Note: Descriptions are shown in the official language in which they were submitted.
CA 02382383 2002-02-26 pCT/US00/23971
TRANSGENIC MAMMAL CAPABLE OF FACILITATING PRODUCTION OF
DONOR-SPECIFIC FUNCTIONAL IMMUNITY
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER
FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
This invention was made with Government support. The Government has
certain rights in this invention.
,o BACKGROUND OF THE INVENTION
Many human diseases remain incurable in large part due to the lack of an
appropriate model system for preclinical studies. Since many diseases are
specific to either
human pathogens or dysfunctional human tissues, it is difficult to model the
course of such
afflictions outside of the human body. For example, the basis of allergic
responses is deeply
~s rooted in the genetics of the host and cannot be completely studied in a
different species.
Infectious diseases, such as HIV, have species-specific virulence factors. And
cancer cells that
arise from a combination of genetic factors usually display altered properties
when
transplanted into immunodeficient animals.
Unfortunately, there are few methods for directly studying the pathology of
zo human diseases. This in turn limits the development of new drugs and novel
therapies. Given
the practical and ethical restrictions of experimenting in both humans and
higher primates,
there is an urgent need to develop alternative models of human diseases.
In models of human disease where an interaction between the disease causing
agent and the immune system is suspected, either hematopoietic stem cells or
mature
Zs circulating lymphocytes are transferred into naturally occurnng strains of
immunodeficient
mice. Although better than their forerunners in certain respects, these models
fail to reproduce
many of the functional properties of human cells that are critical for
unraveling disease
processes. On a more basic level, even attempts to transplant hematopoietic
stem cells
between individuals of the same species have produced allogeneic chimeras that
are
3o functionally impaired. The reasons for this are unclear, but involve the
inability of the donor
stem cells to differentiate properly in the mature lymphoid tissues of the new
host.
In an attempt to overcome these problems, researchers have added IL-7, either
exogenously or transgenically to mice before engraftment. However, this
approach
unexpectedly led to further immunological dysfunction. For example, see, Kapp,
et al., Blood
CA 02382383 2002-02-26
WO 01/15521 PCT/US00/23971
-2-
92:2024 (1998) (exogenous IL-7 led to decrease in B cell development); Rich,
et al., J. Exp.
Med. 177:305 (1993) (transgenic IL-7 under the control of immunogloubulin
heavy chain
promoter and enhancer led to dermal lymphoid infiltration and T and B cell
lymphomas);
Valenzona, et al., Exp. hlematol. 24:1521 (1996) (IL-7 under the MHC class II
promoter
induced B lymphoid tumors); Watanabe, et al., J. Exp. Med. 187:389 (1998) (IL-
7 transgenic
mice developed chronic colitis); Uehira, et al., J. Invest. Dermatol. 110:740
( 1998) (IL-7
transgenic mice developed dermatitis);and Mertsching, et al., Eur. J. Immunol.
26:28 (1996)
(IL-7 transgenic mice developed lymphoproliferative disease).
Thus, there remains a need for a standard transgenic animal model system that
~o supports the functional properties of human hematopoietic cells. This
invention meets this and
other needs.
SUMMARY OF THE INVENTION
The present invention provides for a recipient mammal comprising exogenous
~s cytokines capable of maintaining an immune system; and cells derived from
donor-specific
cells with hematopoietic stem cell properties (HSC); wherein the recipient
mammal is capable
of facilitating production of donor-specific functional immunity. In a
preferred embodiment,
the mammal is a mouse.
In one aspect of this embodiment, the cytokines are from the same species as
Zo the cells derived from donor-specific cells with hematopoietic stem cell
properties. The
cytokines are selected from the group consisting of interleukin 3, (IL-3),
interleukin-6 (IL-6),
interleukin-7 (IL-7), macrophage-colony stimulating factor (M-CSF),
granulocyte-colony
stimulating factor (GM-CSF), stem cell factor (SCF), leukemia inhibitory
factor (LIF) and
oncostatin M (OM). In a preferred aspect of this embodiment, the cytokines
comprise IL-3,
zs IL-6, IL-7, M-CSF, GM-CSF and SCF. In another preferred aspect of this
embodiment, the
cytokines are introduced into the mammal transgenically.
In another preferred aspect of this embodiment, the cells derived from cells
with
hematopoietic stem cell properties are xenogeneic to the mammal. In a
particularly preferred
aspect, the cells are human cells. In a more preferred aspect, the cells are
hematopoietic stem
3o cells. In a most preferred aspect, the hematopoietic stem cells are derived
from umbilical cord
blood. However, in alternative aspects, the cells are derived from bone
marrow, mobilized
peripheral blood, embryonic stem cells, or other source of HSC. In another
alternative
embodiment, the cells derived from cells with hematopoietic stem cell
properties are
W~ ~l/15$21 CA 02382383 2002-02-26 pCT/US00/23971
-3-
differentiated. In particular, the differentiated cells are of lymphoid,
myeloid, or of an
erythroid lineage.
In another embodiment of this invention, a method of making a mammal with a
donor immune system is provided. This method comprises the steps of
introducing transgenes
into an immunodeficient mammal, wherein the transgenes encode cytokines
necessary for the
maintenance and maturation of donor-derived hematopoietic cells; and
introducing cells with
hematopoietic stem cell properties into the mammal.
In one aspect of this embodiment the donor immune system is a xenogeneic
immune system. In a particularly preferred aspect of this embodiment, the
donor immune
o system is a human immune system.
In one aspect of this embodiment, the introduction of transgenes is through
transfection of embryonic stem cells. In a second aspect of this embodiment,
the introduction
of transgenes is through pronuclear transfer. In an alternative aspect of this
embodiment, the
introduction of the transgenes is through breeding the mammal with a mammal
that comprises
cs the transgenes.
In a preferred aspect of this embodiment, the mammal is a RAG-1 or a RAG-2
mutant mouse. In another aspect of the invention, the mammal is a RAG-1 or RAG-
2 mutant
mouse expressing human leukocyte antigen (HLA) Class I and/or Class II genes.
In a further
aspect of the invention, the mammal is a SCID mouse expressing HLA Class I
and/or Class II
zo genes. In yet another aspect of the invention, the mammal is an
immunocompetent mouse
expressing HLA Class I and/or Class II genes and rendered immunodeficient by,
e.g.,
irradiation conditioning.
In another aspect of this invention the donor-derived hematopoietic cells are
from a xenogeneic mammal. However, in a particularly preferred aspect, the
donor-derived
zs hematopoietic cells are from a human.
In yet another embodiment of this invention, a method of determining an
immune response to an antigen is provided. Transgenic chimeric mammals are
immunized
with proteins, peptides, cells or other sources of antigens, to determine
epitopes involved in
donor cell-derived immune responses. These include, but are not limited to,
antigen-specific
o immunoglobulin production, T,,e,~r responses, T~ycocoX;~ responses, cellular
proliferation
responses, innate allogeneic or xenogeneic responses, and natural killer cell
activity.
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-4-
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 demonstrates that allogeneic bone marrow engrafted RAG mice are
tolerant to donor and host MHC, but responsive to third party alloantigens.
CD4+ T cells were
isolated by cytotoxic elimination of class II+ and CD8+ cells from the lymph
nodes of a
syngeneic engrafted RAG mouse (RAG-(syn), (A); an allogeneic engrafted RAG
mouse
(RAG-(alloy, B); a syngeneic engrafted SCID mouse (SCID-(syn), C); an
allogeneic engrafted
SCID mouse (SCID-(alloy, D); and a RAG mouse, E) engrafted with the same bone
marrow
preparation as placed in the SCID-(alloy mouse shown in panel D, as a positive
control for the
bone marrow inoculum.
o CD4+ T cells were co-cultured with irradiated LPS-induced splenic blasts
from
Balb/C (diamonds); C57B1/6 (squares); CBA (circles panels A and B) or (C57B1/6
x CBA)F1
mice (circles, panels C, D and E). Proliferation was assessed colorometrically
(Celltiter;
Promega) on day (d) =5, and is reported as OD49o x 1000 on the y axis.
Background
absorption has been subtracted.
~s Figure 2 demonstrates antigen specific IgG responses by RAG-(alloy mice. In
Figure 2A, control Balb/c mice (open triangles), RAG-(alloy mice (closed
squares; mouse #30),
RAG-(syn) mice (open squares; mouse RN003), and SCID-(alloy mice (closed
circles; two
animals, SN005 and SN006, are shown) were immunized in the hind foot pads with
a total of
50 pg hen egg white lysozyme (HEL) emulsified in complete Freund's adjuvant
(CFA). Two
zo weeks later, animals were boosted i.p. with the same amount of HEL in
incomplete Freund's
adjuvant (IFA). One week after boosting, the animals were bled and the serum
was tested for
the presence of HEL-specific IgG by ELISA. The y axis represents OD4ls-ago x
1000. In Figure
2 B, RAG-(syn) mice (striped bars; mice #61 and 62) and RAG-(alloy mice
(speckled bars;
mice #46 and 51) were immunized in the hind foot pads with a total of SOpg of
KLH
zs emulsified in CFA on d=0. The animals were boosted subcutaneously two weeks
later with
KLH in IFA. Serum samples were taken at d=0, 14 and 21 days, and then tested
for KLH
specific IgG by ELISA. The plain bars on the graph represent individual
control mice:
(C57B1/6x129) Fl mice are represented by the open bars, and Balb/c mice by the
gray bars.
The y axis indicated the OD415-ago x 1000 for a 1:1000 dilution of serum. The
x axis represents
so days post-primary immunization. Specificity was tested by ELISA on HEL
coated plates; no
cross-reactivity was seen.
Figure 3 represents that antigen specific T cell proliferative responses are
restricted to both donor and host MHC in neonatally constructed RAG-(alloy
chimeras. RAG-
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-5-
(alloy mice #135 (A) and 136 (B) were immunized in the hind foot pad with KLH
in CFA. Ten
days later, draining lymph nodes were removed and depleted of B cells and
macrophages by
cytotoxic elimination. The resulting lymph node T (LNT) cells were co-cultured
for three days
with a 2:1 ratio of Mitomycin C-fixed, antigen-pulsed LPS-blasts from Balb/c
and C57B1/6
mice. Proliferative responses were quantitated using a colorometric assay
(CellTiter;
Promega). Background responses were subtracted. LNT from immunized Balb/c mice
gave
OD49o x 1000 = 547 in response to antigen pulsed Balb/c blasts.
DETAILED DESCRIPTION OF THE INVENTION
io I. INTRODUCTION
It has been well established using a variety of model systems that thymic
cortex
epithelial cells perform the majority of the positive selection events that
occur during T cell
differentiation (Paul, ed. FUNDAMENTAL IMMUNOLOGY FOURTH EDITION ( 1999),
Lipincott-
Raven Press). Recently, attempts to further define the cell types involved in
positive selection
~s have revealed a dichotomy in the ability of CD4+ and CD8+ single positive
cells to be selected
by bone marrow (BM)-derived cells. It has been conclusively demonstrated that
CD8+ T cells
can be positively selected by hematopoietic cells using chimeric animals
constructed on an
MHC class I deficient background (Bix & Raulet, Nature 359:330-333 ( 1992)).
However, the
opposite result has been shown for CD4+ T cells using a similar model system
employing
Zo irradiated MHC class II deficient mice (Markowitz, et al., Proc. Nat'L
Acad. Sci. 90(7):2779-83
(1993)). These results suggest that selection events are more stringently
controlled for CD4+
than for CD8+ T cells.
The inventors have found that fully allogeneic chimeric animals generated
either directly after birth, or in adult, non-irradiated antigen receptor
recombination-deficient,
is e.g., recombination activation gene-2 (RAG-2) mutant, mice possess CD4+ T
cells in the
periphery that exhibit donor MHC restricted antigen-specific responses. These
results have not
been seen in either neonatally or adult constructed SCID chimeras. This
suggests that
hematopoietic cells are capable of positively selecting CD4+ T cells in the
thymus, and present
antigen receptor recombination-deficient strains of mammals as a unique model
system which
so may support T cell development more closely resembling normal ontogeny. It
appears that
positive selection of CD4+ T cells by hematopoietic cells has not been
routinely detected in
other systems due to the use of incompletely immunoincompetent mice, and/or
due to
secondary effects of irradiation.
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-6-
The inventors have further discovered methods by which xenogeneic transgenes
required for the growth and development of a xenogeneic hematopoietic stem
cells are
incorporated into the host mammal. After incorporation, cytokine transgenic
(CTG) mammals
engrafted with xenogeneic hematopoietic stem cells (HSC) develop a functional
immune
system capable of donor MHC-restricted antigen-specific responses. This
modification
provides a pathway for donor lymphocyte development in the context of
xenogeneic MHC
molecules expressed on the MHC-expressing tissues of the host. These mammals
can then be
used as a model system for human or other mammalian diseases.
~o II. DEFINITIONS
Unless defined otherwise, all technical and scientific terms used herein have
the
same meaning as commonly understood by one of ordinary skill in the art to
which this
invention belongs. All references are incorporated by reference for all
purposes. Although any
methods and materials similar or equivalent to those described herein can be
used in the
~s practice or testing of the present invention, the preferred methods and
materials are described.
For purposes of the present invention, the following terms are defined below.
The phrase "major histocompatibility complex" (MHC) refers to immune
response genes that encode cell surface glycoproteins that regulate
interactions among cells of
the immune system. The genes were discovered as a result of their involvement
in graft
zo rejection. There are two main classes of MHC genes, Class I and Class II.
The phrase "human
leukocyte antigen" (HLA) refers to the MHC complex of humans. The phrase "MHC
restriction" refers to the recognition of peptides by T cells in the context
of particular allelic
forms of MHC molecules. For a more complete description of the MHC complex in
humans,
as well as in mice, see, , FUNDAMENTAL IMMUNOLOGY, 4TH ED., Paul (ed.) 1999.
zs Cells that are "allogeneic" to a mammal are cells that are from an
individual of
the same species as the mammal but, because of differences in expression of
major and minor
histocompatibility molecules between the cell donor and the host mammal, are
recognized by
the host mammal as non-self.
Cells that are "xenogeneic" to a host mammal are cells that are from an
so individual of a different species as the mammal. Due to significant genetic
differences, they
are recognized by the host mammal as non-self.
The phrase "bone marrow" refers to the red marrow of the bones of the spine,
sternum, ribs, clavicle, scapula, pelvis and skull. This marrow contains
hematopoietic stem
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
_7_
cells. The phrase "umbilical cord blood" refers to whole blood obtained from
the umbilical
cord of a newborn. This blood also contains hematopoietic stem cells. The
phrase "mobilized
peripheral blood" refers to peripheral blood isolated from individuals treated
with recombinant
growth factors, e.g., granulocyte colony stimulating factor (GM-CSF) and stem
cell factor
(SCF), for the purpose of increasing the proportion of hematopoietic stem
cells in the
circulation.
The term "cytokines" refers to proteins that are commonly referred to as
cytokines as well as other proteins, such as growth factors, interleukins,
immune system
modulators, and other types of proteins necessary to maintain an immune
system. For
~o example, cytokines encompasses the interleukins, stem cell factors, colony
stimulating factors
and other factors known to those of skill in the art. "Exogenous cytokines"
refers to cytokines
that are not naturally occurring in the recipient mammal. These cytokines can
be species
homologs of naturally occurnng cytokines or cytokines that do not have
naturally occurring
homologs in the recipient mammal.
