Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 277
NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 277
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
1
Transforming Growth Factor Alpha HIII
Field of the Invention
The present invention relates to a novel human gene encoding a polypeptide
which is
a member of the Transforming Growth Factor family. More specifically, the
present
invention relates to a polynucleotide encoding a novel human polypeptide named
Transforming Growth Factor Alpha III, or "TGF alpha HILL" This invention also
relates to
TGF alpha HIII polypeptides, as well as vectors, host cells, antibodies
directed to TGF alpha
HIII polypeptides, and the recombinant methods for producing the same. Also
provided are
diagnostic methods for detecting disorders related to TGF alpha HIII, and
therapeutic
methods for treating such disorders. The invention further relates to
screening methods for
identifying agonists and antagonists of TGF alpha H)ZI activity.
Background of the Invention
Cellular growth and differentiation appear to be initiated, promoted,
maintained and
regulated by a multiplicity of stimulatory, inhibitory and synergistic factors
and hormones.
The alteration and/or breakdown of the cellular homeostasis mechanism seems to
be a
fundamental cause of growth related diseases, including neoplasia. Growth
modular factors
are implicated in a wide variety of pathological and physiological processes
including signal
transduction, cell communication, growth and development, embryogenesis,
immune
response, hematopoiesis cell survival and differentiation, inflammation,
tissue repair and
remodeling, atherosclerosis and cancer. Epidermal growth factor (EGF),
transforming growth
factor alpha (TGFa,) betacellulin, amphiregulin, and vaccinia growth factor
among other
factors are growth and differentiation modulatory proteins produced by a
variety of cell types
either under normal physiological conditions or in response to exogenous
stimuli and are
members of the EGF family.
These peptide growth factors influence wound cells through autocrine and
paracrine
mechanisms. They also play important roles in normal wound healing in tissues
such as skin,
cornea and gastrointestinal tract and all share substantial amino acid
sequence homology
including the conserved placement of three intra-chain disulfide bonds. In
addition, all the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
2
factors of this family bind to a 170,000 molecular weight transmembrane
glycoprotein
receptor and activate the tyrosine kinase activity in the receptor's
cytoplasmic domain
(Buhrow, S.A. et al., J. Bio. Chem., 258:7824-7826 (1983)).
The receptors are expressed by many types of cells including skin
keratinocytes,
fibroblasts, vascular endothelial cells, and epithelial cells of the GI tract.
These peptide
growth factors are synthesized by several cells involved in wound healing
including platelets,
keratinocytes, and activated macrophages. These growth factors have also been
implicated in
both the stimulation of growth and differentiation of certain cells, for
example, neoplasia,
and the inhibition of other types of cells.
Betacellulin is a 32-kilodalton glycoprotein that appears to be processed from
a larger
transmembrane precursor by proteolytic cleavage. The carboxyl-terminal domain
of
betacellulin has 50% sequence similarity with that of rat transforming growth
factor a.
Betacellulin is a potent mitogen for retinal pigment epithelial cells and
vascular smooth
muscle cells.
Amphiregulin is a bifunctional cell growth regulatory factor which exhibits
potent
inhibitory activity on DNA synthesis in neoplastic cells, yet promotes the
growth of certain
normal cells. A wide variety of uses for amphiregulin have been assigned
including the
treatment of wounds and cancers. For example, amphiregulin has potent anti-
proliferative
effects in vitro on several human cancer cell lines of epithelial origin.
Amphiregulin also
induces the proliferation of human foreskin fibroblasts as shown in United
States Patent
Application No. 5,115,096.
TGF alpha has pleiotropic biological effects. The production of certain
members of
TGF alpha is synthesized by a number of oncogenically transformed fibroblasts
(Ciardiello et
al., J. Cell Biochem., 42:45-57 (1990)) , as well as by a variety of tumors,
including renal,
breast and squamous carcinomas, melanomas and glioblastomas (Derynck, R. et
al., Cancer
Res., 47:707-712 (1987)). There is direct evidence that TGF alpha expression
can be a
contributing factor in the conversion of a normal cell to its tumorigenic
counterpart by
analyzing transgenic mice in which tumor cells express high levels of TGF
alpha. TGF alpha
transgenic animals display a variety of neoplastic lesions, depending on the
strain of mouse
and the choice of promotor regulating TGF alpha expression (Sandgren, et al.,
Cell,
61:1121-1135 (1990)).
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
3
TGF alpha also plays a role in normal embryonic development and adult
physiology
(Derynck, R. Adv. Cancer Res., 58:27-5 (1992)). TGF alpha has been expressed
in many
tissues including skin, brain, gastrointestinal mucosa and activating
macrophages.
Accordingly, TGF alpha is an important factor in controlling growth of
epithelial cells and
has a role in wound healing. TGF alpha has also been found to be angiogenic
(Schreiber, et
al., Science, 232:1250-1253 (1986)).
Thus, there is a need for polypeptides that proliferation of cells, since
disturbances of
such regulation may be involved in disorders, such as cancer. Therefore, there
is a need for
identification and characterization of such human polypeptides which can play
a role in
detecting, preventing, ameliorating or correcting such disorders.
Summary of the Invention
The present invention relates to novel polynucleotides and the encoded
polypeptides
of TGF alpha HITI. Moreover, the present invention relates to vectors, host
cells, antibodies,
and recombinant and synthetic methods for producing the polypeptides and
polynucleotides.
Also provided are diagnostic methods for detecting disorders and conditions
related to the
polypeptides and polynucleotides, and therapeutic methods for treating such
disorders and
conditions. The invention further relates to screening methods for identifying
binding
partners of TGF alpha HIII.
Additionally, the polypeptide of the present invention has been putatively
identified
as transforming growth factor TGF alphaHIII. This identification has been made
as a result
of amino acid sequence homology to human TGFa.
In accordance with one aspect of the present invention, there are provided
novel
mature polypeptides, as well as biologically active and diagnostically or
therapeutically
useful fragments, analogs and derivatives thereof. The polypeptides of the
present invention
are of human origin.
In accordance with another aspect of the present invention, there are provided
isolated nucleic acid molecules encoding the polypeptides of the present
invention, including
mRNAs, cDNAs, genomic DNAs as well as analogs and biologically active and
diagnostically or therapeutically useful fragments thereof.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
4
In accordance with another aspect of the present invention there is provided
isolated
nucleic acid molecule encoding a mature polypeptide expressed by the human
cDNA
contained in ATCC Deposit No. 97342.
In accordance with yet a further aspect of the present invention, there are
provided
processes for producing such polypeptide by recombinant techniques comprising
culturing
recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic
acid sequence
encoding a polypeptide of the present invention.
In accordance with yet a further aspect of the present invention, there are
provided
processes for utilizing such polypeptides, or polynucleotides encoding such
polypeptides for
therapeutic purposes, for example, to stimulate wound healing to restore
normal neurological
functioning after trauma or AIDS dementia, to treat ocular disorders, to
target certain cells, to
treat kidney and liver disorders and, to promote hair follicular development,
to stimulate
angiogenesis for the treatment of burns, ulcers and corneal incisions and to
stimulate
embryogenesis.
In accordance with yet a further aspect of the present invention, there is
also provided
nucleic acid probes comprising nucleic acid molecules of sufficient length to
specifically
hybridize to nucleic acid sequences of the present invention.
In accordance with yet a further aspect of the present invention, there are
provided
antibodies against such polypeptides.
In accordance with yet a further aspect of the present invention, there are
provided
agonists to the polypeptide of the present invention.
In accordance with yet another aspect of the present invention, there are
provided
antagonists to such polypeptides, which may be used to inhibit the action of
such
polypeptides, for example, in the treatment of corneal inflammation,
neoplasia, for example,
tumors and cancers and for psoriasis.
In accordance with still another aspect of the present invention, there are
provided
diagnostic assays for detecting diseases related to overexpression of the
polypeptide of the
present invention and mutations in the nucleic acid sequences encoding such
polypeptide.
In accordance with yet a further aspect of the present invention, there is
provided a
process for utilizing such polypeptides, or polynucleotides encoding such
polypeptides, for in
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
vitro purposes related to scientific research, synthesis of DNA and
manufacture of DNA
vectors.
These and other aspects of the present invention should be apparent to those
skilled in
the art from the teachings herein.
5
Brief Description of the Drawings
Figure 1 depicts the cDNA sequence (SEQ ID NO:1) and corresponding deduced
amino acid sequence (SEQ ID N0:2) of TGF alpha HIII. The standard one letter
abbreviations for amino acids are used. The putative signal sequence has been
underlined.
Figure 2 is an illustration of comparative amino acid sequence homology
between
TGF alpha HIII (top line) and human TGF alpha -HI (bottom line; SEQ ID N0:3).
Darkened
amino acids denote the conserved EGF motif domain which is shown to be
conserved in the
polypeptide of the present invention. By examining the regions of amino acids
shaded and/or
boxed, the skilled artisan can readily identify conserved domains between the
two
polypeptides. These conserved domains are preferred embodiments of the present
invention.
Figure 3 shows an analysis of the TGF alpha HIII amino acid sequence. Alpha,
beta,
turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions;
flexible
regions; antigenic index and surface probability are shown, and all were
generated using the
default settings. In the "Antigenic Index or Jameson-Wolf' graph, the positive
peaks indicate
locations of the highly antigenic regions of the TGF alpha HIII protein, i.e.,
regions from
which epitope-bearing peptides of the invention can be obtained. The domains
defined by
these graphs are contemplated by the present invention.
The data presented in Figure 3 are also represented in tabular form in Table
I. The
columns are labeled with the headings "Res", "Position", and Roman Numerals I-
XIV. The
column headings refer to the following features of the amino acid sequence
presented in
Figure 3, and Table I: "Res": amino acid residue of SEQ ID N0:2 and Figures 1A
and 1B;
"Position": position of the corresponding residue within SEQ ID N0:2 and
Figures 1A and
1B; I: Alpha, Regions - Gamier-Robson; II: Alpha, Regions - Chou-Fasman; III:
Beta,
Regions - Gamier-Robson; IV: Beta, Regions - Chou-Fasman; V: Turn, Regions -
Garnier-Robson; VI: Turn, Regions - Chou-Fasman; VII: Coil, Regions - Gamier-
Robson;
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
6
VIII: Hydrophilicity Plot - Kyte-Doolittle; IX: Hydrophobicity Plot - Hopp-
Woods; X: Alpha,
Amphipathic Regions - Eisenberg; XI: Beta, Amphipathic Regions - Eisenberg;
XII: Flexible
Regions - Karplus-Schulz; XIII: Antigenic Index - Jameson-Wolf; and XIV:
Surface
Probability Plot - Emini.
S Figure 4 shows TGF alpha HIII stimulatory activity in AoSMC alamar blue
proliferation assay. Lanes 1 and 2 are negative controls and lane 4 is PDGF-
BB, a positive
protein control.
Detailed Description
Definitions
The following definitions are provided to facilitate understanding of certain
terms
used throughout this specification.
In the present invention, "isolated" refers to material removed from its
original
environment (e.g., the natural environment if it is naturally occurring), and
thus is altered "by
the hand of man" from its natural state. For example, an isolated
polynucleotide could be part
of a vector or a composition of matter, or could be contained within a cell,
and still be
"isolated" because that vector, composition of matter, or particular cell is
not the original
environment of the polynucleotide. The term "isolated" does not refer to
genomic or cDNA
libraries, whole cell total or mRNA preparations, genomic DNA preparations
(including those
separated by electrophoresis and transferred onto blots), sheared whole cell
genomic DNA
preparations or other compositions where the art demonstrates no
distinguishing features of
the polynucleotide/sequences of the present invention.
In the present invention, a "secreted" TGF alpha HIII protein refers to a
protein
capable of being directed to the ER, secretory vesicles, or the extracellular
space as a result of
a signal sequence, as well as a TGF alpha HIII protein released into the
extracellular space
without necessarily containing a signal sequence. If the TGF alpha HIII
secreted protein is
released into the extracellular space, the TGF alpha HIII secreted protein can
undergo
extracellular processing to produce a "mature" TGF alpha HIII protein. Release
into the
extracellular space can occur by many mechanisms, including exocytosis and
proteolytic
cleavage.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
7
As used herein, a TGF alpha HIII "polynucleotide" refers to a molecule having
a
nucleic acid sequence contained in SEQ ID NO:1 or the cDNA contained within
the clone
deposited with the ATCC. For example, the TGF alpha HIII polynucleotide can
contain the
nucleotide sequence of the full length cDNA sequence, including the 5' and 3'
untranslated
sequences, the coding region, with or without the signal sequence, the
secreted protein coding
region, as well as fragments, epitopes, domains, and variants of the nucleic
acid sequence.
Moreover, as used herein, a TGF alpha HIII "polypeptide" refers to a molecule
having the
translated amino acid sequence generated from the polynucleotide as broadly
defined.
In specific embodiments, the polynucleotides of the invention are at least 15,
at least
30, at least 50, at least 100, at least 125, at least 500, or at least 1000
continuous nucleotides
but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb,
7.5kb, 5 kb, 2.5 kb,
2.0 kb, or 1 kb, in length. In a further embodiment, polynucleotides of the
invention
comprise a portion of the coding sequences, as disclosed herein, but do not
comprise all or a
portion of any intron. In another embodiment, the polynucleotides comprising
coding
sequences do not contain coding sequences of a genomic flanking gene (i.e., 5'
or 3' to the
TGF alpha HI>I gene of interest in the genome). In other embodiments, the
polynucleotides
of the invention do not contain the coding sequence of more than 1000, 500,
250, 100, 50, 25,
20, 15, 10, 5, 4, 3, 2, or 1 genomic flanking gene(s).
In the present invention, the full length TGF alpha HIII sequence identified
as SEQ ID
NO:1 was generated by overlapping sequences of the deposited clone (contig
analysis). A
representative clone containing all or most of the sequence for SEQ ID NO:1
was deposited
with the American Type Culture Collection ("ATCC") on November 20, 1995, and
was
given the ATCC Deposit Number 97342. The ATCC is located at 10801 University
Boulevard, Manassas, VA 20110-2209, USA. The ATCC deposit was made pursuant to
the
terms of the Budapest Treaty on the international recognition of the deposit
of
microorganisms for purposes of patent procedure.
A TGF alpha HIII "polynucleotide" also includes those polynucleotides capable
of
hybridizing, under stringent hybridization conditions, to sequences contained
in SEQ >D
NO:1, the complement thereof, or the cDNA within the deposited clone.
"Stringent
hybridization conditions" refers to an overnight incubation at 42 degree C in
a solution
comprising 50% formamide, 5x SSC (750 mM NaCI, 75 mM trisodium citrate), 50 mM
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
8
sodium phosphate (pH 7.6), Sx Denhardt's solution, 10% dextran sulfate, and 20
pg/ml
denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx
SSC at about
65 degree C.
Also contemplated are nucleic acid molecules that hybridize to the TGF alpha
HIII
polynucleotides lower stringency hybridization conditions. Changes in the
stringency of
hybridization and signal detection are primarily accomplished through the
manipulation of
formamide concentration (lower percentages of formamide result in lowered
stringency); salt
conditions, or temperature. For example, lower stringency conditions include
an overnight
incubation at 37 degree C in a solution comprising 6X SSPE (20X SSPE = 3M
NaCI; 0.2M
NaHZP04; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 ug/ml salmon sperm
blocking DNA; followed by washes at 50 degree C with 1XSSPE, 0.1% SDS. In
addition, to
achieve even lower stringency, washes performed following stringent
hybridization can be
done at higher salt concentrations (e.g. 5X SSC).
Note that variations in the above conditions may be accomplished through the
inclusion and/or substitution of alternate blocking reagents used to suppress
background in
hybridization experiments. Typical blocking reagents include Denhardt's
reagent, BLOTTO,
heparin, denatured salmon sperm DNA, and commercially available proprietary
formulations.
The inclusion of specific blocking reagents may require modification of the
hybridization
conditions described above, due to problems with compatibility.
Of course, a polynucleotide which hybridizes only to polyA+ sequences (such as
any
3' terminal polyA+ tract of a cDNA shown in the sequence listing), or to a
complementary stretch of T (or U) residues, would not be included in the
definition of
"polynucleotide," since such a polynucleotide would hybridize to any nucleic
acid molecule
containing a poly (A) stretch or the complement thereof (e.g., practically any
double-stranded
cDNA clone generated using digo dT as a primer).
The TGF alpha H>ZI polynucleotide can be composed of any polyribonucleotide or
. polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA
or DNA.
For example, TGF alpha HIII polynucleotides can be composed of single- and
double
stranded DNA, DNA that is a mixture of single- and double-stranded regions,
single- and
double-stranded RNA, and RNA that is mixture of single- and double-stranded
regions,
hybrid molecules comprising DNA and RNA that may be single-stranded or, more
typically,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
9
double-stranded or a mixture of single- and double-stranded regions. In
addition, the TGF
alpha HIII polynucleotides can be composed of triple-stranded regions
comprising RNA or
DNA or both RNA and DNA. TGF alpha HIII polynucleotides may also contain one
or more
modified bases or DNA or RNA backbones modified for stability or for other
reasons.
"Modified" bases include, for example, tritylated bases and unusual bases such
as inosine. A
variety of modifications can be made to DNA and RNA; thus, "polynucleotide"
embraces
chemically, enzymatically, or metabolically modified forms.
TGF alpha HIII polypeptides can be composed of amino acids joined to each
other by
peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may
contain amino acids
other than the 20 gene-encoded amino acids. The TGF alpha HIII polypeptides
may be
modified by either natural processes, such as posttranslational processing, or
by chemical
modification techniques which are well known in the art. Such modifications
are well
described in basic texts and in more detailed monographs, as well as in a
voluminous research
literature. Modifications can occur anywhere in the TGF alpha HIII
polypeptide, including
the peptide backbone, the amino acid side-chains and the amino or carboxyl
termini. It will
be appreciated that the same type of modification may be present in the same
or varying
degrees at several sites in a given TGF alpha HIII polypeptide. Also, a given
TGF alpha HIII
polypeptide may contain many types of modifications. TGF alpha HIII
polypeptides may be
branched , for example, as a result of ubiquitination, and they may be cyclic,
with or without
branching. Cyclic, branched, and branched cyclic TGF alpha HIII polypeptides
may result
from posttranslation natural processes or may be made by synthetic methods.
Modifications
include acetylation, acylation, ADP-ribosylation, amidation, covalent
attachment of flavin,
covalent attachment of a heme moiety, covalent attachment of a nucleotide or
nucleotide
derivative, covalent attachment of a lipid or lipid . derivative, covalent
attachment of
phosphotidylinositol, cross-linking, cyclization, disulfide bond formation,
demethylation,
formation of covalent cross-links, formation of cysteine, formation of
pyroglutamate,
formylation, gamma-carboxylation, glycosylation, GPI anchor formation,
hydroxylation,
iodination, methylation, myristoylation, oxidation, pegylation, proteolytic
processing,
phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-
RNA mediated
addition of amino acids to proteins such as arginylation, and ubiquitination.
(See, for
instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
Creighton, W. H. Freeman and Company, New York (1993); POSTTRANSLATIONAL
COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New
York, pgs. 1-12 (1983); Seifter et al., Meth Enzymol 182:626-646 (1990);
Rattan et al., Ann
NY Acad Sci 663:48-62 (1992).)
5 "SEQ >D NO:1" refers to a TGF alpha HIII polynucleotide sequence while "SEQ
ID
N0:2" refers to a TGF alpha HIII polypeptide sequence.
A TGF alpha H>ZI polypeptide "having biological activity" refers to
polypeptides
exhibiting activity similar, but not necessarily identical to, an activity of
a TGF alpha HIII
polypeptide, including mature forms, as measured in a particular biological
assay, with or
10 without dose dependency. In the case where dose dependency does exist, it
need not be
identical to that of the TGF alpha HI11 polypeptide, but rather substantially
similar to the
dose-dependence in a given activity as compared to the TGF alpha HIII
polypeptide (i.e., the
candidate polypeptide will exhibit greater activity or not more than about 25-
fold less' and,
preferably, not more than about tenfold less activity, and most preferably,
not more than
about three-fold less activity relative to the TGF alpha HIII polypeptide.)
TGF alpha HIII Polynucleotides and Polyueptides
In accordance with an aspect of the present invention, there is provided an
isolated
nucleic acid (polynucleotide) which encodes for the mature polypeptide having
the deduced
amino acid sequence of Figure 1 (SEQ ID NO: 2).
The polynucleotide of this invention was discovered in a human testes cDNA
library.
It is structurally related to the TGF alpha gene family. It contains an open
reading frame
encoding a polypeptide of 229 amino acids, which exhibits significant homology
to a number
of members of the TGF alpha gene family; these members include TGF alpha
itself as well
as other members such as amphiregulin and cripto. Furthermore, the six
cysteine residues
occurring in all members in a characteristic motif are conserved in TGF alpha
HIII.
The full-length polypeptide of the present invention as set forth in Figure 1
(SEQ >D
N0:2) has a putative signal sequence which comprises amino acid 1 through
amino acid 25
of Figure 1 (SEQ ID N0:2) which aids in secretion of the polypeptide from the
cell. Amino
acid 126 through amino acid 177 of SEQ ID N0:2 represent the active site of
the protein of
the present invention. Further, amino acid 178 through amino acid 204
represents a putative
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
11
transmembrane portion which is thought to be necessary to direct the
polypeptide to
particular target locations for the carrying out of biological functions as
hereinafter
described. The transmembrane portion may also be cleaved from the polypeptide
such that
the putative soluble portion of the polypeptide of the present invention
comprises amiino
acid 1 through amino acid 177 of SEQ ID N0:2. The protein exhibits the highest
degree of
homology to TGF alpha.
In accordance with another aspect of the present invention there are provided
isolated
polynucleotides encoding a mature polypeptide expressed by the DNA contained
in ATCC
Deposit No. 97342, deposited with the American Type Culture Collection, 12301
Park Lawn
Drive, Rockville, Maryland 20852, USA, on November 20, 1995. The deposited
material is a
bluescript plasmid (Stratagene, La Jolla, CA) that contains the full-length
TGF alpha HIII
cDNA. The deposit has been made under the terms of the Budapest Treaty on the
International Recognition of the Deposit of Microorganisms for purposes of
Patent
Procedure. The strain will be irrevocably and without restriction or condition
released to the
public upon the issuance of a patent. These deposits are provided merely as
convenience to
those of skill in the art and are not an admission that a deposit is required
under 35 U.S.C.
~ 112. The sequence of the polynucleotides contained in the deposited
materials, as well as
the amino acid sequence of the polypeptides encoded thereby, are controlling
in the event of
any conflict with any description of sequences herein. A license may be
required to make,
use or sell the deposited materials, and no such license is hereby granted.
References to
"polynucleotides" throughout this specification includes the DNA of the
deposit referred to
above.
The~polynucleotide of the present invention may be in the form of RNA or in
the
form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA
may be double-stranded or single-stranded, and if single stranded may be the
coding strand
or non-coding (anti-sense) strand. The coding sequence which encodes the
mature
polypeptide may be identical to the coding sequence shown in Figure 1 (SEQ ID
NO: l ) or
may be a different coding sequence which coding sequence, as a result of the
redundancy or
degeneracy of the genetic code, encodes the same mature polypeptide as the DNA
of Figure
1 (SEQ ID NO:1 ).
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
12
The polynucleotide which encodes for the mature polypeptide of Figure 1 (SEQ
>D
N0:2) may include, but is not limited to: only the coding sequence for the
mature
polypeptide; the coding sequence for the mature polypeptide and additional
coding sequence
such as a leader or secretory sequence or a proprotein sequence; the coding
sequence for the
mature polypeptide (and optionally additional coding sequence) and non-coding
sequence,
such as introns or non-coding sequence 51 and/or 31 of the coding sequence for
the mature
polypeptide.
Thus, the term "polynucleotide encoding a polypeptide" encompasses a
polynucleotide which includes only coding sequence for the polypeptide as well
as a
polynucleotide which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the hereinabove described
polynucleotides which encode for fragments, analogs and derivatives of the
polypeptide
having the deduced amino acid sequence of Figure 1 (SEQ ID N0:2). The variant
of the
polynucleotide may be a naturally occurnng allelic variant of the
polynucleotide or a
non-naturally occurnng variant of the polynucleotide.
Thus, the present invention, includes polynucleotides encoding the same mature
polypeptide as shown in Figure 1 (SEQ >D N0:2) as well as variants of such
polynucleotides
which variants encode for a fragment, derivative or analog of the polypeptide
of Figure 1
(SEQ ID N0:2). Such nucleotide variants include deletion variants,
substitution variants and
addition or insertion variants.
As hereinabove indicated, the polynucleotide may have a coding sequence which
is a
naturally occurnng allelic variant of the coding sequence shown in Figure 1
(SEQ >D NO:1).
As known in the art, an allelic variant is an alternate form of a
polynucleotide sequence
which may have a substitution, deletion or addition of one or more
nucleotides, which does
not substantially alter the function of the encoded polypeptide.
The present invention also includes polynucleotides, wherein the coding
sequence for
the mature polypeptide may be fused in the same reading frame to a
polynucleotide sequence
which aids in expression and secretion of a polypeptide from a host cell, for
example, a
leader sequence which functions as a secretory sequence for controlling
transport of a
polypeptide from the cell. The polypeptide having a leader sequence is a
preprotein and may
have the leader sequence cleaved by the host cell to form the mature form of
the polypeptide.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
13
The polynucleotides may also encode for a proprotein which is the mature
protein plus
additional 5' amino acid residues. A mature protein having a prosequence is a
proprotein
and is an inactive form of the protein. Once the prosequence is cleaved an
active mature
protein remains. Thus, for example, the polynucleotide of the present
invention may encode
for a mature protein, or for a protein having a prosequence or for a protein
having both a
prosequence and a presequence (leader sequence).
The polynucleotides of the present invention may also have the coding sequence
fused in frame to a marker sequence which allows for purification of the
polypeptide of the
present invention. The marker sequence may be a hexa-histidine tag supplied by
a pQE-9
vector to provide for purification of the mature polypeptide fused to the
marker in the case of
a bacterial host, or, for example, the marker sequence may be a hemagglutinin
(HA) tag
when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an
epitope
derived from the influenza hemagglutinin protein (Wilson, L, et al., Cell,
37:767 (1984)).
The term "gene" means the segment of DNA involved in producing a polypeptide
chain; it includes regions preceding and following the coding region (leader
and trailer) as
well as intervening sequences (introns) between individual coding segments
(exons).
The TGF alpha HIII nucleotide sequence identified as SEQ LD NO:1 was assembled
from partially homologous ("overlapping") sequences obtained from the
deposited clone. The
overlapping sequences were assembled into a single contiguous sequence of high
redundancy
resulting in a final sequence identified as SEQ 117 NO:1.
Therefore, SEQ m NO:I and the translated SEQ ID N0:2 are sufficiently accurate
and otherwise suitable for a variety of uses well known in the art and
described further below.
For instance, SEQ ID NO:1 is useful for designing nucleic acid hybridization
probes that will
detect nucleic acid sequences contained in SEQ ID NO:1 or the cDNA contained
in the
deposited clone. These probes will also hybridize to nucleic acid molecules in
biological
samples, thereby enabling a variety of forensic and diagnostic methods of the
invention.
Similarly, polypeptides identified from SEQ ID N0:2 may be used, for example,
to generate
antibodies which bind specifically to proteins TGF alpha HIII.
Nevertheless, DNA sequences generated by sequencing reactions can contain
sequencing errors. The errors exist as misidentified nucleotides, or as
insertions or deletions
of nucleotides in the generated DNA sequence. The erroneously inserted or
deleted
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
14
nucleotides cause frame shifts in the reading frames of the predicted amino
acid sequence. In
these cases, the predicted amino acid sequence diverges from the actual amino
acid sequence,
even though the generated DNA sequence may be greater than 99.9% identical to
the actual
DNA sequence (for example, one base insertion or deletion in an open reading
frame of over
1000 bases).
Accordingly, for those applications requiring precision in the nucleotide
sequence or
the amino acid sequence, the present invention provides not only the generated
nucleotide
sequence identified as SEQ ID NO:1 and the predicted translated amino acid
sequence
identified as SEQ 117 N0:2, but also a sample of plasmid DNA containing a
human cDNA of
TGF alpha HIII deposited with the ATCC. The nucleotide sequence of the
deposited TGF
alpha HIII clone can readily be determined by sequencing the deposited clone
in accordance
with known methods. The predicted TGF alpha HIII amino acid sequence can then
be
verified from such deposits. Moreover, the amino acid sequence of the protein
encoded by
the deposited clone can also be directly determined by peptide sequencing or
by expressing
the protein in a suitable host cell containing the deposited human TGF alpha
HIII cDNA,
collecting the protein, and determining its sequence.
The present invention also relates to the TGF alpha HILI gene corresponding to
SEQ
ID NO:1, SEQ >D N0:2, or the deposited clone. The TGF alpha HIII gene can be
isolated in
accordance with known methods using the sequence information disclosed herein.
Such
methods include preparing probes or primers from the disclosed sequence and
identifying or
amplifying the TGF alpha HIII gene from appropriate sources of genomic
material.
Also provided in the present invention are allelic variants, orthologs, and/or
species
homologs. Procedures known in the art can be used to obtain full-length genes,
allelic
variants, splice variants, full-length coding portions, orthologs, and/or
species homologs of
genes corresponding to SEQ ID NO:1, SEQ ID N0:2, or a the deposited clone,
using
information from the sequences disclosed herein or the clones deposited with
the ATCC. For
example, allelic variants and/or species homologs may be isolated and
identified by making
suitable probes or primers from the sequences provided herein and screening a
suitable
nucleic acid source for allelic variants and/or the desired homologue.
The TGF alpha HIII polypeptides can be prepared in any suitable manner. Such
polypeptides include isolated naturally occurnng polypeptides, recombinantly
produced
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
polypeptides, synthetically produced polypeptides, or polypeptides produced by
a
combination of these methods. Means for preparing such polypeptides are well
understood in
the art.
The TGF alpha HIII polypeptides may be in the form of the secreted protein,
including
5 the mature form, or may be a part of a larger protein, such as a fusion
protein (see below). It
is often advantageous to include an additional amino acid sequence which
contains secretory
or leader sequences, pro-sequences, sequences which aid in purification, such
as multiple
histidine residues, or an additional sequence for stability during recombinant
production.
TGF alpha HIII polypeptides are preferably provided in an isolated form, and
10 preferably are substantially purified. A recombinantly produced version of
a TGF alpha HIII
polypeptide, including the secreted polypeptide, can be substantially purified
using techniques
described herein or otherwise known in the art, such as, for example, by the
one-step method
described in Smith and Johnson, Gene 67:31-40 (1988). TGF alpha HIII
polypeptides also
can be purified from natural, synthetic or recombinant sources using
techniques described
15 herein or otherwise known in the art, such as, for example, antibodies of
the invention raised
against the TGF alpha HIII protein.
The present invention provides a polynucleotide comprising, or alternatively
consisting of, the nucleic acid sequence of SEQ m NO:1, and/or a cDNA
contained in ATCC
deposit 97342. The present invention also provides a polypeptide comprising,
or
alternatively, consisting of, the polypeptide sequence of SEQ ID N0:2 and/or a
polypeptide
encoded by the cDNA contained in ATCC deposit 97342. Polynucleotides encoding
a
polypeptide comprising, or alternatively consisting of the polypeptide
sequence of SEQ ID
N0:2 and/or a polypeptide sequence encoded by the cDNA contained in ATCC
deposit
97342 are also encompassed by the invention.
Signal Seguences
The present invention also encompasses mature forms of the polypeptide having
the
polypeptide sequence of SEQ >D N0:2 and/or the polypeptide sequence encoded by
the
cDNA in a deposited clone. Polynucleotides encoding the mature forms (such as,
for
example, the polynucleotide sequence in SEQ 117 NO:1 and/or the polynucleotide
sequence
contained in the cDNA of a deposited clone) are also encompassed by the
invention.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
16
According to the signal hypothesis, proteins secreted by mammalian cells have
a signal or
secretary leader sequence which is cleaved from the mature protein once export
of the
growing protein chain across the rough endoplasmic reticulum has been
initiated. Most
mammalian cells and even insect cells cleave secreted proteins with the same
specificity.
However, in some cases, cleavage of a secreted protein is not entirely
uniform, which results
in two or more mature species of the protein. Further, it has long been known
that cleavage
specificity of a secreted protein is ultimately determined by the primary
structure of the
complete protein, that is, it is inherent in the amino acid sequence of the
polypeptide.
Methods for predicting whether a protein has a signal sequence, as well as the
cleavage point for that sequence, are available. For instance, the method of
McGeoch, Virus
. Res. 3:271-286 (1985), uses the information from a short N-terminal charged
region and a
subsequent uncharged region of the complete (uncleaved) protein. The method of
von
Heinje, Nucleic Acids Res. 14:4683-4690 (1986) uses the information from the
residues
surrounding the cleavage site, typically residues -13 to +2, where +1
indicates the amino
terminus of the secreted protein. The accuracy of predicting the cleavage
points of known
mammalian secretory proteins for each of these methods is in the range of 75-
80%. (von
Heinje, supra.) However, the two methods do not always produce the same
predicted
cleavage points) for a given protein.
In the present case, the deduced amino acid sequence of the secreted
polypeptide was
analyzed by a computer program called SignalP (Henrik Nielsen et al., Protein
Engineering
10:1-6 (1997)), which predicts the cellular location of a protein based on the
amino acid
sequence. As part of this computational prediction of localization, the
methods of McGeoch
and von Heinj a are incorporated.
As one of ordinary skill would appreciate, however, cleavage sites sometimes
vary
from organism to organism and cannot be predicted with absolute certainty.
Accordingly, the
present invention provides secreted polypeptides having a sequence shown in
SEQ ID N0:2
which have an N-terminus beginning within 5 residues (i.e., + or - 5 residues)
of the predicted
cleavage point. Similarly, it is also recognized that in some cases, cleavage
of the signal
sequence from a secreted protein is not entirely uniform, resulting in more
than one secreted
species. These polypeptides, and the polynucleotides encoding such
polypeptides, are
contemplated by the present invention.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
17
Moreover, the signal sequence identified by the above analysis may not
necessarily
predict the naturally occurring signal sequence. For example, the naturally
occurring signal
sequence may be further upstream from the predicted signal sequence. However,
it is likely
that the predicted signal sequence will be capable of directing the secreted
protein to the ER.
Nonetheless, the present invention provides the mature protein produced by
expression of the
polynucleotide sequence of SEQ m NO:1 and/or the polynucleotide sequence
contained in
the cDNA of a deposited clone, in a mammalian cell (e.g., COS cells, as
desribed below).
These polypeptides, and the polynucleotides encoding such polypeptides, are
contemplated by
the present invention.
Polynucleotide and Polypeptide Variants
The present invention is directed to variants of the polynucleotide sequence
disclosed
in SEQ m NO:1, the complementary strand thereto, and/or the cDNA sequence
contained in
a deposited clone.
The present invention also encompasses variants of the polypeptide sequence
disclosed in SEQ >D N0:2 and/or encoded by a deposited clone.
"Variant" refers to a polynucleotide or polypeptide differing from the TGF
alpha H>TI
polynucleotide or polypeptide, but retaining essential properties thereof.
Generally, variants
are overall closely similar, and, in many regions, identical to the TGF alpha
H>TI
polynucleotide or polypeptide.
The present invention is also directed to nucleic acid molecules which
comprise, or
alternatively consist of, a nucleotide sequence which is at least 70%, 80%,
85%, 90%, 95%,
96%, 97%, 98% or 99% identical to, for example, the nucleotide coding sequence
in SEQ >D
NO:1 or the complementary strand thereto, the nucleotide coding sequence
contained in a
deposited cDNA clone or the complementary strand thereto, a nucleotide
sequence encoding
the polypeptide of SEQ >D N0:2, a nucleotide sequence encoding the polypeptide
encoded by
the cDNA contained in a deposited clone, and/or polynucleotide fragments of
any of these
nucleic acid molecules (e.g., those fragments described herein).
Polynucleotides which
hybridize to these nucleic acid molecules under stringent hybridization
conditions or lower
stringency conditions are also encompassed by the invention, as are
polypeptides encoded by
these polynucleotides.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
18
The present invention is also directed to polypeptides which comprise, or
alternatively
consist of, an amino acid sequence which is at least 70%, 80%, 85%, 90%, 95%,
96%, 97%,
98%, 99% identical to, for example, the polypeptide sequence shown in SEQ ID
N0:2, the
polypeptide sequence encoded by the cDNA contained in a deposited clone,
and/or
polypeptide fragments of any of these polypeptides (e.g., those fragments
described herein).
By a nucleic acid having a nucleotide sequence at least, for example, 95%
"identical"
to a reference nucleotide sequence of the present invention, it is intended
that the nucleotide
sequence of the nucleic acid is identical to the reference sequence except
that the nucleotide
sequence may include up to five point mutations per each 100 nucleotides of
the reference
nucleotide sequence encoding the TGF alpha HIII polypeptide. In other words,
to obtain a
nucleic acid having a nucleotide sequence at least 95% identical to a
reference nucleotide
sequence, up to 5% of the nucleotides in the reference sequence may be deleted
or substituted
with another nucleotide, or a number of nucleotides up to 5% of the total
nucleotides in the
reference sequence may be inserted into the reference sequence. The query
sequence may be
an entire sequence shown of SEQ ID NO:1, the ORF (open reading frame), or any
fragment
specified as described herein.
As a practical matter, whether any particular nucleic acid molecule or
polypeptide is at
least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide
sequence of the
presence invention can be determined conventionally using known computer
programs. A
preferred method for determining the best overall match between a query
sequence (a
sequence of the present invention) and a subject sequence, also referred to as
a global
sequence alignment, can be determined using the FASTDB computer program based
on the
algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245.) In a
sequence alignment
the query and subject sequences are both DNA sequences. An RNA sequence can be
compared by converting U's to T's. The result of said global sequence
alignment is in
percent identity. Preferred parameters used in a FASTDB alignment of DNA
sequences to
calculate percent identiy are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=l,
Joining
Penalty=30, Randomization Group Length=0, Cutoff Score=1, Gap Penalty=S, Gap
Size
Penalty 0.05, Window Size=500 or the lenght of the subject nucleotide
sequence, whichever
is shorter.
If the subject sequence is shorter than the query sequence because of 5' or 3'
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
19
deletions, not because of internal deletions, a manual correction must be made
to the results.
This is because the FASTDB program does not account for 5' and 3' truncations
of the
subject sequence when calculating percent identity. For subject sequences
truncated at the 5'
or 3' ends, relative to the query sequence, the percent identity is corrected
by calculating the
number of bases of the query sequence that are 5' and 3' of the subject
sequence, which are
not matched/aligned, as a percent of the total bases of the query sequence.
Whether a
nucleotide is matched/aligned is determined by results of the FASTDB sequence
alignment.
This percentage is then subtracted from the percent identity, calculated by
the above
FASTDB program using the specified parameters, to arnve at a final percent
identity score.
This corrected score is what is used for the purposes of the present
invention. Only bases
outside the 5' and 3' bases of the subject sequence, as displayed by the
FASTDB alignment,
which are not matched/aligned with the query sequence, are calculated for the
purposes of
manually adjusting the percent identity score.
For example, a 90 base subject sequence is aligned to a 100 base query
sequence to
determine percent identity. The deletions occur at the 5' end of the subject
sequence and
therefore, the FASTDB alignment does not show a matched/alignment of the first
10 bases at
5' end. The 10 unpaired bases represent 10% of the sequence (number of bases
at the 5' and
3' ends not matched/total number of bases in the query sequence) so 10% is
subtracted from
the percent identity score calculated by the FASTDB program. If the remaining
90 bases
were perfectly matched the final percent identity would be 90%. In another
example, a 90
base subject sequence is compared with a 100 base query sequence. This time
the deletions
are internal deletions so that there are no bases on the 5' or 3' of the
subject sequence which
are not matched/aligned with the query. In this case the percent identity
calculated by
FASTDB is not manually corrected. Once again, only bases 5' and 3' of the
subject sequence
which are not matched/aligned with the query sequence are manually corrected
for. No other
manual corrections are to made for the purposes of the present invention.
By a polypeptide having an amino acid sequence at least, for example, 95%
"identical" to a query amino acid sequence of the present invention, it is
intended that the
amino acid sequence of the subject polypeptide is identical to the query
sequence except that
the subject polypeptide sequence may include up to five amino acid alterations
per each 100
amino acids of the query amino acid sequence. In other words, to obtain a
polypeptide having
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
an amino acid sequence at least 95% identical to a query amino acid sequence,
up to 5% of
the amino acid residues in the subject sequence may be inserted, deleted,
(indels) or
substituted with another amino acid. These alterations of the reference
sequence may occur at
the amino or carboxy terminal positions of the reference amino acid sequence
or anywhere
5 between those terminal positions, interspersed either individually among
residues in the
reference sequence or in one or more contiguous groups within the reference
sequence.
As a practical matter, whether any particular polypeptide is at least 80%,
85%, 90%,
95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequences
of SEQ ID
N0:2 or to the amino acid sequence encoded by the cDNA contained in a
deposited clone can
10 be determined conventionally using known computer programs. A preferred
method for
determing the best overall match between a query sequence (a sequence of the
present
invention) and a subject sequence, also referred to as a global sequence
alignment, can be
determined using the FASTDB computer program based on the algorithm of Brutlag
et al.
(Comp. App. Biosci. 6:237-245(1990)). In a sequence alignment the query and
subject
15 sequences are either both nucleotide sequences or both amino acid
sequences. The result of
said global sequence alignment is in percent identity. Preferred parameters
used in a
FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=1,
Joining Penalty=20, Randomization Group Length=0, Cutoff Score=1, Window
Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or
the
20 length of the subject amino acid sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence due to N- or C-
terminal
deletions, not because of internal deletions, a manual correction must be made
to the results.
This is because the FASTDB program does not account for N- and C-terminal
truncations of
the subject sequence when calculating global percent identity. For subject
sequences
truncated at the N- and C-termini, relative to the query sequence, the percent
identity is
corrected by calculating the number of residues of the query sequence that are
N- and C-
terminal of the subject sequence, which are not matched/aligned with a
corresponding subject
residue, as a percent of the total bases of the query sequence. Whether a
residue is
matched/aligned is determined by results of the FASTDB sequence alignment.
This
percentage is then subtracted from the percent identity, calculated by the
above FASTDB
program using the specified parameters, to arrive at a final percent identity
score. This final
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
21
percent identity score is what is used for the purposes of the present
invention. Only residues
to the N- and C-termini of the subject sequence, which are not matched/aligned
with the
query sequence, are considered for the purposes of manually adjusting the
percent identity
score. That is, only query residue positions outside the farthest N- and C-
terminal residues of
the subject sequence.
For example, a 90 amino acid residue subject sequence is aligned with a 100
residue
query sequence to determine percent identity. The deletion occurs at the N-
terminus of the
subject sequence and therefore, the FASTDB alignment does not show a
matching/alignment
of the first 10 residues at the N-terminus. The 10 unpaired residues represent
10% of the
sequence (number of residues at the N- and C- termini not matched/total number
of residues
in the query sequence) so 10% is subtracted from the percent identity score
calculated by the
FASTDB program. If the remaining 90 residues were perfectly matched the final
percent
identity would be 90%. In another example, a 90 residue subject sequence is
compared with
a 100 residue query sequence. This time the deletions are internal deletions
so there are no
residues at the N- or C-termini of the subject sequence which are not
matched/aligned with
the query. In this case the percent identity calculated by FASTDB is not
manually corrected.
Once again, only residue positions outside the N- and C-terminal ends of the
subject
sequence, as displayed in the FASTDB alignment, which are not matched/aligned
with the
query sequnce are manually corrected for. No other manual corrections are to
made for the
purposes of the present invention.
The TGF alpha HIII variants may contain alterations in the coding regions, non-
coding regions, or both. Especially preferred are polynucleotide variants
containing
alterations which produce silent substitutions, additions, or deletions, but
do not alter the
properties or activities of the encoded polypeptide. Nucleotide variants
produced by silent
substitutions due to the degeneracy of the genetic code are preferred.
Moreover, variants in
which 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any
combination are
also preferred. TGF alpha HIII polynucleotide variants can be produced for a
variety of
reasons, e.g., to optimize codon expression for a particular host (change
codons in the human
mRNA to those preferred by a bacterial host such as E. coli).
Naturally occurnng TGF alpha HIII variants are called "allelic variants," and
refer to
one of several alternate forms of a gene occupying a given locus on a
chromosome of an
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
22
organism. (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).)
These allelic
variants can vary at either the polynucleotide and/or polypeptide level and
are included in the
present invention. Alternatively, non-naturally occurring variants may be
produced by
mutagenesis techniques or by direct synthesis.
Using known methods of protein engineering and recombinant DNA technology,
variants may be generated to improve or alter the characteristics of the TGF
alpha HIII
polypeptides. For instance, one or more amino acids can be deleted from the N-
terminus or
C-terminus of the secreted protein without substantial loss of biological
function. The
authors of Ron et al., J. Biol. Chem. 268: 2984-2988 (1993), reported variant
KGF proteins
having heparin binding activity even after deleting 3, 8, or 27 amino-terminal
amino acid
residues. Similarly, Interferon gamma exhibited up to ten times higher
activity after deleting
8-10 amino acid residues from the carboxy terminus of this protein. (Dobeli et
al., J.
Biotechnology 7:199-216 (1988).)
Moreover, ample evidence demonstrates that variants often retain a biological
activity
similar to that of the naturally occurring protein. For example, Gayle and
coworkers (J. Biol.
Chem 268:22105-22111 (1993)) conducted extensive mutational analysis of human
cytokine
IL-la. They used random mutagenesis to generate over 3,500 individual IL-la
mutants that
averaged 2.5 amino acid changes per variant over the entire length of the
molecule. Multiple
mutations were examined at every possible amino acid position. The
investigators found that
"[m]ost of the molecule could be altered with little effect on either [binding
or biological
activity]." (See, Abstract.) In fact, only 23 unique amino acid sequences, out
of more than
3,500 nucleotide sequences examined, produced a protein that significantly
differed in
activity from wild-type.
Furthermore, even if deleting one or more amino acids from the N-terminus or C-
terminus of a polypeptide results in modification or loss of one or more
biological functions,
other biological activities may still be retained. For example, the ability of
a deletion variant
to induce and/or to bind antibodies which recognize the secreted form will
likely be retained
when less than the majority of the residues of the secreted form are removed
from the N-
terminus or C-terminus. Whether a particular polypeptide lacking N- or C-
terminal residues
of a protein retains such immunogenic activities can readily be determined by
routine
methods described herein and otherwise known in the art.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
23
Thus, the invention further includes TGF alpha HIII polypeptide variants which
show
substantial biological activity. Such variants include deletions, insertions,
inversions, repeats,
and substitutions selected according to general rules known in the art so as
have little effect
on activity.
The present application is directed to nucleic acid molecules at least 90%,
95%, 96%,
97%, 98% or 99% identical to the nucleic acid sequences disclosed herein,
(e.g., encoding a
polypeptide having the amino acid sequence of an N and/or C terminal deletion
disclosed
below as m-n of SEQ ID N0:2), irrespective of whether they encode a
polypeptide having
TGF alpha HIII functional activity. This is because even where a particular
nucleic acid
molecule does not encode a polypeptide having TGF alpha HIII functional
activity, one of
skill in the art would still know how to use the nucleic acid molecule, for
instance, as a
hybridization probe or a polymerase chain reaction (PCR) primer. Uses of the
nucleic acid
molecules of the present invention that do not encode a polypeptide having TGF
alpha HIII
functional activity include, inter alia, (1) isolating a TGF alpha HIII gene
or allelic or splice
variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH")
to metaphase
chromosomal spreads to provide precise chromosomal location of the TGF alpha
HIII gene,
as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques,
Pergamon Press, New York (1988); and (3) Northern Blot analysis for detecting
TGF alpha
HaI mRNA expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least 90%,
95%,
96%, 97%, 98% or 99% identical to the nucleic acid sequences disclosed herein,
which do, in
fact, encode a polypeptide having TGF alpha HIII functional activity. By "a
polypeptide
having TGF alpha HIII functional activity" is intended polypeptides exhibiting
activity
similar, but not necessarily identical, to a functional activity of the TGF
alpha HIII
polypeptides of the present invention (e.g., complete (full-length) TGF alpha
HIII, mature
TGF alpha HIII and soluble TGF alpha HIII (e.g., having sequences contained in
the
extracellular domain of TGF alpha HIII) as measured, for example, in a
particular
immunoassay or biological assay. For example, a TGF alpha HIII functional
activity can
routinely be measured by determining the ability of a TGF alpha HIII
polypeptide to bind a
TGF alpha HIII ligand. TGF alpha HIII functional activity may also be measured
by
determining the ability of a polypeptide, such as cognate ligand which is free
or expressed on
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
24
a cell surface, to induce cells expressing the polypeptide.
Of course, due to the degeneracy of the genetic code, one of ordinary skill in
the art
will immediately recognize that a large number of the nucleic acid molecules
having a
sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic
acid sequence
of the deposited cDNA, the nucleic acid sequence shown in Figure 1 (SEQ ID
NO:1), or
fragments thereof, will encode polypeptides "having TGF alpha HIII functional
activity." In
fact, since degenerate variants of any of these nucleotide sequences all
encode the same
polypeptide, in many instances, this will be clear to the skilled artisan even
without
performing the above described comparison assay. It will be further recognized
in the art
that, for such nucleic acid molecules that are not degenerate variants, a
reasonable number
will also encode a polypeptide having TGF alpha HIII functional activity. This
is because the
skilled artisan is fully aware of amino acid substitutions that are either
less likely or not likely
to significantly effect protein function (e.g., replacing one aliphatic amino
acid with a second
aliphatic amino acid), as further described below.
For example, guidance concerning how to make phenotypically silent amino acid
substitutions is provided in Bowie et al., "Deciphering the Message in Protein
Sequences:
Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein
the authors
indicate that there are two main strategies for studying the tolerance of an
amino acid
sequence to change.
The first strategy exploits the tolerance of amino acid substitutions by
natural
selection during the process of evolution. By comparing amino acid sequences
in different
species, conserved amino acids can be identified. These conserved amino acids
are likely
important for protein function. In contrast, the amino acid positions where
substitutions have
been tolerated by natural selection indicates that these positions are not
critical for protein
function. Thus, positions tolerating amino acid substitution could be modified
while still
maintaining biological activity of the protein.
The second strategy uses genetic engineering to introduce amino acid changes
at
specific positions of a cloned gene to identify regions critical for protein
function. For
example, site directed mutagenesis or alanine-scanning mutagenesis
(introduction of single
alanine mutations at every residue in the molecule) can be used. (Cunningham
and Wells,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
Science 244:1081-1085 (1989).) The resulting mutant molecules can then be
tested for
biological activity.
As the authors state, these two strategies have revealed that proteins are
surprisingly
tolerant of amino acid substitutions. The authors further indicate which amino
acid changes
5 are likely to be permissive at certain amino acid positions in the protein.
For example, most
buried (within the tertiary structure of the protein) amino acid residues
require nonpolar side
chains, whereas few features of surface side chains are generally conserved.
Moreover,
tolerated conservative amino acid substitutions involve replacement of the
aliphatic or
hydrophobic amino acids Ala, Val, Leu and Ile; replacement of the hydroxyl
residues Ser and
10 Thr; replacement of the acidic residues Asp and Glu; replacement of the
amide residues Asn
and Gln, replacement of the basic residues Lys, Arg, and His; replacement of
the aromatic
residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids
Ala, Ser, Thr,
Met, and Gly.
For example, site directed changes at the amino acid level of TGF alpha HIII
can be
15 made by replacing a particular amino acid with a conservative amino acid.
Preferred
conservative mutations include: M1 replaced with A, G, I, L, S, T, or V; A2
replaced with G,
I, L, S, T, M, or V; H4 replaced with K, or R; GS replaced with A, I, L, S, T,
M, or V; G7
replaced with A, I, L, S, T, M, or V; S8 replaced with A, G, I, L, T, M, or V;
L9 replaced with
A, G, I,S, T, M, or V; T10 replaced with A, G, I, L, S, M, or V; T11 replaced
with A, G, I, L,
20 S, M, or V; L12 replaced with A, G, I, S, T, M, or V; V 13 replaced with A,
G, I, L, S, T, or
M; W15 replaced with F, or Y; A16 replaced with G, I, L, S, T, M, or V; A17
replaced with
G, I, L, S, T, M, or V; A18 replaced with G, I, L, S, T, M, or V; L19 replaced
with A, G, I, S,
T, M, or V; L20 replaced with A, G, I, S, T, M, or V; L21 replaced with A, G,
I, S, T, M, or
V;A22 replaced with G, I, L, S, T, M, or V; L23 replaced with A, G, I, S, T,
M, or V; G24
25 replaced with A, I, L, S, T, M, or V; V25 replaced with A, G, I, L,S, T, or
M; E26 replaced
with D; R27 replaced with H, or K; A28 replaced with G, I, L, S, T, M, or V;
L29 replaced
with A, G, I, S, T, M, or V; A30 replaced with G, I, L, S, T, M, or V; L31
replaced with A, G,
I, S, T, M, or V; E33 replaced with D; I34 replaced with A, G, L, S, T, M, or
V; T36 replaced
with A, G, I, L, S, M, or V; Q37 replaced with N; G40 replaced with A, I, L,
S, T, M, or V;
S41 replaced with A, G, I, L, T, M, or V; V42 replaced with A,G, I, L, S, T,
or M; Q43
replaced with N; N44 replaced with Q; L45 replaced with A, G, I, S, T, M, or
V; 546 replaced
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
26
with A, G, I, L, T, M, or V; K47replaced with H, or R; V48 replaced with A, G,
I, L, S, T, or
M; A49 replaced with G, I, L, S, T, M, or V; FSO replaced with W, or Y; Y51
replaced with
F, or W; K53 replaced with H, or R; T54 replaced with A, G, I, L, S, M, or V;
TSS replaced
with A, G, I, L, S, M, or V; R56 replaced with H, or K; E57replaced with D;
L58 replaced
with A, G, I, S, T, M, or V; M59 replaced with A, G, I, L, S, T, or V; L60
replaced with A, G,
I, S, T, M, or V; H61 replaced with K, or R; A62 replaced with G, I, L, S, T,
M, or V; R63
replaced with H, or K; L66 replaced with A, G, I, S, T, M, or V; N67 replaced
with Q;
Q68replaced with N; K69 replaced with H, or R; G70 replaced with A, I, L, S,
T, M, or V;
T71 replaced with A, G, I, L, S, M, or V; I72 replaced with A, G, L,S, T, M,
or V; L73
replaced with A, G, I, S, T, M, or V; G74 replaced with A, I, L, S, T, M, or
V; L75 replaced
with A, G, I, S, T, M, or V; D76 replaced with E; L77 replaced with A, G, I,
S, T, M, or V;
Q78 replaced with N; N79 replaced with Q; S81 replaced with A, G, I, L, T, M,
or V; L82
replaced with A,G, I, S, T, M, or V; E83 replaced with D; D84 replaced with E;
G86 replaced
with A, I, L, S, T, M, or V; N88 replaced with Q; F89 replaced with W, or
Y;H90 replaced
with K, or R; Q91 replaced with N; A92 replaced with G, I, L, S, T, M, or V;
H93 replaced
with K, or R; T94 replaced with A, G, I, L, S, M, or V; T95 replaced with A,
G, I, L, S, M, or
V; V96 replaced with A, G, I, L, S, T, or M; I97 replaced with A, G, L, S, T,
M, or V; I98
replaced with A, G,L, S, T, M, or V; D99 replaced with E; L100 replaced with
A, G, I, S, T,
M, or V; Q101 replaced with N; A102 replaced with G, I, L, S, T, M, or V;
N103replaced
with Q; L105 replaced with A, G, I, S, T, M, or V; K106 replaced with H, or R;
6107
replaced with A, I, L, S, T, M, or V; D108 replaced with E;L109 replaced with
A, G, I, S, T,
M, or V; A110 replaced with G, I, L, S, T, M, or V; N111 replaced with Q; T112
replaced
with A, G, I, L, S, M, or V;F113 replaced with W, or Y; 8114 replaced with H,
or K; 6115
replaced with A, I, L, S, T, M, or V; F116 replaced with W, or Y; T117
replaced with A, G,I,
L, S, M, or V; Q118 replaced with N; L119 replaced with A, G, I, S, T, M, or
V; Q120
replaced with N; T121 replaced with A, G, I, L, S, M, or V; L122 replaced with
A, G, I, S, T,
M, or V; I123 replaced with A, G, L, S, T, M, or V; L124 replaced with A, G,
I, S, T, M, or
~V; Q126 replaced with N; H127 replaced with K, or R; V128 replaced with A, G,
I, L, S, T,
or M; N129 replaced with Q; 6132 replaced with A, I, L, S, T, M, or V; 6133
replaced with
A, I,L, S, T, M, or V; I134 replaced with A, G, L, S, T, M, or V; N135
replaced with Q; A136
replaced with G, I, L, S, T, M, or V; W137 replaced with F, or Y;N138 replaced
with Q;
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
27
T139 replaced with A, G, I, L, S, M, or V; I140 replaced with A, G, L, S, T,
M, or V; T141
replaced with A, G, I, L, S, M, or V;S142 replaced with A, G, I, L, T, M, or
V; Y143 replaced
with F, or W; I144 replaced with A, G, L, S, T, M, or V; D145 replaced with E;
N146
replaced with Q; Q147 replaced with N; I148 replaced with A, G, L, S, T, M, or
V; Q150
replaced with N; 6151 replaced with A, I, L, S, T, M, or V; Q152 replaced with
N; K153
replaced with H, or R; N154 replaced with Q; L155 replaced with A, G, I, S, T,
M, or V;
N157 replaced with Q; N158 replaced with Q; T159replaced with A, G, I, L, S,
M, or V;
G 160 replaced with A, I, L, S, T, M, or V; D 161 replaced with E; E 163
replaced with D;
M164 replaced with A, G, I, L,S, T, or V; E167 replaced with D; N168 replaced
with Q;
6169 replaced with A, I, L, S, T, M, or V; S 170 replaced with A, G, I, L, T,
M, or V;
V172replaced with A, G, I, L, S, T, or M; D174 replaced with E; 6175 replaced
with A, I, L,
S, T, M, or V; 6177 replaced with A, I, L, S, T, M, or V; L178 replaced with
A, G, I, S, T, M,
or V; L179 replaced with A, G, I, S, T, M, or V; Q180 replaced with N; V182
replaced with
A, G, I, L, S, T, or M; A184 replaced with G, I, L, S, T, M, or V; D185
replaced with E;
6186 replaced with A, I, L, S, T, M, or V; F187 replaced with W, or Y; H188
replaced with
K, or R; 6189 replaced with A, I, L, S, T, M, or V; Y190 replaced with F, or
W; K191
replaced with H, or R; M193 replaced with A, G, I, L, S, T, or V; R194replaced
with H, or K;
Q195 replaced with N; 6196 replaced with A, I, L, S, T, M, or V; 5197 replaced
with A, G, I,
L, T, M, or V; F198 replaced with W, or Y; 5199 replaced with A, G, I, L, T,
M, or V; L200
replaced with A, G, I, S, T, M, or V; L201 replaced with A, G, I, S, T, M, or
V; M202
replaced with A, G, I, L, S, T, or V; F203 replaced with W, or Y; F204
replaced with W, or
Y; 6205 replaced with A, I, L, S, T, M, or V; I206 replaced with A, G, L, S,T,
M, or V; L207
replaced with A, G, I, S, T, M, or V; 6208 replaced with A, I, L, S, T, M, or
V; A209
replaced with G, I, L, S, T, M, or V; T210 replaced with A, G, I, L, S, M, or
V; T211 replaced
with A, G, I, L, S, M, or V; L212 replaced with A, G, I, S, T, M, or V; 5213
replaced with A,
G, I, L, T, M, or V; V214 replaced with A, G, I, L, S, T, or M; S21 S replaced
with A, G, I, L,
T, M, or V; I216 replaced with A, G, L, S, T, M, or V; L217 replaced with A,G,
I, S, T, M, or
V; L218 replaced with A, G, I, S, T, M, or V; W219 replaced with F, or Y; A220
replaced
with G, I, L, S, T, M, or V; T221 replaced with A, G, I, L, S, M, or V; Q222
replaced with N;
8223 replaced with H, or K; 8224 replaced with H, or K; K225 replaced with H,
or R; A226
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
28
replaced with G,I, L, S, T, M, or V; K227 replaced with H, or R; T228 replaced
with A, G, I,
L, S, M, or V; 5229 replaced with A, G, I, L, T, M, or V.
The resulting constructs can be routinely screened for activities or functions
described
throughout the specification and known in the art. Preferably, the resulting
constructs have
an increased and/or a decreased TGF alpha HIII activity or function, while the
remaining TGF
alpha HIII activities or functions are maintained. More preferably, the
resulting constructs
have more than one increased and/or decreased TGF alpha HIII activity or
function, while the
remaining TGF alpha HIII activities or functions are maintained.
Besides conservative amino acid substitution, variants of TGF alpha HIII
include (i)
substitutions with one or more of the non-conserved amino acid residues, where
the
substituted amino acid residues may or may not be one encoded by the genetic
code, or (ii)
substitution with one or more of amino acid residues having a substituent
group, or (iii)
fusion of the mature polypeptide with another compound, such as a compound to
increase the
stability and/or solubility of the polypeptide (for example, polyethylene
glycol), or (iv) fusion
of the polypeptide with additional amino acids, such as, for example, an IgG
Fc fusion region
peptide, or leader or secretory sequence, or a sequence facilitating
purification. Such variant
polypeptides are deemed to be within the scope of those skilled in the art
from the teachings
herein.
For example, TGF alpha HIII polypeptide variants containing amino acid
substitutions
of charged amino acids with other charged or neutral amino acids may produce
proteins with
improved characteristics, such as less aggregation. Aggregation of
pharmaceutical
formulations both reduces activity and increases clearance due to the
aggregate's
immunogenic activity. (Pinckard et al., Clin. Exp. Immunol. 2:331-340 (1967);
Robbins et
al., Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug
Carrier Systems
(0:307-377 (1993).)
For example, preferred non-conservative substitutions of TGF alpha HIII
include: Ml
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A2 replaced with D, E, H,
K, R, N,Q, F,
W, Y, P, or C; P3 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, or C;
H4 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F,W, Y, P, or C; GS
replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; P6 replaced with D, E, H, K, R, A, G, I, L,
S, T, M, V, N, Q,
F, W, Y, or C; G7replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S8
replaced with D, E,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
29
H, K, R, N, Q, F, W, Y, P, or C; L9 replaced with D, E, H, K, R, N, Q, F,W, Y,
P, or C; T10
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Tl 1 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; L12 replaced with D, E,H, K, R, N, Q, F, W, Y, P, or C; V 13
replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; P14 replaced with D, E, H, K, R, A, G,
I, L, S, T, M,
V, N,Q, F, W, Y, or C; W 15 replaced with D, E, H, K, R, N, Q, A, G, I, L, S,
T, M, V, P, or
C; A16 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A17 replaced with
D, E, H, K, R,
N, Q, F, W, Y, P, or C; A18 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; L19
replaced with D, E, H, K, R, N, Q, F,W, Y, P, or C; L20 replaced with D, E, H,
K, R, N, Q, F,
W, Y, P, or C; L21 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A22
replaced with
D,E, H, K, R, N, Q, F, W, Y, P, or C; L23 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or
C; G24 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;V25 replaced with
D, E, H, K, R,
N, Q, F, W, Y, P, or C; E26 replaced with H, K, R, A, G, I, L, S, T, M, V, N,
Q, F, W, Y, P,
or C; R27 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
A28 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; L29 replaced with D, E, H, K, R,
N, Q, F,W, Y,
P, or C; A30 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L31 replaced
with D, E, H,
K, R, N, Q, F, W, Y, P, or C; P32 replaced with D,E, H, K, R, A, G, I, L, S,
T, M, V, N, Q, F,
W, Y, or C; E33 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; I34
replaced with D,E, H, K, R, N, Q, F, W, Y, P, or C; C35 replaced with D, E, H,
K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, or P; T36 replaced with D, E, H, K, R, N,Q, F,
W, Y, P, or C;
Q37 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C38
replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V,N, Q, F, W, Y, or P; P39 replaced with
D, E, H, K, R, A,
G, I, L, S, T, M, V, N, Q, F, W, Y, or C; G40 replaced with D, E, H, K, R, N,
Q, F, W, Y, P,
or C; S41 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V42 replaced
with D, E, H, K,
R, N, Q, F, W, Y, P, or C; Q43 replaced with D, E, H, K,R, A, G, I, L, S, T,
M, V, F, W, Y,
P, or C; N44 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P,
or C; L45
replaced with D, E, H, K, R,N, Q, F, W, Y, P, or C; S46 replaced with D, E, H,
K, R, N, Q, F,
W, Y, P, or C; K47 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C;V48
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A49 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; F50 replaced with D, E, H, K, R, N,Q, A, G, I, L, S, T, M,
V, P, or C; Y51
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; C52
replaced with D, E, H,
K, R, A, G, I, L,S, T, M, V, N, Q, F, W, Y, or P; K53 replaced with D, E, A,
G, I, L, S, T, M,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
V, N, Q, F, W, Y, P, or C; T54 replaced with D, E, H, K, R, N, Q, F, W,Y, P,
or C; T55
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R56 replaced with D, E,
A, G, I, L, S, T,
M, V, N, Q, F, W, Y, P, or C; E57 replaced with H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W,
Y, P, or C; L58 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M59
replaced with D, E,
5 H, K, R,N, Q, F, W, Y, P, or C; L60 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; H61
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;A62
replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; R63 replaced with D, E, A, G, I, L, S, T, M, V,
N, Q, F, W, Y,
P, or C; C64 replaced with D, E,H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W,
Y, or P; C65
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; L66
replaced with
10 D,E, H, K, R, N, Q, F, W, Y, P, or C; N67 replaced with D, E, H, K, R, A,
G, I, L, S, T, M,
V, F, W, Y, P, or C; Q68 replaced with D, E, H, K, R, A, G, I,L, S, T, M, V,
F, W, Y, P, or C;
K69 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; G70
replaced with D,
E, H, K, R, N, Q, F, W,Y, P, or C; T71 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C;
I72 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L73 replaced with D,
E, H,K, R, N,
15 Q, F, W, Y, P, or C; G74 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; L75 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; D76replaced with H, K, R, A, G, I,
L, S, T, M, V,
N, Q, F, W, Y, P, or C; L77 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; Q78
replaced with D, E,H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; N79
replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; C80 replaced with D, E,
H,K, R, A, G, I, L,
20 S, T, M, V, N, Q, F, W, Y, or P; S81 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C;
L82 replaced with D, E, H, K, R, N, Q, F,W, Y, P, or C; E83 replaced with H,
K, R, A, G, I,
L, S, T, M, V, N, Q, F, W, Y, P, or C; D84 replaced with H, K, R, A, G, I, L,
S, T, M, V, N,
Q, F,W, Y, P, or C; P85 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
N, Q, F, W, Y, or
C; G86 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;P87 replaced with
D, E, H, K, R,
25 A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; N88 replaced with D, E, H, K,
R, A, G, I, L, S, T,
M, V, F, W, Y, P, or C;F89 replaced with D, E, H, K, R, N, Q, A, G, I, L, S,
T, M, V, P, or C;
H90 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
Q9lreplaced with D,
E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; A92 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; H93 replaced with D, E,A, G, I, L, S, T, M, V, N, Q, F, W,
Y, P, or C; T94
30 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T95 replaced with D,
E, H, K, R, N, Q,
F, W,Y, P, or C; V96 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I97
replaced with
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
31
D, E, H, K, R, N, Q, F, W, Y, P, or C; I98 replaced with D, E, H,K, R, N, Q,
F, W, Y, P, or
C; D99 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
L100 replaced
with D, E, H, K, R, N, Q, F, W,Y, P, or C; Q101 replaced with D, E, H, K, R,
A, G, I, L, S, T,
M, V, F, W, Y, P, or C; A102 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C;
N103replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C;
P104 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C;L105 replaced
with D, E, H,
K, R, N, Q, F, W, Y, P, or C; K106 replaced with D, E, A, G, I, L, S, T, M, V,
N, Q, F, W, Y,
P, or C; 6107 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D 108
replaced with H, K,
R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L109 replaced with D, E, H,
K, R,N, Q, F,
W, Y, P, or C; Al 10 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Nl
11 replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y,P, or C; T112 replaced with D,
E, H, K, R, N,
Q, F, W, Y, P, or C; F113 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T,
M, V, P, or C;
R114replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; 6115
replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; F116 replaced with D, E,H, K, R, N, Q,
A, G, I, L, S,
T, M, V, P, or C; T117 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
Q118 replaced
with D, E, H, K, R, A, G, I, L,S, T, M, V, F, W, Y, P, or C; L119 replaced
with D, E, H, K, R,
N, Q, F, W, Y, P, or C; Q120 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, F, W,Y, P,
or C; T121 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L122 replaced
with D, E, H,
K, R, N, Q, F, W, Y, P, or C; I123 replaced with D, E,H, K, R, N, Q, F, W, Y,
P, or C; L124
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P125 replaced with D, E,
H, K, R, A, G,
I, L, S, T, M, V, N,Q, F, W, Y, or C; Q126 replaced with D, E, H, K, R, A, G,
I, L, S, T, M,
V, F, W, Y, P, or C; H127 replaced with D, E, A, G, I, L, S, T, M, V, N, Q,
F,W, Y, P, or C;
V 128 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N129 replaced with
D, E, H, K, R,
A, G, I, L, S, T, M, V, F, W, Y, P, or C;C130 replaced with D, E, H, K, R, A,
G, I, L, S, T,
M, V, N, Q, F, W, Y, or P; P 131 replaced with D, E, H, K, R, A, G, I, L, S,
T, M, V, N, Q, F,
W, Y, or C; 6132 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; 6133
replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; I134 replaced with D, E, H,K, R, N, Q,
F, W, Y, P, or
C; N135 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C;
A136 replaced
with D, E, H, K, R, N, Q, F,W, Y, P, or C; W137 replaced with D, E, H, K, R,
N, Q, A, G, I,
L, S, T, M, V, P, or C; N138 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, F, W,Y, P,
or C; T139 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; I140 replaced
with D, E, H,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
32
K, R, N, Q, F, W, Y, P, or C; T 141 replaced with D, E,H, K, R, N, Q, F, W, Y,
P, or C; S 142
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y143 replaced with D, E,
H, K, R, N, Q,
A, G, I, L, S, T,M, V, P, or C; I144 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C; D 145
replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;N146
replaced with D,
E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; Q147 replaced with D, E,
H, K, R, A, G,
I, L, S, T, M, V, F, W, Y, P, or C;I148 replaced with D, E, H, K, R, N, Q, F,
W, Y, P, or C;
C149 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P;
Q150 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; 6151 replaced
with D, E, H, K,
R, N, Q, F, W, Y, P, or C; Q152 replaced with D, E, H, K,R, A, G, I, L, S, T,
M, V, F, W, Y,
P, or C; K153 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or
C; N154
replaced with D, E, H, K, R,A, G, I, L, S, T, M, V, F, W, Y, P, or C; L155
replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; C156 replaced with D, E, H, K, R, A, G, I,
L, S, T,M, V,
N, Q, F, W, Y, or P; N157 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V,
F, W, Y, P, or
C; N158 replaced with D, E, H, K, R, A, G, I, L, S,T, M, V, F, W, Y, P, or C;
T159 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; G 160 replaced with D, E, H, K, R,
N, Q, F, W, Y,
P, or C; D 161 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
P, or C; P 162
replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C;E163
replaced with
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; M164 replaced with D,
E, H, K, R, N,
Q, F, W, Y, P, or C; C 165 replaced with D, E, H, K, R, A, G, I, L, S, T, M,
V, N, Q, F, W, Y,
or P; P166 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y,
or C;
E167replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C;
N168 replaced
with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; G169replaced
with D, E, H, K,
R, N, Q, F, W, Y, P, or C; S 170 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; C 171
replaced with D, E, H, K, R, A, G,I, L, S, T, M, V, N, Q, F, W, Y, or P; V 172
replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; P173 replaced with D, E, H, K, R, A, G,
I, L, S, T,
M,V, N, Q, F, W, Y, or C; D174 replaced with H, K, R, A, G, I, L, S, T, M, V,
N, Q, F, W, Y,
P, or C; 6175 replaced with D, E, H, K, R, N, Q, F, W, Y,P, or C; P 176
replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; 6177 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; L178 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
L179 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q180 replaced with D, E, H, K, R,
A, G,I, L, S, T,
M, V, F, W, Y, P, or C; C 181 replaced with D, E, H, K, R, A, G, I, L, S, T,
M, V, N, Q, F, W,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
33
Y, or P; V182 replaced with D, E, H, K, R, N,Q, F, W, Y, P, or C; C183
replaced with D, E,
H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; A184 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; D185 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F,
W, Y, P, or C;
6186 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F187 replaced with
D, E, H, K, R,
S N, Q, A, G, I, L, S, T, M, V, P, or C; H 188 replaced with D, E, A, G, I, L,
S, T, M, V, N, Q,
F, W, Y, P, or C; 6189 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
Y190 replaced
with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, ,or C; K191 replaced with
D, E,A, G, I, L,
S, T, M, V, N, Q, F, W, Y, P, or C; C 192 replaced with D, E, H, K, R, A, G,
I, L, S, T, M, V,
N, Q, F, W, Y, or P; M 193 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; R 194
replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Q195
replaced with D, E,
H, K, R, A, G, I, L,S, T, M, V, F, W, Y, P, or C; 6196 replaced with D, E, H,
K, R, N, Q, F,
W, Y, P, or C; S197 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F198
replaced with
D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S 199 replaced with D,
E, H, K, R, N, Q,
F, W, Y, P, or C; L200 replaced with D, E,H, K, R, N, Q, F, W, Y, P, or C;
L201 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; M202 replaced with D, E, H, K, R,
N, Q, F, W,
Y, P, or C;F203 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P,
or C; F204
replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; 6205
replaced with D, E,
H, K, R, N, Q, F, W, Y, P, or C; I206 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C;
L207 replaced with D, E, H, K, R, N, Q,F, W, Y, P, or C; 6208 replaced with D,
E, H, K, R,
N, Q, F, W, Y, P, or C; A209 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or
C; T210
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T211 replaced with D, E,
H, K, R, N, Q,
F, W, Y, P, or C; L212 replaced with D, E, H, K, R, N, Q, F, W, Y,P, or C;
5213 replaced
with D, E, H, K, R, N, Q, F, W, Y, P, or C; V214 replaced with D, E, H, K, R,
N, Q, F, W, Y,
P, or C; S215 replaced with D, E,H, K, R, N, Q, F, W, Y, P, or C; I216
replaced with D, E, H,
K, R, N, Q, F, W, Y, P, or C; L217 replaced with D, E, H, K, R, N, Q, F, W, Y,
P, or C; L218
replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; W219 replaced with D, E,
H, K, R, N, Q,
A, G, I, L, S, T, M, V, P, or C; A220 replaced with D, E, H, K, R, N, Q, F, W,
Y, P, or C;
T221 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q222 replaced with
D, E, H, K, R,
A, G, I, L, S, T, M,V, F, W, Y, P, or C; 8223 replaced with D, E, A, G, I, L,
S, T, M, V, N,
Q, F, W, Y, P, or C; 8224 replaced with D, E, A, G, I, L, S, T, M, V, N, Q,
F,W, Y, P, or C;
K225 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A226
replaced with
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
34
D, E, H, K, R, N, Q, F, W, Y, P, or C; K227replaced with D, E, A, G, I, L, S,
T, M, V, N, Q,
F, W, Y, P, or C; T228 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C;
5229 replaced
with D, E,H, K, R, N, Q, F, W, Y, P, or C.
The resulting constructs can be routinely screened for activities or functions
described
throughout the specification and known in the art. Preferably, the resulting
constructs have
an increased and/or decreased TGF alpha HIII activity or function, while the
remaining TGF
alpha HIII activities or functions are maintained. More preferably, the
resulting constructs
have more than one increased and/or decreased TGF alpha HIII activity or
function, while the
remaining TGF alpha HIII activities or functions are maintained.
