Note: Descriptions are shown in the official language in which they were submitted.
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
NOVEL HUMAN ORGANIC ANION TRANSPORTER-LIKE PROTEINS AND
POLYNUCLEOTIDES ENCODING THE SAME
The present application claims the benefit of U.S.
Provisional Applicatior_ Number 60/156,161 which was filed on
September 27, 1999 and is herein incorporated by reference in
its entirety.
1. INTRODUCTION
The present invention relates to the discovery,
identification, and characterization of novel human
polynucleotides encoding proteins that share sequence
similarity with animal organic anion transporter proteins.
The invention encompasses the described polynucleotides, host
cell expression systems, the encoded proteins, fusion
proteins, polypeptides and peptides, antibodies to the encoded
proteins and peptides, and genetically engineered animals that
either lack or over express the disclosed sequences,
antagonists and agonists of the proteins, and other compounds
that modulate the expression or activity of the proteins
encoded by the disclosed sequences that can be used for
diagnosis, drug screening, clinical trial monitoring and the
treatment of physiological disorders.
2. BACKGROUND OF THE INVENTION
Transporter proteins mediate the inflow or outflow of
compounds and/or ions across membranes. Given the
physiological importance of such activities, transporter
proteins have been subject to intense scrutiny and are proven
drug targets.
3. SUMMARY OF THE INVENTION
The present invention relates to the discovery,
identification, and characterization of nucleotides that
encode novel human proteins, and the corresponding amino acid
sequences of these proteins. The novel human proteins (NHPs)
described for the first time herein share structural
1
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
similarity with animal organic anion, and more particularly
prostaglandin, transporter proteins. As such, the NHPs
represents a new family of proteins having homologues and
orthologs across a range of phyla and species.
The novel human nucleic acid sequence described herein,
encodes alternative proteins/open reading frames (ORFs) of 536
or 535 amino acids in length (see SEQ ID NO: 2).
The invention also encompasses agonists and antagonists
of the described NHPs, including small molecules, large
molecules, mutant NHPs, or portions thereof that compete with
native NHPs, peptides, and antibodies, as well as nucleotide
sequences that can be used to inhibit the expression of the
described NHP (e.g., antisense and ribozyme molecules, and
gene or regulatory sequence replacement constructs) or to
enhance the expression of the described NHP polynucleotides
(e. g., expression constructs that place the described sequence
under the control of a strong promoter system). The present
invention also includes both transgenic animals that express a
NHP transgene, and NHP "knock-outs" (which can be conditional)
that do not express a functional NHP.
Further, the present invention also relates to processes
for identifying compounds that modulate, i.e., act as agonists
or antagonists, of NHP expression and/or NHP product activity
that utilize purified preparations of the described NHP and/or
NHP product, or cells expressing the same. Such compounds can
be used as therapeutic agents for the treatment of any of a
wide variety of symptoms associated with biological disorders
or imbalances.
4. DESCRIPTION OF THE SEQUENCE LISTING AND FIGURES
The Sequence Listing provides the sequence of the a
transporter-like ORF that encodes the described NHP amino acid
sequences.
5. DETAILED DESCRIPTION OF THE INVENTION
The NHPs, described for the first time herein, are novel
proteins that are expressed in, inter alia, human cell lines,
2
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
and human brain, pituitary, spinal cord, lymph node, trachea,
testis, heart, adipose, skin, pericardium, and hypothalamus
cells. The described sequences were compiled from gene
trapped cDNAs and clones isolated from a human lymph node cDNA
library (Edge Biosystems, Gaithersburg, MD).
The present invention encompasses the nucleotides
presented in the Sequence Listing, host cells expressing such
nucleotides, the expression products of such nucleotides, and:
(a) nucleotides that encode mammalian homologs of the
described sequence, including the specifically described NHP,
and the NHP products; (b) nucleotides that encode one or more
portions of the NHP that correspond to functional domains, and
the polypeptide products specified by such nucleotide
sequences, including but not limited to the novel regions of
any active domain(s); (c) isolated nucleotides that encode
mutant versions, engineered or naturally occurring, of the
described NHP in which all or a part of at least one domain is
deleted or altered, and the polypeptide products specified by
such nucleotide sequences, including but not limited to
soluble proteins and peptides in which all or a portion of the
signal sequence in deleted; (d) nucleotides that encode
chimeric fusion proteins containing all or a portion of a
coding region of an NHP, or one of its domains (e.g., a
receptor/ligand binding domain, accessory protein/self-
association domain, etc.) fused to another peptide or
polypeptide; or (e) therapeutic or diagnostic derivatives of
the described polynucleotides such as oligonucleotides,
antisense polynucleotides, ribozymes, dsRNA, or gene therapy
constructs comprising a sequence first disclosed in the
Sequence Listing.
As discussed above, the present invention includes:
(a) the human DNA sequences presented in the Sequence Listing
(and vectors comprising the same) and additionally
contemplates any nucleotide sequence encoding a contiguous NHP
open reading frame (ORF) that hybridizes to a complement of a
DNA sequence presented in the Sequence Listing under highly
stringent conditions, e.g., hybridization to filter-bound DNA
3
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
in 0.5 M NaHP04, 7o sodium dodecyl sulfate (SDS), 1 mM EDTA at
65°C, and washing in 0.lxSSC/0.1o SDS at 68°C (Ausubel F.M. et
al., eds., 1989, Current Protocols in Molecular Biology, Vol.
I, Green Publishing Associates, Inc., and John Wiley & sons,
Inc., New York, at p. 2.10.3) and encodes a functionally
equivalent gene product. Additionally contemplated are any
nucleotide sequences that hybridize to the complement of the
DNA sequence that encode and express an amino acid sequence
presented in the Sequence Listing under moderately stringent
conditions, e.g., washing in 0.2xSSC/0.1o SDS at 42°C (Ausubel
et al., 1989, supra), yet still encode a functionally
equivalent NHP product. Functional equivalents of a NHP
include naturally occurring NHPs present in other species and
mutant NHPs whether naturally occurring or engineered (by site
directed mutagenesis, gene shuffling, directed evolution as
described in, for example, U.S. Patent No. 5,837,458). The
invention also includes degenerate nucleic acid variants of
the disclosed NHP polynucleotide sequences.
Additionally contemplated are polynucleotides encoding
NHP ORFs, or their functional equivalents, encoded by
polynucleotide sequences that are about 99, 95, 90, or about
85 percent similar to corresponding regions of SEQ ID N0:1 (as
measured by BLAST sequence comparison analysis using, for
example, the GCG sequence analysis package using default
parameters).
