Note: Descriptions are shown in the official language in which they were submitted.
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
TECHNIQUES AND COMPOSITIONS FOR TREATING CARDIOVASCULAR
DISEASE BY IN VIVO GENE DELIVERY
STATEMENT REGARDING GOVERNMENT-SPONSORED RESEARCH
Certain of the work described herein was supported in part by grants from the
United States Government under Grant Nos. VA-HL0281201, HL1768218 and
IP50HL53773.01 awarded by the National Institutes of Health. The U.S.
Government may
have certain rights in this invention.
CROSS REFERENCE TO RELATED CASES
This application is a continuation-in-part of U.S. Application Serial No.
09/609,080, filed June 30, 2000, which is a continuation-in-part of U.S.
Application Serial
No. 09/435,156, filed November 5, 1999, which is a continuation-in-part of
U.S.
Application Serial No. 08/722,271, filed February 27, 1996 (now proceeding to
issuance),
which is a continuation-in-part of U.S. Application Serial No. 08/485,472,
filed June 7,
1995 (now issued as U.S. Patent No. 5,792,453), which was a continuation-in-
part of U.S.
Application Serial No. 08/396,207, filed February 28, 1995; and this
application is a
continuation-in-part of international application PCT/LTS99/02702 filed
February 9, 1999,
which is a continuation-in-part of U.S. Application Serial No. 09/021,773,
filed February
2o 11, 1998, which is a continuation-in-part of U.S. Application Serial No.
08/485,472, filed
June 7, 1995 (now issued as U.S. Patent No. 5,792,453); and this application
is a
continuation-in-part of U.S. Application Serial No. 09/068,102, filed April
30, 1998, which
is a continuation of U.S. Application Serial No. 08/852,779, filed May 6, 1997
and is a
continuation-in-part of U.S. Application Serial No. 09/132,167, filed August
10, 1998. All
of the above patent applications are incorporated by reference herein.
FIELD OF THE INVENTION
The present invention relates to methods and compositions for treating
cardiovascular disease, by in vivo gene therapy. More specifically, the
present invention
3o relates to techniques and polynucleotide constructs for treating heart
disease and/or for
treating peripheral vascular disease by in vivo delivery of angiogenic
transgenes.
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
BACKGROUND OF THE INVENTION
It has been reported by the American Heart Association (1995 Statistical
Supplement), that about 60 million adults in the United States suffer from
cardiovascular
disease. Cardiovascular diseases are responsible for almost a million deaths
annually in
the United States representing over 40% of all deaths. Each year, in the
United States,
there are about 350,000 new cases of angina pectoris, a common condition of
coronary
artery disease characterized by transient periods of myocardial ischemia
resulting in chest
pain. Similarly, each year, some 400,000 patients are diagnosed with
congestive heart
failure "CHF", another manifestation of heart disease that represents the most
frequent
to non-elective cause of hospitalization in the U.S. In 1996, an estimated
725,000 people
suffered from peripheral vascular disease, of whom over 100,000 would require
a limb
amputation.
Myocardial ischemia is an aspect of heart dysfunction that occurs when the
heart
muscle (the myocardium) does not receive adequate blood supply and is thus
deprived of
necessary levels of oxygen and nutrients. Myocardial ischemia may result in a
variety of
heart diseases including, for example, angina, heart attack andlor congestive
heart failure.
The most common cause of myocardial ischemia is atherosclerosis (also referred
to as
coronary artery disease or "CAD"), which causes blockages in the coronary
arteries, blood
vessels that provide blood flow to the heart muscle. Present treatments for
myocardial
2o ischemia include pharmacological therapies, coronary artery bypass surgery
and
percutaneous revascularization using techniques such as balloon angioplasty.
Standard
pharmacological therapy is predicated on strategies that involve either
increasing blood
supply to the heart muscle or decreasing the demand of the heart muscle for
oxygen and
nutrients. For example, increased blood supply to the myocardium can be
achieved by
agents such as calcium channel blockers or nitroglycerin. These agents are
thought to
increase the diameter of diseased arteries by causing relaxation of the smooth
muscle in the
arterial walls. Decreased demand of the heart muscle for oxygen and nutrients
can be
accomplished either by agents that decrease the hemodynamic load on the heart,
such as
arterial vasodilators, or those that decrease the contractile response of the
heart to a given
3o hemodynamic load, such as beta-adrenergic receptor antagonists. Surgical
treatment of
ischemic heart disease is generally based on the bypass of diseased arterial
segments with
strategically placed bypass grafts (usually saphenous vein or internal mammary
artery
2
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
grafts). Percutaneous revascularization is generally based on the use of
catheters to reduce
the narrowing in diseased coronary arteries. All of these strategies are used
to decrease the
number of, or to eradicate, ischemic episodes, but all have various
limitations, some of
which are discussed below.
Many patients with heart disease, including many of those whose severe
myocardial
ischemia resulted in a heart attack, are diagnosed as having congestive heart
failure.
Congestive heart failure is defined as abnormal heart function resulting in
inadequate
cardiac output to meet metabolic needs (Braunwald, E. (ed), In: Heart Disease,
W.B.
Saunders, Philadelphia, page 426, 1988). An estimated S million people in the
United
1o States suffer from congestive heart failure. Once symptoms of CHF are
moderately severe,
the prognosis is worse than most cancers in that only half of such patients
are expected to
survive for more than 2 years (Braunwald, E. (ed), In: Heart Disease, W.B.
Saunders,
Philadelphia, page 471-485, 1988). Medical therapy can initially attenuate the
symptoms
of CHF (e.g., edema, exercise intolerance and breathlessness), and in some
cases prolong
15 life. However, the prognosis for this disease, even with medical treatment,
remains grim,
and the incidence of CHF has been increasing (see, e.g., Baughman, K.,
Cardiology Clinics
13: 27-34, 1995). Symptoms of CHF include breathlessness, fatigue, weakness,
leg
swelling and exercise intolerance. On physical examination, patients with
heart failure
tend to have elevations in heart and respiratory rates, rates (an indication
of fluid in the
20 lungs), edema, jugular venous distension, and, in general, enlarged hearts.
The most
common cause of CHF is atherosclerosis which, as discussed above, causes
blockages in
the coronary arteries that supply blood to the heart muscle. Thus, congestive
heart failure
is most commonly associated with coronary artery disease that is so severe in
scope or
abruptness that it results in the development of chronic or acute heart
failure. In such
25 patients, extensive and/or abrupt occlusion of one or more coronary
arteries precludes
adequate blood flow to the myocardium, resulting in severe ischemia and, in
some cases,
myocardial infarction or death of heart muscle. The consequent myocardial
necrosis tends
to be followed by progressive chronic heart failure or an acute low output
state - both of
which are associated with high mortality.
3o Most patients with congestive heart failure tend to develop enlarged,
poorly
contracting hearts, a condition referred to as "dilated cardiomyopathy" (or
DCM, as used
herein). DCM is a condition of the heart typically diagnosed by the finding of
a dilated,
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
hypocontractile left and/or right ventricle. Again, in the majority of cases,
the congestive
heart failure associated with a dilated heart is the result of coronary artery
disease, often so
severe that it has caused one or more myocardial infarcts. In a significant
minority of
cases, however, DCM can occur in the absence of characteristics of coronary
artery disease
(e.g., atherosclerosis). In a number of cases in which the dilated
cardiomyopathy is not
associated with CAD, the cause of DCM is known or suspected. Examples include
familial cardiomyopathy (such as that associated with progressive muscular
dystrophy,
myotonic muscular dystrophy, Freidrich's ataxia, and hereditary dilated
cardiomyopathy),
infections resulting in myocardial inflammation (such as infections by various
viruses,
1o bacteria and other parasites), noninfectious inflammations (such as those
due to
autoimmune diseases, peripartum cardiomyopathy, hypersensitivity reactions or
transplantation rejections), metabolic disturbances causing myocarditis
(including
nutritional, endocrinologic and electrolyte abnormalities) and exposure to
toxic agents
causing myocarditis (including alcohol, as well as certain chemotherapeutic
drugs and
catecholamines). In the majority of non-CAD DCM cases, however, the cause of
disease
remains unknown and the condition is thus referred to as "idiopathic dilated
cardiomyopathy" (or ">DCM"). Despite the potential differences in underlying
causation,
most patients with severe CHF have enlarged, thin-walled hearts (i.e., DCM)
and most of
those patients exhibit myocardial ischemia (even though some of them may not
have
2o apparent atherosclerosis). Furthermore, patients with DCM can experience
angina pectoris
even though they may not have severe coronary artery disease.
The occurrence of CHF poses several major therapeutic concerns, including
progressive myocardial injury, hemodynamic inefficiencies associated with the
dilated
heart, the threat of systemic emboli, and the risk of ventricular arrhythmias.
Traditional
revascularization is not an option for treatment of non-CAD DCM, because
occlusive
coronary disease is not the primary problem. Even for those patients for which
the cause
of DCM is known or suspected, the damage is typically not readily reversible.
For
example, in the case of adriamycin-induced cardiotoxicity, the cardiomyopathy
is generally
irreversible and results in death in over 60% of afflicted patients. For some
patients with
DCM, the cause itself is unknown. As a result, there are no generally applied
treatments
for DCM. Physicians have traditionally focused on alleviating the symptoms
presented in
a patient exhibiting DCM (e.g., by relieving fluid retention with diuretics,
and/or reducing
4
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
the demand of the heart muscle for oxygen and nutrients with angiotensin
converting
enzyme inhibitors). As a result, approximately 50% of the patients exhibiting
DCM die
within two years of diagnosis, often from sudden cardiac arrest associated
with ventricular
arrhythmias. "Ventricular remodeling" is an aspect of heart disease that often
occurs after
myocardial infarction and often results in further decrease in ventricular
function. In many
cases, after a myocardial infarct heals, continued ischemia in the border
region between the
healed infarct and normal tissue and other factors lead to a dilation and/or
remodeling of
the remaining heart tissue. This dilating or remodeling, while initially
adaptive, often leads
further impairment of ventricular function. Dilation of the whole heart occurs
in about
50% of patients who have such infarcts, and remodeling usually develops within
a few
months after a myocardial infarction although it can occur as early as 1-2
weeks after the
infarct. Poor left ventricular function is the best single predictor of
adverse outcome
following myocardial infarction. Thus, preventing ventricular remodeling after
myocardial
infarction would be beneficial. One approach to try to prevent ventricular
remodeling is to
treat patients who have suffered a myocardial infarction with angiotensin
converting
enzyme ("ACE") inhibitors (see, e.g., McDonald, K.M., Trans. Assoc. Am.
Physicians
103:229-235, 1990; Cohn, J. Clin. Cardiol. 18 (Suppl. IV) IV-4-IV-12, 1995).
However,
these agents are only somewhat effective at preventing deleterious ventricular
remodeling
and new therapies are needed.
2o Present treatments for CHF include pharmacological therapies, coronary
revascularization procedures and heart transplantation. Pharmacological
therapies for CHF
have been directed toward increasing the force of contraction of the heart (by
using
inotropic agents such as digitalis and beta-adrenergic receptor agonists),
reducing fluid
accumulation in the lungs and elsewhere (by using diuretics), and reducing the
work of the
heart (by using agents that decrease systemic vascular resistance such as
angiotensin
converting enzyme inhibitors). Beta-adrenergic receptor antagonists have also
been tested.
While such pharmacological agents can improve symptoms, and potentially
prolong life,
the prognosis in most cases remains dismal.
Some patients with heart failure due to associated coronary artery disease can
3o benefit, at least temporarily, by revascularization procedures such as
coronary artery bypass
surgery and angioplasty. Such procedures are of potential benefit when the
heart muscle is
not dead but may be dysfunctional because of inadequate blood flow. If normal
coronary
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
blood flow is restored, previously dysfunctional myocardium may contract more
normally,
and heart function may improve. However, if the patient has an inadequate
microvascular
bed (e.g., as may be found in more severe CHF patients), revascularization
will rarely
restore cardiac function to normal or near-normal levels, even though mild
improvements
are sometimes noted. In addition, the incidence of failed bypass grafts and
restenosis
following angioplasty poses further risks to patients treated by such methods.
Heart
transplantation can be a suitable option for CHF patients who have no other
confounding
diseases and are relatively young, but this is an option for only a small
number of such
patients, and only at great expense. In sum, it can be seen that CHF has a
very poor
prognosis and responds poorly to current therapies.
Further complicating the physiological conditions associated with CHF are
various
natural adaptations that tend to occur in patients with dysfunctional hearts.
Although these
natural responses can initially improve heart function, they often result in
other problems
that can exacerbate the disease, confound treatment, and have adverse effects
on survival.
There are three such adaptive responses commonly observed in CHF patients: (i)
volume
retention induced by changes in sodium reabsorption, which expands plasma
volume and
initially improves cardiac output; (ii) cardiac enlargement (from dilation and
hypertrophy)
which can increase stroke volume while maintaining a relatively normal wall
tension; and
(iii) increased norepinephrine release from adrenergic nerve terminals
impinging on the
2o heart which, by interacting with cardiac beta-adrenergic receptors, tends
to increase heart
rate and force of contraction, thereby increasing cardiac output. However,
each of these
three natural adaptations tends ultimately to fail for various reasons. In
particular, fluid
retention tends to result in edema and retained fluid in the lungs that
impairs breathing.
Heart enlargement can lead to deleterious left ventricular remodeling with
subsequent
severe dilation and increased wall tension, thus exacerbating CHF. Finally,
long-term
exposure of the heart to norepinephrine tends to make the heart unresponsive
to adrenergic
stimulation and is linked with poor prognosis.
Diseases of the peripheral vasculature, like heart disease, often result from
restricted blood flow to the tissue (e.g. skeletal muscle) which (like cardiac
disease)
3o becomes ischemic, particularly when metabolic needs increase (such as with
exercise).
Thus, atherosclerosis present in a peripheral vessel may cause ischemia in the
tissue
supplied by the affected vessel. This problem, known as peripheral arterial
occlusive
6
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
disease (PAOD), most frequently affects in the lower limbs of patients. As
with other
forms of cardiovascular disease, this condition or at least some of its
symptoms, may be
treated by using drugs, such as aspirin or other agents that reduce blood
viscosity, or by
surgical intervention, such as arterial grafting, surgical removal of fatty
plaque deposits or
by endovascular treatments, such as angioplasty. While symptoms may be
improved, the
effectiveness of such treatments is typically inadequate, for reasons similar
to those
referred to above.
Recently, investigations into treatments for cardiovascular disease have
turned to
therapeutics related to angiogenesis. Angiogenesis refers generally to the
development and
differentiation of blood vessels. A number of proteins, typically referred to
as "angiogenic
proteins," are known to promote angiogenesis. Such angiogenic proteins include
members
of the fibroblast growth factor (FGF) family, the vascular endothelial growth
factor
(VEGF) family, the platelet-derived growth factor (PDGF) family, the insulin-
like growth
factor (IGF) family, and others (as described in more detail below and in the
art). For
example, the FGF and VEGF family members have been recognized as regulators of
angiogenesis during growth and development. Their role in promoting
angiogenesis in
adult animals has recently been examined (as discussed below). The angiogenic
activity of
the FGF and VEGF families has bee examined. For example, it has been shown
that acidic
FGF ("aFGF") protein, within a collagen-coated matrix, when placed in the
peritoneal
2o cavity of adult rats, resulted in a well vascularized and normally perfused
structure
(Thompson et al., Proc. Natl. Acad. Sci. USA, 86: 7928-7932, 1989). Injection
of basic
FGF ("bFGF") protein into adult canine coronary arteries during coronary
occlusion
reportedly led to decreased myocardial dysfunction, smaller myocardial
infarctions, and
increased vascularity in the bed at risk (Yanagisawa-Miwa et al., Science,
257: 1401-1403,
1992). Similar results have been reported in animal models of myocardial
ischemia using
bFGF protein (Harada et al., J. Clin. Invest., 94: 623-630, 1994; Unger et
al., Am. J.
Physiol., 266: H1588-H-1595, 1994). An increase in collateral blood flow was
shown in
dogs treated with VEGF protein (Banai et al. Circulation 89: 2183-2189, 1994).
However, difficulties associated with the potential use of such protein
infusions to
3o promote cardiac angiogenesis include: achieving proper localization for a
sufficient period
of time, and ensuring that the protein is and remains in the proper form and
concentration
needed for uptake and the promotion of an angiogenic effect within cells of
the
7
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
myocardium. A protein concentration which is high initially (e.g., following
bolus
infusion) but then drops rapidly (with clearance by the body) can be both
toxic and
ineffective. Another difficulty is the need for repeated infusion or injection
of the protein.
Some publications postulated on the use of gene transfer for the treatment or
prevention of disease, including certain heart diseases. See, for example,
French, "Gene
Transfer and Cardiovascular Disorders," Herz 18:222-229, 1993; Williams,
"Prospects for
Gene Therapy of Ischemic Heart Disease," American Journal of Medical Sciences
306:129-136, 1993; Schneider and French, "The Advent of Adenovirus: Gene
Therapy for
Cardiovascular Disease," Circulation 88:1937-1942, 1993; and Mazur et al.,
"Coronary
to Restenosis and Gene Therapy," Molecular and Cellular Pharmacolo~y, 21:104-
111, 1994.
Additionally, some groups have suggested in vivo gene transfer into the
myocardium using
plasmids, retrovirus, adenovirus and other vectors (see e.g., Barr et al.,
Supplement II,
Circulation, 84(4): Abstract 1673, 1991; Barr et al., Gene Ther., 1: 51-58,
1994; French et
al., Circulation, 90(5): 2402-2413, 1994; French et al., Circulation, 90(5):
2414-2424,
1994; French et al., Circulation, 90: 1517 Abstract No. 2785, 1994; Leiden, et
al.,
W094/11506 (26 May 1994); Guzman et al., Circ. Res., 73(6): 1202-1207, 1993;
Kass-
Eisler et al., Proc. Natl. Acad. Sci. USA, 90: 11498-11502, 1993; Muhlhauser
et al., Hum.
Gene Ther., 6: 1457-1465, 1995; Miihlhauser et al. Circ. Res., 77(6): 1077-
1086, 1995; and
Rowland et al., Am. Thorac. Sure., 60(3): 721-728, 1995.
2o In general, however, these reports provided little more than suggestions or
wishes
for potential therapies. Of those providing animal data, most did not employ
disease
models suitably related to actual in vivo conditions. Moreover, the attempted
in vivo
methods generally suffered from one or more of the following deficiencies:
inadequate
transduction efficiency and transgene expression; marked immune response to
the vectors
used, including inflammation and tissue necrosis; and importantly, a relative
inability to
target transduction and transgene expression to the organ of interest (e.g.,
gene transfer
targeted to the heart resulted in the transgene also being delivered to non-
cardiac sites such
as liver, kidneys, lungs, brain and testes of the test animals). By way of
example, the
insertion of a transgene into a rapidly dividing cell population will result
in substantially
3o reduced duration of transgene expression. Examples of such cells include
endothelial
cells, which make up the inner layer of all blood vessels, and fibroblasts,
which are
dispersed throughout the heart. Targeting the transgene so that only the
desired cells will
8
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
receive and express the transgene, and so that the transgene will not be
systemically
distributed, are also critically important considerations. If this is not
accomplished,
systemic expression of the transgene and problems attendant thereto will
result. For
example, inflammatory infiltrates have been documented after adenovirus-
mediated gene
transfer in liver (Yang et al. Proc. Natl. Acad. Sci. U.S.A., 91: 4407, 1994).
Additionally,
inflammatory infiltrates were documented in the heart after direct
intramyocardial injection
through a needle inserted into the myocardial wall (French et al.,
Circulation, 90(5): 2414-
2424, 1994).
A method for treating certain forms of congestive heart failure associated
with
1o beta-adrenergic signaling has recently been demonstrated by Hammond et al.
in PCT
publication WO 98/10085, published 12 March 1998. That method involves the
delivery
of genes encoding elements of the beta-adrenergic signaling pathway to the
heart of a
patient with heart disease associated with a reduction in beta-adrenergic
signaling.
SUMMARY OF THE INVENTION
The present invention relates to methods and compositions for treating
cardiovascular disease comprising delivering a transgene encoding an
angiogenic protein
or peptide to affected tissue by introducing a vector comprising the transgene
into said
tissue wherein the transgene is expressed and disease symptoms ameliorated.
For example,
contractile function and/or blood flow in the heart can be increased by
introduction of a
transgene-containing vector into at least one coronary artery of a patient,
wherein the
transgene is delivered to the myocardium and therein expressed. Methods are
also
provided for use in peripheral vascular diseases such as peripheral arterial
occlusive
disease (PAOD). As described and illustrated herein, these methods are thus
useful for
treating heart disease, peripheral vascular disease and similar disorders.
The present invention provides a method for increasing blood flow in an
ischemic
tissue of a patient, comprising delivering an angiogenic protein or peptide to
an ischemic
region of said tissue by introducing a vector comprising the transgene to the
tissue,
whereby the transgene is expressed in the tissue, and blood flow in the tissue
is increased.
3o In one aspect, the vector, comprising a transgene encoding an angiogenic
protein or
peptide, is introduced into ischemic skeletal muscle, wherein the angiogenic
protein or
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
peptide is expressed and causes an increase in blood flow and a decrease in
ischemia in the
tissue. In an alternative embodiment, the vector is introduced into a blood
vessel supplying
blood to the ischemic tissue (e.g. by introduction into a coronary artery
supplying the
myocardium or into a peripheral artery, such as a femoral artery, supplying
skeletal
muscle). The vectors employed in the invention can be a plasmid or preferably
a viral
vector, for example a replication-deficient adenovirus. Various aspects and
therapeutic
applications of the present invention are described and illustrated below.
In one aspect, the present invention provides a method for increasing
contractile
function in the heart of a patient, comprising delivering a transgene encoding
an angiogenic
1o protein or peptide to the myocardium of the patient by introducing a vector
comprising the
transgene to the myocardium (preferably by delivery to one or more coronary
arteries),
wherein the transgene is delivered to the myocardium and expressed, and
contractile
function in the heart is increased. The transgene may be introduced by, for
example,
intracoronary injection into one or more coronary arteries or saphenous vein
or internal
mammary artery grafts supplying blood to the myocardium. The transgene
preferably
encodes at least one angiogenic protein or peptide. The vectors employed in
the invention
can be a plasmid or preferably a viral vector, including, by way of
illustration, a
replication-deficient adenovirus. By injecting the viral vector stock
(preferably containing
relatively few or no wild-type virus), deeply (at least about 1 cm) into the
lumen of one or
2o both coronary arteries or grafts (preferably into both right and left
coronary arteries or
grafts), and preferably in an amount of 10'-1013 viral particles as determined
by optical
densitometry (more preferably 109-10" viral particles), it is possible to
locally transfect a
desired number of cells, especially cardiac myocytes, in the affected
myocardium with
angiogenic protein- or peptide-encoding genes, thereby maximizing therapeutic
efficacy of
gene transfer, and minimizing undesirable angiogenesis at extracardiac sites
and the
possibility of an inflammatory response to viral proteins. If a cardiomyocyte-
specific
promoter is used expression can be further limited to the cardiac myocytes so
as to further
reduce the potentially harmful effects of angiogenesis in non-cardiac tissues
such as the
retina.
3o Kits and compositions that can be used in accordance with the therapeutic
techniques are also provided.
to
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 graphically presents percent wall thickening during pacing in a
porcine
model of congestive heart failure. Percent wall thickening was assessed
sequentially in the
interventricular septum and lateral wall before pacing (day 0) and every 7
days as heart
failure progressed (as described in Example 1 ). Symbols represent mean
values; error bars
denote one standard deviation (1 SD). Two-way ANOVA (repeated measures) showed
that percent wall thickening was affected by duration of pacing (P< 0.001) and
by region
(P=0.001). Furthermore, the pattern of change in wall thickening was different
between
the two regions (P<0.0001 ). Mean values for percent wall thickening at each
time point
10' were tested for differences between the two regions post hoc by the Tukey
method; P
values for these analyses are shown beneath the error bars.
Figures 2A and 2B graphically present subendocardial blood flow during pacing
in
a porcine model of congestive heart failure, as described in Example 1.
For Figure 2A, subendocardial (endo) blood flow was assessed sequentially in
the
interventricular septum and lateral wall under the conditions listed along the
x axis. Day
refers to the day of sustained pacing that measurements were obtained (0,
initiation of
pacing; 14, 14 days; 21-28, 21 to 28 days). PACE refers to whether blood flow
determinations were obtained with pacemaker activated (+) or inactivated (0).
