Note: Descriptions are shown in the official language in which they were submitted.
' CA 02376634 2001-12-07
WO 00/75304 PCT/FR00/01566
IMMUNOSTIMULANT OLIGONUCLEOTIDE
The present invention relates to the domain of
immunostimulants. More particularly, the invention
relates to oligonucleotides capable of stimulating
human cells involved in the immune system, and to the
use thereof as an immunization adjuvant.
A large number of oligonucleotides have already been
1U described in the prior art, in relation to their
immunostimulant properties. Thus, application EP0468520
describes immunostimulant polynucleotides consisting of
a linear DNA single strand comprising from 10 to 100
nucleotides linked together according to a palindromic
sequence.
According to application WO 96/02555, the
immunostimulatory activity of oligonucleotides is
linked to the presence of a 5' CG 3' dinucleotide
sequence in which C is not methylated, the
immunostimulant activity being greater i.f the CG unit
is preceded in 5' by the dinucleotide GA and/or
followed in 3' by the dinucleotide TC or TT.
On the other hand, according to patent application
WO 98/52962, it is not necessar=y for the
oligonucleotides to have a minimum of 8 nucleotides, as
had been described previously, or for their sequence to
be a palindrome, or even for them to comprise the
dinucleotide CG; thus, this application describes the
following 3 oligonucleotides for their use as an
immunization adjuvant:
5' GACGTT 3', 5' GAGCTT 3', and 5' TCCGGA 3'.
According to US patent 5,663,153, the immunostimulant
activity of oligonucleotides is not linked to the
sequence of the nucleotides, but to the nature of the
bond between nucleotides, the presence of at least one
CA 02376634 2001-12-07
_ 2 _
phosphorothioate bond making it possible to induce
stimulation of the immune system.
Most tests of the prior art for evaluating the
immunostimulant activity of the oligonucleotides
provided are carried out either in vitro, on animal
cells (essentially murine cells), or in vivo on mice.
However, the differences which exist between the immune
system of mice and that of humans have led to
differences between the results obtained on murine
cells and those obtained on human cells. It is
therefore not certain that all the oligonucleotides
which have been described as immunostimulant in the
prior art really are immunostimulant with respect to
humans.
Now, the pharmaceutical industry is in great need of
immunostimulants which can be administered to humans,
in particular in the field of vaccines.
The aim of the present invention is therefore to
propose oligonucleotides capable of stimulating cells
of the immune system of humans.
In order to achieve this aim, a subject of the
invention is an oligonucleotide capable of stimulating
human cells of the immune system, characterized in that
it comprises at least one sequence 5' T 'r N1 N2 T T 3'
in which T is thymine, and N1 and NZ may each represent
adenine, thymine, cytosine or guanine, and in that it
lacks a dinucleotide CG in which the cytosine C is not
methylated.
A subject of the invention is also the use of such an
oligonucleotide, for manufacturing a medicinal product.
According to one characteristic of the :invention, the
oligonucleotide comprises from 6 to 100 nucleotides.
CA 02376634 2001-12-07
- 3 -
According to a particular characteristic, the
oligonucleotide according to the invention is
characterized in that N1 represents adenine and in that
NZ represents guanine.
According to another characteristic, the
oligonucleotide according to the invention is
characterized in that the 5' T T Nl NZ T T 3' unit is
repeated at least once.
According to another characteristic, the
oligonucleotide according to the invention is
characterized in that the 5' T T N1 N2 T 'r 3' unit unit
is repeated twice.
According to another characteristic, the
oligonucleotide according to the invention is
characterized in that the repeated 5' T 'T N1 Nz T T 3'
units are separated by a nucleotide N,3 which, each
time, may be identical or different, and which may
represent A, C, T or G.
According to a particular characteristic, the
oligonucleotide according to the invention is
characterized in that the nucleotide N3 separating the
first two TTN1N2TT units read when the sequence is in
the 5' -~ 3' orientation represents cytosine.
