Note: Descriptions are shown in the official language in which they were submitted.
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
10
CANCER TREATMENTS AND DIAGNOSTICS
UTILIZING RAD51 RELATED MOLECULES AND METHODS
FIELD OF THE INVENTION
The invention relates to compositions and methods for diagnosing, prognosing
and treating cancer
which generally utilize Rad51 inhibitors and Rad51 expression detectors.
BACKGROUND OF THE INVENTION
Breast cancer is the most frequent malignancy, affecting women in Western
industrialized countries.
Germline mutations in the coding sequences of the tumor suppressor genes BRCA1
and BRCA2 are
responsible for more than 65% of familial forms of breast cancer whereas
mutations in these genes
are rare in sporadic cases (Feunteun, J., Mol. Med. Today 4:263-270 (1998).
However, BRCA1
function is also lost in sporadic breast cancer due to down-regulation of
BRCA1 protein levels in tumor
cells (Yoshikawa, K., et al., clin. Canc. Res. 5:1249-1261 (1999); Wilson,
C.A., et al., Nat. Genet.
21:236-240 (1999); Dobrovic, A. and Simpfendorfer, D., Canc. Res. 57:3347-3350
(1997; Mancini,
D.N., et al., Oncogene 16:1161-1169 (1998)). BRCA1 is directly involved in
pathways that respond to
DNA damage (Zhang, H., et al., Cell 92:433-436 (1998)). The polypeptide is
part of a multi protein
complex, which also contains Rad51 (Scully, R., et al., Cell 88:265-275
(1997)), a key enzyme of
homologous recombination and the repair of DNA double strand breaks (Feunteun,
J., Mol. Med.
Today 4:263-270 (1998); Baumann, P. and West, S.C., Trends Biochem. Sci.
23:247-251 (1998)).
Regarding treating cancer, the capability of tumor cells to become resistant
towards chemo- and/or
radiotherapy is regarded as one of the major problems that hinder the
efficiency of most established
-1-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
therapeutic regimes to treat advanced stages of solid tumors. These critical
aspects of the malignant
phenotype of cancer cells are mimicked more reliably by three-dimensional (3D)
cell systems than by
classical monolayer cell cultures (for review, see Mueller-Klieser, W., Am. J.
Physiol. 273:C1109-1123
(1997); Kunz-Schughart, L.A., et al., Int. J. Exp. Path. 79:1-23 (1998)). 3-D
growth enhances the
metastatic potential of different human tumor cell lines (Raz, A and Ben-e'ev,
A., Science 221:1307-
1310 (1983)) and augments the level of radio- and chemoresistance compared to
the same cells
grown as monolayers (Mueller-Klieser, W., Am. J. Physiol. 273:C1109-1123
(1997)). Permanent
genetic alterations alone cannot be responsible for the increase in
chemoresistance in 3D-culture
compared to monolayers, since this phenotype is lost after only a few cell
doublings as monolayers
(Luo, C., et al., Exp. Cell Res. 243:282-289 (1998)). Recently, up-regulations
of P-glycoprotein in
tumor cells grown as spheroids, has been described (Wartenberg, M., et al.,
Int. J. Cancer 75:855-863
(1998)). However, it appears that classical resistance genes are not alone
responsible for the
development of chemoresistance in 3D cultures (Desoize, B., et al.,
AnticancerRes. 18:4147-4158
(1998)).
Regarding DNA repair mechanisms, homologous recombination is one of the
mechanisms involved in
the repair of DNA double strand breaks. One of the key-factors catalyzing
these processes is the
product of the rad51 gene. Induced disruption of the rad51 gene in chicken
cells leads to cell death
accompanied by the accumulation of DNA double-strand breaks (Sonoda, E., et
al., EMBO J., 17:598-
608 (1998)). Elevated expression of Rad51 enhances radioresistance of human
tumor cells
(Yanagisawa, T., et al., Oral Oncol. 334:524-528 (1998); Vispe, S., et al.,
Nucl. Acids Res. 26:2859-
2864 (1998)). Treatment of monolayer cultures of tumor cells with Rad51
specific anti-sense
oligonucleotides renders them radiosensitive (Ohnishi, t., et al., Biochem.
Biophys. Res. Commun.
245:319-324 (1998)).
Homologous recombination of DNA is one of the driving forces of genetic
variety and evolution, but on
the other hand, the same mechanism guarantees maintenance of genomic stability
by participation in
the repair of DNA double strand breaks. The product of the recA gene is known
as one of the key
factors, catalyzing homologous recombination processes in prokaryotes like
Escherichia coli. In
eukaryotes, members of the Rad51 family of proteins share remarkable
structural and functional
homology with E. coli RecA. In bacteria and yeast, RecA/Rad51 deficiency leads
to a drop in
recombination rate and high sensitivity to y-irradiation without affecting
overall cell survival. By
contrast, mouse embryos lacking functional Rad51 die early in development just
prior to gastrulation
and efforts to establish Rad51 deficient mammalian cell lines have failed
(Lim, D.S. & Hasty, P., Mol
Cell Biol 16:7133-43 (1996); Tsuzuki, T., et al., Proc Natl Acad Sci USA
93:6236-40 (1996)).
-2-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
Conditionally Rad51 deficient chicken cells accumulate double strand breaks
prior to cell death
(Sonoda, E., et al., Embo J 17:598-608 (1998)). These results indicate that,
in contrast to bacteria
and yeast, Rad51 is essential for cell survival in vertebrates and might be
involved in maintaining
cellular homeostasis.
Rad51 physically interacts with several tumor suppressors like the BRCA-1
(Scully, R., et al., Cell
88:265-75 (1997b)) and BRCA-2 (Sharan, S.K., et al., Nature 386:804-10
(1997)), polypeptides
defective in hereditary forms of breast and ovarian cancer. Mouse embryos
lacking functional BRCA1
or BRCA2 display a similar phenotype as Rad51 deficient mouse embryos (Hakem,
R., et al., Cell
85:1009-23 (1996); Suzuki, A., et al., Genes Dev 11:1242-52 (1997); Chen,
J.J., et al., Mol Cel12:317-
28 (1998); Chen, J.J., et al., Cancer Res 59:1752s-1756s (1999b)). Moreover,
it has been observed
that BRCA1 and BRCA2 nullizygous embryos show activation of the cell cycle
inhibitor p21 Wa"
(Hakem, R., et al., Cell 85:1009-23 (1996); Suzuki, A., et al., Genes Dev
11:1242-52 (1997)).
Classically, the tumor suppressor p53 is the most prominent regulator of
p21'"a" expression. p53
maintains genomic stability by controlling for DNA integrity and, as
appropriate, responds with halting
the cell cycle or by inducing cell death by apoptosis (for review see, (Janus,
F., et al., Cell Mol Life Sci
55:12-27 (1999)). p53 also forms protein complexes with Rad51 and suppresses
biochemical
activities of the bacterial homologue RecA in vitro (Sturzbecher, H.W., et
al., Embo J 15:1992-2002
(1996). Cells lacking functional p53 develop genomic instability and exhibit
elevated rates of
homologous recombination (Bertrand, P., et al., Oncogene 14:1117-22 (1997);
Mekeel, K.L., et al.,
Oncogene 14:1847-57 (1997)), suggesting a control function of p53 for
processes of homologous
recombination.
Described herein are methods and compositions which address the diagnosis,
prognosis, predictive
outcome of therapies and treatment of cancer and which utilize compositions
and pathways related to
Rad51.
SUMMARY OF THE INVENTION
In accordance with the objects outlined above, the present invention provides
a number of methods of
diagnosis and prognosis, predictive outcome methods and methods of treating
cancer. Methods of
inhibiting and inducing apoptosis are also provided.
-3-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
In one aspect of the invention, a method of diagnosing an individual for
cancer is provided. In one
embodiment, the method comprises determining the level of Rad51 expression in
a sample from an
individual; and comparing said level to a control level wherein a change from
said control indicates
cancer. The sample is preferably a tissue sample or cells which have been
cultured in spheroids.
Various cancers can be diagnosed by said method, including but not limited to
breast cancer, brain
cancer, pancreatic cancer, prostate cancer, colon cancer, lymphoma, and skin
cancer.
Rad51 expression can be determined by the level of Rad51 protein or nucleic
acid, protein being
preferred. In one embodiment, the level is determined through the use of
polyclonal antibodies.
Preferably, the level is determined through the use of monoclonal antibodies.
In one embodiment,
said antibodies are raised against eukaryotic Rad51, preferably, mammalian
Rad51. Alternatively, the
Rad51 expression is determined by the level of Rad51 nucleic acid.
In another aspect of the invention, a method of prognosing an individual for
cancer is provided. In one
embodiment the method comprises determining the level of Rad51 expression in a
sample from an
individual; and comparing said level to a control which indicates the severity
of cancer so as to provide
a prognosis. Generally, the higher level of Rad51 expression in said
individual the less time the
patient has to live without treatment.
Also provided herein is a method for identifying a cancer cell in a primary
tissue sample. In one
embodiment, the method comprises determining the level of Rad51 in a primary
tissue sample of
interest; and comparing said level of Rad51 to a non-cancer tissue sample,
wherein a difference in
said level indicates a cancer cell is in the tissue sample of interest.
In yet another aspect of the invention, a kit for detecting a normal or
abnormal level of Rad51
expression in a tissue sample is provided. The kit comprises a binding agent
for detecting Rad51, a
detectable label; and a control which indicates a normal level of Rad51
expression or Rad51
expression at various severities of cancer.
Also provided herein is a method for treating an individual with cancer,
comprising inhibiting Rad51
activity in said individual. Preferably, a Rad51 inhibitor is administered to
said individual in an amount
effective to inhibit cancer in said individual.
In one embodiment, Rad51 or a Rad51 inhibitor is administered to a cell which
comprises
dysfunctional p53. As shown herein, there is not a requirement that p53 be
present for the methods
-4-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
provided herein. Therefore, in one embodiment, p53 is excluded from
administration in conjuction with
a Rad51 inhibitor.
Also provided herein is a method for inducing sensitivity to radiation and DNA
damaging
chemotherapeutics in an individual with cancer comprising administering
inhibiting Rad51 activity in
said individual. In one embodiment, a composition comprising a Rad51 inhibitor
is administered to
said individual in an amount effective to induce said sensitivity.
In yet another aspect of the invention, a method of inducing apoptosis in a
cell is provided which
comprises administering a Rad51 inhibitor to said cell. In one embodiment, the
cell is a cancer cell.
Also provided herein is a method of determining a predictive outcome of a
treatment for cancer.
Predictive outcome as used herein is a term which indicates whether or not a
treatment will be
effective for a certain condition. In one embodiment, the method comprises
determining the level of
Rad51 expression in a tissue sample of a patient and correlating said level
with a control which
indicates the resistance a patient will have to chemotherapy or radiation
treatments. The greater the
level of Rad51, generally the greater resistance the patient will have.
Moreover, also provided herein is a method of inhibiting apoptosis in a cell
comprising inducing
overexpression of Rad51 in a cell. Overexpression means more expression than
would be found in a
normal unaffected cell. Inducing overexpression can be by a variety of ways
including administering
Rad51 protein, Rad51 nucleic acid or by indirectly stimulating Rad51
expression. Preferably, inducing
is by administration of a Rad51 nucleic acid. In one embodiment, a nuclear
localization signal is joined
to said nucleic acid.
Also provided herein is a method of enhancing survival of a cell comprising
inducing overexpression of
Rad51 in a cell.
Furthermore, a method of screening for agents which modulate Rad51 expression
is provided. In one
embodiment, the method comprises culturing cells in spheroids and adding a
candidate agent to said
spheroids and determining Rad51 expression levels before and after adding said
candidate agent,
wherein a change indicates said candidate agent modulates Rad51 expression.
Preferably, the agent
inhibits expression. The spheroids can also be used to determine effective
treatments. Moreover, the
spheroids can be used to identify agents which modulate Rad51 activity.
-5-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1A-1F show comparison by Rad51 and p53 expression levels in monolayer
cell culture by
immunohistochemistry (Figuers 1A-1D) and Western-Blotting (Figures 1E-1F).
More particularly, in
Figures 1A-1 D, immunocytochemistry of Rad51 (Figure 1 B and 1 D) and p53
(Figures 1A and 1 C) in
pancreatic cancer cell lines are shown. Immunostaining of cell lines 818-4
(Figures 1A-1 B) and
BXPC-3 (Figures 1 C-1 D), respectively, was performed using monoclonal
antibody 1 G8 for Rad51 and
monoclonal antibody PAb1801 for p53. Before staining, cells were fixed in 3,7%
neutral buffered
formalin and permeabilized with 0,2% riton X-100. Rad 51 and p53 proteins were
visualized using
diaminobenzidine tetrahydrochloride as substrate for peroxidase;
counterstaining with hemalum.
Magnification: 1000-fold. In Figures 1 E-1 F, expression of full-length Rad51
(Figure 1 F) and p53
(Figure 1 E) proteins in pancreatic tumor cell lines are shown. Western blot
analysis of Rad51 and p53
proteins in 50 Ng of total protein extracts from 818-4 and BXPC-3 pancreatic
cell lines using
monoclonals 1G8 for Rad51 and DO-1 for p53 detection. Exposure time to detect
Rad51 protein was
about 20 minutes as compared to 45 seconds for p53.
Figures 2A-2H show accumulation of Rad51 protein in human pancreatic cancer
cell lines grown as
spheroids. More particularly, Figures 2A-2F show PancTU-I and 818-4 cells
which were grown as
spheroids and analyzed by immunohistochemistry. Spheroids were harvested,
formalin fixed and
paraffin embedded. Rad51 was detected using monoclonal antibody 1 G8 and
visualized using
diaminobenzidine tetrahydrochloride as substrate for peroxidase;
counterstaining with hemalum. The
order of magnification as indicated. Figures 2G-2H show Western blot analysis
of Rad51 protein in 50
~g of total lysates from PancTU-I (Figure 2G) and 818-4 (Figure 2H) pancreatic
cell lines grown as
monolayer (lane a) or as spheroid (lane b) using monoclonals 1 G8 for Rad51
detection.