Pacemaker
rate was 225 bpm. (See Table 3 herein for numerical values.) Symbols represent
mean
2o values; error bars denote 1 SD. Two-way ANOVA (repeated measures) showed
that
subendocardial blood flow was affected by duration ofpacing (P=0.0001) and by
region
(P=0.017). Furthermore, the pattern of change in subendocardial blood flow was
different
between the two regions (P<0.006). Mean values for subendocardial blood flow
at each
time point were tested for differences between the two regions post hoc by
Tukey analyses;
P values for these analyses are shown beneath the error bars.
For Figure 2B, subendocardial blood flow per beat was assessed sequentially in
the
interventricular septum and lateral wall under the conditions listed along the
x axis.
Symbols and conditions are as in Figure 2A. (See Table 4 herein for numerical
values.)
Two-way ANOVA (repeated measures) showed that subendocardial blood flow per
beat
3o was affected by duration of pacing (P=0.0001 ) and by region (P=0.0198).
Figure 3A graphically presents meridional end-systolic wall stress as assessed
sequentially in the interventricular septum and lateral wall before pacing
(day 0) and every
11
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
7 days as heart failure progressed (described in Example 1 ). Two-way ANOVA
(repeated
measures) showed that systolic wall stress was affected by duration of pacing
(P<0.0001 ).
However, the pattern of systolic wall stress was similar in both regions.
Measurements
were made with pacemakers inactivated.
Figure 3B graphically presents coronary vascular resistance during pacing in a
porcine model of congestive heart failure, as described in Example 1. An index
of
coronary vascular resistance was assessed sequentially in the interventricular
septum and
lateral wall under the conditions listed along the x axis. Symbols and
conditions are the
same as in Fig 2. Two-way ANOVA (repeated measures) showed that the coronary
1o vascular resistance index was affected by duration of pacing (P=0.0001) and
by region
(P=0.013). Furthermore, the pattern of change in coronary vascular resistance
was
different between the two regions (P=0.0012). Mean values for coronary
vascular
resistances at each time point were tested for differences between the two
regions post hoc
by Tukey analyses. This analysis showed that coronary vascular resistance was
higher in
15 the lateral wall than in the septum directly after the initiation of pacing
(P value below
error bar).
Figure 4 shows a schematic of the construction of an exemplary replication-
defective recombinant adenovirus vector useful for gene transfer, as described
in the
Examples below.
2o Figure 5 is a schematic figure which shows rescue recombination
construction of a
transgene-encoding adenovirus.
Figures 6A and 6B graphically present the regional contractile function of the
treated animals, as described in Example 5. Figure 6A shows results of animals
examined
2 weeks post gene transfer and Figure 6B shows results 12 weeks post gene
transfer.
25 Figures 7A, 7B and 7C show diagrams corresponding to myocardial contrast
echocardiographs. White areas denote contrast enhancement (more blood flow)
and dark
areas denote decreased blood flow. Figure 7A illustrates acute LCx occlusion
in a normal
pig. Figure 7B illustrates the difference in contrast enhancement between IVS
and LCx
bed 14 days after gene transfer with lacZ, indicating different blood flows in
two regions
3o during atrial pacing (200 bpm). In Figure 7C, contrast enhancement appears
equivalent in
IVS and LCx bed 14 days after gene transfer with FGF-5, indicating similar
blood flows in
the two regions during atrial pacing. These results are described in Example
5.
12
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Figure 8 shows the peak contrast ratio (a correlate of blood flow) expressed
as the
ratio of the peak video intensity in the ischemic region (LCx bed) divided by
the peak
video intensity in the interventricular septum (IVS), measured from the video
images using
a computer-based video analysis program during atrial pacing (200 bpm) before
and 141
days after gene transfer with lacZ (control gene) and with FGF-5, and in 5
animals, 12
weeks after FGF-5 gene transfer (described in Example 5). Blood flow to the
ischemic bed
remained 50% of normal after gene transfer with the control gene but increased
2-fold
above normal after gene transfer with FGF-5 (p=0.0018), an effect that
persisted for at
least 12 weeks.
to Figure 9 shows vessel number as quantitated by microscopic analysis in the
ischemic and nonischemic regions after gene transfer with FGF-5 and with lacZ
(described
in Example S). There was increased capillary number surrounding each fiber in
the
ischemic and nonischemic regions of animals that received FGF-5 gene transfer
(p<0.038)
compared to animals that received the lacZ gene.
Figures 10A, lOB and l OC are from gels documenting DNA, mRNA and protein
expression after gene transfer of an angiogenic transgene to the myocardium
according to
the present invention (as described in Example 5). Figure lOD is from a gel
following
PCR amplification demonstrating the absence of any detectable gene transfer to
the retina,
liver or skeletal muscle of treated animals (as described in Example 5).
2o Figure 11 shows a comparison of wall thickening achieved with in vivo gene
transfer using different angiogenic gene constructs, FGF-4, FGF-5 and FGF-2LI
+/- sp (i.e.
FGF-2LI plus or minus secretion signal peptide), as described in examples 6
and 7.
Figure 12 shows that improved function in the ischemic region after FGF-4 gene
transfer (as indicated by wall thickening) was associated with improved
regional perfusion.
Figure 13 shows a comparison of perfusion (blood flow) resulting from
injection of
FGF-4, FGF-5 or FGF-2LI +/- sp (= FGF-2LI plus or minus signal peptide), as
described in
Examples 6 and 7.
Figure 14 shows a comparison of wall thickening as a result of gene transfer
with
FGF-2 plus (FGF-2LI+sp) or minus secretion signal peptide (FGF-2LI-sp), as
described in
3o Example 7.
13
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
Definitions
"Heart disease" refers to acute and/or chronic cardiac dysfunctions. Heart
disease
is often associated with a decrease in cardiac contractile function and may be
associated
with an observable decrease in blood flow to the myocardium (e.g., as a result
of coronary
artery disease). Manifestations of heart disease include myocardial ischemia,
which may
result in angina, heart attack and/or congestive heart failure.
"Myocardial ischemia" is a condition in which the heart muscle does not
receive
adequate levels of oxygen and nutrients, which is typically due to inadequate
blood supply
1o to the myocardium (e.g., as a result of coronary artery disease).
"Heart failure" is clinically defined as a condition in which the heart does
not
provide adequate blood flow to the body to meet metabolic demands. Symptoms
include
breathlessness, fatigue, weakness, leg swelling, and exercise intolerance. On
physical
examination, patients with heart failure tend to have elevations in heart and
respiratory
rates, rates (an indication of fluid in the lungs), edema, jugular venous
distension, and, in
many cases, enlarged hearts. Patients with severe heart failure suffer a high
mortality;
typically 50% of the patients die within two years of developing the
condition. In some
cases, heart failure is associated with severe coronary artery disease
("CAD"), typically
resulting in myocardial infarction and either progressive chronic heart
failure or an acute
low output state, as described herein and in the art. In other cases, heart
failure is
associated with dilated cardiomyopathy without associated severe coronary
artery disease.
"Peripheral vascular disease" refers to acute or chronic dysfunction of the
peripheral (i.e., non-cardiac) vasculature and/or the tissues supplied
thereby. As with heart
disease, peripheral vascular disease typically results from an inadequate
blood flow to the
tissues supplied by the vasculature, which lack of blood may result, for
example, in
ischemia or, in severe cases, in tissue cell death. Aspects of peripheral
vascular disease
include, without limitation, peripheral arterial occlusive disease (PAOD) and
peripheral
muscle ischemia. Frequently, symptoms of peripheral vascular disease are
manifested in
the extremities of the patient, especially the legs.
3o As used herein, the terms "having therapeutic effect" and "successful
treatment"
carry essentially the same meaning. In particular, a patient suffering from
heart disease is
successfully "treated" for the condition if the patient shows observable
and/or measurable
14
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
reduction in or absence of one or more of the symptoms of heart disease after
receiving an
angiogenic factor transgene according to the methods of the present invention.
Reduction
of these signs or symptoms may also be felt by the patient. Thus, indicators
of successful
treatment of heart disease conditions include the patient showing or feeling a
reduction in
any one of the symptoms of angina pectoris, fatigue, weakness, breathlessness,
leg
swelling, rates, heart or respiratory rates, edema or jugular venous
distension. The patient
may also show greater exercise tolerance, have a smaller heart with improved
ventricular
and cardiac function, and in general, require fewer hospital visits related to
the heart
condition. The improvement in cardiovascular function may be adequate to meet
the
to metabolic needs of the patient and the patient may not exhibit symptoms
under mild
exertion or at rest. Many of these signs and symptoms are readily observable
by eye andlor
measurable by routine procedures familiar to a physician. Indicators of
improved
cardiovascular function include increased blood flow and/or contractile
function in the
treated tissues. As described below, blood flow in a patient can be measured
by thallium
imaging (as described by Braunwald in Heart Disease, 4th ed., pp. 276-311
(Saunders,
Philadelphia, 1992)) or by echocardiography (described in Examples 1 and 5 and
in Sahn,
DJ., et al., Circulation. 58:1072-1083, 1978). Blood flow before and after
angiogenic gene
transfer can be compared using these methods. Improved heart function is
associated with
decreased signs and symptoms, as noted above. In addition to echocardiography,
one can
2o measure ejection fraction (LV) by nuclear (non-invasive) techniques as is
known in the art.
Blood flow and contractile function can likewise be measured in peripheral
tissues treated
according to the present invention.
An "angiogenic protein or peptide" refers to any protein or peptide capable of
promoting angiogenesis or angiogenic activity, i.e. blood vessel development.
A "polynucleotide" refers to a polymeric form of nucleotides of any length,
either
ribonucleotides or deoxyribonucleotides, or analogs thereof. This term refers
to the
primary structure of the molecule, and thus includes double- and single-
stranded DNA, as
well as double- and single-stranded RNA. It also includes modified
polynucleotides such
as methylated and/or capped polynucleotides.
"Recombinant," as applied to a polynucleotide, means that the polynucleotide
is the
product of various combinations of cloning, restriction and/or ligation steps,
and other
procedures that result in a construct that is distinct from a polynucleotide
found in nature.
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
A "gene" or "transgene" refers to a polynucleotide or portion of a
polynucleotide
comprising a sequence that encodes a protein. For most situations, it is
desirable for the
gene to also comprise a promoter operably linked to the coding sequence in
order to
effectively promote transcription. Enhancers, repressors and other regulatory
sequences
may also be included in order to modulate activity of the gene, as is well
known in the art.
(See, e.g., the references cited below).
The terms "polypeptide," "peptide," and "protein" are used interchangeably to
refer
to polymers of amino acids of any length. These terms also include proteins
that are post-
translationally modified through reactions that include glycosylation,
acetylation and
to phosphorylation.
A "heterologous" component refers to a component that is introduced into or
produced within a different entity from that in which it is naturally located.
For example, a
polynucleotide derived from one organism and introduced by genetic engineering
techniques into a different organism is a heterologous polynucleotide which,
if expressed,
can encode a heterologous polypeptide. Similarly, a promoter or enhancer that
is removed
from its native coding sequence and operably linked to a different coding
sequence is a
heterologous promoter or enhancer.
A "promoter," as used herein, refers to a polynucleotide sequence that
controls
transcription of a gene or coding sequence to which it is operably linked. A
large number
of promoters, including constitutive, inducible and repressible promoters,
from a variety of
different sources, are well known in the art (and identified in databases such
as GenBank)
and are available as or within cloned polynucleotide sequences (from, e.g.,
depositories
such as the ATCC as well as other commercial or individual sources).
An "enhancer," as used herein, refers to a polynucleotide sequence that
enhances
transcription of a gene or coding sequence to which it is operably linked. A
large number
of enhancers, from a variety of different sources are well known in the art
(and identified in
databases such as GenBank) and available as or within cloned polynucleotide
sequences
(from, e.g., depositories such as the ATCC as well as other commercial or
individual
sources). A number of polynucleotides comprising promoter sequences (such as
the
3o commonly-used CMV promoter) also comprise enhancer sequences.
"Operably linked" refers to a juxtaposition of two or more components, wherein
the
components so described are in a relationship permitting them to function in
their intended
16
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
manner. A promoter is operably linked to a gene or coding sequence if the
promoter
controls transcription of the gene or coding sequence. Although an operably
linked
promoter is generally located upstream of the coding sequence, it is not
necessarily
contiguous with it. An enhancer is operably linked to a coding sequence if the
enhancer
increases transcription of the coding sequence. Operably linked enhancers can
be located
upstream, within or downstream of coding sequences. A polyadenylation sequence
is
operably linked to a coding sequence if it is located at the downstream end of
the coding
sequence such that transcription proceeds through the coding sequence into the
polyadenylation sequence.
1o A "replicon" refers to a polynucleotide comprising an origin of replication
which
allows for replication of the polynucleotide in an appropriate host cell.
Examples include
chromosomes of a target cell into which a heterologous nucleic acid might be
integrated
(e.g., nuclear and mitochondrial chromosomes), as well as extrachromosomal
replicons
(such as replicating plasmids and episomes).
1 s "Gene delivery", "gene transfer," and the like as used herein, are terms
referring to
the introduction of an exogenous polynucleotide (sometimes referred to as a
"transgene")
into a host cell, irrespective of the method used for the introduction. Such
methods include
a variety of well-known techniques such as vector-mediated gene transfer (by,
e.g., viral
infection/transfection, or various other protein-based or lipid-based gene
delivery
2o complexes) as well as techniques facilitating the delivery of "naked"
polynucleotides (such
as electroporation, "gene gun" delivery and various other techniques used for
the
introduction of polynucleotides). The introduced polynucleotide may be stable
or
transiently maintained in the host cell. Stable maintenance typically requires
that the
introduced polynucleotide either contains an origin of replication compatible
with the host
25 cell or integrates into a replicon of the host cell such as an
extrachromosomal replicon
(e.g., a plasmid) or a nuclear or mitochondrial chromosome. A number of
vectors are
known to be capable of mediating transfer of genes to mammalian cells, as is
known in the
art and described herein.
"In vivo " gene delivery, gene transfer, gene therapy and the like as used
herein, are
3o terms refernng to the introduction of a vector comprising an exogenous
polynucleotide
directly into the body of an organism, such as a human or non-human mammal,
whereby
the exogenous polynucleotide is introduced into a cell of such organism in
vivo.
17
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
A "vector" (sometimes referred to as a gene delivery or gene transfer
"vehicle")
refers to a macromolecule or complex of molecules comprising a polynucleotide
to be
delivered to a host cell, either in vitro or in vivo. The polynucleotide to be
delivered may
comprise a coding sequence of interest in gene therapy.
"Vasculature" or "vascular" are terms refernng to the system of vessels
carrying
blood (as well as lymph fluids) throughout the mammalian body.
"Blood vessel" refers to any of the vessels of the mammalian vascular system,
including arteries, arterioles, capillaries, venules, veins, sinuses, and vasa
vasorum. In
preferred aspects of the present invention for treating heart disease, vectors
comprising
1o angiogenic transgenes are introduced directly into vascular conduits
supplying blood to the
myocardium. Such vascular conduits include the coronary arteries as well as
vessels such
as saphenous veins or internal mammary artery grafts.
"Artery" refers to a blood vessel through which blood passes away from the
heart.
Coronary arteries supply the tissues of the heart itself, while other arteries
supply the
15 remaining organs of the body. The general structure of an artery consists
of a lumen
surrounded by a mufti-layered arterial wall.
An "individual" or a "patient" refers to a mammal, preferably a large mammal,
most preferably a human.
"Treatment" or "therapy" as used herein refers to administering, to an
individual
2o patient, agents that are capable of eliciting a prophylactic, curative or
other beneficial effect
on the individual.
"Gene therapy" as used herein refers to administering, to an individual
patient,
vectors comprising a therapeutic gene or genes.
A "therapeutic polynucleotide" or "therapeutic gene" refers to a nucleotide
z5 sequence that is capable, when transferred to an individual, of eliciting a
prophylactic,
curative or other beneficial effect in the individual.
REFERENCES
The practice of the present invention will employ, unless otherwise indicated,
3o conventional techniques of molecular biology and the like, which are within
the skill of the
art. Such techniques are explained in the literature. See e.g., Molecular
Cloning: A
Laboratory Manual, (J. Sambrook et al., Cold Spring Harbor Laboratory, Cold
Spring
18
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Harbor, N.Y., 1989); Current Protocols in Molecular Biology (F. Ausubel et al.
eds., 1987
and updated); Essential Molecular Biology (T. Brown ed., IRL Press 1991); Gene
Expression Technology (Goeddel ed., Academic Press 1991 ); Methods for Cloning
and
Analysis of Eukaryotic Genes (A. Bothwell et al. eds., Bartlett Publ. 1990);
Gene Transfer
and Expression (M. Kriegler, Stockton Press 1990); Recombinant DNA Methodology
(R.
Wu et al. eds., Academic Press 1989); PCR: A Practical Approach (M. McPherson
et al.,
IRL Press at Oxford University Press 1991); Cell Culture for Biochemists (R.
Adams ed.,
Elsevier Science Publishers 1990); Gene Transfer Vectors for Mammalian Cells
(J. Miller
& M. Calos eds., 1987); Mammalian Cell Biotechnology (M. Butler ed., 1991);
Animal
l0 Cell Culture (J. Pollard et al. eds., Humana Press 1990); Culture of Animal
Cells, 2nd Ed.
(R. Freshney et al. eds., Alan R. Liss 1987); Flow Cytometry and Sorting (M.
Melamed et
al. eds., Wiley-Liss 1990); the series Methods in Enzymology (Academic Press,
Inc.);
Techniques in Immunocytochemistry, (G. Bullock & P. Petrusz eds., Academic
Press
1982, 1983, 1985, 1989); Handbook of Experimental Immunology, (D. Weir & C.
Blackwell, eds.); Cellular and Molecular Immunology (A. Abbas et al., W.B.
Saunders
Co. 1991, 1994); Current Protocols in Immunology (J. Coligan et al. eds.
1991); the series
Annual Review of Immunology; the series Advances in Immunology;
Oligonucleotide
Synthesis (M. Gait ed., 1984); Animal Cell Culture (R. Freshney ed., IRL Press
1987); the
series Arteriosclerosis, Thrombosis and Vascular Biology (Lippincott, Williams
& Wilkins
2o publishers for the American Heart Association); the series Circulation
(Lippincott,
Williams & Wilkins publishers for the American Heart Association); and the
series
Circulation Research (Lippincott, Williams & Wilkins publishers for the
American Heart
Association).
Additional references describing delivery and logistics of surgery which may
be
used in the methods of the present invention include the following: Topol, EJ
(ed.), The
Textbook of Interventional Cardiology, 2nd Ed. (W.B. Saunders Co. 1994);
Rutherford,
RB, Vascular Surgery, 3rd Ed. (W.B. Saunders Co. 1989); The Cecil Textbook of
Medicine, 19th Ed. (W.B. 1992); and Sabiston, D, The Textbook of Surgery, 14th
Ed.
(W.B. 1991 ). Additional references describing cell types found in the blood
vessels, and
those of the vasculature which may be useful in the methods of the present
invention
include the following: W. Bloom & D. Fawcett, A Textbook of Histology (V.B.
Saunders
Co. 1975).
19
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Various publications have postulated on the uses of gene transfer for the
prevention
of disease, including heart disease. See, e.g., Methods in Virology, Vol. 7:
Gene Transfer
and Expression Protocols, Murray, E. (ed.), Weiss, Clifton, N.J., 1991; Mazur
et al.,
Molecular and Cellular Biology, 21:104-111, 1994; French, Herz 18:222-229,
1993;
Williams, Journal of Medical Sciences 306:129-136, 1993; and Schneider,
Circulation
88:1937-1942, 1993.
The references cited in the above section are hereby incorporated by reference
herein to the extent that these references teach techniques that are employed
in the practice
of the present invention.
to
INCORPORATION BY REFERENCE
All references cited within this application, including patents, patent
applications
and other publications, are hereby incorporated by reference.
15 DETAILED DESCRIPTION OF VARIOUS PREFERRED EMBODIMENTS
Various preferred aspects of the present invention are summarized below and
further described and illustrated in the subsequent detailed descriptions and
figures.
The present invention relates to methods and compositions for treating
cardiovascular diseases including myocardial ischemia, heart failure and
peripheral
2o vascular disease.
In the present method, for treating heart disease, a vector construct
containing a
gene encoding an angiogenic protein or peptide is targeted to the heart of a
patient whereby
the exogenous angiogenic protein is expressed in the myocardium, thus
ameliorating
cardiac dysfunction by improving blood flow and/or improving cardiac
contractile
25 function. Improved heart function ultimately leads to the reduction or
disappearance of
one or more symptoms of heart disease or heart failure and prolonged life
beyond the
expected mortality.
Similarly, in the treatment of peripheral vascular disease according to the
present
method, a vector construct comprising a transgene encoding at least one
angiogenic protein
3o or peptide is targeted to the affected tissue, for example ischemic
skeletal muscle, whereby
synthesis of the exogenous angiogenic protein ameliorates and/or cures
symptoms of the
peripheral vascular disease, for example by increasing blood flow to the
affected (e.g.,
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
ischemic) region of the tissue and/or, in muscle, by improving contractile
function of the
affected muscle.
Thus, in a preferred aspect, the present invention provides a method for
treating
heart disease in a patient having myocardial ischemia, comprising delivering a
transgene-
inserted vector to the myocardium of the patient by intracoronary injection,
preferably by
injecting the vector directly into one or both coronary arteries (or grafts),
whereby the
transgene is expressed and blood flow and/or contractile function are
improved. By way of
illustration, using a vector comprising a transgene coding for an angiogenic
protein or
peptide, such as, for example, FGF-5, FGF-4, aFGF, bFGF and/or a VEGF, which
vector is
to delivered to the heart where the protein or peptide is produced to a
therapeutically
significant degree in the myocardium continuously for sustained periods,
angiogenesis can
be promoted in the affected region of the myocardium. Other transgenes, such
as those
encoding beta-adrenergic signaling proteins or other cardiac- or muscle-
enhancing
proteins, can also be used, as described below, in conjunction with the use of
an angiogenic
transgene. The vectors employed in the invention can be a plasmid or
preferably a viral
vector, for example a replication-deficient adenovirus or adeno-associated
virus (AAV).
By injecting the viral vector stock, such as one that contains relatively few
or no wild-type
virus, deeply into the lumen of one or both coronary arteries (or grafts),
preferably into
both the right and left coronary arteries (or grafts), and preferably in an
amount of about
10'-10'3 viral particles as determined by optical densitometry (more
preferably about 109-
10" viral particles), it is possible to locally transfect a desired number of
cells in the
affected myocardium with angiogenic protein- or peptide-encoding genes,
thereby
maximizing therapeutic efficacy of gene transfer, and minimizing both
undesirable
angiogenesis at extracardiac sites and the possibility of an inflammatory
response to viral
proteins.
In another preferred aspect, the present invention can also be used to treat a
patient
suffering from congestive heart failure, by delivering a transgene-inserted
vector to the
heart of said patient, the vector comprising a transgene encoding an
angiogenic protein or
peptide, whereby the transgene is expressed in the myocardium resulting in
increased
3o blood flow and function in the heart. Among such patients suffering from
congestive heart
failure are those exhibiting dilated cardiomyopathy and those who have
exhibited severe
21
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
myocardial infarctions, typically associated with severe or occlusive coronary
artery
disease. The vector is preferably introduced into a blood vessel supplying
blood to the
myocardium of the heart, so as to deliver the vector to the myocardium.
Preferably the
vector is introduced into the lumen of a coronary artery, a saphenous vein
graft, or an
internal mammary artery graft; most preferably, the vector is introduced into
the lumen of
both a left and right coronary artery. The intracoronary injection is
preferably made, as a
single injection, relatively deeply within each of the selected artery(s),
(e.g., preferably at
least about 1 cm into the lumens of the vessel(s)).
The techniques of the present invention are also useful to prevent or
alleviate
1o deleterious ventricular remodeling in a patient who has suffered (or may
suffer) a
myocardial infarction. Again, a vector comprising a transgene encoding an
angiogenic
protein or peptide, preferably
operably linked to a promoter for expression of the gene, is delivered to the
heart of the
patient, where the transgene is expressed and the deleterious ventricular
remodeling
alleviated.
