Note: Descriptions are shown in the official language in which they were submitted.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
DESCRIPTION
SECRETED PROTEIN ZACRP4
BACKGROUND OF THE INVENTION
Complement factor Clq, a subunit of the C 1 enzyme complex, consists
of six copies of three related polypeptides or subunits (A, B and C chains),
with each
polypeptide being about 225 amino acids long with a near amino-terminal
collagen
domain comprised of collagen repeats having the sequence of Gly-Xaa-Pro or Gly-
Xaa-
Xaa and a carboxy-terminal globular Clq domain made up of ten beta strands.
Six
triple helical regions are formed by the collagen domains of the six A, six B
and six C
chains, forming a central region and six stalks. A globular head portion is
formed by
association of the globular carboxy terminal domain of an A, a B and a C
chain. Clq is
therefore composed of six globular heads linked via six collagen-like stalks
to a central
fibril region. Sellar et al., Biochem. J. 274: 481-90, 1991. This
configuration is often
referred to as a bouquet of flowers.
2 o A single C-terminal C 1 q domain has been reported in several other
collagen-like proteins, including zsig37 (WO 99/04000), zsig39 (WO 99/10492),
chipmunk hibernation-associated plasma proteins HP-20, HP-25 and HP-27
(Takamatsu et al., Mol. Cell. Biol. 13: 1516-21, 1993 and Kondo & Kondo, J.
Biol.
Chem. 267: 473-8, 1992), human precerebellin (Urade et al., Proc. Natl. Acad.
Sci.
2 5 USA 88:1069-73, 1991 ), human endothelial cell multimerin (Hayward et al.,
J. Biol.
Chem. 270:18246-51, 1995), vertebrate collagens type VIII and X (Muragaki et
al.,
Eur. J. Biochem. 197:615-22, 1991) and ACRP30 (Scherer et al., J. Biol. Chem.
270 45 : 26746-9, 1995). The structural elements such as folding topologies,
conserved
residues and similar trimer interfaces and intron positions of the Clq domain
of
30 ACRP30 are homologous to the tumor necrosis factor family suggesting a link
between
the TNF and C 1 q families.
Clq has been found to stimulate defense mechanisms as well as trigger
the generation of toxic oxygen species that can cause tissue damage (Tenner,
Behring
Inst. Mitt. 93:241-53, 1993). Clq binding sites are found on platelets.
Additionally
3 5 complement and C 1 q play a role in inflammation. The complement
activation is
initiated by binding of C 1 q to immunoglobulins. Inhibitors of c 1 q and the
complement
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
2
pathway would be useful for anti-inflammatory applications, inhibition of
complement
activation.
The present invention provides such polypeptides for these and other
uses that should be apparent to those skilled in the art from the teachings
herein.
SUMMARY OF THE INVENTION
Within one aspect the invention provides an isolated polypeptide
comprising: a first Clq domain comprising a sequence of SEQ ID N0:3, 10 beta
strands corresponding to amino acid residues 31-35, 52-54, 60-63, 67-69, 73-
84, 89-95,
101-108, 112-126, 131-136 and 150-154 of SEQ ID N0:2, and a cysteine residue
corresponding to residue 70 of SEQ ID N0:2; and a second Clq domain joined to
the
carboxy terminal of said first C 1 q domain, said second C 1 q domain
comprising a
sequence of SEQ ID N0:3, 10 beta strands corresponding to amino acid residues
179-
183, 206-208, 214-217, 221-223, 227-238, 243-249, 254-262, 267-278, 283-288
and
305-309 of SEQ ID N0:2, and a cysteine residue corresponding to residue 223, a
glycine residue corresponding to residue 228 of SEQ ID N0:2. Within one
embodiment the polypeptide further comprises a secretory signal sequence.
Within a
related embodiment the secretory signal sequence comprises amino acid residues
1-16
of SEQ ID N0:2. The invention also provides an isolated polypeptide comprising
a
2 0 sequence of amino acid residues that is at least 80% identical in amino
acid sequence to
residues 17 to 329 of SEQ ID N0:2, wherein the sequence comprises: a first Clq
domain comprising a sequence of SEQ ID N0:3, 10 beta strands corresponding to
amino acid residues 31-35, 52-54, 60-63, 67-69, 73-84, 89-95, 101-108, 112-
126, 131-
136 and 150-154 of SEQ ID N0:2, and a cysteine residue corresponding to
residue 70
2 5 of SEQ ID N0:2; and a second C 1 q domain joined to the carboxy terminal
of the first
Clq domain, the second Clq domain comprising a sequence of SEQ ID N0:3, 10
beta
strands corresponding to amino acid residues 179-183, 206-208, 214-217, 221-
223,
227-238, 243-249, 254-262, 267-278, 283-288 and 305-309 of SEQ ID N0:2, and a
cysteine residue corresponding to residue 223, a glycine residue corresponding
to
3 0 residue 228 of SEQ ID N0:2. Within one embodiment the polypeptide is at
least 90%
identical in amino acid sequence to residues 17 to 329 of SEQ ID N0:2. Within
another embodiment the amino acid percent identity is determined using a FASTA
program with ktup=1, gap opening penalty=10, gap extension penalty=1, and
substitution matrix=blosum62, with other parameters set as default. Within
another
3 5 embodiment any differences between the polypeptide and SEQ ID N0:2 are due
to
conservative amino acid substitutions. Within a further embodiment the
polypeptide
specifically binds with an antibody that specifically binds with a polypeptide
consisting
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
3
of the amino acid sequence of SEQ ID N0:2. Within still another embodiment the
first
Clq domain comprises amino acid residues 17-159 of SEQ ID N0:2. Another
embodiment provides that the second C 1 q domain comprises amino acid residues
160-
328 of SEQ ID N0:2. Still another embodiment provides that the polypeptide
comprises residues 17-328 of SEQ ID N0:2. Another embodiment provides a
polypeptide as described above covalently linked at the amino or carboxyl
terminus to a
moiety selected from the group consisting of affinity tags, toxins,
radionucleotides,
enzymes and fluorophores.
The invention also provides an isolated polypeptide comprising: a signal
sequence, a first Clq domain comprising a sequence of SEQ ID N0:3, 10 beta
strands
corresponding to amino acid residues 31-35, 52-54, 60-63, 67-69, 73-84, 89-95,
101
108, 112-126, 131-136 and 150-154 of SEQ ID N0:2 and a cysteine residue
corresponding to amino acid residue 70 of SEQ ID N0:2; and a second C 1 q
domain
joined to the carboxy terminal of the first C 1 q domain, the second C 1 q
domain
comprising a sequence of SEQ ID N0:3, 10 beta strands corresponding to amino
acid
residues 179-183, 206-208, 214-217, 221-223, 227-238, 243-249, 254-262, 267-
278,
283-288 and 305-309 of SEQ ID N0:2 and a cysteine residue corresponding to
residue
223 of SEQ ID N0:2; wherein the polypeptide specifically binds with an
antibody that
specifically binds with a polypeptide consisting of the amino acid sequence of
SEQ ID
2 0 N0:2.
Also provides is an isolated polypeptide selected from the group
consisting of a) a polypeptide consisting of amino acid residue 17 to amino
acid
residue 159 of SEQ ID N0:2 or b) a polypeptide consisting of amino acid
residue 160
to amino acid residue 329 of SEQ ID N0:2.
2 5 The invention also provides a fusion protein consisting essentially of a
first portion and a second portion joined by a peptide bond, the first portion
consisting
of a polypeptide selected from the group consisting of a) polypeptide as
described
above; b) a polypeptide comprising the amino acid sequence of residues 17-159
of SEQ
ID N0:2; c) a polypeptide comprising the amino acid sequence of residues 160-
329 of
3 o SEQ ID N0:2; and d) a polypeptide comprising the amino acid sequence of
residues
17-329 of SEQ ID N0:2; and the second portion comprising another polypeptide.
Also provides is a polypeptide as described above in combination with a
pharmaceutically acceptable vehicle.
Within another aspect the invention provides a method of producing an
3 5 antibody to a polypeptide comprising: inoculating an animal with a
polypeptide
selected from the group consisting of: a) polypeptide as described above; b) a
polypeptide comprising the amino acid sequence of residues 17-159 of SEQ ID
N0:2;
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
4
c) a polypeptide comprising the amino acid sequence of residues 160-329 of SEQ
ID
N0:2; d) a polypeptide comprising the amino acid sequence of residues 17-329
of SEQ
ID N0:2; and e) a polypeptide or polypeptide fragment of SEQ ID N0:2; and
wherein
the polypeptide elicits an immune response in the animal to produce the
antibody; and
isolating the antibody from the animal.
Also provided is an antibody or antibody fragment that specifically
binds to a polypeptide as described above. Within one embodiment the antibody
is
selected from the group consisting of a) polyclonal antibody; b) murine
monoclonal
antibody; c) humanized antibody derived from b); and d) human monoclonal
antibody.
l0 Within another embodiment the antibody fragment is selected from the group
consisting of F(ab'), F(ab), Fab', Fab, Fv, scFv, and minimal recognition
unit. Within
still another embodiment is provided an anti-idiotype antibody that
specifically binds to
the antibody described above. Also provided by the invention is a binding
protein that
specifically binds to an epitope of a polypeptide as described above.
Within another aspect of the invention is provided an isolated
polynucleotide molecule encoding a polypeptide as described above. The
invention
also provides an isolated polynucleotide molecule encoding a polypeptide
comprising a
sequence of amino acid residues that is at least 80% identical in amino acid
sequence to
residues 17 to 329 of SEQ ID N0:2, wherein the sequence comprises: a first Clq
2 0 domain comprising a sequence of SEQ ID N0:3, 10 beta strands corresponding
to
amino acid residues 31-35, 52-54, 60-63, 67-69, 73-84, 89-95, 101-108, 112-
126, 131-
136 and 150-154 of SEQ ID N0:2, and a cysteine residue corresponding to
residue 70
of SEQ ID N0:2; and a second Clq domain joined to the carboxy terminal of the
first
C 1 q domain, the second C 1 q domain comprising a sequence of SEQ ID N0:3, 10
beta
strands corresponding to amino acid residues 179-183, 206-208, 214-217, 221-
223,
227-238, 243-249, 254-262, 267-278, 283-288 and 305-309 of SEQ ID N0:2, and a
cysteine residue corresponding to residue 223, a glycine residue corresponding
to
residue 228 of SEQ ID N0:2. Within one embodiment the polypeptide is at least
90%
identical in amino acid sequence to residues 17-329 of SEQ ID N0:2. Within
another
3 0 embodiment the amino acid percent identity is determined using a FASTA
program
with ktup=1, gap opening penalty=10, gap extension penalty=1, and substitution
matrix=blosum62, with other parameters set as default. Within still another
embodiment the polypeptide further comprises a secretory signal sequence.
Within a
related embodiment the secretory signal sequence comprises amino acid residues
1-16
3 5 of SEQ ID N0:2. Within another embodiment differences between the
polypeptide and
SEQ ID N0:2 are due to conservative amino acid substitutions. Within still
another
embodiment the polypeptide specifically binds with an antibody that
specifically binds
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
with a polypeptide consisting of the amino acid sequence of SEQ ID N0:2.
Within
another embodiment the polynucleotide molecule remains hybridized following
stringent wash conditions to a polynucleotide consisting of the nucleotide
sequence of
SEQ ID NO:1, or the complement of SEQ ID NO:1. Another embodiment provides
5 that the first Clq domain comprises amino acid residues 17-159 of SEQ ID
N0:2. Also
provided is a polynucleotide wherein the second C 1 q domain comprises amino
acid
residues 160-329 of SEQ ID N0:2. Within another embodiment the polypeptide
comprises residues 17-329 of SEQ ID N0:2.
Also provided by the invention is an isolated polynucleotide molecule
encoding a polypeptide comprising: a signal sequence, a first carboxyl-
terminal Clq
domain comprising a sequence of SEQ ID N0:3, 10 beta strands corresponding to
amino acid residues 31-35, 52-54, 60-63, 67-69, 73-84, 89-95, 101-108, 112-
126, 131
136 and 150-154 of SEQ ID N0:2 and a cysteine residue corresponding to amino
acid
residue 70 of SEQ ID N0:2; and a second carboxyl-terminal C 1 q domain
comprising a
sequence of SEQ ID N0:3, 10 beta strands corresponding to amino acid residues
179-
183, 206-208, 214-217, 221-223, 227-238, 243-249, 254-262, 267-278, 283-288
and
305-309 of SEQ ID N0:2 and a cysteine residue corresponding to residue 223 of
SEQ
ID N0:2; wherein the polypeptide specifically binds with an antibody that
specifically
binds with a polypeptide consisting of the amino acid sequence of SEQ ID N0:2,
and
2 0 the polynucleotide molecule remains hybridized following stringent wash
conditions to
a polynucleotide consisting of the nucleotide sequence of SEQ ID NO:1, or the
complement of SEQ ID NO:1.
The invention further provides an isolated polynucleotide molecule
selected from the group consisting of, a) a sequence of nucleotides from
nucleotide 1 to
nucleotide 1357 of SEQ ID NO:1; b) a contiguous sequence of nucleotides from
nucleotide 210 to nucleotide 1196 of SEQ ID NO:1; c) a contiguous sequence of
nucleotides from nucleotide 258 to nucleotide 1196 of SEQ ID NO:1; d) a
contiguous
sequence of nucleotides from nucleotide 258 to nucleotide 686 of SEQ ID NO:1;
e) a
contiguous polynucleotide encoding a polypeptide consisting of the sequence of
amino
3 0 acid residues 17 to 159 of SEQ ID N0:2; f) a polynucleotide encoding a
polypeptide
consisting of the sequence of amino acid residues 160 to 329 of SEQ ID N0:2;
g) a
polynucleotide encoding a polypeptide consisting of the sequence of amino acid
residues 17 to 329 of SEQ ID N0:2; h) a polynucleotide that remains hybridized
following stringent wash conditions to a polynucleotide consisting of the
nucleotide
sequence of SEQ ID NO:l, or the complement of SEQ ID NO:l; i) the nucleotide
sequences complementary to a), b), c), d), e), f), g) or h) and m) degenerate
nucleotide
sequences of e), f) or g).
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
6
The invention also provides an isolated polynucleotide molecule
encoding a fusion protein consisting essentially of a first portion and a
second portion
joined by a peptide bond, the first portion is selected from the group
consisting of a)
polypeptide according to claim 1; b) a polypeptide comprising the amino acid
sequence
of residues 17-159 of SEQ ID N0:2; c) a polypeptide comprising the amino acid
sequence of residues 160-329 of SEQ ID N0:2; and d) a polypeptide comprising
the
amino acid sequence of residues 17-329 of SEQ ID N0:2; and the second portion
comprising another polypeptide.
Also provided is an isolated polynucleotide molecule consisting of the
sequence of nucleotide 1 to nucleotide 987 of SEQ ID N0:4.
Within another aspect the invention provides ~n expression vector
comprising the following operably linked elements: a transcription promoter; a
DNA
segment encoding a polypeptide as described above; and a transcription
terminator.
Within one embodiment the DNA segment encodes a polypeptide covalently linked
at
the amino or carboxyl terminus to an affinity tag. The invention also provides
that the
DNA segment further encodes a secretory signal sequence operably linked to the
polypeptide. Within a related embodiment the secretory signal sequence
comprises
residues 1-16 of SEQ ID N0:2.
Within another aspect of the invention is a cultured cell into which has
2 0 been introduced an expression vector as described above, wherein the cell
expresses the
polypeptide encoded by the DNA segment.
Also provided is a method of producing a protein comprising: culturing
a cell into which has been introduced an expression vector as described above;
whereby
the cell expresses the polypeptide encoded by the DNA segment; and recovering
the
2 5 expressed protein.
BRIEF DESCRIPTION OF THE DRAWING
The Figure illustrates an alignment of the aromatic motifs within the
first and second C 1 q domains of zacrp4. The aromatic motif within the first
C 1 q
30 domain (Clql) is from amino acid residue 50 to amino acid residue 80 of SEQ
ID
N0:2. The aromatic motif within the second C 1 q domain (C 1 q2) is from amino
acid
residue 203 to amino acid residue 233 of SEQ ID N0:2.
DETAILED DESCRIPTION OF THE INVENTION
3 5 Prior to setting forth the invention in detail, it may be helpful to the
understanding thereof to define the following terms.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
7
The term "affinity tag" is used herein to denote a peptide segment that
can be attached to a polypeptide to provide for purification or detection of
the
polypeptide or provide sites for attachment of the polypeptide to a substrate.
In
principal, any peptide or protein for which an antibody or other specific
binding agent
is available can be used as an affinity tag. Affinity tags include a poly-
histidine tract,
protein A (Nilsson et al., EMBO J. 4:1075, 1985; Nilsson et al., Methods
Enzymol.
198:3, 1991), glutathione S transferase (Smith and Johnson, Gene 67:31, 1988),
substance P, FIagTM peptide (Hopp et al., Biotechnology 6:1204-10, 1988;
available
from Eastman Kodak Co., New Haven, CT), streptavidin binding peptide, or other
antigenic epitope or binding domain. See, in general Ford et al., Protein
Expression
and Purification 2: 95-107, 1991. DNAs encoding affinity tags are available
from
commercial suppliers (e.g., Pharmacia Biotech, Piscataway, NJ).
The term "allelic variant" denotes any of two or more alternative forms
of a gene occupying the same chromosomal locus. Allelic variation arises
naturally
through mutation, and may result in phenotypic polymorphism within
populations.
Gene mutations can be silent (no change in the encoded polypeptide) or may
encode
polypeptides having altered amino acid sequence. The term allelic variant is
also used
herein to denote a protein encoded by an allelic variant of a gene.
The terms "amino-terminal" and "carboxyl-terminal" are used herein to
2 0 denote positions within polypeptides and proteins. Where the context
allows, these
terms are used with reference to a particular sequence or portion of a
polypeptide or
protein to denote proximity or relative position. For example, a certain
sequence
positioned carboxyl-terminal to a reference sequence within a protein is
located
proximal to the carboxyl terminus of the reference sequence, but is not
necessarily at
2 5 the carboxyl terminus of the complete protein.
The term "complement/anti-complement pair" denotes non-identical
moieties that form a non-covalently associated, stable pair under appropriate
conditions.
For instance, biotin and avidin (or streptavidin) are prototypical members of
a
complement/anti-complement pair. Other exemplary complement/anti-complement
3 0 pairs include receptor/ligand pairs, antibody/antigen (or hapten or
epitope) pairs,
sense/antisense polynucleotide pairs, and the like. Where subsequent
dissociation of
the complement/anti-complement pair is desirable, the complement/anti-
complement
pair preferably has a binding affinity of <109 M-~.
The term "complements of a polynucleotide molecule" is a
3 5 polynucleotide molecule having a complementary base sequence and reverse
orientation as compared to a reference sequence. For example, the sequence 5'
ATGCACGGG 3' is complementary to 5' CCCGTGCAT 3'.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
8
The term "contig" denotes a polynucleotide that has a contiguous stretch
of identical or complementary sequence to another polynucleotide. Contiguous
sequences are said to "overlap" a given stretch of polynucleotide sequence
either in
their entirety or along a partial stretch of the polynucleotide. For example,
representative contigs to the polynucleotide sequence 5'-ATGGCTTAGCTT-3' are
5'-
TAGCTTgagtct-3' and 3'-gtcgacTACCGA-5'.
The term "degenerate nucleotide sequence" denotes a sequence of
nucleotides that includes one or more degenerate codons (as compared to a
reference
polynucleotide molecule that encodes a polypeptide). Degenerate codons contain
l0 different triplets of nucleotides, but encode the same amino acid residue
(i.e., GAU and
GAC triplets each encode Asp).
The term "expression vector" denotes a DNA molecule, linear or
circular, that comprises a segment encoding a polypeptide of interest operably
linked to
additional segments that provide for its transcription. Such additional
segments may
include promoter and terminator sequences, and may optionally include one or
more
origins of replication, one or more selectable markers, an enhancer, a
polyadenylation
signal, and the like. Expression vectors are generally derived from plasmid or
viral
DNA, or may contain elements of both.
The term "isolated", when applied to a polynucleotide, denotes that the
2 0 polynucleotide has been removed from its natural genetic milieu and is
thus free of
other extraneous or unwanted coding sequences, and is in a form suitable for
use within
genetically engineered protein production systems. Such isolated molecules are
those
that are separated from their natural environment and include cDNA and genomic
clones. Isolated DNA molecules of the present invention are free of other
genes with
2 5 which they are ordinarily associated, but may include naturally occurring
5' and 3'
untranslated regions such as promoters and terminators. The identification of
associated regions will be evident to one of ordinary skill in the art (see
for example,
Dynan and Tijan, Nature 316:774-78, 1985).
An "isolated" polypeptide or protein is a polypeptide or protein that is
3 0 found in a condition other than its native environment, such as apart from
blood and
animal tissue. In a preferred form, the isolated polypeptide is substantially
free of other
polypeptides, particularly other polypeptides of animal origin. It is
preferred to provide
the polypeptides in a highly purified form, i.e. greater than 95% pure, more
preferably
greater than 99% pure. When used in this context, the term "isolated" does not
exclude
3 5 the presence of the same polypeptide in alternative physical forms, such
as dimers or
alternatively glycosylated or derivatized forms.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
9
The term "operably linked", when referring to DNA segments, denotes
that the segments are arranged so that they function in concert for their
intended
purposes, e.g. transcription initiates in the promoter and proceeds through
the coding
segment to the terminator.
The term "ortholog" denotes a polypeptide or protein obtained from one
species that is the functional counterpart of a polypeptide or protein from a
different
species. Sequence differences among orthologs are the result of speciation.
"Paralogs" are distinct but structurally related proteins made by an
organism. Paralogs are believed to arise through gene duplication. For
example, a
l0 globin, (3-globin, and myoglobin are paralogs of each other.
The term "polynucleotide" denotes a single- or double-stranded polymer
of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural sources,
synthesized in vitro, or prepared from a combination of natural and synthetic
molecules.
Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"),
nucleotides
("nt"), or kilobases ("kb"). Where the context allows, the latter two terms
may describe
polynucleotides that are single-stranded or double-stranded. When the term is
applied
to double-stranded molecules it is used to denote overall length and will be
understood
to be equivalent to the term "base pairs". It will be recognized by those
skilled in the
2 0 art that the two strands of a double-stranded polynucleotide may differ
slightly in length
and that the ends thereof may be staggered as a result of enzymatic cleavage;
thus all
nucleotides within a double-stranded polynucleotide molecule may not be
paired. Such
unpaired ends will in general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid residues joined by peptide
2 5 bonds, whether produced naturally or synthetically. Polypeptides of less
than about 10
amino acid residues are commonly referred to as "peptides".