Additionally, more than one amino acid (e.g., 2, 3, 4, S, 6, 7, 8, 9 and 10)
can be
replaced with the substituted amino acids as described above (either
conservative or
nonconservative). The substituted amino acids can occur in the full length,
mature, or
proprotein form of TGF alpha HI)I protein, as well as the N- and C- terminal
deletion
mutants, having the general formula m-n, listed below.
A further embodiment of the invention relates to a polypeptide which comprises
the
amino acid sequence of a TGF alpha HIII polypeptide having an amino acid
sequence which
contains at least one amino acid substitution, but not more than SO amino acid
substitutions,
even more preferably, not more than 40 amino acid substitutions, still more
preferably, not
more than 30 amino acid substitutions, and still even more preferably, not
more than 20
amino acid substitutions. Of course, in order of ever-increasing preference,
it is highly
preferable for a polypeptide to have an amino acid sequence which comprises
the amino acid
sequence of a TGF alpha HIII polypeptide, which contains at least one, but not
more than 10,
9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid substitutions. In specific embodiments,
the number of
additions, substitutions, and/or deletions in the amino acid sequence of
Figure 1 or fragments
thereof (e.g., the mature form and/or other fragments described herein), is 1-
5, 5-10, 5-25, 5-
S0, 10-50 or 50-150, conservative amino acid substitutions are preferable.
Polynucleotide and Polypeptide Fragments
The present invention is also directed to polynucleotide fragments of the
polynucleotides of the invention. In the present invention, a "polynucleotide
fragment"
refers to a short polynucleotide having a nucleic acid sequence which: is a
portion of that
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
contained in a deposited clone, or encoding the polypeptide encoded by the
cDNA in a
deposited clone; is a portion of that shown in SEQ >D NO:1 or the
complementary strand
thereto, or is a portion of a polynucleotide sequence encoding the polypeptide
of SEQ ID
N0:2. The nucleotide fragments of the invention are preferably at least about
15 nt, and more
5 preferably at least about 20 nt, still more preferably at least about 30 nt,
and even more
preferably, at least about 40 nt, at least about 50 nt, at least about 75 nt,
or at least about 150
nt in length. A fragment "at least 20 nt in length," for example, is intended
to include 20 or
more contiguous bases from the cDNA sequence contained in a deposited clone or
the
nucleotide sequence shown in SEQ ID NO:1. In this context "about" includes the
particularly
10 recited value, a value larger or smaller by several (5, 4, 3, 2, or 1 )
nucleotides, at either
terminus or at both termini. These nucleotide fragments have uses that
include, but are not
limited to, as diagnostic probes and primers as discussed herein. Of course,
larger fragments
(e.g., 50, 150, 500, 600, 2000 nucleotides) are preferred.
Moreover, representative examples of polynucleotide fragments of the
invention,
15 include, for example, fragments comprising, or. alternatively consisting
of, a sequence from
about nucleotide number 1-50, 51-100, 101-150, 151-200, 201-250, 251-300, 301-
350, 351-
400, 401-450, 451-500, 501-550, 551-600, 651-700, 701-750, 751-800, 800-850,
851-900,
901-950, 951-1000, 1001-1050, 1051-1100, 1101-1150, 1151-1200, 1201-1250, 1251-
1300,
1301-1350, 1351-1400, 1401-1450, 1451-1500, 1501-1550, 1551-1600, 1601-1650,
1651-
20 1700, 1701-1750, 1751-1800, 1801-1850, 1851-1900, 1901-1950, 1951-2000, or
2001 to the
end of SEQ ID NO:1, or the complementary strand thereto, or the cDNA contained
in the
deposited clone. In this context "about" includes the particularly recited
ranges, and ranges
larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either
terminus or at both termini.
Preferably, these fragments encode a polypeptide which has biological
activity. More
25 preferably, these polynucleotides can be used as probes or primers as
discussed herein.
Polynucleotides which hybridize to these nucleic acid molecules under
stringent hybridization
conditions or lower stringency conditions are also encompassed by the
invention, as are
polypeptides encoded by these polynucleotides.In the present invention, a
"polypeptide
fragment" refers to an amino acid sequence which is a portion of that
contained in SEQ ID
30 N0:2 or encoded by the cDNA contained in the deposited clone. Protein
(polypeptide)
fragments may be "free-standing," or comprised within a larger polypeptide of
which the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
36
fragment forms a part or region, most preferably as a single continuous
region.
Representative examples of polypeptide fragments of the invention, include,
for example,
fragments comprising, or alternatively consisting of, from about amino acid
number 1-20, 21-
40, 41-60, 61-80, 81-100, 102-120, 121-140, 141-160, or 161 to the end of the
coding region.
Moreover, polypeptide fragments can be about 20, 30, 40, 50, 60, 70, 80, 90,
100, 110, 120,
130, 140, or 150 amino acids in length. In this context "about" includes the
particularly
recited ranges or values, and ranges or values larger or smaller by several
(5, 4, 3, 2, or 1 )
amino acids, at either extreme or at both extremes. Polynucleotides encoding
these
polypeptides are also encompassed by the invention.
Even if deletion of one or more amino acids from the N-terminus of a protein
results
in modification of loss of one or more biological functions of the protein,
other functional
activities (e.g., biological activities, ability to multimerize, ability to
bind TGF alpha HIII
ligand) may still be retained. For example, the ability of shortened TGF alpha
HIll muteins to
induce and/or bind to antibodies which recognize the complete or mature forms
of the
polypeptides generally will be retained when less than the majority of the
residues of the
complete or mature polypeptide are removed from the N-terminus. Whether a
particular
polypeptide lacking N-terminal residues of a complete polypeptide retains such
immunologic
activities can readily be determined by routine methods described herein and
otherwise
known in the art. It is not unlikely that an TGF alpha HIII mutein with a
large number of
deleted N-terminal amino acid residues may retain some biological or
immunogenic
activities. In fact, peptides composed of as few as six TGF alpha HIII amino
acid residues
may often evoke an immune response.
Preferred polypeptide fragments include the secreted protein as well as the
mature
form. Further preferred polypeptide fragments include the secreted protein or
the mature
form having a continuous series of deleted residues from the amino or the
carboxy terminus,
or both. For example, any number of amino acids,
Accordingly, polypeptide fragments include the secreted TGF alpha HIII protein
as
well as the mature form. Further preferred polypeptide fragments include the
secreted TGF
alpha HIII protein or the mature form having a continuous series of deleted
residues from the
amino or the carboxy terminus, or both. For example, any number of amino
acids, ranging
from 1-60, can be deleted from the amino terminus of either the secreted TGF
alpha HIII
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
37
polypeptide or the mature form. Similarly, any number of amino acids, ranging
from 1-30,
can be deleted from the carboxy terminus of the secreted TGF alpha HIII
protein or mature
form. Furthermore, any combination of the above amino and carboxy terminus
deletions are
preferred. Similarly,polynucleotides encoding these polypeptide fragments are
also preferred.
Particularly, N-terminal deletions of the TGF alpha HIII polypeptide can be
described
by the general formula m-229, where m is an integer from 2 to 223, where m
corresponds to
the position of the amino acid residue identified in SEQ ID N0:2. More in
particular, the
invention provides polynucleotides encoding polypeptides comprising, or
alternatively
consisting of, the amino acid sequence of residues of: A-2 to S-229; P-3 to S-
229; H-4 to S-
229; G-5 to S-229; P-6 to S-229; G-7 to S-229; S-8 to S-229; L-9 to S-229; T-
10 to S-229; T-
11 to S-229; L-12 to S-229; V-l3to S-229; P-14 to S-229; W-15 to S-229; A-16
to S-229; A-
17 to S-229; A-18 to S-229; L-19 to S-229; L-20 to S-229; L-21 to S-229; A-22
to S-229; L-
23 toS-229; G-24 to S-229; V-25 to S-229; E-26 to S-229; R-27 to S-229; A-28
to S-229; L-
29 to S-229; A-30 to S-229; L-31 to S-229; P-32 to S-229; E-33 toS-229; I-34
to S-229; C-35
to S-229; T-36 to S-229; Q-37 to S-229; C-38 to S-229; P-39 to S-229; G-40 to
S-229; S-41
to S-229; V-42 to S-229; Q-43 toS-229; N-44 to S-229; L-45 to S-229; S-46 to S-
229; K-47
to S-229; V-48 to S-229; A-49 to S-229; F-50 to S-229; Y-51 to S-229; C-52 to
S-229; K-53
to S-229; T-54 to S-229; T-55 to S-229; R-56 to S-229; E-57 to S-229; L-58 to
S-229; M-59
to S-229; L-60 to S-229; H-61 to S-229; A-62 to S-229; R-63 toS-229; C-64 to S-
229; C-65
to S-229; L-66 to S-229; N-67 to S-229; Q-68 to S-229; K-69 to S-229; G-70 to
S-229; T-71
to S-229; I-72 to S-229; L-73 to S-229; G-74 to S-229; L-75 to S-229; D-76 to
S-229; L-77 to
S-229; Q-78 to S-229; N-79 to S-229; C-80 to S-229; S-81 to S-229; L-82 to S-
229; E-83 to
S-229; D-84 to S-229; P=85 to S-229; G-86 to S-229; P-87 to S-229; N-88 to S-
229; F-89 to
S-229; H-90 to S-229; Q-91 to S-229; A-92 to S-229; H-93 toS-229; T-94 to S-
229; T-95 to
S-229; V-96 to S-229; I-97 to S-229; I-98 to S-229; D-99 to S-229; L-100 to S-
229; Q-101 to
S-229; A-102 to S-229; N-103 to S-229; P-104 to S-229; L-105 to S-229; K-106
to S-229; 6-
107 to S-229; D-108 to S-229; L-109 to S-229; A-110 to S-229; N-111 to S-229;
T-112 to 5-
229; F-113 to S-229; R-114 to S-229; G-115 to S-229; F-116 to S-229; T-117 to
S-229; Q-
118 to S-229; L-119 to S-229; Q-120 to S-229; T-121 to S-229; L-122 to S-229;
I-123 to S-
229; L-124 to S-229; P-125 to S-229; Q-126 to S-229; H-127 to S-229; V-128 to
S-229; N-
129 to S-229; C-130 to S-229; P-131 to S-229; G-132 to S-229; G-133 to S-229;
I-134 to S-
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
38
229; N-135 to S-229; A-136 to S-229; W-137 to S-229; N-138 to S-229; T-139 to
S-229; I-
140 to S-229; T-141 toS-229; S-142 to S-229; Y-143 to S-229; I-144 to S-229; D-
145 to S-
229; N-146 to S-229; Q-147 to S-229; I-148 to S-229; C-149 to S-229; Q-150 to
S-229; 6-
151 to S-229; Q-152 to S-229; K-153 to S-229; N-154 to S-229; L-155 to S-229;
C-156 to S-
229; N-157 to S-229; N-158 to S-229; T-159 to S-229; G-160 to S-229; D-161 to
S-229; P-
162 to S-229; E-163 to S-229; M-164 to S-229; C-165 to S-229; P-166 to S-229;
E-167 to 5-
229; N-168 to S-229; G-169 to S-229; S-170 to S-229; C-171 to S-229; V-172 to
S-229; P-
173 to S-229; D-174 to S-229; G-175 to S-229; P-176 to S-229; G-177 to S-229;
L-178 to 5-
229; L-179 to S-229; Q-180 to S-229; C-181 to S-229; V-182 to S-229; C-183 to
S-229; A-
184 to S-229; D-185 to S-229; G-186 to S-229; F-187 to S-229; H-188 to S-229;
G-189 to S-
229; Y-190 to S-229; K-191 to S-229; C-192 to S-229; M-193 to S-229; R-194 to
S-229; Q-
195 to S-229; G-196 to S-229; S-197 to S-229; F-198 to S-229; S-199 to S-229;
L-200 to 5-
229; L-201 to S-229; M-202 to S-229; F-203 to S-229; F-204 to S-229; G-205 to
S-229; I-
206 to S-229; L-207 to S-229; G-208 to S-229; A-209 to S-229; T-210 to S-229;
T-211 to S-
229; L-212 to S-229; S-213 to S-229; V-214 to S-229; S-215 to S-229; I-216 toS-
229; L-217
to S-229; L-218 to S-229; W-219 to S-229; A-220 to S-229; T-221 to S-229; Q-
222 to S-229;
R-223 to S-229; and/or R-224 to S-229 of SEQ ID N0:2. Polynucleotides encoding
these
polypeptides are also encompassed by the invention.
Also as mentioned above, even if deletion of one or more amino acids from the
C-terminus of a protein results in modification of loss of one or more
biological functions of
the protein, other functional activities (e.g., biological activities, ability
to multimerize,
ability to bind TGF alpha HIII ligand) may still be retained. For example the
ability of the
shortened TGF alpha HIII mutein to induce and/or bind to antibodies which
recognize the
complete or mature forms of the polypeptide generally will be retained when
less than the
majority of the residues of the complete or mature polypeptide are removed
from the
C-terminus. Whether a particular polypeptide lacking C-terminal residues of a
complete
polypeptide retains such immunologic activities can readily be determined by
routine
methods described herein and otherwise known in the art. It is not unlikely
that an TGF
alpha HIII mutein with a large number of deleted C-terminal amino acid
residues may retain
some biological or immunogenic activities. In fact, peptides composed of as
few as six TGF
alpha HIII amino acid residues may often evoke an immune response.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
39
Accordingly, the present invention further provides polypeptides having one or
more
residues deleted from the carboxy terminus of the amino acid sequence of the
TGF alpha
HIII polypeptide shown in Figure 1 (SEQ ID N0:2), as described by the general
formula 1-n,
where n is an integer from 6 to 229, where n corresponds to the position of
amino acid
residue identified in SEQ ID N0:2. More in particular, the invention provides
polynucleotides encoding polypeptides comprising, or alternatively consisting
of, the amino
acid sequence of residues of: E-26 to T-228; E-26 to K-227; E-26 to A-226; E-
26 to K-225;
E-26 to R-224; E-26 to R-223; E-26 to Q-222; E-26 to T-221; E-26 to A-220; E-
26 to W-
219; E-26 to L-218; E-26 to L-217; E-26 to I-216; E-26 to S-215; E-26 to V-
214; E-26 to S-
213; E-26 to L-212; E-26 to T-211; E-26 to T-210; E-26 toA-209; E-26 to G-208;
E-26 to L-
207; E-26 to I-206; E-26 to G-205; E-26 to F-204; E-26 to F-203; E-26 to M-
202; E-26 to L-
201; E-26 to L-200; E-26 to S-199; E-26 to F-198; E-26 to S-197; E-26 to G-
196; E-26 to
Q-195; E-26 to R-194; E-26 to M-193; E-26 to C-192; E-26 to K-191; E-26 to Y-
190; E-26
to G-189; E-26 to H-188; E-26 to F-187; E-26 to G-186; E-26 to D-185; E-26 to
A-184; E-
26 to C-183; E-26 to V-182; E-26 to C-181;.E-26 to Q-180; E-26 to L-179; E-26
to L-178;
E-26 to G-177; E-26 to P-176; E-26 to G-175; E-26 to D-174; E-26 to P-173; E-
26 to V-
172; E-26 to C-171; E-26 to S-170; E-26 to G-169; E-26 to N-168; E-26 to E-
167; E-26 to
P-166; E-26 to C-165; E-26 to M-164; E-26 to E-163; E-26 to P-162; E-26 to D-
161; E-26
to G-160; E-26 to T-159; E-26 to N-158; E-26 to N-157; E-26 to C-156; E-26 to
L-155; E-
26 to N-154; E-26 to K-153; E-26 to Q-152; E-26 to G-151; E-26 to Q-150; E-26
to C-149;
E-26 to I-148; E-26 to Q-147; E-26 to N-146; E-26 to D-145; E-26 to I-144; E-
26 to Y-143;
E-26 to S-142; E-26 to T-141; E-26 to I-140; E-26 to T-139; E-26 to N-138; E-
26 to W-137;
E-26 to A-136; E-26 to N-135; E-26 to I-134; E-26 to G-133; E-26 to G-132; E-
26 to P-131;
E-26 to C-130; E-26 to N-129; E-26 to V-128; E-26 to H-127; E-26 to Q-126; E-
26 to P-
125; E-26 to L-124; E-26 to I-123; E-26 to L-122; E-26 to T-121; E-26 to Q-
120; E-26 to L-
119; E-26 to Q-118; E-26 to T-117; E-26 to F-116; E-26 to G-115; E-26 to R-
114; E-26 to
F-113; E-26 to T-112; E-26 to N-111; E-26 to A-110; E-26 to L-109; E-26 to D-
108; E-26
to G-107; E-26 to K-106; E-26 to L-105; E-26 to P-104; E-26 to N-103; E-26 to
A-102; E-
26 to Q-101; E-26 to L-100; E-26 to D-99; E-26 to I-98; E-26 to I-97; E-26 to
V-96; E-26 to
T-95; E-26 to T-94; E-26 to H-93; E-26 to A-92; E-26 to Q-91; E-26 to H-90; E-
26 to F-89;
E-26 to N-88; E-26 to P-87; E-26 to G-86; E-26 to P-85; E-26 to D-84; E-26 to
E-83; E-26
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
to L-82; E-26 to S-81; E-26 to C-80; E-26 to N-79; E-26 to Q-78; E-26 toL-77;
E-26 to D-
76; E-26 to L-75; E-26 to G-74; E-26 to L-73; E-26 to I-72; E-26 to T-71; E-26
to G-70; E-
26 to K-69; E-26 to Q-68; E-26 to N-67; E-26 to L-66; E-26 to C-65; E-26 to C-
64; E-26 to
R-63; E-26 to A-62; E-26 to H-61; E-26 to L-60; E-26 to M-59; E-26 to L-58; E-
26 to E-57;
5 E-26 to R-56; E-26 to T-55; E-26 to T-54; E-26 to K-53; E-26 to C-52; E-26
to Y-51; E-26
to F-50; E-26 to A-49; E-26 to V-48; E-26 to K-47; E-26 to S-46; E-26 to L-45;
E-26 to N
44; E-26 to Q-43; E-26 to V-42; E-26 to S-41; E-26 to G-40; E-26 to P-39; E-26
to C-38; E
26 to Q-37; E-26 to T-36; E-26 to C-35; E-26 to I-34; E-26 to E-33; and/or E-
26 to P-32 of
SEQ ID N0:2. Polynucleotides encoding these polypeptides are also encompassed
by the
10 invention.
Moreover, a signal sequence may be added to these C-terminal constructs. For
example, amino acids 1-25 of SEQ 117 N0:2, amino acids 2-25 of SEQ ID N0:2,
amino acids
3-25 of SEQ ID N0:2, amino acids 4-25 of SEQ ID N0:2, amino acids S-25 of SEQ
ID
N0:2, amino acids 6-25 of SEQ ID N0:2, amino acids 7-25 of SEQ ID N0:2, amino
acids 8-
1 S 25 of SEQ 117 N0:2, amino acids 9-25 of SEQ 117 N0:2, amino acids 10-25 of
SEQ ID N0:2,
amino acids 11-25 of SEQ ID N0:2, amino acids 12-25 of SEQ ID N0:2, amino
acids 13-25
of SEQ ID N0:2, amino acids 14-25 of SEQ ID N0:2, amino acids 15-25 of SEQ ID
N0:2,
amino acids 16-25 of SEQ ID N0:2, amino acids 17-25 of SEQ ID N0:2, amino
acids 18-25
of SEQ ID N0:2, amino acids 19-25 of SEQ ID N0:2, amino acids 20-25 of SEQ ID
N0:2,
20 amino acids 21-25 of SEQ ID N0:2, amino acids 22-25 of SEQ ID N0:2, amino
acids 23-25
of SEQ ID N0:2, amino acids 24-25 of SEQ ID N0:2, or amino acid 25 of SEQ ID
N0:2 can
be added to the N-terminus of each C-terminal constructs listed above.
In addition, any of the above listed N- or C-terminal deletions can be
combined to
produce a N- and C-terminal deleted TGF alpha H>TI polypeptide. The invention
also
25 provides polypeptides having one or more amino acids deleted from both the
amino and the
carboxyl termini, which may be described generally as having residues m-n of
SEQ ID N0:2,
where n and m are integers as described above. Polynucleotides encoding these
polypeptides
are also encompassed by the invention.
Also included are a nucleotide sequence encoding a polypeptide consisting of a
30 portion of the complete TGF alpha HIII amino acid sequence encoded by the
cDNA clone
contained in ATCC Deposit No. 97342, where this portion excludes any integer
of amino
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
41
acid residues from 1 to about 228 amino acids from the amino terminus of the
complete
amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
97342, or
any integer of amino acid residues from 1 to about 228 amino acids from the
carboxy
terminus, or any combination of the above amino terminal and carboxy terminal
deletions, of
the complete amino acid sequence encoded by the cDNA clone contained in ATCC
Deposit
No. 97342. Polynucleotides encoding all of the above deletion mutant
polypeptide forms
also are provided.
The present application is also directed to proteins containing polypeptides
at least
90%, 95%, 96%, 97%, 98% or 99% identical to the TGF alpha HIII polypeptide
sequence set
forth herein m-n. In preferred embodiments, the application is directed to
proteins containing
polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides
having the
amino acid sequence of the specific TGF alpha HIII N- and C-terminal deletions
recited
herein. Polynucleotides encoding these polypeptides are also encompassed by
the invention.
Additional preferred polypeptide fragments comprise, or alternatively consist
of, the
amino acid sequence of residues: M-1 to W-15; A-2 to A-16; P-3 to A-17; H-4 to
A-18; G-5
toL-19; P-6 to L-20; G-7 to L-21; S-8 to A-22; L-9 to L-23; T-10 to G-24; T-11
to V-25; L-12
to E-26; V-13 to R-27; P-14 to A-28; W-15 to L-29; A-16 to A-30;A-17 to L-31;
A-18 to P-
32; L-19 to E-33; L-20 to I-34; L-21 to C-35; A-22 to T-36; L-23 to Q-37; G-24
to C-38; V-
to P-39; E-26 to G-40; R-27 to S-41;A-28 to V-42; L-29 to Q-43; A-30 to N-44;
L-31 to
20 L-45; P-32 to S-46; E-33 to K-47; I-34 to V-48; C-35 to A-49; T-36 to F-50;
Q-37 to Y-51;
C-38 to C-52;P-39 to K-53; G-40 to T-54; S-41 to T-55; V-42 to R-56; Q-43 to E-
57; N-44 to
L-58; L-45 to M-59; S-46 to L-60; K-47 to H-61; V-48 to A-62; A-49 to R-63; F-
50 to C-64;
Y-51 to C-65; C-52 to L-66; K-53 to N-67; T-54 to Q-68; T-55 to K-69; R-56 to
G-70; E-57
to T-71; L-58 to I-72; M-59 to L-73; L-60 to G-74;H-61 to L-75; A-62 to D-76;
R-63 to L-77;
25 C-64 to Q-78; C-65 to N-79; L-66 to C-80; N-67 to S-81; Q-68 to L-82; K-69
to E-83; G-70
to D-84; T-71 to P-85; I-72 to G-86; L-73 to P-87; G-74 to N-88; L-75 to F-89;
D-76 to H-90;
L-77 to Q-91; Q-78 to A-92; N-79 to H-93; C-80 to T-94; S-81 to T-95; L-82 to
V-96; E-83
to I-97; D-84 to I-98; P-85 to D-99; G-86 to L-100; P-87 to Q-101; N-88 to A-
102; F-89 to
N-103; H-90 to P-104; Q-91 to L-105; A-92 to K-106; H-93to G-107; T-94 to D-
108; T-95 to
L-109; V-96 to A-110; I-97 to N-111; I-98 to T-112; D-99 to F-113; L-100 to R-
114; Q-101
to G-115; A-102 to F-116; N-103 to T-117; P-104 to Q-118; L-105 to L-119; K-
106 to Q-
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
42
120; G-107 to T-121; D-108 to L-122; L-109 to I-123; A-110 to L-124; N-111 to
P-125; T-
112 to Q-126; F-113 to H-127; R-114 to V-128; G-115 to N-129; F-116 to C-130;
T-117 to
P-131; Q-118 to G-132; L-119 to G-133; Q-120 to I-134; T-121 toN-135; L-122 to
A-136; I-
123 to W-137; L-124 to N-138; P-125 to T-139; Q-126 to I-140; H-127 to T-141;
V-128 to S-
142; N-129 to Y-143; C-130 to I-144;P-131 to D-145; G-132 to N-146; G-133 to Q-
147; I-
134 to I-148; N-135 to C-149; A-136 to Q-150; W-137 to G-151; N-138 to Q-152;
T-139 to
K-153;I-140 to N-154; T-141 to L-155; S-142 to C-156; Y-143 to N-157; I-144 to
N-158; D-
145 to T-159; N-146 to G-160; Q-147 to D-161; I-148 to P-162; C-149 to E-163;
Q-150 to
M-164; G-151 to C-165; Q-152 to P-166; K-153 to E-167; N-154 to N-168; L-155
to G-169;
C-156 to S-170; N-.157 to C-171; N-158 toV-172; T-159 to P-173; G-160 to D-
174; D-161 to
G-175; P-162 to P-176; E-163 to G-177; M-164 to L-178; C-165 to L-179; P-166
to Q-180;
E-167 toC-181; N-168 to V-182; G-169 to C-183; S-170 to A-184; C-171 to D-185;
V-172 to
G-186; P-173 to F-187; D-174 to H-188; G-175 to G-189; P-176 toY-190; G-177 to
K-191;
L-178 to C-192; L-179 to M-193; Q-180 to R-194; C-181 to Q-195; V-182 to G-
196; C-183
to S-197; A-184 to F-198; D-185 to S-199; G-186 to L-200; F-187 to L-201; H-
188 to M-
202; G-189 to F-203; Y-190 to F-204; K-191 to G-205; C-192 to I-206; M-193 to
L-207; 8-
194 to G-208; Q-195 to A-209; G-196 to T-210; S-197 to T-211; F-198 to L-212;
S-199 to 5-
213; L-200 to V-214; L-201 to S-215; M-202 to I-216; F-203 to L-217; F-204 to
L-218; 6-
205 to W-219; I-206 to A-220; L-207 to T-221; G-208 to Q-222; A-209 to R-223;
T-210 to
R-224; T-211 to K-225; L-212 to A-226; S-213 to K-227; V-214 to T-228; S-215
to S-229 of
SEQ 1D N0:2. These polypeptide fragments may retain the biological activity of
TGF alpha
HIII polypeptides of the invention and/or may be useful to generate or screen
for antibodies,
as described further below. Polynucleotides encoding these polypeptide
fragments are also
encompassed by the invention.
Preferably, the polynucleotide fragments of the invention encode a polypeptide
which
demonstrates a TGF alpha HIII functional activity. By a polypeptide
demonstrating a TGF
alpha HIII "functional activity" is meant, a polypeptide capable of displaying
one or more
known functional activities associated with a full-length (complete) TGF alpha
HIII protein.
Such functional activities include, but are not limited to, biological
activity, antigenicity
[ability to bind (or compete with a TGF alpha HIII polypeptide for binding) to
an anti-TGF
alpha HIII antibody], immunogenicity (ability to generate antibody which binds
to a TGF
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
43
alpha HIII polypeptide), ability to form multimers with TGF alpha HI11
polypeptides of the
invention, and ability to bind to a receptor or ligand for a TGF alpha HIII
polypeptide.
The functional activity of TGF alpha HIII polypeptides, and fragments,
variants
derivatives, and analogs thereof, can be assayed by various methods.
For example, in one embodiment where one is assaying for the ability to bind
or
compete with full-length TGF alpha HIII polypeptide for binding to anti-TGF
alpha HIII
antibody, various immunoassays known in the art can be used, including but.
not limited to,
competitive and non-competitive assay systems using techniques such as
radioimmunoassays,
ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays,
immunoradiometric assays, gel diffusion precipitation reactions,
immunodiffusion assays, in
situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for
example),
western blots, precipitation reactions, agglutination assays (e.g., gel
agglutination assays,
hemagglutination assays), complement fixation assays, immunofluorescence
assays, protein
A assays, and immunoelectrophoresis assays, etc. In one embodiment, antibody
binding is
detected by detecting a label on the primary antibody. In another embodiment,
the primary
antibody is detected by detecting binding of a secondary antibody or reagent
to the primary
antibody. In a further embodiment, the secondary antibody is labeled. Many
means are
known in the art for detecting binding in an immunoassay and are within the
scope of the
presentinvention.
In another embodiment, where a TGF alpha HIII ligand is identified, or the
ability of a
polypeptide fragment, variant or derivative of the invention to multimerize is
being evaluated,
binding can be assayed, e.g., by means well-known in the art, such as, for
example, reducing
and non-reducing gel chromatography, protein affinity chromatography, and
affinity blotting.
See generally, Phizicky, E., et al., 1995, Microbiol. Rev. 59:94-123. In
another embodiment,
physiological correlates of TGF alpha HIII binding to its substrates (signal
transduction) can
be assayed.
In addition, assays described herein (see Examples) and otherwise known in the
art
may routinely be applied to measure the ability of TGF alpha HILI polypeptides
and
fragments, variants derivatives and analogs thereof to elicit TGF alpha HIII
related biological
activity (either in vitro or in vivo). Other methods will be known to the
skilled artisan and are
within the scope of the invention.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
44
Among the especially preferred fragments of the invention are fragments
characterized by structural or functional attributes of TGF alpha HIII. Such
fragments
include amino acid residues that comprise alpha-helix and alpha-helix forming
regions
("alpha-regions"), beta-sheet and beta-sheet-forming regions ("beta-regions"),
turn and turn-
s forming regions ("turn-regions"), coil and coil-forming regions ("coil-
regions"), hydrophilic
regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic
regions, surface
forming regions, and high antigenic index regions (i.e., containing four or
more contiguous
amino acids having an antigenic index of greater than or equal to 1.5, as
identified using the
default parameters of the Jameson-Wolf program) of complete (i.e., full-
length) TGF alpha
HIII (SEQ ID N0:2). Certain preferred regions are those set out in Figure 3
and include, but
are not limited to, regions of the aforementioned types identified by analysis
of the amino
acid sequence depicted in Figure 1 (SEQ ID N0:2), such preferred regions
include; Garnier-
Robson predicted alpha-regions, beta-regions, turn-regions, and coil-regions;
Chou-Fasman
predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Kyte-
Doolittle predicted
hydrophilic and hydrophobic regions; Eisenberg alpha and beta amphipathic
regions; Emini
surface-forming regions; and Jameson-Wolf high antigenic index regions, as
predicted using
the default parameters of these computer programs. Polynucleotides encoding
these
polypeptides are also encompassed by the invention.
In additional embodiments, the polynucleotides of the invention encode
functional
attributes of TGF alpha HIlI. Preferred embodiments of the invention in this
regard include
fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-
regions"),
beta-sheet and beta-sheet forming regions ("beta-regions"), turn and turn-
forming regions
("turn-regions"), coil and coil-forming regions ("coil-regions"), hydrophilic
regions,
hydrophobic regions, alpha amphipathic regions, beta amphipathic regions,
flexible regions,
surface-forming regions and high antigenic index regions of TGF alpha HIII.
The data representing the structural or functional attributes of TGF alpha
HIII set forth
in Figure 1 and/or Table I, as described above, was generated using the
various modules and
algorithms of the DNA*STAR set on default parameters. In a preferred
embodiment, the data
presented in columns VIII, IX, XIII, and XIV of Table I can be used to
determine regions of
TGF alpha HIII which exhibit a high degree of potential for antigenicity.
Regions of high
antigenicity are determined from the data presented in columns VIII, IX, XIII,
and/or IV by
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
choosing values which represent regions of the polypeptide which are likely to
be exposed on
the surface of the polypeptide in an environment in which antigen recognition
may occur in
the process of initiation of an immune response.
Certain preferred regions in these regards are set out in Figure 3, but may,
as shown in
5 Table I, be represented or identified by using tabular representations of
the data presented in
Figure 3. The DNA*STAR computer algorithm used to generate Figure 3 (set on
the original
default parameters) was used to present the data in Figure 3 in a tabular
format (See Table I).
The tabular format of the data in Figure 3 may be used to easily determine
specific boundaries
of a preferred region.
10 The above-mentioned preferred regions set out in Figure 3 and in Table I
include, but
are not limited to, regions of the aforementioned types identified by analysis
of the amino
acid sequence set out in Figure 1. As set out in Figure 3 and in Table I, such
preferred
regions include Gamier-Robson alpha-regions, beta-regions, turn-regions, and
coil-regions,
Chou-Fasman alpha-regions, beta-regions, and coil-regions, Kyte-Doolittle
hydrophilic
15 regions and hydrophobic regions, Eisenberg alpha- and beta-amphipathic
regions,
Karplus-Schulz flexible regions, Emini surface-forming regions and Jameson-
Wolf regions of
high antigenic index.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
46
Table
I
Res sitionI 11 III IV V VI VII VIII IX X XI XI1XIII XIV
Po
Met 1 . . B . . . . 0.17 G . . . -0.100.79
Ala 2 . . B . . . . 0.34 G . . . -0.100.61
$ Pro 3 . . B . . . . 0.39 G . . . -0.100.74
His 4 . . . . . . C 0.48 G . . . 0.10 0.74
Gly 5 . . . . . T C 0.06 G . . F 0.45 0.98
Pro 6 . . . . . T C 0.34 G . . F 0.45 0.52
Gly 7 . . . . T T . 0.62 G . . F 0.65 0.55
Ser 8 . . . . . T C 0.02 G * . F 0.45 0.81
Leu 9 . . B B . . . -0.80G * . F -0.450.43
Thr 10 . . B B . . . -0.67G . . F -0.450.32
Thr 11 . . B B . . . -0.74G . . F -0.450.37
Leu 12 . . B B . . . -0.99G . . . -0.600.48
1$ Val 13 . . B B . . . -1.28G . . . -0.600.33
Pro 14 . A B . . . . -1.06G * . . -0.600.23
Trp 15 . A B . . . . -1.56G . . . -0.600.29
Ala 16 A A . . . . . -2.06G . . . -0.600.32
Ala 17 A A . . . . . -2.06G . . . -0.600.17
Ala 18 A A . . . . . -1.79G . . . -0.600.13
Leu 19 . A B . . . . -2.39G . . . -0.600.13
Leu 20 . A B . . . . -2.44G . . . -0.600.11
Leu 21 . A B . . . . -2.71G . . . -0.600.11
Ala 22 . A B . . . . -2.12G * . . -0.600.10
2$ Leu 23 . A B . . . . -1.42G * . . -0.600.20
Gly 24 A B . . . . -1.20. * . . 0.30 0.48
Val 25 ~. A B . . . . -1.20. * . . 0.30 0.48
Glu 26 . A B . . . . -0.98. * . . 0.30 0.48
Arg 27 . A B . . . . -1.20. * . . 0.30 0.49
Ala 28 . A B . . . . -0.60G * . . -0.300.54
Leu 29 . A B . . . . -0.26. . . . 0.30 0.48
Ala 30 . A . . . . C -0.29. . . . 0.50 0.43
Leu 31 . A B . . . . -0.96G . . . -0.600.30
Pro 32 . A . . T . . -1.38G . * . -0.200.19
3$ Glu 33 . A . . T . . -0.79G . . . 0.10 0.27
Ile 34 . A B . . . . -0.64G . . . -0.300.58
Cys 35 . A B . . . . -0.27G * * . -0.300.20
Thr 36 . A B . . . . 0.20 G * * . -0.300.18
Gln 37 . A B . . . . 0.11 G * * F -0.450.25
40 Cys 38 . . B . . T . -0.74G * * F 0.25 0.63
Pro 39 . . . . T T . 0.14 G * * F 0.65 0.32
Gly 40 . . . . T T . 0.81 G * . F 0.65 0.32
Ser 41 . . B . . T . 0.31 G * . F 0.25 0.97
Val 42 . . B . . . . 0.01 G * . F 0.05 0.52
4$ Gln 43 . . B . . . . 0.72 G * * F 0.05 0.70
Asn 44 . A B . . . . 0.08 . * . F 0.60 1.05
Leu 45 . A B . . . . -0.17G * * F 0.00 1.05
Ser 46 . A B . . . . -0.57G * . F -0.150.61
Lys 47 . A B . . . . 0.04 G * . . -0.300.33
$0 Val 48 . A B . . . . -0.62G * * . -0.600.63
Ala 49 . A B . . . . -0.58G * * . -0.600.25
Phe 50 . A B . . . . -0.08G * * . -0.300.25
Tyr 51 . . B B . . . -0.09G . * . -0.600.49
Cys 52 . . B B . . . -0.02G . * . -0.600.69
$$ Lys 53 . . . B T . . 0.83 G * . . 0.25 1.57
Thr 54 . A . B . . C 0.61 . * . F 1.10 1.74
Thr 55 . A . B . . C 0.71 . * . F 1.10 2.67
Arg 56 A A . B . . . 0.14 . * . F 0.90 1.32
Glu 57 . A B B . . . 0.78 . * . . 0.30 0.76
60 Table I (continued)
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
47
Res I II 111 IV V VI VIIVIII IX X XI XIIXIIIXIV
Position
Leu 58 . A B . . . . 0.14 . * * . 0.300.71
Met 59 . A B . . . . 0.57 . * * . 0.300.37
$ Leu 60 . A B . . . . 0.21 . * * . 0.300.42
His 61 . A B . . . . -0.57G * * . -0.G00.27
Ala 62 A A B . . . . -1.38G * * . -0.600.15
Arg 63 . A B . . . . -0.57G * * . -O.GO0.15
Cys 64 . A B . . . . 0.03 G . * . -0.300.17
1 Cys 65 . A . . T . . 0.89 G . * . 0.260.30
~
Leu 66 . A . . T . . 0.58 . . * . 1.020.30
Asn 67 . . . . T T . 0.86 G * * F 1.130.56
Gln 68 . . . . T T . -0.14. * * F 2.041.50
Lys 69 . . . . T T . -0.29G . * F 1.601.28
I Gly 70 . . B . . T . 0.03 G . * F 0.890.66
$
Thr 71 . . B B . . . 0.03 G . * F 0.330.37
Ile 72 . . B B . . . 0.03 G . * . 0.020.15
Leu 73 . . B B . . . -0.78G . * . -0.140.26
Gly 74 . . B B . . . -0.82G . * . -0.600.15
Leu 75 . . B . . . . -0.48G . . . -0.400.37
Asp 76 . . B . . . . -0.83G . . . -0.100.72
Leu 77 . . B . . T . -0:24G . . . 0.100.39
Gln 78 . . B . . T . -0.24G . * . 0.100.63
Asn 79 . . B . . T . 0.10 G . . . 0.100.31
ZS Cys 80 . . B . . T . 0.91 G . . . 0.100.66
Ser 81 . . B . . . . 0.70 . . . . 1.140.63
Leu 82 . . B . . . . 1.17 . . . . 1.480.61
Glu 83 . . . . T . . 0.96 . . . F 2.521.12
Asp 84 . . . . . T C 0.96 . * * F 2.861.29
Pro 85 . . . . T T . 0.92 . * . F 3.402.52
Gly 86 . . . . . T C 1.19 . * . F 2.861.26
Pro 87 . . . . . T C 2.00 . * . F 2.221.03
Asn 88 . A . . . . C 1.41 G * . F 0.881.15
Phe 89 . A . . . . C 1.38 G * . . 0.091.18
3$ His 90 . A B . . . . 1.28 G . . . -0.451.03
Gln 91 . A B . . . . 1.31 G * . . -0.600.93
Ala 92 . A B B . . . 0.67 G * . . -0.451.55
His 93 . A B B . . . -0.22G . . . -0.600.84
Thr 94 . A B B . . . -0.41G . * . -0.600.34
Thr 95 . . B B . . . -0.38G . * . -0.600.24
Val 96 . A B B . . . -1.19G . * . -0.600.29
Ile 97 . A B B . . . -0.60G . * . -0.600.17
Ile 98 . A B B . . . -1.16G . * . -0.600.20
Asp 99 . A B B . . . -0.84G . * . -0.600.27
4$ Leu 100 . A B . . . . -0.74G . * . -0.300.62
Gln 101 . A B . . . . -0.70G * * . 0.191.37
Ala 102 . A B . . . . 0.23 G * * . 0.380.68
Asn 103 . . . . . T C 0.78 G . * F 1.621.64
Pro 104 . . . . . T C 0.78 . . * F 2.410.94
5~ Leu 105 . . . . T T . 0.78 . . * F 3.401.55
Lys 106 . . . . T T . 0.19 . . . F 2.610.80
Gly 107 . A B . . . . 0.78 . . * F 1.470.52
Asp 108 . A B . . . . 0.47 . . * F 1.281.02
Leu 109 . A B . . . . -0.02. * * F 0.790.73
$$ Ala I10 . A B B . . . 0.90 G * * F -O.150.64
Asn 111 . A B B . . . 0.51 . * * . 0.300.75
Thr 112 . A B B . . . 0.16 G * * . -0.300.90
Phe 113 . . B B . . . -0.16G * * . -0.300.77
Table I (continued)
6O Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
48
Arg 114 . . B T . . 0.66 G * * F 0.25O.G9
.
Gly 115 . . B T . . 0.43 G * * F 0.250.83
.
Phe 116 A . B T . . 0.43 G * * F -0.050.79
.
Thr 117 A B B . . . 0.43 G * * F -0.150.70
.
$ Gln 118 A B B . . . 0.32 G * * F -0.301.02
.
Leu 119 A B B . . . -0.68 G * * F -0.450.97
.
Gln 120 A B B . . . -1.14 G * . F -0.450.47
.
Thr 121 A B B . . . -0.66 G * . . -0.600.23
.
Leu 122 A B B . . . -0.34 G . . . -0.600.42
.
1 Ile 123 A B B . . . -0.38 G . * . -0.600.42
~ .
Leu 124 A B B . . . -0.42 G . . . -0.600.40
.
Pro 125 . B B . . . -0.42 G . . . -0.600.36
.
Gln 126 . B B . . . -0.78 G . . . -0.600.82
.
His 127 . B B . . . -0.18 G . . . -0.600.53
.
1$ Val 128 . B B . . . 0.37 G . . . -0.300.53
.
Asn 129 . B B . . . 0.83 G * * . -0.300.31
.
Cys 130 . B . . T . 0.1G G . * F -0.050.22
.
Pro 131 . . . T T . 0.16 G . * F 0.350.21
.
Gly 132 . . . T T . -0.40 G . * F 0.650.21
.
Gly 133 . . . T T . 0.17 G . * F 0.350.40
.
Ile 134 . . . . . C 0.17 G . . F -0.050.27
.
Asn 135 . B . . . . 0.52 G * . . -0.400.44
.
Ala 136 . B B . . . -0.16 G * . . -0.600.64
.
Trp 137 . B B . . . -0.12 G * . . -0.60O.G4
.
2$ Asn 138 . B B . . . -0.08 G * . . -0.600.57
.
Thr 139 . B B . . . 0.57 G * * F -0.450.76
.
lle 140 . B B . . . -0.32 G * * F -0.301.13
.
Thr 141 . B B . . . 0.27 G * . F -0.450.49
.
Ser 142 . B B . . . 0.56 G * * F -0.450.57
.
Tyr 143 . . B T . . 0.56 G * * . -0.051.31
. ~
Ile 144 . . . T T . -0.02 G * * F 0.801.57
.
Asp 145 . . . T T . 0.20 G * * F 0.650.82
.
Asn 146 . . . T T . 0.51 G * . F 0.350.28
.
Gln 147 . B . . T . 0.47 G * . . 0.380.69
.
3 Ile 148 . B . . . . 0.71 . * . . 1.060.41
$ .
Cys 149 . B . . T . 1.64 G * * . 0.940.44
.
Gln 150 . . . T T . 1.64 . * . F 2.370.51
.
Gly 151 . . . T T . 0.83 . * . F 2.801.17
.
Gln 152 . . . T T . 0.17 . * . F 2.521.80
.
Lys 153 . . . T . . 1.06 . * . F 1.890.56
.
Asn 154 . . . T . . 1.72 . * . F 1.G10.91
.
Leu 155 . B . . . . 1.41 . * . . 0.780.84
.
Cys 156 . B . . . . 1.41 . * . . 0.840.61
.
Asn 157 . . . T . . 1.41 G * . F 1.130.37
.
4$ Asn 158 . . . T T . 1.16 . * . F 2.270.76
.
Thr 159 . . . T T . 1.16 . . * F 2.762.19
.
Gly 1G0 . . . T T . 1.37 . . . F 3.402.35
.
Asp 161 . . . . T C 1.37 . . * F 2.861.45
.
Pro 162 . . . . . C 1.16 . . * F 2.180.54
.
$~ Glu 163 . B . . . . 1.16 . . . . 2.100.84
.
Met 164 . B . . . . 1.47 . . * . 2.070.87
.
Cys 1 G5 . B . . T . 1.47 . . * . 2.240.91
.
Pro 166 . . . T T . 1.17 . . . F 3.100.52
.
Glu 167 . . . T T . 0.71 . . . F 2.490.70
.
55 Asn 168 . . . T T . -0.14 . . . F 2.180.70
.
Gly 169 . . . T . . 0.24 . * . F 1.670.34
.
TableI
(continued)
Res sitionII III IV V VI VIIVIII IX X XI XIIXlllXIV
Po 1
Ser 170 . . . T . . 0.91 . * . F 1.610.30
.
Cys 171 . B . . . . 0.78 . * . F 1.150.31
.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
49
Val 172 . . B . . T . 0.57 . . . F 1.G0 0.31
Pro 173 . . . . T T . 0.22 . . . F 2.25 0.36
Asp 174 . . . . T T . -0.24. * . F 2.50 0.67
Gly 175 . . . . . T C -0.76G * . F 1.45 0.74
$ Pro 17G . . . . T . . -0.09G * . F 1.20 0.39
~
Gly 177 . . . B T . . 0.10 G * . F 0.75 0.41
Leu 178 . . B B . . . -0.54G * . . -0.350.22
Leu 179 . . B B . . . -1.21G . . . -0.600.11
Gln 180 . . B B . . . -1.46G . . . -0.600.06
Cys 181 . . B B . . . -1.24G . . . -0.600.07
Val 182 . . B B . . . -1.24G . . . -0.300.14
'
Cys 183 . . B . . T . -1.13G . . . 0.10 0.08
Ala 184 . . B . . T . -0.36G * . . -0.200.13
.
Asp 185 . . . . T T . -0.70G . . . 0.20 0.24
1 Gly 186 . . . . T T . -0.28G . . . 0.50 0.45
S
Phe 187 . . . . T . . 0.62 G . . . 0.30 0.69
His 188 . . . . T T . 0.62 . . . . 1.10 0.83
Gly 189 . . . . T T . 0.61 G . * . 0.20 0.45
Tyr 190 . . . . T T . 0.72 G * . . 0.20 0.51
Lys 191 . . B . . T . 1.07 . * . . 0.70 0.74
Cys 192 . . B . . . . 1.42 . * . . 0.93 1.29
Met 193 . . B . . . . 1.16 . * . . 1.06 0.82
Arg 194 . . B . . T . 0.80 . * . F 1.99 0.55
Gln 195 . . B . . T . 0.74 G * . F 1.37 0.88
25 Gly 196 . . . . T T . -0.11. * . F 2.80 1.20
Ser 197 . . . . . T C -0.26G . . F 1.57 0.50
Phe 198 . . B B . . . -0.26G * . . 0.24 0.24
Ser 199 . . B B . . . -1.07G * . . -0.040.24
Leu 200 . . B B . . . -1.77G . * . -0.320.16
30 Leu 201 . . B B . . . -1.77G . * . -O.GO0.16
Met 202 . . B B . . . -2.36G . . . -0.600.11
Phe 203 . . B B . . . -2.47G . . . -0.600.10
Phe 204 . . B B . . . -2.51G . . . -0.600.10
Gly 205 . . B B . . . -2.29G . . . -0.600.10
3S Ile 206 . . B B . . . -1.79G . . . -O.GO0.11
Leu 207 . . B B . . . -1.50G . . . -0.600.19
Gly 208 . . . B . . C -1.61G . . . -0.400.28
Ala 209 . . . B . . C -1.21G . . . -0.400.32
Thr 210 . . . B . . C -1.72G . . F -0.250.53
40 Thr 211 . . B B . . . -1.13G . * F -0.450.40
Leu 212 . . B B . . . -1.21G . . . -0.600.52
Ser 213 . . B B . . . -1.68G . * . -0.600.25
Val 214 . . B B . . . -1.90G . * . -0.600.15
Ser 215 . . B B . . . -1.88G . * . -0.600.15
4S Ile 216 . . B B . . . -2.16G . * . -0.600.11
Leu 217 . . B B . . . -1.66G . * . -0.600.16
Leu 218 . . B B . . . -1.3GG * * . -O.GO0.17
Trp 219 . . B B . . . -0.39G . * . -0.600.41
Ala 220 . . B B . . . 0.02 G . . . -0.340.98
Thr 221 . . B B . . . 0.9G . . . F 1.12 2.33
Gln 222 . . B B . . . 1.18 . * * F 1.68 4.44
Arg 223 . . . B T . . 2.03 . * * F 2.34 4.44
Arg 224 . . . B T . . 2.01 . . * F 2.60 6.15
Lys 225 . . . B T . . 2.30 . . * F 2.34 5.13
55 TableI
(continued)
Res II III IV V VI VII VIII IX X XI XIIXIII XIV
Position
I
Ala 226 . A . . T . . 2.22 . * * F 2.08 3.51
Lys 227 . A . . . . C 1.83 . * * . 1.47 2.29
(0 Thr 228 . A B . . . . 1.33 . * * . 1.01 1.46
Ser 229 . A B . . . . 0.83 . * . . 0.45 1.85
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
MISSING AT THE TIME OF PUBLICATION
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
51
Among highly preferred fragments in this regard are those that comprise
regions of
TGF alpha HIII that combine several structural features, such as several of
the features set out
above.
Other preferred polypeptide fragments are biologically active TGF alpha HIII
fragments. Biologically active fragments are those exhibiting activity
similar, but not
necessarily identical, to an activity of the TGF alpha HIII polypeptide. The
biological activity
of the fragments may include an improved desired activity, or a decreased
undesirable
activity. Polynucleotides encoding these polypeptide fragments are also
encompassed by the
invention.
However, many polynucleotide sequences, such as EST sequences, are publicly
available and accessible through sequence databases. Some of these sequences
are related to
SEQ ID NO:1 and may have been publicly available prior to conception of the
present
invention. Preferably, such related polynucleotides are specifically excluded
from the scope
of the present invention. To list every related sequence would be cumbersome.
Accordingly,
preferably excluded from the present invention are one or more polynucleotides
comprising a
nucleotide sequence described by the general formula of a-b, where a is any
integer between 1
to 909 of SEQ ID NO:1, b is an integer of 1 S to 923, where both a and b
correspond to the
positions of nucleotide residues shown in SEQ LD NO:1, and where the b is
greater than or
equal to a + 14.
Epitopes and Antibodies
The present invention encompasses polypeptides comprising, or alternatively
consisting of, an epitope of the polypeptide having an amino acid sequence of
SEQ ID N0:2,
or an epitope of the polypeptide sequence encoded by a polynucleotide sequence
contained in
ATCC Deposit No: 9342 or encoded by a polynucleotide that hybridizes to the
complement
of the sequence of SEQ 1D NO:1 or contained in ATCC Deposit No: 9~34a under
stringent
hybridization conditions or lower stringency hybridization conditions as
defined supra. The
present invention further encompasses polynucleotide sequences encoding an
epitope of a
polypeptide sequence of the invention (such as, for example, the sequence
disclosed in SEQ
ID NO:1), polynucleotide sequences of the complementary strand of a
polynucleotide
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
52
sequence encoding an epitope of the invention, and polynucleotide sequences
which
hybridize to the complementary strand under stringent hybridization conditions
or lower
stringency hybridization conditions defined supra.
The term "epitopes," as used herein, refers to portions of a polypeptide
having
antigenic or immunogenic activity in an animal, preferably a mammal, and most
preferably
in a human. In a preferred embodiment, the present invention encompasses a
polypeptide
comprising an epitope, as well as the polynucleotide encoding this
polypeptide. An
"immunogenic epitope," as used herein, is defined as a portion of a protein
that elicits an
antibody response in an animal, as determined by any method known in the art,
for example,
by the methods for generating antibodies described infra. (See, for example,
Geysen et al.,
Proc. Natl. Acad. Sci. USA 81:3998- 4002 (1983)). The term "antigenic
epitope," as used
herein, is defined as a portion of a protein to which an antibody can
immunospecifically bind
its antigen as determined by any method well known in the art, for example, by
the
immunoassays described herein. Immunospecific binding excludes non-specific
binding but
1 S does not necessarily exclude cross- reactivity with other antigens.
Antigenic epitopes need
not necessarily be immunogenic.
Fragments which function as epitopes may be produced by any conventional
means.
(See, e.g., Houghten, Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985), further
described in
U.S. Patent No. 4,631,211).
In the present invention, antigenic epitopes preferably contain a sequence of
at least 4,
at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at
least 10, at least 11, at
least 12, at least 1~3, at least 14, at least 15, at least 20, at least 25, at
least 30, at least 40, at
least 50, and, most preferably, between about 15 to about 30 amino acids.
Preferred
polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15,
20, 25, 30,
35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues
in length.
Additional non-exclusive preferred antigenic epitopes include the antigenic
epitopes
disclosed herein, as well as portions thereof. Antigenic epitopes are useful,
for example, to
raise antibodies, including monoclonal antibodies, that specifically bind the
epitope.
Preferred antigenic epitopes include the antigenic epitopes disclosed herein,
as well as any
combination of two, three, four, five or more of these antigenic epitopes.
Antigenic epitopes
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
53
can be used as the target molecules in immunoassays. (See, for instance,
Wilson et al., Cell
37:767-778 (1984); Sutcliffe et al., Science 219:660-666 (1983)).
Similarly, immunogenic epitopes can be used, for example, to induce antibodies
according to methods well known in the art. (See, for instance, Sutcliffe et
al., supra; Wilson
et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle
et al., J. Gen.
Virol. 66:2347-2354 (1985). Preferred immunogenic epitopes include the
immunogenic
epitopes disclosed herein, as well as any combination of two, three, four,
five or more of
these immunogenic epitopes. The polypeptides comprising one or more
immunogenic
epitopes may be presented for eliciting an antibody response together with a
carrier protein,
such as an albumin, to an animal system (such as rabbit or mouse), or, if the
polypeptide is of
sufficient length (at least about 25 amino acids), the polypeptide may be
presented without a
carrier. However, immunogenic epitopes comprising as few as 8 to 10 amino
acids have
been shown to be sufficient to raise antibodies capable of binding to, at the
very least, linear
epitopes in a denatured polypeptide (e.g., in Western blotting).
Epitope-bearing polypeptides of the present invention may be used to induce
antibodies according to methods well known in the art including, but not
limited to, in vivo
immunization, in vitro immunization, and phage display methods. See, e.g.,
Sutcliffe et al.,
supra; Wilson et al., supra, and Bittle et al., J. Gen. Virol., 66:2347-2354
(1985). If in vivo
immunization is used, animals may be immunized with free peptide; however,
anti-peptide
antibody titer may be boosted by coupling the peptide to a macromolecular
Garner, such as
keyhole limpet hemacyanin (KLH) or tetanus toxoid. For instance, peptides
containing
cysteine residues may be coupled to a Garner using a linker such as
maleimidobenzoyl- N-
hydroxysuccinimide ester (MBS), while other peptides may be coupled to
carriers using a
more general linking agent such as glutaraldehyde. Animals such as rabbits,
rats and mice
are immunized with either free or carrier- coupled peptides, for instance, by
intraperitoneal
and/or intradermal injection of emulsions containing about 100 ~g of peptide
or carrier
protein and Freund's adjuvant or any other adjuvant known for stimulating an
immune
response. Several booster injections may be needed, for instance, at intervals
of about two
weeks, to provide a useful titer of anti-peptide antibody which can be
detected, for example,
by ELISA assay using free peptide adsorbed to a solid surface. The titer of
anti-peptide
antibodies in serum from an immunized animal may be increased by selection of
anti-peptide
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
54
antibodies, for instance, by adsorption to the peptide on a solid support and
elution of the
selected antibodies according to methods well known in the art.
As one of skill in the art will appreciate, and as discussed above, the
polypeptides of
the present invention comprising an immunogenic or antigenic epitope can be
fused to other
polypeptide sequences. For example, the polypeptides of the present invention
may be fused
with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions
thereof
(CHI, CH2, CH3, or any combination thereof and portions thereof) resulting in
chimeric
polypeptides. Such fusion proteins may facilitate purification and may
increase half life in
vivo. This has been shown for chimeric proteins consisting of the first two
domains of the
human CD4-polypeptide and various domains of the constant regions of the heavy
or light
chains of mammalian immunoglobulins. See, e.g., EP 394,827; Traunecker et al.,
Nature,
331:84-86 (1988). Enhanced delivery of an antigen across the epithelial
barrier to the
immune system has been demonstrated for antigens (e.g., insulin) conjugated to
an FcRn
binding partner such as IgG or Fc fragments (see, e.g., PCT Publications WO
96/22024 and
WO 99/04813). IgG Fusion proteins that have a disulfide-linked dimeric
structure due to
the IgG portion desulfide bonds have also been found to be more efficient in
binding and
neutralizing other molecules than monomeric polypeptides or fragments thereof
alone. See,
e.g., Fountoulakis et al., J. Biochem., 270:3958-3964 (1995). Nucleic acids
encoding the
above epitopes can also be recombined with a gene of interest as an epitope
tag (e.g., the
hemagglutinin ("HA") tag or flag tag) to aid in detection and purification of
the expressed
polypeptide. For example, a system described by Janknecht et al. allows for
the ready
purification of non-denatured fusion proteins expressed in human cell lines
(Janknecht et al.,
1991, Proc. Natl. Acad. Sci. USA 88:8972- 897). In this system, the gene of
interest is
subcloned into a vaccinia recombination plasmid such that the open reading
frame of the
gene is translationally fused to an amino-terminal tag consisting of six
histidine residues.
The tag serves as a matrix binding domain for the fusion protein. Extracts
from cells
infected with the recombinant vaccinia virus are loaded onto Ni2+
nitriloacetic acid-agarose
column and histidine-tagged proteins can be selectively eluted with imidazole-
containing
buffers.
Additional fusion proteins of the invention may be generated through the
techniques
of gene-shuffling, motif shuffling, exon-shuffling, and/or codon-shuffling
(collectively
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
referred to as "DNA shuffling"). DNA shuffling may be employed to modulate the
activities
of polypeptides of the invention, such methods can be used to generate
polypeptides with
altered activity, as well as agonists and antagonists of the polypeptides.
See, generally, U.S.
Patent Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and
Patten et al.,
5 Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol.
16(2):76-82
(1998); Hansson, et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo and
Blasco,
Biotechniques 24(2):308- 13 (1998) (each of these patents and publications are
hereby
incorporated by reference in its entirety). In one embodiment, alteration of
polynucleotides
corresponding to SEQ >I7 NO:I and the polypeptides encoded by these
polynucleotides may
10 be achieved by DNA shuffling. DNA shuffling involves the assembly of two or
more DNA
segments by homologous or site-specific recombination to generate variation in
the
polynucleotide sequence. In another embodiment, polynucleotides of the
invention, or the
encoded polypeptides, may be altered by being subjected to random mutagenesis
by error-
prone PCR, random nucleotide insertion or other methods prior to
recombination. In another
15 embodiment, one or more components, motifs, sections, parts, domains,
fragments, etc., of a
polynucleotide encoding a polypeptide of the invention may be recombined with
one or more
components, motifs, sections, parts, domains, fragments, etc. of one or more
heterologous
molecules.
20 Antibodies
Further polypeptides of the invention relate to antibodies and T-cell antigen
receptors
(TCR) which immunospecifically bind a polypeptide, polypeptide fragment, or
variant of
SEQ ID N0:2, and/or an epitope, of the present invention (as determined by
immunoassays
well known in the art for assaying specific antibody-antigen binding).
Antibodies of the
25 invention include, but are not limited to, polyclonal, monoclonal,
multispecific, human,
humanized or chimeric antibodies, single chain antibodies, Fab fragments,
F(ab') fragments,
fragments produced by a Fab expression library, anti-idiotypic (anti-Id)
antibodies
(including, e.g., anti-Id antibodies to antibodies of the invention), and
epitope-binding
fragments of any of the above. The term "antibody," as used herein, refers to
30 immunoglobulin molecules and immunologically active portions of
immunoglobulin
molecules, i.e., molecules that contain an antigen binding site that
immunospecifically binds
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
56
an antigen. The immunoglobulin molecules of the invention can be of any type
(e.g., IgG,
IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and
IgA2) or subclass
of immunoglobulin molecule.
Most preferably the antibodies are human antigen-binding antibody fragments of
the
present invention and include, but are not limited to, Fab, Fab' and F(ab')2,
Fd, single-chain
Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments
comprising
either a VL or VH domain. Antigen-binding antibody fragments, including single-
chain
antibodies, may comprise the variable regions) alone or in combination with
the entirety or a
portion of the following: hinge region, CH1, CH2, and CH3 domains. Also
included in the
invention are antigen-binding fragments also comprising any combination of
variable
regions) with a hinge region, CH1, CH2, and CH3 domains. The antibodies of the
invention
may be from any animal origin including birds and mammals. Preferably, the
antibodies are
human, marine (e.g., mouse and rat), donkey, ship rabbit, goat, guinea pig,
camel, horse, or
chicken. As used herein, "human" antibodies include antibodies having the
amino acid
sequence of a human immunoglobulin and include antibodies isolated from human
immunoglobulin libraries or from animals transgenic for one or more human
immunoglobulin
and that do not express endogenous immunoglobulins, as described infra and,
for example
in, U.S. Patent No. 5,939,598 by Kucherlapati et al.
The antibodies of the present invention may be monospecific, bispecific,
trispecific or
of greater multispecificity. Multispecific antibodies may be specific for
different epitopes of
a polypeptide of the present invention or may be specific for both a
polypeptide of the present
invention as well as for a heterologous epitope, such as a heterologous
polypeptide or solid
support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO
91/00360;
WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Patent Nos.
4,474,893;
4,714,681; 4,925,648; 5,573,920; 5,601,819; Kostelny et al., J. Immunol.
148:1547-1553
(1992).
Antibodies of the present invention may be described or specified in terms of
the
epitope(s) or portions) of a polypeptide of the present invention which they
recognize or
specifically bind. The epitope(s) or polypeptide portions) may be specified as
described
herein, e.g., by N-terminal and C-terminal positions, by size in contiguous
amino acid
residues, or listed in the Tables and Figures. Preferred epitopes of the
invention include: C38-
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
57
N44; K53-L60; C65-I72; L77-F89; Q101-L109; I144-6177; A184-F198; and/or T221-
5229 of SEQ )D
N0:2, as well as polynucleotides that encode these epitopes. Antibodies which
specifically
bind any epitope or polypeptide of the present invention may also be excluded.
Therefore,
the present invention includes antibodies that specifically bind polypeptides
of the present
S invention, and allows for the exclusion of the same.
Antibodies of the present invention may also be described or specified in
terms of
their cross-reactivity. Antibodies that do not bind any other analog,
ortholog, or homolog of a
polypeptide of the present invention are included. Antibodies that bind
polypeptides with at
least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least
70%, at least 65%, at
least 60%, at least 55%, and at least 50% identity (as calculated using
methods known in the
art and described herein) to a polypeptide of the present invention are also
included in the
present invention. In specific embodiments, antibodies of the present
invention cross-react
with murine, rat and/or rabbit homologs of human proteins and the
corresponding epitopes
thereof. Antibodies that do not bind polypeptides with less than 95%, less
than 90%, less than
85%, less than 80%, less than 75%, less than 70%, less than 65%, less than
60%, less than
55%, and less than 50% identity (as calculated using methods known in the art
and described
herein) to a polypeptide of the present invention are also included in the
present invention.
In, a specific embodiment, the above-described cross-reactivity is with
respect to any single
specific antigenic or immunogenic polypeptide, or combinations) of 2, 3, 4, 5,
or more of the
specific antigenic and/or immunogenic polypeptides disclosed herein. Further
included in the
present invention are antibodies which bind polypeptides encoded by
polynucleotides which
hybridize to a polynucleotide of the present invention under stringent
hybridization conditions
(as described herein). Antibodies of the present invention may also be
described or specified
in terms of their binding affinity to a polypeptide of the invention.
Preferred binding
affinities include those with a dissociation constant or Kd less than 5 X 10-Z
M, 10-2 M, 5 X
10-3 M, 10-3 M, 5 X 10~ M, 10-4 M, 5 X 10-5 M, 10-5 M, 5 X 10-6 M, 10-6M, 5 X
10-' M, 10'
M, 5 X 10-8 M, 10-8 M, 5 X 10-9 M, 10-9 M, 5 X 10-' ° M, 10~' °
M, 5 X 10-" M, 10-" M, 5 X
10-' Z M, ' °-' Z M, S X 10-' 3 M, 10-' 3 M, 5 X 10-' 4 M, 10-' 4 M, 5
X 10-' S M, or 10-' S M.
The invention also provides antibodies that competitively inhibit binding of
an
antibody to an epitope of the invention as determined by any method known in
the art for
determining competitive binding, for example, the immunoassays described
herein. In
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
58
preferred embodiments, the antibody competitively inhibits binding to the
epitope by at least
95%, at least 90%, at least 85 %, at least 80%, at least 75%, at least 70%, at
least 60%, or at
least 50%. .
Antibodies of the present invention may act as agonists or antagonists of the
polypeptides of the present invention. For example, the present invention
includes antibodies
which disrupt the receptor/ligand interactions with the polypeptides of the
invention either
partially or fully. Preferrably, antibodies of the present invention bind an
antigenic epitope
disclosed herein, or a portion thereof. The invention features both receptor-
specific antibodies
and ligand-specific antibodies. The invention also features receptor-specific
antibodies which
do not prevent ligand binding but prevent receptor activation. Receptor
activation (i.e.,
signaling) may be determined by techniques described herein or otherwise known
in the art.
For example, receptor activation can be determined by detecting the
phosphorylation (e.g.,
tyrosine or serine/threonine) of the receptor or its substrate by
immunoprecipitation followed
by western blot analysis (for example, as described supra). In specific
embodiments,
antibodies are provided that inhibit ligand activity or receptor activity by
at least 95%, at least
90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or
at least 50% of
the activity in absence of the antibody.
The invention also features receptor-specific antibodies which both prevent
ligand
binding and receptor activation as well as antibodies that recognize the
receptor-ligand
complex, and, preferably, do not specifically recognize the unbound receptor
or the unbound
ligand. Likewise, included in the invention are neutralizing antibodies which
bind the ligand
and prevent binding of the ligand to the receptor, as well as antibodies which
bind the ligand,
thereby preventing receptor activation, but do not prevent the ligand from
binding the
receptor. Further included in the invention are antibodies which activate the
receptor. These
antibodies may act as receptor agonists, i.e., potentiate or activate either
all or a subset of the
biological activities of the ligand-mediated receptor activation, for example,
by inducing
dimerization of the receptor. The antibodies may be specified as agonists,
antagonists or
inverse agonists for biological activities comprising the specific biological
activities of the
peptides of the invention disclosed herein. The above antibody agonists can be
made using
methods known in the art. See, e.g., PCT publication WO 96/40281; U.S. Patent
No.
5,811,097; Deng et al., Blood 92(6):1981-1988 (1998); Chen et al., Cancer Res.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
59
58(16):3668-3678 (1998); Harrop et al., J. Immunol. 161(4):1786-1794 (1998);
Zhu et al.,
Cancer Res. 58(15):3209-3214 (1998); Yoon et al., J. Immunol. 160(7):3170-3179
(1998);
Prat et al., J. Cell. Sci. 111(Pt2):237-247 (1998); Pitard et al., J. Immunol.
Methods
205(2):177-190 (1997); Liautard et al., Cytokine 9(4):233-241 (1997); Carlson
et al., J. Biol.
Chem. 272(17):11295-11301 (1997); Taryman et al., Neuron 14(4):755-762 (1995);
Muller
et al., Structure 6(9):1153-1167 (1998); Bartunek et al., Cytokine 8(1):14-20
(1996) (which
are all incorporated by reference herein in their entireties).
Antibodies of the present invention may be used, for example, but not limited
to, to
purify, detect, and target the polypeptides of the present invention,
including both in vitro and
in vivo diagnostic and therapeutic methods. For example, the antibodies have
use in
immunoassays for qualitatively and quantitatively measuring levels of the
polypeptides of the
present invention in biological samples. See, e.g., Harlow et al., Antibodies:
A Laboratory
Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by
reference
herein in its entirety).
As discussed in more detail below, the antibodies of the present invention may
be
used either alone or in combination with other compositions. The antibodies
may further be
recombinantly fused to a heterologous polypeptide at the N- or C-terminus or
chemically
conjugated (including covalently and non-covalently conjugations) to
polypeptides or other
compositions. For example, antibodies of the present invention may be
recombinantly fused
or conjugated to molecules useful as labels in detection assays and effector
molecules such as
heterologous polypeptides, drugs, radionuclides, or toxins. See, e.g., PCT
publications WO
92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP 396,387.
The antibodies of the invention include derivatives that are modified, i.e, by
the
covalent attachment of any type of molecule to the antibody such that covalent
attachment
does not prevent the antibody from generating an anti-idiotypic response. For
example, but
not by way of limitation, the antibody derivatives include antibodies that
have been modified,
e.g., by glycosylation, acetylation, pegylation, phosphylation, amidation,
derivatization by
known protecting/blocking groups, proteolytic cleavage, linkage to a cellular
ligand or other
protein, etc. Any of numerous chemical modifications may be carried out by
known
techniques, including, but not limited to specific chemical cleavage,
acetylation, formylation,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
metabolic synthesis of tunicamycin, etc. Additionally, the derivative may
contain one or
more non-classical amino acids.
The antibodies of the present invention may be generated by any suitable
method
known in the art. Polyclonal antibodies to an antigen-of interest can be
produced by various
5 procedures well known in the art. For example, a polypeptide of the
invention can be
administered to various host animals including, but not limited to, rabbits,
mice, rats, etc. to
induce the production of sera containing polyclonal antibodies specific for
the antigen.
Various adjuvants may be used to increase the immunological response,
depending on the
host species, and include but are not limited to, Freund's (complete and
incomplete), mineral
10 gels such as aluminum hydroxide, surface active substances such as
lysolecithin, pluronic
polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins,
dinitrophenol, and
potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and
corynebacterium parvum. Such adjuvants are also well known in the art.
Monoclonal antibodies can be prepared using a wide variety of techniques known
in
15 the art including the use of hybridoma, recombinant, and phage display
technologies, or a
combination thereof. For example, monoclonal antibodies can be produced using
hybridoma
techniques including those known in the art and taught, for example, in Harlow
et al.,
Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed.
1988);
Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681
(Elsevier,
20 N.Y., 1981) (said references incorporated by reference in their
entireties). The term
"monoclonal antibody" as used herein is not limited to antibodies produced
through
hybridoma technology. The term "monoclonal antibody" refers to an antibody
that is derived
from a single clone, including any eukaryotic, prokaryotic, or phage clone,
and not the
method by which it is produced.
25 Methods for producing and screening for specific antibodies using hybridoma
technology are routine and well known in the art and are discussed in detail
in the Examples.
In a non-limiting example, mice can be immunized with a polypeptide of the
invention or a
cell expressing such peptide. Once an immune response is detected, e.g.,
antibodies specific
for the antigen are detected in the mouse serum, the mouse spleen is harvested
and
30 splenocytes isolated. The splenocytes are then fused by well known
techniques to any
suitable myeloma cells, for example cells from cell line SP20 available from
the ATCC.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
61
Hybridomas are selected and cloned by limited dilution. The hybridoma clones
are then
assayed by methods known in the art for cells that secrete antibodies capable
of binding a
polypeptide of the invention. Ascites fluid, which generally contains high
levels of
antibodies, can be generated by immunizing mice with positive hybridoma
clones.
Accordingly, the present invention provides methods of generating monoclonal
antibodies as well as antibodies produced by the method comprising culturing a
hybridoma
cell secreting an antibody of the invention wherein, preferably, the hybridoma
is generated by
fusing splenocytes isolated from a mouse immunized with an antigen of the
invention with
myeloma cells and then screening the hybridomas resulting from the fusion for
hybridoma
clones that secrete an antibody able to bind a polypeptide of the invention.
Antibody fragments which recognize specific epitopes may be generated by known
techniques. For example, Fab and F(ab')2 fragments of the invention may be
produced by
proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain
(to
produce Fab fragments) or pepsin (to produce F(ab')2 fragments). F(ab')2
fragments contain
the variable region, the light chain constant region and the CHl domain of the
heavy chain.
For example, the antibodies of the present invention can also be generated
using
various phage display methods known in the art. In phage display methods,
functional
antibody domains are displayed on the surface of phage particles which carry
the
polynucleotide sequences encoding them. In a particular embodiment, such phage
can be
utilized to display antigen binding domains expressed from a repertoire or
combinatorial
antibody library (e.g., human or murine). Phage expressing an antigen binding
domain that
binds the antigen of interest can be selected or identified with antigen,
e.g., using labeled
antigen or antigen bound or captured to a solid surface or bead. Phage used in
these methods
are typically filamentous phage including fd and M13 binding domains expressed
from phage
with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused
to either the
phage gene III or gene VIII protein. Examples of phage display methods that
can be used to
make the antibodies of the present invention include those disclosed in
Brinkman et al., J.
Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-
186
(1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et
al., Gene 187 9-
18 (1997); Burton et al., Advances in Immunology 57:191-280 (1994); PCT
application No.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
62
PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO
92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Patent Nos.
5,698,426;
5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698;
5,427,908;
5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is
incorporated
herein by reference in its entirety.
As described in the above references, after phage selection, the antibody
coding
regions from the phage can be isolated and used to generate whole antibodies,
including
human antibodies, or any other desired antigen binding fragment, and expressed
in any
desired host, including mammalian cells, insect cells, plant cells, yeast, and
bacteria, e.g., as
described in detail below. For example, techniques to recombinantly produce
Fab, Fab' and
F(ab')2 fragments can also be employed using methods known in the art such as
those
disclosed in PCT publication WO 92/22324; Mullinax et al., BioTechniques
12(6):864-869
(1992); and Sawai et al., AJRI 34:26-34 (1995); and Better et al., Science
240:1041-1043
(1988) (said references incorporated by reference in their entireties).
Examples of techniques which can be used to produce single-chain Fvs and
antibodies
include those described in U.S. Patents 4,946,778 and 5,258,498; Huston et
al., Methods in
Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993); and Skerra
et al.,
Science 240:1038-1040 (1988). For some uses, including in vivo use of
antibodies in
humans and in vitro detection assays, it may be preferable to use chimeric,
humanized, or
human antibodies. A chimeric antibody is a molecule in which different
portions of the
antibody are derived from different animal species, such as antibodies having
a variable
region derived from a murine monoclonal antibody and a human immunoglobulin
constant
region. Methods for producing chimeric antibodies are known in the art. See
e.g., Mornson,
Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et
al., (1989) J.
Immunol. Methods 125:191-202; U.S. Patent Nos. 5,807,715; 4,816,567; and
4,816397,
which are incorporated herein by reference in their entirety. Humanized
antibodies are
antibody molecules from non-human species antibody that binds the desired
antigen having
one or more complementarity determining regions (CDRs) from the non-human
species and
a framework regions from a human immunoglobulin molecule. Often, framework
residues in
the human framework regions will be substituted with the corresponding residue
from the
CDR donor antibody to alter, preferably improve, antigen binding. These
framework
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
63
substitutions are identified by methods well known in the art, e.g., by
modeling of the
interactions of the CDR and framework residues to identify framework residues
important
for antigen binding and sequence comparison to identify unusual framework
residues at
particular positions. (See, e.g., Queen et al., U.S. Patent No. 5,585,089;
Riechmann et al.,
Nature 332:323 (1988), which are incorporated herein by reference in their
entireties.)
Antibodies can be humanized using a variety of techniques known in the art
including, for
example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Patent
Nos.
