Note: Descriptions are shown in the official language in which they were submitted.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-1-
Human Chemokine Beta-13
Field of the Invention
The present invention relates to a novel human gene encoding a polypeptide
which is a member of the chemokine family. More specifically, isolated nucleic
acid
molecules are provided encoding a human polypeptide named Human Chemokine
Beta-13, hereinafter referred to as "CK(3-13." Polypeptides are also provided,
as are
vectors, host cells and recombinant methods for producing the same. Also
provided
are diagnostic methods for detecting disorders related to the immune system,
and
therapeutic methods for treating such disorders. The invention further relates
to
screening methods for identifying agonists and antagonists of CK~3-I3
activity.
Background of the Invention
Chemokines, also referred to as intercrine cytokines, are a subfamily of
structurally and functionally related cytokines. These molecules are 8-10 kd
in size.
in general, chemokines exhibit 20% to 75% homology at the amino acid level and
are characterized by four conserved cysteine residues that form two disulfide
bonds.
Based on the arrangement of the first two cysteine residues, chemokines have
been
classified into two subfamilies, alpha and beta. In the alpha subfamily, the
first two
cysteines are separated by one amino acid and hence are referred to as the "C-
X-C"
subfamily. In the beta subfamily, the two cysteines are in an adjacent
position and
are, therefore, referred to as the "C-C" subfamily. Thus far, at least nine
different
members of this family have been identified in humans.
The intercrine cytokines exhibit a wide variety of functions. A hallmark
feature is their ability to elicit chemotactic migration of distinct cell
types, including
monocytes, neutrophils, T lymphocytes, basophils, and fibroblasts. Many
chemokines have proinflammatory activity and are involved in multiple types
during
an inflammatory reaction. These activities include stimulation of histamine
release,
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-2-
lysosomal enzyme and leukotriene release, increased adherence of target immune
cells to endothelial cells, enchanted binding of complement proteins, induced
expression of granulocyte adhesion molecules and complement receptors, and
respiratory burst. In addition to their involvment in inflammation, certain
chemokines
have been shown to exhibit other activities. For example, macrophage
inflammatory
protein-1 (MIP-1) is able to suppress hematopoietic stem cell proliferation,
platelet
factor-4 (PF-4) is a potent inhibitor of endothelial cell growth, interleukin-
8 (IL-8)
promotes proliferation of keratinocytes, and GRO is an autocrine growth factor
for
melanoma cells.
In light of the diverse biological activities, it is not surprising that
chemokines
have been implicated in a number of physiological and disease conditions,
including
lymphocyte trafficking, wound healing, hematopoietic regulation and
immunological
disorders such as allergy, asthma and arthritis.
Members of the "C-C" branch exert their effects on the following cells:
eosinophils which destroy parasites to lessen parasitic infection and cause
chronic
inflammation in the airways of the respiratory system; monocytes and
macrophages
which suppress tumor formation in vertebrates; T lymphocytes which attract T
cells
and basophils which release histamine which plays a role in allergic
inflammation.
While members of the C-C branch act predominately on mononuclear cells
and members of the C-X-C branch act predominantly on neutorphils a distinct
chemoattractant property cannot be assigned to a chemokine based on this
guideline.
Some chemokines from one family show characteristics of the other.
The polypeptide of the present invention has the conserved cysteine "C-C"
region, and has amino acid sequence homology to other known chemokines.
Summary of the Invention
The present invention provides isolated nucleic acid molecules comprising a
polynucleotide encoding at least a portion of the CK(3-13 polypeptide having
the
complete amino acid sequence shown in SEQ ID N0:2 or the complete amino acid
sequence encoded by the cDNA clone deposited in a bacterial host as ATCC
Deposit
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-3-
Number 97113 on April 28, 1995. 'The nucleotide sequence determined by
sequencing the deposited CK(3-13 clone, which is shown in Figure 1 (SEQ ll~
NO:1),
contains an open reading frame encoding a complete polypeptide of 93 amino
acid
residues, including an initiation codon encoding an N-terminal methionine at
nucleotide positions 1-3 .
The polypeptide of the present invention has amino acid sequence homology
to known chemokines, including the conserved cysteine pattern characteristic
of the
beta subfamily of chemokines beginning with the first cysteine from the amino
terminus in SEQ 1D N0:2.
The encoded polypeptide has two observed leader sequences of 24 and 28
amino acids; and the amino acid sequence of the observed mature CK~i-13
proteins
are also shown in Figure 1 (SEQ 1D N0:2), as amino acid residues 25-93 and 29-
93.
Thus, one aspect of the invention provides an isolated nucleic acid molecule
comprising a polynucleotide having a nucleotide sequence selected from the
group
i5 consisting of {a) a nucleotide sequence encoding the CK(3-13 polypeptide
having
the complete amino acid sequence in SEQ >D N0:2; (b) a nucleotide sequence
encoding the observed mature CK~3-13 polypeptide having the amino acid
sequence
at positions 25-93 in SEQ >D N0:2; {c) a nucleotide sequence encoding the
observed mature CK~3-13 polypeptide having the amino acid sequence at
positions
29-93 in SEQ m N0:2; (d) a nucleotide sequence encoding the CKj3-13
polypeptide
having the complete amino acid sequence encoded by the cDNA clone contained in
ATCC Deposit No. 97113; (e) a nucleotide sequence encoding a mature CKJ3-13
polypeptide having the amino acid sequence encoded by the cDNA clone contained
in ATCC Deposit No. 97113; and (f) a nucleotide sequence complementary to any
of
the nucleotide sequences in (a), (b), (c), (d) or (e) above.
. An additional embodiment of this aspect of the invention relates to a
peptide
or polypeptide which comprises the amino acid sequence of an epitope-bearing
portion of a CK(3-13 polypeptide having an amino acid sequence described in
(a), (b),
(c), (d) or (e), above. Peptides or polypeptides having the amino acid
sequence of an
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-4-
epitope-bearing portion of a CK~i-13 polypeptide of the invention include
portions of
such polypeptides with at least six or seven, preferably at least nine, and
more
preferably at least about 30 amino acids to about 50 amino acids, although
epitope-bearing polypeptides of any length up to and including the entire
amino acid
sequence of a polypeptide of the invention described above also are included
in the
invention.
In another embodiment, the invention provides an isolated antibody that binds
specifically to a CK~i-13 polypeptide having an amino acid sequence described
in (a),
(b), (c), (d) or (e) above. The invention further provides methods for
isolating
antibodies that bind specifically to a CK~i-13 polypeptide having an amino
acid
sequence as described herein. Such antibodies are useful diagnostically or
therapeutically as described below.
The invention also provides for pharmaceutical compositions comprising
CK(3-13 polypeptides, particularly human CK~i-13 polypeptides, which may be
employed, for instance, to treat solid tumors, chronic infections, leukemia, T-
cell
mediated auto-immune diseases, parasistic infections, psoriasis, to regulate
hematopoiesis, to stimulate growth factor activity, to treat fibrotic
disorders, to
inhibit angiogenesis and to promote wound healing. CK(3-13 may also be
employed
to treat sepsis and is useful for immune enhancement or suppression,
myeloprotection, and acute and chronic inflammatory control.
Methods of treating individuals in need CK(3-13 polypeptides are also
provided.
The invention further provides compositions comprising a CK~i-13
polynucleotide or a CK~i-13 polypeptide for administration to cells in vitro,
to cells
ex vivo and to cells in vivo, or to a multicellular organism. In certain
particularly
preferred embodiments of this aspect of the invention, the compositions
comprise a
CK(3-13 polynucleotide for expression of a CK~i-13 polypeptide in a host
organism
for treatment of disease. Particularly preferred in this regard is expression
in a human
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-5-
patient for treatment of a dysfunction associated with aberrant endogenous
activity of
a CK(3-13.
In another aspect, a screening assay for agonists and antagonists is provided
which involves determining the effect a candidate compound has on CK(3-13
binding
to a CK[3-13 receptor. In particular, the method involves contacting the CK(3-
13
receptor with a CK(3-13 polypeptide and a candidate compound and determining
whether CK~i-13 polypeptide binding to the CKa-13 is increased or decreased
due to
the presence of the candidate compound. In this assay, an increase in binding
of
CK(3-13 over the standard binding indicates that the candidate compound is an
agonist of CK(3-13 binding activity and a decrease in CK(3-13 binding compared
to
the standard indicates that the compound is an antagonist of CK~i-13 binding
activity.
It has been discovered that CK(3-13 is expressed not only in monocytes but
also in activated dendritic cells. For a number of disorders of these tissues
or cells,
particularly of the immune system, significantly higher or lower levels of
CK(3-I3
gene expression may be detected in certain tissues (e.g., cancerous and
wounded
tissues) or bodily fluids (e.g., serum, plasma, urine, synovial fluid or
spinal fluid)
taken from an individual having such a disorder, relative to a "standard" CK(3-
13
gene expression level, i.e., the CK(3-13 expression level in healthy tissue
from an
individual not having the immune system disorder. Thus, the invention provides
a
diagnostic method useful during diagnosis of such a disorder, which involves:
(a)
assaying CKj3-13 gene expression level in cells or body fluid of an
individual; (b)
comparing the CKj3-13 gene expression level with a standard CK~i-13 gene
expression level, whereby an increase or decrease in the assayed CK~3-13 gene
expression level compared to the standard expression level is indicative of
disorder in
the immune.
An additional aspect of the invention is related to a method for treating an
individual in need of an increased level of CK~i-13 activity in the body
comprising
administering to such an individual a composition comprising a therapeutically
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00130237
-6-
effective amount of an isolated CK(3-13 polypeptide of the invention or an
agonist
thereof.
A still further aspect of the invention is related to a method for treating an
individual in need of a decreased level of CK~i-13 activity in the body
comprising,
administering to such an individual a composition comprising a therapeutically
effective amount of an CK[3-13 antagonist. Preferred antagonists for use in
the
present invention are CK[3-13-specific antibodies.
Brief Description of the Figures
Figure 1 shows the nucleotide sequence (SEQ B7 NO:1) and deduced amino
acid sequence (SEQ LD N0:2) of CK(3-13.
Figure 2 shows the regions of identity between the amino acid sequences of
the CK~i-13 protein and translation product of the human mRNA for monocyte
chemotactic protein-loc (MIP-loc) (lower line) (SEQ ff~ N0:3), determined by
the
computer program Bestfit (Wisconsin Sequence Analysis Package, Version 8 for
Unix, Genetics Computer Group, University Research Park, 575 Science Drive,
Madison, WI 53711) using the default parameters.
Figure 3 shows an analysis of the CK(3-13 amino acid sequence. Alpha, beta,
turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions;
flexible
regions; antigenic index and surface probability are shown, and all were
generated
using the default settings. In the "Antigenic Index or Jameson-Wolf' graph,
the
positive peaks indicate locations of the highly antigenic regions of the CK~i-
13
protein, i.e., regions from which epitope-bearing peptides of the invention
can be
obtained. The domains defined by these graphs are contemplated by the present
invention.
The data presented in Figure 3 are also represented in tabular form in Table
I.
The columns are labeled with the headings "Res", "Position", and Roman
Numerals
I-XIV. The column headings refer to the following features of the amino acid
sequence presented in Figure 3, and Table I: "Res": amino acid residue of SEQ
117
CA 02387808 2002-05-14
WO 01/32128 PCT/i1S00/30237
N0:2 and Figure 1; "Position": position of the corresponding residue within
SEQ >17
N0:2 and Figure 1; 1: Alpha, Regions - Garnier-Robson; iI: Alpha, Regions -
Chou-Fasman; III: Beta, Regions - Gamier-Robson; IV: Beta, Regions -
Chou-Fasman; V: Turn, Regions - Gamier-Robson; Vl: Turn, Regions -
Chou-Fasman; VII: Coil, Regions - Gamier-Robson; VIII: Hydrophilicity Plot -
Kyte-Doolittle; IX: Hydrophobicity Plot - Hopp-Woods; X: Alpha, Amphipathic
Regions - Eisenberg; XI: Beta, Amphipathic Regions - Eisenberg; XII: Flexible
Regions - Karplus-Schulz; XIII: Antigenic Index - Jameson-Wolf; and XIV:
Surface
Probability Plot - Emini.
Figure 4 shows the chemotactic activity of CK[3-I3 on activated T-
lymphocytes taken from 3 donors.
Figure 5 shows the effect of CK/3-13 on VLA4-VCAM-1 interactions of
CD4+ T cell subsets under flow. The top panel shows the increased accumulation
of
naive T cells with increasing levels of CK~3-13 compared to accumulation in
media
alone. The bottom panel shows a decreased memory T cell accumulation under
identical conditions.
Figure 6 shows the effect of CKp-13 co-immobilized with VCAM-1 on T cell
subsets.
Figure 7 shows the effect of CK~i-13 on CD4+ T cell subset accumulation on
(A) VCAM-1-transduced or (B) TNF-a activated HUVEC monolayers under flow:
Figure 8 shows the effect of mAb to the CK[3-13 receptor, CCR4, on T cell
subset interactions with VCAM-1.
Detailed Description
The present invention provides isolated nucleic acid molecules comprising a
polynucleotide encoding a CK(3-13 polypeptide having the amino acid sequence
shown in SEQ m N0:2, which was determined by sequencing a cloned cDNA. The
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
_g_
nucleotide sequence shown in Figure 1 (SEQ m NO:1) was obtained by sequencing
the HMSDB49 clone, which was deposited on April 28, 1995 at the American Type
Culture Collection, located at 10801 University Boulevard, Manassas, VA 20110
2209, USA, and given accession number ATCC 97113. The deposited clone is
contained in the pBluescript SK(-) plasmid (Stratagene, La Jolla, CA).
In the present invention, "isolated" refers to material removed from its
original environment (e.g., the natural environment if it is naturally
occurring), and
thus is altered "by the hand of man" from its natural state. For example, an
isolated
polynucleotide or nucleic acid could be part of a vector or a composition of
matter,
or could be contained within a cell, and still be "isolated" because that
vector,
composition of matter, or particular cell is not the original environment of
the
polynucleotide. The term "isolated" does not refer to genomic or cDNA
libraries,
whole cell total or mRNA preparations, genomic DNA preparations (including
those
separated by electrophoresis and transferred onto blots), sheared whole cell
genomic
DNA preparations or other compositions where the art demonstrates no
distinguishing features of the polynucleotide/sequences of the present
invention.
As used herein, a CK~i-13 "polynucleotide" refers to a molecule having a
nucleic acid sequence contained in SEQ ID NO:1 or the cDNA contained within
the
clone deposited with the ATCC. For example, the CK(3-13 polynucleotide can
contain the nucleotide sequence of the full length cDNA sequence, including
the 5'
and 3' untranslated sequences, the coding region, with or without the signal
sequence, the secreted protein coding region, as well as fragments, epitopes,
domains, and variants of the nucleic acid sequence. Moreover, as used herein,
a
CK[3-13 "polypeptide" refers to a molecule having the translated amino acid
sequence
generated from the polynucleotide as broadly defined.
The polypeptide of the present invention has amino acid sequence homology
to known chemokines, including the conserved cysteine pattern characteristic
of the
beta subfamily of chemokines beginning with the first cysteine from the amino
terminus in SEQ >D N0:2.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-9-
Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by
sequencing a DNA molecule herein were determined using an automated DNA
S sequencer (such as the Model 373 from Applied Biosystems, Inc., Foster City,
CA),
and all amino acid sequences of polypeptides encoded by DNA molecules
determined
herein were predicted by translation of a DNA sequence determined as above.
Therefore, as is known in the art for any DNA sequence determined by this
automated approach, any nucleotide sequence determined herein may contain some
errors. Nucleotide sequences determined by automation are typically at least
about
90% identical, more typically at least about 95% to at least about 99.9%
identical to
the actual nucleotide sequence of the sequenced DNA molecule. The actual
sequence can be more precisely determined by other approaches including manual
DNA sequencing methods well known in the art. As is also known in the art, a
single
insertion or deletion in a determined nucleotide sequence compared to the
actual
sequence will cause a frame shift in translation of the nucleotide sequence
such that
the predicted amino acid sequence encoded by a determined nucleotide sequence
will
be completely different from the amino acid sequence actually encoded by the
sequenced DNA molecule, beginning at the point of such an insertion or
deletion.
By "nucleotide sequence" of a nucleic acid molecule or polynucleotide is
intended, for a DNA molecule or polynucleotide, a sequence of
deoxyribonucleotides, and for an RNA molecule or polynucleotide, the
corresponding sequence of ribonucleotides (A, G, C and U), where each
thymidine
deoxyribonucleotide (T) in the specified deoxyribonucleotide sequence is
replaced by
the ribonucleotide uridine (LI).
Using the information provided herein, such as the nucleotide sequence in
Figure 1 (SEQ ID NO:1), a nucleic acid molecule of the present invention
encoding a
CK(3-13 polypeptide may be obtained using standard cloning and screening
procedures, such as those for cloning cDNAs using mRNA as starting material.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-10-
Illustrative of the invention, the nucleic acid molecule described in Figure 1
(SEQ >D
NO:I) was discovered in a cDNA library derived from human monocytes.
Additional clones of the same gene were also identified in cDNA libraries
from activated dendritic cells.
The determined nucleotide sequence of the CKø-13 cDNA of Figure 1 (SEQ
D7 NO: I ) contains an open reading frame encoding a protein of 93 amino acid
residues, with an initiation codon at nucleotide positions 1-3 of the
nucleotide
sequence in Figure 1 (SEQ ID NO:1). The amino acid sequence of the CKø-13
protein shown in SEQ >D N0:2 is about 33% identical to and 53% similar to
human
mRNA for MIP-la (Figure 2).
As one of ordinary skill would appreciate, due to the possibilities of
sequencing errors discussed above, the actual complete CKø-13 polypeptide
encoded
by the deposited cDNA, which comprises about 93 amino acids, may be somewhat
longer or shorter. More generally, the actual open reading frame may be
anywhere in
the range of ~20 amino acids, more likely in the range of ~10 amino acids, of
that
predicted from the first methionine codon from the N-terminus shown in Figure
1
(SEQ ID NO:1).
Leader and Mature Sequences
The amino acid sequence of the complete CKø-13 protein is shown in SEQ
ID N0:2 and includes leader sequences and mature protein(s), as described
below.
More in particular, the present invention provides nucleic acid molecules
encoding a
mature form of the CKø-13 protein. Thus, according to the signal hypothesis,
once
export of the growing protein chain across the rough endoplasmic reticulum has
been
initiated, proteins secreted by mammalian cells have a signal or secretory
leader
sequence which is cleaved from the complete polypeptide to produce a secreted
"mature" form of the protein. Most mammalian cells and even insect cells
cleave
secreted proteins with the same specificity. However, in some cases, cleavage
of a
secreted protein is not entirely uniform, which results in two or more mature
species
of the protein. Further, it has long been known that the cleavage specificity
of a
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-11-
secreted protein is ultimately determined by the primary structure of the
complete
protein, that is, it is inherent in the amino acid sequence of the
polypeptide.
Therefore, the present invention provides a nucleotide sequence encoding the
mature
CK(3-13 polypeptide having the amino acid sequence encoded by the cDNA clone
contained in the host identified as ATCC Deposit No. 97113. By the "mature
CK/3-
13 polypeptide having the amino acid sequence encoded by the cDNA clone in
ATCC Deposit No. 97113" is meant the mature forms) of the CK[3-13 protein
produced by expression in a mammalian cell (e.g., COS cells, as described
below) of
the complete open reading frame encoded by the human DNA sequence of the clone
contained in the vector in the deposited host.
In the present case, the deposited cDNA has been expressed in a baculovirus
vector in insect cells as described herein below, and amino acid sequencing of
the
amino terminus of the two secreted species indicated that the mature CKj3-13
proteins comprise amino acids 25 to 93 and 29 to 93 of SEQ ID N0:2. Thus, the
leader sequences of the CK(3-13 protein in the amino acid sequence of SEQ ID
N0:2 are 24 and 28 amino acids, respectively.
In addition, methods for predicting whether a protein has a secretory leader
as well as the cleavage point for that leader sequence are available. For
instance, the
method of McGeoch (Virus Res. 3:271-286 (1985)) uses the information from a
short N-terminal charged region and a subsequent uncharged region of the
complete
{uncleaved) protein. The method of von Heinje (Nucleic Acids Res. 14:4683-4690
(1986)) uses the information from the residues surrounding the cleavage site,
typically residues -13 to +2 where +1 indicates the amino terminus of the
mature
protein. The accuracy of predicting the cleavage points of known mammalian
secretory proteins for each of these methods is in the range of 75-80% (von
Heinje,
supra). However, the two methods do not always produce the same predicted
cleavage points) for a given protein.
As one of ordinary skill would appreciate from the above discussions, due to
the possibilities of sequencing errors as well as the variability of cleavage
sites in
different known proteins, the two mature CK(3-13 polypeptide species encoded
by
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-I2-
the deposited cDNA are expected to consist of about 65 and 69 anuno acids, but
may
consist of any number of amino acids in the range of about 58-73 amino acids;
and
the actual leader sequences of this protein are expected to be 24 and 28 amino
acids,
but may consist of any number of amino acids in the range of 20-35 amino
acids.
As indicated, nucleic acid molecules of the present invention may be in the
form of RNA, such as mRNA, or in the form of DNA, including, for instance,
cDNA
and genomic DNA obtained by cloning or produced synthetically. The DNA may be
double-stranded or single-stranded. Single-stranded DNA or RNA may be the
coding strand, also known as the sense strand, or it may be the non-coding
strand,
also referred to as the anti-sense strand.
By "isolated" nucleic acid molecules) is intended a nucleic acid molecule,
DNA or RNA, which has been removed from its native environment For example,
recombinant DNA molecules contained in a vector are considered isolated for
the
purposes of the present invention. Further examples of isolated DNA molecules
include recombinant DNA molecules maintained in heterologous host cells or
purified
(partially or substantially) DNA molecules in solution. Isolated RNA molecules
include in vivo or in vitro RNA transcripts of the DNA molecules of the
present
invention. Isolated nucleic acid molecules according to the present invention
further
include such molecules produced synthetically.
Isolated nucleic acid molecules of the present invention include DNA
molecules comprising an open reading frame (ORF) with an initiation codon at
positions I-3 of the nucleotide sequence shown in Figure 1 (SEQ ID NO:1).
Also included are DNA molecules comprising the coding sequence for the
observed mature CK(3-13 protein.
In addition, isolated nucleic acid molecules of the invention include DNA
molecules which comprise a sequence substantially different from those
described
above but which, due to the degeneracy of the genetic code, still encode the
CK(3-13
protein. Of course, the genetic code and species-specific codon preferences
are well
known in the art. Thus, it would be routine for one skilled in the art to
generate the
degenerate variants described above, for instance, to optimize codon
expression for a
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-13-
particular host {e.g., change codons in the human mRNA to those preferred by a
bacterial host such as E. coli).
In another aspect, the invention provides isolated nucleic acid molecules
encoding the CK(3-13 polypeptide having an amino acid sequence encoded by the
cDNA clone contained m the plasmid deposited as ATCC Deposit No. 97113 on
April 28, 1995. Preferably, this nucleic acid molecule will encode the mature
polypeptide encoded by the above-described deposited cDNA clone.
The invention further provides an isolated nucleic acid molecule having the
nucleotide sequence shown in Figure 1 (SEQ m NO:1) or the nucleotide sequence
of
the CK~i-13 cDNA contained in the above-described deposited clone, or a
nucleic
acid molecule having a sequence complementary to one of the above sequences.
Such isolated molecules, particularly DNA molecules, are useful as probes for
gene
mapping, by in situ hybridization with chromosomes, and for detecting
expression of
the CK(3-13 gene in human tissue, for instance, by Northern blot analysis.
The present invention is further directed to nucleic acid molecules encoding
portions of the nucleotide sequences described herein as well as to fragments
of the
isolated nucleic acid molecules described herein. In particular, the invention
provides
a polynucleotide comprising nucleotides 1 to 279 of SEQ ID N0:2.
More generally, by a fragment of an isolated nucleic acid molecule having the
nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in
Figure 1 (SEQ ID NO:1 ) is intended fragments at least about 15 nt, and more
preferably at least about 20 nt, still more preferably at least about 30 nt,
and even
more preferably, at least about 40 nt in length which are useful as diagnostic
probes
and primers as discussed herein. Of course, larger fragments 50-300 nt in
length are
also useful according to the present invention as are fragments corresponding
to
most, if not all, of the nucleotide sequence of the deposited cDNA or as shown
in
Figure 1 (SEQ )D NO:I). By a fragment at least 20 nt in length, for example,
is
intended fragments which include 20 or more contiguous bases from the
nucleotide
sequence of the deposited cDNA or the nucleotide sequence as shown in Figure 1
(SEQ >D NO:1 ). Preferred nucleic acid fragments of the present invention
include
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-14-
nucleic acid molecules encoding epitope-bearing portions of the CK(3-13
polypeptide
as identified in Figure 3 and described in more detail below.
In another aspect, the invention provides an isolated nucleic acid molecule
comprising a polynucieotide which hybridizes under stringent hybridization
conditions to a portion of the polynucleotide in a nucleic acid molecule of
the
invention described above, for instance, the cDNA clone contained in ATCC
Deposit
No. 97113. By "stringent hybridization conditions" is intended overnight
incubation
at 42° C in a solution comprising: 50% formamide, Sx SSC (750 mM NaCI,
75 mM
trisodium citrate), 50 mM sodium phosphate (pH 7.6), Sx Denhardt's solution,
10%
dextran sulfate, and 20 ltg/ml denatured, sheared salmon sperm DNA, followed
by
washing the filters in 0. lx SSC at about 65° C.
By a polynucleotide which hybridizes to a "portion" of a polynucleotide is
intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15
nucleotides (nt), and more preferably at least about 20 nt, still more
preferably at
1 S least about 30 nt, and even more preferably about 30-70 (e.g., 50) nt of
the reference
polynucleotide. These are useful as diagnostic probes and primers as discussed
above and in more detail below.
By a portion of a polynucleotide of "at least 20 nt in length," for example,
is
intended 20 or more contiguous nucleotides from the nucleotide sequence of the
reference polynucleotide (e.g., the deposited cDNA or the nucleotide sequence
as
shown in Figure 1 (SEQ m NO:1)). Of course, a polynucleotide which hybridizes
only to a poly A sequence {such as the 3' terminal poly(A) tract of the CK[3-
13
cDNA shown in Figure 1 (SEQ ID NO:1)), or to a complementary stretch of T (or
U) residues, would not be included in a polynucleotide of the invention used
to
hybridize to a portion of a nucleic acid of the invention, since such a
polynucleotide
would hybridize to any nucleic acid molecule containing a poly (A) stretch or
the
complement thereof (e.g., practically any double-stranded cDNA clone).
As indicated, nucleic acid molecules of the present invention which encode a
CK(3-13 polypeptide may include, but are not limited to those encoding the
amino
acid sequence of the mature polypeptide, by itself; the coding sequence for
the
CA 02387808 2002-05-14
WO 01/32128 PCT/US00130237
-15-
mature polypeptide and additional sequences, such as those encoding the about
20-35
amino acid leader or secretory sequence, such as a pre-, or pro- or prepro-
protein
sequence; and/or the coding sequence of the mature polypeptide, with or
without the
aforementioned additional coding sequences.
Also encoded by nucleic acids of the invention are the above protein
sequences together with additional, non-coding sequences, including for
example, but
not limited to introns and non-coding 5' and 3' sequences, such as the
transcribed,
non-translated sequences that play a role in transcription, mRNA processing,
including splicing and polyadenylation signals, for example - ribosome binding
and
stability of mRNA; and an additional coding sequence which codes for
additional
amino acids, such as those which provide additional functionalities.
Thus, the sequence encoding the polypeptide may be fused to a marker
sequence, such as a sequence encoding a peptide which facilitates purification
of the
fi~sed polypeptide. In certain preferred embodiments of this aspect of the
invention,
the marker amino acid sequence is a hexa-histidine peptide, such as the tag
provided
in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311),
among others, many of which are commercially available. As described in Gentz
et
al., Proc. Natl. Acad Sci. USA 86:821-824 (1989), for instance, hexa-histidine
provides for convenient purification of the fizsion protein. The "HA" tag is
another
peptide usefi~l for purification which corresponds to an epitope derived from
the
influenza hemagglutinin protein, which has been described by Wilson et al.,
Cell 37:
767 (1984). As discussed below, other such fusion proteins include the CK(3-13
fused to Fc at the N- or C-terminus.
Variant and Mutant Polynucleotides
The present invention is also directed to polynucleotide fragments of the
polynucleotides of the invention. In the present invention, a "polynucleotide
fragment" refers to a short polynucleotide having a nucleic acid sequence
which: is a
portion of that contained in a deposited clone, or encodes the polypeptide
encoded
by the cDNA in a deposited clone; is a portion of that shown in SEQ ID NO:1 or
the
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-16-
complementary strand thereto, or is a portion of a polynucleotide sequence
encoding
the polypeptide of SEQ ID N0:2. The nucleotide fragments of the invention are
preferably at least about 15 nt, and more preferably at least about 20 nt,
still more
preferably at least about 30 nt, and even more preferably, at least about 40
nt, at least
about 50 nt, at least about 75 nt, or at least about 150 nt in length. A
fragment "at
least 20 nt in length," for example, is intended to include 20 or more
contiguous
bases from the cDNA sequence contained in a deposited clone or the nucleotide
sequence shown in SEQ ID NO:1. In this context "about" includes the
particularly
recited value, a value larger or smaller by several (5, 4, 3, 2, or 1)
nucleotides, at
either terminus or at both termini. These nucleotide fragments have uses that
include, but are not limited to, as diagnostic probes and primers as discussed
herein.
Of course, larger fragments (e.g., 50, 150, 500, 600, 2000 nucleotides) are
preferred.
Moreover, representative examples of polynucleotide fragments of the
invention, include, for example, fragments comprising, or alternatively
consisting of,
IS a sequence from about nucleotide number, 1-48, 48-72, 48-84, 72-105, 84-
105, 106
144, 145-192, 193-228, 229-279, and 280 to the end of SEQ >D NO:1, or the
complementary strand thereto, or the cDNA contained in the deposited clone. In
this
context "about" includes the particularly recited ranges, and ranges larger or
smaller
by several (5, 4, 3, 2, or 1 ) nucleotides, at either terminus or at both
termini.
Preferably, these fragments encode a polypeptide which has biological
activity. More
preferably, these polynucleotides can be used as probes or primers as
discussed
herein. Polynucleotides which hybridize to these nucleic acid molecules under
stringent hybridization conditions or lower stringency conditions are also
encompassed by the invention, as are polypeptides encoded by these
polynucleotides.
The present invention further relates to variants of the nucleic acid
molecules
of the present invention, which encode portions, analogs or derivatives of the
CK(3-
13 protein. Variants may occur naturally, such as a natural allelic variant.
By an
"allelic variant" is intended one of several alternate forms of a gene
occupying a given
locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley &
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
_17_
Sons, New York (1985). Non-naturally occurring variants may be produced using
art-known mutagenesis techniques.
Such variants include those produced by nucleotide substitutions, deletions or
additions. The substitutions, deletions or additions may involve one or more
nucleotides. The variants may be altered in coding regions, non-coding
regions, or
both. Alterations in the coding regions may produce conservative or
non-conservative amino acid substitutions, deletions or additions. Especially
preferred among these are silent substitutions, additions and deletions, which
do not
alter the properties and activities of the CK~i-13 protein or portions
thereof. Also
especially preferred in this regard are conservative substitutions.
Most highly preferred are nucleic acid molecules encoding the mature protein
having the amino acid sequence described above or the mature CK(3-13 amino
acid
sequence encoded by the deposited cDNA clone.
Further embodiments include an isolated nucleic acid molecule comprising a
polynucleotide having a nucleotide sequence at least 90% identical, and more
preferably at least 95%, 96%, 97%, 98% or 99% identical to a polynucleotide
selected from the group consisting of (a) a nucleotide sequence encoding the
CK~i-
13 polypeptide having the complete amino acid sequence in SEQ ID N0:2; (b) a
nucleotide sequence encoding the observed mature CK~i-13 polypeptide having
the
amino acid sequence at positions 25 to 93 of SEQ m N0:2; (c) a nucleotide
sequence encoding the observed mature CK(3-13 polypeptide having the amino
acid
sequence at positions 29 to 93 of SEQ ID N0:2; (d) a nucleotide sequence
encoding
the CKJ3-13 polypeptide having the complete amino acid sequence encoded by the
cDNA clone contained in ATCC Deposit No. 97113; (e) a nucleotide sequence
encoding a mature CK~3-13 polypeptide having the amino acid sequence encoded
by
the cDNA clone contained in ATCC Deposit No. 97113; and (f) a nucleotide
sequence complementary to any of the nucleotide sequences in (a), (b), (c),
(d) or (e)
above.
Further embodiments of the invention include. isolated nucleic acid molecules
that comprise a polynucleotide having a nucleotide sequence at least 90%
identical,
CA 02387808 2002-05-14
WO 01/32128 PCT/ITS00/30237
-18-
and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of
the
nucleotide sequences in (a), (b), (c), (d), (e) or (f), above, or a
polynucleotide which
hybridizes under stringent hybridization conditions to a polynucleotide in
(a), (b), (c),
(d), (e) or (f), above. This polynucleotide which hybridizes does not
hybridize under
stringent hybridization conditions to a polynucleotide having a nucleotide
sequence
consisting of only A residues or of only T residues. An additional nucleic
acid
embodiment of the invention relates to an isolated nucleic acid molecule
comprising a
polynucleotide which encodes the amino acid sequence of an epitope-bearing
portion
of a CK(3-13 polypeptide having an amino acid sequence in (a), (b), (c), (d)
or (e),
above. The present invention also relates to recombinant vectors, which
include the
isolated nucleic acid molecules of the present invention, and to host cells
containing
the recombinant vectors, as well as to methods of making such vectors and host
cells
and for using them for production of CK~i-13 polypeptides or peptides by
recombinant techniques.
By a nucleic acid having a nucleotide sequence at least, for example, 95%
"identical" to a reference nucleotide sequence of the present invention, it is
intended
that the nucleotide sequence of the nucleic acid is identical to the reference
sequence
except that the nucleotide sequence may include up to five point mutations per
each
100 nucleotides of the reference nucleotide sequence encoding the CK(3-13
polypeptide. In other words, to obtain a nucleic acid having a nucleotide
sequence at
least 95% identical to a reference nucleotide sequence, up to 5% of the
nucleotides in
the reference sequence may be deleted or substituted with another nucleotide,
or a
number of nucleotides up to 5% of the total nucleotides in the reference
sequence
may be inserted into the reference sequence. The query sequence may be an
entire
sequence shown of SEQ 1D NO:1, the ORF (open reading frame), or any fragment
specified as described herein.
As a practical matter, whether any particular nucleic acid molecule or
polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to
a
nucleotide sequence of the present invention can be determined conventionally
using
known computer programs. A preferred method for determining the best overall
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-19-
match between a query sequence (a sequence of the present invention) and a
subject
sequence, also referred to as a global sequence alignment, can be determined
using
the FASTDB computer program based on the algorithm of Brutlag et al. (Comp.
App. Biosci. (1990) 6:237-245.) In a sequence alignment the query and subject
sequences are both DNA sequences. An RNA sequence can be compared by
converting U's to T's. The result of said global sequence alignment is in
percent
identity. Preferred parameters used in a FASTDB alignment of DNA sequences to
calculate percent identiy are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=1,
Joining Penalty=30, Randomization Group Length=0, Cutoff Score=1, Gap
Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the lenght of the subject
nucleotide sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence because of 5' or 3'
deletions, not because of internal deletions, a manual correction must be made
to the
results. This is because the FASTDB program does not account for 5' and 3'
truncations of the subject sequence when calculating percent identity. For
subject
sequences truncated at the 5' or 3' ends, relative to the query sequence, the
percent
identity is corrected by calculating the number of bases of the query sequence
that are
5' and 3' of the subject sequence, which are not matched/aligned, as a percent
of the
total bases of the query sequence. Whether a nucleotide is matched/aligned is
determined by results of the FASTDB sequence alignment. This percentage is
then
subtracted from the percent identity, calculated by the above FASTDB program
using the specified parameters, to arnve at a final percent identity score.
This
corrected score is what is used for the purposes of the present invention.
Only bases
outside the 5' and 3' bases of the subject sequence, as displayed by the
FASTDB
alignment, which are not matched/aligned with the query sequence, are
calculated for
the purposes of manually adjusting the percent identity score.
For example, a 90 base subject sequence is aligned to a 100 base query
sequence to determine percent identity. The deletions occur at the 5' end of
the
subject sequence and therefore, the FASTDB alignment does not show a
matched/alignment of the first 10 bases at 5' end. The 10 unpaired bases
represent
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-20-
10% of the sequence (number of bases at the 5' and 3' ends not matched/total
number of bases in the query sequence) so 10% is subtracted from the percent
identity score calculated by the FASTDB program. If the remaining 90 bases
were
perfectly matched the final percent identity would be 90%. In another example,
a 90
base subject sequence is compared with a 100 base query sequence. This time
the
deletions are internal deletions so that there are no bases on the 5' or 3' of
the subject
sequence which are not matched/aligned with the query. In this case the
percent
identity calculated by FASTDB is not manually corrected. Once again, only
bases 5'
and 3' of the subject sequence which are not matched/aligned with the query
sequence are manually corrected for. No other manual corrections are to made
for
the purposes of the present invention.
The present application is directed to nucleic acid molecules at Least 90%,
95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in
Figure
1 (SEQ ID NO:1) or to the nucleic acid sequence of the deposited cDNA,
irrespective of whether they encode a polypeptide having CK~i-13 activity.
This is
because even where a particular nucleic acid molecule does not encode a
polypeptide
having CK[3-13 activity, one of skill in the art would still know how to use
the
nucleic acid molecule, for instance, as a hybridization probe or a polymerase
chain
reaction (PCR) primer. Uses of the nucleic acid molecules of the present
invention
that do not encode a polypeptide having CK(3-13 activity include, inter alia,
(1)
isolating the CK[3-13 gene or allelic variants thereof in a cDNA library; (2)
in situ
hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide
precise
chromosomal location of the CK(3-13 gene, as described in Verma et al., Human
Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988);
and Northern Blot analysis for detecting CKji-13 mRNA expression in specific
tissues.
Preferred, however, are nucleic acid molecules having sequences at least
90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence shown in
Figure 1 (SEQ D7 NO:l) or to the nucleic acid sequence of the deposited cDNA
which do, in fact, encode a polypeptide having CK~i-13 protein activity. By "a
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-21-
polypeptide having CKø-13 activity" is intended polypeptides exhibiting
activity
similar, but not necessarily identical, to an activity of the mature protein
of the
invention, as measured in a particular biological assay. For example, the CKø-
l3
protein of the present invention modulates the leukocyte-endothelial cell
interactions
S of T cell subsets.
Treatment of CD4+ T cells with CKø-13 polynucleotides or polypeptides,
strongly modulates the VLA-4 integrin interaction with its endothelial cell
ligand
VCAM-1. Thus, CKø-13 polynucleotides or polypeptides of the invention may be
used to modulate leukocyte-endothelial cell interactions either positively or
negatively, and regulate leukocyte trafficking in the peripheral vasculature.
CKø-13
polynucleotides or polypeptides may be used to negatively regulate memory T
cell
adhesive interactions on VCAM-1. Thus, CKø-13 polynucleotides or polypeptides
may be used to negatively regulate memory T cell recruitment to inflammatory
sites
where VCAM-1 is abundantly expressed on chronic activated vascular epithelium.
I S Alternatively, CKø-13 polynucleotides or polypeptides may be used to
positively
regulate naive T cell adhesive interations on VCAM-1 (See, e.g., Example 6).
Additionally, the CKø-13 protein of the present invention is chemotactic for
activated T-lymphocytes in the assay described in Example 5. CKø-13 protein is
chemotactic in a dose-dependent manner for activated T-lymphocytes in the
above
described assay. Thus, "a polypeptide having CKø-13 protein activity" includes
polypeptides that also exhibit any of the same activities in the above-
described assays
in a dose-dependent manner. Although the degree of dose-dependent activity
need
not be identical to that of the CKø-13 protein, preferably, "a polypeptide
having
CKø-13 protein activity" will exhibit substantially similar dose-dependence in
a given
activity as compared to the CKø-13 protein (i.e., the candidate polypeptide
will
exhibit greater activity or not more than about 25-fold less and, preferably,
not more
than about tenfold less activity relative to the reference CKø-13 protein).
Like other CC chemokines, CKø-13 exhibits activity on leukocytes with a
strong activity on T-lymphocytes which have been activiated by cross-linking
of the
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-22-
CD3 receptor in the presence of IL,-2. For this reason CK(3-13 is active in
directing
the proliferation, differentiation and migration of these cell types. Such
activity is
useful for immune enhancement or suppression, myeloprotection, stem cell
mobilization, acute and chronic inflammatory control and treatment of
leukemia.
However, unlike other known CC chemokines CK(3-13 has been shown to be
expressed only in an activated monocyte and dendritic cell cDNA library. These
two
cell types combined make up the majority of the anitigen presenting cells
(APCs).
Dendritic cells (DCs) and monocytes are professional APCs which are critical
for the
proper response of the host and are responsible for primary antigen-specific
immune
reactions. APCs play a crucial role in the presentation of antigens to both T-
lymphocytes and B-lymphocytes to initiate the immune response, including for
example, antigen trapping and processing, viral trapping, filtering and
processing.
APCs are normally found in the lymph node, spleen, thymus, skin and circulate
throughout the body. When found in the skin, DCs are refered to as Langerhans
cells. Follicular dendritic cells reside in the germinal centers of the lymph
node.
Because CK(3-13 is produced by these cells, CK(3-13 is active in modulating
the
activities of both monocytes and dendritic cells as well as the cells with
which these
APCs interact. In addition, CK(3-13 has effects on the local resident cells in
which
APCs normally reside such as the skin, thymus, spleen, and lymph node.
CK~3-13 regulates the proliferation and maturation of DCs and is monitored in
a proliferation/differentiation assay such as those reviewed by Peters et al.
(1996)
Immun. Today 17:273 and described by Young et al. (1995) J. Exp. Med. 182:11 I
1;
Caux et al. (1992) Nature 360:258; and Santigo-Schwarz et al. (1995) Adv. Exp.
Med. Biol. 378:7. Representative cell lines could also be employed in such
assays.
CK(3-13 also influences the effector function of DCs and monocytes. That is,
CK(3-
13 enhaces the capacity of DCs and monocytes to take up virus, bacteria or
other
foreign substances, process them and present them to the lymphocytes
responsible for
immune responses. CK(3-13 also modulates the interaction of DCs and monocytes
with T-lymphocytes and B-lymphocytes. For instance, CK(3-13 provides a
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-23-
costimulation signal during antigen presentation which directs the responding
cell to
survive, proliferate, differentiate, secrete additional cytokines or soluble
mediators, or
selectively removes the responding cell by inducing apoptosis or other
mechanisms of
cell death. Since DCs and monocytes have been shown to facilitate the transfer
of
HIV to CD4+ T-lymphocytes CK~3-13 also influences this ability and prevents
infection of lymphocytes by HIV or other viruses mediated through monocytes or
DCs. This is also true for the intital infection of monocytes and DCs by such
viruses.
Of course, due to the degeneracy of the genetic code, one of ordinary skill in
the art will immediately recognize that a large number of the nucleic acid
molecules
having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the
nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown
in
Figure 1 (SEQ ID NO:1) will encode a polypeptide "having CK~3-13 protein
activity." In fact, since degenerate variants of these nucleotide sequences
all encode
the same polypeptide, this will be clear to the skilled artisan even without
performing
the above described comparison assay. It will be further recognized in the art
that,
for such nucleic acid molecules that are not degenerate variants, a reasonable
number
will also encode a polypeptide having CK(3-13 protein activity. This is
because the
skilled artisan is fully aware of amino acid substitutions that are either
less likely or
not likely to significantly erect protein function (e.g., replacing one
aliphatic amino
acid with a second aliphatic amino acid), as further described below.
Vectors and Host Cells
The present invention also relates to vectors which include the isolated DNA
molecules of the present invention, host cells which are genetically
engineered with
the recombinant vectors, and the production of CK~i-13 polypeptides or
fragments
thereof by recombinant techniques. The vector may be, for example, a phage,
plasmid, viral or retroviral vector. Retroviral vectors may be replication
competent
or replication defective. In the latter case, viral propagation generally will
occur only
in complementing host cells.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-24-
The polynucleotides may be joined to a vector containing a selectable marker
for propagation in a host. Generally, a plasmid vector is introduced in a
precipitate,
such as a calcium phosphate precipitate, or in a complex with a charged lipid.
If the
vector is a virus, it may be packaged in vitro using an appropriate packaging
cell line
and then transduced into host cells.
The DNA insert should be operatively linked to an appropriate promoter,
such as the phage lambda PL promoter, the E. coli lac, lrp, phoA and tac
promoters,
the SV40 early and late promoters and promoters of retroviral LTRs, to name a
few.
Other suitable promoters will be known to the skilled artisan. The expression
constructs will further contain sites for transcription initiation,
termination and, in the
transcribed region, a ribosome binding site for translation. The coding
portion of the
transcripts expressed by the constructs will preferably include a translation
initiating
codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately
positioned at the end of the polypeptide to be translated.
As indicated, the expression vectors will preferably include at least one
selectable marker. Such markers include dihydrofolate reductase, 6418 or
neomycin
resistance for eukaryotic cell culture and tetracycline, kanamycin or
ampicillin
resistance genes for culturing in E. coli and other bacteria. Representative
examples
of appropriate hosts include, but are not limited to, bacterial cells, such as
E. coli,
Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast
cells;
insect cells such as Drosophila S2 and Spodoptera S~ cells; animal cells such
as
CHO, COS, 293 and Bowes melanoma cells; and plant cells. Appropriate culture
mediums and conditions for the above-described host cells are known in the
art.
Among vectors preferred for use in bacteria include pQE70, pQE60 and
pQE-9, available from QIAGEN, Inc., supra; pB S vectors, Phagescript vectors,
Bluescript vectors, pNH8A, pNHl6a, pNHl8A, pNH46A, available from Stratagene;
and ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS available from Pharmacia.
Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and
pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from
Pharmacia. Other suitable vectors will be readily apparent to the skilled
artisan.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-25-
Introduction of the construct into the host cell can be effected by calcium
phosphate transfection, DEAF-dextran mediated transfection, cationic lipid-
mediated
transfection, electroporation, transduction, infection or other methods. Such
methods are described in many standard laboratory manuals, such as Davis et
al.,
Basic Methods In Molecular Biology ( 1986).
The polypeptide may be expressed in a modified form, such as a fusion
protein, and may include not only secretion signals, but also additional
heterologous
fiznctional regions. For instance, a region of additional amino acids,
particularly
charged amino acids, may be added to the N-terminus of the polypeptide to
improve
stability and persistence in the host cell, during purification, or during
subsequent
handling and storage. Also, peptide moieties may be added to the polypeptide
to
facilitate purification. Such regions may be removed prior to final
preparation of the
polypeptide. The addition of peptide moieties to polypeptides to engender
secretion
or excretion, to improve stability and to facilitate purification, among
others, are
1 S familiar and routine techniques in the art. A preferred fixsion protein
comprises a
heterologous region from immunoglobulin that is usefial to stabilize and
purify
proteins. For example, EP-A-O 464 533 (Canadian counterpart 2045869) discloses
fusion proteins comprising various portions of constant region of
immunoglobulin
molecules together with another human protein or part thereof. In many cases,
the
Fc part in a fixsion protein is thoroughly advantageous for use in therapy and
diagnosis and thus results, for example, in improved pharmacokinetic
properties
(EP-A 0232 262). On the other hand, for some uses it would be desirable to be
able
to delete the Fc part after the fusion protein has been expressed, detected
and
purified in the advantageous manner described. This is the case when Fc
portion
proves to be a hindrance to use in therapy and diagnosis, for example when the
fission
protein is to be used as antigen for immunizations. In drug discovery, for
example,
human proteins, such as hIL-5, have been fizsed with Fc portions for the
purpose of
high-throughput screening assays to identify antagonists of hII,-5. See, D.
Bennett et
al., J. Molecular Recognition 8.52-58 (1995) and K. Johanson et al., J. Biol.
Chem.
270:9459-9471 {1995).
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-26-
The CK~i-13 protein can be recovered and purified from recombinant cell
cultures by well-known methods including ammonium sulfate or ethanol
precipitation, acid extraction, anion or cation exchange chromatography,
phosphocellulose chromatography, hydrophobic interaction chromatography,
affinity
chromatography, hydroxylapatite chromatography and lectin chromatography. Most
preferably, high performance liquid chromatography ("HPLC") is employed for
purification. Polypeptides of the present invention include: products purified
from
natural sources, including bodily fluids, tissues and cells, whether directly
isolated or
cultured; products of chemical synthetic procedures; and products produced by
recombinant techniques from a prokaryotic or eukaryotic host, including, for
example, bacterial, yeast, higher plant, insect and mammalian cells. Depending
upon
the host employed in a recombinant production procedure, the polypeptides of
the
present invention may be glycosylated or may be non-glycosylated. In addition,
polypeptides of the invention may also include an initial modified methionine
residue,
in some cases as a result of host-mediated processes.
Polypeptides and Fragments
The invention further provides an isolated CK~-13 polypeptide having the
amino acid sequence encoded by the deposited cDNA, or the amino acid sequence
in
SEQ ID N0:2, or a peptide or polypeptide comprising a portion of the above
polypeptides.