~s The term "immunodeficiency" refers to a lack of antigen-specific immunity
in a
mammal. In these mammals, B and T lymphocytes fail to mature properly and are
unable to
recognize and respond to antigens.
The phrase "recombination activation genes" (RAG) refers to the RAG-1 and
RAG-2 genes that are involved with initiating the rearrangement of B and T
cell antigen
zo receptors. The genetic recombination at the V, D and/or J gene segments is
necessary to
produce B and T-cell receptors. Mutations in the RAG-1 an RAG-2 genes prevent
early steps
in this process, and result in a blockade of B cell development in the bone
marrow and
thymocyte development in the thymus (Mombaerts, et al., Cell 68:869-77 (1992);
Shinkai, et
al., Cell 68:855-867 (1992)).
zs The phrase "donor-specific cells with hematopoietic stem cell properties"
refer
to cells from a donor species that exhibit hematopoietic stem cell properties.
The most obvious
candidates are hematopoietic stem cells. However, other cells are envisioned,
including but
not limited to, cells that differentiate into HSC, such as embryonic stem
cells.
The phrase "donor immune system" refers to complete or partial immune
3o function that is not naturally found in a host mammal. For example, in a
recipient mammal of
this invention, cytokines necessary for the maintenance of a functional immune
system as well
as donor-specific immune cells are introduced into an immunodeficient mammal,
either
through introduction of transgenes that encode the cytokines or, less
preferably, through the
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
_g_
addition of cytokines to the animal. Donor cells are the source of the
recipient mammal's
immune system (and typically, but not necessarily, the cytokine).
It is not necessary that the donor immune system be fully functional, i.e.,
exhibit
all functions of a mammalian immune system found in nature. However, it is
preferred that the
donor immune system at least comprise donor T and B lymphocytes, and antigen
presenting
cells such as macrophages and dendritic cells.
The phrase "embryonic stem cells" refers to cells that will grow continuously
in
culture and retain the ability to differentiate to all cell lineages,
including but not limited to,
hematopoietic cells. The term "differentiate" or "differentiated" refers to
the process of
~o becoming a more specialized cell type. For example, hematopoietic stem
cells differentiate
into cells of the "lymphoid", "erythroid" and "myeloid" lineages. Lymphoid
cells are cells that
mediate the specificity of immune responses. They are divided into two main
groups, T and B
lymphocytes, and include a small population of large granular lymphocytes, or
natural killer
cells. Erythroid cells are erythroblasts and erythrocytes. Cells of the
myeloid lineage include
~s platelets, neutrophils, basophilic, eosinophils and monocytes.
The phrase "facilitating production of donor-specific functional immunity"
refers to the ability of the recipient mammal to develop and maintain a
functional donor-
derived immune system. Typically, the immune system comprises hematopoietic
cells that are
specific to a donor as well as cytokines and other ancillary compounds that
are necessary, or
zo even desired, to allow the hematopoietic cells to be functional, e.g., bind
to antigen, recognize
an antigen as foreign or self, communicate with other cells of the immune
system so that other
cells, e.g., monocytes and macrophages, are activated, or cytokines, as
defined herein, are
released.
The term "human cells" for purposes of this invention are cells that are
derived
2s from a human. The derivation can be direct, i.e., primary cultures obtained
from a human, or
indirect, e.g., culture lines derived from primary cultures obtained from a
human.
The term "introduction" or "introducing" for purposes of this invention refers
to
the addition of exogenous compounds, particularly cytokine genes, to the
recipient mammals
of this invention. The compounds can be introduced into the recipient mammals
of this
3o invention in a variety of methods, including but not limited to,
introduction of the genes that
encode the compounds. Introduction of the genes that encode the compounds can
be through
gene transfer into a non-fetal mammal or transgenically into a gamete or an
embryonic
mammal. In addition to direct introduction of the genes that encode the
compounds, the
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-9-
genetic material can be introduced into a recipient mammal through breeding or
cloning, e.g.,
the introduction of the genes that encode the compounds into the germline of
an offspring from
a transgenic parent.
The phrase "maintaining an immune system" refers to the ability of exogenous
s cytokines to support a donor-derived immune system in a recipient mammal
that otherwise
would not support such an immune system. Typically, however not necessarily,
the exogenous
cytokines are naturally found in the same species as the donor. Thus, required
interactions
between the cells of the donor-derived immune system and cytokines naturally
found in the
donor to maintain the immune system are supplied in the recipient mammal.
~o The phrase "maintenance and maturation of donor-derived hematopoietic
cells"
refers to providing cytokines necessary to allow hematopoietic stem cells and
other immature
cell types to mature into functional cells, e.g., of the immune system, and
providing necessary
cytokines so that the cells, once mature, survive to function. In addition to
the cells of the
immune system, the maintenance and maturation of other types of hematopoietic
cells, e.g.,
~s erythrocytes, platelets, other lymphoid tissue (for example, the gut-
associated immune system
which consists of Peyer's patches, villi containing intraepithelial
lymphocytes, and
lymphocytes scattered throughout the lamina propria, and the connective tissue
beneath the
surface epithelium.
The terms "making a mammal," or "producing a mammal" refers to the
zo manipulation of the physical characteristics of a mammal so the mammal,
after the
manipulation, comprises a donor immune system. For purposes of this invention,
a human
mammal cannot be made or produced. The manipulation of the physical
characteristics can be
through transgenic technology, gene transfer, or other manipulations of the
genotype of the
mammal, or manipulation can be through the introduction of cells, proteins or
other
zs compounds that affect the physical characteristics of the mammal.
A "mammal" is a warm blooded vertebrate of the class Mammalia. For
purposes of this invention, a "recipient mammal" is a mammal that, because of
the presence of
exogenous transgenes and donor cells with hematopoietic stem cell properties,
is capable of
facilitating production of a donor-specific immune system. For purposes of
this invention, a
so recipient mammal is not a human.
A "mouse" refers to a mammal of the species Mus musculus. Mice
encompassed by this invention include all mice, but in particular, mice of
the, or derived from
the RAG-1 and RAG-2 mutant strains. Because of the severe immunodeficiency of
the mice of
V~0 ~l/1$521 CA 02382383 2002-02-26 pCT/US00/23971
-10-
this invention, it is unlikely they are found in nature. Typically, the mice
of this invention are
laboratory strains of mice, such as the RAG-1, RAG-2 or SCID mice.
The term "transgenically" refers to the introduction of exogenous genetic
material, or transgenes, into the genome of a gamete or an embryo. Preferably,
the genetic
material encodes proteins and the introduction is into a fetal mammal.
"Transgenes" refer to
nucleic acids that comprise a protein coding region and regulatory elements,
e.g., promoters
and termination sequences, if desired. A transgene can comprise a single copy
of a coding
sequence or multiple copies of a coding sequence. If multiple copies are
present, the coding
regions can be partial coding regions. The coding regions can be separated by
regulatory
~o elements or may be arranged in a 5' to 3' or in a 5' to 5' or 3' to 3'
orientation. Multiple
transgenes, representing independent coding and regulatory sequences, may be
present, most
preferably, in a contiguous fashion in the same region, or dispersed elsewhere
in the recipient
mammal's genome.
Cells that are "xenogeneic" to a host mammal are from a different species as
the
~s host mammal. The host mammal normally recognizes xenogeneic cells as non-
self.
II. PRODUCTION OF THE MAMMALS OF THIS INVENTION.
In a preferred embodiment, the recipient mammals of this invention are
immunodeficient. To produce immunodeficient mammals, the naturally occurnng
immune
2o systems of the mammals should be inactivated. Inactivation can take place
by removing or
disrupting multiple immune system-related activities or by removing or
disrupting just one
activity. Although immune function can be disrupted by many different
mechanisms, e.g.,
spontaneous mutation, irradiation and antisense technology, in a preferred
embodiment,
immune function is disrupted by knocking out by e.g., homologous recombination
or
is spontaneous mutation, one or more gene functions necessary for maturation
and maintenance
of the immune system.
Generation of knock out mammals
Homologous recombination may be employed for gene replacement,
inactivation or alteration of genes. A number of papers describe the use of
homologous
so recombination in mammalian cells. See, for example, Thomas & Capecchi, Cell
51:503
(1987); Nandi, et al., Proc. Nat'l Acad. Sci. USA 85:3845 (1988); and Mansour,
et al., Nature
336:348 (1988); Schweizer, et al., J. Biol. Chem. 274:20450 (1999); Hauser, et
al., Proc. Nat'l
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-11-
Acad. Sci. USA 96:8120 ( 1999); Haber, Trends Biochem. Sci. 24:271 ( 1999);
and Bonaventure,
et al., Mol. Pharmacol. 56:54 ( 1999).
Furthermore, various aspects of using homologous recombination to create
specific genetic mutations in embryonic stem cells and to transfer these
mutations to the
s germline have been described (Thomas & Capecchi, Cell 51:503 (1987);
Thompson, et al.,
Cell 56:316 ( 1989); Antoine, et al., J. Cell Sci. 112:2559 ( 1999); Molotkov,
et al., Cancer Lett.
132:187 (1998); Bleich, et al., Pflugers Arch. 438:245 (1999); Struble, et
al., Neurosci. Lett.
267:137 ( 1999); Schweizer, et al., J. Biol. Chem. 274:20450 ( 1999);
Cuzzocrea, et al., Eur.
Cytokine Netw. 10:191 ( 1999); and Mombaerts, et al. Cell 68:869-77 ( 1992);
and Shinkai, et
o al. Cell 68:855-867 ( 1992)).
Thus, the recipient mammals of this invention, which lack necessary
endogenous genes) necessary for the maturation of lymphocytes, can be made
using
homologous recombination to effect targeted gene replacement. In this
technique, a specific
DNA sequence of interest is replaced by an altered DNA. In a preferred
embodiment, the
~s genome of an embryonic stem (ES) cell from a desired mammalian species is
modified
(Capecchi, Science 244:1288 (1989) U.S. Patent No. 5,487,992).
As mentioned above, the gene to be replaced by homologous recombination is
one that is activated early in lymphocyte development. Without being bound by
any particular
theory, it is believed the desired gene is activated while the thymocyte is in
the CD4- and CD8-
o state (double negative) or the CD44~°'" and CD25+ state, and the B
lymphocyte is in the
B220d°°/CD43+ state. Because at these states, T and B cell
receptor rearrangement occurs, it is
believed the genes that encode proteins that modulate the VDJ recombination
are likely targets
for replacement. Examples of these genes are the RAG-1 and RAG-2 genes, the T
cell
receptor (TCR) and immunoglobulin (Ig) genes, the CD3 genes, the pre-T cell
receptor, and
is the SCID gene. Additional types of genes that regulate the survival and
differentiation of
lymphocyte precursors are also potential targets, e.g., the ikarus
transcription factor, the
common gamma chain subunit, IL-7, and the IL-7 receptor, among others.
The procedures employed for inactivating one or both copies of a gene coding
for a particular protein that modulates early thymocyte development will be
similar, differing
3o primarily in the choice of sequence, selectable marker used, and the method
used to identify
the absence of the modulating protein, although similar methods may be used to
ensure the
absence of expression of a particular protein. Since the procedures are
analogous, the
CA 02382383 2002-02-26
WO 01/15521 PCT/US00/23971
-12-
inactivation of the RAG-2 gene in mice will be used as an example. See, U.S.
Patent
5,859,307, the entirety of which is incorporated by reference.
The homologous sequence for targeting the construct may have one or more
deletions, insertions, substitutions or combinations thereof. For example, the
RAG-2 gene may
s include a deletion at one site and/or an insertion at another site. The
presence of an inserted
positive marker gene will result in a defective inactive protein product
insertion as well as a
gene that can be used for selection. Preferably, deletions are employed. For
an inserted gene,
of particular interest is a gene which provides a marker, e.g., antibiotic
resistance such as
neomycin resistance, including 6418 resistance.
o The deletion should be at least about 50 base pairs, or more usually at
least
about 100 base pairs, and generally not more than about 20,000 base pairs,
where the deletion
will normally include at least a portion of the coding region including a
portion of or one or
more exons, a portion of one or more introns, and may or may not include a
portion of the
flanking non-coding regions, particularly the 5'-non-coding region
(transcriptional regulatory
~s region). Thus, the homologous region may extend beyond the coding region
into the 5'-non-
coding region or alternatively into the 3'-non-coding region. Insertions
should generally not
exceed 10,000 base pairs, usually not exceed 5,000 base pairs, generally being
at least 50 base
pairs, more usually at least 200 base pairs.
The homologous sequence should include at least about 100 base pairs,
zo preferably at least about 150 base pairs, and more preferably at least
about 300 base pairs of
the target sequence and generally not exceeding 20,000 base pairs, usually not
exceeding
10,000 base pairs, and preferably less than about a total of 5,000 base pairs,
usually having at
least about 50 base pairs on opposite sides of the insertion and/or the
deletion in order to
provide for double crossover recombination.
zs Upstream and/or downstream from the desired DNA may be a gene which
provides for identification of whether a double crossover has occurred. For
this purpose, the
herpes simplex virus thymidine kinase gene may be employed, since the presence
of the
thymidine kinase gene may be detected by the use of nucleoside analogs, such
as Acyclovir or
Gancyclovir, for their cytotoxic effects on cells that contain a functional
HSV-tk gene. The
so absence of sensitivity to these nucleoside analogs indicates the absence of
the thymidine kinase
gene and, therefore, where homologous recombination has occurred, that a
double crossover
event has also occurred.
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-13-
The presence of the marker gene inserted into the RAG-2 gene of interest
establishes the integration of the targeting construct into the host genome.
However, DNA
analysis might be required in order to establish whether homologous or non-
homologous
recombination occurred. This can be determined by employing probes for the
target DNA
s sequence that hybridize to the 5' and 3' regions flanking the insert. The
presence of an insert,
deletion, or substitution in the targeted gene, can be determined using
restriction endonucleases
that distinguish the size of a targeted allele from a wild type allele.
The polymerase chain reaction may also be used in detecting the presence of
homologous recombination (Kim & Smithies, Nucleic Acid Res. 16:8887-8903 (
1988); and
~o Joyner, et al., Nature 338:153-156 (1989)). Primers may be used which are
complementary to
a sequence within the construct and complementary to a sequence outside the
construct and at
the target locus. In this way, one can only obtain DNA duplexes having both of
the primers
present in the complementary chains if homologous recombination has occurred.
By
demonstrating the presence of the primer sequences or the expected size
sequence, the
~s occurrence of homologous recombination is supported.
The construct may further include an origin of replication which is functional
in
the mammalian host cell. For the most part, these replication systems will
involve viral
replication systems, such as Simian Virus 40, Epstein-Barr virus, papilloma
virus, adenovirus
and the like.
zo Where a marker gene is involved, as an insert, and/or flanking gene,
depending
upon the nature of the gene, it may have the wild-type transcriptional
regulatory regions,
particularly the transcriptional initiation regulatory region or a different
transcriptional
initiation region. Whenever a gene is from a host where the transcriptional
initiation region is
not recognized by the transcriptional machinery of the mammalian host cell, a
different
zs transcriptional initiation region will be required. This region may be
constitutive or inducible,
preferably inducible. A wide variety of transcriptional initiation regions
have been isolated
and used with different genes. Of particular interest as promoters are the
promoters of
metallothionein-I and II from a mammalian host, thymidine kinase, beta-actin,
immunoglobulin promoter, human cytomegalovirus promoters, phosphoglycerate
kinase
30 (PGK) and SV40 promoters. In addition to the promoter, the wild-type
enhancer may be
present or an enhancer from a different gene may be joined to the promoter
region.