According to another characteristic, the
oligonucleotide according to the invention is
characterized in that it comprises the sequence 5'
TTAGTTCTTAGTTN3TTAGTT 3', in which A represents
adenine, T represents thymine, G represents guanine and
C represents cytosine, and in which N3 may signify A,
T, C or G.
According to another characteristic, the
oligonucleotide according to the invention is capable
of inducing human lymphocyte proliferation.
CA 02376634 2001-12-07
- 4 -
According to another characteristic, the
oligonucleotide according to the invention is capable
of increasing the expression of the activation marker
CD86 and of the receptor CD25 on human B lymphocytes.
According to another characteristic, the
oligonucleotide according to the invention is capable
of inducing cytokine secretion.
A subject of the invention is also an immunization
adjuvant, characterized in that it comprises at least
one oligonucleotide which is capable of stimulating
human cells of the immune system and which contains at
least one sequence 5' T T N1 NZ T T 3' in which T is
thymine, and N1 and N2 may each represent adenine,
thymine, cytosine or guanine, the oligonucleotide
lacking a CG dinucleotide sequence :in which the
cytosine C is not methylated.
A subject of the invention is also an immunization
composition for human use, comprising at least one
immunization antigen, characterized in that it also
comprises at least one oligonucleotide which is capable
of stimulating human cells of the immune system and
which contains at least one sequence 5' T T N1 NZ T T 3'
in which T signifies thymine, and N1 and N2 may each
represent adenine, thymine, cytosine or guanine, the
oligonucleotide lacking a CG dinucleotide sequence in
which the cytosine C is not methylated.
The present invention will be more clearly understood
upon reading the following description, with reference
to figures 1 to 11 which illustrate the results
obtained in the tests described in Examples 2 to 7.
In particular, figures 1 and 2 indicate the number of
counts per minute obtained in the test of the example.
CA 02376634 2001-12-07
- 5 -
Figures 3 and 5 indicate the percentage of CD20+ cells
expressing the CD25 receptor, for the ol_igonucleotides
obtained according to Example 1.
Similarly, figures 4 and 6 indicate the percentage of
CD20+ cells expressing the CD86 marker.
Figure 7 indicates the number of counts per minute
obtained in the test of Example 4.
Figure 8 indicates the percentage of CD20+ cells
expressing the CD25 receptor, for the oligonucleotides
obtained according to Example 4, Similarly, Figure 9
indicates the percentage of CD20+ expressing the CD86
marker.
Figure 10 indicates the number of spots measured for
the secretion of y interferon by cells stimulated in
the presence of the oligonucleotides having the
sequences 9 to 12 described in Example 4.
Figure 11 indicates the number of spots measured for
the secretion of IL10 by cells stimulated in the
presence of the oligonucleotides having the sequences 9
to 12 described in Example 4.
For the purposes of the present invention, the term
"oligonucleotide" is intended to mean a polynucleotide
comprising at least six nucleotides. Specifically,
contrary to the teaching of the article entitled "CpG
motifs in bacterial DNA trigger direct B-cell
actiT,ration", Krieg et al., Nature 1995, it was noted
that it is not necessary for the oligonucleotide to
have at least 8 nucleotides. On the other hand, the
upper limit of the size of the oligonucleotides is not
really determined. It may, however, be noted that, the
longer the oligonucleotide, the more difficult it will
be to purify it during the steps of synthesis and the
higher the cost price thereof. In addition, it is
CA 02376634 2001-12-07
- 6 -
probable that a very long oligonucleotide will find it
more difficult to penetrate cells. Thus, for the needs
of the present invention, it is considered that
limiting the size of the oligonucleotide to 100
nucleotides is suitable. This oligonucleotide is
preferably a single-stranded oligonucleotide; it may be
an oligodeoxyribonucleotide or an oligoribonucleotide.