Transgenes Encoding Angiogenic Proteins and Peptides
In the present invention, one or more transgenes encoding an angiogenic
protein or
peptide factor that can enhance blood flow and/or contractile function can be
used. Any
2o protein or peptide that exhibits angiogenic activity, measurable by the
methods described
herein and in the art, can be potentially employed in connection with the
present invention.
A number of such angiogenic proteins are known in the art and new forms are
routinely
identified. Suitable angiogenic proteins or peptides are exemplified by
members of the
family of fibroblast growth factors (FGF), vascular endothelial growth factors
(VEGF),
platelet-derived growth factors (PDGF), insulin-like growth factors (IGF), and
others.
Members of the FGF family include, but are not limited to, aFGF (FGF-1), bFGF
(FGF-2),
FGF-4 (also known as "hst/KS3"), FGF-5, FGF-6. VEGF has been shown to be
expressed
by cardiac myocytes in response to ischemia in vitro and in vivo; it is a
regulator of
angiogenesis under physiological conditions as well as during the adaptive
response to
3o pathological states (Banai et al. Circulation 89:2183-2189, 1994). The VEGF
family,
includes, but is not limited to, members of the VEGF-A sub-family (e.g. VEGF-
121,
VEGF-145, VEGF-165, VEGF-189 and VEGF-206), as well as members of the VEGF-B
22
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
sub-family (e.g. VEGF-167 and VEGF-186) and the VEGF-C sub-family. PDGF
includes,
e.g., PDGF A and PDGF B, and IGF includes, for example, IGF-1. Other
angiogenic
proteins or peptides are known in the art and new ones are regularly
identified. The
nucleotide sequences of genes encoding these and other proteins, and the
corresponding
amino acid sequences are likewise known in the art (see, e.g., the GENBANK
sequence
database).
Angiogenic proteins and peptides include peptide precursors that are post-
translationally processed into active peptides and "derivatives" and
"functional
equivalents" of angiogenic proteins or peptides. Derivatives of an angiogenic
protein or
1o peptide are peptides having similar amino acid sequence and retaining, to
some extent, one
or more activities of the related angiogenic protein or peptide. As is well
known to those
of skill in the art, useful derivatives generally have substantial sequence
similarity (at the
amino acid level) in regions or domains of the protein associated with the
angiogenic
activity. Similarly, those of skill in the art will readily appreciate that by
"functional
equivalent" is meant a protein or peptide that has an activity that can
substitute for one or
more activities of a particular angiogenic protein or peptide. Preferred
functional
equivalents retain all of the activities of a particular angiogenic protein or
peptide;
however, the functional equivalent may have an activity that, when measured
quantitatively, is stronger or weaker than the wild-type peptide or protein.
2o For details on the FGF family, see, e.g., Burgess, Ann. N.Y. Acad. Sci.
638: 89-97,
1991; Burgess et al. Annu. Rev. Biochem. 58: 575-606, 1989; Muhlhauser et al.,
Hum.
Gene Ther. 6: 1457-1465, 1995; Zhan et al., Mol. Cell. Biol., 8: 3487, 1988;
Seddon et al.,
Ann.. N.Y. Acad. Sci. 638: 98-108, 1991. For human hst/KS3 (i.e. FGF-4), see
Taira et al.
Proc. Natl. Acad. Sci. USA 84: 2980-2984, 1987. For human VEGF-A protein, see
e.g.,
Tischer et al. J. Biol. Chem. 206: 11947-11954, 1991, and references therein;
Muhlhauser
et al., Circ. Res. 77: 1077-1086, 1995; and Neufeld et al., WO 98/10071 (12
March 1998).
Other variants of known angiogenic proteins have likewise been described; for
example
variants of VEGF proteins and VEGF related proteins, see e.g., Baird et al.,
WO 99/40197,
(12 August 1999); and Bohlen et al., WO 98/49300, (5 November 1998).
Combinations of
3o angiogenic proteins and gene delivery vectors encoding such combinations
are described in
Gao et al. USSN 09/607,766, filed 30 June 2000, entitled "Dual Recombinant
Gene
Therapy Compositions and Methods of Use", hereby incorporated by reference in
its
23
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
entirety. As is also appreciated by those of skill in the art, angiogenic
proteins can promote
angiogenesis by enhancing the expression, stability or functionality of other
angiogenic
proteins. Examples of such angiogenic proteins or peptides include, e.g.,
regulatory factors
that are induced in response to hypoxia (e.g. the hypoxia-inducible factors
such as Hif 1,
Hif 2 and the like; see, e.g., Wang et al., Proc. Natl. Acad. Sci. USA 90(9):
4304-8, 1993;
Forsythe et al., Mol. Cell. Biol. 16(9): 4604-13, 1996; Semenza et al., Kidney
Int., 51 (2):
553-5, 1997; and O'Rourke et al., Oncol. Res., 9(6-7): 327-32, 1997; as well
as other
regulatory factors, such as, for example, those that are induced by
physiological conditions
associated with cardiovascular disease, such as inflammation (e.g., inducible
nitric oxide
to synthase (iNOS), as well as the constitutive counterpart, cNOS; see e.g.,
Yoshizumi et al.,
Circ. Res., 73(1): 205-9, 1993; Charnain et al., J. Biol. Chem., 269(9): 6765-
72, 1994;
Papapetropoulos et al., Am. J. Pathol., 150(5): 1835-44, 1997; and Palmer, et
al., Am. J.
Ph sy iol., 274(2 Pt 1): L212-9, 1998). Additional examples of such angiogenic
proteins
include certain insulin-like growth factors (e.g., IGF-1) and angiopoietins
(Angs), which
have been reported to promote and/or stimulate expression and/or activity of
other
angiogenic proteins such as VEGF (see e.g. Goad, et al, Endocrinolo~y,
137(6):2262-68
(1996); Warren, et al., J. Bio. Chem., 271(46):29483-88 (1996); Punglia, et
al, Diabetes,
46(10):1619-26 (1997); and Asahara, et al., Circ. Res., 83(3):233-40 (1998)
and Bermont
et al. Int. J. Cancer 85: 117-123, 2000). Similarly, hepatocyte growth factor
(also referred
2o to as Scatter factor), which has been reported to induce blood vessel
formation in vivo (see,
e.g., Grant et al. Proc. Natl. Acad. Sci. USA 90: 1937-1941, 1993) has also
been reported
to increase expression of VEGF (see, e.g., Wojta et al., Lab Invest. 79:427-
438, 1999).
Additional examples of angiogenic polypeptides include natural and synthetic
regulatory
peptides (angiogenic polypeptide regulators) that act as promoters of
endogenous
angiogenic genes. Native angiogenic polypeptide regulators can be derived from
inducers
of endogenous angiogenic genes. Hif, as described above, is one illustrative
example of
such an angiogenic gene which has been reported to promote angiogenesis by
inducing
expression of other angiogenic genes. Synthetic angiogenic polypeptide
regulators can be
designed, for example, by preparing mufti-finger zinc-binding proteins that
specifically
3o bind to sequences upstream of the coding regions of endogenous angiogenic
genes and
which can be used to induce the expression of such endogenous genes. Studies
of
numerous genes has led to the development of "rules" for the design of such
zinc-finger
24
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
DNA binding proteins (see, e.g., Rhodes and Klug, Scientific American,
February 1993, pp
56-65; Choo and Klug, Proc. Natl. Acad. Sci. USA, 91 (23): 11163-7, 1994;
Rebar and
Pabo, Science, 263(5147): 671-3, 1994; Choo et al., J. Mol. Biol., 273(3): 525-
32, 1997;
Pomerantz et al., Science 267: 93-96, 1995; and Liu et al., Proc. Natl. Acad.
Sci. USA, 94:
5525-5530, 1997. As will be appreciated by those of skill in the art, numerous
additional
genes encoding proteins or peptides having the capacity to directly or
indirectly promote
angiogenesis are regularly identified and new genes will be identified based
on similarities
to known angiogenic protein or peptide encoding genes or to the discovered
capability of
such genes to encode proteins or peptides that promote angiogenesis. Sequence
1o information for such genes and encoded polypeptides is readily obtainable
from sequence
databases such as GenBank or EMBL. Polynucleotides encoding these proteins can
also be
obtained from gene libraries, e.g., by using PCR or hybridization techniques
routine in the
art.
Preferably, the angiogenic protein-encoding transgene is operably linked to a
promoter that directs transcription and expression of the gene in a mammalian
cell, such as
a cell in the heart or in the skeletal muscle. One presently preferred
promoter is a CMV
promoter. In other preferred embodiments, as discussed further below, the
promoter is a
tissue-specific promoter, such as a cardiac-specific promoter (e.g., a
cardiomyocyte-
specific promoter). Preferably, the gene encoding the angiogenic factor is
also operably
linked to a polyadenylation signal.
Success of the gene transfer approach requires both synthesis of the gene
product
and secretion from the transfected cell. Thus, preferred angiogenic proteins
or peptides
include those which are naturally secreted or have been modified to permit
secretion, such
as by operably linking to a signal peptide. From this point of view, a gene
encoding a
secreted angiogenic protein, such as, FGF-4, FGF-5, or FGF-6 is preferred
since these
proteins contain functional secretory signal sequences and are readily
secreted from cells.
Many if not most human VEGF proteins (including but not limited to VEGF-121
and
VEGF-165) also are readily secreted and diffusible after secretion. Thus, when
expressed,
these angiogenic proteins can readily access the cardiac interstitium and
induce
3o angiogenesis. Blood vessels that develop in angiogenesis include
capillaries which are the
smallest caliber blood vessels having a diameter of about 8 microns, and
larger caliber
blood vessels that have a diameter of at least about 10 microns. Angiogenic
activity can be
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
determined by measuring blood flow, increase in function of the treated tissue
or the
presence of blood vessels, using procedures known in the art or described
herein. For
example, capillary number or density can be quantitated in an animal visually
or by
microscopic analysis of the tissue site (see Example 5).
With other angiogenic proteins such as aFGF (FGF-1) and bFGF (FGF-2) that lack
a native secretory signal sequence, fusion proteins having secretory signal
sequences can
be recombinantly produced using standard recombinant DNA methodology familiar
to one
of skill in the art. It is believed that both aFGF and bFGF are naturally
secreted to some
degree; however, inclusion of an additional secretion signal sequence can be
used to
to enhance secretion of the protein. The secretory signal sequence would
typically be
positioned at the N-terminus of the desired protein but can be placed at any
position
suitable to allow secretion of the angiogenic factor. For example, a
polynucleotide
containing a suitable signal sequence can be fused 5' to the first codon of
the selected
angiogenic protein gene. Suitable secretory signal sequences include signal
sequences of
15 the FGF-4, FGF-5, FGF-6 genes or a signal sequence of a different secreted
protein such as
IL-1-beta. Example 7 below exemplifies one type of modification of an
angiogenic protein
to contain a signal sequence from another protein, the modification achieved
by
replacement of residues in the angiogenic protein with residues that direct
secretion of the
secreted second protein. A signal sequence derived from a protein that is
normally
2o secreted from cardiac myocytes can be used. Angiogenic genes can also
provide additional
functions that can improve, for example cardiac cell function. For example,
FGFs can
provide cardiac enhancing and/or "ischemic protectant effects" that may be
independent of
their capability to promote angiogenesis. Thus, angiogenic genes can be used
to enhance
cardiac function by mechanisms that are additional to or in place of the
promotion of
25 angiogenesis per se. As an additional example, IGFs, which can promote
angiogenesis,
can also enhance muscle cell function (see e.g. Musaro et al. Nature 400: 581-
585, 1999);
as well as exhibit anti-apoptotic effects (see e.g. Lee et al. Endocrinology
140: 4831-4840,
1999). Other proteins which enhance muscle cell function can also be employed
in
accordance with the methods of the present invention.
3o As noted above, genes encoding one or more angiogenic proteins or peptides
can be
used in conjunction with the present invention. Thus, a gene or genes encoding
a
combination of angiogenic proteins or peptides can be delivered using one or
more vectors
26
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
according to the methods described herein. The families of angiogenic genes
described
herein and in the art comprise numerous examples of such genes. Preferably,
where such a
combination is employed, the genes may be derived from different families of
angiogenic
factors (such as a combination selected from two or more different members of
the group
consisting of FGFs, VEGFs, PDGFs and IGFs). To take a single illustration of
such a
combination, a vector comprising an FGF gene and a VEGF gene may be used. As
an
illustrative example, we have used a combination of an FGF gene (FGF-4
fragment 140)
(see e.g., the FGF-4 gene and variants thereof described by Basilico et al.,
in U.S. Patent
No. 5,459,250, issued 17 October 1995, and related cases) and a variant VEGF
gene
(VEGF-145 mutein 2) (see, e.g., the VEGF-145 gene and variants thereof
described by
Neufeld et al., WO 98/10071, published 12 March 1998, and related cases). Such
combinations can exhibit additive and/or synergistic effects. Numerous other
combinations will be apparent to those of skill in the art based on these
teachings. Vectors
comprising angiogenic genes or combinations of angiogenic genes, in accordance
with the
present invention, can also include one or more other genes that can be used
to further
enhance tissue blood flow and/or contractile function. In the heart, for
example, genes
encoding beta-ASPS (as described, by Hammond et al., in co-pending
applications WO
98/10085, published 12 March 1998) can be employed in combination with one or
more
genes encoding angiogenic proteins or peptides. Other cardiac or muscle cell
enhancing
2o proteins can similarly be incorporated into the compositions and methods of
the present
invention.
Combinations of genes that can be employed in accordance with the present
invention can be provided within a single vector (e.g., as separate genes,
each under the
control of a promoter, or as a single transcriptional or translational fusion
gene).
Combinations of genes can also be provided as a combination of vectors (which
may be
derived from the same or different vectors, such as a combination of
adenovirus vectors, or
an adenovirus vector and an AAV vector); which can be introduced to a patient
coincidentally or in series. In the case of Adenovirus (Ad) and Adeno-
associated virus
(AAV), the presence of Ad, which is normally a helper virus for AAV, can
enhance the
3o ability of AAV to mediate gene transfer. An Ad vector may thus be
introduced coincident
with or prior to introduction of an AAV vector according to the present
invention. In
addition to transfection efficiency, the choice of vector is also influenced
by the desired
27
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
longevity of transgene expression. By way of illustration, since many
angiogenic genes
can bring about long-term effects without requiring long-term expression
(e.g., by
initiating or facilitating the process of angiogenesis which results in an
increase in tissue
vascularization), angiogenic genes may be introduced using an adenovirus (or
other vector
that does not normally integrate into host DNA) which might be used prior to
or in
combination with the introduction of an AAV vector carrying a transgene for
which
longer-term expression is desired (e.g., a beta-ASP transgene). Other
combinations of
transgenes and/or vectors will be apparent to those of skill in the art based
on the teachings
and illustrations of the present invention.
1 o For treating humans, genes encoding angiogenic proteins of human origin
are
preferred although angiogenic proteins of other mammalian origin that exhibit
cross-
species activity i.e. having angiogenic activity in humans, can also be used.
Vectors for Gene Delivery In Vivo
In general, the gene of interest is transferred to the heart or to the
peripheral
vasculature in vivo, and directs production of the encoded protein. Preferably
such
production is constitutive (although inducible expression systems can also be
employed).
Vectors useful in the present invention include viral vectors, lipid-based
vectors
(e.g., liposomes) and other vectors that are capable of delivering DNA to non-
dividing
cells in vivo. Presently preferred are viral vectors, particularly replication-
defective viral
vectors including, for example, replication-defective adenovirus vectors and
adeno-
associated virus vectors. For ease of production and use in the present
invention,
replication-defective adenovirus vectors are presently most preferred.
Adenovirus
efficiently infects non-dividing cells and is therefore useful for expressing
recombinant
genes in the myocardium because of the nonreplicative nature of cardiac
myocytes.
A variety of other vectors suitable for in vivo gene therapy can readily be
employed
to deliver angiogenic protein transgenes for use in the present invention.
Such other
vectors include other viral vectors (such as AAV), non-viral protein-based
delivery
3o platforms, as well as lipid-based vectors (such as liposomes, micelles,
lipid-containing
emulsions and others that have been described in the art). With respect to AAV
vectors, as
is known in the art, they are preferably replication-defective in humans, such
as for
28
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
example, having the rep and cap genes removed (which sequence must therefore
be
supplied in traps to replicate and package AAV vectors, typically in a
packaging cell line)
and the inserted transgene (including, for example, a promoter operably linked
thereto) is
preferably flanked by AAV inverted terminal repeats (ITRs).
Recombinant viral vectors comprise one or more heterologous genes or
sequences.
Since many viral vectors exhibit size-constraints associated with packaging,
and since
replication-deficient viral vectors are generally preferred for in vivo
delivery, the
heterologous genes or sequences are typically introduced by replacing one or
more portions
of the viral genome. Such viruses may become replication-deficient, as a
result of the
1o deletions, thereby requiring the deleted functions) to be provided in traps
during viral
replication and encapsidation (by using, e.g., a helper virus or a packaging
cell line
carrying genes necessary for replication and/or encapsidation) (see, e.g., the
references and
illustrations below). As stated above, modified AAV vectors in which
transgenes are
inserted in place of viral rep and/or cap genes are likewise well known in the
art.
15 Similarly, modified viral vectors in which a polynucleotide to be delivered
is carried on the
outside of the viral particle have also been described (see, e.g., Curiel, DT,
et al. PNAS
88:8850-8854, 1991). References describing a these and other gene delivery
vectors are
known in the art, a number of which are cited herein.
As described above and in the cited references, vectors can also comprise
other
2o components or functionalities that further modulate gene delivery and/or
gene expression,
or that otherwise provide beneficial properties to the targeted cells. Such
other
components include, for example, components that influence binding or
targeting to cells
(including components that mediate cell-type or tissue-specific binding);
components that
influence uptake of the vector by the cell; components that influence
processing and/or
25 localization of the vector and its nucleic acid within the cell after
uptake (such as agents
mediating intracellular processing and/or nuclear localization); and
components that
influence expression of the polynucleotide. Such components also might include
markers,
such as detectable and/or selectable markers that can be used to detect or
select for cells
that have taken up and are expressing the nucleic acid delivered by the
vector. Such
3o components can be provided as a natural feature of the vector (such as the
use of certain
viral vectors which have components or functionalities mediating binding and
uptake), or
vectors can be modified to provide such functionalities. A detectable marker
gene allows
29
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
cells carrying the gene to be specifically detected (e.g., distinguished from
cells which do
not carry the marker gene). One example of such a detectable marker gene is
the lacZ
gene, encoding beta-galactosidase, which allows cells transduced with a vector
carrying the
lacZ gene to be detected by staining, as described below. Selectable markers
can be
positive, negative or bifunctional. Positive selectable markers allow
selection for cells
carrying the marker, whereas negative selectable markers allow cells carrying
the marker to
be selectively eliminated. A variety of such marker genes have been described,
including
bifunctional (i.e. positive/negative) markers (see, e.g., Lupton, S., WO
92/08796, published
29 May 1992; and Lupton, S., WO 94/28143, published 8 December 1994). Such
marker
1o genes can provide an added measure of control that can be advantageous in
gene therapy
contexts. A large variety of such vectors are known in the art and are
generally available
(see, e.g., the various references cited above).
References describing adenovirus vectors and other viral vectors which could
be
used in the methods of the present invention include the following: Horwitz,
M.S.,
Adenoviridae and Their Replication, in Fields, B., et al.. (eds.) Virology,
Vol. 2, Raven
Press New York, pp. 1679-1721, 1990); Graham, F., et al., pp. 109128 in
Methods in
Molecular Biology, Vol. 7: Gene Transfer and Expression Protocols, Murray, E.
(ed.),
Humana Press, Clifton, N.J. (1991); Miller, N., et al., FASEB Journal 9: 190-
199, 1995;
Schreier, H, Pharmaceutica Acta Helvetiae 68: 145-159, 1994; Schneider and
French,
2o Circulation 88:1937-1942, 1993; Curiel D.T., et al., Human Gene Therapy 3:
147-154,
1992; Graham, F.L., et al., WO 95/00655 (5 January 1995); Falck-Pedersen,
E.S., WO
95/16772 (22 June 1995); Denefle, P. et al., WO 95/23867 (8 September 1995);
Haddada,
H. et al., WO 94/26914 (24 November 1994); Perricaudet, M. et al., WO 95/02697
(26
January 1995); Zhang, W., et al., WO 95/25071 (12 October 1995). A variety of
adenovirus plasmids are also available from commercial sources, including,
e.g., Microbix
Biosystems of Toronto, Ontario (see, e.g., Microbix Product Information Sheet:
Plasmids
for Adenovirus Vector Construction, 1996). Various additional adenoviral
vectors and
methods for their production and purification are regularly identified.
Additional references describing AAV vectors which could be used in the
methods
of the present invention include the following: Carter, B., Handbook of
Parvoviruses, vol.
1, pp. 169-228, 1990; Berns, Virology, pp. 1743-1764 (Raven Press 1990);
Carter, B.,
Curr. Opin. Biotechnol., 3: 533-539, 1992; Muzyczka, N., Current Topics in
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Microbiology and Immunology, 158: 92-129, 1992; Flotte, T.R., et al., Am. J.
Respir.
Cell Mol. Biol. 7:349-356, 1992; Chatterjee et al., Ann. NY Acad. Sci., 770:
79-90, 1995;
Flotte, T.R., et al., WO 95/13365 (18 May 1995); Trempe, J.P., et al., WO
95/13392 (18
May 1995); Kotin, R., Human Gene Therapy, 5: 793-801, 1994; Kotin et al., WO
98/11244
(19 March 1998); Kotin et al., WO 99/61601 (2 December 1999); Flotte, T.R., et
al., Gene
Therapy 2:357-362, 1995; Allen, J.M., WO 96/17947 (13 June 1996); and Du et
al., Gene
Therapy 3: 254261, 1996. Various additional AAV vectors and methods for their
production and purification are regularly identified.
As described above and in the scientific literature, a number of retrovirus-
derived
to systems have also been developed to be used in in vivo gene delivery. By
way of
illustration, the lentivirus genus of retroviruses (for example, human
immunodeficiency
virus, feline immunodeficiency virus and the like) can be modified so that
they are able to
transduce cells that are typically non-dividing (see, e.g., Poeschla et al.,
PNAS 96:11395-
11399, 1996; Naldini et al., PNAS 96:11382-11388, 1996; Naldini et al.,
Science 272:263-
267, 1996; Srinivasakumar et al., J. Virol. 71: 5841-5848, 1997; Zufferey et
al., Nat.
Biotechnol. 15: 871-875, 1997; Kim et al., J. Virol. 72: 811-816, 1998;
Miyoshi et al., J.
Virol. 72:8150-8157, 1998; see also Buchschacher et al., Blood 15:2499-2504,
2000; see
also The Salk Institute, W097/12622 (10 April 1997)). While HIV-based
lentiviral vector
systems have received some degree of focus in this regard, other lentiviral
systems have
recently been developed, such as feline immunodeficiency virus-based
lentivirus vector
systems, that offer potential advantages over the HIV-based systems (see e.g.
Poeschla et
al., Nat. Med. 4:354-357, 1998; Johnston et al., J. Virol. 73: 2491-2498,
1999; and
Johnston et al., J. Virol. 73: 4991-5000, 1999; see also the review by Romano
et al., Stem
Cells 18:19-39, 2000 and references reviewed therein).
In addition to viral vectors, non-viral vectors that may be employed as a gene
delivery means are likewise known and continue to be developed. For example,
non-viral
protein-based delivery platforms, such as macromolecular complexes comprising
a DNA
binding protein and a carrier or moiety capable of mediating gene delivery, as
well as lipid-
based vectors (such as liposomes, micelles, lipid-containing emulsions and
others) have
3o been described in the art. References describing non-viral vectors which
could be used in
the methods of the present invention include the following: Ledley, FD, Human
Gene
Therapy 6: 11 29-1144, 1995; Miller, N., et al., FASEB Journal 9: 190-199,
1995; Chonn,
31
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
A., et al., Curr. Opin. in Biotech. 6: 698-708, 1995; Schofield, JP, et al.,
British Med.
