Note: Descriptions are shown in the official language in which they were submitted.
005050669 CA 02382845 2002-02-26
6
Fatty acid desaturase gene from plants
The present invention relates to a process for the preparation of
unsaturated or saturated fatty acids and a process for the
preparation of triglycerides with an increased content of
unsaturated or saturated fatty acids.
Moreover, the invention relates to a nucleic acid sequence; a
nucleic acid construct, a vector and organisms comprising at
least one nucleic acid sequence or one nucleic acid construct.
Furthermore, the invention relates to saturated or unsaturated
fatty acids and triglycerides with an increased content of
unsaturated or saturated fatty acids and their use.
Fatty acids and triglycerides have a multiplicity of applications
in the food industry, animal nutrition, cosmetics and in the
pharmaceutical sector. Depending on whether they are free
saturated or unsaturated fatty acids or triglycerides with an
increased content of saturated or unsaturated fatty acids, they
are suitable for a very wide range of applications; thus, for
example, polyunsaturated fatty acids are added to baby formula to
increase the nutritional value. The various fatty acids and
triglycerides are obtained mainly from microorganisms such as
Mortierella or from oil-producing plants such as soya, oilseed
rape, sunflowers and others, where they are usually obtained in
the form of their triacyl glycerides. Alternatively, they are
obtained advantageously from animals, such as fish. The free
fatty acids are prepared advantageously by hydrolysis.
Whether oils with unsaturated or with saturated fatty acids are
preferred depends on the intended purpose; thus, for example,
lipids with unsaturated fatty acids, specifically polyunsaturated
fatty acids, are preferred in human nutrition since they have a
Positive effect on the cholesterol level in the blood and thus on
the possibility of heart disease. They are used in a variety of
dietetic foodstuffs or medicaments.
Especially valuable and sought-after unsaturated fatty acids are
the so-called conjugated unsaturated fatty acids, such as
conjugated linoleic acid. A series of positive effects have been
found for conjugated fatty acids; thus, the administration of
conjugated linoleic acid reduces body fat in humans and animals,
and increases the conversion of feed into body weight in the case
of animals (WO 94/16690, WO 96/06605, WO 97/46230, WO 97/46118).
By administering conjugated linoleic acid, it is also possible to
positively affect, for example, allergies (WO 97/32008) or cancer
' 0050/50669 CA 02382845 2002-02-26
2
(Banni et al., CarcinogPnesis, Vol. 20, 1999: 1019 - 1024,
Thompson et al., Cancer, Fees., Vol. 57, 1997: 5067 - 5072).
The chemical preparation of conjugated fatty acids, for example
calendulic acid or conjugated linoleic acid, is described in
US 3,356,699 and US 4,164,505. Calendulic acid occurs naturally
in Calendula officinalis (U1'chenko et al., Chemistry of Natural
Compounds, 34, 1998: 272 - 274). Conjugated linoleic acid is
found, for example, in beef (Chin et al., Journal of Food
Composition and Analysis, 5, 1992: 185 - 197). Biochemical
studies into the synthesis of calendulic acid can be found in
Crombie et al., J. Chem. Soc. Chem. Common., 15, 1984: 953 - 955
and J. Chem. Soc. Perkin Trans., 1, 1985: 2425 - 2434.
Owing to their positive properties, there has been no lack of
attempts in the past to make available genes which participate in
the fatty acid or triglyceride synthesis for the production, in
various organisms, of oils with an altered content of unsaturated
fatty acids. Thus, WO 91/13972 and its US equivalent describe a
~-9-desaturase. WO 93/11245 claims a D-15-desaturase, WO 94/11516
a O-12-desaturase. 0-6-Desaturases are described in WO 93/06712
and WO 96/21022. Other desaturases are described, for example, in
EP-A-0 550 162, WO 94/18337, WO 97/30582, WO 97/21340, WO
95/18222, EP-A-0 794 250, Stukey et al., J. Biol. Chem., 265,
1990: 20144 - 20149, Wada et al., Nature 347, 1990: 200-203 or
. Huang et al., Lipids 34, 1999: 649 - 659. However, the
biochemical characterization of the various desaturases is as yet
only insufficient since the enzymes, being the membrane-bound
proteins, can only be isolated and characterized with great
difficulty (McKeon et al., Methods in Enzymol. 71, 1981: 12141 -
12147, Wang et al., Plant Physiol. Biochem., 26, 1988: 777 -
792).
In yeasts, bath a shift of the fatty acid spectrum toward
unsaturated fatty acids and an increase in productivity were
found (see Huang et al., Lipids 34, 1999: 649 - 659, Napier et
al., Biochem. J., Vol. 330, 1998: 611 - 614). However, the
expression of the various desaturases in transgenic plants did
not show the desired success. While it was possible to
demonstrate a shift of the fatty acid spectrum toward unsaturated
fatty acids, it emerged, simultaneously, that the synthetic
productivity of the transgenic plants suffered greatly, viz.
lesser amounts of oils were isolated compared with the starting
plants.
Thus, there remains a great need for new genes which encode
enzymes which participate in the biosynthesis of unsaturated
fatty acids and which allow the latter, specifically conjugated
' X050/50669 CA 02382845 2002-02-26
= 3
unsaturated fatty acids, to be synthesized and produced on an
industrial scale.
It is an object of the present invention to provide other
desaturases for the synthesis of unsaturated conjugated fatty
acids.
We have found that this object is achieved by an isolated nucleic
acid sequence which encodes a polypeptide with desaturase
activity, selected from the following group:
a) a nucleic acid sequence with the sequence shown in SEQ ID NO:
1,
b) nucleic acid sequences which, as a result of the degeneracy
of the genetic code, are derived from the nucleic acid
sequence shown in SEQ ID N0: 1,
c) derivatives of the nucleic acid sequence shown in SEQ ID N0:
1 which encode polypeptides with the amino acid sequences
shown in SEQ ID N0: 2 and which have at least 75~ homology at
amino acid level without substantially reducing the enzymatic
activity of the polypeptides.
A derivative (or derivatives) is/are to be understood as meaning,
for example, functional homologs of the enzyme encoded by SEQ ID
N0: 1 or its enzymatic activity, viz. enzymes which catalyze the
same enzymatic reactions as the enzyme encoded by SEQ ID N0:1.
These genes also allow an advantageous preparation of unsaturated
conjugated fatty acids. Unsaturated fatty acids are to be
understood, in the following text, as meaning mono- and
polyunsaturated fatty acids whose double bonds may be conjugated
or not conjugated. The sequence given in SEQ ID N0:1 encodes a
novel, unknown desaturase which participates in the synthesis of
calendulic acid in Calendula officinalis. The enzyme converts
(9Z,12Z)octadecadienoic/linoleic acid to (8E,10E,12Z)
octadecaconjutrienoic/calendulic acid. This is termed calendulic
acid desaturase hereinbelow.
The nucleic acid sequence according to the invention or its
fragments can be used advantageously for isolating further
genomic sequences by means of homology screening.
0050/50669 CA 02382845 2002-02-26
4
The abovementioned derivatives can be isolated, for example, from
other eukaryotic organisms such as plants like Calendula
stellata, Osteospermum spinescens or Osteospermum hyoseroides,
algae, protozoans such as dinoflagellates, or fungi.
Derivatives or functional derivatives of the sequence given in
SEQ ID No.1 are furthermore to be understood as meaning, for
example, allelic variants which have at least 75~ homology at the
derived amino acid level, preferably at least 80~ homology,
especially preferably at least 85~ homology, very especially
preferably 90~ homology. The homology was calculated over the
entire amino acid range. The program used was Pileup (J. Mol.
Evolution., 25 (1987), 351-360, Higgins et al., CABIOS, 5 1989:
151 - 153). The amino acid sequence derived from the
abovementioned nucleic acid can be seen from the sequence SEQ ID
No.2. Allelic variants encompass, in particular, functional
variants which can be obtained from the sequence shown in SEQ ID
No.1 by means of deletion, insertion or substitution of
nucleotides, the enzymatic activity of the derived synthetic
proteins being retained.
Such DNA sequences can be isolated from other eukaryotes as
mentioned above, starting from the DNA sequence described in SEQ
ID No. 1 or parts of these sequences, for example using customary
hybridization methods or the PCR technique. These DNA sequences
hybridize with the sequences mentioned under standard conditions.
It is advantageous to use, for the hybridization, short
oligonucleotides, for example from the conserved regions, which
can be determined by the skilled worker by comparison with other
desaturase genes.