Figure 3A-3H shows comparison of Rad51 expression in pancreatic cancer cells,
grown either as
monolayer, as tumor in SCID mice after orthotopic transplantation or in
different tumor specimens of
pancreatic adenocarcinoma. Rad51 expression was determined by
immunohistochemistry in: A-B)
Panc-TUI monolayer cells, C-E) Panc-TUI cells growing as tumors in SCID mice
after orthotopic
transplantation or F-H) in different specimens of human pancreatic
adenocarcinoma. Specimens were
harvested, formalin fixed and paraffin embedded. Rad51 was detected using
monoclonal antibody
1 G8 and visualized using diaminobenzidine tetrahydrochloride as substrate for
peroxidase;
counterstaining with hemalum. Order of magnification as indicated.
-6-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
Figure 4 shows specificity of Rad51 immunohistochemistry determined by peptide
competition. More
particularly, Figure 4 shows a competition experiment using a peptide
corresponding to the 1G8
epitope. Rad51 was stained with the monoclonal antibody 1 G8, in absence
(Figure 4A) and presence
(Figure 4B) of competing peptide 10-ADTSVEEESFCPQP-25. Rad51 was visualized
using
diaminobenzidine tetrahydrochloride as substrate for peroxidase. Magnification
200-fold.
Figure 5 shows mutation analysis-of the Rad51 coding sequence using the non-
isotopic RNASE
cleavage assay (NIRCA). Negative control: NIRC-assay performed on hybridized
sense and
anti-sense wild-type Rad51 mRNA; positive control: RNASE cleavage using wild-
type sense and an in
vitro generated point mutant (anti-sense) of Rad51; Capan-1, HPAF: NIR-assay
performed on Rad51
mRNA isolated from the pancreatic tumor cell lines Capan-1 and HPAF,
respectively, hybridized to
genuine wild-type Rad51 mRNA; a) control without RNASE digestion; b) c) d)
RNASE 1, 2, 3
digestion with the enzymes provided by the supplier; wt: wild-type Rad51 mRNA;
mt: mutant Rad51
mRNA; S: sense mRNA; AS: anti-sense mRNA. RNA fragments were analyzed on 2%
agarose gels
and stained with ethidium bromide. Shown is an inverted print of the gel using
the Fluor-S imaging
system.
Figure 6 shows biological consequences of Rad51 over-expression. In
particular, Figure 6A shows
that p53 levels are unaffected by over-expression of Rad51. UiRad51 and UiLacZ
cells were plated
and allowed to sit for 24h. At that time, induction of ectopic protein
production was induced with 1 NM
muristerone A, non-induced cells received 1%o ethanol, the solvent used for
muristerone A. UV
irradiation was carried out after additional 24h and cells were harvested 24h
thereafter. Equal
numbers of cells were subjected to Western blotting for p53 protein detection.
Figure 6B shows
over-expression of Rad51 confers resistance to DNA double strand breaks.
UiRad51 cells were
plated at identical cell numbers and allowed to adhere for 24h. Induction of
ectopic protein production
was induced with 1 NM muristerone A, non-induced cells received 1%o ethanol.
24h after induction,
cells were treated with calicheamicin y1 at the concentrations indicated for
16h, washed three times in
complete medium and allowed to recover for 72h. Subsequently, cells were
stained with crystal violet.
Cell survival was quantified using a GS700 densitometer (Biorad, Munich).
Figure 7 shows a map of the 5'-region of the human rad51 gene. Regulatory
region: fine hatched,
exons: black, introns: coarsed; nucleotides 700 to 1560 are shown; putative
factor binding sites are
boxed.
-7-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
Figures 8A-L show expression of RadG1, p53, Ki67-antigen and BRCA1 in relation
to tumor grading.
A collection of specimens from invasive ductal carcinoma of different
histological grading (G1, G2, G3)
were stained with monoclonal antibodies 1G8 (anti Rad51), Do-1 (anti p53), MIB-
1 (anti Ki67-antigen),
and AB-1 (anti BRCA1). Counterstaining with Hemalum.
Figure 9 shows a graph showing the correlations between Rad51, p53, Ki67-
antigen and BRCA1
expression and established tumor parameters. r5: Spearman s rank correlation
coefficient; */**/***:
p<0.05/0.01/0.001; T: tumor size; N: nodal status; G: histological grading;
ES: estrogen receptor
status; PS: progesterone receptor status; PCI: positive stained cell index;
IRS: immunoreactive
score (Remmele and Stegner, 1987); SII: staining intensity index.
Figures 10A-10D show representative staining patterns of BRCA1. Various
specimens of invasive
ductal breast cancer were stained for BRCA1 expression using monoclonal
antibody AB-1. (0): no
BRCA1 specific staining (blue nuclei due to Mayer's Hemalum counter-staining);
(1): more than 10%
of tumor cells show weak BRCA1 staining (grey color); (2): clear BRCA1
staining with more than 10%
of brown tumor cell nuclei; (3): intense brown staining of more than 10% of
tumor cell nuclei.
Figures 11A-11C show ectopic expression of Rad51 causes cell cycle arrest in
UiRad51 cells. More
particularly, Figure 11A shows UiRad51 cells inducibly over-express ectopic
Rad51 protein. Cells
were grown in the presence or absence of muristerone A as indicated by .+' and
.=, respectively.
Lysates from equal cell numbers were applied to each lane and analyzed by
Western blotting for Rad5
1 protein using monoclonal antibody 1G8. Figure 11B shows UiLacZ and UiRad51
cells arrest in G,
and G2/M in response to UV irradiation. Cells were UV irradiated, harvested
54h later and analyzed by
flow cytometry. Figure 11C shows Rad51 over-expression induces cell cycle
arrest. Cells were
cultivated in the presence or absence of muristerone A for the time indicated
and subjected to cell
cycle analysis by flow cytometry.
Figures 12A-12C shows ectopic expression of Rad51 transcriptionally induces
expression of p21""~f'
protein without p53 activation. More particularly, Figure 12A shows Rad51
triggers p21Waf-I protein
expression. UiRad51 cells were plated and allowed to sit for 24h. At that
time, cells shown in lanes 1
and 2 received 1 %o ethanol, the solvent used for muristerone A, while those
represented in lanes 3
and 4 were supplemented with muristerone A. UV irradiation was carried out
after additional 24h
(lanes 2 and 4) and cells were harvested 24h thereafter. Equal numbers of
cells were subjected to
Western blotting for p21'"af' protein detection by using monoclonal antibody
6B6 (Pharmingen).
Figure 12B shows Rad51 induces transcriptional activation of the vvaf 1
promoter. Equal numbers of
_g_
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
non-induced UiLacZ and UiRad51 cells were transfected with reporter plasmid
WWP-Luc ((e1 Deiry,
W.S., et al., Cell 75:817-25 (1993)). Cells were induced with ponasterone A
for 48h where indicated.
Cell lysates were normalized to protein content and assayed for luciferase
activity. Error bars
represent standard deviation of triplicates. Figure 12C shows Rad51 does not
trigger activation of p53
as transcription factor. UiRad51 blue cells were seeded, allowed to sit for
24h and subsequently
treated with 1 NM muristerone A for 40h. UV irradiation was carried out 16h
before harvesting. ~3-
galactosidase activity assays were carried out in duplicate.
Figures 13A-13C show Rad51 induced cell cycle arrest is lost after prolonged
Rad51 over i
expression. In particular, Figure 13A shows Rad51 arrested UiRad51 cells re-
enter the cell cycle
despite over-expression of Rad51. Cells were induced with muristerone A for
the time indicated and
the distribution of cell cycle phases determined by flow cytometry. G,: dark
gray, S: black, Gz/M: light
gray. Figure 13B shows p21'"a" protein level decreases while cells re-enter
proliferation. Equal cell
numbers derived from (Figure 13A) were analyzed for p21"'a" expression by
Western Blot using
monoclonal antibody 6B6 (Pharmingen). Figure 13C shows Rad51 does not induce
transcriptional
activation of the waf 1 promoter after adaptation. Equal numbers of non-
induced and adapted
UiRad51 cells were transfected with reporter plasmid WWP-Luc (e1 Dei~y, w ~ et
al., Cel175:817-25
(1993)). Cells were induced with ponasterone A for 48h where indicated. Cell
lysates were
normalized to protein content and assayed for luciferase activity. "Non-
induced" and "induced" refer to
ponasterone A treatment for 48h after transfection. "Nonadapted": cells were
treated with
ponasterone A only after transfection with WWP-Luc (see Figure 12C);
"adapted": cells were induced
with muristerone A for more than 28d prior to transfection; "continuous
treatment": uninterrupted
treatment of adapted cells until transfection of WWP-Luc; "discontinuous
treatment": muristerone A
treatment ended 48h prior to transfection of adapted cells. Error bars
represent standard deviation of
triplicates.
Figures 14A-14B show adaptation to Rad51 over-expression does not affect UV
triggered cell cycle
arrest pathways. Particularly, Figure 14A shows re-induction of Rad51 in
adapted cells does not lead
to cell cycle arrest. Ponasterone A was removed from long-term induced (>28d)
UiRad51 cells for 14d
(Panel 1 ) or for 11 d followed by re-induction for 72h (Panel 2) and cells
analyzed by flow cytometry.
Panels 3 and 4: Cells were treated as in panels 1 and 2, respectively, but in
addition cells were
UV-irradiated 24h prior to harvest. Figure 14B shows that p53 accumulates
after UV-irradiation of
adapted cells. Cells were treated as in (A). An aliquot each was lysed for
Western blot analysis.
Lysates from equal cell numbers were applied to each lane and analyzed for p53
protein by using a
polyclonal sheep anti p53 serum. Lane numbers correspond to panel numbers in
Figure 14A.
_g_
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to a series of discoveries relating to the
pivotal role that Rad51 plays
in a number of cellular functions, including those involved in disease states.
In particular, described
herein are compositions and methods for inhibiting Rad51 and methods of
treatment for disease
states associated with Rad51 activity as further defined below using Rad51
inhibitors. Also provided
are methods regarding the regulation of apoptosis. Furthermore, methods of
diagnosis and prognosis
of Rad51 related disorders as well as predictive outcomes of treatments are
provided. Other
compositions and methods related to Rad51 are also described.
In one embodiment, a method is provided which comprises first determining the
level of Rad51
expression in a first tissue type of a first individual, i.e. the sample
tissue for which a diagnosis or
prognosis is required. In some embodiments, the testing may be done on one or
more cells cultured
as spheroids or a primary tissue sample. The first individual, or patient, is
suspected of being at risk
for the disease state, and is generally a human subject, although as will be
appreciated by those in the
art, the patient may be animal as well, for example in the development or
evaluation of animal models
of human disease. Thus other animals, including mammals such as rodents
(including mice, rats,
hamsters and guinea pigs), cats, dogs, rabbits, farm animals including cows,
horses, goats, sheep,
pigs, etc., and primates (including monkeys, chimpanzees, orangutans and
gorillas) are included
within the definition of patient.
As will be appreciated by those in the art, the tissue type tested will depend
on the disease state under
consideration. Thus for example, potentially cancerous tissue may be tested,
including breast tissue,
skin cells, pancreas, prostate, colon, solid tumors, brain tissue, etc. In a
preferred embodiment, the
disease state under consideration is cancer and the tissue sample is a
potentially cancerous tissue
type. Of particular interest is breast, skin, brain, colon, pancreas,
prostate, and other solid tumor
cancers.
Rad51 expression as used herein means any form of expression, at the protein
or nucleic acid level.
Preferably, expression level is determined at the protein level and the
nucleic acid level is excluded
from the determination.
-10-
CA 02379608 2002-02-07
WO 01/11369 PCT/iJS00/22077
Once the determination of the Rad51 expression level is determined, it can be
compared to a control
to determine the diagnosis or prognosis. The control may be another control
experiment on an
unaffected sample such as from another individual or another tissue of the
same individual, or it may
be a chart, graph or diagram which indicates the "normal" range of levels of
Rad51 in an individual
similar to the one being tested. In one case, the severity may be determined
by having one or more
controls and determining how different the test results are from the control.
The greater the level of
Rad51 in the test results over the control indicates a greater severity of
cancer. Alternatively, a
number of controls may be provided such that the results can be matched with a
control which shows
a predetermined severity of cancer. By determining the severity, a prognosis
can also be provided.
A change, preferably an increase, is generally from at least about 5% to about
500% or more, more
preferably 20% to 100%, and sometimes more than a 200% increase, sometimes
more than a 300%
increase, sometimes more than a 400% increase, sometimes more than a 500%
increase, and
sometimes more than a 750% increase, Generally, to see this effect, at least
about 100 cells should
be evaluated, with at least about 500 cells being preferred, and at least
about 1000 being particularly
preferred.
The level of Rad51 expression can be determined in a variety of ways. In a
preferred embodiment, a
labeled binding agent that binds to Rad51 is used. By "labeled" herein is
meant that a compound has
at least one element, isotope or chemical compound attached to enable the
detection of the
compound. In general, labels fall into three classes: a) isotopic labels,
which may be radioactive or
heavy isotopes; b) immune labels, which may be antibodies or antigens; and c)
colored or fluorescent
dyes. The labels may be incorporated into the compound at any position.
Preferred labels are
fluorescent or radioactive labels. The binding agent can either be labeled
directly, or indirectly,
through the use of a labeled secondary agent which will bind to the first
binding agent. The spheroids
or tissue sample are prepared as is known for cellular or in situ staining,
using techniques well known
in the art, as outlined in the Examples.
In a preferred embodiment, the binding agent used to detect Rad51 protein is
an antibody. The
antibodies may be either polyclonal or monoclonal, with monoclonal antibodies
being preferred. In
general, it is preferred, but not required, that antibodies to the particular
Rad51 under evaluation be
used; that is, antibodies directed against human Rad51 are used in the
evaluation of human patients.
However, as the homology between different mammalian Rad51 molecules is quite
high (73% identity
as between human and chicken, for example), it is possible to use antibodies
against Rad51 from one
type of animal to evaluate a different animal (mouse antibodies to evaluate
human tissue, etc.). Thus,
-11-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
in a preferred embodiment, antibodies raised against eukaryotic Rad51 are
used, with antibodies
raised against mammalian Rad51 being especially preferred. Thus, antibodies
raised against yeast,
human, rodent, primate, and avian Rad51 proteins are particularly preferred.
In addition, as will be
appreciated by those in the art, the protein used to generate the antibodies
need not be the full-length
protein; fragments and derivatives may be used, as long as there is sufficient
immunoreactivity against
the sample Rad51 to allow detection. Alternatively, other binding agents which
will bind to Rad51 at
sufficient affinity to allow visualization can be used. In an alternative
embodiment, expression levels
are determined by determining mRNA levels of Rad51.
In another aspect of the invention, methods of inhibiting Rad51 expression
and/or activity are provided.
