Note: Descriptions are shown in the official language in which they were submitted.
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
FLOWERING TIME MODIFICATION
The present invention claims priority in part from US Provisional Application
Serial
Nos. 60/159,464 filed October 12, 1999; 60/164,132 filed November 8, 1999;
60/166,228 filed
November 17, 1999; 60/197,899 filed April 17, 2000; and Plant Trait
Modification III, filed
August 22, 2000.
FIELD OF THE INVENTION
This invention is in the field of plant molecular biology and relates to
compositions and
methods for modifying a plant's flowering time or vernalization requirements.
BACKGROUND OF THE INVENTION
In order to maximize reproductive success, plants have evolved complex
mechanisms
to ensure that flowering occurs under favorable conditions. Analysis of late
flowering mutants
and ecotypes in Arabidopsis has revealed that such mechanisms are based upon
several
genetic pathways which may contain 80 or more genes (Martinez-Zapater and
Somerville,
(1990) Plant Physiol. 92:770-776; Koornneef et al. (1991 ) Mol. Gen. Genet.
229:57-66; EM
Meyerwitz and CR Somerville Eds (1994) Arabidopsis pp 403-433 Cold Spring
Harbor
Laboratory Press, New York). Together these loci co-ordinate flowering time
with
environmental variables (e.g. day-length, temperature, light quality, and
nutrient availability)
and with the developmental stage of the plant.
Arabidopsis flowers rapidly when grown under long day conditions of 16 hours
or
continuous light, but flowers much later under short day conditions of 8 or 10
hours light.
Genes regulating this response constitute the photoperiod pathway and were
identified by
mutations that cause late flowering under long day conditions but which do not
alter flowering
in short day conditions. Examples from this group, which promote flowering in
response to
long days, include CONSTANS (CO), GIGANTEA (GI), FT, FWA, FE, FD, and FHA. A
second group of genes, which includes LUMINIDEPENDENS (LD), FCA, FVE, FY, and
FPA,
form an autonomous pathway that is active under all day-length conditions.
Mutants for this
second class of genes flower later than wild type controls irrespective of the
day length
conditions (Koornneef et al. (1991) Mol. Gen. Genet. 229:57-66; EM Meyenrvitz
and CR
Somerville Eds (1994) Arabidopsis pp 403-433 Cold Spring Harbor Laboratory
Press, New
York).
In addition to differing in their response to day-length, mutants from the
photoperiod
and autonomous pathways show~a differential response to prolonged cold
(vernalization)
treatments (Vince-Prue, (1975) Vernalization. In Photoperiodism in Plants pp
263-291,
McGraw Hill, London) Through a vernalization response, Arabidopsis ecotypes
from Northern
1
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
latitudes, such as Stockholm, are adapted to flower in the spring following
exposure to cold
winter conditions. This avoids flowering in the late summer when seed
maturation might be
curtailed by the onset of winter conditions (Reeves and Coupland, (2000) Curr.
Opin. Plant
Biol 3:37-42). When these ecotypes are grown in the laboratory they flower
late, but will flower
much earlier if subjected to a cold period of 4-6 weeks during seed
germination. In a
comparable manner, mutants from the autonomous pathway exhibit a very marked
reduction
in flowering time when subjected to vernalization. In contrast, mutants from
the photoperiod
pathway only show a minor response to cold treatments (Chandler et al., (1996)
Plant J.
10:637-644; Koornneef et al., (1998) Genetics 148:885-892). Thus,
vernalization can
overcome the requirement for the autonomous pathway conditions (Reeves and.
Coupland,
(2000) Curr. Opin. Plant Biol 3:37-42).
Two Arabidopsis genes, FLOWERING LOCUS C, FLC (also known as FLOWERING
LOCUS F, FLF) and FRIGIDA (FRI), act in conjunction to repress flowering in
the absence of
a vernalization treatment (Napp-Zinn, K. (1957) lndukt. Abstammungs.
VerebungsL 88:253-
285; Napp-Zinn K. (1985) CRC Handbook of Flowering, Vol. 1, A. H. Halevy, pp
492-503;
Clarke and Dean (1994) Mol. Gen. Genet. 248:81-89; Koornneef. et al., (1994)
Plant Journal
6:911-919; Lee et al., (1994) Plant Journal 6:903-909.) Dominant functional
alleles of FLC
and FRI are found together in Northern European Arabidopsis ecotypes such as
Pitztal and
Stockholm. These ecotypes are extremely late flowering when non-vernalized.
The widely
used laboratory ecotype Columbia contains functional alleles at only one of
these two loci and
flower slightly later than strains such as Landsberg erecfa which possess
functional alleles of
neither gene. The FRIGIDA protein sequence has not yet been published.
However, the FLC
gene has recently been cloned and shown to encode a MADS box protein (Sheldon
C. et al.,
1999, Plant Cell 11:445-458; Michaels S. and Amasino, R., 1999, Plant Cell
11:949-956).
Dominant alleles and overexpression of FLC have been reported to delay
flowering, while null
flc mutants are early flowering (Lee et al., (1994) Plant J. 6:903-909;
Michaels and Amasino,
(1999) Plant CeIJ 11:949-956; Sheldon et al., (1999) Proc. Natl. Acad. Sci.
97:3753-3758).
Thus, FLC acts to prevent premature flowering.
We have discovered transcription factors that regulate flowering time or
vernalization
requirements of plants. These transcription factors could therefore be useful
to manipulate
flowering characteristics of a plant.
SUMMARY OF THE INVENTION
In one aspect, the present invention relates to a transgenic plant comprising
a
recombinant polynucleotide. The recombinant polynucleotide comprises a
nucleotide
sequence encoding a polypeptide comprising at least 6 consecutive amino acids
of a
2
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
sequence selected from the group consisting of SEQ ID Nos. 2N, where N=1-28
but excluding
SEQ ID No. 28, and the presence of the recombinant polynucleotide alters the
flowering time
or vernalization requirements of the transgenic plant when compared with the
same trait of
another plant lacking the recombinant polynucleotide.
In one embodiment, the nucleotide sequence encodes a polypeptide comprising a
conserved domain such as 1 ) a localization domain, 2) an activation domain,
3) a repression
domain, 4) an oligomerization domain or 5) a DNA binding domain of SEQ ID Nos.
2N, where
N=1-28. In another embodiment, the recombinant polynucleotide encodes a
polypeptide
comprising a conserved domain having greater than an 84% sequence identity to
a sequence
selected from the group consisting of SEQ ID Nos. 2N, where N=1-28. In a
further
embodiment, the nucleotide sequence further comprises a promoter operably
linked to the
nucleotide sequence. The promoter may be a constitutive or inducible or tissue-
active.
In a second aspect, the present invention relates to a method for altering a
plant's
flowering time or vernalization requirements. The method comprises (a)
transforming a plant
with a recombinant polynucleotide comprising a nucleotide sequence encoding a
polypeptide
comprising at least 6 consecutive amino acids of a sequence selected from the
group
consisting of SEQ ID Nos. 2N, where N=1-28; (b) selecting transformed plants;
and (c)
identifying a transformed plant with the desired trait.
In one embodiment, the nucleotide sequence encodes a polypeptide comprising a
conserved domain such as 1 ) a localization domain, 2) an activation domain,
3) a repression
domain, 4) an oligomerization domain or 5) a DNA binding domain domain of SEQ
ID Nos.
2N, where N=1-28 but excluding SEQ ID No. 28. In another embodiment, the
recombinant
polynucleotide encodes a polypeptide comprising a conserved domain having
greater than an
84% sequence identity to a sequence selected from the group consisting of SEQ
ID Nos. 2N,
where N=1-28. In a further embodiment, the nucleotide sequence further
comprises a
promoter operably linked to the nucleotide sequence. The promoter may be a
constitutive or
inducible or tissue-active.
In a third aspect, the present invention relates to another method for
altering a plant
trait associated with flowering time or the plant's vernalization
requirements. The method
comprises (a) transforming the plant with a recombinant polynucleotide
comprising a
nucleotide sequence comprising at least 18 consecutive nucleotides of a
sequence selected
from the group consisting of SEQ ID Nos. 2N-1, where N= 1-28 but excluding SEQ
ID No. 27;
and (b) selecting said transformed plant.
In yet another aspect, the present invention is yet another method for
altering a plant's
flowering time or vernalization requirements. The method comprises (a)
providing a database
sequence; (b) comparing the database sequence with a polypeptide selected from
SEQ ID
Nos. 2N, where N= 1-28; (c) selecting a database sequence that meets selected
sequence
3
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
criteria; and (d) transforming said database sequence in the plant.
Alternatively, the database
sequence can be compared with a polynucleotide selected from SEQ ID Nos. 2N-1,
where N=
1-28.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 provides a table of exemplary polynucleotide and polypeptide
sequences of
the invention. The table includes from left to right for each sequence: the
SEQ ID No., the
internal code reference number, whether the sequence is a polynucleotide or
polypeptide
sequence, and identification of any conserved domains for the polypeptide
sequences.
Figure 2 provides a table of sequences that are homologous to the sequences
provided in the Sequence Listing. The table includes from left to right: the
SEQ ID No., the
internal code reference number, the unique Genbank sequence ID No. (NID), the
probability
that the comparison was generated by chance (P-value), and the species from
which the
homologous gene was identified.
DETAILED DESCRIPTION OF THE INVENTION
DEFINITIONS
A "recombinant polynucleotide" is a nucleotide sequence comprising a gene
coding
sequence or a fragment thereof (comprising at least 18 consecutive
nucleotides, preferably at
least 30 consecutive nucleotides, and more preferably at least 50 consecutive
nucleotides).
Additionally, the polynucleotide may comprise a promoter, an intron, an
enhancer region, a
polyadenylation site, a translation initiation site, 5' or 3' untranslated
regions, a reporter gene,
a selectable marker or the like. The polynucleotide may comprise single
stranded or double
stranded DNA or RNA. The polynucleotide may comprise modified bases or a
modified
backbone. The polynucleotide may be genomic, a transcript (such as an mRNA) or
a
processed nucleotide sequence (such as a cDNA). The polynucleotide may
comprise a
sequence in either sense or antisense orientations.
A "recombinant polynucleotide" is a polynucleotide that is not in its native
state, e.g.,
the polynucleotide is comprised of a nucleotide sequence not found in nature
or the
polynucleotide is separated from nucleotide sequences with which it typically
is in proximity or
is next to nucleotide sequences with which it typically is not in proximity.
A "recombinant polypeptide" is a polypeptide derived from the translation of a
recombinant polynucleotide or is more enriched in a cell than the polypeptide
in its natural
4
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
state in a wild type cell, e.g. more than 5% enriched, more than 10% enriched
or more than
20% enriched and is not the result of a natural response of a wild type plant
or is separated
from other components with which it is typically associated with in a cell.
A "transgenic plant" may refer to a plant that contains genetic material not
normally
found in a wild type plant of the same species, or in a naturally occurring
variety or in a
cultivar, and which has been introduced into the plant by human manipulation.
A transgenic
plant is a plant that may contain an expression vector or cassette. The
expression cassette
comprises a gene coding sequence and allows for the expression of the gene
coding
sequence. The expression cassette may be introduced into a plant by
transformation or by
breeding after transformation of a parent plant.
A transgenic plant refers to a whole plant as well as to a plant part, such as
seed, fruit,
leaf, or root, plant tissue, plant cells, protoplasts or any other plant
material, and progeny
thereof.
The phrase "altered expression" in reference to polynucleotide or polypeptide
expression refers to an expression pattern in the transgenic plant that is
different from the
expression pattern in the wild type plant or a reference; for example, by
expression in a cell
type other than a cell type in which the sequence is expressed in the wild
type plant, or by
expression at a time other than at the time the sequence is expressed in the
wild type plant, or
by a response to different inducible agents, such as hormones or environmental
signals, or at
different expression levels (either higher or lower) compared with those found
in a wild type
plant. The term also refers to lowering the levels of expression to below the
detection level or
completely abolishing expression. The resulting expression pattern may be
transient or
stable, constitutive or inducible.
A "transcription factor" (TF) refers to a polynucleotide or polypeptide that
controls the
expression of a gene or genes either directly by binding to one or more
nucleotide sequences
associated with a gene coding sequence or indirectly by affecting the level or
activity of other
polypeptides that do bind directly or indirectly to one or more nucleotide
sequences associated
with a gene coding sequence. A TF, in this definition, includes any
polypeptide that can
activate or repress transcription of a single gene or a number of genes. This
polypeptide
group includes, but is not limited to, DNA binding proteins, protein kinases,
protein
phosphatases, GTP-binding proteins and receptors.
The transcription factor sequence may comprise a whole coding sequence or a
fragment or domain of a coding sequence. A "fragment or domain", as referred
to
polypeptides, may be a portion of a polypeptide which performs at least one
biological function
of the intact polypeptide in substantially the same manner or to a similar
extent as does the
intact polypeptide. A fragment may comprise, for example, a DNA binding domain
that binds
to a specific DNA promoter region, an activation domain or a domain for
protein-protein
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
interactions. Fragments may vary in size from as few as 6 amino acids to the
length of the
intact polypeptide, but are preferably at least 30 amino acids in length and
more preferably at
least 60 amino acids in length. In reference to a nucleotide sequence "a
fragment" refers to
any sequence of at least consecutive 18 nucleotides, preferably at least 30
nucleotides, more
preferably at least 50, of any of the sequences provided herein.
Exemplary polynucleotides and polypeptides comprise a sequence provided in the
Sequence Listing as SEQ ID No. 1: 6157 (cDNA); SEQ ID No. 2: 6157 (protein);
SEQ ID No.
3: 6859 (cDNA); SEQ ID No. 4: 6859 (protein); SEQ ID No. 5: 6859.1 (cDNA); SEQ
ID No. 6:
6859.1 (protein); SEQ ID No. 7: 6859.2 (cDNA); SEQ ID No. 8: 6859.2 (protein);
SEQ ID No.
9: 61842 (cDNA); SEQ ID No. 10: 61842 (protein); SEQ ID No. 11: 61842.2
(cDNA); SEQ ID
No. 12: 61842.2 (protein); SEQ ID No. 13: 61842.6 (cDNA); SEQ ID No. 14:
61842.6
(protein); SEQ ID No. 15: 61842.7 (cDNA); SEQ ID No. 16: 61842.7 (protein);
SEQ ID No.
17: 61843 (cDNA); SEQ ID No. 18: 61843 (protein); SEQ ID No. 19: 61844 (cDNA);
SEQ ID
No. 20: 61844 (protein); SEQ ID No. 21: 61844.2 (cDNA); SEQ ID No. 22: 61844.2
(protein);
SEQ ID No. 23: 6861 (cDNA); SEQ ID No. 24: 6861 (protein); SEQ ID No. 25:
6861.1
(cDNA); SEQ ID No. 26: 6861.1 (protein); SEQ ID No. 27: 61759 (cDNA); SEQ ID
No. 28:
61759 (protein); SEQ ID No. 29: 6192 (cDNA); SEQ ID No. 30: 6192 (protein);
SEQ ID No.
31: 6234 (cDNA); SEQ ID No. 32: 6234 (protein); SEQ ID No. 33: 6361 (cDNA);
SEQ ID No.
34: 6361 (protein); SEQ ID No. 35: 6486 (cDNA); SEQ ID No. 36: 6486 (protein);
SEQ ID
No. 37: 6748 (cDNA); SEQ ID No. 38: 6748 (protein); SEQ ID No. 39: 6994
(cDNA); SEQ ID
No. 40: 6994 (protein); SEQ ID No. 41: 61335 (cDNA); SEQ ID No. 42: 61335
(protein); SEQ
ID No. 43: 6562 (cDNA); SEQ ID No. 44: 6562 (protein); SEQ ID No. 45: 6736
(cDNA); SEQ
ID No. 46: 6736 (protein); SEQ ID No. 47: 61073 (cDNA); SEQ ID No. 48: 61073
(protein);
SEQ ID No. 49: 61435 (cDNA); SEQ ID No. 50: 61435 (protein); SEQ ID No. 51:
6180
(cDNA); SEQ ID No. 52: 6180 (protein); SEQ ID No. 53: 6592 (cDNA); SEQ ID No.
54: 6592
(protein); SEQ ID No. 55: 6208 (cDNA); and SEQ ID No. 56: 6208 (protein).
A "conserved domain" refers to a polynucleotide or polypeptide fragment that
is more
conserved at a sequence level than other fragments when the polynucleotide or
polypeptide is
compared with homologous genes or proteins from other plants. The conserved
domain may
be 1 ) a localization domain, 2) an activation domain, 3) a repression domain,
4) a dimerization
or oligomerization domain, 5) a DNA binding domain or any combination thereof.
For MADS
proteins, the conserved domain is typically a DNA-binding domain.
A nucleotide sequence is "operably linked" when it is placed into a functional
relationship with another nucleotide sequence. For example, a promoter or
enhancer is
operably linked to a gene coding sequence if the presence of the promoter or
enhancer
increases the level of expression of the gene coding sequence.
6
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
"Trait" refers to a physiological, morphological, biochemical or physical
characteristic
of a plant or particular plant material or cell. This characteristic may be
visible to the human
eye, such as seed or plant size, or be measured by biochemical techniques,
such as the
protein, starch or oil content of seed or leaves or by the observation of the
expression level of
genes by employing Northerns, RT PCR, microarray gene expression assays or
reporter gene
expression systems or be measured by agricultural observations such as stress
tolerance,
yield or disease resistance.
"Trait modification" refers to a detectable difference in a characteristic in
a transgenic
plant with modified expression of a polynucleotide or polypeptide of the
present invention
relative to a plant not doing so, such as a wild type plant. The trait
modification may entail at
least a 5% increase or decrease in an observed trait (difference), at least a
10% difference, at
least a 20% difference, at least a 30%, at least a 50%, at least a 70%, at
least a 100% or a
greater difference. It is known that there may be a natural variation in the
modified trait.
Therefore, the trait modification observed entails a change in the normal
distribution of the trait
in transgenic plants compared with the distribution observed in wild type
plant.
Trait modifications of particular interest include those to seed (embryo),
fruit, root,
flower, leaf, stem, shoot, seedling or the like, including: enhanced tolerance
to environmental
conditions including freezing, chilling, heat, drought, water saturation,
radiation and ozone;
enhanced resistance to microbial, fungal or viral diseases; resistance to
nematodes,
decreased herbicide sensitivity, enhanced tolerance of heavy metals (or
enhanced ability to
take up heavy metals), enhanced growth under poor photoconditions (e.g., low
light and/or
short day length), or changes in expression levels of genes of interest. Other
phenotypes that
may be modified relate to the production of plant metabolites, such as
variations in the
production of taxol, tocopherol, tocotrienol, sterols, phytosterols, vitamins,
wax monomers,
anti-oxidants, amino acids, lignins, cellulose, tannins, prenyllipids (such as
chlorophylls and
carotenoids), glucosinolates, and terpenoids, enhanced or compositionally
altered protein or
oil production (especially in seeds), or modified sugar (insoluble or soluble)
and/or starch
composition. Physical plant characteristics that may be modified include cell
development
(such as the number of trichomes), fruit and seed size and number, yields of
plant parts such
as stems, leaves and roots, the stability of the seeds during storage,
characteristics of the
seed pod (e.g., susceptibility to shattering), root hair length and quantity,
internode distances,
or the quality of seed coat. Plant growth characteristics that may be modified
include growth
rate, germination rate of seeds, vigor of plants and seedlings, leaf and
flower senescence,
male sterility, apomixis, flowering time, flower abscission, rate of nitrogen
uptake, biomass or
transpiration characteristics, as well as plant architecture characteristics
such as apical
dominance, branching patterns, number of organs, organ identity, organ shape
or size.
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Of particular interest are traits relating to modified vernalization
requirements or
flowering time characteristics, such as changes in flowering time in response
to day-length, in
response to temperature, in response to light quality, nutrient availability,
and development
stage of the plant, and the like.
1. The Sequences
We have discovered particular plant transcription factors (TFs) that can be
employed
to modify the flowering time of a plant. Therefore, the flowering time of
plants can be either
decreased, increased, or made inducible under specific conditions using the
TFs of this
invention. Additionally, the transcription factors can be used to modify the
vernalization
requirements of the plant.
The plant transcription factors may belong to one of the following
transcription factor
families: the AP2 (APETALA2) domain transcription factor family (Riechmann and
Meyerowitz
(1998) Biol. Chem. 379:633-646); the MYB transcription factor family (Martin
and Paz-Ares,
(1997) Trends Genet. 13:67-73); the MADS domain transcription factor family
(Riechmann
and Meyerowitz (1997) Biol. Chem. 378:1079-1101); the WRKY protein family
(Ishiguro and
Nakamura (1994) Mol. Gen. Genet. 244:563-571 ); the ankyrin-repeat protein
family (Zhang et
al. (1992) Plant Ce114:1575-1588); the zinc finger protein (Z) family (Klug
and Schwabe (1995)
FASEB J. 9: 597-604); the homeobox (HB) protein family (Duboule (1994)
Guidebook to the
Homeobox Genes, Oxford University Press); the CART-element binding proteins
(Forsburg
and Guarente (1989) Genes Dev. 3:1166-1178); the squamosa promoter binding
proteins
(SPB) (Klein et al. (1996) Mol. Gen. Genet. 1996 250:7-16); the NAM protein
family (Sower et
al. (9996) Cell 85:159-170); the IAA/AUX proteins (Rouse et al. (1998) Science
279:1371-
1373); the HLH/MYC protein family (Littlewood et al. (1994) Prot. Profile
1:639-709); the DNA-
binding protein (DBP) family (Tucker et al. (1994) EM80 J. 13:2994-3002); the
bZIP family of
transcription factors (Foster et al. (1994) FASEB J. 8:192-200); the Box P-
binding protein (the
BPF-1 ) family (da Costa a Silva et al. (1993) Plant J. 4:125-135); the high
mobility group
(HMG) family (Bustin and Reeves (1996) Prog. Nucl. Acids Res. Mol. Biol. 54:35-
100); the
scarecrow (SCR) family (Di Laurenzio et al. (1996) Ce1186:423-433); the GF14
family (Wu et
al. (1997) Plant Physiol. 114:1421-1431 ); the polycomb (PCOMB) family
(Kennison (1995)
Annu. Rev. Genet. 29:289-303); the teosinte branched (TEO) family (Luo et al.
(1996) Nature
383:794-799; the AB13 family (Giraudat et al. (1992) Plant Ce114:1251-1261 );
the triple helix
(TN) family (Dehesh et al. (1990) Science 250:1397-1399); the EIL family (Chao
et al. (1997)
Cel189:1133-44); the AT-HOOK family (Reeves and Nissen (1990) Journal of
Biological
Chemistry 265:8573-8582); the S1 FA family (Zhou et al. (1995) Nucleic Acids
Res. 23:1165-
1169); the bZIPT2 family (Lu and Ferl (1995) Plant Physiol. 109:723); the
YABBY family
(Bowman et al. (1999) Development 126:2387-96); the PAZ family (Bohmert et al.
(1998)
8
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
EM80 J. 17:170-80); a family of miscellaneous (MISC) transcription factors
including the
DPBF family (Kim et al. (1997) Plant J. 11:1237-1251 ) and the SPF1 family
(Ishiguro and
Nakamura (1994) Mol. Gen. Genet. 244:563-571 ); the golden (GLD) family (Hall
et al. (1998)
Planf Cell 10:925-936), and the TUBBY family (Boggin et al, (1999) Science
286:2119-2125)
In particular, the TFs that we have discovered that are implicated in
flowering time or
vernalization include members of the MADS transcription factor family, the MYB
family, the
WRKY family, the HLH/MYC family, GLD family, AT-HOOK family, the CART family,
the bZIP
family, and members of zinc coordinating protein families (Z-Dof, Z-CLDSH and
Z-CH2H2). In
fact we have identified the first members of the WRKY, CART, bZIP, AT-HOOK and
HLH/MYC
families that are associated with flowering time modification in plants: 6192
and 6190
(WRKY), 6486 (CART), 6562 (bZIP), 61073 (AT-HOOK) and 6592 (HLH/MYC).
The polynucleotides and polypeptides are provided in the Sequence Listing and
are
tabulated in Figure 1. Figure 1 identifies a SEQ ID No., its corresponding GID
number,
whether the sequence is a polynucleotide or a polypeptide sequence, and
indicates the
conserved domains. We have also identified domains or fragments derived from
each of the
sequences in the Sequence Listing. The fragments can be from any region of the
sequence,
can be of any length up to the length of the sequence, and can be as short as
six residues for
protein and 18 nucleotides for DNA. Exemplary fragments of the DNA sequences
are as
follows: 1-50, 51-100, 101-200, 201-218, 218-300, 301-450 and 450-600; and
exemplary .
fragments of proteins are as follows 1-50, 51-100, 101-200, 201-206, 206-250,
251-300. For
DNA sequences, the numbers may be measured from either 5' or 3' end of the
DNA. For the
protein sequences the fragment location is determined from the N-terminus or C-
terminus of
the protein and may include adjacent amino acid sequences, such as for example
for SEQ ID
No. 2 an additional 10, 20, 40, 60 or 100 amino acids in either N-terminal or
C-terminal
direction of the described fragments.
The identified polypeptide fragments may be linked to fragments or sequences
derived from other transcription factors so as to generate additional novel
sequences, such as
by employing the methods described in Short, PCT publication W09827230,
entitled "Methods
and Compositions for Polypeptide Engineering" or in Patten et al., PCT
publication
W09923236, entitled "Method of DNA Shuffling" or in Minshull and Stemmer, US
Patent No.
5,837,458. Alternatively, the identified fragment may be linked to a
transcription activation
domain. A transcription activation domain assists in initiating transcription
from a DNA binding
site'. A common feature of some activation domains is that they are designed
to form
amphiphilic alpha helices with excess positive or negative charge (Giniger and
Ptashne (1987)
Nature 330:670-672, Gill and Ptashne (1987) Cell 51:121-126, Estruch et al
(1994) Nucl.
Acids Res. 22:3983-3989). Examples include the transcription activation region
of VP16 or
GAL4 ( Moore et al. (1998) Proc. Natl. Acad. Sci. USA 95: 376-381; and Aoyama
et al.
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
(1995) Plant Cell 7:1773-1785), peptides derived from bacterial sequences (Ma
and Ptashne
(1987) Cell 51; 113-119) and synthetic peptides (Giniger and Ptashne, supra).
The isolated polynucleotides and polypeptides may be used to modify plant
development, physiology or biochemistry such that the modified plants have a
trait advantage
over wild type plants. The identified polynucleotide fragments are also useful
as nucleic acid
probes and primers. A nucleic acid probe is useful in hybridization protocols,
including
protocols for microarray experiments. Primers may be annealed to a
complementary target
DNA strand by nucleic acid hybridization to form a hybrid between the primer
and the target
DNA strand, and then extended along the target DNA strand by a DNA polymerase
enzyme.
Primer pairs can be used for amplification of a nucleic acid sequence, e.g.,
by the polymerase
chain reaction (PCR) or other nucleic-acid amplification methods. See Sambrook
et al.,
Molecular Cloning. A Laboratory Manual, Ed. 2, Cold Spring Harbor Laboratory
Press, New
York (1989) and Ausubel et al. (eds) Current Protocols in Molecular Biology,
John Wiley &
Sons (1998).
2. Identification of Homologous Sequences (Homologs)
Homologous sequences to those provided in the Sequence Listing derived from
Arabidopsis thaliana or from other plants may be used to modify a plant trait.
Homologous
sequences may be derived from any plant including monocots and dicots and in
particular
agriculturally important plant species, including but not limited to, crops
such as soybean,
wheat, corn, potato, cotton, rice, oilseed rape (including canola), sunflower,
alfalfa, sugarcane
and turf; or fruits and vegetables, such as banana, blackberry, blueberry,
strawberry, and
raspberry, cantaloupe, carrot, cauliflower, coffee, cucumber, eggplant,
grapes, honeydew,
lettuce, mango, melon, onion, papaya, peas, peppers, pineapple, spinach,
squash, sweet
corn, tobacco, tomato, watermelon, rosaceous fruits (such as apple, peach,
pear, cherry and
plum) and vegetable brassicas (such as broccoli, cabbage, cauliflower, brussel
sprouts and
kohlrabi). Other crops, fruits and vegetables whose phenotype may be changed
include
barley, currant, avocado, citrus fruits such as oranges, lemons, grapefruit
and tangerines,
artichoke, cherries, nuts such as the walnut and peanut, endive, leek, roots,
such as
arrowroot, beet, cassava, turnip, radish, yam, sweet potato and beans. The
homologs may
also be derived from woody species, such pine, poplar and eucalyptus.
Substitutions, deletions and insertions introduced into the sequences provided
in the
Sequence Listing are also envisioned by the invention. Such sequence
modifications can be
engineered into a sequence by site-directed mutagenesis (Wu (ed.) Mefh.
Enzymol. (1993)
vol. 217, Academic Press). Amino acid substitutions are typically of single
residues;
insertions usually will be on the order of about from 1 to 10 amino acid
residues; and deletions
will range about from 1 to 30 residues. In preferred embodiments, deletions or
insertions are
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
made in adjacent pairs, e.g., a deletion of two residues or insertion of two
residues.
Substitutions, deletions, insertions or any combination thereof may be
combined to arrive at a
sequence. The mutations that are made in the polynucleotide encoding the
transcription factor
should not place the sequence out of reading frame and should not create
complementary
regions that could produce secondary mRNA structure.
Substitutions are those in which at least one residue in the amino acid
sequence has
been removed and a different residue inserted in its place. Such substitutions
may be
conservative with little effect on the function of the gene, for example by
substituting alanines
for serines, arginines for lysines, glutamate for aspartate and the like. The
substitutions which
are not conservative are expected to produce the greatest changes in protein
properties will
be those in which (a) a hydrophilic residue, e.g., seryl or threonyl, is
substituted for (or by) a
hydrophobic residue, e.g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl;
(b) a cysteine or
proline is substituted for (or by) any other residue; (c) a residue having an
electropositive side
chain, e.g., lysyl, arginyl, or histidyl, is substituted for (or by) an
electronegative residue, e.g.,
glutamyl or aspartyl; or (d) a residue having a bulky side chain, e.g.,
phenylalanine, is
substituted for (or by) one not having a side chain, e.g., glycine.
Additionally, the term "homologous sequence" may encompass a polypeptide
sequence that is modified by chemical or enzymatic means. The homologous
sequence may
be a sequence modified by lipids, sugars, peptides, organic or inorganic
compounds, by the
use of modified amino acids or the like. Protein modification techniques are
illustrated in
Ausubel et al. (eds) Current Protocols in Molecular Biology, John Wiley & Sons
(1998).
Homologous sequences also may mean two sequences having a substantial
percentage of sequence identity after alignment as determined by using
sequence analysis
programs for database searching and sequence alignment and comparison
available, for
example, from the Wisconsin Package Version 10.0, such as BLAST, FASTA,
PILEUP,
FINDPATTERNS or the like (GCG, Madision, WI). Public sequence databases such
as
GenBank, EMBL, Swiss-Prot and PIR or private sequence databases such as
PhytoSeq
(Incyte Pharmaceuticals, Palo Alto, CA) may be searched. Alignment of
sequences for
comparison may be conducted by the local homology algorithm of Smith and
Waterman
(1981 ) Adv. Appl. Math. 2:482, by the homology alignment algorithm of
Needleman and
Wunsch (1970) J. Mol. Biol. 48:443, by the search for similarity method of
Pearson and
Lipman (1988) Proc. Natl. Acad. Sci. U.S.A. 85: 2444, by computerized
implementations of
these algorithms. After alignment, sequence comparisons between two (or more)
polynucleotides or polypeptides are typically performed by comparing sequences
of the two
sequences over a comparison window to identify and compare local regions of
sequence
similarity. The comparison window may be a segment of at least about 20
contiguous
positions, usually about 50 to about 200, more usually about 100 to about 150
contiguous
11
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
positions. A description of the method is provided in Ausubel et al. (eds)
(1999) Current
Protocols in Molecular Biology, John Wiley & Sons.
