Note: Descriptions are shown in the official language in which they were submitted.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
PCR-Based Detection and Quantification of Tapesia yallundae and Tapesia
acuformis
The present invention relates to the use of primers and probes in TaqManT""
quantitative
PCR assays for the detection of Tapesia yallundae (syn. Pseudocercosporella
herpotrichoides W-type) and Tapesia acuformis (syn. Pseudocercosporella
herpotrichoides
R-type). The use of these assays enables the detection of specific fungal
pathogens and
their quantification in plant populations. The invention also relates to the
use of primers and
probes in TaqManT"" quantitative PCR assays for the detection of host wheat
DNA for use
as an endogenous reaction control.
Diseases in plants cause considerable crop loss from year to year resulting
both in
economic deprivation to farmers and, in many parts of the world, to shortfalls
in the
nutritional provision for local populations. The widespread use of fungicides
has provided
considerable security against plant pathogen attack. However, despite $1
billion worth of
expenditure on fungicides, worldwide crop losses amounted to approximately 10%
of crop
value in 1981 (James, 1981; Seed Sci. & Technol. 9: 679-685).
The severity of the destructive process of disease depends on the
aggressiveness of the
pathogen and the response of the host. One aim of most plant breeding programs
is to
increase the resistance of host plants to disease. Typically, different races
of pathogens
interact with different varieties of the same crop species differentially, and
many sources of
host resistance only protect against specific pathogen races. Furthermore,
some pathogen
races show early signs of disease symptoms, but cause little damage to the
crop. Jones
and Clifford (1983; Cereal Diseases, John Wiley) report that virulent forms of
the pathogen
are expected to emerge in the pathogen population in response to the
introduction of
resistance into host cultivars and that it is therefore necessary to monitor
pathogen
populations. In addition, there are several documented cases of the evolution
of fungal
strains that are resistant to particular fungicides. As early as 1981,
Fletcher and Wolfe
(1981; Proc. 1981 Brit. Crop Prot Conf.) contended that 24% of the powdery
mildew
populations from spring barley and 53% from winter barley showed considerable
variation in
response to the fungicide triadimenol and that the distribution of these
populations varied
between varieties, with the most susceptible variety also giving the highest
incidence of less
susceptible types. Similar variation in the sensitivity of fungi to fungicides
has been
documented for wheat mildew (also to triadimenol), Botrytis (to benomyl),
Pyrenophora (to
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-2-
organomercury), Pseudocercosporella (to MBC-type fungicides) and
Mycosphaerella
fijiensis to triazoles to mention just a few (Jones and Clifford; Cereal
Diseases, John Wiley,
1983).
Cereal species are grown world-wide and represent a major fraction of world
food
production. Although yield loss is caused by many pathogens, the necrotizing
pathogens
Septoria and Pseudocercosporella are particularly important in the major
cereal growing
areas of Europe and North America (Jones and Clifford; Cereal Diseases, John
Wiley,
1983). In particular, the differential symptomology caused by different
isolates and species
of these fungi make the accurate predictive determination of potential disease
loss difficult.
Consequently, the availability of improved diagnostic techniques for the rapid
and accurate
identification of specific pathogens will be of considerable use to field
pathologists.
Eyespot of wheat is caused by the pathogens Tapesia acuformis and Tapesia
yallundae.
These have previously been considered varieties of the same species
Pseudocercosporella
herpotrichoides (Fron) Deighton. Wheat, rye, oats and other grasses are
susceptible to the
eyespot disease, which occurs in cool, moist climates and is prevalent in
Europe, North and
South America, Africa and Australia. Wheat is the most susceptible cereal
species, but
isolates have been identified that are also virulent on other cereals. The R-
strain of the
fungus (Tapesia acuformis), for example, has also been isolated from rye and
grows more
slowly on wheat than the W-strain (Tapesia yallundae) which has been isolated
from wheat.
Eyespot is restricted to the basal culm of the plant and can kill tillers or
plants outright;
however, it more usually causes lodging and/or results in a reduction in
kernel size and
number. Yield losses associated with eyespot are of even greater magnitude
than those
associated with Septoria tritici and Septoria nodorum. Typical control
measures for eyespot
include treatment with growth regulators to strengthen internodes, as well as
fungicide
treatment. However, the differing susceptibility of cultivars to different
strains of the fungus
render the predictive efficacy of fungicide treatments difficult.
In view of the above, there is a real need for the development of technology
that will allow
the identification of specific races of pathogen fungi early in the infection
process. By
identifying the specific race of a pathogen before disease symptoms become
evident in the
crop stand, the agriculturist can assess the likely effects of further
development of the
pathogen in the crop variety in which it has been identified and can choose an
appropriate
fungicide if such application is deemed necessary.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-3-
TaqManT"" chemistry and the AB17700 (Perkin Elmer, Applied Biosystems
Division, Foster
City, CA) provide a means of creating precise, reproducible quantitative
assays of DNA and
RNA. The foundation of TaqManT"" chemistry is the polymerase chain reaction
(PCR). In
conventional PCR assays, oligonucleotide primers are designed complementary to
the 5'
and 3' ends of a DNA sequence of interest. During thermal cycling, DNA is
first heat
denatured. The sample is then brought to annealing and extension temperatures
in which
the primers bind their specific complements and are extended by the addition
of nucleotide
tri-phosphates by Taq polymerase. With repeated thermal cycling, the amount of
template
DNA is amplified.
In TaqManT"" chemistry, an oligonucleotide probe is designed that is
complementary to the
sequence region between the primers within the PCR amplicon. The probe
contains a
fluorescent reporter dye at its 5' end and a quencher dye at its 3' end. When
the probe is
intact, its fluorescent emissions are quenched by the phenomena of fluorescent
resonance
energy transfer (FRET). During thermal cycling, the probe hybridizes to the
target DNA
downstream of one of the primers. TaqManT"" chemistry relies on the 5'
exonuclease
activity of Taq polymerase to cleave the fluorescent dye from the probe. As
PCR product
accumulates, fluorescent signal is increased. By measuring this signal, the
amplified
product can be quantified. This method allows the quantitation of disease
pressure by
targeting pathogen DNA. In combination with the PCR primers, the probe
provides another
level of specificity in assays to differentiate pathogens.
The present invention thus provides:
an oligonucleotide primer selected from the group consisting of SEQ ID NOs:3-
6, 8-23, 25-
26, 28, 30, 42, and 43, in particular, wherein said primer is selected from
the group
consisting of SEQ ID NOs:3-6, 8-23, 25-26, 28, and 30
~ a pair of oligonucleotide primers, wherein at least one of said primers is
the
oligonucleotide primer as mentioned hereinbefore
~ a pair of oligonucleotide primers mentioned hereinbefore, wherein said pair
consists of
SEQ ID N0:14 and SEQ ID N0:18 or SEQ ID N0:3 and SEQ ID N0:8
~ an oligonucleotide primer mentioned hereinbefore, wherein said primer is
selected from
the group consisting of SEQ ID NOs:42 and 43
~ a pair of oligonucleotide primers, wherein at least one of said primers is
the
oligonucleotide primer consisting of SEQ ID NOs:42 and 43
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-4-
~ a pair of oligonucleotide primers, wherein said pair consists of SEO ID
N0:42 and SEQ
ID N0:43.
The invention further provides
~ methods for the detection of a fungal pathogen, in particular of Tapesia
yallundae and
Tapesia acuformis, comprising:
(a) isolating DNA from a plant leaf infected with a pathogen;
(b) subjecting said DNA to polymerase chain reaction amplification using at
least one
primer according to the invention; and
(c) detecting said fungal pathogen by visualizing the product or products of
said
polymerase chain reaction amplification.
~ methods for the detection of a fungal pathogen, in particular of Tapesia
yallundae and
Tapesia acuformis, comprising:
(a) isolating DNA from plant tissue infected with said fungal pathogen;
(b) amplifying a part of the Internal Transcribed Spacer sequence of said
fungal pathogen
using said DNA as a template in a polymerase chain reaction with a pair of
primers
according to claim 3; and
(c) detecting said fungal pathogen by visualizing the amplified part of the
Internal
Transcribed Spacer sequence.
The invention further provides diagnostic kit used in detecting a fungal
pathogen,
comprising the primer of as mentioned hereinbefore.
The invention further provides
methods for the detection of wheat DNA, comprising:
(a) isolating DNA from wheat tissue infected with a pathogen;
(b) subjecting said DNA to polymerase chain reaction amplification using a
pair of primers
according to the invention; and
(c) detecting said wheat DNA by visualizing the product or products of said
polymerase
chain reaction amplification.
