Note: Descriptions are shown in the official language in which they were submitted.
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
METHOD OF CORRELATING SEQUENCE FUNCTION BY TRANSFECTING A
NUCLEIC ACID SEQUENCE OF A DONOR ORGANISM INTO A PLANT HOST
IN AN ANTI-SENSE OR POSITIVE SENSE ORIENTATION
This application claims priority to U.S. Application Serial Nos. 09/359,301,
09/359,305, 09/359,297, and 09/359,300, all filed on July 21, 1999.
FIELD OF THE INVENTION
The present invention relates generally to the field of molecular biology and
genetics.
Specifically, the present invention relates to a method for correlating the
function of a host
organism derived nucleic acid sequence by a transient expression of the
nucleic acid
sequence in an antisense or positive sense orientation in a plant host.
BACKGROUND OF THE INVENTION
Great interest exists in launching genome projects in human and non-human
genome
project. The human genome has between 2.8 million and 3.~ million base pairs,
about 3
percent of which are made of genes. In June 2000, the Human Genome Project and
biotech
company Celera Genomics announced that a rough draft of the human genome has
been
completed (http://www.ncbi.nlm.nih.gov). This information, however, will only
represent a
reference sequence of the human genome. The remaining task lies in the
determination of
sequence functions, which are important for the study, diagnosis, and
treatment of human
diseases.
The Mouse genome is also being sequenced. Genbank provides about 1.2% of the 3-
billion-base mouse genome (http~/hvww.informatics.'a~ x.or~.l and a rough
draft of the mouse
genome is expected to be available by 2003 and a finished genome by 2005. In
addition, the
Drosophila Genome Project has recently been completely
(http:/hvww.fruitfly.org).
Valuable and basic agricultural plants, including corn, soybeans and rice are
also
targets for genome projects because the information obtained thereby may prove
very
beneficial for increasing world food production and improving the quality and
value of
agricultural products. The United States Congress is considering launching a
corn genome
project. By helping to unravel the genetics hidden in the corn genome, the
project could aid
in understanding and combating common diseases of grain crops. It could also
provide a big
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
boost for efforts to engineer plants to improve grain yields and resist
drought, pests, salt, and
other extreme environmental conditions. Such advances are critical for a world
population
expected to double by 200. Currently, there are four species which provide 60%
of all
human food: wheat, rice, corn, and potatoes, and the strategies for increasing
the
productivity of these plants is dependent on rapid discovery of the presence
of a trait in these
plants, and the function of unknown gene sequences in these plants.
One strategy that has been proposed to assist in such efforts is to create a
database of
expressed sequence tags (ESTs) that can be used to identify expressed genes.
Accumulation
and analysis of expressed sequence tags (ESTs) have become an important
component of
genome research. EST data may be used to identify gene products and thereby
accelerate
gene cloning. Various sequence databases have been established in an effort to
store and
relate the tremendous amount of sequence information being generated by the
ongoing
sequencing efforts. Some have suggested sequencing 500,000 ESTs for corn and
100,000
ESTs each for rice, wheat, oats, barley, and sorghum. Efforts at sequencing
the genomes of
plant species will undoubtedly rely upon these computer databases to share the
sequence
data as it is generated. Arabidopsis thaliana may be an attractive target
discovery of a trait
and for gene function discovery because a very large set of ESTs have already
been
produced in this organism, and these sequences tag more than 50% of the
expected
Arabidopsis genes.
Potential use of the sequence information so generated is enormous if gene
function
can be determined. It may become possible to engineer commercial seeds for
agricultural
use to convey any number of desirable traits to food and fiber crops and
thereby increase
agricultural production and the world food supply. Research and development of
commercial seeds has so far focused primarily on traditional plant breeding,
however there
has been increased interest in biotechnology as it relates to plant
characteristics. Knowledge
of the genomes involved and the function of genes contained therein for both
monocotyledonous and dicotyledonous plants is essential to realize positive
effects from
such technology.
The impact of genomic research in seeds is potentially far reaching. For
example,
gene profiling in cotton can lead to an understanding of the types of genes
being expressed
primarily in fiber cells. The genes or promoters derived from these genes may
be important
2
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
in genetic engineering of cotton fiber for increased strength or for "built-
in" fiber color. In
plant breeding, gene profiling coupled to physiological trait analysis can
lead to the
identification of predictive markers that will be increasingly important in
marker assisted
breeding programs. Mining the DNA sequence of a particular crop for genes
important for
yield, quality, health, appearance, color, taste, etc., are applications of
obvious importance
for crop improvement.
Work has been conducted in the area of developing suitable vectors for
expressing
foreign DNA and RNA in plant and animal hosts. Ahlquist, U.S. Patent Nos.
4,885,248 and
5,173,410 describes preliminary work done in devising transfer vectors which
might be
useful in transferring foreign genetic material into a plant host for the
purpose of expression
therein. Additional aspects of hybrid RNA viruses and RNA transformation
vectors are
described by Ahlquist et al. in U.S. Patent Nos. 5,466,788, 5,602,242,
5,627,060 and
5,500,360. Donson et al., U.S. Patent Nos. 5,316,931, 5,589,367 and 5,866,785
demonstrate
for the first time plant viral vectors suitable for the systemic expression of
foreign genetic
material in plants. Donson et al. describe plant viral vectors having
heterologous
subgenomic promoters for the systemic expression of foreign genes. Carrington
et al., U.S.
Patent 5,491,076, describe particular potyvirus vectors also useful for
expressing foreign
genes in plants. The expression vectors described by Carrington et al. are
characterized by
utilizing the unique ability of viral polyprotein proteases to cleave
heterologous proteins
from viral polyproteins. These include Potyviruses such as Tobacco Etch Virus.
Additional
suitable vectors are described in U.S. Patent No. 5,811,653 and U.S. Patent
Application
Serial No. 081324,003. Condreay et al., (Proc. Natl. Acad. Sci. USA 96:127-
132) disclose
using baculoviruses to deliver and express gene efficiently in cells types of
human, primate
and rodent origin. Price et al., (Proc. Natl. Acad. Sci. USA 93:9465-9570
(1996)) disclose
infecting insect, plant and mammalian cells with Nodaviruses.
Construction of plant RNA viruses for the introduction and expression of non-
viral
foreign genes in plants has also been demonstrated by Brisson et al., Methods
in Enzymology
118:659 (1986), Guzman et al., Communications in Molecular Biology: Viral
Vectors, Cold
Spring Harbor Laboratory, pp. 172-189 (1988), Dawson et al., Virology 172:285-
292 (1989),
Takamatsu et al., EMBO J. 6:307-311 (1987), French et al., Science 231:1294-
1297 (1986),
and Takamatsu et al., FEBSLetters 269:73-76 (1990). However, these viral
vectors have
3
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
not been shown capable of systemic spread in the plant and expression of the
non-viral
foreign genes in the majority of plant cells in the whole plant. Moreover,
many of these
viral vectors have not proven stable for the maintenance of non-viral foreign
genes.
However, the viral vectors described by Donson et al., in U.S. Patent Nos.
5,316,931,
5,589,367, and 5,866,785, Turpen in U.S. Patent No. 5,811,653, Carrington et
al. in U.S.
Patent No. 5,491,076, and in co-pending U.S. Patent Application Serial No.
08/324,003,
have proven capable of infecting plant cells with foreign genetic material and
systemically
spreading in the plant and expressing the non-viral foreign genes contained
therein in plant
cells locally or systemically. Morsy et al., (Proc. Natl. Acad. Sci. USA,
95:7866-7871
(1998)) develop a helper-dependent adenoviral vectors having up to 37Kb insert
capacity
and being easily propagated.
With the recent advent of technology for cloning, genes can be selectively
turned off.
One method is to create antisense RNA or DNA molecules that bind specifically
with a
targeted gene's RNA message, thereby interrupting the precise molecular
mechanism that
expresses a gene as a protein. The antisense technology which deactivates
specific genes
provides a different approach from a classical genetics approach. Classical
genetics usually
studies the random mutations of all genes in an organism and selects the
mutations
responsible for specific characteristics. Antisense approach starts with a
cloned gene of
interest and manipulates it to elicit information about its function.
The expression of virus-derived positive sense or antisense RNA in transgenic
plants
provides an enhanced or reduced expression of an endogenous gene. In most
cases,
introduction and subsequent expression of a transgene will increase (with a
positive sense
RNA) or decrease (with an antisense RNA) the steady-state level of a specific
gene product
(Curr. Opin. Cell Biol. 7: 399-405 (1995)). There is also evidence that
inhibition of
endogenous genes occurs in transgenic plants containing sense RNA (Van der
Krol et al.,
Plant Cell 2(4):291-299 (1990), Napoli et al., Plant Cell 2:279-289 (1990) and
Fray et al.,
Plant Mol. Biol. 22:589-602 (1993)).
Post-transcriptional gene silencing (PTGS) in transgenic plants is the
manifestation
of a mechanism that suppresses RNA accumulation in a sequence-specific manner.
There
are three models to account for the mechanism of PTGS: direct transcription of
an antisense
RNA from the transgene, an antisense RNA produced in response to over
expression of the
4
CA 02380330 2002-O1-21
WO 01/07600 PCT/CTS00/20261
transgene, or an antisense RNA produced in response to the production of an
aberrant sense
RNA product of the transgene (Baulcombe, Plant Mol. Biol. 32:79-88 (1996)).
The
posttranscriptional gene silencing mechanism is typified by the highly
specific degradation
of both the transgene mRNA and the target RNA, which contains either the same
or
complementary nucleotide sequences. In cases that the silencing transgene is
the same sense
as the target endogenous gene or viral genomic RNA, it has been suggested that
a plant-
encoded RNA-dependent RNA polymerise makes a complementary strand from the
transgene mRNA and that the small cRNAs potentiate the degradation of the
target RNA.
Antisense RNA and the hypothetical cRNAs have been proposed to act by
hybridizing with
the target RNA to either make the hybrid a substrate for double-stranded (ds)
RNases or
arrest the translation of the target RNA (Baulcombe, Plant Mol. Biol. 32: 79-
88 (1996)). It
is also proposed that this downregulation or "co-suppression" by the sense RNA
might be
due to the production of antisense RNA by readthrough transcription from
distal promoters
located on the opposite strand of the chromosomal DNA (Grierson et al., Trends
Biotechnol.
9:122-123 (1993)).
Waterhouse et al (Proc. Natl. Acid. Sci. USA. 10: 13959-64 (1998)) prepared
transgenic tobacco plants containing sense or antisense constructs. Pro[s] and
Pro[a/s]
constructs contained the PVI' nuclear inclusion Pro ORF in the sense and
antisense
orientations, respectively. The Pro[s]-stop construct contained the PVY Pro
ORF in the
sense orientation but with a stop codon three codons downstream from the
initiation codon.
Waterhouse et al show when the genes of those constructs were transformed into
plants, the
plants exhibited immunity to the virus form which the transgene was derived.
Smith et al
(Plant Cell, 6: 1441-1453, (1994)) prepared a tobacco transgenic plant
containing the potato
virus Y (PVY) coat protein (CP) open reading frame, which produced an mRNA
rendered
untranslatable by introduction of a stop codon immediately after the
initiation codon. The
expression of the untranslatable sense RNA inversely correlated with the virus
resistance of
the transgenic plant. Kumagai et al (Proc. Natl. Acid. Sci. USA 92:1679
(1995)) report that
gene expression in transfected Nicotiana benthamiana was cytoplasmic inhibited
by viral
delivery of a RNA of a known sequence derived from cDNA encoding tomato
(lycopersicon
esculentum) phytoene desaturase in a positive sense or an antisense
orientation.
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
The antisense sense and positive sense technology can be used to develop a
functional genomic screening of a donor organism from Monera, Protisca, Fungi,
Plantae or
Animalia. The present invention provides a method of detecting the presence of
a trait in a
plant host and determining the function and sequence of a nucleic acid of a
donor organism
by expressing the nucleic acid sequence in the plant host. GTP-binding
proteins exemplify
this invention. In eukaryotic cells, GTP-binding proteins function in a
variety of cellular
processes, including signal transduction, cytoskeletal organization, and
protein transport.
Low molecular weight (20-25 K Daltons) of GTP-binding proteins include ras and
its close
relatives (for example, Ran), rho and its close relatives, the rab family, and
the ADP-
ribosylation factor (ARF) family. The heterotrimeric and monomeric GTP-binding
proteins
that may be involved in secretion and intracellular transport are divided into
two structural
classes: the rab and the ARF families. Ran, a small soluble GTP-binding
protein, has been
shown to be essential for the nuclear translocation of proteins and it is also
thought to be
involved in regulating cell cycle progression in mammalian and yeast cells.
The cDNAs
encoding GTP binding proteins have been isolated from a variety of plants
including rice,
barley, corn, tobacco, and A. thaliana. For example, Verwoert et al. (Plant
Molecular Biol.
27:629-633 (1995)) report the isolation of a Zea mat's cDNA clone encoding a
GTP-binding
protein of the ARF family by direct genetic selection in an E. coli fabD
mutant with a maize
cDNA expression library. Regad et al. (FEBS 2:133-136 (1993)) isolated a cDNA
clone
encoding the ARF from a cDNA library of Arabidopsis thaliana cultured cells by
randomly
selecting and sequencing cDNA clones. Dallmann et al. (Plant Molecular Biol.
19:847-857
(1992)) isolated two cDNAs encoding small GTP-binding proteins from leaf cDNA
libraries
using a PCR approach. Dallmann et al. prepared leaf cDNAs and use them as
templates in
PCR amplifications with degenerated oligonucleotides corresponding to the
highly
conserved motifs, found in members of the ras superfamily, as primers. Haizel
et al., (Plant
J., 11:93-103 (1997)) isolated cDNA and genomic clones encoding Ran-like small
GTP
binding proteins from Arabidopsis cDNA and genomic libraries using a full-
length tobacco
Nt Ran 1 cDNA as a probe. The present invention provides advantages over the
above
methods in identifying nucleic acid sequence encoding GTP binding proteins in
that it only
sequences clones that have a function and does not randomly sequence clones.
The nucleic
6
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
acid inserts in clones that have a function are labeled and used as probes to
isolate a cDNA
hybridizing to them.
The present invention provides a method for detecting the presence of a trait
in a
plant host by expressing a donor organism derived nucleic acid sequence in an
antisense or
positive orientation in the plant host. Once the presence of a trait is
identified by phenotypic
changes, the nucleic acid insert in the cDNA clone or in the vector is then
sequenced. The
present method provides a rapid method for determining the presence of a trait
and a method
for identifying a nucleic acid sequence and its function in a plant host by
screening
phenotypic or biochemical changes in the plant host transfected with a nucleic
acid
sequence of the donor organism.
SUMMARY OF THE INVENTION
The present invention essentially involves the steps of ( 1 ) introducing into
a viral
vector a library of host organism derived sequence inserts in a positive or
antisense
orientation; (2) expressing each insert in a plant host, and (3) detecting
phenotypic or
biochemical changes of the plant host as a result of the expression. A plant
host may be a
monocotyledonous or dicotyledonous plant, plant tissue or plant cell. Donor
organisms
include species from Monera, Protista, Fungi, Plantae, or Animalia kingdom,
such as
human, mouse, drosophila, etc. If the donor organism is also a plant, the
donor plant and the
host plant typically belong to different genus, family, order, class,
subdivision, or division.
The function of sequence inserts in the library is typically unknown. The
number of
sequence inserts in a library is typically larger than about 10, 15, 20, 50,
100, 200, 500,
1000, 5000, or 15,000, etc. The length of each insert is typically longer than
about 50, 100,
200, or 500 base pairs.
More specifically, the present invention is directed to a method of changing
the
phenotype or biochemistry of a plant host, a method of determining a change in
phenotype
or biochemistry in a plant host, and a method of determining the presence of a
trait in a plant
host. The method comprises the steps of expressing transiently a nucleic acid
sequence of a
donor organism in an antisense or positive sense orientation in a plant host,
identifying
changes in the plant host, and correlating the sequence expression with the
phenotypic or
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
biochemical changes. The nucleic acid sequence does not need to be isolated,
identified, or
characterized prior to transfection into the host organism.
The present invention is also directed to a method of making a functional gene
profile by transiently expressing a nucleic acid sequence library in a host
organism,
determining the phenotypic or biochemical changes in the plant host,
identifying a trait
associated with the change, identifying the donor gene associated with the
trait, identifying
the homologous host gene, if any, and annotating the sequence with its
associated phenotype
or function.
The present invention is also directed to a method of determining the function
of a
nucleic acid sequence, including a gene, in a donor organism, by transfecting
the nucleic
acid sequence into a plant host in a manner so as to affect phenotypic or
biochemical
changes in the plant host. In one embodiment, recombinant viral nucleic acids
are prepared
to include the nucleic acid insert of a donor. The recombinant viral nucleic
acids infect a
plant host and produce antisense or positive sense RNAs in the cytoplasm which
result in a
reduced or enhanced expression of endogenous cellular genes in the host
organism. Once
the presence of a trait is identified by phenotypic or biochemical changes,
the function of the
nucleic acid is determined. The nucleic acid insert in a cDNA clone or in a
vector is then
sequenced. The nucleic acid sequence is determined by a standard sequence
analysis.
One aspect of the invention is a method of identifying and determining a
nucleic acid
sequence in a donor organism, whose function is to silence endogenous genes in
a plant host,
by introducing the nucleic acid into the plant host by way of a viral nucleic
acid suitable to
produce expression of the nucleic acid in the transfected plant. This method
utilizes the
principle of post-transcription gene silencing of the endogenous host gene
homologue, for
example, antisense RNAs, or positive sense RNAs. Particularly, this silencing
function is
useful for silencing a multigene family in a donor organism. In addition, the
overexpressioin of a plus sense RNA that results in overproduction of a
protein may cause
phenotypical or biochemical changes in a host.
Another aspect of the invention is to discover genes in a donor organism
having the
same function as that in a plant host. The method starts with building a cDNA
library, or a
genomic DNA library, or a pool of RNA of a donor organism, for example, from
tissues or
cells of human, mouse, or drosophila. Then, a recombinant viral nucleic acid
comprising a
8
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
nucleic acid insert derived from the library is prepared and is used to infect
a plant host. The
infected plant host is inspected for phenotypic or biochemical changes. The
recombinant
viral nucleic acid that results in phenotypic or biochemical changes in the
plant host is
identified and the sequence of the nucleic acid insert is determined by a
standard method.
Such nucleic acid sequence in the donor organism may have substantial sequence
homology
as that in the plant host, e.g. the nucleic acid sequences are conserved
between the donor and
plant host. Once the nucleic acid is sequenced, it can be labeled and used as
a probe to
isolate full-length cDNAs from the donor organism. This invention provides a
rapid means
for elucidating the function and sequence of nucleic acids of a donor
organism; such rapidly
expanding information can be subsequently utilized in the field of genomics.
Another aspect of the instant invention is directed to a method of increasing
yield of
a grain crop. The method comprises expressing transiently a nucleic acid
sequence of a
donor plant in an antisense or positive sense orientation in a grain crop,
wherein said
expressing results in stunted growth and increased seed production of the
grain crop. A
preferred method comprises the steps of cloning the nucleic acid sequence into
a plant viral
vector and infecting the grain crop with a recombinant viral nucleic acid
comprising said
nucleic acid sequence.
Another aspect of the invention is to discover genes having the same function
in
different plants. The method starts with a library of cDNAs, genomic DNAs, or
a pool of
RNAs of a first plant. Then, a recombinant viral nucleic acid comprising a
nucleic acid
insert derived from the library is prepared and is used to infect a different
host plant. The
infected host plant is inspected for phenotypic or biochemical changes. The
recombinant
viral nucleic acid that results in phenotypic or biochemical changes in the
host plant is
identified and the sequence of the nucleic acid insert is determined by a
standard method.
Such nucleic acid sequence in the first plant has substantial sequence
homology as that in the
host plant: the nucleic acid sequences are conserved between the two plants.
This invention
provides a rapid means for elucidating the function and sequence of nucleic
acids of interest;
such rapidly expanding information can be subsequently utilized in the field
of genomics.
Another aspect of the present invention is to produce human proteins in a
plant host.
After nucleic acids of similar functions from a human and a host plant are
isolated and
identified, the amino acid sequences derived from the DNAs are compared. The
plant
9
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
nucleic acid sequence is changed so that it encodes the same amino acid
sequence as the
human protein. The nucleic acid sequence can be changed according to any
conventional
methods, such as, site directed mutagenesis or polymerase based DNA synthesis.
Plant hosts include plants of commercial interest, such as food crops, seed
crops, oil
crops, ornamental crops and forestry crops. For example, wheat, rice, corn,
potatoes, barley,
tobaccos, soybean canola, maize, oilseed rape, Arabidopsis, Nicotiana can be
selected as a
host plant. In particular, host plants capable of being infected by a virus
containing a
recombinant viral nucleic acid are preferred.
A plant viral vector may comprise a native or non-native subgenomic promoter,
a
coat protein coding sequence, and at least one non-native nucleic acid
sequence. Some viral
vectors used in accordance with the present invention may be encapsidated by
the coat
proteins encoded by the recombinant virus. The recombinant viral nucleic acid
is capable of
replication in the plant host, and transcription or expression of the non-
native nucleic acid in
the plant host to produce a phenotypic or biochemical change. Any suitable
vector
constructs useful to produce localized or systemic expression of nucleic acids
in a plant host
are within the scope of the present invention.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 depicts the plasmid pBS #735
FIG. 2 depicts the plasmid pBS #740.
FIG. 3 depicts the plasmid TTUS 1 A QSEO #3.
FIG. 4 depicts the plasmid TTOIA/Ca CCS+.
FIG. S depicts the plasmid TTO1/PSY+.
FIG. 6 depicts the plasmid TTO1/PDS+.
FIG. 7 depicts a Monocot Viral Vector
FIG. 8 depicts the plasmid TTU51 CTP CrtB.
FIG. 9 depicts the plasmid pBS 740 AT #2441 (ATCC No: PTA-332).
FIG. 10 depicts the nucleotide sequence of 740 AT #2441.
FIG. 11 depicts the nucleotide sequence comparison of 740 AT #2441 and
AF017991.
FIG. 12 depicts the nucleotide sequence comparison of 740 AT #2441 and L16787.
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
FIG. 13 depicts the amino acid sequence comparison of 740 AT #2441 and RAN-B 1
GTP binding proteW .
FIG. 14 depicts the plasmid pBS 740 AT #120 (ATCC No: PTA-325).
FIG. 15 shows the nucleotide sequence comparison ofA. thaliana 740 AT #120 and
A. thaliana est AA042085
FIG. 16 shows the nucleotide sequence alignment of 740 AT #120 to rice D17760
(Oryza sativa) ADP-ribosylation factor.
FIG. 17 shows the nucleotide sequence alignment of 740 AT #120 to human ADP-
ribosylation factor P16587.
FIG. 18 shows the nucleotide sequence alignment of humanized sequence 740 AT
#120 H to human ADP-ribosylation factor M33384.
FIG. 19 shows the plasmid KS+ Nb ARF #3 (ATCC No: PTA-324).
FIG. 20 shows the nucleotide sequence comparison ofA. thaliana 740 AT #120 and
N. benthamiana KS+ Nb ARF#3.
FIG. 21 shows a Tobacco Rattle Virus gene silencing vector.
FIG. 22 shows the plasmid pBS #740 AT #88 (ATCC No: PTA-331).
FIG. 23 shows the sequence of 740 AT #88.
FIG. 24 shows the nucleotide sequence comparison of AT #88 and Brassica rapa
L35812.
FIG. 25 shows the nucleotide sequence comparison of AT #88 and Octopus
Rhodopsin X07797.
FIG. 26 shows the nucleotide sequence comparison of AT #88 and Octopus
Rhodopsin P31356.
FIG. 27 shows the plasmid pBS #377 (ATCC No: PTA-334).
FIG. 28 shows the nucleotide sequence of 740 AT #377.
FIG. 29 shows the plasmid pBS #2483 (ATCC No: PTA-329).
FIG. 30 shows the nucleotide sequence of 740 AT #2483.
FIG. 31 shows the plasmid pBS 740 AT #909 (ATCC No: PTA-330).
FIG. 32 shows the nucleotide sequence comparison of AT #909 and Ribosomal
protein L19 from breast cancer cell line.
FIG. 33 shows the nucleotide sequence comparison of AT #909 and L19 P14118 60S
11
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
ribosomal protein L19.
FIG. 34 shows the plasmid pBS AT #855 (ATCC No: PTA-325).
FIG. 35 shows the nucleotide sequence comparison of AT #855 and HAT7
homeobox protein ORF.
DETAILED DESCRIPTION OF THE INVENTION
The present invention essentially involves the steps of (1) introducing into a
viral
vector a library of host organism derived sequence inserts in a positive or
antisense
orientation; (2) expressing each insert in a plant host, and (3) detecting
phenotypic or
biochemical changes of the plant host as a result of the expression. A plant
host may be a
monocotyledonous or dicotyledonous plant, plant tissue or plant cell. Donor
organisms
include species from Monera, Protista, Fungi, Plantae, or Animalia kingdom,
such as
human, mouse, drosophila, etc. If the donor organism is also a plant, the
donor plant and the
host plant typically belong to different genus, family, order, class,
subdivision, or division.
The function of sequence inserts in the library is typically unknown. The
number of
sequence inserts in a library is typically larger than about 10, 15, 20, 50,
100, 200, 500,
1000, 5000, or 15,000, etc. The length of each insert is typically longer than
about 50, 100,
200, or 500 base pairs.
More specifically, the present invention is directed to a method of changing
the
phenotype or biochemistry of a plant host, a method of determining a change in
phenotype
or biochemistry in a plant host, and a method of determining the presence of a
trait in a plant
host. The method comprises the steps of expressing transiently a nucleic acid
sequence of a
donor organism in an antisense or positive sense orientation in a plant host,
identifying
changes in the plant host, and correlating the sequence expression with the
phenotypic or
biochemical changes. The nucleic acid sequence does not need to be isolated,
identified, or
characterized prior to transfection into the host organism.
The present invention is also directed to a method of making a functional gene
profile by transiently expressing a nucleic acid sequence library in a host
organism,
determining the phenotypic or biochemical changes in the plant host,
identifying a trait
associated with the change, identifying the donor gene associated with the
trait, identifying
12
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
the homologous host gene, if any, and annotating the sequence with its
associated phenotype
or function.
The present invention is also directed to a method of determining the function
of a
nucleic acid sequence, including a gene, in a donor organism, by transfecting
the nucleic
acid sequence into a plant host in a manner so as to affect phenotypic or
biochemical
changes in the plant host. In one embodiment, recombinant viral nucleic acids
are prepared
to include the nucleic acid insert of a donor. The recombinant viral nucleic
acids infect a
plant host and produce antisense or positive sense RNAs in the cytoplasm which
result in a
reduced or enhanced expression of endogenous cellular genes in the host
organism. Once
the presence of a trait is identified by phenotypic or biochemical changes,
the function of the
nucleic acid is determined. The nucleic acid insert in a cDNA clone or in a
vector is then
sequenced. The nucleic acid sequence is determined by a standard sequence
analysis.
