Note: Descriptions are shown in the official language in which they were submitted.
CA 02390972 2002-06-19
FIELD OF THE INVENTION,
The present invention relates generally o the field of apoptosis. More
particularly, it
relates to protein, such as the BVDV p80 protein; that induces apoptosis.
BACKGROUND OF THE INVENTION
Bovine viral diarrhea virus (BVDU) is an economically important and world-wide
distributed pathogen in cattle (lVloennig and Plagemann; 1992; Thiel et al.,
1996). BVDV,
together with classical swine fever virus (CSFV) and border disease virus
(BDV), belongs to the
genus Pestivi~us of the Flaviviridae family that also includes human hepatitis
C virus (Thiel et
al., 1996). The pestiviral genome is a positive, single-stranded RNA molecule
of usually 12.3 kb
in length that encodes one polyprotein of about 4,000 amino acids, which is co-
and post-
translationally processed by cell- and virus-derived proteases to give rise to
the mature viral
proteins (Rice; 1996; Meyers and Thiel, 1996). 'The order of cleavage products
in the pestivirus
polyprotein is as follows: NH2-Np'°-C-EmS-E1-E2-p7-NS2-NS3-NS4A-NS4B-
NSSA-NSSB-
COOH: The pestivirus structural proteins are composed of the basic
nucleocapsid C protein and
of the Ems, El, and E2 envelope glycoproteinsNpr° protein exerts an
autoproteinase activity
whereas the remaining proteins are likely to be enzymatic or structural
proteins of the viral RNA
replication complex. Finally, pestivirus NS3 usually possesses RNA binding,
RNA-stimulated
nucleoside triphosphatase, RNA helicase, and; proteinase activities
(Wiskerchen and Collett,
1991; Tamura et al., 1993; Warrener et al.; 1995), whereas NSSB contains the
conserved GDD
motif characteristic of RNA-dependent RNA polymerases (Meyers and Thiel;
1996).
BVDV strains are divided into two major genetic groups. Group I contains the
classical
BVDV strains (for instance, NADL, Oregon and Singer strains); whereas group II
includes
thrombocytopenic and highly virulent strains (for instance, 890 and 24515
isolates) (Pellerin et
al., 1994, Ridpath et al., 1994; Archambault et al., 2000). Based on 5'
untranslated (UTR)
sequences; classical BVDVs could be further divided into two subgroups (la and
1b) (Pellerin et
al., 1994, Ridpath et al., 1994; Hammers et al., 2001). BVDV strains also
exist as two biotypes,
cytopathogenic {cp) and noncytopathogenic (ncp), according to their effects on
tissue culture
cells (Kummerer et al., 2000): This latter 'observation is parralleled with
the fact that only the cp
biotypes of BVDV express the protein p80 {NS3) protein that is not identified
from cells infected
with ncp strains (Mendez et al., 1998 ; Kummerer et al:, 2000): The ncp
strains, as for the cp
strains, express a 125 kDa polypeptide (p 125) 'which is the precursor of the
p80 in cp strains
(Kummerer et al., 2000). Therefore, expression of the protein p80 is a marker
to distinguish cp
and ncp BVDV strains.
BVDV often causes subclinical infections or only mild symptoms in cattle
(Baker, 1987 ;
Thiel et al.; 1996): However, fetal infection in the early stage of
intrauterine development may
result in immunotolerant BVDV persistently-infected animals which will
propagate BVDV
infection within the herd (Moennig and Plagernann, 1992 ; Thiel et al., 1996).
Such BVDV
persistently-infected animals will develop a, severe fatal syndrome; called
mucosal disease {MD);
generally within the first 18 to 24 months of life (Baker; 1987; Thiel et al:,
1996). Both ncp and
CA 02390972 2002-06-19
cp BVDV, the so-called antigenically-related virus pairs, can be isolated from
such animals
(McClurkin et a1.,1985 ; Thiel et a1:,1996): The cp BVDV detected in animals
with MD may be
due to superinfection or may result from ,genomic rearrangements (e.g.
insertion of cellular
sequences, rearrangement in the viral genorne) or mutations within the genome
of the ncp virus
(see Kummerer et al., 2000): In all cases-analysed so far, the genomic changes
leading to the cp
biotype correlated with the production of the non-structural protein p80
described above
(Kummerer et al., 2000). One may therefore hypothesize that expression of p80
is a determinant
factor for the cytopathogenicity of these viruses.
Apoptosis (the so-called progiarnmed cell death process) and necrosis are
mechanisms by
which eukaryotic cells die (Duvall and Wyllie, 1986). Necrosis results from a
pathological
reaction in response to perturbations in the cell environment, whereas
apoptosis is an innate
mechanism by which the host eliminates unvuanted cells with no inflammation
response. In that
regard, apoptosis is considered the physiological form of cell death which
occurs during
embryonic development, tissue remodeling and tumor regression (Schulze-Osthoff
et al., 1998).
Several marnrnalian DNA and RNA viruses have been associated with cell
apoptosis (Teodoro
and Branton, 1997; O'Brien, 1998)). viruses possess various biochemical and
genetic
mechanisms to evade and7or induce apoptosis in infected cells through
interactions at different
stages of the apoptotic pathway. Thus, in the early phases of infection; it
would be advantageous
for the virus to inhibit host cell death to ensure optimal genomic
replication, whereas at late
stages of infection, it would be beneficial for the virus to induce apoptosis
for maximal
production of new virions.
In BVDV, cells infected with the cp biotype has been shown to undergo
apoptosis (Zhang et
al., 1996). This apoptosis process was associated' with cleavage of poly(ADP-
ribose) polymerase
(PARP) (Hoff and Donis, 1997) and was prevented by certain antioxidants
(Schweizer and
Peterhans; 1999). However; the viral determinants involved in cp BVDV-
associated apoptosis in
the course of cell infection in vitro have never been directly determined. In
this report, we clearly
demonstrate for the first time that the protein p80 (and p80~50, see below) of
BVDV expressed
from an adenovirus promoter-inducible expression system is enable to induce
programmed cell
death (apoptosis) in vitro, as determined by cell DNA fragmentation assays and
cleavage of the
PARP death substrate, an indicator of caspase activation. In addition, BVDV
p80 (p80~50)-
associated cell apoptosis was inhibited by baculovirus p35 protein. Finally;
experiments
conducted with a recombinant adenovirus (rec-Adenovirus) expressing a deletion
mutated form
of the p8U protein (p80~50) have shown that the NH2-terminal filthy amino
acids of the protein
are not involved in BVDV p80-induced apoptosis. Thus, the BVDV p80050 is also
a potent
inducer of cell' apoptosis in vitro.
SUMMARY OF THE INVENTION
An object of the invention is to provide an isolated and purified protein
capable of inducing
apoptosis and its use in the treatment or prevention of cancer diseases andlor
immunological or
any other physiological disorders.
CA 02390972 2002-06-19
4
According to an aspect of the invention; the protein is the BVDV p80 protein
or functional
fragments thereof.