Further polypeptides of the present invention include polypeptides which
comprise, or alternatively consist of, an amino acid sequence which is at
least 80%,
85%, 90%, 95%, 96%, 97%, 98%, 99% identical to, for example, the polypeptide
sequence shown in SEQ ID N0:2, the polypeptide sequence encoded by the cDNA
contained in a deposited clone, and/or polypeptide fragments of any of these
polypeptides (e.g., those fragments described herein).
By a polypeptide having an amino acid sequence at Least, for example, 95%
"identical" to a query amino acid sequence of the present invention, it is
intended that
the amino acid sequence of the subject polypeptide is identical to the query
sequence
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-27-
except that the subject polypeptide sequence may include up to five amino acid
alterations per each 100 amino acids of the query amino acid sequence. In
other
words, to obtain a polypeptide having an amino acid sequence at least 95%
identical
to a query amino acid sequence, up to 5% of the amino acid residues in the
subject
sequence may be inserted, deleted, (indels) or substituted with another amino
acid.
These alterations of the reference sequence may occur at the amino or carboxy
terminal positions of the reference amino acid sequence or anywhere between
those
terminal positions, interspersed either individually among residues in the
reference
sequence or in one or more contiguous groups within the reference sequence.
As a practical matter, whether any particular polypeptide is at least 80%,
85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid
sequences of SEQ ID N0:2 or to the amino acid sequence encoded by the cDNA
contained in a deposited clone can be determined conventionally using known
computer programs. A preferred method for determing the best overall match
1 S between a query sequence (a sequence of the present invention) and a
subject
sequence, also referred to as a global sequence alignment, can be determined
using
the FASTDB computer program based on the algorithm of Brutlag et al. (Comp.
App. Biosci. 6:237-245(1990)). In a sequence alignment the query and subject
sequences are either both nucleotide sequences or both amino acid sequences.
The
result of said global sequence alignment is in percent identity. Preferred
parameters
used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch
Penalty=1, Joining Penalty=20, Randomization Group Length=0, Cutoff Score=1,
Window Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window
Size=500 or the length of the subject amino acid sequence, whichever is
shorter.
If the subject sequence is shorter than the query sequence due to N- or C-
terminal deletions, not because of internal deletions, a manual correction
must be
made to the results. This is because the FASTDB program does not account for N-
and C-terminal truncations of the subject sequence when calculating global
percent
identity. For subject sequences truncated at the N- and C-termini, relative to
the
query sequence, the percent identity is corrected by calculating the number of
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-28-
residues of the query sequence that are N- and C-terminal of the subject
sequence,
which are not matched/aligned with a corresponding subject residue, as a
percent of
the total bases of the query sequence. Whether a residue is matchedlaligned is
determined by results of the FASTDB sequence alignment. This percentage is
then
subtracted from the percent identity, calculated by the above FASTDB program
using the specified parameters, to arrive at a final percent identity score.
This final
percent identity score is what is used for the purposes of the present
invention. Only
residues to the N- and C-termini of the subject sequence, which are not
matchedlaligned with the query sequence, are considered for the purposes of
manually adjusting the percent identity score. That is, only query residue
positions
outside the farthest N- and C-terminal residues of the subject sequence.
For example, a 90 amino acid residue subject sequence is aligned with a 100
residue query sequence to determine percent identity. The deletion occurs at
the N-
terminus of the subject sequence and therefore, the FASTDB alignment does not
1 S show a matching/alignment of the first 10 residues at the N-terminus. The
10
unpaired residues represent 10% of the sequence (number of residues at the N-
and
C- termini not matched/total number of residues in the query sequence) so 10%
is
subtracted from the percent identity score calculated by the FASTDB program.
If
the remaining 90 residues were perfectly matched the final percent identity
would be
90%. In another example, a 90 residue subject sequence is compared with a 100
residue query sequence. This time the deletions are internal deletions so
there are no
residues at the N- or C-termini of the subject sequence which are not
matched/aligned with the query. In this case the percent identity calculated
by
FASTDB is not manually corrected. Once again, only residue positions outside
the
N- and C-terminal ends of the subject sequence, as displayed in the FASTDB
alignment, which are not matched/aligned with the query sequnce are manually
corrected for. No other manual corrections are to made for the purposes of the
present invention.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-29-
Variant and Mutant Polypeptirles
To improve or alter the characteristics of CK/3-13 polypeptides, protein
engineering may be employed. Recombinant DNA technology known to those
skilled in the art can be used to create novel mutant proteins or "muteins
including
single or multiple amino acid substitutions, deletions, additions or fusion
proteins.
Such modified polypeptides can show, e.g., enhanced activity or increased
stability.
In addition, they may be purified in higher yields and show better solubility
than the
corresponding natural polypeptide, at least under certain purification and
storage
conditions.
In the present invention, a "polypeptide fragment" refers to an amino acid
sequence which is a portion of that contained in SEQ 117 N0:2 or encoded by
the
cDNA contained in the deposited clone. Protein (polypeptide) fragments may be
"free-standing," or comprised within a larger polypeptide of which the
fragment
forms a part or region, most preferably as a single continuous region.
Representative
examples of polypeptide fragments of the invention, include, for example,
fragments
comprising, or alternatively consisting of, from about amino acid number 1-24,
1-28,
25-35, 28-35, 36-48, 49-64, 65-76, and 77 to the end of the coding region.
Moreover, polypeptide fragments can be about 20, 30, 40, 50, 60, 70, 80, 90,
100,
110, 120, 130, 140, or 150 amino acids in length. In this context "about"
includes
the particularly recited ranges or values, and ranges or values larger or
smaller by
several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes.
Polynucleotides encoding these polypeptides are also encompassed by the
invention.
For instance, for many proteins, including the extracellular domain of a
membrane associated protein or the mature forms) of a secreted protein, it is
known
in the art that one or more amino acids may be deleted from the N-terminus or
C-
terminus without substantial loss of biological function. For instance, Ron et
al., J.
Biol. Chem., 268:2984-2988 (1993) reported modified KGF proteins that had
heparin binding activity even if 3, 8, or 27 amino-terminal amino acid
residues were
nussing. In the present case, since the protein of the invention is a member
of the
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-3 0-
chemokine polypeptide family, deletions of N-terminal amino acids up to the
Cys at
position 36 of SEQ ID N0:2 may retain some biological activity such as
receptor
binding or modulation of T cell activities, for chemokines. Polypeptides
having
further N-terminal deletions including the Cys-3b residue in SEQ 117 N0:2
would not
be expected to retain such biological activities because it is known that this
residue in
a chemokine-related polypeptide is required for forming a disulfide bridge to
provide
structural stability which is needed for receptor binding and signal
transduction.
Even if deletion of one or more amino acids from the N-terminus of a protein
results in modification of loss of one or more biological functions of the
protein,
other functional activities (e.g., biological activities, ability to
multimerize, ability to
bind CK(3-13 ligand, ability to modulate T cell activity) may still be
retained. For
example, the ability of shortened CK~i-13 muteins to induce and/or bind to
antibodies
which recognize the complete or mature forms of the polypeptides generally
will be
retained when less than the majority of the residues of the complete or mature
polypeptide are removed from the N-terminus. Whether a particular polypeptide
lacking N-terminal residues of a complete polypeptide retains such immunologic
activities can readily be determined by routine methods described herein and
otherwise known in the art. It is not unlikely that an CK~i-13 mutein with a
large
number of deleted N-terminal amino acid residues may retain some biological or
immunogenic activities. In fact, peptides composed of as few as six CK(3-13
amino
acid residues may often evoke an immune response.
Preferred polypeptide fragments include the secreted protein as well as the
mature form. Further preferred polypeptide fragments include the secreted
protein or
the mature form having a continuous series of deleted residues from the amino
or the
carboxy terminus, or both. For example, any number of amino acids,
Accordingly, polypeptide fragments include the secreted CK(3-13 protein as
well as the mature form. Further preferred polypeptide fragments include the
secreted CK(3-13 protein or the mature form having a continuous series of
deleted
residues from the amino or the carboxy terminus, or both. For example, any
number
of amino acids, ranging from 1-60, can be deleted from the amino terminus of
either
CA 02387808 2002-05-14
WO 01/32128 PCTlUS00/30237
-31-
the secreted CK~3-13 polypeptide or the mature form. Similarly, any number of
amino acids, ranging from 1-30, can be deleted from the carboxy terminus of
the
secreted CK(3-13 protein or mature form. Furthermore, any combination of the
above amino and carboxy terminus deletions are preferred. Similarly,
polynucleotides encoding these polypeptide fragments are also preferred.
Particularly, N-terminal deletions of the CK(3-13 polypeptide can be described
by the general formula m'-93, where ml is an integer from 2 to 88, where m'
corresponds to the position of the amino acid residue identified in SEQ »
N0:2.
More in particular, the invention provides polynucleotides encoding
polypeptides
comprising, or alternatively consisting of, the amino acid sequence of
residues of A-2
to Q-93; R-3 to Q-93; L-4 to Q-93; Q-5 to Q-93; T-6 to Q-93; A-7 to Q-93; L-8
to
Q-93; L-9 to Q-93; V-10 to Q-93; V-I 1 to Q-93; L-I2 to Q-93; V-13 to Q-93; L-
14
to Q-93; L-1 S to Q-93; A-16 to Q-93; V-17 to Q-93; A-18 to Q-93; L-19 to Q-
93;
Q-20 to Q-93; A-21 to Q-93; T-22 to Q-93; E-23 to Q-93; A-24 to Q-93; G-25 to
Q-93; P-26 to Q-93; Y-27 to Q-93; G-28 to Q-93; A-29 to Q-93; N-30 to Q-93; M-
31 to Q-93; E-32 to Q-93; D-33 to Q-93; S-34 to Q-93; V-35 to Q-93; C-36 to Q-
93; C-3? to Q-93; R-38 to Q-93; D-39 to Q-93; Y-40 to Q-93; V-41 to Q-93; R-42
to Q-93; H-43 to Q-93; R-44 to Q-93; L-45 to Q-93; P-46 to Q-93; L-47 to Q-93;
R-48 to Q-93; V-49 to Q-93; V-50 to Q-93; K-51 to Q-93; H-52 to Q-93; F-53 to
Q-93; Y-54 to Q-93; W-55 to Q-93; T-56 to Q-93; S-57 to Q-93; D-58 to Q-93; S-
59 to Q-93; C-60 to Q-93; P-61 to Q-93; R-62 to Q-93; P-63 to Q-93; G-64 to Q-
93; V-65 to Q-93; V-66 to Q-93; L-67 to Q-93; L-68 to Q-93; T-69 to Q-93; F-70
to Q-93; R-71 to Q-93; D-72 to Q-93; K-73 to Q-93; E-74 to Q-93; I-75 to Q-93;
C-76 to Q-93; A-77 to Q-93; D-78 to Q-93; P-79 to Q-93; R-80 to Q-93; V-81 to
Q-93; P-82 to Q-93; W-83 to Q-93; V-84 to Q-93; K-85 to Q-93; M-86 to Q-93; I-
87 to Q-93; and/or L-88 to Q-93 of SEQ 117 N0:2. Polypeptides encoded by these
polynucleotides are also encompassed by the invention.
Accordingly, the present invention further provides polypeptides having one
or more residues deleted from the amino terminus of the amino acid sequence of
the
CK(3-13 shown in SEQ B3 N0:2, up to the Cys-36 residue, and polynucleotides
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-32-
encoding such polypeptides. In particular, the present invention provides
polypeptides comprising the amino acid sequence of residues m2-93 of SEQ m
N0:2, where m2 is an integer in the range of 1-35 where Cys-36 is the position
of the
first residue from the N-terminus of the complete CK/3-13 polypeptide (shown
in
SEQ »? N0:2) believed to be required for receptor binding activity of the CK(3-
13
protein.
More in particular, the invention provides polypeptides having the amino acid
sequence of residues 1-93, 2-93, 3-93, 4-93, 5-93, 6-93, 7-93, 8-93, 9-93, 10-
93, 11-
93, 12-93, 13-93, 14-93, 15-93, 16-93, 17-93, 18-93, 19-93, 20-93, 21-93, 22-
93,
23-93, 24-93, 25-93, 26-93, 27-93, 28-93, 29-93, 30-93, 31-93, 32-93, 33-93,
34-
93, and/or 3 5-93 of SEQ ID N0:2. Polynucleotides encoding these polypeptides
also are provided.
Also as mentioned above, even if deletion of one or more amino acids from
the C-terminus of a protein results in modification of loss of one or more
biological
functions of the protein, other functional activities (e.g., biological
activities, ability
to multimerize, ability to bind CK(3-13 ligand, ability to modulate T cell
activity) may
still be retained. For example the ability of the shortened CK~3-13 mutein to
induce
and/or bind to antibodies which recognize the complete or mature forms of the
polypeptide generally will be retained when less than the majority of the
residues of
the complete or mature polypeptide are removed from the C-terminus. Whether a
particular polypeptide lacking C-terminal residues of a complete polypeptide
retains
such immunologic activities can readily be determined by routine methods
described
herein and otherwise known in the art. It is not unlikely that an CK(3-13
mutein with
a large number of deleted C-terminal amino acid residues may retain some
biological
or immunogenic activities. In fact, peptides composed of as few as six CK(3-13
amino acid residues may often evoke an immune response.
Similarly, many examples of biologically functional C-terminal deletion
muteins are known. For instance, interferon gamma shows up to ten times higher
activities by deleting 8-10 amino acid residues from the carboxy terminus of
the
protein (Dobeli et al., .7. Biotechnology 7:199-216 (1988). In the present
case, since
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-33-
the protein of the invention is a member of the chemokine polypeptide family,
deletions of C-terminal amino acids up to the Cys at position 76 of SEQ m N0:2
may retain some biological activity such as receptor binding or modulation of
target
cell activities, for chemokines. Polypeptides having further C-terminal
deletions
S including Cys-76 of SEQ 1D N0:2 would not be expected to retain such
biological
activities because it is known that this residue in a chemokine-related
polypeptide is
required for forming a disulfide bridge to provide structural stability which
is needed
for receptor binding and signal transduction.
However, even if deletion of one or more amino acids from the C-terminus of
a protein results in modification of loss of one or more biological functions
of the
protein, other biological activities may still be retained. Thus, the ability
of the
shortened protein to induce and/or bind to antibodies which recognize the
complete
or mature form of the protein generally will be retained when less than the
majority of
the residues of the complete or mature protein are removed from the C-
terminus.
l5 Whether a particular polypeptide lacking C-terminal residues of a complete
protein
retains such immunologic activities can readily be determined by routine
methods
described herein and otherwise known in the art.
Accordingly, the present invention further provides polypeptides having one
or more residues deleted from the carboxy terminus of the amino acid sequence
of
the CK~i-13 polypeptide shown in Figure 1 (SEQ ID N0:2), as described by the
general formula 1-n', where n' is an integer from 7 to 92, where n'
corresponds to
the position of amino acid residue identified in SEQ 1D N0:2. More in
particular, the
invention provides polynucleotides encoding polypeptides comprising, or
alternatively consisting of, the amino acid sequence of residues of M-1 to S-
92; M-1
to L-91; M-1 to K-90; M-1 to S-89; M-1 to L-88; M-1 to I-87; M-1 to M-86; M-1
to K-85; M-1 to V-84; M-1 to W-83; M-1 to P-82; M-i toV-81; M-1 to R-80; M-1
to P-79; M-1 to D-78; M-1 to A-77; M-lto C-76; M-1 to 1-75; M-1 to E-74; M-1
to
K-73; M-1 to D-72; M-lto R-71; M-1 to F-70; M-1 to T-69; M-1 to L-68; M-1 to
L-67; M-lto V-66; M-1 to V-65; M-1 to G-64; M-1 to P-63; M-1 to R-62; M-1 to
P-61; M-I to C-60; M-1 to S-59; M-1 to D-58; M-1 to S-57; M-1 to T-56; M-1 to
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-3 4-
W-55; M-1 to Y-54; M-1 to F-53; M-1 to H-52; M-1 to K-51; M-1 to V-S0; M-1 to
V-49; M-1 to R-48; M-Ito L-47; M-I to P-46; M-1 to L-45; M-1 to R-44; M-I to
H-43; M-I to R-42; M-1 to V-41; M-1 to Y-40; M-1 to D-39; M-1 to R-38; M-1 to
C-37; M-1 to C-36; M-1 to V-35; M-1 to S-34; M-lto D-33; M-1 to E-32; M-I to
M-31; M-1 to N-30; M-1 to A-29; M-1 to G-28; M-I to Y-27; M-1 to P-26; M-1 to
G-25; M-I to A-24; M-I to E-23; M-1 to T-22; M-1 to A-21; M-1 to Q-20; M-1~ to
L-19; M-1 to A-18; M-1 to V-17; M-1 to A-16; M-1 to L-15; M-I to L-14; M-1 to
V-I3; M-1 to L-12; M-1 to V-1 l; M-1 to V-10; M-1 to L-9; M-1 to L-8; and/or M
1 to A-7 of SEQ ID N0:2. Polypeptides encoded by these polynucleotides are
also
encompassed by the invention.
Further, the present invention further provides polypeptides having one or
more residues from the carboxy terminus of the amino acid sequence of the CK(3-
13
shown in SEQ ID N0:2, up to the Cys-76 of SEQ B7 N0:2, and polynucleotides
encoding such polypeptides. In particular, the present invention provides
IS polypeptides having the amino acid sequence of residues 1-nz of the amino
acid
sequence in SEQ B? N0:2, where n2 is any integer in the range of 77 to 93
where 76
is the position of the C- terminal Cys residue of the complete CK(3-13
polypeptide
(shown in SEQ ID N0:2) believed to be required for receptor binding or
modulation
of target cell activities of the CK(3-13 protein.
More in particular, the invention provides polynucleotides encoding
polypeptides having the amino acid sequence of residues m2-n2, where m2 is an
integer I-35 and n2 is an integer 77-93 of SEQ ID N0:2. Polynucleotides
encoding
these polypeptides also are provided.
In addition, any of the above listed N- or C-terminal deletions can be
combined to produce a N- and C-terminal deleted CK(3-13 polypeptide. The
invention also provides polypeptides having one or more amino acids deleted
from
both the amino and the carboxyl termini, which may be described generally as
having
residues m'-n' of SEQ 117 N0:2, where m' and n' are integers as described
above.
Polynucleotides encoding these polypeptides are also encompassed by the
invention.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-3 5-
In particular, preferred N- and C- terminal deletions comprise amino acid
sequences A-29 to Q-93; G-28 to Q-93; and/or G-25 to Q-93 of SEQ ID N0:2.
Polynucleotides encoding these polypeptides are also encompassed by the
invention.
Accordingly, the present invention further provides polypeptides having one
or more residues deleted from the carboxy terminus of the amino acid sequence
of
the mature CK~i-13 polypeptide shown in Figure 1 (SEQ 117 N0:2), as described
by
the general formula 25-n3, where n3 is an integer from 31 to 92, where n3
corresponds to the position of amino acid residue identified in SEQ ID N0:2.
More
in particular, the invention provides polynucleotides encoding polypeptides
comprising, or alternatively consisting of, the amino acid sequence of
residues of G-
25 to S-92; G-25 to L-91; G-25 to K-90; G-25 to S-89; G-25 to L-88; G-25 to I-
87;
G-25 to M-86; G-25 to K-85; G-25 to V-84; G-25 to W-83; G-25 to P-82; G-25
toV-81; G-25 to R-80; G-25 to P-79; G-25 to D-78; G-25 to A-77; G-25 to C-76;
G-25 to I-75; G-25 to E-74; G-25 to K-73; G-25 to D-72; G-25 to R-71; G-25 to
F-
70; G-25 to T-69; G-25 to L-68; G-25 to L-67; G-25 to V-66; G-25 to V-65; G-25
to G-64; G-25 to P-63; G-25 to R-62; G-25 to P-61; G-25 to C-60; G-25 to S-59;
G-25 to D-58; G-25 to S-57; G-25 to T-56; G-25 to W-55; G-25 to Y-54; G-25 to
F-53; G-25 to H-52; G-25 to K-51; G-25 to V-50; G-25 to V-49; G-25 to R-48; G-
to L-47; G-25 to P-46; G-25 to L-45; G-25 to R-44; G-25 to H-43; G-25 to R-
20 42; G-25 to V-41; G-25 to Y-40; G-25 to D-39; G-25 to R-38; G-25 to C-37; G-
25
to C-36; G-25 to V-35; G-25 to S-34; G-25 to D-33; G-25 to E-32; and/or G-25
to
M-31 of SEQ ID N0:2. Polypeptides encoded by these polynucleotides are also
encompassed by the invention.
Moreover, a signal sequence may be added to these C-terminal constructs.
25 For example, amino acids 1-24 of SEQ ID N0:2, amino acids 2-24 of SEQ 1D
N0:2,
amino acids 3-24 of SEQ 1D N0:2, amino acids 4-24 of SEQ ID N0:2, amino acids
5-24 of SEQ B7 N0:2, amino acids 6-24 of SEQ m N0:2, amino acids 7-24 of SEQ
m N0:2, amino acids 8-24 of SEQ 1D N0:2, amino acids 9-24 of SEQ ID N0:2,
amino acids 10-24 of SEQ ID N0:2, amino acids I1-24 of SEQ 1D N0:2, amino
acids 12-24 of SEQ ID NO:2, amino acids I3-24 of SEQ ID N0:2, amino acids 14-
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-3 6-
24 of SEQ ID N0:2, amino acids 15-24 of SEQ ID N0:2, amino acids 16-24 of SEQ
ID N0:2, amino acids 17-24 of SEQ m N0:2, amino acids 18-24 of SEQ ID N0:2,
amino acids 19-24 of SEQ 117 N0:2, amino acids 20-24 of SEQ ID N0:2, amino
acids 21-24 of SEQ ID N0:2, amino acids 22-24 of SEQ ID N0:2, or amino acids
23-24 of SEQ m N0:2, can be added to the N-terminus of each C-terminal
constructs listed above.
Accordingly, the present invention further provides polypeptides having one
or more residues deleted from the carboxy terminus of the amino acid sequence
of
the mature CK(3-13 polypeptide shown in Figure 1 (SEQ 117 N0:2), as described
by
the general formula 29-n4, where n4 is an integer from 35 to 92, where n4
corresponds to the position of amino acid residue identified in SEQ ID N0:2.
More
in particular, the invention provides polynucleotides encoding polypeptides
comprising, or alternatively consisting of, the amino acid sequence of
residues of G-
29 to S-92; G-29 to L-91; G-29 to K-90; G-29 to S-89; G-29 to L-88; G-29 to I-
87;
G-29 to M-86; G-29 to K-85; G-29 to V-84; G-29 to W-83; G-29 to P-82; G-29
toV-81; G-29 to R-80; G-29 to P-79; G-29 to D-78; G-29 to A-77; G-29 to C-76;.
G-29 to I-75; G-29 to E-74; G-29 to K-73; G-29 to D-72; G-29 to R-71; G-29 to
F-
70; G-29 to T-69; G-29 to L-68; G-29 to L-67; G-29 to V-66; G-29 to V-65; G-29
to G-64; G-29 to P-63; G-29 to R-62; G-29 to P-61; G-29 to C-60; G-29 to S-59;
G-29 to D-58; G-29 to S-57; G-29 to T-56; G-29 to W-S5; G-29 to Y-54; G-29 to
F-53; G-29 to H-52; G-29 to K-51; G-29 to V-50; G-29 to V-49; G-29 to R-48; G
29 to L-47; G-29 to P-46; G-29 to L-45; G-29 to R-44; G-29 to H-43; G-29 to R
42; G-29 to V-41; G-29 to Y-40; G-29 to D-39; G-29 to R-38; G-29 to C-37; G-29
to C-36; and/or G-29 to V-35 of SEQ ID N0:2. Polynucleotides encoding these
polypeptides are also encompassed by the invention.
Alternatively, amino acids 1-28 of SEQ )D N0:2, amino acids 2-28 of SEQ
B7 N0:2, amino acids 3-28 of SEQ m N0:2, amino acids 4-28 of SEQ ID N0:2,
amino acids 5-28 of SEQ )D N0:2, amino acids 6-28 of SEQ ID N0:2, amino acids
7-28 of SEQ ID N0:2, amino acids 8-28 of SEQ ID N0:2, amino acids 9-28 of SEQ
>Q7 N0:2, amino acids 10-28 of SEQ ID N0:2, amino acids 11-28 of SEQ ID N0:2,
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-3 7-
amino acids 12-28 of SEQ ID N0:2, amino acids 13-28 of SEQ >D N0:2, amino
acids 14-28 of SEQ 1D N0:2, amino acids 15-28 of SEQ LD N0:2, amino acids 16-
28 of SEQ ID N0:2, amino acids 17-28 of SEQ >D N0:2, amino acids 18-28 of SEQ
ID N0:2, amino acids 19-28 of SEQ ID N0:2, amino acids 20-28 of SEQ ID N0:2,
amino acids 21-28 of SEQ 1D N0:2, amino acids 22-28 of SEQ II7 N0:2, amino
acids 23-28 of SEQ >D N0:2, amino acids 24-28 of SEQ 1T7 N0:2, amino acids 25-
28 of SEQ m N0:2, amino acids 26-28 of SEQ m N0:2, or amino acids 27-28 of
SEQ ID N0:2, can be added to the N-terminus of each C-terminal constructs
listed
above.
Also included are a nucleotide sequence encoding a polypeptide consisting of
a portion of the complete CK(3-13 amino acid sequence encoded by the cDNA
clone
contained in ATCC Deposit No. 97113, where this portion excludes any integer
of
amino acid residues from 1 to about 83 amino acids from the amino terminus of
the
complete amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit No. 97113, or any integer of amino acid residues from 1 to about 83
amino
acids from the carboxy terminus, or any combination of the above amino
terminal and
carboxy terminal deletions, of the complete amino acid sequence encoded by the
cDNA clone contained in ATCC Deposit No. 97113. Polynucleotides encoding all
of the above deletion mutant polypeptide forms also are provided.
Also included are a nucleotide sequence encoding a polypeptide consisting of
a portion of the complete CK~3-13 amino acid sequence encoded by the cDNA
clone
contained in ATCC Deposit No. 97113, where this portion excludes from 1 to
about
35 amino acids from the amino terminus of the complete amino acid sequence
encoded by the cDNA clone contained in ATCC Deposit No. 97113, or from 1 to
about 17 amino acids from the carboxy terminus, or any combination of the
above
amino terminal and carboxy terminal deletions, of the complete amino acid
sequence
encoded by the cDNA clone contained in ATCC Deposit No. 97113.
Polynucleotides encoding all of the above deletion mutant polypeptide forms
also are
provided.
CA 02387808 2002-05-14
WO O1I32128 PCT/US00/30237
-3 8-
Additional preferred polypeptide fragments comprise, or alternatively consist
of, the amino acid sequence of residues: M-1 to L-15; A-2 to A-16; R-3 to V-
17; L-4
to A-18; Q-5 to L-19; T-6 to Q-20; A-7 to A-21; L-8 to T-22; L-9 to E-23; V-10
to
A-24; V-11 to G-25; L-12 to P-26; V-13 to Y-27; L-14 to G-28; L-15 to A-29; A-
16
to N-30; V-17 to M-31; A-18 to E-32; L-19 to D-33; Q-20 to S-34; A-21 to V-35;
T-22 to C-36; E-23 to C-37; A-24 to R-38; G-25 to D-39; P-26 toY-40; Y-27 to V-
41; G-28 to R-42; A-29 to H-43; N-30 to R-44; M-31 to L-45; E-32 to P-46; D-33
to L-47; S-34 to R-48; V-35 toV-49; C-36 to V-50; C-37 to K-51; R-38 to H-52;
D-
39 to F-53; Y-40 to Y-54; V-41 to W-SS; R-42 to T-56; H-43 to S-57; R-44 to D-
58; L-45 to S-59; P-46 to C-60; L-47 to P-61; R-48 to R-62;V-49 to P-63; V-50
to
G-64; K-51 to V-65; H-52 to V-66; F-53 to L-67; Y-54 to L-68; W-55 to T-69; T-
56 to F-70; S-57 to R-71; D-58 to D-72; S-59 to K-73; C-60 to E-74; P-61 to I-
75;
R-62 to C-76; P-63 to A-?7; G-64 to D-78; V-65 to P-79; V-66 to R-80; L-67 to
V-
81; L-68 to P-82; T-69 to W-83; F-70 to V-84; R-71 to K-85; D-72 to M-86; K-73
to I-87; E-74 to L-88; I-75 to S-89; C-76 to K-90; A-77 to L-91; D-78 to S-92;
and/or P-79 to Q-93 of SEQ ID N0:2. These polypeptide fragments may retain the
biological activity of the CK~3-13 polypeptides of the invention and may be
useful to
generate antibodies, as described further below. Polynucleotides encoding
these
polypeptide fragments are also encompassed by the invention.
The present application is also directed to proteins containing polypeptides
at
least 90%, 95%, 96%, 97%, 98% or 99% identical to the CK~3-13 polypeptide
sequence set forth herein as m'-n', mz-n2, m3-n3, and/or m4-n4. In preferred
embodiments, the application is directed to proteins containing polypeptides
at least
90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid
sequence of the specific CK[3-13 N- and C-terminal deletions recited herein.
Polynucleotides encoding these polypeptides are also encompassed by the
invention.
Preferably, the polynucleotide fragments of the invention encode a
polypeptide which demonstrates a CK(3-13 fi~nctional activity. By a
polypeptide
demonstrating a CK~3-13 "functional activity" is meant, a polypeptide capable
of
displaying one or more known functional activities associated with a full-
length
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-3 9-
(complete) CK[i-13 protein. Such functional activities include, but are not
limited to,
biological activity, antigenicity [ability to bind (or compete with a CK[i-13
polypeptide for binding) to an anti CK(3-13 antibody], immunogenicity (ability
to
generate antibody which binds to a CKJ3-13 polypeptide), ability to form
multimers
with CK(3-13 polypeptides of the invention, and ability to bind to a receptor
or ligand
for a CK(3-13 polypeptide.
The functional activity of CK(3-13 polypeptides, and fragments, variants
derivatives, and analogs thereof, can be assayed by various methods.
For example, in one embodiment where one is assaying for the ability to bind
or compete with full-length CK(3-13 polypeptide for binding to anti-CK(3-13
antibody, various immunoassays known in the art can be used, including but not
limited to, competitive and non-competitive assay systems using techniques
such as
radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich"
immunoassays, immunoradiometric assays, gel diffusion precipitation reactions,
immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or
radioisotope labels, for example), western blots, precipitation reactions,
agglutination
assays (e.g., gel agglutination assays, hemagglutination assays), complement
fixation
assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis
assays, etc. In one embodiment, antibody binding is detected by detecting a
label on
the primary antibody. In another embodiment, the primary antibody is detected
by
detecting binding of a secondary antibody or reagent to the primary antibody.
In a
further embodiment, the secondary antibody is labeled. Many means are known in
the art for detecting binding in an immunoassay and are within the scope of
the
present invention.
In another embodiment, where a CK[i-13 ligand is identified, or the ability of
a polypeptide fragment, variant or derivative of the invention to multimerize
is being
evaluated, binding can be assayed, e.g., by means well-known in the art, such
as, for
example, reducing and non-reducing gel chromatography, protein affinity
chromatography, and affinity blotting. See generally, Phizicky, E., et al.,
1995,
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-40-
Microbiol. Rev. 59:94-123. In another embodiment, physiological correlates of
CK~i-13 binding to its substrates (signal transduction) can be assayed.
In addition, assays described herein (see Examples) and otherwise known in
the art may routinely be applied to measure the ability of CK(3-13
polypeptides and
fragments, variants derivatives and analogs thereof to elicit CK~3-13 related
biological
activity (either in vitro or in vivo). Other methods will be known to the
skilled
artisan and are within the scope of the invention.
Among the especially preferred fragments of the invention are fragments
characterized by structural or functional attributes of CK(3-13 Such fragments
include
amino acid residues that comprise alpha-helix and alpha-helix forming regions
("alpha-regions"), beta-sheet and beta-sheet-forming regions ("beta-regions"),
turn
and turn-forming regions ("turn-regions"), coil and coil-forming regions
("coil-
regions"), hydrophilic regions, hydrophobic regions, alpha amphipathic
regions, beta
amphipathic regions, surface forming regions, and high antigenic index regions
(i.e.,
containing four or more contiguous amino acids having an antigenic index of
greater
than or equal to 1.5, as identified using the default parameters of the
Jameson-Wolf
program) of complete (i.e., full-length) CK(3-13 (SEQ 1D N0:2). Certain
preferred
regions are those set out in Figure 3 and include, but are not limited to,
regions of the
aforementioned types identified by analysis of the amino acid sequence
depicted in
Figure 1 (SEQ ID N0:2), such preferred regions include; Gamier-Robson
predicted
alpha-regions, beta-regions, turn-regions, and coil-regions; Chou-Fasman
predicted
alpha-regions, beta-regions, turn-regions, and coil-regions; Kyte-Doolittle
predicted
hydrophilic and hydrophobic regions; Eisenberg alpha and beta amphipathic
regions;
Emini surface-forming regions; and Jameson-Wolf high antigenic index regions,
as
predicted using the default parameters of these computer programs.
Polynucleotides
encoding these polypeptides are also encompassed by the invention.
In additional embodiments, the polynucleotides of the invention encode
fimctionai attributes of CK(3-13. Preferred embodiments of the invention in
this
regard include fragments that comprise alpha-helix and alpha-helix forming
regions
("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions"),
turn
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-41-
and turn-forming regions ("turn-regions"), coil and coil-forming regions
("coil-regions"), hydrophilic regions, hydrophobic regions, alpha amphipathic
regions, beta amphipathic regions, flexible regions, surface-forming regions
and high
antigenic index regions of CK(3-13.
The data representing the structural or functional attributes of CK(3-13 set
forth in Figure 1 and/or Table I, as described above, was generated using the
various
modules and algorithms of the DNA*STAR set on default parameters_ In a
preferred
embodiment, the data presented in columns VIII, IX, XIII, and XIV of Table I
can be
used to determine regions of CK(3-13 which exhibit a high degree of potential
for
antigenicity. Regions of high antigenicity are determined from the data
presented in
columns VIII, IX, XIII, and/or IV by choosing values which represent regions
of the
polypeptide which are likely to be exposed on the surface of the polypeptide
in an
environment in which antigen recognition may occur in the process of
initiation of an
immune response.
Certain preferred regions in these regards are set out in Figure 3, but may,
as
shown in Table I, be represented or identified by using tabular
representations of the
data presented in Figure 3. The DNA*STAR computer algorithm used to generate
Figure 3 (set on the original default parameters) was used to present the data
in
Figure 3 in a tabular format (See Table I). The tabular format of the data in
Figure 3
may be used to easily determine specific boundaries of a preferred region.
The above-mentioned preferred regions set out in Figure 3 and in Table I
include, but are not limited to, regions of the aforementioned types
identified by
analysis of the amino acid sequence set out in Figure 1. As set out in Figure
3 and in
Table I, such preferred regions include Gamier-Robson alpha-regions, beta-
regions,
turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and
coil-regions, Kyte-Doolittle hydrophilic regions and hydrophobic regions,
Eisenberg
alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Emini
surface-forming regions and Jameson-Wolf regions of high antigenic index.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-42-
Table 1
Res I II IIl IV V VI VII VIII IX X XI XII XIlIXIV
Position
Met 1 A A . . . . . 0.06 0.09 * . -0.300.60
*
Ala 2 A A . . . . . 0.13 0.06 * . -0.300.82
.
Arg 3 A A . . . . . -0.070.11 * . -0.300.93
*
Leu 4 A A . . . . . -0.490.19 * . -0.300.94
*
Gln 5 A A . . . . . -0.910.26 * . -0.300.77
.
Thr 6 A A . . . . . -1.170.44 * . -0.600.32
*
Ala ? A A . . . . . -1.431.09 * . -0.600.29
*
Leu 8 A A . . . . . -2.361.04 * . -0.600.13
*
Leu 9 A A . . . . . -2.401.33 . . -0.600.07
.
Val 10 A A . . . . . -3.211.49 . . -0.600.05
.
Val 11 A A . . . . . -3.711.67 . . -0.600.05
.
Leu 12 A A . . . . . -3.711.67 . . -0.600.05
.
Val 13 A A . . . . . -3.761.49 . . -0.600.07
.
Leu 14 A A . . . . . -3.531.49 . . -0.600.07
.
Leu 15 A A . . . . . -3.491.34 . . -0.600.09
.
Ala 16 A A . . . . . -2.631.34 . . -0.600.10
.
Val 17 A A . . . . . -2.411.10 . . -0.600.20
.
Ala 18 A A . . . . . -1.870.91 . . -0.600.25
.
Leu 19 A A . . . . . -1.060.71 . . -0.600.36
.
Gln 20 A A . . . . . -0.830.21 . . -0.300.84
.
Ala 21 A A . . . . . -0.590.07 . . -0.300.84
.
Thr 22 A A . . . . . 0.06 -0.00. . F 0.601.00
Glu 23 A A . . . . . 0.40 -0.26. . F 0.450.89
Ala 24 . A . . . . C 0.87 0.10 . F 0.201.39
.
Gly 25 . . : . . T C 0.28 0.03 . F 0,450.95
*
Pro 26 . . . . . T C 0.87 0.04 . F 0.450.56
*
Tyr 27 . . . . . T C 0.58 0.44 . F 0.150.88
.
Gly 28 . . . . . T C 0.58 0.56 . . 0.000.88
.
Ala 29 A . . . . . . 1.17 0.13 . . -0.100.99
.
Asn 30 A . . . . . . 1.21 -0.30 . . 0.651.05
*
Met 31 A . . . . . . 0.57 -0.67. . . 0.951.43
Glu 32 A . . . . . . 0. -0.46 . F 0.801.05
i4 .
Asp 33 A . . B . . . -0.18-0.39. * . 0.300.35
Ser 34 A . . B . . . 0.52 -0.21. * . 0.300.19
Val 35 A . . B . . . 0.52 -0.83. . . 0.600.21
Cys 36 A . . B . . . 0.88 -0.83. . . 0.910.21
Cys 37 A . . . . T . 0.02 -0.07 * . 1.320.25
*
Arg 38 A . . . . T . 0.13 0.19 * . 1.030.25
*
Asp 39 . . . . T T . 0.40 -0.46. * . 2.340.92
Tyr 40 . . . . T T . 1.37 -0.53. * . 3.102.32
Val 41 . . . B T . . 1.22 -1.10. * . 2.392.32
,.
Arg 42 . . . B T . . 1.68 -0.41 * . 1.781.15
*
His 43 . . . B T . . 0.76 0.01 * . 0.871.13
*
Arg 44 . . . B T . . 0.87 -0.06. * . 1.161.26
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-43-
Table I (continued}
Res Position 1 II III N V VI VII VIII IX X XI XII XIII XIV
Leu45 . . . B . . C 0.26 -0.70 * . 0.95 1.26
*
Pro46 A . . B . . . 0.26 -0.06 * . 0.30 0.69
*
Leu47 A . . B . . . 0.19 0.09 * . -0.300.26
*
Arg48 A . . B . . . 0.19 0.09 * . -0.300.63
*
Val49 A . . B . . . -0.62-0.10 * . 0.30 0.56
*
Val50 . . B B . . . -0.060.26 * . -0.300.58
*
Lys51 . . B B . . . -0.130.33 . . -0.300.47
*
His52 . . B B . . . 0.37 1.24 . . -0.600.66
*
Phe53 . . . B T . . -0.041.09 . . -0.051.28
*
Tyr54 . . . B T . . 0.81 0.83 . . -0.200.86
*
Trp55 . . . B T . . 1.37 0.83 . . -0.051.06
*
Thr56 . . . . T T . 0.66 0.71 . F 0.50 1.63
*
Ser57 . . . . T T . 0.48 0.50 * F 0.66 0.56
*
Asp58 . . . . T T . 1.29 0.17 * F 1.27 0.82
*
Ser59 . . . . T T . 1.32 -0.74 . F 2.63 1.12
*
Cys60 . . . . . T C 1.27 -0.80. * F 2.74 1.29
Pro61 . . . . T T . 0.72 -0.76. . F 3.10 0.76
Arg62 . . . . . T C 0.17 -0.11 . F 2.29 0.42
*
Pro63 . . . . T T . -0.640.14 . F 1.58 0.59
*
Gly64 . . . B T . . -1.160.26 . F 0.87 0.31
*
Val65 . . B B . . . -0.800.51 . . -0.290.13
*
Val66 . . B B . . . -1.291.00 * . -0.600.12
.
Leu67 . . B B . . . -1.291.36 * . -0.600.11
.
Leu68 . . B B . . . -1.080.93 * . -0.600.28
.
Thr69 A . . B . . . -0.690.29 * . -0.300.64
.
Phe70 A . . B . . . 0.17 -0.36. . . 0.45 1.55
Arg71 A . . B . . . 0.13 -1.04. * F 0.90 3.25
Asp72 A . . B _ . . 0.28 -1.04. . F 0.90 1.58
Lys73 A A . . . . . 0.50 -0.96. * F 0.75 0.98
Glu74 A A . . . . . 0.81 -1.24. . . 0.60 0.50
Ile75 . A . . T . . 1.30 -1.24. * . 1.28 0.50
Cys76 . A . . T . . 1.30 -0.81. * . 1.56 0.39
Ala77 . A . . T . . 0.44 -0.81 * . 1.84 0.44
*
Asp78 . . . . . T C 0.19 -0.17 * F 2.17 0.47
*
Pro79 . . . . T T . -0.10-0.43. * F 2.80 1.34
Arg80 A . . . . T . -0.07-0.09. * F 2.12 1.40
Val81 A . . . . T . 0.64 0.06 * . 0.94 0.62
.
Pro82 A . . B . . . 0.63 0.06 * . 0.26 0.80
.
Trp83 A . . B . . . -0.260.24 * . -0.020.41
.
Val84 A . . B . . . -0.860.93 . . -0.600.38
.
Lys85 A . . B . . . -1.270.97 . . -0.600.20
.
Met86 A . . B . . . -0.370.93 . . -0.600.26
*
Ile87 A . . B . . . -0.970.01 . . -0.300.70
*
Leu88 A . . B . . . -0.980.06 . . -0.300.29
*
CA 02387808 2002-05-14
WO 01132128 PCT/LTS00/30237
-44-
Table I (continued)
Res Position I II III N V VI VII VIII IX X XI XII XIII XIV
Ser 89 A A . . . . . -0.12 0.44 * . -0.60 0.39
.
Lys 90 A A . . . . . -0.56 0.23 * F -0.15 0.97
.
Leu 91 A A . . . . . -0.34 -0.03 F 0.60 1.50
* .
Ser 92 A A . . . . . 0.16 -0.29 . 0.45 1.43
* .
Gln 93 A A . . . . . 0. 5 8 -0. 24 . 0. 3 0.
* . 0 92
Other Mutants
In addition to terminal deletion forms of the protein discussed above, it also
will be recognized by one of ordinary skill in the art that some amino acid
sequences
of the CK(3-13 polypeptide can be varied without significant effect of the
structure or
I S function of the protein. If such differences in sequence are contemplated,
it should
be remembered that there will be critical areas on the protein which determine
activity.
Thus, the invention further includes variations of the CK[3-13 polypeptide
which show substantial CK(3-13 polypeptide activity or which include regions
of
CK~3-13 protein such as the protein portions discussed below. Such mutants
include
deletions, insertions, inversions, repeats, and type substitutions selected
according to
general rules known in the art so as have little effect on activity. For
example,
guidance concerning how to make phenotypically silent amino acid substitutions
is
provided in Bowie, J. U. et al., "Deciphering the Message in Protein
Sequences:
Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein
the
authors indicate that there are two main approaches for studying the tolerance
of an
amino acid sequence to change.
The first strategy exploits the tolerance of amino acid substitutions by
natural
selection during the process of evolution. By comparing amino acid sequences
in
different species, conserved amino acids can be identified. These conserved
amino
acids are likely important for protein function. In contrast, the amino acid
positions
where substitutions have been tolerated by natural selection indicates that
these
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-45-
positions are not critical for protein function. Thus, positions tolerating
amino acid
substitution could be modified while still maintaining biological activity of
the
protein.
The second strategy uses genetic engineering to introduce amino acid changes
at specific positions of a cloned gene to identify regions critical for
protein function.
For example, site directed mutagenesis or alanine-scanning mutagenesis
(introduction
of single alanine mutations at every residue in the molecule) can be used.
(Cunningham and Wells, Science 244:1081-1085 (1989).) The resulting mutant
molecules can then be tested for biological activity.
As the authors state, these two strategies have revealed that proteins are
surprisingly tolerant of amino acid substitutions. The authors further
indicate which
amino acid changes are likely to be permissive at certain amino acid positions
in the
protein. For example, most buried (within the tertiary structure of the
protein) amino
acid residues require nonpolar side chains, whereas few features of surface
side
chains are generally conserved. Moreover, tolerated conservative amino acid
substitutions involve replacement of the aliphatic or hydrophobic amino acids
Ala,
Val, Leu and Ile; replacement of the hydroxyl residues Ser and Thr;
replacement of
the acidic residues Asp and Glu; replacement of the amide residues Asn and
Gln,
replacement of the basic residues Lys, Arg, and His; replacement of the
aromatic
residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids
Ala, Ser,
Thr, Met, and Gly.
Amino acids in the CK(3-13 protein of the present invention that are essential
for function can be identified by methods known in the art, such as site-
directed
mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science
244:1081-1085 (1989)). The latter procedure introduces single alanine
mutations at
every residue in the molecule. The resulting mutant molecules are then tested
for
biological activity such as receptor binding or in vitro or in vitro
proliferative
activity.
Of special interest are substitutions of charged amino acids with other
charged or neutral amino acids which may produce proteins with highly
desirable
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-46-
improved characteristics, such as less aggregation. Aggregation may not only
reduce
activity but also be problematic when preparing pharmaceutical formulations,
because
aggregates can be immunogenic (Pinckard et al., Clin. L'xp. Immunol. 2:331-340
(19b7); Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit.
Rev.
Therapeutic Drag Carrier Systems 10:307-377 (1993).
Replacement of amino acids can also change the selectivity of the binding of a
ligand to cell surface receptors. For example, Ostade et al., NatZrre 361:266-
268
(I993) describes certain mutations resulting in selective binding of TNF-oc to
only
one of the two known types of TNF receptors. Sites that are critical for
ligand-
receptor binding can also be determined by structural analysis such as
crystallization,
nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol.
Biol.
224:899-904 (1992) and de Vos et al. Science 255:306-312 (1992)).
For example, site directed changes at the amino acid level of CK(3-13 can be
made by replacing a particular amino acid with a conservative amino acid.
Preferred
conservative mutations include: M1 replaced with A, G, I, L, S, T, or V; A2
replaced
with G, I, L, S, T, M, or V; R3 replaced with H, or K; L4 replaced with A, G,
I, S,
T, M, or V; QS replaced with N; T6 replaced with A, G, I, L, S, M, or V; A7
replaced with G, I, L, S, T, M, or V; L8 replaced with A, G, I, S, T, M, or V;
L9
replaced with A, G, I, S, T, M, or V; V10 replaced with A, G, I, L, S, T, or
M; Vl 1
replaced with A, G, 1, L, S, T, or M; L 12 replaced with A, G, I, S, T, M, or
V; V 13
replaced with A, G, I, L, S, T, or M; L 14 replaced with A, G, I, S, T, M, or
V; L 15
replaced with A, G, I, S, T, M, or V; A16 replaced with G, I, L, S, T, M, or
V; V17
replaced with A, G, I, L, S, T, or M; A18 replaced with G, I, L, S, T, M, or
V;
L19 replaced with A, G, I, S, T, M, or V; Q20 replaced with N; A21 replaced
with
G, I, L, S, T, M, or V; T22 replaced with A, G, I, L, S, M, or V; E23 replaced
with
D; A24 replaced with G, I, L, S, T, M, or V; G25 replaced with A, I, L, S, T,
M, or
V; Y27 replaced with F, or W; G28 replaced with A, I, L, S, T, M, or V; A29
replaced with G, 1, L, S, T, M, or V; N30 replaced with Q; M31 replaced with
A, G,
I, L, S, T, or V; E32 replaced with D; D33 replaced with E; S34 replaced with
A, G,
I, L, T, M, or V; V35 replaced with A, G, I, L, S, T, or M; R38 replaced with
H, or
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-47-
K; D39 replaced with E; Y40 replaced with F, or W; V41 replaced with A, G, I,
L, S,
T, or M; R42 replaced with H, or K; H43 replaced with K, or R; R44 replaced
with
H, or K; L45 replaced with A, G, I, S, T, M, or V; L4? replaced with A, G, I,
S, T,
M, or V; R48 replaced with H, or K; V49 replaced with A, G, I, L, S, T, or M;
V50
replaced with A, G, I, L, S, T, or M; K51 replaced with H, or R; H52 replaced
with
K, or R; F53 replaced with W, or Y; Y54 replaced with F, or W; W55 replaced
with
F, or Y; T56 replaced with A, G, I, L, S, M, or V; S57 replaced with A, G, I,
L, T,
M, or V; D58 replaced with E; S59 replaced with A, G, I, L, T, M, or V; R62
replaced with H, or K; G64 replaced with A, I, L, S, T, M, or V; V65 replaced
with
A, G, I, L, S, T, or M; V66 replaced with A, G, I, L, S, T, or M; L67 replaced
with
A, G, I, S, T, M, or V; L68 replaced with A, G, I, S, T, M, or V; T69 replaced
with
A, G, I, L, S, M, or V; F70 replaced with W, or Y; R71 replaced with H, or K;
D72
replaced with E; K73 replaced with H, or R; E74 replaced with D; I75 replaced
with
A, G, L, S, T, M,or V; A77 replaced with G, I, L; S, T, M, or V; D78 replaced
with
1 S E; R80 replaced with H, or K; V81 replaced with A, G, I, L, S, T, or M;
W83
replaced with F, or Y; V84 replaced with A, G, I, L, S, T, or M; K85 replaced
with
H, or R; M86 replaced with A, G, I, L, S, T, or V; I87 replaced with A, G, L,
S, T,
M, or V; L88 replaced with A, G, I, S, T, M, or V; S89 replaced with A, G, I,
L, T,
M, or V; K90 replaced with H, or R; L91 replaced with A, G, l, S, T, M, or V;
S92
replaced with A, G, I, L, T, M, or V; and/or Q93 replaced with N in SEQ >D
N0:2.