One aspect of the invention is a method of identifying and determining a
nucleic acid
sequence in a donor organism, whose function is to silence endogenous genes in
a plant host,
by introducing the nucleic acid into the plant host by way of a viral nucleic
acid suitable to
produce expression of the nucleic acid in the transfected plant. This method
utilizes the
principle of post-transcription gene silencing of the endogenous host gene
homologue, for
example, antisense RNAs, or positive sense RNAs. Particularly, this silencing
function is
useful for silencing a multigene family in a donor organism. In addition, the
overexpressioin of a plus sense RNA that results in overproduction of a
protein may cause
phenotypical or biochemical changes in a host.
Another aspect of the invention is to discover genes in a donor organism
having the
same function as that in a plant host. The method starts with building a cDNA
library, or a
genomic DNA library, or a pool of RNA of a donor organism, for example, from
tissues or
cells of human, mouse, or drosophila. Then, a recombinant viral nucleic acid
comprising a
nucleic acid insert derived from the library is prepared and is used to infect
a plant host. The
infected plant host is inspected for phenotypic or biochemical changes. The
recombinant
viral nucleic acid that results in phenotypic or biochemical changes in the
plant host is
identified and the sequence of the nucleic acid insert is determined by a
standard method.
Such nucleic acid sequence in the donor organism may have substantial sequence
homology
as that in the plant host, e.g. the nucleic acid sequences are conserved
between the donor and
13
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
plant host. Once the nucleic acid is sequenced, it can be labeled and used as
a probe to
isolate full-length cDNAs from the donor organism. This invention provides a
rapid means
for elucidating the function and sequence of nucleic acids of a donor
organism; such rapidly
expanding information can be subsequently utilized in the field of genomics.
Another aspect of the instant invention is directed to a method of increasing
yield of
a grain crop. The method comprises expressing transiently a nucleic acid
sequence of a
donor plant in an antisense or positive sense orientation in a grain crop,
wherein said
expressing results in stunted growth and increased seed production of the
grain crop. A
preferred method comprises the steps of cloning the nucleic acid sequence into
a plant viral
vector and infecting the grain crop with a recombinant viral nucleic acid
comprising said
nucleic acid sequence.
Another aspect of the present invention is directed to a method for producing
human
proteins in a plant host. After nucleic acids of similar functions from a
human and a host
plant are isolated and identified, the amino acid sequences derived from the
DNAs are
compared. The plant nucleic acid sequence is changed so that it encodes the
same amino
acid sequence as the human protein. The nucleic acid sequence can be changed
according to
any conventional methods, such as, site directed mutagenesis or polymerase
based DNA
synthesis.
Another aspect of the invention is to discover genes having the same function
in
different plants. The method starts with a library of cDNAs, genomic DNAs, or
a pool of
RNAs of a first plant. Then, a recombinant viral nucleic acid comprising a
nucleic acid
insert derived from the library is prepared and is used to infect a different
host plant. The
infected host plant is inspected for phenotypic or biochemical changes. The
recombinant
viral nucleic acid that results in phenotypic or biochemical changes in the
host plant is
identified and the sequence of the nucleic acid insert is determined by a
standard method.
Such nucleic acid sequence in the first plant has substantial sequence
homology as that in the
host plant: the nucleic acid sequences are conserved between the two plants.
This invention
provides a rapid means for elucidating the function and sequence of nucleic
acids of interest;
such rapidly expanding information can be subsequently utilized in the field
of genomics.
14
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
I. Introducing into a plant viral vector a librar~of sequence inserts from a
donor
organism.
The construction of viral expression vectors may use a variety of methods
known in
the art. In preferred embodiments of the instant invention, the viral vectors
are derived from
RNA plant viruses. A variety of plant virus families may be used, such as
Bromoviridae,
Bunyaviridae, Comoviridae, Geminiviridae, Potyviridae, and Tombusviridae,
among others.
Within the plant virus families, various genera of viruses may be suitable for
the instant
invention, such as alfamovirus, ilarvirus, bromovirus, cucumovirus,
tospovirus, carlavirus,
caulimovirus, closterovirus, comovirus, nepovirus, dianthovirus, furovirus,
hordeivirus,
luteovirus, necrovirus, potexvirus, potvvirus, rymovirus, bymovirus,
oryzavirus,
sobemovirus, tobamovirus, tobravirus, carmovirus, tombusvirus, tymovirus,
umbravirusa,
and among others.
Within the genera of plant viruses, many species are particular preferred.
They
include alfalfa mosaic virus, tobacco streak virus, brome mosaic virus, broad
bean mottle
virus, cowpea chlorotic mottle virus, cucumber mosaic virus, tomato spotted
wilt virus,
carnation latent virus, caulflower mosaic virus, beet yellows virus, cowpea
mosaic virus,
tobacco ringspot virus, carnation ringspot virus, soil-borne wheat mosaic
virus, tomato
golden mosaic virus, cassava latent virus, barley stripe mosaic virus, barley
yellow dwarf
virus, tobacco necrosis virus, tobacco etch virus, potato virus X, potato
virus Y, rice necrosis
virus, ryegrass mosaic virus, barley yellow mosaic virus, rice ragged stunt
virus, Southern
bean mosaic virus, tobacco mosaic virus, ribgrass mosaic virus, cucumber green
mottle
mosaic virus watermelon strain, oat mosaic virus, tobacco rattle virus,
carnation mottle
virus, tomato bushy stunt virus, turnip yellow mosaic virus, carrot mottle
virus, among
others. In addition, RNA satellite viruses, such as tobacco necrosis satellite
may also be
employed.
A given plant virus may contain either DNA or RNA, which may be either single-
or
double-stranded. One example of plant viruses containing double-stranded DNA
includes,
but not limited to, caulimoviruses such as cauliflower mosaic virus (CaMV).
Representative
plant viruses which contain single-stranded DNA are cassava latent virus, bean
golden
mosaic virus (BGMV), and chloris striate mosaic virus. Rice dwarf virus and
wound tumor
virus are examples of double-stranded RNA plant viruses. Single-stranded RNA
plant
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
viruses include tobacco mosaic virus (TMV), turnip yellow mosaic virus (TYMV),
rice
necrosis virus (RNV) and brome mosaic virus (BMV). The single-stranded RNA
viruses
can be further divided into plus sense (or positive-stranded), minus sense (or
negative-
stranded), or ambisense viruses. The genomic RNA of a plus sense RNA virus is
messenger
sense, which makes the naked RNA infectious. Many plant viruses belong to the
family of
plus sense RNA viruses. They include, for example, TMV, BMV, and others. RNA
plant
viruses typically encode several common proteins, such as replicase/polymerase
proteins
essential for viral replication and mRNA synthesis, coat proteins providing
protective shells
for the extracellular passage, and other proteins required for the cell-to-
cell movement,
systemic infection and self assembly of viruses. For general information
concerning plant
viruses, see Matthews, Plant Virology, 3'~ Ed., Academic Press, San Diego
(1991).
Selected groups of suitable plant viruses are characterized below. However,
the
invention should not be construed as limited to using these particular
viruses, but rather the
method of the present invention is contemplated to include all plant viruses
at a minimum.
However, the invention should not be construed as limited to using these
particular viruses,
but rather the present invention is contemplated to include all suitable
viruses. Some
suitable viruses are characterized below.
TOBAMOVIRUS GROUP
The tobacco mosaic virus (TMV) is of particular interest to the instant
invention
because of its ability to express genes at high levels in plants. TMV is a
member of the
tobamovirus group. The TMV virion is a tubular filament, and comprises coat
protein sub-
units arranged in a single right-handed helix with the single-stranded RNA
intercalated
between the turns of the helix. TMV infects tobacco as well as other plants.
TMV virions
are 300 nm x 18 nm tubes with a 4 nm-diameter hollow canal, and consist of
2140 units of a
single structural protein helically wound around a single RNA molecule. The
genome is a
6395 base plus-sense RNA. The 5'-end is capped and the 3'-end contains a
series of
pseudoknots and a tRNA-like structure that will specifically accept histidine.
The genomic
RNA functions as mRNA for the production of proteins involved in viral
replication: a 126-
kDa protein that initiates 68 nucleotides from the 5'-terminus, and a 183-kDa
protein
synthesized by readthrough of an amber termination codon approximately 10% of
the time.
Only the 183-kDa and 126-kDa viral proteins are required for the TMV
replication in trans.
16
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
(Ogawa et al., Virology 185:580-584 (1991)). Additional proteins are
translated from
subgenomic size mRNA produced during replication (Dawson, Adv. Virus Res.,
38:307-342
(1990)). The 30-kDa protein is required for cell-to-cell movement; the 17.5-
kDa capsid
protein is the single viral structural protein. The function of the predicted
54-kDa protein is
unknown.
TMV assembly apparently occurs in plant cell cytoplasm, although it has been
suggested that some TMV assembly may occur in chloroplasts since transcripts
of ctDNA
have been detected in purified TMV virions. Initiation of TMV assembly occurs
by
interaction between ring-shaped aggregates ("discs") of coat protein (each
disc consisting of
two layers of 17 subunits) and a unique internal nucleation site in the RNA; a
hairpin region
about 900 nucleotides from the 3'-end in the common strain of TMV. Any RNA,
including
subgenomic RNAs containing this site, may be packaged into virions. The discs
apparently
assume a helical form on interaction with the RNA, and assembly (elongation)
then proceeds
in both directions (but much more rapidly in the 3'- to 5'- direction from the
nucleation site).
Another member of the Tobamoviruses, the Cucumber Green Mottle Mosaic virus
watermelon strain (CGMMV-W) is related to the cucumber virus. Nozu et al.,
Virology
45:577 (1971). The coat protein of CGMMV-W interacts with RNA of both TMV and
CGMMV to assemble viral particles in vitro. Kurisu et al., Virology 70:214
(1976).
Several strains of the tobamovirus group are divided into two subgroups, on
the basis
of the location of the assembly of origin. Subgroup I, which includes the
vulgare, OM, and
tomato strain, has an origin of assembly about 800-1000 nucleotides from the
3'-end of the
RNA genome, and outside the coat protein cistron. Lebeurier et al., Proc.
Natl. Acad. Sci.
USA 74:149 ( 1977); and Fukuda et al., Virology 101:493 ( 1980). Subgroup II,
which
includes CGMMV-W and cornpea strain (Cc) has an origin of assembly about 300-
500
nucleotides from the 3'-end of the RNA genome and within the coat-protein
cistron. The
coat protein cistron of CGMMV-W is located at nucleotides 176-661 from the 3'-
end. The
3' noncoding region is 175 nucleotides long. The origin of assembly is
positioned within
the coat protein cistron. Meshi et al., Virology 127:54 (1983).
17
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
BROME MOSAIC VIRUS GROUP
Brome Mosaic virus (BMV) is a member of a group of tripartite, single-
stranded,
RNA-containing plant viruses commonly referred to as the bromoviruses. Each
member of
the bromoviruses infects a narrow range of plants. Mechanical transmission of
bromoviruses occurs readily, and some members are transmitted by beetles. In
addition to
BV, other bromoviruses include broad bean mottle virus and cowpea chlorotic
mottle virus.
Typically, a bromovirus virion is icosahedral, with a diameter of about 26 pm,
containing a single species of coat protein. The bromovirus genome has three
molecules of
linear, positive-sense, single-stranded RNA, and the coat protein mRNA is also
encapsidated. The RNAs each have a capped 5'-end, and a tRNA-like structure
(which
accepts tyrosine) at the 3'-end. Virus assembly occurs in the cytoplasm. The
complete
nucleotide sequence of BMV has been identified and characterized as described
by Ahlquist
et al., J. Mol. Biol. 153:23 (1981).
RICE NECROSIS VIRUS
Rice Necrosis virus is a member of the Potato Virus Y Group or Potyviruses.
The
Rice Necrosis virion is a flexuous filament comprising one type of coat
protein (molecular
weight about 32,000 to about 36,000) and one molecule of linear positive-sense
single-
stranded RNA. The Rice Necrosis virus is transmitted by Polymyxa oraminis (a
eukaryotic
intracellular parasite found in plants, algae and fungi).
GEMIrIIVIRUSES
Geminiviruses are a group of small, single-stranded DNA-containing plant
viruses
with virions of unique morphology. Each virion consists of a pair of isometric
particles
(incomplete icosahedral), composed of a single type of protein (with a
molecular weight of
about 2.7-3.4X100. Each geminivirus virion contains one molecule of circular,
positive-
sense, single-stranded DNA. In some geminiviruses (i.e., Cassava latent virus
and bean
golden mosaic virus) the genome appears to be bipartite, containing two single-
stranded
DNA molecules.
18
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
POTYVIRUSES
Potyviruses are a group of plant viruses which produce polyprotein. A
particularly
preferred potyvirus is tobacco etch virus (TEV). TEV is a well characterized
potyvirus and
contains a positive-strand RNA genome of 9.5 kilobases encoding for a single,
large
polyprotein that is processed by three virus-specific proteinases. The nuclear
inclusion
protein "a" proteinase is involved in the maturation of several replication-
associated proteins
and capsid protein. The helper component-proteinase (HC-Pro) and 35-kDa
proteinase both
catalyze cleavage only at their respective C-termini. The proteolytic domain
in each of these
proteins is located near the C-terminus. The 35-kDa proteinase and HC-Pro
derive from the
N-terminal region of the TEV polyprotein.
HORDEIVIRUS GROUP
Hordeiviruses are a group of single-stranded, positive sense RNA-containing
plant
viruses with three or four part genomes. Hordeiviruses have rigid, rod-shaped
virions and
barley stripe mosaic virus (BSMV) is the type member. BSMV infects a large
number of
monocot and dicot species including barley, oat, wheat, corn, rice, , spinach,
and Nicotiana
benthamiana. Local lesion hosts include Chenopodium amaranticolor, and
Nicotiana
tabacum ccv. Samsun . BSMV is not vector transmitted but is mechanically
transmissable
and in some hosts, such as barley, is also transmitted through pollen and
seed.
Most strains of BSMV have three genomic RNAs refered to as alpha(a), beta
(~3),
and gamma (y), At least one strain, the Argentina mild (AM) strain has a
fourth geneomic
RNA that is essentially a deletion mutant of the g RNA. All genomic RNAs are
capped at
the 5' end and have tRNA-like structures at the 3' end. Virus replication and
assembly
occurs in the cytoplasm. The complete nucleotide sequence of several strains
of BSMV has
been identified and characterized (reviewed by Jackson, et al Annual Review of
Phytophathology 27:95-121 (1989)), and infectious cDNA clones are available
(Petty, et al.
Virology 171:342-349 (1989)).
The selection of the genetic backbone for the viral vectors of the instant
invention
may depend on the plant host used. The plant host may be a monocotyledonous or
dicotyledonous plant, plant tissue, or plant cell. Typically, plants of
commercial interest,
such as food crops, seed crops, oil crops, ornamental crops and forestry crops
are preferred.
19
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
For example, wheat, rice, corn, potato, barley, tobacco, soybean canola,
maize, oilseed rape,
lilies, grasses, orchids, irises, onions, palins, tomato, the legumes, or
Arabidopsis, can be
used as a plant host. Host plants may also include those readily infected by
an infectious
virus, such as Nicotiana, preferably, Nicotiana benthamiana, or Nicotiana
clevelandii.
One feature of the present invention is the use of plant viral nucleic acids
which
comprise one or more non-native nucleic acid sequences capable of being
transcribed in a
plant host. These nucleic acid sequences may be native nucleic acid sequences
that occur in
a host plant. Preferably, these nucleic acid sequences are non-native nucleic
acid sequences
that do not normally occur in a host plant. For example, the plant viral
vectors may contain
sequences from more than one virus, including viruses from more than one
taxonomic
group. The plant viral nucleic acids may also contain sequences from non-viral
sources,
such as foreign genes, regulatory sequences, fragments thereof from bacteria,
fungi, plants,
animals or other sources. These foreign sequences may encode commercially
useful
proteins, polypeptides, or fusion products thereof, such as enzymes,
antibodies, hormones,
pharmaceuticals, vaccines, pigments, antimicrobial polypeptides, and the like.
Or they may
be sequences that regulate the transcription or translation of viral nucleic
acids, package viral
nucleic acid, and facilitate systemic infection in the host, among others.
In some embodiments of the instant invention, the plant viral vectors may
comprise
one or more additional native or non-native subgenomic promoters which are
capable of
transcribing or expressing adjacent nucleic acid sequences in the plant host.
These non-
native subgenomic promoters are inserted into the plant viral nucleic acids
without
destroying the biological function of the plant viral nucleic acids using
known methods in
the art. For example, the CaMV promoter can be used when plant cells are to be
transfected.
The subgenomic promoters are capable of functioning in the specific host
plant. For
example, if the host is tobacco, TMV, tomato mosaic virus, or other viruses
containing
subgenomic promoter may be utilized. The inserted subgenomic promoters should
be
compatible with the TMV nucleic acid and capable of directing transcription or
expression
of adjacent nucleic acid sequences in tobacco. It is specifically contemplated
that two or
more heterologous non-native subgenomic promoters may be used. The non-native
nucleic
acid sequences may be transcribed or expressed in the host plant under the
control of the
subgenomic promoter to produce the products of the nucleic acids of interest.
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
In some embodiments of the instant invention, the recombinant plant viral
nucleic
acids may be further modified by conventional techniques to delete all or part
of the native
coat protein coding sequence or put the native coat protein coding sequence
under the
control of a non-native plant viral subgenomic promoter. If it is deleted or
otherwise
inactivated, a non-native coat protein coding sequence is inserted under
control of one of the
non-native subgenomic promoters, or optionally under control of the native
coat protein
gene subgenomic promoter. Thus, the recombinant plant viral nucleic acid
contains a coat
protein coding sequence, which may be native or a nonnative coat protein
coding sequence,
under control of one of the native or non-native subgenomic promoters. The
native or non-
native coat protein gene may be utilized in the recombinant plant viral
nucleic acid. The
non-native coat protein, as is the case for the native coat protein, may be
capable of
encapsidating the recombinant plant viral nucleic acid and providing for
systemic spread of
the recombinant plant viral nucleic acid in the host plant.
In some embodiments of the instant invention, recombinant plant viral vectors
are
constructed to express a fusion between a plant viral coat protein and the
foreign genes or
polypeptides of interest. Such a recombinant plant virus provides for high
level expression
of a nucleic acid of interest. The locations) where the viral coat protein is
joined to the
amino acid product of the nucleic acid of interest may be referred to as the
fusion joint. A
given product of such a construct may have one or more fusion joints. The
fusion joint may
be located at the carboxyl terminus of the viral coat protein or the fusion
joint may be
located at the amino terminus of the coat protein portion of the construct. In
instances where
the nucleic acid of interest is located internal with respect to the 5' and 3'
residues of the
nucleic acid sequence encoding for the viral coat protein, there are two
fusion joints. That
is, the nucleic acid of interest may be located 5', 3', upstream, downstream
or within the
coat protein. In some embodiments of such recombinant plant viruses, a "leaky"
start or
stop codon may occur at a fusion joint which sometimes does not result in
translational
termination.
In some embodiments of the instant invention, nucleic sequences encoding
reporter
proteins) or antibiotic/herbicide resistance genes) may be constructed as
carrier proteins)
for the polypeptides of interest, which may facilitate the detection of
polypeptides of
interest. For example, green fluorescent protein (GFP) may be simultaneously
expressed
21
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
with polypeptides of interest. In another example, a reporter gene, (3-
glucuronidase (GUS)
may be utilized. In another example, a drug resistance marker, such as a gene
whose
expression results in kanamycin resistance, may be used.
Since the RNA genome is typically the infective agent, the cDNA is positioned
adjacent a suitable promoter so that the RNA is produced in the production
cell. The RNA
is capped using conventional techniques, if the capped RNA is the infective
agent. In
addition, the capped RNA can be packaged in vitro with added coat protein from
TMV to
make assembled virions. These assembled virions can then be used to inoculate
plants or
plant tissues. Alternatively, an uncapped RNA may also be employed in the
embodiments
of the present invention. Contrary to the practiced art in scientific
literature and in issued
patent (Ahlquist et al., U.S. Patent No. 5,466,788), uncapped transcripts for
virus expression
vectors are infective on both plants and in plant cells. Capping is not a
prerequisite for
establishing an infection of a virus expression vector in plants, although
capping increases
the efficiency of infection. In addition, nucleotides may be added between the
transcription
start site of the promoter and the start of the cDNA of a viral nucleic acid
to construct an
infectious viral vector. One or more nucleotides may be added. In some
embodiments of
the present invention, the inserted nucleotide sequence may contain a G at the
5'-end.
Alternatively, the inserted nucleotide sequence may be GNN, GTN, or their
multiples,
(GNN)X or (GTN)x.
In some embodiments of the instant invention, more than one nucleic acid is
prepared for a multipartite viral vector construct. In this case, each nucleic
acid may require
its own origin of assembly. Each nucleic acid could be prepared to contain a
subgenomic
promoter and a non-native nucleic acid. Alternatively, the insertion of a non-
native nucleic
acid into the nucleic acid of a monopartite virus may result in the creation
of two nucleic
acids (i.e., the nucleic acid necessary for the creation of a bipartite viral
vector). This would
be advantageous when it is desirable to keep the replication and transcription
or expression
of the nucleic acid of interest separate from the replication and translation
of some of the
coding sequences of the native nucleic acid.
The recombinant plant viral nucleic acid may be prepared by cloning a viral
nucleic
acid. If the viral nucleic acid is DNA, it can be cloned directly into a
suitable vector using
conventional techniques. One technique is to attach an origin of replication
to the viral
22
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
DNA which is compatible with the cell to be transfected. In this manner, DNA
copies of the
chimeric nucleotide sequence are produced in the transfected cell. If the
viral nucleic acid is
RNA, a DNA copy of the viral nucleic acid is first prepared by well-known
procedures. For
example, the viral RNA is transcribed into DNA using reverse transcriptase to
produce
subgenomic DNA pieces, and a double-stranded DNA may be produced using DNA
polymerises. The cDNA is then cloned into appropriate vectors and cloned into
a cell to be
transfected. In some instances, cDNA is first attached to a promoter which is
compatible
with the production cell. The recombinant plant viral nucleic acid can then be
cloned into
any suitable vector which is compatible with the production cell.
Alternatively, the
recombinant plant viral nucleic acid is inserted in a vector adjacent a
promoter which is
compatible with the production cell. In some embodiments, the cDNA ligated
vector may
be directly transcribed into infectious RNA in vitro and inoculated onto the
plant host. The
cDNA pieces are mapped and combined in proper sequence to produce a full-
length DNA
copy of the viral RNA genome, if necessary.
The donor organism from which a library of sequence inserts is derived
includes
Kingdom Monera, Kingdom Protista, Kingdom Fungi, Kingdom Plantae and Kingdom
Animalia. Kingdom Monera includes subkingdom Archaebacteriobionta
(archaebacteria):
division Archaebacteriophyta (methane, salt and sulfolobus bacteria);
subkingdom
Eubacteriobionta (true bacteria): division Eubacteriophyta; subkingdom
Viroids; and
subkingdom Viruses. Kingdom Protista includes subkingdom Phycobionta: division
Xanthophyta 275 (yellow-green algae), division Chrysophyta 400 (golden- brown
algae),
division Dinophyta (Pyrrhophyta) 1,000 (dinoflagellates), division
Bacillariophyta 5,500
(diatoms), division Cryptophyta 74 (cryptophytes), division Haptophyta 250
(haptonema
organisms), division Euglenophyta 550 (euglenoids), division Chlorophyta,
class
Chlorophyceae 10,000 (green algae), class Charophyceae 200 (stoneworts),
division
Phaeophyta 900 (brown algae), and division Rhodophyta 2,500 (red algae);
subkingdom
Mastigobionta 960: division Chytridiomycoia 750 (chytrids), and division
Oomycota (water
molds) 475; subkingdom Mvxobionta 320: division Acrasiomycota (cellular slime
molds)
21, and division Myxomycota 500 (true slime molds). Kingdom Fungi includes
division
Zygomycota 570 (coenocytic fungi): subdivision Zygomycotina; and division
Eumycota 350
(septate fungi): subdivision Ascomycotina 56,000 (cup fungi), subdivision
Basidiomycotina
23
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
25,000 (club fungi), subdivision Deuteromycotina 22,000 (imperfect fungi), and
subdivision
Lichenes 13,500. Kingdom Plantae includes division Bryophyta, Hepatophyta,
Anthocerophyta, Psilophyta, Lycophyta, Sphenophyta, Pterophyta, Coniferophyta,
Cycadeophyta, Ginkgophyta, Gnetophyta and Anthophyta. Kingdom Animalia
includes:
Porifera (Sponges), Cnidaria (Jellyfishes), Ctenophora (Comb Jellies),
Platyhelminthes
(Flatworms), Nemertea (Proboscis Worms), Rotifera (Rotifers), Nematoda
(Roundworms),
Mollusca (Snails, Clams, Squid & Octopus), Onychophora (Velvet Worms),
Annelida
(Segmented Worms), Arthropoda (Spiders & Insects), Phoronida, Bryozoa
(Bryozoans),
Brachiopoda (Lamp Shells), Echinodermata (Sea Urchins & starfish), and
Chordata
(Vertebrata-Fish, Birds, Reptiles, Mammals). A preferred donor organism is
human. Host
organisms are those capable of being infected by an infectious RNA or a virus
containing a
recombinant viral nucleic acid. Host organisms include organisms from Monera,
Protista,
Fungi and Animalia. Preferred host organisms are organisms from Fungi, such as
yeast (for
example, S. cerevisiae) and Anamalia, such as insects (for example, C.
elegans).
To prepare a DNA insert comprising a nucleic acid sequence of a donor
organism,
the first step is to construct a cDNA library, a genomic DNA library, or a
pool of mRNA of
the donor organism. Full-length cDNAs or genomic DNA can be obtained from
public or
private repositories. For example, cDNA and genomic libraries from bovine,
chicken, dog,
drosophila, fish, frog, human, mouse, porcine, rabbit, rat, and yeast; and
retroviral libraries
can be obtained from Clontech (Palo Alto, CA). Alternatively, cDNA library can
be
prepared from a field sample by methods known to a person of ordinary skill,
for example,
isolating mRNAs and transcribing mRNAs into cDNAs by reverse transcriptase
(see, e.g.,
Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd ed.), Vols. 1-3,
Cold
Spring Harbor Laboratory, ( 1989), or Current Protocols in Molecular Biology,
F. Ausubel et
al., ed. Greene Publishing and Wiley-Interscience, New York (1987)). Genomic
DNAs
represented in BAC (bacterial artificial chromosome), YAC (yeast artificial
chromosome),
or TAC (transformation-competent artificial chromosome, Lin et al., Proc.
