Note: Descriptions are shown in the official language in which they were submitted.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
TRANSGENICALLY PRODUCED FUSION PROTEINS
Funding
Work described herein has been funded in part with Federal funds from the
National
Cancer Institute, National Institutes of Health, under Contract No. NO1-CO-
60000.
Related Applications
This application claims the benefit of a previously filed Provisional
Application No.
60/101,083 filed September 18, 1998, which is hereby incorporated by
reference.
Field of the Invention
The invention relates to transgenically produced fusion proteins (e.g.,
immunoglobulin-enzyme fusion proteins), nucleic acids which encode fusion
proteins, and
methods of making and using fusion proteins and nucleic acids.
Background of the Invention
A growing number of recombinant proteins are being developed for therapeutic
and
diagnostic applications. However, many of these proteins may be difficult or
expensive to
produce in a functional form and/or in the required quantities using
conventional methods.
Conventional methods involve inserting the gene responsible for the production
of a
particular protein into host cells such as bacteria, yeast, or mammalian
cells, e.g., COS cells,
and then growing the cells in culture media. The cultured cells then
synthesize the desired
protein. Traditional bacteria or yeast systems may be unable to produce many
complex
proteins in a functional form. While mammalian cells can reproduce complex
proteins, they
are generally difficult and expensive to grow, and often produce only mglL
quantities of
protein. The limitations using bacterial, yeast or mammalian systems are
particularly
applicable to complex proteins, such as immunoglobulin-enzyme fusion proteins,
that
require proper post-translational modifications and assembly to be in
functional form.
CA 02382725 2002-03-12
WO 01/19846 PCT/LJS00/25560
-2-
Summary of the Invention
In general, the invention features, a method of making a transgenic fusion
protein,
e.g., an immunoglobulin-enzyme fusion protein. The method includes providing a
transgenic animal, e.g., goat or a cow, which includes a transgene which
provides for the
S expression of the fusion protein, e.g., an immunoglobulin-enzyme fusion
protein; allowing
the transgene to be expressed; and, preferably, recovering the fusion protein,
from the milk
of the transgenic animal. (Although the embodiment described relates to
expression in milk
other promoters, e.g; other tissue specific promoters, e.g., muscle, hair,
urine, blood, or eggs
specific promoters can be used to produce fusion proteins in other tissues or
products.)
In a preferred embodiment the transgene includes a first member fused to a
second
member. The first member can include the subunit of a targeting molecule,
e.g., an Ig
subunit, e.g., a subunit of an Ig specific for a tumor antigen (e.g.,
carcinoembryonic antigen
(CEA), a transferrin receptor, TAG-72, an epidermal growth factor receptor).
The second
member can be: an enzyme; a polypeptide other than an Ig subunit, or fragment
thereof; an
Rnase, e.g., RnaseA, e.g., angiogenin; or carboxypeptidase B enzyme.
In preferred embodiments, the transgenic fusion protein is made in a mammary
gland of the transgenic mammal, e.g., a ruminant, e.g., a goat or a cow.
In preferred embodiments, the transgenic fusion protein is secreted into the
milk of
the transgenic mammal, e.g., a ruminant, e.g., a dairy animal, e.g., a goat or
a cow.
In preferred embodiments, the transgenic fusion protein is secreted into the
milk of a
transgenic mammal at concentrations of at least about 0.1 mg/ml, 0.5 mg/ml,
1.0 mg/ml, 1.5
mg/ml, 2 mg/ml, 3 mg/ml, 5 mg/ml or higher.
In preferred embodiments, the transgenic fusion protein is made under the
control of
a mammary gland specific promoter, e.g., a milk specific promoter, e.g., a
milk serum
protein or casein promoter. The milk specific promoter can be a casein
promoter, beta
lactoglobulin promoter, whey acid protein promoter, or lactalbumin promoter.
Preferably,
the promoter is a goat /3 casein promoter.
In preferred embodiments, the transgenic fusion has the formula: Rl-L-R2; R2-L-
R1; R2-R1; or R1-R2, wherein R1 is an immunoglobulin moiety, L is a peptide
linker and
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-3-
R2 is an enzyme moiety. Preferably, R1 and R2 are covalently linked, e.g.,
directly fused or
linked via a peptide linker.
In preferred embodiments, the transgenic fusion protein further includes:
a signal sequence which directs the secretion of the fusion protein, e.g., a
signal
from a secreted protein (e.g., a signal from a protein secreted into milk, or
an
immunoglobulin signal); and
(optionally) a sequence which encodes a sufficient portion of the amino
terminal
coding region of a secreted protein, e.g., a protein secreted into milk, or an
immunoglobulin,
to allow secretion, e.g., in the milk of a transgenic mammal, of the fusion
protein.
In preferred embodiments, the fusion protein includes a monoclonal antibody
subunit, e.g., a human, marine (e.g., mouse) monoclonal antibody subunit, or a
fragment
thereof, e.g., an antigen binding fragment thereof. The monoclonal antibody
subunit or
antigen binding fragment thereof can be a single chain polypeptide, a dimer of
a heavy
chain and a light chain, or a tetramer of two heavy and two light chains.
Preferably, the
1 S monoclonal antibody is a human antibody or a fragment thereof, e.g., an
antigen binding
fragment thereof. For example, the human antibody can be produced by a
hybridoma which
includes a B cell obtained from a transgenic non-human animal, e.g., a
transgenic mouse,
having a genome comprising a human heavy chain transgene and a light chain
transgene
fused to an immortalized cell. The antibodies can be of the various isotypes,
including:
IgG (e.g., IgGI, IgG2, IgG3, IgG4), IgM, IgAl, IgA2, IgAsec, IgD, of IgE.
Preferably,
the antibody is an IgG isotype. The antibodies can be full-length (e.g., an
IgGl or IgG4
antibody) or can include only an antigen-binding portion (e.g., a Fab,
F(ab')2, Fv or a single
chain Fv fragment).
In preferred embodiments, the immunoglobulin subunit of a fusion protein is a
recombinant antibody, e.g., a chimeric or a humanized antibody, subunit or an
antigen
binding fragment thereof, e.g., has a variable region, or at least a
complementarity
determining region (CDR), derived from a non-human antibody (e.g., marine)
with the
remaining portions) are human in origin.
In preferred embodiments, the immunoglobulin subunit of the fusion protein is
monovalent (e.g., it included one pair of heavy and light chains, or antigen
binding portions
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-4-
thereof). In other embodiments, the fusion protein is divalent antibody (e.g.,
it included two
pairs of heavy and light chains, or antigen binding portions thereof).
In preferred embodiments, the transgenic fusion protein includes an
immunoglobulin
heavy chain or a fragment thereof, e.g., an antigen binding fragment thereof.
Preferably, the
immunoglobulin heavy chain or fragment thereof (e.g., an antigen binding
fragment thereof)
is linked, e.g., linked via a peptide linker or is directly fused, to an
enzyme. Preferably, the
immunoglobulin heavy chain-enzyme fusion protein is capable of assembling into
a
functional complex, e.g., a di-, tri-, tetra-, or mufti-meric complex having
enzymatic
activity.
In preferred embodiments, the transgenic fusion protein includes an
immunoglobulin
heavy chain or fragment thereof (e.g., an antigen binding fragment thereof),
and a light
chain or a fragment thereof (e.g., an antigen binding fragment thereof).
Preferably, the
immunoglobulin heavy chain is linked, e.g., linked via a peptide linker or
directly fused, to
an enzyme. Preferably, the immunoglobulin-enzyme fusion protein is capable of
assembling into a functional complex, e.g., a di-, tri-, tetra-, or mufti-
meric complex having
enzymatic activity.
In preferred embodiments, the enzyme of the fusion protein is an Rnase, e.g.,
RnaseA, e.g., angiogenin; or carboxypeptidase B enzyme. For diagnostic
applications, the
enzyme can be horseradish peroxidase.
In a preferred embodiment, the transgenic fusion protein includes a peptide
linker
and the peptide linker has one or more of the following characteristics: a) it
allows for the
rotation of the immunoglobulin protein and the enzyme protein relative to each
other; b) it is
resistant to digestion by proteases; c) it does not interact with the
immunoglobulin or the
enzyme; d) it allows the fusion protein to form a complex (e.g., a di-, tri-,
tetra-, or multi-
meric complex) that retains enzymatic activity; and e) it promotes folding
and/or assembly
of the fusion protein into an active complex.
In a preferred embodiment: the transgenic fusion protein includes a peptide
linker
and the peptide linker is 5 to 60, more preferably, 10 to 30, amino acids in
length; the
peptide linker is 20 amino acids in length; the peptide linker is 17 amino
acids in length;
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-5-
each of the amino acids in the peptide linker is selected from the group
consisting of Gly,
Ser, Asn, Thr and Ala; the peptide linker includes a Gly-Ser element.
In a preferred embodiment, the transgenic fusion protein includes a peptide
linker
and the peptide linker includes a sequence having the formula (Ser-Gly-Gly-Gly-
Gly)y
S wherein y is 1, 2, 3, 4, 5, 6, 7, or 8. Preferably, the peptide linker
includes a sequence
having the formula (Ser-Gly-Gly-Gly-Gly)3. Preferably, the peptide linker
includes a
sequence having the formula ((Ser-Gly-Gly-Gly-Gly)3-Ser-Pro).
In preferred embodiments, the transgenic fusion protein assembles into a
dimer,
trimer, tetramer, or higher polymeric complex.
In preferred embodiments, the transgene encoding the transgenic fusion protein
is a
nucleic acid construct which includes:
(a) optionally, an insulator sequence;
(b) a promoter, e.g., a mammary epithelial specific promoter, e.g., a milk
protein
promoter;
(c) a nucleotide sequence which encodes a signal sequence which can direct the
secretion of the fusion protein, e.g. a signal from a milk specific protein;
(d) optionally, a nucleotide sequence which encodes a sufficient portion of
the
amino terminal coding region of a secreted protein, e.g. a protein secreted
into milk, to
allow secretion, e.g., in the milk of a transgenic mammal, of the non-secreted
protein;
(e) one or more nucleotide sequences which encode the fusion protein, e.g., an
immunoglobulin-enzyme fusion protein, e.g., a protein as described herein; and
(f) optionally, a 3' untranslated region from a mammalian gene, e.g., a
mammary
epithelial specific gene, (e.g., a milk protein gene).
In preferred embodiments, elements a (if present), b, c, d (if present), and f
of the
transgene are from the same gene; the elements a (if present), b, c, d (if
present), and f of the
transgene are from two or more genes. For example, the signal sequence, the
promoter
sequence and the 3' untranslated sequence can be from a mammary epithelial
specific gene,
e.g., a milk serum protein or casein gene (e.g., a (3 casein gene).
Preferably, the signal
sequence, the promoter sequence and the 3' untranslated sequence are from a
goat ~3 casein
gene.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-6-
In preferred embodiments, the promoter of the transgene is a mammary
epithelial
specific promoter, e.g., a milk serum protein or casein promoter (e.g., a (3
casein promoter).
The milk specific promoter can be a casein promoter, beta lactoglobulin
promoter, whey
acid protein promoter, or lactalbumin promoter. Preferably, the promoter is a
goat (3 casein
promoter.
In preferred embodiments, the signal sequence encoded by the transgene is an
amino
terminal sequence which directs the expression of the protein to the exterior
of a cell, or into
the cell membrane. Preferably, the signal sequence is from a protein which is
secreted into
the milk, e.g., the milk of the transgenic animal.
In preferred embodiments, the 3' untranslated region of the transgene includes
a
polyadenylation site, and is obtained from a mammary epithelial specific gene,
e.g., a milk
serum protein gene or casein gene. The 3' untranslated region can be obtained
from a
casein gene (e.g., a (3 casein gene), a beta lactoglobulin gene, whey acid
protein gene, or
lactalbumin gene. Preferably, the 3' untranslated region is from a goat (3
casein gene.
In preferred embodiments, the transgene, e.g., the transgene as described
herein,
integrates into a germ cell and/or a somatic cell of the transgenic animal.
In another aspect, the invention features a nucleic acid construct,
preferably, an
isolated nucleic acid construct, which includes:
(a) optionally, an insulator sequence;
(b) a promoter, e.g., a mammary epithelial specific promoter, e.g., a milk
protein
promoter;
(c) a nucleotide sequence which encodes a signal sequence which can direct the
secretion of the fusion protein, e.g. a signal sequence from a milk specific
protein;
(d) optionally, a nucleotide sequence which encodes a sufficient portion of
the
amino terminal coding region of a secreted protein, e.g. a protein secreted
into milk, to
allow secretion, e.g., in the milk of a transgenic mammal, of the non-secreted
protein;
(e) one or more nucleotide sequences which encode a fusion protein as
described
herein; and
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
(f) optionally, a 3' untranslated region from a mammalian gene, e.g., a
mammary
epithelial specific gene, (e.g., a milk protein gene).
In preferred embodiments, the promoter is a mammary epithelial specific
promoter,
e.g., a milk serum protein or casein promoter (e.g., a [3 casein promoter).
The milk specific
promoter can be a casein promoter, beta lactoglobulin promoter, whey acid
protein
promoter, or lactalbumin promoter. Preferably, the promoter is a goat (3
casein promoter.
In preferred embodiments, the signal sequence is an amino terminal sequence
which
directs the expression of the protein to the exterior of a cell, or into the
cell membrane.
Preferably, the signal sequence is from a milk specific protein. Preferably,
the signal
sequence directs secretion of the encoded fusion protein into the milk of a
transgenic
animal, e.g., a transgenic mammal.
In preferred embodiments, the 3' untranslated region includes a
polyadenylation site,
and is obtained from a mammalian gene, e.g., a mammary epithelial specific
gene, e.g., a,
milk serum protein gene or casein gene. The 3' untranslated region can be
obtained from a
casein gene (e.g., a (3 casein gene), a beta lactoglobulin gene, whey acid
protein gene, or
lactalbumin gene. Preferably, the 3' untranslated region is from a goat ~i
casein gene.
In another aspect, the invention features a host cell, e.g., an isolated host
cell, which
includes a nucleic acid of the invention (e.g., a transgene, e.g., a nucleic
acid construct as
described herein).
In another aspect, the invention features, a pharmaceutical or nutraceutical
composition having an effective amount of fusion protein, e.g., an
immunoglobulin-enzyme
fusion protein as described herein, and a pharmaceutically acceptable carrier.
In a preferred embodiment, the composition includes milk.
In another aspect, the invention features, a transgenic animal which includes
a
transgene that encodes a fusion protein, e.g., a transgene which encodes an
immunoglobulin-enzyme fusion protein described herein.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
_g_
Preferred transgenic animals include: mammals; birds; reptiles; marsupials;
and
amphibians. Suitable mammals include: ruminants; ungulates; domesticated
mammals; and
dairy animals. Particularly preferred animals include: mice, goats, sheep,
camels, rabbits,
cows, pigs, horses, oxen, and llamas. Suitable birds include chickens, geese,
and turkeys.
Where the transgenic protein is secreted into the milk of a transgenic animal,
the animal
should be able to produce at least l, and more preferably at least 10, or 100,
liters of milk
per year. Preferably, the transgenic animal is a ruminant, e.g., a goat, cow
or sheep. Most
preferably, the transgenic animal is a goat.
In preferred embodiments, the transgenic animal has germ cells and somatic
cells
containing a transgene that encodes a fusion protein, e.g, a fusion protein
described herein.
In preferred embodiments, the fusion protein expressed in the transgenic
animal is
under the control of a mammary gland specific promoter, e.g., a milk specific
promoter,
e.g., a milk serum protein or casein promoter. The milk specific promoter can
be a casein
promoter, beta lactoglobulin promoter, whey acid protein promoter, or
lactalbumin
promoter. Preferably, the promoter is a goat (3 casein promoter.
