Note: Descriptions are shown in the official language in which they were submitted.
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
KINASE BLOCKING POLYPEPTIDES AND USES THEREOF
Field of the Invention
This invention relates to intracellular signaling and methods to control
intracellular
signaling pathways.
Background of the Invention
Following transcription in the nucleus, many mRNAs are exported to the
cytoplasm
and are stored in a translationally dormant state. Their timed expression is
important for
various processes including early animal development. For example, in Xenopus
oocytes
dormant mRNAs are activated during oocyte maturation causing cells to re-enter
meiosis.
These dormant mRNAs encode a variety of developmentally important products
including
those that drive the cell cycle, establish polarity and determine cell fate.
Examples of
proteins specifically translated from dormant mRNAs include Mos, cyclins and
cdk2.
A mechanism that controls the translation of dormant mRNA is cytoplasmic poly
(A)
elongation. Cytoplasmic adenylation requires two cis elements in the 3'-
untranslated region
(UTR) of a responding mRNA. The two elements are (a) the hexanucleotide
AAUAAA, and
(b) the cytoplasmic polyadenylation element (CPE), which usually resides
within 50 bases
upstream of the hexanucleotide. An RNA binding protein, CPEB, modulates
polyadenylation
by binding to CPE and effecting the timing and extent of translational
activation (Hake et al.,
Biochim. Biophys. Acta, 1332, M31-M38 (1997) and Stebbins-Boaz et al. Crit.
Rev.
Eukaryot. Gene Expr., 7:73-94 (1997)).
In mammals, CPEB is present in oocytes, tissues involved in the immune
response,
and in the brain, particularly in the dendritic layer of the hippocampus and
at synapses of
cultured hippocampal neurons (Wu et al, Neuron, 21:1129-1139, 1998). In
response to
synaptic stimulation, a CPE-containing mRNA encoding a-calmodulin-dependent
protein
kinase II undergoes polyadenylation and translational activation.
- 1 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
Summary of the Invention
The invention is based on the discovery that Xenopus CPEB is phosphorylated by
the
serine\threonine kinase Eg2, and that the phosphorylation occurs at serine
residue 174, found
in a conserved motif consisting of amino acids LDSR. Moreover, an ovalbumin-
linked
polypeptide corresponding to amino acid residues 163-181 of the RNA binding
protein CPEB
competitively inhibits CPEB phosphorylation in vivo and delays progesterone-
induced
maturation of Xenopus oocytes. In addition, polypeptides which contain the
LDXR motif
have been found to be useful for inhibiting Eg2 activity. Since Eg2 functions
as a kinase and
plays a role in intracellular signaling, the present invention provides
polypeptides which can
be used to control Eg2 activity. For example, Eg2 is involved in cancerous
cell growth.
Thus, the polypeptides of the invention can be used to treat cancer.
Based on these discoveries, the invention features a substantially pure
polypeptide of
5-100 amino acids ("blocking polypeptide"), which includes the amino acid
sequence LDXR
(SEQ ID NO: 15), wherein "X" is G, A, V, L, I, M, C, S or T. X can be A, V, L,
I, S or T.
When X is S or T, it can be phosphorylated or non-phosphorylated, depending on
the
blocking polypeptide's intended use. The blocking polypeptide can contain
about 5 to 100
amino acids, e.g., about 5, 6, 7, 8, 9, 10-20, 30, 40, 50, 60, 70, 80, or 90
amino acid residues.
Suitable blocking polypeptides include fragments or variants of CPEB from
various
organisms, e.g., Xenopus CPEB (LRSSRLDSRSILDSRSS; SEQ ID N0:3) or mouse CPEB
(RGSRLDTRPILDSR; SEQ ID N0:4). The CPEB polypeptides can be phosphorylated,
e.g.,
the serine at position 8 of the Xenopus sequence LRSSRLDSRSILDSRSS (SEQ ID
N0:3)
can be phosphorylated; or the threonine at position 7 of the mouse sequence
RGSRLDTRPILDSR (SEQ ID N0:4) can be phosphorylated. Exemplary blocking
polypeptides also include LRSSRLDXRSILDSRSS (SEQ ID NO:S) or RGSRLDXRPILDSR
(SEQ ID N0:6), with one or more conservative amino acid substitutions therein,
provided
that the LDXR motif is preserved. Specific embodiments, of the blocking
polypeptides are
LRSSRLDARSILDSRSS (SEQ ID N0:7) and RGSRLDARPILDSR (SEQ ID N0:8).
Also within the invention are isolated nucleic acid sequences that encode the
blocking
polypeptide described above.
- 2 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
The invention also includes a vector containing the above-described nucleic
acid
sequence, and a cell containing the vector. The cell can be prokaryotic or
eukaryotic, e.g., an
animal cell such as a mammalian cell.
In another aspect, the invention includes a method of producing a blocking
polypeptide. The method includes culturing a cell containing a nucleic acid
sequence which
encodes a blocking polypeptide described herein under conditions and for a
time sufficient to
enable the cell to express a polypeptide encoded by the nucleic acid, and
isolating the
blocking polypeptide from the cell.