Transcription factors that are homologs of the disclosed sequences will
typically share
at least 40% amino acid sequence identity. More closely related TFs may share
at least 50%,
60%, 65%, 70%, 75% or 80% sequence identity with the disclosed sequences.
Factors that
are most closely related to the disclosed sequences share at least 85%, 90% or
95%
sequence identity. At the nucleotide level, the sequences will typically share
at least 40%
nucleotide sequence identity, preferably at least 50%, 60%, 70% or 80%
sequence identity,
and more preferably 85%, 90%, 95% or 97% sequence identity. The degeneracy of
the
genetic code enables major variations in the nucleotide sequence of a
polynucleotide while
maintaining the amino acid sequence of the encoded protein.
One way to identify whether two nucleic acid molecules are closely related is
that the
two molecules hybridize to each other under stringent conditions. Generally,
stringent conditions
are selected to be about 5°C to 20°C lower than the thermal
melting point (Tm) for the specific
sequence at a defined ionic strength and pH. The Tm is the temperature (under
defined ionic
strength and pH) at which 50% of the target sequence hybridizes to a perfectly
matched probe.
Conditions for nucleic acid hybridization and calculation of stringencies can
be found in
Sambrook et al. (1989) Molecular Cloning. A Laboratory Manual, Ed. 2, Cold
Spring Harbor
Laboratory Press, New York and Tijssen (1993) Laboratory Techniques in
Biochemistry and
Molecular Biology--Hybridization with Nucleic Acid Probes Part I, Elsevier,
New York . Nucleic
acid molecules that hybridize under stringent conditions will typically
hybridize to a probe based
on either the entire cDNA or selected portions of the cDNA under wash
conditions of 0.2x SSC
to 2.0 x SSC, 0.1 % SDS at 50-65° C, for example 0.2 x SSC, 0.1 % SDS
at 65° C. For detecting
less closely related homologs washes may be performed at 50° C.
For conventional hybridization the hybridization probe is conjugated with a
detectable
label such as a radioactive label, and the probe is preferably of at least 20
nucleotides in
length. As is well known in the art, increasing the length of hybridization
probes tends to give
enhanced specificity. The labeled probe derived from the Arabidopsis
nucleotide sequence
may be hybridized to a plant cDNA or genomic library and the hybridization
signal detected
using means known in the art. The hybridizing colony or plaque (depending on
the type of
library used) is then purified and the cloned sequence contained in that
colony or plaque
isolated and characterized. Homologs may also be identified by PCR-based
techniques, such
as inverse PCR or RACE, using degenerate primers. See Ausubel et al. (eds)
(1998) Current
Protocols in Molecular Biology, John W iley & Sons.
TF homologs may alternatively be obtained by immunoscreening an expression
library.
With the provision herein of the disclosed TF nucleic acid sequences, the
polypeptide may be
expressed and purified in a heterologous expression system (e.g., E. colic and
used to raise
12
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
antibodies (monoclonal or polyclonal) specific for the TF. Antibodies may also
be 'raised against
synthetic peptides derived from TF amino acid sequences. Methods of raising
antibodies are
well known in the art and are described in Harlow and Lane (1988) Antibodies:
A Laboratory
Manual, Cold Spring Harbor Laboratory, New York. Such antibodies can then be
used to screen
an expression library produced from the plant from which it is desired to
clone the TF homolog,
using the methods described above. The selected cDNAs may be confirmed by
sequencing and
biological activity.
3. Altered Expression of Transcription Factors
Any of the identified sequences may be incorporated into a cassette or vector
for
expression in plants. A number of expression vectors suitable for stable
transformation of plant
cells or for the establishment of transgenic plants have been described
including those
described in Weissbach and Weissbach, (1989) Methods for Plant Molecular
Biology,
Academic Press, and Gelvin et al., (1990) Plant Molecular Biology Manual,
Kluwer Academic
Publishers. Specific examples include those derived from a Ti plasmid of
Agrobacterium
tumefaciens, as well as those disclosed by Herrera-Estrella, L., et al.,
(1983) Nature 303: 209,
Bevan, M., Nucl. Acids Res. (1984) 12: 8711-8721, Klee, H. J., (1985)
BiolTechnology3: 637-
642, for dicotyledonous plants. Ti-derived plasmids can be transferred into
both
monocotonous and docotyledonous species using Agrobacterium-mediated
transformation
(Ishida et al (1996) Nat. Biotechnol. 14:745-50; Barton et al. (1983) Cell
32:1033-1043).
Alternatively, non-Ti vectors can be used to transfer the DNA into plants and
cells by
using free DNA delivery techniques. Such methods may involve, for example, the
use of
liposomes, electroporation, microprojectile bombardment, silicon carbide
wiskers, and viruses.
By using these methods transgenic plants such as wheat, rice (Christou, P.,
(1991 )
BiolTechnology 9: 957-962) and corn (cordon-Kamm, W., (1990) Plant Cell 2: 603-
618) can
be produced. An immature embryo can also be a good target tissue for monocots
for direct
DNA delivery techniques by using the particle gun (Weeks, T. et al., (1993)
Plant Physiol. 102:
1077-1084; Vasil, V., (1993) BiolTechnology 10: 667-674; Wan, Y. and Lemeaux,
P., (1994)
Plant Physiol. 104: 37-48, and for Agrobacterium-mediated DNA transfer (Ishida
et al., (1996)
Nature Biotech. 14: 745-750).
Typically, plant transformation vectors include one or more cloned plant
coding
sequences (genomic or cDNA) under the transcriptional control of 5' and 3'
regulatory
sequences and a dominant selectable marker. Such plant transformation vectors
typically
also contain a promoter (e.g., a regulatory region controlling inducible or
constitutive,
environmentally-or developmentally-regulated, or cell- or tissue-specific
expression), a
transcription initiation start site, an RNA processing signal (such as intron
splice sites), a
transcription termination site, and/or a polyadenylation signal.
13
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Examples of constitutive plant promoters which may be useful for expressing
the TF
sequence include: the cauliflower mosaic virus (CaMV) 35S promoter, which
confers
constitutive, high-level expression in most plant tissues (see, e.g., Odel et
al., (1985) Nature
313:810); the nopaline synthase promoter (An et al., (1988) Plant Physiol.
88:547); and the
octopine synthase promoter (Fromm et al., (1989) Plant Cell 1: 977).
A variety of plant gene promoters that regulate gene expression in response to
environmental, hormonal, chemical, developmental signals, and in a tissue-
active manner can
be used for expression of the TFs in plants, as illustrated by seed-specific
promoters (such as
the napin, phaseolin or DC3 promoter described in US Pat. No. 5,773,697), root-
specific
promoters, such as those disclosed in US Patent Nos. 5,618,988, 5,837,848 and
5,905,186;
fruit-specific promoters that are active during fruit ripening (such as the
dru 1 promoter (US
Pat. No. 5,783,393), or the 2A11 promoter (US Pat. No. 4,943,674) and the
tomato
polygalacturonase promoter (Bird et al. (1988) Plant Mol. Biol. 11:651 ), root-
specific
promoters, such as those disclosed in US Patent Nos. 5,618,988, 5,837,848 and
5,905,186,
pollen-active promoters such as PTA29, PTA26 and PTA13 (US Pat. No.
5,792,929),
promoters active in vascular tissue (Ringli and Keller (1998) Plant Mol. Biol.
37:977-988),
flower-specific (Kaiser et al, (1995) Plant Mol. Biol. 28:231-243), pollen
(Baerson et al. (1994)
Plant Mol. Biol. 26:1947-1959), carpets (0h1 et al. (1990) Plant Cell 2:837-
848), pollen and
ovules (Baerson et al. (1993) Plant Mol. Biol. 22:255-267), auxin-inducible
promoters (such as
that described in van der Kop et al (1999) Plant Mol. Biol. 39:979-990 or
Baumann et al.
(1999) Plant Cell 11:323-334), cytokinin-inducible promoter (Guevara-Garcia
(1998) Plant Mol.
Biol. 38:743-753), promoters responsive to gibberellin (Shi et al. (1998)
Plant Mol. Biol.
38:1053-1060, Willmott et al. (1998) 38:817-825) and the like. Additional
promoters are those
that elicit expression in response to heat (Ainley, et al. (1993) Plant Mol.
Biol. 22: 13-23), light
(e.g., the pea rbcS-3A promoter, Kuhlemeier et al., (1989) Plant Cell 1:471,
and the maize
rbcS promoter, Schaffner and Sheen, (1991 ) Plant Cell 3: 997); wounding
(e.g., wunl, Siebertz
et al., (1989) Plant Cell 1: 961 ); pathogen resistance, and chemicals such as
methyl
jasmonate or salicylic acid.(Gatz et al., (1997) Plant MoL Biol. 48: 89-108).
In addition, the
timing of the expression can be controlled by using promoters such as those
acting at late seed
development (Odell et al. (1994) Plant Physiol. 106:447-458).
Plant expression vectors may also include RNA processing signals that may be
positioned within, upstream or downstream of the coding sequence. In addition,
the
expression vectors may include additional regulatory sequences from the 3'-
untranslated
region of plant genes, e.g., a 3' terminator region to increase mRNA stability
of the mRNA,
such as the PI-II terminator region of potato or the octopine or nopaline
synthase 3' terminator
regions.
14
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Finally, as noted above, plant expression vectors may also include dominant
selectable marker genes to allow for the ready selection of transformants.
Such genes include
those encoding antibiotic resistance genes (e.g., resistance to hygromycin,
kanamycin,
bleomycin, 6418, streptomycin or spectinomycin) and herbicide resistance genes
(e.g.,
phosphinothricin acetyltransferase).
A reduction of TF expression in a transgenic plant to modifiy a plant trait
may be
obtained by introducing into plants antisense constructs based on the TF cDNA.
For
antisense suppression, the TF cDNA is arranged in reverse orientation relative
to the promoter
sequence in the expression vector. The introduced sequence need not be the
full length TF
cDNA or gene, and need not be identical to the TF cDNA or a gene found in the
plant type to
be transformed. Generally, however, where the introduced sequence is of
shorter length, a
higher degree of homology to the native TF sequence will be needed for
effective antisense
suppression. Preferably, the introduced antisense sequence in the vector will
be at least 30
nucleotides in length, and improved antisense suppression will typically be
observed as the
length of the antisense sequence increases. Preferably, the length of the
antisense sequence
in the vector will be greater than 100 nucleotides. Transcription of an
antisense construct as
described results in the production of RNA molecules that are the reverse
complement of
mRNA molecules transcribed from the endogenous TF gene in the plant cell.
Suppression of
endogenous TF gene expression can also be achieved using a ribozyme. Ribozymes
are
synthetic RNA molecules that possess highly specific endoribonuclease
activity. The
production and use of ribozymes are disclosed in U.S. Patent No. 4,987,071 to
Cech and U.S.
Patent No. 5,543,508 to Haselhoff. The inclusion of ribozyme sequences within
antisense
RNAs may be used to confer RNA cleaving activity on the antisense RNA, such
that
endogenous mRNA molecules that bind to the antisense RNA are cleaved, which in
turn leads
to an enhanced antisense inhibition of endogenous gene expression.
Vectors in which RNA encoded by the TF cDNA (or variants thereof) is over-
expressed may also be used to obtain co-suppression of the endogenous TF gene
in the
manner described in U.S. Patent No. 5,231,020 to Jorgensen. Such co-
suppression (also
termed sense suppression) does not require that the entire TF cDNA be
introduced into the
plant cells, nor does it require that the introduced sequence be exactly
identical to the
endogenous TF gene. However, as with antisense suppression, the suppressive
efficiency will
be enhanced as (1 ) the introduced sequence is lengthened and (2) the sequence
similarity
between the introduced sequence and the endogenous TF gene is increased.
Vectors expressing an untranslatable form of the TF mRNA may also be used to
suppress the expression of endogenous TF activity to modify a trait. Methods
for producing such
constructs are described in U.S. Patent No. 5,583,021 to Dougherty et al.
Preferably, such
constructs are made by introducing a premature stop codon into the TF gene.
Alternatively, a
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
plant trait may be modified by gene silencing using double-strand RNA (Sharp
(1999) Genes and
Development 13: 139-141 ). This approach, whereby a vector is prepared in
which a cDNA or
gene is arranged in duplicated fashion and is capable of generating upon
expression a double
stranded RNA molecule with a hairpin structure. This procedure has been used
to modify gene
activity in plants (Chuang and Meyerowitz (1999) Proc. Natl. Acad. Sci.
97:4985-9490).
Another method for abolishing the expression of a gene is by insertion
mutagenesis
using the T-DNA of Agrobacterium tumefaciens. After generating the insertion
mutants, the
mutants can be screened to identify those containing the insertion in a TF
gene. Mutants
containing a single mutation event at the desired gene may be crossed to
generate homozygous
plants for the mutation (Koncz et al. (1992) Methods in Arabidopsis Research.
World Scientific).
A plant trait may also be modified by using the cre-lox system (for example,
as described
in US Pat. No. 5,658,772). A plant genome may be modified to include first and
second lox sites
that are then contacted with a Cre recombinase. If the lox sites are in the
same orientation, the
intervening DNA sequence between the two sites is excised. If the lox sites
are in the opposite
orientation, the intervening sequence is inverted.
The polynucleotides and polypeptides of this invention may also be expressed
in a plant
in the absence of an expression cassette by manipulating the activity or
expression level of the
endogenous gene by other means. For example, by ectopically expressing a gene
by T-DNA
activation tagging (Ichikawa et al., (1997) Nafure 390 698-701, Kakimoto et
al., (1996)
Science 274: 982-985). This method entails transforming a plant with a gene
tag containing
multiple transcriptional enhancers and once the tag has inserted into the
genome, expression
of a flanking gene coding sequence becomes deregulated. In another example,
the
transcriptional machinery in a plant may be modified so as to increase
transcription levels of a
polynucleotide of the invention (See PCT Publications W09606166 and WO 9853057
which
describe the modification of the DNA binding specificity of zinc finger
proteins by changing
particular amino acids in the DNA binding motif).
The transgenic plant may also comprise the machinery necessary for expressing
or
altering the activity of a polypeptide encoded by an endogenous gene, for
example by altering
the phosphorylation state of the polypeptide to maintain it in an activated
state.
4. Transgenic Plants with Modified TF Expression
Once an expression cassette comprising a polynucleotide encoding a TF gene of
this
invention has been constructed, standard techniques may be used to introduce
the
polynucleotide into a plant in order to modify a trait of the plant. The plant
may be any higher
plant, including gymnosperms, monocotyledonous and dicotyledenous plants.
Suitable
protocols are available for Leguminosae (alfalfa, soybean, clover, etc.),
Umbelliferae (carrot,
celery, parsnip), Cruciferae (cabbage, radish, rapeseed, broccoli, etc.),
Curcurbitaceae
16
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
(melons and cucumber), Gramineae (wheat, corn, rice, barley, millet, etc.),
Solanaceae
(potato, tomato, tobacco, peppers, etc.), and various other crops. See
protocols described in
Ammirato et al. (1984) Handbook of Plant Cell Culture -Crop Species. Macmillan
Publ. Co.
Shimamoto et al. (1989) Nature 338:274-276; Fromm et al. (1990) BiolTechnology
8:833-
839; and Vasil et al. (1990) BiolTechnology 8:429-434.
Transformation and regeneration of both monocotyledonous and dicotyledonous
plant
cells is now routine, and the selection of the most appropriate transformation
technique will be
determined by the practitioner. The choice of method will vary with the type
of plant to be
transformed; those skilled in the art will recognize the suitability of
particular methods for given
plant types. Suitable methods may include, but are not limited to:
electroporation of plant
protoplasts; liposome-mediated transformation; polyethylene glycol (PEG)
mediated
transformation; transformation using viruses; micro-injection of plant cells;
micro-projectile
bombardment of plant cells; vacuum infiltration; and Agrobacterium tumeficiens
mediated
transformation. Transformation means introducing a nucleotide sequence in a
plant in a
manner to cause stable or transient expression of the sequence.
Successful examples of the modification of plant characteristics by
transformation with
cloned sequences which serve to illustrate the current knowledge in this field
of technology,
and which are herein incorporated by reference, include: U.S. Patent Nos.
5,571,706;
5,677,175; 5,510,471; 5,750,386; 5,597,945; 5,589,615; 5,750,871; 5,268,526;
5,780,708;
5,538,880; 5,773,269; 5,736,369 and 5,610,042.
Following transformation, plants are preferably selected using a dominant
selectable
marker incorporated into the transformation vector. Typically, such a marker
will confer
antibiotic or herbicide resistance on the transformed plants, and selection of
transformants can
be accomplished by exposing the plants to appropriate concentrations of the
antibiotic or
herbicide.
After transformed plants are selected and grown to maturity, those plants
showing a
modified trait are identified. The modifed trait may be any of those traits
described above.
Additionally, to confirm that the modified trait is due to changes in
expression levels or activity
of the polypeptide or polynucleotide of the invention may be determined by
analyzing mRNA
expression using Northern blots, RT-PCR or microarrays, or protein expression
using
immunoblots or Western blots or gel shift assays.
5. Commercial Applications of the Polynucleotides and Polypeptides
Specific applications for the genes of the present invention relate to their
potential
roles in plant flowering time or the vernalization response. Most modern crop
varieties are the
result of extensive breeding programs and many generations of backcrossing may
be required
17
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
to introduce desired traits. Systems that accelerate flowering could have
valuable applications
in such programs since they allow much faster generation times. Additionally,
in some
instances, a faster generation time might allow additional harvests of a crop
to be made within
a given growing season. With the advent of transformation systems for tree
species such as
oil palm, aspen, pine and eucalyptus, forest biotechnology is a growing area
of interest.
Also, in species such as sugarbeet where the vegetative parts of the plants
constitute
the crop and the reproductive tissues are discarded, it would be advantageous
to delay or
prevent flowering. Extending vegetative development could bring about large
increases in
yields.
Furthermore, by regulating the expression of flowering-time controlling genes,
using
inducible promoters, flowering could potentially be triggered as desired (for
example, by
application of a chemical inducer). This would allow, for example, flowering
to be synchronized
across a crop and facilitate more efficient harvesting. Such inducible systems
could be used to
tune the flowering of crop varieties to different latitudes. At present,
species such as soybean
and cotton are available as a series of maturity groups that are suitable for
different latitudes
on the basis of their flowering time (which is governed by day-length). A
system in which
flowering could be chemically controlled would allow a single high-yielding
northern maturity
group to be grown at any latitude. In southern regions such plants could be
grown for longer,
thereby increasing yields, before flowering was induced. In more northern
areas, the induction
would be used to ensure that the crop flowers prior to the first winter
frosts. Currently, the
existence of a series of maturity groups for different latitudes represents a
major barrier to the
introduction of new valuable traits.
For many crop species, high yielding winter-varieties can only be grown in
temperate
regions where the winter season is prolonged and cold enough to elicit a
vernalization
response. Altered expression of the genes of the invention could compensate
for a
vernalization treatment in late-flowering Arabidopsis ecotypes. Similar
effects might be
achieved in crop plants. Winter varieties of wheat, for instance, which over-
express 6157 (or
the wheat ortholog) might then be grown in areas like Southern California
which would
otherwise be too warm to allow effective vernalization. A second application
for this system is
in cherry (Prunus). Locally grown cherries are unavailable in the early
Californian spring since
the winters are too warm for vernalization to occur.
A further application exists in strawberry (Fragaria). Strawberry has a well-
defined
perennial cycle of flower initiation, dormancy, chilling, crop growth and
runner production. In
temperate European countries, the plants flower in early spring, and fruit is
produced in May
or June. Following fruiting, runners are generated that carry plantlets which
take root. The
plants then remain dormant all through the late summer and autumn. Flowering
cannot be
repeated until the following spring after the plants have received a winter
cold treatment. A
18
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
system, which bypasses this vernalization requirement, might permit a second
autumn crop of
strawberries to be harvested in addition to the spring crop.
Finally, in addition to the direct applications of the genes themselves, their
regulatory
regions could also be of value. If the promoters of these genes are responsive
to low
temperatures they could be incorporated into expression systems for regulation
of genes that
confer tolerance to freezing. Such genes would then be up regulated
specifically at the time
required, thereby minimizing any toxic effects that result from their
constitutive expression.
6. Other Utility of the Polypeptide and Polynucleotides
A transcription factor coding provided by the present invention may also be
used to
identify exogenous or endogenous molecules that may affect expression of the
transcription
factors and may affect flowering time. These molecules may include organic or
inorganic
compounds.
For example, the method may entail first placing the molecule in contact with
a plant
or plant cell. The molecule may be introduced by topical administration, such
as spraying or
soaking of a plant, and then the molecule's effect on the expression or
activity of the TF
polypeptide or the expression of the polynucleotide monitored. Changes in the
expression of
the TF polypeptide may be monitored by use of polyclonal or monoclonal
antibodies, gel
electrophoresis or the like. Changes in the expression of the corresponding
polynucleotide
sequence may be detected by use of microarrays, Northerns or any other
technique for
monitoring changes in mRNA expression. These techniques are exemplified in
Ausubel et al.
(eds) Currenf Protocols in Molecular Biology, John Wiley & Sons (1998). Such
changes in the
expression levels may be correlated with modified plant traits and thus
identified molecules
may be useful for soaking or spraying on fruit, vegetable and grain crops to
modify traits in
plants.
The transcription factors may also be employed to identify promoter sequences
with
which they may interact. After identifying a promoter sequence, interactions
between the
transcription factor and the promoter sequence may be modified by changing
specific
nucleotides in the promoter sequence or specific amino acids in the
transcription factor that
interact with the promoter sequence to alter a plant trait. Typically,
transcription factor DNA
binding sites are identified by gel shift assays. After identifying the
promoter regions, the
promoter region sequences may be employed in double-stranded DNA arrays to
identify
molecules that affect the interactions of the TFs with their promoters (Bulyk
et al. (1999)
Nature Biotechnology 17:573-577).
The identified transcription factors are also useful to identify proteins that
modify the
activity of the transcription factor. Such modification may occur by covalent
modification, such
19
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
as by phosphorylation, or by protein-protein (homo or-heteropolymer)
interactions. Any
method suitable for detecting protein-protein interactions may be employed.
Among the
methods that may be employed are co-immunoprecipitation, cross-linking and co-
purification
through gradients or chromatographic columns, and the two-hybrid yeast system.
The two-hybrid system detects protein interactions in vivo and is described in
Chien,
et al., (1991 ), Proc. Natl. Acad. Sci. USA, 88, 9578-9582 and is commercially
available from
Clontech (Palo Alto, Calif.). In such a system, plasmids are constructed that
encode two
hybrid proteins: one consists of the DNA-binding domain of a transcription
activator protein
fused to the TF polypeptide and the other consists of the transcription
activator protein's
activation domain fused to an unknown protein that is encoded by a cDNA that
has been
recombined into the plasmid as part of a cDNA library. The DNA-binding domain
fusion
plasmid and the cDNA library are transformed into a strain of the yeast
Saccharomyces
cerevisiae that contains a reporter gene (e.g., IacZ) whose regulatory region
contains the
transcription activator's binding site. Either hybrid protein alone cannot
activate transcription of
the reporter gene. Interaction of the two hybrid proteins reconstitutes the
functional activator
protein and results in expression of the reporter gene, which is detected by
an assay for the
reporter gene product. Then, the library plasmids responsible for reporter
gene expression are
isolated and sequenced to identify the proteins encoded by the library,
plasmids. After
identifying proteins that interact with the transcription factors, assays for
compounds that
interfere with the TF protein-protein interactions may be preformed.
The following examples are intended to illustrate but not limit the present
invention.
EXAMPLES
Methods
All experiments were performed using Arabidopsis of ecotype Columbia except
where
otherwise indicated. The Stockholm (CS6863) and Pitztal (CS6832) lines were
supplied by
the ABRC at Ohio State University. In all experiments, seeds were sterilized
by a 2 minute
ethanol treatment followed by 30 minutes in 30% bleach / 0.01% Tween and five
washes in
distilled water. Seeds were sown to MS agar in 0.1 % agarose and stratified
for 3-5 days at 4
°C, before transfer to growth rooms with a temperature of 20-25
°C. MS media was
supplemented with 50mg/I kanamycin for selection of transformed plants. Plants
were
transplanted to soil after 7 days of growth on plates. For vernalization
treatments, seeds were
sown to MS agar plates, sealed with micropore tape, and placed in a 4°C
cold room with low
light levels for 6-8 weeks. The plates were then transferred to the growth
rooms alongside
plates containing freshly sown non-vernalized controls. Whole vegetative
seedlings were
harvested for gene expression analysis at 6 to 9 days after transfer. Rosette
leaves were
counted when a visible inflorescence of approximately 3 cm was apparent.
Rosette and total
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
leaf number on the progeny stem are tightly correlated with the timing of
flowering (Koornneef
et al (1991 ) Mol. Gen. Genet 229:57-66.
Example I. Full Length Gene Identification and Cloning
For the following examples, 6157 refers to SEQ ID Nos 1 and 2, 6859 refers to
SEQ
ID Nos. 3-8, 61842 refers to SEQ ID Nos. 9-16, 61843 refers to SEQ ID Nos. 17
and 18,
61844 refers to SEQ ID Nos. 19-22, 6861 refers to SEQ ID Nos. 23-26 and FLC or
61759
refers to SEQ ID Nos. 27, 28.
Putative transcription factor sequences (genomic or ESTs) related to known
transcription factors were identified in the Arabidopsis thaliana GenBank
database using the
tblastn sequence analysis program using default parameters and a P-value
cutoff threshold of
-4 or-5 or lower, depending on the length of the query sequence. Putative
transcription
factor sequence hits were then screened to identify those containing
particular sequence
strings. If the sequence hits contained such sequence strings, the sequences
were confirmed
as transcription factors.
For example, we identified a MADS box gene 6157 within BAC F22K20 (GenBank
accession AC002291 ) from Chromosome 1 that was predicted to encode a protein
related to
FLC. An 872bp cDNA clone for 6157 was identified among clones isolated from a
library
derived from leaf mRNA. The encoded protein was 196 amino acids in length, and
shared
62% overall amino acid sequence identity with FLC, and 82% identity within the
MADS DNA
binding domain.
6157 is also related to 6859, 61842, 61843, and 61844 that map together as a
tightly linked cluster, at the bottom of chromosome V, that occupies
approximately 22 kb and
spans three adjacent clones, MXK3, F1505, and MQN23 (GenBank accession numbers
AB019236, AB026633, and AB013395, respectively). 6859, 61842, 61843, and 61844
are
all arranged in the same orientation. 6859, 61842, 61843, and 61844 were
likely created by
a duplication event; this could have allowed their divergence into different
aspects of gene
regulation. Their physical proximity suggests that they may act as a unit
controlled via
common regulatory elements.
The pair-wise comparisons of the 57 amino acid MADS domains of FLC, 6157,
6859,
61842, 61843, and 61844 are displayed in Table 1. The table shows percent
amino acid
sequence identity and, in parentheses, the sequence identity percentages when
conservative
amino acid substitutions are considered. The MADS domains of the proteins
encoded by
6859, 61842, 61843, and 61844 are highly conserved with those of FLC and 6157:
these
proteins share from 75% to 91 % of amino acid sequence identity, depending on
the pair-wise
comparison as shown below. When conservative amino substitutions are made, the
MADS
domains of these proteins are 88%-99% identical to each other (shown in
parentheses).
21
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Table 1 Percentage of amino acid identity in the MADS domain
FLC(G1759) 6157 6859 61842 61843 61844
FLC (61759)100% 82%(96%) 84%(94%)77%(91%)78%(99%)75%(92%)
6157 - 100% 87%(95%)89%(94%)78%(95%)78%(93%)
6859 - - 100% 91%(94%)77%(94%)78%(92%)
61842 - - - 100% 77%(91% 78%(88%)
61843 - - - - 100% 85%(92%)
61844 - - - - - 100%
Amino acid residue 30 of FLC and by 6157, 6859, 61842, 61843, and 61844 is an
acidic residue (E or D) whereas, in all other Arabidopsis MADS domain proteins
so far
identified, that position is occupied by a positively charged lysine residue.
The crystal
structure of the human SRF MADS domain bound to DNA has shown that lysine
residue
(which is also conserved in yeast MCM1 and human MEF2A proteins) to contact
the
phosphate backbone of the DNA target site (Pellegrini ef al., (1995) Nature
376:490-498).
That amino acid difference could therefore confer DNA binding properties to
FLC and by
6157, 6859, 61842, 61843, and 61844 distinct from other Arabidopsis MADS
domain .
proteins. Therefore, MADS domain proteins with an acidic residue at position
30 may be
particularly useful in modifying plant flowering time and vernalization
response.
The transcripts from these genes were analyzed by 3' RACE (Rapid Amplification
cDNA Ends) and corresponding cDNAs were isolated by RT-PCR from mixed samples
of
Arabidopsis tissue (Columbia ecotype). During this analysis, it was found that
6859, 61842
and 61844 transcripts exist in multiple alternatively spliced forms.
Example II. Flowering Time Associated Genes
Reverse transcriptase PCR was done using gene specific primers within the
coding
region for each sequence identified. Where possible, the primers were designed
near the 3'
region of each coding sequence initially identified.
Total RNA was isolated from plant tissue tissue and extracted using CTAB. Once
extracted total RNA was normalized in concentration across all the tissue
types to ensure that
the PCR reaction for each tissue received the same amount of cDNA template
using the 28S
band as reference. Poly A+ was purified using a modified protocol from the
Qiagen Oligotex
kit batch protocol. cDNA was synthesized using standard protocols. After the
first strand
cDNA synthesis, primers for Actin 2 were used to normalize the concentration
of cDNA across
the tissue types. Actin 2 is found to be constitutively expressed in fairly
equal levels across
the Arabidopsis tissue types.
For RT PCR, cDNA template was mixed with corresponding primers and Taq
polymerase. Each reaction consisted of 0.2 u1 cDNA template, 2u1 10X Tricine
buffer, and
22
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
16.8 u1 water, 5pmol Primer 1, 5pmol Primer 2, 0.3 u1 Taq polymerase, 200uM
dNTPs and 8.6
u1 water.
The 96 well plate was covered with microfilm and set in the Thermocycler to
start the
following reaction cycle. Step1 93° C for 3 mins, Step 2 93° C
for 30 sec, Step 3 60-65° C
for 1 min, Step 4 72° C for 2 mins,. Steps 2, 3 and 4 were repeated for
20-35 cycles, Step 5
72° C for 5 mins and Step 6 4° C. The PCR plate was sometimes
placed back in the
thermocycler to amplify more products for 5-15 more cycles to identify genes
that have very
low expression. The reaction cycle was as follows: Step 2 93° C for 30
sec, Step 3 65° C for 1
min, and Step 4 72° C for 2 ins, repeated for 8 cycles, and Step 4
4° C.
Eight microliters of PCR product and 1.5 u1 of loading dye were loaded on a
1.2%
agarose gel for analysis between 21 and 36 cycles. Expression levels of
specific transcripts
were considered low if they were only detectable after 35 cycles of PCR.
Expression levels
were considered medium or high depending on the levels of transcript compared
with
observed transcript levels for actin2.
As an example, to assess 6157 mRNA levels in 6157 plants, PCR was carried out
over 25 cycles using primers 5'-GGCATAACCCTTATCGGAGATTTGAAGC-3' (SEQ ID No.
