Note: Descriptions are shown in the official language in which they were submitted.
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
METHODS AND COMPOSITIONS FOR CONTROL OF BONE FORMATION VIA
MODULATION OF LEPTIN ACTIVITY
This application claims priority under 35 U.S.C. ~119 (e) to U.S. provisional
patent application no. 60/138,733 filed June 11, 1999, which is hereby
incorporated by
reference in its entirety. This invention was made with government support
under grant
numbers NIH RO1 DE11290, NIH RO1 AR45548 and NIH RO1 AR43655, awarded by
National Institute of Health. The government may have certain rights in the
invention.
INTRODUCTION
The present invention relates to compositions and methods for the treatment,
diagnosis and prevention of conditions, disorders or diseases involving bone,
including, but
not limited to, osteoporosis. The invention relates to modulation of the
receptor signaling
pathway for the polypeptide hormone leptin. More particularly the present
invention relates
to the modulation of leptin synthesis, leptin receptor synthesis, leptin
binding to its receptor,
and leptin signaling to bone cells.
The present invention also provides methods for the identification and
prophylactic or
therapeutic use of compounds in the treatment, prognosis and diagnosis of
conditions,
disorders, or diseases involving bone. Additionally, methods are provided for
the diagnostic
monitoring of patients undergoing clinical evaluation for the treatment of
conditions or
disorders involving bone, for monitoring the efficacy of compounds in clinical
trials and for
identifying subjects who may be predisposed to such conditions, disorders, or
diseases
involving bone.
2 BACKGROUND OF THE INVENTION
The physiological process of bone remodeling allows constant renewal of bone
through two well-defined sequential cellular processes. Karser~ty, 1999, Genes
and
Development, 13:3037-3051. The initial event is resorption of preexisting bone
by the
osteoclasts, followed by de novo bone formation by the osteoblasts. These two
processes in
bone remodeling must maintain equilibrium of bone mass within narrow limits
between the
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
end of puberty and the arrest of gonadal function. The molecular mechanisms
responsible for
maintaining a constant bone mass are unknown, yet several lines of evidence
suggest that this
may be achieved, at least in part, through a complex endocrine regulation. For
example,
gonadal failure and the concomitant deficiency of the sex steroids stimulates
the bone
resorption process of bone remodeling and eventually leads to osteopenia (low
bone mass) or
osteoporosis (low bone mass and high susceptibility to fractures). Likewise,
the recent
identification of osteoprotegerin in serum and its functional characterization
through a
systemic route is another indication that secreted molecules affect
osteoclastic bone
resorption. Simonet et al., 1997, Cell, 89:309-319. This systemic control of
bone resorption
suggests that other circulating molecules, yet to be identified, could control
bone formation
via the osteoblasts. The identification of these hormones or growth factors,
if they exist, is of
paramount importance given the incidence and morbidity of diseases affecting
bone
remodeling.
One such disease is osteoporosis. Riggs et al., 1998, J. Bone Miner. Res.,
13:763-
773. Osteoporosis is the most common disorder affecting bone remodeling and
the most
prevalent disease in the Western hemisphere. At the physiopathological level,
hallmarks of
the disease are that bones exhibit a lowered mass, that is, are less dense
and, thus, subject to
fractures. In addition, the onset of osteoporosis in both sexes is intimately
linked to arrest of
gonadal function and is rarely observed in obese individuals. At the cellular
level,
osteoporosis is characterized by a loss in equilibrium of bone remodeling
favoring bone
resorption over bone formation, which leads to the lowered bone mass and
increased bone
fractures. At the molecular level, the pathogenesis of osteoporosis remains
largely unknown.
3 SUMMARY OF THE INVENTION
An object of the present invention is the treatment, diagnosis and/or
prevention of
bone disease through manipulation of the leptin signaling pathway. Bone
diseases which can
be treated and/or prevented in accordance with the present invention include
bone diseases
characterized by a decreased bone mass relative to that of corresponding non-
diseased bone,
including, but not limited to osteoporosis, osteopenia and Paget's disease.
Bone diseases
which can be treated and/or prevented in accordance with the present invention
also include
2
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
bone diseases characterized by an increased bone mass relative to that of
corresponding non-
diseased bone, including, but not limited to osteopetrosis, osteosclerosis and
osteochondrosis.
Thus, in accordance with one aspect of the present invention, there is a
method of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that lowers leptin level in
blood serum,
wherein the bone disease is characterized by a decreased bone mass relative to
that of
corresponding non-diseased bone. Specific embodiments of some of these
compounds and
methods include, but are not limited to ones that inhibit or lower leptin
synthesis or increase
leptin breakdown. Among such compounds are antisense, ribozyme or triple helix
sequences
of a leptin-encoding polypeptide.
In accordance with another aspect of the present invention, there is a method
of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that lowers leptin level in
cerebrospinal fluid,
wherein the bone disease is characterized by a decreased bone mass relative to
that of
corresponding non-diseased bone. Specific embodiments of some of these
compounds and
methods include, but are not limited to ones that inhibit or lower leptin
synthesis or increase
leptin breakdown, and compounds that bind leptin in blood.
Particular embodiments of the methods of the invention include, for example, a
method of treating a bone disease comprising: administering to a mammal in
need of said
treatment a therapeutically effective amount of a compound, wherein the bone
disease is
characterized by a decreased bone mass relative to that of corresponding non-
diseased bone,
and wherein the compound is selected from the group consisting of compounds
which bind
leptin in blood, including, but not limited to such compounds as an antibody
which
specifically binds leptin, a soluble leptin receptor polypeptide, an inter-
alpha-trypsin inhibitor
heavy chain related protein and an alpha 2-macroglobulin protein.
In accordance with another aspect of the present invention, there is a method
of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that lowers the level of
phosphorylated Stat3
polypeptide, wherein the bone disease is characterized by a decreased bone
mass relative to
that of corresponding non-diseased bone. Specific embodiments of some of these
compounds
and methods include, but are not limited to ones that inhibit or lower leptin
synthesis or
3
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
increase leptin breakdown, compounds that bind leptin in blood, and leptin
receptor
antagonist compounds, such as acetylphenol compounds, antibodies which
specifically bind
leptin, antibodies which specifically bind leptin receptor, and compounds that
comprise
soluble leptin receptor polypeptide sequences.
In accordance with another aspect of the present invention, there is a method
of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that lowers leptin receptor
levels in
hypothalamus, wherein the bone disease is characterized by a decreased bone
mass relative to
that of corresponding non-diseased bone. Specific embodiments of some of these
compounds
and methods include, but are not limited to ones that inhibit or lower leptin
receptor synthesis
or increase leptin receptor breakdown. Among such compounds are antisense,
ribozyme or
triple helix sequences of a leptin receptor-encoding polypeptide.
In accordance with yet another aspect of the present invention, there is a
method of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that increases leptin level in
blood serum
and/or cerebrospinal fluid, wherein the bone disease is characterized by a
increased bone
mass relative to that of corresponding non-diseased bone. Specific embodiments
of some of
these compounds and methods include, but are not limited to ones that increase
or induce
leptin synthesis or decrease leptin breakdown.
In accordance with another aspect of the present invention, there is a method
of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that increases the level of
phosphorylated
Stat3 polypeptide, wherein the bone disease is characterized by a increased
bone mass relative
to that of corresponding non-diseased bone. Specific embodiments of some of
these
compounds and methods include, but are not limited to ones that increase or
induce leptin
synthesis or decrease leptin breakdown, and leptin receptor agonist compounds.
In accordance with another aspect of the present invention, there is a method
of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that increases leptin receptor
levels in
hypothalamus, wherein the bone disease is characterized by a increased bone
mass relative to
that of corresponding non-diseased bone. Specific embodiments of some of these
compounds
4
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
and methods include, but are not limited to ones that increase or induce
leptin receptor
synthesis or decrease leptin receptor breakdown.
In accordance with yet another aspect of the present invention, there is a
method of
preventing a bone disease comprising: administering to a mammal at risk for
the disease a
compound that lowers leptin level in blood serum, at a concentration
sufficient to prevent the
bone disease, wherein the bone disease is characterized by a decreased bone
mass relative to
that of corresponding non-diseased bone. Specific embodiments of some of these
compounds
and methods include, but are not limited to ones that inhibit or lower leptin
synthesis or
increase leptin breakdown. Among such compounds are antisense, ribozyme or
triple helix
sequences of a leptin-encoding polypeptide.
In accordance with another aspect of the present invention, there is a method
of
preventing a bone disease comprising: administering to a mammal at risk for
the bone
disease a compound that lowers leptin level in cerebrospinal fluid, at a
concentration
sufficient to prevent the bone disease, wherein the bone disease is
characterized by a
decreased bone mass relative to that of corresponding non-diseased bone.
Specific
embodiments of some of these compounds and methods include, but are not
limited to ones
that inhibit or lower leptin synthesis or increase leptin breakdown, and
compounds that bind
leptin in blood.
Particular embodiments of the methods of the invention include, for example, a
method of preventing a bone disease comprising: administering to a mammal at
risk for the
bone disease a compound at a concentration sufficient to prevent the bone
disease, wherein
the bone disease is characterized by a decreased bone mass relative to that of
corresponding
non-diseased bone, and wherein the compound is selected from the group
consisting of
compounds which bind leptin in blood, including, but not limited to such
compounds as an
antibody which specifically binds leptin, a soluble leptin receptor
polypeptide, an inter-alpha-
trypsin inhibitor heavy chain related protein and an alpha 2-macroglobulin
protein.
In accordance with another aspect of the present invention, there is a method
of
preventing a bone disease comprising: administering to a mammal at risk for
the bone
disease a compound that lowers the level of phosphorylated Stat3 polypeptide,
at a
concentration sufficient to prevent the bone disease, wherein the bone disease
is characterized
by a decreased bone mass relative to that of corresponding non-diseased bone.
Specific
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
embodiments of some of these compounds and methods include, but are not
limited to ones
that inhibit or lower leptin synthesis or increase leptin breakdown, compounds
that bind
leptin in blood, and leptin receptor antagonist compounds, such as
acetylphenol compounds,
antibodies which specifically bind leptin, antibodies which specifically bind
leptin receptor,
and compounds that comprise soluble leptin receptor polypeptide sequences.
In accordance with another aspect of the present invention, there is a method
of
preventing a bone disease comprising: administering to a mammal at risk for
the bone
disease a compound that lowers leptin receptor levels in hypothalamus, wherein
the bone
disease is characterized by a decreased bone mass relative to that of
corresponding non-
diseased bone. Specific embodiments of some of these compounds and methods
include, but
are not limited to ones that inhibit or lower leptin receptor synthesis or
increase leptin
receptor breakdown. Among such compounds are antisense, ribozyme or triple
helix
sequences of a leptin receptor-encoding polypeptide.
In accordance with yet another aspect of the present invention, there is a
method of
I 5 preventing a bone disease comprising: administering to a mammal at risk
for the bone
disease a compound that increases leptin level in blood serum and/or
cerebrospinal fluid, at a
concentration sufficient to prevent the bone disease, wherein the bone disease
is characterized
by a increased bone mass relative to that of corresponding non-diseased bone.
Specific
embodiments of some of these compounds and methods include, but are not
limited to ones
that increase or induce leptin synthesis or decrease leptin breakdown.
In accordance with another aspect of the present invention, there is a method
of
preventing a bone disease comprising: administering to a mammalat risk for the
bone disease
a compound that increases the level of phosphorylated Stat3 polypeptide, at a
concentration
sufficient to prevent the bone disease, wherein the bone disease is
characterized by a
increased bone mass relative to that of corresponding non-diseased bone.
Specific
embodiments of some of these compounds and methods include, but are not
limited to ones
that increase or induce leptin synthesis or decrease leptin breakdown, and
leptin receptor
agonist compounds.
In accordance with another aspect of the present invention, there is a method
of
preventing a bone disease comprising: administering to a mammal at risk for
the disease a
compound that increases leptin receptor levels in hypothalamus, at a
concentration sufficient
6
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
to prevent the bone disease, wherein the bone disease is characterized by a
increased bone
mass relative to that of corresponding non-diseased bone. Specific embodiments
of some of
these compounds and methods include, but are not limited to ones that increase
or induce
leptin receptor synthesis or decrease leptin receptor breakdown.
In accordance with yet another aspect of the present invention, there is a
method of
diagnosing or prognosing a bone disease in a mammal, such as a human,
comprising:
(a) measuring leptin levels in blood serum of a mammal, e.g., a mammal
suspected of exhibiting or being at risk for the bone disease; and
(b) comparing the level measured in (a) to the leptin level in control blood
serum,
so that if the level obtained in (a) is higher than that of the control, the
mammal is diagnosed
or prognosed as exhibiting or being at risk for the bone disease, wherein the
bone disease is
characterized by a decreased bone mass relative to that of corresponding non-
diseased bone.
In accordance with another aspect of the present invention, there is a method
of
diagnosing or prognosing a bone disease in a mammal, such as a human,
comprising:
(a) measuring leptin levels in cerebrospinal fluid of a mammal, e.g., a
mammal suspected of exhibiting or being at risk for the bone disease;
and
(b) comparing the level measured in (a) to the leptin level in control
cerebrospinal fluid,
so that if the level obtained in (a) is higher than that of the control, the
mammal is diagnosed
as exhibiting or being at risk for the bone disease, wherein the bone disease
is characterized
by a decreased bone mass relative to that of corresponding non-diseased bone.
In accordance with yet another aspect of the present invention, there is a
method of
diagnosing or prognosing a bone disease in a mammal, such as a human,
comprising:
(a) measuring leptin levels in blood serum of a mammal, e.g., a mammal
suspected of exhibiting or being at risk for the bone disease; and
(b) comparing the level measured in (a) to the leptin level in control blood
serum,
7
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
so that if the level obtained in (a) is lower than that of the control, the
mammal is diagnosed
as exhibiting or being at risk for the bone disease, wherein the bone disease
is characterized
by an increased bone mass relative to that of corresponding non-diseased bone.
In accordance with another aspect of the present invention, there is a method
of
diagnosing or prognosing a bone disease in a mammal, such as a human,
comprising:
(a) measuring leptin levels in cerebrospinal fluid of a mammal, e.g., a
mammal suspected of exhibiting or being at risk for the bone disease;
and
(b) comparing the level measured in (a) to the leptin level in control
cerebrospinal fluid,
so that if the level obtained in (a) is lower than that of the control, the
mammal is diagnosed
as exhibiting or being at risk for the bone disease, wherein the bone disease
is characterized
by an increased bone mass relative to that of corresponding non-diseased bone.
In accordance with yet another aspect of the present invention, there is a
method of
monitoring efficacy of a compound for treating a bone disease in a mammal,
such as a human,
comprising:
(aj administering the compound to a mammal;
(b) measuring leptin levels in blood serum of the mammal; and
(c) comparing the level measured in (b) to the leptin level in blood serum
of the mammal prior to administering the compound,
thereby monitoring the efficacy of the compound, wherein the bone disease is
characterized
by a decreased bone mass relative to that of corresponding non-diseased bone.
In accordance with another aspect of the present invention, there is a method
of
monitoring efficacy of a compound for treating a bone disease in a mammal,
such as a human,
comprising:
(a) administering the compound to a mammal;
(b) measuring leptin levels in cerebrospinal fluid of the mammal; and
(c) comparing the level measured in (b) to the leptin level in cerebrospinal
fluid of the mammal prior to administering the compound,
thereby monitoring the efficacy of the compound, wherein the bone disease is
characterized
by a decreased bone mass relative to that of corresponding non-diseased bone.
8
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
In accordance with yet another aspect of the present invention, there is a
method of
monitoring efficacy of a compound for treating a bone disease in a mammal,
such as a human,
comprising:
(a} administering the compound to a mammal;
(b) measuring leptin levels in blood serum of the mammal; and
(c) comparing the level measured in (b) to the leptin level in blood serum
of the mammal prior to administering the compound,
thereby monitoring the efficacy of the compound, wherein the bone disease is
characterized
by a increased bone mass relative to that of corresponding non-diseased bone.
In accordance with another aspect of the present invention, there is a method
of
monitoring efficacy of a compound for treating a bone disease in a mammal,
such as a human,
comprising:
(a) administering the compound to a mammal;
(b) measuring leptin levels in cerebrospinal fluid of the mammal; and
(c) comparing the level measured in (b) to the leptin level in cerebrospinal
fluid of the mammal prior to administering the compound,
thereby monitoring the efficacy of the compound, wherein the bone disease is
characterized
by a increased bone mass relative to that of corresponding non-diseased bone.
In accordance with another aspect of the present invention, there is a method
for
identifying a compound to be tested for an ability to modulate (increase or
decrease) bone
mass in a mammal, comprising:
(a) contacting a test compound with a polypeptide; and
(b) determining whether the test compound binds the polypeptide, so that if
the
test compound binds the polypeptide, then a compound to be tested for an
ability to modulate
bone mass is identified, wherein the polypeptide is selected from the group
consisting of a
leptin polypeptide and a leptin receptor polypeptide.
In accordance with another aspect of the present invention, there is a method
for
identifying a compound that modulates (increases or decreases) bone mass in a
mammal,
comprising:
(a) contacting test compounds with a polypeptide;
(b) identifying a test compound that binds the polypeptide; and
9
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
(c) administering the test compound in (b) to a non-human mammal, and
determining whether the test compound modulates bone mass in the mammal
relative to that
of a corresponding bone in an untreated control non-human mammal,
wherein the polypeptide is selected from the group consisting of a leptin
polypeptide and a
leptin receptor polypeptide, so that if the test compound modulates bone mass,
then a
compound that modulates bone mass in a mammal is identified.
In accordance with yet another aspect of the present invention, there is a
method for
identifying a compound to be tested for an ability to modulate (increase or
decrease) bone
mass in a mammal, comprising:
(a) contacting a test compound with a leptin polypeptide and a leptin receptor
polypeptide for a time sufficient to form leptin/leptin receptor complexes;
and
(b) measuring leptin/leptin receptor complex level, so that if the level
measured
differs from that measured in the absence of the test compound, then a
compound to be tested
for an ability to modulate bone mass is identified.
In accordance with another aspect of the present invention, there is a method
for
identifying a compound to be tested for an ability to decrease bone mass in a
mammal,
comprising:
(a) contacting a test compound with a cell which expresses a functional leptin
receptor; and
(b) determining whether the test compound activates the leptin receptor,
wherein if the compound activates the leptin receptor a compound to be tested
for an ability
to decrease bone mass in a mammal is identified.
In accordance with another aspect of the present invention, there is a method
for
identifying a compound that decreases bone mass in a mammal, comprising:
(a) contacting a test compound with a cell that expresses a functional leptin
receptor, and determining whether the test compound activates the leptin
receptor;
(b) administering a test compound identified in (a) as activating the leptin
receptor
to a non-human animal, and determining whether the test compound decreases
bone mass of
the animal relative to that of a corresponding bone of a control non-human
animal, so that if
the test compound decreases bone mass, then a compound that decreases bone
mass in a
mammal is identified.
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
In accordance with another aspect of the present invention, there is a method
for
identifying a compound to be tested for an ability to increase bone mass in a
mammal,
comprising:
(a) contacting a leptin polypeptide and a test compound with a cell that
expresses
a functional leptin receptor; and
(b) determining whether the test compound lowers activation of the leptin
receptor
relative to that observed in the absence of the test compound; wherein a test
compounds that
lowers activation of the leptin receptor is identified as a compound to be
tested for an ability
to increase bone mass in a mammal.
In accordance with yet another aspect of the present invention, there is a
method for
identifying a compound that increases bone mass in a mammal, comprising:
(a) contacting a leptin polypeptide and a test compound with a cell that
expresses
a functional leptin receptor, and determining whether the test compound
decreases activation
of the leptin receptor;
(b) administering a test compound identified in (a) as decreasing leptin
receptor to
a non-human animal, and determining whether the test compound increases bone
mass of the
animal relative to that of a corresponding bone of a control non-human animal,
so that if the
test compound increases bone mass, then a compound that increases bone mass in
a mammal
is identified.
The present invention also provides pharmaceutical compositions which can be
used
to treat and/or prevent bone diseases.
Other and further objects, features and advantages would be apparent and
eventually
more readily understood by reading the following specification and by
reference to the
accompanying drawings forming a part thereof, or any examples of the presently
preferred
embodiments of the invention are given for the purpose of the disclosure.
3.1 Definitions
The following terms used herein shall have the meaning indicated:
Leptin, ("Ob") as used herein, is defined by the endogenous polypeptide
product of an
ob gene, preferably a human ob gene, of which the known activities are
mediated through the
hypothalamus.
11
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Leptin receptor ("ObR"), as used herein, is defined by the receptor through
which the
leptin hormone binds to generate its signal; preferably, this term refers to a
human leptin
receptor.
Bone disease, as used herein, refers to any bone disease or state which
results in or is
characterized by loss of health or integrity to bone and includes, but is not
limited to,
osteoporosis, osteopenia, faulty bone formation or resorption, Paget's
disease, fractures and
broken bones, bone metastasis, osteopetrosis, osteosclerosis and
osteochondrosis. More
particularly, bone diseases which can be treated and/or prevented in
accordance with the
present invention include bone diseases characterized by a decreased bone mass
relative to
that of corresponding non-diseased bone (e.g., osteoporosis, osteopenia and
Paget's disease),
and bone diseases characterized by an increased bone mass relative to that of
corresponding
non-diseased bone (e.g., osteopetrosis, osteosclerosis and osteochondrosis).
Prevention of
bone disease includes actively intervening as described herein prior to onset
to prevent the
disease. Treatment of bone disease encompasses actively intervening after
onset to slow
down, ameliorate symptoms of, or reverse the disease or situation . More
specifically,
treating, as used herein, refers to a method that modulates bone mass to more
closely
resemble that of corresponding non-diseased bone (that is a corresponding bone
of the same
type, e.g., long, vertebral, etc.) in a non-diseased state.
Leptin receptor antagonist, as used herein, refers to a factor which
neutralizes or
impedes or otherwise reduces the action or effect of a leptin receptor. Such
antagonists can
include compounds that bind leptin or that bind leptin receptor. Such
antagonists can also
include compounds that neutralize, impede or otherwise reduce leptin receptor
output, that is,
intracellular steps in the leptin signaling pathway following binding of
leptin to the leptin
receptor, i.e., downstream events that affect leptin/leptin receptor
signaling, that do not occur
at the receptor/ligand interaction level. Leptin receptor antagonists may
include, but are not
limited to proteins, antibodies, small organic molecules or carbohydrates,
such as, for
example, acetylphenol compounds, antibodies which specifically bind leptin,
antibodies
which specifically bind leptin receptor, and compounds that comprise soluble
leptin receptor
polypeptide sequences.
Leptin receptor agonist, as used herein, refers to a factor which activates,
induces or
otherwise increases the action or effect of a leptin receptor. Such agonists
can include
12
CA 02376933 2001-12-11
WO 00/76552 PCT/L1S00/15911
compounds that bind leptin or that bind leptin receptor. Such antagonists can
also include
compounds that activate, induce or otherwise increase leptin receptor output,
that is,
intracellular steps in the leptin signaling pathway following binding of
leptin to the leptin
receptor, i. e. , downstream events that affect leptin/leptin receptor
signaling, that do not occur
at the receptor/ligand interaction level. Leptin receptor agonists may
include, but are not
limited to proteins, antibodies, small organic molecules or carbohydrates,
such as, for
example, leptin, leptin analogs, and antibodies which specifically bind and
activate leptin.
An agent is said to be administered in a "therapeutically effective amount" if
the
amount administered results in a desired change in the physiology of a
recipient mammal,
e.g., results in an increase or decrease in bone mass relative to that of a
corresponding bone in
the diseased state; that is, results in treatment, i.e., modulates bone mass
to more closely
resemble that of corresponding non-diseased bone (that is a corresponding bone
of the same
type, e.g., long, vertebral, etc.) in a non-diseased state.
ECD, as used herein, refers to extracellular domain.
TM, as used herein, refers to transmembrane domain.
CD, as used herein, refers to cytoplasmic domain.
4 BRIEF DESCRIPTION OF THE FIGURES
Figures lA-1F. High bone mass phenotype in ob/ob and db/db mice. In Figure 1A,
an X-ray analysis of vertebrae (vert.) and long bones (femurs) of 6 month-old
wild-type (wt)
and ob/ob mice is shown. Figure 1B demonstrates a histological analysis of
bones of 3
month-old (3m.) and 6 month-old (6m.) wt and ob/ob mice. The two upper panels
demonstrate analysis of vertebrae, and the two bottom panels demonstrate long
bones.