Alternatively, it is possible to use longer fragments of the
nucleic acids according to the invention or the full sequences
for the hybridization. Depending on which nucleic acid:
oligonucleotide, longer fragment or full sequence, or depending
on which nucleic acid type, viz. DNA or RNA, is used for the
hybridization, these standard conditions vary. Thus, for example,
the melt temperatures for DNA:DNA hybrids are approximately 10°C
lower than those of equally long DNA: RNA hybrids.
Depending on the nucleic acid, standard conditions are understood
as meaning, for example, temperatures between 42 and 58°C in an
aqueous buffer solution with a concentration of between 0.1 and 5
x SSC (1 x SSC = 0.15 M NaCl, 15 mM sodium citrate, pH 7.2) or
additionally in the presence of 50~ formamide such as, for
example, 42°C in 5 x SSC, 50g formamide. The hybridization
conditions for DNA:DNA hybrids are advantageously 0.1 x SSC and
temperatures between approximately 20°C and 45°C, preferably
0050/50669 CA 02382845 2002-02-26
between approximately 30°C and 45°C. The hybridization
conditions
for DNA: RNA hybrids are advantageously 0.1 x SSC and temperatures
between approximately 30°C and 55°C, preferably between
approximately 45°C and 55°C. These temperatures which are
5 indicated for the hybridization are examples of calculated
melting point data for a nucleic acid with a length of approx.
100 nucleotides and a G + C content of 50g in the absence of
formamide. The experimental conditions for the DNA hybridization
are described in relevant genetics textbooks such as, for
example, by Sambrook et al., "Molecular Cloning", Cold Spring
Harbor Laboratory, 1989 and can be calculated using formulae
known to the skilled worker, for example as a function of the
length of the nucleic acids, the type of hybrid or the G + C
content. The skilled worker can find further information on
hybridization in the following textbooks: Ausubel et al. (eds),
1985, Current Protocols in Molecular Biology, John Wiley & Sons,
New York; Hames and Higgins (eds), 1985, Nucleic Acids
Hybridization: A Practical Approach, IRL Press at Oxford
University Press, Oxford; Brown (ed), 1991, Essential Molecular
Biology: A Practical Approach, IRL Press at Oxford University
Press, Oxford.
Derivatives are furthermore to be understood as meaning homologs
of the sequence SEQ ID No. l, for example eukaryotic homologs,
truncated sequences, simplex DNA of the coding and noncoding DNA
sequence or RNA of the coding and noncoding DNA sequence.
Homologs of the sequence SEQ ID No.1 are also to be understood as
meaning derivatives such as, for example, promoter variants.
These variants can be altered by one or more nucleotide
exchanges, by insertions) and/or deletion(s), without, however,
adversely affecting the functionality or efficacy of the
promoters. Moreover, it is possible to increase the efficacy of
the promoters by altering their sequence or to exchange them
Completely by more efficient promoters from other organisms,
including other species.
Derivatives are also advantageously to be understood as meaning
variants whose nucleotide sequence in the region -1 to -2000
upstream of the start codon was altered in such a way that gene
expression and/or protein expression is altered, preferably
increased. Moreover, derivatives are also to be understood as
meaning variants whose 3' end was altered.
T° achieve optimal expression of heterologous genes in organisms,
it is advantageous to alter the nucleic acid sequences in
accordance with the specific codon usage used. in the organism.
0~5~~50669 CA 02382845 2002-02-26
6
The codon usage can be determined readily by using computer
evaluations of other, known genes of the organism in question.
The calendulic acid desaturase gene can be combined
advantageously in the process according to the invention with
other fatty acid biosynthesis genes.
The amino acid sequences according to the invention are to be
understood as meaning proteins which contain an amino acid
sequence shown in SEQ ID N0: 2 or a sequence obtainable therefrom
by the substitution, inversion, insertion or deletion of one or
more amino acid residues, the enzymatic activity of the protein
shown in SEQ ID N0: 2 being retained or not reduced
substantially. The term not reduced substantially is to be
understood as meaning all enzymes which still have at least 10~,
preferably 20~, especially preferably 30~ of the enzymatic
activity of the starting enzyme. For example, certain amino acids
may be replaced by others with similar physico-chemical
properties (spatial dimension, basicity, hydrophobicity and the
like). For example, arginine residues are exchanged for lysine
residues, valine residues for isoleucine residues or aspartic
acid residues for glutamic acid residues. Alternatively, it is
possible to exchange the sequence of, add or remove one or more
amino acids, or two or more of these measures may be combined
with each other.
The nucleic acid construct or nucleic acid fragment according to
the invention is to be understood as meaning the sequence given
in SEQ ID NO: 1, sequences which are the result of the genetic
code and/or their functional or nonfunctional derivatives, all of
which have been linked functionally to one or more regulatory
signals, advantageously for increasing gene expression. These
regulatory sequences are, for example, sequences to which
inductors or repressors bind and thus regulate the expression of
the nucleic acid. In addition to these novel regulatory
sequences, or instead of these sequences, the natural regulation
of these sequences upstream of the actual structural genes may
still be present and, if desired, may have been genetically
altered in such a way that the natural regulation has been
switched off and the expression of the genes increased. However,
the expression of the gene construct may also have a simpler
structure, viz. no additional regulatory signals have been
inserted upstream of the sequence or its derivatives and the
natural promoter with its regulation has not been removed.
Instead, the natural regulatory sequence has been mutated in such
a way that regulation no longer takes place and gene expression
is increased. These altered promoters may also be placed upstream
of the natural gene on their own, in order to increase activity.
005~~50669 CA 02382845 2002-02-26
In addition, the gene construct can also advantageously contain
one or more so-called enhancer sequences functionally linked to
the promoter, and these allow an increased expression of the
nucleic acid sequence. It is also possible to insert, at the 3'
end of the DNA sequences, additional advantageous sequences such
as further regulatory elements or terminators. One or more copies
of the calendulic acid desaturase gene may be contained in the
gene construct.
Advantageous regulatory sequences for the process according to
the invention are contained, for example, in promoters such as
cos, tac, trp, tet, trp-tet, lpp, lac, lpp-lac, lacIq~ T7, T5,
T3, gal, trc, ara, SP6, ~,-PR or in the ~,-PL promoter, all of which
are advantageously used in Gram-negative bacteria. Other
advantageous regulatory sequences are contained, for example, in
the Gram-positive promoters amy and SP02, in the yeast or fungal
promoters ADC1, MFa , AC, P-60, CYC1, GAPDH, TEF, rp28, ADH, or
in the plant promoters such as CaMV/35S [Franck et al., Cell
21(1980) 285-294], PRP1 [Ward et al., Plant.Mol. Bio1.22(1993)],
SSU, OCS, lib4, STLSl, B33, nos or in the Ubiquitin promoter.
Other advantageous plant promoters are, for example, a
benzenesulfonamide-inducible (EP 388186), a tetracyclin-inducible
(Gatz et al., (1992) Plant J. 2,397-404), an
abscisic-acid-inducible (EP335528) and an ethanol- or
cyclohexanone-inducible (W09321334) promoter. Other plant
promoters are, for example, the potato cytosolic FBPase promoter,
the potato ST-LSI promoter (Stockhaus et al., EMBO J. 8 (1989)
2445-245), the Glycine max phosphoribosyl pyrophosphate amido
transferase promoter (see also gene bank accession number U87999)
or a node-specific promoter as described in EP 249676.
Advantageous plant promoters are, in particular, those which
ensure expression in tissues or parts of the plants in which the
biosynthesis of fats or their precursors takes place. Promoters
which must be mentioned in particular are those which ensure
seed-specific expression such as, for example, the USP promoter,
the LEB4 promoter, the phaseolin promoter or the napin promoter.
In principle, all natural promoters with their regulatory
sequences as those mentioned above may be used for the process
according to the invention. In addition, synthetic promoters may
also advantageously be used.
The nucleic acid fragment (= gene construct, nucleic acid
construct) may also contain further genes to be introduced into
organisms, as this has been described above. These genes can be
under separate regulation or under the same regulatory region as
the desaturase gene according to the invention. These genes are,
for example, other biosynthesis genes, advantageously of the
0050/50669
CA 02382845 2002-02-26
fatty acid and lipid biosynthesis, which allow increased
synthesis. Examples which may be mentioned are the genes for
A15-, X12-, 09-, 06-, 05-desaturase, the various hydroxylases,
acetylenase, the acyl-ACP thioesterases, the (3-ketoacyl-ACP
synthases, the acyltransferases such as diacylglycerol
acyltransferase, glycerol-3-phosphate acyltransferase or
lysophosphatidic acid acyltransferase or (3-ketoacyl-ACP
reductases. It is advantageous to use the desaturase genes in the
nucleic acid construct, especially the 012-desaturase gene.
