantageously, the chaperone fragment itself forms the N-
terminus of
the fusion protein; however, it is envisaged that alternative N-termini may be
included,
such as to protect the chaperone fragment from degradation.
J
In the context of the present invention, although reference is made to both
proteins and
polypeptides, the terms are intended to be substantially interchangeable, with
the
exception that the term ''protein" specifically includes mufti-chain molecules
comprising
more than one polypeptide chain. The polypeptide chains may be held together
by non-
covalent or covalent means, wherein such covalent means do not include peptide
linkages.
For example, the chains may be held together by disulphide linkages.
The invention further comprises a nucleic acid encoding the fusion protein of
the
invention, and preferably the nucleic acid forms part of an expression vector
comprising
I ~ the nucleic acid operably linked to a promoter.
Nucleic acids, vectors and promoters are further described below.
The invention further comprises a host cell carrying the expression vector of
the
invention, and a method of preparing the fusion protein of the invention
comprising (i)
culturing the host cell under conditions which provide for the expression of
the fusion
protein from the expression vector within the host cell; and (ii) recovering
the fusion
protein from the cell.
2~ In cases where the fusion protein further comprises a protease cleavable
linker region
between the first and second regions the method optionally further comprises
cleaving the
protein at the protease cleavable linker and recovering the second region.
Brief Description of the Figures
Figure 1 is a diagram showing plasmid pHGro, comprising an N-terminal
histidine tag,
the 191-345 fragment of GroEL, a thrombin cleavage site and a multiple cloning
site.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
Figure 2 shows an SDS-PAGE analysis of pHGro expression and purification
systems.
Molecular weight standards in the range 14,000 - 70,000 Daltons are loaded in
lanes ~. 10
and 15 (Sigma #SDS-7 Dalton Mark VII-LTM). Analysis of the sonication extracts
shows
that the Tenascin (lane 1 ), RNase HI (lane 6) and FKBP 12 (lane 11 ) fusion
proteins are
all over-expressed to a high level. Following a three hour incubation with
Nickel affiniy
resin, all visible traces of the fusion protein are removed from the Tenascin
(lane 2),
RNase Hl (lane 7) and FKBP 12 (lane 12) sonication extracts. Tenascin, RNase
Hl and
FKBP 12 fusion proteins are released into the elution buffers (lanes 3,8 and
13
10 respectively). Thrombin successfully removes the GroEL fragment from
Tenascin (lane
4), RNase H1 (lane 9) and FKBP 12 (lane 14).
Detailed Description of the Invention.
A: First region.
The first region of the fusion protein of the invention may comprise any
natural or
synthetic chaperone fragment.
Chaperone fragments suitable for use in the present invention are described,
for example,
in International patent application W098/13496, the disclosure of which is
incorporated
herein by reference.
chaperone polypeptide having an amino acid sequence selected from at least
amino acid
residues 230-271 but no more than residues 150-4~5 or 151-456 of a GroEL
sequence
substantially as shown in SEQ. ID. No. 1, or a corresponding sequence of a
substantially
homologous chaperone polypeptide, or a modified, mutated or variant thereof
having
chaperone activity.
The sequence of GroEL is available in the art, as set forth above, and from
academic
databases; however, GroEL fragments which conform to the database sequence are
inoperative. Specifically, the database contains a sequence in which positions
262 and
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
267 are occupied by Alanine and Isoleucine respectively. Fragments
incorporating one or
both of these residues at these positions are inoperative and unable to
promote the folding
of polypeptides. The invention, instead. relates to a GroEL polypeptide in
which at least
one of positions 262 and 267 is occupied by Leucine and Methionine
respectively.
The amino acid sequence is preferably selected from at least amino acid
residues 193-335,
preferably 193-337, more preferably 191-345, even more preferably 191-376 but
no more
than residues 151-455. The invention therefore includes polypeptides being
GroEL amino
acid residues 230-271, 230-272 ...et seq... 230-455 and in like manner
residues 230-271,
229-271 ...et seq... 151-271. Also, residues 230-271, 229-272 ...et seq... 151-
351, 151-
352 ...et seq... 151-455. All amino acid sequences of 42 or more residues
comprising at
least contiguous residues 230-271 and not exceeding 151-455 are within the
scope of this
aspect of the invention e.g. 171-423 or 166-406.
In a highly preferred aspect, the invention provides fragments selected from
the group
consisting of residues 191-375, 191-345 and 193-335.
There are four key properties that may characterise a protein as a molecular
chaperone ( 1 )
suppression of aggregation during protein folding; (2) suppression of
aggregation during
protein unfolding; (3) influence on the yield and kinetics of folding; and (4)
effects
exerted at near stoichiometric levels. Fragments which possess these
activities are
suitable for use in the present invention.
Chaperone activity may be determined in practice by an ability to refold
cyclophilin .A but
other suitable proteins such as glucosamine-6-phosphate deaminase or a mutant
form of
indoleglycerol phosphate synthase (IGPS) (amino acid residues 49-252) may be
used. A
rhodanese refolding assay may also be used. Details of suitable refolding
assays are
described in more detail in the specific examples provided hereinafter.
Preferably, the chaperone activity is determined by the refolding of
cyclophilin A. More
preferably, 8M urea denatured cyclophilin A (100~M) is diluted into 100mM
potassium
phosphate buffer pH7.0, 1 OmM DTT to a final concentration of 1 ~M and then
contacted
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
12
with at least 1~M of said polypeptide at 25°C for at least 5 min, the
resultant cyclophilin
A activity being assayed by the method of Fischer G et al (1984) Biomed
Biochim Acta
43: 1101-1111.
The polypeptide is preferably an hsp60 polypeptide, preferably a GroEL
polypeptide.
A preferred polypeptide has the amino acid sequence 191-345 or 191-376. more
preferably 193-335 or 191-337 of GroEL, or the equivalent residues of
substantially
homologous chaperonins, or a modified, mutated or variant sequence thereof.