Antibodies specific for the blocking polypeptides described herein are also
within the
invention. The antibody can be polyclonal or monoclonal. In one embodiment,
the blocking
polypeptide is phosphorylated, e.g., at amino acid X of the LDXR motif and the
antibody is
specific for the phosphorylated form of the blocking polypeptide. In another
embodiment,
the antibody can be bound to a solid support.
The invention also features a method (e.g., in vivo or in vitro) of inhibiting
the
activity of an Eg2 including contacting Eg2 with an effective amount of a
blocking
polypeptide described herein.
Also within the invention is a method of inhibiting CPEB phosphorylation in a
cell by
contacting Eg2 in the cell with an effective amount of a blocking polypeptide
described
herein. The method can be performed in vivo, ex vivo, or in vitro.
Other methods, such as a method of detecting phosphorylated CPEB, e.g.,
phosphorylated CPEB, are also within the invention. The method includes
contacting an
antibody, that specifically binds to a blocking polypeptide described herein,
to a sample, e.g.,
a cell, under conditions that enable the antibody to bind to phosphorylated
CPEB to form a
CPEB-antibody complex, if present, and detecting any complexes, the presence
of a complex
indicating the presence of CPEB, or phosphorylated CPEB, in the sample. The
method can
be performed in vivo or in vitro.
The invention also includes a method of treating a cancer cell. The method
includes
contacting a cell with an effective amount of blocking polypeptide described
herein, thereby
treating the cancer cell. This method can be performed in vivo or in vitro.
- 3 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
An "isolated DNA" is a DNA free of the genes that flank the DNA in the genome
of
the organism in which the DNA naturally occurs. The term therefore includes a
recombinant
DNA incorporated into a vector, into an autonomously replicating plasmid or
virus, or into
the genomic DNA of a prokaryote or eukaryote. It also includes a separate
molecule such as
a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction
(PCR), or a
restriction fragment.
A gene and a regulatory sequences) are "operably linked" when they are
connected
in such a way as to permit gene expression when the appropriate molecules
(e.g.,
transcriptional activator proteins) are bound to the regulatory sequence(s).
At "substantially pure polypeptide" is a polypeptide separated from components
with
which it is naturally associated. A polypeptide is substantially pure when it
is at least 60% by
weight, free from the proteins and other naturally-occurring organic molecules
with which it
is naturally associated. For example, the purity of the preparation is at
least 75%, at least
90%, or at least 99%, by weight. A substantially pure polypeptide can be
obtained, for
example, by extraction from a natural source, by expression of a recombinant
nucleic acid
encoding a polypeptide, or by chemical synthesis. Purity can be measured by
any appropriate
method, e.g., column chromatography, polyacrylamide gel electrophoresis, or
HPLC analysis.
A chemically synthesized polypeptide or a recombinant polypeptide produced in
a cell type
other than the cell type in which it naturally occurs is, by definition,
substantially free from
components that naturally accompany it. Accordingly, substantially pure
polypeptides
include those having sequences derived from eukaryotic organisms but
synthesized in E. coli
or other prokaryotes.
A "vector" is a replicable nucleic acid construct. Examples of vectors include
plasmids and viral nucleic acids.
Unless otherwise defined, all technical and scientific terms used herein have
the same
meaning as commonly understood by one of ordinary skill in the art to which
this invention
pertains. Although methods and materials similar or equivalent to those
described herein can
be used in the practice or testing of the present invention, suitable methods
and materials are
described below. All publications, patent applications, patents, and other
references
mentioned herein are incorporated by reference in their entirety. In case of
conflict, the
- 4 -
WO 01/07466 CA 02379863 2002-O1-18 pCT/US00/20254
present document, including definitions, will control. Unless otherwise
indicated, materials,
methods, and examples described herein are illustrative only and not intended
to be limiting.
Various features and advantages of the invention will be apparent from the
following
detailed description and from the claims.
Brief Description of the Drawings
Fig. 1 is a representation of a sequence comparison between Xenopus (SEQ ID
N0:12), mouse (SEQ ID N0:13), and zebrafish CPEBs (SEQ ID N0:14). Identical or
similar amino acids are boxed. The phosphoserine is identified by a star.
Figs. 2A and 2B are histograms showing that CPEB is required for oocyte
maturation.
Fig. 2A and 2B show % germinal vesicle break-down (GVBD, marker of oocyte
maturation)
of oocytes injected with (i) wild type CPEB (WT; column 3 and column 4 of Fig.
2A and
column 9 or 10 of Fig. 2B), (ii) alanine CPEB varient (AA; column 5 and 6 of
Fig. 2A) and
(iii) aspartic CPEB varient (DD; column 11 and 12 of Fig. 2B) in the presence
of
progesterone (column 4 or 6 of Fig. 2A and column 10 or 12 of Fig. 2B) or
absence of
progesterone (column 3 or 5 of Fig. 2A and column 9 or 11 of Fig. 2B). The %
GVBD in
control oocytes is shown in column 1 and 2 of Fig. 2A and column 7 and 8 of
Fig. 2B.
Fig. 3 is a line graph showing % GVBD of oocytes injected with the ovalbumin-
linked blocking polypeptide at 1, 2, 3, 4, or S hours in the presence and
absence of
progesterone. BSA was injected into oocytes as a control.