Mineralized bone matrix is stained in black by the von Kossa reagent. Figure 1
C shows
quantification of the increase in bone volume in ob/ob mice. BV/TV, bone
volume over
trabecular volume. Grey bars, wt mice; black bars, ob/ob mice. Figure 1 D
illustrates a three
points bending analysis of femur from wild-type (wt), ob/ob and wild-type
ovariectomized
(wt-OVX) mice. Figure 1E is a histological analysis of vertebrae of 6 month-
old wt and
db/db mice. Figure 1 F is a quantification of the increase in bone volume in
db/db mice.
Asterisks indicate a statistically significant difference between two groups
of mice (p<0.05).
Error bars represent standard error of the mean (SEM).
13
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Figure 2A-2D. High bone mass phenotype of the ob/ob mice is due to leptin
deficiency, not to obesity. Figure 2A demonstrates histological analysis of
vertebrae of 1
month-old wt (wt 1 mo) and ob/ob mice fed a low fat diet (ob/ob 1 mo LF diet).
Figure 2B is
a histological analysis of vertebrae of 3 month-old wt and ob/+ mice. Figure
2C is a
histological analysis of vertebrae of 6 month-old wt and Agouti yellow mutant
mice (A y/a).
Figure 2D is a histological analysis of vertebrae of 6 month-old wt mice fed a
normal diet or a
high fat (HF) diet. Underlined numbers indicate a statistically significant
difference between
experimental and control groups of mice (p<0.05).
Figures 3A-3H. Absence of leptin signaling causes an increase in osteoblast
function. In Figure 3A, calcein double labeling in 3-month-old wild-type (wt)
and ob/ob mice
is demonstrated. The distance between the two labels (white arrow) represents
the rate of
bone formation. In Figures 3B-3F, the rate of bone formation is increased in
ob/ob mice (B)
and db/db mice (D) 45% and 70%, respectively, compared to wt littermates. This
increase
occurs in the presence of a normal number of osteoblasts (Figures 3C and 3E),
and in spite of
the increased number of osteoclasts due to their hypogonadism (Figure 4F).
Empty bars, wt
mice; black bars, ob/ob mice; grey bars, db/db mice; 3m., 3-month-old animals;
6m., 6-
month-old animals. In Figure 4G, increased bone formation rate in fat
restricted 1-month-old
ob/ob mice and heterozygote ob/+ mice, which are not obese (see body weights
Figure 2A
and B) is shown. In Figure 3H, wt mice fed a high fat diet, or A y/a mice,
that are overweight
(see Figure 2C and D) but not leptin-deficient have a normal rate of bone
formation.
Asterisks indicate statistically significant differences compared to control
mice (p<0.05).
Error bars represent SEM.
Figures 4A-4E. Normal osteoclasts function in absence of leptin signaling. A
comparative analyses of wild-type (wt) and ob/ob mice whose hypogonadism has
been
corrected by 17 ~3-estradiol treatment (E2) or not corrected (P, placebo) are
shown. Figure 4A
demonstrates there is correction of the uterus atrophy of the ob/ob mice by
the 17 (3-estradiol
treatment. In Figures 4B through 4D there is histological analysis of
vertebrae showing that
17 ~i-estradiol treatment leads to a significant increase in bone trabeculae
in 17 ~i-estradiol
treated wt and even more in 17 (3-estradiol-treated ob/ob mice. Grey bars,
wild-type mice;
14
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
black bars, ob/ob mice; patterned bars, treated mice; solid bars, placebo
control mice.
Asterisks indicate a statistically significant difference between treated and
untreated mice
(p<0.05). Error bars represent SEM. In Figure 4E, there is shown normal
differentiation and
function of ob/ob and db/db osteoclasts ex-vivo. Marrow progenitors derived
from wt, ob/ob,
and db/db mice differentiate equally well in TRAP positive (TRAP+) osteoclasts
(upper panel
and bottom line). There is also no difference in their ability to form
resorption pits on a
dentin slice matrix (bottom panel).
Figures 5A-SF. Leptin does not signal in osteoblasts. Northern blot analysis
of leptin
expression in tissues and primary cells (non-mineralizing (NM) osteoblasts,
mineralizing (M)
osteoblasts and chondrocytes) (upper panel) is demonstrated in Figure SA.
Gapdh expression
was used as an internal control for loading (lower panel). Figure SB shows
that Oh-Rb (Ob-
receptor, type b) transcripts cannot be detected in long bones, calvaria and
primary osteoblasts
by RT-PCR while this message is detected in hypothalamus. Amplification of
Hprt was used
as an internal control for cDNA quality. Figure SC is a western blot analysis.
Induction by
oncostatin-M (OSM) was used as a positive control. In Figure SD, there is
Northern blot
analysis of immediate early gene expression (Tisll and c fos genes) upon
treatment of
primary osteoblast cultures with leptin or Oncostatin-M. Gapdh expression was
used as an
internal control for loading (lower panel). In Figure SE ex-vivo primary
osteoblast cultures
from wild-type mice maintained in the absence (vehicle) or presence of leptin
are shown. No
effect on collagen synthesis (upper panel, van Gieson staining) or matrix
mineralization
(lower panel, von Kossa staining) can be observed. In Figure SF normal
function of db/db
osteoblasts in ex vivo culture experiments is shown. Collagen synthesis (upper
panel, van
Gieson staining) and matrix mineralization (lower panel, von Kossa staining)
between
primary osteoblast cultures derived from wt and db/db mice are demonstrated.
Figure 6A-6C. Fat tissue is not required for the appearance of a high bone
mass
phenotype. In Figure 6A, there is shown histological analysis of vertebrae of
6 month~old wt
and A-ZIP/F-1 transgenic mice, that have no fat tissue. Bone volume (B) and
bone formation
rate (C) in the transgenic mice are illustrated. Asterisks indicate a
statistically significant
difference between wt and transgenic mice (p<O.OS). Error bars represent SEM.
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Figure 7A-7D. Leptin action on bone formation is mediated by a hypothalamic
relay.
In Figure 7A, there is a histological comparison of vertebrae of 4 month-old
ob/ob mice
infused centrally (third venticule) with PBS or leptin and wt mice. Bone
volume (B),
trabecular volume (C) and the rate of bone formation (D) are demonstrated.
Asterisks
indicate a statistically significant difference between PBS-infused and leptin-
infused mice
(p<O.OS). Error bars represent SEM.
Figure 8. Soluble leptin receptor causes increase in bone mass without
increase in
obesity. In Figure 8, male and female transgenic mice, containing the ApoE-
ObRe transgene,
were generated. At three months of age, these mice were compared with wild
type mice for
bone volume/total volume and body weight. The Figure demonstrates that,
although there
was not a significant increase in body weight at three months, there was a 50%
to 100°,%
increase in bone mass.
The drawings and figures are not necessarily to scale and certain features
mentioned
may be exaggerated in scale or shown in schematic form in the interest of
clarity and
conciseness.
5 DETAILED DESCRIPTION OF THE INVENTION
Various aspects of the present invention are presented in detail herein.
5.1 Leptin and Leptin Receptor Proteins, Polypeptides and Nucleic Acids
Leptin ("Ob") and leptin receptor ("ObR") proteins and nucleic acids (sense
and
antisense) can be utilized as part of the therapeutic, diagnostic, prognostic
and screening
methods of the present invention. For example, Ob and/or ObR proteins,
polypeptides and
peptide fragments, mutated, truncated or deleted forms of Ob or ObR,
including, but not
limited to, soluble derivatives such as peptides or polypeptides corresponding
to one or more
leptin receptor ECDs; truncated leptin receptor polypeptides lacking one or
more ECD or
TM; and leptin and leptin receptor fusion protein products (such as leptin
receptor-Ig fusion
proteins, that is, fusions of the leptin receptor or a domain of the leptin
receptor, to an IgFc
domain) can be utilized.
16
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Sequences of leptin and leptin receptor, including human leptin and leptin
receptors,
are well known. For a review of leptin receptor proteins, see Friedman and
Halaas, 1998,
Nature, 395:763-770. See, also, U.S. Patent No. 5,972,621. For leptin
sequences, including
human leptin coding sequences and leptin gene regulatory sequences, see, e.g.,
Zhang, Y., et
al., 1994, Nature 372:425-432; de la Brousse et al., 1996, PNAS 93:4096-4101;
He et al.,
1995, J. Biol. Chem. 270:28887-28891; Hwang et al., 1996, PNAS 93:873-877; and
Gong et
al., 1996, J. Biol Chem 271:3971-3974.
For example, peptides and polypeptides corresponding to Ob or to one or more
domains of the ObR (e.g., ECD, TM or CD), truncated or deleted Ob or ObRs
(e.g., ObR in
which the TM and/or CD is deleted) as well as fusion proteins in which the
full length Ob or
ObR, an Ob or ObR peptide or truncated Ob or ObR (e.g., an ObR ECD, TM or CD
domain)
is fused to a heterologous, unrelated protein are also within the scope of the
invention and can
be utilized and designed on the basis of such Ob and ObR nucleotide and Ob and
ObR amino
acid sequences which are known to those of skill in the art. Preferably,
leptin polypeptides
can bind leptin receptor under standard physiological and/or cell culture
conditions.
Likewise, preferably leptor receptor polypeptides can bind leptin under
standard
physiological and/or cell culture conditions. Thus, at a minimum, leptin
receptor polypeptides
comprise a leptin amino acid sequence sufficient for leptin receptor binding,
that is for
leptin/leptin receptor complex formation and likewise, at a minimum, leptin
receptor
polypeptides comprise a leptin receptor ECD sequence sufficient for leptin
binding.
With respect to ObR peptides, polypeptides, fusion peptides and fusion
polypeptides
comprising all or part of an ObR ECD, such peptides include soluble leptin
receptor
polypeptides. Preferably, such soluble leptin receptor polypeptides can bind
leptin under
standard physiological and/or cell culture conditions. Thus, at a minimum,
such soluble
leptin receptor polypeptides comprise an ObR ECD sequence sufficient for
leptin binding.
Fusion proteins include, but are not limited to, IgFc fusions which stabilize
the soluble
ObR protein or peptide and prolong half life in vivo; or fusions to any amino
acid sequence
that allows the fusion protein to be anchored to the cell membrane, allowing
the ECD to be
exhibited on the cell surface; or fusions to an enzyme, fluorescent protein,
or luminescent
protein which provide a marker or reporter function, useful e.g, in screening
and/or diagnostic
methods of the invention..
17
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
While the Ob and ObR polypeptides and peptides can be chemically synthesized
(e.g.,
see Creighton, 1983, Proteins: Structures and Molecular Principles, W. H.
Freeman & Co.,
N.Y.), large polypeptides derived from Ob and ObR and full length Ob and ObR
may
advantageously be produced by recombinant DNA technology using techniques well
known
in the art for expressing nucleic acid containing Ob and ObR gene sequences
and/or coding
sequences. 0b and ObR encoding polynucleotides does not refer only to
sequences encoding
open reading frames, but also to upstream and downstream sequences within the
Ob and ObR
genes. Such methods also can be used to construct expression vectors
containing the Ob and
ObR nucleotide sequences. These methods include, for example, in vitro
recombinant DNA
techniques, synthetic techniques, and in vivo genetic recombination. See,
Sambrook et al.,
1989, Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring
Harbor Press,
N.Y., and Ausabel et al., 1989, Current Protocols in Molecular Biology, Green
Publishing
Associates and Wiley Interscience, N.Y., each of which is incorporated herein
by reference in
its entirety. Alternatively, RNA capable of encoding Ob and ObR nucleotide
sequences may
be chemically synthesized using, for example, synthesizers. See, for example,
the techniques
described in "Oligonucleotide Synthesis", 1984, Gait, M. J. ed., IRL Press,
Oxford, which is
incorporated by reference herein in its entirety.
A variety of host-expression vector systems may be utilized to express the Ob
and
ObR nucleotide sequences of the invention. Where the Ob and ObR peptide or
polypeptide is
a soluble derivative (e.g., ObR peptides corresponding to the ECD; truncated
or deleted ObR
in which the TM and/or CD are deleted) the peptide or polypeptide can be
recovered from the
culture, ie., from the host cell in cases where the ObR peptide or polypeptide
is not secreted,
and from the culture media in cases where the ObR peptide or polypeptide is
secreted by the
cells. However, the expression systems also encompass engineered host cells
that express Ob
and ObR or functional equivalents in situ, i.e., anchored in the cell
membrane. Purification or
enrichment of Ob or ObR from such expression systems can be accomplished using
appropriate detergents and lipid micelles and methods well known to those
skilled in the art.
However, such engineered host cells themselves may be used in situations where
it is
important not only to retain the structural and functional characteristics of
Ob and ObR, but to
assess biological activity, e.g., in drug screening assays.
18
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
The expression systems that may be used for purposes of the invention include,
but
are not limited to, microorganisms such as bacteria (e.g., E. coli, B.
subtilis) transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors
containing Ob or ObR nucleotide sequences; yeast (e.g., Saccharomyces, Pichia)
transformed
with recombinant yeast expression vectors containing the nucleotide sequences;
insect cell
systems infected with recombinant virus expression vectors (e.g., baculovirus)
containing the
sequences; plant cell systems infected with recombinant virus expression
vectors (e.g.,
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with
recombinant plasmid expression vectors (e.g., Ti plasmid) containing the
nucleotide
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3) harboring
recombinant expression constructs containing promoters derived from the genome
of
mammalian cells (e.g., metallothionein promoter) or from mammalian viruses
(e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter).
In bacterial systems, a number of expression vectors may be advantageously
selected
depending upon the use intended for the Ob or ObR gene product being
expressed. For
example, when a large quantity of such a protein is to be produced, for the
generation of
pharmaceutical compositions of Ob or ObR protein or for raising antibodies to
Ob or ObR
protein, for example, vectors which direct the expression of high levels of
fusion protein
products that are readily purified may be desirable. Such vectors include, but
are not limited
to, the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J.
2:1791), in which the
Ob or ObR coding sequence may be ligated individually into the vector in frame
with the
lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye &
Inouye, 1985,
Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem.
264:5503-5509); and the like. pGEX vectors may also be used to express foreign
polypeptides as fusion proteins with glutathione S-transferase (GST). In
general, such fusion
proteins are soluble and can easily be purified from lysed cells by adsorption
to
glutathione-agarose beads followed by elution in the presence of free
glutathione. The PGEX
vectors are designed to include thrombin or factor Xa protease cleavage sites
so that the
cloned target gene product can be released from the GST moiety.
19
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
In an insect system, Autographs californica nuclear polyhidrosis virus (AcNPV)
is
used as a vector to express foreign genes. The virus grows in Spodoptera
frugiperda cells. The
Ob or ObR gene coding sequence may be cloned individually into non-essential
regions (for
example the.polyhedrin gene) of the virus and placed under control of an AcNPV
promoter
(for example the polyhedrin promoter). Successful insertion of an Ob or ObR
gene coding
sequence will result in inactivation of the polyhedrin gene and production of
non-occluded
recombinant virus, (i.e., virus lacking the proteinaceous coat coded for by
the polyhedrin
gene). These recombinant viruses are then used to infect Spodoptera frugiperda
cells in which
the inserted gene is expressed. (E.g., see Smith et al., 1983, J. Virol. 46:
584; Smith, U.S. Pat.
No. 4,215,051 ).
In mammalian host cells, a number of viral-based expression systems may be
utilized.
In cases where an adenovirus is used as an expression vector, the Ob or ObR
nucleotide
sequence of interest may be ligated to an adenovirus transcription/translation
control
complex, e.g., the late promoter and tripartite leader sequence. This chimeric
gene may then
be inserted in the adenovirus genome by in vitro or in vivo recombination.
Insertion in a
non-essential region of the viral genome (e.g., region E 1 or E3) will result
in a recombinant
virus that is viable and capable of expressing the Ob or ObR gene product in
infected hosts.
(E.g., See Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81:3655-3659).
Specific
initiation signals may also be required for efficient translation of inserted
Ob or ObR
nucleotide sequences. These signals include the ATG initiation codon and
adjacent
sequences. In cases where entire Ob or ObR genes or cDNAs, including their own
initiation
codons and adjacent sequences, are inserted into the appropriate expression
vector, no
additional translational control signals may be needed. However, in cases
where only a
portion of the coding sequence is inserted, exogenous translational control
signals, including,
perhaps, the ATG initiation codon, must be provided. Furthermore, the
initiation codon must
be in phase with the reading frame of the desired coding sequence to ensure
translation of the
entire insert. These exogenous translational control signals and initiation
codons can be of a
variety of origins, both natural and synthetic. The efficiency of expression
may be enhanced
by the inclusion of appropriate transcription enhancer elements, transcription
terminators, etc.
(See Bittner et al., 1987, Methods in Enzymol. 153:516-544).
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
In addition, a host cell strain may be chosen which modulates the expression
of the
inserted sequences, or modifies and processes the gene product in the specific
fashion desired.
Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of
protein products
may be important for the function of the protein. Different host cells have
characteristic and
specific mechanisms for the post-translational processing and modification of
proteins and
gene products. Appropriate cell lines or host systems can be chosen to ensure
the correct
modification and processing of the foreign protein expressed. To this end,
eukaryotic host
cells which possess the cellular machinery for proper processing of the
primary transcript,
glycosylation, and phosphorylation of the gene product may be used. Such
mammalian host
cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293,
3T3,
WI38, and in particular, choroid plexus cell lines.
For long-term, high-yield production of recombinant proteins, stable
expression is
preferred. For example, cell lines which stably express the Ob or ObR
sequences may be
engineered. Rather than using expression vectors which contain viral origins
of replication,
host cells can be transformed with DNA controlled by appropriate expression
control
elements (e.g., promoter, enhancer sequences, transcription terminators,
polyadenylation
sites, etc.), and a selectable marker. Following the introduction of the
foreign DNA,
engineered cells may be allowed to grow for 1-2 days in an enriched media, and
then are
switched to a selective media. The selectable marker in the recombinant
plasmid confers
resistance to the selection and allows cells to stably integrate the plasmid
into their
chromosomes and grow to form foci which in turn can be cloned and expanded
into cell lines.
This method may advantageously be used to engineer cell lines which express
the Ob or ObR
gene products. Such engineered cell lines may be particularly useful in
screening and
evaluation of compounds that affect the endogenous activity of Ob and ObR gene
products.
A number of selection systems may be used, including but not limited to, the
herpes
simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223),
hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci.
USA
48:2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell
22:817) genes can
be employed in tk-, hgprt~ or aprt- cells, respectively. Also, antimetabolite
resistance can be
used as the basis of selection for the following genes: dhfr, which confers
resistance to
methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et
al., 1981, Proc.
21
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic
acid
(Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which
confers resistance
to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol.
150:1); and hygro,
which confers resistance to hygromycin (Santerre, et al., 1984, Gene 30:147).
The Ob and ObR gene products can also be expressed in transgenic animals.
Animals
of any species, including, but not limited to, mice, rats, rabbits, guinea
pigs, pigs, micro-pigs,
goats, and non-human primates, e.g., baboons, monkeys, and chimpanzees may be
used to
generate the transgenic animals.
Any technique known in the art may be used to introduce the Ob or ObR
transgene
into animals or to "knock-out" or inactivate endogenous Ob or ObR to produce
the founder
lines of transgenic animals. Such animals can be utilized as part of the
screening methods of
the invention, and cells and/or tissues from such animals can be obtained for
generation of
additional compositions (e.g., cell lines, tissue culture systems) that can
also be utilized as
part of the screening methods of the invention.
Techniques for generation of such animals are well known to those of skill in
the art
and include, but are not limited to, pronuclear microinjection (Hoppe, P. C.
and Wagner, T.
E., 1989, tl.S. Pat. No. 4,873,191); retrovirus mediated gene transfer into
germ lines (Van der
Putten et al., 1985, Proc. Natl. Acad. Sci., USA 82:6148-6152); gene targeting
in embryonic
stem cells (Thompson et al., 1989, Cell 56:313-321); electroporation of
embryos (Lo, 1983,
Mol Cell. Biol. 3:1803-1814); and sperm-mediated gene transfer (Lavitrano et
al., 1989, Cell
57x717-723); etc. For a review of such techniques, see Gordon, 1989,
Transgenic Animals,
Intl. Rev. Cytol. 115:171-229, which is incorporated by reference herein in
its entirety.
With respect to transgenic animals containing a transgenic Ob and/or ObR, such
animals can carry an Ob or ObR transgene in all their cells. Alternatively,
such animals can
carry the transgene or transgenes in some, but not all their cells, i.e.,
mosaic animals. The
transgene may be integrated as a single transgene or in concatamers, e.g.,
head-to-head
tandems or head-to-tail tandems. The transgene may also be selectively
introduced into and
activated in a particular cell type by following, for example, the teaching of
Lasko et al.
(Lasko, M. et al., 1992, Proc. Natl.Acad. Sci. USA 89: 6232-6236). The
regulatory sequences
required for such a cell-type specific activation will depend upon the
particular cell type of
22
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
interest, and will be apparent to those of skill in the art. When it is
desired that the transgene
be integrated into the chromosomal site of the endogenous gene, gene targeting
is preferred.
Briefly, when such a technique is to be utilized, vectors containing some
nucleotide
sequences homologous to the endogenous Ob or ObR gene are designed for the
purpose of
integrating, via homologous recombination with chromosomal sequences, into and
disrupting
the function of the nucleotide sequence of the endogenous Ob or ObR gene,
respectively. The
transgene may also be selectively introduced into a particular cell type, thus
inactivating the
endogenous Ob or ObR gene in only that cell type, by following, for example,
the teaching of
Gu et al. (Gu, et al., 1994, Science 265: 103-106). The regulatory sequences
required for such
a cell-type specific inactivation will depend upon the particular cell type of
interest, and will
be apparent to those of skill in the art.
Once transgenic animals have been generated, the expression of the recombinant
gene
may be assayed utilizing standard techniques. Initial screening may be
accomplished by
Southern blot analysis or PCR techniques to analyze animal tissues to assay
whether
integration of the transgene has taken place. The level of mRNA expression of
the transgene
in the tissues of the transgenic animals may also be assessed using techniques
which include,
but are not limited to, Northern blot analysis of tissue samples obtained from
the animal, m
situ hybridization analysis, and RT-PCR. Samples of Ob and ObR gene-expressing
tissue,
may also be evaluated immunocytochemically using antibodies specific for the
transgene
product.
5.1.1 Antibodies to Ob and ObR Proteins
Antibodies that specifically recognize and bind to one or more epitopes of Ob
or ObR,
or epitopes of conserved variants of Ob or ObR, or peptide fragments of Ob or
ObR can be
utilized as part of the methods of the present invention. Such antibodies
include, but are not
limited to, polyelonal antibodies, monoclonal antibodies (mAbs), human,
humanized or
ehimeric antibodies, single chain antibodies, Fab fragments, F(ab'),
fragments, fragments
produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies and
epitope-binding
fragments of any of the above.
Such antibodies may be used, for example, as part of the diagnostic or
prognostic
methods of the invention for diagnosing a bone disease in a mammal by
measuring leptin
23
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
levels in the mammal, e.g., leptin levels in blood serum or cerebrospinal
fluid of the mammal.
Such antibodies may also be utilized in conjunction with, for example,
compound screening
schemes, as described below, for the evaluation of the effect of test
compounds on expression
and/or activity of the Ob or ObR gene product. Additionally, such antibodies
can be used in
therapeutic and preventative methods of the invention. For example, such
antibodies can
correspond to leptin receptor agonists or antagonists. Further, such
antibodies can be
administered to lower leptin levels in the brain, as assayed by leptin levels
in cerebrospinal
fluid. In addition, such antibodies can be utilized to lower leptin levels by
increasing the rate
at which leptin is removed from circulation (e.g., can speed leptin
breakdown), or can be used
to lower leptin receptor levels, including lowering cells expressing leptin
receptor, by
increasing the rate at which leptin receptor (and cells expressing leptin
receptor) breaks down
or is degraded.
For the production of antibodies, various host animals may be immunized by
injection
with Ob or ObR, an Ob or ObR peptide (e.g., for ObR, one corresponding with a
functional
domain of the receptor, such as ECD, TM or CD), truncated Ob or ObR
polypeptides (e.g.,
for ObR, in which one or more domains, e.g., the TM or CD, has been deleted),
functional
equivalents of Ob or ObR or mutants of Ob or ObR. Such host animals may
include, but are
not limited to, rabbits, mice, and rats, to name but a few. Various adjuvants
may be used to
increase the immunological response, depending on the host species, including
but not
limited to, Freund's (complete and incomplete), mineral gels such as aluminum
hydroxide,
surface active substances such as lysolecithin, pluronic polyols, polyanions,
peptides, oil
emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful
human
adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
Polyclonal
antibodies are heterogeneous populations of antibody molecules derived from
the sera of the
immunized animals.