Furthermore, the invention provides oligonucleotide probes for use in
amplification-based
detection of a fungal Internal Transcribed Spacer sequence, wherein said probe
comprises:
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-5-
(a) a nucleotide sequence complementary to at least 10 consecutive nucleotides
of a
sequence selected from the group consisting of: ITS1 of Tapesia yallundae,
ITS2 of
Tapesia yallundae, ITS1 of Tapesia acuformis and ITS2 of Tapesia acuformis;
(b) a fluorescent reporter dye at a 5' end of said nucleotide sequence; and
(c) a quencher dye at a 3' end of said nucleotide sequence.
The invention further provides oligonucleotide probes according as mentioned
hereinbefore,
wherein said nucleotide sequence is complementary to at least 10 consecutive
nucleotides
of a sequence selected from the group consisting of: nucleotides 31-263 of SEQ
ID N0:37,
nucleotides 420-570 of SEQ ID N0:37, nucleotides 31-262 of SEQ ID N0:38, and
nucleotides 419-568 of SEO ID N0:38, but in particular wherein said nucleotide
sequence is
selected from the group consisting of: SEQ ID N0:7, SEO ID N0:24, SEQ ID
N0:27, and
SEQ ID N0:29.
The invention further provides oligonucleotide probes for use in amplification-
based
detection of wheat DNA, wherein said probe comprises:
(a) a nucleotide sequence complementary to at least 10 consecutive nucleotides
of SEQ
ID N0:41 or SEQ ID N0:44;
(b) a fluorescent reporter dye at a 5' end of said nucleotide sequence; and
(c) a quencher dye at a 3' end of said nucleotide sequence.
The invention further provides an oligonucleotide primer pair/probe set for
quantifying
fungal DNA, wherein said primer pair consists of the pair of primers according
to the
invention and the probe is SEQ ID N0:24, SEQ ID N0:7 or SEQ ID N0:44.
In order to ensure a clear and consistent understanding of the specification
and the claims,
the following definitions are provided:
Gene: refers to a coding sequence and associated regulatory sequences wherein
the
coding sequence is transcribed into RNA such as mRNA, rRNA, tRNA, snRNA, sense
RNA
or antisense RNA. Examples of regulatory sequences are promoter sequences, 5'
and 3'
untranslated sequences and termination sequences. Further elements that may be
present
are, for example, introns.
Identi : The percentage of sequence identity is determined using computer
programs that
are based on dynamic programming algorithms. Computer programs that are
preferred
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-6-
within the scope of the present invention include the BLAST (Basic Local
Alignment Search
Tool) search programs designed to explore all of the available sequence
databases
regardless of whether the query is protein or DNA. Version BLAST 2.0 (Gapped
BLAST) of
this search tool has been made publicly available on the Internet (currently
http://www.ncbi.nlm.nih.gov/BLAST~. It uses a heuristic algorithm which seeks
local as
opposed to global alignments and is therefore able to detect relationships
among
sequences which share only isolated regions. The scores assigned in a BLAST
search have
a well-defined statistical interpretation. Said programs are preferably run
with optional
parameters set to the default values.
Plant: refers to any plant, particularly to seed plants.
Plant material: refers to leaves, stems, roots, flowers or flower parts,
fruits, pollen, pollen
tubes, ovules, embryo sacs, egg cells, zygotes, embryos, seeds, cuttings, cell
or tissue
cultures, or any other part or product of a plant
The present invention is drawn to methods of identification and quantification
of different
species of plant pathogenic fungi. The invention provides primer and probe DNA
sequences useful in TaqManT"" quantitative PCR assays. Such DNA sequences are
useful
in the method of the invention as they are used in polymerase chain reaction
(PCR) and
TaqManT""-based diagnostic assays. These primers generate unique fragments in
PCR
reactions in which the DNA template is provided by specific fungal pathogens.
In
combination with the hybridization of the TaqManT"" probe, they can be used to
detect and
quantify the specific pathogens in host plant material before the onset of
disease
symptoms.
In a preferred embodiment, the invention provides ITS-derived diagnostic
primers and
TaqManT"" probes for the detection of Tapesia yallundae (syn.
Pseudocercosporella
herpotrichoides W-type) and Tapesia acuformis (syn. Pseudocercosporella
herpotrichoides
R-type).
This invention provides the possibility of assessing potential damage in a
specific crop
variety-pathogen strain relationship and of utilizing judiciously the diverse
armory of
fungicides that is available. Furthermore, the invention can be used to
provide detailed
information on the development and spread of specific pathogen races over
extended
geographical areas. The invention provides a method of quantification of
disease pressure
on a given crop.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
_7-
Kits useful in the practice of the invention are also provided. The kits find
particular use in
the identification and quantification of the fungal pathogens Tapesia
yallundae and
Tapesia acuformis.
BRIEF DESCRIPTION OF THE SEQUENCES IN THE SEQUENCE LISTING
SEQ ID NOs:1-34 are the following oligonucleotide probes and primers useful
for PCR-
based detection of the fungal pathogens Tapesia yallundae and Tapesia
acuformis:
Sequence Oligo Target Oligo Sequence
IdentifierName (5'->3')
SEQ ID ITS1 Fungal 18S tccgtaggtgaacctgcgg
rDNA
N0:1
SEQ ID ITS4 Fungal 25S tcctccgcttattgatatgc
rDNA
N0:2
SEQ ID J103W Tapesia yallundaeggctaccctacttggtag
N0:3 (V11)
SEQ ID J104W Tapesia yallundaecctgggggctaccctacttg
N0:4 (W )
SEQ ID J105W Tapesia yallundaegggggctaccctacttggtag
N0:5 (W)
SEQ ID J106W Tapesia yallundaetgggggctaccctacttggtag
N0:6 (V11)
SEQ ID J107W Tapesia yallundae(FAM)-tttagagtcgtcaggcctctcggagaagc-
N0:7 (W) (TAMRA)
SEQ ID J108W Tapesia yallundaeatttattcaagggtggaggtcctga
N0:8 (W )
SEQ ID J109W Tapesia yallundaeaagggtggaggtctgaaccag
N0:9 (W )
SEQ ID J110W Tapesia yallundaeaagggtggaggtctgaacca
N0:10 (W)
SEQ ID J111 Tapesia yallundaecaagggtggaggtctgaacc
W
N0:11 (V11)
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
_g_
SEQ ID J112R Tapesia acuformistcaagggtggaggtctgaacc
N0:12 (R)
SEQ ID J100R Tapesia acuformisgggccaccctacttcggtaa
N0:13 (R)
SEQ ID J101 Tapesia acuformisgaaatcctgggggccaccctacttc
R
N0:14 (R)
SEQ ID J102R Tapesia acuformiscctgggggccaccctact
N0:15 (R)
SEQ ID J113R Tapesia acuformisgccaccctacttcggtaaggtt
N0:16 (R)
SEQ ID J114R Tapesia acuformiscaccctacttcggtaaggtttagagtc
N0:17 (R)
SEQ ID J115R Tapesia acuformisaggtaatttattcaagggtggaggt
N0:18 (R)
SEQ ID J116R Tapesia acuformisaggtaatttattcaagggtggaggtc
N0:19 (R)
SEQ ID J117R Tapesia acuformisaaggtaatttattcaagggtggaggt
N0:20 (R)
SEQ ID J118R Tapesia acuformisttattcaagggtggaggtctgg
N0:21 (R)
SECT ID J119R Tapesia acuformistattcaagggtggaggtctgga
N0:22 (R)
SEQ ID J120R Tapesia acuformiscctgccaaagcaacaaaggta
N0:23 (R)
SEQ ID J121 Tapesia acuformis(FAM)-cgggcctctcggagaagcctgg-(TAMRA)
R
N0:24 (R)
SEQ ID J122R Tapesia acuformiscctacttcggtaaggtttagagtcgt
N0:25 (R)
SEQ ID J123R Tapesia acuformistctccgagaggcccgac
N0:26 (R)
SEQ ID J124R Tapesia acuformis(FAM)-aagcctggtccagacctccaccc-(TAMRA)
N0:27 (R)
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
_g_
SEQ ID J125R Tapesia acuformisaaggatcattaatagagcaatggatagac
N0:28 (R)
SEQ ID J126R Tapesia acuformis(FAM)-cgccccgggagaaatcctgg-(TAMRA)
N0:29 (R)
SEO ID J127R Tapesia acuformistgggggccaccctacttc
N0:30 (R)
SEQ ID JB537 Tapesia yallundaegggggctaccctacttggtag
N0:31 (W)
SEQ ID JB541 Tapesia yallundaeccactgattttagaggccgcgag
N0:32 (W )
SEQ ID JB540 Tapesia acuformisgggggccaccctacttcggtaa
N0:33 (R)
SEQ ID JB542 Tapesia acuformisccactgattttagaggccgcgaa
N0:34 (R)
SEQ ID N0:35 is a forward sequencing primer.
SEQ ID N0:36 is a reverse sequencing primer.
SEQ ID N0:37 is a DNA sequence for the Internal Transcribed Spacer of Tapesia
acuformis (syn. P. herpotrichoides R-type), NRRL accession no. B-21234,
comprising in the
5'to 3' direction: 3' end of the small subunit rRNA gene (nucleotides 1-30),
Internal
Transcribed Spacer 1 (nucleotides 31-263), 5.8 S rRNA gene (nucleotides 264-
419),
Internal Transcribed Spacer 2 (nucleotides 420-570), and 5' end of the large
subunit rRNA
gene (nucleotides 571-627).
SEQ ID N0:38 is a DNA sequence for the Internal Transcribed Spacer of Tapesia
yallundae (syn. P. herpotrichoides W-type), NRRL accession no. B-21231,
comprising in the
5' to 3' direction: 3' end of the small subunit rRNA gene (nucleotides 1-30),
Internal
Transcribed Spacer 1 (nucleotides 31-262), 5.8 S rRNA gene (nucleotides 263-
418),
Internal Transcribed Spacer 2 (nucleotides 419-569), and 5' end of the large
subunit rRNA
gene (nucleotides 570-626).
SEQ ID N0:39 is a consensus DNA sequence of the partial ITS region PCR-
amplified from
wheat extracts from three different locations (Barton, Elmdon, Teversham)
infected with
Tapesia acuformis, comprising in the 5' to 3' direction: partial Internal
Transcribed Spacer 1
sequence, 5.8 S rRNA gene, and partial Internal Transcribed Spacer 2 sequence.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-10-
SEQ ID N0:40 is a consensus DNA sequence of the partial ITS region PCR-
amplified from
wheat extracts from three different locations (Barton, Elmdon, Teversham)
infected with
Tapesia yallundae, comprising in the 5' to 3' direction: partial Internal
Transcribed Spacer 1
sequence, 5.8 S rRNA gene, and partial Internal Transcribed Spacer 2 sequence.
SEQ ID N0:41 is the nucleotide sequence of the gene for cytochrome b-559 in
wheat
chloroplast DNA (Hird, et al., Mol. Gen. Genet. 203: 95-100 (1986)).
SEQ ID NOs:42-44 are the following oligonucleotide primers and probe useful
for PCR-
based detection of wheat chloroplast DNA:
Sequence Oligo PrimerOligo Sequence
IdentifierName Name (5'->3')
SEQ ID Forward WCP2 cagtgcgatggctggctatt
N0:42 Primer
SEQ ID Reverse WCP3 cgttggatgaactgcattgct
N0:43 Primer
SEQ ID TaqMan'"" WCP1 (VIC)-acggactagctgtacctactgtttttttcttgggatc-
N0:44 Probe (TAMRA)
The present invention provides unique DNA sequences that are useful in
identifying and
quantifying different pathotypes of plant pathogenic fungi. Particularly; the
DNA sequences
can be used as primers in TaqManT"" PCR-based analysis for the identification
of fungal
pathotypes. The DNA sequences of the invention include primers and probes
derived from
Internal Transcribed Spacer (ITS) sequences of the ribosomal RNA gene regions
of
particular fungal pathogens, which are capable of identifying the particular
pathogen. The
ITS DNA sequences from different pathotypes within a pathogen species or
genus, which
vary between the different members of the species or genus, can be used to
identify those
specific members.
Biomedical researchers have used PCR-based techniques for some time and with
moderate
success to detect pathogens in infected animal tissues. Only recently,
however, has this
technique been applied to detect plant pathogens. The presence of
Gaumannomyces
graminis in infected wheat has been detected using PCR of sequences specific
to the
pathogen mitochondrial genome (Schlesser et al., 1991; Applied and Environ.
Microbiol. 57:
553-556), and random amplified polymorphic DNA (i.e. RAPD) markers were able
to
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-11 -
distinguish numerous races of Gremmeniella abietina, the causal agent of
scleroderris
canker in conifers. U.S. Patent No. 5,585,238 (herein incorporated by
reference in its
entirety) describes primers derived from the ITS sequences of the ribosomal
RNA gene
region of strains of Septoria, Pseudocercosporella, and Mycosphaerella and
their use in the
identification of these fungal isolates using PCR-based techniques. In
addition, WO
95/29260 (herein incorporated by reference in its entirety) describes primers
derived from
the ITS sequences of the ribosomal RNA gene region of strains of Fusarium and
their use
in the identification of these fungal isolates using PCR-based techniques.
Furthermore,
U.S. Patent No. 5,800,997 (herein incorporated by reference in its entirety)
describes
primers derived from the ITS sequences of the ribosomal RNA gene region of
strains of
Cercospora, Helminthosporium, Kabatiella, and Puccinia and their use in the
identification
of these fungal isolates using PCR-based techniques.
Ribosomal genes are suitable for use as molecular probe targets because of
their high copy
number. Despite the high conservation between mature rRNA sequences, the non-
transcribed and transcribed spacer sequences are usually poorly conserved and
are thus
suitable as target sequences for the detection of recent evolutionary
divergence. Fungal
rRNA genes are organized in units, each of which encodes three mature subunits
of 18S
(small subunit), 5.8S, and 28S (large subunit). These subunits are separated
by two
Internal Transcribed Spacers, ITS1 and ITS2, of around 300 by (White etaL,
1990; In: PCR
Protocols; Eds.: Innes et al.; pages 315-322). In addition, the
transcriptional units are
separated by non-transcribed spacer sequences (NTSs). The ITS and NTS
sequences are
particularly suitable for the detection of specific pathotypes of different
fungal pathogens.
The DNA sequences of the invention are from the Internal Transcribed Spacer
sequences
of the ribosomal RNA gene region of particular plant pathogens. The ITS DNA
sequences
from different pathotypes within a pathogen species or genus vary among the
different
members of the species or genus. Once having determined the ITS sequences of a
pathogen, these sequences can be aligned with other ITS sequences. In this
manner,
primers can be derived from the ITS sequences. That is, primers can be
designed based
on regions within the ITS sequences that contain the greatest differences in
sequence
among the fungal pathotypes. These sequences and primers based on these
sequences
can be used to identify specific pathogens.
Sequences of representative oligonucleotide primers derived from ITS sequences
are
disclosed in SEQ ID NOs:1-34. The sequences find use in TaqManT"" quantitative
PCR-
based identification of the pathogens of interest.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-12-
Methods for the use of the primer sequences of the invention in PCR analysis
are well
known in the art. For example, see U.S. Patent Nos. 4,683,195 and 4,683,202,
as well as
Schlesser ef al. (1991 ) Applied and Environ. Microbiol. 57:553-556. See also,
Nazar et al.
(1991; Physiol. and Molec. PIantPathol. 39: 1-11), which used PCR
amplification to exploit
differences in the ITS regions of Verticillium albo-atrum and Verticillium
dahliae and
therefore distinguish between the two species; and Johanson and Jeger (1993;
Mycol. Res.
97: 670-674), who used similar techniques to distinguish the banana pathogens
Mycosphaerella fijiensis and Mycosphaerella musicola.
The TaqManT"" methodology has recently been used in medical research for the
quantitative
detection of herpes simplex virus (HSV) DNA in clinical samples (J. Clin.
MicrobioL 37(6):
1941-7 (June, 1999)) in veterinary medicine for the detection of parasitic
microbes in host
animals (J. Clin. Microbiol. 37(5): 1329-31 (May, 1999)), and has been shown
to be useful in
the screening of ground beef for bacterial pathogens (Appl. Envir. Micro.
62(4): 1347-1353
(Apr., 1996)). Only recently has the TaqManT"" method been used for the
identification
and/or quantification of fungal pathogens in crop plants (Phytopathology. 89
(9): 796-804
(1999).
The ITS DNA sequences of the invention can be cloned from fungal pathogens by
methods
known in the art. In general, the methods for the isolation of DNA from fungal
isolates are
known. See, Raeder & Broda (1985) Letters in Applied Microbiology 2.17-20; Lee
et al.
(1990) Fungal Genetics Newsletter 35:23-24; and Lee and Taylor (1990) In: PCR
Protocols: A Guide to Methods and Applications, Innes et al. (Eds.); pages 282-
287.
The ITS sequences are compared within each pathogen group to locate
divergences that
might be useful to test in TaqManT"" PCR assays to distinguish the different
species and/or
strains. From the identification of divergences, numerous primers are
synthesized for each
probe and tested in TaqManT"" assays. Templates used for TaqManT"" assays are
firstly
purified pathogen DNA, and subsequently DNA isolated from infected host plant
tissue.
Thus, it is possible to identify probe-primer combinations that are
diagnostic, i.e. that identify
one particular pathogen species or strain but not another species or strain of
the same
pathogen.
Preferred primer-probe combinations are able to distinguish between the
different species
or strains in infected host tissue, i.e. host tissue that has previously been
infected with a
specific pathogen species or strain. This invention provides numerous primer-
probe
combinations that fulfill this criterion for Tapesia yallundae and Tapesia
acuformis. The
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-13-
primers and probes of the invention are designed based on sequence differences
among
the fungal ITS regions. A minimum of one base pair difference between
sequences can
permit design of a discriminatory primer or probe. Primer-probe combinations
designed to a
specific fungal pathogen's ITS region can be used in combination with a primer
or probe
made to a conserved sequence region within the ribosomal gene's coding region
to detect
amplification of species-specific PCR fragments. In general, primers should
have a
theoretical melting temperature (TM) near 59°C to achieve good
sensitivity and should be
void of significant secondary structure and 3' overlaps between primer
combinations.
Primer pairs' TMs are typically within 2°C of one another. Primers
generally have sequence
identity with at least about 5-10 contiguous nucleotide bases of ITS1 or ITS2.
In preferred
embodiments, primers are anywhere from approximately 5-30 nucleotide bases
long.
Probes are generally designed to have a TM 10°C higher than that of the
primers.
All wheat extractions contain the host wheat DNA as well as any fungal
pathogen DNA
present. Thus, an endogenous control assay targeting the wheat DNA can be run
on
extracts to account for any differences among sample extractions. The present
invention
describes a control assay targeting the cytochrome b-559 gene. The cytochrome
b-559
gene is a conserved gene among wheat varieties, necessary for the life of the
host plant.
These control assays provide a control against false negatives. That is, a
negative result
for fungal DNA that could be attributed to inhibition of the PCR reaction is
verified by an
endogenous control assay. These control assays also provide a target against
which the
fungal DNA quantity is normalized for sample to sample comparison. The present
invention
describes the use of these control assays in reactions separate from the
fungal pathogen
assays and in multiplexed reactions. The present invention lends itself
readily to the
preparation of "kits" containing the elements necessary to carry out the
process. Such a kit
may comprise a carrier being compartmentalized to receive in close confinement
therein
one or more container, such as tubes or vials. One of the containers may
contain unlabeled
or detestably labeled DNA primers. The labeled DNA primers may be present in
lyophilized
form or in an appropriate buffer as necessary. One or more containers may
contain one or
more enzymes or reagents to be utilized in TaqManTM PCR reactions. These
enzymes may
be present by themselves or in admixtures, in lyophilized form or in
appropriate buffers.
Finally, the kit may contain all of the additional elements necessary to carry
out the
technique of the invention, such as buffers, extraction reagents, enzymes,
pipettes, plates,
nucleic acids, nucleoside triphosphates, filter paper, and other consumables
of the like.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-14-
The examples below show typical experimental protocols that can be used in the
selection
of suitable primer and probe sequences, the testing of primers and probes for
selective and
diagnostic efficacy, and the use of such primers and probes for disease and
fungal isolate
detection and quantification. Such examples are provided by way of
illustration and not by
way of limitation.
EXAMPLES
Standard recombinant DNA and molecular cloning techniques used here are well
known in
the art and are described by J. Sambrook, E. F. Fritsch and T. Maniatis,
Molecular Cloning:
A Laboratory Manual, Cold Spring Harbor laboratory, Cold Spring Harbor, NY
(1989) and by
T.J. Silhavy, M.L. Berman, and L.W. Enquist,_Experiments with Gene Fusions,
Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY (1984) and by Ausubel, F.M. et al.,
Current
Protocols in Molecular Biology, pub. by Greene Publishing Assoc. and Wiley-
Interscience
(1987).
EXAMPLE 1: Fungal Isolates and Fungal genomic DNA Extraction
Table 1 provides a listing of the fungal test isolates used and their source.
Fungi are grown
in 150 ml potato dextrose broth inoculated with mycelial fragments from PDA
(Potato
Dextrose Agar) cultures. Cultures are incubated on an orbital shaker at
28°C for 7-11 days.
Alternatively, mycelia are isolated directly from a PDA plate. Mycelia are
pelleted by
centrifugation and then ground in liquid nitrogen, and total genomic DNA is
extracted using
the protocol of Lee and Taylor (1990; In: PCR Protocols: A Guide to Methods
and
Applications; Eds.: Innes et aL; pages 282-287).
Table 1: Source of Test Isolates
Isolate Organism Source Origin
358 Tapesia acuformis Novartis' ---
308 Tapesia acuformis Novartis' -
44643 Tapesia yallundae ATCC' Germany
44614 Tapesia yallundae ATCC' Ireland
60973 Tapesia acuformis ATCC' Germany
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-15-
42040 Pseudocercosporella herpotrichoidesATCC' ---
var.
herpotrichoides
62012 Pseudocercosporella aestiva ATCC' Germany
24425 Septoria nodorum ATCC' Montana
26517 Septoria tritici ATCC' Minnesota
38699 Septoria glycines ATCC' Illinois
22585 Septoria passerine ATCC' Minnesota
26380 Septoria avenae f.sp. triticea Bergstrom/Minnesota
Ueng3
52182 Ceratobasidium cereale ATCC' Ohio
11404 Drechslera sorokiniana ATCC' Minnesota
R-5391 Fusarium culmorum Nelson" Germany
4551 Fusarium moniliforme Novartis' Indiana
R-8637 Fusarium graminearum Nelson'' Morocco
T-534 Fusarium poae Nelson'' Pennsylvanni
a
18222 Gerlachia nivalis ATCC' United
Kingdom
093 Microdochium nivale var. majus Novartis' ---
'Novartis Agribusiness Biotechnology Research, Inc., Research Triangle Park,
NC, USA
2American Type Culture Collection, Rockville, Maryland, USA
3Dr. Gary Bergstrom, Cornell University, and Dr. Peter Ueng, USDA-ARS,
Beltsville,
Maryland.
4Dr. Paul Nelson, Penn State University, State College, Pennsylvania
EXAMPLE 2: DNA Extraction from Wheat Stem Tissue
DNA is extracted from wheat stem tissues (identified in Table 2) as follows:
(1 ) Up to 25 wheat samples are placed on a clean surface. A sterile scalpel
is used to cut
the stem just above the first tiller or root. Another cut is made 4 cm above
this cut. This 4
cm section constitutes the stem tissue sample which is pooled with the
additional wheat
samples for bulk maceration.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-16-
(2) The stem sample is placed in a Bioreba (Reinach, Switzerland) heavy duty
plastic bag
(cat#490100). The plant tissue is weighed, plastic bag with sample minus the
tare (weight
of the plastic bag).
(3) An equal volume (mL) of Muller Extraction Buffer (0.1 % w/v Tween-80;
0.040 M Tris
base; 0.15 M Sodium chloride; 0.1 % w/v Bovine serum albumin (Pentex Fraction
V); 0.01
w/v Sodium azide; 0.20 M EDTA; pH to 7.7, Store at 4°C) is added per
weight (g) of wheat
tissue. Tissue is macerated using a Bioreba Homex 6 homogenizer set at 70. The
tissue is
ground until fibrous.
(4) Extraction juice is aliquoted into Eppendorf tubes on ice.
(a) Extracts are boiled for 5 minutes.
(b) Boiled extracts are kept on ice. The boiled extract is microfuged for 5
minutes at
12,000 x G.
(c) 1:20 dilutions of the supernatant are made from the microfuged extract in
dH20.
(d) The diluted extracts are stored on ice until ready to use.
Table 2: Origin of Wheat Samples Used in Primer and Probe Development
Sample Description Origin
W(Barton) Eyespot infected wheat United Kingdom
W(Elmdon) Eyespot infected wheat United Kingdom
W(Teversham)Eyespot infected wheat United Kingdom
R(Barton) Eyespot infected wheat United Kingdom
R(Elmdon) Eyespot infected wheat United Kingdom
R(Teversham)Eyespot infected wheat United Kingdom
Table 3: Origin of Wheat Samples Used for Assay Development
Sample Description Origin
1999 H Uninfected wheat Greenhouse
1999 #5 Eyespot infected wheat Fairfield, WA
1999 #6 Eyespot infected wheat Genesee, ID
1999 #8 Eyespot infected wheat Walla Walla,
WA
1999 #10 Eyespot infected wheaf Connell, WA
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-17-
1999 #16 Eyespot infected wheat Connell, WA
1999 #21 Eyespot infected wheat Colfax, WA
1999 #23 Eyespot infected wheat Colfax, WA
1999# 33 Eyespot infected wheat Athena, OR
1999 #38 Eyespot infected wheat Leland, ID
1999 #41 Eyespot infected wheat Coulee City,
WA
1999 #43 Eyespot infected wheat Genesee, ID
1999 #46 Eyespot infected wheat Leland, ID
1999 #47 Eyespot infected wheat Leland, ID
1999 #54 Eyespot infected wheat Wilur, WA
1999 #56 Eyespot infected wheat Ritzville, WA
1999 #57 Eyespot infected wheat Sprague, WA
1999 #72 Eyespot infected wheat Grangeville,
10
1999 #73 Eyespot infected wheat Grangeville,
10
1999 #74 Eyespot infected wheat Grangeville,
10
1999 #80 Eyespot infected wheat Ritzville, WA
1999 #82 Eyespot infected wheat Edwall, WA
1999 #84 Eyespot infected wheat Genesee, ID
1999 #93 Eyespot infected wheat Davenport, WA
1999 #88 Eyespot infected wheat Wilbur, WA
1999 #89 Eyespot infected wheat Coulee City,
WA
1999 #94 Eyespot infected wheat Plummee, ID
1999 #95 Eyespot infected wheat Pendleton, OR
1999 #96 Eyespot infected wheat Harrington,
WA
1999 #100 Eyespot infected wheat Creston, WA
1999 #108 Eyespot infected wheat Wilbur, WA
1999 #111 Eyespot infected wheat Ferdinand, ID
EXAMPLE 3: Isolation and Sequencing of the Internal Transcribed Spacer (ITS)
Region DNA from Tapesia yallundae and Tapesia acuformis Infected Wheat Samples
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-18-
Approximately 420-by truncated ITS region fragments are PCR-amplified from
wheat
extracts identified in Table 2 infected with Tapesia yallundae using the
Tapesia yallundae-
specific primers JB537 (SEQ ID N0:31 ) and JB541 (SEQ ID N0:32). Similarly,
the Tapesia
acuformis truncated ITS fragments are amplified from Tapesia acuformis-
infected wheat
extracts using Tapesia acuformis-specific primers JB540 (SEQ ID N0:33) and
JB542 (SEQ
ID N0:34). Polymerase chain reactions are performed with the GeneAmp Kit from
Perkin-
Elmer (Foster City, CA; part no. N808-0009) using 50 mM KCI, 2.5 mM MgCl2, 10
mM Tris-
HCI, pH 8.3, containing 200 p,M of each dTTP, dATP, dCTP, and dGTP, 50 pmol
each
primer, 2.5 units of Taq polymerase and 1 p.1 1:10 diluted wheat extract in a
final volume of
50 ~.I. Reactions are run at 94°C for 15 s and 1 min. at 75°C
for 35 cycles in a Perkin-Elmer
Model 9700 thermal cycles.
The PCR products are cloned into the pCR02.1-TOPO TA-cloning vector using the
TOPO-
TA Cloning Kit (Invitrogen, Carlsbad, CA; part no. K4550-40) according to
manufacturer's
directions. Clones containing the ITS fragment inserts are sequenced using the
TA cloning
vector's FORWARD (5'-gtaaaacgacggccagt-3'; SEQ ID N0:35) and REVERSE (5'-
caggaaacagctatgac-3'; SEQ ID N0:36) primers. Sequencing is performed on an ABI
PRISM 377T"" DNA sequences (Perkin Elmer Applied Biosystems, Foster City,
California).
EXAMPLE 4: Synthesis and Purification of Oligonucleotides
Oligonucleotides and TaqManT"" probes (primers and probes) are synthesized and
purified
by, for example, either Integrated DNA Technologies (Coralville, IA) or
Midland Certified
Reagent Company (Midland, Texas).
EXAMPLE 5: Selection of Species-Specific Primers and Probes
A multiple sequence alignment is made of ITS region consensus sequences of
Tapesia
yallundae (SEQ ID N0:40) and Tapesia acuformis (SEQ ID N0:39) obtained from
infected
wheat tissue as described in Example 3. Also included in the alignment are ITS
region
sequences from Tapesia yallundae and Tapesia acuformis fungal DNAs referenced
in U.S.
Patent No. 5,585,238 (SEQ ID N0:37 and SEQ ID N0:38, respectively). PCR
primers and
TaqManT"" probes are designed to the regions that contain the greatest
differences in
sequence between the fungal species. This produces primers and probes designed
to be
specific to either Tapesia acuformis or Tapesia yallundae. The oligonucleotide
primers and
probes shown below in Tables 3 and 4 are synthesized according to Example 4.
The
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-19-
previously described (U.S. Patent No. 5,585,238) Tapesia yallundae-specific
primers JB537
(SEQ ID N0:31 ) and JB541 (SEQ ID N0:32), and Tapesia acuformis-specific
primers
JB540 (SEQ ID N0:33) and JB542 (SEQ ID N0:34) are also synthesized. In
addition, the
ribosomal gene-specific primers ITS1 (SEQ ID N0:1 ) and ITS4 (SEQ ID N0:2)
published by
White et al. (1990: In: PCR Protocols; Eds.: Innes et al. Pages 315-322) are
synthesized for
testing in combination with the primers specific for the ITS regions.
Table 4: Primers and Probes for TaqManT"" Amplification of Tapesia acuformis
DNA
SequenceOligo Target Oligo Sequence
IdentifierName (5'->3')
SEQ ID ITS1 Fungal 18S rDNA tccgtaggtgaacctgcgg
N0:1
SEQ ID ITS4 Fungal 25S rDNA tcctccgcttattgatatgc
N0:2
SEQ ID J112R Tapesia acuformistcaagggtggaggtctgaacc
(R)
N0:12
SEQ ID J100R Tapesia acuformisgggccaccctacttcggtaa
(R)
N0:13
SEQ ID J101 Tapesia acuformisgaaatcctgggggccaccctacttc
R (R)
N0:14
SEQ ID J102R Tapesia acuformiscctgggggccaccctact
(R)
N0:15
SEQ ID J113R Tapesia acuformisgccaccctacttcggtaaggtt
(R)
N0:16
SEQ ID J114R Tapesia acuformiscaccctacttcggtaaggtttagagtc
(R)
N0:17
SEQ ID J115R Tapesia acuformisaggtaatttattcaagggtggaggt
(R)
N0:18
SEQ ID J116R Tapesia acuformisaggtaatttattcaagggtggaggtc
(R)
N0:19
SEQ ID J117R Tapesia acuformisaaggtaatttattcaagggtggaggt
(R)
N0:20
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-20-
SEQ ID J118R Tapesia acuformisttattcaagggtggaggtctgg
(R)
N0:21
SEQ ID J119R Tapesia acuformistattcaagggtggaggtctgga
(R)
N0:22
SEQ ID J120R Tapesia acuformiscctgccaaagcaacaaaggta
(R)
N0:23
SEQ ID J121 Tapesia acuformis(FAM)-cgggcctctcggagaagcctgg-(TAMRA)
R (R)
N0:24
SEQ ID J122R Tapesia acuformiscctacttcggtaaggtttagagtcgt
(R)
N0:25
SEQ ID J123R Tapesia acuformistctccgagaggcccgac
(R)
N0:26
SEQ ID J124R Tapesia acuformis(FAM)-aagcctggtccagacctccaccc-(TAMRA)
(R)
N0:27
SEQ ID J125R Tapesia acuformisaaggatcattaatagagcaatggatagac
(R)
N0:28
SEQ ID J126R Tapesia acuformis(FAM)-cgccccgggagaaatcctgg-(TAMRA)
(R)
N0:29
SEQ ID J127R Tapesia acuformistgggggccaccctacttc
(R)
N0:30
SEQ ID JB540 Tapesia acuformisgggggccaccctacttcggtaa
(R)
N0:33
SEQ ID JB542 Tapesia acuformisccactgattttagaggccgcgaa
(R)
N0:34
Table 5: Primers and Probes for TaqManT"" Amplification of Tapesia yallundae
DNA
Sequence Primer Target Oligo Sequence
IdentifierName (5'->3')
SEQ ID ITS1 Fungal 18S rDNA tccgtaggtgaacctgcgg
N0:1
SEQ ID ITS4 Fungal 25S rDNA tcctccgcttattgatatgc
N0:2
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-21 -
SEQ ID J103W Tapesia yallundaeggctaccctacttggtag
N0:3 (W )
SEQ ID J104W Tapesia yallundaecctgggggctaccctacttg
N0:4 (W)
SEQ ID J105W Tapesia yallundaegggggctaccctacttggtag
N0:5 (W )
SEQ ID J106W Tapesia yallundaetgggggctaccctacttggtag
N0:6 (W )
SEQ ID J107W Tapesia yallundae(FAM)-tttagagtcgtcaggcctctcggagaagc-
N0:7 (W) (TAMRA)
SEQ ID J108W Tapesia yallundaeatttattcaagggtggaggtcctga
N0:8 (W )
SEQ ID J109W Tapesia yallundaeaagggtggaggtctgaaccag
N0:9 (W)
SEQ ID J110W Tapesia yallundaeaagggtggaggtctgaacca
N0:10 (W)
SEQ ID J111 W Tapesia yallundaecaagggtggaggtctgaacc
N0:11 (VII)
SEQ ID JB537 Tapesia yallundaegggggctaccctacttggtag
N0:31 (W )
SEQ ID JB541 Tapesia yallundaeccactgattttagaggccgcgag
N0:32 (W )
EXAMPLE 6: Initial Screening of the Primer-Probe Library
The species-specific primer libraries designed in Example 5 are tested in
initial TaqManT""
screens. Primer and probe combinations are tested for their ability to amplify
from the
target pathogen's DNA. All other reaction conditions are held constant (1X
TaqManT""
Universal Master Mix (Perkin Elmer, Norwalk, CT; part no. N430-4447), 200 nM
each
primer, 100 nM probe, 0.04 ng/~.L fungal target genomic DNA, thermal cycling:
50°C for 2
min., 95°C for 10 min., 40 cycles of 95°C for 15 s, 60°C
for 60 s). Pathogen-specific primers
and probes are determined by identifying those that best amplify the targeted
DNA.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-22-
EXAMPLE 7: TaqManT"" Primer Optimization
Once a primer pair specific for the targeted pathogen's DNA has been
identified, the primer
concentrations are optimized in a single TaqManT"" run. A matrix of different
concentrations
of the forward primer are run against those of the reverse primer with all
other reaction
conditions held constant (1 X TaqManT"" Universal Master Mix (Perkin Elmer),
100 nM probe,
0.4 ng/pL fungal target genomic DNA, thermal cycling: 50°C for 2 min.,
95°C for 10 min., 40
cycles of 95°C for 15 s, 60°C for 60 s).
EXAMPLE 8: TaqManT"" Probe Optimization
Once optimal primer concentrations are determined as in Example 7, the probe
concentration is optimized. With primers at their optimal concentrations,
different
concentrations of probe are run in a typical TaqManT"" run. The probe
concentration that
gives the best signal in reporting the PCR amplification is chosen. The
optimal primers and
probe for quantification of Tapesia acuformis and Tapesia yallundae are
recorded along
with their optimal reaction concentrations (Tables 5 and 6, respectively). The
Tapesia
acuformis and Tapesia yallundae assays are established with an annealing
temperature of
60°C over 35 cycles.
Table 6: Primer and Probe Combinations Specific for Tapesia acuformis
Target Oligo Sequence Primer Optimized
Identifier Name Concentration
(nM)
Tapesia acuformis (R) ForwardSEQ ID N0:14 J10150
Primer R
Reverse Primer SEQ ID N0:18 J115R900
TaqMan'"" Probe SEQ ID N0:24 J121700
R
Table 7: Primer and Probe Combinations Specific for Tapesia yallundae
Target Oligo Sequence Primer Optimized
IdentifierName Concentration
(nM)
Tapesia yallundae (W) ForwardSEQ ID J103W 300
Primer N0:3
Reverse Primer SEQ ID J108W 300
N0:8
TaqMan'"" Probe SEQ ID J107W 200
N0:7
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-23-
EXAMPLE 9: Determination of TaqManT"' Assay Specificity to Fungal Genomic DNA
The TaqManT"" assay is validated against a panel of DNA from other cereal
pathogens for
cross-reactivity (Table 1 ). TaqManTM reactions are prepared using the optimal
primer and
probe concentrations as determined in Examples 7 and 8 and tested against 0.2
ng/p,L of
the genomic DNA from the cereal pathogens as prepared in Example 1. Depending
on the
results, changes are made to the thermal cycling parameters to make the assay
more
stringent. These include changing the annealing/extension temperature or the
number of
cycles in the run. A successful TaqManT"" assay is sensitive to sub-picogram
amounts of
target DNA without any cross-reactivity to the panel of cereal pathogens or
the plant DNA.
In Table 8 results of the Tapesia acufonnis (R-type) and Tapesia yallundae
(V11-type) assays
documented under Example 8 are shown. CT values are used to show amplification
among
isolates screened. Those isolates with a CT value of 35 give no amplification
with the
assays.
Table 8: Results of Tapesia acuformis TaqManT"" Assay on Fungal Genomic DNA
Samples
IsolateOrganism CT Value CT Value
R-type W-type
assay assay
358 Tapesia acuformis 18.52 35
308 Tapesia acuformis 18.65 35
44643 Tapesia yallundae 35
44614 Tapesia yallundae 35 17.18
60973 Tapesia acuformis 31.36 35
42040 Pseudocercosporella herpotrichoides35 18.7
var.
herpotrichoides
62012 Pseudocercosporella aestiva 35 35
24425 Septoria nodorum 35 35
26517 Septoria tritici 35 35
38699 Septoria glycines 35 35
22585 Septoria passerini 35 35
26380 Septoria avenae f.sp. triticea 35 35
52182 Ceratobasidium cereale 35 35
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-24-
11404 Drechslera sorokiniana 35 35
R- Fusarium culmorum 35 35
5391
4551 Fusarium moniliforme 35 35
R- Fusarium graminearum 35 35
8637
T-534 Fusarium poae 35 35
18222 Gerlachia nivalis 35 35
093 Microdochium nivale var. majus 35 35
Note: CT value or threshold cycle, represents the PCR cycle at which an
increase in reporter
fluorescence above a baseline signal can first be detected. The Sequence
Detection
software generates a Standard Curve of CT vs. (LogN) Starting Copy Number for
all
standards and then determines the starting copy number of unknowns by
interpolation.
EXAMPLE 10: Determination of TaqManT"" Assay Specificity to Pathogen in
Infected
Wheat
Wheat samples are identified as Tapesia acuformis and/or Tapesia yallundae
infected
based on analysis using the assays described in Example 3. Wheat samples are
also
tested using the primer combinations listed in Table 6 and the PCR conditions
in Example
8. Using Sequence Detection Systems software (Perkin Elmer-Applied
Biosciences), the
amplification of pathogen DNA from the wheat samples is quantified against a
standard
curve of the fungal target's genomic DNA (Table 9). Results for the Tapesia
acuformis
specific assay are presented in Table 10. DNA from Tapesia acuformis is
detected and
quantified in all infected samples. Results for the Tapesia yallundae specific
assay are
presented in Table 11. DNA from Tapesia yallundae is detected and quantified
in all
infected samples. No cross-reactivity is observed in uninfected wheat tissue
for either
assay.
Table 9: Standard Curve of Tapesia acuformis and T, yallundae Genomic DNAs Run
in
Duplicate Against the R-type and W-type Assays, Respectively
R-type Assay W-type Assay
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-25-
Tapesia acuformis CT Value Tapesia yallundae CT Value
#308 #42040
DNA DNA
ng 18.57 5 ng 18.13
18.38 17.92
500 pg 21.3 500 pg 21.83
21.35 22.02
50 pg 23.57 50 pg 25.26
24.27 25.37
5 pg 27.82 5 pg 29.53
27.89 29.88
500 fg 31.47 500 fg 33.32
31.17 35
50 fg 34.13 No Template Control35
34.01 35
No Template Control35
35
Table 10: Results of the Tapesia acuformis TaqManT"" Assay on Wheat
Extractions.
Samples Are Run in Duplicate and are Documented with Results of Conventional
PCR
Assays
TaqMan
Results
ample for CR Testing
Tapesia Results
Number acuformis (0 to +5
assay scale)
CT Template T, acuformis
Standard T. yallundae
Mean
Value
(pg)
Deviation
(pg)
H 35 0 0 0
35 0 0 0
6 35 2.50E-020 0.02
35 2.50E-020 0.02
57 31.07 4.60E-010.03 0.44 +
31.20 4.20E-010.03 0.44
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-26-
47 31.13 4.40E-010.14 0.54 +
30.62 6.40E-010.14 0.54
84 33.68 7.00E-020.01 0.06 +
33.96 5.70E-020.01 0.06
23 29.42 1.50E+000.28 1.71 ++
29.10 1.90E+000.28 1.71
46 28.67 2.60E+000.44 2.90 ++
28.37 3.20E+000.44 2.90
73 30.54 6.70E-010.06 0.72 ++
30.37 7.60E-010.06 0.72
21 27.34 6.80E+002.28 5.15 +++
28.24 3.50E+002.28 5.15
38 30.04 9.70E-010.71 1.47 +++
29.05 2.00E+000.71 1.47
43 26.12 1.60E+010.97 16.94 +++
26.01 1.80E+010.97 16.94
41 24.07 7.20E+0119.75 57.57 ++++
24.75 4.40E+0119.75 57.57
72 28.01 4.20E+000.29 3.96 ++++
28.16 3.80E+000.29 3.96
74 26.01 1.80E+013.03 19.75 ++++
25.71 2.20E+013.03 19.75
26.72 1.10E+011.50 9.51 +++++
27.03 8.50E+001.50 9.51
82 26.74 1.00E+011.29 9.51 +++++
27.01 8.60E+001.29 9.51
93 26.05 1.70E+012.12 18.68 +++++ +
25.82 2.00E+012.12 18.68
96 24.07 7.10E+013.75 68.50 +++++ ++
24.18 6.60E+013.75 68.50
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-27-
Table 11: Results of the Tapesia yallundae TaqManTM Assay on Wheat
Extractions.
Samples Are Run in Duplicate and are Documented with Results of Conventional
PCR
Assays
TaqMan'""
Results
ample for CR Testing
Tapesia Results
Number acuformis (0 to +5
assay scale)
CT Template T. acuformis
Standard T. yallundae
Mean
Value
(pg)
Deviation
(pg)
H 35 0 0 0
35 0 0 0
6 35 0 0 0
35 0 0 0
82 33.41 4.5E-01 0.07 0.40 +++++
33.78 3.6E-01
94 33.29 5.2 E-010.21 0.37 + +
34.68 2.2E-01
108 34.41 2.6E-01 0 0.26 +++ +
34.40 2.7E-01
111 33.21 5.4 E-010.02 0.53 ++ +
33.28 5.2E-01
33 24.67 9.1 E+0137.45 64.30 ++ ++
26.13 3.8 E+01
54 28.09 1.2E+01 6.31 16.10 +++ ++
27.14 2.1 E+01
80 26.43 3.1 E+013.62 34.03 ++++ ++
26.18 3.7E+01
95 29.98 3.8E+00 0.08 3.7 ++
30.03 3.6 E+00
100 27.16 2.0E+01 1.40 21.32 +++ +++
27.01 2.2E+01
8 25.63 5.1 E+019.96 57.91 + +++
25.22 6.5E+01
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-28-
22.36 3.6E+02 79.1 418.46 ++ +++
21.91 4.7E+02
16 23.77 1.6 E+026.18 150.78 ++ ++++
23.87 1.5E+02
56 25.14 6.8E+01 2.26 66.56 ++++ ++++
25.22 6.5 E+01
88 24.48 1.0E+02 21.89 85.90 ++ ++++
25.09 7.0E+01
89 23.87 1.5 E+0216.48 157.85 ++++ +++++
23.63 1.7E+02
EXAMPLE 11: An Endogenous Control To Be Used With The Fungal Pathogen
TaqManT"' Assays
All wheat extractions contain the host wheat DNA as well as any fungal
pathogen DNA
present. Thus, an endogenous control assay targeting the wheat DNA is run on
extracts to
account for any differences among sample extractions. These assays provide a
control
against false negatives. That is, a negative result for fungal DNA that could
be attributed to
inhibition of the PCR reaction is verified by this endogenous control assay.
These assays
also provide a target against which the fungal DNA quantity is normalized for
sample to
sample comparison.
EXAMPLE 12: Selection Of Endogenous Control Primers And Probes
Primers and probes for the amplification and detection of wheat chloroplast
DNA are drawn
to the coding sequence of the cytochrome b-599 gene (SEQ ID N0:41 ). Selection
of primer
and probe sequences is performed using the ABI Primer Express program (PE
Applied
Biosystems, Foster City, CA, USA) according to manufacturer's instructions.
This program
selects TaqManT"" primer and probe sets optimized by melting temperature,
secondary
structure, base composition, and amplicon length. From the sets chosen by the
software, a
best set is selected by manually finding primers with the fewest number of
thermodynamically stable bases at the 3' end. The primer/probe set chosen for
the
amplification of wheat DNA as an endogenous control is documented in Table 12.
These
are synthesized as in Example 4.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-29-
Table 12: Primer And Probe Combinations For An Endogenous Control Reaction
Targeting
Wheat (Triticum aesfivum) Chloroplast DNA
Oligo Sequence Primer Oligo Sequence
Identifier Name (5'->3')
Forward SEQ ID N0:42WCP2 cagtgcgatggctggctatt
Primer
Reverse SEQ ID N0:43WCP3 cgttggatgaactgcattgct
Primer
TaqMan"" SEQ ID N0:44WCP1 (VIC)-acggactagctgtacctactgtttttttcttgggatc-
Probe (TAMRA)
EXAMPLE 13: Use Of A TaqManT"" Assay To Gluantify Wheat DNA In Wheat
Extractions
Extractions of wheat tissue are made as in Example 2. The assay presented in
Example 11
is run against these tissues as follows: Reactions are prepared in thin-walled
optical grade
PCR tubes (PE Applied Biosystems, Foster City, CA, USA). Reaction mixtures are
made by
bringing forward and reverse primer concentrations to 900 nM and probe
concentration to
250 nM in a 1X solution of TaqMan Universal Master Mix (PE Applied Biosystems,
Foster
City, CA, USA). One microliter of 1:20 diluted wheat extract is added.
Additionally, cross-
reactivity with fungal DNA is tested by adding 1 p.L of 5 ng/pL fungal DNA
preparation. The
reactions are carried out in a ABI 7700 instrument (PE Applied Biosystems,
Foster City, CA,
USA), thermal cycling: 50°C for 2 min., 95°C for 10 min., 40
cycles of 95°C for 15 s, 60°C
for 60 s). The ABI 7700 software determines the CT value at which the
fluoresence of each
reaction reaches a threshold value of 0.4. This data is presented in Table 13.
The CT
values presented correspond inversely with the amount of wheat target DNA
present in
each sample. Samples in which a CT of 40 are reported show no amplification.
Table 13
shows that the endogenous control assay detects the cytochrome b-559 gene in
multiple
varieties of wheat. The TaqManT"" assay for wheat chloroplast DNA also shows
that
different amounts of host DNA are present in each sample. By using dilutions
of target
DNA, a standard curve can be generated as described in Example 10 against
which the
wheat DNA can be quantified.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-30-
Table 13: CT Values Reported For A TaqManT"" Assay Targeting Wheat Chloroplast
DNA
In Wheat And Fungal DNA Extractions
Sample Wheat CT
Number Variety Value
6 Madsen 17.17
57 Madsen 19.48
73 Lambert 20.71
21 Brundage18.9
41 Eltan 20.23
13 Mixed 19.99
Madsen 19.19
5 ng 40
Tapesia acuformis
DNA #308
NTC 40
Example 14: Multiplexing Of TaqManT"" Assays For Fungal Pathogens And Control
Assay For Host DNA
The reaction presented in Example 13 is multiplexed with reactions for
quantification of
fungal DNA such that both tests take place in the same reaction tube. The
probe and
primers for Tapesia acuformis documented in Table 6 at their optimized
concentrations are
added to the reactions described in Example 13. These reactions are run as
described on
infected wheat tissue. The data presented here show that TaqManT"" fungal
pathogen
assays may be run in the same reaction tube as an endogenous control reaction
for the
wheat tissue.
Table 14: CT Values Reported For A TaqManT"" Assay Targeting Wheat Chloroplast
DNA
In Wheat DNA Extractions
Sample Wheat R-type Assay PCR Testing
Results
assay
Number CT ValueCT Value Calculated(0 to +5 scale)
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-31 -
Concentration T. T.
(pg) acuformis
yallundae
6 17.09 40 0
41 27.70 20.65 24.3 ++++
13 30.9 19.99 3.69 +++++ +
While the present invention has been described with reference to specific
embodiments
thereof, it will be appreciated that numerous variations, modifications, and
further
embodiments are possible, and accordingly, all such variations, modifications
and
embodiments are to be regarded as being within the scope of the present
invention.
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-1 -
SEQUENCE LISTING
<110> Novartis AG
<120> PCR-BASED DETECTION AND QUANTIFICATION OF TAPESIA
YALLUNDAE AND TAPESIA ACUFORMIS
<130> PB/5-31084A
<140>
<141>
<150> US 09/371,749
<151> 1999-08-10
<150> US 60/168,326
<151> 1999-12-O1
<160> 44
<170> PatentIn Ver. 2.1
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:ITSl
<400> 1
tccgtaggtg aacctgcgg 19
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:ITS2
<400> 2
tcctccgctt attgatatgc 20
<210> 3
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J103W
<400> 3
ggctacccta cttggtag 18
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-2-
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J104W
<400> 4
cctgggggct accctacttg 20
<210> 5
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J105W
<400> 5
gggggctacc ctacttggta g 21
<210> 6
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J106W
<400> 6
tgggggctac cctacttggt ag 22
<210> 7
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J107W
<400> 7
tttagagtcg tcaggcctct cggagaagc 29
<210> 8
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J108W
<400> 8
atttattcaa gggtggaggt cctga 25
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-3-
<210> 9
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J109W
<400> 9
aagggtggag gtctgaacca g 21
<210> 10
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J110W
<400> 10
aagggtggag gtctgaacca 20
<210> 11
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J111W
<400> 11
caagggtgga ggtctgaacc 20
<210> 12
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J112R
<400> 12
tcaagggtgg aggtctgaac c 21
<210> 13
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J100R
<400> 13
gggccaccct acttcggtaa 20
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-4-
<210> 14
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J101R
<400> 14
gaaatcctgg gggccaccct acttc 25
<210> 15
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J102R
<400> 15
cctgggggcc accctact 18
<210> 16
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J113R
<400> 16
gccaccctac ttcggtaagg tt 22
<210> 17
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J114R
<400> 17
caccctactt cggtaaggtt tagagtc 27
<210> 18
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J115R
<400> 18
aggtaattta ttcaagggtg gaggt 25
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-5-
<210> 19
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J116R
<400> 19
aggtaattta ttcaagggtg gaggtc 26
<210> 20
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J117R
<400> 20
aaggtaattt attcaagggt ggaggt 26
<210> 21
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J118R
<400> 21
ttattcaagg gtggaggtct gg 22
<210> 22
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J119r
<400> 22
tattcaaggg tggaggtctg ga 22
<210> 23
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J120R
<400> 23
cctgccaaag caacaaaggt a 21
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-6-
<210> 24
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J121R
<400> 24
cgggcctctc ggagaagcct gg 22
<210> 25
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J122R
<400> 25
cctacttcgg taaggtttag agtcgt 26
<210> 26
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J123R
<400> 26
tctccgagag gcccgac 17
<210> 27
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J124R
<400> 27
aagcctggtc cagacctcca ccc 23
<210> 28
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J125R
<400> 28
aaggatcatt aatagagcaa tggatagac 29
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
_7_
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J126R
<400> 29
cgccccggga gaaatcctgg 20
<210> 30
<211> 18
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:J127R
<400> 30
tgggggccac cctacttc 18
<210> 31
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:JB537
<400> 31
gggggctacc ctacttggta g 21
<210> 32
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:JB541
<400> 32
ccactgattt tagaggccgc gag 23
<210> 33
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:JB540
<400> 33
gggggccacc ctacttcggt as 22
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
_g_
<210> 34
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence:JB542
<400> 34
ccactgattt tagaggccgc gaa 23
<210> 35
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: forward
sequencing primer
<400> 35
gtaaaacgac ggccagt 17
<210> 36
<211> 17
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: reverse
sequencing primer
<400> 36
caggaaacag ctatgac 17
<210> 37
<211> 627
<212> DNA
<213> Tapesia acuformis
<400> 37
tccgtaggtg aacctgcgga aggatcatta atagagcaat ggatagacag cgccccggga 60
gaaatcctgg gggccaccct acttcggtaa ggtttagagt cgtcgggcct ctcggagaag 120
cctggtccag acctccaccc ttgaataaat tacctttgtt gctttggcag ggcgcctcgc 180
gccagcggct tcggctgttg agtacctgcc agaggaccac aactcttgtt tttagtgatg 240
tctgagtact atataatagt taaaactttc aacaacggat ctcttggttc tggcatcgat 300
gaagaacgca gcgaaatgcg ataagtaatg tgaattgcag aattcagtga atcatcgaat 360
ctttgaacgc acattgcgcc ctctggtatt ccggggggca tgcctgttcg agcgtcatta 420
taaccactca agctctcgct tggtattggg gttcgcgtct tcgcggcctc taaaatcagt 480
ggcggtgcct gtcggctcta cgcgtagtaa tactcctcgc gattgagtcc ggtaggttta 540
cttgccagca acccccaatt ttttacaggt tgacctcgga tcaggtaggg atacccgctg 600
aacttaagca tatcaataag cggagga 627
<210> 38
<211> 626
<212> DNA
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-9-
<213> Tapesia yallundae
<400> 38
tccgtaggtg aacctgcgga aggatcatta atagagcaat gaacagacag cgccccggga 60
gaaatcctgg gggctaccct acttggtagg gtttagagtc gtcaggccgc tcggagaagc 120
ctggttcaga cctccaccct tgaataaatt acctttgttg ctttggcagg gcgcctcgcg 180
ccagcggctt cggctgttga gtacctgcca gaggaccaca actcttgttt ttagtgatgt 240
ctgagtacta tataatagtt aaaactttca acaacggatc tcttggttct ggcatcgatg 300
aagaacgcag cgaaatgcga taagtaatgt gaattgcaga attcagtgaa tcatcgaatc 360
tttgaacgca cattgcgccc tctggtattc cggggggcat gcctgttcga gcgtcattat 420
aaccactcaa gctctcgctt ggtattgggg ttcgcgtcct cgcggcctct aaaatcagtg 480
gcggtgcctg tcggctctac gcgtagtaat actcctcgcg attgagtccg gtaggtttac 540
ttgccagtaa cccccaattt tttacaggtt gacctcggat caggtaggga tacccgctga 600
acttaagcat atcaataagc ggagga 626
<210> 39
<211> 415
<212> DNA
<213> Tapesia acuformis
<400> 39
gggggccacc ctacttcggt aaggtttaga gtcgtcgggc ctctcggaga agcctggtcc 60
agacctccac ccttgaataa attacctttg ttgctttggc agggcgcctc gcgccagcgg 120
cttcggctgt tgagtacctg ccagaggacc acaactcttg tttttagtga tgtctgagta 180
ctatataata gttaaaactt tcaacaacgg atctcttggt tctggcatcg atgaagaacg 240
cagcgaaatg cgataagtaa tgtgaattgc agaattcagt gaatcatcga atctttgaac 300
gcacattgcg ccctctggta ttccgggggg catgcctgtt cgagcgtcat tataaccact 360
caagctctcg cttggtattg gggttcgcgt cttcgcgggc ctctaaaatc agtgg 415
<210> 40
<211> 415
<212> DNA
<213> Tapesia yallundae
<400> 40
gggggctacc cctacttggt agggtttaga gtcgtcaggc ctctcggaga agcctggttc 60
agacctccca cccttgaata aattaccttt gttgctttgg cagggcgcct cgcgccagcg 120
gcttcggctg ttgagtacct gccagaggac cacaactctt gtttttagtg atgtctgagt 180
actatataat agttaaaact ttcaacaacg gatctcttgg ttctggcatc gatgaagaac 240
gcagcgaaat gcgataagta atgtgaattg cagaattcag tgaatcatcg aatctttgaa 300
cgcacattgc gccctctggt attccggggg gcatgcctgt tcgagcgtca ttataaccac 360
tcaagctctc gcttggtatt ggggttcgcg tcctcgcggc ctctaaaatc agtgg 415
<210> 41
<211> 554
<212> DNA
<213> Triticum aestivum
<220>
<221> misc_feature
<222> (104)..(355)
<223> cytochrome b-559 coding sequence
<400> 41
tctcacaagg aatgaaatat cagtaatttt ctatttactg gtcgatccca tcttttacgg 60
aatcaattcc tttttgaatg tacaaaaatt ttgggagttc agcatgtctg gaagcacggg 120
agaacgttct tttgctgata ttattaccag tattcgatac tgggttattc atagcattac 180
tataccttcc ctattcattg cgggttggtt atttgtcagt acgggtttag cttatgacgt 240
CA 02381204 2002-02-05
WO 01/11075 PCT/EP00/07708
-10-
gtttggaagt cctaggccaa acgagtattt cacggaaagc cgacaaggaa ttccgttaat 300
aaccgaccgt tttgattctt tagaacaact cgatgaattt agtagatcct tttaggaggc 360
cctcaatgac catagatcga acctatccta tttttacagt gcgatggctg gctattcacg 420
gactagctgt acctactgtt tttttcttgg gatcaatatc agcaatgcag ttcatccaac 480
gataaaccaa attccaacta tagaactatg acacaatcaa acccgaatga acaaaatgtt 540
gaattgaatc gtag 554
<210> 42
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: WCP2
<400> 42
cagtgcgatg gctggctatt 20
<210> 43
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: WCP3
<400> 43
cgttggatga actgcattgc t 21
<210> 44
<211> 37
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: WCP1
<400> 44
acggactagc tgtacctact gtttttttct tgggatc 37
