Note: Descriptions are shown in the official language in which they were submitted.
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
COLOR SAFE LAUNDRY METHODS EMPLOYING
ZWITTERIONIC FORMULATION COMPONENTS
Field of the Invention
The present invention relates to zwitterionic organic catalyst compound bleach
systems
and methods for using such bleach systems to provide increased color safety
during laundering of
fabrics, especially colored fabrics. More particularly, this invention relates
to bleach systems
comprising zwitterionic, quaternary imine bleach boosting compounds,
zwitterionic, quaternary
oxaziridinium bleaching species and mixtures thereof, and methods employing
such bleach
systems in the laundering of fabrics, especially colored fabrics.
Background of the Invention
Oxygen bleaching agents have become increasingly popular in recent years in
household
and personal care products to facilitate stain and soil removal. Bleaches are
particularly desirable
for their stain-removing, dingy fabric cleanup, whitening and sanitization
properties. Oxygen
bleaching agents have found particular acceptance in laundry products such as
detergents, in
automatic dishwashing products and in hard surface cleansers. Oxygen bleaching
agents,
however, are somewhat limited in their effectiveness. Some frequently
encountered
disadvantages include color damage on fabrics and damage to laundry
appliances, specifically
rubber hoses these appliances may contain. In addition, oxygen bleaching
agents tend to be
extremely temperature rate dependent. Thus, the colder the solution in which
they are employed,
the less effective the bleaching action. Temperatures in excess of 60
°C are typically required for
effectiveness of an oxygen bleaching agent in solution.
To solve the aforementioned temperature rate dependency, a class of compounds
known
as "bleach activators" has been developed. Bleach activators, typically
perhydrolyzable acyl
compounds having a leaving group such as oxybenzenesulfonate, react with the
active oxygen
group, typically hydrogen peroxide or its anion, to form a more effective
peroxyacid oxidant. It is
the peroxyacid compound which then oxidizes the stained or soiled substrate
material. However,
bleach activators are also somewhat temperature dependent. Bleach activators
are more effective
at warm water temperatures of from about 40 °C to about 60 °C.
In water temperatures of less
than about 40 °C, the peroxyacid compound loses some of its bleaching
effectiveness.
1
WO Ol/iG278 CA 02381924 2002-02-13 pCT~JS00/23321
U.S. Patent Nos. 5,576,282 and 5,817,614 both to Miracle et al. disclose
attempts at
developing bleach systems comprising zwitterionic organic catalyst compounds
which are
effective in lower temperature water conditions and are relatively safe on
colors. Although the
bleach systems disclosed in this patent provide enhanced color-safety over
traditional organic
catalyst bleach systems, such as cationic, organic catalyst bleach systems
examples of which are
disclosed in U.S. Patent Nos. 5,360,568, 5,360,569, 5,370,826 and 5,482,515
all to Madison et al.,
consumers desire more color-safe bleach products.
A serious disadvantage associated with methods of using conventional organic
catalysts,
examples of which are described in U.S. Patent Nos. 5,360,568, 5,360,569 and
5,370,826 all to
Madison et al., and U.S. Patent Nos. 5,576,282 and 5,817,614, both to Miracle
et al., is that such
organic catalysts are used at too high an in-use concentration. For example,
the method used in
U.S. Patent No. 5,482,515 describes a method wherein the oxygen transfer agent
(an organic
catalyst compound) is present from about 0.01 ppm to 300 ppm, with the
preferred concentration
range from 5 ppm to about 100 ppm per liter of medium. Such a concentration
can result in
unacceptable color damage to fabric dyes. In addition, such a high
concentration can lead to too
much available oxygen ("Av0") consumption, leading to an altered performance
profile (i.e.,
changing the balance between peracid bleaching and organic catalyst
bleaching). It may be
possible to increase stain bleaching performance with increased organic
catalyst concentration but
only at the cost of dye damage and at some point the dye damage becomes
unacceptable.
Accordingly, there is a need to maximize the ratio of stain bleaching
performance to dye damage
of the organic catalyst bleach systems.
In light of the foregoing, it is evident that there still exists a need for
zwitterionic organic
catalyst compound bleach systems and laundry methods employing such
zwitterionic organic
catalyst compound bleach systems that provide effective bleaching in lower
temperature water
conditions and provide superior color-safety properties compared to the
laundry methods
employing the organic catalyst bleach systems disclosed in the prior art, as
discussed above; and
there is a need to maximize the ratio of stain bleaching performance to dye
damage of the organic
catalyst bleach systems.
Summary of the Invention
The present invention fulfills the need discussed above. The present invention
provides
zwitterionic organic catalyst compound bleach systems and methods for
laundering fabrics,
especially colored fabrics, employing such bleach systems.
The zwitterionic organic catalyst compounds of the present invention, and
bleach systems
comprising such zwitterionic organic catalyst compounds provide increased
bleaching
2
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
effectiveness in lower temperature wash applications while providing improved
color safety,
resulting in increased bleaching effectiveness and color safety as compared to
conventional
zwitterionic and cationic organic catalyst bleach systems. The zwitterionic
organic catalyst
compound bleach systems of the present invention act in conjunction with or
without, preferably
with, conventional peroxygen bleaching sources to provide the above-mentioned
increased
bleaching effectiveness and superior fabric color safety.
More particularly, this invention relates to zwitterionic organic catalyst
compounds such
as zwitterionic, quaternary imine bleach boosting compounds, zwitterionic,
quaternary
oxaziridinium bleaching species, bleach systems comprising such zwitterionic
organic catalyst
compounds and laundry methods employing such bleach systems.
Nonlimiting examples of the benefits provided by the zwitterionic organic
catalyst
compounds and bleach systems employing same include superior bleaching
effectiveness even in
lower temperature water, and improved color safety.
In one aspect of the present invention, a zwitterionic organic catalyst bleach
system which
demonstrates effective bleaching in lower water temperature and provides a
superior color-safety
profile compared to the conventional organic catalyst bleach systems is
provided.
In accordance with another aspect of the present invention, a zwitterionic
organic catalyst
bleach system comprising one or more zwitterionic organic catalyst compounds,
as described
hereinafter, in conjunction with or without a peroxygen source is provided.
In accordance with yet another aspect of the present invention, a zwitterionic
organic
catalyst bleach system comprising one or more zwitterionic organic catalyst
compounds, as
described hereinafter, in conjunction with a peracid is provided.
In accordance with still yet another aspect of the present invention, a method
for
laundering a fabric, especially a colored fabric, in need of laundering
comprising contacting the
fabric with a laundry solution comprising one or more zwitterionic organic
catalyst compound
bleach systems described herein is provided.
In accordance with even still yet another aspect of the present invention, a
bleach system
of the present invention as made by the process comprising:
a) providing a wash solution; and
b) adding to said wash solution a bleach composition comprising an
amount of zwitterionic organic catalyst compound. of the present invention
such that the resulting
concentration of the zwitterionic organic catalyst compound in said wash
solution is from about
0.001 ppm to about 5 ppm, is provided.
Accordingly, it is an object of the present invention to provide: zwitterionic
organic
catalyst compound bleach systems , which demonstrate improved performance even
in lower
3
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
temperature water solutions and improved color safety; and a method for
laundering a fabric,
especially a colored fabric, using one or more of the zwitterionic organic
catalyst compound
bleach systems described herein.
These and other objects, features and advantages of the present invention will
be
recognized by one of ordinary skill in the art from the following description
and the appended
claims.
All percentages, ratios and proportions herein are on a weight basis unless
otherwise
indicated. All documents cited herein are hereby incorporated by reference.
Detailed Description of the Invention
The present invention discloses highly useful zwitterionic organic catalyst
compounds,
bleach systems comprising such zwitterionic organic catalyst compounds, and
methods for
laundering fabrics, especially colored fabrics, employing such bleach systems.
The zwitterionic organic catalyst compounds of the present invention, and
bleach systems
comprising such zwitterionic organic catalyst compounds provide increased
bleaching
effectiveness in lower temperature wash applications while providing improved
color safety,
resulting in increased bleaching effectiveness and color safety as compared to
conventional
cationic and zwitterionic organic catalyst bleach systems. The zwitterionic
organic catalyst
compound bleach systems of the present invention act in conjunction with or
without, preferably
with conventional peroxygen bleaching sources to provide the above-mentioned
increased
bleaching effectiveness and superior fabric color safety.
DEFINITIONS
"Peroxygen source" as used herein means materials that generate peroxygen
compounds,
which can include the peroxygen compounds themselves. Examples include, but
are not limited
to, bleach activators, peracids, percarbonate, perborate, hydrogen peroxide,
bleach boosting
compounds, and/or bleaching species (e.g., oxaziridiniums).
"Peroxygen compounds" as used herein includes peracids and peroxides (e.g.,
hydrogen
peroxide, alkyl hydroperoxides, etc.
"Peracid" as used herein means a peroxyacid such as peroxycarboxylic acid
and/or
peroxymonosulfuric acid (tradname OXONE) and their salts.
ZWITTERIONIC ORGANIC CATALYST COMPOUNDS
The zwitterionic organic catalyst compounds and bleach systems comprising such
zwitterionic organic catalyst compounds of the present invention bleach system
preferably are
employed in methods for laundering fabrics, especially colored fabrics, in
need of laundering.
Such methods typically encompass bleaching a stained substrate, preferably a
colored fabric, in an
4
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
aqueous medium with a peroxygen source and with a zwitterionic organic
catalyst compound
whose structure is as defined hereinafter wherein the aqueous medium contains
active oxygen
from the peroxygen compound from about 0.05 to about 250 ppm per liter of
medium, and the
zwitterionic organic catalyst compound from 0.001 ppm to about 2 ppm,
preferably from about
0.01 ppm to about 2 ppm, more preferably from about 0.1 ppm to about 1.5 ppm,
and most
preferably from about 0.2 ppm to about 1 ppm.
In the bleaching systems of the present invention, when present, the molar
ratio of said
peroxygen compound to zwitterionic organic catalyst compound is preferably
greater than 1:1,
more preferably the molar ratio ranges from about 30,000:1 to about 10:1, even
more preferably
from about 10,000:1 to about 50:1, yet even more preferably from about 5,000:1
to about 100:1,
still even more preferably from about 3,500:1 to about 150:1.
The molar ratio of peroxygen compound to zwitterionic organic catalyst
compound does
influence the color safety properties of a bleach system. However, the ppm
concentration of the
zwitterionic organic catalyst compound in the bleach system is the primary
factor in establishing
the bleach systems' color safety properties.
A product can deliver, for example, in an aqueous medium a 1 ppm concentration
of a
zwitterionic organic catalyst compound with a molecular weight of 300, and a
66 ppm
concentration of NOBS (35 ppm pernonanoic acid assuming 100% perhydrolysis)
and a 66 ppm
concentration of percarbonate (21 ppm hydrogen peroxide) to give a molar ratio
of peroxygen
compound to zwitterionic organic catalyst compound of 246:1. A product which
delivers 240
ppm of TAED (forming 160 ppm of peracetic acid) and 865 ppm of percarbonate
(forming 281
ppm of hydrogen peroxide) gives a molar ratio of peroxygen compound to
zwitterionic organic
catalyst of 3142:1. At 0.25 ppm of zwitterionic organic catalyst compound, the
molar ratio would
be 12568:1.
In addition to the molar ratios of peroxygen compound to zwitterionic organic
catalyst
compound, the bleach systems of the present invention can be characterized by
the molar ratio of
a peracid to zwitterionic organic catalyst compound. Preferably, the molar
ratio of peracid to
zwitterionic organic catalyst compound is greater than 1:1, more preferably
about 5,000:1 to
about 5:1, still even more preferably from about 2,000:1 to about 10:1, and
even from about
1,000:1 to 15:1.
The preferred molar ratios of peracid to zwitterionic organic catalyst
compound vary with
the wash conditions. For example, under European wash conditions (typically
comprising from
about 4500 ppm to 5000 ppm of detergent components in the wash water), the
preferred molar
ratio of peracid to zwitterionic organic catalyst compound is from about
2,000:1 to about 150:1.
Whereas, under North American wash conditions (typically comprising from about
850 ppm to
5
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
about 1000 ppm of detergent components in the wash water), the preferred molar
ratio of peracid
to zwitterionic organic catalyst compound is from about 150:1 to about 5:1.
Yet in addition to the molar ratios of peracid to zwitterionic organic
catalyst compound,
the bleach system of the present invention can be characterized by the molar
ratio of a
hydrophobic peracid to zwitterionic organic catalyst compound, preferably a
hydrophobic
zwitterionic organic catalyst compound. Preferably the molar ratio of the
hydrophobic peracid to
zwitterionic organic catalyst compound is from about 500:1 to about 15:1, more
preferably about
350:1 to about 20:1, still even more preferably from about 200:1 to about
25:1, and even more
preferably from about 100:1 to about 35:1.
Preferably, the zwitterionic organic catalyst compounds of the present
invention, more
preferably the iminium-based zwitterionic organic catalyst compounds of the
present invention,
include, but are not limited to, bleach boosting compounds.
I. Bleach Boostin~Compounds - The bleach boosting compounds, preferably
iminium
based bleach boosting compounds, of the present invention include, but are not
limited to,
1 S aryliminium zwitterions, which have a net charge of from about +3 to about
-3.
Aryliminium Zwitterions - The aryliminium zwitterions, which have a net charge
of from
about +3 to about -3, are represented by the formula [II]:
Rs
R6 N O+
To
R~
[II]
25
where R5-R~ are independently selected from substituted or unsubstituted
radicals selected from
the group consisting of H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl,
heterocyclic ring, silyl, nitro,
halo, cyano, sulfonato, alkoxy, keto, carboxylic, and carboalkoxy radicals;
also present in this
formula is the radical represented by the formula:
- T -zpz0
0
where ZP is covalently bonded to To, and Zp- is selected from the group
consisting of
-C02-, -S03-, -OS03-, -S02- and -OS02- and p is either 1, 2 or 3; To is
selected from the group
consisting of substituted or unsubstituted, saturated or unsaturated alkyl,
cycloalkyl, aryl, alkaryl,
aralkyl, and heterocyclic ring.
6
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
Preferably, the aryliminium zwitterions, which have a net charge of from about
+3 to
about -3, are represented by the formula [XII]:
R2s
/ G~ Rz~
fR26 ~ L~Tm
O
n \ ~ O+ w To Zp
R2s
[XII]
where m is 1 to 3 when G is present and m is I to 4 when G is not present; and
n is an integer
from 0 to 4; each R26 is independently selected from a substituted or
unsubstituted radical
selected from the group consisting of H, alkyl, cycloalkyl, aryl, fused aryl,
heterocyclic ring,
fused heterocyclic ring, nitro, halo, cyano, sulfonato, alkoxy, keto,
carboxylic, and carboalkoxy
radicals, and any two vicinal R26 substituents may combine to form a fused
aryl, fused
carbocyclic or fused heterocyclic ring; R25 may be a substituted or
unsubstituted radical selected
from the group consisting of H, alkyl, cycloalkyl, alkaryl, aryl, aralkyl,
heterocyclic ring, silyl,
nitro, halo, cyano, sulfonato, alkoxy, keto, carboxylic, and carboalkoxy
radicals; also present in
this formula is the radical represented by the formula:
- ,I, -Zp0
0
where ZP is covalently bonded to To, and Zp is selected from the group
consisting of
-C02-, -S03-, -OS03-, -S02- and -OS02- and p is either 1, 2 or 3; To is
selected from the group
consisting of:
R29
-~C)q
R29
wherein q is an integer from 1 to 8; R29 is independently selected from
substituted or
unsubstituted radicals selected from the group consisting of linear or
branched H, alkyl,
cycloalkyl, alkaryl, aryl, aralkyl, alkylene, heterocyclic ring, alkoxy,
arylcarbonyl, carboxyalkyl
and amide groups; G is selected from the group consisting of: (1) -O- ; (2) -
N(R30)-; and (3)
N(R30R31 )-. R27~ R28 R30 and R31 are substituted or unsubstituted radicals
independently
selected from the group consisting of H, oxygen, alkyl, cycloalkyl, alkaryl,
aryl, aralkyl,
7
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
alkylenes, heterocyclic ring, alkoxys, arylcarbonyl groups, carboxyalkyl
groups and amide
groups; any of R25, R26, R27 R28 R30 and R31 may be joined together with any
other of R25,
R26~ R27~ R28~ R30 and R31 to form part of a common ring; any geminal R27 -
R28 may
combine to form a carbonyl; any vicinal R27 - R31 may join to form
unsaturation; and wherein
any one group of substituents R27 - R31 may combine to form a substituted or
unsubstituted
fused unsaturated moiety.
More preferred aryliminium zwitterions, which have a net charge of from about
+3 to
about -3, as represented by the formula [XII], include those of formula [XII]
where R25 is H or
methyl, and for the radical represented by the formula:
- T ~O
0
Zp is -C02-, -S03- or -OS03-, and p is 1 or 2.
Most preferably, the aryliminium zwitterions are represented by the formula
[XIIa]:
OS03~
O R44
' 42
R4 i R43 R
[XIIa]
wherein R41-R44 may be independently selected from a substituted or
unsubstituted radical
selected from the group consisting of H, linear or branched, substituted or
unsubstituted alkyl,
cycloalkyl, alkaryl, aryl, aralkyl, alkylene, alkoxy,radicals, provided that
any of R41-R44 may be
joined together with any other of R41-R44 to form part of a common ring; more
preferred, at least
one, even more preferably two of R41-R44 is H. Most preferably, R41 and/or R44
is a linear or
branched Cl - C16 alkyl or cycloalkyl, even more preferably the sum of the
carbon atoms within
R41 and R44 is from 5-15, most preferably 6-13.
II. Bleaching Species - The bleaching species (oxaziridiniums) may also be
used directly
in accordance with the present invention. The bleaching species of the present
invention include,
but are not limited to, oxaziridinium zwitterions, which have a net charge of
from about +3 to
about -3.
The aryliminium zwitterions of the present invention act in conjunction with a
peroxygen
source, when present, to increase bleaching effectiveness. Without being bound
by theory, it is
believed that the aryliminium zwitterions react with the peroxygen source to
form a more active
bleaching species, a zwitterionic quaternary oxaziridinium compound, as
represented by the
following reaction by way of example:
8
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
Rl 1'
R
Ip
~N~To- ,~-p + RCO~ ~ R N~To-Z~ + RCO
R3 R3
The zwitterionic oxaziridinium compounds can have an increased or preferred
activity at
lower temperatures relative to the peroxygen compound.
Oxaziridinium Zwitterions - The oxaziridinium zwitterions, which have a net
charge of
from about +3 to about -3, are represented by formula [IV]:
R5,
R6, N O+
I ~ .I"o- Z O
O
R
[IV]
where R5~-R~~ are independently selected from substituted or unsubstituted
radicals selected from
the group consisting of H, alkyl, cycloalkyl, aryl, alkaryl, aralkyl,
heterocyclic ring, silyl, nitro,
halo, cyano, sulfonato, alkoxy, keto, carboxylic, and carboalkoxy radicals;
also present in this
formula is the radical represented by the formula:
Q
where Z'p is covalently bonded to T'o, and Z'P- is selected from the group
consisting of -C02-, -
S03-, -OS03-, -S02- and -OS02- and p is either 1, 2 or 3; T'o is selected from
the group
consisting of substituted or unsubstituted, saturated or unsaturated alkyl,
cycloalkyl, aryl, alkaryl,
aralkyl, and heterocyclic ring.