"Probes and/or primers" as used herein can be RNA or DNA. DNA can
be either cDNA or genomic DNA. Polynucleotide probes and primers are single or
double-stranded DNA or RNA, generally synthetic oligonucleotides, but may be
3 0 generated from cloned cDNA or genomic sequences or its complements.
Analytical
probes will generally be at least 20 nucleotides in length, although somewhat
shorter
probes (14-17 nucleotides) can be used. PCR primers are at least 5 nucleotides
in
length, preferably 1 S or more nt, more preferably 20-30 nt. Short
polynucleotides can
be used when a small region of the gene is targeted for analysis. For gross
analysis of
3 5 genes, a polynucleotide probe may comprise an entire exon or more. Probes
can be
labeled to provide a detectable signal, such as with an enzyme, biotin, a
radionuclide,
fluorophore, chemiluminescer, paramagnetic particle and the like, which are
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
commercially available from many sources, such as Molecular Probes, Inc.,
Eugene,
OR, and Amersham Corp., Arlington Heights, IL, using techniques that are well
known
in the art.
The term "promoter" denotes a portion of a gene containing DNA
5 sequences that provide for the binding of RNA polymerase and initiation of
transcription. Promoter sequences are commonly, but not always, found in the
5' non-
coding regions of genes.
The term "receptor" denotes a cell-associated protein that binds to a
bioactive molecule (i.e., a ligand) and mediates the effect of the ligand on
the cell.
l0 Membrane-bound receptors are characterized by a multi-domain structure
comprising
an extracellular ligand-binding domain and an intracellular effector domain
that is
typically involved in signal transduction. Binding of ligand to receptor
results in a
conformational change in the receptor that causes an interaction between the
effector
domain and other molecules) in the cell. This interaction in turn leads to an
alteration
in the metabolism of the cell. Metabolic events that are linked to receptor-
ligand
interactions include gene transcription, phosphorylation, dephosphorylation,
increases
in cyclic AMP production, mobilization of cellular calcium, mobilization of
membrane
lipids, cell adhesion, hydrolysis of inositol lipids and hydrolysis of
phospholipids.
Most nuclear receptors also exhibit a mufti-domain structure, including an
amino-
2 0 terminal, transactivating domain, a DNA binding domain and a ligand
binding domain.
In general, receptors can be membrane bound, cytosolic or nuclear; monomeric
(e.g.,
thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric
(e.g.,
PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF
receptor, erythropoietin receptor and IL-6 receptor).
2 5 The term "secretory signal sequence" denotes a DNA sequence that
encodes a polypeptide (a "secretory peptide") that, as a component of a larger
polypeptide, directs the larger polypeptide through a secretory pathway of a
cell in
which it is synthesized. The larger peptide is commonly cleaved to remove the
secretory peptide during transit through the secretory pathway.
3 0 A "soluble receptor" is a receptor polypeptide that is not bound to a cell
membrane. Soluble receptors are most commonly ligand-binding receptor
polypeptides
that lack transmembrane and cytoplasmic domains. Soluble receptors can
comprise
additional amino acid residues, such as affinity tags that provide for
purification of the
polypeptide or provide sites for attachment of the polypeptide to a substrate,
or
3 5 immunoglobulin constant region sequences. Many cell-surface receptors have
naturally
occurring, soluble counterparts that are produced by proteolysis or translated
from
alternatively spliced mRNAs. Receptor polypeptides are said to be
substantially free of
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
11
transmembrane and intracellular polypeptide segments when they lack sufficient
portions of these segments to provide membrane anchoring or signal
transduction,
respectively.
T'he term "splice variant" is used herein to denote alternative forms of
RNA transcribed from a gene. Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA molecule, or less commonly
between separately transcribed RNA molecules, and may result in several mRNAs
transcribed from the same gene. Splice variants may encode polypeptides having
altered amino acid sequence. The term splice variant is also used herein to
denote a
l0 protein encoded by a splice variant of an mRNA transcribed from a gene.
Molecular weights and lengths of polymers determined by imprecise
analytical methods (e.g., gel electrophoresis) will be understood to be
approximate
values. When such a value is expressed as "about" X or "approximately" X, the
stated
value of X will be understood to be accurate to X10%.
The present invention is based in part upon the discovery of a novel
DNA sequence that encodes a polypeptide having regions of homology to
complement
factor Clq. The novel DNA sequence encodes a polypeptide having an amino-
terminal
signal sequence (residues 1-16 of SEQ ID N0:2) and two tandem Clq domains
(residues 17-159 and 160-328 of SEQ ID N0:2). An alignment of the two Clq
2 0 domains (see Figure) shows that they share a conserved cysteine residue,
residues 70
and 223 of SEQ ID N0:2. Such a conserved cysteine residue is seen in other
proteins
having a Clq domain, such as ACRP30. There is a fair amount of conserved
structure
within the Clq domains to enable proper folding. An aromatic motif (F-X(5)-
[ND]-
X(4)-[FYWL]-X(6)-F-X(5)-G-X-Y-X-F-X-[FY] (SEQ ID N0:3) is also found within
2 5 both C 1 q domains, residues 50-80 and 203-233 of SEQ ID N0:2. X
represents any
amino acid residue and the number in parentheses () indicates the number of
amino acid
residues. The amino acid residues contained within the square parentheses []
restrict
the choice of amino acid residues at that particular position. Also, the
zacrp4
polypeptides of the present invention include potential phosphorylation sites
at residues
30 38, 244 and 264 of SEQ ID N0:2. Potential myristylation sites are found at
residues
66, 113, 145, 148, 219, 295 and 322 of SEQ ID N0:2. Potential prenylation
sites are
found in association with the conserved cysteine residues at residue 70 and
223 of SEQ
ID N0:2.
The globular C 1 q domain of ACRP30 has been determined to have a 10
35 beta strand "jelly roll" topology (Shapiro and Scherer, Curr. Biol. 8:335-
8, 1998) that
shows significant homology to the TNF family. The two C 1 q domains of zacrp4
each
contain all 10 beta-strands of this structure. Within the first C 1 q domain
the strands
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
12
comprise amino acid residues 31-35, 52-54, 60-63, 67-69, 73-84, 89-95, 101-
108, 112-
126, 131-136 and 150-154 of SEQ ID N0:2. Within the second Clq domain the
strands comprise amino acid residues 179-183, 206-208, 214-217, 221-223, 227-
238,
243-249, 254-262, 267-278, 283-288 and 305-309 of SEQ ID N0:2. These strands
have been designated "A", "A"', "B", "B"', "C", "D", "E", "F", "G" and "H"
respectively.
The C 1 q domains of zacrp4 each have two receptor binding loops.
Within the first Clq domain these loops are found at amino acid residues 37-62
and 94-
108 of SEQ ID N0:2. Within the second C 1 q domain they are found at amino
acid
residues 185-216 and 248-262 of SEQ ID N0:2. Amino acid residues 74 (Gly), 76
(Tyr), 126 (Leu) and 151 (Phe) of SEQ ID N0:2 in the first Clq domain and 228
(Gly),
230 (Tyr), 279 (Leu) and 307 (Phe) of SEQ ID N0:2 within the second Clq domain
appear to be conserved across the superfamily including CD40, TNFa,, TNF(3,
ACRP30
and zacrp4. Those skilled in the art will recognize that these boundaries are
approximate, and are based on alignments with known proteins and predictions
of
protein folding.
The conserved amino acid residues and motifs in the C 1 q domains of the
zacrp4 polypeptide can be used as a tool to identify new family members. For
instance,
reverse transcription-polyrnerase chain reaction (RT-PCR) can be used to
amplify
2 0 sequences encoding the conserved motifs from RNA obtained from a variety
of tissue
sources. In particular, highly degenerate primers designed from conserved
sequences
described herein are useful for this purpose.
Analysis of the tissue distribution of the mRNA corresponding to this
novel DNA using a full length probe showed that zacrp4 is strongly represented
in
2 5 brain, spinal cord, ovary and testis. Zacrp4 is also expressed in adrenal
gland, bone
marrow, thyroid, liver, prostate, small intestine and colon.
The novel zacrp4 polypeptides of the present invention were initially
identified by querying an EST database for sequences having homology with
adipocyte-specific protein homolog zsig37 (W099/04000). Polypeptides
3 0 corresponding to ESTs meeting those search criteria were compared to known
sequences to identify proteins having homology to known Clq domain containing
proteins. The corresponding full length cDNA was identified as described
herein. The
resulting 1357 by sequence is disclosed in SEQ ID NO:1. Zacrp4 shares 35%
identity
at the amino acid level with the Clq domain of murine ACRP30 and 32% with
human
35 ACRP30.
The full nucleotide sequence encoding the zacrp4 polypeptide of SEQ
ID N0:2 was identified from a clone obtained from a total fetus library. Other
libraries
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
13
that might also be searched for such clones include pituitary, brain, spinal
cord, ovary,
testis and the like.
Another aspect of the present invention includes zacrp4 polypeptide
fragments. Preferred fragments include those containing independent C 1 q
domains of
zacrp4 polypeptides, ranging from amino acid 17-159 or 160-328 of SEQ ID N0:2,
a
portion of the zacrp4 polypeptide containing a C 1 q domain or an active
portion of the
Clq domain. These fragments are particularly useful in the study or modulation
of cell
to cell communication, neurotransmission, anti-microbial activity may also be
present
in such fragments.
The present invention also provides polynucleotide molecules, including
DNA and RNA molecules, that encode the zacrp4 polypeptides disclosed herein.
Those
skilled in the art will readily recognize that, in view of the degeneracy of
the genetic
code, considerable sequence variation is possible among these polynucleotide
molecules. SEQ ID N0:4 is a degenerate DNA sequence that encompasses all DNAs
that encode the zacrp4 polypeptide of SEQ ID N0:2. Those skilled in the art
will
recognize that the degenerate sequence of SEQ ID N0:4 also provides all RNA
sequences encoding SEQ ID N0:2 by substituting U for T. Thus, zacrp4
polypeptide-
encoding polynucleotides comprising nucleotide 1 to nucleotide 987 of SEQ ID
N0:4
and their RNA equivalents are contemplated by the present invention. Table 1
sets forth
2 0 the one-letter codes used within SEQ ID N0:4 to denote degenerate
nucleotide
positions. "Resolutions" are the nucleotides denoted by a code letter.
"Complement"
indicates the code for the complementary nucleotide(s). For example, the code
Y
denotes either C or T, and its complement R denotes A or G, A being
complementary to
T, and G being complementary to C.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
14
TABLE 1
Nucleotide Resolutions Complement Resolutions
A A T T
C C G G
G G C C
T T A A
R AIG Y C~T
Y CIT R AIG
M AIC K GIT
K GIT M AIC
S C~G S C~G
W A~T W A~T
H AICIT D A~GIT
B CIGIT V AICIG
V AICIG B CIG~T
D AIGIT H AIC~T
N A~CIGIT N A~CIG~T
The degenerate codons used in SEQ ID N0:4, encompassing all possible
codons for a given amino acid, are set forth in Table 2.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
TABLE 3
Amino One- Degenerate
Acid Letter Codons Codon
Code
Cys C TGC TGT TGY
Ser S AGC AGT TCA TCC TCG TCT WSN
Thr T ACA ACC ACG ACT CAN
Pro P CCA CCC CCG CCT CCN
Ala A GCA GCC GCG GCT GCN
Gly G GGA GGC GGG GGT GGN
Asn N AAC AAT AAY
Asp D GAC GAT GAY
Glu E GAA GAG GAR
Gln Q CAA CAG CAR
His H CAC CAT CAY
Arg R AGA AGG CGA CGC CGG CGT MGN
Lys K AAA AAG AAR
Met M ATG ATG
Ile I ATA ATC ATT ATH
Leu L CTA CTC CTG CTT TTA TTG YTN
Val V GTA GTC GTG GTT GTN
Phe F TTC TTT TTY
Tyr Y TAC TAT TAY
Trp W TGG TGG
Ter . TAA TAG TGA TRR
AsnIAsp B RAY
GluIGln Z SAR
Any X NNN
Gap - ---
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
16
One of ordinary skill in the art will appreciate that some ambiguity is
introduced in determining a degenerate codon, representative of all possible
codons
encoding each amino acid. For example, the degenerate codon for serine (WSN)
can, in
some circumstances, encode arginine (AGR), and the degenerate codon for
arginine
(MGN) can, in some circumstances, encode serine (AGY). A similar relationship
exists
between codons encoding phenylalanine and leucine. Thus, some polynucleotides
encompassed by the degenerate sequence may encode variant amino acid
sequences,
but one of ordinary skill in the art can easily identify such variant
sequences by
reference to the amino acid sequence of SEQ ID N0:2. Variant sequences can be
l0 readily tested for functionality as described herein.
One of ordinary skill in the art will also appreciate that different species
can exhibit "preferential codon usage." In general, see, Grantham, et al.,
Nuc. Acids
Res. 8:1893-912, 1980; Haas, et al. Curr. Biol. 6:315-24, 1996; Wain-Hobson,
et al.,
Gene 13:355-64, 1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm, Nuc.
Acids
Res. 14:3075-87, 1986; Ikemura, J. Mol. Biol. 158:573-97, 1982. As used
herein, the
term "preferential codon usage" or "preferential codons" is a term of art
refernng to
protein translation codons that are most frequently used in cells of a certain
species,
thus favoring one or a few representatives of the possible codons encoding
each amino
acid (See Table 2). For example, the amino acid threonine (Thr) may be encoded
by
2 0 ACA, ACC, ACG, or ACT, but in mammalian cells ACC is the most commonly
used
codon; in other species, for example, insect cells, yeast, viruses or
bacteria, different
Thr codons may be preferential. Preferential codons for a particular species
can be
introduced into the polynucleotides of the present invention by a variety of
methods
known in the art. Introduction of preferential codon sequences into
recombinant DNA
can, for example, enhance production of the protein by making protein
translation more
efficient within a particular cell type or species. Therefore, the degenerate
codon
sequence disclosed in SEQ ID N0:4 serves as a template for optimizing
expression of
polynucleotides in various cell types and species commonly used in the art and
disclosed herein. Sequences containing preferential codons can be tested and
optimized
3 0 for expression in various species, and tested for functionality as
disclosed herein.
The present invention further provides variant polypeptides and nucleic
acid molecules that represent counterparts from other species (orthologs).
These
species include, but are not limited to mammalian, avian, amphibian, reptile,
fish, insect
and other vertebrate and invertebrate species. Of particular interest are
zacrp4
3 5 polypeptides from other mammalian species, including murine, porcine,
ovine, bovine,
canine, feline, equine, and other primate polypeptides. Orthologs of human
zacrp4 can
be cloned using information and compositions provided by the present invention
in
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
17
combination with conventional cloning techniques. For example, a cDNA can be
cloned using mRNA obtained from a tissue or cell type that expresses zacrp4 as
disclosed herein. Suitable sources of mRNA can be identified by probing
northern
blots with probes designed from the sequences disclosed herein. A library is
then
prepared from mRNA of a positive tissue or cell line.
A zacrp4-encoding cDNA can then be isolated by a variety of methods,
such as by probing with a complete or partial human cDNA or with one or more
sets of
degenerate probes based on the disclosed sequences. A cDNA can also be cloned
using
the polymerase chain reaction with primers designed from the representative
human
zacrp4 sequences disclosed herein. Within an additional method, the cDNA
library can
be used to transform or transfect host cells, and expression of the cDNA of
interest can
be detected with an antibody to zacrp4 polypeptide. Similar techniques can
also be
applied to the isolation of genomic clones.
Those skilled in the art will recognize that the sequence disclosed in
SEQ ID NO:1 represents a single allele of human zacrp4, and that allelic
variation and
alternative splicing are expected to occur. Allelic variants of this sequence
can be
cloned by probing cDNA or genomic libraries from different individuals
according to
standard procedures. Allelic variants of the nucleotide sequence shown in SEQ
ID
NO:1, including those containing silent mutations and those in which mutations
result
2 0 in amino acid sequence changes, are within the scope of the present
invention, as are
proteins which are allelic variants of SEQ ID N0:2. cDNA molecules generated
from
alternatively spliced mRNAs, which retain the properties of the zacrp4
polypeptide are
included within the scope of the present invention, as are polypeptides
encoded by such
cDNAs and mRNAs. Allelic variants and splice variants of these sequences can
be
2 5 cloned by probing cDNA or genomic libraries from different individuals or
tissues
according to standard procedures known in the art.
Within preferred embodiments of the invention, the isolated nucleic acid
molecules can hybridize under stringent conditions to nucleic acid molecules
having the
nucleotide sequence of SEQ ID NO:1 or to nucleic acid molecules having a
nucleotide
3 0 sequence complementary to SEQ ID NO: l . In general, stringent conditions
are selected
to be about 5°C lower than the thermal melting point (Tm) for the
specific sequence at
a defined ionic strength and pH. The Tm is the temperature (under defined
ionic
strength and pH) at which 50% of the target sequence hybridizes to a perfectly
matched
probe.
3 5 A pair of nucleic acid molecules, such as DNA-DNA, RNA-RNA and
DNA-RNA, can hybridize if the nucleotide sequences have some degree of
complementarity. Hybrids can tolerate mismatched base pairs in the double
helix, but
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
18
the stability of the hybrid is influenced by the degree of mismatch. T'he Tm
of the
mismatched hybrid decreases by 1°C for every 1-1.5% base pair mismatch.
Varying
the stringency of the hybridization conditions allows control over the degree
of
mismatch that will be present in the hybrid. The degree of stringency
increases as the
hybridization temperature increases and the ionic strength of the
hybridization buffer
decreases. Stringent hybridization conditions encompass temperatures of about
5-25°C
below the Tm of the hybrid and a hybridization buffer having up to 1 M Na+.
Higher
degrees of stringency at lower temperatures can be achieved with the addition
of
formamide which reduces the Tm of the hybrid about 1 °C for each 1 %
formamide in the
buffer solution. Generally, such stringent conditions include temperatures of
20-70°C
and a hybridization buffer containing up to 6xSSC and 0-50% formamide. A
higher
degree of stringency can be achieved at temperatures of from 40-70°C
with a
hybridization buffer having up to 4xSSC and from 0-50% formamide. Highly
stringent
conditions typically encompass temperatures of 42-70°C with a
hybridization buffer
having up to IxSSC and 0-50% formamide. Different degrees of stringency can be
used during hybridization and washing to achieve maximum specific binding to
the
target sequence. Typically, the washes following hybridization are performed
at
increasing degrees of stringency to remove non-hybridized polynucleotide
probes from
hybridized complexes.
2 0 The above conditions are meant to serve as a guide and it is well within
the abilities of one skilled in the art to adapt these conditions for use with
a particular
polypeptide hybrid. The Tm for a specific target sequence is the temperature
(under
defined conditions) at which 50% of the target sequence will hybridize to a
perfectly
matched probe sequence. Those conditions which influence the Tm include, the
size
2 5 and base pair content of the polynucleotide probe, the ionic strength of
the
hybridization solution, and the presence of destabilizing agents in the
hybridization
solution. Numerous equations for calculating Tm are known in the art, and are
specific
for DNA, RNA and DNA-RNA hybrids and polynucleotide probe sequences of varying
length (see, for example, Sambrook et al., Molecular Cloning: A Laboratory
Manual,
3 0 Second Edition (Cold Spring Harbor Press 1989); Ausubel et al., (eds.),
Current
Protocols in Molecular Biology (John Wiley and Sons, Inc. 1987); Berger and
Kimmel
(eds.), Guide to Molecular Cloning Techniques, (Academic Press, Inc. 1987);
and
Wetmur, Crit. Rev. Biochem. Mol. Biol. 26:227 (1990)). Sequence analysis
software,
such as OLIGO 6.0 (LSR; Long Lake, MN) and Primer Premier 4.0 (Premier Biosoft
3 5 International; Palo Alto, CA), as well as sites on the Internet, are
available tools for
analyzing a given sequence and calculating Tm based on user defined criteria.
Such
programs can also analyze a given sequence under defined conditions and
identify
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
19
suitable probe sequences. Typically, hybridization of longer polynucleotide
sequences,
>50 base pairs, is performed at temperatures of about 20-25°C below the
calculated Tm.
For smaller probes, <50 base pairs, hybridization is typically carried out at
the Tm or 5-
10°C below. This allows for the maximum rate of hybridization for DNA-
DNA and
DNA-RNA hybrids.
The length of the polynucleotide sequence influences the rate and
stability of hybrid formation. Smaller probe sequences, <50 base pairs, reach
equilibrium with complementary sequences rapidly, but may form less stable
hybrids.
Incubation times of anywhere from minutes to hours can be used to achieve
hybrid
formation. Longer probe sequences come to equilibrium more slowly, but form
more
stable complexes even at lower temperatures. Incubations are allowed to
proceed
overnight or longer. Generally, incubations are carried out for a period equal
to three
times the calculated Cot time. Cot time, the time it takes for the
polynucleotide
sequences to reassociate, can be calculated for a particular sequence by
methods known
in the art.
The base pair composition of polynucleotide sequence will effect the
thermal stability of the hybrid complex, thereby influencing the choice of
hybridization
temperature and the ionic strength of the hybridization buffer. A-T pairs are
less stable
than G-C pairs in aqueous solutions containing sodium chloride. Therefore, the
higher
2 0 the G-C content, the more stable the hybrid. Even distribution of G and C
residues
within the sequence also contribute positively to hybrid stability. In
addition, the base
pair composition can be manipulated to alter the Tm of a given sequence. For
example,
5-methyldeoxycytidine can be substituted for deoxycytidine and 5-
bromodeoxuridine
can be substituted for thymidine to increase the Tm, whereas 7-deazz-2'-
deoxyguanosine
2 5 can be substituted for guanosine to reduce dependence on Tm .
The ionic concentration of the hybridization buffer also affects the
stability of the hybrid. Hybridization buffers generally contain blocking
agents such as
Denhardt's solution (Sigma Chemical Co., St. Louis, Mo.), denatured salmon
sperm
DNA, tRNA, milk powders (BLOTTO), heparin or SDS, and a Na+ source, such as
SSC
30 (lx SSC: 0.15 M sodium chloride, 15 mM sodium citrate) or SSPE (lx SSPE:
1.8 M
NaCI, 10 mM NaHZP04, 1 mM EDTA, pH 7.7). By decreasing the ionic concentration
of the buffer, the stringency of the hybridization is increased. Typically,
hybridization
buffers contain from between 10 mM - 1 M Na+. The addition of destabilizing or
denaturing agents such as formamide, tetralkylammonium salts, guanidinium
canons or
3 5 thiocyanate cations to the hybridization solution will alter the Tm of a
hybrid.
Typically, formamide is used at a concentration of up to 50% to allow
incubations to be
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
carried out at more convenient and lower temperatures. Formamide also acts to
reduce
non-specific background when using RNA probes.