The construct may further include a replication system for prokaryotes,
particularly E. coli, for use in preparing the construct, cloning after each
manipulation,
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-14-
allowing for analysis, such as restriction mapping or sequencing, followed by
expansion of a
clone and isolation of the construct for further manipulation. When necessary,
a different
marker may be employed for detecting bacterial transformants.
Once the construct has been prepared and manipulated and the undesired
s sequences removed from the vector, e.g., the undesired bacterial sequences,
the DNA construct
is now ready to be introduced into the target stem cells. Methods of
introducing the desired
DNA into stem cells are well known in the art. Briefly, preferred methods
include, but are not
limited to calcium phosphate/DNA coprecipitates, microinjection of DNA into
the nucleus,
electroporation, bacterial protoplast fusion with intact cells, lipofection,
or the like. The DNA
~o may be single or double stranded, linear or circular, relaxed or
supercoiled DNA. For various
techniques for transforming mammalian cells, see Keown, et al., Methods in
Enzymology
185:527-537 (1990); Sambrook, et al., MOLECULAR CLONING: A LABORATORY MANUAL
(2ND
ED.), VOLS. 1-3, Cold Spring Harbor Laboratory, (1989) ("Sambrook") or CURRENT
PROTOCOLS IN MOLECULAR BIOLOGY, F. Ausubel et al., ed. Greene Publishing and
Wiley-
~s Interscience, New York ( 1987) ("Ausubel").
After transformation of the target cells, many target cells are selected by
means
of positive and/or negative markers, as previously indicated, neomycin
resistance and
Acyclovir or Gancyclovir resistance. Those cells which show the desired
phenotype may then
be further analyzed by restriction analysis, electrophoresis, Southern
analysis, polymerase
zo chain reaction or the like. By identifying fragments which show the
presence of the mutations
at the target gene site, one can identify cells in which homologous
recombination has occurred
to inactivate the target gene.
Cells in which only one copy of the, e.g., RAG-2, gene have been inactivated
still retain a single unmutated copy of the target gene. If desired, these
cells can be expanded
zs and subjected to a second transformation with a vector containing the
desired DNA. If desired,
the mutation within the desired DNA may be the same or different from the
first mutation. If a
deletion, or replacement mutation is involved, a second mutation may overlap
at least a portion
of the mutation originally introduced. If desired, a different positive
selection marker can be
used in this transformation. If a different marker is used, cells with both
mutations can be
so selected in double selection media. Alternatively, to determine if the
cells comprise mutations
in both copies of the transformed cells, the cells can be screened for the
complete absence of
the functional protein of interest. The DNA of the cell may then be further
screened to ensure
the absence of a wild-type target gene.
W~ ~l/1$$ZI CA 02382383 2002-02-26 pCT/US00/23971
-15-
In an alternative embodiment, chimeric mammals can be developed from
transformed stem cells (see, infra) and animals with one mutated sequence can
be bred to other
mammals with one or two mutated sequences and offspring that contain mutations
in both
copies (homozygotes) selected as recipient mammals of this invention.
Similarly, recipient
s mammals developed from chimeric mammals from transformed cells with two
mutated genes
can be bred to produce more recipient mammals.
After transformation, the stem cells containing either one or two copies of
the
replacement DNA are inserted into recipient mammal embryos to produce chimeric
mammals.
Typically, this is done by injecting stem cell clones into mammalian
blastocysts. The
o blastocysts are then implanted into pseudopregnant females. The offspring
derived from the
implanted blastocysts are test-mated to animals of the parental line to
determine whether the
offspring comprise a chimeric germ line. Chimeras with germ cells derived from
the altered
stem cells transmit the modified genome to the offspring of the test matings,
yielding mammals
heterozygous for the target DNA (contain one target DNA and one replacement
DNA). The
~s heterozygotes are then bred with each other to create homozygotes for
replacement DNA.
Because the recipient mammals of this invention are immunodeficient, it may
be necessary to maintain them in a germ free environment. Such environments
are well known
to those of skill in the art and techniques for maintaining immunodeficient
mice can be found
in Immunodeficient rodents : a guide to their immunobiology, husbandry, and
use, Committee
zo on Immunologically Compromised Rodents, Institute of Laboratory Animal
Resources,
Commission on Life Sciences, National Research Council. Washington, D.C. :
National
Academy Press, 1989.
In addition to producing knock-out mammals, the immunodeficient mammals of
this invention are commercially available. For example, mice with a RAG-2
mutation are
zs available from Taconic, RAG-1 and TCRbeta/delta mutant mice from Jackson
Laboratory, or
SCID mice from Jackson and Taconic.
In another embodiment, introduction of transcriptionally active transgenes,
e.g.,
a truncated forms of rearranged antigen receptors or human CD3 epsilon, are
examples of
achieving lymphocyte deficiencies.
3o It is desireable to screen the recipient mammals for the presence of the
knocked
out gene. Screening can be done phenotypically or genotypically. Phenotypic
screening
includes, but is not limited to, the absence of mature T and B cells and other
phenotypic
changes that correlate with the absence of mature T and B cells, such as the
absence of serum
CA 02382383 2002-02-26
WO 01/15521 PCT/C1S00/23971
-16-
immunoglobulins. However, if the mutated gene presents as a dominant
phenotype, animals
that are heterozygous at that gene will present with the same phenotypic
characteristics as the
desired homozygotes. Therefore, it is desirable to screen for homozygotes by
genotypic
screening.
s DNA screening is well known to those of skill in the art and can be found
in, for
example, Ausubel and Sambrook. Briefly, cells containing DNA are removed from
the test
animals. In mice, this can be done by removing the tip of the tail and
isolating cells. The
genomic DNA is isolated from the cells and cut into manageable size by
restriction
endonucleases. The cut genomic DNA is electrophoresed in an agarose gel and
then probed
with a labeled nucleic acid that can distinguish the wild type from the
modified DNA fragment.
Binding of the labeled probe to the genomic DNA depends on the ability of the
probe to remain hybridized to the genomic DNA under the wash conditions used.
An
extensive guide to the hybridization of nucleic acids is found in Tijssen,
LABORATORY
TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY--HYBRIDIZATION WITH NUCLEIC
~s ACID PROBES, Elsevier, New York (1993). Generally, highly stringent
hybridization and wash
conditions are selected to be about 5°C lower than the thermal melting
point (Tm) for the
specific sequence at a defined ionic strength and pH. The Tm is the
temperature (under defined
ionic strength and pH) at which 50% of the target sequence hybridizes to a
perfectly matched
probe. Very stringent conditions are selected to be equal to the Tm for a
particular probe. An
zo example of stringent hybridization conditions for hybridization of
complementary nucleic acids
which have more than 100 complementary residues on a filter in a Southern or
northern blot is
50% formalin with 1 mg of heparin at between 40 and 50°C, preferably
42°C, with the
hybridization being carned out overnight. An example of highly stringent wash
conditions is
0.15M NaCI at from 70 to 80°C with 72°C being preferable for
about 15 minutes. An example
zs of stringent wash conditions is 0.2x SSC wash at about 60 to 70°C,
preferably 65°C for 15
minutes (see, Sambrook, supra for a description of SSC buffer). Often, a high
stringency wash
is preceded by a low stringency wash to remove background probe signal. An
example
medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is lx
SSC at 40 to
50°C, preferably 45°C for 15 minutes. An example low stringency
wash for a duplex of, e.g.,
so more than 100 nucleotides, is 4-6x SSC at 35 to 45°C, with
40°C being preferable, for 15
minutes. In general, a signal to noise ratio of 2x (or higher) than that
observed for an unrelated
probe in the particular hybridization assay indicates detection of a specific
hybridization. After
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-17-
removal of unbound probe, the label is detected and the presence or absence of
the desired
DNA in the genome of the mammals determined.
As the mammal matures, it may exhibit a "leaky phenotype." For purposes of
this invention, a leaky phenotype is one where a few thymocytes and/or pro-B
cells undergo
functional receptor rearrangement and mature into T and B cells, respectively.
Thus, a 5CID
mouse exhibits a leaky phenotype. This phenotype can be detected by monitoring
the
development of host T and B cells and/or serum immunoglobulin in the recipient
mammals
throughout the life of the animal.
Transgenic Mammals
The differentiation of hematopoietic cells is a highly regulated process that
involves the coordinate expression of many factors, including cytokines,
adhesion molecules,
and chemokines, among others. Due to evolutionary changes, considerable
divergence has
occurred between a number of murine and human growth factors such that the
murine factors
do not always interact as efficiently, or in the same manner, as their human
counterparts. A
~s major consideration when supplying exogenous cytokines is the dosage,
combination, and
pattern of delivery. Since cytokines are powerful signaling molecules that
work in close
proximity to their origin, in low concentrations, and synergistically with one
another, systemic
delivery of exogenous cytokines is unlikely to provide the physiological
levels necessary for
normal development.
zo The preferred method of providing human-specific factors to the host is via
transgenesis, whereby copies of genomic DNA encoding the desired factors are
incorporated
into the genome of the host. The DNA should include tissue-specific regulatory
sequences and
any introns and exons required for normal RNA processing, including
alternatively spiced
variants. The latter may be particularly important when the proteins present
themselves as
zs both membrane bound and soluble forms having different physiological
effects. Thus, to
maintain a donor species-specific functional immune system, it is necessary to
introduce
donor-specific cytokines into the germline of the recipient mammals of this
invention.
The recipient mammals of this invention are produced by introducing
transgenes into the germline of a non-human animal. Embryonal target cells at
various
so developmental stages can be used to introduce transgenes. Different methods
are used
depending on the stage of development of the embryonal target cell. For
example, the zygote
is the best target for micro-injection. In the mouse, the male pronucleus of
the zygote reaches
approximately 20 micrometers in diameter. At this size, reproducible
injections of 1-2 pL of
WO 01/15521 CA 02382383 2002-02-26 PC'r/[JS00/23971
-18-
DNA solution can be performed. The use of zygotes as a target for gene
transfer has another
major advantage in that, in most cases, the injected DNA will be incorporated
into the host
genome before the first cleavage (Brinster, et al. Proc. Natl. Acad. Sci. USA
82:4438-4442
(1985)). As a consequence, all cells of the recipient mammal will carry the
incorporated
transgene. This is also reflected in the efficient transmission of the
transgene to offspring of
the parent transgenic mammal since 50°Io of the germ cells of the
offspring will harbor the
transgene.
In another, alternative embodiment, intracytoplasmic sperm injection (ICSI)
can
be used to introduce transgenes into metaphase oocytes. See, Perry, et al.,
Science 284:1180
(1999). Briefly, sperm heads and linearized DNA are incubated for a short
period of time and
co-injected into an oocyte. Improved rates of transgenesis are seen when the
sperm heads have
undergone membrane disruption prior to incubation with the DNA.
Retroviral infection can also be used to introduce a transgene into a
recipient
mammal. The developing embryo can be cultured in vitro to the blastocyst
stage. The
~s blastomeres are then targets for retroviral infection (Jaenisch, Proc.
Nat'l Acad. Sci USA
73:1260-1264 (1976)). Efficient infection of the blastomeres is obtained by
enzymatic
treatment to remove the zona pellucida (Hogan, et al., MANIPULATING THE MOUSE
EMBRYO,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1986)). The
viral vector
system used to introduce the transgene is typically a replication-defective
retrovirus carrying
zo the transgene (Jahner, et al. Proc. Natl. Acad. Sci. USA 82: 6927-6931
(1985); Van der Putten,
et al. Proc. Natl. Acad. Sci USA 82: 6148-6152 (1985)). Infection is easily
and efficiently
obtained by culturing the blastomeres on a monolayer of virus-producing cells
(Van der Putten,
supra; Stewart, et al. EMBO J. 6: 383-388 (1987)). Alternatively, infection
can be performed
at a later stage. Virus or virus-producing cells can be injected into the
blastocoel (Jahner, D.,
zs et al. Nature 298:623-628 (1982)). Most of the founders will be mosaic for
the transgene since
incorporation occurs only in a subset of the cells which form the recipient
mammal. Further,
the founder may contain various retroviral insertions of the transgene at
different positions in
the genome which generally will segregate in the offspring. In addition, it is
also possible to
introduce transgenes into the germ line, albeit with low efficiency, by
intrauterine retroviral
3o infection of the midgestation embryo (Jahner, D. et al. supra).
A fourth type of target cell for transgene introduction is the embryonal stem
cell
(ES). ES cells are obtained from pre-implantation embryos cultured in vitro
and fused with
embryos (Evans, et al. Nature 292:154-156 (1981); Bradley, et al. Nature
309:255-258 (1984);
V~~ 01/15521 CA 02382383 2002-02-26 pCT~S00/23971
-19-
Gossler, et al. Proc. Natl. Acad. Sci USA 83:9065-9069 (1986); and Robertson,
et al. Nature
322:445-448 (1986)). Transgenes can be efficiently introduced into the ES
cells by DNA
transfection or by retrovirus-mediated transduction. Such transformed ES cells
can thereafter
be combined with blastocysts from a nonhuman animal. The ES cells thereafter
colonize the
s embryo and contribute to the germ line of the resulting chimeric recipient
mammal. For
review see Jaenisch, Science 240:1468-1474 (1988); Bradley, et al.
Biotechnology (N Y)
10(5):534-9 (1992); and Williams, Bone Marrow Transplant 5(3):141-4 (1990).
The actual transgenes of this invention include the coding sequences for
proteins necessary for the maturation and maintenance of a donor-specific
functional immune
system. Those of skill will recognize the required cytokines will vary
depending on the desired
functionality. Such cytokines include but are not limited to, IL-6, IL-7, GM-
CSF and SCF,
LIF, M-CSF, and OM. In addition or alternatively, MHC genes from the same
species and
haplotype as that of the donor HSC may be introduced into the recipient mammal
and
expressed in tissues that endogenously express MHC molecules. In this case,
donor
~s thymocytes become "restricted" during development in the recipient's
tissues, particularly the
thymus, via interaction with the transgenic MHC molecules. This leads to the
maturation of T
cells that can have cognate interactions with donor B lymphocytes displaying
the same
haplotype of transgenic MHC molecules as the host mammal. For example, human
HLA -DR,
-DQ, and/or -DP genes of the same haplotype as the HSC donor are expressed in
the mouse
zo tissues. The expression of transgenic MHC expression is most beneficial in
mouse strains
other than those with mutations in the RAG-2 or RAG-1 genes.
In a preferred embodiment, the cytokine genes are derived from a human being
or a human cell line. However, other mammalian sources may be used such as
pig, sheep or
rat. In an alternative embodiment, mammals of the same species but allogeneic
to the donor
zs are the source of the cytokines.
There are numerous other methods of isolating the DNA sequences encoding
the cytokines of this invention. For example, DNA may be isolated from a
genomic or cDNA
library using labeled oligonucleotide probes having sequences complementary to
known
cytokine sequences. For example, full-length cDNA probes may be used, or
oligonucleotide
so probes consisting of subsequences of the known sequences may be used. Such
probes can be
used directly in hybridization assays to isolate DNA encoding cytokines.