In preferred embodiments, the transgenic animal is a mammal, and the
immunoglobulin-enzyme fusion protein is secreted into the milk of the
transgenic animal at
concentrations of at least about 0.1 mg/ml, 0.5 mg/ml, 1.0 mg/ml, 1.5 mg/ml, 2
mg/ml, 3
mg/ml, S mg/ml or higher.
In another aspect, the invention features, a method of selectively killing or
lysing an
aberrant or diseased cell which expresses on its surface a target antigen. The
method
includes:
contacting said aberrant or diseased cell with a transgenically produced
fusion
protein, e.g., a transgenically produced immunoglobulin-enzyme fusion protein
described
herein, wherein the immunoglobulin of said fusion protein recognizes said
target antigen,
The terms peptides, proteins, and polypeptides are used interchangeably
herein.
A purified preparation, substantially pure preparation of a polypeptide, or an
isolated
polypeptide as used herein, means a polypeptide that has been separated from
at least one
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-9-
other protein, lipid, or nucleic acid with which it occurs in the cell or
organism which
expresses it, e.g., from a protein, lipid, or nucleic acid in a transgenic
animal or in a fluid,
e.g., milk, or other substance, e.g., an egg, produced by a transgenic animal.
The
polypeptide is preferably separated from substances, e.g., antibodies or gel
matrix, e.g.,
polyacrylamide, which are used to purify it. The polypeptide preferably
constitutes at least
10, 20, 50 70, 80 or 95% dry weight of the purified preparation. Preferably,
the preparation
contains: sufficient polypeptide to allow protein sequencing; at least l, 10,
or 100 pg of the
polypeptide; at least 1, 10, or 100 mg of the polypeptide.
A substantially pure nucleic acid, is a nucleic acid which is one or both of:
not
immediately contiguous with either one or both of the sequences, e.g., coding
sequences,
with which it is immediately contiguous (i.e., one at the 5' end and one at
the 3' end) in the
naturally-occurring genome of the organism from which the nucleic acid is
derived; or
which is substantially free of a nucleic acid sequence with which it occurs in
the organism
from which the nucleic acid is derived. The term includes, for example, a
recombinant
DNA which is incorporated into a vector, e.g., into an autonomously
replicating plasmid or
virus, or into the genomic DNA of a prokaryote or eukaryote, or which exists
as a separate
molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or
restriction
endonuclease treatment) independent of other DNA sequences. Substantially pure
DNA
also includes a recombinant DNA which is part of a hybrid gene encoding
additional fusion
protein sequence.
As used herein, the term transgene means a nucleic acid sequence (encoding,
e.g.,
one or more fusion protein polypeptides), which is introduced into the genome
of a
transgenic organism. A transgene can include one or more transcriptional
regulatory
sequences and other nucleic acid, such as introns, that may be necessary for
optimal
expression and secretion of a nucleic acid encoding the fusion protein. A
transgene can
include an enhancer sequence. A fusion protein sequence can be operatively
linked to a
tissue specific promoter, e.g., mammary gland specific promoter sequence that
results in the
secretion of the protein in the milk of a transgenic mammal, a urine specific
promoter, or an
egg specific promoter.
As used herein, the term "transgenic cell" refers to a cell containing a
transgene.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
- 10-
A "transgenic organism", as used herein, refers to a transgenic animal or
plant.
As used herein, a "transgenic animal" is a non-human animal in which one or
more,
and preferably essentially all, of the cells of the animal contain a transgene
introduced by
way of human intervention, such as by transgenic techniques known in the art.
The
transgene can be introduced into the cell, directly or indirectly by
introduction into a
precursor of the cell, by way of deliberate genetic manipulation, such as by
microinjection
or by infection with a recombinant virus.
Mammals are defined herein as all animals, excluding humans, that have mammary
glands and produce milk.
As used herein, a "dairy animal" refers to a milk producing non-human animal
which is larger than a rodent. In preferred embodiments, the dairy animal
produce large
volumes of milk and have long lactating periods, e.g., cows or goats.
As used herein, the language "subject" includes human and non-human animals.
The term "non-human animals" of the invention includes vertebrates, e.g.,
mammals and
non-mammals, such as non-human primates, ruminants, birds, amphibians,
reptiles and
rodents, e.g., mice and rats. The term also includes rabbits.
As used herein, a "transgenic plant" is a plant, preferably a mufti-celled or
higher
plant, in which one or more, and preferably essentially all, of the cells of
the plant contain a
transgene introduced by way of human intervention, such as by transgenic
techniques
known in the art.
As used herein, the term "plant" refers to either a whole plant, a plant part,
a plant
cell, or a group of plant cells. The class of plants which can be used in
methods of the
invention is generally as broad as the class of higher plants amenable to
transformation
techniques, including both monocotyledonous and dicotyledonous plants. It
includes plants
of a variety of ploidy levels, including polyploid, diploid and haploid.
As used herein, the term "nutraceutical," refers to a food substance or part
of a food,
which includes a fizsion protein. Nutraceuticals can provide medical or health
benefits,
including the prevention, treatment or cure of a disorder. The transgenic
protein will often
be present in the nutraceutical at concentration of at least 100 p.g/kg, more
preferably at
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-11-
least 1 mg/kg, most preferably at least 10 mg/kg. A nutraceutical can include
the milk of a
transgenic animal.
As used herein, the terms "immunoglobulin" and "antibody" refer to a
glycoprotein
comprising at least two heavy (H) chains and two light (L) chains inter-
connected by
disulfide bonds. Each heavy chain is comprised of a heavy chain variable
region
(abbreviated herein as HCVR or VH) and a heavy chain constant region. The
heavy chain
constant region is comprised of three domains, CHI, CH2 and CH3. Each light
chain is
comprised of a light chain variable region (abbreviated herein as LCVR or VL)
and a light
chain constant region. The light chain constant region is comprised of one
domain, CL.
The VH and VL regions can be further subdivided into regions of
hypervariability, termed
complementarity determining regions (CDR), interspersed with regions that are
more
conserved, termed framework regions (FR). Each VH and VL is composed of three
CDRs
and four FRs, arranged from amino-terminus to carboxy-terminus in the
following order: '
FR1, CDRI, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and
light'
chains contain a binding domain that interacts with an antigen. The constant
regions of the
antibodies may mediate the binding of the immunoglobulin to host tissues or
factors,
including various cells of the immune system (e.g., effector cells) and the
first component
(Clq) of the classical complement system.
The term "antigen-binding portion" of an antibody (or simply "antibody
portion"), as
used herein, refers to one or more fragments of an antibody that retain the
ability to
specifically bind to an antigen (e.g. a target antigen). It has been shown
that the antigen-
binding function of an antibody can be performed by fragments of a full-length
antibody.
Examples of binding fragments encompassed within the term "antigen-binding
portion" of
an antibody include (i) a Fab fragment, a monovalent fragment consisting of
the VL, VH,
CL and CHl domains; (ii) a F(ab')2 fragment, a bivalent fragment comprising
two Fab
fragments linked by a disulfide bridge at the hinge region; (iii) a Fd
fragment consisting of
the VH and CH1 domains; (iv) a Fv fragment consisting of the VL and VH domains
of a
single arm of an antibody, (v) a dAb fragment (Ward et al., (1989) Nature
341:544-546),
which consists of a VH domain; and (vi) an isolated complementarity
determining region
(CDR). Furthermore, although the two domains of the Fv fragment, VL and VH,
are coded
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-12-
for by separate genes, they can be joined, using recombinant methods, by a
synthetic linker
that enables them to be made as a single protein chain in which the VL and VH
regions pair
to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird
et al. (1988)
Science 242:423-426; and Huston et al. (1988) Proc. Natl. Acad. Sci. USA
85:5879-5883).
S Such single chain antibodies are also intended to be encompassed within the
term "antigen-
binding portion" of an antibody. These antibody fragments are obtained using
conventional
techniques known to those with skill in the art, and the fragments are
screened for utility in
the same manner as are intact antibodies.
The term "monoclonal antibody" as used herein refers to an antibody molecule
of
single molecular composition. A monoclonal antibody composition displays a
single
binding specificity and affinity for a particular epitope. Accordingly, the
term "human
monoclonal antibody" refers to antibodies displaying a single binding
specificity which
have variable and constant regions derived from human germline immunoglobulin
sequences. In one embodiment, the human monoclonal antibodies are produced by
a
hybridoma which includes a B cell obtained from a transgenic non-human animal,
e.g., a
transgenic mouse, having a genome comprising a human heavy chain transgene and
a light
chain transgene fused to an immortalized cell.
The term "recombinant human antibody", as used herein, is intended to include
all
human antibodies that are prepared, expressed, created or isolated by
recombinant means,
such as antibodies isolated from an animal (e.g., a mouse) that is transgenic
for human
immunoglobulin genes; antibodies expressed using a recombinant expression
vector
transfected into a host cell, antibodies isolated from a recombinant,
combinatorial human
antibody library, or antibodies prepared, expressed, created or isolated by
any other means
that involves splicing of human immunoglobulin gene sequences to other DNA
sequences.
Such recombinant human antibodies have variable and constant regions derived
from
human germline immunoglobulin sequences. In certain embodiments, however, such
recombinant human antibodies are subjected to in vitro mutagenesis (or, when
an animal
transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and
thus the amino
acid sequences of the VH and VL regions of the recombinant antibodies are
sequences that,
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-13-
while derived from and related to human germline VH and VL sequences, may not
naturally
exist within the human antibody germline repertoire in vivo.
A nucleic acid is "operably linked" when it is placed into a functional
relationship
with another nucleic acid sequence. For instance, a promoter or enhancer is
operably linked
S to a coding sequence if it affects the transcription of the sequence. With
respect to
transcription regulatory sequences, operably linked means that the DNA
sequences being
linked are contiguous and, where necessary to join two protein coding regions,
contiguous
and in reading frame.
The terms "vector" or "construct", as used herein, is intended to refer to a
nucleic
acid molecule capable of transporting another nucleic acid to which it has
been linked. One
type of vector is a "plasmid", which refers to a circular double stranded DNA
loop into
which additional DNA segments may be ligated. Another type of vector is a
viral vector,
wherein additional DNA segments may be ligated into the viral genome. Certain
vectors
are capable of autonomous replication in a host cell into which they are
introduced (e.g.,
bacterial vectors having a bacterial origin of replication and episomal
mammalian vectors).
Other vectors (e.g., non-episomal mammalian vectors) can be integrated into
the genome of
a host cell upon introduction into the host cell, and thereby are replicated
along with the
host genome. Moreover, certain vectors are capable of directing the expression
of genes to
which they are operatively linked. Such vectors are referred to herein as
"recombinant
expression vectors" (or simply, "expression vectors"). In general, expression
vectors of
utility in recombinant DNA techniques are often in the form of plasmids. In
the present
specification, "plasmid" and "vector" may be used interchangeably as the
plasmid is the
most commonly used form of vector. However, the invention is intended to
include such
other forms of expression vectors, such as viral vectors (e.g., replication
defective
retroviruses, adenoviruses and adeno-associated vectors.
The term "recombinant host cell" (or simply "host cell"), as used herein, is
intended
to refer to a cell into which a recombinant expression vector has been
introduced. It should
be understood that such terms are intended to refer not only to the particular
subject cell but
to the progeny of such a cell. Because certain modifications may occur in
succeeding
generations due to either mutation or environmental influences, such progeny
may not, in
CA 02382725 2002-03-12
WO 01/19846 PCT/US00125560
-14-
fact, be identical to the parent cell, but are still included within the scope
of the term "host
cell" as used herein.
Other features and advantages of the invention will be apparent from the
following
detailed description, and from the claims.
Detailed Description
The drawings are first described.
Figure 1 is a schematic representation of the genetic antibody and antibody
angiogenin fusion proteins.
Figure 2A is a schematic diagram of the structure of the transgenic expression
vectors for the transfernng receptor antibody (E6) and the angiogenin-enzyme
fusion
(CH2Ang). The following DNAs were fused between exons 2 and 7 of a modified
goat 13-
casein gene (DiTullio et al., 1992) for expression in the mammary gland of
mice; the heady
chain of the anti-human transferrin receptor monoclonal antibody, E6 (1); the
same heavy
chain fused at the CH2 domain to the 5' end of the gene encoding angiogenin
(Ang) as
previously described (Rybak et al., 1992) (II); the light chain of the E6
antibody (III). Open
boxes, heavy chain; crossed hatched boxes light chain: striped boxes, Ang.
Figure 2B shows Western analysis using anti-angiogenin or anti-IgG antibodies
under reducing conditions of milk collected form lactating females producing
either E6 IgG
antibody or CH2Ang fusion protein. 15u1 of milk diluted with an equal volume
of PBS was
applied to the gel.
Figure 2C shows Western analysis of purified E6 antibody or CH2Ang under
reducing or non-reducing conditions. The blots were analyzed with the
indicated antibodies
0.3 p E6, lanes l and 2; 4 pg E6, lane 3;07 and 0.2 pg CH2Ang lanes 4 and 5,
respectively.
Figure 3 is a graph depicting the effects of angiogenin or a fusion of
angiogenin-
antibody fusion (CH2Ang) on mRNA translation. Angiogenin or the fusion protein
was
added to a lysate mixture containing BMV mRNA and [35S]methionine. Protein
synthesis
was determined by measuring the incorporation of label into newly synthesized
protein as
described in (Newton et al., 1996). Data from 2-3 experiments were pooled and
plotted ~
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-15-
SEM. The results are expressed as a percentage of a mock treated control
reaction IC50 is
the concentration of Ang or the Ang fusion protein required to cause 50%
inhibition of
protein synthesis and was determined form the dose response curves. Solid
circles,
Ang;open circles, CH2 Ang.
Figure 4 is a graph depicting a dose response curve showing the cytotoxic
effect of
the angiogenin-antibody fusion in cultured cells. In vivo toxicity of CH2Ang
to SF539 and
MDA-MB-231 ]mdr cells as assessed by protein synthesis inhibition. Cytoxicity
assays
were performed by measuring the incorporation of [14C]leucine into cell
proteins as
described in Methods. the assays were conducted in the presence of serum and
changed to
leucine-and-serum-free medium prior to pulsing with [14C]leucine. IC50 is the
concentration of the angiogenin fusion proteins required to cause a 50%
inhibition of
protein synthase after 3 days and was determined directly from the dose
response curves.
The SEM is then when it is larger than the symbol. Solid symbols. SF539 human
glioma
cells; open symbols, MDA-MB-23] mdrl human breast cancer cells.
The present invention provides, at least in part, transgenically produced
fusion
proteins. In one embodiment, the fusion protein includes an immunoglobulin
subunit (e.g.,
an immunoglobulin heavy or light chain) fused to a toxin (e.g., a subunit of
an enzyme).
The immunogloblulin-enzyme fusion proteins described herein serve to target a
cytotoxic
agent (e.g. the enzyme) to an undesirable cell, e.g., a tumor cell. For
example, the fusion
proteins described in the Examples below, (i.e., an antibody against
carcinoembryonic
antigen (CEA) fused to an enzyme, e.g., RNAse A, or carboxypeptidase) can be
used to
target, to a tumor cell. After allowing sufficient time for the immunoglobulin-
enzyme
fusion to localize at the tumor site, a non-toxic prodrug can be administered.