Particularly good results have been obtained using an
oligodeoxyribonucleotide. The oligonucleotides which
are suitable for the purposes of the invention may be
in phosphodiester form or, in order to be more stable,
in the form of phosphorot.hioates or
phosphodiester/phosphorothioate hybrids. Those
preferred are phosphorothioate oligonucleotides.
The oligonucleotide according to the invention is
capable of stimulating human cells of the immune
system, such as B lymphocytes, T lymphocytes, monocytes
and d~ndritic cells. This stimulation is assessed, in
particular, by lymphoproliferation or by the expression
of markers, such as the cytokine receptor CD25 or the
activation marker CD86 on B lymphocytes. It is possible
to select the oligonucleotides of interest using tests
other than those provided in the present application,
on the condition, however, that they ax-e tests which
evaluate the capacity for stimulating human cells and
not, as in most of the documents of the prior art,
tests which evaluate the capacity for stimulating
murine cells. It would, in particular, be possible to
test the expression of other B lymphocyte activation
markers, such as the CD69 markers, or the expression of
proliferation markers, such as the KI67 marker; tests
relating to an increase in activation markers and
maturation markers of dendritic cells may also be used.
Simi=arty, tests for assessing an increase in
production of certain cytokines may also be used.
According to one characteristic of the invention, the
oligonucleotide comprises at least one nucleotide
CA 02376634 2001-12-07
_ 7 _
sequence 5' T T N1 N2 T T 3' in which T signifies
thymine, and N1 and NZ may each represent adenine,
thymine, cytosine or guanine. This formula thus covers
16 possibilities. This sequence may be 5'-terminal or
3'-terminal, or be surrounded by other nucleotides. It
may be unique or repeated several times identically
within the same oligonucleotide. An oligonucleotide
according to the invention may also comprise several
different sequences each corresponding to the 5' T T N1
NZ T T 3' unit.
According to the invention, the oligonucleotide does
not comprise a palindromic sequence. Despite this
absence of palindromic sequence, such an
oligonucleotide is capable of stimulating human cells
of the immune system.
According to one characteristic, the oligonucleotide
according to the invention lacks a dinuc:leotide CG in
which the cytosine is not methylated. This exclusion
also applies to the N1 NZ unit. The ability of the
oligonucleotides of the prior art to be immunostimulant
has almost always been interpreted as being linked to
the presence of nonmethylated CpG units (cf. in
particular the article by Krieg et al. in Nature of
April 1995, mentioned above), this interpretation being
coherent with the observation according to which the
frequency of this dinucleotide is approximately four
times greater in the genome of bacteria than in that of
vertebrates. Surprisingly, it has now been found that
oligonucleotides completely lacking this dinucleotide
unit are, however, entirely capable of stimulating the
cells of the human immune system.
According to a particular embodiment of the present
invention, the N1N2 unit corresponds to the dinucleotide
AG in which A signifies adenine and G signifies
guanine.
CA 02376634 2001-12-07
According to an advantageous characteristic, the 5'
TTAGTT 3' unit is repeated at least once in the
oligonucleotide, and preferably at least twice. More
preferably, the repeated units are separated by at
least one nucleotide N3, which represents adenine,
cytosine, guanine or thymine. Within an
oligonucleotide, this separating nucleotide may always
be the same or may be different each time. Preferably,
the nucleotide separating the first two TTAGTT units of
the oligonucleotide (taking the direction for reading
to be 5'-~3') consists of cytosine.
In particular, for the purpose of the present
invention, those oligonucleotides in which the
nucleotide sequences correspond to the formula 5'
TTAGTTCTTAGTTN3TTAGTT 3', in which N3 represents A, T, C
or G, are preferred.
According to a particular characteristic, the
oligonucleotide according to the invention lacks or is
low in nucleotide sequence capable of inhibiting the
cells of the human immune system. In fact, in order to
obtain an overall immunostimulant effect, if inhibitory
or neutralizing units such as, for example, those
described in application WO 98/52581 are present, their
effect must be suppressed or decreased, through the
presence of a sequence with more pronounced
immunostimulant effect or through the presence of a
greater number of 5' T T N1 NZ T T 3' sequences.