In one aspect of the invention, a method for inhibiting at least one Rad51
biological or biochemical
activity is provided. The method comprises administering a Rad51 inhibitor to
a composition
comprising Rad51. The composition can be an in vitro solution comprising Rad51
and Rad51 binders
such as DNA and ATP under conditions which allow Rad51 activity. In one
embodiment, the
composition is a cell. In a preferred embodiment, the Rad51 inhibitor is a
small molecule.
Rad51 biological or biochemical activity as used herein can be selected from
the group consisting of
DNA dependent ATPase activity, formation of Rad51 foci, nucleic acid strand
exchange, DNA binding,
nucleoprotein filament formation, DNA pairing and DNA repair. DNA repair and
recombination are
generally considered biological activities. DNA repair can be double stranded
break repair, single
stranded annealing or post replication recombinational repair.
As further described below, in another aspect of the invention, a Rad51
inhibitor inhibits cell
proliferation. In a further aspect also described below, a Rad51 inhibitor
results in the cells containing
it to be more sensitive to radiation and/or chemotherapeutic agents. In yet
another aspect, a Rad51
inhibitor induces apoptosis as further described below.
In one aspect, a Rad51 inhibitor or an agent or composition having Rad51
inhibitory activity is defined
herein as an agent or composition inhibiting expression or translation of a
Rad51 nucleic acid or the
biological activity of a Rad51 peptide by at least 30%, more preferably 40%,
more preferably 50%,
more preferably 70%, more preferably 90%, and most preferably by at least 95%.
In one embodiment
herein, a Rad51 inhibitor inhibits expression or translation of a Rad51
nucleic acid or the activity of a
Rad51 protein by 100%. In one aspect, inhibition is defined as any detectable
decrease in Rad51
activity compared to a control not comprising the Rad51 inhibitor.
-12-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
In one embodiment, Rad51 inhibitors can include inhibitors of Rad51 homologues
such as RecA
and/or inhibitors that sensitize cells to radiation and also affect aspects of
recombination in vivo, which
were not previously known to inhibit Rad51. Thus, in one embodiment, Rad51 as
used herein refers
to Rad51 and its homologues, preferably human homologues. In one embodiment,
Rad51 excludes
non-human homologues. Rad51 homologues include RecA and Rad51 homologues in
yeast and in
mammals. Genes homologous to E. coli RecA and yeast Rad51 have been isolated
from all groups of
eukaryotes, including mammals. Morita, et al., PNAS USA 90:6577-6580 (1993);
Shinohara, et al.,
Nature Genet. 4:239-243 (1993); Heyer, Experentia, 50:223-233 (1994);
Maeshima, et al., Gene
160:195-200 (1995). Human Rad51 homologues include Rad51 B, Rad51 C, Rad51 D,
XRCC2 and
XRCC3. Albala, et al., Genomics 46:476-479 (1997); Dosanjh, et al., Nucleic
Acids Res
26:1179(1998); Pittman, et al., Genomics 49:103-11 (1998); Cartwright, et al.,
Nucleic Acids Res
26:3084-3089 (1998); Liu, et al., Mol Cell 1:783-793 (1998). In preferred
embodiments, Rad51
inhibitors provided herein were not previously known to inhibit RecA or other
Rad51 homologues and
were not known to induce sensitizing of cells to radiation. In one embodiment,
Rad51 as used herein
excludes homologues thereof.
The Rad51 inhibitor can inhibit Rad51 directly or indirectly, preferably
directly by interacting with at
least a portion of the Rad51 nucleic acid or protein. Additionally, the
inhibitors herein can be utilized
individually or in combination with each other.
In a preferred embodiment, the small molecule is preferably 4 kilodaltons (kd)
or less. In another
embodiment, the small molecule is less than 3 kd, 2kd or 1 kd. In another
embodiment the small
molecule is less than 800 daltons (D), 500 D, 300 D, 200 D or 100 D.
In one embodiment, the Rad51 inhibitor is an inorganic or organic molecule. In
a preferred
embodiment, the Rad51 inhibitor is a small organic molecule, comprising
functional groups necessary
for structural interaction with proteins, particularly hydrogen bonding, and
typically will include at least
an amine, carbonyl, hydroxyl or carboxyl group, preferably at least two of the
functional chemical
groups. The Rad51 inhibitor may comprise cyclical carbon or heterocyclic
structures and/or aromatic
or polyaromatic structures substituted with one or more chemical functional
groups. As further
discussed below, Rad51 inhibitors can comprise nucleotides, nucleosides, and
nucleotide and
nucleoside analogues. Nucleotides as used herein refer to XYP, wherein X can
be U, T, G, C or A
(base being uracil, thymine, guanine, cytosine or adenine, respectively), and
Y can be M, D or T
(mono, di or tri, respectively). In another embodiment, nucleotides can
include xathanine,
hypoxathanine, isocytosine, isoguanine, etc. Analogues as used herein includes
derivatives of and
-13-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
chemically modified nucleotides and nucleosides. In one embodiment, methyl
methanesulfonate is
excluded.
In one aspect of the invention, the Rad51 inhibitor is a nucleotide
diphosphate. In a preferred
embodiment, the Rad51 inhibitor is selected from the group consisting of ADP,
GDP, CDP, UDP and
TDP. In preferred embodiments, ADP is excluded.
In another aspect of the invention, the Rad51 inhibitor is a nucleotide
analogue. In a preferred
embodiment, the Rad51 inhibitor is a nucleotide diphosphate complexed with
aluminum fluoride. In
one embodiment, the Rad51 inhibitor is selected from the group consisting of
ADP.AIF4, GDP.AIF4,
CDP.AIF4, UDP.AIF4 and TDP.AIF4
In yet a further aspect of the invention, the Rad51 inhibitor is a non-
hydrolyzable nucleotide. In a
preferred embodiment, the Rad51 inhibitor is selected from the group
consisting of ATPyS, GTPyS,
UTPyS, CTPyS, TTPyS, ADPYS, GDPyS, UDPyS, CDPyS, TDPyS, AMPyS, GMPyS, UMPyS,
CMPyS, TMPyS, ATP-PNP, GTP-PNP, UTP-PNP, CTP-PNP, TTP-PNP, ADP-PNP, GDP-PNP,
UDP-
PNP, CDP-PNP, TDP-PNP, AMP-PNP, GMP-PNP, UMP-PNP, CMP-PNP, and TMP-PNP In
preferred embodiments, ADPyS is excluded.
Also another embodiment, the Rad51 inhibitor is a DNA minor groove binding
drug. In a preferred
embodiment, the Rad51 inhibitor is selected from the group consisting of
distamycin, netropsin, bis-
benzimidazole and actinomycin.
In yet another embodiment, the Rad51 inhibitor is a peptide. By "peptide"
herein is meant at least two
covalently attached amino acids, which includes proteins, polypeptides,
oligopeptides and peptides.
The protein may be made up of naturally occurring amino acids and peptide
bonds, or synthetic
peptidomimetic structures. Thus "amino acid", or "peptide residue", as used
herein means both
naturally occurring and synthetic amino acids. For example, homo-
phenylalanine, citrulline and
noreleucine are considered amino acids for the purposes of the invention.
"Amino acid" also includes
imino acid residues such as proline and hydroxyproline. The side chains may be
in either the (R) or
the (S) configuration. In the preferred embodiment, the amino acids are in the
(S) or L-configuration.
If non-naturally occurring side chains are used, non-amino acid substituents
may be used, for example
to prevent or retard in vivo degradations.
-14-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
The peptides can be naturally occurring or fragments of naturally occuring
proteins. Thus, for
example, cellular extracts containing proteins, or random or directed digests
of proteinaceous cellular
extracts, may be used. Thus, procaryotic and eukaryotic proteins can be Rad51
inhibitors. Rad51
inhibitors may also be peptides from bacterial, fungal, viral, and mammalian
sources, with the latter
being preferred, and human proteins being especially preferred.
In a preferred embodiment, the Rad51 inhibitors are peptides of from about 5
to about 30 amino
acids, with from about 5 to about 20 amino acids being preferred, and from
about 7 to about 15 being
particularly preferred. The peptides may be digests of naturally occuring
proteins as is outlined above,
random peptides, or "biased" random peptides. By "randomized" or grammatical
equivalents herein is
meant that each nucleic acid and peptide consists of essentially random
nucleotides and amino acids,
respectively. Since generally these random peptides (or nucleic acids,
discussed below) are
chemically synthesized, they may incorporate any nucleotide or amino acid at
any position. The
synthetic process can be designed to generate randomized proteins or nucleic
acids, to allow the
formation of all or most of the possible combinations over the length of the
sequence.
Preferred peptides include p53 and Rad51 antibodies and include but are not
limited to amino acids
94-160 and 264-315 of p53 and fragments of Rad51 antibodies.
In a preferred embodiment, the Rad51 inhibitors are nucleic acids. By "nucleic
acid" or
"oligonucleotide" or grammatical equivalents herein means at least two
nucleotides covalently linked
together. A nucleic acid of the present invention will generally contain
phosphodiester bonds, although
in some cases, as outlined below, nucleic acid analogs are included that may
have alternate
backbones, comprising, for example, phosphoramide (Beaucage et al.,
Tetrahedron 49(10):1925
(1993)) and references therein; Letsinger, J. Org. Chem. 35:3800 (1970);
Sprinzl et al., Eur. J.
Biochem. 81:579 (1977); Letsinger et al., Nucl. Acids Res. 14:3487 (1986);
Sawai et al, Chem. Lett.
805 (1984), Letsinger et al., J. Am. Chem. Soc. 110:4470 (1988); and Pauwels
et al., Chemica Scripts
26:141 91986)), phosphorothioate (Mag et al., Nucleic Acids Res. 19:1437
(1991); and U.S. Patent
No. 5,644,048), phosphorodithioate (Briu et al., J. Am. Chem. Soc. 111:2321
(1989)), O-
methylphophoroamidite linkages (see Eckstein, oligonucleotides and Analogues:
A Practical
Approach, Oxford University Press), and peptide nucleic acid backbones and
linkages (see Egholm, J.
Am. Chem. Soc. 114:1895 (1992); Meier et al., Chem. Int. Ed. Engl. 31:1008
(1992); Nielsen, Nature
365:566 (1993); Carlsson et al., Nature 380:207 (1996)), all of which are
incorporated by reference).
Other analog nucleic acids include those with positive backbones (Denpcy et
al., Proc. Natl. Acad. Sci.
USA 92:6097 (1995); non-ionic backbones (U.S. Patent Nos. 5,386,023,
5,637,684, 5,602,240,
-15-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
5,216,141 and 4,469,863; Kiedrowshi et al., Angew. Chem. Intl. Ed. English
30:423 (1991); Letsinger
et al., J. Am. Chem. Soc. 110:4470 (1988); Letsinger et al., Nucleoside &
Nucleotide 13:1597 (1994);
Chapters 2 and 3, ASC Symposium Series 580, "Carbohydrate Modifications in
Antisense Research",
Ed. Y.S. Sanghui and P. Dan Cook; Mesmaeker et al., Bioorganic & Medicinal
Chem. Lett. 4:395
(1994); Jeffs et al., J. Biomolecular NMR 34:17 (1994); Tetrahedron Lett.
37:743 (1996)) and non-
ribose backbones, including those described in U.S. Patent Nos. 5,235,033 and
5,034,506, and
Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in
Antisense Research",
Ed. Y.S. Sanghui and P. Dan Cook. Nucleic acids containing one or more
carbocyclic sugars are also
included within the definition of nucleic acids (see Jenkins et al., Chem.
Soc. Rev. pp169-176
(1995)). Several nucleic acid analogs are described in Rawls, C & E News p. 35
(June 2, 1997). All of
these references are hereby expressly incorporated by reference. These
modifications of the ribose-
phosphate backbone may be done to facilitate the addition of additional
moieties such as labels, or to
increase the stability and half-life of such molecules in physiological
environments. In addition,
mixtures of naturally occurring nucleic acids and analogs including PNA can be
made. Alternatively,
mixtures of different nucleic acid analogs, and mixtures of naturally occuring
nucleic acids and analogs
may be made. The nucleic acids may be single stranded or double stranded, as
specified, or contain
portions of both double stranded or single stranded sequence. The nucleic acid
may be DNA, both
genomic and cDNA, RNA or a hybrid, where the nucleic acid contains any
combination of deoxyribo-
and ribo-nucleotides, and any combination of bases, including uracil, adenine,
thymine, cytosine,
guanine, inosine, xathanine hypoxathanine, isocytosine, isoguanine, etc.
In one aspect it is understood that Rad51 inhibitors may bind to Rad51, but
exclude agents which
generally activate Rad51 such as DNA on which Rad51 normally binds to in the
process of
recombinational activity, DNA repair, -etc.
As generally for proteins, nucleic acid Rad51 inhibitors may be naturally
occurring nucleic acids,
random nucleic acids, or "biased" random nucleic acids. For example, digests
of procaryotic or
eucaryotic genomes may be used as is outlined above for proteins.
Rad51 inhibitors are obtained from a wide variety of sources, as will be
appreciated by those in the art,
including libraries of synthetic or natural compounds. Any number of
techniques are available for the
random and directed synthesis of a wide variety of organic compounds and
biomolecules, including
expression of randomized oligonucleotides. Alternatively, libraries of natural
compounds in the form of
bacterial, fungal, plant and animal extracts are available or readily
produced. Additionally, natural or
synthetically produced libraries and compounds are readily modified through
conventional chemical,
-16-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
physical and biochemical means. Known pharmacological agents may be subjected
to directed or
random chemical modifications to produce structural analogs.
In a preferred embodiment, the methods include both in vitro and in vivo
applications, preferably in
vivo. Accordingly, in a preferred embodiment, the methods comprise the steps
of administering a
Rad51 inhibitor to a sample comprising Rad51 under physiological conditions,
preferably to a cell.
The cell that the Rad51 inhibitor is administered to may be a variety of
cells. Preferably the cell is
mammalian, and preferably human. The cell may be any cell in a site in need of
Rad51 inhibition such
as diseased cells including cancerous cells and cells infected with viruses
such as HIV as further
discussed below.