Natl. Acad. Sci.
USA, 96:6535-6540 (1999)) libraries can be obtained from public or private
repositories.
Alternatively, a pool of genes, which are overexpressed in a tumor cell line
compared
with a normal cell line, can be prepared or obtained from public or private
repositories.
Zhang et al (Science, 276: 1268-1272 (1997)) report that using a method of
serial analysis of
24
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
gene expression (SAGE) (Velculescu et al, Cell, 88:243 (1997)), 500
transcripts that were
expressed at significantly different levels in normal and neoplastic cells
were identified. The
expression of DNAs that overexpresses in a tumor cell line in a host organism
may cause
changes in the host organism, thus a pool of such DNAs is another source for
DNA inserts
for this invention. The BAC/YAC/TAC DNAs, DNAs or cDNAs can be mechanically
size-fractionated or digested by an enzyme to smaller fragments. The fragments
are ligated
to adapters with cohesive ends, and shotgun-cloned into recombinant viral
nucleic acid
vectors. Alternatively, the fragments can be blunt-end ligated into
recombinant viral nucleic
acid vectors. Recombinant viral nucleic acids containing a nucleic acid
sequence derived
from the cDNA library or genomic DNA library is then constructed using
conventional
techniques. The recombinant viral nucleic acid vectors produced comprise the
nucleic acid
insert derived from the donor organism. The nucleic acid sequence of the
recombinant viral
nucleic acid is transcribed as RNA in a host organism; the RNA is capable of
regulating the
expression of a phenotypic trait by a positive or anti sense mechanism. The
nucleic acid
sequence may also regulate the expression of more than one phenotypic trait.
Nucleic acid
sequences from Monera, Protista, Fungi, Plantae and Animalia may be used to
assemble the
DNA libraries. This method may thus be used to discover useful dominant gene
phenotypes
from DNA libraries through the gene expression in a host organism.
In the case of using plant as a donor organism, the donor plant and the host
plant may
be genetically remote or unrelated: they may belong to different genus,
family, order, class,
subdivision, or division. Donor plants include plants of commercial interest,
such as food
crops, seed crops, oil crops, ornamental crops and forestry crops. For
example, wheat, rice,
corn, potatoes, barley, tobaccos, soybean canola, maize, oilseed rape,
Arabidopsis, Nicotiana
can be selected as a donor plant.
To prepare a DNA insert comprising a nucleic acid sequence of a donor plant,
the
first step is typically to construct a library of cDNAs, genomic DNAs, or a
pool of RNAs of
the plant of interest. Full-length cDNAs can be obtained from public or
private repositories,
for example, cDNA library of Arabidopsis thaliana can be obtained from the
Arabidopsis
Biological Resource Center. Alternatively, cDNA library can be prepared from a
field
sample by methods known to a person of ordinary skill, for example, isolating
mRNAs and
transcribing mRNAs into cDNAs by reverse transcriptase (see, e.g., Sambrook et
al.,
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
Molecular Cloning: A Laboratory Manual (2nd ed.), Vols. 1-3, Cold Spring
Harbor
Laboratory, (1989), or Current Protocols in Molecular Biology, F. Ausubel et
al., ed.
Greene Publishing and Wiley-Interscience, New York (1987)). Genomic DNAs
represented
in BAC (bacterial artificial chromosome), YAC (yeast artificial chromosome),
or TAC
(transformation-competent artificial chromosome, Liu et al., Proc. Natl. Acad.
Sci. USA,
96:6535-6540 (1999)) libraries can be obtained from public or private
repositories, for
example, the Arabidopsis Biological Resource Center. The BAC/YAC/TAC DNAs or
cDNAs can be mechanically size-fractionated or digested by an enzyme to
smaller
fragments. The fragments are ligated to adapters with cohesive ends, and
shotgun-cloned
into recombinant viral nucleic acid vectors. Alternatively, the fragments can
be blunt-end
ligated into recombinant viral nucleic acid vectors. Recombinant plant viral
nucleic acids
containing a nucleic acid sequence derived from the cDNA library or genomic
DNA library
is then constructed using conventional techniques. The recombinant viral
nucleic acid
vectors produced comprise the nucleic acid insert derived from the donor
plant. The nucleic
acid sequence of the recombinant viral nucleic acid is transcribed as RNA in a
host plant; the
RNA is capable of regulating the expression of a phenotypic trait by a
positive or anti sense
mechanism. The nucleic acid sequence may also code for the expression of more
than one
phenotypic trait. Sequences from wheat, rice, corn, potato, barley, tobacco,
soybean, canola,
maize, oilseed rape, Arabidopsis, and other crop species may be used to
assemble the DNA
libraries. This method may thus be used to search for useful dominant gene
phenotypes
from DNA libraries through the gene expression.
Those skilled in the art will understand that these embodiments are
representative
only of many constructs suitable for the instant invention. All such
constructs are
contemplated and intended to be within the scope of the present invention. The
invention is
not intended to be limited to any particular viral constructs but specifically
contemplates
using all operable constructs. A person skilled in the art will be able to
construct the plant
viral nucleic acids based on molecular biology techniques well known in the
art. Suitable
techniques have been described in Sambrook et al. (2nd ed.), Cold Spring
Harbor
Laboratory, Cold Spring Harbor (1989); Methods in Enzymol. (Vols. 68, 100,
101, 118, and
152-155) (1979, 1983, 1986 and 1987); and DNA Cloning, D.M. Clover, Ed., IRL
Press,
Oxford (1985); Walkey, Applied Plant Irirology, Chapman & Hall (1991);
Matthews, Plant
26
WO 01/07600 CA 02380330 2002-0l-21 PCT/US00/20261
Virology, 3'd Ed., Academic Press, San Diego (1991); Turpen et al., ,l. of
Virological
Methods, 42:227-240 (1993); U.S. Patent Nos. 4,885,248, 5,173,410, 5,316,931,
5,466,788,
5,491,076, 5,500,360, 5,589,367, 5,602,242, 5,627,060, 5,811,653, 5,866,785,
5,889,190,
and 5,589,367, U.S. Patent Application No. 08/324,003. Nucleic acid
manipulations and
enzyme treatments are carried out in accordance with manufacturers'
recommended
procedures in making such constructs.
II. Ex~ressin members of donor organism derived sequence inserts in plant
hosts
Plant hosts include plants of commercial interest, such as food crops, seed
crops, oil
crops, ornamental crops and forestry crops. For example, wheat, rice, com,
potatoes, barley,
tobaccos, soybean canola, maize, oilseed rape, Arabidopsis, Nicotiana can be
selected as a
host plant. In particular, host plants capable of being infected by a virus
containing a
recombinant viral nucleic acid are preferred. Preferred host plants include
Nicotiana,
preferably, Nicotiana benthamiana, or Nicotiana cleavlandii.
Individual clones may be transfect into the plant host: 1 ) protoplasts; 2)
whole
plants; or 3) plant tissues, such as leaves of plants (Dijkstra et al.,
Practical Plant Virology:
Protocols and Exercises, Springer Verlag (1998); Plant Virology Protocol: From
Virus
Isolation to Transgenic Resistance in Methods in Molecular Biology,Vol. 81,
Foster and
Taylor, Ed., Humana Press (1998)). In some embodiments of the instant
invention, the
delivery of the plant virus expression vectors into the plant may be affected
by the
inoculation of in vitro transcribed RNA, inoculation of virions, or internal
inoculation of
plant cells from nuclear cDNA, or the systemic infection resulting from any of
these
procedures. In all cases, the co-infection may lead to a rapid and pervasive
systemic
expression of the desired nucleic acid sequences in plant cells.
The host can be infected with a recombinant viral nucleic acid or a
recombinant plant
virus by conventional techniques. Suitable techniques include, but are not
limited to, leaf
abrasion, abrasion in solution, high velocity water spray, and other injury of
a host as well as
imbibing host seeds with water containing the recombinant viral RNA or
recombinant plant
virus. More specifically, suitable techniques include:
(a) Hand Inoculations. Hand inoculations are performed using a neutral pH, low
molarity phosphate buffer, with the addition of celite or carborundum (usually
about
27
W~ 01/07600 CA 02380330 2002-O1-21 pCT/US00/20261
1 %). One to four drops of the preparation is put onto the upper surface of a
leaf and
gently rubbed.
(b) Mechanized Inoculations of Plant Beds. Plant bed inoculations are
performed by
spraying (gas-propelled) the vector solution into a tractor-driven mower while
cutting the leaves. Alternatively. the plant bed is mowed and the vector
solution
sprayed immediately onto the cut leaves.
(c) High Pressure Spray of Single Leaves. Single plant inoculations can also
be
performed by spraying the leaves with a narrow, directed spray (50 psi, 6-12
inches
from the leaf) containing approximately 1 % carborundum in the buffered vector
solution.
(d) Vacuum Infiltration. Inoculations may be accomplished by subjecting a host
organism to a substantially vacuum pressure environment in order to facilitate
infection.
(e) High Speed Robotics Inoculation. Especially applicable when the organism
is a plant, individual organisms may be grown in mass array such as in
microtiter plates. Machinery such as robotics may then be used to transfer
the nucleic acid of interest.
(f) Ballistics (High Pressure Gun) Inoculation. Single plant inoculations can
also be performed by particle bombardment. A ballistics particle delivery
system (BioRad Laboratories, Hercules, (A) can be used to transfect plants
such as N. benthamiana as described previously (Nagar et al., Plant Cell,
7:705-719 (1995)).
An alternative method for introducing viral nucleic acids into a plant host is
a
technique known as agroinfection or Agrobacterium-mediated transformation
(also known
as Agro- -infection) as described by Grimsley et al., Nature 325:177 (1987).
This technique
makes use of a common feature of Agrobacterium which colonizes plants by
transferring a
portion of their DNA (the T-DNA) into a host cell, where it becomes integrated
into nuclear
DNA. The T-DNA is defined by border sequences which are 25 base pairs long,
and any
DNA between these border sequences is transferred to the plant cells as well.
The insertion
of a recombinant plant viral nucleic acid between the T-DNA border sequences
results in
transfer of the recombinant plant viral nucleic acid to the plant cells, where
the recombinant
28
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
plant viral nucleic acid is replicated, and then spreads systemically through
the plant. Agro-
infection has been accomplished with potato spindle tuber viroid (PSTV)
(Gardner et al.,
Plant Mol: Biol. 6:221 (1986); CaV (Grimsley et al., Proc. Natl. Acad. Sci.
USA 83:3282
(1986)); MSV (Grimsley et al., Nature 325:177 (1987)), and Lazarowitz, S.,
Nucl. Acids
Res: 16:229 (1988)) digitaria streak virus (Donson et al., Virology 162:248
(1988)), wheat
dwarf virus (Hayes et al., J. Gen. Yirol. 69:891 (1988)) and tomato golden
mosaic virus
(TGMV) -(Elmer et al., Plant Mol. Biol. 10:225 (1988) and Gardiner et al.,
EMBO J. 7:899
(1988)). Therefore, agro-infection of a susceptible plant could be
accomplished with a
virion containing a recombinant plant viral nucleic acid based on the
nucleotide sequence of
any of the above viruses. Particle bombardment or electrosporation or any
other methods
known in the art may also be used.
In some embodiments of the instant invention, infection may also be attained
by
placing a selected nucleic acid sequence into an organism such as E. coli, or
yeast, either
integrated into the genome of such organism or not, and then applying the
organism to the
surface of the host organism. Such a mechanism may thereby produce secondary
transfer of
the selected nucleic acid sequence into a host organism. This is a
particularly practical
embodiment when the host organism is a plant. Likewise, infection may be
attained by first
packaging a selected nucleic acid sequence in a pseudovirus. Such a method is
described in
WO 94/10329. Though the teachings of this reference may be specific for
bacteria, those of
skill in the art will readily appreciate that the same procedures could easily
be adapted to
other organisms.
Plant may be grown from seed in a mixture of "Peat-Lite MixTM (Speedling, Inc.
Sun
City, Fl) and NutricoteTM controlled release fertilizer 14-14-14 (Chiss-Asahi
Fertilizer Co.,
Tokyo, Japan). Plants may be grown in a controlled environment provided 16
hours of light
and 8 hours of darkness. Sylvania "Gro-Lux/Aquarium" wide spectrum 40 watt
fluorescent
grow lights. (Osram Sylvania Products, Inc. Danvers, MA) may be used.
Temperatures may
be kept at around 80° F during light hours and 70° F during dark
hours. Humidity may be
between 60 and 85%.
III. Detectin~phenotwic or biochemical changes as a result of expression.
29
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
After a plant host is infected with individual clone of the library, one or
more
phenotypic or biochemical changes may be detected.
The phenotypic changes in a plant host may be determined by any known methods
in
the art. Phenotypic changes may include growth rate, color, or morphology
changes.
Typically, these methods include visual, macroscopic or microscopic analysis.
For example,
growth changes, such as stunting, color changes (e.g. leaf yellowing,
mottling, bleaching,
chlorosis) among others are easily visualized. Examples of morphological
changes include,
developmental defects, wilting, necrosis, among others.
Biochemical changes can be determined by any analytical methods known in the
art
for detecting, quantitating, or isolating DNA, RNA, proteins, antibodies,
carbohydrates,
lipids, and small molecules. Selected methods may include Northern, Western
blotting,
MALDI-TOF, LC/MS, GC/MS, two-dimensional IEF/SDS-PAGE, ELISA, etc. In
particular, suitable methods may be performed in a high-throughput, fully
automated fashion
using robotics. Examples of biochemical changes may include the accumulation
of
substrates or products from enzymatic reactions, changes in biochemical
pathways,
inhibition or augmentation of endogenous gene expression in the cytoplasm of
cells, changes
in the RNA or protein profile. For example, the clones in the viral vector
library may be
functionally classified based on metabolic pathway affected or
visual/selectable phenotype
produced in the organism. This process enables a rapid determination of gene
function for
unknown nucleic acid sequences of a donor organism as well as a host organism.
Furthermore, this process can be used to rapidly confirm function of full-
length DNA's of
unknown function. Functional identification of unknown nucleic acid sequences
in a library
of one organism may then rapidly lead to identification of similar unknown
sequences W
expression libraries for other organisms based on sequence homology. Such
information is
useful in many aspects including in human medicine.
The biochemical or phenotypic changes in the infected host plant may be
correlated
to the biochemistry or phenotype of a host plant that is uninfected.
Optionally, the
biochemical or phenotypic changes in the infected host plant is further
correlated to a host
plant that is infected with a viral vector that contains a control nucleic
acid of a known
sequence. The control nucleic acid may have similar size but is different in
sequence from
the nucleic acid insert derived from the library. For example, if the nucleic
acid insert
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
derived from the library is identified as encoding a GTP binding protein in an
antisense
orientation, a nucleic acid derived from a gene encoding green fluorescent
protein can be
used as a control nucleic acid. Green fluorescent protein is known not to have
the same
effect as the GTP binding protein when expressed in a host plant.
In some embodiments, the phenotypic or biochemical trait may be determined by
complementation analysis, that is, by observing the endogenous gene or genes
whose
function is replaced or augmented by introducing the nucleic acid of interest.
A discussion
of such phenomenon is provided by Napoli et al., The Plant Cell 2:279-289
(1990). The
phenotypic or biochemical trait may also be determined by (1)analyzing the
biochemical
alterations in the accumulation of substrates or products from enzymatic
reactions according
to any means known by those skilled in the art; (2) by observing any changes
in
biochemical pathways which may be modified in a host organism as a result of
expression of
the nucleic acid; (3) by utilizing techniques known by those skilled in the
art to observe
inhibition of endogenous gene expression in the cytoplasm of cells as a result
of expression
of the nucleic acid.; (4) by utilizing techniques known by those skilled in
the art to observe
changes in the RNA or protein profile as a result of expression of the nucleic
acid; or (S) by
selection of organisms capable of growing or maintaining viability in the
presence of
noxious or toxic substances, such as, for example, pharmaceutical ingredients.
One useful means to determine the function of nucleic acids transfected into a
host
plant is to observe the effects of gene silencing. Traditionally, functional
gene knockout has
been achieved following inactivation due to insertion of transposable elements
or random
integration of T-DNA into the chromosome, followed by characterization of
conditional,
homozygous-recessive mutants obtained upon backcrossing. Some teachings in
these
regards are provided by WO 97/42210 which is herein incorporated by reference.
As an
alternative to traditional knockout analysis, an EST/DNA library from a donor
organism,
may be assembled into a viral transcription plasmid. The nucleic acid
sequences in the
transcription plasmid library may then be introduced into host cells as part
of a functional
RNA virus which post-transcriptionally silences the homologous target gene.
The
EST/DNA sequences may be introduced into a viral vector in either the plus or
anti sense
orientation, and the orientation can be either directed or random based on the
cloning
strategy. A high-throughput, automated cloning scheme based on robotics may be
used to
31
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
assemble and characterize the library. Alternatively, the EST/cDNA sequences
can be
inserted into the genomic RNA of a viral vector such that they are represented
as genomic
RNA during the viral replication in host cells. The library of EST clones is
then transcribed
into infectious RNAs and inoculated onto a host organism susceptible to viral
infection. The
viral RNAs containing the EST/cDNA sequences contributed from the original
library are
now present in a sufficiently high concentration in the cytoplasm of host
organism cells such
that they cause post-transcriptional gene silencing of the endogenous gene in
a host
organism. Since the replication mechanism of the virus produces both sense and
antisense
RNA sequences, the orientation of the EST/cDNA insert is normally irrelevant
in terms of
producing the desired phenotype in the host organism.
The present invention provides a method to express transiently viral-derived
positive
sense or antisense RNAs in transfected plants. Such method is much faster than
the time
required to obtain genetically engineered antisense transgenic organisms.
Systemic infection
and expression of viral antisense RNA occurs as short as several days post
inoculation,
whereas it takes several months or longer to create a single transgenic
organism. The
invention provides a method to identify genes involved in the regulation of
growth by
inhibiting the expression of specific endogenous genes using viral vectors.
This invention
provides a method to characterize specific genes and biochemical pathways in
donor
organisms or in host plants using an RNA viral vector.
It is known that silencing of endogenous genes can be achieved with homologous
sequences from the same plant family. For example, Kumagai et al., (Proc.
Natl. Acad. Sci.
USA 92:1679 (1995)) report that the Nicotiana benthamiana gene for phytoene
desaturase
(PDS) was silenced by transfection with a viral RNA derived from a clone
containing a
partial tomato (Lycopersicon esculentum) cDNA encoding PDS being in an
antisense
orientation. Kumagai et al. demonstrate that gene encoding PDS from one plant
can be
silenced by transfecting a host plant with a nucleic acid of a known sequence,
namely, a
PDS gene, from a donor plant of the same family. The present invention
provides a method
of silencing a gene in a host organism by transfecting a hon-plant host
organism with a viral
nucleic acid comprising a nucleic acid insert derived from a cDNA library or a
genomic
DNA library or a pool of RNA from a non-plant organism. Different from Kumagai
et al,
the sequence of the nucleic acid insert in the present invention does not need
to be identified
32
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
prior to the transfection. Another feature of the present invention is that it
provides a
method to silence a conserved gene of a nonplant kingdom; the antisense
transcript of an
organism results in reducing expression of the endogenous gene of a host
organism from
Monera, Protista, Fungi and Animalia. The invention is exemplified by GTP
binding
proteins. In eukaryotic cells, GTP-binding proteins function in a variety of
cellular
processes, including signal transduction, cytoskeletal organization, and
protein transport.
Low molecular weight (20-25 K Daltons) of GTP-binding proteins include ras and
its close
relatives (for example, Ran), rho and its close relatives, the rab family, and
the ADP-
ribosylation factor (ARF) family. The heterotrimeric and monomeric GTP-binding
proteins
that may be involved in secretion and intracellular transport are divided into
two structural
classes: the rab and the ARF families. The ARFs from many organisms have been
isolated
and characterized. The ARFs share structural features with both the ras and
trimeric GTP-
binding protein families. The present invention demonstrates that genes of one
plant, such
as Nicotiana, which encode GTP binding proteins, can be silenced by
transfection with
infectious RNAs from a clone containing GTP binding protein open reading frame
in an
antisense orientation, derived from a plant of a different family, such as
Arabidopsis. The
present invention also demonstrates that GTP binding proteins are highly
homologous in
human, frog, mouse, bovine, fly and yeast, not only at the amino acid level,
but also at
the nucleic acid level. The present invention thus provides a method to
silence a conserved
gene in a host organism, by transfecting the host with infectious RNAs derived
from a
homologous gene of a non-plant organism.
Nucleic acid sequences that may result in changing a host phenotype include
those
involved in cell growth, proliferation, differentiation and development; cell
communication;
and the apoptotic pathway. Genes regulating growth of cells or organisms
include, for
example, genes encoding a GTP binding protein, a ribosomal protein L 19
protein, an S 18
ribosomal protein, etc. Henry et al. (Cancer Res., 53:1403-1408 (1993)) report
that erb B-2
(or HER-2 or neu) gene was amplified and overexpressed in one-third of cancers
of the
breast, stomach, and ovary; and the mRNA encoding the ribosomal protein L19
was more
abundant in breast cancer samples that express high levels of erbB-2.
Lijsebettens et al.
(EMBO J., 13:3378-3388 (1994)) report that in Arabidopsis, mutation at PFL
caused pointed
first leaves, reduced fresh weight and growth retardation. PFL codes for
ribosomal protein
33
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/202G1
S 18, which has a high homology with the rat S 18 protein. Genes involved in
development
of cells or organisms include, for example, homeobox-containing genes and
genes encoding
G-protein-coupled receptor proteins such as the rhodopsin family. Homeobox
genes are a
family of regulatory genes containing a common 183-nucleotide sequence
(homeobox) and
coding for specific nuclear proteins (homeoproteins) that act as transcription
factors. The
homeobox sequence itself encodes a 61-amino-acid domain, the homeodomain,
responsible
for recognition and binding of sequence-specific DNA motifs. The specificity
of this
binding allows homeoproteins to activate or repress the expression of
batteries of down-
stream target genes. Initially identified in genes controlling Drosophila
development, the
homeobox has subsequently been isolated in evolutionarily distant animal
species, plants,
and fungi. Several indications suggest the involvement of homeobox genes in
the control of
cell growth and, when dysregulated, in oncogenesis (Cillo et al., Exp. Cell
Res., 248:1-9
(1999). Other nucleic acid sequences that may result in changes of an organism
include
genes encoding receptor proteins such as hormone receptors; cAMP receptors,
serotonin
receptors, and calcitonin family of receptors; and light-regulated DNA
encoding a leucine
(Leu) zipper motif (Zheng et al., Plant Physiol., 116:27-35 (1998)).
Deregulation or
alteration of the process of cell growth, proliferation, differentiation and
development; cell
communication; and the apoptotic pathways may result in cancer. Therefore,
identifying the
nucleic acid sequences involved in those processes and determining their
functions are
beneficial to the human medicine; it also provides a tool for cancer research.
A Library of human nucleic acid sequences is cloned into vectors. The vectors
are
applied to the host to obtain infection. Each infected host is grown with an
uninfected host
and a host infected with a null vector. A null vector will show no phenotypic
or biochemical
change other than the effects of the virus itself. Each host is observed daily
for visual
differences between the infected host and its two controls. In each host
displaying an
observable phenotypic or biochemical change a trait is identified. The donor
nucleic acid
sequence is identified, the full-length gene sequence is obtained and the full-
length gene in
the host is obtained, if a gene from the host is associated with the trait.
Both genes are
sequenced and homology is determined. A variety of biochemical tests may also
be made
on the host or host tissue depending on the information that is desired. A
variety of
34
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
phenotypic changes or traits and biochemical tests are set forth in this
document. A
functional gene profile can be obtained by repeating the process several
times.
Large amounts of DNA sequence information are being generated in the public
domain, which may be entered into a relational database. Links may be made
between
sequences from various species predicted to carry out similar biochemical or
regulatory
functions. Links may also be generated between predicted enzymatic activities
and visually
displayed biochemical and regulatory pathways. Likewise, links may be
generated between
predicted enzymatic or regulatory activity and known small molecule
inhibitors, activators,
substrates or substrate analogs. Phenotypic data from expression libraries
expressed in
transfected hosts may be automatically linked within such a relational
database. Genes with
similar predicted roles of interest in other organisms may be rapidly
discovered.
The present invention is also directed to a method of changing the phenotype
or
biochemistry of a plant by expressing transiently a nucleic acid sequence from
a donor plant
in an antisense orientation in a host plant, which inhibits an endogenous gene
expression in
the meristem of the host plant. The one or more phenotypic or biochemical
changes in the
host plant are detected by methods as describes previously. Transient
expressing a nucleic
acid sequence in a host plant can affect the gene expression in meristem.
Meristems are of
interest in plant development because plant growth is driven by the formation
and activity of
meristems throughout the entire life cycle. This invention is exemplified by a
nucleic acid
sequence encoding ribosomal protein S 18. The activity of S 18 promoter is
restricted to
meristems (Lijsebettesn et al., EMBO J. 13: 3378-3388). Transient expression
of a nucleic
acid sequence in a host plant can trigger a signal transmitting to meristems
and affect the
gene expression in menstem.
One problem with gene silencing in a plant host is that many plant genes exist
in
multigene families. Therefore, effective silencing of a gene function may be
especially
problematic. According to the present invention, however, nucleic acids may be
inserted
into the viral genome to effectively silence a particular gene function or to
silence the
function of a multigene family. It is presently believed that about 20% of
plant genes exist
in multigene families.
A detailed discussion of some aspects of the "gene silencing" effect is
provided in
the co-pending patent application, U.S. Patent Application Serial No.
08/260,546
WO 01/07600 CA 02380330 2002-0l-21 pCT~JS00/20261
(W095/34668 published 12/21/95) the disclosure of which is incorporated herein
by
reference. RNA can reduce the expression of a target gene through inhibitory
RNA
interactions with target mRNA that occur in the cytoplasm and/or the nucleus
of a cell.
An EST/cDNA library from a plant such as Arabidopsis thaliana may be assembled
into a plant viral transcription plasmid background. The cDNA sequences in the
transcription plasmid library can then be introduced into plant cells as
cytoplasmic RNA in
order to post-transcriptionally silence the endogenous genes. The EST/cDNA
sequences
may be introduced into the plant viral transcription plasmid in either the
plus or anti-sense
orientation (or both), and the orientation can be either directed or random
based on the
cloning strategy. A high-throughput, automated cloning strategy using robotics
can be used
to assemble the library. The EST clones can be inserted behind a duplicated
subgenomic
promoter such that they are represented as subgenomic transcripts during viral
replication in
plant cells. Alternatively, the EST/cDNA sequences can be inserted into the
genomic RNA
of a plant viral vector such that they are represented as genomic RNA during
the viral
replication in plant cells. The library of EST clones is then transcribed into
infectious RNAs
and inoculated onto a host plant susceptible to viral infection. The viral
RNAs containing
the EST/cDNA sequences contributed from the original library are now present
in a
sufficiently high concentration in the cytoplasm of host plant cells such that
they cause post-
transcriptional gene silencing of the endogenous gene in a host plant. Since
the replication
mechanism of the virus produces both sense and antisense RNA sequences, the
orientation
of the EST/cDNA insert is normally irrelevant in terms of producing the
desired phenotype
in the host plant.