Detailed Description
The invention encompasses polypeptides (referred to herein as "blocking
polypeptides") that can inhibit the activity of Eg2. Eg2 is a member of the
Aurora family of
protein kinases and is known to play a role in cell signaling. For example,
Eg2 plays a role in
early animal development and embryogenesis and, in the brain, can mediate
synaptic
plasticity. Accordingly, the blocking polypeptides of the invention can be
used to inhibit Eg2
activity, and control Eg2 activity. In another example, Eg2 is involved in
cancerous cell
growth. Inhibition of Eg2 activity using the polypeptides of the invention can
be used to treat
cancer by inhibiting Eg2 activity.
- 5 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
Polypeptides
The invention features blocking polypeptides between 6-100 amino acids in
length,
and contains the amino acid sequence LDXR (SEQ ID NO: 7), wherein "X" is G, A,
V, L, I,
M, C, S, or T. Exemplary blocking polypeptides are fragments or variants of
CPEB. The
CPEB fragments or variants can be from any of various organisms such as
Xenopus, mouse,
human, rat, pig, horse, cow or rabbit. Suitable blocking polypeptides include
LRSSRLDXRSILDSRSS (SEQ ID NO:S) or RGSRLDXRPILDSR (SEQ ID N0:6), or those
same peptides with one or more conservative amino acid substitutions therein.
The
replacement of an amino acid of a blocking polypeptide with a conservative
amino acid
preferably results in a polypeptide which retains the function of the original
blocking
polypeptide, e.g., inhibits Eg2 activity. "Conservative" amino acid
substitutions are
substitutions in which one amino acid residue is replaced with another amino
acid residue
having a similar side chain. Families of amino acid residues having similar
side chains have
been defined in the art. These families include amino acids with basic side
chains (e.g.,
lysine, arginine, histidine), acidic side chains (e.g., aspartic acid,
glutamic acid), uncharged
polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine,
tyrosine, cysteine),
nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline,
phenylalanine,
methionine, tryptophan), beta-branched side chains (e.g., threonine, valine,
isoleucine) and
aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
Any one of a
family of amino acids can be used to replace any other members of the family
in a
conservative substitution.
The blocking polypeptides can be used, e.g., to inhibit Eg2 activity, inhibit
phosphorylation of CPEB, or to distinguish between phosphorylated and non-
phosphorylated
CPEB in an organism, e.g., an animal, e.g., a human. It has been discovered
that a blocking
polypeptide with the X position occupied by an alanine residue is particularly
effective for
inhibiting Eg2 activity. Without intending to be bound by theory, the
inventors observe that
this may result from the A-substituted blocking polypeptide remaining bound in
the Eg2
active site.
- 6 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
A blocking polypeptide can be isolated and purified from a natural source.
Alternatively, it can be chemically synthesized by conventional methods.
Methods for
synthesizing polypeptides include solid phase synthesis as described by
Merdfield (J. Am.
Chem. Soc. 85:2149 (1963)), fragment condensation or classical solution
synthesis.
Automated synthesizers such as the Beckman, Applied Biosystem Inc. (Rao et
al., Int. J, Pep.
Prot. Res. 40:508-515 ( 1992), Vega 250 automated peptide synthesizer, or
other peptide
synthesizers can be employed to synthesize the polypeptides of the present
invention.
Recombinant DNA methodology can also be used to prepare the blocking
polypeptides. A typical method involves transfecting host cells (e.g.,
bacterial cells, human
cells, or Xenopus cells) with an expression vector containing a nucleotide
sequence that
encodes a blocking polypeptide. The recombinant blocking polypeptide can be
purified from
the culture medium or from lysates of the cells.
A phosphorylated form of the blocking polypeptide can be generated by methods
known in the art. For example, the blocking polypeptide can be phosphorylated
by
incubating the blocking polypeptide with a Eg2 source, e.g., progesterone-
stimulated oocyte
cell extracts or with recombinant Eg2. Alternatively, a phosphorylated
blocking polypeptide
can be made chemically, using known methods that are commercially available.
Also within the invention are fusion proteins or polypeptides that include the
blocking
polypeptides of the invention fused to an unrelated protein. The unrelated
protein can be
selected to facilitate purification, detection, solubilization, or to provide
some other function.
Fusion proteins can be produced synthetically or the blocking polypeptide can
be linked to an
unrelated protein using an appropriate coupling reagent, e.g.,
dicyclohexylcarbodiimide
(DCC). Alternatively, fusion proteins can be produced recombinately by cloning
a nucleotide
sequence that expresses the fusion protein into an appropriate expression
vector. The
recombinant fusion polypeptide can then be purified from the culture medium or
from lysates
of the cells.
The blocking polypeptides can be purified using HPLC, gel filtration, ion
exchange
chromatography, or other known methods.
The "blocking polypeptides" of this invention can be used to treat cancer,
inhibit
synaptic function, or inhibit oocyte maturation or embryogenesis
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
DNA Molecules and Vectors
The invention includes an isolated DNA molecule that encodes a blocking
polypeptide described above. Those of skill in the art will recognize that
because of the
degeneracy of the genetic code, numerous different nucleotide sequences can be
used to
encode any given blocking polypeptide. However, codons can be chosen for
optimal
expression in the host organism. Isolated DNAs for use in the invention
include DNA
fragments or variants of wild type CPEB that contain a sequence that encodes
an LDXR
motif. The CPEB DNA for use in the present invention can be from any of
various
organisms, including Xenopus, mouse, human, rat, pig, horse, cow and rabbit.