The invention also includes nucleic acid molecules,
preferably DNA molecules, that hybridize to, and are therefore
the complements of, the described NHP nucleotide sequences.
Such hybridization conditions may be highly stringent or less
highly stringent, as described above. In instances where the
nucleic acid molecules are deoxyoligonucleotides ("DNA
oligos"), such molecules are generally about 16 to about 100
bases long, or about 20 to about 80, or about 34 to about 45
bases long, or any variation or combination of sizes
represented therein that incorporate a contiguous region of
sequence first disclosed in the Sequence Listing. Such
oligonucleotides can be used in conjunction with the
4
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
polymerase chain reaction (PCR) to screen libraries, isolate
clones, and prepare cloning and sequencing templates, etc.
Alternatively, such NHP oligonucleotides can be used as
hybridization probes for screening libraries, and assessing
gene expression patterns (particularly using a micro array or
high-throughput "chip" format). Additionally, a series of the
described NHP oligonucleotide sequences, or the complements
thereof, can be used to represent all or a portion of the
described NHP sequences. The oligonucleotides, typically
between about 16 to about 40 (or any whole number within the
stated range) nucleotides in length may partially overlap each
other and/or the NHP sequence may be represented using
oligonucleotides that do not overlap. Accordingly, the
described NHP polynucleotide sequences shall typically
comprise at least about two or three distinct oligonucleotide
sequences of at least about 18, and preferably about 25,
nucleotides in length that are each first disclosed in the
described Sequence Listing. Such oligonucleotide sequences
may begin at any nucleotide present within a sequence in the
Sequence Listing and proceed in either a sense (5'-to-3')
orientation vis-a-vis the described sequence or in an
antisense orientation.
For oligonucleotide probes, highly stringent conditions
may refer, e.g., to washing in 6xSSC/0.05o sodium
pyrophosphate at 37°C (for 14-base oligos), 48°C (for 17-base
oligos) , 55°C (for 20-base oligos) , and 60 °C (for 23-base
oligos). These nucleic acid molecules may encode or act as
NHP sequence antisense molecules, useful, for example, in NHP
sequence regulation (for and/or as antisense primers in
amplification reactions of NHP gene nucleic acid sequences).
With respect to NHP gene regulation, such techniques can be
used to regulate biological functions. Further, such
sequences can be used as part of ribozyme and/or triple helix
sequences that are also useful for NHP sequence regulation.
Inhibitory antisense or double stranded oligonucleotides
can additionally comprise at least one modified base moiety
which is selected from the group including but not limited to
5
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,
hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-
2-thiouridine, 5-carboxymethylaminomethyluracil,
dihydrouracil, beta-D-galactosylqueosine, inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine,
3-methylcytosine, 5-methylcytosine, N6-adenine,
7-methylguanine, 5-methylaminomethyluracil,
5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine,
5'-methoxycarboxymethyluracil, 5-methoxyuracil,
2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid
(v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine,
5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-
5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-
carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
The antisense oligonucleotide can also comprise at least
one modified sugar moiety selected from the group including
but not limited to arabinose, 2-fluoroarabinose, xylulose, and
hexose.
In yet another embodiment, the antisense oligonucleotide
will comprise at least one modified phosphate backbone
selected from the group consisting of a phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate,
a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, and a formacetal or analog thereof.
In yet another embodiment, the antisense oligonucleotide
is an a-anomeric oligonucleotide. An a-anomeric
oligonucleotide forms specific double-stranded hybrids with
complementary RNA in which, contrary to the usual (3-units, the
strands run parallel to each other (Gautier et al., 1987,
Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-
methylribonucleotide ( moue et al., 1987, Nucl. Acids Res.
15:6131-6148), or a chimeric RNA-DNA analogue (moue et al.,
1987, FEBS Lett. 215:327-330). Alternatively, double stranded
RNA can be used to disrupt the expression and function of a
6
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
targeted NHP. Oligonucleotides of the invention can be
synthesized by standard methods known in the art, e.g. by use
of an automated DNA synthesizer (such as are commercially
available from Biosearch, Applied Biosystems, etc.). As
examples, phosphorothioate oligonucleotides can be synthesized
by the method of Stein et al. (1988, Nucl. Acids Res.
16:3209), and methylphosphonate oligonucleotides can be
prepared by use of controlled pore glass polymer supports
(Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-
7451), etc.
Low stringency conditions are well known to those of
skill in the art, and will vary predictably depending on the
specific organisms from which the library and the labeled
sequences are derived. For guidance regarding such conditions
see, for example, Sambrook et al., 1989, Molecular Cloning, A
Laboratory Manual (and periodic updates thereof), Cold Springs
Harbor Press, N.Y.; and Ausubel et al., 1989, Current
Protocols in Molecular Biology, Green Publishing Associates
and Wiley Interscience, N.Y.
Alternatively, suitably labeled NHP nucleotide probes can
be used to screen a human genomic library using appropriately
stringent conditions or by PCR. The identification and
characterization of human genomic clones is helpful for
identifying polymorphisms (including, but not limited to,
nucleotide repeats, microsatellite alleles, single nucleotide
polymorphisms, or coding single nucleotide polymorphisms),
determining the genomic structure of a given locus/allele, and
designing diagnostic tests. For example, sequences derived
from regions adjacent to the intron/exon boundaries of the
human gene can be used to design primers for use in
amplification assays to detect mutations within the exons,
introns, splice sites (e. g., splice acceptor and/or donor
sites), etc., that can be used in diagnostics and
pharmacogenomics.
Further, a NHP sequence homolog can be isolated from
nucleic acid from an organism of interest by performing PCR
using two degenerate or "wobble" oligonucleotide primer pools
7
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
designed on the basis of amino acid sequences within the NHP
products disclosed herein. The template for the reaction may
be total RNA, mRNA, and/or cDNA obtained by reverse
transcription of mRNA prepared from, for example, human or
non-human cell lines or tissue, such as prostate, rectum,
colon, or adrenal gland, known or suspected to express an
allele of a NHP sequence. The PCR product can be
subcloned and sequenced to ensure that the amplified sequences
represent the sequence of the desired NHP. The PCR fragment
can then be used to isolate a full length cDNA clone by a
variety of methods. For example, the amplified fragment can
be labeled and used to screen a cDNA library, such as a
bacteriophage cDNA library. Alternatively, the labeled
fragment can be used to isolate genomic clones via the
screening of a genomic library.