Preferably, the oxaziridinium zwitterions, which have a net charge of from
about +3 to
about -3, are represented by formula [XIV]:
Rzs'
G~ R2~'
[R26'~ I +L~Tm
,O
8250
[XIV]
wherein m is 1 to 3 when G is present and m is 1 to 4 when G is not present;
and n is an integer
from 0 to 4; each R26' is independently selected from a substituted or
unsubstituted radical
9
CA 02381924 2002-02-13
WO 01!16278 PCT/US00/23321
selected from the group consisting of H, alkyl, cycloalkyl, aryl, fused aryl,
heterocyclic ring,
fused heterocyclic ring, nitro, halo, cyano, sulfonato, alkoxy, keto,
carboxylic, and carboalkoxy
radicals, and any two vicinal R26~ substituents may combine to form a fused
aryl, fused
carbocyclic or fused heterocyclic ring; R25' may be a substituted or
unsubstituted radical selected
from the group consisting of H, alkyl, cycloalkyl, alkaryl, aryl, aralkyl,
heterocyclic ring, silyl,
nitro, halo, cyano, sulfonato, alkoxy, keto, carboxylic, and carboalkoxy
radicals; and also present
in this formula is the radical represented by the formula:
-.Po Z~O
where Z'P is covalently bonded to T'o, and Z'P is selected from the group
consisting of -C02-, -
S03-, -OS03-, -S02- and -OS02-, and a is either 1 or 2; T'o is selected from
the group consisting
of
R29'
O)q-
R29'
wherein q is an integer from 1 to 8; R29~ is independently selected from
substituted or
unsubstituted radicals selected from the group consisting of linear or
branched H, alkyl,
cycloalkyl, alkaryl, aryl, aralkyl, alkylene, heterocyclic ring, alkoxy,
arylcarbonyl, carboxyalkyl
and amide groups, provided that all R29~ groups are not independently selected
to be H; G is
selected from the group consisting of: (1) -O- ; (2) -N(R30~)-; and (3) -
N(R30~R31')_; R27'~ R28'
R30~ and R31 ~ are substituted or unsubstituted radicals independently
selected from the group
consisting of H, oxygen, alkyl, cycloalkyl, alkaryl, aryl, aralkyl, alkylenes,
heterocyclic ring,
alkoxys, arylcarbonyl groups, carboxyalkyl groups and amide groups; any of
R25~, R26', R27'
R28', R30' and R31~ may be joined together with any other of R25~, R26', R27'~
R28'~ R30' and
R31 ~ to form part of a common ring; any geminal R27~- R28' may combine to
form a carbonyl;
any vicinal R27~- R31' may join to form unsaturation; and wherein any one
group of substituents
R27'_ R31' may combine to form a substituted or unsubstituted fused
unsaturated moiety.
More preferred oxaziridinium zwitterions, which have a net charge of from
about +3 to
about -3, as represented by the formula [XIV], include those of formula [XIV]
where R25~ is H or
methyl, and for the radical represented by the formula:
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
-.,ho Z~O
Z'p is -C02-, -S03- or -OS03-, and p is 1 or 2.
Most preferably, the oxaziridinium zwitterions are represented by the formula
[XIVa]:
OSO~
/ R44
42
\ I R4i/ R4sR
O
[xlva]
wherein R41-R44 may be independently selected from a substituted or
unsubstituted radical
selected from the group consisting of H, linear or branched, substituted or
unsubstituted alkyl,
cycloalkyl, alkaryl, aryl, aralkyl, alkylene, alkoxy,radicals, provided that
any of R41-R44 may be
joined together with any other of R41-R44 to form part of a common ring; more
preferred, least
one, even more preferably two of R41-R44 is H. Most preferably, R41 and/or R44
is a linear or
branched C1 - C16 alkyl or cycloalkyl, even more preferably the sum of the
carbon atoms within
R41 and R44 is from S-15, most preferably 6-13.
Concentration of Organic Catalyst Compounds - The zwitterionic organic
catalyst
compounds (bleach boosting compounds and bleaching species) of the present
invention may be
and preferably are added to a wash solution, typically aqueous wash solution,
in levels of from
about 0.00001 % (0.0001 ppm) to about 10% ( 100 ppm) by weight of the
composition, and
preferably from about 0.0001 % (0.001 ppm) to about 1 % ( 10 ppm) by weight of
the composition,
more preferably from about 0.001% (0.01 ppm) to about 0.5% (5 ppm), even more
preferably
from about 0.004% (0.04 ppm) to about 0.25% (2.5 ppm). Most preferably from
about 0.01%
(0.1 ppm) to about 0.1 % ( 1 ppm).
The conversion values (in ppm) are provided for exemplary purposes, based on
an in-use
product concentration of 1000 ppm. A 1000 ppm wash solution of a product
containing 0.2%
organic catalyst compound by weight results in a organic catalyst compound
concentration of 2
ppm. Similarly, a 3500 ppm wash solution of a product containing 0.2% organic
catalyst
compound by weight results in a organic catalyst compound concentration of 6.5
ppm.
DECOMPOSITION OF ORGANIC CATALYSTS
The organic catalysts, specifically the bleach boosting compounds of the
present
invention are susceptible to decomposition by various decomposition pathways
including, but not
11
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
limited to, the aromatization pathway. The aromatization (decomposition)
reaction of 6-
membered ring boosters is well known in the art, as exemplified, without being
limited by theory,
in Hanquet et al., Tetrahedron 1993, 49, pp. 423-438. Other means of
decomposition include, but
are not limited to, attack on the bleach boosting compound and/or on the
bleaching species by
nucleophiles, including but not limited to attack by hydroxide anion,
perhydroxide anion,
carboxylate anion, percarboxylate anion and other nucleophiles present under
in-wash conditions.
METHODS FOR DELAYED~CONTROLLED) ADDITION OF ORGANIC CATALYST
COMPOUNDS
It has surprisingly been found with organic catalyst compounds of limited
lifetime, that
the addition of organic catalyst compounds by a delivery means to a wash
solution after a fabric
has been added to a wash solution, especially a wash solution that contains a
peroxygen source,
provides enhanced bleaching compared to the addition of such organic catalyst
compounds to the
wash solution before a fabric has been added to the wash solution. It is
believed, without being
limited by theory, that the organic catalyst compound undergoes decomposition
in the wash
solution prior to the introduction of the fabric load. One method for
improving the performance
of organic catalyst compounds is to delay the addition of the organic catalyst
compound of the
present invention to the wash solution. Another method of improving the
performance of organic
catalyst compounds is to use an organic catalyst compound with increased
stability to the wash
conditions. Methods for delayed (controlled) addition of organic catalyst
compounds are more
fully described in copending and co-owned U.S. Provisional Patent Application
entitled
"Controlled Availability of Formulation Components, Compositions and Laundry
Methods
Employing Same" filed August 27, 1999 (P&G Attorney Docket Number 7749P).
BLEACH SYSTEMS COMPRISING ZWITTERIONIC ORGANIC CATALYST COMPOUNDS
In addition to the use of zwitterionic organic catalyst compounds discussed
above, the
zwitterionic organic catalyst compounds of the present invention may be
employed in conjunction
with or without, preferably with a peroxygen source in other bleach systems,
regardless of their
form. For example, the zwitterionic organic catalyst compounds may be employed
in a laundry
additive product. In the bleach systems of the present invention, the
peroxygen source may be
present in levels of from about 0.1 % to about 60% by weight of the
composition, and preferably
from about 1 % to about 40% by weight of the composition. In a composition,
the organic catalyst
compound may be present from about 0.00001 % to about 10% by weight of the
system, and
preferably from about 0.0001 % to about 1 % by weight of the system, more
preferably from about
0.001% to about 0.5%, even more preferably from about 0.004% to about 0.25%.
Most
preferably from about 0.01 % to about 0.1 %.
12
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
The bleach systems of the present invention may be advantageously employed in
laundry
applications, hard surface cleaning, automatic dishwashing applications, as
well as cosmetic
applications such as dentures, teeth, hair and skin. However, due to the
unique advantages of
increased color safety and increased effectiveness in cold and possibly warm
water solutions due
to possible increased stability, the organic catalyst compounds of the present
invention are ideally
suited for laundry applications such as the bleaching of fabrics through the
use of bleach-
containing detergents or laundry bleach additives. Furthermore, the bleach
boosting compounds
of the present invention may be employed in both granular and liquid
compositions.
The zwitterionic organic catalyst compounds and bleach systems comprising the
organic
catalyst compounds can be used as antimicrobial agents and disinfectants.
Accordingly, the bleach systems of the present invention may include various
additional
ingredients which are desirable in laundry applications. Such ingredients
include detersive
surfactants, bleach catalysts, builders, chelating agents, enzymes, polymeric
soil release agents,
brighteners and various other ingredients. Compositions including any of these
various additional
ingredients preferably have a pH of from about 6 to about 12, preferably from
about 8 to about
10.5 in a 1 % solution of the bleach system.
The bleach systems preferably include at least one detersive surfactant, at
least one
chelating agent, at least one detersive enzyme and preferably has a pH of
about 6 to about 12,
preferably from 8 to about 10.5 in a 1 % solution of the bleach system.
In another embodiment of the present invention, a method for laundering a
fabric,
especially a colored fabric, in need of laundering is provided. The preferred
method comprises
contacting the fabric with a laundry solution. The fabric may comprise most
any fabric capable of
being laundered in normal consumer use conditions. The laundry solution
comprises a bleach
system comprising one or more zwitterionic organic catalyst compounds of the
present invention,
as fully described herein. The water temperatures preferably range from about
0 °C to about SO
°C or higher. The water to fabric ratio is preferably from about 1:1 to
about 15:1.
The laundry solution may further include at least one additional ingredient
selected from
the group consisting of detersive surfactants, chelating agents, detersive
enzymes and mixtures
thereof. Preferably, the laundry solution has a pH of about 6 to about 12,
preferably from about 8
to about 10.5 in a 1 % solution of the bleach system.
The bleach systems of the present invention typically and preferably comprise
a
peroxygen source. Peroxygen sources are well-known in the art and the
peroxygen source
employed in the present invention may comprise any of these well known
sources, including
peroxygen compounds as well as compounds which under consumer use conditions
provide an
effective amount of peroxygen in situ. The peroxygen source may include a
hydrogen peroxide
13
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
source, the in situ formation of a peracid anion through the reaction of a
hydrogen peroxide
source and a bleach activator, preformed peracid compounds or mixtures of
suitable peroxygen
sources. Of course, one of ordinary skill in the art will recognize that other
sources of peroxygen
may be employed without departing from the scope of the invention. Preferably,
the peroxygen
source is selected from the group consisting of:
(i) preformed peracid compounds selected from the group consisting of
percarboxylic acids and salts, percarbonic acids and salts, perimidic acids
and salts,
peroxymonosulfuric acids and salts, and mixtures thereof, and
(ii) hydrogen peroxide sources selected from the group consisting of perborate
compounds, percarbonate compounds, perphosphate compounds and mixtures
thereof, and a
bleach activator.
When present, peroxygen sources (peracids and/or hydrogen peroxide sources)
will
typically be at levels of from about 1%, preferably from about 5% to about
30%, preferably to
about 20% by weight of the composition. If present, the amount of bleach
activator will typically
be from about 0.1 %, preferably from about 0.5% to about 60%, preferably to
about 40% by
weight, of the bleach system comprising the bleaching agent-plus-bleach
activator.
a. Preformed Peracids - The preformed peracid compound as used herein is any
convenient compound which is stable and which under consumer use conditions
provides an
effective amount of peracid anion. The organic catalysts of the present
invention may of course
be used in conjunction with a preformed peracid compound selected from the
group consisting of
percarboxylic acids and salts, percarbonic acids and salts, perimidic acids
and salts,
peroxymonosulfuric acids and salts, and mixtures thereof, examples of which
are described in
U.S. Patent No. 5,576,282 to Miracle et al.
One class of suitable organic peroxycarboxylic acids have the general formula:
O
Y-R-C-O-OH
wherein R is an alkylene or substituted alkylene group containing from 1 to
about 22 carbon
atoms or a phenylene or substituted phenylene group, and Y is hydrogen,
halogen, alkyl, aryl, -
C(O)OH or -C(O)OOH.
Organic peroxyacids suitable for use in the present invention can contain
either one or
two peroxy groups and can be either aliphatic or aromatic. When the organic
peroxycarboxylic
acid is aliphatic, the unsubstituted peracid has the general formula:
O
Y-(CH2)n-C-O-OH
14
CA 02381924 2002-02-13
WO 01/16278 PCT/CJS00/23321
where Y can be, for example, H, CH3, CH2C1, C(O)OH, or C(O)OOH; and n is an
integer from 0
to 20. When the organic peroxycarboxylic acid is aromatic, the unsubstituted
peracid has the
general formula:
O
Y-C6H4-C-O-OH
wherein Y can be, for example, hydrogen, alkyl, alkylhalogen, halogen, C(O)OH
or C(O)OOH.
Typical monoperoxy acids useful herein include alkyl and aryl peroxyacids such
as:
(i) peroxybenzoic acid and ring-substituted peroxybenzoic acid, e.g. peroxy-a-
naphthoic acid, monoperoxyphthalic acid (magnesium salt hexahydrate), and o-
carboxybenzamidoperoxyhexanoic acid (sodium salt);
(ii) aliphatic, substituted aliphatic and arylalkyl monoperoxy acids, e.g.
peroxylauric
acid, peroxystearic acid, N-nonanoylaminoperoxycaproic acid (NAPCA), N,N-(3-
octylsuccinoyl)aminoperoxycaproic acid (SAPA) and N,N-
phthaloylaminoperoxycaproic
acid (PAP);
(iii) amidoperoxyacids, e.g. monononylamide of either peroxysuccinic acid
(NAPSA)
or of peroxyadipic acid (NAPAA).
Typical diperoxyacids useful herein include alkyl diperoxyacids and
aryldiperoxyacids,
such as:
(iv) 1,12-diperoxydodecanedioic acid;
(v) 1,9-diperoxyazelaic acid;
(vi) diperoxybrassylic acid; diperoxysebacic acid and diperoxyisophthalic
acid;
(vii) 2-decyldiperoxybutane-1,4-dioic acid;
(viii) 4,4'-sulfonylbisperoxybenzoic acid.
Such bleaching agents are disclosed in U.S. Patent 4,483,781, Hartman, issued
November
20, 1984, U.S. Patent 4,634,551 to Burns et al., European Patent Application
0,133,354, Banks et
al. published February 20, 1985, and U.S. Patent 4,412,934, Chung et al.
issued November 1,
1983. Sources also include 6-nonylamino-6-oxoperoxycaproic acid as fully
described in U.S.
Patent 4,634,551, issued January 6, 1987 to Burns et al. Persulfate compounds
such as for
example OXONE, manufactured commercially by E.I. DuPont de Nemours of
Wilmington, DE
can also be employed as a suitable source of peroxymonosulfuric acid.
b. Hydrogen Peroxide Sources - The hydrogen peroxide source may be any
suitable
hydrogen peroxide source and present at such levels as fully described in U.S.
Patent No.
5,576,282. For example, the hydrogen peroxide source may be selected from the
group consisting
of perborate compounds, percarbonate compounds, perphosphate compounds and
mixtures
thereof.
WO 01/16278 CA 02381924 2002-02-13 pCT~S00/23321
Hydrogen peroxide sources are described in detail in the herein incorporated
Kirk
Othmer's Encyclopedia of Chemical Technology, 4th Ed (1992, John Wiley &
Sons), Vol. 4, pp.
271-300 "Bleaching Agents (Survey)", and include the various forms of sodium
perborate and
sodium percarbonate, including various coated and modified forms.
The preferred source of hydrogen peroxide used herein can be any convenient
source,
including hydrogen peroxide itself. For example, perborate, e.g., sodium
perborate (any hydrate
but preferably the mono- or tetra-hydrate), sodium carbonate peroxyhydrate or
equivalent
percarbonate salts, sodium pyrophosphate peroxyhydrate, urea peroxyhydrate, or
sodium peroxide
can be used herein. Also useful are sources of available oxygen such as
persulfate bleach (e.g.,
OXONE, manufactured by DuPont). Sodium perborate monohydrate and sodium
percarbonate
are particularly preferred. Mixtures of any convenient hydrogen peroxide
sources can also be
used.
A preferred percarbonate bleach comprises dry particles having an average
particle size in
the range from about 500 micrometers to about 1,000 micrometers, not more than
about 10% by
weight of said particles being smaller than about 200 micrometers and not more
than about 10%
by weight of said particles being larger than about 1,250 micrometers.
Optionally, the
percarbonate can be coated with a silicate, borate or water-soluble
surfactants. Percarbonate is
available from various commercial sources such as FMC, Solway and Tokai Denka.
Compositions of the present invention may also comprise as the bleaching agent
a
chlorine-type bleaching material. Such agents are well known in the art, and
include for example
sodium dichloroisocyanurate ("NaDCC"). However, chlorine-type bleaches are
less preferred for
compositions which comprise enzymes.
b. Bleach Activators - Preferably, the peroxygen source in the composition is
formulated with an activator (peracid precursor). The activator is present at
levels of from about
0.01%, preferably from about 0.5%, more preferably from about 1% to about 15%,
preferably to
about 10%, more preferably to about 8%, by weight of the composition. A bleach
activator as
used herein is any compound which when used in conjunction with a hydrogen
peroxide source
leads to the in situ production of the peracid corresponding to the bleach
activator. Various non
limiting examples of activators are fully disclosed in U.S. Patent No.
5,576,282, U.S. Patent
4,915,854 and U.S. Patent 4,412,934. See also U.S. 4,634,551 for other typical
bleaches and
activators useful herein.
Preferred activators are selected from the group consisting of tetraacetyl
ethylene diamine
(TAED), benzoylcaprolactam (BzCL), 4-nitrobenzoylcaprolactam, 3-
chlorobenzoylcaprolactam,
benzoyloxybenzenesulphonate (BOBS), nonanoyloxybenzenesulphonate (HOBS),
phenyl
benzoate (PhBz), decanoyloxybenzenesulphonate (C10-OBS), benzoylvalerolactam
(BZVL),
16
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
octanoyloxybenzenesulphonate (Cg-OBS), perhydrolyzable esters and mixtures
thereof, most
preferably benzoylcaprolactam and benzoylvalerolactam. Particularly preferred
bleach activators
in the pH range from about 8 to about 9.5 are those selected having an OBS or
VL leaving group.
Preferred hydrophobic bleach activators include, but are not limited to,
nonanoyloxybenzenesulphonate (NOBS), 4-[N-(nonanoyl) amino hexanoyloxy]-
benzene
sulfonate sodium salt (NACA-OBS) an example of which is described in U.S.
Patent No.
5,523,434, lauroyloxybenzenesulphonate (LOBS or C12-OBS), 10
undecenoyloxybenzenesulfonate (UDOBS or C11-OBS with unsaturation in the 10
position), and
decanoyloxybenzoic acid (DOBA).
Preferred bleach activators are those described in U.S. 5,698,504 Christie et
al., issued
December 16, 1997; U.S. 5,695,679 Christie et al. issued December 9, 1997;
U.S. 5,686,401
Willey et al., issued November 11, 1997; U.S. 5,686,014 Hartshorn et al.,
issued November 11,
1997; U.S. 5,405,412 Willey et al., issued April I 1, 1995; U.S. 5,405,413
Willey et al., issued
April 11, 1995; U.S. 5,130,045 Mitchel et al., issued July 14, 1992; and U.S.
4,412,934 Chung et
al., issued November 1, 1983, and copending patent applications U. S. Serial
Nos. 08/709,072,
08/064,564, all of which are incorporated herein by reference.
The mole ratio of peroxygen bleaching compound (as Av0) to bleach activator in
the
present invention generally ranges from at least 1:1, preferably from about
20:1, more preferably
from about 10:1 to about 1:1, preferably to about 3:1.