The polypeptide preferably has a molecular weight of less than 34kDa.
"Modifications" include chemically modified polypeptides for example.
"Variants"
include, for example, naturally occurring variants of the kind to be found
amongst a
population of hsp60 chaperonin harbouring organisms/cells as well as naturally
occurring
polymorphisms or mutations. "Mutations" may also be introduced artificially by
processes of mutagenesis well known to a person skilled in the art.
In being "substantially homologous" peptides may have at least 50% amino acid
sequence
homology with the specified GroEL amino acid sequences, preferably at least
60%
homology and more preferably 75% homology. Homology may of course also reside
in
the nucleotide sequences for the polypeptide which may be at least 50%,
preferably at
least 60% homologous and more preferably 75% homologous with the nucleotide
sequence encoding the specified GroEL amino acid residues.
Where conservative substitutions are made they may be made by reference to the
following table, where amino acids on the same block in the second column and
preferably in the same line in the third column may be substituted for each
other:
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
13
ALIPHATIC Non-polar G A P
ILV
Polar - unchargedC S T M
NQ
Polar - charged D E
RK
AROMATIC H F W Y
OTHER N Q D E
Synthetic variants of naturally-occurring chaperone proteins may be made by
standard
recombinant DNA techniques. For example, site-directed mutagenesis may be used
to
introduce changes to the coding region of a DNA encoding a naturally-occurring
coiled-
coil protein. Where insertions are to be made, synthetic DNA encoding the
insertion
together with 5' and 3' flanking regions corresponding to the naturally-
occurring sequence
either side of the insertion site. The flanking regions will contain
convenient restriction
sites corresponding to sites in the naturally-occurring sequence so that the
sequence may
be cut with the appropriate enzymes) and the synthetic DNA ligated into the
cut. The
DNA is then expressed in accordance with the invention to make the encoded
protein.
These methods are only illustrative of the numerous standard techniques known
in the art
for manipulation of DNA sequences and other known techniques may also be used.
The hsp60 class of chaperonin proteins are generally homologous in structure
and so there
are therefore conserved or substantially homologous amino acid sequences
between the
members of the class. GroEL is just an example of an hsp60 chaperonin protein;
other
suitable proteins having an homologous apical domain may be followed.
A fusion protein according to the invention will comprise as small a chaperone
fragment
as is feasible. This can be especially important where in structural
determination of
proteins by NMR it is often necessary to carry out isotopic labelling with 15N
or 13C. This
is expensive and with a long fusion partner much of the incorporated
radioactivity is
removed if the carrier protein (e.g. GST in many cases) is cleaved off.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
14
B: Second Region.
The second region of the fusion protein according to the invention may
comprise any
polypeptide sequence of interest which is not naturally associated with the
first region.
Usually this will mean that the sequence of interest will be found in nature
encoded by a
gene different from the gene encoding the first region. This may be determined
easily by
examining the sequences of the first and second regions against publicly
available
sequence databanla: The second region may be from the same species as the
first region,
or from a different species. It is also possible that the first and second
regions are derived
from portions of the same protein but are present in the fusion protein of the
invention in
a manner different from the natural protein sequence.
The fusion protein according to the invention may be of any size although in
general the
invention is particularly useful when the polypeptide sequence of interest is
short, e.g.
from 2 to 100 amino acids in length, preferably 2 to 50 or even 2 to 30 or 5
to 10 amino
acids in size. However larger polypeptide sequences of interest, e.g. up 150,
200, 400 or
1000 amino acids are also contemplated. The invention is particularly
advantageous for
the preparation of small polypeptides which are currently difficult to
manufacture by
recombinant means. Examples of such polypeptides include fragments of
chaperone
proteins, metabolic enzymes, DNA and RNA binding proteins, antibodies, viral
proteins,
intrinsic membrane proteins (including transport proteins from mitochondria,
seven-helix
receptor molecules, T-cell receptors), and cytoskeletal complexes, antibody
binding
peptides, peptide hormones (and other biologically active peptides made by
ribosomal
synthesis), and small subunits from mufti-subunit biological structures such
as respiratory
enzymes, the ATP synthase. In general, the invention is suitable for use with
peptides of
any dimension, but the advantageous properties thereof are best exploited with
small
polypeptides, for example from 2 to 50 amino acids in length, particularly
from 2 to 20
amino acids in length, and preferably from 5 to 10 amino acids in length.
A particular advantage of the present invention is that peptides may be
produced by
recombinant DNA technology which are so short that they would previously have
been
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
made by oligopeptide synthesis techniques. Thus it is possible to produce
libraries of
peptides, for example of mutants of biologically active peptides, which may be
screened
or otherwise analysed, cheaply and efficiently in recombinant expression
systems.
particularly bacterial expression systems.
5
C: Cleavable linker region.
Where the first and second regions are linked by a cleavable linker region
this may be any
region suitable for this purpose. Preferably, the cleavable linker region is a
protease
10 cleavable linker, although other linkers, cleavable for example by small
molecules, may
be used. These include Met-X sites, cleavable by cyanogen bromide, Asn-Gly,
cleavable
by hydroxylamine; Asp-Pro, cleavable by weak acid and Trp-X cleavable by.
inter alia,
NBS-skatole. Protease cleavage sites are preferred due to the milder cleavage
conditions
necessary and are found in, for example, factor Xa, thrombin and collagenase.
Any of
15 these may be used. The precise sequences are available in the art and the
skilled person
will have no difficulty in selecting a suitable cleavage site. By way of
example, the
protease cleavage region targeted by Factor Xa is I E G R. The protease
cleavage region
targeted by Enterokinase is D D D D K. The protease cleavage region targeted
by
Thrombin is L V P R G.
D. Nucleic acids.
The invention also provides nucleic acid encoding the fusion proteins of the
invention.
These may be constructed using standard recombinant DNA methodologies. The
nucleic
acid may be RNA or DNA and is preferably DNA. Where it is RNA, manipulations
may
be performed via cDNA intermediates. Generally, a nucleic acid sequence
encoding the
first region will be prepared and suitable restriction sites provided at the
5' and/or 3' ends.