For expression in a host organism, for example a microorganism
such as fungus or a plant, the nucleic acid fragment is
advantageously inserted into a vector such as, for example, a
plasmid, a phage or other DNA, which vector allows optimal
e~ression of the genes in the host. Examples of suitable
plasmids are, in E. coli, pLG338, pACYC184, pBR322, pUCl8, pUCl9,
pKC30, pRep4, pHSl, pHS2, pPLc236, pMBL24, pLG200, pUR290,
pIN-III213_gl~ ~,gtl1 or pBdCI, in Streptomyces pIJ101, pIJ364,
pIJ702 or pIJ361, in Bacillus pUB110, pC194 or pBD214, in
Corynebacterium pSA77 or pAJ667, in fungi pALSl, pIL2 or pBB116,
in yeasts 2~iM, pAG-1, YEp6, YEpl3 or pEMBLYe23, or, in plants,
pLGV23, pGHlac+, pBINl9, pAK2004, pVKH or pDH5l, or derivatives of
the abovementioned plasmids. The plasmids mentioned represent a
small selection of the plasmids which are possible. Other
plasmids are well known to the skilled worker and can be found,
for example, in the book Cloning Vectors (Eds. Pouwels P. H. et
al. Elsevier, Amsterdam-New York-Oxford, 1985 , ISBN 0 444
904018). Suitable plant vectors are described, inter alia, in
"Methods in Plant Molecular Biology and Biotechnology" (CRC
Press), Chapter 6/7, pp.71-119.
In addition to plasmids, vectors are also to be understood as
meaning all the other vectors which are known to the skilled
worker, such as, for example, phages, viruses such as SV40, CMV,
baculovirus, adenovirus, transposons, IS elements, phasmids,
phagemids, cosmids, linear or circular DNA. These vectors can be
replicated autonomously in the host organism or replicated
chromosomally. Chromosomal replication is preferred.
The vector advantageously contains at least one copy of the
nucleic acid sequence according to the invention and/or of the
nucleic acid fragment according to the invention.
To increase the gene copy number, the nucleic acid sequences or
homologous genes can be introduced, for example, into a nucleic
acid fragment or into a vector which preferably contains the
regulatory gene sequences assigned to the genes in question, or
0050/50669 CA 02382845 2002-02-26
9
analogously acting promoter act;.vity. Regulatory sequences which
are used in particular are those which increase gene expression.
To express the other genes contained, the nucleic acid fragment
advantageously additionally contains 3'- and/or 5'-terminal
regulatory sequences to increase expression, these sequences
being selected for optimal expression, depending on the host
organism chosen and the gene or genes.
These regulatory sequences should allow the targeted expression
of the genes and protein expression. Depending on the host
organism, this may mean, for example, that the gene is expressed
and/or overexpressed only after induction, or that it is
expressed and/or overexpressed immediately.
The regulatory sequences or factors can preferably have a
positive effect on, and thus increase, the gene expression of the
genes introduced. Thus, strengthening of the regulatory elements
can advantageously take place at the transcriptional level by
using strong transcription signals such as promoters and/or
enhancers. In addition, however, strengthening of translation is
also possible, for example by improving mRNA stability.
In a further embodiment of the vector, the gene construct
according to the invention can advantageously also be introduced
into the organisms in the form of a linear DNA and integrated
into the genome of the host organism by means of heterologous or
homologous recombination. This linear DNA may consist of a
linearized plasmid or only of the nucleic acid fragment as vector
or of the nucleic acid sequence according to the invention.
The nucleic acid sequence according to the invention is
advantageously cloned into a nucleic acid construct together with
at least one reporter gene, and the nucleic acid construct is
introduced into the genome. This reporter gene should allow easy
detectability via a growth assay, a fluorescence assay, a chemo
assay, a bioluminescence assay or a resistance assay, or via a
photometric measurement. Examples of reporter genes which may be
mentioned are genes for resistance to antibiotics or herbicides,
hydrolase genes, fluorescence protein genes, bioluminescence
genes, sugar metabolism genes or nucleotide metabolism genes, or
biosynthesis genes such as the Ura3 gene, the Ilv2 gene, the
luciferase gene, the (3-galactosidase gene, the gfp gene, the
2-deoxyglucose-6-phosphate phosphatase gene, the ~i-glucuronidase
gene, the (3-lactamase gene, the neomycin phosphotransferase gene,
the hygromycin phosphotransferase gene or the BASTA
(= gluphosinate) resistance gene. These genes allow the
~~50/50669 CA 02382845 2002-02-26
l~
transcriptional activity, and thus gene expression, to be
measured and quantified easily. In this way, genome sites which
show different productivity can be identified.
In a further advantageous embodiment, the nucleic acid sequence
according to the invention may also be introduced into an
organism on its own.
If it is intended to introduce, into the organism, other genes in
addition to the nucleic acid sequence according to the invention,
all can be introduced into the organism in a single vector with a
reporter gene, or each individual gene with a reporter gene per
vector, it being possible for the various vectors to be
introduced simultaneously or in succession.
The host organism advantageously contains at least one copy of
the nucleic acid according to the invention and/or of the nucleic
acid construct according to the invention.
In principle, the nucleic acid according to the invention, the
nucleic acid construct or the vector can be introduced into
organisms, for example plants, by all methods known to the
skilled worker.
In the case of microorganisms, the skilled worker can find
suitable methods in the textbooks by Sambrook, J. et al. (1989)
Molecular cloning: A laboratory manual, Cold Spring Harbor
Laboratory Press, by F.M. Ausubel et al. (1994) Current protocols
in molecular biology, John Wiley and Sons, by D.M. Glover et al.,
DNA Cloning Vol.l, (1995), IRL Press (ISBN 019-963476-9), by
Kaiser et al. (1994) Methods in Yeast Genetics, Cold Spring
Harbor Laboratory Press or by Guthrie et al. Guide to Yeast
Genetics and Molecular Biology, Methods in Enzymology, 1994,
Academic Press.
The transfer of foreign genes into the genome of a plant is
termed transformation. The described methods for the
transformation and regeneration of plants from plant tissues or
plant cells are used for transient or stable transformation.
Suitable methods are protoplast transformation by
polyethylene-glycol-induced DNA uptake, the use of a gene gun,
electroporation, the incubation of dry embryos in DNA-containing
solution, microinjection and the agrobacterium-mediated gene
transfer. The methods mentioned are described, for example, in B.
Jenes et al., Techniques for Gene Transfer, in: Transgenic
Plants, Vol. 1, Engineering and Utilization, edited by S.D. Kung
and R. Wu, Academic Press (1993) 128-143 and by Potrykus, Annu.
0050/50669 CA 02382845 2002-02-26
11
Rev. Plant Physiol.Plant Molec.Biol. 42 (1991) 205-225). The
construct to be expressed is preferably cloned into a vector
which is suitable for transforming Agrobacterium tumefaciens, for
example pBinl9 (Bevan et al., Nucl. Acids Res. 12 (1984) 8711).
The transformation of plants with Agrobacterium tumefaciens is
described, for example, by Hofgen and Willmitzer in Nucl. Acid
Res. 16 (1988) 9877.
Agrobacteria which have been transformed with an expression
vector according to the invention can also be used in the known
manner to transform plants such as test plants like Arabidopsis
or crop plants, in particular oil-containing crop plants such as
soya, peanuts, castor, sunflowers, corn, cotton, flax, oilseed
rape, coconut palms, oil palms, safflower (Carthamus tinctorius)
or cacao, for example by bathing wounded leaves or leaf sections
in agrobacterial solution and subsequently culturing them in
suitable media.
The genetically altered plant cells can be regenerated by all
methods known to the skilled worker. Suitable methods can be
found in the abovementioned publications by S.D. Kung and R. Wu,
Potrykus or Hofgen and Willmitzer.
Suitable organisms or host organisms for the nucleic acid
according to the invention, the nucleic acid construct or the
vector are, in principle, all organisms which are capable of
synthesizing fatty acids, specifically unsaturated fatty acids,
and which are suitable for the expression of recombinant genes.
Examples which may be mentioned are plants such as Arabidopsis,
Asteraceae such as Calendula or crop plants such as soya,
peanuts, castor, sunflowers, corn, cotton, flax, oilseed rape,
coconut palms, oil palms, safflower (Carthamus tinctorius) or
cacao, microorganisms such as fungi, for example the genus
Mortierella, Saprolegnia or Pythium, bacteria such as the genus
Escherichia, yeasts such as the genus Saccharomyces, algae or
protozoans such as dinoflagellates such as Crypthecodinium.