As an illustration, a nucleic acid molecule encoding a variant zacrp4
polypeptide can be hybridized with a nucleic acid molecule having the
nucleotide
5 sequence of SEQ ID NO:1 at 42°C overnight in a solution comprising
50% formamide,
Sx SSC (lx SSC: 0.15 M sodium chloride and 15 mM sodium citrate), 50 mM sodium
phosphate (pH 7.6), Sx Denhardt's solution (100x Denhardt's solution: 2% (w/v)
Ficoll
400, 2% (w/v) polyvinyl-pyrrolidone, and 2% (w/v) bovine serum albumin), 10%
dextran sulfate, and 20 ~g/ml denatured, sheared salmon sperm DNA. One of
skill in
10 the art can devise variations of these hybridization conditions. For
example, the
hybridization mixture can be incubated at a higher temperature, such as about
65°C, in
a solution that does not contain formamide. Moreover, premixed hybridization
solutions are available (e.g.; EXPRESSHYB Hybridization Solution from CLONTECH
Laboratories, Inc.), and hybridization can be performed according to the
manufacturer's
15 instructions.
Following hybridization, the nucleic acid molecules can be washed to
remove non-hybridized nucleic acid molecules under stringent conditions, or
under
highly stringent conditions. Typical stringent washing conditions include
washing in a
solution of O.Sx-2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 55-
65°C. That is,
2 0 nucleic acid molecules encoding a variant zacrp4 polypeptide hybridize
with a nucleic
acid molecule having the nucleotide sequence of SEQ ID NO:1 (or its
complement)
under stringent washing conditions, in which the wash stringency is equivalent
to O.Sx
2x SSC with 0.1% SDS at 55-65°C, including O.Sx SSC with 0.1% SDS at
55°C, or 2x
SSC with 0.1% SDS at 65°C. One of skill in the art can readily devise
equivalent
conditions, for example, by substituting SSPE for SSC in the wash solution.
Typical highly stringent washing conditions include washing in a
solution of O.lx-0.2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 50-
65°C. In
other words, nucleic acid molecules encoding a variant zacrp4 polypeptide
hybridize
with a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:l (or
its
3 0 complement) under highly stringent washing conditions, in which the wash
stringency
is equivalent to O.lx-0.2x SSC with 0.1% SDS at 50-65°C, including O.lx
SSC with
0.1% SDS at 50°C, or 0.2x SSC with 0.1% SDS at 65°C.
The present invention also provides isolated zacrp4 polypeptides that
have a substantially similar sequence identity to the polypeptides of SEQ ID
N0:2, or
3 5 their orthologs. The term "substantially similar sequence identity" is
used herein to
denote polypeptides having at least 70%, at least 80%, at least 90%, at least
95% or
greater than 95% sequence identity to the sequences shown in SEQ ID N0:2, or
their
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
21
orthologs. The present invention further includes nucleic acid molecules that
encode
such polypeptide variants.
Such nucleic acid molecules can be identified using two criteria: a
determination of the similarity between the encoded polypeptide with the amino
acid
sequence of SEQ ID N0:2, and a hybridization assay, as described herein. Such
zacrp4
sequences include nucleic acid molecules (1) that hybridize with a nucleic
acid
molecule having the nucleotide sequence of SEQ ID NO:1 (or its complement)
under
stringent washing conditions, in which the wash stringency is equivalent to
O.Sx-2x
SSC with 0.1 % SDS at 55-65°C, and (2) that encode a polypeptide having
at least 70%,
at least 80%, at least 90%, at least 95% or greater than 95% sequence identity
to the
amino acid sequence of SEQ ID N0:2. Alternatively, zacrp4 sequence variants
can be
characterized as nucleic acid molecules (1) that hybridize with a nucleic acid
molecule
having the nucleotide sequence of SEQ ID NO:1 (or its complement) under highly
stringent washing conditions, in which the wash stringency is equivalent to
O.lx-0.2x
SSC with 0.1% SDS at 50-65°C, and (2) that encode a polypeptide having
at least 70%,
at least 80%, at least 90%, at least 95% or greater than 95% sequence identity
to the
amino acid sequence of SEQ ID N0:2.
Percent sequence identity is determined by conventional methods. See,
for example, Altschul et al., Bull. Math. Bio. 48:603, 1986, and Henikoff and
Henikoff,
2 0 Proc. Natl. Acad. Sci. USA 89:10915, 1992. Briefly, two amino acid
sequences are
aligned to optimize the alignment scores using a gap opening penalty of 10, a
gap
extension penalty of 1, and the "BLOSUM62" scoring matrix of Henikoff and
Henikoff
ibid.) as shown in Table 3 (amino acids are indicated by the standard one-
letter codes).
The percent identity is then calculated as: ([Total number of identical
matches]/[length
2 5 of the longer sequence plus the number of gaps introduced into the longer
sequence in
order to align the two sequences])(100).
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
22
r1N
M
r-1I
H II1N N
I O
I
Ll~ d~r-~M N
I N
I
I
W I~ ' r1 ~ M
r1I I N
I I
I
W l0d' N N riM
I I r1
I
In O N r1r1 riH
I I I I r1
I
,Y, tllr1 M r1 O r-IM N
I I I I I N
I
I
Hl d~ N N O M N r-IN r1
v-I
M I I I I I I
H d' N M r1 O M N ri M r-I
M
I I I I I I
x 00M M riN riN riN N N
M
H I I I I I I I I I I
CJ l0 N d' ~ N M M N O N N M
I I I I I I I I I M
I
I
W IllN O M M r1N M r1 O r1 M N
I I I I I I I I N
I
I
D! LflN N O M N riO M r1 O ~-iN r-1
I I I I I I I N
I
I
U O1M ~ M M ~-i,-IM r-1N M r1r1 N N
I I I I I I I I I I I I I r1
I
I
l0 M O N r1 r1M ~ riM M r1 O H ~ M
I I I I I I I I I I I M
I
I
z l0ri M O O O r1M M O N M N r1O diN
I I I I I I I M
I
I
(Y., l!1O N M r1 O N O M N N r1 M N r1H M N
I I I I I I I I I I I M
I
I
FI,'d'r1 N N O v-Iv-IO N r-Ir1 riv-IN r1 r1O M N
I I I I I I I I I I I I I O
I
~cx z a a a w a x H a x ~ w r~ ~nH z ~,
In o m O
r-I r1 N
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
23
Those skilled in the art appreciate that there are many established
algorithms available to align two amino acid sequences. The "FASTA" similarity
search algorithm of Pearson and Lipman is a suitable protein alignment method
for
examining the level of identity shared by an amino acid sequence disclosed
herein and
the amino acid sequence of a putative variant zacrp4. The FASTA algorithm is
described by Pearson and Lipman, Proc. Nat. Acad. Sci. USA 85:2444, 1988, and
by
Pearson, Meth. Enzymol. 183:63, 1990.
Briefly, FASTA first characterizes sequence similarity by identifying
regions shared by the query sequence (e.g., SEQ ID N0:2) and a test sequence
that
have either the highest density of identities (if the ktup variable is 1 ) or
pairs of
identities (if ktup=2), without considering conservative amino . acid
substitutions,
insertions, or deletions. The ten regions with the highest density of
identities are then
re-scored by comparing the similarity of all paired amino acids using an amino
acid
substitution matrix, and the ends of the regions are "trimmed" to include only
those
residues that contribute to the highest score. If there are several regions
with scores
greater than the "cutoff' value (calculated by a predetermined formula based
upon the
length of the sequence and the ktup value), then the trimmed initial regions
are
examined to determine whether the regions can be joined to form an approximate
alignment with gaps. Finally, the highest scoring regions of the two amino
acid
2 0 sequences are aligned using a modification of the Needleman-Wunsch-Sellers
algorithm (Needleman and Wunsch, J. Mol. Biol. 48:444, 1970; Sellers, SIAM J.
Appl.
Math. 26:787, 1974), which allows for amino acid insertions and deletions.
Preferred
parameters for FASTA analysis are: ktup=1, gap opening penalty=10, gap
extension
penalty=1, and substitution matrix=BLOSUM62. These parameters can be
introduced
into a FASTA program by modifying the scoring matrix file ("SMATRIX"), as
explained in Appendix 2 of Pearson, Meth. Enzymol. 183:63, 1990.
FASTA can also be used to determine the sequence identity of nucleic
acid molecules using a ratio as disclosed above. For nucleotide sequence
comparisons,
the ktup value can range between one to six, preferably from three to six,
most
3 o preferably three, with other parameters set as default.
The present invention includes nucleic acid molecules that encode a
polypeptide having one or more "conservative amino acid substitutions,"
compared
with the amino acid sequence of SEQ ID N0:2. Conservative amino acid
substitutions
can be based upon the chemical properties of the amino acids. That is,
variants can be
3 5 obtained that contain one or more amino acid substitutions of SEQ ID N0:2,
in which
an alkyl amino acid is substituted for an alkyl amino acid in a zacrp4 amino
acid
sequence, an aromatic amino acid is substituted for an aromatic amino acid in
a zacrp4
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
24
amino acid sequence, a sulfur-containing amino acid is substituted for a
sulfur-
containing amino acid in a zacrp4 amino acid sequence, a hydroxy-containing
amino
acid is substituted for a hydroxy-containing amino acid in a zacrp4 amino acid
sequence, an acidic amino acid is substituted for an acidic amino acid in a
zacrp4 amino
acid sequence, a basic amino acid is substituted for a basic amino acid in a
zacrp4
amino acid sequence, or a dibasic monocarboxylic amino acid is substituted for
a
dibasic monocarboxylic amino acid in a zacrp4 amino acid sequence.
Among the common amino acids, for example, a "conservative amino
acid substitution" is illustrated by a substitution among amino acids within
each of the
following groups: (1) glycine, alanine, valine, leucine, and isoleucine, (2)
phenylalanine, tyrosine, and tryptophan, (3) serine and threonine, (4)
aspartate and
glutamate, (5) glutamine and asparagine, and (6) lysine, arginine and
histidine.
The BLOSUM62 table is an amino acid substitution matrix derived from
about 2,000 local multiple alignments of protein sequence segments,
representing
highly conserved regions of more than 500 groups of related proteins (Henikoff
and
Henikoff, Proc. Natl. Acad. Sci. USA 89:10915, 1992). Accordingly, the
BLOSUM62
substitution frequencies can be used to define conservative amino acid
substitutions that
may be introduced into the amino acid sequences of the present invention.
Although it
is possible to design amino acid substitutions based solely upon chemical
properties (as
2 0 discussed above), the language "conservative amino acid substitution"
preferably refers
to a substitution represented by a BLOSUM62 value of greater than -1. For
example,
an amino acid substitution is conservative if the substitution is
characterized by a
BLOSUM62 value of 0, 1, 2, or 3. According to this system, preferred
conservative
amino acid substitutions are characterized by a BLOSUM62 value of at least 1
(e.g., 1,
2 or 3), while more preferred conservative amino acid substitutions are
characterized by
a BLOSUM62 value of at least 2 (e.g., 2 or 3).
Conservative amino acid changes in a zacrp4 gene can be introduced by
substituting nucleotides for the nucleotides recited in SEQ ID NO:l. Such
"conservative amino acid" variants can be obtained, for example, by
oligonucleotide-
3 0 directed mutagenesis, linker-scanning mutagenesis, mutagenesis using the
polymerase
chain reaction, and the like (see Ausubel (1995) at pages 8-10 to 8-22; and
McPherson
(ed.), Directed Mutagenesis: A Practical Approach (IRL Press 1991)). The
ability of
such variants to promote the neuronal, anti-microbial, regulatory or other
properties of
the wild-type protein can be determined using a standard methods, such as the
assays
3 5 described herein. Alternatively, a variant zacrp4 polypeptide can be
identified by the
ability to specifically bind anti-zacrp4 antibodies.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
The proteins of the present invention can also comprise non-naturally
occurring amino acid residues. Non-naturally occurnng amino acids include,
without
limitation, traps-3-methylproline, 2,4-methanoproline, cis-4-hydroxyproline,
traps-4-
hydroxyproline, N methyl-glycine, allo-threonine, methylthreonine,
hydroxyethyl-
5 cysteine, hydroxyethylhomocysteine, nitroglutamine, homo-glutamine,
pipecolic acid,
thiazolidine carboxylic acid, dehydroproline, 3- and 4-methylproline, 3,3-
dimethyl-
proline, tert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenylalanine, 4-
azaphenylalanine, and 4-fluorophenyl-alanine. Several methods are known in the
art
for incorporating non-naturally occurnng amino acid residues into proteins.
For
l0 example, an in vitro system can be employed wherein nonsense mutations are
suppressed using chemically aminoacylated suppressor tRNAs. Methods for
synthesizing amino acids and aminoacylating tRNA are known in the art.
Transcription
and translation of plasmids containing nonsense mutations is typically carried
out in a
cell-free system comprising an E. coli S30 extract and commercially available
enzymes
15 and other reagents. Proteins are purified by chromatography. See, for
example,
Robertson et al., J. Am. Chem. Soc. 113:2722, 1991, Ellman et al., Methods
Enzymol.
202:301, 1991, Chung et al., Science 259:806, 1993, and Chung et al., Proc.
Nat. Acad.
Sci. USA 90:10145, 1993.
In a second method, translation is carned out in Xenopus oocytes by
20 microinjection of mutated mRNA and chemically aminoacylated suppressor
tRNAs
(Turcatti et al., J. Biol. Chem. 271:19991, 1996). Within a third method, E.
coli cells
are cultured in the absence of a natural amino acid that is to be replaced
(e.g.,
phenylalanine) and in the presence of the desired non-naturally occurring
amino acids)
(e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4
2 5 fluorophenylalanine). The non-naturally occurnng amino acid is
incorporated into the
protein in place of its natural counterpart. See, Koide et al., Biochem.
33:7470, 1994.
Naturally occurring amino acid residues can be converted to non-naturally
occurnng
species by in vitro chemical modification. Chemical modification can be
combined
with site-directed mutagenesis to further expand the range of substitutions
(Wynn and
3 0 Richards, Protein Sci. 2: 395, 1993).
A limited number of non-conservative amino acids, amino acids that are
not encoded by the genetic code, non-naturally occurnng amino acids, and
unnatural
amino acids may be substituted for zacrp4 amino acid residues.
Multiple amino acid substitutions can be made and tested using known
3 5 methods of mutagenesis and screening, such as those disclosed by Reidhaar-
Olson and
Sauer Science 241:53, 1988) or Bowie and Sauer (Proc. Nat. Acad. Sci. USA
86:2152,
1989). Briefly, these authors disclose methods for simultaneously randomizing
two or
CA 02378951 2001-12-28
WO 01!02565 PCT/US00/17692
26
more positions in a polypeptide, selecting for functional polypeptide, and
then
sequencing the mutagenized polypeptides to determine the spectrum of allowable
substitutions at each position. Other methods that can be used include phage
display
(e.g., Lowman et al., Biochem. 30:10832, 1991, Ladner et al., U.S. Patent No.
5,223,409, Huse, international publication No. WO 92/06204, and region-
directed
mutagenesis (Derbyshire et al., Gene 46:145, 1986, and Ner et al., DNA 7:127,
1988).
Variants of the disclosed zacrp4 nucleotide and polypeptide sequences
can also be generated through DNA shuffling as disclosed by Stemmer, Nature
370:389, 1994, Stemmer, Proc. Nat. Acad. Sci. USA 91:10747, 1994, and
international
publication No. WO 97/20078. Briefly, variant DNA molecules are generated by
in
vitro homologous recombination by random fragmentation of a parent DNA
followed
by reassembly using PCR, resulting in randomly introduced point mutations.
This
technique can be modified by using a family of parent DNA molecules, such as
allelic
variants or DNA molecules from different species, to introduce additional
variability
into the process. Selection or screening for the desired activity, followed by
additional
iterations of mutagenesis and assay provides for rapid "evolution" of
sequences by
selecting for desirable mutations while simultaneously selecting against
detrimental
changes.
Mutagenesis methods as disclosed herein can be combined with high-
2 0 throughput, automated screening methods to detect activity of cloned,
mutagenized
polypeptides in host cells. Mutagenized DNA molecules that encode biologically
active polypeptides, or polypeptides that bind with anti-zacrp4 antibodies,
can be
recovered from the host cells and rapidly sequenced using modern equipment.
These
methods allow the rapid determination of the importance of individual amino
acid
residues in a polypeptide of interest, and can be applied to polypeptides of
unknown
structure.
Essential amino acids in the polypeptides of the present invention can be
identified according to procedures known in the art, such as site-directed
mutagenesis
or alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081, 1989,
3 0 Bass et al., Proc. Nat. Acad. Sci. USA 88:4498, 1991, Coombs and Corey,
"Site-
Directed Mutagenesis and Protein Engineering," in Proteins: Analysis and
Design,
Angeletti (ed.), pages 259-311 (Academic Press, Inc. 1998)). In the latter
technique,
single alanine mutations are introduced at every residue in the molecule, and
the
resultant mutant molecules are tested for biological activity as disclosed
below to
3 5 identify amino acid residues that are critical to the activity of the
molecule. See also,
Hilton et al., J. Biol. Chem. 271:4699, 1996. The identities of essential
amino acids can
also be inferred from analysis of homologies with zacrp4.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
27
The location of zacrp4 receptor binding domains can be identified by
physical analysis of structure, as determined by such techniques as nuclear
magnetic
resonance, crystallography, electron diffraction or photoaffinity labeling, in
conjunction
with mutation of putative contact site amino acids. See, for example, de Vos
et al.,
Science 255:306, 1992, Smith et al., J. Mol. Biol. 224:899, 1992, and Wlodaver
et al.,
FEBS Lett. 309:59, 1992. Moreover, zacrp4 labeled with biotin or FITC can be
used
for expression cloning of zacrp4 receptors.
The present invention also provides polypeptide fragments or peptides
comprising an epitope-bearing portion of a zacrp4 polypeptide described
herein. Such
fragments or peptides may comprise an "immunogenic epitope," which is a part
of a
protein that elicits an antibody response when the entire protein is used as
an
immunogen. Immunogenic epitope-bearing peptides can be identified using
standard
methods (see, for example, Geysen et al., Proc. Nat. Acad. Sci. USA 81:3998,
1983).
In contrast, polypeptide fragments or peptides may comprise an
"antigenic epitope," which is a region of a protein molecule to which an
antibody can
specifically bind. Certain epitopes consist of a linear or contiguous stretch
of amino
acids, and the antigenicity of such an epitope is not disrupted by denaturing
agents. It
is known in the art that relatively short synthetic peptides that can mimic
epitopes of a
protein can be used to stimulate the production of antibodies against the
protein (see,
for example, Sutcliffe et al., Science 219:660, 1983). Antibodies that
recognize short,
linear epitopes are particularly useful in analytic and diagnostic
applications that
employ denatured protein, such as Western blotting (Tobin, Proc. Natl. Acad.
Sci. USA
76:4350-6, 1979), or in the analysis of fixed cells or tissue samples.
Antibodies to linear
epitopes are also useful for detecting fragments of zacrp4, such as might
occur in body
2 5 fluids or cell culture media. Accordingly, antigenic epitope-bearing
peptides and
polypeptides of the present invention are useful to raise antibodies that bind
with the
polypeptides described herein.
Antigenic epitope-bearing peptides and polypeptides preferably contain
at least four to ten amino acids, at least ten to fifteen amino acids, or
about 15 to about
3 0 30 amino acids of SEQ ID N0:2. Such epitope-bearing peptides and
polypeptides can
be produced by fragmenting a zacrp4 polypeptide, or by chemical peptide
synthesis, as
described herein. Moreover, epitopes can be selected by phage display of
random
peptide libraries (see, for example, Lane and Stephen, Curr. Opin. Immunol.
5:268,
1993, and Cortese et al., Curr. Opin. Biotechnol. 7:616, 1996). Standard
methods for
3 5 identifying epitopes and producing antibodies from small peptides that
comprise an
epitope are described, for example, by Mole, "Epitope Mapping," in Methods in
Molecular Biology, Vol. 10, Manson (ed.), pages 105-16 (The Humana Press, Inc.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
28
1992), Price, "Production and Characterization of Synthetic Peptide-Derived
Antibodies," in Monoclonal Antibodies: Production, Engineering, and Clinical
Application, Ritter and Ladyman (eds.), pages 60-84 (Cambridge University
Press
1995), and Coligan et al. (eds.), Current Protocols in Immunology, pages 9.3.1
- 9.3.5
and pages 9.4.1 - 9.4.11 (John Wiley & Sons 1997).
Regardless of the particular nucleotide sequence of a variant zacrp4
gene, the gene encodes a polypeptide that is characterized by its neuronal,
anti-
microbial, regulatory or other activities of the wild-type protein, or by the
ability to
bind specifically to an anti-zacrp4 antibody. More specifically, variant
zacrp4 genes
encode polypeptides which exhibit at least 50%, and preferably, greater than
70, 80, or
90%, of the activity of polypeptide encoded by the human zac~-p4 gene
described
herein.
For any zacrp4 polypeptide, including variants and fusion proteins, one
of ordinary skill in the art can readily generate a fully degenerate
polynucleotide
sequence encoding that variant using the information set forth in Tables 1 and
2 herein.
Moreover, those of skill in the art can use standard software to devise zacrp4
variants
based upon the nucleotide and amino acid sequences described herein.
Accordingly,
the present invention includes a computer-readable medium encoded with a data
structure that provides at least one of the following sequences: SEQ ID NO:1,
SEQ ID
2 0 N0:2, and SEQ ID NO:10. Suitable forms of computer-readable media include
magnetic media and optically-readable media. Examples of magnetic media
include a
hard or fixed drive, a random access memory (RAM) chip, a floppy disk, digital
linear
tape (DLT), a disk cache, and a ZIP disk. Optically readable media are
exemplified by
compact discs (e.g., CD-read only memory (ROM), CD-rewritable (RW), and CD-
2 5 recordable), and digital versatile/video discs (DVD) (e.g., DVD-ROM, DVD-
RAM,
and DVD+RW).
The present invention also provides zacrp4 fusion proteins. For
example, fusion proteins of the present invention encompass a polypeptide
selected
from the group consisting of (a) polypeptide molecules comprising a sequence
of
3 0 amino acid residues as shown in SEQ ID N0:2 from amino acid residue 1 to
residue
329; (b) polypeptide molecules ranging from amino acid residue 17 to residue
159 of
SEQ ID N0:2, (c) polypeptide molecules ranging from amino acid residue 160 to
residue 328 of SEQ ID N0:2 or (d) a portion of the zacrp4 polypeptide
containing a
Clq domain or an active portion of a Clq domain; and another polypeptide. The
other
3 5 polypeptide may be alternative or additional C 1 q domains, a collagen-
like domain, a
signal peptide to facilitate secretion of the fusion protein or the like. The
globular
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
29
domain of complement binds IgG, thus, the globular Clq domains of zacrp4
polypeptides, fragments or fusions may have a similar ability.