DESCRIPTION OF THE INVENTION
Materials And Methods
Cells and viruses
The cells used in this study were free of mycoplasmas, and fetal bovine serum
was exempt
of BVDV antigen and BVDV-specific antibodies. BVDV-free MDBK cells (a gift
from Susy
Carman, Animal Diagnostic Laboratory, Guelphs Ontario) were maintained in
Dulbecco minimal
essential medium (DMEM) with high glucose concentration supplemented with 2 mM
L-
glutamine, 0.2% (w/v) lactalbumin HCI, 10% fetal bovine serum (FBS) (GibcoBRL,
Gaithersburg, ' MD) and antibiotics. For cell infection, confluent 2-day old
cultures were
inoculated with type 1 cp NADL reference strain of BVDy (ATCC # VR-534) and
were further
incubated with 2% FBS in DMEM until 50 to 70% of the cells exhibited a
cytopathic effect.
After one cycle of cell freezing and thawing, the cell culture supernatant was
collected by
centrifugation: The viral titers were determined and calculated as the median
tissue culture
infective dose (TCIDSO) per ml (St-Laurent et al:; 1994).
BMAdEl 220-8, 293A, and 293rtTA (Jani et al., 1997; Massie et al., 1998a, b)
were
propagated in antibiotic-free DMEM supplemented with 10% tetracycline-free FBS
{Clontech
Laboratories Inc., Palo Alto, CA). 293rtTA cells were used to generate
recombinant
adenoviruses (rec-Adenovirus) expressing the protein of interest and to
titrate the adenovirus
stocks by measuring green fluorescent protein (GFP) signal by cytofluorometry,
whereas
BMAdEl 220-8 or 293A cells were used for virus amplification to generate
adenovirus stocks
(Jani et al., 1997). A549 cells (derived from human lung carcinoma tissues)
which were
genitically transformed to express the tetracycline transactivation factor
(tTA) (A549tTA)
(Massie et al:; 1998a, b) were used in the cell 'apoptosis experiments-
conducted with the rec-
Adenoviruses.
Viral RNA isolation and oligonucleotide primers
Viral genomic RNA was extracted using the guanidium isothiocyanate method from
the
supernatant of infected MDBK cells as described (Abed et al., 1999): The
oligonucleotide
primers for reverse transcription-PCR (RT-PCR) amplification of nucleic acid
sequences that
encode BVDV p80 protein (nucleotides 5423 to 7471 of the viral genome; amino
acids 1 to 683
of the p80) and truncated forms of p80 e:g. the p80~26 protein (nucleotides
SSOl to 7471 of the
viral genome, ;amino acids 27 to 683 of-the p80) and the p80050 protein
(nucleotides 5573 to
7471 of the viral genome; amino acids 51 to 6'83 of the p80) were selected
according to the
BVDV NADL strain genomic sequence (Genbank Database accession number M31182),
and to
the predicted NH2- and COOH-termini of the protein (Xu et al:, 1997). Primers
(listed in Table
1 ) contained short 5' extensions in which restriction endonuclease cleavage
sites; initation or
termination codons and/or histidine codons' were present for
cloning/subcloning and expression
purposes.
CA 02390972 2002-06-19
Reverse transcription-PCR amplification, cloning, and sequencing
The BVDV genomic RNA was converted to complementary DNA (cDNA) by reverse
transcription using random hexadeoxyribonucleotides (pd(N)6 ; Pharmacia
Biotech Inc.,
Uppsala, Sweden) as previously described (St-Laurent et al., 1994). The cDNA
was then
amplified by ;using the appropriate primer pair with a programmable thermal
cycler by 35
successive cycles of denaturation at 95 °C for 1.30 min; primer
annealing at 48 °C for 1.30 min,
and DNA chain extension at 72 °C for 2.30 min: The amplified cDNA
products were
subsequently cloned into the pbluescript/KS+ (pBS) vector according to the
manufacturer's
instructions (Stratagene; La Jolla; CA) to generate the plasmid constructs
pBS/pEt (p80),
pBS/pEt (p80026); pBS/pEt (p80050), pBS/Ad (p80), and pBS/Ad (p80~50) (Table
1). All
constructs were sequenced by the chain termination method of Sanger et al. (
1977} to confirm
the BVDV-specific nature of the amplified product:
Expression of BVDV p80 in Escherichia coli (E. coh~ and production of BVDV p80-
specific
antiserum
The cDNA sequences encoding BVDV p80, p80026, and p80~50 were excised from the
pBS/pEt (p80), pBS/pEt (p80426), and pBS/pEt (p80050) plasmid constructs with
the
appropriate restriction enzymes, purified by using a low-melting-temperature
agarose gel, and
ligated into the procaryotic expression vector pEt-21b (Novagen; Madison; WI).
This procedure
allowed the BVDV p80-; p80026, or p80~50-encoding sequences to be in frame
with a six
histidine-tag at the NH2-terminal; generating pEt-21b-p80, pEt-21b-p80026; and
pEt-21b-
p80050 which then could putatively express 'recombinant rHis-p80, rHis-p80a26,
or rHis=
p80050 fusion proteins. The recombinant plasmids were sequenced as above to
confirm that the
junction sequence was in the correct reading frame.
Protein expression in E. coli strain DHSa was performed as previously
described (St-
Laurent and Archambault; 2000): The resulting -soluble (bacterial crude
extracts) and insoluble
(inclusion bodies) fractions were analysed by 12 % sodium dodecyl sulfate-
polyacrylamide gel
electrophoresis (SDS-PAGE) (Kheyar et al., 1997). Recombinant fusion proteins
that were
mostly present in the insoluble fraction (inclusion bodies) were purified by
electroelution
(Microeluter, BioRad, Hercules, CA) of the proteins that were cut out of a 8%
SDS-PAGE
(Kheyar et al.; 1997). The purity and concentration of the, purified
recombinant proteins were
assessed by Coomassie-blue stained-SDS-PAGE. BVDV p80-specific polyclonal
antibodies
were raised by immunizing a New Zealand white rabbit with rHis-p80~50 fusion
protein,
according to a standard protocol (Harlow and Lane, 1988). Antiserum was then
tested by
Western immunoblotting to confirm the presence of specific antibodies to the
immunizing
protein (Kheyar et al., 1997): This antiserum was used in further experiments
(see above) to
assess BVDV p80 or p80~50 expression in mammalian cells:
Construction of recombinant adenoviruses (rec-Adenovirus) and cell infection
The procedures used were carried out essentially as described (Jani et al. ,
1997). To
construct the rec-Adenoviruses, the cDNA p80 and p80050-encoding sequences
were excised
from plasmids pBS/Ad (p80); and pBS/Ad (p80050); respectively, with
restriction enzyme Pmel
(blunt ends), purified; and cloned in the adenovirus transfer vector AdTRS-DC-
GFPq digested
with EcoRT~ (blunt ends). This transfer vector enables the gene of interest to
be expressed from a
tetracycline-inducible promoter in a di-cistronic means coexpressing the green
fluorescent
CA 02390972 2002-06-19
protein (GFP) and the BVDV protein of interest: Thereafter, 293A cells were co-
transfected with
FseI-restricted transfer vector, and the-CIaI-restricted Ad5/~El~E3 viral DNA
to generate
recombinant viruses by in vivo homologous recombination between overlapping
sequences of
linearized transfer vectors pADTRSf DC-GFPq, and AdS/DElDE2 genomic DNA
(Massie et al.,
1998a, b). Recombinant adenovirus-containing plaques were screened 10 to 15
days after cell
transfection by monitoring basal GFP expression by fluorescence microscopy.