The resulting constructs can be routinely screened for activities or functions
described throughout the specification and known in the art. Preferably, the
resulting
constructs have one CK(3-13 activity or function increased and/or decreased,
while
the remaining CK~3-I3 activities or functions are maintained. More preferably,
the
resulting constructs have more than one CK~3-13 activity or function increased
and/or
decreased, while the remaining CK(3-13 activities or functions are maintained.
Besides conservative amino acid substitution, variants of CK(3-13 include (i)
substitutions with one or more of the non-conserved amino acid residues, where
the
substituted amino acid residues may or may not be one encoded by the genetic
code,
or (ii) substitution with one or more of amino acid residues having a
substituent
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-48-
group, or (iii) fusion of the mature polypeptide with another compound, such
as a
compound to increase the stability and/or solubility of the polypeptide (for
example,
polyethylene glycol), or (iv) fusion of the polypeptide with additional amino
acids,
such as, for example, an IgG Fc fusion region peptide, or leader or secretory
sequence, or a sequence facilitating purification. Such variant polypeptides
are
deemed to be within the scope of those skilled in the art from the teachings
herein.
For example, CK~3-13 polypeptide variants containing amino acid
substitutions of charged amino acids with other charged or neutral amino acids
may
produce proteins with improved characteristics, such as less aggregation.
Aggregation of pharmaceutical formulations both reduces activity and increases
clearance due to the aggregate's immunogenic activity. (Pinckard et al., Clin.
Exp.
Immunol. 2:331-340 (196?); Robbins et al., Diabetes 36: 838-845 (1987);
Cleland et
al., Crit. Rev. Therapeutic Drug Carrier Systems 10.307-377 (1993).}
For example, preferred non-conservative substitutions of CK(3-13 include:
M1 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A2 replaced with D, E,
H,
K, R, N, Q, F, W, Y, P, or C; R3 replaced with D, E, A, G, I, L, S, T, M, V,
N, Q, F,
W, Y, P, or C; L4 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; QS
replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; T6 replaced with
D, E,
H, K, R, N, Q, F, W, Y, P, or C; A7 replaced with D, E, H, K, R, N, Q, F,W, Y,
P,
or C; L8 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L9 replaced with
D, E,
H, K, R, N, Q, F, W, Y, P, or C; V 10 replaced with D, E, H, K, R, N, Q, F, W,
Y, P,
or C; V 11 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L 12 replaced
with D,
E, H, K, R, N, Q, F, W, Y, P, or C; V 13 replaced with D, E, H, K, R, N, Q, F,
W, Y,
P, or C; L14 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L15 replaced
with
D, E, H, K, R, N, Q, F, W, Y, P, or C; A16 replaced with D, E, H, K, R, N, Q,
F, W,
Y, P, or C; V17 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A18
replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; L 19 replaced with D, E, H, K, R,
N, Q,
F, W, Y, P, or C; Q20 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F,
W, Y,
P, or C; A21 replaced with D, E, H, K, R, N, Q, F,W, Y, P, or C; T22 replaced
with
D, E, H, K, R, N, Q, F, W, Y, P, or C; E23 replaced with H, K, R, A, G, I, L,
S, T,
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-49-
M, V, N, Q, F, W, Y, P, or C; A24 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or
C; G25 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P26 replaced with
D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; Y27 replaced with D, E,
H, K,
R, N, Q, A, G, I, L, S, T, M, V, P, or C; G28 replaced with D, E, H, K, R, N,
Q, F,
W, Y, P, or C; A29 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N30
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; M31
replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; E32 replaced with H, K, R, A, G,
I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; D33 replaced with H, K, R, A, G, I, L, S,
T, M,
V, N, Q, F, W, Y, P, or C; S34 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C;
V35 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C36 replaced with D,
E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; C37 replaced with D, E,
H, K,
R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; R38 replaced with D, E, A, G,
I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; D39 replaced with H, K, R, A, G, I, L, S,
T, M,
V, N, Q, F, W, Y, P, or C; Y40 replaced with D, E, H, K, R, N, Q, A, G, I, L,
S, T,
M, V, P, or C; V41 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R42
replaced with D, E, A, G, I, L, S,T, M, V, N, Q, F, W, Y, P, or C; H43
replaced with
D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R44 replaced with D, E,
A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L45 replaced with D, E, H, K, R, N,
Q, F,
W, Y, P, or C; P46 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W,
Y, or C; L47 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R48 replaced
with
D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V49 replaced with D, E,
H, K,
R, N, Q, F, W, Y, P, or C; V50 replaced with D, E, H, K, R, N, Q, F, W, Y, P,
or C;
K51 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H52
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F53
replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Y54 replaced with
D, E,
H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W55 replaced with D, E, H, K,
R, N,
Q, A, G, I, L, S, T, M, V, P, or C; T56 replaced with D, E, H, K, R, N, Q, F,
W, Y,
P, or C; S57 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D58 replaced
with
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S59 replaced with D,
E, H,
K, R, N, Q, F, W, Y, P, or C; C60 replaced with D, E, H, K, R, A, G, I, L, S,
T, M,
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-50-
V, N, Q, F, W, Y, or P; P61 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, N,
Q, F, W, Y, or C; R62 replaced with D, E, A, G, 1, L, S, T, M, V, N, Q, F, W,
Y, P,
or C; P63 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or C;
G64 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V65 replaced with D,
E,
H, K, R, N, Q, F, W, Y, P, or C; V66 replaced with D, E, H, K, R, N, Q, F,W,
Y, P,
or C; L67 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L68 replaced
with D,
E, H, K, R, N, Q, F, W, Y, P, or C; T69 replaced with D, E, H, K, R, N, Q, F,
W, Y,
P, or C; F70 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or
C; R71
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D72
replaced
with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K73 replaced
with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; E74 replaced with H, K, R,
A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; I75 replaced with D, E, H, K, R, N,
Q, F,
W, Y, P, or C; C76 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W,
Y, or P; A77 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D78 replaced
with
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; P79 replaced with D,
E, H,
K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; R80 replaced with D, E, A,
G, I,
L, S, T, M, V, N, Q, F, W, Y, P, or C; V81 replaced with D, E, H, K, R, N, Q,
F, W,
Y, P, or C; P82 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y,
or C; W83 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C;
V84
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K85 replaced with D, E,
A, G,
I, L, S, T, M, V, N, Q, F, W, Y, P, or C; M86 replaced with D, E, H, K, R, N,
Q, F,
W, Y, P, or C; I87 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L88
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S89 replaced with D, E,
H, K,
R, N, Q, F, W, Y, P, or C; K90 replaced with D, E, A, G, I, L, S, T, M, V, N,
Q, F,
W, Y, P, or C; L91 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S92
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; andlor Q93 replaced with
D, E,
H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C.
The invention further provides an isolated CK~3-13 polypeptide having the
amino acid sequence in SEQ m N0:2 wherein H43 is replaced with Y and/or S89 is
replaced with N. These replacements may occur singularly or together in the
full
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-$1-
length, mature, or proprotein form of CK(3-13 protein; as well as the N- and C
terminal deletion mutants having the general formula m'-n', m2-n2, m3-n3,
and/or m4
n4 listed above; and/or further variants, and polypeptide fragments of the
invention,
including but not limited to, predicted epitope fragments. These polypeptides
are
expected to retain the biological function of a CK~i-13 polypeptide.
The resulting constructs can be routinely screened for activities or functions
described throughout the specification and known in the art. Preferably, the
resulting
constructs have one CKJ3-13 activity or function increased and/or decreased,
while
the remaining CK(i-13 activities or functions are maintained. More preferably,
the
resulting constructs have more than one CK(3-13 activity or function increased
and/or
decreased, while the remaining CK~i-13 activities or functions are maintained.
Additionally, more than one amino acid (e.g., 2, 3, 4, 5, 6, 7, 8, 9 and 10)
can
be replaced with the substituted amino acids as described above (either
conservative
or nonconservative). The substituted amino acids can occur in the full length,
mature, or proprotein form of CK~i-13 protein, as well as the N- and C-
terminal
deletion mutants, having the general formula m'-n' and/or m2-n2, listed above.
A further embodiment of the invention relates to a polypeptide which
comprises the amino acid sequence of a CK(3-13 polypeptide having an amino
acid
sequence which contains at least one amino acid substitution, but not more
than 50
amino acid substitutions, even more preferably, not more than 40 amino acid
substitutions, still more preferably, not more than 30 amino acid
substitutions, and
still even more preferably, not more than 20 amino acid substitutions. Of
course, in
order of ever-increasing preference, it is highly preferable for a polypeptide
to have
an amino acid sequence which comprises the amino acid sequence of a CK~3-13
polypeptide, which contains at least one, but not more than 10, 9, 8, 7, 6, 5,
4, 3, 2 or
1 amino acid substitutions. In specific embodiments, the number of additions,
substitutions, and/or deletions in the amino acid sequence of Figure 1 or
fragments
thereof (e.g., the mature form and/or other fragments described herein), is 1-
5, 5-10,
5-25, S-50, 10-50 or 50-150, conservative amino acid substitutions are
preferable.
CA 02387808 2002-05-14
WO 01/32128 PCT/L1S00/30237
-S 2-
The polypeptides of the present invention are preferably provided in an
isolated form, and preferably are substantially purified. A recombinantly
produced
version of the CK(3-13 polypeptide can be substantially purified by the one-
step
method described in Smith and Johnson, Gene 67:31-40 (1988). Polypeptides of
the
invention also can be purified from natural or recombinant sources using anti-
CK(3-
13 antibodies of the invention in methods which are well known in the art of
protein
purifi cation.
The polypeptide of the present invention could be used as a molecular weight
marker on SDS-PAGE gels or on molecular sieve gel filtration columns using
methods well known to those of skill in the art.
As described in detail below, the polypeptides of the present invention can
also be used to raise polyclonal and monoclonal antibodies, which are useful
in assays
for detecting CK~3-13 protein expression as described below or as agonists and
antagonists capable of enhancing or inhibiting CK(3-13 protein function.
Further,
such polypeptides can be used in the yeast two-hybrid system to "capture" CK(3-
13
protein binding proteins which are also candidate agonists and antagonists
according
to the present invention. The yeast two hybrid system is described in Fields
and
Song, Nature 340:245-246 (1989).
Epitope-Bearing Portions
The present invention is also directed to polypeptide fragments comprising, or
alternatively consisting of, an epitope of the polypeptide sequence shown in
SEQ ID
N0:2, or the polypeptide sequence encoded by the cDNA contained in a deposited
clone. Polynucleotides encoding these epitopes (such as, for example, the
sequence
disclosed in SEQ ID NO:1) are also encompassed by the invention, as is the
nucleotide sequences of the complementary strand of the polynucleotides
encoding
these epitopes. And polynucleotides which hybridize to the complementary
strand
under stringent hybridization conditions or lower stringency conditions.
In the present invention, "epitopes" refer to polypeptide fragments having
antigenic activity and/or immunogenic activity in an animal, especially in a
human. A
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-53-
preferred embodiment of the present invention relates to a polypeptide
fragment
comprising an epitope, as well as the polynucleotide encoding this fragment. A
region of a protein molecule to which an antibody can bind is defined as an
"antigenic
epitope." In contrast, an "immunogenic epitope" is defined as a part of a
protein that
elicits an antibody response. (See, for instance, Geysen et al.,Proc. Natl.
Acad. Sci.
USA 81.3998- 4002 (1983).)
Fragments which function as epitopes may be produced by any conventional
means. (See, e.g., Houghten, R. A., Proc. Natl. Acad. Sci. USA 82:5131-5135
(1985) further described in U.S. Patent No. 4,631,211.)
In the present invention, antigenic epitopes preferably contain a sequence of
at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at
least 9, at least
10, at least 15, at least 20, at least 25, and most preferably between about
15 to
about 30 amino acids. Preferred polypeptides comprising immunogenic or
antigenic
epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75,
80, 85, 90,
95, or 100 amino acid residues in length. Antigenic epitopes are useful, for
example,
to raise antibodies, including monoclonal antibodies, that specifically bind
the
epitope. (See, for instance, Wilson et al., Cell 37:767-778 (1984); Sutcliffe
et al.,
Science 219:660-666 (1983).) Non-limiting examples of antigenic polypeptides
or
peptides that can be used to generate CK(i-13-specific antibodies include: a
polypeptide comprising amino acid residues from about Thr-22 to about Gly-28;
Asn-30 to about Leu-47; Thr-56 to about Val-65; and Phe-70 to about Trp-83.
These polypeptide fragments have been determined to bear antigenic epitopes of
the
CK(3-13 protein by the analysis of the Jameson-Wolf antigenic index, as shown
in
Figure 3 and Table l, above.
Similarly, immunogenic epitopes can be used, for example, to induce
antibodies according to methods well known in the art. (See, for instance,
Sutcliffe
et al., supra; Wilson et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA
82:910-
914; and Bittle et al., J. Gen. Virol. 66:2347-2354 (1985).) A preferred
immunogenic epitope includes the secreted protein. The immunogenic epitopes
may
be presented together with a carrier protein, such as an albumin, to an animal
system
CA 02387808 2002-05-14
WO 01/32128 PCT/I1S00/30237
-54-
(such as rabbit or mouse) or, if it is long enough (at least about 25 amino
acids),
without a carrier. However, immunogenic epitopes comprising as few as 8 to 10
amino acids have been shown to be sufficient to raise antibodies capable of
binding
to, at the very least, linear epitopes in a denatured polypeptide (e.g., in
Western
blotting.)
Epitope-bearing polypeptides of the present invention may be used to induce
antibodies according to methods well known in the art including, but not
limited to,
in vivo immunization, in vitro immunization, and phage display methods. See,
e.g.,
Sutclii~e et al., supra; Wilson et al., supra, and Bittle et al., J. Gen.
Virol.,
66:2347-2354 (1985). If in vivo immunization is used, animals may be immunized
with free peptide; however, anti-peptide antibody titer may be boosted by
coupling of
the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin
(KLH)
or tetanus toxoid_ For instance, peptides containing cysteine residues may be
coupled to a carrier using a linker such as -maleimidobenzoyl- N-
hydroxysuccinimide
ester (MBS), while other peptides may be coupled to carriers using a more
general
linking agent such as glutaraldehyde. Animals such as rabbits, rats and mice
are
immunized with either free or carrier-coupled peptides, for instance, by
intraperitoneal and/or intradermal injection of emulsions containing about 100
pgs of
peptide or earner protein and Freund's adjuvant. Several booster injections
may be
needed, for instance, at intervals of about two weeks, to provide a useful
titer of
anti-peptide antibody which can be detected, for example, by ELISA assay using
free
peptide adsorbed to a solid surface. The titer of anti-peptide antibodies in
serum
from an immunized animal may be increased by selection of anti-peptide
antibodies,
for instance, by adsorption to the peptide on a solid support and elution of
the
selected antibodies according to methods well known in the art.
As one of skill in the art will appreciate, and discussed above, the
polypeptides of the present invention comprising an immunogenic or antigenic
epitope can be fused to heterologous polypeptide sequences. For example, the
polypeptides of the present invention may be fused with the constant domain of
immunoglobulins (IgA, IgE, IgG, 1gM), or portions thereof (CH1, CH2, CH3, any
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-55-
combination thereof including both entire domains and portions thereof)
resulting in
chimeric polypeptides. These fizsion proteins facilitate purification, and
show an
increased half life in vivo. This has been shown, e.g., for chimeric proteins
consisting
of the first two domains of the human CD4-polypeptide and various domains of
the
constant regions of the heavy or light chains of mammalian immunoglobulins.
See,
e.g., EPA 0,394,827; Traunecker et al., Nature, 331:84-86 (1988). Fusion
proteins
that have a disulfide-linked dimeric structure due to the IgG portion can also
be more
e~cient in binding and neutralizing other molecules than monomeric
polypeptides or
fragments thereof alone. See, e.g., Fountoulakis et al., J. Biochem., 270:3958-
3964
(1995). Nucleic acids encoding the above epitopes can also be recombined with
a
gene of interest as an epitope tag to aid in detection and purification of the
expressed
polypeptide.
Fusion Proteins
As one of skill in the art will appreciate, and discussed above, the
polypeptides of the present invention comprising an immunogenic or antigenic
epitope can be fused to heterologous polypeptide sequences. For example, the
polypeptides of the present invention may be fused with the constant domain of
immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CH1, CH2, CH3, any
combination thereof including both entire domains and portions thereof)
resulting in
chimeric polypeptides. These fizsion proteins facilitate purification, and
show an
increased half life in vivo. This has been shown, e.g., for chimeric proteins
consisting
of the first two domains of the human CD4-polypeptide and various domains of
the
constant regions of the heavy or light chains of mammalian immunoglobulins.
See,
e.g., EPA 0,394,827; Traunecker et al., Nature, 331:84-86 (1988). Fusion
proteins
that have a disulfide-linked dimeric structure due to the IgG portion can also
be more
efficient in binding and neutralizing other molecules than monomeric
polypeptides or
fragments thereof alone. See, e.g., Fountoulakis et al., J. Biochem., 270:3958-
3964
(1995). Nucleic acids encoding the above epitopes can also be recombined with
a
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-56-
gene of interest as an epitope tag to aid in detection and purification of the
expressed
polypeptide.
Additional fusion proteins of the invention may be generated through the
techniques of gene-shuffling, motif shuffling, exon-shuffling, and/or codon-
shuffling
(collectively referred to as "DNA shuffling"). DNA shuffling may be employed
to
modulate the activities of polypeptides corresponding to SEQ ID N0:2 thereby
effectively generating agonists and antagonists of the polypeptides.
See,generally,
U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,837,458,
and
Patten, P.A., et al., Curr. Opinion Biotechnol. 8:724-33 ( 1997); Harayama,
S.,
Trends Biotechnol. 16(2):76-82 (1998); Hansson, L.O., et, al., J. Mol. Biol.
287:265-
76 (1999); and Lorenzo, M. M. and Blasco, R., Biotechniques 24(2):308-13
(1998)
(each of these patents and publications are hereby incorporated by reference).
In one
embodiment, alteration of polynucleotides corresponding to SEQ ID NO:1 and
corresponding polypeptides may be achieved by DNA shuffling. DNA shuffling
1 S involves the assembly of two or more DNA segments into a desired molecule
corresponding to SEQ ID NO:1 polynucleotides of the invention by homologous,
or
site-specific, recombination. In another embodiment, polynucleotides
corresponding
to SEQ ID NO:1 and corresponding polypeptides may be altered by being
subjected
to random mutagenesis by error-prone PCR, random nucleotide insertion or other
methods prior to recombination. In another embodiment, one or more components,
motifs, sections, parts, domains, fragments, etc., of coding polynucleotide
corresponding to SEQ ID NO:1, or the polypeptide encoded thereby may be
recombined with one or more components, motifs, sections, parts, domains,
fragments, etc. of one or more heterologous molecules.
Antibodies
The present invention further relates to antibodies and T-cell antigen
receptors (TCR) which specifically bind the polypeptides of the present
invention.
The antibodies of the present invention include IgG (including IgGl, IgG2,
IgG3,
and IgG4), IgA (including IgAl and IgA2), IgD, IgE, or IgM, and IgY. As used
CA 02387808 2002-05-14
WO 01/32128 PCTlUS00/30237
-57-
herein, the term "antibody" (Ab) is meant to include whole antibodies,
including
single-chain whole antibodies, and antigen-binding fragments thereof. Most
preferably the antibodies are human antigen binding antibody fragments of the
present invention and include, but are not limited to, Fab, Fab' and F(ab')2,
Fd,
single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv)
and
fragments comprising either a VL or VH domain. The antibodies may be from any
animal origin including birds and mammals. Preferably, the antibodies are
human,
murine, rabbit, goat, guinea pig, camel, horse, or chicken.
Antigen-binding antibody fragments, including single-chain antibodies, may
comprise the variable regions) alone or in combination with the entire or
partial of
the following: hinge region, CH1, CH2, and CH3 domains. Also included in the
invention are any combinations of variable regions) and hinge region, CHI,
CH2,
and CH3 domains. The present invention further includes monoclonal,
polyclonal,
chimeric, humanized, and human monoclonal and human polyclonal antibodies
which
specifically bind the polypeptides of the present invention. The present
invention
further includes antibodies which are anti-idiotypic to the antibodies of the
present
invention.
The antibodies of the present invention may be monospecific, bispecific,
trispecific or of greater multispecificity. Multispecific antibodies may be
specific for
different epitopes of a polypeptide of the present invention or may be
specific for
both a polypeptide of the present invention as well as for heterologous
compositions,
such as a heterologous polypeptide or solid support material. See, e.g., WO
93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol.
147:60-69 (1991); US Patents 5,573,920, 4,474,893, 5,601;819, 4,714,681,
4,925,648; Kostelny et al., J. Immunol. 148:1547-1553 (1992).
Antibodies of the present invention may be described or specified in terms of
the epitope(s) or portions) of a polypeptide of the present invention which
are
recognized or specifically bound by the antibody. The epitope(s) or
polypeptide
portion{s) may be specified as described herein, e.g., by N-terminal and C-
terminal
positions, by size in contiguous amino acid residues, or listed in the Tables
and
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-58-
Figures. Antibodies which specifically bind any epitope or polypeptide of the
present
invention may also be excluded. Therefore, the present invention includes
antibodies
that specifically bind polypeptides of the present invention, and allows for
the
exclusion of the same.
Antibodies of the present invention may also be described or specified in
terms of their cross-reactivity. Antibodies that do not bind any other analog,
ortholog, or homolog of the polypeptides of the present invention are
included.
Antibodies that do not bind polypeptides with less than 95%, less than 90%,
less than
85%, less than 80%, less than 75%, less than 70%, less than 65%, less than
60%, less
than 55%, and less than 50% identity (as calculated using methods known in the
art
and described herein) to a polypeptide of the present invention are also
included in
the present invention. Further included in the present invention are
antibodies which
only bind polypeptides encoded by polynucleotides which hybridize to a
polynucleotide of the present invention under stringent hybridization
conditions (as
described herein). Antibodies of the present invention may also be described
or
specified in terms of their binding affinity. Preferred binding affinities
include those
with a dissociation constant or Kd less than 5X10'6M, 10'~M, 5X10-7M, i0'7M,
5X10'RM, 10'8M, 5X10'~1VI, 10'9M, 5X10''°M, 10''°M, 5X10'"M, 10-
"M, 5X10''2M,
10''2M, 5X10''3M, 10''3M, 5X10''4M, 10''4M, 5X10''SM, and 10-'5M.
Antibodies of the present invention have uses that include, but are not
limited
to, methods known in the art to purify, detect, and target the polypeptides of
the
present invention including both in vitro and in vivo diagnostic and
therapeutic
methods. For example, the antibodies have use in immunoassays for
qualitatively and
quantitatively measuring levels of the polypeptides of the present invention
in
biological samples. See, e.g., Harlow et al., ANTIBODIES: A LABORATORY
MANUAL, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by
reference in the entirety).
The antibodies of the present invention may be used either alone or in
combination with other compositions. The antibodies may further be
recombinantly
fused to a heterologous polypeptide at the N- or C-terminus or chemically
CA 02387808 2002-05-14
WO 01/32128 PCTfUS00/30237
-59-
conjugated (including covalently and non-covalently conjugations) to
polypeptides or
other compositions. For example, antibodies of the present invention may be
recombinantly fused or conjugated to molecules useful as labels in detection
assays
and effector molecules such as heterologous polypeptides, drugs, or toxins.
See, e.g.,
WO 92/08495; WO 91/I4438; WO 89/12624; US Patent 5,314,995; and EP 0 396
387.
The antibodies of the present invention may be prepared by any suitable
method known in the art. For example, a polypeptide of the present invention
or an
antigenic fragment thereof can be administered to an animal in order to induce
the
production of sera containing polyclonal antibodies. The term "monoclonal
antibody" is not a limited to antibodies produced through hybridoma
technology.
The term "monoclonal antibody" refers to an antibody that is derived from a
single
clone, including any eukaryotic, prokaryotic, or phage clone, and not the
method by
which it is produced. Monoclonal antibodies can be prepared using a wide
variety of
techniques known in the art including the use of hybridoma, recombinant, and
phage
display technology.
Hybridoma techniques include those known in the art and taught in Harlow et
al., ANTIBODIES: A LABORATORY MANUAL, (Cold Spring Harbor Laboratory
Press, 2nd ed. 1988); Hammerling, et al., in: MONOCLONAL ANTIBODIES AND
T-CELL HYBRmOMAS 563-681 (Elsevier, N.Y., 1981) (said references
incorporated by reference in their entireties). Fab and F(ab')2 fragments may
be
produced by proteolytic cleavage, using enzymes such as papain (to produce Fab
fragments) or pepsin (to produce F(ab')2 fragments).
Alternatively, antibodies of the present invention can be produced through the
application of recombinant DNA and phage display technology or through
synthetic
chemistry using methods known in the art. For example, the antibodies of the
present invention can be prepared using various phage display methods known in
the
art. In phage display methods, functional antibody domains are displayed on
the
surface of a phage particle which carries polynucleotide sequences encoding
them.
Phage with a desired binding property are selected from a repertoire or
combinatorial
CA 02387808 2002-05-14
WO 01/32128 PCT/USOOJ30237
-60-
antibody library (e.g. human or murine) by selecting directly with antigen,
typically
antigen bound or captured to a solid surface or bead. Phage used in these
methods
are typically filamentous phage including fd and M13 with Fab, Fv or disulfide
stabilized Fv antibody domains recombinantly fused to either the phage gene
III or
gene VIII protein. Examples of phage display methods that can be used to make
the
antibodies of the present invention include those disclosed in Brinkman et
al., J.
Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-
186 (1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic
et al.,
Gene 187 9-i8 (1997); Burton et al., Advances in Immunology 57:191-280 (1994);
PCT/GB91/01134; WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619;
WO 93/11236; WO 95/15982; WO 95/20401; and US Patents 5,698,426, 5,223,409,
5,403,484, 5,580,717, 5,427,908, 5,750,753, 5,821,047, 5,571,698, 5,427,908,
5,516,637, 5,780,225, 5,658,727 and 5,733,743 (said references incorporated by
reference in their entireties).
As described in the above references, after phage selection, the antibody
coding regions from the phage can be isolated and used to generate whole
antibodies,
including human antibodies, or any other desired antigen binding fragment, and
expressed in any desired host including mammalian cells, insect cells, plant
cells,
yeast; and bacteria. For example, techniques to recombinantly produce Fab,
Fab' and
F(ab')2 fragments can also be employed using methods known in the art such as
those
disclosed in WO 92/22324; Mullinax et al., BioTechniques 12{6):864-869 (1992);
and Sawai et al., AJRI 34:26-34 (1995); and Better et al., Science 240:1041-
1043
(1988) (said references incorporated by reference in their entireties).
Examples of techniques which can be used to produce single-chain Fvs and
antibodies include those described in U.S. Patents 4,946,778 and 5,258,498;
Huston
et al., Methods in Enzymology 203:46-88 (1991); Shu, L. et al., PNAS 90:7995-
7999 (1993); and Skerra et al., Science 240:1038-1040 (1988). For some uses,
including in vivo use of antibodies in humans and in vitro detection assays,
it may be
preferable to use chimeric, humanized, or human antibodies. Methods for
producing
chimeric antibodies are known in the art. See e.g., Morrison, Science 229:1202
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-61-
(1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al., (1989) J.
lmmunol.
Methods 125:191-202; and US Patent 5,807,715. Antibodies can be humanized
using a variety of techniques including CDR-grafting (EP 0 239 400; WO
91/09967;
US Patent 5,530,101; and 5,585,089), veneering or resurfacing (EP 0 592 106;
EP 0
519 596; Padlan E.A., Molecular Immunology 28{4/5):489-498 (1991); Studnicka
et
al., Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973
(1994)), and chain shuffling (US Patent 5,565,332). Human antibodies can be
made
by a variety of methods known in the art including phage display methods
described
above. See also, US Patents 4,444,887, 4,716,111, 5,545,806, and 5,814,318;
and
WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO
96/33735, and WO 91/10741 (said references incorporated by reference in their
entireties).
Further included in the present invention are antibodies recombinantly fused
or chemically conjugated (including both covalently and non-covalently
conjugations)
to a polypeptide of the present invention. The antibodies may be specific for
antigens
other than polypeptides of the present invention. For example, antibodies may
be
used to target the polypeptides of the present invention to particular cell
types, either
in vitro or in vivo, by fusing or conjugating the polypeptides of the present
invention
to antibodies specific for particular cell surface receptors. Antibodies fused
or
conjugated to the polypeptides of the present invention may also be used in in
vitro
immunoassays and purification methods using methods known in the art. See
e.g.,
Harbor et al. supra and WO 93/21232; EP 0 439 095; Naramura et al., Immunol.
Lett. 39:91-99 (1994); US Patent 5,474,981; Gillies et al., PNAS 89:1428-1432
(1992); Fell et al., J. Immunol. 146:2446-2452(1991) (said references
incorporated
by reference in their entireties).
The present invention further includes compositions comprising the
polypeptides of the present invention fused or conjugated to antibody domains
other
than the variable regions. For example, the polypeptides of the present
invention may
be fused or conjugated to an antibody Fc region, or portion thereof. The
antibody
portion fused to a polypeptide of the present invention may comprise the hinge
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-62-
region, CHl domain, CHZ domain, and CH3 domain or any combination of whole
domains or portions thereof. The polypeptides of the present invention may 6e
fizsed
or conjugated to the above antibody portions to increase the in vivo half life
of the
polypeptides or for use in immunoassays using methods known in the art. The
polypeptides may also be fused or conjugated to the above antibody portions to
form
multimers. For example, Fc portions fi~sed to the polypeptides of the present
invention can form dimers through disulfide bonding between the Fc portions.
Higher multimeric forms can be made by fusing the polypeptides to portions of
IgA
and IgM. Methods for fusing or conjugating the polypeptides of the present
invention
to antibody portions are known in the art. See e.g., US Patents 5,336,603,
5,622,929, 5,359,046, 5,349,053, 5,447,851, 5,112,946; EP 0 307 434, EP 0 367
166; WO 96/04388, WO 91/06570; Ashkenazi et al., PNAS 88:10535-10539 (1991);
Zheng et al., J. Immunol. 154:5590-5600 (1995); and Vil et al., PNAS 89:11337-
11341(1992} (said references incorporated by reference in their entireties).
The invention further relates to antibodies which act as agonists or
antagonists of the polypeptides of the present invention. For example, the
present
invention includes antibodies which disrupt the receptor/ligand interactions
with the
polypeptides of the invention either partially or fully. Included are both
receptor-
specific antibodies and ligand-specific antibodies. Included are receptor-
specific
antibodies which do not prevent ligand binding but prevent receptor
activation.
Receptor activation (i.e., signaling) may be determined by techniques
described
herein or otherwise known in the art. Also included are receptor-specific
antibodies
which both prevent ligand binding and receptor activation. Likewise, included
are
neutralizing antibodies which bind the ligand and prevent binding of the
ligand to the
receptor, as well as antibodies which bind the ligand, thereby preventing
receptor
activation, but do not prevent the ligand from binding the receptor. Further
included
are antibodies which activate the receptor. These antibodies may act as
agonists for
either all or less than all of the biological activities affected by ligand-
mediated
receptor activation. The antibodies may be specified as agonists or
antagonists for
biological activities comprising specific activities disclosed herein. The
above
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-63-
antibody agonists can be made using methods known in the art. See e.g., WO
96/40281; US Patent 5,811,097; Deng et al., Blood 92(6):1981-1988 (1998);
Chen,
et al., Cancer Res. 58(16):3668-3678 (1998); Harrop et al., J. lmmunol.
161(4):1786-1794 (1998); Zhu et al., Cancer Res. 58(15):3209-3214 (1998);
Yoon,
et al., J. Immunol. 160(7):3170-3179 (1998); Prat et al., J. Cell. Sci.
111(Pt2):237-
247 (1998); Pitard et al., J. Immunol. Methods 205(2):177-190 (1997); Liautard
et
al., Cytokinde 9(4):233-241 {1997); Carlson et al., J. Biol. Chem.
272(17):11295
11301 (1997); Taryman et al., Neuron 14(4):755-762 (1995); Muller et al.,
Structure
6(9):1153-1167 {1998); Bartunek et al., Cytokine 8(1):14-20 (1996) (said
references
incorporated by reference in their entireties).
As discussed above, antibodies to the polypeptides of the invention can, in
turn, be utilized to generate anti-idiotype antibodies that "mimic"
polypeptides of the
invention using techniques well known to those skilled in the art. (See, e.g.,
Greenspan & Bona, FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol.
147(8):2429-2438 (1991)). For example, antibodies which bind to and
competitively
inhibit polypeptide multimerization and/or binding of a polypeptide of the
invention
to ligand can be used to generate anti-idiotypes that "mimic" the polypeptide
mutimerization and/or binding domain and, as a consequence, bind to and
neutralize
polypeptide and/or its ligand. Such neutralizing anti-idiotypes or Fab
fragments of
such anti-idiotypes can be used in therapeutic regimens to neutralize
polypeptide
ligand. For example, such anti-idiotypic antibodies can be used to bind a
polypeptide
of the invention and/or to bind its Iigands/receptors, and thereby block its
biological
activity.
The invention further relates to a diagnostic kit for use in screening serum
containing antibodies specific against proliferative and/or cancerous
polynucleotides
and polypeptides. Such a kit may include a substantially isolated polypeptide
antigen
comprising an epitope which is specifically immunoreactive with at least one
anti-
polypeptide antigen antibody. Such a kit also includes means for detecting the
binding of said antibody to the antigen. In specific embodiments, the kit may
include
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-64-
a recombinantly produced or chemically synthesized polypeptide antigen. The
polypeptide antigen of the kit may also be attached to a solid support.
In a more specific embodiment the detecting means of the above-described kit
includes a solid support to which said polypeptide antigen is attached. Such a
kit may
also include a non-attached reporter-labelled anti-human antibody. In this
embodiment, binding of the antibody to the polypeptide antigen can be detected
by
binding of the said reporter-labelled antibody.
The invention further includes a method of detecting proliferative and/or
cancerous disorders and conditions in a test subject. This detection method
includes
reacting serum from a test subject (e.g., one in which proliferative and/or
cancerous
cells or tissues may be present) with a substantially isolated polypeptide
and/or
polynucleotide antigen, and examining the antigen for the presence of bound
antibody. In a specific embodiment, the method includes a polypeptide antigen
attached to a solid support, and the serum is reacted with the support.
Subsequently,
1 S the support is reacted with a reporter labelled anti-human antibody. The
solid support
is then examined for the presence of reporter-labelled antibody.
Additionally, the invention includes a proliferative condition vaccine
composition. The composition includes a substantially isolated polypeptide
and/or
polynucleotide antigen, where the antigen includes an epitope which is
specifically
immunoreactive with at least antibody specific for the epitope. The peptide
and/or
polynucleotide antigen may be produced according to methods known in the art,
including recombinant expression or chemical synthesis. The peptide antigen is
preferably present in a pharmacologically effective dose in a pharmaceutically
acceptable Garner.
Further, the invention includes a monoclonal antibody that is specifically
immunoreactive with polypeptide and/or polynucleotide epitopes. The invention
includes a substantially isolated preparation of polyclonal antibodies
specifically
immunoreactive with polynucleotides and/or polypeptides of the present
invention. In
a more specific embodiment, such polyclonal antibodies are prepared by
affinity
chromatography, in addition to, other methods known in the art.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-65-
In another emodiment, the invention includes a method for producing
antibodies to polypeptide and/or polynucleotide antigens. The method includes
administering to a test subject a substantially isolated polypeptide and/or
polynucleotide antigen, where the antigen includes an epitope which is
specifically
immunoreactive with at least one anti- polypeptide and/or polynucleotide
antibody.
The antigen is administered in an amount sufficient to produce an immune
response
in the subject.
In an additional embodiment, the invention includes a diagnostic kit for use
in
screening serum containing antigens of the polypeptide of the invention. The
diagnostic kit includes a substantially isolated antibody specifically
immunoreactive
with polypeptide or polynucleotide antigens, and means for detecting the
binding of
the polynucleotide or polypeptide antigen to the antibody. In one embodiment,
the
antibody is attached to a solid support. In a specific embodiment, the
antibody may
be a monoclonal antibody. The detecting means of the kit may include a second,
labelled monoclonal antibody. Alternatively, or in addition, the detecting
means may
include a labelled, competing antigen.
In one diagnostic configuration, test serum is reacted with a solid phase
reagent having a surface-bound antigen obtained by the methods of the present
invention. After binding with specific antigen antibody to the reagent and
removing
unbound serum components by washing, the reagent is reacted with reporter-
labelled
anti-human antibody to bind reporter to the reagent in proportion to the
amount of
bound anti-antigen antibody on the solid support. The reagent is again washed
to
remove unbound labelled antibody, and the amount of reporter associated with
the
reagent is determined. Typically, the reporter is an enzyme which is detected
by
incubating the solid phase in the presence of a suitable fluorometric or
colorimetric
substrate (Sigma, St. Louis, MO).
The solid surface reagent in the above assay is prepared by known techniques
for attaching protein material to solid support material, such as polymeric
beads, dip
sticks, 96-well plate or filter material. These attachment methods generally
include
non-specific adsorption of the protein to the support or covalent attachment
of the
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-66-
protein, typically through a free amine group, to a chemically reactive group
on the
solid support, such as an activated carboxyl, hydroxyl, or aldehyde group.
Alternatively, streptavidin coated plates can be used in conjunction with
biotinylated
antigen(s).
Thus, the invention provieds an assay system or kit for carrying out this
diagnostic method. The kit generally includes a support with surface-bound
recombinant antigens, and a reporter-labelled anti-human antibody for
detecting
surface-bound anti-antigen antibody.
Immune System-Related Disorders
Immune Activity
CK(3-13 polynucleotides or polypeptides, or agonists or antagonists of CK~3-
13, may be useful in treating deficiencies or disorders of the immune system,
by
activating or inhibiting the proliferation, differentiation, or mobilization
(chemotaxis)
of immune cells. Immune cells develop through a process called hematopoiesis,
producing myeloid (platelets, red blood cells, neutrophils, and macrophages)
and
lymphoid (B and T lymphocytes) cells from pluripotent stem cells. The etiology
of
these immune deficiencies or disorders may be genetic, somatic, such as cancer
or
some autoimmune disorders, acquired (e.g., by chemotherapy or toxins), or
infectious. Moreover, CK(3-13 polynucleotides or polypeptides, or agonists or
antagonists of CK(3-13, can be used as a marker or detector of a particular
immune
system disease or disorder.
CK~3-13 polynucleotides or polypeptides, or agonists or antagonists of CK(3-
13, may be useful in treating or detecting deficiencies or disorders of
hematopoietic
cells. CK~i-13 polynucleotides or polypeptides, or agonists or antagonists of
CK~i-I3,
could be used to increase differentiation and proliferation of hematopoietic
cells,
including the pluripotent stem cells, in an effort to treat those disorders
associated
with a decrease in certain (or many) types hematopoietic cells. Examples of
immunologic deficiency syndromes include, but are not limited to: blood
protein
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-67-
disorders (e.g. agammaglobulinemia, dysgammaglobulinemia), ataxia
telangiectasia,
common variable immunodeficiency, Digeorge Syndrome, HIV infection, HTLV
BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte
bactericidal dysfunction, severe combined immunodeficiency (SC>Ds), Wiskott
Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
Moreover, CK(3-13 polynucleotides or polypeptides, or agonists or
antagonists of CK(3-13, can also be used to modulate hemostatic (the stopping
of
bleeding) or thrombolytic activity (clot formation). For example, by
increasing
hemostatic or thrombolytic activity, CKj3-13 polynucleotides or polypeptides,
or
agonists or antagonists of CK(3-13, could be used to treat blood coagulation
disorders (e.g., afibrinogenemia, factor deficiencies), blood platelet
disorders (e.g.
thrombocytopenia), or wounds resulting from trauma, surgery, or other causes.
Alternatively, CK(3-13 polynucleotides or polypeptides, or agonists or
antagonists of
CK(3-13, that can decrease hemostatic or thrombolytic activity could be used
to
1 S inhibit or dissolve clotting. These molecules could be important in the
treatment of
heart attacks (infarction), strokes, or scarring.
CK~i-I3 polynucleotides or polypeptides, or agonists or antagonists of CK[3-
13, may also be useful in treating or detecting autoimmune disorders. Many
autoimmune disorders result from inappropriate recognition of self as foreign
material by immune cells. This inappropriate recognition results in an immune
response leading to the destruction of the host tissue. Therefore, the
administration
of CK~3-13 polynucleotides or polypeptides, or agonists or antagonists of CK(3-
13,
that can inhibit an immune response, particularly the proliferation,
differentiation, or
chemotaxis of T-cells, may be an effective therapy in preventing autoimmune
disorders.
Examples of autoimmune disorders that can be treated or detected include,
but are not limited to: Addison's Disease, hemolytic anemia, antiphospholipid
syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis,
glomerulonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple
Sclerosis,
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-68-
Myasthenia Gravis, Neuritis, Ophthalmic, Bullous Pemphigoid, Pemphigus,
Polyendocrinopathies, Purpura, Reiter's Disease, Stiff Man Syndrome,
Autoimmune
Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation,
Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and autoimmune
inflammatory eye disease.
Similarly, allergic reactions and conditions, such as asthma (particularly
allergic asthma) or other respiratory problems, may also be treated by CK(3-13
polynucleotides or polypeptides, or agonists or antagonists of CK(3-13.
Moreover,
these molecules can be used to treat anaphylaxis, hypersensitivity to an
antigenic
molecule, or blood group incompatibility.
CK(3-13 polynucleotides or polypeptides, or agonists or antagonists of CK(3-
13, may also be used to treat and/or prevent organ rejection or graft-versus-
host
disease (GVHI~). Organ rejection occurs by host immune cell destruction of the
transplanted tissue through an immune response. Similarly, an immune response
is
also involved in GVHD, but, in this case, the foreign transplanted immune
cells
destroy the host tissues. The administration of CK~i-13 polynucleotides or
polypeptides, or agonists or antagonists of CK(3-13, that inhibits an immune
response, particularly the proliferation, differentiation, or chemotaxis of T-
cells, may
be an effective therapy in preventing organ rejection or GVHD.
Similarly, CK(3-13 polynucleotides or polypeptides, or agonists or antagonists
of CK~3-13, may also be used to modulate inflammation. For example, CK(3-13
polynucleotides or polypeptides, or agonists or antagonists of CK(3-13, may
inhibit
the proliferation and differentiation of cells involved in an inflammatory
response.
These molecules can be used to treat inflammatory conditions, both chronic and
acute conditions, including chronic prostatitis, granulomatous prostatitis and
malacoplakia, inflammation associated with infection (e.g., septic shock,
sepsis, or
systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury,
endotoxin lethality, arthritis, complement-mediated hyperacute rejection,
nephritis,
CA 02387808 2002-05-14
WO. 01/32128 PCT/US00/30237
-69-
cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's
disease, or resulting from over production of cytokines (e.g., TNF or IL-1.)
lnfectious Disease
CK~3-13 polynucleotides or polypeptides, or agonists or antagonists of CK(3-
13, can be used to treat or detect infectious agents. For example, by
increasing the
immune response, particularly increasing the proliferation and differentiation
of B
and/or T cells, infectious diseases may be treated. The immune response may be
increased by either enhancing an existing immune response, or by initiating a
new
immune response. For example, CK(3-13 polynucleotides or polypeptides, or
agonists
or antagonists of CK~i-13, may recruite naive T cells to a site of new
infection.
Alternatively, CK~i-13 polynucleotides or polypeptides, or agonists or
antagonists of
CK(3-13, may also directly inhibit the infectious agent, without necessarily
eliciting an
immune response.
Viruses are one example of an infectious agent that can cause disease or
symptoms that can be treated or detected by a polynucleotide or polypeptide
and/or
agonist or antagonist of the present invention. Examples of viruses, include,
but are
not limited to Examples of viruses, include, but are not limited to the
following DNA
and RNA viruses and viral families: Arbovirus, Adenoviridae, Arenaviridae,
Arterivirus, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae,
Coronaviridae,
Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis), Herpesviridae
(such
as, Cytomegalovirus, Herpes Simplex, Herpes Zoster), Mononegavirus (e.g.,
Paramyxoviridae, Morbillivirus, Rhabdoviridae), Orthomyxoviridae (e.g.,
Influenza
A, Influenza B, and parainfluenza), Papiloma virus, Papovaviridae,
Parvoviridae,
Picornaviridae, Poxviridae (such as Smallpox or Vaccinia), Reoviridae (e.g.,
Rotavirus), Retroviridae (HTLV-I, HTLV-II, Lentivirus), and Togaviridae (e.g.,
Rubivirus). Viruses falling within these families can cause a variety of
diseases or
symptoms, including, but not limited to: arthritis, bronchiollitis,
respiratory syncytial
virus, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic
fatigue
syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), Japanese B
encephalitis,
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-70-
Junin, Chikungunya, Rift Valley fever, yellow fever, meningitis, opportunistic
infections (e.g., A)DS), pneumonia, Burkitt's Lymphoma, chickenpox,
hemorrhagic
fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio,
leukemia,
Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts),
and
viremia. polynucleotides or polypeptides, or agonists or antagonists of the
invention,
can be used to treat or detect any of these symptoms or diseases. In specific
embodiments, polynucleotides, polypeptides, or agonists or antagonists of the
invention are used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g.,
hepatitis
B). In an additional specific embodiment polynucleotides, polypeptides, or
agonists
or antagonists of the invention are used to treat patients nonresponsive to
one or
more other commercially available hepatitis vaccines. In a further specific
embodiment polynucleotides, polypeptides, or agonists or antagonists of the
invention are used to treat AIDS.
Similarly, bacterial or fungal agents that can cause disease or symptoms and
1 S that can be treated or detected by a polynucleotide or polypeptide and/or
agonist or
antagonist of the present invention include, but not limited to, include, but
not limited
to, the following Gram-Negative and Gram-positive bacteria and bacterial
families
and fungi: Actinomycetales (e.g., Corynebacterium, Mycobacterium, Norcardia),
Cryptococcus neoformans, Aspergillosis, Bacillaceae (e.g., Anthrax,
Clostridium),
Bacteroidaceae, Blastomycosis, Bordetella, Borrelia (e.g., Borrelia
burgdorferi,
Brucellosis, Candidiasis, Campylobacter, Coccidioidomycosis, Cryptococcosis,
Dermatocycoses, E. coli (e.g., Enterotoxigenic E. coli and Enterohemorrhagic
E.
coli), Enterobacteriaceae (Klebsiella, Salmonella {e.g., Salmonella typhi, and
Salmonella paratyphi}, Serratia, Yersinia), Erysipelothrix, Helicobacter,
Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Mycobacterium leprae,
Vibrio cholerae, Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal),
Meisseria meningitidis, Pasteurellacea Infections (e.g., Actinobacillus,
Heamophilus
(e.g., Heamophilus influenza type B), Pasteurella), Pseudomonas,
Rickettsiaceae,
Chlamydiaceae, Syphilis, Shigella spp., Staphylococcal, Meningiococcal,
Pneumococcal and Streptococcal (e.g., Streptococcus pneumoniae and Group B
CA 02387808 2002-05-14
WO 01/32128 PCT/US00130237
-71-
Streptococcus). These bacterial or fungal families can cause the following
diseases
or symptoms, including, but not limited to: bacteremia, endocarditis, eye
infections
(conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections
(e.g., AIDS
related infections), paronychia, prosthesis-related infections, Reiter's
Disease,
respiratory tract infections, such as Whooping Cough or Empyema, sepsis, Lyme
Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning,
Typhoid, pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B),
Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis,
Lupus,
Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever,
sexually
transmitted diseases, skin diseases (e.g., cellulitis, dermatocycoses),
toxemia, urinary
tract infections, wound infections. Polynucleotides or polypeptides, agonists
or
antagonists of the invention, can be used to treat or detect any of these
symptoms or
diseases. In specific embodiments, Ppolynucleotides, polypeptides, agonists or
antagonists of the invention are used to treat: tetanus, Diptheria, botulism,
and/or
meningitis type B.