Conveniently the sequence is manipulated in a standard laboratory vector, such
as a
plasmid vector based on pBR322 or pUCl9 (see below). Reference may be made to
Molecular Cloning by Sambrook et al. (Cold Spring Harbor, 1989) or similar
standard
reference books for exact details of the appropriate techniques.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
16
Nucleic acid encoding the second region may likewise be provided in a similar
vector
system. Sources of nucleic acid may be ascertained by reference to published
literature or
databanla such as Genbanl:.
Nucleic acid encoding the desired first or second region may be obtained from
academic
or commercial sources where such sources are willing to provide the material
or by
synthesising or cloning the appropriate sequence where only the sequence data
are
available. Generally this may be done by reference to literature sources which
describe
the cloning of the gene in question.
Alternatively, where limited sequence data are available or where it is
desired to express a
nucleic acid homologous or otherwise related to a known nucleic acid,
exemplary nucleic
acids can be characterised as those nucleotide sequences which hybridise to
the nucleic
acid sequences known in the art.
Stringency of hybridisation refers to conditions under which polynucleic acids
hybrids are
stable. Such conditions are evident to those of ordinary skill in the field.
As known to
those of skill in the art, the stability of hybrids is reflected in the
melting temperature
(Tm) of the hybrid which decreases approximately 1 to 1.5°C with every
1% decrease in
sequence homology. In general, the stability of a hybrid is a function of
sodium ion
concentration and temperature. Typically, the hybridisation reaction is
performed under
conditions of higher stringency, followed by washes of varying stringency.
As used herein, high stringency refers to conditions that permit hybridisation
of only those
2~ nucleic acid sequences that form stable hybrids in 1 M Na+ at 6~-68
°C. High stringency
conditions can be provided, for example, by hybridisation in an aqueous
solution
containing 6x SSC, Sx Denhardt's, 1 % SDS (sodium dodecyl sulphate), 0.1 Na+
pyrophosphate and 0.1 mg/ml denatured salmon sperm DNA as non specific
competitor.
Following hybridisation, high stringency washing may be done in several steps,
with a
final wash (about 30 min) at the hybridisation temperature in 0.2 - O.lx SSC,
0.1 % SDS.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
17
Moderate stringency refers to conditions equivalent to hybridisation in the
above
described solution but at about 60-62°C. In that case the final wash is
performed at the
hybridisation temperature in lx SSC, 0.1 % SDS.
Low stringency refers to conditions equivalent to hybridisation in the above
described
solution at about 50-52°C. In that case, the final wash is performed at
the hybridisation
temperature in 2x SSC, 0.1 % SDS.
It is understood that these conditions may be adapted and duplicated using a
variety of
buffers, e.g. formamide-based buffers, and temperatures. Denhardt's solution
and SSC
are well known to those of skill in the art as are other suitable
hybridisation buffers (see,
e.g. Sambrook, et al., eds. (1989) Molecular Cloning: A Laboratory Manual,
Cold
Spring Harbor Laboratory Press, New York or Ausubel, et al., eds. (1990)
Current
Protocols in Molecular Biology, John Wiley & Sons, Inc.). Optimal
hybridisation
1 ~ conditions have to be determined empirically, as the length and the GC
content of the
probe also play a role.
Given the guidance provided herein, nucleic acids suitable for forming the
first or second
region of a fusion protein according to the invention are obtainable according
to methods
well known in the art. For example, a DNA of the invention is obtainable by
chemical
synthesis, using polymerase chain reaction (PCR) or by screening a genomic
library or a
suitable cDNA library prepared from a source believed to possess the desired
nucleic acid
and to express it at a detectable level.
Chemical methods for synthesis of a nucleic acid of interest are known in the
art and
include triester, phosphite, phosphoramidite and H-phosphonate methods, PCR
and other
autoprimer methods as well as oligonucleotide synthesis on solid supports.
These
methods may be used if the entire nucleic acid sequence of the nucleic acid is
known, or
the sequence of the nucleic acid complementary to the coding strand is
available.
Alternatively, if the target amino acid sequence is known, one may infer
potential nucleic
acid sequences using known and preferred coding residues for each amino acid
residue.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
18
An alternative means to isolate the gene encoding the desired region of the
fusion protein
is to use PCR technology as described e.g. in section 14 of Sambrook et al.,
1989. This
method requires the use of oligonucleotide probes that will hybridise to the
desired
nucleic acid. Strategies for selection of oligonucleotides are described
below.
Libraries are screened with probes or analytical tools designed to identify
the gene of
interest or the protein encoded by it. For cDNA expression libraries suitable
means
include monoclonal or polyclonal antibodies that recognise and specifically
bind to the
desired protein; oligonucleotides of about 20 to 80 bases in length that
encode known or
suspected eDNA encoding the desired protein from the same or different
species: and/or
complementary or homologous cDNAs or fragments thereof that encode the same or
a
hybridising gene. Appropriate probes for screening genomic DNA libraries
include, but
are not limited to oligonucleotides, cDNAs or fragments thereof that encode
the same or
hybridising DNA; and/or homologous genomic DNAs or fragments thereof.
A nucleic acid encoding the desired protein may be isolated by screening
suitable cDNA
or genomic libraries under suitable hybridisation conditions with a probe.
As used herein, a probe is e.g. a single-stranded DNA or RNA that has a
sequence of
nucleotides that includes between 10 and 50, preferably between 15 and 30 and
most
preferably at least about 20 contiguous bases that are the same as (or the
complement o~
an equivalent or greater number of contiguous bases from a known or desired
sequence.
The nucleic acid sequences selected as probes should be of sufficient length
and
sufficiently unambiguous so that false positive results are minimised. The
nucleotide
sequences are usually based on conserved or highly homologous nucleotide
sequences or
regions of the desired protein. The nucleic acids used as probes may be
degenerate at one
or more positions. The use of degenerate oligonucleotides may be of particular
importance where a library is screened from a species in which preferential
codon usage
in that species is not known.