Monoclonal antibodies, which are homogeneous populations of antibodies to a
particular antigen, may be obtained by any technique which provides for the
production of
antibody molecules by continuous cell lines in culture. These include, but are
not limited to,
the hybridoma technique of Kohler and Milstein, (1975, Nature 256:495-497; and
U.S. Pat.
No. 4,376,110), the human B-cell hybridoma technique (Kosbor et al., 1983,
Immunology
Today 4:72; Cole et al., 1983, Proc. Natl. Acad. Sci. USA 80:2026-2030), and
the
24
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies And Cancer
Therapy,
Alan R. Liss, Inc., pp. 77-96). Such antibodies may be of any immunoglobulin
class
including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma
producing the
mAb of this invention may be cultivated in vitro or in vivo. Production of
high titers of mAbs
in vivo makes this the presently preferred method of production.
Additionally, recombinant antibodies, such as chimeric and humanized
monoclonal
antibodies, comprising both human and non-human portions, which can be made
using
standard recombinant DNA techniques, are within the scope of the invention. A
chimeric
antibody is a molecule in which different portions are derived from different
animal species,
such as those having a variable region derived from a marine mAb and a human
immunoglobulin constant region. (See, e.g., Cabilly et al., U.S. Patent No.
4,816,567; and
Boss et al., U.S. Patent No. 4,816397, which are incorporated herein by
reference in their
entirety.) Humanized antibodies are antibody molecules from non-human species
having one
or more complementarily determining regions (CDRs) from the non-human species
and a
framework region from a human immunoglobulin molecule. (See, e.g., Queen, U.S.
Patent
No. 5,585,089, which is incorporated herein by reference in its entirety.)
Such chimeric and
humanized monoclonal antibodies can be produced by recombinant DNA techniques
known
in the art, for example using methods described in PCT Publication No. WO
87/02671;
European Patent Application 184,187; European Patent Application 171,496;
European
Patent Application 173,494; PCT Publication No. WO 86/01533; U.S. Patent No.
4,816,567;
European Patent Application 125,023; Better et al. (1988) Science 240:1041-
1043; Liu et al.
(1987) Proc. Natl. Acad. Sci. USA 84:3439-3443; Liu et al. (1987) J. Immunol.
139:3521-3526; Sun et al. (1987) Proc. Natl. Acad. Sci. USA 84:214-218;
Nishimura et al.
(1987) Canc. Res. 47:999-1005; Wood et al. (1985) Nature 314:446-449; and Shaw
et al.
(1988) J. Natl. Cancer Inst. 80:1553-1559); Morrison (1985) Science 229:1202-
1207; Oi et
al. (1986) BiolTechniques 4:214; U.S. Patent 5,225,539; Jones et al. (1986)
Nature
321:552-525; Verhoeyan et al. (1988) Science 239:1534; and Beidler et al.
(1988) J.
Immunol. 141:4053-4060.
Completely human antibodies are particularly desirable for therapeutic
treatment of
human patients. Such antibodies can be produced, for example, using transgenic
mice which
are incapable of expressing endogenous immunoglobulin heavy and light chains
genes, but
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
which can express human heavy and light chain genes. The transgenic mice are
immunized
in the normal fashion with a selected antigen, e.g., all or a portion of a
polypeptide of the
invention. Monoclonal antibodies directed against the antigen can be obtained
using
conventional hybridoma technology. The human immunoglobulin transgenes
harbored by the
transgenic mice rearrange during B cell differentiation, and subsequently
undergo class
switching and somatic mutation. Thus, using such a technique, it is possible
to produce
therapeutically useful IgG, IgA and IgE antibodies. For an overview of this
technology for
producing human antibodies, see Lonberg and Huszar (1995, Int. Rev. Immunol.
13:65-93).
For a detailed discussion of this technology for producing human antibodies
and human
monoclonal antibodies and protocols for producing such antibodies, see, e.g.,
U.S. Patent
5,625,126; U.S. Patent 5,633,425; U.S. Patent 5,569,825; U.S. Patent
5,661,016; and U.S.
Patent 5,545,806. In addition, companies such as Abgenix, Inc. (Fremont, CA),
can be
engaged to provide human antibodies directed against a selected antigen using
technology
similar to that described above.
Completely human antibodies which recognize a selected epitope can be
generated
using a technique referred to as "guided selection." In this approach a
selected non-human
monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of
a completely
human antibody recognizing the same epitope. (Jespers et al. ( 1994)
Bioltechnology
12:899-903).
Alternatively, techniques described for the production of single chain
antibodies (U.S.
Pat. No. 4,946,778; Bird, 1988, Science 242:423-426; Huston et al., 1988,
Proc. Natl. Acad.
Sci. USA 85:5879-5883; and Ward et al., 1989, Nature 334:544-546) can be
adapted to
produce single chain antibodies against Ob and ObR gene products. Single chain
antibodies
are formed by linking the heavy and light chain fragments of the Fv region via
an amino acid
bridge, resulting in a single chain polypeptide.
Antibody fragments which recognize specific epitopes may be generated by known
techniques. For example, such fragments include, but are not limited to: the
F(ab'), fragments
which can be produced by pepsin digestion of the antibody molecule and the Fab
fragments
which can be generated by reducing the disulfide bridges of the F(ab')z
fragments.
Alternatively, Fab expression libraries may be constructed (Huse et al., 1989,
Science,
26
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
246:1275-1281) to allow rapid and easy identification of monoclonal Fab
fragments with the
desired specificity.
Antibodies to Ob or ObR can, in turn, be utilized to generate anti-idiotype
antibodies
that "mimic" Ob or ObR, using techniques well known to those skilled in the
art. (See, e.g.,
Greenspan & Bona, 1993, FASEB J 7(5):437-444; and Nissinoff, 1991, J. Immunol.
147(8):2429-2438). For example, antibodies which bind to the ObR ECD and
competitively
inhibit the binding of Ob to the ObR can be used to generate anti-idiotypes
that "mimic" the
ECD and, therefore, bind and neutralize Ob. Such neutralizing anti-idiotypes
or Fab
fragments of such anti-idiotypes can be used in therapeutic regimens to
neutralize Ob and
treat bone disease characterized by a decreased bone mass relative to a
corresponding non-
diseased bone.
5.2 Diagnosis and Prognosis of Bone Disease and Comnound/Patient
Monitoring
A variety of methods can be employed for the diagnostic and prognostic
evaluation of
bone diseases or states, including, but not limited to, osteoporosis,
osteopenia, faulty bone
formation or resorption, Paget's disease, fractures and broken bones, bone
metastasis,
osteopetrosis, osteosclerosis and osteochondrosis and for the identification
of subjects having
a predisposition to such diseases or states.
In particular, bone diseases which can be diagnosed or prognosed in accordance
with
the present invention include bone diseases characterized by a decreased bone
mass relative
to that of corresponding non-diseased bone; including, but not limited to
osteoporosis,
osteopenia and Paget's disease.
Thus, in accordance with this aspect of the present invention, there is a
method of
diagnosing or prognosing a bone disease in a mammal, such as a human,
comprising:
(a) measuring leptin levels in blood serum of a mammal, e.g., a mammal
suspected of exhibiting or being at risk for the bone disease; and
(b) comparing the level measured in (a) to the leptin level in control blood
3 0 serum,
27
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
so that if the level obtained in (a) is higher than that of the control, the
mammal is diagnosed
as exhibiting or being at risk for the bone disease, wherein the bone disease
is characterized
by a decreased bone mass relative to that of corresponding non-diseased bone.
Alternatively, there is a method of diagnosing or prognosing a bone disease in
a
mammal, such as a human, comprising:
(a) measuring leptin levels in cerebrospinal fluid of a mammal, e.g., a
mammal suspected of exhibiting or being at risk for the bone disease;
and
(b) comparing the level measured in (a) to the leptin level in control
cerebrospinal fluid,
so that if the level obtained in (a) is higher than that of the control, the
mammal is diagnosed
as exhibiting or being at risk for the bone disease, wherein the bone disease
is characterized
by a decreased bone mass relative to that of corresponding non-diseased bone.
Further, bone diseases which can be diagnosed or prognosed in accordance with
the
present invention also include bone diseases characterized by an increased
bone mass relative
to that of corresponding non-diseased bone, including, but not limited to
osteopetrosis,
osteosclerosis and osteochondrosis.
Thus, in accordance with this aspect of the present invention, there is a
method of
diagnosing or prognosing a bone disease in a mammal, such as a human,
comprising:
(a) measuring leptin levels in blood serum of a mammal, e.g., a mammal
suspected of exhibiting or being at risk for the bone disease; and
(b) comparing the level measured in (a) to the leptin level in control blood
serum,
so that if the level obtained in (a) is lower than that of the control, the
mammal is diagnosed
as exhibiting or being at risk for the bone disease, wherein the bone disease
is characterized
by an increased bone mass relative to that of corresponding non-diseased bone.
Alternatively, there is a method of diagnosing or prognosing a bone disease in
a
mammal, such as a human, comprising:
(a) measuring leptin levels in cerebrospinal fluid of a mammal, e.g., a
mammal suspected of exhibiting or being at risk for the bone disease;
and
28
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
(b) comparing the level measured in (a) to the leptin level in control
cerebrospinal fluid,
so that if the level obtained in (a) is lower than that of the control, the
mammal is diagnosed
as exhibiting or being at risk for the bone disease, wherein the bone disease
is characterized
by an increased bone mass relative to that of corresponding non-diseased bone.
Additionally, methods are provided for the diagnostic monitoring of patients
undergoing clinical evaluation for the treatment of bone disease, and for
monitoring the
efficacy of compounds in clinical trials.
Thus, yet another aspect of the present invention, there is a method of
monitoring
efficacy of a compound for treating a bone disease in a mammal, such as a
human,
comprising:
(a) administering the compound to a mammal;
(b) measuring leptin levels in blood serum of the mammal; and
1 S (c) comparing the level measured in (b) to the leptin level in blood serum
of the mammal prior to administering the compound,
thereby monitoring the efficacy of the compound, wherein the bone disease is
characterized
by a decreased bone mass relative to that of corresponding non-diseased bone.
Preferred
compounds are ones that increase leptin levels relative to that observed prior
to
administration.
In accordance with another aspect of the present invention, there is a method
of
monitoring efficacy of a compound for treating a bone disease in a mammal,
such as a human,
comprising:
(a) administering the compound to a mammal;
(b) measuring leptin levels in cerebrospinal fluid of the mammal; and
(c) comparing the level measured in (b) to the leptin level in cerebrospinal
fluid of the mammal prior to administering the compound,
thereby monitoring the efficacy of the compound, wherein the bone disease is
characterized
by a decreased bone mass relative to that of corresponding non-diseased bone.
Preferred
compounds are ones that increase leptin levels relative to that observed prior
to
administration.
29
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
In accordance with yet another aspect of the present invention, there is a
method of
monitoring efficacy of a compound for treating a bone disease in a mammal,
such as a human,
comprising:
(a) administering the compound to a mammal;
(b) measuring leptin levels in blood serum of the mammal; and
(c) comparing the level measured in (b) to the leptin level in blood serum
of the mammal prior to administering the compound,
thereby monitoring the efficacy of the compound, wherein the bone disease is
characterized
by a increased bone mass relative to that of corresponding non-diseased bone.
Preferred
compounds are ones that decrease leptin levels relative to that observed prior
to
administration.
In accordance with another aspect of the present invention, there is a method
of
monitoring efficacy of a compound for treating a bone disease in a mammal,
such as a human,
comprising:
(a) administering the compound to a mammal;
(b) measuring leptin levels in cerebrospinal fluid of the mammal; and
(c) comparing the level measured in (b) to the leptin level in cerebrospinal
fluid of the mammal prior to administering the compound,
thereby monitoring the efficacy of the compound, wherein the bone disease is
characterized
by a increased bone mass relative to that of corresponding non-diseased bone.
Preferred
compounds are ones that decrease leptin levels relative to that observed prior
to
administration.
Methods such as these can also be utilized for monitoring of patients
undergoing
lcinical evaluation for treatment of bone disease. Generally, such methods
further include a
monitoring of bone mass relative to a corresponding non-diseased bone.
Methods described herein may, for example, utilize reagents such as the Ob and
ObR
nucleotide sequences described above and known to those of skill in the art
(See, e.g., U.S.
Patent No. 5,972,621 ), and Ob and ObR antibodies, as described, in Section
5.1.1. 0b is
typically expressed within adipocytes, and lower levels are also found in the
stomach and in
lymphocytes. ObR is typically expressed in the brain within the hypothalamus.
Friedman
and Halaas, 1998, Nature, 395:763-770. As such, such reagents may be used, for
example,
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
for: ( 1 ) the detection of the presence of Ob and ObR gene mutations, or the
detection of either
over- or under-expression of Ob or ObR mRNA relative to the non-bone diseased
states, e.g.,
in a mammal's blood serum or in cerebrospinal fluid; (2) the detection of
either an over- or an
under-abundance of Ob or ObR gene product relative to the non-bone diseased
states, e.g., in
a mammal's blood serum or in cerebrospinal fluid; and (3) the detection of
perturbations or
abnormalities in the signal transduction pathway mediated by Ob or ObR.
Alternatively,
levels of phosphorylation of Stat3 protein can be measured relative to levels
observed in a
corresponding control sample or mammal. Stat3 phosphorylation is a biochemical
event
which occurs following binding of leptin to the leptin receptor. Devos et al.,
1997, JBC,
272:18304-18310.
The methods described herein may be performed in conjunction with, prior to,
or
subsequent to techniques for measuring bone mass. For example, upon
identifying a mammal
(e.g., human) exhibiting higher or lower levels of leptin (e.g., in blood
serum or cerebospinal
fluid) relative to that of a corresponding control sample, bone mass of the
individual can be
measured to further clarify whether the mammal exhibits increased or decreased
bone mass
relative to a corresponding non-diseased bone. If no abnormal bone mass is
observed, the
mammal can be considered to be at risk for developing disease, while is an
abnormal bone
mass is observed, the mammal exhibits the bone disease.
Among the techniques well known to those of skill in the art for measuring
bone mass
are ones that include, but are not limited to, skeletal X-ray, which shows the
lucent level of
bone (the lower the lucent level, the higher the bone mass); classical bone
histology (e.g.,
bone vlume, number and aspects of trabiculi/trabiculations, numbers of
osteoblast relative to
controls and/or relative to osteoclasts); and dual energy X-ray absorptiometry
(DEXA) (Levis
and Altman, 1998, Arthritis and Rheumatism, 41:577-587) which measures bone
mass and is
commonly used in osteoporosis.
The methods described herein may further be used to diagnose individuals at
risk for
bone disease. Such individuals include, but are not limited to, peri-
menopausal women (as
used herein, this tem is meant to encompass a time frame from approximately 6
months prior
to the onset of menopause to approximately 18 months subsequent to menopause)
and
patients undergoing treatment with corticosteroids, especially long-term
corticosteroid
treatment..
31
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
The methods described herein may be performed, for example, by utilizing
pre-packaged diagnostic kits comprising at least one specific Ob or ObR
nucleotide sequence
or Ob or ObR antibody reagent, which may be conveniently used, e.g., in
clinical settings, to
diagnose patients exhibiting bone diseases.
For the detection of Ob or ObR mutations, any nucleated cell can be used as a
starting
source for genomic nucleic acid. For the detection of Ob or ObR gene
expression or gene
products, any cell type or tissue in which the Ob or ObR gene is expressed,
such as, for
example, choroid plexus cells for the ObR, may be utilized.
Nucleic acid-based detection techniques are described below, in Section 5.2.1.
Peptide detection techniques are described below, in Section 5.2.2.
5.2.1 Detection of Ob and ObR Gene and Transcripts
Mutations within the Ob and ObR gene can be detected by utilizing a number of
techniques. Nucleic acid from any nucleated cell can be used as the starting
point for such
assay techniques, and may be isolated according to standard nucleic acid
preparation
procedures which are well known to those of skill in the art.
DNA may be used in hybridization or amplification assays of biological samples
to
detect abnormalities involving Ob or ObR gene structure, including point
mutations,
insertions, deletions and chromosomal rearrangements. Such assays may include,
but are not
limited to, Southern analyses, single stranded conformational polymorphism
analyses
(SSCP), and PCR analyses.
Such diagnostic methods for the detection of Ob or ObR gene-specific mutations
can
involve for example, contacting and incubating nucleic acids including
recombinant DNA
molecules, cloned genes or degenerate variants thereof, obtained from a
sample, e.g., derived
from a patient sample or other appropriate cellular source, with one or more
labeled nucleic
acid reagents including recombinant DNA molecules, cloned genes or degenerate
variants
thereof, under conditions favorable for the specific annealing of these
reagents to their
complementary sequences within the Ob or ObR gene, respectively. Preferably,
the lengths
of these nucleic acid reagents are at least 15 to 30 nucleotides. After
incubation, all
non-annealed nucleic acids are removed from the nucleic acid:Ob/ObR molecule
hybrid. The
presence of nucleic acids which have hybridized, if any such molecules exist,
is then detected.
32
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Using such a detection scheme, the nucleic acid from the cell type or tissue
of interest can be
immobilized, for example, to a solid support such as a membrane, or a plastic
surface such as
that on a microtiter plate or polystyrene beads. In this case, after
incubation, non-annealed,
labeled nucleic acid reagents are easily removed. Detection of the remaining,
annealed,
labeled Ob or ObR nucleic acid reagents is accomplished using standard
techniques
well-known to those in the art. The Ob or ObR gene sequences to which the
nucleic acid
reagents have annealed can be compared to the annealing pattern expected from
a normal Ob
or ObR gene sequence in order to determine whether an Ob or ObR gene mutation
is present.
Alternative diagnostic methods for the detection of Ob or ObR gene specific
nucleic
acid molecules, in patient samples or other appropriate cell sources, may
involve their
amplification, e.g., by PCR (the experimental embodiment set forth in Mullis,
K. B., 1987,
U.S. Pat. No. 4,683,202), followed by the detection of the amplified molecules
using
techniques well known to those of skill in the art. The resulting amplified
sequences can be
compared to those which would be expected if the nucleic acid being amplified
contained
only normal copies of the Ob or ObR gene in order to determine whether an Ob
or ObR gene
mutation exists.
Additionally, well-known genotyping techniques can be performed to identify
individuals carrying Ob or ObR gene mutations. Such techniques include, for
example, the
use of restriction fragment length polymorphisms (RFLPs), which involve
sequence
variations in one of the recognition sites for the specific restriction enzyme
used.
Additionally, improved methods for analyzing DNA polymorphisms which can be
utilized for the identification of Ob or ObR gene mutations have been
described which
capitalize on the presence of variable numbers of short, tandemly repeated DNA
sequences
between the restriction enzyme sites. For example, Weber (U.S. Pat. No.
5,075,217, which is
incorporated herein by reference in its entirety) describes a DNA marker based
on length
polymorphisms in blocks of (dC-dA)n-(dG-dT)n short tandem repeats. The average
separation of (dC-dA)n-(dG-dT)n blocks. is estimated to be 30,000-60,000 bp.
Markers which
are so closely spaced exhibit a high frequency co-inheritance, and axe
extremely useful in the
identification of genetic mutations, such as, for example, mutations within
the Ob or ObR
gene, and the diagnosis of diseases and disorders related to Ob or ObR
mutations.
33
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Also, Caskey et al. (U.S. Pat. No. 5,364,759, which is incorporated herein by
reference in its entirety) describe a DNA profiling assay for detecting short
tri and tetra
nucleotide repeat sequences. The process includes extracting the DNA of
interest, such as the
Ob or ObR gene, amplifying the extracted DNA, and labeling the repeat
sequences to form a
genotypic map of the individual's DNA.
The level of Ob or ObR gene expression can also be assayed by detecting and
measuring Ob or ObR transcription, respectively. For example, RNA from a cell
type or
tissue known, or suspected to express the Ob or ObR gene, such as brain,
especially choroid
plexus cells, may be isolated and tested utilizing hybridization or PCR
techniques such as are
described, above. The isolated cells can be derived from cell culture or from
a patient. The
analysis of cells taken from culture may be a necessary step in the assessment
of cells to be
used as part of a cell-based gene therapy technique or, alternatively, to test
the effect of
compounds on the expression of the Ob or ObR gene. Such analyses may reveal
both
quantitative and qualitative aspects of the expression pattern of the Ob or
ObR gene,
including activation or inactivation of Ob or ObR gene expression.
In one embodiment of such a detection scheme, cDNAs are synthesized from the
RNAs of interest (e.g., by reverse transcription of the RNA molecule into
cDNA). A
sequence within the cDNA is then used as the template for a nucleic acid
amplification
reaction, such as a PCR amplification reaction, or the like. The nucleic acid
reagents used as
synthesis initiation reagents (e.g., primers) in the reverse transcription and
nucleic acid
amplification steps of this method are chosen from among Ob and ObR nucleic
acid reagents
which are well known to those of skill in the art. The preferred lengths of
such nucleic acid
reagents are at least 9-30 nucleotides. For detection of the amplified
product, the nucleic acid
amplification may be performed using radioactively or non-radioactively
labeled nucleotides.
Alternatively, enough amplified product may be made such that the product may
be
visualized by standard ethidium bromide staining or by utilizing any other
suitable nucleic
acid staining method.
Additionally, it is possible to perform such Ob and ObR gene expression assays
"in
situ", ie., directly upon tissue sections (fixed and/or frozen) of patient
tissue obtained from
biopsies or resections, such that no nucleic acid purification is necessary.
Nucleic acid
reagents which are well known to those of skill in the art may be used as
probes and/or
34
CA 02376933 2001-12-11
WO 00/76552 PCTNS00/15911
primers for such in situ procedures (See, for example, Nuovo, G. J., 1992,
"PCR In situ
Hybridization: Protocols And Applications", Raven Press, NY).
Alternatively, if a sufficient quantity of the appropriate cells can be
obtained, standard
Northern analysis can be performed to determine the level of mRNA expression
of the Ob
and ObR gene.
5.2.2 Detection of Ob and ObR Gene Products
Antibodies directed against wild type or mutant Ob or ObR gene products or
conserved variants or peptide fragments thereof, which are discussed, above,
in Section 5.1.1,
may also be used as diagnostics and prognostics for bone disease, as described
herein. Such
diagnostic methods may be used to detect abnormalities in the level of Ob or
ObR gene
expression, or abnormalities in the structure and/or temporal, tissue,
cellular, or subcellular
location of Ob or ObR, and may be performed in vivo or in vitro, such as, for
example, on
biopsy tissue.
For example, antibodies directed to epitopes of the ObR ECD or Ob can be used
in
vivo to detect the pattern and level of expression of the ObR or Ob in the
body. Such
antibodies can be labeled, e.g., with a radio-opaque or other appropriate
compound and
injected into a subject in order to visualize binding to ObR or Ob expressed
in the body using
methods such as X-rays, CAT-scans, or MRI. Labeled antibody fragments, e.g.,
the Fab or
single chain antibody comprising the smallest portion of the antigen binding
region, are
preferred for this purpose to promote crossing the blood-brain barrier and
permit labeling
ObRs expressed in the brain.
Additionally, any Ob or ObR fusion protein or Ob or ObR conjugated protein
whose
presence can be detected, can be administered. For example, Ob or ObR fusion
or conjugated
proteins labeled with a radio-opaque or other appropriate compound can be
administered and
visualized in vivo, as discussed, above for labeled antibodies. Further such
fusion proteins can
be utilized for in vitro diagnostic procedures.
Alternatively, immunoassays or fusion protein detection assays, as described
above,
can be utilized on biopsy and autopsy samples in vitro to permit assessment of
the expression
pattern of Ob or ObR. Such assays are not confined to the use of antibodies
that define any
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
particular epitope of Ob or ObR. The use of these labeled antibodies will
yield useful
information regarding translation and intracellular transport of Ob and ObR to
the cell
surface, and can identify defects in processing.