57) and 5'-ACACAAACTCTGATCTTGTCTCCGAAGG-3' (SEQ ID No. 58). To assess mRNA
levels in different tissues extracted from wild type plants, 25 or 30 cycles
of PCR were
performed using primers 5'-GCATAACCCTTATCGGAGATTTGAAGCCAT-3' (SEQ ID No. 59)
and 5'-AACATTCCTCTCTCATCATCTGTTGCCAGC-3' (SEQ ID No. 60). PCR for FLC was
performed either with primers 5'-AACGCTTAGTATCTCCGGCGACTTGAAC-3' (SEQ ID No.
51) and 5'-CTCACACGAATAAGGTACAAAGTTCATC-3' (SEQ ID No. 62) over 35 cycles, or
5'-TTAGTATCTCCGGCGACTTGAACCCAAACC-3' (SEQ ID No. 63) and 5'-
AGATTCTCAACAAGCTTCAACATGAGTTCG-3' (SEQ ID No. 64) over 30 cycles. Primer
specificity was verified by sequencing RT-PCR products. Samples were
standardized via 20-
25 cycles of PCR with actin primers.
Example III. Construction of Expression Vectors
The sequence was amplified from a genomic or cDNA library using primers
specific to
sequences upstream and downstream of the coding region. The expression vector
was
pMEN20 or pMEN65, which are both derived from pMON316 (Sanders et al, (1987)
Nucleic
Acids Research 15:1543-58) and contain the CaMV 35S promoter to express
transgenes. To
clone the sequence into the vector, both pMEN20 and the amplified DNA fragment
were
digested separately with Sall and Notl restriction enzymes at 37° C for
2 hours. The digestion
products were subject to electrophoresis in a 0.8% agarose gel and visualized
by ethidium
bromide staining. The DNA fragments containing the sequence and the linearized
plasmid
23
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
were excised and purified by using a Qiaquick gel extraction kit (Qiagen, CA).
The fragments
of interest were ligated at a ratio of 3:1 (vector to insert). Ligation
reactions using T4 DNA
ligase (New England Biolabs, MA) were carried out at 16° C for 16
hours. The ligated DNAs
were transformed into competent cells of the E. coli strain DHSalpha by using
the heat shock
method. The transformations were plated on LB plates containing 50 mg/I
spectinomycin
(Sigma).
Individual colonies were grown overnight in five milliliters of LB broth
containing 50
mg/l spectinomycin at 37° C. Plasmid DNA was purified by using Qiaquick
Mini Prep kits
(Qiagen, CA).
Example IV. Transformation of Agrobacferium with the Expression Vector
After the plasmid vector containing the gene was constructed, the vector was
used to
transform Agrobacterium tumefaciens cells expressing the gene products. The
stock of
Agrobacterium tumefaciens cells for transformation were made as described by
Nagel et al.
FEMS Microbiol Letts 67: 325-328 (1990). Agrobacterium strain GV3101 was grown
in 250 ml
LB medium (Sigma) overnight at 28°C with shaking until an absorbance
(Asoo) of 0.5 - 1.0 was
reached. Cells were harvested by centrifugation at 4,000 x g for 15 min at
4° C. Cells were
then resuspended in 250 NI chilled buffer (1 mM HEPES, pH adjusted to 7.0 with
KOH). Cells
were centrifuged again as described above and resuspended in 125 NI chilled
buffer. Cells
were then centrifuged and resuspended two more times in the same HEPES buffer
as
described above at a volume of 100 p1 and 750 NI, respectively. Resuspended
cells were then
distributed into 40 u1 aliquots, quickly frozen in liquid nitrogen, and stored
at -80° C.
Agrobacterium cells were transformed with plasmids prepared as described above
following the protocol described by Nagel et al. FEMS Microbiol Letts 67: 325-
328 (1990). For
each DNA construct to be transformed, 50 - 100 ng DNA (generally resuspended
in 10 mM
Tris-HCI, 1 mM EDTA, pH 8.0) was mixed with 40 NI of Agrobacterium cells. The
DNA/cell
mixture was then transferred to a chilled cuvette with a 2mm electrode gap and
subject to a
2.5 kV charge dissipated at 25 pF and 200 NF using a Gene Pulser II apparatus
(Bio-Rad).
After electroporation, cells were immediately resuspended in 1.0 ml LB and
allowed to recover
without antibiotic selection for 2 - 4 hours at 28° C in a shaking
incubator. After recovery, cells
were plated onto selective medium of LB broth containing 100 ug/ml
spectinomycin (Sigma)
and incubated for 24-48 hours at 28° C. Single colonies were then
picked and inoculated in
fresh medium. The integrity of the plasmid construct was verified by PCR
amplification and
sequence analysis.
24
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Example V. Transformation of Arabidopsis Plants with Agrobacterium tumefaciens
with Expression Vector
After transformation of Agrobacterium tumefaciens with plasmid vectors
containing the
gene, single Agrobacterium colonies were identified, propagated, and used to
transform
Arabidopsis plants. Briefly, 500 ml cultures of LB medium containing 50 mg/I
spectinomycin
were inoculated with the colonies and grown at 28° C with shaking for 2
days until an
absorbance (Asoo) of > 2.0 is reached. Cells were then harvested by
centrifugation at 4,000 x
g for 10 min, and resuspended in infiltration medium (1/2 X Murashige and
Skoog salts
(Sigma), 1 X Gamborg's B-5 vitamins (Sigma), 5.0% (w/v) sucrose (Sigma), 0.044
NM
benzylamino purine (Sigma), 200 NI/L Silwet L-77 (Lehle Seeds) until an
absorbance (Asoo) of
0.8 was reached.
Prior to transformation, Arabidopsis thaliana seeds (ecotype Columbia) were
sown at
a density of -10 plants per 4" pot onto Pro-Mix BX potting medium (Hummert
International)
covered with fiberglass mesh (18 mm X 16 mm). Plants were grown under
continuous
illumination (50-75 NE/m2/sec) at 22-23° C with 65-70% relative
humidity. After about 4
weeks, primary inflorescence stems (bolts) are cut off to encourage growth of
multiple
secondary bolts. After flowering of the mature secondary bolts, plants were
prepared for
transformation by removal of all siliques and opened flowers.
The pots were then immersed upside down in the mixture of Agrobacterium
infiltration
medium as described above for 30 sec, and placed on their sides to allow
draining into a 1' x
2' flat surface covered with plastic wrap. After 24 h, the plastic wrap was
removed and pots
are turned upright. The immersion procedure was repeated one week later, for a
total of two
immersions per pot. Seeds were then collected from each transformation pot and
analyzed
following the protocol described below.
Example VI. Identification of Arabidopsis Primary Transformants
Seeds collected from the transformation pots were sterilized essentially as
follows.
Seeds were dispersed into in a solution containing 0.1 % (v/v) Triton X-100
(Sigma) and sterile
H20 and washed by shaking the suspension for 20 min. The wash solution was
then drained
and replaced with fresh wash solution to wash the seeds for 20 min with
shaking. After
removal of the second wash solution, a solution containing 0.1% (v/v) Triton X-
100 and 70%
ethanol (Equistar) was added to the seeds and the suspension was shaken for 5
min. After
removal of the ethanol/detergent solution, a solution containing 0.1 % (v/v)
Triton X-100 and
30% (v/v) bleach (Clorox) was added to the seeds, and the suspension was
shaken for 10
min. After removal of the bleach/detergent solution, seeds were then washed
five times in
sterile distilled H20. The seeds were stored in the last wash water at
4° C for 2 days in the
dark before being plated onto antibiotic selection medium (1 X Murashige and
Skoog salts (pH
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
adjusted to 5.7 with 1 M KOH), 1 X Gamborg's B-5 vitamins, 0.9% phytagar (Life
Technologies), and 50 mg/I kanamycin). Seeds were germinated under continuous
illumination (50-75 NE/mz/sec) at 22-23° C. After 7-10 days of growth
under these conditions,
kanamycin resistant primary transformants (T~ generation) were visible and
obtained. These
seedlings were transferred first to fresh selection plates where the seedlings
continued to
grow for 3-5 more days, and then to soil (Pro-Mix BX potting medium).
Primary transformants are self-crossed and progeny seeds (T2) collected. T2
progeny seeds
were germinated on kanamycin as described above and kanamycin resistant
seedlings were
selected, transferred to soil and analyzed.
Example VII. Analysis of transgenic Arabidopsis plants
In a first experiment, 6157 plants (ie plants expressing the 6157 transgene)
were
grown in 12 hours light. 31 of 40 lines flowered earlier than control plants
transformed with a
control vector. Mean rosette leaf number of early T1 lines was 12.4+/-0.8
whereas control
lines had 27+/-1.2 rosette leaves. 2 of 40 T1 plants flowered at the same time
as controls and
7 of 40 lines were late flowering and produced visible inflorescences 2 to 3
weeks after wild
type.
In further experiments, plants were grown under conditions of 24 hours light
at 20-25
°C. Under these conditions, the non-transformed control plants produced
a mean total of
14.3+/-0.7 leaves on the primary shoots prior to flower bud initiation. Flower
buds were first
visible on these plants at a mean of 21.1+/-0.5 days after sowing (error
values represent
standard error of the mean to which 95% confidence limits have been attached).
For 6859,
14/19 T1 plants were early flowering (mean leaf total of 6.4+/-0.7, flower
buds visible at
12.9+/-0.7days after sowing), 3/19 were wild type, and 2/19 were slightly late
flowering
compared to wild type (mean total of 19 leaves, flower buds visible at 27
days). RT
expression studies revealed that the late flowering individuals possessed the
highest levels of
transgene expression. These results strongly parallel those obtained for 6157.
For 61842,
7/10 T1 flowered early (mean total of 7.9+/-0.6 leaves, flower buds visible at
13.9+/-1.0 days),
and 3/10 plants were wild type. Overexpression studies were also performed
with cDNAs
encoding shortened splice variants of 61842. For 61842.2 (encodes a 185 amino
acid splice
variant), 15/18 T1 plants flowered early (mean total of 6.9+/-0.9 leaves,
flower buds visible at
14.5+/-0.6 days) and 3/18 were wild type. For 61842.6 (encodes a 77 amino acid
splice
variant), 8/10 T1 plants flowered early mean total of 6.8+/-1.6 leaves, flower
buds visible at
13.9+/-0.9 days) and 2/10 were wild type. For 61842.7 (encodes a 118 amino
acid splice
variant) 8/10 T1 plants flowered early (accurate leaf counts not made) and
2/10 were wild
type. Thus, the 61842 splice variants produced comparable effects to the full-
length cDNA
26
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
clone when over-expressed. For 61843, 7/11 flowered early (mean total of 6.4+/-
0.5 leaves,
flower buds visible at 16.0+/-1.6 days) and 2/11 had a wild type flowering
time. The 61843 T1
plants, however, were dwarfed and showed retarded development of some organs.
This
suggests that 61843 has unpredicted toxic effects when over-expressed. For
61844, 6/10 T1
plants flowered early (mean total of 6.8+/-1.7 leaves, flower buds visible at
14.7+/-1.3 days)
and 4/10 plants were wild type. Overexpression studies were also performed
with a cDNA
encoding a shortened splice variant of 61844. For overexpression of 61844.2
(encodes a
184 amino acid splice variant), 6/19 T1 plants flowered early (mean total of
7.8+/-1.7 leaves,
flower buds visible at 15.7+/-1.3 days) and 13/19 were wild type). The over-
expression data
for 6859, 61842, 61843, and 61844 support the hypothesis that they have a role
in the
control of flowering time.
RT-PCR was performed on materials from 6157 plants using 6157 specific primers
at
approximately 25 cycles. The highest levels of 6157 expression were detected
in late
flowering individual plants or in samples from pooled seedlings that contained
late flowering
individuals. Plants that showed only moderate or low levels of overexpression
compared to
wild type were slightly early flowering or normal.
To test whether an increase in 6157 could affect flowering time in late
flowering
ecotypes of Arabidopsis, we overexpressed 6157 in the late flowering ecotypes
Stockholm
and Piztal. In this experiment, 32 primary transformants from each ecotype
were grown
interspersed with controls under continuous light conditions. In both
ecotypes, around 50% of
the transformants flowered earlier than controls, and in some transformants
the time to
flowering was halved. As was observed with Columbia 6157 plants, a minority of
Pitztal and
Stockholm transformants were clearly later flowering compared to controls.
A correlation between 6157 transgene expression and flowering time was also
observed in 6157 Stockholm and Pitztal T1 plants. RT-PCR was performed with
two early
and two late flowering lines in each background. Again, the late flowering
lines contained the
higher levels of 6157 expression. Thus, the factor appears to affect flowering
time in a
quantitative manner; a modest level of overexpression triggers early
flowering, whereas a
larger increase delays flowering.
In conclusion, over-expression of 6157 or any of the related genes modifies
flowering
time in plants: a modest level of over-expression triggers early flowering,
whereas a larger
increase delays flowering.
Using similar or identical methodologies described in the examples above,
further
Arabidopsis genes were identified whose altered expression was correlated with
delayed or
accelerated flowering. These genes are tabulated in Table 2 with their
Sequence Listing Nos.,
and their effects on flowering time.
27
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Table 2. Further Arabidopsis genes for manipulating flowering time
SEQ ID Nos. Gene observations
23, 24 6861 early or late flowering
25, 26 6861.1 early or late flowering
29, 30 6192 late flowering
31, 32 6234 late flowering
33, 34 6361 late flowering
35, 36 6486 late flowering
37, 38 6748 late flowering
39, 40 6994 late flowering
41, 42 61335 late flowering
43, 44 6562 late flowering
45, 46 6736 late flowering
47,48 61073 late flowering
49, 50 61435 late flowering
51, 52 6180 early flowering
53, 54 6592 early flowering
55, 56 6208 early flowering
The vernalization response was also investigated. Late flowering vernalization
responsive ecotypes and mutants have high steady state levels of FLC
transcript, which
decrease during the promotion of flowering by vernalization (Michaels and
Amasino, (1999)
Plant Cell 11:949-956; Sheldon et al., (1999) Plant Cell 11:445-458; Sheldon
et al., (2000)
Proc. Natl. Acad. Sci. 97: 3735-3758). In contrast to FLC, 6157 transcript
levels show no
consistent correlation with the vernalization response in the late flowering
Stockholm and
Pitztal ecotypes. Additionally we found that over-expression of 6157 did not
influence FLC
levels. The effects of vernalization on expression of 6861, 6859, 61842,
61843, and 61844
were also examined. Germinating seeds of Columbia, Pitztal, Stockholm,
constans-1, and
fca-9 were vernalized on MS agar plates in a 4°C cold room for 8 weeks,
and then transferred
to a continuous light growth room. Total tissues from the vernalized
seedlings, and freshly
sown non-vernalized controls were harvested at 9 days after the transfer. RT-
PCR was
performed for FLC, 6157, 6859, 61842, 61843, 61844, and 6861, and actin.
Compared to
FLC and 6157, none of the genes showed a clear consistent decline upon
vernalization in the
five different sample sets. However, 61844 displayed a converse pattern of
expression to
FLC: 61844 levels consistently increased on vernalization. This is
particularly significant as it
directly implicates 61844 in control of the vernalization response. Thus 61844
likely activates
flowering and has an opposing role to FLC.
28
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
To explore whether overexpression of 6157 produces comparable effects on
vernalization, batches of wild type Pitztal and Stockholm seedlings were cold
treated for 6
weeks at 4°C, then grown amongst a second selection of 6157 T1 Pitztal,
6157 T1 Stockholm
and non-vernalized wild type plants. As expected, vernalization markedly and
uniformly
reduced flowering time in both Pitztal and Stockholm wild type plants. Amongst
the 6157
Stockholm lines, the earliest flowering T1 group (8/23 lines) was
indistinguishable from
vernalized plants. For Pitztal, however, the early flowering T1 plants were on
average
marginally later than the vernalized plants. Therefore, overexpression of 6157
can
substantially reduce the requirement for vernalization in late flowering
ecotypes.
Additionally, we observed that the late flowering of 6157 lines is independent
of FLC
expression and does not respond to vernalization. However, the late flowering
6157 plants
are responsive to photoperiod. In an experiment conducted under short day
conditions of 8
hours of light, we obtained a number of 6157 Columbia T1 plants that flowered
up to a month
later than wild type controls (data not shown). To confirm that the late
flowering effects caused
by 6157 overexpression were independent of FLC transcription, we tested
whether late
flowering 6157 Columbia plants were responsive to vernalization. No
significant change in
flowering time was noted: in continuous light conditions, vernalized T2 plants
of line 4 had a
total of 31.3 +/- 1.8 leaves compared to 30.1 +/- 1.3 when non-vernalized.
Control fca plants
verified that the treatment was effective: vernalized plants flowered after
only 10.3 +/- 0.9
leaves compared to more than 40 leaves for the non-vernalized controls. Thus,
the late
flowering phenotype caused by 6157 could not be overcome by vernalization, as
would be
expected if the delay occurred independently of changes in FLC expression
Example IX. Identification of Homologous Sequences
Homologs from plant species other than Arabidopsis were identified using
database
sequence search tools, such as the Basic Local Alignment Search Tool (BLAST)
(Altschul et
al. (1990) J. Mol. Biol. 215:403-410; and Altschul et al. (1997) Nucl. Acid
Res. 25: 3389-3402).
The tblastx sequence analysis programs were employed using the BLOSUM-62
scoring matrix
(Henikoff, S. and Henikoff, J. G. (1992) Proc. Natl. Acad. Sci. USA 89: 10915-
10919).
The entire NCBI Genbank database was filtered for sequences from all plants
except
Arabidopsis thaliana by selecting all entries in the NCBI Genbank database
associated with
NCBI taxonomic ID 33090 (Viridiplantae; all plants) and excluding entries
associated with
taxonomic ID 3701 (Arabidopsis thaliana). These sequences were compared to
sequences
representing genes of SEQ IDs 1-56 on 9/26/2000 using the Washington
University TBLASTX
algorithm (version 2.Oa19MP). For each gene of SEQ IDs 1-56, individual
comparisons were
ordered by probability score (P-value), where the score reflects the
probability that a particular
alignment occurred by chance. For example, a score of 3.6e-40 is 3.6 x
10~°. For up to ten
29
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
species, the gene with the lowest P-value (and therefore the most likely
homology is listed in
Figure 2.
In addition to P-values, comparisons were also scored by percentage identity.
Percentage identity reflects the degree to which two segments of DNA or
protein are identical
over a particular length. The ranges of percent identity between the non-
Arabidopsis genes
shown in Figure 2 and the Arabidopsis genes in the sequence listing are: SEQ
ID No. 1: 54%-
67%; SEQ ID Nos. 3,5,7: 37%-47%; SEQ ID Nos. 9,11,13,15: 54%-62%; SEQ ID No.
17:
62%-71%; SEQ ID Nos. 19, 21: 50%-67%; SEQ ID Nos. 23,25: 75%-91%; SEQ ID No.
27:
46%-69%; SEQ ID No. 29: 44%-90%; SEQ ID No. 31: 57-89%; SEQ ID No. 33: 37%-
79%;
SEQ ID No. 35: 50%-71 %; SEQ ID No. 37: 39%-63%; SEQ ID No. 39: 58%-70%; SEQ
ID No.
41: 45%-73%; SEQ ID No. 43: 42%-84%; SEQ ID No. 45: 47%-81 %; SEQ ID No. 47:
31 %-
71 %; SEQ ID No. 49: 40%-67%; SEQ ID No. 51: 69%-51 %; SEQ ID No. 53: 43%-86%;
and
SEQ ID No. 55: 79%-89%.
Arabidopsis homologs of genes in Table 2 were also identifed using BLAST.
These
genes are found in the following Arabidopsis BAC sequences, identified by
their Genbank
sequence NID numbers: 2827698 (G234 homology, 3241917 (G748 homology, 2618604
(G994 homology, 6598548 (G1335 homology, 7340331 (G736 homology, 6523051
(G1435
homology, 6598491 (G208 homology and 3172156 (G208 homology.
All references (publications and patents) are incorporated herein by reference
in their
entirety for all purposes.
Although the invention has been described with reference to the embodiments
and
examples above, it should be understood that various modifications can be made
without
departing from the spirit of the invention. Accordingly, the invention is
limited only by the
following claims.
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Figure 1
o. ene c or conserve Oman
1 6157 cDNA
2 6157 rotein 2-57
3 6859 cDNA
4 6859 rotein 2-57
6859.1cDNA
6 6859.1rotein 2-57
7 6859.2cDNA
8 6859.2rotein 2-57
9 61842 cDNA
61842 rotein 2-57
11 61842.2cDNA
12 61842.2rotein 2-57
13 61842.6cDNA
14 61842.6rotein 2-57
61842.7cDNA
16 61842.7rotein 2-57
17 61843 cDNA
18 61843 rotein 2-57
19 61844 cDNA
61844 rotein 2-57
21 61844.2cDNA
22 61844.2rotein 2-57
23 6861 cDNA
24 6861 rotein 2-57
6861.1cDNA
26 6861.1rotein 2-57
27 61759 cDNA
28 61759 rotein 2-57
29 6192 cDNA
6192 rotein 128-185
31 6234 cDNA
32 6234 rotein 14-115
33 6361 cDNA
34 6361 rotein 43-63
6486 cDNA
36 6486 rotein 5-66
37 6748 cDNA
38 6748 rotein 112-140
39 6994 cDNA
6994 rotein 14-123
41 61335 cDNA
42 61335 rotein 24-43, 131-144,
185-203
43 6562 cDNA
44 6562 rotein 253-315
6736 cDNA
46 6736 rotein 54-111
47 61073 cDNA
48 61073 rotein 33-42, 78-175
49 61435 cDNA
61435 rotein 146-194
51 6180 cDNA
52 6180 rotein 118-174
53 6592 cDNA
54 6592 rotein 290-342
.
6208 cDNA
56 6208 rotein 14-116 1
31
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Figure 2A
SEQ IDs Gene Genbank P-value S ecies
Ids NID
1 6157 6530836 3.10E-22 L co ersicon esculentum
1 6157 5606765 5.50E-14 GI cine max
1 6157 6826955 1.20E-13 Zea ma s
1 6157 6536942 6.00E-13 Medicago truncatula
1 6157 8707754 1.40E-12 Hordeum vulgare
1 6157 2293891 1.40E-12 Petunia x h brida
1 6157 19870 1.40E-12 Nicotiana tabacum
1 6157 7628118 3.70E-12 Goss ium arboreum
1 6157 5050220 3.80E-12 Goss ium hirsutum
1 6157 9414215 4.50E-12 Triticum aestivum
3,5,7 6859 6530836 1.40E-34 L co ersicon esculentum
3,5,7 6859 5777903 4.70E-30 Malus domestics
3,5,7 6859 9367312 7.10E-30 Hordeum vul are
3,5,7 6859 6467973 3.60E-29 Dendrobium rex Madame
Thon -IN
3,5,7 6859 4204233 1.20E-28 Lolium temulentum
3,5,7 6859 939784 2.50E-28 Zea ma s
3,5,7 6859 6651032 3.10E-28 Ca sicum annuum
3,5,7 6859 1483227 4.60E-28 Betula endula
3,5,7 6859 5295983 8.70E-28 Or za sativa
3,5,7 6859 5070137 1.10E-27 Nicotiana s Ivestris
9,11,13,1561842 6530836 5.90E-19 L co ersicon esculentum
9,11,13,1561842 5606765 8.00E-15 GI cine max
9,11,13,15G 18426826955 1.20E-12 Zea ma s
9,11,13,15G 18424979250 1.50E-11 O za sativa
9,11,13,1561842 6536942 1.50E-11 Medics o truncatula
9,11,13,1561842 7501504 4.00E-11 Goss ium arboreum
9,11,13,1561842 9444818 4.70E-11 Triticum aestivum
9,11,13,1561842 5859176 5.40E-11 Pinus taeda
9,11,13,1561842 5777905 6.80E-11 Malus domestics
9,11,13,1561842 6647105 6.80E-11 Mesemb anthemum c stallinum
17 61843 8707754 6.60E-15 Hordeum vul are '
17 61843 5606765 1.10E-14 GI cine max
17 61843 4387730 1.50E-14 L co ersicon esculentum
17 61843 3646325 1.60E-14 Malus domestics
17 61843 7625048 1.60E-14 Goss ium arboreum
17 61843 5050220 1.80E-14 Goss ium hirsutum
17 61843 9429009 3.00E-14 Triticum aestivum
17 61843 7145381 6.30E-14 Zea ma s
17 61843 3824730 8.20E-14 O za sativa
17 61843 4528048 2.30E-13 Citrus unshiu
19, 21 61844 5606765 1.70E-14 GI cine max
19, 21 61844 8707754 3.30E-13 Hordeum vulgare
19, 21 61844 9429009 4.40E-13 Triticum aestivum
19, 21 61844 4979250 1.00E-12 O za sativa
19, 21 61844 7628118 1.10E-12 Goss ium arboreum
19, 21 61844 5050220 1.20E-12 Goss ium hirsutum
19, 21 61844 6530836 1.40E-12 L co ersicon esculentum
19, 21 61844 6918768 1.70E-12 Zea ma s
19, 21 61844 6536942 3.50E-12 Medics o truncatula
19, 21 61844 2252481 3.70E-12 Cerato teris richardii
23,25 6861 5601313 8.20E-49 L co ersicon esculentum
23,25 6861 2735763 1.50E-37 Solanum tuberosum
23,25 6861 6652755 5.40E-37 Paulownia kawakamii
32
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Figure 2B
SEQ IDs Gene Genbank P-value S ecies
Ids NID
23,25 6861 9367233 3.30E-33 Hordeum vulgare
23,25 6861 7672990 8.90E-29 Canavalia lineata
23,25 6861 3986688 5.20E-26 Cichorium int bus
23,25 6861 7552197 2.40E-25 Sor hum bicolor
23,25 6861 5295977 4.90E-24 O a sativa
23,25 6861 9194959 3.60E-19 Medica o truncatula
23,25 6861 3855425 4.40E-19 Po ulus tremula x Po ulus
tremuloides
27 61759 5606765 4.60E-16 GI cine max
27 61759 7647685 4.10E-15 L co ersicon esculentum
27 61759 4979250 2.70E-14 O za sativa
27 61759 8707754 6.30E-14 Hordeum vulgare
27 61759 5777905 6.80E-14 Malus domestics
27 61759 7626240 1.10E-13 Goss ium arboreum
27 61759 5047371 1.10E-13 Goss ium hirsutum
27 61759 6918768 1.20E-13 Zea ma s
27 61759 8574456 1.30E-13 Ca sicum annuum
27 61759 8216956 1.30E-13 Cucumis sativus
29 6192 7284340 3.60E-40 GI cine max
29 6192 7779802 1.10E-39 Lotus 'a onicus
29 6192 9361307 9.40E-28 Triticum aestivum
29 6192 7340336 8.10E-24 O za sativa
29 6192 6529152 4.70E-23 L co ersicon esculentum
29 6192 7206269 2.90E-22 Medics o truncatula
29 6192 4886128 4.50E-15 Zea ma s
29 6192 8706346 4.70E-13 Hordeum vulgare
29 6192 9302479 8.80E-13 Sor hum bicolor
29 6192 3326241 2.40E-12 Goss ium hirsutum
31 6234 9193243 7.50E-60 Medics o truncatula
31 6234 9264511 3.30E-57 GI cine max
31 6234 7412424 3.60E-49 L co ersicon esculentum
31 6234 8335078 2.60E-48 O a sativa
31 6234 7218651 1.00E-42 Sor hum bicolor
31 6234 9364630 9.90E-40 Triticum aestivum
31 6234 6079814 5.10E-36 Goss ium arboreum
31 6234 9252441 5.40E-35 Solanum tuberosum
31 6234 5860031 1.00E-33 Pinus taeda
31 6234 5050757 2.60E-33 Goss ium hirsutum
33 6361 7561045 2.30E-21 Medicago truncatula
33 6361 9307604 1.20E-17 Sor hum bicolor
33 6361 4119050 1.70E-13 O a sativa
33 6361 8175037 7.30E-13 Hordeum vul are
33 6361 8329902 5.30E-09 Mesemb anthemum c stallinum
33 6361 6534259 1.20E-08 L co ersicon esculentum
33 6361 7283798 1.30E-08 GI cine max
33 6361 3854369 5.50E-08 Po ulus tremula x Po ulus
tremuloides
33 6361 9365078 1.70E-07 Triticum aestivum
33 6361 5268965 0.00023 Zea ma s
35 6486 6845875 3.10E-36 Gi cine max
35 6486 8172030 4.20E-29 Medics o truncatula
35 6486 9416562 6.40E-29 Triticum aestivum
35 6486 5050127 4.90E-28 Goss ium hirsutum
35 6486 7628400 6.10E-28 Goss ium arboreum
35 6486 7781090 2.10E-27 Lotus japonicus J
33
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Figure 2C
SEQ IDs Gene Genbank P-value S ecies
Ids NID
35 6486 22379 3.40E-27 Zea ma s
35 6486 9441376 4.80E-27 Chlam domonas reinhardtii
35 6486 7409616 1.30E-26 L co ersicon esculentum
35 6486 8071558 1.40E-26 Solanum tuberosum
37 6748 853689 5.60E-87 Cucurbita maxima
37 6748 7242897 3.10E-59 O a sativa
37 6748 5888560 9.70E-46 L co ersicon esculentum
37 6748 6341666 4.50E-38 GI cine max
37 6748 9190140 2.90E-35 Medica o truncatula
37 6748 7535776 4.00E-33 Sor hum bicolor
37 6748 9419494 1.70E-31 Hordeum vul are
37 6748 9410157 8.20E-29 Triticum aestivum
37 6748 3929324 3.50E-25 Dendrobium rex Madame
Thong-IN
37 6748 6020953 7.30E-21 Zea ma s
39 6994 6651291 1.50E-55 Pim inella brach car a
39 6994 7561750 5.60E-51 Medicago truncatula
39 6994 5268844 2.10E-50 Zea ma s
39 6994 1430845 3.10E-50 L co ersicon esculentum
39 6994 1945282 5.40E-49 O a sativa
39 6994 22637 1.40E-46 Ph scomitrella atens
39 6994 7626566 4.40E-44 Goss ium arboreum
39 6994 2921339 4.50E-44 Goss ium hirsutum
39 6994 7590249 3.60E-43 GI cine max
39 6994 20562 6.30E-43 Petunia x h brida
41 61335 19742 8.40E-63 Nicotiana s Ivestris
41 61335 5398738 1.20E-59 Zea ma s
41 61335 9361467 1.40E-50 Triticum aestivum
41 61335 8330366 1.60E-48 Mesemb anthemum c stallinum
41 61335 8174823 7.50E-43 Hordeum vul are
41 61335 6696628 8.00E-42 Pinus taeda
41 61335 7721100 1.20E-39 Lotus 'a onicus
41 61335 7502173 2.60E-37 Goss ium arboreum
41 61335 1817176 5.60E-36 Pinus radiata
41 61335 7550978 3.30E-35 Sor hum bicolor
43 6562 1399004 6.60E-142Brassica na us
43 6562 5381310 6.80E-53 Catharanthus roseus
43 6562 169958 3.80E-45 GI cine max
43 6562 2879779 3.60E-43 S inacia oleracea
43 6562 7565950 2.10E-41 Medica o truncatula
43 6562 728627 4.50E-41 Nicotiana tabacum
43 6562 1155053 2.30E-40 Phaseolus vul aris
43 ~ 6562 1498300 5.70E-40 Petroselinum cris um
43 6562 5046889 6.70E-34 Goss ium hirsutum
43 6562 8328888 2.60E-25 Mesemb anthemum c stallinum
45 6736 7409627 1.40E-37 L co ersicon esculentum
45 6736 9197391 5.60E-32 Medicago truncatula
45 6736 9419494 4.70E-27 Hordeum vulgare
45 6736 7328718 1.30E-25 O za sativa
45 6736 9410157 1.80E-25 Triticum aestivum
45 6736 853689 5.20E-25 Cucurbita maxima
45 6736 7535776 6.60E-25 Sor hum bicolor
45 6736 3929324 4.70E-21 Dendrobium rex Madame
Thon -IN
45 6736 2393774 9.60E-20 Zea mays
34
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
Fioure 2D
SEQ IDs Gene Genbank P-value S ecies
Ids NID
45 6736 7624398 1.10E-19 Goss ium arboreum
47 61073 7718401 2.20E-55 Medicago truncatula
47 61073 6846994 2.50E-44 GI tine max
47 61073 7615218 1.60E-42 Lotus 'a onicus
47 61073 7333102 2.70E-34 L co ersicon esculentum
47 61073 9445090 3.40E-25 Triticum aestivum
47 61073 9252370 2.20E-24 Solanum tuberosum
47 61073 5042437 4.60E-21 O a sativa
47 61073 7536402 5.30E-20 Sor hum bicolor
47 61073 2213535 7.30E-19 Pisum sativum
47 61073 7624850 2.10E-18 Goss ium arboreum
49 61435 9203811 3.70E-37 GI tine max
49 61435 9430136 4.10E-35 L co ersicon esculentum
49 61435 8904354 4.30E-32 Hordeum vul are
49 61435 5050706 3.30E-26 Goss ium hirsutum
49 61435 7614196 6.40E-19 Lotus 'a onicus
49 61435 7551484 1.00E-18 Sorghum bicolor
49 61435 6916552 7.20E-12 L co ersicon ennellii
49 61435 2443007 5.50E-11 O za sativa
.