This prodrug
is converted to a highly cytotoxic drug by the action of the targeted enzyme
localized at the
tumor site, permitting to achieve therapeutic levels of the drug without
unacceptable toxicity
for the patients.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-16-
Production of Immunoglobulins
A monoclonal antibody against a target antigen, e.g., a cell surface protein
(e.g.,
receptor) on a cell can be produced by a variety of techniques, including
conventional
monoclonal antibody methodology e.g., the standard somatic cell hybridization
technique
of Kohler and Milstein, Nature 256: 495 (1975). Although somatic cell
hybridization
procedures are preferred, in principle, other techniques for producing
monoclonal antibody
can be employed e.g., viral or oncogenic transformation of B lymphocytes.
The preferred animal system for preparing hybridomas is the murine system.
Hybridoma production in the mouse is a very well-established procedure.
Immunization
protocols and techniques for isolation of immunized splenocytes for fusion are
known in the
art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are
also known.
Human monoclonal antibodies (mAbs) directed against human proteins can be
generated using transgenic mice carrying the complete human immune system
rather than
the mouse system. Splenocytes from these transgenic mice immunized with the
antigen of
interest are used to produce hybridomas that secrete human mAbs with specific
affinities
for epitopes from a human protein (see, e.g., Wood et al. International
Application WO
91/00906, Kucherlapati et al. PCT publication WO 91/10741; Lonberg et al.
International
Application WO 92/03918; Kay et al. International Application 92/03917;
Lonberg, N. et
al. 1994 Nature 368:856-859; Green, L.L. et al. 1994 Nature Genet. 7:13-21;
Morrison,
S.L. et al. 1994 Proc. Natl. Acad. Sci. USA 81:6851-6855; Bruggeman et al.
1993 Year
Immunol 7:33-40; Tuaillon et al. 1993 PNAS 90:3720-3724; Bruggeman et al. 1991
Eur J
Immunol 21:1323-1326).
Monoclonal antibodies can also be generated by other methods known to those
skilled in the art of recombinant DNA technology. An alternative method,
referred to as the
"combinatorial antibody display" method, has been developed to identify and
isolate
antibody fragments having a particular antigen specificity, and can be
utilized to produce
monoclonal antibodies (for descriptions of combinatorial antibody display see
e.g., Sastry et
al. 1989 PNAS 86:5728; Huse et al. 1989 Science 246:1275; and Orlandi et al.
1989 PNAS
86:3833). After immunizing an animal with an immunogen as described above, the
antibody repertoire of the resulting B-cell pool is cloned. Methods are
generally known for
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-17-
obtaining the DNA sequence of the variable regions of a diverse population of
immunoglobulin molecules by using a mixture of oligomer primers and PCR. For
instance,
mixed oligonucleotide primers corresponding to the 5' leader (signal peptide)
sequences
and/or framework 1 (FR1) sequences, as well as primer to a conserved 3'
constant region
primer can be used for PCR amplification of the heavy and light chain variable
regions from
a number of marine antibodies (Larrick et a1.,1991, Biotechniques 11:152-156).
A similar
strategy can also been used to amplify human heavy and light chain variable
regions from
human antibodies (Larrick et al., 1991, Methods: Companion to Methods in
Enzymology
2:106-110).
In an illustrative embodiment, RNA is isolated from B lymphocytes, for
example,
peripheral blood cells, bone marrow, or spleen preparations, using standard
protocols (e.g.,
U.S. Patent No. 4,683,202; Orlandi, et al. PNAS (1989) 86:3833-3837; Sastry et
al., PNAS
(1989) 86:5728-5732; and Huse et al. (1989) Science 246:1275-1281.) First-
strand cDNA
is synthesized using primers specific for the constant region of the heavy
chains) and each
of the K and 7~ light chains, as well as primers for the signal sequence.
Using variable
region PCR primers, the variable regions of both heavy and light chains are
amplified, each
alone or in combinantion, and ligated into appropriate vectors for further
manipulation in
generating the display packages. Oligonucleotide primers useful in
amplification protocols
may be unique or degenerate or incorporate inosine at degenerate positions.
Restriction
endonuclease recognition sequences may also be incorporated into the primers
to allow for
the cloning of the amplified fragment into a vector in a predetermined reading
frame for
expression.
The V-gene library cloned from the immunization-derived antibody repertoire
can
be expressed by a population of display packages, preferably derived from
filamentous
phage, to form an antibody display library. Ideally, the display package
comprises a system
that allows the sampling of very large variegated antibody display libraries,
rapid sorting
after each affinity separation round, and easy isolation of the antibody gene
from purified
display packages. In addition to commercially available kits for generating
phage display
libraries (e.g., the Pharmacia Recombinant Phage Antibody System, catalog no.
27-9400-O1;
and the Stratagene SurfZAPTM phage display kit, catalog no. 240612), examples
of
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-18-
methods and reagents particularly amenable for use in generating a variegated
antibody
display library can be found in, for example, Ladner et al. U.S. Patent No.
5,223,409; Kang
et al. International Publication No. WO 92/18619; Dower et al. International
Publication
No. WO 91/17271; Winter et al. International Publication WO 92/20791; Markland
et al.
International Publication No. WO 92/15679; Breitling et al. International
Publication WO
93/01288; McCafferty et al. International Publication No. WO 92/01047; Garrard
et al.
International Publication No. WO 92/09690; Ladner et al. International
Publication No. WO
90/02809; Fuchs et al. (1991) BiolTechnology 9:1370-1372; Hay et al. (1992)
Hum Antibod
Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281; Griffths et al.
(1993)
EMBO J 12:725-734; Hawkins et al. (1992) JMoI Biol 226:889-896; Clackson et
al. (1991)
Nature 352:624-628; Gram et al. (1992) PNAS 89:3576-3580; Garrad et al. (1991)
BiolTechnology 9:1373-1377; Hoogenboom et al. (1991) Nuc Acid Res 19:4133-
4137; and
Barbas et al. (1991) PNAS 88:7978-7982.
In certain embodiments, the V region domains of heavy and light chains can be
expressed on the same polypeptide, joined by a flexible linker to form a
single-chain Fv
fragment, and the scFV gene subsequently cloned into the desired expression
vector or
phage genome. As generally described in McCafferty et al., Nature (1990)
348:552-554,
complete VH and VL domains of an antibody, joined by a flexible (Gly4-Ser)3
linker can
be used to produce a single chain antibody which can render the display
package separable
based on antigen affinity. Isolated scFV antibodies immunoreactive with the
antigen can
subsequently be formulated into a pharmaceutical preparation for use in the
subject method.
Once displayed on the surface of a display package (e.g., filamentous phage),
the
antibody library is screened with the target antigen, or peptide fragment
thereof, to identify
and isolate packages that express an antibody having specificity for the
target antigen.
Nucleic acid encoding the selected antibody can be recovered from the display
package
(e.g., from the phage genome) and subcloned into other expression vectors by
standard
recombinant DNA techniques.
Specific antibody molecules with high affinities for a surface protein can be
made
according to methods known to those in the art, e.g, methods involving
screening of
libraries (Ladner, R.C., et al., U.S. Patent 5,233,409; Ladner, R.C., et al.,
U.S. Patent
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-19-
5,403,484). Further, the methods of these libraries can be used in screens to
obtain binding
determinants that are mimetics of the structural determinants of antibodies.
In particular, the Fv binding surface of a particular antibody molecule
interacts with
its target ligand according to principles of protein-protein interactions,
hence sequence data
for VH and VL (the latter of which may be of the K or ~, chain type) is the
basis for protein
engineering techniques known to those with skill in the art. Details of the
protein surface
that comprises the binding determinants can be obtained from antibody sequence
information, by a modeling procedure using previously determined three-
dimensional
structures from other antibodies obtained from NMR studies or crytallographic
data. See
for example Bajorath, J. and S. Sheriff, 1996, Proteins: Struct., Funct., and
Genet. 24 (2),
152-157; Webster, D.M. and A. R. Rees, 1995, "Molecular modeling of antibody-
combining sites,"in S. Paul, Ed., Methods in Molecular Biol. 5I, Antibody
Engineering
Protocols, Humana Press, Totowa, NJ, pp 17-49; and Johnson, G., Wu, T.T. and
E.A.
Kabat, 1995, "Seqhunt: A program to screen aligned nucleotide and amino acid
sequences,"
in Methods in Molecular Biol.5l, op. cit., pp 1-15.
In one embodiment, a variegated peptide library is expressed by a population
of
display packages to form a peptide display library. Ideally, the display
package comprises a
system that allows the sampling of very large variegated peptide display
libraries, rapid
sorting after each affinity separation round, and easy isolation of the
peptide-encoding gene
from purified display packages. Peptide display libraries can be in, e.g.,
prokaryotic
organisms and viruses, which can be amplified quickly, are relatively easy to
manipulate,
and which allows the creation of large number of clones. Preferred display
packages
include, for example, vegetative bacterial cells, bacterial spores, and most
preferably,
bacterial viruses (especially DNA viruses). However, the present invention
also
contemplates the use of eukaryotic cells, including yeast and their spores, as
potential
display packages. Phage display libraries are described above.
Other techniques include affinity chromatography with an appropriate
"receptor",
e.g., a target antigen, followed by identification of the isolated binding
agents or ligands by
conventional techniques (e.g., mass spectrometry and NMR). Preferably, the
soluble
receptor is conjugated to a label (e.g., fluorophores, colorimetric enzymes,
radioisotopes,
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-20-
or luminescent compounds) that can be detected to indicate ligand binding.
Alternatively,
immobilized compounds can be selectively released and allowed to diffuse
through a
membrane to interact with a receptor.
Combinatorial libraries of compounds can also be synthesized with "tags" to
encode
the identity of each member of the library (see, e.g., W.C. Still et al.,
International
Application WO 94/08051). In general, this method features the use of inert
but readily
detectable tags, that are attached to the solid support or to the compounds.
When an active
compound is detected, the identity of the compound is determined by
identification of the
unique accompanying tag. This tagging method permits the synthesis of large
libraries of
compounds which can be identified at very low levels among to total set of all
compounds
in the library.
The term modified antibody is also intended to include antibodies, such as
monoclonal antibodies, chimeric antibodies, and humanized antibodies which
have been
modified by, e.g., deleting, adding, or substituting portions of the antibody.
For example,
an antibody can be modified by deleting the hinge region, thus generating a
monovalent
antibody. Any modification is within the scope of the invention so long as the
antibody has
at least one antigen binding region specific.
Chimeric mouse-human monoclonal antibodies (i.e., chimeric antibodies) can be
produced by recombinant DNA techniques known in the art. For example, a gene
encoding
the Fc constant region of a marine (or other species) monoclonal antibody
molecule is
digested with restriction enzymes to remove the region encoding the marine Fc,
and the
equivalent portion of a gene encoding a human Fc constant region is
substituted. (see
Robinson et al., International Patent Publication PCT/LTS86/02269; Akira, et
al., European
Patent Application 184,187; Taniguchi, M., European Patent Application
171,496;
Morrison et al., European Patent Application 173,494; Neuberger et al.,
International
Application WO 86/01533; Cabilly et al. U.S. Patent No. 4,816,567; Cabilly et
al.,
European Patent Application 125,023; Better et al. (1988 Science 240:1041-
1043); Liu et al.
(1987) PNAS 84:3439-3443; Liu et al., 1987, J. Immunol. 139:3521-3526; Sun et
al. (1987)
PNAS 84:214-218; Nishimura et al., 1987, Canc. Res. 47:999-1005; Wood et al.
(1985)
Nature 314:446-449; and Shaw et al., 1988, J. Natl Cancer Inst. 80:1553-1559).
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-21-
The chimeric antibody can be further humanized by replacing sequences of the
Fv
variable region which are not directly involved in antigen binding with
equivalent
sequences from human Fv variable regions. General reviews of humanized
chimeric
antibodies are provided by Morrison, S. L., 1985, Science 229:1202-1207 and by
Oi et al.,
1986, BioTechniques 4:214. Those methods include isolating, manipulating, and
expressing the nucleic acid sequences that encode all or part of
immunoglobulin Fv variable
regions from at least one of a heavy or light chain. Sources of such nucleic
acid are well
known to those skilled in the art and, for example, may be obtained from 7E3,
an anti-
GPIIbIIIa antibody producing hybridoma. The recombinant DNA encoding the
chimeric
antibody, or fragment thereof, can then be cloned into an appropriate
expression vector.
Suitable humanized antibodies can alternatively be produced by CDR
substitution U.S.
Patent 5,225,539; Jones et al. 1986 Nature 321:552-525; Verhoeyan et al. 1988
Science
239:1534; and Beidler et al. 1988 J. Immunol. 141:4053-4060.
All of the CDRs of a particular human antibody may be replaced with at least a
portion of a non-human CDR or only some of the CDRs may be replaced with non-
human
CDRs. It is only necessary to replace the number of CDRs required for binding
of the
humanized antibody to the Fc receptor.
An antibody can be humanized by any method, which is capable of replacing at
least
a portion of a CDR of a human antibody with a CDR derived from a non-human
antibody.
Winter describes a method which may be used to prepare the humanized
antibodies of the
present invention (UK Patent Application GB 2188638A, filed on March 26,
1987), the
contents of which is expressly incorporated by reference. The human CDRs may
be
replaced with non-human CDRs using oligonucleotide site-directed mutagenesis.
Also within the scope of the invention are chimeric and humanized antibodies
in
which specific amino acids have been substituted, deleted or added. In
particular, preferred
humanized antibodies have amino acid substitutions in the framework region,
such as to
improve binding to the antigen. For example, in a humanized antibody having
mouse
CDRs, amino acids located in the human framework region can be replaced with
the amino
acids located at the corresponding positions in the mouse antibody. Such
substitutions are
known to improve binding of humanized antibodies to the antigen in some
instances.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-22-
Antibodies in which amino acids have been added, deleted, or subsituted are
referred to
herein as modified antibodies or altered antibodies.
Target Antigens
In preferred embodiments, a component of the fusion proteins of the present
invention is a targeting agent, e.g., a polypeptide having a high affinity for
a target, e.g., an
antibody, a ligand, or an enzyme. Accordingly, the fusion proteins of the
invention can be
used to selectively direct (e.g., localize) the second component of the fusion
protein to the
vicinity of an undesirable cell.
For example, the first component can be an immunoglobulin that interacts with
(e.g.,
binds to a target antigen). In certain embodiments, the target antigen is
present on the
surface of a cell, e.g., an aberrant cell such a hyperproliferative cell
(e.g., a cancer cell).
Exemplary target antigens include carcinoembryonic antigen (CEA), TAG-72, her-
2/neu,
epidermal growth factor receptor, transferrin receptor, among others.
Preferably, the target
antigen is carcinoembryonic antigen.
As used herein, "target cell" shall mean any undesirable cell in a subject
(e.g., a
human or animal) that can be targeted by a fusion protein of the invention.
Exemplary
target cells include tumor cells, such as carcinoma or adenocarcinoma-derived
cells (e.g.,
colon, breast, prostate, ovarian and endometrial cancer cells) (Thor, A. et
al. (1997) Cancer
Res 46: 3118; Soisson A. P. et al. (1989) Am. J. Obstet. Gyneco1.:1258-63).
The term
"carcinoma" is art recognized and refers to malignancies of epithelial or
endocrine tissues
including respiratory system carcinomas, gastrointestinal system carcinomas,
genitourinary
system carcinomas, testicular carcinomas, breast carcinomas, ovarian
carcinomas, prostatic
carcinomas, endocrine system carcinomas, and melanomas. Exemplary carcinomas
include
those forming from tissue of the cervix, lung, prostate, breast, head and
neck, colon and
ovary. The term also includes carcinosarcomas, e.g., which include malignant
tumors
composed of carcinomatous and sarcomatous tissues. An "adenocarcinoma" refers
to a
carcinoma derived from glandular tissue or in which the tumor cells form
recognizable
glandular structures. The term "sarcoma" is art recognized and refers to
malignant tumors
of mesenchymal derivation.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
- 23 -
Production of Fusion Proteins
The components of the fusion protein can be linked to each other, preferably
via a
linker sequence. The linker sequence should separate the first and second
members of the
fusion protein by a distance sufficient to ensure that each member properly
folds into its
secondary and tertiary structures. Preferred linker sequences (1) should adopt
a flexible
extended conformation, (2) should not exhibit a propensity for developing an
ordered
secondary structure which could interact with the functional first and second
component,
and (3) should have minimal hydrophobic or charged character, which could
promote
interaction with the functional protein domains. Typical surface amino acids
in flexible
protein regions include Gly, Asn and Ser. Permutations of amino acid sequences
containing
Gly, Asn and Ser would be expected to satisfy the above criteria for a linker
sequence.