The tissue or cell type to be analyzed will generally include those which are
known, or
S suspected, to express the Ob or ObR gene, such as, for example, the
hypothalamus and
choroid plexus cells for ObR; and adipocytes for Ob. The protein isolation
methods employed
herein may, for example, be such as those described in Harlow and Lane
(Harlow, E. and
Lane, D., 1988, "Antibodies: A Laboratory Manual", Cold Spring Harbor
Laboratory Press,
Cold Spring Harbor, N.Y.), which is incorporated herein by reference in its
entirety. The
isolated cells can be derived from cell culture or from a patient. The
analysis of cells taken
from culture may be a necessary step in the assessment of cells that could be
used as part of a
cell-based gene therapy technique or, alternatively, to test the effect of
compounds on the
expression of the Ob or ObR gene.
For example, antibodies, or fragments of antibodies, such as those described,
above,
in Section 5.1.1, useful in the present invention may be used to
quantitatively or qualitatively
detect the presence of Ob or ObR gene products or conserved variants or
peptide fragments
thereof. This can be accomplished, for example, by immunofluorescence
techniques
employing a fluorescently labeled antibody (see below, this Section) coupled
with light
microscopic, flow cytometric, or fluorimetric detection. Such techniques are
especially
preferred if such Ob or ObR gene products are expressed on the cell surface.
The antibodies (or fragments thereof) or Ob or ObR fusion or conjugated
proteins
useful in the present invention may, additionally, be employed histologically,
as in
immunofluorescence, immunoelectron microscopy or non-immuno assays, for in
situ
detection of Ob and ObR gene products or conserved variants or peptide
fragments thereof, or
for Ob binding (in the case of labeled Ob fusion protein).
In situ detection may be accomplished by removing a histological specimen from
a
patient, and applying thereto a labeled antibody or fusion protein of the
present invention.
The antibody (or fragment) or fusion protein is preferably applied by
overlaying the labeled
antibody (or fragment) onto a biological sample. Through the use of such a
procedure, it is
possible to determine not only the presence of the Ob or ObR gene product, or
conserved
variants or peptide fragments, or Ob binding, but also its distribution in the
examined tissue.
36
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Using the present invention, those of ordinary skill will readily perceive
that any of a wide
variety of histological methods (such as staining procedures) can be modified
in order to
achieve such in situ detection.
Immunoassays and non-immunoassays for Ob and ObR gene products or conserved
variants or peptide fragments thereof will typically comprise incubating a
sample, such as a
biological fluid (e.g., blood serum or cerebrospinal fluid), a tissue extract,
freshly harvested
cells, or lysates of cells which have been incubated in cell culture, in the
presence of a
detectably labeled antibody capable of identifying Ob or ObR gene products or
conserved
variants or peptide fragments thereof, and detecting the bound antibody by any
of a number
of techniques well-known in the art.
The biological sample may be brought in contact with and immobilized onto a
solid
phase support or carrier such as nitrocellulose, or other solid support which
is capable of
immobilizing cells, cell particles or soluble proteins. The support may then
be washed with
suitable buffers followed by treatment with the detectably labeled Ob or ObR
antibody or Ob
1 ~ or ObR fusion protein. The solid phase support may then be washed with the
buffer a second
time to remove unbound antibody or fusion protein. The amount of bound label
on solid
support may then be detected by conventional means.
By "solid phase support or carrier" is intended any support capable of binding
an
antigen or an antibody. Well-known supports or carriers include glass,
polystyrene,
polypropylene, polyethylene, dextran, nylon, amylases, natural and modified
celluloses,
polyacrylamides, gabbros, and magnetite. The nature of the carrier can be
either soluble to
some extent or insoluble for the purposes of the present invention. The
support material may
have virtually any possible structural configuration so long as the coupled
molecule is
capable of binding to an antigen or antibody. Thus, the support configuration
may be
spherical, as in a bead, or cylindrical, as in the inside surface of a test
tube, or the external
surface of a rod. Alternatively, the surface may be flat such as a sheet, test
strip, etc. Preferred
supports include polystyrene beads. Those skilled in the art will know many
other suitable
carriers for binding antibody or antigen, or will be able to ascertain the
same by use of routine
experimentation.
The binding activity of a given lot of Ob or ObR antibody or Ob or ObR fusion
protein may be determined according to well known methods. Those skilled in
the art will be
37
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
able to determine operative and optimal assay conditions for each
determination by
employing routine experimentation.
With respect to antibodies, one of the ways in which the Ob or ObR antibody
can be
detectably labeled is by linking the same to an enzyme and use in an enzyme
immunoassay
(EIA) (Voller, A., "The Enzyme Linked Immunosorbent Assay (ELISA)", 1978,
Diagnostic
Horizons 2:1-7, Microbiological Associates Quarterly Publication,
Walkersville, Md.);
Voller, A. et al., 1978, J. Clin. Pathol. 31:507-520; Butler, J. E., 1981,
Meth. Enzymol.
73:482-523; Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton,
Fla.,;
Ishikawa, E. et al., (eds.), 1981, Enzyme Immunoassay, Kgaku Shoin, Tokyo).
The enzyme
which is bound to the antibody will react with an appropriate substrate,
preferably a
chromogenic substrate, in such a manner as to produce a chemical moiety which
can be
detected, for example, by spectrophotometric, fluorimetric or by visual means.
Enzymes
which can be used to detectably label the antibody include, but are not
limited to, malate
dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast
alcohol
dehydrogenase, alphaglycerophosphate, dehydrogenase, triose phosphate
isomerase,
horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase,
beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate
dehydrogenase,
glucoamylase and acetylcholinesterase. The detection can be accomplished by
calorimetric
methods which employ a chromogenic substrate for the enzyme. Detection may
also be
accomplished by visual comparison of the extent of enzymatic reaction of a
substrate in
comparison with similarly prepared standards.
Detection may also be accomplished using any of a variety of other
immunoassays.
For example, by radioactively labeling the antibodies or antibody fragments,
it is possible to
detect Ob or ObR through the use of a radioimmunoassay (RIA) (see, for
example,
Weintraub. B., Principles of Radioimmunoassays, Seventh Training Course on
Radioligand
Assay Techniques, The Endocrine Society, March, 1986, which is incorporated by
reference
herein). The radioactive isotope can be detected by such means as the use of a
gamma counter
or a scintillation counter or by autoradiography.
It is also possible to label the antibody with a fluorescent compound. When
the
fluorescently labeled antibody is exposed to light of the proper wave length,
its presence can
then be detected due to fluorescence. Among the most commonly used fluorescent
labeling
38
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin,
phycocyanin,
allophycocyanin, o-phthaldehyde and fluorescamine.
The antibody can also be detectably labeled using fluorescence emitting metals
such
as'SZEu, or others of the lanthanide series. These metals can be attached to
the antibody using
such metal chelating groups as diethylenetriaminepentacetic acid (DTPA) or
ethylenediaminetetraacetic acid (EDTA).
The antibody also can be detectably labeled by coupling it to a
chemiluminescent
compound. The presence of the chemiluminescent-tagged antibody is then
determined by
detecting the presence of luminescence that arises during the course of a
chemical reaction.
Examples of particularly useful chemiluminescent labeling compounds are
luminol,
isoluminol, theromatic acridinium ester, imidazole, acridinium salt and
oxalate ester.
Likewise, a bioluminescent compound may be used to label the antibody of the
present invention. Bioluminescence is a type of chemiluminescence found in
biological
systems in, which a catalytic protein increases the efficiency of the
chemiluminescent
reaction. The presence of a bioluminescent protein is determined by detecting
the presence of
luminescence. Important bioluminescent compounds for purposes of labeling are
luciferin,
luciferase and aequorin.
5.3 Screening Assays for Compounds Useful in the Treatment, Diagnosis and
Prevention of Bone Disease
The present invention also provides screening methods (e.g., assays) for the
identification of compounds which affect bone disease. The invention further
encompasses
agonists and antagonists of leptin and leptin receptors, including small
molecules, large
molecules, and antibodies, as well as nucleotide sequences that can be used to
inhibit leptin
and leptin receptor gene expression (e.g., antisense and ribozyme molecules),
and gene or
regulatory sequence replacement constructs designed to enhance leptin or
leptin receptor gene
expression (e.g., expression constructs that place the leptin or leptin
receptor gene under the
control of a strong promoter system). Such compounds may be used to treat bone
diseases.
In particular, cellular and non-cellular assays are described that can be used
to identify
compounds that interact with leptin and leptin receptors, e.g., modulate the
activity of leptin
and leptin receptors and/or bind to the leptin receptor. The cell based assays
can be used to
39
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
identify compounds or compositions that affect the signal-transduction
activity of leptin and
leptin receptors, whether they bind to the leptin receptor or act on
intracellular factors
involved in the leptin signal transduction pathway. Such cell-based assays of
the invention
utilize cells, cell lines, or engineered cells or cell lines that express
leptin or leptin receptors.
The cells can be further engineered to incorporate a reporter molecule linked
to the signal
transduced by the activated leptin receptor to aid in the identification of
compounds that
modulate leptin and leptin receptors signaling activity.
The invention also encompasses the use of cell-based assays or cell-lysate
assays (e.g.,
in vitro transcription or translation assays) to screen for compounds or
compositions that
modulate leptin and leptin receptor gene expression. To this end, constructs
containing a
reporter sequence linked to a regulatory element of the leptin or leptin
receptor genes can be
used in engineered cells, or in cell lysate extracts, to screen for compounds
that modulate the
expression of the reporter gene product at the level of transcription. For
example, such assays
could be used to identify compounds that modulate the expression or activity
of transcription
factors involved in leptin and leptin receptor gene expression, or to test the
activity of triple
helix polynucleotides. Alternatively, engineered cells or translation extracts
can be used to
screen for compounds (including antisense and ribozyme constructs) that
modulate the
translation of leptin and leptin receptors mRNA transcripts, and therefore,
affect expression
of the leptin receptor.
The following assays are designed to identify compounds that interact with
(e.g., bind
to) Ob or ObR (including, but not limited to, the ECD or CD of ObR), compounds
that
interact with (e.g., bind to) intracellular proteins that interact with Ob or
ObR (including, but
not limited to, the TM and CD of ObR), compounds that interfere with the
interaction of Ob
or ObR with transmembrane or intracellular proteins involved in ObR-mediated
signal
transduction, and to compounds which modulate the activity of Ob or ObR gene
expression
or modulate the level of Ob or ObR. Assays may additionally be utilized which
identify
compounds which bind to Ob or ObR gene regulatory sequences (e.g., promoter
sequences)
and which may modulate Ob or ObR gene expression. See e.g., Platt, K. A.,
1994, J. Biol.
Chem. 269:28558-28562 Upon identification, compounds can further be tested for
an ability
to modulate leptin signalling in vitro or in vivo, and can still further be
tested for an ability to
modulate bone mass (that is, increase or decrease bone mass) and to treat a
bone disease
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
characterized by a decreased or an increased bone mass relative to a
corresponding non-
diseased bone.
Thus, in accordance with this aspects of the present invention, there is a
method for
identifying a compound to be tested for an ability to modulate (increase or
decrease) bone
mass in a mammal, comprising:
(a) contacting a test compound with a polypeptide; and
(b) determining whether the test compound binds the polypeptide, so that if
the
test compound binds the polypeptide, then a compound to be tested for an
ability to modulate
bone mass is identified, wherein the polypeptide is selected from the group
consisting of a
leptin polypeptide and a leptin receptor polypeptide.
Alternatively, there is a method for identifying a compound that modulates
(increases
or decreases) bone mass in a mammal, comprising:
(a) contacting test compounds with a polypeptide;
(b) identifying a test compound that binds the polypeptide; and
(c) administering the test compound in (b) to a non-human mammal, and
determining whether the test compound modulates bone mass in the mammal
relative to that
of a corresponding bone in an untreated control non-human mammal, wherein the
polypeptide
is selected from the group consisting of a leptin polypeptide and a leptin
receptor polypeptide,
so that if the test compound modulates bone mass, then a compound that
modulates bone
mass in a mammal is identified.
In accordance with this, and other aspects of the present invention, a control
non-
human mammal, as used herein, is intended to mean a corresponding mammal that
has not
been administered the test compound
In accordance with yet another aspect of the present invention, there is a
method for
identifying a compound to be tested for an ability to modulate (increase or
decrease) bone
mass in a mammal, comprising:
(a) contacting a test compound with a leptin polypeptide and a leptin receptor
polypeptide for a time sufficient to form leptin/leptin receptor complexes;
and
(b) measuring leptin/leptin receptor complex level, so that if the level
measured
differs from that measured in the absence of the test compound, then a
compound to be tested
for an ability to modulate bone mass is identified.
41
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
In accordance with this, and other aspects of the present invention,
leptin/leptin
receptor complex formation can be measured by, for example, isolating the
complex and
determining the amount complex formation by various assays well known to those
of skill in
the art, e.g., Western Blot.
In accordance with another aspect of the present invention, there is a method
for
identifying a compound to be tested for an ability to decrease bone mass in a
mammal,
comprising:
(a) contacting a test compound with a cell which expresses a functional leptin
receptor; and
(b) determining whether the test compound activates the leptin receptor,
wherein if the compound activates the leptin receptor a compound to be tested
for an ability
to decrease bone mass in a mammal is identified.
In accordance with this, and other aspects of the present invention, a
functional leptin
receptor is a leptin receptor which is capable of signal transduction
following ligand binding
to the active site of the receptor. Activation of the leptin receptor, as used
herein, is any
increase in the activity (i.e., signal transduction) of the leptin receptor.
In accordance with another aspect of the present invention, there is a method
for
identifying a compound that decreases bone mass in a mammal, comprising:
(a) contacting a test compound with a cell that expresses a functional leptin
receptor, and determining whether the test compound activates the leptin
receptor;
(b) administering a test compound identified in (a) as activating the leptin
receptor
to a non-human animal, and determining whether the test compound decreases
bone mass of
the animal relative to that of a corresponding bone of a control non-human
animal, so that if
the test compound decreases bone mass, then a compound that decreases bone
mass in a
mammal is identified.
In accordance with another aspect of the present invention, there is a method
for
identifying a compound to be tested for an ability to increase bone mass in a
mammal,
comprising:
(a) contacting a leptin polypeptide and a test compound with a cell that
expresses
a functional leptin receptor; and
42
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
(b) determining whether the test compound lowers activation of the leptin
receptor
relative to that observed in the absence of the test compound; wherein a test
compounds that
lowers activation of the leptin receptor is identified as a compound to be
tested for an ability
to increase bone mass in a mammal.
In accordance with yet another aspect of the present invention, there is a
method for
identifying a compound that increases bone mass in a mammal, comprising:
(a) contacting a leptin polypeptide and a test compound with a cell that
expresses
a functional leptin receptor, and determining whether the test compound
decreases activation
of the leptin receptor;
(b) administering a test compound identified in (a) as decreasing leptin
receptor to
a non-human animal, and determining whether the test compound increases bone
mass of the
animal relative to that of a corresponding bone of a control non-human animal,
so that if the
test compound increases bone mass, then a compound that increases bone mass in
a mammal
is identified.
In accordance with yet another aspect of the invention, there is a method in
which
activation of a leptin receptor is determined by measuring levels of
phosphorylated Stat3
polypeptide. Stat3 polypeptide, a downstream effector of leptin signaling in
its target cells
(Tartaglia et al., 1995, Cell 83, 1263-1271; Baumann et al., 1996, Proc Natl
Acad Sci L1SA
93, 8374-8378; Ghilardi et al., 1996, Proc Nati Acad Sci USA 93, 6231-6235;
Vaisse et al.,
1996, Nat Genet 14, 95-97), is phosphorylated following activation of the
leptin receptor by
leptin.
The compounds which may be screened in accordance with the invention include,
but
are not limited to, peptides, antibodies and fragments thereof, and other
organic compounds
(e.g., peptidomimetics) that bind to Ob or ObR and either mimic the activity
triggered by the
natural ligand (i.e., agonists) or inhibit the activity triggered by the
natural ligand (i.e.,
antagonists); as well as peptides, antibodies or fragments thereof, and other
organic
compounds that mimic the ECD of the ObR (or a portion thereof) and bind to and
"neutralize" natural ligand. Additional compounds which may be screened in
accordance
with the invention include, but are not limited to, compounds which interact
with Ob and
prevent the transport of Ob across the blood-brain barrier, thereby preventing
Ob from
activating the ObR.
43
CA 02376933 2001-12-11
WO 00/76552 PCT/LJS00/15911
Such compounds may include, but are not limited to, peptides such as, for
example,
soluble peptides, including but not limited to members of random peptide
libraries; (see, e.g.,
Lam, K. S. et al., 1991, Nature 354:82-84; Houghten, R. et al., 1991, Nature
354:84-86), and
combinatorial chemistry-derived molecular library made of D- and/or L-
configuration amino
acids, phosphopeptides (including, but not limited to, members of random or
partially
degenerate, directed phosphopeptide libraries; see, e.g., Songyang, Z. et al.,
1993, Cell
72:767-778), antibodies (including, but not limited to, polyclonal,
monoclonal, human,
humanized, anti-idiotypic, chimeric or single chain antibodies, and FAb,
F(ab'), and FAb
expression library fragments, and epitope-binding fragments thereof), and
small organic or
inorganic molecules.
Other compounds which can be screened in accordance with the invention
include, but
are not limited to, small organic molecules that are able to cross the blood-
brain barrier, gain
entry into an appropriate cell (e.g., in the choroid plexus or in the
hypothalamus) and affect
the expression of the Ob or ObR gene or some other gene involved in the ObR
signal
transduction pathway (e.g., by interacting with the regulatory region or
transcription factors
involved in gene expression); or such compounds that affect the activity of
the ObR (e.g., by
inhibiting or enhancing the enzymatic activity of the CD) or the activity of
some other
intracellular factor involved in the ObR signal transduction pathway, such as,
for example,
gp 130.
Computer modeling and searching technologies permit identification of
compounds,
or the improvement of already identified compounds, that can modulate Ob or
ObR
expression or activity. Having identified such a compound or composition, the
active sites or
regions are identified. Such active sites might typically be ligand binding
sites, such as the
interaction domains of Ob with ObR itself. The active site can be identified
using methods
known in the art including, for example, from the amino acid sequences of
peptides, from the
nucleotide sequences of nucleic acids, or from study of complexes of the
relevant compound
or composition with its natural ligand. In the latter case, chemical or X-ray
crystallographic
methods can be used to find the active site by finding where on the factor the
complexed
ligand is found. Next, the three dimensional geometric structure of the active
site is
determined. This can be done by known methods, including X-ray
crystallography, which
can determine a complete molecular structure. On the other hand, solid or
liquid phase NMR
44
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
can be used to determine certain intra-molecular distances. Any other
experimental method
of structure determination can be used to obtain partial or complete geometric
structures. The
geometric structures may be measured with a complexed ligand, natural or
artificial, which
may increase the accuracy of the active site structure determined.
If an incomplete or insufficiently accurate structure is determined, the
methods of
computer based numerical modeling can be used to complete the structure or
improve its
accuracy. Any recognized modeling method may be used, including parameterized
models
specific to particular biopolymers such as proteins or nucleic acids,
molecular dynamics
models based on computing molecular motions, statistical mechanics models
based on
thermal ensembles, or combined models. For most types of models, standard
molecular force
fields, representing the forces between constituent atoms and groups, are
necessary, and can
be selected from force fields known in physical chemistry. The incomplete or
less accurate
experimental structures can serve as constraints on the complete and more
accurate structures
computed by these modeling methods.
Finally, having determined the structure of the active site, either
experimentally, by
modeling, or by a combination, candidate modulating compounds can be
identified by
searching databases containing compounds along with information on their
molecular
structure. Such a search seeks compounds having structures that match the
determined active
site structure and that interact with the groups defining the active site.
Such a search can be
manual, but is preferably computer assisted. These compounds found from this
search are
potential Ob or ObR modulating compounds.
Alternatively, these methods can be used to identify improved modulating
compounds
from an already known modulating compound or ligand. The composition of the
known
compound can be modified and the structural effects of modification can be
determined using
the experimental and computer modeling methods described above applied to the
new
composition. The altered structure is then compared to the active site
structure of the
compound to determine if an improved fit or interaction results. In this
manner, systematic
variations in composition, such as by varying side groups, can be quickly
evaluated to obtain
modified modulating compounds or ligands of improved specificity or activity.
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Further experimental and computer modeling methods useful to identify
modulating
compounds based upon identification of the active sites of Ob, ObR, and
related transduction
and transcription factors will be apparent to those of skill in the art.
Examples of molecular modeling systems are the CHARMm and QUANTA programs
(Polygen Corporation, Waltham, Mass.). CHARMm performs the energy minimization
and
molecular dynamics functions. QUANTA performs the construction, graphic
modelling and
analysis of molecular structure. QUANTA allows interactive construction,
modification,
visualization, and analysis of the behavior of molecules with each other.
A number of articles review computer modeling of drugs interactive with
specific-proteins, such as Rotivinen, et al., 1988, Acta Pharmaceutical
Fennica 97:159-166;
Ripka, New Scientist 54-57 (Jun. 16, 1988); McKinaly and Rossmann, 1989, Annu.
Rev.
Pharmacol. Toxiciol. 29:111-122; Perry and Davies, OSAR: Quantitative
Structure-Activity
Relationships in Drug Design pp. 189-193 (Alan R. Liss, Inc. 1989); Lewis and
Dean, 1989
Proc. R. Soc. Lond. 236:125-140 and 141-162; and, with respect to a model
receptor for
nucleic acid components, Askew, et al., 1989, J. Am. Chem. Soc. 111:1082-1090.
Other
computer programs that screen and graphically depict chemicals are available
from
companies such as BioDesign, Inc. (Pasadena, Calif.), Allelix, Inc.
(Mississauga, Ontario,
Canada), and Hypercube, Inc. (Cambridge, Ontario). Although these are
primarily designed
for application to drugs specific to particular proteins, they can be adapted
to design of drugs
specific to regions of DNA or RNA, once that region is identified.
Although described above with reference to design and generation of compounds
which could alter binding, one could also screen libraries of known compounds,
including
natural products or synthetic chemicals, and biologically active materials,
including proteins,
for compounds which are inhibitors or activators.
Compounds identified via assays such as those described herein may be useful,
for
example, in elaborating the biological function of the Ob or ObR gene product,
and for
ameliorating bone diseases. Assays for testing the effectiveness of compounds,
identified by,
for example, techniques such as those described in Section 5.3.1 through
5.3.3, are discussed,
below, in Section 5.3.4.
46
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
5.3.1 In vitro Screening Assays for Compounds that Bind to Ob and
ObR
In vitro systems may be designed to identify compounds capable of interacting
with
(e.g., binding to) Ob and ObR (including, but not limited to, the ECD or CD of
ObR).
Compounds identified may be useful, for example, in modulating the activity of
wild type
and/or mutant Ob or ObR gene products; may be useful in elaborating the
biological function
of Ob or ObR; may be utilized in screens for identifying compounds that
disrupt normal Ob
and ObR interactions; or may in themselves disrupt such interactions.
The principle of the assays used to identify compounds that bind to Ob or ObR
involves preparing a reaction mixture of Ob or ObR and the test compound under
conditions
and for a time sufficient to allow the two components to interact and bind,
thus forming a
complex which can be removed and/or detected in the reaction mixture. The Ob
or ObR
species used can vary depending upon the goal of the screening assay. For
example, where
l S agonists of the natural ligand are sought, the full length ObR, or a
soluble trlrncated ObR,
e.g., in which the TM and/or CD is deleted from the molecule, a peptide
corresponding to the
ECD or a fusion protein containing the ObR ECD fused to a protein or
polypeptide that
affords advantages in the assay system (e.g., labeling, isolation of the
resulting complex, etc.)
can be utilized. Where compounds that interact with the ObR cytoplasmic domain
are sought
to be identified, peptides corresponding to the ObR CD and fusion proteins
containing the
ObR CD can be used. In addition, where compounds which will prevent Ob entry
across the
blood-brain barrier are sought, Ob, or soluble forms of Ob, can be used.
The screening assays can be conducted in a variety of ways. For example, one
method to conduct such an assay would involve anchoring the Ob or ObR protein,
polypeptide, peptide or fusion protein or the test substance onto a solid
phase and detecting
Ob or ObR/test compound complexes anchored on the solid phase at the end of
the reaction.
In one embodiment of such a method, the Ob or ObR reactant may be anchored
onto a solid
surface, and the test compound, which is not anchored, may be labeled, either
directly or
indirectly.
In practice, microtiter plates may conveniently be utilized as the solid
phase. The
anchored component may be immobilized by non-covalent or covalent attachments.
Non-covalent attachment may be accomplished by simply coating the solid
surface with a
47
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
solution of the protein and drying. Alternatively, an immobilized antibody,
preferably a
monoclonal antibody, specific for the protein to be immobilized may be used to
anchor the
protein to the solid surface. The surfaces may be prepared in advance and
stored.