49 61435 9255229 1.30E-10 Zea ma s
49 61435 7766737 2.80E-10 Medica o truncatula
51 6180 8468047 1.90E-35 O za sativa
51 6180 7559831 1.20E-24 Medicago truncatula
51 6180 5272716 9.90E-24 L co ersicon esculentum
51 6180 9187621 3.30E-23 Solanum tuberosum
51 6180 6566312 1.30E-22 GI tine max
51 6180 9304207 1.30E-21 Sorghum bicolor
51 6180 7721184 1.30E-20 Lotus 'a onicus
51 6180 9444636 3.10E-19 Triticum aestivum
51 6180 3220212 5.20E-19 Goss ium hirsutum
51 6180 1159876 8.00E-19 Avena fatua
53 6592 7924069 7.10E-27 GI tine max
53 6592 5896650 1.10E-22 L co ersicon esculentum
53 6592 6279773 1.10E-17 L co ersicon ennellii
53 6592 9364330 1.20E-14 Triticum aestivum
53 6592 6166282 5.40E-14 Pinus taeda
53 6592 8367093 1.60E-12 Zea ma s
53 6592 9301543 6.60E-11 Sor hum bicolor
53 6592 7562632 2.80E-10 Medica o truncatula
53 6592 702652 5.80E-05 O za sativa
53 6592 7322923 0.094 L co ersicon hirsutum
55 6208 437326 2.80E-65 Goss ium hirsutum
55 6208 7765706 4.40E-64 Medica o truncatula
55 6208 5269878 5.80E-64 L co ersicon esculentum
55 6208 19054 6.90E-63 Hordeum vulgare
55 6208 2605616 1.00E-62 O za sativa
55 6208 7626566 3.50E-62 Goss ium arboreum
55 6208 6667606 4.10E-62 GI tine max
55 6208 517492 1.80E-60 Zea ma s
55 6208 9302672 2.40E-57 Sor hum bicolor
55 6208 5860031 1.30E-54 Pinus taeda
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
SEQUENCE LISTING
<110> Ratcliffe, Oliver
Heard, Jacqueline
Samaha, Raymond
Creelman, Robert
Keddie, James
Jiang, Cai-zhong
Reuber, Lynne
Riechmann, Jose Luis
<120> Flowering Time Modification
<130> MBI-0021
<150> US 60/159,464
<151> 1999-10-12
<150> US 60/166,228
<151> 1999-11-17
<150> US 60/197,899
<151> 2000-04-17
<150> Plant Trait Modification III
<151> 2000-08-22
<150> US 60/164,132
<151> 1999-11-08
<160> 64
<170> PatentIn version 3.0
<210> 1
<211> 883
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (31)..(621)
<223> 6157
<400> 1
gggcataacc cttatcggag atttgaagcc atg gga aga aga aaa atc gag atc 54
Met Gly Arg Arg Lys Ile Glu Ile
1 5
aag cga atc gag aac aaa agc agt cga caa gtc act ttc tcc aaa cga 102
Lys Arg Ile Glu Asn Lys Ser Ser Arg Gln Val Thr Phe Ser Lys Arg
15 20
cgc aat ggt ctc atc gac aaa get cga caa ctt tcg att ctc tgt gaa 150
Arg Asn Gly Leu Ile Asp Lys Ala Arg Gln Leu Ser Ile Leu Cys Glu
25 30 35 40
tcc tcc gtc get gtt gtc gtc gta tct gcc tcc gga aaa ctc tat gac 198
Ser Ser Val Ala Val Val Val Val Ser Ala Ser Gly Lys Leu Tyr Asp
45 50 55
tct tcc tcc ggt gac gac att tcc aag atc att gat cgt tat gaa ata 246
Page 1
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI -0021.txt
SerSer Gly AspAspIle SerLysIle IleAspArg TyrGluIle
Ser
60 65 70
caacat gat gaacttaga gccttagat cttgaagaa aaaattcag 294
get
GlnHis Asp GluLeuArg AlaLeuAsp LeuGluGlu LysIleGln
Ala
75 80 85
aattat cca cacaaggag ttactagaa acagtccaa agcaagctt 342
ctt
AsnTyr Pro HisLysGlu LeuLeuGlu ThrValGln SerLysLeu
Leu
90 95 100
gaagaa aat gtcgataat gtaagtgta gattctcta atttctctg 390
cca
GluGlu Asn ValAspAsn ValSerVal AspSerLeu IleSerLeu
Pro
105 110 115 120
gaggaa ctt gagactget ctgtccgta agtagaget aggaaggca 438
caa
GluGlu Leu GluThrAla LeuSerVal SerArgAla ArgLysAla
Gln
125 130 135
gaactg atg gagtatatc gagtccctt aaagaaaag gagaaattg 486
atg
GluLeu Met GluTyrIle GluSerLeu LysGluLys GluLysLeu
Met
140 145 150
ctgaga gag aaccaggtt ctggetagc cagatggga aagaatacg 534
gaa
LeuArg Glu AsnGlnVal LeuAlaSer GlnMetGly LysAsnThr
Glu
155 160 165
ttgctg aca gatgatgag agaggaatg tttccggga agtagctcc 582
gca
LeuLeu Thr AspAspGlu ArgGlyMet PheProGly SerSerSer
Ala
170 175 180
ggcaac ata ccggagact ctcccgctg ctcaattag ccaccatcat 631
aaa
GlyAsn Ile ProGluThr LeuProLeu LeuAsn
Lys
185 190 195
caacggctga gcctgattca taattaagag
691
gttttcacct aataaatttg
taaactcaaa
tatattataa cttttatctt cctctagtgt
751
aaagctgtgt ggaatttaag
aatctcaaac
gtcaaaaaga gtgttgtacc tccttcggag
81~
aaacgagaaa acaagatcag
gtatggatca
agtttgtgtg ttggattttt aaagttgtgc
871
tttgtgtctg tttctttctt
aatgtacgga
caaaaaaaaa 883
as
<210>
2
<211>
196
<212>
PRT
<213> is
Arabidops thaliana
<400> 2
Met Gly Arg Arg Lys Ile Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Asn Gly Leu Ile Asp Lys Ala
20 25 30
Arg Gln Leu Ser Ile Leu Cys Glu Ser Ser Val Ala Val Val Val Val
35 40 45
Page 2
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Ser Ala Ser Gly Lys Leu Tyr Asp Ser Ser Ser Gly Asp Asp Ile Ser
50 55 60
Lys Ile Ile Asp Arg Tyr Glu Ile Gln His Ala Asp Glu Leu Arg Ala
65 70 75 80
Leu Asp Leu Glu Glu Lys Ile Gln Asn Tyr Leu Pro His Lys Glu Leu
85 90 95
Leu Glu Thr Val Gln Ser Lys Leu Glu Glu Pro Asn Val Asp Asn Val
100 105 110
Ser Val Asp Ser Leu Ile Ser Leu Glu Glu Gln Leu Glu Thr Ala Leu
115 120 125
Ser Val Ser Arg Ala Arg Lys Ala Glu Leu Met Met Glu Tyr Ile Glu
130 135 140
Ser Leu Lys Glu Lys Glu Lys Leu Leu Arg Glu Glu Asn Gln Val Leu
145 150 155 160
Ala Ser Gln Met Gly Lys Asn Thr Leu Leu Ala Thr Asp Asp Glu Arg
165 170 175
Gly Met Phe Pro Gly Ser Ser Ser Gly Asn Lys Ile Pro Glu Thr Leu
180 185 190
Pro Leu Leu Asn
195
<210> 3
<211> 1196
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (132)..(569)
<223> 6859
<400> 3
aaaaaggaga gagagagaga gagagagaga gagagagaga gaaacgaaga aaaaaaaaga 60
agcaaaaaac attgtgggtc tccggtgatt aggatcaaat tagggcacca gccttatcgg 120
aggaagaagc c atg ggt aga aaa aaa gtc gag atc aag cga atc gag aac 170
Met Gly Arg Lys Lys Val Glu Ile Lys Arg Ile Glu Asn
1 5 10
aaa agt agt cga caa gtc act ttc tcc aaa cga cgc aat ggt ctc atc 218
Page 3
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Lys Ser Ser Arg Gln Val Ser Lys Arg Asn Gly Leu Ile
Thr Phe Arg
15 20 25
gag aaa get cga caa ctt ctc tgt tct tcc atc get gtt 266
tca att gaa
Glu Lys Ala Arg Gln Leu Leu Cys Ser Ser Ile Ala Val
Ser Ile Glu
30 35 40 45
ctc gtc gtc tcc ggc tcc ctc tac tct gcc tcc ggt gac 314
gga aaa aag
Leu Val Val Ser Gly Ser Leu Tyr Ser Ala Ser Gly Asp
Gly Lys Lys
50 55 60
aac atg tca aag atc att tac gaa cat cat get gat gaa 362
gat cgt ata
Asn Met Ser Lys Ile Ile Tyr Glu His His Ala Asp Glu
Asp Arg Ile
65 70 75
ctt gaa gcc tta gat ctt aaa act aat tat ctg cca ctc 410
gca gaa cgg
Leu Glu Ala Leu Asp Leu Lys Thr Asn Tyr Leu Pro Leu
Ala Glu Arg
80 85 90
aaa gag tta cta gaa ata agg tta caa aga cac ttt tat 458
gtc caa gca
Lys Glu Leu Leu Glu Ile Arg Leu Gln Arg His Phe Tyr
Val Gln Ala
95 100 105
ctc cct ctt ctt ctg atg act ttt ttt ctt ttc ttt tgg 506
aaa aat ttt
Leu Pro Leu Leu Leu Met Thr Phe Phe Leu Phe Phe Trp
Lys Asn Phe
110 115 120 125
cga att atg aat aca gca aag aat atg tcg ata atg caa 554
agc ttg caa
Arg Ile Met Asn Thr Ala Lys Asn Met Ser Ile Met Gln
Ser Leu Gln
130 135 140
gtg tgg ata ctt taa tttctctggagaacagctc 609
g gagactgctc
tgtccgtaac
Val Trp Ile Leu
145
tagagctagg aagacagaac taatgatgggggaagtgaagtcccttcaaa aaacgcatgt669
caaagatcat tgatcgttat gaaatacatcatgctgatgaacttaaagcc ttagatcttg729
cagaaaaaat tcggaattat cttccacacaaggagttactagaaatagtc caaagattct789
ctaatatcta tggaggaaca gctcgagactgctctgtcagtaattagagc taagaagaca849
gaactaatga tggaggatat gaagtcacttcaagaaagggagaagttgct gatagaagag909
aaccagattc tggctagcca ggtggggaagaagacgtttctggttataga aggtgacaga969
ggaatgtcat gggaaaatgg ctccggcaacaaagtacgggagactcttcc gctgctcaag1029
taatcaccat catcaacggc tgagctttcaccttaaacttacagcctgat tcagaagttt1089
ttacaaattt gtaaattata aaaagcttcataataatctcaaccttttta tcttcctcgc1149
gccaatgtgg aaattaaggt aaaccaaaaaaaaaaaaaaaaaaaaaa 1196
<210> 4
<211> 145
<212> PRT
<213> Arabidopsis thaliana
<400> 4
Page 4
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Met Gly Arg Lys Lys Val Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Asn Gly Leu Ile Glu Lys Ala
20 25 30
Arg Gln Leu Ser Ile Leu Cys Glu Ser Ser Ile Ala Val Leu Val Val
35 40 45
Ser Gly Ser Gly Lys Leu Tyr Lys Ser Ala Ser Gly Asp Asn Met Ser
50 55 60
Lys Ile Ile Asp Arg Tyr Glu Ile His His Ala Asp Glu Leu Glu Ala
65 70 75 80
Leu Asp Leu Ala Glu Lys Thr Arg Asn Tyr Leu Pro Leu Lys Glu Leu
85 90 95
Leu Glu Ile Val Gln Arg Leu Ala Gln Arg His Phe Tyr Leu Pro Leu
100 105 110
Leu Leu Met Lys Asn Thr Phe Phe Phe Leu Phe Phe Trp Arg Ile Met
115 120 125
Asn Thr Ala Ser Leu Lys Asn Gln Met Ser Ile Met Gln Val Trp Ile
130 135 140
Leu
145
<210> 5
<211> 972
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (132)..(569)
<223> 6859.1
<400> 5
aaaaaggaga gagagagaga gagagagaga gagagagaga gaaacgaaga aaaaaaaaga 60
agcaaaaaac attgtgggtc tccggtgatt aggatcaaat tagggcacca gccttatcgg 120
aggaagaagc c atg ggt aga aaa aaa gtc gag atc aag cga atc gag aac 170
Met Gly Arg Lys Lys Val Glu Ile Lys Arg Ile Glu Asn
1 5 10
aaa agt agt cga caa gtc act ttc tcc aaa cga cgc aat ggt ctc atc 218
Lys Ser Ser Arg Gln Val Thr Phe Ser Lys Arg Arg Asn Gly Leu Ile
15 20 25
Page 5
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
gag aaa cgacaactt tca ctc tgt tct atcget gtt 266
get att gaa tcc
Glu Lys ArgGlnLeu Ser Leu Cys Ser IleAla Val
Ala Ile Glu Ser
30 35 40 45
ctc gtc tccggctcc gga ctc tac tct tccggt gac 314
gtc aaa aag gcc
Leu Val SerGlySer Gly Leu Tyr Ser SerGly Asp
Val Lys Lys Ala
50 55 60
aac atg aagatcatt gat tac gaa cat getgat gaa 362
tca cgt ata cat
Asn Met LysIleIle Asp Tyr Glu His AlaAsp Glu
Ser Arg Ile His
65 70 75
ctt gaa ttagatctt gca aaa act aat ctgcca ctc 410
gcc gaa cgg tat
Leu Glu LeuAspLeu Ala Lys Thr Asn LeuPro Leu
Ala Glu Arg Tyr
80 85 90
aaa gag ctagaaata gtc agg tta caa cacttt tat 458
tta caa gca aga
Lys Glu LeuGluIle Val Arg Leu Gln HisPhe Tyr
Leu Gln Ala Arg
95 100 105
ctc cct cttctgatg aaa act ttt ttt ttcttt tgg 506
ctt aat ttt ctt
Leu Pro LeuLeuMet Lys Thr Phe Phe PhePhe Trp
Leu Asn Phe Leu
110 115 120 125
cga att aatacagca agc aag aat atg ataatg caa 554
atg ttg caa tcg
Arg Ile AsnThrAla Ser Lys Asn Met IleMet Gln
Met Leu Gln Ser
130 135 140
gtg tgg ctttaatttctctgga gaacagctc tg tccgtaac 609
ata g gagactgctc
Val Trp Leu
Ile
145
tagagctagg ggaagtgaagtcccttcaaa aaacggagaa 669
aagacagaac
taatgatggg
cttgctgaga tagccaggtggggaagaaga cgtttctggt 729
gaagagaacc
agactttggc
tatagaaggt aaatggctccggcaacaaag tacgggagac 789
gacagaggaa
tgtcatggga
tcttccgctg aacggctgagctttcacctt aaacttacag 849
ctcaagtaat
caccatcatc
cctgattcag attataaaaagcttcataat aatctcaacc 909
aagtttttac
aaatttgtaa
tttttatctt taaggtaaaccaaaaaaaaa aaaaaaaaaa 969
cctcgcgcca
atgtggaaat
aaa 972
<210> 6
<211> 145
<212> PRT
<213> Arabidopsis
thaliana
<400> 6
Met Gly Arg Lys Lys Val Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Asn Gly Leu Ile Glu Lys Ala
20 25 30
Page 6
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Arg Gln Leu Ser Ile Leu Cys Glu Ser Ser Ile Ala Val Leu Val Val
35 40 45
Ser Gly Ser Gly Lys Leu Tyr Lys Ser Ala Ser Gly Asp Asn Met Ser
50 55 60
Lys Ile Ile Asp Arg Tyr Glu Ile His His Ala Asp Glu Leu Glu Ala
65 70 75 80
Leu Asp Leu Ala Glu Lys Thr Arg Asn Tyr Leu Pro Leu Lys Glu Leu
85 90 95
Leu Glu Ile Val Gln Arg Leu Ala Gln Arg His Phe Tyr Leu Pro Leu
100 105 110
Leu Leu Met Lys Asn Thr Phe Phe Phe Leu Phe Phe Trp Arg Ile Met
115 120 125
Asn Thr Ala Ser Leu Lys Asn Gln Met Ser Ile Met Gln Val Trp Ile
130 135 140
Leu
145
<210> 7
<211> 1036
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (162)..(752)
<223> 6859.2
<400>
7
gatttgtcattttttgtcta aaaaaaaaaa aggagagagagagagagaga60
gccaaaaaaa
gagagagagagaaacgaaga agcaaaaaac attgtgggtctccggtgatt120
aaaaaaaaga
aggatcaaattagggcacca aggaagaagc c atg ggt 176
gccttatcgg aga aaa
aaa
Met Gly rg Lys
A Lys
1 5
gtc gag aag cga gag aaaagt agtcga caa act ttc 224
atc atc aac gtc
Val Glu Lys Arg Glu LysSer SerArg Gln Thr Phe
Ile Ile Asn Val
10 15 20
tcc aaa cgc aat ctc gagaaa getcga caa tca att 272
cga ggt atc ctt
Ser Lys Arg Asn Leu GluLys AlaArg Gln Ser Ile
Arg Gly Ile Leu
25 30 35
ctc tgt tct tcc get ctcgtc gtctcc ggc gga aaa 320
gaa atc gtt tcc
Leu Cys Ser Ser Ala LeuVal ValSer Gly Gly Lys
Glu Ile Val Ser
40 45 50
Page 7
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
ctctacaagtct gcctccggt gacaacatg tcaaag atcattgatcgt 368
LeuTyrLysSer AlaSerGly AspAsnMet SerLys IleIleAspArg
55 60 65
tacgaaatacat catgetgat gaacttgaa gcctta gatcttgcagaa 416
TyrGluIleHis HisAlaAsp GluLeuGlu AlaLeu AspLeuAlaGlu
70 75 80 85
aaaactcggaat tatctgcca ctcaaagag ttacta gaaatagtccaa 464
LysThrArgAsn TyrLeuPro LeuLysGlu LeuLeu GluIleValGln
90 95 100
agcaagcttgaa gaatcaaat gtcgataat gcaagt gtggatacttta 512
SerLysLeuGlu GluSerAsn ValAspAsn AlaSer ValAspThrLeu
105 110 115
atttctctggag gaacagctc gagactget ctgtcc gtaactagaget 560
IleSerLeuGlu GluGlnLeu GluThrAla LeuSer ValThrArgAla
120 125 130
aggaagacagaa ctaatgatg ggggaagtg aagtcc cttcaaaaaacg 608
ArgLysThrGlu LeuMetMet GlyGluVal LysSer LeuGlnLysThr
135 140 145
gagaacttgctg agagaagag aaccagact ttgget agccaggtgggg 656
GluAsnLeuLeu ArgGluGlu AsnGlnThr LeuAla SerGlnValGly
150 155 160 165
aagaagacgttt ctggttata gaaggtgac agagga atgtcatgggaa 704
LysLysThrPhe LeuValIle GluGlyAsp ArgGly MetSerTrpGlu
170 175 180
aatggctccggc aacaaagta cgggagact cttccg ctgctcaagtaa 752
AsnGlySerGly AsnLysVal ArgGluThr LeuPro LeuLeuLys
185 190 195
tcaccatc at caacggctga taaacttaca gcctgattca gaagttttta
812
gctttcacct
caaatttg ta taatctcaac ctttttatct tcctcgcgcc
872
aattataaaa
agcttcataa
aatgtgga aa aaacagaagc tcatgcgaaa gaattgtaaa
932
ttaaggttaa
aaataaaata
actaagat aa gtaccttcgt agacgatata agatttattc
992
agctatagta
gatctttatt
gtgtgttt gt aaaaaaaaaa aaaa 1036
cttcccctcn
aaaaaaaaaa
<210>
8
<211> 96
1
<212> RT
P
<213>
Arabidopsis
thaliana
<400> 8
Met Gly Arg Lys Lys Val Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Asn Gly Leu Ile Glu Lys Ala
20 25 30
Page 8
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Arg Gln Leu Ser Ile Leu Cys Glu Ser Ser Ile Ala Val Leu Val Val
35 40 45
Ser Gly Ser Gly Lys Leu Tyr Lys Ser Ala Ser Gly Asp Asn Met Ser
50 55 60
Lys Ile Ile Asp Arg Tyr Glu Ile His His Ala Asp Glu Leu Glu Ala
65 70 75 80
Leu Asp Leu Ala Glu Lys Thr Arg Asn Tyr Leu Pro Leu Lys Glu Leu
85 90 95
Leu Glu Ile Val Gln Ser Lys Leu Glu Glu Ser Asn Val Asp Asn Ala
100 105 110
Ser Val Asp Thr Leu Ile Ser Leu Glu Glu Gln Leu Glu Thr Ala Leu
115 120 125
Ser Val Thr Arg Ala Arg Lys Thr Glu Leu Met Met Gly Glu Val Lys
130 135 140
Ser Leu Gln Lys Thr Glu Asn Leu Leu Arg Glu Glu Asn Gln Thr Leu
145 150 155 160
Ala Ser Gln Val Gly Lys Lys Thr Phe Leu Val Ile Glu Gly Asp Arg
165 170 175
Gly Met Ser Trp Glu Asn Gly Ser Gly Asn Lys Val Arg Glu Thr Leu
180 185 190
Pro Leu Leu Lys
195
<210> 9
<211> 1059
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (219)..(809)
<223> 61842
<400> 9
actattacat gcctcttcct cgcttcaaaa cggcaccgtt tccacttgtt attatttttc 60
tctctatcgt ctaacaaaaa aaaaaactga cttgggattt tttttcattt gtctagccca 120
aaagaagaag atagaaacga agaaaaaaag caaacacatt ttgggtcccc ggtggttagg 180
atcaaattag ggcacaaacc ttatcggaga aagaagcc atg gga aga aga aaa gtc 236
Page 9
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Met Gly Arg Arg Lys Val
1 5
gagatc aagcgaatc gagaacaaa agcagtcga caagtcact ttctcc 284
GluIle LysArgIle GluAsnLys SerSerArg GlnValThr PheSer
10 15 20
aaacga cgcaaaggt ctcatcgaa aaagetcga caactttca attctc 332
LysArg ArgLysGly LeuIleGlu LysAlaArg GlnLeuSer IleLeu
25 30 35
tgtgaa tcttccatc getgttgtc gccgtctcc ggttccgga aaactc 380
CysGlu SerSerIle AlaValVal AlaValSer GlySerGly LysLeu
40 45 50
tacgac tctgcctcc ggtgacaac atgtcaaag atcattgat cgttat 428
TyrAsp SerAlaSer GlyAspAsn MetSerLys IleIleAsp ArgTyr
55 60 65 70
gaaata catcatget gatgaactt aaagcctta gatcttgca gaaaaa 476
GluIle HisHisAla AspGluLeu LysAlaLeu AspLeuAla GluLys
75 80 85
attcgg aattatctt ccacacaag gagttacta gaaatagtc caaagc 524
IleArg .AsnTyrLeu ProHisLys GluLeuLeu GluIleVal GlnSer
90 95 100
aagctt gaagaatca aatgtcgat aatgtaagt gtagattct ctaata 572
LysLeu GluGluSer AsnValAsp AsnValSer ValAspSer LeuIle
105 110 115
tctatg gaggaacag ctcgagact getctgtca gtaattaga getaag 620
SerMet GluGluGln LeuGluThr AlaLeuSer ValIleArg AlaLys
120 125 130
aagaca gaactaatg atggaggat atgaagtca cttcaagaa agggag 668
LysThr GluLeuMet MetGluAsp MetLysSer LeuGlnGlu ArgGlu
135 140 145 150
aagttg ctgatagaa gagaaccag attctgget agccaggtg gggaag 716
LysLeu LeuIleGlu GluAsnGln IleLeuAla SerGlnVal GlyLys
155 160 165
aagacg tttctggtt atagaaggt gacagagga atgtcacgg gaaaat 764
LysThr PheLeuVal IleGluGly AspArgGly MetSerArg GluAsn
170 175 180
ggctcc ggcaacaaa gtaccggag actctttcg ctgctcaag taa 809
GlySer GlyAsnLys ValProGlu ThrLeuSer LeuLeuLys
185 190 195
tcaccatcat caacggctga gctttcacca taaacttact cacagcctga ttcagaagct 869
tttacaaaat tgtaaattat aaaaagctgc ataataatct caaccttttt atcttcctcg 929
cgccaatgtg gaaataaagg taaaacaaaa cgaagctctt ttcttttatg cgaaagaatt 989
gtaaaactaa gataaagcta ccgatctttg ttgtacctta gtagacaaat atcagagttc 1049
ttgtgcttgt 1059
<210> 10
Page 10
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
<211> 196
<212> PRT
<213> Arabidopsis thaliana
<400> 10
Met Gly Arg Arg Lys Val Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Lys Gly Leu Ile Glu Lys Ala
20 25 30 .
Arg Gln Leu Ser Ile Leu Cys Glu Ser Ser Ile Ala Val Val Ala Val
35 40 45
Ser Gly Ser Gly Lys Leu Tyr Asp Ser Ala Ser Gly Asp Asn Met Ser
50 55 60
Lys Ile Ile Asp Arg Tyr Glu Ile His His Ala Asp Glu Leu Lys Ala
65 70 75 80
Leu Asp Leu Ala Glu Lys Ile Arg Asn Tyr Leu Pro His Lys Glu Leu
85 90 95
Leu Glu Ile Val Gln Ser Lys Leu Glu Glu Ser Asn Val Asp Asn Val
100 105 110
Ser Val Asp Ser Leu Ile Ser Met Glu Glu Gln Leu Glu Thr Ala Leu
115 120 125
Ser Val Ile Arg Ala Lys Lys Thr Glu Leu Met Met Glu Asp Met Lys
130 135 140
Ser Leu Gln Glu Arg Glu Lys Leu Leu Ile Glu Glu Asn Gln Ile Leu
145 150 155 160
Ala Ser Gln Val Gly Lys Lys Thr Phe Leu Val Ile Glu Gly Asp Arg
165 170 175
Gly Met Ser Arg Glu Asn Gly Ser Gly Asn Lys Val Pro Glu Thr Leu
180 185 190
Ser Leu Leu Lys
195
<210> 11
<211> 880
<212> DNA
<213> Arabidopsis thaliana
Page 11
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
<220>
<221> CDS
<222> (79)..(636)
<223> 61842.2
MBI-0021.txt
<400> 11
agaaaaa aagcaaacacatt atcaaattag ggcacaaacc
60
ttgggtcccc
ggtggttagg
ttatcgg agaaagaagcc atggga agaagaaaa gtcgagatc aagcgaatc 111
MetGly ArgArgLys ValGluIle LysArgIle
1 5 10
gagaacaaaagc agtcgacaa gtcactttc tccaaacga cgcaaaggt 159
GluAsnLysSer SerArgGln ValThrPhe SerLysArg ArgLysGly
15 20 25
ctcatcgaaaaa getcgacaa ctttcaatt ctctgtgaa tcttccatc 207
LeuIleGluLys AlaArgGln LeuSerIle LeuCysGlu SerSerIle
30 35 40
getgttgtcgcc gtctccggt tccggaaaa ctctacgac tctgcctcc 255
AlaValValAla ValSerGly SerGlyLys LeuTyrAsp SerAlaSer
45 50 55
ggtgacaacatg tcaaagatc attgatcgt tatgaaata catcatget 303
GlyAspAsnMet SerLysIle IleAspArg TyrGluIle HisHisAla
60 65 70 75
gatgaacttaaa gccttagat cttgcagaa aaaattcgg aattatctt 351
AspGluLeuLys AlaLeuAsp LeuAlaGlu LysIleArg AsnTyrLeu
80 85 90
ccacacaaggag ttactagaa atagtccaa agtgtagat tctctaata 399
ProHisLysGlu LeuLeuGlu IleValGln SerValAsp SerLeuIle
95 100 105
tctatggaggaa cagctcgag actgetctg tcagtaatt agagetaag 447
SerMetGluGlu GlnLeuGlu ThrAlaLeu SerValIle ArgAlaLys
110 115 120
aagacagaacta atgatggag gatatgaag tcacttcaa gaaagggag 495
LysThrGluLeu MetMetGlu AspMetLys SerLeuGln GluArgGlu
125 130 135
aagttgctgata gaagagaac cagattctg getagccag gtggggaag 543
LysLeuLeuIle GluGluAsn GlnIleLeu AlaSerGln ValGlyLys
140 145 150 155
aagacgtttctg gttatagaa ggtgacaga ggaatgtca cgggaaaat 591
LysThrPheLeu ValIleGlu GlyAspArg GlyMetSer ArgGluAsn
160 165 170
ggctccggcaac aaagtaccg gagactctt tcgctgctc aagtaa 636.