Other near neutral amino acids, such as Thr and Ala, can also be used in the
linker
sequence.
A linker sequence length of 20 amino acids can be used to provide a suitable
separation of functional protein domains, although longer or shorter linker
sequences may
also be used. The length of the linker sequence separating the first and
second components
can be from 5 to 500 amino acids in length, or more preferably from S to 100
amino acids in
length. Preferably, the linker sequence is from about 5-30 amino acids in
length. In
preferred embodiments, the linker sequence is from about 5 to about 20 amino
acids, and is
advantageously from about 10 to about 20 amino acids. Amino acid sequences
useful as
linkers of the first and second member include, but are not limited to,
(SerGly4)y wherein y
is greater than or equal to 8, or Gly4SerGlySSer. A preferred linker sequence
has the
formula (SerGly4)4. Another preferred linker has the sequence ((Ser-Ser-Ser-
Ser-Gly)3-
S er-Pro).
The first and second components can be directly fused without a linker
sequence.
Linker sequences are unnecessary where the proteins being fused have non-
essential N-or
C-terminal amino acid regions which can be used to separate the functional
domains and
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-24-
prevent steric interference. In preferred embodiments, the C-terminus of first
member can
be directly fused to the N-terminus of second, or viceversa.
Recombinant Production
A fusion protein of the invention can be prepared with standard recombinant
DNA
techniques using a nucleic acid molecule encoding the fusion protein. A
nucleotide
sequence encoding a fusion protein can be synthesized by standard DNA
synthesis methods.
A nucleic acid encoding a fusion protein can be introduced into a host cell,
e.g., a
cell of a primary or immortalized cell line. The recombinant cells can be used
to produce
the fusion protein. A nucleic acid encoding a fusion protein can be introduced
into a host
cell, e.g., by homologous recombination. In most cases, a nucleic acid
encoding the
fusion protein is incorporated into a recombinant expression vector.
The nucleotide sequence encoding a fusion protein can be operatively linked to
one
or more regulatory sequences, selected on the basis of the host cells to be
used for
expression. The term "operably linked" means that the sequences encoding the
fusion
protein compound are linked to the regulatory sequences) in a manner that
allows for
expression of the fusion protein. The term "regulatory sequence" refers to
promoters,
enhancers and other expression control elements (e.g., polyadenylation
signals). Such
regulatory sequences are described, for example, in Goeddel; Gene Expression
Technology:
Methods in Enzymology 185, Academic Press, San Diego, CA (1990), the content
of which
are incorporated herein by reference. Regulatory sequences include those that
direct
constitutive expression of a nucleotide sequence in many types of host cells,
those that
direct expression of the nucleotide sequence only in certain host cells (e.g.,
tissue-specific
regulatory sequences) and those that direct expression in a regulatable manner
(e.g., only in
the presence of an inducing agent). It will be appreciated by those skilled in
the art that the
design of the expression vector may depend on such factors as the choice of
the host cell to
be transformed, the level of expression of fusion protein desired, and the
like. The fusion
protein expression vectors can be introduced into host cells to thereby
produce fusion
proteins encoded by nucleic acids.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-25-
Recombinant expression vectors can be designed for expression of fusion
proteins in
prokaryotic or eukaryotic cells. For example, fusion proteins can be expressed
in bacterial
cells such as E. coli, insect cells (e.g., in the baculovirus expression
system), yeast cells or
mammalian cells. Some suitable host cells are discussed further in Goeddel,
Gene
Expression Technology: Methods in Enrymology 185, Academic Press, San Diego,
CA
(1990). Examples of vectors for expression in yeast S. cerevisiae include
pYepSecl
(Baldari et al., (1987) EMBO J. 6:229-234), pMFa (Kurjan and Herskowitz,
(1982) Cell
30:933-943), pJRY88 (Schultz et al., (1987) Gene 54:113-123), and pYES2
(Invitrogen
Corporation, San Diego, CA). Baculovirus vectors available for expression of
fusion
proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series
(Smith et al., (1983)
Mol. Cell. Biol. 3:2156-2165) and the pVL series (Lucklow, V.A., and Summers,
M.D.,
(1989) Virology 170:31-39).
Examples of mammalian expression vectors include pCDM8 (Seed, B., (1987)
Nature 329:840) and pMT2PC (Kaufinan et al. (1987), EMBO J. 6:187-195). When
used
in mammalian cells, the expression vector's control functions are often
provided by viral
regulatory elements. For example, commonly used promoters are derived from
polyoma,
Adenovirus 2, cytomegalovirus and Simian Virus 40.
In addition to the regulatory control sequences discussed above, the
recombinant
expression vector can contain additional nucleotide sequences. For example,
the
recombinant expression vector may encode a selectable marker gene to identify
host cells
that have incorporated the vector. Moreover, to facilitate secretion of the
fusion protein
from a host cell, in particular mammalian host cells, the recombinant
expression vector
can encode a signal sequence operatively linked to sequences encoding the
amino-
terminus of the fusion protein such that upon expression, the fusion protein
is
synthesized with the signal sequence fused to its amino terminus. This signal
sequence
directs the fusion protein into the secretory pathway of the cell and is then
cleaved,
allowing for release of the mature fusion protein (i.e., the fusion protein
without the
signal sequence) from the host cell. Use of a signal sequence to facilitate
secretion of
proteins or peptides from mammalian host cells is known in the art.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-26-
Vector DNA can be introduced into prokaryotic or eukaryotic cells via
conventional
transformation or transfection techniques. As used herein, the terms
"transformation" and
"transfection" refer to a variety of art-recognized techniques for introducing
foreign nucleic
acid (e.g., DNA) into a host cell, including calcium phosphate or calcium
chloride co-
y precipitation, DEAE-dextran-mediated transfection, lipofection,
electroporation,
_nicroinjection and viral-mediated transfection. Suitable methods for
transforming or
transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A
Laboratory
Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other
laboratory
manuals.
Often only a small fraction of mammalian cells integrate the foreign DNA into
their
genome. In order to identify and select these integrants, a gene that encodes
a selectable
marker (e.g., resistance to antibiotics) can be introduced into the host cells
along with the
gene encoding the fusion protein. Preferred selectable markers include those
that confer
resistance to drugs, such as 6418, hygromycin and inethotrexate. Nucleic acid
encoding a
selectable marker can be introduced into a host cell on the same vector as
that encoding the
fusion protein or can be introduced on a separate vector. Cells stably
transfected with the
introduced nucleic acid can be identified by drug selection (e.g., cells that
have incorporated
the selectable marker gene will survive, while the other cells die).
A recombinant expression vector can be transcribed and translated in vitro,
for
example using T7 promoter regulatory sequences and T7 polymerase.
Transgenic Mammals
Methods for generating non-human transgenic animals are described herein. DNA
constructs can be introduced into the germ line of a mammal to make a
transgenic mammal.
For example, one or several copies of the construct can be incorporated into
the genome of a
mammalian embryo by standard transgenic techniques.
It is often desirable to express the transgenic protein in the milk of a
transgenic
mammal. Mammals that produce large volumes of milk and have long lactating
periods are
preferred. Preferred mammals are ruminants, e.g., cows, sheep, camels or
goats, e.g., goats
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-27-
of Swiss origin, e.g., the Alpine, Saanen and Toggenburg breed goats. Other
preferred
animals include oxen, rabbits and pigs.
In an exemplary embodiment, a transgenic non-human animal is produced by
introducing a transgene into the germline of the non-human animal. Transgenes
can be
introduced into embryonal target cells at various developmental stages.
Different methods
are used depending on the stage of development of the embryonal target cell.
The specific
lines) of any animal used should, if possible, be selected for general good
health, good
embryo yields, good pronuclear visibility in the embryo, and good reproductive
fitness.
Introduction of the fusion protein transgene into the embryo can be
accomplished by
any of a variety of means known in the art such as microinjection,
electroporation, or
lipofection. For example, a fusion protein transgene can be introduced into a
mammal by
microinjection of the construct into the pronuclei of the fertilized mammalian
eggs) to
cause one or more copies of the construct to be retained in the cells of the
developing
mammal(s). Following introduction of the transgene construct into the
fertilized egg, the
egg can be incubated in vitro for varying amounts of time, or reimplanted into
the surrogate
host, or both. One common method is to incubate the embryos in vitro for about
1-7 days,
depending on the species, and then reimplant them into the surrogate host.
The progeny of the transgenically manipulated embryos can be tested for the
presence of the construct by Southern blot analysis of a segment of tissue. An
embryo
having one or more copies of the exogenous cloned construct stably integrated
into the
genome can be used to establish a permanent transgenic mammal line carrying
the
transgenically added construct.
Litters of transgenically altered mammals can be assayed after birth for the
incorporation of the construct into the genome of the offspring. This can be
done by
hybridizing a probe corresponding to the DNA sequence coding for the fusion
protein or a
segment thereof onto chromosomal material from the progeny. Those mammalian
progeny
found to contain at least one copy of the construct in their genome are grown
to maturity.
The female species of these progeny will produce the desired protein in or
along with their
milk. The transgenic mammals can be bred to produce other transgenic progeny
useful in
producing the desired proteins in their milk.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-28-
Transgenic females may be tested for protein secretion into milk, using an art-
known
assay technique, e.g., a Western blot or enzymatic assay.
Other Transgenic Animals
S Fusion protein can be expressed from a variety of transgenic animals. A
protocol for
the production of a transgenic pig can be found in White and Yannoutsos,
Current Topics in
Complement Research: 64th Forum in Immunology, pp. 88-94; US Patent No.
5,523,226;
US Patent No. 5,573,933; PCT Application W093/25071; and PCT Application
W095/04744. A protocol for the production of a transgenic mouse can be found
in US
Patent No. 5,530,177. A protocol for the production of a transgenic rat can be
found in
Bader and Ganten, Clinical and Experimental Pharmacology and Physiology, Supp.
3:581-
S87, 1996. A protocol for the production of a transgenic cow can be found in
Transgenic
Animal Technology, A Handbook, 1994, ed., Carl A. Pinkert, Academic Press,
Inc. A
protocol for the production of a transgenic sheep can be found in Transgenic
Animal
Technology, A Handbook, 1994, ed., Carl A. Pinkert, Academic Press, Inc. A
protocol for
the production of a transgenic rabbit can be found in Hammer et al., Nature
315:680-683,
1985 and Taylor and Fan, Frontiers in Bioscience 2:d298-308, 1997.
Production of Trans~enic Protein in the Milk of a Transgenic Animal
Milk Specific Promoters
Useful transcriptional promoters are those promoters that are preferentially
activated
in mammary epithelial cells, including promoters that control the genes
encoding milk
proteins such as caseins, beta lactoglobulin (Clark et al., (1989)
BiolTechnology 7: 487-
492), whey acid protein (Gorton et al. (1987) BiolTechnology 5: 1183-1187),
and
lactalbumin (Soulier et al., ( 1992) FEBS Letts. 297: ~. The alpha, beta,
gamma or kappa
casein gene promoter of any mammalian species can be used to provide mammary
expression; a preferred promoter is the goat beta casein gene promoter
(DiTullio, (1992)
BiolTechnology 10:74-77). Milk-specific protein promoter or the promoters that
are
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-29-
specifically activated in mammary tissue can be isolated from cDNA or genomic
sequences.
Preferably, they are genomic in origin.
DNA sequence information is available for mammary gland specific genes listed
above, in at least one, and often in several organisms. See, e.g., Richards et
al., J. Biol.
S Chem. 256, 526-532 (1981) (a-lactalbumin rat); Campbell et al., Nucleic
Acids Res. 12,
8685-8697 (1984) (rat WAP); Jones et al., J. Biol. Chem. 260, 7042-7050 (1985)
(rat (3-
casein); Yu-Lee & Rosen, J. Biol. Chem. 258, 10794-10804 (1983) (rat y-
casein); Hall,
Biochem. J. 242, 735-742 (1987) (a-lactalbumin human); Stewart, Nucleic Acids
Res. 12,
389 (1984) (bovine asl and x casein cDNAs); Gorodetsky et al., Gene 66, 87-96
(1988)
(bovine (3 casein); Alexander et al., Eur. J. Biochem. 178, 395-401 (1988)
(bovine x casein);
Brignon et al., FEBSLett. 188, 48-55 (1977) (bovine aS2 casein); Jamieson et
al., Gene 61,
85-90 (1987), Ivanov et al., Biol. Chem. Hoppe-Seyler 369, 425-429 (1988),
Alexander et_
al., Nucleic Acids Res. 17, 6739 (1989) (bovine (3 lactoglobulin); Vilotte et
al., Biochimie
69, 609-620 (1987) (bovine a-lactalbumin). The structure and function of the
various milk
protein genes are reviewed by Mercier & Vilotte, J. Dairy Sci. 76, 3079-3098
(1993)
(incorporated by reference in its entirety for all purposes). If additional
flanking sequence
are useful in optimizing expression, such sequences can be cloned using the
existing
sequences as probes. Mammary-gland specific regulatory sequences from
different
organisms can be obtained by screening libraries from such organisms using
known cognate
nucleotide sequences, or antibodies to cognate proteins as probes.
Signal Sequences
Useful signal sequences are milk-specific signal sequences or other signal
sequences
which result in the secretion of eukaryotic or prokaryotic proteins.
Preferably, the signal
sequence is selected from milk-specific signal sequences, i.e., it is from a
gene which
encodes a product secreted into milk. Most preferably, the milk-specific
signal sequence is
related to the milk-specific promoter used in the expression system of this
invention. The
size of the signal sequence is not critical for this invention. All that is
required is that the
sequence be of a sufficient size to effect secretion of the desired
recombinant protein, e.g.,
in the mammary tissue. For example, signal sequences from genes coding for
caseins, e.g.,
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-30-
alpha, beta, gamma or kappa caseins, beta lactoglobulin, whey acid protein,
and lactalbumin
are useful in the present invention. A preferred signal sequence is the goat
(3-casein signal
sequence.
Signal sequences from other secreted proteins, e.g., immunoglobulins, or
proteins
secreted by liver cells, kidney cell, or pancreatic cells can also be used.
Insulator Sequences
The DNA constructs of the invention further comprise at least one insulator
sequence. The terms "insulator", "insulator sequence" and "insulator element"
are used
interchangeably herein. An insulator element is a control element which
insulates the
transcription of genes placed within its range of action but which does not
perturb gene
expression, either negatively or positively. Preferably, an insulator sequence
is inserted on
either side of the DNA sequence to be transcribed. For example, the insulator
can be
positioned about 200 by to about 1 kb, 5' from the promoter, and at least
about 1 kb to S kb
from the promoter, at the 3' end of the gene of interest. The distance of the
insulator
sequence from the promoter and the 3' end of the gene of interest can be
determined by
those skilled in the art, depending on the relative sizes of the gene of
interest, the promoter
and the enhancer used in the construct. In addition, more than one insulator
sequence can
be positioned 5' from the promoter or at the 3' end of the transgene. For
example, two or
more insulator sequences can be positioned S' from the promoter. The insulator
or
insulators at the 3' end of the transgene can be positioned at the 3' end of
the gene of
interest, or at the 3'end of a 3' regulatory sequence, e.g., a 3' untranslated
region (UTR) or a
3' flanking sequence.