Preferred organisms are those which are naturally capable of
synthesizing oils in substantial amounts, like fungi such as
Mortierella alpina, Pythium insidiosum or plants such as soya,
oilseed rape, flax, coconut palms, oil palms, safflower, castor,
Calendula, peanuts, cacao or sunflowers, or yeasts such as
Saccharomyces cerevisiae, with soya, oilseed rape, flax,
sunflowers, Calendula or Saccharomyces cerevisiae being
especially preferred. In principle, transgenic animals, for
example Caenorhabditis elegans, are also suitable as host
organisms.
0050/50669 CA 02382845 2002-02-26
12
Another embodiment according to the invention are, as described
above, transgenic plants which contain a functional or a
nonfunctional nucleic acid or a functional or nonfunctional
nucleic acid construct. The term nonfunctional is to be
understood as meaning that an enzymatically active protein is no
longer synthesized since the natural gene has been inactivated.
In addition, the term nonfunctional nucleic acids or nucleic acid
constructs is also to be understood as meaning a so-called
antisense DNA which leads to transgenic plants which show a
reduction in, or lack, enzymatic activity. The antisense
technology, specifically when combining, in the antisense DNA,
the nucleic acid sequence according to the invention with other
fatty acid synthesis genes, allows the synthesis of triglycerides
with an elevated content of saturated fatty acids, or saturated
fatty acids. Transgenic plants are to be understood as meaning
single plant cells and their cultures on solid media or in liquid
culture, parts of plants and entire plants.
The use of the nucleic acid sequence according to the invention
or of the nucleic acid construct according to the invention for
the generation of transgenic plants is therefore also subject
matter of the invention.
The invention furthermore relates to an enzyme which converts a
fatty acid of the structure I,
a ~
R CH-t-COOR1 ( I )
'/ n
which has two double bonds separated from each other by a
methylene group, to give a triunsaturated fatty acid of the
structure II,
2 ~
R \ / CH;-f-COOR1 ( II ) ,
'~ n
the three double bonds of the fatty acid being conjugated and the
substituents and variables in the compounds of the structures I
and II having the following meanings:
0050/50669 CA 02382845 2002-02-26
13
R1 = hydrogen, substituted or unsubstituted, unsaturated or
saturated, branched or unbranched C1-Clp-alkyl-,
-CH~
°~O ~0
Rs Ra
R2 = substituted or unsubstituted, unsaturated or saturated
C1-Cg-Alkyl-
R3 and R4 independently of one another are hydrogen, substituted
or unsubstituted, saturated or unsaturated, branched or
unbranched C1-C22-alkylcarbonyl or phospho-,
n = 1 to 14, preferably 1 to 8, especially preferably 4 to 6,
very especially preferably 6.
R1 in the compounds of the formula I and II is hydrogen,
substituted or unsubstituted, unsaturated or saturated, branched
or unbranched C1-Clp-alkyl-, or -CHZ-~---
O O
R3 Ra
Alkyl radicals which may be mentioned are substituted or
unsubstituted, branched or unbranched C1-Clo-alkyl chains such as,
for example, methyl, ethyl, n-propyl, 1-methylethyl, n-butyl,
1-methylpropyl-, 2-methylpropyl, 1,1-dimethylethyl, n-pentyl,
1-methylbutyl, 2-methylbutyl, 3-methylbutyl, 2,2-dimethylpropyl,
1-ethylpropyl, n-hexyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl,
1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl,
1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl,
2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl,
1-ethylbutyl, 2-ethylbutyl, 1,1,2-trimethylpropyl,
1,2,2-trimethylpropyl, 1-ethyl-1-methylpropyl,
1-ethyl-2-methylpropyl, n-heptyl, n-octyl, n-nonyl or n-decyl.
Preferred radicals for R1 are hydrogen and -CH~
0 0
R3 R4
R2 in the compounds of the formula I and II denotes substituted or
unsubstituted, unsaturated or saturated C1-C9-alkyl-.
Alkyl radicals which may be mentioned are substituted or
unsubstituted, branched or unbranched C1-C9-alkyl chains such as,
for example, methyl, ethyl, n-propyl, 2-methylethyl, n-butyl,
1-methylpropyl-, 2-me~hylpropyl, 1,1-dimethylethyl, n-pentyl,
1-methylbutyl, 2-methyl.butyl, 3-methylbutyl, 2,2-dimethylpropyl,
005050669 CA 02382845 2002-02-26
14
1-ethylpropyl, n-hexyl, i,l-dimethylpropyl, 1,2-dimethylpropyl,
1-methylpentyl, 2-methylpentyl, 3-methylpentyl, 4-methylpentyl,
1,1-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl,
2,2-dimethylbutyl, 2,3-dimethylbutyl, 3,3-dimethylbutyl,
1-ethylbutyl, 2-ethylbutyl, 1,1,2-trimethylpropyl,
1,2,2-trimethylpropyl, 1-ethyl-1-methylpropyl,
1-ethyl-2-methylpropyl, n-heptyl, n-octyl or n-nonyl. C1-C5-alkyl
is preferred, C5-alkyl is especially preferred.
R3 and R4 independently of one another are hydrogen, substituted
or unsubstituted, saturated or unsaturated, branched or
unbranched C1-C22-alkylcarbonyl- or phospho-.
C1-C22-alkylcarbonyl such as methylcarbonyl, ethylcarbonyl,
n-propylcarbonyl, 1-methylethylcarbonyl, n-butylcarbonyl,
1-methylpropylcarbonyl, 2-methylpropylcarbonyl,
1,1-dimethylethylcarbonyl, n-pentylcarbonyl,
1-methylbutylcarbonyl, 2-methylbutylcarbonyl,
3-methylbutylcarbonyl, 1,1-dimethylpropylcarbonyl,
1,2-dimethylpropylcarbonyl, 2,2-dimethylpropylcarbonyl,
1-ethylpropylcarbonyl, n-hexylcarbonyl, 1-methylpentylcarbonyl,
2-methylpentylcarbonyl, 3-methylpentylcarbonyl,
4-methylpentylcarbonyl, 1,1-dimethylbutylcarbonyl,
1,2-dimethylbutylcarbonyl, 1,3-dimethylbutylcarbonyl,
2,2-dimethylbutylcarbonyl, 2,3-dimethylbutylcarbonyl,
3,3-dimethylbutylcarbonyl, 1-ethylbutylcarbonyl,
2-ethylbutylcarbonyl, 1,1,2-trimethylpropylcarbonyl,
1,2,2-trimethylpropylcarbonyl, 1-ethyl-1-methylpropylcarbonyl and
1-ethyl-2-methylpropylcarbonyl, heptylcarbonyl, nonylcarbonyl,
decylcarbonyl, undecylcarbonyl, n-dodecylcarbonyl,
n-tridecylcarbonyl, n-tetradecylcarbonyl, n-pentadecylcarbonyl,
n-hexadecylcarbonyl, n-heptadecylcarbonyl, n-octadecylcarbonyl,
n-nonadecylcarbonyl or n-eicosylcarbonyl.
Preferred substituents for R3 and R4 are saturated or unsaturated
Cis-C22-alkylcarbonyl .
Examples of substituents of the abovementioned radicals which may
be mentioned are halogen such as fluorine or chlorine, alkyl or
hydroxyl.
In the conversion with the enzyme according to the invention, one
double bond is introduced into the fatty acid and one double bond
is shifted so that the three double bonds which participate in
the reaction are conjugated. Furthermore, one double bond is
isomerized (from cis to trans).
X050/50669 CA 02382845 2002-02-26
The enzyme (= calendulic acid desaturase) advantageously
catalyzes the conversion of linoleic acid (18:2, 9Z,12Z) to
calendulic acid (18:3, 8E,10E,12Z). The enzyme introduces a trans
double bond at position C8 and causes the specific shift of a cis
5 double bond in position C9 to a trans double bond in position
C10, the isomerization being effected regiospecifically. A
possible hypothetical reaction mechanism is shown in Fig. 1.