A subject of the present invention is also an
immunization adjuvant comprising at least one
immunostimulant oligonucleotide having at least one 5'
T T N1 NZ T T 3' unit as mentioned above. The term
"immunization adjuvant" is intended to mean a product
which makes it possible to increase or to modify the
response of the immune system of an organism with
respect to the administration of an antigen. In
CA 02376634 2001-12-07
- 9 -
particular, it may be an increase in the humoral
response or in the cellular response.
The action of an immunization adjuvant may also be, not
an increase in the response which would. occur in the
absence of adjuvant, but a different orientation of the
response produced: for example, orientation toward a
cellular response rather than a humoral response,
production of certain cytokines rather than others,
production of certain antibody types or subtypes rather
than others, stimulation of certain cells rather than
others, etc.
The immunostimulant oligonucleotide of the present
invention may be used as an immunization adjuvant
whatever the nature of the antigen administered and
whatever the number of valencies used. It may be the
only adjuvant used or, on the contrary, it may be one
element of an adjuvant combination.
The adjuvant action of the oligonucleotide according to
the invention may be obtained either when it is
combined with the antigens) when they are
administered, i.e. when they are part of the same
immunization composition, or when it is administered
separately from the antigen(s). It is, however,
preferred to use it in the same immunization
composition as the antigens) to be administered.
The oligonucleotide according to the invention may
advantageously be administered via all the routes which
can be used for an immunization composition: mucosal
route or systemic route.
One of the subjects of the invention is an immunization
composition comprising at least one immunostimulant
oligonucleotide having a 5' T T N1N2 T T 3' sequence as
described above.
CA 02376634 2001-12-07
- 10 -
An immunization composition according to the invention
may be intended for immunization against a single
disease or intended for immunization against several
diseases. It may be a liquid immunization composition
or a lyophilized composition. It may comprise, besides
the antigens, all or some of the components
conventionally present in a vaccine, such as buffers,
stabilizers, preserving agents, etc. It may also
comprise one or more adjuvant(s) other than those which
are subjects of the present invention. It may also
comprise several adjuvants which are subjects of the
present invention, consisting either of
oligonucleotides which all have the same 5' T T N1 N2 TT
3' unit but which differ by the nucleotides in 5'
and/or in 3', or nucleotides which have different 5' T
T N1 NZ T T 3' units, the sequence in 5' and in 3' of
which are identical or different.
The immunization composition according to the invention
may be intended for prophylactic administration or for
therapeutic administration.
The immunization composition according to the invention
may be formulated sa as to optimize the adjuvant action
of the oligonucleotide which is the subject of the
invention. Thus, the oligonucleotide may be coupled to
a lipid, such as cholesterol; it may be integrated into
an emulsion of the oil/water type or formulated in the
form of liposomes.
The following examples illustrate particular
embodiments of the present invention.
E-xample 1: Oligonucleotide synthesis
15 oligonucleotides were synthesized, each having one
of the following units:
' CA 02376634 2001-12-07
- 11 -
5'TTAATT 3'
5'TTACTT 3'
5' '~ T A T T T 3' Series A
5'TTAGTT 3'
5' TTTTTT 3'
5' TTTATT 3'
5' T T T C T T ~' Series T
5' TTTGTT 3'
5' TTCCTT 3'
5' TTCATT 3' SeriesC
~' 'i"tL TTT 3'
5'TTGGTT 3'
5'TTrATT 3'
,. ; T ~',1
T T Series G
3
5'TTGCTT 3'
and having 4 adenines in 5' and 5 adenines in 3'.
