Note: Descriptions are shown in the official language in which they were submitted.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
COMBINATORIAL SCREENING OF MIXED POPULATIONS OF
ORGANISMS
FIELD OF THE INVENTION
The present invention relates generally to screening and identification of
bioactive molecules and more specifically to the production and screening of
gene
libraries generated from nucleic acid isolated from more than one organism for
bioactive molecules or bioactivities.
BACKGROUND
The majority of bioactive compounds currently in use are derived from soil
microorganisms. Many microbes inhabiting soils and other complex ecological
communities produce a variety of compounds that increase their ability to
survive and
proliferate. These compounds"'are generally thought to be nonessential for
growth of
the organism and are synthesized with the aid of genes involved in
intermediary
metabolism. Such secondary metabolites that influence the growth or survival
of
other organisms are known as "bioactive" compounds and serve as key components
of
the chemical defense arsenal of both micro- and macroorganisms. Humans have
exploited these compounds for use as antibiotics, antiinfectives and other
bioactive
compounds with activity against a broad range of prokaryotic and eukaryotic
pathogens (Barnes et al., Proc.Nat. Acad. Sci. U,S.A., 91, 1994).
Despite the seemingly large number of available bioactive compounds, it is
clear
that one of the greatest challenges facing modern biomedical science is the
proliferation
of antibiotic resistant pathogens. Because of their short generation time and
ability to
readily exchange genetic information, pathogenic microbes have rapidly evolved
and
disseminated resistance mechanisms against virtually all classes of antibiotic
compounds. For example, there are virulent strains of the human pathogens
Staphylococcus and Streptococcus that can now be treated with but a single
antibiotic,
vancomycin, and resista~zce to this compound will require only the transfer of
a single
gene, vafzA, from resistant Ehtey-ococcus species for this to occur. (Bateson
et al.,
System. Appl. Micfobiol, 12, 1989). When this crucial need for novel
antibacterial
compounds is superimposed on the growing demand for enzyme inhibitors,
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
2
immunosuppressants and anti-cancer agents it becomes readily apparent why
pharmaceutical companies have stepped up their screening of microbial samples
for
bioactive compounds.
The approach currently used to screen microbes for new bioactive compounds
has been largely unchanged since the inception of the field. New isolates of
bacteria,
particularly gram positive strains from soil environments, are collected and
their
metabolites tested for pharmacological activity.
There is still tremendous biodiversity that remains untapped as the source of
lead compounds. However, the currently available methods for screening and
producing lead compounds cannot be applied efficiently to these under-explored
resources. For instance, it is estimated that at least 99% of marine bacteria
species do
not survive on laboratory media, and commercially available fermentation
equipment
is not optimal for use in the conditions under which these species will grow,
hence
these organisms are difficult or impossible to culture for screening or re-
supply.
Recollection, growth, strain improvement, media improvement and scale-up
production of the drug-producing organisms often pose problems for synthesis
and
development of lead compounds. Furthermore, the need for the interaction of
specific
organisms to synthesize some compounds makes their use in discovery extremely
difficult. New methods to harness the genetic resources and chemical diversity
of
these untapped sources of compounds for use in drug discovery are very
valuable.
A central core of modern biology is that genetic information resides in a
nucleic
acid genome, and that the information embodied in such a genome (i.e., the
genotype)
directs cell function. This occurs through the expression of various genes in
the genome
of an organism and regulation of the expression of such genes. The expression
of genes
in a cell or organism defines the cell or organism's physical characteristics
(i.e., its
phenotype). This is accomplished through the translation of genes into
proteins.
Determining the biological activity of a protein obtained from an
environmental sample
can provide valuable information about the role of proteins in the
environments. In
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
addition, such information can help in the development of biologics,
diagnostics,
therapeutics, and compositions for industrial applications.
Accordingly, the present invention provides methods to access this untapped
biodiversity and to rapidly screen for sequences and activities of interest
utilizing
recombinant DNA technology. This invention combines the benefits associated
with
the ability to rapidly screen natural compounds with the flexibility and
reproducibility
afforded with working with the genetic material of organisms.