Preferred regions from which to construct probes include S' and/or 3' coding
sequences,
sequences predicted to encode ligand binding sites, and the like. For example,
either the
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
19
full-length cDNA clone disclosed herein as SEQ. ID. No. 1 or fragments thereof
can be
used as probes, especially for isolating first region-encoding genes.
Preferably, nucleic
acid probes of the invention are labelled with suitable label means for ready
detection
upon hybridisation. For example, a suitable label means is a radiolabel. The
preferred
~ method of labelling a DNA fragment is by incorporating a''P dATP with the
Klenow
fragment of DNA polymerase in a random priming reaction, as is well known in
the art.
Oligonucleotides are usually end-labelled with y'''P-labelled ATP and
polynucleotide
kinase. However, other methods (e.g. non-radioactive) may also be used to
label the
fragment or oligonucleotide, including e.g. enzyme labelling, fluorescent
labelling with
suitable fluorophores and biotinylation.
After screening the library, e.g. with a portion of DNA including
substantially the entire
desired sequence or a suitable oligonucleotide based on a portion of said DNA,
positive
clones are identified by detecting a hybridisation signal; the identified
clones are
1 ~ characterised by restriction enzyme mapping and/or DNA sequence analysis,
and then
examined to ascertain whether they include DNA encoding a complete polypeptide
(i.e., if
they include translation initiation and termination codons). If the selected
clones are
incomplete, they may be used to rescreen the same or a different library to
obtain
overlapping clones. If the library is genomic, then the overlapping clones may
include
exons and introns. If the library is a cDNA library, then the overlapping
clones will
include an open reading frame. In both instances, complete clones may be
identified by
comparison with the DNAs and deduced amino acid sequences provided herein.
It is envisaged that the nucleic acid of the invention can be readily modified
by nucleotide
substitution, nucleotide deletion, nucleotide insertion or inversion of a
nucleotide stretch,
and any combination thereof. Such mutants can be used e.g. to produce a mutant
that has
an amino acid sequence differing from the sequences as found in nature.
Mutagenesis
may be predetermined (site-specific) or random. A mutation which is not a
silent
mutation must not place sequences out of reading frames and preferably will
not create
complementary regions that could hybridise to produce secondary mRNA structure
such
as loops or hairpins.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
The foregoing methods may, of course. be applied to the identification and
modification
or generation of sequences useful in any part of the fusion protein of the
invention. In
particular, the sequence of the IF, polypeptide coiled coil provided herein as
SEQ. ID.
No. l, or suitable fragments thereof as discussed above, may be used as a
probe for the
identification of further suitable sequences.
The first or second region may also be manipulated to introduce an appropriate
restriction
enzyme site at the terminus which is to be linked to the nucleic acid encoding
the first
region via a corresponding restriction enzyme site. Desirably the sites will
be either the
10 same or at least have matching cohesive ends. Of course, the first and
second regions
may be joined by alternative means; for example, first region may be
incorporated into
primers used to isolate or replicate the second region.
Where a protease cleavable linker region is required, this maybe introduced
into the
1 ~ linked first and second regions (e.g. into the restriction site linking
the two) or introduced
into one or the other prior to their combination.
E. Expression vectors and host cells.
The nucleic acid encoding a fusion protein according to the invention, or
constituent
parts) thereof, can be incorporated into vectors for further manipulation. As
used herein,
vector (or plasmid) refers to discrete elements that are used to introduce
heterologous
DNA into cells for either expression or replication thereof. Selection and use
of such
vehicles are well within the skill of the artisan. Many vectors are available,
and selection
of appropriate vector will depend on the intended use of the vector, i.e.
whether it is to be
used for DNA amplification or for DNA expression, the size of the DNA to be
inserted
into the vector, and the host cell to be transformed with the vector. Each
vector contains
various components depending on its function (amplification of DNA or
expression of
DNA) and the host cell for which it is compatible. The vector components
generally
include, but are not limited to, one or more of the following: an origin of
replication, one
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
21
or more marker genes, an enhancer element. a promoter, a transcription
termmanon
sequence and a signal sequence.
Both expression and cloning vectors generally contain nucleic acid sequences
that enable
the vector to replicate in one or more selected host cells. Typically in
cloning vectors,
these sequences enable the vector to replicate independently of the host
chromosomal
DNA, and includes origins of replication or autonomously replicating
sequences. Such
sequences are well known for a variety of bacteria, yeast and viruses. The
origin of
replication from the plasmid pBR322 is suitable for most Gram-negative
bacteria. the 2u
plasmid origin is suitable for yeast, and various viral origins (e.g. SV 40,
polyoma,
adenovirus) are useful for cloning vectors in mammalian cells. Generally, the
origin of
replication component is not needed for mammalian expression vectors unless
these are
used in mammalian cells competent for high level DNA replication, such as COS
cells.
Most expression vectors are shuttle vectors, i.e. they are capable of
replication in at least
one class of organisms but can be transfected into another organism for
expression. For
example, a vector is cloned in E. coli and then the same vector is transfected
into yeast or
mammalian cells even though it is not capable of replicating independently of
the host cell
chromosome. DNA may also be replicated by insertion into the host genome.
However,
the recovery of genomic DNA encoding the fusion protein of the invention is
more
complex than that of exogenously replicated vector because restriction enzyme
digestion
is required to excise the DNA. DNA can be amplified by PCR and be directly
transfected
into the host cells without any replication component.