Moreover, parasitic agents causing disease or symptoms that can be treated
or detected by a polynucleotide or polypeptide and/or agonist or antagonist of
the
present invention include, but not limited to, the following families or
class:
Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis,
Dourine,
Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis,
Toxoplasmosis,
Trypanosomiasis, and Trichomonas and Sporozoans (e.g., Plasmodium virax,
Plasmodium falciparium, Plasmodium malariae and Plasmodium ovate). These
parasites can cause a variety .of diseases or symptoms, including, but not
limited to:
Scabies, Trombiculiasis, eye infections, intestinal disease (e.g., dysentery,
giardiasis),
Iiver disease, lung disease, opportunistic infections (e.g., AIDS related),
malaria,
pregnancy complications, and toxoplasmosis. polynucleotides or polypeptides,
or
agonists or antagonists of the invention, can be used to treat or detect any
of these
symptoms or diseases. In specific embodiments, polynucleotides, polypeptides,
or
agonists or antagonists of the invention are used to treat malaria.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00l30237
-72-
Preferably, treatment using a polypeptide or polynucleotide and/or agonist or
antagonist of the present invention could either be by administering an
effective
amount of a polypeptide to the patient, or by removing cells from the patient,
supplying the cells with a polynucleotide of the present invention, and
returning the
engineered cells to the patient (ex vivo therapy). Moreover, the polypeptide
or
polynucleotide of the present invention can be used as an antigen in a vaccine
to raise
an immune response against infectious disease.
Diagnosis
The present inventors have discovered that CK~i-13 is expressed inactivated
monocytes and ex vivo expanded dendritic cells. For a number of immune system-
related disorders, substantially altered (increased or decreased) levels of
CK~i-13
gene expression can be detected in immune system tissue or other cells or
bodily
fluids (e.g., sera, plasma, urine, synovial fluid or spinal fluid) taken from
an individual
having such a disorder, relative to a "standard" CK(3-13 gene expression
level, that
is, the CK(3-13 expression level in inunune system tissues or bodily fluids
from an
individual not having the immune system disorder. Thus, the invention provides
a
diagnostic method useful during diagnosis of a immune system disorder, which
involves measuring the expression level of the gene encoding the CK(3-13
protein in
immune system tissue or other cells or body fluid from an individual and
comparing
the measured gene expression level with a standard CK/3-13 gene expression
level,
whereby an increase or decrease in the gene expression level compared to the
standard is indicative of an immune system disorder.
In particular, it is believed that certain tissues in mammals with cancer of
the
immune system express significantly altered (i.e., either enhanced or
decreased) levels
of the CK(3-13 protein and mRNA encoding the CK(3-13 protein when compared to
a
corresponding "standard" level. Further, it is believed that altered levels of
the CK~i
13 protein can be detected in certain body fluids (e.g., sera, plasma, urine,
and spinal
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-73-
fluid) from mammals with such a cancer when compared to sera from mammals of
the same species not having the cancer.
Thus, the invention provides a diagnostic method useful during diagnosis of
an immune system disorder, including cancers of this system which involves
measuring the expression level of the gene encoding the CK(3-13 protein in
immune
system tissue or other cells or body fluid from an individual and comparing
the
measured gene expression level with a standard CK(3-13 gene expression level,
whereby a significant increase or decrease in the gene expression level
compared to
the standard is indicative of an immune system disorder.
Where a diagnosis of a disorder in the immune system, including diagnosis of
a tumor has already been made according to conventional methods, the present
invention is useful as a prognostic indicator, whereby patients exhibiting a
significantly altered CK(3-13 gene expression will experience a worse clinical
outcome relative to patients expressing the gene at a level nearer the
standard level.
By "assaying the expression level of the gene encoding the CK(3-13 protein"
is intended qualitatively or quantitatively measuring or estimating the level
of the
CK~i-l3 protein or the level of the mRNA encoding the CK(3-13 protein in a
first
biological sample either directly (e.g., by determining or estimating absolute
protein
level or mRNA level) or relatively (e.g., by comparing to the CK(3-13 protein
level
or mRNA level in a second biological sample). Preferably, the CK(3-13 protein
level
or mRNA level in the first biological sample is measured or estimated and
compared
to a standard CK~3-13 protein level or mRNA level, the standard being taken
from a
second biological sample obtained from an individual not having the disorder
or being
determined by averaging levels from a population of individuals not having a
disorder
of the immune system. As will be appreciated in the art, once a standard CK~3-
13
protein level or mRNA level is known, it can be used repeatedly as a standard
for
comparison.
By "biological sample" is intended any biological sample obtained from an
individual, body fluid, cell line, tissue culture, or other source which
contains CK(3-13
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-74-
protein or mRNA. As indicated, biological samples include body fluids (such as
sera,
plasma, urine, synovial fluid and spinal fluid) which contain free CK(3-13
protein,
immune system tissue, and other tissue sources found to express complete or
mature
CK~i-13 or a CK(i-13 receptor. Methods for obtaining tissue biopsies and body
S fluids from mammals are well known in the art. Where the biological sample
is to
include mRNA, a tissue biopsy is the preferred source.
The present invention is useful for diagnosis or treatment of various immune
system-related disorders, including disregulation of immune cell function in
mammals, preferably humans. Such disorders include tumors, cancers,
interstitial
lung disease (such as Langerhans cell granulomatosis) and any disregulation of
immune cell function including but not limited to, leukemias, lymphomas,
autoimmune diseases, arthritis, immune suppression, histamine and IgE-mediated
allergic reactions, sepsis, prostaglandin-independant fever, bone marrow
failure,
wound healing, silicosis, sarcoidosis, acute and chronic infection, cell
mediated
immunity, humoral immunity, inflammatory bowel disease, mylosuppression and
hyper-eosinophil syndrome and the like.
Total cellular RNA can be isolated from a biological sample using any suitable
technique such as the single-step guanidinium-thiocyanate-phenol-chloroform
method
described in Chomczynski and Sacchi, Anal. Biochem. 162:156-159 (1987). Levels
of mRNA encoding the CK~i-13 protein are then assayed using any appropriate
method. These include Northern blot analysis, S 1 nuclease mapping, the
polymerase
chain reaction (PCR), reverse transcription in combination with the polymerase
chain
reaction (RT-PCR), and reverse transcription in combination with the ligase
chain
reaction (RT-LCR).
Assaying CK~i-13 protein levels in a biological sample can occur using
antibody-based techniques. For example CKj3-13 protein expression in tissues
can be
studied with classical immunohistological methods (Jalkanen, M., et al., .I.
Cell.
Biol. 101:976-985 (1985); Jalkanen, M., et al., J. Cell . Biol. 105:3087-3096
(1987)). Other antibody-based methods useful for detecting CK(3-13 protein
gene
expression include immunoassays, such as the enzyme linked immunosorbent assay
CA 02387808 2002-05-14
WO 01/32128 PCTlUS00/30237
-75-
(ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are
known
in the art and include enzyme labels, such as, glucose oxidase, and
radioisotopes,
such as iodine ('zsl, 'z'I), carbon ('4C), sulfur (3sS), tritium (3H), indium
("zIn), and
technetium (99"'Tc), and fluorescent labels, such as fluorescein and
rhodamine, and
biotin.
In addition to assaying CK[3-13 protein levels in a biological sample obtained
from an individual, CK[3-13 protein can also be detected in vivo by imaging.
Antibody labels or markers for in vivo imaging of CK(3-13 protein include
those
detectable by X-radiography, NMR or ESR. For X-radiography, suitable labels
include radioisotopes such as barium or cesium, which emit detectable
radiation but
are not overtly harmful to the subject. Suitable markers for NMR and ESR
include
those with a detectable characteristic spin, such as deuterium, which may be
incorporated into the antibody by labeling of nutrients for the relevant
hybridoma.
A CK(3-13 protein-specific antibody or antibody fragment which has been
labeled with an appropriate detectable imaging moiety, such as a radioisotope
(for
example, '3'I, "zln, 99'"Tc), a radio-opaque substance, or a material
detectable by
nuclear magnetic resonance, is introduced (for example, parenterally,
subcutaneously
or intraperitoneally) into the mammal to be examined for immune system
disorder. It
will be understood in the art that the size of the subject and the imaging
system used
will determine the quantity of imaging moiety needed to produce diagnostic
images.
In the case of a radioisotope moiety, for a human subject, the quantity of
radioactivity injected will normally range from about 5 to 20 millicuries of
99"'Tc.
The labeled antibody or antibody fragment will then preferentially accumulate
at the
location of cells which contain CK(3-13 protein. In vivo tumor imaging is
described
in S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies
and
Their Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical Detection of
Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982)).
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-76-
Treatment
As noted above, CK~3-13 polynucleotides and polypeptides are useful for
diagnosis of conditions involving abnormally high or low expression of CK~i-13
activities. Given the cells and tissues where CK(3-13 is expressed as well as
the
activities modulated by CKj3-13, it is readily apparent that a substantially
altered
{increased or decreased) level of expression of CK~3-13 in an individual
compared to
the standard or "normal" level produces pathological conditions related to the
bodily
systems) in which CK~3-13 is expressed and/or is active.
It will also be appreciated by one of ordinary skill that, since the CK[3-13
protein of the invention is a member of the chemokine beta family the mature
forms)
of the protein rnay be released in soluble form from the cells which express
the CK(3-
13 by proteolytic cleavage. Therefore, when mature CK(3-13 is added from an
exogenous source to cells, tissues or the body of an individual, the protein
will exert
its physiological activities on its target cells of that individual.
Therefore, it will be appreciated that conditions caused by a decrease in the
standard or normal level of CK(3-13 activity in an individual, particularly
disorders of
the immune system, ca.n be treated by administration of CK(3-13 polypeptide
(in the
form of mature protein. Thus, the invention also provides a method of
treatment of
an individual in need of an increased level of CK(3-13 activity comprising
administering to such an individual a pharmaceutical composition comprising an
amount of an isolated CKj3-I3 polypeptide of the invention, particularly a
mature
form of the CKj3-13 effective to increase the CK~3-13 activity level in such
an
individual.
The polypeptides of the present invention may be emplyed to inhibit bone
2.5 marrow stem cell colony formation as an adjunct protective treatment
during cancer
chemotherapy. The CK(3-13 polypeptide may inhibit the proliferation and
dii~erentiation of hematopoietic cells such as bone marrow stem cells. The
inhibitor
effect on the population of committed progenitor cells, (for example,
granulocytes,
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
_77_
and macrophages/monocytes) may be employed therapeutically to inhibit
proliferation of leukemic cells.
The polypeptides of the present invention may also be employed to inhibit
epidermal keratinocyte proliferation for treatment of psoriasis, which is
characterized
by keratinocyte hyper-proliferation, since Langerhans cells in skin have been
found to
produce chemokines.
CK(3-13 may be employed as an anti-neovascularizing agent to treat solid
tumors; e.g., Karposi sarcoma by stimulating the invasion and activation of
host
defense cells; e.g., cytotoxic T cells and macrophages and by inhibiting the
angiogenesis of tumors. Those of skill in the art will recognize other non-
cancer
indications where blood vessel proliferation is not wanted.
CK(3-13 polypeptides may be employed to enhance host defenses against
resistant chronic and acute infections, for example, mycobacterial infections
via the
attraction and activation of microbicidal leukocytes.
CK~i-13 may also be employed to inhibit T-cell proliferation by the inhibition
of IL-2 biosynthesis for the treatment of T-cell mediated auto-immune diseases
and
Iymphocytic leukemias.
CK(3-13 may also be employed to stimulate wound healing and prevent
scarnng during healing, both via the recruitment of debris clearing and
connective
tissue promoting inflammatory cells and also via its control of excessive TGF -
mediated fibrosis. In this same manner, CKJ3-13 may also be employed to treat
other
fibrotic disorders, including liver cirrhosis, osteoarthritis and pulmonary
fibrosis.
CK(3-13 also increases the presence of eosinophils which have the distinctive
fiznction of killing the larvae of parasites that invade tissues, as in
schistosomiasis,
trichinosis and ascariasis. CKj3-13 also increases the presence of and
activates
Natural Killer (NK) cells which will be useful for treating a variety of
diseases in
which the presence of NK cells are beneficial well known to those of skill in
the art.
It may also be employed to regulate hematopoiesis, by regulating the
activation and differentiation of various hematopoietic progenitor cells, for
example,
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
_78_
to release mature leukocytes from the bone marrow following chemotherapy,
i.e., in
stem cell mobilization.
CK(3-13 may also be employed to treat sepsis and is useful for immune
enhancement or suppression, myeloprotection, and acute and chronic
inflammatory
control.
They may also be employed to regulate hematopoiesis, by regulating
activation and differentiation of various hematopoietic progenitor cells, for
example,
to release mature leukocytes from the bone marrow following chemotherapy.
The polypeptides of the present invention may also be used to target
unwanted cells, such as in the treatment of cancer, for apoptosis.
The polypeptide may also be used to mobilize bone marrow stem cells to
peripheral blood, which allows easy isolation of stem cells. The isolation of
stem
cells may be employed for bone marrow colonization after high dose
chemotherapy.
Chemotnxis
CK(3-13 polynucleotides or polypeptides, or agonists or antagonists of CK~3-
13, may have chemotaxis activity. A chemotaxic molecule attracts or mobilizes
cells
(e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils,
epithelial
and/or endothelial cells) to a particular site in the body, such as
inflammation,
infection, or site of hyperproliferation. The mobilized cells can then fight
off and/or
heal the particular trauma or abnormality.
CK(3-13 polynucleotides or polypeptides, or agonists or antagonists of CK~i-
13, may increase chemotaxic activity of particular cells. These chemotactic
molecules can then be used to treat inflammation, infection,
hyperproliferative
disorders, or any immune system disorder by increasing the number of cells
targeted
to a particular location in the body. For example, chemotaxic molecules can be
used
to treat wounds and other trauma to tissues by attracting immune cells to the
injured
location. Chemotactic molecules of the present invention can also attract
fibroblasts,
which can be used to treat wounds.
CA 02387808 2002-05-14
WO 01/32128 PCTlUS00/30237
-79-
It is also contemplated that CK~3-13 polynucleotides or polypeptides, or
agonists or antagonists of CK(3-13, rnay inhibit chemotactic activity. These
molecules could also be used to treat disorders. Thus, CK~i-13 polynucleotides
or
polypeptides, or agonists or antagonists of CK(3-13, could be used as an
inhibitor of
chemotaxis.
Binding Activity
CK~i-13 polypeptides may be used to screen for molecules that bind to CK(3
13 or for molecules to which CK(3-13 binds. The binding of CK~i-13 and the
i 0 molecule may activate (agonist), increase, inhibit (antagonist), or
decrease activity of
the CK~i-13 or the molecule bound. Examples of such molecules include
antibodies,
oligonucleotides, proteins (e.g., receptors, such as CCR4), or small
molecules.
Preferably, the molecule is closely related to the natural ligand of CK(3-13,
e.g., a fragment of the ligand, or a natural substrate, a Iigand, a structural
or
functional mimetic. (See, Coligan et al., Current Protocols in immunology
1(2}:
Chapter 5 (1991).) Similarly, the molecule can be closely related to the
natural
receptor to which CK(3-13 binds, or at least, a fragment of the receptor
capable of
being bound by CK/3-13 (e.g., active site}. In either case, the molecule can
be
rationally designed using known techniques.
Preferably, the screening for these molecules involves producing appropriate
cells which express CK~i-13, either as a secreted protein or on the cell
membrane.
Preferred cells include cells from mammals, yeast, Drosophila, or E. coli.
Cells
expressing CK(3-13 (or cell membrane containing the expressed polypeptide) are
then
preferably contacted with a test compound potentially containing the molecule
to
observe binding, stimulation, or inhibition of activity of either CK(3-13 or
the
molecule.
The assay may simply test binding of a candidate compound to CK[3-13,
wherein binding is detected by a label, or in an assay involving competition
with a
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-80-
labeled competitor. Further, the assay may test whether the candidate compound
results in a signal generated by binding to CKø-13.
Alternatively, the assay can be carried out using cell-free preparations,
polypeptidelmolecule affixed to a solid support, chemical libraries, or
natural product
mixtures. The assay may also simply comprise the steps of mixing a candidate
compound with a solution containing CKø-13, measuring CKø-13 /molecule
activity
or binding, and comparing the CKø-13 /molecule activity or binding to a
standard.
Preferably, an ELISA assay can measure CKø-13 level or activity in a sample
(e.g., biological sample) using a monoclonal or polyclonal antibody. The
antibody
can measure CKø-13 level or activity by either binding, directly or
indirectly, to
CKø-13 or by competing with CKø-13 for a substrate.
Additionally, the receptor to which CKø-13 binds can be identified by
numerous methods known to those of skill in the art, for example, ligand
panning and
FACS sorting (Coligan, et al., Current Protocols in Immun., 1 (2), Chapter 5,
(1991)). For example, expression cloning is employed wherein polyadenylated
RNA
is prepared from a cell responsive to the polypeptides, for example, NIH3T3
cells
which are known to contain multiple receptors for the FGF family proteins, and
SC-3
cells, and a cDNA library created from this RNA is divided into pools and used
to
transfect COS cells or other cells that are not responsive to the
polypeptides.
Transfected cells which are grown on glass slides are exposed to the
polypeptide of
the present invention, after they have been labelled. The polypeptides can be
labeled
by a variety of means including iodination or inclusion of a recognition site
for a site-
specific protein kinase.
Following fixation and incubation, the slides are subjected to auto
radiographic analysis. Positive pools are identified and sub-pools are
prepared and
re-transfected using an iterative sub-pooling and re-screening process,
eventually
yielding a single clones that encodes the putative receptor.
As an alternative approach for receptor identification, the labeled
polypeptides can be photoaf~nity linked with cell membrane or extract
preparations
that express the receptor molecule. Cross-linked material is resolved by PAGE
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-81-
analysis and exposed to X-ray film. The labeled complex containing the
receptors of
the polypeptides can be excised, resolved into peptide fragments, and
subjected to
protein microsequencing. The amino acid sequence obtained from microsequencing
would be used to design a set of degenerate oligonucleotide probes to screen a
cDNA library to identify the genes encoding the putative receptors.
Moreover, the techniques of gene-shuffling, motif shuffling, exon-shuffling,
and/or codon-shuffling (collectively referred to as "DNA shuffling") may be
employed to modulate the activities of CK(3-13 thereby effectively generating
agonists and antagonists of CK(3-13. See generally, U.S. Patent Nos.
5,605,793,
5,811,238, 5,830,721, 5,834,252, and 5,837,458, and Patten, P. A., et al.,
Curr.
Opinion Biotechnol. 8:724-33 (1997); Harayama, S. Trends Biotechnol. 16(2):76-
82 (1998); Hansson, L. O., et al., J. Mol. Biol. 287:265-76 (1999); and
Lorenzo, M.
M. and Blasco, R. Biotechniques 24(2):308-13 (1998) (each of these patents and
publications are hereby incorporated by reference). In one embodiment,
alteration of
CK~3-l3 polynucleotides and corresponding polypeptides may be achieved by DNA
shuffling. DNA shuffling involves the assembly of two or more DNA segments
into a
desired CK(i-13 molecule by homologous, or site-specific, recombination. In
another
embodiment, CK(3-13 polynucleotides and corresponding polypeptides may be
alterred by being subjected to random mutagenesis by error-prone PCR, random
nucleotide insertion or other methods prior to recombination. In another
embodiment, one or more components, motifs, sections, parts, domains,
fragments,
etc., of CK(3-13 may be recombined with one or more components, motifs,
sections,
parts, domains, fragments, etc. of one or more heterologous molecules. In
preferred
embodiments, the heterologous molecules are CK(3-13 family members. In further
preferred embodiments, the heterologous molecule is a growth factor such as,
for
example, platelet-derived growth factor (PDGF), insulin-like growth factor
(IGF-I),
transforming growth factor {TGF)-alpha, epidermal growth factor (EGF),
fibroblast
growth factor (FGF), TGF-beta, bone morphogenetic protein (BMP)-2, BMP-4,
BMP-5, BMP-6, BMP-7, activins A and B, decapentaplegic(dpp), 60A, OP-2,
dorsalin, growth differentiation factors (GDFs), nodal, M1S, inhibin-alpha,
TGF-
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-82-
beta!, TGF-beta2, TGF-beta3, TGF-betas, and glial-derived neurotrophic factor
(GDNF).
Other preferred fragments are biologically active CK~3-13 fragments.
Biologically active fragments are those exhibiting activity similar, but not
necessarily
identical, to an activity of the CK(3-13 polypeptide. The biological activity
of the
fragments may include an improved desired activity, or a decreased undesirable
activity.
Additionally, this invention provides a method of screening compounds to
identify those which modulate the action of the polypeptide of the present
invention.
An example of such an assay comprises combining a mammalian fibroblast cell, a
the
polypeptide of the present invention, the compound to be screened and 3[H]
thymidine under cell culture conditions where the fibroblast cell would
normally
proliferate. A control assay may be performed in the absence of the compound
to be
screened and compared to the amount of fibroblast proliferation in the
presence of
the compound to determine if the compound stimulates proliferation by
determining
the uptake of 3 [H] thymidine in each case. The amount of fibroblast cell
proliferation
is measured by liquid scintillation chromatography which measures the
incorporation
of 3[H] thymidine. Both agonist and antagonist compounds may be identified by
this
procedure.
In another method, a mammalian cell or membrane preparation expressing a
receptor for a polypeptide of the present invention is incubated with a
labeled
polypeptide of the present invention in the presence of the compound. The
ability of
the compound to enhance or block this interaction could then be measured.
Alternatively, the response of a known second messenger system following
interaction of a compound to be screened and the CK[i-13 receptor is measured
and
the ability of the compound to bind to the receptor and elicit a second
messenger
response is measured to determine if the compound is a potential agonist or
antagonist. Such second messenger systems include but are not limited to, cAMP
guanylate cyclase, ion channels or phosphoinositide hydrolysis.
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-83-
All of these above assays can be used as diagnostic or prognostic markers.
The molecules discovered using these assays can be used to treat disease or to
bring
about a particular result in a patient (e.g., blood vessel growth) by
activating or
inhibiting the polypeptide/molecule. Moreover, the assays can discover agents
which may inhibit or enhance the production of the polypeptides of the
invention
from suitably manipulated cells or tissues. Therefore, the invention includes
a method
of identifying compounds which bind to CK~3-13 comprising the steps of-. (a)
incubating a candidate binding compound with CK~i-13; and (b) determining if
binding has occurred. Moreover, the invention includes a method of identifying
agonists/antagonists comprising the steps of-. (a) incubating a candidate
compound
with CK(3-13, (b) assaying a biological activity , and (b) determining if a
biological
activity of CK(3-13 has been altered.
Also, one could identify molecules bind CK(3-13 experimentally by using the
beta-pleated sheet regions disclosed in Figure 3, and Table 1. Accordingly,
specific
embodiments of the invention are directed to polynucleotides encoding
polypeptides
which comprise, or alternatively consist of, the amino acid sequence of each
beta
pleated sheet regions disclosed in Figure 3, and Table 1. Additional
embodiments of
the invention are directed to polynucleotides encoding CK(3-13 polypeptides
which
comprise, or alternatively consist of, any combination or all of the beta
pleated sheet
regions disclosed in Figure 3, and Table 1. Additional preferred embodiments
of the
invention are directed to polypeptides which comprise, or alternatively
consist of, the
CK(3-13 anuno acid sequence of each of the beta pleated sheet regions
disclosed in
Figure 3, and Table 1. Additional embodiments of the invention are directed to
CK(3
13 polypeptides which comprise, or alternatively consist of, any combination
or all of
the beta pleated sheet regions disclosed in Figure 3, and Table 1.
CA 02387808 2002-05-14
WO 01132128 PCT/USOO130237
-84-
Targeted Delivery
In another embodiment, the invention provides a method of delivering
compositions to targeted cells expressing a receptor for a polypeptide of the
invention, or cells expressing a cell bound form of a polypeptide of the
invention.
As discussed herein, polypeptides or antibodies of the invention may be
associated with heterologous polypeptides, heterologous nucleic acids, toxins,
or
prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions. In
one
embodiment, the invention provides a method for the specific delivery of
compositions of the invention to cells by administering polypeptides of the
invention
(including antibodies} that are associated with heterologous polypeptides or
nucleic
acids. In one example, the invention provides a method for delivering a
therapeutic
protein into the targeted cell. In another example, the invention provides a
method
for delivering a single stranded nucleic acid {e.g., antisense or ribozymes)
or double
stranded nucleic acid (e.g., DNA that can integrate into the cell's genome or
replicate
episomally and that can be transcribed) into the targeted cell.
In another embodiment, the invention provides a method for the specific
destruction of cells (e.g., the destruction of tumor cells) by administering
polypeptides of the invention (e.g., polypeptides of the invention or
antibodies of the
invention) in association with toxins or cytotoxic prodrugs.
By "toxin" is meant compounds that bind and activate endogenous cytotoxic
effector systems, radioisotopes, holotoxins, modified toxins, catalytic
subunits of
toxins, or any molecules or enzymes not normally present in or on the surface
of a
cell that under defined conditions cause the cell's death. Toxins that may be
used
according to the methods of the invention include, but are not limited to,
radioisotopes known in the art, compounds such as, for example, antibodies (or
complement fixing containing portions thereof) that bind an inherent or
induced
endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse,
alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin,
momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin.
By
"cytotoxic prodrug" is meant a non-toxic compound that is converted by an
enzyme,
CA 02387808 2002-05-14
WO 01/32128 PCT/iJS00/30237
-85-
normally present in the cell, into a cytotoxic compound. Cytotoxic prodrugs
that
may be used according to the methods of the invention include, but are not
limited to,
glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate
derivatives
of etoposide or mitomycin C, cytosine arabinoside, daunorubisin, and
phenoxyacetamide derivatives of doxorubicin.
Drug Screening
Further contemplated is the use of the polypeptides of the present invention,
or the polynucleotides encoding these polypeptides, to screen for molecules
which
modify the activities of the polypeptides of the present invention. Such a
method
would include contacting the polypeptide of the present invention with a
selected
compounds) suspected of having antagonist or agonist activity, and assaying
the
activity of these polypeptides following binding.
This invention is particularly useful for screening therapeutic compounds by
I S using the polypeptides of the present invention, or binding fragments
thereof, in any
of a variety of drug screening techniques. The polypeptide or fragment
employed in
such a test may be affixed to a solid support, expressed on a cell surface,
free in
solution, or located intracellularly. One method of drug screening utilizes
eukaryotic
or prokaryotic host cells which are stably transformed with recombinant
nucleic acids
expressing the polypeptide or fragment. Drugs are screened against such
transformed
cells in competitive binding assays. One may measure, for example, the
formulation
of complexes between the agent being tested and a polypeptide of the present
invention.
Thus, the present invention provides methods of screening for drugs or any
other agents which affect activities mediated by the polypeptides of the
present
invention. These methods comprise contacting such an agent with a polypeptide
of
the present invention or a fragment thereof and assaying for the presence of a
complex between the agent and the polypeptide or a fragment thereof, by
methods
well known in the art. In such a competitive binding assay, the agents to
screen are
typically labeled. Following incubation, free agent is separated from that
present in
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-86-
bound form, and the amount of free or uncomplexed label is a measure of the
ability
of a particular agent to bind to the polypeptides of the present invention.
Another technique for drug screening provides high throughput screening for
compounds having suitable binding affinity to the polypeptides of the present
invention, and is described in great detail in European Patent Application
84/03564,
published on September 13, 1984, which is incorporated herein by reference
herein.
Briefly stated, large numbers of different small peptide test compounds are
synthesized on a solid substrate, such as plastic pins or some other surface.
The
peptide test compounds are reacted with polypeptides of the present invention
and
washed. Bound polypeptides are then detected by methods well known in the art-
Purified polypeptides are coated directly onto plates for use in the
aforementioned
drug screening techniques. In addition, non-neutralizing antibodies may be
used to
capture the peptide and immobilize it on the solid support.
This invention also contemplates the use of competitive drug screening assays
in which neutralizing antibodies capable of binding polypeptides of the
present
invention specifically compete with a test compound for binding to the
polypeptides
or fragments thereof. In this manner, the antibodies are used to detect the
presence of
any peptide which shares one or more antigenic epitopes with a polypeptide of
the
invention.
Formulations
The CK~i-13 polypeptide composition will be formulated and dosed in a
fashion consistent with good medical practice, taking into account the
clinical
condition of the individual patient (especially the side effects of treatment
with CK~3
13 polypeptide alone), the site of delivery of the CK(3-13 polypeptide
composition,
the method of administration, the scheduling of administration, and other
factors
known to practitioners. The "effective amount" of CK/3-13 polypeptide for
purposes
herein is thus determined by such considerations.
As a general proposition, the total pharmaceutically effective amount of CK(3-
13 polypeptide administered parenterally per dose will be in the range of
about 1
CA 02387808 2002-05-14
WO 01/32128 PCT/US00130237
_87_
pg/kg/day to 10 mg/kg/day of patient body weight, although, as noted above,
this
will be subject to therapeutic discretion. More preferably, this dose is at
least 0.01
mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day
for
the hormone. If given continuously, the CK~3-13 polypeptide is typically
administered at a dose rate of about 1 pg/kg/hour to about 50 pg/kg/hour,
either by
1-4 injections per day or by continuous subcutaneous infusions, for example,
using a
mini-pump. An intravenous bag solution may also be employed. The length of
treatment needed to observe changes and the interval following treatment for
responses to occur appears to vary depending on the desired effect.
Pharmaceutical compositions containing the CK(3-13 of the invention may be
administered orally, rectally, parenterally, intracistemally, intravaginally,
intraperitoneally, topically (as by powders, ointments, drops or transdermal
patch),
bucally, or as an oral or nasal spray. By "pharmaceutically acceptable
carrier" is
meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating
material or
formulation auxiliary of any type. The term "parenteral" as used herein refers
to
modes of administration which include intravenous, intramuscular,
intraperitoneal,
intrasternal, subcutaneous and intraarticular injection and infusion.
The CK(3-13 polypeptide is also suitably administered by sustained-release
systems. Suitable examples of sustained-release compositions include semi
permeable polymer matrices in the form of shaped articles, e.g., films, or
mirocapsules. Sustained-release matrices include polylactides (U. S. Pat. No.
3,773,919, EP 58,48I), copolymers of L-glutamic acid and gamma-ethyl-L-
glutamate
(Sidman, U. et al., Biopolymers 22:547-556 (1983)), poly (2- hydroxyethyl
methacrylate) (R. Larger et al., .1. Bivmed. Mater. Res. 15:167-277 {1981),
and R.
Larger, Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate (R.. Larger et
al., Id.)
or poly-D- (-)-3-hydroxybutyric acid (EP 133,988). Sustained-release CK~i-13
polypeptide compositions also include liposomally entrapped CK~i-13
polypeptide.
Liposomes containing CK~i-13 polypeptide are prepared by methods known per se:
DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692
(1985);
Hwang et al., Proc. Natl. Acad. Sci. (IJSA) 77:4030-4034 (1980); EP 52,322; EP
CA 02387808 2002-05-14
WO 01132128 PCT/US00/30237
-88-
36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. App!. 83-118008; U.S.
Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes
are
of the small (about 200-800 Angstroms) unilamellar type in which the lipid
content is
greater than about 30 mol. percent cholesterol, the selected proportion being
adjusted for the optimal CK~i-13 polypeptide therapy.
For parenteral administration, in one embodiment, the CK(3-13 polypeptide is
formulated generally by mixing it at the desired degree of purity, in a unit
dosage
injectable form (solution, suspension, or emulsion), with a pharmaceutically
acceptable carrier, i.e., one that is non-toxic to recipients at the dosages
and
concentrations employed and is compatible with other ingredients of the
formulation.
For example, the formulation preferably does not include oxidizing agents and
other
compounds that are known to be deleterious to polypeptides.
Generally, the formulations are prepared by contacting the CK[3-13
polypeptide uniformly and intimately with liquid carriers or finely divided
solid
carriers or both. Then, if necessary, the product is shaped into the desired
formulation. Preferably the carrier is a parenteral earner, more preferably a
solution
that is isotonic with the blood of the recipient. Examples of such earner
vehicles
include water, saline, Ringer's solution, and dextrose solution. Non-aqueous
vehicles
such as fixed oils and ethyl oleate are also useful herein, as well as
liposomes.
The carrier suitably contains minor amounts of additives such as substances
that enhance isotonicity and chemical stability. Such materials are non-toxic
to
recipients at the dosages and concentrations employed, and include buffers
such as
phosphate, citrate, succinate, acetic acid, and other organic acids or their
salts;
antioxidants such as ascorbic acid; low molecular weight (less than about ten
residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as
serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic
acid, or
arginine; monosaccharides, disaccharides, and other carbohydrates including
cellulose
or its derivatives, glucose, manose, or dextrins; chelating agents such as
EDTA;
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-89-
sugar alcohols such as mannitol or sorbitol; counterions such as sodium;
and/or
nonionic surfactants such as polysorbates, poloxamers, or PEG.
The CK~i-13 polypeptide is typically formulated in such vehicles at a
concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH
of
about 3 to 8. It will be understood that the use of certain of the foregoing
excipients,
Garners, or stabilizers will result in the formation of CKj3-13 polypeptide
salts.
CK(3-13 polypeptide to be used for therapeutic administration must be sterile.
Sterility is readily accomplished by filtration through sterile filtration
membranes
(e.g., 0.2 micron membranes). Therapeutic CK(3-13 polypeptide compositions
generally are placed into a container having a sterile access port, for
example, an
intravenous solution bag or vial having a stopper pierceable by a hypodermic
injection needle.
CK~i-13 polypeptide ordinarily will be stored in unit or mufti-dose
containers,
for example, sealed ampoules or vials, as an aqueous solution or as a
lyophilized
formulation for reconstitution. As an example of a lyophilized formulation, 10-
ml
vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous CK~i-13
polypeptide
solution, and the resulting mixture is lyophilized. The infusion solution is
prepared
by reconstituting the lyophilized CK~i-13 polypeptide using bacteriostatic
Water-for-
Inj ection.
The invention also provides a pharmaceutical pack or kit comprising one or
more containers filled with one or more of the ingredients of the
pharmaceutical
compositions of the invention. Associated with such containers) can be a
notice in
the form prescribed by a governmental agency regulating the manufacture, use
or sale
of pharmaceuticals or biological products, which notice reflects approval by
the
agency of manufacture, use or sale for human administration. In addition, the
polypeptides of the present invention may be employed in conjunction with
other
therapeutic compounds.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-90-
Agonists and Antagonists - Assays and Molecules
In specific embodiments, antagonists according to the present invention are
nucleic acids corresponding to the sequences contained in SEQ ID NO:1, or the
complementary strand thereof, and/or to nucleotide sequences contained in the
deposited clone CK~3-13. In one embodiment, antisense sequence is generated
internally, by the organism, in another embodiment, the antisense sequence is
separately administered (see, for example, O'Connor, J., Neurochem. 56:560
(1991).
Oligodeoxynucleotides as Anitsense Inhibitors of Gene Expression, CRC Press,
Boca
Raton, FL (1988). Antisense technology can be used to control gene expression
through antisense DNA or RNA, or through triple-helix formation. Antisense
techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press,
Boca
Raton, FL (1988). Triple helix formation is discussed in, for instance, Lee et
al.,
Nucleic Acids Research 6:3073 (1979); Cooney et al., Science 241:456 (1988);
and
Dervan et al., Science 251:1300 (1991). The methods are based on binding of a
polynucleotide to a complementary DNA or RNA.
For example, the use of c-myc and c-myb antisense RNA constructs to inhibit
the growth of the non-lymphocytic leukemia cell line HL-60 and other cell
lines was
previously described. (Wickstrom et al. (1988); Anfossi et al. (1989)). These
experiments were performed in vitro by incubating cells with the
oligoribonucleotide.
A similar procedure for in vivo use is described in WO 91/15580. Briefly, a
pair of
oligonucleotides for a given antisense RNA is produced as follows: A sequence
complimentary to the first 15 bases of the open reading frame is flanked by an
EcoRl
site on the 5 end and a HindIII site on the 3 end. Next, the pair of
oligonucleotides
is heated at 90°C for one minute and then annealed in 2X ligation
buffer (20mM
TRIS HCl pH 7.5, IOmM MgCl2, IOMM dithiothreitol (DTT) and 0.2 mM ATP)
and then ligated to the EcoRl/Hind III site of the retroviral vector PMV7 {WO
91 /15580).
For example, the 5' coding portion of a polynucleotide that encodes the
mature polypeptide of the present invention may be used to design an antisense
RNA
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-91-
oligonucleotide of from about 10 to 40 base pairs in length. A DNA
oligonucleotide
is designed to be complementary to a region of the gene involved in
transcription
thereby preventing transcription and the production of the receptor. The
antisense
RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of
the
mRNA molecule into receptor polypeptide.
In one embodiment, the CK(3-13 antisense nucleic acid of the invention is
produced intracellularly by transcription from an exogenous sequence. For
example,
a vector or a portion thereof, is transcribed, producing an antisense nucleic
acid
(RNA) of the invention. Such a vector would contain a sequence encoding the
CKj3-
13 antisense nucleic acid. Such a vector can remain episomal or become
chromosomally integrated, as long as it can be transcribed to produce the
desired
antisense RNA. Such vectors can be constructed by recombinant DNA technology
methods standard in the art. Vectors can be plasmid, viral, or others known in
the
art, used for replication and expression in vertebrate cells. Expression of
the
sequence encoding CK(3-13, or fragments thereof, can be by any promoter known
in
the art to act in vertebrate, preferably human cells. Such promoters can be
inducible
or constitutive. Such promoters include, but are not limited to, the SV40
early
promoter region (Bernoist and Chambon, Nature 29:304-310 (1981), the promoter
contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et
al., Cell
22:787-797 (1980), the herpes thymidine promoter (Wagner et al., Proc. Natl.
Acad.
Sci. U.S.A. 78.1441-1445 (1981), the regulatory sequences of the
metallothionein
gene (Brinster, et al., Nature 296:39-42 (1982)), etc.
The antisense nucleic acids of the invention comprise a sequence
complementary to at least a portion of an RNA transcript of a CK~3-13 gene.
However, absolute complementarity, although preferred, is not required. A
sequence
"complementary to at least a portion of an RNA," referred to herein, means a
sequence having sufficient complementarity to be able to hybridize with the
RNA,
forming a stable duplex; in the case of double stranded CK~3-13 antisense
nucleic
acids, a single strand of the duplex DNA may thus be tested, or triplex
formation may
be assayed. The ability to hybridize will depend on both the degree of
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-92-
complementarity and the length of the antisense nucleic acid. Generally, the
larger
the hybridizing nucleic acid, the more base mismatches with a CK(3-13 RNA it
may
contain and still form a stable duplex (or triplex as the case may be}. One
skilled in
the art can ascertain a tolerable degree of mismatch by use of standard
procedures to
determine the melting point of the hybridized complex.
Oligonucleotides that are complementary to the S' end of the message, e.g.,
the 5' untranslated sequence up to and including the AUG initiation codon,
should
work most ei~ciently at inhibiting translation. However, sequences
complementary
to the 3' untranslated sequences of mRNAs have been shown to be effective at
inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994,
Nature
372:333-335. Thus, oligonucleotides complementary to either the 5'- or 3'- non-
translated, non-coding regions of CK(3-13 shown in Figures lA-B could be used
in
an antisense approach to inhibit translation of endogenous CK(3-13 mRNA.
Oligonucleotides complementary to the 5' untranslated region of the mRNA
should
l S include the complement of the AUG start codon. Antisense oligonucleotides
complementary to mRNA coding regions are less efficient inhibitors of
translation but
could be used in accordance with the invention. Whether designed to hybridize
to
the 5'-, 3'--or coding region of CK(3-13 mRNA, antisense nucleic acids should
be at
least six nucleotides in length, and are preferably oligonucleotides ranging
from 6 to
about 50 nucleotides in length. In specific aspects the oligonucleotide is at
least 10
nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50
nucleotides.
The polynucleotides of the invention can be DNA or RNA or chimeric
mixtures or derivatives or modified versions thereof, single-stranded or
double
stranded. The oligonucleotide can be modified at the base moiety, sugar
moiety, or
phosphate backbone, for example, to improve stability of the molecule,
hybridization,
etc. The oligonucleotide may include other appended groups such as peptides
(e.g.,
for targeting host cell receptors in vivo), or agents facilitating transport
across the
cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci.
U.S.A.
86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT
Publication No. W088/09810, published December 15, 1988) or the blood-brain
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-93-
barrier (see, e.g., PCT Publication No. W089/10134, published April 25, 1988),
hybridization-triggered cleavage agents. (See, e.g., Krol et al., 1988,
BioTechniques
6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-
549).
To this end, the oligonucleotide may be conjugated to another molecule, e.g.,
a
peptide, hybridization triggered cross-linking agent, transport agent,
hybridization-
triggered cleavage agent, etc.
The antisense oligonucleotide may comprise at least one modified base moiety
which is selected from the group including, but not limited to, 5-
fluorouracil,
5-bromouracil, S-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-
acetylcytosine,
5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine, N6-isopentenyladenine, I-methylguanine, I-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine,
5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil,
I S 5-methoxyaminomethyl-2-thiouracil, . beta-D-mannosylqueosine,
5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-
isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil,
S-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid
(v),
5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and
2, 6-diaminopurine.
The antisense oligonucleotide may also comprise at least one modified sugar
moiety selected from the group including, but not limited to, arabinose,
2-fluoroarabinose, xylulose, and hexose.
In yet another embodiment, the antisense oligonucleotide comprises at least
one modified phosphate backbone selected from the group including, but not
limited
to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl
phosphotriester, and a formacetal or analog thereof.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-94-
In yet another embodiment, the antisense oligonucieotide is an a-anomeric
oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded
hybrids with complementary RNA in which, contrary to the usual b-units, the
strands
run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-
6641 ). The
oligonucleotide is a 2'-0-methylribonucleotide (moue et al., 1987, Nucl. Acids
Res.
15:6131-6148), or a chimeric RNA-DNA analogue (lnoue et al., 1987, FEBS Lett.
215:327-330).
Polynucleotides of the invention may be synthesized by standard methods
known in the art, e.g. by use of an automated DNA synthesizer (such as are
commercially available from Biosearch, Applied Biosystems, etc.). As examples,
phosphorothioate oligonucleotides may be synthesized by the method of Stein et
al.
(1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be
prepared by use of controlled pore glass polymer supports (Sarin et al., 1988,
Proc.
Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.
While antisense nucleotides complementary to the CK~i-13 coding region
sequence could be used, those complementary to the transcribed untranslated
region
are most preferred.
Potential antagonists according to the invention also include catalytic RNA,
or a ribozyme (See, e.g., PCT International Publication WO 90/11364, published
October 4, 1990; Sarver et al, Science 247:1222-1225 (1990). While ribozymes
that
cleave mRNA at site specific recognition sequences can be used to destroy CKj3-
13
mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes
cleave mRNAs at locations dictated by flanking regions that form complementary
base pairs with the target mRNA. The sole requirement is that the target mRNA
have the following sequence of two bases: 5'-UG-3'. The construction and
production of hammerhead ribozymes is well known in the art and is described
more
fully in Haseloff and Gerlach, Nature 334:585-591 (1988). There are numerous
potential hammerhead ribozyme cleavage sites within the nucleotide sequence of
CK~i-13 (Figures IA-B). Preferably, the ribozyme is engineered so that the
cleavage
recognition site is located near the 5' end of the CK(3-13 mRNA; i.e., to
increase
CA 02387808 2002-05-14
WO 01/32128 PCT/IJS00/30237
-95-
efficiency and minimize the intracellular accumulation of non-functional mRNA
transcripts.
As in the antisense approach, the ribozymes of the invention can be composed
of modified oligonucleotides (e.g. for improved stability, targeting, etc.)
and should
be delivered to cells which express CK~i-13 in vivo. DNA constructs encoding
the
ribozyme may be introduced into the cell in the same manner as described above
for
the introduction of antisense encoding DNA. A preferred method of delivery
involves using a DNA construct "encoding" the ribozyme under the control of a
strong constitutive promoter, such as, for example, pol III or pol II
promoter, so that
transfected cells will produce sufficient quantities of the ribozyme to
destroy
endogenous CK~3-13 messages and inhibit translation. Since ribozymes unlike
antisense molecules, are catalytic, a lower intracellular concentration is
required for
efficiency.
Antagonist/agonist compounds may be employed to inhibit the cell growth
and proliferation effects of the polypeptides of the present invention on
neoplastic
cells and tissues, i.e. stimulation of angiogenesis of tumors, and, therefore,
retard or
prevent abnormal cellular growth and proliferation, for example, in tumor
formation
or growth.
The antagonist/agonist may also be employed to prevent hyper-vascular
diseases, and prevent the proliferation of epithelial lens cells after
extracapsular
cataract surgery. Prevention of the mitogenic activity of the polypeptides of
the
present invention may also be desirous in cases such as restenosis after
balloon
angioplasty.
The antagonist/agonist may also be employed to prevent the growth of scar
tissue during wound healing.
The antagonist/agonist may also be employed to treat the diseases described
herein.
Thus, the invention provides a method of treating disorders or diseases,
including but not limited to the disorders or diseases listed throughout this
application, associated with overexpression of a polynucleotide of the present
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-96-
invention by administering to a patient (a) an antisense molecule directed to
the
polynucleotide of the present invention, and/or (b) a ribozyme directed to the
polynucleotide of the present invention.
The invention also provides a method of screening compounds to identify
those which enhance or block the action of CK(3-13 on cells, such as its
interaction
with CK(3-13-binding molecules such as receptor molecules. An agonist is a
compound which increases the natural biological functions of CK(i-13 or which
functions in a manner similar to CK(3-13, while antagonists decrease or
eliminate
such functions.
In the assay of the invention for agonists or antagonists, a cellular
compartment, such as a membrane or a preparation thereof, may be prepared from
a
cell that expresses a molecule that binds CK~3-13, such as a molecule of a
signaling or
regulatory pathway modulated by CK(3-13. The preparation is incubated with
labeled
CKj3-13 in the absence or the presence of a candidate molecule which may be a
CK~3-
13 agonist or antagonist. The ability of the candidate molecule to bind the
binding
molecule is reflected in decreased binding of the labeled ligand. Molecules
which
bind gratuitously, i.e., without inducing the effects of CK~i-13 on binding
the CK(3-
13 binding molecule, are most likely to be good antagonists. Molecules that
bind
well and elicit erects that are the same as or closely related to CK(3-13 are
agonists.
CK~i-13-like effects of potential agonists and antagonists may by measured,
for instance, by determining activity of a second messenger system following
interaction of the candidate molecule with a cell or appropriate cell
preparation, and
comparing the effect with that of CK(3-13 or molecules that elicit the same
effects as
CK~3-13. Second messenger systems that may be useful in this regard include
but are
not limited to AMP guanylate cyclase, ion channel or phosphoinositide
hydrolysis
second messenger systems.
Another example of an assay for CK~i-13 antagonists is a competitive assay
that combines CK(3-13 and a potential antagonist with membrane-bound CK~i-13
receptor molecules or recombinant CK(3-13 receptor molecules under appropriate
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-97-
conditions for a competitive inhibition assay. CK(3-13 can be labeled, such as
by
radioactivity, such that the number of CK(3-13 molecules bound to a receptor
molecule can be determined accurately to assess the effectiveness of the
potential
antagonist.
Potential antagonists include small organic molecules, peptides, polypeptides
and antibodies that bind to a polypeptide of the invention and thereby inhibit
or
extinguish its activity. Potential antagonists also may be small organic
molecules, a
peptide, a polypeptide such as a closely related protein or antibody that
binds the
same sites on a binding molecule, such as a receptor molecule, without
inducing
CK(3-13-induced activities, thereby preventing the action of CK(3-13 by
excluding
CK(3-13 from binding.
Other potential antagonists include antisense molecules. Antisense
technology can be used to control gene expression through antisense DNA or RNA
or through triple-helix formation. Antisense techniques are discussed, for
example, in
Okano, J. Neurochem. 5b: 560 (1991); "Oligodeoxynucleotides as Antisense
Inhibitors of Gene Expression." CRC Press, Boca Raton, FL (1988). Triple helix
formation is discussed in, for instance Lee et al., Nucleic Acids Research 6:
3073
(1979); Cooney et al., Science 241: 456 (1988); and Dervarr et al., Science
251:
1360 (1991). The methods are based on binding of a polynucleotide to a
complementary DNA or RNA. For example, the 5' coding portion of a
polynucleotide that encodes the mature polypeptide of the present invention
may be
used to design an antisense RNA oligonucleotide of from about 10 to 40 base
pairs in
length. A DNA oligonucleotide is designed to be complementary to a region of
the
gene involved in transcription thereby preventing transcription and the
production of
CK[3-13. The antisense RNA oligonucleotide hybridises to the mRNA in vivo and
blocks translation of the mRNA molecule into CK~i-13 polypeptide. The
oligonucleotides described above can also be delivered to cells such that the
antisense
RNA or DNA may be expressed irr vivo to inhibit production of CK~i-13 protein.
The agonists and antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as described above.
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-98-
The antagonists may be employed for instance to inhibit the chemotaxis and
activation of macrophages and their precursors, and of neutrophils, basophils,
B
lymphocytes and some T-cell subsets, e.g., activated and CD8 cytotoxic T cells
and
natural killer cells, in certain auto-immune and chronic inflammatory and
infective
diseases. Examples of auto-immune diseases include multiple sclerosis, and
insulin-
dependent diabetes.
The antagonists may also be employed to treat infectious diseases including
silicosis, sarcoidosis, idiopathic pulmonary fibrosis by preventing the
recruitment and
activation of mononuclear phagocytes. They may also be employed to treat
idiopathic hyper-eosinophilic syndrome by preventing eosinophil production and
migration. Endotoxic shock may also be treated by the antagonists by
preventing the
migration of macrophages and their production of the human chemokine
polypeptides
of the present invention.