SUMMARY' OF THE INVENTION
The present invention provides rapid screening of samples for bioactivities or
biomolecules of interest. Samples can be derived from a wide range of sources
and
include, for example, environmental libraries, samples containinig more than
one
organisms (e.g., mixed populations of organisms}, samples from unculturable
organisms,
deep sea vents and the like. As described herein, such samples provide a rich
source of
untapped molecules useful in biologics, therapeutics and industrial
application, which
prior to the present invention required laborious and time consuming methods
for
characterization and identification or were unable to be identified or
characterized.
In one embodiment the invention provides a method for obtaining a bioactivity
or a biomolecule of interest by screening a library of clones generated from
nucleic acids
from a mixed population of cells, for a specified bioactivity or biomolecule,
variegating
a nucleic acid sequence contained in a clone having the specified bioactivity
or
biomolecule; and comparing the variegated bioactivity or biomolecule with the
specified
bioactivity or biomolecule wherein a difference in the bioactivity or
biomolecule is
indicative of an effect of sequence variegation, thereby providing the
bioactivity or
biomolecule of interest.
In another embodiment, the invention provides a method for identifying a
bioactivity or a biomolecule of interest by screening a library of clones
generated from
pooled nucleic acids obtained from a plurality of isolates for a specified
bioactivity or
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
4
biomolecule; and identifying a clone which contains the specified bioactivity
or
biomolecule.
In yet another embodiment, the invention provides a method for identifying a
bioactivity or a biomolecule of interest. The method includes screening a
library of
clones generated from pooled nucleic acids obtained from a plurality of
isolates for a
specified bioactivity or biomolecule, variegating a nucleic acid sequence
contained in a
clone having the specified bioactivity or biomolecule, and comparing the
variegated
bioactivity or biomolecule with the specified bioactivity or biomolecule
wherein a
difference in the bioactivity or biomolecule is indicative of an effect of
introducing at
least one sequence variegation, thereby providing the bioactivity or
biomolecule of
interest.
In another embodiment, the invention provides a method for identifying a
bioactivity or a biomolecule of interest, wherein the method includes
screening a library
of clones generated from pooling individual gene libraries generated from the
nucleic
acids obtained from each of a plurality of isolates for a specified
bioactivity or
biomolecule and identifying a clone which contains the specified bioactivity
or
biomolecule.
In another embodiment, the invention provides a method for identifying a
bioactivity or a biomolecule of interest by screening a library for a
specified bioactivity
or biomolecule wherein the library is generated from pooling individual gene
libraries
generated from the nucleic acids obtained from each of a plurality of
isolates, variegating
a nucleic acid sequence contained in a clone having the specified bioactivity
or
biomolecule, and comparing the variegated bioactivity or biomolecule with the
specified
bioactivity or biomolecule wherein a difference in the bioactivity or
biomolecule is
indicative of an effect of introducing at least one sequence variegation,
thereby providing
the bioactivity or biomolecule of interest.
In yet another embodiment, the invention provides a method of identifying a
bioactivity or biomolecule of interest, including screening a library of
clones generated
from the nucleic acids from an enriched population of organisms for a
specified
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
bioactivity or biomolecule and identifying a clone containing the specified
bioactivity or
biomolecule.
In yet another embodiment, the invention provides a method of identifying a
bioactivity or biomolecule of interest by screening a library of clones
generated from
5 nucleic acids from an enriched population of organisms for a specified
bioactivity or
biomolecule, variegating a nucleic acid sequence contained in a clone having
the
specified bioactivity or biomolecule, and comparing the variegated bioactivity
or
biomolecule with the specified bioactivity or biomolecule wherein a difference
in the
bioactivity or biomolecule is indicative of an effect of introducing at least
one sequence
variegation, thereby providing the bioactivity or biomolecule of interest.