Advantageously, an expression and cloning vector may contain a selection gene
also
referred to as selectable marker. This gene encodes a protein necessary for
the survival or
growth of transformed host cells grown in a selective culture medium. Host
cells not
transformed with the vector containing the selection gene will not survive in
the culture
medium. Typical selection genes encode proteins that confer resistance to
antibiotics and
other toxins, e.g. ampicillin, neomycin, methotrexate or tetracycline,
complement
auxotrophic deficiencies, or supply critical nutrients not available from
complex media.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
22
As to a selective gene marker appropriate for yeast, any marker gene can be
used which
facilitates the selection for transformants due to the phenotypic expression
of the marker
gene. Suitable markers for yeast are, for example. those conferring resistance
to
antibiotics 6418, hygromycin or bleomycin, or provide for prototrophy in an
auxotrophic
~ yeast mutant, for example the URA3, LEU2, LYS2, TRP1, or HIS3 gene.
Since the replication of vectors is conveniently done in E. coli, an E. coli
genetic marker
and an E. coli origin of replication are advantageously included. These can be
obtained
from E. coli plasmids, such as pBR322, Bluescript~ vector or a pUC plasmid,
e.g.
pUC 18 or pUC 19, which contain both E. coli replication origin and E. coli
genetic
marker conferring resistance to antibiotics, such as ampicillin.
Suitable selectable markers for mammalian cells are those that enable the
identification of
cells competent to take up vector nucleic acid, such as dihydrofolate
reductase (DHFR,
1 ~ methotrexate resistance), thymidine kinase, or genes conferring resistance
to 6418 or
hygromycin. The mammalian cell transformants are placed under selection
pressure
which only those transformants which have taken up and are expressing the
marker are
uniquely adapted to survive. In the case of a DHFR or glutamine synthase (GS)
marker,
selection pressure can be imposed by culturing the transformants under
conditions in
which the pressure is progressively increased, thereby leading to
amplification (at its
chromosomal integration site) of both the selection gene and the linked DNA
that encodes
the fusion protein. Amplification is the process by which genes in greater
demand for the
production of a protein critical for growth, together with closely associated
genes which
may encode a desired protein, are reiterated in tandem within the chromosomes
of
2~ recombinant cells. Increased quantities of desired protein are usually
synthesised from
thus amplified DNA.
Expression and cloning vectors usually contain a promoter that is recognised
by the host
organism and is operably linked to the fusion-protein encoding nucleic acid.
Such a
promoter may be inducible or constitutive. The promoters are operably linked
to DNA
encoding the fusion protein by removing the promoter from the source DNA by
restriction
enzyme digestion and inserting the isolated promoter sequence into the vector.
Both the
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
23
native promoter sequence of one of the constituents of the fusion protein and
many
heterologous promoters may be used to direct amplification and/or expression
of the
DNA. The term "operably linked" refers to a juxtaposition wherein the
components
described are in a relationship permitting them to function in their intended
manner. A
control sequence "operably linked" to a coding sequence is ligated in such a
way that
expression of the coding sequence is achieved under conditions compatible with
the
control sequences.
Promoters suitable for use with prokaryotic hosts include, for example. the (3-
lactamase
and lactose promoter systems, alkaline phosphatase, the tryptophan (trp)
promoter system
and hybrid promoters such as the tic promoter. Their nucleotide sequences nave
peen
published, thereby enabling the skilled worker operably to ligate them to DNA
encoding
the fusion protein using linkers or adaptors to supply any required
restriction sites.
Promoters for use in bacterial systems will also generally contain a Shine-
Delgarno
sequence operably linked to the DNA encoding the fusion protein.
Preferred expression vectors are bacterial expression vectors which comprise a
promoter
of a bacteriophage such as phagex or T7 which is capable of functioning in the
bacteria.
In one of the most widely used expression systems, the nucleic acid encoding
the fusion
protein may be transcribed from the vector by T7 RNA polymerise (Studier et
al,
Methods in Enzymol. 185; 60-89, 1990). In the E. coli BL21(DE3) host strain,
used in
conjunction with pET vectors, the T7 RNA polymerise is produced from the ~,-
lysogen
DE3 in the host bacterium, and its expression is under the control of the IPTG
inducible
lac UV5 promoter. This system has been employed successfully for over-
production of
many globular proteins, but in many other cases significant over-production
cannot be
achieved because of the toxicity of over-expression (Studier et a1.,1990;
George et al, J.
Mol. Biol. 235; 424-435, 1994) . Alternatively the polymerise gene may be
introduced
on a lambda phage by infection with an int- phage such as the CE6 phage which
is
commercially available (Novagen, Madison, USA). other vectors include vectors
containing the lambda PL promoter such as PLEX (Invitrogen, NL) , vectors
containing
the trc promoters such as pTrcHisXpressTm (Invitrogen) or pTrc99 (Pharmacia
Biotech,
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
24
SE) , or vectors containing the tac promoter such as pKK223-3 (Pharmacia
Biotech] or
PMAL (New England Biolabs, MA, USA).
Moreover, the fusion protein gene according to the invention may include a
secretion
sequence in order to facilitate secretion of the polypeptide from bacterial
hosts, such that
it will be produced as a soluble native peptide rather than in an inclusion
body. The
peptide may be recovered from the bacterial periplasmic space, or the culture
medium, as
appropriate.
Suitable promoting sequences for use with yeast hosts may be regulated or
constitutme
and are preferably derived from a highly expressed yeast gene, especially a
Saccharomyces cerevisiae gene. Thus, the promoter of the TRP 1 gene, the ADHI
or
ADHII gene, the acid phosphatase (PHO~) gene, a promoter of the yeast mating
pheromone genes coding for the a- or a-factor or a promoter derived from a
gene
1 ~ encoding a glycolytic enzyme such as the promoter of the enolase,
glyceraldehyde-3-
phosphate dehydrogenase (GAP), 3-phospho glycerate kinase (PGK), hexokinase,
pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-
phosphoglycerate mutase, pyruvate kinase, triose phosphate isomerase,
phosphoglucose
isomerase or glucokinase genes, the S. cerevisiae GAL 4 gene, the S. pombe nmt
1 gene
or a promoter from the TATA binding protein (TBP) gene can be used.