Prefer ed
DNA sequences of the present invention include Xenopus CPEB 5'-
tgcgtagctctcgattggacagccgctctattttggattctcgctccagc- 3' (SEQ ID NO:1) or mouse
CPEB 5'-
agaggatctcgcctggacacccggcccatcctggactcccgt-3' (SEQ ID N0:2). The complete DNA
sequence of mouse (NIH accession number Y08260) and Xenopus CPEB (1VIH
accession
number U14169) are known in the art.
The DNA of this invention can be used to treat cancer, inhibit synaptic
function, or
control oocyte maturation or embryogenesis. Alternatively, it can be used to
produce a
recombinant blocking polypeptide. For such uses, the DNA of the present
invention is
typically cloned into an expression vector, i.e., a vector wherein DNA is
operably linked to
expression control sequences. The need for, and identity of, expression
control sequences
will vary according to the type of cell in which the DNA is to be expressed.
Generally,
expression control sequences include a transcriptional promoter, enhancer,
suitable mRNA
ribosomal binding sites, and sequences that terminate transcription and
translation. Suitable
expression control sequences can be selected by one of ordinary skill in the
art.
Conventional methods can be used by the skilled person to construct expression
vectors. See generally, Sambrook et al., 1989, Molecular Cloning.' A
Laboratory Manual
(2nd Edition), Cold Spring Harbor Press, N.Y. Vectors useful in this invention
include
plasmid vectors and viral vectors. Preferred viral vectors are those derived
from retroviruses,
adenovirus, adeno-associated virus, SV40 virus, or herpes viruses.
_ g _
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
In some embodiments of the invention, the DNA is introduced into, and
expressed in,
a prokaryotic cell. A preferred prokaryotic cell is Escherichia coli. For
expression in a
prokaryotic cell, the DNA can be integrated into a bacterial chromosome or
expressed from
an extrachromosomal DNA.
In other embodiments of the invention, the DNA is introduced into, and
expressed in,
a eukaryotic cell in vitro. Eukaryotic cells useful for expressing DNA in
vitro include, but
are not limited to, COS, CHO, and Sf~ cells. Transfection of the eukaryotic
cell can be
transient or stable. The DNA can be, but is not necessarily, integrated into a
chromosome of
the eukaryotic cell.
Specific Antibodies
Antibodies specific for the blocking polypeptide can be raised by immunizing a
suitable subject, (e.g., rabbit, goat, mouse or other mammal) with an
immunogenic
preparation that contains the blocking polypeptide. An appropriate immunogenic
preparation
1 S can contain, for example, a recombinantly expressed blocking polypeptide
or a chemically
synthesized blocking polypeptide. The preparation can further include an
adjuvant, such as
Freund's complete or incomplete adjuvant, or similar immunostimulatory agent.
Immunization of a suitable subject with an immunogenic blocking polypeptide
preparation
induces a polyclonal anti-blocking polypeptide antibody response. Antibodies
specific for
the phosphorylated form of the blocking polypeptide can also be generated and
used, e.g., to
determine if phosphorylated CPEB is present in a cell. The term antibody
refers to
immunoglobulin molecules and immunologically active portions of immunoglobulin
molecules. Examples of immunologically active portions of immunoglobulin
molecules
include F (ab) and F (ab')Z fragments, which can be generated by treating the
antibody with
an enzyme such as pepsin. The term monoclonal antibody or monoclonal antibody
composition refers to a population of antibody molecules that contain only one
species of an
antigen binding site capable of immunoreacting with a particular epitope of a
polypeptide. A
monoclonal antibody composition thus typically displays a single binding
affinity for the
blocking polypeptide with which it immunoreacts.
_ g _
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
Polyclonal anti-blocking polypeptide antibodies can be prepared by immunizing
a
suitable subject with a polypeptide immunogen. The anti-blocking polypeptide
antibody titer
in the immunized subject can be monitored over time by well-known techniques,
such as with
an enzyme linked immunosorbent assay (ELISA) using immobilized polypeptide. If
desired,
the antibody molecules directed against the polypeptide can be isolated from
the mammal
(e.g., from the blood) and further purified by well-known techniques, such as
protein A
chromatography, to obtain the IgG fraction. Anti-blocking polypeptide
antibodies against the
phosphorylated form of the blocking polypeptide can also be generated using
methods known
in the art. For example, the phosphorylated form of the protein can be
immunized into a
rabbit. Following isolation of antibodies, the IgG fraction is purified with
protein A-agarose.
Phosphorylated peptide-specific IgG antibodies are then purified by first
passing the IgG over
immobilized, nonphosphorylated blocking polypeptides to remove antibodies
reactive with
nonphophorylated epitopes. The nonadsorbed fraction is then passed over a
column of
immobilized phosphorylated blocking polypeptides. After extensive washing, the
retained
immunoglobulins are eluted at low pH, rapidly neutralized, dialyzed and
concentrated.