These oligonuc'eotides are synthesized using an
automatic synthesizer supplied by Applied Biosystems,
wr~icr~ ases the . ~andard phosphoramidite chemical method
ar_d whi~h comprises, in each cycle, an oxidation step,
which is carried out using a
tetraethylthiuram/acetonitrile solution, in order to
obtain a phosphorothioate bond.
An ol,'_gonucleoti.de A15(S) which comprises only As and
which .is phospho-~othioate throughout its length is also
prepa_ed, in the same way. This oligonucleotide is a
neg~.tive control since it causes neither proliferation
nor an increase in the expression of activation markers
on B lymphocytes.
CA 02376634 2001-12-07
- 12 -
An oligonucleotide 3Db(S), the sequence of which is
identified in patent application W096/02555 under SEQ
ID No. 15 (5'GAGAACGCTCGACCTTCGAT3'), is also prepared;
this oligonucleotide comprises phosphorothioate bonds
throughout its length and is used as a positive
control.
All the oligonucleotides are maintained in solution in
PBS buffer.
Example 2: Lymphoproliferation test
Lymphocytes are isolated from the peripheral blood of a
donor by carrying out a centrifugation on a Ficoll
gradient. These lymphocytes are adjusted to 2x106
cells/ml in culture medium (RPMI 1640 + 10% fetal calf
serum, and also glutamine, streptomycin and
penicillin).
The cells are distributed into 96-well plates (round
bottomed) in 100 ~,1, i . a . 2x105 cells pe:r well . 100 ~,1
of a 4 ~,M solution of oligonucleotides to be tested
produced in Example 1 (a single type of oligonucleotide
per well) are then added in order to obtain a 2 ~,M
final concentration.
The cells are incubated for 48 to 72 hours.
Tritiated thymidine (Amersham TRK 120) is diluted in
culture medium and then distributed in the plates in
the proportion of 1 ~Ci per well in 50 ~1. After
incubation for 7 to 8 hours in an incubator (5% C02,
37°C), the plates can be frozen at -80"C and treated
later.
Using a "Harvester", the content of the wells is
harvested onto Unif_ilter GF/C plates and 6 washes in
distilled water are carried out followed by a wash in
70~ ethanol in order to precipitate the DNA.
CA 02376634 2001-12-07
- 13 -
After drying the plates, 25 ~tl of liquid scintillant
(Microscint-40, Packard) are distributed into each well
and allow the radioactivity (radiation emitted by
tritium) to be quantified by measuring the number of
counts/minute (cpm) emitted by each well on a Top Count
counter (Packard).
The results obtained for each of the oligonucleotides
tested are represented on figures 1 and 2, which
indicate, for each oligonucleotide tested, the number
of counts per minute; it is noted that all the
nucleotides according to the invention have a result
which is clearly greater than the result obtained with
the medium alone or the negative control A15(S), which
means that they are all capable of stimulating
lymphocyte proliferation.
Example 3:
Test relating to activation markers
The test is carried out using lymphocytes isolated from
a donor as described in the previous example, and
adjusted to 2x106 cells/ml in the same culture medium.
The cells are then distributed into 12-well plates in a
volume of 2 ml, i.e. 4x106 cells/well. An amount of
oligonucleotides to be tested prepared in Example 1 (1
oligonucleotide/well) which is sufficient to obtain a
2 ~M oligonucleotide concentration is added to each
we~yl. The cells are then incubated for 72 hours at
37''C. The cells are then double-.Labeled using
CD25PE/CD20FITC or CD86PE/CD20FITC, followed by
analysis on a FACScan. The results obtained are
illustrated on figures 3, 4, 5 and 6, which represent,
for each oligonucleotide tested, the percentage of B
cells (CD20+) which express the CD25 receptor (those
which are CD25+) or the CD86 marker (those which are
CA 02376634 2001-12-07
- 14 -
CD86+). The results represented on figures 3 and 4 were
obtained in a test carried out at a different time from
the test for which the results are illustrated on
figures 5 and 6, which explains the difference in the
order of magnitude of the results obtained.