The present invention also provides a method of isolating a conserved gene
such as a
gene encoding a GTP binding protein, from rice, barley, corn, soybean, maize,
oilseed, and
other plant of commercial interest, using another gene having homology with
gene being
isolated. Libraries containing full-length cDNAs from a donor plant such as
rice, barley,
corn, soybean and other important crops can be obtained from public and
private sources or
can be prepared from plant mRNAs. The cDNAs are inserted in viral vectors or
in small
subcloning vectors such as pBluescript (Strategene), pUCl8, M13, or pBR322.
Transformed bacteria are then plated and individual clones selected by a
standard method.
The bacteria transformants or DNAs are rearrayed at high density onto membrane
filters or
36
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
glass slides. Full-length cDNAs encoding GTP binding proteins can be
identified by
probing filters or slides with labeled nucleic acid inserts which result in
changes in a host
plant, or labeled probes prepared from DNAs encoding GTP binding proteins from
Arabidopsis. Useful labels include radioactive, fluorescent, or
chemiluminecent molecules,
enzymes, etc.
Alternatively, genomic libraries containing sequences from rice, barley, corn,
soybean
and other important crops can be obtained from public and private sources, or
be prepared from
plant genomic DNAs. BAC clones containing entire plant genomes have been
constructed and
organized in a minimal overlapping order. Individual BACs are sheared to
fragments and
directly cloned into viral vectors. Clones that completely cover an entire BAC
form a BAC viral
vector sublibrary. Genomic clones can be identified by probing filters
containing BACs with
labeled nucleic acid inserts which result in changes in a host plant, or with
labeled probes
prepared from DNAs encoding GTP binding proteins from Arabidopsis. Useful
labels include
radioactive, fluorescent, or chemiluminecent molecules, enzymes, etc. BACs
that hybridize to
the probe are selected and their corresponding BAC viral vectors are used to
produce infectious
RNAs. Plants that are transfected with the BAC sublibrary are screened for
change of function,
for example, change of growth rate or change of color. Once the change of
function is observed,
the inserts from these clones or their corresponding plasmid DNAs are
characterized by dideoxy
sequencing. This provides a rapid method to obtain the genomic sequence for a
plant protein,
for example, a GTP binding protein. Using this method, once the DNA sequence
in one plant
such as Arabidopsis thaliana is identified, it can be used to identify
conserved sequences of
similar function that exist in other plant libraries.
A functional genomics screen is set up using a tobacco mosaic virus TMV-O coat
protein capsid for infection of Nicotiana benthamiana, a plant related to the
common
tobacco plant. For Arabidopsis thaliana cDNA libraries are obtained from the
Arabidopsis
Biological Resource Center, Bluescript~ phagemid vectors are recovered by Not
1
digestion. cDNA is transformed into a plasmid. The plasmid is transcribed into
viral vector
RNA. The inserts are in the antisense orientation as in Figure until all of
the cDNA from
each cDNA library is represented on viral vectors. Each viral vector is
sprayed onto the leaf
of a two-week old N. benthamiana plant host with sufficient force to cause
tissue injury and
localized viral infection. Each infected plant is grown side by side with an
uninfected plant
37
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
and a plant infected with a null insert vector as controls. All plants are
grown in an artificial
environment having 16 hours of light and 8 hours of dark. Lumens are
approximately equal
on each plant. At intervals of 2 days a visual and photographic observation of
phenotype is
made and recorded for each infected plant and each of its controls and a
comparison is made.
Data is entered into a Laboratory Information Management System database. At
the end of
the observation period stunted plants are grouped for analysis. The nucleic
acid insert
contained in the viral vector clone 740AT#120 is responsible for severe
stunting of one of
the plants. Clone 740AT #120 is sequenced. The homologue from the plant host
is also
sequenced. The 740AT #120 clone is found to have 80% homology to plant host
nucleic
acid sequence. The amino acid sequence of homology is 96%. The entire cDNA
sequence
of the insert is obtained by sequencing and found to code for a GTP binding
protein. The
host plant homologue is selected and sequenced. It also codes for a GTP
binding protein.
We conclude that this GTP binding protein coding sequence is highly conserved
in nature.
This information is useful in pharmaceutical development as well as in
toxicology studies.
A complete classification scheme of gene functionality for a fully sequenced
eukaryotic organism has been established for yeast. This classification scheme
may be
modified for plants and divided into the appropriate categories. Such
organizational
structure may be utilized to rapidly identify herbicide target loci which may
confer dominant
lethal phenotypes, and thereby is useful in helping to design rational
herbicide programs.
The present invention is also directed to a method of increasing yield of a
grain crop.
In Rice Biotechnology Quarterly 37:4 ( 1999) and Ashikari et al., Proc. Natl.
Acad. Sci. USA
96:10284-10289 (1999)), it is reported that a transgenic rice plant
transformed with a rgpl
gene, which encodes a small GTP binding protein from rice, was shorter than a
control plant,
but it produced more seeds than the control plant. To increase the yield of a
grain crop, the
present method comprises expressing transiently a nucleic acid sequence of a
donor plant in
an antisense orientation in the grain crop, wherein said expressing results in
stunted growth
and increased seed production of said grain crop. A preferred method comprises
the steps of
cloning the nucleic acid sequence into a plant viral vector and infecting the
grain crop with a
recombinant viral nucleic acid comprising said nucleic acid sequence.
Preferred plant viral
vector is derived from a Brome Mosaic virus, a Rice Necrosis virus, or a
geminivirus.
Preferred grain crops include rice, wheat, and barley. The nucleic acid
expressed in the host
38
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
plant, for example, comprises a GTP binding protein open reading frame having
an antisense
orientation. The present method provides a transiently expression of a gene to
obtain a
stunted plant. Because less energy is put into plant growth, more energy is
available for
production of seed, which results in increase yield of a grain crop. The
present method has
an advantage over other method using a transgenic plant, because it does not
have an effect
on the genome of a host plant.
In order to provide an even clearer and more consistent understanding of the
specification and the claims, including the scope given herein to such terms,
the following
definitions are provided:
Adjacent: A position in a nucleotide sequence proximate to and S' or 3' to a
defined
sequence. Generally, adjacent means within 2 or 3 nucleotides of the site of
reference.
Anti-Sense Inhibition: A type of gene regulation based on cytoplasmic, nuclear
or
organelle inhibition of gene expression due to the presence in a cell of an
RNA molecule
complementary to at least a portion of the mRNA being translated. It is
specifically
contemplated that RNA molecules may be from either an RNA virus or mRNA from
the
host cells genome or from a DNA virus.
Cell Culture: A proliferating group of cells which may be in either an
undifferentiated or differentiated state, growing contiguously or non-
contiguously.
Chimeric Sequence or Gene: A nucleotide sequence derived from at least two
heterologous parts. The sequence may comprise DNA or RNA.
Coding Sequence: A deoxyribonucleotide or ribonucleotide sequence which, when
either transcribed and translated or simply translated, results in the
formation of a cellular
polypeptide or a ribonucleotide sequence which, when translated, results in
the formation of
a cellular polypeptide.
Compatible: The capability of operating with other components of a system. A
vector or plant or animal viral nucleic acid which is compatible with a host
is one which is
capable of replicating in that host. A coat protein which is compatible with a
viral
nucleotide sequence is one capable of encapsidating that viral sequence.
Complementation Analysis: As used herein, this term refers to observing the
changes produced in an organism when a nucleic acid sequence is introduced
into that
organism after a selected gene has been deleted or mutated so that it no
longer functions
39
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
fully in its normal role. A complementary gene to the deleted or mutated gene
can restore
the genetic phenotype of the selected gene.
Dual Heterologous Subgenomic Promoter Expression System (DHSPES): a plus
stranded RNA vector having a dual heterologous subgenomic promoter expression
system to
increase, decrease, or change the expression of proteins, peptides or RNAs,
preferably those
described in U.S. Patent Nos. 5,316,931, 5,811,653, 5,589,367, and 5,866,785,
the disclosure
of which is incorporated herein by reference.
Expressed sequence tags (ESTs): Relatively short single-pass DNA sequences
obtained from one or more ends of cDNA clones and RNA derived therefrom. They
may be
present in either the 5' or the 3' orientation. ESTs have been shown useful
for identifying
particular genes.
Expression: The term as used herein is meant to incorporate one or more of
transcription, reverse transcription and translation.
A functional Gene Profile: The collection of genes of an organism which code
for a
biochemical or phenotypic trait. The functional gene profile of an organism is
found by
screening nucleic acid sequences from a donor organism by over expression or
suppression
of a gene in a host organism. A functional gene profile requires a collection
or library of
nucleic acid sequences from a donor organism. A functional gene profile will
depend on the
ability of the collection or library of donor nucleic acids to cause over-
expression or
suppression in the host organism. Therefore, a functional gene profile will
depend upon the
quantity of donor genes capable of causing over-expression or suppression of
host genes or
of being expressed in the host organism in the absence of a homologous host
gene.
Gene: A discrete nucleic acid sequence responsible for producing one or more
cellular products and/or performing one or more intercellular or intracellular
functions.
Gene silencing: A reduction in gene expression. A viral vector expressing gene
sequences from a host may induce gene silencing of homologous gene sequences.
Homology: A degree of nucleic acid similarity in all or some portions of a
gene
sequence sufficient to result in gene suppression when the nucleic acid
sequence is delivered
in the antisense onentation.
Host: A cell, tissue or organism capable of replicating a nucleic acid such as
a vector
or viral nucleic acid and which is capable of being infected by a virus
containing the viral
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
vector or viral nucleic acid. This term is intended to include prokaryotic and
eukaryotic
cells, organs, tissues or organisms, where appropriate. Bacteria, fungi,
yeast, and animal
(cell, tissues, or organisms), are examples of a host.
Infection: The ability of a virus to transfer its nucleic acid to a host or
introduce a
viral nucleic acid into a host, wherein the viral nucleic acid is replicated,
viral proteins are
synthesized, and new viral particles assembled. In this context, the terms
"transmissible"
and "infective" are used interchangeably herein. The term is also meant to
include the
ability of a selected nucleic acid sequence to integrate into a genome,
chromosome or gene
of a target organism.
Insert: a stretch of nucleic acid seqeunce, typically more than 20 base pairs
long.
Multigene family: A set of genes descended by duplication and variation from
some
ancestral gene. Such genes may be clustered together on the same chromosome or
dispersed
on different chromosomes. Examples of multigene families include those which
encode the
histones, hemoglobins, immunoglobulins, histocompatibility antigens, actions,
tubulins,
keratins, collagens, heat shock proteins, salivary glue proteins, chorion
proteins, cuticle
proteins, yolk proteins, and phaseolins.
Non-Native: Any RNA or DNA sequence that does not normally occur in the cell
or
organism in which it is placed. Examples include recombinant viral nucleic
acids and genes
or ESTs contained therein. That is, an RNA or DNA sequence may be non-native
with
respect to a viral nucleic acid. Such an RNA or DNA sequence would not
naturally occur in
the viral nucleic acid. Also, an RNA or DNA sequence may be non-native with
respect to a
host organism. That is, such a RNA or DNA sequence would not naturally occur
in the host
organism.
Nucleic acid: As used herein the term is meant to include any DNA or RNA
sequence from the size of one or more nucleotides up to and including a
complete gene
sequence. The term is intended to encompass all nucleic acids whether
naturally occurnng
in a particular cell or organism or non-naturally occurring in a particular
cell or organism.
Nucleic acid of interest: The term is intended to refer to the nucleic acid
sequence
whose function is to be determined. The sequence will normally be non-native
to a viral
vector but may be native or non-native to a host organism.
41
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
Phenotypic Trait: An observable, measurable or detectable property resulting
from
the expression or suppression of a gene or genes.
Plant Cell: The structural and physiological unit of plants, consisting of a
protoplast
and the cell wall.
Plant Organ: A distinct and visibly differentiated part of a plant, such as
root, stem,
leaf or embryo.
Plant Tissue: Any tissue of a plant in plant or in culture. This term is
intended to
include a whole plant, plant cell, plant organ, protoplast, cell culture, or
any group of plant
cells organized into a structural and functional unit.
Positive-sense inhibition: A type of gene regulation based on cytoplasmic
inhibition
of gene expression due to the presence in a cell of an RNA molecule
substantially
homologous to at least a portion of the mRNA being translated.
Promoter: The 5'-flanking, non-coding sequence substantially adjacent a coding
sequence which is involved in the initiation of transcription of the coding
sequence.
Protoplast: An isolated plant or bacterial cell without some or all of its
cell wall.
Recombinant Viral Nucleic Acid: Viral nucleic acid which has been modified to
contain non-native nucleic acid sequences. These non-native nucleic acid
sequences may be
from any organism or purely synthetic, however, they may also include nucleic
acid
sequences naturally occurring in the organism into which the recombinant viral
nucleic acid
is to be introduced.
Recombinant Virus: A virus containing the recombinant viral nucleic acid.
Subgenomic Promoter: A promoter of a subgenomic mRNA of a viral nucleic acid.
Substantial Sequence Homology: Denotes nucleotide sequences that are
substantially functionally equivalent to one another. Nucleotide differences
between such
sequences having substantial sequence homology are insignificant in affecting
function of
the gene products or an RNA coded for by such sequence.
Systemic Infection: Denotes infection throughout a substantial part of an
organism
including mechanisms of spread other than mere direct cell inoculation but
rather including
transport from one infected cell to additional cells either nearby or distant.
Transient Expression: Expression of a nucleic acid sequence in a host without
insertion of the nucleic acid sequence into the host genome, such as by way of
a viral vector.
42
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
Transposon: A nucleotide sequence such as a DNA or RNA sequence which is
capable of transferring location or moving within a gene, a chromosome or a
genome.
EXAMPLES
The following examples further illustrate the present invention. These
examples are
intended merely to be illustrative of the present invention and are not to be
construed as
being limiting.
EXAMPLE 1
Arabidopsis thaliana cDNA librar~,construction in a dual sub~enomic promoter
vector.
Arabidopsis thaliana cDNA libraries obtained from the Arabidopsis Biological
Resource Center (ABRC). The four libraries from ABRC were size-fractionated
with inserts
of 0.5-1 kb (CD4-13), 1-2 kb (CD4-14), 2-3 kb (CD4-15), and 3-6 kb (CD4-16).
All
libraries are of high quality and have been used by several dozen groups to
isolate genes.
The pBluescript~ phagemids from the Lambda ZAP II vector were subjected to
mass
excision and the libraries were recovered as plasmids according to standard
procedures.
Alternatively, the cDNA inserts in the CD4-13 (Lambda ZAP II vector) were
recovered by digestion with NotI. Digestion with NotI in most cases liberated
the entire
Arabidopsis thaliana cDNA insert because the original library was assembled
with NotI
adapters. NotI is an 8-base cutter that infrequently cleaves plant DNA. In
order to insert the
NotI fragments into a transcription plasmid, the pBS735 transcription plasmid
(FIGURE 1)
was digested with PacIlXhoI and ligated to an adapter DNA sequence created
from the
oligonucleotides 5'-TCGAGCGGCCGCAT-3' (SEQ ID NO: 1) and 5'-GCGGCCGC-3'.
The resulting plasmid pBS740 (FIGURE 2) contains a unique NotI restriction
site for bi-
directional insertion of NotI fragments from the CD4-13 library. Recovered
colonies were
prepared from these for plasmid minipreps with a Qiagen BioRobot 9600~. The
plasmid
DNA preps performed on the BioRobot 9600~ were done in 96-well format and
yield
transcription quality DNA. An Arabidopsis cDNA library was transformed into
the plasmid
and analyzed by agarose gel electrophoresis to identify clones with inserts.
Clones with
inserts were transcribed in vitro and inoculated onto N. benthamiana or
Arabidopsis
43
CA 02380330 2002-O1-21
WO 01107600 PCT/US00/20261
thaliana. Selected leaf disks from transfected plants were then taken for
biochemical
analysis.
EXAMPLE 2
Genomic DNA libr construction in a recombinant viral nucleic acid vector.
Genomic DNAs represented in BAC (bacterial artificial chromosome) or YAC
(yeast artificial chromosome) libraries are obtained from the Arabidopsis
Biological
Resource Center (ABRC). The BAC/YAC DNAs are mechanically size-fractionated,
ligated to adapters with cohesive ends, and shotgun-cloned into recombinant
viral nucleic
acid vectors. Alternatively, mechanically size-fractionated genomic DNAs are
blunt-end
ligated into a recombinant viral nucleic acid vector. Recovered colonies are
prepared for
plasmid minipreps with a Qiagen BioRobot 9600~. The plasmid DNA preps done on
the
BioRobot 9600~ are assembled in 96-well format and yield transcription quality
DNA. The
recombinant viral nucleic acidlArabidopsis genomic DNA library is analyzed by
agarose gel
electrophoresis (template quality control step) to identify clones with
inserts. Clones with
inserts are then transcribed in vitro and inoculated onto N. benthamiana
and/or Arabidopsis
thaliana. Selected leaf disks from transfected plants are then be taken for
biochemical
analysis.
Genomic DNA from Arabidopsis typically contains a gene every 2.5 kb
(kilobases)
on average. Genomic DNA fragments of 0.5 to 2.5 kb obtained by random shearing
of
DNA were shotgun assembled in a recombinant viral nucleic acid
expression/knockout
vector library. Given a genome size of Arabidopsis of approximately 120,000
kb, a random
recombinant viral nucleic acid genomic DNA library would need to contain
minimally
48,000 independent inserts of 2.5 kb in size to achieve 1X coverage of the
Arabidopsis
genome. Alternatively, a random recombinant viral nucleic acid genomic DNA
library
would need to contain minimally 240,000 independent inserts of 0.5 kb in size
to achieve
1X coverage of the Arabidopsis genome. Assembling recombinant viral nucleic
acid
expressionlknockout vector libraries from genomic DNA rather than cDNA has the
potential
to overcome known difficulties encountered when attempting to clone rare, low-
abundance
mRNA's in a cDNA library. A recombinant viral nucleic acid expression/knockout
vector
library made with genomic DNA would ~be especially useful as a gene silencing
knockout
44
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
library. In addition, the Dual Heterologous Subgenomic Promoter Expression
System
(DHSPES) expression/knockout vector library made with genomic DNA would be
especially useful for expression of genes lacking introns. Furthermore, other
plant species
with moderate to small genomes (e.g. rose, approximately 80,000 kb) would be
especially
useful for recombinant viral nucleic acid expression/knockout vector libraries
made with
genomic DNA. A recombinant viral nucleic acid expression/knockout vector
library can be
made from existing BAC/YAC genomic DNA or from newly-prepared genomic DNAs for
any plant species.
EXAMPLE 3
Genomic DNA or cDNA library construction in a DHSPES vector. and transfection
of
individual clones from said vector library onto T-DNA tabbed or transposon
tweed or
mutated plants.
Genomic DNA or cDNA library construction in a recombinant viral nucleic acid
vector, and transfection of individual clones from the vector library onto T-
DNA tagged or
transposon tagged or mutated plants may be performed according to the
procedure set forth
in Examples l and 2. Such a protocol may be easily designed to complement
mutations
introduced by random insertional mutagenesis of T-DNA sequences or transposon
sequences.
CA 02380330 2002-O1-21
WO 01/07600 PCT/CTS00/20261
EXAMPLE 4
Construction of a Nicotiana benthamiana cDNA library.
Vegetative N. benthamiana plants were harvested 3.3 weeks after sowing and
sliced
up into three groups of tissue: leaves, stems and roots. Each group of tissue
was flash frozen
in liquid nitrogen and total RNA was isolated from each group separately using
the
following hot borate method. Frozen tissue was ground to a fine powder with a
pre-chilled
mortar and pestle, and then further homogenized in pre-chilled glass tissue
grinder.
Immediately thereafter, 2.5 ml/g tissue hot (~82°C) XT Buffer (0.2 M
borate decahydrate,
30 mM EGTA, 1% (wiv) SDS. Adjusted pH to 9.0 with 5 N NaOH, treated with 0.1%
DEPC and autoclaved. Before use, added 1 % deoxycholate (sodium salt), 10 mM
dithiothreitol, 15 Nonidet P-40 (NP-40) and 2% (w/v) polyvinylpyrrolidone, MW
40,000
(PVP-40)) was added to the ground tissue. The tissue was homogenized 1-2
minutes and
quickly decanted to a pre-chilled Oak Ridge centrifuge tube containing 105 ~l
of 20 mg/ml
proteinase K in DEPC treated water. The tissue grinder was rinsed with an
additional 1 ml
hot XT Buffer per g tissue, which was then added to rest of the homogenate.
The
homogenate was incubated at 42°C at 100 rpm for 1.5 h. 2 M KCl was
added to the
homogenate to a final concentration of 160 mM, and the mixture was incubated
on ice for 1
h to precipitate out proteins. The homogenate was centrifuged at 12,000 x g
for 20 min at
4°C, and the supernatant was filtered through sterile miracloth into a
clean 50 ml Oak Ridge
centrifuge tube. 8 M LiCI was added to a final concentration of 2 M LiCI and
incubated on
ice overnight. Precipitated RNA was collected by centrifugation at 12,000 x g
for 20 min at
4°C. The pellet was washed three times in 3-5 ml 4°C 2 M LiCI.
Each time the pellet was
resuspended with a glass rod and then spun at 12,000 x g for 20 min at
4°C. The RNA pellet
was suspended in 2 ml 10 mM Tris-HCl (pH 7.5), and purified from insoluble
cellular
components by spinning at 12,000 x g for 20 min at 4°C. The RNA
containing supernatant
was transferred to a 15 ml Corex tube and precipitated overnight at -
20°C with 2.5 volumes
of 100 % ethanol. The RNA was pelleted by centrifugation at 9,800 x g for 30
min at 4°C.
The RNA pellet was washed in 1-2 ml cold 70°C ethanol and centrifuged
at 9,800 x g for ~
min at 4°C. Residual ethanol was removed from the RNA pellet under
vacuum, and the
RNA was resuspended in 200 q1 DEPC treated dd-water and transferred to a 1.5
ml
microfuge tube. The Corex tube was rinsed in 100 ~1 DEPC-treated dd-water,
which was
46
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
then added to the rest of the RNA. The RNA was then precipitated with 1/10
volume of 3 M
sodium acetate, pH 6.0 and 2.5 volumes of cold 100% ethanol at -20°C
for 1-2 h. The tube
was centrifuged for 20 min at 16,000 x g, and the RNA pellet washed with cold
70%
ethanol, and centrifuged for 5 min at 16,000 x g. After drying the pellet
under vacuum, the
RNA was resuspended in DEPC-treated water. This is the total RNA.
Messenger RNA was purified from total RNA using an Poly(A)Pure kit (Ambion,
Austin TX), following the manufacturer's instructions. A reverse transcription
reaction was
used to synthesize cDNA from the mRNA template, using either the Stratagene
(La Jolla,
CA) or Gibco BRL (Gaithersburg, MD) cDNA cloning kits. For the Stratagene
library, the
cDNAs were subcloned into bacteriophage at EcoRl/XhoI site by ligating the
arms using the
Gigapack III Gold kit (Stratagene, La Jolla, CA), following the manufacturer's
instructions.
For the Gibco BRL library, the cDNAs were subcloned into a tobamoviral vector
that
contained a fusion of TMV-U1 and TMV-U5 at the NotI/Xhol sites.
EXAMPLE 5
Expression of Chinese cucumber cDNA clone p021 D in transfected plants in a
positive
sense confirms that it encodes a-trichosanthin.
We have developed a plant viral vector that directs the expression of a-
trichosanthin
in transfected plants. The open reading frame (ORF) for a-trichosanthin, from
the genomic
clone SEO, was placed under the control of the TMV coat protein subgenomic
promoter.
Infectious RNA from TTU51A QSEO #3 (FIGURE 3; nucleic acid sequence as SEQ ID
NO: 2 and amino acid sequence as SEQ. ID. NO: 3) was prepared by in vitro
transcription
using SP6 DNA-dependent RNA polymerase and was used to mechanically inoculate
N.
benthamiana. The hybrid virus spread throughout all the non-inoculated upper
leaves as
verified by local lesion infectivity assay, and PCR amplification. The viral
symptoms
consisted of plant stunting with mild chlorosis and distortion of systemic
leaves. The 27-
kDa a-trichosanthin accumulated in upper leaves ( 14 days after inoculation)
and cross-
reacted with an anti-trichosanthin antibody.
47
WO 01/07600 CA 02380330 2002-0l-21 pCT/[JS00/202G1
Plasmid Constructions.
An 0.88-kb XhoI, AvrII fragment, containing the a-trichosanthin coding
sequence,
was amplified from genomic DNA isolated from Trichosanthes kirilowii
Maximowicz by
PCR mutagenesis using oligonucleotides QMIX: 5'-GCC TCG AGT GCA GCA TGA TCA
GAT TCT TAG TCC TCT CTT TGC-3' (upstream) (SEQ ID NO: 4) and Q1266A 5'-TCC
CTA GGC TAA ATA GCA TAA CTT CCA CAT CA AAGC-3' (downstream) (SEQ ID
NO: 5). The a-trichosanthin open reading frame was verified by dideoxy
sequencing, and
placed under the control of the TMV-U1 coat protein subgenomic promoter by
subcloning
into TTUS 1 A, creating plasmid TTUS l A QSEO #3.
In vitro Transcriptions Inoculations and Analysis of Transfected Plants.
N. benthaminana plants were inoculated with in vitro transcripts of Kpn I-
digested
TTUS 1A QSEO #3. Virions were isolated from N. benthamiana leaves infected
with
TTUS1A QSEO #3 transcripts.
Purification Immunolo~ical Detection and in vitro Assay of a-Trichosanthin.
Two weeks after inoculation, total soluble protein was isolated from upper,
noninoculated N. benthamiana leaf tissue and assayed from cross-reactivity to
a a-
trichosanthin antibody. The proteins from systemically infected tissue were
analyzed on a
0.1% SDS/12.5% polyacrylamide gel and transferred by electroblotting for 1 hr
to a
nitrocellulose membrane. The blotted membrane was incubated for 1 hr with a
2000-fold
dilution of goat anti-a-trichosanthin antiserum. The enhanced
chemiluminescence
horseradish peroxidase-linked, rabbit anti-goat IgG assay (Cappel
Laboratories) was
performed according to the manufacturer's (Amersham) specifications. The
blotted
membrane was subjected to film exposure times of up to 10 sec. Shorter and
longer
chemiluminescent exposure times of the blotted membrane gave the same
quantitative
results.