5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing (EP 592,106; EP
519,596;
Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein
Engineering 7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973 (1994)), and
chain
shuffling (U.5. Patent No. 5,565,332).
Completely human antibodies are particularly desirable for therapeutic
treatment of
human patients. Human antibodies can be made by a variety of methods known in
the art
including phage display methods described above using antibody libraries
derived from
human immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and
4,716,111; and
PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO
96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein
by
reference in its entirety.
Human antibodies can also be produced using transgenic mice which are
incapable of
expressing functional endogenous immunoglobulins, but which can express human
immunoglobulin genes. For example, the human heavy and light chain
immunoglobulin gene
complexes may be introduced randomly or by homologous recombination into mouse
embryonic stem cells. Alternatively, the human variable region, constant
region, and
diversity region may be introduced into mouse embryonic stem cells in addition
to the human
heavy and light chain genes. The mouse heavy and light chain immunoglobulin
genes may
be rendered non-functional separately or simultaneously with the introduction
of human
immunoglobulin loci by homologous recombination. In particular, homozygous
deletion of
the JH region prevents endogenous antibody production. The modified embryonic
stem cells
are expanded and microinjected into blastocysts to produce chimeric mice. The
chimeric
mice are then bred to produce homozygous offspring which express human
antibodies. The
transgenic mice are immunized in the normal fashion with a selected antigen,
e.g., all or a
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
64
portion of a polypeptide of the invention. Monoclonal antibodies directed
against the antigen
can be obtained from the immunized, transgenic mice using conventional
hybridoma
technology. The human immunoglobulin transgenes harbored by the transgenic
mice
rearrange during B cell differentiation, and subsequently undergo class
switching and
somatic mutation. Thus, using such a technique, it is possible to produce
therapeutically
useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology
for producing
human antibodies, see Lonberg and Huszar, Int. Rev. Immunol. 13:65-93 (1995).
For a
detailed discussion of this technology for producing human antibodies and
human
monoclonal antibodies and protocols for producing such antibodies, see, e.g.,
PCT
publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European
Patent
No. 0 598 877; U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825;
5,661,016;
5,545,806; 5,814,318; 5,885,793; 5,916,771; and 5,939,598, which are
incorporated by
reference herein in their entirety. In addition, companies such as Abgenix,
Inc. (Freemont,
CA) and Genpharm (San Jose, CA) can be engaged to provide human antibodies
directed
against a selected antigen using technology similar to that described above.
Completely human antibodies which recognize a selected epitope can be
generated
using a technique referred to as "guided selection." In this approach a
selected non-human
monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of
a completely
human antibody recognizing the same epitope. (Jespers et al., Biotechnology
12:899-903
(1988)).
Further, antibodies to the polypeptides of the invention can, in turn, be
utilized to
generate anti-idiotype antibodies that "mimic" polypeptides of the invention
using techniques
well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J.
7(5):437-444;
(1989) and Nissinoff, J. Immunol. 147(8):2429-2438 (1991)). For example,
antibodies
which bind to and competitively inhibit polypeptide multimerization and/or
binding of a
polypeptide of the invention to a ligand can be used to generate anti-
idiotypes that "mimic"
the polypeptide multimerization and/or binding domain and, as a consequence,
bind to and
neutralize polypeptide and/or its ligand. Such neutralizing anti-idiotypes or
Fab fragments of
such anti-idiotypes can be used in therapeutic regimens to neutralize
polypeptide ligand. For
example, such anti-idiotypic antibodies can be used to bind a polypeptide of
the invention
and/or to bind its ligands/receptors, and thereby block its biological
activity.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
Antibodies specific to TGF alpha HIII may be used for cancer diagnosis and
therapy,
since many types of cancer cells up-regulate various members of the TGF alpha
family
during the process of neoplasia or hyperplasia. These antibodies bind to and
inactivate TGF
alpha HIII. Monoclonal antibodies against TGF alpha HIII (and/or its family
members) are in
5 clinical use for both the diagnosis and therapy of certain disorders
including (but not limited
to) hyperplastic and neoplastic growth abnormalities. Upregulation of growth
factor
'expression by neoplastic tissues forms the basis for a variety of serum
assays which detect
increases in growth factor in the blood of affected patients. These assays are
typically applied
not only in diagnostic settings, but are applied in prognostic settings as
well (to detect the
10 presence of occult tumor cells following surgery,chemotherapy, etc)
In addition, malignant cells expressing the TGF alpha HIII receptor may be
detected
by using labeled TGF alpha H>TI in a receptor binding assay, or by the use of
antibodies to
the TGF alpha HIII receptor itself. Cells may be distinguished in accordance
with the
presence and density of receptors for TGF alpha HIII, thereby providing a
means for
15 predicting the susceptibility of such cells to the biological activities of
TGF alpha HIII.
Polynucleotides Encoding Antibodies
The invention further provides polynucleotides comprising a nucleotide
sequence
20 encoding an antibody of the invention and fragments thereof. The invention
also
encompasses polynucleotides that hybridize under stringent or lower stringency
hybridization
conditions, e.g., as defined supra, to polynucleotides that encode an
antibody, preferably, that
specifically binds to a polypeptide of the invention, preferably, an antibody
that binds to a
polypeptide having the amino acid sequence of SEQ ID N0:2.
25 The polynucleotides may be obtained, and the nucleotide sequence of the
polynucleotides determined, by any method known in the art. For example, if
the nucleotide
sequence of the antibody is known, a polynucleotide encoding the antibody may
be assembled
from chemically synthesized oligonucleotides (e.g., as described in Kutmeier
et al.,
BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of
overlapping
30 oli~onucleotides containing portions of the sequence encoding the antibody,
annealing and
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
66
ligating of those oligonucleotides, and then amplification of the ligated
oligonucleotides by
PCR.
Alternatively, a polynucleotide encoding an antibody may be generated from
nucleic
acid from a suitable source. If a clone containing a nucleic acid encoding a
particular
antibody is not available, but the sequence of the antibody molecule is known,
a nucleic acid
encoding the immunoglobulin may be chemically synthesized or obtained from a
suitable
source (e.g., an antibody cDNA library, or a cDNA library generated from, or
nucleic acid,
preferably poly A+ RNA, isolated from, any tissue or cells expressing the
antibody, such as
hybridoma cells selected to express an antibody of the invention) by PCR
amplification using
synthetic primers hybridizable to the 3' and S' ends of the sequence or by
cloning using an
oligonucleotide probe specific for the particular gene sequence to identify,
e.g., a cDNA
clone from a cDNA library that encodes the antibody. Amplified nucleic acids
generated by
PCR may then be cloned into replicable cloning vectors using any method well
known in the
art.
Once the nucleotide sequence and corresponding amino acid sequence of the
antibody
is determined, the nucleotide sequence of the antibody may be manipulated
using methods
well known in the art for the manipulation of nucleotide sequences, e.g.,
recombinant DNA
techniques, site directed mutagenesis, PCR, etc. (see, for example, the
techniques described
in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold
Spring
Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al., eds., 1998,
Current Protocols
in Molecular Biology, John Wiley & Sons, NY, which are both incorporated by
reference
herein in their entireties ), to generate antibodies having a different amino
acid sequence, for
example to create amino acid substitutions, deletions, and/or insertions.
In a specific embodiment, the amino acid sequence of the heavy and/or light
chain
variable domains may be inspected to identify the sequences of the
complementarity
determining regions (CDRs) by methods that are well know in the art, e.g., by
comparison to
known amino acid sequences of other heavy and light chain variable regions to
determine the
regions of sequence hypervariability. Using routine recombinant DNA
techniques, one or
more of the CDRs may be inserted within framework regions, e.g., into human
framework
regions to humanize a non-human antibody, as described supra. The framework
regions may
be naturally occurnng or consensus framework regions, and preferably human
framework
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
67
regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479 (1998) for a
listing of human
framework regions). Preferably, the polynucleotide generated by the
combination of the
framework regions and CDRs encodes an antibody that specifically binds a
polypeptide of
the invention. Preferably, as discussed supra, one or more amino acid
substitutions may be
made within the framework regions, and, preferably, the amino acid
substitutions improve
binding of the antibody to its antigen. Additionally, such methods may be used
to make
amino acid substitutions or deletions of one or more variable region cysteine
residues
participating in an intrachain disulfide bond to generate antibody molecules
lacking one or
more intrachain disulfide bonds. Other alterations to the polynucleotide are
encompassed by
the present invention and within the skill of the art.
In addition, techniques developed for the production of "chimeric antibodies"
(Mornson et al., Proc. Natl. Acad. Sci. 81:851-855 (1984); Neuberger et al.,
Nature
312:604-608 (1984); Takeda et al., Nature 314:452-454 (1985)) by splicing
genes from a
mouse antibody molecule of appropriate antigen specificity together with genes
from a
human antibody molecule of appropriate biological activity can be used. As
described supra,
a chimeric antibody is a molecule in which different portions are derived from
different
animal species, such as those having a variable region derived from a murine
mAb and a
human immunoglobulin constant region, e.g., humanized antibodies.
Alternatively, techniques described for the production of single chain
antibodies (U.S.
Patent No. 4,946,778; Bird, Science 242:423- 42 (1988); Huston et al., Proc.
Natl. Acad. Sci.
USA 85:5879-5883 (1988); and Ward et al., Nature 334:544-54 (1989)) can be
adapted to
produce single chain antibodies. Single chain antibodies are formed by linking
the heavy and
light chain fragments of the Fv region via an amino acid bridge, resulting in
a single chain
polypeptide. Techniques for the assembly of functional Fv fragments in E. coli
may also be
used (Skerra et al., Science 242:1038- 1041 (1988)).
Methods of Producing Antibodies
The antibodies of the invention can be produced by any method known in the art
for
the synthesis of antibodies, in particular, by chemical synthesis or
preferably, by recombinant
expression techniques.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
68
Recombinant expression of an antibody of the invention, or fragment,
derivative or
analog thereof, (e.g., a heavy or light chain of an antibody of the invention
or a single chain
antibody of the invention), requires construction of an expression vector
containing a
polynucleotide that encodes the antibody. Once a polynucleotide encoding an
antibody
molecule or a heavy or light chain of an antibody, or portion thereof
(preferably containing
the heavy or light chain variable domain), of the invention has been obtained,
the vector for
the production of the antibody molecule may be produced by recombinant DNA
technology
using techniques well known in the art. Thus, methods for preparing a protein
by expressing
a polynucleotide containing an antibody encoding nucleotide sequence are
described herein.
Methods which are well known to those skilled in the art can be used to
construct expression
vectors containing antibody coding sequences and appropriate transcriptional
and
translational control signals. These methods include, for example, in vitro
recombinant DNA
techniques, synthetic techniques, and in vivo genetic recombination. The
invention, thus,
provides replicable vectors comprising a nucleotide sequence encoding an
antibody molecule
of the invention, or a heavy or light chain thereof, or a heavy or light chain
variable domain,
operably linked to a promoter. Such vectors may include the nucleotide
sequence encoding
the constant region of the antibody molecule (see, e.g., PCT Publication WO
86/05807; PCT
Publication WO 89/01036; and U.S. Patent No. 5,122,464) and the variable
domain of the
antibody may be cloned into such a vector for expression of the entire heavy
or light chain.
The expression vector is transferred to a host cell by conventional techniques
and the
transfected cells are then cultured by conventional techniques to produce an
antibody of the
invention. Thus, the invention includes host cells containing a polynucleotide
encoding an
antibody of the invention, or a heavy or light chain thereof, or a single
chain antibody of the
invention, operably linked to a heterologous promoter. In preferred
embodiments for the
expression of double-chained antibodies, vectors encoding both the heavy and
light chains
may be co-expressed in the host cell for expression of the entire
immunoglobulin molecule,
as detailed below.
A variety of host-expression vector systems may be utilized to express the
antibody
molecules of the invention. Such host-expression systems represent vehicles by
which the
coding sequences of interest may be produced and subsequently purified, but
also represent
cells which may, when transformed or transfected with the appropriate
nucleotide coding
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
69
sequences, express an antibody molecule of the invention in situ. These
include but are not
limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis)
transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors
containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia)
transformed with
recombinant yeast expression vectors containing antibody coding sequences;
insect cell
systems infected with recombinant virus expression vectors (e.g., baculovirus)
containing
antibody coding sequences; plant cell systems infected with recombinant virus
expression
vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or
transformed
with recombinant plasmid expression vectors (e.g., Ti plasmid) containing
antibody coding
sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells)
harboring
recombinant expression constructs containing promoters derived from the genome
of
mammalian cells (e.g., metallothionein promoter) or from mammalian viruses
(e.g., the
adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably,
bacterial cells such
as Escherichia coli, and more preferably, eukaryotic cells, especially for the
expression of
whole recombinant antibody molecule, are used for the expression of a
recombinant antibody
molecule. For example, mammalian cells such as Chinese hamster ovary cells
(CHO), in
conjunction with a vector such as the major intermediate early gene promoter
element from
human cytomegalovirus is an effective expression system for antibodies
(Foecking et al.,
Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).
In bacterial systems, a number of expression vectors may be advantageously
selected
depending upon the use intended for the antibody molecule being expressed. For
example,
when a large quantity of such a protein is to be produced, for the generation
of
pharmaceutical compositions of an antibody molecule, vectors which direct the
expression of
high levels of fusion protein products that are readily purified may be
desirable. Such vectors
include, but are not limited, to the E. coli expression vector pUR278 (Ruther
et al., EMBO J.
2:1791 (1983)), in which the antibody coding sequence may be ligated
individually into the
vector in frame with the lac Z coding region so that a fusion protein is
produced; pIN vectors
(Inouye & Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke &
Schuster, J. Biol.
Chem. 24:5503-5509 (1989)); and the like. pGEX vectors may also be used to
express
foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
In general, such
fusion proteins are soluble and can easily be purified from lysed cells by
adsorption and
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
binding to matrix glutathione-agarose beads followed by elution in the
presence of free
glutathione. The pGEX vectors are designed to include thrombin or factor Xa
protease
cleavage sites so that the cloned target gene product can be released from the
GST moiety.
In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV)
is
5 used as a vector to express foreign genes. The virus grows in Spodoptera
frugiperda cells.
The antibody coding sequence may be cloned individually into non-essential
regions (for
example the polyhedrin gene) of the virus and placed under control of an AcNPV
promoter
(for example the polyhedrin promoter).
In mammalian host cells, a number of viral-based expression systems may be
utilized.
10 In cases where an adenovirus is used as an expression vector, the antibody
coding sequence
of interest may be ligated to an adenovirus transcription/translation control
complex, e.g., the
late promoter and tripartite leader sequence. This chimeric gene may then be
inserted in the
adenovirus genome by in vitro or in vivo recombination. Insertion in a non-
essential region
of the viral genome (e.g., region E1 or E3) will result in a recombinant virus
that is viable and
15 capable of expressing the antibody molecule in infected hosts. (e.g., see
Logan & Shenk,
Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Specific initiation signals may
also be
required for efficient translation of inserted antibody coding sequences.
These signals
include the ATG initiation codon and adjacent sequences. Furthermore, the
initiation codon
must be in phase with the reading frame of the desired coding sequence to
ensure translation
20 of the entire insert. These exogenous translational control signals and
initiation codons can
be of a variety of origins, both natural and synthetic. The efficiency of
expression may be
enhanced by the inclusion of appropriate transcription enhancer elements,
transcription
terminators, etc. (see Bittner et al., Methods in Enzymol. 153:51-544 (1987)).
In addition, a host cell strain may be chosen which modulates the expression
of the
25 inserted sequences, or modifies and processes the gene product in the
specific fashion
desired. Such modifications (e.g., glycosylation) and processing (e.g.,
cleavage) of protein
products may be important for the function of the protein. Different host
cells have
characteristic and specific mechanisms for the post-translational processing
and modification
of proteins and gene products. Appropriate cell lines or host systems can be
chosen to ensure
30 the correct modification and processing of the foreign protein expressed.
To this end,
eukaryotic host cells which possess the cellular machinery for proper
processing of the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
71
primary transcript, glycosylation, and phosphorylation of the gene product may
be used.
Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela,
COS,
MDCK, 293, 3T3, WI38, and in particular, breast cancer cell lines such as, for
example,
BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such
as, for
example, CRL7030 and Hs578Bst.
For long-term, high-yield production of recombinant proteins, stable
expression is
preferred. For example, cell lines which stably express the antibody molecule
may be
engineered. Rather than using expression vectors which contain viral origins
of replication,
host cells can be transformed with DNA controlled by appropriate expression
control
elements (e.g., promoter, enhancer, sequences, transcription terminators,
polyadenylation
sites, etc.), and a selectable marker. Following the introduction of the
foreign DNA,
engineered cells may be allowed to grow for 1-2 days in an enriched media, and
then are
switched to a selective media. The selectable marker in the recombinant
plasmid confers
resistance to the selection and allows cells to stably integrate the plasmid
into their
chromosomes and grow to form foci which in turn can be cloned and expanded
into cell lines.
This method may advantageously be used to engineer cell lines which express
the antibody
molecule. Such engineered cell lines may be particularly useful in screening
and evaluation
of compounds that interact directly or indirectly with the antibody molecule.
A number of selection systems may be used, including but not limited to the
herpes
simplex virus thymidine kinase (Wigler et al., Cell 11:223 (1977)),
hypoxanthine-guanine
phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA
48:202
(1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22:817
(1980)) genes can
be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite
resistance can be
used as the basis of selection for the following genes: dhfr, which confers
resistance to
methotrexate (Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et
al., Proc. Natl.
Acad. Sci. USA 78:1527 (1981)); gpt, which confers resistance to mycophenolic
acid
(Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); neo, which
confers
resistance to the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and
Wu,
Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-
596 (1993);
Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev.
Biochem.
62:191-217 (1993); May, 1993, TIB TECH 11(5):155-215); and hygro, which
confers
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
72
resistance to hygromycin (Santerre et al., Gene 30:147 (1984)). Methods
commonly known
in the art of recombinant DNA technology may be routinely applied to select
the desired
recombinant clone, and such methods are described, for example, in Ausubel et
al. (eds.),
Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993);
Kriegler, Gene
Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and
in Chapters
12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John
Wiley & Sons,
NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981), which are
incorporated by
reference herein in their entireties.
The expression levels of an antibody molecule can be increased by vector
amplification (for a review, see Bebbington and Hentschel, The use of vectors
based on gene
amplification for the expression of cloned genes in mammalian cells in DNA
cloning, Vol.3.
(Academic Press, New York, 1987)). When a marker in the vector system
expressing
antibody is amplifiable, increase in the level of inhibitor present in culture
of host cell will
increase the number of copies of the marker gene. Since the amplified region
is associated
with the antibody gene, production of the antibody will also increase (Grouse
et al., Mol.
Cell. Biol. 3:257 (1983)).
The host cell may be co-transfected with two expression vectors of the
invention, the
first vector encoding a heavy chain derived polypeptide and the second vector
encoding a
light chain derived polypeptide. The two vectors may contain identical
selectable markers
which enable equal expression of heavy and light chain polypeptides.
Alternatively, a single
vector may be used which encodes, and is capable of expressing, both heavy and
light chain
polypeptides. In such situations, the light chain should be placed before the
heavy chain to
avoid an excess of toxic free heavy chain (Proudfoot, Nature 322:52 (1986);
Kohler, Proc.
Natl. Acad. Sci. USA 77:2197 (1980)). The coding sequences for the heavy and
light chains
may comprise cDNA or genomic DNA.
Once an antibody molecule of the invention has been produced by an animal,
chemically synthesized, or recombinantly expressed, it may be purified by any
method known
in the art for purification of an immunoglobulin molecule, for example, by
chromatography
(e.g., ion exchange, affinity, particularly by affinity for the specific
antigen after Protein A,
and sizing column chromatography), centrifugation, differential solubility, or
by any other
standard technique for the purification of proteins. In addition, the
antibodies of the present
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
73
invention or fragments thereof can be fused to heterologous polypeptide
sequences described
herein or otherwise known in the art, to facilitate purification.
The present invention encompasses antibodies recombinantly fused or chemically
conjugated (including both covalently and non-covalently conjugations) to a
polypeptide (or
portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100
amino acids of the
polypeptide) of the present invention to generate fusion proteins. The fusion
does not
necessarily need to be direct, but may occur through linker sequences. The
antibodies may be
specific for antigens other than polypeptides (or portion thereof, preferably
at least 10, 20,
30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the
present invention. For
example, antibodies may be used to target the polypeptides of the present
invention to
particular cell types, either in vitro or in vivo, by fusing or conjugating
the polypeptides of
the present invention to antibodies specific for particular cell surface
receptors. Antibodies
fused or conjugated to the polypeptides of the present invention may also be
used in in vitro
immunoassays and purification methods using methods known in the art. See
e.g., Harbor et
1 S al., supra, and PCT publication WO 93/21232; EP 439,095; Naramura et al.,
Immunol. Lett.
39:91-99 (1994); U.S. Patent 5,474,981; Gillies et al., PNAS 89:1428-1432
(1992); Fell et
al., J. Immunol. 146:2446-2452(1991), which are incorporated by reference in
their entireties.
The present invention further includes compositions comprising the
polypeptides of
the present invention fused or conjugated to antibody domains other than the
variable regions.
For example, the polypeptides of the present invention may be fused or
conjugated to an
antibody Fc region, or portion thereof. The antibody portion fused to a
polypeptide of the
present invention may comprise the constant region, hinge region, CH1 domain,
CH2
domain, and CH3 domain or any combination of whole domains or portions
thereof. The
polypeptides may also be fused or conjugated to the above antibody portions to
form
multimers. For example, Fc portions fused to the polypeptides of the present
invention can
form dimers through disulfide bonding between the Fc portions. Higher
multimeric forms
can be made by fusing the polypeptides to portions of IgA and IgM. Methods for
fusing or
conjugating the polypeptides of the present invention to antibody portions are
known in the
art. See, e.g., U.S. Patent Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053;
5,447,851;
5,112,946; EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570;
Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88:10535-10539 (1991); Zheng et
al., J.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
74
Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad. Sci. USA
89:11337-
11341(1992) (said references incorporated by reference in their entireties).
As discussed, supra, the polypeptides corresponding to a polypeptide,
polypeptide
fragment, or a variant of SEQ ID N0:2 may be fused or conjugated to the above
antibody
portions to increase the in vivo half life of the polypeptides or for use in
immunoassays using
methods known in the art. Further, the polypeptides corresponding to SEQ ID
N0:2 may be
fused or conjugated to the above antibody portions to facilitate purification.
One reported
example describes chimeric proteins consisting of the first two domains of the
human CD4-
polypeptide and various domains of the constant regions of the heavy or light
chains of
mammalian immunoglobulins. (EP 394,827; Traunecker et al., Nature 331:84-86
(1988).
The polypeptides of the present invention fused or conjugated to an antibody
having
disulfide- linked dimeric structures (due to the IgG) may also be more
efficient in binding and
neutralizing other molecules, than the monomeric secreted protein or protein
fragment alone.
(Fountoulakis et al., J. Biochem. 270:3958-3964 (1995)). In many cases, the Fc
part in a
fusion protein is beneficial in therapy and diagnosis, and thus can result in,
for example,
improved pharmacokinetic properties. (EP A 232,262). Alternatively, deleting
the Fc part
after the fusion protein has been expressed, detected, and purified, would be
desired. For
example, the Fc portion may hinder therapy and diagnosis if the fusion protein
is used as an
antigen for immunizations. In drug discovery, for example, human proteins,
such as hII,-5,
have been fused with Fc portions for the purpose of high-throughput screening
assays to
identify antagonists of hIL-5. (See, Bennett et al., J. Molecular Recognition
8:52-58 (1995);
Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
Moreover, the antibodies or fragments thereof of the present invention can be
fused to
marker sequences, such as a peptide to facilitate purification. In preferred
embodiments, the
marker amino acid sequence is a hexa-histidine peptide, such as the tag
provided in a pQE
vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others,
many of
which are commercially available. As described in Gentz et al., Proc. Natl.
Acad. Sci. USA
86:821-824 (1989), for instance, hexa-histidine provides for convenient
purification of the
fusion protein. Other peptide tags useful for purification include, but are
not limited to, the
"HA" tag, which corresponds to an epitope derived from the influenza
hemagglutinin protein
(Wilson et al., Cell 37:767 (1984)) and the "flag" tag.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
The present invention further encompasses antibodies or fragments thereof
conjugated
to a diagnostic or therapeutic agent. The antibodies can be used
diagnostically to, for
example, monitor the development or progression of a tumor as part of a
clinical testing
procedure to, e.g., determine the efficacy of a given treatment regimen.
Detection can be
5 facilitated by coupling the antibody to a detectable substance. Examples of
detectable
substances include various enzymes, prosthetic groups, fluorescent materials,
luminescent
materials, bioluminescent materials, radioactive materials, positron emitting
metals using
various positron emission tomographies, and nonradioactive paramagnetic metal
ions. The
detectable substance may be coupled or conjugated either directly to the
antibody (or
10 fragment thereof) or indirectly, through an intermediate (such as, for
example, a linker known
in the art) using techniques known in the art. See, for example, U.S. Patent
No. 4,741,900 for
metal ions which can be conjugated to antibodies for use as diagnostics
according to the
present invention. Examples of suitable enzymes include horseradish
peroxidase, alkaline
phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable
prosthetic
15 group complexes include streptavidin/biotin and avidin/biotin; examples of
suitable
fluorescent materials include umbelliferone, fluorescein, fluorescein
isothiocyanate,
rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or
phycoerythrin; an example
of a luminescent material includes luminol; examples of bioluminescent
materials include
luciferase, luciferin, and aequorin; and examples of suitable radioactive
material include 125I,
20 131I, 111In or 99Tc.
Further, an antibody or fragment thereof may be conjugated to a therapeutic
moiety
such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic
agent or a radioactive
metal ion, e.g., alpha-emitters such as, for example, 213Bi. A cytotoxin or
cytotoxic agent
includes any agent that is detrimental to cells. Examples include paclitaxol,
cytochalasin B,
25 gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide,
vincristine,
vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione,
mitoxantrone,
mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine,
tetracaine,
lidocaine, propranolol, and puromycin and analogs or homologs thereof.
Therapeutic agents
include, but are not limited to, antimetabolites (e.g., methotrexate, 6-
mercaptopurine, 6-
30 thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents
(e.g.,
mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and
lomustine
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
76
(CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin
C, and
cis- dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g.,
daunorubicin
(formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin
(formerly
actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic
agents
(e.g., vincristine and vinblastine).
The conjugates of the invention can be used for modifying a given biological
response, the therapeutic agent or drug moiety is not to be construed as
limited to classical
chemical therapeutic agents. For example, the drug moiety may be a protein or
polypeptide
possessing a desired biological activity. Such proteins may include, for
example, a toxin
such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein
such as tumor
necrosis factor, a-interferon, 13-interferon, nerve growth factor, platelet
derived growth factor,
tissue plasminogen activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta,
AIM I (See,
International Publication No. WO 97/33899), AIM II (See, International
Publication No. WO
97/34911), Fas Ligand (Takahashi et al., Int. Immunol., 6:1567-1574 (1994)),
VEGI (See,
International Publication No. WO 99/23105), a thrombotic agent or an anti-
angiogenic agent,
e.g., angiostatin or endostatin; or, biological response modifiers such as,
for example,
lymphokines, interleukin-1 ("IL-1"), interleukin-2 ("IL,-2"), interleukin-6
("IL-6"),
granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte
colony
stimulating factor ("G-CSF"), or other growth factors.
Antibodies may also be attached to solid supports, which are particularly
useful for
immunoassays or purification of the target antigen. Such solid supports
include, but are not
limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl
chloride or
polypropylene.
Techniques for conjugating such therapeutic moiety to antibodies are well
known, see,
e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In
Cancer
Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.),
pp. 243-56
(Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery",
in Controlled
Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker,
Inc. 1987);
Thorpe, "Antibody Garners Of Cytotoxic Agents In Cancer Therapy: A Review", in
Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et
al. (eds.), pp.
475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic
Use Of
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
77
Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer
Detection
And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and
Thorpe et al.,
"The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates",
Immunol. Rev.
62:119-S 8 ( 1982).
Alternatively, an antibody can be conjugated to a second antibody to form an
antibody
heteroconjugate as described by Segal in U.S. Patent No. 4,676,980, which is
incorporated
herein by reference in its entirety.
An antibody, with or without a therapeutic moiety conjugated to it,
administered alone
or in combination with cytotoxic factors) and/or cytokine(s) can be used as a
therapeutic.
Immunophenotyuin~
The antibodies of the invention may be utilized for immunophenotyping of cell
lines
and biological samples. The translation product of the gene of the present
invention may be
useful as a cell specific marker, or more specifically as a cellular marker
that is differentially
expressed at various stages of differentiation and/or maturation of particular
cell types.
Monoclonal antibodies directed against a specific epitope, or combination of
epitopes, will
allow for the screening of cellular populations expressing the marker. Various
techniques can
be utilized using monoclonal antibodies to screen for cellular populations
expressing the
marker(s), and include magnetic separation using antibody-coated magnetic
beads, "panning"
with antibody attached to a solid matrix (i.e., plate), and flow cytometry
(See, e.g., U.S.
Patent 5,985,660; and Morrison et al., Cell, 96:737-49 (1999)).
These techniques allow for the screening of particular populations of cells,
such as
might be found with hematological malignancies (i.e. minimal residual disease
(MRD) in
acute leukemic patients) and "non-self' cells in transplantations to prevent
Graft-versus-Host
Disease (GVHD). Alternatively, these techniques allow for the screening of
hematopoietic
stem and progenitor cells capable of undergoing proliferation and/or
differentiation, as might
be found in human umbilical cord blood.
Assays For Antibody Binding
The antibodies of the invention may be assayed for immunospecific binding by
any
method known in the art. The immunoassays which can be used include but are
not limited
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
78
to competitive and non-competitive assay systems using techniques such as
western blots,
radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich"
immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion
precipitin
reactions, immunodiffusion assays, agglutination assays, complement-fixation
assays,
immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to
name
but a few. Such assays are routine and well known in the art (see, e.g.,
Ausubel et al, eds,
1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc.,
New York,
which is incorporated by reference herein in its entirety). Exemplary
immunoassays are
described briefly below (but are not intended by way of limitation).
Immunoprecipitation protocols generally comprise lysing a population of cells
in a
lysis buffer such as RIPA buffer (1% NP-40 or Triton X- 100, 1% sodium
deoxycholate,
0.1 % SDS, 0.15 M NaCI, 0.01 M sodium phosphate at pH 7.2, 1 % Trasylol)
supplemented
with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF,
aprotinin, sodium
vanadate), adding the antibody of interest to the cell lysate, incubating for
a period of time
(e.g., 1-4 hours) at 4° C, adding protein A and/or protein G sepharose
beads to the cell lysate,
incubating for about an hour or more at 4° C, washing the beads in
lysis buffer and
resuspending the beads in SDS/sample buffer. The ability of the antibody of
interest to
immunoprecipitate a particular antigen can be assessed by, e.g., western blot
analysis. One
of skill in the art would be knowledgeable as to the parameters that can be
modified to
increase the binding of the antibody to an antigen and decrease the background
(e.g., pre-
clearing the cell lysate with sepharose beads). For further discussion
regarding
immunoprecipitation protocols see, e.g., Ausubel et al, eds, 1994, Current
Protocols in
Molecular Biology, Vol. l, John Wiley & Sons, Inc., New York at 10.16.1.
Western blot analysis generally comprises preparing protein samples,
electrophoresis
of the protein samples in a polyacrylamide gel (e.g., 8%- 20% SDS-PAGE
depending on the
molecular weight of the antigen), transfernng the protein sample from the
polyacrylamide gel
to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in
blocking
solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in
washing buffer
(e.g., PBS-Tween 20), blocking the membrane with primary antibody (the
antibody of
interest) diluted in blocking buffer, washing the membrane in washing buffer,
blocking the
membrane with a secondary antibody (which recognizes the primary antibody,
e.g., an anti-
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
79
human antibody) conjugated to an enzymatic substrate (e.g., horseradish
peroxidase or
alkaline phosphatase) or radioactive molecule (e.g., 32P or 125I) diluted in
blocking buffer,
washing the membrane in wash buffer, and detecting the presence of the
antigen. One of skill
in the art would be knowledgeable as to the parameters that can be modified to
increase the
signal detected and to reduce the background noise. For further discussion
regarding western
blot protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in
Molecular Biology,
Vol. 1, John Wiley & Sons, Inc., New York at 10.8.1.
ELISAs comprise preparing antigen, coating the well of a 96 well microtiter
plate
with the antigen, adding the antibody of interest conjugated to a detectable
compound such
as an enzymatic substrate (e.g., horseradish peroxidase or alkaline
phosphatase) to the well
and incubating for a period of time, and detecting the presence of the
antigen. In ELISAs the
antibody of interest does not have to be conjugated to a detectable compound;
instead, a
second antibody (which recognizes the antibody of interest) conjugated to a
detectable
compound may be added to the well. Further, instead of coating the well with
the antigen,
the antibody may be coated to the well. In this case, a second antibody
conjugated to a
detectable compound may be added following the addition of the antigen of
interest to the
coated well. One of skill in the art would be knowledgeable as to the
parameters that can be
modified to increase the signal detected as well as other variations of ELISAs
known in the
art. For further discussion regarding ELISAs see, e.g., Ausubel et al, eds,
1994, Current
Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at
11.2.1.
The binding affinity of an antibody to an antigen and the off rate of an
antibody-
antigen interaction can be determined by competitive binding assays. One
example of a
competitive binding assay is a radioimmunoassay comprising the incubation of
labeled
antigen (e.g., 3H or 125I) with the antibody of interest in the presence of
increasing amounts
of unlabeled antigen, and the detection of the antibody bound to the labeled
antigen. The
affinity of the antibody of interest for a particular antigen and the binding
off rates can be
determined from the data by scatchard plot analysis. Competition with a second
antibody
can also be determined using radioimmunoassays. In this case, the antigen is
incubated with
antibody of interest conjugated to a labeled compound (e.g., 3H or 125I) in
the presence of
increasing amounts of an unlabeled second antibody.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
Therapeutic Uses
The present invention is further directed to antibody-based therapies which
involve
administering antibodies of the invention to an animal, preferably a mammal,
and most
preferably a human, patient for treating one or more of the disclosed
diseases, disorders, or
S conditions. Therapeutic compounds of the invention include, but are not
limited to,
antibodies of the invention (including fragments, analogs and derivatives
thereof as described
herein) and nucleic acids encoding antibodies of the invention (including
fragments, analogs
and derivatives thereof and anti-idiotypic antibodies as described herein).
The antibodies of
the invention can be used to treat, inhibit or prevent diseases, disorders or
conditions
10 associated with aberrant expression and/or activity of a polypeptide of the
invention,
including, but not limited to, any one or more of the diseases, disorders, or
conditions
described herein. The treatment and/or prevention of diseases, disorders, or
conditions
associated with aberrant expression and/or activity of a polypeptide of the
invention includes,
but is not limited to, alleviating symptoms associated with those diseases,
disorders or
15 conditions. Antibodies of the invention may be provided in pharmaceutically
acceptable
compositions as known in the art or as described herein.
A summary of the ways in which the antibodies of the present invention may be
used
therapeutically includes binding polynucleotides or polypeptides of the
present invention
locally or systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated
20 by complement (CDC) or by effector cells (ADCC). Some of these approaches
are described
in more detail below. Armed with the teachings provided herein, one of
ordinary skill in the
art will know how to use the antibodies of the present invention for
diagnostic, monitoring or
therapeutic purposes without undue experimentation. a
The antibodies of this invention may be advantageously utilized in combination
with
25 other monoclonal or chimeric antibodies, or with lymphokines or
hematopoietic growth
factors (such as, e.g., IL-2, IL,-3 and IL-7), for example, which serve to
increase the number or
activity of effector cells which interact with the antibodies.
The antibodies of the invention may be administered alone or in combination
with
other types of treatments (e.g., radiation therapy, chemotherapy, hormonal
therapy,
30 immunotherapy and anti-tumor agents). Generally, administration of products
of a species
origin or species reactivity (in the case of antibodies) that is the same
species as that of the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
81
patient is preferred. Thus, in a preferred embodiment, human antibodies,
fragments
derivatives, analogs, or nucleic acids, are administered to a human patient
for therapy or
prophylaxis.
It is preferred to use high affinity and/or potent in vivo inhibiting and/or
neutralizing
antibodies against polypeptides or polynucleotides of the present invention,
fragments or
regions thereof, for both immunoassays directed to and therapy of disorders
related to
polynucleotides or polypeptides, including fragments thereof, of the present
invention. Such
antibodies, fragments, or regions, will preferably have an affinity for
polynucleotides or
polypeptides of the invention, including fragments thereof. Preferred binding
affinities
include those with a dissociation constant or Kd less than S X 10-Z M, 10-Z M,
5 X 10-3 M,
10-3 M, S X 10~ M, 10-4 M, 5 X 10-5 M, 10-5 M, 5 X 10-6 M, 10-6 M, 5 X 10-~ M,
10-~ M, 5 X
10-g M, 10-8 M, 5 X 10-9 M, 10-9 M, 5 X 10-' ° M, 10-' ° M, 5 X
10-" M, 10-'' M, 5 X 10-' Z M,
10-' 2 M, 5 X 10-' 3 M, 10-' 3 M, 5 X 10-' 4 M, 1 O-' 4 M, 5 X 10-' S M, and
10-' S M.
Gene Therapy
In a specific embodiment, nucleic acids comprising sequences encoding
antibodies or
functional derivatives thereof, are administered to treat, inhibit or prevent
a disease or
disorder associated with aberrant expression and/or activity of a polypeptide
of the invention,
by way of gene therapy. Gene therapy refers to therapy performed by the
administration to a
subject of an expressed or expressible nucleic acid. In this embodiment of the
invention, the
nucleic acids produce their encoded protein that mediates a therapeutic
effect.
Any of the methods for gene therapy available in the art can be used according
to the
present invention. Exemplary methods are described below.
For general reviews of the methods of gene therapy, see Goldspiel et al.,
Clinical
Pharmacy 12:488-505 (1993); Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev,
Ann.
Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932
(1993); and
Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); May, TIBTECH
11(5):155-
215 (1993). Methods commonly known in the art of recombinant DNA technology
which can
be used are described in Ausubel et al. (eds.), Current Protocols in Molecular
Biology, John
Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A
Laboratory
Manual, Stockton Press, NY (1990).
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
82
In a preferred aspect, the compound comprises nucleic acid sequences encoding
an
antibody, said nucleic acid sequences being part of expression vectors that
express the
antibody or fragments or chimeric proteins or heavy or light chains thereof in
a suitable host.
In particular, such nucleic acid sequences have promoters operably linked to
the antibody
coding region, said promoter being inducible or constitutive, and, optionally,
tissue- specific.
In another particular embodiment, nucleic acid molecules are used in which the
antibody
coding sequences and any other desired sequences are flanked by regions that
promote
homologous recombination at a desired site in the genome, thus providing for
intrachromosomal expression of the antibody encoding nucleic acids (Koller and
Smithies,
Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al., Nature
342:435-438 (1989).
In specific embodiments, the expressed antibody molecule is a single chain
antibody;
alternatively, the nucleic acid sequences include sequences encoding both the
heavy and light
chains, or fragments thereof, of the antibody.
Delivery of the nucleic acids into a patient may be either direct, in which
case the
patient is directly exposed to the nucleic acid or nucleic acid- carrying
vectors, or indirect, in
which case, cells are first transformed with the nucleic acids in vitro, then
transplanted into
the patient. These two approaches are known, respectively, as in vivo or ex
vivo gene
therapy.
In a specific embodiment, the nucleic acid sequences are directly administered
in
vivo, where it is expressed to produce the encoded product. This can be
accomplished by
any of numerous methods known in the art, e.g., by constructing them as part
of an
appropriate nucleic acid expression vector and administering it so that they
become
intracellular, e.g., by infection using defective or attenuated retrovirals or
other viral vectors
(see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by
use of
microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating
with lipids or
cell-surface receptors or transfecting agents, encapsulation in liposomes,
microparticles, or
microcapsules, or by administering them in linkage to a peptide which is known
to enter the
nucleus, by administering it in linkage to a ligand subject to receptor-
mediated endocytosis
(see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used
to target
cell types specifically expressing the receptors), etc. In another embodiment,
nucleic acid-
ligand complexes can be formed in which the ligand comprises a fusogenic viral
peptide to
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
83
disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation.
In yet another
embodiment, the nucleic acid can be targeted in vivo for cell specific uptake
and expression,
by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180; WO
92/22635;
W092/20316; W093/14188, WO 93/20221). Alternatively, the nucleic acid can be
introduced intracellularly and incorporated within host cell DNA for
expression, by
homologous recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA
86:8932-8935
(1989); Zijlstra et al., Nature 342:435-438 (1989)).
In a specific embodiment, viral vectors that contains nucleic acid sequences
encoding
an antibody of the invention are used. For example, a retroviral vector can be
used (see
Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors
contain the
components necessary for the correct packaging of the viral genome and
integration into the
host cell DNA. The nucleic acid sequences encoding the antibody to be used in
gene therapy
are cloned into one or more vectors, which facilitates delivery of the gene
into a patient.
More detail about retroviral vectors can be found in Boesen et al., Biotherapy
6:291-302
(1994), which describes the use of a retroviral vector to deliver the mdrl
gene to
hematopoietic stem cells in order to make the stem cells more resistant to
chemotherapy.
Other references illustrating the use of retroviral vectors in gene therapy
are: Clowes et al., J.
Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83:1467-1473 (1994);
Salmons and
Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr.
Opin.
in Genetics and Devel. 3:110-114 (1993).
Adenoviruses are other viral vectors that can be used in gene therapy.
Adenoviruses
are especially attractive vehicles for delivering genes to respiratory
epithelia. Adenoviruses
naturally infect respiratory epithelia where they cause a mild disease. Other
targets for
adenovirus-based delivery systems are liver, the central nervous system,
endothelial cells,
and muscle. Adenoviruses have the advantage of being capable of infecting non-
dividing
cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-
503
(1993) present a review of adenovirus-based gene therapy. Bout et al., Human
Gene Therapy
5:3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to
the respiratory
epithelia of rhesus monkeys. Other instances of the use of adenoviruses in
gene therapy can
be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al.,
Cell 68:143- 155
(1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT
Publication W094/12649;
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
84
and Wang, et al., Gene Therapy 2:775-783 (1995). In a preferred embodiment,
adenovirus
vectors are used.
Adeno-associated virus (AAV) has also been proposed for use in gene therapy
(Walsh
et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Patent No.
5,436,146).
Another approach to gene therapy involves transferring a gene to cells in
tissue culture
by such methods as electroporation, lipofection, calcium phosphate mediated
transfection, or
viral infection. Usually, the method of transfer includes the transfer of a
selectable marker to
the cells. The cells are then placed under selection to isolate those cells
that have taken up
and are expressing the transferred gene. Those cells are then delivered to a
patient.
In this embodiment, the nucleic acid is.introduced into a cell prior to
administration in
vivo of the resulting recombinant cell. Such introduction can be carned out by
any method
known in the art, including but not limited to transfection, electroporation,
microinjection,
infection with a viral or bacteriophage vector containing the nucleic acid
sequences, cell
fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer,
spheroplast
fusion, etc. Numerous techniques are known in the art for the introduction of
foreign genes
into cells (see, e.g., Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993);
Cohen et al.,
Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther. 29:69-92m (1985) and
may be
used in accordance with the present invention, provided that the necessary
developmental
and physiological functions of the recipient cells are not disrupted. The
technique should
provide for the stable transfer of the nucleic acid to the cell, so that the
nucleic acid is
expressible by the cell and preferably heritable and expressible by its cell
progeny.
The resulting recombinant cells can be delivered to a patient by various
methods
known in the art. Recombinant blood cells (e.g., hematopoietic stem or
progenitor cells) are
preferably administered intravenously. The amount of cells envisioned for use
depends on
the desired effect, patient state, etc., and can be determined by one skilled
in the art.
Cells into which a nucleic acid can be introduced for purposes of gene therapy
encompass any desired, available cell type, and include but are not limited to
epithelial cells,
endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes;
blood cells such as
Tlymphocytes, Blymphocytes, monocytes, macrophages, neutrophils, eosinophils,
megakaryocytes, granulocytes; various stem or progenitor cells, in particular
hematopoietic
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord
blood,
peripheral blood, fetal liver, etc.
In a preferred embodiment, the cell used for gene therapy is autologous to the
patient.
In an embodiment in which recombinant cells are used in gene therapy, nucleic
acid
5 sequences encoding an antibody are introduced into the cells such that they
are expressible
by the cells or their progeny, and the recombinant cells are then administered
in vivo for
therapeutic effect. In a specific embodiment, stem or progenitor cells are
used. Any stem
and/or progenitor cells which can be isolated and maintained in vitro can
potentially be used
in accordance with this embodiment of the present invention (see e.g. PCT
Publication WO
10 94/08598; Stemple and Anderson, Cell 71:973-985 (1992); lRheinwald, Meth.
Cell Bio.
21A:229 (1980); and Pittelkow and Scott, Mayo Clinic Proc. 61:771 (1986)).
In a specific embodiment, the nucleic acid to be introduced for purposes of
gene
therapy comprises an inducible promoter operably linked to the coding region,
such that
expression of the nucleic acid is controllable by controlling the presence or
absence of the
15 appropriate inducer of transcription. Demonstration of Therapeutic or
Prophylactic Activity
The compounds or pharmaceutical compositions of the invention are preferably
tested
in vitro, and then in vivo for the desired therapeutic or prophylactic
activity, prior to use in
humans. For example, in vitro assays to demonstrate the therapeutic or
prophylactic utility of
a compound or pharmaceutical composition include, the effect of a compound on
a cell line
20 or a patient tissue sample. The effect of the compound or composition on
the cell line and/or
tissue sample can be determined utilizing techniques known to those of skill
in the art
including, but not limited to, rosette formation assays and cell lysis assays.
In accordance
with the invention, in vitro assays which can be used to determine whether
administration of
a specific compound is indicated, include in vitro cell culture assays in
which a patient tissue
25 sample is grown in culture, and exposed to or otherwise administered a
compound, and the
effect of such compound upon the tissue sample is observed.
Therapeutic/Prophylactic Administration and Composition
The invention provides methods of treatment, inhibition and prophylaxis by
30 administration to a subject of an effective amount of a compound or
pharmaceutical
composition of the invention, preferably an antibody of the invention. In a
preferred aspect,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
86
the compound is substantially purified (e.g., substantially free from
substances that limit its
effect or produce undesired side-effects). The subject is preferably an
animal, including but
not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc.,
and is preferably
a mammal, and most preferably human.
Formulations and methods of administration that can be employed when the
compound comprises a nucleic acid or an immunoglobulin are described above;
additional
appropriate formulations and routes of administration can be selected from
among those
described herein below.
Various delivery systems are known and can be used to administer a compound of
the
invention, e.g., encapsulation in liposomes, microparticles, microcapsules,
recombinant cells
capable of expressing the compound, receptor-mediated endocytosis (see, e.g.,
Wu and Wu, J.
Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a
retroviral or
other vector, etc. Methods of introduction include but are not limited to
intradermal,
intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal,
epidural, and oral
routes. The compounds or compositions may be administered by any convenient
route, for
example by infusion or bolus injection, by absorption through epithelial or
mucocutaneous
linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be
administered
together with other biologically active agents. Administration can be systemic
or local. In
addition, it may be desirable to introduce the pharmaceutical compounds or
compositions of
the invention into the central nervous system by any suitable route, including
intraventricular
and intrathecal injection; intraventricular injection may be facilitated by an
intraventricular
catheter, for example, attached to a reservoir, such as an Ommaya reservoir.
Pulmonary
administration can also be employed, e.g., by use of an inhaler or nebulizer,
and formulation
with an aerosolizing agent.
In a specific embodiment, it may be desirable to administer the pharmaceutical
compounds or compositions of the invention locally to the area in need of
treatment; this may
be achieved by, for example, and not by way of limitation, local infusion
during surgery,
topical application, e.g., in conjunction with a wound dressing after surgery,
by injection, by
means of a catheter, by means of a suppository, or by means of an implant,
said implant being
of a porous, non-porous, or gelatinous material, including membranes, such as
sialastic
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
87
membranes, or fibers. Preferably, when administering a protein, including an
antibody, of
the invention, care must be taken to use materials to which the protein does
not absorb.
In another embodiment, the compound or composition can be delivered in a
vesicle, in
particular a liposome (see Larger, Science 249:1527-1533 (1990); Treat et al.,
in Liposomes
in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler
(eds.), Liss,
New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 317-327; see
generally ibid.)
In yet another embodiment, the compound or composition can be delivered in a
controlled release system. In one embodiment, a pump may be used (see Larger,
supra;
Sefton, CRC Crit. Ref. Biomed. Erg. 14:201 (1987); Buchwald et al., Surgery
88:507 (1980);
Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment,
polymeric
materials can be used (see Medical Applications of Controlled Release, Larger
and Wise
(eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug
Bioavailability, Drug
Product Design and Performance, Smolen and Ball (eds.), Wiley, New York
(1984); Ranger
and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also
Levy et al.,
Science 228:190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et
al.,
J.Neurosurg. 71:105 (1989)). In yet another embodiment, a controlled release
system can be
placed in proximity of the therapeutic target, i.e., the brain, thus requiring
only a fraction of
the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled
Release, supra,
vol. 2, pp. 115-138 (1984)).
Other controlled release systems are discussed in the review by Larger
(Science
249:1527-1533 (1990)).
In a specific embodiment where the compound of the invention is a nucleic acid
encoding a protein, the nucleic acid can be administered in vivo to promote
expression of its
encoded protein, by constructing it as part of an appropriate nucleic acid
expression vector
and administering it so that it becomes intracellular, e.g., by use of a
retroviral vector (see
U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle
bombardment
(e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface
receptors or
transfecting agents, or by administering it in linkage to a homeobox- like
peptide which is
known to enter the nucleus (see e.g., Joliot et al., Proc. Natl. Acad. Sci.
USA 88:1864-1868
(1991)), etc. Alternatively, a nucleic acid can be introduced intracellularly
and incorporated
within host cell DNA for expression, by homologous recombination.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
88
The present invention also provides pharmaceutical compositions. Such
compositions
comprise a therapeutically effective amount of a compound, and a
pharmaceutically
acceptable carrier. In a specific embodiment, the term "pharmaceutically
acceptable" means
approved by a regulatory agency of the Federal or a state government or listed
in the U.S.
Pharmacopeia or other generally recognized pharmacopeia for use in animals,
and more
particularly in humans. The term "carrier" refers to a diluent, adjuvant,
excipient, or vehicle
with which the therapeutic is administered. Such pharmaceutical carriers can
be sterile
liquids, such as water and oils, including those of petroleum, animal,
vegetable or synthetic
origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
Water is a
preferred carrier when the pharmaceutical composition is administered
intravenously. Saline
solutions and aqueous dextrose and glycerol solutions can also be employed as
liquid carriers,
particularly for injectable solutions. Suitable pharmaceutical excipients
include starch,
glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel,
sodium stearate, glycerol
monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene,
glycol, water,
ethanol and the like. The composition, if desired, can also contain minor
amounts of wetting
or emulsifying agents, or pH buffering agents. These compositions can take the
form of
solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-
release
formulations and the like. The composition can be formulated as a suppository,
with
traditional binders and carriers such as triglycerides. Oral formulation can
include standard
Garners such as pharmaceutical grades of mannitol, lactose, starch, magnesium
stearate,
sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable
pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences"
by E.W.
Martin. Such compositions will contain a therapeutically effective amount of
the compound,
preferably in purified form, together with a suitable amount of carrier so as
to provide the
form for proper administration to the patient. The formulation should suit the
mode of
administration.
In a preferred embodiment, the composition is formulated in accordance with
routine
procedures as a pharmaceutical composition adapted for intravenous
administration to
human beings. Typically, compositions for intravenous administration are
solutions in sterile
isotonic aqueous buffer. Where necessary, the composition may also include a
solubilizing
agent and a local anesthetic such as lignocaine to ease pain at the site of
the injection.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
89
Generally, the ingredients are supplied either separately or mixed together in
unit dosage
form, for example, as a dry lyophilized powder or water free concentrate in a
hermetically
sealed container such as an ampoule or sachette indicating the quantity of
active agent.
Where the composition is to be administered by infusion, it can be dispensed
with an
infusion bottle containing sterile pharmaceutical grade water or saline. Where
the
composition is administered by injection, an ampoule of sterile water for
injection or saline
can be provided so that the ingredients may be mixed prior to administration.
The compounds of the invention can be formulated as neutral or salt forms.
Pharmaceutically acceptable salts include those formed with anions such as
those derived
from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those
formed with
canons such as those derived from sodium, potassium, ammonium, calcium, fernc
hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine,
procaine, etc.
The amount of the compound of the invention which will be effective in the
treatment, inhibition and prevention of a disease or disorder associated with
aberrant
expression and/or activity of a polypeptide of the invention can be determined
by standard
clinical techniques. In addition, in vitro assays may optionally be employed
to help identify
optimal dosage ranges. The precise dose to be employed in the formulation will
also depend
on the route of administration, and the seriousness of the disease or
disorder, and should be
decided according to the judgment of the practitioner and each patient's
circumstances.
Effective doses may be extrapolated from dose-response curves derived from in
vitro or
animal model test systems.
For antibodies, the dosage administered to a patient is typically 0.1 mg/kg to
100
mg/kg of the patient's body weight. Preferably, the dosage administered to a
patient is
between 0.1 mg/kg and 20 mg/kg of the patient's body weight, more preferably 1
mg/kg to 10
mg/kg of the patient's body weight. Generally, human antibodies have a longer
half life
within the human body than antibodies from other species due to the immune
response to the
foreign polypeptides. Thus, lower dosages of human antibodies and less
frequent
administration is often possible. Further, the dosage and frequency of
administration of
antibodies of the invention may be reduced by enhancing uptake and tissue
penetration (e.g.,
into the brain) of the antibodies by modifications such as, for example,
lipidation.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
The invention also provides a pharmaceutical pack or kit comprising one or
more
containers filled with one or more of the ingredients of the pharmaceutical
compositions of
the invention. Optionally associated with such containers) can be a notice in
the form
prescribed by a governmental agency regulating the manufacture, use or sale of
5 pharmaceuticals or biological products, which notice reflects approval by
the agency of
manufacture, use or sale for human administration. Diagnosis and Imaging
Labeled antibodies, and derivatives and analogs thereof, which specifically
bind to a
polypeptide of interest can be used for diagnostic purposes to detect,
diagnose, or monitor
diseases and/or disorders associated with the aberrant expression and/or
activity of a
10 polypeptide of the invention. The invention provides for the detection of
aberrant expression
of a polypeptide of interest, comprising (a) assaying the expression of the
polypeptide of
interest in cells or body fluid of an individual using one or more antibodies
specific to the
polypeptide interest and (b) comparing the level of gene expression with a
standard gene
expression level, whereby an increase or decrease in the assayed polypeptide
gene expression
15 level compared to the standard expression level is indicative of aberrant
expression.
The invention provides a diagnostic assay for diagnosing a disorder,
comprising (a)
assaying the expression of the polypeptide of interest in cells or body fluid
of an individual
using one or more antibodies specific to the polypeptide interest and (b)
comparing the level
of gene expression with a standard gene expression level, whereby an increase
or decrease in
20 the assayed polypeptide gene expression level compared to the standard
expression level is
indicative of a particular disorder. With respect to cancer, the presence of a
relatively high
amount of transcript in biopsied tissue from an individual may indicate a
predisposition for
the development of the disease, or may provide a means for detecting the
disease prior to the
appearance of actual clinical symptoms. A more definitive diagnosis of this
type may allow
25 health professionals to employ preventative measures or aggressive
treatment earlier thereby
preventing the development or further progression of the cancer.
Antibodies of the invention can be used to assay protein levels in a
biological sample
using classical immunohistological methods known to those of skill in the art
(e.g., see
Jalkanen, et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, et al., J. Cell
. Biol. 105:3087-
30 3096 (1987)). Other antibody-based methods useful for detecting protein
gene expression
include immunoassays, such as the enzyme linked immunosorbent assay (ELISA)
and the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
91
radioimmunoassay (RIA). Suitable antibody assay labels are known in the art
and include
enzyme labels, such as, glucose oxidase; radioisotopes, such as iodine (125I,
121I), carbon
(14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99Tc);
luminescent labels,
such as luminol; and fluorescent labels, such as fluorescein and rhodamine,
and biotin.
One aspect of the invention is the detection and diagnosis of a disease or
disorder
associated with aberrant expression of a polypeptide of interest in an animal,
preferably a
mammal and most preferably a human. In one embodiment, diagnosis comprises: a)
administering (for example, parenterally, subcutaneously, or
intraperitoneally) to a subject an
effective amount of a labeled molecule which specifically binds to the
polypeptide of
interest; b) waiting for a time interval following the administering for
permitting the labeled
molecule to preferentially concentrate at sites in the subject where the
polypeptide is
expressed (and for unbound labeled molecule to be cleared to background
level); c)
determining background level; and d) detecting the labeled molecule in the
subject, such that
detection of labeled molecule above the background level indicates that the
subject has a
particular disease or disorder associated with aberrant expression of the
polypeptide of
interest. Background level can be determined by various methods including,
comparing the
amount of labeled molecule detected to a standard value previously determined
for a
particular system.
It will be understood in the art that the size of the subject and the imaging
system used
will determine the quantity of imaging moiety needed to produce diagnostic
images. In the
case of a radioisotope moiety, for a human subject, the quantity of
radioactivity injected will
normally range from about 5 to 20 millicuries of 99mTc. The labeled antibody
or antibody
fragment will then preferentially accumulate at the location of cells which
contain the specific
protein. In vivo tumor imaging is described in S.W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments."
(Chapter 13
in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B.
A.
Rhodes, eds., Masson Publishing Inc. (1982).
Depending on several variables, including the type of label used and the mode
of
administration, the time interval following the administration for permitting
the labeled
molecule to preferentially concentrate at sites in the subject and for unbound
labeled
molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours
or 6 to 12 hours.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
92
In another embodiment the time interval following administration is 5 to 20
days or 5 to 10
days.
In an embodiment, monitoring of the disease or disorder is carried out by
repeating the
method for diagnosing the disease or disease, for example, one month after
initial diagnosis,
six months after initial diagnosis, one year after initial diagnosis, etc.
Presence of the labeled molecule can be detected in the patient using methods
known
in the art for in vivo scanning. These methods depend upon the type of label
used. Skilled
artisans will be able to determine the appropriate method for detecting a
particular label.
Methods and devices that may be used in the diagnostic methods of the
invention include, but
are not limited to, computed tomography (CT), whole body scan such as position
emission
tomography (PET), magnetic resonance imaging (MRI), and sonography.
In a specific embodiment, the molecule is labeled with a radioisotope and is
detected
in the patient using a radiation responsive surgical instrument (Thurston et
al., U.S. Patent
No. 5,441,050). In another embodiment, the molecule is labeled with a
fluorescent
compound and is detected in the patient using a fluorescence responsive
scanning instrument.
In another embodiment, the molecule is labeled with a positron emitting metal
and is detected
in the patent using positron emission-tomography. In yet another embodiment,
the molecule
is labeled with a paramagnetic label and is detected in a patient using
magnetic resonance
imaging (MRI).
Kits
The present invention provides kits that can be used in the above methods. In
one
embodiment, a kit comprises an antibody of the invention, preferably a
purified antibody, in
one or more containers. In a specific embodiment, the kits of the present
invention contain a
substantially isolated polypeptide comprising an epitope which is specifically
immunoreactive with an antibody included in the kit. Preferably, the kits of
the present
invention further comprise a control antibody which does not react with the
polypeptide of
interest. In another specific embodiment, the kits of the present invention
contain a means for
detecting the binding of an antibody to a polypeptide of interest (e.g., the
antibody may be
conjugated to a detectable substrate such as a fluorescent compound, an
enzymatic substrate,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
93
a radioactive compound or a luminescent compound, or a second antibody which
recognizes
the first antibody may be conjugated to a detectable substrate).
In another specific embodiment of the present invention, the kit is a
diagnostic kit for
use in screening serum containing antibodies specific against proliferative
and/or cancerous
polynucleotides and polypeptides. Such a kit may include a control antibody
that does not
react with the polypeptide of interest. Such a kit may include a substantially
isolated
polypeptide antigen comprising an epitope which is specifically immunoreactive
with at least
one anti-polypeptide antigen antibody. Further, such a kit includes means for
detecting the
binding of said antibody to the antigen (e.g., the antibody may be conjugated
to a fluorescent
compound such as fluorescein or rhodamine .which can be detected by flow
cytometry). In
specific embodiments, the kit may include a recombinantly produced or
chemically
synthesized polypeptide antigen. The polypeptide antigen of the kit may also
be attached to a
solid support.
In a more specific embodiment the detecting means of the above-described kit
includes a solid support to which said polypeptide antigen is attached. Such a
kit may also
include a non-attached reporter-labeled anti-human antibody. In this
embodiment, binding of
the antibody to the polypeptide antigen can be detected by binding of the said
reporter-labeled
antibody.
In an additional embodiment, the invention includes a diagnostic kit for use
in
screening serum containing antigens of the polypeptide of the invention. The
diagnostic kit
includes a substantially isolated antibody specifically immunoreactive with
polypeptide or
polynueleotide antigens, and means for detecting the binding of the
polynucleotide or
polypeptide antigen to the antibody. In one embodiment, the antibody is
attached to a solid
support. In a specific embodiment, the antibody may be a monoclonal antibody.
The detecting
means of the kit may include a second, labeled monoclonal antibody.
Alternatively, or in
addition, the detecting means may include a labeled, competing antigen.
In one diagnostic configuration, test serum is reacted with a solid phase
reagent
having a surface-bound antigen obtained by the methods of the present
invention. After
binding with specific antigen antibody to the reagent and removing unbound
serum
components by washing, the reagent is reacted with reporter-labeled anti-human
antibody to
bind reporter to the reagent in proportion to the amount of bound anti-antigen
antibody on the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
94
solid support. The reagent is again washed to remove unbound labeled antibody,
and the
amount of reporter associated with the reagent is determined. Typically, the
reporter is an
enzyme which is detected by incubating the solid phase in the presence of a
suitable
fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).
The solid surface reagent in the above assay is prepared by known techniques
for
attaching protein material to solid support material, such as polymeric beads,
dip sticks, 96-
well plate or filter material. These attachment methods generally include non-
specific
adsorption of the protein to the support or covalent attachment of the
protein, typically
through a free amine group, to a chemically reactive group on the solid
support, such as an
activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin
coated plates can
be used in conjunction with biotinylated antigen(s).
Thus, the invention provides an assay system or kit for carrying out this
diagnostic
method. The kit generally includes a support with surface- bound recombinant
antigens, and a
reporter-labeled anti-human antibody for detecting surface-bound anti-antigen
antibody.
Fusion Proteins
Any TGF alpha HIII polypeptide can be used to generate fusion proteins. For
example, the TGF alpha HIII polypeptide, when fused to a second protein, can
be used as an
antigenic tag. Antibodies raised against the TGF alpha HIII polypeptide can be
used to
indirectly detect the second protein by binding to the TGF alpha HIII.
Moreover, because
secreted proteins target cellular locations based on trafficking signals, the
TGF alpha HIII
polypeptides can be used as targeting molecules once fused to other proteins.
Examples of domains that can be fused to TGF alpha HIII polypeptides include
not
only heterologous signal sequences, but also other heterologous functional
regions. The
fusion does not necessarily need to be direct, but may occur through linker
sequences.
In certain preferred embodiments, TGF alpha HIII proteins of the invention
comprise
fusion proteins wherein the TGF alpha HIlI polypeptides are those described
above.as m-n.
In preferred embodiments, the application is directed to nucleic acid
molecules at least 90%,
95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences encoding
polypeptides
having the amino acid sequence of the specific N- and C-terminal deletions
recited herein.
Polynucleotides encoding these polypeptides are also encompassed by the
invention.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
Moreover, fusion proteins may also be engineered to improve characteristics of
the
TGF alpha HIII polypeptide. For instance, a region of additional amino acids,
particularly
charged amino acids, may be added to the N-terminus of the TGF alpha HIII
polypeptide to
improve stability and persistence during purification from the host cell or
subsequent
5 handling and storage. Also, peptide moieties may be added to the TGF alpha
HIII
polypeptide to facilitate purification. Such regions may be removed prior to
final preparation
of the TGF alpha HIII polypeptide. The addition of peptide moieties to
facilitate handling of
polypeptides are familiar and routine techniques in the art.
As one of skill in the art will appreciate, polypeptides of the present
invention and the
10 epitope-bearing fragments thereof described above, can be combined with
heterologous
polypeptide sequences. For example, the polypeptides of the present invention
may be fused
with heterologous polypeptide sequences, for example, the polypeptides of the
present
invention may be fused with parts of the constant domain of immunoglobulins
(IgA, IgE,
IgG, IgM) or portions thereof (CHl, CH2, CH3, and any combination thereof,
including both
1 S entire domains and portions thereof), resulting in chimeric polypeptides.
These fusion
proteins facilitate purification and show an increased half life in vivo. One
reported example
describes chimeric proteins consisting of the first two domains of the human
CD4-
polypeptide and various domains of the constant regions of the heavy or light
chains of
mammalian immunoglobulins. (EP A 394,827; Traunecker et al., Nature 331:84-86
(1988).)
20 Fusion proteins having disulfide-linked dimeric structures (due to the IgG)
can also be more
efficient in binding and neutralizing other molecules, than the monomeric
secreted protein or
protein fragment alone. (Fountoulakis et al., J. Biochem. 270:3958-3964
(1995).)
Similarly, EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion
proteins
comprising various portions of constant region of immunoglobulin molecules
together with
25 another human protein or part thereof. In many cases, the Fc part in a
fusion protein is
beneficial in therapy and diagnosis, and thus can result in, for example,
improved
pharmacokinetic properties. (EP-A 0232 262.) Alternatively, deleting the Fc
part after the
fusion protein has been expressed, detected, and purified, would be desired.
For example, the
Fc portion may hinder therapy and diagnosis if the fusion protein is used as
an antigen for
30 immunizations. In drug discovery, for example, human proteins, such as hIL-
5, have been
fused with Fc portions for the purpose of high-throughput screening assays to
identify
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
96
antagonists of hIL-5. (See, D. Bennett et al., J. Molecular Recognition 8:52-
58 (1995); K.
Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).)
Moreover, the TGF alpha HIII polypeptides can be fused to marker sequences,
such as
a peptide which facilitates purification of TGF alpha HIII. In preferred
embodiments, the
marker amino acid sequence is a hexa-histidine peptide, such as the tag
provided in a pQE
vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others,
many of
which are commercially available. As described in Gentz et al., Proc. Natl.
Acad. Sci. USA
86:821-824 (1989), for instance, hexa-histidine provides for convenient
purification of the
fusion protein. Another peptide tag useful for purification, the "HA" tag,
corresponds to an
epitope derived from the influenza hemagglutinin protein. (Wilson et al., Cell
37:767
(1984).)
Thus, any of these above fusions can be engineered using the TGF alpha H1ZI
polynucleotides or the polypeptides.
Vectors, Host Cells, and Protein Production
The present invention also relates to vectors containing the TGF alpha HIII
polynucleotide, host cells, and the production of polypeptides by recombinant
techniques.
The vector may be, for example, a phage, plasmid, viral, or retroviral vector.
Retroviral
vectors may be replication competent or replication defective. In the latter
case, viral
propagation generally will occur only in complementing host cells.
Host cells are genetically engineered (transduced or transformed or
transfected) with the
vectors of this invention which may be, for example, a cloning vector or an
expression vector.
The vector may be, for example, in the form of a plasmid, a viral particle, a
phage, etc. The
engineered host cells can be cultured in conventional nutrient media modified
as appropriate
for activating promoters, selecting transformants or amplifying the genes of
the present
invention. The culture conditions, such as temperature, pH and the like, are
those previously
used with the host cell selected for expression, and will be apparent to the
ordinarily skilled
artisan.
The polynucleotides of the present invention may be employed for producing
polypeptides by recombinant techniques. Thus, for example, the polynucleotide
may be
included in any one of a variety of expression vectors for expressing a
polypeptide. Such
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
97
vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g.,
derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast
plasmids; vectors
derived from combinations of plasmids and phage DNA, viral DNA such as
vaccinia,
adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be
used as
long as it is replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of
procedures. In general, the DNA sequence is inserted into an appropriate
restriction
endonuclease sites) by procedures known in the art. Such procedures and others
are deemed
to be within the scope of those skilled in the art. The DNA sequence in the
expression
vector is operatively linked to an appropriate expression control sequences)
(promoter) to
direct mRNA synthesis. As representative examples of such promoters, there may
be
mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda PL
promoter
and other promoters known to control expression of genes in prokaryotic or
eukaryotic cells
or their viruses. The expression vector also contains a ribosome binding site
for translation
initiation and a transcription terminator. The vector may also include
appropriate sequences
for amplifying expression.
In addition, the expression vectors preferably contain one or more selectable
marker
genes to provide a phenotypic trait for selection of transformed host cells
such as
dihydrofolate reductase or neomycin - resistance for eukaryotic cell culture,
or such as
tetracycline or ampicillin resistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove described,
as
well as an appropriate promoter or control sequence, may be employed to
transform an
appropriate host to permit the host to express the protein.
As representative examples of appropriate hosts, there may be mentioned:
bacterial
cells, such as E. coli, Streptomyces, Salmonella typhimuriaum, fungal cells,
such as yeast;
insect cells such as Drosophila S2 and Spodoptera SF9; animal cells such as
CHO, COS or
Bowes melanoma; adenoviruses; plant cells, etc. The selection of an
appropriate host is
deemed to be within the scope of those skilled in the art from the teachings
herein.
More particularly, the present invention also includes recombinant constructs
comprising one or more of the sequences as broadly described above. The
constructs
comprise a vector, such as a plasmid or viral vector, into which a sequence of
the invention
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
98
has been inserted, in a forward or reverse orientation. In a preferred aspect
of this
embodiment, the construct further comprises regulatory sequences including,
for example, a
promoter, operably linked to the sequence. Large numbers of suitable vectors
and promoters
are known to those of skill in the art, and are commercially available. The
following vectors
are provided by way of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS,
pDlO,
phagescript, psiX174, pbluescript SK, pbsks, pNHBA, PNHl6a, pNHl8A, pNH46A
(Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRITS (Pharmacia);
Eukaryotic:
pWLNEO, pSV2CAT, pOG44, pXTI, pSG (Stratagene), pSVK3, pBPV, pMSG, pSVL
(Pharmacia). However, any other plasmid or vector may be used as long as they
are
replicable and viable in the host.
Promoter regions can be selected from any desired gene using CAT
(chloramphenicol
transferase) vectors or other vectors with selectable markers. Two appropriate
vectors are
pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ,
T3, T7, gpt,
lambda PR, P~ and trp. Eukaryotic promoters include CMV immediate early, HSV
thymidine
kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-
I. Selection of
the appropriate vector and promoter is well within the level of ordinary skill
in the art.
In a further embodiment, the present invention relatesto host cells containing
the
above-described constructs. The host cell can be a higher eukaryotic cell,
such as a
mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host
cell can be a
prokaryotic cell, such as a bacterial cell. Introduction of the construct into
the host cell can be
effected by calcium phosphate transfection, DEAF-Dextran mediated
transfection, or
electroporation (Davis, L., Dibner, M., Battey, L, Basic Methods in Molecular
Biology,
(1986)).
The constructs in host cells can be used in a conventional manner to produce
the gene
product encoded by the recombinant sequence. Alternatively, the polypeptides
of the
invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other
cells
under the control of appropriate promoters. Cell-free translation systems can
also be
employed to produce such proteins using RNAs derived from the DNA constructs
of the
present invention. Appropriate cloning and expression vectors for use with
prokaryotic and
eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A
Laboratory
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
99
Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of
which is
hereby incorporated by reference.
Transcription of the DNA encoding the polypeptides of the present invention by
higher eukaryotes is increased by inserting an enhancer sequence into the
vector. Enhancers
are cis-acting elements of DNA, usually about from 10 to 300 by that act on a
promoter to
increase its transcription. Examples including the SV40 enhancer on the late
side of the
replication origin by 100 to 270, a cytomegalovirus early promoter enhancer,
the polyoma
enhancer on the late side of the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors, will include origins of replication
and
selectable markers permitting transformation of the host cell, e.g., the
ampicillin resistance
gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a
highly-expressed
gene to direct transcription of a downstream structural sequence. Such
promoters can be
derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate
kinase
(PGK), alpha factor acid phosphatase, or heat shock proteins, among others.
The
heterologous structural sequence is assembled in appropriate phase with
translation initiation
and termination sequences, and preferably, a leader sequence capable of
directing secretion
of translated protein into the periplasmic space or extracellular medium.
Optionally, the
heterologous sequence can encode a fusion protein including an N-terminal
identification
peptide imparting desired characteristics, e.g., stabilization or simplified
purification of
expressed recombinant product.
Useful expression vectors for bacterial use are constructed by inserting a
structural
DNA sequence encoding a desired protein together with suitable translation
initiation and
termination signals in operable reading phase with a functional promoter. The
vector will
comprise one or more phenotypic selectable markers and an origin of
replication to ensure
maintenance of the vector and to, if desirable, provide amplification within
the host. Suitable
prokaryotic hosts for transformation include E. Bacillus subtilis, Salmonella
typhimurium
and various species within the genera Pseudomonas, Streptomyces, and
Staphylococcus,
although others may also be employed as a matter of choice.
As a representative but nonlimiting example, useful expression vectors for
bacterial
use can comprise a selectable marker and bacterial origin of replication
derived from
commercially available plasmids comprising, genetic elements of the well known
cloning
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
100
vector pBR322 (ATCC 37017). Such commercial vectors include, for example,
pKK223-3
(Pharmacia Fine Chemicals, Uppsala, Sweden) and GEM1 (Promega Biotec, Madison,
WI,
USA). These PBR322 "backbone" sections are combined with an appropriate
promoter and
the structural sequence to be expressed.
Additionally, TGF alpha HIII polynucleotides may be joined to a vector
containing a
selectable marker for propagation in a host. Generally, a plasmid vector is
introduced in a
precipitate, such as a calcium phosphate precipitate, or in a complex with a
charged lipid. If
the vector is a virus, it may be packaged in vitro using an appropriate
packaging cell line and
then transduced into host cells.
The TGF alpha HIII polynucleotide insert should be operatively linked to an
appropriate promoter, such as the phage lambda PL promoter, the E. coli lac,
trp, phoA and
tac promoters, the SV40 early and late promoters and promoters of retroviral
LTRs, to name a
few. Other suitable promoters will be known to the skilled artisan. The
expression
constructs will further contain sites for transcription initiation,
termination, and, in the
1 S transcribed region, a ribosome binding site for translation. The coding
portion of the
transcripts expressed by the constructs will preferably include a translation
initiating codon at
the beginning and a termination codon (UAA, UGA or UAG) appropriately
positioned at the
end of the polypeptide to be translated.
As indicated, the expression vectors will preferably include at least one
selectable
marker. Such markers include dihydrofolate reductase, 6418 or neomycin
resistance for
eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance
genes for
culturing in E. coli and other bacteria. Representative examples of
appropriate hosts include,
but are not limited to, bacterial cells, such as E. coli, Streptomyces and
Salmonella
typhimurium cells; fungal cells, such as yeast cells; insect cells such as
Drosophila S2 and
Spodoptera Sf~ cells; animal cells such as CHO, COS, 293, and Bowes melanoma
cells; and
plant cells. Appropriate culture mediums and conditions for the above-
described host cells
are known in the art.
Among vectors preferred for use in bacteria include pQE70, pQE60 and pQE-9,
available from QIAGEN, Inc.; pBluescript vectors, Phagescript vectors, pNHBA,
pNHl6a,
pNHl8A, pNH46A, available from Stratagene Cloning Systems, Inc.; and ptrc99a,
pKK223
3, pKK233-3, pDR540, pRITS available from Pharmacia Biotech, Inc. Among
preferred
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
101
eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTI and pSG available from
Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other
suitable
vectors will be readily apparent to the skilled artisan.