Specifically, in this type of manipulation, the tests
are very variable from one assay to the other, and only
the results obtained in the same test are comparable
with one another, hence the necessity of including, in
each test, an oligonucleotide-control and also an assay
of the medium alone.
It is noted that all the oligonucleotides which are
subjects of the invention activate the B lymphocytes
which express their activation marker CD86, and also
the cytokine receptor CD25.
Example 4:
In the same way as in Example 1, a series of 16
oligonucleotides are prepared, which have the following
sequences:
Seq ID1 5' TTAGTTATTAGTTATTAGTT 3'
.
Seq ID2 5' TTAGTTATTAGTTTTTAGTT 3'
.
Seq ID3 5' TTAGTTATTAGTTCTTAGTT 3'
.
Seq ID4 5' TTAGTTATTAGTTGTTAGTT 3'
.
Seq ID5 5' TTAGTTTTTAGTTATTAGTT 3'
.
Seq ID6 5' TTAGTTTTTAGTTTTTAGTT 3'
.
Seq ID7 5' TTAGTTTTTAGTTCTTAGTT 3'
.
Seq ID8 5' TTAGTTTTTAGTTGTTAGTT 3'
.
Seq ID9 5' TTAGTTCTTAGTTATTAGTT 3'
.
Seq ID10 . TTAGTTCTTAGTTTTTAGTT 3'
5'
Seq ID11 . TTAGTTCTTAGTTCTTAGTT 3'
5'
Seq ID12 . TTAGTTCTTAGTTGTTAGTT 3'
5'
Seq ID13 . TTAGTTGTTAGTTATTAGTT 3'
5'
Seq IJ14 . TTAGTTGTTAGTTTTTAGTT 3'
5'
Seq ID15 . TTAGTTGTTAGTTCTTAGTT 3'
5'
Seq ID16 . TTAGTTGTTAGTTGTTAGTT 3'
5'
CA 02376634 2001-12-07
- 15 -
These oligonucleotides are of the phosphorothioate type
throughout their length.
Example 5:
The capacity of the oligonucleotides prepared in
Example 4 to induce human lymphocyte proliferation is
evaluated using a lymphoproliferation test such as the
one described in Example 2. In the same way as in
Example 2, the oligonucleotide concentration per well
is 2 ~,M and the controls consist of the medium alone,
the oligonucleotide A15(S) and the oligonucleotide
3Db (S) .
The results obtained, expressed in counts per minute,
are represented in figure 7, which shows that all the
oligonucleotides according to the invention are capable
of inducing lymphocyte proliferation and that
particularly good results are obtained when the
sequences of the oligonucleotides are those identified
by Seq IDs 9 to 12, i.e. when cytosine separates the
first two TTN1NZTT units of the oligonucleotide .
2.5 Example 6:
The capacity of the oligonucleotides prepared in
Example 4 to induce the expression of l.he activation
marker CD86 and of the receptor CD25 on B lymphocytes
is evaluated. This evaluation is carried out using the
test described in Example 3. The results obtained with
the oligonucleotides prepared according to Example 4
are represented on figures 8 and 9, which illustrate
the percentages of B cells (CD20+) which also express
the receptor CD25 (figure 8) or the marker CD86 (figure
9) .
The results obtained in this test confirm those
obtained in the lymphoproliferation test: all the
CA 02376634 2001-12-07
- 16 -
oligonucleotides according to the invention induce the
expression of activation markers on human B
lyrnphocytes; particularly good results are obtained
when the first 2 TTN1N2TT units of the oligonucleotide
are separated by cytosine.
Example 7:
The capacity of the oligonucleotides according to the
present invention to induce cytokine secretion is
evaluated.
For this evaluation, lymphocytes are isolated from the
peripheral blood of a donor by carrying out a
centrifugation on a Ficoll gradient. These lymphocytes
are adjusted to 2x106 cells/ml in culture medium (AIM V
medium + streptomycin + penicillin).