Zacrp4 polypeptides, ranging from amino acid 1 (Met) to amino acid
328 of SEQ ID N0:2; the mature zacrp4 polypeptides, ranging from amino acid 17
to
amino acid 328 of SEQ ID N0:2; or the secretion leader fragments thereof,
which
fragments range from amino acid 1 to amino acid 16 of SEQ ID N0:2 may be used
in
the study of secretion of proteins from cells. In preferred embodiments of
this aspect of
the present invention, the mature polypeptides are formed as fusion proteins
with
putative secretory signal sequences; plasmids bearing regulatory regions
capable of
directing the expression of the fusion protein is introduced into test cells;
and secretion
of mature protein is monitored. The monitoring may be done by techniques known
in
the art, such as HPLC and the like.
The polypeptides of the present invention, including full-length proteins,
fragments thereof and fusion proteins, can be produced in genetically
engineered host
cells according to conventional techniques. Suitable host cells are those cell
types that
can be transformed or transfected with exogenous DNA and grown in culture, and
include bacteria, fungal cells, and cultured higher eukaryotic cells.
Eukaryotic cells,
particularly cultured cells of multicellular organisms, are preferred.
Techniques for
manipulating cloned DNA molecules and introducing exogenous DNA into a variety
of
2 0 host cells are disclosed by Sambrook et al., ibid., and Ausubel et al.
ibid.
In general, a DNA sequence encoding a zacrp4 polypeptide of the
present invention is operably linked to other genetic elements required for
its
expression, generally including a transcription promoter and terminator within
an
expression vector. The vector will also commonly contain one or more
selectable
2 5 markers and one or more origins of replication, although those skilled in
the art will
recognize that within certain systems selectable markers may be provided on
separate
vectors, and replication of the exogenous DNA may be provided by integration
into the
host cell genome. Selection of promoters, terminators, selectable markers,
vectors and
other elements is a matter of routine design within the level of ordinary
skill in the art.
3 0 Many such elements are described in the literature and are available
through
commercial suppliers.
To direct a zacrp4 polypeptide into the secretory pathway of a host cell,
a secretory signal sequence (also known as a leader sequence, signal sequence,
prepro
sequence or pre-sequence) is provided in the expression vector. The secretory
signal
3 5 sequence may be that of the zacrp4 polypeptide, or may be derived from
another
secreted protein (e.g., t-PA) or synthesized de novo. The secretory signal
sequence is
joined to the zacrp4 polypeptide DNA sequence in the correct reading frame.
Secretory
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
signal sequences are commonly positioned 5' to the DNA sequence encoding the
polypeptide of interest, although certain signal sequences may be positioned
elsewhere
in the DNA sequence of interest (see, e.g., Welch et al., U.S. Patent No.
5,037,743;
Holland et al., U.S. Patent No. 5,143,830). Conversely, the signal sequence
portion of
5 the zacrp4 polypeptide (amino acids 1-16 of SEQ ID N0:2) may be employed to
direct
the secretion of an alternative protein by analogous methods.
The secretory signal sequence contained in the polypeptides of the
present invention can be used to direct other polypeptides into the secretory
pathway.
The present invention provides for such fusion polypeptides. A signal fusion
l0 polypeptide can be made wherein a secretory signal sequence derived from
amino acid
residues 1-16 of SEQ ID N0:2 is operably linked to another polypeptide using
methods
known in the art and disclosed herein. The secretory signal sequence contained
in the
fusion polypeptides of the present invention is preferably fused amino-
terminally to an
additional peptide to direct the additional peptide into the secretory
pathway. Such
15 constructs have numerous applications known in the art. For example, these
novel
secretory signal sequence fusion constructs can direct the secretion of an
active
component of a normally non-secreted protein, such as a receptor. Such fusions
may be
used in vivo or in vitro to direct peptides through the secretory pathway.
Cultured mammalian cells are suitable hosts within the present
2 0 invention. Methods for introducing exogenous DNA into mammalian host cells
include
calcium phosphate-mediated transfection (Wigler et al., Cell 14:725, 1978;
Corsaro and
Pearson, Somatic Cell Genetics 7:603, 1981: Graham and Van der Eb, Virology
52:456, 1973), electroporation (Neumann et al., EMBO J. 1:841-5, 1982), DEAE-
dextran mediated transfection (Ausubel et al., ibid.), and liposome-mediated
25 transfection (Hawley-Nelson et al., Focus 15:73, 1993; Ciccarone et al.,
Focus 15:80,
1993, and viral vectors (Miller and Rosman, BioTechniques 7:980-90, 1989; Wang
and
Finer, Nature Med. 2:714-6, 1996). The production of recombinant polypeptides
in
cultured mammalian cells is disclosed, for example, by Levinson et al., U.S.
Patent No.
4,713,339; Hagen et al., U.S. Patent No. 4,784,950; Palmiter et al., U.S.
Patent No.
30 4,579,821; and Ringold, U.S. Patent No. 4,656,134. Suitable cultured
mammalian cells
include the COS-1 (ATCC No. CRL 1650), COS-7 (ATCC No. CRL 1651), BHK
(ATCC No. CRL 1632), BHK 570 (ATCC No. CRL 10314), 293 (ATCC No. CRL
1573; Graham et al., J. Gen. Virol. 36:59-72, 1977) and Chinese hamster ovary
(e.g.
CHO-K1; ATCC No. CCL 61, CHO DG44 (Chasm et al., Som. Cell. Mol. Genet.
12:555-666, 1986)) cell lines. Additional suitable cell lines are known in the
art and
available from public depositories such as the American Type Culture
Collection,
Manassas, VA. In general, strong transcription promoters are preferred, such
as
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
31
promoters from SV-40 or cytomegalovirus. See, e.g., U.S. Patent No. 4,956,288.
Other suitable promoters include those from metallothionein genes (U.S. Patent
Nos.
4,579,821 and 4,601,978) and the adenovirus major late promoter.
Drug selection is generally used to select for cultured mammalian cells
into which foreign DNA has been inserted. Such cells are commonly referred to
as
"transfectants". Cells that have been cultured in the presence of the
selective agent and
are able to pass the gene of interest to their progeny are referred to as
"stable
transfectants." A preferred selectable marker is a gene encoding resistance to
the
antibiotic neomycin. Selection is carned out in the presence of a neomycin-
type drug,
l0 such as G-418 or the like. Selection systems may also be used to increase
the
expression level of the gene of interest, a process referred to ,as
"amplification."
Amplification is carned out by culturing transfectants in the presence of a
low level of
the selective agent and then increasing the amount of selective agent to
select for cells
that produce high levels of the products of the introduced genes. A preferred
amplifiable selectable marker is dihydrofolate reductase, which confers
resistance to
methotrexate. Other drug resistance genes (e.g., hygromycin resistance, multi-
drug
resistance, puromycin acetyltransferase) can also be used. Alternative markers
that
introduce an altered phenotype, such as green fluorescent protein, or cell
surface
proteins such as CD4, CDB, Class I MHC, placental alkaline phosphatase may be
used
2 0 to sort transfected cells from untransfected cells by such means as FACS
sorting or
magnetic bead separation technology.
Other higher eukaryotic cells can also be used as hosts, including plant
cells, insect cells and avian cells. The use of Agrobacterium rhizogenes as a
vector for
expressing genes in plant cells has been reviewed by Sinkar et al., J. Biosci.
2 5 (Ban alore 11:47-58, 1987. Transformation of insect cells and production
of foreign
polypeptides therein is disclosed by Guarino et al., U.S. Patent No. 5,162,222
and
WIPO publication WO 94/06463. Insect cells can be infected with recombinant
baculovirus, commonly derived from Autographa californica nuclear polyhedrosis
virus (AcNPV). See, King and Possee, The Baculovirus Expression System: A
3 0 Laboratory Guide, London, Chapman & Hall; O'Reilly et al., Baculovirus
Expression
Vectors: A Laboratory Manual, New York, Oxford University Press., 1994; and,
Richardson, C. D., Ed., Baculovirus Expression Protocols. Methods in Molecular
Biology, Totowa, NJ, Humana Press, 1995. A second method of making recombinant
zacrp4 baculovirus utilizes a transposon-based system described by Luckow
(Luckow
3 5 et al., J. Virol. 67:4566-79, 1993). This system, which utilizes transfer
vectors, is sold
in the Bac-to-BacT"~ kit (Life Technologies, Rockville, MD). This system
utilizes a
transfer vector, pFastBaclT"" (Life Technologies) containing a Tn7 transposon
to move
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
32
the DNA encoding the zacrp4 polypeptide into a baculovirus genome maintained
in E.
coli as a large plasmid called a "bacmid." The pFastBaclT"~ transfer vector
utilizes the
AcNPV polyhedrin promoter to drive the expression of the gene of interest, in
this case
zacrp4. However, pFastBaclTM can be modified to a considerable degree. 'The
polyhedrin promoter can be removed and substituted with the baculovirus basic
protein
promoter (also known as Pcor, p6.9 or MP promoter) which is expressed earlier
in the
baculovirus infection, and has been shown to be advantageous for expressing
secreted
proteins. See, Hill-Perkins and Possee, J. Gen. Virol. 71:971-6, 1990; Bonning
et al., J.
Gen. Virol. 75:1551-6, 1994; and, Chazenbalk, and Rapoport, J. Biol. Chem.
270:1543-
9, 1995. In such transfer vector constructs, a short or long version of the
basic protein
promoter can be used. Moreover, transfer vectors can be constructed which
replace the
native zacrp4 secretory signal sequences with secretory signal sequences
derived from
insect proteins. For example, a secretory signal sequence from Ecdysteroid
Glucosyltransferase (EGT), honey bee Melittin (Invitrogen, Carlsbad, CA), or
baculovirus gp67 (PharMingen, San Diego, CA) can be used in constructs to
replace the
native zacrp4 secretory signal sequence. In addition, transfer vectors can
include an in-
frame fusion with DNA encoding an epitope tag at the C- or N-terminus of the
expressed zacrp4 polypeptide, for example, a Glu-Glu epitope tag (Grussenmeyer
et al.,
Proc. Natl. Acad. Sci. 82:7952-4, 1985). Using a technique known in the art, a
transfer
2 0 vector containing zacrp4 is transformed into E. coli, and screened for
bacmids which
contain an interrupted lacZ gene indicative of recombinant baculovirus. The
bacmid
DNA containing the recombinant baculovirus genome is isolated, using common
techniques, and used to transfect Spodoptera frugiperda cells, e.g. Sf~ cells.
Recombinant virus that expresses zacrp4 is subsequently produced. Recombinant
viral
2 5 stocks are made by methods commonly used the art.
The recombinant virus is used to infect host cells, typically a cell line
derived from the fall armyworm, Spodoptera frugiperda. See, in general, Glick
and
Pasternak, Molecular Biotechnology: Principles and Applications of Recombinant
DNA, ASM Press, Washington, D.C., 1994. Another suitable cell line is the High
3 0 FiveOT"' cell line (Invitrogen) derived from Trichoplusia ni (U.S. Patent
#5,300,435).
Commercially available serum-free media are used to grow and maintain the
cells.
Suitable media are Sf~00 IIT"~ (Life Technologies) or ESF 921T"" (Expression
Systems)
for the Sf~ cells; and Ex-ce11O405T~~ (JRH Biosciences, Lenexa, KS) or Express
FiveOT"" (Life Technologies) for the T. ni cells. The cells are grown up from
an
35 inoculation density of approximately 2-5 x 105 cells to a density of 1-2 x
106 cells at
which time a recombinant viral stock is added at a multiplicity of infection
(MOI) of
0.1 to 10, more typically near 3. Procedures used are generally described in
available
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
33
laboratory manuals (King and Possee, ibid.; O'Reilly et al., ibid.;
Richardson, ibid.).
Subsequent purification of the zacrp4 polypeptide from the supernatant can be
achieved
using methods described herein.
Fungal cells, including yeast cells, can also be used within the present
invention. Yeast species of particular interest in this regard include
Saccharomyces
cerevisiae, Pichia pastoris, and Pichia methanolica. Methods for transforming
S.
cerevisiae cells with exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,311;
Kawasaki et al., U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008;
Welch et
al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075.
Transformed cells are selected by phenotype determined by the selectable
marker,
commonly drug resistance or the ability to grow in the absence of a particular
nutrient
(e.g., leucine). A preferred vector system for use in Saccharomyces cerevisiae
is the
POTI vector system disclosed by Kawasaki et al. (U.S. Patent No. 4,931,373),
which
allows transformed cells to be selected by growth in glucose-containing media.
Suitable promoters and terminators for use in yeast include those from
glycolytic
enzyme genes (see, e.g., Kawasaki, U.S. Patent No. 4,599,311; Kingsman et al.,
U.S.
Patent No. 4,615,974; and Bitter, U.S. Patent No. 4,977,092) and alcohol
dehydrogenase genes. See also U.S. Patents Nos. 4,990,446; 5,063,154;
5,139,936 and
2 0 4,661,454. Transformation systems for other yeasts, including Hansenula
polymorpha,
Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces fragilis,
Ustilago
maydis, Pichia pastoris, Pichia methanolica, Pichia guillermondii and Candida
maltosa are known in the art. See, for example, Gleeson et al., J. Gen.
Microbiol.
132:3459-65, 1986 and Cregg, U.S. Patent No. 4,882,279. Aspergillus cells may
be
utilized according to the methods of McKnight et al., U.S. Patent No.
4,935,349.
Methods for transforming Acremonium chrysogenum are disclosed by Sumino et
al.,
U.S. Patent No. 5,162,228. Methods for transforming Neurospora are disclosed
by
Lambowitz, U.S. Patent No. 4,486,533.
The use of Pichia methanolica as host for the production of recombinant
proteins is disclosed in WIPO Publications WO 97/17450, WO 97/17451, WO
98/02536, and WO 98/02565. DNA molecules for use in transforming P.
methanolica
will commonly be prepared as double-stranded, circular plasmids, which are
preferably
linearized prior to transformation. For polypeptide production in P.
methanolica, it is
preferred that the promoter and terminator in the plasmid be that of a P.
methanolica
3 5 gene, such as a P. methanolica alcohol utilization gene (A UGI or A UG2).
Other useful
promoters include those of the dihydroxyacetone synthase (DHAS), formate
dehydrogenase (FMD), and catalase (CAT) genes. To facilitate integration of
the DNA
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
34
into the host chromosome, it is preferred to have the entire expression
segment of the
plasmid flanked at both ends by host DNA sequences. A preferred selectable
marker
for use in Pichia methanolica is a P. methanolica ADE2 gene, which encodes
phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC 4.1.1.21 ), which allows
ade2 host cells to grow in the absence of adenine. For large-scale, industrial
processes
where it is desirable to minimize the use of methanol, it is preferred to use
host cells in
which both methanol utilization genes (AUGl and AUG2) are deleted. For
production
of secreted proteins, host cells deficient in vacuolar protease genes (PEP4
and PR81 )
are preferred. Electroporation is used to facilitate the introduction of a
plasmid
l0 containing DNA encoding a polypeptide of interest into P. methanolica
cells. It is
preferred to transform P. methanolica cells by electroporation using an
exponentially
decaying, pulsed electric field having a field strength of from 2.5 to 4.5
kV/cm,
preferably about 3.75 kV/cm, and a time constant (i) of from 1 to 40
milliseconds, most
preferably about 20 milliseconds.
Prokaryotic host cells, including strains of the bacteria Escherichia coli,
Bacillus and other genera are also useful host cells within the present
invention.
Techniques for transforming these hosts and expressing foreign DNA sequences
cloned
therein are well known in the art (see, e.g., Sambrook et al., ibid.). When
expressing a
zacrp4 polypeptide in bacteria such as E . cot i, the polypeptide may be
retained in
2 o the cytoplasm, typically as insoluble granules, or may be directed to the
periplasmic
space by a bacterial secretion sequence. In the former case, the cells are
lysed, and the
granules are recovered and denatured using, for example, guanidine
isothiocyanate or
urea. The denatured polypeptide can then be refolded and dimerized by diluting
the
denaturant, such as by dialysis against a solution of urea and a combination
of reduced
and oxidized glutathione, followed by dialysis against a buffered saline
solution. In the
latter case, the polypeptide can be recovered from the periplasmic space in a
soluble
and functional form by disrupting the cells (by, for example, sonication or
osmotic
shock) to release the contents of the periplasmic space and recovering the
protein,
thereby obviating the need for denaturation and refolding.
3 0 Transformed or transfected host cells are cultured according to
conventional procedures in a culture medium containing nutrients and other
components required for the growth of the chosen host cells. A variety of
suitable
media, including defined media and complex media, are known in the art and
generally
include a carbon source, a nitrogen source, essential amino acids, vitamins
and
3 5 minerals. Media may also contain such components as growth factors or
serum, as
required. The growth medium will generally select for cells containing the
exogenously added DNA by, for example, drug selection or deficiency in an
essential
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
nutrient which is complemented by the selectable marker carned on the
expression
vector or co-transfected into the host cell.
Expressed recombinant zacrp4 polypeptides (or zacrp4 polypeptide
fusions) can be purified using fractionation and/or conventional purification
methods
5 and media. Ammonium sulfate precipitation and acid or chaotrope extraction
may be
used for fractionation of samples. Exemplary purification steps may include
hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid
chromatography. Suitable chromatographic media include derivatized dextrans,
agarose, cellulose, polyacrylamide, specialty silicas, and the like. PEI,
DEAE, QAE
l0 and Q derivatives are preferred. Exemplary chromatographic media include
those media
derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF
(Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-
Sepharose
(Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG 71
(Toso
Haas) and the like. Suitable solid supports include glass beads, silica-based
resins,
15 cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene
beads, cross-
linked polyacrylamide resins and the like that are insoluble under the
conditions in
which they are to be used. These supports may be modified with reactive groups
that
allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl
groups,
hydroxyl groups and/or carbohydrate moieties. Examples of coupling chemistries
2 0 include cyanogen bromide activation, N-hydroxysuccinimide activation,
epoxide
activation, sulfliydryl activation, hydrazide activation, and carboxyl and
amino
derivatives for carbodiimide coupling chemistries. These and other solid media
are
well known and widely used in the art, and are available from commercial
suppliers.
Methods for binding receptor polypeptides to support media are well known in
the art.
25 Selection of a particular method is a matter of routine design and is
determined in part
by the properties of the chosen support. See, for example, Affinity
Chromatography:
Principles & Methods, Pharmacia LKB Biotechnology, Uppsala, Sweden, 1988.
The polypeptides of the present invention can be isolated by exploitation
of their structural or binding properties. For example, immobilized metal ion
3 0 adsorption (IMAC) chromatography can be used to purify histidine-rich
proteins or
proteins having a His tag. Briefly, a gel is first charged with divalent metal
ions to
form a chelate (Sulkowski, Trends in Biochem. 3:1-7, 1985). Histidine-rich
proteins
will be adsorbed to this matrix with differing affinities, depending upon the
metal ion
used, and will be eluted by competitive elution, lowering the pH, or use of
strong
3 5 chelating agents. Other methods of purification include purification of
glycosylated
proteins by lectin affinity chromatography and ion exchange chromatography
Methods
in Enzymol., Vol. 182, "Guide to Protein Purification", M. Deutscher, (ed.),
Acad.
CA 02378951 2001-12-28
WO 01/02565 PCT/L1S00/17692
36
Press, San Diego, 1990, pp. 529-39). Within an additional preferred
embodiments of
the invention, a fusion of the polypeptide of interest and an affinity tag
(e.g., maltose-
binding protein, FLAG, Glu-Glu, an immunoglobulin domain) may be constructed
to
facilitate purification as is discussed in greater detail in the Example
sections below.
Protein refolding (and optionally, reoxidation) procedures may be
advantageously used. It is preferred to purify the protein to >80% purity,
more
preferably to >90% purity, even more preferably >95%, and particularly
preferred is a
pharmaceutically pure state, that is greater than 99.9% pure with respect to
contaminating macromolecules, particularly other proteins and nucleic acids,
and free
of infectious and pyrogenic agents. Preferably, a purified protein is
substantially free of
other proteins, particularly other proteins of animal origin.
Zacrp4 polypeptides or fragments thereof may also be prepared through
chemical synthesis by methods well known in the art. Such zacrp4 polypeptides
may
be monomers or multimers; glycosylated or non-glycosylated; pegylated or non-
pegylated; and may or may not include an initial methionine amino acid
residue.
A ligand-binding polypeptide, such as a zacrp4-binding polypeptide, can
also be used for purification of ligand. The polypeptide is immobilized on a
solid
support, such as beads of agarose, cross-linked agarose, glass, cellulosic
resins, silica-
based resins, polystyrene, cross-linked polyacrylamide, or like materials that
are stable
2 0 under the conditions of use. Methods for linking polypeptides to solid
supports are
known in the art, and include amine chemistry, cyanogen bromide activation, N-
hydroxysuccinimide activation, epoxide activation, sulfhydryl activation, and
hydrazide
activation. The resulting medium will generally be configured in the form of a
column,
and fluids containing ligand are passed through the column one or more times
to allow
2 5 ligand to bind to the ligand-binding polypeptide. The ligand is then
eluted using
changes in salt concentration, chaotropic agents (guanidine HCl), or pH to
disrupt
ligand-receptor binding.
Nucleic acid molecules disclosed herein can be used to detect the
expression of a zacrp4 gene in a biological sample. Such probe molecules
include
3 0 double-stranded nucleic acid molecules comprising the nucleotide sequences
of SEQ ID
NO:1, or fragments thereof, as well as single-stranded nucleic acid molecules
having
the complement of the nucleotide sequences of SEQ ID NO:1, or a fragment
thereof.
Probe molecules may be DNA, RNA, oligonucleotides, and the like.
As an illustration, suitable probes include nucleic acid molecules that
3 5 bind with a portion of a zacrp4 domain or motif, such as the nucleotide
sequence that
encode the amino-terminal signal sequence (residues 1-16 of SEQ ID N0:2), the
two
tandem Clq domains (residues 17-159 and 160-328 of SEQ ID N0:2), aromatic
motif
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
37
(F-X(5)-[ND]-X(4)-[FYWL]-X(6)-F-X(5)-G-X-Y-X-F-X-[FY] (SEQ ID N0:3), the 10
beta-strands amino acid residues 31-35, 52-54, 60-63, 67-69, 73-84, 89-95, 101-
108,
112-126, 131-136 and 150-154, and 179-183, 206-208, 214-217, 221-223, 227-238,
243-249, 254-262, 267-278, 283-288 and 305-309 of SEQ ID N0:2, receptor
binding
loops 37-62, 94-108, 185-216 and 248-262 of SEQ ID N0:2.