Furthermore, it is
possible to use hybrid promoters comprising upstream activation sequences
(UAS) of one
yeast gene and downstream promoter elements including a functional TATA box of
another yeast gene, for example a hybrid promoter including the UAS(s) of the
yeast
PHOS gene and downstream promoter elements including a functional TATA box of
the
yeast GAP gene (PHOS-GAP hybrid promoter). A suitable constitutive PHOS
promoter is
e.g. a shortened acid phosphatase PHOS promoter devoid of the upstream
regulatory
elements (UAS) such as the PHO~ (-173) promoter element starting at nucleotide
-173 and
ending at nucleotide -9 of the PHOS gene.
Fusion protein gene transcription from vectors in mammalian hosts may be
controlled by
promoters derived from the genomes of viruses such as polyoma virus,
adenovirus,
fowlpox virus, bovine papilloma virus, avian sarcoma virus, cytomegalovirus
(CMV), a
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
retrovirus and Simian Virus 40 (SV40), from heterologous mammalian promoters
such as
the actin promoter or a very strong promoter, e.g. a ribosomal protein
promoter, and from
the promoter normally associated with the gene encoding a component of the
fusion
protein, provided such promoters are compatible with the host cell systems.
Transcription of a DNA encoding the fusion protein by higher eukaryotes may be
increased by inserting an enhancer sequence into the vector. Enhancers are
relatively
orientation and position independent. Many enhancer sequences are known from
mammalian genes (e.g. elastase and globin). However, typically one will employ
an
enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on
the late
side of the replication origin (bp 100-270) and the CMV early promoter
enhancer. The
enhancer may be spliced into the vector at a position ~' or 3' to the coding
sequence, but is
preferably located at a site 5' from the promoter.
Advantageously, a eukaryotic expression vector encoding the fusion protein may
comprise a locus control region (LCR). LCRs are capable of directing high-
level
integration site independent expression of transgenes integrated into host
cell chromatin,
which is of importance especially where the fusion protein gene is to be
expressed in the
context of a permanently-transfected eukaryotic cell line in which chromosomal
integration of the vector has occurred, in vectors designed for gene therapy
applications
or in transgenic animals.
An expression vector includes any vector capable of expressing nucleic acids
that are
operatively linked with regulatory sequences, such as promoter regions, that
are capable
2~ of expression of such DNAs. Thus, an expression vector refers to a
recombinant DNA or
RNA construct, such as a plasmid, a phage, recombinant virus or other vector,
that upon
introduction into an appropriate host cell, results in expression of the
cloned DNA.
Appropriate expression vectors are well known to those with ordinary skill in
the art and
include those that are replicable in eukaryotic and/or prokaryotic cells and
those that
remain episomal or those which integrate into the host cell genome. For
example, DNAs
encoding the fusion protein according to the invention may be inserted into a
vector
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
26
suitable for expression of cDNAs in mammalian cells, e.g. a CMV enhancer-based
vector
such as pEVRF (Matthias, et al., (1989) NAR 17, 6418).
Particularly useful for practising the present invention are expression
vectors that provide
for the transient expression of DNA encoding the fusion protein in mammalian
cells.
Transient expression usually involves the use of an expression vector that is
able to
replicate efficiently in a host cell, such that the host cell accumulates many
copies of the
expression vector, and. in turn, synthesises high levels of fusion protein.
For the purposes
of the present invention, transient expression systems are useful e.g. for
identiying
fusion protein mutants, to identify potential phosphorylation sites, or to
characterise
functional domains of the protein.
Construction of vectors according to the invention employs conventional
liQation
techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and
religated in
the form desired to generate the plasmids required. If desired, analysis to
confirm correct
sequences in the constructed plasmids is performed in a known fashion.
Suitable methods
for constructing expression vectors, preparing in vitro transcripts,
introducing DNA into
host cells, and performing analyses for assessing expression and function are
known to
those skilled in the art. Gene presence, amplification and/or expression may
be measured
in a sample directly, for example, by conventional Southern blotting, Northern
blotting to
quantitate the transcription of mRNA, dot blotting (DNA or RNA analysis), or
in situ
hybridisation, using an appropriately labelled probe based on a sequence
provided herein.
Those skilled in the art will readily envisage how these methods may be
modified, if
desired.
2j
The invention moreover provides an expression vector comprising a first
nucleic acid
sequence encoding a polypeptide capable of forming a coiled coil structure
operably
linked to a promoter capable of expressing the first nucleic acid sequence in
a host cell,
and, linked to the nucleic acid sequence, a cloning site permitting the
insertion of a second
nucleic acid sequence such that it is capable of being expressed in fusion
with the first
nucleic acid sequence. Such a vector is a useful vehicle for expressing
nucleic acids
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
27
encoding any desired polypeptide in the form of a fusion protein accordin~~ to
the
invenrion.
A further embodiment of the invention provides host cells transformed or
transfected with
~ the vectors for the replication and expression of polynucleotides of the
invention. The
cells will be chosen to be compatible with the vector and may for example be
bacterial,
yeast, insect or mammalian.
Such host cells such as prokaryote, yeast and higher eukaryote cells may be
used for
replicating DNA and producing the fusion protein. Suitable prokaryotes include
eubacteria, such as Gram-negative or Gram-positive organisms, such as E. coli,
e.g. E.
coli K-12 strains, DH~a and HB101, or Bacilli. Further hosts suitable for
fusion protein
encoding vectors include eukaryotic microbes such as filamentous fungi or
yeast, e.g.
Saccharomyces cerevisiae. Higher eukaryotic cells include insect and
vertebrate cells,
1 ~ particularly mammalian cells. In recent years propagation of vertebrate
cells in culture
(tissue culture) has become a routine procedure. Examples of useful mammalian
host cell
lines are epithelial or fibroblastic cell lines such as Chinese hamster ovary
(CHO) cells,
NIH 3T3 cells, HeLa cells or 293T cells. The host cells referred to in this
disclosure
comprise cells in in vitro culture as well as cells that are within a host
animal.