After deprotonation at C8 of the linoleic acid and a
rearrangement of the free radical to C10, the elimination of
10 water leads to a deprotonation at C11 and thus to the formation
of calendulic acid. Simultaneously, bound FeIV is reduced to
FeIII. Fig. 1 shows the hypothetical mechanism for
(8,11)-linoleoyl desaturase (calendulic acid desaturase),
modified after Svatos, A et al. (Insect Biochemistry and
15 Molecular Biology 29,1999:225-232) based on the proposed
catalytic mechanism for Ricinus ~9 desaturase (Lindqvist, Y et
al., EMBO Journal 15, 1996:4081-4092). Suitable substrates are
still 6Z,9Z,12Z, 18:3-fatty acid and 9Z,12Z,15Z, 18:3-fatty acid,
which, in turn, are then reacted to give 6Z,8E,10E,12Z- and
8E,10E,12Z,15Z-fatty acids, respectively.
The invention furthermore relates to a process for the
preparation of unsaturated fatty acids, which comprises
introducing at least one above-described nucleic acid sequence
according to the invention or at least one nucleic acid construct
according to the invention into a preferentially oil-producing
organism, growing this organism, isolating the oil contained in
the organism and liberating the fatty acids contained in the oil.
The invention also includes a process for the preparation of
triglycerides with an increased content of unsaturated fatty
acids, which comprises introducing at least one above-described
nucleic acid sequence according to the invention or at least one
nucleic acid construct according to the invention into a
preferentially oil-producing organism, growing this organism and
isolating the oil contained in the organism.
Both processes advantageously allow the synthesis of fatty acids
of triglycerides with an increased content of unsaturated fatty
acids such as calendulic acid.
The invention furthermore relates to a process for the
preparation of saturated fatty acids, which comprises introducing
at least one nonfunctional abovernentioned nucleic acid sequence
according to the invention or at least one nonfunctional nucleic
acid construct according to the invention into an oil-producing
organism, growing this organism, isolating the oil contained in
0050/50669 CA 02382845 2002-02-26
16
the organism and liberating the fatty acids contained in the oil,
and to a process for the preparation of triglycerides with an
increased content of saturated fatty acids, which comprises
introducing at least one nonfunctional abovementioned nucleic
acid sequence according to the invention or at least one
nonfunctional nucleic acid construct according to the invention
into an oil-producing organism, growing this organism and
isolating the oil contained in the organism. Both processes
involve the use of the so-called antisense technology (see
above), or the inactivation of the lateral synthesis genes.
Examples of organisms for the abovementioned processes are plants
such as Arabidopsis, Soya, peanuts, castor, sunflowers, corn,
cotton, flax, oilseed rape, coconut palms, oil palms, safflower
(Carthamus tinctorius) or cacao, microorganisms such as the fungi
Mortierella, Saprolegnia or Pythium, bacteria such as the genus
Escherichia, yeasts such as the genus Saccharomyces, algae or
protozoans such as dinoflagellates, for example Crypthecodinium.
Preferred organisms are those which can naturally synthesize oils
in substantial amounts, such as fungi, for example Mortierella
alpina, Pythium insidiosum, or plants such as Soya, oilseed rape,
flax, coconut palms, oil palms, safflower, castor, Calendula,
peanuts, cacao or sunflowers, or yeasts such as Saccharomyces
cerevisiae; soya, oilseed rape, flax, sunflowers, Calendula or
Saccharomyces cerevisiae are especially preferred.
Depending on the host organism, the organisms used in the
processes are grown or cultured in the manner known to those
skilled in the art. As a rule, microorganisms are grown in a
liquid medium which contains a carbon source, usually in the form
of sugars, a nitrogen source, usually in the form of organic
nitrogen sources such as yeast extract or salts such as ammonium
sulfate, a phosphate source such as potassium hydrogen phosphate,
trace elements such as iron salts, manganese salts, magnesium
salts and, if required, vitamins, at temperatures between 0°C and
100°C, preferably between 10°C and 60°C, while gassing in
oxygen.
The pH of the liquid medium can be maintained at a fixed value,
i.e. the pH is regulated while culture takes place. However, the
microorganisms may also be cultured without pH regulation.
Culturing can be effected by the batch method, the semi-batch
method or continuously. Nutrients may be supplied at the
beginning of the fermentation or fed in semicontinuously or
continuously.
Post-transformation, plants are first regenerated as described
above and then grown or planted as usual.
0050/50669 CA 02382845 2002-02-26
17
After the organisms have been grown, the lipids are obtained in
the usual manner. To this end, the organisms can first be
harvested and then disrupted, or they can be used directly. It is
advantageous to extract the lipids with suitable solvents such as
apolar solvents, for example hexane, or polar solvents, for
example ethanol, isopropanol, or mixtures such as
hexane/isopropanol, phenol/chloroform/isoamyl alcohol, at
temperatures between 0°C and 80°C, preferably between
20°C and
50°C. As a rule, the biomass is extracted with an excess of
solvent, for example with an excess of solvent to biomass of 1:4.
The solvent is subsequently removed, for example by distillation.
The extraction may also be carried out with supercritical C02.
After the extraction, the remainder of the biomass can be
removed, for example, by filtration. Standard methods for the
extraction of fatty acids from plants and microorganisms are
described in Bligh et al. (Can. J. Biochem. Physiol. 37, 1959:
911-917) or Vick et al. (Plant Physiol. 69, 1982: 1103-1108).
The crude oil thus obtained can then be purified further, for
example by removing cloudiness by adding polar solvents such as
acetone or apolar solvents such as chloroform, followed by
filtration or centrifugation. Further purification via columns or
other techniques is also possible.
To obtain the free fatty acids from the triglycerides, the latter
are hyrolyzed in the customary manner, for example using NaOH or
KOH.
The invention furthermore relates to unsaturated or saturated
fatty acids and triglycerides with an increased content of
saturated or unsaturated fatty acids which have been prepared by
the abovementioned processes, and to their use for the
preparation of foodstuffs, animal feed, cosmetics or
pharmaceuticals. To this end, they are added to the foodstuffs,
animal feed, cosmetics or pharmaceuticals in the customary
quantities.
The invention is illustrated in greater detail in the examples
which follow:
Examples
A cDNA was cloned from Calendula officinalis mRNA using RT-PCR
and RACE techniques. When expressing this cDNA in yeast, linoleic
acid is converted into the octadecaconjutriene calendulic acid
(8E, 20E, 122). As far as we know, this is the first time that a
calendulic acid desaturase has been described. The enzyme causes
CA 02382845 2002-02-26
18
a regiospecific shift of a cis double bond in position C9 to a
trans double bond in position C10 and introduces a new traps
double bond at position C8.
Transgenic yeasts and plants with an increased expression of
calendulic acid desaturase cDNA show calendulic acid in their
lipids.
Example 1: Isolation of RNA from Calendula officinalis seeds
In order to be able to isolate cDNA clones for calendulic acid
desaturase by means of PCR, RNA was isolated from Calendula
officinalis seeds. Owing to the high fat content of the seeds, it
was impossible to use standard protocols; the following method
was used instead:
Using a pestle and mortar, 20 g of plant material were ground in
liquid nitrogen to give a powder. 100 ml of extraction buffer I
[100 mM tris/HC1, pH 7.5, 20 mM EDTA, 2~ (w/v) lauryl sarcosyl,
4 M guanidinium thiocyanate, 5$ (w/v) PVP (= polyvinyl-
pyrrolidone), 1~ (v/v) (3-mercaptoethanol] were added, and the
batch was mixed immediately and homogenized. The solution was
transferred into 50-ml-vessels and shaken for approximately
15 minutes. After centrifugation for 10-15 minutes at 4,000 g,
the fatty layer or fat drops which had risen to the top were
removed and the supernatant was transferred into fresh vessels.
This was followed by extraction with 1 volume of
phenol/chloroform/isoamyl alcohol (= PCI, 25:24:1) and one
extraction with chloroform; in each case, the mixture was shaken
for 15 minutes and then centrifuged. The upper, aqueous phase was
removed, placed on an 8-ml-CsCl cushion (5 M CsCl) and
centrifuged for 18 hours at 18°C and 100,000 g. The supernatant
was decanted off and the RNA precipitate was dried briefly. After
a washing step with 70~ ethanol, the RNA was dissolved in a
mixture of 7.5 ml extraction buffer II (100 ml tris/HC1, pH 8.8,
100 mM NaCl, 5 mM EDTA, 2~ SDS) and 10 ml of PCI, shaken for
15 minutes and centrifuged. The upper, aqueous phase was
extracted with chloroform and then an equal volume of 5 M LiCl
was added. The RNA was precipitated overnight at 4°C. The mixture
was then centrifuged for 60 minutes at 12,000 g and 4°C. The
precipitate was washed twice with 70~ ethanol, dried and finally
taken up in 500 ~1 of H20.
mRNA was isolated from the resulting Calendula total RNA using
the Poly-Attract Kit (Promega, Mannheim) following the
manufacturer's instructions. 1 ~g of this mRNA was translated
into cDNA with the SuperscriptII reverse transcriptase by Gibco
0050/50669 CA 02382845 2002-02-26
19
BRL (Eggenstein) using 200 pmol of oligo-dT primer following the
manufacturer's instructions and employed as template in a
polymerase chain reaction (PCR).