ELISPOT 96-well plates (flat bottom made of
nitrocellulose) are pre-incubated the day before with a
solution of antibodies for capturing cytokines (IL-10
or y IFN depending on the test carried out), and then
saturated with culture medium.
Ne:a, 100 ~l of cells are distributed into the ELISPOT
plates, i.e. 2x105 cells per well, and then 100 ~1 of a
4 ~M solution of oligonucleotides to be tested,
produced according to Example 4 (a single type of
oligonucleotide per well) are added in order to obtain
a 2 ~,M final concentration. The test i.s carried out
with the oligonucleotides having t:he sequences
described under Seq ID 9, Seq ID 10, Seq ID 11 and Seq
ID 12.
The plates are incubated at 37°C, under a 5o C02
atmosphere. After incubation for 72 hours, the cells
are removed by washing in the presence of detergent (10
Tween) and the cytokines attached tc the capture
antibodies are revealed by successively adding
CA 02376634 2001-12-07
- 17 -
biotinylated detection antibodies (anti-IL-10 or anti-
y-IFN depending on the test carried out), streptavidin-
HR~ and the AEC substrate.
The spots (1 spot corresponding to 1 cytokine-secreting
cell) are counted using an automatic counter. The
results are expressed as number of spots (number of
secretor cells) per million cells.
The results obtained for each of the oligonucleotides
tested are represented on figures 10 and 11, which
indicate, for each oligonucleotide tested, the number
of cytokine-secreting cells per million total cells it
is noted that all the oligonucleotides according to the
invention have a result which is clearly greater than
the =esult obtained with the medium alone or the
negative control A15(S), which means that they are all
capable of inducing cytokine secretion, in particular
IL10 and Y interferon secretion.
CA 02376634 2001-12-07
- 21 -
SEQUENCE LISTING
<110> AVENTIS PASTEUR
<120> IMMUNOSTIMULANT OLIGONUCLEOTIDE
<130> PM9908W0
<140>
<141>
<150> 16
<170> Patentin Ver. 2.1
<210> 1
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: ol:igonucleotide
<400> 1
ttagttatta gttattagtt 20
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: oligonucleotide
<400> 2
ttagttatta gtttttagtt 20
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: oligonucleotide
CA 02376634 2001-12-07
- 22 -
<400> 3
ttag-ttatta gttcttagtt 20
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: ol:igonucleotide
<400> 4
ttagttatta gttgttagtt 20
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: ol:igonucleotide
<400> 5
ttagttttta gttattagtt 20
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence
<22G>
<223> Artificial sequence description; ol:igonucleotide
<400> 6
ttagttttta gtttttagtt 20
<210> 7
<211> 20
<2i2> DNA
<2i.~> Artificial sequence
<220>
<223> Artificial sequence description: oligonucleotide
<400> 7
ttagttttta gttcttagtt 20
CA 02376634 2001-12-07
- 23 -
<210> 8
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: oli.gonucleotide
<400> 8
ttagttttta gttgttagtt 2G
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: oli.gonucleotide
<400> 9
ttagttctta gttattagtt 2G
<210> 10
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: oligonucleotide
2.5 <400> 10
ttaattcata gtttttagtt 20
<210> 11
<211> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: oli_gonucleotide
<40C> ~~1
ttaattctta gttcttagtt 20
<210> 12
<2~-1> 20
<2i2> DNA
CA 02376634 2001-12-07
- 24 -
<2~3> Artificial sequence
<220>
<223> Artificial sequence description: oligonucleotide