GlySerGlyAsn LysValPro GluThrLeu SerLeuLeu Lys
175 180 185
tcaccatcat caacggctga gctttcacca taaacttact cacagcctga ttcagaagct 696
tttacaaaat tgtaaattat aaaaagctgc ataataatct caaccttttt atcttcctcg 756
cgccaatgtg gaaataaagg taaaacaaaa cgaagctctt ttcttttatg cgaaagaatt 816
Page 12
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
gtaaaactaa gataaagcta ccgatctttg ttgtacctta gtagacaaat atcagagttc 876
ttgt ~ 880
<210> 12
<211> 185
<212> PRT
<213> Arabidopsis thaliana
<400> 12
Met Gly Arg Arg Lys Val Glu Ile Lys Arg IIe GIu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Lys Gly Leu Ile Glu Lys Ala
20 25 30
Arg Gln Leu Ser Ile Leu Cys Glu Ser Ser Ile Ala Val Val Ala Val
35 40 45
Ser Gly Ser Gly Lys Leu Tyr Asp Ser Ala Ser Gly Asp Asn Met Ser
50 55 60
Lys Ile Ile Asp Arg Tyr Glu Ile His His Ala Asp Glu Leu Lys Ala
65 70 75 80
Leu Asp Leu Ala Glu Lys Ile Arg Asn Tyr Leu Pro His Lys Glu Leu
85 90 95
Leu Glu Ile Val Gln Ser Val Asp Ser Leu Ile Ser Met Glu Glu Gln
100 105 110
Leu Glu Thr Ala Leu Ser Val Ile Arg Ala Lys Lys Thr Glu Leu Met
115 120 125
Met Glu Asp Met Lys Ser Leu Gln Glu Arg Glu Lys Leu Leu Ile Glu
130 135 140
Glu Asn Gln Ile Leu Ala Ser Gln Val Gly Lys Lys Thr Phe Leu Val
145 150 155 160
Ile Glu Gly Asp Arg Gly Met Ser Arg Glu Asn Gly Ser Gly Asn Lys
165 170 175
Val Pro Glu Thr Leu Ser Leu Leu Lys
180 185
<210> 13
<211> 978
<212> DNA
Page 13
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
<213> Arabidopsis thaliana
MBI-0021.txt
<220>
<221> CDS
<222> (219) . . (452)
<223> 61842.6
<400> 13
actattacat gcctcttcct cgcttcaaaacggcaccgtttccacttgtt attatttttc60
tctctatcgt ctaacaaaaa aaaaaactgacttgggattttttttcattt gtctagccca120
aaagaagaag atagaaacga agaaaaaaagcaaacacattttgggtcccc ggtggttagg180
atcaaattag ggcacaaacc ttatcggagaaagaagcc 236
atg gga
aga aga
aaa gtc
Met Gly
Arg Arg
Lys Val
1 5
gag atc aag cga atc gag agc agt caa gtc act ttc tcc 284
aac aaa cga
Glu Ile Lys Arg Ile Glu Ser Ser Gln Val Thr Phe Ser
Asn Lys Arg
15 20
aaa cga cgc aaa ggt ctc aaa get caa ctt tca att ctc 332
atc gaa cga
Lys Arg Arg Lys Gly Leu Lys Ala Gln Leu Ser Ile Leu
Ile Glu Arg
25 30 35
tgt gaa tct tcc atc get gcc gtc ggt tcc gga aaa ctc 380
gtt gtc tcc
Cys Glu Ser Ser Ile Ala Gly Ser Gly Lys Leu
Val Val Ala Val Ser
40 45 50
tac gac tct gcc tcc ggt atc ttg aaa aaa ttc gga att 428
gac aag cag
Tyr Asp Ser Ala Ser Gly Ile Leu Lys Lys Phe Gly Ile
Asp Lys Gln
55 60 65 70
atc ttc cac aca agg agt aaatagtcca 482
tac tag aagattctct
aatatctatg
Ile Phe His Thr Arg Ser
Tyr
75
gaggaacagc tcgagactgc tctgtcagtaattagagctaagaagacaga actaatgatg542
gaggatatga agtcacttca agaaagggagaagttgctgatagaagagaa ccagattctg602
gctagccagg tggggaagaa gacgtttctggttatagaaggtgacagagg aatgtcacgg662
gaaaatggct ccggcaacaa agtaccggagactctttcgctgctcaagta atcaccatca722
tcaacggctg agctttcacc ataaacttactcacagcctgattcagaagc ttttacaaaa782
ttgtaaatta taaaaagctg cataataatctcaacctttttatcttcctc gcgccaatgt842
ggaaataaag gtaaaacaaa acgaagctcttttcttttatgcgaaagaat tgtaaaacta902
agataaagct accgatcttt gttgtaccttagtagacaaatatcagagtt cttgtgcttg962
aaaaaaaaaa aaaaaa 978
<210> 14
<211> 77
<212> PRT
<213> Arabidopsis thaliana
Page 14
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
<400> 14
Met Gly Arg Arg Lys Val Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Lys Gly Leu Ile Glu Lys Ala
20 25 30
Arg Gln Leu Ser Ile Leu Cys Glu Ser Ser Ile Ala Val Val Ala Val
35 40 45
Ser Gly Ser Gly Lys Leu Tyr Asp Ser Ala Ser Gly Asp Lys Ile Leu
50 55 60
Gln Lys Lys Phe Gly Ile Ile Phe His Thr Arg Ser Tyr
65 70 75
<210> 15
<211> 876
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (80) . . (436)
<223> 61842.7
<400> 15
cagaaaaaaa cggtggttag gatcaaatta gggcacaaac
60
gcaaacacat
tttgggtccc
cttatcggag aaagaagcc aga aag 112
atg aaa cga
gga gtc atc
aga gag
atc
Met Gly Arg Val Ly s
Arg Lys Glu Arg
Ile Ile
1 5 10
gagaacaaaagc agtcga caagtc actttctccaaa cgacgcaaa ggt 160
GluAsnLysSer SerArg GlnVal ThrPheSerLys ArgArgLys Gly
15 20 25
ctcatcgaaaaa getcga caactt tcaattctctgt gaatcttcc atc 208
LeuIleGluLys AlaArg GlnLeu SerIleLeuCys GluSerSer Ile
30 35 40
getgttgtcgcc gtctcc ggttcc ggaaaactctac gactctgcc tcc 256
AlaValValAla ValSer GlySer GlyLysLeuTyr AspSerAla Ser
45 50 55
ggtgacaacatg tcaaag atcatt gatcgttatgaa atacatcat get 304
GlyAspAsnMet SerLys IleIle AspArgTyrGlu IleHisHis Ala
60 65 70 75
gatgaacttaaa gcctta gatctt gcagaaaaaatt cggaattat ctt 352
AspGluLeuLys AlaLeu AspLeu AlaGluLysIle ArgAsnTyr Leu
80 85 90
ccacacaaggag ttacta gaaata gtccaaagattc tctaatatc tat 400
ProHisLysGlu LeuLeu GluIle ValGlnArgPhe SerAsnIle Tyr
95 100 105
Page 15
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt ,
gga gga get cga gtc agt tag agctaagaag 446
aca gac tgc aat . ~
tct
Gly Gly Ala Arg Val Ser
Thr Asp Cys Asn
Ser
110 115
acagaactaatgatggaggatatgaagtcacttcaagaaagggagaagttgctgatagaa 506
gagaaccagattctggctagccaggtggggaagaagacgtttctggttatagaaggtgac 566
,
agaggaatgtcacgggaaaatggctccggcaacaaagtaccggagactctttcgctgctc 626
aagtaatcaccatcatcaacggctgagctttcaccataaacttactcacagcctgattca 686
gaagcttttacaaaattgtaaattataaaaagctgeataataatctcaacctttttatct 746
tcctcgcgccaatgtggaaataaaggtaaaacaaaacgaagctcttttcttttatgcgaa 806
agaattgtaaaactaagataaagctaccgatctttgttgtaccttagtagacaaatatca 866
gagttcttgt 876
<210> 16
<211> 118
<212> PRT
<213> Arabidopsis thaliana
<400> 16
Met Gly Arg Arg Lys Val Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Lys Gly Leu Ile Glu Lys Ala
20 25 30
Arg Gln Leu Ser Ile Leu Cys Glu Ser Ser Ile Ala Val Val Ala Val
35 40 45 !
Ser Gly Ser Gly Lys Leu Tyr Asp Ser Ala Ser Gly Asp Asn Met Ser
50 55 60
Lys Ile Ile Asp Arg Tyr Glu Ile His His Ala Asp Glu Leu Lys Ala
65 70 75 80
Leu Asp Leu Ala Glu Lys Ile Arg Asn Tyr Leu Pro His Lys Glu Leu
85 90 95
Leu Glu Ile Val Gln Arg Phe Ser Asn Ile Tyr Gly Gly Thr Ala Arg
100 105 110
Asp Cys Ser Val Ser Asn
115
<210> 17
<211> 818
Page 16
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (51) . . (653)
<223> 61843
MBI-0021.txt
<400> 17
cagacatcac aatcaaatta gaaaacagcc atg 56
ggtcagaaga gga
attagtcgga
Met
Gly
1
agaagaaaagta gagatc aaacgaatt gagaacaaa agctctcga caa 104
ArgArgLysVal GluIle LysArgIle GluAsnLys SerSerArg Gln
5 10 15
gttactttctgt aaacga cgaaatggt ctcatggag aaagetcgt caa 152
ValThrPheCys LysArg ArgAsnGly LeuMetGlu LysAlaArg Gln
20 25 30
ctctcaattctt tgtgaa tcctccgtc getcttatc atcatctct gcc 200
LeuSerIleLeu CysGlu SerSerVal AlaLeuIle IleIleSer Ala
35 40 45 50
accggaagactc tacagc ttctcctca ggtgatagc atggccaag atc 248
ThrGlyArgLeu TyrSer PheSerSer GlyAspSer MetAlaLys Ile
55 60 65
ctcagtcgttat gaatta gaacagget gatgatctt aaaaccttg gat 296
LeuSerArgTyr GluLeu GluGlnAla AspAspLeu LysThrLeu Asp
70 75 80
ctagaagaaaaa actctt aattatctt tcgcacaag gagttgcta gaa 344
LeuGluGluLys ThrLeu AsnTyrLeu SerHisLys GluLeuLeu Glu
85 90 95
acaatccaatgc aagatt gaagaagcg aaaagcgat aatgtaagt ata 392
ThrIleGlnCys LysIle GluGluAla LysSerAsp AsnValSer Ile
100 105 110
gattgtctaaag tccctg gaagagcag ctcaagact getctgtct gta 440
AspCysLeuLys SerLeu GluGluGln LeuLysThr AlaLeuSer Val
115 120 125 130
actagagetagg aagaca gaactaatg atggagctt gtgaagacc cat 488
ThrArgAlaArg LysThr GluLeuMet MetGluLeu ValLysThr His
135 140 145
caagagaaggag aagctg ctgagagag gagaaccag agtttgact aac 536
GlnGluLysGlu LysLeu LeuArgGlu GluAsnGln SerLeuThr Asn
150 155 160
cagcttataaag atgggg aagatgaag aagtctgtg gaagcagag gat 584
GlnLeuIleLys MetGly LysMetLys LysSerVal GluAlaGlu Asp
165 170 175
gcaagagcaatg tcaccg gaaagtagc tctgacaac aagccaccg gag 632
AlaArgAlaMet SerPro GluSerSer SerAspAsn LysProPro Glu
180 185 190
actctcctgctt ctcaag taaccaccatcac 683
caacgactga
ttcgaaaaat
P age17
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Thr Leu Leu Leu Leu Lys
195 200
aaaaattgta aaaattatga tttgtagttc ataaggaaag ctacatactg tatgttaaaa 743
atcctcttct tccccctgct acggaaaagt catccaagga gatgcatcaa ataaagtaat 803
tgatttttat tgtta 818
<210> 18
<211> 200
<212> PRT
<213> Arabidopsis thaliana
<400> 18
Met Gly Arg Arg Lys Val Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Met Glu Lys Ala
20 25 30
Arg Gln Leu Ser Ile Leu Cys Glu Ser Ser Val Ala Leu Ile Ile Ile
35 40 45
Ser Ala Thr Gly Arg Leu Tyr Ser Phe Ser Ser Gly Asp Ser Met Ala
50 55 60
Lys Ile Leu Ser Arg Tyr Glu Leu Glu Gln Ala Asp Asp Leu Lys Thr
65 70 75 80
Leu Asp Leu Glu Glu Lys Thr Leu Asn Tyr Leu Ser His Lys Glu Leu
85 90 95
Leu Glu Thr Ile Gln Cys Lys Ile Glu Glu Ala Lys Ser Asp Asn Val
100 105 110
Ser Ile Asp Cys Leu Lys Ser Leu Glu Glu Gln Leu Lys Thr Ala Leu
115 120 125
Ser Val Thr Arg Ala Arg Lys Thr Glu Leu Met Met Glu Leu Val Lys
130 135 140
Thr His Gln Glu Lys Glu Lys Leu Leu Arg Glu Glu Asn Gln Ser Leu
145 150 155 160
Thr Asn Gln Leu Ile Lys Met Gly Lys Met Lys Lys Ser Val Glu Ala
165 170 175
Glu Asp Ala Arg Ala Met Ser Pro Glu Ser Ser Ser Asp Asn Lys Pro
180 185 190
Page 18
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Pro Glu Thr Leu Leu Leu Leu Lys
195 200
<210> 19
<211> 834
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (39)..(635)
<223> 61844
<400> 19
agaaatt agg ggattagatg tg 56
tgtcggaaga gga
gtgaagcc aga
a aga
aga
gta
Met
Gly
Arg
Arg
Arg
Val
1 5
gagatcaaa cgaatt gagaacaaa agcagtagacaa gtcact ttctgt 104
GluIleLys ArgIle GluAsnLys SerSerArgGln ValThr PheCys
10 15 20
aagagacga aatggt ctcatggag aaagetcgtcaa ctctca attctc 152
LysArgArg AsnGly LeuMetGlu LysAlaArgGln LeuSer IleLeu
25 30 35
tgtggatcc tccgtc getcttttc atcgtctcttcc accggc aaactc 200
CysGlySer SerVal AlaLeuPhe IleValSerSer ThrGly LysLeu
40 45 50
tacaactcc tcctcc ggcgacagc atggccaagatc atcagt cgtttt 248
TyrAsnSer SerSer GlyAspSer MetAlaLysIle IleSer ArgPhe
55 60 65 70
aaaatacaa caaget gatgatcct gaaaccttggat cttgaa gacaaa 296
LysIleGln GlnAla AspAspPro GluThrLeuAsp LeuGlu AspLys
75 80 85
actcaggat tatctt tcacacaag gagttactagaa atagtt caaaga 344
ThrGlnAsp TyrLeu SerHisLys GluLeuLeuGlu IleVal GlnArg
90 95 100
aagattgaa gaagca aaaggggat aatgtaagtata gaatct ctaatt 392
LysIleGlu GluAla LysGlyAsp AsnValSerIle GluSer LeuIle
105 110 115
tccatggaa gagcag ctcaagagt getctgtctgta attaga getagg 440
SerMetGlu GluGln LeuLysSer AlaLeuSerVal IleArg AlaArg
120 125 130
aagacagag ttattg atggagctt gtgaagaacctt caggat aaggag 488
LysThrGlu LeuLeu MetGluLeu ValLysAsnLeu GlnAsp LysGlu
135 140 145 150
aagttgctg aaagaa aagaacaag gttctagetagc gaggtg gggaag 536
LysLeuLeu LysGlu LysAsnLys ValLeuAlaSer GluVal GlyLys
155 160 165
ctgaagaaa attttg gaaacaggg gatgaaagagca gtaatg tcaccg 584
P age19
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Leu Lys Lys Ile Leu Glu Thr Gly Asp Glu Arg Ala Val Met Ser Pro
170 175 180
gaa aat agc tct ggc cac agc cca ccg gag act ctc ccg ctt ctc aag 632
Glu Asn Ser Ser Gly His Ser Pro Pro Glu Thr Leu Pro Leu Leu Lys
185 190 195
taa ccaccaatca tcaacggctg atttttcatc atcctgattc aaaaaaggta 685
aaaaaaattc atgtgtaaaa atcataaaga agctacatgt tttaaaatcc tcttctcccc 745
ctgcatacgg ataaatttat agaccaaaaa tataatgttt tccctcaaat aagatatcga 805
cctttgtgtt accttggaag acaggatca ' 834
<210> 20
<211> 198
<212> PRT
<213> Arabidopsis thaliana
<400> 20
Met Gly Arg Arg Arg Val Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Met Glu Lys Ala
20 25 30
Arg Gln Leu Ser Ile Leu Cys Gly Ser Ser Val Ala Leu Phe Ile Val
35 40 45
Ser Ser Thr Gly Lys Leu Tyr Asn Ser Ser Ser Gly Asp Ser Met Ala
50 55 60
Lys Ile Ile Ser Arg Phe Lys Ile Gln Gln Ala Asp Asp Pro Glu Thr
65 70 75 80
Leu Asp Leu Glu Asp Lys Thr Gln Asp Tyr Leu Ser His Lys Glu Leu
85 90 95
Leu Glu Ile Val Gln Arg Lys Ile Glu Glu Ala Lys Gly Asp Asn Val
100 105 110
Ser Ile Glu Ser Leu Ile Ser Met Glu Glu Gln Leu Lys Ser Ala Leu
115 120 125
Ser Val Ile Arg Ala Arg Lys Thr Glu Leu Leu Met Glu Leu Val Lys
130 135 140
Asn Leu Gln Asp Lys Glu Lys Leu Leu Lys Glu Lys Asn Lys Val Leu
145 150 155 160
Page 20
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Ala Ser Glu Val Gly Lys Leu Lys Lys Ile Leu Glu Thr Gly Asp Glu
165 170 175
Arg Ala Val Met Ser Pro Glu Asn Ser Ser Gly His Ser Pro Pro Glu
180 185 190
Thr Leu Pro Leu Leu Lys
195
<210> 21
<211> 753
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (1) . . (555)
<223> 61844.2
<400> 21
atgggaagaaga agagtagag atcaaacga attgagaac aaaagcagt 48
MetGlyArgArg ArgValGlu IleLysArg IleGluAsn LysSerSer
1 5 10 15
agacaagtcact ttctgtaag agacgaaat ggtctcatg gagaaaget 96
ArgGlnValThr PheCysLys ArgArgAsn GlyLeuMet GluLysAla
20 25 30
cgtcaactctca attctctgt ggatcctcc gtcgetctt ttcatcgtc 144
ArgGlnLeuSer IleLeuCys GlySerSer ValAlaLeu PheIleVal
35 40 45
tcttccaccggc aaactctac aactcctcc tccggcgac agcatggcc 192
SerSerThrGly LysLeuTyr AsnSerSer SerGlyAsp SerMetAla
50 55 60
aagatcatcagt cgttttaaa atacaacaa getgatgat cctgaaacc 240
LysIleIleSer ArgPheLys IleGlnGln AlaAspAsp ProGluThr
65 70 75 80
ttggatcttgaa gacaaaact caggattat ctttcacac aaggagtta 288
LeuAspLeuGlu AspLysThr GlnAspTyr LeuSerHis LysGluLeu
85 90 95
ctagaaatagtt caaagaaag attgaagaa gcaaaaggg gataatgta 336
LeuGluIleVal GlnArgLys IleGluGlu AlaLysGly AspAsnVal
100 105 110
agtatagaatct ctaatttcc atggaagag cagctcaag agtgetctg 384
SerIleGluSer LeuIleSer MetGluGlu GlnLeuLys SerAlaLeu
115 120 125
tctgtaattaga getaggaag acagagtta ttgatggag cttgtgaag 432
SerValIleArg AlaArgLys ThrGluLeu LeuMetGlu LeuValLys
130 135 140
aaccttcaggat aaggtgggg aagctgaag aaaattttg gaaacaggg 480
AsnLeuGlnAsp LysValGly LysLeuLys LysIleLeu GluThrGly
145 150 155 160
P age21
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
gat gaa aga gca gta atg tca ccg gaa aat agc tct ggc cac agc cca 528
Asp Glu Arg Ala Val Met Ser Pro Glu Asn Ser Ser Gly His Sex Pro
165 170 175
ccg gag act ctc ccg ctt ctc aag taa ccaccaatca tcaacggctg 575
Pro Glu Thr Leu Pro Leu Leu Lys
180
atttttcatcatcctgattcaaaaaaggtaaaaaaaattcatgtgtaaaaatcataaaga 635
agctacatgttttaaaatcctcttctccccctgcatacggataaatttatagaccaaaaa 695
tataatgttttccctcaaataagatatcgacctttgtgttaccttggaagacaggatc 753
<210> 22
<211> 184
<212> PRT
<213> Arabidopsis thaliana
<400> 22
Met Gly Arg Arg Arg Val Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Cys Lys Arg Arg Asn Gly Leu Met Glu Lys Ala
20 25 30
Arg Gln Leu Ser Ile Leu Cys Gly Ser Ser Val Ala Leu Phe Ile Val
35 40 45
Ser Ser Thr Gly Lys Leu Tyr~Asn Ser Ser Ser Gly Asp Ser Met Ala
50 55 60
Lys Ile Ile Ser Arg Phe Lys Ile Gln Gln Ala Asp Asp Pro Glu Thr
65 70 75 80
Leu Asp Leu Glu Asp Lys Thr Gln Asp Tyr Leu Ser His Lys Glu Leu
85 90 95
Leu Glu Ile Val Gln Arg Lys Ile Glu Glu Ala Lys Gly Asp Asn Val
100 105 110
Ser Ile Glu Ser Leu Ile Ser Met Glu Glu Gln Leu Lys Ser Ala Leu
115 120 125
Ser Val Ile Arg Ala Arg Lys Thr Glu Leu Leu Met Glu Leu Val Lys
130 135 140
Asn Leu Gln Asp Lys Val Gly Lys Leu Lys Lys Ile Leu Glu Thr Gly
145 150 155 160
Page 22
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Asp Glu Arg Ala Val Met Ser Pro Glu Asn Ser Ser Gly His Ser Pro
165 170 175
Pro Glu Thr Leu Pro Leu Leu Lys
180
<210> 23
<211> 1134
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (158)..(880)
<223> 6861
<400> 23
cttcttc ctcctcctccatc taatcatctc tcattcttga
60
tcttctcttt
actctctctt
atcttga tccatcaaaatca attaaaatca aaacctaagc
120
atcccgttct
cgaaagatcc
tctctct cttgcttctaggg 175
tttttttgtt
cgttgtg
atg
gcg
aga
gaa
aag
att
Met
Ala
Arg
Glu
Lys
Ile
1 5
cagatcaggaag atcgac aacgca acggcgagacaa gtgacgttt tcg 223
GlnIleArgLys IleAsp AsnAla ThrAlaArgGln ValThrPhe Ser
10 15 20
aaacgaagaaga gggctt ttcaag aaagetgaagaa ctctccgtt ctc 271
LysArgArgArg GlyLeu PheLys LysAlaGluGlu LeuSerVal Leu
25 30 35
tgcgacgccgat gtcget ctcatc atcttctcttcc accggaaaa ctg 319
CysAspAlaAsp ValAla LeuIle IlePheSerSer ThrGlyLys Leu
40 45 50
ttcgagttctgt agctcc agcatg aaggaagtccta gagaggcat aac 367
PheGluPheCys SerSer SerMet LysGluValLeu GluArgHis Asn
55 60 65 70
ttgcagtcaaag aacttg gagaag cttgatcagcca tctcttgag tta 415
LeuGlnSerLys AsnLeu GluLys LeuAspGlnPro SerLeuGlu Leu
75 80 85
cagctggttgag aacagt gatcac gcccgaatgagt aaagaaatt gcg 463
GlnLeuValGlu AsnSer AspHis AlaArgMetSer LysGluIle Ala
90 95 100
gacaagagccac cgacta aggcaa atgagaggagag gaacttcaa gga 511
AspLysSerHis ArgLeu ArgGln MetArgGlyGlu GluLeuGln Gly
105 110 115
cttgacattgaa gagctt cagcag ctagagaaggcc cttgaaact ggt 559
LeuAspIleGlu GluLeu GlnGln LeuGluLysAla LeuGluThr Gly
120 125 130
ttgacgcgtgtg attgaa acaaag agtgacaagatt atgagtgag atc 607
LeuThrArgVal IleGlu ThrLys SerAspLysIle MetSerGlu Ile
135 140 145 150
P age23
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
agc gaa cag aaaaaggga atgcaattgatg gat gag aag cgg 655
ctt aac
Ser Glu Gln LysLysGly MetGlnLeuMet Asp Glu Lys Arg
Leu Asn
155 160 165
ttg agg caa ggaacgcaa ctaacggaagag aac gag ctt ggc 703
cag cga
Leu Arg Gln GlyThrGln LeuThrGluGlu Asn Glu Leu Gly
Gln Arg
170 175 180
atg caa tgt aacaatgtg catgcacacggt ggt get tcg gag 751
ata gaa
Met Gln Cys AsnAsnVal HisAlaHisGly Gly Ala Ser Glu
Ile Glu
185 190 195
aac get gtg tacgaggaa ggacagtcgtcg gag tct act aac 799
get att
Asn Ala Val TyrGluGlu GlyGlnSerSer Glu Ser Thr Asn
Ala Ile
200 205 210
gcc gga tct accggagcg cctgttgactcc gag agc gac act 847
aac tcc
Ala Gly Ser ThrGlyAla ProValAspSer Glu Ser Asp Thr
Asn Ser
215 220 225 230
tcc ctt ctc ggcttaccg tatggtggttag agatggaacaattcaaagaa 900
agg
Ser Leu Leu GlyLeuPro TyrGlyGly
Arg
235 240
gttgatggagtgaggagagt tttttaactc ggtagtaacaagagacaatg
960
aatgtaaatc
tctaagtagt aagtttctgc ctatggaagaggctttcatt 1020
gaattctcaa
atgtttgtgt
tttatgattt tcactgcatt tctggttagtaacggcttgt 1080
tcactatgta
tgatctctct
caccgataaa agaataaaaa aaaaaaaaaaaaaa 1134
ctttctcgtt
atggaaagtt
<210>
24
<211>
240
<212>
PRT
<213>
Arabidopsis
thaliana
<400> 24
Met Ala Arg Glu Lys Ile Gln Ile Arg Lys Ile Asp Asn Ala Thr Ala
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Arg Gly Leu Phe Lys Lys Ala
20 25 30
Glu Glu Leu Ser Val Leu Cys Asp Ala Asp Val Ala Leu Ile Ile Phe
35 40 45
Ser Ser Thr Gly Lys Leu Phe Glu Phe Cys Ser Ser Ser Met Lys-Glu
50 55 60
Val Leu Glu Arg His Asn Leu Gln Ser Lys Asn Leu Glu Lys Leu Asp
65 70 75 80
Gln Pro Ser Leu Glu Leu Gln Leu Val Glu Asn Ser Asp His Ala Arg
85 90 95
Page 24
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Met Ser Lys Glu Ile Ala Asp Lys Ser His Arg Leu Arg Gln Met Arg
100 105 110
Gly Glu Glu Leu Gln Gly Leu Asp Ile Glu Glu Leu Gln Gln Leu Glu
115 120 125
Lys Ala Leu Glu Thr Gly Leu Thr Arg Val Ile Glu Thr Lys Ser Asp
130 135 140
Lys Ile Met Ser Glu Ile Ser Glu Leu Gln Lys Lys Gly Met Gln Leu
145 150 155 160
Met Asp Glu Asn Lys Arg Leu Arg Gln Gln Gly Thr Gln Leu Thr Glu
165 170 175
Glu Asn Glu Arg Leu Gly Met Gln Ile Cys Asn Asn Val His Ala His
180 185 190
Gly Gly Ala Glu Ser Glu Asn Ala Ala Val Tyr Glu Glu Gly Gln Ser
195 200 205
Ser Glu Ser Ile Thr Asn Ala Gly Asn Ser Thr Gly Ala Pro Val Asp
210 215 220
Ser Glu Ser Ser Asp Thr Ser Leu Arg Leu Gly Leu Pro Tyr Gly Gly
225 230 235 240
<210> 25
<211> 1552
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (193)..(825)
<223> 6861.1
<400>
25
attctctctctcncaaaatttatttcctctggcttcttcttcctcctcct ccatctcttc60
tctttactctctctttaatcatctctcattcttgaatcttgatccatcaa aatcaatccc120
gttctcgaaagatccattaaaatcaaaacctaagctctctctcttgcttc tagggttttt180
ttgttcgttgtg atg aga gaa g att cag 231
gcg aa atc agg
aag atc
gac aac
Met Ala Arg Glu s Ile Gln
Ly Ile Arg
Lys Ile
Asp Asn
1 5 10
gca acg aga caa tcg aaa aga aga ggg ctt ttc 279
gcg gtg acg cga
ttt
Ala Thr Arg Gln Ser Lys Arg Arg Gly Leu Phe
Ala Val Thr Arg
Phe
15 20 25
Page 25
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
aagaaa getgaagaa ctctccgtt ctctgcgac gccgatgtc getctc 327
LysLys AlaGluGlu LeuSerVal LeuCysAsp AlaAspVal AlaLeu
30 35 40 45
atcatc ttctcttcc accggaaaa ctgttcgag ttctgtagc tccagc 375
IleIle PheSerSer ThrGlyLys LeuPheGlu PheCysSer SerSer
50 55 60
atgaag gaagtccta gagaggcat aacttgcag tcaaagaac ttg.gag 423
MetLys GluValLeu GluArgHis AsnLeuGln SerLysAsn LeuGlu
65 70 75
aagctt gatcagcca tctcttgag ttacagctg gttgagaac agtgat 471
LysLeu AspGlnPro SerLeuGlu LeuGlnLeu ValGluAsn SerAsp
80 85 90
cacgcc cgaatgagt aaagaaatt gcggacaag agccaccga ctaagg 519
HisAla ArgMetSer LysGluIle AlaAspLys SerHisArg LeuArg
95 100 105
caaatg agaggagag gaacttcaa ggacttgac attgaagag cttcag 567
GlnMet ArgGlyGlu GluLeuGln GlyLeuAsp IleGluGlu LeuGln
110 115 120 125
cagcta gagaaggcc cttgaaact ggtttgacg cgtgtgatt gaaaca 615
GlnLeu GluLysAla LeuGluThr GlyLeuThr ArgValIle GluThr
130 135 140