The antagonists may also be employed for treating atherosclerosis, by
1 S preventing monocyte infiltration in the artery wall.
The antagonists may also be employed to treat histamine-mediated allergic
reactions and immunological disorders including late phase allergic reactions,
chronic
urticaria, and atopic dermatitis by inhibiting chemokine-induced mast cell and
basophil degranulation and release of histamine. IgE-mediated allergic
reactions such
as allergic asthma, rhinitis, and eczema may also be treated.
The antagonists may also be employed to treat chronic and acute
inflammation by preventing the attraction of monocytes to a wound area. They
may
also be employed to regulate normal pulmonary macrophage populations, since
chronic and acute inflammatory pulmonary diseases are associated with
sequestration
of mononuclear phagocytes in the lung.
Antagonists may also be employed to treat rheumatoid arthritis by preventing
the attraction of monocytes into synovial fluid in the joints of patients.
Monocyte
influx and activation plays a significant role in the pathogenesis of both
degenerative
and inflammatory arthropathies.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-99-
The antagonists may be employed to interfere with the deleterious cascades
attributed primarily to IL-1 and TNF, which prevents the biosynthesis of other
inflammatory cytokines. In this way, the antagonists may be employed to
prevent
inflammation. The antagonists may also be employed to inhibit prostaglandin-
independent fever induced by chemokines.
The antagonists may also be employed to treat cases of bone marrow failure,
for example, aplastic anemia and myelodysplastic syndrome.
The antagonists may also be employed to treat asthma and allergy by
preventing eosinophil accumulation in the lung. The antagonists may also be
employed to treat subepithelial basement membrane fibrosis which is a
prominent
feature of the asthmatic lung.
Antibodies against CK(3-13 may be employed to bind to and inhibit CK(3-13
activity to treat, for example, ARDS, by preventing infiltration of
neutrophils into the
lung after injury.
Any of the above antagonists may be employed in a composition with a
pharmaceutically acceptable carrier, e.g., as described herein.
Chromosome Assays
The nucleic acid molecules of the present invention are also valuable for
chromosome identification. The sequence is specifically targeted to and can
hybridize with a particular location on an individual human chromosome.
Moreover,
there is a current need for identifying particular sites on the chromosome.
Few
chromosome marking reagents based on actual sequence data (repeat
polymorphisms) are presently available for marking chromosomal location. The
mapping of DNAs to chromosomes according to the present invention is an
important first step in correlating those sequences with genes associated with
disease.
In certain preferred embodiments in this regard, the cDNA herein disclosed is
used to clone genomic DNA of a CK(3-13 protein gene. This can be accomplished
using a variety of well known techniques and libraries, which generally are
available
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-100-
commercially. The genomic DNA then is used for in situ chromosome mapping
using well known techniques for this purpose.
In addition, in some cases, sequences can be mapped to chromosomes by
preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis
of
the 3' untranslated region of the gene is used to rapidly select primers that
do not
span more than one exon in the genomic DNA, thus complicating the
amplification
process. These primers are then used for PCR screening of somatic cell hybrids
containing individual human chromosomes. Fluorescence in situ hybridization
("FISH") of a cDNA clone to a metaphase chromosomal spread can be used to
provide a precise chromosomal location in one step. This technique can be used
with
probes from the cDNA as short as 50 or 60 bp. For a review of this technique,
see
Verma et al., Human Chromosomes: A Manual Of Basic Techniques, Pergamon
Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the
physical position of the sequence on the chromosome can be correlated with
genetic
map data. Such data are found, for example, in V. McKusick, Mendelian
Inheritance In Man, available on-line through Johns Hopkins University, Welch
Medical Library. The relationship between genes and diseases that have been
mapped to the same chromosomal region are then identified through linkage
analysis
(coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic
sequence between affected and unaffected individuals. If a mutation is
observed in
some or all of the affected individuals but not in any normal individuals,
then the
mutation is likely to be the causative agent of the disease.
Having generally described the invention, the same will be more readily
understood by reference to the following examples, which are provided by way
of
illustration and are not intended as limiting.
CA 02387808 2002-05-14
WO 01132128 PCT/US00/30237
-101-
Examples
Example l: Expression anal Purification of CK/313 in E. coli
The bacterial expression vector pQE60 was used for bacterial expression in
this example (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311). pQE60
encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial
origin of
replication ("ori"), an IPTG inducible promoter, a ribosome binding site
("RBS"), six
codons encoding histidine residues that allow affinity purification using
nickel-nitrilo
tri-acetic acid ("Ni-NTA") affinity resin sold by QIAGEN, Inc., szspra, and
suitable
single restriction enzyme cleavage sites. These elements are arranged such
that a
DNA fragment encoding a polypeptide may be inserted in such as way as to
produce
that polypeptide with the six His residues (i.e., a "6 X His tag") covalently
linked to
the carboxyl terminus of that polypeptide. However, in this example, the
polypeptide
coding sequence is inserted such that translation of the six His codons is
prevented
and, therefore, the polypeptide is produced with no 6 X His tag.
The DNA sequence encoding the desired portion of the CK~3-13 protein
comprising the mature form beginning with Gly-25 of the CK~i-13 amino acid
sequence was amplified from the deposited cDNA clone using PCR oligonucleotide
primers which anneal to the amino terminal sequences of the desired portion of
the
CK~i-I3 protein and to sequences in the deposited construct 3' to the cDNA
coding
sequence. Additional nucleotides containing restriction sites to facilitate
cloning in
the pQE60 vector were added to the 5' and 3' sequences, respectively.
For cloning the mature form of the CK~i-13 protein beginning with Gly-25,
the 5' primer has the sequence 5'
AAACCATGGGTCCGTACGGTGCAAACATGGAAGACAGCG 3' (SEQ ID
N0:4) containing the underlined NcoI restriction site (bold). Particular
nucleotides
in the "wobble" position in certain codons in both primers have been altered
based on
E. coli preference. One of ordinary skill in the art would appreciate, of
course, that
the point in the protein coding sequence where the 5' primer begins may be
varied to
amplify a desired portion of the complete protein shorter or longer than the
mature
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-102-
form. The 3' primer has the sequence 5'
AAAAAGCTTCTGACCCTTCCCTGGAAGGTA 3' (SEQ ID NO:S) containing the
underlined HindIII restriction site.
The amplified CK(3-13 DNA fragments and the vector pQE60 were digested
with NcoI and HindIII and the digested DNAs were then ligated together.
Insertion
of the CK~3-13 DNA into the restricted pQE60 vector places the CK~i-13 protein
coding region including its associated stop codon downstream from the IPTG-
inducible promoter and in-frame with an initiating AUG. The associated stop
codon
prevents translation of the six histidine codons downstream of the insertion
point.
The ligation mixture was transformed into competent E. coli cells using
standard procedures such as those described in Sambrook et al., Molecular
Cloning:
a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY (1989). E. coli strain M15/rep4, containing multiple copies of the
plasmid pREP4, which expresses the lac repressor and confers kanamycin
resistance
("Kanr"), is used in carrying out the illustrative example described herein.
This
strain, which is only one of many that are suitable for expressing CK~3-13
protein, is
available commercially from QIAGEN, Inc., supra. Transformants were identified
by
their ability to grow on LB plates in the presence of ampicillin and
kanamycin.
Plasmid DNA was isolated from resistant colonies and the identity of the
cloned
DNA confirmed by restriction analysis, PCR and DNA sequencing.
Clones containing the desired constructs were gown overnight ("O/N") in
liquid culture in LB media supplemented with both ampicillin (100 p.g/mI) and
kanamycin (25 ug/ml). The O/N culture was used to inoculate a large culture,
at a
dilution of approximately 1:25 to 1:250. The cells were grown to an optical
density
at 600 nm ("OD600") of between 0.4 and 0.6. isopropyl-b-D-
thiogalactopyranoside
("IPTG") was then added to a final concentration of 1 mM to induce
transcription
from the lac repressor sensitive promoter, by inactivating the lacl repressor.
Cells
subsequently were incubated further for 3 to 4 hours. Cells then were
harvested by
centrifugation.
CA 02387808 2002-05-14
WO 01/32128 PCT/IJS00/30237
-103-
To purify the CK(3-13 polypeptide, the cells were then stirred for 3-4 hours
at
4° C in 6M guanidine-HCI, pH 8. The cell debris was removed by
centrifugation,
and the supernatant containing the CK~3-13 was dialyzed against 50 mM Na-
acetate
buffer pH 6, supplemented with 200 mM NaCl. Alternatively, the protein can be
successfully refolded by dialyzing it against 500 mM NaCI, 20% glycerol, 25 mM
Tris/HCI pH 7.4, containing protease inhibitors. After renaturation the
protein can
be purified by ion exchange, hydrophobic interaction and size exclusion
chromatography. Alternatively, an affinity chromatography step such as an
antibody
column can be used to obtain pure CK/3-13 protein. The purified protein is
stored at
4° C or frozen at -80° C.
The following alternative method may be used to purify CK~i-13 expressed in
E toll when it is present in the form of inclusion bodies. Unless otherwise
specified,
all of the following steps are conducted at 4-10°C.
Upon completion of the production phase of the E. toll fermentation, the cell
culture is cooled to 4-10°C and the cells are harvested by continuous
centrifugation
at 15,000 rpm (Heraeus Sepatech). On the basis of the expected yield of
protein per
unit weight of cell paste and the amount of purified protein required, an
appropriate
amount of cell paste, by weight, is suspended in a buffer solution containing
100 mM
Tris, 50 mM EDTA, pH 7.4. The cells are dispersed to a homogeneous suspension
using a high shear mixer.
The cells ware then lysed by passing the solution through a microfluidizer
(Microfuidics, Corp. or APV Gaulin, Inc.) twice at 4000-6000 psi. The
homogenate
is then mixed with NaCI solution to a final concentration of 0.5 M NaCI,
followed by
centrifugation at 7000 xg for 15 min. The resultant pellet is washed again
using
0.5M NaCI, 100 mM Tris, 50 mM EDTA, pH 7.4.
The resulting washed inclusion bodies are solubilized with 1.5 M guanidine
hydrochloride (GuHCI) for 2-4 hours. After 7000 xg centrifugation for 15 min.,
the
pellet is discarded and the CK(3 -13 polypeptide-containing supernatant is
incubated
at 4°C overnight to allow further GuHCI extraction.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-104-
Following high speed centrifugation (30,000 xg) to remove insoluble
particles, the GuHCI solubilized protein is refolded by quickly mixing the
GuHCI
extract with 20 volumes of buffer containing 50 mM sodium, pH 4.5, 150 mM
NaCI,
2 mM EDTA by vigorous stirring. The refolded diluted protein solution is kept
at
4°C without mixing for 12 hours prior to further purification steps.
To clarify the refolded CK~3-13 polypeptide solution, a previously prepared
tangential filtration unit equipped with 0.16 ~m membrane filter with
appropriate
surface area (e.g., Filtron), equilibrated with 40 mM sodium acetate, pH 6.0
is
employed. The filtered sample is loaded onto a cation exchange resin (e.g.,
Poros
HS-50, Perceptive Biosystems). The column is washed with 40 mM sodium acetate,
pH 6.0 and eluted with 250 mM, 500 mM, 1000 mM, and 1500 mM NaCI in the
same buffer, in a stepwise manner. The absorbance at 280 mm of the effluent is
continuously monitored. Fractions are collected and fixrther analyzed by SDS-
PAGE.
Fractions containing the CK(3-13 polypeptide are then pooled and mixed with
4 volumes of water. The diluted sample is then loaded onto a previously
prepared set
of tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and
weak
anion (Poros CM-20, Perceptive Biosystems) exchange resins. The columns are
equilibrated with 40 mM sodium acetate, pH 6Ø Both columns are washed with
40
mM sodium acetate, pH 6.0, 200 mM NaCI. The CM-20 column is then eluted using
a 10 column volume linear gradient ranging from 0.2 M NaCI, 50 mM sodium
acetate, pH 6.0 to 1.0 M NaCI, 50 mM sodium acetate, pH 6.5. Fractions are
collected under constant A2go monitoring of the ei~luent. Fractions containing
the
CK(3-13 polypeptide (determined, for instance, by 16% SDS-PAGE) are then
pooled.
The resultant CK(3-13 polypeptide exhibits greater than 95% purity after the
above refolding and purification steps. No major contaminant bands are
observed
from Commassie blue stained 16% SDS-PAGE gel when 5 pg of purified protein is
loaded. The purified protein is also tested for endotoxinlLPS contamination,
and
typically the LPS content is less than 0.1 ng/m1 according to LAL assays.
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-105-
Example 2: Cloning and Expression of CK~(3 13 protein in a Bnculovirus
Expression System
In this example, the plasmid shuttle vector pA2 was used to insert the cloned
DNA encoding complete protein, including its naturally associated secretory
signal
(leader) sequence, into a baculovirus to express the mature CK(3-13 protein,
using
standard methods as described in Summers et al., A iLlanual of tYlethods for
Baculovirus hectors and Insect Cell Culture Procedures, Texas Agricultural
Experimental Station Bulletin No. 1555 (1987). This expression vector contains
the
strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis
virus
(AcMNPV) followed by convenient restriction sites such as BamHI, Xba I and
Asp718. The polyadenylation site of the simian virus 40 ("SV40") is used for
efficient polyadenylation. For easy selection of recombinant virus, the
plasmid
contains the beta-galactosidase gene from E. coli under control of a weak
Drosophila
promoter in the same orientation, followed by the polyadenylation signal of
the
polyhedrin gene. The inserted genes are flanked on both sides by viral
sequences for
cell-mediated homologous recombination with wild-type viral DNA to generate a
viable virus that express the cloned polynucleotide.
Many other baculovirus vectors could be used in place of the vector above,
such as pAc373, pVL941 and pAcIMI, as one skilled in the art would readily
appreciate, as long as the construct provides appropriately located signals
for
transcription, translation, secretion and the like, including a signal peptide
and an in
frame AUG as required. Such vectors are described, for instance, in Luckow et
al.,
hirology 170:31-39 (1989).
The cDNA sequence encoding the full length CK(3-13 protein in the deposited
clone, including the AUG initiation codon and the naturally associated leader
sequence shown in SEQ ID N0:2, was amplified using PCR oligonucleotide primers
corresponding to the 5' and 3' sequences of the gene. The 5' primer has the
sequence 5' AAAGGATCCGCCACCATGGCTCGCCTACAGACT 3' (SEQ ID
CA 02387808 2002-05-14
WO 01/32128 PCT/US00130237
-106-
N0:6) containing a BamHI restriction enzyme site (bold), and an e~cient signal
for
initiation of translation in eukaryotic cells, as described by Kozak, M., J.
Mol. Biol.
196:947-950 (1987). The 3' primer has the sequence
S' AAAGGTACCTCATTGGCTCAGCTTATT 3' (SEQ ID N0:7) containing an
S Asp718 restriction enzyme site (bold).
The amplified fragment was isolated from a 1% agarose gel using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The
fragment
then was digested with BamHI and Asp718 and again is purified on a 1% agarose
gel.
The plasmid was digested with the restriction enzymes BamHI and Asp718
and optionally, can be dephosphorylated using calf intestinal phosphatase,
using
routine procedures known in the art. The DNA was then isolated from a 1%
agarose
gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla,
Ca.).
The fragment and dephosphorylated plasmid were ligated together with T4
DNA ligase. E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue
(Statagene Cloning Systems, La Jolla, CA) cells were transformed with the
ligation
mixture and spread on culture plates. Bacteria were identified that contain
the
plasmid with the human CK(3-13 gene by digesting DNA from individual colonies
using BamHI and Asp718 and then analyzing the digestion product by gel
electrophoresis. The sequence of the cloned fragment was confirmed by DNA
sequencing. This plasmid is designated herein pA2CKj3-13.
Five pg of the plasmid pA2CK(3-13 was co-transfected with 1.0 ~g of a
commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus
DNA", Pharmingen, San Diego, CA), using the lipofection method described by
Felgner et aL, Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987). One ~g of
BaculoGoldTM virus DNA and 5 ~g of the plasmid pA2CK(3-13 were mixed in a
sterile well of a microtiter plate containing 50 ~l of serum-free Grace's
medium (Life
Technologies Inc., Gaithersburg, MD). Afterwards, 10 ~l Lipofectin plus 90 p1
Grace's medium were added, mixed and incubated for 15 minutes at room
temperature. Then the transfection mixture was added drop-wise to Sil3 insect
cells
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-107-
(ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's
medium
without serum. The plate was then incubated for 5 hours at 27° C. The
transfection
solution was then removed from the plate and 1 ml of Grace's insect medium
supplemented with 10% fetal calf serum was added. Cultivation was then
continued
at 27° C for four days.
After four days the supernatant was collected and a plaque assay was
performed, as described by Summers and Smith, szrpra. An agarose gel with
"Blue
Gal" (Life Technologies Inc., Gaithersburg) was used to allow easy
identification and
isolation of gal-expressing clones, which produce blue-stained plaques. (A
detailed
description of a "plaque assay" of this type can also be found in the user's
guide for
insect cell culture and baculovirology distributed by Life Technologies Inc.,
Gaithersburg, page 9-10). After appropriate incubation, blue stained plaques
were
picked with the tip of a micropipettor (e.g., Eppendorf). The agar containing
the
recombinant viruses was then resuspended in a microcentrifuge tube containing
200
p1 of Grace's medium and the suspension containing the recombinant baculovirus
was
used to infect Sf~ cells seeded in 3 5 mm dishes. Four days later the
supernatants of
these culture dishes were harvested and then stored at 4° C. The
recombinant virus
is called V-C.K(3-13.
To verify the expression of the CK(3-13 gene Sf9 cells were grown in Grace's
medium supplemented with 10% heat-inactivated FB S. The cells were infected
with
the recombinant baculovirus V- CK(3-13 at a multiplicity of infection ("MOI")
of
about 2. 6 hours later the medium is removed and is replaced with SF900 II
medium
minus methionine and cysteine (available from Life Technologies Inc.,
Rockville,
MD). After 42 hours, 5 pCi of 35S-methionine and 5 pCi 35S-cysteine (available
from
Amersham) were added. The cells were further incubated for 16 hours and then
harvested by centrifugation. The proteins in the supernatant as well as the
intracellular proteins were analyzed by SDS-PAGE followed by autoradiography
(if
radiolabeled).
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-108-
Microsequencing of the amino acid sequence of the amino terminus of
purified proteins was used to determine the amino terminal sequence of the
mature of
the CK[3-13 protein, and thus the leader and mature forms, as described above.
Example 3: Expression of Recombinant CK/.~13 in COS Cells
The expression of plasmid CK~i-13HA is derived from a vector pcDNAI/Amp
(Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin
resistance gene,
3) E.coli replication origin, 4) CMV promoter followed by a polylinker region,
a
SV40 intron and polyadenylation site. A DNA fragment encoding the entire CK~i-
13
precursor and an HA tag fused in frame to its 3' end is cloned into the
polylinker
region of the vector, therefore, the recombinant protein expression is
directed under
the CMV promoter. The HA tag corresponds to an epitope derived from the
influenza hemaglutinin protein as previously described (I. Wilson et al.,
1984, Cell
37, 767). The fusion of an HA tag to the target protein allows easy detection
of the
recombinant protein with an antibody that recognizes the HA epitope.
The plasmid construction strategy is described as follows:
The DNA sequence encoding CK~i-13, ATCC # 97113, is constructed by
PCR using two primers: The 5' primer
5' AAAAAGCTTAACATAGGCTCGCCTACAGACT 3' (SEQ ID N0:8)
contains a HindIII site followed by 18 nucleotides of CK(3-13 coding sequence
starting from the minus 3 position relative to the initiation codon; the 3'
primer
5'CGCTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTATTGGCTCAGC
TTATTGAGAAT 3' (SEQ ID N0:9) contains complementary sequence to an XbaI
site, translation stop codon, HA tag and the last 21 nucleotides of the CK[3-
13 coding
sequence (not including the stop codon). Therefore, the PCR product contains a
HindIII site, CK(3-13 coding sequence followed by an HA tag fused in frame, a
translation termination stop codon next to the HA tag, and an Xbal site. The
PCR
amplified DNA fragment and the vector, pcDNA3/Amp, are digested with HindIII
and XbaI restriction enzyme and ligated. The ligation mixture is transformed
into E.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-109-
coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the transformed
culture
is plated on ampicillin media plates and resistant colonies are selected.
Plasmid DNA
is isolated from transformants and examined by restriction analysis for the
presence
of the correct fragment. For expression of the recombinant CK~i-13
polypeptide,
COS cells are transfected with the expression vector by DEAF-DEXTRAN method
(J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring
Harbor
Laboratory Press, (1989)). The expression of the CK(3-13 HA protein is
detected by
radiolabelling and immunoprecipitation method (E. Harlow et al., Antibodies: A
Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are
labelled for 8 hours with 35-S-Cysteine two days post transfection. Culture
media
are then collected and cells are lysed with detergent (RIPA buffer (150 mM
NaCI,
1% NP-40, 0.1% SDS, 0.5% DOC, SOmM Tris, pH 7.5) (Wilson, I. et al., Id.
37:767
{1984)). Both cell lysate and culture media are precipitated with an HA.
specific
monoclonal antibody. Proteins precipitated are analyzed by SDS-PAGE.
Example 4: Expression via Gene Therapy
Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue
is
placed in tissue-culture medium and separated into small pieces. Small chunks
of the
tissue are placed on a wet surface of a tissue culture flask, approximately
ten pieces
are placed in each flask. The flask is turned upside down, closed tight and
left at
room temp. over night. After 24 hours at room temp., the flask is inverted and
the
chunks of tissue remain fixed to the bottom of the flask and fresh media,
e.g., Ham's
F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then
incubated at 37 degrees C for approximately one week. At this time fresh media
is
added and subsequently changed every several days. After an additional two
weeks
in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized
and
scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al. DNA, 7:219-25 (1988) flanked by the long
terminal repeats of the Moloney murine sarcoma virus is digested with EcoRI
and
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-110-
HindIII and subsequently treated with calf intestinal alkaline phosphatase.
The linear
vector is fractionated on agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention is amplified using
PCR primers which correspond to~ the 5' and 3' end sequences respectively. The
5'
primer containing an EcoRI site and the 3' primer further includes a HindIII
site.
Equal quantities of the Moloney murine sarcoma virus linear backbone and the
amplified EcoRI and HindIII fragment are added together, in the presence of T4
DNA ligase. The resulting mixture is maintained under conditions appropriate
for
ligation of the two fragments. The ligation mixture is used to transform
bacteria
HB 1 O 1, which are then plated onto agar-containing kanamycin for the purpose
of
confirming that the vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue
culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with
10% calf serum (CS), penicillin and streptomycin. The MSV vector containing
the
I S gene is then added to the media and the packaging cells are transduced
with the
vector. The packaging cells now produce infectious viral particles containing
the
gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently the
media is harvested from a lOcm plate of confluent producer cells. The spent
media,
containing the infectious viral particles, is filtered through a millipore
filter to remove
detached producer cells and this media is then used to infect fibroblast
cells. Media is
removed from a sub-confluent plate of fibroblasts and quickly replaced with
the
media from the producer cells. This media is removed and replaced with fresh
media.
If the titer of virus is high, then virtually all fibroblasts will be infected
and no
selection is required. If the titier is very low, then it is necessary to use
a retroviral
vector that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either alone or
after
having been grown to confluence on cytodex 3 microcarrier beads. The
fibroblasts
now produce the protein product.
CA 02387808 2002-05-14
WO 01/32128 PCTIUS00/30237
-I11-
Example 5: Chemotactic Effect of CK~3 13 on Activated T lymphocytes
Peripheral blood mononuclear cells were purified from donor leukopacks
(Red Cross) by centrifugation on lymphocyte separation medium (LSM; density
1.077 g/ml; Organon Teknika Corp.) and harvesting the interface band. T-
lymphocytes purified from the PBMCs using T-cell enrichment columns (R&D
Systems). For activation of the T-lymphocytes, cells were stimulated by
crosslinking
through the CD3 receptor in the presence of IL-2 (10 U/ml) for 16 hours prior
to the
chemotaxis assay. Cells used for the assay were washed 3X with HBSS/0.1% BSA
and resuspended at 2 x 106/m1 for labeling. Calcein-AM (Molecular Probes) was
added to a final concentration of 1 mM and the cells incubated at 37°C
for 30
minutes. Following this incubation the cells were washed 3X with HBSS/0.1%
BSA.
Labeled cells were resuspended as 4-8 x 106/m1 and 25m1 (1-2 x 105 cells)
added to
the top of a polycarbonate filter (3-5 mm pore size; PVP free; NeuroProbe,
Inc.)
which separates the cell suspension from the chemotactic agent in the plate
below.
Cells are allowed to migrate for 45 - 90 minutes and then the number of
migrated
cells (both attached to the filter as well as in the bottom plate) are
quantitated using a
Cytofluor II fluorescence plate reader (PerSeptive Biosystems).
Activated T-lymphocytes from three different donors were used for
chemotaxis assays as described above. The data for MCP-1 (open circles) and
CkBeta-13 (closed triangles) are presented as the chemotactic index (the ratio
between the number of cells migrated in the presence of chemokines and the
number
of cells migrated in the presence of buffer control) in Figure 4.
Example 6: CKBeta-13 Modulates the YLA-4 VCAM 1 Adhesion Pathway
in CD4+ Memory and Naive T cells Under Flow Conditions.
In this assay a well characterized in vitro flow model is used to examine the
ability of CKf3-13 to modulate the VLA-4 - VCAM-1 adhesion pathway in CD4+
naive and memory T cells adhesion. (See, e.g., Luscinskas et al. J Cell Biol.
125:1417
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-112-
(1994) and Luscinskas et al. J. Exp. Med. 181:1179 (1995); both references in
their
entirety are hereby incorporated herein by reference.)
T cell interactions with immobilized VCAM-1 on coverslips with or without
CK(3-13 under defined laminar flow were studied using a parallel plate flow
chamber.
Purified T cell subsets were resuspended in RPMI containing 10% FCS at 25 x
106/m1 and incubated for 5 minutes at 37°C. Cells were treated with
medium alone,
or media containing CK[3-13 at various concentrations for a further 5 minutes
at
37°C, diluted to 5 x 106/m1 in prewarmed (3?°C) DPBS containing
0.1% (v/v) HAS
and perfused across coverslips at 2.0 dynes/cm2 (1 ml/min) for 3 min and then
at
decreasing levels of shear stress in increments of 3 minutes. The entire assay
was
videotaped. The number of rolling and firmly adhered cells were determined at
each
shear stess online. T cell accumulation and instantaneous rate of attachment,
ka, were
measured in four randomly chosen fields. Accumulated cells included T cells
that
were either rolling on or firmly adhered to VCAM-1 coated coverslips.
As shown in Figure 5 top panel, pretreatment of naive CD4+ T cells with
CK~3-13 caused a dose-dependent increase in cell accumulation across a range
of
estimated shear stresses. In contrast, as shown in Figure 5 bottom panel,
under
identical conditions CK~i-13 decreased memory T cell accumulation with a range
of
inhibition between 42-72% (N=4) at 1 dynes/cm 2. This concentration range for
CK(3-13 is chemotactic for both T cell subsets (data not shown).
Example 7: CK/.~13 Co-Immobilized with VCAM 1 the VLA-4 YCAM 1
Adhesion Pathway in CD4+Memory anrl Naive T cells Under Flow Conditions
Soluble human VCAM-1 IgG fusion protein, expressed by a recombinant
baculovirus was absorbed at saturating concentrations to 25 mm glass
coverslips
using goat F(ab')2 anti-human Fc antibody. CK(3-13 was adsorbed to VCAM-1
coated coverslips by incubating a 20 u1 aliquot of 100 ng/ml CK(3-13 for 10
minutes
followed by extensive washing with DPBS just prior to use in the flow assay.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-113-
Purified T cell subsets were incubated with perfusion buffer alone or buffer
containing CK~3-13 (100 ng/ml) for 5 minutes and perfused across coverslips
containing VCAM-1 or VCAM-I co-immobilized with CK(3-13 (100 ng/ml). T cell
accumulation at each shear was determined as in Example 6. Either protocol led
to a
significant drop in memory T cell accumulation and conversely, an increase in
naive T
cell accumulation (Figure 6). No cell adhesion to CK(3-13 immobilized alone
(without VCAM-1 ) was observed. These data suggest that independent of the
mode
of presentation, CK~i-I3 exerted specific, but opposing effects, on T cell
subset
VLA-4 dependent adhesion to VCAM-1 under flow.
Example 8: CK~13 modulates CD4+ T cell subset accumulation on
VCAM 1-transduced or TNF-ac activated HUYEC monolayers under flow
HUVEC were induced to selectively express VCAM-1 by transfection of
HUVEC with a VCAM-1 adenovirus. CD4+ naive or memory T cells, either
untreated or treated with CK~i-13 (100 ng/mI, S min prior to perfusion), were
perfused across VCAM-1-expressing HUVEC monolayers. Accumulation of
lymphocytes was measured over a range of shear stresses and is shown in Figure
7A.
CK(3-I3 reduces memory T cell adhesion to 4 hr TNF-a activated HUVEC
monolayers. HUVEC were treated for 4 hr with culture media alone or media
containing 25 ng/ml of recombinant human TNF-oc and inserted into the flow
plate
apparatus. Memory T cells were treated for 5 min with media or media
containing
100 ng/ml CKj3-13 and then perfused across HLTVEC monolayers at 1.2 dynes/cm2.
Flow was sequentially reduced every 3 min to the indicated level of estimated
shear
stress. Memory T cell accumulation at each shear stress was determined as in
Example 6. Data shown in Figure 7B are from n=3 separate experiments. These
data
suggest that CK(3-13 preferentially effects the VLA-4-VCAM-I pathway of T cell-
endothelial cell adhesion.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-I14-
Example 9: mAb to CCR4 totally blocks CK~13 effects on T cells
interactions with YCAM 1.
T cell subsets were incubated with the mAb 1G1, specific for the CKj3-13 cell
receptor, CCR4; or mAb specific for an unrelated receptor CCR2 (each at 20
ug/ml,
20 min at 37°C) and then CK(3-13 (100 ng/ml) was added 5 min prior to
perfusion
across VCAM-1 at 1 dynes/cm2. Naive cells, which do not express CCR4 were
included as a control. T cell accumulation was assessed as in Example 6. Data
are
n=2 for naive and n=3 for memory T cells. CK(3-13 signals through the CCR4 in
memory T cells to down regulate VLA-4 interactions with VCAM-1 as shown in
Figure 8.
Example 10: Construction of N Terminal antUor C Terminal Deletion
Mutants of CK~13.
The following general approach may be used to clone a N-terminal or C-
terminal deletion CK(3-13 deletion mutant. Generally, two oligonucleotide
primers of
about 15-25 nucleotides are derived from the desired 5' and 3' positions of a
polynucleotide of SEQ m NO:1. The 5' and 3' positions of the primers are
determined based on the desired CK(3-13 polynucIeotide fragment. An initiation
and
stop codon are added to the 5' and 3' primers respectively, if necessary, to
express
the CK(3-I3 polypeptide fragment encoded by the polynucleotide fragment.
Preferred CK/3-I3 polynucleotide fragments are those encoding the N-terminal
and
C-terminal deletion mutants disclosed above in the "Polynucleotide and
Polypeptide
Fragments" section of the Specification.
Additional nucleotides containing restriction sites to facilitate cloning of
the
CK~i-13 polynucleotide fragment in a desired vector may also be added to the
5' and
3' primer sequences. The CK/3-13 polynucleotide fragment is amplified from
genomic DNA or from the deposited cDNA clone using the appropriate PCR
oligonucleotide primers and conditions discussed herein or known in the art.
The
CK(3-13 polypeptide fragments encoded by the CK(3-13 polynucleotide fragments
of
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-I15-
the present invention may be expressed and purified in the same general manner
as
the full length polypeptides, although routine modifications may be necessary
due to
the differences in chemical and physical properties between a particular
fragment and
full length polypeptide.
As a means of exemplifying but not limiting the present invention, the
polynucleotide encoding the CKj3-13 polypeptide fragment A-29 to Q-93 is
amplified
and cloned as follows: A 5' primer is generated comprising a restriction
enzyme site
followed by an initiation codon in frame with the polynucleotide sequence
encoding
the N-terminal portion of the polypeptide fragment beginning with A-29. A
complementary 3' primer is generated comprising a restriction enzyme site
followed
by a stop codon in frame with the polynucleotide sequence encoding C-terminal
portion of the CK(3-13 polypeptide fragment ending with Q-93.
The amplified polynucleotide fragment and the expression vector are digested
with restriction enzymes which recognize the sites in the primers. The
digested
polynucleotides are then ligated together. The CK/3-13 polynucleotide fragment
is
inserted into the restricted expression vector, preferably in a manner which
places the
CK~i-13 polypeptide fragment coding region downstream from the promoter. The
ligation mixture is transformed into competent E. coli cells using standard
procedures
and as described in the Examples herein. Plasmid DNA is isolated from
resistant
colonies and the identity of the cloned DNA confirmed by restriction analysis,
PCR
and DNA sequencing.
Example 11: Tissue Distribution of CK~13 Polypeptides
Tissue distribution of mRNA expression of CK(3-13 is determined using
protocols for Northern blot analysis, described by, among others, Sambrook et
al.
For example, a CK(3-13 polynucleotide may be amplified as described in Example
1
and labeled with P32 using the rediprimeTM DNA labeling system (Amersham Life
Science), according to manufacturer's instructions to generate a CK(3-13
specific
probe. After labeling, the probe is purified using CHROMA SPIN-100TM column
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-116-
(Clontech Laboratories, Inc.), according to manufacturer's protocol number
PT1200-
1. The purified labeled probe is then used to examine various human tissues
for
mRNA expression.
Multiple Tissue Northern (MTN) blots containing various human tissues (H)
or human immune system tissues (IM) (Clontech) are examined with the labeled
probe using ExpressHybTM hybridization solution (Clontech) according to
manufacturer's protocol number PT1190-1. Following hybridization and washing,
the blots are mounted and exposed to film at -?0 degree C overnight, and the
films
developed according to standard procedures.
Example 12: Chromosomal Mapping of CK~(313.
An oligonucleotide primer set is designed according to the sequence at the 5'
end of SEQ m NO:l. This primer preferably spans about 100 nucleotides. This
primer set is then used in a polymerase chain reaction under the following set
of
conditions : 30 seconds, 95 degree C; 1 minute, 56 degree C; 1 minute, 70
degree C.
This cycle is repeated 32 times followed by one 5 minute cycle at 70 degree C.
Human, mouse, and hamster DNA is used as template in addition to a somatic
cell
hybrid panel containing individual chromosomes or chromosome fragments (Bios,
Inc). The reactions is analyzed on either 8% polyacrylamide gels or 3.5 %
agarose
gels. Chromosome mapping is determined by the presence of an approximately 100
by PCR fragment in the particular somatic cell hybrid.
Example 13: Protein Fusions of CK~13.
. CKø-13 polypeptides are preferably fused to other proteins. These fusion
proteins can be used for a variety of applications. For example, fusion of
CK(3-13
polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding
protein facilitates purification. (See Example 1; see also EP A 394,827;
Traunecker,
et al., Nature 331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and
albumin
increases the halflife time in vivo. Nuclear localization signals fused to
CK(3-13
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-117-
polypeptides can target the protein to a specific subcellular localization,
while
covalent heterodimer or homodimers can increase or decrease the activity of a
fusion
protein. Fusion proteins can also create chimeric molecules having more than
one
function. Finally, fusion proteins can increase solubility and/or stability of
the fused
protein compared to the non-fused protein. All of the types of fusion proteins
described above can be made by modifying the following protocol, which
outlines the
fusion of a polypeptide to an IgG molecule, or the protocol described in
Example 1.
Briefly, the human Fc portion of the IgG molecule can be PCR amplified,
using primers that span the 5' and 3' ends of the sequence described below.
These
primers also should have convenient restriction enzyme sites that will
facilitate
cloning into an expression vector, preferably a mammalian expression vector.
For example, if pC4 (Accession No. 209646) is used, the human Fc portion
can be ligated into the BamHI cloning site. Note that the 3' BamHI site should
be
destroyed. Next, the vector containing the human Fc portion is re-restricted
with
BamHI, linearizing the vector, and CK~i-13 polynucleotide, isolated by the PCR
protocol described in Example 1, is ligated into this BamHl site. Note that
the
polynucleotide is cloned without a stop codon, otherwise a fusion protein will
not be
produced.
if the naturally occurring signal sequence is used to produce the secreted
protein, pC4 does not need a second signal peptide. Alternatively, if the
naturally
occurring signal sequence is not used, the vector can be modified to include a
heterologous signal sequence. (See, e.g., WO 96134891.)
Human IgG Fc region:
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCAC
CGTGCCCAGCACCTGAATTCGAGGGTGCACCGTCAGTCTTCCTCTTCCCC
CCAAA.ACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATG
CGTGGTGGTGGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGG
TACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGG
AGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCAC
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-118-
CAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAG
CCCTCCCAACCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCC
CGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCA
AGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGAC
ATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGA
CCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAG
CTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCT
CCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCC
CTGTCTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT (SEQ
ID NO:10)
Example 14: Production of an Antibody
a) Hybridoma Technology
The antibodies of the present invention can be prepared by a variety of
methods. (See, Current Protocols, Chapter 2.) As one example of such methods,
cells expressing CK(3-13 is administered to an animal to induce the production
of sera
containing polyclonal antibodies. In a preferred method, a preparation of CK~3-
13
protein is prepared and purified to render it substantially free of natural
contaminants.
Such a preparation is then introduced into an animal in order to produce
polyclonal
antisera of greater specific activity.
In the most preferred method, the antibodies of the present invention are
monoclonal antibodies (or protein binding fragments thereof). Such monoclonal
antibodies can be prepared using hybridoma technology. (Kohler et al., Nature
256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et al.,
Eur. J.
Immunol. 6:292 (1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell
Hybridomas, Elsevier, N.Y., pp. 563-681 (1981).) In general, such procedures
involve immunizing an animal (preferably a mouse) with CK(3-13 polypeptide or,
more preferably, with a secreted CKj3-13 polypeptide-expressing cell. Such
cells
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-119-
may be cultured in any suitable tissue culture medium; however, it is
preferable to
culture cells in Earle's modified Eagle's medium supplemented with 10% fetal
bovine
serum (inactivated at about 56 degree C), and supplemented with about 10 g/1
of
nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ug/ml
of
streptomycin.
The splenocytes of such mice are extracted and fused with a suitable myeloma
cell line. Any suitable myeloma cell line may be employed in accordance with
the
present invention; however, it is preferable to employ the parent myeloma cell
line
(SP20), available from the ATCC. After fusion, the resulting hybridoma cells
are
selectively maintained in HAT medium, and then cloned by limiting dilution as
described by Wands et al. (Gastroenterology 80:225-232 (1981).) The hybridoma
cells obtained through such a selection are then assayed to identify clones
which
secrete antibodies capable of binding the CK(3-13 polypeptide.
Alternatively, additional antibodies capable of binding to CK~i-13 polypeptide
1 S can be produced in a two-step procedure using anti-idiotypic antibodies.
Such a
method makes use of the fact that antibodies are themselves antigens, and
therefore,
it is possible to obtain an antibody which binds to a second antibody. In
accordance
with this method, protein specific antibodies are used to immunize an animal,
preferably a mouse. The splenocytes of such an animal are then used to produce
hybridoma cells, and the hybridoma cells are screened to identify clones which
produce an antibody whose ability to bind to the CK[3-13 protein-specific
antibody
can be blocked by CK(3-13. Such antibodies comprise anti-idiotypic antibodies
to the
CK(3-13 protein-specific antibody and can be used to immunize an animal to
induce
formation of further CK(3-13 protein-specific antibodies.
It will be appreciated that Fab and F(ab')2 and other fragments of the
antibodies of the present invention may be used according to the methods
disclosed
herein. Such fragments are typically produced by proteolytic cleavage, using
enzymes such as papain (to produce Fab fragments) or pepsin (to produce
F(ab')2
fragments). Alternatively, secreted CK(3-13 protein-binding fragments can be
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-120-
produced through the application of recombinant DNA technology or through
synthetic chemistry.
For in vivo use of antibodies in humans, it may be preferable to use
"humanized" chimeric monoclonal antibodies. Such antibodies can be produced
using genetic constructs derived from hybridoma cells producing the monoclonal
antibodies described above. Methods for producing chimeric antibodies are
known in
the art. (See, for review, Morrison, Science 229:1202 (1985); Oi et al.,
BioTechniques 4:214 (1986); Cabilly et al., U.S. Patent No. 4,816,567;
Taniguchi et
al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533;
Robinson et al., WO 8702671; Boulianne et al., Nature 312:643 (1984);
Neuberger
et al., Nature 314:268 (1985).)
b) Isolation of antibody fragments directed against CK(3-13 from a
library of scFvs.
Naturally occuring V-genes isolated from human PBLs are constructed into a
large library of antibody fragments which contain reactivities against CK~i-13
to
which the donor may or may not have been exposed (see e.g., U.S. Patent
5,885,793
incorporated herein in its entirety by reference).
Rescue of the Library. A library of scFvs is constructed from the RNA of
human PBLs as described in W092/01047. To rescue phage displaying antibody
fragments, approximately 109 E. coli harbouring the phagemid are used to
inoculate
50 ml of 2xTY containing 1% glucose and 100 ug/ml of ampicillin (2xTY-AMP-
GLU) and grown to an O.D. of 0.8 with shaking. Five ml of this culture is used
to
innoculate 50 ml of 2xTY-AMP-GLU, 2 x lOx TU of delta gene 3 helper (M13 delta
gene III, see W092/01047) are added and the culture incubated at 37 degree C
for
45 minutes without shaking and then at 37 degree C for 45 minutes with
shaking.
The culture is centrifuged at 4000 r.p.m. for 10 min. and the pellet
resuspended in 2
liters of of 2xTY containing 100 ug/ml ampicillin and 50 ug/ml kanamycin and
grown
overnight. Phage are prepared as described in W092/01047.
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-121-
M 13 delta gene III is prepared as follows. M 13 delta gene III helper phage
does not encode gene III protein, hence the phage(mid) displaying antibody
fragments have a greater avidity of binding to antigen. Infectious M13 delta
gene III
particles are made by growing the helper phage in cells harbouring a pUCl9
derivative supplying the wild type gene III protein during phage
morphogenesis. The
culture is incubated for 1 hour at 37 degree C without shaking and then for a
further
hour at 37 degree C with shaking. Cells are spun down (IEC-Centra 8, 4000
revs/min
for 10 min), resuspended in 300 ml 2xTY broth containing 100 ug ampicillin/ml
and
25 ug kanamycin/ml (2xTY-AMP-KAN) and grown overnight, shaking at 37°
C.
Phage particles are purified and concentrated from the culture medium by two
PEG-
precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS and passed
through
a 0.45 um filter (Minisart NML,; Sartorius) to give a final concentration of
approximately 10'3 transducing units/ml (ampicillin-resistant clones).
Panning of the Library. Immunotubes (Nunc) are coated overnight in PBS
with 4 ml of either 100 ug/ml or 10 ug/ml of a polypeptide of the present
invention.
Tubes are blocked with 2% Marvel-PBS for 2 hours at 37 degree C and then
washed
3 times in PBS. Approximately 10'3 TU of phage is applied to the tube and
incubated
for 30 minutes at room temperature tumbling on an over and under turntable and
then left to stand for another 1.5 hours. Tubes are washed 10 times with PBS
0.1%
Tween-20 and 10 times with PBS. Phage are eluted by adding 1 ml of 100 mM
triethylamine and rotating 15 minutes on an under and over turntable after
which the
solution is immediately neutralized with 0.5 ml of 1.0M Tris-HCI, pH 7.4.
Phage are
then used to infect 10 ml of mid-log E. coli TG1 by incubating eluted phage
with
bacteria for 30 minutes at 37 degree C. The E. toll are then plated on TYE
plates
containing 1% glucose and 100 ug/ml ampicillin. The resulting bacterial
library is
then rescued with delta gene 3 helper phage as described above to prepare
phage for
a subsequent round of selection. This process is then repeated for a total of
4 rounds
of amity purification with tube-washing increased to 20 times with PBS, 0.1%
Tween-20 and 20 times with PBS for rounds 3 and 4.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-122-
Characterization of Binders. Eluted phage from the 3rd and 4th rounds of
selection are used to infect E. coli HB 2151 and soluble scFv is produced
(Marks, et
al., 1991) from single colonies for assay. ELISAs are performed with
microtitre
plates coated with either 10 pg/ml of the polypeptide of the present invention
in 50
mM bicarbonate pH 9.6. Clones positive in EL1SA are further characterized by
PCR
fingerprinting (see e.g., W092/01047) and then by sequencing.
Example 1 S: Production Of CK~13 Protein For High-Tlzroughput
Screening Assays
The following protocol produces a supernatant containing CK~i-13
polypeptide to be tested. This supernatant can then be used in the Screening
Assays
described in Examples 17-21.
First, dilute Poly-D-Lysine (644 587 Boehringer-Mannheim) stock solution
(lmg/ml in PBS) 1:20 in PBS (w/o calcium or magnesium 17-516F Biowhittaker)
for
1 S a working solution of SOug/ml. Add 200 u1 of this solution to each well
(24 well
plates) and incubate at RT for 20 minutes. Be sure to distribute the solution
over
each well (note: a 12-channel pipetter may be used with tips on every other
channel).
Aspirate off the Poly-D-Lysine solution and rinse with lml PBS (Phosphate
Buffered
Saline). The PBS should remain in the well until just prior to plating the
cells and
plates may be poly-lysine coated in advance for up to two weeks.
Plate 293T cells (do not carry cells past P+20) at 2 x 105 cells/well in .SmI
DMEM(Dulbecco's Modified Eagle Medium)(with 4.5 G/L glucose and L-glutamine
(12-604F Biowhittaker))/10% heat inactivated FBS(14-503F Biowhittaker)/lx
Penstrep(17-602E Biowhittaker). Let the cells grow overnight.
The next day, mix together in a sterile solution basin: 300 ui Lipofectamine
(18324-012 GibcoBRL) and Sml Optimem I (31985070 GibcoBRL)/96-well plate.
With a small volume mufti-channel pipetter, aliquot approximately tug of an
expression vector containing a polynucleotide insert, produced by the methods
described in Examples 1-3, into an appropriately labeled 96-well round bottom
plate.
With a mufti-channel pipetter, add SOuI of the Lipofectamine/Optimem I mixture
to
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-123-
each well. Pipette up and down gently to mix. Incubate at RT 15-45 minutes.
After
about 20 minutes, use a mufti-channel pipetter to add 150u1 Optimem I to each
well.
As a control, one plate of vector DNA lacking an insert should be transfected
with
each set of transfections.
S Preferably, the transfection should be performed by tag-teaming the
following
tasks. By tag-teaming, hands on time is cut in half, and the cells do not
spend too
much time on PBS. First, person A aspirates off the media from four 24-well
plates
of cells, and then person B rinses each well with .5-lml PBS. Person A then
aspirates off PBS rinse, and person B, using alt-channel pipetter with tips on
every
other channel, adds the 200u1 of DNA/Lipofectamine/Optimem I complex to the
odd
wells first, then to the even wells, to each row on the 24-well plates.
Incubate at 37
degree C for 6 hours.
While cells are incubating, prepare appropriate media, either 1%BSA in
DMEM with lx penstrep, or HGS CHO-5 media (116.6 mg/L of CaCl2 (anhyd);
0.00130 mglL CuS04-5H20; 0.050 mglL of Fe(N03)3-9H20; 0.417 mg/L of
FeS04-7H20; 311.80 mg/L of Kcl; 28.64 mg/L of MgCl2; 48.84 mg/L of MgS04;
6995.50 mg/L of NaCI; 2400.0 mg/L of NaHC03; 62.50 mg/L of NaH2P04-H20;
71.02 mg/L of Na2HP04; .4320 mg/L of ZnS04-7H20; .002 mg/L of Arachidonic
Acid ; 1.022 mg/L of Cholesterol; .070 mg/L of DL-alpha-Tocopherol-Acetate;
0.0520 mg/L of Linoleic Acid; 0.010 mg/L of Linolenic Acid; 0.010 mg/L of
Myristic
Acid; 0.010 mg/L of Oleic Acid; 0.010 mg/L of Palmitric Acid; 0.010 mglL of
Palmitic Acid; 100 mg/L of Pluronic F-68; 0.010 mg/L of Stearic Acid; 2.20
mg/L of
Tween 80; 4551 mg/L of D-Glucose; 130.85 mg/ml of L- Alanine; 147.50 mg/ml of
L-Arginine-HCL; 7.50 mg/ml of L-Asparagine-H20; 6.65 mg/ml of L-Aspartic Acid;
29.56 mg/ml of L-Cystine-2HCL-H20; 31.29 mg/ml of L-Cystine-2HCL; 7.35 mg/ml
of L-Glutamic Acid; 365.0 mg/ml of L-Glutamine; 18.75 mg/ml of Glycine; 52.48
mg/ml of L-Histidine-HCL-H20; 106.97 mg/m1 of L-lsoleucine; 1 I 1.45 mg/ml of
L-
Leucine; 163.75 mg/ml of L-Lysine HCL; 32.34 mg/ml of L-Methionine; 68.48
mg/ml of L-Phenylalainine; 40.0 mg/ml of L-Proline; 26.25 mg/ml of L-Serine;
101.05 mg/ml of L-Threonine; 19.22 mg/ml of L-Tryptophan; 91.79 mg/ml of L-
CA 02387808 2002-05-14
WO 01132128 PCT/ITS00130237
-124-
Tryrosine-2Na- 2H20; and 99.65 mg/ml of L-Valine; 0.0035 mglL of Biotin; 3.24
mg/L of D-Ca Pantothenate; 11.78 mg/L of Choline Chloride; 4.65 mglL of Folic
Acid; 15.60 mg/L of i-Inositol; 3.02 mg/L of Niacinamide; 3.00 mg/L of
Pyridoxal
HCL; 0.031 mg/L of Pyridoxine HCL; 0.319 mg/L of Riboflavin; 3.17 mg/L of
Thiamine HCL; 0.365 mg/I, of Thymidine; 0.680 mg/L of Vitamin B12; 25 mM of
HEPES Buffer; 2.39 mg/L of Na Hypoxanthine; 0.105 mglL of Lipoic Acid; 0.081
mg/L of Sodium Putrescine-2HCL; 55.0 mg/L of Sodium Pyruvate; 0.0067 mg/L of
Sodium Selenite; 20uM of Ethanolamine; 0.122 mg/L of Ferric Citrate; 41.70
mg/L
of Methyl-B-Cyclodextrin complexed with Linoleic Acid; 33.33 mg/L of Methyl-B-
Cyclodextrin complexed with Oleic Acid; 10 mg/L of Methyl-B-Cyclodextrin
complexed with Retinal Acetate. Adjust osmolarity to 327 mOsm) with 2mm
glutamine and lx penstrep. (BSA (81-068-3 Bayer) 100gm dissolved in 1L DMEM
for a 10% BSA stock solution). Filter the media and collect 50 u1 for
endotoxin
assay in I5m1 polystyrene conical.