Example 2 . Isolation and cloning of the Calendula officinalis
calendulic acid desaturase
In order to isolate, from Calendula officinalis, DNA sequences
which encode a calendulic acid desaturase, various degenerate
oligonucleotide primers were derived from amino acid sequences of
the conserved histidine boxes of various 012 desaturases.
Primer A: 5' - CCD TAY TTC TCI TGG AAR WWH AGY CAY CG - 3'
forward primer, derived from the amino acid sequence
P Y F S W K Y/I S H R
Primer B: 5' - CCA RTY CCA YTC IGW BGA RTC RTA RTG - 3'
reverse primer, derived from the amino acid sequence
H Y D S S/T E W D/N W
The letters in primers A and B have the following meaning:
R = A/G
Y = C/T
W = A/T
H = A/C/T
B = C/G/T
D = A/G/T
I = inositol
In a PCR with Calendula simplex cDNA (prepared as described in
Example 1) as template, a DNA fragment with a length of 470 by
was amplified using primers A and B. The following PCR program
was used:
1. 2 min 94 C
2. 30 sec 94 C
3. 45 sec 50 C (annealing temperature)
4. 1 min 72 C
10 x to
2. 4.
5. 0 sec 94 C
6. 45 sec 50 C
7. 1 min 72 C, time increment 5 sec per cycle
20 x to
5. 7.
2 min 72 C
8.
0050/50669 CA 02382845 2002-02-26
The TfI DNA polymerase from Biozym (Hess. Oldendorf) was used for
the amplification. The 470 by DNA fragment was cloned into the
vector pCR 2.1-TOPO with the aid of the TOPO TA Cloning Kit
(Invitrogen, Carlsbad, USA) and sequenced. The sequence of the
5 470 by fragment corresponded to the sequence of nucleotide 466 to
893 of SEQ ID N0:1.
Example 3: Obtaining and sequencing complete cDNA clones
10 In order to obtain a full-length clone, the fragment was extended
by means of 5'- and 3'-RACE (rapid amplification of cDNA ends).
Starting from 1 ~.g of mRNA (isolated as described in Example 1),
duplex cDNA was prepared using the "Marathon cDNA Amplification
Kit" by CLONTECH (Heidelberg). After ligation of the adaptor, 5'-
15 and 3'-RACE was carried out using the following primers:
Specific primers for 5'-RACE:
Primer C 5' - GTG AGG GAG TGA GAG ATG GGT GTG GTG C - 3'
20 Primer D 5' - AAC ACA CTT ACA CCT AGT ACT GGA ATT G - 3'
Specific primers for 3'-RACE:
Primer E 5' - TAT TCC AAA CTT CTT AAC AAT CCA CCC G - 3'
Primer F 5'- CAA TTC CAG TAC TAG GTG TAA GTG TGT T - 3'
First, a PCR was carried out with the adaptor-ligated duplex cDNA
and primer C or E; then, a second FCR was carried out with primer
D or F and a 1:50 dilution of the PCR product from the reaction
with primer C or E as template.
The RACE-PCR was carried out using the following program:
1. 1 min 94C
30 sec 94C
2.
3. 3 min 68C
10 x - 3.
2.
4. 30 sec 94C
5. 30 sec 65C
3 min 68C
6.
25 x - 6.
4.
7. 5 min 68C
The resulting DNA fragments were cloned into pCR 2.1-TOPO with
the aid of the TOPO TA Cloning Kit (Invitrogen, Carlsbad, USA)
and sequenced. The 5'-RACE product extended over the start codon
0050/50669 CA 02382845 2002-02-26
21
into the 5'-untranslated region (5'-UTR), and the 3'-RACE over
the stop codon into the 3'-UTR).
The composite sequence composed of the first PCR product and the
RACE product is shown in SEQ ID N0: 1. The encoding region
extends from nucleotide 42 (start codon) to 1175 (stop codon).
The 5'- and 3'- UTRs were only sequenced as simplexes, so that
individual sequencing mistakes are possible here.
In order to obtain an uninterrupted full-length clone, a PCR was
carried out using the Expand High Fidelity System (Boehringer,
Mannheim) and the primers G and H, with Calendula cDNA (see
Example 1) as template.
Primer G 5' - ATTAGAGCTCATGGGTGCTGGTGGTCGGATGTCG - 3'
forward primer (with Sac= cleavage site)
Primer H 5' - ATTACTCGAGTGACATACACCTTTTTGATTACATCTTG - 3'
reverse primer (with ~ho~ cleavage site)
The PCR was carried out using the following program:
1. 2 min 94°C
2. 30 sec 94°C
3. 35 sec 63°C
4. 2 min 72°C
10 x 2. - 4.
5. 30 sec 94°C
6. 35 sec 63°C
7. 2 min 72°C, time increment 5 seconds per cycle
15 x 5. - 7
8. 2 min 72 ~C.
The 1.2 kb PCR product was cloned into the vector pGEM-T
(Promega, Mannheim) and transformed into E. coli DH10B. The
insert DNA was sequenced as duplex using a 373 DNA sequencer
(Applied Biosystems). To this end, the following
sequence-specific primers were used in addition to reverse primer
and -21 primer:
Primer I: 5' - CGG TCT TCT CGC TGT ATT - 3'
Primer J: 5' - ATT ACC CAA GCT GCC C - 3'
0050/50669 CA 02382845 2002-02-26
22
The complete DNA sequence of calendulic acid desaturase (CalDes)
is identical to the section from nucleotide 42 to 1193 of SEQ ID
N0:1. The sequence encompasses the encoding region and a short
section of the 3'-UTR.
A comparison of the derived amino acid sequence of Co-CalDes
(SEQ ID N0:2) with annotated protein sequences of the SWISS-PROT
and SP-TREMBL databases demonstrated the highest homology to a
Crepis alpina 012-acetylenase (SP_PL: 081931, 74~ identical amino
acids), a Crepis palaestina 012-epoxygenase (SP_PL: 065771, 73~
identical amino acids) and a Borago officinalis 012-desaturase
(SP_PL: 082729, 62~ identical amino acids) over the entire
encoding region. The sequence comparisons are shown in Fig. 2.
Fig. 2 shows a comparisons of the amino acid sequences of
Co-CalDes with Crepis alpina 012-acetylenase (Ca-Acetyl), Crepis
palaestina 012-epoxygenase (Cp-Epoxy) and Borago officinalis
X12-desaturase (Bo-Des).
Example 4: Expression of calendulic acid desaturase in yeast
In a first approach, the encoding region of the cDNA was cloned
in a yeast expression vector and expressed in S. cerevisiae, in
order to demonstrate the functionality of CalDes. The calendulic
acid desaturase produced in the yeast was meant to convert added
linoleic acid into calendulic acid. The latter, in turn, was to
be detected by HPLC in hydrolyzed lipid extracts.
In a second approach, the A. thaliana 012-desaturase FAD2
(Kajiwara et al., Appl. Environ. Microbiol., 62, 1996: 4309 -
4313) was expressed in yeast in addition to CalDes, so that the
yeast cells endogenously produce linoleic acid which, in turn,
can be converted into calendulic acid owing to the activity of
CalDes. The calendulic acid, in turn, was to be detected by HPLC.
All solid and liquid media for yeast were prepared by protocols
of Ausubel et al. (Current Protocols in Molecular Biology, John
Wiley & Sons, New York, 1995).
The CalDes cDNA was excised from the vector pGEM-T by restriction
digest with SacI/XhoI and cloned into the SacI/XhoI-cut shuttle
vector pYES2 (Invitrogen, Carlsbad, USA), and the resulting
vector pYES2-CalDes was transformed into E. coli XL1 blue. After
another plasmid preparation with the aid of the Plasmid Maxi Kit
(QIAGEN), pYES2-CalDes was transformed into S. cerevisiae INCSvI
(Invitrogen, Carlsbad, USA) with the aid of the polyethylene
glycol method (Von Pein M., PhD thesis, Heinrich Heine-
0050/50669 CA 02382845 2002-02-26
23
Universitat Diisseldorf, 1992), where the expression of the CalDes
cDNA was under the control of the GAL1 promoter.