Bull. 51: 56-71, 1995; Brigham, K. L., et al., J. Liposome Res. 3: 31 49,
1993; Brigham,
K.L., WO 91/06309 (16 May 1991); Felgner, P.L., et al., WO 91/17424 (14
November
1991); Solodin et al., Biochemistry 34: 13537-13544, 1995; WO 93/19768 (14
October
1993); Debs et al., WO 93/125673; Felgner, P.L., et al., U.S. Patent 5,264,618
(November
23, 1993); Epand, R.M., et al., U.S. Patent 5,283,185 (February 1, 1994); Gao
et al., WO
96/22765 (1 August 1996); Gebeyehu et al., U.S. Patent 5,334,761 (August 2,
1994);
Felgner, P.L., et al., U.S. Patent 5,459,127 (October 17, 1995); Overell,
R.W., et al., WO
95/28494 (26 October 1995); Jessee, WO 95/02698 (26 January 1995); Haces and
1o Ciccarone, WO 95/17373 (29 June 1995); Lin et al., WO 96/01840 (25 January
1996).
Numerous additional lipid-mediated in vivo gene delivery vectors and vector
delivery co-
factors have been identified (see e.g. Kollen et al., Hum. Gene Ther. 10:615-
22, 1999; Roy
et al., Nat. Med. 5:387-391; Fajac et al., Hum. Gene Ther. 10:395-406, 1999;
Ochiya et al.,
Nat. Med. 5:707-710, 1999). Additionally, the development of systems which
combine
components of viral and non-viral mediated gene delivery systems have been
described and
may be employed herein (see e.g. Philip et al., Mol. Cell Biol., 14: 2411-
2418, 1994; see
also Di Nicola et al., Hum. Gene Ther. 10:1875-1884, 1999). Various additional
non-viral
gene delivery vectors and methods for their preparation and purification are
regularly
identified.
2o As described above, the efficiency of gene delivery using a vector such as
a viral
vector can be enhanced by delivering the vector into a blood vessel such as an
artery or into
a tissue that is pre-infused and/or co-infused with a vasoactive agent, for
example
histamine or a histamine agonist, or a vascular endothelial growth factor
(VEGF) protein,
as described herein and further illustrated in co-pending PCT application WO
99/40945,
published 19 Aug. 1999. Another example of a vasoactive agent that can be
employed to
enhance the efficiency of gene delivery is a nitric oxide donor such as sodium
nitroprusside. Most preferably the vasoactive agent is infused into the blood
vessel or
tissue coincidently with and/or within several minutes prior to introduction
of the vector.
Vasoactive agent, as used herein, refers to a natural or synthetic substance
that induces
increased vascular permeability and/or enhances transfer of macromolecules
such as gene
delivery vectors from blood vessels, e.g. across capillary endothelia. By
augmenting
vascular permeability to macromolecules or otherwise facilitating the transfer
of
32
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
macromolecules into the capillary bed perfused by an artery, vasoactive agents
can enhance
delivery of these vectors to the targeted sites and thus effectively enhance
overall
expression of the transgene in the target tissue. We have employed histamine
as a
vasoactive agent and such was found to substantially enhance delivery of a
vector to an
s infused site such as the myocardium. Histamine derivatives and agonists,
such as those that
interact with histamine H receptors, which can be employed include, for
example, 2-
methylhistamine, 2-pyridylethylamine, betahistine, and 2 thiazolylethylamine.
These and
additional histamine agonists are described, for example, in Garrison JC.,
Goodman and
Gilman's The Pharmacological Basis of Therapeutics (8th Ed: Gilman AG, Rall
TW, Nies
1o AS, Taylor P, eds) Pergamon Press, 1990, pp 575-582 and in other
pharmacological treatises.
In addition to histamine and histamine agonists, which can be employed as
vasoactive
agents, vascular endothelial growth factors (VEGFs) and VEGF agonists (as
described
herein and in the cited references) can also induce increased vascular
permeability and can
therefore be used as a vasoactive agent to enhance gene delivery in the
context of the
15 compositions and methods described herein. As with histamine, the VEGF is
preferably
infused into a blood vessel supplying the target site over several minutes
prior to infusion
of vector. Nitric oxide donors, such as sodium nitroprusside (SNP), can also
be employed
as vasoactive agents. Preferably the nitric oxide donor (e.g., SNP) is pre-
infused into the
target tissue (or blood vessel supplying a target tissue), beginning several
minutes prior to
2o and continuing up until the time of infusion of the vector composition.
Administration can
also be continued during infusion of the vector composition.
An Exemplary Adenoviral Vector that is Helper-Independent and Replication-
Deficient in Humans
25 In general, the gene of interest is transferred to the heart or to the
peripheral
vasculature, in vivo, and directs production of the encoded protein. Several
different gene
transfer approaches are feasible. Presently preferred is a helper-independent
replication-
deficient system based on human adenovirus 5 (Ad5). Using a single
intracoronary
injection of such a recombinant Ad5-based system, we have demonstrated
significant
30 transfection of myocardial cells in vivo (Giordano and Hammond, Clin. Res.,
42:123A,
1994). Non-replicative recombinant adenoviral vectors are particularly useful
in
transfecting coronary endothelium and cardiac myocytes resulting in highly
efficient
33
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
transfection after intracoronary injection. Adenovirus vectors can also be
used to transfect
tissue supplied by the peripheral vasculature, e.g., by intra-arterial or
direct injection.
As demonstrated herein, the helper-independent replication-defective human
adenovirus 5 system can be used to effectively transfect a large percentage of
myocardial
cells in vivo by a single intracoronary injection. We have also shown that
such a delivery
technique can be used to effectively target vectors to the myocardium of a
large mammal
heart. Additional means of targeting vectors to particular cells or tissue
types are described
below and in the art.
In various illustrations described below, the recombinant adenovirus vectors
used
to are based on the human adenovirus 5 (as described by McGrory WJ et al.,
Virolo~y
163:614-617, 1988) which are missing essential early genes from the adenovirus
genome
(usually ElA/E1B), and are therefore unable to replicate unless grown in
permissive cell
lines that provide the missing gene products in traps. In place of the
missing. adenovirus
genomic sequences, a transgene of interest can be cloned and expressed in
tissue/cells
infected with the replication-defective adenovirus. Generally, adenovirus-
based gene
transfer does not result in stable integration into the target cell genome.
However,
adenovirus vectors can be propagated in high titer and transfect non-
replicating cells; and,
although the transgene is not passed to daughter cells, this is suitable for
gene transfer to
adult cardiac myocytes, which do not actively divide. Retrovirus vectors
provide stable
2o gene transfer, and high titers are now obtainable via retrovirus
pseudotyping (Burns, et al.,
Proc Natl. Acad. Sci. USA, 90: 8033-8037, 1993), but current retrovirus
vectors are
generally unable to efficiently transduce nonreplicating cells (e.g., cardiac
myocytes)
efficiently. In addition, the potential hazards of transgene incorporation
into host DNA are
not warranted if short-term gene transfer is sufficient.
Indeed, we have demonstrated that a limited duration in the expression of an
angiogenic protein is sufficient to substantially improve blood flow and
function in the
ischemic tissue (see Example 5). Thus, transient gene transfer is
therapeutically adequate
for treating such cardiovascular conditions. Within 14 days after gene
transfer of FGF-5
into the myocardium, blood flow to the ischemic bed had increased two-fold and
the effect
3o persisted for at least 12 weeks (Example 5 and Figure 8). The increased
blood flow
correlated with an increase in the number of capillaries in the heart (see
Example S). Wall
thickening also increased within two weeks after gene transfer and persisted
for at least 12
34
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
weeks. Thus, the angiogenic factor gene does not have to be present in the
infected cell for
more than a few weeks to produce a therapeutic effect. Once the blood vessels
have
developed, continued expression of the exogenous angiogenic protein may not be
required
to maintain the new vascular structure and increased blood flow.
An advantage associated with non-dividing cells such as myocytes is that the
viral
vector is not readily "diluted out" by host cell division. However, if it is
necessary or
desirable to further enhance duration of transgene expression in the heart, it
is also possible
to employ various second generation adenovirus vectors that have both E1 and
E4
deletions, which can be used in conjunction with cyclophosphamide
administration (See,
to e.g., Dai et al., Proc. Natl. Acad. Sci. USA, 92: 1401-1405, 1995).
Human 293 cells (Accession No. ATCC CRL1573; Rockville, MD), which are
human embryonic kidney cells transformed with adenovirus ElA/E1B genes, typify
useful
permissive cell lines for the production of such replication-defective
vectors. However,
other cell lines which allow replication-defective adenovirus vectors to
propagate therein
can also be used, such as HeLa cells.
Construction of Recombinant Adenoviral Vector
Adenoviral vectors used in the present invention can be constructed by the
rescue
recombination technique described in Graham, Virology 163:614-617, 1988.
Briefly, the
transgene of interest is cloned into a shuttle vector that contains a
promoter, polylinker and
partial flanking adenoviral sequences from which ElA/E1B genes have been
deleted. As
the shuttle vector, plasmid pACl (Virology 163:614-617, 1988) (or an analog)
which
encodes portions of the left end of the human adenovirus 5 genome (Virology
163:614-
617, 1988) minus the early protein encoding ElA and El B sequences that are
essential for
2s viral replication, and plasmid ACCMVPLPA (Gomez-Foix et al., J. Biol. Chem.
267:
25129-25134, 1992) which contains polylinker, the CMV promoter and SV40
polyadenylation signal flanked by partial adenoviral sequences from which the
ElA/E1B
genes have been deleted can be exemplified. The use of plasmid pACl or
ACCMVPLA
facilitates the cloning process. The shuttle vector is then co-transfected
with a plasmid
3o which contains the entire human adenoviral 5 genome with a length too large
to be
encapsulated, into 293 cells. Co-transfection can be conducted by calcium
phosphate
precipitation or lipofection (Zhang et al., Biotechniques 15:868-872, 1993).
Plasmid JM17
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
encodes the entire human adenovirus S genome plus portions of the vector
pBR322
including the gene for ampicillin resistance (4.3 kb). Although JM 17 encodes
all of the
adenoviral proteins necessary to make mature viral particles, it is too large
to be
encapsulated (40 kb versus 36 kb for wild type). In a small subset of co-
transfected cells,
rescue recombination between the transgene containing the shuttle vector such
as plasmid
pACI and the plasmid having the entire adenoviral S genome such as plasmid
pJMl7
provides a recombinant genome that is deficient in the ElA/E1B sequences, and
that
contains the transgene of interest but secondarily loses the additional
sequence such as the
pBR322 sequences during recombination, thereby being small enough to be
encapsulated
l0 (see Figure 1 ). With respect to the above method, we have reported
successful results
(Giordano, et al. Circulation 88:1-139, 1993, and Giordano and Hammond, Clin.
Res.
42:123A, 1994). The CMV driven (J-galactosidase encoding adenovirus
HCMVSPIIacZ
(Clin Res 42:123A, 1994) can be used to evaluate efficiency of gene transfer
using X-gal
treatment.
Targeted Vector Constructs
Limiting expression of the angiogenic transgene to the heart, or to particular
cell
types within the heart (e.g. cardiac myocytes) or to other target tissues,
such as those in the
peripheral vasculature, can provide certain advantages as discussed below.
2o The present invention contemplates the use of targeting not only by
delivery of the
transgene into the coronary artery or other tissue-specific conduit, for
example, but also by
use of targeted vector constructs having features that tend to target gene
delivery and/or
gene expression to particular host cells or host cell types (e.g. cardiac or
other myocytes).
Such targeted vector constructs would thus include targeted delivery vectors
and/or
targeted vectors, as described in more detail below and in the published art.
Restricting
delivery and/or expression can be beneficial as a means of further focusing
the potential
effects of gene therapy. The potential usefulness of further restricting
delivery/expression
depends in large part on the type of vector being used and the method and
place of
introduction of such vector. As described herein, delivery of viral vectors
via
3o intracoronary injection to the myocardium has been observed to provide, in
itself, highly
targeted gene delivery (see the Examples below). In addition, using vectors
that generally
do not result in transgene integration into a replicon of the host cell (such
as adenovirus
36
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
and numerous other vectors), cardiac myocytes are expected to exhibit
relatively long
transgene expression since the cells do not generally replicate. In contrast,
expression in
rapidly dividing cells such as endothelial cells would tend to be decreased by
cell division
and turnover. However, other means of limiting delivery andlor expression can
also be
employed, in addition to or in place of the illustrated delivery methods, as
described herein.
Targeted delivery vectors include, for example, vectors (such as viruses, non-
viral
protein-based vectors and lipid-based vectors) having surface components (such
as a
member of a ligand-receptor pair, the other half of which is found on a host
cell to be
targeted) or other features that mediate preferential binding and/or gene
delivery to
particular host cells or host cell types. As is known in the art, a number of
vectors of both
viral and non-viral origin have inherent properties facilitating such
preferential binding
and/or have been modified to effect preferential targeting (see, e.g., Douglas
et al., Nat.
Biotech. 14:1574-1578, 1996; Kasahara, N. et al. Science 266:1373-1376, 1994;
Miller,
N., et al., FASEB Journal 9: 190-199, 1995; Chonn, A., et al., Curr. Opin. in
Biotech. 6:
698-708, 1995; Schofield, JP, et al., British Med. Bull. 51: 56-71, 1995;
Schreier, H,
Pharmaceutica Acta Helvetiae 68: 145-159, 1994; Ledley, F.D., Hum. Gene Ther.
6: 1129-
1144, 1995; Conary, J.T., et al., WO 95/34647 (21 December 1995); Overell,
R.W., et al.,
WO 95/28494 (26 October 1995); and Truong, V.L. et al., WO 96/00295 (4 January
1996)).
2o Targeted vectors include vectors (such as viruses, non-viral protein-based
vectors
and lipid-based vectors) in which delivery results in transgene expression
that is relatively
limited to particular host cells or host cell types. By way of illustration,
angiogenic
transgenes to be delivered according to the present invention can be operably
linked to
heterologous tissue-specific promoters thereby restricting expression to cells
in that
particular tissue.
For example, tissue-specific transcriptional control sequences derived from a
gene
encoding a cardiomyocyte-specific myosin light chain (MLC) or myosin heavy
chain
(MHC) promoter can be fused to a transgene such as an FGF gene within a vector
such as
the adenovirus constructs described above. Expression of the transgene can
therefore be
3o relatively restricted to cardiac myocytes. The efficacy of gene expression
and degree of
specificity provided by cardiomyocyte-specific MLC and MHC promoters with lacZ
have
been determined (using a recombinant adenovirus system such as that
exemplified herein);
37
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
and cardiac-specific expression has been reported (see, e.g., Lee et al., J.
Biol Chem
267:15875-15885,1992).
Since the MLC promoter can comprise as few as about 250 bp, it easily fits
within
even size-restricted delivery vectors such as the adenovirus-5 packaging
system
exemplified herein. The myosin heavy chain promoter, known to be a vigorous
promoter
of transcription, provides another alternative cardiac-specific promoter,
comprising less
than about 300 bp. While other promoters, such as the troponin-C promoter do
not provide
tissue specificity, they are small and highly efficacious.
1o Targeted Gene Expression
An unexpected finding of the present invention is that the recombinant
adenovirus
is taken up very efficiently in the first vascular bed that it encounters.
Indeed, in the
animal model of Example 4, the efficiency of the uptake of the virus in the
heart after
intracoronary injection, was 98%, i.e., 98% of the virus was removed in the
first pass of the
15 virus through the myocardial vascular bed. Furthermore, serum taken from
the animals
during the injection was incapable of growing viral plaques (Graham, Virology,
163:614-
617, 1988) until diluted 200-fold, suggesting the presence of a serum factor
(or binding
protein) that inhibits viral propagation. These two factors (efficient first
pass attachment of
virus and the possibility of a serum binding protein) may act together to
limit gene
2o expression to the first vascular bed encountered by the virus.
To further evaluate the extent to which gene transfer was limited to the heart
following intracoronary gene transfer, polymerase chain reaction (PCR) was
used to see
whether there was evidence for extracardiac presence of viral DNA two weeks
after gene
transfer in two treated animals (Example 4 below). Animals showed the presence
of viral
25 DNA in their hearts but not in their retinas, skeletal muscles, or livers.
The sensitivity of
the PCR is such that a single DNA sequence per 5,000,000 cells would be
detectable.
Therefore these data demonstrated that no viral DNA was present in
extracardiac tissues
two weeks after gene delivery. These results were further confirmed using
other
angiogenic proteins and derivatives as described below. These findings are
extremely
3o important because they confirm the concept of cardiac transgene targeting
(i.e. providing
expression of the transgene in the heart, but not elsewhere). The localized
transgene
38
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
delivery and expression provide the advantage of safety, further enhancing the
use of the
present methods in the treatment of patients.
Propagation and Purification of Adenovirus Vectors
Recombinant viral vectors, such as adenoviral vectors, can be plaque purified
according to standard methods. By way of illustration, the resulting
recombinant
adenoviral viral vectors can be propagated in human 293 cells (which provide
ElA and
E1B functions in traps) to titers in the preferred range of about 101°-
1012 viral particles/ml.
Propagation and purification techniques have been described for a variety of
viral vectors
l0 that can be used in conj unction with the present invention. Adenoviral
vectors are
exemplified herein but other viral vectors such as AAV can also be employed.
For
adenovirus, cells can be infected at 80% confluence and harvested 48 hours
later. After 3
freeze-thaw cycles of the infected cells, the cellular debris is pelleted by
centrifugation and
the virus purified by CsCI gradient ultracentrifugation (double CsCI gradient
ultracentrifugation is preferred). Prior to in vivo injection, the viral
stocks can be desalted
(e.g., by gel filtration through Sepharose columns such as Sephadex G25). The
desalted
viral stock can also be filtered through a 0.3 micron filter if desired. We
typically
concentrate and purify the viral stock by double CsCI ultracentrifugation,
followed by
chromatography on Sephadex G25 equilibrated with phosphate buffered saline
(PBS). The
2o resulting viral stock typically has a final viral titer that is at least
about 10'°-1012 viral
particles/ml.
Preferably, the recombinant adenovirus is highly purified and is substantially
free
of wild-type (potentially replicative) virus. For these reasons, propagation
and purification
can be conducted to exclude contaminants and wild-type virus by, for example,
identifying
successful recombinant virus with PCR using appropriate primers, conducting
two rounds
of plaque purification, and double CsCI gradient ultracentrifugation.
Delivery of Vectors Carrying an Angiogenic Transgene
The means and compositions which are used to deliver the vectors carrying
3o angiogenic protein transgenes depend on the particular vector employed as
is well known
in the art. Typically, however, a vector can be in the form of an injectable
preparation
containing a pharmaceutically acceptable carner/diluent such as phosphate
buffered saline,
39
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
for example. Other pharmaceutical carriers, formulations and dosages are
described
below.
The presently preferred means of in vivo delivery for heart disease
(especially for
vector constructs that are not otherwise targeted for delivery and/or
expression that is
restricted to the myocardium or other target tissue), is by injection of the
vector into a
blood vessel or other conduit directly supplying the myocardium or tissue,
preferably by
injection into one or both coronary arteries or other tissue-specific arteries
(or by a bolus
injection into peripheral tissue). By way of illustration, for delivery to the
myocardium,
such injection is preferably achieved by catheter introduced substantially
(typically at least
1o about 1 cm) within the lumen of one or both coronary arteries or one or
more saphenous
veins or internal mammary artery grafts or other conduits delivering blood to
the
myocardium. Preferably the injection is made in both left and right coronary
arteries to
provide general distribution to all areas of the heart (e.g., LAD, LCx and
Right). By
injecting an adenoviral vector preparation in accordance herewith, optionally
in
combination with a vasoactive agent to enhance gene delivery as described
herein, it is
possible to perform effective adenovirus-mediated angiogenic gene transfer for
the
treatment of cardiovascular disease, for example clinical myocardial ischemia,
or
peripheral vascular disease without any undesirable effects.
The vectors are delivered in an amount sufficient for the transgene to be
expressed
2o and to provide a therapeutic benefit. For viral vectors (such as
adenovirus), the final titer
of the virus in the injectable preparation is preferably in the range of about
10'-10'3 viral
particles which allows for effective gene transfer. An adenovirus vector stock
preferably
free of wild-type virus can be injected deeply into the lumen of one or both
coronary
arteries (or grafts), preferably into both right and left coronary arteries
(or grafts), and
preferably in an amount of about 109 - 10" viral particles as determined by
optical
densitometry. Preferably the vector is delivered in a single injection into
each conduit (e.g.
into each coronary artery).
To further augment the localized delivery of the gene therapy vector, and to
enhance gene delivery efficiency, in accordance with the present invention,
one can infuse
3o a vasoactive agent, preferably histamine or a histamine agonist or a
vascular endothelial
growth factor (VEGF) protein or a nitric oxide donor (e.g. sodium
nitroprusside), into the
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
tissue to be treated, either coincidently with or, preferably, within several
minutes before,
introduction of the angiogenic gene therapy vector.
By injecting the vector composition directly into the lumen of the coronary
artery
by coronary catheters, it is possible to target the gene rather effectively,
and to minimize
loss of the recombinant vectors to the proximal aorta during injection. This
type of
injection enables local transfection of a desired number of cells, especially
cardiac
myocytes, in the affected myocardium with angiogenic protein- or peptide-
encoding genes,
thereby maximizing therapeutic efficacy of gene transfer, and minimizing
undesirable
angiogenesis at extracardiac sites. For delivery to diseased tissues supplied
by peripheral
1o vasculature, the vector can be introduced into one or more arteries
supplying such tissue, or
as a bolus injection into the tissue.
Vector constructs that are specifically targeted to the myocardium, such as
vectors
incorporating myocardial-specific binding or uptake components, and/or which
incorporate
angiogenic protein transgenes that are under the control of myocardial-
specific
transcriptional regulatory sequences (e.g., cardiomyocyte-specific promoters)
can be used
in place of or, preferably, in conjunction with such directed injection
techniques as a means
of further restricting expression to the myocardium, (e.g. the ventricular
myocytes). For
vectors that can elicit an immune response, it is preferable to inject the
vector directly into
a blood vessel supplying the myocardium as described above, although the
additional
2o techniques for restricting the extracardiac delivery or otherwise reducing
the potential for
an immune response can also be employed. Vectors targeted to tissues supplied
by the
peripheral vasculature, such as vectors targeted to skeletal muscle or
promoters specifically
expressed in skeletal muscle, can likewise be employed.
As described in detail below, it was demonstrated that using techniques of the
present invention for in vivo delivery of a viral vector containing an
angiogenic transgene,
transgene expression did not occur in hepatocytes and viral RNA could not be
found in the
urine at any time after intracoronary injection. In addition, no evidence of
extracardiac
gene expression in the eye, liver, or skeletal muscle could be detected by PCR
two weeks
after intracoronary delivery of transgenes in this manner.
3o A variety of catheters and delivery routes can be used to achieve
intracoronary
delivery, as is known in the art (see, e.g., the references cited above,
including: Topol, EJ
(ed.), The Textbook of Interventional Cardiology, 2nd Ed. ( W.B. Saunders Co.
1994);
41
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Rutherford, RB, Vascular Surgery, 3rd Ed. (W.B. Saunders Co. 1989); Wyngaarden
JB et
al. (eds.), The Cecil Textbook of Medicine, 19th Ed. (W.B. Saunders, 1992);
and Sabiston,
D, The Textbook of Surgery, 14th Ed. (W.B. Saunders Co. 1991)). Direct
intracoronary
(or graft vessel) injection can be performed using standard percutaneous
catheter based
methods under fluoroscopic guidance. Any variety of coronary catheter, or a
Stack
perfusion catheter, for example, can be used in the present invention. For
example, a
variety of general purpose catheters, as well as modified catheters, suitable
for use in the
present invention are available from commercial suppliers such as Advanced
Cardiovascular Systems (ACS), Target Therapeutics, Boston Scientific and
Cordis. Also,
1o where delivery to the myocardium is achieved by injection directly into a
coronary artery
(which is presently most preferred), a number of approaches can be used to
introduce a
catheter into the coronary artery, as is known in the art. By way of
illustration, a catheter
can be conveniently introduced into a femoral artery and threaded retrograde
through the
iliac artery and abdominal aorta and into a coronary artery. Alternatively, a
catheter can be
first introduced into a brachial or carotid artery and threaded retrograde to
a coronary
artery. The capillary bed of the myocardium can also be reached by retrograde
perfusion,
e.g., from a catheter placed in the coronary sinus. Such a catheter may also
employ a
proximal balloon to prevent or reduce anterograde flow as a means of
facilitating
retrograde perfusion. For delivery to tissues supplied by the peripheral
vasculature,
2o catheters can be introduced into arteries supplying such tissues (e.g.,
femoral arteries in the
case of the leg) or may be introduced, by example, as a bolus injection or
infusion into the
affected tissue.