PCR technology can also be used to isolate full length
cDNA sequences. For example, RNA can be isolated, following
standard procedures, from an appropriate cellular or tissue
source (i.e., one known, or suspected, to express NHP
sequence, such as, for example, testis tissue). A reverse
transcription (RT) reaction can be performed on the RNA using
an oligonucleotide primer specific for the most 5' end of the
amplified fragment for the priming of first strand synthesis.
The resulting RNA/DNA hybrid may then be "tailed" using a
standard terminal transferase reaction, the hybrid may be
digested with RNase H, and second strand synthesis may then be
primed with a complementary primer. Thus, cDNA sequences
upstream of the amplified fragment can be isolated. For a
review of cloning strategies that can be used, see e.g.,
Sambrook et al., 1989, supra.
A cDNA encoding a mutant NHP sequence can be isolated,
for example, by using PCR. In this case, the first cDNA
strand may be synthesized by hybridizing an oligo-dT
oligonucleotide to mRNA isolated from tissue known or
suspected to be expressed in an individual putatively carrying
a mutant NHP allele, and by extending the new strand with
reverse transcriptase. The second strand of the cDNA is then
8
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
synthesized using an oligonucleotide that hybridizes
specifically to the 5' end of the normal sequence. Using
these two primers, the product is then amplified via PCR,
optionally cloned into a suitable vector, and subjected to DNA
sequence analysis through methods well known to those of skill
in the art. By comparing the DNA sequence of the mutant NHP
allele to that of a corresponding normal NHP allele, the
mutations) responsible for the loss or alteration of function
of the mutant NHP sequence product can be ascertained.
Alternatively, a genomic library can be constructed using
DNA obtained from an individual suspected of or known to carry
a mutant NHP allele (e. g., a person manifesting a NHP-
associated phenotype such as, for example, immune disorders,
obesity, high blood pressure, etc.), or a cDNA library can be
constructed using RNA from a tissue known, or suspected, to
express a mutant NHP allele. A normal NHP sequence, or any
suitable fragment thereof, can then be labeled and used as a
probe to identify the corresponding mutant NHP allele in such
libraries. Clones containing mutant NHP sequence can then be
purified and subjected to sequence analysis according to
methods well known to those skilled in the art.
Additionally, an expression library can be constructed
utilizing cDNA synthesized from, for example, RNA isolated
from a tissue known, or suspected, to express a mutant NHP
allele in an individual suspected of or known to carry such a
mutant allele. In this manner, gene products made by the
putatively mutant tissue may be expressed and screened using
standard antibody screening techniques in conjunction with
antibodies raised against a normal NHP product, as described
below. (For screening techniques, see, for example, Harlow,
E. and Lane, eds., 1988, "Antibodies: A Laboratory Manual",
Cold Spring Harbor Press, Cold Spring Harbor.)
Additionally, screening can be accomplished by screening with
labeled NHP fusion proteins, such as, for example, alkaline
phosphatase-NHP or NHP-alkaline phosphatase fusion proteins.
In cases where a NHP mutation results in an expressed gene
product with altered function (e. g., as a result of a missense
9
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
or a frameshift mutation), polyclonal antibodies to a NHP are
likely to cross-react with a corresponding mutant NHP sequence
product. Library clones detected via their reaction with such
labeled antibodies can be purified and subjected to sequence
analysis according to methods well known in the art.
An additional application of the described novel human
polynucleotide sequences is their use in the molecular
mutagenesis/evolution of proteins that are at least partially
encoded by the described novel sequences using, for example,
polynucleotide shuffling or related methodologies. Such
approaches are described in U.S. Patents Nos. 5,830,721 and
5,837,458 which are herein incorporated by reference in their
entirety.
The invention also encompasses (a) DNA vectors that
contain any of the foregoing NHP coding sequences and/or their
complements (i.e., antisense); (b) DNA expression vectors that
contain any of the foregoing NHP coding sequences operatively
associated with a regulatory element that directs the
expression of the coding sequences (for example, baculo virus
as described in U.S. Patent No. 5,869,336 herein incorporated
by reference); (c) genetically engineered host cells that
contain any of the foregoing NHP coding sequences operatively
associated with a regulatory element that directs the
expression of the coding sequences in the host cell; and (d)
genetically engineered host cells that express ar~ endogenous
NHP sequence under the control of an exogenously introduced
regulatory element (i.e., gene activation). As used herein,
regulatory elements include, but are not limited to, inducible
and non-inducible promoters, enhancers, operators and other
elements known to those skilled in the art that drive and
regulate expression. Such regulatory elements include but are
not limited to the human cytomegalovirus (hCMV) immediate
early gene, regulatable, viral elements (particularly
retroviral LTR promoters) the early or late promoters of SV40
adenovirus, the 1ac system, the trp system, the TAC system,
the TRC system, the major operator and promoter regions of
phage lambda, the control regions of fd coat protein, the
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
promoter for 3-phosphoglycerate kinase (PGK), the promoters of
acid phosphatase, and the promoters of the yeast a-mating
factors.
Where, as in the present instance, some of the described
NHP peptides or polypeptides are thought to be membrane
associated, expression systems can be engineered that produce
soluble derivatives of a NHP (corresponding to a NHP
extracellular and/or intracellular domains, or truncated
polypeptides lacking one or more transmembrane domains) and/or
NHP fusion protein products (especially NHP-Ig fusion
proteins, i.e., fusions of a NHP domain, e.g., ECD, ATM to an
IgFc), NHP antibodies and anti-idiotypic antibodies (including
Fab fragments) which can be used in therapeutic applications.
Preferably, the above expression systems are engineered to
allow the desired peptide or polypeptide to be recovered from
the culture media. It should also be noted that a sequence
roughly similar to a sequence present near the 3' region of
the described ORF has been reported as a human secreted
protein in gene 28 clone HLHSH36 so it remains possible that
one or more regions or domains of the described protein
circulates as a soluble molecule within the body.
The present invention also encompasses antibodies and
anti-idiotypic antibodies (including Fab fragments),
antagonists and agonists of the NHP, as well as compounds or
nucleotide constructs that inhibit expression of the NHP
coding sequence (transcription factor inhibitors, antisense
and ribozyme molecules, or gene or regulatory sequence
replacement constructs), or promote the expression of a NHP
(e.g., expression constructs in which NHP coding sequences are
operatively associated with expression control elements such
as promoters, promoter/enhancers, etc.).