Introduction of the construct into the host cell can be effected by calcium
phosphate
transfection, DEAE-dextran mediated transfection, cationic lipid-mediated
transfection,
electroporation, transduction, infection, or other methods. Such methods are
described in
many standard laboratory manuals, such as Davis et al., Basic Methods In
Molecular Biology
( 1986). It is specifically contemplated that TGF alpha HIII polypeptides may
in fact be
expressed by a host cell lacking a recombinant vector.
Following transformation of a suitable host strain and growth of the host
strain to an
appropriate cell density, the selected promoter is induced by appropriate
means (e.g.,
temperature shift or chemical induction) and cells are cultured for an
additional period.
Cells are typically harvested by centrifugation, disrupted by physical or
chemical
means, and the resulting crude extract retained for further purification.
Microbial cells employed in expression of proteins can be disrupted by any
convenient method, including freezethaw cycling, sonication, mechanical
disruption, .or use
of cell lysing agents, such methods are well known to those skilled in the
art.
Various manunalian cell culture systems can also be employed to express
recombinant
protein. Examples of mammalian expression systems include the COS-7 lines of
monkey
kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell
lines capable of
expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK
cell lines.
Mammalian expression vectors will comprise an origin of replication, a
suitable promoter and
enhancer, and also any necessary ribosome binding sites, polyadenylation site,
splice donor
and acceptor sites, transcriptional termination sequences, and S' flanking
nontranscribed
sequences. DNA sequences derived from the SV40 splice, and polyadenylation
sites may be
used to provide the required nontranscribed genetic elements.
TGF alpha HBI polypeptides can be recovered and purified from recombinant cell
cultures by well-known methods including ammonium sulfate or ethanol
precipitation, acid
extraction, anion or cation exchange chromatography, phosphocellulose
chromatography,
hydrophobic interaction chromatography, affinity chromatography,
hydroxylapatite
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
102
chromatography and lectin chromatography. Most preferably, high performance
liquid
chromatography ("HPLC") is employed for purification.
Additionally, the polypeptides can be recovered and purified from recombinant
cell
cultures by methods including ammonium sulfate or ethanol precipitation, acid
extraction,
anion or canon exchange chromatography, phosphocellulose chromatography,
hydrophobic
interaction chromatography, affinity chromatography, hydroxylapatite
chromatography and
lectin chromatography. Protein refolding steps can be used, as necessary, in
completing
configuration of the mature protein. Finally, high performance liquid
chromatography
(HPLC) can be employed for final purification steps.
The polypeptides of the present invention may be a naturally purified product,
or a
product of chemical synthetic procedures, or produced by recombinant
techniques from a
prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher
plant, insect and
mammalian cells in culture). Depending upon the host employed in a recombinant
production
procedure, the polypeptides of the present invention may be glycosylated or
may be
nonglycosylated. Polypeptides of the invention may also include an initial
methionine amino
acid residue.
TGF alpha H>II polypeptides, and preferably the secreted form, can also be
recovered
from: products purified from natural sources, including bodily fluids, tissues
and cells,
whether directly isolated or cultured; products of chemical synthetic
procedures; and products
produced by recombinant techniques from a prokaryotic or eukaryotic host,
including, for
example, bacterial, yeast, higher plant, insect, and mammalian cells.
Depending upon the
host employed in a recombinant production procedure, the TGF alpha HI»
polypeptides may
be glycosylated or may be non-glycosylated. In addition, TGF alpha HIII
polypeptides may
also include an initial modified methionine residue, in some cases as a result
of host-mediated
processes. Thus, it is well known in the art that the N-terminal methionine
encoded by the
translation initiation codon generally is removed with high efficiency from
any protein after
translation in all eukaryotic cells. While the N-terminal methionine on most
proteins also is
efficiently removed in most prokaryotes, for some proteins, this prokaryotic
removal process
is inefficient, depending on the nature of the amino acid to which the N-
terminal methionine
is covalently linked.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
103
In addition to encompassing host cells containing the vector constructs
discussed
herein, the invention also encompasses primary, secondary, and immortalized
host cells of
vertebrate origin, particularly mammalian origin, that have been engineered to
delete or
replace endogenous genetic material (e.g., TGF alpha HIII coding sequence),
and/or to
S include genetic material (e.g., heterologous polynucleotide sequences) that
is operably
associated with TGF alpha HIII polynucleotides of the invention, and which
activates, alters,
and/or amplifies endogenous TGF alpha HIII polynucleotides. For example,
techniques
known in the art may be used to operably associate heterologous control
regions (e.g.,
promoter and/or enhancer) and endogenous TGF alpha HIII polynucleotide
sequences via
homologous recombination, resulting in the formation of a new transcription
unit (see, e.g.,
U.S. Patent No. 5,641,670, issued June 24, 1997; U.S. Patent No. 5,733,761,
issued March
31, 1998; International Publication No. WO 96/29411, published September 26,
1996;
International Publication No. WO 94/12650, published August 4, 1994; Koller et
al., Proc.
Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-
438 (1989),
1 S the disclosures of each of which are incorporated by reference in their
entireties).
In addition, polypeptides of the invention can be chemically synthesized using
techniques known in the art (e.g:, see Creighton, 1983, Proteins: Structures
and Molecular
Principles, W.H. Freeman & Co., N.Y., and Hunkapiller et al., Nature, 310:105-
111 (1984)).
For example, a polypeptide corresponding to a fragment of a TGF alpha HIII
polypeptide can
be synthesized by use of a peptide synthesizer. Furthermore, if desired,
nonclassical amino
acids or chemical amino acid analogs can be introduced as a substitution or
addition into the
TGF alpha HIII polypeptide sequence. Non-classical amino acids include, but
are not limited
to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a-
amino isobutyric
acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino
hexanoic acid,
Aib, 2-amino isobutyric acid, 3-amino propionic acid, ornithine, norleucine,
norvaline,
hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-
butylglycine, t
butylalanine, phenylglycine, cyclohexylalanine, b-alanine, fluoro-amino acids,
designer
amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na-methyl
amino acids,
and amino acid analogs in general. Furthermore, the amino acid can be D
(dextrorotary) or L
(levorotary).
The invention encompasses TGF alpha H1TI polypeptides which are differentially
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
104
modified during or after translation, e.g., by glycosylation, acetylation,
phosphorylation,
amidation, derivatization by known protecting/blocking groups, proteolytic
cleavage, linkage
to an antibody molecule or other cellular ligand, etc. Any of numerous
chemical
modifications may be carried out by known techniques, including but not
limited, to specific
S chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8
protease, NaBH4;
acetylation, formylation, oxidation, reduction; metabolic synthesis in the
presence of
tunicamycin; etc.
Additional post-translational modifications encompassed by the invention
include, for
example, e.g., N-linked or O-linked carbohydrate chains, processing of N-
terminal or
C-terminal ends), attachment of chemical moieties to the amino acid backbone,
chemical
modifications of N-linked or O-linked carbohydrate chains, and addition or
deletion of an
N-terminal methionine residue as a result of procaryotic host cell expression.
The
polypeptides may also be modified with a detectable label, such as an
enzymatic, fluorescent,
isotopic or affinity label to allow for detection and isolation of the
protein.
Also provided by the invention are chemically modified derivatives of the
polypeptides of the invention which may provide additional advantages such as
increased
solubility, stability and circulating time of the polypeptide, or decreased
immunogenicity (see
U.S. Patent No. 4,179,337). The chemical moieties for derivitization may be
selected from
water soluble polymers such as polyethylene glycol, ethylene glycol/propylene
glycol
copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
The
polypeptides may be modified at random positions within the molecule, or at
predetermined
positions within the molecule and may include one, two, three or more attached
chemical
moieties.
The polymer may be of any molecular weight, and may be branched or unbranched.
For polyethylene glycol, the preferred molecular weight is between about I kDa
and about 100
kDa (the term "about" indicating that in preparations of polyethylene glycol,
some molecules
will weigh more, some less, than the stated molecular weight) for ease in
handling and
manufacturing. Other sizes may be used, depending on the desired therapeutic
profile (e.g.,
the duration of sustained release desired, the effects, if any on biological
activity, the ease in
handling, the degree or lack of antigenicity and other known effects of the
polyethylene glycol
to a therapeutic protein or analog).
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
105
The polyethylene glycol molecules (or other chemical moieties) should be
attached to
the protein with consideration of effects on functional or antigenic domains
of the protein.
There are a number of attachment methods available to those skilled in the
art, e.g., EP 0 401
384, herein incorporated by reference (coupling PEG to G-CSF), see also Malik
et al., Exp.
Hematol. 20:1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl
chloride). For
example, polyethylene glycol may be covalently bound through amino acid
residues via a
reactive group, such as, a free amino or carboxyl group. Reactive groups are
those to which
an activated polyethylene glycol molecule may be bound. The amino acid
residues having a
free amino group may include lysine residues and the N-terminal amino acid
residues; those
having a free carboxyl group may include aspartic acid residues glutamic acid
residues and
the C-terminal amino acid residue. Sulfhydryl groups may also be used as a
reactive group
for attaching the polyethylene glycol molecules. Preferred for therapeutic
purposes is
attachment at an amino group, such as attachment at the N-terminus or lysine
group.
One may specifically desire proteins chemically modified at the N-terminus.
Using
1 S polyethylene glycol as an illustration of the present composition, one may
select from a
variety of polyethylene glycol molecules (by molecular weight, branching,
etc.), the
proportion of polyethylene glycol molecules to protein (polypeptide) molecules
in the
reaction mix, the type of pegylation reaction to be performed, and the method
of obtaining the
selected N-terminally pegylated protein. The method of obtaining the N-
terminally pegylated
preparation (i.e., separating this moiety from other monopegylated moieties if
necessary) may
be by purification of the N-terminally pegylated material from a population of
pegylated
protein molecules. Selective proteins chemically modified at the N-terminus
modification
may be accomplished by reductive alkylation which exploits differential
reactivity of different
types of primary amino groups (lysine versus the N-terminal) available for
derivatization in a
particular protein. Under the appropriate reaction conditions, substantially
selective
derivatization of the protein at the N-terminus with a carbonyl group
containing polymer is
achieved.
The TGF alpha HIII polypeptides of the invention may be in monomers or
multimers
(i.e., dimers, trimers, tetramers and higher multimers). Accordingly, the
present invention
relates to monomers and multimers of the TGF alpha HIII polypeptides of the
invention, their
preparation, and compositions (preferably, Therapeutics) containing them. In
specific
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
106
embodiments, the polypeptides of the invention are monomers, dimers, trimers
or tetramers.
In additional embodiments, the multimers of the invention are at least dimers,
at least trimers,
or at least tetramers.
Multimers encompassed by the invention may be homomers or heteromers. As used
herein, the term homomer, refers to a multimer containing only polypeptides
corresponding to
the amino acid sequence of SEQ ~ N0:2 or encoded by the cDNA contained in the
deposited clone (including fragments, variants, splice variants, and fusion
proteins,
corresponding to these as described herein). These homomers may contain TGF
alpha HIII
polypeptides having identical or different amino acid sequences. In a specific
embodiment, a
homomer of the invention is a multimer containing only TGF alpha HIII
polypeptides having
an identical amino acid sequence. In another specific embodiment, a homomer of
the
invention is a multimer containing TGF alpha HIII polypeptides having
different amino acid
sequences. In specific embodiments, the multimer of the invention is a
homodimer (e.g.,
containing TGF alpha HBI polypeptides having identical or different amino acid
sequences)
or a homotrimer (e.g., containing TGF alpha HIII polypeptides having identical
and/or
different amino acid sequences). In additional embodiments, the homomeric
multimer of the
invention is at least a homodimer, at least a homotrimer, or at least a
homotetramer.
As used herein, the term heteromer refers to a multimer containing one or more
heterologous polypeptides (i.e., polypeptides of different proteins) in
addition to the TGF
alpha HIB polypeptides of the invention. In a specific embodiment, the
multimer of the
invention is a heterodimer, a heterotrimer, or a heterotetramer. In additional
embodiments,
the heteromeric multimer of the invention is at least a heterodimer, at least
a heterotrimer, or
at least a heterotetramer.
Multimers of the invention may be the result of hydrophobic, hydrophilic,
ionic andlor
covalent associations and/or may be indirectly linked, by for example,
liposome formation.
Thus, in one embodiment, multimers of the invention, such as, for example,
homodimers or
homotrimers, are formed when polypeptides of the invention contact one another
in solution.
In another embodiment, heteromultimers of the invention, such as, for example,
heterotrimers
or heterotetramers, are formed when polypeptides of the invention contact
antibodies to the
polypeptides of the invention (including antibodies to the heterologous
polypeptide sequence
in a fusion protein of the invention) in solution. In other embodiments,
multimers of the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
107
invention are formed by covalent associations with and/or between the TGF
alpha HIII
polypeptides of the invention. Such covalent associations may involve one or
more amino
acid residues contained in the polypeptide sequence (e.g., that recited in SEQ
ID N0:2, or
contained in the polypeptide encoded by the clone HTECD31 ). In one instance,
the covalent
associations are cross-linking between cysteine residues located within the
polypeptide
sequences which interact in the native (i.e., naturally occurnng) polypeptide.
In another
instance, the covalent associations are the consequence of chemical or
recombinant
manipulation. Alternatively, such covalent associations may involve one or
more amino acid
residues contained in the heterologous polypeptide sequence in a TGF alpha
HIII fusion
protein. In one example, covalent associations are between the heterologous
sequence
contained in a fusion protein of the invention (see, e.g., US Patent Number
5,478,925). In a
specific example, the covalent associations are between the heterologous
sequence contained
in a TGF alpha HIII-Fc fusion protein of the invention (as described herein).
In another
specific example, covalent associations of fusion proteins of the invention
are between
heterologous polypeptide sequence from another protein that is capable of
forming covalently
associated multimers, such as for example, oseteoprotegerin (see, e.g.,
International
Publication NO: WO 98/49305, the contents of which are herein incorporated by
reference in
its entirety). In another embodiment, two or more polypeptides of the
invention are joined
through peptide linkers. Examples include those peptide linkers described in
U.S. Pat. No.
5,073,627 (hereby incorporated by reference). Proteins comprising multiple
polypeptides of
the invention separated by peptide linkers may be produced using conventional
recombinant
DNA technology.
Another method for preparing multimer polypeptides of the invention involves
use of
polypeptides of the invention fused to a leucine zipper or isoleucine zipper
polypeptide
sequence. Leucine zipper and isoleucine zipper domains are polypeptides that
promote
multimerization of the proteins in which they are found. Leucine zippers were
originally
identified in several DNA-binding proteins (Landschulz et al., Science
240:1759, (1988)),
and have since been found in a variety of different proteins. Among the known
leucine
zippers are naturally occurnng peptides and derivatives thereof that dimerize
or trimerize.
Examples of leucine zipper domains suitable for producing soluble multimeric
proteins of
the invention are those described in PCT application WO 94/10308, hereby
incorporated by
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
108
reference. Recombinant fusion proteins comprising a polypeptide of the
invention fused to a
polypeptide sequence that dimerizes or trimerizes in solution are expressed in
suitable host
cells, and the resulting soluble multimeric fusion protein is recovered from
the culture
supernatant using techniques known in the art.
Trimeric polypeptides of the invention may offer the advantage of enhanced
biological activity. Preferred leucine zipper moieties and isoleucine moieties
are those that
preferentially form trimers. One example is a leucine zipper derived from lung
surfactant
protein D (SPD), as described in Hoppe et al. (FEBS Letters 344:191, (1994))
and in U.S.
patent application Ser. No. 08/446,922, hereby incorporated by reference.
Other peptides
derived from naturally occurnng trimeric proteins may be employed in preparing
trimeric
polypeptides of the invention.
In another example, proteins of the invention are associated by interactions
between
Flag~ polypeptide sequence contained in fusion proteins of the invention
containing Flag~
polypeptide seuqence. In a further embodiment, associations proteins of the
invention are
associated by interactions between heterologous polypeptide sequence contained
in Flag~
fusion proteins of the invention and anti-Flag~ antibody.
The multimers of the invention may be generated using chemical techniques
known in
the art. For example, polypeptides desired to be contained in the multimers of
the invention
may be chemically cross-linked using linker molecules and linker molecule
length
optimization techniques known in the art (see, e.g., US Patent Number
5,478,925, which is
herein incorporated by reference in its entirety). Additionally, multimers of
the invention
may be generated using techniques known in the art to form one or more inter-
molecule
cross-links between the cysteine residues located within the sequence of the
polypeptides
desired to be contained in the multimer (see, e.g., US Patent Number
5,478,925, which is
herein incorporated by reference in its entirety). Further, polypeptides of
the invention may
be routinely modified by the addition of cysteine or biotin to the C terminus
or N-terminus of
the polypeptide and techniques known in the art may be applied to generate
multimers
containing one or more of these modified polypeptides (see, e.g., US Patent
Number
5,478,925, which is herein incorporated by reference in its entirety).
Additionally, techniques
known in the art may be applied to generate liposomes containing the
polypeptide
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
109
components desired to be contained in the multimer of the invention (see,
e.g., US Patent
Number 5,478,925, which is herein incorporated by reference in its entirety).
Alternatively, multimers of the invention may be generated using genetic
engineering
techniques known in the art. In one embodiment, polypeptides contained in
multimers of the
invention are produced recombinantly using fusion protein technology described
herein or
otherwise known in the art (see, e.g., US Patent Number 5,478,925, which is
herein
incorporated by reference in its entirety). In a specific embodiment,
polynucleotides coding
for a homodimer of the invention are generated by ligating a polynucleotide
sequence
encoding a polypeptide of the invention to a sequence encoding a linker
polypeptide and then
further to a synthetic polynucleotide encoding the translated product of the
polypeptide in the
reverse orientation from the original C-terminus to the N-terminus (lacking
the leader
sequence) (see, e.g., US Patent Number 5,478,925, which is herein incorporated
by reference
in its entirety). In another embodiment, recombinant techniques described
herein or
otherwise known in the art are applied to generate recombinant polypeptides of
the invention
which contain a transmembrane domain (or hyrophobic or signal peptide) and
which can be
incorporated by membrane reconstitution techniques into liposomes (see, e.g.,
US Patent
Number 5,478,925, which is herein incorporated by reference in its entirety).
Uses of the TGF aloha HIII Polynucleotides
The TGF alpha HIII polynucleotides identified herein can be used in numerous
ways
as reagents. The following description should be considered exemplary and
utilizes known
techniques.
There exists an ongoing need to identify new chromosome markers, since few
chromosome marking reagents, based on actual sequence data (repeat
polymorphisms), are
presently available.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers
(preferably 15-25 bp) from the sequences shown in SEQ ID NO:1. Primers can be
selected
using computer analysis so that primers do not span more than one predicted
exon in the
genomic DNA. These primers are then used for PCR screening of somatic cell
hybrids
containing individual human chromosomes. Only those hybrids containing the
human TGF
alpha HIII gene corresponding to the SEQ ID NO:1 will yield an amplified
fragment.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
110
Similarly, somatic hybrids provide a rapid method of PCR mapping the
polynucleotides to particular chromosomes. Three or more clones can be
assigned per day
using a single thermal cycler. Moreover, sublocalization of the TGF alpha HIII
polynucleotides can be achieved with panels of specific chromosome fragments.
Other gene
mapping strategies that can be used include in situ hybridization,
prescreening with labeled
flow-sorted chromosomes, and preselection by hybridization to construct
chromosome
specific-cDNA libraries.
Precise chromosomal location of the TGF alpha HIII polynucleotides can also be
achieved using fluorescence in situ hybridization (FISH) of a metaphase
chromosomal
spread. This technique uses polynucleotides as short as 500 or 600 bases;
however,
polynucleotides 2,000-4,000 by are preferred. For a review of this technique,
see Verma et
al., "Human Chromosomes: a Manual of Basic Techniques," Pergamon Press, New
York
(1988).
For chromosome mapping, the TGF alpha HBI polynucleotides can be used
1 S individually (to mark a single chromosome or a single site on that
chromosome) or in panels
(for marking multiple sites and/or multiple chromosomes). Preferred
polynucleotides
correspond to the noncoding regions of the cDNAs because the coding sequences
are more
likely conserved within gene families, thus increasing the chance of cross
hybridization
during chromosomal mapping.
Once a polynucleotide has been mapped to a precise chromosomal location, the
physical position of the polynucleotide can be used in linkage analysis.
Linkage analysis
establishes coinheritance between a chromosomal location and presentation of a
particular
disease. (Disease mapping data are found, for example, in V. McKusick,
Mendelian
Inheritance in Man (available on line through Johns Hopkins University Welch
Medical
Library) .) Assuming 1 megabase mapping resolution and one gene per 20 kb, a
cDNA
precisely localized to a chromosomal region associated with the disease could
be one of 50-
500 potential causative genes.
Thus, once coinheritance is established, differences in the TGF alpha HI>Z
polynucleotide and the corresponding gene between affected and unaffected
individuals can
be examined. First, visible structural alterations in the chromosomes, such as
deletions or
translocations, are examined in chromosome spreads or by PCR. If no structural
alterations
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
111
exist, the presence of point mutations are ascertained. Mutations observed in
some or all
affected individuals, but not in normal individuals, indicates that the
mutation may cause the
disease. However, complete sequencing of the TGF alpha H)ZI polypeptide and
the
corresponding gene from several normal individuals is required to distinguish
the mutation
from a polymorphism. If a new polymorphism is identified, this polymorphic
polypeptide
can be used for further linkage analysis.
Furthermore, increased or decreased expression of the gene in affected
individuals as
compared to unaffected individuals can be assessed using TGF alpha HIII
polynucleotides.
Any of these alterations (altered expression, chromosomal rearrangement, or
mutation) can be
used as a diagnostic or prognostic marker.
For example, this invention is also related to the use of the gene of the
present
invention as a diagnostic. Detection of a mutated form of the gene of the
present invention
will allow a diagnosis of a disease or a susceptibility to a disease which
results from
underexpression of the polypeptide of the present invention, for example,
improper wound
healing, improper neurological functioning, ocular disorders, kidney and liver
disorders, hair
follicular development, angiogenesis and embryogenesis.
Thus, the invention also provides a diagnostic method useful during diagnosis
of a
disorder, involving measuring the expression level of polynucleotides of the
present invention
in cells or body fluid from an individual and comparing the measured gene
expression level
with a standard level of polynucleotide expression level, whereby an increase
or decrease in
the gene expression level compared to the standard is indicative of a
disorder.
In still another embodiment, the invention includes a kit for analyzing
samples for the
presence of proliferative and/or cancerous polynucleotides derived from a test
subject. In a
general embodiment, the kit includes at least one polynucleotide probe
containing a
nucleotide sequence that will specifically hybridize with a polynucleotide of
the present
invention and a suitable container. In a specific embodiment, the kit includes
two
polynucleotide probes defining an internal region of the polynucleotide of the
present
invention, where each probe has one strand containing a 31'mer-end internal to
the region. In
a further embodiment, the probes may be useful as primers for polymerase chain
reaction
amplification.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
112
Where a diagnosis of a disorder, has already been made according to
conventional
methods, the present invention is useful as a prognostic indicator, whereby
patients exhibiting
enhanced or depressed polynucleotide of the present invention expression will
experience a
worse clinical outcome relative to patients expressing the gene at a level
nearer the standard
level.
By "measuring the expression level of polynucleotide of the present invention"
is
intended qualitatively or quantitatively measuring or estimating the level of
the polypeptide of
the present invention or the level of the mRNA encoding the polypeptide in a
first biological
sample either directly (e.g., by determining or estimating absolute protein
level or mRNA
level) or relatively (e.g., by comparing to the polypeptide level or mRNA
level in a second
biological sample). Preferably, the polypeptide level or mRNA level in the
first biological
sample is measured or estimated and compared to a standard polypeptide level
or mRNA
level, the standard being taken from a second biological sample obtained from
an individual
not having the disorder or being determined by averaging levels from a
population of
individuals not having a disorder. As will be appreciated in the art, once a
standard
polypeptide level or mRNA level is known, it can be used repeatedly as a
standard for
comparison.
By "biological sample" is intended any biological sample obtained from an
individual,
body fluid, cell line, tissue culture, or other source which contains the
polypeptide of the
present invention or mRNA. As indicated, biological samples include body
fluids (such as
semen, lymph, sera, plasma, urine, synovial fluid and spinal fluid) which
contain the
polypeptide of the present invention, and other tissue sources found to
express the
polypeptide of the present invention. Methods for obtaining tissue biopsies
and body fluids
from mammals are well known in the art. Where the biological sample is to
include mRNA,
a tissue biopsy is the preferred source.
The methods) provided above may preferrably be applied in a diagnostic method
and/or kits in which polynucleotides and/or polypeptides are attached to a
solid support. In
one exemplary method, the support may be a "gene chip" or a "biological chip"
as described
in US Patents 5,837,832, 5,874,219, and 5,856,174. Further, such a gene chip
with
polynucleotides of the present invention attached may be used to identify
polymorphisms
between the polynucleotide sequences, with polynucleotides isolated from a
test subject. The
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
113
knowledge of such polymorphisms (i.e. their location, as well as, their
existence) would be
beneficial in identifying disease loci for many disorders, including cancerous
diseases and
conditions. Such a method is described in US Patents 5,858,659 and 5,856,104.
The US
Patents referenced supra are hereby incorporated by reference in their
entirety herein.
The present invention encompasses polynucleotides of the present invention
that are
chemically synthesized, or reproduced as peptide nucleic acids (PNA), or
according to other
methods known in the art. The use of PNAs would serve as the preferred form if
the
polynucleotides are incorporated onto a solid support, or gene chip. For the
purposes of the
present invention, a peptide nucleic acid (PNA) is a polyamide type of DNA
analog and the
monomeric units for adenine, guanine, thymine and cytosine are available
commercially
(Perceptive Biosystems). Certain components of DNA, such as phosphorus,
phosphorus
oxides, or deoxyribose derivatives, are not present in PNAs. As disclosed by
P. E. Nielsen,
M. Egholm, R. H. Berg and O. Buchardt, Science 254, 1497 (1991); and M.
Egholm, O.
Buchardt, L.Christensen, C. Behrens, S. M. Freier, D. A. Driver, R. H. Berg,
S. K. Kim, B.
Norden, and P. E. Nielsen, Nature 365, 666 (1993), PNAs bind specifically and
tightly to
complementary DNA strands and are not degraded by nucleases. In fact, PNA
binds more
strongly to DNA than DNA itself does. This is probably because there is no
electrostatic
repulsion between the two strands, and also the polyamide backbone is more
flexible.
Because of this, PNA/DNA duplexes bind under a wider range of stringency
conditions than
DNA/DNA duplexes, making it easier to perform multiplex hybridization. Smaller
probes can
be used than with DNA due to the strong binding. In addition, it is more
likely that single
base mismatches can be determined with PNA/DNA hybridization because a single
mismatch
in a PNA/DNA 15-mer lowers the melting point (Tm) by 8°-20°
C, vs. 4°-16° C for the
DNA/DNA 15-mer duplex. Also, the absence of charge groups in PNA means that
hybridization can be done at low ionic strengths and reduce possible
interference by salt
during the analysis.
The present invention is useful for detecting cancer in mammals. In particular
the
invention is useful during diagnosis of pathological cell proliferative
neoplasias which
include, but are not limited to: acute myelogenous leukemias including acute
monocytic
leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute
myelomonocytic
leukemia, acute erythroleukemia, acute megakaryocytic leukemia, and acute
undifferentiated
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
114
leukemia, etc.; and chronic myelogenous leukemias including chronic
myelomonocytic
leukemia, chronic granulocytic leukemia, etc. Preferred mammals include
monkeys, apes,
cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are
humans.
Pathological cell proliferative disorders are often associated with
inappropriate
activation of proto-oncogenes. (Gelmann, E. P. et al., "The Etiology of Acute
Leukemia:
Molecular Genetics and Viral Oncology," in Neoplastic Diseases of the Blood,
Vol 1.,
Wiernik, P. H. et al. eds., 161-182 (1985)). Neoplasias are now believed to
result from the
qualitative alteration of a normal cellular gene product, or from the
quantitative modification
of gene expression by insertion into the chromosome of a viral sequence, by
chromosomal
translocation of a gene to a more actively transcribed region, or by some
other mechanism.
(Gelmann et al., supra) It is likely that mutated or altered expression of
specific genes is
involved in the pathogenesis of some leukemias, among other tissues and cell
types.
(Gelmann et al., supra) Indeed, the human counterparts of the oncogenes
involved in some
animal neoplasias have been amplified or translocated in some cases of human
leukemia and
carcinoma. (Gelmann et al., supra)
For example, c-myc expression is highly amplified in the non-lymphocytic
leukemia
cell line HL-60. When HL-60 cells are chemically induced to stop
proliferation, the level of
c-myc is found to be downregulated. (International Publication Number WO
91/15580)
However, it has been shown that exposure of HL-60 cells to a DNA construct
that is
complementary to the 5' end of c-myc or c-myb blocks translation of the
corresponding
mRNAs which downregulates expression of the c-myc or c-myb proteins and causes
arrest
of cell proliferation and differentiation of the treated cells. (International
Publication
Number WO 91/15580; Wickstrom et al., Proc. Natl. Acad. Sci. 85:1028 (1988);
Anfossi et '
al., Proc. Natl. Acad. Sci. 86:3379 (1989)). However, the skilled artisan
would appreciate
the present invention's usefulness would not be limited to treatment of
proliferative
disorders of hematopoietic cells and tissues, in light of the numerous cells
and cell types of
varying origins which are known to exhibit proliferative phenotypes.
In addition to the foregoing, a TGF alpha HIII polynucleotide can be used to
control
gene expression through triple helix formation or antisense DNA or RNA.
Antisense
techniques are discussed, for example, in Okano, J. Neurochem. 56: 560 (1991);
"Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,CRC Press,
Boca Raton,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
115
FL (1988). Triple helix formation is discussed in, for instance Lee et al.,
Nucleic Acids
Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et
al., Science
251: 1360 (1991). Both methods rely on binding of the polynucleotide to a
complementary
DNA or RNA. For these techniques, preferred polynucleotides are usually
oligonucleotides
20 to 40 bases in length and complementary to either the region of the gene
involved in
transcription (triple helix - see Lee et al., Nucl. Acids Res. 6:3073 (1979);
Cooney et al.,
Science 241:456 (1988); and Dervan et al., Science 251:1360 (1991) ) or to the
mRNA itself
(antisense - Okano, J. Neurochem. 56:560 (1991); Oligodeoxy-nucleotides as
Antisense
Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).) Triple helix
formation
optimally results in a shut-off of RNA transcription from DNA, while antisense
RNA
hybridization blocks translation of an mRNA molecule into polypeptide. Both
techniques are
effective in model systems, and the information disclosed herein can be used
to design
antisense or triple helix polynucleotides in an effort to treat disease.
TGF alpha HIII polynucleotides are also useful in gene therapy. One goal of
gene
therapy is to insert a normal gene into an organism having a defective gene,
in an effort to
correct the genetic defect. TGF alpha HIII offers a means of targeting such
genetic defects in
a highly accurate manner. Another goal is to insert a new gene that was not
present in the
host genome, thereby producing a new trait in the host cell.
The TGF alpha HIII polynucleotides are also useful for identifying individuals
from
minute biological samples. The United States military, for example, is
considering the use of
restriction fragment length polymorphism (RFLP) for identification of its
personnel. In this
technique, an individual's genomic DNA is digested with one or more
restriction enzymes,
and probed on a Southern blot to yield unique bands for identifying personnel.
This method
does not suffer from the current limitations of "Dog Tags" which can be lost,
switched, or
stolen, making positive identification difficult. The TGF alpha HIII
polynucleotides can be
used as additional DNA markers for RFLP.
The TGF alpha HIII polynucleotides can also be used as an alternative to RFLP,
by
determining the actual base-by-base DNA sequence of selected portions of an
individual's
genome. These sequences can be used to prepare PCR primers for amplifying and
isolating
such selected DNA, which can then be sequenced. Using this technique,
individuals can be
identified because each individual will have a unique set of DNA sequences.
Once an unique
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
116
ID database is established for an individual, positive identification of that
individual, living or
dead, can be made from extremely small tissue samples.
Forensic biology also benefits from using DNA-based identification techniques
as
disclosed herein. DNA sequences taken from very small biological samples such
as tissues,
e.g., hair or skin, or body fluids, e.g., blood, saliva, semen, synovial
fluid, amniotic fluid,
breast milk, lymph, pulmonary sputum or surfactant, urine,fecal matter, etc.,
can be amplified
using PCR. In one prior art technique, gene sequences amplified from
polymorphic loci, such
as DQa class II HLA gene, are used in forensic biology to identify
individuals. (Erlich, H.,
PCR Technology, Freeman and Co. (1992).) Once these specific polymorphic loci
are
amplified, they are digested with one or more restriction enzymes, yielding an
identifying set
of bands on a Southern blot probed with DNA corresponding to the DQa class II
HLA gene.
Similarly, TGF alpha HIII polynucleotides can be used as polymorphic markers
for forensic
purposes.
There is also a need for reagents capable of identifying the source of a
particular
tissue. Such need arises, for example, in forensics when presented with tissue
of unknown
origin. Appropriate reagents can comprise, for example, DNA probes or primers
specific to
particular tissue prepared from TGF alpha HIII sequences. Panels of such
reagents can
identify tissue by species and/or by organ type. In a similar fashion, these
reagents can be
used to screen tissue cultures for contamination.
TGF alpha HIII polynucleotides are useful as hybridization probes for
differential
identification of the tissues) or cell types) present in a biological sample.
Similarly,
polypeptides and antibodies directed to TGF alpha HIII polypeptides are useful
to provide
immunological probes for differential identification of the tissues) or cell
type(s). In
addition, for a number of disorders of the above tissues or cells,
significantly higher or lower
levels of TGF alpha HIII gene expression may be detected in certain tissues
(e.g., cancerous
and wounded tissues) or bodily fluids (e.g., serum, plasma, urine, synovial
fluid or spinal
fluid) taken from an individual having such a disorder, relative to a
"standard" TGF alpha
HIII gene expression level, i.e., the TGF alpha HIII expression level in
healthy tissue from an
individual not having the disorder.
Thus, the invention provides a diagnostic method of a disorder, which
involves: (a)
assaying TGF alpha HIII gene expression level in cells or body fluid of an
individual; (b)
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
117
comparing the TGF alpha HIII gene expression level with a standard TGF alpha
H)ZI gene
expression level, whereby an increase or decrease in the assayed TGF alpha
HIII gene
expression level compared to the standard expression level is indicative of
disorder.
The present invention also relates to diagnostic assays for detecting altered
levels of
the polypeptide of the present invention in various tissues since an
overexpression of the
proteins compared to normal control tissue samples can detect the presence of
certain disease
conditions such as neoplasia, skin disorders, ocular disorders and
inflammation. Assays used
to detect levels of the polypeptide of the present invention in a sample
derived from a host
are well-known to those of skill in the art and include radioimmunoassays,
competitive-binding assays, Western Blot analysis and preferably an ELISA
assay. An
ELISA assay initially comprises preparing an antibody specific to an antigen
of the
polypeptide of the present invention, preferably a monoclonal antibody. In
addition a reporter
antibody is prepared against the monoclonal antibody. To the reporter antibody
is attached a
detectable reagent such as radioactivity, fluorescence or in this example a
horseradish
1 S peroxidase enzyme. A sample is now removed from a host and incubated on a
solid support,
e.g. a polystyrene dish, that binds the proteins in the sample. Any free
protein binding sites
on the dish are then covered by incubating with a non-specific protein such as
bovine serum
albumin. Next, the monoclonal antibody is incubated in the dish during which
time the
monoclonal antibodies attach to any polypeptides of the present invention
attached to the
polystyrene dish. All unbound monoclonal antibody is washed out with buffer.
The reporter
antibody linked to horseradish peroxidase is now placed in the dish resulting
in binding of
the reporter antibody to any monoclonal antibody bound to polypeptides of the
present
invention. Unattached reporter antibody is then washed out. Peroxidase
substrates are then
added to the dish and the amount of color developed in a given time period is
a measurement
of the amount of protein present in a given volume of patient sample when
compared against
a standard curve.
A competition assay may also be employed to determine levels of the
polypeptide of
the present invention in a sample derived from the hosts. Such an assay
comprises isolating
plasma membranes which over-express the receptor for the polypeptide of the
present
invention. A test sample containing the polypeptides of the present invention
which have
been labeled, are then added to the plasma membranes and then incubated for a
set period of
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
118
time. Also added to the reaction mixture is a sample derived from a host which
is suspected
of containing the polypeptide of the present invention. The reaction mixtures
are then passed
through a filter which is rapidly washed and the bound radioactivity is then
measured to
determine the amount of competition for the receptors and therefore the amount
of the
polypeptides of the present invention in the sample.
In the very least, the TGF alpha HI1I polynucleotides can be used as molecular
weight
markers on Southern gels, as diagnostic probes for the presence of a specific
mRNA in a
particular cell type, as a probe to "subtract-out" known sequences in the
process of
discovering novel polynucleotides, for selecting and making oligomers for
attachment to a
"gene chip" or other support, to raise anti-DNA antibodies using DNA
immunization
techniques, and as an antigen to elicit an immune response.
Uses of TGF alpha HIII Polypeptides
TGF alpha HIII polypeptides can be used in numerous ways. The following
1 S description should be considered exemplary and utilizes known techniques.
TGF alpha HIII polypeptides can be used to assay protein levels in a
biological sample
using antibody-based techniques. For example, protein expression in tissues
can be studied
with classical immunohistological methods. (Jalkanen, M., et al., J. Cell.
Biol. 101:976-985
(1985); Jalkanen, M., et al., J. Cell . Biol. 105:3087-3096 (1987).) Other
antibody-based
methods useful for detecting protein gene expression include immunoassays,
such as the
enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
Suitable
antibody assay labels are known in the art and include enzyme labels, such as,
glucose
oxidase, and radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur
(35S), tritium
(3H), indium (112In), and technetium (99mTc), and fluorescent labels, such as
fluorescein
and rhodamine, and biotin.
In addition to assaying protein levels in a biological sample, proteins can
also be
detected in vivo by imaging. Antibody labels or markers for in vivo imaging of
protein
include those detectable by X-radiography, NMR or ESR. For X-radiography,
suitable labels
include radioisotopes such as barium or cesium, which emit detectable
radiation but are not
overtly harmful to the subject. Suitable markers for NMR and ESR include those
with a
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
119
detectable characteristic spin, such as deuterium, which may be incorporated
into the
antibody by labeling of nutrients for the relevant hybridoma.
A protein-specific antibody or antibody fragment which has been labeled with
an
appropriate detectable imaging moiety, such as a radioisotope (for example,
131I, 112In,
99mTc), a radio-opaque substance, or a material detectable by nuclear magnetic
resonance, is
introduced (for example, parenterally, subcutaneously, or intraperitoneally)
into the mammal.
It will be understood in the art that the size of the subject and the imaging
system used will
determine the quantity of imaging moiety needed to produce diagnostic images.
In the case
of a radioisotope moiety, for a human subject, the quantity of radioactivity
injected will
normally range from about 5 to 20 millicuries of 99mTc. The labeled antibody
or antibody
fragment will then preferentially accumulate at the location of cells which
contain the specific
protein. In vivo tumor imaging is described in S.W. Burchiel et al.,
"Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments."
(Chapter 13 in
Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A.
Rhodes,
eds., Masson Publishing Inc. (1982).)
Thus, the invention provides a diagnostic method of a disorder, which involves
(a)
assaying the expression of TGF alpha HIII polypeptide in cells or body fluid
of an individual;
(b) comparing the level of gene expression with a standard gene expression
level, whereby an
increase or decrease in the assayed TGF alpha HIII polypeptide gene expression
level
compared to the standard expression level is indicative of a disorder. With
respect to cancer,
the presence of a relatively high amount of transcript in biopsied tissue from
an individual
may indicate a predisposition for the development of the disease, or may
provide a means for
detecting the disease prior to the appearance of actual clinical symptoms. A
more definitive
diagnosis of this type may allow health professionals to employ preventative
measures or
. aggressive treatment earlier thereby preventing the development or further
progression of the
cancer.
Moreover, TGF alpha HIII polypeptides can be used to treat disease. For
example,
patients can be administered TGF alpha HIII polypeptides in an effort to
replace absent or
decreased levels of the TGF alpha HIII polypeptide (e.g., insulin), to
supplement absent or
decreased levels of a different polypeptide (e.g., hemoglobin S for hemoglobin
B, SOD,
catalase, DNA repair proteins), to inhibit the activity of a polypeptide
(e.g., an oncogene or
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
120
tumor supressor), to activate the activity of a polypeptide (e.g., by binding
to a receptor), to
reduce the activity of a membrane bound receptor by competing with it for free
ligand (e.g.,
soluble TNF receptors used in reducing inflammation), or to bring about a
desired response
(e.g., blood vessel growth inhibition, enhancement of the immune response to
proliferative
S cells or tissues).
Similarly, antibodies directed to TGF alpha HIII polypeptides can also be used
to treat
disease. For example, administration of an antibody directed to a TGF alpha
HIII polypeptide
can bind and reduce overproduction of the polypeptide. Similarly,
administration of an
antibody can activate the polypeptide, such as by binding to a polypeptide
bound to a
membrane (receptor).
At the very least, the TGF alpha HIII polypeptides can be used as molecular
weight
markers on SDS-PAGE gels or on molecular sieve gel filtration columns using
methods well
known to those of skill in the art. TGF alpha HIII polypeptides can also be
used to raise
antibodies, which in turn are used to measure protein expression from a
recombinant cell, as a
way of assessing transformation of the host cell. Moreover, TGF alpha HIII
polypeptides can
be used to test the following biological activities.
The polypeptide of the present invention may also be employed for
characterization
of receptors. The EGF family receptors currently includes four EGF receptors,
denoted as
EGFR1, EGFR2, EGFR3 and EGFR4. The EGFR2 receptor may also be referred to as
Erb-2
and this molecule is useful for a variety of diagnostic and therapeutic
indications (Prigent,
S.A., and Lemoine, N.R., Prog. Growth Factor Res., 4:1-24 (1992)). The TGF
alpha HIII
polypeptide is likely a ligand for one or more of these receptors as well as
for a new EGF
type receptor. Use of the TGF alpha HIII can assist with the identification,
characterization
and cloning of such receptors. For example, the EGF receptor gene represents
the cellular
homolog of the v-erb-B oncogene of avian erythroblastosis virus.
Overexpression of the EGF
receptor or deletion of kinase regulatory segments of the protein can bring
about tumorigenic
transformation of cells (Manjusri, D. et al., Human Cyokines, 364 and 381
(1991)) .
The polypeptides of the present invention may also be employed for restoration
or
enhancement of neurological functions diminished as a result of trauma or
other damaging
pathologies (such as AIDS dementia, senile dementia, etc) . TGF alpha and its
homologs
have been found to be the most abundant ligand for the EGF/TGF alpha receptor
in most
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
121
parts of the brain (Kaser, et al., Mol. Brain Res., 16:316-322, (1992)) .
There appears to be a
widespread distribution of TGF alpha in various regions of the brain in
contrast to EGF
which is only present in smaller, more discrete areas, suggesting that TGF-
alpha might play a
physiological role in brain tissues. These numerous receptor sites for TGF
alpha in the brain
suggest that TGF has an important utility in promoting normal brain cell
differentiation and
function. Accordingly, in instances where neurological functioning is
diminished, an
administration of the polypeptide of the present invention may stimulate the
brain and
enhance proper physiological functions.
TGF alpha HIII or soluble form thereof may also, be employed to treat ocular
disorders, for example, corneal inflammation. A variety of experiments have
implicated
members of the TGF alpha gene family in such pathologies. A recent paper
summarizes
some of the data related to the role these growth factors play in eye disease
(Mann, et al Cell
73:249-261 (1993)). Recent experiments have shown that a number of mice
lacking the TGF
alpha gene displayed corneal inflammation due to an infiltration of leukocytes
and other cells
to the substantia propria of the eyes. In addition, the specificity of the TGF
alpha growth
factors for their target cells can be exploited as a mechanism to destroy the
target cell. For
example, TGF alpha HIII or soluble forms thereof can be coupled (by a wide
variety of
methods) to toxic molecules: for example, a radiopharmaceutical which
inactivates target
cells. These growth factor-toxin fusions kill the target cell (and in certain
cases neighboring
cells by a variety of "bystander" effects). A recent example of such toxin-
fusion genes is
published by Mesri, et al., J. Biol. Chem. 268:4853-62 (1993). TGF alpha HIII
and related
molecules may also be encapsulated in liposomes and may be conjugated to
antibodies which
recognize and bind to tumor or cell specific antigens, thereby provided a
means for
"targeting" cells.
In this same manner, TGF alpha HIII can be employed as an anti-neoplastic
compound, since members of the EGF family show anti-proliferative effects on
transformed
cells. For in vivo use, the subject polypeptide may be administered in a
variety of ways,
including but not limited to, injection, infusion, topically, parenterally,
etc. Administration
may be in any physiologically acceptable carrier, including phosphate buffered
saline, saline,
sterilized water, etc. The TGF alpha HIII polypeptide fragment may also be
employed to treat
certain kidney disorders, since it has been found that there has been
expression of these
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
122
growth factors in the kidney. Thus, these factors may be necessary for the
proper
physiological maintenance of this organ.
Treatments may also be related to liver regeneration or liver dysfunction,
since TGF
alpha and its homologs and hepatocyte growth factor trigger hepatocyte
regeneration after
partial hepatectomy and after acute liver cell necrosis (Masuhara, M. et al,
Hepatology
16:1241-1249 (1992)).
A significant treatment involving TGF alpha HIII relates to wound healing. The
compositions of the present invention may be employed for treating a wide
variety of wounds
including substantially all cutaneous wounds, corneal wounds, and injuries to
the
epithelial-lined hollow organs of the body. Wounds suitable for treatment
include those
resulting from trauma such as burns, abrasions and cuts, as well as from
surgical procedures
such as surgical incisions and skin grafting Other conditions suitable for
treatment with the
polypeptide of the present invention include chronic conditions, such as
chronic ulcers,
diabetic ulcers, and other non-healing (trophic) conditions.
TGF alpha HIII or soluble fragment thereof may be incorporated in
physiologically-acceptable carriers for application to the affected area. The
nature of the
carriers may, vary widely and will depend on the intended location of
application. For
application to the skin, a cream or ointment base is usually preferred;
suitable bases include
lanolin, Silvadene (Marion) (particularly for the treatment of burns),
Aquaphor (Duke
Laboratories, South Norwalk, Conn.), and the like. If desired, it will be
possible to
incorporate TGF alpha HIII containing compositions in bandages and other wound
dressings
to provide for continuous exposure of the wound to the peptide. Aerosol
applications may
also find use.
The concentration of TGF alpha HIII in the treatment composition is not
critical but
should be enough to induce epithelial cell proliferation. The compositions may
be applied
topically to the affected area, typically as eye drops to the eye or as
creams, ointments or
lotions to the skin. In the case of the eyes, frequent treatment is desirable,
usually being
applied at intervals of 4 hours or less. On the skin, it is desirable to
continually maintain the
treatment composition on the affected area during the healing, with
applications of the
treatment composition from two to four times a day or more frequently.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
123
The amount employed of the subject polypeptide will vary with the manner of
administration, the employment of other active compounds, and the like,
generally being in
the range of about lug to 100 ug. The subject polypeptide may be employed with
a
physiologically acceptable carrier, such as saline, phosphate-buffered saline,
or the like. The
amount of compound employed will be determined empirically, based on the
response of
cells in vitro and response of experimental animals to the subject
polypeptides or
formulations containing the subject polypeptides.
The TGF alpha HIII or soluble fragment thereof may be employed in the
modulation
of angiogenesis, bone resorption, immune response, and synaptic and neuronal
effector
functions. TGF alpha HIII may also be used in the modulation of the
arachidonic acid
cascade.
TGF alpha H>ZI or soluble fragment thereof may also be employed for
applications
related to terminal differentiation. Many TGF alpha factors, and their
homologs, induce
terminal differentiation in their target cells. This property can be exploited
in vivo by
administering the factor and inducing target cell death. This regimen is under
consideration
for disorders related to the hyperproliferation of medically undesirable cell
types such as
cancers and other proliferative disorders (eg inflammation, psoriasis, etc) In
addition to in
vivo administration, there are a variety of situations where in vitro
administration may be
warranted. For example, bone marrow can be purged of undesirable cell
populations in vitro
by treating the cells with growth factors and/or derivatives thereof.
Applications are also related to alopecia, hair loss and to other skin
conditions which
affect hair follicular development. Several lines of evidence implicate the
involvement TGF
alpha growth factors in such conditions. As described above, "knockout" mice
engineered to
contain a null mutation in the TGF alpha gene display abnormalities related to
quantitative
and qualitative hair synthesis. In addition, mapping studies in mice have
shown that some
mutations affecting hair growth map to the TGF alpha gene locus (Mann et al,
Cell
73:249-261 (1993) ) . Topical or systemic applications of TGF alpha HIII or
derivatives
thereof may be employed to treat some forms of alopecia and hair loss and
these claims f all
within the scope of this invention.
Certain disease pathologies may be partially or completely ameliorated by the
systemic
clinical administration of the TGF alpha HIII growth factor. This
administration can be in the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
124
form of gene therapy (see below) or through the administration of peptides or
proteins
synthesized from recombinant constructs of TGF alphaHIII DNA or from peptide
chemical
synthesis (Woo, et al., Protein Engineering 3:29-37 (1989).
S Gene Therapy Methods
Another aspect of the present invention is to gene therapy methods for
treating
disorders, diseases and conditions. The gene therapy methods relate to the
introduction of
nucleic acid (DNA, RNA and antisense DNA or RNA) sequences into an animal to
achieve
expression of the TGF alpha HIII polypeptide of the present invention. This
method requires
a polynucleotide which codes for a TGF alpha HIII polypeptide operatively
linked to a
promoter and any other genetic elements necessary for the expression of the
polypeptide by
the target tissue. Such gene therapy and delivery techniques are known in the
art, see, for
example, W090/11092, which is herein incorporated by reference.
Thus, for example, cells from a patient may be engineered with a
polynucleotide
(DNA or RNA) comprising a promoter operably linked to a TGF alpha HIII
polynucleotide ex
vivo, with the engineered cells then being provided to a patient to be treated
with the
polypeptide. Such methods are well-known in the art. For example, see
Belldegrun, A., et
al., J. Natl. Cancer lnst. 85: 207-216 (1993); Ferrantini, M. et al., Cancer
Research 53: 1107-
1112 (1993); Ferrantini, M. et al., J. Immunology 153: 4604-4615 (1994);
Kaido, T., et al.,
Int. J. Cancer 60: 221-229 (1995); Ogura, H., et al., Cancer Research S0: 5102-
5106 (1990);
Santodonato, L., et al., Human Gene Therapy 7:1-10 (1996); Santodonato, L., et
al., Gene
Therapy 4:1246-1255 (1997); and Zhang, J.-F. et al., Cancer Gene Therapy 3: 31-
38 (1996)),
which are herein incorporated by reference. In one embodiment, the cells which
are
engineered are arterial cells. The arterial cells may be reintroduced into the
patient through
direct injection to the artery, the tissues surrounding the artery, or through
catheter injection.
The polypeptides, and agonists and antagonists which are polypeptides, may
also be
employed in accordance with the present invention by expression of such
polypeptides in
vivo, which is often referred to as "gene therapy."
Thus, for example, cells from a patient may be engineered with a
polynucleotide
(DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then
being
provided to a patient to be treated with the polypeptide.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
125
Such methods are well-known in the art and are apparent from the teachings
herein.
For example, cells may be engineered by the use of a retroviral plasmid vector
containing
RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo for expression of a polypeptide in
vivo by,
for example, procedures known in the art. For example, a packaging cell is
transduced with a
retroviral plasmid vector containing RNA encoding a polypeptide of the present
invention
such that the packaging cell now produces infectious viral particles
containing the gene of
interest. These producer cells may be administered to a patient for
engineering cells in vivo
and expression of the polypeptide in vivo.
These and other methods for administering a polypeptide of the present
invention by
such method should be apparent to those skilled in the art from the teachings
of the present
invention.
Retroviruses from which the retroviral plasmid vectors hereinabove mentioned
may
be derived include, but are not limited to, Moloney Murine Leukemia Virus,
spleen necrosis
virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian
leukosis virus,
gibbon ape leukemia virus, human immunodeficiency virus, adenovirus,
Myeloproliferative
Sarcoma Virus, and mammary tumor virus. In one embodiment, the retroviral
plasmid vector
is derived from Moloney Murine Leukemia Virus.
The vector includes one or more promoters. Suitable promoters which may be
employed include, but are not limited to, the retroviral LTR; the SV40
promoter; and the
human cytomegalovirus (CMV) promoter described in Miller, et al.,
Biotechniques Vol. 7,
No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as
eukaryotic
cellular promoters including, but not limited to, the histone, pol III, and
beta-actin
promoters). Other viral promoters which may be employed include, but are not
limited to,
adenovirus promoters, thymidine kinase (TK) promoters, and B 19 parvovirus
promoters. The
selection of a suitable promoter will be apparent to those skilled in the art
from the teachings
contained herein.
The nucleic acid sequence encoding the polypeptide of the present invention is
under
the control of a suitable promoter. Suitable promoters which may be employed
include, but
are not limited to, adenoviral promoters, such as the adenoviral major late
promoter; or
heterologous promoters such as the cytomegalovirus (CMV) promoter; the
respiratory
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
126
syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter,
the
metallothionein promoter; heat shock promoters; the albumin promoter; the
ApoAI
promoter; human globin promoters; viral thymidine kinase promoters, such as
the Herpes
Simplex thymidine kinase promoter; retroviral LTRs (including the modified
retroviral LTRs
hereinabove described); the beta-actin promoter; and human growth hormone
promoters. The
promoter also may be the native promoter which controls the gene encoding the
polypeptide.
The retroviral plasmid vector is employed to transduce packaging cell lines to
form
producer cell lines. Examples of packaging cells which may be transfected
include, but are
not limited to, the PE501, PA317, psi-2, psi-AM, PA12, T19-14X, VT-19-17--H2,
psi-CRE,
psi-CRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller,
Human Gene
Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference
in its entirety.
The vector may transduce the packaging cells through any means known in the
art. Such
means include, but are not limited to, electroporation, the use of liposomes,
and
CaP04 precipitation. In one alternative, the retroviral plasmid vector may be
encapsulated
into a liposome, or coupled to a lipid, and then administered to a host.
The producer cell line generates infectious retroviral vector particles which
include
the nucleic acid sequence (s) encoding the polypeptides. Such retroviral
vector particles then
may be employed, to transduce eukaryotic cells, either in vitro or in vivo.
The transduced
eukaryotic cells will express the nucleic acid sequences) encoding the
polypeptide.
Eukaryotic cells which may be transduced include, but are not limited to,
embryonic stem
cells, embryonic carcinoma cells, as well as hematopoietic stem cells,
hepatocytes,
fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial
epithelial cells.
As discussed in more detail below, the TGF alpha HIII polynucleotide
constructs can
be delivered by any method that delivers injectable materials to the cells of
an animal, such
as, injection into the interstitial space of tissues (heart, muscle, skin,
lung, liver, and the like).
The TGF alpha HIII polynucleotide constructs may be delivered in a
pharmaceutically
acceptable liquid or aqueous Garner.
In one embodiment, the TGF alpha HIII polynucleotide is delivered as a naked
polynucleotide. The term "naked" polynucleotide, DNA or RNA refers to
sequences that are
free from any delivery vehicle that acts to assist, promote or facilitate
entry into the cell,
including viral sequences, viral particles, liposome formulations, lipofectin
or precipitating
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
127
agents and the like. However, the TGF alpha HIII polynucleotides can also be
delivered in
liposome formulations and lipofectin formulations and the like can be prepared
by methods
well known to those skilled in the art. Such methods are described, for
example, in U.S.
Patent Nos. 5,593,972, 5,589,466, and 5,580,859, which are herein incorporated
by reference.
The TGF alpha HIIIpolynucleotide vector constructs used in the gene therapy
method
are preferably constructs that will not integrate into the host genome nor
will they contain
sequences that allow for replication. Appropriate vectors include pWLNEO,
pSV2CAT,
pOG44, pXTI and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL
available from Pharmacia; and pEFI/V5, pcDNA3.1, and pRc/CMV2 available from
Invitrogen. Other suitable vectors will be readily apparent to the skilled
artisan.
Any strong promoter known to those skilled in the art can be used for driving
the
expression of TGF alpha H>ZI polynucleotide sequence. Suitable promoters
include
adenoviral promoters, such as the adenoviral major late promoter; or
heterologous promoters,
such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus
(RSV)
promoter; inducible promoters, such as the MMT promoter, the metallothionein
promoter;
heat shock promoters; the albumin promoter; the ApoAI promoter; human globin
promoters;
viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase
promoter;
retroviral LTRs; the b-actin promoter; and human growth hormone promoters. The
promoter
also may be the native promoter for TGF alpha HIII.
Unlike other gene therapy techniques, one major advantage of introducing naked
nucleic acid sequences into target cells is the transitory nature of the
polynucleotide synthesis
in the cells. Studies have shown that non-replicating DNA sequences can be
introduced into
cells to provide production of the desired polypeptide for periods of up to
six months.
The TGF alpha HIII polynucleotide construct can be delivered to the
interstitial space
of tissues within the an animal, including of muscle, skin, brain, lung,
liver, spleen, bone
marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall
bladder, stomach,
intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, and
connective tissue.
Interstitial space of the tissues comprises the intercellular, fluid,
mucopolysaccharide matrix
among the reticular fibers of organ tissues, elastic fibers in the walls of
vessels or chambers,
collagen fibers of fibrous tissues, or that same matrix within connective
tissue ensheathing
muscle cells or in the lacunae of bone. It is similarly the space occupied by
the plasma of the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
128
circulation and the lymph fluid of the lymphatic channels. Delivery to the
interstitial space of
muscle tissue is preferred for the reasons discussed below. They may be
conveniently
delivered by injection into the tissues comprising these cells. They are
preferably delivered to
and expressed in persistent, non-dividing cells which are differentiated,
although delivery and
S expression may be achieved in non-differentiated or less completely
differentiated cells, such
as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells
are particularly
competent in their ability to take up and express polynucleotides.
For the naked nucleic acid sequence injection, an effective dosage amount of
DNA or
RNA will be in the range of from about 0.05 mg/kg body weight to about SO
mg/kg body
weight. Preferably the dosage will be from about 0.005 mg/kg to about 20 mg/kg
and more
preferably from about 0.05 mg/kg to about S mg/kg. Of course, as the artisan
of ordinary skill
will appreciate, this dosage will vary according to the tissue site of
injection. The appropriate
and effective dosage of nucleic acid sequence can readily be determined by
those of ordinary
skill in the art and may depend on the condition being treated and the route
of administration.
The preferred route of administration is by the parenteral route of injection
into the
interstitial space of tissues. However, other parenteral routes may also be
used, such as,
inhalation of an aerosol formulation particularly for delivery to lungs or
bronchial tissues,
throat or mucous membranes of the nose. In addition, naked TGF alpha HIII DNA
constructs
can be delivered to arteries during angioplasty by the catheter used in the
procedure.
The naked polynucleotides are delivered by any method known in the art,
including,
but not limited to, direct needle injection at the delivery site, intravenous
injection, topical
administration, catheter infusion, and so-called "gene guns". These delivery
methods are
known in the art.
The constructs may also be delivered with delivery vehicles such as viral
sequences,
viral particles, liposome formulations, lipofectin, precipitating agents, etc.
Such methods of
delivery are known in the art.
In certain embodiments, the TGF alpha HIII polynucleotide constructs are
complexed
in a liposome preparation. Liposomal preparations for use in the instant
invention include
cationic (positively charged), anionic (negatively charged) and neutral
preparations. However,
cationic liposomes are particularly preferred because a tight charge complex
can be formed
between the cationic liposome and the polyanionic nucleic acid. Cationic
liposomes have
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
129
been shown to mediate intracellular delivery of plasmid DNA (Felgner et al.,
Proc. Natl.
Acad. Sci. USA (1987) 84:7413-7416, which is herein incorporated by
reference); mRNA
(Malone et al., Proc. Natl. Acad. Sci. USA (1989) 86:6077-6081, which is
herein
incorporated by reference); and purified transcription factors (Debs et al.,
J. Biol. Chem.
(1990) 265:10189-10192, which is herein incorporated by reference), in
functional form.
Cationic liposomes are readily available. For example,
N[1-2,3-dioleyloxy)propyl~-N,N,N-triethylammonium (DOTMA) liposomes are
particularly
useful and are available under the trademark Lipofectin, from GIBCO BRL, Grand
Island,
N.Y. (See, also, Felgner et al., Proc. Natl Acad. Sci. USA (1987) 84:7413-
7416, which is
herein incorporated by reference). Other commercially available liposomes
include
transfectace (DDAB/DOPE) and DOTAP/DOPE (Boehringer).
Other cationic liposomes can be prepared from readily available materials
using
techniques well known in the art. See, e.g. PCT Publication No. WO 90/11092
(which is
herein incorporated by reference) for a description of the synthesis of DOTAP
(1,2-
bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes. Preparation of DOTMA
liposomes
is explained in the literature, see, e.g., P. Felgner et al., Proc. Natl.
Acad. Sci. USA
84:7413-7417, which is herein incorporated by reference. Similar methods can
be used to
prepare liposomes from other cationic lipid materials.
Similarly, anionic and neutral liposomes are readily available, such as from
Avanti
Polar Lipids (Birmingham, Ala.), or can be easily prepared using readily
available materials.
Such materials include phosphatidyl, choline, cholesterol, phosphatidyl
ethanolamine,
dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG),
dioleoylphoshatidyl ethanolamine (DOPE), among others. These materials can
also be mixed
with the DOTMA and DOTAP starting materials in appropriate ratios. Methods for
making
liposomes using these materials are well known in the art.
For example, commercially dioleoylphosphatidyl choline (DOPC),
dioleoylphosphatidyl glycerol (DOPG), and dioleoylphosphatidyl ethanolamine
(DOPE) can
be used in various combinations to make conventional liposomes, with or
without the
addition of cholesterol. Thus, for example, DOPG/DOPC vesicles can be prepared
by drying
50 mg each of DOPG and DOPC under a stream of nitrogen gas into a sonication
vial. The
sample is placed under a vacuum pump overnight and is hydrated the following
day with
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
130
deionized water. The sample is then sonicated for 2 hours in a capped vial,
using a Heat
Systems model 350 sonicator equipped with an inverted cup (bath type) probe at
the
maximum setting while the bath is circulated at 15EC. Alternatively,
negatively charged
vesicles can be prepared without sonication to produce multilamellar vesicles
or by extrusion
through nucleopore membranes to produce unilamellar vesicles of discrete size.
Other
methods are known and available to those of skill in the art.
The liposomes can comprise multilamellar vesicles (MLVs), small unilamellar
vesicles (SUVs), or large unilamellar vesicles (LUVs), with SUVs being
preferred. The
various liposome-nucleic acid complexes are prepared using methods well known
in the art.
See, e.g., Straubinger et al., Methods of Immunology (1983), 101:512-527,
which is herein
incorporated by reference. For example, MLVs containing nucleic acid can be
prepared by
depositing a thin film of phospholipid on the walls of a glass tube and
subsequently hydrating
with a solution of the material to be encapsulated. SUVs are prepared by
extended sonication
of MLVs to produce a homogeneous population of unilamellar liposomes. The
material to be
entrapped is added to a suspension of preformed MLVs and then sonicated. When
using
liposomes containing cationic lipids, the dried lipid film is resuspended iri
an appropriate
solution such as sterile water or an isotonic buffer solution such as 10 mM
Tris/NaCI,
sonicated, and then the preformed liposomes are mixed directly with the DNA.
The liposome
and DNA form a very stable complex due to binding of the positively charged
liposomes to
the cationic DNA. SUVs fmd use with small nucleic acid fragments. LUVs are
prepared by a
number of methods, well known in the art. Commonly used methods include Caz+-
EDTA
chelation (Papahadjopoulos et al., Biochim. Biophys. Acta (1975) 394:483;
Wilson et al.,
Cell (1979) 17:77); ether injection (Deamer, D. and Bangham, A., Biochim.
Biophys. Acta
(1976) 443:629; Ostro et al., Biochem. Biophys. Res. Commun. (1977) 76:836;
Fraley et al.,
Proc. Natl. Acad. Sci. USA (1979) 76:3348); detergent dialysis (Enoch, H. and
Strittmatter,
P., Proc. Natl. Acad. Sci. USA (1979) 76:145); and reverse-phase evaporation
(REV) (Fraley
et al., J. Biol. Chem. (1980) 255:10431; Szoka, F. and Papahadjopoulos, D.,
Proc. Natl. Acad.
Sci. USA (1978) 75:145; Schaefer-Ridder et al., Science (1982) 215:166), which
are herein
incorporated by reference.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
131
Generally, the ratio of DNA to liposomes will be from about 10:1 to about
1:10.
Preferably, the ration will be from about 5:1 to about 1:5. More preferably,
the ration will be
about 3:1 to about 1:3. Still more preferably, the ratio will be about 1:1.
U.5. Patent No. 5,676,954 (which is herein incorporated by reference) reports
on the
injection of genetic material, complexed with cationic liposomes carriers,
into mice. U.S.
Patent Nos. 4,897,355, 4,946,787, 5,049,386, 5,459,127, 5,589,466, 5,693,622,
5,580,859,
5,703,055, and international publication no. WO 94/9469 (which are herein
incorporated by
reference) provide cationic lipids for use in transfecting DNA into cells and
mammals. U.5.
Patent Nos. 5,589,466, 5,693,622, 5,580,859, 5,703,055, and international
publication no.
WO 94/9469 (which are herein incorporated by reference) provide methods for
delivering
DNA-cationic lipid complexes to mammals.
In certain embodiments, cells are engineered, ex vivo or in vivo, using a
retroviral
particle containing RNA which comprises a sequence encoding TGF alpha HIII.
Retroviruses
from which the retroviral plasmid vectors may be derived include, but are not
limited to,
Moloney Murine Leukemia Virus, spleen necrosis virus, Rous sarcoma Virus,
Harvey
Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human
immunodeficiency
virus, Myeloproliferative Sarcoma Virus, and mammary tumor virus.
The retroviral plasmid vector is employed to transduce packaging cell lines to
form
producer cell lines. Examples of packaging cells which may be transfected
include, but are
not limited to, the PE501, PA317, R-2, R-AM, PA12, T19-14X, VT-19-17-H2, RCRE,
RCRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human
Gene
Therapy 1:5-14 (1990), which is incorporated herein by reference in its
entirety. The vector
may transduce the packaging cells through any means known in the art. Such
means include,
but are not limited to, electroporation, the use of liposomes, and CaP04
precipitation. In one
alternative, the retroviral plasmid vector may be encapsulated into a
liposome, or coupled to a
lipid, and then administered to a host.
The producer cell line generates infectious retroviral vector particles which
include
polynucleotide encoding TGF alpha H>TI. Such retroviral vector particles then
may be
employed, to transduce eukaryotic cells, either in vitro or in vivo. The
transduced eukaryotic
cells will express TGF alpha HIII.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
132
In certain other embodiments, cells are engineered, ex vivo or in vivo, with
TGF alpha
HIII polynucleotide contained in an adenovirus vector. Adenovirus can be
manipulated such
that it encodes and expresses TGF alpha HIII, and at the same time is
inactivated in terms of
its ability to replicate in a normal lytic viral life cycle. Adenovirus
expression is achieved
without integration of the viral DNA into the host cell chromosome, thereby
alleviating
concerns about insertional mutagenesis. Furthermore, adenoviruses have been
used as live
enteric vaccines for many years with an excellent safety profile (Schwartz, A.
R. et al. ( 1974)
Am. Rev. Respir. Dis.109:233-238). Finally, adenovirus mediated gene transfer
has been
demonstrated in a number of instances including transfer of alpha-1-
antitrypsin and CFTR to
the lungs of cotton rats (Rosenfeld, M. A. et al. (1991) Science 252:431-434;
Rosenfeld et al.,
(1992) Cell 68:143-155). Furthermore, extensive studies to attempt to
establish adenovirus as
a causative agent in human cancer were uniformly negative (Green, M. et al. (
1979) Proc.
Natl. Acad. Sci. USA 76:6606).
Suitable adenoviral vectors useful in the present invention are described, for
example,
in Kozarsky and Wilson, Curr. Opin. Genet. Devel. 3:499-503 (1993); Rosenfeld
et al., Cell
68:143-155 (1992); Engelhardt et al., Human Genet. Ther. 4:759-769 (1993);
Yang et al.,
Nature Genet. 7:362-369 (1994); Wilson et al., Nature 365:691-692 (1993); and
U.S. Patent
No. 5,652,224, which are herein incorporated by reference. For example, the
adenovirus
vector Ad2 is useful and can be grown in human 293 cells. These cells contain
the E1 region
of adenovirus and constitutively express Ela and Elb, which complement the
defective
adenoviruses by providing the products of the genes deleted from the vector.
In addition to
Ad2, other varieties of adenovirus (e.g., Ad3, AdS, and Ad7) are also useful
in the present
invention.
Preferably, the adenoviruses used in the present invention are replication
deficient.
Replication deficient adenoviruses require the aid of a helper virus and/or
packaging cell line
to form infectious particles. The resulting virus is capable of infecting
cells and can express a
polynucleotide of interest which is operably linked to a promoter, but cannot
replicate in most
cells. Replication deficient adenoviruses may be deleted in one or more of all
or a portion of
the following genes: Ela, Elb, E3, E4, E2a, or L1 through L5.
In certain other embodiments, the cells are engineered, ex vivo or in vivo,
using an
adeno-associated virus (AAV). AAVs are naturally occurring defective viruses
that require
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
133
helper viruses to produce infectious particles (Muzyczka, N., Curr. Topics in
Microbiol.
Immunol. 158:97 (1992)). It is also one of the few viruses that may integrate
its DNA into
non-dividing cells. Vectors containing as little as 300 base pairs of AAV can
be packaged and
can integrate, but space for exogenous DNA is limited to about 4.5 kb. Methods
for
producing and using such AAVs are known in the art. See, for example, U.S.
Patent Nos.
5,139,941, 5,173,414, 5,354,678, 5,436,146, 5,474,935, 5,478,745, and
5,589,377.
For example, an appropriate AAV vector for use in the present invention will
include
all the sequences necessary for DNA replication, encapsidation, and host-cell
integration.
The TGF alpha HIII polynucleotide construct is inserted into the AAV vector
using standard
cloning methods, such as those found in Sambrook et al., Molecular Cloning: A
Laboratory
Manual, Cold Spring Harbor Press (1989). The recombinant AAV vector is then
transfected
into packaging cells which are infected with a helper virus, using any
standard technique,
including lipofection, electroporation, calcium phosphate precipitation, etc.
Appropriate
helper viruses include adenoviruses, cytomegaloviruses, vaccinia viruses, or
herpes viruses.
Once the packaging cells are transfected and infected, they will produce
infectious AAV viral
particles which contain the TGF alpha HIII polynucleotide construct. These
viral particles are
then used to transduce eukaryotic cells, either ex vivo or in vivo. The
transduced cells will
contain the TGF alpha HIII polynucleotide construct integrated into its
genome, and will
express TGF alpha HIII.
Another method of gene therapy involves operably associating heterologous
control
regions and endogenous polynucleotide sequences (e.g. encoding TGF alpha HIII)
via
homologous recombination (see, e.g., U.S. Patent No. 5,641,670, issued June
24, 1997;
International Publication No. WO 96/29411, published September 26, 1996;
International
Publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc.
Natl. Acad. Sci.
USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989). This
method
involves the activation of a gene which is present in the target cells, but
which is not normally
expressed in the cells, or is expressed at a lower level than desired.
Polynucleotide constructs are made, using standard techniques known in the
art,
which contain the promoter with targeting sequences flanking the promoter.
Suitable
promoters are described herein. The targeting sequence is sufficiently
complementary to an
endogenous sequence to permit homologous recombination of the promoter-
targeting
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
134
sequence with the endogenous sequence. The targeting sequence will be
sufficiently near the
5' end of the TGF alpha HIII desired endogenous polynucleotide sequence so the
promoter
will be operably linked to the endogenous sequence upon homologous
recombination.
The promoter and the targeting sequences can be amplified using PCR.
Preferably,
the amplified promoter contains distinct restriction enzyme sites on the S'
and 3' ends.
Preferably, the 3' end of the first targeting sequence contains the same
restriction enzyme site
as the 5' end of the amplified promoter and the 5' end of the second targeting
sequence
contains the same restriction site as the 3' end of the amplified promoter.
The amplified
promoter and targeting sequences are digested and ligated together.
The promoter-targeting sequence construct is delivered to the cells, either as
naked
polynucleotide, or in conjunction with transfection-facilitating agents, such
as liposomes,
viral sequences, viral particles, whole viruses, lipofection, precipitating
agents, etc., described
in more detail above. The P promoter-targeting sequence can be delivered by
any method,
included direct needle injection, intravenous injection, topical
administration, catheter
infusion, particle accelerators, etc. The methods are described in more detail
below.
The promoter-targeting sequence construct is taken up by cells. Homologous
recombination between the construct and the endogenous sequence takes place,
such that an
endogenous TGF alpha HIII sequence is placed under the control of the
promoter. The
promoter then drives the expression of the endogenous TGF alpha HIII sequence.
The polynucleotides encoding TGF alpha HIB may be administered along with
other
polynucleotides encoding an angiogenic protein. Examples of angiogenic
proteins include,
but are not limited to, acidic and basic fibroblast growth factors, VEGF-1,
VEGF-2, VEGF-3,
epidermal growth factor alpha and beta, platelet-derived endothelial cell
growth factor,
platelet-derived growth factor, tumor necrosis factor alpha, hepatocyte growth
factor, insulin
like growth factor, colony stimulating factor, macrophage colony stimulating
factor,
granulocyte/macrophage colony stimulating factor, and nitric oxide synthase.
Preferably, the polynucleotide encoding TGF alpha HIII contains a secretory
signal
sequence that facilitates secretion of the protein. Typically, the signal
sequence is positioned
in the coding region of the polynucleotide to be expressed towards or at the
5' end of the
coding region. The signal sequence may be homologous or heterologous to the
polynucleotide
of interest and may be homologous or heterologous to the cells to be
transfected.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
135
Additionally, the signal sequence may be chemically synthesized using methods
known in the
art.
Any mode of administration of any of the above-described polynucleotides
constructs
can be used so long as the mode results in the expression of one or more
molecules in an
amount sufficient to provide a therapeutic effect. This includes direct needle
injection,
systemic injection, catheter infusion, biolistic injectors, particle
accelerators (i.e., "gene
guns"), gelfoam sponge depots, other commercially.available depot materials,
osmotic pumps
(e.g., Alza minipumps), oral or suppositorial solid (tablet or pill)
pharmaceutical
formulations, and decanting or topical applications during surgery. For
example, direct
injection of naked calcium phosphate-precipitated plasmid into rat liver and
rat spleen or a
protein-coated plasmid into the portal vein has resulted in gene expression of
the foreign gene
in the rat livers (Kaneda et al., Science 243:375 (1989)).
A preferred method of local administration is by direct injection. Preferably,
a
recombinant molecule of the present invention complexed with a delivery
vehicle is
administered by direct injection into or locally within the area of arteries.
Administration of a
composition locally within the area of arteries refers to injecting the
composition centimeters
and preferably, millimeters within arteries.
Another method of local administration is to contact a polynucleotide
construct of the
present invention in or around a surgical wound. For example, a patient can
undergo surgery
and the polynucleotide construct can be coated on the surface of tissue inside
the wound or
the construct can be injected into areas of tissue inside the wound.
Therapeutic compositions useful in systemic administration, include
recombinant
molecules of the present invention complexed to a targeted delivery vehicle of
the present
invention. Suitable delivery vehicles for use with systemic administration
comprise liposomes
comprising ligands for targeting the vehicle to a particular site.