Monoclonal antibodies can be generated by immunizing a subject with an
immunogenic preparation containing a blocking polypeptide. At an appropriate
time after
immunization, e.g., when the anti-polypeptide antibody titers are highest,
antibody-producing
cells can be obtained from the subject and used to prepare monoclonal
antibodies by
techniques well known in the art, such as the hybridoma technique originally
described by
Kohler and Milstein (1975) Nature 256:495-497, the human B cell hybridoma
technique
(Kozbor et al. (1983) Immunol Today 4:72), the EBV-hybridoma technique (Cole
et al.
(1985), Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-
96), or trioma
techniques. The technology for producing monoclonal antibody hybridomas is
well known
(see generally Current Protocols in Immunology (1994) Coligan et al. (eds.)
John Wiley &
Sons, Inc., New York, NY). Briefly, an immortal cell line (typically a
myeloma) is fused to
lymphocytes (typically splenocytes) from a mammal immunized with a blocking
polypeptide
immunogen as described above, and the culture supernatant of the resulting
hybridoma cells
are screened to identify a hybridoma producing a monoclonal antibody that
binds to the
blocking polypeptide.
- 10 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
In addition to preparing monoclonal antibody-secreting hybridomas, one can
identify
and isolate monoclonal anti-blocking polypeptide antibodies by screening a
recombinant
combinatorial immunoglobulin library (e.g., an antibody phage display library)
with the
blocking polypeptide to thereby isolate immunoglobulin library members that
bind to the
blocking polypeptide. Kits for generating and screening phage display
libraries are
commercially available (e.g., the Pharmacia Recombinant Phage Antibody System,
Catalog
No. 27-9400-O1; and the Stratagene SurfZAP Phage Display Kit, Catalog No.
240612).
Additionally, examples of methods and reagents particularly amenable for use
in generating
and screening antibody display libraries can be found in, for example, U.S.
Patent No.
5,223,409; PCT Publication No. WO 92/18619; and PCT Publication No. WO
91/17271.
Additionally, recombinant anti-blocking polypeptide antibodies, such as
chimeric and
humanized monoclonal antibodies, comprising both human and non-human portions,
which
can be made using recombinant DNA techniques, are within the scope of the
invention. Such
chimeric and humanized monoclonal antibodies can be produced by recombinant
DNA
techniques known in the art, for example using methods described in PCT
Publication No.
WO 87/02671; European Patent Application 184,187; European Patent Application
171,496;
and European Patent Application 173,494.
An anti-polypeptide antibody (e.g., monoclonal antibody) can be used to
isolate a
polypeptide using techniques well known in the art, such as affinity
chromatography or
immunoprecipitation. An anti-blocking polypeptide antibody can facilitate the
purification of
recombinantly produced polypeptide expressed in host cells. Moreover, an anti-
blocking
polypeptide antibody can be used to detect a blocking polypeptide (e.g., in a
cellular lysate or
cell supernatant) in order to evaluate the abundance and pattern of expression
of the
polypeptide. Anti-blocking polypeptide antibodies can be used diagnostically,
e.g., to detect
CPEB or phosphorylated CPEB in a cell, e.g., a neuron. Detection can be
facilitated by
coupling the antibody to a detectable substance. Examples of detectable
substances include
various enzymes, prosthetic groups, fluorescent materials, luminescent
materials,
bioluminescent materials, and radioactive materials. Examples of suitable
enzymes include
horseradish peroxidase, alkaline phosphatase, a-galactosidase, or
acetylcholinesterase;
examples of suitable prosthetic group complexes include streptavidin/biotin
and
- 11 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
avidin/biotin; examples of suitable fluorescent materials include
umbelliferone, fluorescein,
fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein,
dansyl chloride or
phycoerythrin; an example of a luminescent material includes luminol; examples
of
bioluminescent materials include luciferase, luciferin, and aequorin, and
examples of suitable
radioactive material include lzsh ~3y~ ssS or 3H.
Uses of antibodies include inhibiting the activity of endogenous CPEB,
detecting
CPEB polypeptides in immunohistochemical methods and immunoassays, and
purifying
CPEB polypeptides. Antibodies generated against the phosphorylated form of the
CPEB
polypeptide can be used to distinguish between phosphorylated and non-
phosphorylated
CPEB; to identify cells in which CPEB is phosphorylated; and to identify cells
in which Eg2
is active. Since Eg2 has a role in the brain mediating synaptic plasticity,
antibodies against
Eg2 may be useful for inhibiting neural development, learning and memory. By
administering these antibodies to an animal, one can generate an animal model
for studying
Alzheimers disease. Alternatively, Eg2 can contribute to the over-
proliferative activity of
cells, e.g., cancer. Thus, the antibodies can be useful to treat cancer.
The antibodies of the present invention can be bound to a solid support, e.g.,
polystyrene beads, cross-linked beaded agaroses, or Protein A-Sepharose CL-4B
(Sigma).
Pharmaceutical Formulation and Administration
When administered to an animal or a human, e.g., to treat cancer, modulate
synaptic
function, or inhibit oocyte maturation, the new DNAs, blocking polypeptides,
or antibodies
can be used alone, or in a mixture, in the presence of a pharmaceutically
acceptable excipient
or carrier (e.g., physiological saline). The excipient or carrier is selected
on the basis of the
mode and route of administration, and well known pharmaceutical practice.
Suitable
pharmaceutical carriers, as well as pharmaceutical necessities for use in
pharmaceutical
formulations, are described in Remington's Pharmaceutical Sciences (E. W.