Recombinant
adenoviruses were then purified by three further rounds of plaque isolation,
and expanded in 293
cells as described. (Jani et al., 1997 Massie et al., 1998b). Titers of the
recombinant adenovirus
stocks were determined by a method based on the measurement of the GFP signal
by
cytofluorometry (Massie et al., 1998a). By this means, rec-Adenovirus stocks
with transformed
viral titers ranging from 3.2 x 101° to 2:2 x 1011 plaque forming units
(PFU) per ml were
obtained:
In order to determine the apoptotic capability of BVDV p80 or p80050, one-day
old (sub-
confluent) old A549tTA cells were infected with each of the rec-Adenovirus
expressing the
respective BVDV protein at multiplicity of infection (MOI) value of 500
PFU/cell (as
determined in preliminary experiments where a range of virus titers of 125 to
1,000 PFU/cell was
tested). A recombinant adenovirus only expressing GFP (rec-Adenovirus-GFP)
with the same
genetic background as the rec-Adenoviruses expressing the BVDV proteins was
used as a
negative control; whereas cells treated with actinomycin D (50 ~g/ml) was used
as a positive
control of apoptosis (Archambault and St-Laurent, 2000). Briefly; cells wee
seeded at densities
of 3 X 106 cells per 75 cm2 flask (for cell DNA fragmentation assay on agarose
gel, p80 and
p80~50 expression by Western blot; and PARP cleavage detection), 2 X 105 cells
per well in
six-well plates (for flow cytometry analyses), and 3 X 104 cell per well in
eight-well Labtek-
chambers (Nalge Nunc International, Naperville,, IL) (for TUNEL DNA
fragmentation assay and
fluoresence microscopy analyses) in DMEM supplemented with 10% FBS. Cells were
then
washed with PBSS, pH 7:3, mock-infected, treated with actinomycin D; or
inoculated with each
of the recombinant virus to 12 ml (75 cm2 flasks), 2 ml (each well of six-well
plates) or 300 p1
(each well of eight-well Labtek chamber wells) of DMEM with 5% FBS for 4 h at
37 °C under
slow agitation using a rocker platform. Cells -were further incubated without
agitation and
analysed for cell apoptosis indicators (see below) or BVDV gene expression at
different period
times pi.
Expression of BVDV p80 and p80050 in mammalian cells by Western
irnmunoblotting and'
fluorescence microscopy
For the Western immunoblotting procedure; cells were washed in phosphate-
buffered saline
solution (PBS's), pH 7.3, and lysed in standard SDS-PAGE sample buffer:
Proteins were
fractionated by 15% SDS-PAGE and - electrotransferred onto nitrocellulose
membranes.
Immunoblotting was performed by using; as the blocking reagent solution, 5%
nonfat dried milk
solids and 0.05% Tween 20 in PBSS. The blot was then incubated with rabbit
preimmune and
anti-BVDV p80~50 antiserum (used at a dilution of 1:500) for 2 h at room
temperature: The
membranes were then washed three times in PBSS before adding a peroxidase-
conjugated goat
anti-rabbit imrnunoglobulin G (whole molecule) for 1 h at room temperature.
The imrnunological
reactivity was revealed after adding the peroxidase substrate (PBSS; ph 7:3,
H202, methanol and
4-chloro-naphthol) for 20 min (Abed et al:; 1999).
CA 02390972 2002-06-19
For fluorescence microscopy; cells were examined with a confocal fluorescence
microscope
(Model MRC-1024, Biorad). Briefly, cells grown on glass coverslips - (eight-
well Labtek
chamber) were fixed in 4% paraformaldehyde in PBSS~ pH 7:3, for l h at room
temperature and
permeabilised with 0.1 % Triton X-100 in 0.1 % sodium citrate for 10 min.
Cells were then
exposed to rabbit anti-BVDV p80~50 antiserum (1:100, 1 h at 37 °C in a
humidified chamber)
in PBSS containing 3% (wfv) bovine serum albumin. Cells were washed three
times in PBSS
before adding for l h a Cy3-conjugated goat anti-rabbit immunoglobulin G
(whole molecule)
(Sigma Chemical Company, St-Louis, MO) used at a l :500 dilution. Cy3-
conjugated antibody
was excited with a Green HeNe 543 nm laser beam, and fluorescence emission was
collected at
575 nm. GFP was excited with an argon laser at 488 nm, and fluorescence
emission was
collected at 515 nm. Sequential collection was performed for each sample to
avoid overlapping
fluorescence.
DNA fragmentation
The fragmentation of cellular DNA was analysed by visualizing oligonucleosomal-
sized
DNA fragments (DNA ladder formation) essentially as described (Archambault and
St-Laurent,
2000). In situ DNA fragmentation from cells that were grown in coverslips (8-
well Labtek
chamber) was assessed using, a colorimetric Tdt-mediated dUTP nick end
labeling (TUNEL)
commercial kit (In situ Cell Death Detection, POD; Roche Diagnostics,
Mannheim, Germany);
according to the supplier's instructions.
Detection of poly(ADP-ribose) polymerase (PARP) cleavage
Adherent cells collected at various timepoints following treatment
(actinomycin D or
infection with each rec-Adenovirus} were washed with PBSS; pooled with
detached cells, lysed
in standard SDS-PAGE Sample buffer containing 6 M urea, and sonicated for 15
sec on ice. Cell
proteins were fractionated by 8% SDS-PAGE and electrotransferred onto
nitrocellulose
membranes. Immunoblotting was' performed as 'above by using, as primary
antibody, a PARP
monoclonal antibody (C-2-10; BioVision Inc., Mountain View; CA), and, as
secondary antibody,
a peroxidase-conjugated goat anti-mouse immunoglobulin G (H + L chains). The
membranes
were developed by enhanced chemiluminescence, (ECL; PerkinElmer; Boston; MA).
Cytometry analysis
Single cell suspensions {including adherent and nonadherent cells) were
prepared at various
timepoints following rec-Adenovirus infection by trypsinization, centrifugated
and resuspended
in 200 ~,1 of a solution containing 25 ~gfml propidium iodide (PI), 0.06%
saponin, 2.5 Ufml
RNAse A, and 20 ~,M (EDTA) for 20 min before cytometry analysis using a
fluorescence-
activated cell ,sorter (FACScan; Becton Dickinson; Mississauga, Ontario). Cell
debris were
excluded from the analyses by the conventional scatter gating method. The
cells or the nuclei
doublets were also excluded in analyses by using the pulse processor boards.