aagagt gacaagatt atgagtgag atcagcgaa cttcagaaa aaggga 663
LysSer AspLysIle MetSerGlu IleSerGlu LeuGlnLys LysGly
145 150 155
atgcaa ttgatggat gagaacaag cggttgagg cagcaagta tgtgtc 711
MetGln LeuMetAsp GluAsnLys ArgLeuArg GlnGlnVal CysVal
160 165 170
ttaccc tctctgttg ataacaaat ccctttctt ttgtctacc attaac 759
LeuPro SerLeuLeu IleThrAsn ProPheLeu LeuSerThr IleAsn
175 180 185
gtacac actcctaaa tttaatccc cagttgtct acaacacat atgttt 807
ValHis ThrProLys PheAsnPro GlnLeuSer ThrThrHis MetPhe
190 195 200 205
gatcat actgtgaga taaatgaataaac 855
caagtgatat
agcgcgattt
AspHis ThrValArg
210
aaaaatgtct ttaaaactaa aggtaaccat. gtagctagtt agtctctagg gtcctagagg 915
tctacgagtg tgcatgcatg gatttggtgc gttttttctt tttcatcttc attttgtttt 975
ttgaaacaag gaaccataaa cgaatatata tctaattctt gtttgatata tagtttggtc 1035
gaggcttcat gtcaagattt gctcattcgt agttagttga tctctagaga aattcaaaac 1095
acatggtgcc actaaaaaca caaaatgcaa atacttagct agagaactta atgatatgtt 1155
ttgtcttgat ttttgcaggg aacgcaacta acggaagaga acgagcgact tggcatgcaa 1215
atatgtaaca atgtgcatgc acacggtggt gctgaatcgg agaacgctgc tgtgtacgag 1275
Page 26
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
gaaggacagtcgtcggagtctattactaacgccggaaactctaccggagcgcctgttgac1335
tccgagagctccgacacttcccttaggctcggcttaccgtatggtggttagagatggaac1395
aattcaaagaagttgatggagtgaggagagtaatgtaaatctttttaactcggtagtaac1455
aagagacaatgtctaagtagtgaattctcaaatgtttgtgtaagtttctgcctatggaag1515
aggctttcatttttatgattaaaaaaaaaaaaaaaaa 1552
<210> 26
<211> 210
<212> PRT
<213> Arabidopsis thaliana
<400> 26
Met Ala Arg Glu Lys Ile Gln Ile Arg Lys Ile Asp Asn Ala Thr Ala
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Arg Gly Leu Phe Lys Lys Ala
20 25 30
Glu Glu Leu Ser Val Leu Cys Asp Ala Asp Val Ala Leu Ile Ile Phe
35 40 45
Ser Ser Thr Gly Lys Leu Phe Glu Phe Cys Ser Ser Ser Met Lys Glu
50 55 60
Val Leu Glu Arg His Asn Leu Gln Ser Lys Asn Leu Glu Lys Leu Asp
65 70 75 80
Gln Pro Ser Leu Glu Leu Gln Leu Val Glu Asn Ser Asp His Ala Arg
85 90 95
Met Ser Lys Glu Ile Ala Asp Lys Ser His Arg Leu Arg Gln Met Arg
100 105 110
Gly Glu Glu Leu Gln Gly Leu Asp Ile Glu Glu Leu Gln Gln Leu Glu
115 120 125
Lys Ala Leu Glu Thr Gly Leu Thr Arg Val Ile Glu Thr Lys Ser Asp
130 135 140
Lys Ile Met Ser Glu Ile Ser Glu Leu Gln Lys Lys Gly Met Gln Leu
145 150 155 160
Met Asp Glu Asn Lys Arg Leu Arg Gln Gln Val Cys Val Leu Pro Ser
165 170 175
Leu Leu Ile Thr Asn Pro Phe Leu Leu Ser Thr Ile Asn Val His Thr
Page 27
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
180 185 190
Pro Lys Phe Asn Pro Gln Leu Ser Thr Thr His Met Phe Asp His Thr
195 200 205
Val Arg
210
<210> 27
<211> 943
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (110)..(700)
<223> 61759
<400> 27
cgagaaaagg aaaaaaaaaa gtatctccgg cgacttgaac
60
atagaaagag
aaaacgctta
ccaaacctga ggatcaaatt agagaagcc 118
agggcacaaa atg
gccctctcgg gga
aga
Met
Gly
Arg
1
aaaaaactagaa atcaagcga attgagaac aaaagtagc cgacaagtc 166
LysLysLeuGlu IleLysArg IleGluAsn LysSerSer ArgGlnVal
10 15
accttctccaaa cgtcgcaac ggtctcatc gagaaaget cgtcagctt 214
ThrPheSerLys ArgArgAsn GlyLeuIle GluLysAla ArgGlnLeu
20 25 30 35
tctgttctctgt gacgcatcc gtcgetctt ctcgtcgtc tccgcctcc 262
SerValLeuCys AspAlaSer ValAlaLeu LeuValVal SerAlaSer
40 45 50
ggcaagctctac agcttctcc tccggcgat aacctggtc aagatcctt 310
GlyLysLeuTyr SerPheSer SerGlyAsp AsnLeuVal LysIleLeu
55 60 65
gatcgatatggg aaacagcat getgatgat cttaaagcc ttggatcat 358
AspArgTyrGly LysGlnHis AlaAspAsp LeuLysAla LeuAspHis
70 75 80
cagtcaaaaget ctgaactat ggttcacac tatgagcta cttgaactt 406
GlnSerLysAla LeuAsnTyr GlySerHis TyrGluLeu LeuGluLeu
85 90 95
gtggatagcaag cttgtggga tcaaatgtc aaaaatgtg agtatcgat 454
ValAspSerLys LeuValGly SerAsnVal LysAsnVal SerIleAsp
100 105 110 115
getcttgttcaa ctggaggaa caccttgag actgccctc tccgtgact 502
AlaLeuValGln LeuGluGlu HisLeuGlu ThrAlaLeu SerValThr
120 125 130
agagccaagaag accgaactc atgttgaag cttgttgag aatcttaaa 550
ArgAlaLysLys ThrGluLeu MetLeuLys LeuValGlu AsnLeuLys
P age28
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
135 140 145
gaaaag gagaaaatgctg aaagaa gagaac caggtt.ttgget agccag 598
GluLys GluLysMetLeu LysGlu GluAsn GlnValLeuAla SerGln
150 155 160
atggag aataatcatcat gtggga gcagaa getgagatggag atgtca 646
MetGlu AsnAsnHisHis ValGly AlaGlu AlaGluMetGlu MetSer
165 170 175
cctget ggacaaatctcc gacaat cttccg gtgactctccca ctactt 694
ProAla GlyGlnIleSer AspAsn LeuPro ValThrLeuPro LeuLeu
180 185 190 195
aattag ccaccttaaa tcggcggttg ccaaaac atatataattatg
750
aaatcaaaat
Asn
aagaaaaaaa aaataagata tgtaattatt ccgctgataa gggcgagcgt ttgtatatct 810
taatactctc tctttggcca agagactttg tgtgtgatac ttaagtagac ggaactaagt 870
caatactatc tgttttaaga caaaaggttg.atgaactttg taccttattc gtgtgagaaa 930
aaaaaaaaaa aaa 943
<210> 28
<211> 196
<212> PRT
<213> Arabidopsis thaliana
<400> 28
Met Gly Arg Lys Lys Leu Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser
1 5 10 15
Arg Gln Val Thr Phe Ser Lys Arg Arg Asn Gly Leu Ile Glu Lys Ala
20 25 30
Arg Gln Leu Ser Val Leu Cys Asp Ala Ser Val Ala Leu Leu Val Val
35 40 45
Ser Ala Ser Gly Lys Leu Tyr Ser Phe Ser Ser Gly Asp Asn Leu Val
50 55 60
Lys Ile Leu Asp Arg Tyr Gly Lys Gln His Ala Asp Asp Leu Lys Ala
65 70 75 80
Leu Asp His Gln Ser Lys Ala Leu Asn Tyr Gly Ser His Tyr Glu Leu
85 90 95
Leu Glu Leu Val Asp Ser Lys Leu Val Gly Ser Asn Val Lys Asn Val
100 105 110
Ser Ile Asp Ala Leu Val Gln Leu Glu Glu His Leu Glu Thr Ala Leu
Page 29
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
115 120 125
Ser Val Thr Arg Ala Lys Lys Thr Glu Leu Met Leu Lys Leu Val Glu
130 135 140
Asn Leu Lys Glu Lys Glu Lys Met Leu Lys Glu Glu Asn Gln Val Leu
145 150 155 160
Ala Ser Gln Met Glu Asn Asn His His Val Gly Ala Glu Ala Glu Met
165 170 175
Glu Met Ser Pro Ala Gly Gln Ile Ser Asp Asn Leu Pro Val Thr Leu
180 185 190
Pro Leu Leu Asn
195
<210> 29
<211> 1171
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (63) . . (959)
<223> 6192
<400> 29
cttttttctcttctctcctc gagattcga ctttttgtctcccct gag taaccaaatt 60
a ag
caatg gccgacgat tgggatctc cacgccgta gtcagaggc tgctca 107
Met Ala Asp TrpAspLeu HisAla Val Gly CysSer
Asp Val Arg
1 5 10 15
gccgta agctcatca getactacc accgtatat tcccccggc gtttca 155
AlaVal SerSerSer AlaThrThr ThrValTyr SerProGly ValSer
20 25 30
tctcac acaaaccct atattcacc gtcggacga caaagtaat gccgtc 203
SerHis ThrAsnPro IlePheThr ValGlyArg GlnSerAsn AlaVal
35 40 45
tccttc ggagagatt cgagatctc tacacaccg ttcacacaa gaatct 251
SerPhe GlyGluIle ArgAspLeu TyrThrPro PheThrGln GluSer
50 55 60
gtcgtc tcttcgttt tcttgtata aactaccca gaagaacct agaaag 299
ValVal SerSerPhe SerCysIle AsnTyrPro GluGluPro ArgLys
65 70 75
ccacag aaccagaaa cgtcctctt tctctctct gettcttcc ggtagc 347
ProGln AsnGlnLys ArgProLeu SerLeuSer AlaSerSer GlySer
80 85 90 95
gtcact agcaaaccc agtggctcc aatacctct agatctaaa agaaga 395
ValThr SerLysPro SerGlySer AsnThrSer ArgSerLys ArgArg
Page 30
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
100 105 110
aagata cagcataag aaagtgtgc catgtagca gcagaagettta aac 443
LysIle GlnHisLys LysValCys HisValAla AlaGluAlaLeu Asn
115 120 125
tccgat gtctgggca tggcgaaag tacggacag aaacccatcaaa ggt 491
SerAsp ValTrpAla TrpArgLys TyrGlyGln LysProIleLys Gly
130 135 140'
tcacca tatccaaga ggatactac agatgtagt acatcaaaaggt tgt 539
SerPro TyrProArg GlyTyrTyr ArgCysSer ThrSerLysGly Cys
145 150 155
ttagcc cgtaaacaa gtggagcga aatagatcc gacccgaagatg ttt 587
LeuAla ArgLysGln ValGluArg AsnArgSer AspProLysMet Phe
160 165 170 175
atcgtc acttacacg gcggagcat aatcatcca getccgacacac cgt 635
IleVal ThrTyrThr AlaGluHis AsnHisPro AlaProThrHis Arg
180 185 190
aattct ctcgccgga agcacacgt cagaaacca tccgatcaacag acg 683
AsnSer LeuAlaGly SerThrArg GlnLysPro SerAspGlnGln Thr
195 200 205
agtaaa tctccgacg accactatt getacttat tcatcgtctccg gtg 731
SerLys SerProThr ThrThrIle AlaThrTyr SerSerSerPro Val
210 215 220
acttca gccgacgaa tttgttttg cctgttgag gatcatctagcg gtg 779
ThrSer AlaAspGlu PheValLeu ProValGlu AspHisLeuAla Val
225 230 235
ggagat cttgacgga gaagaagat ctgttatct ttgtcggatacg gtg 827
GlyAsp LeuAspGly GluGluAsp LeuLeuSer LeuSerAspThr Val
240 245 250 255
gttagc gatgatttc ttcgatggg ttagaggaa ttcgcagccgga gat 875
ValSer AspAspPhe PheAspGly LeuGluGlu PheAlaAlaGly Asp
260 265 270
agcttt tccgggaac tcggetccg gcgagtttt gatctctcttgg gtt 923
SerPhe SerGlyAsn SerAlaPro AlaSerPhe AspLeuSerTrp Val
275 280 285
gtgaac agtgccgcc actaccacc ggaggaata tgattagattacg 969
ValAsn SerAlaAla ThrThrThr GlyGlyIle
290 295
acggcttaga ttataggatt aaggaattat tctcggagca
1029
atactcttat
taggacagat
tatgtaaaaa tttgttactt tttttcgggt tttcttccta
1089
taggataaaa
gaaaatgttc
ttgtttctaa aaatttaa ttgtatattc cttaagctcg
atacatcttg 1149
acatcttaga
aa
ttttaaaaaa 1171
aaaaaaaaaa
as
<210> 30
<211>
298
<212>
PRT
<213> ana
Arabidopsis
thali
Page 31
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
<400> 30
Met Ala Asp Asp Trp Asp Leu His Ala Val Val Arg Gly Cys Ser Ala
1 5 10 15
Val Ser Ser Ser Ala Thr Thr Thr Val Tyr Ser Pro Gly Val Ser Ser
20 25 30
His Thr Asn Pro Ile Phe Thr Val Gly Arg Gln Ser Asn Ala Val Ser
35 40 45
Phe Gly Glu Ile Arg Asp Leu Tyr Thr Pro Phe Thr Gln Glu Ser Val
50 55 60
Val Ser Ser Phe Ser Cys Ile Asn Tyr Pro Glu Glu Pro Arg Lys Pro
65 70 75 80
Gln Asn Gln Lys Arg Pro Leu Ser Leu Ser Ala Ser Ser Gly Ser Val
85 90 95
Thr Ser Lys Pro Ser Gly Ser Asn Thr Ser Arg Ser Lys Arg Arg Lys
100 105 110
Ile Gln His Lys Lys Val Cys His Val Ala Ala Glu Ala Leu Asn Ser
115 120 125
Asp Val Trp Ala Trp Arg Lys Tyr Gly Gln Lys Pro Ile Lys Gly Ser
130 135 140
Pro Tyr Pro Arg Gly Tyr Tyr Arg Cys Ser Thr Ser Lys Gly Cys Leu
145 150 155 160
Ala Arg Lys Gln Val Glu Arg Asn Arg Ser Asp Pro Lys Met Phe Ile
165 170 175
Val Thr Tyr Thr Ala Glu His Asn His Pro Ala Pro Thr His Arg Asn
180 185 190
Ser Leu Ala Gly Ser Thr Arg Gln Lys Pro Ser Asp Gln Gln Thr Ser
195 200 205
Lys Ser Pro Thr Thr Thr Ile Ala Thr Tyr Ser Ser Ser Pro Val Thr
210 215 220
Ser Ala Asp Glu Phe Val Leu Pro Val Glu Asp His Leu Ala Val Gly
225 230 235 240
Page 32
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Asp Leu Asp Gly Glu Glu Asp Leu Leu Ser Leu Ser Asp Thr Val Val
245 250 255
Ser Asp Asp Phe Phe Asp Gly Leu Glu Glu Phe Ala Ala Gly Asp Ser
260 265 270
Phe Ser Gly Asn Ser Ala Pro Ala Ser Phe Asp Leu Ser Trp Val Val
275 280 285
Asn Ser Ala Ala Thr Thr Thr Gly Gly Ile
290 295
<210> 31
<211> 1139
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (106)..(1032)
<223> 6234
<400> 31
cacaaca tca tacccaccaa gagagataaa cagaggccgc
60
catatataat
cttgatcata
tatcaag aac aagactaaga caagt 117
acaagacttc atg
actaggagta gga
aga
gca
Met 1y
G Arg
Ala
1
ccgtgttgt gacaaagca aacgtgaag aaagggcct tggtctcct gag 165
ProCysCys AspLysAla AsnValLys LysGlyPro TrpSerPro Glu
10 15 20
gaagatgca aaactcaaa tcttacatt gaaaatagt ggcaccgga ggc 213
GluAspAla LysLeuLys SerTyrIle GluAsnSer GlyThrGly Gly
25 30 35
aattggatc getttgcct caaaagatt ggtttaaag agatgtgga aag 261
AsnTrpIle AlaLeuPro GlnLysIle GlyLeuLys ArgCysGly Lys
40 45 50
agttgcagg ctgaggtgg cttaactat cttagacca aacatcaaa cat 309
SerCysArg LeuArgTrp LeuAsnTyr LeuArgPro AsnIleLys His
55 60 65
ggtggcttc tctgaggaa gaagaaaac atcatttgt agcctttac ctt 357
GlyGlyPhe SerGluGlu GluGluAsn IleIleCys SerLeuTyr Leu
70 75 80
acaattggt agcaggtgg tctataatc getgetcaa ttgccggga cga 405
ThrIleGly SerArgTrp SerIleIle AlaAlaGln LeuProGly Arg
85 90 95 100
acagacaac gatataaaa aactattgg aacacgagg ctcaagaag aaa 453
ThrAspAsn AspIleLys AsnTyrTrp AsnThrArg LeuLysLys Lys
105 110 115
ctcattaac aaacaacgc aaggagctt caagaaget tgtatggag cag 501
P age33
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
LeuIleAsnLys GlnArg LysGluLeu GlnGluAlaCys MetGlu Gln
120 125 130
caagagatgatg gtgatg atgaagaga caacaccaacaa caacaa atc 549
GlnGluMetMet ValMet MetLysArg GlnHisGlnGln GlnGln Ile
135 140 145
caaacttctttt atgatg agacaagac caaacaatgttc acatgg cca 597
GlnThrSerPhe MetMet ArgGlnAsp GlnThrMetPhe ThrTrp Pro
150 155 160
ctacatcatcat aatgtt caagttcca getcttttcaga atcaaa cca 645
LeuHisHisHis AsnVal GlnValPro AlaLeuPheArg IleLys Pro
165 170 175 180
actcgttttgcg accaag aagatgtta agccagtgctca tcaaga aca 693
ThrArgPheAla ThrLys LysMetLeu SerGlnCysSer SerArg Thr
185 190 195
tggtcaagatcg aagatc aagaactgg agaaaacaaacc tcatca tca 741
TrpSerArgSer LysIle LysAsnTrp ArgLysGlnThr SerSer Ser
200 205 210
tcaagattcaat gacaac gettttgat catctctctttc tctcaa ctc 789
SerArgPheAsn AspAsn AlaPheAsp HisLeuSerPhe SerGln Leu
215 220 225
ttgttagatcct aatcat aaccactta ggatcaggagag ggtttc tcc 837
LeuLeuAspPro AsnHis AsnHisLeu GlySerGlyGlu GlyPhe Ser
230 235 240
atgaactctatc ttgagc gccaacaca aactctccattg cttaac aca 885
MetAsnSerIle LeuSer AlaAsnThr AsnSerProLeu LeuAsn Thr
245 250 255 260
agtaatgataat cagtgg ttcgggaat ttccaggccgaa accgta aac 933
SerAsnAspAsn GlnTrp PheGlyAsn PheGlnAlaGlu ThrVal Asn
265 270 275
ttgttctcagga gcctcc acaagtact tcggcagatcaa agcact ata 981
LeuPheSerGly AlaSer ThrSerThr SerAlaAspGln SerThr Ile
280 285 290
agttgggaagac ataagc tctcttgtt tattctgattca aagcaa ttt 1029
SerTrpGluAsp IleSer SerLeuVal TyrSerAspSer LysGln Phe
295 300 305
ttttaattataat gatgaaacgtacat cattattatt
1082
aatatattat
tcttaa
Phe
aattgggggt acgtaacgta aac gatctag tttgtttaaa
1139
tatatggaat tttaaaa
<210>
32
<211>
309
<212>
PRT
<213>
Arabidopsis
thaliana
<400> 32
Met Gly Arg Ala Pro Cys Cys Asp Lys Ala Asn Val Lys Lys Gly Pro
1 5 10 15
Page 34
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Trp Ser Pro Glu Glu Asp Ala Lys Leu Lys Ser Tyr Ile Glu Asn Ser
20 25 30
Gly Thr Gly Gly Asn Trp Ile Ala Leu Pro Gln Lys Ile Gly Leu Lys
35 40 45
Arg Cys Gly Lys Ser Cys Arg Leu Arg Trp Leu Asn Tyr Leu Arg Pro
50 55 60
Asn Ile Lys His Gly Gly Phe Ser Glu Glu Glu Glu Asn Ile Ile Cys
65 70 75 80
Ser Leu Tyr Leu Thr Ile Gly Ser Arg Trp Ser Ile Ile Ala Ala Gln
85 90 95
Leu Pro Gly Arg Thr Asp Asn Asp Ile Lys Asn Tyr Trp Asn Thr Arg
100 105 110
Leu Lys Lys Lys Leu Ile Asn Lys Gln Arg Lys Glu Leu Gln Glu Ala
115 120 125
Cys Met Glu Gln Gln Glu Met Met Val Met Met Lys Arg Gln His Gln
130 135 140
Gln Gln Gln Ile Gln Thr Ser Phe Met Met Arg Gln Asp Gln Thr Met
145 150 155 160
Phe Thr Trp Pro Leu His His His Asn Val Gln Val Pro Ala Leu Phe
165 170 175
Arg Ile Lys Pro Thr Arg Phe Ala Thr Lys Lys Met Leu Ser Gln Cys
180 185 190
Ser Ser Arg Thr Trp Ser Arg Ser Lys Ile Lys Asn Trp Arg Lys Gln
195 200 205
Thr Ser Ser Ser Ser Arg Phe Asn Asp Asn Ala Phe Asp His Leu Ser
210 215 220
Phe Ser Gln Leu Leu Leu Asp Pro Asn His Asn His Leu Gly Ser Gly
225 230 235 240
Glu Gly Phe Ser Met Asn Ser Ile Leu Ser Ala Asn Thr Asn Ser Pro
245 250 255
Leu Leu Asn Thr Ser Asn Asp Asn Gln Trp Phe Gly Asn Phe Gln Ala
Page 35
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
260 265 270
Glu Thr Val Asn Leu Phe Ser Gly Ala Ser Thr Ser Thr Ser Ala Asp
275 280 285
Gln Ser Thr Ile Ser Trp Glu Asp Ile Ser Ser Leu Val Tyr Ser Asp
290 295 300
Ser Lys Gln Phe Phe
305
<210> 33
<211> 922
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (54) . . (647)
<223> 6361
<400> 33
tctgtctctc tctctctctt catatataga taagctcaca tat
atg 56
tgtaaatata
Met
1
gcgact gaaacatct tctttgaag ctcttcggt ataaacctactt gaa 104
AlaThr GluThrSer SerLeuLys LeuPheGly IleAsnLeuLeu Glu
5 10 15
acgacg tcggttcaa aaccagtca tcggaacca agacccggatcc gga 152
ThrThr SerValGln AsnGlnSer SerGluPro ArgProGlySer Gly
20 25 30
tcagga tccgagtca cgtaagtac gagtgtcaa tactgttgtaga gag 200
SerGly SerGluSer ArgLysTyr GluCysGln TyrCysCysArg Glu
35 40 45
tttget aactctcaa getcttggt ggtcaccaa aacgetcacaag aaa 248
PheAla AsnSerGln AlaLeuGly GlyHisGln AsnAlaHisLys Lys
50 55 60 65
gagcgt.cagcttctt aaacgtgca cagatgtta getactcgtggt ttg 296
GluArg GlnLeuLeu LysArgAla GlnMetLeu AlaThrArgGly Leu
70 75 80
ccacgt catcataat tttcaccct cataccaat ccgcttctctcc gcc 344
ProArg HisHisAsn PheHisPro HisThrAsn ProLeuLeuSer Ala
85 90 95
ttcgcg ccgctgcct cacctcctc tctcagccg catcctccgccg cat 392
PheAla ProLeuPro HisLeuLeu SerGlnPro HisProProPro His
100 105 110
atgatg ctctctcct tcttcttcg agttctaag tggctttacggt gaa 440
MetMet LeuSerPro SerSerSer SerSerLys TrpLeuTyrGly Glu
115 120 125
Page 36
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
cac atg tca caa aac gcc ggg tac cat ggt agg gga 488
tcg gtt ttt gga
His Met Ser Gln Asn Ala Gly Tyr His Gly Arg Gly
Ser Val Phe Gly
130 135 140 145
ctt tac ggt ggc atg gag atg gcc gaa gta act cat 536
gga tct gga aag
Leu Tyr Gly Gly Met Glu Met Ala Glu Val Thr His
Gly Ser Gly Lys
150 155 160
ggt ggt ttg ccg gag atg agg ttc gga gat gat cgg 584
tct agg gcc agt
Gly Gly Leu Pro Glu Met Arg Phe Gly Asp Asp Arg
Ser Arg Ala Ser
165 170 175
agt agc att aag tta gag ggt att ctg gac cat tta 632
gga aat ggg ctc
Ser Ser Ile Lys Leu Glu Gly Ile Leu Asp His Leu
Gly Asn Gly Leu
180 185 190
agc ctt cca tga atgattataatttggccca aaaatact 687
ggg t gtaaagatct
gt
Ser Leu Pro
Gly
195
actaggatttcatttttata gagtatgtttttttccttaatttcggttgaaattggtgaa747
tatttttatctcttacttac caaatctcatatttctatgtatgcgtttgctttcactttt807
tttttttatataattcttct tgtaaaaaatgcaatgtgagttttcttccctatcattctg867
tcaagctttg aataatataggaatagtgttgaaag 922
gttcaattat
ttagtaatcg
<210> 34
<211> 197
<212> PRT
<213> Arabidopsis
thaliana
<400> 34
Met Ala Thr Glu Thr Ser Ser Leu Lys Leu Phe Gly Ile Asn Leu Leu
1 5 10 15
Glu Thr Thr Ser Val Gln Asn Gln Ser Ser Glu Pro Arg Pro Gly Ser
20 25 30
Gly Ser Gly Ser Glu Ser Arg Lys Tyr Glu Cys Gln Tyr Cys Cys Arg
35 40 45
Glu Phe Ala Asn Ser Gln Ala Leu Gly Gly His Gln Asn Ala His Lys
50 55 60
Lys Glu Arg Gln Leu Leu Lys Arg Ala Gln Met Leu Ala Thr Arg Gly
65 70 75 80
Leu Pro Arg His His Asn Phe His Pro His Thr Asn Pro Leu Leu Ser
85 90 95
Ala Phe Ala Pro Leu Pro His Leu Leu Ser Gln Pro His Pro Pro Pro
100 105 110
Page 37
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
His Met Met Leu Ser Pro Ser Ser Ser Ser Ser Lys Trp Leu Tyr Gly
115 120 125
Glu His Met Ser Ser Gln Asn Ala Val Gly Tyr Phe His Gly Gly Arg
130 135 140
Gly Leu Tyr Gly Gly Gly Met Glu Ser Met Ala Gly Glu Val Lys Thr
145 150 155 160
His Gly Gly Ser Leu Pro Glu Met Arg Arg Phe Ala Gly Asp Ser Asp
165 170 175
Arg Ser Ser Gly Ile Lys Leu Glu Asn Gly Ile Gly Leu Asp Leu His
180 185 190
Leu Ser Leu Gly Pro
195
<210> 35
<211> 420
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (1) . . (420)
<223> 6486
<400> 35
atgacagac gaagataga ttgttgcca atagccaat gtagggaga ctt 48
MetThrAsp GluAspArg LeuLeuPro IleAlaAsn ValGlyArg Leu
1 5 10 15
atgaagcaa atcctacca tcaaatgca aagatctca aaagaagca aaa 96
MetLysGln IleLeuPro SerAsnAla LysIleSer LysGluAla Lys
20 25 30
caaacagtt caagaatgt gcaacagag ttcataagc tttgttaca tgc 144
GlnThrVal GlnGluCys AlaThrGlu PheIleSer PheValThr Cys
35 40 45
gaagcatca gagaagtgc cacagggag aatcggaag acggtgaat gga 192
GluAlaSer GluLysCys HisArgGlu AsnArgLys ThrValAsn Gly
50 55 60
gacgacatc tggtggget ctcagcact ctcggcctc gataactat get 240
AspAspIle TrpTrpAla LeuSerThr LeuGlyLeu AspAsnTyr Ala
65 70 75 80
gacgccgtg ggtaggcat cttcacaag taccgtgaa gccgagaga gaa 288
AspAlaVal GlyArgHis LeuHisLys TyrArgGlu AlaGluArg Glu
85 90 95
agaactgag cacaacaaa ggtagcaat gatagtggg aatgagaaa gaa 336
ArgThrGlu HisAsnLys GlySerAsn AspSerGly AsnGluLys Glu
P age38
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
100 105 110
accaacact agaagtgat gtacagaac caatcg aca aaa ttt att aga
384
ThrAsnThr ArgSerAsp ValGlnAsn GlnSer Thr Lys Phe Ile Arg
115 120 125
gttgttgag aagggaagc agctcctcg gcccgt tga 420
ValValGlu LysGlySer SerSerSer AlaArg
130 135
<210> 36
<211> 139
<212> PRT
<213> Arabidopsis thaliana
<400> 36
Met Thr Asp Glu Asp Arg Leu Leu Pro Ile Ala Asn Val Gly Arg Leu
1 5 10 15
Met Lys Gln Ile Leu Pro Ser Asn Ala Lys Ile Ser Lys Glu Ala Lys
20 25 30
Gln Thr Val Gln Glu Cys Ala Thr Glu Phe Ile Ser Phe Val Thr Cys
35 40 45
Glu Ala Ser Glu Lys Cys His Arg Glu Asn Arg Lys Thr Val Asn Gly
50 55 60
Asp Asp Ile Trp Trp Ala Leu Ser Thr Leu Gly Leu Asp Asn Tyr Ala
65 70 75 80
Asp Ala Val Gly Arg His Leu His Lys Tyr Arg Glu Ala Glu Arg Glu
85 90 95
Arg Thr Glu His Asn Lys Gly Ser Asn Asp Ser Gly Asn Glu Lys Glu
100 105 110
Thr Asn Thr Arg Ser Asp Val Gln Asn Gln Ser Thr Lys Phe Ile Arg
115 120 125
Val Val Glu Lys Gly Ser Ser Ser Ser Ala Arg
130 135
<210> 37
<211> 1707
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (98)..(1444)
<223> 6748
Page 39
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
<400> 37
ccacgcgtcc caaaaaaaaa atcacagaga 60