Quaternary substituted bleach activators may also be included. The present
bleach
systems preferably comprise a quaternary substituted bleach activator (QSBA)
or a quaternary
substituted peracid (QSP); more preferably, the former. Preferred QSBA
structures are further
described in U.S. 5,686,015 Willey et al., issued November 11, 1997; U.S.
5,654,421 Taylor et
al., issued August 5, 1997; U.S. 5,460,747 Gosselink et al., issued October
24, 1995; U.S.
5,584,888 Miracle et al., issued December 17, 1996; and U.S. 5,578,136 Taylor
et al., issued
November 26, 1996; all of which are incorporated herein by reference.
Highly preferred bleach activators useful herein are amide-substituted as
described in
U.S. 5,698,504, U.S. 5,695,679, and U.S. 5,686,014 each of which are cited
herein above.
Preferred examples of such bleach activators include: (6-octanamidocaproyl)
oxybenzenesulfonate, (6-nonanamidocaproyl)oxybenzenesulfonate, (6-decanamido
caproyl)oxybenzenesulfonate and mixtures thereof.
Other useful activators, disclosed in U.S. 5,698,504, U.S. 5,695,679, U.S.
5,686,014
each of which is cited herein above and U.S. 4,966,723Hodge et al., issued
October 30, 1990,
include benzoxazin-type activators, such as a C6H4 ring to which is fused in
the 1,2-positions a
moiety --C(O)OC(R1)=N-.
17
WO 01/16278 CA 02381924 2002-02-13 PCT/US00/23321
Depending on the activator and precise application, good bleaching results can
be
obtained from bleaching systems having with in-use pH of from about 6 to about
13, preferably
from about 9.0 to about 10.5. Typically, for example, activators with electron-
withdrawing
moieties are used for near-neutral or sub-neutral pH ranges. Alkalis and
buffering agents can be
used to secure such pH.
Acyl lactam activators, as described in U.S. 5,698,504, U.S. 5,695,679 and
U.S.
5,686,014, each of which is cited herein above, are very useful herein,
especially the acyl
caprolactams (see for example WO 94-28102 A) and acyl valerolactams (see U.S.
5,503,639
Willey et al., issued April 2, 1996 incorporated herein by reference).
d. Organic Peroxides, especially Diacyl Peroxides - In addition to the
bleaching agents
described above, the bleach systems of the present invention can optionally
include organic
peroxides. Organic peroxides are extensively illustrated in Kirk Othmer,
Encyclopedia of
Chemical Technology, Vol. 17, John Wiley and Sons, 1982 at pages 27-90 and
especially at pages
63-72, all incorporated herein by reference. If a diacyl peroxide is used, it
will preferably be one
which exerts minimal adverse impact on spotting/filming.
e. Metal-containing Bleach Catalysts - The bleach systems can also optionally
include
metal-containing bleach catalysts, preferably manganese and cobalt-containing
bleach catalysts.
One type of metal-containing bleach catalyst is a catalyst system comprising a
transition
metal canon of defined bleach catalytic activity, such as copper, iron,
titanium, ruthenium
tungsten, molybdenum, or manganese cations, an auxiliary metal canon having
little or no bleach
catalytic activity, such as zinc or aluminum cations, and a sequestrate having
defined stability
constants for the catalytic and auxiliary metal canons, particularly
ethylenediaminetetraacetic
acid, ethylenediaminetetra (methylenephosphonic acid) and water-soluble salts
thereof. Such
catalysts are disclosed in U.S. 4,430,243 Bragg, issued February 2, 1982.
i. Manganese Metal Complexes - If desired, the compositions herein can be
catalyzed by means of a manganese compound. Such compounds and levels of use
are well
known in the art and include, for example, the manganese-based catalysts
disclosed in U.S.
5,576,282 Miracle et al., issued November 19, 1996; U.S. 5,246,621 Favre et
al., issued
September 21, 1993; U.S. 5,244,594 Favre et al., issued September 14, 1993;
U.S. 5,194,416
Jureller et al., issued March 16, 1993; U.S. 5,114,606 van Vliet et al.,
issued May 19, 1992; and
European Pat. App. Pub. Nos. 549,271 A 1, 549,272 A 1, 544,440 A2, and 544,490
A 1; Preferred
examples of these catalysts include MnIV2(u-O)3(1,4,7-trimethyl-1,4,7-
triazacyclononane)2-
(PF6)2, MnIII2(u-O)1(u-OAc)2(1,4,7-trimethyl-1,4,7-triazacyclononane)2(C104)2,
MnIV4(u-
O)6(1,4,7-triazacyclononane)4(C104)4, MnIIIMnIV4(u-O)1(u-OAc)2-(1,4,7-
trimethyl-1,4,7-
triazacyclononane)2(C104)3, MnIV(1,4,7-trimethyl-1,4,7-triazacyclononane)-
(OCH3)3(PF6),
18
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
and mixtures thereof. Other metal-based bleach catalysts include those
disclosed in U.S.
4,430,243 included by reference herein above and U.S. 5,114,611 van Kralingen,
issued May 19,
1992. The use of manganese with various complex ligands to enhance bleaching
is also reported
in the following: U.S. 4,728,455 Rerek, issued March l, 1988; U.S. 5,284,944
Madison, issued
February 8, 1994; U.S. 5,246,612 van Dijk et al., issued September 21, 1993;
U.S. 5,256,779
Kerschner et al., issued October 26, 2993; U.S. 5,280,117 Kerschner et al.,
issued January 18,
1994; U.S. 5,274,147 Kerschner et al., issued December 28, 1993; U.S.
5,153,161 Kerschner et
al., issued October 6, 1992; and U.S. 5,227,084 Martens et al., issued July
13, 1993.
ii. Cobalt Metal Complexes - Cobalt bleach catalysts useful herein are known,
and are described, for example, in U.S. 5,597,936 Perkins et al., issued
January 28, 1997; U.S.
5,595,967 Miracle et al., January 21, 1997; U.S. 5,703,030 Perkins et al.,
issued December 30,
1997; and M. L. Tobe, "Base Hydrolysis of Transition-Metal Complexes", Adv.
Inorg. Bioinor~
Mech., (1983), 2, pages 1-94. The most preferred cobalt catalyst useful herein
are cobalt
pentaamine acetate salts having the formula [Co(NH3)50Ac] Ty, wherein "OAc"
represents an
acetate moiety and "Ty" is an anion, and especially cobalt pentaamine acetate
chloride,
[Co(NH3)50Ac]CI2; as well as [Co(NH3)50Ac](OAc)2; [Co(NH3)50Ac](PF6)2;
[Co(NH3)50Ac](S04); [Co(NH3)50Ac](BF4)2; and [Co(NH3)50Ac](N03)2 (herein
"PAC").
These cobalt catalysts are readily prepared by known procedures, such as
taught for
example in U.S. 5,597,936, U.S. 5,595,967, U.S. 5,703,030, cited herein above,
the Tobe article
and the references cited therein, and in U.S. Patent 4,810,410, to Diakun et
al, issued March
7,1989, J. Chem. Ed. (1989), 66 (12), 1043-45; The Synthesis and
Characterization of Inorganic
Compounds, W.L. Jolly (Prentice-Hall; 1970), pp. 461-3; Inorg-.. Chem., 18,
1497-1502 (1979);
Inorg. Chem., 21, 2881-2885 (1982); Inorg. Chem., 18, 2023-2025 (1979); Inorg.
Synthesis, 173-
176 (1960); and Journal ofPl~sical Chemistry, 56, 22-25 (1952).
iii. Transition Metal Complexes of Macropolycyclic Ri i'~ ag nds -
Compositions herein may also suitably include as bleach catalyst a transition
metal complex of a
macropolycyclic rigid ligand. The phrase "macropolycyclic rigid ligand" is
sometimes
abbreviated as "MRL" in discussion below. The amount used is a catalytically
effective amount,
suitably about 1 ppb or more, for example up to about 99.9%, more typically
about 0.001 ppm or
more, preferably from about 0.05 ppm to about 500 ppm (wherein "ppb" denotes
parts per billion
by weight and "ppm" denotes parts per million by weight).
Suitable transition metals e.g., Mn are illustrated hereinafter.
"Macropolycyclic" means a
MRL is both a macrocycle and is polycyclic. "Polycyclic" means at least
bicyclic. The term
"rigid" as used herein herein includes "having a superstructure" and "cross-
bridged". "Rigid" has
been defined as the constrained converse of flexibility: see D.H. Busch.,
Chemical Reviews.,
19
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
(1993), 93, 847-860, incorporated by reference. More particularly, "rigid" as
used herein means
that the MRL must be determinably more rigid than a macrocycle ("parent
macrocycle") which is
otherwise identical (having the same ring size and type and number of atoms in
the main ring) but
lacking a superstructure (especially linking moieties or, preferably cross-
bridging moieties) found
in the MRL's. In determining the comparative rigidity of macrocycles with and
without
superstructures, the practitioner will use the free form (not the metal-bound
form) of the
macrocycles. Rigidity is well-known to be useful in comparing macrocycles;
suitable tools for
determining, measuring or comparing rigidity include computational methods
(see, for example,
Zimmer, Chemical Reviews, (1995), 95(38), 2629-2648 or Hancock et al.,
Inor~anica Chimica
Acta, ( 1989), 164, 73-84.
Preferred MRL's herein are a special type of ultra-rigid ligand which is cross-
bridged. A
"cross-bridge" is nonlimitingly illustrated in 1.11 hereinbelow. In 1.11, the
cross-bridge is a
CH2CH2- moiety. It bridges N 1 and N8 in the illustrative structure. By
comparison, a "same
side" bridge, for example if one were to be introduced across N1 and N12 in
1.1 l, would not be
sufficient to constitute a "cross-bridge" and accordingly would not be
preferred.
Suitable metals in the rigid ligand complexes include Mn(II), Mn(III), Mn(IV);
Mn(V),
Fe(II), Fe(III), Fe(IV), Co(I), Co(II), Co(III), Ni(I), Ni(II), Ni(III),
Cu(I), Cu(II), Cu(III), Cr(II),
Cr(III), Cr(IV), Cr(V), Cr(VI), V(III), V(IV), V(V), Mo(IV), Mo(V), Mo(VI),
W(IV), W(V),
W(VI), Pd(II), Ru(II), Ru(III), and Ru(IV). Preferred transition-metals in the
instant transition
metal bleach catalyst include manganese, iron and chromium.
More generally, the MRL's (and the corresponding transition-metal catalysts)
herein
suitably comprise:
(a) at least one macrocycle main ring comprising four or more heteroatoms; and
(b) a covalently connected non-metal superstructure capable of increasing the
rigidity of the
macrocycle, preferably selected from
(i) a bridging superstructure, such as a linking moiety;
(ii) a cross-bridging superstructure, such as a cross-bridging linking moiety;
and
(iii) combinations thereof.
The term "superstructure" is used herein as defined in the literature by Busch
et al., see,
for example, articles by Busch in "Chemical Reviews".
Preferred superstructures herein not only enhance the rigidity of the parent
macrocycle,
but also favor folding of the macrocycle so that it coordinates to a metal in
a cleft. Suitable
superstructures can be remarkably simple, for example a linking moiety such as
any of those
illustrated in Fig. 1 and Fig. 2 below, can be used.
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
\(c j
Fig. 1
wherein n is an integer, for example from 2 to 8, preferably less than 6,
typically 2 to 4, or
T
~(CH2)n
'JZ
Fig. 2
wherein m and n are integers from about 1 to 8, more preferably from 1 to 3; Z
is N or CH; and T
is a compatible substituent, for example H, alkyl, trialkylammonium, halogen,
nitro, sulfonate, or
the like. The aromatic ring in 1.10 can be replaced by a saturated ring, in
which the atom in Z
connecting into the ring can contain N, O, S or C.
Suitable MRL's are further nonlimitingly illustrated by the following
compound:
3
2 4
5
1a N a N 6
13 12 b 8
/N N
I 1~ 9
Fig. 3
This is a MRL in accordance with the invention which is a highly preferred,
cross-
bridged, methyl-substituted (all nitrogen atoms tertiary) derivative of
cyclam. Formally, this
ligand is named 5,12-dimethyl-1,5,8,12-tetraazabicyclo[6.6.2]hexadecane using
the extended von
Baeyer system. See "A Guide to IUPAC Nomenclature of Organic Compounds:
Recommendations 1993", R. Panico, W.H. Powell and J-C Richer (Eds.), Blackwell
Scientific
Publications, Boston, 1993; see especially section R-2.4.2.1.
Transition-metal bleach catalysts of Macrocyclic Rigid Ligands which are
suitable for use
in the invention compositions can in general include known compounds where
they conform with
the definition herein, as well as, more preferably, any of a large number of
novel compounds
expressly designed for the present laundry or cleaning uses, and non-
limitingly illustrated by any
of the following:
Dichloro-5,12-dimethyl-1,5,8,12-tetraazabicyclo[6.6.2]hexadecane Manganese(II)
Diaquo-5,12-dimethyl-1,5,8,12-tetraazabicyclo[6.6.2]hexadecane Manganese(II)
21
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
Hexafluorophosphate
Aquo-hydroxy-5,12-dimethyl-1,5,8,12-tetraazabicyclo[6.6.2]hexadecane
Manganese(III)
Hexafluorophosphate
Diaquo-5,12-dimethyl-1,5,8,12-tetraazabicyclo[6.6.2]hexadecane Manganese(II)
Tetrafluoroborate
Dichloro-5,12-dimethyl-1,5,8,12-tetraazabicyclo[6.6.2]hexadecane
Manganese(III)
Hexafluorophosphate
Dichloro-5,12-di-n-butyl-1,5,8,12-tetraaza bicyclo[6.6.2]hexadecane
Manganese(II)
Dichloro-5,12-dibenzyl-1,5,8,12-tetraazabicyclo[6.6.2]hexadecane Manganese(II)
Dichloro-5-n-butyl-12-methyl-1,5,8,12-tetraaza- bicyclo[6.6.2]hexadecane
Manganese(II)
Dichloro-5-n-octyl-12-methyl-1,5,8,12-tetraaza- bicyclo[6.6.2]hexadecane
Manganese(II)
Dichloro-5-n-butyl-12-methyl-1,5,8,12-tetraaza- bicyclo[6.6.2]hexadecane
Manganese(II).
(f) Other Bleach Catalysts - The compositions herein may comprise one or more
other
bleach catalysts. Preferred bleach catalysts are zwitterionic bleach
catalysts, which are described
in U.S. Patent No. 5,576,282 (especially 3-(3,4-dihydroisoquinolinium) propane
sulfonate. Other
bleach catalysts include cationic bleach catalysts are described in U.S.
Patent Nos. 5,360,569,
5,442,066, 5,478,357, 5,370,826, 5,482,515, 5,550,256, and WO 95/13351, WO
95/13352, and
WO 95/13353.
As a practical matter, and not by way of limitation, the compositions and
cleaning
processes herein can be adjusted to provide on the order of at least one part
per hundred million of
the active bleach catalyst species in the aqueous washing medium, and will
preferably provide
from about 0.01 ppm to about 25 ppm, more preferably from about 0.05 ppm to
about 10 ppm,
and most preferably from about 0.1 ppm to about 5 ppm, of the bleach catalyst
species in the wash
liquor. In order to obtain such levels in the wash liquor of an automatic
washing process, typical
compositions herein will comprise from about 0.0005% to about 0.2%, more
preferably from
about 0.004% to about 0.08%, of bleach catalyst, especially manganese or
cobalt catalysts, by
weight of the cleaning compositions.
Preferably, the peroxygen source is selected from hydrogen peroxide sources
selected
from the group consisting of perborate compounds, percarbonate compounds,
perphosphate
compounds and mixtures thereof, and a bleach activator.
Preferably, the bleach activator is selected from the group consisting of
hydrophobic
bleach activators as disclosed herein.
The purpose of such a bleach system is to mitigate unwanted decomposition of
the
organic catalyst, and to allow the peracid to achieve bleaching performance on
a fabric in need of
22
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
cleaning, such as a stained fabric, in a wash solution prior to the
availability of the organic
catalyst.
The period of time between the peracid becoming active in a wash solution and
the
organic catalyst compounds becoming active can be in the range of from about 1
second to about
24 hours. Alternatively, since the organic catalyst compounds are relatively
stable in the wash
solution, the peracid can become active in the wash solution after the organic
catalyst compound
becomes active or available.
The purpose of a delayed addition bleach system (which may or may not be used
in
conjunction with this invention) is to allow the peracid to achieve maximum
bleaching
performance on a fabric in need of cleaning, such as a stained fabric, in a
wash solution prior to
the introduction of the organic catalyst compound. In other words, a bleach
system comprising a
organic catalyst compound which becomes active in a wash solution after a
fabric in need of
cleaning has been added to the wash solution. Alternatively, since the organic
catalyst
compounds can have increased stability, a bleach system comprising an organic
catalyst
compound which becomes active in a wash solution prior to a fabric in need of
cleaning has been
added to the wash solution may be used.
A preferred bleach system in accordance with the present invention is a bleach
system
comprising:
(a) a peroxygen source; and
(b) a zwitterionic organic catalyst compound;
wherein the zwitterionic organic catalyst compound becomes active in a wash
solution containing
said bleach system a period of time after said peroxygen source becomes
active. The peroxygen
source, like discussed above, is preferably selected from the group consisting
of
(i) preformed peracid compounds selected from the group consisting of
percarboxylic
acids and salts, percarbonic acids and salts, perimidic acids and salts,
peroxymonosulfuric acids
and salts, and mixtures thereof, and
(ii) hydrogen peroxide sources selected from the group consisting of perborate
compounds, percarbonate compounds, perphosphate compounds and mixtures
thereof, and a
bleach activator.
The bleach systems of the present invention also preferably comprise, in
addition to one
or more organic catalysts, described hereinbefore, one or more cleaning
adjunct materials,
preferably compatible with the organic catalysts) and/or any enzymes present
in the bleach
23
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
system. The term "compatible", as used herein, means the bleach system
materials do not reduce
the bleaching activity of the organic catalyst and/or any enzymatic activity
of any enzyme present
in the bleach system to such an extent that the organic catalyst and/or enzyme
is not effective as
desired during normal use situations. The term "cleaning adjunct materials",
as used herein,
means any liquid, solid or gaseous material selected for the particular type
of bleach system
desired and the form of the product (e.g., liquid; granule; powder; bar;
paste; spray; tablet; gel;
foam composition), which materials are also preferably compatible with the
protease enzymes)
and bleaching agents) used in the composition. Granular compositions can also
be in "compact"
form and the liquid compositions can also be in a "concentrated" form.
The specific selection of cleaning adjunct materials are readily made by
considering the
surface, item or fabric to be cleaned, and the desired form of the composition
for the cleaning
conditions during use (e.g., through the wash detergent use). Examples of
suitable cleaning
adjunct materials include, but are not limited to, surfactants, builders,
bleaches, bleach activators,
bleach catalysts, other enzymes, enzyme stabilizing systems, chelants, optical
brighteners, soil
release polymers, dye transfer agents, dispersants, suds suppressors, dyes,
perfumes, colorants,
filler salts, hydrotropes, photoactivators, fluorescers, fabric conditioners,
hydrolyzable surfactants,
preservatives, anti-oxidants, anti-shrinkage agents, anti-wrinkle agents,
germicides, fungicides,
color speckles, silvercare, anti-tarnish and/or anti-corrosion agents,
alkalinity sources, solubilizing
agents, carriers, processing aids, pigments and pH control agents as described
in U.S. Patent Nos.
5,705,464, 5,710,11 S, 5,698,504, 5,695,679, 5,686,014 and 5,646,101. Specific
bleach system
materials are exemplified in detail hereinafter.