Alternatively probes
can be designed for use in amplification techniques such as PCR, and DNA
encoding cytokines
may be isolated by using methods such as PCR.
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-20-
To prepare a cDNA library, mRNA is isolated from a source tissue or cells. For
example, Il-7 is expressed by bone marrow stroma, thus, these cells would be a
suitable source
of mRNA that encodes Il-7. cDNA is reverse transcribed from the mRNA according
to
procedures well known in the art and inserted into bacterial cloning vectors.
The vectors are
transformed into a recombinant host for propagation, screening and cloning.
Methods for
making and screening cDNA libraries are well known. See, Gubler & Hoffman,
Gene 25:263-
269, ( 1983) and Sambrook, et al.
From a genomic library, total DNA is extracted from the host tissue or cells
and
then cut into smaller pieces of DNA by mechanically shearing or by enzymatic
digesting to
o yield fragments of about e.g., 12-SOkb. Fragments of a desired size are then
separated by
gradient centrifugation and are inserted into bacteriophage lambda vectors or
other vectors.
These vectors and phage are packaged in vitro, as described in Sambrook, et
al. Recombinant
phage can be analyzed for the presence of cytokine nucleic acids by plaque
hybridization as
described in Ausubel.
~s Libraries containing genomic DNA sequences greater than SOkb are prepared
using various cloning vectors, e.g., YAC, BAC, P1, and PAC vectors. Techniques
for
generating these libraries are well known. See, Markie, ed. (for YACS) Methods
in Molecular
Biology 54 (1997), Ramsay (for YACS), Mol Biotechnol 1(2):181-201 (1994),
Monaco et al.,
Trends Biotechnol. 12:280-6 (1994), and Shepherd et al., Genet Eng (NY) 16:213-
28 (1994).
zo Hybridization probes useful in this invention include known sequences that
encode for the cytokines of interest or sequences that encode homologous
cytokines from
another species, for example a probe derived from a murine sequence to probe a
human cDNA
library for a homologous sequence. One of skill will recognize that if
homologous sequences
are used as probes, the stringency of the wash conditions should be lowered.
is In addition to generating coding sequences of the cytokines to be used as
transgenes, many of the nucleic acids that encode the necessary cytokines of
this invention are
commercially available. Such resources include R&D Systems, Genetic Systems,
and CEPH.
The preferred method of making transgenic mammals that express the necessary
cytokines is as follows. From both animal and in vitro studies, IL-3, IL-6, IL-
7, M-CSF, GM-
so CSF, stem cell factor, LIF and oncostatin M appear to either play a role in
hematopoiesis, are
expressed in the bone marrow or thymus, or the murine proteins show
specificity for murine
vs. human cells, thus suggesting that human HSC engrafted in a recipient
mammal may not
recognize the native mammalian cytokine. Genomic clones for these human genes
can be
W~ ~l/1$521 CA 02382383 2002-02-26 pCT/US00/23971
-21-
obtained and transfected into ES cells. The ES cells can be introduced into
blastocysts to
transfer the donor transgenes into the germline of a recipient mammal.
Isolation of genomic clones.
In a preferred method, PCR primer sets are designed against either the 5' or
the
s 3' end of genomic sequences so that constructs containing the genes can be
identified by PCR.
In addition, these primer sets can be designed to distinguish between mouse
and human genes
so that the native mammalian genes are not mistakenly identified during a
genomic or
transcriptional screen of the transfected ES cells or suspected recipient
mammals.
Human genomic libraries are screened using gene specific primer sets (See
o Example 2 and Ausubel for a general description of genomic library
screening). If desired,
positive clones can be further confirmed by either other primer sets for the
same gene or by
Southern blot analysis. Depending on the size of the gene, different types of
cloning vectors
and libraries are readily available. Genes up to approximately l5kb may be
obtained from
lambda libraries. Those up to SOkb may be identified from cosmid libraries.
Larger genes
~s over SOkb can be isolated from BAC, PAC, P1, YAC, MAC, or other such
libraries.
Demonstration of in vitro transcription from the genomic constructs.
Because the transgenes will be expressed in mammalian hosts, it may be
desirable to determine the ability of the human sequences to be transcribed by
mammalian cells
other than human, preferably murine before transfection into possibly rare ES
cells.
zo Undigested or digested genomic constructs can be transfected by lipofection
into a murine cell
line that expresses the endogenous form of each cytokine. Commercial
lipofection reagents are
widely available and may require optimization for a particular cell type to
obtain adequate
transfection efficiencies in a transient assay. The mRNA from the transfected
cells is then
analyzed for transcription of the contruct. Depending on the preference of one
of skill, the
zs mRNA can be electrophoresed according to standard procedures and then
probed in a northern
blot, or first strand cDNA can be synthesized by standard reverse
transcription methods. The
resulting cDNA can then be analyzed by labeled probe and Southern blot or by
PCR methods.
Selection of ES clones that contain human cytokine genes.
Two equally preferred embodiments can be used to combine all of the desired
so genes into one strain. In the first method, groups of transgenes are co-
transfected into ES cells
along with a selectable marker for neomycin resistance. For example, one group
of genes can
contain IL-7, SCF, and LIF constructs, and the second contain GM-CSF, M-CSF,
and IL6
constructs. In the second method, all desired genes are co-transfected
together. If all of the
CA 02382383 2002-02-26
WO 01/15521 PCT/L1S00/23971
-22-
necessary transgenes are not present in the germline of one transgenic mammal,
that mammal
can be mated to a mammal comprising, in its germline, the necessary transgene
to create
offspring with all necessary transgenes.
To introduce the transgenes into the ES cells, the DNA constructs are digested
with a desired restriction endonuclease that linearizes the DNA, if circular.
Within each group,
it is preferred that DNA constructs are mixed in equal molar ratio. However,
one of skill will
recognize that if more copies of one gene is desired, DNA constructs of that
gene should be
over-represented. For positive selection, a marker-containing plasmid can be
mixed with these
DNAs at molar ratio of about 4:1.
The DNA can then be introduced ES cells by lipofection or another suitable
technique. The preferred transfection protocol is similar to that provided by
the manufacturer
of the lipofection reagent and is described in detail in Example 2. After a
suitable time in
selection media (preferably 5-20 days and more preferably 10-14 days),
individual transfected
ES cell colonies are transferred into 96-well dishes for cloning and
expansion.
~s Although one method is described here and in Example 2, those of skill in
the
art will realize that other methods of inserting transgenes in the germ line
of mammals are
known and also available. Some of these methods can are found in US Patents
4,873,191,
5,434,340, 4,464,764, 5,487,992, 5,814,318; PCT published patent applications
WO 97/20043,
WO 99/07829, WO 99/08511; and Perry, et al., Science 284:1180 (1999).
2o Depending on the transgene that has been inserted into the ES cell,
different
techniques can be used to detect the transgene. For example, PCR can be used
to detect
genomic DNA or cDNA made from RNA transcripts, ELISA and other antibody-based
assays
can be used to determine whether the gene product of the transgenes are
synthesized in ES
cells or are present extracellularly, and if such an assay is available, a
functional assay can be
2s used to detect the gene product.
Reconstitution of an Immune System
A common method for studying the biology of human hematopoietic stem cells
is to transfer them into immunocompromised mice. Inbred strains of mice
carrying
spontaneous mutations, such as the SCID, NOD/SCID and beige/nude/xid mice,
have been the
3o most widely used hosts. The advent of gene targeting has led to a large
variety of
immunodeficient animals that are presently under evaluation for this purpose.
The animals are
usually conditioned by sublethal irradiation, and are often supplemented with
injections of
human growth factors to augment the level of bone marrow engraftment and
expansion of
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-23-
progenitor and/or mature cells. In studies with mice with the SCID mutation,
it appears that a
dominant genotype present in the B6/129 mouse, if the mutation is placed in
this mouse, serves
to nullify some of the phenotypes observed with the mutation. Fewer effects
are seen on a
Balb/c background. Even fewer effects are seen on a NOD background. Thus, the
preferred
s murine background for the RAG mutation may be NOD/SCID. It is not well
understood why
particular genetic backgrounds perform better than others, or if supplemental
growth factors
are beneficial. For example, transgenic SCID mice that express human genes for
stem cell
factor, GM-CSF, and IL-3, engraft more efficiently than non-transgenic SCID
mice, but not
any better than NOD/SCID mice. The human genes were driven by a viral promoter
rather
than the endogenous regulatory sequences, and most likely had abnormal
patterns and levels of
expression (Bock, et al. J. Exp. Med. 182:2037-2043).
In addition to the SCID, RAG and NOD mutations, other mutations may be
beneficial to the recipient mammals of this invention. For example,
experiments with the
SCID mutation have shown that a y~ knock out mutation or a (3-2 microglobulin
knockout
~s mutation may improve the engraftment of xenogeniec HSC.
Transplanted Hematopoietic Stem Cells
Sources of hematopoietic stem cells include, but are not limited to, umbilical
cord blood (CB), bone marrow (BM) and mobilized peripheral blood (MPB).
Human CB can be obtained, for example, from Advanced Bioscience Resources
zo Inc (ABR), Alameda, CA, or Purecell, San Mateo, CA. CB is collected by ABR
from local
hospitals within 24 hours of shipping and is processed on site. Alternatively,
human BM, CB,
and/or MPB cells are obtained from Purecell as either fresh or frozen cells,
and fractionated or
unfractionated cells. Before use, all samples are tested for Hepatitis B and
C, and HIV. Any
experimental materials involving samples found to be virus positive are
discarded immediately
zs and animals removed, marked and disposed of in accordance with procedures
for disposing
contaminated animal carcasses. Throughout the course of the experiment, all
samples should
be treated under the assumption that they may be contaminated with human blood
borne
pathogens (Biosafety Level 2, BL-2). All personnel handling mice with human
blood cells
should receive the hepatitis B vaccine.
3o The preferred age for transplant is either shortly after birth
(approximately 72
hours) or as adult animals (4-8 weeks of age) that have been conditioned with
gamma-
irradiation, however, other types of conditioning are known and are
envisioned. The haplotype
of the donor hematopoietic stem cells may be selected on the basis of the test
population of
W~ 01/15521 CA 02382383 2002-02-26
PCT/US00/23971
-24-
interest in order to determine the responsiveness of particular individuals to
specific antigens,
e.g., for the purpose of determining the allergenicity of proteins or peptides
within the
population.
To transplant, lymphocytes from a source of hematopoietic stem cells are
isolated, preferably by density separation and counted. As a guide, adult mice
can receive
from 0.1-10 x 10' total cells. Alternatively, animals may also be transplanted
with CD34+ cells
purified from, for example, cord blood using, e.g., the Dynal Detach-a-Bead
research grade
separation system or by FACS sorting. Purified CD34+ cells from cord blood are
then injected
into neonatal or adult animals. In mice, approximately105 cells are injected
per pup, or about 5
x 105 cells per adult.
HSC-populations can be injected intravenously (iv). If desired, adult mammals
may be treated on day minus-1 with rabbit polyclonal anti-asialo GM antibodies
to reduce the
activity of NK cells. Alternatively, recipient mammals, in particular mice,
may be crossed
onto a background deficient in NK cell function, such as perform-deficient
mice. Neonatal
~s animals have little to no NK activity and, therefore, it is not necessary
to treat them.
Typically, adult mice are the recipient mammals. They are injected into the
tail
vein by standard procedures. They may also be injected via the retro-orbital
sinus, in which
case animals are anesthetized first. Typically, a mixture of ketamine and
xylazine delivered
intraperitoneally or intramuscularly is used. Animals should be kept warm and
eyes moistened
zo during the procedure and monitored until they recover. To inject cells into
the retro-orbital
sinus of neonatal mice, pups are held below a light source to better visualize
the eye vein. The
needle is held parallel to the vein and inserted by aiming just below the
surface of the skin.
Cells are slowly injected while watching to determine that blood is cleared
downstream of the
needle point, and that swelling around the vein does not occur. After
injection the needle is
2s held in place for a short period to allow the cells to enter the
circulation. If necessary, pups
may be chilled briefly on ice to reduce their activity.
In an alternative embodiment, the recipient mammals may receive gamma-
irradiation conditioning according to established experimental protocols (Bix,
et al. Nature
349:329-331 (1991); Markowitz, et al. Proc. Natl. Acad. Sci. 90: 2779-2783
(1993)). Using
so mice as an example, a Mark I Model 30 sealed Cs-irradiator or similar
instrument is used to
administer doses ranging from 100-1000 cGy/animal according to manufacturer's
protocol. A
lethal level of radiation may be administered as a split dose (e.g., 2 x SOOR
for Balb/c mice) for
W~ ~l/15521 CA 02382383 2002-02-26 pCT/US00/23971
-25-
improved reduction of natural killer cells. Radiation is performed from 2-24
hours prior to
injecting human hematopoietic cells.
Methods of determining whether engraftment has taken place are well known in
the art and include Pflumio, et al. Blood 88:3731-3740 (1996); Dick, et al.
Stem Cells 15 Suppl
1:199-203 (1997); Ramirez, et al. Exp. Hematol. 26:332-344 (1998); Hogan, et
al. Biol. Blood
Marrow Transplant 3:236-246 (1997); Hogan, et al. Blood 90:85-96 (1997); and
Lapidot, et al.
J. Mol. Med. 75: 664-673 (1997).
One of skill in the art will realize there are many ways to determine if the
transplanted HSC have engrafted. In a preferred method, lymphocytes from the
recipient
to mammals are removed and investigated for the presence of human cell surface
antigens. CD45
is preferred. This detection it typically done by staining cells with a dye
conjugated to an
antibody that binds to human CD45, which is found on both B and T lymphocytes,
and not
murine CD45. See, Colas, et al., Transplantation 67:984 ( 1999). Other methods
include PCR
amplification of human DNA sequences from lymphocytes.
III. USES OF MAMMALS OF THIS INVENTION
The mammals of this invention have a variety of uses. For example, the
recipient animals of this invention cab be used as a model for determining the
allergenicity of
non-donor, e.g., non-human, macromolecules. These macromolecules include
proteins,
zo carbohydrates lipids, and other compounds. Proteins include but are not
limited to
commercially important enzymes such as bacterial proteases, fungal cellulases
and the like.
With the model, as described above, the animals can be exposed to the test
compounds and the
immune response of the animals monitored. Based on the response in the animal
model, the
compounds can be modified so that the immune response is lessened, for example
to decrease
zs allergenicity, or increased, for example, if the compound is to be used as
a vaccine.
Alternatively, the model of this invention can be used to determine the effect
compounds have on a human immune system. For obvious ethical reasons,
experimental
compounds cannot be used on human subjects. A mouse with a functional human
immune
system allows this more relevant preclinical testing to be done.
3o In another use of this invention, the recipient mammals generate fully
human
polyclonal or monoclonal antibodies to specific antigens. Unlike human
antibodies currently
available in the art, no genetic manipulation of antibodies of other species,
e.g., humanization,
would be needed, and would not pose the same biological hazard as purified
antibodies from
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-26-
humans with accidental exposure to antigens possess. It is also contemplated
the mouse of the
instant invention can be used to determine whether humanized or other
monoclonal antibodies
will raise a response in a human immune system.