DNA may be stably incorporated into cells or may be transiently expressed
using methods
known in the art. Stably transfected mammalian cells may be prepared by
transfecting
cells with an expression vector having a selectable marker gene, and growing
the
transfected cells under conditions selective for cells expressing the marker
gene. To
prepare transient transfectants, mammalian cells are transfected with a
reporter gene to
monitor transfection efficiency.
To produce such stably or transiently transfected cells, the cells should be
transfected with
a sufficient amount of fusion protein-encoding nucleic acid to form the fusion
protein.
The precise amounts of DNA encoding the fusion protein may be empirically
determined
and optimised for a particular cell and assay.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
28
Host cells are transfected or, preferably, transformed with the above-
captioned expression
or cloning vectors of this invention and cultured in conventional nutrient
media modified
as appropriate for inducing promoters, selecting transformants, or amplifying
the Genes
encoding the desired sequences. Heterologous DNA may be introduced into host
cells by
any method known in the art, such as transfection with a vector encoding a
heterologous
DNA by the calcium phosphate coprecipitation technique or by electroporation.
Numerous methods of transfection are known to the skilled worker in the field.
Successful transfection is generally recognised when any indication of the
operation of
this vector occurs in the host cell. Transformation is achieved using standard
techniques
appropriate to the particular host cells used.
Incorporation of cloned DNA into a suitable expression vector, transfection of
eukaryotic
cells with a plasmid vector or a combination of plasmid vectors, each encoding
one or
more distinct genes or with linear DNA, and selection of transfected cells are
well known
in the art (see, e.g. Sambrook et al. (1989) Molecular Cloning: A Laboratory
Manual,
Second Edition, Cold Spring Harbor Laboratory Press).
Transfected or transformed cells are cultured using media and culturing
methods known
in the art, preferably under conditions, whereby the fusion protein encoded by
the DNA is
expressed. The composition of suitable media is known to those in the art, so
that they
can be readily prepared. Suitable culturing media are also commercially
available.
Preferred bacterial hosts which may be used in the method of the invention
include B
strains of E. coli such as BL21 or a K strain such as JM109. These strains are
widely
available in the art from academic and/or commercial sources. The B strains
are deficient
in the lon protease and other strains with this genotype may also be used.
Preferably the
strain should not be defective in recombination genes.
Most preferably the strain is BL21(DE3), as disclosed in Studier et al.
(1990). Bacteria
obtainable by selection for improved heterologous polypeptide expression,
optionally
cured of the original vector, may also be used as host cells in the present
invention.
Particular bacteria include E. coli C43 (DE3) (deposited at the European
Collection of
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
29
Cell Cultures (ECCC) , Salisbury, Wiltshire. UK on 4th July 1996 as B960704-
l~); E. coli
C0214(DE3) (deposited at the National Collections of Industrial and Marine
Bacteria on
25th June 1997 as NCIMB 40884); E. coli DK8(DE3)S (deposited at the National
Collections of Industrial and Marine Bacteria on 25th June 1997 as NCIMB
40880; or E.
coli C41 (DE3) (deposited at the ECCC on 4th July 1996 as B96070444). Such
bacteria,
when cured, provide a host for the expression of fusion proteins of the
invention and are
especially suitable for the expression of fusion proteins whose expression is
tonic to
bacteria.
F. Production of fusion proteins and their processing.
Host cells of the invention may be cultured under conditions in which
expression of the
fusion protein occurs. The fusion protein may be recovered by any suitable
means. for
example affinity chromatography or HPLC. Where small fusion proteins are
involved
1 ~ HPLC is particularly suitable.
The fusion protein may be cleaved, e.g. using an appropriate protease, to
provide the
polypeptide sequence of interest and this sequence may be recovered from the
resulting
mixture of first and second regions of the fusion protein.
Alternatively the fusion protein may find application as such, for example as
an
immunogen where the coiled-coils form aggregates. This avoids the necessity
for
preparing immunogenic material form small proteins and peptides by coupling
them by
separate chemical reaction to a carrier protein such as key-hole limpet
hemocyanin
(KLH).
H. Use in NMR studies
Fusion proteins according to the invention possess an extremely small fusion
partner.
One advantage thereof is that the fusion proteins may be employed directly in
an NMR
experiment without the fusion partner interfering in the spectrum received.
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
NMR analysis may be performed according to techniques and methodology which
are
known in the art, for example as described in K. Wiirtrich, "NMR of Proteins
and Nucleic
Acids", Wiley, New York, 1986, incorporated herein by reference.
5
The present invention is illustrated with reference to the following examples.
Example 1
Preparation of a GroEL fusion vector
The polymerase chain reaction (PCR) is used to generate a DNA fragment
containing a N-
terminal histidine tag, the 191-345 fragment of GroEl, a thrombin cleavage
site and a multiple
cloning site. The 5'- flanking PCR primer is 5'- AGA CGG ACT GCC ATA TGC ATC
ATC
ATC ATC ATC ATG AAG GTA TGC AGT TCG ACC - 3'. The 3'- flanking primer is 5'-
ATT
GAC CCC AAG CTT CGA ATT CCA TGG TAC CAG CTG CAG ATG TCG AGC TCG GAT
CCA CGC GGA ACC AGA CCA CGG CCC TGG ATT GCA GCT TCT TCA CCC -3'. The
template for the PCR amplification is as described in Zahn et al., (1996) PNAS
(USA) 93:15024-
15026. The resulting fragment is cloned into Nde I and Hind III digested
PRSETA (Invitrogen)
to create pHGro (see fig. 1 ).
A Fibronectin type III domain of human Tenascin and human FKBP 12 are sub-
cloned into
pHGro using BamH I and EcoR I. Residues 2-62 of S. cerevisiae RNase HI are
amplified
2~ from genomic DNA by PCR and subcloned via BamHI and EcoRI restriction sites
into the
pRSETa vector (Invitrogen), which also contains a fragment of the GroEL
chaperone
protein and a histidine tag. The sequences of the primers used for PCR
amplification are
as follows;
5' GCACCTAGGCGTTCCGTTCCCTTGAAGATGCGC (forward)
5'-GGGAATTCAGGAACTTCCATAGTTAGATGTAGTATTTGG (reverse).