If the cleaning adjunct materials are not compatible with the protease
variants) in the
bleach systems, then suitable methods of keeping the cleaning adjunct
materials and the protease
variants) separate (not in contact with each other) until combination of the
two components is
appropriate can be used. Suitable methods can be any method known in the art,
such as gelcaps,
encapulation, tablets, physical separation, etc.
Such bleach systems include detergent compositions for cleaning hard surfaces,
unlimited
in form (e.g., liquid, granular, paste, foam, spray, etc.); detergent
compositions for cleaning
fabrics, unlimited in form (e.g., granular, liquid, bar formulations, etc.);
dishwashing
compositions (unlimited in form and including both granular and liquid
automatic dishwashing);
oral bleach systems, unlimited in form (e.g., dentifrice, toothpaste and
mouthwash formulations);
and denture bleach systems, unlimited in form (e.g., liquid, tablet).
The fabric bleach systems of the present invention are mainly intended to be
used in the
wash cycle of a washing machine; however, other uses can be contemplated, such
as pretreatment
product for heavily-soiled fabrics, or soaking product; the use is not
necessarily limited to the
24
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
washing-machine context, and the compositions of the present invention can be
used alone or in
combination with compatible handwash compositions.
The bleach systems may include from about 1 % to about 99.9% by weight of the
composition of the cleaning adjunct materials.
As used herein, "non-fabric bleach systems" include hard surface bleach
systems,
dishwashing compositions, oral bleach systems, denture bleach systems and
personal cleansing
compositions.
When the bleach systems of the present invention are formulated as
compositions suitable
for use in a laundry machine washing method, the compositions of the present
invention
preferably contain both a surfactant and a builder compound and additionally
one or more
cleaning adjunct materials preferably selected from organic polymeric
compounds, bleaching
agents, additional enzymes-, suds suppressors, dispersants, lime-soap
dispersants, soil suspension
and anti-redeposition agents and corrosion inhibitors. Laundry compositions
can also contain
softening agents, as additional cleaning adjunct materials.
The compositions of the present invention can also be used as detergent
additive products
in solid or liquid form. Such additive products are intended to supplement or
boost the
performance of conventional detergent compositions and can be added at any
stage of the
cleaning process.
When formulated as compositions for use in manual dishwashing methods the
compositions of the invention preferably contain a surfactant and preferably
other cleaning
adjunct materials selected from organic polymeric compounds, suds enhancing
agents, group II
metal ions, solvents, hydrotropes and additional enzymes.
If needed the density of the laundry detergent compositions herein ranges from
400 to
1200 glitter, preferably 500 to 950 glitter of composition measured at
20°C.
The "compact" form of the bleach systems herein is best reflected by density
and, in terms
of composition, by the amount of inorganic filler salt; inorganic filler salts
are conventional
ingredients of detergent compositions in powder form; in conventional
detergent compositions,
the filler salts are present in substantial amounts, typically 17-35% by
weight of the total
composition. In the compact compositions, the filler salt is present in
amounts not exceeding 15%
of the total composition, preferably not exceeding 10%, most preferably not
exceeding 5% by
weight of the composition. The inorganic filler salts, such as meant in the
present compositions
are selected from the alkali and alkaline-earth-metal salts of sulfates and
chlorides. A preferred
filler salt is sodium sulfate.
Liquid bleach systems according to the present invention can also be in a
"concentrated
form", in such case, the liquid bleach systems according the present invention
will contain a lower
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
amount of water, compared to conventional liquid detergents. Typically the
water content of the
concentrated liquid bleach system is preferably less than 40%, more preferably
less than 30%,
most preferably less than 20% by weight of the bleach system.
Cleaning A~unct Materials
While not essential for the purposes of the present invention, several
conventional
adjuncts illustrated hereinafter are suitable for use in the instant bleach
systems and may be
desirably incorporated in preferred embodiments of the invention, for example
to assist or
enhance cleaning performance, for treatment of the substrate to be cleaned, or
to modify the
aesthetics of the bleach system as is the case with perfumes, colorants, dyes
or the like. The
precise nature of these additional components, and levels of incorporation
thereof, will depend on
the physical form of the composition and the nature of the cleaning operation
for which it is to be
used. Unless otherwise indicated, the bleach systems of the invention may for
example, be
formulated as granular or powder-form all-purpose or "heavy-duty" washing
agents, especially
laundry detergents; liquid, gel or paste-form all-purpose washing agents,
especially the so-called
heavy-duty liquid types; liquid fine-fabric detergents; hand dishwashing
agents or light duty
dishwashing agents, especially those of the high-foaming type; machine
dishwashing agents,
including the various tablet, granular, liquid and rinse-aid types for
household and institutional
use; liquid cleaning and disinfecting agents, including antibacterial hand-
wash types, laundry
bars, mouthwashes, denture cleaners, car or carpet shampoos, bathroom
cleaners; hair shampoos
and hair-rinses; shower gels and foam baths and metal cleaners; as well as
cleaning auxiliaries
such as bleach additives and "stain-stick" or pre-treat types.
Surfactants - The compositions of the present invention preferably contain a
detersive
surfactant. The detersive surfactant is typically selected from the group
consisting of anionic,
nonionics, cationics, ampholytics, zwitterionics, and mixtures thereof. By
selecting the type and
amount of detersive surfactant, along with other adjunct ingredients disclosed
herein, the present
detergent compositions can be formulated to be used in the context of laundry
cleaning or in other
different cleaning applications, particularly including dishwashing. The
particular surfactants
used can therefore vary widely depending upon the particular end-use
envisioned. Suitable
surfactants are described below. Examples of suitable nonionic, anionic,
cationic amphoteric and
zwitterionic surfactants are given in "Surface Active Agents and Detergents"
(Vol. I and II by
Schwartz, Perry and Berch). A variety of such surfactants are also generally
disclosed in U.S.
Patent 3,929,678, issued December 30, 1975 to Laughlin, et al. at Column 23,
line 58 through
Column 29, line 23.
26
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
The surfactant is typically present at a level of from about 0.1 %, preferably
about 1 %,
more preferably about 5% by weight of the bleach systems to about 99.9%,
preferably about 80%,
more preferably about 35%, most preferably 30% about by weight of the bleach
systems.
Anionic Surfactants - Anionic surfactants useful in the present invention are
preferably
selected from the group consisting of, linear alkylbenzene sulfonate, alpha
olefin sulfonate,
paraffin sulfonates, alkyl ester sulfonates, alkyl sulfates, alkyl alkoxy
sulfate, alkyl sulfonates,
alkyl alkoxy carboxylate, alkyl alkoxylated sulfates, sarcosinates,
taurinates, and mixtures thereof.
An effective amount, typically from about 0.5% to about 90%, preferably about
5% to about 60%,
more preferably from about 10 to about 30%, by weight of anionic detersive
surfactant can be
used in the present invention.
Alkyl sulfate surfactants are another type of anionic surfactant of importance
for use herein.
In addition to providing excellent overall cleaning ability when used in
combination with
polyhydroxy fatty acid amides (see below), including good grease/oil cleaning
over a wide range
of temperatures, wash concentrations, and wash times, dissolution of alkyl
sulfates can be
obtained, as well as improved formidability in liquid detergent formulations
are water soluble
salts or acids of the formula ROS03M wherein R preferably is a C10-C24
hydrocarbyl,
preferably an alkyl or hydroxyalkyl having a C10-C20 alkyl component, more
preferably a C12-
Clg alkyl or hydroxyalkyl, and M is H or a cation, e.g., an alkali (Group IA)
metal canon (e.g.,
sodium, potassium, lithium), substituted or unsubstituted ammonium cations
such as methyl-,
dimethyl-, and trimethyl ammonium and quaternary ammonium cations, e.g.,
tetramethyl-
ammonium and dimethyl piperdinium, and cations derived from alkanolamines such
as
ethanolamine, diethanolamine, triethanolamine, and mixtures thereof, and the
like. Typically,
alkyl chains of C12-16 are preferred for lower wash temperatures (e.g., below
about 50°C) and
C16-18 alkyl chains are preferred for higher wash temperatures (e.g., above
about SO°C).
Alkyl alkoxylated sulfate surfactants are another category of useful anionic
surfactant.
These surfactants are water soluble salts or acids typically of the formula
RO(A)mS03M wherein
R is an unsubstituted C 10-C24 alkyl or hydroxyalkyl group having a C 10-C24
alkyl component,
preferably a C 12-C20 alkyl or hydroxyalkyl, more preferably C 12-C 1 g alkyl
or hydroxyalkyl, A
is an ethoxy or propoxy unit, m is greater than zero, typically between about
0.5 and about 6,
more preferably between about 0.5 and about 3, and M is H or a cation which
can be, for
example, a metal canon (e.g., sodium, potassium, lithium, etc.), ammonium or
substituted-
ammonium canon. Alkyl ethoxylated sulfates as well as alkyl propoxylated
sulfates are
contemplated herein. Specific examples of substituted ammonium canons include
methyl-,
dimethyl-, trimethyl-ammonium and quaternary ammonium cations, such as
tetramethyl-
ammonium, dimethyl piperidinium and cations derived from alkanolamines, e.g.
27
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
monoethanolamine, diethanolamine, and triethanolamine, and mixtures thereof.
Exemplary
surfactants are C 12-C 1 g alkyl polyethoxylate ( 1.0) sulfate, C 12-C 1 g
alkyl polyethoxylate (2.25)
sulfate, C 12-C 1 g alkyl polyethoxylate (3.0) sulfate, and C 12-C 1 g alkyl
polyethoxylate (4.0)
sulfate wherein M is conveniently selected from sodium and potassium.
Surfactants for use
herein can be made from natural or synthetic alcohol feedstocks. Chain lengths
represent average
hydrocarbon distributions, including branching.
Additionally and preferably, the surfactant may be a midchain branched alkyl
sulfate,
midchain branched alkyl alkoxylate, or midchain branched alkyl alkoxylate
sulfate. These
surfactants are further described in No. 60/061,971, Attorney docket No 6881P
October 14, 1997,
No. 60/061,975, Attorney docket No 6882P October 14, 1997, No. 60/062,086,
Attorney docket
No 6883P October 14, 1997, No. 60/061,916, Attorney docket No 6884P October
14, 1997, No.
60/061,970, Attorney docket No 6885P October 14, 1997, No: 60/062,407,
Attorney docket No
6886P October 14, 1997,. Other suitable mid-chain branched surfactants can be
found in U.S.
Patent applications Serial Nos. 60/032,035 (Docket No. 6401P), 60/031,845
(Docket No. 6402P),
60/031,916 (Docket No. 6403P), 60/031,917 (Docket No. 6404P), 60/031,761
(Docket No.
6405P), 60/031,762 (Docket No. 6406P) and 60/031,844 (Docket No. 6409P).
Mixtures of these
branched surfactants with conventional linear surfactants are also suitable
for use in the present
compositions.
Another preferred anionic surfactant are the so-called modified alkyl benzene
sulfonate
surfactants, or MLAS. Some suitable MLAS surfactants, methods of making them
and exemplary
compositions are further described in copending U.S. Patent applications
Serial Nos. 60/053,319
(Docket No. 6766P), 60/053,318 (Docket No. 6767P), 60/053,321 (Docket No.
6768P),
60/053,209 (Docket No. 6769P), 60/053,328 (Docket No. 6770P), 60/053,186
(Docket No.
6771P), 60/055,437 (Docket No. 6796P), 60/105,017 (Docket No. 7303P), and
60/104,962
(Docket No. 7304P).
Examples of suitable anionic surfactants are given in "Surface Active Agents
and
Detergents" (Vol. I and II by Schwartz, Perry and Berch).
Nonionic Detergent Surfactants - Suitable nonionic detergent surfactants are
generally
disclosed in U.S. Patent 3,929,678, Laughlin et al., issued December 30, 1975,
at column 13, line
14 through column 16, line 6, incorporated herein by reference. Exemplary, non-
limiting classes
of useful nonionic surfactants include: amine oxides, alkyl ethoxylate,
alkanoyl glucose amide,
alkyl betaines, sulfobetaine and mixtures thereof.
Amine oxides are semi-polar nonionic surfactants and include water-soluble
amine oxides
containing one alkyl moiety of from about 10 to about 18 carbon atoms and 2
moieties selected
from the group consisting of alkyl groups and hydroxyalkyl groups containing
from about 1 to
28
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
about 3 carbon atoms; water-soluble phosphine oxides containing one alkyl
moiety of from about
to about 18 carbon atoms and 2 moieties selected from the group consisting of
alkyl groups
and hydroxyalkyl groups containing from about 1 to about 3 carbon atoms; and
water-soluble
sulfoxides containing one alkyl moiety of from about 10 to about 18 carbon
atoms and a moiety
5 selected from the group consisting of alkyl and hydroxyalkyl moieties of
from about 1 to about 3
carbon atoms.
Semi-polar nonionic detergent surfactants include the amine oxide surfactants
having the
formula
O
R3~OR4)xN~RS)2
10 wherein R3 is an alkyl, hydroxyalkyl, or alkyl phenyl group or mixtures
thereof containing from
about 8 to about 22 carbon atoms; R4 is an alkylene or hydroxyalkylene group
containing from
about 2 to about 3 carbon atoms or mixtures thereof; x is from 0 to about 3;
and each RS is an
alkyl or hydroxyalkyl group containing from about 1 to about 3 carbon atoms or
a polyethylene
oxide group containing from about 1 to about 3 ethylene oxide groups. The RS
groups can be
attached to each other, e.g., through an oxygen or nitrogen atom, to form a
ring structure.
These amine oxide surfactants in particular include C10-Clg alkyl dimethyl
amine oxides
and Cg-C12 alkoxy ethyl dihydroxy ethyl amine oxides. Preferably the amine
oxide is present in
the composition in an effective amount, more preferably from about 0.1 % to
about 20%, even
more preferably about 0.1% to about 15%, even more preferably still from about
0.5% to about
10%,by weight.
The polyethylene, polypropylene, and polybutylene oxide condensates of alkyl
phenols. In
general, the polyethylene oxide condensates are preferred. These compounds
include the
condensation products of alkyl phenols having an alkyl group containing from
about 6 to about 12
carbon atoms in either a straight chain or branched chain configuration with
the alkylene oxide.
In a preferred embodiment, the ethylene oxide is present in an amount equal to
from about 5 to
about 25 moles of ethylene oxide per mole of alkyl phenol. Commercially
available nonionic
surfactants of this type include Igepal~ CO-630, marketed by the GAF
Corporation; and Triton~
X-45, X-114, X-100, and X-102, all marketed by the Rohm & Haas Company. These
compounds
are commonly referred to as alkyl phenol alkoxylates, (e.g., alkyl phenol
ethoxylates).
The condensation products of aliphatic alcohols with from about 1 to about 25
moles of
ethylene oxide. The alkyl chain of the aliphatic alcohol can either be
straight or branched,
primary or secondary, and generally contains from about 8 to about 22 carbon
atoms. Particularly
preferred are the condensation products of alcohols having an alkyl group
containing from about
10 to about 20 carbon atoms with from about 2 to about 18 moles of ethylene
oxide per mole of
29
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
alcohol. Examples of commercially available nonionic surfactants of this type
include Tergitol~
15-S-9 (the condensation product of C11-C15 linear secondary alcohol with 9
moles ethylene
oxide), Tergitol~ 24-L-6 NMW (the condensation product of C12-C14 primary
alcohol with 6
moles ethylene oxide with a narrow molecular weight distribution), both
marketed by Union
Carbide Corporation; Neodol~ 45-9 (the condensation product of C 14-C 15
linear alcohol with 9
moles of ethylene oxide), Neodol~ 23-6.5 (the condensation product of C12-C13
linear alcohol
with 6.5 moles of ethylene oxide), Neodol~ 45-7 (the condensation product of C
14-C 15 linear
alcohol with 7 moles of ethylene oxide), Neodol~ 45-4 (the condensation
product of C 14-C 15
linear alcohol with 4 moles of ethylene oxide), marketed by Shell Chemical
Company, and
Kyro~ EOB (the condensation product of C 13-C 15 alcohol with 9 moles ethylene
oxide),
marketed by The Procter & Gamble Company. Other commercially available
nonionic
surfactants include Dobanol 91-8~ marketed by Shell Chemical Co. and Genapol
UD-080~
marketed by Hoechst. This category of nonionic surfactant is referred to
generally as "alkyl
ethoxylates."
The preferred alkylpolyglycosides have the formula
R20(CnH2n0)t(glYcosyl)x
wherein R2 is selected from the group consisting of alkyl, alkyl-phenyl,
hydroxyalkyl,
hydroxyalkylphenyl, and mixtures thereof in which the alkyl groups contain
from about 10 to
about 18, preferably from about 12 to about 14, carbon atoms; n is 2 or 3,
preferably 2; t is from 0
to about 10, preferably 0; and x is from about 1.3 to about 10, preferably
from about 1.3 to about
3, most preferably from about 1.3 to about 2.7. The glycosyl is preferably
derived from glucose.
To prepare these compounds, the alcohol or alkylpolyethoxy alcohol is formed
first and then
reacted with glucose, or a source of glucose, to form the glucoside
(attachment at the 1-position).
The additional glycosyl units can then be attached between their 1-position
and the preceding
glycosyl units 2-, 3-, 4- and/or 6-position, preferably predominantly the 2-
position.
Fatty acid amide surfactants having the formula:
O
R6CN(R~)2
wherein R6 is an alkyl group containing from about 7 to about 21 (preferably
from about 9 to
about 17) carbon atoms and each R7 is selected from the group consisting of
hydrogen, C1-C4
alkyl, C1-C4 hydroxyalkyl, and -(C2H40)xH where x varies from about 1 to about
3.
Preferred amides are Cg-C20 ammonia amides, monoethanolamides,
diethanolamides, and
isopropanolamides.
WO 01/16278 CA 02381924 2002-02-13 pCT~jg00/23321
Preferably the nonionic surfactant, when present in the composition, is
present in an
effective amount, more preferably from about 0.1 % to about 20%, even more
preferably about
0.1% to about 15%, even more preferably still from about 0.5% to about 10%,by
weight.
Pol~ydroxy Fatty Acid Amide Surfactant - The detergent compositions hereof may
also
contain an effective amount of polyhydroxy fatty acid amide surfactant. By
"effective amount" is
meant that the formulator of the composition can select an amount of
polyhydroxy fatty acid
amide to be incorporated into the compositions that will improve the cleaning
performance of the
detergent composition. In general, for conventional levels, the incorporation
of about 1 %, by
weight, polyhydroxy fatty acid amide will enhance cleaning performance.
The detergent compositions herein will typically comprise about 1% weight
basis,
polyhydroxy fatty acid amide surfactant, preferably from about 3% to about
30%, of the
polyhydroxy fatty acid amide. The polyhydroxy fatty acid amide surfactant
component comprises
compounds of the structural formula:
O
R2CNZ
R1
wherein: R1 is H, C1-C4 hydrocarbyl, 2-hydroxy ethyl, 2-hydroxy propyl, or a
mixture thereof,
preferably C 1-C4 alkyl, more preferably C 1 or C2 alkyl, most preferably C 1
alkyl (i.e., methyl);
and R2 is a CS-C31 hydrocarbyl, preferably straight chain C~-C19 alkyl or
alkenyl, more
preferably straight chain Cg-C1~ alkyl or alkenyl, most preferably straight
chain C11-C15 alkyl
or alkenyl, or mixtures thereof; and Z is a polyhydroxyhydrocarbyl having a
linear hydrocarbyl
chain with at least 3 hydroxyls directly connected to the chain, or an
alkoxylated derivative
(preferably ethoxylated or propoxylated) thereof. Z preferably will be derived
from a reducing
sugar in a reductive amination reaction; more preferably Z will be a glycityl.