Ten thousand
events per sample were analysed by using the Cell Quest software system
(Becton Dickinson).
Cell cycle analysis in relation with BVDV p80 or BVDV p80050-induced apoptosis
In order to determine at which phase of the cell cycle the apoptotic process
occurs, A549tTA
cells-were seeded as above, mock-infected or infected with each of the BVDV
rec-Adenovirus
expressing either p80 or p80~80; and the apoptotic cells analysed (based on a
procedure
CA 02390972 2002-06-19
described by Gorczyca et al., 1993) at various timepoints pi by flow cytometry
for TLJNEL using
a fluochrome (for instance, Texas Red-conjugated dUTP)-conjugated dUTP.
Alternatively,
mimosine or cyclosporine A (CsA) were used to block cells from entry into the
S phase of the
cell cycle (Terada et al., 1991 ). To do this, mock or virus-infected
confluent or sub-confluent
A540tTA cells were concomittently incubated with medium containing 200 ~M
mimosine or 1
pg/ml CsA (Hanon et al., 1997), and analysed for apoptotic parameters as above
(DNA ladder
formation, in situ TLTNEL, PARP cleavage and/or cytometry analysis) at various
timepoints pi.
RESULTS
Expression of BVDV p80 in E. coli
BVDV sequence encoding full-length p80 protein was successfully inserted into
the pEt-21b
where the tac promoter could be adequately controlled by isopropyl-(3-D-
thiogalacto-pyranoside
(IPTG): When bacterial cells were induced with IPTG for 3 hours, no p80
expression was
detected from a SDS-polyacrylamide gel stained with Coomassie brilliant blue
(Fig. l, lane 3).
IPTG induction of bacterial cells for longer time periods and/or using
different temperatures and
conditions of expression did not result in significant BVDV p80 expression
(data not shown).
These latter results prompted us to generate truncated forms of the BVDV p80
in which the
NH2-terminal 26 or 50 amino acids of BVDV p80 were deleted: As shown in Fig.
l, this strategy
allowed us to produce BVDV p80~26 (lane 5) and BVDV p80~50 (lane 7) fusion
proteins,
respectively, in E. coli strain DHSa after 3 hours of'IPTG induction. More
intense protein bands
were obtained 'when the bacterial cells were incubated for a longer incubation
time period of 6 to
12 hours (data not shown). However, the best protein expression levels were
consistenly
obtained with the plasmid construct containing the BVDV p80050-encoding
sequence. The
expressed BVDV p80050 fusion protein which was found mostly in cytoplasmic
inclusion
bodies, was electroeluted from a polyacrylamide gel o obtain relatively
purified fusion protein
preparation (Fig. 1, lane 8): The purified fusion protein was then used to
immunize a laboratory
rabbit; and the antiserum obtained was confirmed to contain protein-specific
antibodies by using
a Western blot assay (not shown). Thus; this BVDV p80~50-specific antiserum
was used in
subsequent experiments to monitor p80 or p80~50 expression in mammalian cells.
Cytopathogenicity correlates with BVDV p80 and p80050 expressed from rec-
Adenovirus
Following infection of A549tTA cells with each of the BVDV protein-expressing
rec-
Adenovirus and the control rec-Adenovirus-GFP, GFP signal was gererally
observed under
fluorescence microscopy from 6 hours post infection (pi) to reach maximum GFP
fluorescence
signal in infected cells (approximately 40 to 50% of cells) at 12 to 18 hours
pi (data not shown).
Along with the expression of GFP signal; the cells infected with each rec-
Adenovirus carrying
the BVDV sequences bowed the first evidence- of morphological changes (cell
rounding and
shrinking in size and cell detachment in cell culture supernatant) at l8 (for
the p80 truncated
form) to 24 hours (for the whole p80) pi to reach maximal cythopathogenic
effect {CPE) (e.g.
morphological 'changes occurring in 30 to 40% of infected cells) with cell
detachment from he
substrate at 36 to 40 hours (for the p80 truncated form), or 48 to 60 hours
(for the whole p80) pi.
Microscopic observations at 40 (p80d50) or 48 (p80) hours pi showed that most
of the shrinking
cells carried the characteristic apoptosis nucleus chromatin condensation with
reduction in cell
volume (Fig. 2B and 2C for the BVDV p80- and p80~50-expressing rec-Adenovirus,
CA 02390972 2002-06-19
respectively). No significant CPE was observed in mock-infected cells (not
shown) and in cells
infected with the rec-Adenovirus-GFP used as negative control (Fig. 2A)
throughout the
incubation period. In contrast, CPE was readily observed in cells,treated with
actinomycin D or
the recombinant Ad5TR5~Rl (Massie et al., 1998b) which were used as positive
controls of
apoptosis (data not shown).
Along with the appearance of CPE; we analysed whether the infected cells were
indeed
expressing the relevant BVDV proteins: As shown in Fig. 3A, both BVDV p80 and
p80050
proteins, as determined by Western immunoblotting, were expressed from cells
infected for 48 or
40 hours with each of the respective rec-Adenovirus (lanes 4 and 5,
respectively). No immune
reactivity was obtained with the rabbit pre-immune serum' (not shown).
Expression of BVDV
p80~50 protein, as determined by confocal fluorescence microscopy at 40 hours
pi; was
observed in cells which concomitantly expressed GFP (Fig. 3B; panel d},
demonstrating herein
the effectiveness of the di-cistronic adenovirus expression system used in
this study.
Tnterestingly, the GFP appeared to be localized mostly in the nucleus of the
infected cell (Fig.
3B; panel d). 'On the basis of the results it was concluded that expression of
BVDV p80 or
p80050 from each rec-Adenovirus correlated with CPE in infected cells.