The NHP or NHP peptides, NHP fusion proteins, NHP
nucleotide sequences, antibodies, antagonists and agonists can
be useful for the detection of mutant NHPs or inappropriately
expressed NHPs for the diagnosis of disease. The NHP proteins
or peptides, NHP fusion proteins, NHP nucleotide sequences,
host cell expression systems, antibodies, antagonists,
11
SUBSTITUTE SHEET (RULE 26l
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
agonists and genetically engineered cells and animals can be
used for screening for drugs (or high throughput screening of
combinatorial libraries) effective in the treatment of the
symptomatic or phenotypic manifestations of perturbing the
normal function of NHP in the body. The use of engineered
host cells and/or animals can offer an advantage in that such
systems allow not only for the identification of compounds
that bind to the endogenous receptor/ligand of a NHP, but can
also identify compounds that trigger NHP-mediated activities
or pathways.
Finally, the NHP products can be used as therapeutics.
For example, soluble derivatives such as NHP peptides/domains
corresponding the NHP, NHP fusion protein products (especially
NHP-Ig fusion proteins, i.e., fusions of a NHP, or a domain of
a NHP, to an IgFc), NHP antibodies and anti-idiotypic
antibodies (including Fab fragments), antagonists or agonists
(including compounds that modulate or act on downstream
targets in a NHP-mediated pathway) can be used to directly
treat diseases or disorders. For instance, the administration
of an effective amount of soluble NHP, or a NHP-IgFc fusion
protein or an anti-idiotypic antibody (or its Fab) that mimics
the NHP could activate or effectively antagonize the
endogenous NHP or a protein interactive therewith. Nucleotide
constructs encoding such NHP products can be used to
genetically engineer host cells to express such products in
vivo; these genetically engineered cells function as
"bioreactors" in the body delivering a continuous supply of a
NHP, a NHP peptide, or a NHP fusion protein to the body.
Nucleotide constructs encoding functional NHPs, mutant NHPs,
as well as antisense and ribozyme molecules can also be used
in "gene therapy" approaches for the modulation of NHP
expression. Thus, the invention also encompasses
pharmaceutical formulations and methods for treating
biological disorders.
Various aspects of the invention are described in greater
detail in the subsections below.
12
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
5.1 THE NHP SEQUENCES
The cDNA sequence and the corresponding deduced amino
acid sequence of the described NHP are presented in the
Sequence Listing. The NHP coding sequence was obtained from
human cDNA libraries using probes and/or primers generated
from human gene trapped sequence tags. The described ORF has
a predicted hydrophobic leader sequence characteristic of
membrane proteins.
Expression analysis has provided evidence that the
described NHPs can be expressed in human tissues as well as
gene trapped human cells. In addition to the organic ion
transporter proteins discussed above, the described NHP shares
significant similarity to a range of prostaglandin
transporters. Given the physiological importance of
prostaglandins, their transporters have been subject to
intense scrutiny as exemplified in U.S. Patent No. 5,792,851
herein incorporated by reference in its entirety.
The described sequences have several features of note
including the fact that the described ORF initiates with
tandem ATG codons, and an alternative form of the transcript
has been identified that deletes sequences 103-151 from SEQ ID
N0:3 (upstream from the tandem initiation codons). Where
translation initiates from the second of the two initiation
codons, the resulting NHP will be one amino acid shorter (on
the 5' end) than the NHP product described in SEQ ID N0:2.
5.2 NHPS AND NHP POLYPEPTIDES
NHPs, polypeptides, peptide fragments, mutated,
truncated, or deleted forms of the NHPs, and/or NHP fusion
proteins can be prepared for a variety of uses. These uses
include but are not limited to the generation of antibodies,
as reagents in diagnostic assays, the identification of other
cellular gene products related to a NHP, as reagents in assays
for screening for compounds that can be as pharmaceutical
reagents useful in the therapeutic treatment of mental,
biological, or medical disorders and disease.
13
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
The Sequence Listing discloses the amino acid sequences
encoded by the described NHP coding sequence. The NHP has
initiator methionines in DNA sequence contexts consistent with
a translation initiation site.
The NHP amino acid sequences of the invention include the
amino acid sequence presented in the Sequence Listing as well
as analogues and derivatives thereof. Further, corresponding
NHP homologues from other species are encompassed by the
invention. In fact, any NHP protein encoded by the NHP
nucleotide sequences described above are within the scope of
the invention, as are any novel polynucleotide sequences
encoding all or any novel portion of an amino acid sequence
presented in the Sequence Listing. The degenerate nature of
the genetic code is well known, and, accordingly, each amino
acid presented in the Sequence Listing, is generically
representative of the well known nucleic acid "triplet" codon,
or in many cases codons, that can encode the amino acid. As
such, as contemplated herein, the amino acid sequences
presented in the Sequence Listing, when taken together with
the genetic code (see, for example, Table 4-1 at page 109 of
"Molecular Cell Biology", 1986, J. Darnell et al. eds.,
Scientific American Books, New York, NY, herein incorporated
by reference) are generically representative of all the
various permutations and combinations of nucleic acid
sequences that can encode such amino acid sequences.
The invention also encompasses proteins that are
functionally equivalent to the NHPs encoded by the presently
described nucleotide sequences as judged by any of a number of
criteria, including, but not limited to, the ability to bind
and cleave a substrate of a NHP, or the ability to effect an
identical or complementary downstream pathway, or a change in
cellular metabolism (e. g., proteolytic activity, ion flux,
tyrosine phosphorylation, etc.). Such functionally equivalent
NHP proteins include, but are not limited to, additions or
substitutions of amino acid residues within the amino acid
sequence encoded by the NHP nucleotide sequences described
above, but which result in a silent change, thus producing a
14
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
functionally equivalent gene product. Amino acid
substitutions may be made on the basis of similarity in
polarity, charge, solubility, hydrophobicity, hydrophilicity,
and/or the amphipathic nature of the residues involved. For
example, nonpolar (hydrophobic) amino acids include alanine,
leucine, isoleucine, valine, proline, phenylalanine,
tryptophan, and methionine; polar neutral amino acids include
glycine, serine, threonine, cysteine, tyrosine, asparagine,
and glutamine; positively charged (basic) amino acids include
arginine, lysine, and histidine; and negatively charged
(acidic) amino acids include aspartic acid and glutamic acid.
A variety of host-expression vector systems can be used
to express the NHP nucleotide sequences of the invention.
Where, as in the present instance, the NHP peptide or
polypeptide is thought to be a soluble or secreted molecule,
the peptide or polypeptide can be recovered from the culture
media. Such expression systems also encompass engineered host
cells that express a NHP, or functional equivalent, in situ.