In addition to a humoral response, the mouse of this invention can be used to
investigate the human cell mediated response to pathogens and other
immunomodulatory
compounds. For example, T cell epitopes present in proteins present in
pathogens can be
determined. In addition to pathogens, other proteins, such as proteins
involved in an
autoimmune response can be examined for the presence of T cell epitopes.
In still another use of the invention, factors involved in regulating the
development and function of human hematopoietic cells can be determined. These
factors can
serve to both identify the biological properties of these factors and to test
their effectiveness as
therapeutic molecules in preclinical models. Of particular interest are
factors that augment
hematopoietic reconstitution (e.g., after bone marrow transplantation or other
states of
immunodeficiency), can direct the targeting of immune responses towards
cellular vs. humoral
~s effectors, suppress harmful inflammatory or autoimmune responses, and
stimulate immune-
mediated clearance of infectious agents or cancerous tissue.
EXAMPLES
The following examples are submitted for illustrative purposes only and should
not be interpreted as limiting the invention in any way.
2o Example 1 Allogeneic reconstitution of RAG -2 mutant mice.
To compare the ability of CB 17.SCID (SCID; H-2d) and RAG2~~- mutant (RAG;
H-2b) mice to support development of bone marrow (BM)-derived lymphocyte
precursors,
animals were engrafted intravenously with 10' T-cell depleted BM cells
approximately 72
hours after birth. RAG mice were engrafted with syngeneic (H-2b) C57B1/6 or
Zs (129xC57B1/6)F1 BM (RAG-(syn); H-2b -> H-2b) or with fully allogeneic
Balb/c BM (RAG-
(allo); H-2d -> H-2b). SCID mice were engrafted with syngeneic Balb/c BM (SCID-
(syn); H-
2d -> H-2d) or with fully allogeneic C57B1/6 BM (SCID-(alloy; H-2b -> H-2d).
Hind leg bones (femur and tibia) were taken from euthanized 4 to 8 week old
healthy donor mice and flushed using a 25 gauge needle attached to a 3 ml
syringe filled with
so cold DPBS to obtain cells in a single cell suspension. Cells were washed
with DPBS and
pelleted. Since bone marrow preparations contain functionally mature T cells,
T cells were
depleted using 10 pg/ml anti-Thy-1 mAb (30H12) at 2-5 x 10' cells/ml for 30
minutes on ice.
Cells were then centrifuged, resuspended in anti-rat IgG (MAR 18.5) culture
supernatant at
W~ 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-27-
approximately 2-5x10' cells/ml. Guinea pig and rabbit complement were then
added to 1:20
v:v each and incubated at 37° for 45 minutes. Cells were centrifuged
and resuspended in 3 ml
room temperature DPBS, and underlayed with 3 ml room temperature Histopaque
density =
1.119 and centrifuged for 10 minutes at 800 g. Viable cells were collected
from the interface,
washed in 2% FCS/DPBS, counted and resuspended in DPBS to a concentration of
3x108
cells/ml with no FCS
Mice were anesthetized using an injectable ketamine/xylazine (100 and 20
mg/kg, respectively) 0200 ~.l for average mouse) solution. 3x 107 ( 100 ~1) T-
depleted bone
marrow cells were injected intravenously via the retro-orbital sinus into the
appropriate donor
(same sex, 5 to 6 weeks of age). Neonatal mice received no more than 50 ~1 of
injectate
containing 10' bone marrow cells via the retro-orbital vein with no injectable
anesthetic, just
reduction of body temperature with ice. Both syngeneic (same MHC haplotype)
and
allogeneic (MHC haplotype mismatched) mice were transplanted. Mice were left
for 8 weeks
to allow bone marrow to engraft at which time the mice (usually 3 in each
group) were
~s euthanized and organs removed for study. A thorough cellular analysis (FACS
) of the
thymus, spleen, mesentaeric lymph nodes (in some cases) and peripheral blood
(PB) was
performed. T cells, B cells, and granulocytes were assessed in these areas
using fluorescence-
conjugated cell type-specific antibodies. See Table 1.
Table 1: Cell numbers and uercenta~es for spleen, lymph node and thymus
for reuresentative 7 to 8 week old neonatallv engrafted animals.
Spleen Lymph Thymus
Cell Nodes Cell
# Cell # (CD4/CD8)
(%CD3B220) #
(%CD3B220)
SCID (s 5.4 (28/53) 7.8 (79/17) 1.0 (6/15)
n) x x x 10
10 10
SCID (alloy7.5 (30/58) 4.8 (65/31) 2.6 (3/10)
x x x 10
10 10
RAG (s 6.8 (28/33) 2.2 (78/18) 1.0 (4/10)
n) x x x 10
10 10
RAG (alloy3.6 (49/44) 2.6 (83/15) 4.6 (5.15)
x x x 10
10 10
(129xB6)a 9.9 (32/58) 2.7 (63/29) 11 x (3/10)
x x 10
10 10
Balb/c$ 1.1 (35/54) 2.2 (66/23) 6.6 (2/12)
x x x 10
10 10
RAG 2' 5.8 (0/5) 3.1 (0/3) 2.5 (0/0)
-a x x x 10
10 10
a: averaged data
As can be seen, SCID animals tended to engraft higher percentages of B cells
than RAG animals. This was found to be true over a number of different time
points.
Thymuses of eight week old animals engrafted well, and exhibited normal
percentages of
is CD4+ and CD8+ single positive cells. Additionally, thymus flow cytometric
profiles are
comparable, including the percentage of CD3+ cells. The RAG (alloy chimera
depicted had
WD ~l/15$Zl CA 02382383 2002-02-26 pCT/US00/23971
-28-
slightly more immature double negative (DN) thymocytes; however, an enrichment
for DN
thymocytes was not a reproducible finding over the X number of RAG-(alloy mice
examined
during the course of this study.
Remaining mice of successful chimera studies were then immunized with 50 pg
s KI,H in CFA intraperitoneally and boosted 2 weeks later with KLH in IFA.
Immunized mice
were bled 1 week later and sera samples were tested for total IgG as well as
IgGI (in some
cases) by ELISA. See Figure 2 and Table 2 below.
Table 2~ Characterization of the functional development of hematopoietic cells
in novel
allo~eneic chimaeras
Donor strain Recipient strain Engraftmt? Ab
prod?
B6 (H-2b) 129 RAG-2 (H-2b) Yes Yes
Balb/c (H-2d) 129 RAG-2 (H-2b) Yes Yes
Balb/c (H-2d) Balb SCID (H-2d) Yes - N/A
B6 (H-2b) Balb SCID (H-2d) No N/A
B6 (H-2b) C1D/ 129 RAG-2 (H-2b) CD4's Yes
Balb/c (H-2d) C1D/ 129 RAG-2 (H-2b) CD4s, a few Slight
CDBs
B6 (H-2b) C2D/ 129 RAG-2 (H-2b) Mediocre N/A
Balb/c (H-2d) C2D/ 129 RAG-2 (H-2b) No N/A
B6 (H-2b) brad C1D/ 129 RAG-2 (H-2b) Yes Yes
Balb/c (H-2d) brad C1D/ 129 RAG-2 (H-2b) Yes Yes
B6 (H-2b) Irrad C2D/ 129 RAG-2 (H-2b)Yes Yes
Balb/c (H-2d) Irrad C2D/ 129 RAG-2 (H-2b)Yes Yes
Balb/c (H-2d) Balb RAG-2 (H-2d) Yes Yes
B6 (H-2b) Balb RAG-2 (H-2d) Yes Yes
B6 (H-2b) B6 SCID (H-2b) Yes N/A
Balb/c (H-2d) B6 SCID (H-2b) No N/A
B6 (H-2b) (129XB6) RAG-1 (H-2b) Yes N/A
Balb/c (H-2d) (129XB6) RAG-1 (H-2b) No N/A
B6 (H-2b) repeat(129XB6) RAG-1 (H-2b) Yes Yes
Balb/c (H-2d) (129XB6) RAG-1 (H-2b) No N/A
repeat
Balb/c (H-2b) (129XB6) RAG-1 (H-2b) 5E7 No N/A
Balb/c (H-2d) (129XB6) RAG-1 (H-2b) irradYes Yes
Balb/c (H-2d) 129 RAG-2 (H-2b) Yes Yes
AKR (H-2k) 129 RAG-2 (H-2b) Yes Yes
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-29-
AKR (H-2k) 129 RAG-2 (H-2b) Yes Unknow
n
TCRtgxAKR (H-2~S) 129 RAG-2 (H-2b) Yes unknow
n
B6 (H-2b) TCR (3/8 ko (H-26) (irrad) Yes Yes
Balb/c (H-2d) TCR [3/8 ko (H-2b) (irrad) Yes Yes
As has been reported, SCID-(alloy mice responded poorly, indicating a lack of
antigen-specific cognate T-B interactions. This has been presumed to be due to
positive
selection of donor CD4+ T cells by the host thymic epithelium, resulting in T
cells unable to
s interact with donor MHC-expressing B cells. In contrast, RAG-(alloy mice
produced
equivalent levels of antigen-specific IgG as RAG-(syn) animals (Figure 2 A).
Prebleed serum
routinely showed absorbances equal to background. In addition, serum IgG was
not cross-
reactive when tested on ovalbumin (OVA) coated plates. Antigen specific IgM
responses were
also noted. This phenomenon was investigated for a second antigen, KLH. As is
shown in
Figure 2 B for two independent RAG-(alloy animals, the antigen-specific serum
IgG response
was found to be on the order of control RAG-(syn) responses, and developed
with similar
kinetics. Serum from all mice was found not to cross-react on ELISA plates
coated with an
irrelevant antigen. This result suggests that donor derived BM cells are
capable of positively
selecting CD4+ T cells which can then interact with donor derived antigen-
specific B cells in
~s the periphery, resulting in an isotype switch to IgG.
Functional analyses on peripheral lymphocytes from chimeric animals were also
performed. CD4+ T cells were isolated from the lymph nodes of engrafted
animals, and tested
for reactivity in a mixed lymphocyte culture (MLR). Figures 1A and C depict
proliferative
responses of RAG-(syn) (A) and SCID-(syn) (C) CD4+ T cells to LPS-induced
splenic blasts
Zo from C57B1/6, Balb/c and third party H-2k expressing mice. Both RAG-(syn)
and SCID-(syn)
were tolerant to self, but were responsive to alloantigens. RAG-(alloy mice
were tolerant to
both C57B1/6 and Balb/c and were responsive to third party H-2k alloantigens.
However,
SLID-(alloy was functionally compromised in that a small response was mounted
to Balb/c
derived stimulators, indicating incomplete tolerance to self MHC.
Additionally, the response
zs to third party H-2k expressing stimulators was impaired. A control RAG-
(syn) created with the
same BM inoculum as injected into the SCID-(alloy is shown in panel D. Thus,
RAG-(alloy
mice were found to be tolerant to both donor and host MHC, and were responsive
to third
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-30-
party, but SCID-(alloy was functionally impaired. In addition, the mitogen
reactivity of
splenocytes and lymph node cells was tested. RAG-(alloy splenocytes responded
normally to
the T cell mitogen PHA, while SCID-(alloy T cells were hyporesponsive. All
engrafted
animals' splenocytes showed control level responses to LPS.
To further investigate the apparent donor restricted T cell responses, RAG-
(alloy
animals were immunized in the hind foot pads, then CD4+ T cells were purified
from draining
lymph nodes. Primed CD4+ T cells were co-cultured with antigen-pulsed LPS-
induced splenic
blasts, and proliferation was assessed. Figure 3 shows the proliferative
responses of KLH-
primed draining CD4+ T cells from two different RAG-(alloy animals. The
response to KLH
pulsed C57B1/6 stimulators was found to dominate, indicating preferential
selection of CD4+ T
cells to recognize antigen in the context of the thymic epithelium MHC.
However, an antigen-
specific response to KLH-pulsed Balb/c blasts represented approximately 30% of
the control
response. This experiment was repeated 5 times, with a similar level of donor
restricted
response noted (range = 20 to 50°10 of host response). Similar results
were obtained with adult
~s engrafted mice.
These results suggest that for the fully allogeneic H-2d -> H-2b combination
created in unirradiated neonatal RAG hosts, donor derived BM cells positively
selected CD4+
T cells. It had been well accepted that thymic epithelium affected the
majority of the positive
selection occurnng in the thymus. However, selection by other cell types and
across MHC
zo barriers had been observed only for CD8+ T cells. Positive selection of
both MHC class I
restricted (Pawlowsky, et al. Nature 364:642-5 (1993)) and class II restricted
(Hugo, et al.
Proc. Nat'l Acad. Sci. 90:10335-10339 (1993)) T cells had been demonstrated to
occur on
transfected fibroblasts injected intrathymically. Selection of MHC class II
restricted cells was
demonstrated when the thymocytes shared MHC haplotypes with both the thymic
epithelium
zs and the injected fibroblasts. This constraint was not evident for the
selection of MHC class I
restricted cells. While thymic positive selection by BM cells for CD4+ T cells
did not occur in
BM engrafted irradiated adult MHC class II-deficient mice, others have
demonstrated
functional restriction to donor MHC using parental into Fl bone marrow
chimeras. On the
other hand, functional restriction of CD4+ T cells to donor MHC, indicating
positive selection
3o by BM-derived cells, has not been demonstrated in fully allogeneic
chimeras, although with a
few exceptions (Longo, et al. Nature 287:44-47 (1980); Longo, et al. J.
Immunol 130:2525-
2528 (1983); and Longo, et al. Proc. Nat'l Acad. Sci. 82:5900-5904 (1985)).
Taken together
these data indicate that thymic epithelium and BM-derived cells must share MHC
haplotypes
CA 02382383 2002-02-26 PCT/US00/23971
-31-
to effect efficient positive selection (Zink, and Elliot), and the
requirements for selection of
CD4+ T cells may be more strict than those for CD8+ T cells.
The results presented here suggest that the RAG2-~- mutant strain is unique
because it provides an environment that allows for BM derived cell selection
events to occur
s efficiently and in the absence of haplotype sharing by the thymic
epithelium. The uniqueness
of the RAG mouse may be due to the non-leaky nature of the mutation. The SCID
mouse is
well known to occasionally develop cells with functional antigen receptors.
The development
of even a few antigen-receptor positive cells may be enough of a signal to the
thymic
microenvironment to induce functional changes which preclude the recruitment
and/or
functionality of donor BM-derived cells capable of positive selection. Both
neonatal and adult
SCID mice were used in these experiments and neither exhibited the capacity to
support donor
allogeneic BM restriction. Therefore, RAG mice may represent a model whose
lymphopoietic
microenvironments are functionally frozen at a fetal developmental stage, as
has been
suggested by thymocyte phenotype. If RAG mice represent a "fetal" model, then
selection
~s onto BM derived cells may be a normal event in the thymus, and this
phenomenon may not
have been routinely detected in other systems due to the use of the SCID
mouse, or due to
secondary effects of irradiation.
Example 2. Development of trans~enic mice expressing human cvtokine genes.
zo Based on both animal and in vitro studies, the following set of transgenes
either
play a role in hematopoiesis, are expressed in the bone marrow or thymus,
and/or the murine
proteins show specificity for murine vs. human cells: IL-3, IL-6, IL-7, M-CSF,
GM-CSF, stem
cell factor, LIF and oncostatin M. Genomic clones for this set of human genes
were obtained
and used to select ES cell clones to derive transgenic mice.