In a basic assay, a single-stranded probe molecule is incubated with
RNA, isolated from a biological sample, under conditions of temperature and
ionic
strength that promote base pairing between the probe and target zacrp4 RNA
species, as
described herein. After separating unbound probe from hybridized molecules,
the
l0 amount of hybrids is detected.
Well-established hybridization methods of RNA, detection include
northern analysis and dot/slot blot hybridization (see, for example, Ausubel
ibid. and
Wu et al. (eds.), "Analysis of Gene Expression at the RNA Level," in Methods
in Gene
Biotechnology, pages 225-239 (CRC Press, Inc. 1997)). Nucleic acid probes can
be
detectably labeled with radioisotopes such as 32P Or 355. Alternatively,
zacrp4 RNA can
be detected with a nonradioactive hybridization method (see, for example,
Isaac (ed.),
Protocols for Nucleic Acid Analysis by Nonradioactive Probes, Humans Press,
Inc.,
1993). Typically, nonradioactive detection is achieved by enzymatic conversion
of
chromogenic or chemiluminescent substrates. Illustrative nonradioactive
moieties include
2 0 biotin, fluorescein, and digoxigenin.
Zacrp4 oligonucleotide probes are also useful for in vivo diagnosis. As
an illustration, '8F-labeled oligonucleotides can be administered to a subject
and
visualized by positron emission tomography (Tavitian et al., Nature Medicine
4:467,
1998).
2 5 Numerous diagnostic procedures take advantage of the polymerise chain
reaction (PCR) to increase sensitivity of detection methods. Standard
techniques for
performing PCR are well-known (see, generally, Mathew (ed.), Protocols in
Human
Molecular Genetics (Humans Press, Inc. 1991 ), White (ed.), PCR Protocols:
Current
Methods and Applications (Humans Press, Inc. 1993), Cotter (ed.), Molecular
3 0 Diagnosis of Cancer (Humans Press, Inc. 1996), Hanausek and Walaszek
(eds.), Tumor
Marker Protocols (Humans Press, Inc. 1998), Lo (ed.), Clinical Applications of
PCR
(Humans Press, Inc. 1998), and Meltzer (ed.), PCR in Bioanalysis (Humans
Press, Inc.
1998)). PCR primers can be designed to amplify a sequence encoding a
particular
zacrp4 domain or motif, as described above.
3 5 One variation of PCR for diagnostic assays is reverse transcriptase-PCR
(RT-PCR). In the RT-PCR technique, RNA is isolated from a biological sample,
reverse transcribed to cDNA, and the cDNA is incubated with zacrp4 primers
(see, for
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
38
example, Wu et al. (eds.), "Rapid Isolation of Specific cDNAs or Genes by
PCR," in
Methods in Gene Biotechnology, CRC Press, Inc., pages 15-28, 1997). PCR is
then
performed and the products are analyzed using standard techniques.
As an illustration, RNA is isolated from biological sample using, for
example, the guanidinium-thiocyanate cell lysis procedure described above.
Alternatively, a solid-phase technique can be used to isolate mRNA from a cell
lysate.
A reverse transcription reaction can be primed with the isolated RNA using
random
oligonucleotides, short homopolymers of dT, or zacrp4 anti-sense oligomers.
Oligo-dT
primers offer the advantage that various mRNA nucleotide sequences are
amplified that
can provide control target sequences. Zacrp4 sequences are amplified by the
polymerise chain reaction using two flanking oligonucleotide primers that are
typically
at least 5 bases in length.
PCR amplification products can be detected using a variety of
approaches. For example, PCR products can be fractionated by gel
electrophoresis, and
visualized by ethidium bromide staining. Alternatively, fractionated PCR
products can
be transferred to a membrane, hybridized with a detectably-labeled zacrp4
probe, and
examined by autoradiography. Additional alternative approaches include the use
of
digoxigenin-labeled deoxyribonucleic acid triphosphates to provide
chemiluminescence
detection, and the C-TRAK colorimetric assay.
2 0 Another approach is real time quantitative PCR (Perkin-Elmer Cetus,
Norwalk, Ct.). A fluorogenic probe, consisting of an oligonucleotide with both
a
reporter and a quencher dye attached, anneals specifically between the forward
and
reverse primers. Using the 5' endonuclease activity of Taq DNA polymerise, the
reporter dye is separated from the quencher dye and a sequence-specific signal
is
generated and increases as amplification increases. The fluorescence intensity
can be
continuously monitored and quantified during the PCR reaction.
Another approach for detection of zacrp4 expression is cycling probe
technology (CPT), in which a single-stranded DNA target binds with an excess
of
DNA-RNA-DNA chimeric probe to form a complex, the RNA portion is cleaved with
3 0 RNase H, and the presence of cleaved chimeric probe is detected (see, for
example,
Beggs et al., J. Clin. Microbiol. 34:2985, 1996 and Bekkaoui et al.,
Biotechniques
20:240, 1996). Alternative methods for detection of zacrp4 sequences can
utilize
approaches such as nucleic acid sequence-based amplification (NASBA),
cooperative
amplification of templates by cross-hybridization (CATCH), and the ligase
chain
reaction (LCR) (see, for example, Marshall et al., U.S. Patent No. 5,686,272
(1997),
Dyer et al., J. Virol. Methods 60:161, 1996; Ehricht et al., Eur. J. Biochem.
243:358,
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
39
1997 and Chadwick et al., J. Virol. Methods 70:59, 1998). Other standard
methods are
known to those of skill in the art.
Zacrp4 probes and primers can also be used to detect and to localize
zacrp4 gene expression in tissue samples. Methods for such in situ
hybridization are
well-known to those of skill in the art (see, for example, Choo (ed.), In Situ
Hybridization Protocols, Humana Press, Inc., 1994; Wu et al. (eds.), "Analysis
of
Cellular DNA or Abundance of mRNA by Radioactive In Situ Hybridization
IRISH),"
in Methods in Gene Biotechnology, CRC Press, Inc., pages 259-278, 1997 and Wu
et al.
(eds.), "Localization of DNA or Abundance of mRNA by Fluorescence In Situ
Hybridization IRISH)," in Methods in Gene Biotechnology, CRC Press, Inc.,
pages 279-
289, 1997).
Various additional diagnostic approaches are well-known to those of
skill in the art (see, for example, Mathew (ed.), Protocols in Human Molecular
Genetics
Humana Press, Inc., 1991; Coleman and Tsongalis, Molecular Diagnostics, Humana
Press, Inc., 1996 and Elles, Molecular Diagnosis of Genetic Diseases, Humana
Press,
Inc., 1996).
An assay system that uses a ligand-binding receptor (or an antibody, one
member of a complement/ anti-complement pair) or a binding fragment thereof,
and a
commercially available biosensor instrument (BIAcoreTM, Pharmacia Biosensor,
2 0 Piscataway, NJ) may be advantageously employed. Such receptor, antibody,
member
of a complement/anti-complement pair or fragment is immobilized onto the
surface of a
receptor chip. Use of this instrument is disclosed by Karlsson, J. Immunol.
Methods
145:229-40, 1991 and Cunningham and Wells, J. Mol. Biol. 234:554-63, 1993. A
receptor, antibody, member or fragment is covalently attached, using amine or
2 5 sulfllydryl chemistry, to dextran fibers that are attached to gold film
within the flow
cell. A test sample is passed through the cell. If a ligand, epitope, or
opposite member
of the complement/anti-complement pair is present in the sample, it will bind
to the
immobilized receptor, antibody or member, respectively, causing a change in
the
refractive index of the medium, which is detected as a change in surface
plasmon
3 0 resonance of the gold film. This system allows the determination of on-
and off rates,
from which binding affinity can be calculated, and assessment of stoichiometry
of
binding.
Ligand-binding polypeptides can also be used within other assay
systems known in the art. Such systems include Scatchard analysis for
determination
35 of binding affinity (see Scatchard, Ann. NY Acad. Sci. 51: 660-72, 1949)
and
calorimetric assays (Cunningham et al., Science 253:545-48, 1991; Cunningham
et al.,
Science 245:821-25, 1991).
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
The invention also provides anti-zacrp4 antibodies. Antibodies to
zacrp4 can be obtained, for example, using as an antigen the product of a
zacrp4
expression vector, or zacrp4 isolated from a natural source. Particularly
useful anti-
zacrp4 antibodies "bind specifically" with zacrp4. Antibodies are considered
to be
5 specifically binding if the antibodies bind to a zacrp4 polypeptide, peptide
or epitope
with a binding affinity (Ka) of 106 M 1 or greater, preferably 107 M 1 or
greater, more
preferably 108 M 1 or greater, and most preferably 109 M 1 or greater. The
binding
affinity of an antibody can be readily determined by one of ordinary skill in
the art, for
example, by Scatchard analysis (Scatchard, Ann. NY Acad. Sci. 51:660, 1949).
10 Suitable antibodies include antibodies that bind with zacrp4 in particular
domains.
Anti-zacrp4 antibodies can be produced using antigenic zacrp4 epitope-
bearing peptides and polypeptides. Antigenic epitope-bearing peptides and
polypeptides of the present invention contain a sequence of at least nine,
preferably
between 15 to about 30 amino acids contained within SEQ ID N0:2. However,
15 peptides or polypeptides comprising a larger portion of an amino acid
sequence of the
invention, containing from 30 to 50 amino acids, or any length up to and
including the
entire amino acid sequence of a polypeptide of the invention, also are useful
for
inducing antibodies that bind with zacrp4. It is desirable that the amino acid
sequence
of the epitope-bearing peptide is selected to provide substantial solubility
in aqueous
2 0 solvents (i.e., the sequence includes relatively hydrophilic residues,
while hydrophobic
residues are preferably avoided). Hydrophilic peptides can be predicted by one
of skill
in the art from a hydrophobicity plot, see for example, Hopp and Woods Proc.
Nat.
Acad. Sci. USA 78:3824-8, 1981) and Kyte and Doolittle (J. Mol. Biol. 157: 105-
142,
1982). Moreover, amino acid sequences containing proline residues may be also
be
2 5 desirable for antibody production.
Polyclonal antibodies to recombinant zacrp4 protein or to zacrp4
isolated from natural sources can be prepared using methods well-known to
those of
skill in the art. See, for example, Green et al., "Production of Polyclonal
Antisera," in
Immunochemical Protocols (Manson, ed.), pages 1-5 (Humana Press 1992), and
3 0 Williams et al., "Expression of foreign proteins in E. coli using plasmid
vectors and
purification of specific polyclonal antibodies," in DNA Cloning 2: Expression
Systems,
2nd Edition, Glover et al. (eds.), page 15 (Oxford University Press 1995). The
immunogenicity of a zacrp4 polypeptide can be increased through the use of an
adjuvant, such as alum (aluminum hydroxide) or Freund's complete or incomplete
3 5 adjuvant. Polypeptides useful for immunization also include fusion
polypeptides, such
as fusions of zacrp4 or a portion thereof with an immunoglobulin polypeptide
or with
maltose binding protein. The polypeptide immunogen may be a full-length
molecule or
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
41
a portion thereof. If the polypeptide portion is "hapten-like," such portion
may be
advantageously joined or linked to a macromolecular carrier (such as keyhole
limpet
hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for
immunization.
Although polyclonal antibodies are typically raised in animals such as
horses, cows, dogs, chicken, rats, mice, rabbits, hamsters, guinea pigs,
goats, or sheep,
an anti-zacrp4 antibody of the present invention may also be derived from a
subhuman
primate antibody. General techniques for raising diagnostically and
therapeutically
useful antibodies in baboons may be found, for example, in Goldenberg et al.,
international patent publication No. WO 91/11465, and in Losman et al., Int.
J. Cancer
46:310, 1990. Antibodies can also be raised in transgenic animals such as
transgenic
sheep, cows, goats or pigs, and can also be expressed in yeast and fungi in
modified
forms as will as in mammalian and insect cells.
Alternatively, monoclonal anti-zacrp4 antibodies can be generated.
Rodent monoclonal antibodies to specific antigens may be obtained by methods
known
to those skilled in the art (see, for example, Kohler et al., Nature 256:495
(1975),
Coligan et al. (eds.), Current Protocols in Immunology, Vol. 1, pages 2.5.1-
2.6.7 (John
Wiley & Sons 1991 ), Picksley et al., "Production of monoclonal antibodies
against
proteins expressed in E. coli," in DNA Cloning 2: Expression Systems, 2nd
Edition,
Glover et al. (eds.), page 93 (Oxford University Press 1995)).
Briefly, monoclonal antibodies can be obtained by injecting mice with a
composition comprising a zacrp4 gene product, verifying the presence of
antibody
production by removing a serum sample, removing the spleen to obtain B-
lymphocytes,
fizsing the B-lymphocytes with myeloma cells to produce hybridomas, cloning
the
hybridomas, selecting positive clones which produce antibodies to the antigen,
2 5 culturing the clones that produce antibodies to the antigen, and isolating
the antibodies
from the hybridoma cultures.
In addition, an anti-zacrp4 antibody of the present invention may be
derived from a human monoclonal antibody. Human monoclonal antibodies are
obtained
from transgenic mice that have been engineered to produce specific human
antibodies in
3 0 response to antigenic challenge. In this technique, elements of the human
heavy and light
chain locus are introduced into strains of mice derived from embryonic stem
cell lines that
contain targeted disruptions of the endogenous heavy chain and light chain
loci. The
transgenic mice can synthesize human antibodies specific for human antigens,
and the
mice can be used to produce human antibody-secreting hybridomas. Methods for
3 5 obtaining human antibodies from transgenic mice are described, for
example, by Green et
al., Nature Genet 7:13, 1994, Lonberg et al., Nature 368:856, 1994, and Taylor
et al., Int.
Immun. 6:579, 1994.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
42
Monoclonal antibodies can be isolated and purified from hybridoma
cultures by a variety of well-established techniques. Such isolation
techniques include
affinity chromatography with Protein-A Sepharose, size-exclusion
chromatography,
and ion-exchange chromatography (see, for example, Coligan at pages 2.7.1-
2.7.12 and
pages 2.9.1-2.9.3; Baines et al., "Purification of Immunoglobulin G (IgG)," in
Methods
in Molecular Biology, Vol. 10, pages 79-104 (The Humana Press, Inc. 1992)).
For particular uses, it may be desirable to prepare fragments of anti-
zacrp4 antibodies. Such antibody fragments can be obtained, for example, by
proteolytic hydrolysis of the antibody. Antibody fragments can be obtained by
pepsin
or papain digestion of whole antibodies by conventional methods. As an
illustration,
antibody fragments can be produced by enzymatic cleavage of antibodies with
pepsin to
provide a SS fragment denoted F(ab')2. This fragment can be further cleaved
using a
thiol reducing agent to produce 3.5S Fab' monovalent fragments. Optionally,
the
cleavage reaction can be performed using a blocking group for the sulfliydryl
groups
that result from cleavage of disulfide linkages. As an alternative, an
enzymatic
cleavage using pepsin produces two monovalent Fab fragments and an Fc fragment
directly. These methods are described, for example, by Goldenberg, U.S. patent
No.
4,331,647, Nisonoff et al., Arch Biochem. Biophys. 89:230, 1960, Porter,
Biochem. J.
73:119, 1959, Edelman et al., in Methods in Enzymology Vol. l, page 422
(Academic
2 0 Press 1967), and by Coligan, ibid.
Other methods of cleaving antibodies, such as separation of heavy
chains to form monovalent light-heavy chain fragments, further cleavage of
fragments,
or other enzymatic, chemical or genetic techniques may also be used, so long
as the
fragments bind to the antigen that is recognized by the intact antibody.
2 5 For example, Fv fragments comprise an association of VH and VL chains.
This association can be noncovalent, as described by mbar et al., Proc. Natl.
Acad. Sci.
USA 69:2659, 1972. Alternatively, the variable chains can be linked by an
intermolecular disulfide bond or cross-linked by chemicals such as
gluteraldehyde (see,
for example, Sandhu, Crit. Rev. Biotech. 12:437, 1992).
3 0 The Fv fragments may comprise VH and VL chains which are connected
by a peptide linker. These single-chain antigen binding proteins (scFv) are
prepared by
constructing a structural gene comprising DNA sequences encoding the VH and VL
domains which are connected by an oligonucleotide. The structural gene is
inserted
into an expression vector which is subsequently introduced into a host cell,
such as E.
3 5 coli. The recombinant host cells synthesize a single polypeptide chain
with a linker
peptide bridging the two V domains. Methods for producing scFvs are described,
for
example, by Whitlow et al., Methods: A Companion to Methods in Enzymology
2:97,
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
43
1991, also see, Bird et al., Science 242:423, 1988, Ladner et al., U.S. Patent
No.
4,946,778, Pack et al., Bio/Technology 11:1271, 1993, and Sandhu, ibid.
As an illustration, a scFV can be obtained by exposing lymphocytes to
zacrp4 polypeptide in vitro, and selecting antibody display libraries in phage
or similar
vectors (for instance, through use of immobilized or labeled zacrp4 protein or
peptide).
Genes encoding polypeptides having potential zacrp4 polypeptide binding
domains can
be obtained by screening random peptide libraries displayed on phage (phage
display)
or on bacteria, such as E. coli. Nucleotide sequences encoding the
polypeptides can be
obtained in a number of ways, such as through random mutagenesis and random
polynucleotide synthesis. These random peptide display libraries can be used
to screen
for peptides which interact with a known target which can be a protein or
polypeptide,
such as a ligand or receptor, a biological or synthetic macromolecule, or
organic or
inorganic substances. Techniques for creating and screening such random
peptide
display libraries are known in the art (Ladner et al., U.S. Patent No.
5,223,409, Ladner
et al., U.S. Patent No. 4,946,778, Ladner et al., U.S. Patent No. 5,403,484,
Ladner et al.,
U.S. Patent No. 5,571,698, and Kay et al., Phage Display of Peptides and
Proteins
(Academic Press, Inc. 1996)) and random peptide display libraries and kits for
screening such libraries are available commercially, for instance from
Clontech (Palo
Alto, CA), Invitrogen Inc. (San Diego, CA), New England Biolabs, Inc.
(Beverly, MA),
2 0 and Pharmacia LKB Biotechnology Inc. (Piscataway, NJ). Random peptide
display
libraries can be screened using the zacrp4 sequences disclosed herein to
identify
proteins which bind to zacrp4.
Another form of an antibody fragment is a peptide coding for a single
complementarity-determining region (CDR). CDR peptides ("minimal recognition
2 5 units") can be obtained by constructing genes encoding the CDR of an
antibody of
interest. Such genes are prepared, for example, by using the polymerase chain
reaction
to synthesize the variable region from RNA of antibody-producing cells (see,
for
example, Larrick et al., Methods: A Companion to Methods in Enzymology 2:106,
1991 ), Courtenay-Luck, "Genetic Manipulation of Monoclonal Antibodies," in
3 0 Monoclonal Antibodies: Production, Engineering and Clinical Application,
Ritter et al.
(eds.), page 166 (Cambridge University Press, 1995), and Ward et al., "Genetic
Manipulation and Expression of Antibodies," in Monoclonal Antibodies:
Principles and
Applications, Birch et al., (eds.), page 137 (Whey-Liss, Inc. 1995)).
Alternatively, an anti-zacrp4 antibody may be derived from a
3 5 "humanized" monoclonal antibody. Humanized monoclonal antibodies are
produced
by transferring mouse complementary determining regions from heavy and light
variable chains of the mouse immunoglobulin into a human variable domain.
Typical
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
44
residues of human antibodies are then substituted in the framework regions of
the
murine counterparts. The use of antibody components derived from humanized
monoclonal antibodies obviates potential problems associated with the
immunogenicity
of murine constant regions. General techniques for cloning murine
immunoglobulin
variable domains are described, for example, by Orlandi et al., Proc. Nat.
Acad. Sci.
USA 86:3833, 1989. Techniques for producing humanized monoclonal antibodies
are
described, for example, by Jones et al., Nature 321:522, 1986, Carter et al.,
Proc. Nat.
Acad. Sci. USA 89:4285, 1992, Sandhu, Crit. Rev. Biotech. 12:437, 1992, Singer
et al.,
J. Immun. 150:2844, 1993, Sudhir (ed.), Antibody Engineering Protocols (Humana
Press, Inc. 1995), Kelley, "Engineering Therapeutic Antibodies," in Protein
Engineering: Principles and Practice, Cleland et al. (eds.), pages 399-434
(John Wiley
& Sons, Inc. 1996), and by Queen et al., U.S. Patent No. 5,693,762 (1997).
Polyclonal anti-idiotype antibodies can be prepared by immunizing
animals with anti-zacrp4 antibodies or antibody fragments, using standard
techniques.
See, for example, Green et al., "Production of Polyclonal Antisera," in
Methods In
Molecular Biology: Immunochemical Protocols, Manson (ed.), pages 1-12 (Humana
Press 1992). Also, see Coligan, ibid. at pages 2.4.1-2.4.7. Alternatively,
monoclonal
anti-idiotype antibodies can be prepared using anti-zacrp4 antibodies or
antibody
fragments as immunogens with the techniques, described above. As another
2 0 alternative, humanized anti-idiotype antibodies or subhuman primate anti-
idiotype
antibodies can be prepared using the above-described techniques. Methods for
producing anti-idiotype antibodies are described, for example, by Irie, U.S.
Patent No.
5,208,146, Greene, et. al., U.S. Patent No. 5,637,677, and Varthakavi and
Minocha, J.
Gen. Virol. 77:1875, 1996.
2 5 Genes encoding polypeptides having potential zacrp4 polypeptide
binding domains, "binding proteins", can be obtained by screening random or
directed
peptide libraries displayed on phage (phage display) or on bacteria, such as
E. coli.
Nucleotide sequences encoding the polypeptides can be obtained in a number of
ways,
such as through random mutagenesis and random polynucleotide synthesis.
3 0 Alternatively, constrained phage display libraries can also be produced.
These peptide
display libraries can be used to screen for peptides which interact with a
known target
which can be a protein or polypeptide, such as a ligand or receptor, a
biological or
synthetic macromolecule, or organic or inorganic substances. Techniques for
creating
and screening such peptide display libraries are known in the art (Ladner et
al., US
3 5 Patent NO. 5,223,409; Ladner et al., US Patent NO. 4,946,778; Ladner et
al., US Patent
NO. 5,403,484 and Ladner et al., US Patent NO. 5,571,698) and peptide display
libraries and kits for screening such libraries are available commercially,
for instance
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
from Clontech (Palo Alto, CA), Invitrogen Inc. (San Diego, CA), New England
Biolabs, Inc. (Beverly, MA) and Pharmacia LKB Biotechnology Inc. (Piscataway,
NJ).