Purification or enrichment of a NHP from such expression
systems can be accomplished using appropriate detergents and
lipid micelles and methods well known to those skilled in the
art. However, such engineered host cells themselves may be
used in situations where it is important not only to retain
the structural and functional characteristics of the NHP, but
to assess biological activity, e.g., in drug screening assays.
The expression systems that may be used for purposes of
the invention include but are not limited to microorganisms
such as bacteria (e. g., E. coli, B. subtilis) transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA
expression vectors containing NHP nucleotide sequences; yeast
(e. g., Saccharomyces, Pichia) transformed with recombinant
yeast expression vectors containing NHP nucleotide sequences;
insect cell systems infected with recombinant virus expression
vectors (e. g., baculovirus) containing NHP sequences; plant
cell systems infected with recombinant virus expression
vectors (e. g., cauliflower mosaic virus, CaMV; tobacco mosaic
virus, TMV) or transformed with recombinant plasmid expression
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
vectors (e. g., Ti plasmid) containing NHP nucleotide
sequences; or mammalian cell systems (e. g., COS, CHO, BHK,
293, 3T3) harboring recombinant expression constructs
containing promoters derived from the genome of mammalian
cells (e. g., metallothionein promoter) or from mammalian
viruses (e. g., the adenovirus late promoter; the vaccinia
virus 7.5K promoter).
In bacterial systems, a number of expression vectors may
be advantageously selected depending upon the use intended for
the NHP product being expressed. For example, when a large
quantity of such a protein is to be produced for the
generation of pharmaceutical compositions of or containing
NHP, or for raising antibodies to NHP, vectors that direct the
expression of high levels of fusion protein products that are
readily purified may be desirable. Such vectors include, but
are not limited, to the E. coli expression vector pUR278
(Ruther et al., 1983, EMBO J. 2:1791), in which a NHP coding
sequence may be ligated individually into the vector in frame
with the lacZ coding region so that a fusion protein is
produced; pIN vectors (Inouye & Inouye, 1985, Nucleic Acids
Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem.
264:5503-5509); and the like. pGEX vectors may also be used
to express foreign polypeptides as fusion proteins with gluta-
thione S-transferase (GST). In general, such fusion proteins
are soluble and can easily be purified from lysed cells by
adsorption to glutathione-agarose beads followed by elution in
the presence of free glutathione. The PGEX vectors are
designed to include thrombin or factor Xa protease cleavage
sites so that the cloned target gene product can be released
from the GST moiety.
In an insect system, Autographa californica nuclear
polyhidrosis virus (AcNPV) is used as a vector to express
foreign sequences. The virus grows in Spodoptera frugiperda
cells. A NHP coding sequence may be cloned individually into
non-essential regions (for example the polyhedrin gene) of the
virus and placed under control of an AcNPV promoter (for
example the polyhedrin promoter). Successful insertion of NHP
16
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
coding sequence will result in inactivation of the polyhedrin
gene and production of non-occluded recombinant virus (i.e.,
virus lacking the proteinaceous coat coded for by the
polyhedrin gene). These recombinant viruses are then used to
infect Spodoptera frugiperda cells in which the inserted
sequence is expressed (e.g., see Smith et al., 1983, J.
Virol. 46: 584; Smith, U.S. Patent No. 4,215,051).
In mammalian host cells, a number of viral-based
expression systems may be utilized. In cases where an
adenovirus is used as an expression vector, the NHP nucleotide
sequence of interest may be ligated to an adenovirus
transcription/translation control complex, e.g., the late
promoter and tripartite leader sequence. This chimeric gene
may then be inserted in the adenovirus genome by in vitro or
in vivo recombination. Insertion in a non-essential region of
the viral genome (e.g., region E1 or E3) will result in a
recombinant virus that is viable and capable of expressing a
NHP product in infected hosts (e. g., See Logan & Shenk, 1984,
Proc. Natl. Acad. Sci. USA 81:3655-3659). Specific initiation
signals may also be required for efficient translation of
inserted NHP nucleotide sequences. These signals include the
ATG initiation codon and adjacent sequences. In cases where
the entire NHP coding sequence or cDNA, including its own
initiation codon and adjacent sequences, is inserted into the
appropriate expression vector, no additional translational
control signals may be needed. However, in cases where only a
portion of a NHP coding sequence is inserted, exogenous
translational control signals, including, perhaps, the ATG
initiation codon, must be provided. Furthermore, the
initiation codon must be in phase with the reading frame of
the desired coding sequence to ensure translation of the
entire insert. These exogenous translational control signals
and initiation codons can be of a variety of origins, both
natural and synthetic. The efficiency of expression may be
enhanced by the inclusion of appropriate transcription
enhancer elements, transcription terminators, etc. (See
Bittner et al., 1987, Methods in Enzymol. 153:516-544).
17
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
In addition, a host cell strain may be chosen that
modulates the expression of the inserted sequences, or
modifies and processes the gene product in the specific
fashion desired. Such modifications (e.g., glycosylation) and
processing (e.g., cleavage) of protein products may be
important for the function of the protein. Different host
cells have characteristic and specific mechanisms for the
post-translational processing and modification of proteins and
gene products. Appropriate cell lines or host systems can be
chosen to ensure the correct modification and processing of
the foreign protein expressed. To this end, eukaryotic host
cells which possess the cellular machinery for proper
processing of the primary transcript, glycosylation, and
phosphorylation of the gene product may be used. Such
mammalian host cells include, but are not limited to, CHO,
VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and in particular,
human cell lines.
For long-term, high-yield production of recombinant
proteins, stable expression is preferred. For example, cell
lines which stably express the NHP sequences described above
can be engineered. Rather than using expression vectors which
contain viral origins of replication, host cells can be
transformed with DNA controlled by appropriate expression
control elements (e. g., promoter, enhancer sequences,
transcription terminators, polyadenylation sites, etc.), and a
selectable marker. Following the introduction of the foreign
DNA, engineered cells may be allowed to grow for 1-2 days in
an enriched media, and then are switched to a selective media.
The selectable marker in the recombinant plasmid confers
resistance to the selection and allows cells to stably
integrate the plasmid into their chromosomes and grow to form
foci which in turn can be cloned and expanded into cell lines.
This method may advantageously be used to engineer cell lines
which express the NHP product. Such engineered cell lines may
be particularly useful in screening and evaluation of
compounds that affect the endogenous activity of the NHP
product.
18
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
A number of selection systems may be used, including but
not limited to the herpes simplex virus thymidine kinase
(Wigler, et al., 1977, Cell 11:223), hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc.