The transfection reaction is terminated, preferably by tag-teaming, at the end
of the incubation period. Person A aspirates off the transfection media, while
person
B adds 1.5m1 appropriate media to each well. Incubate at 37 degree C for 45 or
72
hours depending on the media used: 1%BSA for 45 hours or CHO-5 for 72 hours.
On day four, using a 300u1 multichannel pipetter, aliquot 600u1 in one lml
deep well plate and the remaining supernatant into a 2m1 deep well. The
supernatants
from each well can then be used in the assays described in Examples 17-24.
It is specifically understood that when activity is obtained in any of the
assays
described below using a supernatant, the activity originates from either the
CK/3-I3
polypeptide directly (e.g., as a secreted protein) or by CK(3-13 inducing
expression of
other proteins, which are then secreted into the supernatant. Thus, the
invention
further provides a method of identifying the protein in the supernatant
characterized
by an activity in a particular assay.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-125-
Example 16: Construction of GAS Reporter Construct
One signal transduction pathway involved in the differentiation and
proliferation of cells is called the Jaks-STATs pathway. Activated proteins in
the
Jaks-STATs pathway bind to gamma activation site "GAS" elements or interferon-
sensitive responsive element ("ISRE"), located in the promoter of many genes.
The
binding of a protein to these elements alter the expression of the associated
gene.
GAS and ISRE elements are recognized by a class of transcription factors
called Signal Transducers and Activators of Transcription, or "STATs." There
are
six members of the STATs family. Statl and Stat3 are present in many cell
types, as
is Stat2 (as response to IFN-alpha is widespread). Stat4 is more restricted
and is not
in many cell types though it has been found in T helper class I, cells after
treatment
with IL-12. StatS was originally called mammary growth factor, but has been
found
at higher concentrations in other cells including myeloid cells. It can be
activated in
tissue culture cells by many cytokines.
The STATs are activated to translocate from the cytoplasm to the nucleus
upon tyrosine phosphorylation by a set of kinases known as the Janus Kinase
("Jaks")
family. Jaks represent a distinct family of soluble tyrosine kinases and
include Tyk2,
Jakl, Jak2, and Jak3. These kinases display significant sequence similarity
and are
generally catalytically inactive in resting cells.
The Jaks are activated by a wide range of receptors summarized in the Table
below. (Adapted from review by Schidler and Darnell, Ann. Rev. Biochem. 64:621-
51 (1995).) A cytokine receptor family, capable of activating Jaks, is divided
into two
groups: (a) Class 1 includes receptors for IL-2, IL,-3, IL-4, IL-6, IL-7, IL-
9, IL-1l,
IL-12, IL-I5, Epo, PRL, GH, G-CSF, GM-CSF, LIF, CNTF, and thrombopoietin;
and (b) Class 2 includes IFN-a, IFN-g, and IL-10. The Class 1 receptors share
a
conserved cysteine motif (a set of four conserved cysteines and one
tryptophan) and
a WSXWS motif (a membrane proximal region encoding Trp-Ser-Xxx-Trp-Ser (SEQ
ID NO:S)).
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-126-
Thus, on binding of a ligand to a receptor, Jaks are activated, which in turn
activate STATs, which then translocate and bind to GAS elements. This entire
process is encompassed in the Jaks-STATs signal transduction pathway.
Therefore, activation of the Jaks-STATs pathway, reflected by the binding of
the GAS or the 1SRE element, can be used to indicate proteins involved in the
proliferation and differentiation of cells. For example, growth factors and
cytokines
are known to activate the Jaks-STATs pathway. (See Table below.) Thus, by
using
GAS elements linked to reporter molecules, activators of the Jaks-STATs
pathway
can be identified.
JAKs
STATS
GAS (elements)
L~gand ~k2 Jakl Jak2 Jak3 or ISRE
IFN family
IFN-a.B + + - - 1,2,3 ISRE
IFN-y + + - 1 GAS
(IRFI>Lys6>IFP)
Il-10 + ? ? - 1,3
gp 130 family
IL-6 (Pleiotrohic) + + + ? 1,3 GAS
(IRF 1 >Lys6>IFP)
Il-1 1(Pleiotrohic) ? + ? ? 1 3
OnM(Pleiotrohic) ? + + ? 1,3
LIF(Pleiotrohic) ? + + ? 1,3
CNTF(Pleiotrohic) /+ + + ? 1,3
G-CSF(Pleiotrohic) ? + ? ? 1,3
IL-12(Pleiotrohic) + - + + 1,3
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-127-
g-C family
IL-2 (lymphocytes)- + - + 1,3,5 GAS
IL-4 (lymph/myeloid)- + - + 6 GAS (IRFI=IFP
>Ly6)(IgH)
IL-7 (lymphocytes)- + - + 5 GAS
IL-9 (lymphocytes)- + - + 5 GAS
IL-13 (lymphocyte)- + ? ? 6 GAS
IL-15 ? + ? + 5 GAS
gp 140 fami~
IL-3 (myeloid) - - + - 5 GAS
(IRF I >IFPLy6)
IL-5 (myeloid) - - + - 5 GAS
GM-CSF (myeloid) - - + - 5 GAS
Growth hormone
family
GH ? - + - 5
PRL ? +1- + - 1,3,5
EPO ? - + - 5 GAS(B-CAS>
IRF 1=IFPLy6)
Receptor Tyrosine
Kinases
EGF ? + + - 1,3 GAS (IRF1)
PDGF ? + + - 1,3
CSF-1 ? + + - 1,3 GAS (not IRF1)
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-128-
To constrict a synthetic GAS containing promoter element, which is used in
the Biological Assays described in Examples 17-18, a PCR based strategy is
employed to generate a GAS-SV40 promoter sequence. The 5' primer contains four
tandem copies of the GAS binding site found in the IRF1 promoter and
previously
demonstrated to bind STATs upon induction with a range of cytokines (Rothman
et
al., Immunity 1:457-468 (1994).), although other GAS or ISRE elements can be
used
instead. The 5' primer also contains l8bp of sequence complementary to the
SV40
early promoter sequence and is flanked with an XhoI site. The sequence of the
5'
primer is:
5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATT
TCCCCGAAATGATTTCCCCGAAATATCTGCCATCTCAATTAG:3' (SEQ ID
NO:11)
The downstream primer is complementary to the SV40 promoter and is
flanked with a Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3'
(SEQ ID N0:12)
PCR amplification is performed using the SV40 promoter template present in
the B-gal:promoter plasmid obtained from Clontech. The resulting PCR fragment
is
digested with XhoIlHind III and subcloned into BLSK2-. (Stratagene.)
Sequencing
with forward and reverse primers confirms that the insert contains the
following
sequence:
5':CTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCC
CGAAATGATTTCCCCGAAATATCTGCCATCTCAATTAGTCAGCAACCATA
GTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGC
CCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGA
GGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTG
GAGGCCTAGGCTTTTGCAAAAAGCTT:3' (SEQ ID N0:13)
With this GAS promoter element linked to the SV40 promoter, a
GAS:SEAP2 reporter construct is next engineered. Here, the reporter molecule
is a
secreted alkaline phosphatase, or "SEAP." Clearly, however, any reporter
molecule
can be instead of SEAP, in this or in any of the other Examples. Well known
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-129-
reporter molecules that can be used instead of SEAP include chloramphenicol
acetyltransferase (CAT), luciferase, alkaline phosphatase, beta-galactosidase,
green
fluorescent protein (GFP), or any protein detectable by an antibody.
The above sequence confirmed synthetic GAS-SV40 promoter element is
subcloned into the pSEAP-Promoter vector obtained from Clontech using HindIIl
and Xhol, effectively replacing the SV40 promoter with the amplified GAS:SV40
promoter element, to create the GAS-SEAP vector. However, this vector does not
contain a neomycin resistance gene, and therefore, is not preferred for
mammalian
expression systems.
Thus, in order to generate mammalian stable cell lines expressing the GAS-
SEAP reporter, the GAS-SEAP cassette is removed from the GAS-SEAP vector
using SaII and NotI, and inserted into a backbone vector containing the
neomycin
resistance gene, such as pGFP-1 (Clontech), using these restriction sites in
the
multiple cloning site, to create the GAS-SEAP/Neo vector. Once this vector is
transfected into mammalian cells, this vector can then be used as a reporter
molecule
for GAS binding as described in Examples 17-18.
Other constructs can be made using the above description and replacing GAS
with a different promoter sequence. For example, construction of reporter
molecules
containing NFK-B and EGR promoter sequences are described in Examples 20 and
19. However, many other promoters can be substituted using the protocols
described in these Examples. For instance, SRE, IL-2, NEAT, or Osteocalcin
promoters can be substituted, alone or in combination (e.g., GAS/NF-
kappaB/EGR,
GAS/NF-kappaB, Il-2/NFAT, or NF-kappaB/GAS). Similarly, other cell lines can
be
used to test reporter construct activity, such as HELA (epithelial), HUVEC
(endothelial), Reh (B-cell), Saos-2 (osteoblast), HUVAC (aortic), or
Cardiomyocyte.
Example 17: High-Throughput Screening Assay. for T cell Activity.
The following protocol is used to assess T-cell activity by identifying
factors,
and determining whether supernate containing a polypeptide of the invention
proliferates and/or dii~erentiates T-cells. T-cell activity is assessed using
the
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-130-
GAS/SEAP/Neo construct produced in Example 16. Thus, factors that increase
SEAP activity indicate the ability to activate the Jaks-STATS signal
transduction
pathway. The T-cell used in this assay is Jurkat T-cells (ATCC Accession No.
TIB
152), although Molt-3 cells (ATCC Accession No. CRL-1552) and Molt-4 cells
(ATCC Accession No. CRL-1582) cells can also be used.
Jurkat T-cells are lymphoblastic CD4+ Thl helper cells. In order to generate
stable cell lines, approximately 2 million Jurkat cells are transfected with
the GAS-
SEAP/neo vector using DMRIE-C (Life Technologies)(transfection procedure
described below). The transfected cells are seeded to a density of
approximately
20,000 cells per well and transfectants resistant to 1 mg/ml genticin
selected.
Resistant colonies are expanded and then tested for their response to
increasing
concentrations of interferon gamma. The dose response of a selected clone is
demonstrated.
Specifically, the following protocol will yield sufficient cells for 75 wells
containing 200 u1 of cells. Thus, it is either scaled up, or performed in
multiple to
generate sufficient cells for multiple 96 well plates. Jurkat cells are
maintained in
RPMI + 10% serum with 1%Pen-Strep. Combine 2.5 mls of OPTI-MEM {Life
Technologies) with 10 ug of plasmid DNA in a T25 flask. Add 2.5 ml OPTI-MEM
containing 50 u1 of DMRIE-C and incubate at room temperature for 15-45 mins.
During the incubation period, count cell concentration, spin down the
required number of cells (10' per transfection), and resuspend in OPTI-MEM to
a
final concentration of 10' cells/ml. Then add 1 ml of 1 x 10' cells in OPTI-
MEM to
T25 flask and incubate at 37 degree C for 6 hrs. After the incubation, add 10
ml of
RPMI + 15% serum.
The Jurkat:GAS-SEAP stable reporter lines are maintained in RPMI + 10%
serum, 1 mg/ml Genticin, and 1% Pen-Strep. These cells are treated with
supernatants containing CK(3-I3 polypeptides or CK~i-13 induced polypeptides
as
produced by the protocol described in Example 15.
On the day of treatment with the supernatant, the cells should be washed and
resuspended in fresh RPMI + 10% serum to a density of 500,000 cells per ml.
The
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-131-
exact number of cells required will depend on the number of supernatants being
screened. For one 96 well plate, approximately 10 million cells (for 10
plates, 100
million cells) are required.
Transfer the cells to a triangular reservoir boat, in order to dispense the
cells
into a 96 well dish, using a 12 channel pipette. Using a 12 channel pipette,
transfer
200 u1 of cells into each well (therefore adding 100, 000 cells per well).
After all the plates have been seeded, 50 u1 of the supernatants are
transferred
directly from the 96 well plate containing the supernatants into each well
using a 12
channel pipette. In addition, a dose of exogenous interferon gamma (0.1, 1.0,
10 ng)
is added to wells H9, H10, and Hl 1 to serve as additional positive controls
for the
assay.
The 96 well dishes containing 3urkat cells treated with supernatants are
placed in an incubator for 48 hrs (note: this time is variable between 48-72
hrs). 35
u1 samples from each well are then transferred to an opaque 96 well plate
using a 12
channel pipette. The opaque plates should be covered (using sellophene covers)
and
stored at -20 degree C until SEAP assays are performed according to Example
18.
The plates containing the remaining treated cells are placed at 4 degree C and
serve
as a source of material for repeating the assay on a specific well if desired.
As a positive control, 100 Unit/ml interferon gamma can be used which is
known to activate Jurkat T cells. Over 30 fold induction is typically observed
in the
positive control wells.
The above protocol may be used in the generation of both transient, as well
as, stable transfected cells, which would be apparent to those of skill in the
art.
Example 18: High-Throughput Screening Assay Identifying Myeloid
Activity
The following protocol is used to assess myeloid activity of CK(3-13 by
determining whether CK(3-13 proliferates and/or differentiates myeloid cells.
Myeloid cell activity is assessed using the GAS/SEAP/Neo construct produced in
Example 16. Thus, factors that increase SEAP activity indicate the ability to
activate
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-132-
the Jaks-STATS signal transduction pathway. The myeloid cell used in this
assay is
U937, a pre-monocyte cell line, although TF-1, HL60, or KG1 can be used.
To transiently transfect U937 cells with the GAS/SEAP/Neo construct
produced in Example 16, a DEAF-Dextran method (Kharbanda et. al., 1994, Cell
Growth & Differentiation, 5:259-265) is used. First, harvest 2x10e7 U937 cells
and
wash with PBS. The U937 cells are usually grown in RPMI 1640 medium containing
10% heat-inactivated fetal bovine serum (FBS) supplemented with 100 units/ml
penicillin and 100 mg/ml streptomycin.
Next, suspend the cells in 1 ml of 20 mM Tris-HCl (pH 7.4) buffer containing
0.5 mg/ml DEAE-Dextran, 8 ug GAS-SEAP2 plasmid DNA, 140 mM NaCI, 5 mM
KCI, 375 uM Na2HP04.7H20, 1 mM MgCl2, and 675 uM CaCl2. Incubate at 37
degrees C for 45 min.
Wash the cells with RPMI 1640 medium containing 10% FBS and then
resuspend in 10 ml complete medium and incubate at 37 degree C for 36 hr.
The GAS-SEAP/U937 stable cells are obtained by growing the cells in 400
ug/ml 6418. The 6418-free medium is used for routine growth but every one to
two
months, the cells should be re-grown in 400 ug/ml 6418 for couple of passages.
These cells are tested by harvesting 1x10 cells (this is enough for ten 96-
well
plates assay) and wash with PBS. Suspend the cells in 200 ml above described
growth medium, with a final density of 5x105 cells/ml. Plate 200 u1 cells per
well in
the 96-well plate (or 1x105 cells/well).
Add 50 u1 of the supernatant prepared by the protocol described in Example
15. Incubate at 37 degee C for 48 to 72 hr- As a positive control, 100 Unit/ml
interferon gamma can be used which is known to activate U937 cells. Over 30
fold
induction is typically observed in the positive control wells. SEAP assay the
supernatant according to the protocol described in Example 18.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-133-
Example 19: High-Throughput Screening Assay Irlenttfying Neuronal
Activity.
When cells undergo differentiation and proliferation, a group of genes are
activated through many different signal transduction pathways. One of these
genes,
EGRl (early growth response gene 1), is induced in various tissues and cell
types
upon activation. The promoter of EGRI is responsible for such induction. Using
the
EGR1 promoter linked to reporter molecules, activation of cells can be
assessed by
CK(3-13.
Particularly, the following protocol is used to assess neuronal activity in PC
12
cell lines. PC12 cells (rat phenochromocytoma cells) are known to proliferate
and/or
differentiate by activation with a number of mitogens, such as TPA
(tetradecanoyl
phorbol acetate), NGF (nerve growth factor), and EGF (epidermal growth
factor).
The EGRI gene expression is activated during this treatment. Thus, by stably
transfecting PC12 cells with a construct containing an EGR promoter linked to
SEAP reporter, activation of PC12 cells by CK~-13 can be assessed.
The EGR/SEAP reporter construct can be assembled by the following
protocol. The EGR-1 promoter sequence (-633 to +1)(Sakamoto K et al.,
Oncogene.
6:867-871 (1991)) can be PCR amplified from human genomic DNA using the
following primers:
5' GCGCTCGAGGGATGACAGCGATAGAACCCCGG -3' (SEQ )D
N0:14)
5' GCGAAGCTTCGCGACTCCCCGGATCCGCCTC-3' (SEQ ID NO:15)
Using the GAS/SEAP/Neo vector produced in Example 16, EGRI amplified
product can then be inserted into this vector. Linearize the GAS:SEAP/Neo
vector
using restriction enzymes XhoI/HindIII, removing the GAS/SV40 stuffer.
Restrict
the EGRi amplified product with these same enzymes. Ligate the vector and the
EGRl promoter.
To prepare 96 well-plates for cell culture, two mls of a coating solution
(1:30
dilution of collagen type I (Upstate Biotech lnc. Cat#08-115) in 30% ethanol
(filter
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-134-
sterilized)) is added per one 10 cm plate or 50 ml per well of the 96-well
plate, and
allowed to air dry for 2 hr.
PC12 cells are routinely grown in RPMI-1640 medium (Bio Whittaker)
containing 10% horse serum (JRH BIOSCIENCES, Cat. # 12449-78P), 5% heat-
inactivated fetal bovine serum (FBS) supplemented with 100 units/ml penicillin
and
100 ug/ml streptomycin on a precoated 10 cm tissue culture dish. One to four
split is
done every three to four days. Cells are removed from the plates by scraping
and
resuspended with pipetting up and down for more than 15 times.
Transfect the EGR/SEAP/Neo construct into PC12 using the Lipofectamine
protocol described in Example 15. EGR-SEAP/PC12 stable cells are obtained by
growing the cells in 300 ug/ml 6418. The 6418-free medium is used for routine
growth but every one to two months, the cells should be re-grown in 300 ug/ml
6418 for couple of passages.
To assay for neuronal activity, a 10 cm plate with cells around 70 to 80%
confluent is screened by removing the old medium. Wash the cells once with PBS
(Phosphate bui~ered saline). Then starve the cells in low serum medium (RPMI-
1640
containing 1% horse serum and 0.5% FBS with antibiotics) overnight.
The next morning, remove the medium and wash the cells with PBS. Scrape
off the cells from the plate, suspend the cells well in 2 ml low serum medium.
Count
the cell number and add more low serum medium to reach final cell density as
5x105
cells/ml.
Add 200 u1 of the cell suspension to each well of 96-well plate (equivalent to
1x105 cellslwell). Add 50 u1 supernatant produced by Example 15, 37 degree C
for
48 to 72 hr. As a positive control, a growth factor known to activate PC12
cells
through EGR can be used, such as 50 ng/ul of Neuronal Growth Factor (NGF).
Over fifty-fold induction of SEAP is typically seen in the positive control
wells.
SEAP assay the supernatant according to Example 18.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-135-
Example 20: HiglZ-Throughput Screening Assay for T cell Activity
NF-kappaB (Nuclear Factor kappaB) is a transcription factor activated by a
wide variety of agents including the inflammatory cytokines IL,-1 and TNF,
CD30
and CD40, lymphotoxin-alpha and lymphotoxin-beta, by exposure to LPS or
thrombin, and by expression of certain viral gene products. As a transcription
factor,
NF-kappaB regulates the expression of genes involved in immune cell
activation,
control of apoptosis (NF-kappaB appears to shield cells from apoptosis), B and
T-
cell development, anti-viral and antimicrobial responses, and multiple stress
responses.
In non-stimulated conditions, NF-kappaB is retained in the cytoplasm with I-
kappaB (Inhibitor kappaB). However, upon stimulation, I-kappaB is
phosphorylated
and degraded, causing NF-kappaB to shuttle to the nucleus, thereby activating
transcription of target genes. Target genes activated by NF-kappaB include IL-
2, IL-
b, GM-CSF, ICAM-1 and class 1 MHC.
Due to its central role and ability to respond to a range of stimuli, reporter
constructs utilizing the NF-kappaB promoter element are used to screen the
supernatants produced in Example 15. Activators or inhibitors of NF-kappaB
would
be useful in treating diseases. For example, inhibitors of NF-kappaB could be
used
to treat those diseases related to the acute or chronic activation of NF-
kappaB, such
as rheumatoid arthritis.
To construct a vector containing the NF-kappaB promoter element, a PCR
based strategy is employed. The upstream primer contains four tandem copies of
the
NF-kappaB binding site (GGGGACTTTCCC) (SEQ ID N0:16), 18 by of sequence
complementary to the 5' end of the SV40 early promoter sequence, and is
flanked
with an XhoI site:
5':GCGGCCTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCC
GGGACTTTCCATCCTGCCATCTCAATTAG:3' (SEQ ID N0:17)
The downstream primer is complementary to the 3' end of the SV40
promoter and is flanked with a Hind III site:
5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID N0:12)
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-136-
PCR amplification is performed using the SV40 promoter template present in
the pB-gal:promoter plasmid obtained from Clontech. The resulting PCR fragment
is
digested with XhoI and Hind III and subcloned into BLSK2- (Stratagene).
Sequencing with the T7 and T3 primers confirms the insert contains the
following
sequence:
5':CTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGAC
TTTCCATCTGCCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTC
CGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATG
GCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCT
GAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTG
CAAAAAGCTT:3' (SEQ ID N0:18)
Next, replace the SV40 minimal promoter element present in the pSEAP2-
promoter plasmid (Clontech) with this NF-kappaB/SV40 fragment using Xhol and
HindIII. However, this vector does not contain a neomycin resistance gene, and
therefore, is not preferred for mammalian expression systems.
In order to generate stable mammalian cell lines, the NF-kappaB/SV40/SEAP
cassette is removed from the above NF-kappaB/SEAP vector using restriction
enzymes SaII and NotI, and inserted into a vector containing neomycin
resistance.
Particularly, the NF-kappaB/SV40/SEAP cassette was inserted into pGFP-1
(Clontech), replacing the GFP gene, after restricting pGFP-1 with SaII and
NotI.
Once NF-kappaB/SV40/SEAP/Neo vector is created, stable Jurkat T-cells
are created and maintained according to the protocol described in Example 17.
Similarly, the method for assaying supernatants with these stable Jurkat T-
cells is also
described in Example 17. As a positive control, exogenous TNF alpha (0.1,1, 10
ng)
is added to wells H9, H10, and Hl 1, with a 5-10 fold activation typically
observed.
Example 21: Assay for SEAPActivity
As a reporter molecule for the assays described in Examples 17-20, SEAP
activity is assayed using the Tropix Phospho-light Kit (Cat. BP-400) according
to the
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-137-
following general procedure. The Tropix Phospho-light Kit supplies the
Dilution,
Assay, and Reaction Buffers used below.
Prime a dispenser with the 2.5x Dilution Buffer and dispense 15 u1 of 2.5x
dilution buffer into Optiplates containing 35 u1 of a supernatant. Seal the
plates with
a plastic sealer and incubate at 65 degree C for 30 min. Separate the
Optiplates to
avoid uneven heating.
Cool the samples to room temperature for 1 S minutes. Empty the dispenser
and prime with the Assay Buffer. Add 50 ml Assay Buffer and incubate at room
temperature 5 min. Empty the dispenser and prime with the Reaction Buffer (see
the
table below). Add 50 u1 Reaction Buffer and incubate at room temperature for
20
minutes. Since the intensity of the chemiluminescent signal is time dependent,
and it
takes about 10 minutes to read 5 plates on luminometer, one should treat 5
plates at
each time and start the second set 10 minutes later.
Read the relative light unit in the luminometer. Set H12 as blank, and print
the results. An increase in chemiluminescence indicates reporter activity.
Reaction BuB'er Formulation:
# of Rxn buffer diluent CSPD
plates (ml) (ml)
...............................................................................
_..............................................................................
......
10 60 3
11 65 3.25
12 ?0 3.5
13 75 3.75
14 80 4
15 85 4.25
16 90 4.5
17 95 4.75
18 100 5
19 105 5.25
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-138-
20 110 5.5
21 115 5.75
22 120 6
23 125 6.25
24 130 6.5
25 135 6.75
26 140 7
27 145 7.25
28 150 7.5
29 155 7.75
30 160 8
31 165 8.25
32 170 8.5
33 175 8.75
34 180 9
35 185 9.25
36 190 9.5
37 195 9.75
38 200 10
39 205 10.25
40 210 10.5
41 215 10.75
42 220 11
43 225 11.25
44 230 11.5
45 235 11.75
46 240 12
47 245 12.25
48 250 12.5
16 90
CA 02387808 2002-05-14
WO 01/32128 PCT/US00l30237
-139-
49 255 12.75
50 260 13
Example 22: High-Throughput Screening Assay Identifying Changes in
Small Molecule Concentration anrl Membrane Permeability
Binding of a ligand to a receptor is known to alter intracellular levels of
small
molecules, such as calcium, potassium, sodium, and pH, as well as alter
membrane
potential. These alterations can be measured in an assay to identify
supernatants
which bind to receptors of a particular cell. Although the following protocol
describes an assay for calcium, this protocol can easily be modified to detect
changes
in potassium, sodium, pH, membrane potential, or any other small molecule
which is
detectable by a fluorescent probe.
The following assay uses Fluorometric Imaging Plate Reader ("FLIPR") to
measure changes in fluorescent molecules (Molecular Probes) that bind small
molecules. Clearly, any fluorescent molecule detecting a small molecule can be
used
instead of the calcium fluorescent molecule, fluo-4 (Molecular Probes, Inc.;
catalog
no. F-14202), used here.
For adherent cells, seed the cells at 10,000 -20,000 cells/well in a Co-star
black 96-well plate with clear bottom. The plate is incubated in a COz
incubator for
hours. The adherent cells are washed two times in Biotek washer with 200 u1 of
20 HBSS (Hank's Balanced Salt Solution) leaving 100 u1 of buffer after the
final wash.
A stock solution of 1 mg/ml fluo-4 is made in 10% pluronic acid DMSO. To
load the cells with fluo-4, 50 u1 of 12 ug/ml fluo-4 is added to each well.
The plate is
incubated at 37 degrees C in a C02 incubator for 60 min. The plate is washed
four
times in the Biotek washer with HBSS leaving 100 u1 of buffer.
For non-adherent cells, the cells are spun down from culture media. Cells are
re-suspended to 2-5x106 cells/ml with HBSS in a 50-ml conical tube. 4 u1 of 1
mg/ml
fluo-4 solution in 10% pluronic acid DMSO is added to each ml of cell
suspension.
The tube is then placed in a 37 degrees C water bath for 30-60 min. The cells
are
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-140-
washed twice with HBSS, resuspended to 1x106 cells/ml, and dispensed into a
microplate, 100 ul/well. The plate is centrifuged at 1000 rpm for S min. The
plate is
then washed once in Denley CellWash with 200 u1, followed by an aspiration
step to
100 u1 final volume.
S For a non-cell based assay, each well contains a fluorescent molecule, such
as
fluo-4. The supernatant is added to the well, and a change in fluorescence is
detected.
To measure the fluorescence of intracellular calcium, the FLIPR is set for the
following parameters: (1) System gain is 300-800 mW; (2) Exposure time is 0.4
second; (3) Camera FJstop is F/2; (4) Excitation is 488 nm; (5) Emission is
530 nm;
and (6) Sample addition is SO u1. Increased emission at 530 nm indicates an
extracellular signaling event caused by the a molecule, either CK(3-13 or a
molecule
induced by CK(3-13, which has resulted in an increase in the intracellular
Ca++
concentrarion.
Example 23: High-Throughput Screening Assay Identifying Tyrosine
Kinase Activity
The Protein Tyrosine Kinases {PTK) represent a diverse group of
transmembrane and cytopiasmic kinases. Within the Receptor Protein Tyrosine
Kinase RPTK) group are receptors for a range of mitogenic and metabolic growth
factors including the PDGF, FGF, EGF, NGF, HGF and Insulin receptor
subfamilies.
In addition there are a large family of RPTKs for which the corresponding
ligand is
unknown. Ligands for RPTKs include mainly secreted small proteins, but also
membrane-bound and extracellular matrix proteins.
Activation of RPTK by ligands involves ligand-mediated receptor
dimerization, resulting in transphosphorylation of the receptor subunits and
activation
of the cytoplasmic tyrosine kinases. The cytoplasmic tyrosine kinases include
receptor associated tyrosine kinases of the src-family (e.g., src, yes, lck,
lyn, fyn) and
non-receptor linked and cytosolic protein tyrosine kinases, such as the Jak
family,
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-141-
members of which mediate signal transduction triggered by the cytokine
superfamily
of receptors {e.g., the Interleukins, Interferons, GM-CSF, and Leptin).
Because of the wide range of known factors capable of stimulating tyrosine
kinase activity, identifying whether CK(3-13 or a molecule induced by CK(3-13
is
capable of activating tyrosine kinase signal transduction pathways is of
interest.
Therefore, the following protocol is designed to identify such molecules
capable of
activating the tyrosine kinase signal transduction pathways.
Seed target cells (e.g., primary keratinocytes) at a density of approximately
25,000 cells per well in a 96 well Loprodyne Silent Screen Plates purchased
from
Nalge Nunc (Naperville, II,). The plates are sterilized with two 30 minute
rinses with
100% ethanol, rinsed with water and dried overnight. Some plates are coated
for 2
hr with 100 ml of cell culture grade type I collagen (50 mg/ml), gelatin (2%)
or
polylysine (50 mg/ml), all of which can be purchased from Sigma Chemicals (St.
Louis, MO) or 10% Matrigel purchased from Becton Dickinson (Bedford, MA), or
calf serum, rinsed with PBS and stored at 4 degree C. Cell growth on these
plates is
assayed by seeding 5,000 cells/well in growth medium and indirect quantitation
of
cell number through use of alamarBlue as described by the manufacturer Alamar
Biosciences, Inc. (Sacramento, CA) after 48 hr. Falcon plate covers #3071 from
Becton Dickinson (Bedford, MA) are used to cover the Loprodyne Silent Screen
Plates. Falcon Microtest III cell culture plates can also be used in some
proliferation
experiments.
To prepare extracts, A43I cells are seeded onto the nylon membranes of
Loprodyne plates (20,000/200m1/well) and cultured overnight in complete
medium.
Cells are quiesced by incubation in serum-free basal medium for 24 hr. After 5-
20
minutes treatment with EGF (60ng/ml) or 50 u! of the supernatant produced in
Example 15, the medium was removed and 100 ml of extraction buffer ((20 mM
HEPES pH 7.5, 0.15 M NaCI, 1% Triton X-100, 0.1% SDS, 2 mM Na3V04, 2 mM
Na4P2O7 and a cocktail of protease inhibitors {# 1836170) obtained from
Boeheringer Mannheim (Indianapolis, IN) is added to each well and the plate is
shaken on a rotating shaker for 5 minutes at 4oC. The plate is then placed in
a
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-142-
vacuum transfer manifold and the extract filtered through the 0.45 mm membrane
bottoms of each well using house vacuum. Extracts are collected in a 96-well
catch/assay plate in the bottom of the vacuum manifold and immediately placed
on
ice. To obtain extracts clarified by centrifugation, the content of each well,
after
detergent solubilization for S minutes, is removed and centrifuged for 15
minutes at 4
degree C at 16,000 x g.
Test the filtered extracts for levels of tyrosine kinase activity. Although
many
methods of detecting tyrosine kinase activity are known, one method is
described
here.
Generally, the tyrosine kinase activity of a supernatant is evaluated by
determining its ability to phosphorylate a tyrosine residue on a specific
substrate (a
biotinylated peptide). Biotinylated peptides that can be used for this purpose
include
PSK1 (corresponding to amino acids 6-20 of the cell division kinase cdc2-p34)
and
PSK2 (corresponding to amino acids 1-17 of gastrin). Both peptides are
substrates
for a range of tyrosine kinases and are available from Boehringer Mannheim.
The tyrosine kinase reaction is set up by adding the following components in
order. First, add 10u1 of SuM Biotinylated Peptide, then 10u1 ATP/Mg2+ (SmM
ATP/SOmM MgCl2), then 10u1 of Sx Assay Buffer (40mM imidazole hydrochloride,
pH7.3, 40 mM beta-glycerophosphate, 1mM EGTA, 100mM MgCl2, 5 mM MnCl2,
0.5 mg/ml BSA), then Sul of Sodium Vanadate (1mM), and then Sul of water. Mix
the components gently and preincubate the reaction mix at 30 degree C for 2
min.
Initial the reaction by adding 10u1 of the control enzyme or the filtered
supernatant.
The tyrosine kinase assay reaction is then terminated by adding 10 u1 of
120mm EDTA and place the reactions on ice.
Tyrosine kinase activity is determined by transfernng 50 u1 aliquot of
reaction
mixture to a microtiter plate (MTP) module and incubating at 37 degree C for
20
min. This allows the streptavadin coated 96 well plate to associate with the
biotinylated peptide. Wash the MTP module with 300u1/well of PBS four times.
Next add 75 u1 of anti-phospotyrosine antibody conjugated to horse radish
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-143-
peroxidase(anti-P-Tyr-POD(0.5u/ml)) to each well and incubate at 37 degree C
for
one hour. Wash the well as above.
Next add 100u1 of peroxidase substrate solution (Boehringer Mannheim) and
incubate at room temperature for at least 5 mins (up to 30 min). Measure the
absorbance of the sample at 405 nm by using ELISA reader. The level of bound
peroxidase activity is quantitated using an ELISA reader and reflects the
level of
tyrosine kinase activity.
Example 24: High-Throughput Screening Assay Identifying
Phosphorylation Activity
As a potential alternative and/or compliment to the assay of protein tyrosine
kinase activity described in Example 23, an assay which detects activation
(phosphorylation) of major intracellular signal transduction intermediates can
also be
used. For example, as described below one particular assay can detect tyrosine
phosphorylation of the Erk-1 and Erk-2 kinases. However, phosphorylation of
other
molecules, such as Raf, JNK, p38 MAP, Map kinase kinase (MEK), MEK kinase,
Src, Muscle specific kinase (MuSK), IRAK, Tec, and Janus, as well as any other
phosphoserine, phosphotyrosine, or phosphothreonine molecule, can be detected
by
substituting these molecules for Erk-1 or Erk-2 in the following assay.
Specifically, assay plates are made by coating the wells of a 96-well ELISA
plate with O.lml of protein G (lug/ml) for 2 hr at room temp, {RT). The plates
are
then rinsed with PBS and blocked with 3% BSA/PBS for 1 hr at RT. The protein G
plates are then treated with 2 commercial monoclonal antibodies (100ng/well)
against
Erk-land Erk-2 (1 hr at RT) (Santa Cruz Biotechnology). (To detect other
molecules, this step can easily be modified by substituting a monoclonal
antibody
detecting any of the above described molecules.) After 3-5 rinses with PBS,
the
plates are stored at 4 degree C until use.
A431 cells are seeded at 20,000/well in a 96-well Loprodyne filterplate and
cultured overnight in growth medium. The cells are then starved for 48 hr in
basal
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-144-
medium (DMEM) and then treated with EGF (6ng/well) or 50 u1 of the
supernatants
obtained in Example 15 for 5-20 minutes. The cells are then solubilized and
extracts
filtered directly into the assay plate.
After incubation with the extract for 1 hr at RT, the wells are again rinsed.
As a positive control, a commercial preparation of MAP kinase (1 Ong/well) is
used in
place of A431 extract. Plates are then treated with a commercial polyclonal
(rabbit)
antibody (luglml) which specifically recognizes the phosphorylated epitope of
the
Erk-1 and Erk-2 kinases (1 hr at RT). This antibody is biotinylated by
standard
procedures. The bound polyclonal antibody is then quantitated by successive
incubations with Europium-streptavidin and Europium fluorescence enhancing
reagent in the Wallac DELFIA instrument (time-resolved fluorescence). An
increased fluorescent signal over background indicates a phosphorylation by
CKj3-13
or a molecule induced by CK~i-13.
Example 25: Method of Determining Alterations in the CK~13 Gene
RNA isolated from entire families or individual patients presenting with, a
phenotype of interest (such as a disease) is be isolated. cDNA is then
generated from
these RNA samples using protocols known in the art. (See, Sambrook.) The cDNA
is then used as ~ a template for PCR, employing primers surrounding regions of
interest in SEQ D7 NO:l. Suggested PCR conditions consist of 35 cycles at 95
degree C for 30 seconds; 60-120 seconds at 52-58 degree C; and 60-120 seconds
at
70 degree C, using buffer solutions described in Sidransky, D., et al.,
Science
252:706 (1991).
PCR products are then sequenced using primers labeled at their 5' end with
T4 polynucleotide kinase, employing SequiTherm Polymerase. (Epicentre
Technologies). The intron-exon borders of selected exons of CK(3-13 is also
determined and genomic PCR products analyzed to confirm the results. PCR
products harboring suspected mutations in CK(3-13 is then cloned and sequenced
to
validate the results of the direct sequencing.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-145-
PCR products of CK(3-13 are cloned into T-tailed vectors as described in
Holton, T.A. and Graham, M.W., Nucleic Acids Research, 19:1156 (1991) and
sequenced with T7 polymerase (United States Biochemical). Affected individuals
are
identified by mutations in CK~3-13 not present in unaffected individuals.
S Genomic rearrangements are also observed as a method of determining
alterations in a gene corresponding to CK(3-13. Genomic clones isolated
according
to Example 2 are nick-translated with digoxigenindeoxy-uridine S'-triphosphate
(Boehringer Manheim), and FISH performed as described in Johnson, Cg. et al.,
Methods Cell Biol. 35:73-99 (1991). Hybridization with the labeled probe is
carried
out using a vast excess of human cot-1 DNA for specific hybridization to the
CKj3-13
genomic locus.
Chromosomes are counterstained with 4,6-diamino-2-phenylidole and
propidium iodide, producing a combination of C- and R-bands. Aligned images
for
precise mapping are obtained using a triple-band filter set (Chroma
Technology,
Brattleboro, VT) in combination with a cooled charge-coupled device camera
(Photometrics, Tucson, AZ) and variable excitation wavelength filters.
(Johnson, Cv.
et al., Genet. Anal. Tech. Appl., 8:75 (1991).) Image collection, analysis and
chromosomal fractional length measurements are performed using the ISee
Graphical
Program System. (lnovision Corporation, Durham, NC.) Chromosome alterations of
the genomic region of CK(3-13 (hybridized by the probe) are identified as
insertions,
deletions, and translocations. These CK/3-13 alterations are used as a
diagnostic
marker for an associated disease.
Example 26: Method of Detecting Abnormal Levels of CK~13 in a
Biological Sample
CK(3-13 polypeptides can be detected in a biological sample, and if an
increased or decreased level of CK(3-13 is detected, this polypeptide is a
marker for a
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-146-
particular phenotype. Methods of detection are numerous, and thus, it is
understood
that one skilled in the art can modify the following assay to fit their
particular needs.
For example, antibody-sandwich ELISAs are used to detect CK(3-13 in a
sample, preferably a biological sample. Wells of a microtiter plate are coated
with
specific antibodies to CK/3-13, at a final concentration of 02 to 10 ug/ml.
The
antibodies are either monoclonal or polyclonal and are produced by the method
described in Example 11. The wells are blocked so that non-specific binding of
CK~i-
13 to the well is reduced.
The coated wells are then incubated for > 2 hours at RT with a sample
containing CK(3-13. Preferably, serial dilutions of the sample should be used
to
validate results. The plates are then washed three times with deionized or
distilled
water to remove unbounded CK~3-13.
Next, 50 u1 of specific antibody-alkaline phosphatase conjugate, at a
concentration of 25-400 ng, is added and incubated for 2 hours at room
temperature.
The plates are again washed three times with deionized or distilled water to
remove
unbounded conjugate.
Add 75 u1 of 4-methylumbelliferyi phosphate (MUP) or p-nitrophenyl
phosphate (NPP) substrate solution to each well and incubate 1 hour at room
temperature. Measure the reaction by a microtiter plate reader. Prepare a
standard
curve, using serial dilutions of a control sample, and plot CK~3-13
polypeptide
concentration on the X-axis (log scale) and fluorescence or absorbance of the
Y-axis
(linear scale). Interpolate the concentration of the CK~i-13 in the sample
using the
standard curve.
Example 27: Formulation
The invention also provides methods of treatment and/or prevention of
diseases or disorders (such as, for example, any one or more of the diseases
or
disorders disclosed herein) by administration to a subject of an effective
amount of a
Therapeutic. By therapeutic is meant a polynucleotides or polypeptides of the
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-147-
invention (including fragments and variants), agonists or antagonists thereof,
and/or
antibodies thereto, in combination with a pharmaceutically acceptable carrier
type
(e. g., a sterile carrier).
The Therapeutic will be formulated and dosed in a fashion consistent with
good medical practice, taking into account the clinical condition of the
individual
patient (especially the side effects of treatment with the Therapeutic alone),
the site
of delivery, the method of administration, the scheduling of administration,
and other
factors known to practitioners. The "effective amount" for purposes herein is
thus
determined by such considerations.
As a general proposition, the total pharmaceutically effective amount of the
Therapeutic administered parenterally per dose will be in the range of about
lug/kg/day to 10 mg/kg/day of patient body weight, although, as noted above,
this
will be subject to therapeutic discretion. More preferably, this dose is at
least 0.01
mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day
for
the hormone. If given continuously, the Therapeutic is typically administered
at a
dose rate of about 1 ug/kg/hour to about 50 ug/kg/hour, either by 1-4
injections per
day or by continuous subcutaneous infusions, for example, using a mini-pump.
An
intravenous bag solution may also be employed. The length of treatment needed
to
observe changes and the interval following treatment for responses to occur
appears
to vary depending on the desired effect.
Therapeutics can be are administered orally, rectally, parenterally,
intracistemally, intravaginally, intraperitoneally, topically (as by powders,
ointments,
gels, drops or transdermal patch), bucally, or as an oral or nasal spray.
"Pharmaceutically acceptable carrier" refers to a non-toxic solid, semisolid
or liquid
filler, diluent, encapsulating material or formulation auxiliary of any. The
term
"parenteral" as used herein refers to modes of administration which include
intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and
intraarticular injection and infusion.
Therapeutics of the invention are also suitably administered by sustained-
release systems. Suitable examples of sustained-release Therapeutics are
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-148-
administered orally, rectally, parenterally, intracistemally, intravaginally,
intraperitoneally, topically (as by powders, ointments, gels, drops or
transdermal
patch), bucally, or as an oral or nasal spray. "Pharmaceutically acceptable
earner"
refers to a non-toxic solid, semisolid or liquid filler, diluent,
encapsulating material or
formulation auxiliary of any type. The term "parenteral" as used herein refers
to
modes of administration which include intravenous, intramuscular,
intraperitoneal,
intrasternal, subcutaneous and intraarticular injection and infusion.
Therapeutics of the invention are also suitably administered by sustained
release systems. Suitable examples of sustained-release Therapeutics include
suitable
polymeric materials (such as, for example, semi-permeable polymer matrices in
the
form of shaped articles, e.g., films, or mirocapsules), suitable hydrophobic
materials
(for example as an emulsion in an acceptable oil) or ion exchange resins, and
sparingly soluble derivatives (such as, for example, a sparingly soluble
salt).
Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP
58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et
al., Biopolymers 22:547-556 (1983)), poly (2- hydroxyethyl methacrylate)
(Larger et
al., J. Biomed. Mater. Res. 15:167-277 (1981), and Larger, Chem. Tech. 12:98-
105
(1982)), ethylene vinyl acetate (Larger et al., Id.) or poly-D- (-)-3-
hydroxybutyric
acid (EP 133,988).
Sustained-release Therapeutics also include liposomally entrapped
Therapeutics of the invention (.see generally, Larger, Science 249:1527-1533
(1990);
Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer,
Lopez-
Berestein and Fidler (eds.), Liss, New York, pp. 317 -327 and 353-365 (1989)).
Liposomes containing the Therapeutic are prepared by methods known per se: DE
3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985);
Hwang et al., Proc. Natl. Acad. Sci.(USA) 77:4030-4034 (1980); EP 52,322; EP
36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appl. 83-118008; U.S.
Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes
are
of the small (about 200-800 Angstroms) unilamellar type in which the lipid
content is
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-149-
greater than about 30 mol. percent cholesterol, the selected proportion being
adjusted for the optimal Therapeutic.
In yet an additional embodiment, the Therapeutics of the invention are
delivered by way of a pump (see Langer, ~zrprcr; Sefton, CRC Crit. Ref.
Biomed.
Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N.
Engl.
J. Med. 321:574 (1989)).
Other controlled release systems are discussed in the review by Langer
(Science 249:1527-1533 (1990)).
For parenteral administration, in one embodiment, the Therapeutic is
formulated generally by mixing it at the desired degree of purity, in a unit
dosage
injectable form {solution, suspension, or emulsion), with a pharmaceutically
acceptable carrier, i.e., one that is non-toxic to recipients at the dosages
and
concentrations employed and is compatible with other ingredients of the
formulation.
For example, the formulation preferably does not include oxidizing agents and
other
compounds that are known to be deleterious to the Therapeutic.
Generally, the formulations are prepared by contacting the Therapeutic
uniformly and intimately with liquid Garners or finely divided solid carriers
or both.
Then, if necessary, the product is shaped into the desired formulation.
Preferably the
carrier is a parenteral carrier, more preferably a solution that is isotonic
with the
blood of the recipient. Examples of such carrier vehicles include water,
saline,
Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed
oils and
ethyl oleate are also useful herein, as well as liposomes.
The carrier suitably contains minor amounts of additives such as substances
that enhance isotonicity and chemical stability. Such materials are non-toxic
to
recipients at the dosages and concentrations employed, and include bui~ers
such as
phosphate, citrate, succinate, acetic acid, and other organic acids or their
salts;
antioxidants such as ascorbic acid; low molecular weight (less than about ten
residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as
serum
albumin, gelatin, or immunoglobulins; hydrophilic polymers such as
polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic
acid, or
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-150-
arginine; monosaccharides, disaccharides, and other carbohydrates including
cellulose
or its derivatives, glucose, manose, or dextrins; chelating agents such as
EDTA;
sugar alcohols such as mannitol or sorbitol; counterions such as sodium;
and/or
nonionic surfactants such as polysorbates, poloxamers, or PEG.
The Therapeutic is typically formulated in such vehicles at a concentration of
about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mglml, at a pH of about 3 to 8.
It
will be understood that the use of certain of the foregoing excipients,
carriers, or
stabilizers will result in the formation of polypeptide salts.
Any pharmaceutical used for therapeutic administration can be sterile.
Sterility is readily accomplished by filtration through sterile filtration
membranes
(e.g., 0.2 micron membranes). Therapeutics generally are placed into a
container
having a sterile access port, for example, an intravenous solution bag or vial
having a
stopper pierceable by a hypodermic injection needle.
Therapeutics ordinarily will be stored in unit or mufti-dose containers, for
example, sealed ampoules or vials, . as an aqueous solution or as a
lyophilized
formulation for reconstitution. As an example of a lyophilized formulation, 10-
ml
vials are filled with 5 ml of sterile-filtered 1 % (w/v) aqueous Therapeutic
solution,
and the resulting mixture is lyophilized. The infusion solution is prepared by
reconstituting the lyophilized Therapeutic using bacteriostatic Water-for-
Injection.
The invention also provides a pharmaceutical pack or kit comprising one or
more containers filled with one or more of the ingredients of the Therapeutics
of the
invention. Associated with such containers) can be a notice in the form
prescribed by
a governmental agency regulating the manufacture, use or sale of
pharmaceuticals or
biological products, which notice reflects approval by the agency of
manufacture, use
or sale for human administration. In addition, the Therapeutics may be
employed in
conjunction with other therapeutic compounds.