In another embodiment, the invention provides a method for identifying a
bioactivity or a biomolecule of interest. The bioactivity or biomolecule of
interest is
identified by incubating nucleic acids from a mixed population of organisms
with at least
one oligonucleotide probe having a detectable molecule and at least a portion
of a
nucleic acid sequence encoding a molecule of interest under conditions to
allow
interaction of complementary sequences, identifying nucleic acid sequences
having a
complement to the oligonucleotide probe using an analyzer that detects the
detectable
molecule. A. library is then generated from the identified nucleic acid
sequences and the
library is screened for a specified bioactivity or biomolecule. Nucleic acid
sequence
contained in a clone having the specified bioactivity or biomolecule is
variegated and the
variegated bioactivity or biomolecule compared with the specified bioactivity
or
biomolecule wherein a difference in the bioactivity or biomolecule is
indicative of an
effect of introducing at least one sequence variation, thereby providing the
bioactivity or
biomolecule of interest
In another embodiment, the invention provides a method for identifying a
bioactivity or a biomolecule of interest by co-encapsulating in a
microenvironment
nucleic acids obtained from a mixed population of organisms, with at least one
oligonucleotide probe having a detectable molecule and at least a portion of a
nucleic
acid sequence encoding a molecule of interest under such conditions and for
such time as
to allow interaction of complementary sequences, identifying encapsulated
nucleic acids
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
6
containing a complement to the oligonucleotide probe encoding the molecule of
interest
by separating the encapsulated nucleic acids with an analyzer that detects the
detectable
molecule, generating a library from the separated encapsulated nucleic acids,
screening
the library for a specified bioactivity or biomolecule, variegating a nucleic
acid sequence
contained in a clone having the specified bioactivity or biomolecule, and
comparing the
variegated bioactivity or biomolecule with the specified bioactivity or
biomolecule
wherein a difference in the bioactivity or biomolecule is indicative of an
effect of
introducing at least one sequence variation, thereby providing the bioactivity
or
biomolecule of interest.
In yet another embodiment, the invention provides a method including co- ,
encapsulating in a microenvironment nucleic acids obtained from an isolate of
a mixed
population of organisms, with at least one oligonucleotide probe having a
detectable
marker and at least a portion of a polynucleotide sequence encoding a molecule
having a
bioactivity of interest under conditions and for such time as to allow
interaction of
complementary sequences, identifying encapsulated nucleic acids containing a
complement to the oligonucleotide probe encoding the molecule of interest by
separating
the encapsulated nucleic acids with an analyzer that detects the detectable
marker,
generating a library from the separated encapsulated nucleic acids, screening
the library
for a specified bioactivity or biomolecule, variegating a nucleic acid
sequence contained
in a clone having the specified bioactivity or biomolecule, and comparing the
variegated
bioactivity or biomolecule with the specified bioactivity or biomolecule
wherein a
difference in the bioactivity or biomolecule is indicative of an effect of
introducing at
least one sequence variation, thereby providing the bioactivity or biomolecule
of interest.
In another embodiment, the invention provides a method for obtaining a
bioactivity or a biomolecule of interest by co-encapsulating in a
microenvironment
nucleic acids obtained from one or more isolates of a mixed population of
organisms,
with at least one oligonucleotide probe having a detectable marker and at
least a portion
of a polynucleotide sequence encoding a molecule having a bioactivity of
interest under
such conditions and for such time as to allow interaction of complementary
sequences,
identifying encapsulated nucleic acids containing a complement to the
oligonucleotide
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
7
probe encoding the molecule of interest by separating the encapsulated nucleic
acids
with an analyzer that detects the detectable marker, generating a library from
the
separated encapsulated nucleic acids, screening the library for a specified
bioactivity or
biomolecule, variegating a nucleic acid sequence contained in a clone having
the
specified bioactivity or biomolecule, and comparing the variegated bioactivity
or
biomolecule with the specified bioactivity or biomolecule wherein a difference
in the
bioactivity or biomolecule is indicative of an effect of introducing at least
one sequence
variation, thereby providing the bioactivity or biomolecule of interest.