In order to be able to express, in the second approach, not only
CalDes, but also FAD2, in yeast, the encoding region of the FAD2
gene was first amplified via PCR (protocol see Primers G and H)
from A, thaliana cDNA with the aid of Tf1 polymerase (Biozym).
The following primers were used for this purpose:
Primer K: 5' - AAA~CGAGATGGGTGCAGGTGGAAGAATGCCGG - 3'
forward primer (Xhol cleavage site)
Primer L: 5' - A,P~!TCATAACTTATTGTTGTACCAGTACACACC - 3'
reverse primer (Hirzd==I cleavage site)
The resulting PCR product was subjected to a restriction digest
with XhoI/HindIII and then cloned into the XhoI/HindIII-cut yeast
expression vector pESC-Leu (Stratagene), where the FAD2 DNA was
under the control of the GAL1 promoter.
The expression of CalDes in S. cerevisiae INCSvl was carried out
using a modification of the procedure of Avery et al. (Appl.
Environ. Microbiol., 62, 1996: 3960 - 3966) and Girke et al. (The
Plant Journal, 5, 1998: 39 - 48). To prepare a starter culture,
10 ml of YPAD medium were inoculated with a single colony and the
culture was incubated for 48 hours at 30°C at 200 rpm. Then, the
cell culture was washed in 1 x YPA medium without sugar and
centrifuged. The pelleted cells were resuspended in 2 ml of
minimal medium without supplements and without sugar. 100 ml of
minimal medium (dropout powder, 2~ raffinose, 1~ Tergitol NP40)
in 500-ml-Erlenmeyer flasks were inoculated with 1 ml of this
cell suspension and the culture was grown at 30°C and'200 rpm. At
an ODSOo of 0.5, 2~ (w/v) of galactose were added and (in the case
of the first batch) 0.003~k of linoleic acid (3~ stock solution in
5~ Tergitol NP40). The cells were grown on until the stationary
phase had been reached. They were then washed in minimal medium
without supplements and stored at -20°C.
Example 5: Lipid extraction and HPLC analysis of the fatty acids
from transgenic yeast
The yeast cells were suspended in 30 ml of HIP solution (0.1 mM
2.6-di-tert-butyl-4-methylphenol in hexane: isopropanol (3:2
v/v)), acidified with 150 ~tl of concentrated HCl and homogenized
in an Ultra-Turrax (1 min, 24,000 rpm). The samples were then
shaken for 10 minutes at 4°C and centrifuged for 10 minutes at
5,000 g and 4°C. The supernatant was transferred into a fresh
X050/50669 CA 02382845 2002-02-26
24
container and made up to 47.5 ml with 0.38 M K2S04. The samples,
in turn, were shaken for 10 minutes at 4°C and centrifuged (see
above). The hexane phase was withdrawn and evaporated to dryness
under a stream of NZ. The residue was dissolved in 20 ~.1 of
chloroform. For the alkaline hydrolysis of fatty acid esters,
400 ~1 of methanol and 80 ~,1 of 40$ strength (w/v) KOH solution
were added and the sample was incubated for 20 minutes at 60°C
under argon. The sample was subsequently cooled to room
temperature, acidified to pH 3.0 with 35 ~1 of concentrated HC1
and separated by HPLC.
The free fatty acids were separated using an ET 250/4 Nucleosil
120-5 C18-column (Macherey & Nagel). The mobile phase used was
methano1:H20:glacial acetic acid (85:15:0.1 v/v/v). The separation
was carried out at a flow rate of 1 ml/min and 25°C, and the
absorption was measured at 268 nm to detect the conjutrienes.
Fig. 3 shows the elution profiles of the lipid extracts from
transformed yeast cells following alkaline hydrolysis (Fig. 3B,
elution profile of S. cerevisiae INCSvI transformed with
A. thaliana FAD2 DNA, and C, elution profile of S. cerevisiae
INCSvI transformed with Calendula officinalis pYES2-CalDes), and
the elution profile of a calendulic acid standard (Fig. 3A).
Calendulic acid has a retention time of 12 minutes with a strong
absorption at 268 nm, which is typical for conjutrienes. The
hydrolyzed lipid extracts of yeast cells which were transformed
with the blank vector pYES2 and grown with 0.003 of linoleic
acid show no fatty acids with a retention time of calendulic acid
(not shown). Equally, the hydrolyzed lipid extracts of yeast
cells which express the FAD2 gene contain no calendulic acid
(Fig. 3B).
In contrast, the HPLC analysis of the extracts of
pYES2-CalDes-transformed yeast cells grown with 0.003 of
linoleic acid showed a signal with the retention time of
calendulic acid (Fig. 3C), which also showed the same absorption
spectrum as the standard with a maximum of 268 nm and secondary
maxima of 258 and 282 nm (Fig. 4A, standard, and C, elution
profile of S. cerevisiae INCSvl transformed with Calendula
officinalis pYES2-CalDes). It was thus demonstrated that the
expression of calendulic acid desaturase in yeast results in the
biosynthesis of calendulic acid. Calendulic acid from transformed
yeast cells was only successfully detected after hydrolysis of
the lipids. No calendulic acid was detected in the free fatty
acids of these cells, that is to say that, in yeast, calendulic
acid is incorporated into lipids. Since yeast contains no
005/50669 CA 02382845 2002-02-26
triacylglycerides, it must be assumed that the detected
calendulic acid had been bound in the phospholipids of the yeast.
In addition, the lipid extracts of transgenic yeast cells which
5 simultaneously express FAD2 and CalDes also contain calendulic
acid (not shown).
Example 6: Expression of calendulic acid desaturase in
Arabidopsis thaliana and Linum usitatissimum
The expression of Calendula officinalis calendulic acid
desaturase in transgenic plants is advantageous for increasing
the calendulic acid content in these plants. To this end, the
CalDes cDNA was cloned into binary vectors and transferred into
A. thaliana and L. usitatissimum via Agrobacterium-mediated DNA
transfer. The expression of the CalDes cDNA was under the control
of the constitutive CaMV 35S promoter or the seed-specific USP
promoter.
The expression vectors used were the vector pBinAR (Hofgen and
Willmitzer, Plant Science, 66, 1990: 221 - 230) and the pBinAR
derivative pBinAR-USP, in which the CaMV 35S promoter had been
exchanged for the V. faba USP promoter. For recloning, the CalDes
cDNA had to be excised from the vector pGEM-T. To this end, the
latter was first cut with NcoI and filled up with Klenow to
provide blunt ends; the insert was subsequently excised with SalI
and cloned into the Smal/SalI-cut vectors pBinAR and pBinAR-USP.
The resulting plasmids pBinAR-CalDes and pBinAR-USP-CalDes were
transformed into Agrobacterium tumefaciens (Hofgen and
Willmitzer, Nucl. Acids Res., 16, 1988: 9877). A. thaliana was
transformed by "floral dip" (Clough and Bent, Plant Journal, 16,
1998: 735 - 743), and L. usitatissimum by coculturing linseed
hypocotyl sections with transformed A. tumefaciens cells.
The expression of the CalDes gene in transgenic Arabidopsis and
Linum plants was studied by Northern Blot analysis. Selected
plants were studied for their calendulic acid content in the seed
oil.
To achieve seed-specific expression of CalDes, it is also
possible to use the napin promoter analogously to the USP
promoter.