Natl. Acad. Sci. USA 48:2026), and adenine
phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817)
genes can be employed in tk-, hgprt- or aprt- cells,
respectively. Also, antimetabolite resistance can be used as
the basis of selection for the following genes: dhfr, which
confers resistance to methotrexate (Wigler, et al., 1980,
Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc.
Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance
to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad.
Sci. USA 78:2072); neo, which confers resistance to the
aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol.
Biol. 150:1); and hygro, which confers resistance to
hygromycin (Santerre, et al., 1984, Gene 30:147).
Alternatively, any fusion protein can be readily purified
by utilizing an antibody specific for the fusion protein being
expressed. For example, a system described by Janknecht et
al. allows for the ready purification of non-denatured fusion
proteins expressed in human cell lines (Janknecht, et al.,
1991, Proc. Natl. Acad. Sci. USA 88:8972-8976). In this
system, the gene of interest is subcloned into a vaccinia
recombination plasmid such that the gene's open reading frame
is translationally fused to an amino-terminal tag consisting
of six histidine residues. Extracts from cells infected with
recombinant vaccinia virus are loaded onto Ni2+~nitriloacetic
acid-agarose columns and histidine-tagged proteins are
selectively eluted with imidazole-containing buffers.
5.3 ANTIBODIES TO NHP PRODUCTS
Antibodies that specifically recognize one or more
epitopes of a NHP, or epitopes of conserved variants of a NHP,
or peptide fragments of a NHP are also encompassed by the
invention. Such antibodies include but are not limited to
polyclonal antibodies, monoclonal antibodies (mAbs), humanized
19
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
or chimeric antibodies, single chain antibodies, Fab
fragments, F(ab')2 fragments, fragments produced by a Fab
expression library, anti-idiotypic (anti-Id) antibodies, and
epitope-binding fragments of any of the above.
The antibodies of the invention may be used, for example,
in the detection of NHP in a biological sample and may,
therefore, be utilized as part of a diagnostic or prognostic
technique whereby patients may be tested for abnormal amounts
of NHP. Such antibodies may also be utilized in conjunction
with, for example, compound screening schemes for the
evaluation of the effect of test compounds on expression
and/or activity of a NHP coding sequence product.
Additionally, such antibodies can be used in.conjunction gene
therapy to, for example, evaluate the normal and/or engineered
NHP-expressing cells prior to their introduction into the
patient. Such antibodies may additionally be used as a method
for the inhibition of abnormal NHP activity. Thus, such
antibodies may, therefore, be utilized as part of treatment
methods.
For the production of antibodies, various host animals
may be immunized by injection with the NHP, an NHP peptide
(e. g., one corresponding the a functional domain of an NHP),
truncated NHP polypeptides (NHP in which one or more domains
have been deleted), functional equivalents of the NHP or
mutated variant of the NHP. Such host animals may include but
are not limited to pigs, rabbits, mice, goats, and rats, to
name but a few. Various adjuvants may be used to increase the
immunological response, depending on the host species,
including but not limited to Freund's adjuvant (complete and
incomplete), mineral salts such as aluminum hydroxide or
aluminum phosphate, surface active substances such as
lysolecithin, pluronic polyols, polyanions, peptides, oil
emulsions, and potentially useful human adjuvants such as BCG
(bacille Calmette-Guerin) and Corynebacterium parvum.
Alternatively, the immune response could be enhanced by
combination and or coupling with molecules such as keyhole
limpet hemocyanin, tetanus toxoid, diptheria toxoid,
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/LTS00/26630
ovalbumin, cholera toxoid or fragments thereof. Polyclonal
antibodies are heterogeneous populations of antibody molecules
derived from the sera of the immunized animals.
Monoclonal antibodies, which are homogeneous populations
of antibodies to a particular antigen, can be obtained by any
technique which provides for the production of antibody
molecules by continuous cell lines in culture. These include,
but are not limited to, the hybridoma technique of Kohler and
Milstein, (1975, Nature 256:495-497; and U.S. Patent No.
4,376,110), the human B-cell hybridoma technique (Kosbor et
al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc.
Natl. Acad. Sci. USA 80:2026-2030), and the EBV-hybridoma
technique (Cole et al., 1985, Monoclonal Antibodies And Cancer
Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies may
be of any immunoglobulin class including IgG, IgM, IgE, IgA,
IgD and any subclass thereof. The hybridoma producing the mAb
of this invention may be cultivated in vitro or in vivo.
Production of high titers of mAbs in vivo makes this the
presently preferred method of production.
In addition, techniques developed for the production of
"chimeric antibodies" (Morrison et al., 1984, Proc. Natl.
Acad. Sci., 81:6851-6855; Neuberger et al., 1984, Nature,
312:604-608; Takeda et al., 1985, Nature, 324:452-454) by
splicing the genes from a mouse antibody molecule of
appropriate antigen specificity together with genes from a
human antibody molecule of appropriate biological activity can
be used. A chimeric antibody is a molecule in which different
portions are derived from different animal species, such as
those having a variable region derived from a murine mAb and a
human immunoglobulin constant region. Such technologies are
described in U.S. Patents Nos. 6,075,181 and 5,877,397 and
their respective disclosures which are herein incorporated by
reference in their entirety.
Alternatively, techniques described for the production of
single chain antibodies (U. S. Patent 4,946,778; Bird, 1988,
Science 242:423-426; Huston et al., 1988, Proc. Natl. Acad.
Sci. USA 85:5879-5883; and Ward et al., 1989, Nature 334:544-
21
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
546) can be adapted to produce single chain antibodies against
NHP coding sequence products. Single chain antibodies are
formed by linking the heavy and light chain fragments of the
Fv region via an amino acid bridge, resulting in a single
chain polypeptide.
Antibody fragments which recognize specific epitopes may
be generated by known techniques. For example, such fragments
include, but are not limited to: the F(ab')2 fragments which
can be produced by pepsin digestion of the antibody molecule
and the Fab fragments which can be generated by reducing the
disulfide bridges of the F(ab')2 fragments. Alternatively, Fab
expression libraries may be constructed (Huse et al., 1989,
Science, 246:1275-1281) to allow rapid and easy identification
of monoclonal Fab fragments with the desired specificity.