In yet another embodiment, the invention provides a method for identifying a
bioactivity or a biomolecule of interest. The method includes co-encapsulating
in a
microenvironment nucleic acids obtained from a mixture of isolates of a mixed
population of organisms, with at least one oligonucleotide probe having a
detectable
marker and at least a portion of a polynucleotide sequence encoding a molecule
having a
bioactivity of interest under such conditions and for such time as to allow
interaction of
complementary sequences, identifying encapsulated nucleic acids containing a
complement to the oligonucleotide probe encoding the molecule of interest by
separating
the encapsulated nucleic acids with an analyzer that detects the detectable
marker,
generating a library from the separated encapsulated nucleic acids, screening
the library
for a specified bioactivity or biomolecule, variegating the a nucleic acid
sequence
contained in a clone having the specified bioactivity or biomolecule, and
comparing the
variegated bioactivity or biomolecule with the specified bioactivity or
biomolecule
wherein a difference in the bioactivity or biomolecule is indicative of an
effect of
introducing at least one sequence variation, thereby providing the bioactivity
or
biomolecule of interest.
These and other aspects of the present invention will be apparent to those
skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 is an illustration of the preferred embodiments of site-saturation
mutagenesis.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
8
Figure 2 shows an illustration of the gGeneration of an exhaustive set of
chimeric combinations by synthetic ligation reassembly.
Figure 3A and 3B are diagrams of the application of end-selection using a
topoisomerase-guided selection step to select for desirable polynucleotides
(e.g. the
selection of full length molecules) generated by polynucleotide reassembly
(e.g. by
synthetic ligation reassembly).
Figure 4 illustrates various aspects of the end-selection technology.
Figure 5 illustrates a specific aspect of the end-selection technology where
step
of "c) Performing directed expression cloning" is achieved using the enzyme
N.BstNBI
in order to introduce "sticky ends" into an originally blunt-ended DNA in
order to
achieve directional expression cloning of the original blunt-ended DNA.
Figure 6 shows the activity of the enzyme exonuclease III. The asterisk
indicates
that the enzyme acts from the 3' direction towards the 5' direction of the
polynucleotide
substrate.
Figure 7 shows an exemplary application of the enzyme exonuclease III in
exonuclease-mediated polynucleotide reassembly.
Figure 8 shows the generation of a poly-binding nucleic acid strand.
Figure 9 shows the use of exonuclease treatment as a means to liberate 3' and
5'-terminal nucleotides from the unhybridized single-stranded end of an
annealed
nucleic acid strand in a heteromeric nucleic acid complex, leaving a shortened
but
hybridized end to facilitate polymerase-based extension andlor ligase-mediated
ligation
of the treated end. Shown also is the combined use of in vivo "repair".
Figure 10 shows the use of exonuclease-mediated nucleic acid reassembly in an
example in which one methylated poly-binding nucleic acid strand is annealed
to several
unmethylated mono-binding nucleic acid strands.
Figure 11 shows an illustration of the use of exonuclease-mediated nucleic
acid
reassembly in an example in which a plurality of methylated poly-binding
nucleic acid
strand are annealed to several unmethylated mono-binding nucleic acid strands.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
9
Figure 12 shows a graph of the thermal stability of wild type (20F12) and
mutant (Dhla 5) dehalogenase at 55°C.
Figure 13 shows a graph of the thernial stability of Dhla 5 dehalogenase at
55°C.
Figure 14 shows enzyme progress curves for Dhla 5 and 20F12 at
30°C and
55°C.
Figure 15 shows thermal stability of Dhla 5 dehalogenase at 80°C.
The data
are fit to an exponential decay (C*exp-~'t) where tli2 = ln2/k.
Figure 16 shows thermal stability of Dhla 5 and Dhla 8 dehalogenase at
80°C.
The data are fit to an exponential decay (C*exp-kt) where tli2 = ln2/k giving
values of
13 and 138 minutes for Dhla 5 and Dhla 8, respectively.
Figures 17A, B and C show differential scanning calorimetry of the three
dehalogenase variants. The data were recorded using a Perkin Elmer Pyris 1 at
a
scan rate of 10°C/min.
DETAILED DESCRIPTION OF THE INVENTION
The present invention provides rapid screening of libraries derived from more
than one organism, such as a mixed population of organisms from, for example,
an
environmental sample or an uncultivated population of organisms or a
cultivated
population of organisms.
In one embodiment, gene libraries are generated by obtaining nucleic acids
from
a mixed population of organisms and cloning the nucleic acids into a suitable
vector for
transforming a plurality of clones to generate a gene library. The gene
library thus
contains gene or gene fragments present in organisms of the mixed population.