Preferred methods of systemic administration, include intravenous injection,
aerosol,
oral and percutaneous (topical) delivery. Intravenous injections can be
performed using
methods standard in the art. Aerosol delivery can also be performed using
methods standard
in the art (see, for example, Stribling et al., Proc. Natl. Acad. Sci. USA
189:11277-11281,
1992, which is incorporated herein by reference). Oral delivery can be
performed by
complexing a polynucleotide construct of the present invention to a Garner
capable of
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
136
withstanding degradation by digestive enzymes in the gut of an animal.
Examples of such
carriers, include plastic capsules or tablets, such as those known in the art.
Topical delivery
can be performed by mixing a polynucleotide construct of the present invention
with a
lipophilic reagent (e.g., DMSO) that is capable of passing into the skin.
Determining an effective amount of substance to be delivered can depend upon a
number of factors including, for example, the chemical structure and
biological activity of the
substance, the age and weight of the animal, the precise condition requiring
treatment and its
severity, and the route of administration. The frequency of treatments depends
upon a
number of factors, such as the amount of polynucleotide constructs
administered per dose, as
well as the health and history of the subject. The precise amount, number of
doses, and
timing of doses will be determined by the attending physician or veterinarian.
Therapeutic compositions of the present invention can be administered to any
animal,
preferably to mammals and birds. Preferred mammals include humans, dogs, cats,
mice, rats,
rabbits sheep, cattle, horses and pigs, with humans being particularly
preferred.
Biological Activities of TGF alpha HIII
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, can be used in assays to test for one or more biological
activities. If TGF alpha
HIII polynucleotides or polypeptides, or agonists or antagonists of TGF alpha
HIII, do exhibit
activity in a particular assay, it is likely that TGF alpha HIII may be
involved in the diseases
associated with the biological activity. Therefore, TGF alpha HIII could be
used to treat the
associated disease.
Immune Activity
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, may be useful in treating deficiencies or disorders of the immune
system, by
activating or inhibiting the proliferation, differentiation, or mobilization
(chemotaxis) of
immune cells. Immune cells develop through a process called hematopoiesis,
producing
myeloid (platelets, red blood cells, neutrophils, and macrophages) and
lymphoid (B and T
lymphocytes) cells from pluripotent stem cells. The etiology of these immune
deficiencies or
disorders may be genetic, somatic, such as cancer or some autoimmune
disorders, acquired
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
137
(e.g., by chemotherapy or toxins), or infectious. Moreover, TGF alpha HILI
polynucleotides
or polypeptides, or agonists or antagonists of TGF alpha HIII, can be used as
a marker or
detector of a particular immune system disease or disorder.
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, may be useful in treating or detecting deficiencies or disorders
of hematopoietic
cells. TGF alpha HIII polynucleotides or polypeptides, or agonists or
antagonists of TGF
alpha HIII, could be used to increase differentiation and proliferation of
hematopoietic cells,
including the pluripotent stem cells, in an effort to treat those disorders
associated with a
decrease in certain (or many) types hematopoietic cells. Examples of
immunologic
deficiency syndromes include, but are not limited to: blood protein disorders
(e.g.
agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common
variable
immunodeficiency, Digeorge Syndrome, HIV infection, HTLV-BLV infection,
leukocyte
adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction,
severe
combined immunodeficiency (SC>Ds), Wiskott-Aldrich Disorder, anemia,
thrombocytopenia, or hemoglobinuria.
Moreover, TGF alpha HI>Z polynucleotides or polypeptides, or agonists or
antagonists
of TGF alpha HIII, can also be used to modulate hemostatic (the stopping of
bleeding) or
thrombolytic activity (clot formation). For example, by increasing hemostatic
or
thrombolytic activity, TGF alpha HIII polynucleotides or polypeptides, or
agonists or
antagonists of TGF alpha HIII, could be used to treat blood coagulation
disorders (e.g.,
afibrinogenemia, factor deficiencies), blood platelet disorders (e.g.
thrombocytopenia), or
wounds resulting from trauma, surgery, or other causes. Alternatively, TGF
alpha HIII
polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIII,
that can
decrease hemostatic or thrombolytic activity could be used to inhibit or
dissolve clotting.
These molecules could be important in the treatment of heart attacks
(infarction), strokes, or
scamng.
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, may also be useful in treating or detecting autoimmune disorders.
Many
autoimmune disorders result from inappropriate recognition of self as foreign
material by
immune cells. This inappropriate recognition results in an immune response
leading to the
destruction of the host tissue. Therefore, the administration of TGF alpha
HIII
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
138
polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIII,
that can inhibit
an immune response, particularly the proliferation, differentiation, or
chemotaxis of T-cells,
may be an effective therapy in preventing autoimmune disorders.
Examples of autoimmune disorders that can be treated or detected include, but
are not
limited to: Addison's Disease, hemolytic anemia, antiphospholipid syndrome,
rheumatoid
arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis,
Goodpasture's Syndrome,
Graves' Disease, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia,
Bullous
Pemphigoid, Pemphigus, Polyendocrinopathies, Purpura, Reiter's Disease, Stiff
Man
Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune
Pulmonary Inflammation, Guillain-Barre Syndrome, insulin dependent diabetes
mellitis, and
autoimmune inflammatory eye disease.
Similarly, allergic reactions and conditions, such as asthma (particularly
allergic
asthma) or other respiratory problems, may also be treated by TGF alpha HIII
polynucleotides
or polypeptides, or agonists or antagonists of TGF alpha HIII. Moreover, these
molecules can
be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or
blood group
incompatibility.
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, may also be used to treat and/or prevent organ rejection or graft-
versus-host
disease (GVHD). Organ rejection occurs by host immune cell destruction of the
transplanted
tissue through an immune response. Similarly, an immune response is also
involved in
GVHD, but, in this case, the foreign transplanted immune cells destroy the
host tissues. The
administration of TGF alpha HIII polynucleotides or polypeptides, or agonists
or antagonists
of TGF alpha HIII, that inhibits an immune response, particularly the
proliferation,
differentiation, or chemotaxis of T-cells, may be an effective therapy in
preventing organ
rejection or GVHD.
Similarly, TGF alpha HIII polynucleotides or polypeptides, or agonists or
antagonists
of TGF alpha HIII, may also be used to modulate inflammation. For example, TGF
alpha
HIII polynucleotides or polypeptides, or agonists or antagonists of TGF alpha
HIII, may
inhibit the proliferation and differentiation of cells involved in an
inflammatory response.
These molecules can be used to treat inflammatory conditions, both chronic and
acute
conditions, including chronic prostatitis, granulomatous prostatitis and
malacoplakia,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
139
inflammation associated with infection (e.g., septic shock, sepsis, or
systemic inflammatory
response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality,
arthritis,
complement-mediated hyperacute rejection, nephritis, cytokine or chemokine
induced lung
injury, inflammatory bowel disease, Crohn's disease, or resulting from over
production of
cytokines (e.g., TNF or IL-1.)
Hyperproliferative Disorders
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, can be used to treat or detect hyperproliferative disorders,
including neoplasms.
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF alpha
HIII, may inhibit the proliferation of the disorder through direct or indirect
interactions.
Alternatively, TGF alpha HIII polynucleotides or polypeptides, or agonists or
antagonists of
TGF alpha HIII, may proliferate other cells which can inhibit the
hyperproliferative disorder.
For example, by increasing an immune response, particularly increasing
antigenic
qualities of the hyperproliferative disorder or by proliferating,
differentiating, or mobilizing
T-cells, hyperproliferative disorders can be treated. This immune response may
be increased
by either enhancing an existing immune response, or by initiating a new immune
response.
Alternatively, decreasing an immune response may also be a method of treating
hyperproliferative disorders, such as a chemotherapeutic agent.
Examples of hyperproliferative disorders that can be treated or detected by
TGF alpha
HIII polynucleotides or polypeptides, or agonists or antagonists of TGF alpha
HIII, include,
but are not limited to neoplasms located in the:colon, abdomen, bone, breast,
digestive
system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid,
pituitary,
testicles, ovary, thymus, thyroid), eye, head and neck, nervous (central and
peripheral),
lymphatic system, pelvic, skin, soft tissue, spleen, thoracic, and urogenital.
Similarly, other hyperproliferative disorders can also be treated or detected
by TGF
alpha HIII polynucleotides or polypeptides, or agonists or antagonists of TGF
alpha HIII.
Examples of such hyperproliferative disorders include, but are not limited to:
hypergammaglobulinemia, lymphoproliferative disorders, paraproteinemias,
purpura,
sarcoidosis, Sezary Syndrome, Waldenstron's Macroglobulinemia, Gaucher's
Disease,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
140
histiocytosis, and any other hyperproliferative disease, besides neoplasia,
located in an organ
system listed above.
One preferred embodiment utilizes polynucleotides of the present invention to
inhibit
aberrant cellular division, by gene therapy using the present invention,
and/or protein fusions
S or fragments thereof.
Thus, the present invention provides a method for treating cell proliferative
disorders
by inserting into an abnormally proliferating cell a polynucleotide of the
present invention,
wherein said polynucleotide represses said expression.
Another embodiment of the present invention provides a method of treating cell-
proliferative disorders in individuals comprising administration of one or
more active gene
copies of the present invention to an abnormally proliferating cell or cells.
In a preferred
embodiment, polynucleotides of the present invention is a DNA construct
comprising a
recombinant expression vector effective in expressing a DNA sequence encoding
said
polynucleotides. In another preferred embodiment of the present invention, the
DNA
construct encoding the poynucleotides of the present invention is inserted
into cells to be
treated utilizing a retrovirus, or more preferrably an adenoviral vector (See
G J. Nabel, et. al.,
PNAS 1999 96: 324-326, which is hereby incorporated by reference). In a most
preferred
embodiment, the viral vector is defective and will not transform non-
proliferating cells, only
proliferating cells. Moreover, in a preferred embodiment, the polynucleotides
of the present
invention inserted into proliferating cells either alone, or in combination
with or fused to
other polynucleotides, can then be modulated via an external stimulus (i.e.
magnetic, specific
small molecule, chemical, or drug administration, etc.), which acts upon the
promoter
upstream of said polynucleotides to induce expression of the encoded protein
product. As
such the beneficial therapeutic affect of the present invention may be
expressly modulated
(i.e. to increase, decrease, or inhibit expression of the present invention)
based upon said
external stimulus.
Polynucleotides of the present invention may be useful in repressing
expression of
oncogenic genes or antigens. By "repressing expression of the oncogenic genes
" is intended
the suppression of the transcription of the gene, the degradation of the gene
transcript (pre-
message RNA), the inhibition of splicing, the destruction of the messenger
RNA, the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
141
prevention of the post-translational modifications of the protein, the
destruction of the
protein, or the inhibition of the normal function of the protein.
For local administration to abnormally proliferating cells, polynucleotides of
the
present invention may be administered by any method known to those of skill in
the art
including, but not limited to transfection, electroporation, microinjection of
cells, or in
vehicles such as liposomes, lipofectin, or as naked polynucleotides, or any
other method
described throughout the specification. The polynucleotide of the present
invention may be
delivered by known gene delivery systems such as, but not limited to,
retroviral vectors
(Gilboa, J. Virology 44:845 (1982); Hocke, Nature 320:275 (1986); Wilson, et
al., Proc. Natl.
Acad. Sci. U.S.A. 85:3014), vaccinia virus system (Chakrabarty et al., Mol.
Cell Biol. 5:3403
(1985) or other efficient DNA delivery systems (Yates et al., Nature 313:812
(1985)) known
to those skilled in the art. These references are exemplary only and are
hereby incorporated
by reference. In order to specifically deliver or transfect cells which are
abnormally
proliferating and spare non-dividing cells, it is preferable to utilize a
retrovirus, or adenoviral
(as described in the art and elsewhere herein) delivery system known to those
of skill in the
art. Since host DNA replication is required for retroviral DNA to integrate
and the retrovirus
will be unable to self replicate due to the lack of the retrovirus genes
needed for its life cycle.
Utilizing such a retroviral delivery system for polynucleotides of the present
invention will
target said gene and constructs to abnormally proliferating cells and will
spare the non
dividing normal cells.
The polynucleotides of the present invention may be delivered directly to cell
proliferative disorder/disease sites in internal organs, body cavities and the
like by use of
imaging devices used to guide an injecting needle directly to the disease
site. The
polynucleotides of the present invention may also be administered to disease
sites at the time
of surgical intervention.
By "cell proliferative disease" is meant any human or animal disease or
disorder,
affecting any one or any combination of organs, cavities, or body parts, which
is characterized
by single or multiple local abnormal proliferations of cells, groups of cells,
or tissues,
whether benign or malignant.
Any amount of the polynucleotides of the present invention may be administered
as
long as it has a biologically inhibiting effect on the proliferation of the
treated cells.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
142
Moreover, it is possible to administer more than one of the polynucleotide of
the present
invention simultaneously to the same site. By "biologically inhibiting" is
meant partial or
total growth inhibition as well as decreases in the rate of proliferation or
growth of the cells.
The biologically inhibitory dose may be determined by assessing the effects of
the
polynucleotides of the present invention on target malignant or abnormally
proliferating cell
growth in tissue culture, tumor growth in animals and cell cultures, or any
other method
known to one of ordinary skill in the art.
The present invention is further directed to antibody-based therapies which
involve
administering of anti-polypeptides and anti-polynucleotide antibodies to a
mammalian,
preferably human, patient for treating one or more of the described disorders.
Methods for
producing anti-polypeptides and anti-polynucleotide antibodies polyclonal and
monoclonal
antibodies are described in detail elsewhere herein. Such antibodies may be
provided in
pharmaceutically acceptable compositions as known in the art or as described
herein.
A summary of the ways in which the antibodies of the present invention may be
used
therapeutically includes binding polynucleotides or polypeptides of the
present invention
locally or systemically in the body or by direct cytotoxicity of the antibody,
e.g. as mediated
by complement (CDC) or by effector cells (ADCC). Some of these approaches are
described
in more detail below. Armed with the teachings provided herein, one of
ordinary skill in the
art will know how to use the antibodies of the present invention for
diagnostic, monitoring or
therapeutic purposes without undue experimentation.
In particular, the antibodies, fragments and derivatives of the present
invention are
useful for treating a subject having or developing cell proliferative and/or
differentiation
disorders as described herein. Such treatment comprises administering a single
or multiple
doses of the antibody, or a fragment, derivative, or a conjugate thereof.
The antibodies of this invention may be advantageously utilized in combination
with
other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic
growth
factors, for example, which serve to increase the number or activity of
effector cells which
interact with the antibodies.
It is preferred to use high affinity and/or potent in vivo inhibiting and/or
neutralizing
antibodies against polypeptides or polynucleotides of the present invention,
fragments or
regions thereof, for both immunoassays directed to and therapy of disorders
related to
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
143
polynucleotides or polypeptides, including fragements thereof, of the present
invention. Such
antibodies, fragments, or regions, will preferably have an affinity for
polynucleotides or
polypeptides, including fragements thereof. Preferred binding affinities
include those with a
dissociation constant or Kd less than 5X10-6M, 10-6M, 5X10-'M, 10-'M, 5X10-gM,
10-$M,
5X10-9M, 10-9M, 5X10-'°M, 10-'°M, 5X10-"M, 10-"M, 5X10-'ZM, 10-
'2M, 5X10-'3M, 10~
'3M, 5X10-'4M, 10-'4M, 5X10-'SM, and 10-'SM.
Moreover, polypeptides of the present invention are useful in inhibiting the
angiogenesis of proliferative cells or tissues, either alone, as a protein
fusion, or in
combination with other polypeptides directly or indirectly, as described
elsewhere herein. In a
most preferred embodiment, said anti-angiogenesis effect may be achieved
indirectly, for
example, through the inhibition of hematopoietic, tumor-specific cells, such
as tumor-
associated macrophages (See Joseph IB, et al. J Natl Cancer Inst, 90(21):1648-
53 (1998),
which is hereby incorporated by reference). Antibodies directed to
polypeptides or
polynucleotides of the present invention may also result in inhibition of
angiogenesis directly,
or indirectly (See Witte L, et al., Cancer Metastasis Rev. 17(2):155-61
(1998), which is
hereby incorporated by reference)).
Polypeptides, including protein fusions, of the present invention, or
fragments thereof
may be useful in inhibiting proliferative cells or tissues through the
induction of apoptosis.
Said polypeptides may act either directly, or indirectly to induce apoptosis
of proliferative
cells and tissues, for example in the activation of a death-domain receptor,
such as tumor
necrosis factor (TNF) receptor-1, CD95 (Fas/APO-1), TNF-receptor-related
apoptosis-
mediated protein (TRAMP) and TNF-related apoptosis-inducing ligand (TRAIL)
receptor-1
and -2 (See Schulze-Osthoff K, et.al., Eur J Biochem 254(3):439-59 (1998),
which is hereby
incorporated by reference). Moreover, in another preferred embodiment of the
present
invention, said polypeptides may induce apoptosis through other mechanisms,
such as in the
activation of other proteins which will activate apoptosis, or through
stimulating the
expression of said proteins, either alone or in combination with small
molecule drugs or
adjuviants, such as apoptonin, galectins, thioredoxins, antiinflammatory
proteins (See for
example, Mutat Res 400(1-2):447-55 (1998), Med Hypotheses.50(5):423-33 (1998),
Chem
Biol Interact. Apr 24;111-112:23-34 (1998), J Mol Med.76(6):402-12 (1998), Int
J Tissue
React;20(1):3-15 (1998), which are all hereby incorporated by reference).
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
144
Polypeptides, including protein fusions to, or fragments thereof, of the
present
invention are useful in inhibiting the metastasis of proliferative cells or
tissues. Inhibition
may occur as a direct result of administering polypeptides, or antibodies
directed to said
polypeptides as described elsewere herein, or indirectly, such as activating
the expression of
proteins known to inhibit metastasis, for example alpha 4 integrins, (See,
e.g., Curr Top
Microbiol Immunol 1998;231:125-41, which is hereby incorporated by reference).
Such
thereapeutic affects of the present invention may be achieved either alone, or
in combination
with small molecule drugs or adjuvants.
In another embodiment, the invention provides a method of delivering
compositions
containing the polypeptides of the invention (e.g., compositions containing
polypeptides or
polypeptide antibodes associated with heterologous polypeptides, heterologous
nucleic acids,
toxins, or prodrugs) to targeted cells expressing the polypeptide of the
present invention.
Polypeptides or polypeptide antibodes of the invention may be associated with
with
heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via
hydrophobic,
hydrophilic, ionic and/or covalent interactions.
Polypeptides, protein fusions to, or fragments thereof, of the present
invention are
useful in enhancing the immunogenicity and/or antigenicity of proliferating
cells or tissues,
either directly, such as would occur if the polypeptides of the present
invention 'vaccinated'
the immune response to respond to proliferative antigens and immunogens, or
indirectly,
such as in activating the expression of proteins known to enhance the immune
response (e.g.
chemokines), to said antigens and immunogens.
Cardiovascular Disorders
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, encoding TGF alpha HIII may be used to treat cardiovascular
disorders, including
peripheral artery disease, such as limb ischemia.
Cardiovascular disorders include cardiovascular abnormalities, such as arterio-
arterial
fistula, arteriovenous fistula, cerebral arteriovenous malformations,
congenital heart defects,
pulmonary atresia, and Scimitar Syndrome. Congenital heart defects include
aortic
coarctation, cor triatriatum, coronary vessel anomalies, crisscross heart,
dextrocardia, patent
ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left
heart syndrome,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
145
levocardia, tetralogy of fallot, transposition of great vessels, double outlet
right ventricle,
tricuspid atresia, persistent truncus arteriosus, and heart septal defects,
such as
aortopulmonary septal defect, endocardial cushion defects, Lutembacher's
Syndrome, trilogy
of Fallot, ventricular heart septal defects.
S Cardiovascular disorders also include heart disease, such as arrhythmias,
carcinoid
heart disease, high cardiac output, low cardiac output, cardiac tamponade,
endocarditis
(including bacterial), heart aneurysm, cardiac arrest, congestive heart
failure, congestive
cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy,
congestive
cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy,
post-infarction
heart rupture, ventricular septal rupture, heart valve diseases, myocardial
diseases, myocardial
ischemia, pericardial effusion, pericarditis (including constrictive and
tuberculous),
pneumopericardium, postpericardiotomy syndrome, pulmonary heart disease,
rheumatic heart
disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy
complications,
Scimitar Syndrome, cardiovascular syphilis, and cardiovascular tuberculosis.
Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter,
bradycardia,
extrasystole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block,
long QT
syndrome,parasystole, Lown-Ganong-LevineSyndrome,Mahaim-type pre-excitation
syndrome,Wolff Parkinson-White sick sinussyndrome, tachycardias,
syndrome, and
ventricularfibrillation. Tachycardiasparoxysmaltachycardia, supraventricular
include
tachycardia, accelerated idioventricular rhythm, atrioventricular nodal
reentry tachycardia,
ectopic atrial tachycardia, ectopic functional tachycardia, sinoatrial nodal
reentry tachycardia,
sinus tachycardia, Torsades de Pointes, and ventricular tachycardia.
Heart valve disease include aortic valve insufficiency, aortic valve stenosis,
hear
murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve
prolapse, mitral valve
insufficiency, mural valve stenosis, pulmonary atresia, pulmonary valve
insufficiency,
pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency,
and tricuspid valve
stenosis.
Myocardial diseases include alcoholic cardiomyopathy, congestive
cardiomyopathy,
hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary
subvalvular stenosis,
restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis,
endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion injury, and
myocarditis.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
146
Myocardial ischemias include coronary disease, such as angina pectoris,
coronary
aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm,
myocardial
infarction and myocardial stunning.
Cardiovascular diseases also include vascular diseases such as aneurysms,
angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease,
Klippel-
Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic edema, aortic
diseases,
Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive
diseases, arteritis,
enarteritis, polyarteritis nodosa, cerebrovascular disorders, diabetic
angiopathies, diabetic
retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic veno-
occlusive
disease, hypertension, hypotension, ischemia, peripheral vascular diseases,
phlebitis,
pulmonary veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal
vein
occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia,
atacia
telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose
veins, varicose
ulcer, vasculitis, and venous insufficiency.
Aneurysms include dissecting aneurysms, false aneurysms, infected aneurysms,
ruptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms,
heart
aneurysms, and iliac aneurysms.
Arterial occlusive diseases include arteriosclerosis, intermittent
claudication, carotid
stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya
disease, renal
artery obstruction, retinal artery occlusion, and thromboangiitis obliterans.
Cerebrovascular disorders include carotid artery diseases, cerebral amyloid
angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis,
cerebral
arteriovenous malformation, cerebral artery diseases, cerebral embolism and
thrombosis,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral
hemorrhage,
epidural hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral
infarction,
cerebral ischemia (including transient), subclavian steal syndrome,
periventricular
leukomalacia, vascular headache, cluster headache, migraine, and
vertebrobasilar
insufficiency.
Embolisms include air embolisms, amniotic fluid embolisms, cholesterol
embolisms,
blue toe syndrome, fat embolisms, pulmonary embolisms, and thromoboembolisms.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
147
Thrombosis include coronary thrombosis, hepatic vein thrombosis, retinal vein
occlusion,
carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and
thrombophlebitis.
Ischemia includes cerebral ischemia, ischemic colitis, compartment syndromes,
anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and
peripheral
limb ischemia. Vasculitis includes aortitis, arteritis, Behcet's Syndrome,
Churg-Strauss
Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans,
hypersensitivity vasculitis, Schoenlein-Henoch purpura, allergic cutaneous
vasculitis, and
Wegener's granulomatosis.
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, are especially effective for the treatment of critical limb
ischemia and coronary
disease. TGF alpha HIII polypeptides may be administered using any method
known in
the art, including, but not limited to, direct needle injection at the
delivery site, intravenous
injection, topical administration, catheter infusion, biolistic injectors,
particle accelerators,
gelfoam sponge depots, other commercially available depot materials, osmotic
pumps, oral or
suppositorial solid pharmaceutical formulations, decanting or topical
applications during
surgery, aerosol delivery. Such methods are known in the art. TGF alpha HIII
polypeptides
may be administered as part of a Therapeutic, described in more detail below.
Methods of
delivering TGF alpha HIII polynucleotides are described in more detail herein.
Anti-An~io~enesis Activity
The naturally occurnng balance between endogenous stimulators and inhibitors
of
angiogenesis is one in which inhibitory influences predominate. Rastinejad et
al., Cell
56:345-355 (1989). In those rare instances in which neovascularization occurs
under normal
physiological conditions, such as wound healing, organ regeneration, embryonic
development, and female reproductive processes, angiogenesis is stringently
regulated and
spatially and temporally delimited. Under conditions of pathological
angiogenesis such as
that characterizing solid tumor growth, these regulatory controls fail.
Unregulated
angiogenesis becomes pathologic and sustains progression of many neoplastic
and non-
neoplastic diseases. A number of serious diseases are dominated by abnormal
neovascularization including solid tumor growth and metastases, arthritis,
some types of eye
disorders, and psoriasis. See, e.g., reviews by Moses et al., Biotech. 9:630-
634 (1991);
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
148
Folkman et al., N. Engl. J. Med., 333:1757-1763 (1995); Auerbach et al., J.
Microvasc. Res.
29:401-411 (1985); Folkman, Advances in Cancer Research, eds. Klein and
Weinhouse,
Academic Press, New York, pp. 175-203 (1985); Patz, Am. J. Opthalmol. 94:715-
743
(1982); and Folkman et al., Science 221:719-725 (1983). In a number of
pathological
conditions, the process of angiogenesis contributes to the disease state. For
example,
significant data have accumulated which suggest that the growth of solid
tumors is dependent
on angiogenesis. Folkman and Klagsbrun, Science 235:442-447 (1987).
The present invention provides for treatment of diseases or disorders
associated with
neovascularization by administration of the polynucleotides and/or
polypeptides of the
invention, as well as agonists or antagonists of the present invention.
Malignant and
metastatic conditions which can be treated with the polynucleotides and
polypeptides, or
agonists or antagonists of the invention include, but are not limited to,
malignancies, solid
tumors, and cancers described herein and otherwise known in the art (for a
review of such
disorders, see Fishman et al., Medicine, 2d Ed., J. B. Lippincott Co.,
Philadelphia
(1985)).Thus, the present invention provides a method of treating an
angiogenesis-related
disease and/or disorder, comprising administering to an individual in need
thereof a
therapeutically effective amount of a polynucleotide, polypeptide, antagonist
and/or agonist
of the invention. For example, polynucleotides, polypeptides, antagonists
and/or agonists
may be utilized in a variety of additional methods in order to therapeutically
treat a cancer or
tumor. Cancers which may be treated with polynucleotides, polypeptides,
antagonists and/or
agonists include, but are not limited to solid tumors, including prostate,
lung, breast, ovarian,
stomach, pancreas, larynx, esophagus, testes, liver, parotid, biliary tract,
colon, rectum,
cervix, uterus, endometrium, kidney, bladder, thyroid cancer; primary tumors
and metastases;
melanomas; glioblastoma; Kaposi's sarcoma; leiomyosarcoma; non- small cell
lung cancer;
colorectal cancer; advanced malignancies; and blood born tumors such as
leukemias. For
example, polynucleotides, polypeptides, antagonists and/or agonists may be
delivered
topically, in order to treat cancers such as skin cancer, head and neck
tumors, breast tumors,
and Kaposi's sarcoma.
Within yet other aspects, polynucleotides, polypeptides, antagonists and/or
agonists
may be utilized to treat superficial forms of bladder cancer by, for example,
intravesical
administration. Polynucleotides, polypeptides, antagonists and/or agonists may
be delivered
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
149
directly into the tumor, or near the tumor site, via injection or a catheter.
Of course, as the
artisan of ordinary skill will appreciate, the appropriate mode of
administration will vary
according to the cancer to be treated. Other modes of delivery are discussed
herein.
Polynucleotides, polypeptides, antagonists and/or agonists may be useful in
treating
other disorders, besides cancers, which involve angiogenesis. These disorders
include, but
are not limited to: benign tumors, for example hemangiomas, acoustic neuromas,
neurofibromas, trachomas, and pyogenic granulomas; artheroscleric plaques;
ocular
angiogenic diseases, for example, diabetic retinopathy, retinopathy of
prematurity, macular
degeneration, corneal graft rejection, neovascular glaucoma, retrolental
fibroplasia, rubeosis,
retinoblastoma, uvietis and Pterygia (abnormal blood vessel growth) of the
eye; rheumatoid
arthritis; psoriasis; delayed wound healing; endometriosis; vasculogenesis;
granulations;
hypertrophic scars (keloids); nonunion fractures; scleroderma; trachoma;
vascular adhesions;
myocardial angiogenesis; coronary collaterals; cerebral collaterals;
arteriovenous
malformations; ischemic limb angiogenesis; Osler-Webber Syndrome; plaque
neoyascularization; telangiectasia; hemophiliac joints; angiofibroma;
fibromuscular
dysplasia; wound granulation; Crohn's disease; and atherosclerosis.
For example, within one aspect of the present invention methods are provided
for
treating hypertrophic scars and keloids, comprising the step of administering
a
polynucleotide, polypeptide, antagonist and/or agonist of the invention to a
hypertrophic scar
or keloid.
Within one embodiment of the present invention polynucleotides, polypeptides,
antagonists and/or agonists are directly injected into a hypertrophic scar or
keloid, in order to
prevent the progression of these lesions. This therapy is of particular value
in the
prophylactic treatment of conditions which are known to result in the
development of
hypertrophic scars and keloids (e.g., burns), and is preferably initiated
after the proliferative
phase has had time to progress (approximately 14 days after the initial
injury), but before
hypertrophic scar or keloid development. As noted above, the present invention
also provides
methods for treating neovascular diseases of the eye, including for example,
corneal
neovascularization, neovascular glaucoma, proliferative diabetic retinopathy,
retrolental
fibroplasia and macular degeneration.
Moreover, Ocular disorders associated with neovascularization which can be
treated
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
150
with the polynucleotides and polypeptides of the present invention (including
agonists and/or
antagonists) include, but are not limited to: neovascular glaucoma, diabetic
retinopathy,
retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of prematurity
macular
degeneration, corneal graft neovascularization, as well as other eye
inflammatory diseases,
ocular tumors and diseases associated with choroidal or iris
neovascularization. See, e.g.,
reviews by Waltman et al., Am. J. Ophthal. 85:704-710 (1978) and Gartner et
al., Surv.
Ophthal. 22:291-312 (1978).
Thus, within one aspect of the present invention methods are provided for
treating
neovascular diseases of the eye such as corneal neovascularization (including
corneal graft
neovascularization), comprising the step of administering to a patient a
therapeutically
effective amount of a compound (as described above) to the cornea, such that
the formation
of blood vessels is inhibited. Briefly, the cornea is a tissue which normally
lacks blood
vessels. In certain pathological conditions however, capillaries may extend
into the cornea
from the pericorneal vascular plexus of the limbus. When the cornea becomes
vascularized,
it also becomes clouded, resulting in a decline in the patient's visual
acuity. Visual loss may
become complete if the cornea completely opacitates. A wide variety of
disorders can result
in corneal neovascularization, including for example, corneal infections
(e.g., trachoma,
herpes simplex keratitis, leishmaniasis and onchocerciasis), immunological
processes (e.g.,
graft rejection and Stevens-Johnson's syndrome), alkali burns, trauma,
inflammation (of any
cause), toxic and nutritional deficiency states, and as a complication of
wearing contact
lenses.
Within particularly preferred embodiments of the invention, may be prepared
for
topical administration in saline (combined with any of the preservatives and
antimicrobial
agents commonly used in ocular preparations), and administered in eyedrop
form. The
solution or suspension may be prepared in its pure form and administered
several times daily.
Alternatively, anti-angiogenic compositions, prepared as described above, may
also be
administered directly to the cornea. Within preferred embodiments, the anti-
angiogenic
composition is prepared with a muco-adhesive polymer which binds to cornea.
Within
further embodiments, the anti-angiogenic factors or anti-angiogenic
compositions may be
utilized as an adjunct to conventional steroid therapy. Topical therapy may
also be useful
prophylactically in corneal lesions which are known to have a high probability
of inducing an
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
151
angiogenic response (such as chemical burns). In these instances the
treatment, likely in
combination with steroids, may be instituted immediately to help prevent
subsequent
complications.
Within other embodiments, the compounds described above may be injected
directly
S into the corneal stroma by an ophthalmologist under microscopic guidance.
The preferred
site of injection may vary with the morphology of the individual lesion, but
the goal of the
administration would be to place the composition at the advancing front of the
vasculature
(i.e., interspersed between the blood vessels and the normal cornea). In most
cases this would
involve perilimbic corneal injection to "protect" the cornea from the
advancing blood vessels.
This method may also be utilized shortly after a corneal insult in order to
prophylactically
prevent corneal neovascularization. In this situation the material could be
injected in the
perilimbic cornea interspersed between the corneal lesion and its undesired
potential limbic
blood supply. Such methods may also be utilized in a similar fashion to
prevent capillary
invasion of transplanted corneas. In a sustained-release form injections might
only be
required 2-3 times per year. A steroid could also be added to the injection
solution to reduce
inflammation resulting from the inj ection itself.
Within another aspect of the present invention, methods are provided for
treating
neovascular glaucoma, comprising the step of administering to a patient a
therapeutically
effective amount of a polynucleotide, polypeptide, antagonist and/or agonist
to the eye, such
that the formation of blood vessels is inhibited. In one embodiment, the
compound may be
administered topically to the eye in order to treat early forms of neovascular
glaucoma.
Within other embodiments, the compound may be implanted by injection into the
region of
the anterior chamber angle. Within other embodiments, the compound may also be
placed in
any location such that the compound is continuously released into the aqueous
humor.
Within another aspect of the present invention, methods are provided for
treating
proliferative diabetic retinopathy, comprising the step of administering to a
patient a
therapeutically effective amount of a polynucleotide, polypeptide, antagonist
and/or agonist to
the eyes, such that the formation of blood vessels is inhibited.
Within particularly preferred embodiments of the invention, proliferative
diabetic
retinopathy may be treated by injection into the aqueous humor or the
vitreous, in ordento
increase the local concentration of the polynucleotide, polypeptide,
antagonist and/or agonist
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
152
in the retina. Preferably, this treatment should be initiated prior to the
acquisition of severe
disease requiring photocoagulation.
Within another aspect of the present invention, methods are provided for
treating
retrolental fibroplasia, comprising the step of administering to a patient a
therapeutically
effective amount of a polynucleotide, polypeptide, antagonist and/or agonist
to the eye, such
that the formation of blood vessels is inhibited. The compound may be
administered
topically, via intravitreous injection and/or via intraocular implants.
Additionally, disorders which can be treated with the polynucleotides,
polypeptides,
agonists and/or agonists include, but are not limited to, hemangioma,
arthritis, psoriasis,
angiofibroma, atherosclerotic plaques, delayed wound healing, granulations,
hemophilic
joints, hypertrophic scars, nonunion fractures, Osler-Weber syndrome, pyogenic
granuloma,
scleroderma, trachoma, and vascular adhesions.
Moreover, disorders and/or states, which can be treated with be treated with
the the
polynucleotides, polypeptides, agonists and/or agonists include, but are not
limited to, solid
tumors, blood born tumors such as leukemias, tumor metastasis, Kaposi's
sarcoma, benign
tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas,
and
pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular angiogenic
diseases, for
example, diabetic retinopathy, retinopathy of prematurity, macular
degeneration, corneal graft
rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis,
retinoblastoma, and uvietis,
delayed wound healing, endometriosis, vascluogenesis, granulations,
hypertrophic scars
(keloids), nonunion fractures, scleroderma, trachoma, vascular adhesions,
myocardial
angiogenesis, coronary collaterals, cerebral collaterals, arteriovenous
malformations,
ischemic limb angiogenesis, Osler-Webber Syndrome, plaque neovascularization,
telangiectasia, hemophiliac joints, angiofibroma fibromuscular dysplasia;
wound granulation,
Crohn's disease, atherosclerosis, birth control agent by preventing
vascularization required for
embryo implantation controlling menstruation, diseases that have angiogenesis
as a
pathologic consequence such as cat scratch disease (Rochele minalia quintosa),
ulcers
(Helicobacter pylori), Bartonellosis and bacillary angiomatosis.
In one aspect of the birth control method, an amount of the compound
sufficient to
block embryo implantation is administered before or after intercourse and
fertilization have
occurred, thus providing an effective method of birth control, possibly a
"morning after"
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
153
method. Polynucleotides, polypeptides, agonists and/or agonists may also be
used in
controlling menstruation or administered as either a peritoneal lavage fluid
or for peritoneal
implantation in the treatment of endometriosis.
Polynucleotides, polypeptides, agonists and/or agonists of the present
invention may
be incorporated into surgical sutures in order to prevent stitch granulomas.
Polynucleotides, polypeptides, agonists and/or agonists may be utilized in a
wide
variety of surgical procedures. For example, within one aspect of the present
invention a
compositions (in the form of, for example, a spray or film) may be utilized to
coat or spray an
area prior to removal of a tumor, in order to isolate normal surrounding
tissues from
malignant tissue, and/or to prevent the spread of disease to surrounding
tissues. Within other
aspects of the present invention, compositions (e.g., in the form of a spray)
may be delivered
via endoscopic procedures in order to coat tumors, or inhibit angiogenesis in
a desired locale.
Within yet other aspects of the present invention, surgical meshes which have
been coated
with anti- angiogenic compositions of the present invention may be utilized in
any procedure
wherein a surgical mesh might be utilized. For example, within one embodiment
of the
invention a surgical mesh laden with an anti-angiogenic composition may be
utilized during
abdominal cancer resection surgery (e.g., subsequent to colon resection) in
order to provide
support to the structure, and to release an amount of the anti-angiogenic
factor.
Within further aspects of the present invention, methods are provided for
treating
tumor excision sites, comprising administering a polynucleotide, polypeptide,
agonist and/or
agonist to the resection margins of a tumor subsequent to excision, such that
the local
recurrence of cancer and the formation of new blood vessels at the site is
inhibited. Within
one embodiment of the invention, the anti-angiogenic compound is administered
directly to
the tumor excision site (e.g., applied by swabbing, brushing or otherwise
coating the resection
margins of the tumor with the anti-angiogenic compound). Alternatively, the
anti-angiogenic
compounds may be incorporated into known surgical pastes prior to
administration. Within
particularly preferred embodiments of the invention, the anti-angiogenic
compounds are
applied after hepatic resections for malignancy, and after neurosurgical
operations.
Within one aspect of the present invention, polynucleotides, polypeptides,
agonists
and/or agonists may be administered to the resection margin of a wide variety
of tumors,
including for example, breast, colon, brain and hepatic tumors. For example,
within one
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
154
embodiment of the invention, anti-angiogenic compounds may be administered to
the site of a
neurological tumor subsequent to excision, such that the formation of new
blood vessels at
the site are inhibited.
The polynucleotides, polypeptides, agonists and/or agonists of the present
invention
may also be administered along with other anti-angiogenic factors.
Representative examples
of other anti-angiogenic factors include: Anti-Invasive Factor, retinoic acid
and derivatives
thereof, paclitaxel, Suramin, Tissue Inhibitor of Metalloproteinase-1, Tissue
Inhibitor of
Metalloproteinase-2, Plasminogen Activator Inhibitor-1, Plasminogen Activator
Inhibitor-2,
and various forms of the lighter "d group" transition metals.
Lighter "d group" transition metals include, for example, vanadium,
molybdenum,
tungsten, titanium, niobium, and tantalum species. Such transition metal
species may form
transition metal complexes. Suitable complexes of the above-mentioned
transition metal
species include oxo transition metal complexes.
Representative examples of vanadium complexes include oxo vanadium complexes
such as vanadate and vanadyl complexes. Suitable vanadate complexes include
metavanadate
and orthovanadate complexes such as, for example, ammonium metavanadate,
sodium
metavanadate, and sodium orthovanadate. Suitable vanadyl complexes include,
for example,
vanadyl acetylacetonate and vanadyl sulfate including vanadyl sulfate hydrates
such as
vanadyl sulfate mono- and trihydrates.
Representative examples of tungsten and molybdenum complexes also include oxo
complexes. Suitable oxo tungsten complexes include tungstate and tungsten
oxide
complexes. Suitable tungstate complexes include ammonium tungstate, calcium
tungstate,
sodium tungstate dehydrate, and tungstic acid. Suitable tungsten oxides
include tungsten (IV)
oxide and tungsten (VI) oxide. Suitable oxo molybdenum complexes include
molybdate,
molybdenum oxide, and molybdenyl complexes. Suitable molybdate complexes
include
ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and
potassium
molybdate and its hydrates. Suitable molybdenum oxides include molybdenum (VI)
oxide,
molybdenum (VI) oxide, and molybdic acid. Suitable molybdenyl complexes
include, for
example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum
complexes
include hydroxo derivatives derived from, for example, glycerol, tartaric
acid, and sugars.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
155
A wide variety of other anti-angiogenic factors may also be utilized within
the context
of the present invention. Representative examples include platelet factor 4;
protamine
sulphate; sulphated chitin derivatives (prepared from queen crab shells),
(Murata et al.,
Cancer Res. 51:22-26, 1991); Sulphated Polysaccharide Peptidoglycan Complex
(SP- PG)
(the function of this compound may be enhanced by the presence of steroids
such as estrogen,
and tamoxifen citrate); Staurosporine; modulators of matrix metabolism,
including for
example, proline analogs, cishydroxyproline, d,L-3,4-dehydroproline,
Thiaproline,
alpha,alpha-dipyridyl, aminopropionitrile fumarate; 4-propyl-5-(4-pyridinyl)-
2(3H)-
oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-
serum;
ChIMP-3 (Pavloff et al., J. Bio. Chem. 267:17321-17326, 1992); Chymostatin
(Tomkinson et
al., Biochem J. 286:475-480, 1992); Cyclodextrin Tetradecasulfate; Eponemycin;
Camptothecin; Fumagillin (Ingber et al., Nature 348:555-557, 1990); Gold
Sodium
Thiomalate ("GST"; Matsubara and Ziff, J. Clin. Invest. 79:1440-1446, 1987);
anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol. Chem.
262(4):1659-1664,
1987); Bisantrene (National Cancer Institute); Lobenzarit disodium (N-(2)-
carboxyphenyl-4-
chloroanthronilic acid disodium or "CCA"; Takeuchi et al., Agents Actions
36:312-316,
1992); Thalidomide; Angostatic steroid; AGM-1470; carboxynaminolmidazole; and
metalloproteinase inhibitors such as BB94.
Diseases at the Cellular Level
Diseases associated with increased cell survival or the inhibition of
apoptosis that
could be treated or detected by TGF alpha HIII polynucleotides or
polypeptides, as well as
antagonists or agonists of TGF alpha HIII, include cancers (such as follicular
lymphomas,
carcinomas with p53 mutations, and hormone-dependent tumors, including, but
not limited to
colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma,
glioblastoma,
lung cancer, intestinal cancer, testicular cancer, stomach cancer,
neuroblastoma, myxoma,
myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma,
chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and
ovarian
cancer); autoimmune disorders (such as, multiple sclerosis, Sjogren's
syndrome, Hashimoto's
thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease,
polymyositis, systemic lupus
erythematosus and immune-related glomerulonephritis and rheumatoid arthritis)
and viral
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
156
infections (such as herpes viruses, pox viruses and adenoviruses),
inflammation, graft v. host
disease, acute graft rejection, and chronic graft rejection. In preferred
embodiments, TGF
alpha HIII polynucleotides, polypeptides, and/or antagonists of the invention
are used to
inhibit growth, progression, and/or metasis of cancers, in particular those
listed above.
Additional diseases or conditions associated with increased cell survival that
could be
treated or detected by TGF alpha HIII polynucleotides or polypeptides, or
agonists or
antagonists of TGF alpha HIII, include, but are not limited to, progression,
and/or metastases
of malignancies and related disorders such as leukemia (including acute
leukemias (e.g., acute
lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic,
promyelocytic,
myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g.,
chronic
myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)),
polycythemia vera,
lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple
myeloma,
Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors
including, but not
limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma,
liposarcoma,
chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma,
lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma,
Ewing's
tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer,
breast
cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell
carcinoma,
adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary
carcinoma,
papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma,
bronchogenic
carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma,
choriocarcinoma, serriinoma,
embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung
carcinoma, small
cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma,
astrocytoma,
medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma,
acoustic
neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and
retinoblastoma.
Diseases associated with increased apoptosis that could be treated or detected
by TGF
alpha H>ZI polynucleotides or polypeptides, as well as agonists or antagonists
of TGF alpha
HILT, include AIDS; neurodegenerative disorders (such as Alzheimer's disease,
Parkinson's
disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar
degeneration and
brain tumor or prior associated disease); autoimmune disorders (such as,
multiple sclerosis,
Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's
disease, Crohn's
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
157
disease, polymyositis, systemic lupus erythematosus and immune-related
glomerulonephritis
and rheumatoid arthritis) myelodysplastic syndromes (such as aplastic anemia),
graft v. host
disease, ischemic injury (such as that caused by myocardial infarction, stroke
and reperfusion
injury), liver injury (e.g., hepatitis related liver injury,
ischemia/reperfusion injury, cholestosis
(bile duct injury) and liver cancer); toxin-induced liver disease (such as
that caused by
alcohol), septic shock, cachexia and anorexia.
Wound Healing and Epithelial Cell Proliferation
In accordance with yet a further aspect of the present invention, there is
provided a
process for utilizing TGF alpha HIII polynucleotides or polypeptides, as well
as agonists or
antagonists of TGF alpha HIII, for therapeutic purposes, for example, to
stimulate epithelial
cell proliferation and basal keratinocytes for the purpose of wound healing,
and to stimulate
hair follicle production and healing of dermal wounds. TGF alpha HIII
polynucleotides or
polypeptides, as well as agonists or antagonists of TGF alpha HIII, may be
clinically useful in
1 S stimulating wound healing including surgical wounds, excisional wounds,
deep wounds
involving damage of the dermis and epidermis, eye tissue wounds, dental tissue
wounds, oral
cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial
ulcers, venous stasis
ulcers, burns resulting from heat exposure or chemicals, and other abnormal
wound healing
conditions such as uremia, malnutrition, vitamin deficiencies and
complications associted
with systemic treatment with steroids, radiation therapy and antineoplastic
drugs and
antimetabolites. TGF alpha HIII polynucleotides or polypeptides, as well as
agonists or
antagonists of TGF alpha HIII, could be used to promote dermal reestablishment
subsequent
to dermal loss
TGF alpha HIII polynucleotides or polypeptides, as well as agonists or
antagonists of
TGF alpha HIII, could be used to increase the adherence of skin grafts to a
wound bed and to
stimulate re-epithelialization from the wound bed. The following are types of
grafts that TGF
alpha HIII polynucleotides or polypeptides, agonists or antagonists of TGF
alpha HIII, could
be used to increase adherence to a wound bed: autografts, artificial skin,
allografts,
autodermic graft, autoepdermic grafts, avacular grafts, Blair-Brown grafts,
bone graft,
brephoplastic grafts, cubs graft, delayed graft, dermic graft, epidermic
graft, fascia graft, full
thickness graft, heterologous graft, xenograft, homologous graft, hyperplastic
graft, lamellar
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
158
graft, mesh graft, mucosal graft, Oilier-Thiersch graft, omenpal graft, patch
graft, pedicle
graft, penetrating graft, split skin graft, thick split graft. TGF alpha HIII
polynucleotides or
polypeptides, as well as agonists or antagonists of TGF alpha HIII, can be
used to promote
skin strength and to improve the appearance of aged skin.
It is believed that TGF alpha HIII polynucleotides or polypeptides, as well as
agonists or
antagonists of TGF alpha HIII, will also produce changes in hepatocyte
proliferation, and
epithelial cell proliferation in the lung, breast, pancreas, stomach, small
intesting, and large
intestine. TGF alpha HIII polynucleotides or polypeptides, as well as agonists
or antagonists
of TGF alpha HIII, could promote proliferation of epithelial cells such as
sebocytes, hair
follicles, hepatocytes, type II pneumocytes, mucin-producing goblet cells, and
other epithelial
cells and their progenitors contained within the skin, lung, liver, and
gastrointestinal tract.
TGF alpha HIII polynucleotides or polypeptides, agonists or antagonists of TGF
alpha HIII,
may promote proliferation of endothelial cells, keratinocytes, and basal
keratinocytes.
TGF alpha HIII polynucleotides or polypeptides, as well as agonists or
antagonists of
1 S TGF alpha HIII, could also be used to reduce the side effects of gut
toxicity that result from
radiation, chemotherapy treatments or viral infections. TGF alpha HIll
polynucleotides or
polypeptides, as well as agonists or antagonists of TGF alpha H>II, may have a
cytoprotective
effect on the small intestine mucosa. TGF alpha HIII polynucleotides or
polypeptides, as well
as agonists or antagonists of TGF alpha HIII, may also stimulate healing of
mucositis (mouth
ulcers) that result from chemotherapy and viral infections.
TGF alpha HIII polynucleotides or polypeptides, as well as agonists or
antagonists of
TGF alpha HIII, could further be used in full regeneration of skin in full and
partial thickness
skin defects, including burns, (i.e., repopulation of hair follicles, sweat
glands, and sebaceous
glands), treatment of other skin defects such as psoriasis. TGF alpha HIII
polynucleotides or
polypeptides, as well as agonists or antagonists of TGF alpha HIII, could be
used to treat
epidermolysis bullosa, a defect in adherence of the epidermis to the
underlying dermis which
results in frequent, open and painful blisters by accelerating
reepithelialization of these
lesions. TGF alpha HIII polynucleotides or polypeptides, as well as agonists
or antagonists of
TGF alpha HIII, could also be used to treat gastric and doudenal ulcers and
help heal by scar
formation of the mucosal lining and regeneration of glandular mucosa and
duodenal mucosal
lining more rapidly. Inflamamatory bowel diseases, such as Crohn's disease and
ulcerative
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
159
colitis, are diseases which result in destruction of the mucosal surface of
the small or large
intestine, respectively. Thus, TGF alpha HIII polynucleotides or polypeptides,
as well as
agonists or antagonists of TGF alpha HIII, could be used to promote the
resurfacing of the
mucosal surface to aid more rapid healing and to prevent progression of
inflammatory bowel
disease. Treatment with TGF alpha HIII polynucleotides or polypeptides,
agonists or
antagonists of TGF alpha HIII, is expected to have a significant effect on the
production of
mucus throughout the gastrointestinal tract and could be used to protect the
intestinal mucosa
from injurious substances that are ingested or following surgery. TGF alpha
HIII
polynucleotides or polypeptides, as well as agonists or antagonists of TGF
alpha HIII, could
be used to treat diseases associate with the under expression of TGF alpha
HIII.
Moreover, TGF alpha HIII polynucleotides or polypeptides, as well as agonists
or
antagonists of TGF alpha HIII, could be used to prevent and heal damage to the
lungs due to
various pathological states. A growth factor such as TGF alpha HIII
polynucleotides or
polypeptides, as well as agonists or antagonists of TGF alpha HIII, which
could stimulate
proliferation and differentiation and promote the repair of alveoli and
brochiolar epithelium
to prevent or treat acute or chronic lung damage. For example, emphysema,
which results in
the progressive loss of aveoli, and inhalation injuries, i.e., resulting from
smoke inhalation
and burns, that cause necrosis of the bronchiolar epithelium and alveoli could
be effectively
treated using TGF alpha HIII polynucleotides or polypeptides, agonists or
antagonists of TGF
alpha HIII. Also, TGF alpha HIII polynucleotides or polypeptides, as well as
agonists or
antagonists of TGF alpha HIII, could be used to stimulate the proliferation of
and
differentiation of type II pneumocytes, which may help treat or prevent
disease such as
hyaline membrane diseases, such as infant respiratory distress syndrome and
bronchopulmonary displasia, in premature infants.
TGF alpha HIII polynucleotides or polypeptides, as well as agonists or
antagonists of
TGF alpha HIII, could stimulate the proliferation and differentiation of
hepatocytes and, thus,
could be used to alleviate or treat liver diseases and pathologies such as
fulminant liver
failure caused by cirrhosis, liver damage caused by viral hepatitis and toxic
substances (i.e.,
acetaminophen, carbon tetraholoride and other hepatotoxins known in the art).
In addition, TGF alpha HIII polynucleotides or polypeptides, as well as
agonists or
antagonists of TGF alpha HIII, could be used treat or prevent the onset of
diabetes mellitus.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
160
In patients with newly diagnosed Types I and II diabetes, where some islet
cell function
remains, TGF alpha HIII polynucleotides or polypeptides, as well as agonists
or antagonists
of TGF alpha H>ZI, could be used to maintain the islet function so as to
alleviate, delay or
prevent permanent manifestation of the disease. Also, TGF alpha HIII
polynucleotides or
polypeptides, as well as agonists or antagonists of TGF alpha HIII, could be
used as an
auxiliary in islet cell transplantation to improve or promote islet cell
function.
Neurological Diseases
Nervous system disorders, which can be treated with the TGF alpha HIII
compositions
of the invention (e.g., TGF alpha HIII polypeptides, polynucleotides, and/or
agonists or
antagonists), include, but are not limited to, nervous system injuries, and
diseases or disorders
which result in either a disconnection of axons, a diminution or degeneration
of neurons, or
demyelination. Nervous system lesions which may be treated in a patient
(including human
and non-human mammalian patients) according to the invention, include but are
not limited
to, the following lesions of either the central (including spinal cord, brain)
or peripheral
nervous systems: (1) ischemic lesions, in which a lack of oxygen in a portion
of the nervous
system results in neuronal injury or death, including cerebral infarction or
ischemia, or spinal
cord infarction or ischemia; (2) traumatic lesions, including ~ lesions caused
by physical
injury or associated with surgery, for example, lesions which sever a portion
of the nervous
system, or compression injuries; (3) malignant lesions, in which a portion of
the nervous
system is destroyed or injured by malignant tissue which is either a nervous
system associated
malignancy or a malignancy derived from non-nervous system tissue; (4)
infectious lesions,
in which a portion of the nervous system is destroyed or injured as a result
of infection, for
example, by an abscess or associated with infection by human immunodeficiency
virus,
herpes zoster, or herpes simplex virus or with Lyme disease, tuberculosis,
syphilis; (5)
degenerative lesions, in which a portion of the nervous system is destroyed or
injured as a
result of a degenerative process including but not limited to degeneration
associated with
Parkinson's disease, Alzheimer's disease, Huntington's chorea, or amyotrophic
lateral
sclerosis (ALS); (6) lesions associated with nutritional diseases or
disorders, in which a
portion of the nervous system is destroyed or injured by a nutritional
disorder or disorder of
metabolism including but not limited to, vitamin B 12 deficiency, folic acid
deficiency,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
161
Wernicke disease, tobacco-alcohol amblyopia, Marchiafava-Bignami disease
(primary
degeneration of the corpus callosum), and alcoholic cerebellar degeneration;
(7)
neurological lesions associated with systemic diseases including, but not
limited to, diabetes
(diabetic neuropathy, Bell's palsy), systemic lupus erythematosus, carcinoma,
or sarcoidosis;
(8) lesions caused by toxic substances including alcohol, lead, or particular
neurotoxins; and
(9) demyelinated lesions in which a portion of the nervous system is destroyed
or injured by
a demyelinating disease including, but not limited to, multiple sclerosis,
human
immunodeficiency virus-associated myelopathy, transverse myelopathy or various
etiologies,
progressive multifocal leukoencephalopathy, and central pontine myelinolysis.
In a preferred embodiment, the TGF alpha HIII polypeptides, polynucleotides,
or
agonists or antagonists of the invention are used to protect neural cells from
the damaging
effects of cerebral hypoxia. According to this embodiment, the TGF alpha HI>I
compositions
of the invention are used to treat or prevent neural cell injury associated
with cerebral
hypoxia. In one aspect of this embodiment, the TGF alpha HIII polypeptides,
polynucleotides, or agonists or antagonists of the invention are used to treat
or prevent neural
cell injury associated with cerebral ischemia. In another aspect of this
embodiment, the TGF
alpha HIII polypeptides, polynucleotides, or agonists or antagonists of the
invention are used
to treat or prevent neural cell injury associated with cerebral infarction. In
another aspect of
this embodiment, the TGF alpha HIII polypeptides, polynucleotides, or agonists
or
antagonists of the invention are used to treat or prevent neural cell injury
associated with a
stroke. In a further aspect of this embodiment, the TGF alpha HIII
polypeptides,
polynucleotides, or agonists or antagonists of the invention are used to treat
or prevent neural
cell injury associated with a heart attack.
The compositions of the invention which are useful for treating or preventing
a
nervous system disorder may be selected by testing for biological activity in
promoting the
survival or differentiation of neurons. For example, and not by way of
limitation, TGF alpha
HIII compositions of the invention which elicit any of the following effects
may be useful
according to the invention: (1) increased survival time of neurons in culture;
(2) increased
sprouting of neurons in culture or in vivo; (3) increased production of a
neuron-associated
molecule in culture or in vivo, e.g., choline acetyltransferase or
acetylcholinesterase with
respect to motor neurons; or (4) decreased symptoms of neuron dysfunction in
vivo. Such
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
162
effects may be measured by any method known in the art. In preferred, non-
limiting
embodiments, increased survival of neurons may routinely be measured using a
method set
forth herein or otherwise known in the art, such as, for example, the method
set forth in
Arakawa et al. (J. Neurosci. 10:3507-3515 (1990)); increased sprouting of
neurons may be
S detected by methods known in the art, such as, for example, the methods set
forth in Pestronk
et al. (Exp. Neurol. 70:65-82 (1980)) or Brown et al. (Ann. Rev. Neurosci.
4:17-42 (1981));
increased production of neuron-associated molecules may be measured by
bioassay,
enzymatic assay, antibody binding, Northern blot assay, etc., using techniques
known in the
art and depending on the molecule to be measured; and motor neuron dysfunction
may be
measured by assessing the physical manifestation of motor neuron disorder,
e.g., weakness,
motor neuron conduction velocity, or functional disability.
In specific embodiments, motor neuron disorders that may be treated according
to the
invention include, but are not limited to, disorders such as infarction,
infection, exposure to
toxin, trauma, surgical damage, degenerative disease or malignancy that may
affect motor
1 S neurons as well as other components of the nervous system, as well as
disorders that
selectively affect neurons such as amyotrophic lateral sclerosis, and
including, but not limited
to, progressive spinal muscular atrophy, progressive bulbar palsy, primary
lateral sclerosis,
infantile and juvenile muscular atrophy, progressive bulbar paralysis of
childhood (Fazio
Londe syndrome), poliomyelitis and the post polio syndrome, and Hereditary
Motorsensory
Neuropathy (Charcot-Marie-Tooth Disease).
Additional examples of neurologic diseases which can be treated or detected
with
polynucleotides, polypeptides, agonists, and/or antagonists of the present
invention include
brain diseases, such as metabolic brain diseases which includes
phenylketonuria such as
maternal phenylketonuria, pyruvate carboxylase deficiency, pyruvate
dehydrogenase complex
deficiency, Wernicke's Encephalopathy, brain edema, brain neoplasms such as
cerebellar
neoplasms which include infratentorial neoplasms, cerebral ventricle neoplasms
such as
choroid plexus neoplasms, hypothalamic neoplasms, supratentorial neoplasms,
caravan
disease, cerebellar diseases such as cerebellar ataxia which include
spinocerebellar
degeneration such as ataxia telangiectasia, cerebellar dyssynergia,
Friederich's Ataxia,
Machado-Joseph Disease, olivopontocerebellar atrophy, cerebellar neoplasms
such as
infratentorial neoplasms, diffuse cerebral sclerosis such as encephalitis
periaxialis, globoid
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
163
cell leukodystrophy, metachromatic leukodystrophy and subacute sclerosing
panencephalitis,
cerebrovascular disorders (such as carotid artery diseases which include
carotid artery
thrombosis, carotid stenosis and Moyamoya Disease, cerebral amyloid
angiopathy, cerebral
aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous
malformations,
cerebral artery diseases, cerebral embolism and thrombosis such as carotid
artery thrombosis,
sinus thrombosis and Wallenberg's Syndrome, cerebral hemorrhage such as
epidural
hematoma, subdural hematoma and subarachnoid hemorrhage, cerebral infarction,
cerebral
ischemia such as transient cerebral ischemia, Subclavian Steal Syndrome and
vertebrobasilar
insufficiency, vascular dementia such as multi-infarct dementia,
periventricular leukomalacia,
vascular headache such as cluster headache, migraine, dementia such as A>DS
Dementia
Complex, presenile dementia such as Alzheimer's Disease and Creutzfeldt-Jakob
Syndrome,
senile dementia such as Alzheimer's Disease and progressive supranuclear
palsy, vascular
dementia such as mufti-infarct dementia, encephalitis which include
encephalitis periaxialis,
viral encephalitis such as epidemic encephalitis, Japanese Encephalitis, St.
Louis
Encephalitis, tick-borne encephalitis and West Nile Fever, acute disseminated
encephalomyelitis, meningoencephalitis such as uveomeningoencephalitic
syndrome,
Postencephalitic Parkinson Disease and subacute sclerosing panencephalitis,
encephalomalacia such as periventricular leukomalacia, epilepsy such as
generalized epilepsy
which includes infantile spasms, absence epilepsy, myoclonic epilepsy which
includes
MERRF Syndrome, tonic-clonic epilepsy, partial epilepsy such as complex
partial epilepsy,
frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic epilepsy,
status epilepticus
such as Epilepsia Partialis Continua, Hallervorden-Spatz Syndrome,
hydrocephalus such as
Dandy-Walker Syndrome and normal pressure hydrocephalus, hypothalamic diseases
such as
hypothalamic neoplasms, cerebral malaria, narcolepsy which includes cataplexy,
bulbar
poliomyelitis, cerebri pseudotumor, Rett Syndrome, Reye's Syndrome, thalamic
diseases,
cerebral toxoplasmosis, intracranial tuberculoma and Zellweger Syndrome,
central nervous
system infections such as ASS Dementia Complex, Brain Abscess, subdural
empyema,
encephalomyelitis such as Equine Encephalomyelitis, Venezuelan Equine
Encephalomyelitis,
Necrotizing Hemorrhagic Encephalomyelitis, Visna, cerebral malaria, meningitis
such as
arachnoiditis, aseptic meningtitis such as viral meningtitis which includes
lymphocytic
choriomeningitis. Bacterial meningtitis which includes Haemophilus
Meningtitis, Listeria
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
164
Meningtitis, Meningococcal Meningtitis such as Waterhouse-Friderichsen
Syndrome,
Pneumococcal Meningtitis and meningeal tuberculosis, fungal meningitis such as
Cryptococcal Meningtitis, subdural effusion, meningoencephalitis such as
uvemeningoencephalitic syndrome, myelitis such as transverse myelitis,
neurosyphilis such as
tabes dorsalis, poliomyelitis which includes bulbar poliomyelitis and
postpoliomyelitis
syndrome, prion diseases (such as Creutzfeldt-Jakob Syndrome, Bovine
Spongiform
Encephalopathy, Gerstmann-Straussler Syndrome, Kuru, Scrapie) cerebral
toxoplasmosis,
central nervous system neoplasms such as brain neoplasms that include
cerebellear neoplasms
such as infratentorial neoplasms, cerebral ventricle neoplasms such as choroid
plexus
neoplasms, hypothalamic neoplasms and supratentorial neoplasms, meningeal
neoplasms,
spinal cord neoplasms which include epidural neoplasms, demyelinating diseases
such as
Canavan Diseases, diffuse cerebral sceloris which includes
adrenoleukodystrophy,
encephalitis periaxialis, globoid cell leukodystrophy, diffuse cerebral
sclerosis such as
metachromatic leukodystrophy, allergic encephalomyelitis, necrotizing
hemorrhagic
encephalomyelitis, progressive multifocal leukoencephalopathy, multiple
sclerosis, central
pontine myelinolysis, transverse myelitis, neuromyelitis optics, Scrapie,
Swayback, Chronic
Fatigue Syndrome, Visna, High Pressure Nervous Syndrome, Meningism, spinal
cord
diseases such as amyotonia congenita, amyotrophic lateral sclerosis, spinal
muscular atrophy
such as Werdnig-Hoffinann Disease, spinal cord compression, spinal cord
neoplasms such as
epidural neoplasms, syringomyelia, Tabes Dorsalis, Stiff Man Syndrome, mental
retardation
such as Angelman Syndrome, Cri-du-Chat Syndrome, De Lange's Syndrome, Down
Syndrome, Gangliosidoses such as gangliosidoses G(M1), Sandhoff Disease, Tay-
Sachs
Disease, Hartnup Disease, homocystinuria, Laurence-Moon- Biedl Syndrome, Lesch-
Nyhan
Syndrome, Maple Syrup Urine Disease, mucolipidosis such as fucosidosis,
neuronal ceroid-
lipofuscinosis, oculocerebrorenal syndrome, phenylketonuria such as maternal
phenylketonuria, Prader-Willi Syndrome, Rett Syndrome, Rubinstein-Taybi
Syndrome,
Tuberous Sclerosis, WAGR Syndrome, nervous system abnormalities such as
holoprosencephaly, neural tube defects such as anencephaly which includes
hydrangencephaly, Arnold-Chairi Deformity, encephalocele, meningocele,
meningomyelocele, spinal dysraphism such as spins bifida cystica and spins
bifida occults,
hereditary motor and sensory neuropathies which include Charcot-Marie Disease,
Hereditary
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
165
optic atrophy, Refsum's Disease, hereditary spastic paraplegia, Werdnig-
Hoffmann Disease,
Hereditary Sensory and Autonomic Neuropathies such as Congenital Analgesia and
Familial
Dysautonomia, Neurologic manifestations (such as agnosia that include
Gerstmann's
Syndrome, Amnesia such as retrograde amnesia, apraxia, neurogenic bladder,
cataplexy,
communicative disorders such as hearing disorders that includes deafness,
partial hearing
loss, loudness recruitment and tinnitus, language disorders such as aphasia
which include
agraphia, anomia, broca aphasia, and Wernicke Aphasia, Dyslexia such as
Acquired Dyslexia,
language development disorders, speech disorders such as aphasia which
includes anomia,
broca aphasia and Wernicke Aphasia, articulation disorders, communicative
disorders such as
speech disorders which include dysarthria, echolalia, mutism and stuttering,
voice disorders
such as aphonia and hoarseness, decerebrate state, delirium, fasciculation,
hallucinations,
meningism, movement disorders such as angelman syndrome, ataxia, athetosis,
chorea,
dystonia, hypokinesia, muscle hypotonia, myoclonus, tic, torticollis and
tremor, muscle
hypertonia such as muscle rigidity such as stiff man syndrome, muscle
spasticity, paralysis
such as facial paralysis which includes Herpes Zoster Oticus, Gastroparesis,
Hemiplegia,
ophthalmoplegia such as diplopia, Duane's Syndrome, Horner's Syndrome, Chronic
progressive external ophthalmoplegia such as Kearns Syndrome, Bulbar
Paralysis, Tropical
Spastic Paraparesis, Paraplegia such as Brown-Sequard Syndrome, quadriplegia,
respiratory
paralysis and vocal cord paralysis, paresis, phantom limb, taste disorders
such as ageusia and
dysgeusia, vision disorders such as amblyopia, blindness, color vision
defects, diplopia,
hemianopsia, scotoma and subnormal vision, sleep disorders such as hypersomnia
which
includes Kleine-Levin Syndrome, insomnia, and somnambulism, spasm such as
trismus,
unconsciousness such as coma, persistent vegetative state and syncope and
vertigo,
neuromuscular diseases such as amyotonia congenita, amyotrophic lateral
sclerosis, Lambert-
Eaton Myasthenic Syndrome, motor neuron disease, muscular atrophy such as
spinal
muscular atrophy, Charcot-Marie Disease and Werdnig-Hoffmann Disease,
Postpoliomyelitis Syndrome, Muscular Dystrophy, Myasthenia Gravis, Myotonia
Atrophica,
Myotonia Confenita, Nemaline Myopathy, Familial Periodic Paralysis, Multiplex
Paramyloclonus, Tropical Spastic Paraparesis and Stiff Man Syndrome,
peripheral nervous
system diseases such as acrodynia, amyloid neuropathies, autonomic nervous
system diseases
such as Adie's Syndrome, Barre-Lieou Syndrome, Familial Dysautonomia, Horner's
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
166
Syndrome, Reflex Sympathetic Dystrophy and Shy-Drager Syndrome, Cranial Nerve
Diseases such as Acoustic Nerve Diseases such as Acoustic Neuroma which
includes
Neurofibromatosis 2, Facial Nerve Diseases such as Facial Neuralgia,Melkersson-
Rosenthal
Syndrome, ocular motility disorders which includes amblyopia, nystagmus,
oculomotor nerve
paralysis, ophthalmoplegia such as Duane's Syndrome, Horner's Syndrome,
Chronic
Progressive External Ophthalmoplegia which includes Kearns Syndrome,
Strabismus such as
Esotropia and Exotropia, Oculomotor Nerve Paralysis, Optic Nerve Diseases such
as Optic
Atrophy which includes Hereditary Optic Atrophy, Optic Disk Drusen, Optic
Neuritis such as
Neuromyelitis Optica, Papilledema, Trigeminal Neuralgia, Vocal Cord Paralysis,
Demyelinating Diseases such as Neuromyelitis Optica and Swayback, Diabetic
neuropathies
such as diabetic foot, nerve compression syndromes such as carpal tunnel
syndrome, tarsal
tunnel syndrome, thoracic outlet syndrome such as cervical rib syndrome, ulnar
nerve
compression syndrome, neuralgia such as causalgia, cervico-brachial neuralgia,
facial
neuralgia and trigeminal neuralgia, neuritis such as experimental allergic
neuritis, optic
neuritis, polyneuritis, polyradiculoneuritis and radiculities such as
polyradiculitis, hereditary
motor and sensory neuropathies such as Charcot-Marie Disease, Hereditary Optic
Atrophy,
Refsum's Disease, Hereditary Spastic Paraplegia and Werdnig-Hoffinann Disease,
Hereditary
Sensory and Autonomic Neuropathies which include Congenital Analgesia and
Familial
Dysautonomia, POEMS Syndrome, Sciatica, Gustatory Sweating and Tetany).
Infectious Disease
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, can be used to treat or detect infectious agents. For example, by
increasing the
immune response, particularly increasing the proliferation and differentiation
of B and/or T
cells, infectious diseases may be treated. The immune response may be
increased by either
enhancing an existing immune response, or by initiating a new immune response.
Alternatively, TGF alpha HIII polynucleotides or polypeptides, or agonists or
antagonists of
TGF alpha HIII, may also directly inhibit the infectious agent, without
necessarily eliciting an
immune response.
Viruses are one example of an infectious agent that can cause disease or
symptoms
that can be treated or detected by a polynucleotide or polypeptide and/or
agonist or antagonist
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
167
of the present invention. Examples of viruses, include, but are not limited to
Examples of
viruses, include, but are not limited to the following DNA and RNA viruses and
viral
families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae,
Bunyaviridae,
Caliciviridae, Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae,
Hepadnaviridae
(Hepatitis), Herpesviridae (such as, Cytomegalovirus, Herpes Simplex, Herpes
Zoster),
Mononegavirus (e.g., Paramyxoviridae, Morbillivirus, Rhabdoviridae),
Orthomyxoviridae
(e.g., Influenza A, Influenza B, and parainfluenza), Papiloma virus,
Papovaviridae,
Parvoviridae, Picornaviridae, Poxviridae (such as Smallpox or Vaccinia),
Reoviridae (e.g.,
Rotavirus), Retroviridae (HTLV-I, HTLV-II, Lentivirus), and Togaviridae (e.g.,
Rubivirus).
Viruses falling within these families can cause a variety of diseases or
symptoms, including,
but not limited to: arthritis, bronchiollitis, respiratory syncytial virus,
encephalitis, eye
infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome,
hepatitis (A, B, C, E,
Chronic Active, Delta), Japanese B encephalitis, Junin, Chikungunya, Rift
Valley fever,
yellow fever, meningitis, opportunistic infections (e.g., AIDS), pneumonia,
Burkitt's
Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps, Parainfluenza,
Rabies, the
common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin
diseases (e.g.,
Kaposi's, warts), and viremia. polynucleotides or polypeptides, or agonists or
antagonists of
the invention, can be used to treat or detect any of these symptoms or
diseases. In specific
embodiments, polynucleotides, polypeptides, or agonists or antagonists of the
invention are
used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g., hepatitis B).
In an additional
specific embodiment polynucleotides, polypeptides, or agonists or antagonists
of the
invention are used to treat patients nonresponsive to one or more other
commercially
available hepatitis vaccines. In a further specific embodiment
polynucleotides, polypeptides,
or agonists or antagonists of the invention are used to treat AIDS.
Similarly, bacterial or fungal agents that can cause disease or symptoms and
that can
be treated or detected by a polynucleotide or polypeptide and/or agonist or
antagonist of the
present invention include, but not limited to, include, but not limited to,
the following Gram-
Negative and Gram-positive bacteria and bacterial families and fungi:
Actinomycetales (e.g.,
Corynebacterium, Mycobacterium, Norcardia), Cryptococcus neoformans,
Aspergillosis,
Bacillaceae (e.g., Anthrax, Clostridium), Bacteroidaceae, Blastomycosis,
Bordetella, Borrelia
(e.g., Borrelia burgdorferi), Brucellosis, Candidiasis, Campylobacter,
Coccidioidomycosis,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
168
Cryptococcosis, Dermatocycoses, E. coli (e.g., Enterotoxigenic E. coli and
Enterohemorrhagic E. coli), Enterobacteriaceae (Klebsiella, Salmonella (e.g.,
Salmonella
typhi, and Salmonella paratyphi), Serratia, Yersinia), Erysipelothrix,
Helicobacter,
Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Mycobacterium leprae,
Vibrio
cholerae, Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal),
Meisseria
meningitidis, Pasteurellacea Infections (e.g., Actinobacillus, Heamophilus
(e.g., Heamophilus
influenza type B), Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae,
Syphilis,
Shigella spp., Staphylococcal, Meningiococcal, Pneumococcal and Streptococcal
(e.g.,
Streptococcus pneumoniae and Group B Streptococcus). These bacterial or fungal
families
can cause the following diseases or symptoms, including, but not limited to:
bacteremia,
endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis),
gingivitis, opportunistic
infections (e.g., AIDS related infections), paronychia, prosthesis-related
infections, Reiter's
Disease, respiratory tract infections, such as Whooping Cough or Empyema,
sepsis, Lyme
Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning,
Typhoid,
pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B), Chlamydia,
Syphilis,
Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism,
gangrene, tetanus,
impetigo, Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin
diseases (e.g.,
cellulitis, dermatocycoses), toxemia, urinary tract infections, wound
infections.
Polynucleotides or polypeptides, agonists or antagonists of the invention, can
be used to treat
or detect any of these symptoms or diseases. In specific embodiments,
Ppolynucleotides,
polypeptides, agonists or antagonists of the invention are, used to treat:
tetanus, Diptheria,
botulism, and/or meningitis type B.
Moreover, parasitic agents causing disease or symptoms that can be treated or
detected by a polynucleotide or polypeptide and/or agonist or antagonist of
the present
invention include, but not limited to, the following families or class:
Amebiasis, Babesiosis,
Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic,
Giardiasis,
Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis,
and
Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium falciparium,
Plasmodium
malariae and Plasmodium ovate). These parasites can cause a variety of
diseases or
symptoms, including, but not limited to: Scabies, Trombiculiasis, eye
infections, intestinal
disease (e.g., dysentery, giardiasis), liver disease, lung disease,
opportunistic infections (e.g.,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
169
AmS related), malaria, pregnancy complications, and toxoplasmosis.
polynucleotides or
polypeptides, or agonists or antagonists of the invention, can be used to
treat or detect any of
these symptoms or diseases. In specific embodiments, polynucleotides,
polypeptides, or
agonists or antagonists of the invention are used to treat malaria.
S Preferably, treatment using a polypeptide or polynucleotide and/or agonist
or
antagonist of the present invention could either be by administering an
effective amount of a
polypeptide to the patient, or by removing cells from the patient, supplying
the cells with a
polynucleotide of the present invention, and returning the engineered cells to
the patient (ex
vivo therapy). Moreover, the polypeptide or polynucleotide of the present
invention can be
used as an antigen in a vaccine to raise an immune response against infectious
disease.