BVDV p80 and p80050-expressing rec-Adenovirus infections correlate with cell
DNA
fragmentation
As the oligonucleosomal DNA ladder of multiples of 180-200 base pairs in
apopptic cells is
considered a hallmark of the programmed cell death process, we carried out DNA
fragmentation
assays from rec-Adenovirus-infected A549tTA cells. Fig. 4 shows typical DNA
fragmentation in
cells infected with each of the rec-Adenovirus expressing either BVDV p80 or
p80~50 (lanes 4
and 5, respectively). DNA fragmentation was observed in cells treated with
actinomycin D (lane
3) or in MDBK cells infected with the NADL strain of BVDV (lane 7) which was
used as an
additional positive control of apoptosis. In contrast; no DNA fragmentation
was observed in the
mock-infected' and rec-Adenovirus-GFP-infected negative control cell cultures
(lanes 1 and 2,
respectively). To confirm; by an independent means, the cell DNA
fragmentation, a colorimetric
TLTNEL assay was performed to detect in situ' DNA fragmentation. Labelling of
cell nuclei
typical of DNA fragmentation was readily detected in cells infected with rec-
Adenovirus
expressing either BVDV p80 (48 hours pi) or p80050 (40 hours pi) (Fig: 2B and
C;
respectiuely). 'In contrast, no DNA labeling was detected in cells infected
with the rec-
Adenovirus-GFP negative control (Fig. 2A), nor in mock-infected cells (data
not shown). Since
similar results were obtained with BVDV p80 and p80~50, further experiments
were mostly
conducted with the BVDV p80~50-expressing rec-Adenovirus:
Flow cytometry quantitation of apoptotic cells over time
Morphologic changes and DNA fragmentation assays are not indicative of the
number of
cells undergoing apoptosis. By using flow cytometry analysis, we were able to
determine the
proportion of apoptotic cells with DNA content that would decrease after
sufficient
endonucleolytic activity, leading to the cell DNA fragmentation described
above. By gating the
cells that were GFP positive (and that were also expressing the BVDV protein
of interest), and
by measuring the DNA content below the diploid (Go/G 1 ) level, we were able
to detect cells in a
cluster peak associated with apoptosis from cells infected for 40 hours with
the p80050-
CA 02390972 2002-06-19
expressing rec-Adenovirus, or treated with actinomycin D (used as an apoptosis
control system)
(Fig. 5A). In contrast; no sub GO/Gl peak was observed in cells mock-infected
or infected with
rec-Adenovirus-GFP, thereby indicating the absence of apoptotic process in
these cells (Fig: SA).
By conducting cytometry analyses at different time points pi, an increase over
time of the
percentages of cells undergoing apoptosis, beginning pat 18 hours pi (which
correlated with the
first evidence of morphologic changes in cell cultures), was obtained in the
cell cultures infected
with rec-Adenovirus expressing BVDV p80d50or in actinomycin D-treated cell
cultures (Fig.
5B). An increase over time of the percentages of apoptotic cells (albeit to a
lesser degree than
that obtained from cells infected with the rec-Adenovirus expressing BVDV
p80050) was also
observed in cells infected with rec-Adenovirus expressing the BVDV 80. In
contrast, no
significant changes in the percentages of basal apoptotic cells over time was
observed in mock-
infected cells or in cells infected with the rec-Adenovirus-GFP.
Cleavage of the death substrate, PARP
Chromosome DNA fragmentation requires the activation of cysteine proteases of
the
interleukin-I (3-converting enzyme (ICE), ermed he caspases. In response to
apoptotic stimuli,
the caspases (the so-called executioners of cell death in apoptosis} (Cohen,
1997), are involved in
a proteolytic cascade that serves to transmit and' amplify the death signals
(Cohen, 1997; Cryns
and Yuan, 1998). Caspase activation leads to the cleavage of various death
substrates, including
the 116 kDa PARP (Cohen, 1997; Hoff and Donis, 1997; Cryns and Yuan, 1998). As
it was
reported that ep BVDV-infected cells undergoing apoptosis express; late in
infection, the 85
kDA cleaved-product of PARP (Hoff and'Donis, 1997); we wished to determine
whether the rec-
Adenovirus-infected cells expressing BVDV p80~50 would also express the
cleaved form of
PARP. The kinetics of the expression of PARP cleavage product, as determined
by Western
immunoblotting, was then conducted from cells infected with BVDV p80~50-
expressing rec-
Adenovirus. As shown in Fig. 6, evidence of PARP cleavage was observed from 24
hours pi at
the time where CPE was- readily apparent; and continued to 60 hours pi (lanes
12 to 16), For the
BVDV p80-expressing rec-Adenovirus infected cells, PARP cleavage was only
detected 60
hours pi (lane 10). Finally, PARP cleavage was observed in cells treated with
actinornycin D
(lane 4). The results clearly indicate that BVDV p80 and p80~50-induced
apoptosis is mediated
through a caspase activation pathway.
BVDV p80~50-induced apoptosis is inhibited by baculovirus p35
The p35 protein of baculovirus has been shown to block apoptosis in insect and
mammalian
cells by functioning as an inhibitor of caspases (Miller et al., 1998):
Therefore, we wished to
determine whether this was also the case for BVDV p8Od50-induced apoptosis
using a rec-
Adenovirus expressing 'baculovirus p35 (rec-Adenovirus-baculovirus-p35) (B.
Massie,
unpublished). To do this, cells were infected as above with both BVDV p80~50
and p35-
expressing rec-Adenovirus (with has the same adenovirus genetic background as
the other rec-
Adenoviruses used in this study) at MOIs of 500 each, and then checked for CPE
and cleavage of
PARP. Cytotoxicity developed in cells infected with BVDV p80050-expressing rec-
Adenovirus,
while cells co-infected with both BVDV p80050-expressing rec-Adenovirus and
baculovirus
p35-expressing rec-Adenovirus had no significant apoptotic-related CPE up to
60 hours pi. (not
shown). Concomitantly; cleavage of PARP was detected in cells infected with
BVDV p80~50-
expressing rec-Adenovirus (as shown above), whereas no PARP cleavage product
was observed
CA 02390972 2002-06-19
11
from cells co-infected with the rec-Adenoviruses at any timepoint pi (Fig. 6,
lanes 18 to 22).
Finally, as a control for adenovirus background, cells were co-infected with
BVDV p80050-
expressing rec-Adenovirus and GFP-expressing rec-Adenovirus, and showed CPE
typical of
apoptosis and PARP cleavage product (not shown) similar to what was observed
in cells infected
BVDV p80050-expressing rec-Adenovirus alone (nat shown).
BVDV p80 or:BVDV p80~50-induced apoptosis in relation with cell cycle
Preliminary results indicated that BVDV p80 and/or p80~50-induced apoptosis
occurs at
and/or before S phase ofthe cell cycle (not shown).
DISCUSSION
In this paper, the entire BVDV p80-encoding nucleic acid sequence was
successfully
inserted into the procaryotic pEt-21b expression vector with the aim of
obtaining a His-tag
recombinant p80 to be used for the generation of a BVDV p80-specific
polyclonal antiserum.
This nucleic acid sequence was selected according to the paper of Xue et al.
(1998) in which the
NH2-terminus of the BVDV p80 was predicted to be a glycine at amino acid
position 1690 of the
NADL polyprotein. However; no -significant expression from this plasmid
construction in
bacterial cells was -obtained. Because the NH2-terminal region of the p80
appears to be
somewhat hydrophobic (as determined by using the algorithm of Kyte and
Doolittle; 1982), we
hypothesize that this hydropathic character could have explain the
unsuccessful expression
result. Therefore, two other plasmid constructions were, generated by deleting
the first 26 or 50
amino acids of the p80 NH2-terminal, and then tested for protein expression.
Although deletion
of 26 amino acids from the p80 NH2-terminal resulted in significant protein
(p80426)
expression; the best protein expression yield was obtained from the plasmid
construct containing
the p80050-encoding sequence.