Suitable reducing
sugars include glucose, fructose, maltose, lactose, galactose, mannose, and
xylose. As raw
materials, high dextrose corn syrup, high fructose corn syrup, and high
maltose corn syrup can be
utilized as well as the individual sugars listed above. These corn syrups may
yield a mix of sugar
components for Z. It should be understood that it is by no means intended to
exclude other
suitable raw materials. Z preferably will be selected from the group
consisting of -CH2-
(CHOH)n-CH20H, -CH(CH20H)-(CHOH)n_1-CH20H, -CH2-(CHOH)2(CHOR')(CHOH)-
CH20H, and alkoxylated derivatives thereof, where n is an integer from 3 to 5,
inclusive, and R'
is H or a cyclic or aliphatic monosaccharide. Most preferred are glycityls
wherein n is 4,
particularly -CH2-(CHOH)4-CH20H.
R can be, for example, N-methyl, N-ethyl, N-propyl, N-isopropyl, N-butyl, N-2-
hydroxy
ethyl, or N-2-hydroxy propyl.
31
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
R2-CO-N< can be, for example, cocamide, stearamide, oleamide, lauramide,
myristamide,
capricamide, palmitamide, tallowamide, etc.
Z can be I-deoxyglucityl, 2-deoxyfructityl, 1-deoxymaltityl, I-deoxylactityl,
1-
deoxygalactityl, I-deoxymannityl, 1-deoxymaltotriotityl, etc.
Methods for making polyhydroxy fatty acid amides are known in the art. In
general, they
can be made by reacting an alkyl amine with a reducing sugar in a reductive
amination reaction to
form a corresponding N-alkyl polyhydroxyamine, and then reacting the N-alkyl
polyhydroxyamine with a fatty aliphatic ester or triglyceride in a
condensation/amidation step to
form the N-alkyl, N-polyhydroxy fatty acid amide product. Processes for making
compositions
containing polyhydroxy fatty acid amides are disclosed, for example, in G.B.
Patent Specification
809,060, published February 18, 1959, by Thomas Hedley & Co., Ltd., U.S.
Patent 2,965,576,
issued December 20, 1960 to E. R. Wilson, and U.S. Patent 2,703,798, Anthony
M. Schwartz,
issued March 8, 1955, and U.S. Patent 1,985,424, issued December 25, 1934 to
Piggott, each of
which is incorporated herein by reference.
Diamines - The preferred liquid detergent compositions, such as light duty
liquid, LDL
compositions, useful in the methods of the present invention may further
comprise one or more
diamines, preferably an amount of diamine such that the ratio of anionic
surfactant present to the
diamine is from about 40 : 1 to about 2: I . Said diamines provide for
increased removal of grease
and greasy food material while maintaining suitable levels of suds.
The diamines suitable for use in the compositions of the present invention
have the
formula:
R20 R20
~N -X-N
R20~ ~R20
wherein each RZ° is independently selected from the group consisting of
hydrogen, Cl-C4
linear or branched alkyl, alkyleneoxy having the formula:
-~R21 O)yR22
wherein R21 is C2-C4 linear or branched alkylene, and mixtures thereof; R22 is
hydrogen, Cl-C4 alkyl, and mixtures thereof; y is from 1 to about 10; X is a
unit selected
from:
i) C3-C l0 linear alkylene, C3-C I0 branched alkylene, C3-C I 0 cyclic
alkylene, C3-
Clp branched cyclic alkylene, an alkyleneoxyalkylene having the formula:
~R21 O )YR21-
wherein R21 and y are the same as defined herein above;
32
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
ii) C3-C I O linear, C3-C I O branched linear, C3-C I O cyclic, C3-C 1 p
branched cyclic
alkylene, C6-CIO arylene, wherein said unit comprises one or more electron
donating or electron withdrawing moieties which provide said diamine with a
pKa greater than about 8; and
iii) mixtures of (i) and (ii)
provided said diamine has a pKa of at least about 8.
The preferred diamines of the present invention have a pKl and pK2 which are
each in
the range of from about 8 to about I 1.5, preferably in the range of from
about 8.4 to about I I ,
more preferably from about 8.6 to about 10.75. For the purposes of the present
invention the term
"pKa" stands equally well for the terms "pKl" and "pK2" either separately or
collectively. The
term pKa as used herein throughout the present specification in the same
manner as used by those
of ordinary skill in the art. pKa values are readily obtained from standard
literature sources, for
example, "Critical Stability Constants: Volume 2, Amines" by Smith and Martel,
Plenum Press,
N.Y. and London, (1975).
As an applied definition herein, the pKa values of the diamines are specified
as being
measured in an aqueous solution at 25o C having an ionic strength of from
about 0.1 to about 0.5
M. As used herein, the pKa is an equilibrium constant dependent upon
temperature and ionic
strength, therefore, value reported by literature references, not measured in
the above described
manner, may not be within full agreement with the values and ranges which
comprise the present
invention. To eliminate ambiguity, the relevant conditions and/or references
used for pKa s of
this invention are as defined herein or in "Critical Stability Constants:
Volume 2, Amines". One
typical method of measurement is the potentiometric titration of the acid with
sodium hydroxide
and determination of the pKa by suitable methods as described and referenced
in "The Chemist's
Ready Reference Handbook" by Shugar and Dean, McGraw Hill, NY, 1990.
Preferred diamines for performance and supply considerations are 1,3-
bis(methylamino)cyclohexane, 1,3-diaminopropane (pKl=10.5; pK2=8.8), 1,6-
diaminohexane
(pKl=11; pK2=10), 1,3-diaminopentane (Dytek EP) (pKl=10.5; pK2=8.9), 2-methyl
1,5-
diaminopentane (Dytek A) (pKl=11.2; pK2=10.0). Other preferred materials are
the
primary/primary diamines having alkylene spacers ranging from C4-Cg. In
general, primary
diamines are preferred over secondary and tertiary diamines.
The following are non-limiting examples of diamines suitable for use in the
present
invention.
1-N,N-dimethylamino-3-aminopropane having the formula:
33
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
\N ~~NH2
1,6-diaminohexane having the formula:
H2N
NH2
1,3-diaminopropane having the formula:
H2N ~~NH2
2-methyl-1,5-diaminopentane having the formula:
H2N ~ v ~NHZ
1,3-diaminopentane, available under the tradename Dytek EP, having the
formula:
H2N
NH2
1,3-diaminobutane having the formula:
H2N NH2
Jeffamine EDR 148, a diamine having an alkyleneoxy backbone, having the
formula:
~/O~ ~/NH2
H2N O
3-methyl-3-aminoethyl-5-dimethyl-1-aminocyclohexane (isophorone diamine)
having the
formula:
34
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
NH2
w NH2 ~ and
1,3-bis(methylamino)cyclohexane having the formula:
CHZNH2
~CH2NH2
ADDITIONAL DETERGENT COMPONENTS
The following are non-limiting examples of additional detergent components
(adjunct
ingredients) useful in the bleach systems, especially laundry detergent
compositions, of the
present invention, said adjunct ingredients include builders, optical
brighteners, soil release
polymers, dye transfer agents, dispersants, enzymes, suds suppressers, dyes,
perfumes, colorants,
filler salts, hydrotropes, photoactivators, fluorescers, fabric conditioners,
hydrolyzable
surfactants, preservatives, anti-oxidants, chelants, stabilizers, anti-
shrinkage agents, anti-wrinkle
agents, germicides, fungicides, anti corrosion agents, and mixtures thereof.
Builders - The bleach systems of the present invention preferably comprise one
or more
detergent builders or builder systems. When present, the compositions will
typically comprise at
least about 1% builder, preferably from about 5%, more preferably from about
10% to about
80%, preferably to about 50%, more preferably to about 30% by weight, of
detergent builder.
The level of builder can vary widely depending upon the end use of the
composition and
its desired physical form. When present, the compositions will typically
comprise at least about
1% builder. Formulations typically comprise from about 5% to about 50%, more
typically about
5% to about 30%, by weight, of detergent builder. Granular formulations
typically comprise
from about 10% to about 80%, more typically from about 15% to about 50% by
weight, of the
detergent builder. Lower or higher levels of builder, however, are not meant
to be excluded.
Inorganic or P-containing detergent builders include, but are not limited to,
the alkali
metal, ammonium and alkanolammonium salts of polyphosphates (exemplified by
the
tripolyphosphates, pyrophosphates, and glassy polymeric meta-phosphates),
phosphonates, phytic
acid, silicates, carbonates (including bicarbonates and sesquicarbonates),
sulphates, and
aluminosilicates. However, non-phosphate builders are required in some
locales. Importantly,
the compositions herein function surprisingly well even in the presence of the
so-called "weak"
WO 01/16278 CA 02381924 2002-02-13 pCT/US00/23321
builders (as compared with phosphates) such as citrate, or in the so-called
"underbuilt" situation
that may occur with zeolite or layered silicate builders.
Examples of silicate builders are the alkali metal silicates, particularly
those having a
Si02:Na20 ratio in the range 1.6:1 to 3.2:1 and layered silicates, such as the
layered sodium
silicates described in U.S. 4,664,839 Rieck, issued May 12, 1987. NaSKS-6 is
the trademark for
a crystalline layered silicate marketed by Hoechst (commonly abbreviated
herein as "SKS-6").
Unlike zeolite builders, the Na SKS-6 silicate builder does not contain
aluminum. NaSKS-6 has
the delta-Na2Si05 morphology form of layered silicate. It can be prepared by
methods such as
those described in German DE-A-3,417,649 and DE-A-3,742,043. SKS-6 is a highly
preferred
layered silicate for use herein, but other such layered silicates, such as
those having the general
formula NaMSix02x+1 ~yH20 wherein M is sodium or hydrogen, x is a number from
1.9 to 4,
preferably 2, and y is a number from 0 to 20, preferably 0 can be used herein.
Various other
layered silicates from Hoechst include NaSKS-5, NaSKS-7 and NaSKS-11, as the
alpha, beta and
gamma forms. As noted above, the delta-Na2Si05 (NaSKS-6 form) is most
preferred for use
herein. Other silicates may also be useful such as for example magnesium
silicate, which can
serve as a crispening agent in granular formulations, as a stabilizing agent
for oxygen bleaches,
and as a component of suds control systems.
Examples of carbonate builders are the alkaline earth and alkali metal
carbonates as
disclosed in German Patent Application No. 2,321,001 published on November 15,
1973.
Aluminosilicate builders are useful in the present invention. Aluminosilicate
builders are
of great importance in most currently marketed heavy duty granular detergent
compositions, and
can also be a significant builder ingredient in liquid detergent formulations.
Aluminosilicate
builders include those having the empirical formula:
[Mz(zA102)y]-xH20
wherein z and y are integers of at least 6, the molar ratio of z to y is in
the range from 1.0 to about
0.5, and x is an integer from about 15 to about 264.
Useful aluminosilicate ion exchange materials are commercially available.
These
aluminosilicates can be crystalline or amorphous in structure and can be
naturally-occurnng
aluminosilicates or synthetically derived. A method for producing
aluminosilicate ion exchange
materials is disclosed in U.S. 3,985,669, Krummel et al, issued October 12,
1976. Preferred
synthetic crystalline aluminosilicate ion exchange materials useful herein are
available under the
designations Zeolite A, Zeolite P (B), Zeolite MAP and Zeolite X. In an
especially preferred
embodiment, the crystalline aluminosilicate ion exchange material has the
formula:
Nal2[(A102)12(Si02)12]~xH20
36
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
wherein x is from about 20 to about 30, especially about 27. This material is
known as Zeolite A.
Dehydrated zeolites (x = 0 - 10) may also be used herein. Preferably, the
aluminosilicate has a
particle size of about 0.1-10 microns in diameter.
Organic detergent builders suitable for the purposes of the present invention
include, but
are not restricted to, a wide variety of polycarboxylate compounds. As used
herein, "poly-
carboxylate" refers to compounds having a plurality of carboxylate groups,
preferably at least 3
carboxylates. Polycarboxylate builder can generally be added to the
composition in acid form,
but can also be added in the form of a neutralized salt. When utilized in salt
form, alkali metals,
such as sodium, potassium, and lithium, or alkanolammonium salts are
preferred.
Included among the polycarboxylate builders are a variety of categories of
useful mate-
rials. One important category of polycarboxylate builders encompasses the
ether polycarboxy-
lates, including oxydisuccinate, as disclosed in U.S. 3,128,287 Berg, issued
April 7, 1964, U.S.
3,635,830 Lamberti et al., issued January 18, 1972, and U.S. 3,936,448
Lamberti, issued
February 3, 1976. See also "TMS/TDS" builders of U.S. 4,663,071 Bush et al.,
issued May 5,
1987. Suitable ether polycarboxylates also include cyclic compounds,
particularly alicyclic
compounds, such as those described in U.S. 3,923,679 Rapko, issued December 2,
1975; U.S.
4,158,635 Crutchfield et al., issued June 19, 1979; U.S. 4,120,874 Crutchfield
et al., issued
October 17, 1978; and U.S. 4,102,903 Crutchfield et al., issued July 25, 1978.
Other useful detergency builders include the ether hydroxypolycarboxylates,
copolymers
of malefic anhydride with ethylene or vinyl methyl ether, I, 3, 5-trihydroxy
benzene-2, 4, 6
trisulphonic acid, and carboxymethyloxysuccinic acid, the various alkali
metal, ammonium and
substituted ammonium salts of polyacetic acids such as ethylenediamine
tetraacetic acid and
nitrilotriacetic acid, as well as polycarboxylates such as mellitic acid,
succinic acid, oxydisuccinic
acid, polymaleic acid, benzene 1,3,5-tricarboxylic acid,
carboxymethyloxysuccinic acid, and
soluble salts thereof.
Citrate builders, e.g., citric acid and soluble salts thereof (particularly
sodium salt), are
polycarboxylate builders of particular importance for heavy duty liquid
detergent formulations
due to their availability from renewable resources and their biodegradability.
Citrates can also be
used in granular compositions, especially in combination with zeolite and/or
layered silicate
builders. Oxydisuccinates are also especially useful in such compositions and
combinations.
Also suitable in the bleach systems of the present invention are the 3,3-
dicarboxy-4-oxa-
1,6-hexanedioates and the related compounds disclosed in U.S. 4,566,984, Bush,
issued January
28, 1986. Useful succinic acid builders include the CS-C20 alkyl and alkenyl
succinic acids and
salts thereof. A particularly preferred compound of this type is
dodecenylsuccinic acid. Specific
examples of succinate builders include: laurylsuccinate, myristylsuccinate,
palmitylsuccinate, 2-
37
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
dodecenylsuccinate (preferred), 2-pentadecenylsuccinate, and the like.
Laurylsuccinates are the
preferred builders of this group, and are described in European Patent
Application
86200690.5/0,200,263, published November 5, 1986.
Other suitable polycarboxylates are disclosed in U.S. 4,144,226, Crutchfield
et al., issued
March 13, 1979 and in U.S. 3,308,067, Diehl, issued March 7, 1967. See also
Diehl U.S. Patent
3,723,322.
Fatty acids, e.g., C12-Clg monocarboxylic acids, can also be incorporated into
the
compositions alone, or in combination with the aforesaid builders, especially
citrate and/or the
succinate builders, to provide additional builder activity. Such use of fatty
acids will generally
result in a diminution of sudsing, which should be taken into account by the
formulator.
In situations where phosphorus-based builders can be used, and especially in
the for-
mulation of bars used for hand-laundering operations, the various alkali metal
phosphates such as
the well-known sodium tripolyphosphates, sodium pyrophosphate and sodium
orthophosphate
can be used. Phosphonate builders such as ethane-I-hydroxy-I,I-diphosphonate
and other
known phosphonates (see, for example, U.S. Patents 3,159,581; 3,213,030;
3,422,021; 3,400,148
and 3,422,137) can also be used.
Chelatin~ Agents - The bleach systems herein may also optionally contain one
or more
iron and/or manganese chelating agents. Such chelating agents can be selected
from the group
consisting of amino carboxylates, amino phosphonates, polyfunctionally-
substituted aromatic
chelating agents and mixtures therein, all as hereinafter defined. Without
intending to be bound
by theory, it is believed that the benefit of these materials is due in part
to their exceptional ability
to remove iron and manganese ions from washing solutions by formation of
soluble chelates.
Examples of suitable chelating agents and levels of use are described in U.S.
Pat. Nos.
5,576,282 and 5,728,671.
A preferred biodegradable chelator for use herein is ethylenediamine
disuccinate
("EDDS"), especially the [S,S] isomer as described in U.S. Patent 4,704,233,
November 3, 1987,
to Hartman and Perkins.
The compositions herein may also contain water-soluble methyl glycine diacetic
acid
(MGDA) salts (or acid form) as a chelant or co-builder useful with, for
example, insoluble
builders such as zeolites, layered silicates and the like.
If utilized, these chelating agents will generally comprise from about 0.1% by
weight of
the bleach systems herein to about 15%, more preferably 3.0% by weight of the
bleach systems
herein.
Dye Transfer Inhibiting dents - The bleach systems of the present invention
may also
include one or more compounds, dye transfer inhibiting agents, for inhibiting
dye transfer from
38
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
one fabric to another of solubilized and suspended dyes encountered during
fabric laundering and
conditioning operations involving colored fabrics.
Suitable polymeric dye transfer inhibiting agents include, but are not limited
to,
polyvinylpyrrolidone polymers, polyamine N-oxide polymers, copolymers of N-
vinylpyrrolidone
and N-vinylimidazole, polyvinyloxazolidones and polyvinylimidazoles or
mixtures thereof.
Examples of such dye transfer inhibiting agents are disclosed in U.S. Pat.
Nos. 5,707,950 and
5,707,951.
Additional suitable dye transfer inhibiting agents include, but are not
limited to, cross-
linked polymers. Cross-linked polymers are polymers whose backbone are
interconnected to a
certain degree; these links can be of chemical or physical nature, possibly
with active groups on
the backbone or on branches. Cross-linked polymers have been described in the
Journal of
Polymer Science, volume 22, pages 1035-1039.
In one embodiment, the cross-linked polymers are made in such a way that they
form a
three-dimensional rigid structure, which can entrap dyes in the pores formed
by the three-
1 S dimensional structure.
In another embodiment, the cross-linked polymers entrap dyes by swelling.
Suitable cross-linked polymers are described in the co-pending European patent
application 94870213.9.
Addition of such polymers also enhances the performance of the enzymes within
the
bleach systems herein.
The dye transfer inhibiting agents have the ability to complex or adsorb
fugitive dyes
wash out of dyed fabrics before the dyes have the opportunity to become
attached to other articles
in the wash.
When present in the bleach systems herein, the dye transfer inhibiting agents
are present at
levels from about 0.0001 %, more preferably about 0.01 %, most preferably
about 0.05% by weight
of the bleach systems to about 10%, more preferably about 2%, most preferably
about 1 % by
weight of the bleach systems.
Dispersants - The bleach systems of the present invention can also contain
dispersants.
Suitable water-soluble organic salts are the homo- or co-polymeric acids or
their salts, in which
the polycarboxylic acid comprises at least two carboxyl radicals separated
from each other by not
more than two carbon atoms.
Polymers of this type are disclosed in GB-A-1,596,756. Examples of such salts
are
polyacrylates of MW 2000-5000 and their copolymers with malefic anhydride,
such copolymers
having a molecular weight of from 1,000 to 100,000.
39
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
Especially, copolymer of acrylate and methylacrylate such as the 480N having a
molecular weight of 4000, at a level from 0.5-20% by weight of composition can
be added in the
detergent compositions of the present invention.
The compositions of the invention may contain a lime soap peptiser compound,
which has
a lime soap dispersing power (LSDP), as defined hereinafter of no more than 8,
preferably no
more than 7, most preferably no more than 6. The lime soap peptiser compound
is preferably
present at a level from 0% to 20% by weight.