<400> 12
ttacttctta gttgttagtt 20
<210> 13
<2_~_.'L> 20
<212> DNA
<213> Artificial sequence
<220>
<223> Artificial sequence description: oligonucleotide
<400> 13
ttagttgtta gttattagtt 20
<210> 14
<211> 20
<212> DNA
<213> Artificial sequence
<22(>
<223> Artificial sequence description: oligonucleotide
<400> 14
ttagttgtta gtttttagtt 20
<2~.0> 15
<21 1> 20
<212> DNA
<21~> Artificial sequence
<22C~>
<223> Artificial sequence description: ol:igonucleotide
<400> 15
ttaattgtta gttcttagtt 20
<210> 16
<211> 20
<2i2> DNA
<<"~3> Artificial sequence
<2.~'0>
<223> Artificial sequence description: oligonucleotide
Image
CA 02376634 2001-12-07
WO 00/75304 PCT/FR00/01566
-1-
LISTE DE SEQUENCES
<110> AVENTIS PASTEUR
s <120> OLIGONUCLEOTIDE IMMUNOSTIMULANT
<130> PM9908W0
<140>
io <141>
<160> 16
<170> Patentln Ver. 2.1
is
<210> 1
<211 > 20
<212> ADN
<213> Sequence artificielle
20 <220>
<223> Description de la sequence artificielle:
oligonucleotide
<400> 1
ttagttatta gttattagtt 20
2s
<210> 2
<211 > 20
<212> ADN
30 <213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
oligonucleotide
<400> 2
3s ttagttatta gtttttagtt 20
<210> 3
<211 > 20
40 <212> ADN
<213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
oligonucleotide
4s <400> 3
ttagttatta gttcttagtt 20
CA 02376634 2001-12-07
WO 00/75304 PCT/FR00/01566
-2-
<210> 4
<211 > 20
<212> ADN
<213> Sequence artificielle
s <220>
<223> Description de la sequence artificielle:
oligonucleotide
<400> 4
ttagttatta gttgttagtt 20
to
<210> 5
<211 > 20
<212> ADN
is <213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
oligonucleotide
<400> 5
2o ttagttttta gttattagtt 20
<210> 6
<211 > 20
2s <212> ADN
<213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
oligonucleotide
30 <400> 6
ttagttttta gtttttagtt 20
<210> 7
3s <211 > 20
<212> ADN
<213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
40 oligonucleotide
<400> 7
ttagttttta gttcttagtt 20
CA 02376634 2001-12-07
WO 00/75304 PCT/FR00/01566
-3-
<210> 8
<211 > 20
<212> ADN
s <213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
oligonucleotide
<400> 8
io ttagttttta gttgttagtt 20
<210> 9
<211 > 20
Is <212> ADN
<213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
oligonucleotide
20 <400> 9
ttagttctta gttattagtt 20
<210> 10
2s <211 > 20
<212> ADN
<213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
30 oligonucleotide
<400> 10
ttagttctta gtttttagtt 20
3s <210> 11
<211 > 20
<212> ADN
<213> Sequence artificielle
<220>
40 <223> Description de la sequence artificielle:
oligonucleotide
<400> 11
ttagttctta gttcttagtt 20
CA 02376634 2001-12-07
WO 00/75304 PCT/FR00/01566
-4-
<210> 12
<211 > 20
<212> ADN
s <213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
oligonucleotide
<400> 12
io ttagttctta gttgttagtt 20
<210> 13
<211 > 20
is <212> ADN
<213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
oligonucleotide
20 <400> 13
ttagttgtta gttattagtt 20
<210> 14
2s <211 > 20
<212> ADN
<213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
30 oligonucleotide
<400> 14
ttagttgtta gtttttagtt 20
3s <210> 15
<211 > 20
<212> ADN
<213> Sequence artificielle
<220>
40 <223> Description de la sequence artificielle:
oligonucleotide
<400> 15
ttagttgtta gttcttagtt 20
CA 02376634 2001-12-07
WO 00/75304 PCT/FR00/01566
-5-
<210> 16
<211 > 20
<212> ADN
s <213> Sequence artificielle
<220>
<223> Description de la sequence artificielle:
oligonucleotide
<400> 16
to ttagttgtta gttgttagtt 20
is