In contrast to the expression results obtained in bacterial cells; the
eucaryotic adenovirus
inducible expression system used in this 'study allowed us to express both the
p80 and the
p80050 of BVDV. This system also was used to determine directly the
involvement of these
BVDV proteins in the induction of apoptosis in vitro: The results have shown
that both BVDV
proteins expressed in cells infected with the respective rec-Adenovirus was
cleaxly associated
with the induction of CPE and cell DNA fragmentation typical of apoptosis.
However, the CPE
observed in cells infected with the rec-Adenovirus expressing the p80 was
somewhat delayed in
time and less intense than in cells infected with the rec-Adenovirus
expressing the p80~50: This
was confirmed by the much less number of apoptotic cells in the cell cultures
infected with the
rec-Adenovirus expressing the p80 at the same timepoints pi (Fig: SB); and by
the delay in the
detection of PARP cleavage, when compared to the cell cultures infected with
the p80050-
expressing rec-Adenovirus.
As reported elsewhere; infection of cells in vitro with cp BVDV induces
apoptosis through
the caspase activation pathway (Zhang et al., 1996; Hoff and Donis; 1997).
Oxydative stress
(Schweizer and Peterhans, 1999) and intracellular viral RNA viral,accumulation
(Vassilev and
Donis, 2000) have been reported to be key=factors associated with cp BVDV-
induced apoptosis.
On the other hand, it was also shown that macrophages/monocytes constitute,
among blood
CA 02390972 2002-06-19
12
mononuclear cells; the major cell population undergoing apoptosis following in
vitro infection
with cp BVDV, and that T, B and NK cells, albeit to a lesser degree, also
undergo apoptosis
(Lambot et a1.1998). Here, expression of either p80 or p80050 of BVDV from an
adenovirus
inducible expression system correlated v~ith apoptosis of these cells. This
p80- or p80450-
induced apoptosis is mediated through the caspase activation pathway (as
determined by the
cleavage of the death substrate, PARP), similar to the apoptosis induced by
cell infection with cp
BVDV in vitro (Hoff and Donis, 1997). Thus, p80 of BVDV is a viral determinant
involved in cp
BVDV induced apoptosis in vitro:
To conclude, the results presented here constitute the first experimental
proof of a direct link
between BVDV p80 (and thereof BVDV p80~50) expression and apoptosis. Moreover,
the
BVDV p80 (and p80~50) is the first described pestivirus NS3 protein associated
with apoptosis.
REFERENCES
Abed, Y., St-Laurent, G:; Zhang, H., Jacobs, R. M:, and Archambault, D.
(1999). Development
of a Western blot assay for detection of bovine immunodeficiency-like virus
using capsid and
transmembrane envelope proteins expressed from recombinant baculovirus: Clin:
Diagn. Lab.
Immunol. 6, 68-172.
Archambault; D., and St-Laurent; G. (2000). Induction of apoptosis by equine
arteritis virus
infection. Virus Genes 20; 143-147:
Aichambault, D:; Beliveau, C., Couture, Y., and Caiman, 5. (2000). Clinical
response and
immunomodulation following experimental challenge of calves with type 2
noncytopathogenic
bovine viral diarrhea virus. Vet. Res. 31, 215-227:
Baker, J.C. (1987). Bovine viral diarrhea virus: a review. J. Am. Vet. Med:
Assoc. 190; 1449-
1458.
Cohen, J. M. (1997). Caspases : the executioners of apoptosis. Biochem. J.
326, 1-16.
Cryns, V., and Yuan, J. (1998). Proteases to die for. Genes Dev. 12, 1551-
1570.
Duvall, E:, and Wyllie, A. H. (1986). Death and the cell. Immunol. Today 7,
115-119.
Goiczyca, W., 'Gong, J., Ardelt, B.; Traganos, F.and Darzynkiewicz; Z. (1993).
The cell cycle
related differences in susceptibility of HL-60 cells to apoptosis induced by
vaious antitumor
agents. CancerRes. 53, 3186-3192.
CA 02390972 2002-06-19
Hammers, C., Dehan, P., Couvreur, B., Letellier, C.,'Kerkhofs; P., and
P~toret, P.-P. (2001).
Diversity among bovine pestiviruses. Vet. J. 161, 112-122.
Hanon, E., Hoornaert, 5., Dequiedt, F., Vanderplasschen, A.; Lyaku; J.,
Willems, L., and
Pastoret, P.-P. (1997). Bovine herpesvirus 1-induced apoptosis occures at the
GO/G1 phase of the
cell cycle. Virology 232; 351-358.
Harlow, E, and Lane, D: (1988): Antibodies; a laboratory manual. New York:
Cold Spring
Harbor Laboratory Press.
Hoff H: 5., and Donis, R. O. (1997). Induction of apoptosis and cleavage of
poly(ADP-ribose)
polymerase by cytopathic bovine viral diarrhea virus infection. Virus Res: 49,
141-113:
Jani, A., Lochmuller, H., Acsadi, G., Simoneau; M., Huard, J., Gamier, A.,
Karpati, G., and
Massie, B. (1997). Generation, validation; and large scale production of
adenoviral recombinants
with large size inserts such as 6.3 kb human distrophin cDNA. J. Virol:
Methods 64, 111-124.
Kheyar, A, Martin, 5.; St-Laurent; G., Timoney,' P. J:; McCollum, W. H., and
Archambault, D.
( 1997). Expression cloning and humoral immune response to the nucleocapsid
and membrane
proteins of equine arteritis virus. Clin. Diagn. Lab. Immunol. 4, 648-652.
Kummerer; B. M., Tautz, N., Becher; P., Thiel, H.-J., and Meyers, G. (2000).
The genetic basis
for cytopathogenicity of pestiviruses: Vet: Microbiol. 77; 117-128.
Kyte, J.; and Doolittle, R. F. (1982). A simple method for dysplaying the
hydropathic character
of a protein. J. Mol. Biol: 5; 105-132:
Lambot, M., I3anon, E., Lecomte, C., Hamers,C.; Letesson, J:-J., and Pastoret,
P.-P. (1998).
Bovine viral diarrhoea virus induces apoptosis ' in blood mononuclear cells by
a mechanism
largely dependent on monocytes. J: Gen. Virol. 79; 1745-1749.
Massie, B., Mosses, D. D., Koutrowrnanis; M:Vine-Mony; I., Lamoureux, L.,
Couture, F.,
Paquet, L., Guilbault, C, Dionne, J., Chahla; D.~ Jolicoeur, P., and
Langelier, Y. (1998a): New
adenovirus vectors for protein production and gene transfer.
Cytotechnology'28; 53-64.
Massie, B., Couture, F., Lamoureux, L., Mosses, D. D., Guilbault, C.,
Jolicoeur, P., Belanger, F:,
and Langelier,'Y: (1998b): Inducible overexpression of'a toxic protein by an
adenovirus vector
with a tetracycline-regulatable expression cassette. J. Virol. 72; 2289-2298.