A preferred insulator is a DNA segment which encompasses the 5' end of the
chicken ~i-globin locus and corresponds to the chicken 5' constitutive
hypersensitive site as
described in PCT Publication 94/23046, the contents of which is incorporated
herein by
reference.
DNA Constructs
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-31-
A fusion protein can be expressed from a construct which includes a promoter
specific for mammary epithelial cells, e.g., a casein promoter, e.g., a goat
beta casein
promoter, a milk-specific signal sequence, e.g., a casein signal sequence,
e.g., a ~3-casein
signal sequence, and a DNA encoding a fusion protein.
A construct can also include a 3' untranslated region downstream of the DNA
sequence coding for the non-secreted protein. Such regions can stabilize the
RNA transcript
of the expression system and thus increases the yield of desired protein from
the expression
system. Among the 3' untranslated regions useful in the constructs of this
invention are
sequences that provide a poly A signal. Such sequences may be derived, e.g.,
from the
SV40 small t antigen, the casein 3' untranslated region or other 3'
untranslated sequences
well known in the art. Preferably, the 3' untranslated region is derived from
a milk specific
protein. The length of the 3' untranslated region is not critical but the
stabilizing effect of its
poly A transcript appears important in stabilizing the RNA of the expression
sequence.
A construct can include a S' untranslated region between the promoter and the
DNA
sequence encoding the signal sequence. Such untranslated regions can be from
the same
control region from which promoter is taken or can be from a different gene,
e.g., they may
be derived from other synthetic, semi-synthetic or natural sources. Again
their specific
length is not critical, however, they appear to be useful in improving the
level of expression.
A construct can also include about 10%, 20%, 30%, or more of the N-terminal
coding region of a gene preferentially expressed in mammary epithelial cells.
For example,
the N-terminal coding region can correspond to the promoter used, e.g., a goat
(3-casein N-
terminal coding region.
Prior art methods can include making a construct and testing it for the
ability to
produce a product in cultured cells prior to placing the construct in a
transgenic animal.
Surprisingly, the inventors have found that such a protocol may not be of
predictive value in
determining if a normally non-secreted protein can be secreted, e.g., in the
milk of a
transgenic animal. Therefore, it may be desirable to test constructs directly
in transgenic
animals, e.g., transgenic mice, as some constructs which fail to be secreted
in CHO cells are
secreted into the milk of transgenic animals.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-32-
Purification from milk
The transgenic fusion protein can be produced in milk at relatively high
concentrations and in large volumes, providing continuous high level output of
normally
processed peptide that is easily harvested from a renewable resource. There
are several
different methods known in the art for isolation of proteins from milk.
Milk proteins usually are isolated by a combination of processes. Raw milk
first is
fractionated to remove fats, for example, by skimming, centrifugation,
sedimentation (H.E.
Swaisgood, Developments in Dairy Chemistry, I: Chemistry of Milk Protein,
Applied
Science Publishers, NY, 1982), acid precipitation (U.S. Patent No. 4,644,056)
or enzymatic
coagulation with rennin or chymotrypsin (Swaisgood, ibid.). Next, the major
milk proteins
may be fractionated into either a clear solution or a bulk precipitate from
which the specific
protein of interest may be readily purified.
USSN 08/648,235 discloses a method for isolating a soluble milk component,
such
as a peptide, in its biologically active form from whole milk or a milk
fraction by tangential
flow filtration. Unlike previous isolation methods, this eliminates the need
for a first
fractionation of whole milk to remove fat and casein micelles, thereby
simplifying the
process and avoiding losses of recovery and bioactivity. This method may be
used in
combination with additional purification steps to further remove contaminants
and purify
the component of interest.
Production of Trans~enic Protein in the Eggs of a Transgenic Animal
A fusion protein can be produced in tissues, secretions, or other products,
e.g., an
egg, of a transgenic animal. For example, fusion proteins can be produced in
the eggs of a
transgenic animal, preferably a transgenic turkey, duck, goose, ostrich,
guinea fowl,
peacock, partridge, pheasant, pigeon, and more preferably a transgenic
chicken, using
methods known in the art (Sang et al., Trends Biotechnology, 12:415-20, 1994).
Genes
encoding proteins specifically expressed in the egg, such as yolk-protein
genes and
albumin-protein genes, can be modified to direct expression of fusion protein.
Egg Specific Promoters
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
- 33 -
Useful transcriptional promoters are those promoters that are preferentially
activated
in the egg, including promoters that control the genes encoding egg proteins,
e.g.,
ovalbumin, lysozyme and avidin. Promoters from the chicken ovalbumin, lysozyme
or
avidin genes are preferred. Egg-specific protein promoters or the promoters
that are
S specifically activated in egg tissue can be from cDNA or genomic sequences.
Preferably,
the egg-specific promoters are genomic in origin.
DNA sequences of egg specific genes are known in the art (see, e.g., Burley et
al.,
"The Avian Egg", John Wiley and Sons, p. 472, 1989, the contents of which are
incorporated herein by reference). If additional flanking sequence are useful
in optimizing
expression, such sequences can be cloned using the existing sequences as
probes. Egg
specific regulatory sequences from different organisms can be obtained by
screening
libraries from such organisms using known cognate nucleotide sequences, or
antibodies to
cognate proteins as probes.
1 S Transgenic Plants
A fusion protein can be expressed in a transgenic organism, e.g., a transgenic
plant,
e.g., a transgenic plant in which the DNA transgene is inserted into the
nuclear or plastidic
genome. Plant transformation is known as the art. See, in general, Methods in
Enzymology
Vol. 153 ("Recombinant DNA Part D") 1987, Wu and Grossman Eds., Academic Press
and
European Patent Application EP 693554.
Foreign nucleic acid can be introduced into plant cells or protoplasts by
several
methods. For example, nucleic acid can be mechanically transferred by
microinjection
directly into plant cells by use of micropipettes. Foreign nucleic acid can
also be transferred
into a plant cell by using polyethylene glycol which forms a precipitation
complex with the
genetic material that is taken up by the cell (Paszkowski et al. (1984) EMBO
J. 3:2712-22).
Foreign nucleic acid can be introduced into a plant cell by electroporation
(Fromm et al.
(1985) Proc. Natl. Acad. Sci. USA 82:5824). In this technique, plant
protoplasts are
electroporated in the presence of plasmids or nucleic acids containing the
relevant genetic
construct. Electrical impulses of high field strength reversibly permeabilize
biomembranes
allowing the introduction of the plasmids. Electroporated plant protoplasts
reform the cell
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-34-
wall, divide, and form a plant callus. Selection of the transformed plant
cells with the
transformed gene can be accomplished using phenotypic markers.
Cauliflower mosaic virus (CaMV) can be used as a vector for introducing
foreign
nucleic acid into plant cells (Hohn et al. (1982) "Molecular Biology of Plant
Tumors,"
Academic Press, New York, pp. 549-560; Howell, U.S. Pat. No. 4,407,956). CaMV
viral
DNA genome is inserted into a parent bacterial plasmid creating a recombinant
DNA
molecule which can be propagated in bacteria. The recombinant plasmid can be
further
modified by introduction of the desired DNA sequence. The modified viral
portion of the
recombinant plasmid is then excised from the parent bacterial plasmid, and
used to
inoculate the plant cells or plants.
High velocity ballistic penetration by small particles can be used to
introduce
foreign nucleic acid into plant cells. Nucleic acid is disposed within the
matrix of small
beads or particles, or on the surface (Klein et al. (1987) Nature 327:70-73).
Although
typically only a single introduction of a new nucleic acid segment is
required, this method
also provides for multiple introductions.
A nucleic acid can be introduced into a plant cell by infection of a plant
cell, an
explant, a meristem or a seed with Agrobacterium tumefaciens transformed with
the nucleic
acid. Under appropriate conditions, the transformed plant cells are grown to
form shoots,
roots, and develop further into plants. The nucleic acids can be introduced
into plant cells,
for example, by means of the Ti plasmid of Agrobacterium tumefaciens. The Ti
plasmid is
transmitted to plant cells upon infection by Agrobacterium tumefaciens, and is
stably
integrated into the plant genome (Horsch et al. (1984) "Inheritance of
Functional Foreign
Genes in Plants," Science 233:496-498; Fraley et al. (1983) Proc. Natl. Acad.
Sci. USA
80:4803).
Plants from which protoplasts can be isolated and cultured to give whole
regenerated
plants can be transformed so that whole plants are recovered which contain the
transferred
foreign gene. Some suitable plants include, for example, species from the
genera Fragaria,
Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum,
Geranium,
Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum,
Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana,
Ciohorium,
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-35-
Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Hererocallis, Nemesia,
Pelargonium, Panicum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis,
Browaalia, Glycine, Lolium, Zea, Triticum, Sorghum, and Datura.
Plant regeneration from cultured protoplasts is described in Evans et al.,
"Protoplasts
Isolation and Culture," Handbook of Plant Cell Cultures 1:124-176 (MacMillan
Publishing
Co. New York 1983); M.R. Davey, "Recent Developments in the Culture and
Regeneration
of Plant Protoplasts," Protoplasts (1983)-Lecture Proceedings, pp. 12-29,
(Birkhauser,
Basal 1983); P.J. Dale, "Protoplast Culture and Plant Regeneration of Cereals
and Other
Recalcitrant Crops," Protoplasts (1983)-Lecture Proceedings, pp. 31-41,
(Birkhauser, Basel
1983); and H. Binding, "Regeneration of Plants," Plant Protoplasts, pp. 21-73,
(CRC Press,
Boca Raton 1985).
Regeneration from protoplasts varies from species to species of plants, but
generally
a suspension of transformed protoplasts containing copies of the exogenous
sequence is first
generated. In certain species, embryo formation can then be induced from the
protoplast
suspension, to the stage of ripening and germination as natural embryos. The
culture media
can contain various amino acids and hormones, such as auxin and cytokinins. It
can also be
advantageous to add glutamic acid and proline to the medium, especially for
such species as
corn and alfalfa. Shoots and roots normally develop simultaneously. Efficient
regeneration
will depend on the medium, on the genotype, and on the history of the culture.
If these
three variables are controlled, then regeneration is fully reproducible and
repeatable.
In vegetatively propagated crops, the mature transgenic plants can be
propagated by
the taking of cuttings or by tissue culture techniques to produce multiple
identical plants for
trialling, such as testing for production characteristics. Selection of a
desirable transgenic
plant is made and new varieties are obtained thereby, and propagated
vegetatively for
commercial sale. In seed propagated crops, the mature transgenic plants can be
self crossed
to produce a homozygous inbred plant. The inbred plant produces seed
containing the gene
for the newly introduced foreign gene activity level. These seeds can be grown
to produce
plants that have the selected phenotype. The inbreds according to this
invention can be used
to develop new hybrids. In this method a selected inbred line is crossed with
another inbred
line to produce the hybrid.
CA 02382725 2002-03-12
WO 01/19846 PCT/LTS00/25560
-36-
Parts obtained from a transgenic plant, such as flowers, seeds, leaves,
branches,
fruit, and the like are covered by the invention, provided that these parts
include cells which
have been so transformed. Progeny and variants, and mutants of the regenerated
plants are
also included within the scope of this invention, provided that these parts
comprise the
introduced DNA sequences. Progeny and variants, and mutants of the regenerated
plants
are also included within the scope of this invention.
Selection of transgenic plants or plant cells can be based upon a visual
assay, such as
observing color changes (e.g., a white flower, variable pigment production,
and uniform
color pattern on flowers or irregular patterns), but can also involve
biochemical assays of
either enzyme activity or product quantitation. Transgenic plants or plant
cells are grown
into plants bearing the plant part of interest and the gene activities are
monitored, such as by
visual appearance (for flavonoid genes) or biochemical assays (Northern
blots); Western
blots; enzyme assays and flavonoid compound assays, including spectroscopy,
see,
Harborne et al. (Eds.), (1975) The Flavonoids, Vols: 1 and 2, [Acad. Press]).
Appropriate
plants are selected and further evaluated. Methods for generation of
genetically engineered
plants are further described in US Patent No. 5,283,184, US Patent No. 5,
482,852, and
European Patent Application EP 693 554, all of which are hereby incorporated
by reference.
Embodiments of the invention are further illustrated by the following examples
which should not be construed as being limiting. The contents of all cited
references
(including literature references, issued patents, published patent
applications, and co-
pending patent applications) cited throughout this application are hereby
expressly
incorporated by reference.
EXAMPLE 1: Generation and Testing of An Antibody-Carboxmeptidase B Fusion
An F(ab') 2-enzyme fusion protein was subcloned into a Goat Beta-Casein
expression vector BC350. For each one of the 3 constructs: 213 (MF21q3-13, Fd-
enzyme
fusion gene), LC (LC3, light chain), and 141 (MF141-4, pro domain with C-
terminal
leucine), expression cassettes were separated from the bacterial plasmid
sequences. The
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-37-
three transgenes were then co-microinjected in mouse zygotes. Seven transgenic
mouse
lines that carry all 3 subunits of the F(ab')2-enzyme fusion protein antibody
and 3 lines that
only carried transgenes LC and 213 were analyzed. Milk samples were collected
from
founder and first generation females, and tested for ELISA and enzyme activity
assays.
Four of the seven lines carrying 3 transgenes express the F(ab')2-enzyme
fusion protein at
levels superior to 1 mg/ml (possibly up to 4 - 6 mg/ml), whereas all 3 lines
carrying only the
LC and 213 transgenes express at levels inferior to 0.1 mg/ml.
Transgenic mice expressing a humanized antibody fragment - enzyme fusion
protein
(F(ab')2-CPB) comprising a humanized anti-carcinoembryonic antigen (CEA)
F(ab')2,
806.077 fused to a modified human carboxypeptidase B enzyme were generated.
These
transgenic mice were generated by co-microinjection of three Goat Beta-Casein
mammary
gland expression constructs. One construct, 141 (MF141-4, pro domain with C-
terminal
leucine) expressed the pro-domain of CPB, the other 2 constructs, LC and 213
(light chain
and Fd-enzyme fusion gene respectively) expressed-the antibody-CPB fusion.
Expression
of the CPB pro-domain in traps was shown in experiments conducted previously
to be
necessary for the proper folding of fusion-proteins based on mature CPB.
Materials and Methods
Restriction enzymes were obtained from New England Biolabs, Beverly, MA.
Nylon membranes (MagnaGraph nylon transfer membranes) were obtained from
Micron
Sepasrations Inc (MSI, Westboro, MA 01581). Alpha32P--dATP was obtained from
NEN
Life Science Products, Inc. Boston, MA. Sequencing was performed by Sequegen
Company, Worcester, MA. Plasmids, 213 containing the MF21q3-13 Fd-enzyme
fusion
gene, LC containing the 806.077 light chain coding region, and 141 Zeneca
Pharmaceuticals. CD 1 mice were obtained from Charles River Labs, Wilmington,
MA.
Preparation of Infection Fragments
Plasmid DNA was obtained from Dr. Michael D. Edge (Zeneca Pharmaceuticals)
and expression cassettes (100 Ng each) were separated from the vector backbone
by
digesting to completion with SaII: Digests were then electrophoresed in an
agarose gel,
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-38-
using 1X TAE (Maniatis et al., 1982) as running buffer. The region of the gel
containing
the DNA fragment corresponding to the expression cassette was visualized under
UV light
(long wave). The band containing the DNA of interest was excised, transferred
to a dialysis
bag, and the DNA is isolated by electro-elution in 1X TAE. This procedure was
applied for
each expression cassette.