Martin), a well
known reference text in this field, and in the USP/NF.
Alternatively, the therapeutic compositions can be formulated to include
ingredients
that augment or potentiate the therapeutic activity of the blocking
polypeptides, e.g., those
that increase the biological stability of the polypeptides.
- 12 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
Preferably, the therapeutic compositions of the invention are administered
locally to a
target tissue or cell. For example, the blocking polypeptides or antibodies of
the invention
can be directly injected into a tumor. Administration of a therapeutic
composition may be
repeated as needed, as determined by one skilled in the art.
Treatment includes administering a pharmaceutically effective amount of a
composition containing a blocking polypeptide to a subject in need of such
treatment, thereby
inhibiting or reducing cancer cell growth in the subject. Such a composition
typically
contains from about 0.1 to 90% by weight (such as 1 to 20% or 1 to 10%) of a
blocking
polypeptide in a pharmaceutically acceptable carrier.
Solid formulations of the compositions for oral administration can contain
suitable
earners or excipients, such as corn starch, gelatin, lactose, acacia, sucrose,
microcrystalline
cellulose, kaolin, mannitol, dicalcium phosphate, calcium carbonate, sodium
chloride, or
alginic acid. Disintegrators that can be used include, without limitation,
micro-crystalline
cellulose, corn starch, sodium starch glycolate and alginic acid. Tablet
binders that can be
used include acacia, methylcellulose, sodium carboxymethylcellulose,
polyvinylpyrrolidone
(Povidone ), hydroxypropyl methylcellulose, sucrose, starch, and
ethylcellulose. Lubricants
that can be used include magnesium stearates, stearic acid, silicone fluid,
talc, waxes, oils,
and colloidal silica.
Liquid formulations of the compositions for oral administration prepared in
water or
other aqueous vehicles can contain various suspending agents such as methyl
cellulose,
alginates, tragacanth, pectin, kelgin, carageenan, acacia,
polyvinylpyrrolidone, and polyvinyl
alcohol. The liquid formulations can also include solutions, emulsions, syrups
and elixirs
containing, together with the active compound(s), wetting agents, sweeteners,
and coloring
and flavoring agents. Various liquid and powder formulations can be prepared
by
conventional methods for inhalation into the lungs of the mammal to be
treated.
Injectable formulations of the compositions can contain various carriers such
as
vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl
carbonate,
isopropyl myristate, ethanol, polyols (glycerol, propylene glycol, liquid
polyethylene glycol,
and the like). For intravenous injections, water soluble versions of the
compounds can be
administered by the drip method, whereby a pharmaceutical formulation
containing the
- 13 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
blocking polypeptide and a physiologically acceptable excipient is infused.
Physiologically
acceptable excipients can include, for example, 5% dextrose, 0.9% saline,
Ringer's solution,
or other suitable excipients. For intramuscular preparations, a sterile
formulation of a
suitable soluble salt form of the compounds can be dissolved and administered
in a
pharmaceutical excipient such as Water-for-Injection, 0.9% saline, or 5%
glucose solution. A
suitable insoluble form of the compound can be prepared and administered as a
suspension in
an aqueous base or a pharmaceutically acceptable oil base, such as an ester of
a long chain
fatty acid, (e.g., ethyl oleate).
A topical semi-solid ointment formulation typically contains a concentration
of the
active ingredient from about 1 to 20%, e.g., 5 to 10% in a carrier such as a
pharmaceutical
cream base. Various formulations for topical use include drops, tinctures,
lotions, creams,
solutions, and ointments containing the active ingredient and various supports
and vehicles.
The optimal percentage of the blocking polypeptides in each pharmaceutical
formulation varies according to the formulation itself and the therapeutic
effect desired in the
specific pathologies and correlated therapeutic regimens. Appropriate dosages
of the
blocking polypeptides can be determined by those of ordinary skill in the art
of medicine by
monitoring the subject for signs of disease amelioration or inhibition, and
increasing or
decreasing the dosage and/or frequency of treatment as desired. The optimal
amount of the
blocking polypeptides used for treatment of conditions caused by or
contributed to by Eg2,
e.g., cancer, depends upon the manner of administration, the age and the body
weight of the
subject, and the condition of the subject to be treated. Generally, the
blocking polypeptides
compound are administered at a dosage of 0.01 to 100 mg/kg body weight.
Use of Blocking Polypeptides and Antibodies
The blocking polypeptides can be used as a research tool or clinically to
inhibit the
activity of Eg2. For example, the blocking polypeptides can be used to inhibit
early animal
development and embryogenesis by inhibiting phosphorylation of CPEB by Eg2 in
maturing
oocytes. The blocking peptides thus provide the opportunity to situate events
in a cell and
determine the exact developmental control point for CPEB.
- 14 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
The blocking polypeptides can also be used to inhibit Eg2 phosphorylation of
CPEB
in the brain. Since CPEB phosphorylation in the brain mediates synaptic
plasticity, the
blocking polypeptides can be used to inhibit synaptic plasticity and are
useful for inhibiting
neural development, learning and memory. Administration of the blocking
peptides to an
animal serves to generate an animal model for studying Alzheimers disease.
This animal
model can be used to screen for drugs that enhance synaptic plasticity.