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
31
The vector is used to transform Escherichia coli strain BL21(DE3)C41 (Novaaen:
ivliroux,
B., and Walker, J. E. (1996) J. Nlol. Biol. 260, 289 - 298) which is used for
the expression tests
in 2xTY medium. Transformants are obtained using a polyethylene glycol method
(Chung, et al.
(1989) Proc. Natl. Acad. Sci. USA 86, 2172 - 2175).
Example 2
Expression and purification of fusion proteins
A 2 litre shake flask containing 0.25 litre of 2XTY medium plus ampicillin at
50 ~g per ml is
inoculated with 4 C41 colonies containing a pHGro fusion vector. The culture
is grown at 28 °C
in an orbital shaker at 200 rpm. At an Ab 600 value of 0.3, expression is
induced with isopropyl
B-D-thiogalactoside (IPTG), using a 50 pM final concentration. The cells are
harvested about
hours after induction by centrifugation and re-suspended in 200 ml of 20 mM
sodium
15 phosphate buffer pH 7.2 + 150 mM NaCI + 10 mM (3-mercaptoethanol + PMSF
(0.5 mM final
concentration). The suspension is sonicated on power level 8 on a Misonix Inc.
Model No.
XL2020 sonicator, using 1 second pulses and 3 seconds cooling on ice for a
total of 12 minutes
and centrifuged at 15 k rpm for 30 minutes. The insoluble fraction is re-
suspended in 100 ml of
sonication buffer, re-sonicated and re-centrifuged.
Purification is performed in a batch-wise manner. The centrifuged protein
solutions are
combined and 10 ml of Ni'+ charged iminodiacetic acid resin (Sigma) is added.
The solution is
stirred for 3 hours at 4 °C and the resin washed 3 times with 50 ml of
sonication buffer followed
by 2 times with 50 ml of 50 mM Trizma base / Trizma HCI (Sigma) buffer pH 8.4
+ 10 mM
mercaptoethanol. Centrifugation is used to isolate the resin following each 1
minute wash. This
process is repeated for each pHGro fusion. 50 ml of buffer containing 250 mM
Imidazole is used
to elute the fusion proteins from the resin. 50 mM Tris buffer pH 8.4 + 10 mM
B-
mercaptoethanol is used for human FKBPI2, pH 7.4 is used for Tenascin and
RNase HI. It is
necessary to include 150 mM NaCI during the elution of the RNase HI domain.
600 units of
Thrombin (Sigma) is added to FKBP 12 and 50 units to the other two. After
about 20 hours at
room temperature the purifications are analysed by SDS-PAGE (Shagger, H., and
Jagow, G.
(1987) Analytical Biochemistry 166, 368 - 379). Protein concentrations are
estimated using Bio-
Rad's Protein Assay solution, which is based on the Bradford dye-binding
procedure. Bovine
Serum Albumin is used to produce the calibration curve.
3~
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
32
The test proteins are produced to an average of 400 mg per litre of culture.
which is
approximately 30% of the total soluble protein. All three fusion proteins
behave in a typical
manner during metal affinity chromatography, and thrombin removes the GroEL
fragment
successfully in each case (see FIG.2). Tenascin and RNase HI only require a
small quantity of
thrombin for the complete removal of GroEL. In the case of FKBP 12, a small
amount of fusion
protein remains after the treatment with thrombin. This has also been
experienced with other
FKBP 12 fusion proteins where thrombin has been used and is to be expected.
The 191-345 apical fragment of GroEL with a N-terminal histidine tag satisfies
the criteria for a
good fusion protein. It can be over-expressed to high levels as soluble fusion
proteins in E.coli, it
is small and can be purified easily using nickel affinity chromatography.
Being monomeric, this
expression system does not suffer from the problems associated with the
expression of
multimeric proteins with dimeric fusion proteins.
Example 3
NMR sample preparation
Uniform labelling of proteins with 15N, or 15N and 13C is achieved by growing
cells in
minimal media containing t5NH4Cl or ~3C6-glucose as nitrogen and carbon
sources
respectively. A 10 % 13C-labelled protein is produced by incorporating 10 %
I3C6-glucose
and 90 % unlabelled glucose into the growth medium. Half litre cultures are
grown at 28
°C, 250 rpm shaking, to an optical density of 0.2 AUs at 600 nm.
Protein expression is
induced for 16 h with 0.2 mM isopropyl-D-thiogalactoside and harvested cells
are
resuspended in 16 mM Na2HP04, 4 mM NaH2PO,~.H20, 150 mM NaCI and 10 mM ~i-
mercaptoethanol. Cells are subject to two rounds of sonication and cell
lysates are
centrifuged at 17,000 r.p.m. for 30 min. The supernatant is applied to a
nickel affinity
column (Sigma) and the fusion protein eluted with 50 mM Tris-HCl pH 8.4, 150
mM
NaCI, 10 mM ~i-mercaptoethanol and 250 mM imidazole. Thrombin digestion of the
fusion protein, using 5 U thrombin per ml protein, released the RNase HI
fragment from
the GroEL tag fragment. This is carried out for 2 h at room temperature. The
RNase HI
is purified from the GroEL fragment using a Heparin HyperD column (Sigma) with
a
gradient of 1 M NaCI (0-100%) in 50 mM Tris-HC1 pH 8.4 and 10 mM (3-
CA 02376062 2001-12-03
WO 00/75346 PCT/GB00/01981
-, -,
mercaptoethanol. RNase HI containing fractions are dialysed overnight against
50 mM
acetate buffer pH 3.6 and 5 mM DTT, and concentrated in an Amicon
concentrator.
NMR samples contained approximately 2 mM protein in ~0 mM acetate buffer pH
3.6
j and ~ mM DTT, in either HZO with 10 % DSO or 100 % DSO.