The Therapeutics of the invention may be administered alone or in
combination with adjuvants. Adjuvants that may be administered with the
Therapeutics of the invention include, but are not limited to, alum, alum plus
deoxycholate (InununoAg), MTP-PE (Biocine Corp.), QS21 (Genentech, Inc.),
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-151-
BCG, and MPL. In a specific embodiment, Therapeutics of the invention are
administered in combination with alum. In another specific embodiment,
Therapeutics
of the invention are administered in combination with QS-21. Further adjuvants
that
may be administered with the Therapeutics of the invention include, but are
not
limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18,
CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology. Vaccines
that may be administered with the Therapeutics of the invention include, but
are not
limited to, vaccines directed toward protection against MMR (measles, mumps,
rubella), polio, varicella, tetanus/diptheria, hepatitis A, hepatitis B,
haemophilus
influenzae B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavirus,
cholera, yellow fever, Japanese encephalitis, poliomyelitis, rabies, typhoid
fever, and
pertussis. Combinations may be administered either concomitantly, e.g., as an
admixture, separately but simultaneously or concurrently; or sequentially.
This
includes presentations in which the combined agents are administered together
as a
therapeutic mixture, and also procedures in which the combined agents are
administered separately but simultaneously, e.g., as through separate
intravenous
lines into the same individual. Administration "in combination" further
includes the
separate administration of one of the compounds or agents given first,
followed by
the second.
The Therapeutics of the invention may be administered alone or in
combination with other therapeutic agents. Therapeutic agents that may be
administered in combination with the Therapeutics of the invention, include
but not
limited to, other members of the TNF family, chemotherapeutic agents,
antibiotics,
steroidal and non-steroidal anti-inflammatories, conventional
immunotherapeutic
agents, cytokines and/or growth factors. Combinations may be administered
either
concomitantly, e.g., as an admixture, separately but simultaneously or
concurrently;
or sequentially. This includes presentations in which the combined agents are
administered together as a therapeutic mixture, and also procedures in which
the
combined agents are administered separately but simultaneously, e.g_, as
through
separate intravenous lines into the same individual. Administration "in
combination"
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-152-
further includes the separate administration of one of the compounds or agents
given
first, followed by the second.
In one embodiment, the Therapeutics of the invention are administered in
combination with members of the TNF family. TNF, TNF-related or TNF-like
molecules that may be administered with the Therapeutics of the invention
include,
but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha {LT-
alpha,
also known as TNF-beta), LT-beta (found in complex heterotrimer LT-alpha2-
beta),
OPGL, Fast, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma
(International Publication No. WO 96/14328), AIM-I (International Publication
No.
WO 97/33899), endokine-alpha (International Publication No. WO 98/07880), TR6
(International Publication No. WO 98/30694), OPG, and neutrokine-alpha
(International Publication No. WO 98/18921, OX40, and nerve growth factor
(NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2
(International
Publication No. WO 96/34095), DR3 (International Publication No. WO 97/33904),
DR4 (International Publication No. WO 98/32856), TRS (International
Publication
No. WO 98/30693), TR6 (International Publication No. WO 98/30694), TR7
(International Publication No. WO 98/41629), TRANK, TR9 (International
Publication No. WO 98/56892),TR10 (International Publication No. WO 98/54202),
312C2 (International Publication No. WO 98/06842), and TR12, and soluble forms
CD 154, CD70, and CD 153.
In certain embodiments, Therapeutics of the invention are administered in
combination with antiretroviral agents, nucleoside reverse transcriptase
inhibitors,
non-nucleoside reverse transcriptase inhibitors, and/or protease inhibitors.
Nucleoside reverse transcriptase inhibitors that may be administered in
combination
with the Therapeutics of the invention, include, but are not limited to,
RETROVIRT""
(zidovudine/AZT), V1DEXT"" (didanosine/ddI), HIV1DT"" (zalcitabine/ddC),
ZERITT""
(stavudine/d4T), EPIVIRT"" (lamivudine/3TC), and COMBIV1RT""
(zidovudine/lamivudine). Non-nucleoside reverse transcriptase inhibitors that
may be
administered in combination with the Therapeutics of the invention, include,
but are
not limited to, T"" {nevirapine), RESCRIPTORT"" (delavirdine), and
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-153-
SUSTIVAT"" (efavirenz). Protease inhibitors that may be administered in
combination
with the Therapeutics of the invention, include, but are not limited to,
CR1XIVANT"~
(indinavir), NORVIRT"" (ritonavir), INVIRASET"" (saquinavir), and VIRACEPTT"'
(nelfinavir). In a specific embodiment, antiretroviral agents, nucleoside
reverse
transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors,
andJor
protease inhibitors may be used in any combination with Therapeutics of the
invention to treat AIDS and/or to prevent or treat HIV infection.
In other embodiments, Therapeutics of the invention may be administered in
combination with anti-opportunistic infection agents. Anti-opportunistic
agents that
20 may be administered in combination with the Therapeutics of the invention,
include,
but are not limited to, TRIMETHOPRIM-SULFAMETHOXAZOLET"",
DAPSONET"', PENTAMmINET"', ATOVAQUONET"", ISOIVIAZ~TM,
RIFAMPINT"', PYRAZINAMmET"", ETHAMBUTOLT"', RIFABUTINT'",
CLARITHROMYCINT"", AZITHROMYCINT"", GANCICLOVIRT"",
FOSCARNETT"", C1J70FOVIRT"", FLUCONAZOLET"", ITR.ACONAZOLET"",
KETOCONAZOLET"", ACYCLOVIRT"', FAMCICOLVIRT"", PYRIMETHAMINET"',
LEUCOVORINT"", NEUPOGENT"" (filgrastim/G-CSF), and LELTKINET""
(sargramostim/GM-CSF). In a specific embodiment, Therapeutics of the invention
are used in any combination with TRIMETHOPRIM-SULFAMETHOXAZOLET"",
DAPSONET"", PENTAMmINET"", and/or ATOVAQUONET"" to prophylactically
treat or prevent an opportunistic Pneumocystis carinii pneumonia infection. In
another specific embodiment, Therapeutics of the invention are used in any
combination with ISONIAZII7T"", RIFAMPINT"", PYRAZINAMIDET"', and/or
ETHAMBUTOLT"' to prophylactically treat or prevent an opportunistic
Mycobacterium avi~rm complex infection. In another specific embodiment,
Therapeutics of the invention are used in any combination with RIFABUT1NT"",
CLARITHROMYCINT"", and/or AZ1THROMYCINT"" to prophylactically treat or
prevent an opportunistic Mycobacterium tuberculosis infection. In another
specific
embodiment, Therapeutics of the invention are used in any combination with
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-I54-
GANCICLOVIRT"", FOSCARNETT"', and/or C)DOFOVIRT"~ to prophylactically treat
or prevent an opportunistic cytomegalovirus infection. In another specific
embodiment, Therapeutics of the invention are used in any combination with
FLUCONAZOLET"", ITR.ACONAZOLET"', and/or KETOCONAZOLET"" to
prophylactically treat or prevent an opportunistic fungal infection. In
another specific
embodiment, Therapeutics of the invention are used in any combination with
ACYCLOVIRT"" and/or FAMCICOLVIRT"" to prophylactically treat or prevent an
opportunistic herpes simplex virus type I and/or type II infection. In another
specific
embodiment, Therapeutics of the invention are used in any combination with
PYRIIV>ETf AN11NET"" and/or LEUCOVORINT"" to prophylactically treat or prevent
an opportunistic Toxoplasma gondii infection. In another specific embodiment,
Therapeutics of the invention are used in any combination with LEUCOVORINT"'
and/or NEUPOGENT"" to prophylactically treat or prevent an opportunistic
bacterial
infection.
In a further embodiment, the Therapeutics of the invention are administered in
combination with an antiviral agent. Antiviral agents that may be administered
with
the Therapeutics of the invention include, but are not limited to, acyclovir,
ribavirin,
amantadine, and remantidine.
In a further embodiment, the Therapeutics of the invention are administered in
combination with an antibiotic agent. Antibiotic agents that may be
administered with
the Therapeutics of the invention include, but are not limited to,
amoxicillin, beta-
lactamases, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases,
Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin,
erythromycin, fluoroquinolones, macroIides, metronidazole, penicillins,
quinolones,
rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim-
suifamthoxazole, and vancomycin.
Conventional nonspecific immunosuppressive agents, that may be
administered in combination with the Therapeutics of the invention include,
but are
not limited to, steroids, cyclosporine, cyclosporine analogs, cyclophosphamide
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-155-
methylprednisone, prednisone, azathioprine, FK-506, 15-deoxyspergualin, and
other
immunosuppressive agents that act by suppressing the function of responding T
cells.
In specific embodiments, Therapeutics of the invention are administered in
combination with immunosuppressants. Immunosuppressants preparations that may
be administered with the Therapeutics of the invention include, but are not
limited to,
ORTHOCLONET"' (OKT3), SANDIIVIMUNET""/NEORALTM~SANGDYATM
(cyclosporin), PROGRAFT"" (tacrolimus), CELLCEPTT"" (mycophenolate),
Azathioprine, glucorticosteroids, and RAPAMUNET"" (sirolimus). In a specific
embodiment, immunosuppressants may be used to prevent rejection of organ or
bone
marrow transplantation.
In an additional embodiment, Therapeutics of the invention are administered
alone or in combination with one or more intravenous immune globulin
preparations.
Intravenous immune globulin preparations that may be administered with the
Therapeutics of the invention include, but not limited to, GANIMART"",
IVEEGAMT"", SANDOGLOBULINT"", GAMMAGARD S/DT"", and GAMIMUNET""
In a specific embodiment, Therapeutics of the invention are administered in
combination with intravenous immune globulin preparations in transplantation
therapy (e.g., bone marrow transplant).
In an additional embodiment, the Therapeutics of the invention are
administered alone or in combination with an anti-inflammatory agent. Anti-
inflammatory agents that may be administered with the Therapeutics of the
invention
include, but are not limited to, glucocorticoids and the nonsteroidal anti-
inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid
derivatives,
arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic acid
derivatives,
pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e-
acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid,
amixetrine, bendazac, benzydamine, bucolome, difenpiramide, ditazol,
emorfazone,
guaiazulene, nabumetone, nimesulide, orgotein, oxaceprol, paranyline,
perisoxal,
pifoxime, proquazone, proxazole, and tenidap.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-156-
In another embodiment, compostions of the invention are administered in
combination with a chemotherapeutic agent. Chemotherapeutic agents that may be
administered with the Therapeutics of the invention include, but are not
limited to,
antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and
dactinomycin);
antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU,
methotrexate, floxuridine, interferon alpha-Zb, glutamic acid, plicamycin,
mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU,
lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine,
hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and vincristine
sulfate);
hormones (e.g., medroxyprogesterone, estramustine phosphate sodium, ethinyl
estradiol, estradiol, megestrol acetate, methyltestosterone,
diethylstilbestrol
diphosphate, chlorotrianisene, and testolactone); nitrogen mustard derivatives
(e.g.,
mephalen, chorambucil, mechlorethamine (nitrogen mustard) and thiotepa);
steroids
and combinations (e.g., bethamethasone sodium phosphate); and others (e.g.,
dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate,
and
etoposide).
In a specific embodiment, Therapeutics of the invention are administered in
combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and
prednisone) or any combination of the components of CHOP. In another
embodiment, Therapeutics of the invention are administered in combination with
Rituximab. In a further embodiment, Therapeutics of the invention are
administered
with Rituxmab and CHOP, or Rituxmab and any combination of the components of
CHOP.
In an additional embodiment, the Therapeutics of the invention are
administered in combination with cytokines. Cytokines that may be administered
with the Therapeutics of the invention include, but are not limited to, IL2,
IL3, IL4,
II;S, Ih6, IL7, IL10, II,12, IL13, IL,15, anti-CD40, CD40L, IFN-gamma and TNF-
alpha. In another embodiment, Therapeutics of the invention may be
administered
with any interleukin, including, but not limited to, IL-lalpha, IL-Ibeta, IL-
2, IL-3,
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-157-
IL,-4, IL,-5, IL,-6, IL-7, IL-8, IL-9, IL,-10, IL-11, IL,-12, IL,-13, IL-14,
IL-15, IL-16,
IL,-17, IL,-18, IL-19, IL-20, and IL-21.
In an additional embodiment, the Therapeutics of the invention are
administered in combination with angiogenic proteins. Angiogenic proteins that
may
be administered with the Therapeutics of the invention include, but are not
limited to,
Glioma Derived Growth Factor (GDGF), as disclosed in European Patent Number
EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as disclosed in European
Patent Number EP-682110; Platelet Derived Growth Factor-B (PDGF-B), as
disclosed in European Patent Number EP-282317; Placental Growth Factor (P1GF),
as disclosed in International Publication Number WO 92/06194; Placental Growth
Factor-2 (P1GF-2), as disclosed in Hauser et al., Gorwth Factors, 4:259-268
(1993);
Vascular Endothelial Growth Factor (VEGF), as disclosed in International
Publication Number WO 90/13649; Vascular Endothelial Growth Factor-A (VEGF-
A), as disclosed in European Patent Number EP-506477; Vascular Endothelial
Growth Factor-2 (VEGF-2), as disclosed in International Publication Number WO
96/39515; Vascular Endothelial Growth Factor B (VEGF-3); Vascular Endothelial
Growth Factor B-186 (VEGF-B186), as disclosed in International Publication
Number WO 96/26736; Vascular Endothelial Growth Factor-D (VEGF-D), as
disclosed in International Publication Number WO 98/02543; Vascular
Endothelial
Growth Factor-D (VEGF-D), as disclosed in International Publication Number WO
98/07832; and Vascular Endothelial Growth Factor-E (VEGF-E), as disclosed in
German Patent Number DE19639601. The above mentioned references are
incorporated herein by reference herein.
In an additional embodiment, the Therapeutics of the invention are
administered in combination with hematopoietic growth factors. Hematopoietic
growth factors that may be administered with the Therapeutics of the invention
include, but are not limited to, LEUKINET"" (SARGRAMOSTIMT"") and
NEUPOGENT"" (FILGRASTIMT"").
In an additional embodiment, the Therapeutics of the invention are
administered in combination with Fibroblast Growth Factors. Fibroblast Growth
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-158-
Factors that may be administered with the Therapeutics of the invention
include, but
are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8,
FGF-9, FGF-10, FGF-11, FGF-12, FGF-13, FGF-14, and FGF-15.
In additional embodiments, the Therapeutics of the invention are administered
in combination with other therapeutic or prophylactic regimens, such as, for
example,
radiation therapy.
Example 28: Method of Treating Decreased Levels of CK~13
The present invention relates to a method for treating an individual in need
of
an increased level of a polypeptide of the invention in the body comprising
administering to such an individual a composition comprising a therapeutically
effective amount of an agonist of the invention (including polypeptides of the
' invention). Moreover, it will be appreciated that conditions caused by a
decrease in
the standard or normal expression level of CK(3-13 in an individual can be
treated by
administering CK~3-13, preferably in the secreted form. Thus, the invention
also
provides a method of treatment of an individual in need of an increased level
of CK(3-
13 polypeptide comprising administering to such an individual a Therapeutic
. comprising an amount of CK~i-13 to increase the activity level of CK(3-13 in
such an
individual.
For example, a patient with decreased levels of CK(3-13 polypeptide receives
a daily dose 0.1-100 ug/kg of the polypeptide for six consecutive days.
Preferably,
the polypeptide is in the secreted form. The exact details of the dosing
scheme,
based on administration and formulation, are provided in Example 27.
Example 29: Method of Treating Increased Levels of CK~13
The present invention also relates to a method of treating an individual in
need of a decreased level of a polypeptide of the invention in the body
comprising
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-159-
administering to such an individual a composition comprising a therapeutically
effective amount of an antagonist of the invention (including polypeptides and
antibodies of the invention).
In one example, antisense technology is used to inhibit production of CK(3
S 13. This technology is one example of a method of decreasing levels of CKj3-
13
polypeptide, preferably a secreted form, due to a variety of etiologies, such
as cancer.
For example, a patient diagnosed with abnormally increased levels of CK~i-13
is administered intravenously antisense polynucleotides at 0.5, 1.0, 1.5, 2.0
and 3.0
mg/kg day for 21 days. This treatment is repeated after a 7-day rest period if
the
treatment was well tolerated. The formulation of the antisense polynucleotide
is
provided in Example 27.
Example 30: Methorl of Treatment Using Gene Therapy - Ex Yivo
1 S One method of gene therapy transplants fibroblasts, which are capable of
expressing CK(3-13 polypeptides, onto a patient. Generally, flbroblasts are
obtained
from a subject by skin biopsy. The resulting tissue is placed in tissue-
culture medium
and separated into small pieces. Small chunks of the tissue are placed on a
wet
surface of a tissue culture flask, approximately ten pieces are placed in each
flask.
The flask is turned upside down, closed tight and left at room temperature
over night.
After 24 hours at room temperature, the flask is inverted and the chunks of
tissue
remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12
media, with
10% FBS, penicillin and streptomycin) is added. The flasks are then incubated
at 37
degree C for approximately one week.
At this time, fresh media is added and subsequently changed every several
days. After an additional two weeks in culture, a monolayer of fibroblasts
emerge.
The monolayer is trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al., DNA, 7:219-25 (1988)), flanked by the long
terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI
and
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-160-
HindIII and subsequently treated with calf intestinal phosphatase. The linear
vector
is fractionated on agarose gel and purified, using glass beads.
The cDNA encoding CK~3-13 can be amplified using PCR primers which
correspond to the 5' and 3' end sequences respectively as set forth in Example
1.
Preferably, the S' primer contains an EcoRI site and the 3' primer includes a
HindIll
site. Equal quantities of the Moloney murine sarcoma virus linear backbone and
the
amplified EcoRI and HindIII fragment are added together, in the presence of T4
DNA ligase. The resulting mixture is maintained under conditions appropriate
for
ligation of the two fragments. The ligation mixture is then used to transform
bacteria
HB101, which are then plated onto agar containing kanamycin for the purpose of
confirming that the vector contains properly inserted CK(3-13.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue
culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with
10% calf serum (CS), penicillin and streptomycin. The MSV vector containing
the
CK(3-13 gene is then added to the media and the packaging cells transduced
with the
vector. The packaging cells now produce infectious viral particles containing
the
CK(3-13 gene(the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the
media is harvested from a 10 cm plate of confluent producer cells. The spent
media,
containing the infectious viral particles, is filtered through a millipore
filter to remove
detached producer cells and this media is then used to infect fibroblast
cells. Media is
removed from a sub-confluent plate of fibroblasts and quickly replaced with
the
media from the producer cells. This media is removed and replaced with fresh
media.
If the titer of virus is high, then virtually all fibroblasts will be infected
and no
selection is required. If the titer is very low, then it is necessary to use a
retroviral
vector that has a selectable marker, such as neo or his. Once the fibroblasts
have
been efficiently infected, the fibroblasts are analyzed to determine whether
CK(3-13
protein is produced.
The engineered fibroblasts are then transplanted onto the host, either alone
or
after having been grown to confluence on cytodex 3 microcarrier beads.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-161-
Example 31: Gene Therapy Using Endogenous CK~13 Gene
Another method of gene therapy according to the present invention involves
operably associating the endogenous CK~i-13 sequence with a promoter via
homologous recombination as described, for example, in U.S. Patent No.
5,641,670,
issued June 24, 1997; International Publication No. WO 96/29411, published
September 26, 1996; International Publication No. WO 94/12650, published
August
4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and
Zijlstra
et al., Nature 342:435-438 (1989). This method involves the activation of a
gene
which is present in the target cells, but which is not expressed in the cells,
or is
expressed at a lower level than desired.
Polynucleotide constructs are made which contain a promoter and targeting
sequences, which are homologous to the 5' non-coding sequence of endogenous
CK[3-13, flanking the promoter. The targeting sequence will be sui~ciently
near the
5' end of CK(3-13 so the promoter will be operably linked to the endogenous
sequence upon homologous recombination. The promoter and the targeting
sequences can be amplified using PCR. Preferably, the amplified promoter
contains
distinct restriction enzyme sites on the S' and 3' ends. Preferably, the 3'
end of the
first targeting sequence contains the same restriction enzyme site as the 5'
end of the
amplified promoter and the 5' end of the second targeting sequence contains
the same
restriction site as the 3' end of the amplified promoter.
The amplified promoter and the amplified targeting sequences are digested
with the appropriate restriction enzymes and subsequently treated with calf
intestinal
phosphatase. The digested promoter and digested targeting sequences are added
together in the presence of T4 DNA ligase. The resulting mixture is maintained
under conditions appropriate for ligation of the two fragments. The construct
is size
fractionated on an agarose gel then purified by phenol extraction and ethanol
precipitation.
In this Example, the polynucleotide constructs are administered as naked
polynucleotides via electroporation. However, the polynucleotide constructs
may
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/3023'7
-162-
also be administered with transfection-facilitating agents, such as liposomes,
viral
sequences, viral particles, precipitating agents, etc. Such methods of
delivery are
known in the art.
Once the cells are transfected, homologous recombination will take place
which results in the promoter being operably linked to the endogenous CK(3-13
sequence. This results in the expression of CK~i-13 in the cell. Expression
may be
detected by immunological staining, or any other method known in the art.
Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue
is
placed in DMEM + 10% fetal calf serum. Exponentially growing or early
stationary
phase fibroblasts are trypsinized and rinsed from the plastic surface with
nutrient
medium. An aliquot of the cell suspension is removed for counting, and the
remaining
cells are subjected to centrifizgation. The supernatant is aspirated and the
pellet is
resuspended in 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM
NaCI, 5 mM KCI, 0.7 mM Na2 HP04, 6 mM dextrose). The cells are recentrifizged,
the supernatant aspirated, and the cells resuspended in electroporation buffer
containing 1 mg/ml acetylated bovine serum albumin. The final cell suspension
contains approximately 3X10 cells/ml. Electroporation should be performed
immediately following resuspension.
Plasmid DNA is prepared according to standard techniques. For example, to
construct a plasmid for targeting to the CK~3-13 locus, plasmid pUC 18 (MBI
Fermentas, Amherst, NY) is digested with HindIII. The CMV promoter is
amplified
by PCR with an XbaI site on the 5' end and a BamHI site on the 3'end. Two CK~i-
13
non-coding sequences are amplified via PCR: one CK(3-13 non-coding sequence
CK[3-13 fragment 1) is amplified with a HindIII site at the 5' end and an Xba
site at
the 3'end; the other CK(3-13 non-coding sequence CK(3-13 fragment 2) is
amplified
with a BamHI site at the 5'end and a HindIII site at the 3'end. The CMV
promoter
and CK(3-13 fragments (1 and 2) are digested with the appropriate enzymes (CMV
promoter - XbaI and BamHI; CK(3-13 fragment 1 - Xbal; CK(3-13 fragment 2 -
CA 02387808 2002-05-14
WO 01/32128 PCTlITS00/30237
-163-
BamHI) and ligated together. The resulting ligation product is digested with
HindIII, and ligated with the HindIII-digested pUCl8 plasmid.
Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap
(Bio-Rad). The final DNA concentration is generally at least 120 ug/ml. 0.5 ml
of the
cell suspension (containing approximately 1.5.X106 cells) is then added to the
cuvette, and the cell suspension and DNA solutions are gently mixed.
Electroporation
is performed with a Gene-Pulser apparatus (Bio-Rad). Capacitance and voltage
are
set at 960 pF and 250-300 V, respectively. As voltage increases, cell survival
decreases, but the percentage of surviving cells that stably incorporate the
introduced
DNA into their genome increases dramatically. Given these parameters, a pulse
time
of approximately 14-20 mSec should be observed.
Electroporated cells are maintained at room temperature for approximately 5
min, and the contents of the cuvette are then gently removed with a sterile
transfer
pipette. The cells are added directly to 10 ml of prewarmed nutrient media
(DMEM
with 15% calf serum) in a 10 cm dish and incubated at 37 degree C. The
following
day, the media is aspirated and replaced with 10 ml of fresh media and
incubated for
a further 16-24 hours.
The engineered fibroblasts are then injected into the host, either alone or
after
having been grown to confluence on cytodex 3 microcarner beads. The
fibroblasts
now produce the protein product. The fibroblasts can then be introduced into a
patient as described above.
Example 32: Method of Treatment Using Gene Therapy - In hivo
Another aspect of the present invention is using in vivo gene therapy methods
to treat disorders, diseases and conditions. The gene therapy method relates
to the
introduction of naked nucleic acid (DNA, RNA, and antisense DNA or RNA) CK~i-
13 sequences into an animal to increase or decrease the expression of the CK[3-
13
polypeptide. The CK(3-13 polynucleotide may be operatively linked to a
promoter or
any other genetic elements necessary for the expression of the CK~i-13
polypeptide
CA 02387808 2002-05-14
WO 01/32128 PCT/L1S00/30237
-164-
by the target tissue. Such gene therapy and delivery techniques and methods
are
known in the art, see, for example, W090/11092, W098/I 1779; U.S. Patent NO.
5693622, 5705151, 5580859; Tabata H. et al. (1997) Cardiovasc. Res. 35(3):470-
479, Chao J et al. (1997) Pharmacol. Res. 35(6):517-522, Wolff J.A. (1997)
Neuromuscul. Disord. 7(5):314-318, Schwartz B. et al. (1996) Gene Ther.
3(5):405-
41 l, Tsurumi Y. et al. (1996) Circulation 94(12):3281-3290 (incorporated
herein by
reference).
The CK~3-13 polynucleotide constructs may be delivered by any method that
delivers injectable materials to the cells of an animal, such as, injection
into the
interstitial space of tissues (heart, muscle, skin, lung, liver, intestine and
the like). The
CK(3-13 polynucleotide constructs can be delivered in a pharmaceutically
acceptable
liquid or aqueous carrier.
The term "naked" polynucleotide, DNA or RNA, refers to sequences that are
free from any delivery vehicle that acts to assist, promote, or facilitate
entry into the
cell, including viral sequences, viral particles, liposome formulations,
lipofectin or
precipitating agents and the like. However, the CK(3-13 polynucleotides may
also be
delivered in liposome formulations (such as those taught in Felgner P.L. et
al. (1995)
Ann. NY Acad. Sci. 772:126-139 and Abdallah B. et al. (1995) Biol. Cell
85(1):1-7)
which can be prepared by methods well known to those skilled in the art.
The CK~3-13 polynucleotide vector constructs used in the gene therapy
method are preferably constructs that will not integrate into the host genome
nor will
they contain sequences that allow for replication. Any strong promoter known
to
those skilled in the art can be used for driving the expression of DNA. Unlike
other
gene therapies techniques, one major advantage of introducing naked nucleic
acid
sequences into target cells is the transitory nature of the polynucleotide
synthesis in
the cells. Studies have shown that non-replicating DNA sequences can be
introduced
into cells to provide production of the desired polypeptide for periods of up
to six
months.
The CK~3-13 polynucleotide construct can be delivered to the interstitial
space of tissues within the an animal, including of muscle, skin, brain, lung,
liver,
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-165-
spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas,
kidney,
gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous
system, eye,
gland, and connective tissue. Interstitial space of the tissues comprises the
intercellular fluid, mucopolysaccharide matrix among the reticular fibers of
organ
tissues, elastic fibers in the walls of vessels or chambers, collagen fibers
of fibrous
tissues, or that same matrix within connective tissue ensheathing muscle cells
or in
the lacunae of bone. It is similarly the space occupied by the plasma of the
circulation and the lymph fluid of the lymphatic channels. Delivery to the
interstitial
space of muscle tissue is preferred for the reasons discussed below. They may
be
conveniently delivered by injection into the tissues comprising these cells.
They are
preferably delivered to and expressed in persistent, non-dividing cells which
are
differentiated, although delivery and expression may be achieved in non-
differentiated
or less completely differentiated cells, such as, for example, stem cells of
blood or
skin fibroblasts. In vivo muscle cells are particularly competent in their
ability to take
up and express polynucleotides.
For the naked CKj3-13 polynucleotide injection, an effective dosage amount
of DNA or RNA will be in the range of from about 0.05 g/kg body weight to
about
50 mg/kg body weight. Preferably the dosage will be from about 0.005 mg/kg to
about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg. Of
course, as the artisan of ordinary skill will appreciate, this dosage will
vary according
to the tissue site of injection. The appropriate and effective dosage of
nucleic acid
sequence can readily be determined by those of ordinary skill in the art and
may
depend on the condition being treated and the route of administration. The
preferred
route of administration is by the parenteral route of injection into the
interstitial space
of tissues. However, other parenteral routes may also be used, such as,
inhalation of
an aerosol formulation particularly for delivery to lungs or bronchial
tissues, throat or
mucous membranes of the nose. In addition, naked CK(3-13 polynucleotide
constructs can be delivered to arteries during angioplasty by the catheter
used in the
procedure.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-166-
The dose response effects of injected CK(3-13 polynucleotide in muscle in
vivo is determined as follows. Suitable CK(3-13 template DNA for production of
mRNA coding for CK(3-13 polypeptide is prepared in accordance with a standard
recombinant DNA methodology. The template DNA, which may be either circular or
S linear, is either used as naked DNA or complexed with liposomes. The
quadriceps
muscles of mice are then injected with various amounts of the template DNA.
Five to six week old female and male Balb/C mice are anesthetized by
intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is
made on
the anterior thigh, and the quadriceps muscle is directly visualized. The CK(3-
13
template DNA is injected in 0.1 ml of carrier in a 1 cc syringe through a 27
gauge
needle over one minute, approximately 0.5 cm from the distal insertion site of
the
muscle into the knee and about 0.2 cm deep. A suture is placed over the
injection
site for future localization, and the skin is closed with stainless steel
clips.
After an appropriate incubation time (e.g., 7 days) muscle extracts are
prepared by excising the entire quadriceps. Every fifth 15 um cross-section of
the
individual quadriceps muscles is histochemically stained for CK~i-13 protein
expression. A time course for CK~i-13 protein expression may be done in a
similar
fashion except that quadriceps from different mice are harvested at different
times.
Persistence of CK~i-13 DNA in muscle following injection may be determined by
Southern blot analysis after preparing total cellular DNA and HIRT
supernatants
from injected and control mice. The results of the above experimentation in
mice can
be use to extrapolate proper dosages and other treatment parameters in humans
and
other animals using CK(3-13 naked DNA.
Example 33: CK/f13 Transgenic Animals
The CK[3-13 polypeptides can also be expressed in transgenic animals.
Animals of any species, including, but not limited to, mice, rats, rabbits,
hamsters,
guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates,
e.g.,
baboons, monkeys, and chimpanzees may be used to generate transgenic animals.
In
CA 02387808 2002-05-14
WO 01/32128 PCT/LTS00/30237
-167-
a specific embodiment, techniques described herein or otherwise known in the
art, are
used to express polypeptides of the invention in humans, as part of a gene
therapy
protocol.
Any technique known in the art may be used to introduce the transgene (i.e.,
polynucleotides of the invention) into animals to produce the founder lines of
transgenic animals. Such techniques include, but are not limited to,
pronuclear
microinjection (Paterson et al., Appl. Microbiol. Biotechnol. 40:691-698
(1994);
Carver et ai., Biotechnology (NY) I1:I263-1270 (1993); Wright et al.,
Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S. Pat. No. 4,873,191
(1989)); retrovirus mediated gene transfer into germ lines (Van der Putten et
al.,
Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts or embryos; gene
targeting in embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation of cells or embryos (Lo, 1983, Mol Cell. Biol. 3:1803-1814
(1983));
introduction of the polynucleotides of the invention using a gene gun (see,
e.g.,
IS Ulmer et al., Science 259:1745 (1993); introducing nucleic acid constructs
into
embryonic pleuripotent stem cells and transferring the stem cells back into
the
blastocyst; and sperm-mediated gene transfer {Lavitrano et al., Cell 57:717-
723
(1989); etc. For a review of such techniques, see Gordon, "Transgenic
Animals,"
Intl. Rev. Cytol. 115:171-229 (1989), which is incorporated by reference
herein in its
entirety.
Any technique known in the art may be used to produce transgenic clones
containing polynucleotides of the invention, for example, nuclear transfer
into
enucleated oocytes of nuclei from cultured embryonic, fetal, or adult cells
induced to
quiescence (Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature
385:810
813 ( 1997)).
The present invention provides for transgenic animals that carry the transgene
in all their cells, as well as animals which carry the transgene in some, but
not all their
cells, i.e., mosaic animals or chimeric. The transgene may be integrated as a
single
transgene or as multiple copies such as in concatamers, e.g., head-to-head
tandems or
head-to-tail tandems. The transgene may also be selectively introduced into
and
CA 02387808 2002-05-14
WO 01/32128 PCT/ITS00/30237
-168-
activated in a particular cell type by following, for example, the teaching of
Lasko et
al. (Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)). The
regulatory
sequences required for such a cell-type specific activation will depend upon
the
particular cell type of interest, and will be apparent to those of skill in
the art. When
it is desired that the polynucleotide transgene be integrated into the
chromosomal site
of the endogenous gene, gene targeting is preferred.
Briefly, when such a technique is to be utilized, vectors containing some
nucleotide sequences homologous to the endogenous gene are designed for the
purpose of integrating, via homologous recombination with chromosomal
sequences,
into and disrupting the function of the nucleotide sequence of the endogenous
gene.
The transgene may also be selectively introduced into a particular cell type,
thus
inactivating the endogenous gene in only that cell type, by following, for
example, the
teaching of Gu et al. (Gu et al., Science 265:103-106 (1994)). The regulatory
sequences required for such a cell-type specific inactivation will depend upon
the
particular cell type of interest, and will be apparent to those of skill in
the art. The
contents of each of the documents recited in this paragraph is herein
incorporated by
reference in its entirety.
Any of the CK(3-13 polypeptides disclosed throughout this application can be
used to generate transgenic animals. For example, the DNA encoding the foil
length
CK(3-13 protein {nucleotides 1-279 of SEQ ID NO:1) can be inserted into a
vector
containing a promoter, such as the actin promoter, which will ubiquitously
express
the inserted fragment. Therefore, DNA encoding the full length CK/3-13 protein
can
be inserted into a vector using the following primers: A S' primer containing
a
BamHI restriction site shown in bold:
GCAGCAGGATCCGCCATCATGGCTCGCCTACAGACTGCACTCCTGG(SEQ
B? NO: 19) and a 3' primer, containing a Xba restriction site shown in bold:
GCAGCATCTAGATCATTGGCTCAGCTTATTGAGAATCATCTTCACCC
(SEQ ID NO: 20). Besides these two examples; other fragments of CK[3-13 can
also
be inserted into a vector to create transgenics having ubiquitous expression.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-169-
Alternatively, polynucleotides of the invention can be inserted in a vector
which controls tissue specific expression through a tissue specific promoter.
For
example, a construct having a transferrin promoter would express the CK~3-13
polypeptide in the liver of transgenic animals. Therefore, DNA encoding the
full
length CK(3-13 protein (nucleotides 1-279 of SEQ B7 NO:1) can be inserted into
a
vector for tissue specific expression using the following primers: A 5' primer
containing a BamHI restriction site shown in bold:
GCAGCAGGATCCGCCATCATGGCTCGCCTACAGACTGCACTCCTGG(SEQ
)l7 NO: 21 ) and a 3' primer, containing a Xba restriction site shown in bold:
GCAGCATCTAGATCATTGGCTCAGCTTATTGAGAATCATCTTCACCC
(SEQ >D NO: 22).
Once transgenic animals have been generated, the expression of the
recombinant gene may be assayed utilizing standard techniques. Initial
screening may
be accomplished by Southern blot analysis or PCR techniques to analyze animal
tissues to verify that integration of the transgene has taken place. The level
of
mRNA expression of the transgene in the tissues of the transgenic animals may
also
be assessed using techniques which include, but are not limited to, Northern
blot
analysis of tissue samples obtained from the animal, in situ hybridization
analysis, and
reverse transcriptase-PCR (rt-PCR). Samples of transgenic gene-expressing
tissue
may also be evaluated immunocytochemically or immunohistochemically using
antibodies specific for the transgene product.
Once the founder animals are produced, they may be bred, inbred, outbred, or
crossbred to produce colonies of the particular animal. Examples of such
breeding
strategies include, but are not limited to: outbreeding of founder animals
with more
than one integration site in order to establish separate lines; inbreeding of
separate
lines in order to produce compound transgenics that express the transgene at
higher
levels because of the effects of additive expression of each transgene;
crossing of
heterozygous transgenic animals to produce animals homozygous for a given
integration site in order to both augment expression and eliminate the need
for
screening of animals by DNA analysis; crossing of separate homozygous lines to
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-170-
produce compound heterozygous or homozygous lines; and breeding to place the
transgene on a distinct background that is appropriate for an experimental
model of
interest.
Transgenic animals of the invention have uses which include, but are
not limited to, animal model systems useful in elaborating the biological
function of
CK(3-13 polypeptides, studying conditions and/or disorders associated with
aberrant
CK(3-13 expression, and in screening for compounds effective in ameliorating
such
conditions and/or disorders.
Example 34: CK~13 Knock-Out Animals.
Endogenous CK~3-13 gene expression can also be reduced by inactivating or
"knocking out" the CK(3-13 gene and/or its promoter using targeted homologous
recombination. (E.g., see Smithies et al., Nature 317:230-234 (1985); Thomas &
Capecchi, Cell 51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989); each
of
which is incorporated by reference herein in its entirety). For example, a
mutant,
non-functional polynucleotide of the invention (or a completely unrelated DNA
sequence) flanked by DNA homologous to the endogenous polynucleotide sequence
(either the coding regions or regulatory regions of the gene) can be used,
with or
without a selectable marker andlor a negative selectable marker, to transfect
cells that
express polypeptides of the invention in vivo. In another embodiment,
techniques
known in the art are used to generate knockouts in cells that contain, but do
not
express the gene of interest. Insertion of the DNA construct, via targeted
homologous recombination, results in inactivation of the targeted gene. Such
approaches are particularly suited in research and agricultural fields where
modifications to embryonic stem cells can be used to generate animal offspring
with
an inactive targeted gene (e.g., see Thomas & Capecchi 1987 and Thompson 1989,
supra). However this approach can be routinely adapted for use in humans
provided
the recombinant DNA constructs are directly administered or targeted to the
required
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-171-
site in vivo using appropriate viral vectors that will be apparent to those of
skill in the
art.
In further embodiments of the invention, cells that are genetically engineered
to express the polypeptides of the invention, or alternatively, that are
genetically
engineered not to express the polypeptides of the invention (e.g., knockouts)
are
administered to a patient in vivo. Such cells may be obtained from the patient
(i.e.,
animal, including human) or an MHC compatible donor and can include, but are
not
limited to fibroblasts, bone marrow cells, blood cells (e.g_, lymphocytes),
adipocytes,
muscle cells, endothelial cells etc. The cells are genetically engineered in
vitro using
recombinant DNA techniques to introduce the coding sequence of polypeptides of
the invention into the cells, or alternatively, to disrupt the coding sequence
and/or
endogenous regulatory sequence associated with the polypeptides of the
invention,
~, by transduction (using viral vectors, arid preferably vectors that
integrate the
transgene into the cell genome) or transfection procedures, including, but not
limited
to, the use of plasmids, cosnuds, YACs, naked DNA, electroporation, liposomes,
etc.
The coding sequence of the polypeptides of the invention can be placed under
the
control of a strong constitutive or inducible promoter or promoter/enhancer to
achieve expression, and preferably secretion, of the CK(3-13 polypeptides. The
engineered cells which express and preferably secrete the polypeptides of the
invention can be introduced into the patient systemically, e.g., in the
circulation, or
intraperitoneally.
Alternatively, the cells can be incorporated into a matrix and implanted in
the
body, e.g., genetically engineered fibroblasts can be implanted as part of a
skin graft;
genetically engineered endothelial cells can be implanted as part of a
lymphatic or
vascular graft. (See, for example, Anderson et al. U.S. Patent No. 5,399,349;
and
Mulligan & Wilson, U.S. Patent No. 5,460,959 each of which is incorporated by
reference herein in its entirety).
When the cells to be administered are non-autologous or non-MHC
compatible cells, they can be administered using well known techniques which
prevent the development of a host immune response against the introduced
cells. For
CA 02387808 2002-05-14
WO 01/32128 PCT/iTS00/30237
-172-
example, the cells may be introduced in an encapsulated form which, while
allowing
for an exchange of components with the immediate extracellular environment,
does
not allow the introduced cells to be recognized by the host immune system.
Knock-out animals of the invention have uses which include, but are not
limited to, animal model systems useful in elaborating the biological function
of CK(3
13 polypeptides, studying conditions and/or disorders associated with aberrant
CK/3
13 expression, and in screening for compounds effective in ameliorating such
conditions and/or disorders.
Example 35: Assays Detecting Stimulation or Inhibition of B cell
Proliferation and Differentiation
Generation of functional humoral immune responses requires both soluble and
cognate signaling between B-lineage cells and their microenvironment. Signals
may
impart a positive stimulus that allows a B-lineage cell to continue its
programmed
development, or a negative stimulus that instructs the cell to arrest its
current
developmental pathway. To date, numerous stimulatory and inhibitory signals
have
been found to influence B cell responsiveness including IL-2, IL-4, IL,-5, IL-
6, IL,-7,
IL10, IL-13, IL-14 and IL-15. Interestingly, these signals are by themselves
weak
erectors but can, in combination with various co-stimulatory proteins, induce
activation, proliferation, differentiation, homing, tolerance and death among
B cell
populations.
One of the best studied classes of B-cell co-stimulatory proteins is the TNF
superfamily. Within this family CD40, CD27, and CD30 along with their
respective
ligands CD 154, CD70, and CD 153 have been found to regulate a variety of
immune
responses. Assays which allow for the detection and/or observation of the
proliferation and differentiation of these B-cell populations and their
precursors are
valuable tools in determining the effects various proteins may have on these B-
cell
populations in terms of proliferation and differentiation. Listed below are
two assays
CA 02387808 2002-05-14
WO 01!32128 PCT/US00/30237
-173-
designed to allow for the detection of the differentiation, proliferation, or
inhibition
of B-cell populations and their precursors.
In Vitro Assay- Purified CK/3-13 protein, or truncated forms thereof, is
assessed for its ability to induce activation, proliferation, differentiation
or inhibition
and/or death in B-cell populations and their precursors. The activity of CK(3-
13
protein on purified human tonsillar B cells, measured qualitatively over the
dose
range from 0.1 to 10,000 ng/mL, is assessed in a standard B-lymphocyte co-
stimulation assay in which purified tonsillar B cells are cultured in the
presence of
either formalin-fixed Staphylococcus aureus Cowan I (SAC) or immobilized anti-
human IgM antibody as the priming agent. Second signals such as 1L-2 and IL-15
synergize with SAC and IgM crosslinking to elicit B cell proliferation as
measured by
tritiated-thymidine incorporation. Novel synergizing agents can be readily
identified
using this assay. The assay involves isolating human tonsillar B cells by
magnetic
bead (MACS) depletion of CD3-positive cells. The resulting cell population is
I S greater than 95% B cells as assessed by expression of CD45R(B220).
Various dilutions of each sample are placed into individual wells of a 96-well
plate to which are added 105 B-cells suspended in culture medium (RPMI 1640
containing 10% FBS, 5 X 10'5M 2ME, IOOU/ml penicillin, l0ug/ml streptomycin,
and 10-5 dilution of SAC) in a total volume of 150u1. Proliferation or
inhibition is
quantitated by a 20h pulse (luCi/well) with 3H-thymidine (6.7 Ci/mM} beginning
72h
post factor addition. The positive and negative controls are IL2 and medium
respectively.
In Vivo Assay- BALB/c mice are injected {i.p.) twice per day with buffer
only, or 2 mg/Kg of CK~i-13 protein, or truncated forms thereof. Mice receive
this
treatment for 4 consecutive days, at which time they are sacrificed and
various tissues
and serum collected for analyses. Comparison of H&E sections from normal and
CK(3-13 protein-treated spleens identify the results of the activity of CK~i-
13 protein
on spleen cells, such as the diffusion of peri-arterial lymphatic sheaths,
and/or
significant increases in the nucleated cellularity of the red pulp regions,
which may
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-174-
indicate the activation of the differentiation and proliferation of B-cell
populations.
Immunohistochemical studies using a B cell marker, anti-CD45R(B220), are used
to
determine whether any physiological changes to splenic cells, such as splenic
disorganization, are due to increased B-cell representation within loosely
defined B
cell zones that infiltrate established T-cell regions.
Flow cytometric analyses of the spleens from CK~i-13 protein-treated mice is
used to indicate whether CK(3-13 protein specifically increases the proportion
of
ThB+, CD45R(B220)dull B cells over that which is observed in control mice.
Likewise, a predicted consequence of increased mature B-cell representation
in vivo is a relative increase in serum Ig titers. Accordingly, serum IgM and
IgA
levels are compared between buffer and CK(3-13 protein-treated mice.
The studies described in this example tested activity in CK~i-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK/3-13 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists
of CK(3-13.
Example 36: T Cell Proliferation Assay
A CD3-induced proliferation assay is performed on PBMCs and is measured
by the uptake of 3H-thymidine. The assay is performed as follows. Ninety-six
well
plates are coated with 100 pl/well of mAb to CD3 (HIT3a, Pharmingen) or
isotype
matched control mAb (B33.1) overnight at 4°C (1 ~g/ml in .05M
bicarbonate buffer,
pH 9.5), then washed three times with PBS. PBMC are isolated by F/H gradient
centrifugation from human peripheral blood and added to quadruplicate wells (5
x
104/well) of mAb coated plates in RPMI containing 10% FCS and P/S in the
presence of varying concentrations of CK~3-13 protein (total volume 200 ~1).
Relevant protein buffer and medium alone are controls. After 48 hr. culture at
37°C,
plates are spun for 2 min. at 1000 rpm and 100 p1 of supernatant is removed
and
stored -20°C for measurement of II,-2 (or other cytokines) if effect on
proliferation is
observed. Wells are supplemented with 100 p.1 of medium containing 0.5 ~Ci of
3H-
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-175-
thymidine and cultured at 37°C for 18-24 hr. Wells are harvested and
incorporation
of 3H-thymidine used as a measure of proliferation. Anti-CD3 alone is the
positive
control for proliferation. IL-2 (100 U/ml) is also used as a control which
enhances
proliferation. Control antibody which does not induce proliferation of T cells
is used
as the negative controls for the effects of CK(3-13 proteins.
The studies described in this example tested activity in CK~i-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK~i-13 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists
of CK(3-13.
Example 37: Effect of CK~13 on the Expression of MHC Class l1,
Costimulatory and Adhesion Molecules and Cell Differentiation of Monocytes
and Monocyte-Derived Human Dendritic Cells
Dendritic cells are generated by the expansion of proliferating precursors
found in the peripheral blood: adherent PBMC or elutriated monocytic fractions
are
cultured for 7-10 days with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These
dendritic cells have the characteristic phenotype of immature cells
(expression of
CD1, CD80, CD86, CD40 and MHC class II antigens). Treatment with activating
factors, such as TNF-oc, causes a rapid change in surface phenotype (increased
expression of MHC class I and II, costimulatory and adhesion molecules,
downregulation of FCyRII, upregulation of CD83). These changes correlate with
increased antigen-presenting capacity and with functional maturation of the
dendritic
cells.
FACS analysis of surface antigens is performed as follows. Cells are treated
1-3 days with increasing concentrations of CK~3-13 or LPS (positive control),
washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then
incubated with 1:20 dilution of appropriate FITC- or PE-labeled monoclonal
antibodies for 30 minutes at 4°C. After an additional wash, the labeled
cells are
analyzed by flow cytometry on a FACScan (Becton Dickinson).
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-176-
Erect on the production of c okines. Cytokines generated by dendritic cells,
in particular IL-12, are important in the initiation of T-cell dependent
immune
responses. IL-12 strongly influences the development of Thl helper T-cell
immune
response, and induces cytotoxic T and NK cell function. An ELISA is used to
measure the II,-12 release as follows. Dendritic cells (106/m1) are treated
with
increasing concentrations of CK(3-13 for 24 hours. LPS (100 ng/ml) is added to
the
cell culture as positive control. Supernatants from the cell cultures are then
collected
and analyzed for IL-12 content using commercial ELISA kit (e..g, R & D Systems
(Minneapolis, MN)). The standard protocols provided with the kits are used.
Effect on the expression of MHC Class II, costimulatory and adhesion
molecules. Three major families of cell surface antigens can be identified on
monocytes: adhesion molecules, molecules involved in antigen presentation, and
Fc
receptor. Modulation of the expression of MHC class II antigens and other
costimulatory molecules, such as B7 and ICAM-I, may result in changes in the
antigen presenting capacity of monocytes and ability to induce T cell
activation.
Increase expression of Fc receptors may correlate with improved monocyte
cytotoxic
activity, cytokine release and phagocytosis.
FACS analysis is used to examine the surface antigens as follows. Monocytes
are treated 1-S days with increasing concentrations of CK~3-13 or LPS
(positive
control), washed with PB S containing 1 % B SA and 0.02 mM sodium azide, and
then
incubated with 1:20 dilution of appropriate FITC- or PE-labeled monoclonal
antibodies for 30 minutes at 4°C. After an additional wash, the labeled
cells are
analyzed by flow cytometry on a FACScan (Becton Dickinson).