McClurkin; A. W., Coria, M. F., and Bolin 5. R. (1985): Isolation of
cytopathic and
noncytopathic bovine viral diarrhea virus from the spleen of cattle acutely
and chronically
affected with bovine viral diarrhea. J. Am. Vet. Med. Assoc: 186, 568-569.
Mendez, E., Ruggli, N.; Coilett, M, S., and'RiceC. M: (1998). Infectious
bovine viral diarrhea
virus (strain NADL) RNA from stable cDNA clones : a cellular insert determines
NS3
production and'viral cytopathogenicity. J. Virol. 72, 4737-4745.
CA 02390972 2002-06-19
Meyers, G., and Thiel, H:-J. (1996): Molecular characterization
ofpestiviruses. Adv. Virus Res.
47; 53-118.
Miller, L. K.; Kaiser, W: J., and Seshagiri; S. (1998). Baculovirus regulation
of apoptosis. Sem.
Virol. 8, 445-452.
Moennig, V., and Plagemann, P. G. (1992): Thepestiviruses. Adv. Virus Res: 41,
53-98.
Nuttall, P. A., Stott, E. J., and Thomas, L: H. (1980). Experimental infection
of calves with two
strains of bovine virus diarrhoea virus': virus recovery and clinical
reactions. Res. Vet. Sci. 28,
91=95.
O'Brien, V. (1998). Viruses and apoptosis: J: Gen.Virol. 79, 1833-1845.
Pellerin; C., Van der Hurk; J., Lecornte, J.; and Tijssen, P: (1994):
Identification of a new group
of bovine diarrhea virus strains associated with severe outbreaks and high
mortalities. Virology
203, 265-268.
Rice, C. M. ( 1996): Flaviviridae: the viruses and ,their replication: In:
Fields Virology, Fields, B.
N, Knipe, D. M., and Hewley, P, M., eds3rd Edition, Lippincott-Raven
Publishers; pp. 931-
939:
Ridpath, J. F., Bolin; 5. R., and Dubovi; E: J. (1994). Segregation of bovine
viral diarrhea virus
into genotypes. Virology ZOS; 66-74.
Stinger, F., Nicklen, S., and Coulson, A: R . (F977). DNA sequencing with
chain-terminating
inhibitors: Proc. Natl: Acad. Sci (USA) 74,' 5473 '-5467.
Schulze-Osthoff; K., Ferrari, D.; Los M:, Wesselberg, S., and Peter, M: E.
(1998). Apoptosis
signaling by death receptors. Eur. J: Biochem. 254; 439-459.
Schweizer; M:, and Peterhans; E: 1999. Oxydative stress in cells infected with
bovine viral
diarrhoea virus : a crucial step in the induction of apoptosis. J: Gen. Virol.
801147-1155:
St-Laurent, G., Morin, G.; and Archambault, D. (1994). Detection of equine
arteritis virus
following amplification of structural and nontructural viral genes by reverse
transcription-PCR.
J. Clin. Microbiol. 32; 658-665.
St-Laurent, G, and Archambault, D. (2000). Molecular cloning, phylogenetic
analysis and
expression of beluga whale (Delphihapterus leucas) interleukin 6. Vet.
Immunol. Immunopathol.
73, 3 i -44.
Tamura, J: K., Warrener, P:, and Collett, M. S. (1993). RNA-stimulated NTPase
activity
associated with the p80 protein of the pestiVirus bovine viral diarrhea virus:
Virology 193, 1-10.
CA 02390972 2002-06-19
Teodoro; J. G;; and Branton, P. E. (1997). Regulation of apoptosis by viral
gene products, J.
Virol. 71, 1739-1746:
Tereda, N., Lucas, J. J., and Gelfand, E: W: (1991). Differential regulation
of the tumor
suppresser molecules, retinoblastoma susceptibility gene product (Rb) and p53,
during cell cycle
progression of normal human T cells. J. Immunol. 147; 698-704:
Thiel; H.-J.; Plagemann, P. G. W., and Moennig; V. (1996). Pestiviruses: In:
Fields Virology,
Fields, B. N., Knipe, D. M:, and Hewley; P. M., eds; 3rd Edition, Lippincott-
Raven Publishers,
pp. 1059-1073:
Vassilev, V. B., and Donis; R. O. (2000). Bovine viral diarrhea virus induced
apoptosis
correlates with increased intracellular viral RNA accumulation: Virus Res.
6995-107.
Warrener, P, and Collett, M. S. (1995). Pestivirus NS3 (p80) protein possesses
RNA helicase
activity. J. Virol. 69, 1720-1726.
Wiskerchen, M., and Collett, M. S. (1991). Pestivirus gene expression :
protein p80 of bovine
viral diarrhea virus is a proteinase involved in polyprotein processing.
Virology 184, 341-350.
Zhang, G., Aldridge; 5.; Clarke, M. C., and McCauley, J. W. (1996). Cell death
induced by
cytopathic bovine viral diarrhoea virus is mediated by apoptosis. J. Gen:
Virol. 77, 1677-1681.
Xu; J., Mendez, E., Caron; P. R.; Lin, C., Murcko; M. A., Collett; M. S., and
Rice, C. M. (1997).
Bovine viral diarrhea virus NS3 serine proteinase: polyprotein cleavage sites,
cofactor
requirements; and molecular model of an enzyme essential for pestivirus
replication. J. Virol. 71;
5312-5322.
CA 02390972 2002-06-19
Table 1
Oligonucleotide primers used to generate recombinant
plasmids containing
BVDV p80- and p80~50-encoding nucleic acid sequences
Recombinant Sense
plasmids
Nucleotide
sequences
(5'~3')
pBS/pEt (p80)CAAACA_TATGGGGCCTGCCGTGTGTAAGAAG +
CAAA CTCGAGCAACCCGGTCACTTGCTTCA
pBS/pEt (p80~50)CAAACATATGGGTCTGGAGACTGCCTGGGCTTA +
CAAACTCGAGCAACCCGGTCACTTGCTTCA -
pBS/pEt (p80~26)CAAA CATATGGGGATCATGCCAAGGGGGACTAC +
CAAACTCGAGCAACCCGGTCACTTGCTTCA -
pBS/Ad (p80)CAAAGTTTAAACGATCCACCAT GGA CAT CAC CAT CAC CAT +
CAC
GGGCCTGCCGTGTGTAAGAAG
CAAAGTTTAAAC ~CAACCCGGTCACTTGCTTCAGT
pBS/Ad (p8005D)CAAAGTTTAAACGATCCACCATGGGA CAT CAC CAT CAC CAT +
CAC
GGTCTGGAGACTGCCTGGGCTTA
CAAAGTTTAAAC T ACAACCCGGTCACTTGCTTCAGT -
The underlined nucleotides refer to restriction endonuclease cleavage sites:
GTTTAAAC: PmeI; CTCGAG: XhoI;
CATAT : NdeI. The initiation ATG ; termination ~ and histidine codons (CAT and
CAC) are also shown.