48
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
EXAMPLE 6
Expression of bell pepper cDNA in transfected plant in a positive sense
orientation confirms
that it encodes capsanthin-capsorubin s tyn hase.
The biosynthesis of leaf carotenoids in Nicotiana benthamiana was altered by
rerouting the pathway to the synthesis of capsanthin, a non-native chromoplast-
specific
xanthophyll, using an RNA viral vector. A cDNA encoding capsanthin-capsorubin
synthase
(Ccs), was placed under the transcriptional control of a tobamovirus
subgenomic promoter.
Leaves from transfected plants expressing Ccs developed an orange phenotype
and
accumulated high levels of capsanthin. This phenomenon was associated by
thylakoid
membrane distortion and reduction of gram stacking. In contrast to the
situation prevailing
in chromoplasts, capsanthin was not esterified and its increased level was
balanced by a
concomitant decrease of the major leaf xanthophylls, suggesting an
autoregulatory control of
chloroplast carotenoid composition. Capsanthin was exclusively recruited into
the trimeric
and monomeric light-harvesting complexes of Photosystem II. This demonstration
that
higher plant antenna complexes can accommodate non-native carotenoids provides
compelling evidence for functional remodeling of photosynthetic membranes by
rational
design of carotenoids.
Construction of the Ccs expression vector. Unique XhoI, AvrII sites were
inserted into the
bell pepper capsanthin-capsorubin synthase (Ccs) cDNA by polymerase chain
reaction
(PCR) mutagenesis using oligonucleotides: 5'-
GCCTCGAGTGCAGCATGGAAACCCTTCTAAAGCTTTTCC-3' (upstream) (SEQ ID
NO: 6), 5'-TCCCTAGGTCAAAGGCTCTCTATTGCTAGATTGCCC-3' (downstream)
(SEQ ID NO: 7). The 1.6-kb XhoI, AvrII cDNA fragment was placed under the
control of
the TMV-Ul coat protein subgenomic promoter by subcloning into TTOIA, creating
plasmid TTOIA CCS+ (FIGURE 4; nucleic acid sequence as SEQ ID NO: 8 and amino
acid
sequence as SEQ. ID. NO: 9) in the sense orientation as represented by FIGURE
4.
Carotenoid analysis. Twelve days after inoculation upper leaves from 12 plants
were
harvested and lyophilized. The resulting non-saponified extract was evaporated
to dryness
under argon and weighed to determine the total lipid content. Pigment analysis
from the
49
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
total lipid content was performed by HPLC and also separated by thin layer
chromatography
on silica gel G using hexane / acetone (60:40 (V/V)). Plants transfected with
TTOIA CCS+
accumulated high levels of capsanthin (36% of total carotenoids).
EXAMPLE 7
Expression of cDNAs encoding_tomato ph oene synthase and phytoene desaturase
in a
positive and anti sense orientation in Nicotiana benthamiana.
Isolation of tomato mosaic virus cDNA. An 861 base pair fragment (5524-6384)
from the
tomato mosaic virus (fruit necrosis strain F; tom-F) containing the putative
coat protein
subgenomic promoter, coat protein gene, and the 3'-end was isolated by PCR
using primers
5'-CTCGCAAAGTTTCGAACCAAATCCTC-3' (upstream) (SEQ ID NO: 10) and S'-
CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (downstream) (SEQ ID NO:
11) and subcloned into the HincII site of pBluescript KS-. A hybrid virus
consisting of
TMV-Ul and ToMV-F was constructed by swapping an 874-by BamHI-KpnI ToMV
fragment into pBGC152, creating plasmid TTO1. The inserted fragment was
verified by
dideoxynucleotide sequencing. A unique AvrII site was inserted downstream of
the XhoI
site in TTO1 by PCR mutagenesis, creating plasmid TTOIA, using the following
oligonucleotides: 5'-TCCTCGAGCCTAGGCTCGCAAAGTTTCGAACCAAATCCTCA-3'
(upstream) (SEQ ID NO: 12), 5'-
CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (downstream) (SEQ ID NO:
13).
Isolation of a cDNA encoding tomato phytoene synthase and a partial cDNA
encoding
tomato ph~toene desaturase. Partial cDNAs were isolated from ripening tomato
fruit RNA
by polymerase chain reaction (PCR) using the following oligonucleotides: PSY,
5'-
TATGTATGGTGCAGAAGAACAGAT-3' (upstream) (SEQ ID NO: 14), 5'-
AGTCGACTCTTCCTCTTCTGGCAT C-3' (downstream) (SEQ ID NO: 15); PDS, 5'-
TGCTCGAGTGTGTTCTTCAGTTTTCTGTCA-3' (SEQ ID NO: 16) (upstream), 5'-
AACTCGAGCGCTTTGATTTCTCCGAAGCTT-3' (downstream) (SEQ ID NO: 17).
Approximately 3 X 10~ colonies from a Lycopersicon esculentum cDNA library
were
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
screened by colony hybridization using a 3''P labeled tomato phytoene synthase
PCR
product. Hybridization was carried out at 42°C for 48 hours in 50%
formamide, 5X SSC,
0.02 M phosphate buffer, SX Denhart's solution, and 0.1 mg/ml sheared calf
thymus DNA.
Filters were washed at 65°C in O.1X SSC, 0.1% SDS prior to
autoradiography. PCR
products and the phytoene synthase cDNA clones were verified by
dideoxynucleotide
sequencing.
DNA seauencin~ and computer analysis. A PstI, BamHI fragment containing the
phytoene
synthase cDNA and the partial phytoene desaturase cDNA was subcloned into
pBluescript~
KS+ (Stratagene, La Jolla, California). The nucleotide sequencing of KS+/PDS
#38 and
KS+/ 5'3'PSY was carried out by dideoxy termination using single-stranded
templates
(Maniatis, Molecular Cloning, 15' Ed.) Nucleotide sequence analysis and amino
acid
sequence comparisons were performed using PCGENE~ and DNA Inspector~ IIE
programs.
Construction of the tomato phytoene synthase expression vector. A XhoI
fragment
containing the tomato phytoene synthase cDNA was subcloned into TTO1. The
vector
TTOI/PSY + (FIGURE 5; nucleic acid sequence as SEQ ID NO: 18 and amino acid
sequence as SEQ. ID. NO: 19) contains the phytoene synthase cDNA in the
positive
orientation under the control of the TMV-Ul coat protein subgenomic promoter;
while, the
vector TTO1/PSY - contains the phytoene synthase cDNA in the antisense
orientation.
Construction of a viral vector containine a partial tomato phvtoene desaturase
cDNA. A
.~'hoI fragment containing the partial tomato phytoene desaturase cDNA was
subcloned into
TTO1. The vector TTOIA/PDS + (FIGURE 6) contains the phytoene desaturase cDNA
in
the positive orientation under the control of the TMV-U1 coat protein
subgenomic promoter;
while the vector TTOIA/PDS - contains the phytoene desaturase cDNA in the
antisense
orientation.
Analysis of N benthamiana -transfected byTT01/PSY+ TTO1/PSY-. TTOIA/PDS +.
TTO1/PDS -. Infectious RNAs from TTOI/PSY+, TTO1/PSY-,TTO1/PDS +, and
51
WO 01/07600 CA 02380330 2002-0l-21 pCT~JS00/202G1
TTOI/PDS-, were prepared by in vitro transcription using SP6 DNA-dependent RNA
polymerase -as described previously (Dawson et al., Proc. Natl. Acad. Sci. USA
85:1832
(1986)) and were used to mechanically inoculate N benthamiana. The hybrid
viruses spread
throughout all the non-inoculated upper leaves as verified by transmission
electron
microscopy, local lesion infectivity assay, and polvmerase chain reaction
(PCR)
amplification. The viral symptoms resulting from the infection consisted of
distortion of
systemic leaves and plant stunting with mild chlorosis. The leaves from plants
transfected
with TTO1/PSY+ turned orange and accumulated high levels of phytoene while
those
transfected with TTO1/PDS+ and TTO1/PDS- turned white. Agarose gel
electrophoresis of
PCR cDNA isolated from virion RNA and Northern blot analysis of virion RNA
indicate
that the vectors are maintained in an extrachromosomal state and have not
undergone any
detectable intramolecular rearrangements.
Purification and analysis of carotenoids from transfected plants. The
carotenoids were
isolated from systemically infected tissue and analyzed by HPLC
chromatography.
Carotenoids were extracted in ethanol and identified by their peak retention
time and
absorption spectra on a 25-cm Spherisorb~ ODS-15- m column using
acetonitrile/methanol/2-propanol (85:10:5) as a developing solvent at a flow
rate of 1
ml/min. They had identical retention time to a synthetic phytoene standard and
~3-carotene
standards from carrot and tomato. The phytoene peak from N. benthamiana
transfected with
TTO1/PSY + had an optical absorbance maxima at 276, 285, and 298 nm. Plants
transfected
with viral encoded phytoene synthase showed a ten-fold increase in phvtoene
compared to
the levels in noninfected plants. The expression of sense and antisense RNA to
a partial
phytoene desaturase in transfected plants increased the level of phytoene and
altered the
biochemical pathway; it thus inhibited the synthesis of colored carotenoids
and caused the
systemically infected leaves to turn white. HPLC analysis of these plants
revealed that they
also accumulated phytoene. The white leaf phenotype was also observed in
plants treated
with the herbicide norflurazon which specifically inhibits phytoene
desaturase.
This change in the levels of phytoene represents one of the largest increases
of any
carotenoid (secondary metabolite) in any genetically engineered plant. Plants
transfected
with viral-encoded phytoene synthase in a plus sense showed a ten-fold
increase in phytoene
52
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
compared to the levels in noninfected plants. In addition, the accumulation of
phytoene in
plants transfected with antisense phytoene desaturase suggests that viral
vectors can be used
as a potent tool to manipulate pathways in the production of secondary
metabolites through
cytoplasmic antisense inhibition. Leaves from systemically infected TTOIA/PDS+
plants
also accumulated phytoene and developed a bleaching white phenotype; the
actual
mechanism of inhibition is not clear. These data are presented by Kumagai et
al., Proc.
Natl. Acid. Sci. USA 92:1679-1683 (1995).
EXAMPLE 8
Expression o~hytoene desaturase in transfected plants using a multipartitie
viral vector
Construction of a monocot viral vector. BSMV is a tripartite RNA virus that
infects many
agriculturally important monocot species such as oat, wheat and barley
(McKinney and
Greeley, "Biological characteristics of barley stripe mosaic virus strains and
their evolution"
Technical Bulletin U. S. Department ofAgriculture 1324 (1965)). An expression
vector
derived from barley stripe mosaic virus (BSMV) was constructed by modifying a
BSMV Y
cDNA -(Gustafson et al., Virology 158(2):394-406 (1987)) (Figure 7A). In this
example, we
developed a monocot viral vector that directs the expression of nucleotide
sequences in
transfected plants. Foreign inserts can be placed under the control of the yb
subgenomic
promoter. The infectious BSMV Y cDNA (y.42) was modified by site-directed
mutagenesis.
Nucleotides 5098-5103 of Y.42 were replaced with a Nhe I site. Using
polymerise chain
reaction (PCR) mutagenesis, a 646 by Nhe I fragment, containing the zeomycin
resistance
gene as a cloning marker, was amplified from pZErO (Invitrogen Corporation,
Carlsbad, CA,
USA) using the oligonucleotides S'
TATGCTAGCTGATTAATTAAGTCGACGAGCTGATTTAACAAATTTTAAC 3'
(upstream) (SEQ. ID. NO: 20) and S'
TATGCTAGCTGAGCGGCCGCGCACGTGTCAGTCCTGC
TCCTCGG 3' (downstream) (SEQ. ID. NO: 21), and inserted into the Nhe site of
the BSMV
y cDNA. This generated two plasmids, y.yb.st.P/N-zeo (positive orientation)
and y.yb.st.N/P-
zeo (negative orientation), with PacI and NotI sites flanking the zeomycin
resistance gene
(Figure 7B).
53
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
To improve the expression of the y subgenomic RNA1, an infectious BSMV beta
(b) cDNA (~342SpI) (Petty et al., Virology 179(2):712-8 (1990)) was modified
by
substituting the majority of the coat protein ORF by PCR mutagenesis. A 423 by
fragment
was amplified from ~342SpI using the oligonucleotides 5'
GGAAAGCCGGCGAACGTGGCG 3' (upstream) (SEQ. ID. NO: 22) and 5'
TATATTCGAATCTAGAATCGATGCTAGCTTGCATGCTGTGAAGTGG
TAAAAGAAATGC 3' (downstream) (SEQ. ID. NO: 23) and cloned into the NgoMIV and
BstBI sites of creating plasmid (3.D~a. This construct contains only an
untranslated portion
of the coat protein ORF that is required for expression of the subsequent (3
RNA ORFs
(Figure 7C).
Construction of monocot viral vectors the contain partial maize phytoene
desaturase cDNAs.
Partial cDNAs encoding phytoene desaturase (PDS) were amplified from corn leaf
tissue
RNA by RT-PCR using oligonucleotides pairs 175 S'
ATATTAATTAACATGGACACTGGCTGCCTGTC 3' (upstream) (SEQ. ID. NO: 24) and
180 S' TATGCGGCCGCCTACAAAGCAATCAAAATGCACTG 3' (downstream) (SEQ.
>D. NO: 25) encoding PDS Met'- Leu~~°, pairs 177 5'
ATATTAATTAACAAGGTAGCTGCTTGGAAGGATG 3' (upstream) (SEQ. ID. NO: 26)
and 178 5' TATGCGGCCGCCTAGCAGGTTACTGACATGTCTGC 3' (downstream)
(SEQ. ID. NO: 27) encoding PDS Lys"'- Cys4", and pairs 179 5'
ATATTAATTAACCAGTGCATTTTGATTGCTTTG 3' (upstream) (SEQ. ID. NO: 28) and
176 5' TATGCGGCCGCCTAAGATGGGACGGGAACTTCTCC 3' (downstream) (SEQ.
ID. NO: 29) encoding PDS G1n28'- Sers". The 0.8 Kb amplified Pac I and Not I
fragments
containing the partial cDNAs encoding corn PDS were placed under the control
of the
BSMV yb subgenomic promoter by subcloning into the PacI and NotI sites
y.yb.st.P/N-zeo
and y. yb.st.N/P-zeo. This eliminated the Zeocin resistance gene and created
plasmids with
PDS inserts in the positive orientation (y.yb.st.P/N-mPDS-N, y.yb.st.P/N-mPDS-
M, and
y.yb.st.P/N-mPDS-C) and negative orientation (y.yb.st.P/N-mPDS-N as,
y.yb.st.P/N-mPDS-
M as, and y.yb.st.P/N-mPDS-C as).
54
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
Analysis of barley plants transfected with y.yb.st.P/N-mPDS. Infectious BSMV
RNAs from
cDNA clones were prepared by in vitro transcription using T7 DNA-dependent RNA
polymerise (Ambion) as described previously (Petty, et al., Virology
171(2):342-9 (1989)).
Transcripts of each of the three BSMV genomes were mixed in a 1:1:1 ratio. A 7
u1 aliquot
of the transcription mix was combined with 40 ~L of FES and directly applied
to 12 day old
black hulless barley plants. The BSMV::mPDS hybrid viruses spread throughout
the non-
inoculated leaves. The initial viral symptoms (1-7 days post inoculation)
resulting from the
PDS containing constructs displayed symptoms similar to a wild type BSMV
infection. 8-
days post inoculation, the BSMV-PDS plants began to exhibit streaks and
patches of
unusually white tissue. The affected areas lacked the necrosis or desiccation
that is often
associated with BSMV induced bleaching and more like the bleached tissue found
in plants
treated with the chemical inhibitor of PDS, norflurazon. These white streaks
were observed
to some degree in all the BSMV::mPDS infected plants, although the most
extensive areas
of bleaching were generally found on the plants infected with BSMV containing
PDS in the
sense orientation.
Purification and analysis of carotenoids from transfected barley plants. The
carotenoids
were isolated from 50 mg of systemically infected leaf tissue 18 days post
inoculation and
analyzed by HPLC chromatography. Carotenoids were extracted in the dark in
methanol
and identified by their peak retention time and absorption spectra on a Zorbax
4.6 X 15 cm
C-18 column using acetonitrile/methanol/2-propanol (85:10:5) as a developing
solvent at a
flow rate of 2 ml/min. They had identical retention times to a synthetic
phytoene standard
and ~3-carotene standards from tomato and carrot. The expression of sense and
antisense
RNA to the partial maize phytoene desaturase in transfected barley inhibited
the synthesis of
colored carotenoids and caused the systemically infected tissue to turn white.
HPLC
analysis of these plants revealed that they also accumulated phytoene. The
white leaf
phenotype was also observed in barley plants treated with the herbicide
norflurazon which
specifically inhibits phytoene desaturase. Phytoene extracted from barley
transfected with
BSMV-PDS was analyzed by HPLC, had a retention time similar to that of a
phytoene
standard, and showed a 10-60 fold increase over the levels in a BSMV
transfected control
plant.
WO 01/07600 CA 02380330 2002-0l-21 pCT~S00/20261
Our results that phytoene accumulated in barley plants transfected with
partial
antisense and positive sense phytoene desaturase suggests that plant viral
vectors can be
used to manipulate biosynthetic pathways in monocots through cytoplasmic
inhibition of
endogenous gene expression.
EXAMPLE 9
Expression of bacterial CrtB gene in transfected plants in a positive sense
orientation
confirms that it encodes phvtoene svnthase.
We developed a new viral vector, TTU51, consisting of tobacco mosaic virus
strain
U1 (TMV-U1) (Goelet et al., Proc. Natl. Acad. Sci. USA 79:5818-5822 (1982)),
and tobacco
mild green mosaic virus (TMGMV; U5 strain) (Sobs et al., 177:553-8 (1990)).
The open
reading frame (ORF) for Erwinia herbicola phytoene synthase (CrtB) (Armstrong
et al.,
Proc. Natl. Acad. Sci. USA 87:9975-9979 (1990)) was placed under the control
of the
tobacco mosaic virus (TMV) coat protein subgenomic promoter in the vector
TTU51. This
construct also contained the gene encoding the chloroplast targeting peptide
(CTP) for the
small subunit of ribulose-1,5-bisphosphate carboxylase (RUBISCO) (O'Neal et
al., Nucl.
Acids Res. 15:8661-8677 (1987)) and was called TTU51 CTP CrtB as represented
by
FIGURE 8 (Nucleic acid sequence as SEQ. ID. NO: 30 and amino acid sequence as
SEQ.
ID. NO: 31 ). Infectious RNA was prepared by in vitro transcription using SP6
DNA-
dependent RNA polymerase (Dawson et al, Proc. Natl. Acad. Sci. USA 83:1832-
1836
(1986)); Susek et al., Cell 74:787-799 (1993)) and was used to mechanically
inoculate N
benthamiana. The hybrid virus spread throughout all the non-inoculated upper
leaves and
was verified by local lesion infectivity assay and polymerase chain reaction
(PCR)
amplification. The leaves from plants transfected with TTU51 CTP CrtB
developed an
orange pigmentation that spread systemically during plant growth and viral
replication.
Leaves from plants transfected with TTU51 CTP CrtB had a decrease in
chlorophyll
content (result not shown) that exceeded the slight reduction that is usually
observed during
viral infection. Since previous studies have indicated that the pathways of
carotenoid and
chlorophyll biosynthesis are interconnected (Susek et al., Ce1174:787-799
(1993)), we
decided to compare the rate of synthesis of phytoene to chlorophyll. Two weeks
post-
inoculation, chloroplasts from plants infected with TTU51 CTP CrtB transcripts
were
56
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
isolated and assayed for enzyme activity. The ratio of phvtoene synthetase to
chlorophyll
syntheses was 0.55 in transfected plants and 0.033 in uninoculated plants
(control).
Phytoene synthase activity from plants transfected with TTUS 1 CTP CrtB was
assayed using
isolated chloroplasts and labeled [ 14C] geranylgeranyl PP. There was a large
increase in
phytoene and an unidentified C4p alcohol in the CrtB plants.
Phytoene synthetase assay.
The chloroplasts were prepared as described previously (Camara, Methods
Enzymol.
214:352-365 (1993)). The phytoene synthase assays were carried out in an
incubation
mixture (0.5 ml final volume) buffered with Tris-HCL, pH 7.6, containing [
14C]
geranylgeranyl PP (100,000 cpm) (prepared using pepper GGPP synthase expressed
in E.
coli), 1 mM ATP, 5 mM MnCl2, 1 mM MgCl2, Triton X-100 (20 mg per mg of
chloroplast
protein) and chloroplast suspension equivalent to 2 mg protein. After 2 h
incubation at
30°C, the reaction products were extracted with chloroform methanol
(Camara, supra) and
subjected to TLC onto silicagel plate developed with benzene/ethyl acetate
(90/10) followed
by autoradiography.
Chlorophyll synthetase assay.
For the chlorophyll synthetase assay, the isolated chloroplasts were lysed by
osmotic
shock before incubation. The reaction mixture (0.2 ml, final volume)
consisting of 50 mM
Tris-HCL (pH 7.6) containing [14C] geranylgeranyl PP (100,000 cpm), 5 MgCl2, 1
mM
ATP, and ruptured plasmid suspension equivalent to 1 mg protein was incubated
for 1 hr at
30°C. The reaction products were analyzed as described previously.
Plasmid Constructions.
The chloroplast targeting, phytoene synthase expression vector, TTU51 CTP CrtB
as
represented in FIGURE 8, was constructed in several subcloning steps. First, a
unique SphI
site was inserted in the start codon for the Erwinia herbicola phytoene
synthase gene by
polymerase -chain reaction (PCR) mutagenesis (Saiki et al., Science 230:1350-
1354 (1985))
using oligonucleotides CrtB M1S 5'-CCA AGC TTC TCG AGT GCA GCA TGC AGC
AAC CGC CGC TGC TTG AC-3' (upstream) (SEQ ID NO: 32) and CrtB P300 5'-AAG
57
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
ATC TCT CGA GCT AAA CGG GAC GCT GCC AAA GAC CGG CCG G-3'
(downstream) (SEQ ID NO: 33). The CrtB PCR fragment was subcloned into
pBluescript~
(Stratagene) at the EcoRV site, creating plasmid pBS664. A 938 by SphI, XhoI
CrtB
fragment from pBS664 was then subcloned into a vector containing the sequence
encoding
the N. tabacum chloroplast targeting peptide (CTP) for the small subunit of
RUBISCO,
creating plasmid pBS670. Next, the tobamoviral vector, TTUS 1, was
constructed. A 1020
base pair fragment from the tobacco mild green mosaic virus (TMGMV; US strain)
containing the viral subgenomic promoter, coat protein gene, and the 3'-end
was isolated by
PCR using TMGMV primers 5'-GGC TGT GAA ACT CGA AAA GGT TCC GG-3'
(upstream) (SEQ ID NO: 34) and 5'-CGG GGT ACC TGG GCC GCT ACC GGC GGT
TAG GGG AGG-3' (downstream) (SEQ ID NO: 35), subcloned into the HincII site of
Bluescript KS-, and verified by dideoxynucleotide sequencing. This clone
contains a
naturally occurring duplication of 147 base that includes the whole upstream
pseudoknot
domain in the 3' noncoding region. The hybrid viral cDNA consisting of TMV-U1
and
TMGMV was constructed by swapping a 1-Kb XhoI-KpnI TMGMV fragment into TTOl
(Kumagai et al., Proc. Natl. Acad. Sci. USA 92:1679-1683 (1995)), creating
plasmid TTU51.
Finally, the 1.1 Kb XhoI CTP CrtB fragment from pBS670 was subcloned into the
XhoI of
TTU51, creating plasmid TTU51 CTP CrtB. As a CTP negative control, a 942 by
XhoI
fragment containing the CrtB gene from pBS664 was subcloned into TTUS 1,
creating
plasmid TTU51 CrtB #15.
EXAMPLE 10
Identification of nucleotide sequences involved in the regulation of plant
growth by
cytoplasmic inhibition of gene expression in a positive sense orientation
using viral derived
RNA.
In this example, we show: (1) a method for producing plus sense RNA using an
RNA
viral vector, (2) a method to produce viral-derived sense RNA in the
cytoplasm, (3) a
method to enhance or suppress the expression of endogenous plant proteins in
the cytoplasm
by viral antisense RNA, and (4) a method to produce transfected plants
containing viral plus
sense RNA; such methods are much faster than the time required to obtain
genetically
engineered sense transgenic plants. Systemic infection and expression of viral
plus sense
58
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
RNA occurs as short as four days post inoculation, whereas it takes several
months or longer
to create a single transgenic plant. This example demonstrates that novel
positive strand
viral vectors, which replicate solely in the cytoplasm, can be used to
identify genes involved
in the regulation of plant growth by enhancing or inhibiting the expression of
specific
endogenous genes. This example also enables one to characterize specific genes
and
biochemical pathways in transfected plants using an RNA viral vector.
Tobamoviral vectors have been developed for the heterologous expression of
uncharacterized nucleotide sequences in transfected plants. A partial
Arabidopsis thaliana
cDNA library was placed under the transcriptional control of a tobamovirus
subgenomic
promoter in a RNA viral vector. Colonies from transformed E. coli were
automatically
picked using a Flexys robot and transferred to a 96 well flat bottom block
containing terrific
broth (TB) Amp 50 ug/ml. Approximately 2000 plasmid DNAs were isolated from
overnight cultures using a BioRobot and infectious RNAs from 430 independent
clones were
directly applied to plants. One to two weeks after inoculation, transfected
Nicotiana
benthamiana plants were visually monitored for changes in growth rates,
morphology, and
color. One set of plants transfected with 740 AT #2441 were severely stunted.
DNA
sequence analysis revealed that this clone contained an Arabidopsis Ran GTP
binding
protein open reading frame (ORF) in a plus sense orientation. This
demonstrates that an
episomal RNA viral vector can be used to deliberately alter the metabolic
pathway and cause
plant stunting. In addition, our results show that the Arabidopsis plus sense
transcript can
cause phenotypic changes in N. benthamiana.
Construction of an Arabid~sis thaliana cDNA library in an RNA viral vector.
An Arabidopsis thaliana CD4-13 cDNA library was digested with NotI. DNA
fragments between 500 and 1000 by were isolated by trough elution and
subcloned into the
NotI site of pBS740. E. coli C600 competent cells were transformed with the
pBS740 AT
library and colonies containing Arabidopsis cDNA sequences were selected on LB
Amp 50
ug/ml. Recombinant C600 cells were automatically picked using a Flexys robot
and then
transferred to a 96 well flat bottom block containing terrific broth (TB) Amp
50 ug/ml.