Administration may occur in a number of ways. The addition of the Rad51
inhibitor to a cell will be
done as is known in the art for other inhibitors, and may include the use of
nuclear localization signal
(NLS). NLSs are generally short, positively charged (basic) domains that serve
to direct the entire
protein in which they occur to the cell's nucleus. Numerous NLS amino acid
sequences have been
reported including single basic NLS's such as that of the SV40 (monkey virus)
large T Antigen (Pro
Lys Lys Lys Arg Lys Val), Kalderon (1984), et al., Cell 39:499-509; the human
retinoic acid receptor-f3
nuclear localization signal (ARRRRP); NFtcB p50 (EEVQRKRQKL; Ghosh et al.,
Cell 62:1019 (1990);
NFKB p65 (EEKRKRTYE; Nolan et al., Cell 64:961 (1991 )); and others (see for
example Boulikas, J.
Cell. Biochem. 55(1):32-58 (1994)), hereby incorporated by reference) and
double basic NLS's
exemplified by that of the Xenopus (African clawed toad) protein,
nucleoplasmin (Ala Val Lys Arg Pro
Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Leu Asp), Dingwall, et
al., Cell 30:449-458, 1982
and Dingwall, et al., J. Cell Biol., 107:641-849; 1988). Numerous localization
studies have
demonstrated that NLSs incorporated in synthetic peptides or grafted onto
reporter proteins or other
molecules not normally targeted to the cell nucleus cause these molecules to
be concentrated in the
nucleus. See, for example, Dingwall, and Laskey, Ann, Rev. Cell Biol. 2:367-
390, 1986; Bonnerot, et
al., Proc. Natl. Acad. Sci. USA 84:6795-6799, 1987; Galileo, et al., Proc.
Nat!. Acad. Sci. USA 87:458-
462, 1990.
There are a variety of techniques available for introducing a Rad51 inhibitor
into cells. The techniques
vary depending upon whether the inhibitor is transferred into cultured cells
in vitro, or in vivo in the
cells of the intended host. Techniques suitable for the transfer of inhibitors
into mammalian cells in
vitro include the use of liposomes, electroporation, microinjection, cell
fusion, DEAE-dextran, the
calcium phosphate precipitation method, etc. The currently preferred in vivo
transfer techniques
-17-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
include transfection with viral (typically retroviral) vectors and viral coat
protein-liposome mediated
transfection (Dzau et al., Trends in Biotechnology 11:205-210 (1993)). Special
or other liposomes,
modified electroporation, chemical treatment or Piezo injection techniques are
particularly preferred.
The inhibitory agents may be administered in a variety of ways, orally,
systemically, topically,
parenterally e.g., subcutaneously, intraperitoneally, intravascularly, etc. In
one embodiment, the
inhibitors are applied to the site of a tumor (or a removed tumor) intra-
operatively during surgery.
Depending upon the manner of introduction, the compounds may be formulated in
a variety of ways.
The concentration of therapeutically active compound in the formulation may
vary from about 0.1-100
wt.%. Generally, a therapeutic amount for the need is used, for example, to
achieve inhibition of
cellular proliferation, radiation or chemotherapeutic sensitization or
inducing apoptosis.
The Rad51 inhibitory molecules can be combined in admixture with a
pharmaceutically or
physiologically acceptable carrier vehicle. Therapeutic formulations are
prepared for storage by mixing
the active ingredient having the desired degree of purity with optional
physiologically acceptable
carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th
edition, Osol, A. Ed.
(1980)), in the form of lyophilized formulations or aqueous solutions.
Acceptable carriers, excipients or
stabilizers are nontoxic to recipients at the dosages and concentrations
employed, and include buffers
such as phosphate, citrate and other organic acids; antioxidants including
ascorbic acid; low molecular
weight (less than about 10 residues) polypeptides; proteins, such as serum
albumin, gelatin or
immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone, amino
acids such as glycine,
glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides and
other carbohydrates
including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar
alcohols such as
mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic
surfactants such as
Tween, Pluronics or PEG.
The pharmaceutical compositions can be prepared in various forms, such as
granules, aerosols,
tablets, pills, suppositories, capsules, suspensions, salves, lotions and the
like. Pharmaceutical grade
organic or inorganic carriers and/or diluents suitable for oral and topical
use can be used to make up
compositions containing the therapeutically-active compounds. Diluents known
to the art include
aqueous media, vegetable and animal oils and fats. Stabilizing agents, wetting
and emulsifying
agents, salts for varying the osmotic pressure or buffers for securing an
adequate pH value, and skin
penetration enhancers can be used as auxiliary agents.
-18-
CA 02379608 2002-02-07
WO 01/11369 PCT/iJS00/22077
In some situations it is desirable to provide the inhibitor with an agent that
targets the target cells, such
as an antibody specific for a cell surface membrane protein or the target
cell, a ligand for a receptor on
the target cell, etc. Where liposomes are employed, proteins which bind to a
cell surface membrane
protein associated with endocytosis may be used for targeting andlor to
facilitate uptake, e.g. capsid
proteins or fragments thereof tropic for a particular cell type, antibodies
for proteins which undergo
internalization in cycling, proteins that target intracellular localization
and enhance intracellular half-life.
The technique of receptor-mediated endocytosis is described, for example, by
Wu et al., J. Biol.
Chem. 262:4429-4432 (1987); and Wagner et al., Proc. Natl. Acad. Sci. USA
87:3410-3414 (1990).
Dosages and desired drug concentrations of pharmaceutical compositions of the
present invention
may vary depending on the particular use envisioned. The determination of the
appropriate dosage or
route of administration is well within the skill of an ordinary physician.
Animal experiments provide
reliable guidance for the determination of effective doses for human therapy.
Interspecies scaling of
effective doses can be performed following the principles laid down by
Mordenti, J. and Chappell, W.
"The use of interspecies scaling in toxicokinetics" In Toxicokinetics and New
Drug Development,
Yacobi et al., Eds., Pergamon Press, New York pp. 42-96 (1989).
In a preferred embodiment, the methods comprise identifying the inhibitory
effect of the Rad51
inhibitor. For example, determining the effect on double strand break repair,
homologous
recombination, sensitivity to ionizing radiation, class switch recombination,
cellular inhibition, induction
of apoptosis, etc. Assays are detailed in Park, J. Biol. Chem. 270(26):15467
(1995) and Li et al.,
PNAS USA 93:10222 (1996), Shinohara et al., supra, (1992), all of which are
hereby incorporated by
reference. Further assays are discussed below in the examples.
In an embodiment provided herein, the invention provides methods of treating
disease states requiring
inhibition of cellular proliferation. In a preferred embodiment, the disease
state requires inhibition of at
least one of Rad51 expression, translation or the biological activity of Rad51
as described herein. As
will be appreciated by those in the art, a disease state means either that an
individual has the disease,
or is at risk to develop the disease.
Disease states which can be treated by the methods and compositions provided
herein include, but
are not limited to hyperproliferative disorders. More particular, the methods
can be used to treat, but
are not limited to treating, cancer (further discussed below), premature
aging, autoimmune disease,
arthritis, graft rejection, inflammatory bowel disease, proliferation induced
after medical procedures,
including, but not limited to, surgery, angioplasty, and the like. Thus, in
one embodiment, the invention
-19-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
herein includes application to cells or individuals afflicted or impending
affliction with any one of these
disorders.
The compositions and methods provided herein are particularly deemed useful
for the treatment of
cancer including solid tumors such as skin, breast, brain, cervical
carcinomas, pancreas, testicular
carcinomas, etc. More particularly, cancers that may be treated by the
compositions and methods of
the invention include, but are not limited to: Cardiac: sarcoma (angiosarcoma,
fibrosarcoma,
rhabdomyosarcoma; liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and
teratoma; Lun4:
bronchogenic carcinoma (squamous cell, undifferentiated small cell,
undifferentiated large cell,
adenocarcinoma), alveolar (bronchiolar) carcinoma, bronchial adenoma, sarcoma,
lymphoma,
chondromatous hamartoma, mesothelioma; Gastrointestinal: esophagus (squamous
cell carcinoma,
adenocarcinoma, leiomyosarcoma, lymphoma), stomach (carcinoma, lymphoma,
leiomyosarcoma),
pancreas (ductal adenocarcinoma, insulinoma, glucagonoma, gastrinoma,
carcinoid tumors, vipoma),
small bowel (adenocarcinoma, lymphoma, carcinoid tumors, Karposi's sarcoma,
leiomyoma,
hemangioma, lipoma, neurofibroma, fibroma), large bowel (adenocarcinoma,
tubular adenoma, villous
adenoma, hamartoma, leiomyoma); Genitourinary tract: kidney (adenocarcinoma,
Wilm's tumor
[nephroblastoma], lymphoma, leukemia), bladder and urethra (squamous cell
carcinoma, transitional
cell carcinoma, adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis
(seminoma, teratoma,
embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, interstitial
cell carcinoma, fibroma,
fibroadenoma, adenomatoid tumors, lipoma); Liver: hepatoma (hepatocellular
carcinoma),
cholangiocarcinoma, hepatoblastom, angiosarcoma, hepatocellular adenoma,
hemangioma; Bone:
osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrous
histiocytoma, chondrosarcoma,
Ewing's sarcoma, malignant lymphoma (reticulum cell sarcoma), multiple
myeloma, malignant giant
cell tumor chordoma, osteochronfroma (osteocartilaginous exostoses), benign
chondroma,
chondroblastoma, chondromyxofibroma, osteoid osteoma and giant cell tumors;
Nervous system:
skull (osteoma, hemangioma, granuloma, xanthoma, osteitis deformans), meninges
(meningioma,
meningiosarcoma, gliomatosis), brain (astrocytoma, medulloblastoma, glioma,
ependymoma,
germinoma [pinealoma], glioblastoma multiform, oligodendroglioma, schwannoma,
retinoblastoma,
congenital tumors), spinal cord neurofibroma, meningioma, glioma, sarcoma);
Gynecological: uterus
(endometrial carcinoma), cervix (cervical carcinoma, pre-tumor cervical
dysplasia), ovaries (ovarian
carcinoma [serous cystadenocarcinoma, mucinous cystadenocarcinoma,
unclassified carcinoma],
granulosa-thecal cell tumors, Sertoli-Leydig cell tumors, dysgerminoma,
malignant teratoma), vulva
(squamous cell carcinoma, intraepithelial carcinoma, adenocarcinoma,
fibrosarcoma, melanoma),
vagina (clear cell carcinoma, squamous cell carcinoma, botryoid sarcoma
[embryonal
rhabdomyosarcoma], fallopian tubes (carcinoma); Hematologic: blood (myeloid
leukemia [acute and
-20-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
chronic], acute lymphoblastic leukemia, chronic lymphocytic leukemia,
myeloproliferative diseases,
multiple myeloma, myelodysplastic syndrome), Hodgkin's disease, non-Hodgkin's
lymphoma
[malignant lymphoma]; Skin: malignant melanoma, basal cell carcinoma, squamous
cell carcinoma,
Karposi's sarcoma, moles dysplastic nevi, lipoma, angioma, dermatofibroma,
keloids, psoriasis; and
Adrenal 4lands: neuroblastoma. Thus, the term "cancerous cell" as provided
herein, includes a cell
afflicted by any one of the above identified conditions.
The individual, or patient, is generally a human subject, although as will be
appreciated by those in the
art, the patient may be animal as well. Thus other animals, including mammals
such as rodents
(including mice, rats, hamsters and guinea pigs), cats, dogs, rabbits, farm
animals including cows,
horses, goats, sheep, pigs, etc., and primates (including monkeys,
chimpanzees, orangutans and
gorillas) are included within the definition of patient. In a preferred
embodiment, the individual requires
inhibition of cell proliferation. More preferably, the individual has cancer
or a hyperproliferative cell
condition.
IS
The compositions provided herein may be administered in a physiologically
acceptable carrier to a
host, as previously described. Preferred methods of administration include
systemic or direct
administration to a tumor cavity or cerebrospinal fluid (CSF).
In one aspect, the Rad51 inhibitors herein induce sensitivity to alkylating
agents, DNA cross-linkers,
intra and inter strand, cisplatin and related compounds and radiation. Induced
sensitivity (also called
sensitization or hypersensitivity) is measured by the cells tolerance to
radiation or alkylating agents.
For example, sensitivity, which is measured, i.e., by toxicity, occurs if it
is increased by at least 20%,
more preferably at least 40%, more preferably at least 60%, more preferably at
least 80%, and most
preferably by 100% to 200% or more.
In an embodiment herein, the methods comprising administering the Rad51
inhibitors provided herein
further comprise administering an alkylating agent or radiation. For the
purposes of the present
application the term ionizing radiation shall mean all forms of radiation,
including but not limited to
alpha, beta and gamma radiation and ultra violet light, which are capable of
directly or indirectly
damaging the genetic material of a cell or virus. The term irradiation shall
mean the exposure of a
sample of interest to ionizing radiation, and term radiosensitive shall refer
to cells or individuals which
display unusual adverse consequences after receiving moderate, or medically
acceptable (i.e.,
nonlethal diagnostic or therapeutic doses), exposure to ionizing irradiation.
Alkylating agents include
-21 -
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
BCNU and CCNU. Additionally, radiation sensitizers (e.g., xanthine and
xanthine derivatives including
caffeine) can be applied with, before or after the Rad51 inhibitors.
In one embodiment herein, the Rad51 inhibitors provided herein are
administered to prolong the
survival time of an individual suffering from a disease state requiring the
inhibition of the proliferation of
cells. In a preferred embodiment, the individual is further administered
radiation or an alkylating agent.
In yet another aspect of the invention, a fragment of Rad51 is provided
wherein said fragment consists
essentially of a binding site for a small molecule, wherein said small
molecule regulates the biological
or biochemical activity of Rad51. Preferably, the regulation is inhibitory. In
one embodiment, the
binding site is the binding site for p53.
Generally, the binding site is identified by combining the inhibitor with
fragments of Rad51. In one
embodiment, the fragments are from between amino acids 125 and 220. In one
embodiment, Rad51
125-220 is fragmented to fragments of 5-25 amino acids and then tested
separately or in random
recombinations to determine the binding site by standard binding techniques.
The following examples serve to more fully describe the manner of using the
above-described
invention, as well as to set forth the best modes contemplated for carrying
out various aspects of the
invention. It is understood that these examples in no way serve to limit the
true scope of this invention,
but rather are presented for illustrative purposes. All references cited
herein are incorporated by
reference.
EXAMPLES
EXAMPLE 1: RAD51 IS OVEREXPRESSED IN HUMAN PANCREATIC ADENOCARCINOMA.