Following electro-elution, DNA fragments were concentrated and cleaned-up by
using the "Wizard DNA clean-up system" (Promega, Cat #A7280), following the
provided
protocol and eluting in 125 ml of microinjection buffer (10 mM Tris pH 7.5
EDTA 0.2
mMO. Fragment concentration was evaluated by comparative agarose gel
electrophoresis.
The deduced concentrations of microinjection fragments stocks were as follows:
LC, 1 S
ng/ml; 141, 180 ng/ml, and 213, 270 ng/ml. The stocks were co-diluted in
microinjection
buffer just prior to pronuclear injections so that the final concentration of
each fragment was
0.5 ng.ml.
Microinjection
CD 1 female mice were superovulated and fertilized ova were retrieved from the
oviduct. The male pronuclei were then microinjected with DNA diluted in
microinjection
buffer. Microinjected embryos were either cultured overnight in CZB media or
transferred
immediately into the oviduct of pseudopregnant recipient CD 1 female mice.
Twenty to
thirty 2-cell or forty to fifty one-cell embryos were transferred to each
recipient female and
allowed to proceed to term.
Identification of Founder Animals
Genomic DNA was isolted from tail tissue by precipitation with sopropanol and
analyzed by polymerise chain reaction (PCR) for the presence of the chicken
beta-globin
insulator DNA sequence. This sequence is part of the Goat Beta-Case vector
(GBC 350).
For the PCR reactions, approximately 250 ng of genomic DNA is diluted in 50 ~l
of PCR
buffer (20 mM Tris pH 8.3, SO mM KCl and 1.5 mM MgCL2, 100 ~M deoxynucleotide
triphosphates, and each primer at a concentration of 600 nM) with 2.5 units of
Taq
polymerise and processed using the following temperature program
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-39-
1 cycle 94° 60 sec
cycles 94C 30 sec
58C 45 sec
74C 45 sec
30 cycles 94C 30 sec
55C 30 sec
74C 30 sec
Primer sets:
GBC 332 and GBC 386, amplicon is 206 by
5
GBC 332: TGTGCTCCTCTCCATGCTGG (SEQ ID NO:~
GBC 386 TGGTCTGGGGTGACACATGT (SEQ ID NO:~
Southern blot analysis of transgenic founders:
Genomic DNA ((24 ug total, 8 Ng/lane) from each founder mouse positive for the
insulator PCR was digested to completion with the restriction enzyme EcoRI.
Digested
DNAs were electrophoresed in triplicate and transferred to nylon membranes
according to
standard methods (Maniatis et al., 1982). Probes specific for each expression
cassette were
isolated from the VK (LC10 in pSP72, 72 by probe), ProL (pMF141-4 in pSP72
345, by
probe), and fd-CPB (pMF213-20 in pSP72, 1861 by probe) plasmids (provided by
Michael
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-40-
D. Edge, Zeneca Pharmaceuticals) by cutting with SaII, Xhol, and Xhol
respectively. Each
probe was labeled using reagents from the Prime-It"II kit (Stratagene, LaJolla
CA 92037)
according to manufacturers' instructions, and hybridized to one set of nylon
filters in 50%
formamide at 42° C following standard protocols (Maniatis et al.,
1982). Washes were
performed at 60°C, with 0.2X SSC, 0.1 % SDS.
Mouse milking
Female mice were allowed to deliver their pups naturally, and were generally
milked
on days 7 and 9 postpartum. Mice were separated from their litters for
approximately one
hour prior to the milking procedure. After the one hour holding period, mice
were induced
to lactate using an intraperitoneal injection of 5 i. U. Oxytocin in sterile
Phosphate Buffered
Saline, using a 25 gaugage needle. Hormone injections were followed by a one
to five
minutes waiting period for the Oxytocin to take effect. A suction and
collection system
consisting of a 15 ml conical tube sealed with a rubber stopper with two 18
gauge needles
inserted in it, the hub end of one needle being inserted into rubber tubing
connected to a
human breast pump, was used for milking. Mice were placed on a cage top, held
only by
their tail and otherwise not restricted or confined. The hub end of the other
needle was
placed over the mice's teats (one at a time) for the purpose of collecting the
milk into
individual eppendorf tube placed in the 15 ml conical tube. Eppendorf tubes
were changed
after each sample collection. Milking was continued until at least 1 SO p.1 of
milk had been
obtained. After collection, mice were returned to their litters.
Microiniection of Mouse Embryos.
The fragments were coinjected into 1708 mouse embryos, of which 945 were
transferred to 31 recipient females. Of these females, 27 carried pups to term
and gave birth
to 172 p ups, 20 of which appeared transgenic following PCR analysis. Of the
embryos
injected, 1.2% appeared transgenic; of the pups born, 11.6% appeared
transgenic.
Southern blot analysis of founder mouse lines.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-41 -
The 20 transgenic founders identified with the insulator PCR were analyzed
further
by Southern blotting hybridization to determine: A - which were positives for
all three (35,
63, 73, 81, 86,92,120, 169) were weak mosaics. These were clearly positive
using the very
sensitive PCR assay, but no equivocal positive signal could be detected using
Southern
hybridizations. Six other founders (5, 76, 121, 128, 131, and 161 were clearly
positive for
at least one of the transgenes, but clearly negative or mosaic for at least
one of the other
transgenes. Finally, six founders (25, 67, 89, 106, 161, 166) showed
hybridization signals
indicating at least one copy of each transgene.
Table 1: Summary of Southern hybridization data from Beta-casein - F(ab')2-
enzyme
fusion protein transgenic founders. Copy number was roughly evaluated by
comparison to
signal obtained with known amount of Eco RI digested microinjection fragment
(und, is
undetectable by Southern).
Founder LC transgene 141 transgene 213 transgene
Estimated copy estimated copy estimated copy
# # #
2 and 2-3
4 4 2
und. und. und.
63 und. und. und.
67 2-3 2_3 3
73 und. und. < 1
76 und. 1-2 1
81 und. und. und.
86 und. und. und.
89 >10 >10 >10
92 und. und. < 1
106 3 2-3 1
120 und. und. und.
121 <1 1 1
128 <1 und. <1
131 < 1 und. < 1
152 2-3 2-3 2-3
161 und. 1 < 1
166 2-3 3 3-5
169 und. und. und.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-42-
Breeding of mouse lines:
Following Southern blot analysis of founders 10 lines were selected for
breeding: 5,
25, 67, 76, 89, 106, 121, 128, 152, and 166. Table 2 summarizes the breeding
of each line;
Table 3, summarizes the Southern blot analysis of PCR positive F1 offspring.
From this
analysis, all founders, except #121, passed their transgenic integration(s) to
the next
generation. Other lines (5, 25, 76, 128, see Table 2) also showed signs of
germline
mosaicism, with low percentage of transgene positive offspring.
Southern analysis also suggested that some of the founders may have multiple
integrations for some of the transgenes. For example, 200 and 201 which are
offspring of
founder 166 appear to have different copy number for transgenes LC and 141,
and the same
copy number for transgene 213. One explanation could be that the 166 founder
has at least
two integration sites on different chromosomes, one containing only LC and 141
transgenes
and the other containing all three transgenes. 200 would have inherited both
integration
sites whereas 201 may have inherited only the site with all the transgenes
(other scenarios
are also possible). Multiple integrations are difficult to identify by
Southern blot analysis,
especially when 3 different transgenes are involved. However, in large animals
our use of
FISH (fluorescence in situ hybridization) and karyotyping permits to sort out
multiple
integration situations.
In summary, 2 founders (5, 76) passed double transgene integrations (LC and
213)
to their offspring, and 6 lines (25, 67, 89, 106, 152, and 166) passed all
three transgenes to
the next generation. Another founder, 128 was doubly transgenic for LC and
213, had a
transgenic offspring (232). However this offspring was not analyzed (it was
born later due
to delays in breeding 128). That line was not pursued further since protein
analysis of 128
milk showed no significant production of the fusion-protein.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-43-
Table 2. Breeding of transgenic founders. All offspring were analyzed with the
insulator PCR-assay
Founder PCR positive ID number
(sex) offspring/litterof
(only femalesselected F
were analyzed)1
transgenic
females
(F) 2/10 217,219
25 (F) 1/7 204
67(M) -- 1/3 177
76(F) 1/6 212
89(F) 2/5 178, 179
106(M) 1 /5 186
121 (M) - 0/5 None
128(F) 1/8 232
152(M) 2%4 194, 195
166(F) 2/6 200, 201
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-44-
Table 3: Summary of Southern hybridization data from Beta-casein - F(ab')2-
enzyme
fusion protein transgenic Fl. Copy number was roughly evaluated by comparison
to signal
obtained with know amount of EcoRI digested microinjection fragment (und. Is
undetectable by Southern).
S
Founder Transgenic Lc Transgene141 Transgene213 Transgene
Parent F1 Copy # Copy # Copy #
217, 219 2 0 2
25 204 3 3 33-4
67 177 1 1-2? - 1-2?
76 212 2 0 2
89 178, 179 > 10 > 10 > 10
106 186 3 3-4 2-3
152 194, 195 4-5 4 4-5
166 200, 201 1 (200 1 (200 4-5
3-4 (201) 4 (200) (Both 200
and
201 )
Analysis of transgenic mouse milk samples:
Mouse milk samples were collected from founder females as well as from F1
transgenic females. It was decided not to dilute the milk with PBS, to avoid
possible
interference with the enzymatic assays. Samples were frozen at -20°C
until testing. Assays
are summarized below as Table 4.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-45-
Table 4: Summary of ELISA and activity assays performed on the milk of mice
expressing
a humanized antibody fragment - enzyme fusion protein (Fab')2-CPB). (NA, not
applicable)
Founder (sex, F1 (transgenes)ELISA levels Enzyme assay
Transgenes) (mg/ml) (mg/ml)
(F, LC-213)
0.092 0.025
217, 219 (LC-213)low low
25 (F, LC-213-141) 1.5* 1.2*
204 (LC-213-141)1.5 - 2 1.5 - 2
67 (M, LC-213-141) NA NA
177 (LC-213-141)Negative negative
76 (F, LC-213) negative negative
212 (LC-213) negative negative
89 (F, LC-213-141) 1.5 - 2 1.5 -2
178, 179 (LC-213-1.5 - 2 1.5 - 2
141)
106 (M, LC-213- NA NA
141) 186 (LC-213-141)4 - 6 4 - 6
128 (F, LC-213) low low
152 (M, LC-213- NA NA
141) 195 (LC-213-141)4 - 6 4 - 6
166 (F, LC-213-141) negative negative
200, 201 (LC-213-negative negative
141)
*Assays performed on milk collected on the second lactation of the 25
consistently gave
higher values
Constructs linking the Goat Beta Casein regulatory sequences to coding region
of
the light and heavy chains of humanized anti-CEA F(ab')2, 806.077 fused to a
modified
human carboxypeptidase B enzyme, and to the coding region of the pro-domain of
CPB
(with C-terminal leucine) were generated. Transgenic mouse lines were
generated with and
without the transgene expressing the CPB pro-domain. It was demonstrated that
mice
transgenic for all 3 constructs are capable of producing the (Fab')2-CPB
fusion at high
levels (up to 4 - 6 mg/ml) in the milk of transgenic mice (4/6 triple
transgenic lines
expressed at levels superior to 1 mg/ml), with expected enzymatic activity.
However, the
absence of CPB pro-domain expression seems to correlate with low level
secretion of the
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-46-
active fusion protein. However this result has to be considered with caution
since only 3
double transgenic lines were analyzed (only 2 both founder and F1).
In summary, variants of human pancreatic carboxypeptidase B (HCPB), with
specificity for hydrolysis of C-terminal glutamic acid and aspartic acid, were
prepared by
site-directed mutagenesis of the human gene and expressed in the periplasm of
Escherichia
coli. By changing residues in the lining of the S 1' pocket of the enzyme, it
was possible to
reverse the substrate specificity to give variants able to hydrolyse prior to
C-terminal acidic
amino acid residues instead of the normal C-terminal basic residues. This was
achieved by
mutating Asp253 at the base of the S 1' specificity pocket, which normally
interacts with the
basic side-chain of the substrate, to either Lys or Arg. The resulting enzymes
had the
desired reversed polarity and enzyme activity was improved significantly with
further
mutations at residue 251. The [G251T,D253K]HCPB double mutant was 100 times
more
active against hippuryl-L-glutamic acid (hipp-Glu) as substrate than was the
single mutant.
[D253K]JCPB, Triple mutants, containing additional changes at A1a248, had
improved
activity against hipp-Glu subtrate when position 251 was Asn. These reversed
polarity
mutants of a human enzyme have the potential to be used in antibody-directed
enzyme
prodrug therapy of cancer.
EXAMPLE 2: Generation and Testing of Anti-Transferrin Receptor Antibody/
Angiogenin Fusion Constructs
This Examples shows expression of anti-transferrin receptor
antibody/angiogenin
fusion proteins in the mammary gland of transgenic mice. A chimeric
mouse/human
antibody directed against the human transferrin receptor (E6) was fused as its
CH2 domain
to the gene for a human angiogenic ribonuclease, angiogenin (Ang). It was
expressed in the
mammary gland of mice and secreted into mouse milk. Expression levels in milk
were
approximately 0.8 g/L. The chimeric protein retained antibody binding activity
and protein
synthesis inhibitory activity equivalent to that of free Ang. It was
specifically cytotoxic to
human tumor cells in vitro.
Materials and methods
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-47-
Trans~enic mice
Transgenic mice were generated following standard published procedures
(Roberts
et al., 1992; DiTullio et al., 1992; Gutierrez et al., 1996). Founder mice
were bred to
produce lactating females and the milk collected and diluted with an equal
volume of
phosphate buffered saline as previously described. Milk was stored at -70 C.
Fractionation of milk
Milk containing E6 IG antibody was applied to a Protein A Sepharose column and
eluted with O.1M glycine. pH 3.0 into tubes containing IM Tris based to adjust
pH to
neutrality. Milk containing the fusion protein (CH2Ang) was made 0.2 M EDTA
and
incubated on ice for 20 min before centrifugation for 10 min at 4 C in an
eppifuge. The
skim milk was removed carefully from the fat layer and centrifuged again
before
purification by size exclusion high performance liquid chromatography on a TSK
3000
column (Toso Haas Corp., PA) equilibrated and eluted with 0.1 M phosphate
buffer, pH 7.4.
The flow rate was 0.5 ml/min and 1 min fractions were collected. the majority
of material
reacting with an antibody against angiogenin eluted in the void volume of the
column. This
material was pooled and arginine powder was added to a final concentration of
1 M. After
an overnight incubation at 4 C, the sample was re-chromatographed on the TSK
3000
column as described above. CH2Ang containing milk required a second treatment
with 1 M
arginine and re=chromatography on the sizing column.
Protein determination
Protein was determined using the following extinction coefficients: E6 IgG
antibody, E1%/280nm = 14.0; CH2Ang, E1%/280nm = 10Ø
Protein synthesis assay
Cells were plated at 2500 cells per well in 96-well microtiter plates in
Dulbecco's
minimum essential medium supplemented with 10% fetal bovine serum. Additions
were
made in a total volume of 10 pL, and the plates were incubated at 37 C for 3
days before 0.1
mCi of [14C]-leucine was added for 2-4 h. Cells were harvested onto glass
fiber filters
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-48-
using a PHD cell harvester, washed with water, dried with ethanol and counted.
The results
are expressed a percent of [ 14C]-leucine incorporation in mock-treated wells.