CA 02390972 2002-06-19
Figure Legends
FIG. 1 : SDS-polyacrylamide gel analysis of BVDV p80 and p$0050 fusion
proteins expressed
in E. coli DHSa after 3 hours post-induction: Lane 1 refers to total protein
extract from
uninduced E. coli DHSa containing no expression plasrnid vector; lanes 2 and 3
refer to total
protein extract from uninduced and induced recombinant bacteria containing the
p80-expressing
plasmid vector; respectively; lanes 4 and 5 refer to total protein extract
from uninduced and
induced recombinant bacteria containing 'the p80026-expressing plasrnid
vector; respectively;
lanes 6 and 7 refer o total protein extract from uninduced and induced
recombinant bacteria
containing the p80050-expressing plasmid vector; respectively; lane 8 refers
to purified p80~50
protein. Lane M, molecular weight standards in kDa (indicated in the left
margin). Proteins were
visualized by staining the gel with Coomassie brilliant blue:
FIG. 2: Changes in cell morphology (400X enlargement) induced by BVDV p80 and
p80050
proteins. A549tTA cells were infected with GFP-expressing rec-Adenovirus (A),
BVDV p80-
expressing rec-Adenovirus (B) or BVDV p80050-expressing rec-Adenovirus (C)
with an MOI
of 500 PFU per cell, and incubated for 40, 48, and 40 hours; respectively. In
situ cell DNA
fragmentation was assessed using a colorimetric Tdt-mediated dUTP nick end
labeling (TUNEL)
commercial kit: Arrows indicate examples of nucleus condensation and labeling
(dark-brownish
color) with T'UNEL.
FIG. 3 : Expression analysis of BVDV p80 and p80050 proteins in A549tTA cells.
Cells were
mock-infected, treated with actinomycin D (50 ~.g per ml), or infected with
rec-Adenoviruses
with an MOI of 500 PFU per cell. (A) Western blot immunoblotting on 'cell
extracts using
BVDV p80050-rabbit antiserum; and a peroxidase-conjugated anti-rabbit
antiserum.
Immunological reactivity was revealed after adding the peroxidase substrate
(PBSS; ph 7.3
H202; methanol and 4-chloro-naphthol) for 20 min. Lane 1; mock-infected cells
(40 hours of
incubation); lane 2, actinomycin D treated-cells (30 hours of incubation);
lane 3, cells infected
with GFP-expressing rec-Adenovirus (40 hours. pi); lane 4, cells infected with
BVDV p80-
expressing rec-Adenovirus (48 hours post infection); lane 5, cells infected
with BVDV p80050-
expressing rec-Adenovirus (40 hours of infection); lane 6; BVDV p80~50
expressed in E. coli
used as a positive control. Lane M, molecular weight standards in kDa
(indicated in the left
margin). (B) Confocal fluorescence microscopy. Cells were infected with p80050-
expressing
rec-Adenovirus for 40 hours, fixed in paraformaldehyde solution for 1 hour;
and perrneabilised
with Triton X-100 solution for 10 min. Cells were then exposed to rabbit anti-
BVDV p80~50,
washed, and exposed to Cy3-conjugated goat anti-rabbit immunoglobulin G (whole
molecule).
a) unlabeled cells; b) GFP expression; c) BVDV p80050 expression; d) co-
localization of GFP
and BVDV p80~50- expressed proteins.
CA 02390972 2002-06-19
I8
FiG. 4 : Cell DNA oligonucleosomal fragmentation-analysis as determined on
ethidium bromide
stained agarose gel. A549tTA cells were mock-infected; treated with
Actinomycin D (SO ~g per
ml); or infected with rec-Adenoviruaes with an MOI of 500 PFU per cell. Lane
1, mock infected
cells (40 hours of incubation); lane 2, cells infected with GFP-expressing rec-
Adenovirus (40
hours post infection); lane 3; actinomycin D-treated cells (30 hours of
'incubation); lane 4, cells
infected with BVDV p80-expressing rec-Adenovirus (48 hours post infection);
lane S, cells
infected with BVDV p80~5U-expressing rec-Adenovirus (40 hours post infection);
lane 6, mock-
infected MDBK cells (72 hours of incubation); lane 7, MDBK cells infected with
BVDV (NADL
strain) (72 hours post infection). M: HaeIII-digested ~X-174 and HindIIi=~,
replicative- form
DNAs as molecular mass markers.
FIG. 5; Determination of subdiploid D1VA content and quantitation of apoptotic
cells by flow
cytometry. (A) Typical histograms of cell DNA fragmentation obtained after 40
hours of cell
incubation are shown. A549tTA cells were mock-infected, treated with
actinomycin D (50 ~.g
per ml), or infected with GFP- or BVDV p80 or p80050=expressing rec-Adenovirus
with an
MOL of SOO PFU per cell. Single cell susperisiori were fixed and
permeabilized, and stained with
propidium iodide (PI) before flow cytometry analysis. PI fluorescence was
detected at 660 nrn
(x axis): 1VI1 refers to areas showing lower DNA content. (B) Kinetics of
percentages of cells
undergoing apoptosis at different timepoints of cell incubation. Full boxes;
mock-infected cells;
open boxes, cells infected with GFP-expressing rec-Adenovirus; open circles;
actinomycin D-
treated cells; full circles; BVDV p8U050-expressing rec-Adenovirus; open
triangles, BVDV p80-
expressing rec-Adenovirus. Results are means + SD for duplicate samples:
FIG: 6 : Kinetics of the expression of PARP cleavage product by Western
immunoblotting
analysis. A549tTA cells were mock-infected, treated with actinomycin L7 (50
~.g per ml),
infected with GFP- or BVDV p80 or p80~50-expressing 'rec-Adenovirus, or co-
infected with
BVDV p80050-expressing rec-Adenovirus and rec-Adenovirus expressing
baculovirus p35
protein with MOIs of 500 PFU per cell: '~Uestern blot immunoblatting on cell
extracts was
conducted using, as primary antibody, a PARP monoclonal antibody, and, as
secondary
antibody, a peroxidase-conjugated goat anti-mouse immunogtobulin G (I-I + L
chains). The
membranes were developed -by enhanced chemiluminescence. Lanes 1 and 2 refer
to mock-
infected cells after 12 h and 60 hours of incubation; respectively; lane 3
refers to aetinomycin D-
treated cells after 12 and 40 hours of incubation; respectively; lanes 5 to 10
refer to cells infected
with BVDV p80-expressing rec-Adenovirus at 12, 24, 30,, 40, 48, and 60 hours
post infection,
respectively; lanes 11 to 16 refer to cells infected with BVDV p80050-
expressing rec-
Actenovirus at 12, 24, 30; 40; 48, and 60 hours post infection; respectively;
lane 17 refers to cells
infected with GFP-expressing rec-Adenovirt~s at 40 hours post infection; lanes
18 to 22 refer to
cells. co-infected with BVDV p80~50-expressing rec-Adenovirus and rec-
Adenovirus expressing
baculovirus p35 protein at 12; 24, 30, 40, and 60 hours post infection:
