Note: Descriptions are shown in the official language in which they were submitted.
WO 01/12665 CA 02381794 2002-02-11 pCT~S00/22714
Description
HELICAL CYTOKINE ZALPHA48
BACKGROUND OF THE INVENTION
Cytokines are polypeptide hormones that are produced by a cell and
affect the growth or metabolism of that cell or another cell. In multicellular
animals,
cytokines control cell growth, migration, differentiation, and maturation.
Cytokines
play a role in both normal development and pathogenesis, including the
development of
solid tumors.
Cytokines are physicochemically diverse, ranging in size from 5 kDa
(TGF-a) to 140 kDa (Mullerian-inhibiting substance). They include single
polypeptide
chains, as well as disulfide-linked homodimers and heterodimers.
Cytokines influence cellular events by binding to cell-surface receptors.
Binding initiates a chain of signalling events within the cell, which
ultimately results in
phenotypic changes such as cell division, protease production, cell migration,
expression of cell surface proteins, and production of additional growth
factors.
2 0 Cell differentiation and maturation are also under control of cytokines.
For example, the hematopoietic factors erythropoietin, thrombopoietin, and G-
CSF
stimulate the production of erythrocytes, platelets, and neutrophils,
respectively, from
precursor cells in the bone marrow. Development of mature cells from
pluripotent
progenitors may require the presence of a plurality of factors.
2 5 The role of cytokines in controlling cellular processes makes them likely
candidates and targets for therapeutic intervention; indeed, a number of
cytokines have
been approved for clinical use. Interferon-alpha (IFN-a), for example, is used
in the
treatment of hairy cell leukemia, chronic myeloid leukemia, Kaposi's sarcoma,
condylomata acuminata, chronic hepatitis C, and chronic hepatitis B (Aggarwal
and
3 0 Puri, "Common and Uncommon Features of Cytokines and Cytokine Receptors:
An
Overview", in Aggarwal and Puri, eds., Human Cytokines: Their Role in Disease
and
Therapy, Blackwell Science, Cambridge, MA, 1995, 3-24). Platelet-derived
growth
factor (PDGF) has been approved in the United States and other countries for
the
WO 01/12665 CA 02381794 2002-02-11 pCT/US00/22714
2
treatment of dermal ulcers in diabetic patients. The hematopoietic cytokine
erythropoietin has been developed for the treatment of anemias (e.g., EP
613,683). G-
CSF, GM-CSF, IFN-(3, IFN-y, and IL-2 have also been approved for use in humans
(Aggarwal and Puri, ibid.). Experimental evidence supports additional
therapeutic uses
of cytokines and their inhibitors. Inhibition of PDGF receptor activity has
been shown
to reduce intimal hyperplasia in injured baboon arteries (Giese et al.,
Restenosis Summit
VIII, Poster Session #23, 1996; U.S. Patent No. 5,620,687). Vascular
endothelial
growth factors (VEGFs) have been shown to promote the growth of blood vessels
in
ischemic limbs (Isner et al., The Lancet 348:370-374, 1996), and have been
proposed
for use as wound-healing agents, for treatment of periodontal disease, for
promoting
endothelialization in vascular graft surgery, and for promoting collateral
circulation
following myocardial infarction (WIPO Publication No. WO 95/24473; U.S. Patent
No.
5,219,739). A soluble VEGF receptor (soluble flt-1) has been found to block
binding of
VEGF to cell-surface receptors and to inhibit the growth of vascular tissue in
vitro
(Biotechnology News 16(17):5-6, 1996). Experimental evidence suggests that
inhibition
of angiogenesis may be used to block tumor development (Biotechnology News,
Nov.
13, 1997) and that angiogenesis is an early indicator of cervical cancer (Br.
J. Cancer
76:1410-1415, 1997). More recently, thrombopoietin has been shown to stimulate
the
production of platelets in vivo (Kaushansky et al., Nature 369:568-571, 1994)
and has
2 0 been the subject of several clinical trials (reviewed by von dem Borne et
al., Bailliere's
Clin. Haematol. 11:427-445, 1998).
In view of the proven clinical utility of cytokines, there is a need in the
art for additional such molecules for use as both therapeutic agents and
research tools
and reagents. Cytokines are used in the laboratory to study developmental
processes,
2 5 and in laboratory and industry settings as components of cell culture
media.
SUMMARY OF THE INVENTION
The present invention provides novel polypeptides, polynucleotides
encoding them, and methods of making them, as well as compositions and methods
for
3 0 modulating the proliferation, differentiation, migration, and metabolism
of responsive
cell types and for regulating tissue development.
WO 01/12665 CA 02381794 2002-02-11 PCT/US00/22714
3
Within one aspect of the invention there is provided an isolated
polypeptide comprising at least nine contiguous amino acid residues of SEQ 1D
N0:2.
Within one embodiment, the isolated polypeptide of claim 1 consists of from 15
to 1500
amino acid residues. Within another embodiment, the at least nine contiguous
amino
acid residues of SEQ m N0:2 are operably linked via a peptide bond or
polypeptide
linker to a second polypeptide selected from the group consisting of maltose
binding
protein, an immunoglobulin constant region, a polyhistidine tag, and a peptide
as shown
in SEQ >D NO:S. Within another embodiment, the isolated polypeptide comprises
at
least 30 contiguous residues of SEQ >D N0:2. Exemplary polypeptides of the
invention
include, without limitation, those comprising residues 34-48 of SEQ )D N0:2,
residues
49-69 of SEQ >D N0:2, residues 70-84 of SEQ )D N0:2, residues 87-101 of SEQ >D
N0:2, residues 102-126 of SEQ >D N0:2, residues 127-141 of SEQ )D N0:2,
residues
20-53 of SEQ )D N0:2, residues 49-57 of SEQ 1D N0:2, residues 34-147 of SEQ )D
N0:3, residues 34-147 of SEQ m N0:2, residues 34-151 of SEQ >D N0:3, residues
34-
151 of SEQ >D N0:2, residues 21-151 of SEQ >D N0:3, and residues 21-151 of SEQ
1D
N0:2.
Within a second aspect of the invention there is provided an expression
vector comprising the following operably linked elements: a transcription
promoter; a
DNA segment encoding a polypeptide as disclosed above; and a transcription
2 o terminator. Within one embodiment, the DNA segment comprises nucleotides
61 to
453 of SEQ >D N0:4. Within another embodiment, the expression vector further
comprises a secretory signal sequence operably linked to the DNA segment. An
exemplary secretory signal sequence encodes residues 1-20 of SEQ ID N0:2.
Within a third aspect of the invention there is provided a cultured cell
2 5 into which has been introduced an expression vector as disclosed above,
wherein the
cell expresses the DNA segment. Within one embodiment, the expression vector
comprises a secretory signal sequence operably linked to the DNA segment, and
the
polypeptide is secreted by the cell. The cultured cell of the invention can be
used within
a method of making a protein, wherein the cell is cultured under conditions
whereby the
3 0 DNA segment is expressed and the polypeptide is produced, and the produced
polypeptide is recovered. Within one embodiment, the expression vector
comprises a
WO 01/12665 CA 02381794 2002-02-11 pCT~S00/22714
4
secretory signal sequence operably linked to the DNA segment, the polypeptide
is
secreted by the cell, and the polypeptide is recovered from a medium in which
the cell is
cultured.
Within a fourth aspect of the invention there is provided a polypeptide
produced by the method disclosed above.
With a fifth aspect of the invention there is provided an antibody that
specifically binds to a polypeptide as disclosed above.
Within a sixth aspect of the invention there is provided a method of
detecting, in a test sample, the presence of an antagonist of zalpha48
activity,
comprising the steps of culturing a cell that is responsive to zalpha48,
exposing the cell
to a zalpha48 polypeptide in the presence and absence of a test sample,
comparing
levels of response to the zalpha48 polypeptide, in the presence and absence of
the test
sample, by a biological or biochemical assay, and determining from the
comparison the
presence of an antagonist of zalpha48 activity in the test sample.
These and other aspects of the invention will become evident upon
reference to the following detailed description of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
The figure is a Hopp/Woods hydrophilicity profile of the amino acid
2 0 sequence shown in SEQ ID N0:2. The profile is based on a sliding six-
residue
window. Buried G, S, and T residues and exposed H, Y, and W residues were
ignored.
These residues are indicated in the figure by lower case letters.
DETAILED DESCRIPTION OF THE INVENTION
2 5 Prior to setting forth the invention in detail, it may be helpful to the
understanding thereof to define the following terms:
The term "affinity tag" is used herein to denote a polypeptide segment
that can be attached to a second polypeptide to provide for purification of
the second
polypeptide or provide sites for attachment of the second polypeptide to a
substrate. In
3 0 principal, any peptide or protein for which an antibody or other specific
binding agent is
available can be used as an affinity tag. Affinity tags include a poly-
histidine tract,
WO 01/12665 CA 02381794 2002-02-11 pCT/US00/22714
protein A (Nilsson et al., EMBO J. 4:1075, 1985; Nilsson et al., Methods
EnZymol.
198:3, 1991), glutathione S transferase (Smith and Johnson, Gene 67:31, 1988),
Glu-
Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acad. Sci. USA 82:7952-4,
1985)
(SEQ >D NO:S), substance P, FIagTM peptide (Hopp et al., Biotechnology 6:1204-
1210,
5 1988), streptavidin binding peptide, maltose binding protein (Guan et al.,
Gene 67:21-
30, 1987), cellulose binding protein, thioredoxin, ubiquitin, T7 polymerase,
or other
antigenic epitope or binding domain. See, in general, Ford et al., Protein
Expression
and Purification 2: 95-107, 1991. DNAs encoding affinity tags and other
reagents are
available from commercial suppliers (e.g., Pharmacia Biotech, Piscataway, NJ;
New
England Biolabs, Beverly, MA; Eastman Kodak, New Haven, CT).
The term "allelic variant" is used herein to denote any of two or more
alternative forms of a gene occupying the same chromosomal locus. Allelic
variation
arises naturally through mutation, and may result in phenotypic polymorphism
within
populations. Gene mutations can be silent (no change in the encoded
polypeptide) or
may encode polypeptides having altered amino acid sequence. The term allelic
variant
is also used herein to denote a protein encoded by an allelic variant of a
gene.
The terms "amino-terminal" and "carboxyl-terminal" are used herein to
denote positions within polypeptides. Where the context allows, these terms
are used
with reference to a particular sequence or portion of a polypeptide to denote
proximity
2 0 or relative position. For example, a certain sequence positioned carboxyl-
terminal to a
reference sequence within a polypeptide is located proximal to the carboxyl
terminus of
the reference sequence, but is not necessarily at the carboxyl terminus of the
complete
polypeptide.
A "complement" of a polynucleotide molecule is a polynucleotide
2 5 molecule having a complementary base sequence and reverse orientation as
compared to
a reference sequence. For example, the sequence 5' ATGCACGGG 3' is
complementary to 5' CCCGTGCAT 3'.
The term "conservative amino acid substitution" refers to a substitution
represented by a value of greater than -1 as determined from the BLOSUM62
matrix of
30 Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-10919, 1992
(Table 1).
The BLOSUM62 matrix is an amino acid substitution matrix derived from about
2,000
WO 01/12665 CA 02381794 2002-02-11 pCT/US00/22714
6
local multiple alignments of protein sequence segments, representing highly
conserved
regions of more than 500 groups of related proteins. An amino acid
substitution is
conservative if the substitution is characterized by a BLOSUM62 value of 0, l,
2, or 3.
Preferred conservative amino acid substitutions are characterized by a
BLOSUM62
value of at least 1 (e.g., 1, 2 or 3), while more preferred conservative amino
acid
substitutions are characterized by a BLOSUM62 value of at least 2 (e.g., 2 or
3).
WO 01/12665 CA 02381794 2002-02-11 PCT/US00/22714
7
r3 .~N M
E--~ N ~?N O
M N N
p." ~ ~ ~ ~ M N
~3,, \p<t N N ,~M .-.
i i i i ~
~ M ~ O ~ M N N
d' N N O M N ; N ~ .-.
N M .~ O M N ~' M ~ M
i n i n i i
cG
pp M M .~N ~ N -~N N N M
i i i ~ i i ~ i i i
urN ~ d~ N M M N O N N M M
w V; N O M M ,_,N M ~ " ~ M N N
V7N N O M N .~O M -, O i N i N
M ~ M M ~ ~ M ~ N M ~ ~ N N
VrM O N i i M ~ i M M ~ O i ~'M M
M O O O ,.,M M O N M N .-,O V'N M
~/ V; O N M ,~" N O M N N ~ M N ~ ~ M N M
Q ~ i N N O i ~ O N i . i i N . " O M N O
z a v a w ~ ~ ~ w ~ ~ w a, ~ H 3 ~ >
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
8
The term "corresponding to", when applied to positions of amino acid
residues in sequences, means corresponding positions in a plurality of
sequences when
the sequences are optimally aligned.
The term "degenerate nucleotide sequence" denotes a sequence of
nucleotides that includes one or more degenerate codons (as compared to a
reference
polynucleotide molecule that encodes a polypeptide). Degenerate codons contain
different triplets of nucleotides, but encode the same amino acid residue
(i.e., GAU and
GAC triplets each encode Asp).
The term "expression vector" is used to denote a DNA molecule, linear
or circular, that comprises a segment encoding a polypeptide of interest
operably linked
to additional segments that provide for its transcription. Such additional
segments
include promoter and terminator sequences, and may also include one or more
origins of
replication, one or more selectable markers, an enhancer, a polyadenylation
signal, etc.
Expression vectors are generally derived from plasmid or viral DNA, or may
contain
elements of both.
The term "isolated", when applied to a polynucleotide, denotes that the
polynucleotide has been removed from its natural genetic milieu and is thus
free of
other extraneous or unwanted coding sequences, and is in a form suitable for
use within
genetically engineered protein production systems. Such isolated molecules are
those
2 0 that are separated from their natural environment and include eDNA and
genomic
clones. Isolated DNA molecules of the present invention are free of other
genes with
which they are ordinarily associated, but may include naturally occurring 5'
and 3'
untranslated regions such as promoters and terminators. The identification of
associated
regions will be evident to one of ordinary skill in the art (see for example,
Dynan and
Tijan, Nature 316:774-78, 1985).
An "isolated" polypeptide or protein is a polypeptide or protein that is
found in a condition other than its native environment, such as apart from
blood and
animal tissue. The isolated polypeptide or protein can be prepared
substantially free of
other polypeptides or proteins, particularly those of animal origin. For
certain
3 0 applications it is preferred to provide polypeptides and proteins in a
highly purified
form, i.e. greater than 95% pure or greater than 99% pure. When used in this
context,
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
9
the term "isolated" does not exclude the presence of the same polypeptide or
protein in
alternative physical forms, such as dimers or alternatively glycosylated or
derivatized
forms.
"Operably linked" means that two or more entities are joined together
such that they function in concert for their intended purposes. When referring
to DNA
segments, the phrase indicates, for example, that coding sequences are joined
in the
correct reading frame, and transcription initiates in the promoter and
proceeds through
the coding segments) to the terminator. When referring to polypeptides,
"operably
linked" includes both covalently (e.g., by disulfide bonding) and non-
covalently (e.g.,
by hydrogen bonding, hydrophobic interactions, or salt-bridge interactions)
linked
sequences, wherein the desired functions) of the sequences are retained.
The term "ortholog" denotes a polypeptide or protein obtained from one
species that is the functional counterpart of a polypeptide or protein from a
different
species. Sequence differences among orthologs are the result of speciation.
A "polynucleotide" is a single- or double-stranded polymer of
deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end.
Polynucleotides include RNA and DNA, and may be isolated from natural sources,
synthesized in vitro, or prepared from a combination of natural and synthetic
molecules.
Sizes of polynucleotides are expressed as base pairs (abbreviated "bp"),
nucleotides
2 0 ("nt"), or kilobases ("kb"). Where the context allows, the latter two
terms may describe
polynucleotides that are single-stranded or double-stranded. When the term is
applied
to double-stranded molecules it is used to denote overall length and will be
understood
to be equivalent to the term "base pairs". It will be recognized by those
skilled in the art
that the two strands of a double-stranded polynucleotide may differ slightly
in length
2 5 and that the ends thereof may be staggered as a result of enzymatic
cleavage; thus all
nucleotides within a double-stranded polynucleotide molecule may not be
paired. Such
unpaired ends will in general not exceed 20 nt in length.
A "polypeptide" is a polymer of amino acid residues joined by peptide
bonds, whether produced naturally or synthetically. Polypeptides of less than
about 10
3 0 amino acid residues are commonly referred to as "peptides".
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
The term "promoter" is used herein for its art-recognized meaning to
denote a portion of a gene containing DNA sequences that provide for the
binding of
RNA polymerase and initiation of transcription. Promoter sequences are
commonly,
but not always, found in the 5' non-coding regions of genes.
5 A "protein" is a macromolecule comprising one or more polypeptide
chains. A protein may also comprise non-peptidic components, such as
carbohydrate
groups. Carbohydrates and other non-peptidic substituents may be added to a
protein by
the cell in which the protein is produced, and will vary with the type of
cell. Proteins
are defined herein in terms of their amino acid backbone structures;
substituents such as
10 carbohydrate groups are generally not specified, but may be present
nonetheless. thus, a
protein ''consisting op', for example, from 1 ~ to 1500 amino acid residues
may further
contain one or more carbohydrate chains.
A "secretory signal sequence" is a DNA sequence that encodes a
polypeptide (a "secretory peptide") that, as a component of a larger
polypeptide, directs
the larger polypeptide through a secretory pathway of a cell in which it is
synthesized.
The larger polypeptide is commonly cleaved to remove the secretory peptide
during
transit through the secretory pathway.
A "segment" is a portion of a larger molecule (e.g., polynucleotide or
polypeptide) having specified attributes. For example, a DNA segment encoding
a
2 0 specified polypeptide is a portion of a longer DNA molecule, such as a
plasmid or
plasmid fragment, that, when read from the 5' to the 3' direction, encodes the
sequence
of amino acids of the specified polypeptide.
Molecular weights and lengths of polymers determined by imprecise
analytical methods (e.g., gel electrophoresis) will be understood to be
approximate
2 5 values. When such a value is expressed as "about" X or "approximately" X,
the stated
value of X will be understood to be accurate to ~10%.
The present invention provides novel cytokine polypeptides and proteins.
This novel cytokine, termed "zalpha48", was identified by the presence of
polypeptide
and polynucleotide features characteristic of four-helix-bundle cytokines
(e.g.,
3 0 erythropoietin, thrombopoietin, G-CSF, IL-2, IL-4, leptin, and growth
hormone).
Analysis of the amino acid sequence shown in SEQ m N0:2 indicates the presence
of
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
11
four amphipathic, alpha-helical regions. These regions include at least amino
acid
residues 34 through 48 (helix A), 70 through 84 (helix B), 87 through 101
(helix C), and
127 through 141 (helix D). Within these helical regions, residues that are
expected to
lie within the core of the four-helix bundle occur at positions 34, 37, 38,
41. 44, 45, 48,
70, 73, 74, 77, 80, 81, 84, 87, 90, 91, 94, 97, 98, 101, 127, 130, 131, 134,
137, 138, and
141 of SEQ >D N0:2. Residues 35, 36, 39, 40, 42, 43, 46, 47, 71, 72, 75, 76,
78, 79, 82,
83, 88, 89, 92, 93, 95, 96, 99, 100, 128, 129, 132, 133, 135, 136, 139, and
140 are
expected to lie on the exposed surface of the bundle. Inter-helix loops
comprise
approximately residues 49 through 69 (loop A-B) and 102 through 126 (loop C-
D). The
human zalpha48 cDNA (SEQ )D NO: I ) encodes a polypeptide of 151 amino acid
residues. While not wishing to be bound by theory, this sequence is predicted
to include
a secretory peptide of 20 residues. Cleavage after residue 20 will result in a
mature
polypeptide (residues 21-151 of SEQ 1'D N0:2) having a calculated molecular
weight
(exclusive of glycosylation) of 14,823 Da. Those skilled in the art will
recognize,
however, that some cytokines (e.g., endothelial cell growth factor, basic FGF,
and IL-
1 ~3) do not comprise conventional secretory peptides and are secreted by a
mechanism
that is not understood. The cDNA also includes a clear polyadenylation signal,
as well
as two message instability motifs (ATTTA) in the 3'-untranslated region
beginnning at
nucleotides 749 and 862 of SEQ ID NO:I. These message instability motifs are
2 o characteristic of cytokine genes (see, e.g., Shaw and Kamen, Cell 46:659-
667, 1986).
Those skilled in the art will recognize that predicted domain boundaries
are somewhat imprecise and may vary by up to ~ 5 amino acid residues.
Polypeptides of the present invention comprise at least 6, at least 9, or at
least 15 contiguous amino acid residues of SEQ ID N0:2. Within certain
embodiments
2 5 of the invention, the polypeptides comprise 20, 30, 40, 50, 100, or more
contiguous
residues of SEQ >D N0:2, up to the entire predicted mature polypeptide
(residues 21 to
151 of SEQ ID N0:2) or the primary translation product (residues 1 to 151 of
SEQ m
N0:2). As disclosed in more detail below, these polypeptides can further
comprise
additional, non-zalpha48, polypeptide sequence(s).
3 0 Within the polypeptides of the present invention are polypeptides that
comprise an epitope-bearing portion of a protein as shown in SEQ >D N0:2. An
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
12
"epitope" is a region of a protein to which an antibody can bind. See, for
example,
Geysen et al., Proc. Natl. Acad. Sci. USA 81:3998-4002, 1984. Epitopes can be
linear
or conformational, the latter being composed of discontinuous regions of the
protein
that form an epitope upon folding of the protein. Linear epitopes are
generally at least 6
amino acid residues in length. Relatively short synthetic peptides that mimic
part of a
protein sequence are routinely capable of eliciting an antiserum that reacts
with the
partially mimicked protein. See, Sutcliffe et al., Science 219:660-666, 1983.
Antibodies that recognize short, linear epitopes are particularly useful in
analytic and
diagnostic applications that employ denatured protein, such as Western
blotting (Tobin,
Proc. Natl. Acad. Sci. USA 76:4350-4356, 1979), or in the analysis of fixed
cells or
tissue samples. Antibodies to linear epitopes are also useful for detecting
fragments of
zalpha48, such as might occur in body fluids or cell culture media.
Antigenic, epitope-bearing polypeptides of the present invention are
useful for raising antibodies, including monoclonal antibodies, that
specifically bind to a
zalpha48 protein. Antigenic, epitope-bearing polypeptides contain a sequence
of at
least six, often at least nine, more commonly from 15 to about 30 contiguous
amino
acid residues of a zalpha48 protein (e.g., SEQ ID N0:2). Polypeptides
comprising a
larger portion of a zalpha48 protein, i.e. from 30 to 50 residues up to the
entire
sequence, are included. It is preferred that the amino acid sequence of the
epitope-
2 0 bearing polypeptide is selected to provide substantial solubility in
aqueous solvents, that
is the sequence includes relatively hydrophilic residues, and hydrophobic
residues are
substantially avoided. Such regions include the interdomain loops of zalpha48
and
fragments thereof. Specific polypeptides in this regard include those
comprising
residues 2-7, 20-33, 20-34, 25-30, 46-51, 47-57, 49-57, 89-94, and 146-151 of
SEQ ID
2 5 N0:2.
Of particular interest within the present invention are polypeptides that
comprise the entire four-helix bundle of a zalpha48 polypeptide (e.g.,
residues 34-141
of SEQ ID N0:2). Such polypeptides may further comprise all or part of one or
both of
the native zalpha48 amino-terminal (residues 21-33 of SEQ ID N0:2) and
carboxyl-
3 0 terminal (residues 142-151 of SEQ ID N0:2) regions, as well as non-
zalpha48 amino
acid residues or polypeptide sequences as disclosed in more detail below.
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
13
Polypeptides of the present invention can be prepared with one or more
amino acid substitutions, deletions or additions as compared to SEQ >D N0:2.
Where
preservation of zalpha48 biological activity is desired, these changes will
ordinarily be
of a minor nature, that is conservative amino acid substitutions and other
changes that
do not significantly affect the folding or activity of the protein or
polypeptide.
Sequence changes in this regard include amino- or carboxyl-terminal
extensions, such
as an amino-terminal methionine residue, an amino or carboxyl-terminal
cysteine
residue to facilitate subsequent linking to maleimide-activated keyhole limpet
hemocyanin, a linker peptide (typically, but not exclusively, of up to about
20-25
1 o residues), or an extension that facilitates purification (an affinity tag)
as disclosed
above. Two or more affinity tags may be used in combination. Polypeptides
comprising affinity tags can further comprise a polypeptide linker and/or a
proteolytic
cleavage site between the zalpha48 polypeptide and the affinity tag. Exemplary
cleavage sites include thrombin cleavage sites and factor Xa cleavage sites.
The present invention further provides a variety of other polypeptide
fusions. For example, a zalpha48 polypeptide can be prepared as a fusion to a
dimerizing protein as disclosed in U.S. Patents Nos. 5,155,027 and 5,567,584.
Exemplary dimerizing proteins in this regard include immunoglobulin constant
region
domains. Immunoglobulin-zalpha48 polypeptide fusions can be expressed in
2 0 genetically engineered cells to produce a variety of multimeric zalpha48
analogs. In
addition, a zalpha48 polypeptide can be joined to another bioactive molecule,
such as a
cytokine, to provide a mufti-functional molecule. One or more helices of a
zalpha48
polypeptide can be joined to another cytokine to enhance or otherwise modify
its
biological properties. Auxiliary domains can be fused to zalpha48 polypeptides
to
2 5 target them to specific cells, tissues, or macromolecules (e.g.,
collagen). For example, a
zalpha48 polypeptide or protein can be targeted to a predetermined cell type
by fusing a
zalpha48 polypeptide to a ligand that specifically binds to a receptor on the
surface of
the target cell. In this way, polypeptides and proteins can be targeted for
therapeutic or
diagnostic purposes. A zalpha48 polypeptide can be fused to two or more
moieties,
3 0 such as an affinity tag for purification and a targeting domain.
Polypeptide fusions can
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
14
also comprise one or more cleavage sites, particularly between domains. See,
Tuan et
al., Connective Tissue Research 34:1-9, 1996.
Polypeptide fusions of the present invention will generally contain not
more than about 1,500 amino acid residues, often not more than about 1,200
residues,
commonly not more than about 1,000 residues, and will in many cases be
considerably
smaller. For example, a zalpha48 polypeptide of 131 residues (residues 21-151
of SEQ
>D N0:2) can be fused to E. coli ~3-galactosidase (1,021 residues; see
Casadaban et al.,
J. Bacteriol. 143:971-980, 1980), a 10-residue spacer, and a 4-residue factor
Xa
cleavage site to yield a polypeptide of 1,166 residues. In a second example,
residues
to 21-151 of SEQ 1D N0:2 can be fused to maltose binding protein
(approximately 370
residues), a 4-residue cleavage site, and a 6-residue polvhistidine tag.
The polypeptidews of the present invention can comprise non-naturally
occuring amino acid residues. Non-naturally occuring amino acids include,
without
limitation, traps-3-methylproline, 2,4-methanoproline, cis-4-hydroxyproline,
traps-4-
hydroxyproline, N-methylglycine, allo-threonine, methylthreonine,
hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine,
pipecolic acid, tert-leucine, norvaline, 2-azaphenylalanine, 3-
azaphenylalanine, 4-
azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in the
art for
incorporating non-naturally occuring amino acid residues into proteins. See,
for
2 o example, Robertson et al., J. Am. Chem. Soc. 113:2722, 1991; Ellman et
al., Methods
Enzymol. 202:301, 1991; Chung et al., Science 259:806-809, 1993; Chung et al.,
Proc
Natl. Acad. Sci. USA 90:10145-10149, 1993; Turcatti et al., J. Biol. Chem.
271:19991
19998, 1996; and Koide et al., Biochem. 33:7470-7476, 1994. Chemical
modification
can be combined with site-directed mutagenesis to further expand the range of
2 5 substitutions (Wynn and Richards, Protein Sci. 2:395-403, 1993).
Amino acid sequence changes are made in zalpha48 polypeptides so as
to minimize disruption of higher order structure essential to biological
activity. Amino
acid residues that are within regions or domains that are critical to
maintaining
structural integrity can be determined. Within these regions one can identify
specific
3 o residues that will be more or less tolerant of change and maintain the
overall tertiary
structure of the molecule. Methods for analyzing sequence structure include,
but are not
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
limited to, alignment of multiple sequences with high amino acid or nucleotide
identity,
secondary structure propensities, binary patterns, complementary packing, and
buried
polar interactions (Barton, Current Opin. Struct. Biol. 5:372-376, 1995 and
Cordes et
al., Current Opin. Struct. Biol. 6:3-10, 1996). In general, determination of
structure will
5 be accompanied by evaluation of activity of modified molecules. For example,
changes
in amino acid residues will be made so as not to disrupt the four-helix bundle
structure
of the protein family. The effects of amino acid sequence changes can be
predicted by,
for example, computer modeling using available software (e.g., the Insight II~
viewer
and homology modeling tools; MSI, San Diego, CA) or determined by analysis of
10 crystal structure (see, e.g., Lapthorn et al, Nature 369:455-461, 1994;
Lapthorn et al.,
Nat. Struct. Biol. 2:266-268, 1995). Protein folding can be measured by
circular
dichroism (CD). Measuring and comparing the CD spectra generated by a modified
molecule and standard molecule are routine in the art (Johnson, Proteins 7:205-
214,
1990). Crystallography is another well known and accepted method for analyzing
15 folding and structure. Nuclear magnetic resonance (NMR), digestive peptide
mapping
and epitope mapping are other known methods for analyzing folding and
structural
similarities between proteins and polypeptides (Schaanan et al., Science
257:961-964,
1992). Mass spectrometry and chemical modification using reduction and
alkylation can
be used to identify cysteine residues that are associated with disulfide bonds
or are free
2 0 of such associations (Bean et al., Anal. Biochem. 201:216-226, 1992; Gray,
Protein Sci.
2:1732-1748, 1993; and Patterson et al., Anal. Chem. 66:3727-3732, 1994).
Alterations
in disulfide bonding will be expected to affect protein folding. These
techniques can be
employed individually or in combination to analyze and compare the structural
features
that affect folding of a variant protein or polypeptide to a standard molecule
to
2 5 determine whether such modifications would be significant.
A hydrophilicity profile of SEQ ID N0:2 is shown in the attached figure.
Those skilled in the art will recognize that this hydrophilicity will be taken
into account
when designing alterations in the amino acid sequence of a zalpha48
polypeptide, so as
not to disrupt the overall profile. Residues within the core of the four-helix
bundle can
3 0 be replaced with a hydrophobic residue selected from the group consisting
of Leu, Ile,
Val, Met, Phe, Trp, Gly, and Ala as shown in SEQ >D N0:3. Cysteine residues at
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
16
positions 66, 111. 125, and 147 of SEQ )D N0:2 and the residues predicted to
be on the
exposed surface of the four-helix bundle will be relatively intolerant of
substitution.
The length and amino acid composition of the interdomain loops are also
expected to be
important for receptor binding (and therefore biological activity);
conservative
substitutions and relatively small insertions and deletions are thus preferred
within the
loops, and the insertion of bulky amino acid residues (e.g., Phe) will in
general be
avoided. Zalpha48 variant proteins having amino acid substitutions within the
four-
helix bundle are shown in SEQ 1D N0:3.
Essential amino acids in the polypeptides of the present invention can be
identified experimentally according to procedures known in the art, such as
site-directed
mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science
244,
1081-1085, 1989: Bass et al., Proc. Natl. Acad. Sci. USA 88:4498-4502, 1991).
In the
latter technique, single alanine mutations are introduced at even' residue in
the
molecule, and the resultant mutant molecules are tested for biological
activity as
disclosed below to identify amino acid residues that are critical to the
activity of the
molecule.
Multiple amino acid substitutions can be made and tested using known
methods of mutagenesis and screening, such as those disclosed by Reidhaar-
Olson and
Sauer (Science 241:53-57, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA
2 0 86:2152-2156, 1989). Briefly, these authors disclose methods for
simultaneously
randomizing two or more positions in a polypeptide, selecting for functional
polypeptide, and then sequencing the mutagenized polypeptides to determine the
spectrum of allowable substitutions at each position. Other methods that can
be used
include phage display (e.g., Lowman et al., Biochem. 30:10832-10837, 1991;
Ladner et
2 5 al., U.S. Patent No. 5,223,409; Huse, WIPO Publication WO 92/06204) and
region-
directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA
7:127,
1988).
Variants of the disclosed zalpha48 DNA and polypeptide sequences can
be generated through DNA shuffling as disclosed by Stemmer, Nature 370:389-
391,
3 0 1994 and Stemmer, Proc. Natl. Acad. Sci. USA 91:10747-10751, 1994.
Briefly, variant
genes are generated by in vitro homologous recombination by random
fragmentation of
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
17
a parent gene followed by reassembly using PCR, resulting in randomly
introduced
point mutations. This technique can be modified by using a family of parent
genes,
such as allelic variants or genes from different species, to introduce
additional
variability into the process. Selection or screening for the desired activity,
followed by
additional iterations of mutagenesis and assay provides for rapid "evolution"
of
sequences by selecting for desirable mutations while simultaneously selecting
against
detrimental changes.
In many cases, the structure of the final polypeptide product will result
from processing of the nascent polypeptide chain by the host cell, thus the
final
sequence of a zalpha48 polypeptide produced by a host cell will not always
correspond
to the full sequence encoded by the expressed polynucleotide. For example,
expressing
the complete zalpha48 sequence in a cultured mammalian cell is expected to
result in
removal of at least the secretory peptide, while the same polypeptide produced
in a
prokaryotic host would not be expected to be cleaved. Differential processing
of
individual chains may result in heterogeneity of expressed polypeptides.
The human zalpha48 polypeptide sequence (SEQ ID N0:2) contains five
cysteine residues, at positions 66, 111, 125, 134, and 147. Structural
predictions
indicate that cys residues 66 and 147 may form an intrachain disulfide bond,
and that
residues 111 and 125 may be free to form interchain disulfide bonds, resulting
in
2 0 dimerization. Actual conformation will depend in part upon the cell in
which in the
polypeptide is expressed. The polypeptides of the present invention thus
include those
comprising these cysteine residues, such as polypeptides comprising residues
34-147 of
SEQ >Z7 N0:2.
Zalpha48 proteins of the present invention are characterized by their
2 5 activity, that is, modulation of the proliferation, differentiation,
migration, adhesion, or
metabolism of responsive cell types. Biological activity of zalpha48 proteins
is assayed
using in vitro or in vivo assays designed to detect cell proliferation,
differentiation,
migration or adhesion; or changes in cellular metabolism (e.g., production of
other
growth factors or other macromolecules). Many suitable assays are known in the
art,
3 0 and representative assays are disclosed herein. Assays using cultured
cells are most
convenient for screening, such as for determining the effects of amino acid
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
18
substitutions, deletions, or insertions. However, in view of the complexity of
developmental processes (e.g., angiogenesis, wound healing), in vivo assays
will
generally be employed to confirm and further characterize biological activity.
Certain
in vitro models, such as the three-dimensional collagen gel matrix model of
Pepper et
al. (Biochem. Biophys. Res. Comm. 189:824-831, 1992), are sufficiently complex
to
assay histological effects. Assays can be performed using exogenously produced
proteins, or may be carried out in vivo or in vitro using cells expressing the
polypeptide(s) of interest. Assays can be conducted using zalpha48 proteins
alone or in
combination with other growth factors, such as members of the VEGF family or
1 o hematopoietic cytokines (e.g., EPO, TPO, G-CSF, stem cell factor).
Representative
assays are disclosed below.
Mutagenesis methods as disclosed above can be combined with high
volume or high-throughput screening methods to detect biological activity of
zalpha48
variant polypeptides. Assays that can be scaled up for high throughput include
mitogenesis assays, which can be run in a 96-well format. Mutagenized DNA
molecules that encode active zalpha48 polypeptides can be recovered from the
host cells
and rapidly sequenced using modern equipment. These methods allow the rapid
determination of the importance of individual amino acid residues in a
polypeptide of
interest, and can be applied to polypeptides of unknown structure.
2 o Using the methods discussed above, one of ordinary skill in the art can
prepare a variety of polypeptide fragments or variants of SEQ ID N0:2 that
retain the
activity of wild-type zalpha48.
The present invention also provides polynucleotide molecules, including
DNA and RNA molecules, that encode the zalpha48 polypeptides disclosed above.
A
2 5 representative DNA sequence encoding the amino acid sequence of SEQ 1D
N0:2 is
shown in SEQ 1D NO:1. Those skilled in the art will readily recognize that, in
view of
the degeneracy of the genetic code, considerable sequence variation is
possible among
these polynucleotide molecules. SEQ ID N0:4 is a degenerate DNA sequence that
encompasses all DNAs that encode the zalpha48 polypeptide of SEQ 1D NO: 2.
Those
3 0 skilled in the art will recognize that the degenerate sequence of SEQ 1D
N0:4 also
provides all RNA sequences encoding SEQ ID N0:2 by substituting U for T. Thus,
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
19
zalpha48 polypeptide-encoding polynucleotides comprising nucleotides 1-453 or
nucleotides 61-453 of SEQ 1D N0:4, and their RNA equivalents are contemplated
by
the present invention, as are segments of SEQ ID N0:4 encoding other zalpha48
polypeptides disclosed herein. Table 2 sets forth the one-letter codes used
within SEQ
1D N0:4 to denote degenerate nucleotide positions. "Resolutions" are the
nucleotides
denoted by a code letter. "Complement" indicates the code for the
complementary
nucleotide(s). For example, the code Y denotes either C or T, and its
complement R
denotes A or G, A being complementary to T, and G being complementary to C.
TABLE 2
Nucleotide Resolutions Complement Resolutions
A A T T
C C G G
G G C C
T T A A
R A~G Y C~T
Y CST R A~G
M A~C K G~T
K G~T M A~C
S CMG S CMG
W A~T W A~T
H A~C~T D A~G~T
B C~G~T V A~C~G
V A~C~G B C~G~T
D A~G~T H A~C~T
N A~C~G~T N A~C~G~T
The degenerate codons used in SEQ m N0:4, encompassing all possible
codons for a given amino acid, are set forth in Table 3, below.
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
TABLE 3
Amino One-Letter Degenerate
Acid Code Codons Codon
Cys C TGC TGT TGY
Ser S AGC AGT TCA TCC TCG TCT WSN
Thr T ACA ACC ACG ACT
Pro P CCA CCC CCG CCT CCN
Ala A GCA GCC GCG GCT GCN
Gly G GGA GGC GGG GGT GGN
Asn N AAC AAT AAY
Asp D GAC GAT GAY
Glu E GAA GAG GAR
Gln Q CAA CAG
CAR
His H CAC CAT CAY
Arg R AGA AGG CGA CGC CGG CGT MGN
Lys K AAA AAG AAR
Met M ATG ATG
Ile I ATA ATC ATT ATH
Leu L CTA CTC CTG CTT TTA TTG YTN
Val V GTA GTC GTG GTT GTN
Phe F TTC TTT TTY
Tyr Y TAC TAT TAY
Trp W TGG TGG
Ter . TAA TAG TGA TRR
Asn~Asp B RAY
Glu~Gln Z
SAR
Any X NNN
Gap - ___
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
21
One of ordinary skill in the art will appreciate that some ambiguity is
introduced in determining a degenerate codon, representative of all possible
codons
encoding each amino acid. For example, the degenerate codon for serine (WSN)
can, in
some circumstances, encode arginine (AGR), and the degenerate codon for
arginine
(MGN) can, in some circumstances, encode serine (AGY). A similar relationship
exists
between codons encoding phenylalanine and leucine. Thus, some polynucleotides
encompassed by the degenerate sequence may encode variant amino acid
sequences, but
one of ordinary skill in the art can easily identify such variant sequences by
reference to
the amino acid sequence of SEQ ID NO: 2. Variant sequences can be readily
tested for
functionality as described herein.
One of ordinary skill in the art will also appreciate that different species
can exhibit preferential codon usage. See, in general, Grantham et al., Nuc.
Acids Res.
8:1893-912, 1980; Haas et al. Curr. Biol. 6:315-24, 1996; Wain-Hobson et al.,
Gene
13:355-64, 1981; Grosjean and Fiers, Gene 18:199-209, 1982; Holm, Nuc. Acids
Res.
14:3075-87, 1986; and Ikemura, J. Mol. Biol. 158:573-97, 1982. Introduction of
preferred codon sequences into recombinant DNA can, for example, enhance
production of the protein by making protein translation more efficient within
a
particular cell type or species. Therefore, the degenerate codon sequence
disclosed in
SEQ ID N0:4 serves as a template for optimizing expression of polynucleotides
in
2 o various cell types and species commonly used in the art and disclosed
herein.
Within certain embodiments of the invention the isolated
polynucleotides will hybridize to similar sized regions of SEQ ID NO:I or a
sequence
complementary thereto under stringent conditions. In general, stringent
conditions are
selected to be about 5°C lower than the thermal melting point (Tm) for
the specific
2 5 sequence at a defined ionic strength and pH. The Tm is the temperature
(under defined
ionic strength and pH) at which 50% of the target sequence hybridizes to a
perfectly
matched probe. Typical stringent conditions are those in which the salt
concentration is
up to about 0.03 M at pH 7 and the temperature is at least about 60°C.
As previously noted, the isolated polynucleotides of the present
3 0 invention include DNA and RNA. Methods for preparing DNA and RNA are well
known in the art. In general, RNA is isolated from a tissue or cell that
produces large
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
22
amounts of zalpha48 RNA. Pancreatic islet cells are preferred. Fibroblasts are
another
preferred source. Total RNA can be prepared using guanidine HCl extraction
followed
by isolation by centrifugation in a CsCI gradient (Chirgwin et al.,
Biochemistry 18:52-
94, 1979). Poly (A)+ RNA is prepared from total RNA using the method of Aviv
and
Leder (Proc. Natl. Acad. Sci. USA 69:1408-1412, 1972). Complementary DNA
(cDNA) is prepared from poly(A)+ RNA using known methods. In the alternative,
genomic DNA can be isolated. Polynucleotides encoding zalpha48 polypeptides
are
then identified and isolated by, for example, hybridization or PCR.
Full-length clones encoding zalpha48 can be obtained by conventional
cloning procedures. Complementary DNA (cDNA) clones are generally preferred,
although for some applications (e.g., expression in transgenic animals) it may
be
preferable to use a genomic clone, or to modify a cDNA clone to include at
least one
genomic intron. Methods for preparing cDNA and genomic clones are well known
and
within the level of ordinary skill in the art, and include the use of the
sequence disclosed
herein, or parts thereof, for probing or priming a library. Expression
libraries can be
probed with antibodies to zalpha48, receptor fragments, or other specific
binding
partners.
Zalpha48 polynucleotide sequences disclosed herein can also be used as
probes or primers to clone 5' non-coding regions of a zalpha48 gene. Promoter
2 0 elements from a zalpha48 gene can thus be used to direct the expression of
heterologous
genes in, for example, transgenic animals or patients treated with gene
therapy. Cloning
of 5' flanking sequences also facilitates production of zalpha48 proteins by
"gene
activation" as disclosed in U.S. Patent No. 5,641,670. Briefly, expression of
an
endogenous zalpha48 gene in a cell is altered by introducing into the zalpha48
locus a
2 5 DNA construct comprising at least a targeting sequence, a regulatory
sequence, an exon,
and an unpaired splice donor site. The targeting sequence is a zalpha48 5' non-
coding
sequence that permits homologous recombination of the construct with the
endogenous
zalpha48 locus, whereby the sequences within the construct become operably
linked
with the endogenous zalpha48 coding sequence. In this way, an endogenous
zalpha48
3 0 promoter can be replaced or supplemented with other regulatory sequences
to provide
enhanced, tissue-specific, or otherwise regulated expression.
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
23
Those skilled in the art will recognize that the sequences disclosed in
SEQ >D NOS:1 and 2 represent a single allele of human zalpha48. Allelic
variants of
these sequences can be cloned by probing cDNA or genomic libraries from
different
individuals according to standard procedures.
The present invention further provides counterpart polypeptides and
polynucleotides from other species ("orthologs"). Of particular interest are
zalpha48
polypeptides from other mammalian species, including murine, porcine, ovine,
bovine,
canine, feline, equine, and other primate polypeptides. Orthologs of human
zalpha48
can be cloned using information and compositions provided by the present
invention in
combination with conventional cloning techniques. For example, a cDNA can be
cloned using mRNA obtained from a tissue or cell type that expresses zalpha48
as
disclosed above. A library is then prepared from mRNA of a positive tissue or
cell line.
A zalpha48-encoding cDNA can then be isolated by a variety of methods, such as
by
probing with a complete or partial human cDNA or with one or more sets of
degenerate
probes based on the disclosed sequence. A cDNA can also be cloned using the
polymerase chain reaction, or PCR (Mullis, U.S. Patent No. 4,683,202), using
primers
designed from the representative human zalpha48 sequence disclosed herein.
Within an
additional method, the cDNA library can be used to transform or transfect host
cells,
and expression of the cDNA of interest can be detected with an antibody to
zalpha48
2 o polypeptide. Similar techniques can also be applied to the isolation of
genomic clones.
For any zalpha48 polypeptide, including variants and fusion proteins,
one of ordinary skill in the art can readily generate a fully degenerate
polynucleotide
sequence encoding that variant using the information set forth in Tables 2 and
3, above.
Moreover, those of skill in the art can use standard software to devise
zalpha48 variants
2 5 based upon the nucleotide and amino acid sequences described herein. The
present
invention thus provides a computer-readable medium encoded with a data
structure that
provides at least one of the following sequences: SEQ 1D NO:1, SEQ m N0:2, SEQ
1D
N0:3, SEQ 1D N0:4, and portions thereof. Suitable forms of computer-readable
media
include magnetic media and optically-readable media. Examples of magnetic
media
3 0 include a hard or fixed drive, a random access memory (RAM) chip, a floppy
disk,
digital linear tape (DLT), a disk cache, and a ZIPTM disk. Optically readable
media are
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
24
exemplified by compact discs (e.g., CD-read only memory (ROM). CD-rewritable
(RW), and CD-recordable), and digital versatile/video discs (DVD) (e.g., DVD-
ROM,
DVD-RAM, and DVD+RW).
The zalpha48 polypeptides of the present invention, including full-length
polypeptides, biologically active fragments, and fusion polypeptides can be
produced
according to conventional techniques using cells into which have been
introduced an
expression vector encoding the polypeptide. As used herein, "cells into which
have
been introduced an expression vector" include both cells that have been
directly
manipulated by the introduction of exogenous DNA molecules and progeny thereof
that
1 o contain the introduced DNA. Suitable host cells are those cell types that
can be
transformed or transfected with exogenous DNA and grown in culture, and
include
bacteria, fungal cells, and cultured higher eukaryotic cells. Techniques for
manipulating
cloned DNA molecules and introducing exogenous DNA into a variety of host
cells are
disclosed by Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed.,
Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, and Ausubel et
al.,
eds., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., NY,
1987.
In general, a DNA sequence encoding a zalpha48 polypeptide is operably
linked to other genetic elements required for its expression, generally
including a
transcription promoter and terminator, within an expression vector. The vector
will also
2 o commonly contain one or more selectable markers and one or more origins of
replication, although those skilled in the art will recognize that within
certain systems
selectable markers may be provided on separate vectors, and replication of the
exogenous DNA may be provided by integration into the host cell genome.
Selection of
promoters, terminators, selectable markers, vectors and other elements is a
matter of
2 5 routine design within the level of ordinary skill in the art. Many such
elements are
described in the literature and are available through commercial suppliers.
To direct a zalpha48 polypeptide into the secretory pathway of a host
cell, a secretory signal sequence (also known as a leader sequence, prepro
sequence or
pre sequence) is provided in the expression vector. The secretory signal
sequence may
3 0 be that of zalpha48, or may be derived from another secreted protein
(e.g., t-PA; see,
U.S. Patent No. 5,641,655) or synthesized de novo. The secretory signal
sequence is
CA 02381794 2002-02-11
WO 01/12665 PCTNS00/22714
operably linked to the zalpha48 DNA sequence, i.e., the two sequences are
joined in the
correct reading frame and positioned to direct the newly sythesized
polypeptide into the
secretory pathway of the host cell. Secretory signal sequences are commonly
positioned
5' to the DNA sequence encoding the polypeptide of interest, although certain
signal
5 sequences may be positioned elsewhere in the DNA sequence of interest (see,
e.g.,
Welch et al., U.S. Patent No. 5,037,743; Holland et al., U.S. Patent No.
5,143,830).
Cultured mammalian cells can be used as hosts within the present
invention. Methods for introducing exogenous DNA into mammalian host cells
include
calcium phosphate-mediated transfection (Wigler et al., Cell 14:725, 1978;
Corsaro and
10 Pearson, Somatic Cell Genetics 7:603, 1981; Graham and Van der Eb, Virology
52:456,
1973), electroporation (Neumann et al., EMBO J. 1:841-845, 1982), DEAF-dextran
mediated transfection (Ausubel et al., ibid.), and liposome-mediated
transfection
(Hawley-Nelson et al., Focus 15:73, 1993; Ciccarone et al., Focus 15:80,
1993). The
production of recombinant polypeptides in cultured mammalian cells is
disclosed, for
15 example, by Levinson et al., U.S. Patent No. 4,713,339; Hagen et al., U.S.
Patent No.
4,784,950; Palmiter et al., U.S. Patent No. 4,579,821; and Ringold, U.S.
Patent No.
4,656,134. Suitable cultured mammalian cells include the COS-1 (ATCC No. CRL
1650), COS-7 (ATCC No. CRL 1651 ), BHK (ATCC No. CRL 1632), BHK 570 (ATCC
No. CRL 10314), 293 (ATCC No. CRL 1573; Graham et al., J. Gen. Virol. 36:59-
72,
20 1977) and Chinese hamster ovary (e.g. CHO-K1, ATCC No. CCL 61; or CHO DG44,
Chasm et al., Som. Cell. Molec. Genet. 12:555, 1986) cell lines. Additional
suitable cell
lines are known in the art and available from public depositories such as the
American
Type Culture Collection, Mantissas, VA. Suitable promoters include those from
SV-40
or cytomegalovirus (e.g., U.S. Patent No. 4,956,288), metallothionein genes
(U.S.
25 Patent Nos. 4,579,821 and 4,601,978), and the adenovirus major late
promoter.
Expression vectors for use in mammalian cells include pZP-1 and pZP-9, which
have
been deposited with the American Type Culture Collection, Mantissas, VA USA
under
accession numbers 98669 and 98668, respectively, and derivatives thereof.
Drug selection is generally used to select for cultured mammalian cells
3 0 into which foreign DNA has been inserted. Such cells are commonly referred
to as
"transfectants". Cells that have been cultured in the presence of the
selective agent and
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
26
are able to pass the gene of interest to their progeny are referred to as
"stable
transfectants." An exemplary selectable marker is a gene encoding resistance
to the
antibiotic neomycin. Selection is carried out in the presence of a neomycin-
type drug,
such as G-418 or the like. Selection systems can also be used to increase the
expression
level of the gene of interest, a process referred to as "amplification."
Amplification is
carried out by culturing transfectants in the presence of a low level of the
selective agent
and then increasing the amount of selective agent to select for cells that
produce high
levels of the products of the introduced genes. An exemplary amplifiable
selectable
marker is dihydrofolate reductase, which confers resistance to methotrexate.
Other drug
resistance genes (e.g. hygromycin resistance, mufti-drug resistance, puromycin
acetyltransferase) can also be used.
The adenovirus system (disclosed in more detail below) can also be used
for protein production in vitro. By culturing adenovirus-infected non-293
cells under
conditions where the cells are not rapidly dividing, the cells can produce
proteins for
extended periods of time. For instance, BHK cells are grown to confluence in
cell
factories, then exposed to the adenoviral vector encoding the secreted protein
of
interest. The cells are then grown under serum-free conditions, which allows
infected
cells to survive for several weeks without significant cell division. In an
alternative
method, adenovirus vector-infected 293 cells can be grown as adherent cells or
in
2 0 suspension culture at relatively high cell density to produce significant
amounts of
protein (See Gamier et al., Cytotechnol. 15:145-55, 1994). With either
protocol, an
expressed, secreted heterologous protein can be repeatedly isolated from the
cell culture
supernatant, lysate, or membrane fractions depending on the disposition of the
expressed protein in the cell. Within the infected 293 cell production
protocol, non
2 5 secreted proteins can also be effectively obtained.
Insect cells can be infected with recombinant baculovirus, commonly
derived from Autographa californica nuclear polyhedrosis virus (AcNPV)
according to
methods known in the art. Within one method, recombinant baculovirus is
produced
through the use of a transposon-based system described by Luckow et al. (J.
Virol.
3 0 67:4566-4579, 1993). This system, which utilizes transfer vectors, is
commercially
available in kit form (Bac-to-BacTM kit; Life Technologies, Rockville, MD).
The
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
27
transfer vector (e.g., pFastBaclT'~'; Life Technologies) contains a Tn7
transposon to
move the DNA encoding the protein of interest into a baculovirus genome
maintained
in E. coli as a large plasmid called a "bacmid." See, Hill-Perkins and Possee,
J. Gen.
Virol. 71:971-976. 1990; Bonning et al., J. Gen. Virol. 75:1551-1556, 1994;
and
Chazenbalk and Rapoport, J. Biol. Cherv. 270:1543-1549, 1995. For protein
production, the recombinant virus is used to infect host cells, typically a
cell line
derived from the fall armyworm, Spodoptera frugiperda (e.g., Sf9 or Sf21
cells) or
Trichoplusia ni (e.g., High FiveT"" cells; Invitrogen, Carlsbad, CA). See, for
example,
U.S. Patent No. 5,300,435. Serum-free media are used to grow and maintain the
cells.
Suitable media formulations are known in the art and can be obtained from
commercial
suppliers. The cells are grown up from an inoculation density of approximately
2-5 x
105 cells to a density of 1-2 x 106 cells, at which time a recombinant viral
stock is added
at a multiplicity of infection (MOI) of 0.1 to 10, more typically near 3.
Procedures used
are generally known in the art.
Other higher eukaryotic cells can also be used as hosts, including plant
cells and avian cells. The use of Agrobacterium rhizogenes as a vector for
expressing
genes in plant cells has been reviewed by Sinkar et al., J. Biosci.
(Bangalore) 11:47-58,
1987.
Fungal cells, including yeast cells, can also be used within the present
2 0 invention. Yeast species of particular interest in this regard include
Sacclxaromyces
cerevisiae, Pichia pastoris, and Pichia methanolica. Methods for transforming
S.
cerevisiae cells with exogenous DNA and producing recombinant polypeptides
therefrom are disclosed by, for example, Kawasaki, U.S. Patent No. 4,599,311;
Kawasaki et al., U.S. Patent No. 4,931,373; Brake, U.S. Patent No. 4,870,008;
Welch et
al., U.S. Patent No. 5,037,743; and Murray et al., U.S. Patent No. 4,845,075.
Transformed cells are selected by phenotype determined by the selectable
marker, such
as drug resistance, the ability to grow in the absence of a particular
nutrient (e.g.,
leucine), or the POTI vector system disclosed by Kawasaki et al. (U.S. Patent
No.
4,931,373), which allows transformed cells to be selected by growth in glucose-
3 0 containing media. Suitable promoters and terminators for use in yeast
include those
from glycolytic enzyme genes (see, e.g., Kawasaki, U.S. Patent No. 4,599,311;
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
28
Kingsman et al., U.S. Patent No. 4,615,974; and Bitter, U.S. Patent No.
4,977.092) and
alcohol dehydrogenase genes. See also U.S. Patents Nos. 4,990,446; 5,063,154;
5,139,936 and 4,661,454. Transformation systems for other yeasts, including
Hansenula polvrnorpha, Schizosaccharomyces pombe, Kluyveromyces lactis,
Kluyveromyces fragilis, Ustilago nZavdis, Pichia pastoris, Pichia methanolica,
Pichia
guillermondii and Candida maltosa are known in the art. See, for example,
Gleeson et
al., J. Gen. Microbiol. 132:3459-3465, 1986; Cregg, U.S. Patent No. 4,882,279;
and
Raymond et al., Yeast 14, 11-23, 1998. Aspergillus cells may be utilized
according to
the methods of McKnight et al., U.S. Patent No. 4,935,349. Methods for
transforming
Acremonium chrysogenum are disclosed by Sumino et al., U.S. Patent No.
5,162,228.
Methods for transforming Neurospora are disclosed by Lambowitz, U.S. Patent
No.
4,486,533. Production of recombinant proteins in Pichia methanolica is
disclosed in
U.S. Patents No. 5,716,808, 5,736,383, 5,854,039, and 5,888,768.
Prokaryotic host cells, including strains of the bacteria Escherichia coli,
Bacillus and other genera are also useful host cells within the present
invention.
Techniques for transforming these hosts and expressing foreign DNA sequences
cloned
therein are well known in the art (see, e.g., Sambrook et al., ibid.). When
expressing a
zalpha48 polypeptide in bacteria such as E. coli, the polypeptide may be
retained in the
cytoplasm, typically as insoluble granules, or may be directed to the
periplasmic space
2 0 by a bacterial secretion sequence. In the former case, the cells are
lysed, and the
granules are recovered and denatured using, for example, guanidine
isothiocyanate or
urea. The denatured polypeptide can then be refolded and dimerized by diluting
the
denaturant, such as by dialysis against a solution of urea and a combination
of reduced
and oxidized glutathione, followed by dialysis against a buffered saline
solution. In the
2 5 latter case, the polypeptide can be recovered from the periplasmic space
in a soluble and
functional form by disrupting the cells (by, for example, sonication or
osmotic shock) to
release the contents of the periplasmic space and recovering the protein,
thereby
obviating the need for denaturation and refolding.
Transformed or transfected host cells are cultured according to
3 0 conventional procedures in a culture medium containing nutrients and other
components
required for the growth of the chosen host cells. A variety of suitable media,
including
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
29
defined media and complex media, are known in the art and generally include a
carbon
source, a nitrogen source, essential amino acids, vitamins and minerals. Media
may
also contain such components as growth factors or serum, as required. The
growth
medium will generally select for cells containing the exogenously added DNA
by, for
example, drug selection or deficiency in an essential nutrient which is
complemented by
the selectable marker carried on the expression vector or co-transfected into
the host
cell. Liquid cultures are provided with sufficient aeration by conventional
means, such
as shaking of small flasks or sparging of fermentors.
Depending upon the intended use, the polypeptides and proteins of the
present invention may be purified to >_80% purity, >_90% purity, >_95% purity,
or to a
pharmaceutically pure state, that is greater than 99.9% pure with respect to
contaminating macromolecules, particularly other proteins and nucleic acids,
and free of
infectious and pyrogenic agents.
Expressed recombinant zalpha48 proteins (including chimeric
polypeptides and multimeric proteins) are purified by conventional protein
purification
methods, typically by a combination of chromatographic techniques. See, in
general,
Affinity ChromatoQraphy: Principles & Methods, Pharmacia LKB Biotechnology,
Uppsala, Sweden, 1988; and Scopes, Protein Purification: Princples and
Practice,
Springer-Verlag, New York, 1994. Proteins comprising a polyhistidine affinity
tag
2 0 (typically about 6 histidine residues) are purified by affinity
chromatography on a nickel
chelate resin. See, for example, Houchuli et al., BiolTechnol. 6: 1321-1325,
1988.
Proteins comprising a glu-glu tag can be purified by immunoaffinity
chromatography
according to conventional procedures. See, for example, Grussenmeyer et al.,
ibid.
Maltose binding protein fusions are purified on an amylose column according to
2 5 methods known in the art.
Zalpha48 polypeptides can also be prepared through chemical synthesis
according to methods known in the art, including exclusive solid phase
synthesis, partial
solid phase methods, fragment condensation or classical solution synthesis.
See, for
example, Merrifield, J. Am. Chena. Soc. 85:2149, 1963; Stewart et al., Solid
Phase
3 0 Peptide Synthesis (2nd edition), Pierce Chemical Co., Rockford, IL, 1984;
Bayer and
Rapp, Chem. Pept. Prot. 3:3, 1986; and Atherton et al., Solid Phase Peptide
Synthesis:
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
A Practical Approach, IRL Press, Oxford, 1989. In vitro synthesis is
particularly
advantageous for the preparation of smaller polypeptides.
Using methods known in the art, zalpha48 proteins can be prepared as
monomers or multimers; glycosylated or non-glycosylated; pegylated or non-
pegylated;
5 and may or may not include an initial methionine amino acid residue.
Target cells for use in zalpha48 activity assays include, without
limitation, vascular cells (especially endothelial cells and smooth muscle
cells),
hematopoietic (myeloid and lymphoid) cells, liver cells (including
hepatocytes,
fenestrated endothelial cells, Kupffer cells, and Ito cells), fibroblasts
(including human
10 dermal fibroblasts and lung fibroblasts), fetal lung cells, articular
synoviocytes,
pericvtes. chondrocvtes, osteoblasts, and prostate epithelial cells.
Endothelial cells and
hematopoietic cells are derived from a common ancestral cell, the
hemangioblast (Choi
et al., Developr~ie~at 125:725-732, 1998).
Activity of zalpha48 proteins can be measured in vitro using cultured
15 cells or in vivo by administering molecules of the claimed invention to an
appropriate
animal model. Assays measuring cell proliferation or differentiation are well
known in
the art. For example, assays measuring proliferation include such assays as
chemosensitivity to neutral red dye (Cavanaugh et al., Investigational New
Drugs
8:347-354, 1990), incorporation of radiolabelled nucleotides (as disclosed by,
e.g.,
2 0 Raines and Ross, Methods En:.vmol. 109:749-773, 1985; Wahl et al., Mol.
Cell Biol.
8:5016-5025, 1988; and Cook et al., Analytical Biochem. 179:1-7, 1989),
incorporation
of 5-bromo-2'-deoxyuridine (BrdU) in the DNA of proliferating cells (Porstmann
et al.,
J. Immunol. Methods 82:169-179, 1985), and use of tetrazolium salts (Mosmann,
J.
Immurtol. Methods 65:55-63, 1983; Alley et al., Cancer Res. 48:589-601, 1988;
2 5 Marshall et al., Growtl2 Reg. 5:69-84, 199; and Scudiero et al., Cancer
Res. 48:4827-
4833, 1988). Differentiation can be assayed using suitable precursor cells
that can be
induced to differentiate into a more mature phenotype. Assays measuring
differentiation include, for example, measuring cell-surface markers
associated with
stage-specific expression of a tissue, enzymatic activity, functional activity
or
30 morphological changes (Watt, FASEB, x:281-284, 1991; Francis,
Differentiation 57:63-
75, 1994; Raes, Adv. Anim. Cell Biol. Technol. Bioprocesses, 161-I71, 1989).
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
31
Zalpha48 activity may also be detected using assays designed to measure
zalpha48-induced production of one or more additional growth factors or other
macromolecules. Such assays include those for determining the presence of
hepatocyte
growth factor (HGF), epidermal growth factor (EGF), transforming growth factor
alpha
(TGFoc), interleukin-6 (IL-6), VEGF, acidic fibroblast growth factor (aFGF),
angiogenin, and other macromolecules produced by the liver. Suitable assays
include
mitogenesis assays using target cells responsive to the macromolecule of
interest,
receptor-binding assays, competition binding assays, immunological assays
(e.g.,
ELISA), and other formats known in the art. Metalloprotease secretion is
measured
from treated primary human dermal fibroblasts, synoviocytes and chondrocytes.
The
relative levels of collagenase, gelatinase and stromalysin produced in
response to
culturing in the presence of a zalpha48 protein is measured using zymogram
gels (Loita
and Stetler-Stevenson, Cancer Biology 1:96-106, 1990). Procollagen/collagen
synthesis
by dermal fibroblasts and chondrocytes in response to a test protein is
measured using
~H-proline incorporation into nascent secreted collagen. ~H-labeled collagen
is
visualized by SDS-PAGE followed by autoradiography (Unemori and Amento, J.
Biol.
Chem. 265: 10681-10685, 1990). Glycosaminoglycan (GAG) secretion from dermal
fibroblasts and chondrocvtes is measured using a 1,9-dimethylmethylene blue
dye
binding assay (Farndale et al., Biochim. Biophys. Acta 883:173-177, 1986).
Collagen
2 0 and GAG assays are also carried out in the presence of IL-1 (3 or TGF-(3
to examine the
ability of zalpha48 protein to modify the established responses to these
cytokines.
Monocyte activation assays are carried out ( 1 ) to look for the ability of
zalpha48 proteins to further stimulate monocyte activation, and (2) to examine
the
ability of zalpha48 proteins to modulate attachment-induced or endotoxin-
induced
2 5 monocyte activation (Fuhlbrigge et al., J. Immunol. 138: 3799-3802, 1987).
IL-1 (3 and
TNFoc levels produced in response to activation are measured by ELISA
(Biosource,
Inc. Camarillo, CA). Monocytelmacrophage cells, by virtue of CD14 (LPS
receptor),
are exquisitely sensitive to endotoxin, and proteins with moderate levels of
endotoxin-
like activity will activate these cells.
3 0 Hematopoietic activity of zalpha48 proteins can be assayed on various
hematopoietic cells in culture. Suitable assays include primary bone marrow
colony
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
32
assays and later stage lineage-restricted colony assays, which are known in
the art (e.g.,
Holly et al., WIPO Publication WO 95/21920). Marrow cells plated on a suitable
semi-
solid medium (e.g., 50% methylcellulose containing 15% fetal bovine serum, 10%
bovine serum albumin, and 0.6% PSN antibiotic mix) are incubated in the
presence of
test polypeptide, then examined microscopically for colony formation. Known
hematopoietic factors are used as controls. Mitogenic activity of zalpha48
polypeptides
on hematopoietic cell lines can be measured as disclosed above.
Cell migration is assayed essentially as disclosed by Kahler et al.
(Arteriosclerosis, Thrombosis, and Vascular Biology 17:932-939, 1997). A
protein is
considered to be chemotactic if it induces migration of cells from an area of
low protein
concentration to an area of high protein concentration. A typical assay is
performed
using modified Boyden chambers with a polystrvrene membrane separating the two
chambers. Cell migration can also be measured using the matrigel method of
Grant et
al. ("Angiogenesis as a component of epithelial-mesenchymal interactions" in
Goldberg
and Rosen, Epithelial-Mesenchvmal Interaction in Cancej-, Birkhauser Verlag,
1995,
235-248; Baatout, Anticancer Research 17:451-456, 1997).
Cell adhesion activity is assayed essentially as disclosed by LaFleur et al.
(J. Biol. Chem. 272:32798-32803, 1997). Briefly, microtiter plates are coated
with the
test protein, non-specific sites are blocked with BSA, and cells (such as
smooth muscle
cells, leukocytes, or endothelial cells) are plated at a density of
approximately 10~' - 10~
cells/well. The wells are incubated at 37°C (typically for about 60
minutes), then non-
adherent cells are removed by gentle washing. Adhered cells are quantitated by
conventional methods (e.g., by staining with crystal violet, lysing the cells,
and
determining the optical density of the lysate). Control wells are coated with
a known
adhesive protein, such as fibronectin or vitronectin.
The activity of zalpha48 proteins can be measured with a silicon-based
biosensor microphysiometer that measures the extracellular acidification rate
or proton
excretion associated with receptor binding and subsequent physiologic cellular
responses. An exemplary such device is the CytosensorT"" Microphysiometer
3 0 manufactured by Molecular Devices, Sunnyvale, CA. A variety of cellular
responses,
such as cell proliferation, ion transport, energy production, inflammatory
response,
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
33
regulatory and receptor activation, and the like, can be measured by this
method. See,
for example, McConnell et al., Science 257:1906-1912, 1992; Pitchford et al.,
Meth.
Enzvrnol. 228:84-108, 1997; Arimilli et al., J. ImnZUnol. Meth. 212:49-59,
1998; and
Van Liefde et al., Eur. J. Pharmacol. 346:87-95, 1998. The microphysiometer
can be
used for assaying adherent or non-adherent eukaryotic or prokaryotic cells. By
measuring extracellular acidification changes in cell media over time, the
microphysiometer directly measures cellular responses to various stimuli,
including
zalpha48 proteins, their agonists, and antagonists. Preferably, the
microphysiometer is
used to measure responses of a zalpha48-responsive eukaryotic cell. compared
to a
control eukaryotic cell that does not respond to zalpha48 polypeptide.
Zalpha48-
responsive eukaryotic cells comprise cells into which a receptor for zalpha48
has been
transfected, thereby creating a cell that is responsive to zalpha48, as well
as cells
naturally responsive to zalpha48. Those skilled in the art will recognize that
these
methods can also be used to identify agonists and antagonists of zalpha48
proteins.
Expression of zalpha48 polynucleotides in animals provides models for
further study of the biological effects of overproduction or inhibition of
protein activity
in vivo. Zalpha48-encoding polynucleotides and antisense polynucleotides can
be
introduced into test animals, such as mice, using viral vectors or naked DNA,
or
transgenic animals can be produced.
2 0 One in vivo approach for assaying proteins of the present invention
utilizes viral delivery systems. Exemplary viruses for this purpose include
adenovirus,
herpesvirus, retroviruses, vaccinia virus, and adeno-associated virus (AAV).
Adenovirus, a double-stranded DNA virus, is currently the best studied gene
transfer
vector for delivery of heterologous nucleic acids. For review, see Becker et
al., Meth.
Cell Biol. 43:161-89, 1994; and Douglas and Curiel, Science & Medicine 4:44-
53, 1997.
The adenovirus system offers several advantages. Adenovirus can (i)
accommodate
relatively large DNA inserts; (ii) be grown to high-titer; (iii) infect a
broad range of
mammalian cell types; and (iv) be used with many different promoters including
ubiquitous, tissue specific, and regulatable promoters. Because adenoviruses
are stable
3 o in the bloodstream, they can be administered by intravenous injection.
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
34
By deleting portions of the adenovirus genome, larger inserts (up to 7 kb)
of heteroloaous DNA can be accommodated. These inserts can be incorporated
into the
viral DNA by direct ligation or by homologous recombination with a co-
transfected
plasmid. In an exemplary system, the essential El gene is deleted from the
viral vector,
and the virus will not replicate unless the E1 gene is provided by the host
cell (e.g., the
human 293 cell line). When intravenously administered to intact animals,
adenovirus
primarily targets the liver. If the adenoviral delivery system has an E1 gene
deletion,
the virus cannot replicate in the host cells. However, the host's tissue
(e.g., liver) will
express and process (and, if a signal sequence is present, secrete) the
heterologous
1 o protein. Secreted proteins will enter the circulation in the highly
vascularized liver, and
effects on the infected animal can be determined.
An alternative method of gene delivery comprises removing cells from
the body and introducing a vector into the cells as a naked DNA plasmid. The
transformed cells are then re-implanted in the body. Naked DNA vectors are
introduced
into host cells by methods known in the art, including transfection,
electroporation,
microinjection, transduction, cell fusion, DEAF dextran, calcium phosphate
precipitation, use of a gene gun, or use of a DNA vector transporter. See, Wu
et al., J.
Biol. Cl2enZ. 263:14621-14624, 1988; Wu et al., J. Biol. Chem. 267:963-967,
1992; and
Johnston and Tang, Metl2. Cell Biol. 43:353-365, 1994.
2 0 Transgenic mice, engineered to express a zalpha48 gene, and mice that
exhibit a complete absence of zalpha48 gene function, referred to as "knockout
mice"
(Snouwaert et al., Science 257:1083, 1992), can also be generated (Lowell et
al., Nature
366:740-742, 1993). These mice can be employed to study the zalpha48 gene and
the
protein encoded thereby in an in vivo system. Transgenic mice are particularly
useful
2 5 for investigating the role of zalpha48 proteins in early development in
that they allow
the identification of developmental abnormalities or blocks resulting from the
over- or
underexpression of a specific factor. See also, Maisonpierre et al., Scier2ce
277:55-60,
1997 and Hanahan, Science 277:48-50, 1997. Exemplary promoters for transgenic
expression include promoters from metallothionein and albumin genes.
3 0 Antisense methodology can be used to inhibit zalpha48 gene
transcription to examine the effects of such inhibition in vivo.
Polynucleotides that are
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
complementary to a segment of a zalpha48-encoding polynucleotide (e.g., a
polynucleotide as set forth in SEQ >D NO:1 ) are designed to bind to zalpha48-
encoding
mRNA and to inhibit translation of such mRNA. Such antisense oliaonucleotides
can
also be used to inhibit expression of zalpha48 polypeptide-encoding genes in
cell
5 culture.
Most four-helix bundle cytokines as well as other proteins produced by
activated lymphocytes play an important biological role in cell
differentiation,
activation, recruitment and homeostasis of cells throughout the body. Zalpha48
and
inhibitors of zalpha48 activity are expected to have a variety of therapeutic
applications.
10 These therapeutic applications include treatment of diseases which require
immune
regulation, including autoimmune diseases such as rheumatoid arthritis,
multiple
sclerosis. myasthenia gravis, systemic lupus erythematosis, and diabetes.
Zalpha48 may
be important in the regulation of inflammation, and therefore would be useful
in treating
rheumatoid arthritis, asthma and sepsis. There may be a role of zalpha48 in
mediating
15 tumorgenesis, whereby a zalpha48 antagonist would be useful in the
treatment of
cancer. Zalpha48 may be useful in modulating the immune system, whereby
zalpha48
and zalpha48 antagonists may be used for reducing graft rejection, preventing
graft-vs-
host disease, boosting immunity to infectious diseases, treating
immunocompromised
patients (e.g., HN+ patients), or in improving vaccines.
2 0 Zalpha48 polypeptides can be administered alone or in combination with
other vasculogenic or angiogenic agents, including VEGF. When using zalpha48
in
combination with an additional agent, the two compounds can be administered
simultaneously or sequentially as appropriate for the specific condition being
treated.
For pharmaceutical use, zalpha48 proteins are formulated for topical or
25 parenteral, particularly intravenous or subcutaneous, delivery according to
conventional
methods. In general, pharmaceutical formulations will include a zalpha48
polypeptide
in combination with a pharmaceutically acceptable vehicle, such as saline,
buffered
saline, 5% dextrose in water, or the like. Formulations may further include
one or more
excipients, preservatives, solubilizers, buffering agents, albumin to prevent
protein loss
3 0 on vial surfaces, etc. Methods of formulation are well known in the art
and are
disclosed, for example, in Remington: The Science a~zd Practice of Pharmacy.
Gennaro,
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
36
ed.. Mack Publishing Co., Easton, PA, 19th ed., 1995. Zalpha48 will preferably
be used
in a concentration of about 10 to 100 ~tg/ml of total volume, although
concentrations in
the range of 1 ng/ml to 1000 ~g/ml may be used. For topical application, such
as for the
promotion of wound healing, the protein will be applied in the range of 0.1-10
~tg/cm~
of wound area, with the exact dose determined by the clinician according to
accepted
standards, taking into account the nature and severity of the condition to be
treated,
patient traits, etc. Determination of dose is within the level of ordinary
skill in the art.
Dosing is daily or intermittently over the period of treatment. Intravenous
administration will be by bolus injection or infusion over a typical period of
one to
several hours. Sustained release formulations can also be employed. In
general, a
therapeutically effective amount of zalpha48 is an amount sufficient to
produce a
clinically significant change in the treated condition, such as a clinically
significant
change in hematopoietic or immune function, a significant reduction in
morbidity, or a
significantly increased histological score.
Zalpha48 proteins, agonists, and antagonists are useful for modulating
the expansion, proliferation, activation, differentiation, migration, or
metabolism of
responsive cell types, which include both primary cells and cultured cell
lines. Of
particular interest in this regard are hematopoietic cells (including stem
cells and mature
myeloid and lymphoid cells), endothelial cells, smooth muscle cells,
fibroblasts, and
2 0 hepatocytes. Zalpha48 polypeptides are added to tissue culture media for
these cell
types at a concentration of about 10 pg/ml to about 100 ng/ml. Those skilled
in the art
will recognize that zalpha48 proteins can be advantageously combined with
other
growth factors in culture media.
Within the laboratory research field, zalpha48 proteins can also be used
2 5 as molecular weight standards or as reagents in assays for determining
circulating levels
of the protein, such as in the diagnosis of disorders characterized by over-
or under-
production of zalpha48 protein or in the analysis of cell phenotype.
Zalpha48 proteins can also be used to identify inhibitors of their activity.
Test compounds are added to the assays disclosed above to identify compounds
that
3 o inhibit the activity of zalpha48 protein. In addition to those assays
disclosed above,
samples can be tested for inhibition of zalpha48 activity within a variety of
assays
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
37
designed to measure receptor binding or the stimulation/inhibition of zalpha48-
dependent cellular responses. For example, zalpha48-responsive cell lines can
be
transfected with a reporter gene construct that is responsive to a zalpha48-
stimulated
cellular pathway. Reporter gene constructs of this type are known in the art,
and will
generally comprise a zalpha48-activated serum response element (SRE) operably
linked
to a gene encoding an assayable protein, such as luciferase. Candidate
compounds,
solutions, mixtures or extracts are tested for the ability to inhibit the
activity of zalpha48
on the target cells as evidenced by a decrease in zalpha48 stimulation of
reporter gene
expression. Assays of this type will detect compounds that directly block
zalpha48
1 o binding to cell-surface receptors, as well as compounds that block
processes in the
cellular pathway subsequent to receptor-ligand binding. In the alternative,
compounds
or other samples can be tested for direct blocking of zalpha48 binding to
receptor using
zalpha48 tagged with a detectable label (e.g., ~~~I, biotin, horseradish
peroxidase, FTTC,
and the like). Within assays of this type, the ability of a test sample to
inhibit the
binding of labeled zalpha48 to the receptor is indicative of inhibitory
activity, which can
be confirmed through secondary assays. Receptors used within binding assays
may be
cellular receptors or isolated, immobilized receptors.
As used herein, the term "antibodies" includes polyclonal antibodies,
monoclonal antibodies, antigen-binding fragments thereof such as F(ab')~ and
Fab
2 0 fragments, single chain antibodies. and the like, including genetically
engineered
antibodies. Non-human antibodies may be humanized by grafting non-human CDRs
onto human framework and constant regions, or by incorporating the entire non-
human
variable domains (optionally "cloaking" them with a human-like surface by
replacement
of exposed residues, wherein the result is a ''veneered" antibody). In some
instances,
2 5 humanized antibodies may retain non-human residues within the human
variable region
framework domains to enhance proper binding characteristics. Through
humanizing
antibodies, biological half-life may be increased, and the potential for
adverse immune
reactions upon administration to humans is reduced. One skilled in the art can
generate
humanized antibodies with specific and different constant domains (i.e.,
different Ig
3 0 subclasses) to facilitate or inhibit various immune functions associated
with particular
antibody constant domains. Antibodies are defined to be specifically binding
if they
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
38
bind to a zalpha48 polypeptide or protein with an affinity at least 10-fold
greater than
the binding affinity to control (non-zalpha48) polypeptide or protein. The
affinity of a
monoclonal antibody can be readily determined by one of ordinary skill in the
art (see,
for example, Scatchard, Ann. NYAcad. Sci. 51: 660-67?, 1949).
Methods for preparing polyclonal and monoclonal antibodies are well
known in the art (see for example, Hurrell, J. G. R., Ed., Monoclonal
Hvbridoma
Antibodies: Tech~ziques and Applications, CRC Press, Inc., Boca Raton, FL,
198?). As
would be evident to one of ordinary skill in the art, polyclonal antibodies
can be
generated from a variety of warm-blooded animals such as horses, cows, goats,
sheep,
dogs, chickens, rabbits, mice, and rats. The immunogenicity of a zalpha48
polypeptide
may be increased through the use of an adjuvant such as alum (aluminum
hvdroxidej or
Freund's complete or incomplete adjuvant. Polypeptides useful for immunization
also
include fusion polypeptides, such as fusions of a zalpha48 polypeptide or a
portion
thereof with an immunoglobulin polypeptide or with maltose binding protein.
The
polypeptide immunogen may be a full-length molecule or a portion thereof. If
the
polypeptide portion is "hapten-like", such portion may be advantageously
joined or
linked to a macromolecular carrier (such as keyhole limpet hemocyanin (KLH),
bovine
serum albumin (BSA) or tetanus toxoid) for immunization.
Alternative techniques for generating or selecting antibodies include in
2 0 vitro exposure of lymphocytes to zalpha48 polypeptides, and selection of
antibody
display libraries in phage or similar vectors (e.g., through the use of
immobilized or
labeled zalpha48 polypeptide). Human antibodies can be produced in transgenic,
non-
human animals that have been engineered to contain human immunoglobulin genes
as
disclosed in WIPO Publication WO 98/24893. It is preferred that the endogenous
2 5 immunoglobulin genes in these animals be inactivated or eliminated, such
as by
homologous recombination.
A variety of assays known to those skilled in the art can be utilized to
detect antibodies which specifically bind to zalpha48 polypeptides. Exemplary
assays
are described in detail in Ai2tibodies: A Laboratory Manual, Harlow and Lane
(Eds.),
3 0 Cold Spring Harbor Laboratory Press, 1988. Representative examples of such
assays
include: concurrent immunoelectrophoresis, radio-immunoassays, radio-
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
39
immunoprecipitations, enzyme-linked immunosorbent assays (ELISA), dot blot
assays,
Western blot assays, inhibition or competition assays, and sandwich assays.
Antibodies to zalpha48 may be used for affinity purification of the
protein, within diagnostic assays for determining circulating levels of the
protein; for
detecting or quantitating soluble zalpha48 polypeptide as a marker of
underlying
pathology or disease; for immunolocalization within whole animals or tissue
sections,
including immunodiagnostic applications; for immunohistochemisty ; and as
antagonists to block protein activity in vitro and in viva. Antibodies to
zalpha48 may
also be used for tagging cells that express zalpha48; for affinity
purification of zalpha48
polypeptides and proteins; in analytical methods employing FACS; for screening
expression libraries; and for generating anti-idiotypic antibodies. For
example.
antibodies to zalpha48 can be used to tai pancreatic islet cells or cells from
adrenal
gland, testis, or ovary. Anti-idiotypic antibodies can be linked to other
compounds,
including therapeutic and diagnostic agents, using known methods, to provide
for
targetting of those compounds to cells expressing receptors for zalpha48.
Antibodies of
the present invention may also be directly or indirectly conjugated to drugs,
toxins,
radionuclides and the like as disclosed below, and these conjugates used for
in vivo
diagnostic or therapeutic applications (e.g., inhibition of cell proliferation
j or for in
vitro diagnosis. See, in general. Ramakrishnan et al.. Cancer Res. 56:1324-
1330. 1996.
2 0 Polypeptides and proteins of the present invention can be used to identify
and isolate receptors. Zalpha48 receptors may be involved in growth regulation
in the
liver, blood vessel formation, and other developmental processes. For example,
zalpha48 proteins and polypeptides can be immobilized on a column, and
membrane
preparations run over the column (as generally disclosed in Immobilized
Affinity
LiQand Techniques, Hermanson et al., eds., Academic Press, San Diego, CA,
1992,
pp.195-202). Proteins and polypeptides can also be radiolabeled (Methods
Enzymol.,
vol. 182, "Guide to Protein Purification", M. Deutscher, ed., Academic Press,
San
Diego, 1990; 721-737j or photoaffinity labeled (Brunner et al., Ann. Rev.
Biochem.
62:483-514, 1993 and Fedan et al., Biochena. Pharmacol. 33:1167-1180, 1984)
and used
3 0 to tag specific cell-surface proteins. In a similar manner, radiolabeled
zalpha48 proteins
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
and polypeptides can be used to clone the cognate receptor in binding assays
using cells
transfected with an expression cDNA library.
The present invention also provides reagents for use in diagnostic
applications. For example, the zalpha48 gene, a probe comprising zalpha48 DNA
or
5 RNA, or a subsequence thereof can be used to determine the presence of
mutations at or
near the zalpha48 locus. Detectable chromosomal aberrations at the zalpha48
gene
locus include, but are not limited to, aneuploidy, gene copy number changes,
insertions,
deletions, restriction site changes, and rearrangements. These aberrations can
occur
within the coding sequence, within introns, or within flanking sequences,
including
10 upstream promoter and regulatory regions, and may be manifested as physical
alterations within a coding sequence or changes in gene expression level.
Analytical
probes will generally be at least 20 nucleotides in length, although somewhat
shorter
probes (14-17 nucleotides) can be used. PCR primers are at least ~ nucleotides
in
length, commonly 15 or more nt, and more often 20-30 nt. Short polynucleotides
can be
15 used when a small region of the gene is targetted for analysis. For gross
analysis of
genes, a polynucleotide probe may comprise an entire exon or more. Probes will
Qenerally comprise a polynucleotide linked to a signal-generating moiety such
as a
radionucleotide. In General, these diagnostic methods comprise the steps of
(a)
obtaining a genetic sample from a patient; (b) incubating the genetic sample
with a
2 0 polynucleotide probe or primer as disclosed above, under conditions
wherein the
polynucleotide will hybridize to complementary polynucleotide sequence, to
produce a
first reaction product; and (c) comparing the first reaction product to a
control reaction
product. A difference between the first reaction product and the control
reaction
product is indicative of a genetic abnormality in the patient. Genetic samples
for use
2 5 within the present invention include genomic DNA, cDNA, and RNA. The
polynucleotide probe or primer can be RNA or DNA, and will comprise a portion
of
SEQ ID NO:1, the complement of SEQ ID NO:I, or an RNA equivalent thereof.
Suitable assay methods in this regard include molecular genetic techniques
known to
those in the art, such as restriction fragment length polymorphism (RFLP)
analysis,
3 0 short tandem repeat (STR) analysis employing PCR techniques, ligation
chain reaction
(Barany, PCR Methods and Applications 1:5-16, 1991), ribonuclease protection
assays,
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
41
and other genetic linkage analysis techniques known in the art (Sambrook et
al., ibid.;
Ausubel et. al., ibid.; A.J. Marian, Chest 108:255-6~, 1995). Ribonuclease
protection
assays (see, e.g., Ausubel et al., ibid., ch. 4) comprise the hybridization of
an RNA
probe to a patient RNA sample, after which the reaction product (RNA-RNA
hybrid) is
exposed to RNase. Hybridized regions of the RNA are protected from digestion.
Within PCR assays, a patient genetic sample is incubated with a pair of
polynucleotide
primers, and the region between the primers is amplified and recovered.
Changes in
size or amount of recovered product are indicative of mutations in the
patient. Another
PCR-based technique that can be employed is single strand conformational
polymorphism (SSCP) analysis (Hayashi, PCR Methods and Applications 1:34-38,
1991 ).
Radiation hybrid mapping is a somatic cell genetic technique developed
for constructing high-resolution, contiguous maps of mammalian chromosomes
(Cox et
al., Science 250:245-50, 1990). Partial or full knowledge of a gene's sequence
allows
one to design PCR primers suitable for use with chromosomal radiation hybrid
mapping
panels. Radiation hybrid mapping panels that cover the entire human genome are
commercially available, such as the Stanford G3 RH Panel and the GeneBridge 4
RH
Panel (Research Genetics, Inc., Huntsville, AL). These panels enable rapid,
PCR-based
chromosomal localizations and ordering of genes, sequence-tagged sites (STSs),
and
2 0 other nonpolymorphic and polymorphic markers within a region of interest,
and the
establishment of directly proportional physical distances between newly
discovered
genes of interest and previously mapped markers. The precise knowledge of a
gene's
position can be useful for a number of purposes, including: 1 ) determining if
a sequence
is part of an existing contig and obtaining additional surrounding genetic
sequences in
2 5 various forms, such as YACs, BACs or cDNA clones; 2) providing a possible
candidate gene for an inheritable disease which shows linkage to the same
chromosomal
region; and 3) cross-referencing model organisms, such as mouse, which may aid
in
determining what function a particular gene might have.
Sequence tagged sites (STSs) can also be used independently for
3 0 chromosomal localization. An STS is a DNA sequence that is unique in the
human
genome and can be used as a reference point for a particular chromosome or
region of a
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
42
chromosome. An STS is defined by a pair of oligonucleotide primers that are
used in a
polymerase chain reaction to specifically detect this site in the presence of
all other
genomic sequences. Since STSs are based solely on DNA sequence they can be
completely described within an electronic database, for example. Database of
Sequence
Tagged Sites (dbSTS), GenBank (National Center for Biological Information,
National
Institutes of Health, Bethesda, MD http://www.ncbi.nlm.nih.gov), and can be
searched
with a gene sequence of interest for the mapping data contained within these
short
aenomic landmark STS sequences.
Zalpha48 polynucleotides can also be used as probes for analyzing cells
and tissues. Zalpha48 mRNA is found at relatively high levels in pancreas
(particularly
pancreatic islet cells) and adrenal gland, with lower levels of expression in
testis and
ovary. Thus, zalpha48 mRNA levels provide a useful reference standard for
study of
these cells and tissues, such as within investigations of physiological
states. High level
expression in other tissues or cells may be indicative of metabolic
abnormalities,
including malignant transformation.
The polypeptides, nucleic acid and/or antibodies of the present invention
may be used in diagnosis or treatment of disorders associated with cell loss
or abnormal
cell proliferation (including cancer). Labeled zalpha48 polypeptides may be
used for
imaging tumors or other sites of abnormal cell proliferation.
2 0 Inhibitors of zalpha48 activity (zalpha48 antagonists) include anti-
zalpha48 antibodies and soluble zalpha48 receptors, as well as other peptidic
and non-
peptidic agents (including ribozymes). Such antagonists can be used to block
the effects
of zalpha48 on cells or tissues. Of particular interest is the use of
antagonists of
zalpha48 activity in cancer therapy. As early detection methods improve it
becomes
2 5 possible to intervene at earlier times in tumor development, making it
feasible to use
inhibitors of growth factors to block cell proliferation, angiogenesis, and
other events
that lead to tumor development and metastasis. Inhibitors are also expected to
be useful
in adjunct therapy after surgery to prevent the growth of residual cancer
cells. Inhibitors
can also be used in combination with other cancer therapeutic agents.
3 0 In addition to antibodies, zalpha48 inhibitors include small molecule
inhibitors and inactive receptor-binding fragments of zalpha48 polypeptides.
Inhibitors
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
43
are formulated for pharmaceutical use as generally disclosed above, taking
into account
the precise chemical and physical nature of the inhibitor and the condition to
be treated.
The relevant determinations are within the level of ordinary skill in the
formulation art.
Polynucleotides encoding zalpha48 polypeptides are useful within gene
therapy applications where it is desired to increase or inhibit zalpha48
activity. If a
mammal has a mutated or absent zalpha48 gene, a zalpha48 gene can be
introduced into
the cells of the mammal. In one embodiment, a gene encoding a zalpha48
polypeptide
is introduced in vivo in a viral vector. Such vectors include an attenuated or
defective
DNA virus, such as, but not limited to, herpes simplex virus (HSV~,
papillomavirus,
Epstein Barr virus (EBV), adenovirus, adeno-associated virus (AAV), and the
like.
Defective viruses, which entirely or almost entirely lack viral genes. are
preferred. A
defective virus is not infective after introduction into a cell. Use of
defective viral
vectors allows for administration to cells in a specific, localized area,
without concern
that the vector can infect other cells. Examples of particular vectors
include, but are not
limited to, a defective herpes simplex virus 1 (HSV 1 ) vector (Kaplitt et
al., Molec. Cell.
Neurosci. 2:320-330, 1991); an attenuated adenovirus vector, such as the
vector
described by Stratford-Perricaudet et al., J. Clin. Invest. 90:626-630, 1992;
and a
defective adeno-associated virus vector (Samulski et al., J. Virol. 61:3096-
3101, 1987;
Samulski et al., J. Virol. 63:3822-3888, 1989). Within another embodiment, a
zalpha48
2 0 gene can be introduced in a retroviral vector as described, for example,
by Anderson et
al., U.S. Patent No. 5,399,346; Mann et al. Cell 33:153, 1983; Temin et al.,
U.S. Patent
No. 4,650,764; Temin et al., U.S. Patent No. 4,980,289; Markowitz et al., J.
Virol.
62:1120, 1988; Temin et al., U.S. Patent No. 5,124,263; Dougherty et al., WIPO
Publication WO 95/07358; and Kuo et al., Blood 82:845, 1993. Alternatively,
the
vector can be introduced by liposome-mediated transfection ("lipofection").
Synthetic
cationic lipids can be used to prepare liposomes for in vivo transfection of a
gene
encoding a marker (Felgner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417,
1987;
Mackey et al., Proc. Natl. Acad. Sci. USA 85:8027-8031, 1988). The use of
lipofection
to introduce exogenous genes into specific organs in vivo has certain
practical
3 0 advantages, including molecular targeting of liposomes to specific cells.
Directing
transfection to particular cell types is particularly advantageous in a tissue
with cellular
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
44
heterogeneity, such as the pancreas, liver, kidney, and brain. Lipids may be
chemically
coupled to other molecules for the purpose of targeting. Peptidic and non-
peptidic
molecules can be coupled to liposomes chemically. Within another embodiment,
cells
are removed from the body, a vector is introduced into the cells as a naked
DNA
plasmid, and the transformed cells are re-implanted into the body as disclosed
above.
Antisense methodology can be used to inhibit zalpha48 gene
transcription in a patient as generally disclosed above.
Zalpha48 polypeptides and anti-zalpha48 antibodies can be directly or
indirectly conjugated to drugs, toxins, radionuclides and the like, and these
conjugates
used for in vivo diagnostic or therapeutic applications. For instance,
polypeptides or
antibodies of the present invention may be used to identify or treat tissues
or organs that
express a corresponding anti-complementary molecule (receptor or antigen,
respectively, for instance). More specifically, zalpha48 polypeptides or anti-
zalpha48
antibodies, or bioactive fragments or portions thereof, can be coupled to
detectable or
cytotoxic molecules and delivered to a mammal having cells, tissues, or organs
that
express the anti-complementary molecule.
Suitable detectable molecules can be directly or indirectly attached to the
polypeptide or antibody, and include radionuclides, enzymes, substrates,
cofactors,
inhibitors, fluorescent markers, chemiluminescent markers, magnetic particles,
and the
2 0 like. Suitable cytotoxic molecules can be directly or indirectly attached
to the
polypeptide or antibody, and include bacterial or plant toxins (for instance,
diphtheria
toxin, Pseudomonas exotoxin, ricin, abrin, saporin, and the like), as well as
therapeutic
radionuclides, such as iodine-131, rhenium-188 or yttrium-90. These can be
either
directly attached to the polypeptide or antibody, or indirectly attached
according to
2 5 known methods, such as through a chelating moiety. Polypeptides or
antibodies can
also be conjugated to cytotoxic drugs, such as adriamycin. For indirect
attachment of a
detectable or cytotoxic molecule, the detectable or cytotoxic molecule may be
conjugated with a member of a complementary/anticomplementary pair, where the
other
member is bound to the polypeptide or antibody portion. For these purposes,
3 0 biotin/streptavidin is an exemplary complementary/anticomplementary pair.
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
Polypeptide-toxin fusion proteins or antibody/fragment-toxin fusion
proteins may be used for targeted cell or tissue inhibition or ablation, such
as in cancer
therapy. Of particular interest in this regard are conjugates of a zalpha48
polypeptide
and a cytotoxin, which can be used to target the cytotoxin to a tumor or other
tissue that
5 is undergoing undesired angiogenesis or neovascularization. Target cells
(i.e., those
displaying the zalpha48 receptor) bind the zalpha48-toxin conjugate, which is
then
internalized, killing the cell. The effects of receptor-specific cell killing
(target
ablation) are revealed by changes in whole animal physiology or through
histological
examination. Thus, ligand-dependent, receptor-directed cyotoxicity can be used
to
10 enhance understanding of the physiological significance of a protein
ligand. A preferred
such toxin is saporin. Mammalian cells have no receptor for saporin, which is
non-
toxic when it remains extracellular.
In another embodiment, zalpha48-cytokine fusion proteins or
antibody/fragment-cytokine fusion proteins may be used for enhancing in vitro
15 cytotoxicity (for instance, that mediated by monoclonal antibodies against
tumor
targets) and for enhancing in vivo killing of target tissues (for example,
blood and bone
marrow cancers). See, generally, Hornick et al., Blood 89:4437-4447, 1997). In
general, cytokines are toxic if administered systemically. The described
fusion proteins
enable targeting of a cytokine to a desired site of action, such as a cell
having binding
2 0 sites for zalpha48, thereby providing an elevated local concentration of
cvtokine.
Suitable cytokines for this purpose include, for example, interleukin-2 and
granulocyte-
macrophage colony-stimulating factor (GM-CSF). Such fusion proteins may be
used to
cause cytokine-induced killing of tumors and other tissues undergoing
angiogenesis or
neovascularization.
25 The bioactive polypeptide or antibody conjugates described herein can be
delivered intravenously, intra-arterially or intraductally, or may be
introduced locally at
the intended site of action.
In view of the unique combinations of specific physical and chemical
properties embodied in zalpha48 polynucleotides and polypeptides, the
polynucleotides
3 0 and polypeptides of the present invention will additionally find use as
educational tools
as, for example, laboratory kits for courses related to genetics, molecular
biology,
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
46
protein chemistry, antibody production and analysis, and the like. Such kits
will
optionally contain one or more of an instruction sheet, a sheet of
specifications, one or
more standards or controls, and additional reagents. Kits may also contain
various
combinations of zalpha48 polynucleotides, polypeptides, and antibodies. Due to
their
unique polynucleotide and polypeptide sequences, molecules of zalpha48 can be
used as
standards or as "unknowns" for testing purposes. For example, zalpha48
polynucleotides can be used to teach a student how to prepare expression
constructs for
bacterial, viral, and/or mammalian expression, including fusion constructs,
wherein the
zalpha48 gene is to be expressed; for determining the restriction endonuclease
cleavage
sites of the polynucleotides (which cleavage sites will be evident to those
skilled in the
art from the sequences disclosed herein); for determining mRNA and DNA
localization
of zalpha48 polynucleotides in tissues (e.g., by Northern blotting, Southern
blotting, or
polymerase chain reaction); and for identifying related polynucleotides and
polypeptides
by nucleic acid hybridization. Zalpha48 polypeptides can be used in teaching
preparation of antibodies, identification of proteins by Western blotting,
protein
purification, determination of the mass of expressed zalpha48 polypeptides as
a ratio to
total protein expressed, identification of peptide cleavage sites, coupling of
amino- and
carboxyl-terminal tags, amino acid sequence analysis, as well as, but not
limited to,
monitoring biological activities of both the native and tagged protein (i.e.,
receptor
binding, signal transduction, proliferation. and differentiation) in vitro and
in vivo.
Zalpha48 polypeptides can also be used to teach analytical skills such as mass
spectrometry; circular dichroism to determine conformation, in particular the
locations
of the disulfide bonds; x-ray crystallography to determine the three-
dimensional
structure in atomic detail; and nuclear magnetic resonance spectroscopy to
reveal the
2 5 structure of proteins in solution. For example, a kit containing a
zalpha48 polypeptide
can be given to the student to analyze in order to develop or test the
student's skills.
Since the amino acid sequence and other properties of the polypeptide would be
known
by the instructor, the instructor would then know whether or not the student
has
correctly analyzed the polypeptide. Antibodies that specifically bind to
zalpha48
3 o polypeptides can be used, for example, as teaching aids to instruct
students how to
prepare affinity chromatography columns to purify zalpha48 polypeptides and
how to
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
47
perform immunological assays and histological analysis. Anti-zalpha48
antibodies can
also be used as tools in the cloning and sequencing of a polynucleotide that
encodes an
antibody and are thus useful for teaching a student how to design humanized
antibodies.
Such kits are considered within the scope of the present invention.
The invention is further illustrated by the following non-limiting
examples.
Examples
Example 1
RNA extracted from human pancreatic islet cells was reverse
transcribed. The first strand cDNA reaction contained 10 ~tl of human
pancreatic islet
cell poly d(T)-selected poly (A)+ mRNA (Clontech Laboratories, Inc., Palo
Alto, CA)
at a concentration of 1.0 mg/ml, and 2 ~1 of 20 pmole/~l first strand primer
SEQ ID
N0:6, containing an Xho I restriction site. The mixture was heated at
70°C for 2.5
minutes and cooled by chilling on ice. First strand cDNA synthesis was
initiated by the
addition of 8 ~tl of first strand buffer (~x SUPERSCRIPTT"" buffer; Life
Technologies,
Gaithersburg, MD), 4 ~tl of 100 mM dithiothreitol, and 3 X11 of a
deoxynucleotide
triphosphate (dNTP) solution containing 10 mM each of dTTP, dATP, dGTP and 5-
methyl-dCTP (Pharmacia LKB Biotechnology, Piscataway, NJ) to the RNA-primer
2 0 mixture. The reaction mixture was incubated at 40° C for 2 minutes,
followed by the
addition of 10 ~l of 200 U/~1 RNase H- reverse transcriptase (SUPERSCRIPT II~~
Life
Technologies). The efficiency of the first strand synthesis was analyzed in a
parallel
reaction by the addition of 10 ~tCi of 32P-adCTP to a 5 ~tl aliquot from one
of the
reaction mixtures to label the reaction products for analysis. The reaction
mixtures
were incubated at 40°C for 5 minutes, 45°C for 50 minutes, then
50°C for 10 minutes.
Unincorporated 32P-adCTP in the mixture was removed by chromatography on a 400
pore size gel filtration column (Clontech Laboratories). The unincorporated
nucleotides
and primers in the unlabeled first strand reaction mixtures were removed by
chromatography on 400 pore size gel filtration column. The length of labeled
first
3 0 strand cDNA was determined by agarose gel electrophoresis.
CA 02381794 2002-02-11
WO 01/12665 PCTNS00/22714
48
The second strand reaction contained 102 ~tl of the unlabeled first strand
cDNA, 30 ~tl of 5x polymerase I buffer (125 mM Tris:HCl, pH 7.5, 500 mM KCI,
25
mM MgCI,, 50mM (NH.~)~SO,~), 2.0 ~1 of 100 mM dithiothreitol, 3.0 q1 of a
solution
containing 10 mM of each deoxynucleotide triphosphate, 7 ~l of 5 mM (3-NAD,
2.0 ~l
of 10 U/~l E. coli DNA lipase (New England Biolabs; Beverly, MA), 5 ~l of 10
U/ql E.
coli DNA polymerase I (New England Biolabs), and 1.5 ~tl of 2 U/~l RNase H
(Life
Technologies). A 10-~1 aliquot from one of the second strand synthesis
reactions was
labeled by the addition of 10 ~Ci 32P-adCTP to monitor the efficiency of
second strand
synthesis. The reactions were incubated at 16°C for two hours, followed
by the addition
of 1 ~1 of a 10 mM dNTP solution and 6.0 ~tl T4 DNA polvmerase ( 10 U/~1,
Boehringer
Mannheim. Indianapolis, IN), and incubated for an additional 10 minutes at
16°C.
Unincorporated 32P-adCTP was removed by chromatography through a 400 pore size
gel filtration column before analysis by agarose Qel electrophoresis. The
reaction was
terminated by the addition of 10.0 ~l 0.5 M EDTA and extraction with
phenol/chloroform and chloroform followed by ethanol precipitation in the
presence of
3.0 M Na acetate and 2 ~tl of a dye-labeled carrier (Pellet PaintT"' Co-
Precipitant;
Novagen, Madison, WI). The yield of cDNA was estimated to be approximately 2
~g
from starting mRNA template of 10 fig.
Eco RI adapters were ligated onto the 5' ends of the cDNA to enable
cloning into an expression vector. A 12.5 ~l aliquot of cDNA (~2.0 fig) and 3
q1 of 69
pmole/~tl of Eco RI adapter (Pharmacia LKB Biotechnology Inc.) were mixed with
2.5
~I lOx lipase buffer (660 mM Tris-HCl pH 7.5, 100 mM M~CI~), 2.5 u1 of 10 mM
ATP,
3.5 ~1 0.1 M DTT and 1 ~l of 15 U/~1 T4 DNA lipase (Promega Corp., Madison,
WI).
The mixture was incubated 1 hour at 5°C, 2 hours at 7.5°C, 2
hours at 10°C, 2 hours at
12.5°C, and 16 hours at 10°C. The reaction was terminated by the
addition of 65 ~tl
HBO and 10 ~tl lOX H buffer (Boehringer Mannheim, Indianapolis, IN) and
incubation
at 70°C for 20 minutes.
To facilitate the directional cloning of the cDNA into an expression
vector, the cDNA was digested with Xho I, resulting in a cDNA having a 5' Eco
RI
3 0 cohesive end and a 3' Xho I cohesive end. The Xho I restriction site at
the 3' end of the
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
49
cDNA had been previously introduced. Restriction enzyme digestion was carried
out in
a reaction mixture by the addition of 1.0 ~tl of 40 U/~tl Xho I (Boehringer
Mannheim,
Indianapolis, IN) with incubation at 37°C for 45 minutes. The reaction
was terminated
by incubation at 70°C for 20 minutes and chromatography through a 400
pore size gel
filtration column.
The cDNA was ethanol precipitated, washed with 70% ethanol, air-dried
and resuspended in 10.0 u1 water, 2 p1 of lOX kinase buffer (660 mM Tris-HCI,
pH 7.5,
100 mM MgCI~), 0.5 p1 0.1 M DTT, 2 ~1 10 mM ATP, 2 p1 T4 polynucleotide kinase
( 10 U/~1, Life Technologies). Following incubation at 37° C for 30
minutes, the cDNA
was ethanol precipitated in the presence of 2.~ M ammonium acetate, and
electrophoresed on a 0.8% low melt agarose gel. The contaminating adapters and
cDNA below 0.6 Kb in length were excised from the gel. The electrodes were
reversed,
and the cDNA was electrophoresed until concentrated near the lane origin. The
area of
the gel containing the concentrated cDNA was excised and placed in a microfuge
tube,
and the approximate volume of the gel slice was determined. An aliquot of
water
approximately three times the volume of the gel slice (300 p1) and 35 ~l lOx
~i-agarase I
buffer (New England Biolabs) was added to the tube, and the agarose was melted
by
heating to 65°C for 15 minutes. Following equilibration of the sample
to 45°C, 3 ~l of
1 U/~l (3-agarase I (New England Biolabs, Beverly, MA) was added, and the
mixture
2 0 was incubated for 60 minutes at 45°C to digest the agarose. After
incubation, 40 p1 of 3
M Na acetate was added to the sample, and the mixture was incubated on ice for
15
minutes. The sample was centrifuged at 14,000 x g for 15 minutes at room
temperature
to remove undigested agarose. The cDNA was ethanol precipitated, washed in 70%
ethanol, air-dried and resuspended in 40 p1 water.
2 5 Following recovery from the gel, the cDNA was cloned into the Eco RI
and Xho I sites of a commercially available phagemid vector (pBluescript~
SK(+);
Stratagene, La Jolla, CA) and electroporated into E. coli host cells
(Electromax
DH10BTM cells; Life Technologies, Inc.). Bacterial colonies containing known
sequences were identified and eliminated from sequence analysis by reiterative
cycles of
3 0 probe hybridization to high-density colony filter arrays (Genome Systems,
St. Louis,
MI). cDNAs of known genes were pooled in groups of 50 - 100 inserts and were
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
labeled with 3''P-adCTP using a commercially available labeling kit
(MegaprimeT°''
DNA labeling system; Amersham, Arlington Heights, IL,). Colonies which did not
hybridize to the probe mixture were selected for sequencing. Sequencing was
done
using an automated DNA sequencer (ABI PRISMTM 377; PE Applied Biosystems,
S Foster City, CA) using either the T3 or the reverse primer. The resulting
data were
analyzed, and a database of partial sequences (ESTs) was prepared.
The pancreatic EST database was analyzed using a quasi-threading
method to identify assemblies of contiguous sequences that comprised a
predicted
secretory signal, an alpha-helical region, and an in-frame stop codon upstream
of the
10 predicted intiation Met. One such assembly was identified. A corresponding
cDNA
clone was recovered from the library and sequenced. Analysis indicated that
the clone
contained a full-length cDNA encoding a secreted polypeptide of 151 amino acid
residues (SEQ ID NO:1 and SEQ ID N0:2).
15 Example 2
An expression plasmid containing all or part of a polynucleotide
encoding zalpha48 is constructed via homologous recombination. A fragment of
zalpha48 cDNA is isolated by PCR using the polynucleotide sequence of SEQ B7
NO: 1
with flanking regions at the 5" and 3' ends corresponding to the vector
sequences
2 0 flanking the zalpha48 insertion point. The primers for PCR each include
from 5' to 3'
end: 40 by of flanking sequence from the vector and 17 by corresponding to the
amino
and carboxyl termini from the open reading frame of zalpha48.
Ten ~1 of the 100 ~1 PCR reaction mixture is run on a 0.8% low-melting-
temperature agarose (SeaPlaque GTG~; FMC BioProducts, Rockland, ME) gel with 1
2 5 x TBE buffer for analysis. The remaining 90 ~ul of the reaction misture is
precipitated
with the addition of 5 ~l 1 M NaCI and 250 E.tl of absolute ethanol. The
plasmid
pZMP6, which has been cut with SmaI, is used for recombination with the PCR
fragment. Plamid pZMP6 is a mammalian expression vector containing an
expression
cassette having the cytomegalovirus immediate early promoter, multiple
restriction sites
3 o for insertion of coding sequences, a stop codon, and a human growth
hormone
terminator; an E. coli origin of replication: a mammalian selectable marker
expression
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
51
unit comprising an SV40 promoter, enhancer and origin of replication, a DHFR
gene,
and the SV40 terminator; and URA3 and CEN-ARS sequences required for selection
and replication in S. cerevisiae. It was constructed from pZP9 (deposited at
the
American Type Culture Collection, 10801 University Boulevard, Manassas, VA
20110-
2209, under Accession No. 98668) with the yeast genetic elements taken from
pRS316
(deposited at the American Type Culture Collection, 10801 University
Boulevard,
Manassas, VA 20110-2209, under Accession No. 77145), an internal ribosome
entry
site (IRES) element from poliovirus, and the extracellular domain of CD8
truncated at
the C-terminal end of the transmembrane domain.
One hundred microliters of competent yeast (S. cerevisiae) cells are
independently combined with 10 u1 of the various DNA mixtures from above and
transferred to a 0.2-cm electroporation cuvette. The yeast/DNA mixtures are
electropulsed using power supply (BioRad Laboratories, Hercules, CA) settings
of 0.75
kV (5 kV/cm), ~ ohms, 25 ~F. To each cuvette is added 600 ~ l of 1.2 M
sorbitol, and
the yeast is plated in two 300-~1 aliquots onto two URA-D plates and incubated
at
30°C. After about 48 hours, the Ura+ yeast transformants from a single
plate are
resuspended in 1 ml HBO and spun briefly to pellet the yeast cells. The cell
pellet is
resuspended in 1 ml of lysis buffer (2% Triton X-100, 1 % SDS, 100 mM NaCI, 10
mM
Tris, pH 8.0, 1 mM EDTA). Five hundred microliters of the lysis mixture is
added to
2 0 an Eppendorf tube containing 300 u1 acid-washed glass beads and 200 ~1
phenol-
chloroform, vortexed for 1 minute intervals two or three times, and spun for 5
minutes
in an Eppendorf centrifuge at maximum speed. Three hundred microliters of the
aqueous phase is transferred to a fresh tube, and the DNA is precipitated with
600 ~1
ethanol (EtOH), followed by centrifugation for 10 minutes at 4°C. The
DNA pellet is
2 5 resuspended in 10 ~ l H20.
Transformation of electrocompetent E. coli host cells (Electromax
DH10BTM cells; obtained from Life Technologies, Inc., Gaithersburg, MD) is
done with
0.5-2 ml yeast DNA prep and 40 ~l of cells. The cells are electropulsed at 1.7
kV, 25
~F, and 400 ohms. Following electroporation, 1 ml SOC (2% BactoTM Tryptone
(Difco,
3 0 Detroit, MI), 0.5% yeast extract (Difco), 10 mM NaCI, 2.5 mM KCI, 10 mM
MgCh, 10
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
52
mM MgSO.~, 20 mM glucose) is plated in 250-ul aliquots on four LB AMP plates
(LB
broth (Lennox), 1.8% BactoT"' Agar (Difco), 100 mg/L Ampicillin).
Individual clones harboring the correct expression construct for zalpha48
are identified by restriction digest to verify the presence of the zalpha48
insert and to
confirm that the various DNA sequences have been joined correctly to one
another. The
inserts of positive clones are subjected to sequence analysis. Larger scale
plasmid DNA
is isolated using a commercially available kit (QIAGEN Plasmid Maxi Kit,
Qiagen,
Valencia, CA) according to manufacturer's instructions. The correct construct
is
designated pZMP6/zalpha48.
Example 3
CHO DG44 cells (Chasm et al., Sons. Cell. Molec. Genet. 12:555-666,
1986) are plated in 10-cm tissue culture dishes and allowed to grow to
approximately
50% to 70% confluency overnight at 37°C, 5% C02, in Ham's F12/FBS media
(Ham's
F12 medium (Life Technologies), 5% fetal bovine serum (Hyclone, Logan, UT), 1%
L-
glutamine (JRH Biosciences, Lenexa, KS), 1 % sodium pyruvate (Life
Technologies)).
The cells are then transfected with the plasmid zalpha48/pZMP6 by liposome-
mediated
transfection using a 3:1 (w/w) liposome formulation of the polycationic lipid
2,3-
dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propaniminium-
2 0 trifluoroacetate and the neutral lipid dioleoyl phosphatidylethanolamine
in membrane-
filetered water (LipofectamineT"'' Reagent, Life Technologies), in serum free
(SF) media
formulation (Ham's F12, 10 mg/ml transferrin, 5 mg/ml insulin, 2 mg/ml fetuin,
1 % L-
glutamine and 1 % sodium pyruvate). Zalpha48/pZMP6 is diluted into 15-ml tubes
to a
total final volume of 640 ~1 with SF media. 35 ~l of LipofectamineTM is mixed
with
605 ~l of SF medium. The resulting mixture is added to the DNA mixture and
allowed
to incubate approximately 30 minutes at room temperature. Five ml of SF media
is
added to the DNA:LipofectamineTM mixture. The cells are rinsed once with 5 ml
of SF
media, aspirated, and the DNA:LipofectamineT"' mixture is added. The cells are
incubated at 37°C for five hours, then 6.4 ml of Ham's F12/10% FBS, 1%
PSN media is
3 0 added to each plate. The plates are incubated at 37°C overnight,
and the
DNA:LipofectamineT~' mixture is replaced with fresh 5% FBS/Ham's media the
next
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
53
day. On day 3 post-transfection, the cells are split into T-175 flasks in
growth medium.
On day 7 postransfection, the cells are stained with FITC-anti-CD8 monoclonal
antibody (Pharmingen, San Diego, CA) followed by anti-FITC-conjugated magnetic
beads (Miltenyi Biotec). The CD8-positive cells are separated using
commercially
available columns (mini-MACS columns; Miltenyi Biotec) according to the
manufacturer's directions and put into DMEM/Ham's F12/5% FBS without
nucleosides
but with 50 nM methotrexate (selection medium).
Cells are plated for subcloning at a density of 0.5, 1 and 5 cells per well
in 96-well dishes in selection medium and allowed to grow out for
approximately two
weeks. The wells are checked for evaporation of medium and brought back to 200
~l
per well as necessary during this process. When a lame percentage of the
colonies in the
plate are near confluency, 100 ~1 of medium is collected from each well for
analysis by
dot blot. and the cells are fed with fresh selection medium. The supernatant
is applied to
a nitrocellulose filter in a dot blot apparatus, and the filter is treated at
100°C in a
vacuum oven to denature the protein. The filter is incubated in 625 mM Tris-
glycine,
pH 9.1, 5mM (3-mercaptoethanol, at 65°C, 10 minutes, then in 2.5% non-
fat dry milk
Western A Buffer (0.25% gelatin, 50 mM Tris-HCl pH 7.4, 150 mM NaCI, 5 mM
EDTA, 0.05% Igepal CA-630) overnight at 4°C on a rotating shaker. The
filter is
incubated with the antibody-HRP conjugate in 2.5% non-fat dry milk Western A
buffer
2 0 for 1 hour at room temperature on a rotating shaker. The filter is then
washed three
times at room temperature in PBS plus 0.01 % Tween 20, 15 minutes per wash.
The
filter is developed with chemiluminescence reagents (ECLTM direct labelling
kit;
Amersham Corp., Arlington Heights, IL) according to the manufacturer's
directions and
exposed to film (Hyperfilm ECL, Amersham Corp.) for approximately 5 minutes.
2 5 Positive clones are trypsinized from the 96-well dish and transferred to 6-
well dishes in
selection medium for scaleup and analysis by Western blot.
Example 4
Full-length zalpha48 protein is produced in BHK cells transfected with
3 o pZMP6/zalpha48 (Example 2). BHK 570 cells (ATCC CRL-10314) are plated in
10-
cm tissue culture dishes and allowed to grow to approximately 50 to 70%
confluence
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
54
overnight at 37°C, 5% CO~, in DMEM/FBS media (DMEM, GibcoBRL High
Glucose;
Life Technologies), 5% fetal bovine serum (Hyclone, Logan, UT), 1 mM L-
glutamine
(JRH Biosciences, Lenexa, KS), 1 mM sodium pyruvate (Life Technologies). The
cells
are then transfected with pZMP6/zalpha48 by liposome-mediated transfection
(using
LipofectamineTM; Life Technologies), in serum free (SF) media (DMEM
supplemented
with 10 mg/ml transferrin, 5 mg/ml insulin, 2 mg/ml fetuin, 1 % L-glutamine
and 1 %
sodium pyruvate). The plasmid is diluted into 15-ml tubes to a total final
volume of
640 ~1 with SF media. 35 ~l of the lipid mixture is mixed with 605 ~l of SF
medium,
and the resulting mixture is allowed to incubate approximately 30 minutes at
room
temperature. Five milliliters of SF media is then added to the DNA:lipid
mixture. The
cells are rinsed once with 5 ml of SF media, aspirated, and the DNA:lipid
mixture is
added. The cells are incubated at 37°C for five hours, then 6.4 ml of
DMEM/10% FBS,
1 % PSN media is added to each plate. The plates are incubated at 37°C
overnight, and
the DNA:lipid mixture is replaced with fresh 5% FBS/DMEM media the next day.
On
day 5 post-transfection, the cells are split into T-162 flasks in selection
medium
(DMEM + 5% FBS, 1 % L-Gln, 1 % NaPyr, 1 ~M methotrexate). Approximately 10
days post-transfection, two 150-mm culture dishes of methotrexate-resistant
colonies
from each transfection are trypsinized, and the cells are pooled and plated
into a T-162
flask and transferred to large-scale culture.
Example 5
For construction of adenovirus vectors, the protein coding region of
human zalpha48 is amplified by PCR using primers that add PmeI and AscI
restriction
sites at the 5' and 3' termini respectively. Amplification is performed with a
full-length
zalpha48 cDNA template in a PCR reaction as follows: one cycle at 95°C
for ~ minutes;
followed by 15 cycles at 95°C for 1 min., 61 °C for 1 min., and
72°C for 1.5 min.;
followed by 72°C for 7 min.; followed by a 4°C soak. The PCR
reaction product is
loaded onto a 1.2% low-melting-temperature agarose gel in TAE buffer (0.04 M
Tris-
acetate, 0.001 M EDTA). The zalpha48 PCR product is excised from the gel and
3 0 purified using a commercially available kit comprising a silica gel
mambrane spin
column (QIAquickT"" PCR Purification Kit and gel cleanup kit; Qiagen, Inc.) as
per kit
CA 02381794 2002-02-11
WO 01/12665 PCTNS00/22714
instructions. The PCR product is then digested with PmeI and AscI,
phenol/chloroform
extracted, EtOH precipitated, and rehydrated in 20 ml TE (Tris/EDTA pH 8). The
zalpha48 fragment is then ligated into the PmeI-AscI sites of the transgenic
vector
pTGl2-8 and transformed into E. coli DH10BT"' competent cells by
electroporation.
5 Vector pTGl2-8 was derived from p2999B4 (Palmiter et al., Mol. Cell Biol.
13:5266-
5275, 1993) by insertion of a rat insulin II intron (ca. 200 bp) and
polylinker (Fse I/Pme
I/Asc I) into the Nru I site. The vector comprises a mouse metallothionein (MT-
1 )
promoter (ca. 750 bp) and human growth hormone (hGH) untranslated region and
polyadenylation signal (ca. 650 bp) flanked by 10 kb of MT-1 5' flanking
sequence and
10 7 kb of MT-1 3' flanking sequence. The cDNA is inserted between the insulin
II and
hGH sequences. Clones containing zalpha48 are identified by plasmid DNA
miniprep
followed by digestion with PmeI and AscI. A positive clone is sequenced to
insure that
there were no deletions or other anomalies in the construct.
DNA is prepared using a commercially available kit (Maxi Kit, Qiagen,
15 Inc.), and the zalpha48 cDNA is released from the pTGl2-8 vector using PmeI
and AscI
enzymes. The cDNA is isolated on a 1 % low melting temperature agarose gel and
excised from the gel. The gel slice is melted at 70°C, and the DNA is
extracted twice
with an equal volume of Tris-buffered phenol, precipitated with EtOH, and
resuspended
in 10 ~l HBO.
2 0 The zalpha48 cDNA is cloned into the EcoRV-AscI sites of a modified
pAdTrack-CMV (He, T-C. et al., Pnoc. Natl. Acad. Sci. USA 95:2509-2514, 1998).
This construct contains the green fluorescent protein (GFP) marker gene. The
CMV
promoter driving GFP expression is replaced with the SV40 promoter, and the
SV40
polyadenylation signal is replaced with the human growth hormone
polyadenylation
25 signal. In addition, the native polylinker is replaced with FseI, EcoRV,
and AscI sites.
This modified form of pAdTrack-CMV is named pZyTrack. Ligation is performed
using a commercially available DNA libation and screening kit (Fast-LinkT""
kit;
Epicentre Technologies, Madison, WI). Clones containing zalpha48 are
identified by
digestion of mini prep DNA with FseI and AscI.
3 0 In order to linearize the plasmid, approximately 5 ~g of the resulting
pZyTrack zalpha48 plasmid is digested with PmeI. Approximately 1 ~g of the
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
56
linearized plasmid is cotransformed with 200 ng of supercoiled pAdEasy (He et
al.,
ibid.) into E. coli BJ5183 cells (He et al., ibid.). The co-transformation is
done using a
Bio-Rad Gene Pulser at 2.5 kV, 200 ohms and 25 ~Fa. The entire co-
transformation
mixture is plated on 4 LB plates containing 2~ ~g/ml kanamycin. The smallest
colonies
are picked and expanded in LB/kanamycin, and recombinant adenovirus DNA is
identified by standard DNA miniprep procedures. The recombinant adenovirus
miniprep DNA is transformed into E. coli DH10BT"' competent cells, and DNA is
prepared using a Maxi Kit (Qiagen, Inc.) aaccording to kit instructions.
Approximately 5 ~g of recombinant adenoviral DNA is digested with
PacI enzyme (New England Biolabs) for 3 hours at 37°C in a reaction
volume of 100 ~tl
containing 20-30U of PacI. The digested DNA is extracted twice with an equal
volume
of phenol/chloroform and precipitated with ethanol. The DNA pellet is
resuspended in
101 distilled water. A T25 flask of QBI-293A cells (Quantum Biotechnologies,
Inc.
Montreal, Qc. Canada), inoculated the day before and grown to 60-70%
confluence, is
transfected with the PacI digested DNA. The PacI-digested DNA is diluted up to
a total
volume of 50 ~tl with sterile HBS (150mM NaCI, 20mM HEPES). In a separate
tube,
~l of lmglml N-[1-(2,3-Dioleoyloxy)propyl]-N,N,N-trimethyl-ammonium salts
(DOTAP) (Boehringer Mannheim, Indianapolis, IN) is diluted to a total volume
of 100
~tl with HBS. The DNA is added to the DOTAP, mixed gently by pipeting up and
2 0 down, and left at room temperature for 1 ~ minutes. The media is removed
from the
293A cells and washed with 5 ml serum-free minimum essential medium (MEM)
alpha
containing 1mM sodium pyruvate, 0.1 mM MEM non-essential amino acids, and 25mM
HEPES buffer (reagents obtained from Life Technologies, Gaithersburg, MD). 5
ml of
serum-free MEM is added to the 293A cells and held at 37°C. The
DNA/lipid mixture
2 5 is added drop-wise to the T25 flask of 293A cells, mixed gently, and
incubated at 37°C
for 4 hours. After 4 hours the media containing the DNA/lipid mixture is
aspirated off
and replaced with 5 ml complete MEM containing 5% fetal bovine serum. The
transfected cells are monitored for GFP expression and formation of foci
(viral plaques).
Seven days after transfection of 293A cells with the recombinant
3 0 adenoviral DNA, the cells express the GFP protein and start to form foci
(viral
"plaques"). The crude viral lysate is collected using a cell scraper to
collect all of the
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
57
293A cells. The lysate is transferred to a 50-ml conical tube. To release most
of the
virus particles from the cells, three freeze/thaw cycles are done in a dry
ice/ethanol bath
and a 37° waterbath.
The crude lysate is amplified (Primary ( 1 °) amplification) to
obtain a
working "stock" of zalpha48 rAdV lysate. Ten lOcm plates of nearly confluent
(80-
90%) 293A cells are set up 20 hours previously, 200 ml of crude rAdV lysate is
added
to each 10-cm plate, and the cells are monitored for 48 to 72 hours for CPE
(cytopathic
effect) under the white light microscope and expression of GFP under the
fluorescent
microscope. When all of the 293A cells show CPE, this 1 ° stock lysate
is collected and
1 o freeze/thaw cycles performed as described above.
A secondary (2°) amplification of zalpha48 rAdV is then performed.
Twenty 1 ~-cm tissue culture dishes of 293A cells are prepared so that the
cells are 80-
90% confluent. All but 20 ml of 5% MEM media is removed, and each dish is
inoculated with 300-500 ml of the 1 ° amplified rAdv lysate. After 48
hours the 293A
cells are lysed from virus production, the lysate is collected into 250-ml
polypropylene
centrifuge bottles, and the rAdV is purified.
NP-40 detergent is added to a final concentration of 0.5% to the bottles
of crude lysate in order to lyse all cells. Bottles are placed on a rotating
platform for 10
minutes agitating as fast as possible without the bottles falling over. The
debris is
pelleted by centrifugation at 20,000 X G for l~ minutes. The supernatant is
transferred
to 250-ml polycarbonate centrifuge bottles, and 0.~ volume of 20% PEG8000/2.5
M
NaCI solution is added. The bottles are shaken overnight on ice. The bottles
are
centrifuged at 20,000 X G for 15 minutes, and the supernatant is discarded
into a bleach
solution. Using a sterile cell scraper, the white, virus/PEG precipitate from
2 bottles is
2 5 resuspended in 2.5 ml PBS. The resulting virus solution is placed in 2-ml
microcentrifuge tubes and centrifuged at 14,000 X G in the microcentrifuge for
10
minutes to remove any additional cell debris. The supernatant from the 2-ml
microcentrifuge tubes is transferred into a 15-ml polypropylene snapcap tube
and
adjusted to a density of 1.34 g/ml with CsCI. The solution is transferred to
3.2-ml,
3 0 polycarbonate, thick-walled centrifuge tubes and spun at 348,000 X G for 3-
4 hours at
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
58
25°C. The virus forms a white band. Using wide-bore pipette tips, the
virus band is
collected.
A commercially available ion-exchange columns (e.g., PD-10 columns
prepacked with Sephadex~ G-25M; Pharmacia Biotech, Piscataway, NJ) is used to
desalt the virus preparation. The column is equilibrated with 20 ml of PBS.
The virus
is loaded and allowed to run into the column. 5 ml of PBS is added to the
column, and
fractions of 8-10 drops are collected. The optical densities of 1:50 dilutions
of each
fraction are determined at 260 nm on a spectrophotometer. Peak fractions are
pooled,
and the optical density (OD) of a 1:25 dilution is determined. OD is converted
to virus
concentration using the formula: (OD at 260nm)(25)(1.1 x 10~~) = virions/ml.
To store the virus, glycerol is added to the purified virus to a final
concentration of 15%, mixed gently but effectively, and stored in aliquots at -
80°C.
A protocol developed by Quantum Biotechnologies, Inc. (Montreal,
Canada) is followed to measure recombinant virus infectivity. Briefly, two 96-
well
tissue culture plates are seeded with 1 X 10~ 293A cells per well in MEM
containing 2%
fetal bovine serum for each recombinant virus to be assayed. After 24 hours 10-
fold
dilutions of each virus from 1X10-~ to 1X10-~4 are made in MEM containing 2%
fetal
bovine serum. 100 ~tl of each dilution is placed in each of 20 wells. After 5
days at
37°C, wells are read either positive or negative for CPE, and a value
for "Plaque
2 0 Forming Units/ml" (PFU) is calculated.
An adenovirus vector comprising the human zalpha48 coding sequence
was constructed essentially as disclosed above and designated AdZyAlpha48.
Example 6
2 5 Analysis of tissue distribution was performed by the Northern blotting
technique using commercially available blots of human RNA (Human Multiple
Tissue
Northern Blots; Clontech Laboratories, Inc., Palo Alto, CA). A probe was
obtained by
restriction digest of a human zalpha48 clone with EcoRI and XhoI, resulting in
a cDNA
fragment of 470 bp. The fragment was gel-purified, labeled with 3'P, and
purified using
3 0 commercially available reagents and standard procedures. Hybridization was
carried out
using standard procedures and reagents, with washing in 0.1 x SSC and 0.1 %
SDS at
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
59
55°C. The blots were exposed to film for three days at -80°C.
One major transcript size
was observed on the blots at ~1.4 - 1.5 kb. The signal was strongest in
pancreas and
adrenal gland, with a weaker signal in testis and ovary.
From the foregoing, it will be appreciated that, although specific
embodiments of the invention have been described herein for purposes of
illustration,
various modifications may be made without deviating from the spirit and scope
of the
invention. Accordingly, the invention is not limited except as by the appended
claims.
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
SEQUENCE LISTING
<110> ZymoGenetics, Inc.
<120> HELICAL CYTOKINE ZALPHA48
<130> 99-54PC
<160> 6
<170> FastSEQ for Windows Version 3.0
<210>1
<211>1214
<212>DNA
<213>Homo sapiens
<220>
<221> CDS
<222> (192)...(647)
<400> 1
cggggtccgcggaggtgaggggccgggtccagcgccagcggctcctcccg cctcccctcc60
cctcccccgccccgcgctccgtccccctcccccgctgactttctctccgg ccccccgcgc120
cccttctctcgcagcgagcccagctctcggcgcgtgtcggagtctcccag ccccgcggcc180
ccgagcgcacg atg gga ccc cac ccc ctc ctg ggg ctg 230
cgc ggg ctc ctg
Met Arg Gly Pro His Pro Leu Leu Gly Leu
Gly Leu Leu
1 5 10
ctg gtg ctg ggg gcg gcg ggg cgc ggc cgg ggg ggc gcg gag ccc cgg 278
Leu Val Leu Gly Ala Ala Gly Arg Gly Arg Gly Gly Ala Glu Pro Arg
15 20 25
gag ccg gcg gac gga cag gcg ctg ctg cgg ctg gtg gtg gaa ctc gtc 326
Glu Pro Ala Asp Gly Gln Ala Leu Leu Arg Leu Val Val Glu Leu Val
30 35 40 45
cag gag ctg cgg aag cac cac tcg gcg gag cac aag ggc ctg cag ctc 374
Gln Glu Leu Arg Lys His His Ser Ala Glu His Lys Gly Leu Gln Leu
50 55 60
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
ctc ggg cgg gac tgc gcc ctg ggc cgc gcg gag gcg gcg ggg ctg ggg 422
Leu Gly Arg Asp Cys Ala Leu Gly Arg Ala Glu Ala Ala Gly Leu Gly
65 70 75
cct tcg ccg gag cag cga gtg gaa att gtt cct cga gat ctg agg atg 470
Pro Ser Pro Glu Gln Arg Ual Glu Ile Ual Pro Arg Asp Leu Arg Met
80 85 90
aag gac aag ttt cta aaa cac ctt aca ggc cct ctt tat ttt agt cca 518
Lys Asp Lys Phe Leu Lys His Leu Thr Gly Pro Leu Tyr Phe Ser Pro
95 100 105
aag tgc agc aaa cac ttc cat aga ctt tat cac aac acc aga gac tgc 566
Lys Cys Ser Lys His Phe His Arg Leu Tyr His Asn Thr Arg Asp Cys
110 115 120 125
acc att cct gca tac tat aaa aga tgc gcc agg ctt ctt acc cgg ctg 614
Thr Ile Pro Ala Tyr Tyr Lys Arg Cys Ala Arg Leu Leu Thr Arg Leu
130 135 140
get gtc agt cca gtg tgc atg gag gat aag tga gcagaccgta caggagcagc 667
Ala Ual Ser Pro Ual Cys Met Glu Asp Lys
145 150
acaccaggagccatgagaagtgccttggaaaccaacagggaaacagaactatctttatac727
acatcccctcatggacaagagatttatttttgcagacagactcttccataagtcctttga787
gttttgtatgttgttgacagtttgcagatatatattcgataaatcagtgtacttgacagt847
gttatctgtcacttatttaaaaaaaaaacacaaaaggaatgctccacatttgacgtgtag907
tgctataaaacacagaatatttcattgtcttcattaggtgaaatcgcaaaaaatatttct967
ttagaaacataagcagaatcttaaagtatattttcatataacataatttgatattctgta1027
ttactttcactgttaaattctcagagtattatttggaacggcatgaaaaattaaaatttc1087
ggtcatgttttagagacagtggagtgtaaatctgtggctaattctgttggtcgtttgtat1147
tataaatgtaaaatagtattccagctattgtgcaatatgtaaatagtgtaaataaacaca1207
agtaata 1214
<210>2
<211>151
<212>PRT
<213>Homo sapiens
<400> 2
Met Arg Gly Pro Gly His Pro Leu Leu Leu Gly Leu Leu Leu Ual Leu
1 5 10 15
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
3
Gly Ala Ala Gly Arg Gly Arg Gly Gly Ala Glu Pro Arg Glu Pro Ala
20 25 30
Asp Gly Gln Ala Leu Leu Arg Leu Ual Ual Glu Leu Ual Gln Glu Leu
35 40 45
Arg Lys His His Ser Ala Glu His Lys Gly Leu Gln Leu Leu Gly Arg
50 55 60
Asp Cys Ala Leu Gly Arg Ala Glu Ala Ala Gly Leu Gly Pro Ser Pro
65 70 75 80
Glu Gln Arg Ual Glu Ile Ual Pro Arg Asp Leu Arg Met Lys Asp Lys
85 90 95
Phe Leu Lys His Leu Thr Gly Pro Leu Tyr Phe Ser Pro Lys Cys Ser
100 105 110
Lys His Phe His Arg Leu Tyr His Asn Thr Arg Asp Cys Thr Ile Pro
115 120 125
Ala Tyr Tyr Lys Arg Cys Ala Arg Leu Leu Thr Arg Leu Ala Ual Ser
130 135 140
Pro Ual Cys Met Glu Asp Lys
145 150
<210> 3
<211> 151
<212> PRT
<213> Artificial Sequence
<220>
<223> variant protein
<221> VARIANT
<222> (34)...(48)
<223> Xaa = Leu. Ile, Ual. Met, Phe, Trp. Gly or Ala
<221> VARIANT
<222> (70)...(70)
<223> Xaa = Arg. Leu, Ile, Ual, Met. Phe, Trp. Gly or
Ala
<221> VARIANT
<222> (73)...(77)
<223> Xaa = Leu, Ile, Ual, Met, Phe, Trp, Gly or Ala
<221> VARIANT
<222> (80)...(80)
<223> Xaa = Pro, Leu, Ile, Ual, Met, Phe, Trp, Gly or
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
4
Ala
<221> VARIANT
<222> (81)...(81)
<223> Xaa = Glu, Leu. Ile, Val, Met, Phe. Trp, Gly or
Ala
<221> VARIANT
<222> (84)...(87)
<223> Xaa = Leu. Ile. Val, Met, Phe, Trp, Gly or Ala
<221> VARIANT
<222> (90)...(90)
<223> Xaa = Asp, Leu. Ile, Val, Met. Phe, Trp. Gly or
Ala
<221> VARIANT
<222> (91)...(91)
<223> Xaa = Leu. Ile. Val, Met, Phe, Trp, Gly or Ala
<221> VARIANT
<222> (94)...(94)
<223> Xaa = Lys. Leu, Ile, Val. Met, Phe, Trp. Gly or
Ala
<221> VARIANT
<222> (97)...(127)
<223> Xaa = Leu, Ile. Val, Met. Phe, Trp, Gly or Ala
<221> VARIANT
<222> (130)...(131)
<223> Xaa = Tyr, Leu. Ile. Val, Met. Phe, Trp. Gly or
Ala
<221> VARIANT
<222> (134)...(134)
<223> Xaa = Cys, Leu, Ile. Val. Met, Phe, Trp, Gly or
Ala
<221> VARIANT
<222> (137)...(141)
<223> Xaa = Leu, Ile, Ual, Met, Phe, Trp, Gly or Ala
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
<400> 3
Met Arg Gly Pro Gly His Pro Leu Leu Leu Gly Leu Leu Leu Ual Leu
1 5 10 15
Gly Ala Ala Gly Arg Gly Arg Gly Gly Ala Glu Pro Arg Glu Pro Ala
20 25 30
Asp Xaa Gln Ala Xaa Xaa Arg Leu Xaa Ual Glu Xaa Xaa Gln Glu Xaa
35 40 45
Arg Lys His His Ser Ala Glu His Lys Gly Leu Gln Leu Leu Gly Arg
50 55 60
Asp Cys Ala Leu Gly Xaa Ala Glu Xaa Xaa Gly Leu Xaa Pro Ser Xaa
65 70 75 80
Xaa Gln Arg Xaa Glu Ile Xaa Pro Arg Xaa Xaa Arg Met Xaa Asp Lys
85 90 95
Xaa Xaa Lys His Xaa Thr Gly Pro Leu Tyr Phe Ser Pro Lys Cys Ser
100 105 110
Lys His Phe His Arg Leu Tyr His Asn Thr Arg Asp Cys Thr Xaa Pro
115 120 125
Ala Xaa Xaa Lys Arg Xaa Ala Arg Xaa Xaa Thr Arg Xaa Ala Ual Ser
130 135 140
Pro Ual Cys Met Glu Asp Lys
145 150
<210> 4
<211> 453
<212> DNA
<213> Artificial Sequence
<220>
<223> degenerate sequence
<221> misc_feature
<222> (1). .(453)
<223> n = A,T,C or G
<400> 4
atgmgnggnccnggncayccnytnytnytnggnytnytnytngtnytnggngcngcnggn60
mgnggnmgnggnggngcngarccnmgngarccngcngayggncargcnytnytnmgnytn120
gtngtngarytngtncargarytnmgnaarcaycaywsngcngarcayaarggnytncar180
ytnytnggnmgngaytgygcnytnggnmgngcngargcngcnggnytnggnccnwsnccn240
garcarmgngtngarathgtnccnmgngayytnmgnatgaargayaarttyytnaarcay300
ytnacnggnccnytntayttywsnccnaartgywsnaarcayttycaymgnytntaycay360
aayacnmgngaytgyacnathccngcntaytayaarmgntgygcnmgnytnytnacnmgn420
ytngcngtnwsnccngtntgyatggargayaar 453
CA 02381794 2002-02-11
WO 01/12665 PCT/US00/22714
6
<210> 5
<211> 6
<212> PRT
<213> Artificial Sequence
<220>
<223> peptide tag
<400> 5
Glu Tyr Met Pro Met Glu
1 5
<210> 6
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> oligonucleotide primer
<400> 6
gtctgggttc gctactcgag gcggccgcta tttttttttt tttttttt 48