Various combinations of vectors comprising angiogenic genes and catheters or
other in vivo delivery devices (e.g., other devices capable of introducing a
pharmaceutical
composition, generally in buffered solution, into a blood vessel or into
muscle) can be
incorporated into kits for use in accordance with the present invention. Such
kits may also
incorporate one or more vasoactive agents to enhance gene delivery, and may
further
include instructions describing their use in accordance with any of the
methods described
herein.
42
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Animal Models
Important prerequisites for successful studies of cardiovascular gene therapy
are (1)
constitution of an animal model that is applicable to clinical cardiovascular
disease that can
provide useful data regarding mechanisms for increased blood flow and/or
contractile
function, and (2) accurate evaluation of the effects of gene transfer. From
this point of
view, none of the earlier techniques are satisfactory. Thus, we have made use
of porcine
models that fulfill these prerequisites. The pig is a particularly suitable
model for studying
heart diseases of humans because of its relevance to human physiology. The pig
heart
closely resembles the human heart in the following ways. The pig has a native
coronary
circulation very similar to that of humans, including the relative lack of
native coronary
collateral vessels. Secondly, the size of the pig heart, as a percentage of
total body weight,
is similar to that of the human heart. Additionally, the pig is a large animal
model,
therefore allowing more accurate extrapolation of various parameters such as
effective
vector dosages, toxicity, etc. In contrast, the hearts of animals such as dogs
and members
of the murine family have a lot of endogenous collateral vessels.
Additionally, relative to
total body weight, the size of the dog heart is twice that of the human heart.
An animal model described herein in Example 5 is exemplary of myocardial
ischemia. (Since, myocardial ischemia can also result in and/or occur in
connection with
congestive heart failure, this particular model is further relevant to that
situation.) Using
2o this model, it was demonstrated that vector-mediated delivery of a gene
encoding an
angiogenic protein alleviated myocardial ischemia and enhanced blood flow in
the
ischemic region. Collateral vessel development was likewise increased. By way
of
illustration, we have successfully demonstrated these gene transfer techniques
with several
different angiogenic proteins, including both native forms and muteins (as
described in
detail in the Examples below).
In this model, which mimics clinical coronary artery disease, placement of an
ameroid constrictor around the left circumflex (LCx) coronary artery results
in gradually
complete closure (within 7 days of placement) with minimal infarction (1% of
the left
ventricle, 4 ~ 1 % of the LCx bed) (Roth, et al., Circulation. 82:1778, 1990;
Roth, et al.,
3o Am. J. Physiol., 235:1-11279, 1987; White, et al., Circ. Res., 71:1490,
1992; Hammond,
et al., Cardiol., 23:475, 1994; and Hammond, et al., J. Clin. Invest.,
92:2644, 1993).
Myocardial function and blood flow are normal at rest in the region previously
perfused by
43
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
the occluded artery (referred to as the ischemic region), but blood flow
reserve is
insufficient to prevent ischemia when myocardial oxygen demands increase, due
to limited
endogenous collateral vessel development. Thus, the LCx bed is subject to
episodic
ischemia, analogous to clinical angina pectoris. Collateral vessel development
and flow-
s function relationships are stable within 21 days of ameroid placement, and
remain stable
for four months (Roth, et al., Circulation, 82:1778, 1990; Roth, et al., Am.
J. Physiol.,
235:H1279, 1987; White, et al., Circ. Res., 71:1490, 1992). It has been shown
by
telemetry that animals have periodic ischemic dysfunction in the bed at risk,
throughout the
day, related to abrupt increases in heart rate during feeding, interruptions
by personnel, etc.
1o Thus, the model has a bed with stable but inadequate collateral vessels,
and is subject to
periodic ischemia. Another distinct advantage of the model is that there is a
normally
perfused and functioning region (the LAD bed) adjacent to an abnormally
perfused and
dysfunctioning region (the LCx bed), thereby offering a control bed within
each animal.
Myocardial contrast echocardiography was used to estimate regional myocardial
15 perfusion. The contrast material is composed of microaggregates of
galactose and
increases the echogenicity (whiteness) of the image. The microaggregates
distribute into
the coronary arteries and myocardial walls in a manner that is proportional to
blood flow
(Skyba, et al., Circulation, 90:1513-1521, 1994). It has been shown that peak
intensity of
contrast is closely correlated with myocardial blood flow as measured by
microspheres
20 (Skyba, et al., Circulation, 90:1513-1521, 1994). To document that the
echocardiographic
images employed in the present invention were accurately identifying the LCx
bed, and
that myocardial contrast echocardiography could be used to evaluate myocardial
blood
flow, a hydraulic cuff occluder was placed around the proximal LCx adjacent to
the
ameroid.
25 In certain aspects of the present study, when animals were sacrificed, the
hearts
were perfusion-fixed (glutaraldehyde, physiological pressures, in situ) in
order to quantitate
capillary growth by microscopy. PCR was used to detect angiogenic protein DNA
and
mRNA in myocardium from animals that had received gene transfer. As described
below,
two weeks after gene transfer, myocardial samples from lacZ-transduced animals
showed
3o substantial beta-galactosidase activity on histological inspection.
Finally, using a
polyclonal antibody to an angiogenic protein, angiogenic protein expression in
cells and
myocardium from animals that had received gene transfer was demonstrated.
44
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
With respect to demonstrating improved blood flow, various techniques are
known
to those of skill in the art. For example, myocardial blood flow can be
determined by the
radioactive microsphere technique as described in Roth, DM, et al., Am. J.
Physiol.
253:H1279-H1288, 1987 or Roth, DM, et al., Circulation 82:1778-1789, 1990.
Myocardial blood flow can also be quantitated, e.g., by thallium imaging,
which involves
perfusing the heart with the radionuclide thallium as described by Braunwald
in Heart
Disease, 4'" ed., pp. 276-311 (Saunders, Philadelphia, 1992). The cells in the
heart have an
avidity for thallium. Uptake of thallium is positively correlated with blood
flow. Thus,
reduced uptake indicates reduced blood flow as occurs in ischemic conditions
in which
to there is a perfusion deficit. In a conscious individual, angiogenic
activity can be readily
evaluated by contrast echocardiography such as described in Examples 1 and 5
and in
Sahn, DJ, et al., Circulation. 58:1072-1083, 1978. Improved myocardial
function can be
determined by measuring wall thickening such as by transthoracic
echocardiography.
The strategy for therapeutic studies included the timing of transgene
delivery, the
means and route of administration of the transgene, and choice of the
angiogenic gene. In
the ameroid model of myocardial ischemia, gene transfer was performed after
stable but
insufficient collateral vessels had developed. Previous studies using the
ameroid model
had involved delivery of angiogenic peptides during the closure of the
ameroid, prior to the
development of ischemia and collateral vessels. However, that approach was not
2o employed for several reasons. First, such studies are not suitable for
closely duplicating
the conditions that would be present in the treatment of clinical myocardial
ischemia in
which gene transfer would be given in the setting of ongoing myocardial
ischemia;
previous studies are analogous to providing the peptide in anticipation of
ischemia, and are
therefore less relevant. Second, it was presumed, based upon previous studies
in cell
culture, that an ischemic stimulus in conjunction with the angiogenic peptide
would be the
optimal milieu for the stimulation of angiogenesis. This could optimally be
achieved by
delivery of the transgene at a time when heart disease was already present.
Linked to these
decisions was the selection of the method to achieve transgene delivery. The
constraint
that the technique should be applicable for the subsequent treatment of
patients with
3o coronary disease made several approaches untenable (continuous infusion of
a peptide into
the coronary artery, direct plasmid injection into the heart, coating the
heart with a resin
containing the peptide to provide long-term slow release). Finally, the pig
model provided
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
an excellent means to follow regional blood flow and function before and after
gene
delivery. The use of control animals that received the same vector (e.g., a
recombinant
adenovirus), but with a reporter gene, provide a control for these studies.
The pig has a
native coronary circulation very similar of that of humans, including the
relative lack of
native coronary collateral vessels. The pig model also provided an excellent
means to
follow regional blood flow and function before and after gene delivery. The
use of control
animals that received the same recombinant adenovirus construct but with a
reporter gene
provided a control for these studies. Based on the foregoing, and previous
published
studies, those skilled in the art will appreciate that the results described
below in pigs are
1o expected to be predictive of results in humans.
With respect to peripheral vascular disease, delivery of angiogenic genes into
the
peripheral vasculature using gene therapy vectors of the present invention can
be examined
using, for example, a hind limb ligation model of peripheral ischemia. See,
e.g., the
femoral artery ligation model described by R.L. Terjung and colleagues (see,
for example,
Yang, et al., Circ. Res., 79(1):62-9, 1996). As with delivery of angiogenic
genes to
ischemic myocardium, the delivery of angiogenic genes according to the present
invention
to the peripheral vasculature and/or associated muscle can be used to overcome
effects of
peripheral vascular disease.
Another animal model, described herein in Example 1, induces dilated
2o cardiomyopathy such as that observed in clinical congestive heart failure.
In this model,
continuous rapid ventricular pacing over a period of 3 to 4 weeks induces
heart failure
which shows similarities with many features of clinical heart failure,
including left
ventricular dilation with impaired systolic function analogous to regional
functional
abnormalities seen in heart failure (including those associated with severe
coronary artery
disease and with non-CAD DCM, such as >DCM). Other animal models of congestive
heart failure include the induction of chronic ventricular dysfunction via
intracoronary
delivery of microspheres (see e.g. Lavine et al., J Am Coll. Cardiol. 18: 1794-
1803 (1991);
Blaustein et al., Am. J. Cardio. Path. 5: 32-48 (1994); Sabbah et al. Am. J.
Phi. 260:
H1379-H1384 (1991)). As an additional example of ventricular dysfunction,
occlusion of
3o the left coronary artery in a rat model can induce infarcts and the animals
can then be
studied and treated over subsequent days or weeks (see e.g. Pfeffer et al.,
Circ. Res. 44:
503-512, 1979; Pfeffer et al., Am. J. Physiol. 260: H1406-1414, 1991).
46
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Thus, these models can be used to determine whether delivery of a vector
construct
coding for an angiogenic peptide or protein is effective to alleviate the
cardiac dysfunctions
associated with these conditions. These models are particularly useful in
providing some
of the parameters by which to assess the effectiveness of in vivo gene therapy
for the
treatment of congestive heart failure and ventricular remodeling.
Therapeutic Applications
The vectors of the present invention (such as the replication-deficient
adenovirus)
allow for highly efficient gene transfer in vivo without significant necrosis
or
1o inflammation. Based on these results, some of which are described in detail
in the
Examples below, it is seen that a sufficient degree of in vivo gene transfer
to effect in vivo
functional changes is achieved. The gene transfer of an angiogenic protein,
either alone or
in combination with another muscle enhancing protein or peptide, will improve
blood flow
and enhance muscle function in the treated muscle. Furthermore, if desired, a
vasoactive
15 agent can be employed in conjunction with these methods and compositions,
as described
herein, in order to further enhance gene delivery at the target site. Since a
vasoactive
agent, (such as histamine, a histamine agonist, a nitric oxide donor, or a
VEGF protein) can
be used to increase the efficiency of gene transfer at a gene vector dose, the
inclusion of
such an agent can be employed to limit the amount of vector required to be
administered in
20 order to achieve a given therapeutic effect.
In one aspect, the vectors and methods of the present invention can be
employed to
treat dilated cardiomyopathy (DCM), a type of heart failure that is typically
diagnosed by
the finding of a dilated, hypocontractile left and/or right ventricle. As
discussed above,
DCM can occur in the absence of other characteristic forms of cardiac disease
such as
25 coronary occlusion or a history of myocardial infarction. DCM is associated
with poor
ventricular function and symptoms of heart failure. In these patients, chamber
dilation and
wall thinning generally results in a high left ventricular wall tension. Many
patients exhibit
symptoms even under mild exertion or at rest, and are thus characterized as
exhibiting
severe, i.e. "Type-III" or "Type-IV", heart failure, respectively (see, e.g.,
NYHA
3o classification of heart failure). As noted above, many patients with
coronary artery disease
may progress to exhibiting dilated cardiomyopathy, often as a result of one or
more heart
attacks (myocardial infarctions).
47
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
A further application of the present invention is to prevent, or at least
lessen
deleterious left ventricular remodeling (a.k.a., deleterious remodeling, for
short), which
refers to chamber dilation after myocardial infarction that can progress to
severe heart
failure. Even if ventricular remodeling has already initiated, it is still
desirable to promote
an increase in blood flow, as this can still be effective to offset
ventricular dysfunction.
Similarly, promotion of angiogenesis can be useful, since the development of a
microvascular bed can also be effective to offset ventricular dysfunction.
Further, such
angiogenic proteins or peptides can also have other enhancing effects. In a
patient who has
suffered a myocardial infarction, deleterious ventricular remodeling is
prevented if the
1o patient lacks chamber dilation and if symptoms of heart failure do not
develop.
Deleterious ventricular remodeling is alleviated if there is any observable or
measurable
reduction in an existing symptom of the heart failure. For example, the
patient may show
less breathlessness and improved exercise tolerance. Methods of assessing
improvement
in heart function and reduction of symptoms are essentially analogous to those
described
above for DCM. Prevention or alleviation of deleterious ventricular remodeling
as a result
of improved collateral blood flow and ventricular function and/or other
mechanisms is
expected to be achieved within weeks after in vivo angiogenic gene transfer in
the patient
using methods as described herein.
In one example, the present method of in vivo transfer of a transgene encoding
an
2o angiogenic protein is used to demonstrate that gene transfer of a
recombinant adenovirus
expressing an angiogenic protein or peptide is effective in substantially
reducing
myocardial ischemia. In another example, the present method of in vivo
transfer of a
transgene encoding an angiogenic protein is used to treat conditions
associated with
congestive heart failure.
As the data below shows, expression of an exogenously-provided angiogenic
transgene results in increased blood flow and/or function in the heart (or
other target
tissue). This increased blood flow and/or function will lessen one or more
symptoms of the
cardiovascular disease affecting the target tissues.
As described herein, a number of different vectors can be employed to deliver
the
3o angiogenic protein transgenes in vivo according to the methods of the
present invention.
By way of illustration, the replication-deficient recombinant adenovirus
vectors
48
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
exemplified herein achieved highly efficient gene transfer in vivo without
cytopathic effect
or inflammation in the areas of gene expression.
In treating angina, as may be associated with CAD, gene transfer of an
angiogenic
protein encoding a transgene can be conducted at any time, but preferably is
performed
relatively soon after the onset of severe angina. In treating most congestive
heart failure,
gene transfer of an angiogenic protein encoding transgene can be conducted,
for example,
when development of heart failure is likely or heart failure has been
diagnosed. For
treating ventricular remodeling, gene transfer can be performed any time after
the patient
has suffered an infarct, preferably within 30 days and even more preferably
within 7-20
to days after an infarct.
As noted above, beta-adrenergic signaling proteins (beta-ASPS) (including beta-
adrenergic receptors (beta-ARs), G-protein receptor kinase inhibitors (GRK
inhibitors) and
adenylylcyclases (ACs)) can also be employed to enhance cardiac function as
described
and illustrated in detail in U.S. patent application Serial No. 08/924,757,
filed OS
September 1997 (based on U.S. 60/048,933 filed 16 June 1997 and U.S.
08/708,661 filed
OS September 1996), as well as PCT/US97/15610 filed OS September 1997, and
U.S.
continuing case Serial No. 09/008,097, filed 16 January 1998, and U.S.
continuing case
Serial No. 09/472,667, filed 27 December 1999, each of which is incorporated
by reference
herein.
Compositions or products of the invention may conveniently be provided in the
form of formulations suitable for administration to a patient, into the blood
stream (e.g. by
intra-arterial injection or as a bolus infusion into tissue such as the
skeletal muscle). A
suitable administration format may best be determined by a medical
practitioner. Suitable
pharmaceutically acceptable Garners and their formulation are described in
standard
formulations treatises, e.g., Remington's Pharmaceuticals Sciences by E.W.
Martin. See
also Wang, Y.J. and Hanson, M.A., "Parental Formulations of Proteins and
Peptides:
Stability and Stabilizers", .lournals of Parental Sciences and Technology,
Technical Report
No. 10, Supp. 42:25 (1988). Vectors of the present invention should preferably
be
formulated in solution at neutral pH, for example, about pH 6.5 to about pH
8.5, more
preferably from about pH 7 to 8, with an excipient to bring the solution to
about
isotonicity, for example, 4.5% mannitol or 0.9% sodium chloride, pH buffered
with art-
known buffer solutions, such as sodium phosphate, that are generally regarded
as safe,
49
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
together with an accepted preservative such as metacresol 0.1 % to 0.75%, more
preferably
from 0.15% to 0.4% metacresol. The desired isotonicity may be accomplished
using
sodium chloride or other pharmaceutically acceptable agents such as dextrose,
boric acid,
sodium tartrate, propylene glycol, polyols (such as mannitol and sorbitol), or
other
inorganic or organic solutes. Sodium chloride is preferred particularly for
buffers
containing sodium ions. If desired, solutions of the above compositions also
can be
prepared to enhance shelf life and stability. The therapeutically useful
compositions of the
invention are prepared by mixing the ingredients following generally accepted
procedures.
For example, the selected components may be mixed to produce a concentrated
mixture
1o which may then be adjusted to the final concentration and viscosity by the
addition of
water and/or a buffer to control pH or an additional solute to control
tonicity.
For use by the physician, the compositions will be provided in dosage form
containing an amount of a vector of the invention which will be effective in
one or
multiple doses in order to provide a therapeutic effect. As will be recognized
by those in
the field, an effective amount of therapeutic agent will vary with many
factors including
the age and weight of the patient, the patient's physical condition, and the
level of
angiogenesis and/or other effect to be obtained, and other factors.
The effective dose of the viral vectors of this invention will typically be in
the
range of about 10' - 103 viral particles, preferably about 109 - 101 viral
particles. As
2o noted, the exact dose to be administered is determined by the attending
clinician, but is
preferably in 5 ml or less of physiologically buffered solution (such as
phosphate buffered
saline), more preferably in 1-3 ml.
The preferred mode of administration is by injection into one or more
localized
sites (e.g., one or both coronary arteries, in the case of heart diseases)
using a suitable
catheter or other in vivo delivery device.
The following Examples are provided to further assist those of ordinary skill
in the
art. Such examples are intended to be illustrative and therefore should not be
regarded as
limiting the invention. A number of exemplary modifications and variations are
described
in this application and others will become apparent to those of skill in this
art. Such
3o variations are considered to fall within the scope of the invention as
described and claimed
herein.
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
EXAMPLES
EXAMPLE I: PORCINE MODEL OF CONGESTIVE HEART FAILURE AND ASSOCIATED
MYOCARDIAL ISCHEMIA
1-A. Animals and Surgical Procedure
Nine Yorkshire pigs (Sus scrofa) weighing 406 kg were anesthetized with
ketamine (50 mg/kg IM) and atropine sulfate (0.1 mg/kg IM) followed by sodium
amytal
(100 mg/kg IV). After endotracheal intubation, halothane (0.5% to 1.5%) was
delivered by
a pressure-cycled ventilator throughout the procedure. At left thoracotomy,
catheters were
to placed in the aorta, pulmonary artery, and left atrium. A Konigsberg
micromanometer was
placed into the left ventricular apex, and an epicardial unipolar lead was
placed 1.0 cm
below the atrioventricular groove in the lateral wall of the left ventricle.
The power
generator (Spectrax 5985; Medtronic, Inc.) was inserted into a subcutaneous
pocket in the
abdomen. Four animals were instrumented with a flow probe (Transonic, Inc.)
around the
main pulmonary artery. The pericardium was loosely approximated and the chest
closed.
Seven to 10 days after thoracotomy, baseline measures of hemodynamics, left
ventricular
function, and myocardial blood flow were made. Ventricular pacing then was
initiated
(22019 bpm (beats per minute) for 264 days). The stimulus amplitude was 2.5 V,
the
pulse duration 0.5 ms. Nine additional pigs (407 kg) were used as controls;
five
underwent thoracotomy and instrumentation without pacing and were killed 307
days
after initial thoracotomy. Data regarding right and left ventricular mass were
similar in the
control animals whether they had undergone thoracotomy or not, so their data
were pooled
into a single control group.
1-B. Hemodynamic Studies
Hemodynamic data were obtained from conscious, unsedated animals after the
pacemaker had been inactivated for at least 1 hour and animals were in a basal
state. All
data were obtained in each animal at 7-day intervals. Pressures were obtained
from the left
atrium, pulmonary artery, and aorta. Left ventricular dP/dt was obtained from
the high-
3o fidelity left ventricular pressure. Pulmonary artery flow was recorded.
Aortic and
pulmonary blood samples were obtained for calculation of arteriovenous oxygen
content
difference.
51
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
1-C. Echocardiographic Studies
Echocardiography is a method of measuring regional myocardial blood flow which
involves injection of a contrast material into the individual or animal.
Contrast material
(microaggregates of galactose) increase the echogenicity ("whiteness") of the
image after
left atrial injection. The microaggregates distribute into the coronary
arteries and
myocardial walls in a manner that is proportional to blood flow (Skyba, et
al., Circulation,
90:1513-1521, 1994). The peak intensity of contrast enhancement is correlated
with
myocardial blood flow as measured by microspheres (Skyba, et al., Circulation,
90:1513-
io 1521, 1994).
Two-dimensional and M-mode images were obtained with a Hewlett Packard
Sonos 1500 imaging system. Images were obtained from a right parasternal
approach at
the mid-papillary muscle level and recorded on VHS tape. Measurements were
made
according to criteria of the American Society of Echocardiography (Satin, DJ,
et al.,
~5 Circulation. 58:1072-1083, 1978). Because of the midline orientation of the
porcine
interventricular septum (1VS) and use of the right parasternal view, short-
axis M-mode
measures were made through the IVS and the anatomic lateral wall. All
parameters,
including end-diastolic dimension (EDD), end-systolic dimension (ESD), and
wall
thickness, were measured on at least five random end-expiratory beats and
averaged. End-
2o diastolic dimension was obtained at the onset of the QRS complex. End-
systolic
dimension was taken at the instant of maximum lateral position of the NS or at
the end of
the T wave. Left ventricular systolic function was assessed by use of
fractional shortening,
FS=[(EDD-ESD)/EDD]x100. Percent wall thickening (%WTh) was calculated as
%WTh=[(ESWTh-EDWTh)/EDWTh]x100. To demonstrate reproducibility of
25 echocardiographic measurements, animals were imaged on 2 consecutive days
before the
pacing protocol was initiated. The data from the separate determinations were
highly
reproducible (fractional shortening, RZ=.94, P=.006; lateral wall thickening,
RZ=.90,
P=.005). All of these measurements were obtained with pacemakers inactivated.
52
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
1-D. Myocardial Blood Flow
Myocardial blood flow was determined by the radioactive microsphere technique
as
described in detail in previously (Roth, DM, et al., Am. J. Ph,~iol. 253:H1279-
H1288,
1987; Roth, DM, et al., Circulation 82:1778-1789, 1990). Transmural samples
from the
left ventricular lateral wall and IVS were divided into endocardial, midwall,
and epicardial
thirds, and blood flow to each third and transmural flow were determined.
Transmural
sections were taken from regions in which echocardiographic measures had been
made so
that blood flow and functional measurements corresponded within each bed.
Microspheres
were injected in the control state (unpaced), at the initiation of ventricular
pacing (225
to bpm), and then at 7-day intervals during ventricular pacing at 225 bpm;
microspheres were
also injected with the pacemakers inactivated at 14 days (n=4) and 21 to 28
days (n=3).
Myocardial blood flow per beat was calculated by dividing myocardial blood
flow by the
heart rate (recorded during microsphere injection) (Indolfi, C., et al.,
Circulation 80:933-
993, 1989). Mean left atrial arid mean arterial pressures were recorded during
microsphere
injection so that an estimate of coronary vascular resistance could be
calculated; coronary
vascular resistance index equals mean arterial pressure minus mean left atrial
pressure
divided by transmural coronary blood flow.
1-E. Systolic Wall Stress
Circumferential systolic wall stress could not be determined because we could
not
obtain a suitable view to estimate the long axis of the left ventricle.