gcactctccc
aaatctctct
tctttaacaa
catagagaga agaagacgga 115
acagaggctc
caaaaaa
atg
atg
atg
gag
act
aga
Met t u
Me Met Thr
Gl Arg
1 5
gatccaget attaagctt ttcggtatg aaaatccctttt ccgtcg gtt 163
AspProAla IleLysLeu PheGlyMet LysIleProPhe ProSer Val
10 15 20
tttgaatcg gcagttacg gtggaggat gacgaagaagat gactgg agc 211
PheGluSer AlaValThr ValGluAsp AspGluGluAsp AspTrp Ser
25 30 35
ggcggagat gacaaatca ccagagaag gtaactccagag ttatca gat 259
GlyGlyAsp AspLysSer ProGluLys ValThrProGlu LeuSer Asp
40 45 50
aagaacaac aacaactgt aacgacaac agttttaacaat tcgaaa ccc 307
LysAsnAsn AsnAsnCys AsnAspAsn SerPheAsnAsn SerLys Pro
55 60 65 70
gaaaccttg gacaaagag gaagcgaca tcaactgatcag atagag agt 355
GluThrLeu AspLysGlu GluAlaThr SerThrAspGln IleGlu Ser
75 80 85
agtgacacg cctgaggat aatcagcag acgacacctgat ggtaaa acc 403
SerAspThr ProGluAsp AsnGlnGln ThrThrProAsp GlyLys Thr
90 95 100
ctaaagaaa ccgactaag attctaccg tgtccgagatgc aaaagc atg 451
LeuLysLys ProThrLys IleLeuPro CysProArgCys LysSer Met
105 110 115
gagaccaag ttctgttat tacaacaac tacaacataaac cagcct cgt 499
GluThrLys PheCysTyr TyrAsnAsn TyrAsnIleAsn GlnPro Arg
120 125 130
catttctgc aaggettgt cagagatat tggactgetgga gggact atg 547
HisPheCys LysAlaCys GlnArgTyr TrpThrAlaGly GlyThr Met
135 140 145 150
aggaatgtt cctgtgggg gcaggacgt cgtaagaacaaa agctca tct 595
ArgAsnVal ProValGly AlaGlyArg ArgLysAsnLys SerSer Ser
155 160 165
tctcattac cgtcacatc actatttcc gaggetcttgag getgcg agg 643
SerHisTyr ArgHisIle ThrIleSer GluAlaLeuGlu AlaAla Arg
170 175 180
cttgacccg ggcttacag gcaaacaca agggtcttgagt tttggt ctc 691
LeuAspPro GlyLeuGln AlaAsnThr ArgValLeuSer PheGly Leu
185 190 195
gaagetcag cagcagcac gttgetget cccatgacacct gttatg aag 739
GluAlaGln GlnGlnHis ValAlaAla ProMetThrPro ValMet Lys
200 205 210
ctacaagaa gatcaaaag gtctcaaac ggtgetaggaac aggttt cac 787
LeuGlnGlu AspGlnLys ValSerAsn GlyAlaArgAsn ArgPhe His
P age40
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
215 220 225 230
gggtta gcggat caacggcttgta getcgggta gagaatgga gatgat 835
GlyLeu AlaAsp GlnArgLeuVal AlaArgVal GluAsnGly AspAsp
235 240 245
tgctca agcgga tcctctgtgacc acctctaac aatcactca gtggat 883
CysSer SerGly SerSerValThr ThrSerAsn AsnHisSer ValAsp
250 255 260
gaatca agagca caaagcggcagt gttgttgaa gcacaaatg aacaac 931
GluSer ArgAla GlnSerGlySer ValValGlu AlaGlnMet AsnAsn
265 270 275
aacaac aacaat aacatgaatggt tatgettgc atcccaggt gttcca 979
AsnAsn AsnAsn AsnMetAsnGly TyrAlaCys IleProGly ValPro
280 285 290
tggcct tacacg tggaatccagcg atgcctcca ccaggtttt tacccg 1027
TrpPro TyrThr TrpAsnProAla MetProPro ProGlyPhe TyrPro
295 300 305 310
cctcca gggtat ccaatgccgttt tacccttac tggaccatc ccaatg 1075
ProPro GlyTyr ProMetProPhe TyrProTyr TrpThrIle ProMet
315 320 325
ctacca ccgcat caatcctcatcg cctataagc caaaagtgt tcaaat 1123
LeuPro ProHis GlnSerSerSer ProIleSer GlnLysCys SerAsn
330 335 340
acaaac tctccg actctcggaaag catccgaga gatgaagga tcatcg 1171
ThrAsn SerPro ThrLeuGlyLys HisProArg AspGluGly SerSer
345 350 355
aaaaag gacaat gagacagagcga aaacagaag gccgggtgc gttctg 1219
LysLys AspAsn GluThrGluArg LysGlnLys AlaGlyCys ValLeu
360 365 370
gtcccg aaaacg ttgagaatagat gatcctaac gaagcagca aagagc 1267
ValPro LysThr LeuArgIleAsp AspProAsn GluAlaAla LysSer
375 380 385 390
tcgata tggaca acattgggaatc aagaacgag gcgatgtgc aaagcc 1315
SerIle TrpThr ThrLeuGlyIle LysAsnGlu AlaMetCys LysAla
395 400 405
ggtggt atgttc aaagggtttgat cataagaca aagatgtat aacaac 1363
GlyGly MetPhe LysGlyPheAsp HisLysThr LysMetTyr AsnAsn
410 415 420
gacaaa getgag aactcccctgtt ctttctget aaccctget getcta 1411
AspLys AlaGlu AsnSerProVal LeuSerAla AsnProAla AlaLeu
425 430 435
tcaaga tcacac aatttccatgaa cagatttag agttacatat 1464
gtatatgtat
SerArg SerHis Asn.PheHisGlu GlnIle
440 445
atatgtatga tactggagaa tgatgagttt
1524
ttgattgtat ttgagaatca
gtatagatga
aactcttttc tattccttta catgttttgg
1584
ttctttctag ttctctgtac
tgattgcctt
actatttgat cttcatttgt caggaaatgt
1644
ttaccttttt tggaagataa
tactttcttt
P age 41
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
cattaatggt aaaaagttgg tgtggaccgt tgttgcgttg gcatttcaaa aaaaaaaaaa 1704
aaa 1707
<210> 38
<211> 448
<212> PRT
<213> Arabidopsis thaliana
<400> 38
Met Met Met Glu Thr Arg Asp Pro Ala Ile Lys Leu Phe Gly Met Lys
1 5 10 15
Ile Pro Phe Pro Ser Val Phe Glu Ser Ala Val Thr Val Glu Asp Asp
20 25 30
Glu Glu Asp Asp Trp Ser Gly Gly Asp Asp Lys Ser Pro Glu Lys Val
35 40 45
Thr Pro Glu Leu Ser Asp Lys Asn Asn Asn Asn.Cys Asn Asp Asn Ser
50 55 60
Phe Asn Asn Ser Lys Pro Glu Thr Leu Asp Lys Glu Glu Ala Thr Ser
65 70 75 80
Thr Asp Gln Ile Glu Ser Ser Asp Thr Pro Glu Asp Asn Gln Gln Thr
85 90 95
Thr Pro Asp Gly Lys Thr Leu Lys Lys Pro Thr Lys Ile Leu Pro Cys
100 105 110
Pro Arg Cys Lys Ser Met Glu Thr Lys Phe Cys Tyr Tyr Asn Asn Tyr
115 120 125
Asn Ile Asri Gln Pro Arg His Phe Cys Lys Ala Cys Gln Arg Tyr Trp
130 135 140
Thr Ala Gly Gly Thr Met Arg Asn Val Pro Val Gly Ala Gly Arg Arg
145 150 155 160
Lys Asn Lys Ser Ser Ser Ser His Tyr Arg His Ile Thr Ile Ser Glu
165 170 175
Ala Leu Glu Ala Ala Arg Leu Asp Pro Gly Leu Gln Ala Asn Thr Arg
180 185 190
Val Leu Ser Phe Gly Leu Glu Ala Gln Gln Gln His Val Ala Ala Pro
195 200 205
Page 42
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Met Thr Pro Val Met Lys Leu Gln Glu Asp Gln Lys Val Ser Asn Gly
210 215 220
Ala Arg Asn Arg Phe His Gly Leu Ala Asp Gln Arg Leu Val Ala Arg
225 230 235 240
Val Glu Asn Gly Asp Asp Cys Ser Ser Gly Ser Ser Val Thr Thr Ser
245 250 255
Asn Asn His Ser Val Asp Glu Ser Arg Ala Gln Ser Gly Ser Val Val
260 ' 265 270
Glu Ala Gln Met Asn Asn Asn Asn Asn Asn Asn Met Asn Gly Tyr Ala
275 280 285
Cys Ile Pro Gly Val Pro Trp Pro Tyr Thr Trp Asn Pro Ala Met Pro
290 295 300
Pro Pro Gly Phe Tyr Pro Pro Pro Gly Tyr Pro Met Pro Phe Tyr Pro
305 310 315 320
Tyr Trp Thr Ile Pro Met Leu Pro Pro His Gln Ser Ser Ser Pro Ile
325 330 335
Ser Gln Lys Cys Ser Asn Thr Asn Ser Pro Thr Leu Gly Lys His Pro
340 345 350
Arg Asp Glu Gly Ser Ser Lys Lys Asp Asn Glu Thr Glu Arg Lys Gln
355 360 365
Lys Ala Gly Cys Val Leu Val Pro Lys Thr Leu Arg Ile Asp Asp Pro
370 375 380
Asn Glu Ala Ala Lys Ser Ser Ile Trp Thr Thr Leu Gly Ile Lys Asn
385 390 395 400
Glu Ala Met Cys Lys Ala Gly Gly Met Phe Lys Gly Phe Asp His Lys
405 410 415
Thr Lys Met Tyr Asn Asn Asp Lys Ala Glu Asn Ser Pro Val Leu Ser
420 425 430
Ala Asn Pro Ala Ala Leu Ser Arg Ser His Asn Phe His Glu Gln Ile
435 440 445
<210> 39
Page 43
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
<211> 1095
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (180) . . (917)
<223> 6994
MBI-0021.txt
<400>
39
tgtatatata cttttgtgtg 60
gttagttagt gtctttcttt
tgagataaac
ttggttacca
ttctttttct agctaattac tttcgcgatt 120
ccattttcca
tttatcgacc
ccttgggtgt
ttcaaatcca aaaccatata 179
ataaagtttt atataaata
aatttgatga
agcttttttt
atgggt ggtcgtaaa ccatgttgt gatgaggttgga ttaagaaag ggt 227
MetGly GlyArgLys ProCysCys AspGluValGly LeuArgLys Gly
1 5 10 15
ccatgg acagtggaa gaagatggg aaactagttgat ttcttaagg gca 275
ProTrp ThrValGlu GluAspGly LysLeuValAsp PheLeuArg Ala
20 25 30
cgtggc aactgcggt ggtggtgga ggaggatggtgc tggagagac gtg 323
ArgGly AsnCysGly GlyGlyGly GlyGlyTrpCys TrpArgAsp Val
35 40 45
ccaaaa ctggcgggg ctaaggagg tgtggcaaaagt tgccgtctc cgg 371
ProLys LeuAlaGly LeuArgArg CysGlyLysSer CysArgLeu Arg
50 55 60
tggact aattatctc cggccagat ctcaagagaggt ctttttact gaa 419
TrpThr AsnTyrLeu ArgProAsp LeuLysArgGly LeuPheThr Glu
65 70 75 80
gaagaa atccaacta gtcattgat cttcatgetcgc cttggcaat aga 467
GluGlu IleGlnLeu ValIleAsp LeuHisAlaArg LeuGlyAsn Arg
85 90 95
tggtcg aagattgca gtggagtta ccaggaagaaca gacaacgat atc 515
TrpSer LysIleAla ValGluLeu ProGlyArgThr AspAsnAsp Ile
100 105 110
aaaaat tattggaac actcatata aagaggaagctt ataagaatg ggt 563
LysAsn TyrTrpAsn ThrHisIle LysArgLysLeu IleArgMet Gly
115 120 125
attgat ccaaacaca catcgtcga tttgaccaacaa aaagtcaac gag 611
IleAsp ProAsnThr HisArgArg PheAspGlnGln LysValAsn Glu
130 135 140
gaggaa acgatattg gtcaacgat ccaaagcctctg tctgagacc gag 659
GluGlu ThrIleLeu ValAsnAsp ProLysProLeu SerGluThr Glu
145 150 155 160
gtatct gttgetttg aagaatgac acgtcagcagtg ttatcagga aat 707
ValSer ValAlaLeu LysAsnAsp ThrSerAlaVal LeuSerGly Asn
165 170 175
ctaaac caattgget gacgtggac ggtgatgatcag ccgtggagc ttt 755
LeuAsn GlnLeuAla AspValAsp GlyAspAspGln ProTrpSer Phe
P age44
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
180 185 190
ctaatg gaaaatgac gaaggagga ggtggcgac gccgccgga gagctt 803
LeuMet GluAsnAsp GluGlyGly GlyGlyAsp AlaAlaGly GluLeu
195 200 205
acgatg ctattgtcc ggtgacatt acgtcatca tgttcttct tcgtca 851
ThrMet LeuLeuSer GlyAspIle ThrSerSer CysSerSer SerSer
210 215 220
tctttg tggatgaag tatggagaa ttcggatac gaagattta gaactt 899
SerLeu TrpMetLys TyrGlyGlu PheGlyTyr GluAspLeu GluLeu
225 230 235 240
ggatgt ttcgatgtt tagagattcaagt 947
atgtttaatt
aggccgtagg
GlyCys PheAspVal
245
ttgattaatc ataaggttca ttgacttcat tctagaattg tgtagttgga ccagtataaa 1007
gaatcaaagt tatgaaacat tgtaatttga tttccaaatt aatctaatga ataaatgtgc 1067
tttgcaaaaa aaaaaaaaaa aaaaaaaa 1095
<210> 40
<211> 245
<212> PRT
<213> Arabidopsis thaliana
<400> 40
Met Gly Gly Arg Lys Pro Cys Cys Asp Glu Val Gly Leu Arg Lys Gly
1 5 10 15
Pro Trp Thr Val Glu Glu Asp Gly Lys Leu Val Asp Phe Leu Arg Ala
20 25 30
Arg Gly Asn Cys Gly Gly Gly Gly Gly Gly Trp Cys Trp Arg Asp Val
35 40 45
Pro Lys Leu Ala Gly Leu Arg Arg Cys Gly Lys Ser Cys Arg Leu Arg
50 55 60
Trp Thr Asn Tyr Leu Arg Pro Asp Leu Lys Arg Gly Leu Phe Thr Glu
65 70 75 80
Glu Glu Ile Gln Leu Val Ile Asp Leu His Ala Arg Leu Gly Asn Arg
85 90 95
Trp Ser Lys Ile Ala Val Glu Leu Pro Gly Arg Thr Asp Asn Asp Ile
100 105 110
Lys Asn Tyr Trp Asn Thr His Ile Lys Arg Lys Leu Ile Arg Met Gly
115 120 125
Page 45
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Ile Asp Pro Asn Thr His Arg Arg Phe Asp Gln Gln Lys Val Asn Glu
130 135 140
Glu Glu Thr Ile Leu Val Asn Asp Pro Lys Pro Leu Ser Glu Thr Glu
145 150 155 160
Val Ser Val Ala Leu Lys Asn Asp Thr Ser Ala Val Leu Ser Gly Asn
165 170 175
Leu Asn Gln Leu Ala Asp Val Asp Gly Asp Asp Gln Pro Trp Ser Phe
180 185 190
Leu Met Glu Asn Asp Glu Gly Gly Gly Gly Asp Ala Ala Gly Glu Leu
195 200 205
Thr Met Leu Leu Ser Gly Asp Ile Thr Ser Ser Cys Ser Ser Ser Ser
210 215 220
Ser Leu Trp Met Lys Tyr Gly Glu Phe Gly Tyr Glu Asp Leu Glu Leu
225 230 235 240
Gly Cys Phe Asp Val
245
<210> 41
<211> 965
<212> DNA
<213> Arabididopsis thaliana
<220>
<221> CDS
<222> (56) . . (667)
<223> 61335
<400>
41
ttttttttta aaagatttag gagttattaa gagattccaa
tcaaaatg 58
agagaaaagt
Met
1
agcggagacaac ggcggt ggtgag aggcgcaaaggc tccgtcaag tgg 106
SerGlyAspAsn GlyGly GlyGlu ArgArgLysGly SerValLys Trp
5 10 15
tttgatacccag aagggt ttcggc ttcatcactcct gacgacggt ggc 154
PheAspThrGln LysGly PheGly PheIleThrPro AspAspGly Gly
20 25 30
gacgatctcttc gttcac cagtcc tccatcagatct gagggtttc cgt 202
AspAspLeuPhe ValHis GlnSer SerIleArgSer GluGlyPhe Arg
35 40 45
agcctcgetgcc gaagaa gccgta gagttcgaggtt gagatcgac aac 250
SerLeuAlaAla GluGlu AlaVal GluPheGluVal GluIleAsp Asn
P age46
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
50 55 60 65
aacaaccgt cccaaggcc atcgat gtttctggaccc gacggcget ccc 298
AsnAsnArg ProLysAla IleAsp ValSerGlyPro AspGlyAla Pro
70 75 80
gtccaagga aacagcggt ggtggt tcatctggcgga cgcggcggt ttc 346
ValGlnGly AsnSerGly GlyGly SerSerGlyGly ArgGlyGly Phe
85 90 95
ggtggagga agaggaggt ggacgc ggatctggaggt ggatacggc ggt 394
GlyGlyGly ArgGlyGly GlyArg GlySerGlyGly GlyTyrGly Gly
100 105 110
ggcggtggt ggatacgga ggaaga ggaggtggtggt cgaggaggc agc 442
GlyGlyGly GlyTyrGly GlyArg GlyGlyGlyGly ArgGlyGly Ser
115 120 125
gactgctac aagtgtggt gagccc ggtcacatggcg agagactgt tct 490
AspCysTyr LysCysGly GluPro GlyHisMetAla ArgAspCys Ser
130 135 140 145
gaaggcggt ggaggttac ggagga ggcggcggtggc tacggaggt gga 538
GluGlyGly GlyGlyTyr GlyGly GlyGlyGlyGly TyrGlyGly Gly
150 155 160
ggcggatac ggcggagga ggtggt ggttacggaggt ggtggccgt gga 586
GlyGlyTyr GlyGlyGly GlyGly GlyTyrGlyGly GlyGlyArg Gly
165 170 175
ggtggtggc ggcggggga agctgc tacagctgtggc gagtcggga cat 634
GlyGlyGly GlyGlyGly SerCys TyrSerCysGly GluSerGly His
180 185 190
ttcgccagg gattgcacc agcggt ggacgttaaaaccaacgcc cgcgg 687
ggtta
PheAlaArg AspCysThr SerGly GlyArg
195 200
tggagaagag tgatcggttc tttctcccgc tctat
747
tgagttggtt cgcct
atctcacaag
ctctctatta atggatctct atctttgtta
807
tccacttttt gttggttttt
gcttattatg
tcttgatggt ttggttttgc tacttatggt ttatt
867
ttcggattag tggtt
gactcttctt
tatggtactt aaatgctc tacttgttgc tctgtttc aa cataa
927
gtgatatggg gtgtt
tg
tatgcgaaca atattctgg tttg.tttc aaaaaaa a
965
a gt
<210>
42
<211>
203
<212>
PRT
<213> didopsis tha liana
Arabi
<400> 42
Met Ser Gly Asp Asn Gly Gly Gly Glu Arg Arg Lys Gly Ser Val Lys
1 5 10 15
Trp Phe Asp Thr Gln Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly
20 25 30
Page 47
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Gly Asp Asp Leu Phe Val His Gln Ser Ser Ile Arg Ser Glu Gly Phe
35 40 45
Arg Ser Leu Ala Ala Glu Glu Ala Val Glu Phe Glu Val Glu Ile Asp
50 55 60
Asn Asn Asn Arg Pro Lys Ala Ile Asp Val Ser Gly Pro Asp Gly Ala
65 70 75 80
Pro Val Gln Gly Asn Ser Gly Gly Gly Ser Ser Gly Gly Arg Gly Gly
85 90 95
Phe Gly Gly Gly Arg Gly Gly Gly Arg Gly Ser Gly Gly Gly Tyr Gly
100 105 110
Gly Gly Gly Gly Gly Tyr Gly Gly Arg Gly Gly Gly Gly Arg Gly Gly
115 120 125
Ser Asp Cys Tyr Lys Cys Gly Glu Pro Gly His Met Ala Arg Asp Cys
130 135 140
Ser Glu Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Tyr Gly Gly
145 150 155 160
Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Gly Arg
165 170 175
Gly Gly Gly Gly Gly Gly Gly Ser Cys Tyr Ser Cys Gly Glu Ser Gly
180 185 190
His Phe Ala Arg Asp Cys Thr Ser Gly Gly Arg
195 200
<210> 43
<211> 1554
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (137)..(1285)
<223> 6562
<400> 43
atttgaattt ctgggtttct ctctgtttaa gcttcttctt cttcatcttc tgcttacgtt 60
tcttcttcaa ggagctttcg gattcttgta gaaagagtca ttgttctctt gagtgggaaa 120
ccttgaaacc attcct atg gga aat agc agc gag gaa cca aag cct cct acc 172
Met Gly Asn Ser Ser Glu Glu Pro Lys Pro Pro Thr
Page 48
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
1 5 10
aaatca gataaa ccatcttcaccc ccggtggat caaacaaat gttcat 220
LysSer AspLys ProSerSerPro ProValAsp GlnThrAsn ValHis
15 20 25
gtctac cctgat tgggcagetatg caggcatat tatggtcca agagta 268
ValTyr ProAsp TrpAlaAlaMet GlnAlaTyr TyrGlyPro ArgVal
30 35 40
gcaatg cctcct tattacaattca getatgget gcatctggt catcct 316
AlaMet ProPro TyrTyrAsnSer AlaMetAla AlaSerGly HisPro
45 50 55 60
cctcct ccttac atgtggaatcct cagcatatg atgtcacca tctgga 364
ProPro ProTyr MetTrpAsnPro GlnHisMet MetSerPro SerGly
65 70 75
gcaccc tatget getgtttatcct catggagga ggagtttac getcat 412
AlaPro TyrAla AlaValTyrPro HisGlyGly GlyValTyr AlaHis
80 85 90
cccggt attccc atgggatcactg cctcaaggt caaaaggat ccacct 460
ProGly IlePro MetGlySerLeu ProGlnGly GlnLysAsp ProPro
95 100 105
ttaaca actccg gggacgcttttg agcatcgac actcctact aaatct 508
LeuThr ThrPro GlyThrLeuLeu SerIleAsp ThrProThr LysSer
110 115 120
acaggg aacaca gacaatggattg atgaagaag ctgaaagag tttgat 556
ThrGly AsnThr AspAsnGlyLeu MetLysLys LeuLysGlu PheAsp
125 130 135 140
gggctt getatg tctctaggaaat gggaatcct gaaaatggt gcagat 604
GlyLeu AlaMet SerLeuGlyAsn GlyAsnPro GluAsnGly AlaAsp
145 150 155
gaacat aaacga tcacggaacagc tcagaaact gatggttct actgat 652
GluHis LysArg SerArgAsnSer SerGluThr AspGlySer ThrAsp
160 165 170
ggaagt gatggg aatacaactggg gcagatgaa ccgaaactt aaaaga 700
GlySer AspGly AsnThrThrGly AlaAspGlu ProLysLeu LysArg
175 180 185
agtcga gaggga actccaacaaaa gatgggaaa caattggtt caaget 748
SerArg GluGly ThrProThrLys AspGlyLys GlnLeuVal GlnAla
190 195 200
agctca tttcat tctgtttctccg tcaagtggt gataccggc gtaaaa 796
SerSer PheHis SerValSerPro SerSerGly AspThrGly ValLys
205 210 215 220
ctcatt caagga tctggagetata ctctctcct ggtgtaagt gcaaat 844
LeuIle GlnGly SerGlyAlaIle LeuSerPro GlyValSer AlaAsn
225 230 235
tccaac cccttc atgtcacaatct ttagccatg gttcctcct gaaact 892
SerAsn ProPhe MetSerGlnSer LeuAlaMet ValProPro GluThr
240 245 250
tggctt cagaac gagagagaactg aaacgggag cgaaggaaa cagtct 940
Page 49
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
TrpLeu GlnAsnGlu ArgGluLeu LysArgGlu ArgArgLysGln Ser
255 260 265
aataga gaatctget agaaggtca agattaagg aaacaggccgag aca 988
AsnArg GluSerAla ArgArgSer ArgLeuArg LysGlnAlaGlu Thr
270 275 280
gaagaa cttgetagg aaagtggaa gccttgaca gccgaaaacatg gca 1036
GluGlu LeuAlaArg LysValGlu AlaLeuThr AlaGluAsnMet Ala
285 290, 295 300
ttaaga tctgaacta aaccaactt aatgagaaa tctfiataaacta aga 1084
LeuArg SerGIuLeu AsnGlnLeu AsnGluLys SerAspLysLeu Arg
305 310 315
ggagca aatgcaacc ttgttggac aaactgaaa tgctcggaaccc gaa 1132
GlyAla AsnAlaThr LeuLeuAsp LysLeuLys CysSerGluPro Glu
320 325 330
aagaga gtccccgca aatatgttg tctagagtt aagaactcagga get 1180
LysArg ValProAla AsnMetLeu SerArgVal LysAsnSerGly Ala
335 340 345
ggafiataagaacaag aaccaagga gacaatfiattctaactctaca agc 1228
GlyAsp LysAsnLys AsnGlnGly AspAsnAsp SerAsnSerThr Ser
350 355 360
aaattc catcaactg ctcfiatacg aagcctcga getaaagcagta get 1276
LysPhe HisGlnLeu LeuAspThr LysProArg AlaLysAlaVal Ala
365 370 375 380
gcaggc tgaatcgatggta g 1325
attcatgtc atttctactt
aatttgtcga
AlaGly
cataaacaaa tcagaaaaac ttgatagata gatagtatag
1385
gaaaataagt
gctactaatt
tagagagaga gattattgat ctataaattt tcggagagag
1445
gagagagaga
gaggtgtgat
agagggagaa tgaaaatttg gtgttatfigt ttgttactgt
1505
agagaaactt
ttcctccaga
taatatagag aatggcttcc tttgttgca
1554
aggcttttct
ttttttataa
<210>
44
<211>
382
<212>
PRT
<213>
Arabidopsis
thaliana
<400> 44
Met Gly Asn Ser Ser Glu Glu Pro Lys Pro Pro Thr Lys Ser Asp Lys
1 5 10 15
Pro Ser Ser Pro Pro Val Asp Gln Thr Asn Val His Val Tyr Pro Asp
20 25 ' 30
Trp Ala Ala Met Gln Ala Tyr Tyr Gly Pro Arg Val Ala Met Pro Pro
35 40 45
Page 50
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Tyr Tyr Asn Ser Ala Met Ala Ala Ser Gly His Pro Pro Pro Pro Tyr
50 55 60
Met Trp Asn Pro Gln His Met Met Ser Pro Ser Gly Ala Pro Tyr Ala
65 70 75 80
Ala Val Tyr Pro His Gly Gly Gly Val Tyr Ala His Pro Gly Ile Pro
85 90 95
Met Gly Ser Leu Pro Gln Gly Gln Lys Asp Pro Pro Leu Thr Thr Pro
100 105 110
Gly Thr Leu Leu Ser Ile Asp Thr Pro Thr Lys Ser Thr Gly Asn Thr
115 120 125
Asp Asn Gly Leu Met Lys Lys Leu Lys Glu Phe Asp Gly Leu Ala Met
130 135 140
Ser Leu Gly Asn Gly Asn Pro Glu Asn Gly Ala Asp Glu His Lys Arg
145 150 155 160
Ser Arg Asn Ser Ser Glu Thr Asp Gly Ser Thr Asp Gly Ser Asp Gly
165 170 175
Asn Thr Thr Gly Ala Asp Glu Pro Lys Leu Lys Arg Ser Arg Glu Gly
180 185 190
Thr Pro Thr Lys Asp Gly Lys Gln Leu Val Gln Ala Ser Ser Phe His
195 200 205
Ser Val Ser Pro Ser Ser Gly Asp Thr Gly Val Lys Leu Ile Gln Gly
210 215 220
Ser Gly Ala Ile Leu Ser Pro Gly Val Ser Ala Asn Ser Asn Pro Phe
225 230 235 240
Met Ser Gln Ser Leu Ala Met Val Pro Pro Glu Thr Trp Leu Gln Asn
245 250 255
Glu Arg Glu Leu Lys Arg Glu Arg Arg Lys Gln Ser Asn Arg Glu Ser
260 265 270
Ala Arg Arg Ser Arg Leu Arg Lys Gln Ala Glu Thr Glu Glu Leu Ala
275 280 285
Arg Lys Val Glu Ala Leu Thr Ala Glu Asn Met Ala Leu Arg Ser Glu
290 295 300
Page 51
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Leu Asn Gln Leu Asn Glu Lys Ser Asp Lys Leu Arg Gly Ala Asn Ala
305 310 315 320
Thr Leu Leu Asp Lys Leu Lys Cys Ser Glu Pro Glu Lys Arg Val Pro
325 330 335
Ala Asn Met Leu Ser Arg Val Lys Asn Ser Gly Ala Gly Asp Lys Asn
340 345 350
Lys Asn Gln Gly Asp Asn Asp Ser Asn Ser Thr Ser Lys Phe His Gln
355 360 365
Leu Leu Asp Thr Lys Pro Arg Ala Lys Ala Val Ala Ala Gly
370 375 380
<210> 45
<211> 513
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (1) . . (513)
<223> 6736
<400> 45
atg~gcgact caagattct caagggatt aaactcttt ggcaaaact att 48
MetAlaThr GlnAspSer GlnGlyIle LysLeuPhe GlyLysThr Ile
1 5 10 15
gcatttaac actcgaaca ataaaaaat gaagaagag acacacccg ccg 96
AlaPheAsn ThrArgThr IleLysAsn GluGluGlu ThrHisPro Pro
20 25 30
gagcaagaa gccacaata gccgttaga tcatcatca tcatcggat ctg 144
GluGlnGlu AlaThrIle AlaValArg SerSerSer SerSerAsp Leu
35 40 45
acggccgag aagcgtccg gataagatc atagcatgt ccaagatgc aag 192
ThrAlaGlu LysArgPro AspLysIle IleAlaCys ProArgCys Lys
50 55 60
agcatggag acaaagttc tgttacttc aacaactac aacggtaat cag 240
SerMetGlu ThrLysPhe CysTyrPhe AsnAsnTyr AsnGlyAsn Gln
65 70 75 80
cctcgacac ttttgtaaa ggctgccac cgttactgg accgccggt ggt 288
ProArgHis PheCysLys GlyCysHis ArgTyrTrp ThrAlaGly Gly .