EXAMPLE 3: Expression of an Antihuman Transferrin Receptor Antibody and
Antibody-Angiogenin Fusion Protein in the Milk of Transgenic Mice
The DNA constructs used to produce the transgenic mice are illustrated in
Figure 1
and Fig. 2A. The chimeric antitransferin receptor antibody used in the studies
described
was originally fused to human tumor necrosis factor (Hoogenboom et al., 1991)
and then to
human ribonuclease, angiogenin (Ang, Rybak, et al., 1992). The Ang gene was
fused
behind the first three amino acid residues of 5' region of the CHZ domain of
the antibody,
thus leaving the hinge region unaffected and dimeriaation of the heavy chain
possible. The
goal was to create humanized immunotoxin-like proteins that might elicit less
immunogemc
side effects when administered to patients. The in vivo mammalian cell
expression systems
yielded very little material functional studies, especially when the antibody
was fused to the
human Rnase, angiogenin (Ang) Ang is a member of the RNase A superfamily. All
members of this superfamily are small (12-l4kDa). basic ribonucleolyutic
enzymes found
in the pancreas as well as other organs. Fluid and tissues of mammals and
amphibians.
Though these RNase can leave RNA physiological actions e.g. eliciting
angiogenesis, host
defense actions and antiviral effects have been described for various RNase
members.
Because RNases might be part of a natural defense system they have been used
to create
chemical conjugates and recombinant fusion protein with a variety of
antibodies. Since
those studies indicate that RNase based therapeutic may have potential for the
treatment of
cancer and AmS, the original RNase work with the chimeric antibody against the
human
transferrin receptor was re-explored using newly developed technology for the
production
of complex proteins in the milk transgenic animals. The molecular details of
the genetic
constructs used in these studies are shown above. The Roman numerals
correspond to those
shown in Fig.2 panel A and expand on the DNAs cloned between exons 2 and 7 of
the goat
13-casein gene.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
- 49 -
DNA encoding the entire heavy chain of the E6 antibody, a chimeric antibody
against the human transferrin receptor (Hoogenboom et al., 1990) was used
between exons
2 and 7 of a modified goat J3-casein gene (Fig. 2A, I) that is expressed at
high levels in the
milk of lactating transgenic mice (Roberts et al., 1992). A second transgene
encoding an
antibody-enzyme fusion was prepared by linking the gene for the human RNase,
angiogenin
(Ang) to the CH2 domain of the antibody (Fig. l and Fig. 2A, II). Those genes
as well as
the gene encoding the light chain of the same antibody (Fig. 2A, III) were all
cloned
separately, and the appropriate pairs (heavy (H) and light (L) chains; CH2Ang
and L chain)
were purified free of procaryotic DNA and co-injected into mouse embryos that
were
reimplanted using standard methods (Roberts et al., 1992). Transgenic mice
were identified
by PCR and southern blot analysis of DNA obtained from tails of the resulting
progeny.
Founder mice were bred to produce lactating transgenic females. Milk was
collected, diluted with PBS and analyzed for the presence of the antibody
chains and Ang.
Polyclonal antibodies raised against human Ang only reacted with a band of the
expected M
(43 kDa; antibody heavy chain, 29 kDA; Ang, 14 kDA) in the fusion protein
(Fig. 2B, left
panel). However, anti-IgG antisera strongly reacted with both the H and L
chains of the
chimeric E6 antibody (Fig. 2B, right panel). Whereas the L chain of the
antibody fusion
protein was clearly observed with the anti-IgG antisera, the truncated H chain
of CH2Ang
was barely detectable suggesting that the fusion of angiogenin to the CH2
domain hindered
binding of the antisera to the H chain.
The chimeric IgG antibody was purified by chromatography on Protein A
Sepharose. As shown in Fig. 2C, lanes 1 and 2, Western analysis of the final
purified
product by gel electrophoresis under reducing conditions showed the presence
of light (28
kDa) and heavy chain proteins (approximately 55 kDa). Western analysis under
non-
reducing conditions (Fig. 2C, lane 3) demonstrated that the transgenic
antibody existed as a
mixture of IgG and Fab forms (168 and 84 kDa, respectively). A small amount of
free
heavy chain (55 kDa) was also seen.
Milk containing the CH2Ang fusion protein was similarly collected and diluted
with
PBS. Protein A Sepharose failed to bind the angiogenin fusion protein.
Analogous results
were obtained when the same CH2 antibody fragment previously was fused to TNF
and it
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-50-
was postulated that this was due to the deletion of the Protein A binding site
believed to be
near the CH2-CH3 junction (Hoogenboom et al., 1991). The nature of the
transgenic
antibody-Ang fusion protein was determined by Western blotting. After
reduction of the
interchain disulfide bonds, the H chain Ang fusion (43 kDA) and light chain
(28 kDA) were
dissociated (Fig. 2C, lane 2). Western analysis with an anti-IgG antibody
under non-
reducing conditions (Fig. 2C, lane 5) demonstrated that the transgenic
antibody-enzyme
fusion protein existed as a mixture of F(ab)2 and Fab forms (142 and 71 kDa,
respectively).
Identical results were obtained when the analysis was performed with anti-Ang
antisera (not
shown). Taken together the latter results demonstrate that the light chain is
associated with
the heavy chain-Ang fusion.
EXAMPLE 4: Biological characterization of antibody-angiogenin fusion protein
Angiogenin is a potent inhibitor of the translational capacity of the
rabbiteticulocyte
lysate by a mechanism that depends upon its ribonucleoytic activity (St. Clair
et al., 1987).
1 S Fig. 2 shows that the addition of Ang or CH2Ang to the lysate caused the
inhibition of
protein synthesis as measured by the incorporation of [35S]methionine into
acid-
precipitable protein. The ICSOS(40 nM) of unfused Ang or CH2Ang were
indistinguishable
in this assay indicating that the conformation of the active site residues was
not affected by
fusing Ang in this orientation (NH2-terminus) to the CH2 antibody domain.
The antibody potion of the fusion protein was characterized by competition
binding
experiments (Table 5). Binding of milk-derived E6 antibody (IgG) to the human
transferrin
receptor was tested and compared to that of the same antibody originally
purified from
hybridoma cells (Heyligen et al., 1985). The ability of both antibodies to
displace the
[1251]labeled parental antibody was identical (50% displacement by either
antibody was 0.8
nM). the CH2Ang fusion protein was 175 fold less active than the E6 intact
antibody ( 140
nM CH2Ang versus 0.8 nM E6).
The cytotoxic effects of the Ang fusion protein on human tumor cells was
assessed
by measuring [14C]leucine incorporation into newly synthesized proteins.
Typical dose
response curves are depicted in Fig. 3. CH2Ang inhibited the protein synthesis
of SFS39
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-51-
human glioma cells and MDA-MB-231mdr1 breast cancer cells with ICSpS of 15 and
45
nM, respectively. Cytoxicity on other human tumor cell lines is compared in
Table II. The
ICSOS ranged from 15 to 70 nM. Cytotoxicity was specific to the fusion protein
since no
activity was observed on an antigen negative cell line (mouse NIH3T3 cells,
data not
shown) and a five fold molar excess of the unfused chimeric antibody reversed
cytotoxicity
by approximately 50%. Whereas CH2Ang inhibited protein synthesis to 99% of
mock
treated cells, protein synthesis was decreased to 45% of mock treated cells in
the presence
of a 5 fold molar excess of antibody. Since neither the unfused antibody
(Rybak et al.,
1992) or free Ang (Newton et al., 1996) are cytotoxic, the two domains in the
fusion
proteins must be covalently joined to elicit cytotoxic, the two domains in the
fusion proteins
must be covalently joined to elicit cytotoxicity.
Angiogenin was isolated from tumor cell conditioned medium by following
angiogenic activity in the chicken embryo chorioallantoic membrane and rabbit
corneal
assays (Fett et al., 1985). Its homology to ribonuclease and distinctive
nucleolytic activity
(Shapiro et al., 1986) coupled to its angiogenic activity yield unique
biological properties
that may promote enhanced tumor cell killing when Ang is targeted to tumor
cells with cell
specific targeting agents. Angiogenic activity is maintained when Ang is
expressed as a
fusion protein (Newton et al., 1996). Angiogenin also binds a cell surface
proteoglycan on
human colon carcinoma cells (Soncin et al., 1994). Accordingly, localization
to tumor sites
by the antibody could be increased by the tumor cell binding properties of Ang
while
increased angiogenesis could conceivable aid tumor penetration by increasing
tumor
vascularization (Newton et al., 1996). Moreover antagonists of Ang prevent
tumor growth
(Piccoli et al., 1998; Olson et al., 1995). Thus Ang activities are
pleiotropic; their
manifestation is governed by the cellular milieu to which Ang is exposed e.g.,
targeting the
cytosolic protein synthesis machinery causes cytoxicity (St. Clair et al.,
1987; Rybak et al.,
1991) while endocytosis and translocation of Ang to the nucleus in endothelial
cells has
been reported to elicit angiogenesis (Moroianu and Riordan, 1994). These
biological
properties of Ang afford unique opportunities to design both cytostatic
(antiangiogenic) and
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-52-
cytotoxic (antitumor cell) therapeutic strategies by antagonizing or
specifically targeting
this protein, respectively.
The realization of human enzyme-based mufti-domain targeted therapeutics for
cancer (Rybak et al., 1991; Rybak et al., 1992; Newton et al., 1992; Newton et
al., 1994;
Newton et al., 1996; Jinno et al., 1996; Zewe et al., 1997; Deonarain &
Epenetos, 1998) and
cardiovascular disease (Haber, 1994; Collen, 1997) depends on developing
expression
systems capable of producing these reagents for preclinical characterization
and eventual
clinical use. Expression of a two chain antibody Ang fusion protein in the
milk of
transgenic mice was accomplished and presented in this study. It was not
obvious that Ang
could be successfully expressed as a fusion protein in transgenic mice because
a similar
fusion protein was expressed only at very low levels from cultured myeloma
cells
presumably due to retrograde transport during secretion leading to the
selection of low
producers (Rybak et al., 1992). Remarkably, in the natural environment of the
mammary
gland the efficiency of expression was increased 160,000 times over the cell
culture system
(0.8 g/L vs. 5 ~g/L in milk and myeloma cells, respectively). Thus, it was
possible to purify
sufficient amounts of the Ang fusion protein for biological characterization.
One of the
consequences of this work is that the importance of the orientation of Ang in
a fusion
protein is demonstrated for the first time. In single chain antibody Ang
fusion proteins Ang
was fused at the C-terminus to the N-terminus of the antibody (Newton et al.,
1996).
Subsequently, it became known that the last three amino acid residues of the C-
terminal
region of Ang contribute an active center subsite (Russo et al., 1996).
Whereas Ang in the
CH2 fusion protein and free Ang were equipotent in the rabbit reticulocyte
lysate assay,
Ang in a single chain fusion protein was two fold less effective than Free Ang
to inhibit
protein synthesis in the lysate assay (Newton et al., 1996).
This is the first demonstration, in general, that antibody-enzyme fusion
proteins can
be expressed at high levels in the mammary gland. In particular, the
demonstration that
antibody-Ang fusions can be expressed in the mammary gland has implications of
the
development of transgenic mouse models for breast cancer. Promoters from other
milk
specific genes have been used to cause the expression of transgenes during
lactation
imitating the onset of neoplasias (Amundadottier et al., 1996). Since the
results of the
CA 02382725 2002-03-12
WO 01/19846 PCT/iJS00/25560
-53-
present study show that a milk specific promoter can induce expression of an
active
immunotoxin, double transgenic strains could be developed to test whether the
expression
of an Ang fusion protein targeted against the engineered neoplasia could
prevent or alter the
progression of the disease. These results are especially relevant to Ang since
marine
counterparts are available (Bond et al., 1993).
In summary, these results demonstrate for the first time that complex
heterologous
fusion proteins can be expressed in the mammary gland of mice in larger
amounts and with
superior biological properties than mammalian cell culture (Rybak et al.,
1992) and E. coli
expression systems (Newton et al., 1996). The results impact both the
possibility of
producing these fusion proteins as therapeutics as well as the possibility of
creating new
animal models for breast cancer.
The following abbreviations are used herein Ang. human angiogenin; E6, anti-
transferrin receptor IgG monolonal antibody; RNase, ribonuclease; H chain
heavy chain; L
chain, light chain: CH2Ang, angiogenin fused to the CH2 domain of the E6 heavy
chain;
IC50~ the concentration of fusion protein which inhibits protein synthesis by
50%.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-54-
Table 5
Binding of E6 and Ang fusion proteins to human transferrin receptor
S Construct Source Binding Bold Difference
ECSOW)
E6 hybridoma 0.8 1
E6 milk 0.8 1
CH2aNG MILK 140 175
Table II
Cytoxicity of Ch2Ang
Cell Line CH2Ang
Ic50~~)
As539 15
HS578T 70
MDAOMB-23 mdr 45
MALME 40
ACHN 30
Example 7: Generation and Characterization of Transgenic Goats
The sections outlined below briefly describe the major steps in the production
of
transgenic goats.
Goat Species and breeds:
Swiss-origin goats, e.g., the Alpine, Saanen, and Toggenburg breeds, are
preferred
in the production of transgenic goats.
Goat superovulation:
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-SS-
The timing of estrus in the donors is synchronized on Day 0 by 6 mg
subcutaneous
norgestomet ear implants (Syncromate-B, CEVA Laboratories, Inc., Overland
Park, KS).
Prostaglandin is administered after the first seven to nine days to shut down
the endogenous
synthesis of progesterone. Starting on Day 13 after insertion of the implant,
a total of 18 mg
of follicle-stimulating hormone (FSH - Schering Corp., Kenilworth, NJ) is
given
intramuscularly over three days in twice-daily injections. The implant is
removed on Day
14. Twenty-four hours following implant removal the donor animals are mated
several
times to fertile males over a two-day period (Selgrath, et al.,
Theriogenology, 1990. pp.
1195-1205).
Embryo collection:
Surgery for embryo collection occurs on the second day following breeding (or
72
hours following implant removal). Superovulated does are removed from food and
water
36 hours prior to surgery. Does are administered 0.8 mg/kg Diazepam (Valium~)
IV,
followed immediately by 5.0 mg/kg Ketamine (Keteset), IV. Halothane (2.5%) is
administered during surgery in 2 L/min oxygen via an endotracheal tube. The
reproductive
tract is exteriorized through a midline laparotomy incision. Corpora lutes,
unruptured
follicles greater than 6 mm in diameter, and ovarian cysts are counted to
evaluate
superovulation results and to predict the number of embryos that should be
collected by
oviductal flushing. A cannula is placed in the ostium of the oviduct and held
in place with a
single temporary ligature of 3.0 Prolene. A 20 gauge needle is placed in the
uterus
approximately 0.5 cm from the uterotubal junction. Ten to twenty ml of sterile
phosphate
buffered saline (PBS) is flushed through the cannulated oviduct and collected
in a Petri dish.
This procedure is repeated on the opposite side and then the reproductive
tract is replaced in
the abdomen. Before closure, 10-20 ml of a sterile saline glycerol solution is
poured into
the abdominal cavity to prevent adhesions. The lines albs is closed with
simple interrupted
sutures of 2.0 Polydioxanone or Supramid and the skin closed with sterile
wound clips.
Fertilized goat eggs are collected from the PBS oviductal flushings on a
stereomicroscope, and are then washed in Ham's F12 medium (Sigma, St. Louis,
MO)
containing 10% fetal bovine serum (FBS) purchased from Sigma. In cases where
the
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-56-
pronuclei are visible, the embryos is immediately microinjected. If pronuclei
are not
visible, the embryos can be placed in Ham's F12 containing 10% FBS for short
term culture
at 37°C in a humidified gas chamber containing 5% C02 in air until the
pronuclei become
visible (Selgrath, et al., Theriogenology, 1990. pp. 1195-1205).