Therefore, we
calculated meridional end-systolic wall stress (Riechek, N., et al.,
Circulation 65:99-108,
1982) using the equation meridional end-systolic wall stress (dynes) _
(0.334xPxD)-[h(I-
h/D)], where P is left ventricular end-systolic pressure in dynes, D is left
ventricular end-
systolic diameter in cm, and h is end-systolic wall thickness. Meridional end-
systolic wall
stress was calculated for both lateral wall and IVS before the initiation of
pacing and
subsequently at weekly intervals (pacemaker off).
1-F. Terminal Surgery
3o After 262 days of continuous pacing, animals were anesthetized and
intubated,
and midline sternotomies were made. The still-beating hearts were submerged in
saline
(4°C), the coronary arteries were rapidly perfused with saline
(4°C), the right ventricle and
53
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
left ventricle (including NS) were weighed, and transmural samples from each
region
were rapidly frozen in liquid nitrogen and stored at a temperature of -
70°C.
1-G. Adenine Nucleotides
ATP and ADP were measured in transmural samples of the NS and lateral wall in
four animals with heart failure (paced 28 days) and four control animals. The
samples
from the animals with heart failure were obtained with the pacemakers off (60
minutes) on
the day the animals were killed. Samples were obtained identically in all
animals. ATP
and ADP were measured in a Waters high-performance liquid chromatograph as
previously
described (Pilz, R.B., et al., J. Biol. Chem. 259:2927-2935, 1984).
1-H. Statistical Analysis
Data are expressed as mean ~ standard deviation (SD). Specific measurements
obtained in the control (prepaced) state and at 1-week intervals during pacing
were
compared by repeated measures ANOVA (Crunch4, Crunch Software Corp.). In some
comparisons (lateral wall versus NS, for example), two-way ANOVA was used.
Post hoc
comparisons were performed with the "Tukey method" as described in the art.
Nine
animals survived 21 days of pacing; six of these survived 28 days of pacing.
Data from
animals surviving 28 days were statistically indistinguishable from those who
survived
only 21 days. ANOVA was conducted, therefore, on nine animals at four time
points:
control (prepacing), 7 days, 14 days, and 21 to 28 days. The null hypothesis
was rejected
when P<.OS (two-tailed).
Results
1-I. Hemodynamic Studies
Rapid ventricular pacing resulted in changes in hemodynamics that were
significant
after 7 to 14 days of pacing. At 7 days, animals had increased mean left
atrial and
pulmonary arterial pressures. These pressures became increasingly abnormal
with
additional weeks of pacing (Table 1 ). Signs of circulatory congestion
(tachypnea, ascites,
3o and tachycardia) were evident by 14 to 21 days. Pulmonary arterial flow
(cardiac output)
had decreased by 21 days of pacing (control, 3.30.1 L/min; 21 days, 1.90.4
L/min;
P<.OS).
54
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Table 1. HEMODYNAMICS AND LEFT VENTRICULAR FUNCTION
n Control7d 14d 21-28d p
HR (bpm) 9 122 136 15 149 13b 157 15~'g .0004
16
MAP (mm Hg) 9 10318 996 987 10214 .52
PA (mm Hg) 7 247 37~4b 42t9~ 48~8~'g'' .0001
LA (mm Hg) 8 133 255' 3017 36~6~'e .0001
AVOzD(ml/dl) 7 3.61.1 3.50.9 5.211.5 6.2~1.Sb'h.0005
EDD (cm) 9 3.90.4 4.410.5 4.90.6 5.8t0.6~'f''.0001
FS (%) 9 393 265' 18~6~'e 1314'' .0001
LV dP/dt (mm 4 284927 240846 1847~381~'d1072123'e''.0001
Hg/s)
8 0
Analysis of variance (repeated measures) was used to determine whether
duration
of pacing affected a specific variable; p-values from ANOVA are listed in the
rightward
column. Post hoc testing was performed by the Tukey method: ap<0.05; by<0.01;
°p<0.001
(versus control value for the same variable); dp<0.05; ep<0.01; fp,0.001 (vs.
previous
week); &p<0.05; hp<0.01;'p<0.001 (vs. 7d value); post-hoc testing by Tukey
method.
Measurements were made with pacemakers inactivated and represent mean LSD. 7d:
7
1o days of pacing; 14d: 14 days of pacing; 21-28d: 21-28 days of pacing.
1-J. Global Left Ventricular Function
Left ventricular function was assessed by echocardiography and hemodynamic
variables after pacemakers had been inactivated. Fractional shortening was
progressively
reduced with duration of pacing (P=.0001; Table 1), reaching its lowest value
at 21 to 28
days (control, 3913%; 21 to 28 days 1314%; P<.0002). Left ventricular end-
diastolic
dimension progressively increased during pacing (P<.0001; Table 1 ), reaching
its maximal
value at 21 to 28 days (control, 3.90.4 cm; 21 to 28 days, 5.80.6 cm;
P=.0002). Left
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
ventricular peak positive dP/dt also decreased throughout the study (P=.0001;
Table 1).
The progressive fall in peak dP/dt was accompanied by increasing left
ventricular end-
diastolic pressure, documenting decreased left ventricular contractility,
since increased
preload normally augments left ventricular peak dP/dt. (Mahler, F., et al.,
Am. J. Cardiol.
35:626-634, 1975)
1-K. Left Ventricular Regional Function
With the pacemaker inactivated, regional left ventricular function was
assessed by
measurement of percent wall thickening of the left ventricular lateral wall
and NS.
Ventricular pacing from the lateral wall caused significant deterioration in
function of the
lateral wall compared with the NS (P=.001; Fig 1 and Table 2). This difference
was
significant at 7 days and increased further at 21 to 28 days as lateral wall
function
deteriorated. The NS showed an insignificant decrease in wall thickening over
the course
of the study. End-diastolic wall thickness showed progressive thinning during
the study
that was more severe in the lateral wall (Table 2).
Table 2. SEQUENTIAL LEFT VENTRICULAR WALL THICKENING
CONTROL 7d 14d 21-28d p(ANOVA)
NS EDTh (cm) .8~.1 .7~.1 .7~.1 .6~.1 time: .0001
LAT EDTh (cm).8t.1 .7t.1 .6~.1 .5~.1 region: .039
p (NS vs. ns ns ns ns inter: .027
LAT)
NS WTh (%) 3314 335 283 286 time: .0001
LAT WTh (%) 355 2514 198 146 region: .001
p (NS vs. ns .02 .007 .0001 inter: .0001
LAT)
Two-way analysis of variance (repeated measures) was used to determine whether
end-diastolic wall thickness (EDTh) or % wall thickening (WTh) was affected by
duration
of pacing (time), or region (lateral wall, LAT; or interventricular septum,
NS), or whether
56
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
the change in EDTh or WTh% was different between the two regions (inter). Mean
values
for EDTh and WTh% at each time point were tested for differences between the
two
regions post-hoc by Tukey analyses. Values represent mean LSD. 7d: Seven days
of
pacing; 14d: 14 days of pacing; 21-28d: 21-28 days of pacing. n=9.
1-L. Left Ventricular Regional Blood Flow
Subendocardial blood flow per minute increased more in the NS than in the
lateral
wall when pacing was initiated (Fig 2 and Table 3). This difference in
regional blood flow
during pacing persisted for the duration of the study, and the pattern of
change in blood
l0 flow was different between the two regions (P=.006). The pattern of change
in blood flow
per minute between the two regions during pacing was consistent whether
measured in
endocardial (P=.006), midwall (P=.002), epicardial (P=.016), or transmural
(P=.003)
sections (Table 3). In contrast, when the pacemaker was inactivated,
subendocardial blood
flow showed no regional differences whether measured in the control state, at
14 days, or
at 21 to 28 days (Fig 2 and Table 3).
57
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Table 3. SEQUENTIAL MYOCARDIAL BLOOD FLOW
DAY 0 DAY 14 DAY 21-28
OFF ON OFF ON OFF ON P(ANOVA
IVS ENDO 1.41.2 1.96.38 1.68.22 2.35.4 1.88.1 2.67.3 time: .0001
(ml/min/g) 6 6 8 9
LAT 1.40.3 1.11.14 1.501.35 1.65.2 1.73.0 2.05.1 region:.017
ENDO 3 5 5 6
(ml/min/g)
p (IVS vs. Ns .001 ns .002 ns .006 inter: .006
LAT)
NS M>D 1.561.2 2.111.33 1.84.29 2.48.3 2.04.0 2.98.4 time:
(ml/min/g) 0 1 9 6 .0001
LAT MID 1.661.2 1.53.17 1.50.43 1.77.2 1.76.3 2.12.0 region:.019
(ml/min/g) 8 9 9 6
p (IVS vs. Ns .O1 ns ns ns .001 inter: .002
LAT)
IVS EPI 1.13.2 1.50.24 1.54.38 1.911.4 1.79.1 2.531.3 time:
(ml/min/g) 7 8 4 8 .0001
LAT EPI 1.371.2 1.481.31 1.24.24 1.55.2 1.50.0 1.92.0 region:.l7
(ml/min/g) 2 5 4 8
p (IVS vs. Ns ns ns ns .049 ns inter:
LAT) .0016
NS 1.36.2 1.85.27 1.69.30 2.24.4 1.90.0 2.731.4 time:
TRANS 1 6 9 0 .0001
(ml/min/g)
LAT 1.47.2 1.38.22 1.41.33 1.65.2 1.66.0 2.03.0 region:.019
TRANS 7 5 2 7
(ml/min/g)
p (IVS vs. Ns .001 ns ns ns .001 inter: .003
LAT)
IVS 1.30.3 1.32.23 1.13.20 1.27.2 1.05.2 1.06.1 time: .058
ENDO/ 6 0 0
EPI
58
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
LAT 1.01.0 0.77.10 1.21.06 1.071.1 1.151.0 1.071.1 region:.054
ENDO/ 7 1 2 0
EPI
p (IVS vs. Ns .0002 ns ns ns ns inter:
LAT) .0008
Two-way analysis of variance (repeated measures) was used to determine whether
subendocardial (ENDO) or transmural (TRAMS) blood flow was affected by
duration of
pacing (time), or region (lateral wall, LAT; or interventricular septum, IVS),
or whether the
pattern of change in blood flow was different between the two regions (inter).
Mean
values for blood flows at each time point were tested for differences between
the two
regions post-hoc by Tukey analyses. Values represent mean tSD from 5 animals.
ON:
microspheres injected during ventricular pacing (225 bpm). OFF: Pacemaker
inactivated.
Day O=Control; Day 14: 14 days of pacing; Day 21-28: 21-28 days of pacing.
Endocardial-to-epicardial blood flow ratios did not change significantly as
heart
failure progressed (P=.058). However, with the initiation of pacing, the
endocardial-to-
epicardial ratio was substantially lower in the lateral wall than in the IVS
(IVS, 1.320.23;
lateral wall, 0.770.10; P=.0002; Table 3). Ratios in both regions were >1.0
throughout
the rest of the study.
Endocardial blood flow per beat (Fig 2 and Table 4) was similar in both
regions before the
initiation of pacing (NS, 0.0130.003 mL ~ miri' ~ g' ~ beat'; lateral wall,
0.012~0.004mL
miri' ~ g' ~ beat'; P=NS). On initiation of ventricular pacing (225 bpm),
there was a
regional deficit in endocardial blood flow per beat in the lateral wall but
not in the IVS
(NS, 0.00910.002 mL ~ miri' ~ g' ~ beat'; lateral wall, 0.00510.001 mL ~ miri'
~ g' ~ beat
'; P=.001). At 14 days and 21 to 28 days, endocardial flow per beat was less
in the lateral
wall than in the IVS during pacing (Fig 2 and Table 4). These data indicate
that
myocardial hypoperfusion in the lateral wall began with the onset of pacing,
and this
relative ischemia persisted. However, endocardial blood flows per beat
remained normal
in both regions with the pacemaker off (Fig. 2 and Table 4).
Blood flow in both regions tended to increase during the final week of pacing
(Fig
2 and Table 3). This pattern was associated with a progressive fall in the
coronary vascular
resistance index (Fig 3), suggesting that alterations in coronary vascular
structure and
function may accompany left ventricular remodeling as heart failure
progresses. The
coronary vascular resistance index was significantly greater in the lateral
wall than in the
3o IVS at the initiation of pacing, and the pattern of change in coronary
vascular resistance
59
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
was different between the two regions (P=.0012) (Fig 3). These findings may
indicate an
effect of altered electrical activation on myocardial perfusion.
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Table 4. ENDOCARDIAL BLOOD FLOW PER BEAT
MODEL ENDOCARDIAL FLOW PER BEAT
(ml/min/gram/beat)
PORCINE AMAROID ISCHEMIA (HR 220 bpm; n=6)
NONISCHEMIC BED 0.0120.004
ISCHEMIC BED 0.0060.002
p < 0.001
PORCINE LV PACING-INDUCED CHF (HR 225 bpm; n=5)
PACER ON PACER OFF
DAY 0 IVS 0.00910.002 0.0130.003 (HR
122 bpm)
LATERAL WALL 0.0050.001 0.0120.004
p = 0.001 ns
DAY 14 1VS 0.0100.003 0.0110.002
(HR 149 bpm)
LATERAL WALL 0.0070.001 0.0100.003
p = 0.008 ns
DAY 21-28 IVS 0.0120.002 0.0130.003
(HR 157 bpm)
LATERAL WALL 0.0090.001 0.01210.002
p < 0.024 ns
Data from ameroid ischemia model have been previously published from our
laboratory
(Hammond, H.K. and McKirnan, M.D., J. Am. Coll. Cardiol., 23:475-82, 1994).
Values
represent mean ~ 1 SD. These data show that the collateral-dependent (ischemic
region) of
the ameroid model and the lateral wall of the left ventricular pacing-induced
heart failure
model have similar deficits in endocardial blood flow per beat compared with
myocardial
regions that are normally perfused.
61
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
1-M. Left Ventricular End-Systolic Wall Stress
There was a significant increase in estimated meridional end-systolic wall
stress
with respect to duration of pacing (P<.0001), but the pattern of change in
wall stress was
similar for the lateral wall and IVS (P=33), and post hoc testing failed to
show any regional
differences in systolic wall stress at any specific time point (Fig 3). The
increase in end-
systolic wall stress was roughly threefold in the lateral wall (control,
16840x103 dynes; 28
days, 412 143x103 dynes; P=.0001) and in the IVS (control, 159135x103 dynes;
28 days,
480~225x 103 dynes; P=.0001 ).
1-N. Necropsy
At necropsy, animals with heart failure had ascites (mean amount, 1809 mL;
range,
300 to 3500 mL) and dilated, thin-walled hearts, with all four chambers
appearing grossly
enlarged. Ratios of ventricular weight to body weight suggested hypertrophy of
the right
ventricle only, confirming data from a previous study using this model. (Roth,
D.A., et al.,
J. Clin. Invest. 91:939-949, 1993) Compared with weight-matched control
animals, there
was no change in left ventricular mass associated with heart failure (control,
11210 g;
heart failure, 11417 g); ratios of left ventricular weight to body weight were
also similar
in both groups (control, 2.80.3 g/kg; heart failure, 2.90.3 g/kg). In
contrast, heart failure
was associated with increased right ventricular weight (control, 3813 g; heart
failure,
5211 g; P=.003) and ratios of right ventricular weight to body weight
(control, 0.0910.1
g/kg; heart failure, 1.30.3 g/kg; P<.003). Paced animals gained 4 kg during
the course of
the study, an amount accounted for in part by ascites accumulation. If the
initial body
weight is used to calculate the ratio of left ventricular weight to body
weight, the ratio still
is not significantly higher than that from weight-matched control animals.
These data
confirm that there was no substantive increase in left ventricular mass during
the course of
the study.
1-O. Adenine Nucleotides
Control animals showed normal ATP/ADP ratios, similar to those reported in pig
heart collected by drill biopsies followed by immediate submersion in liquid
nitrogen,
(White, F.C., and Boss, G., J. Cardiovasc. Pathol. 3:225-236, 1990)
documenting that the
sampling techniques used were suitable. Animals with heart failure showed a
marked
62
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
reduction in ATP/ADP ratio in samples taken from the NS (control, 14.811.1;
heart
failure, 2.40.3; P<.0001, n=4 both groups) and from the lateral wall (control,
14.314.0;
heart failure, 2.40.9; P=.0012, n=4 both groups). This confirms an imbalance
between
myocardial oxygen supply and demand.
1-P. Myocardial Blood Flow
Regional variations in myocardial blood flow, an immediate consequence of
rapid
ventricular pacing, may play a role in the pathogenesis of regional and global
dysfunction
in pacing-induced heart failure. During pacing, a difference was found in
myocardial
blood flow per minute between the left ventricular lateral wall (adjacent to
the site of
stimulation) and the IVS. Reduced blood flow was present in the lateral wall
immediately
on the initiation of pacing and remained for 21 to 28 days. The left
ventricular lateral wall,
receiving less blood flow than the IVS during pacing, showed progressive
reduction in wall
thickening (pacer off) during 21 to 28 days of pacing. In contrast, the IVS,
receiving
greater blood flow during pacing, maintained relatively normal wall thickening
through 21
to 28 days of pacing.
Since myocardial blood flow per minute does not readily permit assessment of
relative myocardial ischemia, we also expressed coronary flow as endocardial
blood flow
per beat. The physiological basis for such an analysis lies in previous
experiments
2o showing that regional subendocardial blood flow per minute (rather than
outer wall of
transmural flow) is the primary determinant of regional myocardial contraction
under
conditions of progressive coronary artery stenosis (Gallagher, K.P., et al.,
Am. J. Physiol.
16:H727-H738, 1984) and that increases in heart rate shift this flow-function
relation
downward, with lower regional function at any level of subendocardial blood
flow.
(Delbaas, T., et al., J. Phi. 477:481-496, 1990) However, if the flow-function
relation
is plotted as regional function versus endocardial blood flow per beat, to
correct for heart
rate effects, there is a single relation at different heart rates, indicating
that endocardial
blood flow per beat primarily determines the level of wall function when
coronary blood
flow is reduced. (Indolfi, C., et al., Circulation 80:933-993, 1989; Ross, J.,
Circulation
83:1076-1083, 1991 ) With the initiation of pacing, there was a >50% reduction
in
endocardial blood flow per beat in the lateral wall compared with the NS
(P<.001; Table
4)
63
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
In prior studies in the conscious pig, we have documented that a 50% reduction
in
endocardial blood flow caused a 50% reduction of regional function and was
associated
with a subendocardial flow per beat similar to that observed in the lateral
wall in the
present studies (Table 4). The reduction in blood flow in the lateral wall
during pacing
persisted throughout the study. These data provide evidence for myocardial
ischemia in
the lateral wall on initiation of ventricular pacing. In contrast, IVS
function and
endocardial flow per beat remained relatively normal. With the pacemaker off,
subendocardial blood flow per beat remained normal in both regions throughout
the study,
while regional dysfunction persisted in the lateral wall, consistent with the
occurrence of
myocardial stunning in that region. Thus, we postulate that sustained ischemia
of the
lateral wall has a significant effect on global function during and after
pacing.
EXAMPLE Z: PREPARAT10N OF ILLUSTRATIVE GENE DELIVERY CONSTRUCTS
2-A. Preparation of Illustrative Adenoviral Constructs
As an initial gene delivery vector, a helper independent replication deficient
human
adenovirus-5 system was used. As an initial illustration of vector constructs,
we used the
genes encoding (3-galactosidase and FGF-5. Recombinant adenoviruses encoding ~-
galactosidase or FGF-5 were constructed using full length cDNAs. The system
used to
generate recombinant adenoviruses imposed a packing limit of about Skb for
transgene
2o inserts. Each of the (3-gal and FGF-5 genes operably linked to the CMV
promoter and with
the SV40 polyadenylation sequences were less than 4 kb, well within the
packaging
constraints.
The full length cDNA for human FGF-5 was released from plasmid pLTR122E
(Zhan et al., Mol. Cell. Biol., 8:3487, 1988) as a 1.1 kb ECOR1 fragment which
includes
981 by of the open reading frame of the gene and cloned into the polylinker of
shuttle
vector plasmid ACCMVpLpA. The nucleotide and amino acid sequence of FGF-5 is
disclosed in Figure 1 of Zhan et al., Mol. Cell. Biol., 8:3487, 1988.
pACCMVpLpA is
described in Gomez-Foix et al. J. Biol. Chem., 267:25129-25134, 1992.
pACCMVpLpA
contains the 5' end of the adenovirus serotype S genome (map units 0 to 17)
where the E 1
3o region has been substituted with the human cytomegalovirus enhancer-
promoter (CMV
promoter) followed by the multiple cloning site (polylinker) from pUC 19
(plasmid well
known in the art), followed by the SV40 polyadenylation signal. The lacZ-
encoding
64
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
control adenovirus is based on a ElA /E1B deletion from map unit 1 to 9.8. The
FGF-5-
encoding adenovirus (Ad.FGF-5) is based on a ElA /ElB deletion from map unit
1.3 to 9.3.
Both of these vectors eliminate the entire ElA coding sequences and most of
the E1B
coding sequences. Both of the vectors have the transgene inserts cloned in an
inverted
orientation relative to the adenovirus sequences. Therefore, in the unlikely
event of read-
through transcription, the adenovirus transcript would be antisense and would
not express
viral proteins.
The FGF-5 gene-containing plasmid was co-transfected (using calcium phosphate
precipitation) into 293 cells with plasmid JM 17 (pJM 17) which contains the
entire human
1 o adenovirus 5 genome with an additional 4.3 kb insert, making pJM 17 too
large to be
encapsidated into mature adenovirus virions. The cells were then overlaid with
nutrient
agarose. Infectious viral particles containing the angiogenic gene were
generated by
homologous rescue recombination in the 293 cells and were isolated as single
plaques 10-
12 days later. (Identification of successful recombinant virus also can be
done by co-
transfection by lipofection and directly looking for cytopathic effect
microscopically as
described in Zhang et al. Biotechniques 15(5):868-872, 1993). The resultant
adenoviral
vectors contain the transgene but are devoid of E 1 A/E 1 B sequences and are
therefore
replication-deficient. Adenovirus vector carrying the FGF-5 gene is also
referred to herein
as Ad.FGF-5.
Although these recombinant adenovirus were nonreplicative in mammalian cells,
they could propagate in 293 cells which had been transformed with E 1 A/E 1 B
and provided
these essential gene products in traps. Recombinant virus from individual
plaques was
propagated in 293 cells and viral DNA was characterized by restriction
analysis.
Successful recombinant virus then underwent two rounds of plaque purification
, using standard procedures. Viral stocks were propagated in 293 cells to
titers in the range
of 101° to 1012 per milliliter (ml) as determined by optical
densitometry. Human 293 cells
were infected at 80% confluence and culture supernatant was harvested at 36-48
hours.
After subjecting the virus-containing supernatant to freeze-thaw cycles, the
cellular debris
was pelleted by standard centrifugation and the virus further purified by two
cesium
chloride (CsCI) gradient ultracentrifugations (discontinuous 1.33/1.45 CsCI
gradient; CsCI
prepared in 5 mM Tris, 1 mM EDTA (pH 7.8); 90,000 x g (2 hr), 105,000 x g (18
hr)).
Prior to in vivo injection, the viral stocks were desalted by gel filtration
through Sepharose
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
columns (e.g. G25 Sephadex equilibrated with PBS). Final viral concentrations
were about
10" viral particles per milliliter (ml), as determined by optical
densitometry. Viral stocks
can be conveniently stored in cells in media at minus 70 degrees C. For
injections, purified
virus is preferably resuspended in saline. The adenoviral vector preparation
was highly
purified and substantially free of wild-type (potentially replicative) virus
(i.e., preferably
containing less than about one (1) replication competent adenovirus (RCA)
particle per
million, more preferably less than 1 per 109 and most preferably less than 1
per 10'2).
Thus, adenoviral infection and inflammatory infiltration in the heart were
minimized.
Additional illustrations of adenoviral vector constructs are provided below
and, in
combination with the other teachings provided herein, other adenoviral vector
constructs
suitable for use in the present invention, including constructs based on
modified adenoviral
vectors, can be employed.
2-B. Additional Illustrative Vector and Transgene Constructs
As described above, various viral and non-viral vectors can be used to deliver
genes
in accordance with the present invention. As an illustrative example of
another vector,
adeno-associated viral (AAV) vectors have been generated for in vivo delivery
according
to the methods of the present invention as described above. As an illustrative
example of
another angiogenic gene that can be used in the context of the present
invention, we have
prepared constructs comprising an IGF gene as described above, in both
adenoviral (Ad)
and AAV vector constructs.