25 Isolation of genomic clones.
PCR primer sets were designed against either the 5' or the 3' end of genomic
sequences so that constructs containing the genes could be readily identified
by PCR. In
addition, these primer sets were designed to distinguish between mouse and
human genes. The
following primers and conditions were used to identify the human clones:
so human IL-7
3181-SP6-F2: 5' AAATCAAGCTTGAATGACAAACTCC 3' (SEQ ID
NO:1 )
3181-SP6-R2: 5' GGACAGCATGAAAGAGATTGGAGC 3' (SEQ ID N0:2)
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-32-
product size: 121bp
annealing temperature: 60°C
human SCF
s 20180-T7-F: 5' ATGCAAGCTTGATTCATCCTC 3' (SEQ ID N0:3)
20180-T7-R: 5' CGTGGTITT"TATTCGAAATGC 3' (SEQ ID N0:4)
product size: 176bp
annealing temperature: 60°C
~o human LIF
hLIF-3F: 5' TTCCTCTGGGTAAAGGTCTGTAAG 3' (SEQ ID NO:S)
hLIF-3R: 5' TCCACTTGTAACATTGTCGACTTC 3' (SEQ ID N0:6)
product size: 388bp
annealing temperature: 60°C
is
human GM-CSF
GMCSF2/3F: 5' CTCAGAAATGTTTGACCTCCAG 3' (SEQ ID N0:7)
GMCSF2/3R: 5' GTCTGTAGGCAGGTCGGCTC 3' (SEQ ID N0:8)
product size: 729 by
zo Annealing temperature: 60°C
human M-CSF
31HU-MCSF-F: 5' GAAGACAGACCATCCATCTGC 3' (SEQ ID N0:9)
31HU-MCSF-R: 5' TGTAGAACAAGAGGCCTCCG 3' (SEQ ID NO:10)
zs product size: 401 by
Annealing temperature: 60°C
human IL-6
S1-BSF2-F: 5' TGGTGAAGAGACTCAGTGGC 3' (SEQ ID NO:11)
30 51-BSF2-R: 5' TACTTCAAGGCGTCTCCAGG 3' (SEQ ID N0:12)
product size: 225 by
annealing temperature: 60°C
W~ (fl/l5rJZ1 CA 02382383 2002-02-26 pCT/US00/23971
-33-
Human genomic P1(for IL-6, M-CSF, and LIF), BAC(for IL-7 and SCF), and
PAC(for GM-CSF) libraries (Genome Systems, Inc.) were screened using the gene
specific
primer sets, above. IL-3 and OM are closely lined to GM-CSF and LIF,
respectively, and were
not screened for in the first round. Positive clones were further confirmed by
either other
s primer sets for the same gene or by southern blot. The following primers
were used for PCR
confirmation:
human IL-7
51 IL7F: 5' GGCGTTGAGAGATCATCTGG 3' (SEQ ID N0:13)
~0 51 IL7R: 5' TGCAGCTGGTTCCTCTTACC 3' (SEQ ID N0:14)
product size: 342 by
Annealing temperature: 60°C
FIL7: 5' CATACAGCATTACAAATTGC 3' (SEQ ID NO:15)
is RIL-7: 5' TGTAGATTCTGGCCTGC 3' (SEQ ID N0:16)
product size: 322 by
annealing temperature: 60°C
human SCF
zo SCF-DF: 5' CCAAACTTCTGGGGCATTTA 3' (SEQ ID N0:17)
SCF-DR: 5' CTCTCCACTGTCCCTGCTTC 3' (SEQ ID N0:18)
product size: 220 by
annealing temperature: 60°C
zs SCF-3F2: 5' GCATGGAGCAGGACTCTATT 3' (SEQ ID N0:19)
SCF-3R4: 5' AGTTTGTATCTGAAGAATAAAGCTAGG 3' (SEQ ID
N0:20)
product size: 160 by
annealing temperature: 60°C
human LIF
hLIF-3F: 5' TTCCTCTGGGTAAAGGTCTGTAAG 3' (SEQ ID N0:21)
hLIF-3R: 5' TCCACTTGTAACATTGTCGACTTC 3' (SEQ ID N0:22)
W~ ~l/15521 CA 02382383 2002-02-26 pCT/US00/23971
-34-
product size: 388bp
annealing temperature: 60°C
human OM
s OSMSF1: 5' CCTAAAGTGAGGTCACCCAGAC 3' (SEQ ID N0:23)
OSMSR1: 5' CTCTGTGGATGAGAGGAACCAT 3' (SEQ ID N0:24)
product size: 456 by
annealing temperature: 60°C
io OSM3F1: 5' GAGATCCAGGGCTGTAGATGAC 3' (SEQ ID N0:25)
OSM3R1: 5' GATGCTGAGAAGGGGAGAGAG 3' (SEQ ID N0:26)
product size: 384 by
annealing temperature: 60°C
~s human GM-CSF
GMCSF1/2F: 5' AGCCTGCTGCTCTTGGGCAC 3' (SEQ ID N0:27)
GMCSFI/2R: 5' CTGGAGGTCAAACATTTCTGAG 3' (SEQ ID N0:28)
product size: 282 by
annealing temperature: 60°C
GMCSF3/4F: 5' ATGGCCAGCCACTACAAGCAG 3' (SEQ ID N0:28A)
GMCSF3/4R: 5' GGTGATAATCTGGGTTGCACAG 3' (SEQ ID N0:29)
product size: 878 by
annealing temperature: 60°C
2s
human IL-3
IL-3F: 5' CGTCTGTTGAGCCTGCGCAT 3' (SEQ ID N0:29A)
IL-3R: 5' AAATCTCCTGCCATGTCTGCC 3' (SEQ ID N0:29B)
product size: 298 by
so annealing temperature: 60°C
human M-CSF
VVO ~l/1$SZl CA 02382383 2002-02-26 pCT/US00/23971
-35-
HUM-CSF-SF1: 5' GAGGGAGCAAGTAACACTGGAC 3' (SEQ ID
N0:30)
HUM-CSF-SR1: 5' CGTCTTCCTAGTCACCCTCTGT 3' (SEQ ID N0:31)
product size: 322 by
s annealing temperature: 60°C
human IL-6
IL6-3F: 5' CTAGATGCAATAACCACCCCTG 3' (SEQ ID N0:32)
IL6-3R: 5' CAGGTTTCTGACCAGAAGAAGG 3' (SEQ ID N0:33)
to product size: 217 by
annealing temperature: 60°C
Plasmid DNA from Pl, BAC, or PAC clones was prepared using the KB-100
Magnum columns (Genome Systems, Inc.). Detailed experimental procedures were
described
in detail in the user's manual supplied by the manufacturer. To quantify DNA
concentrations,
a DNA constructs were digested with EcoRI, followed by electrophoresis on 0.8%
agarose gel
along with DNA standards with known concentration. Plasmid DNA concentrations
were
determined by comparison with the standards.
The following DNA constructs were identified as having the full structural
sequences for the target genes based upon the presence of both 5'- and 3'-
ends of the coding
zo regions:
IL-7: BAC20854 (100kb), BAC2267C7 (110kb), PAC24404 (90kb)
SCF: BAC21029 (145kb)
LIF: P1-20872 (100kb), P1-20873 (100kb)
GM-CSF: PAC21689 ( 150kb), PAC21691 ( 194kb)
zs M-CSF: Pl-3882 (SSkb)
IL-6: P1-3877 (n/d), P1-3878 (65kb)
The sizes of the clones (in parentheses) were determined by restriction
digestion
with Notl followed by pulse-field gel electrophoresis. The gel running
conditions were set as
followed:
so initial switch time: 1 sec
final switch time: 6 sec
total run time: 12 hrs
voltage: 6 v/cm
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-36-
angle: 120°
Demonstration of in vitro transcription from the genomic constructs
To determine the ability of the human genomic clones to be transcribed by
murine cells, undigested genomic constructs were transfected into MM54 cells
(a murine cell
s line that expresses the endogenous form of each cytokine, ATCC # 6434-CRL)
by lipofection
using Tfx50 (Promega) according to the manufacturer's instructions. The cells
were harvested
48 hours later for mRNA analysis. Total RNA was prepared using the Ultrspec~
RNA
isolation system (Biotecx). lOmg of gelatin carrier protein was added prior to
ethanol
precipitation to enhance RNA yield. First strand cDNA was synthesized by
standard reverse
transcription methods. Briefly, the RNA was resuspended in 29.5 ml of H20, and
mixed with
ml Sx first strand buffer, 2.5 ml IOmM dNTP, 5 m1 O.1M DTT, 1 ml O.Smg/ml
random
primer, and 2 ml M-MLV reverse transcriptase (Life Technologies). The reaction
was
incubated at 37°C for 1 hour, and the cDNA was purified by
Phenol/Chloroform extraction.
The resulting cDNA was then resuspended in 20 ml of H20. Human specific
transcripts were
's analyzed by nested-PCR methods. 1 ml of cDNA sample was first amplified
with the first
PCR primer-set for 30 cycles. After that, a 5 w1 aliquot was taken from the
reaction mixture
and subjected to a second round of PCR with the nested PCR primer set for an
additional 30
cycles. The DNA samples were resolved on a 1 % agarose gel.
Primer sets for nested-PCR:
zo human IL-7
15' round primers (Clontech):
CTIL-7F: 5' ATGTTCCATGTTTCTTTTAGGTATATCT 3' (SEQ ID
N0:35)
CTIL-7R: 5' TGCATTTCTCAAATGCCCTAATCCG 3' (SEQ ID N0:36)
Zs product size: 681 by
annealing temperature: 60°C
2"d round primers:
hIL-7F1: 5' GCATCGATCAATTATTGGACAGC 3' (SEQ ID N0:37)
hIL-7R1: 5' CTCTTTGTTGGTTGGGCTTCAC 3' (SEQ ID N0:38)
so product size: 280 by
annealing temperature: 60°C
human SCF
CA 02382383 2002-02-26
WO 01/15521 PCT/US00/23971
-37-
1 S' round primers:
hSCF5F3: 5' CACTGTTTGTGCTGGATCGCAG 3' (SEQ ID N0:39)
hSCFB-R: 5' TGAGACACGTGCTTTCTCTTCC 3' (SEQ ID N0:40)
product size: 1173 by
s annealing temperature: 60°C
2"d round primers:
hSCF3F1: 5' CAGCCAAGTCTTACAAGGGCAG 3' (SEQ ID N0:41)
hSCFA-R: 5' AGACCCAAGTCCCGCAGTCC 3' (SEQ ID N0:42)
product size: 364 by
'o annealing temperature: 60°C
human LIF:
1s' round primers:
hLIF-F1: 5' TAATGAAGGTCTTGGCGGCAGGAG 3' (SEQ ID N0:43)
's hLIF-R2: 5' TCCTGAGATCCCTCGGTTCACAGC 3' (SEQ ID N0:44)
product size: 652 by
annealing temperature: 60°C
2"d round primers:
hLIF-F2: 5' AACAACCTCATGAACCAGATCAGGAGC 3' (SEQ ID
2o N0:45)
hLIF-R1: 5' ATCCTTACCCGAGGTGTCAGGGCCGTAGG 3' (SEQ ID
N0:46)
product size: 402 by
annealing temperature: 60°C
human GM-CSF:
1s' round primers (from Clontech):
CT-hGMCSF-F: 5' ATGTGGCTGCAGAGCCTGCTGC 3' (SEQ ID N0:47)
CT-HGMCSF-R: 5' CTGGCTCCCAGCAGTCAAAGGG 3' (SEQ ID
3o N0:48)
product size: 424 by
annealing temperature: 60°C
2"d round primers:
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-38-
hGMCSF-F1: 5' CGTCTCCTGAACCTGAGTAGAG 3' (SEQ ID N0:49)
hGMCSF-R1: 5' CAAGCAGAAAGTCCTTCAGGTTC 3' (SEQ ID NO:50)
product size: 276 by
annealing temperature: 60°C
s
human IL-6:
1 S' round primers (from Clontech):
CT-hIL6F: 5' ATGAACTCCTTCTCCACAAGCGC 3' (SEQ ID NO:51)
CT-hIL6R: 5' GAAGAGCCCTCAGGCTGGACTG 3' (SEQ ID N0:52)
'o product size: 628 by
annealing temperature: 60°C
2"d round primers:
hIL6-F2: 5' TGGGGCTGCTCCTGGTGTTGC 3' (SEQ ID N0:53)
hIL6-R2: 5' CAGGAACTCCTTAAAGCTGCG 3' (SEQ ID N0:54)
's product size: 560 by
annealing temperature: 60°C
human M-CSF:
1 S' round primers:
zo hMCSF-F: 5' CTCTCCCAGGATCTCATCAGCG 3' (SEQ ID NO:55)
hMCSF-R1: 5' CAGGATGGTGAGGGGTCTTAG 3' (SEQ ID N0:56)
product size: 492 by
annealing temperature: 60°C
2°d round primers:
zs hMCSF-F: 5' CTCTCCCAGGATCTCATCAGCG 3' (SEQ ID N0:57)
hMCSF-R2: 5' TTGCTCCAAGGGAGAATCCGCTC 3' (SEQ ID N0:58)
product size: 410 by
annealing temperature: 60°C
The following genomic clones produced human-specific transcripts and were
3o chosen for use in ES cell transfection:
IL-7: BAC20854
SCF: BAC21029
LIF: P1-20872, P120873
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-39-
GM-CSF: PAC21689, PAC21691
M-CSF: P1-3882
IL-6: P1-3878
Selection of ES clones that contain human cytokine genes.
Murine embryonic stem (ES) cells (either RAG-/- ES cells or 129Sv/J wild type
ES cells) were transfected with 3 sets of genes of human hematopoietic growth
factors. The
liposome reagent, Tfx-50 (Promega) was used according to the manufacturer's
instructions.
Each set of genes contained equal molar concentration of 3 linearized growth
factor DNA. The
first DNA set (GM-CSF set) contained GM-CSF, M-CSF and IL-6. The second DNA
set (IL-7
set) contained IL-7, SCF and LIF. The third DNA set contained all 6
transgenes. Plasmid
DNA with a selectable marker, either PGK-Hyg (for RAG-/- ES cells) or PGK-Neo
(for
129Sv/J wild type ES cells), was used for positive selection.
Briefly, the growth factor DNA was linearized by digestion with Notl . The
growth factor DNA mixtures (2.18 fig) and linearized selectable marker DNA
(0.42 ~,g) was
~s mixed in 1 ml serum free Opti-MEM media and incubated with 170.6 ~g (97.51)
Tfx-50 for
15 minutes at room temperature. The molar ratio of marker versus DNA mixture
was 4:1 and
the ratio of Tfx-50 versus total DNA (marker and growth factor DNA) was 25:1.
Then, 6 - 9 x
106 ES cells in 5 ml of serum free Opti-MEM media were added to the
DNA/liposome mixture
and incubated for 1 hr at 37~C. After 1 hr incubation, the cells were
harvested and replated in
zo 6 well plates at a concentration of 2.5 x 105 ES cells per well. Hygromycin
( 120 ~,g/ml) or
6418 (400 ~g/ml) selection was started 24 hrs post transfection. Drug
resistant ES colonies
were picked after 10 to 14 days of selection.
Southern blot analysis of transgenic ES clones and determination of gene copy
numbers.