Herein we analyze expression levels of human Rad51 protein in tumor cells
cultured as spheroids
compared to monolayers. In fact, 3D-growth of human pancreatic cancer cell
lines is accompanied by
nuclear cultures of the same cell lines. Similar accumulation of Rad51 is
induced after orthotopic
transplantation of human pancreatic cancer cells into SCID mice. The clinical
significance of these
observations with respect to the malignant phenotype of pancreatic cancer is
underlined by our finding
that wild-type Rad51 also accumulates to high levels in human pancreatic
cancer in situ. Functional
analysis revealed that the 5'-regulatory region of the rad59 gene is comprised
of TATA-less, GC-rich
-22-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
elements known from housekeeping genes and that Rad51 over-expression enhances
survival of cells
after induction of DNA double strand breaks.
Materials and Methods
Cell culture
Human pancreatic cancer cell lines 818-4, Colo-357, SW-850, QUIP-1, BXPC-3,
Capan-1, HPAF,
PancTU-II, PT 45-P1, Panc 89 (Kalthoff, H., et al., Oncogene 8:289-298 (1993))
as well as UiRad51
and UiLacZ cells were maintained in a humidified incubator at 37°C in
an atmosphere of 5% carbon
dioxide, 95% air in DMEM supplemented with 10% fetal calf serum (PAA, Colbe,
Germany).
Hybridoma cell line 1G8 was grown as described previously (Buchhop, S., et
al., Hybridoma 15:205-
210 (1996). Production of antibody was performed using a miniPERM Bioreactor
(Heraeus, Osterode,
Germany) according to the recommendations of the supplier. The ecdysone
analogues muristerone A
and ponasterone A, respectively (Invitrogen), were dissolved at ImM in
absolute ethanol and used at a
final concentration of 1 NM to induce expression of ectopic Rad51 (UiRad51) or
(3-galactosidase
(UiLacZ). Non-induced controls were supplemented with the same amount of
ethanol. For UV
treatment, media were removed and cells irradiated for 1 second on a TFL-20M
transilluminator
(Biometra, Gottingen, Germany) equipped with 312nm bulbs. According to
biological calibration, this
corresponds to approximately 270J/m2. Cells were then grown in fresh medium,
as were non-
irradiated controls. Calicheamicin y, (Wyeth-Ayers" research, Pearl River, NY,
USA) was dissolved in
absolute ethanol at 100 NM and stored at -80°C. For determination of
chemosensitivity, cells were
treated with increasing concentrations of calicheamicin y1 for 16h, allowed to
recover for 72h at 37°C
under standard conditions and stained with crystal violet.
Antibodies
Hybridoma cell line 1G8 was isolated as described previously (Buchhop, S., et
al., Hybridoma 15:205-
210 (1996)). Monoclonal antibody 1G8 specifically recognizes Rad51 protein.
Prof. J. Gerdes,
Forschungszentrum Borstel, Germany kindly provided the monoclonal antibody MIB-
1 directed against
the proliferation marker protein KI-67. Monoclonal anti p53 antibodies PAb1801
and DO-1 were
supplied by Dianova, Hamburg, Germany. Roche Biochemicals, Mannheim, Germany,
supplied the
polyclonal sheep anti p53 serum. HRP-conjugated goat anti-mouse IgG (Amersham
Buchler KG,
Braunschweig, Germany) and HRP-conjugated donkey anti-sheep IgG (Sigma-Aldrich
Chemie,
Steinheim, Germany) were used as second antibody.
-23-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
Immunohistochemistry
For immunohistochemical staining, tissue from 41 surgical resection specimens
(38 Whipple
specimens and 3 left pancreatectomies) from patients with ductal
adenocarcinoma of the pancreas
were classified according to the criteria of the WHO (Kloppel, G., et al.,
Histological typing of tumours
of the exocrine pancreas. Second edition. WHO International histological
classification of tumours,
Springer Verlag, Berlin ( 1996)). The mean age of the patients was 59.7 years
(45-75). The tumor
stages were pT2 (n=6), pT3 (n=29) and pT4 (n=6). Histologically, 6 cases were
grade 1, 24 grade 2
and 11 grade 3. Specimens were fixed in neutral buffered formalin (4%) and
subsequently embedded
in paraffin. Consecutive 5pm thick sections were placed on slide glasses,
dewaxed in xylene, passed
through alcohol and washed in phosphate buffered saline (PBS). As antigen
retrieval treatment the
sections were immersed in citrate buffer (100 mM Na-citrate, pH 7.2) and
boiled for 3 minutes under
pressure in a pressure cooker. Following this treatment, endogenous peroxidase
activity was blocked
by incubation in 0.3% hydrogen peroxide in PBS for 10 min. Sections were
incubated with the different
antibodies for Ih at room temperature in a wet chamber. After washing in PBS,
a biotinylated anti
mouse antibody (Vector Laboratories Inc., Burlingame, USA) was added for 30
min at room
temperature. After washing in PBS, sections were incubated with ABC complexes
(Vector
Laboratories Inc.) and subsequently stained using DAB (Diaminobenzidine
tetrahydrochloride, Vector
Laboratories Inc.) as substrate for peroxidase. Counter-staining was performed
using Mayers
hemalum (Merck, Darmstadt, Germany).
Western blot analysis
Cultured cells were washed with ice-cold PBS. Subsequently, cellular proteins
were extracted in SDS
lysis buffer (25mM Tris-HCI (pH 6.5), 1 % SDS, 5% ~3-mercaptoethanol, 0.1 %
Bromophenol blue, 5%
glycerol). Following sonification and boiling, equal amounts of total protein
(determined by BCA
protein assay, Pierce, Rockford, USA) were loaded onto an 11.5% SDS-
polyacrylamide gel. After
transfer to PVDF membrane (Biorad, Munich, Germany), relevant proteins were
detected using the
antibodies described above. The Super Signal Substrate system (Pierce,
Rockford, USA) was used
for chemiluminescence detection.
NIRC-assay
Non-isotopic RNASE cleavage assay was performed following the manufacturer's
guidelines provided
with the Mismatch Detection Kit II (Ambion, Texas, USA). Briefly, total cell
RNA was prepared from
cultured cells using the RNeasy kit supplied by Quiagen (Hilden, Germany).
Reverse Transcription
-24-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
and PCR was performed in a one-tube reaction (Life Technologies, Karlsruhe,
Germany), using the
"outer primer pairs" for the PCR reaction described below. Subsequently, an
aliquot of this reaction
was subjected to a nested PCR using the primers listed, which include the SP6
or T7 promoter
sequence. PCR products were transcribed in vitro with T7 or SP6 RNA polymerase
to produce sense
and antisense RNA probes, respectively. Sense RNA products were hybridized
with antisense from
wild-type control and vice versa. The hybridized samples were treated in three
different reactions with
the RNases provided with the kit. The cleaved products were analyzed on
ethidium bromide-stained
agarose gels (2%) using the Fluor-S imaging system (Biorad, Munich, Germany).
For Rad51 mutation analysis, the following primers were used for the
amplification of nucleotides 1 to
1020 of the Rad51 coding region:
outer 5'-primer: ATGGCAATGCAGATGCAGCTTGAAGC,
3'-primer: TCAAGTCTTTGGCATCTCCCACTCC;
for nested PCR: 5'-primer:
GATAATACGACTCACTATAGGGAAGAAGAAAGCTTTG. 3'-primer:
TCATTTAGGTGACACTATAGGAAGACAGGGAGAGTC.
To amplify the region from -232 to 1289 the following primers were used:
outer 5'-primer: CCGCGCGCAGCGGCCAGAGACCG,
3'-primer: GTCAAAGATACTTCATACCCCTCC;
for nested PCR of nucleotides -190 to 703:
5'-primer: GATAATACGACTCACTATAGGGCGCTTCCCGAGGC:
3'-primer: TCATTTAGGTGACACTATAGGACCCGAGTAGTCTGTTC;
30
for nested PCR of 346 to 1123:
5'-primer: GATAATACGACTCACTATAGGGAATTGAGACTGGAT
3'-primer: TCATTTAGGTGACACTATAGGAATAAACATTTTAGATC.
Rad5 sequences are underlined.
Isolation and characterization of a genomic rad51 clone
A human genomic PAC library (RPC11,3-5 Human PAC Library No.: 704, Pieter
de Jong, Rosewell Park Cancer Institute) was kindly provided by Resource
Center/Primary Database
of the German Human Genome Project, Berlin, Germany. This library was screened
with a random
-25-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
labeled PCR fragment amplified from human genomic DNA by using the rad51
specific primers 5'-
ATGGCAATGCAGATGCAGCTTGAAGC-3' and
5'-TGGCTTCACTAATTCCCTTA-3'. PAC clone RPCIP704124767 was identified to contain
rad51
sequences. The isolated clone was fragmented with restriction enzymes Pstl,
Hindlll and
EcoRI/EcoRV and subcloned into the pBluescript SK vector (Stratagene,
Amsterdam, Netherlands).
Clones positive for the target gene fragments were lifted using a Hybond-C
Nitro-cellulose membrane
(Amersham Pharmacia Biotech, Freiburg, Germany) and identified by means of
hybridization with
oligonucleotides spanning the human rad51 cDNA sequence (DDBI accession no.
D14134;
Yoshimura, Y., et al., Nucl. Acids. Res. 21:1665 (1993)). DNA from positive
subclones was extracted
using the Qiagen DNA purification Kit (Qiagen, Hilden, Germany) and sequenced
on a MWG
automated sequencer (LI-COR LI-4200 system, MWG AG Biotech, Munich ,Germany).
The putative
promoter and potential transcription factor binding sites upstream of exon 1
were analyzed using the
program Promoter Scan II (Prestridge, 1995). Determination of intron-exon
junctions was performed
by Splice Site Prediction by Neural Network (NNSPLICE0.9; Reese, M.G., et al.,
J. Comp. Biol. 4:311-
323 (1997)).
Results:
Accumulation of Rad51 protein in human pancreatic cancer cell lines cultured
as spheroids
During cell cycle progression only minor variations in Rad51 protein level
occur (Yamamoto, A., et al.,
Mol. Gene. Genet. 251:1-12 (1996); Chen, F., et al., Mutat. Res. 384:205-211
(1997)). Immortalization
of human fibroblasts is accompanied by a three- to four-fold increase in Rad51
mRNA expression
levels (Xia, S.J., et al., Mol. Cell Biol. 17:7151-7158 (1997)). There is,
however, no description of the
Rad51 protein levels in different human tumor cell lines derived from a single
tumor entity. Therefore,
we first compared the amount of Rad51 protein in a panel of well-characterized
human pancreatic
cancer cell lines (818-4, Colo-357, SW-850, QCP-1, BXPC-3, Capan-1, HPAF, Panc-
TU-I, Panc TU-II,
PT 45-P1, Panc 89; (Kalthoff, H., et al., Oncogene 8:289-298 (1993)) by
immunocytochemistry and
Western blotting. Figure 1 shows representative examples of staining intensity
and subcellular
localization of Rad51 protein and by way of comparison of p53 in 818-4 and
BXPC3 cells. Both cell
lines exhibited weak nuclear staining for Rad51 polypeptide similar to the
signal intensity for p53 in
818-4 cells. By contrast, a very strong signal for over-expressed mutant p53
was found in BXPC-3
cells. Examination at low order magnification revealed only minor variat+ons
in staining intensities for
both polypeptides between individual cells of a given cell line. To
established that the differences in
staining intensity reflect quantitative differences in Rad51 and p53 content,
protein levels were
determined by Western blotting (Figure 1 B). In these experiments, 50 Ng of
total protein extract was
-26-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
loaded in each lane. The amount of mutant p53 in BXPC-3 of total protein
extract was loaded in each
lane. The amount of mutant p53 in BXPC-3 cells is increased at least by a
factor of 10 compared to
p53 in 818-4. No such difference between the two cell lines was observed for
Rad5l. Staining
intensities observed by immunocytochemistry correlate with the amount of Rad51
and p53 protein in
the cells. In addition, we did not find gross variations for Rad51 between all
cell lines tested (data not
shown). These results demonstrate that pancreatic cancer cell lines display a
very low level of Rad51
protein, hardly detectable by immunocytochemical methods and comparable to the
amount of wild-
type p53 in these cells.
In order to test, whether 3D growth might affect expression of Rad51, 818-4
and PancTU1 cells were
grown as spheroids. Figure 2A demonstrates that Rad51 accumulates to much
higher levels in a sub-
population of tumor cell nuclei compared to monolayer cultures. The proportion
of cells over-
expressing Rad51 varies between cell lines with about 5-10 percent of cells
for PancTU-I and more
than 30 percent for 818-4. There is no apparent correlation between Rad51 over-
expression and the
genetic status of p53 in the respective cell lines (data not shown). Western
blot analysis of Rad51 in
PancTU-I and 818-4 cells grown as monolayers or as spheroids confirmed the
immunocytochemical
data (Figure 2B). In contrast to Rad51, expression of p53 was not affected by
cell culture conditions
(data not shown). Quantification of the Western blot reveals about a five-fold
difference for Rad51
between monolayer and spheroid. Given that Rad51 is over-expressed only in 20
percent of 818-4
cells, this argues that the level of Rad51 in over-expressing spheroid cells
is increased 25-fold
compared to monolayers.
Accumulation of Rad51 in PancTU-I cells after orthotopic transplantation into
SCID mice
To further elucidate the biological significance of these findings and to
test, whether the observed
accumulation of Rad51 in spheroids might also occur under in vivo conditions,
Rad51 expression was
analyzed in an orthotopic xeno-transplantation model. 106 PancTU-I cells were
inoculated into the
pancreas in SCID mice. Mice were sacrificed on day 21 after inoculation.
PancTU-I tumors were
fixed, paraffin embedded, and prepared for immunohistochemistry. To rule out
that paraffin
embedding would affect the outcome of the experiment, PancTU-I cells grown as
monolayer were
harvested by centrifugation after scraping and processed under identical
technical conditions
concerning fixation, paraffin embedding, and histochemical analysis. High-
level Rad51 protein
expression was detected only in PancTU-I tumors (Figure 3, panel B) but not in
cells grown as
monolayer (Figure 3, panel A). These data show that high-level expression of
Rad51 represent a
unique feature of tumor cells grown as 3-dimensional network in vitro as well
as in vivo.
-27-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
Over-expression of wild-type Rad51 protein in specimens of human pancreatic
adenocharcinoma
To further substantiate these findings, Rad51 expression was investigated in
paraffin embedded
specimens of human pancreatic adenocarcinoma. As shown in Figure 3, panel C,
Rad51 protein
accumulates to high levels in tumor cell nuclei. Rad51 over-expression is
restricted to tumor cells and
not found in nuclei of surrounding tissue. Under identical staining
conditions, nuclear antigens like Ki-
67 and p53 were also easily detectable in the tumor cell population. There was
apparent correlation
between Rad51 and p53 expression in tumor specimens (data not shown). Intense
staining was
highly specific for Rad51 protein, since pre-incubation of the anti Rad51
monoclonal 1 G8 with a
peptide corresponding to the epitope recognized by the antibody (Buchhop, S.,
et al., Hybridoma.
15:205-210 (1996)) completely blocked the staining reaction (Figure 4). The
percentage of Rad51
positive tumor cells ranged from 5% to nearly 50% between different specimens.
Tumor specimens
were scored positive when more than 5% of tumor cell nuclei were stained as
intense as in spheroids
1 S or xeno-transplants. According to thee criteria, 27 (66%) out of 41
pancreatic adenocarcinoma
specimens expressed Rad51 protein at high-levels.
Over-expression of Rad51 protein is not a consequence of mutations in the
Rad51 coding
sequence
The panel of 13 pancreatic cancer cell lines used in this study and 12 tumor
specimens were tested
for mutations in the Rad51 coding sequence. The highly sensitive and specific
non-isotopic RNase
cleavage assay (NIRCA) was used for mutation screening. NIRCA detects single
mismatches in
double stranded RNA molecules derived after cross hybridization between wild-
type and mutant
mRNAs by RNASE cleavage. mRNAs are generated by in vitro transcription of
cNDAs amplified by
RT-PCR. Using the commercially available assay system for the screening of
mutations in the p53
coding sequence, the test reliably detected known single point mutations
(Kalthoff, H., et al.,
Oncogene 8:289-298 (1993)) in the human pancreatic cancer cell lines used in
this study. To verify
the functionality of the assay for Rad51 mutation detection, mRNA
corresponding to a Rad51 point
mutant created by in vitro mutagenesis was hybridized with wild-type Rad51
transcripts. The results of
these experiments are shown in Figure 5. No degradation occurs after RNASE
digestion of
hybridized sense and anti-sense wild-type Rad51 mRNA (negative control). Cross
hybridization
befinreen wild-type and mutant Rad51 mRNA on the other hand results in
distinctive and specific
cleavage patterns after RNASE digestion (positive control). These controls
indicate that the assay can
be applied for specific detection of mutations in the Rad51 coding sequence.
Thirteen different
-28-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
pancreatic cancer cell lines and 12 tumor specimens of pancreatic
adenocarcinoma were screened for
Rad51 mutations using NIRCA, but not mutations were found. Based on these
data, we argue that
over-expressed Rad51 protein in spheroids of human pancreatic tumor cells
lines and tumor
specimens represents wild-type Rad51 protein.
Over-expression of Rad51 confers resistance to DNA double strand breaks
In order to create a model system in which the biological consequences of
modulating the Rad51
content in cells can be easily monitored, the human osteosarcoma cell line U-
ZOS was used as
parental cell line to establish clone UiRad51 which inducibly expresses Rad51.
As a control, the
inducibly E. coli ~i-galactosidase producing clone UiLacZ was developed.
Treating these cells with
muristerone A or ponasterone A, analogues of the insect steroid hormone
ecdysone, induces
expression of the respective ectopic proteins (Miska, et al., submitted for
publication). All cell clones
express wild-type p53, which accumulates and becomes activated to induce cell
cycle arrest in
response to DNA damage. This system was used to elucidate the link between
Rad51 over-
expression and the cellular response to DNA double strand breaks. To test
whether over-expression
of Rad51 can affect p53 levels, these were compared in non-induced versus
induced UiRad51 and
UiLacZ cells. Western blot analysis shows that induction of Rad51 or [3-
galactosidase, respectively,
does not have an effect on the level of p53 (Figure 6A). Both UiRad51 and
UiLacZ arrest their cell
cycle in response to UV-irradiation without any evidence of cell death (data
not shown).
Over-expression of Rad51 does not interfere with p53 accumulation in response
to DNA damage by
UV--irradiation (Figure 6A). Without being bound by theory, it is believed
that Rad51 over-expression
does not confer resistance to UV-irradiation because UV-induced DNA damage is
predominantly
corrected via excision repair, it is not surprising that (data not shown). By
contrast, homologous
recombination is one of the mechanisms involved the repair of DNA double
strand breaks (DSBs). In
order to test whether high-level expression of Rad51 might be advantageous for
cell survival, we used
calicheamicin y1, which induces DSBs without any mediators. UiRad51 cells were
treated for 16h with
various concentrations of the drug followed by fixation of the cells after 72h
of recovery. The
differences in cell numbers of non-induced versus induced controls not treated
with calicheamicin y1
(Figure 6B) can be attributed to the fact, that over-expression of Rad51
induces a transient cell cycle
arrest in G, and Gz/M (Miska, et al., submitted for publication). Massive cell
death occurs in response
to increasing concentrations of calicheamicin y1 (Figure 6B). However, over-
expression of Rad51
significantly potentiated the rate of survival compared to cells expressing
basal levels.
The promoter region of human rad51 shows characteristics of a housekeeping
gene
-29-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
Recent evidence suggests that expression of Rad5 1 is regulated at the
transcriptional level (Xia, et
al., Mol. Cell Biol., 17:7151-7158 (1997); Ohnishi, et al., Biochem. Biophys.
Res. Commun. 245:319-
324 (1998)). This prompted us to study the 5 -regulatory region of the human
rad51 gene. An 8.1kb
DNA fragment of the 5'-region of this gene was sequenced (GenBank accession
number: AF203691 ).
The 5'-UTR involves the first exon and a 3.3kb nucleotide sequence encompasses
the first intron.
The translation start codon is located immediately at the beginning of the
second exon. The predicted
regulatory region has been pointed 5.4kb upstream of ATG. Nucleotide sequence
analysis of this
region revealed consensus sequences known to be involved in RNA polymerase II
mediated
transcription. Binding motives for AP-2, Spl, Ets-1 as well as c-Myc were
identified. No TATA-like or
initiator element sequences were found (Figure 7). These data suggest that
human rad51 gene
belongs to the TATA-less GC-rich housekeeping gene family.
Pancreatic adenocarcinoma is regarded a paradigm for a chemo- and
radioresistant tumor entity. In
our survey, we found only weak expression of Rad51 in all pancreatic cancer
cell lines tested, when
they were grown as monolayers. These data confirm previous reports on Rad51
expression in
monolayer cell systems (Yamamoto et al., Oral. Oncol. 34:524-528 (1996); Chen
et al., Mutat. Res.
384:205-211b (1997); Xia et al., Mol. CeII8iol. 17:7151-7158 (1997)).
Different results emerge when
tumor cells were grown as spheroids or as xeno-transplants in SCID mice. Under
these conditions,
Rad51 protein accumulates to high levels in the nuclei of a sub-population of
cells. Moreover, tumor
cells in specimens of human pancreatic adenocarcinoma also showed Rad51 over-
expression. Since
we did not detect any mutations in the coding sequence, we assert that the
over-expressed protein
represents wild-type Rad51. In summary, our data present Rad51 a DNA repair
associated gene
which is over-expressed in human cancer. Furthermore, 3D systems like
spheroids or
xeno-transplants reliably reflect the expression status of Rad51 in human
pancreatic cancer.
Western blot analysis of spheroids confirms an about flue-fold increase
compared to monolayer
culture cell lines. Taking into account that only about 20% of the cells over-
express Rad51, the level in
this sub-population should be elevated by a factor of at least 25.
While cancer cells predominantly express high levels of mutant rather than
wild-type p53,
over-expression of Rad51 protein is not associated with alterations in the
coding region. Up-regulation
of rad51 expression has been reported on the transcriptional level during
immortalization of primary
human fibroblasts (Xia et al., Mol. Cell Biol. 17:7151-7158 (1997). From our
analysis of the 5
-regulatory region, the rad51 gene appears to contain a TATA-less, GC-rich
promoter known from
-30-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
housekeeping genes. Nutritional deficits like shortage of oxygen, common to
inner cell layers of
spheroid cultures are not believed to trigger Rad51 over-expression (data not
shown).
EXAMPLE 2: BREAST CANCER IS ACCOMPANIED BY OVER-EXPRESSION OF RAD51
Here we describe over-expression of wild-type Rad51 protein in tumor specimens
of invasive ductal
mammary carcinoma. Statistical analysis of more than one hundred tumor
specimens revealed that
Rad51 over-expression significantly correlates with tumor grading. These data
qualify Rad51
overexpression as a marker for diagnosis and prognosis of invasive ductal
mammary carcinoma. In
addition to down-regulation of BRCA1 protein in dedifferentiated tumors, over-
expression of Rad51 is
shown to contribute to the pathogenesis of sporadic breast cancers.
Patients, Materials and Methods:
Patients
The study was performed using paraffin-embedded tumor specimens from 107
female patients (mean
age: 58 years) with sporadic invasive ductal breast carcinoma. Tumor size was
26mm on average.
36 cases were assigned to category T1, 44 cases to T2, six cases to T3 and 19
cases to T4 of the
TNM classification. In 48 patients, no axillary lymph node metastases were
detectable, whereas 49
cases were found nodal-positive. T classification of two patients and the
nodal status of ten patients
were unknown. All tumor specimens were reviewed by one pathologist (S.K.)
according to the
grading criteria of Elston and Ellis (Elston, C.W. and Ellis, LO.,
Histopathology 19:403-410 (1991)). 28
carcinomas were graded as G1, 49 as G2 and 30 as G3. For assessment of the
hormonal receptor
status, serial sections of each paraffin-embedded tumor sample were
immunostained using
monoclonal antibodies directed against estrogen receptor (clone 1 D5) and
progesterone receptor
(clone 1A6; DAKO, Hamburg, Germany). An immunoreactive score ranging from 0 to
12 was
calculated according to Remmele and Stegner (Remmele, W. and Stegner, H.E.,
Pathologe 8:138-140
(1987)).
Antibodies
The mouse monoclonal antibody 1G8 specifically recognizing Rad51 protein in
paraffin embedded
tissues was isolated as described previously (Buchhop, S., et al., Hybridoma
15:205-210 (1996);
Maacke et al., submitted for publication)). Monoclonal antibody MIB-1 directed
against the
proliferation marker Ki67-antigen was kindly provided by Prof. J. Gerdes
(Forschungszentrum Borstel,
-31 -
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
Germany). Monoclonal anti p53 antibody DO-1 was supplied by Dianova (Hamburg,
Germany), and
monoclonal antibody AB-1 (MS110 (Wilson, C.A., et al., Nat. Genet. 21:236-240
(1999)) directed
against BRCA1 was purchased from Calbiochem (Schwalbach, Germany).
Immunohistochemistry
Tissue sections were fixed routinely in neutral buffered formalin (4%) and
subsequently embedded in
paraffin. Consecutive 4 Nm thick sections were dewaxed in xylene, passed
through alcohol and
washed in phosphate buffered saline (PBS). In order to improve antigen
retrieval, sections were
immersed in citrate buffer (100 mM Na-citrate, pH 6.0) and boiled for 3
minutes in a pressure cooker.
Endogenous peroxidase activity was blocked by incubation in 3,5% hydrogen
peroxide in PBS for
5min. After permeabilizing the cells with Triton-X 100 for 5min, specimens
were blocked in horse
serum and subsequently with avidin and biotin (Vector Laboratories Inc.,
Burlingame, USA). Sections
were incubated with the different antibodies for Ih at room temperature in a
wet
chamber. After washing in PBS, a biotinylated anti-mouse antibody (Vektor
Laboratories Inc.,
Burlingame, USA) was added for 30 min at room temperature. Sections were then
incubated with
ABC complexes (Vector Laboratories Inc., Burlingame, USA) and stained using
DAB
(Diaminobenzidine tetrahydrochlorid, Vector Laboratories Inc., Burlingame,
USA) as peroxidase
substrate. Specimens were counter-stained using Mayers hemalum (Merck,
Darmstadt, Germany).
For BRCA1 this staining protocol was modified according to Wilson et al.
(Wilson, C.A., et al., Nat.
Genet. 21:236-240 (1999)). The antigen retrieval solution used for this
modified procedure was
purchased from DAKO, (Hamburg, Germany). Antibody incubation was performed
overnight at 4°C.
Image Analysis
Stained specimens were analyzed using an Olympus BX40 microscope (Olympus
Optical CO. GmbH,
Hamburg, Germany). Images were digitized using AnalysisPro 2.10.200 software
(SIS Software
GmbH, Munster, Germany). For Rad51, p53, and Ki67-antigen, the positive
stained cell index (PCI;
10) was quantified using PiClick Image analysis (S. Opitz, unpublished). 1000
representative tumor
cells per slide were analyzed and the PCI was assessed by two observers
independently.
For BRCA1 evacuation a scoring system based on the criteria established by
Wilson et al. (Wilson,
C.A., et al., Nat. Genet. 21:236-240 (1999)) was used. First the area of most
intense staining was
determined at low order magnification. Subsequently, BRCA1 staining intensity
was classified using
the following criteria: (0): no BRCA1 specific staining (blue nuclei due to
Mayer's Hemalum
-32-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
counter-staining); (1 ): more than 10% of tumor cells show weak BRCA1 staining
(grey color); (2):
clear BRCA1 staining with more than 10% of brown tumor cell nuclei; (3):
intense brown staining of
more than 10% of tumor cell nuclei.
Statistical Analysis
SPSS Version 8 software was used for statistical analysis. The association
between Rad51 and
biologic or pathologic parameters was assessed by Spearman's rank correlation
coefficient (r3). To
search for significance different groups were compared globally by H-test
according to Kruskal and
Wallis. Significance in each group of pairs was confirmed using Mann and
Whitney's Utest with
Bonferroni's correction.
NIRC-assay
Non-isotopic RNase cleavage assay was performed following the manufacturer's
guidelines provided
with the Mismatch detection Kit II (Ambion, Texas, USA). Briefly: total cell
RNA was prepared using
the RNeasy kit supplied by Quiagen (Hilden, Germany). Reverse Transcription
and PCR was
performed in a one-tube reaction (GibcoBRL, Karlsruhe, Germany), using the
"outer primer pairs"
described below for PCR. An aliquot of this reaction was subjected to nested
PCR using primers,
which include SP6 or T7 promoter sequences. PCR products were transcribed in
vitro with T7 or SP6
RNA polymerase to produce sense and antisense RNA probes, respectively. Sense
RNA products
were hybridized with antisense from wild-type control and vice versa. The
hybridized samples were
treated in three different reactions with the RNases provided with the kit.
The cleaved products were
analyzed on ethidium bromide-stained agarose gels (2%) using the Fluor-S
imaging system (Biorad,
Munchen, Germany). For Rad51 mutation analysis, the following primers were
used for amplification
of the Rad51 coding region 4 (Rad51 sequences are underlined):
outer primers:
5'-primer: ATGGCAATGCAGATGCAGCTTGAAGC.
3'-primer : TCAAGTCTTTGGCATCTCCCACTCC;
5'-primer: CCGCGCGCAGCGGCCAGAGACCG,
3'-primer: GTCAAAGATACTTCATACCCCTCC~
for nested PCR:
5'-primer: GATAATACGACTCACTATAGGGAAGAAGAAAGCTTTG.
3'-primer: TCATTTAGGTGACACTATAGGAAGACAGGGAGAGTC.
-33-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
5'-primer: GATAATACGACTCACTATAGGGCGCTTCCCGAGGC;
3'-primer: TCATTTAGGTGACACTATAGGACCCGAGTAGTCTGTTC;
5~-ptinter: ~ GATAATACGACTCACTATAGGGAATTGAGACTGGAT
3'-primer: TCATTTAGGTGACACTATAGGAATAAACATTTTAGATC..
F~esuits:
In a CNA repair pathway, recombinational processes may act to maintain genetic
stab7ity, but if
deregulated or Increased, genomic instabUlty and malignant transformation can
result. In order to test,
i0 whether RadS1 protein expression is altered in malignandes of epithelial
origin. specimens of invasive
ducts! mammary carcinoma were analyzed by immunohistochemistry. The results
indicate that Rad51
fs~ over-expressed in Tumor cell nuclei (Figure 8) compared to normal breast
tissue derived from
reduc;ion;mamniaplasty (n=8) and tissue from fibrocystic mastopathy (n=i 0)
(not shown). Tumor cells
cars be cfassitied as either positive (dark brown staining) or negative for
Rad51 (Figure 8). This
15- psfEern allows the classification of Rad51 expression by pos'dive cell
index (PCI (10)). In a small panel
of'spscimens~of invasive ductal breast carcinomas analyzed first, the PCI for
Rad51 ranged from 0%
up tD 6S%.
To assess correlations with established tumor parameters, the Rad51 PCI was
detenntned in a panel
20. of 1p7 specimens of ductal invasive breast cancers. Table 1 below gives a
summary of the statistical
arislysis of Rad51 PCI compared to a spectrum of established tumor parameters,
corresponding rank
correlation coe~cients are shown in Figure 9. The notable correlation was
found between Rad61
ov~r-expression and tumor grading with a coefficient of ,=0.535 (rank
correlation according to
Spearman) that reached sta4stical significance (p<0.001 ). In addition, RadS1
PCI was tnversaty
ZS correlated with the estrogen receptor status of the tumors (rB=-0.352;
p<0.001). Rad51
over-expression was also compared with expression of iwo established marker
proteins, the tumor
suppressor p53 and the proliferation protein K187-antigen. There was no
significant direct correlation
between Rad54 and p53 PCI, but a highly significant correlation between Rad51
and Ki67-antigen
expression (r,--0.563; p<0.001 ). Figure 8 shows representative examples of
Rad51, p53 and
3D ICS7-antigen staining patterns in relation to tumor grading.
The alteration of Rad51 expression in breast cancer described above does not
result from mutations
in'the,Rad51 coding sequence. A panes of 14 r~presentative breast cancer
samples was analy~od
using the highly sensitive and specific mutation detection non-isotopic RNASE
cleavage assay
35 {NIRCA) as described in Material and Methods. No Rad51 mutations were found
(data not shown), In
-34-
RECTIFIED SHEET (.~'s(li_E c~~~
ISA / EP
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
summary, recombination factor Rad51 over-expression in invasive ductal breast
cancer classified as
PCI correlates with clinical tumor parameters like tumor grading and hormonal
receptor status. Since
Rad51 in the tumors represents the wild-type form of the protein, over-
expression is the result of
epigenetic changes in tumor cells.
Recently, epigenetic phenomena have been described as being responsible for
the down-regulation of
BRCA1 expression in sporadic breast cancers (Yoshikawa, K., et al., clin.
Canc. Res. 5:1249-1261
(1999); Wilson, C.A., et al., Nat. Genet. 21:236-240 (1999); Dobrovic, A. and
Simpfendorfer, D., Canc.
Res. 57:3347-3350 (1997); Mancini, D.N., et al., Oncogene 16:1161-1169
(1998)). Therefore BRCA1
expression was determined in our collective of breast cancer specimens using
AB-1 (Calbiochem,
Schwalbach, Germany), a monoclonal anti BRCA1 antibody providing optimal
results in paraffin
embedded tissue (Wilson, C.A., et al., Nat. Genet. 21:236-140 (1999)). In
agreement with Wilson and
co-workers we found BRCA1 staining restricted exclusively to cell nuclei.
Occasional additional
cytoplasmic staining was registered in only two out of 98 specimens analyzed.
In contrast to Rad51,
differences in BRCA1 staining intensities were subtle ranging from weak brown
to dark-brown.
Consequently, a scoring system based on the criteria established by Wilson,
C.A., et al., Nat. Genet.
21:236-240 (1999) was used to evaluate BRCA1. Figure 10 shows staining
patterns representative of
this scoring system for BRCA1. Figure 8 gives examples of BRCA1 expression in
relation to tumor
grading. Statistical analysis of 108 tumor specimens confirms the inverse
correlation between BRCA1
expression and tumor grading (Figure 9) first described by Wilson and co-
workers (Wilson, C.A., et al.,
Nat. Genet. 21:236-240 (1999)). Although there is not necessarily a
correlation between Rad51
over-expression and loss of BRCA1 (Figure 9), the data establishes the
correlation between both
parameters and tumor grading.
Table 1
Statistical analysis of Rad51 in invasive ductal breast carcinoma
n: number of cases; n~: number of cases in a particular class; PCI: positive
stained cell index; IRS:
immunoreactive score (Remmele and Stegner, 1987); SII: staining intensity
index; nn: test not
necessary; ns: not significant; */**I***: p<0.05/0.01/0.001 (if necessary,
Bonferroni-correction was
applied); H-test: according to Kruskal and Wallis; U-test: according to Mann
and Whitney.
Table 1
-35-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
parameter n class n~ Rad51 H- U-test
(PCI; tes
median t
tumor size 105 1 36 10,35 ** 1:2*, 1:3ns, 1:4ns
(T)
2 44 20,5 2:3nx, 2:4ns, 3:4ns
3 6 24,9
4 19 16,4
nodal status97 0 48 18,35 ns nn
(N)
1 42 14,75
2 7 22,5
grading (G) 107 1 28 5,4 ***1:2**, 1:3**, 2:3**
2 49 16,4
3 30 25,3
Ki67 (PCI) 104 PCI<25,7 51 10,1 nn ***
PCI>35,4 53 20,5
p53 (PCI) 101 PCI<35,4 51 16,5 nn ns
PCI>35,4 50 16,45
BRCA1 (S11) 98 0 15 17,6 0 0:1 ns, 0:2ns,
0:3ns,
1 44 17,2 1:2nd, 1:3ns, 2:3ns
2 27 10,1
3 12 23,75
estrogen 105 IRS<6 54 20,55 nn **
receptor IRS>6 51 12
status
progesterone105 IRS<6 57 19,6 nn ns
receptor IRS>6 48 13,4
status
The development of cancer is accompanied by the accumulation of mutations in
proto-oncogenes and
tumor suppressor genes. In addition, cancer related genes may also be
dysregulated by epigenetic
mechanisms as demonstrated recently for the BRCA1 tumor suppressor gene in
sporadic breast
cancer (Wilson, C.A., et al., Nat. Genet. 21:236-240 (1999)). The biological
function of BRCA1 is not
-36-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
understood in detail, but it appears to be involved in DNA double strand break
(DSB) repair (Feunteun,
J., Mol. Med. Today4:263-270 (1998)) via a pathway, which relies on homologous
recombination
(Hendrickson, E.A., Am. J. Hum. Genet. 61:795-800 (1997)). BRCA1 protein is
found in complex with
Rad51, the key enzyme of homologous recombination (Scully, R., et al., Cell
88:265-275 (1997)).
This study demonstrates the statistically significant positive correlation
between over-expression of
wild-type Rad51 protein in tumor cells and tumor grading of invasive ductal
breast cancer. In
confirmation of previous reports, BRCA1 expression showed an inverse
correlation with tumor grading
(Wilson, C.A., et al., Nat. Genet. 21:236-240 (1999)). Although there does not
appear to be a direct
correlation between Rad51 PCI and BRCA1 score, the result that over-expression
of Rad51 increases
during dedifferentiation whereas BRCA1 expression decreases, indicates that
both incidents confer
advantages during tumor progression.
Loss of BRCA1 during murine embryogenesis results in accumulation of DNA
damage that triggers
activation of p53 dependent pathways leading to cell cycle arrest or
apoptosis. Cell survival is
increased in mouse embryos, nullizygous for BRCA1 and p53 (Hakem, R., et al.,
Cell 85:1009-1023
(1996); Hakem, R., et al., Nat. Genet. 16:298-302 (1997); Xu, X., et al., Nat.
Genet. 22:37-43 (1999)).
We assert that accumulating DNA damage in BRCAI defective breast cancer cells
triggers apoptosis
pathways unless permissive events like inactivation of p53 function occur to
prevent elimination of
damaged cells (Crook, T., et al., Lancet 350:638-639 (1997)). Loss of p53
function accelerates breast
cancer development in BRCA1 hemizygous transgenic mice (Xu, X., et al., Nat.
Genet. 22:37-43
(1999)). In this model system, we assert that inactivation of BRCA1 leads to
an increase of mutation
rates of all genes, including tumor suppressor genes and oncogenes. Wild-type
p53 acts against the
establishment of this phenotype by inducing either cell cycle arrest via p21
or apoptotic cell death (Xu,
X., et al., Nat. Genet. 22:37-43 (1999); Sourvinos, G. and Spandidos, D.A.,
Biochem. Blophys. Res.
Commun., 245:75-80 (1998)). We assert that overexpression of Rad51 is also a
permissive event for
tumor progression since it will help to keep the DNA damage, which accumulates
upon
down-regulation of BRCA1 at a tolerable level for cell survival, thus
inhibition thereof will lead to
apoptosis. Thus, epigenetic dysregulation of protein expression manifested as
BRCA1
down-regulation and/or over-expression of wild-type Rad51 contribute to the
development of sporadic
breast cancer.
EXAMPLE 3: RAD51 TRIGGERS A P53 INDEPENDENT CELL CYCLE CONTROL PATHWAY
Materials and Methods
-37-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
Cell Culture
Cell lines UiRad51, over-expressing Rad51 protein and UiLacZ, producing (3-
galactosidase were
prepared. In brief, Rad51 cDNA (Stiirzbecher, H.W., et al., Embo J 15:1992-
2002 (1996)) was
inserted into plasmid pIND and co-transfected with a modified pVgRxR
(Invitrogen, de Schelp, the
Netherlands, S.M, and H.-W.S., in preparation) into U-2 OS cells (Ponten, J. &
Saksela, E., Int J
Cancer2:434-47 (1967)) by the CaPO, precipitation method (Graham, F.L. & Eb,
A.J.v.d., Virology
52:456-67 (1973)). Clones resistant to 6418 (500 Nglml, Life Technologies,
Egenstein, Germany)
and Zeocin (250 Ng/ml, Invitrogen) were picked by cloning ring, expanded and
tested for Rad51
overexpression by immunohistochemistry. To exclude potential heterogeneity in
the cell population,
the original UiRad51 culture was subcloned. Growth retardation in response to
Rad51 induction was
retained in seven of 12 subclones. Further studies were performed with
subclone 2 of UiRad51. Cell
line UiRad51-blue was established from UiRad51 (subclone 2) by stable
transfection with an E. coli (3-
galactosidase reporter for p53 transcriptional activation (pRGCOFosLacZ
(Frebourg, T., et al., Cancer
Res 52:6976-8 (1992)) and a plasmid conferring hygromycin resistance (pDSP
Hygro; (Pfarr, D.S., et
al., Dna 4:461-7 (1985)). UiRad51-blue cells were selected with 80 Ng/ml
hygromycin B (Roche
Molecular Biochemicals, Mannheim, Germany) and maintained in 40 Ng/ml. All
cells were grown in
Dulbecco's Modified Eagle medium (DMEM, Life Technologies, Egenstein,
Germany), supplemented
with 10% fetal calf serum. The ecdysone analogues, muristerone A and
ponasterone A, respectively
(Invitrogen), were dissolved at ImM in absolute ethanol and used at a final
concentration of 1 NM to
induce expression of ectopic Rad51 or (3-galactosidase. Non-induced controls
were supplemented
with the same amount of ethanol. For UV treatment, media were removed and
cells irradiated for 1
second on a TFL-20M transilluminator (Biometra, Gottingen, Germany) equipped
with 312nm bulbs.
According to biological calibration using UiRad51-blue cells, this corresponds
to approximately
270J/m2. Cells were then grown in fresh medium, as were non-irradiated
controls. Calicheamicin y,
(Wyeth-Ayerst research, Pearl River, NY, USA) was dissolved in absolute
ethanol at 100 NM and
stored at -80°C. Etoposide in solution (Vepesid J) was purchased by
Bristol GmbH, Munchen,
Germany.
Cell Cycle Analysis
Cells were trypsinised at the time indicated, collected by centrifugation,
washed and resuspended in
PBS. An aliquot of 200 NI of cell suspension was transferred to 1 ml of ice
cold 70% ethanol and
stored at 4°C until use. Fixed cells were collected by centrifugation,
washed in PBS and digested with
400 Ng/ml DNase-free RNase for Ih at room temperature with agitation.
Propidium iodide was added
-38-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
to a final concentration of 15 Ng/ml. 30.000 events were analyzed on a FACscan
using the "cell fit"
cell cycle analysis software (version 2.0; Becton Dickinson, Heidelberg,
Germany).
Western Blotting
Equal cell numbers were pelleted and lysed in 2x SDS sample buffer (5% SDS;
125mM Tris/CI, pH
6,8; 10% glycerol; 0,02 % bromophenol blue and 12,5% freshly added (3-
mercaptoethanol), boiled for
minutes and nucleic acids were removed by digestion with 260 U Benzonase for
30min at 37°C
(Merck, Darmstadt, Germany). Transfer was essentially carried out as described
(Towbin, H., et al.,
10 Proc Natl Acad Sci USA 76:4350-4 (1979)). Rad51 was detected with
monoclonal antibody 1G8
(Buchhop et al., 1996), p21 Waf' with monoclonal antibody 6B6 (Pharmingen,
Hamburg, Germany) and
p53 with a polyclonal sheep antiserum. Peroxidase coupled secondary antibodies
were supplied by
Amersham (Braunschweig, Germany). Signals were generated with chemiluminescent
substrate
Super Signal Ultra (Pierce, Rockford, IL, USA).
~3-Galactosidase Assay
Cells were trypsinised, washed once with PBS, resuspended in 100 NI assay
buffer (60mM Naz HP04;
40mM NaHzP04; 10mM KCI; ImM MgSO 4) and lysed by three freeze-thaw cycles (-
70°C/+37°C). The
total protein content was measured by the bichinonic acid (BCA) method
according to the protocol of
the supplier (Pierce) and the protein concentration equalized by addition of
assay buffer. Aliquots
were diluted in assay buffer containing 50mM (3-mercaptoethanol, adjusted to
contain 6.7 mg/ml
ortho-nitrophenyl-(3-D-galactopyranoside (ONPG; Sigma, Deisenhofen, Germany)
and incubated at
37°C for 1 hour. Adding Na2C03 to a final concentration of 143mM
stopped the reaction and OD
readings were taken at 420nm.
Luciferase Assays
Cells were trypsinised, washed in PBS and lysed in cell lysis buffer (Promega,
Mannheim, Germany).
Cell lyeates were assayed for protein content using the BCA assay kit (Pierce)
and diluted with lysis
buffer to contain identical protein levels. Luciferase activity was measured
in triplicate using the
Steady-GIoT"" as say kit (Promega) in a Microlumate LB 96P luminom eter ( K G
& G B erthold ,
Freiburg, Germany) according to the suppliers recommendations.
Results
-39-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
Growth retardation and cell cycle arrest in response to high-level expression
of Rad51
The human osteosarcoma cell line U-2 OS was used as parental cell line to
create clone UiRad51
which inducibly expresses Rad51. As a control, the inducibly E. coli ~i-
galactosidase producing clone
UiLacZ was established. Treating the cells with muristerone A or ponasterone
A, analogues of the
insect steroid hormone ecdysone, induces expression of the respective ectopic
proteins. From
experiments obtained in rats pharmacological effects of these metamorphosing
insect hormones can
be excluded (Masuoka, M., et al., Jap. J. Pharmac. 20:142-156 (1970)). Figure
11A shows the
induction of ectopic Rad51 protein by muristerone A treatment. Equal cell
numbers were applied to
each lane in this analysis and in all other relevant experiments in need of
quantitative evaluation. Due
to the short exposure time in the experiment shown, only ectopic protein is
visible. In order to test,
whether high-level expression of Rad51 would affect cell proliferation, growth
curves were recorded.
Proliferation of U-2 OS parental cells was not affected by muristerone A
treatment confirming that
steroid treatment alone does not affect cell proliferation of this cell line,
while growth of UiLacZ controls
was slightly retarded, presumably due to the high synthesis rate of
ectopically expressed protein. By
contrast, induction of Rad51 expression triggered serious growth retardation
of UiRad51, while
non-treated UiRad51 cells proliferated exponentially with a doubling time of
approximately 24h. There
was no evidence of cell death in response to Rad51 over-expression as
determined by Annexin V
FLUOS (Roche Biochemicals, Mannheim, Germany) and propidium iodide staining
(data not shown).
It is well established that the parental cell line U2-OS expresses wild-type
p53 at levels comparable to
normal diploid fibroblasts (Diller, L., et al., Mol Cell Biol 10:5772-81
(1990)). In response to DNA
damage or upon ectopic expression of the inhibitor of cyclin dependent
kineses, p21 Waf', U2-OS cells
arrest in G, and GZ/M (van Oijen et al., 1998). To assess whether the newly
established cell clones
UiLacZ and UiRad51 still respond to genotoxic stress with cell cycle arrest,
cells were treated either
with etoposide (not shown) or were W irradiated. Cell cycle analyses 56 hours
after treatment reveal
that both cell clones halt the cell cycle in G, and GZ/M (Figure 11 B).
Treatment with the DNA double
strand break (DSB) inducing agent calicheamicin y, leads to cell cycle arrest
exclusively in GZ/M
while the cells arrest exclusively in G, after serum deprivation (data not
shown). These control
experiments indicate that cell cycle control mechanisms appear to be intact in
all cell clones used in
this study. Within 26 hours of Rad51 over-expression the number of UiRad51
cells in S-Phase
dropped from 53,8% to 18,3%, reaching its minimum of only 13% at 56 hours
(Figure 11C). In
non-induced controls 55,1 %, 51,7% and 40,5% of cells were found in S-phase at
the respective
timepoints (data not shown). During 26h of Rad51 induction, the fraction of
Gz/M cells increased from
16,4% to 46,0%, compared to 16,9% and 13,9% in non-induced controls. By
contrast, the fraction of
-40-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
cells in G, raised only slightly in induced cells (29,8%, 35,1% and 46,7%, at
Oh, 26h and 56h)
compared to non-induced controls (27,4%, 34,3% and 36,4%). For non-induced
UiRad51 and for
UiLacZ cells the increase in GI cells is dependent on cell density upon
prolonged cultivation. However,
this does not apply to induced UiRad51 cells, since they no longer
proliferate. We therefore conclude
that expressing high levels of Rad51 induces an arrest of cell proliferation
in the G, and G2/M phases.
When UiRad51 cells were induced for 24h and were subsequently cultured for
additional 50h in
absence of muristerone A, cell cycle arrest was still maintained, although the
Rad51 levels return to
normal within 16h after cessation of treatment (data not shown). These
findings indicate that once cell
cycle arrest has been implemented, high levels of Rad51 are dispensable to
prevent cell proliferation
for at least additional 50h.
Rad51 induces p21"'a" in a p53 independent manner by activating the waf 1
promoter
The inhibitor of cyclin dependent kineses, p21'"a", mediates cell cycle arrest
(e1 Deiry, W.S., et al., Cell
75:817-25 (1993)). Over-expression of p21'"a" is sufficient to trigger both,
G, and Gz/M arrest, in
U2-OS cells, the line used to establish UiRad51 and UiLacZ (van Oijen, M., et
al., Am J. Clin Pathol
110:24-31 (1998)). In order to test whether p21'"a" is involved in Rad51
dependent cell cycle arrest,
p21'"a" protein content was determined by Western blot analysis. Under normal
conditions, UiRad51
cells contain low levels of p21'"a" (Figure 12A, lane 1) which increase upon
UV irradiation (Figure 12A,
lane 2). Accumulation of p21'"a" protein to even higher levels was found in
response to expression of
ectopic Rad51 for 48h (Figure 12A, lane 3). There was no further increase in
p21'"a" protein content,
when both ectopic Rad51 expression and additional UV irradiation were applied
(Figure 12A, lane 4).
In UiLacZ control cells there was no influence of muristerone A treatment on
p21'"a" expression level,
while UV irradiation resulted in p21'"a" induction (data not shown). Therefore
over-expression of
Rad51 is sufficient to induce cell cycle arrest which correlates with an
induction of p21~"af'.
Since the waf 1 gene is activated on the transcriptional level (e1 Deiry,
W.S., et al., Cell 75:817-25
(1995)) we analyzed the waf 1 promoter for responsiveness to ectopically
expressed Rad51 using
reporter plasmid WWP-Luc (e1 Deiry, W.S., et al., Cel175:817-25 (1993)). This
construct carries the
firefly luciferase gene under control of the distal 2.4kb part of the waf 7
promoter. Consistent with the
protein data, there was an increase in luciferase activity upon ponasterone A
treatment in UiRad51,
but not in UiLacZ cells (Figure 12B). Additional controls include transfection
of both cell lines with
pGL3 (Promega, Mannheim, Germany) the vector used to construct WWP-Luc
providing the
promoterless luciferase gene (data not shown). A control for transfection
efficiency was not necessary
since cells were transfected as one batch. Half were induced with ponasterone
A, the other was
-41 -
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
mock-induced with ethanol. Furthermore, as shown below, in adapted UiRad51
cells WWP-Luc is not
responsive to Rad51 over-expression (Figure 13C). These data show that high
level expression of
Rad51 specifically activates the waf 1 promoter and that the element
responsive to Rad51 is located
within the 2.4kb region used in the reporter construct.
One of the major regulators that trigger activation of the waf 1 promoter is
p53 and p53 dependent cell
cycle arrest is at least partially mediated by p21'"a" (e1 Deiry, W.S., et
al., Ce1175:817-25 (1993)). In
order to explore whether Rad51 requires the transactivator activity of p53 to
induce p21'"af', cell line
UiRad51-blue was established from UiRad51 by stable integration of the highly
p53 specific reporter
pRGC~fos-LacZ (Frebourg, T., et al., Cancer Res 52:6976-8 (1992)). Thus,
substrate cleavage by
/3-galactosidase can be used as direct measure of p53 transactivator activity
in this cell clone.
Muristerone A dependent Rad51 over-expression in UiRad51-blue was verified by
Western blot
analysis as was Rad51 dependent cell cycle arrest (data not shown). As
expected, UV irradiated
UiRad51-blue cells exhibit elevated levels of (3-galactosidase activity
compared to non-irradiated
controls, indicating that under these conditions p53 becomes competent to work
as transactivator
(Figure 12C). On the other hand, induction of Rad51 expression with
muristerone A did not lead to an
increase of (3-galactosidase activity beyond basal levels. These results argue
that Rad51 triggers
stimulation of p21'"af' expression independent of p53 transactivator activity.
Cells adapt to high levels of Rad51
After 56h of ectopic Rad51 expression, only 13% of cells are found in S-phase.
When UiRad51 cells
were cultured on in presence of muristerone A, the fraction of cells in S-
phase increased again to 15%
at 78h and to 21% at 152h (Figure 13A). Long-term cultivation (28d) of induced
UiRad51 led to a
complete release from cell cycle arrest although Rad51 was permanently
produced at high levels.
Under such conditions as many as 40% of S-phase cells were detected by flow
cytometry compared to
38% in untreated cultures. Cells adapt to high levels of Rad51 with time and
re-enter proliferation.
Release from cell cycle arrest was paralleled by a decline of p21'"af' protein
levels (Figure 13B). An
increase in p21'"a" levels was already visible after 24h (data not shown)
while its maximal amount was
found at 56h and 78h of induction and thereafter decreased to very low basal
levels. Thus, Rad51
causes a transient cell cycle arrest via reversible and p53 independent
induction of p21'~~f'.
To learn more about the underlying mechanism of adaptation, viraf 1 promoter
activity was analyzed
after transient transfection of reporter construct WWP-Luc and assayed 48h
thereafter. In adapted
UiRad51, i.e., cells that had been induced for 28 days. The level of
Luciferase activity in adapted cells
-42-
CA 02379608 2002-02-07
WO 01/11369 PCT/US00/22077
does not exceed the level detectable in control cells (compare Figure 12B).
Removal of the drug from
adapted cells 48h prior to assaying did not cause a change of Luciferase
activity above basal level
(Figure 13C, column 3). Here the question arises whether the expression of p21
Way' can be
re-stimulated in adapted cells after a period of recovery from Rad51 over-
expression. Time-course
experiments confirmed that the ectopically expressed Rad51 protein is
completely degraded 16h after
removal of muristerone A (data not shown). Consequently, adapted cells were
allowed to recover for
48h in absence of the drug, transfected with WWP-Luc, and Rad51 expression was
re-induced for
another 48h (Figure 13C, column 6). As control, cells were left non-induced
after transfection (Figure
13C, column 5). The data shows the failure of re-activation of the waf 1
promoter in response to a
second round of Rad51 over-expression. Assuming, that expression of p21'"a"
was responsible for
Rad51 triggered cell cycle arrest, one might expect that reinduction of Rad51
in adapted cells should
not affect cell proliferation. To test this hypothesis, adapted cells were
cultured in absence of
muristerone for 2 (data not shown) or 11 days, re-induced for 72h and analyzed
by flow cytometry
(Figure 14A, panel 2). As control, adapted cells were left non-induced for 14
days prior to cell cycle
analysis (Figure 14A, panel 1 ). Cell cycle distribution, of re-induced and
control cells is
indistinguishable. Consequently, 11 days without high levels of Rad51 are not
sufficient to re-establish
Rad51 triggered cell cycle arrest. The loss of waf 1 promoter activation and
subsequent cell cycle
arrest after adaptation to high level expression of Rad51 prompted us to sort
out whether other p21'"8"
mediated cell proliferation control pathways might also be affected. Cells
were treated as in Figure
14A panels 1 and 2 but in addition UV irradiated 24 hours before harvest. Flow
cytometric analysis
revealed that adapted cells do arrest in G, and GZ/M in response to UV-
irradiation as do non-adapted
cells (Figure 14A, panels 3, 4).
As shown above, Rad51 induces a transient cell cycle arrest in non-adapted
cells independent of p53.
In non-adapted, non-induced UiRad51 cells the p53 dependent and p21'"a"
mediated cell cycle arrest
in response to UV-irradiation is intact: p53 accumulates (not shown), is
activated as transcription
factor (Figure 12C), p21 Wa" accumulates (Figure 12A) and cells arrest in G,
and GZ/M (Figure 11 B).
To test whether p53 accumulation in response to UV-irradiation is affected by
adaptation to Rad51, an
aliquot of the cells shown in Figure 14A were used for the determination of
p53 levels (Figure 14B,
lane numbers refer to panel numbers of Figure 14A). Western blot analysis
demonstrates that the
ability of p53 to accumulate in response to UV-irradiation is still intact.
Consequently, the p53
dependent pathway is not affected by adaptation to high level expression of
Rad51. Moreover, serum
dependence is conserved since after serum withdrawal adapted UiRad51 cells
accumulate in G, as do
non-adapted, non-induced UiRad51 and UiLacZ (data not shown). Therefore only
the Rad51 triggered
cell cycle regulation pathway appears to be affected by adaptation to Rad51
overexpression.
-43-