The exemplary constructs contain the IGF-1 gene under the control of a
heterologous promoter (the CMV promoter was used for purposes of
illustration), and are
designated as rAd/IGF or rAAV/IGF. In addition to these, constructs comprising
a marker
gene, e.g., enhanced green fluorescent protein (EGFP), have been constructed.
The
rAd/IGF or rAAV/IGF constructs can also be constructed to include a marker
gene (such
as, EGFP). Constructs comprising EGFP are commercially available (for example,
from
Clontech, Palo Alto, California).
To generate rAd/IGF, the IGF-1 gene (available from the ATCC) is subcloned
into
an adenovirus shuttle vector, such as pAdshuttle-CMV, pAdSCI, and/or pAdtrack-
CMV.
The resulting IGF-1 shuttle plasmid undergoes a recombination process with a
helper
plasmid, pJMl7, in either bacteria or 293 cells depending on the shuttle
vector used. The
66
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
resulting rAd/IGF virus is verified for the expression of IGF-1 protein by RT-
PCR and/or
western blotting.
By way of illustration, we have prepared exemplary rAd/IGF constructs using
the
shuttle vector and pJMl7 helper plasmid in 293 cells essentially as described
and
illustrated above for the generation of adenoviral vectors comprising the FGF-
5 angiogenic
gene. Adenoviral vectors comprising EGFP were prepared as controls using
analogous
techniques.
We have prepared exemplary rAAV/IGF constructs using techniques for the
production of recombinant AAV vectors essentially as described in the art;
see, e.g., the
to references related to AAV production as cited above. Although AAV vectors
can be
generated using a variety of different techniques, as described in the art, we
used a basic
double transfection procedure, essentially as described by Samulski et al., J.
Virol. 63:
3822-3828, 1989. Briefly, to generate rAAV/IGF, the IGF-1 gene was subcloned
into an
rAAV plasmid DNA (such that the IGF gene would be flanked by the AAV inverted
terminal repeats or ITRs) and this rAAV plasmid was then co-transfected into
293 cells
with an AAV helper plasmid (to provide the AAV rep and cap genes in trans).
AAV
production was subsequently initiated by infecting with a helper adenovirus
(we used an
E1-deleted adenovirus known as d1312). Viral lysates are generally heat
treated to
inactivate adenovirus and treated with DNase and Pronase following standard
techniques
(see, e.g., Samulski et al., supra).
A variety of techniques can be employed for the purification of rAAV vectors.
For
purposes of this illustration, we used a standard cesium chloride (CsCI)
ultracentrifugation
procedure (using two CsCI purifications) for initially separating the rAAV
particles from
contaminants, essentially as has been described in the art. After dialysis, we
further
purified the material by HPLC. In this example, we used an affinity
chromatography
column which is coated with heparin (POROS HE, which is available from PE
Biosystems,
Foster City, California), and eluted with salt (1 to 2M NaCI). In this
example, most of the
AAV eluted at approximately 0.7M NaCI. Following dialysis against PBS (pH
7.4), the
vector was heat-treated at 56 degrees Celsius for 60 minutes to destroy
residual
3o adenoviruses. As with adenovirus, the resulting vector stocks are generally
titered for
DNase resistant particles (DRP); and are tested for absence of cytopathic
effect.
67
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Expression of IGF-1 in the rAd/IGF and rAAV/IGF was verified by western blot
analysis. They were further tested for the production of functional IGF-1
protein using a
proliferation assay on cultured MCF-7 cells. Briefly, HEK (human embryonic
kidney
carcinoma) 293 cells are transduced with rAd/IGF or rAAV/IGF on Day 1 and
cultured in
serum-free medium. After a 48 hour incubation, the serum free medium is
harvested and
put onto MCF-7 cells that have been cultured in serum-free medium. The
proliferation of
MCF-7 cells is monitored for the next 72 hours with a standard proliferation
assay method
(e.g. MTT assay), essentially as described by Mosmann (see e.g. Mosmann, J.
Immunol.
Meth. 16: SS-63, 1983). An adenovirus or AAV vector carrying enhanced green
1o fluorescence protein gene, rAd/EGFP or rAAV/EGFP, was used as negative
control and
recombinant human IGF-1 protein was used as a positive control. Results from
this MTT
assay indicated that both the rAd/IGF and rAAV/IGF vector constructs were
capable of
delivering the IGF-1 transgene to the human target cells (HEK 293) and that
the medium of
such targeted cells was then capable of inducing proliferation of the MCF-7
cells in a
manner analogous to purified IGF-1 protein. No significant proliferation was
observed
using medium from cells transfected with the negative controls (i.e. rAd/EGFP
or
rAAV/EGFP). We have also tested the vector constructs by directly transfecting
MCF-7
cells and have demonstrated that the IGF constructs (in both AAV and
adenovirus) can be
used to directly induce proliferation in the transfected cells in a manner
comparable to the
2o administration of IGF-1 protein to the cells (at a concentration of about 3
micrograms/ml).
Additional tests to confirm the functionality of the IGF vector constructs can
be
performed using myocytes, in which the effects of IGF on muscle cell size
and/or function
can be observed. By way of illustration, the effect of IGF on primary neonatal
cardiomyocytes (NCM), or adult cardiomyocytes, can be examined by various
assays. For
example, IGF-1 can be delivered by adenovirus or AAV vectors to induce
hypertrophy and
cellular DNA synthesis in NCM. After transduction of NCM at an appropriate
multiplicity
of infection (MOI), typically in the range of about 100 to 1000, the
cardiomyocytes are
stained with crystal violet or neutral red. The cells are imaged under a
microscope, and the
size of individual cells, including area, length, and width, can be measured
automatically
(e.g. using Image Plus software). The effect of IGF-1 on cellular DNA
synthesis can be
quantified by cellular incorporation of 3H-thymidine whereby the cellular DNA
synthesis is
monitored by 3H count after TCA precipitation of cellular DNA.
68
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Vectors comprising angiogenic transgenes can be delivered to a heart by
intracoronary delivery as described and illustrated herein. As an initial test
of candidate
vectors, prior to delivery in a large animal model such as pig, we have also
employed a rat
model in which we use indirect intracoronary delivery of vector to the
myocardium. In that
model, delivery is achieved by introduction of a solution comprising the
vector (e.g. in
phosphate buffered saline (PBS) or HEPES buffered saline) into the chamber of
the left
ventricle (i.e. by introduction into the lumen of the chamber as opposed to
the ventricular
wall) after constricting both the pulmonary artery and the distal aorta. Flow
from the
chamber of the ventricle thus carries the material to be delivered into the
coronary arteries
1o since alternative pathways are temporarily blocked. We have employed a
cross-clamping
procedure to constrict the pulmonary artery and aorta (see, e.g., Hajjar, et
al., Proc. Natl.
Acad. Sci. USA, 95: 5251-5256, 1998). We have also employed pretreatment with
a
vasoactive agent, as described above and in the corresponding co-pending
application
referred to above, in order to enhance gene transfer via intracoronary
delivery. We
typically use either histamine or sodium nitroprusside (SNP) as a vasoactive
agent. These
can be employed at ranges of about 1 to 75 milligrams/ml. Typically, we use
about 25
mg/ml of histamine infused prior to delivery of vector. In the case of SNP, we
typically
use about 50 mg/ml of the vasoactive agent with infusion beginning up to
several minutes
prior to introduction of the vector and continuing until vector has been
completely injected.
2o Using these procedures, we have demonstrated very high levels of gene
transfer to the
myocardium via intracoronary delivery of both adenoviral and AAV vectors.
Using
rAAV/EGFP as described above, delivered at a dose of about 1 x 10e11 DNase-
resistant
particles, for example, we can achieve transduction of the left ventricle (LV)
at levels of
about 30% of cells (as measured by fluorescent microscopy, after fixing LV
sections in
paraformaldehyde and cutting with a cryostat into 8-10 micron sections, and
quantifying
the percentage of green area using ImagePro Plus software). Gene expression
within the
myocardium was greatest within the epicardium but significant expression was
observed
even in the endocardium. Additionally, we have demonstrated relatively long-
lived gene
expression (with little if any reduction in expression levels between 30 days
and 180 days
post-injection) following delivery of an AAV vector to the myocardium as
described.
Further, histological and pathological analyses revealed little or no
inflammatory response
in the heart and no detectable gene expression in either the liver or the
lung.
69
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
EXAMPLE 3: GENE TRANSFER IN RAT CARDIOMYOCYTES
3-A Ad.~-gal Gene Transfer and Expression
Adult rat cardiomyocytes were prepared by Langendorf perfusion with a
collagenase containing perfusate according to standard methods. Rod shaped
cells were
cultured on laminin coated plates and at 24 hours, were infected with the ~3-
galactosidase-
encoding adenovirus obtained in the above Example 2, at a multiplicity of
infection of 1:1.
After a further 36 hour period, the cells were fixed with glutaraldehyde and
incubated with
X-gal. Consistently 70-90% of adult myocytes expressed the (3-galactosidase
transgene
after infection with the recombinant adenovirus. At a multiplicity of
infection of 1-2:1
l0 there was no cytotoxicity observed.
3-B. rAAV/IGF-1 Gene Transfer and Expression
To assess the effects of IGF-1 expression in rat neonatal cardiac myocytes, 2
x 10e6
cells were plated on 10 cm cell culture dishes and infected with 1 x 10e10
DNase resistant
particles of rAAV/IGF-1 or rAAV/EGFP. Cells were cultured without serum in
minimal
media and normal oxygen levels at 37 degrees Celsius. Recombinant IGF-1
protein (SO
ng/ml) or phenylephrine (50 uM) were added to the culture as positive
controls. Cells were
visually assessed 48 hours after treatment. Cells treated with rAAV-IGF-1
displayed
significant hypertrophy (comparable to that obtained using phenylephrine),
based on
2o morphological appearance, as compared to untreated cells. Exogenously-added
IGF-1
protein appeared to induce only slight hypertrophy as compared to rAAV/IGF-1.
To
quantitate the level of hypertrophy, a stereological program, Image Pro Plus 5
(Media
Cybernetics, Carlsbad, California), was utilized. Briefly, the Image Pro Plus
5 program
allows individual cells to be traced and measurements obtained. Cells were
outlined
within the program and area counts per cell were calculated. Approximately 50-
100 cells
were counted per condition and graphed in the statistical program Prizm. It
was found that
phenylephrine-treated cells and rAAV/IGF-1-infected cells demonstrated
significant
hypertrophy compared to untreated cells.
In addition to examining hypertrophy, the level of IGF-1 secretion into the
media
following rAAV/IGF-1 expression was determined using an ELISA assay for IGF-1
protein. Briefly, protein expression was found in the media of rAAV/IGF-1-
infected
cultures, collected at 48 hours, at levels of approximately 0.1-1.0 ng/ml,
representing a
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
significant increase over IGF-1 levels in control populations (untreated or
infected with
rAAV/EGFP).
EXAMPLE 4: IN VIVO GENE TRANSFER INTO PORCINE MYOCARDIUM
4-A. Ad.(3-gal Gene Transfer and Expression
The (3-galactosidase-encoding adenoviral vector obtained in Example 2 was
propagated in permissive 293 cells and purified by CsCI gradient
ultracentrifugation with a
final viral titer of 1.5 x 10'° viral particles, based on the
procedures of Example 2. An
anesthetized, ventilated 40 kg pig underwent thoracotomy. A 26 gauge butterfly
needle
1 o was inserted into the mid left anterior descending (LAD) coronary artery
and the vector
(1.5 x 10'° viral particles) was injected in a 2 ml volume in phosphate
buffered saline. The
chest was closed and the animal allowed to recover. On the fourth post-
injection day the
animal was killed. The heart was fixed with glutaraldehyde, sectioned and
incubated with
X-gal for 16.5 hours. After imbedding and sectioning, the tissue was
counterstained with
eosin.
Microscopic analysis of tissue sections (transmural sections of LAD bed 96
hours
after intracoronary injection of adenovirus containing lacZ) revealed a
significant
magnitude of gene transfer observed in the LAD coronary bed with many tissue
sections
demonstrating a substantial proportion of the cells staining positively for (3-
galactosidase.
Areas of the myocardium remote from the LAD circulatory bed did not
demonstrate X-gal
staining and served as a negative control, while diffuse expression of a gene
was observed
in myocytes and in endothelial cells. A substantial proportion of myocytes
showed (3-
galactosidase activity (blue stain), and, in subsequent studies using closed
chest
intracoronary injection, similar activity was present 14 days after gene
transfer (n=8).
There was no evidence of inflammation or necrosis in areas of gene expression.
4-B. rAAV/EGFP Gene Transfer and Expression
An EGFP-encoding adeno-associated viral vector was produced, propagated and
purified as described above in Example 2. Four farm pigs (~30 kg each) were
3o anesthetized, ventilated and underwent a midline neck cutdown. The carotid
artery was
isolated and a 5 French Introducer sheath inserted. A 5 French multipurpose
angiocatheter
was placed in the left circumflex artery (LCX) with the tip of the catheter
positioned about
71
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
1 cm within the coronary artery lumen. The syringe to be used for gene
injection was first
flushed with PBS and then the gene solution was drawn into the syringe.
Intracoronary
histamine, 25 pg/min, was infused for 3 min into the LCX prior to virus
administration,
followed by either 2.36 x 10'3 viral particles of rAAV/EGFP (n=3) or 4.72 x
10'3 viral
particles of rAAV/EGFP (n=1). A total volume of 1.5 ml of gene solution was
injected
into each pig at an infusion rate of 1 m1/30 seconds. The angiocatheter and
introducer
sheath were then removed and the neck incision closed. The animals were
allowed to
recover from anesthesia and placed in their holding cage until completion of
the study.
At 6-8 weeks post gene injection, pigs were sacrificed and tissues collected.
Hearts
to were excised and placed in iced saline. Coronary arteries were cold
perfused and the tissue
collected and flash frozen in liquid nitrogen. Other tissues were likewise
collected as
quickly as possible and flash frozen in liquid nitrogen. Both fluorescence
microscopy and
RT-PCR of tissue sections demonstrated successful delivery and expression of
the EGFP
gene by rAAV vector using this direct intracoronary injection method of
delivery in closed-
chest pigs. In particular, as shown below, results from RT-PCR confirmed the
gene was
successfully delivered to and expressed in the bed supplied by the injected
artery (i.e., the
LCX bed) as compared to the left anterior descending coronary artery (LAD)
bed:
Pig #1 Pig #2 Pig #3 Pig #4
LCX section 1 + + + +
LCX section 2 + - + +
L~ - _ _ _
EXAMPLE S: PORCINE MODEL OF ANGIOGENESIS-MEDIATED GENE THERAPY (USING
AN FGF-5 TRANSGENE)
In this pig model for myocardial ischemia and heart failure, animals were
subjected
to stress by atrial electrical stimulation (pacing). The degree of stress-
induced myocardial
dysfunction and inadequate regional blood flow was quantified and then gene
transfer was
performed by intracoronary injection of an illustrative recombinant adenovirus
expressing
FGF-5. Gene transfer was performed after stable but limited endogenous
angiogenesis had
developed, and inducible ischemia, analogous to angina pectoris in patients,
was present.
The animals had no ischemia at rest but developed ischemia during activity or
atrial
pacing. Control animals received a recombinant adenovirus expressing lacZ ((3-
gal) to
72
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
exclude the possibility that the adenovirus itself, independent of FGF-5, was
stimulating
new blood vessel formation. This also controlled for possible continued
collateral vessel
development unrelated to gene transfer. Two weeks after gene transfer, stress-
induced
cardiac dysfunction and regional blood flow were again measured.
Pigs receiving lacZ showed a similar degree of pacing-induced dysfunction in
the
ischemic region before and two weeks after gene transfer. In contrast, two
weeks after
receiving the FGF-5 gene, the animals showed increase in wall thickening and
improved
blood flow in the ischemic region during pacing. The results demonstrated that
gene
transfer of an angiogenic transgene (FGF-5) was effective to ameliorate
regional
to myocardial contractile dysfunction by improving regional blood flow through
newly-
formed blood vessels.
Methods
Animals and model.
15 Yorkshire domestic pigs (Sus scrofa, n = 27) weight 47 ~ 9 kg were used.
Two
animals underwent intracoronary injection of a recombinant adenovirus
expressing lacZ
(101' viral particles in 2.0 ml saline) and were killed 3 or 5 days after
injection. The
remaining 25 animals had catheters placed in the left atrium, pulmonary artery
and aorta,
providing a means to measure regional blood flow, and to monitor pressures.
Wires were
2o sutured on the left atrium to permit ECG recording and atrial pacing. An
ameroid
constrictor placed around the proximal left circumflex coronary artery. The
ameroid
material is hygroscopic and slowly swells, leading gradually to complete
closure of the
artery 10 days after placement, with minimal infarction (<1% of the left
ventricle) because
of the development of collateral blood vessels. Myocardial function arid blood
flow are
25 normal at rest in the region previously perfused by the occluded artery
(the ischemic
region), but blood flow is insufficient to prevent ischemia when myocardial
oxygen
demands increase. Collateral vessel development is complete within 21 days of
ameroid
placement and remains unchanged for at least 4 months (Roth et al., Am. J.
Physiol. 253:
H1279-H1288, 1987). A hydraulic cuff was also placed around the artery,
adjacent but
3o distal to the ameroid. These procedures have been described in detail
elsewhere
(Hammond et al., J. Am. Coll. Cardiol. 23: 475-482, 1994 and Hammond et al.,
J. Clin.
Invest. 92: 2644-2652, 1993). Two animals died 5 and 7 days after ameroid
placement.
73
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Thirty-eight (~ 2) days after ameroid placement, when limited collateral
circulation had
developed and stabilized, animals underwent studies to define pacing-induced
regional
function and blood flow and then received recombinant adenovirus expressing
either lacZ
(n = 7, control animals) or FGF-5 (n = 16, treatment group) delivered by
intracoronary
injection. Then, 14 ~ 1 days later, studies to define pacing-induced regional
function and
blood flow were repeated. The following day, AdlacZ (n = 7) and AdFGF-5 (n =
11)
animals were killed and tissues collected. Five AdFGF-5 animals were studied
12 weeks
after gene transfer and then killed.
to Recombinant adenovirus and transgene delivery.
A helper-independent replication-deficient human adenovirus-5 system was
prepared as described in Example 2 above.
For intracoronary delivery of the transgene, animals were anesthetized, and a
SF
arterial sheath placed into the carotid artery. A SF multipurpose (A2)
coronary catheter
15 was inserted through the sheath and into the coronary arteries. Closure of
the ameroid was
confirmed in all animals by contrast injection into the left main coronary
artery. The
catheter tip was then placed deeply within the arterial lumen so that minimal
material
would be lost to the proximal aorta during injection. Four milliliters
containing 2 X 10"
viral particles of recombinant adenovirus was delivered by slowly injecting
2.0 ml into
2o both the left and right coronary arteries.
Assays:
(i) Regional contractile function and perfusion. Two-dimensional and M-mode
images were obtained from a right parasternal approach at the papillary muscle
level using
25 a Hewlett Packard ultrasound imaging system (Hewlett-Packard Sonos 1000).
Conscious
animals were studied suspended in a comfortable sling to minimize body
movement.
Images were recorded on VHS tape with animals in a basal state and again
during left atrial
pacing (heart rate = 200 beats per min). These studies were performed 1 day
before gene
transfer and repeated 14 ~ 1 days later. Five animals were examined again 12
weeks after
3o gene transfer with FGF-S to determine whether the effect on improved
function was
persistent. Rate-pressure products and left atrial pressures were similar in
both groups
before and after gene transfer, indicating similar myocardial oxygen demands
and loading
74
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
conditions. Echocardiographic measurements were made using standardized
criteria (Sahn
et al., Circulation 58: 1072-1083, 1978). To demonstrate reproducibility of
echocardiographic measurements, animals (n = S) were imaged on two consecutive
days.
The data from the separate determinations were highly reproducible (lateral
wall
thickening: rZ = 0.90; P = 0.005). The percent decrease in function measured
by
transthoracic echocardiography and sonomicrometry in this model are similar
(Hammond
et al., J., Am. Coll. Cardiol. 23: 475-482, 1994 and Haminond et al. J. Clin.
Invest. 92:
2644-2652, 1993), documenting the accuracy of echocardiography for evaluation
of
ischemic dysfunction. Analysis was performed without knowledge of treatment
group.
1o Contrast material (Levovist; microaggregates of galactose) increases the
echogenicity (whiteness) of the image after left atrial injection. The
microaggregates
distribute into the coronary arteries and myocardial walls in a manner that is
proportional
to blood flow. The peak intensity of contrast enhancement is correlated with
myocardial
blood flow as measured by microspheres (Skyba et al., Circulation 58: 1072-
1083, 1978).
Thirty-eight (~ 2) days after ameroid placement, well after ameroid closure,
but before
gene transfer, contrast echocardiographic studies were performed during atrial
pacing
(200 bpm). Studies were repeated 14 ~ 1 days after gene transfer, and, in five
animals,
12 weeks after gene transfer with FGF-5. Peak contrast intensity was measured
from the
video images with a computer-based video analysis program (Color Vue II, Nova
2o Microsonics, Indianapolis, Indiana), that provided an objective measure of
video intensity.
Data were expressed as the ratio of the peak video intensity in the ischemic
region (LCx
bed) divided by the peak video intensity in the interventricular septum (IVS,
a region
receiving normal blood flow through the unoccluded left anterior descending
coronary
artery). The differences in regional blood.flow during atrial pacing measured
by contrast
echocardiography were similar to the differences measured by microspheres in
this same
model in our laboratory, documenting the accuracy of echocardiography for the
evaluation
of regional myocardial blood flow. The contrast studies were analyzed without
knowledge
of which gene the animals had received.
(ii) Assessment of angiogenesis.
The brachiocephalic artery was cannulated and other great vessels ligated.
After
intravenous injection of heparin (10,000 ICn, papaverine (60 mg), and then
potassium
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
chloride (to induce diastolic cardiac arrest), the aorta was cross-clamped and
the coronary
vasculature perfused. Glutaraldehyde solution (6.25%, 0.1 M cacodylate buffer)
was
perfused at 120 mm Hg pressure; the heart was removed; the beds were
identified using
color-coded dyes injected anterograde through the left anterior descending,
left circumflex
and right coronary arteries; and the ameroid was examined to confirm closure.
Samples
taken from the normally perfused and ischemic regions (endocardial and
epicardial thirds)
were plastic-embedded and prepared for microscopic analysis of capillary
number. Four 1-
pm-thick transverse sections were taken from each subsample (endocardium and
epicardium of each region ) as previously described (Mathieu-Costello,
Microvasc. Res.
33: 98-117, 1987 and Poole & Mathieu-Costello, Am. J. Physiol. 259: H204-H210,
1990).
The number of capillaries around each fiber and fiber cross-sectional~area in
each of eight
fields in each subsample (randomly selected by systematic sampling) were
measured with
an image analyzer (Videometric 150, American Innovision) at X1400. The number
of
capillaries around a total of 325 ~ 18 fibers was measured. Capillary density
(number per
fiber cross-sectional area) was estimated by point counting 15 ~ 1 fields per
subsample.
The relative standard errors of capillary number around a fiber, fiber cross-
sectional area
and capillary density were 1.4, 4.1 and 4.2% respectively. Capillary-to-fiber
ratio was
calculated as the product of capillary density and fiber cross-sectional area.
There was no
significant difference in fiber cross-sectional area in myocardial samples
from either group.
2o Bromodeoxyuridine (50 mg/kg) was injected into the peritoneal space of five
animals: a
control animal (no ameroid); two animals with ameroid occluders that received
lacZ gene
transfer 2 weeks before; and two animals with ameroid occluders that received
FGF-5 gene
transfer 2 weeks before. Thirty-six hours after BRDU injection the animals
were killed,
and the tissue was prepared for analysis using methods previously described
(Kajstura et
al., Circ. Res. 74: 383-400, 1994). Sections of duodenum were used as positive
controls.
(iii) DNA, mRNA and protein expression.