85 90 95
gcactccgg aacgttccc gtcggcgcc ggtcgtcgg aagtccaaa cca 336
AlaLeuArg AsnValPro ValGlyAla GlyArgArg LysSerLys Pro
100 105 110
cctggtcgt gtcgtggtt ggtatgctt ggagatgga aatggtgtt cgc 384
ProGlyArg ValValVal GlyMetLeu GlyAspGly AsnGlyVal Arg
P age52
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
115 120 125
caa gtc gag ctt ata aat ggc ttg ctc gtt gag gag tgg cag cat gcc 432
Gln Val Glu Leu Ile Asn Gly Leu Leu Val Glu Glu Trp Gln His Ala
130 135 140
gca gcc gca get cac ggt agt ttc cgg cat gat ttt ccc atg aag cgg 480
Ala Ala Ala Ala His Gly Ser Phe Arg His Asp Phe Pro Met Lys Arg
145 150 155 160
ctc cgg tgt tac tcc gac ggt caa tcg tgc tga 513
Leu Arg Cys Tyr Ser Asp Gly Gln Ser Cys
165 170
<210> 46
<211> 170
<212> PRT
<213> Arabidopsis thaliana
<400> 46
Met Ala Thr Gln Asp Ser Gln Gly Ile Lys Leu Phe Gly Lys Thr Ile
1 5 10 15
Ala Phe Asn Thr Arg Thr Ile Lys Asn Glu Glu Glu Thr His Pro Pro
20 25 30
Glu Gln Glu Ala Thr Ile Ala Val Arg Ser Ser Ser Ser Ser Asp Leu
35 40 45
Thr Ala Glu Lys Arg Pro Asp Lys Ile Ile Ala Cys Pro Arg Cys Lys
50 55 60
Ser Met Glu Thr Lys Phe Cys Tyr Phe Asn Asn Tyr Asn Gly Asn Gln
65 70 75 80
Pro Arg His Phe Cys Lys Gly Cys His Arg Tyr Trp Thr Ala Gly Gly
85 90 95
Ala Leu Arg Asn Val Pro Val Gly Ala Gly Arg Arg Lys Ser Lys Pro
100 105 110
Pro Gly Arg Val Val Val Gly Met Leu Gly Asp Gly Asn Gly Val Arg
115 120 125
Gln Val Glu Leu Ile Asn Gly Leu Leu Val Glu Glu Trp Gln His Ala
130 135 140
Ala Ala Ala Ala His Gly Ser Phe Arg His Asp Phe Pro Met Lys Arg
145 150 155 160
Leu Arg Cys Tyr Ser Asp Gly Gln Ser Cys
Page 53
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
165 170
<210> 47
<211> 974
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (62)..(874)
<223> 61073
<400> 47
ccccccg acc gattccagaa ccccacctga 60
tgcctctaca tcaaaaataa
gagacctgaa
c 109
atg
gaa
ctt
aac
aga
tct
gaa
gca
gac
gaa
gca
aag
gcc
gag
acc
act
Met 1u a
G Leu Asp
Asn Glu
Arg Ala
Ser Lys
Glu Ala
Al Glu
Thr
Thr
1 5 10 15
cccacc ggtgga gccaccagctca gccacagcc tctggctct tcctcc 157
ProThr GlyGly AlaThrSerSer AlaThrAla SerGlySer SerSer
20 25 30
ggacgt cgtcca cgtggtcgtcct gcaggttcc aaaaacaaa cccaaa 205
GlyArg ArgPro ArgGlyArgPro AlaGlySer LysAsnLys ProLys
35 40 45
cctccg acgatt ataactagagat agtcctaac gtccttaga tcacac 253
ProPro ThrIle IleThrArgAsp SerProAsn ValLeuArg SerHis
50 55 60
gttctt gaagtc acctccggttcg gacatatcc gaggcagtc tccacc 301
ValLeu GluVal ThrSerGlySer AspIleSer GluAlaVal SerThr
65 70 75 80
tacgcc actcgt cgcggctgcggc gtttgcatt ataagcggc acgggt 349
TyrAla ThrArg ArgGlyCysGly ValCysIle IleSerGly ThrGly
85 90 95
gcggtc actaac gtcacgatacgg caacctgcg getccgget ggtgga 397
AlaVal ThrAsn ValThrIleArg GlnProAla AlaProAla GlyGly
100 105 110
ggtgtg attacc ctgcatggtcgg tttgacatt ttgtctttg accggt 445
GlyVal IleThr LeuHisGlyArg PheAspIle LeuSerLeu ThrGly
115 120 125
actgcg cttcca ccgcctgcacca ccgggagca ggaggtttg acggtg 493
ThrAla LeuPro ProProAlaPro ProGlyAla GlyGlyLeu ThrVal
130 135 140
tatcta gccgga ggtcaaggacaa gttgtagga gggaatgtg getggt 541
TyrLeu AlaGly GlyGlnGlyGln ValValGly GlyAsnVal AlaGly
145 150 155 160
tcgtta attget tcgggaccggta gtgttgatg getgettct tttgca 589
SerLeu IleAla SerGlyProVal ValLeuMet AlaAlaSer PheAla
165 170 175
aacgca gtttat gataggttaccg attgaagag gaagaaacc ccaccg 637
AsnAla ValTyr AspArgLeuPro IleGluGlu GluGluThr ProPro
P age 54
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
180 185 190
ccg accacc ggggtg cagcagcag cagccggag gcgtctcag tcg 685
aga
Pro ThrThr GlyVal GlnGlnGln GlnProGlu AlaSerGln Ser
Arg
195 200 205
tcg gttacg gggagt ggggcccag gcgtgtgag tcaaacctc caa 733
gag
Ser ValThr GlySer GlyAlaGln AlaCysGlu SerAsnLeu Gln
Glu
210 215 220
ggt aatggt ggagga ggtgttget ttctacaat cttggaatg aat 781
gga
Gly AsnGly GlyGly GlyValAla PheTyrAsn LeuGlyMet Asn
Gly
225 230 235 240
atg aatttt caattc tccggggga gatatttac ggtatgagc ggc 829
aac
Met AsnPhe GlnPhe SerGlyGly AspIleTyr GlyMetSer Gly
Asn
245 250 255
ggt ggagga ggtggt ggcggtgcg actagaccc gcgttttag . 874
agc
Gly GlyGly GlyGly GlyGlyAla ThrArgPro AlaPhe
Ser
260 265 270
agttttagcg ttttggtgac gtttgacctc 934
accttttgtt aaactactag
gcgtttgcgt
gctactagct atagcggt tg 974
cgaaatgcga
atattaggtt
<210> 48
<211> 270
<212> PRT
<213> idopsis thaliana
Arab
<400> 48
Met Glu Leu Asn Arg Ser Glu Ala Asp Glu Ala Lys Ala Glu Thr Thr
1 5 10 15
Pro Thr Gly Gly Ala Thr Ser Ser Ala Thr Ala Ser Gly Ser Ser Ser
20 25 30
Gly Arg Arg Pro Arg Gly Arg Pro Ala Gly Ser Lys Asn Lys Pro Lys
35 40 45
Pro Pro Thr Ile Ile Thr Arg Asp Ser Pro Asn Val Leu Arg Ser His
50 55 60
Val Leu Glu Val Thr Ser Gly Ser Asp Ile Ser Glu Ala Val Ser Thr
65 70 75 80
Tyr Ala Thr Arg Arg Gly Cys Gly Val Cys Ile Ile Ser Gly Thr Gly
85 90 95
Ala Val Thr Asn Val Thr Ile Arg Gln Pro Ala Ala Pro Ala Gly Gly
100 105 110
Gly Val Ile Thr Leu His Gly Arg Phe Asp Ile Leu Ser Leu Thr Gly
' Page 55
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
115 120 125
Thr Ala Leu Pro Pro Pro Ala Pro Pro Gly Ala Gly Gly Leu Thr Val
130 135 140
Tyr Leu Ala Gly Gly Gln Gly Gln Val Val Gly Gly Asn Val Ala Gly
145 150 155 160
Ser Leu Ile Ala Ser Gly Pro Val Val Leu Met Ala Ala Ser Phe Ala
165 170 175
Asn Ala Val Tyr Asp Arg Leu Pro Ile Glu Glu Glu Glu Thr Pro Pro
180 185 190
Pro Arg Thr Thr Gly Val Gln Gln Gln Gln Pro Glu Ala Ser Gln Ser
195 200 205
Ser Glu Val Thr Gly Ser Gly Ala Gln Ala Cys Glu Ser Asn Leu Gln
210 215 220
Gly Gly Asn Gly Gly Gly Gly Val Ala Phe Tyr Asn Leu Gly Met Asn
225 230 235 240
Met Asn Asn Phe Gln Phe Ser Gly Gly Asp Ile Tyr Gly Met Ser Gly
245 250 255
Gly Ser Gly Gly Gly Gly Gly Gly Ala Thr Arg Pro Ala Phe
260 265 270
<210> 49
<211> 1281
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (8)..(904)
<223> 61435
<400> 49
gtgaaac atg ggg aag gaa gtt atg gtg agc gat tac ggt gac gac gac 49
Met Gly Lys Glu Val Met Val Ser Asp Tyr Gly Asp Asp Asp
1 5 10
gga gaa gac gcc ggc ggc ggc gat gaa tat agg att ccg gaa tgg gaa 97
Gly Glu Asp Ala Gly Gly Gly Asp Glu Tyr Arg Ile Pro Glu Trp Glu
15 20 25 30
att ggt tta ccc aac gga gat gat ttg act ccg tta tct caa tat cta 145
Ile Gly Leu Pro Asn Gly Asp Asp Leu Thr Pro Leu Ser Gln Tyr Leu
35 40 45
Page 56
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
gtcccgtcgatt ctcgcgtta getttcagc atgatccca gaacgaagc 193
ValProSerIle LeuAlaLeu AlaPheSer MetIlePro GluArgSer
50 55 60
cgtacaattcac gacgtcaat cgcgcgtcg caaatcacg ctctcttcg 241
ArgThrIleHis AspValAsn ArgAlaSer GlnIleThr LeuSerSer
65 70 75
ttgagaagcagt accaatget tcgtctgtg atggaggag gtcgtggat 289
LeuArgSerSer ThrAsnAla SerSerVal MetGluGlu ValValAsp
80 85 90
cgagttgaatcg agtgttcca ggatcagat ccgaagaaa cagaagaaa 337
ArgValGluSer SerValPro GlySerAsp ProLysLys GlnLysLys
95 100 105 110
tcggatggtggt gaagcagcg gcggtggag gattccacg gcggaggaa 385
SerAspGlyGly GluAlaAla AlaValGlu AspSerThr AlaGluGlu
115 120 125
ggagactccggg cctgaagac gcgtctggg aagacatcg aaacgaccg 433
GlyAspSerGly ProGluAsp AlaSerGly LysThrSer LysArgPro
130 135 140
cgtttagtgtgg acaccgcag ctacacaag agatttgtg gacgttgtg 481
ArgLeuValTrp ThrProGln LeuHisLys ArgPheVal AspValVal
145 150 155
getcatctaggg attaaaaac gcagtgccg aagacgatt atgcagctg 529
AlaHisLeuGly IleLysAsn AlaValPro LysThrIle MetGlnLeu
160 165 170
atgaacgtggaa ggacttact cgtgagaac gttgcgtct catttgcag 577
MetAsnValGlu GlyLeuThr ArgGluAsn ValAlaSer HisLeuGln
175 180 185 190
aaatataggctt taccttaaa cggattcaa ggattgacg acggaagaa 625
LysTyrArgLeu TyrLeuLys ArgIleGln GlyLeuThr ThrGluGlu
195 200 205
gatccttattcg tcgtcggat cagctcttc tcttcaacg ccggttcct 673
AspProTyrSer SerSerAsp GlnLeuPhe SerSerThr ProValPro
210 215 220
ccacagagcttt caagacggc ggaggaagt aacggaaag ttgggggtt 721
ProGlnSerPhe GlnAspGly GlyGlySer AsnGlyLys LeuGlyVal
225 230 235
ccggttccggtt ccgtcgatg gtgcctatt ccaggctat gggaatcaa 769
ProValProVal ProSerMet ValProIle ProGlyTyr GlyAsnGln
240 245 250
atgggtatgcaa ggatattat caacagtat agtaaccat ggcaatgaa 817
MetGlyMetGln GlyTyrTyr GlnGlnTyr SerAsnHis GlyAsnGlu
255 260 265 270
tcaaaccaatat atgatgcag cagaataag tttggaaca atggtgaca 865
SerAsnGlnTyr MetMetGln GlnAsnLys PheGlyThr MetValThr
275 280 285
tatccttctgtt ggtggtggt gacgtgaat gacaagtaa atggatctta 914
TyrProSerVal GlyGlyGly AspValAsn AspLys
290 295
Page 57
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
aaggtctataatttgctctacagagagatactggttcttggcttatggtttattttccca974
cttcatgaggttgttgtgacttttaattctccatgttttccacacaagtctttattgcct1034
ttgtatagaaaatgatttcgagaaaatcactgggaagcttggtattgttggaggatgaag1094
ccttctatgaatgatttagtttcctactgtctccattctttatgaggtaataaagccttc1154
ttttgctcatcgcttgtagtcttcttaaattcaagacagcgtcacatgtttgttcggtta1214
tgttaattgtttctttctttggataatgaagatagcatcaggtctcatgtctcctcactt1274
tgataaa 1281
<210> 50
<211> 298
<212> PRT
<213> Arabidopsis thaliana
<400> 50
Met Gly Lys Glu Val Met Val Ser Asp Tyr Gly Asp Asp Asp Gly Glu
1 5 10 15
Asp Ala Gly Gly Gly Asp Glu Tyr Arg Ile Pro Glu Trp Glu Ile Gly
20 25 30
Leu Pro Asn Gly Asp Asp Leu Thr Pro Leu Ser Gln Tyr Leu Val Pro
35 40 45
Ser Ile Leu Ala Leu Ala Phe Ser Met Ile Pro Glu Arg Ser Arg Thr
50 55 60
Ile His Asp Val Asn Arg Ala Ser Gln Ile Thr Leu Ser Ser Leu Arg
65 70 75 80
Ser Ser Thr Asn Ala Ser Ser Val Met Glu Glu Val Val Asp Arg Val
85 90 95
Glu Ser Ser Val Pro Gly Ser Asp Pro Lys Lys Gln Lys Lys Ser Asp
100 105 110
Gly Gly Glu Ala Ala Ala Val Glu Asp Ser Thr Ala Glu Glu Gly Asp
115 120 125
Ser Gly Pro Glu Asp Ala Ser Gly Lys Thr Ser Lys Arg Pro Arg Leu
130 135 140
Val Trp Thr Pro Gln Leu His Lys Arg Phe Val Asp Val Val Ala His
145 150 155 160
Page 58
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Leu Gly Ile Lys Asn Ala Val Pro Lys Thr Ile Met Gln Leu Met Asn
165 170 175
Val Glu Gly Leu Thr Arg Glu Asn Val Ala Ser His Leu Gln Lys Tyr
180 185 190
Arg Leu Tyr Leu Lys Arg Ile Gln Gly Leu Thr Thr Glu Glu Asp Pro
195 200 205
Tyr Ser Ser Ser Asp Gln Leu Phe Ser Ser Thr Pro Val Pro Pro Gln
210 215 220
Ser Phe Gln Asp Gly Gly Gly Ser Asn Gly Lys Leu Gly Val Pro Val
225 230 235 240
Pro Val Pro Ser Met Val Pro Ile Pro Gly Tyr Gly Asn Gln Met Gly
245 250 255
Met Gln Gly Tyr Tyr G1n Gln Tyr Ser Asn His Gly Asn Glu Ser Asn
260 265 270
Gln Tyr Met Met Gln Gln Asn Lys Phe Gly Thr Met Val Thr Tyr Pro
275 280 285
Ser Val Gly Gly Gly Asp Val Asn Asp Lys
290 295
<210> 51
<211> 837
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (54) . . (629)
<223> 6180
<400> 51
gtaattacga tctacaacaa cgtcgacgac gattcaagag
aatatg 56
gtgacatcgt
Met
1
aacttcctcgtt ccttttgaa gaaaccaat ttaacc tttttctct 104
gtc
AsnPheLeuVal ProPheGlu GluThrAsn LeuThr PhePheSer
Val
5 10 15
tcttcttcttcc tcttctctt tcttctcct ttcccc attcacaac 152
tct
SerSerSerSer SerSerLeu SerSerPro PhePro IleHisAsn
Ser
20 25 30
tcttcctccact actactact catgcacct gggttt tctaataat 200
cta
SerSerSerThr ThrThrThr HisAlaPro GlyPhe SerAsnAsn
Leu
35 40 45
Page 59
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
cttcagggt ggagga cccttgggatca aaggtggtt aatgatgat cag 248
LeuGlnGly GlyGly ProLeuGlySer LysValVal AsnAspAsp Gln
50 55 60 65
gagaatttt ggaggt ggaactaacaat gatgetcat tctaattct tgg 296
GluAsnPhe GlyGly GlyThrAsnAsn AspAlaHis SerAsnSer Trp
70 75 80
tggagatca aatagt ggaagtggagat atgaagaac aaagtgaag ata 344
TrpArgSer AsnSer GlySerGlyAsp MetLysAsn LysValLys Ile
85 90 95
aggaggaaa ctaaga gagccaagattc tgtttccaa accaaaagc gat 392
ArgArgLys LeuArg GluProArgPhe CysPheGln ThrLysSer Asp
100 105 110
gttgatgtt cttgac gatggctacaaa tggcgtaaa tatggtcag aaa 440
ValAspVal LeuAsp AspGlyTyrLys TrpArgLys TyrGlyGln Lys
115 120 125
gtcgtcaag aacagc cttcaccccagg agttattac agatgcaca cac 488
ValValLys AsnSer LeuHisProArg SerTyrTyr ArgCysThr His
130 135 140 145
aacaactgt agggtg aaaaagagagtg gagcgacta tcggaagat tgt 536
AsnAsnCys ArgVal LysLysArgVal GluArgLeu SerGluAsp Cys
150 155 160
agaatggtg attact acttacgaaggt cgtcacaac cacattccc tct 584
ArgMetVal IleThr ThrTyrGluGly ArgHisAsn HisIlePro Ser
165 170 175
gatgactcc acttct cctgaccatgat tgtctctct tccttttaa 629
AspAspSer ThrSer ProAspHisAsp CysLeuSer SerPhe
180 185 190
catctctttc tatatatcta tatatagaca gttatatgtg cacatataga tgtgtgatat 689
attgcatatt tgatattgca tgtgtttttc aagagtatgt catcagatgt tatgcatata 749
ttcttgactt gttgcttata gtatacatat gtaataatat atattgacat tggtagttca 809
tttctgttca aacaaaaaaa aaaaaaaa 837
<210> 52
<211> 191
<212> PRT
<213> Arabidopsis thaliana
<400> 52
Met Asn Phe Leu Val Pro Phe Glu Glu Thr Asn Val Leu Thr Phe Phe
1 5 10 I5
Ser Ser Ser Ser Ser Ser Ser Leu Ser Ser Pro Ser Phe Pro Ile His
20 25 30
Asn Ser Ser Ser Thr Thr Thr Thr His Ala Pro Leu Gly Phe Ser Asn
35 40 45
Page 60
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Asn Leu Gln Gly Gly Gly Pro Leu Gly Ser Lys Val Val Asn Asp Asp
50 55 60
Gln Glu Asn Phe Gly Gly Gly Thr Asn Asn Asp Ala His Ser Asn Ser
65 70 75 80
Trp Trp Arg Ser Asn Ser Gly Ser Gly Asp Met Lys Asn Lys Val Lys
85 90 95
Ile Arg Arg Lys Leu Arg Glu Pro Arg Phe Cys Phe Gln Thr Lys Ser
100 105 110
Asp Val Asp Val Leu Asp Asp Gly Tyr Lys Trp Arg Lys Tyr Gly Gln
115 120 125
Lys Val Val Lys Asn Ser Leu His Pro Arg Ser Tyr Tyr Arg Cys Thr
130 135 140
His Asn Asn Cys Arg Val Lys Lys Arg Val Glu Arg Leu Ser Glu Asp
145 150 155 160
Cys Arg Met Val Ile Thr Thr Tyr Glu Gly Arg His Asn His Ile Pro
165 170 175
Ser Asp Asp Ser Thr Ser Pro Asp His Asp Cys Leu Ser Ser Phe
180 185 190
<210> 53
<211> 1413
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (121)..(1200)
<223> 6592
<400> 53
aagctat taagatttggttt tgttcttcct gaaacgtcac gagacagagc
60
tctacaaatt
ttacaag aagagaaaacaga ttgcattttt tttacatatt gattcgatta
120
ggaaatttcg
atg gat tcaaat aatcatctc tacgacccg cccacc gggtcgggt 168
aat
Met Asp SerAsn AsnHisLeu TyrAspPro ProThr GlySerGly
Asn
' 1 5 10 15
.
ctt ctt cgtttt agatcaget ccgagctct ctcgcc gettttgtt 216
gtt
Leu Leu ArgPhe ArgSerAla ProSerSer LeuAla AlaPheVal
Val
20 25 30
gac gac gacaag attggtttc gactccgat ttgctt tcaagattc 264
agg
Page 61
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI -0021.txt
AspAspAspLys IleGlyPhe AspSerAsp ArgLeuLeu SerArgPhe
35 40 45
gtgacctctaat ggcgttaac ggagatctg ggttcacct aaattcgag 312
ValThrSerAsn GlyValAsn GlyAspLeu GlySerPro LysPheGlu
50 55 60
gataagtctccg gtttcgtta acgaacacc tctgtttca tacgccgcc 360
AspLysSerPro ValSerLeu ThrAsnThr SerValSer TyrAlaAla
65 70 75 80
actctgccgcca ccgccgcag cttgagccg tcgagtttt ctgggtttg 408
ThrLeuProPro ProProGln LeuGluPro SerSerPhe LeuGlyLeu
8 5 90 95
ccgccgcattac ccgaggcag agtaaaggg ataatgaac tcggttggt 456
ProProHisTyr ProArgGln SerLysGly IleMetAsn SerValGly
100 105 110
ttggatcagttt ctcggtatc aataatcat cacaccaaa ccagttgaa 504
LeuAspGlnPhe LeuGlyIle AsnAsnHis HisThrLys ProValGlu
115 120 125
tctaatcttctc cgtcaaagc agctctcca gccggaatg tttactaat 552
SerAsnLeuLeu ArgGlnSer SerSerPro AlaGlyMet PheThrAsn
130 135 140
ctctctgaccaa aacggttat ggttcaatg aggaatttg atgaattac 600
LeuSerAspGln AsnGlyTyr GlySerMet ArgAsnLeu MetAsnTyr
145 150 155 160
gaagaagatgaa gagagtcca tctaattcc aatggatta agacgccat 648
GluGluAspGlu GluSerPro SerAsnSer AsnGlyLeu ArgArgHis
165 170 175
tgcagtctctct tcaaggcca ccttcttca cttggaatg ctttctcaa 696
CysSerLeuSer SerArgPro ProSerSer LeuGlyMet LeuSerGln
180 185 190
atacctgaaatc gcacccgaa actaatttt ccatatagc cattggaat 744
IleProGluIle AlaProGlu ThrAsnPhe ProTyrSer HisTrpAsn
195 200 205
gatccatccagc tttattgat aacttatcc tcacttaaa agagaagcc 792
AspProSerSer PheIleAsp AsnLeuSer SerLeuLys ArgGluAla
210 215 220
gaggacgatgga aaattgttt ctcggaget cagaacgga gagtccggg 840
GluAspAspGly LysLeuPhe LeuGlyAla GlnAsnGly GluSerGly
225 230 235 240
aatcgtatgcag ttactgtcg catcatttg agcctacca aagtcatca 888
AsnArgMetGln LeuLeuSer HisHisLeu SerLeuPro LysSerSer
245 250 255
tcgacagcctcg gacatggtt tcagtggat aagtatctt cagctacaa 936
SerThrAlaSer AspMetVal SerValAsp LysTyrLeu GlnLeuGln
260 265 270
gattctgttcct tgtaaaatc agagccaaa cgtggttgc getacacat 984
AspSerValPro CysLysIle ArgAlaLys ArgGlyCys AlaThrHis
275 280 285
Page 62
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
cct cga atc getgaa cgggta agaaga cgg.ata gag cga 1032
agc acg agc
Pro Arg Ile AlaGlu ArgVal ArgArg Arg Ile Glu Arg
Ser Thr Ser
290 295 300
atg agg tta caagag cttgtt cctaac gac aag acc aac 1080
aag atg caa
Met Arg Leu GlnGlu LeuVal ProAsn Asp Lys Thr Asn
Lys Met Gln
305 310 315 320
act tcg atg ttggat ttaget gtggat atc aaa tta caa 1128
gat tac gat
Thr Ser Met LeuAsp LeuAla ValAsp Ile Lys Leu Gln
Asp Tyr Asp
325 330 335
aga cag aag atttta aacgac aacaga aac tgt tgt atg 1176
tat get aag
Arg Gln Lys IleLeu AsnAsp AsnArg Asn Cys Cys Met
Tyr Ala Lys
340 345 350
aac aag aag aagtca atatag ggcgcaacaa agtgtgtagtgataggact 1230
gag a
Asn Lys Lys LysSer Ile
Glu
355
aaaaagcagg aatgtcatgt ctgaatattttttagccgaa 1290
gagaaggaca
agaaagaaac
acagaccaaattgtctatgt gaaaagcatc tgcttccaacaaaattctaa
1350
aagctctcga
gtaataaaatagtactcgat ttcattatta caatgcagaatctactaatc
1410
ttgttcttat
aaa 1413
<210>
54
<211>
359
<212>
PRT
<213> idopsis
Arab thaliana
<400> 54
Met Asp Ser Asn Asn His Leu Tyr Asp Pro Asn Pro Thr Gly Ser Gly
1 5 10 15
Leu Leu Arg Phe Arg Ser Ala Pro Ser Ser Val Leu Ala Ala Phe Val
20 25 30
Asp Asp Asp Lys Ile Gly Phe Asp Ser Asp Arg Leu Leu Ser Arg Phe
35 40 45
Val Thr Ser Asn Gly Val Asn Gly Asp Leu Gly Ser Pro Lys Phe Glu
50 55 60
Asp Lys Ser Pro Val Ser Leu Thr Asn Thr Ser Val Ser Tyr Ala Ala
65 70 75 80
Thr Leu Pro Pro Pro Pro Gln Leu Glu Pro Ser Ser Phe Leu Gly Leu
85 90 95
Pro Pro His Tyr Pro Arg Gln Ser Lys Gly Ile Met Asn Ser Val Gly
100 105 110
Page 63
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Leu Asp Gln Phe Leu Gly Ile Asn Asn His His Thr Lys Pro Val Glu
115 120 125
Ser Asn Leu Leu Arg Gln Ser Ser Ser Pro Ala Gly Met Phe Thr Asn
130 135 140
Leu Ser Asp Gln Asn Gly Tyr Gly Ser Met Arg Asn Leu Met Asn Tyr
145 150 155 160
Glu Glu Asp Glu Glu Ser Pro Ser Asn Ser Asn Gly Leu Arg Arg His
165 170 175
Cys Ser Leu Ser Ser Arg Pro Pro Ser Ser Leu Gly Met Leu Ser Gln
180 185 190
Ile Pro Glu Ile Ala Pro Glu Thr Asn Phe Pro Tyr Ser His Trp Asn
195 200 205
Asp Pro Ser Ser Phe Ile Asp Asn Leu Ser Ser Leu Lys Arg Glu Ala
210 215 220
Glu Asp Asp Gly Lys Leu Phe Leu Gly Ala Gln Asn Gly Glu Ser Gly
225 ~ 230 235 240
Asn Arg Met Gln Leu Leu Ser His His Leu Ser Leu Pro Lys Ser Ser
245 250 255
Ser Thr Ala Ser Asp Met Val Ser Val Asp Lys Tyr Leu Gln Leu Gln
260 265 270
Asp Ser Val Pro Cys Lys Ile Arg Ala Lys Arg Gly Cys Ala Thr His
275 280 285
Pro Arg Ser Ile Ala Glu Arg Val Arg Arg Thr Arg Ile Ser Glu Arg
290 295 300
Met Arg Lys Leu Gln Glu Leu Val Pro Asn Met Asp Lys Gln Thr Asn
305 310 315 320
Thr Ser Asp Met Leu Asp Leu Ala Val Asp Tyr Ile Lys Asp Leu Gln
325 330 335
Arg Gln Tyr Lys Ile Leu Asn Asp Asn Arg Ala Asn Cys Lys Cys Met
340 345 350
Asn Lys Glu Lys Lys Ser Ile
355
Page 64
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
<210> 55
<211> 764
<212> DNA
<213> Arabidopsis thaliana
<220>
<221> CDS
<222> (15) . . (725)
<223> 6208
<400>
55
cttcttcatt caccatggga agatctccttgt tgtgaa aaagetcac aca 50
MetGly ArgSerProCys CysGlu LysAlaHis Thr
1 5 10
aacaaaggaget tggact aaagaagaagat caacgt ctcgtagat tat 98
AsnLysGlyAla TrpThr LysGluGluAsp GlnArg LeuValAsp Tyr
15 20 25
atccgtaatcac ggtgaa ggttgttggcgt tctctt cctaaatcc get 146
IleArgAsnHis GlyGlu GlyCysTrpArg SerLeu ProLysSer Ala
30 35 40
ggattgttgcgt tgtggt aaaagttgtaga ttgaga tggattaat tac 194
GlyLeuLeuArg CysGly LysSerCysArg LeuArg TrpIleAsn Tyr
45 50 55 60
cttcgtcctgat cttaaa cgtggtaatttt actgat gatgaagat caa 242
LeuArg'ProAsp LeuLys ArgGlyAsnPhe ThrAsp AspGluAsp Gln
65 70 75
atcatcatcaaa ctccat agcttactcggt aacaaa tggtcattg ata 290
IleIleIleLys LeuHis SerLeuLeuGly AsnLys TrpSerLeu Ile
80 85 90
getggaagatta ccagga agaacagataac gaaata aagaattat tgg 338
AlaGlyArgLeu ProGly ArgThrAspAsn GluIle LysAsnTyr Trp
95 100 105
aacactcatatt aagagg aagcttcttagt cacggt attgatcca caa 386
AsnThrHisIle LysArg LysLeuLeuSer HisGly IleAspPro Gln
110 115 120
actcatcgtcag attaac gaatccaaaacg gtgtcg tctcaagtt gtt 434
ThrHisArgGln IleAsn GluSerLysThr ValSer SerGlnVal Val
125 130 135 140
gttcctattcaa aacgat gccgttgagtat tctttt tccaattta gcc 482
ValProIleGln AsnAsp AlaValGluTyr SerPhe SerAsnLeu Ala
145 150 155
gttaaaccgaag acggaa aattcctccgat aacgga gettcgact agc 530
ValLysProLys ThrGlu AsnSerSerAsp AsnGly AlaSerThr Ser
160 165 170
ggcacgacgacg gacgag gatctccggcag aatggg gagtgttat tat 578
GlyThrThrThr AspGlu AspLeuArgGln AsnGly GluCysTyr Tyr
175 180 185
agtgataattca ggacat ataaagctgaat ttggat ttaactctt ggg 626
P age65
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Ser Asp Asn Ser Gly His Ile Lys Leu Asn Leu Asp Leu Thr Leu Gly
190 195 200
ttt gga tcc tgg tcg ggt cgg ata gtc gga gtc ggg tca tcg get gat 674
Phe Gly Ser Trp Ser Gly Arg Ile Val Gly Val Gly Ser Ser Ala Asp
205 210 215 220
tct aaa ccg tgg tgc gac ccg gtg atg gag gcg cgt ttg tca ctg ttg 722
Ser Lys Pro Trp Cys Asp Pro Val Met Glu Ala Arg Leu Ser Leu Leu
225 230 235
taa taatttgtca aaaaaatccc aaaaaatggg tttgttaaa 764
<210> 56
<211> 236
<212> PRT
<213> Arabidopsis thaliana
<400> 56
Met Gly Arg Ser Pro Cys Cys Glu Lys Ala His Thr Asn Lys Gly Ala
1 5 . 10 15
Trp Thr Lys Glu Glu Asp Gln Arg Leu Val Asp Tyr Ile Arg Asn His
20 25 30
Gly Glu Gly Cys Trp Arg Ser Leu Pro Lys Ser Ala Gly Leu Leu Arg
35 40 45
Cys Gly Lys Ser Cys Arg Leu Arg Trp Ile Asn Tyr Leu Arg Pro Asp
50 55 60
Leu Lys Arg Gly Asn Phe Thr Asp Asp Glu Asp Gln Ile Ile Ile Lys
65 70 75 80
Leu His Ser Leu Leu Gly Asn Lys Trp Ser Leu Ile Ala Gly Arg Leu
85 90 95
Pro Gly Arg Thr Asp Asn Glu Ile Lys Asn Tyr Trp Asn Thr His Ile
100 105 110
Lys Arg Lys Leu Leu Ser His Gly Ile Asp Pro Gln Thr His Arg Gln
115 120 125
Ile Asn Glu Ser Lys Thr Val Ser Ser Gln Val Val Val Pro Ile Gln
130 135 140
Asn Asp Ala Val Glu Tyr Ser Phe Ser Asn Leu Ala Val Lys Pro Lys
145 150 155 160
Thr Glu Asn Ser Ser Asp Asn Gly Ala Ser Thr Ser Gly Thr Thr Thr
165 170 175
Page 66
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
Asp Glu Asp Leu Arg Gln Asn Gly Glu Cys Tyr Tyr Ser Asp Asn Ser
180 185 190
Gly His Ile Lys Leu Asn Leu Asp Leu Thr Leu Gly Phe Gly Ser Trp
195 200 205
Ser Gly Arg Ile Val Gly Val Gly Ser Ser Ala Asp Ser Lys Pro Trp
210 215 220
Cys Asp Pro Val Met Glu Ala Arg Leu Ser Leu Leu
225 230 235
<210> 57
<211> 28
<212> DNA
<213> synthetic oligonucleotide
<220>
<221> misc_feature
<222> () . . ()
<223> 025908
<400> 57
ggcataaccc ttatcggaga tttgaagc 28
<210> 58
<211> 28
<212> DNA
<213> synthetic oligonucleotide
<220>
<221> misc_feature
<222> () .. ()
<223> 025910
<400> 58
acacaaactc tgatcttgtc tccgaagg 28
<210> 59
<211> 30
<212> DNA
<213> synthetic oligonucleotide
<220>
<221> misc_feature
<222> () . . ()
<223> 028990
<400> 59
gcataaccct tatcggagat ttgaagccat 30
Page 67
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
<210> 60
<211> 30
<212> DNA
<213> synthetic oligonucleotide
<220>
<221> misc feature
<222> () . . ()
<223> 028991
MBI-0021.txt
<400> 60
aacattcctc tctcatcatc tgttgccagc 30
<210> 61
<211> 28
<212> DNA
<213> synthetic oligonucleotide
<220>
<221> misc_feature
<222> () . . ()
<223> 025907
<400> 61
aacgcttagt atctccggcg acttgaac 28
<210> 62
<211> 28
<212> DNA
<213> synthetic oligonucleotide
<220>
<221> misc_feature
<222> () . . ()
<223> 025909
<400> 62
ctcacacgaa taaggtacaa agttcatc 28
<210> 63
<211> 30
<212> DNA
<213> synthetic oligonucleotide
<400> 63
ttagtatctc cggcgacttg aacccaaacc 30
<210> 64
<211> 30
<212> DNA
<213> synthetic oligonucleotide
<220>
<221> misc_feature
<222> () .. ()
<223> 028985
Page 68
CA 02386170 2002-04-12
WO 01/26459 PCT/US00/28141
MBI-0021.txt
<400> 64
agattctcaa caagcttcaa catgagttcg 30
Page 69