0~5~/50669 CA 02382845 2002-02-26
26
SEQUENCE LISTING
<110> Department of plant biochemistry
<120> Fatty acid desaturase gene from plants
<130> Sequence_desaturase
<140> 50669
<141> 1999-08-31
<160> 2
<170> PatentIn Vers. 2.0
<210> 1
<211> 1285
<212> DNA
<213> Calendula officinalis
<220>
<221> CDS
<222> (42)..(1175)
<400> 1
aaaagctcac ttctctgtga gggtaattat atatcaacaa c atg ggt get ggt ggt 56
Met Gly Ala Gly Gly
1 5
cgg atg tcg gat cca tct gag gga aaa aac atc ctt gaa cgt gtg cca 104
Arg Met Ser Asp Pro Ser Glu Gly Lys Asn Ile Leu Glu Arg Val Pro
15 20
gtc gat cca ccg ttc acg tta agc gat ctg aag aaa gcg att cct acc 152
Val Asp Pro Pro Phe Thr Leu Ser Asp Leu Lys Lys Ala Ile Pro Thr
25 30 35
cat tgc ttt gag cga tct gtc atc cgg tca tca tac tat gtt gtt cat 200
His Cys Phe Glu Arg Ser Val Ile Arg Ser Ser Tyr Tyr Val Val His
40 45 50
gat ctc att gtt gcc tat gtc ttc tac tac ctt gca aac acg tat atc 248
Asp Leu Ile Val Ala Tyr Val Phe Tyr Tyr Leu Ala Asn Thr Tyr Ile
55 60 65
cct ctt att cct aca cct ctg get tac cta gca tgg ccc gtt tac tgg 296
Pro Leu Ile Pro Thr Pro Leu Ala Tyr Leu Ala Trp Pro Val Tyr Trp
70 75 80 85
ttt tgt caa get agc atc ctc acc ggc ctc tgg gtc atc ggt cac gaa 344
Phe Cys Gln Ala Ser Ile Leu Thr Gly Leu Trp Val Ile Gly His Glu
UU50/50669 CA 02382845 2002-02-26
27
90 95 100
tgt ggt cac cat gca ttt agc gac tac cag ttg att gat gac att gtt 392
Cys Gly His His Ala Phe Ser Asp Tyr Gln Leu Ile Asp Asp Ile Val
105 110 115
gga ttc gtg ctc cat tcg get ctc ctc acc ccg tat ttc tct tgg aaa 440
Gly Phe Val Leu His Ser Ala Leu Leu Thr Pro Tyr Phe Ser Trp Lys
120 125 130
tat agc cac agg aat cac cac gcc aac aca aat tca ctc gat aac gat 488
Tyr Ser His Arg Asn His His Ala Asn Thr Asn Ser Leu Asp Asn Asp
135 140 145
gaa gtt tac att cct aaa cgt aag tcg aag gtc aag att tat tcc aaa 536
Glu Val Tyr Ile Pro Lys Arg Lys Ser Lys Val Lys Ile Tyr Ser Lys
150 155 160 165
ctt ctt aac aat cca ccc ggg cga gtg ttc act ttg gtg ttt cgg ttg 584
Leu Leu Asn Asn Pro Pro Gly Arg Val Phe Thr Leu Val Phe Arg Leu
170 175 180
act tta gga ttt ccg tta tac ctc tta act aat atc tcg ggc aag aaa 632
Thr Leu Gly Phe Pro Leu Tyr Leu Leu Thr Asn Ile Ser Gly Lys Lys
185 190 195
tac ggg agg ttt gcc aac cac ttt gat ccc atg agt cca att ttc aac 680
Tyr Gly Arg Phe Ala Asn His Phe Asp Pro Met Ser Pro Ile Phe Asn
200 205 210
gat cgt gaa cgc gtt caa gtt ttg cta tcc gat ttc ggt ctt ctc get 728
Asp Arg Glu Arg Val Gln Val Leu Leu Ser Asp Phe Gly Leu Leu Ala
215 220 225
gta ttt tat gca atc aag ctt ctt gta gca gca aaa ggg gca get tgg 776
Val Phe Tyr Ala Ile Lys Leu Leu Val Ala Ala Lys Gly Ala Ala Trp
230 235 240 245
gta atc aac atg tac gca att cca gta cta ggt gta agc gtg ttc ttc 824
Val Ile Asn Met Tyr Ala Ile Pro Val Leu Gly Val Ser Val Phe Phe
250 255 260
gtt ttg atc aca tat ttg cac cac acc cat ctc tca ctc cct cat tat 872
Val Leu Ile Thr Tyr Leu His His Thr His Leu Ser Leu Pro His Tyr
265 270 275
gat tca acc gaa tgg aac tgg atc aaa ggc gcc tta tca aca atc gat 920
Asp Ser Thr Glu Trp Asn Trp Ile Lys Gly Ala Leu Ser Thr Ile Asp
280 285 290
agg gat ttc ggg ttc ctg aat cgg gtt ttc cac gac gtt aca cac act 968
~~50/50669 CA 02382845 2002-02-26
28
Arg Asp Phe Gly Phe Leu Asn Arg Val Phe His Asp Val Thr His Thr
295 300 305
cac gtc ttg cat cat ttg atc tca tac att cca cat tat cat gca aag 1016
His Val Leu His His Leu Ile Ser Tyr Ile Pro His Tyr His Ala Lys
310 315 320 325
gaa gca agg gat gca atc aag cca gtg ttg ggc gag tac tat aaa atc 1064
Glu AIa Arg Asp Ala Ile Lys Pro Val Leu Gly Glu Tyr Tyr Lys Ile
330 335 340
gac agg act cca att ttc aaa gca atg tat aga gag get aag gaa tgc 1112
Asp Arg Thr Pro Ile Phe Lys Ala Met Tyr Arg Glu Ala Lys Glu Cys
345 350 355
atc tac atc gag ccc gat gag gat agc gag cac aaa ggt gtg ttc tgg 1160
Ile Tyr Ile Glu Pro Asp Glu Asp Ser Glu His Lys Gly Val Phe Trp
360 365 370
tac cac aag atg taa tcaaaaaggt gtatgtcaat gcaattgtat gcttaattaa 1215
Tyr His Lys Met
375
gttgttaaac tttctattcc gtgtaataaa ttatcattaa gagaaaaaaa aaaaaaaaaa 1275
aaaaaaaaaa 1285
<210> 2
<211> 377
<212> PRT
<213> Calendula officinalis
<400> 2
Met Gly Ala GIy Gly Arg Met Ser Asp Pro Ser Glu Gly Lys Asn Ile
1 5 10 15
Leu Glu Arg Val Pro Val Asp Pro Pro Phe Thr Leu Ser Asp Leu Lys
20 25 30
Lys Ala Ile Pro Thr His Cys Phe Glu Arg Ser Val Ile Arg Ser Ser
35 40 45
Tyr Tyr Val Val His Asp Leu Ile Val Ala Tyr Val Phe Tyr Tyr Leu
50 55 60
Ala Asn Thr Tyr Ile Pro Leu Ile Pro Thr Pro Leu Ala Tyr Leu Ala
65 70 75 80
Trp Pro Val Tyr Trp Phe Cys Gln Ala Ser Ile Leu Thr Gly Leu Trp
85 90 95
0050/50669 CA 02382845 2002-02-26
29
Val Ile Gly His Glu Cys Gly His His Ala Phe Ser Asp Tyr Gln Leu
100 105 110
Ile Asp Asp Ile Val Gly Phe Val Leu His Ser Ala Leu Leu Thr Pro
115 120 125
Tyr Phe Ser Trp Lys Tyr Ser His Arg Asn His His Ala Asn Thr Asn
130 135 140
Ser Leu Asp Asn Asp Glu Val Tyr Ile Pro Lys Arg Lys Ser Lys Val
145 150 155 160
Lys Ile Tyr Ser Lys Leu Leu Asn Asn Pro Pro Gly Arg Val Phe Thr
165 170 175
Leu Val Phe Arg Leu Thr Leu Gly Phe Pro Leu Tyr Leu Leu Thr Asn
180 185 190
Ile Ser Gly Lys Lys Tyr Gly Arg Phe Ala Asn His Phe Asp Pro Met
195 200 205
Ser Pro Ile Phe Asn Asp Arg Glu Arg Val Gln Val Leu Leu Ser Asp
210 215 220
Phe Gly Leu Leu Ala Val Phe Tyr Ala Ile Lys Leu Leu Val Ala Ala
225 230 235 240
Lys Gly Ala Ala Trp Val Ile Asn Met Tyr Ala Ile Pro Val Leu Gly
245 250 255
Val Ser Val Phe Phe Val Leu Ile Thr Tyr Leu His His Thr His Leu
260 265 270
Ser Leu Pro His Tyr Asp Ser Thr Glu Trp Asn Trp Ile Lys Gly Ala
275 280 285
Leu Ser Thr Ile Asp Arg Asp Phe Gly Phe Leu Asn Arg Val Phe His
290 295 300
Asp Val Thr His Thr His Val Leu His His Leu Ile Ser Tyr Ile Pro
305 310 315 320
His Tyr His Ala Lys Glu Ala Arg Asp Ala Ile Lys Pro Val Leu Gly
325 330 335
Glu Tyr Tyr Lys Ile Asp Arg Thr Pro Ile Phe Lys Ala Met Tyr Arg
340 345 350
Glu Ala Lys Glu Cys Ile Tyr Ile Glu Pro Asp Glu Asp Ser Glu His
355 360 365
0050/50669 CA 02382845 2002-02-26
Lys Gly Val Phe Trp Tyr His Lys Met
370 375