Monocyte activation and/or increased survival. Assays for molecules that
activate (or alternatively, inactivate) monocytes and/or increase monocyte
survival
(or alternatively, decrease monocyte survival) are known in the art and may
routinely
be applied to determine whether a molecule of the invention functions as an
inhibitor
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-177-
or activator of monocytes. CK(3-13, agonists, or antagonists of CK~i-l3 can be
screened using the three assays described below. For each of these assays,
Peripheral
blood mononuclear cells (PBMC) are purified from single donor leukopacks
(American Red Cross, Baltimore, MD) by centrifugation through a Histopaque
gradient (Sigma). Monocytes are isolated from PBMC by counterflow centrifugal
elutriation.
Monocyte Survival Assay. Human peripheral blood monocytes progressively
lose viability when cultured in absence of serum or other stimuli. Their death
results
from internally regulated process (apoptosis). Addition to the culture of
activating
factors, such as TNF-alpha dramatically improves cell survival and prevents
DNA
fragmentation. Propidium iodide (PI) staining is used to measure apoptosis as
follows. Monocytes are cultured for 48 hours in polypropylene tubes in serum-
free
medium (positive control), in the presence of 100 ng/ml TNF-alpha (negative
control), and in the presence of varying concentrations of the compound to be
tested.
Cells are suspended at a concentration of 2 x 106/m1 in .PBS containing PI at
a final
concentration of 5 p.g/ml, and then incubaed at room temperature for 5 minutes
before FACScan analysis. PI uptake has been demonstrated to correlate with DNA
fragmentation in this experimental paradigm.
Effect on cytokine release. An important function of
monocytes/macrophages is their regulatory activity on other cellular
populations of
the immune system through the release of cytokines after stimulation. An ELISA
to
measure cytokine release is performed as follows. Human monocytes are
incubated at
a density of 5x105 cells/ml with increasing concentrations of CKj3-13 and
under the
same conditions, but in the absence of CK~3-13. For IL-12 production, the
cells are
primed overnight with IFN (100 U/ml) in presence of CK~i-13. LPS (10 ng/ml) is
then added. Conditioned media are collected after 24h and kept frozen until
use.
Measurement of TNF-alpha, IL-10, MCP-1 and IL,-8 is then performed using a
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-178-
commercially available ELISA kit (e.g, R & D Systems (Minneapolis, MN)) and
applying the standard protocols provided with the kit.
Oxidative burst. Purified monocytes are plated in 96-w plate at 2-1x105
cell/well. Increasing concentrations of CK(3-13 are added to the wells in a
total
volume of 0.2 ml culture medium (RPMI 1640 + 10% FCS, glutamine and
antibiotics). After 3 days incubation, the plates are centrifuged and the
medium is
removed from the wells. To the macrophage monolayers, 0.2 ml per well of
phenol
red solution (140 mM NaCI, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM
dextrose, 0.56 mM phenol red and 19 U/ml of HRPO) is added, together with the
stimulant (200 nM PMA)_ The plates are incubated at 37°C for 2 hours
and the
reaction is stopped by adding 20 p1 1N NaOH per well. The absorbance is read
at
610 nm. To calculate the amount of H202 produced by the macrophages, a
standard
curve of a HZOZ solution of known molarity is performed fpr each experiment.
IS The studies described in this example tested activity in CK~3-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK(3-13 poiynucleotides (e.g., gene therapy), agonists, and/or
antagonists
of CK(3-13.
Example 38: CK/.~13 Biological Effects Astrocyte anal Neuronal Assays.
Recombinant CKJ3-13, expressed in Escherichia coli and purified as
described above, can be tested for activity in promoting the survival, neurite
outgrowth, or phenotypic differentiation of cortical neuronal cells and for
inducing
the proliferation of glial fibrillary acidic protein immunopositive cells,
astrocytes.
The selection of cortical cells for the bioassay is based on the prevalent
expression of
FGF-1 and FGF-2 in cortical structures and on the previously reported
enhancement
of cortical neuronal survival resulting from FGF-2 treatment. A thymidine
incorporation assay, for example, can be used to elucidate CKj3-13's activity
on these
cells.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-I 79-
Moreover, previous reports describing the biological erects of FGF-2 (basic
FGF) on cortical or hippocampal neurons in vitro have demonstrated increases
in
both neuron survival and neurite outgrowth (Walicke, P. et al., "Fibroblast
growth
factor promotes survival of dissociated hippocampal neurons and enhances
neurite
extension." Proc. Natl. Acad. Sci. USA 83:3012-3016. (1986), assay herein
incorporated by reference in its entirety). However, reports from experiments
done
on PC-12 cells suggest that these two responses are not necessarily synonymous
and
may depend on not only which FGF is being tested but also on which receptors)
are
expressed on the target cells. Using the primary cortical neuronal culture
paradigm,
the ability of CK(3-13 to induce neurite outgrowth can be compared to the
response
achieved with FGF-2 using, for example, a thymidine incorporation assay.
Fibroblast anal endothelial cell assays.
Human lung fibroblasts are obtained from Clonetics (San Diego, CA) and
maintained in growth media from Clonetics. Dermal microvascular endothelial
cells
are obtained from Cell Applications (San Diego, CA). For proliferation assays,
the
human lung fibroblasts and dermal microvascular endothelial cells can be
cultured at
5,000 cells/well in a 96-well plate for one day in growth medium. The cells
are then
incubated for one day in 0.1% BSA basal medium. After replacing the medium
with
fresh 0.I% BSA medium, the cells are incubated with the test proteins for 3
days.
Alamar Blue (Alamar Biosciences, Sacramento, CA) is added to each well to a
final
concentration of 10%. The cells are incubated for 4 hr. Cell viability is
measured by
reading in a CytoFluor fluorescence reader. For the PGE2 assays, the human
lung
fibroblasts are cultured at 5,000 cells/well in a 96-well plate for one day.
After a
medium change to 0.1% BSA basal medium, the cells are incubated with FGF-2 or
CK(3-13 with or without IL-la for 24 hours. The supernatants are collected and
assayed for PGEZ by EIA kit (Cayman, Ann Arbor, MI). For the IL-6 assays, the
human lung fibroblasts are cultured at 5,000 cells/well in a 96-well plate for
one day.
After a medium change to 0.1% BSA basal medium, the cells are incubated with
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-180-
FGF-2 or CK(3-13 with or without IL,-la for 24 hours. The supernatants are
collected and assayed for IL-6 by ELISA kit (Endogen, Cambridge, MA).
Human lung fibroblasts are cultured with FGF-2 or CK(3-13 for 3 days in
basal medium before the addition of Alamar Blue to assess effects on growth of
the
S fibroblasts_ FGF-2 should show a stimulation at 10 - 2500 ng/ml which can be
used
to compare stimulation with CK~3-13.
Parkinson Models.
The loss of motor function in Parkinson's disease is attributed to a
deficiency
of striatal dopamine resulting from the degeneration of the nigrostriatal
dopaminergic
projection neurons. An animal model for Parkinson's that has been extensively
characterized involves the systenuc administration of 1-methyl-4 phenyl
1,2,3,6-
tetrahydropyridine (MPTP). In the CNS, MPTP is taken-up by astrocytes and
catabolized by monoamine oxidase B to 1-methyl-4-phenyl pyridine (MPP+) and
released. Subsequently, MPP+ is actively accumulated in dopaminergic neurons
by
the high-affinity reuptake transporter for dopamine. MPP+ is then concentrated
in
mitochondria by the electrochemical gradient and selectively inhibits
nicotidamide
adenine disphosphate: ubiquinone oxidoreductionase (complex I), thereby
interfering
with electron transport and eventually generating oxygen radicals.
It has been demonstrated in tissue culture paradigms that FGF-2 (basic FGF)
has trophic activity towards nigral dopaminergic neurons (Ferrari et al., Dev.
Biol.
1989). Recently, Dr. Unsicker's group has demonstrated that administering FGF-
2 in
gel foam implants in the striatum results in the near complete protection of
nigral
dopaminergic neurons from the toxicity associated with MPTP exposure (Otto and
Unsicker, J. Neuroscience, 1990).
Based on the data with FGF-2, CK(3-13 can be evaluated to determine
whether it has an action similar to that of FGF-2 in enhancing dopaminergic
neuronal
survival in vitro and it can also be tested in vivo for protection of
dopaminergic
neurons in the striatum from the damage associated with MPTP treatment. The
potential effect of CK(3-13 is first examined in vitro in a dopaminergic
neuronal cell
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-181-
culture paradigm. The cultures are prepared by dissecting the midbrain floor
plate
from gestation day 14 Wistar rat embryos. The tissue is dissociated with
trypsin and
seeded at a density of 200,000 cellslcm2 on polyorthinine-laminin coated glass
coverslips. The cells are maintained in Dulbecco's Modified Eagle's medium and
F12
medium containing hormonal supplements (N 1 ). The cultures are fixed with
paraformaldehyde after 8 days in vitro and are processed for tyrosine
hydroxylase, a
specific marker for dopminergic neurons, immunohistochemical staining.
Dissociated
cell cultures are prepared from embryonic rats. The culture medium is changed
every
third day and the factors are also added at that time.
Since the dopaminergic neurons are isolated from animals at gestation day 14,
a developmental time which is past the stage when the dapaminergic precursor
cells
are proliferating, an increase in the number of tyrosine hydroxylase
immunopositive
neurons would represent an increase in the number of dopaminergic neurons
surviving in vitro. Therefore, if CK(3-13 acts to prolong the survival of
dopaminergic
neurons, it would suggest that CK(3-13 may be involved in Parkinson's Disease.
The studies described in this example tested activity in CKj3-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK(3-13 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists
of CK~3-13.
This example will be used to explore the possibility that CK~i-13 may
stimulate lymphatic endothelial cell migration.
Endothelial cell migration assays are performed using a 48 well
microchemotaxis chamber (Neuroprobe Inc., Cabin John, MD; Falk, W., et al., J.
Immunological Methods 1980;33:239-247). Polyvinylpyrrolidone-free
polycarbonate
filters with a pore size of 8 um (Nucleopore Corp. Cambridge, MA) are coated
with
0.1 % gelatin for at least 6 hours at room temperature and dried under sterile
air.
Test substances are diluted to appropriate concentrations in M199 supplemented
with
0.25% bovine serum albumin (BSA), and 25 u1 of the final dilution is placed in
the
lower chamber of the modified Boyden apparatus. Subconfluent, early passage (2-
6)
HUVEC or BMEC cultures are washed and trypsinized for the minimum time
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-182-
required to achieve cell detachment. After placing the filter between lower
and upper
chamber, 2.5 x 105 cells suspended in 50 u1 M199 containing 1% FBS are seeded
in
the upper compartment. The apparatus is then incubated for 5 hours at
37°C in a
humidified chamber with S% C02 to allow cell migration. After the incubation
period, the filter is removed and the upper side of the filter with. the non-
migrated
cells is scraped with a rubber policeman. The filters are fixed with methanol
and
stained with a Giemsa solution (Dif~ Quick, Baxter, McGraw Park, 1L).
Migration is
quantified by counting cells of three random high-power fields (40x) in each
well, and
all groups are performed in quadruplicate.
The studies described in this example tested activity in CK(3-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK~3-13 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists
of CK(3-13.
Example 39: Stimulation of Nitric Oxide Production by Endothelial Cells
Nitric oxide released by the vascular endothelium is believed to be a mediator
of vascular endothelium relaxation. Thus, CK(3-13 activity can be assayed by
determining nitric oxide production by endothelial cells in response to CK~3-
13.
Nitric oxide is measured in 96-well plates of confluent microvascular
endothelial cells after 24 hours starvation and a subsequent 4 hr exposure to
various
levels of a positive control (such as VEGF-1) and CK(3-13. Nitric oxide in the
medium is determined by use of the Griess reagent to measure total nitrite
after
reduction of nitric oxide-derived nitrate by nitrate reductase. The effect of
CK(3-13
on nitric oxide release is examined on HLTVEC.
Briefly, NO release from cultured HLTVEC monolayer is measured with a
NO-specific polarographic electrode connected to a NO meter (iso-NO, World
Precision Instruments Inc.) (1049). Calibration of the NO elements is
performed
according to the following equation:
2KN02+2KI+2H2S0462N0+I2+2H20+2K2S04
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-183-
The standard calibration curve is obtained by adding graded concentrations of
KN02 (0, 5, 10, 25, 50, 100, 250, and 500 nmol/L) into the calibration
solution
containing KI and HZSO4. The specificity of the Iso-NO electrode to NO is
previously determined by measurement of NO from authentic NO gas (1050). The
culture medium is removed and HWECs are washed twice with Dulbecco's
phosphate buffered saline. The cells are then bathed in 5 ml of filtered Krebs-
Henseleit solution in 6-well plates, and the cell plates are kept on a slide
warmer (Lab
Line Instruments Inc.) To maintain the temperature at 37°C. The NO
sensor probe is
inserted vertically into the wells, keeping the tip of the electrode 2 mm
under the
surface of the solution, before addition of the different conditions. S-
nitroso acetyl
penicillamin (SNAP) is used as a positive control. The amount of released NO
is
expressed as picomoles per 1x106 endothelial cells. All values reported are
means of
four to six measurements in each group (number of cell culture wells). See,
Leak et
al. Biochem. and Biophys. Res. Comm. 217:96-105 (1995).
The studies described in this example tested activity in CK/3-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK~3-13 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists
of CK(3-13.
Example 90: Rat Corneal Wound Healing Model
This animal model shows the effect of CK(3-13 on neovascularization. The
experimental protocol includes:
a) Making a 1-1.5 mm long incision from the center of cornea into the
stromallayer.
b) Inserting a spatula below the lip of the incision facing the outer corner
of the eye.
c) Making a pocket (its base is 1-1.5 mm form the edge of the eye).
d) Positioning a pellet, containing 50ng- 5ug of CK~i-13, within the pocket.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-184-
e) CK~i-13 treatment can also be applied topically to the corneal wounds
in a dosage range of 20mg - SOOmg (daily treatment for five days).
The studies described in this example tested activity in CK(3-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK(3-13 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists
of CK(3-13.
Example 41: Diabetic Mouse and Glucocorticoi~llmpaired Wound
Healing Models
A. Diabetic db+ldb+MouseMorlel.
To demonstrate that CK~i-13 accelerates the healing process, the genetically
diabetic mouse model of wound healing is used. The fizll thickness wound
healing
model in the db+/db+ mouse is a well characterized, clinically relevant and
reproducible model of impaired wound healing. Healing of the diabetic wound is
dependent on formation of granulation tissue and re-epithelialization rather
than
contraction (Gartner, M.H. et al., .l. SZrrg. Res. 52:389 (1992); Greenhalgh,
D.G. et
al., Am. J. Pathol. 136:1235 (1990)).
The diabetic animals have many of the characteristic features observed in
Type II diabetes mellitus. Homozygous (db+/db+) mice are obese in comparison
to
their normal heterozygous (db+/+m) littermates. Mutant diabetic (db+/db+) mice
have a single autosomal recessive mutation on chromosome 4 (db+) (Coleman et
al.
Proc. Natl. Acad. Sci. USA 77:283-293 (1982)). Animals show polyphagia,
polydipsia and polyuric. Mutant diabetic mice (db+/db+) have elevated blood
glucose, increased or normal insulin levels, and suppressed cell-mediated
immunity
(Mandel et al., J. Immunol. 120:1375 (1978); Debray-Sachs, M. et al., Clin.
Exp.
Immunol. 51(1):1-7 (1983); Leiter et al., Am. J. of Pathol. 114:4b-55 (1985)).
Peripheral neuropathy, myocardial complications, and microvascular lesions,
basement membrane thickening and glomerular filtration abnormalities have been
described in these animals (Norido, F. et al., Exp. Neurol. 83(2):221-232
(1984);
CA 02387808 2002-05-14
WO 01/32128 PCT/ITS00/30237
-185-
Robertson et al.., Diabetes 29(1):60-67 (1980); Giacomelli et al., dab Invest.
40(4):460-473 (1979}; Coleman, D.L., Diabetes 3l (SZrppl):l-6 (1982)). These
homozygous diabetic mice develop hyperglycemia that is resistant to insulin
analogous to human type II diabetes (Mandel et al., J. Immzrnol. 120:1375-1377
(1978)).
The characteristics observed in these animals suggests that healing in this
model may be similar to the healing observed in human diabetes (Greenhalgh, et
al.,
Am. .1. of Pathol. 136:1235-1246 (1990)).
Genetically diabetic female C57BL/KsJ (db+/db+) mice and their non-diabetic
(db+/+m) heterozygous littermates are used in this study (Jackson
Laboratories).
The animals are purchased at 6 weeks of age and are 8 weeks old at the
beginning of
the study. Animals are individually housed and received food and water ad
libitum.
All manipulations are performed using aseptic techniques. The experiments are
conducted according to the rules and guidelines of Human Genome Sciences, Inc.
Institutional Animal Care and Use Committee and the Guidelines for the Care
and
Use of Laboratory Animals.
Wounding protocol is performed according to previously reported methods
(Tsuboi, R. and Riflcin, D.B., J. Exp. Med. 172:245-251 (1990)). Briefly, on
the day
of wounding, animals are anesthetized with an intraperitoneal injection of
Avertin
(0.01 mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in
deionized
water. The dorsal region of the animal is shaved and the skin washed with 70%
ethanol solution and iodine. The surgical area is dried with sterile gauze
prior to
wounding. An 8 mm full-thickness wound is then created using a Keyes tissue
punch. Immediately following wounding, the surrounding skin is gently
stretched to
eliminate wound expansion. The wounds are left open for the duration of the
experiment. Application of the treatment is given topically for 5 consecutive
days
commencing on the day of wounding. Prior to treatment, wounds are gently
cleansed with sterile saline and gauze sponges.
Wounds are visually examined and photographed at a fixed distance at the
day of surgery and at two day intervals thereafter. Wound closure is
determined by
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-186-
daily measurement on days I-5 and on day 8. Wounds are measured horizontally
and
vertically using a calibrated Jameson caliper. Wounds are considered healed if
granulation tissue is no longer visible and the wound is covered by a
continuous
epithelium.
CK[i-13 is administered using at a range different doses of CK[i-13, from
4mg to SOOmg per wound per day for 8 days in vehicle. Vehicle control groups
received SOmL of vehicle solution.
Animals are euthanized on day 8 with an intraperitoneal injection of sodium
pentobarbital (300mg/kg). The wounds and surrounding skin are then harvested
for
histology and immunohistochemistry. Tissue specimens are placed in 10% neutral
buffered formalin in tissue cassettes between biopsy sponges for further
processing.
Three groups of IO animals each (5 diabetic and 5 non-diabetic controls) are
evaluated: I) Vehicle placebo control, 2) untreated; and 3) treated group.
Wound closure is analyzed by measuring the area in the vertical and
horizontal axis and obtaining the total square area of the wound. Contraction
is then
estimated by establishing the differences between the initial wound area (day
0) and
that of post treatment (day 8). The wound area on day 1 is 64mmz, the
corresponding size of the dermal punch. Calculations are made using the
following
formula:
[Open area on day 8] - [Open area on day 1 ] / [Open area on day 1
Specimens are fixed in 10% buffered formalin and paraffin embedded blocks
are sectioned perpendicular to the wound surface (Smm) and cut using a
Reichert-
Jung microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross-
sections of bisected wounds. Histologic examination of the wounds are used to
assess whether the healing process and the morphologic appearance of the
repaired
skin is altered by treatment with CK(3-13. This assessment included
verification of
the presence of cell accumulation, inflammatory cells, capillaries,
fibroblasts, re-
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-187-
epithelialization and epidermal maturity (Greenhalgh, D.G. et al., Am. .l.
Pathol.
!3G:1235 (1990)). A calibrated lens micrometer is used by a blinded observer.
Tissue sections are also stained immunohistochemically with a polyclonal
rabbit anti-human keratin antibody using ABC Elite detection system. Human
skin is
used as a positive tissue control while non-immune IgG is used as a negative
control.
Keratinocyte growth is determined by evaluating the extent of
reepithelialization of
the wound using a calibrated lens micrometer.
Proliferating cell nuclear antigen/cyclin (PCNA) in skin specimens is
demonstrated by using anti-PCNA antibody (1.50) with an ABC Elite detection
system. Human colon cancer can serve as a positive tissue control and human
brain
tissue can be used as a negative tissue control. Each specimen includes a
section
with omission of the primary antibody and substitution with non-immune mouse
IgG.
Ranking of these sections is based on the extent of proliferation on a scale
of 0-8, the
lower side of the scale reflecting slight proliferation to the higher side
reflecting
intense proliferation.
Experimental data are analyzed using an unpaired t test. A p value of < 0.05
is considered significant.
B. Steroid Impaired Rat Morlel
The inhibition of wound healing by steroids has been well documented in
various in vitro and in vivo systems (Wahl, S.M. Glucocorticoids and Wound
healing. In: Anti-lnflammatory Steroid Action: Basic and Clinical Aspects. 280-
302
(1989}; Wahl, S.M.et al.., J. Immunvl. 11S: 476-481 (1975); Werb, Z. et al.,
J. Fxp.
Med. 147:1684-1694 (1978)). Glucocorticoids retard wound healing by inhibiting
angiogenesis, decreasing vascular permeability (Ebert, R.H., et al., An.
Intern. Mea'.
37:701-705 (1952)), fibroblast proliferation, and collagen synthesis (Beck,
L.S. et al.,
Growth Factors. 5: 295-304 (1991); Haynes, B.F. et al., J. Clin. Invesl. 61:
703-
797 (1978)) and producing a transient reduction of circulating monocytes
(Haynes,
B.F., et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, S. M.,
"Glucocorticoids and
wound healing", In: Antiinflammatory Steroid Action: Basic and Clinical
Aspects,
CA 02387808 2002-05-14
WO 01132128 PCT/US00l30237
-188-
Academic Press, New York, pp. 280-302 (1989)). The systemic administration of
steroids to impaired wound healing is a well establish phenomenon in rats
(Beck, L.S.
et al., Growth Factors. S: 295-304 (1991); Haynes, B.F., et al., J. Clin.
Invest. 61:
703-797 ( 1978); Wahl, S. M., "Glucocorticoids and wound healing", In:
Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press,
New
York, pp. 280-302 (1989); Pierce, G.F. et al., Proc. Nat!. Acad Sci. USA 86:
2229-
2233 ( 1989)).
To demonstrate that CK~3-13 can accelerate the healing process, the effects of
multiple topical applications of CK(3-13 on full thickness excisional skin
wounds in
rats in which healing has been impaired by the systemic administration of
methylprednisolone is assessed.
Young adult male Sprague Dawley rats weighing 250-300 g (Charles River
Laboratories) are used in this example. The animals are purchased at 8 weeks
of age
and are 9 weeks old at the beginning of the study. 'The healing response of
rats is
impaired by the systemic administration of methylprednisolone (l7mg/kg/rat
intramuscularly) at the time of wounding. Animals are individually housed and
received food and water ad libitum. All manipulations are performed using
aseptic
techniques. This study is conducted according to the rules and guidelines of
Human
Genome Sciences, Inc. Institutional Animal Care and Use Committee and the
Guidelines for the Care and Use of Laboratory Animals.
The wounding protocol is followed according to section A, above. On the
day of wounding, animals are anesthetized with an intramuscular injection of
ketamine (50 mg/kg) and xylazine (5 mg/kg). The dorsal region of the animal is
shaved and the skin washed with 70% ethanol and iodine solutions. The surgical
area
is dried with sterile gauze prior to wounding. An 8 mm full-thickness wound is
created using a Keyes tissue punch. The wounds are left open for the duration
of the
experiment. Applications of the testing materials are given topically once a
day for 7
consecutive days commencing on the day of wounding and subsequent to
methylprednisolone administration. Prior to treatment, wounds are gently
cleansed
with sterile saline and gauze sponges.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-189-
Wounds are visually examined and photographed at a fixed distance at the
day of wounding and at the end of treatment. Wound closure is determined by
daily
measurement on days 1-5 and on day 8. Wounds are measured horizontally and
vertically using a calibrated Jameson caliper. Wounds are considered healed if
granulation tissue is no longer visible and the wound is covered by a
continuous
epithelium.
CK(3-13 is administered using at a range different doses of CK~3-13, from
4mg to SOOmg per wound per day for 8 days in vehicle. Vehicle control groups
received SOmL of vehicle solution.
Animals are euthanized on day 8 with an intraperitoneal injection of sodium
pentobarbital (300mg/kg). The wounds and surrounding skin are then harvested
for
histology. Tissue specimens are placed in 10% neutral bufJ'ered formalin in
tissue
cassettes between biopsy sponges for further processing.
Four groups of 10 animals each (5 with methylprednisolone and S without
glucocorticoid) are evaluated: 1) Untreated group 2) Vehicle placebo control
3)
CK(3-13 treated groups.
Wound closure is analyzed by measuring the area in the vertical and'
horizontal axis and obtaining the total area of the wound. Closure is then
estimated
by establishing the differences between the initial wound area (day 0) and
that of post
treatment (day 8). The wound area on day 1 is 64mm2, the corresponding size of
the
dermal punch. Calculations are made using the following formula:
[Open area on day 8] - [Open area on day 1 ] / [Open area on day 1 ]
Specimens are fixed in 10% buffered formalin and para~n embedded blocks
are sectioned perpendicular to the wound surface (Smm) and cut using an
Olympus
microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross-
sections of bisected wounds. Histologic examination of the wounds allows
assessment of whether the healing process and the morphologic appearance of
the
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-190-
repaired skin is improved by treatment with CK(3-13. A calibrated lens
micrometer is
used by a blinded observer to determine the distance of the wound gap.
Experimental data are analyzed using an unpaired t test. A p value of < 0.05
is considered significant.
The studies described in this example tested activity in CK(3-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK~3-13 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists
of CK(3-13.
Example 42: Lymphadema Animal Model
The purpose of this experimental approach is to create an appropriate and
consistent lymphedema model for testing the therapeutic effects of CK~3-13 in
lymphangiogenesis and re-establishment of the lymphatic circulatory system in
the rat
hind limb. Effectiveness is measured by swelling volume of the affected limb,
quantification of the amount of lymphatic vasculature, total blood plasma
protein,
and histopathology. Acute lymphedema is observed for 7-10 days. Perhaps more
importantly, the chronic progress of the edema is followed for up to 3-4
weeks.
Prior to beginning surgery, blood sample is drawn for protein concentration
analysis. Male rats weighing approximately ~350g are dosed with Pentobarbital.
Subsequently, the right legs are shaved from knee to hip. The shaved area is
swabbed with gauze soaked in 70% EtOH. Blood is drawn for serum total protein
testing. Circumference and volumetric measurements are made prior to injecting
dye
into paws after marking 2 measurement levels (0.5 cm above heel, at mid-pt of
dorsal
paw). The intradermal dorsum of both right and left paws are injected with
0.05 ml
of 1 % Evan's Blue. Circumference and volumetric measurements are then made
following injection of dye into paws.
Using the knee joint as a landmark, a mid-leg inguinal incision is made
circumferentially allowing the femoral vessels to be located. Forceps and
hemostats
are used to dissect and separate the skin flaps. After locating the femoral
vessels, the
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-191-
lymphatic vessel that runs along side and underneath the vessels) is located.
The
main lymphatic vessels in this area are then electrically coagulated or suture
ligated.
Using a microscope, muscles in back of the leg (near the semitendinosis and
adductors) are bluntly dissected. The popliteal lymph node is then located.
The 2
proximal and 2 distal lymphatic vessels and distal blood supply of the
popliteal node
are then and ligated by suturing. The popliteal lymph node, and any
accompanying
adipose tissue, is then removed by cutting connective tissues.
Care is taken to control any mild bleeding resulting from this procedure.
After lymphatics are occluded, the skin flaps are sealed by using liquid skin
(Vetbond) (AJ Buck). The separated skin edges are sealed to the underlying
muscle
tissue while leaving a gap of ~0.5 cm around the leg. Skin also may be
anchored by
suturing to underlying muscle when necessary.
To avoid infection, animals are housed individually with mesh (no bedding).
Recovering animals are checked daily through the optimal edematous peak, which
typically occurred by day 5-7. The plateau edematous peak are then observed.
To
evaluate the intensity of the lymphedema, the circumference and volumes of 2
designated places on each paw before operation and daily for 7 days are
measured.
The effect plasma proteins on lymphedema is determined and whether protein
analysis is a useful testing perimeter is also investigated. The weights of
both control
and edematous limbs are evaluated at 2 places. Analysis is performed in a
blind
manner.
Circumference Measurements: Under brief gas anesthetic to prevent limb
movement, a cloth tape is used to measure limb circumference. Measurements are
done at the ankle bone and dorsal paw by 2 different people then those 2
readings are
averaged. Readings are taken from both control and edematous limbs.
Volumetric Measurements: On the day of surgery, animals are
anesthetized with Pentobarbital and are tested prior to surgery. For daily
volumetrics
animals are under brief halothane anesthetic (rapid immobilization and quick
recovery), both legs are shaved and equally marked using waterproof marker on
legs.
Legs are first dipped in water, then dipped into instrument to each marked
level then
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-192-
measured by Buxco edema software(Chen/Victor). Data is recorded by one person,
while the other is dipping the limb to marked area.
Blood-plasma protein measurements: Blood is drawn, spun, and serum
separated prior to surgery and then at conclusion for total protein and Ca2+
comparison.
Limb Weight Comparison: After drawing blood, the animal is prepared for
tissue collection. The limbs are amputated using a quillitine, then both
experimental
and control legs are cut at the ligature and weighed. A second weighing is
done as
the tibio-cacaneal joint is disarticulated and the foot is weighed.
Fiistological Preparations: The transverse muscle located behind the knee
(popliteal) area is dissected and arranged in a metal mold, filled with
freezeGel,
dipped into cold methylbutane, placed into labeled sample bags at - 80EC until
sectioning. Upon sectioning, the muscle is observed under fluorescent
microscopy
for iymphatics..
The studies described in this example tested activity in CK~3-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK(3-13 polynucleotides (e.g., gene therapy), agonists, and/or
antagonists
of CK~i-13 .
Example 43: Suppression of TNF alpha-induced adhesion molecule
expression by CK~13
The recruitment of lymphocytes to areas of inflammation and angiogenesis
involves specific receptor-ligand interactions between cell surface adhesion
molecules
(CAMs) on lymphocytes and the vascular endothelium. The adhesion process, in
both normal and pathological settings, follows a mufti-step cascade that
involves
intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1
(VCAM-1), and endothelial leukocyte adhesion molecule-1 (E-selectin)
expression
on endothelial cells (EC). The expression of these molecules and others on the
vascular endothelium determines the effrciency with which leukocytes may
adhere to
CA 02387808 2002-05-14
WO 01/32128 PCT/L1S00/30237
-193-
the local vasculature and extravasate into the local tissue during the
development of
an inflammatory response. The local concentration of cytokines and growth
factor
participate in the modulation of the expression of these CAMs.
Tumor necrosis factor alpha (TNF-a), a potent proinflammatory
cytokine, is a stimulator of all three CAMS on endothelial cells and may be
involved
in a wide variety of inflammatory responses, often resulting in a pathological
outcome.
The potential of CK~3-13 to mediate a suppression of TNF-a induced CAM
expression can be examined. A modified ELISA assay which uses ECs as a solid
phase absorbent is employed to measure the amount of CAM expression on TNF-a
treated ECs when co-stimulated with a member of the FGF family of proteins.
To perform the experiment, human umbilical vein endothelial cell (HUVEC)
cultures are obtained from pooled cord harvests and maintained in growth
medium
(EGM-2; Clonetics, San Diego, CA) supplemented with 10% FCS and 1%
penicillin/streptomycin in a 37 degree C humidified incubator containing 5%
C02.
HUVECs are seeded in 96-well plates at concentrations of 1 x 104 cells/well in
EGM
medium at 37 degree C for 18-24 hrs or until confluent. The monolayers are
subsequently washed 3 times with a serum-free solution of RPMI-1640
supplemented
with 100 U/ml penicillin and I00 mg/ml streptomycin, and treated with a given
cytokine and/or growth factors) for 24 h at 37 degree C. Following incubation,
the
cells are then evaluated for. CAM expression.
Human Umbilical Vein Endothelial cells (HCIVECs) are grown in a standard
96 well plate to confluence. Growth medium is removed from the cells and
replaced
with 90 u1 of 199 Medium (10% FBS). Samples for testing and positive or
negative
controls are added to the plate in triplicate (in 10 u1 volumes). Plates are
incubated at
37 degree C for either 5 h (selectin and integrin expression) or 24 h
(integrin
expression only). Plates are aspirated to remove medium and 100 ~.1 of 0.1
paraformaldehyde-PBS(with Ca++ and Mg++) is added to each well. Plates are
held
at 4°C for 30 min.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-l 94-
Fixative is then removed from the wells and wells are washed 1X with
PBS(+Ca,Mg)+0.5% BSA and drained. Do not allow the welts to dry. Add 10 ~l of
diluted primary antibody to the test and control wells. Anti-ICAM-1-Biotin,
Anti-
VCAM-1-Biotin and Anti-E-selectin-Biotin are used at a concentration of 10
pg/ml
(1:10 dilution of 0.1 mg/ml stock antibody). Cells are incubated at
37°C for 30 min.
in a humidified environment. Wells are washed X3 with PBS(+Ca,Mg)+0.5% BSA.
Then add 20 p1 of diluted ExtrAvidin-Alkaline Phosphotase (1:5,000 dilution)
to each well and incubated at 37°C for 30 min. Wells are washed X3 with
PBS(+Ca,Mg)+0.5% BSA. 1 tablet of p-Nitrophenol Phosphate pNPP is dissolved
in 5 ml of glycine buffer (pH 10.4). 100 p1 of pNPP substrate in glycine
buffer is
added to each test well. Standard wells in triplicate are prepared from the
working
dilution of the ExtrAvidin-Alkaline Phosphotase in glycine buffer: 1:5,000
(10°) > 10-
o.s > 10-' > 10-'~5. 5 p1 of each dilution is added to triplicate wells and
the resulting AP
content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. 100 p1 of pNNP
reagent
must then be added to each of the standard wells. The plate must be incubated
at
37°C for 4h. A volume of 50 p1 of 3M NaOH is added to all wells. The
results are
quantified on a plate reader at 405 nm. The background subtraction option is
used on
blank wells filled with glycine buffer only. The template is set up to
indicate the
concentration of AP-conjugate in each standard well.[ 5.50 ng; 1.74 ng; 0.55
ng;
0.18 ng]. Results are indicated as amount of bound AP-conjugate in each
sample.
The studies described in this example tested activity in CK(3-13 protein.
However, one skilled in the art could easily modify the exemplified studies to
test the
activity of CK(3-13 polynucleotides {e.g., gene therapy), agonists, andlor
antagonists
of CK[i-I3.
It will be clear that the invention may be practiced otherwise than as
particularly described in the foregoing description and examples. Numerous
modifications and variations of the present invention are possible in light of
the above
teachings and, therefore, are within the scope of the appended claims.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
-195-
The entire disclosure of each document cited (including patents, patent
applications, journal articles, abstracts, laboratory manuals, books, or other
disclosures) in the Background of the Invention, Detailed Description, and
Examples
is hereby incorporated herein by reference. Moreover, the sequence listing
from
U.S. application Serial No. 08/986,188 is herein incorporated by reference.
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
1
SEQUENCE LISTING
<110> HUMAN GENOME SCIENCES, INC.
<120> Human Chemokine Beta 13
<130> PFI77PCT3
<140> Unassigned
<141> 2000-11-02
<150> 09/432,768
<151> 1999-11-03
<160> 22
<170> PatentIn Ver. 2.0
<210> 1
<211> 282
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (1) . . (279)
<400> 1
atg get cgc cta cag act gca ctc ctg gtt gtc ctc gtc ctc ctt get 48
Met Ala Arg Leu Gln Thr Ala Leu Leu Val Val Leu Val Leu Leu Ala
1 5 10 15
gtg gcg ctt caa gca act gag gca ggc ccc tac ggc gcc aac atg gaa 96
Val Ala Leu Gln Ala Thr Glu Ala Gly Pro Tyr Gly Ala Asn Met Glu
20 25 30
gac agc gtc tgc tgc cgt gat tac gtc cgt cac cgt ctg ccc ctg cgc 144
Asp Ser Val Cys Cys Arg Asp Tyr Val Arg His Arg Leu Pro Leu Arg
35 40 45
gtg gtg aaa cac ttc tac tgg acc tca gac tcc tgc ccg agg cct ggc 192
Val Val Lys His Phe Tyr Trp Thr Ser Asp Ser Cys Pro Arg Pro Gly
50 55 60
gtg gtg ttg cta acc ttc agg gat aag gag atc tgt gcc gat ccc aga 240
Val Val Leu Leu Thr Phe Arg Asp Lys Glu Ile Cys Ala Asp Pro Arg
65 70 75 80
gtg ccc tgg gtg aag atg att ctc aat aag ctg agc caa tga 282
Val Pro Trp Val Lys Met Ile Leu Asn Lys Leu Ser Gln
85 90
<210> 2
<211> 93
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
2
<212> PRT
<213> Homo Sapiens
<400> 2
Met Ala Arg Leu Gln Thr Ala Leu Leu Val Val Leu Val Leu Leu Ala
1 5 10 15
Val Ala Leu Gln Ala Thr Glu Ala Gly Pro Tyr Gly Ala Asn Met Glu
20 25 30
Asp Ser Val Cys Cys Arg Asp Tyr Val Arg His Arg Leu Pro Leu Arg
35 40 45
Val Val Lys His Phe Tyr Trp Thr Ser Asp Ser Cys Pro Arg Pro Gly
50 55 60
Val Val Leu Leu Thr Phe Arg Asp Lys Glu Ile Cys Ala Asp Pro Arg
65 70 75 80
Val Pro Trp Val Lys Met Ile Leu Asn Lys Leu Ser Gln
85 90
<210> 3
<211> 92
<212> PRT
<213> Homo Sapiens
<400> 3
Met Gln Val Ser Thr Ala Ala Leu Ala Val Leu Leu Cys Thr Met Ala
1 5 10 15
Leu Cys Asn Gln Phe Ser Ala Ser Leu Ala Ala Asp Thr Pro Thr Ala
20 25 30
Cys Cys Phe Ser Tyr Thr Ser Arg Gln Ile Pro Gln Asn Phe Ile Ala
35 40 45
Asp Tyr Phe Glu Thr Ser Ser Gln Cars Ser Lys Pro Gly Val Ile Phe
50 55 60
Leu Thr Lys Arg Ser Arg Gln Val Cys Ala Asp Pro Ser Glu Glu Trp
65 70 75 80
Val Gln Lys Tyr Val Ser Asp Leu Glu Leu Ser Ala
85 90
<210> 4
<211> 39
<212> DNA
<213> Homo Sapiens
<400> 4
aaaccatggg tccgtacggt gcaaacatgg aagacagcg 39
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
3
<210> 5
<211> 30
<212> DNA
<213> Homo Sapiens
<400> 5
aaaaagcttc tgacccttcc ctggaaggta 30
<210> 6
<211> 33
<2I2> DNA
<213> Homo Sapiens
<400> 6
aaaggatccg ccaccatggc tcgcctacag act 33
<210> 7
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 7
aaaggtacct cattggctca gcttatt 27
<210> 8
<211> 3I
<212> DNA
<213> Homo Sapiens
<400> 8
aaaaagctta acataggctc gcctacagac t 31
<210> 9
<211> 60
<212> DNA
<213> Homo Sapiens
<400> 9
cgctctagat taagcgtagt ctgggacgtc gtatgggtat tggctcagct tattgagaat 60
<210> 10
<211> 733
<212> DNA
<213> Homo Sapiens
<400> 10
gggatccgga gcccaaatct tctgacaaaa ctcacacatg cccaccgtgc ccagcacctg 60
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
4
aattcgaggg tgcaccgtca gtcttcctct tccccccaaa acccaaggac accctcatga 120
tctcccggac tcctgaggtc acatgcgtgg tggtggacgt aagccacgaa gaccctgagg 180
tcaagttcaa ctggtacgtg gacggcgtgg aggtgcataa tgccaagaca aagccgcggg 240
aggagcagta caacagcacg taccgtgtgg tcagcgtcct caccgtcctg caccaggact 300
ggctgaatgg caaggagtac aagtgcaagg tctccaacaa agccctccca acccccatcg 360
agaaaaccat ctccaaagcc aaagggcagc cccgagaacc acaggtgtac accctgcccc 420
catcccggga tgagctgacc aagaaccagg tcagcctgac ctgcctggtc aaaggcttct 480
atccaagcga catcgccgtg gagtgggaga gcaatgggca gccggagaac aactacaaga 540
ccacgcctcc cgtgctggac tccgacggct ccttcttcct ctacagcaag ctcaccgtgg 600
acaagagcag gtggcagcag gggaacgtct tctcatgctc cgtgatgcat gaggctctgc 660
acaaccacta cacgcagaag agcctctccc tgtctccggg taaatgagtg cgacggccgc 720
gactctagag gat 733
<210> 11
<211> 86
<212> DNA
<213> Homo sapiens
<400> 11
gcgcctcgag atttccccga aatctagatt tccccgaaat gatttccccg aaatgatttc 60
cccgaaatat ctgccatctc aattag 86
<210> 12
<211> 27
<212> DNA
<213> Homo Sapiens
<400> 12
gcggcaagct ttttgcaaag cctaggc 27
<210> 13
<211> 271
<212> DNA
<213> Homo sapiens
<400> 13
ctcgagattt ccccgaaatc tagatttccc cgaaatgatt tccccgaaat gatttccccg 60
aaatatctgc catctcaatt agtcagcaac catagtcccg cccctaactc cgcccatccc 120
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
gcccctaact ccgcccagtt ccgcccattc tccgccccat ggctgactaa ttttttttat 180
ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt gaggaggctt 240
ttttggaggc ctaggctttt gcaaaaagct t 271
<210> 14
<211> 32
<212> DNA
<213> Homo Sapiens
<400> 14
gcgctcgagg gatgacagcg atagaacccc gg 32
<210> 15
<211> 31
<212> DNA
<213> Homo Sapiens
<400> 15
gcgaagcttc gcgactcccc ggatccgcct c 31
<210> i6
<211> 12
<212> DNA
<213> Homo Sapiens
<400> 16
12
ggggactttc cc
<210> 17
<211> 73
<212> DNA
<213> Homo Sapiens
<400> 17
gcggcctcga ggggactttc ccggggactt tccggggact ttccgggact ttccatcctg 60
ccatctcaat tag 73
<210> 18
<211> 256
<212> DNA
<213> Homo Sapiens
<400> 18
ctcgagggga ctttcccggg gactttccgg ggactttccg ggactttcca tctgccatct 60
caattagtca gcaaccatag tcccgcccct aactccgccc atcccgcccc taactccgcc 120
CA 02387808 2002-05-14
WO 01/32128 PCT/US00/30237
6
cagttccgcc cattctccgc cccatggctg actaattttt tttatttatg cagaggccga 180
ggccgcctcg gcctctgagc tattccagaa gtagtgagga ggcttttttg gaggcctagg 240
cttttgcaaa aagctt 256
<210> 19
<211> 46
<212> DNA
<213> Homo Sapiens
<400> 19
gcagcaggat ccgccatcat ggctcgccta cagactgcac tcctgg 46
<210> 20
<211> 47
<212> DNA
<213> Homo Sapiens
<400> 20
gcagcatcta gatcattggc tcagcttatt gagaatcatc ttcaccc 47
<210> 21
<211> 46
<212> DNA
<213> Homo Sapiens
<400> 21
gcagcaggat ccgccatcat ggctcgccta cagactgcac tcctgg 46
<210> 22
<211> 47
<212> DNA
<213> Homo Sapiens
<400> 22
gcagcatcta gatcattggc tcagcttatt gagaatcatc ttcaccc 47
CA 02387808 2002-05-14
PCTJUS00/30237
INDICATIONS RELATING TO A DEPOSITED MICROORGANISM
(PCT Rule 13 bis)
A Theindicationsmadebelowrelatetothemicroorganismreferredtointhedescription
on page 3 , line ~
B. IDENTIF1CATIONOFDEPOSIT Furtherdepositsareidentifiedonanadditional
sheet
Nameofdepositaryinstitution American
Type Culture Collection
Address of depositary institution
including postal code and country)
10801 University Boulevard
Manassas, Virginia 20110-2209
United States of America
Dateofdeposit AccessionNumber
28 April 1995 97113
G ADDIT10NALIND1CATIONS(leaveblankifnotapplicable)
Thisinfom~ationiscontinuedonanadditionalsheet
D: DES1CNATED STATES FOR WIRCH
INDICATIONS ARE MADE (tfthe indications
are notforall designated States)
Europe
In respect to those designations
in which a European Patent is
sought a sample of the deposited
microorganism will be made available
until the publication of the
mention of the grant of the European
patent
or until the date on which application
has been refused or withdrawn
or is deemed to be withdrawn,
only by
the issue of such a sample to
an expert nominated by the person
requesting the sample (Rule 28
(4) EPC).
Continued on the Attached Pages
2 & 3
E. SEPARATEFLJRNISHINGOFINDICATIONS(/eaveblankifrtotapplicable)
The indications listed below will
be submitted to the International
Bureau later (specifythegeneml
natioeoftheindict#ionse.~, 'Acoess~ion
Number of Deposit')
Forreceiving Officeuse only Forlntemational Bureauuse only
Thissheetwasreceivedwiththeintemationalapplication a
Tl,issheetwasreceivedbytheIntemationalBureauon:
AuthorizedolRcer ~~'~'w v. w~svvaaw .i~a 1 1 Authorizedofficer
Form PCT/RO/134 (July 1992)
CA 02387808 2002-05-14
PCT/US00/30237
ATCC Deposit No. 97113
Page No. 2
CANADA
The applicant requests that, until either a Canadian patent has been issued on
the basis of an
application or the application has been refused, or is abandoned and no longer
subject to
reinstatement, or is withdrawn, the Commissioner of Patents only authorizes
the furnishing of
a sample of the deposited biological material referred to in the application
to an independent
expert nominated by the Commissioner, the applicant must, by a written
statement, inform
the International Bureau accordingly before completion of technical
preparations for
publication of the international application.
NORWAY
The applicant hereby requests that the application has been laid open to
public inspection (by
the Norwegian Patent Office), or has been finally decided upon by the
Norwegian Patent
Office without having been laid open inspection, the furnishing of a sample
shall only be
effected to an expert in the art. The request to this effect shall be filed by
the applicant with
the Norwegian Patent Office not later than at the time when the application is
made available
to the public under Sections 22 and 33(3) of the Norwegian Patents Act. If
such a request has
been filed by the applicant, any request made by a third party for the
furnishing of a sample
shall indicate the expert to be used. That expert may be any person entered on
the list of
recognized experts drawn up by the Norwegian Patent Office or any person
approved by the
applicant in the individual case.
AUSTRALIA
The applicant hereby gives notice that the furnishing of a sample of a
microorganism shall
only be effected prior to the grant of a patent, or prior to the lapsing,
refusal or withdrawal of
the application, to a person who is a skilled addressee without an interest in
the invention
(Regulation 3.25(3) of the Australian Patents Regulations).
FINLAND
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the National Board of Patents and Regulations), or has been
finally decided
upon by the National Board of Patents and Registration without having been
laid open to
public inspection, the furnishing of a sample shall only be effected to an
expert in the art.
UNITED KINGDOM
The applicant hereby requests that the furnishing of a sample of a
microorganism shall only
be made available to an expert. The request to this effect must be filed by
the applicant with
the International Bureau before the completion of the technical preparations
for the
international publication of the application.
CA 02387808 2002-05-14
PCT/US00/30237
ATCC Deposit No.: 97113
Page No. 3
DENMARK
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the Danish Patent Office), or has been finally decided upon by
the Danish
Patent office without having been laid open to public inspection, the
furnishing of a sample
shall only be effected to an expert in the art. The request to this effect
shall be filed by the
applicant with the Danish Patent Office not later that at the time when the
application is made
available to the public under Sections 22 and 33(3) of the Danish Patents Act.
If such a
request has been filed by the applicant, any request made by a third party for
the furnishing of
a sample shall indicate the expert to be used. That expert may be any person
entered on a list
of recognized experts drawn up by the Danish Patent Office or any person by
the applicant in
the individual case.
SWEDEN
The applicant hereby requests that, until the application has been laid open
to public
inspection (by the Swedish Patent Office), or has been finally decided upon by
the Swedish
Patent Office without having been laid open to public inspection, the
furnishing of a sample
shall only be effected to an expert in the art. The request to this effect
shall be filed by the
applicant with the International Bureau before the expiration of 16 months
from the priority
date (preferably on the Form PCT/RO/134 reproduced in annex Z of Volume I of
the PCT
Applicant's Guide). If such a request has been filed by the applicant any
request made by. a
third party for the furnishing of a sample shall indicate the expert to be
used. That expert
may be any person entered on a list of recognized experts drawn up by the
Swedish Patent
Office or any person approved by a applicant in the individual case.
NETHERLANDS
The applicant hereby requests that until the date of a grant of a Netherlands
patent or until the
date on which the application is refused or withdrawn or lapsed, the
microorganism shall be
made available as provided in the 3IF(1) of the Patent Rules only by the issue
of a sample to
an expert. The request to this effect must be furnished by the applicant with
the Netherlands
Industrial Property Office before the date on which the application is made
available to the
public under Section 22C or Section 25 of the Patents Act of the Kingdom of
the Netherlands,
whichever of the two dates occurs earlier.