Approximately 2000 plasmid DNAs were isolated from overnight cultures using a
BioRobot
(Qiagen) and infectious RNAs from 430 independent clones were directly applied
to plants.
59
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
Isolation of a gene encoding a GTP bindine protein.
One to two weeks after inoculation, transfected Nicotiana benthamiana plants
were
visually monitored for changes in growth rates, morphology, and color. Plants
transfected
with 740 AT #2441 (FIGURE 9) were severely stunted. Plasmid 740 AT #2441
contains the
TMV-U1 open reading frames (ORFs) encoding 126-, 183-, and 30-kDa proteins,
the TMV-
US coat protein gene (I15 cp), the T7 promoter, an _Arabidopsis thaliana CD4-
13 NotI
fragment, and part of the pUCl9 plasmid. The TMV-U1 subgenomic promoter
located
within the minus strand of the 30-kDa ORF controls the synthesis of the CD4-13
subgenomic RNA.
DNA sequencing and computer analysis.
A 841 by NotI fragment of 740 AT #2441 (FIGURE 10; nucleic acid sequence and
amino
acid sequence as SEQ ID NOs: 36 and 37, respectively) containing the Ran GTP
binding protein
cDNA was characterized. The nucleotide
sequencing of 740 AT #2441 was carried out by dideoxy termination using double
stranded
templates. Nucleotide sequence analysis and amino acid sequence comparisons
were
performed using DNA Strider, PCGENE and NCBI Blast programs. 740 AT #2441
contained an open reading frame (ORF) in the positive orientation that encodes
a protein of
221 amino acids with an apparent molecular weight of 25,058 Da. The mass of
the protein
was calculated using the Voyager program (Perceptive Biosystems). FIGURE 11
shows the
nucleotide sequence alignment of 740AT #2441 to AF017991 (SEQ. ID. Nos: 38 and
39
respectively), a A. thaliana salt stress inducible small GTP binding protein
Ranl. FIGURE
12 shows the nucleotide alignment of 740 AT #2441 to L16787 (SEQ. ID. Nos: 40
and 41
respectively), a N. tabacum small ras-like GTP binding protein. FIGURE 13
shows the
amino acid comparison of 740 AT #2441 to tobacco Ran-B 1 GTP binding protein
(SEQ. ID.
Nos: 42 and 43 respectively).
The A. thaliana cDNA exhibits a high degree of homology (99% to 82%) to .A.
thaliana, tomato (L. esculentum), tobacco (N. tabacum), L. japonicus and bean
(Y. faba) GTP
binding proteins cDNAs (Table 1 ). The nucleotide sequence from 740 AT #2441
encodes a
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
protein that has strong similarity (100% to 95%) to A. thaliana, tomato,
tobacco, and bean
GTP binding proteins (Table 2).
The #2441 DNA also exhibits a high degree of homology (67% to 83%) to human,
yeast, mouse and drosophila GTP binding proteins cDNAs (Table 3). The protein
also has
67%-97% identities, and 79%-98% positives to yeast, mammalian organisms such
as human
(Table 4)
61
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
0 0 o c ~ o ~ c~ 0 0
,C~ G1 GO N M N N N N N --~
O> G1 00 00 00 00 00 00 00 00
..i
00 00 00 I~ I~ U1 '~ N ~ ~1 00
7 M M M I~ V I~ l~ t~ ~O M ~'
r I~ r ~J Vr ': ~ ~.J sJ ~J ~J
w v w ~ w w w w w w w
~v~MMM ~~.f~0I~00~O~
O M f~ M ~O ~ ~ ~J ~1 ~' N M
l~ (~ I~ N V~ ~ V7 N V1 V~ V1
~ o ~ 0 0 0 0 o c o 0
J~ G1 G~ N M N N N N N ~
~~ O~ G1 ~ 00 00 00 00 00 00 00 00
~r ~
ø, U o0 00 00 t~ t~ ~ V N ~ t!1 00
M M M ~ \'J f~ I~ (~ IO M
I~ I~ _l~ ~_J V_' _~V' ~_J' _V' ~O _~J ~O
O M M O ~-~ V' I~ O (~ 00 ~D
U I~ M M ~.:~ V'1 V'1 ~J V1 ~ N M
I~ I~ I~ V7 V1 N ~ V1 N U1 N
U
C
U
U
.b
O
_U
U
Z o 0 0 °' c' ~ c' °° 'r
Q7 ~ O O i . i i . i
W W W W W W W W W W W
N ~ O O O O O O O O O O O
~t ' O O O ~n O~ O ~ M t~ O (~
(~ O O O ~ M M ~Y M t~ M C1
Q
O
U _ _ ~
r _ w_ ~_ ~_ _ ~_ _ ~_
N N .D ~ ~ .fl '~ ~ .L
I~ I~ ~ O~ ~!1 ~-~ ~ ~ 00 N M
O O OWO v'1 G~ ~n N t~ ~'J ~
O O ,n ~ ~ M d' ~ N O O
r. .~ Q~ ~D V' ~ Vr ~O ~ ~O ~J
v7 V~ 00 ~ ~ ~ M N ~ G1 00
~~L'~~'J~JMMMMMN~-"~-'
C/~~MMMNNNNNNNN
-. O ~ M
01 ~O .~ .-. ~
01 v7 '-' (W~ I~ l~ ~ O Q~
t~ l~ ~ GO ~ 00 00
01
O ~~.. ~ ,-.~ ~ W .~ CO ~_ I~ f~
W V~
G
G G ~ ~ C ~ ~ N
_ ~ U U
G G G .~ U .~ ,~; N U ~~ ~'
:~. :" ~, ~ G .~; ~. G G O O
U G G G L ~O 'v L ~O ~O
v ~ '~ ~ G y~
UI Q ~C ~C ~-7 ~ ~ ~7 ~ ~ ~ N
62
WO 01/07600 CA 02380330 2002-0l-21 pCT/IJS00/20261
.-. i-. ~ ~ .-. i-. ~-. ~ .-.
0 0 0 0 0 0 0 0 0 o a
O o ~ \ \ \ ~ \ \ o
O O~ G~ oo t~ oo WD ~ t~ a1 00
.-. C~ G1 Q\ Q1 G1 G~ 01 U~ ~ Q\
,.,., ,--. ~ .~ r- .-. ~ .-. .~ .~ G1 01
> N N N N N N N N N N O O
N N N N N N N N N N N N
w w w w ~ w w ~ w w w
v~ C G1 00 ~ I~ <f ~t ~ N_ ~ O
G.~ N N N N N N N N N N N N
O c ~ \ \ \ \ \ \ ~ ~ o
O o0 ~ t~ v~ v~ own ~n U1 00 I
r-. G'~ ..~~ Q1 ~1 ~ ''1 ~ ~ G1 ~ G1
yr w. ~ ~ ~ wr
y _ ~ Ov G1
'.~ N N N N N N N N N N O O
'~ N N N N N N N N N N N _N
r ~ ~ ~ ~ ~ N ~ N N ~ O
O ~ N ,., .-, .-. .-. ~ ..-. ,-. O O
N N N N N N N N N N N N
cb
r
r_
O
U
N O O G~ t~ ~J ~ Wn ~n --~ O
yJ ~ ~ ~n ~n vo v'Wn ~n v~ v> vo
~ ~ ~
~ i i i i i i i i i i i
W W W W W W L7 W W W W W
O O O O O ~ O O O O O O
> ~ .-. N V1 ~ N M ~'
... C,'~ ~ N N
.O
O ~ ~ ~ .~ ~.
C ~n cn ~ v~ ~n ~n ~ cn ~n v~ ~n ~n
fl .fl .D ~~. ~ ,~ ~ .fl
.--~ 00 00 ~Y G1 ~D I~ M M '~t N ~"
~t ~t ~h M VO ~ M N ~ O '.O
M M M M M M ~'
V1 ~ ~1 N V7 U1 N N V7 N N N
a ~ W r ~ W r wr yr ~
N N N O~ v1 O o0 v1 M
t~ ~_O V'~ v_~ '~ ~ ~t ~' ~' O
U r. ~ ~ ~ .... ~ ~ '-' .-,
O
N
N
N
00 ~t G'~ ~ '~~7
D1 ~ G~ 00 t~
,.-. ~ M M ~'
w ~
d 00 E-'° CJ d ~ ~-' ~ E'~
Q ~ ~ J a O O
..'~~ ~ ~ O Q Q NI O .~I d '-~I
N' z m~ z ' z z
0 0 o z > z ~ z ~ z ~ Q
~; , x
~, ~, ~-, ~ Q ~ ~ ~ ~ ~ 3 3
a, a. c~
~_ ~ ~ ~ ~ ~_
'~ ~' ~ U U_
CS CS a U~_.G'v_ ~r_.
'" ,.p .~~ Ci v -C> V ~ O O
_O
UI <C ~ ~ ~ ~ ~C ~l ~ ~ ~ N ~7
63
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
j I
I
i
I
i 0 0
I .
. ~ .
i 0 0 0 0
o o c
\ \
0 ~ 0 . ~ . .
o . .
0 0 oo ~ t~ > ~--~......O .. ..
> G~ O~ N y N O O N t~ O
"J 00 V7 O N N ~f \ N
',..,'J 'O O M <t' O 00 ~~ ~ l~ ~ M
in~ O N ~ M A"' 00 (~ ~1 V'
~ I cNn
N
0 0 0 0 0 0
O ~O O t~ I~ M I
~ l~ o0 I~ I~ I~ ~J
\ ~ o ~ y w r
~ , .~ O C O I~ O
~D ~O ~:7~ ~J y, ~
. ~ N N N N ~ N
W N G~ v~ I N U ~ ~ ~ ~ o0
..-~~. ~J o0 U b I
L,]'I I .-.
~D ~_ i
I I
M
~
O ~ t~ O N ~t M ~ I
U I .~N M N h ~ U
y --.~~ V '~ N N
M
N O ~ ~' N N
_ .~ U N N ~ ~- O O
" ~ O ~ .-~.--..--..--. .-.
O O O V~ cpC ~ LL7W W W W W
7 ~' ~ ~ ~ c~3O O O O O O
7 i i i i i O > ,~ N V7
b ~ W W W W W _~ . .
~ O O C O O p., N N M t'
O r-.Q~ M t~
,~ > .-.M ~ N M d
(1,
U
.,
~ ~ y ~ ~ y
_ _ _ _ _ _
N ~, ,~ ..r...
.a .fl~
._-~..~~_.w_ y_ ~ E"~ 01 N ~' ~ 00 M
N
~ .fl~ d t~ ~t I~ ~ N M
N -. r-.Ov O1 M V~
i "" ~ 01 ~ C ~. d' M M M M
M v~ O~ ~D ~
00 00 ~ . O C~ _ ~ ~
. M M M t~ I~ O ~ ~ 0 O
N
~ N ~ Cl~00 00 00 00 l~ t~
M ~)M M M i
U E-. ~ G1
cc
O i M
r N 0 M
~ ~ O Q.
M .~ .
pp M ~ ~ O l O
I y.
a d ~ ~ M
v w z z ~
x x z N
~ Q N ,
G ~ N v
- s U ~ M ' 7
b ~ ~ ~ ~
,~ W _
~ .. .-~
fl ~ p U ~ ~ ~ _
U ~ ~ U ~ ~ ~ ~
~ E" b . a
t-c3.E.."[~ ~ p v, ~ ~ 0
O ~ U ~ ~_ 'j _~ ~_ ' ~_
~ ~ ~ U "C7 ~ N ~ ~.
x ~ ~ U ~1 U
64
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
MALDI-TOF analysis of N benthamiana transfected with 740 AT #2441
days after inoculation, the apical meristem, leaves, and stems from N.
benthamiana transfected with 740 AT #2441. were frozen in liquid nitrogen. The
soluble
proteins were extracted in grinding buffer ( l 00mM Tris, pH 7.5, 2 mM EDTA, 1
mM PMSF,
10 mM BME) using a mortar and pestle. The homogenate was filtered through four
layers of
cheesecloth and spun at 10, 000 X g for 1 S min. The supernatant was decanted
and spun at
100, 000 X g for 1 hr. A S00 ~l aliquot of the supernant was mixed with S00
~.l 20% TCA
(acetone/0.07% BME) and stored at 4° C overnight. The supernant was
analyzed by
MALDI-TOF. (Karas et al., Anal. Chem. 60:2299-2301 (1988)). The results showed
that the
soluble proteins contained a newly expressed protein of molecular weight
2S,OS8.
Isolation of an Arabidoz~sis thaliana GTP binding protein ~enomic clone
A genomic clone encoding A. thaliana GTP binding proteins can be isolated by
probing
filters containing A. thaliana BAC clones using a 3'-P-labelled 740 AT #2441
NotI insert.
Other members of the A. thaliana ARF multigene family have been identified
using
programs of the University of Wisconsin Genetic Computer Group.
EXAMPLE 11
Identification of nucleotide sequences involved in the regulation of plant
growth by
~o~lasmic inhibition of e~ ne expression in an antisense orientation using
viral derived
RNA (GTP binding proteins).
In this example, we show: (1) a method for producing antisense RNA using an
RNA
viral vector, (2) a method to produce viral-derived antisense RNA in the
cytoplasm, (3) a
method to inhibit the expression of endogenous plant proteins in the cytoplasm
by viral
antisense RNA, and (4) a method to produce transfected plants containing viral
antisense
RNA, such method is much faster than the time required to obtain genetically
engineered
antisense transgenic plants. Systemic infection and expression of viral
antisense RNA
occurs as short as several days post inoculation, whereas it takes several
months or longer to
create a single transgenic plant. This example demonstrates that novel
positive strand viral
vectors, which replicate in the cytoplasm, can be used to identify genes
involved in the
regulation of plant growth by inhibiting.the expression of specific endogenous
genes. This
6S
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
example enables one to characterize specific genes and biochemical pathways in
transfected
plants using an RNA viral vector.
Tobamoviral vectors have been developed for the heterologous expression of
uncharacterized nucleotide sequences in transfected plants. A partial
Arabidopsis thaliana
cDNA library was placed under the transcriptional control of a tobamovirus
subgenomic
promoter in a RNA viral vector. Colonies from transformed E. coli were
automatically
picked using a Flexys robot and transferred to a 96 well flat bottom block
containing terrific
broth (TB) Amp 50 ug/ml. Approximately 2000 plasmid DNAs were isolated from
overnight cultures using a BioRobot and infectious RNAs from 430 independent
clones were
directly applied to plants. One to two weeks after inoculation, transfected
Nicotiana
bPnthamiana plants were visually monitored for changes in growth rates,
morphology, and
color. One set of plants transfected with 740 AT #120 were severely stunted.
DNA
sequence analysis revealed that this clone contained an Arabidopsis GTP
binding protein
open reading frame (ORF) in the antisense orientation. This demonstrates that
an episomal
RNA viral vector can be used to deliberately alter the metabolic pathway and
cause plant
stunting. In addition, our results suggest that the Arabidopsis antisense
transcript can turn
off the expression of the N. benthamiana gene.
Construction of an Arabidopsis thaliana cDNA library in an RNA viral vector.
An Arabidopsis thaliana CD4-13 cDNA library was digested with NotI. DNA
fragments between 500 and 1000 by were isolated by trough elution and
subcloned into the
NotI site of pBS740. E. coli C600 competent cells were transformed with the
pBS740 AT
library and colonies containing Arabidopsis cDNA sequences were selected on LB
Amp 50
ug/ml. Recombinant C600 cells were automatically picked using a Flexys robot
and then
transferred to a 96 well flat bottom block containing terrific broth (TB) Amp
50 ug/ml.
Approximately 2000 plasmid DNAs were isolated from overnight cultures using a
BioRobot
(Qiagen) and infectious RNAs from 430 independent clones were directly applied
to plants.
Isolation of a gene encoding a GTP binding protein.
One to two weeks after inoculation, transfected Nicotiana benthamiana plants
were
visually monitored for changes in growth rates, morphology, and color. Plants
transfected
66
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
with 740 AT #120 (FIGURE 14) were severely stunted. Plasmid 740 AT #120
contains the
TMV-U1 126-, 183-, and 30-kDa ORFs, the TMV-US coat protein gene (US cp), the
T7
promoter, an ~Irabidopsis thaliana CD4-13 NotI fragment, and part of the pUCl9
plasmid.
The TMV-U1 subgenomic promoter located within the minus strand of the 30-kDa
ORF
controls the synthesis of the CD4-13 antisense subgenomic RNA.
DNA sequencing and computer analysis.
A 782 by NotI fragment of 740 AT #120 containing the ADP-ribosylation factor
(ARF) cDNA was characterized. DNA sequence of NotI fragment of 740 AT #120
(774
base pairs) is as follows: S'-
CCGAAACATTCTTCGTAGTGAAGCAAAATGGGGTTGAGTTTCGCCAAGCTGTTT
AGCAGGCTTTTTGCCAAGAAGGAGATGCGAATTCTGATGGTTGGTCTTGATGCT
GCTGGTAAGACCACAATCTTGTACAAGCTCAAGCTCGGAGAGATTGTCACCACC
ATCCCTACTATTGGTTTCAATGTGGAAACTGTGGAATACAAGAACATTAGTTTCA
CCGTGTGGGATGTCGGGGGTCAGGACAAGATCCGTCCCTTGTGAGACACTACTT
CCAGAACACTCAAGGTCTAATCTTTGTTGTTGATAGCAATGACAGAGACAGAGT
TGTTGAGGCTCGAGATGAACTCCACAGGATGCTGAATGAGGACGAGCTGCGTGA
TGCTGTGTTGCTTGTGTTTGCCAACAAGCAAGATCTTCCAAATGCTATGAACGCT
GCTGAAATCACAGATAAGCTTGGCCTTCACTCCCTCCGTCAGCGTCATTGGTATA
TCCAGAGCACATGTGCCACTTCAGGTGAAGGGCTTTATGAAGGTCTGGACTGGC
TCTCCAACAACATCGCTGGCAAGGCATGATGAGGGAGAAATTGCGTTGCATCGA
GATGATTCTGTCTGCTGTGTTGGGATCTCTCTCTGTCTTGATGCAAGAGAGATTA
TAAATATTATCTGAACCTTTTTGCTTTTTTGGGTATGTGAATGTTTCTTATTGTGC
AAGTAGATGGTCTTGTACCTAAAAATTTACTAGAAGAACCCTTTTAAATAGCTTT
CGTGTATTGT-3' (SEQ ID NO: 44).
The nucleotide sequencing of 740 AT #120 was carried out by dideoxy
termination
using double stranded templates. Nucleotide sequence analysis and amino acid
sequence
comparisons were performed using DNA Strider, PCGENE and NCBI Blast programs.
740
AT #120 contained an open reading frame (ORF) in the antisense orientation
that encodes a
protein of 181 amino acids with an apparent molecular weight of 20,579
Daltons.
67
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
Seguence comparison
FIGURE 15 shows a nucleotide sequence comparison of A. thalana 740 AT #120
and A. thaliana est AA042085 (SEQ ID Nos: 45 and 46 respectively). The
nucleotide
sequence from 740 AT #120 is also compared with a rice (Oryza sativa) ADP
ribosylation
factor AF012896, SEQ ID NOs: 47 and 48 (FIGURE 16); which shows 82% (456/550)
positives and identities.
The nucleotide sequence from 740 AT #120 exhibits a high degree of homology
(81-
84% identity and positive) to rice, barley, carrot, corn and A. thaliana DNA
encoding ARFs
and also a high degree of homology (71-84% identity and positive) to yeast,
plants, insects
such as fly, amphibian such as frog, mammalian such as bovine, human, and
mouse DNA
encoding (Table 5).
The amino acid sequence derived from 740 AT #120 exhibits an even higher
degree
of homology (96-98% identity and 97-98% positive) to ARFs from rice, carrot,
corn and A.
thaliana and a high degree of homology (61-98% identity and 78-98% positive;
even higher
than nucleotide sequence homology) to ARFs from yeast, plants insects such as
fly,
mammalian such as bovine, human, and mouse (Table 6).
The high homology of DNAs encoding GTP binding proteins from yeast, plants,
insects, human, mice, and amphibians indicates that DNAs from one donor
organism can be
transfected into another host organism and silence the endogenous gene of the
host organism
68
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
.--. .-. .-. ..-. ~. .-. .-. .--. ~. .--. ~. .--, .~ .-. .-. .-. ..-. .-.
0 0 0 0 o c ~ ~ o o ~ o c o 0
M M .~ .-. G1 \J ~7 ~.~ I~ l~ ~t ~ N ~ N I~ ~ 00
00 00 00 00 GO f~ I~ I~ I~ I~ f~ I~ t~ I~ l~ (~ 00 M I~
.r wr ~ '. w. v.r ~ ~r ~ a ~ ~ .
N 00 O M G1 '~ ~, L% ~t V ~~ ~' N I~ ~ ~ ~ 00 ~ t~
~ ~ M ~ M N v~ N N N ~ ~J N ~t
v~ ~n ~1 ~n V1 v~ ~n ~n v~ v1 ~n v~ Y1 v1 ~n N N -~ N
~ w w w w w w w w w w w w w w w ~ w
cn ..-. .-. N ~ O ~;r ~J G'l l~ Gl ~ N O ~-' (~ ~ ~
O ~ ~J vJ l~ ~n M ~ O ~ O O G~ CO I~ ~n M M C~
0.. d' d' ~f V ~ '~ r1' d' ~ ~ ~ ~t M M M ~ N O~
\°\\\\°\\°\°\°\\\°\°~\\\~\
c c o o c o o c c o 0 0 o c o 0 0 0 0
V M M .~ .~ C1 vfJ ~D ~O I~ I~ ~Y ~t N ~' N l~ ~ 00
00 00 00 00 00 t~ I~ I~ t~ t~ t~ (~ t~ I~ I~ I~ 00 M t
~.r ~ ~ ~.r ~ ~ ~r .~ ~ ~ ~ ~ a ~r ~ ~ ~ pp
~ 00 O M G1 G1 l~ ~D ~ ~O ~--~ ~ N I~ O~ ~ ~ GO " l~
~~, ~ ~ ~ ~ ~~ ~~ ~ M d' M N U1 N N N ~ ~O N ~
., '~, m v1 v'1 ~n ~n ~n ~n ~n ~n ~n ~n ~n h v1 V~ N N --~ N
w w w w w w w w w w w w w w w w w w
c~ ~ .-~ ~. N ~ O ~J ~J OW ~ a1 v~ N O ~~ C~ ~ d' W1
ø, U
l0 ~D t~ V1 M ~ O ~' O O '-' O~ 00 (~ ~ M M Q1
b ~t ~f ~ ~T '~ ~ ~?' ~f ~ r1 ~ ~ M M M .-~ N O~ ~-'
O
U
U
U
I~ l~ ~O N O~ G~ ~ M M
V7 V7 v1 ~ M N N N N N ~ O C1 00 O o0 M N
C U .-.. .--m. ~.. .~ .-.. .-. r. .~ .~ .~ .~ .-. CT O~ Q1 I~ l~ l~
U N i i i i i ~ i i ~ i i i i i i i ~ i i
U U U U U U U U U U U U U U U U U U N
~t ~t M 00 00 ~;7 I~ ~D G1 ~ 00 I~ O ~J M O 00 l~ 00
.b W --1 t~ .~ O~ ~ ~ ~' M ~ '-. vo .-. .-. r. ~ N ~ D1 N
.Y
O
U
G1 ~'7 M ~ C C V1 01 (~ O N M l~ ~ ~
~n ~t '~ N ~n ~' V ~' ~ v'1 ~ O O ~ G1 N M Cry I
O Ov 01 01 G1 00 t~ ~ N ~ ~ ~ ~ ~ ~ ~ v1 ~ M I
~
N a ~ ~ a a a a W ,r ~ ~_ a ~ a a a ~ ~ a
~ Y t~ Y J ~ Y ~..~ 1.r Y ~ J_~-i ~i_-.i i.J Y ~ w.i Y Y
.~ ~ ~ ~ ~ Y_
d ~ 00 v1 l~ ~' M O ~' OWn N ~ ~n ~ 00 ~' 00 l~ v~ G1
O~ OI O o0 I~ ~ N O w0 M O 0o V t~ N o0 O~ v~ I~ ~-'
U ~' M M M ~ ~ M N M M N ~
M M M ~ N N
~j O N
y O
G1
N ~ ~ O
E.., N C~ M a\ V, ~ ~ M
M O O
~w
'" C ~ ~' ~ ... d ~ o ~ o H b
c,
~ N _w ~ ~ '~' ~ o w c ~ M
o ~ ~ ~ o
W.a~~o°o~~'-'~.odM ~ ~ a
c~a °' c~ ~
V7 . (. r. ." r'
J O OJ ~ ~ C/~
s.. ~ U ~. = ~ O O ~ a' ~ Q ~ V ~ ~ ,. ~ ~,
~~i:. U OU ~~~i~~C~~~wU~~ aC~...
69
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
.-. .--. ., .-. ..-. .-.
...
0 0 0 0 0 0 0 0 0 0 0 0
0 0
y y y y o y y o y o o y
y y
00 00 00 [~ ~D M M M M O
01 O\ O 00
C\ G1 01 C1 Q\ 01 U1 v~1
G1 '.:'~ 00 00 Q\ h
wr wr ~ ~ ~ ~ ~ ~ ~ wr W
r
vi ~ ~, ~. .-. r.. Q h h h h
O o0 00 h h
h h 00 h h h h
00 00 00 00 00 h h
.-. ~.. .~ .-. r- ~ ..-.
r. .-
w w w w w w w w w w ~ w
w w
O v~ C1 O~ C1 00 '~ ~D ~J ~J'
V' <Y O ~' O
O hhhhh~;7V''rJ'.0~~~:7Vr
~
.--,
.
-
,~ .
.
~.-. .-. .-. ~. .~ .~ r-
O
N
O
C
o 0 o c o 0 o c c o 0 o
c
O 00 h ~J h ~ O O O G1 h .-~
~' 00
G~ G~ G~ C\ D\ Q> a1 G~
00 00 00 0o h ~O
~ ~ ~ ~ ~ wr ~ ~
p~ ~ wr ~ ~ ~
w U .~ ,--~ .~ O h h h h O o0
00 h h
00 00 00 00 00 h h t~ h
~ 00 h h h h
~ ~. ~ r-. .~ .--. .-.
~
-~
a - .
.