All DNA probes for the genes were generated by PCR from either human
zs genomic DNA or cDNA samples, then cloned into the pCRR2.1-TOPO vector. The
PCR
fragments were then recovered from the plasmid by EcoRI digestion and gel
purification using,
e.g., a Gel Extraction Kit (Qiagen).
human IL-7: A 350bp genomic fragment was amplified from total human DNA
with primer set 51 IL7F/51 IL7R (SEQ ID NOs:l3 and 14).
so human SCF: A 1173bp cDNA fragment was amplified from cDNA extracted
from human embryonic kidney cell line 293 with primer set hSCF5F3/hSCFB-R (SEQ
ID
NOs:39 and 40). This fragment was subsequently cloned into the pCRR2.1-TOPO
vector.
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-40-
After EcoRI digestion, an 808bp DNA fragment was purified from the gel and was
used as the
probe for identifying SCF.
human LIF: The 388bp PCR fragment(hLIF-3F/hLIF-3R) was subcloned and
used as the probe (hLIF-3F/hLIF-3R; SEQ ID N0:21 and 22).
s human GM-CSF: The 424 cDNA fragment was generated by PCR with primer
set CT-hGMCSF-F/CT-hGMCSF-R (SEQ ID N0:47 and 48) from human 293 cell cDNA
samples.
human M-CSF: The 400bp probe was generated with PCR primer set 31HU-
MCSF-F/31HU-MCSF-R (SEQ ID N0:9 and 10).
human IL-6: The 298bp probe was generated with primer set 51-BSF2-F/51-
BSF2-R (SEQ ID NO:11 and 12).
ES cell clones were analyzed by Southern blotting to confirm the presence of
genomic sequences and to determine relative copy number in comparison to human
DNA
controls. 10 ~g of DNA from each ES cell clones was digested with either EcoRI
(for IL-7 and
SCF), BamHI (for LIF and IL-6), or HindIII (for GM-CSF and M-CSF) and resolved
on 1 %
agarose gel. The DNA was transferred to a nylon membrane by alkaline transfer
(user's
manual, Genescreen Plus). The membranes were then prehybridized over night at
420C with
standard formamide containing buffer (Ausubel). Each probe was labeled using
the Prime-It II
Kit (Stratagene) and then added to the membrane. The hybridizations were
carned out
zo overnight with rotation at 420C. The membranes were washed two times at
room temperature
with the low stringency buffer (2xSSC, 0.1 % SDS) for 10 min each, and two
more times at
500C for 10 min each. The membranes were then dried by blotting in between two
layers of
Whatman paper, and exposed to phospho screens (Molecular Dynamics). The image
was
quantified by the STORM System (Molecular Dynamics). The copy number for each
zs transgene was derived by comparison with the human control.
Over 3400 drug resistant colonies were picked, of these, 264 clones have been
expanded. From these clones, 179 ES clones were found suitable for injection.
Among these
injectable ES clones, 2 had 6 genes, 18 had 5 genes and 95 clones had 3
transgenes.
The copy number for the same gene varied among different clones. For
3o example, clone 6 had one copy of IL-6 gene whereas clone 15 had two copies
of the same
gene. On the other hand, within the same clone, the copy number of one gene
varied from the
other gene. For example, clone 18 had one copy of IL-7 gene, two copies of SCF
gene, and
three copies of LIF gene.
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-41-
Generation of transgenic mice
ES cell clones containing the human cytokine genes are used to derive
transgenic mice as described in Robertson (ed), Teratocarcinomas and embryonic
stem cells -
a practical approach (1987), IRL Press. ES cells are injected into 3.5 day
p.c. C57BL/6
embryos and implanted into the uterus of pseudopregnant females and allowed to
develop to
birth. Male chimeras are mated with wild type C57B1/6 females to obtain
germline transgenic
lines.
Identification of mice with human transgenes
There are two ways to identify mice that have incorporated human transgenes:
Southern Blot and PCR analysis. It is preferable to use PCR to genotype the
mice due to its
speed and ease of experimental procedure. However, whenever there is concern
about the
validity of PCR results, Southern Blot should be carned out to confirm the
results. Briefly,
DNA samples were isolated from the tips of mice tails following standard
protocols (Qiagen
manual, DNeasy 96 Tissue Kit). PCR analysis using human-specific primer sets
(see Isolation
~s of genomic clones) was performed for each transgene. A positive control
sample containing
human DNA and a negative control sample containing mouse DNA were also carried
out at the
same time to ensure the specificity of the PCR products. Only mice that
contain the expected
human transgenes were selected for further breedings and experiments.
Seven independent lines of transgenic mice have been established so far. Clone
zo 12 and clone 71 have IL-6, M-CSF, and GM-CSF. Clone 74 and clone 75 have IL-
7, SCF, and
LIF. Clone 182 and clone 185 have all six transgenes in the germline, whereas
clone 201 has
every gene except for LIF. The same procedure was done throughout the breeding
process to
ensure the genotypes of the mice.
Demonstration of in vivo trascription from the genomic constructs
zs Total RNA samples were prepared (RNeasy Midi Kit, Qiagen) from nine tissues
of each transgenic mouse, including spleen, thymus, liver, kidney, heart,
muscle, lung brain,
and bone marrow. Total cDNA was prepared as previously described (see
Demonstration of
in vitro trascription from the genomic constructs). Gene expression analysis
for each
transgene was carned out by nested-PCR (see above). To ensure the
reproducibility of the
3o results, at least two mice from each genotype were analyzed by this method.
Mice from clone 71, which have human IL-6, M-CSF, and GM-CSF, showed
expression of all three transgenes in different tissues. Human IL-6 was mainly
expressed in the
spleen and thymus. Human GM-CSF expression was restricted in the thymus. On
the other
CA 02382383 2002-02-26
WO 01/15521 PCT/LJS00/23971
-42-
hand, human M-CSF has a much wider tissue distribution, with transcripts in
the spleen,
thymus, liver, kidney, heart, muscle, lung, and brain. Mice from clone 75,
which have human
IL-7, SCF, and LIF, also showed expression of all three transgenes in tissues.
Human IL-7 and
SCF seem to have a wide distribution pattern similar to M-CSF, whereas human
LIF
expression was restricted to the brain.
Mice from other ES clones that contain either IL-6, M-CSF, and GM-CSF, or
IL-7, SCF, and LIF were also analyzed by the same method. Although the
expression pattern
vary in certain tissues, the overall pattern was similar. This variation may
be attributed to the
difference in the insertion site of the transgenes and the copy numbers for
each gene. The
murine endogenous genes were also analyzed by nested-PCR. Despite differences
in certain
specific tissues, the expression pattern largely agrees with that of the human
transgenes.
Protein expression of human transgenes in serum and in the supernatant of bone
marrow stromal cell cultures derived from the injected mice were examined by
ELISA.
It was found that transgene expression patterns and levels varied between
~s clones, litters, littermates, and even stromal cells from same mouse. The
following table
provides ELISA results from mice injected with 4 ES cell clones
Table2: Trans~ene Expression Patterns
GM-CSF IL-7
set set
of of
transgenes transgenes
ES cloneMedia M-CSF IL-6 GM-CSF SCF IL-7 LIF
clone Serum X -- -- N/A N/A N/A
12
Supernatant-- -- -- N/A N/A N/A
clone Serum X X -- N/A N/A N/A
71
SupernatantX X -- N/A N/A N/A
clone Serum N/A N/A N/A X -- --
74
SupernatantN/A N/A N/A -- -- --
clone Serum N/A N/A N/A X X --
75
SupernatantN/A N/A N/A -- X --
In addition to transgene transcription and translation, the ability of the
stromal
2o cells to support hematopoietesis was investigated.
W~ 01/1$$21 CA 02382383 2002-02-26 pCT/US00/23971
-43-
To examine the effects of transgenic murine hematopoietic microenvironment
on human hematopoiesis, long term bone marrow cultures derived from transgenic
or wildtype
littermates were set up in tissue culture flasks.
After 2 weeks of culture, a monolayer of bone marrow stromal cells will form
and adhere to the bottom of flasks. Hematopoietic stem/progenitor cells then
adhere to the
stromal layer. As hematopoietic cells proliferate and differentiate, they
become non-adherent
and float freely in the supernatant of the culture. The cell number of
differentiated cells can be
counted and stained to determine the extent of proliferation and
differentiation of the
hematopoietic stem cells.
Once a stromal layer formed, the cultures were irradiated to eliminate murine
hematopoiesis and to stop proliferation of stromal cells. Irradiation,
however, maintained the
ability of the stromal cells to support human hematopoiesis in vitro. After
irradiation, human
cord blood mononuclear cells were added to the culture. Cell counts were made
weekly, as
was a 50% change in media. Every week, the non-adherent cells were counted and
analyzed
~s by FACS.
Stromal cells from clone 71 transgenic mice supported human hematopoiesis in
vitro better than clone 12 and clone 75. Non-adherent cells harvested from
transgenic co-
cultures were greater in number than wild type co-cultures established from
clone 71
littermates. Mixtures of stromal cells from clone 71 and 75 transgenic mice
supported human
zo hematopoiesis in vitro better than stromal cells from either clone 71 or
clone 75 alone, in terms
of non-adherent cellularity.
The effects of human transgenes on murine hematopoiesis were also examined.
Expression of human transgenes increased bone marrow B cell progenitor
production in
transgenic littermates of clone 71 and 75 mice.
zs
Example 3: Ability of irradiated H-2d -> H-2b C1D/RAG-2 and H-2b C2D/RAG-2
bone
marrow chimaeras to support functional en~raftment.
MHC class I deficient (C1D)/RAG-2 and class II deficient (C2D)/RAG-2 mice
were tested to assess whether MHC was necessary to facilitate alloengraftment.
Unirradiated
3o allogeneic C1D/RAG-2 chimeras produced antigen specific IgG antibody when
chimeras
contained greater than 10% donor B lymphocytes in the peripheral blood. In
comparison,
irradiation (800 rads) of C1D/RAG-2 hosts led to a relative increase in the
levels of donor cell
WD Ol/155Z1 CA 02382383 2002-02-26 pCT/US00/Z3971
engraftment, with a higher percentage of B cells in peripheral blood. All of
these chimeras
produced good antigen specific IgG antibody to KLH. Although radiation
conditioning was
not found to be an absolute requirement for the functional engraftment of
allogeneic
C1D/RAG-2 chimaeras, irradiated hosts supported more extensive cellular and
functional
engraftment.
In contrast to allogeneic C1D/RAG-2 chimeras, unirradiated C2D/RAG-2 mice
were unable to support cellular alloengraftment, therefore irradiation
preconditioning was used.
The level of thymocyte development in H-2d -> H-2b C2D/RAG-2 mice that
received 8008
irradiation was significantly better. The relative percentage of CD4+ cells
was diminished
relative to C1D/RAG-2 chimeras, which correlated with the absence of host-
expressed MHC
Class II molecules, but CD4 development was present. These chimaeras elicited
an anti-KLH
antibody response following immunization, demonstrating the functional
engraftment of these
mice. This suggests that neither class I nor class II are absolutely required
in_the recipient for
functional engraftment of RAG-2 mice.
~s Evaluating the MHC haplotype dependence in supporting donor MHC-restricted
immunity.
The following experiments were performed and conclusions were drawn that
the RAG-2 mutation confers a "universal" property to support the functional
development of
allogeneic HSC.
The following allogeneic and syngeneic bone marrow chimaeras were prepared:
zo (i) Balb/c (H-2d) -> Balb/c RAG-2 (H-2d) hosts
(ii) C57B1/6 (H-2b) -> Balb/c RAG-2 (H-2d) hosts
(iii) Balb/c (H-2d) -> 129 RAG-2 (H-2b) hosts
(iv) C57B1/6 (H-2b) -> 129 RAG-2 (H-2b) hosts
(v) Balb/c (H-2d) -> C57B1/6 SCID (H-2b) hosts
zs (vi) C57B1/6 (H-2b) -> C57B1/6 SCID (H-2b) hosts
The first set of chimeras (i-iv) were designed to determine whether RAG-2
mutant mice on an H-2d background have the ability to support allogeneic donor-
specific
immunity. All of these chimeras supported functional engraftment.
The second set of chimeras (v-vi) were prepared to test the ability of SCID
so mutant mice, on an H-2b background, to support allogeneic donor-specific
immunity. The
allogeneic chimeras engrafted very poorly relative to the syngeneic group
(thymuses were too
small to sample) which is very similar to the H-2d into H-2b SCID results
reported. These
results suggest there is a significant difference between the SCID and RAG-2
mutations to
CA 02382383 2002-02-26 pCT/US00/23971
-45-
support the cellular development of T lymphocytes independent of MHC
haplotype.
To assess whether RAG-2 hosts could support functional engraftment from a
donor with an unrelated haplotype, an H-2k AKR -> H-2b RAG-2 chimera was
produced.
These mice supported donor-derived immunity.
Taken together, these results indicate the RAG-2 mutation supports bone
marrow alloengraftment from different donor strains, independent of haplotype.
This suggests
these mice could support hematopoiesis from any donor.
Evaluating other mutations for donor-derived immunity
RAG-2 mice appeared to be unique relative to other immunodeficient strains in
supporting donor-restricted immunity until transplantation studies in RAG-1
and TCR ~i/8
(with irradiation to eliminate host B cells) mice were performed. Although
unirradiated RAG-
1 chimaeras did not support engraftment from allogeneic donors, irradiated
(800 rads) RAG-1
mice supported functional engraftment. Both RAG-1 and RAG-2 genes are required
to initiate
T and B lymphocyte receptor rearrangements. In addition, studies showed that
irradiated TCR
~s (3/8 mice also supported donor-derived immunity.
Cytochrome-c specific TCR transgenic (H-2k class 11-restricted)-> H-2b RAG-2
bone marrow
chimaeras support cellular engraftment of donor CD4+ T cells in the absence of
host
expression of cognate MHC Class 11 molecules.
In order to determine the mechanism of donor-derived immunity, SJL-
zo TgN(TcrAND)53Hed mice were obtained from Jackson Laboratory and backcrossed
onto
AKR (H-2k) mice to provide the appropriate MHC Class II molecule (I-Ek) for
positive
selection of TCR-transgenic (TCR-tg) T cells (which recognize cyt-c in the
context of I-Ek).
Bone marrow from these mice was used to engraft H-2b RAG-2 mice which do not
express the
cognate MHC Class II receptor for the transgenic T cells. This created a host
environment for
zs the transgenic bone marrow cells that is functionally equivalent to a Class
II knockout
background. Donor T cell development would therefore be dependent on donor-
derived
antigen presenting cells to positively select TCR-tg T cells.
The percentages of thymocytes in TCRtgxAKR -> RAG-2 chimaeras were
similar to that of wild type AKR->RAG-2 mice. Both of these chimeras have
overall lower
so percentages of T cells in comparison to TCRtgxAKR donor mice consistent
with other
haplotype combinations of allogeneic RAG-2 chimaeras. The level of B cell
reconstitution
was relatively high (greater than 10%). Both the TCRtgxAKR -> RAG-2 and AKR-
>RAG-2
were immunized with cytochrome c to determine their ability to produce antigen-
specific IgG
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-46-
antibody.
Example 4 Development of trans~enic mice expressing human HLA Class II eg nes.