Regeneration
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, can be used to differentiate, proliferate, and attract cells,
leading to the
regeneration of tissues. (See, Science 276:59-87 (1997).) The regeneration of
tissues could
be used to repair, replace, or protect tissue damaged by congenital defects,
trauma (wounds,
burns, incisions, or ulcers), age, disease (e.g. osteoporosis,
osteocarthritis, periodontal
disease, liver failure), surgery, including cosmetic plastic surgery,
fibrosis, reperfusion injury,
or systemic cytokine damage.
Tissues that could be regenerated using the present invention include organs
(e.g.,
pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth,
skeletal or cardiac),
vasculature (including vascular and lymphatics), nervous, hematopoietic, and
skeletal (bone,
cartilage, tendon, and ligament) tissue. Preferably, regeneration occurs
without or decreased
scarnng. Regeneration also may include angiogenesis.
Moreover, TGF alpha HIII polynucleotides or polypeptides, or agonists or
antagonists
of TGF alpha HIII, may increase regeneration of tissues difficult to heal. For
example,
increased tendon/ligament regeneration would quicken recovery time after
damage. TGF
alpha HIII polynucleotides or polypeptides, or agonists or antagonists of TGF
alpha HIII, of
the present invention could also be used prophylactically in an effort to
avoid damage.
Specific diseases that could be treated include of tendinitis, carpal tunnel
syndrome, and other
tendon or ligament defects. A further example of tissue regeneration of non-
healing wounds
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
170
includes pressure ulcers, ulcers associated with vascular insufficiency,
surgical, and traumatic
wounds.
Similarly, nerve and brain tissue could also be regenerated by using TGF alpha
HIII
polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIII,
to proliferate
and differentiate nerve cells. Diseases that could be treated using this
method include central
and peripheral nervous system diseases, neuropathies, or mechanical and
traumatic disorders
(e.g., spinal cord disorders, head trauma, cerebrovascular disease, and
stoke). Specifically,
diseases associated with peripheral nerve injuries, peripheral neuropathy
(e.g., resulting from
chemotherapy or other medical therapies), localized neuropathies, and central
nervous system
diseases (e.g., Alzheimer's disease, Parkinson's disease, Huntington's
disease, amyotrophic
lateral sclerosis, and Shy-Drager syndrome), could all be treated using the
TGF alpha HIII
polynucleotides or polypeptides, or agonists or antagonists of TGF alpha HIII.
Chemotaxis
1 S TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists
of TGF
alpha HIII, may have chemotaxis activity. A chemotaxic molecule attracts or
mobilizes cells
(e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils,
epithelial and/or
endothelial cells) to a particular site in the body, such as inflammation,
infection, or site of
hyperproliferation. The mobilized cells can then fight off and/or heal the
particular trauma or
abnormality.
TGF alpha HIII polynucleotides or polypeptides, or agonists or antagonists of
TGF
alpha HIII, may increase chemotaxic activity of particular cells. These
chemotactic molecules
can then be used to treat inflammation, infection, hyperproliferative
disorders, or any immune
system disorder by increasing the number of cells targeted to a particular
location in the body.
For example, chemotaxic molecules can be used to treat wounds and other trauma
to tissues
by attracting immune cells to the injured location. Chemotactic molecules of
the present
invention can also attract fibroblasts, which can be used to treat wounds.
It is also contemplated that TGF alpha HIII polynucleotides or polypeptides,
or
agonists or antagonists of TGF alpha HIII, may inhibit chemotactic activity.
These molecules
could also be used to treat disorders. Thus, TGF alpha HIII polynucleotides or
polypeptides,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
171
or agonists or antagonists of TGF alpha HIII, could be used as an inhibitor of
chemotaxis.
Binding Activity
TGF alpha HIII polypeptides may be used to screen for molecules that bind to
TGF
alpha HIII or for molecules to which TGF alpha HIII binds. The binding of TGF
alpha HIII
and the molecule may activate (agonist), increase, inhibit (antagonist), or
decrease activity of
the TGF alpha HIII or the molecule bound. Examples of such molecules include
antibodies,
oligonucleotides, proteins (e.g., receptors),or small molecules.
Preferably, the molecule is closely related to the natural ligand of TGF alpha
HIII,
e.g., a fragment of the ligand, or a natural substrate, a ligand, a structural
or functional
mimetic. (See, Coligan et al., Current Protocols in Immunology 1(2):Chapter 5
(1991).)
Similarly, the molecule can be closely related to the natural receptor to
which TGF alpha HIII
binds, or at least, a fragment of the receptor capable of being bound by TGF
alpha HIII (e.g.,
1 S active site). In either case, the molecule can be rationally designed
using known techniques.
Preferably, the screening for these molecules involves producing appropriate
cells
which express TGF alpha HIII, either as a secreted protein or on the cell
membrane.
Preferred cells include cells from mammals, yeast, Drosophila, or E. coli.
Cells expressing
TGF alpha HIII(or cell membrane containing the expressed polypeptide) are then
preferably
contacted with a test compound potentially containing the molecule to observe
binding,
stimulation, or inhibition of activity of either TGF alpha HIII or the
molecule.
The assay may simply test binding of a candidate compound toTGF alpha HIII,
wherein binding is detected by a label, or in an assay involving competition
with a labeled
competitor. Further, the assay may test whether the candidate compound results
in a signal
generated by binding to TGF alpha HIII.
Alternatively, the assay can be carried out using cell-free preparations,
polypeptide/molecule affixed to a solid support, chemical libraries, or
natural product
mixtures. The assay may also simply comprise the steps of mixing a candidate
compound
with a solution containing TGF alpha HIII, measuring TGF alpha HIII/molecule
activity or
binding, and comparing the TGF alpha HIII/molecule activity or binding to a
standard.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
172
Preferably, an ELISA assay can measure TGF alpha HIII level or activity in a
sample
(e.g., biological sample) using a monoclonal or polyclonal antibody. The
antibody can
measure TGF alpha HIII level or activity by either binding, directly or
indirectly, to TGF
alpha HIII or by competing with TGF alpha HIII for a substrate.
Additionally, the receptor to which TGF alpha HIII binds can be identified by
numerous methods known to those of skill in the art, for example, ligand
panning and FACS
sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5,
(1991)). For example,
expression cloning is employed wherein polyadenylated RNA is prepared from a
cell
responsive to the polypeptides, for example, NIH3T3 cells which are known to
contain
multiple receptors for the FGF family proteins, and SC-3 cells, and a cDNA
library created
from this RNA is divided into pools and used to transfect COS cells or other
cells that are not
responsive to the polypeptides. Transfected cells which are grown on glass
slides are exposed
to the polypeptide of the present invention, after they have been labelled.
The polypeptides
can be labeled by a variety of means including iodination or inclusion of a
recognition site for
a site-specific protein kinase.
Following fixation and incubation, the slides are subjected to auto-
radiographic
analysis. Positive pools are identified and sub-pools are prepared and re-
transfected using an
iterative sub-pooling and re-screening process, eventually yielding a single
clones that
encodes the putative receptor.
As an alternative approach for receptor identification, the labeled
polypeptides can be
photoaffmity linked with cell membrane or extract preparations that express
the receptor
molecule. Cross-linked material is resolved by PAGE analysis and exposed to X-
ray film.
The labeled complex containing the receptors of the polypeptides can be
excised, resolved
into peptide fragments, and subjected to protein microsequencing. The amino
acid sequence
obtained from microsequencing would be used to design a set of degenerate
oligonucleotide
probes to screen a cDNA library to identify the genes encoding the putative
receptors.
Moreover, the techniques of gene-shuffling, motif shuffling, exon-shuffling,
and/or
codon-shuffling (collectively referred to as "DNA shuffling") may be employed
to modulate
the activities of TGF alpha HI>Z thereby effectively generating agonists and
antagonists of
TGF alpha HIII. See generally, U.S. Patent Nos. 5,605,793, 5,811,238,
5,830,721, 5,834,252,
and 5,837,458, and Patten, P. A., et al., Curr. Opinion Biotechnol. 8:724-33
(1997);
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
173
Harayama, S. Trends Biotechnol. 16(2):76-82 (1998); Hansson, L. O., et al., J.
Mol. Biol.
287:265-76 (1999); and Lorenzo, M. M. and Blasco, R. Biotechniques 24(2):308-
13 (1998)
(each of these patents and publications are hereby incorporated by reference).
In one
embodiment, alteration of TGF alpha HIII polynucleotides and corresponding
polypeptides
may be achieved by DNA shuffling. DNA shuffling involves the assembly of two
or more
DNA segments into a desired TGF alpha HIII molecule by homologous, or site-
specific,
recombination. In another embodiment, TGF alpha HIII polynucleotides and
corresponding
polypeptides may be alterred by being subjected to random mutagenesis by error-
prone PCR,
random nucleotide insertion or other methods prior to recombination. In
another
embodiment, one or more components, motifs, sections, parts, domains,
fragments, etc., of
TGF alpha HIII may be recombined with one or more components, motifs,
sections, parts,
domains, fragments, etc. of one or more heterologous molecules. In preferred
embodiments,
the heterologous molecules are Transforming Growth Factor family members. In
further
preferred embodiments, the heterologous molecule is a growth factor such as,
for example,
platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-I),
transforming
growth factor (TGF)-alpha, epidermal growth factor (EGF), fibroblast growth
factor (FGF),
TGF-beta, bone morphogenetic protein (BMP)-2, BMP-4, BMP-S, BMP-6, BMP-7,
activins
A and B, decapentaplegic(dpp), 60A, OP-2, dorsalin, growth differentiation
factors (GDFs),
nodal, MIS, inhibin-alpha, TGF-betal, TGF-beta2, TGF-beta3, TGF-betas, and
glial-derived
neurotrophic factor (GDNF).
Other preferred fragments are biologically active TGF alpha HIII fragments.
Biologically active fragments are those exhibiting activity similar, but not
necessarily
identical, to an activity of the TGF alpha HIII polypeptide. The biological
activity of the
fragments may include an improved desired activity, or a decreased undesirable
activity.
Additionally, this invention provides a method of screening compounds to
identify
those which modulate the action of the polypeptide of the present invention.
An example of
such an assay comprises combining a mammalian fibroblast cell, a the
polypeptide of the
present invention, the compound to be screened and 3[H] thymidine under cell
culture
conditions where the fibroblast cell would normally proliferate. A control
assay may be
performed in the absence of the compound to be screened and compared to the
amount of
fibroblast proliferation in the presence of the compound to determine if the
compound
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
174
stimulates proliferation by determining the uptake of 3[H] thymidine in each
case. The
amount of fibroblast cell proliferation is measured by liquid scintillation
chromatography
which measures the incorporation of 3[H] thymidine. Both agonist and
antagonist
compounds may be identified by this procedure.
S In another method, a mammalian cell or membrane preparation expressing a
receptor
for a polypeptide of the present invention is incubated with a labeled
polypeptide of the
present invention in the presence of the compound. The ability of the compound
to enhance
or block this interaction could then be measured. Alternatively, the response
of a known
second messenger system following interaction of a compound to be screened and
the TGF
alpha HIII receptor is measured and the ability of the compound to bind to the
receptor and
elicit a second messenger response is measured to determine if the compound is
a potential
agonist or antagonist. Such second messenger systems include but are not
limited to, cAMP
guanylate cyclase, ion channels or phosphoinositide hydrolysis.
All of these above assays can be used as diagnostic or prognostic markers. The
molecules discovered using these assays can be used to treat disease or to
bring about a
particular result in a patient (e.g., blood vessel growth) by activating or
inhibiting the
polypeptide/molecule. Moreover, the assays can discover agents which may
inhibit or
enhance the production of the polypeptides of the invention from suitably
manipulated cells
or tissues. Therefore, the invention includes a method of identifying
compounds which bind
to TGF alpha H)ZI comprising the steps of: (a) incubating a candidate binding
compound
with TGF alpha HIII; and (b) determining if binding has occurred. Moreover,
the invention
includes a method of identifying agonists/antagonists comprising the steps of
(a) incubating
a candidate compound with TGF alpha HIII, (b) assaying a biological activity ,
and (b)
determining if a biological activity of TGF alpha H)ZI has been altered.
Also, one could identify molecules bind TGF alpha HIII experimentally by using
the
beta-pleated sheet regions disclosed in Figure 3 and Table 1. Accordingly,
specific
embodiments of the invention are directed to polynucleotides encoding
polypeptides which
comprise, or alternatively consist of, the amino acid sequence of each beta
pleated sheet
regions disclosed in Figure 3/Table 1. Additional embodiments of the invention
are directed
to polynucleotides encoding TGF alpha HIII polypeptides which comprise, or
alternatively
consist of, any combination or all of the beta pleated sheet regions disclosed
in Figure 3/Table
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
175
1. Additional preferred embodiments of the invention are directed to
polypeptides which
comprise, or alternatively consist of, the TGF alpha HIII amino acid sequence
of each of the
beta pleated sheet regions disclosed in Figure 3/Table 1. Additional
embodiments of the
invention are directed to TGF alpha HIII polypeptides which comprise, or
alternatively
consist of, any combination or all of the beta pleated sheet regions disclosed
in Figure 3/Table
1.
Targeted Delivery
In another embodiment, the invention provides a method of delivering
compositions
to targeted cells expressing a receptor for a polypeptide of the invention, or
cells expressing a
cell bound form of a polypeptide of the invention.
As discussed herein, polypeptides or antibodies of the invention may be
associated
with heterologous polypeptides, heterologous nucleic acids, toxins, or
prodrugs via
hydrophobic, hydrophilic, ionic and/or covalent interactions. In one
embodiment, the
invention provides a method for the specific delivery of compositions of the
invention to cells
by administering polypeptides of the invention (including antibodies) that are
associated with
heterologous polypeptides or nucleic acids. In one example, the invention
provides a method
for delivering a therapeutic protein into the targeted cell. In another
example, the invention
provides a method for delivering a single stranded nucleic acid (e.g.,
antisense or ribozymes)
or double stranded nucleic acid (e.g., DNA that can integrate into the cell's
genome or
replicate episomally and that can be transcribed) into the targeted cell.
In another embodiment, the invention provides a method for the specific
destruction
of cells (e.g., the destruction of tumor cells) by administering polypeptides
of the invention
(e.g., polypeptides of the invention or antibodies of the invention) in
association with toxins
or cytotoxic prodrugs.
By "toxin" is meant compounds that bind and activate endogenous cytotoxic
effector
systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of
toxins, or any
molecules or enzymes not normally present in or on the surface of a cell that
under defined
conditions cause the cell's death. Toxins that may be used according to the
methods of the
invention include, but are not limited to, radioisotopes known in the art,
compounds such as,
for example, antibodies (or complement fixing containing portions thereof)
that bind an
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
176
inherent or induced endogenous cytotoxic effector system, thymidine kinase,
endonuclease,
RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin,
saporin,
momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin.
By
"cytotoxic prodrug" is meant a non-toxic compound that is converted by an
enzyme, normally
present in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may be
used
according to the methods of the invention include, but are not limited to,
glutamyl derivatives
of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide
or mitomycin C,
cytosine arabinoside, daunorubisin, and phenoxyacetamide derivatives of
doxorubicin.
Drug Screening
Further contemplated is the use of the polypeptides of the present invention,
or the
polynucleotides encoding these polypeptides, to screen for molecules which
modify the
activities of the polypeptides of the present invention. Such a method would
include
contacting the polypeptide of the present invention with a selected compounds)
suspected of
1 S having antagonist or agonist activity, and assaying the activity of these
polypeptides
following binding.
This invention is particularly useful for screening therapeutic compounds by
using the
polypeptides of the present invention, or binding fragments thereof, in any of
a variety of drug
screening techniques. The polypeptide or fragment employed in such a test may
be affixed to
a solid support, expressed on a cell surface, free in solution, or located
intracellularly. One
method of drug screening utilizes eukaryotic or prokaryotic host cells which
are stably
transformed with recombinant nucleic acids expressing the polypeptide or
fragment. Drugs
are screened against such transformed cells in competitive binding assays. One
may measure,
for example, the formulation of complexes between the agent being tested and a
polypeptide
of the present invention.
Thus, the present invention provides methods of screening for drugs or any
other
agents which affect activities mediated by the polypeptides of the present
invention. These
methods comprise contacting such an agent with a polypeptide of the present
invention or a
fragment thereof and assaying for the presence of a complex between the agent
and the
polypeptide or a fragment thereof, by methods well known in the art. In such a
competitive
binding assay, the agents to screen are typically labeled. Following
incubation, free agent is
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
177
separated from that present in bound form, and the amount of free or
uncomplexed label is a
measure of the ability of a particular agent to bind to the polypeptides of
the present
invention.
Another, technique for drug screening provides high throughput screening for
compounds having suitable binding affinity to the polypeptides of the present
invention, and
is described in great detail in European Patent Application 84/03564,
published on September
13, 1984, which is incorporated herein by reference herein. Briefly stated,
large numbers of
different small peptide test compounds are synthesized on a solid substrate,
such as plastic
pins or some other surface. The peptide test compounds are reacted with
polypeptides of the
present invention and washed. Bound polypeptides are then detected by methods
well known
in the art. Purified polypeptides are coated directly onto plates for use in
the aforementioned
drug screening techniques. In addition, non-neutralizing antibodies may be
used to capture
the peptide and immobilize it on the solid support.
This invention also contemplates the use of competitive drug screening assays
in
which neutralizing antibodies capable of binding polypeptides of the present
invention
specifically compete with a test compound for binding to the polypeptides or
fragments
thereof. In this manner, the antibodies are used to detect the presence of any
peptide which
shares one or more antigenic epitopes with a polypeptide of the invention.
Antisense And Ribozyme (Antagonists)
In specific embodiments, antagonists according to the present invention are
nucleic
acids corresponding to the sequences contained in SEQ ID NO:1, or the
complementary
strand thereof, and/or to nucleotide sequences contained in the deposited
clone 97342. In one
embodiment, antisense sequence is generated internally, by the organism, in
another
embodiment, the antisense sequence is separately administered (see, for
example, O'Connor,
J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Anitsense Inhibitors of
Gene
Expression, CRC Press, Boca Raton, FL (1988). Antisense technology can be used
to control
gene expression through antisense DNA or RNA, or through triple-helix
formation.
Antisense techniques are discussed for example, in Okano, J., Neurochem.
56:560 (1991);
Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press,
Boca Raton,
FL (1988). Triple helix formation is discussed in, for instance, Lee et al.,
Nucleic Acids
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
178
Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et
al., Science
251:1300 ( 1991 ). The methods are based on binding of a polynucleotide to a
complementary
DNA or RNA.
For example, the use of c-myc and c-myb antisense RNA constructs to inhibit
the
growth of the non-lymphocytic leukemia cell line HL-60 and other cell lines
was previously
described. (Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments
were
performed in vitro by incubating cells with the oligoribonucleotide. A similar
procedure for
in vivo use is described in WO 91/15580. Briefly, a pair of oligonucleotides
for a given
antisense RNA is produced as follows: A sequence complimentary to the first 15
bases of the
open reading frame is flanked by an EcoRl site on the 5 end and a HindIII site
on the 3 end.
Next, the pair of oligonucleotides is heated at 90°C for one minute and
then annealed in 2X
ligation buffer (20mM TRIS HCl pH 7.5, IOmM MgCl2, IOMM dithiothreitol (DTT)
and 0.2
mM ATP) and then ligated to the EcoRl/Hind III site of the retroviral vector
PMV7 (WO
91/15580).
For example, the 5' coding portion of a polynucleotide that encodes the mature
polypeptide of the present invention may be used to design an antisense RNA
oligonucleotide
of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed
to be
complementary to a region of the gene involved in transcription thereby
preventing
transcription and the production of the receptor. The antisense RNA
oligonucleotide
hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule
into receptor
polypeptide.
In one embodiment, the TGF alpha HIII antisense nucleic acid of the invention
is
produced intracellularly by transcription from an exogenous sequence. For
example, a vector
or a portion thereof, is transcribed, producing an antisense nucleic acid
(RNA) of the
invention. Such a vector would contain a sequence encoding the TGF alpha HIII
antisense
nucleic acid. Such a vector can remain episomal or become chromosomally
integrated, as
long as it can be transcribed to produce the desired antisense RNA. Such
vectors can be
constructed by recombinant DNA technology methods standard in the art. Vectors
can be
plasmid, viral, or others known in the art, used for replication and
expression in vertebrate
cells. Expression of the sequence encoding TGF alpha HIII, or fragments
thereof, can be by
any promoter known in the art to act in vertebrate, preferably human cells.
Such promoters
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
179
can be inducible or constitutive. Such promoters include, but are not limited
to, the SV40
early promoter region (Bernoist and Chambon, Nature 29:304-310 (1981), the
promoter
contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et
al., Cell 22:787-
797 (1980), the herpes thymidine promoter (Wagner et al., Proc. Natl. Acad.
Sci. U.S.A.
78:1441-1445 (1981), the regulatory sequences of the metallothionein gene
(Brinster, et al.,
Nature 296:39-42 (1982)), etc.
The antisense nucleic acids of the invention comprise a sequence complementary
to at
least a portion of an RNA transcript of a TGF alpha HIII gene. However,
absolute
complementarity, although preferred, is not required. A sequence
"complementary to at least
a portion of an RNA," referred to herein, means a sequence having sufficient
complementarity to be able to hybridize with the RNA, forming a stable duplex;
in the case of
double stranded TGF alpha HIII antisense nucleic acids, a single strand of the
duplex DNA
may thus be tested, or triplex formation may be assayed. The ability to
hybridize will depend
on both the degree of complementarity and the length of the antisense nucleic
acid.
Generally, the larger the hybridizing nucleic acid, the more base mismatches
with a TGF
alpha HIII RNA it may contain and still form a stable duplex (or triplex as
the case may be).
One skilled in the art can ascertain a tolerable degree of mismatch by use of
standard
procedures to determine the melting point of the hybridized complex.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
180
Oligonucleotides that are complementary to the 5' end of the message, e.g.,
the 5'
untranslated sequence up to and including the AUG initiation codon, should
work most
efficiently at inhibiting translation. However, sequences complementary to the
3' untranslated
sequences of mRNAs have been shown to be effective at inhibiting translation
of mRNAs as
well. See generally, Wagner, R., 1994, Nature 372:333-335. Thus,
oligonucleotides
complementary to either the 5'- or 3'- non- translated, non-coding regions of
TGF alpha HIZI
shown in Figures lA-B could be used in an antisense approach to inhibit
translation of
endogenous TGF alpha HIII mRNA. Oligonucleotides complementary to the 5'
untranslated
region of the mRNA should include the complement of the AUG start codon.
Antisense
oligonucleotides complementary to mRNA coding regions are less efficient
inhibitors of
translation but could be used in accordance with the invention. Whether
designed to
hybridize to the 5'-, 3'- or coding region of TGF alpha HIII mRNA, antisense
nucleic acids
should be at least six nucleotides in length, and are preferably
oligonucleotides ranging from
6 to about 50 nucleotides in length. In specific aspects the oligonucleotide
is at least 10
nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50
nucleotides.
The polynucleotides of the invention can be DNA or RNA or chimeric mixtures or
derivatives or modified versions thereof, single-stranded or double-stranded.
The
oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate
backbone, for
example, to improve stability of the molecule, hybridization, etc. The
oligonucleotide may
include other appended groups such as peptides (e.g., for targeting host cell
receptors in
vivo), or agents facilitating transport across the cell membrane (see, e.g.,
Letsinger et al.,
1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc.
Natl. Acad.
Sci. 84:648-652; PCT Publication No. W088/09810, published December 15, 1988)
or the
blood-brain barrier (see, e.g., PCT Publication No. W089/10134, published
April 25, 1988),
hybridization-triggered cleavage agents. (See, e.g., Krol et al., 1988,
BioTechniques 6:958-
976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549).
To this end, the
oligonucleotide may be conjugated to another molecule, e.g., a peptide,
hybridization
triggered cross-linking agent, transport agent, hybridization-triggered
cleavage agent, etc.
The antisense oligonucleotide may comprise at least one modified base moiety
which
is selected from the group including, but not limited to, S-fluorouracil, S-
bromouracil,
5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
181
5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine,
S-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-
adenine,
7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-
D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-
methylthio-N6
isopentenyladenine, uracil-S-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, ' 4-thiouracil, 5-
methyluracil, uracil
S-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-
thiouracil, 3-(3-amino
3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
The antisense oligonucleotide may also comprise at least one modified sugar
moiety
selected from the group including, but not limited to, arabinose, 2-
fluoroarabinose, xylulose,
and hexose.
In yet another embodiment, the antisense oligonucleotide comprises at least
one
modified phosphate backbone selected from the group including, but not limited
to, a
phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a
phosphoramidate, a
phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a
formacetal or
analog thereof.
In yet another embodiment, the antisense oligonucleotide is an a-anomeric
oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded
hybrids with
complementary RNA in which, contrary to the usual b-units, the strands run
parallel to each
other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The
oligonucleotide is a 2'-0-
methylribonucleotide (moue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a
chimeric
RNA-DNA analogue (moue et al., 1987, FEBS Lett. 215:327-330).
Polynucleotides of the invention may be synthesized by standard methods known
in
the art, e.g. by use of an automated DNA synthesizer (such as are commercially
available
from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate
oligonucleotides
may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res.
16:3209),
methylphosphonate oligonucleotides can be prepared by use of controlled pore
glass polymer
supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451),
etc.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
182
While antisense nucleotides complementary to the TGF alpha HIII coding region
sequence could be used, those complementary to the transcribed untranslated
region are most
preferred.
Potential antagonists according to the invention also include catalytic RNA,
or a
ribozyme (See, e.g., PCT International Publication WO 90/11364, published
October 4, 1990;
Sarver et al, Science 247:1222-1225 (1990). While ribozymes that cleave mRNA
at site
specific recognition sequences can be used to destroy TGF alpha HIII mRNAs,
the use of
hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at
locations
dictated by flanking regions that form complementary base pairs with the
target mRNA. The
sole requirement is that the target mRNA have the following sequence of two
bases: 5'-UG-3'.
The construction and production of hammerhead ribozymes is well known in the
art and is
described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988). There
are
numerous potential hammerhead ribozyme cleavage sites within the nucleotide
sequence of
TGF alpha HIII (Figures lA-B). Preferably, the ribozyme is engineered so that
the cleavage
recognition site is located near the 5' end of the TGF alpha HIII mRNA; i.e.,
to increase
efficiency and minimize the intracellular accumulation of non-functional mRNA
transcripts.
As in the antisense approach, the ribozymes of the invention can be composed
of
modified oligonucleotides (~ for improved stability, targeting, etc.) and
should be delivered
to cells which express TGF alpha HIII in vivo. DNA constructs encoding the
ribozyme may
be introduced into the cell in the same manner as described above for the
introduction of
antisense encoding DNA. A preferred method of delivery involves using a DNA
construct
"encoding" the ribozyme under the control of a strong constitutive promoter,
such as, for
example, pol III or pol II promoter, so that transfected cells will produce
sufficient quantities
of the ribozyme to destroy endogenous TGF alpha HIII messages and inhibit
translation.
Since ribozymes unlike antisense molecules, are catalytic, a lower
intracellular concentration
is required for efficiency.
Antagonist/agonist compounds may be employed to inhibit the cell growth and
proliferation effects of the polypeptides of the present . invention on
neoplastic cells and
tissues, i.e. stimulation of angiogenesis of tumors, and, therefore, retard or
prevent abnormal
cellular growth and proliferation, for example, in tumor formation or growth.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
183
The antagonist/agonist may also be employed to prevent hyper-vascular
diseases, and
prevent the proliferation of epithelial lens cells after extracapsular
cataract surgery.
Prevention of the mitogenic activity of the polypeptides of the present
invention may also be
desirous in cases such as restenosis after balloon angioplasty.
S The antagonist/agonist may also be employed to prevent the growth of scar
tissue
during wound healing.
The antagonist/agonist may also be employed to treat the diseases described
herein.
Thus, the invention provides a method of treating disorders or diseases,
including but
not limited to the disorders or diseases listed throughout this application,
associated with
overexpression of a polynucleotide of the present invention by administering
to a patient (a)
an antisense molecule directed to the polynucleotide of the present invention,
and/or (b) a
ribozyme directed to the polynucleotide of the present invention.
Additionally, this invention provides a method of screening compounds to
identify
agonist or antagonist compounds to the polypeptide of the present invention.
As an example,
a mammalian cell or membrane preparation expressing a TGF alphaHIII receptor
is
incubated with a potential compound and the ability of the compound to
generate a second
signal from the receptor is measured to determine if it is an effective
agonist. Such second
messenger systems include but are not limited to, cAMP guanylate cyclase, ion
channels or
phosphoinositide hydrolysis. Effective antagonists are determined by the
method above
wherein an antagonist compound is detected which binds to the receptor but
does not elicit a
second messenger response to thereby block the receptor from TGF alpha HIII.
Another assay for identifying potential antagonists specific to the receptors
to the
polypeptide of the present invention is a competition assay which comprises
isolating plasma
membranes which overexpress a receptor to the polypeptide of the present
invention, for
example, human A431 carcinoma cells. Serially diluted test sample in a medium
(volume is
approximately 10 microliters) containing 10 nM 125I-TGF alpha HIII is added to
five
micrograms of the plasma membrane in the presence of the potential antagonist
compound
and incubated for 4 hours at 40 degree C. The reaction mixtures are diluted
and immediately
passed through a millipore filter. The filters are then rapidly washed and the
bound
radioactivity is measured in a gamma counter. The amount of bound TGF alpha
HIII is then
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
184
measured. A control assay is also performed in the absence of the compound to
determine if
the antagonists reduce the amount of bound TGF alpha HIII.
Potential antagonist compounds include an antibody, or in some cases, an
oligopeptide, which binds to the polypeptide. Alternatively, a potential
antagonist may be a
closely related protein which binds to the receptor which is an inactive forms
of the
polypeptide and thereby prevent the action of the polypeptide of the present
invention.
Another antagonist compound is an antisense construct prepared using antisense
technology. Antisense technology can be used to control gene expression
through triple-helix
formation or antisense DNA or RNA, both of which methods are based on binding
of a
polynucleotide to DNA or RNA. For example, the 5' coding portion of the
polynucleotide
sequence, which encodes for the mature polypeptides of the present invention,
is used to
design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in
length. A
DNA oligonucleotide is designed to be complementary to a region of the gene
involved in
transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (1979) ;
Cooney et al,
Science, 241:456 (1988) and Dervan et al., Science, 251: 1360 (1991)), thereby
preventing
transcription and the production of the polypeptide of the present invention.
The antisense
RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of
the mRNA
molecule into the polypeptide of the present invention (Antisense - Okano, J.
Neurochem.,
56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene
Expression, CRC
Press, Boca Raton, FL (1988)) . The oligonucleotides described above can also
be delivered
to cells such that the antisense RNA or DNA may be expressed in vivo to
inhibit production
of the polypeptide of the present invention.
Antagonist compounds include a small molecule which binds to the polypeptide
of
the present invention and blocks its action at the receptor such that normal
biological activity
is prevented. The small molecules may also bind the receptor to the
polypeptide to prevent
binding. Examples of small molecules include but are not limited to small
peptides or
peptide-like molecules.
The antagonists may be employed to treat neoplasia, for example, cancers and
tumors. It is known that inhibition of secretion or production of members of
the EGF family
by tumor cells in mice causes regression of tumors.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
185
The antagonists to the polypeptides of the present invention may also be used
therapeutically for the treatment of certain skin disorders, for example,
psoriasis. Elevated
levels of expression of members of this family of growth factors in skin
biopsies taken from
diseases such as psoriatic lesions have been found to be elevated (Cook, et
al., Cancer
Research, 52:3224-3227 (1992)). The antagonists may be employed in a
composition with a
pharmaceutically acceptable carrier, e.g., as hereinafter described.
Other Activities
A polypeptide, polynucleotide, agonist, or antagonist of the present
invention, as a
result of the ability to stimulate vascular endothelial cell growth, may be
employed in
treatment for stimulating re-vascularization of ischemic tissues due to
various disease
conditions such as thrombosis, arteriosclerosis, and other cardiovascular
conditions. The
polypeptide, polynucleotide, agonist, or antagonist of the present invention
may also be
employed to stimulate angiogenesis and limb regeneration, as discussed above.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention
may
also be employed for treating wounds due to injuries, burns, post-operative
tissue repair, and
ulcers since they are mitogenic to various cells of different origins, such as
fibroblast cells
and skeletal muscle cells, and therefore, facilitate the repair or replacement
of damaged or
diseased tissue.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention
may
also be employed stimulate neuronal growth and to treat and prevent neuronal
damage which
occurs in certain neuronal disorders or neuro-degenerative conditions such as
Alzheimer's
disease, Parkinson's disease, and AIDS-related complex. A polypeptide,
polynucleotide,
agonist, or antagonist of the present invention may have the ability to
stimulate chondrocyte
growth, therefore, they may be employed to enhance bone and periodontal
regeneration and
aid in tissue transplants or bone grafts.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention
may be
also be employed to prevent skin aging due to sunburn by stimulating
keratinocyte growth.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention
may
also be employed for preventing hair loss, since FGF family members activate
hair-forming
cells and promotes melanocyte growth. Along the same lines, a polypeptide,
polynucleotide,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
186
agonist, or antagonist of the present invention may be employed to stimulate
growth and
differentiation of hematopoietic cells and bone marrow cells when used in
combination with
other cytokines.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention
may
also be employed to maintain organs before transplantation or for supporting
cell culture of
primary tissues. A polypeptide, polynucleotide, agonist, or antagonist of the
present
invention may also be employed for inducing tissue of mesodermal origin to
differentiate in
early embryos.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention
may
also increase or decrease the differentiation or proliferation of embryonic
stem cells, besides,
as discussed above, hematopoietic lineage.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention
may
also be used to modulate mammalian characteristics, such as body height,
weight, hair color,
eye color, skin, percentage of adipose tissue, pigmentation, size, and shape
(e.g., cosmetic
surgery). Similarly, a polypeptide, polynucleotide, agonist, or antagonist of
the present
invention may be used to modulate mammalian metabolism affecting catabolism,
anabolism,
processing, utilization, and storage of energy.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention
may be
used to change a mammal's mental state or physical state by influencing
biorhythms,
caricadic rhythms, depression (including depressive disorders), tendency for
violence,
tolerance for pain, reproductive capabilities (preferably by Activin or
Inhibin-like activity),
hormonal or endocrine levels, appetite, libido, memory, stress, or other
cognitive qualities.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention
may
also be used as a food additive or preservative, such as to increase or
decrease storage
capabilities, fat content, lipid, protein, carbohydrate, vitamins, minerals,
cofactors or other
nutritional components.
The above-recited applications have uses in a wide variety of hosts. Such
hosts
include, but are not limited to, human, murine, rabbit, goat, guinea pig,
camel, horse, mouse,
rat, hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat, non-human
primate, and
human. In specific embodiments, the host is a mouse, rabbit, goat, guinea pig,
chicken, rat,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
187
hamster, pig, sheep, dog or cat. In preferred embodiments, the host is a
mammal. In most
preferred embodiments, the host is a human.
Having generally described the invention, the same will be more readily
understood
by reference to the following examples, which are provided by way of
illustration and are not
intended as limiting. Having generally described the invention, the same will
be more
readily understood by reference to the following examples, which are provided
by way of
illustration and are not intended as limiting.
Examples
Example 1: Isolation of the TGF alpha HIII cDNA Clone
From the Deposited Sample
Two approaches can be used to isolate TGF alpha HIII from the deposited
sample.
1 S First, the deposited clone is transformed into a suitable host (such as XL-
1 Blue (Stratagene))
using techniques known to those of skill in the art, such as those provided by
the vector
supplier or in related publications or patents. The transformants are plated
on 1.5% agar
plates (containing the appropriate selection agent, e.g., ampicillin) to a
density of about 150
transformants (colonies) per plate. A single colony is then used to generate
DNA using
nucleic acid isolation techniques well known to those skilled in the art.
(e.g., Sambrook et al.,
Molecular Cloning: A Laboratory Manual, 2nd Edit., (1989), Cold Spring Harbor
Laboratory
Press.)
Alternatively, two primers of 17-20 nucleotides derived from both ends of the
SEQ ID
NO:1 (i.e., within the region of SEQ )17 NO:1 bounded by the 5' NT and the 3'
NT of the
clone) are synthesized and used to amplify the TGF alpha HIlZ cDNA using the
deposited
cDNA plasmid as a template. The polymerise chain reaction is carried out under
routine
conditions, for instance, in 25 u1 of reaction mixture with 0.5 ug of the
above cDNA template.
A convenient reaction mixture is 1.5-S mM MgCl2, 0.01% (w/v) gelatin, 20 uM
each of
dATP, dCTP, dGTP, dTTP, 25 pmol of each primer and 0.25 Unit of Taq
polymerise. Thirty
five cycles of PCR (denaturation at 94 degree C for 1 min; annealing at 55
degree C for 1
min; elongation at 72 degree C for 1 min) are performed with a Perkin-Elmer
Cetus
automated thermal cycler. The amplified product is analyzed by agarose gel
electrophoresis
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
188
and the DNA band with expected molecular weight is excised and purified. The
PCR product
is verified to be the selected sequence by subcloning and sequencing the DNA
product.
Several methods are available for the identification of the 5' or 3' non-
coding portions
of the TGF alpha HIII gene which may not be present in the deposited clone.
These methods
include but are not limited to, filter probing, clone enrichment using
specific probes, and
protocols similar or identical to 5' and 3' "RACE" protocols which are well
known in the art.
For instance, a method similar to 5' RACE is available for generating the
missing 5' end of a
desired full-length transcript. (Fromont-Racine et al., Nucleic Acids Res.
21(7):1683-1684
(1993).)
Briefly, a specific RNA oligonucleotide is ligated to the 5' ends of a
population of
RNA presumably containing full-length gene RNA transcripts. A primer set
containing a
primer specific to the ligated RNA oligonucleotide and a primer specific to a
known sequence
of the TGF alpha HIII gene of interest is used to PCR amplify the 5' portion
of the TGF alpha
H>ZI full-length gene. This amplified product may then be sequenced and used
to generate the
full length gene.
This above method starts with total RNA isolated from the desired source,
although
poly-A+ RNA can be used. The RNA preparation can then be treated with
phosphatase if
necessary to eliminate S' phosphate groups on degraded or damaged RNA which
may
interfere with the later RNA ligase step. The phosphatase should then be
inactivated and the
RNA treated with tobacco acid pyrophosphatase in order to remove the cap
structure present
at the 5' ends of messenger RNAs. This reaction leaves a 5' phosphate group at
the 5' end of
the cap cleaved RNA which can then be ligated to an RNA oligonucleotide using
T4 RNA
ligase.
This modified RNA preparation is used as a template for first strand cDNA
synthesis
using a gene specific oligonucleotide. The first strand synthesis reaction is
used as a template
for PCR amplification of the desired 5' end using a primer specific to the
ligated RNA
oligonucleotide and a primer specific to the known sequence of the gene of
interest. The
resultant product is then sequenced and analyzed to confirm that the 5' end
sequence belongs
to the TGF alpha HIII gene.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
189
Example 2: Isolation of TGF alpha HIII Genomic Clones
A human genomic Pl library (Genomic Systems, Inc.) is screened by PCR using
primers selected for the cDNA sequence corresponding to SEQ ID NO:l.,
according to the
method described in Example 1. (See also, Sambrook.)
Example 3: Tissue Distribution of TGF alpha Hlll Polypeptides
Tissue distribution of mRNA expression of TGF alpha HIII is determined using
protocols for Northern blot analysis, described by, among others, Sambrook et
al. For
example, a TGF alpha HIII probe produced by the method described in Example 1
is labeled
with P3z using the rediprimeTM DNA labeling system (Amersham Life Science),
according to
manufacturer's instructions. After labeling, the probe is purified using
CHROMA SPIN-
100TM column (Clontech Laboratories, Inc.), according to manufacturer's
protocol number
PT1200-1. The purified labeled probe is then used to examine various human
tissues for
mRNA expression.
Multiple Tissue Northern (MTN) blots containing various human tissues (H) or
human immune system tissues (IM) (Clontech) are examined with the labeled
probe using
ExpressHybTM hybridization solution (Clontech) according to manufacturer's
protocol
number PT1190-1. Following hybridization and washing, the blots are mounted
and exposed
to film at -70 degree C overnight, and the films developed according to
standard procedures.
Example 4: Chromosomal Mapping of TGF alpha HIII
An oligonucleotide primer set is designed according to the sequence at the S'
end of
SEQ 1D NO:1. This primer preferably spans about 100 nucleotides. This primer
set is then
used in a polymerase chain reaction under the following set of conditions : 30
seconds, 95
degree C; 1 minute, 56 degree C; 1 minute, 70 degree C. This cycle is repeated
32 times
followed by one 5 minute cycle at 70 degree C. Human, mouse, and hamster DNA
is used as
template in addition to a somatic cell hybrid panel containing individual
chromosomes or
chromosome fragments (Bios, Inc). The reactions is analyzed on either 8%
polyacrylamide
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
190
gels or 3.5 % agarose gels. Chromosome mapping is determined by the presence
of an
approximately 100 by PCR fragment in the particular somatic cell hybrid.
Example 5: Bacterial Expression of TGF alpha Hlll
The DNA sequence encoding TGF alpha HIII, ATCC # 97342, was initially
amplified
using PCR oligonucleotide primers corresponding to the S 1 sequences of the
processed TGF
alpha HIII protein (minus the signal peptide sequence) and the vector
sequences 3' to the
TGF alpha H>ZI gene. Additional nucleotides corresponding to TGF alpha HIII
were added to
the 5' and 3' sequences respectively. The 5' oligonucleotide primer has the
sequence 5'
CGCGGATCCGGGCAAAAGAACCTTTGC 3' (SEQ ID N0:14) contains a BamHI
restriction enzyme site (in bold) followed by 18 nucleotides of TGF alpha HIII
coding
sequence starting from the presumed terminal amino acid of the processed
protein. The 3'
sequence
5' GCGTCTAGACTAAAGCAGTGAGAACGAGCC 3' (SEQ ID NO: l S) contains
complementary sequences to a XbaI site and is followed by 21 nucleotides of
TGF alpha
HIII. The restriction enzyme sites correspond to the restriction enzyme sites
on the bacterial
expression vector pQE-9 (Qiagen, Inc. Chatsworth, CA, 91311 ). pQE-9 encodes
antibiotic
resistance (Amp') a bacterial origin of replication (ori) , an IPTG-
regulatable promoter
operator (P/0), a ribosome binding site (RBS) , a 6-His tag and restriction
enzyme sites.
pQE-9 was then digested with BamHI and XbaI. The amplified sequences were
ligated into
pQE-9 and were inserted in frame with the sequence encoding for the histidine
tag and the
RBS. The ligation mixture was then used to transform E. coli strain M15/rep 4
(Qiagen, Inc.)
by the procedure described in Sambrook, J. et al., Molecular Cloning: A
Laboratory Manual,
Cold Spring Laboratory Press, (1989) M15/rep4 contains multiple copies of the
plasmid
pREP4, which expresses the lacI repressor and also confers kanamycin
resistance (Kan').
Transf ormants were identified by their ability to grow on LB plates and
ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was
isolated and
confirmed by restriction analysis. Clones containing the desired constructs
were grown
overnight (OIN) in liquid culture in LB media supplemented with both Amp (100
ug/ml) and
Kan (25 ug/ml) The O/N culture was used to inoculate a large culture at a
ratio of 1:100 to
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
191
1:250. The cells were grown to an optical density 600 (O.D.6w) of between 0.4
and 0.6 IPTG
("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final
concentration of 1 mM.
IPTG induces by inactivating the lacI repressor, clearing the P/O leading to
increased gene
expression. Cells were grown an extra 3 to 4 hours. Cells were then harvested
by
centrifugation. The cell pellet was solubilized in the chaotropic agent 6
Molar Guanidine
HC 1. After clarification, solubilized TGF alpha HIII was purified from this
solution by
chromatography on a Nickel-Chelate column under conditions that allow for
tight binding by
proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography
411:177-184
(1984)). TGF alpha HIII (85 % pure) was eluted from the column in 6 molar
guanidine HC1
pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl,
100 mM
sodium phosphate, 10 molar glutathione (reduced) and 2 molar glutathione
(oxidized). After
incubation in this solution for 12 hours the protein was dialyzed to 10 molar
sodium
phosphate.
In addition to the above expression vector, the present invention further
includes an
expression vector comprising phage operator and promoter elements operatively
linked to a
TGF alpha HIII polynucleotide, called pHE4a. (ATCC Accession Number 209645,
deposited
February 25, 1998.) This vector contains: 1) a neomycinphosphotransferase gene
as a
selection marker, 2) an E. coli origin of replication, 3) a T5 phage promoter
sequence, 4) two
lac operator sequences, 5) a Shine-Delgarno sequence, and 6) the lactose
operon repressor
gene (lacIq). The origin of replication (oriC) is derived from pUCl9 (LTI,
Gaithersburg,
MD). The promoter sequence and operator sequences are made synthetically.
DNA can be inserted into the pHEa by restricting the vector with NdeI and
XbaI,
BamHI, XhoI, or Asp718, running the restricted product on a gel, and isolating
the larger
fragment (the stuffer fragment should be about 310 base pairs). The DNA insert
is generated
according to the PCR protocol described in Example 1, using PCR primers having
restriction
sites for NdeI (5' primer) and XbaI, BamHI, XhoI, or Asp718 (3' primer). The
PCR insert is
gel purified and restricted with compatible enzymes. The insert and vector are
ligated
according to standard protocols.
The engineered vector could easily be substituted in the above protocol to
express
protein in a bacterial system.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
192 ,
Example 6: Purification of TGF alpha HIII Polypeptide
from an Inclusion Body
The following alternative method can be used to purify TGF alpha HIII
polypeptide
expressed in E coli when it is present in the form of inclusion bodies. Unless
otherwise
specified, all of the following steps are conducted at 4-10 degree C.
Upon completion of the production phase of the E. coli fermentation, the cell
culture
is cooled to 4-10 degree C and the cells harvested by continuous
centrifugation at 15,000 rpm
(Heraeus Sepatech). On the basis of the expected yield of protein per unit
weight of cell paste
and the amount of purified protein required, an appropriate amount of cell
paste, by weight, is
suspended in a buffer solution containing 100 mM Tris, 50 mM EDTA, pH 7.4. The
cells are
dispersed to a homogeneous suspension using a high shear mixer.
The cells are then lysed by passing the solution through a microfluidizer
(Microfuidics, Corp. or APV Gaulin, Inc.) twice at 4000-6000 psi. The
homogenate is then
mixed with NaCI solution to a final concentration of 0.5 M NaCI, followed by
centrifugation
at 7000 xg for 15 min. The resultant pellet is washed again using O.SM NaCI,
100 mM Tris,
SO mM EDTA, pH 7.4.
The resulting washed inclusion bodies are solubilized with 1.5 M guanidine
hydrochloride (GuHCI) for 2-4 hours. After 7000 xg centrifugation for 15 min.,
the pellet is
discarded and the polypeptide containing supernatant is incubated at 4 degree
C overnight to
allow further GuHCI extraction.
Following high speed centrifugation (30,000 xg) to remove insoluble particles,
the
GuHCI solubilized protein is refolded by quickly mixing the GuHCI extract with
20 volumes
of buffer containing 50 mM sodium, pH 4.5, 150 mM NaCI, 2 mM EDTA by vigorous
stirring. The refolded diluted protein solution is kept at 4 degree C without
mixing for 12
hours prior to further purification steps.
To clarify the refolded polypeptide solution, a previously prepared tangential
filtration
unit equipped with 0.16 um membrane filter with appropriate surface area
(e.g., Filtron),
equilibrated with 40 mM sodium acetate, pH 6.0 is employed. The filtered
sample is loaded
onto a cation exchange resin (e.g., Poros HS-S0, Perseptive Biosystems). The
column is
washed with 40 mM sodium acetate, pH 6.0 and eluted with 250 mM, 500 mM, 1000
mM,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
193
and 1500 mM NaCI in the same buffer, in a stepwise manner. The absorbance at
280 nm of
the effluent is continuously monitored. Fractions are collected and further
analyzed by SDS-
PAGE.
Fractions containing the TGF alpha HIII polypeptide are then pooled and mixed
with
S 4 volumes of water. The diluted sample is then loaded onto a previously
prepared set of
tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak
anion
(Poros CM-20, Perseptive Biosystems) exchange resins. The columns are
equilibrated with
40 mM sodium acetate, pH 6Ø Both columns are washed with 40 mM sodium
acetate, pH
6.0, 200 mM NaCI. The CM-20 column is then eluted using a 10 column volume
linear
gradient ranging from 0.2 M NaCI, 50 mM sodium acetate, pH 6.0 to 1.0 M NaCI,
50 mM
sodium acetate, pH 6.5. Fractions are collected under constant Az$o monitoring
of the
effluent. Fractions containing the polypeptide (determined, for instance, by
16% SDS-
PAGE) are then pooled.
The resultant TGF alpha HIII polypeptide should exhibit greater than 95%
purity after
the above refolding and purification steps. No major contaminant bands should
be observed
from Commassie blue stained 16% SDS-PAGE gel when 5 ug of purified protein is
loaded.
The purified TGF alpha HIII protein can also be tested for endotoxin/LPS
contamination, and
typically the LPS content is less than 0.1 ng/ml according to LAL assays.
Example 7: Cloning and Expression of TGF alpha HIII
in a Baculovirus Expression System
The DNA sequence encoding the TGF alpha HIII protein, ATCC 97342, was
amplified using PCR oligonucleotide primers corresponding to the 5' and 3'
sequences of the
gene. The first set of primers listed below correspond to the extracellular
domain and the
second set correspond the putative active domain.
The first set of primers are:
S' CGCGGATCCGTCCATCATGGCGCCTCACGGCCCG 3' (SEQ ID N0:16) and
5 ' GCGTCTAGACTACATAAGCAGTGACAACGAGCC 3' (SEQ ID N0:17).
The second set of primers are:
S' CGCGGATCCCGGGCAAAAGAACCTTTGC 3' (SEQ ID N0:18)
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
194
5' GCGTCTAGACTACATAAGCAGTGAGAACGAGCC 3' (SEQ >D N0:19)
All 5' primers have a BamHI restriction enzyme site (in bold). The 3' primer
sequences contain the cleavage site for the restriction endonuclease XbaI and
have
nucleotides complementary to the 3' extracellular and active domain,
respectively of the TGF
alpha HIII gene. The amplified sequences were isolated from a 1% agarose gel
using a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.) . The
fragment was
then digested with the endonucleases BamHI and XbaI and then purified again on
a 1%
agarose gel. This fragment was designated F2.
The vectors pA2 and pA2GP were used (modification of PVL941 vector, discussed
below) for the expression of the TGF alpha HIII protein using the baculovirus
expression
system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of
methods for
baculovirus vectors and insect cell culture procedures, Texas Agricultural
Experimental
Station Bulletin No. 1555). This expression vector contains the strong
polyhedrin promoter
of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by
the
recognition sites for the restriction endonucleases. The polyadenylation site
of the simian
virus SV40 was used for efficient polyadenylation. For an easy selection of
recombinant
virus the beta-galactosidase gene from E.coli was inserted in the same
orientation as the
polyhedrin promoter followed by the polyadenylation . signal of the polyhedrin
gene. The
polyhedrin sequences were flanked at both sides by viral sequences for the
cell-mediated
homologous recombination of co-transfected wild-type viral DNA. Many other
baculovirus
vectors could be used such as pAc373, pRGI, pVL941 and pAcIMl (Luckow, V.A.
and
Summers, M.D., Virology, 170:31-39).
The plasmid was digested with the restriction enzymes BamHI and XbaI and then
dephosphorylated using calf intestinal phosphatase by procedures known in the
art. The DNA
was then isolated from a 1 % agarose gel using the conunercially available kit
("Geneclean"
BIO 101 Inc., La Jolla, Ca.). This vector DNA was designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA
ligase.
E.coli HB101 cells were then transformed and bacteria identified that
contained the plasmid
(pBacTGF alpha HIII) with the TGF alpha H>II gene using the restriction
enzymes BamHI
and XbaI. The sequence of the cloned fragment was confirmed by DNA sequencing.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
195
ug of the plasmid pBacTGF alpha HIII was co-transfected with 1.0 ug of a
commercially available linearized baculovirus ("BaculoGold baculovirus DNA",
Pharmingen, San Diego, CA.) using the lipofection method (Felgner et al. Proc.
Natl. Acad.
Sci. USA, 84:7413-7417 (1987)).
5 lug of BaculoGold virus DNA and 5 ug of the plasmid pBacTGF alpha HIII were
mixed in a sterile well of a, microtiter plate containing SO u1 of serum free
Grace's medium
(Life Technologies Inc., Gaithersburg, MD) Afterwards 10 u1 Lipofectin plus 90
u1 Grace's
medium were added, mixed and incubated for 15 minutes at room temperature.
Then the
transfection mixture was added drop-wise to the Sf~ insect cells (ATCC CRL
1711) seeded
in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The
plate was
rocked back and forth to mix the newly added solution. The plate was then
incubated for 5
hours at 27 degree C. After 5 hours the transfection solution was removed from
the plate and
2 ml of Grace's insect medium supplemented with 10% fetal calf serum was
added. The
plate was put back into an incubator and cultivation continued at 27 degree C
for four days.
After four days the supernatant was collected and a plaque assay performed
similar as
described by Summers and Smith (supra) . As a modification an agarose gel with
"Blue Gall'
(Life Technologies Inc., Gaithersburg) was used which allows an easy isolation
of blue
stained plaques. (A detailed description of a "plaque assay" can also be found
in the user's
guide for insect cell culture and baculovirology distributed by Life
Technologies Inc.,
Gaithersburg, page 9-10).
Four days after the serial dilution, the virus was added to the cells and blue
stained
plaques were picked with the tip of an Eppendorf pipette. The agar containing
the
recombinant viruses was then resuspended in an Eppendorf tube containing 200
u1 of Grace's
medium. The agar was removed by a brief centrifugation and the supernatant
containing the
recombinant baculovirus was used to infect Sf9 cells seeded in 35 mm dishes.
Four days later
the supernatants of these culture dishes were harvested and then stored at 4
degree C.
Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated
FBS. The cells were infected with the recombinant baculovirus V-TGF alpha HIII
at a
multiplicity of infection (MOI) of 2. Six hours later the medium was removed
and replaced
with SF900 II medium minus methionine and cysteine (Life Technologies Inc.,
Gaithersburg). 42 hours later 5 uCi of 35S methionine and 5 uCi 35S cysteine
(Amersham)
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
196
were added. The cells were further incubated for 16 hours before they were
harvested by
centrifugation and the labelled proteins visualized by SDS-PAGE and
autoradiography.
Microsequencing of the amino acid sequence of the amino terminus of purified
protein may be used to determine the amino terminal sequence of the produced
TGF alpha
HIII protein.
Example 8: Expression of TGF alpha HIII in Mammalian Cells
TGF alpha HIII polypeptide can be expressed in a mammalian cell. A typical
m~malian expression vector contains a promoter element, which mediates the
initiation of
transcription of mRNA, a protein coding sequence, and signals required for the
termination of
transcription and polyadenylation of the transcript. Additional elements
include enhancers,
Kozak sequences and intervening sequences flanked by donor and acceptor sites
for RNA
splicing. Highly efficient transcription is achieved with the early and late
promoters from
SV40, the long terminal repeats (LTRs) from Retroviruses, e.g., RSV, HTLVI,
HIVI and the
early promoter of the cytomegalovirus (CMV). However, cellular elements can
also be used
(e.g., the human actin promoter).
Suitable expression vectors for use in practicing the present invention
include, for
example, vectors such as pSVL and pMSG (Pharmacia, Uppsala, Sweden), pRSVcat
(ATCC
37152), pSV2DHFR (ATCC 37146), pBCI2MI (ATCC 67109), pCMVSport 2.0, and
pCMVSport 3Ø Mammalian host cells that could be used include, human Hela,
293, H9 and
Jurkat cells, mouse NIH3T3 and C127 cells, Cos 1, Cos 7 and CV1, quail QC1-3
cells, mouse
L cells and Chinese hamster ovary (CHO) cells.
Alternatively, TGF alpha HIII polypeptide can be expressed in stable cell
lines
containing the TGF alpha HIII polynucleotide integrated into a chromosome. The
co-
transfection with a selectable marker such as DHFR, gpt, neomycin, hygromycin
allows the
identification and isolation of the transfected cells.
The transfected TGF alpha HIII gene can also be amplified to express large
amounts
of the encoded protein. The DHFR (dihydrofolate reductase) marker is useful in
developing
cell lines that carry several hundred or even several thousand copies of the
gene of interest.
(See, e.g., Alt, F. W., et al., J. Biol. Chem. 253:1357-1370 (1978); Hamlin,
J. L. and Ma, C.,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
197
Biochem. et Biophys. Acta, 1097:107-143 (1990); Page, M. J. and Sydenham, M.
A.,
Biotechnology 9:64-68 (1991).) Another useful selection marker is the enzyme
glutamine
synthase (GS) (Murphy et al., Biochem J. 227:277-279 (1991); Bebbington et
al.,
Bio/Technology 10:169-175 (1992). Using these markers, the mammalian cells are
grown in
selective medium and the cells with the highest resistance are selected. These
cell lines
contain the amplified genes) integrated into a chromosome. Chinese hamster
ovary (CHO)
and NSO cells are often used for the production of proteins.
Derivatives of the plasmid pSV2-DHFR (ATCC Accession No. 37146), the
expression vectors pC4 (ATCC Accession No. 209646) and pC6 (ATCC Accession
No.209647) contain the strong promoter (LTR) of the Rous Sarcoma Virus (Cullen
et al.,
Molecular and Cellular Biology, 438-447 (March, 1985)) plus a fragment of the
CMV-
enhancer (Boshart et al., Cell 41:521-530 (1985).) Multiple cloning sites,
e.g., with the
restriction enzyme cleavage sites BamHI, XbaI and Asp718, facilitate the
cloning of TGF
alpha HIII. The vectors also contain the 3' intron, the polyadenylation and
termination signal
of the rat preproinsulin gene, and the mouse DHFR gene under control of the
SV40 early
promoter.
If a naturally occurring signal sequence is used to produce a secreted
protein, the
vector does not need a second signal peptide. Alternatively, if a naturally
occurring signal
sequence is not used, the vector can be modified to include a heterologous
signal sequence in
an effort to secrete the protein from the cell. (See, e.g., WO 96/34891.)
The amplified fragment is then digested and purified on a 1% agarose gel using
a
commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The
isolated fragment
and the dephosphorylated vector are then ligated with T4 DNA ligase. E. coli
HB 101 or XL-
1 Blue cells are then transformed and bacteria are identified that contain the
fragment inserted
into plasmid pC6 or pC4 using, for instance, restriction enzyme analysis.
Chinese hamster ovary cells lacking an active DHFR gene is used for
transfection.
Five ~g of the expression plasmid pC6 or pC4 is cotransfected with 0.5 ug of
the plasmid
pSVneo using lipofectin (Felgner et al., supra). The plasmid pSV2-neo contains
a dominant
selectable marker, the neo gene from Tn5 encoding an enzyme that confers
resistance to a
group of antibiotics including 6418. The cells are seeded in alpha minus MEM
supplemented with 1 mg/ml 6418. After 2 days, the cells are trypsinized and
seeded in
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
198
hybridoma cloning plates (Greiner, Germany) in alpha minus MEM supplemented
with 10,
25, or 50 ng/ml of metothrexate plus 1 mg/ml 6418. After about 10-14 days
single clones are
trypsinized and then seeded in 6-well petri dishes or 10 ml flasks using
different
concentrations of methotrexate (50 nM, 100 nM, 200 nlVl, 400 nM, 800 nM).
Clones growing
at the highest concentrations of methotrexate are then transferred to new 6-
well plates
containing even higher concentrations of methotrexate (1 uM, 2 uM, 5 uM, 10
mM, 20 mM).
The same procedure is repeated until clones are obtained which grow at a
concentration of
100 - 200 uM. Expression of TGF alpha HIII is analyzed, for instance, by SDS-
PAGE and
Western blot or by reversed phase HPLC analysis.
Alternatively, the expression of plasmid, TGF alpha HIII HA is derived from a
vector
pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2)
ampicillin resistance
gene, 3) E. coli replication origin, 4) CMV promoter followed by a polylinker
region, an
SV40 intron and polyadenylation site. A DNA fragment encoding the entire TGF
alpha HIII
precursor and a HA tag fused in frame to its 3' end is cloned into the
polylinker region of the
vector, therefore, the recombinant protein expression is directed under the
CMV promoter.
The HA tag corresponds to an epitope derived from the influenza hemagglutinin
protein as
previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M.
Connolly, and R.
Lerner, 1984, Cell 37:767, (1984)) . The infusion of HA tag to the target
protein allows easy
detection of the recombinant protein with an antibody that recognizes the HA
epitope.
The plasmid construction strategy is described as follows:
The DNA sequence encoding TGF alpha HIII, ATCC 97342, is constructed by PCR
using two primers: the 5' primer S'
CGCGGATCCGTCCATCATGGCGCCTCACGGCCCG 3' (SEQ ID N0:20)
contains a BamHI site (in bold) followed by 18 nucleotides of TGF alpha HIII
coding
sequence starting from the initiation codon; the 3' sequence
S' GCGCTCAGACATAAGCAGTGAGAACGAGCC 3' (SEQ >D N0:21) contains
complementary sequences to an XhoI site, the last 21 nucleotides of the TGF
alpha HIII
domain and an XhoI site. pcDNA3/Amp vector contains BamHI/XhoI cloning sites
which
bring the PCR insert in frame with the 3' HA tag followed by a stop codon.
Therefore, the
PCR product contains a BamHI site, 606 base pair coding sequence and an XhoI
site. The
PCR amplified DNA fragment and the vector, pcDNA3/Amp, are digested with BamHI
and
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
199
XhoI restriction enzyme and ligated. The ligation mixture is transformed into
E. coli strain
SURE (available from Stratagene Cloning Systems, La Jolla, CA 92037) the
transformed
culture is plated on ampicillin media plates and resistant colonies are
selected. Plasmid DNA
is isolated from transformants and examined by restriction analysis for the
presence of the
correct fragment. For expression of the recombinant TGF alpha HIII, COS cells
are
transfected with the expression vector by DEAF-DEXTRAN method (J. Sambrook, E.
Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring
Laboratory
Press, (1989)). The expression of the TGF alpha HIII HA protein is detected by
radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies:
A
Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are
labelled for 8
hours with 35S cysteine two days post transfection. Culture media is then
collected and cells
are lysed with detergent (RIPA buffer (150 mM NaCI, 1 % NP40, 0.1 % SDS, 1 %
NP-40,
0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both cell
lysate and
culture media are precipitated with an HA specific monoclonal antibody.
Proteins
precipitated are analyzed on 15% SDS-PAGE gels.
Example 9: Construction of N Terminal and/or
C Terminal Deletion Mutants
The following general approach may be used to clone a N-terminal or C-terminal
deletion TGF alpha HIII deletion mutant. Generally, two oligonucleotide
primers of about
15-25 nucleotides are derived from the desired 5' and 3' positions of a
polynucleotide of SEQ
)D NO:l. The 5' and 3' positions of the primers are determined based on the
desired TGF
alpha HIII polynucleotide fragment. An initiation and stop codon are added to
the 5' and 3'
primers respectively, if necessary, to express the TGF alpha H)ZI polypeptide
fragment
encoded by the polynucleotide fragment. Preferred TGF alpha HIII
polynucleotide fragments
are those encoding the N-terminal and C-terminal deletion mutants disclosed
above in the
"Polynucleotide and Polypeptide Fragments" section of the Specification.
Additional nucleotides containing restriction sites to facilitate cloning of
the TGF
alpha HIII polynucleotide fragment in a desired vector may also be added to
the 5' and 3'
primer sequences. The TGF alpha HIII polynucleotide fragment is amplified from
genomic
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
200
DNA or from the deposited cDNA clone using the appropriate PCR oligonucleotide
primers
and conditions discussed herein or known in the art. The TGF alpha HIII
polypeptide
fragments encoded by the TGF alpha HIII polynucleotide fragments of the
present invention
may be expressed and purified in the same general manner as the full length
polypeptides,
although routine modifications may be necessary due to the differences in
chemical and
physical properties between a particular fragment and full length polypeptide.
As a means of exemplifying but not limiting the present invention, the
polynucleotide
encoding the TGF alpha HBI polypeptide fragment C-35 to S-215 is amplified and
cloned as
follows: A 5' primer is generated comprising a restriction enzyme site
followed by an
initiation codon in frame with the polynucleotide sequence encoding the N-
terminal portion
of the polypeptide fragment beginning with C-35. A complementary 3' primer is
generated
comprising a restriction enzyme site followed by a stop codon in frame with
the
polynucleotide sequence encoding C-terminal portion of the TGF alpha HIII
polypeptide
fragment ending with S-215.
The amplified polynucleotide fragment and the expression vector are digested
with
restriction enzymes which recognize the sites in the primers. The digested
polynucleotides
are then ligated together. The TGF alpha HIII polynucleotide fragment is
inserted into the
restricted expression vector, preferably in a manner which places the TGF
alpha HIII
polypeptide fragment coding region downstream from the promoter. The ligation
mixture is
transformed into competent E. coli cells using standard procedures and as
described in the
Examples herein. Plasmid DNA is isolated from resistant colonies and the
identity of the
cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
Example 1 D: Protein Fusions of TGF alpha HIII
TGF alpha HIII polypeptides are preferably fused to other proteins. These
fusion
proteins can be used for a variety of applications. For example, fusion of TGF
alpha H1ZI
polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding
protein
facilitates purification. (See Example 5; see also EP A 394,827; Traunecker,
et al., Nature
331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases
the halflife time
in vivo. Nuclear localization signals fused to TGF alpha HIII polypeptides can
target the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
201
protein to a specific subcellular localization, while covalent heterodimer or
homodimers can
increase or decrease the activity of a fusion protein. Fusion proteins can
also create chimeric
molecules having more than one function. Finally, fusion proteins can increase
solubility
and/or stability of the fused protein compared to the non-fused protein. All
of the types of
S fusion proteins described above can be made by modifying the following
protocol, which
outlines the fusion of a polypeptide to an IgG molecule, or the protocol
described in Example
S.
Briefly, the human Fc portion of the IgG molecule can be PCR amplified, using
primers that span the S' and 3' ends of the sequence described below. These
primers also
should have convenient restriction enzyme sites that will facilitate cloning
into an expression
vector, preferably a mammalian expression vector.
For example, if pC4 (Accession No. 209646) is used, the human Fc portion can
be
ligated into the BamHI cloning site. Note that the 3' BamHI site should be
destroyed. Next,
the vector containing the human Fc portion is re-restricted with BamHI,
linearizing the
1 S vector, and TGF alpha HIII polynucleotide, isolated by the PCR protocol
described in
Example 1, is ligated into this BamHI site. Note that the polynucleotide is
cloned without a
stop codon, otherwise a fusion protein will not be produced.
If the naturally occurnng signal sequence is used to produce the secreted
protein, pC4
does not need a second signal peptide. Alternatively, if the naturally
occurring signal
sequence is not used, the vector can be modified to include a heterologous
signal sequence.
(See, e.g., WO 96/34891.)
Human IgG Fc region:
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCAGCACCTGAATTCGAGGGTGCAC
2S CGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGG
TGGTGGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCA
AGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACT
GGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCATCTCCA
AAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCAAGAACCAGG
3O TCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGG
AGAACAACTACAAGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCTCACCGTGG
ACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTGCACAACCACTACACGC
AGAAGAGCCTCTCCCTGTCTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT (SEQID N0:4)
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
202
Example 11: Production of an Antibody
a) Hybridoma Technology
S The antibodies of the present invention can be prepared by a variety of
methods. (See,
Current Protocols, Chapter 2.) As one example of such methods, cells
expressing TGF alpha
Hz z z are administered to an animal to induce the production of sera
containing polyclonal
antibodies. In a preferred method, a preparation of TGF alpha HIII protein is
prepared and
purified to render it substantially free of natural contaminants. Such a
preparation is then
introduced into an animal in order to produce polyclonal antisera of greater
specific activity.
Monoclonal antibodies specific for TcF alpha Hm protein are prepared using
hybridoma technology. (Kohler et al., Nature 256:495 (1975); Kohler et al.,
Eur. J.
Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976);
Hammerling et al., in:
Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681
(1981)). In
general, an animal (preferably a mouse) is immunized with TGF alpha Hm
polypeptide or,
more preferably, with a secreted TGF alpha HIII polypeptide-expressing cell.
Such
polypeptide-expressing cells are cultured in any suitable tissue culture
medium, preferably in
Earle's modified Eagle's medium supplemented with 10% fetal bovine serum
(inactivated at
about 56°C), and supplemented with 'about 10 g/1 of nonessential amino
acids, about 1,000
U/ml of penicillin, and about 100 ~g/ml of streptomycin.
The splenocytes of such mice are extracted and fused with a suitable myeloma
cell
line. Any suitable myeloma cell line may be employed in accordance with the
present
invention; however, it is preferable to employ the parent myeloma cell line
(SP20), available
from the ATCC. After fusion, the resulting hybridoma cells are selectively
maintained in
HAT medium, and then cloned by limiting dilution as described by Wands et al.
(Gastroenterology 80:225-232 (1981)). The hybridoma cells obtained through
such a
selection are then assayed to identify clones which secrete antibodies capable
of binding the
TGF alpha HIII polypeptide.
Alternatively, additional antibodies capable of binding to TGF alpha HI>I
polypeptide
can be produced in a two-step procedure using anti-idiotypic antibodies. Such
a method
makes use of the fact that antibodies are themselves antigens, and therefore,
it is possible to
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
203
obtain an antibody which binds to a second antibody. In accordance with this
method, protein
specific antibodies are used to immunize an animal, preferably a mouse. The
splenocytes of
such an animal are then used to produce hybridoma cells, and the hybridoma
cells are
screened to identify clones which produce an antibody whose ability to bind to
the TGF alpha
HIII protein-specific antibody can be blocked by TGF alpha HIII. Such
antibodies comprise
anti-idiotypic antibodies to the TGF alpha HIII protein-specific antibody and
are used to
immunize an animal to induce formation of further TGF alpha HIII protein-
specific
antibodies.
For in vivo use of antibodies in humans, an antibody is "humanized". Such
antibodies
can be produced using genetic constructs derived from hybridoma cells
producing the
monoclonal antibodies described above. Methods for producing chimeric and
humanized
antibodies are known in the art and are discussed herein. (See, for review,
Morrison, Science
229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Cabilly et al., U.S.
Patent No.
4,816,567; Taniguchi et al., EP 171496; Mornson et al., EP 173494; Neuberger
et al., WO
8601533; Robinson et al., WO 8702671; Boulianne et al., Nature 312:643 (1984);
Neuberger
et al., Nature 314:268 (1985).)
b) Isolation Of Antibody Fragments Directed Against TGF alpha HIII From A
Library
Of scFvs
Naturally occurring V-genes isolated from human PBLs are constructed into a
library
of antibody fragments which contain reactivities against TGF alpha HIII to
which the donor
may or may not have been exposed (see e.g., U.S. Patent 5,885,793 incorporated
herein by
reference in its entirety).
Rescue of the Library. A library of scFvs is constructed from the RNA of human
PBLs as described in PCT publication WO 92/01047. To rescue phage displaying
antibody
fragments, approximately 109 E. coli harboring the phagemid are used to
inoculate 50 ml of
2xTY containing 1 % glucose and 100 ~g/ml of ampicillin (2xTY-AMP-GLU) and
grown to
an O.D. of 0.8 with shaking. Five ml of this culture is used to innoculate 50
ml of 2xTY-
AMP-GLU, 2 x 108 TU of delta gene 3 helper (M13 delta gene III, see PCT
publication WO
92/01047) are added and the culture incubated at 37°C for 45 minutes
without shaking and
then at 37°C for 45 minutes with shaking. The culture is centrifuged at
4000 r.p.m. for 10
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
204
min. and the pellet resuspended in 2 liters of 2xTY containing 100 ~g/ml
ampicillin and 50
ug/ml kanamycin and grown overnight. Phage are prepared as described in PCT
publication
WO 92/01047.
M13 delta gene III is prepared as follows: M13 delta gene III helper phage
does not
encode gene III protein, hence the phage(mid) displaying antibody fragments
have a greater
avidity of binding to antigen. Infectious M13 delta gene III particles are
made by growing the
helper phage in cells harboring a pUCl9 derivative supplying the wild type
gene III protein
during phage morphogenesis. The culture is incubated for 1 hour at 37°
C without shaking
and then for a further hour at 37°C with shaking. Cells are spun down
(IEC-Centra 8,400
r.p.m. for 10 min), resuspended in 300 ml 2xTY broth containing 100 pg
ampicillin/ml and
25 ~.g kanamycin/ml (2xTY-AMP-KAN) and grown overnight, shaking at
37°C. Phage
particles are purified and concentrated from the culture medium by two PEG-
precipitations
(Sambrook et al., 1990), resuspended in 2 ml PBS and passed through a 0.45 pm
filter
(Minisart NML; Sartorius) to give a final concentration of approximately 1013
transducing
units/ml (ampicillin-resistant clones).
Panning of the Library. Immunotubes (Nunc) are coated overnight in PBS with 4
ml
of either 100 pg/ml or 10 ~g/ml of a polypeptide of the present invention.
Tubes are blocked
with 2% Marvel-PBS for 2 hours at 37°C and then washed 3 times in PBS.
Approximately
1013 TU of phage is applied to the tube and incubated for 30 minutes at room
temperature
tumbling on an over and under turntable and then left to stand for another 1.5
hours. Tubes
are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS. Phage are
eluted by
adding 1 ml of 100 mM triethylamine and rotating 1 S minutes on an under and
over turntable
after which the solution is immediately neutralized with 0.5 ml of 1.0M Tris-
HCI, pH 7.4.
Phage are then used to infect 10 ml of mid-log E. coli TG1 by incubating
eluted phage with
bacteria for 30 minutes at 37°C. The E. coli are then plated on TYE
plates containing 1%
glucose and 100 pg/ml ampicillin. The resulting bacterial library is then
rescued with delta
gene 3 helper phage as described above to prepare phage for a subsequent round
of selection.
This process is then repeated for a total of 4 rounds of affinity purification
with tube-washing
increased to 20 times with PBS, 0.1 % Tween-20 and 20 times with PBS for
rounds 3 and 4.
Characterization of Binders. Eluted phage from the 3rd and 4th rounds of
selection
are used to infect E. coli HB 2151 and soluble scFv is produced (Marks, et
al., 1991 ) from
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
205
single colonies for assay. ELISAs are performed with microtitre plates coated
with either 10
pg/ml of the polypeptide of the present invention in 50 mM bicarbonate pH 9.6.
Clones
positive in ELISA are further characterized by PCR fingerprinting (see, e.g.,
PCT publication
WO 92/01047) and then by sequencing. These ELISA positive clones may also be
further
characterized by techniques known in the art, such as, for example, epitope
mapping, binding
affinity, receptor signal transduction, ability to block or competitively
inhibit
antibody/antigen binding, and competitive agonistic or antagonistic activity.
Example 12: Production Of TGF alpha HIII Protein For
l0 High-Throughput Screening Assays
The following protocol produces a supernatant containing TGF alpha HIII
polypeptide
to be tested. This supernatant can then be used in the Screening Assays
described in
Examples 14-21.
First, dilute Poly-D-Lysine (644 587 Boehringer-Mannheim) stock solution
(lmg/ml
in PBS) 1:20 in PBS (w/o calcium or magnesium 17-516F Biowhittaker) for a
working
solution of SOug/ml. Add 200 u1 of this solution to each well (24 well plates)
and incubate at
RT for 20 minutes. Be sure to distribute the solution over each well (note: a
12-channel
pipetter may be used with tips on every other channel). Aspirate off the Poly-
D-Lysine
solution and rinse with lml PBS (Phosphate Buffered Saline). The PBS should
remain in the
well until just prior to plating the cells and plates may be poly-lysine
coated in advance for up
to two weeks.