Peptide display libraries can be screened using the zacrp4 sequences disclosed
herein to
identify proteins which bind to zacrp4. These "binding proteins" which
interact with
5 zacrp4 polypeptides can be used essentially like an antibody.
A variety of assays known to those skilled in the art can be utilized to
detect antibodies and/or binding proteins which specifically bind to zacrp4
proteins or
peptides. Exemplary assays are described in detail in Antibodies: A Laboratory
Manual, Harlow and Lane (Eds.), Cold Spring Harbor Laboratory Press, 1988.
10 Representative examples of such assays include: concurrent
immunoelectrophoresis,
radioimmunoassay, radioimmuno-precipitation, enzyme-linked immunosorbent assay
(ELISA), dot blot or Western blot assay, inhibition or competition assay, and
sandwich
assay. In addition, antibodies can be screened for binding to wild-type versus
mutant
zacrp4 protein or polypeptide.
15 Antibodies and binding proteins to zacrp4 may be used for tagging cells
that express zacrp4; for isolating zacrp4 by affinity purification; for
diagnostic assays
for determining circulating levels of zacrp4 polypeptides; for detecting or
quantitating
soluble zacrp4 as marker of underlying pathology or disease; in analytical
methods
employing FACS; for screening expression libraries; for generating anti-
idiotypic
2 0 antibodies; and as neutralizing antibodies or as antagonists to block
zacrp4 polypeptide
modulation of spermatogenesis or like activity in vitro and in vivo. Suitable
direct tags
or labels include radionuclides, enzymes, substrates, cofactors, inhibitors,
fluorescent
markers, chemiluminescent markers, magnetic particles and the like; indirect
tags or
labels may feature use of biotin-avidin or other complement/anti-complement
pairs as
2 5 intermediates. Moreover, antibodies to zacrp4 or fragments thereof may be
used in
vitro to detect denatured zacrp4 or fragments thereof in assays, for example,
Western
Blots or other assays known in the art.
Antibodies or polypeptides herein can also be directly or indirectly
conjugated to drugs, toxins, radionuclides and the like, and these conjugates
used for in
3 0 vivo diagnostic or therapeutic applications. For instance, polypeptides or
antibodies of
the present invention can be used to identify or treat tissues or organs that
express a
corresponding anti-complementary molecule (receptor or antigen, respectively,
for
instance). More specifically, zacrp4 polypeptides or anti-zacrp4 antibodies,
or
bioactive fragments or portions thereof, can be coupled to detectable or
cytotoxic
3 5 molecules and delivered to a mammal having cells, tissues or organs that
express the
anti-complementary molecule.
CA 02378951 2001-12-28
WO 01102565 PCT/US00/17692
46
An additional aspect of the present invention provides methods for
identifying agonists or antagonists of the zacrp4 polypeptides disclosed
above, which
agonists or antagonists may have valuable properties as discussed further
herein.
Within one embodiment, there is provided a method of identifying zacrp4
polypeptide
agonists, comprising providing cells responsive thereto, culturing the cells
in the
presence of a test compound and comparing the cellular response with the cell
cultured
in the presence of the zacrp4 polypeptide, and selecting the test compounds
for which
the cellular response is of the same type.
Within another embodiment, there is provided a method of identifying
1 o antagonists of zacrp4 polypeptide, comprising providing cells responsive
to a zacrp4
polypeptide, culturing a first portion of the cells in the presence of zacrp4
polypeptide,
culturing a second portion of the cells in the presence of the zacrp4
polypeptide and a
test compound, and detecting a decrease in a cellular response of the second
portion of
the cells as compared to the first portion of the cells. In addition to those
assays
disclosed herein, samples can be tested for inhibition of zacrp4 activity
within a variety
of assays designed to measure receptor binding or the stimulation/inhibition
of zacrp4-
dependent cellular responses. For example, zacrp4-responsive cell lines can be
transfected with a reporter gene construct that is responsive to a zacrp4-
stimulated
cellular pathway. Reporter gene constructs of this type are known in the art,
and will
2 o generally comprise a zacrp4-DNA response element operably linked to a gene
encoding
an assayable protein, such as luciferase. DNA response elements can include,
but are
not limited to, cyclic AMP response elements (CRE), hormone response elements
(HRE), insulin response element (IRE) (Nasrin et al., Proc. Natl. Acad. Sci.
USA
87:5273-7, 1990) and serum response elements (SRE) (Shaw et al. Cell 56: 563-
72,
2 5 1989). Cyclic AMP response elements are reviewed in Roestler et al., J.
Biol. Chem.
263 (19):9063-6, 1988 and Habener, Molec. Endocrinol. 4 (8):1087-94, 1990.
Hormone response elements are reviewed in Beato, Cell 56:335-44; 1989.
Candidate
compounds, solutions, mixtures or extracts are tested for the ability to
inhibit the
activity of zacrp4 on the target cells as evidenced by a decrease in zacrp4
stimulation of
3 0 reporter gene expression. Assays of this type will detect compounds that
directly block
zacrp4 binding to cell-surface receptors, as well as compounds that block
processes in
the cellular pathway subsequent to receptor-ligand binding. In the
alternative,
compounds or other samples can be tested for direct blocking of zacrp4 binding
to
receptor using zacrp4 tagged with a detectable label (e.g., '25I, biotin,
horseradish
3 5 peroxidase, FITC, and the like). Within assays of this type, the ability
of a test sample
to inhibit the binding of labeled zacrp4 to the receptor is indicative of
inhibitory
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
47
activity, which can be confirmed through secondary assays. Receptors used
within
binding assays may be cellular receptors or isolated, immobilized receptors.
Zacrp4 is a secreted protein which functions as a primary message
involved in cell to cell communication. As such zacrp4 polypeptides, fragments
and
fusions may act as paracrine factors, exerting their influence on distant
targets. Zacrp4
polypeptides, fragments and fusions may be useful as autocrine factors,
particularly
during development. Acting as endocrine factors, zacrp4 polypeptides,
fragments and
fusions are useful in mediating the processes of an organism. Zacrp4
polypeptides,
fragments and fusions would be useful in regulating cellular processes such as
cell
l0 proliferation and/or differentiation, cell survival and energy balance.
Zacrp4 is highly expressed in testis and ovarian tissues. Testis-specific
factors that influence spermatogenesis may come directly from the Sertoli
cells that are
in contact with spermatogenic cells, or may be paracrine or endocrine factors.
Paracrine factors that cross the cellular barner and enter the sperm cell
microenvironment include molecules secreted from Leydig cells. Leydig cells
produce
several factors believed to play an important role in spermatogenic cell
maturation
process, such as testosterone, Leydig factor, IGF-1, inhibin and activin.
Zacrp4
expression in the testis suggests a role in the spermatogenic cycle. As such,
zacrp4
polypeptides, fragments, fusions and the like may serve in sperm cell
maturation, testis
2 0 cell-cell interactions, regulating spermatogenesis by affecting
proliferation or
differentiation of spermatogenic cells, affecting cell-cell interactions,
modulating
hormones involved in the process, sperm motility, capacitation, zona
interaction and the
like.
In vivo assays for evaluating the effect of polypeptides, such as zacrp4,
on testes are well known in the art. For example, compounds can be injected
intraperitoneally into animals for a specific time duration. After the
treatment period,
the animals are sacrificed and testes removed and weighed. Testicles are
homogenized
and sperm head counts are made (Meistrich et al., Exp. Cell Res. 99:72-78,
1976).
Other activities, such as chemotaxic activity that may be associated with
3 0 proteins of the present invention can be analyzed using methods known in
the art. For
example, late stage factors in spermatogenesis may be involved in egg-sperm
interactions and sperm motility. Activities, such as enhancing viability of
cryopreserved sperm, stimulating the acrosome reaction, enhancing sperm
motility and
enhancing egg-sperm interactions may be associated with the proteins of the
present
3 5 invention. Assays evaluating such activities can be found, for example, in
Rosenberger,
J. Androl. _l 1:89-96, 1990; Fuchs, Zentralbl Gynakol 1 1:l 17-120, 1993;
Neurwinger et
al., Andrologia 22:335-9, 1990; Harns et al., Human Reprod. 3:856-60, 1988;
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
48
Jockenhovel, Andrologia 22:171-178, 1990; Lessing et al., Fertil. Steril.
44:406-9
(1985) and Zaneveld, In Male Infertility Chapter 11, Comhaire Ed., Chapman &
Hall,
London 1996. These activities are expected to result in enhanced fertility and
successful reproduction.
Zacrp4 expression in ovaries suggests a role in oogenesis. The classic
control of ovarian function by luteinizing hormone (LH) and follicle
stimulating
hormone (FSH) is now thought to include the action of a variety of other
molecules that
act to promote cell-cell interactions between cells of the follicle, for
review, see
Gougeon, Endocrine Rev. 17:121-55, 1996. As such, zacrp4 polypeptides,
fragments,
fusions and the like may serve in oocyte maturation, ovarian cell-cell
interactions,
regulating folliculogenesis and dominant follicle selection, by affecting
proliferation or
differentiation of follicular cells, affecting cell-cell interactions,
modulating hormones
involved in the process, promoting uterine implantation of fertilized oocytes
and the
like.
Zacrp4 is also expressed at high levels in brain tissue. Regulation of
reproductive function in males and females is controlled, in part, by feedback
inhibition
of the hypothalamus and anterior pituitary by blood-bone hormones.
Gonadotropin-
releasing hormone is secreted from the hypothalamus and controls the
reproductive
hormone cascade directing synthesis and release of pituitary gonadotropins
through
2 0 specific high-affinity membrane bound receptors. These gonadotropins,
luteinizing
hormone (LH) and follicle stimulating hormone (FSH), in turn regulate the
activity of
testes and ovaries. Modulators of their activity is desirable for therapeutic
applications
such as precocious puberty, endometriosis, uterine leiomyomata, hirsutism,
infertility,
pre-menstrual syndrome, amenorrhea and as contraceptive agents. Such
applications
2 5 would also include breakthrough menopausal bleeding, as part of a
therapeutic regime
for pregnancy support, or for treating symptoms associated with polycystic
ovarian
syndrome (PCOS), PMS and menopause. Testis proteins, such as activins and
inhibins,
have been shown to regulate secretion of active molecules including FSH for
the
pituitary (Ying, Endodcr. Rev. 9:267-93, 1988; Plant et al., Hum. Reprod. 8:41-
30 44,1993). Inhibins and relaxin are also expressed in the ovaries have also
been shown
to regulate ovarian functions and follicular and uterine growth (Woodruff et
al., Endocr.
132:2332-42,1993; Russell et al., J. Reprod. Fertil. 100:115-22, 1994; Bagnell
et al., J.
Reprod. Fertil. 48:127-38, 1993). Zacrp4 polypeptide, fragments and fusions
may act to
modulate the hormones associated with the reproductive cascade.
3 5 In addition, the present invention also provides methods for studying
steroidogenesis and steroid hormone secretion. For example, such a method
would
comprise incubating ovarian cells in culture medium comprising zacrp4
polypeptides,
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
49
fragments, fusions, monoclonal antibodies, agonists or antagonists thereof
with and
without gonadotropins and/or steroid hormones, and subsequently observing
protein
and steroid secretion. Exemplary gonadotropin hormones include luteinizing
hormone
and follicle stimulating hormone (Rouillier et al., Mol. Reprod. Dev. 50:170-
7, 1998).
Exemplary steroid hormones include estradiol, androstenedione, and
progesterone.
Effects of zacrp4 on steroidogenesis or steroid secretion can be determined by
methods
known in the art, such as radioimmunoassay (to detect levels of estradiol,
androstenedione, progesterone, and the like), and immunoradiometric assay
(IRMA).
Molecules expressed in the ovaries and testis, such as zacrp4, which may
1 o modulate hormones, hormone receptors, growth factors, or cell-cell
interactions, of the
reproductive cascade or are involved in oocyte or ovarian development, sperm
or testis
development, would be useful as markers for cancer of reproductive organs and
as
therapeutic agents for hormone-dependent cancers, by inhibiting hormone-
dependent
growth and/or development of tumor cells. Moreover, receptors for steroid
hormones
involved in the reproductive cascade are found in human tumors and tumor cell
lines
(breast, prostate, endometrial, ovarian, kidney, and pancreatic tumors) (Kakar
et al.,
Mol. Cell. Endocrinol., 106:145-49, 1994; Kakar and Jennes, Cancer Letts.,
98:57-62,
1995). Thus, expression of zacrp4 in ovaries and testis suggests that
polypeptides of
the present invention would be useful in diagnostic methods for the detection
and
2 0 monitoring of reproductive cell cancers.
Zacrp4 polypeptides, fragments, fusions, agonists or antagonists can be
used to modulate energy balance in mammals. In this regard zacrp4 polypeptides
would modulate cellular metabolic reactions. Such metabolic reactions include
adipogenesis, gluconeogenesis, glycogenolysis, lipogenesis, glucose uptake,
protein
2 5 synthesis, thermogenesis, oxygen utilization and the like.
Among other methods known in the art or described herein, mammalian
energy balance may be evaluated by monitoring one or more of the following
metabolic
functions: adipogenesis, gluconeogenesis, glycogenolysis, lipogenesis, glucose
uptake,
protein synthesis, thermogenesis, oxygen utilization or the like. These
metabolic
3 0 functions are monitored by techniques (assays or animal models) known to
one of
ordinary skill in the art, as is more fully set forth below. For example, the
glucoregulatory effects of insulin are predominantly exerted in the liver,
skeletal muscle
and adipose tissue. Insulin binds to its cellular receptor in these three
tissues and
initiates tissue-specific actions that result in, for example, the inhibition
of glucose
3 5 production and the stimulation of glucose utilization. In the liver,
insulin stimulates
glucose uptake and inhibits gluconeogenesis and glycogenolysis. In skeletal
muscle
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
and adipose tissue, insulin acts to stimulate the uptake, storage and
utilization of
glucose.
Art-recognized methods exist for monitoring all of the metabolic
functions recited above. Thus, one of ordinary skill in the art is able to
evaluate zacrp4
5 polypeptides, fragments, fusion proteins, antibodies, agonists and
antagonists for
metabolic modulating functions. Exemplary modulating techniques are set forth
below.
Adipogenesis, gluconeogenesis and glycogenolysis are interrelated
components of mammalian energy balance, which may be evaluated by known
techniques using, for example, oblob mice or dbldb mice. The oblob mice are
inbred
l0 mice that are homozygous for an inactivating mutation at the ob (obese)
locus. Such
ob/ob mice are hyperphagic and hypometabolic, and are believed to be deficient
in
production of circulating OB protein. The db/db mice are inbred mice that are
homozygous for an inactivating mutation at the db (diabetes) locus. The db/db
mice
display a phenotype similar to that of oblob mice, except db/db mice also
display a
15 diabetic phenotype. Such db/db mice are believed to be resistant to the
effects of
circulating OB protein. Also, various in vitro methods of assessing these
parameters
are known in the art.
Insulin-stimulated lipogenesis, for example, may be monitored by
measuring the incorporation of 14C-acetate into triglyceride (Mackall et al.
J. Biol.
2 0 Chem. 251:6462-4, 1976) or triglyceride accumulation (Kletzien et al.,
Mol.
Pharmacol. 41:393-8, 1992).
Glucose uptake may be evaluated, for example, in an assay for insulin-
stimulated glucose transport. Non-transfected, differentiated L6 myotubes
(maintained
in the absence of 6418) are placed in DMEM containing 1 g/1 glucose, 0.5 or
1.0%
25 BSA, 20 mM Hepes, and 2 mM glutamine. After two to five hours of culture,
the
medium is replaced with fresh, glucose-free DMEM containing 0.5 or 1.0% BSA,
20
mM Hepes, 1 mM pyruvate, and 2 mM glutamine. Appropriate concentrations of
insulin or IGF-1, or a dilution series of the test substance, are added, and
the cells are
incubated for 20-30 minutes. 3H or 14C-labeled deoxyglucose is added to X50 1
M
3 0 final concentration, and the cells are incubated for approximately 10-30
minutes. The
cells are then quickly rinsed with cold buffer (e.g. PBS), then lysed with a
suitable
lysing agent (e.g. 1 % SDS or 1 N NaOH). The cell lysate is then evaluated by
counting
in a scintillation counter. Cell-associated radioactivity is taken as a
measure of glucose
transport after subtracting non-specific binding as determined by incubating
cells in the
3 5 presence of cytocholasin b, an inhibitor of glucose transport. Other
methods include
those described by, for example, Manchester et al., Am. J. Physiol. 266
(Endocrinol.
Metab. ~:E326-E333, 1994 (insulin-stimulated glucose transport).
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
51
Protein synthesis may be evaluated, for example, by comparing
precipitation of 35S-methionine-labeled proteins following incubation of the
test cells
with 35S-methionine and 35S-methionine and a putative modulator of protein
synthesis.
Thermogenesis may be evaluated as described by B. Stanley in The
Biology of Neuropeptide Y and Related Peptides, Colmers and Wahlestedt (eds.),
Humana Press, Ottawa, 1993, pp. 457-509; Billington et al., Am. J. Physiol.
260:8321,
1991; Zarjevski et al., Endocrinology 133:1753, 1993; Billington et al., Am.
J. Physiol.
266:81765, 1994; Heller et al., Am. J. Physiol. 252(4 Pt 2): 8661-7, 1987; and
Heller
et al., Am. J. Physiol. 245: 8321-8, 1983. Also, metabolic rate, which may be
measured by a variety of techniques, is an indirect measurement of
thermogenesis.
Oxygen utilization may be evaluated as described by Heller et al.,
Pflugers Arch 369: 55-9, 1977. This method also involved an analysis of
hypothalmic
temperature and metabolic heat production. Oxygen utilization and
thermoregulation
have also been evaluated in humans as described by Haskell et al., J. Appl.
Physiol. 51:
948-54, 1981.
Zacrp4 polypeptides may be used in the analysis of energy efficiency of
a mammal. Zacrp4 polypeptides found in serum or tissue samples may be
indicative of
a mammals ability to store food, with more highly efficient mammals tending
toward
obesity. More specifically, the present invention contemplates methods for
detecting
2 0 zacrp4 polypeptide comprising:
exposing a sample possibly containing zacrp4 polypeptide to an
antibody attached to a solid support, wherein said antibody binds to an
epitope of a
zacrp4 polypeptide;
washing said immobilized antibody-polypeptide to remove unbound
2 5 contaminants;
exposing the immobilized antibody-polypeptide to a second antibody
directed to a second epitope of a zacrp4 polypeptide, wherein the second
antibody is
associated with a detectable label; and
detecting the detectable label. The concentration of zacrp4 polypeptide
3 0 in the test sample appears to be indicative of the energy efficiency of a
mammal. This
information can aid nutritional analysis of a mammal. Potentially, this
information may
be useful in identifying and/or targeting energy deficient tissue.
A further aspect of the invention provides a method for studying insulin.
Such methods of the present invention comprise incubating adipocytes in a
culture
3 5 medium comprising zacrp4 polypeptide, monoclonal antibody, agonist or
antagonist
thereof ~ insulin and observing changes in adipocyte protein secretion or
differentiation.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
52
The present invention also provides methods of studying mammalian
cellular metabolism. Such methods of the present invention comprise incubating
cells
to be studied, for example, human vascular endothelial cells, ~ zacrp4
polypeptide,
monoclonal antibody, agonist or antagonist thereof and observing changes in
adipogenesis, gluconeogenesis, glycogenolysis, lipogenesis, glucose uptake, or
the like.
Expression in the brain and spinal cord suggests that zacrp4
polypeptides, fragments, fusions and the like may be involved in neuronal
signal
propagation or guidance of neuronal cell migration. Cerebellin, a member of
the Clq
family is involved in synaptic activity (Urade et al., Proc. Natl. Acad. Sci.
USA
88:1069-73, 1991). As neurotransmitters or neurotransmission modulators,
zacrp4
polypeptide fragments as well as zacrp4 polypeptides, fusion proteins,
agonists,
antagonists or antibodies of the present invention may also modulate calcium
ion
concentration, muscle contraction, hormone secretion, DNA synthesis or cell
growth,
inositol phosphate turnover, arachidonate release, phospholipase-C activation,
gastric
emptying, human neutrophil activation or ADCC capability, superoxide anion
production and the like. Evaluation of these properties can be conducted by
known
methods, such as those set forth herein.
Among other methods known in the art or described herein,
neurotransmission functions may be evaluated by monitoring 2-deoxy-glucose
uptake
2 0 in the brain. This parameter is monitored by techniques (assays or animal
models)
known to one of ordinary skill in the art, for example, autoradiography.
Useful
monitoring techniques are described, for example, by Kilduff et al., J.
Neurosci. 10
2463-75, 1990, with related techniques used to evaluate the "hibernating
heart" as
described in Gerber et al. Circulation 94: 651-8, 1996, and Fallavollita et
al.,
2 5 Circulation 95: 1900-9, 1997.
Neurite growth cues are of great therapeutic value. Proteins involved in
the guidance of neural cell migration would be of value for example, in
modulating
neurite growth and development; treatment of peripheral neuropathies; for use
as
therapeutics for the regeneration of neurons following strokes, brain damage
caused by
3 0 head injuries and paralysis caused by spinal injuries; diagnosing
neurological diseases
and in treating neurodegenerative diseases such as multiple sclerosis,
Alzheimer's
disease and Parkinson's disease.
The ability of zacrp4 polypeptides, fragments, fusions, agonists,
antagonists and antibodies of the present invention to guide neural cell
migration can be
3 5 measured using assays known in the art. For example, changes in neuron
growth
patterns in response to exogenous proteins, can be measured according to the
procedures disclosed in Hastings, WIPO Patent Application No:97/29189 and
Walter et
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
53
al., Development _101:685-96, 1987. Other assays such as the C assay (see for
example,
Raper and Kapfhammer, Neuron 4:21-9, 1990 and Luo et al., Cell 75:217-27,
1993),
can be used to determine whether an exogenously added protein induces
collapsing
activity on growing neurons. Other methods which assess inhibition of neurite
extension or divert such extension are also known, see Goodman, Annu. Rev.
Neurosci.
_19:341-77, 1996. Conditioned media from cells expressing the desired protein,
protein
agonists or antagonists, or aggregates of such protein expressing cells, can
by placed in
a gel matrix near suitable neural cells, such as dorsal root ganglia (DRG) or
sympathetic ganglia explants, which have been cocultured with nerve growth
factor.
Compared to control cells, exogenous protein-induced changes in neuron growth
can be
measured (see for example, Messersmith et al., Neuron 14:949-59,,1995; Puschel
et al.,
Neuron _14:941-8, 1995). Likewise neurite outgrowth can be measured using
neuronal
cell suspensions grown in the presence of molecules of the present invention
see for
example, O'Shea et al., Neuron 7:231-7, 1991 and DeFreitas et al., Neuron
15:333-43,
1995.