A numerical measure of the effectiveness of a lime soap peptiser is given by
the lime soap
dispersant power (LSDP) which is determined using the lime soap dispersant
test as described in
an article by H.C. Borghetty and C.A. Bergman, J. Am. Oil. Chem. Soc., volume
27, pages 88-90,
(1950). This lime soap dispersion test method is widely used by practitioners
in this art field being
referred to, for example, in the following review articles; W.N. Linfield,
Surfactant science Series,
Volume 7, page 3; W.N. Linfield, Tenside surf. det., volume 27, pages 159-163,
(1990); and M.K.
Nagarajan, W.F. Masler, Cosmetics and Toiletries, volume 104, pages 71-73,
(1989). The LSDP
is the % weight ratio of dispersing agent to sodium oleate required to
disperse the lime soap
deposits formed by 0.025g of sodium oleate in 30m1 of water of 333ppm CaCo3
(Ca:Mg=3:2)
equivalent hardness.
Surfactants having good lime soap peptiser capability will include certain
amine oxides,
betaines, sulfobetaines, alkyl ethoxysulfates and ethoxylated alcohols.
Exemplary surfactants having a LSDP of no more than 8 for use in accord with
the
present invention include C 16-C 1 g dimethyl amine oxide, C 12-C 1 g alkyl
ethoxysulfates with an
average degree of ethoxylation of from 1-5, particularly C12-C15 alkyl
ethoxysulfate surfactant
with a degree of ethoxylation of amount 3 (LSDP=4), and the C14-C15
ethoxylated alcohols with
an average degree of ethoxylation of either 12 (LSDP=6) or 30, sold under the
tradenames
Lutensol A012 and Lutensol A030 respectively, by BASF GmbH.
Polymeric lime soap peptisers suitable for use herein are described in the
article by M.K.
Nagarajan, W.F. Masler, to be found in Cosmetics and Toiletries, volume 104,
pages 71-73,
(1989).
Hydrophobic bleaches such as 4-[N-octanoyl-6-aminohexanoyl]benzene sulfonate,
4-[N-
nonanoyl-6-aminohexanoyl]benzene sulfonate, 4-[N-decanoyl-6-
aminohexanoyl]benzene
sulfonate and mixtures thereof; and nonanoyloxy benzene sulfonate together
with hydrophilic /
hydrophobic bleach formulations can also be used as lime soap peptisers
compounds.
Enzymes - The bleach systems can comprise in addition to the amylase of the
present
invention one or more detergent enzymes which provide cleaning performance
and/or fabric care
benefits. Such enzymes can include proteases, amylases, cellulases and
lipases. They may be
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
incorporated into the non-aqueous liquid bleach systems herein in the form of
suspensions,
"marumes" or "prills". Another suitable type of enzyme comprises those in the
form of slurries of
enzymes in nonionic surfactants, e.g., the enzymes marketed by Novo Nordisk
under the
tradename "SL" or the microencapsulated enzymes marketed by Novo Nordisk under
the
tradename "LDP." Suitable enzymes and levels of use are described in U.S. Pat.
No. 5,576,282.
Enzymes added to the compositions herein in the form of conventional enzyme
prills are
especially preferred for use herein. Such prills will generally range in size
from about 100 to
1,000 microns, more preferably from about 200 to 800 microns and will be
suspended throughout
the non-aqueous liquid phase of the composition. Prills in the compositions of
the present
invention have been found, in comparison with other enzyme forms, to exhibit
especially
desirable enzyme stability in terms of retention of enzymatic activity over
time. Thus,
compositions which utilize enzyme prills need not contain conventional enzyme
stabilizing such
as must frequently be used when enzymes are incorporated into aqueous liquid
detergents.
Examples of suitable enzymes include, but are not limited to, hemicellulases,
peroxidases,
proteases, cellulases, xylanases, lipases, phospholipases, esterases,
cutinases, pectinases,
keratanases, reductases, oxidases, phenoloxidases, lipoxygenases, ligninases,
pullulanases,
tannases, pentosanases, malanases, 13-glucanases, arabinosidases,
hyaluronidase, chondroitinase,
laccase, known amylases, mannanases, xyloglucanases and mixtures thereof. A
preferred
combination is a bleach system having a cocktail of conventional applicable
enzymes like
protease, lipase, cutinase and/or cellulase in conjunction with the amylase of
the present
invention.
Examples of such suitable enzymes are disclosed in U.S. Patent Nos. 5,576,282,
5,728,671 and 5,707,950
Suitable proteases are the subtilisins which are obtained from particular
strains of B.
subtilis and B. licheniformis (subtilisin BPN and BPN'). One suitable protease
is obtained from a
strain of Bacillus, having maximum activity throughout the pH range of 8-12,
developed and sold
as ESPERASE~ by Novo Industries A/S of Denmark, hereinafter "Novo". The
preparation of
this enzyme and analogous enzymes is described in GB 1,243,784 to Novo. Other
suitable
proteases include ALCALASE~, DURAZYM~ and SAVINASE~ from Novo and
MAXATASE~~ MAXACAL~, PROPERASE~ and MAXAPEM~ (protein engineered
Maxacal) from Gist-Brocades. Proteolytic enzymes also encompass modified
bacterial serine
proteases, such as those described in European Patent Application Serial
Number 87 303761.8,
filed April 28, 1987 (particularly pages 17, 24 and 98), and which is called
herein "Protease B",
and in European Patent Application 199,404, Venegas, published October 29,
1986, which refers
to a modified bacterial serine protealytic enzyme which is called "Protease A"
herein. More
41
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
preferred is what is called herein "Protease C", which is a variant of an
alkaline serine protease
from Bacillus in which lysine replaced arginine at position 27, tyrosine
replaced valine at position
104, serine replaced asparagine at position 123, and alanine replaced
threonine at position 274.
Protease C is described in EP 90915958:4, corresponding to WO 91/06637,
Published May 16,
1991. Genetically modified variants, particularly of Protease C, are also
included herein. See also
a high pH protease from Bacillus sp. NCIMB 40338 described in WO 93/18140 A to
Novo.
Enzymatic detergents comprising protease, one or more other enzymes, and a
reversible protease
inhibitor are described in WO 92/03529 A to Novo. When desired, a protease
having decreased
adsorption and increased hydrolysis is available as described in WO 95/07791
to Procter &
Gamble. A recombinant trypsin-like protease for detergents suitable herein is
described in WO
94/25583 to Novo.
In more detail, the protease referred to as "Protease D" is a carbonyl
hydrolase variant
having an amino acid sequence not found in nature, which is derived from a
precursor carbonyl
hydrolase by substituting a different amino acid for a plurality of amino acid
residues at a position
in said carbonyl hydrolase equivalent to position +76, preferably also in
combination with one or
more amino acid residue positions equivalent to those selected from the group
consisting of +99,
+101, +103, +104, +107, +123, +27, +105, +109, +126, +128, +135, +156, +166,
+195, +197,
+204, +206, +210, +216, +217, +218, +222, +260, +265, and/or +274 according to
the numbering
of Bacillus amyloliquefaciens subtilisin, as described in WO 95/10615
published April 20, 1995
by Genencor International. Also suitable for the present invention are
proteases described in
patent applications EP 251 446 and W091/06637 and protease BLAP~ described in
W091/02792. The proteolytic enzymes are incorporated in the bleach systems of
the present
invention a level of from 0.0001 % to 2%, preferably from 0.001 % to 0.2%,
more preferably from
0.005% to 0.1 % pure enzyme by weight of the composition.
Useful proteases are also described in PCT publications: WO 95/30010 published
November 9, 1995 by The Procter & Gamble Company; WO 95/30011 published
November 9,
1995 by The Procter & Gamble Company; WO 95/29979 published November 9, 1995
by The
Procter & Gamble Company.
Other particularly useful proteases are multiply-substituted protease variants
comprising a
substitution of an amino acid residue with another naturally occurring amino
acid residue at an
amino acid residue position corresponding to position 103 of Bacillus
amyloliquefaciens subtilisin
in combination with a substitution of an amino acid residue with another
naturally occurring
amino acid residue at one or more amino acid residue positions corresponding
to positions 1, 3, 4,
8, 9, 10, 12, 13, 16, 17, 18, 19, 20, 21, 22, 24, 27, 33, 37, 38, 42, 43, 48,
55, 57, 58, 61, 62, 68, 72,
75, 76, 77, 78, 79, 86, 87, 89, 97, 98, 99, 101, 102, 104, 106, 107, 109, 111,
114, 116, 117, 119,
42
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
121, 123, 126, 128, 130, 131, 133, 134, 137, 140, 141, 142, 146, 147, 158,
159, 160, 166, 167,
170, 173, 174, 177, 181, 182, 183, 184, 185, 188, 192, 194, 198, 203, 204,
205, 206, 209, 2I0,
211, 212, 213, 214, 215, 216, 217, 218, 222, 224, 227, 228, 230, 232, 236,
237, 238, 240, 242,
243, 244, 245, 246, 247, 248, 249, 251, 252, 253, 254, 255, 256, 257, 258,
259, 260, 261, 262,
263, 265, 268, 269, 270, 271, 272, 274 and 275 of Bacillus amyloliquefaciens
subtilisin; wherein
when said protease variant includes a substitution of amino acid residues at
positions
corresponding to positions 103 and 76, there is also a substitution of an
amino acid residue at one
or more amino acid residue positions other than amino acid residue positions
corresponding to
positions 27, 99, 101, 104, 107, 109, 123, 128, 166, 204, 206, 210, 216, 217,
218, 222, 260, 265
or 274 of Bacillus amyloliquefaciens subtilisin and/or multiply-substituted
protease variants
comprising a substitution of an amino acid residue with another naturally
occurring amino acid
residue at one or more amino acid residue positions corresponding to positions
62, 212, 230, 232,
252 and 257 of Bacillus amyloliquefaciens subtilisin as described in PCT
Published Application
Nos. WO 99/20727, WO 99/20726, and WO 99/20723 all owned by The Procter &
Gamble
Company.
More preferably the protease variant includes a substitution set selected from
the group
consisting of:
12/76/ 103/ 104/ 130/222/245/261;
62/103/104/159/232/236/245/248/252;
62/103/104/159/213/232/236/245/248/252;
62/101/103/104/159/212/213/232/236/245/248/252;
68/103/104/159/232/236/245;
68/103/104/159/230/232/236/245;
68/103/ 104/ 159/209/232/236/245;
68/ 103/ 104/ 159/232/236/245/257;
68/76/103/104/159/213/232/236/245/260;
68/103/104/159/213/232/236/245/248/252;
68/103/104/159/183/232/236/245/248/252;
68/103/104/159/185/232/236/245/248/252;
68/103/104/159/185/210/232/236/245/248/252;
68/103/104/159/210/232/236/245/248/252;
68/ 103/ 104/ 159/213/232/236/245;
98/103/104/159/232/236/245/248/252;
98/ 102/ 103/ 104/ 159/212/232/236/245/248/252;
43
CA 02381924 2002-02-13
WO 01/16278 PCT/CJS00/23321
101/103/104/159/232/236/245/248/252;
I 02/103/104/159/232/236/245/248/252;
I 03/ 104/ 159/230/23 6/245;
103/104/159/232/236/245/248/252;
103/104/159/217/232/236/245/248/252;
103/104/130/159/232/236/245/248/252;
103/ 104/ 131 / 159/232/236/245/248/252;
103/104/159/213/232/236/245/248/252; and
103/104/159/232/236/245.
Still even more preferably the protease variant includes a substitution set
selected from the group
consisting of:
12R/76D/103A/104T/130T/222S/245R/261 D;
62D/103A/104I/159D/232V/236H/245R/248D/252K;
62D/103A/104I/159D/213R/232V/236H/245R/248D/252K;
68A/103A/104I/159D/209W/232V/236H/245R;
68A/76D/103A/104I/159D/213R/232V/236H/245R/260A;
68A/103A/104I/159D/213E/232V/236H/245R/248D/252K;
68A/103A/104I/159D/183D/232V/236H/245R/248D/252K;
68A/103A/104I/159D/232V/236H/245R;
68A/103A/104I/159D/230V/232V/236H/245R;
68A/103A/104I/159D/232V/236H/245R/257V;
68A/103A/104I/159D/213G/232V/236H/245R/248D/252K;
68A/103A/104I/159D/185D/232V/236H/245R/248D/252K;
68A/103A/104I/159D/185D/21 OL/232V/236H/245R/248D/252K;
68A/103A/104I/159D/210L/232V/236H/245R/248D/252K;
68A/103A/104I/159D/213G/232V/236H/245R;
98L/103A/104I/159D/232V/236H/245R/248D/252K;
98L/102A/103A/104I/159D/212G/232V/236H/245R/248D/252K;
101 G/103A/104I/159D/232V/236H/245R/248D/252K;
102A/103A/104I/159D/232V/236H/245R/248D/252K;
103A/104I/159D/230V/236H/245R;
103A/104I/159D/232V/236H/245R/248D/252K;
103A/104I/159D/217E/232V/236H/245R/248D/252K;
44
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
103A/ 104I/ 130G/ 159D/232V/236H/245R/248D/252K;
103A/104I/131 V/159D/232V/236H/245R/248D/252K;
103A/104I/159D/213R/232V/236H/245R/248D/252K; and
103A/104I/159D/232V/236H/245R.
Most preferably the protease variant includes the substitution set
101/103/104/159/232/
236/245/248/252, preferably lOIG/103A/104I/159D/232V/236H/245R/248D/252K.
The cellulases usable in the present invention include both bacterial or
fungal cellulase.
Preferably, they will have a pH optimum of between 5 and 9.5. Suitable
cellulases are disclosed in
U.S. Patent 4,435,307, Barbesgoard et al, which discloses fungal cellulase
produced from
Humicola insolens. Suitable cellulases are also disclosed in GB-A-2.075.028;
GB-A-2.095.275
and DE-OS-2.247.832.
Examples of such cellulases are cellulases produced by a strain of Humicola
insolens
(Humicola grisea var. thermoidea), particularly the Humicola strain DSM 1800.
Other suitable cellulases are cellulases originated from Humicola insolens
having a
molecular weight of about 50KDa, an isoelectric point of 5.5 and containing
415 amino acids; and
a "'43kD endoglucanase derived from Humicola insolens, DSM 1800, exhibiting
cellulase activity;
a preferred endoglucanase component has the amino acid sequence disclosed in
PCT Patent
Application No. WO 91/17243. Also suitable cellulases are the EGIII cellulases
from
Trichoderma longibrachiatum described in W094/21801, Genencor, published
September 29,
1994. Especially suitable cellulases are the cellulases having color care
benefits. Examples of
such cellulases are cellulases described in European patent application No.
91202879.2, filed
November 6, 1991 (Novo). Carezyme and Celluzyme (Novo Nordisk A/S) are
especially useful.
See also W091/17243.
Peroxidase enzymes are known in the art, and include, for example, horseradish
peroxidase, ligninase and haloperoxidase such as chloro- and bromo-peroxidase.
Peroxidase
containing bleach systems are disclosed, for example, in U.S. Patent Nos.
5,576,282, 5,728,671
and 5,707,950, PCT International Applications WO 89/099813, W089/09813 and in
European
Patent application EP No. 91202882.6, filed on November 6, 1991 and EP No.
96870013.8, filed
February 20, 1996. Also suitable is the laccase enzyme.
Preferred enhancers are substituted phenthiazine and phenoxasine 10
Phenothiazinepropionicacid (PPT), 10-ethylphenothiazine-4-carboxylic acid
(EPC), 10
phenoxazinepropionic acid (POP) and 10-methylphenoxazine (described in WO
94/12621) and
substituted syringates (C3-C5 substituted alkyl syringates) and phenols.
Sodium percarbonate or
perborate are preferred sources of hydrogen peroxide.
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
Said peroxidases are normally incorporated in the bleach system at levels from
0.0001%
to 2% of active enzyme by weight of the bleach system.
Other preferred enzymes that can be included in the bleach systems of the
present
invention include lipases. Suitable lipase enzymes for detergent usage include
those produced by
microorganisms of the Pseudomonas group, such as Pseudomonas stutzeri ATCC
19.154, as
disclosed in British Patent 1,372,034. Suitable lipases include those which
show a positive
immunological cross-reaction with the antibody of the lipase, produced by the
microorganism
Pseudomonas fluorescent IAM 1057. This lipase is available from Amano
Pharmaceutical Co.
Ltd., Nagoya, Japan, under the trade name Lipase P "Amano," hereinafter
referred to as "Amano-
P". Other suitable commercial lipases include Amano-CES, lipases ex
Chromobacter viscosum,
e.g. Chromobacter viscosum var. lipolyticum NRRLB 3673 from Toyo Jozo Co.,
Tagata, Japan;
Chromobacter viscosum lipases from U.S. Biochemical Corp., U.S.A. and Disoynth
Co., The
Netherlands, and lipases ex Pseudomonas gladioli. Especially suitable lipases
are lipases such as
M1 LIPASE~ and LIPOMAX~ (Gist-Brocades) and LIPOLASE~ and LIPOLASE
ULTRA~(Novo) which have found to be very effective when used in combination
with the
compositions of the present invention.
Also suitable are cutinases [EC 3.1.1.50] which can be considered as a special
kind of
lipase, namely lipases which do not require interfacial activation. Addition
of cutinases to bleach
systems have been described in e.g. WO 88/09367 (Genencor).
The lipases and/or cutinases are normally incorporated in the bleach system at
levels from
0.0001% to 2% of active enzyme by weight of the bleach system.
Known amylases (a and/or 13) can be included for removal of carbohydrate-based
stains.
WO 94/02597, Novo Nordisk A/S published February 03, 1994, describes cleaning
compositions
which incorporate mutant amylases. See also W094/18314, Genencor, published
August 18, 1994
and W095/10603, Novo Nordisk A/S, published April 20, 1995. Other amylases
known for use
in bleach systems include both a- and (3-amylases. a-Amylases are known in the
art and include
those disclosed in US Pat. 5,003,257; EP 252,666; WO 91/00353; FR 2,676,456;
EP 285,123; EP
525,610; EP 368,341; and British Patent Specification No. 1,296,839 (Novo).
Other suitable
amylase are stability-enhanced amylases including PURAFACT OX AM~ described in
WO
94/18314, published August 18, 1994 and W096/05295, Genencor, published
February 22, 1996
and amylase variants from Novo Nordisk A/S, disclosed in WO 95/10603,
published April 95.
Examples of commercial a-amylases products are TERMAMYL~, BAN~,
FUNGAMYL~ and DURAMYL~, all available from Novo Nordisk A/S Denmark.
W095/26397 describes other suitable amylases : a-amylases characterized by
having a specific
activity at least 25% higher than the specific activity of TERMAMYL~ at a
temperature range of
46
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
25°C to 55°C and at a pH value in the range of 8 to 10, measured
by the Phadebas~ a-amylase
activity assay. Other amylolytic enzymes with improved properties with respect
to the activity
level and the combination of thermostability and a higher activity level are
described in
W095/35382.
The compositions of the present invention may also comprise a mannanase
enzyme.
Preferably, the mannanase is selected from the group consisting of: three
mannans-degrading
enzymes : EC 3.2.1.25 : (3-mannosidase, EC 3.2.1.78 : Endo-1,4-[3-mannosidase,
referred therein
after as "mannanase" and EC 3.2.1.100 : 1,4-(3-mannobiosidase and mixtures
thereof. (IUPAC
Classification- Enzyme nomenclature, 1992 ISBN 0-12-227165-3 Academic Press).