In order to conduct the assay, the nonimmobilized component is added to the
coated
surface containing the anchored component. After the reaction is complete,
unreacted
components are removed (e.g., by washing) under conditions such that any
complexes formed
will remain immobilized on the solid surface. The detection of complexes
anchored on the
solid surface can be accomplished in a number of ways. Where the previously
nonimmobilized component is pre-labeled, the detection of label immobilized on
the surface
indicates that complexes were formed. Where the previously nonimmobilized
component is
not pre-labeled, an indirect label can be used to detect complexes anchored on
the surface;
e.g., using a labeled antibody specific for the previously nonimmobilized
component (the
antibody, in turn, may be directly labeled or indirectly labeled with a
labeled anti-Ig
antibody).
Alternatively, a reaction can be conducted in a liquid phase, the reaction
products
separated from unreacted components, and complexes detected; e.g., using an
immobilized
antibody specific for Ob or ObR protein, polypeptide, peptide or fusion
protein or the test
compound to anchor any complexes formed in solution, and a labeled antibody
specific for
the other component of the possible complex to detect anchored complexes.
Alternatively, cell-based assays can be used to identify compounds that
interact with
Ob or ObR. To this end, cell lines that express Ob or ObR, or cell lines
(e.g., COS cells,
CHO cells, fibroblasts, etc.) that have been genetically engineered to express
Ob or ObR
(e.g., by transfection or transduction of Ob or ObR DNA) can be used.
Interaction of the test
compound with, for example, the ECD of ObR expressed by the host cell can be
determined
by comparison or competition with native Ob.
5.3.2 Assays for Proteins that Interact with Ob and ObR
Any method suitable for detecting protein-protein interactions may be employed
for
identifying transmembrane proteins or intracellular proteins that interact
with Ob or ObR.
Among the traditional methods which may be employed are co-
immunoprecipitation,
crosslinking and co-purification through gradients or chromatographic columns
of cell lysates
48
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
or proteins obtained from cell lysates and Ob or ObR to identify proteins in
the lysate that
interact with Ob or ObR. For these assays, the Ob or ObR component used can be
full length,
a soluble derivative lacking the membrane-anchoring region (e.g., a truncated
ObR in which
the TM is deleted resulting in a truncated molecule containing the ECD fused
to the CD), a
peptide corresponding to the CD or a fusion protein containing Ob or the CD of
ObR. Once
isolated, such an intracellular protein can be identified and can, in turn, be
used in
conjunction with standard techniques, to identify proteins with which it
interacts. For
example, at least a portion of the amino acid sequence of an intracellular
protein which
interacts with Ob or ObR can be ascertained using techniques well known to
those of skill in
the art, such as via the Edman degradation technique. (See, e.g., Creighton,
1983. "Proteins:
Structures and Molecular Principles", W.H. Freeman & Co., N.Y., pp.34-49). The
amino
acid sequence obtained may be used as a guide for the generation of
oligonucleotide mixtures
that can be used to screen for gene sequences encoding such intracellular
proteins. Screening
may be accomplished, for example, by standard hybridization or PCR techniques.
Techniques for the generation of oligonucleotide mixtures and the screening
are well-known.
(See, e.g., Ausubel, supra., and PCR Protocols: A Guide to Methods and
Applications, 1990,
Innis, M. et al., eds. Academic Press, Inc., New York).
Additionally, methods may be employed which result in the simultaneous
identification of genes which encode the transmembrane or intracellular
proteins interacting
with ObR or Ob. These methods include, for example, probing expression
libraries in a
manner similar to the well known technique of antibody probing of ~,gtl 1
libraries, using
labeled Ob or ObR protein, or an Ob or ObR polypeptide, peptide or fusion
protein, e.g., an
Ob or ObR polypeptide or an Ob or ObR domain fused to a marker (e.g., an
enzyme, fluor,
luminescent protein, or dye), or an Ig-Fc domain.
One method which detects protein interactions in vivo, the two-hybrid system,
is
described in detail for illustration only and not by way of limitation. One
version of this
system has been described (Chien et al., 1991, Proc. Natl. Acad. Sci. USA,
88:9578-9582)
and is commercially available from Clontech (Palo Alto, Calif.).
Briefly, utilizing such a system, plasmids are constructed that encode two
hybrid
proteins: one plasmid consists of nucleotides encoding the DNA-binding domain
of a
49
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
transcription activator protein fused to an Ob or ObR nucleotide sequence
encoding Ob or
ObR, an Ob or ObR polypeptide, peptide or fusion protein, and the other
plasmid consists of
nucleotides encoding the transcription activator protein's activation domain
fused to a cDNA
encoding an unknown protein which has been recombined into this plasmid as
part of a
cDNA library. The DNA-binding domain fusion plasmid and the cDNA library are
transformed into a strain of the yeast Saccharomyces cerevisiae that contains
a reporter gene
(e.g., HBS or lacZ) whose regulatory region contains the transcription
activator's binding site.
Either hybrid protein alone cannot activate transcription of the reporter
gene: the
DNA-binding domain hybrid cannot because it does not provide activation
function and the
activation domain hybrid cannot because it cannot localize to the activator's
binding sites.
Interaction of the two hybrid proteins reconstitutes the functional activator
protein and results
in expression of the reporter gene, which is detected by an assay for the
reporter gene product.
The two-hybrid system or related methodology may be used to screen activation
domain libraries for proteins that interact with the "bait" gene product. By
way of example,
and not by way of limitation, Ob or ObR may be used as the bait gene product.
Total
genomic or cDNA sequences are fused to the DNA encoding an activation domain.
'This
library and a plasmid encoding a hybrid of a bait Ob or ObR gene product fused
to the
DNA-binding domain are cotransformed into a yeast reporter strain, and the
resulting
transformants are screened for those that express the reporter gene. For
example, and not by
way of limitation, a bait Ob or ObR gene sequence, such as the open reading
frame of Ob or
ObR (or a domain of ObR), can be cloned into a vector such that it is
translationally fused to
the DNA encoding the DNA-binding domain of the GAL4 protein. These colonies
are
purified and the library plasmids responsible for reporter gene expression are
isolated. DNA
sequencing is then used to identify the proteins encoded by the library
plasmids.
A cDNA library of the cell line from which proteins that interact with bait Ob
or ObR
gene product are to be detected can be made using methods routinely practiced
in the art.
According to the particular system described herein, for example, the cDNA
fragments can be
inserted into a vector such that they are translationally fused to the
transcriptional activation
domain of GAL4. This library can be co-transformed along with the bait Ob or
ObR
gene-GAL4 fusion plasmid into a yeast strain which contains a lacZ gene driven
by a
promoter which contains GAL4 activation sequence. A cDNA encoded protein,
fused to
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
GAL4 transcriptional activation domain, that interacts with bait Ob or ObR
gene product will
reconstitute an active GAL4 protein and thereby drive expression of the HIS3
gene. Colonies
which express HIS3 can be detected by their growth on petri dishes containing
semi-solid
agar based media lacking histidine. The cDNA can then be purified from these
strains, and
S used to produce and isolate the bait Ob or ObR gene-interacting protein
using techniques
routinely practiced in the art.
5.3.3 Assavs for Compounds that Interfere with Ob and
ObR/Intracellular or ObR/Transmembrane Macromolecule
Interactions
The macromolecules that interact with Ob or ObR are referred to, for purposes
of this
discussion, as "binding partners". These binding partners are likely to be
involved in the ObR
signal transduction pathway, and therefore, in the role of Ob or ObR in
regulation of bone
disorders. Therefore, it is desirable to identify compounds that interfere
with or disrupt the
interaction of such binding partners with Ob which may be useful in regulating
the activity of
the ObR and control bone disorders associated with ObR activity.
The basic principle of the assay systems used to identify compounds that
interfere
with the interaction between Ob or ObR and their binding partner or partners
involves
preparing a reaction mixture containing Ob or ObR protein, polypeptide,
peptide or fusion
protein as described above, and the binding partner under conditions and for a
time sufficient
to allow the two to interact and bind, thus forming a complex. In order to
test a compound
for inhibitory activity, the reaction mixture is prepared in the presence and
absence of the test
compound. The test compound may be initially included in the reaction mixture,
or may be
added at a time subsequent to the addition of the Ob or ObR moiety and its
binding partner.
Control reaction mixtures are incubated without the test compound or with a
placebo. The
formation of any complexes between the Ob or ObR moiety and the binding
partner is then
detected. The formation of a complex in the control reaction, but not in the
reaction mixture
containing the test compound, indicates that the compound interferes with the
interaction of
Ob or ObR and the interactive binding partner. Additionally, complex formation
within
reaction mixtures containing the test compound and normal Ob or ObR protein
may also be
compared to complex formation within reaction mixtures containing the test
compound and a
51
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
mutant Ob or ObR. This comparison may be important in those cases wherein it
is desirable
to identify compounds that disrupt interactions of mutant but not normal Ob or
ObRs.
The assay for compounds that interfere with the interaction of Ob or ObR and
binding
partners can be conducted in a heterogeneous or homogeneous format.
Heterogeneous assays
involve anchoring either the Ob or ObR moiety product or the binding partner
onto a solid
phase and detecting complexes anchored on the solid phase at the end of the
reaction. In
homogeneous assays, the entire reaction is carried out in a liquid phase. In
either approach,
the order of addition of reactants can be varied to obtain different
information about the
compounds being tested. For example, test compounds that interfere with the
interaction by
competition can be identified by conducting the reaction in the presence of
the test substance;
i.e., by adding the test substance to the reaction mixture prior to or
simultaneously with the
Ob or ObR moiety and interactive binding partner. Alternatively, test
compounds that disrupt
preformed complexes, e.g. compounds with higher binding constants that
displace one of the
components from the complex, can be tested by adding the test compound to the
reaction
mixture after complexes have been formed. The various formats are described
briefly below.
In a heterogeneous assay system, either the Ob or ObR moiety or the
interactive
binding partner, is anchored onto a solid surface, while the non-anchored
species is labeled,
either directly or indirectly. In practice, microtiter plates are conveniently
utilized. The
anchored species may be immobilized by non-covalent or covalent attachments.
Non-covalent attachment may be accomplished simply by coating the solid
surface with a
solution of the Ob or ObR gene product or binding partner and drying.
Alternatively, an
immobilized antibody specific for the species to be anchored may be used to
anchor the
species to the solid surface. The surfaces may be prepared in advance and
stored.
In order to conduct the assay, the partner of the immobilized species is
exposed to the
coated surface with or without the test compound. After the reaction is
complete, unreacted
components are removed (e.g., by washing) and any complexes formed will remain
immobilized on the solid surface. The detection of complexes anchored on the
solid surface
can be accomplished in a number of ways. Where the non-immobilized species is
pre-labeled, the detection of label immobilized on the surface indicates that
complexes were
formed. Where the non-immobilized species is not pre-labeled, an indirect
label can be used
to detect complexes anchored on the surface; e.g., using a labeled antibody
specific for the
52
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
initially non-immobilized species (the antibody, in turn, may be directly
labeled or indirectly
labeled with a labeled anti-Ig antibody). Depending upon the order of addition
of reaction
components, test compounds which inhibit complex formation or which disrupt
preformed
complexes can be detected.
Alternatively, the reaction can be conducted in a liquid phase in the presence
or
absence of the test compound, the reaction products separated from unreacted
components,
and complexes detected; e.g., using an immobilized antibody specific for one
of the binding
components to anchor any complexes formed in solution, and a labeled antibody
specific for
the other partner to detect anchored complexes. Again, depending upon the
order of addition
of reactants to the liquid phase, test compounds which inhibit complex or
which disrupt
preformed complexes can be identified.
In an alternate embodiment of the invention, a homogeneous assay can be used.
In
this approach, a preformed complex of the Ob or ObR moiety and the interactive
binding
partner is prepared in which either Ob or ObR or its binding partners is
labeled, but the signal
generated by the label is quenched due to formation of the complex (see, e.g.,
U.S. Pat. No.
4,109,496 by Rubenstein which utilizes this approach for immunoassays). The
addition of a
test substance that competes with and displaces one of the species from the
preformed
complex will result in the generation of a signal above background. In this
way, test
substances which disrupt Ob or ObR/intracellular binding partner interaction
can be
identified.
In a particular embodiment, an Ob or ObR fusion can be prepared for
immobilization.
For example, the Ob or ObR or a peptide fragment, e.g., corresponding to the
ObR CD, can
be fused to a glutathione-S-transferase (GST) gene using a fusion vector, such
as
pGEX-SX-l, in such a manner that its binding activity is maintained in the
resulting fusion
protein. The interactive binding partner can be purified and used to raise a
monoclonal
antibody, using methods routinely practiced in the art. This antibody can be
labeled with the
radioactive isotope'25 I, for example, by methods routinely practiced in the
art. In a
heterogeneous assay, e.g., the GST-ObR fusion protein can be anchored to
glutathione-agarose beads. The interactive binding partner can then be added
in the presence
or absence of the test compound in a manner that allows interaction and
binding to occur. At
the end of the reaction period, unbound material can be washed away, and the
labeled
53
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
monoclonal antibody can be added to the system and allowed to bind to the
complexed
components. The interaction between the Ob or ObR gene product and the
interactive
binding partner can be detected by measuring the amount of radioactivity that
remains
associated with the glutathione-agarose beads. A successful inhibition of the
interaction by
the test compound will result in a decrease in measured radioactivity.
Alternatively, the GST-Ob/ObR fusion protein and the interactive binding
partner can
be mixed together in liquid in the absence of the solid glutathione-agarose
beads. The test
compound can be added either during or after the species are allowed to
interact. This
mixture can then be added to the glutathione-agarose beads and unbound
material is washed
away. Again the extent of inhibition of the Ob or ObR/binding partner
interaction can be
detected by adding the labeled antibody and measuring the radioactivity
associated with the
beads.
In another embodiment of the invention, these same techniques can be employed
using peptide fragments that correspond to the binding domains of Ob or ObR
and/or the
l5 interactive or binding partner (in cases where the binding partner is a
protein), in place of one
or both of the full length proteins. Any number of methods routinely practiced
in the art can
be used to identify and isolate the binding sites. These methods include, but
are not limited
to, mutagenesis of the gene encoding one of the proteins and screening for
disruption of
binding in a co-immunoprecipitation assay. Compensating mutations in the gene
encoding
the second species in the complex can then be selected. Sequence analysis of
the genes
encoding the respective proteins will reveal the mutations that correspond to
the region of the
protein involved in interactive binding. Alternatively, one protein can be
anchored to a solid
surface using methods described above, and allowed to interact with and bind
to its labeled
binding partner, which has been treated with a proteolytic enzyme, such as
trypsin. After
washing, a short, labeled peptide comprising the binding domain may remain
associated with
the solid material, which can be isolated and identified by amino acid
sequencing. Also, once
the gene coding for the intracellular binding partner is obtained, short gene
segments can be
engineered to express peptide fragments of the protein, which can then be
tested for binding
activity and purified or synthesized.
For example, and not by way of limitation, an Ob or ObR gene product can be
anchored to a solid material as described, above, by making a GST-Ob or -ObR
fusion protein
54
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
and allowing it to bind to glutathione agarose beads. The interactive binding
partner can be
labeled with a radioactive isotope, such as 35S, and cleaved with a
proteolytic enzyme such as
trypsin. Cleavage products can then be added to the anchored GST-Ob or -ObR
fusion
protein and allowed to bind. After washing away unbound peptides, labeled
bound material,
representing the intracellular binding partner binding domain, can be eluted,
purified, and
analyzed for amino acid sequence by well-known methods. Peptides so identified
can be
produced synthetically or fused to appropriate facilitative proteins using
recombinant DNA
technology.
5.3.4 Assays for Identification of Compounds that Ameliorate Bone
Disease
Compounds, including, but not limited to, compounds identified via assay
techniques
such as those described, above, in Sections 5.3.1 through 5.3.3, can be tested
for the ability to
treat bone disease and ameliorate bone disease symptoms. The assays described
above can
identify compounds which affect Ob or ObR activity (e.g., leptin receptor
agonists or
antagonists), and compounds that bind to the natural ligand of the ObR and
neutralize ligand
activity; or compounds that affect Ob or ObR gene activity (by affecting Ob or
ObR gene
expression, including molecules, e.g., proteins or small organic molecules,
that affect or
2U interfere with splicing events so that expression of the full length or the
truncated form of the
Ob or ObR can be modulated). However, it should be noted that the assays
described can
also identify compounds that modulate Ob or ObR signal transduction (e.g.,
compounds
which affect downstream signaling events, such as inhibitors or enhancers of
tyrosine kinase
or phosphatase activities which participate in transducing the signal
activated by Ob binding
to the ObR). Alternatively, the assays described can also identify compounds
which
modulate the entry of Ob through the blood-brain barrier. The identification
and use of such
compounds which affect another step in the Ob or ObR signal transduction
pathway in which
the Ob or ObR gene and/or gene product is involved and, by affecting this same
pathway may
modulate the effect of Ob or ObR on the development of bone disorders are
within the scope
of the invention. Such compounds can be used as part of a therapeutic method
for the
treatment of bone disease.
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Cell-based systems can be used to identify compounds which may act to
ameliorate
bone disease. Such cell systems can include, for example, recombinant or non-
recombinant
cells, such as cell lines, which express the Ob or ObR gene, e.g., NIH3T3L1
cell lines.
Further, for example, for ObR, choroid plexus cells, hypothalamus cells, or
cell lines derived
from choroid plexus or hypothalamus can be used. In addition, expression host
cells (e.g.,
COS cells, CHO cells, fibroblasts) genetically engineered to express a
functional Ob or ObR
and to respond to activation by the natural Ob ligand, e.g., as measured by a
chemical or
phenotypic change, induction of another host cell gene, change in ion flux
(e.g., Ca++),
tyrosine phosphorylation of host cell proteins, etc., can be used as an end
point in the assay.
In utilizing such cell systems, cells may be exposed to a compound suspected
of
exhibiting an ability to ameliorate bone disorders, at a sufficient
concentration and for a time
sufficient to elicit such an amelioration of bone disorders in the exposed
cells. After
exposure, the cells can be assayed to measure alterations in the expression of
the Ob or ObR
gene, e.g., by assaying cell lysates for Ob or ObR mRNA transcripts (e.g., by
Northern
analysis) or for Ob or ObR protein expressed in the cell; compounds which
regulate or
modulate expression of the Ob or ObR gene are good candidates as therapeutics.
Alternatively, the cells are examined to determine whether one or more bone
disorder-like
cellular phenotypes has been altered to resemble a more normal or more wild
type, non-bone
disorder phenotype, or a phenotype more likely to produce a lower incidence or
severity of
disorder symptoms. Still further, the expression and/or activity of components
of the signal
transduction pathway of which ObR is a part, or the activity of the ObR signal
transduction
pathway itself can be assayed.
For example, after exposure, the cell lysates can be assayed for the presence
of
tyrosine phosphorylation of host cell proteins, as compared to lysates derived
from unexposed
control cells. The ability of a test compound to inhibit tyrosine
phosphorylation of host cell
proteins in these assay systems indicates that the test compound inhibits
signal transduction
initiated by ObR activation. The cell lysates can be readily assayed using a
Western blot
format; i.e., the host cell proteins are resolved by gel electrophoresis,
transferred and probed
using a anti-phosphotyrosine detection antibody (e.g., an anti-phosphotyrosine
antibody
labeled with a signal generating compound, such as radiolabel, fluor, enzyme,
etc.) (See, e.g.,
56
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Glenney et al., 1988, J. Immunol. Methods 109:277-285; Frackelton et al.,
1983, Mol. Cell.
Biol. 3:1343-1352). Alternatively, an ELISA format could be used in which a
particular host
cell protein involved in the ObR signal transduction pathway is immobilized
using an
anchoring antibody specific for the target host cell protein, and the presence
or absence of
phosphotyrosine on the immobilized host cell protein is detected using a
labeled
anti-phosphotyrosine antibody. (See, King et al., 1993, Life Sciences 53:1465-
1472). In yet
another approach, ion flux, such as calcium ion flux, can be measured as an
end point for
ObR stimulated signal transduction.
In addition, animal-based bone disorder systems, which may include, for
example, ob,
db and ob/db mice, may be used to identify compounds capable of ameliorating
bone
disorder-like symptoms. Such animal models may be used as test substrates for
the
identification of drugs, pharmaceuticals, therapies and interventions which
may be effective
in treating such disorders. For example, animal models may be exposed to a
compound
suspected of exhibiting an ability to ameliorate bone disorder symptoms, at a
sufficient
concentration and for a time sufficient to elicit such an amelioration of bone
disorder
symptoms in the exposed animals. The response of the animals to the exposure
may be
monitored by assessing the reversal of disorders associated with bone
disorders such as
osteoporosis. With regard to intervention, any treatments which reverse any
aspect of bone
disorder-like symptoms should be considered as candidates for human bone
disorder
therapeutic intervention. Dosages of test agents may be determined by deriving
dose-response curves, as discussed below.
5.4 Compounds that Modulate Ob or ObR Expression or Activity
Compounds that interact with (e.g., bind to) Ob or ObR (including, but not
limited to,
the ECD or CD of ObR), compounds that interact with (e.g., bind to)
intracellular proteins
that interact with Ob or ObR (including, but not limited to, the TM and CD of
ObR),
compounds that interfere with the interaction of Ob or ObR with transmembrane
or
intracellular proteins involved in ObR-mediated signal transduction, and
compounds which
modulate the activity of Ob or ObR gene expression or modulate the level of Ob
or ObR are
capable of modulating levels of bone mass. More specifically, compounds which
decrease
57
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
the levels of Ob or ObR, inhibit the transport of Ob across the blood-brain
barrier or inhibit
binding of Ob to the ObR would cause an increase in bone mass.
Examples of such compounds are leptin and leptin receptor agonists and
antagonists.
Leptin receptor antagonist, as used herein, refers to a factor which
neutralizes or impedes or
otherwise reduces the action or effect of a leptin receptor. Such antagonists
can include
compounds that bind leptin or that bind leptin receptor. Such antagonists can
also include
compounds that neutralize, impede or otherwise reduce leptin receptor output,
that is,
intracellular steps in the leptin signaling pathway following binding of
leptin to the leptin
receptor, i.e., downstream events that affect leptin/leptin receptor
signaling, that do not occur
at the receptor/ligand interaction level. Leptin receptor antagonists may
include, but are not
limited to proteins, antibodies, small organic molecules or carbohydrates,
such as, for
example, acetylphenol compounds, antibodies which specifically bind leptin,
antibodies
which specifically bind leptin receptor, and compounds that comprise soluble
leptin receptor
polypeptide sequences.
For example, leptin antagonists also include agents, or drugs, which decrease,
inhibit,
block, abrogate or interfere with binding of leptin to its receptors or
extracellular domains
thereof; agents which decrease, inhibit, block, abrogate or interfere with
leptin production or
activation; agents which are antagonists of signals that drive leptin
production or synthesis,
and agents which prohibit leptin from reaching its receptor, e.g., prohibit
leptin from crossing
the blood-brain barrier. Such an agent can be any organic molecule that
inhibits or prevents
the interaction of leptin with its receptor, or leptin production. See, U.S.
Patent No.
5,866,547.
Leptin receptor agonist, as used herein, refers to a factor which activates,
induces or
otherwise increases the action or effect of a leptin receptor. Such agonists
can include
compounds that bind leptin or that bind leptin receptor. Such antagonists can
also include
compounds that activate, induce or otherwise increase leptin receptor output,
that is,
intracellular steps in the leptin signaling pathway following binding of
leptin to the leptin
receptor, i.e., downstream events that affect leptin/leptin receptor
signaling, that do not occur
at the receptor/ligand interaction level. Leptin receptor agonists may
include, but are not
limited to proteins, antibodies, small organic molecules or carbohydrates,
such as, for
example, leptin, leptin analogs, and antibodies which specifically bind and
activate leptin.
58
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
Leptin antagonists include, but are not limited to, anti-leptin antibodies,
receptor molecules
and derivatives which bind specifically to leptin and prevent leptin from
binding to its
cognate receptor.
Additional Ob binding proteins include, but are not limited to, inter-alpha-
trypsin
inhibitor heavy chain-related protein (IHRP); alpha 2-macroglobulin; and OB-
BP1 which
specifically bind Ob and is thus capable of preventing Ob from binding to the
ObR. The
specific Ob binding protein further enables modulation of free Ob levels,
immobilization and
assay of bound/free leptin. See, U.S. Patent No. 5,919,902; Birkenmeier et
al., 1998, Eur. J.