Microinjection procedure:
One-cell goat embryos are placed in a microdrop of medium under oil on a glass
depression slide. Fertilized eggs having two visible pronuclei are immobilized
on a flame-
polished holding micropipet on a Zeiss upright microscope with a fixed stage
using
Normarski optics. A pronucleus is microinjected with the DNA construct of
interest, e.g., a
BC355 vector containing the human erythropoietin analog-human serum albumin
(immunoglobulin-enzyme-hSA) fusion protein gene operably linked to the
regulatory
elements of the goat beta-casein gene, in injection buffer (Tris-EDTA) using a
fine glass
microneedle (Selgrath, et al., Theriogenology, 1990: pp. 1195-1205).
Embryo development:
After microinjection, the surviving embryos are placed in a culture of Ham's
F12
containing 10% FBS and then incubated in a humidified gas chamber containing
5% C02 in
air at 37°C until the recipient animals are prepared for embryo
transfer (Selgrath, et al.,
Theriogenology, 1990. p. 1195-1205).
Preparation of recipients:
Estrus synchronization in recipient animals is induced by 6 mg norgestomet ear
implants (Syncromate-B). On Day 13 after insertion of the implant, the animals
are given a
single non-superovulatory injection (400 LU.) of pregnant mares serum
gonadotropin
(PMSG) obtained from Sigma. Recipient females are mated to vasectomized males
to
ensure estrus synchrony (Selgrath, et al., Theriogenology, 1990. pp. 1195-
1205).
Embryo Transfer:
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-57-
All embryos from one donor female are kept together and transferred to a
single
recipient when possible. The surgical procedure is identical to that outlined
for embryo
collection outlined above, except that the oviduct is not cannulated, and the
embryos are
transferred in a minimal volume of Ham's F12 containing 10% FBS into the
oviductal
lumen via the fimbria using a glass micropipet. Animals having more than six
to eight
ovulation points on the ovary are deemed unsuitable as recipients. Incision
closure and
post-operative care are the same as for donor animals (see, e.g., Selgrath, et
al.,
Theriogenology, 1990. pp. 1195-1205).
Monitoring of pregnancy and parturition:
Pregnancy is determined by ultrasonography 45 days after the first day of
standing
estrus. At Day 110 a second ultrasound exam is conducted to confirm pregnancy
and assess
fetal stress. At Day 130 the pregnant recipient doe is vaccinated with tetanus
toxoid and
Clostridium C&D. Selenium and vitamin E (Bo-Se) are given IM and Ivermectin
was given
SC. The does are moved to a clean stall on Day 145 and allowed to acclimatize
to this
environment prior to inducing labor on about Day 147. Parturition is induced
at Day 147
with 40 mg of PGF2a (Lutalyse~, Upjohn Company, Kalamazoo Michigan). This
injection
is given IM in two doses, one 20 mg dose followed by a 20 mg dose four hours
later. The
doe is under periodic observation during the day and evening following the
first injection of
Lutalyse~ on Day 147. Observations are increased to every 30 minutes beginning
on the
morning of the second day. Parturition occurred between 30 and 40 hours after
the first
injection. Following delivery the doe is milked to collect the colostrum and
passage of the
placenta is confirmed.
Verification of the transgenic nature of Fp animals:
To screen for transgenic FO animals, genomic DNA is isolated from two
different
cell lines to avoid missing any mosaic transgenics. A mosaic animal is defined
as any goat
that does not have at least one copy of the transgene in every cell.
Therefore, an ear tissue
sample (mesoderm) and blood sample are taken from a two day old Fp animal for
the
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-58-
isolation of genomic DNA (Lacy, et al., A Laboratory Manual, 1986, Cold
Springs Harbor,
NY; and Hemnann and Frischauf, Methods Enzymology, 1987. 152: pp. 180-183).
The
DNA samples are analyzed by the polymerise chain reaction (Gould, et al.,
Proc. Natl.
Acid. Sci, 1989. 86:pp. 1934-1938) using primers specific for human
immunoglobulin-
enzyme-hSA fusion protein gene and by Southern blot analysis (Thomas, Proc
Natl. Acid.
Sci., 1980. 77:5201-5205) using a random primed IMMUNOGLOBULIN-ENZYME or
hSA cDNA probe (Feinberg and Vogelstein, Anal. Bioc., 1983. 132: pp. 6-13).
Assay
sensitivity is estimated to be the detection of one copy of the transgene in
10% of the
somatic cells.
Generation and Selection of production herd
The procedures described above can be used for production of transgenic
founder
(Fp) goats, as well as other transgenic goats. The transgenic FO founder
goats, for example,
are bred to produce milk, if female, or to produce a transgenic female
offspring if it is a
male founder. This transgenic founder male, can be bred to non-transgenic
females, to
produce transgenic female offspring.
Transmission of transgene and pertinent characteristics
Transmission of the transgene of interest, in the goat line is analyzed in ear
tissue
and blood by PCR and Southern blot analysis. For example, Southern blot
analysis of the
founder male and the three transgenic offspring shows no rearrangement or
change in the
copy number between generations. The Southern blots are probed with
immunoglobulin-
enzyme fusion protein cDNA probe. The blots are analyzed on a Betascope 603
and copy
number determined by comparison of the transgene to the goat beta casein
endogenous
gene.
Evaluation of expression levels
The expression level of the transgenic protein, in the milk of transgenic
animals, is
determined using enzymatic assays or Western blots.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-59-
Additional list of references:
Maniatis, T., Fritsch, E. F., and Sambrook, J. 1983. Molecular Cloning, A
Laboratory Manual.
Cold Spring Harbor, New York: Cold Spring Harbor Laboratory
Amudadottir, L.T. Merlino., and Dickson, R.B. (1996) Transgenic mouse models
of breast
cancer, Breast Can. Res. and Treatment 39, 119.
Bond, M.D., Strydom, D.J. and Vallee, B.L. (1993) Characterization and
sequencing of
rabbit pig and mouse angiogenins; discernment of functionally important
residues and
regions. Biochems Biophys, Acta 1162.177.
Bosslet, K., Czech J., Lorenz P., Sedlacek, H.H., Schuermann, M., and Seemann.
G. (1992)
Molecular and functional characterization of a fusion protein suited for timer
specific
prodrug activation. Br.J. Cancer 65,234.
Castilla, J., Pintado, B. Sola, L, Sanchez-Morgado, J.M. and Enjuanes, L.
(1998)
Engineering passive immunity in transgenic mice secreting virus-neutralizing
antibodies in
milk. Nature Biotechnology 16, 349.
Clark A. (1997) Gene expression in the mammary glands of transgenic animals.
Biochem.
Soc. Symp. 63, 133.
Collen, D. (1997) Thrombolytic Therapy. Thrombosis and Haemostasis 78.742.
Colman, A. ( 1996) Production of proteins of proteins in the milk of
transgenic livestocks;
problems, solutions and success. Am. J. clin. Nutr. 63, 639S.
Deonarain, M.P. and Epenetos, A.A. (1998) Design, characterization and
antitumor
cytoxicity of a panel or recombinant, mammalian ribonuclease-based
immunotoxins Br. J.
Cancer 77,537.
DiTullio, P. Cheng S.H. Marshall, J. Gregory, R.J. Ebert, K.M. Meade H.M. and
Smith,
A.E. ( 1992) Production of cystic fibrosis transmembrane conductance regulator
in the milk
of transgenic mice. Bio/Technology 10,74.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-60-
Fett, J.W., Strydom, D.J. Lobb, R.R., Alderman, E.M. Bethune, J.L. Riodan,J.F.
and Vallee,
B.L. (1985) Isolation and characterization of angiogenin an angiogenic protein
form human
carcinoma cells. Biochemistry 24,5480.
Goshom, S.C. Svensson, H.P. Kerr, D.E. Somerville, J.E. Senter, P.D. and Fell,
H.P. (1993)
Genetic construction, expression and characterization of a single chain anti-
carcinoma
antibody fused to B-lactamase, cancer Res. 53,2123.
Gutierrez., A., Meade, H.M.., DiTuillio, P. Pollock,D., Harvey, M. Jimenez-
Flores, R.
Anderson, G. Murray, J., and Medrano, J. ( 1996) Expression of a bovine kappa
CN cDNA
in the mammary gland of transgenic mice utilizing a genomic milk protein gene
as an
expression cassette, Transgenic Res.S, 271.
Haber, E. (1994) Antibody-plasminogen activator conjugates and recombinant
proteins. .
methods in Mol.Genet,5,111.
Heyligen, H., Thijs,C., Weber,W., Bosmans, E., and Raus, J. (1985) Monoclonal
antibodies
detecting human T cell activation antigens; development of monoclonal
antibodies and
expression of antigens on activated T cells and leukemic cells. Fed. Proc,
44,787.
Hoogenboom, H.R. raus, J.C.M., and Volckaert, G. (1990) Cloning and expression
of a
chimeric antibody directed against the human transferrin receptor.J. Immunol.
144,3211.
Hoogenboom, H.E. Volckaert, G., and Raus, J.C.M. (1991) Construction and
expression of
antibody-tumor necrosis factor fusion proteins. Mol. immunol. 28, 1027.
Jinno, H., Ueda, M., Ozawa, S., Kikuchi, K., Ikeda, T., Enomoto, K, and
Kitajima, M.
( 1996) Epidermal growth factor receptor dependent cytotoxic effect by an
effect by an EGF-
ribonuclease conjugate on human cancer cell lines: a trial for less immongenic
chimeric
toxin. Can. Cheomoter. Pharmacol 38,303.
Limonta, J., Pedraza, A., Rodriquez, A., Grehre, F.M., Barral, A.M., Castro,
F.O. Lleonart,
R., Gracia, C.A. Gavilondo,J.V., and DelaFuente, J. (1995) Production of
active auto-CD6
mouse/human chimeric antibodies in the milk transgenic mice. Immontechnology
1.107.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-61 -
Maga, E., and Murray J. (1995) Mammary gland expression of transgenes and the
potential
for altering the properties of milk. Bio/Technology 13,1452.
S Moroninau, J., and Riordan, J.F. (1994) Nuclear translocation of angiogenin
in proliferating
endothelial cells is essential to its angiogenic activity. Proc. Natl. Acad,
Sci U.S.A. 91,
1677.
Newton, D.K. Illercil, O. Laske, D.W., Oldfield, E., Rybak, S.M. and Youle,
R.J. (1992)
Cytoxic ribonuclease chimeras: Targeted tumoricidal activity in vivo and in
vivo. J. Biol,
Chem. 267,19572.
Newton, D.L. Nicholls, P.J., Rybak, S.M. and Youle, R.J. (1994) Express on and
characterization of recombinant human eosinophil-derived neurotoxin and
eosinophil-
derived neurotoxin-anti=transferrin receptor sFv. J. Biol. Chem 269, 26739.
Newton, D.L., Xue, Y., Olson, K.A., Fett, J.W., and Rybak, S.M. (1996)
Angiogenin single
chain imminofusions; Influence of peptide linkers and spacer between fusion
proteins
domains Biochemistry 35,545.
Olson, K.A., Fett, J.W. Grench, T.C., Key M.E., and Vallee, B.L. (1995)
Angiogenin
antagonists prevent tumor growth in vivo. Prox. Natl. Acad. Sci. U.S.A. 92,
442.
Pastan, I. (1997) Targeted therapy of cancer with recombinant immunotoxins.
Biochim
Biophys Acta 1333, Cl.
Piccoli, R., Olson, K.A. Vallee, B.L., and Fett, J.W. (1998) Chimeric anti-
angiogenin
antibody cAB 26-2F inhibits the formation of human breast cancer xenografts in
a hymic
mice. Proc. Natl. Acad, Sci, U.S.A. 95, 4579.
Roberts, B., DiTullio, P. Vitale, J., Hehir, K., and Gordon, K. (1992) Cloning
of the goat 13
casein-encoding gene and expression in transgenic mice Gene 121,255.
Rodriguez, M.L. Presta, L.G., Kotts, C.E., Wirth, C. Mordenti, J., Isaka, G.
Wong, W.L. T.,
Nuijens, A. Blackburn, B., and Carter, P. (1995) Development of a humanized
disulfide
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-62-
stabilized auto-p185 HER2 Rv-13 Lactamase fusion protein for activation of a
cephalosporin
doxorubiein prodrug. Cancer Res. 55, 63.
Russo,N., Nobile,V., DiDonato, A., Riordan, J.F. and Valee, B.L. (1996) The C-
terminal
93,3243.
Rybak, S.M., Hoogenboom, H.R. meade, H.M., Raus, j.C. Schwartz, D., and Youle,
R.J.
(1992) humanization of immunotoxins. Proc. Natl. Acad. Scu USA 89, 3165.
Rybak, S.M., newton, D.L. and Xue, y. (1995) RNase immunofusions for cancer
therapy.
Tumor Targeting 1,141.
Rybak, S.M., Saxena, S.K., Ackerman, E.J. youle, R.J. (1991) Cytotoxic
potential of
ribonuclease and ribonuclease hybrid proteins. J. Biol. Chem 266, 21202.
Schein, C.H, (1997) From housekeeper to microsurgeon: The diagnostic and
therapeutic
potential of ribonuclease. Nature Biochemistry 1 S, 529.
Shapiro, R. Riordan, J.F. and Vallee, B.L. (1986) Characteristic ribonuclolyt
c activity of
human angiogenin. Biochemistry 25, 3527.
Siemens, N.O. Kerr, D/E/. Arnold, S. Stebbins, M.R. Vrudhula, V.M., Hellstrom,
J.
Hellstrom, K.E. and Senter, P.D. (1997) Construction, expression and
activities ofL49-sFv-
13-Lactamse, a single-chain antibody fusion protein for anticancer prodrug
activation.
Bioconjugate Chem., 8, 510.
Sola, L, Castilla, J. Pintado, B., Sanchez-Morgado, J.M. Whitelaw, B.A. Clark,
A.J., and
Enjuanes, L. (1998) Transgenic mice secreting conornvirus neutralizing
antibodies into the
mile.J.Virol, 72,3762.
Soncin, F. Sharpiro, R., and Fett, J.W. (19940 A cell-surface proteoglycan
mediates human
adenocarcinoma HT-29 cell adhesion to human angiogenin. J. Biol. Chem,
269,8999.
CA 02382725 2002-03-12
WO 01/19846 PCT/US00/25560
-63-
St. Clair, D.K., Rybak, S.M. Riordan, J.F., and Vallee, B.L. (1987) Angiogenin
abolishes
cell-free protein synthesis by specific ribonuclolytic inactivation of
biosomes. Proc. Natl.
Acad. Sci. USA 84, 8330.
Strydom D.J. Fett, J.W. Lobb, R.R. Alderan, E.M. Bethune, J.L. Riordan, J.F.
and Vallee,
B.L. (1985) Amino acid sequence of human tumor derived angiogenin.
Biochemistry 24,
5486.
Thrush, G.R., Lark, L.R. Clinchy, B.C. and Vietta, E.S. (1996) Immunotoxins:
An Update
Ann. Rev. Immunol, 14,49.
Youle, R.J. Newton, D.L., Wu, Y.N. Gadina, M. and Rybak, S.M. (1993) Cytoxic
Ribonuclease and Shimeras in Cancer Therapy. Critical Reviews in Therapeutic
Drug
Carrier Systems 10,1.
Zewe, M. Rybak, S.M. Dubel, S., Coy, J.F. Welscholf, M., Newton, D.L. and
Little M.
(1997) Cloning and cytoxicity of human pancreatic RNase immunofusion.
Immnotechnology 3, 127.
Other embodiments are within the following claims.