..~ ... .~ r. .-. .
w w w w w w w w w w w w
w w
C1 t~ ~ h N O O O o0 h v1
U v1 G1 Q1
'
'
'
.: M O
~ ~ d
~
(~ h h ~O Vr V
~
3
0
N
a V O 00 O h O~ C\ C1 01 h M
N O M
V'
N O O O~ O C1 00 00 00 00
00 00 00 00
~ i ~ ~ ~ ~ i ~ ~ i
p >G ,-, m,
N N M N N N Wit' d' h ~J
h N N N
h
4-r
O
G
O
pp .-. ~1 ~ 00 01 h h ~
M ~ O d' 00
N N O .-~ O~ N N N N ~ h
h ~n O
D1 D1 01 Ov 00 00 00 00
00 00 h h h 'O
y n cn ~n cn ~n vwn ~ v~ vwn
cn cwn
Y rY r Y Y Y 1~ 1~ Y Y Y_
Y_ ~4-~
U
v1 M ~D N V h v0 ~D v1 -~
v~ ~t o0
vp ~;7 vWD v~ N N N N N
O O O~ ~
U M M M M M M M M M M M M
~/] N N
N
U 00 ~ h M
c~ M h
O ~ M ~ N ~ N
C pp p U1 ~ ~' h
~ ~
~
M
.--~.-.
~V~t_
h h ~.. a4 on h w
~ M :~ M V'7
~"'
O
~
N ,
~'y C~ L'
~ G
C3 M M
a aaa~
a~ c c c c d :r
H
.
~
.
,.
~~,~~~~
~
OcG~
U U U ~ r~ 0 ~ .~. w
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
The protein encoded by 740 AT #120, 120P, contained three conserved domains:
the
phosphate binding loop motif, GLDAAGKT (SEQ ID N0:49), (consensus GXXXXGKS/T,
SEQ ID N0:50); the G' motif, DVGGQ (SEQ ID N0:51), (consensus DXXGQ, SEQ ID
N0:52), a sequence which interacts with the gamma-phosphate of GTP; and the G
motif
NKQD (SEQ ID N0:53), (consensus NKXD, SEQ. ID. 54), which is specific for
guanidinyl
binding. The 120P contains a putative glycine-myristoylation site at position
2, a potential
N-glycosylation site (NXS) at position 60, and several putative
serine/threonine
phosphorylations sites.
Humanizing DNA
The nucleotide sequence from 740 AT #120 is also compared with a human ADP
ribosylation factor (ARF3) M33384, which shows a strong similarity (76%
identity at the
nucleotide level and 87% identity at the amino acid level). The amino acid
sequence
alignment of 740 AT #120 to human ADP-ribosylation factor (ARF3) P16587 is
compared
in FIGURE 17 (SEQ. ID. Nos: 55-57), which shows 87% identity and 90% positive.
The high homology of the nucleic acid and amino acid sequence between the two
makes humanizing 740 #AT120 practical. A humanized sequence, 740 AT#120 H
nucleic
acid sequence is prepared by changing the 740 AT#120 nucleic acid sequence so
that it
encodes the same amino acid sequence as the human M33384 encodes. The nucleic
acid is
changed by a standard method such as site directed mutagenisis or DNA
synthesis. FIGURE
18 (SEQ. ID. Nos: 58 and 59 for nucleotide sequences and SEQ. ID. NO: 60 for
amino acid
sequence) shows the sequence alignment of 740 AT #120H to human ARF3 M33384.
Isolation of an Arabid~sis thaliana ARF ~enomic clone
A genomic clone encoding A. thaliana ARF can be isolated by probing filters
containing A. thaliana BAC clones using a 3'-P labeled 740 AT #120 NotI
insert. Other
members of the A. thaliana ARF multigene family have been identified using
programs of
the University of Wisconsin Genetic Computer Group. The BAC clone T08I13
located on
chromosome II has a high degree of homology to 740 AT #120 (78% to 86%
identity at the
nucleotide level).
71
WO 01/07600 CA 02380330 2002-O1-21 pCT/US00/20261
Isolation and characterization of a cDNA encodinC Nicotiana benthamiana ARF.
A 488 by cDNA from N. benthamiana stem cDNA library was isolated by
polymerise chain reaction (PCR) using the following oligonucleotides: ATARFKl
S, 5'
AAG AAG GAG ATG CGA ATT CTG ATG GT 3' (upstream) (SEQ ID N0:61),
ATARFN176, 5' ATG TTG TTG GAG AGC CAG TCC AGA CC 3' (downstream) (SEQ ID
NO: 62). The vent polymerise in the reaction was inactivated using
phenol/chloroform, and
the PCR product was directly cloned into the HincII site in Bluescript KS+
(Strategene).
The plasmid map of KS+ Nb ARF #3, which contains the N. benthamiaca ARF ORF in
pBluescript KS+ is shown in FIGURE 19. The nucleotide sequence of N.
benthamiana KS+
Nb ARF#3, which contains partial ADP-ribosylation factor ORF, was determined
by
dideoxynucleotide sequencing. The nucleotide sequence from KS+ Nb ARF#3 had a
strong
similarity to other plant ADP-ribosylation factor sequences (82 to 87%
identities at the
nucleotide level). The nucleotide sequence comparison of N. benthamiana KS+ Nb
ARF#3
and A. thaliana 740 AT #120 shows a high homology between them (FIGURE 20,
SEQ. ID.
Nos: 63 and 64 respectively). The nucleotide sequence of KS+ NbARF #3 exhibits
a high
degree of homology (77-87% identities and positives) to plant, yeast and
mammalian DNA
encoding ARFs (Table 7). Again, the high homology of DNAs encoding GTP binding
proteins from yeast, plants, human, bovine and mice indicates that DNAs from
one donor
organism can be transfected into another host organism and effectively silence
the
endogenous gene of the host organism.
72
WO 01/07600 CA 02380330 2002-O1-21 PCT~S00/20261
..-...-..-.~. .-.~ ........--..~ .~ ....~.-,
0 0 ~ o ~ o ~ ~ o
~ v1 v~ M N N N N G~ G~ ~
'r .~ ~ w r
W r w r wr N N N N N N ~ N
U y d' ~' ~'~ ~' ~ <t V'V' ~t ~f V ~tw
w w w w w w w w w w w w w
N W D O ~ t~ (w J M ~'c0 N C ~ O d'
O V l~ V v7 v'1V1 U1 v~~' v7 ~' M M N
U LZr M M M M M M M M M M M M M M
O" 0 0 0 ~ ~ ~ c o c ~ c c o~c
U ~ ~p ~ v1 v~ M N N N N G1 G~ ~
~ ~ w r ~ a W r ~r
N ~ a ~ a ~ ~ t~ t~ t~-~ I~ t~ G~ ~
',r U o0 t~ ~ 00 00 N N N N N N N
'~ .--~N N ~ d' d' ~'~ ~t ~' ~ ~tw
U w w w w w w w w w w w w w
~ 'p pp 'p~ ~ ~~.M ~to0 N O V O N
U lD ~J ~'V~ V7 ~ V7 N ~' V~ ~' M M
~ M M M M 00 M M M M M M M M M
z
M
~pr.,.~ V1 V~ ~ M N M
U N ~ ~ "~ ~ O O I
i i i .-..~ ~ .-~ 011
U N i i i i i i i i i i
, C7 U U i U U U U U N Q7
N M .-.U .~ N N M M I~ O ~'
.I~ ,-r~ .~.~ V7 ~ M M N M N I~ ' '
tn
pp C _
.-.~. ~ ~ _~ ~,~~ I~_ _ _ M V C
~ <Y ~ G1 V Go O N
~ W v1 ~ <t .~~ '~YM ~ N N
D w ...~r- -. ~- cn
cCS r r ~ ~ ..i~ ,~~ ~ ~ sr~
~ ~ ~ ~ ~
~ .a _ ~ _ _ ~ ~ ~ s~ .~ ~n ,~
O N O ~ 00 s~ .flG~ ~t~- ~t ~U ~n M v:7
o0 ~ a\v' c0 ~ ~ 00O M M I~ v1N
U d' ~' ~ N W1 M O O O I~ Vr vo
<f' N M M M M
O
O
C1
N C
M N ~ M
p ~ M
O N ~ O N M
O N Q ~ ~ N ~ C~
x N = M d 1
V t ~ O : Li. l~
x O O ~j N ~ R/'.'.'s~~O
O ~ ~~.J
G O LL 'apW U p C c~
'~'c3Q ~ N ~ ~, U .~..~ n
~ >.. ~ f. ~ ~ .~ ~ O O
d U v~~ 7 ~ v~ v '~~~.s-.x ~ W
U
73
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
A full-length cDNA encoding ARF is isolated by screening the N. benthamiana
cDNA library by colony hybridization using a 3zP-labeled N. benthamiana KS+/Nb
ARF #3
probe. Hybridization is carried out at 42°C for 48 hours in 50%
formamide, SX SSC, 0.02
M phosphate buffer, 5X Denhart's solution, and 0.1 mg/ml sheared calf thymus
DNA.
Filters are washed at 65°C in O.1X SSC, 0.1% SDS prior to
autoradiography.
Rapid isolation of cDNAs -encoding ARF GTP binding proteins from rice, barley,
com.
soKbean and other plants
Libraries containing full-length cDNAs from rice, barley, corn, soybean and
other
important crops are obtained from public and private sources or can be
prepared from plant
mRNAs. The cDNAs are inserted in viral vectors or in small subcloning vectors
such as
pBluescript (Strategene), pUCl8, M13, or pBR322. Transformed bacteria (E.
coli) are then
plated on large petri plates or bioassay plates containing the appropriate
media and
antibiotic. Individual clones are selected using a robotic colony picker and
arrayed into 96
well microtiter plates. The cultures are incubated at 37°C until the
transformed cells reach
log phase. Aliquots are removed to prepare glycerol stocks for long term
storage at -80°C.
The remainder of the culture is used to inoculate an additional 96 well
microtiter plate
containing selective media and grown overnight. DNAs are isolated from the
cultures and
stored at -20°C. Using a robotic unit such as the Qbot (Genetix), the
E. coli transformants or
DNAs are rearrayed at high density on nylon filters or glass slides. Full-
length cDNAs
encoding ARFs from rice, barley, corn, soybean and other important crops are
isolated by
screening the various filters of slides by hybridization using a 32P-labeled
or fluorescent N.
benthamiana KS+/Nb ARF #3 probe, or Arabidopsis 740 AT #120 NotI insert.
Rapid isolation of ~enomic clones encoding ARF GTP binding proteins from rice.
barley,
corn soXbean and other plants
Genomic libraries containing sequences from rice, barley, corn, soybean and
other
important crops are obtained from public and private sources, or are prepared
from plant
genomic DNAs. BAC clones containing entire plant genomes have been constructed
and
organized in minimal overlapping order. Individual BACs are sheared to 500-
1000 by
fragments and directly cloned into viral vectors. Approximate 200-500 clones
that
74
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
completely cover an entire BAC will form a BAC viral vector sublibrary. These
libraries
can be stored as bacterial glycerol stocks at -80C and as DNA at -20C. Genomic
clones are
identified by first probing filters of BACs with a 3zP-labeled or fluorescent
N. benthamiana
KS+/Nb ARF #3 probe, or 3''P-labeled Arabidopsis 740 AT #120 NotI insert. BACs
that
hybridize to the probe are selected and their corresponding BAC viral vector
sublibrary is
used to produce infectious RNA. Plants that are transfected with the BAC
sublibrary are
screened for loss of function (for example, stunted plants). The inserts from
these clones or
their corresponding plasmid DNAs are characterized by dideoxy sequencing. This
provides
a rapid method to obtain the genomic sequence for the plant ARFs or GTP
binding proteins.
Rapid isolation of cDNAs encoding_human ADP-ribosvlation factor
Libraries containing full-length human cDNAs from organisms such as brain,
liver,
breast, lung, etc. are obtained from public and private sources or prepared
from human
mRNAs. The cDNAs are inserted in viral vectors or in small subcloning vectors
such as
pBluescript (Strategene), pUCl8, M13, or pBR322. Transformed bacteria (E.
coli) are then
plated on large petri plates or bioassay plates containing the appropriate
media and
antibiotic. Individual clones are selected using a robotic colony picker and
arrayed into 96
well microtiter plates. The cultures are incubated at 37°C until the
transformed cells reach
log phase. Aliquots are removed to prepare glycerol stocks for long term
storage at -80°C.
The remainder of the culture is used to inoculate an additional 96 well
microtiter plate
containing selective media and grown overnight. DNAs are isolated from the
cultures and
stored at -20°C. Using a robotic unit such as the Qbot (Genetix), the
E. coli transformants or
DNAs are rearrayed at high density on nylon or nitrocellulose filters or glass
slides. Full-
length cDNAs encoding ARFs from human brain, liver, breast, lung, etc. are
isolated by
screening the various filters or slides by hybridization with a 32P-labeled or
fluorescent N.
benthamiana KS+/Nb ARF #3 probe or Arabidopsis 740 AT #120 NotI insert.
Construction of a viral vector containing human cDNAs.
An ARFS clone containing nucleic acid inserts from a human brain cDNA library
(Bobak et al., Proc. Natl. Acid. Su. USA 86:6101-6105 (1989)) was isolated by
polymerise
chain reaction (PCR) using the following oligonucleotides: HARFMIA, 5' TAC CTA
GGG
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
CAA TAT CTT TGG AAA CCT TCT CAA G 3' (upstream) (SEQ ID N0:65),
HARFK181X, 5' CGC TCG AGT CAC TTC TTG TTT TTG AGC TGA TTG GCC AG 3'
(downstream) (SEQ ID NO: 66). The vent polymerase in the reaction was
inactivated using
phenol/chloroform. The PCR products are directly cloned into the XhoI, AvrII
site TTOIA.
EXAMPLE 12
Silencing of ~hytoene desaturase in nicotiana benthamiana using a tobravirus
vector.
Tobacco rattle tobravirus (TRV) is a bipartite positive-sense, single-stranded
RNA
virus. TRV is able to infect a wide range of plant hosts, including
Arabidopsis thaliana
(unpublished data), Nicotiana species, Brassica campestris, Capsicum annuum,
Chenopodium amaranticolor, Glycine max, Lycopersicon esculentum, Narcissus
pseudonarcissus, Petunia X hybrida, Pisum sativum, Solanum tuberosum, Spinacia
oleracea, Yicia faba,
(http://www.ncbi.nlm.nih.gov/ICTVdb/ICTVdB/72010004.htm#SymptHost). TRV RNA-1
encodes proteins involved in viral replication (Replicase, 134/194 kDa) and
movement
(Movement Protein (mp) 29 kDa), as well as Cysteine Rich Protein ((CRP) 16
kDa) (Figure
21.A). An improved mutant of TRV RNA-l, pLSB-l, was isolated from an N.
benthamiana
plant that had been inoculated with a passaged sap extract of PpK20
(MacFarlane and
Popovich. Efficient expression of foreign proteins in roots from tobravirus
vectors.
Virology, 267, 29-35 (2000)) from another N. benthamiana plant. Plants
inoculated with
pLSB-1 RNA-1 exhibit gene silencing more extensively compared to those
inoculated with
PpK20 RNA-1. Virions were purified from the leaf tissue by a PEG precipitation
method
(Gooding GV Jr, Hebert TT (1967) A simple technique for purification of
tobacco mosaic
virus in large quantities. Phytopathology 57(11):1285), RNA was isolated using
the RNeasy
Mini Kit (Qiagen~), then cDNA was made using the cDNA Synthesis System (Gibco
BRL~) using the oligonucleotide 5'-
TTAATTAAGCATGCGGATCCCGTACGGGCGTAATAACGCTTACGTAGGCGAGGG
GTTTTAC-3'. The full length TRV RNA-1 was PCR amplified using the
oligonucleotides
5'-
76
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
ATGAAGAGCATGCTAATACGACTCACTATAGATAAAACATTTCAATCCTTTGAA
CGC-3' (upstream) and 5'-
TTCATCTGGATCCCGGGCGTAATAACGCTTACGTAGGCG-3' (downstream) and
cloned into pUCl8 at the Sph IlBam HI sites. This TRV RNA-1 construct, pLSB-l,
was
verified by dideoxynucleotide sequencing and found to have 29 point mutations
compared
with the published sequence for PpK20 RNA-1 (Visser,P.B. and BoI,J.F. (1999).
ACCESSION AF166084). All of these point mutations are in the replicase gene,
and many
code for amino acid substitutions. The sequence of the mutant TRV RNA-1 viral
sequence
contained within pLSB-1 is as follows. 5'-
ATAAAACATTTCAATCCTTTGAACGCGGTAGAACGTGCTAATTGGATTTTGGTG
AGAACGCGGTAGAACGTACTTATCACCTACAGTTTTATTTTGTTTTTCTTTTTGGT
TTAATCTATCCAGCTTAGTACCGAGTGGGGGAAAGTGACTGGTGTGCCTAAAAC
CTTTTCTTTGATACTTTGTAAAAATACATACAGATACAATGGCGAACGGTAACTT
CAAGTTGTCTCAATTGCTCAATGTGGACGAGATGTCTGCTGAGCAGAGGAGTCA
TTTCTTTGACTTGATGCTGACTAAACCTGATTGTGAGATCGGGCAAATGATGCAA
AGAGTTGTTGTTGATAAAGTCGATGACATGATTAGAGAAAGAAAGACTAAAGAT
CCAGTGATTGTTCATGAAGTTCTTTCTCAGAAGGAACAGAACAAGTTGATGGAA
ATTTATCCTGAATTCAATATCGTGTTTAAAGACGACAAAAACATGGTTCATGGG
TTTGCGGCTGCTGAGCGAAAACTACAAGCTTTATTGCTTTTAGATAGAGTTCCTG
CTCTGCAAGAGGTGGATGACATCGGTGGTCAATGGTCGTTTTGGGTAACTAGAG
GTGAGAAAAGGATTCATTCCTGTTGTCCAAATCTAGATATTCGGGATGATCAGA
GAGAAATTTCTCGACAGATATTTCTTACTGCTATTGGTGATCAAGCTAGAAGTG
GTAAGAGACAGATGTCGGAGAATGAGCTGTGGATGTATGACCAATTTCGTGAAA
ATATTGCTGCGCCTAACGCGGTTAGGTGCAATAATACATATCAGGGTTGTACAT
GTAGGGGTTTTTCTGATGGTAAGAAGAAAGGCGCGCAGTATGCGATAGCTCTTC
ACAGCCTGTATGACTTCAAGTTGAAAGACTTGATGGCTACTATGGTTGAGAAGA
AAACTAAAGTGGTTCATGCTGCTATGCTTTTTGCTCCTGAAAGTATGTTAGTGGA
CGAAGGTCCATTACCTTCTGTTGACGGTTACTACATGAAGAAGAACGGGAAGAT
CTATTTCGGTTTTGAGAAAGATCCTTCCTTTTCTTACATTCATGACTGGGAAGAG
TACAAGAAGTATCTACTGGGGAAGCCAGTGAGTTACCAAGGGGATGTGTTCTAC
TTCGAACCGTGGCAGGTGAGAGGAGACACAATGCTTTTTTCGATCTACAGGATA
77
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
GCTGGAGTTCCGAGGAGGTCTCTATCATCGCAAGAGTACTACCGAAGAATATAT
ATCAGTAGATGGGAAAACATGGTTGTTGTCCCAATTTTCGATCTGGTCGAATCA
ACGCGAGAGTTGGTCAAGAAAGACCTGTTTGTAGAGAAACAATTCATGGACAA
GTGTTTGGATTACATAGCTAGGTTATCTGACCAGCAGCTGACCATAAGCAATGT
TAAATCATACTTGAGTTCAAATAATTGGGTCTTATTCATAAACGGGGCGGCCGT
GAAGAACAAGCAAAGTGTAGATTCTCGAGATTTACAGTTGTTGGCTCAAACTTT
GCTAGTGAAGGAACAAGTGGCGAGACCTGTCATGAGGGAGTTGCGTGAAGCAA
TTCTGACTGAGACGAAACCTATCACGTCATTGACTGATGTGCTGGGTTTAATATC
AAGAAAACTGTGGAAGCAGTTTGCTAACAAGATCGCAGTCGGCGGATTCGTTGG
CATGGTTGGTACTCTAATTGGATTCTATCCAAAGAAGGTACTAACCTGGGCGAA
GGACACACCAAATGGTCCAGAACTATGTTACGAGAACTCGCACAAAACCAAGG
TGATAGTATTTCTGAGTGTTGTGTATGCCATTGGAGGAATCACGCTTATGCGTCG
AGACATCCGAGATGGACTGGTGAAAAAACTATGTGATATGTTTGATATCAAACG
GGGGGCCCATGTCTTAGACGTTGAGAATCCGTGCCGCTATTATGAAATCAACGA
TTTCTTTAGCAGTCTGTATTCGGCATCTGAGTCCGGTGAGACCGTTTTACCAGAT
TTATCCGAGGTAAAAGCCAAGTCTGATAAGCTATTGCAGCAGAAGAAAGAAAT
CGCTGACGAGTTTCTAAGTGCAAAATTCTCTAACTATTCTGGCAGTTCGGTGAGA
ACTTCTCCACCATCGGTGGTCGGTTCATCTCGAAGCGGACTGGGTCTGTTGTTGG
AAGACAGTAACGTGCTGACCCAAGCTAGAGTTGGAGTTTCAAGAAAGGTAGAC
GATGAGGAGATCATGGAGCAGTTTCTGAGTGGTCTTATTGACACTGAAGCAGAA
ATTGACGAGGTTGTTTCAGCCTTTTCAGCTGAATGTGAAAGAGGGGAAACAAGC
GGTACAAAGGTGTTGTGTAAACCTTTAACGCCACCAGGATTTGAGAACGTGTTG
CCAGCTGTCAAACCTTTGGTCAGCAAAGGAAAAACGGTCAAACGTGTCGATTAC
TTCCAAGTGATGGGAGGTGAGAGATTACCAAAAAGGCCGGTTGTCAGTGGAGA
CGATTCTGTGGACGCTAGAAGAGAGTTTCTGTACTACTTAGATGCGGAGAGAGT
CGCTCAAAATGATGAAATTATGTCTCTGTATCGTGACTATTCGAGAGGAGTTATT
CGAACTGGAGGTCAGAATTACCCGCACGGACTGGGAGTGTGGGATGTGGAGAT
GAAGAACTGGTGCATACGTCCAGTGGTCACTGAACATGCTTATGTGTTCCAACC
AGACAAACGTATGGATGATTGGTCGGGATACTTAGAAGTGGCTGTTTGGGAACG
AGGTATGTTGGTCAACGACTTCGCGGTCGAAAGGATGAGTGATTATGTCATAGT
TTGCGATCAGACGTATCTTTGCAATAACAGGTTGATCTTGGACAATTTAAGTGCC
78
W~ 01/07600 CA 02380330 2002-O1-21 pCT/US00/20261
CTGGATCTAGGACCAGTTAACTGTTCTTTTGAATTAGTTGACGGTGTACCTGGTT
GTGGTAAGTCGACAATGATTGTCAACTCAGCTAATCCTTGTGTCGATGTGGTTCT
CTCTACTGGGAGAGCAGCAACCGACGACTTGATCGAGAGATTCGCGAGCAAAG
GTTTTCCATGCAAATTGAAAAGGAGAGTGAAGACGGTTGATTCTTTTTTGATGC
ATTGTGTCGATGGTTCTTTAACCGGAGACGTGTTGCATTTCGACGAAGCTCTCAT
GGCCCATGCTGGTATGGTGTACTTTTGCGCTCAGATAGCTGGTGCTAAACGATGT
ATCTGTCAAGGAGATCAGAATCAAATTTCTTTCAAGCCTAGGGTATCTCAAGTT
GATTTGAGGTTTTCTAGTCTGGTCGGAAAGTTTGACATTGTTACAGAAAAAAGA
GAAACTTACAGAAGTCCAGCAGATGTGGCTGCCGTATTGAACAAGTACTATACT
GGAGATGTCAGAACACATAACGCGACTGCTAATTCGATGACGGTGAGGAAGAT
TGTGTCTAAAGAACAGGTTTCTTTGAAGCCCGGTGCTCAGTACATAACTTTCCTT
CAGTCTGAGAAGAAGGAGTTGGTAAATTTGTTGGCATTGAGGAAAGTGGCAGCT
AAAGTGAGTACAGTACACGAGTCGCAAGGAGAGACATTCAAAGATGTAGTCCT
AGTCAGGACGAAACCTACGGATGACTCAATCGCTAGAGGTCGGGAGTACTTAAT
CGTGGCGTTGTCGCGTCACACACAATCACTTGTGTATGAAACTGTGAAAGAGGA
CGATGTAAGCAAAGAGATCAGGGAAAGTGCCGCGCTTACGAAGGCGGCTTTGG
CAAGATTTTTTGTTACTGAGACCGTCTTATGACGGTTTCGGTCTAGGTTTGATGT
CTTTAGACATCATGAAGGGCCTTGCGCCGTTCCAGATTCAGGTACGATTACGGA
CTTGGAGATGTGGTACGACGCTTTGTTTCCGGGAAATTCGTTAAGAGACTCAAG
CCTAGACGGGTATTTGGTGGCAACGACTGATTGCAATTTGCGATTAGACAATGT
TACGATCAA.AAGTGGAAACTGGAAAGACAAGTTTGCTGAAAAAGAAACGTTTC
TGAAACCGGTTATTCGTACTGCTATGCCTGACAAAAGGAAGACTACTCAGTTGG
AGAGTTTGTTAGCATTGCAGAAAAGGAACCAAGCGGCACCCGATCTACAAGAA
AATGTGCACGCGACAGTTCTAATCGAAGAGACGATGAAGAAGCTGAAATCTGTT
GTCTACGATGTGGGAAAAATTCGGGCTGATCCTATTGTCAATAGAGCTCAAATG
GAGAGATGGTGGAGAAATCA.4AGCACAGCGGTACAGGCTAAGGTAGTAGCAGA
TGTGAGAGAGTTACATGAAATAGACTATTCGTCTTACATGTATATGATCAAATCT
GACGTGAAACCTAAGACTGATTTAACACCGCAATTTGAATACTCAGCTCTACAG
ACTGTTGTGTATCACGAGAAGTTGATCAACTCGTTGTTCGGTCCAATTTTCAAAG
AAATTAATGAACGCAAGTTGGATGCTATGCAACCACATTTTGTGTTCAACACGA
GAATGACATCGAGTGATTTAAACGATCGAGTGAAGTTCTTAAATACGGAAGCGG
79
WO 01/07600 CA 02380330 2002-0l-21 PCT/US00/20261
CTTACGACTTTGTTGAGATAGACATGTCTAAATTCGACAAGTCGGCAAATCGCTT
CCATTTACAACTGCAGCTGGAGATTTACAGGTTATTTGGGCTGGATGAGTGGGC
GGCCTTCCTTTGGGAGGTGTCGCACACTCAAACTACTGTGAGAGATATTCAAAA
TGGTATGATGGCGCATATTTGGTACCAACAAAAGAGTGGAGATGCTGATACTTA
TAATGCAAATTCAGATAGAACACTGTGTGCGCTCTTGTCTGAATTACCATTGGA
GAAAGCAGTCATGGTTACATATGGAGGAGATGACTCACTGATTGCGTTTCCTAG
AGGAACGCAGTTTGTTGATCCGTGTCCAAAGTTGGCTACTAAGTGGAATTTCGA
GTGCAAGATTTTTAAGTACGATGTCCCAATGTTTTGTGGGAAGTTCTTGCTTAAG
ACGTCATCGTGTTACGAGTTCGTGCCAGATCCGGTAAAAGTTCTGACGAAGTTG
GGGAAAAAGAGTATAAAGGATGTGCAACATTTGGCCGAGATCTACATCTCGCTG
AATGATTCCAATAGAGCTCTTGGGAACTACATGGTGGTATCCAAACTGTCCGAG
TCTGTTTCAGACCGGTATTTGTACAAAGGTGATTCTGTTCATGCGCTTTGTGCGC
TATGGAAGCATATTAAGAGTTTTACAGCTCTGTGTACATTATTCCGAGACGAAA
ACGATAAGGAATTGAACCCGGCTAAGGTTGATTGGAAGAAGGCACAGAGAGCT
GTGTCAAACTTTTACGACTGGTAATATGGAAGACAAGTCATTGGTCACCTTGAA
GAAGAAGACTTTCGAAGTCTCAAAATTCTCAAATCTAGGGGCCATTGAATTGTT
TGTGGACGGTAGGAGGAAGAGACCGAAGTATTTTCACAGAAGAAGAGAAACTG
TCCTAAATCATGTTGGTGGGAAGAAGAGTGAACACAAGTTAGACGTTTTTGACC
AAAGGGATTACAAAATGATTAAATCTTACGCGTTTCTAAAGATAGTAGGTGTAC
AACTAGTTGTAACATCACATCTACCTGCAGATACGCCTGGGTTCATTCAAATCG
ATCTGTTGGATTCGAGACTTACTGAGAAAAGAAAGAGAGGAAAGACTATTCAG
AGATTCAAAGCTCGAGCTTGCGATAACTGTTCAGTTGCGCAGTACAAGGTTGAA
TACAGTATTTCCACACAGGAGAACGTACTTGATGTCTGGAAGGTGGGTTGTATT
TCTGAGGGCGTTCCGGTCTGTGACGGTACATACCCTTTCAGTATCGAAGTGTCGC
TAATATGGGTTGCTACTGATTCGACTAGGCGCCTCAATGTGGAAGAACTGAACA
GTTCGGATTACATTGAAGGCGATTTTACCGATCAAGAGGTTTTCGGTGAGTTCAT
GTCTTTGAAACAAGTGGAGATGAAGACGATTGAGGCGAAGTACGATGGTCCTTA
CAGACCAGCTACTACTAGACCTAAGTCATTATTGTCAAGTGAAGATGTTAAGAG
AGCGTCTAATAAGAAAAACTCGTCTTAATGCATAAAGAAATTTATTGTCAATAT
GACGTGTGTACTCAAGGGTTGTGTGAATGAAGTCACTGTTCTTGGTCACGAGAC
GTGTAGTATCGGTCATGCTAACAAATTGCGAAAGCAAGTTGCTGACATGGTTGG
WO 01/07600 CA 02380330 2002-O1-21 pCT/[JS00/20261
TGTCACACGTAGGTGTGCGGAAAATAATTGTGGATGGTTTGTCTGTGTTGTTATC
AATGATTTTACTTTTGATGTGTATAATTGTTGTGGCCGTAGTCACCTTGAAAAGT
GTCGTAAACGTGTTGAAACAAGAAATCGAGAAATTTGGAAACAAATTCGACGA
AATCAAGCTGAAAACATGTCTGCGACAGCTAAAAAGTCTCATAATTCGAAGACC
TCTAAGAAGAAATTCAAAGAGGACAGAGAATTTGGGACACCAAAAAGATTTTT
AAGAGATGATGTTCCTTTCGGGATTGATCGTTTGTTTGCTTTTTGATTTTATTTTA
TATTGTTATCTGTTTCTGTGTATAGACTGTTTGAGATTGGCGCTTGGCCGACTCA
TTGTCTTACCATAGGGGAACGGACTTTGTTTGTGTTGTTATTTTATTTGTATTTTA
TTAAAATTCTCAATGATCTGAAAAGGCCTCGAGGCTAAGAGATTATTGGGGGGT
GAGTAAGTACTTTTAAAGTGATGATGGTTACAAAGGCAAAAGGGGTAAAACCC
CTCGCCTACGTAAGCGTTATTACGCCC-3'
RNA-2 encodes the capsid protein and two non-structural proteins, 2b and 2c
(Figure 21.A.) A TRV RNA-2 construct expressing GFP was derived from a full-
length
clone of RNAZ of TRV isolate PpK20 (Mueller et al 1997. Journal of General
Virology, 78,
2085-2088 (1997), MacFarlane and Popovich. E~cient expression offoreign
proteins in
roots from tobravirus vectors. Virology, 267, 29-35 (2000)). This TRV-GFP
construct has
the 2c gene of TRV RNA-2 replaced with the pea early browning virus (PEBV)
coat protein
promoter linked to GFP (MacFarlane and Popovich, 2000). This TRV-GFP construct
was
further modified by replacing the GFP gene with Pst I and Not I cloning sites
to produce the
plasmid pK20-2b-P/N. The phy~toene desaturase (PDS) gene from N. benthamiana
was PCR
amplified from the plasmid pWPFl87 using the following oligonucleotides S'-
TGGTTCTGCAGTTATG
CATGCCCCAAATTGGACTTG-3' (upstream) and 5'-TTTTCCTTTTGCGGCCG
CTAAACTACGCTTGCTTCTG-3' (downstream). This PCR product was then subcloned
into pK20-2b-P/N in the positive orientation. The resulting construct, TRV-PDS
(Figure
2I.B.), was linearized with Sma I and transcribed using T7 RNA polymerase
(Ambion
mMessage mMachine). Transcript RNA2 was mixed with transcripts from a full-
length
clone of TRV RNA-1 (pLSB-1).
TRV-PDS was inoculated onto N. benthamiana. After 6-7 days, chlorotic areas
began to develop in the upper emerging leaves. After 8-10 days, these
chlorotic areas
developed into white areas. Samples fro-m TRV-PDS infected plants were
analyzed using
81
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
HPLC. HPLC analysis revealed a dramatically elevated level of phytoene in TRV-
PDS
infected plants when compared to an uninoculated control.
EXAMPLE 13
Identification of nucleotide sequences involved in the reeulation of plant
development by
cvoplasmic inhibition of gene expression in an anti sense orientation using
viral derived
RNA (G protein coupled receptor).
This example again demonstrates that an episomal RNA viral vector can be used
to
deliberately manipulate a signal transduction pathway in plants. In addition,
our results
suggest that the Arabidopsis antisense transcript can turn off the expression
of the N
benthamiana gene.
A partial Arabidopsis thaliana cDNA library was placed under the
transcriptional
control of a tobamovirus subgenomic promoter in a RNA viral vector. Colonies
from
transformed E. coli were automatically picked using a Flexys robot and
transferred to a 96
well flat bottom block containing terrific broth (TB) Amp 50 ug/ml.
Approximately 2000
plasmid DNAs were isolated from overnight cultures using a BioRobot and
infectious RNAs
from 430 independent clones were directly applied to plants. One to two weeks
after
inoculation, transfected Nicotiana benthamiana plants were visually monitored
for changes
in growth rates, morphology, and color. One set of plants transfected with 740
AT #88
(FIGURE 22) developed a white phenotype on the infected leaf tissue. DNA
sequence
analysis revealed that this clone contained an Arabidopsis G-protein coupled
receptor open
reading frame (ORF) in the antisense orientation.
DNA sequencing and computer analysis.
A 758 by NotI fragment of 740 AT #88 containing the G-protein coupled receptor
cDNA was characterized. The nucleotide sequencing of 740 AT #88 was carried
out by
dideoxy termination using double stranded templates. Nucleotide sequence
analysis and
amino acid sequence comparisons were performed using DNA Strider, PCGENE and
NCBI
Blast programs. FIGURE 23 shows the partial nucleotide sequence (SEQ ID N0:69)
and
amino acid sequence (SEQ ID N0:70) of 740 AT #88 insert. The nucleotide
sequence from
740 AT #88 was compared with Brassica rapa cDNA L35812 (FIGURE 24, SEQ. ID.
Nos:
82
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
71 and 72), 91 % identities and positives; and the octopus rhodopsin cDNA
X07797
(FIGURE 25, SEQ ID NOs: 73 and 74), 68°/° identities and
positives. The homology of
DNAs encoding rhodopsin from plant and animal rhodopsin indicates that genes
from one
kingdom can inhibit the expression of gene of another kingdom. The amino acid
sequence
derived from 740 AT #88 was compared with octopus rhodopsin P31356 (FIGURE 26,
SEQ. ID. Nos: 75-77), 65% identities and positives. Table 8 shows the amino
acid sequence
comparison of 740 AT #88 with D. discoideum and Octopus rhodopsin: 58 - 62%
identities
and 63 - 65% positives.
83
CA 02380330 2002-O1-21
wo ovo~6oo rcT~sooizozm
0 0
N
h v', N ~n
O N O O O~
O
O v~ N N
w w w w
0 0 0 0
~ ~ 0 0
M
O ~ N
U
U
U
C
Q7
U ~ ~_ y_ ~_
.fl
b
y p N h
~p ~ N
O ~ o~0 00 0~0
C
O O
% ~
C N N N
a ~
~t
O
a ~r N
O
_U
~ ~
_ _
7 ~
h
z z
h
O
w w
z z
a a
Q ~ ~ O
~ b
o ~
o
C ~ o
\ o ~ v
~ o
v~o .,.,. ~"
C '" y M
O M '
v'1
~ O O
~ ~
U .C " ~ t~,
~O 00 v1
U
I ~
U Q.~C ~ ~ O
~ ~ ~ v
',
v-, o
84
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
EXAMPLE 14
Identification of nucleotide sequences containing an Arahidopsis S 18
ribosomal t~rotein
den readinu frame.
One to two weeks after inoculation, transfected Nicotiana benthamiana plants
were visually monitored for changes in growth rates, morphology, and color.
one set of
plants transfected with 740 AT #377 (FIGURE 27) were severely stunted. DNA
sequence analysis (FIGURE 28, SEQ ID NO: 78) revealed that this clone
contained an
Arabidopsis S 18 ribosomal protein open reading frame (ORF) in the antisense
orientation.
EXAMPLE 15
Identification of L19 ribosomal protein gene involved in the reeulation of
t~lant Qrowth
b~c t~o~lasmic inhibition of expression using viral derived RNA.
One to two weeks after inoculation, transfected Nicotiana benthamiana plants
were visually monitored for changes in growth rates, morphology, and color.
One set
of plants transfected with 740 AT #2483 (FIGURE 29) were severely stunted. DNA
sequence analysis (FIGURE 30, SEQ ID NO: 79) revealed that this clone
contained an
Arabidopsis L19 ribosomal protein open reading frame (ORF) in the antisense
orientation. The 740 AT #2483 nucleotide sequence exhibited a high degree of
homology (77-78% identities and positives) to plant, L19 ribosomal proteins
genes
(Table 9). In addition, The 740 AT #2483 nucleotide sequence exhibited a high
degree
of homology (71 - 79% identities and positives) to yeast, insect and human L19
ribosomal proteins genes (Table 9). The 740 AT #2483 amino acid sequence
comparison with human, insect and yeast ribosomal protein L19 shows 38 - 88%
identities and 61 - 88% positives (Table 10). The high homology of DNAs
encoding
ribosomal L 19 protein from human, plant, yeast and insect indicates that
genes from
one organism can inhibit the gene expression of an organism from another
kingdom.
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
oo ~ oo cw-
a~ o ~ c~ ~ ~ ~
>
y, .~ ~ ~ ~ M M
y ~ ~J ~O ~ v1 Vr
w w w w w
O O O G1 O N U1
p. ~ ~ ~t ~n
\°
0
\°\°\\\°
I~ o c c o c
~ 00 ~V o0 G1
O p l~ I~ I~ l~ I~
M yr wr ~ ~
W O v0 V V~ 'V
y ~ w w w w w
.b O O G~ O N
r., ..-. N ~ ~ ~ ~t
O
0o O O~ ~
V N
M ~ O O O
O
i i i i
i i
W W W W L.7
W
O
~J O O C O O
O
U '> \J N ~ ul
~T M
U N N M M ~
o0
U
r-
a'
U
U
'b .~,~. 'r
~_ ~_
~ r ~
~ ~ t~ ~' ~
G'~ M
_ ~-' M V1 N
V
.~ V7 ~1 V~
N wr ~ .~ .~
~ a
z
O Q~ 00 V'1
V V' M
M U 00 01 00 '1
~J
M
N
E-' o0 N
O
N ~l N
x
H w
o~,~
~~
_
_
0
~ M n
ca
~N~ ,.~.
o Q
0
cue, ~ -z
o
~n o ~ ~n
~
'C
~
~
o ,~ '' ,~
f1.
~
o
v,
d c,..,
J O
,~
cy
_
n
U
J 'C
~ e~ -~
e~ c
O U
a
86
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
0 0 0 0
00 M M 00
O M 00 00 00
r. ..-n
M
ON~NVr
0 0 0 0
00 M M 00
N M 00 00 00
W W v
.~Nv:~n~
r.
O
1
G1
G1
o0
a, ~ W W W
of W
O O O
O
O ~ ~ N N
~
U i!1 00
00
U
U
C
N
U
b w
~
~
_ _
U _
_
~
~
.fl
.fl
00
O V'
~'
M
v~ v1
U 'v.7
' N M M
M
~ l~
O
U ~p t
M
N
~t
Q
O
O p1
D\
U O~
N
~
00
f
.
h O
~
a
N
...
O..
~
O
O
~
O
p
c3
O
U
O
c~
O
~
t~
O
pp
O
~O
C
U
N ~ c~
~ N
O ~ O 1
~
U ~ ~ ~
L1
87
WO 01/07600 CA 02380330 2002-0l-21 PCT/US00/20261
DNA sec~uencin~ and computer analysis.
The by NotI fragment of 740 AT #909 containing the ribosomal protein L 19
cDNA was characterized. The nucleotide sequencing of 740 AT #909 (FIGURE 31)
was carried out by dideoxy termination using double stranded templates.
Nucleotide
sequence analysis and amino acid sequence comparisons were performed using DNA
Strider, PCGENE and NCBI Blast programs. FIGURE 32 shows nucleotide alignment
of 740 AT #909 to human SS 6985 ribosomal protein L19 cDNA (SEQ ID NOs: 80 and
81 respectively). FIGURE 33 (SEQ ID NOs: 82-84) shows the amino acid sequence
alignment of 740 AT #909 to human P14118 60S ribosomal protein L19. Table 11
shows the 740 AT #909 nucleotide sequence comparison to plant, drosophila,
yeast, and
human: 63-79% identities and positives. Table 12 shows the 740 AT #909 amino
acid
comparison to plant, human, mouse, yeast, and insect L19 ribosomal protein: 6~-
88%
identities and 80-92% positives.
88
WO 01/07600 CA 02380330 2002-0l-21 pC'T/[JS00/20261
I
o \ ~ o c o 0
<t d" N N O N M
00 0o GG100 00 0000
o ~ c o c
C1 ~'Cr'1M M M I
l~ ~O ~D'vJvJ V' ~D in ~t ~t G~ ~ o0 v0
'-'" " " O N N O N
00 00 ~tvo 00 00 00 0., .-r r.
M N N ~' M M M
v~ G1 00 v7O O G1 v:7
~
O ~ 01 I~~ 00 I~ I~
p., M N N N N N N
O O
/1 n n n
01 Cr10 ~ O 4
0o t~ I~ O V1
~ a ~
I C ~ ~ ~ ~ O vJ a C1
~ C O /~ ~ /1 I ~ ,~ N \ W ~r ~ O ~
r O O O ~ y.., ~ \ ~ \ \ \ e-~\
G~ 01 ~'O~ M M ~ c3 ~ ~ O 01 O~ \
tw o ~ ~ ~:7V O G ~ O r., O~ Ov 00Ov
I r. Ov
M
V'~
~r ~ 'r ~ e~
p CJ 00 GO ~ V'100 00 00 ~ I,
M N N ~ M M M U N I, O
O ' ~' ~ ~ M ~' ~' ~' I - 1 0 0 W
01 O\ON O O C1 ~ U ~ N
M ~ N N N N I U W ~ W W W W
I N J
I I W
U _ ~ N '1 01
U ~ ~J V 00 N N Ov
Gh
O M v'1~1 ~ ~' ~ .b
W W W W W W W
z O O O O z
~ ~ ~..~j l~ N
I
O p ~ ~. ~. ~ ~. .-.~.
E"" y E'' 00 00 M O 00 O 'Cf
~ r~n n
O ~ v~ vw ~ w Q, N V7 G1 l~ M N ~~
~_ ._~._J._~~_ ._r ~
pp -D ~ .D ~ ~ ~ ~ N ~ ~' d' <h ~tM
~ ~,,~O M V7 N l~ M C~ ~ ~ 'N'~
00 00 v1~1 N ~ N I ~ ~ N I~ O ~OM
.-, M lp ~ .-,r-.O O ~ C/~ V'1V7 V'7V~ N N O
~ ~ ~ ~ ~
N ~ O~ '~ U
N .-.
M Wit'M O~
00 ~' ,r~.a~N O
O M ~ Q ~ C. O
O 1 O o ~ o n..p O
N ~ ~ z ~ A-'~ ~ y
O r~GN N ~ ~ ~ ~ ~ .,.U,O
Q ~ ~ ..~C~ .~ .a~.~~~ O O p.,
M z o e~ ~ d ~ ~ o ~ o O p-
d ~ z x a
z ~ ~ o 0 o 0
. d :~ x ~ ~ ~. .
y ~ Ov U N O O
_ V7 ~ y _ L
~ U .fl~ ~ ~ s.C1
~ a Y ~
L ~ " a
.~ 3 w 3 ~1
v ti4~ 0 ~ N ..-.~ v ,~ O
U p
U ~ O ~ .~ ~ ~ y .
-O~ ~ ~ ~ ~" U ~
ti N ~ ~J ,r~cC ctiv~ , N ~O
~ ~ ~ ~ a x x
s9
W~ 01/07600 CA 02380330 2002-O1-21 pCT/US00/20261
EXAMPLE 16
Construction of a cytoplasmic inhibition vector in a positive sense containine
A. thaliana HAT7
homeobox-leucine zipper nucleotide sequence.
An Arabidopsis thaliana CD4-13 cDNA library was digested with NotI. DNA
fragments between 500 and 1000 by were isolated by trough elution and
subcloned into the
NotI site of pBS740. E. coli C600 competent cells were transformed with the
pBS740 AT
library and colonies containing Arabidopsis cDNA sequences were selected on LB
Amp 50
~g/ml.
Isolation of a gene encoding HAT7 homeobox-leucine zinner.
One to two weeks after inoculation, transfected Nicotiana benthamiana plants
were
visually monitored for changes in growth rates, morphology, and color. Plants
transfected
with 740 AT #855 (FIGURE 34) were moderately stunted. Plasmid 740 AT #855
contains
the TMV-U1 126-, 193-, and 30-kDa ORFs, the TMV-U5 coat protein gene (U5 cp),
the T7
promoter, an Arabidopsis thaliana CD4-13 NotI fragment, and part of the pUCl9
plasmid.
The TMV-U1 subgenomic promoter located within the minus strand of the 30-kDa
ORF
controls the synthesis of the CD4-13 subgenomic RNA.
DNA se~uencin~and computer analysis.
The NotI fragment of 740 AT #855 was characterized: nucleotide sequence
analysis
and amino acid sequence comparisons were performed using DNA Strider, PCGENE
and
NCBI Blast programs 740 AT #855 contained A. thaliana HAT 7 homeobox-luecine
zipper
cDNA sequence. The nucleotide sequence alignment of 740 AT #855 and
Arabidopsis
thaliana HAT7 homeobox protein ORF (U09340) was compared. FIGURE 36 (SEQ. ID.
Nos: 85-87) shows the nucleotide sequences of 740 #855 and A. thaliana HAT7
homeobox
protein ORF, and the amino acid sequence of A. thaliana HAT7 homeobox protein
ORFs.
The result show that 740 AT #855 contains a 3'- untranslated region (UTR) of
the A.
thaliana HAT7 homeobox protein ORF in a positive orientation, thus inhibited
the
expression of HAT 7 homeobox protein in the transfected N. benthamiana. Table
13 shows
the 740 AT #855 nucleotide sequence comparison with A. thaliana, rat and
human: 65-98%
identities and positives
CA 02380330 2002-O1-21
WO 01/07600 PCT/US00/20261
0
00 ~n ~n
,..
~ M ~D Vr
'~-. M M
~ . w w w
O C~ ~t 'd'
p.,- N N
0
O
a
L. O M ~ ~O
O ~
V U N N
~ ~~
C
N
a'
O r, r,
O
~ i O
O
j O I~ O
U oo
p.,~-,~n o0
z
Q
O M O O
d.
C/~00 I~ (~
U
M
M
r, M O
x'
N
M
I
O
N 'CJ
O M O
M O
4\
t~ ~ O
i.
O
O ~
v d
O
_o
I
U ~C ~
91
WO 01/07600 CA 02380330 2002-0l-21 PCT/[JS00/202G1
EXAMPLE 17
Identification of human nucleotide sequences involved in the regulation of
plant Qrowth by
cvtoplasmic inhibition of eene expression using viral derived RNA containing
human
nucleotide sequences.
A human brain cDNA library are obtained from public and private sources or
prepared from human mRNAs. The cDNAs are inserted in viral rectors or in small
subcloning vectors and the cDNA inserts are isolated from the cloning vectors
with
appropriate enzymes, modified, and NotI linkers are attached to the cDNA blunt
ends. The
human cDNA inserts are subcloned into the NotI site of pBS740. E. coli C600
competent
cells are transformed with the pBS740 sublibrary and colonies containing human
cDNA
sequences are selected on LB Amp 50 ug/ml. DNAs containing the viral human
brain
cDNA library are purified from the transformed colonies and used to make
infectious RNAs
that are directly applied to plants. One to three weeks post transfection, the
plants
developing severe stunting phenotypes are identified and their corresponding
viral vector
inserts are characterized by nucleic acid sequencing.
Identification of human nucleotide sequences involved in the Qrowth regulation
of a host
organism by inhibition of an endosenous -gene expression using viral derived
RNA
containing human nucleotide sequences.
A human brain cDNA library are obtained from public and private sources or
prepared from human mRNAs. The cDNAs are inserted in viral vectors or in small
subcloning vectors and the cDNA inserts are isolated from the cloning vectors
with
appropriate enzymes, modified, and NotI linkers are attached to the cDNA blunt
ends. The
human cDNA inserts are subcloned into the NotI site of pFastBacl. The human
cDNA insert
is removed from the shuttle plasmid pFastBac-HcDNA containing the human cDNA
insert
to pFastBacMaml as an EcoRI-XbaI fragment to construct pFastBacMaml-HcDNA
according to Condreay et al., (Proc. Natl. Acad. Sci.USA, 96: 127-132 (1999)).
Recombinant virus is generated using the Bac-to-Bac system (Life
Technologies). Virus is
further amplified by propagation in Spodoptera frugiperda cells. Phenotypic
changes such
as doubling rate, shape, size, kinase activity, cytokine release, response to
excipients (e.g.
toxic compounds, pathogens, etc.), division of cell culture, serum-free
growth, activation of
92
WO 01/07600 CA 02380330 2002-0l-21 PCT/US00/20261
gene, and expression of receptor are detected microscopically,
macroscopically, or by a
biochemical method. Cells with phenotypic or biochemical changes are detected
and the
nucleic acid insert in the cDNA clone or in the vector that results in changes
is then
sequenced.
Humanizing plant homologue for expression of plant derived human protein
In order to obtain the corresponding plant cDNAs, the human clones responsible
for
causing changes in the transfected plant phenotype (for example, stunting) are
used as
probes. Full-length plant cDNAs are isolated by hybridizing filters or slides
containing N.
benthamiana cDNAs with'ZP-labelled or fluorescent human cDNA insert probes.
The
positive plant clones are characterized by nucleic acid sequencing and
compared with their
human homologs. Plant codons that encode for different amino acids are changed
by site
directed mutagenesis to codons that encode for the same amino acids as their
human
homologs. The resulting "humanized" plant cDNAs encode an identical protein as
the
human clone. The "humanized" plant clones are used to produce human proteins
in either
transfected or transgenic plants by standard techniques. Because the
"humanized" cDNA is
from a plant origin, it is optimal for expression in plants.
EXAMPLE 18
Gene silencin /c~ o-suppression of genes induced by deliverins an RNA capable
of base
pairine with itself to form double stranded regions.
Gene silencing has been used to down regulate gene expression in transgenic
plants.
Recent experimental evidence suggests that double stranded RNA may be an
effective
stimulator of gene silencing/co-suppression phenomenon in transgenic plant.
For example,
Waterhouse et al. (Proc. Natl. Acad. Sci. USA 95:13959-13964 (1998),
incorporated herein
by reference) described that virus resistance and gene silencing in plants
could be induced by
simultaneous expression of sense and antisense RNA. Gene silencing/co-
suppression of
plant genes may be induced by delivering an RNA capable of base pairing with
itself to form
double stranded regions.
93
WO 01/07600 CA 02380330 2002-0l-21 pCT/US00/20261
This example shows: (1) a novel method for generating an RNA virus vector
capable
of producing an RNA capable of forming double stranded regions, and (2) a
process to
silence plant genes by using such a viral vector.
Step l: Construction of a DNA sequence which after it is transcribed would
generate
an RNA molecule capable of base pairing with itself. Two identical, or nearly
identical, ds
DNA sequences are ligated together in an inverted orientation to each other
(i.e., in either a
head to tail or tail to head orientation) with or without a linking nucleotide
sequence between
the homologous sequences. The resulting DNA sequence is then be cloned into a
cDNA
copy of a plant viral vector genome.
Step 2: Cloning, screening, transcription of clones of interest using known
methods
in the art.
Step 3: Infect plant cells with transcripts from clones.
As virus expresses foreign gene sequence, RNA from foreign gene forms base
pair
upon itself, forming double-stranded RNA regions. This approach is used with
any plant or
non-plant gene and used to silence plant gene homologous to assist in
identification of the
function of a particular gene sequence.
Although the invention has been described with reference to the presently
preferred
embodiments, it should be understood that various modifications can be made
without
departing from the spirit of the invention.
All publications, patents, patent applications, and web sites are herein
incorporated
by reference in their entirety to the same extent as if each individual
publication, patent,
patent application, or web site was specifically and individually indicated to
be incorporated
by reference in its entirety.
94