An alternative embodiment of the invention involves the expression of human
HLA Class II molecules in MHC Class II-bearing tissues of the mouse. In this
example, donor
HSC are introduced that express the same HLA haplotype(s) as the transgenic
HLA Class II
molecules. This combination provides cognate interactions between donor T
lymphocytes,
which develop in the context of the transgenic HLA Class II molecules
expressed on the host
tissues (in particular the thymus), and donor-derived B lymphocytes. Although
the methods
for making transgenic mice that express human HLA Class II molecules of the
DR3 haplotype
are taught, these methods can be applied to any desired HLA haplotype,
including those for
Class I genes, for the purpose of evaluating responses representing other
individuals in the
population.
Preparation of YAC DNA for lipofection:
~s YAC 4D1 spans approximately SSOkb of the HLA Class II region (Ragoussis et
al. Nucleic Acids Research, 20:3135-3138 (1992), and Ragoussis, et al. in
Tsuji, et al. (eds.)
HLA 1991, Oxford Univ. Press (1992)). It is bordered on one end by the RING3
gene, and the
opposite end by DRa. It contains the DRa, DRb, DQa, and DQb chains of the DR3
haplotype.
Yeast cultures containing the 4D1 YAC were grown in AHC media. Agarose
2o blocks were formed in 1 % low melting temperature agarose containing
approximately 3x 109
cells/ml. The YAC was separated from yeast chromosomes by pulse-field gel
electrophoresis
in a 1 % low melting temperature agarose gel. Running conditions were: 200V,
40 hours
duration, with a 50 second switch time. After electrophoresis, the gel was cut
lengthwise at the
outer edges and in the middle. The three slices were stained with ethidium
bromide to
zs visualize the position of the 4D1 YAC vis a vis the host chromosomes. The
position of the
4D 1 YAC was marked with notches and the marker pieces realigned with the
unstained gel
sections. A horizontal band containing the 4D 1 YAC was excised based on the
position of the
notches.
The 4D1 gel slices were equilibrated twice for one hour/each in 1X gelase
so buffer (Epicentre Technologies) on a rotating platform. The buffer was
changed after the
second rinse and left at 4°C overnight. Based on the input amount of
yeast DNA, the estimated
amount of 4D 1 DNA in the entire gel was approximately 8 mg. The following
day, the gel
slices were cut into 20 blocks weighing approximately one gram each, and
placed into
WO 01/15521 CA 02382383 2002-02-26 pCT/(IS00/23971
-47-
individual tubes. The gel fragments were melted at 70°C for 20 minutes
and then equilibrated
at 45°C for 15 minutes. Ten units of Gelase (Epicenter Technologies,
lunit/ml) was added per
tube and incubated at 45°C for 45 minutes. The gelase step was then
repeated.
Transfection of YAC DNA into ES cells
s Each agarose block contained approximately 400 ng of YAC DNA, or
400 ng/ml. A neomycin resistance plasmid (PGKneo) was added at a molar ratio
of
approximately 4:1 (20 ng per ml of gel block). Transfectam (Promega, lot
318402) was added
at a 50:1 weight:weight ratio (approximately 19 mg per m1 of gel block) and
the mixture
allowed to sit at room temperature for one hour. ES cells had been split 1:2
the day before and
seeded onto 100mm plates. The cells were trypsinized on the day of
transfection and
resuspended at 3x106 cells/ml in serum-free ES media. One ml of the ES cells
was placed into
60mm dishes with eight ml of serum-free ES media. One ml of DNA/lipid mixture
was added
and the cells were incubated at 37°C for 4 hours. Afterward, the
lipofection/ES cell mixture
was plated onto feeder cells at 1x106 ES cells per 100mm dish. 6418 [400
mg/ml] was added
~s to the media the following day and changed every other day for 9-12 days
until clones
appeared. Individual clones were picked and grown in 96 wells. The cells were
split 1:2 into
duplicate 96 well plates. One plate was frozen in situ and the other was
harvested for DNA
analysis.
Characterization of 4D1 positive clones:
zo The presence of the entire YAC was determined using PCR primers for six
genes that span the entire SSOkb: TAP-1, TAP-2, DQb, DQa, DRb, and DRa. The
first screen
involved the TAP-1 and DRa primer sets. Clones that were double positive for
these two end-
region genes were further screened with the remaining four primer sets.
Tap 1
zs 1069 F: CAC CCT GAG TGA TTC TCT (SEQ ID N0:59)
1069 R: ACT GAG TCT GCC AAG TCT (SEQ ID N0:60)
Tap 2:
1231 F: GCG GAG AGA CCT GGA ACG (SEQ ID N0:61)
30 1231 R: TCA GCA TCA GCA TCT GCA (SEQ ID N0:62)
Q:
GH26: GTG CTG CAG GTG TAA ACT TGT ACC AG (SEQ ID N0:63)
WO 01/15521 CA 02382383 2002-02-26 pCT/L1S00/23971
-48-
GH27: CAC GGA TCC GGT AGC AGC GGT AGA GTT G (SEQ ID N0:64)
GH28: CTC GGA TCC GCA TGT GCT ACT TCA CCA ACG (SEQ ID N0:65)
s GH29: GAG CTG CAG GTA GTT GTG TCT GCA CAC (SEQ ID N0:66)
DRa:
DRaF: CTT TGC AAG AAC CCT TCC C (SEQ ID N0:67)
DRaR: ATA GCC CAT GAT TCC TGA GC (SEQ ID N0:68)
DR
GH46: CCG GAT CCT TCG TGT CCC CAC AGC ACG (SEQ ID N0:69)
GH50: CTC CCC AAC CCC GTA GTT GTG TCT GCA (SEQ ID N0:70) -
~s All product sizes are 300bp.
Tap 1 PCR Program:
92C 15"
SSC 30"
zo 72C 1' (30X)
Tap 2 PCR Program:
96C 20"
65C 30"
zs 72C 30" (30X)
(Requires 2 rounds of PCR)
DR and DQ PCR Program:
95C 15"
so SSC 30"
72C 1' (30X)
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-49-
Generation of transgenic mice
Clone 4D 1.18 was used to derive transgenic mice as described in Robertson
(ed), TERATOCARCINOMAS AND EMBRYONIC STEM CELLS - A PRACTICAL APPROACH (
1987), IRL
Press. ES cells were injected into 3.5 days p.c. C57BL/6 embryos and implanted
into the
s uterus of pseudopregnant females and allowed to develop to birth. Chimeric
males were mated
with wild type C57B1/6 females to obtain germline transgenic lines.
Antibody response of transgenic mice
Four Dl/C2D/RAG-2 (HLA-transgenic) mice were bled and their sera tested for
I-Ealpha, I-Ebeta and DRalpha expression using FACS analysis. Mice that were
confirmed to
express surface DR but not I-Ealpha were chosen for functional testing. These
mice were
immunized via the footpad with 50 pg/mouse. Three proteins were used as an
immunogen.
Two were fungal proteases and the third was a hybrid of the two proteins which
has been
found to be of reduced allergenicity in an in vitro human T cell epitope
assay. The proteins
were emulsed with CFA for total volume of 100 p1 per footpad and boosted 2
weeks later with
~s the same concentration in IFA in the other footpad. Immunized mice were
bled 1 week later
and sera samples were tested for antibodies to the appropriate protein by
ELISA. A second set
of animals were immunized for antibody responses but using a different
protocol which is as
follows: mice were immunized intraperitoneally with 50 pg/mouse of the same
three proteins
emulsed with CFA for total volume of 100 p1 per mouse and boosted ip 2 weeks
later with the
zo same concentration in IFA. Mice were bled 1 week later and sera samples
were tested for
antibodies.
To assess whether the T cells in these transgenic mice were functioning
normally, a positive control immunogenic peptide known to be a major T cells
epitope (HSP65
1-20) was used. Mice were immunized according to a previously reported
protocol by Geluk
zs et. al. Popliteal lymph nodes were taken and T cell proliferation assessed
using a T cell
proliferastion assay (also reported by Geluk et. ,zl.)
A summary of the array of experiments is below.
Protein T Cell Response Antibody Response
Protein 1 ND ++
Protein 2 ND ++
Hybrid proteinND +
HSP65 epitope++ ND
W~ 01/1$521 CA 02382383 2002-02-26 pCT/US00/23971
-50-
Tetanus Toxoid ND +++++
KLH ND +++++
The results suggest that the immune system in these transgenic mice is
functionally intact and may be used to assess DR3-specific immune responses.
s Example 5. En~raftment of transQenic immunodeficient mice with human
hematonoietic stem
cells.
Transgenic immunodeficient mice that express human IL-3, IL7, SCF, LIF, IL6,
M-CSF, OM, and GM-CSF are engrafted with a source of human hematopoietic stem
cells.
The age for engraftment is approximately 72 hours after birth. The preferred
source of donor
cells is umbilical cord blood. For this example, the haplotype of the donor
cells is selected on
the basis of the test population of interest in order to determine the
responsiveness of particular
individuals to specific antigens, e.g., for the purpose of determining the
allergenicity of
proteins or peptides within the population.
Source material for transplantation:
~s Human cord blood (CB) is obtained from Advanced Bioscience Resources Inc
(ABR), Alameda, CA, or Purecell, San Mateo, CA. CB is collected by ABR from
local
hospitals within 24 hours of shipping and is processed on site. Alternatively,
human bone
marrow (BM), CB, and/or MPB cells is obtained from Purecell as either fresh or
frozen cells,
and fractionated or unfractionated cells. All samples are tested for Hepatitis
B and C, and
2o HIV. Any experimental materials involving samples found to be virus
positive are discarded
immediately and animals removed, marked and disposed of in accordance with
procedures for
disposing contaminated animal carcasses. Throughout the course of the
experiment, all
samples are treated under the assumption that they may be contaminated with
human blood
borne pathogens (Biosafety Level 2, BL-2). All personnel handling mice with
human blood
zs cells should receive the hepatitis B vaccine.
CB-17/SCID and NOD/SCID mice are engrafted as experimental controls, as
they are currently the strains of choice for investigators working in the
field (Bhatia et al, Proc.
Nat'l Acad. Sci. 94:5320-5325 ( 1997), Cashman et al. Blood 89: 4307-4316 (
1997), Hogan, et
al. Blood 90( 1 ):85-96 ( 1997), Vormoor, et al Blood 83:2489-2497 ( 1994),
and Wang, et al.
so Blood 89:3919-3924 (1994)).
WO 01/15521 CA 02382383 2002-02-26 pCT/US00/23971
-51-
Finally, human HLA DR transgenic mice expressing human cytokine genes are
engrafted. The expression of human major histocompatibility gene products in
mouse tissues
provides an alternate developmental pathway for thymocyte development.
Procedures for injecting mice:
HSC-enriched populations are injected intravenously (i.v). Neonatal mice
should receive no more than 50 ~,L of cells. Pups are held below a light
source to better
visualize the eye vein. The needle is held parallel to the vein and inserted
by aiming just below
the surface of the skin. Cells are slowly injected while watching to determine
that blood is
cleared downstream of the needle point, and that swelling around the vein does
not occur.
After injection the needle is held in place for 10-30 seconds to allow the
cells to enter the
circulation. The animals are kept warm and the eye moistened until recovery.
If necessary,
pups may be chilled briefly on ice to reduce their activity.
Analysis of mice
At various time intervals ranging from two weeks to several months, mice are
~s analyzed for reconstitution of human immune cells. Peripheral blood is
drawn from the orbital
sinus or tail vein and analyzed by to flow cytometry using monoclonal
antibodies specific for
human hematopoietic cells. Animals are sacrificed and their peripheral immune
system organs
examined for the presence of human cells by flow cytometry (Pflumio, et al.
Blood 88:3731-
3740 ( 1996); Dick, et al. Stem Cells 15 Suppl 1:199-203 ( 1997); Ramirez, et
al. Exp. Hematol.
zo 26:332-344 (1998); Hogan, et al. Biol. Blood Marrow Transplant 3:236-246
(1997); Hogan, et
al. Blood 90:85-96 (1997); and Lapidot, et al. J. Mol. Med. 75: 664-673
(1997)). Functional
properties of mature human cells are determined, such as mitogen stimulation,
mixed
lymphocyte reaction (MLR) to allogeneic or xenogeneic cells, and the ability
to produce
different classes of immunoglobulins. Immunization with specific proteins,
peptides, or
2s glycoproteins is performed to determine the ability to induce particular
subclasses of antibody,
and antigen-specific T cell responses.
Example 6. Methods for obtaining functional human immune cells.
Four types of human HSC chimeras are envisioned by the invention. The
strains of host mice all contain human growth factor transgenes that provide
the necessary
so species-specific factors for supporting the human donor HSCs. The host
strains vary in the
nature of their immunodeficiency, and whether they include the transgenic
expression of HLA
molecules.
CA 02382383 2002-02-26
WO 01/15521 PCT/US00/23971
-52-
The first type of chimeras consists of RAG-1 or RAG-2 mutant mice that
contain human CTG. As shown in Example 1, allogeneic RAG chimeras display the
ability to
support donor-restricted immune responses. Thus, human CTG RAG mice are
engrafted with
human HSC from umbilical cord blood, and develop human T and B lymphocytes
which
s function to provide antigen-specific T and B cell responses. Engraftment of
either neonatal or
adult mice leads to mixed bone marrow chimeras in which hematopoietic-derived
antigen
presenting cells of both the host and donor are present. A major biological
effect of mixed
chimerism is the negative selection of "host"-reactive T cells, mediated by
APCs of donor and
host origin. This leads to the development of T cells that are tolerant to
both donor and host
MHC haplotypes, but the potential to react to either allogeneic or xenogeneic
antigens in a
MLR. T cells that develop independently of the thymus are also supported by
the CTG hosts.
These primarily include intestinal epithelial lymphocytes of the small and
large intestine, and
other gut associated lymphocyte tissues (GALT).
Although RAG mice support the development of donor haplotype-restricted T
~s cells, the major developmental pathway for thymocytes involves positive
selection in the
context of MHC molecules expressed on thymic epithelial cells. The second type
of chimeras
thus consists of human CTG RAG mice that also express human HLA genes in host
tissues
that endogenously express MHC molecules. This provides an additional pathway
for the donor
human HSC to develop in the RAG-mutant host, and results in some mature T
cells that are
zo restricted to the HLA haplotype of the transgenes. It is preferable to
match the HLA haplotype
of the donor HSC to that of the transgenic HLA molecules such that the mature
T cells can
subsequently interact with donor-derived B lymphocytes through cognate T cell
receptor:HLA
interactions.
The third type of chimeras are prepared in mice that are genetically
is immunodeficient by means other than a mutation in the RAG genes, and
express human HLA
transgenes of the same haplotype as the source of donor HSC. For example,
human GFTG
SCID mice are mated with DR3 Class II transgenic mice and used to engraft HLA
DR3
haplotype HSC. Some of the human T lymphocytes are positively selected in the
context of
HLA DR3 Class II molecules and are capable of interacting with DR3+ donor B
lymphocytes
3o to produce antigen-specific antibodies.
The fourth type of chimeras are prepared in immunocompetent human CTG
mice that express human HLA transgenes of the same haplotype as the source of
donor HSC.
In order to engraft human HSC, these hosts must be depleted of their
endogenous immune
W~ ~l/1$$21 CA 02382383 2002-02-26 PCT/US00/23971
-53-
system, e.g., with a lethal dose of irradiation or other method. The pattern
of lymphocyte
development is then similar to that of the third type of chimeras, above.