Endocrin., 139:224-230; Patel et al., 1999, J. Biol. Chem., 32:22729-22738.
Additional Ob
binding proteins, such as apolipoproteins, are disclosed in U.S. Patent No.
5,830,450.
Examples of ObR antagonists are acetylphenols, which are known to be useful as
antiobesity and antidiabetic compounds. Since acetylphenols are antagonists of
the ObR,
they prevent binding of Ob to the ObR. Thus, in view of the teachings of the
present
invention, the compounds would effectively cause an increase in bone mass. For
specific
structures of acetylphenols which can be used as ObR antagonists, see U.S.
Patent No.
5,859,051.
Additional antagonists and agonists of the ObR, and other compounds that
modulate
ObR gene expression or ObR activity that can be used for diagnosis, drug
screening, clinical
trial monitoring, and/or the treatment of bone disorders can be found in U.S.
Patent Nos.
5,972,621, 5874,535, and 5,912,123.
5.5. Methods for the Treatment or Prevention of Bone Disease
Bone diseases which can be treated and/or prevented in accordance with the
present
invention include bone diseases characterized by a decreased bone mass
relative to that of
corresponding non-diseased bone, including, but not limited to osteoporosis,
osteopenia and
Paget's disease. Bone diseases which can be treated and/or prevented in
accordance with the
present invention also include bone diseases characterized by an increased
bone mass relative
to that of corresponding non-diseased bone, including, but not limited to
osteopetrosis,
osteosclerosis and osteochondrosis.
In one aspect of the invention is a method of treating a bone disease
comprising:
administering to a mammal in need of said treatment a therapeutically
effective amount of a
59
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
compound that lowers leptin level in blood serum, wherein the bone disease is
characterized
by a decreased bone mass relative to that of corresponding non-diseased bone.
Specific
embodiments of some of these compounds and methods include, but are not
limited to ones
that inhibit or lower leptin synthesis or increase leptin breakdown. Among
such compounds
are antisense, ribozyme or triple helix sequences of a leptin-encoding
polypeptide.
In accordance with another aspect of the present invention, there is a method
of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that lowers leptin level in
cerebrospinal fluid,
wherein the bone disease is characterized by a decreased bone mass relative to
that of
corresponding non-diseased bone. Specific embodiments of some of these
compounds and
methods include, but are not limited to ones that inhibit or lower leptin
synthesis or increase
leptin breakdown, and compounds that bind leptin in blood.
Particular embodiments of the methods of the invention include, for example, a
method of treating a bone disease comprising: administering to a mammal in
need of said
treatment a therapeutically effective amount of a compound, wherein the bone
disease is
characterized by a decreased bone mass relative to that of corresponding non-
diseased bone,
and wherein the compound is selected from the group consisting of compounds
which bind
leptin in blood, including, but not limited to such compounds as an antibody
which
specifically binds leptin, a soluble leptin receptor polypeptide, an inter-
alpha-trypsin inhibitor
heavy chain related protein and an alpha 2-macroglobulin protein.
In accordance with another aspect of the present invention, there is a method
of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that lowers the level of
phosphorylated Stat3
polypeptide, wherein the bone disease is characterized by a decreased bone
mass relative to
that of corresponding non-diseased bone. Specific embodiments of some of these
compounds
and methods include, but are not limited to ones that inhibit or lower leptin
synthesis or
increase leptin breakdown, compounds that bind leptin in blood, and leptin
receptor
antagonist compounds, such as acetylphenol compounds, antibodies which
specifically bind
leptin, antibodies which specifically bind leptin receptor, and compounds that
comprise
soluble leptin receptor polypeptide sequences.
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
In accordance with another aspect of the present invention, there is a method
of
treating a bone disease comprising: administering to a mammal in need of said
treatment a
therapeutically effective amount of a compound that lowers leptin receptor
levels in
hypothalamus, wherein the bone disease is characterized by a decreased bone
mass relative to
that of corresponding non-diseased bone. Specific embodiments of some of these
compounds
and methods include, but are not limited to ones that inhibit or lower leptin
receptor synthesis
or increase leptin receptor breakdown. Among such compounds are antisense,
ribozyme or
triple helix sequences of a leptin receptor-encoding polypeptide.
A compound that lowers leptin levels in blood serum or in cerebrospinal fluid
is one
that lowers leptin levels in the following assay: contacting the compound with
a cell from a
leptin expressing cell line, preferably a NIH3T3L1 cell line, and determining
whether leptin
expression and/or synthesis is lowered relative to the level exhibited by the
cell line in the
absence of the compound. Standard assays such as Northern Blot can be used to
determine
levels of leptin expression and Western Blot can be used to determine levels
of leptin
synthesis. An alternate assay comprises comparing the level of leptin in a
mammal being
treated for a bone disease before and after administration of the compound,
such that, if the
level of leptin decreases, the compound is one that lowers leptin levels.
Likewise, a
compound that increases leptin levels in blood serum or in cerebrospinal fluid
is one that
increases leptin levels via such assays.
A compound that lowers the level of phosphorylated Stat3 polypeptide, a
downstream
effector of leptin signaling in its target cells (Tartaglia et al., 1995, Cell
83, 1263-1271;
Baumann et al., 1996, Proc Natl Acad Sci USA 93, 8374-8378; Ghilardi et al.,
1996, Proc
Nati Acad Sci USA 93, 6231-6235; Vaisse et al., 1996, Nat Genet 14, 95-97), is
one that
lowers the level of phosphorylated Stat3 in the following assay: contacting a
leptin
polypeptide and the compound with a cell that expresses a functional leptin
receptor and
determining the level of phosphorylated Stat3 polypeptide in the cell. To
determine the level
of phosphorylation of Stat3 polypeptide, the cells can, for example, be lysed
and an
appropriate analysis (e.g., Western Blot) can be performed. If the level of
phosphorylated
Stat3 decreases relative to the level exhibited by the cell line in the
absence of the compound,
the compound is one that lowers the level of phosphorylated Stat3. Likewise, a
compound
61
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
that increases the level of phosphorylated Stat3 polypeptide in blood serum or
in
cerebrospinal fluid is one that increases leptin levels via such assays.
A compound is said to be administered in a "therapeutically effective amount"
if the
amount administered results in a desired change in the physiology of a
recipient mammal,
e.g., results in an increase or decrease in bone mass relative to that of a
corresponding bone in
the diseased state; that is, results in treatment, i.e., modulates bone mass
to more closely
resemble that of corresponding non-diseased bone (that is a corresponding bone
of the same
type, e.g., long, vertebral, etc.) in a non-diseased state. With respect to
these methods, a
corresponding non-diseased bone refers to a bone of the same type as the bone
being treated
(e.g., a corresponding vertebral or long bone), and bone mass is measured
using standard
techniques well known to those of skill in the art and described above, and
include, for
example, X-ray, DEXA and classical histological assessments and measurements
of bone
mass.
Among the compounds that can be utilized as part of the methods presented
herein are
those described, for example, in the sections and teached presented herein, as
well as
compounds identified via techniques such as those described in the sections
and teaching
presented herein.
Particular techniques and methods that can be utilized as part of the
therapeutic and
preventative methods of the invention are presented in detail below.
5.5.1. Inhibition of Ob or ObR Expression, Levels or Activity to Treat
Bone Disease by Increasing Bone Mass
Any method which neutralizes, slows or inhibits Ob or ObR expression (either
transcription or translation), levels, or activity can be used to treat or
prevent a bone disease
characterized by a decrease in bone mass relative to a corresponding non-
diseased bone by
effectuating an increase in bone mass. Such approaches can be used to treat or
prevent bone
diseases such as osteoporosis, osteopenia, faulty bone formation or
resorption, Paget's
disease, and bone metastasis. Such methods can be utilized to treat states
involving bone
fractures and broken bones.
For example, the administration of componds such as soluble peptides,
proteins,
fusion proteins, or antibodies (including anti-idiotypic antibodies) that bind
to and
62
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
"neutralize" circulating Ob, the natural ligand for the ObR, can be used to
effectuate an
increase in bone mass. Similarly, such compounds as soluble peptides,
proteins, fusion
proteins, or antibodies (including anti-idiotypic antibodies) can be used to
effectuate an
increase in bone mass. To this end, peptides corresponding to the ECD of ObR,
soluble
deletion mutants of ObR, or either of these ObR domains or mutants fused to
another
polypeptide (e.g., an IgFc polypeptide) can be utilized. Alternatively, anti-
idiotypic
antibodies or Fab fragments of antiidiotypic antibodies that mimic the ObR ECD
and
neutralize Ob can be used. Alternatively, compounds that inhibit ObR
homodimerization
such that leptin's affinity for the leptin receptor is decreased, also can be
used. Devos et al.,
1997, JBC, 272:18304-18310. For treatment, such ObR peptides, proteins, fusion
proteins,
anti-idiotypic antibodies or Fabs are administered to a subject in need of
treatment at
therapeutically effective levels. For prevention, such ObR peptides, proteins,
fusion proteins,
anti-idiotypic antibodies or Fabs are administered to a subject at risk for a
bone disease, for a
time and concentration sufficient to prevent the bone disease.
In an alternative embodiment for neutralizing circulating Ob, cells that are
genetically
engineered to express such soluble or secreted forms of ObR may be
administered to a
patient, whereupon they will serve as "bioreactors" in vivo to provide a
continuous supply of
the Ob neutralizing protein. Such cells may be obtained from the patient or an
MHC
compatible donor and can include, but are not limited to, fibroblasts, blood
cells (e.g.,
lymphocytes), adipocytes, muscle cells, endothelial cells etc. The cells are
genetically
engineered in vitro using recombinant DNA techniques to introduce the coding
sequence for
the ObR ECD, or for ObR-Ig fusion protein into the cells, e.g., by
transduction (using viral
vectors, and preferably vectors that integrate the transgene into the cell
genome) or
transfection procedures, including, but not limited to, the use of plasmids,
cosmids, YACs,
electroporation, liposomes, etc. The ObR coding sequence can be placed under
the control of
a strong constitutive or inducible promoter or promoter/enhancer to achieve
expression and
secretion of the ObR peptide or fusion protein. The engineered cells which
express and
secrete the desired ObR product can be introduced into the patient
systemically, e.g., in the
circulation, intraperitoneally, at the choroid plexus or hypothalamus.
Alternatively, the cells
can be incorporated into a matrix and implanted in the body, e.g., genetically
engineered
63
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
fibroblasts can be implanted as part of a skin graft; genetically engineered
endothelial cells
can be implanted as part of a vascular graft. (See, for example, Anderson et
al. U.S. Pat. No.
5,399,349; and Mulligan & Wilson, U.S. Pat. No. 5,460,959 each of which is
incorporated by
reference herein in its entirety).
When the cells to be administered are non-autologous cells, they can be
administered
using well known techniques which prevent the development of a host immune
response
against the introduced cells. For example, the cells may be introduced in an
encapsulated
form which, while allowing for an exchange of components with the immediate
extracellular
environment, does not allow the introduced cells to be recognized by the host
immune
system.
In an alternate embodiment, bone disease therapy can be designed to reduce the
level
of endogenous Ob or ObR gene expression, e.g., using antisense or ribozyme
approaches to
inhibit or prevent translation of Ob or ObR mRNA transcripts; triple helix
approaches to
inhibit transcription of the Ob or ObR gene; or targeted homologous
recombination to
inactivate or "knock out" the Ob or ObR gene or its endogenous promoter.
Because the ObR
gene is expressed in the brain, including the choroid plexus and hypothalamus,
delivery
techniques should be preferably designed to cross the blood-brain barrier (see
PCT
W089/10134, which is incorporated by reference herein in its entirety).
Alternatively, the
antisense, ribozyme or DNA constructs described herein could be administered
directly to the
site containing the target cells; e.g., the choroid plexus, hypothalamus,
adipose tissue, etc.
Antisense approaches involve the design of oligonucleotides (either DNA or
RNA)
that are complementary to Ob or ObR mRNA. The antisense oligonucleotides will
bind to the
complementary Ob or ObR mRNA transcripts and prevent translation. Absolute
complementarity, although preferred, is not required. A sequence
"complementary" to a
portion of an RNA, as referred to herein, means a sequence having sufficient
complementarity to be able to hybridize with the RNA, forming a stable duplex;
in the case of
double-stranded antisense nucleic acids, a single strand of the duplex DNA may
thus be
tested, or triplex formation may be assayed. The ability to hybridize will
depend on both the
degree of complementarity and the length of the antisense nucleic acid.
Generally, the longer
the hybridizing nucleic acid, the more base mismatches with an RNA it may
contain and still
form a stable duplex (or triplex, as the case may be). One skilled in the art
can ascertain a
64
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
tolerable degree of mismatch by use of standard procedures to determine the
melting point of
the hybridized complex.
The skilled artisan recognizes that modifications of gene expression can be
obtained
by designing antisense molecules to the control regions of the leptin or
leptin receptor genes,
i. e. promoters, enhancers, and introns, as well as to the coding regions of
these genes. Such
sequences are referred to herein as leptin-encoding polynucleotides or leptin
receptor-
encoding polynucleotides, respectively.
Oligonucleotides derived from the transcription initiation site, e.g. between -
10 and
+10 regions of the leader sequence, are preferred. Oligonucleotides that are
complementary
to the 5' end of the message, e.g., the 5' untranslated sequence up to and
including the AUG
initiation codon, generally work most efficiently at inhibiting translation.
However,
sequences complementary to the 3' untranslated sequences of mRNAs have
recently shown to
be effective at inhibiting translation of mRNAs as well. See generally,
Wagner, R., 1994,
Nature 372:333-335. Oligonucleotides complementary to the 5' untranslated
region of the
mRNA should include the complement of the AUG start codon. Antisense
oligonucleotides
complementary to mRNA coding regions are less efficient inhibitors of
translation but could
be used in accordance with the invention. Whether designed to hybridize to the
5'-, 3'- or
coding region of Ob or ObR mRNA, antisense nucleic acids should be at least
six nucleotides
in length, and are preferably oligonucleotides ranging from 6 to about 50
nucleotides in
length. In specific aspects the oligonucleotide is at least nucleotides, at
least 17 nucleotides, at
least 25 nucleotides or at least 50 nucleotides.
Regardless of the choice of target sequence, it is preferred that in vitro
studies are first
performed to quantitate the ability of the antisense oligonucleotide to
inhibit gene expression.
It is preferred that these studies utilize controls that distinguish between
antisense gene
inhibition and nonspecific biological effects of oligonucleotides. It is also
preferred that these
studies compare levels of the target RNA or protein with that of an internal
control RNA or
protein. Additionally, it is envisioned that results obtained using the
antisense oligonucleotide
are compared with those obtained using a control oligonucleotide. It is
preferred that the
control oligonucleotide is of approximately the same length as the test
oligonucleotide and
that the nucleotide sequence of the oligonucleotide differs from the antisense
sequence no
more than is necessary to prevent specific hybridization to the target
sequence.
CA 02376933 2001-12-11
WO 00/76552 PCT/IJS00/15911
The oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or
modified versions thereof, single-stranded or double-stranded. The
oligonucleotide can be
modified at the base moiety, sugar moiety, or phosphate backbone, for example,
to improve
stability of the molecule, hybridization, etc. The oligonucleotide may include
other appended
groups such as peptides (e.g., for targeting host cell receptors in vivo), or
agents facilitating
transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc.
Natl. Acad. Sci.
U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652;
PCT
Publication No. W088/09810, published Dec. 15, 1988) or the blood-brain
barrier (see, e.g.,
PCT Publication No. W089/10134, published Apr. 25, 1988), hybridization-
triggered
cleavage agents. (See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or
intercalating
agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the
oligonucleotide may
be conjugated to another molecule, e.g., a peptide, hybridization triggered
cross-linking agent,
transport agent, hybridization-triggered cleavage agent, etc.
The antisense oligonucleotide may comprise at least one modified base moiety
which
is selected from the group including but not limited to 5-fluorouracil, 5-
bromouracil,
5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-
adenine,
7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil,
2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine,
pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-
thiouracil,
5-methyluracil, uracil5-oxyacetic acid methylester, uracil-S-oxyacetic acid
(v),
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2,6-diaminopurine.
The antisense oligonucleotide may also comprise at least one modified sugar
moiety
selected from the group including but not limited to arabinose, 2-
fluoroarabinose, xylulose,
and hexose.
66
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
In yet another embodiment, the antisense oligonucleotide comprises at least
one
modified phosphate backbone selected from the group consisting of a
phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a
phosphordiamidate, a
methylphosphonate, an alkyl phosphotriester, and a formacetal or analog
thereof.
In yet another embodiment, the antisense oligonucleotide is an a-anomeric
oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded
hybrids with
complementary RNA in which, contrary to the usual (3-units, the strands run
parallel to each
other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The
oligonucleotide is a
2'-0-methylribonucleotide (moue et al., 1987, Nucl. Acids Res. 15:6131-6148),
or a chimeric
RNA-DNA analogue (moue et al., 1987, FEBS Lett. 215:327-330).
Oligonucleotides of the invention may be synthesized by standard methods known
in
the art, e.g. by use of an automated DNA synthesizer (such as are commercially
available
from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides
may be synthesized by the method of Stein et al. (1988. Nucl. Acids Res.
16:3209),
I 5 methylphosphonate oligonucleotides can be prepared by use of controlled
pore glass polymer
supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451),
etc.
While antisense nucleotides complementary to the Ob or ObR coding region
sequence
could be used, those complementary to the transcribed untranslated region are
most preferred.
For example, antisense oligonucleotides to the ObR coding region having the
following
sequences can be utilized in accordance with the invention:
a) 5'-CATCTTACTTCAGAGAA-3'
b) 5'-CATCTTACTTCAGAGAAGTACAC-3'
c) 5'-CATCTTACTTCAGAGAAGTACACCCATAA-3'
d) 5'-CATCTTACTTCAGAGAAGTACACCCATAATCCTCT-3'
e) 5'-AATCATCTTACTTCAGAGAAGTACACCCATAATCC-3'
f) 5'-CTTACTTCAGAGAAGTACACCCATAATCC-3'
g) 5'-TCAGAGAAGTACACCCATAATCC-3'
h) 5'-AAGTACACCCATAATCC-3'
The antisense molecules should be delivered to cells which express the Ob or
ObR in
vivo. A number of methods have been developed for delivering antisense DNA or
RNA to
67
CA 02376933 2001-12-11
WO 00/76552 PC'T/US00/15911
cells; e.g., antisense molecules can be injected directly into the tissue
site, or modified
antisense molecules, designed to target the desired cells (e.g., antisense
linked to peptides or
antibodies that specifically bind receptors or antigens expressed on the
target cell surface) can
be administered systemically.
A preferred approach for achieving intracellular concentrations of the
antisense
sufficient to suppress translation of endogenous mRNAs utilizes a recombinant
DNA
construct in which the antisense oligonucleotide is placed under the control
of a strong pol III
or pol II promoter. The use of such a construct to transfect target cells in
the patient will result
in the transcription of sufficient amounts of single stranded RNAs that will
form
complementary base pairs with the endogenous Ob or ObR transcripts and thereby
prevent
translation of the Ob or ObR mRNA, respectively. For example, a vector can be
introduced in
vivo such that it is taken up by a cell and directs the transcription of an
antisense RNA. Such a
vector can remain episomal or become chromosomally integrated, as long as it
can be
transcribed to produce the desired antisense RNA. Such vectors can be
constructed by
recombinant DNA technology methods standard in the art. Vectors can be
plasmid, viral, or
others known in the art, used for replication and expression in mammalian
cells. Expression
of the sequence encoding the antisense RNA can be by any promoter known in the
art to act
in mammalian, preferably human cells. Such promoters can be inducible or
constitutive. Such
promoters include but are not limited to: the SV40 early promoter region
(Bernoist and
Chambon, 1981, Nature 290:304-310), the promoter contained in the 3' long
terminal repeat
of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes
thymidine
kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441-
1445), the
regulatory sequences of the metallothionein gene (Brinster et al., 1982,
Nature 296:39-42),
etc. Any type of plasmid, cosmid, YAC or viral vector can be used to prepare
the recombinant
DNA construct which can be introduced directly into the tissue site; e.g., the
choroid plexus
or hypothalamus. Alternatively, viral vectors can be used which selectively
infect the desired
tissue; (e.g., for brain, herpesvirus vectors may be used), in which case
administration may be
accomplished by another route (e.g., systemically).
Ribozyme molecules-designed to catalytically cleave Ob or ObR mRNA transcripts
can also be used to prevent translation of Ob or ObR mRNA and expression of Ob
or ObR.
68
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
(See, e.g., PCT International Publication W090/11364, published Oct. 4, 1990;
Sarver et al.,
1990, Science 247:1222-1225). While ribozymes that cleave mRNA at site
specific
recognition sequences can be used to destroy Ob or ObR mRNAs, the use of
hammerhead
ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations
dictated by
flanking regions that form complementary base pairs with the target mRNA. The
sole
requirement is that the target mRNA have the following sequence of two bases:
5'-UG-3'. The
construction and production of hammerhead ribozymes is well known in the art
and is
described more fully in Haseloff and Gerlach, 1988, Nature, 334:585-591. There
are hundreds
of potential hammerhead ribozyme cleavage sites within the nucleotide sequence
of human
Ob and ObR cDNA. See, e.g., U.S. Patent No. 5,972,621. Preferably, the
ribozyme is
engineered so that the cleavage recognition site is located near the 5' end of
the Ob or ObR
mRNA; i.e., to increase efficiency and minimize the intracellular accumulation
of
non-functional mRNA transcripts.
For example, hammerhead ribozymes directed to ObR mRNA having the following
sequences can be utilized in accordance with the invention:
a)5'-ACAGAAUUUUUGACAAAUCAAAGCAGANNNNUCUGAGNAGUCCUUACUUC
AGAGAA-3';
b)5'-GGCCCGGGCAGCCUGCCCAAAGCCGGNNNNCCGGAGNAGUCGCCAGACCG
GCUCGUG-3';
c)5'-UGGCAUGCAAGACAAAGCAGGNNNNCCUGAGNAGUCCUUAAAUCUCCAAG
GAGUAA-3';
d)5'-UAUAUGACAAAGCUGUNNNNACAGAGNAGtICCUUGUGUGGUAAAGACACG
-3''
e)5'-AGCACCAAUUGAAUUGAUGGCCAAAGCGGGNNNNCCCGAGNAGUCAACCG
UAACAGUAUGU-3';
f)5'-UGAAAUUGUUUCAGGCUCCAAAGCCGGNNNNCCGGAGNAGUCAAGAAGAG
GACCACAUGUCACUGAUGC-3';
g)S'-GGUUUCUUCAGUGAAAUUACACAAAGCAGCNNNNGCUGAGNAGUCAGUUA
GGUCACACAUC-3 ;
69
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
h)5'-ACCCAUUAUAACACAAAGCUGANNNNUCAGAGNAGUCAUCUGAAGGUUUC
UUC -3'.
The ribozymes of the present invention also include RNA endoribonucleases
(hereinafter "Cech-type ribozymes") such as the one which occurs naturally in
Tetrahymena
thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively
described
by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-578;
Zaug and Cech,
1986, Science, 231:470-475; Zaug, et al., 1986, Nature, 324:429-433; published
International
patent-application No. WO 88/04300 by University Patents Inc.; Been and Cech,
1986, Cell,
47:207-216). The Cech-type ribozymes have an eight base pair active site which
hybridizes to
a target RNA sequence whereafter cleavage of the target RNA takes place. The
invention
encompasses those Cech-type ribozymes which target eight base-pair active site
sequences
that are present in Ob and ObR.
As in the antisense approach, the ribozymes can be composed of modified
oligonucleotides (e.g. for improved stability, targeting, etc.) and should be
delivered to cells
16 which express Ob and ObR in vivo. A preferred method of dE:livety involves
using a DNA
construct "encoding" the ribozyme under the control of a strong constitutive
pol III ur pol Il
promoter, so that transfected cells will produce sufficient quantities of the
ribozyme to
destroy endogenous Ob or ObR messages and inhibit translation. Because
ribozymes, unlike
antisense molecules, are catalytic, a lower intracellular concentration is
required for
efficiency.
Similarly, leptin or leptin receptor inhibition can be achieved by using
"triple helix"
base-pairing methodology. Triple helix pairing compromises the ability of the
double helix to
open sufficiently for the binding of polymerases, transcription factors, or
regulatory
molecules. Techniques for utilizing triple helix technology are well known to
those of skill in
the art. See generally Helene (1991) Anticancer Drug Des. 6(6):569-84; Helene
(1992) Ann.