Complement component Clq plays a role in host defense against
infectious agents, such as bacteria and viruses. Clq is known to exhibit
several
specialized functions. For example, Clq triggers the complement cascade via
interaction with bound antibody or C-reactive protein (CRP). Also, C 1 q
interacts
2 0 directly with certain bacteria, RNA viruses, mycoplasma, uric acid
crystals, the lipid A
component of bacterial endotoxin and membranes of certain intracellular
organelles.
Clq binding to the Clq receptor is believed to promote phagocytosis. Clq also
appears
to enhance the antibody formation aspect of the host defense system. See, for
example,
Johnston, Pediatr. Infect. Dis. J. 12: 933-41, 1993. Thus, soluble Clq-like
molecules
may be useful as anti-microbial agents, promoting lysis or phagocytosis of
infectious
agents.
Zacrp4 fragments as well as zacrp4 polypeptides, fusion proteins,
agonists, antagonists or antibodies may be evaluated with respect to their
anti-microbial
properties according to procedures known in the art. See, for example, Barsum
et al.,
3 0 Eur. Respir. J. 8 5 : 709-14, 1995; Sandovsky-Losica et al., J. Med. Vet.
Mycol
En land 28 4 : 279-87, 1990; Mehentee et al., J. Gen. Microbiol. (England) 135
Pt.
~: 2181-8, 1989; Segal and Savage, J. Med. Vet. Mycol. 24: 477-9, 1986 and the
like.
If desired, the performance of zacrp4 in this regard can be compared to
proteins known
to be functional in this regard, such as proline-rich proteins, lysozyme,
histatins,
3 5 lactoperoxidase or the like. In addition, zacrp4 fragments, polypeptides,
fusion
proteins, agonists, antagonists or antibodies may be evaluated in combination
with one
or more anti-microbial agents to identify synergistic effects. One of ordinary
skill in
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
54
the art will recognize that the anti-microbial properties of zacrp4
polypeptides,
fragments, fusion proteins, agonists, antagonists and antibodies may be
similarly
evaluated.
Anti-microbial protective agents may be directly acting or indirectly
acting. Such agents operating via membrane association or pore forming
mechanisms
of action directly attach to the offending microbe. Anti-microbial agents can
also act
via an enzymatic mechanism, breaking down microbial protective substances or
the cell
wall/membrane thereof. Anti-microbial agents, capable of inhibiting
microorganism
proliferation or action or of disrupting microorganism integrity by either
mechanism set
forth above, are useful in methods for preventing contamination in cell
culture by
microbes susceptible to that anti-microbial activity. Such techniques involve
culturing
cells in the presence of an effective amount of said zacrp4 polypeptide or an
agonist or
antagonist thereof.
Also, zacrp4 polypeptides or agonists thereof may be used as cell culture
reagents in in vitro studies of exogenous microorganism infection, such as
bacterial,
viral or fungal infection. Such moieties may also be used in in vivo animal
models of
infection.
In view of the tissue distribution observed for zacrp4, agonists
(including the natural ligand/substrate/ cofactor/etc.) and antagonists have
enormous
potential in both in vitro and in vivo applications. Compounds identified as
zacrp4
agonists are useful for stimulating cell growth or development in vitro and in
vivo. For
example, zacrp4 and agonist compounds are useful as components of defined cell
culture media, and may be used alone or in combination with other cytokines
and
hormones to replace serum that is commonly used in cell culture. Agonists are
thus
useful in specifically promoting the growth and/or development of cells in
culture.
For example, considering the high expression of zacrp4 in testis and
ovary, zacrp4 polypeptides, fragments, fusions and agonists may be
particularly useful
as research reagents to stimulate proliferation, maturation and
differentiation of
testicular cells, ovarian cells, eggs, sperm, cells from animal embryos or
primary
3 0 cultures derived from these tissues. Proliferation and differentiation can
be measured
using cultured cells or by in vivo administration of molecules of the present
invention to
the appropriate animal model. Cultured testicular cells include dolphin
DBl.Tes cells
(CRL-6258); mouse GC-1 spg cells (CRL-2053); TM3 cells (CRL-1714); TM4 cells
(CRL-1715); and pig ST cells (CRL-1746), available from American Type Culture
3 5 Collection, 12301 Parklawn Drive, Rockville, MD.
Assays measuring cell proliferation or differentiation are well known in
the art. Such methods include incubating granulosa cells, theca cells, oocytes
or a
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
combination thereof, in the presence and absence of a zacrp4 polypeptide,
fragment,
fusion, monoclonal antibody, agonist or antagonist thereof and observing
changes in
cell proliferation, maturation and differentiation. See for example, Basini et
al. J. Re .
Immunol. 37:139-53, 1998); Duleba et al., Fert. Ster. 69:335-40, 1998); and
Campbell
5 et al., J. Reprod. and Fert. 112:69-77, 1998).
Other assays measuring proliferation include such assays as
chemosensitivity to neutral red dye (Cavanaugh et al., Investigational New
Drugs
8:347-354, 1990), incorporation of radiolabelled nucleotides (Cook et al.,
Analytical
Biochem. 179:1-7, 1989), incorporation of 5-bromo-2'-deoxyuridine (BrdU) in
the
10 DNA of proliferating cells (Porstmann et al., J. Immunol. Methods 82:169-
179, 1985),
and use of tetrazolium salts (Mosmann, J. Immunol. Methods 65:55-63, 1983;
Alley et
al., Cancer Res. 48:589-601, 1988; Marshall et al., Growth Reg. 5:69-84, 1995;
and
Scudiero et al., Cancer Res. 48:4827-4833, 1988). Another dye incorporation
assay to
quantitatively measure the proliferation of cells uses alamar BIueTM (AccuMed,
15 Chicago, IL) to indicate a colorimetric change which is quantitated by
fluorescent
signal (Lancaster et al., US Patent No. 5,501,959).
Assays measuring differentiation include, for example, measuring cell-
surface markers associated with stage-specific expression of a tissue,
enzymatic
activity, functional activity or morphological changes (Watt, FASEB, 5:281-
284, 1991;
2 0 Francis, Differentiation 57:63-75, 1994; Raes, Adv. Anim. Cell Biol.
Technol.
Bioprocesses, 161-171, 1989).
An additional aspect of the invention provides a method for studying
trimerization. Such methods of the present invention comprise incubating
zacrp4
polypeptides or fragments or fusion proteins thereof containing one or both C
1 q
2 5 domains alone or in combination with other polypeptides bearing C 1 q
domains. Such
associations may compete with the formation of complement Clq trimers and
thereby
disrupt serum complement activity. The impact of zacrp4 polypeptides,
fragments,
fusions, agonists or antagonists on complement inhibition may be assessed by
methods
known in the art.
3 0 Adipocyte complement related proteins are involved in cell-cell or cell-
extracellular matrix interactions, particularly those involving modulation of
tissue
remodeling. The phenotypic manifestation of many autoimmune and remodeling-
related diseases is extensive activation of inflammatory and/or tissue
remodeling
processes. The result is often that functional organ or sub-organ tissue is
replaced by a
3 5 variety of extracellular matrix (ECM) components incapable of performing
the function
of the replaced biological structure. There is an incomplete understanding of
the
initiation events in these diseases, and the resulting excessive extracellular
matrix
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
56
deposition. The initiation events have been hypothesized to involve an injury
or initial
perturbation of the optimal biological structure regulation. Interestingly,
sometimes
intracellular components are found as autoantigens, indicative of particular
diseases. It
could be that the production of antibodies by the immune system, after
excessive
exposure to these intracellular proteins, is a result of excessive or improper
remodeling.
By targeting the remodeling process it may be possible to lessen the effect
autoantigens. Therefor, zacrp4 polypeptides, fragments, fusions, agonists,
antagonists
and the like would be beneficial in mediating a variety of autoimmune and
remodeling
diseases.
It is possible that an improper remodeling response to connective tissue
or muscle injury in the joints results in sensitivity to excessive release of
cellular
components at the site of the injury. Zacrp6 polypeptides, fragments, fusions
and the
like would be useful in determining if an association exists between such a
response
and the inflammation associated with arthritis. Such indicators include a
reduction in
inflammation and relief of pain or stiffness. In animal models, indications
would be
derived from macroscopic inspection of joints and change in swelling of hind
paws.
Zacrp6 polypeptides, fragments, fusions and the like can be administered to
animal
models of osteoarthritis (Kikuchi et al., Osteoarthritis Cartilage 6:177-86,
1998 and
Lohmander et al., Arthritis Rheum. 42:534-44, 1999) to look for inhibition of
tissue
2 0 destruction that results from inflammation stimulated by the action of
collagenase.
Autoantigens diagnostic of scleroderma are to what would be consider
cytoplasmic proteins. A knockout animal for zacrp4, as described herein, would
be
useful in determining if antibodies to zacrp4 proteins, fragments, fusions and
the like
are raised as a response to inflammation due to improper or incomplete repair
of local
2 5 tissue in response to stress.
Zacrp4 polypeptides, fragments, fusions and the like, as provided herein,
would be useful in determining if excessive and/or inappropriate arterial
remodeling
plays a role in plaque formation in arterial sclerosis and arterial injury,
such as arterial
occlusion, using methods provided herein. Treatment of a vascular injury (and
30 underlying extracellular matrix) with adipocyte complement protein zsig37
appears to
alter the process of vascular remodeling at a very early stage (co-pending US
Patent
09/253,604). Treatment with an adipocyte complement protein may act to keep
platelets relatively quiescent after injury, eliminating excessive recruitment
of pro-
remodeling and proinflammatory proteins and cells.
3 5 Other members of the family may modulate remodeling induced by the
presence of fat, or cholesterol for instance. Excessive amounts of cholesterol
and fat in
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
57
the blood might activate remodeling, in the absence of the correct adipocyte
complement protein family member.
ACRP30 is expressed only in actively proliferating adipose tissue.
Connective tissue remodeling is tightly linked to this activation of fat
cells. There is
clearly a link between excessive weight gain (fat) and diabetes. It is
therefore likely
that ACRP30 is involved in fat remodeling and this process is overtaxed in
obese
individuals. As a result, the effects of improper and inadequate fat storage
contribute to
the onset of Type II diabetes.
Zacrp4 polypeptides, fragments, fusion proteins, antibodies, agonists or
antagonists of the present invention can be used in methods for promoting
blood flow
within the vasculature of a mammal by reducing the number of platelets that
adhere and
are activated and the size of platelet aggregates. Used to such an end, Zacrp4
can be
administered prior to, during or following an acute vascular injury in the
mammal.
Vascular injury may be due to vascular reconstruction, including but not
limited to,
angioplasty, coronary artery bypass graft, microvascular repair or anastomosis
of a
vascular graft. Also contemplated are vascular injuries due to trauma, stroke
or
aneurysm. In other preferred methods the vascular injury is due to plaque
rupture,
degradation of the vasculature, complications associated with diabetes and
atherosclerosis. Plaque rupture in the coronary artery induces heart attack
and in the
2 0 cerebral artery induces stroke. Use of zacrp4 polypeptides, fragments,
fusion proteins,
antibodies, agonists or antagonists in such methods would also be useful for
ameliorating whole system diseases of the vasculature associated with the
immune
system, such as disseminated intravascular coagulation (DIC) and SIDS.
Additionally
the complement inhibiting activity would be useful for treating non-
vasculature
2 5 immune diseases such as arteriolosclerosis.
A correlation has been found between the presence of C 1 q in localized
ischemic myocardium and the accumulation of leukocytes following coronary
occlusion and reperfusion. Release of cellular components following tissue
damage
triggers complement activation which results in toxic oxygen products that may
be the
3 0 primary cause of myocardial damage (Rossen et al., Circ. Res. 62:572-84,
1998 and
Tenner, ibid.). Blocking the complement pathway was found to protect ischemic
myocardium from reperfusion injury (Buerke et al., J. Pharm. Exp. There.
286:429-38,
1998). Proteins having complement inhibition and C 1 q binding activity would
be
useful for such purposes.
3 5 Complement and C 1 q play a role in inflammation. The complement
activation is initiated by binding of Clq to immunoglobulins (Johnston,
Pediatr. Infect.
Dis. J. 12:933-41, 1993; Ward and Ghetie, Therap. Immunol. 2:77-94, 1995).
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
58
Inhibitors of Clq and complement would be useful as anti-inflammatory agents.
Such
application can be made to prevent infection. Additionally, such inhibitors
can be
administrated to an individual suffering from inflammation mediated by
complement
activation and binding of immune complexes to C 1 q. Inhibitors of C 1 q and
complement would be useful in methods of mediating wound repair, enhancing
progression in wound healing by overcoming impaired wound healing. Progression
in
wound healing would include, for example, such elements as a reduction in
inflammation, fibroblasts recruitment, wound retraction and reduction in
infection.
Radiation hybrid mapping is a somatic cell genetic technique developed
l0 for constructing high-resolution, contiguous maps of mammalian chromosomes
(Cox et
al., Science 250:245-50, 1990). Partial or full knowledge of a gene's sequence
allows
the designing of PCR primers suitable for use with chromosomal radiation
hybrid
mapping panels. Commercially available radiation hybrid mapping panels which
cover
the entire human genome, such as the Stanford G3 RH Panel and the GeneBridge 4
RH
Panel (Research Genetics, Inc., Huntsville, AL), are available. These panels
enable
rapid, PCR based, chromosomal localizations and ordering of genes, sequence-
tagged
sites (STSs), and other nonpolymorphic- and polymorphic markers within a
region of
interest. This includes establishing directly proportional physical distances
between
newly discovered genes of interest and previously mapped markers. The precise
2 0 knowledge of a gene's position can be useful in a number of ways
including: 1 )
determining if a sequence is part of an existing contig and obtaining
additional
surrounding genetic sequences in various forms such as YAC-, BAC- or cDNA
clones,
2) providing a possible candidate gene for an inheritable disease which shows
linkage
to the same chromosomal region, and 3) for cross-referencing model organisms
such as
2 5 mouse which may be beneficial in helping to determine what function a
particular gene
might have.
The gene encoding the zacrp4 polypeptide was mapped to human
chromosome 11, region q11. The present invention also provides reagents which
will
find use in diagnostic applications. For example, the zacrp4 gene, a probe
comprising
3 0 zacrp4 DNA or RNA, or a subsequence thereof can be used to determine if
the zacrp4
gene is present on chromosome 11 or if a mutation has occurred. Detectable
chromosomal aberrations at the zacrp4 gene locus include, but are not limited
to,
aneuploidy, gene copy number changes, insertions, deletions, restriction site
changes
and rearrangements. These aberrations can occur within the coding sequence,
within
3 5 introns, or within flanking sequences, including upstream promoter and
regulatory
regions, and may be manifested as physical alterations within a coding
sequence or
changes in gene expression level.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
59
In general, these diagnostic methods comprise the steps of (a) obtaining
a genetic sample from a patient; (b) incubating the genetic sample with a
polynucleotide probe or primer as disclosed above, under conditions wherein
the
polynucleotide will hybridize to complementary polynucleotide sequence, to
produce a
first reaction product; and (iii) comparing the first reaction product to a
control reaction
product. A difference between the first reaction product and the control
reaction
product is indicative of a genetic abnormality in the patient. Genetic samples
for use
within the present invention include genomic DNA, cDNA, and RNA. The
polynucleotide probe or primer can be RNA or DNA, and will comprise a portion
of
SEQ ID NO:1, the complement of SEQ ID NO:1, or an RNA equivalent thereof.
Suitable assay methods in this regard include molecular genetic techniques
known to
those in the art, such as restriction fragment length polymorphism (RFLP)
analysis,
short tandem repeat (STR) analysis employing PCR techniques, ligation chain
reaction
(Barany, PCR Methods and Applications 1:5-16, 1991), ribonuclease protection
assays,
and other genetic linkage analysis techniques known in the art (Sambrook et
al., ibid.;
Ausubel et. al., ibid.; Marian, Chest 108:255-65, 1995). Ribonuclease
protection assays
(see, e.g., Ausubel et al., ibid., ch. 4) comprise the hybridization of an RNA
probe to a
patient RNA sample, after which the reaction product (RNA-RNA hybrid) is
exposed to
RNase. Hybridized regions of the RNA are protected from digestion. Within PCR
2 0 assays, a patient's genetic sample is incubated with a pair of
polynucleotide primers,
and the region between the primers is amplified and recovered. Changes in size
or
amount of recovered product are indicative of mutations in the patient.
Another PCR-
based technique that can be employed is single strand conformational
polymorphism
(SSCP) analysis (Hayashi, PCR Methods and Applications 1:34-8, 1991).
2 5 For pharmaceutical use, the proteins of the present invention can be
formulated with pharmaceutically acceptable carriers for parenteral, oral,
nasal, rectal,
topical, transdermal administration or the like, according to conventional
methods. In
general, pharmaceutical formulations will include a zacrp4 protein in
combination with
a pharmaceutically acceptable vehicle, such as saline, buffered saline, 5%
dextrose in
3 0 water or the like. Formulations may further include one or more
excipients,
preservatives, solubilizers, buffering agents, albumin to prevent protein loss
on vial
surfaces, etc. Methods of formulation are well known in the art and are
disclosed, for
example, in Remington: The Science and Practice of Pharmacy, Gennaro, ed.,
Mack
Publishing Co., Easton PA, 19'" ed., 1995. Therapeutic doses will generally be
3 5 determined by the clinician according to accepted standards, taking into
account the
nature and severity of the condition to be treated, patient traits, etc.
Determination of
dose is within the level of ordinary skill in the art.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
As used herein a "pharmaceutically effective amount" of a zacrp4
polypeptide, fragment, fusion protein, agonist or antagonist is an amount
sufficient to
induce a desired biological result. The result can be alleviation of the
signs, symptoms,
or causes of a disease, or any other desired alteration of a biological
system. For
5 example, an effective amount of a zacrp4 polypeptide is that which provides
either
subjective relief of symptoms or an objectively identifiable improvement as
noted by
the clinician or other qualified observer. Such an effective amount of a
zacrp4
polypeptide would provide, for example, recovery from microbial infection,
improved
cognitive function, changes in metabolic function that result in weight
modification or a
10 decrease in glucose levels in patients with IDDM. Effective amounts of the
zacrp4
polypeptides can vary widely depending on the disease or symptom to be
treated. The
amount of the polypeptide to be administered and its concentration in the
formulations,
depends upon the vehicle selected, route of administration, the potency of the
particular
polypeptide, the clinical condition of the patient, the side effects and the
stability of the
15 compound in the formulation. Thus, the clinician will employ the
appropriate
preparation containing the appropriate concentration in the formulation, as
well as the
amount of formulation administered, depending upon clinical experience with
the
patient in question or with similar patients. Such amounts will depend, in
part, on the
particular condition to be treated, age, weight, and general health of the
patient, and
2 0 other factors evident to those skilled in the art. Typically a dose will
be in the range of
0.01-100 mg/kg of subject. In applications such as balloon catheters the
typical dose
range would be 0.05-5 mg/kg of subject. Doses for specific compounds may be
determined from in vitro or ex vivo studies in combination with studies on
experimental
animals. Concentrations of compounds found to be effective in vitro or ex vivo
provide
25 guidance for animal studies, wherein doses are calculated to provide
similar
concentrations at the site of action.
Polynucleotides encoding zacrp4 polypeptides are useful within gene
therapy applications where it is desired to increase or inhibit zacrp4
activity. If a
mammal has a mutated or absent zacrp4 gene, the zacrp4 gene can be introduced
into
3 0 the cells of the mammal. In one embodiment, a gene encoding a zacrp4
polypeptide is
introduced in vivo in a viral vector. Such vectors include an attenuated or
defective
DNA virus, such as, but not limited to, herpes simplex virus (HSV),
papillomavirus,
Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the
like.
Defective viruses, which entirely or almost entirely lack viral genes, are
preferred. A
3 5 defective virus is not infective after introduction into a cell. Use of
defective viral
vectors allows for administration to cells in a specific, localized area,
without concern
that the vector can infect other cells. Examples of particular vectors
include, but are not
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
61
limited to, a defective herpes simplex virus 1 (HSV1) vector (Kaplitt et al.,
Molec. Cell.
Neurosci. 2:320-30, 1991); an attenuated adenovirus vector, such as the vector
described by Stratford-Perncaudet et al., J. Clin. Invest. 90:626-30, 1992;
and a
defective adeno-associated virus vector (Samulski et al., J. Virol. 61:3096-
101, 1987;
Samulski et al., J. Virol. 63:3822-8, 1989).
In another embodiment, a zacrp4 gene can be introduced in a retroviral
vector, e.g., as described in Anderson et al., U.S. Patent No. 5,399,346; Mann
et al. Cell
33:153, 1983; Temin et al., U.S. Patent No. 4,650,764; Temin et al., U.S.
Patent No.
4,980,289; Markowitz et al., J. Virol. 62:1120, 1988; Temin et al., U.S.
Patent No.
5,124,263; WIPO Publication WO 95/07358; and Kuo et al., Blood 82:845, 1993.
Alternatively, the vector can be introduced by lipofection in vivo using
liposomes.
Synthetic cationic lipids can be used to prepare liposomes for in vivo
transfection of a
gene encoding a marker (Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7,
1987;
Mackey et al., Proc. Natl. Acad. Sci. USA 85:8027-31, 1988). The use of
lipofection to
introduce exogenous genes into specific organs in vivo has certain practical
advantages.
Molecular targeting of liposomes to specific cells represents one area of
benefit. More
particularly, directing transfection to particular cells represents one area
of benefit. For
instance, directing transfection to particular cell types would be
particularly
advantageous in a tissue with cellular heterogeneity, such as the pancreas,
liver, kidney,
2 0 and brain. Lipids may be chemically coupled to other molecules for the
purpose of
targeting. Targeted peptides (e.g., hormones or neurotransmitters), proteins
such as
antibodies, or non-peptide molecules can be coupled to liposomes chemically.
It is possible to remove the target cells from the body; to introduce the
vector as a naked DNA plasmid; and then to re-implant the transformed cells
into the
2 5 body. Naked DNA vectors for gene therapy can be introduced into the
desired host
cells by methods known in the art, e.g., transfection, electroporation,
microinjection,
transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, use
of a gene
gun or use of a DNA vector transporter. See, e.g., Wu et al., J. Biol. Chem.
267:963-7,
1992; Wu et al., J. Biol. Chem. 263:14621-4, 1988.