Following gene transfer, left ventricular homogenates underwent studies to
document transgene presence and expression. The polymerase chain reaction
(PCR), using
3o a sense primer to the CMV promoter (GCAGAGCTCGTTTAGTGAAC; SEQ 1D. NO. 1)
and an antisense to the internal FGF-5 sequence (GAAAATGGGTAGAGATATGCT;
SEO >D NO. 2) amplified the expected 500-by fragment. Using a sense primer to
the
76
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
beginning of the FGF-5 sequence (ATGAGCTTGTCCTTCCTCCTC; S~ >D NO. 3) and
an antisense primer to the internal FGF-5 sequence (i.e., SEQ >D NO. 2), RT-
PCR
amplified the expected 400-by fragment. Primers directed against the
adenovirus DNA E2
region were used to detect wild-type or recombinant viral DNA in tissues
(TCGTTTCTCAGCAGCTGTTG; S~ ID NO. 4) and
(CATCTGAACTCAAAGCGTGG; S~ ID NO. 5). The expected 900-by fragment was
amplified from the recombinant virus. These studies were conducted on 200-mg
tissue
samples from myocardium and other tissues. PCR detection sensitivity was 1
viral
sequence per 5 million cells. A polyclonal antibody directed against FGF-5
(Kitaoka et al.,
to Invest. Ophthalmol. Vis. Sci. 35:3189-3198, 1994) was used in immunoblots
of protein
from the medium of cultured rat cardiac fibroblasts 48 h after the gene
transfer of FGF-5 or
lacZ. FGF-5 protein was found in conditioned media after gene transfer of FGF-
5, but not
after gene transfer of lacZ. Methods for PCR and western blotting have been
described in
detail elsewhere (Hammond et al., J. Clin. Invest. 92: 2644-2652, 1993, Roth
et al. J. Clin.
Invest. 91: 939-949, 1993, and Tsai et al. Am. J. Physiol. 267:H2079-H2085,
1994). To
examine the transgene for mitogenic activity in vitro, adult rat cardiac
fibroblasts were
infected with adenovirus-encoding FGF-5 or with adenovirus-encoding lacZ, or
were not
infected. Media from these cell cultures were incubated with NIH 3T3 mouse
fibroblasts,
and tritiated thymidine incorporation was measured (Tsai et al., Endocrinolo~y
136: 3831-
3838, 1995).
(iv) Adenovirus release during intracoronary delivery.
Pulmonary arterial blood was withdrawn continuously during intracoronary
injection of recombinant adenovirus in three animals. Serum from each sample
was used
in a standard plaque assay. Undiluted serum (0.5 ml) was added to subconfluent
H293
cells; 10 days later, no plaques had formed. However, when 0.5 ml serum was
diluted 200-
to 8000-fold with DMEM (2% FBS), viral plaques formed by day 9. A single
vascular bed
(myocardial) separates the coronary and pulmonary arteries. If no virus
attaches in this bed
after inj ection into the coronary artery, then the pulmonary artery
concentration of virus
3o should reflect the dilution of coronary sinus blood by systemic venous
blood over the time
of the injection. Measurements from our laboratory indicate that coronary flow
represents
5% of pulmonary artery flow. Using this dilution factor (20-fold), the
duration of coronary
77
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
injection, and the amount of adenovirus injected, we calculated the amount of
adenovirus
delivered to the pulmonary artery, assuming no adenovirus escape or
attachment. This
estimate was compared to the measured amount and the difference used as an
estimate of
the amount of virus cleared by the myocardial vascular bed.
(v) Assessment of inflammation.
Hematoxylin/eosin and Masson's trichrome stains were used to detect
inflammatory cell infiltrates, cell necrosis and fibrosis. Mouse ascites,
porcine anti-CD4
and anti-CD8 monoclonal antibodies (1.0 mg/ml; VMRD, Inc., Pullman,
Washington)
1o were used to detect CD4 and CD8 markers on T lymphocytes in frozen sections
(6 pm) of
spleen (positive control) and heart. These studies were performed on
transmural samples
of hearts of six animals that had received ameroid occluders 50 days before
being killed:
two animals received no gene transfer, two received FGF-5 gene transfer 2
weeks before,
and two received lacZ gene transfer 2 weeks before. Analysis was conducted
without
knowledge of treatment group.
(vi) Statistical analysis.
Data are expressed as means ~ 1 s.e.m. Measurements made before and after gene
transfer with FGF-5 and lacZ were compared using two-way analysis of variance
(Crunch4, Crunch Software Corporation, Oakland, California). Data from
angiogenesis
studies also underwent two-way analysis of variance. The null hypothesis was
rejected
when P <0.05.
RESULTS USING AN FGF-5 TRANSGENE
Three measurements were used to assess whether gene transfer of FGF-5 was
effective in treating myocardial ischemia: regional contractile function and
perfusion
(assessed before and after gene transfer) and capillary number. All
measurements were
conducted without knowledge of which gene the animals had received (FGF-5
versus
lacZ).
3o Regional contractile function and blood flow. Thirty-eight days after
ameroid
placement, animals showed impaired wall thickening during atrial electrical
stimulation
(pacing). Pigs receiving lacZ showed a similar degree of pacing-induced
dysfunction in
78
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
the ischemic region before and two weeks after gene transfer. In contrast, two
weeks after
FGF-5 gene transfer there was a 2.7-fold increase in wall thickening in the
ischemic region
during pacing (P < 0.0001; Fig. 6). Wall thickening in the normally perfused
region (the
interventricular septum) was normal during pacing and unaffected by gene
transfer (% wall
thickening: lacZ: pre gene transfer 53 ~ 8%, post gene transfer 51 ~ 6%; FGF-
5: pre gene
transfer 59 ~ 4%, post gene transfer 59 ~ 6%).
Associated with improved function in the ischemic region was improved regional
blood flow. Two weeks after IacZ gene transfer there was a persistent flow
deficit in the
ischemic region during pacing (Fig. 8). Animals receiving FGF-5 gene transfer,
however,
1o showed homogeneous contrast enhancement in the two regions two weeks later,
indicating
improved blood flow in the ischemic region (P = 0.0001). To determine whether
improved
function and perfusion in the ischemic bed were long lasting, five animals
were examined
again 12 weeks after FGF-S gene transfer. Each animal showed persistent
improvements
in function (P = 0.005; Fig. 6) and perfusion (P = 0.001; Fig. 8).
Angiogenesis. Uninfected ameroid-constricted animals (no gene transfer
performed) had
identical physiological responses to animals receiving lacZ-encoding
adenovirus,
indicating that the lacZ vector did not adversely affect native angiogenesis.
To assess
angiogenesis, myocardial capillary number was quantified using microscopic
analysis of
2o perfusion-fixed hearts (Fig. 9). The number of capillaries surrounding each
myocardial
fiber was greater in the endocardium of the ischemic and nonischemic regions
in animals
that received gene transfer with FGF-5 when compared with the same regions of
the hearts
of animals that had received gene transfer with ZacZ (P = 0.038). Thus,
improved regional
function and perfusion were associated with capillary angiogenesis two weeks
after FGF-5
gene transfer. Increased capillary number around each fiber tended to increase
in the
epicardial portion of the wall after FGF-5 gene transfer (P = 0.13). Other
measures of
capillarity such as capillary number per fiber cross-sectional area and
capillary number per
fiber number were not changed in endocardium or epicardium.
DNA, mRNA and protein expression. Having established favorable effects of FGF-
5
gene transfer on function, perfusion and capillary number around each fiber,
it was
imperative to demonstrate presence and expression of the transgene in the
heart.
79
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Polymerase chain reaction (PCR) and reverse transcriptase coupled with PCR (RT-
PCR)
were used to detect transgenic FGF-5 DNA and mRNA in myocardium from animals
that
had received FGF-5 gene transfer.
Following gene transfer, left ventricular samples were examined to document
transgene incorporation and expression. Briefly, 3 days after intracoronary
gene transfer of
lacZ, myocardium was treated with X-gal, and then counterstained with Eosin
X120.
Examination using standard histological techniques revealed that the majority
of myocytes
showed (3-galactosidase activity (blue stain). Activity was also seen 14 ~ 1
days after gene
transfer in all animals that had received lacZ gene transfer. Higher
magnification
1o demonstrated cross striations in cells containing ~3-galactosidase
activity, confirming gene
expression in myocytes. PCR analysis using a sense primer directed against the
CMV
promoter and an antisense primer directed against an internal FGF-5 sequence,
was
performed to confirm the presence of recombinant adenovirus DNA encoding FGF-5
in the
ischemic (LCx) and nonischemic (LAD) regions of three animals that received
FGF-5 gene
transfer. The results, shown in Figure 10A confirmed the presence of the
expected 500-by
fragments. FGF-5 mRNA expression was then examined 14 days after gene
transfer. As
shown in Figure IOB, the RT-PCR-amplified 400-by fragment was present in both
regions
from two animals, whereas control animals showed no signal. A polyclonal
antibody
directed against FGF-S was used in immunoblots of protein from the medium of
cultured
2o rat cardiac fibroblasts 48 hours after gene transfer of FGF-5 or lacZ. As
shown in Figure
l OC, FGF-5 protein was found after gene transfer of FGF-5 (F), but not after
gene transfer
of lacZ ((3), demonstrating protein expression and extracellular secretion
after FGF-5 gene
transfer. Finally, PCR, using a set of primers directed against adenovirus DNA
(E2
region), was performed to determine whether adenovirus DNA was present in
retina, liver,
or skeletal muscle of two animals that received intracoronary injection of
adenovirus
14 days before. As shown in Figure l OD, the expected 900-by amplified
fragment was
only found in a control lane (+) containing recombinant adenovirus (as a
positive control),
and not in the lanes derived from the retina (r), liver (1), or skeletal
muscle (m) of the
treated animals.
3o Successful gene transfer was documented in both the ischemic and
nonischemic
regions. Immunoblotting showed FGF-5 protein in myocardium from animals that
received FGF-S gene transfer. In additional experiments using cultured
fibroblasts, we
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
documented that gene transfer of FGF-5 conferred the ability of these cells to
synthesize
and secrete FGF-5 extracellularly. Media from cultured cells infected with
recombinant
adenovirus expressing FGF-5 showed a mitogenic response (14-fold increase
versus
control; P = 0.005). Finally, two weeks after gene transfer, myocardial
samples (but not
liver samples) from IacZ-infected animals showed (3-galactosidase activity on
histological
inspection. These studies confirm successful in vivo gene transfer and
expression, and
demonstrate the biological activity of the transgene product.
Two weeks after intracoronary injection of recombinant adenovirus, we were
unable to detect viral DNA in liver, retina or skeletal muscle using PCR
despite the
1o presence of viral DNA in myocardium. Furthermore, viral DNA was
undetectable in urine
2-24 hours after intracoronary injection. These experiments indicated that
intracoronary
delivery of the adenoviral vector minimized systemic arterial distribution of
the virus to a
level below the detection limits of the PCR methods. This technique might be
difficult to
achieve in animals with smaller coronary artery size such as rabbits.
To assess the efficiency of myocardial uptake of adenovirus, we measured the
amount of adenovirus released from the heart by sampling pulmonary arterial
blood during
intracoronary injection. A surprising 98.7% of the virus was cleared by the
heart on the
first pass. Undiluted serum obtained from the pulmonary artery during
intracoronary
delivery of virus was incapable of forming viral plaques in appropriate
conditions. Thus
2o the present invention effectively provides a caidiac-specific gene delivery
system.
Assessment of inflammation. Microscopic inspection of transmural sections of
hearts of
animals that had received recombinant adenovirus did not show inflammatory
cell
infiltrates, cell necrosis or increased fibrosis. As an additional evaluation
for an
adenovirus-induced cytopathic effect, we conducted immuno-histological studies
to detect
CD4 and CD8 antigens that would indicate the presence of cytotoxic T cells.
These studies
showed rare positive cells on transmural sections of heart from uninfected
animals (n = 2)
or animals that had received recombinant adenovirus (n = 4). The liver also
was free from
inflammation.
81
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
EXAMPLE G: GENE-MEDIATED AN GIOGENESIS USING AN FGF-4 TRANSGENE
This experimental example demonstrated successful gene therapy using a
different
angiogenic protein-encoding gene, FGF-4. The protocol for FGF-4 gene therapy
was
essentially as described in Example 5 above for FGF-5.
The human FGF-4 gene was isolated from a cDNA library which was constructed
from mRNA of Kaposi's Sarcoma DNA transformed-NIH3T3 cells. The FGF-4 cDNA is
about 1.2 kb in length and encodes a polypeptide of 206 amino acids including
a 30 amino
acid signal peptide at the N-terminal (Dell Bovi et al. Cell 50:729-737, 1987;
Bellosta et al.
J. Cell Biol. 121:705-713, 1993). We subcloned the FGF-4 cDNA as an
essentially full-
to length 1.2 kb EcoRl fragment, into the EcoRl site in adenovirus vector
pACCMVpLpASR (pACSR for simplicity). The 5' start site was at 243 basepairs
and the
3' end at 863 basepairs. Recombinant adenovirus encoding FGF-4 (also referred
to herein
as Ad.FGF-4) was made as described in Example 2 for making the FGF-5
adenovirus.
Expression of FGF-4 in cardiac tissue (and a lack of expression in other
tissues
15 including the liver, skeletal muscle and eye) was confirmed by Western-blot
analysis using
anti-FGF-4 antibody for detection. The mitogenic effect of FGF-4 on
proliferation of
endothelial cells in vitro was also tested.
Forty-five days after ameroid placement, animals underwent studies to define
stress-induced regional function and blood flow and then received recombinant
adenovirus
2o expressing FGF-4 (n=6 animals) delivered by intracoronary injection.
Thirteen days later,
studies to define stress-induced regional function and blood flow were
repeated. The
following day, animals were killed and tissues collected.
Transgene Delivery
25 As with FGF-5, gene transfer was performed after endogenous angiogenesis
was
quiescent and inducible myocardial ischemia, analogous to angina pectoris in
patients, was
present. For intracoronary delivery of the transgene, animals were
anesthetized, and a 5F
arterial sheath placed into the carotid artery. A 5F multipurpose coronary
catheter was
inserted through the sheath and into the coronary arteries. Closure of the
ameroid was
3o confirmed in all animals by contrast injection into the left main coronary
artery. The
catheter tip was then placed 1 cm within the arterial lumen so that minimal
material would
be lost to the proximal aorta during injection. Five ml containing 1.5x10'2
viral particles
82
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
of recombinant adenovirus expressing FGF-4 were delivered by slowly injecting
3.0 ml
into the left and 2.0 ml into the right coronary arteries.
RESULTS USING AN FGF-4 TRANSGENE
Regional Function and Perfusion
Forty-five days after ameroid placement, animals showed impaired wall
thickening
during atrial pacing. In contrast, two weeks after FGF-4 gene transfer there
was a 2.7 fold
increase in wall thickening in the ischemic region during pacing (p<0.0001;
Figures 11 and
12). Wall thickening in the normally perfused region (the interventricular
septum) was
to normal during pacing and unaffected by gene transfer. The improvement in
function after
FGF-4 gene transfer was statistically indistinguishable from the improvement
obtained
following gene transfer with FGF-5 or FGF-2LI + signal peptide ("sp") (Figure
11 ).
Improved function in the ischemic region was associated with improved regional
perfusion
(Figure 12). As shown in Figure 12, prior to FGF-4 gene transfer there was a
flow deficit
in the ischemic region during pacing. Two weeks after gene transfer with FGF-
4,
homogeneous contrast enhancement was seen in the two regions, indicating
improved flow
in the ischemic region (p=0.0001). Results with FGF-4 were statistically
indistinguishable
from results obtained with FGF-S and FGF-2LI + sp (Figure 13). FGF-2LI+sp is
described
in Example 7 and refers to FGF-2 containing a signal sequence.
Transgene Expression
Exclusive expression of FGF-4 in the heart was confirmed by performing PCR and
RT-PCR using primers specific for sequences encoding the transgene. FGF-4 DNA
and
mRNA were found in the heart, but absent in the eye, liver, and skeletal
muscle. These
data confirm data derived from the use of Ad.FGF-5 (n=2) and Ad.FGF-2LI + sp
(n=1 ).
Thus exclusive expression of the transgene in the heart was confirmed in all
four animals
which had received adenoviral vectors containing different angiogenic protein-
encoding
genes.
3o Absence of Myocardial Inflammation
Transmural myocardial biopsies from three consecutive animals that received
Ad.FGF-4 have been examined. The animals were killed 2 weeks after gene
transfer.
83
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
There was no evidence of inflammatory cell infiltrates, necrosis, or increased
fibrosis in
these sections compared to control ameroid animals that received no
adenovirus. This was
true in both the LAD and LCx beds. These slides were reviewed by a pathologist
who
made a blind-sample assessment and commented that there was no evidence for
myocarditis in any section.
EXAMPLE 7: GENE-MEDIATED ANGIOGENESIS USING AN FGF-2 MUTEIN
This experimental example demonstrated successful gene therapy using a third
angiogenic protein-encoding gene, FGF-2. This experiment also demonstrates how
an
1o angiogenic protein can be modified to increase secretion and potentially
improve efficacy
of angiogenic gene therapy in enhancing blood flow and cardiac function within
the heart.
The protocol used for human FGF-2 gene therapy was virtually identical to that
employed
for FGF-5 and FGF-4 above.
Acidic FGF (aFGF, FGF-1) and basic FGF (FGF-2) lack a native secretory signal
15 sequence; although some protein secretion may occur. An alternate secretary
pathway, not
involving the Golgi apparatus, has been described for acidic FGF. Two FGF-2
constructs
(FGF-2LI +sp and FGF-2LI -sp) were made, one with a sequence encoding a signal
peptide
(FGF-2LI +sp) for the classic protein secretary pathway and one without the
signal peptide
encoding sequence (FGF-2LI -sp) to test for improved efficacy of FGF-2 having
an added
2o signal peptide over the same protein without the added signal peptide.
As shown below, FGF-2 has a five-residue loop structure which extends from
amino acid residue 118 to residue 122. This loop structure was replaced by
cassette
directed mutagenesis, with the corresponding five-residue loop from
interleukin-1 (3 to
produce FGF-2LI loop replacement mutants. Briefly, the gene encoding human
25 Glu3°SFGF-2 (Seddon et al. Ann. N.Y. Acad. Sci. 638:98-108, 1991)
was cloned into T7
expression vector pET-3a (M13), a derivative of pET-3a (Rosenberg et al. Gene
56:125-
135, 1987), between restriction sites Ndel and BamHl. The unique restriction
endonuclease sites, BstBl and Spll, were introduced into the gene in such a
way as to
produce no change in the encoded amino acids (i.e. silent mutations) at
positions that flank
3o the codons encoding the segment Ser117-Trp123 of FGF-2.
84
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
Structured alignment' of the (39-(310 loops in FGF-l, FGF-2, and II,-1 (3.
110 115 120 125 130
FGF-1 ENHYNTYISKKHAEKHWFVGLKKNG (SEO ~ NO. 6)
110 115 120 125 130
FGF-2 SNNYNTYRSRKY..TSWYVALKRTG (S~ ID NO. 7)
110 115 120 125
IL-1 (3 NNKLEFESA F..PNWYISTSQAE (SEO ID NO. 8)
l0
' Numbering for FGF-1 and FGF-2 is from amino acid residue 1 deduced from the
cDNA sequence encoding the 155-residue form (as described in Seddon et al.
Ann.
N. Y. Acad. Sci. 638:98-108, 1991), and that for IL-1(3 is from residue 1 of
the
mature 153-residue polypeptide (id.).
Replacement of residues Arg118-Lys119-Tyr120-Thr121-Serl22 of FGF-2 with the
human sequence Ala-Gln-Phe-Pro-Asn from the corresponding loop of the
structural
analogue IL-1 (3 (115-119) was essentially performed as follows:
The plasmid DNA, pET-3a (M13), was subjected to BStBI and Spll digestion, and
2o the resulting larger DNA fragment was isolated using agarose gel
electrophoresis. The
DNA fragment was ligated, using T4 DNA ligase, to a double-stranded DNA
obtained by
annealing two synthetic oligonucleotides: 5"-CGAACGATTG GAATCTAATA
ACTACAATAC GTACCGGTCT GCGCAGTTTC CTAACTGGTA TGTGGCACTT
AAGC-3' (S~ ID NO. 9) and 5' GTACGCTTAA GTGCCACATA CCAGTTAGGA
AACTGCGCAG ACCGGTACGT ATTGTAGTTA TTAGATTCCA ATCGTT-3' (S~
ID NO. 10), that contain termini compatible with those generated by BstBl and
Spll
digestion. The ligation product was used to transfer Escherichia coli (strain
DHSa) cells.
The desired mutant plasmid (FGF-2LI) was selected for on the basis of
susceptibility to
cleavage at the newly introduced Afl2 restriction site (underlined above).
3o FGF-2LI with and without signal peptide were constructed by using a
polymerase
chain reaction (PCR)-based method. In order to add the FGF-4 signal peptide
sequences to
the 5' of FGF-2LI and to ensure that the signal peptide will be cleaved from
FGF-2LI
protein, the gene cassette used by Forough R. et al for getting the secreted
FGF-1 was
employed. Using a primer (pFlB: 5'- CGGGATCCGC CCATGGCGGG
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
GCCCGGGACG GC-3' (SEO ID NO. 11 ) matching the S' portion of the FGF-4 signal
peptide and a second primer (pF2R: 5'-CGGAATTCTG TGAAGGTGGT GATTTCCC-
3') (SEO ID NO. 12) to the 5' portion of FGF-1, we synthesized, by PCR, a DNA
fragment
containing a Bam HI site at the S' end of the FGF-4 signal peptide sequences
followed by
the first ten amino acids of FGF-l and an EcoRI site at the 3' end. Using
another pair of
primers (pF3R: 5'-CGGAATTCAT GGCTGAAGGG GAAATCACC-3' (SEQ ID NO. 13)
and pF4HA: 5'-GCTCTAGATT AGGCGTAGTC TGGGACGTCG TATGGGTAGC
TCTTAGCAGA CATTGGAAGA AA.AAG-3' (SEQ ID NO. 14)) matching the sequences
of S'- and 3'-of FGF-2LI, respectively, we obtained a second DNA fragment
which has an
1o EcoRI site at the 5' end and an influenzae hemoagglutinin (HA) tag plus an
XbaI site at the
3' end of the FGF-2LI. These two fragments were then subcloned into pcDNA3
vector at a
BamHI and XbaI site by three molecule ligation. The plasmid pFGF-2LI/cDNA3
which
was similar to pSPFGF-2LI/cDNA3 except that it has no signal peptide was
subcloned in a
similar manner. Both plasmids were then sequenced to confirm the correction of
the
inserts. Both FGF-2LI fragments were then released from pcDNA3 by digestion
with
BamHI and XbaI and subcloned into pACCMVpLpASR(+) (pACSR for simplicity) which
is a shuttle vector for making recombinant virus. Recombinant virus and
injectable vector
were prepared essentially as described in Example 2. Gene transfer was
performed as
described in Example 5 (using 8 animals for FGF-2LI sp+ and 6 animals for FGF-
2LI sp-,
2o with the lacZ vector serving as a control, all with 10~ 1 to 1012 viral
particles).
RESULTS USING FGF-2 MUTEINS
Two weeks after gene transfer with FGF-2LI +sp, the peak contrast ratio
(LCx/LV)
during pacing stress at 200 bpm was significantly improved compared to pre-
gene transfer.
Figure 13 shows results using intracoronary gene transfer of recombinant
adenovirus
expressing lacZ, FGF-S, FGF-2LI +sp, FGF-2LI -sp, and FGF-4 for comparison.
The
black bar on the right side in Figure 13 shows the normal flow ratio using
this method.
FGF-2LI +sp normalized peak contrast flow ratio in these animals.
Percent wall thickening was also improved two weeks after intracoronary
delivery
of a recombinant adenovirus expressing FGF-2LI +sp. Figure 11 shows results
using
intracoronary gene transfer of recombinant adenovirus expressing lacZ, FGF-5,
FGF-2LI
+sp, FGF-2LI -sp, and FGF-4 for comparison. The black bar on the right side in
Figure 11
86
CA 02389524 2002-04-30
WO 01/34208 PCT/US00/30345
shows the normal percent wall thickening before pacing-induced stress. FGF-2LI
+sp
improved regional function to a degree that was statistically
indistinguishable from FGF-5.
Although there was some improvement noted after gene transfer with FGF-2LI -
sp, the
improvement with the signal peptide containing transgene was superior (Figure
13).
87