N. Y. Acad. Sci. 660:27-36; and Maher (1992) Bioassays 14(12):807-15.
Endogenous Ob or ObR gene expression can also be reduced by inactivating or
"knocking out" the Ob or ObR gene or its promoter using targeted homologous
recombination. (E.g., see Smithies et al., 1985, Nature 317:230-234; Thomas &
Capecchi,
1987, Cell 51:503-512; Thompson et al., 1989 Cell 5:313-321; each of which is
incorporated
by reference herein in its entirety). For example, a mutant, non-functional Ob
or ObR (or a
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
completely unrelated DNA sequence) flanked by DNA homologous to the endogenous
Ob or
ObR gene (either the coding regions or regulatory regions) can be used, with
or without a
selectable marker and/or a negative selectable marker, to transfect cells that
express Ob or
ObR in vivo. Insertion of the DNA construct, via targeted homologous
recombination, results
in inactivation of the Ob or ObR gene. Such approaches are particularly suited
in the
agricultural field where modifications to ES (embryonic stem) cells can be
used to generate
animal offspring with an inactive ObR (e.g., see Thomas & Capecchi 1987 and
Thompson
1989, supra). However, this approach can be adapted for use in humans provided
the
recombinant DNA constructs are directly administered or targeted to the
required site in vivo
using appropriate viral vectors, e.g., herpes virus vectors for delivery to
brain tissue; e.g., the
hypothalamus, choroid plexus, or adipose tissue.
Alternatively, endogenous Ob or ObR gene expression can be reduced by
targeting
deoxyribonucleotide sequences complementary to the regulatory region of the Ob
or ObR
gene (i.e., promoters and/or enhancers) to form triple helical structures that
prevent
transcription of the Ob or ObR gene in target cells in the body. (See
generally, Helene, C.
1991, Anticancer Drug Des., 6(6):569-84; Helene, C., et al., 1992, Ann, N.Y.
Accad. Sci.,
660:27-36; and Maher, L. J., 1992, Bioassays 14(12):807-15).
In yet another embodiment of the invention, the activity of Ob or ObR can be
reduced
using a "dominant negative" approach to effectuate an increase in bone mass.
To this end,
constructs which encode defective Ob or ObRs can be used in gene therapy
approaches to
diminish the activity of the Ob or ObR in appropriate target cells. For
example, nucleotide
sequences that direct host cell expression of ObRs in which the CD or a
portion of the CD is
deleted or mutated can be introduced into cells in the choroid plexus or
hypothalamus (either
by in vivo or ex vivo gene therapy methods described above). Alternatively,
targeted
homologous recombination can be utilized to introduce such deletions or
mutations into the
subject's endogenous ObR gene in the hypothalamus or choroid plexus. The
engineered cells
will express non-functional receptors (i.e., an anchored receptor that is
capable of binding its
natural ligand, but incapable of signal transduction). Such engineered cells
present in the
choroid plexus or hypothalamus should demonstrate a diminished response to the
endogenous
Ob ligand, resulting in an increase in bone mass.
71
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
An additional embodiment of the present invention is a method to decrease
leptin
levels by increasing breakdown of leptin protein, i.e., by binding of an
antibody such that the
leptin protein is targeted for removal. An alternative embodiment of the
present invention is
a method to decrease leptin receptor levels by increasing the breakdown of
leptin receptor
protein, i.e., by binding of an antibody such that the leptin receptor protein
is targeted for
removal. Another embodiment is to decrease leptin levels by increasing the
synthesis of a
soluble form of the leptin receptor, which binds to free leptin.
Another embodiment of the present invention is a method to administer
compounds
which affect leptin receptor structure, function or homodimerization
properties. Such
compounds include, but are not limited to, proteins, nucleic acids,
carbohydrates or other
molecules which upon binding alter leptin receptor structure, function, or
homodimerization
properties, and thereby render the receptor ineffectual in its activity.
5.5.2. Restoration or Increase in Ob or ObR Expression or Activity to
Decrease Bone Mass
~JVith respect to an increase in the level of normal Ob or ObR gene expression
and/or
gene product activity, Ob or ObR nucleic acid sequences can be utilized for
the treatment of
bone disorders. Where the cause of the disorder is a defective Ob or ObR,
treatment can be
administered, for example, in the form of gene replacement therapy.
Specifically, one or
more copies of a normal Ob or ObR gene or a portion of the Ob or ObR gene that
directs the
production of an Ob or ObR gene product exhibiting normal function, may be
inserted into
the appropriate cells within a patient or animal subject, using vectors which
include, but are
not limited to, adenovirus, adeno-associated virus, retrovirus and herpes
virus vectors, in
addition to other particles that introduce DNA into cells, such as liposomes.
Because the ObR gene is expressed in the brain, including the choroid plexus
and
hypothalamus, such gene replacement therapy techniques involving ObR should be
capable
of delivering ObR gene sequences to these cell types within patients. Thus,
the techniques for
delivery of the ObR gene sequences should be designed to readily cross the
blood-brain
barrier, which are well known to those of skill in the art (see, e.g., PCT
application,
72
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
publication No. W089/10134, which is incorporated herein by reference in its
entirety), or,
alternatively, should involve direct administration of such ObR gene sequences
to the site of
the cells in which the ObR gene sequences are to be expressed. Alternatively,
targeted
homologous recombination can be utilized to correct the defective endogenous
Ob or ObR
gene in the appropriate tissue. In animals, targeted homologous recombination
can be used to
correct the defect in ES cells in order to generate offspring with a corrected
trait.
Additional methods which may be utilized to increase the overall level of Ob
or ObR
gene expression and/or activity include the introduction of appropriate Ob or
ObR-expressing
cells, preferably autologous cells, into a patient at positions and in numbers
which are
sufficient to ameliorate the symptoms of bone disorders associated with
increased bone mass.
Such cells may be either recombinant or non-recombinant. Among the cells which
can be
administered to increase the overall level of Ob or ObR gene expression in a
patient are
normal cells, preferably choroid plexus cells, or hypothalamus cells which
express the ObR
gene, or adipocytes, which express the Ob gene. The cells can be administered
at the
anatomical site in the brain or in the adipose tissue, or as part of a tissue
graft located at a
different site in the body. Such cell-based gene therapy techniques are well
known to those
skilled in the art, see, e.g., Anderson, et al., U.S. Pat. No. 5,399,349;
Mulligan & Wilson,
U.S. Pat. No. 5,460,959.
Finally, compounds, identified in the assays described above, that stimulate
or
enhance the signal transduced by activated ObR, e.g., by activating downstream
signaling
proteins in the ObR cascade and thereby by-passing the defective ObR, can be
used to
achieve decreased bone mass. The formulation and mode of administration will
depend upon
the physico-chemical properties of the compound. The administration should
include known
techniques that allow for a crossing of the blood-brain barrier.
5.5.3. Gene Therap~pproaches to Controlling Ob and ObR Activity
and Treating or Prventin~ Bone Disease
The expression of Ob and ObR can be controlled in vivo (e.g. at the
transcriptional or
translational level) using gene therapy approaches to regulate Ob and ObR
activity and treat
bone disorders. Certain approaches are described below.
73
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
With respect to an increase in the level of normal Ob and ObR gene expression
and/or
Ob and ObR gene product activity, Ob and ObR nucleic acid sequences can be
utilized for the
treatment of bone diseases. Where the cause of the bone disease is a defective
Ob or ObR
gene, treatment can be administered, for example, in the form of gene
replacement therapy.
Specifically, one or more copies of a normal Ob or ObR gene or a portion of
the gene that
directs the production of a gene product exhibiting normal function, may be
inserted into the
appropriate cells within a patient or animal subject, using vectors which
include, but are not
limited to adenovirus, adeno-associated virus, retrovirus and herpes virus
vectors, in addition
to other particles that introduce DNA into cells, such as liposomes.
Because the ObR gene is expressed in the brain, including the cortex,
thalamus, brain
stem and spinal cord and hypothalamus, such gene replacement therapy
techniques should be
capable of delivering ObR gene sequences to these cell types within patients.
Thus, the
techniques for delivery of the ObR gene sequences should be designed to
readily cross the
blood-brain barrier, which are well known to those of skill in the art (see,
e.g., PCT
application, publication No. W089/10134, which is incorporated herein by
reference in its
entirety), or, alternatively, should involve direct administration of such ObR
gene sequences
to the site of the cells in which the ObR gene sequences are to be expressed.
Alternatively, targeted homologous recombination can be utilized to correct
the
defective endogenous Ob or ObR gene in the appropriate tissue; e.g., adipose
and brain tissue,
respectively. In animals, targeted homologous recombination can be used to
correct the defect
in ES cells in order to generate offspring with a corrected trait.
Additional methods which may be utilized to increase the overall level of Ob
or ObR
gene expression and/or activity include the introduction of appropriate Ob or
ObR-expressing
cells, preferably autologous cells, into a patient at positions and in numbers
which are
sufficient to ameliorate the symptoms of bone disorders, including, but not
limited to,
osteopetrosis, osteosclerosis and osteochondrosis. Such cells may be either
recombinant or
non-recombinant. Among the cells which can be administered to increase the
overall level of
Ob or ObR gene expression in a patient are normal cells, or adipose or
hypothalamus cells
which express the Ob or ObR gene, respectively. The cells can be administered
at the
anatomical site in the adipose tissue or in the brain, or as part of a tissue
graft located at a
different site in the body. Such cell-based gene therapy techniques are well
known to those
74
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
skilled in the art, see, e.g., Anderson, et al., U.S. Pat. No. 5,399,349;
Mulligan & Wilson,
U.S. Pat. No. 5,460,959.
5.6 Pharmaceutical Formulations and Methods of Treating Bone Disorders
The compounds of this invention can be formulated and administered to inhibit
a
variety of bone disease states by any means that produces contact of the
active ingredient with
the agent's site of action in the body of a mammal. They can be administered
by any
conventional means available for use in conjunction with pharmaceuticals,
either as
individual therapeutic active ingredients or in a combination of therapeutic
active ingredients.
They can be administered alone, but are generally administered with a
pharmaceutical carrier
selected on the basis of the chosen route of administration and standard
pharmaceutical
practice.
The dosage administered will be a therapeutically effective amount of the
compound
sufficient to result in amelioration of symptoms of the bone disease and will,
of course, vary
depending upon known factors such as the pharmacodynamic characteristics of
the particular
active ingredient and its mode and route of administration; age, sex, health
and weight of the
recipient; nature and extent of symptoms; kind of concurrent treatment,
frequency of
treatment and the effect desired.
5.6.1 Dose Determinations
Toxicity and therapeutic efficacy of such compounds can be determined by
standard
pharmaceutical procedures in cell cultures or experimental animals, e.g., for
determining the
LDSO (the dose lethal to 50% of the population) and the EDso (the dose
therapeutically
effective in 50% of the population). The dose ratio between toxic and
therapeutic effects is
the therapeutic index and it can be expressed as the ratio LDso /EDso.
Compounds which
exhibit large therapeutic indices are preferred. While compounds that exhibit
toxic side
effects may be used, care should be taken to design a delivery system that
targets such
compounds to the site of affected tissue in order to minimize potential damage
to uninfected
cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used
in
formulating a range of dosage for use in humans. The dosage of such compounds
lies
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
preferably within a range of circulating concentrations that include the EDso
with little or no
toxicity. The dosage may vary within this range depending upon the dosage form
employed
and the route of administration utilized. For any compound used in the method
of the
invention, the therapeutically effective dose can be estimated initially from
cell culture
assays. A dose may be formulated in animal models to achieve a circulating
plasma
concentration range that includes the ICso (i.e., the concentration of the
test compound which
achieves a half maximal inhibition of symptoms) as determined in cell culture.
Such
information can be used to more accurately determine useful doses in humans.
Levels in
plasma may be measured, for example, by high performance liquid
chromatography.
Specific dosages may also be utilized for antibodies. Typically, the preferred
dosage
is 0.1 mg/kg to 100 mg/kg of body weight (generally 10 mg/kg to 20 mg/kg), and
if the
antibody is to act in the brain, a dosage of 50 mg/kg to 100 mg/kg is usually
appropriate. If
the antibody is partially human or fully human, it generally will have a
longer half life within
the human body than other antibodies. Accordingly, lower dosages of partially
human and
fully human antibodies is often possible. Additional modifications may be used
to further
stabilize antibodies. For example, lipidation can be used to stabilize
antibodies and to
enhance uptake and tissue penetration (e.g., into the brain). A method for
lipidation of
antibodies is described by Cruikshank et al. ((1997) J. Acquired Immune
Deficiency
Syndromes and Human Retrovirology 14:193).
A therapeutically effective amount of protein or polypeptide (i. e., an
effective dosage)
ranges from about 0.001 to 30 mg/kg body weight, preferably about 0.01 to 25
mg/kg body
weight, more preferably about 0.1 to 20 mg/kg body weight, and even more
preferably about
1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body
weight.
Moreover, treatment of a subject with a therapeutically effective amount of a
protein,
polypeptide or antibody can include a single treatment or, preferably, can
include a series of
treatments. In a preferred example, a subject is treated with antibody,
protein, or polypeptide
in the range of between about 0.1 to 20 mg/kg body weight, one time per week
for between
about 1 to 10 weeks, preferably between 2 to 8 weeks, more preferably between
about 3 to 7
weeks, and even more preferably for about 4, 5 or 6 weeks.
The present invention further encompasses agents which modulate expression or
activity. An agent may, for example, be a small molecule. For example, such
small
76
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
molecules include, but are not limited to, peptides, peptidomimetics, amino
acids, amino acid
analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide
analogs, organic or
inorganic compounds (i. e,. including heteroorganic and organometallic
compounds) having a
molecular weight less than about 10,000 grams per mole, organic or inorganic
compounds
having a molecular weight less than about 5,000 grams per mole, organic or
inorganic
compounds having a molecular weight less than about 1,000 grams per mole,
organic or
inorganic compounds having a molecular weight less than about 500 grams per
mole, and
salts, esters, and other pharmaceutically acceptable forms of such compounds.
It is understood that appropriate doses of small molecule agents depends upon
a
number of factors known to those or ordinary skill in the art, e.g., a
physician. The doses) of
the small molecule will vary, for example, depending upon the identity, size,
and condition of
the subject or sample being treated, further depending upon the route by which
the
composition is to be administered, if applicable, and the effect which the
practitioner desires
the small molecule to have upon the nucleic acid or polypeptide of the
invention. Exemplary
doses include milligram or microgram amounts of the small molecule per
kilogram of subject
or sample weight (e.g., about 1 microgram per kilogram to about 500 milligrams
per
kilogram, about 100 micrograms per kilogram to about 5 milligrams per
kilogram, or about 1
microgram per kilogram to about 50 micrograms per kilogram.
5.6.2 Formulations and Use
Pharmaceutical compositions for use in accordance with the present invention
may be
formulated in conventional manner using one or more physiologically acceptable
carriers or
excipients.
Thus, the compounds and their physiologically acceptable salts and solvates
may be
formulated for administration by inhalation or insufflation (either through
the mouth or the
nose) or oral, buccal, parenteral or rectal administration.
For oral administration, the pharmaceutical compositions may take the form of,
for
example, tablets or capsules prepared by conventional means with
pharmaceutically
acceptable excipients such as binding agents (e.g., pregelatinised maize
starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g.,
lactose,
microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g.,
magnesium
77
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch
glycolate); or
wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by
methods well
known in the art. Liquid preparations for oral administration may take the
form of, for
example, solutions, syrups or suspensions, or they may be presented as a dry
product for
constitution with water or other suitable vehicle before use. Such liquid
preparations may be
prepared by conventional means with pharmaceutically acceptable additives such
as
suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated
edible fats);
emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g.,
almond oil, oily
esters, ethyl alcohol or fractionated vegetable oils); and preservatives
(e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain
buffer salts,
flavoring, coloring and sweetening agents as appropriate.
Preparations for oral administration may be suitably formulated to give
controlled
release of the active compound.
For buccal administration the compositions may take the form of tablets or
lozenges
formulated in conventional manner.
For administration by inhalation, the compounds for use according to the
present
invention are conveniently delivered in the form of an aerosol spray
presentation from
pressurized packs or a nebulizer, with the use of a suitable propellant, e.g ,
dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane,
carbon dioxide
or other suitable gas. In the case of a pressurized aerosol the dosage unit
may be determined
by providing a valve to deliver a metered amount. Capsules and cartridges of
e.g. gelatin for
use in an inhaler or insufflator may be formulated containing a powder mix of
the compound
and a suitable powder base such as lactose or starch.
The compounds may be formulated for parenteral administration by injection,
e.g., by
bolus injection or continuous infusion. Formulations for injection may be
presented in unit
dosage form, e.g., in ampoules or in mufti-dose containers, with an added
preservative. The
compositions may take such forms as suspensions, solutions or emulsions in
oily or aqueous
vehicles, and may contain formulatory agents such as suspending, stabilizing
and/or
dispersing agents. Alternatively, the active ingredient may be in powder form
for constitution
with a suitable vehicle, e.g., sterile pyrogen-free water, before use. In
general, water, a
78
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
suitable oil, saline, aqueous dextrose (glucose), and related sugar solutions
and glycols such
as propylene glycol or polyethylene glycols are suitable carriers for
parenteral solutions.
Solutions for parenteral administration contain preferably a water soluble
salt of the active
ingredient, suitable stabilizing agents and, if necessary, buffer substances.
Antioxidizing
agents such as sodium bisulfate, sodium sulfite or ascorbic acid, either alone
or combined, are
suitable stabilizing agents. Also used are citric acid and its salts and
sodium
ethylenediaminetetraacetic acid (EDTA). In addition, parenteral solutions can
contain
preservatives such as benzalkonium chloride, methyl- or propyl-paraben and
chlorobutanol.
Suitable pharmaceutical carriers are described in Remington's Pharmaceutical
Sciences, a
standard reference text in this field.
The compounds may also be formulated in rectal compositions such as
suppositories
or retention enemas, e.g., containing conventional suppository bases such as
cocoa butter or
other glycerides.
In addition to the formulations described previously, the compounds may also
be
formulated as a depot preparation. Such long acting formulations may be
administered by
implantation (for example subcutaneously or intramuscularly) or by
intramuscular injection.
Thus, for example, the compounds may be formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion in an acceptable oil) or ion
exchange
resins, or as sparingly soluble derivatives, for example, as a sparingly
soluble salt.
Additionally, standard pharmaceutical methods can be employed to control the
duration of action. These are well known in the art and include control
release preparations
and can include appropriate macromolecules, for example polymers, polyesters,
polyamino
acids, polyvinyl, pyrolidone, ethylenevinylacetate, methyl cellulose,
carboxymethyl cellulose
or protamine sulfate. The concentration of macromolecules as well as the
methods of
incorporation can be adjusted in order to control release. Additionally, the
agent can be
incorporated into particles of polymeric materials such as polyesters,
polyamino acids,
hydrogels, poly (lactic acid) or ethylenevinylacetate copolymers. In addition
to being
incorporated, these agents can also be used to trap the compound in
microcapsules.
The compositions may, if desired, be presented in a pack or dispenser device
which
may contain one or more unit dosage forms containing the active ingredient.
The pack may
79
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
for example comprise metal or plastic foil, such as a blister pack. The pack
or dispenser
device may be accompanied by instructions for administration.
Useful pharmaceutical dosage forms, for administration of the compounds of
this
invention can be illustrated as follows:
Capsules: Capsules are prepared by filling standard two-piece hard gelatin
capsulates
each with the desired amount of powdered active ingredient, 175 milligrams of
lactose, 24
milligrams of talc and 6 milligrams magnesium stearate.
Soft Gelatin Capsules: A mixture of active ingredient in soybean oil is
prepared and
injected by means of a positive displacement pump into gelatin to form soft
gelatin capsules
containing the desired amount of the active ingredient. The capsules are then
washed and
dried.
Tablets: Tablets are prepared by conventional procedures so that the dosage
unit is the
desired amount of active ingredient. 0.2 milligrams of colloidal silicon
dioxide, 5 milligrams
of magnesium stearate, 275 milligrams of microcrystalline cellulose, 11
milligrams of
cornstarch and 98.8 milligrams of lactose. Appropriate coatings may be applied
to increase
palatability or to delay absorption.
Injectable: A parenteral composition suitable for administration by injection
is
prepared by stirring 1.5% by weight of active ingredients in 10% by volume
propylene glycol
and water. The solution is made isotonic with sodium chloride and sterilized.
Suspension: An aqueous suspension is prepared for oral administration so that
each 5
millimeters contain 100 milligrams of finely divided active ingredient, 200
milligrams of
sodium carboxymethyl cellulose, 5 milligrams of sodium benzoate, 1.0 grams of
sorbitol
solution U.S.P. and 0.025 millimeters of vanillin.
Gene Therapy Administration: Where appropriate, the gene therapy vectors can
be
formulated into preparations in solid, semisolid, liquid or gaseous forms such
as tablets,
capsules, powders, granules, ointments, solutions, suppositories, injections,
inhalants, and
aerosols, in the usual ways for their respective route of administration.
Means known in the
art can be utilized to prevent release and absorption of the composition until
it reaches the
target organ or to ensure timed-release of the composition. A pharmaceutically
acceptable
form should be employed which does not ineffectuate the compositions of the
present
invention. In pharmaceutical dosage forms, the compositions can be used alone
or in
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
appropriate association, as well as in combination, with other
pharmaceutically active
compounds.
Accordingly, the pharmaceutical composition of the present invention may be
delivered via various routes and to various sites in an animal body to achieve
a particular
S effect (see, e.g., Rosenfeld et al. (1991), supra; Rosenfeld et al., Clin.
Res., 3 9(2), 31 1A
(1991 a); Jaffe et al., supra; Berkner, supra). One skilled in the art will
recognize that
although more than one route can be used for administration, a particular
route can provide a
more immediate and more effective reaction than another route. Local or
systemic delivery
can be accomplished by administration comprising application or instillation
of the
formulation into body cavities, inhalation or insufflation of an aerosol, or
by parenteral
introduction, comprising intramuscular, intravenous, peritoneal, subcutaneous,
intradermal, as
well as topical administration.
The composition of the present invention can be provided in unit dosage form
wherein
each dosage unit, e.g., a teaspoonful, tablet, solution, or suppository,
contains a
predetermined amount of the composition, alone or in appropriate combination
with other
active agents. The term "unit dosage form" as used herein refers to physically
discrete units
suitable as unitary dosages for human and animal subjects, each unit
containing a
predetermined quantity of the compositions of the present invention, alone or
in combination
with other active agents, calculated in an amount sufficient to produce the
desired effect, in
association with a pharmaceutically acceptable diluent, carrier, or vehicle,
where appropriate.
The specifications for the unit dosage forms of the present invention depend
on the particular
effect to be achieved and the particular pharmacodynamics associated with the
pharmaceutical composition in the particular host.
Accordingly, the present invention also provides a method of transferring a
therapeutic gene to a host, which comprises administering the vector of the
present invention,
preferably as part of a composition, using any of the aforementioned routes of
administration
or alternative routes known to those skilled in the art and appropriate for a
particular
application. The "effective amount" of the composition is such as to produce
the desired
effect in a host which can be monitored using several end-points known to
those skilled in the
art. Effective gene transfer of a vector to a host cell in accordance with the
present invention
to a host cell can be monitored in terms of a therapeutic effect (e.g.
alleviation of some
81
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
symptom associated with the particular disease being treated) or, further, by
evidence of the
transferred gene or expression of the gene within the host (e.g., using the
polymerase chain
reaction in conjunction with sequencing, Northern or Southern hybridizations,
or transcription
assays to detect the nucleic acid in host cells, or using immunoblot analysis,
antibody-
mediated detection, mRNA or protein half life studies, or particularized
assays to detect
protein or polypeptide encoded by the transferred nucleic acid, or impacted in
level or
function due to such transfer).
These methods described herein are by no means all-inclusive, and further
methods to
suit the specific application will be apparent to the ordinary skilled
artisan. Moreover, the
effective amount'of the compositions can be further approximated through
analogy to
compounds known to exert the desired effect.
Furthermore, the actual dose and schedule can vary depending on whether the
compositions are administered in combination with other pharmaceutical
compositions, or
depending on interindividual differences in pharmacokinetics, drug
disposition, and
metabolism. Similarly, amounts can vary in in vitro applications depending on
the particular
cell line utilized (e.g., based on the number of adenoviral receptors present
on the cell surface,
or the ability of the particular vector employed for gene transfer to
replicate in that cell line).