Eg2 has been observed to be overexpressed in many human cancers including
breast,
colon, ovarian, prostate, neuroblastoma, and cervical cancers. See, e.g.,
Bischoff et al.,
EMBO J. 17:3052-3065 (1998); Zhou et al., Nat. Genet. 20:189-193 (1998); Sen
et al.,
Oncogene 14:2195-2200 (1997); Tatsuka et al., Cancer Res. 58:4811-4816 (1998);
Tanaka et
al., CancerRes 59:2041-2044 (1999); Kimura et al., J. Biol. Chem. 274:7334-
7340 (1999)
and Katayama et al., Gene 224:1-7 (1998). The blocking polypeptides can be
used to treat
cancer by inhibiting Eg2 activity, e.g., the blocking polypeptides can be
administered to a
prostate cell suspected of being cancerous. In one embodiment, the blocking
polypeptides
are linked to a tumor-specific targeting moiety, e.g., an antibody, which can
be used to
deliver the polypeptides to a selected tumor.
Examples
The invention is further described in the following examples, which do not
limit the
scope of the invention described in the claims.
- 15 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
Example 1: Detection of early CPEB phosphorylation
To detect an early CPEB phosphorylation, stage VI Xenopus oocytes were
metabolically labeled with 32P and then stimulated to mature with
progesterone. Oocytes
were collected at different time points before progesterone, 2 hours after
progesterone, and at
maturation. After immunoprecipitation, CPEB was resolved by SDS-PAGE and
detected by
Western blotting, and the phosphorylation state analyzed by autoradiography.
CPEB
underwent a low level of phosphorylation even in immature oocytes and was
heavily
phosphorylated early during maturation at a time commensurate with c-mos
messenger RNA
(mRNA) polyadenylation. This early phosphorylation did not result in an
altered mobility of
CPEB, which was the case late in maturation. This demonstrated that CPEB
underwent
multiple, time-dependent phosphorylation events during maturation. The early
phosphorylation of CPEB triggers maturation of oocytes.
Example 2: Early CPEB phosphorylation sites
To determine the sites) of the early CPEB phosphorylation, an in vitro assay
was
developed. Recombinant histidine-tagged CPEB was phosphorylated using extracts
from
non-stimulated or progesterone-stimulated oocytes as the kinase source.
However, to first be
certain that exogenous CPEB would be phosphorylated in a manner similar to
endogenous
CPEB, a 2-dimensional phospho-peptide analysis of the two proteins following
32P labeling
and trypsin digestion was performed. Metabolically labeled CPEB was
immunoprecipitated
from mature oocytes and incubated with 32P. Recombinant His-tagged CPEB was
phosphorylated in vitro with extracts from mature stage VI Xenopus oocytes as
the kinase
source in the presence of 32P. This CPEB was then purified by nickel-
chromatography CPEB
(recombinant CPEB). Both endogenous and recombinant CPEBs were resolved by
SDS-PAGE, Western-blotted, digested with trypsin, and the resultant
phosphopeptides were
analyzed by two-dimensional peptide mapping followed by autoradiography.
A single tryptic phospho-peptide (Ppl) was detected when recombinant CPEB was
phosphorylated in extracts from oocytes incubated with progesterone for a
period of time
shorter than that required for p34~'2 activation. However, when extracts from
fully mature
- 16 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
oocytes were used to phosphorylate CPEB, eight phospho-peptides were detected,
which had
two-dimensional migration patterns similar to those observed for endogenous
CPEB. The
phospho-peptides Pp2-Pp8 correspond to likely p34'a°z phosphorylation
sites as indicated by
peptide sequencing.
To determine whether CPEB phosphorylation in the translational recruitment of
c-mos mRNA preceded Mos synthesis, oocytes were first injected with an
antisense
oligonucleotide to destroy c-mos mRNA, and then incubated in progesterone-
containing
medium. This treatment prevented Mos protein accumulation and subsequent
p34~a°z kinase
activation, as well as the CPEB mobility shift and late polyadenylation
events, such as those
that take place on cyclin Bl and histone B4 mRNAs. Extracts prepared from
these oocytes
were still able to phosphorylate Ppl, but not Pp2-PpB. The data indicated that
progesterone
induced the phosphorylation of a single CPEB peptide prior to Mos synthesis,
and suggested
that the modification of Ppl was responsible for activation of CPEB.
Therefore, Ppl was
extracted from the TLC plate, HPLC-purified, and sequenced. The peptide
contained the
sequence LDSR (SEQ ID NO:1 S) (residues 172-175 of CPEB), where serine 174 was
the
phosphorylated residue. This LDSR, and related LDTR motif, are conserved in
all known
vertebrate CPEBs, and are tandemly repeated in the Xenopus and mouse proteins.
- 17 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
Example 3: Ser174 Phosphorylation
To assess whether Ser174 phosphorylation plays a role in the regulation of
CPEB
activity, site-directed mutagenesis, in which not only Ser174, but also
Ser180, were replaced
by alanine or aspartic acid residues, was performed. Although Ser180
phosphorylation was
not detected, Ser180 was mutated to prevent a possible cryptic phosphorylation
event that
could mask the importance of changes of Ser174. The CPEB mutants were
constructed as
described below. Point mutations were made by using a Chamaleon mutagenesis
kit
(Stratagene, La Jolla, CA) as instructed by the supplier. The selection primer
was located in
the pMyc-CPEB 5' -CCTCGAGGGGCGGGCCCGTACCCAATTCGCCC-3' (SEQ ID N0:9)
and changed a KpnI site to a SrfI site. This primer was used in conjunction
with the
following mutation primers to create new clones: Serine 174/180 to alanine
substitution
(PMyc-AA-CPEB) 5'-GCTCTCGATTGGACGCCCGGTCTATTTTGGATGCTCGCTCC-3'
(SEQ ID NO:10), and Serine 174/180 to aspartic acid substitution (pMyc-DD-
CPEB) 5'-
GCTCTCGATT GGACGATCGCTCTATTTTGGATGATCGCTCC-3'(SEQ ID NO:11).
The Histagged form of the mutant CPEBs was obtained by subclonning the NcoI-
BamHI
fragment of Pmyc-AA-CPEB and Pmyc-DD-CPEB in to the NcoI-and BarnHI sites of
pHis-CPEB (Stebbins-Boaz et al. EMBO J 15:2582-2592 (1997).
Messenger RNA encoding CPEB with the Ser174A1a and Ser180A1a was injected into
oocytes, which were also injected with a c-mos 3'UTR fragment to examine
polyadenylation.
While mRNA encoding wild type CPEB had no effect on progesterone-induced c-mos
RNA
polyadenylation, the mRNA encoding CPEB with the two alanine substitutions
(AA)
completely prevented the polyadenylation of this RNA. Moreover, the injection
of this
mutant CPEB mRNA also prevented endogenous Mos synthesis, as well as oocyte
maturation. The data demonstrated that the activation of CPEB requires Ser174
phosphorylation.
While the alanine substitutions caused CPEB to act in a dominant negative
fashion,
the effect of permanent negative charges in the 174 and 180 positions caused
CPEB to act as
a dominant gain-of function mutant. Ser174Asp and Ser180Asp CPEB mutations
were
constructed, and mRNA encoding this protein was injected into oocytes. In
oocytes
incubated in the absence of progesterone, mRNA encoding wild type CPEB did not
induce
- 18 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
the polyadenylation of c-mos RNA. However, mRNA encoding CPEB with the two Asp
substitutions (DD) stimulated the polyadenylation of this RNA in the absence
of
progesterone. While this polyadenylation was not as robust as that observed in
oocytes
incubated with progesterone, it was sufficient to induce detectable levels of
endogenous Mos
accumulation and a very high incidence of oocyte maturation. The data
demonstrated that
CPEB phosphorylation was sufficient to trigger cytoplasmic polyadenylation and
subsequent
signaling cascades that result in meiotic progression.
Example 4: Role of Kinase Eg2
Whether Eg2 could be responsible for the phosphorylation of CPEB Serl74 was
determined. Baculovirus-expressed Eg2 (NIH accession number 217206)
phosphorylated the
same tryptic peptide of recombinant CPEB in vitro (Ppl) as was phosphorylated
in vivo
during progesterone-stimulated oocyte maturation. Moreover, the Ser174A1a and
Ser180A1a
mutant CPEB, which was not phosphorylated in egg extracts, was also not
phosphorylated by
Eg2, suggesting that the regulatory Ser174 residue was a target of this
kinase. In addition, an
ovalbumin-linked peptide corresponding to amino acids 163-181 of CPEB of SEQ
ID N0:2,
which included the motif present in Ppl (ova-pep), was phosphorylated in vitro
using egg
extract or purified recombinant Eg2. This peptide was also able to compete for
the
phosphorylation of CPEB by Eg2. Finally, the injection of this ovalbumin-
linked peptide
into oocytes delayed progesterone-induced maturation, as would be expected of
a competitive
inhibitor of CPEB phosphorylation. The data indicated that Eg2 is the
regulatory kinase
responsible for the phosphorylation and activation of CPEB.
In subsequent experiments, E. coli-expressed histidine-tagged CPEB bound to
Xenopus oocyte Eg2, when oocyte extract was applied to a column containing His-
CPEB.
Example 5: Cancer Therapy
The blocking polypeptides are useful for inhibiting cancer growth. To evaluate
the
role of the blocking polypeptides in prostate cancer progression, the blocking
polypeptides
are administered to a transgenic adenocarcinoma mouse prostate (TRAMP) model
(see, e.g.,
U.S. Patent No. 5,907,078). More particularly, sixty 12-week-old male TRAMP
mice are
- 19 -
CA 02379863 2002-O1-18
WO 01/07466 PCT/US00/20254
placed randomly into two groups. The animals are treated by daily oral gavage
with vehicle
(1% water) or blocking polypeptides for 18-weeks. Following this time period,
the prostate
lobes, seminal vesicles, lungs, and periaortic lymph nodes are preserved and
sectioned for
histological evaluation. Growth of cancerous prostate cells is assessed and
compared in test
and control mice.
Other Embodiments
It is to be understood that while the invention has been described in
conjunction with
the detailed description thereof, the foregoing description is intended to
illustrate and not
limit the scope of the invention, which is defined by the scope of the
appended claims. Other
aspects, advantages, and modifications are within the scope of the following
claims.
We claim:
- 20 -