Antibodies to NHP can, in turn, be utilized to generate
anti-idiotype antibodies that "mimic" the NHP, using
techniques well known to those skilled in the art. (See,
e.g., Greenspan & Bona, 1993, FASEB J 7(5):437-444; and
Nissinoff, 1991, J. Immunol. 147(8):2429-2438). For example
antibodies which bind to a NHP domain and competitively
inhibit the binding of NHP to its cognate receptor can be used
to generate anti-idiotypes that "mimic" the NHP and,
therefore, bind, activate, or neutralize a NHP, NHP receptor,
or NHP ligand. Such anti-idiotypic antibodies or Fab
fragments of such anti-idiotypes can be used in therapeutic
regimens involving a NHP mediated pathway.
The present invention is not to be limited in scope by
the specific embodiments described herein, which are intended
as single illustrations of individual aspects of the
invention, and functionally equivalent methods and components
are within the scope of the invention. Indeed, various
modifications of the invention, in addition to those shown and
described herein will become apparent to those skilled in the
art from the foregoing description. Such modifications are
intended to fall within the scope of the appended claims. All
cited publications, patents, and patent applications are
herein incorporated by reference in their entirety.
22
SUBSTITUTE SHEET (RULE 26)
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
SEQUENCE LISTING
<110> Turner, C. Alexander Jr.
Donoho, Gregory
Wattles, Frank
Nehls, Michael
Friedrich, Glenn
Zambrowicz, Brian
Sands, Arthur T.
<120> NOVEL HUMAN ORGANIC ANION
TRANSPORTER-LIKE PROTEINS AND POLYNUCLEOTIDES ENCODING THE
SAME
<130> LEX-0045-PCT
<150> US 60/156,161
<151> 1999-09-27
<160> 3
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 1608
<212> DNA
<213> homo Sapiens
<400>
1
atgatgtacttgctgctcattggggcccaggtgctcctgggcatcggtgctacccctgtg60
cagcccctgggcgtctcctacatcgacgaccacgtgcggaggaaggactcctcgctctat120
ataggaatcctgttcacgatgctggtatttggaccagcctgcgggtttatcctgggctct180
ttctgtaccaaaatctacgtggatgcggtcttcattgacacaagtaacctggacatcact240
ccggacgacccccgctggatcggagcctggtggggtggctttctgctctgcggtgcctta300
ctcttcttctcttccctcttgatgtttgggtttccacagtccctgcccccgcactcagag360
cccgccatggaaagcgagcaggccatgctctccgaaagagaatacgagagacccaagccc420
agcaacggggtcctgaggcaccccctggagccagacagcagtgcctcctgtttccagcag480
ctgagagtgatcccgaaggtcaccaagcacctgctctcaaaccctgtgttcacctgcatc540
atcctggccgcctgcatggagattgcagtggtggctggcttcgctgcctttttggggaag600
tacctggagcagcagtttaacctcaccacctcttctgccaaccagctgcttgggatgact660
gcgatcccgtgtgcttgtctgggtatcttcctgggaggtcttttggtgaagaagctcagc720
ctgtctgccctgggggccattcggatggccatgctcgtcaacctggtgtccactgcttgc780
tacgtctccttcctcttcctgggctgcgacactggccctgtggctggggttactgttccc840
tatggaaacagcacagcacctggctcagccctggacccctactcgccctgcaataataac900
tgtgaatgccaaaccgattccttcactccagtgtgtggggcagatggcatcacctacctg960
tctgcctgctttgctggctgcaacagcacgaatctcacgggctgtgcgtgcctcaccacc1020
gtccctgctgagaacgcaaccgtggttcctggaaaatgccccagtcctgggtgccaagag1080
gccttcctcactttcctctgtgtgatgtgtatctgcagcctgatcggtgccatggcacag1140
acaccctcagtcatcatcctcatcaggacagtcagccctgaactcaagtcttacgctttg1200
ggagttctttttctcctccttcgtttgttgggcttcatccctccacccctcatcttcggg1260
gctggcatcgactccacctgcctgttctggagcacgttctgtggggagcaaggcgcctgc1320
gtcctctacgacaatgtggtctaccgatacctgtatgtcagcatcgccatcgcgctcaaa1380
tccttcgccttcatcctgtacaccaccacgtggcagtgcctgaggaaaaactataaacgc1440
tacatcaaaaaccacgagggcgggctgagcaccagtgagttctttgcctctactctgacc1500
ctagacaacctggggagggaccctgtgcccgcaaaccagacacataggacaaagtttatc1560
1 / 4
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
tataacctgg aagaccatga gtggtgtgaa aacatggagt ccgtttta 1608
<210> 2
<211> 536
<212> PRT
<213> homo sapiens
<400> 2
Met Met Tyr Leu Leu Leu Ile Gly Ala Gln Val Leu Leu Gly Ile Gly
1 5 10 15
Ala Thr Pro Val Gln Pro Leu Gly Val Ser Tyr Ile Asp Asp His Val
20 25 30
Arg Arg Lys Asp Ser Ser Leu Tyr Ile Gly Ile Leu Phe Thr Met Leu
35 40 45
Val Phe Gly Pro Ala Cys Gly Phe Ile Leu Gly Ser Phe Cys Thr Lys
50 55 60
Ile Tyr Val Asp Ala Val Phe Ile Asp Thr Ser Asn Leu Asp Ile Thr
65 70 75 80
Pro Asp Asp Pro Arg Trp Ile Gly Ala Trp Trp Gly Gly Phe Leu Leu
85 90 95
Cys Gly Ala Leu Leu Phe Phe Ser Ser Leu Leu Met Phe Gly Phe Pro
100 105 110
Gln Ser Leu Pro Pro His Ser Glu Pro Ala Met Glu Ser Glu Gln Ala
115 120 125
Met Leu Ser Glu Arg Glu Tyr Glu Arg Pro Lys Pro Ser Asn Gly Val
130 135 140
Leu Arg His Pro Leu Glu Pro Asp Ser Ser Ala Ser Cys Phe Gln Gln
145 150 155 160