Furthermore, the amount of vector to be added per cell will likely vary with
the length and
stability of the therapeutic gene inserted in the vector, as well as also the
nature of the
sequence, and is particularly a parameter which needs to be determined
empirically, and can
be altered due to factors not inherent to the methods of the present invention
(for instance, the
cost associated with synthesis). One skilled in the art can easily make any
necessary
adjustments in accordance with the exigencies of the particular situation.
The following examples are offered by way of example, and are not intended to
limit
the scope of the invention in any manner.
6 EXAMPLES
6.1 Generation, Characterization and Treatment of Animals
Breeders and mutant mice (C57BL/6J Lep°b, CS 7BL/6J Leprab, C57BL/6J
Ay/a) were
purchased from the Jackson Laboratory. Generation of A-ZIP/F-I transgenic mice
has been
previously reported. (Moitra et al., 1998, Genes Dev 12, 3168-3181) Genotyping
was
82
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
performed according to established protocols (Chua et al., 1997, Genomics 45,
264-270;
Moitra et al., 1998, Genes Dev 12, 3168-3181; Namae et al., 1998, Lab Animal
Sci 48, 103-
104). Animals were fed a regular diet (Purina #5001 ) or, when indicated, a
high fat/high
carbohydrate diet (Bio-serv # F3282). Bone specimens were processed as
described (Ducy et
al., 1999, Genes Dev 13, 1025-1036).
6.2 Demonstration of Bone Mass Phenotype in ob/ob and db/db Mice
Hypogonadism induces an increase in osteoclast number and in bone resorption
activity which leads to a low bone mass phenotype (Riggs and Melton, 1986, N
Engl J Med
314, 1676-1678). Thus, the ob/ob mice that have a hypogonadism of hypothalamic
origin
should have a lower bone mass than wild-type littermates (Ahima et al., 1996,
Nature 382,
250-252; Chehab et al., 1996, Nat Genet 12, 318-320; Ahima et al., 1997, J
Clin Invest 99,
391-395). To determine if the obesity of the ob/ob mice could affect their
expected low bone
mass phenotype, X-ray analysis of vertebrae and long bones of 6-month-old wild-
type and
ob/ob mice was performed using a Faxitron (Phillips). Surprisingly, the bones
of the ob/ob
mice appeared much denser than those of their wild-type littermates (Figure
1A),
demonstrating the presence of a higher amount of mineralized bone matrix.
Given the poor
sensitivity of X-rays to quantify bone mass abnormalities, the increase in
bone density was an
indication of a major change in bone architecture (i.e. affecting more than
30% of the bone
matrix).
Histologic analysis was performed on undecalcified sections stained with the
von
Kossa reagent and counterstained with Kernechtrot (Amling et al., 1999,
Endocrin. 140:4982-
4987). In 3 and 6 month-old mice the presence of many more thick trabeculae in
the bones of
ob/ob mice compared to those of wild-type mice was observed (Figure 1 B). The
cortical bone
was not affected. Histomorphometric quantification according to standard
techniques were
performed (Parfitt et al., 1987, J Bone Min Res 2, 595-610) using the
Osteomeasure Analysis
System (Osteometrics, Atlanta). Statistical differences between groups (n=4 to
6) were
assessed by Student's test. The experiments showed a nearly 2-fold increase in
trabecular
bone volume in long bones and vertebrae of ob/ob mice compared to wild-type
littermates
(Figure 1 C). This phenotype was observed in both sexes. The functional
consequences of this
increase in bone mass were analyzed by comparing the biomechanical properties
of long
83
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
bones of 6 month-old ob/ob mice, wild-type mice, and wild-type mice that have
been
ovariectomized (wild-type-ovx) for 4 months to mimic the hypogonadic state of
the ob/ob
mice. An assay in which femora were tested to failure by three-point bending
on a servo-
hydrolic testing machine (Zwick GmbH & Co.) at a constant displacement rate of
10 mm/min
was used to determine failure load, which is a measure of the strength of the
bones. Failure
load of the bones from wild-type and ob/ob mice were undistinguishable but
significantly
higher than the one observed in the bones of wild-type-ovx mice (Figure 1 D).
This result
indicates that leptin deficiency has a beneficial effect on the biomechanical
properties of the
bones. Analysis of the bones of the db/db mice that have an inactivating
mutation of the leptin
receptor was also performed (Tartaglia et al., 1995, Cell 83, 1263-1271). Like
the ob/ob mice,
the db/db mice are obese and hypogonadic. There was an increase in the number
of trabeculae
in both long bones and vertebrae similar to that observed in ob/ob mice
(Figure 1 E) resulting
in a 3-fold increase in bone volume compared to wild-type mice (Figure 1 F).
This latter result
demonstrates genetically that leptin signals through its known receptor to
affect bone mass.
To whether the high bone mass phenotype of the ob/ob mice could be explained
by
other endocrine abnormalities secondary to the absence of leptin signaling,
serum levels of
hormones whose dysregulation affects bone mass were measured. Ob/ob mice had a
normal
level of parathyroid hormone, a hormone whose deficiency causes high bone
mass. The
animals also have nearly normal IGFl and thyroxin levels but a severe
hypercortisolism. This
is of importance because hypercortisolism inhibits bone formation and is the
second most
frequent cause of bone loss after gonadal failure. Thus, the high bone mass
phenotype of the
ob/ob mice develops despite the coexisitence of two bone loss-favoring
circumstances,
hypogonadalism and hypercorisolism.
6.3 The High Bone Mass Phenotype of the ob/ob and db/db Mice is
Secondary to the Absence of Leptin Signaling and Not to Obesity
The high bone mass phenotype of the ob/ob and ob/db mice could be secondary
either
to a lack of leptin signaling or to the obesity of these mice. To distinguish
between these two
possibilities, several additional groups of mutant mice were analyzed for high
bone mass
phenotype as in Example 2. First, a low fat diet which postpones the
appearance of obesity in
ob/ob mice was fed to ob/ob mice, and they had a normal weight at one month of
age.
84
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
However, the mice already had a high bone mass phenotype at that age (Figure
2A). Second,
heterozygote leptin-deficient mice (ob/+) that are not obese were analyzed.
These animals
also had a high bone mass phenotype (Figure 2B). Third, the bones of other
mouse models of
obesity that are not primarily related to leptin signaling were observed.
Another genetic model
of obesity, the Agouti yellow (Ay/a) mice (Herberg and Coleman, 1977,
Metabolism 26, 59-
99), had a normal bone mass, as did wild-type mice fed with a high fat diet
(Figures 2C and
2D).
Thus, the existence of a high bone mass phenotype in ob/ob mice prior to the
appearance of obesity and in ob/+ mice that are not obese, and its absence in
leptin-unrelated
models of obesity demonstrate that it is the absence of leptin signaling, not
the obesity, that
causes this high bone mass phenotype.
6.4 Increased Osteoblast Function in ob/ob and db/db Mice
The increase in bone mass could be due to an increase in osteoblastic bone
formation,
to a decrease in osteoclastic bone resorption, or to a combination of both
abnormalities. To
study osteoblast function in vivo, the rate of bone formation was quantified
following double
labeling with calcein, a marker of newly formed bone (Figure 3A) as described
(Duct' et al.,
1999, Genes Dev 13, 1025-1036). Calcein was injected twice at 8 day intervals
and animals
were sacrificed two days later. In 3 month-old, and 6 month-old ob/ob mice
there was a 70%
and 60%, respectively, increase of the bone formation rate compared to the one
of wild-type
littermates (Figure 3B). This result demonstrated that the high bone mass
phenotype of the
ob/ob mice was due, at least in part, to an increase in bone formation
activity. Remarkably,
considering the massive increase of the bone formation rate, the surface of
the osteoblasts as
well as the osteoblast number were not increased in ob/ob mice, indicating
that leptin
deficiency affects the function of the osteoblasts and not their
differentiation after birth
(Figure 3C). Likewise, calcein labeling of the db/db mice showed an increase
in the rate of
bone formation in both long bones and vertebrae in the face of a normal number
of
osteoblasts (Figures 3D and 3E). As expected given the existence of the
hypogonadism, the
number of osteoclasts was increased in both mutant mouse strains (Figure 3F)
suggesting that
the high bone mass phenotype of the ob/ob and db/db mice may have developed
despite an
increase in bone resorption.
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
The specificity of the effect of the absence of leptin signaling on osteoblast
function
using the same groups of control animals as above was determined. One month-
old ob/ob
animals fed a low fat diet and heterozygote leptin-deficient mice, both of
which were lean,
also had a significant increase in their rate of bone formation (Figure 3G).
In contrast, Ar/a
mutant mice as well as wild-type mice fed a high fat diet, two leptin-
unrelated models of
obesity, had normal bone formation parameters (Figure 3H).
6.5 Analysis of Osteoclast Function in ob/ob Mice
The coexistence of a high bone mass phenotype and of hypogonadism was so
exceptional that it raised the hypothesis that bone resorption might be
defective in these mice.
The increased urinary elimination of deoxypyridinoline crosslinks (Dpd), a
biochemical
marker of bone resorption (Eyre et al., 1988, Biochem 252, 494-500), in the
ob/ob mice
argued against this hypothesis (wild-type: 10.5 ~ 2.5 nM Dpd/mM creatinine;
ob/ob: 24.0 b
4.0 nM Dpd/mM creatinine). Deoxypyridinoline crosslinks were measured in
morning urines
using the Pyrilinks-D immunoassay kit (Metra Biosystem). Creatinine values
were used for
standardization between samples (Creatinine kit, Metra Biosystem). Circulating
concentration
of 17~i-estradiol and leptin were quantified by radioimmunoassays, using the
third generation
estradiol kit (Diagnostic system laboratories) and the mouse leptin RIA kit
(Linco),
respectively. Estradiol is an estrogen analog and also a Selective Estrogen
Receptor
Modulator (SERM). Coadministration of an estrogen analog with an Ob or ObR
inhibitor
further increases the high bone mass phenotype.
Nevertheless, to address this point more thoroughly the hypogonadism of the
ob/ob
mice was exploited. Hypogonadism normally leads to an increase in osteoclasts
number and
in bone resorptive activity. Thus, if the osteoclasts of the ob/ob mice were
functional,
correcting the hypogonadism of these mice should decrease their rate of bone
resorption by
diminishing the number of osteoclasts and thereby should further increase
their bone mass.
On the other hand, if the osteoclasts of the ob/ob mice were not functioning
properly,
correcting their hypogonadism should not affect the severity of their high
bone mass
phenotype. To determine which of these two possibilities was correct, 17 ~i-
estradiol or
placebo pellets (Innovative Research of America) were implanted subcutaneously
in 2-month-
86
CA 02376933 2001-12-11
WO 00/76552 PCT/LJS00/15911
old female ob/ob mice to maintain a serum concentration of 250 pg/mL. These
animals were
analyzed after a 3-month treatment period.
As expected, the estradiol treatment corrected their hypogonadism as judged by
the
aspect of their uteri and their levels of estradiol in blood (Figure 4A), and
furthermore
resulted in a normalization of the osteoclast number (Figure 4C). It also led
to a further
increase of the high bone mass phenotype of these mice compared to placebo
treated ob/ob
mice, thus eliminating a defect of bone resorption as the origin of the high
bone mass
phenotype in ob/ob mice (Figure 4B). Estradiol-treated ob/ob mice had a 50%
increase in
bone volume compared to estradiol-treated wild-type mice and a 3-fold increase
compared to
untreated wild-type mice at the end of the treatment period (Figure 4D).
Similar results were
obtained in male ob/ob mice treated with testosterone implants. Finally, the
function of the
osteoclasts of ob/ob and db/db mice was studied in vitro in an assay using
hematopoietic
progenitor cells from wild type, ob/ob, or db/db mice and growth factors known
to induce the
differentiation of these cells into functional osteoclasts. Mouse osteoclasts
were generated in
vitro according to protocols previously reported (Simonet et al., 1997, Cell
89, 309-319;
Quinn et al., 1998, Endocrinology 139, 4424-4427). Bone-marrow cells of wt,
ob/ob, and
db/db mice were cultured at an initial density of 106 cells/well on 24-well
tissue culture plates
or dentin chips in a-MEM (Sigma) containing 10% FBS (Hiclone), marine M-CSF 40
ng/mL
(Sigma), RANKL/ODF 25 ng/mL (Peprotech), 10-8 M dexamethasone (Sigma) and 10-g
1,25
dihydroxy vitamin D3. Medium was changed every other day. After 6 days of
culture, cells
were fixed in 3.7% formalin. Osteoclasts formed on plastic plates were stained
for tartrate
resistant acid phosphatase. Cells on dentin chips were removed by treatment
with sodium
hypochloride solution. Dentin chips were then stained with toluidine blue to
visualize
resorption pits.
As shown in Figure 4E, wild-type, ob/ob, and db/db hematopoietic progenitor
cells
differentiated equally well into osteoclasts able to resorb a matrix.
Thus, these experiments demonstrate that there is no detectable functional
defect of
the osteoclasts in ob/ob and db/db mice and establish that the high bone mass
phenotype of
these mouse mutant strains results exclusively from the increase in bone
formation secondary
to the absence of leptin signaling.
87
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
6.6 Absence of Leptin Signaling in Osteoblasts
The previous analyses indicate that leptin is an inhibitor of osteoblastic
bone
formation. Moreover, the existence of a high bone mass phenotype in db/db mice
demonstrates that leptin must bind to its known receptor to fulfill this
function. In theory,
leptin could either act directly on osteoblasts, indirectly through the
release of a second factor
present in fat, or by using a hypothalamic pathway as it does for the control
of body weight.
These three possible mechanisms of action were tested.
Expression of leptin in osteoblasts was studied in subconfluent primary
osteoblast
cultures from wild-type mice which were maintained for 4 days in 10% FBS
mineralization
medium and then subsequently switched to 0.5% for 2 days and replaced daily.
Medium was
replaced 2 hours before a 20 min treatment with 80 ng/mL leptin (Sigma) or 40
ng/mL
Oncostatin M (R&D Diagnostics) or vehicle. RNA extractions were performed
using Triazol
(Gibco). Northern blots were performed with 15 ~g of total RNA according to
methods well
known in the art.
Expression of leptin in osteoblasts could not be detected even after a long
film
exposure, indicating that an autocrine regulation was unlikely (Figure SA).
Leptin expression
could also not be detected in whole bone samples, providing an indirect
argument against a
paracrine regulation of osteoblast function by leptin (Figure SA). In any
case, a paracrine
and/or an endocrine regulation of osteoblast function by leptin would require
that functional
leptin receptors are present on osteoblasts. There are several transcripts of
the leptin receptor,
but only one, Ob-Rb, is thought to have signal transduction ability (Tartaglia
et al., 1995, Cell
83, 1263-1271; Chen et al., 1996, Cell 84, 491-495; Lee et al., 1996, Nature
379, 632-635).
The expression of this transcript of leptin receptor is highly, although not
strictly,
hypothalamus-specific. RT-PCR experiments were performed to search for Ob-Rb
transcripts
in primary osteoblasts and whole bone samples. RT-PCR analysis (27 cycles) of
Ob-Rb
expression was performed on random-primed cDNAs using the following primers:
5'-TGGATAAACC CTTGCTCTTCA-3', and 5'-ACACTGTTAATTTCACACCAGAG-3'
(Friedman and Halaas, 1998, Nature 395, 763-770). Amplification of Hprt was
used as an
internal control for cDNA quality using the following primers:
5'-GTTGAGAGATCATCTCCACC-3', and 5'-AGCGATGATG AACCAGGTTA-3'.
88
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
In several experiments using a number of amplification cycles necessary to
detect Ob-
Rb transcripts in hypothalamus, there was no detection of Ob-Rb expression in
calvaria, long
bone, and primary osteoblast cultures (Figure SB).
To determine whether or not leptin could transduce its signal in osteoblasts,
serum-
starved primary osteoblasts isolated from wild-type mice were treated with
leptin. Primary
osteoblast cultures from calvaria of newborn wild-type or db/db mice were
established as
previously described (Ducy et al., 1999, Genes Dev 13, 1025-1036) and
maintained in
mineralization medium (aMEMI 0.1 mg/mL ascorbic acid; 5 mM a-glycerophosphate)
supplemented with 10% PBS. Cultures of mutant cells were maintained in this
medium for 15
days before analysis. Cultures derived from wild-type mice were maintained for
10 days in
this medium then the percentage of serum was reduced to 0.5% and the medium
supplemented with 1.2 ,ug/mL leptin (Sigma) or vehicle for S days.
The phosphorylation of Stat3, a downstream effector of leptin signaling in its
target
cells (Tartaglia et al., 1995, Cell 83, 1263-1271; Baumann et al., 1996, Proc
Natl Acad Sci
USA 93, 8374-8378; Ghilardi et al., 1996, Proc Nati Acad Sci USA 93, 6231-
6235; Vaisse et
al., 1996, Nat Genet 14, 95-97), was monitored, in addition to the expression
of two
immediate early genes whose transcription is increased following leptin
treatment of target
cells (Elmquist et al., 1997, Endocrinology 138, 839-842). As a positive
control oncostatin-M
that induces Stat3 phosphorylation and activates the expression of the same
two immediate
early genes in osteoblasts (Levy et al., 1996, Endocrinology 137, 1159-1165)
was utilized.
Western blot analysis was performed to determine Stat3 phosphorylation as
follows. Cells
were lysed, protein extracts were separated on a 7.5% SDS-PAGE and blotted on
nitrocellulose (Biorad) for immunoblotting assay by methods well known in the
art. Analysis
of Stat3 phosphorylation was performed using the PhosphoPlus Stat3 (Tyr7O5)
Antibody kit
(New England Biolabs) according to the manufacturer's instructions.
As shown in Figure SC, treatment of osteoblasts with Oncostatin-M did induce
Stat3
phosphorylation while leptin treatment did not. Several doses of leptin,
physiologic and
supraphysiologic, were used in this experiment, yet all of them failed to
induce Stat3
phosphorylation. Similarly, expression of Tisll and c fos, analyzed by
standaxd Northern
analysis methods, was quickly and transiently activated by oncostatin-M but
not by leptin
(Figure SD). Finally, the effect of a long-term leptin treatment of primary
osteoblast cultures
89
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
from wild-type mice on extracellular matrix synthesis and bone matrix
mineralization was
determined. The presence of a collagen-rich extracellular matrix and of
mineralization
nodules was assessed by whole-mount staining of the cultures by the van Gieson
and von
Kossa reagent, respectively. No difference was observed when assessing
collagen synthesis or
mineralization nodule formation between control and leptin-treated cultures
(Figure SE).
Finally, if there is no functional leptin receptor on osteoblasts, then wild-
type and
db/db osteoblasts should be undistinguishable in ex vivo culture. Primary
cultures of
osteoblasts from db/db and wild-type mice were analyzed for their ability to
generate a bona
fide bone extracellular matrix and to mineralize it. For all the parameters
analyzed, which
were alkaline phosphatase staining, type I collagen production and formation
of
mineralization nodules, there was no difference between wild type and db/db
primary
osteoblast cultures (Figure SF). Taken together, these results indicate that
leptin action on
bone formation in the entire animal does not require leptin binding to a
receptor located on
the osteoblasts.
6.7 High Bone Mass in Absence of Fat Tissue
To address the possibility that this action of leptin could require the
presence of fat, a
transgenic mouse model expressing, exclusively in adipocytes, a dominant
negative protein
termed A-ZIP was utilized (Moitra et al., 1998, Genes Dev 12, 3168-3181). This
dominant
negative protein abolishes the DNA-binding ability of most B-ZIP transcription
factors, a
class of transcription factors critical for adipocyte differentiation. As a
result the A-ZIP/F-1
transgenic mice have no white adipose tissue, which is the type of fat
regulated by leptin
signaling, and dramatically reduced amounts of inactive brown adipose tissue.
They also have
a 20-fold reduction in leptin synthesis (Moitra et al., 1998, Genes Dev 12,
3168-3181). In A-
ZIP/F-I transgenic mice the same high bone mass phenotype due to an increase
in osteoblast
function was observed as is seen in ob/ob and db/db mice (Figure 6).
This experiment has two implications. First, it confirms that leptin
deficiency, not
high fat index, is responsible for the high bone mass phenotype of the ob/ob
and db/db mice.
Second, it demonstrates that fat tissue is not a necessary relay for the
action of leptin on bone
formation.
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
6.8 Intracerebroventricular Infusion of Leptin Corrects the High Bone Mass
Phenotype of the ob/ob Mice
The issue of whether leptin binding to its hypothalamic receptor could correct
the high
bone mass phenotype of the ob/ob mice as it can rescue their obesity phenotype
was
addressed. To that end pumps delivering either PBS or leptin (8 ng/hr) in the
third ventricle of
ob/ob mice were inserted as follows. Animals were anesthetized with avertin
and placed on a
stereotaxic instrument (Stoelting). The calvaria was exposed and a 0.7 mm hole
was drilled
upon bregma. A 28-gauge cannula (Brain infusion kit U, Alza) was implanted
into the third
ventricle according to the following coordinates: midline, -0.3 AP, 3 mm
ventral (0 point
bregma). The cannula was secured to the skull with cyanoacrylate, and attached
with Tygon
tubing to an osmotic pump (Alza) placed in the dorsal subcutaneous space of
the animal. The
rate of delivery was 0.25 ~.1/hour (8 ng/hr of leptin (Sigma)) or PBS for 28
days. The dosage
has been previously shown to have no effect when administered systemically
(Halaas et al.,
1997, Proc Nati Acad Sci USA 94, 8878-8883). To be as close as possible to the
biological
situation of the ob/ob mice, the animals in which pumps were inserted were
ovariectomized
to avoid any artificial increase in bone mass due to the correction of their
hypogonadism. The
pumps were left in place for 28 days and double-labeling with calcein was
performed to
measure the bone formation parameters.
Classical histology showed that the bone of leptin-treated mice but not of the
PBS-
treated mice had regained a normal appearance (Figure 7A). They had fewer
trabeculae and
these trabeculae looked more regular than in the PBS-treated ob/ob mice. Bone
volume,
trabeculae thickness and bone formation rates were all significantly decreased
in leptin-
treated mice (Figure 7A). No leptin in the serum of these animals was detected
using a
specific radioimmunoassay. The rescue of the bone phenotype by leptin
intracerebroventricular infusion, together with the absence of measurable
circulating leptin,
demonstrates that control of bone formation is a neuroendocrine leptin-
dependent function.
6.9 Overexpression of Soluble Leptin Receptor (ObRe) Increases Bone Mass
But Does Not Result In Obesity
Mice heterozygous for the absence of leptin (ob/+) have a high bone mass
phenotype
(Figure 2B) suggesting that it could be possible to dissociate the effect of
leptin or leptin
91
CA 02376933 2001-12-11
WO 00/76552 PCT/US00/15911
deficiency on bone mass from its effect on body weight. In order to test this,
transgenic mice
overexpressing a cDNA encoding ObRe, a soluble form of the leptin receptor,
under the
control of the apolipoprotein E promoter (ApoE-ObRe), were generated using
standard
techniques. The ApoE promoter is expressed specifically in liver and, thus, is
able to achieve
high serum concentrations of any secreted protein with which it is connected.
The results of this experiment demonstrate that overexpression of ObRe in the
serum
of wild type mice does not result in obesity or infertility but does result in
a 50% to 100%
increase in bone mass in both sexes at three months of age (Figure 8).
This experiment corroborates, genetically, the role of leptin in regulating
bone
formation, before, and independently of, its role on body weight. It also
verifies that the
ObRe itself, or any derivative of ObRe, can routinely be tested for and used
as a bone
formation enhancing drug for bone loss diseases such as osteoporosis.
All patents and publications mentioned in the specifications are indicative of
the
levels of those skilled in the art to which the invention pertains. All
patents and publications
are herein incorporated by reference to the same extent as if each individual
publication was
specifically and individually indicated to be incorporated by reference.
One skilled in the art readily appreciates that the patent invention is well
adapted to
carry out the objectives and obtain the ends and advantages mentioned as well
as those
inherent therein. Leptin, leptin receptor, leptin antibodies, leptin analogs,
leptin antagonists,
pharmaceutical compositions, treatments, methods, procedures and techniques
described
herein are presently representative of the preferred embodiments and are
intended to be
exemplary and are not intended as limitations of the scope. Changes therein
and other uses
will occur to those skilled in the art which are encompassed within the spirit
of the invention
or defined by the scope of the pending claims.
92