More preferably, the treating compositions of the present invention, when a
mannanase is
present, comprise a (3-1,4-Mannosidase (E.C. 3.2.1.78) referred to as
Mannanase. The term
"mannanase" or "galactomannanase" denotes a mannanase enzyme defined according
to the art as
officially being named mannan endo-1,4-beta-mannosidase and having the
alternative names beta-
mannanase and endo-1,4-mannanase and catalysing the reaction: random
hydrolysis of 1,4-beta-
D- mannosidic linkages in mannans, galactomannans, glucomannans, and
galactoglucomannans.
In particular, Mannanases (EC 3.2.1.78) constitute a group of polysaccharases
which
degrade mannans and denote enzymes which are capable of cleaving polyose
chains containing
mannose units, i.e. are capable of cleaving glycosidic bonds in mannans,
glucomannans,
galactomannans and galactogluco-mannans. Mannans are polysaccharides having a
backbone
composed of (3-1,4- linked mannose; glucomannans are polysaccharides having a
backbone or
more or less regularly alternating ~3-1,4 linked mannose and glucose;
galactomannans and
galactoglucomannans are mannans and glucomannans with a-1,6 linked galactose
sidebranches.
These compounds may be acetylated.
The degradation of galactomannans and galactoglucomannans is facilitated by
full or
partial removal of the galactose sidebranches. Further the degradation of the
acetylated mannans,
glucomannans, galactomannans and galactogluco-mannans is facilitated by full
or partial
deacetylation. Acetyl groups can be removed by alkali or by mannan
acetylesterases. The
oligomers which are released from the mannanases or by a combination of
mannanases and a
galactosidase and/or mannan acetyl esterases can be further degraded to
release free maltose by (3
mannosidase and/or (3-glucosidase.
Mannanases have been identified in several Bacillus organisms. For example,
Talbot et
al., Appl. Environ. Microbiol., Vo1.56, No. 1 l, pp. 3505-3510 (1990)
describes a beta-mannanase
derived from Bacillus stearothermophilus in dimer form having molecular weight
of 162 kDa and
an optimum pH of 5.5-7.5. Mendoza et al., World J. Microbiol. Biotech., Vol.
10, No. 5, pp. 551-
555 (1994) describes a beta-mannanase derived from Bacillus subtilis having a
molecular weight
47
CA 02381924 2002-02-13
WO 01/16278 PCT/US00123321
of 38 kDa, an optimum activity at pH 5.0 and SSC and a pI of 4.8. JP-03047076
discloses a beta-
mannanase derived from Bacillus sp., having a molecular weight of 373 kDa
measured by gel
filtration, an optimum pH of 8-10 and a pI of 5.3-5.4. JP-63056289 describes
the production of an
alkaline, thermostable beta-mannanase which hydrolyses beta-1,4-D-
mannopyranoside bonds of
e.g. mannans and produces manno-oligosaccharides. JP-63036774 relates to the
Bacillus
microorganism FERM P-8856 which produces beta-mannanase and beta-mannosidase
at an
alkaline pH. JP-08051975 discloses alkaline beta-mannanases from alkalophilic
Bacillus sp. AM-
001. A purified mannanase from Bacillus amyloliguefaciens useful in the
bleaching of pulp and
paper and a method of preparation thereof is disclosed in WO 97/11164. WO
91/18974 describes
a hemicellulase such as a glucanase, xylanase or mannanase active at an
extreme pH and
temperature. WO 94/25576 discloses an enzyme from Aspergillus aculeatus, CBS
101.43,
exhibiting mannanase activity which may be useful for degradation or
modification of plant or
algae cell wall material. WO 93/24622 discloses a mannanase isolated from
Trichoderma reseei
useful for bleaching lignocellulosic pulps. An hemicellulase capable of
degrading mannan-
containing hemicellulose is described in W091/18974 and a purified mannanase
from Bacillus
amyloliquefaciens is described in W097/11164.
Preferably, the mannanase enzyme will be an alkaline mannanase as defined
below, more
preferably, a mannanase originating from a bacterial source. Especially, the
laundry detergent
composition of the present invention will comprise an alkaline mannanase
selected from the
mannanase from the strain Bacillus agaradhaerens NICMB 40482; the mannanase
from Bacillus
subtilis strain 168, gene yght; the mannanase from Bacillus sp. I633 and/or
the mannanase from
Bacillus sp. AAI12. Most preferred mannanase for the inclusion in the
detergent compositions of
the present invention is the mannanase enzyme originating from Bacillus sp.
I633 as described in
the co-pending Danish patent application No. PA 1998 01340.
The terms "alkaline mannanase enzyme" is meant to encompass an enzyme having
an
enzymatic activity of at least 10%, preferably at least 25%, more preferably
at least 40% of its
maximum activity at a given pH ranging from 7 to 12, preferably 7.5 to 10.5.
The alkaline mannanase from Bacillus agaradhaerens NICMB 40482 is described in
the
co-pending U.S. patent application serial No. 09/111,256. More specifically,
this mannanase is:
i) a polypeptide produced by Bacillus agaradhaerens, NCIMB 40482; or
ii) a polypeptide comprising an amino acid sequence as shown in positions 32-
343
of SEQ ID N0:2 as shown in U.S. patent application serial No. 09/111,256; or
iii) an analogue of the polypeptide defined in i) or ii) which is at least 70%
homologous with said polypeptide, or is derived from said polypeptide by
substitution, deletion or addition of one or several amino acids, or is
48
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
immunologically reactive with a polyclonal antibody raised against said
polypeptide in purified form.
Also encompassed is the corresponding isolated polypeptide having mannanase
activity selected
from the group consisting of:
(a) polynucleotide molecules encoding a polypeptide having mannanase activity
and
comprising a sequence of nucleotides as shown in SEQ ID NO: 1 from nucleotide
97 to nucleotide 1029 as shown in U.S. patent application serial No.
09/111,256;
(b) species homologs of (a);
(c) polynucleotide molecules that encode a polypeptide having mannanase
activity that is at least 70% identical to the amino acid sequence of SEQ ID
NO: 2
from amino acid residue 32 to amino acid residue 343 as shown in U.S. patent
application serial No. 09/111,256;
(d) molecules complementary to (a), (b) or (c); and
(e) degenerate nucleotide sequences of (a), (b), (c) or (d).
The plasmid pSJ1678 comprising the polynucleotide molecule (the DNA sequence)
encoding said mannanase has been transformed into a strain of the Escherichia
coli which was
deposited by the inventors according to the Budapest Treaty on the
International Recognition of
the Deposit of Microorganisms for the Purposes of Patent Procedure at the
Deutsche Sammlung
von Mikroorganismen and Zellkulturen GmbH, Mascheroder Weg 1b, D-38124
Braunschweig,
Federal Republic of Germany, on 18 May 1998 under the deposition number DSM
12180.
A second more preferred enzyme is the mannanase from the Bacillus subtilis
strain 168,
which is described in the co-pending U.S. patent application serial No.
09/095,163. More
specifically, this mannanase is:
i) is encoded by the coding part of the DNA sequence shown in SED ID No. 5
shown in the U.S. patent application serial No. 09/095,163 or an analogue of
said
sequence; and/or
ii) a polypeptide comprising an amino acid sequence as shown SEQ ID N0:6 shown
in the U.S. patent application serial No. 09/095,163; or
iii) an analogue of the polypeptide defined in ii) which is at least 70%
homologous
with said polypeptide, or is derived from said polypeptide by substitution,
deletion or addition of one or several amino acids, or is immunologically
reactive
with a polyclonal antibody raised against said polypeptide in purified form.
Also encompassed in the corresponding isolated polypeptide having mannanase
activity selected
from the group consisting o~
49
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
(a) polynucleotide molecules encoding a polypeptide having mannanase
activity and comprising a sequence of nucleotides as shown in SEQ ID N0:5 as
shown in the U.S. patent application serial No. 09/095,163
(b) species homologs of (a);
(c) polynucleotide molecules that encode a polypeptide having mannanase
activity that is at least 70% identical to the amino acid sequence of SEQ ID
NO: 6
as shown in the U.S. patent application serial No. 09/095,163;
(d) molecules complementary to (a), (b) or (c); and
(e) degenerate nucleotide sequences of (a), (b), (c) or (d).
A third more preferred mannanase is described in the co-pending Danish patent
application No. PA 1998 01340. More specifically, this mannanase is:
i) a polypeptide produced by Bacillus sp. I633;
ii) a polypeptide comprising an amino acid sequence as shown in positions
33-340 of SEQ ID N0:2 as shown in the Danish application No. PA 1998 01340;
or
iii) an analogue of the polypeptide defined in i) or ii) which is at least 65%
homologous with said polypeptide, is derived from said polypeptide by
substitution, deletion or addition of one or several amino acids, or is
immunologically reactive with a polyclonal antibody raised against said
polypeptide in purified form.
Also encompassed is the corresponding isolated polynucleotide molecule
selected from the group
consisting of:
(a) polynucleotide molecules encoding a polypeptide having mannanase activity
and
comprising a sequence of nucleotides as shown in SEQ ID NO: 1 from nucleotide
317 to nucleotide 1243 the Danish application No. PA 1998 01340;
(b) species homologs of (a);
(c) polynucleotide molecules that encode a polypeptide having mannanase
activity that is at least 65% identical to the amino acid sequence of SEQ ID
NO: 2
from amino acid residue 33 to amino acid residue 340 the Danish application
No.
PA 1998 01340;
(d) molecules complementary to (a), (b) or (c); and
(e) degenerate nucleotide sequences of (a), (b), (c) or (d).
The plasmid pBXM3 comprising the polynucleotide molecule (the DNA sequence)
encoding a mannanase of the present invention has been transformed into a
strain of the
Escherichia coli which was deposited by the inventors according to the
Budapest Treaty on the
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
International Recognition of the Deposit of Microorganisms for the Purposes of
Patent Procedure
at the Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH,
Mascheroder Weg Ib,
D-38124 Braunschweig, Federal Republic of Germany, on 29 May 1998 under the
deposition
number DSM 12197.
A fourth more preferred mannanase is described in the Danish co-pending patent
application No. PA 1998 01341. More specifically, this mannanase is:
i) a polypeptide produced by Bacillus sp. AAI 12;
ii) a polypeptide comprising an amino acid sequence as shown in positions
25-362 of SEQ ID N0:2as shown in the Danish application No. PA 1998 01341;
or
iii) an analogue of the polypeptide defined in i) or ii) which is at least 65%
homologous with said polypeptide, is derived from said polypeptide by
substitution, deletion or addition of one or several amino acids, or is
immunologically reactive with a polyclonal antibody raised against said
polypeptide in purified form.
Also encompassed is the corresponding isolated polynucleotide molecule
selected from the group
consisting of
(a) polynucleotide molecules encoding a polypeptide having mannanase activity
and
comprising a sequence of nucleotides as shown in SEQ ID NO: 1 from nucleotide
225 to nucleotide 1236 as shown in the Danish application No. PA 1998 01341;
(b) species homologs of (a);
(c) polynucleotide molecules that encode a polypeptide having mannanase
activity that is at least 65% identical to the amino acid sequence of SEQ ID
NO: 2
from amino acid residue 25 to amino acid residue 362 as shown in the Danish
application No. PA 1998 01341;
(d) molecules complementary to (a), (b) or (c); and
(e) degenerate nucleotide sequences of (a), (b), (c) or (d).
The plasmid pBXMl comprising the polynucleotide molecule (the DNA sequence)
encoding a mannanase of the present invention has been transformed into a
strain of the
Escherichia coli which was deposited by the inventors according to the
Budapest Treaty on the
International Recognition of the Deposit of Microorganisms for the Purposes of
Patent Procedure
at the Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH,
Mascheroder Weg 1b,
D-38124 Braunschweig, Federal Republic of Germany, on 7 October 1998 under the
deposition
number DSM 12433.
51
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
The mannanase, when present, is incorporated into the treating compositions of
the
present invention preferably at a level of from 0.0001 % to 2%, more
preferably from 0.0005% to
0.1 %, most preferred from 0.001 % to 0.02% pure enzyme by weight of the
composition.
The compositions of the present invention may also comprise a xyloglucanase
enzyme.
Suitable xyloglucanases for the purpose of the present invention are enzymes
exhibiting
endoglucanase activity specific for xyloglucan, preferably at a level of from
about 0.001 % to
about 1%, more preferably from about 0.01% to about 0.~%, by weight of the
composition. As
used herein, the term "endoglucanase activity" means the capability of the
enzyme to hydrolyze
1,4-~i-D-glycosidic linkages present in any cellulosic material, such as
cellulose, cellulose
derivatives, lichenin, (3-D-glucan, or xyloglucan. The endoglucanase activity
may be determined
in accordance with methods known in the art, examples of which are described
in WO 94/14953
and hereinafter. One unit of endoglucanase activity (e.g. CMCU, AVIU, XGU or
BGU) is
defined as the production of 1 ~mol reducing sugar/min from a glucan
substrate, the glucan
substrate being, e.g., CMC (CMCU), acid swollen Avicell (AVID), xyloglucan
(XGU) or cereal /3
-glucan (BGU). The reducing sugars are determined as described in WO 94/14953
and
hereinafter. The specific activity of an endoglucanase towards a substrate is
defined as units/mg
of protein.
Suitable are enzymes exhibiting as its highest activity XGU endoglucanase
activity
(hereinafter "specific for xyloglucan"), which enzyme:
i) is encoded by a DNA sequence comprising or included in at least one of the
following
partial sequences
(a) ATTCATTTGT GGACAGTGGA C (SEQ ID No: 1)
(b) GTTGATCGCA CATTGAACCA (SEQ ID NO: 2)
(c) ACCCCAGCCG ACCGATTGTC (SEQ ID NO: 3)
(d) CTTCCTTACC TCACCATCAT (SEQ ID NO: 4)
(e) TTAACATCTT TTCACCATGA (SEQ ID NO: 5)
(f) AGCTTTCCCT TCTCTCCCTT (SEQ ID NO: 6)
(g) GCCACCCTGG CTTCCGCTGC CAGCCTCC (SEQ ID NO: 7)
(h) GACAGTAGCA ATCCAGCATT (SEQ ID NO: 8)
(i) AGCATCAGCC GCTTTGTACA (SEQ ID NO: 9)
(j) CCATGAAGTT CACCGTATTG (SEQ ID NO: 10)
(k) GCACTGCTTC TCTCCCAGGT (SEQ ID NO: 11 )
(1) GTGGGCGGCC CCTCAGGCAA (SEQ ID NO: 12)
(m) ACGCTCCTCC AATTTTCTCT (SEQ ID NO: 13)
(n) GGCTGGTAG TAATGAGTCT (SEQ ID NO: 14)
52
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
(o) GGCGCAGAGT TTGGCCAGGC (SEQ ID NO: 15)
(p) CAACATCCCC GGTGTTCTGG G (SEQ ID NO: 16)
(q) AAAGATTCAT TTGTGGACAG TGGACGTTGA TCGCACATTG AACCAACCCC
AGCCGACCGA
TTGTCCTTCC TTACCTCACC ATCATTTAAC ATCTTTTCAC CATGAAGCTT
TCCCTTCTCT
CCCTTGCCAC CCTGGCTTCC GCTGCCAGCC TCCAGCGCCG CACACTTCTG
CGGTCAGTGG
GATACCGCCA CCGCCGGTGA CTTCACCCTG TACAACGACC TTTGGGGCGA
GACGGCCGGC
ACCGGCTCCC AGTGCACTGG AGTCGACTCC TACAGCGGCG ACACCATCGC
TTGTCACACC
AGCAGGTCCT GGTCGGAGTA GCAGCAGCGT CAAGAGCTAT GCCAACG (SEQ ID
N0:17) or
(r) CAGCATCTCC ATTGAGTAAT CACGTTGGTG TTCGGTGGCC CGCCGTGTTG
CGTGGCGGAG
GCTGCCGGGA GACGGGTGGG GATGGTGGTG GGAGAGAATG TAGGGCGCCG
TGTTTCAGTC
CCTAGGCAGG ATACCGGAAA ACCGTGTGGT AGGAGGTTTA TAGGTTTCCA
GGAGACGCTG
TATAGGGGAT AAATGAGATT GAATGGTGGC CACACTCAAA CCAACCAGGT
CCTGTACATA
CAATGCATAT ACCAATTATA CCTACCAAAA AAAAAAAAAA AAAAAAAAAA AAAA
(SEQ ID N0:18)
or a sequence homologous thereto encoding a polypeptide specific for
xyloglucan with
endoglucanase activity,
ii) is immunologically reactive with an antibody raised against a highly
purified
endoglucanase encoded by the DNA sequence defined in i) and derived from
Aspergillus
aculeatus, CBS 101.43, and is specific for xyloglucan.
More specifically, as used herein the term "specific for xyloglucan" means
that the
endoglucanse enzyme exhibits its highest endoglucanase activity on a
xyloglucan substrate, and
preferably less than 75% activity, more preferably less than SO% activity,
most preferably less
than about 25% activity, on other cellulose-containing substrates such as
carboxymethyl cellulose,
cellulose, or other glucans.
53
WO ()1/16278 CA 02381924 2002-02-13 pCT~JS00/23321
Preferably, the specificity of an endoglucanase towards xyloglucan is further
defined as a
relative activity determined as the release of reducing sugars at optimal
conditions obtained by
incubation of the enzyme with xyloglucan and the other substrate to be tested,
respectively. For
instance, the specificity may be defined as the xyloglucan to (3-glucan
activity (XGU/BGU),
xyloglucan to carboxy methyl cellulose activity (XGU/CMCU), or xyloglucan to
acid swollen
Avicell activity (XGU/AVIU), which is preferably greater than about S0, such
as 75, 90 or 100.
The term "derived from" as used herein refers not only to an endoglucanase
produced by
strain CBS 101.43, but also an endoglucanase encoded by a DNA sequence
isolated from strain
CBS 101.43 and produced in a host organism transformed with said DNA sequence.
The term
"homologue" as used herein indicates a polypeptide encoded by DNA which
hybridizes to the
same probe as the DNA coding for an endoglucanase enzyme specific for
xyloglucan under
certain specified conditions (such as presoaking in SxSSC and prehybridizing
for 1 h at -40°C in a
solution of SxSSC, SxDenhardt's solution, and 50 ~g of denatured sonicated
calf thymus DNA,
followed by hybridization in the same solution supplemented with 50 ~Ci 32-P-
dCTP labeled
probe for 18 h at -40°C and washing three times in 2xSSC, 0.2% SDS at
40°C for 30 minutes).
More specifically, the term is intended to refer to a DNA sequence which is at
least 70%
homologous to any of the sequences shown above encoding an endoglucanase
specific for
xyloglucan, including at least 75%, at least 80%, at least 85%, at least 90%
or even at least 95%
with any of the sequences shown above. The term is intended to include
modifications of any of
the DNA sequences shown above, such as nucleotide substitutions which do not
give rise to
another amino acid sequence of the polypeptide encoded by the sequence, but
which correspond
to the codon usage of the host organism into which a DNA construct comprising
any of the DNA
sequences is introduced or nucleotide substitutions which do give rise to a
different amino acid
sequence and therefore, possibly, a different amino acid sequence and
therefore, possibly, a
different protein structure which might give rise to an endoglucanase mutant
with different
properties than the native enzyme. Other examples of possible modifications
are insertion of one
or more nucleotides into the sequence, addition of one or more nucleotides at
either end of the
sequence, or deletion of one or more nucleotides at either end or within the
sequence.
Endoglucanase specific for xyloglucan useful in the present invention
preferably is one
which has a XGU/BGU, XGU/CMU and/or XGU/AVIU ratio (as defined above) of more
than 50,
such as 75, 90 or 100.