Leu Arg Val Ile Pro Lys Val Thr Lys His Leu Leu Ser Asn Pro Val
165 170 175
Phe Thr Cys Ile Ile Leu Ala Ala Cys Met Glu Ile Ala Val Val Ala
180 185 190
Gly Phe Ala Ala Phe Leu Gly Lys Tyr Leu Glu Gln Gln Phe Asn Leu
195 200 205
Thr Thr Ser Ser Ala Asn Gln Leu Leu Gly Met Thr Ala Ile Pro Cys
210 215 220
Ala Cys Leu Gly Ile Phe Leu Gly Gly Leu Leu Val Lys Lys Leu Ser
225 230 235 240
Leu Ser Ala Leu Gly Ala Ile Arg Met Ala Met Leu Val Asn Leu Val
245 250 255
Ser Thr Ala Cys Tyr Val Ser Phe Leu Phe Leu Gly Cys Asp Thr Gly
260 265 270
Pro Val Ala Gly Val Thr Val Pro Tyr Gly Asn Ser Thr Ala Pro Gly
275 280 285
Ser Ala Leu Asp Pro Tyr Ser Pro Cys Asn Asn Asn Cys Glu Cys Gln
290 295 300
Thr Asp Ser Phe Thr Pro Val Cys Gly Ala Asp Gly Ile Thr Tyr Leu
305 310 315 320
Ser Ala Cys Phe Ala Gly Cys Asn Ser Thr Asn Leu Thr Gly Cys Ala
325 330 335
Cys Leu Thr Thr Val Pro Ala Glu Asn Ala Thr Val Val Pro Gly Lys
340 345 350
Cys Pro Ser Pro Gly Cys Gln Glu Ala Phe Leu Thr Phe Leu Cys Val
355 360 365
Met Cys Ile Cys Ser Leu Ile Gly Ala Met Ala Gln Thr Pro Ser Val
370 375 380
2 / 4
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
Ile Ile Leu Ile Arg Thr Val Ser Pro Glu Leu Lys Ser Tyr Ala Leu
385 390 395 400
Gly Val Leu Phe Leu Leu Leu Arg Leu Leu Gly Phe Ile Pro Pro Pro
405 410 415
Leu Ile Phe Gly Ala Gly Ile Asp Ser Thr Cys Leu Phe Trp Ser Thr
420 425 430
Phe Cys Gly Glu Gln Gly Ala Cys Val Leu Tyr Asp Asn Val Val Tyr
435 440 445
Arg Tyr Leu Tyr Val Ser Ile Ala Ile Ala Leu Lys Ser Phe Ala Phe
450 455 460
Ile Leu Tyr Thr Thr Thr Trp Gln Cys Leu Arg Lys Asn Tyr Lys Arg
465 470 475 480
Tyr Ile Lys Asn His Glu Gly Gly Leu Ser Thr Ser Glu Phe Phe Ala
485 490 495
Ser Thr Leu Thr Leu Asp Asn Leu Gly Arg Asp Pro Val Pro Ala Asn
500 505 510
Gln Thr His Arg Thr Lys Phe Ile Tyr Asn Leu Glu Asp His Glu Trp
515 520 525
Cys Glu Asn Met Glu Ser Val Leu
530 535
<210> 3
<211> 2230
<212> DNA
<213> homo sapiens
<400>
3
cgcgctgctgtcagcgctgcccgagttcctgacccaccagtacaagtacgaggcgggcga60
gatccgctggggcgccgagggccgcgacgtctgcgcagccaacggctcgggcggcgacga120
ggggcccgaccccgacctcatctgccgcaaccggacggctaccaacatgatgtacttgct180
gctcattggggcccaggtgctcctgggcatcggtgctacccctgtgcagcccctgggcgt240
ctcctacatcgacgaccacgtgcggaggaaggactcctcgctctatataggaatcctgtt300
cacgatgctggtatttggaccagcctgcgggtttatcctgggctctttctgtaccaaaat360
ctacgtggatgcggtcttcattgacacaagtaacctggacatcactccggacgacccccg420
ctggatcggagcctggtggggtggctttctgctctgcggtgccttactcttcttctcttc480
cctcttgatgtttgggtttccacagtccctgcccccgcactcagagcccgccatggaaag540
cgagcaggccatgctctccgaaagagaatacgagagacccaagcccagcaacggggtcct600
gaggcaccccctggagccagacagcagtgcctcctgtttccagcagctgagagtgatccc660
gaaggtcaccaagcacctgctctcaaaccctgtgttcacctgcatcatcctggccgcctg720
catggagattgcagtggtggctggcttcgctgcctttttggggaagtacctggagcagca780
gtttaacctcaccacctcttctgccaaccagctgcttgggatgactgcgatcccgtgtgc840
ttgtctgggtatcttcctgggaggtcttttggtgaagaagctcagcctgtctgccctggg900
ggccattcggatggccatgctcgtcaacctggtgtccactgcttgctacgtctccttcct960
cttcctgggctgcgacactggccctgtggctggggttactgttccctatggaaacagcac1020
agcacctggctcagccctggacccctactcgccctgcaataataactgtgaatgccaaac1080
cgattccttcactccagtgtgtggggcagatggcatcacctacctgtctgcctgctttgc1140
tggctgcaacagcacgaatctcacgggctgtgcgtgcctcaccaccgtccctgctgagaa1200
cgcaaccgtggttcctggaaaatgccccagtcctgggtgccaagaggccttcctcacttt1260
cctctgtgtgatgtgtatctgcagcctgatcggtgccatggcacagacaccctcagtcat1320
catcctcatcaggacagtcagccctgaactcaagtcttacgctttgggagttctttttct1380
cctccttcgtttgttgggcttcatccctccacccctcatcttcggggctggcatcgactc1440
cacctgcctgttctggagcacgttctgtggggagcaaggcgcctgcgtcctctacgacaa1500
tgtggtctaccgatacctgtatgtcagcatcgccatcgcgctcaaatccttcgccttcat1560
cctgtacaccaccacgtggcagtgcctgaggaaaaactataaacgctacatcaaaaacca1620
cgagggcgggctgagcaccagtgagttctttgcctctactctgaccctagacaacctggg1680
gagggaccctgtgcccgcaaaccagacacataggacaaagtttatctataacctggaaga1740
3 / 4
CA 02385880 2002-03-27
WO 01/23566 PCT/US00/26630
ccatgagtggtgtgaaaacatggagtccgttttatagtgactaaaggagggctgaactct1800
gtattagtaatccaagggtcatttttttcttaaaaaaagaaaaaaaggttccaaaaaaaa1860
ccaaaactcagtacacacacacaggcacagatgcacacacacgcagacagacacaccgac1920
tttgtcctttttctcagcatcagagccagacaggattcagaataaggagagaatgacatc1980
gtgcggcagggtcctggaggccactcgcgcggctgggccacagagtctactttgaaggca2040
cctcatggttttcaggatgctgacagctgcaagcaacaggcactgccaaattcagggaac2100
agtggtggccagcttggaggatggacatttctggatacacatacacatacaaaacagaaa2160
acattttttaaaagaagtttcctaaaataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa2220
aaaaaaaaaa 2230
4 / 4