3 0 Antisense methodology can be used to inhibit zacrp4 gene transcription,
such as to inhibit cell proliferation in vivo. Polynucleotides that are
complementary to a
segment of a zacrp4-encoding polynucleotide (e.g., a polynucleotide as set
froth in SEQ
ID NO:1 ) are designed to bind to zacrp4-encoding mRNA and to inhibit
translation of
such mRNA. Such antisense polynucleotides are used to inhibit expression of
zacrp4
35 polypeptide-encoding genes in cell culture or in a subject.
Transgenic mice, engineered to express the zacrp4 gene, and mice that
exhibit a complete absence of zacrp4 gene function, referred to as "knockout
mice"
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
62
(Snouwaert et al., Science 257:1083, 1992), may also be generated (Lowell et
al.,
Nature 366:740-42, 1993). These mice may be employed to study the zacrp4 gene
and
the protein encoded thereby in an in vivo system.
Polynucleotides and polypeptides of the present invention are also useful
as educational tools for use in laboratory practicum kits for academic courses
related to
genetics and molecular biology, protein chemistry and antibody production and
analysis. Due to its unique polynucleotide and polypeptide sequence, molecules
of
zacrp4 can be used as standards or as "unknowns" for testing purposes. For
example,
zacrp4 polynucleotides can be used as an aid to teach a student how to prepare
expression constructs for bacterial, viral, and/or mammalian expression,
including
fusion constructs, wherein zacrp4 is the gene to be expressed;. for
determining the
restriction endonuclease cleavage sites of the polynucleotides; determining
mRNA and
DNA localization of zacrp4 polynucleotides in tissues (i.e., by Northern and
Southern
blotting as well as polymerise chain reaction); and for identifying related
polynucleotides and polypeptides by nucleic acid hybridization.
Zacrp4 polypeptides can also be used as an educational aid to teach
preparation of antibodies; identification of proteins by Western blotting;
protein
purification; determination of the weight of expressed zacrp4 polypeptides as
a ratio to
total protein expressed; identification of peptide cleavage sites; coupling
amino and
2 o carboxyl terminal tags; amino acid sequence analysis, as well as, but not
limited to,
monitoring biological activities of both the native and tagged protein (i.e.,
receptor
binding, signal transduction, proliferation, and differentiation) in vitro and
in vivo.
Antibodies that bind specifically to zacrp-4 can be used as an aid to instruct
students
how to prepare affinity chromatography columns to purify zacrp-4, and as a
practicum
2 5 for teaching a student how to design humanized antibodies.
Zacrp4 polypeptides can also be used to teach analytical skills such as
mass spectrometry, circular dichroism to determine conformation, x-ray
crystallography
to determine the three-dimensional structure in atomic detail, nuclear
magnetic
resonance spectroscopy to reveal the structure of proteins in solution. For
example, a kit
3 0 containing zacrp4 can be given to the student to analyze as an unknown
protein to
developanalytical skills of the student or as a test of those skills. Since
every
polypeptide is unique, the educational utility of zacrp-4 would be unique unto
itself.
The invention provides zacpr-4 gene, polypeptide or antibody packaged
in educational kits to be used in academic programs allowing students to gain
skill in
3 5 art of molecular biology. Since each gene and protein is unique, each gene
and protein
provides unique challenges and learning experiences for students in a lab
practicum
setting.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
63
The invention is further illustrated by the following non-limiting
examples.
EXAMPLES
Example 1
Identification of zacrp4
Novel zacrp4 polynucleotides and polypeptides of the present invention
were initially identified querying an expressed sequence tag (EST) database
for proteins
having homology to adipocyte complement related proteins. To identify the
corresponding cDNA sequence, a clone was isolated from an arrayed human
pituitary
cDNA/plasmid library. The library was screened by PCR using oligonucleotides
ZC20,839 (SEQ ID NO:S) and ZC20,840 (SEQ ID N0:6). Thermocycler conditions
were as follows: 1 cycle at 94°C for 2 minutes 30 seconds, followed by
30 cycles at
94°C for 10 seconds, 64°C for 20 seconds, 72°C for 30
seconds, ending with a 7 minute
extension at 72°C. The library was deconvoluted down to a positive pool
of 250 clones.
E. coli DH10B cells (GIBCO BRL, Gaithersburg, MD) were transformed with this
pool
by electroporation following manufacturer's protocol. The transformed culture
was
titered and arrayed into a 96 well plate at ~20 cells/well. The cells were
grown
2 0 overnight at 37°C in LB + ampicillin. An aliquot of the cells were
pelleted and
screened using PCR to identify positive wells using oligonucleotide primers
and PCR
conditions were as described above. The remaining cells in the positive wells
were
plated and colonies screened by PCR to identify a single positive clone. The
clone was
subjected to sequence analysis using a Hybaid OmniGene Temperature Cycling
System
(National Labnet Co., Woodbridge, NY). SequencherTM 3.0 sequence analysis
software (Gene Codes Corporation, Ann Arbor, MI) was used for data analysis.
The
resulting 1196 by sequence is disclosed in SEQ ID NO:1.
Example 2
3 0 Tissue Distribution
Northerns were performed using Human Multiple Tissue Blots (MTN1,
MTN2 and MTN3) from Clontech (Palo Alto, CA) were probed to determine the
tissue
distribution of human zacrp4. A clone described above was used as a template
for the
generation of a 303 by cDNA probe based on the initially discovered EST
sequence
(SEQ ID N0:7) using the PCR. Oligo nucleotides ZC20,839 (SEQ ID NO:S) and
ZC20,840 (SEQ ID N0:6) were used as primers. The probe was purified using a
Gel
Extraction Kit (Qiagen, Chatsworth, CA) according to manufacturer's
instructions. The
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
64
probe was then radioactively labeled using a Rediprime II DNA labeling kit
(Amersham, Arlington Heights, IL) according to the manufacturer's
specifications. The
probe was purified using a NUCTrap push column (Stratagene Cloning Systems, La
Jolla, CA). ExpressHyb (Clontech) solution was used for prehybridization and
as a
hybridizing solution for the Northern blots. Hybridization took place
overnight at
SSoC, using 1.5 x 106 cpm/ml labeled probe. The blots were then washed in 2X
SSC
and 0.1% SDS at room temperature, then with 2X SSC and 0.1% SDS at
65°C,
followed by a wash in O.1X SSC and 0.1% SDS at 65°C. A single
transcript of
approximately 1.4 kb was seen in brain, spinal cord, ovary, and testis.
Fainter signals
l0 were detected in thyroid, adrenal gland, bone marrow, small intestine,
prostate, liver
and colon.
A RNA Master Dot Blot (Clontech) that contained RNAs from various
tissues that were normalized to 8 housekeeping genes were also probed and
hybridized
as described above. Expression was seen in all brain tissues and in fetal
brain, spinal
cord, ovary and pituitary gland. Fainter signals were detected in testis,
uterus, prostate,
salivary gland, lymph node and fetal liver and lung.
Example 3
Chromosomal Assignment and Placement of Zacrp4
Zacrp4 was mapped to chromosome 11 using the commercially available
GeneBridge 4 Radiation Hybrid Panel (Research Genetics, Inc., Huntsville, AL).
The
GeneBridge 4 Radiation Hybrid Panel contains PCRable DNAs from each of 93
radiation hybrid clones, plus two control DNAs (the HFL donor and the A23
recipient).
A publicly available WWW server (http://www-genome.wi.mit.edu/cgi-bin/contig/
rhmapper.pl) allows mapping relative to the Whitehead Institute/MIT Center for
Genome Research's radiation hybrid map of the human genome (the "WICGR"
radiation hybrid map) which was constructed with the GeneBridge 4 Radiation
Hybrid
Panel.
3 0 For the mapping of zacrp4 with the GeneBridge 4 RH Panel, 20 ~l
reactions were set up in a 96-well microtiter plate (Stratagene, La Jolla, CA)
and used
in a "RoboCycler Gradient 96" thermal cycler (Stratagene). Each of the 95 PCR
reactions consisted of 2 p1 lOX KlenTaq PCR reaction buffer (Clontech
Laboratories,
Inc., Palo Alto, CA), 1.6 ~1 dNTPs mix (2.5 mM each, Perkin-Elmer, Foster
City, CA),
1 p1 sense primer, ZC 22,162, (SEQ ID N0:8), 1 ~1 antisense primer, ZC 22,168
(SEQ
ID N0:9), 2 p1 RediLoad (Research Genetics, Inc.), 0.4 ~1 SOX Advantage
KlenTaq
Polymerase Mix (Clontech Laboratories, Inc.), 25 ng of DNA from an individual
hybrid
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
clone or control and ddHzO for a total volume of 20 ~l. The reactions were
overlaid
with an equal amount of mineral oil and sealed. The PCR cycler conditions were
as
follows: an initial 1 cycle 5 minute denaturation at 94oC, 40 cycles of a 45
seconds
denaturation at 94oC, 45 seconds annealing at 66°C and 1 minute and 15
seconds
5 extension at 72oC, followed by a final 1 cycle extension of 7 minutes at
72oC. The
reactions were separated by electrophoresis on a 2% agarose gel (Life
Technologies,
Gaithersburg, MD).
The results showed that zacrp4 maps 16.37 cR 3000 from the
framework marker D11S1350 on the chromosome 11 WICGR radiation hybrid map.
10 Proximal and distal framework markers were D11S1350 and CHLC.GATA6G03,
respectively. The use of surrounding markers positions Zacrp4 in the llqll
region on
the integrated LDB chromosome 11 map (The Genetic Location Database,
University
of Southhampton, WWW server: http://cedar. genetics.soton.ac.uk/public html~.
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
1
SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> SECRETED PROTEIN ZACRP4
<130> 99-29
<150> 09/346,502
<151> 1999-07-Ol
<160> 9
<170> FastSEQ for Windows Version 3.0
<210>1
<211>1357
<212>DNA
<213>Homo sapiens
<220>
<221> CDS
<222> (210)...(1196)
<400> 1
cgcccggcccctggccccagcaccctgtcc gctgccgcctcagagccggg aaaagcagcc60
ggagcccccgccgcccctgccgcagcgcgg gcggtcagcgcgcagcccgg cacccgcagc120
ctgcagcctgcagcccgcagcccgcagccc ggagccagatcgcgggctca gaccgaaccc180
gactcgaccgccgcccccagccaggcgcc atg ctg ctt ctg ctg ggc ctg 233
ccg
Met Leu Pro Leu Leu Leu Gly Leu
1 5
ctg ggc cca gcg gcc tgc tgg gcc ctg ggc ccg acc ccc ggc ccg gga 281
Leu Gly Pro Ala Ala Cys Trp Ala Leu Gly Pro Thr Pro Gly Pro Gly
15 20
tcc tct gag ctg cgc tcg gcc ttc tcg gcg gca cgc acc acc ccc ctg 329
Ser Ser Glu Leu Arg Ser Ala Phe Ser Ala Ala Arg Thr Thr Pro Leu
25 30 35 40
gag ggc acg tcg gag atg gcg gtg acc ttc gac aag gtg tac gtg aac 377
Glu Gly Thr Ser Glu Met Ala Val Thr Phe Asp Lys Val Tyr Val Asn
45 50 55
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
2
atc ggg ggc gac ttc gat gtg gcc acc ggc cag ttt cgc tgc cgc gtg 425
Ile Gly Gly Asp Phe Asp Val Ala Thr Gly Gln Phe Arg Cys Arg Val
60 65 70
ccc ggc gcc tac ttc ttc tcc ttc acg get ggc aag gcc ccg cac aag 473
Pro Gly Ala Tyr Phe Phe Ser Phe Thr Ala Gly Lys Ala Pro His Lys
75 80 85
agc ctg tcg gtg atg ctg gtg cga aac cgc gac gag gtg cag gcg ctg 521
Ser Leu Ser Val Met Leu Val Arg Asn Arg Asp Glu Val Gln Ala Leu
90 95 100
gcc ttc gac gag cag cgg cgg cca ggc gcg cgg cgc gca gcc agc cag 569
Ala Phe Asp Glu Gln Arg Arg Pro Gly Ala Arg Arg Ala Ala Ser Gln
105 110 115 120
agc gcc atg ctg cag ctc gac tac ggc gac aca gtg tgg ctg cgg ctg 617
Ser Ala Met Leu Gln Leu Asp Tyr Gly Asp Thr Val Trp Leu Arg Leu
125 130 135
cat ggc gcc ccg cac tac gcg cta ggc gcg ccc ggc gcc acc ttc agc 665
His Gly Ala Pro His Tyr Ala Leu Gly Ala Pro Gly Ala Thr Phe Ser
140 145 150
ggc tac cta gtc tac gcc gac gcc gac get gac gcg cct gcg cgc ggg 713
Gly Tyr Leu Val Tyr Ala Asp Ala Asp Ala Asp Ala Pro Ala Arg Gly
155 160 165
ccg ccc gcg ccc ccc gag ccg cgc tcg gcc ttc tcg gcg gcg cgc acg 761
Pro Pro Ala Pro Pro Glu Pro Arg Ser Ala Phe Ser Ala Ala Arg Thr
170 175 180
cgc agc ttg gtg ggc tcg gac get ggc ccc ggg ccg cgg cac caa cca 809
Arg Ser Leu Val Gly Ser Asp Ala Gly Pro Gly Pro Arg His Gln Pro
185 190 195 200
ctc gcc ttc gac acc gag ttc gtc aac att ggc ggc gac ttc gac gcg 857
Leu Ala Phe Asp Thr Glu Phe Val Asn Ile Gly Gly Asp Phe Asp Ala
205 210 215
gcg gcc ggc gtg ttc cgc tgc cgt ctg ccc ggc gcc tac ttc ttc tcc 905
Ala Ala Gly Val Phe Arg Cys Arg Leu Pro Gly Ala Tyr Phe Phe Ser
220 225 230
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
3
ttc acg ctg ggc aag ctg ccg cgt aag acg ctg tcg gtt aag ctg atg 953
Phe Thr Leu Gly Lys Leu Pro Arg Lys Thr Leu Ser Val Lys Leu Met
235 240 245
aag aac cgc gac gag gtg cag gcc atg att tac gac gac ggc gcg tcg 1001
Lys Asn Arg Asp Glu Val Gln Ala Met Ile Tyr Asp Asp Gly Ala Ser
250 255 260
cgg cgc cgc gag atg cag agc cag agc gtg atg ctg gcc ctg cgg cgc 1049
Arg Arg Arg Glu Met Gln Ser Gln Ser Val Met Leu Ala Leu Arg Arg
265 270 275 280
ggc gac gcc gtc tgg ctg ctc agc cac gac cac gac ggc tac, ggc gcc 1097
Gly Asp Ala Val Trp Leu Leu Ser His Asp His Asp Gly Tyr Gly Ala
285 290 295
tac agc aac cac ggc aag tac atc acc ttc tcc ggc ttc ctg gtg tac 1145
Tyr Ser Asn His Gly Lys Tyr Ile Thr Phe Ser Gly Phe Leu Val Tyr
300 305 310
ccc gac ctc gcc ccc gcc gcc ccg ccg ggc ctc ggg gcc tcg gag cta 1193
Pro Asp Leu Ala Pro Ala Ala Pro Pro Gly Leu Gly Ala Ser Glu Leu
315 320 325
ctg tgagccccgg gccagagaag agcccgggag ggccaggggc gtgcatgcca 1246
Leu
ggccgggccc gaggctcgaa agtcccgcgc gagcgccacg gcctccgggc gcgcctggac 1306
tctgccaata aagcggaaag cgggcacgcg cagcgcccgg cagcccaggc a 1357
<210>2
<211>329
<212>PRT
<213>Homo sapiens
<400> 2
Met Leu Pro Leu Leu Leu Gly Leu Leu Gly Pro Ala Ala Cys Trp Ala
1 5 10 15
Leu Gly Pro Thr Pro Gly Pro Gly Ser Ser Glu Leu Arg Ser Ala Phe
20 25 30
Ser Ala Ala Arg Thr Thr Pro Leu Glu Gly Thr Ser Glu Met Ala Val
35 40 45
Thr Phe Asp Lys Val Tyr Val Asn Ile Gly Gly Asp Phe Asp Val Ala
50 55 60
Thr Gly Gln Phe Arg Cys Arg Val Pro Gly Ala Tyr Phe Phe Ser Phe
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
4
65 70 75 80
Thr Ala Gly Lys Ala Pro His Lys Ser Leu Ser Val Met Leu Val Arg
85 90 95
Asn Arg Asp Glu Val Gln Ala Leu Ala Phe Asp Glu Gln Arg Arg Pro
100 105 110
Gly Ala Arg Arg Ala Ala Ser Gln Ser Ala Met Leu Gln Leu Asp Tyr
115 120 125
Gly Asp Thr Val Trp Leu Arg Leu His Gly Ala Pro His Tyr Ala Leu
130 135 140
Gly Ala Pro Gly Ala Thr Phe Ser Gly Tyr Leu Val Tyr Ala Asp Ala
145 150 155 160
Asp Ala Asp Ala Pro Ala Arg Gly Pro Pro Ala Pro Pro Glu Pro Arg
165 170 175
Ser Ala Phe Ser Ala Ala Arg Thr Arg Ser Leu Val Gly Ser Asp Ala
180 185 190
Gly Pro Gly Pro Arg His Gln Pro Leu Ala Phe Asp Thr Glu Phe Val
195 200 205
Asn Ile Gly Gly Asp Phe Asp Ala Ala Ala Gly Val Phe Arg Cys Arg
210 215 220
Leu Pro Gly Ala Tyr Phe Phe Ser Phe Thr Leu Gly Lys Leu Pro Arg
225 230 235 240
Lys Thr Leu Ser Val Lys Leu Met Lys Asn Arg Asp Glu Val Gln Ala
245 250 255
Met Ile Tyr Asp Asp Gly Ala Ser Arg Arg Arg Glu Met Gln Ser Gln
260 265 270
Ser Ual Met Leu Ala Leu Arg Arg Gly Asp Ala Val Trp Leu Leu Ser
275 280 285
His Asp His Asp Gly Tyr Gly Ala Tyr Ser Asn His Gly Lys Tyr Ile
290 295 300
Thr Phe Ser Gly Phe Leu Val Tyr Pro Asp Leu Ala Pro Ala Ala Pro
305 310 315 320
Pro Gly Leu Gly Ala Ser Glu Leu Leu
325
<210> 3
<211> 31
<212> PRT
<213> Artificial Sequence
<220>
<223> C1q Aromatic Motif
<221> VARIANT
<222> (2)...(6)
<223> Each Xaa is independently any amino acid residue
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
<221> VARIANT
<222> (7)...(7)
<223> Xaa is asparagine or aspartic acid
<221> VARIANT
<222> (8)...(11)
<223> Each Xaa is independently any amino acid residue
<221> VARIANT
<222> (12)...(12)
<223> Xaa is phenylalanine, tyrosine, tryptophan or
leucine
<221> VARIANT
<222> (13)...(18)
<223> Each Xaa is independently any amino acid residue
<221> VARIANT
<222> (20)...(24)
<223> Each Xaa is independently any amino acid residue
<221> VARIANT
<222> (26)...(26)
<223> Xaa is any amino acid residue
<221> VARIANT
<222> (28)...(28)
<223> Xaa is any amino acid residue
<221> VARIANT
<222> (30)...(30)
<223> Xaa is any amino acid residue
<221> VARIANT
<222> (31)...(31)
<223> Xaa is phenylalanine or tyrosine
<400> 3
Phe Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa
1 5 10 15
Xaa Xaa Phe Xaa Xaa Xaa Xaa Xaa Gly Xaa Tyr Xaa Phe Xaa Xaa
20 25 30
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
6
<210> 4
<211> 987
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate nucleotide sequence encoding the
polypeptide of SEQ ID N0:2
<221> variation
<222> (1)...(987)
<223> Each N is A, T. G or C
<400> 4
atgytnccnytnytnytnggnytnytnggnccngcngcntgytgggcnytnggnccnacn60
ccnggnccnggnwsnwsngarytnmgnwsngcnttywsngcngcnmgnacnacnccnytn120
garggnacnwsngaratggcngtnacnttygayaargtntaygtnaayathggnggngay180
ttygaygtngcnacnggncarttymgntgymgngtnccnggngcntayttyttywsntty240
acngcnggnaargcnccncayaarwsnytnwsngtnatgytngtnmgnaaymgngaygar300
gtncargcnytngcnttygaygarcarmgnmgnccnggngcnmgnmgngcngcnwsncar360
wsngcnatgytncarytngaytayggngayacngtntggytnmgnytncayggngcnccn420
caytaygcnytnggngcnccnggngcnacnttywsnggntayytngtntaygcngaygcn480
gaygcngaygcnccngcnmgnggnccnccngcnccnccngarccnmgnwsngcnttywsn540
gcngcnmgnacnmgnwsnytngtnggnwsngaygcnggnccnggnccnmgncaycarccn600
ytngcnttygayacngarttygtnaayathggnggngayttygaygcngcngcnggngtn660
ttymgntgymgnytnccnggngcntayttyttywsnttyacnytnggnaarytnccnmgn720
aaracnytnwsngtnaarytnatgaaraaymgngaygargtncargcnatgathtaygay780
gayggngcnwsnmgnmgnmgngaratgcarwsncarwsngtnatgytngcnytnmgnmgn840
ggngaygcngtntggytnytnwsncaygaycaygayggntayggngcntaywsnaaycay900
ggnaartayathacnttywsnggnttyytngtntayccngayytngcnccngcngcnccn960
ccnggnytnggngcnwsngarytnytn 987
<210> 5
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC20,839
<400> 5
atgtacttgc cgtggttgct gtag 24
<210> 6
<211> 23
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
7
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC20840
<400> 6
cgacaccgag ttcgtcaaca ttg 23
<210> 7
<211> 325
<212> DNA
<213> Artificial Sequence
<220>
<223> Degenerate nucleotide sequence encoding the
polypeptide of SEQ ID N0:2.
<221> variation
<222> (1)...(325)
<223> Each N is independently A. T. C or G.
<400> 7
ctggccccgggccgcggcaccaaccactcgccttcgacaccgagttcgtcaacattggcg 60
gcgacttcgacgcggcggccggcgtgttccgctgccgtctgnccggcgcctacttcttct 120
ncttcacgctgggcaagctgccgcgtaagacgctgtcggttaagctgatgaagaaccgcg 180
acgaggtgcaggccatgatttacgacgacggcgcgtcgcggcgccgcgagatgcagagcc 240
agagcgtgatgctggccctgcggcgcggngacgccgtctggctgtcagccacgaccacga 300
cggctacggcgcctacagcaaccac 325
<210> 8
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC22162
<400> 8
ccgcggcacc aaccactc 18
<210> 9
<211> 18
<212> DNA
CA 02378951 2001-12-28
WO 01/02565 PCT/US00/17692
<213> Artificial Sequence
<220>
<223> Oligonucleotide ZC 22168
<400> 9
gtcgcggttc ttcatcag 18