Furthermore, the endoglucanase specific for xyloglucan is preferably
substantially devoid
of activity towards (3-glucan and/or exhibits at the most 25% such as at the
most 10% or about
5%, activity towards carboxymethyl cellulose and/or Avicell when the activity
towards
xyloglucan is 100%. In addition, endoglucanase specific for xyloglucan of the
invention is
54
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
preferably substantially devoid of transferase activity, an activity which has
been observed for
most endoglucanases specific for xyloglucan of plant origin.
Endoglucanase specific for xyloglucan may be obtained from the fungal species
A.
aculeatus, as described in WO 94/14953. Microbial endoglucanases specific for
xyloglucan has
also been described in WO 94/14953. Endoglucanases specific for xyloglucan
from plants have
been described, but these enzymes have transferase activity and therefore must
be considered
inferior to microbial endoglucanses specific for xyloglucan whenever extensive
degradation of
xyloglucan is desirable. An additional advantage of a microbial enzyme is that
it, in general, may
be produced in higher amounts in a microbial host, than enzymes of other
origins.
The xyloglucanase, when present, is incorporated into the treating
compositions of the
invention preferably at a level of from 0.0001% to 2%, more preferably from
0.0005% to 0.1%,
most preferred from 0.001 % to 0.02% pure enzyme by weight of the composition.
The above-mentioned enzymes may be of any suitable origin, such as vegetable,
animal,
bacterial, fungal and yeast origin. Purified or non-purified forms of these
enzymes may be used.
Also included by definition, are mutants of native enzymes. Mutants can be
obtained e.g. by
protein and/or genetic engineering, chemical and/or physical modifications of
native enzymes.
Common practice as well is the expression of the enzyme via host organisms in
which the genetic
material responsible for the production of the enzyme has been cloned.
Said enzymes are normally incorporated in the bleach system at levels from
0.0001% to
2% of active enzyme by weight of the bleach system. The enzymes can be added
as separate
single ingredients (grills, granulates, stabilized liquids, etc. containing
one enzyme ) or as
mixtures of two or more enzymes ( e.g. cogranulates).
Other suitable detergent ingredients that can be added are enzyme oxidation
scavengers.
Examples of such enzyme oxidation scavengers are ethoxylated tetraethylene
polyamines.
A range of enzyme materials and means for their incorporation into synthetic
bleach
systems is also disclosed in WO 93/07263 and WO 93/07260 to Genencor
International, WO
89/08694 to Novo, and U.S. 3,553,139, January 5, 1971 to McCarty et al.
Enzymes are further
disclosed in U.S. 4,101,457, Place et al, July 18, 1978, and in U.S.
4,507,219, Hughes, March 26,
1985. Enzyme materials useful for liquid detergent formulations, and their
incorporation into such
formulations, are disclosed in U.S. 4,261,868, Hora et al, April 14, 1981.
Enzyme Stabilizers - Enzymes for use in detergents can be stabilized by
various
techniques. Enzyme stabilization techniques are disclosed and exemplified in
U.S. 3,600,319,
August 17, 1971, Gedge et al, EP 199,405 and EP 200,586, October 29, 1986,
Venegas. Enzyme
stabilization systems are also described, for example, in U.S. 3,519,570. A
useful Bacillus, sp.
AC13 giving proteases, xylanases and cellulases, is described in WO 9401532 to
Novo. The
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
enzymes employed herein can be stabilized by the presence of water-soluble
sources of calcium
and/or magnesium ions in the finished compositions which provide such ions to
the enzymes.
Suitable enzyme stabilizers and levels of use are described in U.S. Pat. No.
5,576,282.
Other Deter eg-nt Ingredients - The bleach systems herein may also
optionally contain one or more of the following: polymeric dispersing agents,
clay
soil removal/anti-redeposition agents, brighteners, suds suppressors, dyes,
perfumes,
structure elasticizing agents, fabric softeners, carriers, hydrotropes,
processing aids
and/or pigments. Suitable examples of such other detergent ingredients and
levels of
use are found in U.S. Patent No. 5,576,282.
Methods of Cleaning - In addition to the methods for cleaning fabrics, dishes
and other
hard surfaces, and body parts by personal cleansing, described herein, the
invention herein also
encompasses a laundering pretreatment process for fabrics which have been
soiled or stained
comprising directly contacting said stains and/or soils with a highly
concentrated form of the
bleach system set forth above prior to washing such fabrics using conventional
aqueous washing
solutions. Preferably, the bleach system remains in contact with the
soil/stain for a period of from
about 30 seconds to 24 hours prior to washing the pretreated soiled/stained
substrate in
conventional manner. More preferably, pretreatment times will range from about
1 to 180
minutes.
The following examples are meant to exemplify compositions of the present
invention,
but are not necessarily meant to limit or otherwise define the scope of the
invention.
In the following examples some abbreviations known to those of ordinary skill
in the art
are used, consistent with the disclosure set forth herein.
EXAMPLE I
Bleaching detergent compositions having the form of granular laundry
detergents are
exemplified by the following formulations.
A B C D E
Organic Catalyst 0.034 0.06 0.03 0.10 0.05
*
Conventional Activator2.00 2.80 2.00 1.80 5.30
(NOBS)
Conventional Activator0.00 0.00 0.60 0.00 0.00
(TAED)
Sodium Percarbonate5.30 0.00 0.00 4.00 0.00
Sodium Perborate 0.00 5.30 3.60 0.00 4.30
Monohydrate
56
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
Linear Alkylbenzenesulfonate12.00 0.00 12.00 0.00 21.00
C45AE0.6S 0.00 15.00 0.00 15.00 0.00
C2 Dimethylamine N-Oxide0.00 2.00 0.00 2.00 0.00
C12 Coco Amidopropyl 1.50 0.00 1.50 0.00 0.00
Betaine
Palm N- Methyl Glucamide1.70 2.00 1.70 2.00 0.00
C12 Dimethylhydroxyethyl-1.50 0.00 1.50 0.00 0.00
ammonium Chloride
AE23-6.ST 2.50 3.50 2.50 3.50 1.00
C25E3S 4.00 0.00 4.00 0.00 0.00
Sodium Tripolyphosphate25.00 25.00 15.00 15.00 25.00
Acrylic Acid / Malefic0.00 0.00 0.00 0.00 1.00
Acid
Copolymer
Polyacrylic Acid, 3.00 3.00 3.00 3.00 0.00
partially
neutralized
Soil Release Agent 0.00 0.00 0.50 0.40 0.00
Carboxymethylcellulose0.40 0.40 0.40 0.40 0.40
Sodium Carbonate 2.00 2.00 2.00 0.00 8.00
Sodium Silicate 3.00 3.00 3.00 3.00 6.00
Sodium Bicarbonate 5.00 5.00 5.00 5.00 5.00
Savinase (4T) 1.00 1.00 1.00 1.00 0.60
Termamyl (60T) 0.40 0.40 0.40 0.40 0.40
Lipolase ( 1 OOT) 0.12 0.12 0.12 0.12 0.12
Carezyme(5 T) 0.1 0.15 0.1 S 0.15 0.15
S
Diethylenetriaminepenta1.60 1.60 1.60 1.60 0.40
(methylenephosphonic
Acid)
Brightener 0.20 0.20 0.20 0.05 0.20
Sulfonated Zinc 0.50 0.00 0.25 0.00 0.00
Phthalocyanine Photobleach
MgS04 2.20 2.20 2.20 2.20 0.64
NazS04 balancebalancebalance balance balance
'Organic catalyst catalysts
can be any of the described
zwitterionic organic herein,
preferably
it is
an iminium-based organic m-based
catalyst, more preferably organic
it is a dihydroisoquinoliniu
catalyst.
57
WO 01/16278 CA 02381924 2002-02-13 pCT/US00/23321
Any of the above compositions
can be used to launder
fabrics at a concentration
of 3500
ppm in water, 25C, ratio. ypical but can
and a 15:1 water:cloth The pH be can
t is be
about
9.5
adjusted by altering enzenesulfonate.
the proportion of
acid to Na- salt form
of alkylb
$ EXAMPLE
II
Bleaching detergent having
compositions the
form
of granular
laundry
detergents
are
exemplified by the
following formulations.
A B C D E
Organic Catalyst * 0.009 0.04 0.14 0.14 0.002
Conventional Activator1.80 0.00 0.00 1.00 1.00
(NOBS)
Conventional Activator0.00 1.00 2.50 3.00 0.00
(TAED)
Sodium Percarbonate 5.30 0.00 0.00 0.00 0.00
Sodium Perborate 0.00 9.00 17.60 9.00 9.00
Monohydrate
Linear 21.00 12.00 0.00 12.00 12.00
Alkylbenzenesulfonate
C45AE0.6S 0.00 0.00 15.00 0.00 0.00
~
C2 Dimethylamine N-Oxide0.00 0.00 2.00 0.00 0.00
C12 Coco Amidopropyl 0.00 1.50 0.00 1.50 1.50
Betaine
Palm N- Methyl Glucamide0.00 1.70 2.00 1.70 1.70
C12 1.00 1.50 0.00 1.50 1.50
Dimethylhydroxyethylammo
nium Chloride
AE23-6.ST 0.00 2.50 3.50 2.50 2.50
C25E3S 0.00 4.00 0.00 4.00 4.00
Sodium Tripolyphosphate25.00 15.00 25.00 15.00 15.00
Polyacrylic Acid, partially0.00 3.00 3.00 3.00 3.00
neutralized
Soil Release Agent 0.30 0.50 0.00 0.50 0.50
Carboxymethylcellulose0.00 0.40 0.40 0.40 0.40
Sodium Carbonate 0.00 2.00 2.00 2.00 2.00
Sodium Silicate 6.00 3.00 3.00 3.00 3.00
58
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
Sodium Bicarbonate2.00 5.00 5.00 5.00 5.00
Savinase (4T) 0.60 1.00 1.00 1.00 1.00
Termamyl (60T) 0.40 0.40 0.40 0.40 0.40
Lipolase ( 1 OOT) 0.12 0.12 0.12 0.12 0.12
Carezyme(5T) 0.15 0.15 0.15 0.15 0.15
Diethylenetriaminepenta(met0.40 0.00 1.60 0.00 0.00
hylenephosphonic
Acid)
Brightener 0.20 0.30 0.20 0.30 0.30
Sulfonated Zinc 0.25 0.00 0.00 0.00 0.00
Phthalocyanine
Photobleach
MgS04 0.64 0.00 2.20 0.00 0.00
Na2S04 balance balance balance balancebalance
'Organic catalyst f the scribedin, preferably
can be any o zwitterionic here it is
organic
catalysts
de
an iminium-based alyst, preferablyis a isoquinolinium-based
organic cat more it dihydro organic
catalyst.
Any of the above compositions can be used to launder fabrics at a
concentration of 3500
ppm in water, 25°C, and a 15:1 water:cloth ratio. The typical pH is
about 9.5 but can be can be
adjusted by altering the proportion of acid to Na- salt form of
alkylbenzenesulfonate.
EXAMPLE III
A bleaching detergent powder in accordance with the present invention
comprises the
following ingredients:
Component Weight
Organic Catalyst* 0.01
NOBS 2.0
Sodium Perborate Tetrahydrate 10
C12 linear alkyl benzene sulfonate 8
Phosphate (as sodium tripolyphosphate) 9
Sodium carbonate 20
Talc 15
Brightener, perfume 0.3
Sodium Chloride 25
Water and Minors Balance to 100%
59
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
'Organic catalyst can be any of the zwitterionic organic catalysts described
herein, preferably it is
an iminium-based organic catalyst, more preferably it is a
dihydroisoquinolinium-based organic
catalyst.
EXAMPLE IV
A laundry bar suitable for hand-washing soiled fabrics is prepared by
standard extrusion processes and comprises the following:
Component Weight
Organic Catalyst* 0.02
NOBS 1.7
TAED 0.2
Sodium Perborate Tetrahydrate 12
C12 linear alkyl benzene sulfonate 30
Phosphate (as sodium tripolyphosphate) 10
Sodium carbonate 5
Sodium pyrophosphate 7
Coconut monoethanolamide 2
Zeolite A (0.1-10 micron) 5
Carboxymethylcellulose 0.2
Polyacrylate (m.w. 1400) 0.2
Brightener, perfume 0.2
Protease 0.3
CaS04 1
MgS04 1
Water 4
Fillerz Balance to 100%
'Organic catalyst can be any of the zwitterionic organic catalysts described
herein, preferably it is
an iminium-based organic catalyst, more preferably it is a
dihydroisoquinolinium-based organic
catalyst.
2 Can be selected from convenient materials such as CaC03, talc, clay,
silicates, and the like.
Acidic fillers can be used to reduce pH.
60
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
EXAMPLE V
A laundry detergent composition suitable for machine use is prepared by
standard
methods and comprises the following composition:
Component Weight%
Organic Catalyst* 0.3
TAED 10.0
Sodium Perborate Tetrahydrate 9.2
Sodium Carbonate 23.74
Anionic surfactant 14.80
Alumino Silicate 21.30
Silicate 1.85
Diethylenetriaminepentacetic 0.43
acid
Polyacrylic acid 2.72
Brightener 0.23
Polyethylene glycol solids 1.05
Sulfate 8.21
Perfume 0.25
Processing aid 0.10
Miscellaneous 0.43
Water Balance
Organic catalyst can be any of the zwitterionic organic catalysts described
herein, preferably it is
an iminium-based organic catalyst, more preferably it is a
dihydroisoquinolinium-based organic
catalyst.
The composition can be used to launder fabrics at a concentration in solution
of about
1000 ppm at a temperature of 20-40°C and a water to fabric ratio of
about 20:1.
EXAMPLE VI
Component Wei _i?h
Organic Catalyst* 0.082
NOBS 7.20
Sodium Perborate Tetrahydrate 8.0
Sodium Carbonate 21.0
61
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
Anionic surfactant 12.0
Alumino Silicate 18.0
Diethylenetriaminepentacetic acid 0.3
Nonionic surfactant 0.5
Polyacrylic acid 2.0
Brightener 0.3
Sulfate 17.0
Perfume 0.25
Miscellaneous 2.95
Water Balance
"Organic catalyst can be any of the zwitterionic organic catalysts described
herein, preferably it is
an iminium-based organic catalyst, more preferably it is a
dihydroisoquinolinium-based organic
catalyst.
The composition can be used as a laundry auxiliary for laundering fabrics at a
concentration in solution of about 850 ppm at a temperature of 5-SOoC and a
water to fabric ratio
of about 20:1.
EXAMPLE VII
A bleaching composition suitable for use in high suds phosphate geographies
has the
formula:
Component ~%wt'I B (%wt~
Organic Catalyst* 0.02 0.018
NOBS 1.90 2.00
Sodium Perborate Tetrahydrate 2.25 3.00
Sodium Carbonate 13.00 13.00
Anionic surfactant 19.00 19.00
Cationic surfactant 0.60 0.60
Nonionic surfactant - 0.40
Sodium Tripolyphosphate 22.50 22.50
Diethylenetriaminepentacetic acid 0.90 0.90
Acrylic acid/Maleic acid copolymer 0.90 0.90
Carboxymethylcellulose 0.40 0.40
62
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
Protease 0.70 0.70
Amylase 0.36 0.36
Cellulase 0.35 0.35
Brightener 0.16 0.18
Magnesium sulfate 0.70 0.70
Water 3.0 1.0
Sodium sulfate Balance Balance
Organic catalyst can be any of the zwitterionic organic catalysts described
herein, preferably it is
an iminium-based organic catalyst, more preferably it is a
dihydroisoquinolinium-based organic
catalyst.
While particular embodiments of the subject invention have been described, it
will be
obvious to those skilled in the art that various changes and modifications of
the subject invention
can be made without departing from the spirit and scope of the invention. It
is intended to cover,
in the appended claims, all such modifications that are within the scope of
the invention.
The compositions of the present invention can be suitably prepared by any
process chosen
by the formulator, non-limiting examples of which are described in U.S. Patent
Nos. 5,691,297;
5,574,005; 5,569,645; 5,565,422; 5,516,448; 5,489,392; and 5,486,303.
In addition to the above examples, the bleach systems of the present invention
can be
formulated into any suitable laundry detergent composition, non-limiting
examples of which are
described in U.S. Patent Nos. 5,679,630; 5,565,145; 5,478,489; 5,470,507;
5,466,802; 5,460,752;
5,458,810; 5,458,809; and 5,288,431.
Having described the invention in detail with reference to preferred
embodiments and the
examples, it will be clear to those skilled in the art that various changes
and modifications may be
made without departing from the scope of the invention and the invention is
not to be considered
limited to what is described in the specification.
63
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
SEQUENCE LISTING
<110> The Procter & Gamble Company
Dykstra, Robert
Kellett, Patti
<120> Color Safe Laundry Methods Employing Zwitterionic Formulation Components
<130> 7758M
<150> 60/151,174
< 151 > 1999-08-27
<160> 18
<170> Patentln version 3.0
<210> 1
<211> 21
<212> DNA
<213> Aspergillus aculeatus
<400> 1
attcatttgt ggacagtgga c 21
<210> 2
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 2
gttgatcgca cattgaacca 20
<210> 3
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 3
accccagccg accgattgtc 20
<210> 4
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 4
cttccttacc tcaccatcat 20
<210> 5
<211> 20
<212> DNA
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
<213> Aspergillus aculeatus
<400> 5
ttaacatctt ttcaccatga 20
<210> 6
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 6
agctttccct tctctccctt 20
<210> 7
<211> 28
<212> DNA
<213> Aspergillus aculeatus
<400> 7
gccaccctgg cttccgctgc cagcctcc 28
<210> 8
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 8
gacagtagca atccagcatt 20
<210> 9
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 9
agcatcagcc gctttgtaca 20
<210> 10
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 10
ccatgaagtt caccgtattg 20
<210> 11
<211> 20
<212> DNA
<213> Aspergillus aculeatus
2
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
<400> 11
gcactgcttc tctcccaggt 20
<210> 12
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 12
gtgggcggcc cctcaggcaa 20
<210> 13
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 13
acgctcctcc aattttctct 20
<210> 14
<211> 19
<212> DNA
<213> Aspergillus aculeatus
<400> 14
ggctggtagt aatgagtct 19
<210> 15
<211> 20
<212> DNA
<213> Aspergillus aculeatus
<400> 15
ggcgcagagtttggccaggc 20
<210> 16
<211> 21
<212> DNA
<213> Aspergillus aculeatus
<400> 16
caacatcccc ggtgttctgg g 21
<210> 17
<211> 347
<212> DNA
<213> Aspergillus aculeatus
<400> 17
aaagattcat ttgtggacag tggacgttga tcgcacattg aaccaacccc agccgaccga 60
3
CA 02381924 2002-02-13
WO 01/16278 PCT/US00/23321
ttgtccttcc ttacctcacc atcatttaac atcttttcac catgaagctt tcccttctct 120
cccttgccac cctggcttcc gctgccagcc tccagcgccg cacacttctg cggtcagtgg 180
gataccgcca ccgccggtga cttcaccctg tacaacgacc tttggggcga gacggccggc 240
accggctccc agtgcactgg agtcgactcc tacagcggcg acaccatcgc ttgtcacacc 300
agcaggtcct ggtcggagta gcagcagcgt caagagctat gccaacg 347
<210> 18
<211> 294
<212> DNA
<213> Aspergillus aculeatus
<400> 18
cagcatctcc attgagtaat cacgttggtg ttcggtggcc cgccgtgttg cgtggcggag 60
gctgccggga gacgggtggg gatggtggtg ggagagaatg tagggcgccg tgtttcagtc 120
cctaggcagg ataccggaaa accgtgtggt aggaggttta taggtttcca ggagacgctg 180
tataggggat aaatgagatt gaatggtggc cacactcaaa ccaaccaggt cctgtacata 240
caatgcatat accaattata cctaccaaaa aaaaaaaaaa aaaaaaaaaa aaaa 294
4