Plate 293T cells (do not carry cells past P+20) at 2 x 105 cells/well in .5m1
DMEM(Dulbecco's Modified Eagle Medium)(with 4.5 G/L glucose and L-glutamine
(12
604F Biowhittaker))/10% heat inactivated FBS(14-503F Biowhittaker)/lx
Penstrep(17-602E
Biowhittaker). Let the cells grow overnight.
The next day, mix together in a sterile solution basin: 300 u1 Lipofectamine
(18324-
012 Gibco/BRL) and Sml Optimem I (31985070 Gibco/BRL)/96-well plate. With a
small
volume multi-channel pipetter, aliquot approximately tug of an expression
vector containing
a polynucleotide insert, produced by the methods described in Examples 8-10,
into an
appropriately labeled 96-well round bottom plate. With a multi-channel
pipetter, add SOuI of
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
206
the Lipofectamine/Optimem I mixture to each well. Pipette up and down gently
to mix.
Incubate at RT 15-45 minutes. After about 20 minutes, use a multi-channel
pipetter to add
150u1 Optimem I to each well. As a control, one plate of vector DNA lacking an
insert
should be transfected with each set of transfections.
Preferably, the transfection should be performed by tag-teaming the following
tasks.
By tag-teaming, hands on time is cut in half, and the cells do not spend too
much time on
PBS. First, person A aspirates off the media from four 24-well plates of
cells, and then
person B rinses each well with .5-lml PBS. Person A then aspirates off PBS
rinse, and
person B, using a12-channel pipetter with tips on every other channel, adds
the 200u1 of
DNA/Lipofectamine/Optimem I complex to the odd wells first, then to the even
wells, to
each row on the 24-well plates. Incubate at 37 degree C for 6 hours.
While cells are incubating, prepare appropriate media, either 1%BSA in DMEM
with
lx penstrep, or HGS CHO-5 media (116.6 mg/L of CaCl2 (anhyd); 0.00130 mg/L
CuS04-
5H20; 0.050 mg/L of Fe(N03)3-9H20; 0.417 mg/L of FeS04-7H20; 311.80 mg/L of
Kcl;
28.64 mg/L of MgCl2; 48.84 mg/L of MgS04; 6995.50 mg/L of NaCI; 2400.0 mg/L of
NaHC03; 62.50 mg/L of NaH2P04-H20; 71.02 mg/L of Na2HP04; .4320 mg/L of ZnS04-
7H20; .002 mg/L of Arachidonic Acid ; 1.022 mg/L of Cholesterol; .070 mg/L of
DL-alpha-
Tocopherol-Acetate; 0.0520 mg/L of Linoleic Acid; 0.010 mg/L of Linolenic
Acid; 0.010
mg/L of Myristic Acid; 0.010 mg/L of Oleic Acid; 0.010 mg/L of Palmitric Acid;
0.010 mg/L
of Palmitic Acid; 100 mg/L of Pluronic F-68; 0.010 mg/L of Stearic Acid; 2.20
mg/L of
Tween 80; 4551 mg/L of D-Glucose; 130.85 mg/ml of L- Alanine; 147.50 mg/ml of
L-
Arginine-HCL; 7.50 mg/ml of L-Asparagine-H20; 6.65 mg/ml of L-Aspartic Acid;
29.56
mg/ml of L-Cystine-2HCL-H20; 31.29 mg/ml of L-Cystine-2HCL; 7.35 mg/ml of L-
Glutamic Acid; 365.0 mg/ml of L-Glutamine; 18.75 mg/ml of Glycine; 52.48 mg/ml
of L-
Histidine-HCL-H20; 106.97 mg/ml of L-Isoleucine; 111.45 mg/ml of L-Leucine;
163.75
mg/ml of L-Lysine HCL; 32.34 mg/ml of L-Methionine; 68.48 mg/ml of L-
Phenylalainine;
40.0 mg/ml of L-Proline; 26.25 mg/ml of L-Serine; 101.05 mg/ml of L-Threonine;
19.22
mg/ml of L-Tryptophan; 91.79 mg/ml of L-Tryrosine-2Na-2H20; and 99.65 mg/ml of
L-
Valine; 0.0035 mg/L of Biotin; 3.24 mg/L of D-Ca Pantothenate; 11.78 mg/L of
Choline
Chloride; 4.65 mg/L of Folic Acid; 15.60 mg/L of i-Inositol; 3.02 mg/L of
Niacinamide; 3.00
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
207
mg/L of Pyridoxal HCL; 0.031 mg/L of Pyridoxine HCL; 0.319 mg/L of Riboflavin;
3.17
mg/L of Thiamine HCL; 0.365 mg/L of Thymidine; 0.680 mg/L of Vitamin B12; 25
mM of
HEPES Buffer; 2.39 mg/L of Na Hypoxanthine; 0.105 mg/L of Lipoic Acid; 0.081
mg/L of
Sodium Putrescine-2HCL; 55.0 mg/L of Sodium Pyruvate; 0.0067 mg/L of Sodium
Selenite;
20uM of Ethanolamine; 0.122 mg/L of Ferric Citrate; 41.70 mg/L of Methyl-B-
Cyclodextrin
complexed with Linoleic Acid; 33.33 mg/L of Methyl-B-Cyclodextrin complexed
with Oleic
Acid; 10 mg/L of Methyl-B-Cyclodextrin complexed with Retinal Acetate. Adjust
osmolarity to 327 mOsm) with 2mm glutamine and lx penstrep. (BSA (81-068-3
Bayer)
100gm dissolved in 1L DMEM for a 10% BSA stock solution). Filter the media and
collect
50 u1 for endotoxin assay in 15m1 polystyrene conical.
The transfection reaction is terminated, preferably by tag-teaming, at the end
of the
incubation period. Person A aspirates off the transfection media, while person
B adds 1.5m1
appropriate media to each well. Incubate at 37 degree C for 45 or 72 hours
depending on the
media used: 1%BSA for 45 hours or CHO-5 for 72 hours.
On day four, using a 300u1 multichannel pipetter, aliquot 600u1 in one lml
deep well
plate and the remaining supernatant into a 2m1 deep well. The supernatants
from each well
can then be used in the assays described in Examples 14-21.
It is specifically understood that when activity is obtained in any of the
assays
described below using a supernatant, the activity originates from either the
TGF alpha HIII
polypeptide directly (e.g., as a secreted protein) or by TGF alpha HIII
inducing expression of
other proteins, which are then secreted into the supernatant. Thus, the
invention further
provides a method of identifying the protein in the supernatant characterized
by an activity in
a particular assay.
Example 13: Construction of GAS Reporter Construct
One signal transduction pathway involved in the differentiation and
proliferation of
cells is called the Jaks-STATs pathway. Activated proteins in the Jaks-STATs
pathway bind
to gamma activation site "GAS" elements or interferon-sensitive responsive
element
("ISRE"), located in the promoter of many genes. The binding of a protein to
these elements
alter the expression of the associated gene.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
208
GAS and ISRE elements are recognized by a class of transcription factors
called
Signal Transducers and Activators of Transcription, or "STATs." There are six
members of
the STATs family. Statl and Stat3 are present in many cell types, as is Stat2
(as response to
IFN-alpha is widespread). Stat4 is more restricted and is not in many cell
types though it has
been found in T helper class I, cells after treatment with II,-12. StatS was
originally called
mammary growth factor, but has been found at higher concentrations in other
cells including
myeloid cells. It can be activated in tissue culture cells by many cytokines.
The STATs are activated to translocate from the cytoplasm to the nucleus upon
tyrosine phosphorylation by a set of kinases known as the Janus Kinase
("Jaks") family. Jaks
represent a distinct family of soluble tyrosine kinases and include Tyk2,
Jakl, Jak2, and Jak3.
These kinases display significant sequence similarity and are generally
catalytically inactive
in resting cells.
The Jaks are activated by a wide range of receptors summarized in the Table
below.
(Adapted from review by Schidler and Darnell, Ann. Rev. Biochem. 64:621-51
(1995).) A
cytokine receptor family, capable of activating Jaks, is divided into two
groups: (a) Class 1
includes receptors for IL,-2, IL,-3, IL,-4, IL,-6, IL-7, IL-9, IL-11, II,-12,
IL-15, Epo, PRL, GH,
G-CSF, GM-CSF, LIF, CNTF, and thrombopoietin; and (b) Class 2 includes IFN-a,
IFN-g,
and IL-10. The Class 1 receptors share a conserved cysteine motif (a set of
four conserved
cysteines and one tryptophan) and a WSXWS motif (a membrane proximal region
encoding
Trp-Ser-Xaa-Trp-Ser (SEQ ID N0:5)).
Thus, on binding of a ligand to a receptor, Jaks are activated, which in turn
activate
STATs, which then translocate and bind to GAS elements. This entire process is
encompassed in the Jaks-STATs signal transduction pathway.
Therefore, activation of the Jaks-STATs pathway, reflected by the binding of
the GAS
or the ISRE element, can be used to indicate proteins involved in the
proliferation and
differentiation of cells. For example, growth factors and cytokines are known
to activate the
Jaks-STATs pathway. (See Table below.) Thus, by using GAS elements linked to
reporter
molecules, activators of the Jaks-STATs pathway can be identified.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
209
JAKs STATS GAS(elements) or ISRE
Li and tvk2 Jakl Jak3
Jak2
1FN family
IFN-a/B + + - - 1,2,3 ISRE
IFN-g + + - 1 GAS (IRF 1 >Lys6>IFP)
II-10 + ? ? - 1,3
gp130 family
IL-6 (Pleiotrohic)+ + + ? 1,3 GAS (IKFl>Lys6>IFP)
Il-11(Pleiotrohic)? + ? ? 1,3
OnM(Pleiotrohic)? + + ? 1,3
LIF(Pleiotrohic)? + + ? 1,3
CNTF(Pleiotrohic)-/+ + + ? 1,3
G-CSF(Pleiotrohic)? + ? ? 1,3
IL-12(Pleiotrohic)+ - + + 1,3
g-C family
IL-2 (lymphocytes)- + - + 1,3,5 GAS
IL-4 (lymph/myeloid)- + - + 6 GAS (IRF1 - IFP
Ly6)(IgH)
IL-7 (lymphocytes)- + - + 5 GAS
IL-9 (lymphocytes)- + - + 5 GAS
IL-13 (lymphocyte)- + ? ? 6 GAS
IL-15 ? + ? + S GAS
gp 140 family
IL-3 (myeloid) - - + - 5 GAS (IRF1>IFPLy6)
IL-5 (myeloid) - - + - 5 GAS
GM-CSF (myeloid)- - + - 5 GAS
Growth hormone
family
GH ? - + - 5
PRL ? +/-+ - 1,3,5
EPO ? - + - 5 GAS(B-
CAS>IRF 1=IFPLy6)
Receptor Tyrosine
Kinases
EGF ? + + - 1,3 GAS (IRF1)
PDGF ? + + - 1,3
CSF-1 ? + + - 1,3 GAS (not IRF1)
To construct GAS promoter
a synthetic containing element,
which
is
used
in
the
Biological Assays in Examples14-15, a based strategy is employed
described PCR to
generate a GAS-SV40 The primer
promoter sequence. 5' contains
four
tandem
copies
of
the
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
210
GAS binding site found in the IRF1 promoter and previously demonstrated to
bind STATs
upon induction with a range of cytokines (Rothman et al., Immunity 1:457-468
(1994).),
although other GAS or ISRE elements can be used instead. The 5' primer also
contains l8bp
of sequence complementary to the SV40 early promoter sequence and is flanked
with an XhoI
site. The sequence of the 5' primer is:
5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCGAAA
TGATTTCCCCGAAATATCTGCCATCTCAATTAG:3' (SEQ ID N0:6)
The downstream primer is complementary to the SV40 promoter and is flanked
with a
Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID N0:7)
PCR amplification is performed using the SV40 promoter template present in the
B-
gal:promoter plasmid obtained from Clontech. The resulting PCR fragment is
digested with
XhoI/Hind III and subcloned into BLSK2-. (Stratagene.) Sequencing with forward
and
reverse primers confirms that the insert contains the following sequence:
5':CTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCGAAATGATT
TCCCCGAAATATCTGCCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACT
CCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCT
GACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTC
CAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT:3'
(SEQ ID N0:8)
With this GAS promoter element linked to the SV40 promoter, a GAS:SEAP2
reporter construct is next engineered. Here, the reporter molecule is a
secreted alkaline
phosphatase, or "SEAP." Clearly, however, any reporter molecule can be instead
of SEAP, in
this or in any of the other Examples. Well known reporter molecules that can
be used instead
of SEAP include chloramphenicol acetyltransferase (CAT), luciferase, alkaline
phosphatase,
B-galactosidase, green fluorescent protein (GFP), or any protein detectable by
an antibody.
The above sequence confirmed synthetic GAS-SV40 promoter element is subcloned
into the pSEAP-Promoter vector obtained from Clontech using HindIII and XhoI,
effectively
replacing the SV40 promoter with the amplified GAS:SV40 promoter element, to
create the
GAS-SEAP vector. However, this vector does not contain a neomycin resistance
gene, and
therefore, is not preferred for mammalian expression systems.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
211
Thus, in order to generate mammalian stable cell lines expressing the GAS-SEAP
reporter, the GAS-SEAP cassette is removed from the GAS-SEAP vector using SaII
and
NotI, and inserted into a backbone vector containing the neomycin resistance
gene, such as
pGFP-1 (Clontech), using these restriction sites in the multiple cloning site,
to create the
S GAS-SEAP/Neo vector. Once this vector is transfected into mammalian cells,
this vector
can then be used as a reporter molecule for GAS binding as described in
Examples 14-15.
Other constructs can be made using the above description and replacing GAS
with a
different promoter sequence. For example, construction of reporter molecules
containing
NFK-B and EGR promoter sequences are described in Examples 16 and 17. However,
many
other promoters can be substituted using the protocols described in these
Examples. For
instance, SRE, IL-2, NFAT, or Osteocalcin promoters can be substituted, alone
or in
combination (e.g., GAS/NF-KB/EGR, GAS/NF-KB, Il-2/NFAT, or NF-KB/GAS).
Similarly,
other cell lines can be used to test reporter construct activity, such as HELA
(epithelial),
HLTVEC (endothelial), Reh (B-cell), Saos-2 (osteoblast), HUVAC (aortic), or
Cardiomyocyte.
Example 14: High-Throughput Screening Assay
for T cell Activity.
The following protocol is used to assess T-cell activity by identifying
factors, and
determining whether supernate containing a polypeptide of the invention
proliferates and/or
differentiates T-cells. T-cell activity is assessed using the GAS/SEAP/Neo
construct
produced in Example 13. Thus, factors that increase SEAP activity indicate the
ability to
activate the Jaks-STATS signal transduction pathway. The T-cell used in this
assay is Jurkat
T-cells (ATCC Accession No. TIB-152), although Molt-3 cells (ATCC Accession
No. CRL
1552) and Molt-4 cells (ATCC Accession No. CRL-1582) cells can also be used.
Jurkat T-cells are lymphoblastic CD4+ Thl helper cells. In order to generate
stable
cell lines, approximately 2 million Jurkat cells are transfected with the GAS-
SEAP/neo vector
using DMRIE-C (Life Technologies)(transfection procedure described below). The
transfected cells are seeded to a density of approximately 20,000 cells per
well and
transfectants resistant to 1 mg/ml genticin selected. Resistant colonies are
expanded and then
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
212
tested for their response to increasing concentrations of interferon gamma.
The dose response
of a selected clone is demonstrated.
Specifically, the following protocol will yield sufficient cells for 75 wells
containing
200 u1 of cells. Thus, it is either scaled up, or performed in multiple to
generate sufficient
cells for multiple 96 well plates. Jurkat cells are maintained in RPMI + 10%
serum with
1%Pen-Strep. Combine 2.5 mls of OPTI-MEM (Life Technologies) with 10 ug of
plasmid
DNA in a T25 flask. Add 2.5 ml OPTI-MEM containing 50 u1 of DMRIE-C and
incubate at
room temperature for 15-45 mins.
During the incubation period, count cell concentration, spin down the required
number of cells (10' per transfection), and resuspend in OPTI-MEM to a final
concentration
of 10' cells/ml. Then add lml of 1 x 10' cells in OPTI-MEM to T25 flask and
incubate at 37
degree C for 6 hrs. After the incubation, add 10 ml of RPMI + 15% serum.
The Jurkat:GAS-SEAP stable reporter lines are maintained in RPMI + 10% serum,
1
mg/ml Genticin, and 1 % Pen-Strep. These cells are treated with supernatants
containing TGF
alpha HIII polypeptides or TGF alpha HIII induced polypeptides as produced by
the protocol
described in Example 12.
On the day of treatment with the supernatant, the cells should be washed and
resuspended in fresh RPMI + 10% serum to a density of 500,000 cells per ml.
The exact
number of cells required will depend on the number of supernatants being
screened. For one
96 well plate, approximately 10 million cells (for 10 plates, 100 million
cells) are required.
Transfer the cells to a triangular reservoir boat, in order to dispense the
cells into a 96
well dish, using a 12 channel pipette. Using a 12 channel pipette, transfer
200 u1 of cells into
each well (therefore adding 100, 000 cells per well).
After all the plates have been seeded, 50 u1 of the supernatants are
transferred directly
from the 96 well plate containing the supernatants into each well using a 12
channel pipette.
In addition, a dose of exogenous interferon gamma (0.1, 1.0, 10 ng) is added
to wells H9,
H10, and H11 to serve as additional positive controls for the assay.
The 96 well dishes containing Jurkat cells treated with supernatants are
placed in an
incubator for 48 hrs (note: this time is variable between 48-72 hrs). 35 u1
samples from each
well are then transferred to an opaque 96 well plate using a 12 channel
pipette. The opaque
plates should be covered (using sellophene covers) and stored at -20 degree C
until SEAP
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
213
assays are performed according to Example 18. The plates containing the
remaining treated
cells are placed at 4 degree C and serve as a source of material for repeating
the assay on a
specific well if desired.
As a positive control, 100 Unit/ml interferon gamma can be used which is known
to
activate Jurkat T cells. Over 30 fold induction is typically observed in the
positive control
wells.
The above protocol may be used in the generation of both transient, as well
as, stable
transfected cells, which would be apparent to those of skill in the art.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
214
Example 1 S: High-Throughput Screening Assay
Identifying Myeloid Activity
The following protocol is used to assess myeloid activity of TGF alpha HIII by
determining whether TGF alpha HIII proliferates and/or differentiates myeloid
cells. Myeloid
cell activity is assessed using the GAS/SEAP/Neo construct produced in Example
13. Thus,
factors that increase SEAP activity indicate the ability to activate the Jaks-
STATS signal
transduction pathway. The myeloid cell used in this assay is U937, a pre-
monocyte cell line,
although TF-1, HL60, or KG1 can be used.
To transiently transfect U937 cells with the GAS/SEAP/Neo construct produced
in
Example 13, a DEAE-Dextran method (Kharbanda et. al., 1994, Cell Growth &
Differentiation, 5:259-265) is used. First, harvest 2x10e7 U937 cells and wash
with PBS.
The U937 cells are usually grown in RPMI 1640 medium containing 10% heat-
inactivated
fetal bovine serum (FBS) supplemented with 100 units/ml penicillin and 100
mg/ml
streptomycin.
Next, suspend the cells in 1 ml of 20 mM Tris-HCl (pH 7.4) buffer containing
0.5
mg/ml DEAF-Dextran, 8 ug GAS-SEAP2 plasmid DNA, 140 mM NaCI, 5 mM KCI, 375.vuM
Na2HP04.7H20, 1 mM MgCl2, and 675 uM CaCl2. Incubate at 37 degrees C for 45
min.
Wash the cells with RPMI 1640 medium containing 10% FBS and then resuspend in
10 ml complete medium and incubate at 37 degree C for 36 hr.
The GAS-SEAP/LJ937 stable cells are obtained by growing the cells in 400 ug/ml
6418. The 6418-free medium is used for routine growth but every one to two
months, the
cells should be re-grown in 400 ug/ml 6418 for couple of passages.
s
These cells are tested by harvesting 1x10 cells (this is enough for ten 96-
well plates
assay) and wash with PBS. Suspend the cells in 200 ml above described growth
medium,
with a final density of Sx105 cells/ml. Plate 200 u1 cells per well in the 96-
well plate (or
1x105 cells/well).
Add SO u1 of the supernatant prepared by the protocol described in Example 12.
Incubate at 37 degee C for 48 to 72 hr. As a positive control, 100 Unit/ml
interferon gamma
can be used which is known to activate U937 cells. Over 30 fold induction is
typically
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
215
observed in the positive control wells. SEAP assay the supernatant according
to the protocol
described in Example 18.
Example 16: High-Throughput Screening Assay
Identifying Neuronal Activity.
When cells undergo differentiation and proliferation, a group of genes are
activated
through many different signal transduction pathways. One of these genes, EGR1
(early
growth response gene 1 ), is induced in various tissues and cell types upon
activation. The
promoter of EGR1 is responsible for such induction. Using the EGR1 promoter
linked to
reporter molecules, activation of cells can be assessed by TGF alpha HIII.
Particularly, the following protocol is used to assess neuronal activity in PC
12 cell
lines. PC 12 cells (rat phenochromocytoma cells) are known to proliferate
and/or differentiate
by activation with a number of mitogens, such as TPA (tetradecanoyl phorbol
acetate), NGF
(nerve growth factor), and EGF (epidermal growth factor). The EGR1 gene
expression is
activated during this treatment. Thus, by stably transfecting PC12 cells with
a construct
containing an EGR promoter linked to SEAP reporter, activation of PC12 cells
by TGF alpha
HIII can be assessed.
The EGR/SEAP reporter construct can be assembled by the following protocol.
The
EGR-1 promoter sequence (-633 to +1)(Sakamoto K et al., Oncogene 6:867-871
(1991)) can
be PCR amplified from human genomic DNA using the following primers:
5' GCGCTCGAGGGATGACAGCGATAGAACCCCGG -3' (SEQ ID N0:9)
5' GCGAAGCTTCGCGACTCCCCGGATCCGCCTC-3' (SEQ ID NO:10)
Using the GAS:SEAP/Neo vector produced in Example 13, EGR1 amplified product
can then be inserted into this vector. Linearize the GAS:SEAP/Neo vector using
restriction
enzymes XhoI/HindIII, removing the GAS/SV40 stuffer. Restrict the EGRl
amplified
product with these same enzymes. Ligate the vector and the EGR1 promoter.
To prepare 96 well-plates for cell culture, two mls of a coating solution
(1:30 dilution
of collagen type I (Upstate Biotech Inc. Cat#08-115) in 30% ethanol (filter
sterilized)) is
added per one 10 cm plate or 50 ml per well of the 96-well plate, and allowed
to air dry for 2
hr.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
216
PC12 cells are routinely grown in RPMI-1640 medium (Bio Whittaker) containing
10% horse serum (JRH BIOSCIENCES, Cat. # 12449-78P), 5% heat-inactivated fetal
bovine
serum (FBS) supplemented with 100 units/ml penicillin and 100 ug/ml
streptomycin on a
precoated 10 cm tissue culture dish. One to four split is done every three to
four days. Cells
are removed from the plates by scraping and resuspended with pipetting up and
down for
more than 15 times.
Transfect the EGR/SEAP/Neo construct into PC 12 using the Lipofectamine
protocol
described in Example 12. EGR-SEAPlPCI2 stable cells are obtained by growing
the cells in
300 ug/ml 6418. The 6418-free medium is used for routine growth but every one
to two
months, the cells should be re-grown in 300 ug/ml 6418 for couple of passages.
To assay for neuronal activity, a 10 cm plate with cells around 70 to 80%
confluent is
screened by removing the old medium. Wash the cells once with PBS (Phosphate
buffered
saline). Then starve the cells in low serum medium (RPMI-1640 containing 1%
horse serum
and 0.5% FBS with antibiotics) overnight.
The next morning, remove the medium and wash the cells with PBS. Scrape off
the
cells from the plate, suspend the cells well in 2 ml low serum medium. Count
the cell
number and add more low serum medium to reach final cell density as 5x105
cells/ml.
Add 200 u1 of the cell suspension to each well of 96-well plate (equivalent to
1x105
cells/well). Add 50 u1 supernatant produced by Example 12, 37 degree C for 48
to 72 hr. As
a positive control, a growth factor known to activate PC 12 cells through EGR
can be used,
such as 50 ng/ul of Neuronal Growth Factor (NGF). Over fifty-fold induction of
SEAP is
typically seen in the positive control wells. SEAP assay the supernatant
according to
Example 18.
Example 17: High-Throughput Screening Assay for T cell Activity
NF-KB (Nuclear Factor KB) is a transcription factor activated by a wide
variety of
agents including the inflammatory cytokines IL-1 and TNF, CD30 and CD40,
lymphotoxin-
alpha and lymphotoxin-beta, by exposure to LPS or thrombin, and by expression
of certain
viral gene products. As a transcription factor, NF-KB regulates the expression
of genes
involved in immune cell activation, control of apoptosis (NF- KB appears to
shield cells from
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
217
apoptosis), B and T-cell development, anti-viral and antimicrobial responses,
and multiple
stress responses.
In non-stimulated conditions, NF- KB is retained in the cytoplasm with I-KB
(Inhibitor KB). However, upon stimulation, I- KB is phosphorylated and
degraded, causing
NF- KB to shuttle to the nucleus, thereby activating transcription of target
genes. Target
genes activated by NF- KB include IL-2, IL-6, GM-CSF, ICAM-1 and class 1 MHC.
Due to its central role and ability to respond to a range of stimuli, reporter
constructs
utilizing the NF-KB promoter element are used to screen the supernatants
produced in
Example 12. Activators or inhibitors of NF-KB would be useful in treating
diseases. For
example, inhibitors of NF-KB could be used to treat those diseases related to
the acute or
chronic activation of NF-KB, such as rheumatoid arthritis.
To construct a vector containing the NF-KB promoter element, a PCR based
strategy
is employed. The upstream primer contains four tandem copies of the NF-KB
binding site
(GGGGACTTTCCC) (SEQ ID NO:11), 18 by of sequence complementary to the 5' end
of
the SV40 early promoter sequence, and is flanked with an XhoI site:
5':GCGGCCTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGACTTTC
CATCCTGCCATCTCAATTAG:3' (SEQ ID N0:12)
The downstream primer is complementary to the 3' end of the SV40 promoter and
is
flanked with a Hind III site:
5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID N0:7)
PCR amplification is performed using the SV40 promoter template present in the
pB-
gal:promoter plasmid obtained from Clontech. The resulting PCR fragment is
digested with
XhoI and Hind III and subcloned into BLSK2-. (Stratagene) Sequencing with the
T7 and T3
primers confirms the insert contains the following sequence:
5':CTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGACTTTCCATCTG
CCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCC
CTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTAT
TTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGG
AGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT:3' (SEQ ID N0:13)
Next, replace the SV40 minimal promoter element present in the pSEAP2-promoter
plasmid (Clontech) with this NF-KB/SV40 fragment using XhoI and HindIII.
However, this
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
218
vector does not contain a neomycin resistance gene, and therefore, is not
preferred for
mammalian expression systems.
In order to generate stable mammalian cell lines, the NF-KB/SV40/SEAP cassette
is
removed from the above NF-KB/SEAP vector using restriction enzymes SaII and
NotI, and
inserted into a vector containing neomycin resistance. Particularly, the NF-
KB/SV40/SEAP
cassette was inserted into pGFP-1 (Clontech), replacing the GFP gene, after
restricting pGFP-
1 with SaII and NotI.
Once NF-KB/SV40/SEAP/Neo vector is created, stable Jurkat T-cells are created
and
maintained according to the protocol described in Example 14. Similarly, the
method for
assaying supernatants with these stable Jurkat T-cells is also described in
Example 14. As a
positive control, exogenous TNF alpha (0.1,1, 10 ng) is added to wells H9,
H10, and H11,
with a S-10 fold activation typically observed.
Example 18: Assay for SEAP Activity
As a reporter molecule for the assays described in Examples 14-17, SEAP
activity is
assayed using the Tropix Phospho-light Kit (Cat. BP-400) according to the
following general
procedure. The Tropix Phospho-light Kit supplies the Dilution, Assay, and
Reaction Buffers
used below.
Prime a dispenser with the 2.5x Dilution Buffer and dispense 15 u1 of 2.5x
dilution
buffer into Optiplates containing 35 u1 of a supernatant. Seal the plates with
a plastic sealer
and incubate at 65 degree C for 30 min. Separate the Optiplates to avoid
uneven heating.
Cool the samples to room temperature for 15 minutes. Empty the dispenser and
prime
with the Assay Buffer. Add 50 ml Assay Buffer and incubate at room temperature
5 min.
Empty the dispenser and prime with the Reaction Buffer (see the table below).
Add 50 u1
Reaction Buffer and incubate at room temperature for 20 minutes. Since the
intensity of the
chemiluminescent signal is time dependent, and it takes about 10 minutes to
read 5 plates on
luminometer, one should treat 5 plates at each time and start the second set
10 minutes later.
Read the relative light unit in the luminometer. Set H12 as blank, and print
the
results. An increase in chemiluminescence indicates reporter activity.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
219
Reaction Buffer Formulation:
# of platesRxn buffer diluent CSPD (ml)
(ml)
60 3
11 65 3.25
12 70 3.5
13 75 3.75
14 80 4
85 4.25
16 90 4'.5
17 95 4.75
18 100 5
19 105 5.25
110 5.5
21 115 5.75
22 120 6
23 125 6.25
24 130 6.5
135 6.75
26 140 7
27 145 7.25
28 150 7.5
29 155 7.75
160 8
31 165 8.25
32 170 8.5
33 175 8.75
34 180 9
185 9.25
36 190 9.5
37 195 9.75
38 200 10
39 205 10.25
210 10.5
41 215 10.75
42 220 11
43 225 11.25
44 230 11.5
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
220
45 235 11.75
46 240 12
47 245 12.25
48 250 12.5
49 255 12.75
50 260 13
Example 19: High-Throughput Screening Assay Identifying Changes in
Small Molecule Concentration and Membrane Permeability
Binding of a ligand to a receptor is known to alter intracellular levels of
small
molecules, such as calcium, potassium, sodium, and pH, as well as alter
membrane potential.
These alterations can be measured in an assay to identify supernatants which
bind to receptors
of a particular cell. Although the following protocol describes an assay for
calcium, this
protocol can easily be modified to detect changes in potassium, sodium, pH,
membrane
potential, or any other small molecule which is detectable by a fluorescent
probe.
The following assay uses Fluorometric Imaging Plate Reader ("FLIPR") to
measure
changes in fluorescent molecules (Molecular Probes) that bind small molecules.
Clearly, any
fluorescent molecule detecting a small molecule can be used instead of the
calcium
fluorescent molecule, fluo-4 (Molecular Probes, Inc.; catalog no. F-14202),
used here.
For adherent cells, seed the cells at 10,000 -20,000 cells/well in a Co-star
black 96-
well plate with clear bottom. The plate is incubated in a COZ incubator for 20
hours. The
adherent cells are washed two times in Biotek washer with 200 u1 of HBSS
(Hank's Balanced
Salt Solution) leaving 100 u1 of buffer after the final wash.
A stock solution of 1 mg/ml fluo-4 is made in 10% pluronic acid DMSO. To load
the
cells with fluo-4 , SO u1 of 12 ug/ml fluo-4 is added to each well. The plate
is incubated at 37
degrees C in a COZ incubator for 60 min. The plate is washed four times in the
Biotek
washer with HBSS leaving 100 u1 of buffer.
For non-adherent cells, the cells are spun down from culture media. Cells are
re-
suspended to 2-5x106 cells/ml with HBSS in a SO-ml conical tube. 4 u1 of 1
mg/ml fluo-4
solution in 10% pluronic acid DMSO is added to each ml of cell suspension. The
tube is then
placed in a 37 degrees C water bath for 30-60 min. The cells are washed twice
with HBSS,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
221
resuspended to 1x10 cells/ml, and dispensed into a microplate, 100 ul/well.
The plate is
centrifuged at 1000 rpm for 5 min. The plate is then washed once in Denley
CellWash with
200 u1, followed by an aspiration step to 100 u1 final volume.
For a non-cell based assay, each well contains a fluorescent molecule, such as
fluo-4 .
The supernatant is added to the well, and a change in fluorescence is
detected.
To measure the fluorescence of intracellular calcium, the FLIPR is set for the
following parameters: (1) System gain is 300-800 mW; (2) Exposure time is 0.4
second; (3)
Camera F/stop is F/2; (4) Excitation is 488 nm; (5) Emission is 530 nm; and
(6) Sample
addition is 50 u1. Increased emission at 530 nm indicates an extracellular
signaling event
caused by the a molecule, either TGF alpha HIII or a molecule induced by TGF
alpha HIII,
which has resulted in an increase in the intracellular Ca++ concentration.
Example 20: High-Throughput Screening Assay
Identifying Tyrosine Kinase Activity
The Protein Tyrosine Kinases (PTK) represent a diverse group of transmembrane
and
cytoplasmic kinases. Within the Receptor Protein Tyrosine Kinase RPTK) group
are
receptors for a range of mitogenic and metabolic growth factors including the
PDGF, FGF,
EGF, NGF, HGF and Insulin receptor subfamilies. In addition there are a large
family of
RPTKs for which the corresponding ligand is unknown. Ligands for RPTKs include
mainly
secreted small proteins, but also membrane-bound and extracellular matrix
proteins.
Activation of RPTK by ligands involves ligand-mediated receptor dimerization,
resulting in transphosphorylation of the receptor subunits and activation of
the cytoplasmic
tyrosine kinases. The cytoplasmic tyrosine kinases include receptor associated
tyrosine
kinases of the src-family (e.g., src, yes, lck, lyn, fyn) and non-receptor
linked and cytosolic
protein tyrosine kinases, such as the Jak family, members of which mediate
signal
transduction triggered by the cytokine superfamily of receptors (e.g., the
Interleukins,
Interferons, GM-CSF, and Leptin).
Because of the wide range of known factors capable of stimulating tyrosine
kinase
activity, identifying whether TGF alpha HIII or a molecule induced by TGF
alpha HIII is
capable of activating tyrosine kinase signal transduction pathways is of
interest. Therefore,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
222
the following protocol is designed to identify such molecules capable of
activating the
tyrosine kinase signal transduction pathways.
Seed target cells (e.g., primary keratinocytes) at a density of approximately
25,000
cells per well in a 96 well Loprodyne Silent Screen Plates purchased from
Nalge Nunc
S (Naperville, IL). The plates are sterilized with two 30 minute rinses with
100% ethanol,
rinsed with water and dried overnight. Some plates are coated for 2 hr with
100 ml of cell
culture grade type I collagen (50 mg/ml), gelatin (2%) or polylysine (50
mg/ml), all of which
can be purchased from Sigma Chemicals (St. Louis, MO) or 10% Matrigel
purchased from
Becton Dickinson (Bedford,MA), or calf serum, rinsed with PBS and stored at 4
degree C.
Cell growth on these plates is assayed by seeding 5,000 cells/well in growth
medium and
indirect quantitation of cell number through use of alamarBlue as described by
the
manufacturer Alamar Biosciences, Inc. (Sacramento, CA) after 48 hr. Falcon
plate covers
#3071 from Becton Dickinson (Bedford,lVIA) are used to cover the Loprodyne
Silent Screen
Plates. Falcon Microtest III cell culture plates can also be used in some
proliferation
experiments.
To prepare extracts, A431 cells are seeded onto the nylon membranes of
Loprodyne
plates (20,000/200m1/well) and cultured overnight in complete medium. Cells
are quiesced
by incubation in serum-free basal medium for 24 hr. After 5-20 minutes
treatment with EGF
(60ng/ml) or 50 u1 of the supernatant produced in Example 12, the medium was
removed and
100 ml of extraction buffer ((20 mM HEPES pH 7.5, 0.15 M NaCI, 1 % Triton X-
100, 0.1
SDS, 2 mM Na3V04, 2 mM Na4P2O7 and a cocktail of protease inhibitors (#
1836170)
obtained from Boeheringer Mannheim (Indianapolis, IN) is added to each well
and the plate
is shaken on a rotating shaker for 5 minutes at 4~C. The plate is then placed
in a vacuum
transfer manifold and the extract filtered through the 0.45 mm membrane
bottoms of each
well using house vacuum. Extracts are collected in a 96-well catch/assay plate
in the bottom
of the vacuum manifold and immediately placed on ice. To obtain extracts
clarified by
centrifugation, the content of each well, after detergent solubilization for 5
minutes, is
removed and centrifuged for 1 S minutes at 4 degree C at 16,000 x g.
Test the filtered extracts for levels of tyrosine kinase activity. Although
many
methods of detecting tyrosine kinase activity are known, one method is
described here.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
223
Generally, the tyrosine kinase activity of a supernatant is evaluated by
determining its
ability to phosphorylate a tyrosine residue on a specific substrate (a
biotinylated peptide).
Biotinylated peptides that can be used for this purpose include PSK1
(corresponding to amino
acids 6-20 of the cell division kinase cdc2-p34) and PSK2 (corresponding to
amino acids 1-
17 of gastrin). Both peptides are substrates for a range of tyrosine kinases
and are available
from Boehringer Mannheim.
The tyrosine kinase reaction is set up by adding the following components in
order.
First, add 10u1 of SuM Biotinylated Peptide, then 10u1 ATP/Mg2+ (SmM ATP/SOmM
MgCl2), then 10u1 of Sx Assay Buffer (40mM imidazole hydrochloride, pH7.3, 40
mM beta-
glycerophosphate, 1mM EGTA, 100mM MgCl2, 5 mM MnCl2 0.5 mg/ml BSA), then Sul
of
Sodium Vanadate(1mM), and then Sul of water. Mix the components gently and
preincubate
the reaction mix at 30 degree C for 2 min. Initial the reaction by adding 10u1
of the control
enzyme or the filtered supernatant.
The tyrosine kinase assay reaction is then terminated by adding 10 u1 of 120mm
EDTA and place the reactions on ice.
Tyrosine kinase activity is determined by transferring 50 u1 aliquot of
reaction mixture
to a microtiter plate (MTP) module and incubating at 37 degree C for 20 min.
This allows the
streptavadin coated 96 well plate to associate with the biotinylated peptide.
Wash the MTP
module with 300u1/well of PBS four times. Next add 75 u1 of anti-
phospotyrosine antibody
conjugated to horse radish peroxidase(anti-P-Tyr-POD(O.Su/ml)) to each well
and incubate at
37 degree C for one hour. Wash the well as above.
Next add 1 OOuI of peroxidase substrate solution (Boehringer Mannheim) and
incubate
at room temperature for at least 5 mins (up to 30 min). Measure the absorbance
of the sample
at 405 nm by using ELISA reader. The level of bound peroxidase activity is
quantitated using
an ELISA reader and reflects the level of tyrosine kinase activity.
Example 21: High-Throughput Screening Assay
Identifying Phosphorylation Activity
As a potential alternative and/or compliment to the assay of protein tyrosine
kinase
activity described in Example 20, an assay which detects activation
(phosphorylation) of
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
224
major intracellular signal transduction intermediates can also be used. For
example, as
described below one particular assay can detect tyrosine phosphorylation of
the Erk-1 and
Erk-2 kinases. However, phosphorylation of other molecules, such as Raf, JNK,
p38 MAP,
Map kinase kinase (MEK), MEK kinase, Src, Muscle specific kinase (MuSK),
IR.AK, Tec,
and Janus, as well as any other phosphoserine, phosphotyrosine, or
phosphothreonine
molecule, can be detected by substituting these molecules for Erk-1 or Erk-2
in the following
assay.
Specifically, assay plates are made by coating the wells of a 96-well ELISA
plate with
O.lml of protein G (lug/ml) for 2 hr at room temp, (RT). The plates are then
rinsed with PBS
and blocked with 3% BSA/PBS for 1 hr at RT. The protein G plates are then
treated with 2
commercial monoclonal antibodies (100ng/well) against Erk-1
and Erk-2 (1 hr at RT) (Santa Cruz Biotechnology). (To detect other molecules,
this step can
easily be modified by substituting a monoclonal antibody detecting any of the
above
described molecules.) After 3-5 rinses with PBS, the plates are stored at 4
degree C until
use.
A431 cells are seeded at 20,000/well in a 96-well Loprodyne filterplate and
cultured overnight in growth medium. The cells are then starved for 48 hr in
basal medium
(DMEM) and then treated with EGF (6ng/well) or 50 u1 of the supernatants
obtained in
Example 12 for 5-20 minutes. The cells are then solubilized and extracts
filtered directly into
the assay plate.
After incubation with the extract for 1 hr at RT, the wells are again rinsed.
As a
positive control, a commercial preparation of MAP kinase (lOng/well) is used
in place
of A431 extract. Plates are then treated with a commercial polyclonal (rabbit)
antibody
(lug/ml) which specifically recognizes the phosphorylated epitope of the Erk-1
and Erk-2
kinases (1 hr at RT). This antibody is biotinylated by standard procedures.
The bound
polyclonal antibody is then quantitated by successive incubations with
Europium-streptavidin
and Europium fluorescence enhancing reagent in the Wallac DELFIA instrument
(time-
resolved fluorescence). An increased fluorescent signal over background
indicates a
phosphorylation by TGF alpha HIII or a molecule induced by TGF alpha HIII.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
225
Example 22: Method of Determining Alterations
in the TGF alpha HIII Gene
RNA isolated from entire families or individual patients presenting with a
phenotype
of interest (such as a disease) is be isolated. cDNA is then generated from
these RNA
samples using protocols known in the art. (See, Sambrook.) The cDNA is then
used as a
template for PCR, employing primers surrounding regions of interest in SEQ >D
NO:1.
Suggested PCR conditions consist of 35 cycles at 95 degree C for 30 seconds;
60-120
seconds at 52-58 degree C; and 60-120 seconds at 70 degree C, using buffer
solutions
described in Sidransky, D., et al., Science 252:706 (1991).
PCR products are then sequenced using primers labeled at their 5' end with T4
polynucleotide kinase, employing SequiTherm Polymerase. (Epicentre
Technologies). The
intron-exon borders of selected exons of TGF alpha HIII is also determined and
genomic
PCR products analyzed to confirm the results. PCR products harboring suspected
mutations
in TGF alpha H>II is then cloned and sequenced to validate the results of the
direct
sequencing.
PCR products of TGF alpha HIII are cloned into T-tailed vectors as described
in
Holton, T.A. and Graham, M.W., Nucleic Acids Research, 19:1156 (1991) and
sequenced
with T7 polymerase (United States Biochemical). Affected individuals are
identified by
mutations in TGF alpha HIII not present in unaffected individuals.
Genomic rearrangements are also observed as a method of determining
alterations in a
gene corresponding to TGF alpha HIII. Genomic clones isolated according to
Example 2 are
nick-translated with digoxigenindeoxy-uridine 5'-triphosphate (Boehringer
Manheim), and
FISH performed as described in Johnson, Cg. et al., Methods Cell Biol. 35:73-
99 (1991).
Hybridization with the labeled probe is carried out using a vast excess of
human cot-1 DNA
for specific hybridization to the TGF alpha HIII genomic locus. .
Chromosomes are counterstained with 4,6-diamino-2-phenylidole and propidium
iodide, producing a combination of C- and R-bands. Aligned images for precise
mapping are
obtained using a triple-band filter set (Chroma Technology, Brattleboro, VT)
in combination
with a cooled charge-coupled device camera (Photometrics, Tucson, AZ) and
variable
excitation wavelength filters. (Johnson, Cv. et al., Genet. Anal. Tech. Appl.,
8:75 (1991).)
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
226
Image collection, analysis and chromosomal fractional length measurements are
performed
using the ISee Graphical Program System. (Inovision Corporation, Durham, NC.)
Chromosome alterations of the genomic region of TGF alpha HIII (hybridized by
the probe)
are identified. as insertions, deletions, and translocations. These TGF alpha
HIII alterations
are used as a diagnostic marker for an associated disease.
Example 23: Method of Detecting Abnormal Levels
of TGF alpha Hlll in a Biological Sample
TGF alpha HIII polypeptides can be detected in a biological sample, and if an
increased or decreased level of TGF alpha HIII is detected, this polypeptide
is a marker for a
particular phenotype. .Methods of detection are numerous, and thus, it is
understood that one
skilled in the art can modify the following assay to fit their particular
needs.
For example, antibody-sandwich ELISAs are used to detect TGF alpha HIII in a
sample, preferably a biological sample. Wells of a microtiter plate are coated
with specific
antibodies to TGF alpha HIII, at a final concentration of 0.2 to 10 ug/ml. The
antibodies are
either monoclonal or polyclonal and are produced by the method described in
Example 11.
The wells are blocked so that non-specific binding of TGF alpha HIII to the
well is reduced.
The coated wells are then incubated for > 2 hours at RT with a sample
containing
TGF alpha HIII. Preferably, serial dilutions of the sample should be used to
validate results.
The plates are then washed three times with deionized or distilled water to
remove
unbounded TGF alpha HIII.
Next, 50 u1 of specific antibody-alkaline phosphatase conjugate, at a
concentration of
25-400 ng, is added and incubated for 2 hours at room temperature. The plates
are again
washed three times with deionized or distilled water to remove unbounded
conjugate.
Add 75 u1 of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate
(NPP) substrate solution to each well and incubate 1 hour at room temperature.
Measure the
reaction by a microtiter plate reader. Prepare a standard curve, using serial
dilutions of a
control sample, and plot TGF alpha HIII polypeptide concentration on the X-
axis (log scale)
and fluorescence or absorbance of the Y-axis (linear scale). Interpolate the
concentration of
the TGF alpha HIII in the sample using the standard curve.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
227
Example 24: Form ulation
The invention also provides methods of treatment and/or prevention of diseases
or
S disorders (such as, for example, any one or more of the diseases or
disorders disclosed herein)
by administration to a subject of an effective amount of a Therapeutic. By
therapeutic is
meant a polynucleotides or polypeptides of the invention (including fragments
and variants),
agonists or antagonists thereof, and/or antibodies thereto, in combination
with a
pharmaceutically acceptable carrier type (e.g., a sterile Garner).
The Therapeutic will be formulated and dosed in a fashion consistent with good
medical practice, taking into account the clinical condition of the individual
patient
(especially the side effects of treatment with the Therapeutic alone), the
site of delivery, the
method of administration, the scheduling of administration, and other factors
known to
practitioners. The "effective amount" for purposes herein is thus determined
by such
considerations.
As a general proposition, the total pharmaceutically effective amount of the
Therapeutic administered parenterally per dose will be in the range of about
lug/kg/day to 10
mg/kg/day of patient body weight, although, as noted above, this will be
subject to
therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day,
and most
preferably for humans between about 0.01 and 1 mg/kg/day for the hormone. If
given
continuously, the Therapeutic is typically administered at a dose rate of
about 1 ug/kg/hour to
about 50 ug/kg/hour, either by 1-4 injections per day or by continuous
subcutaneous
infusions, for example, using a mini-pump. An intravenous bag solution may
also be
employed. The length of treatment needed to observe changes and the interval
following
treatment for responses to occur appears to vary depending on the desired
effect.
Therapeutics can be are administered orally, rectally, parenterally,
intracistemally,
intravaginally, intraperitoneally, topically (as by powders, ointments, gels,
drops or
transdermal patch), bucally, or as an oral or nasal spray. "Pharmaceutically
acceptable carrier"
refers to a non-toxic solid, semisolid or liquid filler, diluent,
encapsulating material or
formulation auxiliary of any. The term "parenteral" as used herein refers to
modes of
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
228
administration which include intravenous, intramuscular, intraperitoneal,
intrasternal,
subcutaneous and intraarticular injection and infusion.
Therapeutics of the invention are also suitably administered by sustained-
release
systems. Suitable examples of sustained-release Therapeutics are administered
orally,
rectally, parenterally, intracistemally, intravaginally, intraperitoneally,
topically (as by
powders, ointments, gels, drops or transdermal patch), bucally, or as an oral
or nasal spray.
"Pharmaceutically acceptable Garner" refers to a non-toxic solid, semisolid or
liquid filler,
diluent, encapsulating material or formulation auxiliary of any type. The term
"parenteral" as
used herein refers to modes of administration which include intravenous,
intramuscular,
intraperitoneal, intrasternal, subcutaneous and intraarticular inj ection and
infusion.
Therapeutics of the invention are also suitably administered by sustained-
release
systems. Suitable examples of sustained-release Therapeutics include suitable
polymeric
materials (such as, for example, semi-permeable polymer matrices in the form
of shaped
articles, e.g., films, or mirocapsules), suitable hydrophobic materials (for
example as an
emulsion in an acceptable oil) or ion exchange resins, and sparingly soluble
derivatives (such
as, for example, a sparingly soluble salt).
Sustained-release matrices include polylactides (IJ.S. Pat. No. 3,773,919, EP
58,481),
copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al.,
Biopolymers
22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (Langer et al., J.
Biomed. Mater.
Res. 15:167-277 (1981), and Langer, Chem. Tech. 12:98-105 (1982)), ethylene
vinyl acetate
(Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988).
Sustained-release Therapeutics also include liposomally entrapped Therapeutics
of the
invention (see generally, Langer, Science 249:1527-1533 (1990); Treat et al.,
in Liposomes in
the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler
(eds.), Liss, New
York, pp. 317 -327 and 353-365 (1989)). Liposomes containing the Therapeutic
are prepared
by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci.
(USA)
82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.(USA) 77:4030-4034
(1980); EP
52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appl. 83-
118008;
U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the
liposomes are of
the small (about 200-800 Angstroms) unilamellar type in which the lipid
content is greater
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
229
than about 30 mol. percent cholesterol, the selected proportion being adjusted
for the optimal
Therapeutic.
In yet an additional embodiment, the Therapeutics of the invention are
delivered by
way of a pump (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201
(1987);
Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med.
321:574 (1989)).
Other controlled release systems are discussed in the review by Langer
(Science
249:1527-1533 (1990)).
For parenteral administration, in one embodiment, the Therapeutic is
formulated
generally by mixing it at the desired degree of purity, in a unit dosage
injectable form
(solution, suspension, or emulsion), with a pharmaceutically acceptable
Garner, i.e., one that
is non-toxic to recipients at the dosages and concentrations employed and is
compatible with
other ingredients of the formulation. For example, the formulation preferably
does not
include oxidizing agents and other compounds that are known to be deleterious
to the
Therapeutic.
Generally, the formulations are prepared by contacting the Therapeutic
uniformly and
intimately with liquid carriers or finely divided solid Garners or both. Then,
if necessary, the
product is shaped into the desired formulation. Preferably the carrier is a
parenteral carrier,
more preferably a solution that is isotonic with the blood of the recipient.
Examples of such
Garner vehicles include water, saline, Ringer's solution, and dextrose
solution. Non-aqueous
vehicles such as fixed oils and ethyl oleate are also useful herein, as well
as liposomes.
The Garner suitably contains minor amounts of additives such as substances
that
enhance isotonicity and chemical stability. Such materials are non-toxic to
recipients at the
dosages and concentrations employed, and include buffers such as phosphate,
citrate,
succinate, acetic acid, and other organic acids or their salts; antioxidants
such as ascorbic
acid; low molecular weight (less than about ten residues) polypeptides, e.g.,
polyarginine or
tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins;
hydrophilic
polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic
acid, aspartic
acid, or arginine; monosaccharides, disaccharides, and other carbohydrates
including
cellulose or its derivatives, glucose, manose, or dextrins; chelating agents
such as EDTA;
sugar alcohols such as mannitol or sorbitol; counterions such as sodium;
and/or nonionic
surfactants such as polysorbates, poloxamers, or PEG.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
230
The Therapeutic is typically formulated in such vehicles at a concentration of
about
0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It
will be
understood that the use of certain of the foregoing excipients, Garners, or
stabilizers will
result in the formation of polypeptide salts.
Any pharmaceutical used for therapeutic administration can be sterile.
Sterility is
readily accomplished by filtration through sterile filtration membranes (e.g.,
0.2 micron
membranes). Therapeutics generally are placed into a container having a
sterile access port,
for example, an intravenous solution bag or vial having a stopper pierceable
by a hypodermic
inj ection needle.
Therapeutics ordinarily will be stored in unit or multi-dose containers, for
example,
sealed ampoules or vials, as an aqueous solution or as a lyophilized
formulation for
reconstitution. As an example of a lyophilized formulation, 10-ml vials are
filled with S ml
of sterile-filtered 1 % (w/v) aqueous Therapeutic solution, and the resulting
mixture is
lyophilized. The infusion solution is prepared by reconstituting the
lyophilized Therapeutic
, using bacteriostatic Water-for-Injection.
The invention also provides a pharmaceutical pack or kit comprising one or
more
containers filled with one or more of the ingredients of the Therapeutics of
the invention.
Associated with such containers) can be a notice in the form prescribed by a
governmental
agency regulating the manufacture, use or sale of pharmaceuticals or
biological products,
which notice reflects approval by the agency of manufacture, use or sale for
human
administration. In addition, the Therapeutics may be employed in conjunction
with other
therapeutic compounds.
The Therapeutics of the invention may be administered alone or in combination
with
adjuvants. Adjuvants that may be administered with the Therapeutics of the
invention
include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-
PE (Biocine
Corp.), QS21 (Genentech, Inc.), BCG, and MPL. In a specific embodiment,
Therapeutics of
the invention are administered in combination with alum. In another specific
embodiment,
Therapeutics of the invention are administered in combination with QS-21.
Further adjuvants
that may be administered with the Therapeutics of the invention include, but
are not limited
to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005,
Aluminum salts, MF-59, and Virosomal adjuvant technology. Vaccines that may be
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
231
administered with the Therapeutics of the invention include, but are not
limited to, vaccines
directed toward protection against MMR (measles, mumps, rubella), polio,
varicella,
tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae B,
whooping cough,
pneumonia, influenza, Lyme's Disease, rotavirus, cholera, yellow fever,
Japanese
encephalitis, poliomyelitis, rabies, typhoid fever, and pertussis.
Combinations may be
administered either concomitantly, e.g., as an admixture, separately but
simultaneously or
concurrently; or sequentially. This includes presentations in which the
combined agents are
administered together as a therapeutic mixture, and also procedures in which
the combined
agents are administered separately but simultaneously, e.g., as through
separate intravenous
lines into the same individual. Administration "in combination" further
includes the separate
administration of one of the compounds or agents given first, followed by the
second.
The Therapeutics of the invention may be administered alone or in combination
with
other therapeutic agents. Therapeutic agents that may be administered in
combination with
the Therapeutics of the invention, include but not limited to, other members
of the TNF
family, chemotherapeutic agents, antibiotics, steroidal and non-steroidal anti-
inflammatories,
conventional immunotherapeutic agents, cytokines and/or growth factors.
Combinations may
be administered either concomitantly, e.g., as an admixture, separately but
simultaneously or
concurrently; or sequentially. This includes presentations in which the
combined agents are
administered together as a therapeutic mixture, and also procedures in which
the combined
agents are administered separately but simultaneously, e.g., as through
separate intravenous
lines into the same individual. Administration "in combination" further
includes the separate
administration of one of the compounds or agents given first, followed by the
second.
In one embodiment, the Therapeutics of the invention are administered in
combination with members of the TNF family. TNF, TNF-related or TNF-like
molecules
that may be administered with the Therapeutics of the invention include, but
are not limited
to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-
beta),
LT-beta (found in complex heterotrimer LT-alpha2-beta), OPGL, Fast, CD27L,
CD30L,
CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO
96/14328), AIM-I (International Publication No. WO 97/33899), endokine-alpha
(International Publication No. WO 98/07880), TR6 (International Publication
No. WO
98/30694), OPG, and neutrokine-alpha (International Publication No. WO
98/18921, OX40,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
232
and nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and
4-IBB,
TR2 (International Publication No. WO 96/34095), DR3 (International
Publication No. WO
97/33904), DR4 (International Publication No. WO 98/32856), TRS (International
Publication No. WO 98/30693), TR6 (International Publication No. WO 98/30694),
TR7
(International Publication No. WO 98/41629), TRANK, TR9 (International
Publication No.
WO 98/56892),TR10 (International Publication No. WO 98/54202), 312C2
(International
Publication No. WO 98/06842), and TR12, and soluble forms CD154, CD70, and
CD153.
In certain embodiments, Therapeutics of the invention are administered in
combination with antiretroviral agents, nucleoside reverse transcriptase
inhibitors, non-
nucleoside reverse transcriptase inhibitors, and/or protease inhibitors.
Nucleoside reverse
transcriptase inhibitors that may be administered in combination with the
Therapeutics of the
invention, include, but are not limited to, RETROVIRT"" (zidovudine/AZT),
VIDEXT""
(didanosine/ddI), HNIDT"" (zalcitabine/ddC), ZERITT"' (stavudine/d4T),
EPIVIRT""
(lamivudine/3TC), and COMBIVIRT"~ (zidovudine/lamivudine). Non-nucleoside
reverse
transcriptase inhibitors that may be administered in combination with the
Therapeutics of the
invention, include, but are not limited to, VIRAMUNET"" (nevirapine),
RESCRIPTORT""
(delavirdine), and SUSTIVAT"" (efavirenz). Protease inhibitors that may be
administered in
combination with the Therapeutics of the invention, include, but are not
limited to,
CRIXNANT"" (indinavir), NORVIRT"" (ritonavir), INVIRASET"" (saquinavir), and
VIRACEPTT"" (nelfinavir). In a specific embodiment, antiretroviral agents,
nucleoside
reverse transcriptase inhibitors, non-nucleoside reverse transcriptase
inhibitors, and/or
protease inhibitors may be used in any combination with Therapeutics of the
invention to
treat AIDS and/or to prevent or treat HIV infection.
In other embodiments, Therapeutics of the invention may be administered in
combination with anti-opportunistic infection agents. Anti-opportunistic
agents that may be
administered in combination with the Therapeutics of the invention, include,
but are not
limited to, TRIMETHOPRIM-SULFAMETHOXAZOLET"", DAPSONET"",
PENTAMIDINET"~, ATOVAQUONET"", ISONIAZ>DT~~, RIFAMpINT"", pYRAZINAM)DET"~,
ETHAMBUTOLT"", RIFABUTINT"", CLARITHROMYCINT"~, AZITHROMYCINT"",
GANCICLOVIRT"", FOSCARNETT"", CIDOFOVIRT"", FLUCONAZOLET"",
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
233
ITRACONAZOLET"~, KETOCONAZOLET"~, ACYCLOVIRT~~, FAMCICOLVIRT"",
PYRIMETHAMINET"", LEUCOVORINT"", NEUPOGENT"" (filgrastim/G-CSF), and
LEUKINET"" (sargramostim/GM-CSF). In a specific embodiment, Therapeutics of
the
invention are used in any combination with TRIMETHOPRIM-SULFAMETHOXAZOLET"",
DAPSONET"", PENTAM>DINET"", and/or ATOVAQUONET"" to prophylactically treat or
prevent an opportunistic Pneumocystis carinii pneumonia infection. In another
specific
embodiment, Therapeutics of the invention are used in any combination with
ISONIAZIDT"",
RIFAMPINT"", PYRAZINAMIDET~~, and/or ETHAMBUTOLT"" to prophylactically treat
or
prevent an opportunistic Mycobacterium avium complex infection. In another
specific
embodiment, Therapeutics of the invention are used in any combination with
RIFABUTINT"",
CLARITHROMYCINT"", and/or AZITHROMYCINT"" to prophylactically treat or prevent
an
opportunistic Mycobacterium tuberculosis infection. In another specific
embodiment,
Therapeutics of the invention are used in any combination with GANCICLOVIRT"",
FOSCARNETT"", and/or CIDOFOVIRT"~ to prophylactically treat or prevent an
opportunistic
1 S cytomegalovirus infection. In another specific embodiment, Therapeutics of
the invention
are used in any combination with FLUCONAZOLET"", ITRACONAZOLET"", and/or
KETOCONAZOLET"~ to prophylactically treat or prevent an opportunistic fungal
infection.
In another specific embodiment, Therapeutics of the invention are used in any
combination
with ACYCLOVIRT"~ and/or FAMCICOLVIRT"" to prophylactically treat or prevent
an
opportunistic herpes simplex virus type I and/or type II infection. In another
specific
embodiment, Therapeutics of the invention are used in any combination with
PYRIMETHAMINET"~ and/or LEUCOVORINT"~ to prophylactically treat or prevent an
opportunistic Toxoplasma gondii infection. In another specific embodiment,
Therapeutics of
the invention are used in any combination with LEUCOVORINT"" and/or
NEUPOGENT"" to
prophylactically treat or prevent an opportunistic bacterial infection.
In a further embodiment, the Therapeutics of the invention are administered in
combination with an antiviral agent. Antiviral agents that may be administered
with the
Therapeutics of the invention include, but are not limited to, acyclovir,
ribavirin, amantadine,
and remantidine.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
234
In a further embodiment, the Therapeutics of the invention are administered in
combination with an antibiotic agent. Antibiotic agents that may be
administered with the
Therapeutics of the invention include, but are not limited to, amoxicillin,
beta-lactamases,
aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, Clindamycin,
chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin,
fluoroquinolones, macrolides, metronidazole, penicillins, quinolones,
rifampin,
streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim-
sulfamthoxazole, and
vancomycm.
Conventional nonspecific immunosuppressive agents, that may be administered in
combination with the Therapeutics of the invention include, but are not
limited to, steroids,
cyclosporine, cyclosporine analogs, cyclophosphamide methylprednisone,
prednisone,
azathioprine, FK-506, 15-deoxyspergualin, and other immunosuppressive agents
that act by
suppressing the function of responding T cells.
In specific embodiments, Therapeutics of the invention are administered in
1 S combination with immunosuppressants. Immunosuppressants preparations that
may be
administered with the Therapeutics of the invention include, but are not
limited to,
ORTHOCLONET"" (OKT3), SANDIMMLTNET"~/NEORALT""/SANGDYAT"" (cyclosporin),
PROGRAFT"" (tacrolimus), CELLCEPTT"" (mycophenolate), Azathioprine,
glucorticosteroids,
and RAPAMLJNET"" (sirolimus). In a specific embodiment, immunosuppressants may
be
used to prevent rejection of organ or bone marrow transplantation.
In an additional embodiment, Therapeutics of the invention are administered
alone or
in combination with one or more intravenous immune globulin preparations.
Intravenous
immune globulin preparations that may be administered with the Therapeutics of
the
invention include, but not limited to, GAMMART"", IVEEGAMT"",
SANDOGLOBULINT"",
GAMMAGARD S/DT"", and GAMIMLTNET"". In a specific embodiment, Therapeutics of
the
invention are administered in combination with intravenous immune globulin
preparations in
transplantation therapy (e.g., bone marrow transplant).
In an additional embodiment, the Therapeutics of the invention are
administered
alone or in combination with an anti-inflammatory agent. Anti-inflammatory
agents that may
be administered with the Therapeutics of the invention include, but are not
limited to,
glucocorticoids and the nonsteroidal anti-inflammatories, aminoarylcarboxylic
acid
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
235
derivatives, arylacetic acid derivatives, arylbutyric acid derivatives,
arylcarboxylic acids,
arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid
derivatives,
thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-
hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome,
difenpiramide, ditazol,
emorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxaceprol,
paranyline,
perisoxal, pifoxime, proquazone, proxazole, and tenidap.
In another embodiment, compostions of the invention are administered in
combination with a chemotherapeutic agent. Chemotherapeutic agents that may be
administered with the Therapeutics of the invention include, but are not
limited to, antibiotic
derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and dactinomycin);
antiestrogens
(e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate,
floxuridine,
interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-
thioguanine);
cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine
arabinoside,
cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin,
busulfan, cis-
1 S platin, and vincristine sulfate); hormones (e.g., medroxyprogesterone,
estramustine
phosphate sodium, ethinyl estradiol, estradiol, megestrol acetate,
methyltestosterone,
diethylstilbestrol diphosphate, chlorotrianisene, and testolactone); nitrogen
mustard
derivatives (e.g., mephalen, chorambucil, mechlorethamine (nitrogen mustard)
and thiotepa);
steroids and combinations (e.g., bethamethasone sodium phosphate); and others
(e.g.,
dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate,
and etoposide).
In a specific embodiment, Therapeutics of the invention are administered in
combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and
prednisone) or
any combination of the components of CHOP. In another embodiment, Therapeutics
of the
invention are administered in combination with Rituximab. In a further
embodiment,
Therapeutics of the invention are administered with Rituxmab and CHOP, or
Rituxmab and
any combination of the components of CHOP.
In an additional embodiment, the Therapeutics of the invention are
administered in
combination with cytokines. Cytokines that may be administered with the
Therapeutics of
the invention include, but are not limited to, IL2, IL3, IL4, IL,S, IL6, IL,7,
IL10, IL12, IL13,
IL15, anti-CD40, CD40L, IFN-gamma and TNF-alpha. In another embodiment,
Therapeutics of the invention may be administered with any interleukin,
including, but not
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
236
limited to, IL-lalpha, IL-lbeta, IL,-2, IL,-3, IL-4, IL-5, IL-6, IL,-7, IL,-8,
IL,-9, IL-10, IL,-11, IL-
12, IL,-13, IL-14, IL,-15, IL,-16, IL,-17, IL-18, IL-19, IL-20, and IL-21.
In an additional embodiment, the Therapeutics of the invention are
administered in
combination with angiogenic proteins. Angiogenic proteins that may be
administered with
the Therapeutics of the invention include, but are not limited to, Glioma
Derived Growth
Factor (GDGF), as disclosed in European Patent Number EP-399816; Platelet
Derived
Growth Factor-A (PDGF-A), as disclosed in European Patent Number EP-682110;
Platelet
Derived Growth Factor-B (PDGF-B), as disclosed in European Patent Number EP-
282317;
Placental Growth Factor (P1GF), as disclosed in International Publication
Number WO
92/06194; Placental Growth Factor-2 (P1GF-2), as disclosed in Hauser et al.,
Gorwth Factors,
4:259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as disclosed in
International
Publication Number WO 90/13649; Vascular Endothelial Growth Factor-A (VEGF-A),
as
disclosed in European Patent Number EP-506477; Vascular Endothelial Growth
Factor-2
(VEGF-2), as disclosed in International Publication Number WO 96/39515;
Vascular
Endothelial Growth Factor B (VEGF-3); Vascular Endothelial Growth Factor B-186
(VEGF-
B186), as disclosed in International Publication Number WO 96/26736; Vascular
Endothelial
Growth Factor-D (VEGF-D), as disclosed in International Publication Number WO
98/02543; Vascular Endothelial Growth Factor-D (VEGF-D), as disclosed in
International
Publication Number WO 98/07832; and Vascular Endothelial Growth Factor-E (VEGF-
E), as
disclosed in German Patent Number DE19639601. The above mentioned references
are
incorporated herein by reference herein. .
In an additional embodiment, the Therapeutics of the invention are
administered in
combination with hematopoietic growth factors. Hematopoietic growth factors
that may be
administered with the Therapeutics of the invention include, but are not
limited to,
LEUKINET"" (SARGRAMOSTIMT"") and NEUPOGENT"" (FILGRASTIMT"").
In an additional embodiment, the Therapeutics of the invention are
administered in
combination with Fibroblast Growth Factors. Fibroblast Growth Factors that may
be
administered with the Therapeutics of the invention include, but are not
limited to, FGF-1,
FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-11, FGF-
12,
FGF-13, FGF-14, and FGF-15.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
237
In additional embodiments, the Therapeutics of the invention are administered
in
combination with other therapeutic or prophylactic regimens, such as, for
example, radiation
therapy.
Example 25: Method of Treating Decreased Levels of TGF alpha HIII
The present invention relates to a method for treating an individual in need
of an
increased level of a polypeptide of the invention in the body comprising
administering to such
an individual a composition comprising a therapeutically effective amount of
an agonist of
the invention (including polypeptides of the invention). Moreover, it will be
appreciated that
conditions caused by a decrease in the standard or normal expression level of
TGF alpha HIII
in an individual can be treated by administering TGF alpha HIII, preferably in
the secreted
form. Thus, the invention also provides a method of treatment of an individual
in need of an
increased level of TGF alpha HIII polypeptide comprising administering to such
an individual
a Therapeutic comprising an amount of TGF alpha HIII to increase the activity
level of TGF
alpha HIII in such an individual.
For example, a patient with decreased levels of TGF alpha HIII polypeptide
receives a
daily dose 0.1-100 ug/kg of the polypeptide for six consecutive days.
Preferably, the
polypeptide is in the secreted form. The exact details of the dosing scheme,
based on
administration and formulation, are provided in Example 24.
Example 26: Method of Treating Increased Levels of TGF alpha HIII
The present invention also relates to a method of treating an individual in
need of a
decreased level of a polypeptide of the invention in the body comprising
administering to
such an individual a composition comprising a therapeutically effective amount
of an
antagonist of the invention (including polypeptides and antibodies of the
invention).
In one example, antisense technology is used to inhibit production of TGF
alpha HIII.
This technology is one example of a method of decreasing levels of TGF alpha
HIII
polypeptide, preferably a secreted form, due to a variety of etiologies, such
as cancer.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
238
For example, a patient diagnosed with abnormally increased levels of TGF alpha
HIII
is administered intravenously antisense polynucleotides at 0.5, 1.0, 1.5, 2.0
and 3.0 mg/kg day
for 21 days. This treatment is repeated after a 7-day rest period if the
treatment was well
tolerated. The formulation of the antisense polynucleotide is provided in
Example 24.
Example 27: Method of Treatment Using
Gene Therapy - Ex Yivo
One method of gene therapy transplants fibroblasts, which are capable of
expressing
TGF alpha HIII polypeptides, onto a patient. Generally, fibroblasts are
obtained from a
subject by skin biopsy. The resulting tissue is placed in tissue-culture
medium and separated
into small pieces. Small chunks of the tissue are placed on a wet surface of a
tissue culture
flask, approximately ten pieces are placed in each flask. The flask is turned
upside down,
closed tight and left at room temperature over night. After 24 hours at room
temperature, the
flask is inverted and the chunks of tissue remain fixed to the bottom of the
flask and fresh
media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin) is
added. The
flasks are then incubated at 37 degree C for approximately one week.
At this time, fresh media is added and subsequently changed every several
days. After
an additional two weeks in culture, a monolayer of fibroblasts emerge. The
monolayer is
trypsinized and scaled into larger flasks.
pMV-7 (Kirschmeier, P.T. et al., DNA, 7:219-25 (1988)), flanked by the long
terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI
and HindIII
and subsequently treated with calf intestinal phosphatase. The linear vector
is fractionated on
agarose gel and purified, using glass beads.
The cDNA encoding TGF alpha HIII can be amplified using PCR primers which
correspond to the 5' and 3' end sequences respectively as set forth in Example
1. Preferably,
the 5' primer contains an EcoRI site and the 3' primer includes a HindIII
site. Equal quantities
of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI
and HindIII
fragment are added together, in the presence of T4 DNA ligase. The resulting
mixture is
maintained under conditions appropriate for ligation of the two fragments. The
ligation
mixture is then used to transform bacteria HB101, which are then plated onto
agar containing
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
239
kanamycin for the purpose of confirming that the vector contains properly
inserted TGF alpha
HIII.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture
to
confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf
serum
(CS), penicillin and streptomycin. The MSV vector containing the TGF alpha
HIII gene is
then added to the media and the packaging cells transduced with the vector.
The packaging
cells now produce infectious viral particles containing the TGF alpha HIII
gene(the packaging
cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the
media is
harvested from a 10 cm plate of confluent producer cells. The spent media,
containing the
infectious viral particles, is filtered through a millipore filter to remove
detached producer
cells and this media is then used to infect fibroblast cells. Media is removed
from a sub-
confluent plate of fibroblasts and quickly replaced with the media from the
producer cells.
This media is removed and replaced with fresh media. If the titer of virus is
high, then
virtually all fibroblasts will be infected and no selection is required. If
the titer is very low,
then it is necessary to use a retroviral vector that has a selectable marker,
such as neo or his.
Once the fibroblasts have been efficiently infected, the fibroblasts are
analyzed to determine
whether TGF alpha HIII protein is produced.
The engineered fibroblasts are then transplanted onto the host, either alone
or after
having been grown to confluence on cytodex 3 microcarrier beads.
Example 28: Gene Therapy Using Endogenous TGF alpha HIII Gene
Another method of gene therapy according to the present invention involves
operably
associating the endogenous TGF alpha HIII sequence with a promoter via
homologous
recombination as described, for example, in U.S. Patent No. 5,641,670, issued
June 24, 1997;
International Publication No. WO 96/29411, published September 26, 1996;
International
Publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc.
Natl. Acad. Sci.
USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989). This
method
involves the activation of a gene which is present in the target cells, but
which is not
expressed in the cells, or is expressed at a lower level than desired.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
240
Polynucleotide constructs are made which contain a promoter and targeting
sequences, which are homologous to the 5' non-coding sequence of endogenous
TGF alpha
HIII, flanking the promoter. The targeting sequence will be sufficiently near
the 5' end of
TGF alpha HIII so the promoter will be operably linked to the endogenous
sequence upon
S homologous recombination. The promoter and the targeting sequences can be
amplified
using PCR. Preferably, the amplified promoter contains distinct restriction
enzyme sites on
the 5' and 3' ends. Preferably, the 3' end of the first targeting sequence
contains the same
restriction enzyme site as the 5' end of the amplified promoter and the 5' end
of the second
targeting sequence contains the same restriction site as the 3' end of the
amplified promoter.
The amplified promoter and the amplified targeting sequences are digested with
the
appropriate restriction enzymes and subsequently treated with calf intestinal
phosphatase.
The digested promoter and digested targeting sequences are added together in
the presence of
T4 DNA ligase. The resulting mixture is maintained under conditions
appropriate for ligation
1 S of the two fragments. The construct is size fractionated on an agarose gel
then purified by
phenol extraction and ethanol precipitation.
In this Example, the polynucleotide constructs are administered as naked
polynucleotides via electroporation. However, the polynucleotide constructs
may also be
administered with transfection-facilitating agents, such as liposomes, viral
sequences, viral
particles, precipitating agents, etc. Such methods of delivery are known in
the art.
Once the cells are transfected, homologous recombination will take place which
results in the promoter being operably linked to the endogenous TGF alpha HIII
sequence.
This results in the expression of TGF alpha HIII in the cell. Expression may
be detected by
immunological staining, or any other method known in the art.
Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue
is placed
in DMEM + 10% fetal calf serum. Exponentially growing or early stationary
phase fibroblasts
are trypsinized and rinsed from the plastic surface with nutrient medium. An
aliquot of the
cell suspension is removed for counting, and the remaining cells are subjected
to
centrifugation. The supernatant is aspirated and the pellet is resuspended in
5 ml of
electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCI, 5 mM KCI, 0.7 mM Na2
HP04, 6 mM dextrose). The cells are recentrifuged, the supernatant aspirated,
and the cells
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
241
resuspended in electroporation buffer containing 1 mg/ml acetylated bovine
serum albumin.
The final cell suspension contains approximately 3X106 cells/ml.
Electroporation should be
performed immediately following resuspension.
Plasmid DNA is prepared according to standard techniques. For example, to
, construct a plasmid for targeting to the TGF alpha HIII locus, plasmid pUC
18 (MBI
Fermentas, Amherst, NY) is digested with HindIII. The CMV promoter is
amplified by PCR
with an XbaI site on the S' end and a BamHI site on the 3'end. Two TGF alpha
HIII non-
coding sequences are amplified via PCR: one TGF alpha HIII non-coding sequence
(TGF
alpha HIII fragment 1) is amplified with a HindIII site at the 5' end and an
Xba site at the
3'end; the other TGF alpha HIII non-coding sequence (TGF alpha HIII fragment
2) is
amplified with a BamHI site at the 5'end and a HindIII site at the 3'end. The
CMV promoter
and TGF alpha HIII fragments (1 and 2) are digested with the appropriate
enzymes (CMV
promoter - XbaI and BamHI; TGF alpha HIII fragment 1 - XbaI; TGF alpha HIII
fragment 2
BamHI) and ligated together. The resulting ligation product is digested with
HindIII, and
ligated with the HindIlI-digested pUC 18 plasmid.
Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap (Bio-
Rad). The
final DNA concentration is generally at least 120 pg/ml. 0.5 ml of the cell
suspension
(containing approximately 1.5.X106 cells) is then added to the cuvette, and
the cell
suspension and DNA solutions are gently mixed. Electroporation is performed
with a
Gene-Pulser apparatus (Bio-Rad). Capacitance and voltage are set at 960 ~F and
250-300 V,
respectively. As voltage increases, cell survival decreases, but the
percentage of surviving
cells that stably incorporate the introduced DNA into their genome increases
dramatically.
Given these parameters, a pulse time of approximately 14-20 mSec should be
observed.
Electroporated cells are maintained at room temperature for approximately 5
min, and
the contents of the cuvette are then gently removed with a sterile transfer
pipette. The cells
are added directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf
serum) in a
10 cm dish and incubated at 37 degree C. The following day, the media is
aspirated and
replaced with 10 ml of fresh media and incubated for a further 16-24 hours.
The engineered fibroblasts are then injected into the host, either alone or
after having
been grown to confluence on cytodex 3 microcarner beads. The fibroblasts now
produce the
protein product. The fibroblasts can then be introduced into a patient as
described above.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
242
Example 29: Method of Treatment Using
Gene Therapy - In Vivo
Another aspect of the present invention is using in vivo gene therapy methods
to treat
disorders, diseases and conditions. The gene therapy method relates to the
introduction of
naked nucleic acid (DNA, RNA, and antisense DNA or RNA) TGF alpha HIII
sequences
into an animal to increase or decrease the expression of the TGF alpha HIII
polypeptide. The
TGF alpha HIII polynucleotide may be operatively linked to a promoter or any
other genetic
elements necessary for the expression of the TGF alpha HIII polypeptide by the
target tissue.
Such gene therapy and delivery techniques and methods are known in the art,
see, for
example, W090/11092, W098/11779; U.S. Patent NO. 5693622, 5705151, 5580859;
Tabata
H. et al. (1997) Cardiovasc. Res. 35(3):470-479, Chao J et al. (1997)
Pharmacol. Res.
35(6):517-522, Wolff J.A. (1997) Neuromuscul. Disord. 7(5):314-318, Schwartz
B. et al.
(1996) Gene Ther. 3(5):405-411, Tsurumi Y. et al. (1996) Circulation
94(12):3281-3290
(incorporated herein by reference).
The TGF alpha HI)I polynucleotide constructs may be delivered by any method
that
delivers injectable materials to the cells of an animal, such as, injection
into the interstitial
space of tissues (heart, muscle, skin, lung, liver, intestine and the like).
The TGF alpha HIII
polynucleotide constructs can be delivered in a pharmaceutically acceptable
liquid or aqueous
Garner.
The term "naked" polynucleotide, DNA or RNA, refers to sequences that are free
from any delivery vehicle that acts to assist, promote, or facilitate entry
into the cell,
including viral sequences, viral particles, liposome formulations, lipofectin
or precipitating
agents and the like. However, the TGF alpha HIII polynucleotides may also be
delivered in
liposome formulations (such as those taught in Felgner P.L. et al. (1995) Ann.
NY Acad. Sci.
772:126-139 and Abdallah B. et al. (1995) Biol. Cell 85(1):1-7) which can be
prepared by
methods well known to those skilled in the art.
The TGF alpha HI>I polynucleotide vector constructs used in the gene therapy
method are preferably constructs that will not integrate into the host genome
nor will they
contain sequences that allow for replication. Any strong promoter known to
those skilled in
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
243
the art can be used for driving the expression of DNA. Unlike other gene
therapies
techniques, one major advantage of introducing naked nucleic acid sequences
into target cells
is the transitory nature of the polynucleotide synthesis in the cells. Studies
have shown that
non-replicating DNA sequences can be introduced into cells to provide
production of the
desired polypeptide for periods of up to six months.
The TGF alpha HIII polynucleotide construct can be delivered to the
interstitial space
of tissues within the an animal, including of muscle, skin, brain, lung,
liver, spleen, bone
marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall
bladder,
stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland,
and connective
tissue. Interstitial space of the tissues comprises the intercellular fluid,
mucopolysaccharide
matrix among the reticular fibers of organ tissues, elastic fibers in the
walls of vessels or
chambers, collagen fibers of fibrous tissues, or that same matrix within
connective tissue
ensheathing muscle cells or in the lacunae of bone. It is similarly the space
occupied by the
plasma of the circulation and the lymph fluid of the lymphatic channels.
Delivery to the
interstitial space of muscle tissue is preferred for the reasons discussed
below. They may be
conveniently delivered by injection into the tissues comprising these cells.
They are
preferably delivered to and expressed in persistent, non-dividing cells which
are
differentiated, although delivery and expression may be achieved in non-
differentiated or less
completely differentiated cells, such as, for example, stem cells of blood or
skin fibroblasts.
In vivo muscle cells are particularly competent in their ability to take up
and express
polynucleotides.
For the naked TGF alpha HIII polynucleotide injection, an effective dosage
amount of
DNA or RNA will be in the range of from about 0.05 g/kg body weight to about
50 mg/kg
body weight. Preferably the dosage will be from about 0.005 mg/kg to about 20
mg/kg and
more preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the
artisan of
ordinary skill will appreciate, this dosage will vary according to the tissue
site of injection.
The appropriate and effective dosage of nucleic acid sequence can readily be
determined by
those of ordinary skill in the art and may depend on the condition being
treated and the route
of administration. The preferred route of administration is by the parenteral
route of injection
into the interstitial space of tissues. However, other parenteral routes may
also be used, such
as, inhalation of an aerosol formulation particularly for delivery to lungs or
bronchial tissues,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
244
throat or mucous membranes of the nose. In addition, naked TGF alpha HIII
polynucleotide
constructs can be delivered to arteries during angioplasty by the catheter
used in the
procedure.
The dose response effects of injected TGF alpha HIII polynucleotide in muscle
in vivo
is determined as follows. Suitable TGF alpha HIII template DNA for production
of mRNA
coding for TGF alpha HIII polypeptide is prepared in accordance with a
standard recombinant
DNA methodology. The template DNA, which may be either circular or linear, is
either used
as naked DNA or complexed with liposomes. The quadriceps muscles of mice are
then
injected with various amounts of the template DNA.
Five to six week old female and male Balb/C mice are anesthetized by
intraperitoneal
injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is made on the
anterior thigh, and
the quadriceps muscle is directly visualized. The TGF alpha HIII template DNA
is injected in
0.1 ml of carrier in a 1 cc syringe through a 27 gauge needle over one minute,
approximately
0.5 cm from the distal insertion site of the muscle into the knee and about
0.2 cm deep. A
suture is placed over the injection site for future localization, and the skin
is closed with
stainless steel clips.
After an appropriate incubation time (e.g., 7 days) muscle extracts are
prepared by
excising the entire quadriceps. Every fifth 1 S um cross-section of the
individual quadriceps
muscles is histochemically stained for TGF alpha~HIII protein expression. A
time course for
TGF alpha HlII protein expression may be done in a similar fashion except that
quadriceps
from different mice are harvested at different times. Persistence of TGF alpha
HIII DNA in
muscle following injection may be determined by Southern blot analysis after
preparing total
cellular DNA and HIRT supernatants from injected and control mice. The results
of the
above experimentation in mice can be use to extrapolate proper dosages and
other treatment
parameters in humans and other animals using TGF alpha HIII naked DNA.
Example 30: TGF alpha HIII Transgenic Animals.
The TGF alpha HIII polypeptides can also be expressed in transgenic animals.
Animals of any species, including, but not limited to, mice, rats, rabbits,
hamsters, guinea
pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates, e.g.,
baboons, monkeys,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
245
and chimpanzees may be used to generate transgenic animals. In a specific
embodiment,
techniques described herein or otherwise known in the art, are used to express
polypeptides of
the invention in humans, as part of a gene therapy protocol.
Any technique known in the art may be used to introduce the transgene (i.e.,
polynucleotides of the invention) into animals to produce the founder lines of
transgenic
animals. Such techniques include, but are not limited to, pronuclear
microinjection (Paterson
et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994); Carver et al.,
Biotechnology (NY)
11:1263-1270 ( 1993); Wright et al., Biotechnology (NY) 9:830-834 ( 1991 );
and Hoppe et al.,
U.S. Pat. No. 4,873,191 (1989)); retrovirus mediated gene transfer into germ
lines (Van der
Putten et al., Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts
or embryos; gene
targeting in embryonic stem cells (Thompson et al., Cell 56:313-321 (1989));
electroporation
of cells or embryos (Lo, 1983, Mol Cell. Biol. 3:1803-1814 (1983));
introduction of the
polynucleotides of the invention using a gene gun (see, e.g., Ulmer et al.,
Science 259:1745
(1993); introducing nucleic acid constructs into embryonic pleuripotent stem
cells and
transferring the stem cells back into the blastocyst; and sperm-mediated gene
transfer
(Lavitrano et al., Cell 57:717-723 (1989); etc. For a review of such
techniques, see Gordon,
"Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989), which is
incorporated by
reference herein in its entirety.
Any technique known in the art may be used to produce transgenic clones
containing
polynucleotides of the invention, for example, nuclear transfer into
enucleated oocytes of
nuclei from cultured embryonic, fetal, or adult cells induced to quiescence
(Campell et al.,
Nature 380:64-66 (1996); Wilmut et al., Nature 385:810-813 (1997)).
The present invention provides for transgenic animals that carry the transgene
in all
their cells, as well as animals which carry the transgene in some, but not all
their cells, i.e.,
mosaic animals or chimeric. The transgene may be integrated as a single
transgene or as
multiple copies such as in concatamers, e.g., head-to-head tandems or head-to-
tail tandems.
The transgene may also be selectively introduced into and activated in a
particular cell type
by following, for example, the teaching of Lasko et al. (Lasko et al., Proc.
Natl. Acad. Sci.
USA 89:6232-6236 (1992)). The regulatory sequences required for such a cell-
type specific
activation will depend upon the particular cell type of interest, and will be
apparent to those
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
246
of skill in the art. When it is desired that the polynucleotide transgene be
integrated into the
chromosomal site of the endogenous gene, gene targeting is preferred.
Briefly, when such a technique is to be utilized, vectors containing some
nucleotide
sequences homologous to the endogenous gene are designed for the purpose of
integrating,
via homologous recombination with chromosomal sequences, into and disrupting
the function
of the nucleotide sequence of the endogenous gene. The transgene may also be
selectively
introduced into a particular cell type, thus inactivating the endogenous gene
in only that cell
type, by following, for example, the teaching of Gu et al. (Gu et al., Science
265:103-106
(1994)). The regulatory sequences required for such a cell-type specific
inactivation will
depend upon the particular cell type of interest, and will be apparent to
those of skill in the
art. The contents of each of the documents recited in this paragraph is herein
incorporated by
reference in its entirety.
Any of the TGF alpha HIII polypeptides disclose throughout this application
can be
used to generate transgenic animals. For example, DNA encoding amino acids M1-
5229 of
SEQ ID N0:2 can be inserted into a vector containing a promoter, such as the
actin promoter,
which will ubiquitously express the inserted fragment. Other fragments of TGF
alpha HIII
can also be inserted into a vector to create transgenics having ubiquitous
expression.
Alternatively, polynucleotides of the invention can be inserted in a vector
which
controls tissue specific expression through a tissue specific promoter. For
example, a
construct having a transfernn promoter would express the TGF alpha HIII
polypeptide in the
liver of transgenic animals. Therefore, DNA encoding amino acids M1-5229 of
SEQ ID
N0:2 can be amplified.
In addition to expressing the polypeptide of the present invention in a
ubiquitous or
tissue specific manner in transgenic animals, it would also be routine for one
skilled in the art
to generate constructs which regulate expression of the polypeptide by a
variety of other
means (for example, developmentally or chemically regulated expression).
Once transgenic animals have been generated, the expression of the recombinant
gene
may be assayed utilizing standard techniques. Initial screening may be
accomplished by
Southern blot analysis or PCR techniques to analyze animal tissues to verify
that integration
of the transgene has taken place. The level of mRNA expression of the
transgene in the
tissues of the transgenic animals may also be assessed using techniques which
include, but
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
247
are not limited to, Northern blot analysis of tissue samples obtained from the
animal, in situ
hybridization analysis, and reverse transcriptase-PCR (rt-PCR). Samples of
transgenic gene-
expressing tissue may also be evaluated immunocytochemically or
immunohistochemically
using antibodies specific for the transgene product.
Once the founder animals are produced, they may be bred, inbred, outbred, or
crossbred to produce colonies of the particular animal. Examples of such
breeding strategies
include, but are not limited to: outbreeding of founder animals with more than
one
integration site in order to establish separate lines; inbreeding of separate
lines in order to
produce compound transgenics that express the transgene at higher levels
because of the
effects of additive expression of each transgene; crossing of heterozygous
transgenic animals
to produce animals homozygous for a given integration site in order to both
augment
expression and eliminate the need for screening of animals by DNA analysis;
crossing of
separate homozygous lines to produce compound heterozygous or homozygous
lines; and
breeding to place the transgene on a distinct background that is appropriate
for an
experimental model of interest.
Transgenic animals of the invention have uses which include, but are not
limited to,
animal model systems useful in elaborating the biological function of TGF
alpha HIII
polypeptides, studying conditions and/or disorders associated with aberrant
TGF alpha HIII
expression, and in screening for compounds effective in ameliorating such
conditions and/or
disorders.
Example 31: TGF alpha HIII Knock-Out Animals.
Endogenous TGF alpha HIII gene expression can also be reduced by inactivating
or
"knocking out" the TGF alpha HIII gene and/or its promoter using targeted
homologous
recombination. (E.g., see Smithies et al., Nature 317:230-234 (1985); Thomas &
Capecchi, .
Cell 51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989); each of which
is
incorporated by reference herein in its entirety). For example, a mutant, non-
functional
polynucleotide of the invention (or a completely unrelated DNA sequence)
flanked by DNA
homologous to the endogenous polynucleotide sequence (either the coding
regions or
regulatory regions of the gene) can be used, with or without a selectable
marker and/or a
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
248
negative selectable marker, to transfect cells that express polypeptides of
the invention in
vivo. In another embodiment, techniques known in the art are used to generate
knockouts in
cells that contain, but do not express the gene of interest. Insertion of the
DNA construct, via
targeted homologous recombination, results in inactivation of the targeted
gene. Such
approaches are particularly suited in research and agricultural fields where
modifications to
embryonic stem cells can be used to generate animal offspring with an inactive
targeted gene
(e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra). However this
approach can
be routinely adapted for use in humans provided the recombinant DNA constructs
are directly
administered or targeted to the required site in vivo using appropriate viral
vectors that will
be apparent to those of skill in the art.
In further embodiments of the invention, cells that are genetically engineered
to
express the polypeptides of the invention, or alternatively, that are
genetically engineered not
to express the polypeptides of the invention (e.g., knockouts) are
administered to a patient in
vivo. Such cells may be obtained from the patient (i.e., animal, including
human) or an MHC
compatible donor and can include, but are not limited to fibroblasts, bone
marrow cells, blood
cells (e.g_, lymphocytes), adipocytes, muscle cells, endothelial cells etc.
The cells are
genetically engineered in vitro using recombinant DNA techniques to introduce
the coding
sequence of polypeptides of the invention into the cells, or alternatively, to
disrupt the coding
sequence and/or endogenous regulatory sequence associated with the
polypeptides of the
invention, ~, by transduction (using viral vectors, and preferably vectors
that integrate the
transgene into the cell genome) or transfection procedures, including, but not
limited to, the
use of plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc.
The coding
sequence of the polypeptides of the invention can be placed under the control
of a strong
constitutive or inducible promoter or promoter/enhancer to achieve expression,
and
preferably secretion, of the TGF alpha HIII polypeptides. The engineered cells
which express
and preferably secrete the polypeptides of the invention can be introduced
into the patient
systemically, e.g., in the circulation, or intraperitoneally.
Alternatively, the cells can be incorporated into a matrix and implanted in
the body,
e.~., genetically engineered fibroblasts can be implanted as part of a skin
graft; genetically
engineered endothelial cells can be implanted as part of a lymphatic or
vascular graft. (See,
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
249
for example, Anderson et al. U.S. Patent No. 5,399,349; and Mulligan & Wilson,
U.S. Patent
No. 5,460,959 each of which is incorporated by reference herein in its
entirety).
When the cells to be administered are non-autologous or non-MHC compatible
cells,
they can be administered using well known techniques which prevent the
development of a
host immune response against the introduced cells. For example, the cells may
be introduced
in an encapsulated form which, while allowing for an exchange of components
with the
immediate extracellular environment, does not allow the introduced cells to be
recognized by
the host immune system.
Knock-out animals of the invention have uses which include, but are not
limited to,
animal model systems useful in elaborating the biological function of TGF
alpha HIII
polypeptides, studying conditions and/or disorders associated with aberrant
TGF alpha HIII
expression, and in screening for compounds effective in ameliorating such
conditions and/or
disorders.
Example 32: Assays Detecting Stimulation or Inhibition of
B cell Proliferation and Differentiation
Generation of functional humoral immune responses requires both soluble and
cognate signaling between B-lineage cells and their microenvironment. Signals
may impart a
positive stimulus that allows a B-lineage cell to continue its programmed
development, or a
negative stimulus that instructs the cell to arrest its current developmental
pathway. To date,
numerous stimulatory and inhibitory signals have been found to influence B
cell
responsiveness including IL-2, IL-4, IL,-5, IL-6, IL-7, IL10, IL-13, IL-14 and
IL-15.
Interestingly, these signals are by themselves weak effectors but can, in
combination with
various co-stimulatory proteins, induce activation, proliferation,
differentiation, homing,
tolerance and death among B cell populations.
One of the best studied classes of B-cell co-stimulatory proteins is the TNF-
superfamily. Within this family CD40, CD27, and CD30 along with their
respective ligands
CD154, CD70, and CD153 have been found to regulate a variety of immune
responses.
Assays which allow for the detection and/or observation of the proliferation
and
differentiation of these B-cell populations and their precursors are valuable
tools in
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
250
determining the effects various proteins may have on these B-cell populations
in terms of
proliferation and differentiation. Listed below are two assays designed to
allow for the
detection of the differentiation, proliferation, or inhibition of B-cell
populations and their
precursors.
In Vitro Assay- Purified TGF alpha HIII protein, or truncated forms thereof,
is
assessed for its ability to induce activation, proliferation, differentiation
or inhibition and/or
death in B-cell populations and their precursors. The activity of TGF alpha
HIII protein on
purified human tonsillar B cells, measured qualitatively over the dose range
from 0.1 to
10,000 ng/mL, is assessed in a standard B-lymphocyte co-stimulation assay in
which purified
tonsillar B cells are cultured in the presence of either formalin-fixed
Staphylococcus aureus
Cowan I (SAC) or immobilized anti-human IgM antibody as the priming agent.
Second
signals such as IL-2 and IL-15 synergize with SAC and IgM crosslinking to
elicit B cell
proliferation as measured by tritiated-thymidine incorporation. Novel
synergizing agents can
be readily identified using this assay. The assay involves isolating human
tonsillar B cells by
magnetic bead (MACS) depletion of CD3-positive cells. The resulting cell
population is
greater than 95% B cells as assessed by expression of CD45R(B220).
Various dilutions of each sample are placed into individual wells of a 96-well
plate to
which are added 105 B-cells suspended in culture medium (RPMI 1640 containing
10% FBS,
5 X 10-SM 2ME, 100U/ml penicillin, l0ug/ml streptomycin, and 10-5 dilution of
SAC) in a
total volume of 150u1. Proliferation or inhibition is quantitated by a 20h
pulse (luCi/well)
with 3H-thymidine (6.7 Ci/mM) beginning 72h post factor addition. The positive
and
negative controls are IL2 and medium respectively.
In Vivo Assay- BALB/c mice are injected (i.p.) twice per day with buffer only,
or 2
mg/Kg of TGF alpha HIII protein, or truncated forms thereof. Mice receive this
treatment for
4 consecutive days, at which time they are sacrificed and various tissues and
serum collected
for analyses. Comparison of H&E sections from normal and TGF alpha HIII
protein-treated
spleens identify the results of the activity of TGF alpha HIII protein on
spleen cells, such as
the diffusion of peri-arterial lymphatic sheaths, and/or significant increases
in the nucleated
cellularity of the red pulp regions, which may indicate the activation of the
differentiation and
proliferation of B-cell populations. Immunohistochemical studies using a B
cell marker, anti-
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
251
CD45R(B220), are used to determine whether any physiological changes to
splenic cells,
such as splenic disorganization, are due to increased B-cell representation
within loosely
defined B-cell zones that infiltrate established T-cell regions.
Flow cytometric analyses of the spleens from TGF alpha HIB protein-treated
mice is
used to indicate whether TGF alpha HIII protein specifically increases the
proportion of
ThB+, CD45R(B220)dull B cells over that which is observed in control mice.
Likewise, a predicted consequence of increased mature B-cell representation in
vivo is
a relative increase in serum Ig titers. Accordingly, serum IgM and IgA levels
are compared
between buffer and TGF alpha HIII protein-treated mice.
The studies described in this example tested activity in TGF alpha HBI
protein.
However, one skilled in the art could easily modify the exemplified studies to
test the activity
of TGF alpha HIII polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TGF
alpha HIII.
Example 33: T Cell Proliferation Assay
A CD3-induced proliferation assay is performed on PBMCs and is measured by the
uptake
of 3H-thymidine. The assay is performed as follows. Ninety-six well plates are
coated with 100
p.l/well of mAb to CD3 (HIT3a, Pharmingen) or isotype-matched control mAb
(B33.1) overnight
at 4°C (1 p,g/ml in .05M bicarbonate buffer, pH 9.5), then washed three
times with PBS. PBMC
are isolated by F/H gradient centrifugation from human peripheral blood and
added to
quadruplicate wells (S x 104/well) of mAb coated plates in RPMI containing 10%
FCS and P/S in
the presence of varying concentrations of TGF alpha HIII protein (total volume
200 p1). Relevant
protein buffer and medium alone are controls. After 48 hr. culture at
37°C, plates are spun for 2
min. at 1000 rpm and 100 ~1 of supernatant is removed and stored -20°C
for measurement of IL,-2
(or other cytokines) if effect on proliferation is observed. Wells are
supplemented with 100 ~1 of
medium containing 0.5 ~Ci of 3H-thymidine and cultured at 37°C for 18-
24 hr. Wells are
harvested and incorporation of 3H-thymidine used as a measure of
proliferation. Anti-CD3 alone
is the positive control for proliferation. IL-2 (100 U/ml) is also used as a
control which enhances
proliferation. Control antibody which does not induce proliferation of T cells
is used as the
negative controls for the effects of TGF alpha HIII proteins.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
252
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 34: Effect of TGF alpha HIII on the Expression of MHC Class II,
Costimulatory and Adhesion Molecules and
Cell Differentiation of Monocytes and
Monocyte Derived Human Dendritic Cells
Dendritic cells are generated by the expansion of proliferating precursors
found in the
peripheral blood: adherent PBMC or elutriated monocytic fractions are cultured
for 7-10 days
with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These dendritic cells have the
characteristic
phenotype of immature cells (expression of CDl, CD80, CD86, CD40 and MHC class
II
antigens). Treatment with activating factors, such as TNF-a, causes a rapid
change in surface
phenotype (increased expression of MHC class I and II, costimulatory and
adhesion molecules,
downregulation of FCyRII, upregulation of CD83). These changes correlate with
increased
antigen-presenting capacity and with functional maturation of the dendritic
cells.
FACS analysis of surface antigens is performed as follows. Cells are treated 1-
3 days with
increasing concentrations of TGF alpha HIII or LPS (positive control), washed
with PBS
containing 1% BSA and 0.02 mM sodium azide, and then incubated with 1:20
dilution of
appropriate FITC- or PE-labeled monoclonal antibodies for 30 minutes at
4°C. After an
additional wash, the labeled cells are analyzed by flow cytometry on a FACScan
(Becton
Dickinson).
Effect on the production of cytokines. Cytokines generated by dendritic cells,
in
particular IL-12, are important in the initiation of T-cell dependent immune
responses. IL-12
strongly influences the development of Thl helper T-cell immune response, and
induces
cytotoxic T and NK cell function. An ELISA is used to measure the IL-12
release as follows.
Dendritic cells (106/m1) are treated with increasing concentrations of TGF
alpha HIII for 24
hours. LPS (100 ng/ml) is added to the cell culture as positive control.
Supernatants from the
cell cultures are then collected and analyzed for IL-12 content using
commercial ELISA kit
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
253
(e..g, R & D Systems (Minneapolis, MN)). The standard protocols provided with
the kits are
used.
Effect on the expression of MHC Class II, costimulatory and adhesion
molecules.
Three major families of cell surface antigens can be identified on monocytes:
adhesion
molecules, molecules involved in antigen presentation, and Fc receptor.
Modulation of the
expression of MHC class II antigens and other costimulatory molecules, such as
B7 and
ICAM-1, may result in changes in the antigen presenting capacity-of monocytes
and ability to
induce T cell activation. Increase expression of Fc receptors may correlate
with improved
monocyte cytotoxic activity, cytokine release and phagocytosis.
FACS analysis is used to examine the surface antigens as follows. Monocytes
are
treated 1-5 days with increasing concentrations of TGF alpha HIII or LPS
(positive control),
washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then incubated
with
1:20 dilution of appropriate FITC- or PE-labeled monoclonal antibodies for 30
minutes at
4°C. After an additional wash, the labeled cells are analyzed by flow
cytometry on a
FACScan (Becton Dickinson).
Monocyte activation and/or increased survival. Assays for molecules that
activate (or
alternatively, inactivate) monocytes and/or increase monocyte survival (or
alternatively,
decrease monocyte survival) are known in the art and may routinely be applied
to determine
whether.a molecule of the invention functions as an inhibitor or activator of
monocytes. TGF
alpha HIII, agonists, or antagonists of TGF alpha HIII can be screened using
the three assays
described below. For each of these assays, Peripheral blood mononuclear cells
(PBMC) are
purified from single donor leukopacks (American Red Cross, Baltimore, MD) by
centrifugation through a Histopaque gradient (Sigma). Monocytes are isolated
from PBMC
by counterflow centrifugal elutriation.
Monocyte Survival Assay. Human peripheral blood monocytes progressively lose
viability when cultured in absence of serum or other stimuli. Their death
results from
internally regulated process (apoptosis). Addition to the culture of
activating factors, such as
TNF-alpha dramatically improves cell survival and prevents DNA fragmentation.
Propidium
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
254
iodide (PI) staining is used to measure apoptosis as follows. Monocytes are
cultured for 48
hours in polypropylene tubes in serum-free medium (positive control), in the
presence of 100
ng/ml TNF-alpha (negative control), and in the presence of varying
concentrations of the
compound to be tested. Cells are suspended at a concentration of 2 x 106/m1 in
PBS
containing PI at a final concentration of 5 pg/ml, and then incubaed at room
temperature for S
minutes before FACScan analysis. PI uptake has been demonstrated to correlate
with DNA
fragmentation in this experimental paradigm.
Effect on cytokine release. An important function of monocytes/macrophages is
their
regulatory activity on other cellular populations of the immune system through
the release of
cytokines after stimulation. An ELISA to measure cytokine release is performed
as follows.
Human monocytes are incubated at a density of Sx 105 cells/ml with increasing
concentrations of TGF alpha H>TI and under the same conditions, but in the
absence of TGF
alpha HIII. For IL-12 production, the cells are primed overnight with IFN (100
U/ml) in
presence of TGF alpha HIII. LPS (10 ng/ml) is then added. Conditioned media
are collected
after 24h and kept frozen until use. Measurement of TNF-alpha, IL-10, MCP-1
and IL,-8 is
then performed using a commercially available ELISA kit (e..g, R & D Systems
(Minneapolis, MN)) and applying the standard protocols provided with the kit.
Oxidative burst. Purified monocytes are plated in 96-w plate at 2-1x105
cell/well.
Increasing concentrations of TGF alpha HIII are added to the wells in a total
volume of 0.2
ml culture medium (RPMI 1640 + 10% FCS, glutamine and antibiotics). After 3
days
incubation, the plates are centrifuged and the medium is removed from the
wells. To the
macrophage monolayers, 0.2 ml per well of phenol red solution (140 mM NaCI, 10
mM
potassium phosphate buffer pH 7.0, 5.5 mM dextrose, 0.56 mM phenol red and 19
U/ml of
HRPO) is added, together with the stimulant (200 nM PMA). The plates are
incubated at
37°C for 2 hours and the reaction is stopped by adding 20 p1 1N NaOH
per well. The
absorbance is read at 610 nm. To calculate the amount of H202 produced by the
macrophages,
a standard curve of a Hz02 solution of known molarity is performed for each
experiment.
The studies described in this example tested activity in TGF alpha HIII
protein.
However, one skilled in the art could easily modify the exemplified studies to
test the activity
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
255
of TGF alpha HIII polynucleotides (e.g., gene therapy), agonists, and/or
antagonists of TGF
alpha HIII.
Example 35: TGF alpha HIII Biological Effects
Astrocyte and Neuronal Assays'
Recombinant TGF alpha HIII, expressed in Escherichia coli and purified as
described
above, can be tested for activity in promoting the survival, neurite
outgrowth, or phenotypic
differentiation of cortical neuronal cells and for inducing the proliferation
of glial fibrillary acidic
protein immunopositive cells, astrocytes. The selection of cortical cells for
the bioassay is based
on the prevalent expression of FGF-1 and FGF-2 in cortical structures and on
the previously
reported enhancement of cortical neuronal survival resulting from FGF-2
treatment. A thymidine
incorporation assay, for example, can be used to elucidate TGF alpha HMI's
activity on these cells.
Moreover, previous reports describing the biological effects of FGF-2 (basic
FGF) on
cortical or hippocampal neurons in vitro have demonstrated increases in both
neuron survival and
neurite outgrowth (Walicke, P. et al., "Fibroblast growth factor promotes
survival of dissociated
hippocampal neurons and enhances neurite extension." Proc. Natl. Acad. Sci.
USA 83:3012-3016.
(1986), assay herein incorporated by reference in its entirety). However,
reports from experiments
done on PC-12 cells suggest that these two responses are not necessarily
synonymous and may
depend on not only which FGF is being tested but also on which receptors) are
expressed on the
target cells. Using the primary cortical neuronal culture paradigm, the
ability of TGF alpha HIII
to induce neurite outgrowth can be compared to the response achieved with FGF-
2 using, for
example, a thymidine incorporation assay.
Fibroblast and endothelial cell assays
Human lung fibroblasts are obtained from Clonetics (San Diego, CA) and
maintained in
growth media from Clonetics. Dermal microvascular endothelial cells are
obtained from Cell
Applications (San Diego, CA). For proliferation assays, the human lung
fibroblasts and dermal
microvascular endothelial cells can be cultured at 5,000 cells/well in a 96-
well plate for one day
in growth medium. The cells are then incubated for one day in 0.1% BSA basal
medium. After
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
256
replacing the medium with fresh 0.1% BSA medium, the cells are incubated with
the test proteins
for 3 days. Alamar Blue (Alamar Biosciences, Sacramento, CA) is added to each
well to a final
concentration of 10%. The cells are incubated for 4 hr. Cell viability is
measured by reading in a
CytoFluor fluorescence reader. For the PGEZ assays, the human lung fibroblasts
are cultured at
5,000 cells/well in a 96-well plate for one day. After a medium change to 0.1
% BSA basal
medium, the cells are incubated with FGF-2 or TGF alpha HIII with or without
IL-la for 24
hours. The supernatants are collected and assayed for PGEZ by EIA kit (Cayman,
Ann Arbor,
MI). For the IL-6 assays, the human lung fibroblasts are cultured at 5,000
cells/well in a 96-well
plate for one day. After a medium change to 0.1% BSA basal medium, the cells
are incubated
with FGF-2 or TGF alpha HIII with or without IL-la for 24 hours. The
supernatants are collected
and assayed for IL-6 by ELISA kit (Endogen, Cambridge, MA).
Human lung fibroblasts are cultured with FGF-2 or TGF alpha HIII for 3 days in
basal
medium before the addition of Alamar Blue to assess effects on growth of the
fibroblasts. FGF-2
should show a stimulation at 10 - 2500 ng/ml which can be used to compare
stimulation with TGF
alpha HIII.
Parkinson Models.
The loss of motor function in Parkinson's disease is attributed to a
deficiency of striatal
dopamine resulting from the degeneration of the nigrostriatal dopaminergic
projection neurons.
An animal model for Parkinson's that has been extensively characterized
involves the systemic
administration of 1-methyl-4 phenyl 1,2,3,6-tetrahydropyridine (MPTP). In the
CNS, MPTP is
taken-up by astrocytes and catabolized by monoamine oxidase B to 1-methyl-4-
phenyl pyridine
(MPP+) and released. Subsequently, MPP+ is actively accumulated in
dopaminergic neurons by
the high-affinity reuptake transporter for dopamine. MPP+ is then concentrated
in mitochondria by
the electrochemical gradient and selectively inhibits nicotidamide adenine
disphosphate:
ubiquinone oxidoreductionase (complex I), thereby interfering with electron
transport and
eventually generating oxygen radicals.
It has been demonstrated in tissue culture paradigms that FGF-2 (basic FGF)
has trophic
activity towards nigral dopaminergic neurons (Ferrari et al., Dev. Biol.
1989). Recently, Dr.
Unsicker's group has demonstrated that administering FGF-2 in gel foam
implants in the striatum
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
257
results in the near complete protection of nigral dopaminergic neurons from
the toxicity associated
with MPTP exposure (Otto and Unsicker, J. Neuroscience, 1990).
Based on the data with FGF-2, TGF alpha HIII can be evaluated to determine
whether it
has an action similar to that of FGF-2 in enhancing dopaminergic neuronal
survival in vitro and it
can also be tested in vivo for protection of dopaminergic neurons in the
striatum from the damage
associated with MPTP treatment. The potential effect of TGF alpha HITI is
first examined in vitro
in a dopaminergic neuronal cell culture paradigm. The cultures are prepared by
dissecting the
midbrain floor plate from gestation day 14 Wistar rat embryos. The tissue is
dissociated with
trypsin and seeded at a density of 200,000 cells/cm2 on polyorthinine-laminin
coated glass
coverslips. The cells are maintained in Dulbecco's Modified Eagle's medium and
F12 medium
containing hormonal supplements (N1). The cultures are fixed with
paraformaldehyde after 8
days in vitro and are processed for tyrosine hydroxylase, a specific marker
for dopminergic
neurons, immunohistochemical staining. Dissociated cell cultures are prepared
from embryonic
rats. The culture medium is changed every third day and the factors are also
added at that time.
Since the dopaminergic neurons are isolated from animals at gestation day 14,
a
developmental time which is past the stage when the dopaminergic precursor
cells are
proliferating, an increase in the number of tyrosine hydroxylase
immunopositive neurons would
represent an increase in the number of dopaminergic neurons surviving in
vitro. Therefore, if
TGF alpha HIII acts to prolong the survival of dopaminergic neurons, it would
suggest that TGF
alpha HIII may be involved in Parkinson's Disease.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 36: The Effect of TGF alpha HIII on the
Growth of Vascular Endothelial Cells
On day 1, human umbilical vein endothelial cells (HUVEC) are seeded at 2-5x104
cells/35
mm dish density in M199 medium containing 4% fetal bovine serum (FBS), 16
units/ml heparin,
and 50 units/ml endothelial cell growth supplements (ECGS, Biotechnique,
Inc.). On day 2, the
medium is replaced with M199 containing 10% FBS, 8 units/ml heparin. TGF alpha
HIII protein
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
258
of SEQ ID NO. 2, and positive controls, such as VEGF and basic FGF (bFGF) are
added, at
varying concentrations. On days 4 and 6, the medium is replaced. On day 8,
cell number is
determined with a Coulter Counter.
An increase in the number of HUVEC cells indicates that TGF alpha HIII may
proliferate
vascular endothelial cells.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 3 7: Stim ulatory Effect of TGF alpha HIII
on the Proliferation of Vascular Endothelial Cells
For evaluation of mitogenic activity of growth factors, the colorimetric MTS
(3-(4,5-
dimethylthiazol-2-yl)-S-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)2H-
tetrazolium) assay with
the electron coupling reagent PMS (phenazine methosulfate) was performed
(CellTiter 96 AQ,
Promega). Cells are seeded in a 96-well plate (5,000 cells/well) in 0.1 mL
serum-supplemented
medium and are allowed to attach overnight. After serum-starvation for 12
hours in 0.5% FBS,
conditions (bFGF, VEGFI6s or TGF alpha HIII in 0.5% FBS) with or without
Heparin (8 U/ml)
are added to wells for 48 hours. 20 mg of MTS/PMS mixture (1:0.05) are added
per well and
allowed to incubate for 1 hour at 37°C before measuring the absorbance
at 490 nm in an ELISA
plate reader. Background absorbance from control wells (some media, no cells)
is subtracted, and
seven wells are performed in parallel for each condition. See, Leak et al. In
Vitro Cell. Dev. Biol.
30A:512-518 (1994).
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 38: Inhibition of PDGF induced Vascular Smooth Muscle Cell
Proliferation Stimulatory Effect
HAoSMC proliferation can be measured, for example, by BrdUrd incorporation.
Briefly,
subconfluent, quiescent cells grown on the 4-chamber slides are transfected
with CRP or FITC-
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
259
labeled AT2-3LP. Then, the cells are pulsed with 10% calf serum and 6 mg/ml
BrdUrd. After 24
h, immunocytochemistry is performed by using BrdUrd Staining Kit (Zymed
Laboratories). In
brief, the cells are incubated with the biotinylated mouse anti-BrdUrd
antibody at 4 °C for 2 h
after being exposed to denaturing solution and then incubated with the
streptavidin-peroxidase
and diaminobenzidine. After counterstaining with hematoxylin, the cells are
mounted for
microscopic examination, and the BrdUrd-positive cells are counted. The BrdUrd
index is
calculated as a percent of the BrdUrd-positive cells to the total cell number.
In addition, the
simultaneous detection of the BrdUrd staining (nucleus) and the FITC uptake
(cytoplasm) is
performed for individual cells by the concomitant use of bright field
illumination and dark field-
UV fluorescent illumination. See, Hayashida et al., J. Biol. Chem.
6:271(36):21985-21992
(1996).
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 39: Stimulation ofEndothelial Migration
This example will be used to explore the possibility that TGF alpha HBI may
stimulate
lymphatic endothelial cell migration.
Endothelial cell migration assays are performed using a 48 well
microchemotaxis chamber
(Neuroprobe Inc., Cabin John, MD; Falk, W., et al., J. Immunological Methods
1980;33:239-
247). Polyvinylpyrrolidone-free polycarbonate filters with a pore size of 8 um
(Nucleopore Corp.
Cambridge, MA) are coated with 0.1 % gelatin for at least 6 hours at room
temperature and dried
under sterile air. Test substances are diluted to appropriate concentrations
in M199 supplemented
with 0.25% bovine serum albumin (BSA), and 25 u1 of the final dilution is
placed in the lower
chamber of the modified Boyden apparatus. Subconfluent, early passage (2-6)
HUVEC or BMEC
cultures are washed and trypsinized for the minimum time required to achieve
cell detachment.
After placing the filter between lower and upper chamber, 2.5 x 105 cells
suspended in 50 u1
M199 containing 1% FBS are seeded in the upper compartment. The apparatus is
then incubated
for 5 hours at 37°C in a humidified chamber with 5% C02 to allow cell
migration: After the
incubation period, the filter is removed and the upper side of the filter with
the non-migrated cells
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
260
is scraped with a rubber policeman. The filters are fixed with methanol and
stained with a
Giemsa solution (Diff Quick, Baxter, McGraw Park, IL). Migration is quantified
by counting
cells of three random high-power fields (40x) in each well, and all groups are
performed in
quadruplicate.
S The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 40: Stimulation of Nitric Oxide Production
to by Endothelial Cells
Nitric oxide released by the vascular endothelium is believed to be a mediator
of vascular
endothelium relaxation. Thus, TGF alpha HIII activity can be assayed by
determining nitric oxide
production by endothelial cells in response to TGF alpha HIII.
15 Nitric oxide is measured in 96-well plates of confluent microvascular
endothelial cells
after 24 hours starvation and a subsequent 4 hr exposure to various levels of
a positive control
(such as VEGF-1) and TGF alpha HIII. Nitric oxide in the medium is determined
by use of the
Griess reagent to measure total nitrite after reduction of nitric oxide-
derived nitrate by nitrate
reductase. The effect of TGF alpha HIII on nitric oxide release is examined on
HLTVEC.
20 Briefly, NO release from cultured HLJVEC monolayer is measured with a NO-
specific
polarographic electrode connected to a NO meter (Iso-NO, World Precision
Instruments Inc.)
(1049): Calibration of the NO elements is performed according to the following
equation:
2KN02+2KI+2HZS0462N0+IZ+2H20+2KZS04
The standard calibration curve is obtained by adding graded concentrations of
KNOZ (0, 5,
25 10, 25, 50, 100, 250, and 500 nmol/L) into the calibration solution
containing KI and HZS04. The
specificity of the Iso-NO electrode to NO is previously determined by
measurement of NO from
authentic NO gas (1050). The culture medium is removed and HUVECs are washed
twice with
Dulbecco's phosphate buffered saline. The cells are then bathed in 5 ml of
filtered Krebs-
Henseleit solution in 6-well plates, and the cell plates are kept on a slide
warmer (Lab Line
30 Instruments Inc.) To maintain the temperature at 37°C. The NO sensor
probe is inserted vertically
into the wells, keeping the tip of the electrode 2 mm under the surface of the
solution, before
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
261
addition of the different conditions. S-nitroso acetyl penicillamin (SNAP) is
used as a positive
control. The amount of released NO is expressed as picomoles per 1x10
endothelial cells. All
values reported are means of four to six measurements in each group (number of
cell culture
wells). See, Leak et al. Biochem. and Biophys. Res. Coynm. 217:96-105 (1995).
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 41: Effect of TGF alpha HIII on
Cord Formation in Angiogenesis
Another step in angiogenesis is cord formation, marked by differentiation of
endothelial
cells. This bioassay measures the ability of microvascular endothelial cells
to form capillary-like
structures (hollow structures) when cultured in vitro.
CADMEC (microvascular endothelial cells) are purchased from Cell Applications,
Inc. as
proliferating (passage 2) cells and are cultured in Cell Applications' CADMEC
Growth Medium
and used at passage 5. For the in vitro angiogenesis assay, the wells of a 48-
well cell culture plate
are coated with Cell Applications' Attachment Factor Medium (200 ml/well) for
30 min. at 37°C.
CADMEC are seeded onto the coated wells at 7,500 cells/well and cultured
overnight in Growth
Medium. The Growth Medium is then replaced with 300 mg Cell Applications'
Chord Formation
Medium containing control buffer or TGF alpha HIII (0.1 to 100 ng/ml) and the
cells are cultured
for an additional 48 hr. The numbers and lengths of the capillary-like chords
are quantitated
through use of the Boeckeler VIA-170 video image analyzer. All assays are done
in triplicate.
Commercial (R&D) VEGF (50 ng/ml) is used as a positive control. b-esteradiol
(1 ng/ml)
is used as a negative control. The appropriate buffer (without protein) is
also utilized as a control.
The studies described in this example tested activity in TGF alpha HIII
protein.However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
262
Example 42: Angiogenic Effect on
Chick Chorioallantoic Membrane
Chick chorioallantoic membrane (CAM) is a well-established system to examine
angiogenesis. Blood vessel formation on CAM is easily visible and
quantifiable. The ability of
TGF alpha HIII to stimulate angiogenesis in CAM can be examined.
Fertilized eggs of the White Leghorn chick (callus gallus) and the Japanese
qual
(Coturnix coturnix) are incubated at 37.8°C and 80% humidity.
Differentiated CAM of 16-day-
old chick and 13-day-old qual embryos is studied with the following methods.
On Day 4 of development, a window is made into the egg shell of chick eggs.
The
embryos are checked for normal development and the eggs sealed with cellotape.
They are further
incubated until Day 13. Thermanox coverslips (Nunc, Naperville, IL) are cut
into disks of about 5
mm in diameter. Sterile and salt-free growth factors are dissolved in
distilled water and about 3.3
mg/ 5 ml are pipetted on the disks. After air-drying, the inverted disks are
applied on CAM.
After 3 days, the specimens are fixed in 3% glutaraldehyde and 2% formaldehyde
and rinsed in
0.12 M sodium cacodylate buffer. They are photographed with a stereo
microscope [Wild M8]
and embedded for semi- and ultrathin sectioning as described above. Controls
are performed with
carrier disks alone.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 43: Angiogenesis Assay Using
a Matrigel Implant in Mouse
In vivo angiogenesis assay of TGF alpha HIII measures the ability of an
existing capillary
network to form new vessels in an implanted capsule of murine extracellular
matrix material
(Matrigel). The protein is mixed with the liquid Matrigel at 4 degree C and
the mixture is then
injected subcutaneously in mice where it solidifies. After 7 days, the solid
"plug" of Matrigel is
removed and examined for the presence of new blood vessels. Matrigel is
purchased from Becton
Dickinson Labware/Collaborative Biomedical Products.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
263
When thawed at 4 degree C the Matrigel material is a liquid. The Matrigel is
mixed with
TGF alpha HIII at 150 ng/ml at 4 degree C and drawn into cold 3 ml syringes.
Female C57B1/6
mice approximately 8 weeks old are injected with the mixture of Matrigel and
experimental
protein at 2 sites at the midventral aspect of the abdomen (0.5 ml/site).
After 7 days, the mice are
sacrificed by cervical dislocation, the Matrigel plugs are removed and cleaned
(i.e., all clinging
membranes and fibrous tissue is removed). Replicate whole plugs are fixed in
neutral buffered
10% formaldehyde, embedded in paraffin and used to produce sections for
histological
examination after staining with Masson's Trichrome. Cross sections from 3
different regions of
each plug are processed. Selected sections are stained for the presence of
vWF. The positive
control for this assay is bovine basic FGF (150 ng/ml). Matrigel alone is used
to determine basal
levels of angiogenesis.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 44: Rescue of Ischemia in Rabbit
Lower Limb Model
To study the in vivo effects of TGF alpha HIII on ischemia, a rabbit hindlimb
ischemia
model is created by surgical removal of one femoral arteries as described
previously (Takeshita, S.
et al., Am J. Pathol 147:1649-1660 (1995)). The excision of the femoral artery
results in
retrograde propagation of thrombus and occlusion of the external iliac artery.
Consequently,
blood flow to the ischemic limb is dependent upon collateral vessels
originating from the internal
iliac artery (Takeshita, S. et al. Am J. Pathol 147:1649-1660 (1995)). An
interval of 10 days is
allowed for post-operative recovery of rabbits and development of endogenous
collateral vessels.
At 10 day post-operatively (day 0), after performing a baseline angiogram, the
internal i 1 iac artery
of the ischemic limb is transfected with 500 mg naked TGF alpha HIII
expression plasmid by
arterial gene transfer technology using a hydrogel-coated balloon catheter as
described (Riessen,
R. et al. Hum Gene Ther. 4:749-758 (1993); Leclerc, G. et al. J. Clin. Invest.
90: 936-944 (1992)).
When TGF alpha HIII is used in the treatment, a single bolus of 500 mg TGF
alpha HIII protein or
control is delivered into the internal iliac artery of the ischemic limb over
a period of 1 min.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
264
through an infusion catheter. On day 30, various parameters are measured in
these rabbits: (a) BP
ratio - The blood pressure ratio of systolic pressure of the ischemic limb to
that of normal limb;
(b) Blood Flow and Flow Reserve - Resting FL: the blood flow during undilated
condition and
Max FL: the blood flow during fully dilated condition (also an indirect
measure of the blood
vessel amount) and Flow Reserve is reflected by the ratio of max FL: resting
FL; (c)
Angiographic Score - This is measured by the angiogram of collateral vessels.
A score is
determined by the percentage of circles in an overlaying grid that with
crossing opacified arteries
divided by the total number m the rabbit thigh; (d) Capillary density - The
number of collateral
capillaries determined in light microscopic sections taken from hindlimbs.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 45: Effect of TGF alpha HIII on Vasodilation
Since dilation of vascular endothelium is important in reducing blood
pressure, the ability
of TGF alpha HIII to affect the blood pressure in spontaneously hypertensive
rats (SHR) is
examined. Increasing doses (0, 10, 30, 100, 300, and 900 mg/kg) of the TGF
alpha HIII are
administered to 13-14 week old spontaneously hypertensive rats (SHR). Data are
expressed as the
mean +/- SEM. Statistical analysis are performed with a paired t-test and
statistical significance is
defined as p<0.05 vs. the response to buffer alone.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 46: Rat Ischemic Skin Flap Model
The evaluation parameters include skin blood flow, skin temperature, and
factor VIII
immunohistochemistry or endothelial alkaline phosphatase reaction. TGF alpha
HIII expression,
during the skin ischemia, is studied using in situ hybridization.
The study in this model is divided into three parts as follows:
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
265
a) Ischemic skin
b) Ischemic skin wounds
c) Normal wounds
The experimental protocol includes:
a) Raising a 3x4 cm, single pedicle full-thickness random skin flap
(myocutaneous flap
over the lower back of the animal).
b) An excisional wounding (4-6 mm in diameter) in the ischemic skin (skin-
flap).
c) Topical treatment with TGF alpha HIII of the excisional wounds (day 0, l,
2, 3, 4
post-wounding) at the following various dosage ranges: lmg to 100 mg.
d) Harvesting the wound tissues at day 3, 5, 7, 10, 14 and 21 post-wounding
for
histological, immunohistochemical, and in situ studies.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 47: Peripheral Arterial Disease Model
Angiogenic therapy using TGF alpha HIII is a novel therapeutic strategy to
obtain
restoration of blood flow around the ischemia in case of peripheral arterial
diseases. The
experimental protocol includes:
a) One side of the femoral artery is ligated to create ischemic muscle of
the hindlimb, the other side of hindlimb serves as a control.
b) TGF alpha HIII protein, in a dosage range of 20 mg - 500 mg, is delivered
intravenously
and/or intramuscularly 3 times (perhaps more) per week for 2-3 weeks.
c) The ischemic muscle tissue is collected after ligation of the femoral
artery at 1, 2, and 3 weeks for the analysis of TGF alpha HIII expression and
histology. Biopsy is
also performed on the other side of normal muscle of the contralateral
hindlimb.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
266
Example 48: Ischemic Myocardial Disease Model
TGF alpha HIII is evaluated as a potent mitogen capable of stimulating the
development of
collateral vessels, and restructuring new vessels after coronary artery
occlusion. Alteration of
TGF alpha HIII expression is investigated in situ. The experimental protocol
includes:
a) The heart is exposed through a left-side thoracotomy in the rat.
Immediately, the left
coronary artery is occluded with a thin suture (6-0) and the thorax is closed.
b) TGF alpha HIII protein, in a dosage range of 20 mg - 500 mg, is delivered
intravenously
and/or intramuscularly 3 times (perhaps more) per week for 2-4 weeks.
c) Thirty days after the surgery, the heart is removed and cross-sectioned
for morphometric and in situ analyzes.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 49: Rat Corneal Wound Healing Model
This animal model shows the effect of TGF alpha HIII on neovascularization.
The
experimental protocol includes:
a) Making a 1-1.5 mm long incision from the center of cornea into the stromal
layer.
b) Inserting a spatula below the lip of the incision facing the outer corner
of the eye.
c) Making a pocket (its base is 1-1.5 mm form the edge of the eye).
d) Positioning a pellet, containing SOng- Sug of TGF alpha H>ZI, within the
pocket.
e) TGF alpha HIII treatment can also be applied topically to the corneal
wounds in a
dosage range of 20mg - SOOmg (daily treatment for five days).
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HaI polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HI>Z.
3o Example S0: Diabetic Mouse and Glucocorticoid Impaired Wound Healing
Models
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
267
A. Diabetic db+/db+ Mouse Model.
To demonstrate that TGF alpha HIII accelerates the healing process, the
genetically
diabetic mouse model of wound healing is used. The full thickness wound
healing model in the
db+/db+ mouse is a well characterized, clinically relevant and reproducible
model of impaired
wound healing. Healing of the diabetic wound is dependent on formation of
granulation tissue
and re-epithelialization rather than contraction (Gartner, M.H. et al., J.
Surg. Res. 52:389 (1992);
Greenhalgh, D.G. et al., Am. J. Pathol. 136:1235 (1990)).
The diabetic animals have many of the characteristic features observed in Type
II diabetes
mellitus. Homozygous (db+/db+) mice are obese in comparison to their normal
heterozygous
(db+/+m) littermates. Mutant diabetic (db+/db+) mice have a single autosomal
recessive
mutation on chromosome 4 (db+) (Coleman et al. Proc. Natl. Acad. Sci. USA
77:283-293 (1982)).
Animals show polyphagia, polydipsia and polyuria. Mutant diabetic mice
(db+/db+) have
elevated blood glucose, increased or normal insulin levels, and suppressed
cell-mediated
immunity (Mandel et al., J. Immunol. 120:1375 (1978); Debray-Sachs, M. et al.,
Clin. Exp.
Immunol. 51(1):1-7 (1983); Leiter et al., Am. J. of Pathol. 114:46-55 (1985)).
Peripheral
neuropathy, myocardial complications, and microvascular lesions, basement
membrane thickening
and glomerular filtration abnormalities have been described in these animals
(Norido, F. et al.,
Exp. Neurol. 83(2):221-232 (1984); Robertson et al., Diabetes 29(1):60-67
(1980); Giacomelli et
al., Lab Invest. 40(4):460-473 (1979); Coleman, D.L., Diabetes 31 (Suppl):1-6
(1982)). These
homozygous diabetic mice develop hyperglycemia that is resistant to insulin
analogous to human
type II diabetes (Mandel et al., J. Immunol. 120:1375-1377 (1978)).
The characteristics observed in these animals suggests that healing in this
model may be
similar to the healing observed in human diabetes (Greenhalgh, et al., Am. J.
of Pathol. 136:1235-
1246 (1990)).
Genetically diabetic female C57BL/KsJ (db+/db+) mice and their non-diabetic
(db+/+m)
heterozygous littermates are used in this study (Jackson Laboratories). The
animals are purchased
at 6 weeks of age and are 8 weeks old at the beginning of the study. Animals
are individually
housed and received food and water ad libitum. All manipulations are performed
using aseptic
techniques. The experiments are conducted according to the rules and
guidelines of Human
Genome Sciences, Inc. Institutional Animal Care and Use Committee and the
Guidelines for the
Care and Use of Laboratory Animals.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
268
Wounding protocol is performed according to previously reported methods
(Tsuboi, R.
and Riflcin, D.B., J. Exp. Med. 172:245-251 (1990)). Briefly, on the day of
wounding, animals are
anesthetized with an intraperitoneal injection of Avertin (0.01 mg/mL), 2,2,2-
tribromoethanol and
2-methyl-2-butanol dissolved in deionized water. The dorsal region of the
animal is shaved and
S the skin washed with 70% ethanol solution and iodine. The surgical area is
dried with sterile
gauze prior to wounding. An 8 mm full-thickness wound is then created using a
Keyes tissue
punch. Immediately following wounding, the surrounding skin is gently
stretched to eliminate
wound expansion. The wounds are left open for the duration of the experiment.
Application of
the treatment is given topically for 5 consecutive days commencing on the day
of wounding. Prior
to treatment, wounds are gently cleansed with sterile saline and gauze
sponges.
Wounds are visually examined and photographed at a fixed distance at the day
of surgery
and at two day intervals thereafter. Wound closure is determined by daily
measurement on days
1-5 and on day 8. Wounds are measured horizontally and vertically using a
calibrated Jameson
caliper. Wounds are considered healed if granulation tissue is no longer
visible and the wound is
covered by a continuous epithelium.
TGF alpha HIII is administered using at a range different doses of TGF alpha
HIII, from
4mg to SOOmg per wound per day for 8 days in vehicle. Vehicle control groups
received SOmL.of
vehicle solution.
Animals are euthanized on day 8 with an intraperitoneal injection of sodium
pentobarbital
(300mg/kg). The wounds and surrounding skin are then harvested for histology
and
immunohistochemistry. Tissue specimens are placed in 10% neutral buffered
formalin in tissue
cassettes between biopsy sponges for further processing.
Three groups of 10 animals each (5 diabetic and 5 non-diabetic controls) are
evaluated: 1)
Vehicle placebo control, 2) untreated; and 3) treated group.
Wound closure is analyzed by measuring the area in the vertical and horizontal
axis and
obtaining the total square area of the wound. Contraction is then estimated by
establishing the
differences between the initial wound area (day 0) and that of post treatment
(day 8). The wound
area on day 1 is 64mm2, the corresponding size of the dermal punch.
Calculations are made using
the following formula:
[Open area on day 8] - [Open area on day 1 ] / [Open area on day 1 ]
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
269
Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are
sectioned
perpendicular to the wound surface (5mm) and cut using a Reichert-Jung
microtome. Routine
hematoxylin-eosin (H&E) staining is performed on cross-sections of bisected
wounds. Histologic
examination of the wounds are used to assess whether the healing process and
the morphologic
appearance of the repaired skin is altered by treatment with TGF alpha HIII.
This assessment
included verification of the presence of cell accumulation, inflammatory
cells, capillaries,
fibroblasts, re-epithelialization and epidermal maturity (Greenhalgh, D.G. et
al., Am. J. Pathol.
136:1235 (1990)). A calibrated lens micrometer is used by a blinded observer.
Tissue sections are also stained immunohistochemically with a polyclonal
rabbit anti-
human keratin antibody using ABC Elite detection system. Human skin is used as
a positive
tissue control while non-immune IgG is used as a negative control.
Keratinocyte growth is
determined by evaluating the extent of reepithelialization of the wound using
a calibrated lens
micrometer.
Proliferating cell nuclear antigen/cyclin (PCNA) in skin specimens is
demonstrated by
using anti-PCNA antibody (1:50) with an ABC Elite detection system. Human
colon cancer can
serve as a positive tissue control and human brain tissue can be used as a
negative tissue control.
Each specimen includes a section with omission of the primary antibody and
substitution with
non-immune mouse IgG. Ranking of these sections is based on the extent of
proliferation on a
scale of 0-8, the lower side of the scale reflecting slight proliferation to
the higher side reflecting
intense proliferation.
Experimental data are analyzed using an unpaired t test. A p value of c 0.05
is considered
significant.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
270
B. Steroid Impaired Rat Model
The inhibition of wound healing by steroids has been well documented in
various in vitro
and in vivo systems (Wahl, S.M. Glucocorticoids and Wound healing. In: Anti-
Inflammatory
Steroid Action: Basic and Clinical Aspects. 280-302 (1989); Wahl, S.M.et al.,
J. Immunol. 115:
476-481 (1975); Werb, Z. et al., J. Exp. Med. 147:1684-1694 (1978)).
Glucocorticoids retard
wound healing by inhibiting angiogenesis, decreasing vascular permeability (
Ebert, R.H., et al.,
An. Intern. Med. 37:701-705 (1952)), fibroblast proliferation, and collagen
synthesis (Beck, L.S.
et al., Growth Factors. 5: 295-304 (1991); Haynes, B.F. et al., J. Clin.
Invest. 61: 703-797
(1978)) and producing a transient reduction of circulating monocytes (Haynes,
B.F., et al., J. Clin.
Invest. 61: 703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing",
In:
Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press,
New York, pp.
280-302 (1989)). The systemic administration of steroids to impaired wound
healing is a well
establish phenomenon in rats (Beck, L.S. et al., Growth Factors. 5: 295-304
(1991); Haynes,
B.F., et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, S. M.,
"Glucocorticoids and wound
healing", In: Antiinflammatory Steroid Action: Basic and Clinical Aspects,
Academic Press, New
York, pp. 280-302 (1989); Pierce, G.F. et al., Proc. Natl. Acad. Sci. USA 86:
2229-2233 (1989)).
To demonstrate that TGF alpha HIII can accelerate the healing process, the
effects of
multiple topical applications of TGF alpha HIII on full thickness excisional
skin wounds in rats. in
which healing has been impaired by the systemic administration of
methylprednisolone is
assessed.
Young adult male Sprague Dawley rats weighing 250-300 g (Charles River
Laboratories)
are used in this example. The animals are purchased at 8 weeks of age and are
9 weeks old at the
beginning of the study. The healing response of rats is impaired by the
systemic administration of
methylprednisolone (l7mg/kg/rat intramuscularly) at the time of wounding.
Animals are
individually housed and received food and water ad libitum. All manipulations
are performed
using aseptic techniques. This study is conducted according to the rules and
guidelines of Human
Genome Sciences, Inc. Institutional Animal Care and Use Committee and the
Guidelines for the
Care and Use of Laboratory Animals.
The wounding protocol is followed according to section A, above. On the day of
wounding, animals are anesthetized with an intramuscular injection of ketamine
(50 mg/kg) and
xylazine (5 mg/kg). The dorsal region of the animal is shaved and the skin
washed with 70%
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
271
ethanol and iodine solutions. The surgical area is dried with sterile gauze
prior to wounding. An
8 mm full-thickness wound is created using a Keyes tissue punch. The wounds
are left open for
the duration of the experiment. Applications of the testing materials are
given topically once a
day for 7 consecutive days commencing on the day of wounding and subsequent to
methylprednisolone administration. Prior to treatment, wounds are gently
cleansed with sterile
saline and gauze sponges.
Wounds are visually examined and photographed at a fixed distance at the day
of
wounding and at the end of treatment. Wound closure is determined by daily
measurement on
days 1-5 and on day 8. Wounds are measured horizontally and vertically using a
calibrated
Jameson caliper. Wounds are considered healed if granulation tissue is no
longer visible and the
wound is covered by a continuous epithelium.
TGF alpha HIII is administered using at a range different doses of TGF alpha
HIII, from
4mg to SOOmg per wound per day for 8 days in vehicle. Vehicle control groups
received SOmL of
vehicle solution.
Animals are euthanized on day 8 with an intraperitoneal injection of sodium
pentobarbital
(300mg/kg). The wounds and surrounding skin are then harvested for histology.
Tissue
specimens are placed in 10% neutral buffered formalin in tissue cassettes
between biopsy sponges
for further processing.
Four groups of 10 animals each (5 with methylprednisolone and 5 without
glucocorticoid)
are evaluated: 1) Untreated group 2) Vehicle placebo control 3) TGF alpha HIII
treated groups.
Wound closure is analyzed by measuring the area in the vertical and horizontal
axis and
obtaining the total area of the wound. Closure is then estimated by
establishing the differences
between the initial wound area (day 0) and that of post treatment (day 8). The
wound area on day
1 is 64mm2, the corresponding size of the dermal punch. Calculations are made
using the
following formula:
[Open area on day 8] - [Open area on day 1 ] / [Open area on day 1 ]
Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are
sectioned
perpendicular to the wound surface (Smm) and cut using an Olympus microtome.
Routine
hematoxylin-eosin (H&E) staining is performed on cross-sections of bisected
wounds. Histologic
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
272
examination of the wounds allows assessment of whether the healing process and
the morphologic
appearance of the repaired skin is improved by treatment with TGF alpha HIII.
A calibrated lens
micrometer is used by a blinded observer to determine the distance of the
wound gap.
Experimental data are analyzed using an unpaired t test. A p value of < 0.05
is considered
significant.
The studies described in this example tested activity in TGF alpha H1II
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HI>I polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha H>ZI.
l0 Example 51: Lymphadema Animal Model
The purpose of this experimental approach is to create an appropriate and
consistent
lymphedema model for testing the therapeutic effects of TGF alpha HIII in
lymphangiogenesis
and re-establishment of the lymphatic circulatory system in the rat hind limb.
Effectiveness is
measured by swelling volume of the affected limb, quantification of the amount
of lymphatic
vasculature, total blood plasma protein, and histopathology. Acute lymphedema
is observed for
7-10 days. Perhaps more importantly, the chronic progress of the edema is
followed for up to 3-4
weeks.
Prior to beginning surgery, blood sample is drawn for protein concentration
analysis.
Male rats weighing approximately ~350g are dosed with Pentobarbital.
Subsequently, the right
legs are shaved from knee to hip. The shaved area is swabbed with gauze soaked
in 70% EtOH.
Blood is drawn for serum total protein testing. Circumference and volumetric
measurements are
made prior to injecting dye into paws after marking 2 measurement levels (0.5
cm above heel, at
mid-pt of dorsal paw). The intradermal dorsum of both right and left paws are
injected with 0.05
ml of 1% Evan's Blue. Circumference and volumetric measurements are then made
following
injection of dye into paws.
Using the knee joint as a landmark, a mid-leg inguinal incision is made
circumferentially
allowing the femoral vessels to be located. Forceps and hemostats are used to
dissect and separate
the skin flaps. After locating the femoral vessels, the lymphatic vessel that
runs along side and
underneath the vessels) is located. The main lymphatic vessels in this area
are then electrically
coagulated or suture ligated.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
273
Using a microscope, muscles in back of the leg (near the semitendinosis and
adductors)
are bluntly dissected. The popliteal lymph node is then located. The 2
proximal and 2 distal
lymphatic vessels and distal blood supply of the popliteal node are then and
ligated by suturing.
The popliteal lymph node, and any accompanying adipose tissue, is then removed
by cutting
connective tissues.
Care is taken to control any mild bleeding resulting from this procedure.
After lymphatics
are occluded, the skin flaps are sealed by using liquid skin (Vetbond) (AJ
Buck). The separated
skin edges are sealed to the underlying muscle tissue while leaving a gap of
~0.5 cm around the
leg. Skin also may be anchored by suturing to underlying muscle when
necessary.
To avoid infection, animals are housed individually with mesh (no bedding).
Recovering
animals are checked daily through the optimal edematous peak, which typically
occurred by day
5-7. The plateau edematous peak are then observed. To evaluate the intensity
of the
lymphedema, the circumference and volumes of 2 designated places on each paw
before operation
and daily for 7 days are measured. The effect plasma proteins on lymphedema is
determined and
whether protein analysis is a useful testing perimeter is also investigated.
The weights of both
control and edematous limbs are evaluated at 2 places. Analysis is performed
in a blind manner.
Circumference Measurements: Under brief gas anesthetic to prevent limb
movement, a
cloth tape is used to measure limb circumference. Measurements are done at the
ankle bone and
dorsal paw by 2 different people then those 2 readings are averaged. Readings
are taken from
both control and edematous limbs.
Volumetric Measurements: On the day of surgery, animals are anesthetized with
Pentobarbital and are tested prior to surgery. For daily volumetrics animals
are under brief
halothane anesthetic (rapid immobilization and quick recovery), both legs are
shaved and equally
marked using waterproof marker on legs. Legs are first dipped in water, then
dipped into
instrument to each marked level then measured by Buxco edema
software(Chen/Victor). Data is
recorded by one person, while the other is dipping the limb to marked area.
Blood-plasma protein measurements: Blood is drawn, spun, and serum separated
prior
to surgery and then at conclusion for total protein and Ca2+ comparison.
Limb Weight Comparison: After drawing blood, the animal is prepared for tissue
collection. The limbs are amputated using a quillitine, then both experimental
and control legs are
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
274
cut at the ligature and weighed. A second weighing is done as the tibio-
cacaneal joint is
disarticulated and the foot is weighed.
Histological Preparations: The transverse muscle located behind the knee
(popliteal)
area is dissected and arranged in a metal mold, filled with freezeGel, dipped
into cold
methylbutane, placed into labeled sample bags at - 80EC until sectioning. Upon
sectioning, the
muscle is observed under fluorescent microscopy for lymphatics..
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 52: Suppression of TNF alpha-induced adhesion molecule
expression by TGF alpha HIII
The recruitment of lymphocytes to areas of inflammation and angiogenesis
involves
specific receptor-ligand interactions between cell surface adhesion molecules
(CAMS) on
lymphocytes and the vascular endothelium. The adhesion process, in both normal
and
pathological settings, follows a mufti-step cascade that involves
intercellular adhesion molecule-1
(ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), and endothelial
leukocyte adhesion
molecule-1 (E-selectin) expression on endothelial cells (EC). The expression
of these molecules
and others on the vascular endothelium determines the efficiency with which
leukocytes may
adhere to the local vasculature and extravasate into the local tissue during
the development of an
inflammatory response. The local concentration of cytokines and growth factor
participate in the
modulation of the expression of these CAMS.
Tumor necrosis factor alpha (TNF-a), a potent proinflammatory cytokine, is a
stimulator of
all three CAMS on endothelial cells and may be involved in a wide variety of
inflammatory
responses, often resulting in a pathological outcome.
The potential of TGF alpha HIII to mediate a suppression of TNF-a induced CAM
expression can be examined. A modified ELISA assay which uses ECs as a solid
phase absorbent
is employed to measure the amount of CAM expression on TNF-a treated ECs when
co-
stimulated with a member of the FGF family of proteins.
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
275
To perform the experiment, human umbilical vein endothelial cell (HUVEC)
cultures are
obtained from pooled cord harvests and maintained in growth medium (EGM-2;
Clonetics, San
Diego, CA) supplemented with 10% FCS and 1% penicillin/streptomycin in a 37
degree C
humidified incubator containing 5% C02. HUVECs are seeded in 96-well plates at
concentrations of 1 x 104 cells/well in EGM medium at 37 degree C for 18-24
hrs or until
confluent. The monolayers are subsequently washed 3 times with a serum-free
solution of RPMI-
1640 supplemented with 100 U/ml penicillin and 100 mg/ml streptomycin, and
treated with a
given cytokine and/or growth factors) for 24 h at 37 degree C. Following
incubation, the cells are
then evaluated for CAM expression.
Human Umbilical Vein Endothelial cells (HUVECs) are grown in a standard 96
well plate
to confluence. Growth medium is removed from the cells and replaced with 90 u1
of 199 Medium
(10% FBS). Samples for testing and positive or negative controls are added to
the plate in
triplicate (in 10 u1 volumes). Plates are incubated at 37 degree C for either
5 h (selectin and
integrin expression) or 24 h (integrin expression only). Plates are aspirated
to remove medium
and 100 ~1 of 0.1% paraformaldehyde-PBS(with Ca++ and Mg++) is added to each
well. Plates
are held at 4°C for 30 min.
Fixative is then removed from the wells and wells are washed FX with
PBS(+Ca,Mg)+0.5% BSA and drained. Do not allow the wells to dry. Add 10 p1 of
diluted
primary antibody to the test and control wells. Anti-ICAM-1-Biotin, Anti-VCAM-
1-Biotin and
Anti-E-selectin-Biotin are used at a concentration of 10 pg/ml (1:10 dilution
of 0.1 mg/ml stock
antibody). Cells are incubated at 37°C for 30 min. in a humidified
environment. Wells are
washed X3 with PBS(+Ca,Mg)+0.5% BSA.
Then add 20 ~1 of diluted ExtrAvidin-Alkaline Phosphotase (1:5,000 dilution)
to each well
and incubated at 37°C for 30 min. Wells are washed X3 with
PBS(+Ca,Mg)+0.5% BSA. 1 tablet
of p-Nitrophenol Phosphate pNPP is dissolved in 5 ml of glycine buffer (pH
10.4). 100 p1 of
pNPP substrate in glycine buffer is added to each test well. Standard wells in
triplicate are
prepared from the working dilution of the ExtrAvidin-Alkaline Phosphotase in
glycine buffer:
1:5,000 (10°) > 10-°'S > 10-~ > 10-l5. 5 ~1 of each dilution is
added to triplicate wells and the
resulting AP content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. 100
~l of pNNP reagent
must then be added to each of the standard wells. The plate must be incubated
at 37°C for 4h. A
volume of 50 p1 of 3M NaOH is added to all wells. The results are quantified
on a plate reader at
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
276
405 nm. The background subtraction option is used on blank wells filled with
glycine buffer only.
The template is set up to indicate the concentration of AP-conjugate in each
standard well [ 5.50
ng; 1.74 ng; 0.55 ng; 0.18 ng~. Results are indicated as amount of bound AP-
conjugate in each
sample.
The studies described in this example tested activity in TGF alpha HIII
protein. However,
one skilled in the art could easily modify the exemplified studies to test the
activity of TGF alpha
HIII polynucleotides (e.g., gene therapy), agonists, and/or antagonists of TGF
alpha HIII.
Example 53: Human Dermal Fibroblast and Aortic Smooth Muscle Cell
Proliferation
Supernatants from transiently transfected cells containing TGF alpha HITI were
added
to cultures of normal human dermal fibroblasts (NHDF) and human aortic smooth
muscle
cells (AoSMC). Two co-assays were performed with each supernatant. . The first
assay
examined the effect of supernatants on the proliferation of normal human
dermal fibroblasts
(NHDF) or aortic smooth muscle cells (AoSMC).
Aberrant growth of fibroblasts or smooth muscle cells is a part of several
pathological
processes, including fibrosis, and restenosis. The second assay examines IL6
production by
both NHDF and SMC. IL6 production is an indication of functional activation.
Activated
cells will have increased production of a number of cytokines and other
factors, which can
result in a proinflammatory or immunomodulatory outcome. Assays are run with
and without
co-TNFa stimulation, in order to check for costimulatory or inhibitory
activity.
Assay
On day l, set up 96-well black plates with 1000 cells/well (NHDF) or 2000
cells/well
(AoSMC) in 100u1 culture media. NHDF culture media contains: Clonetics FB
basal media,
lmg/ml hFGF, 5mg/ml insulin, 50mg/ml gentamycin, 2%FBS, while AoSMC culture
media
contains Clonetics SM basal media, 0.5ug/ml hEGF, 5mg/ml insulin, lug/ml hFGF,
50mg/ml
gentamycin, 50 ug/ml Amphotericin B, 5%FBS. Incubate @ 37C for at least 4-5
hours and
then aspirate culture media and replace with growth arrest media. Growth
arrest media for
NHDF contains fibroblast basal media, 50mg/ml gentamycin, 2% FBS, while growth
arrest
CA 02390839 2002-05-08
WO 01/40251 PCT/US00/32745
277
media for AoSMC contains SM basal media, SOmg/ml gentamycin, SOug/ml
Amphotericin B,
0.4% FBS. Incubate at 37C until day 2.
On day 2, design serial dilutions and templates of supernatants always
including
media controls and known-protein controls. For both stimulation and inhibition
experiments,
proteins are diluted in growth arrest media. For inhibition experiments, TNFa
is added to a
final concentration of 2ng/ml (NHDF) or Sng/ml (AoSMC). Then add 1/3 vol media
containing controls or supernatents and Incubate at 37C/5%C02 until day 5.
Transfer 60u1 from each well to another labeled 96-well plate, cover with a
plate-
sealer, and store at 4C until Day 6 (for IL6 ELISA). To the remaining 100u1 in
the cell
culture plate, aseptically add Alamar Blue in an amount equal to 10% of the
culture volume
(10u1). Return plates to incubator for 3 to 4 hours. Then measure fluorescence
with
excitation at 530nm and emission at 590nm using the CytoFluor. This yields the
growth
stimulation/inhibition data.
On day 5, the IL6 ELISA is performed by coating a 96 well plate with 50-100
ul/well
of Anti-Human IL6 Monoclonal antibody diluted in PBS, pH 7.4, incubate ON at
room
temperature.
On day 6, empty the plates into the sink and blot on paper towels. Prepare
Assay
Buffer containing PBS with 4% BSA. Block the plates with 200u1/well of Pierce
Super
Block blocking buffer in PBS for 1-2 hr and then wash plates with wash buffer
(PBS, 0.05%
Tween-20). Blot plates on paper towels. Then add SO ul/well of diluted Anti-
Human IL-6
Monoclonal, Biotin-labeled antibody at 0.50 mg/ml. Make dilutions of IL-6
stock in media
(30, 10, 3, 1, 0.3, 0 ng/ml). Add duplicate samples to top row of plate. Cover
the plates and
incubate for 2 hours at RT on shaker.
Wash plates with wash buffer and blot on paper towels. Dilute EU-labeled
Streptavidin 1:1000 in Assay buffer, and add 100 ul/well. Cover the plate and
incubate 1 h at
RT. Wash plates with wash buffer. Blot on paper towels.
Add 100 ul/well of Enhancement Solution. Shake for 5 minutes. Read the plate
on
the Wallac DELFIA Fluorometer. Readings from triplicate samples in each assay
were
tabulated and averaged.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
CONTENANT LES PAGES 1 A 277
NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 277
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