The
gene library can be an expression library, in which case the library can be
screened for
an expressed polypeptide having a desired activity. Alternatively, the gene
library can
be screened for sequences of interest by, for example, PCR or hybridization
screening.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
In one embodiment, nucleic acids from isolates of a sample containing a mixed
population of orgaiusm are pooled and the pooled nucleic acids are used to
generate a
gene library.
By "isolates" is meant that a particular species, genus, family, order, or
class of
5 organisms is obtained or derived from a sample having more than one organism
or from
a mixed population of organisms. Nucleic acids from these isolated populations
can
then be used to generate a gene library. Isolates can be obtained from by
selectively
filtering or culturing a sample containing more than one orgaiusm or a mixed
population
of organisms. For example, isolates of bacteria can be obtained by filtering
the sample
10 through a filter which excludes organisrizs based on size or by culturing
the sample on
media that allows from selective growth or selective inhibition of certain
populations of
organisms.
An "enriched population" is a population of orgaiusms wherein the percentage
of
organisms belonging to a particular species, genus, family, order or class of
organisms is
increased with respect to the population as a whole. For example, selective
growth or
inhibition media can increase the overall number of organisms. One can enrich
for
prokaryotic organisms with respect to the total number of organisms in the
population.
Similarly, a particular species, genus, family, order or class of organisms
can be enriched
by growing a mixed population on a selective media that inhibits or promotes
the growth
of a subpopulation within the mixed population.
In another embodiment, nucleic acids from a plurality (e.g., two or more) of
isolates from a mixed population of organisms are used to generate a plurality
of gene
libraries containing a plurality of clones, and the gene libraries from at
least two isolates
are then pooled to obtain a "pooled isolate library."
Once gene libraries axe generated, the clones are screened to detect a
bioactivity
(e.g., an enzymatic activity, secondary messenger activity, binding activity,
transcriptional activity and the like) or a biomolecule of interest (e.g., a
nucleic acid
sequence, a peptide, a polypeptide, a lipid or other small molecule, and the
like). Such
screening techniques include, for example, contacting a clone, clonal
population, or
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
11
population of nucleic acid sequences with a substrate or substrates having a
detectable
molecule that provides a detectable signal upon interaction with the
bioactivity or
biomolecule of interest. The substrate can be an enzymatic substrate, a
bioactive
molecule, an oligonucleotide, and the like.
In one embodiment, gene libraries are generated, clones are either exposed to
a
chromagenic or fluorogenic substrate or substrates) of interest, or hybridized
to a
labeled probe (e.g., an oligonucleotide having a detectable molecule) having a
sequence
corresponding to a sequence of interest and positive clones are identified by
a detectable
signal (e.g., fluorescence emission).
In one embodiment, expression libraries generated from a mixed population of
organisms are screened for an activity of interest. Specifically, expression
libraries are
generated, clones are exposed to the substrate or substrates) of interest, and
positive
clone are identified and isolated. The present invention does not require
cells to survive.
The cells only need to be viable long enough to produce the molecule to be
detected, and
can thereafter be either viable or nonviable cells, so long as the expressed
biomolecule
(e.g., an enzyme) remains active.
In certain embodiment, the invention provides an approach that combines direct
cloning of genes encoding novel or desired bioactivities from environmental
samples
with a high-throughput screening system designed for the rapid discovery of
new
molecules, for example, enzymes. The approach is based on the construction of
environmental "expression libraries" which can represent the collective
genomes of
numerous naturally occurring microorgaiusms archived in closing vectors that
can be
propagated in E. coli or other suitable host cells. Because the cloned DNA can
be
initially extracted directly from environmental samples or from isolates of
the
environmental samples, the libraries are not limited to the small fraction of
prokaryotes
that can be grown in pure culture. Additionally, a normalization of the
environmental
DNA present in these samples could allows a more equal representation of the
DNA
from all of the species present in a sample. Normalization techniques
(described below)
can dramatically increase the efficiency of finding interesting genes from
minor
constituents of the sample that may be under-represented by several orders of
magnitude
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
12
compared to the dominant species in the sample. Normilization can occur in any
of the
foregoing embodiments following obtaining nucleic acids from the sample or
isolate(s),
In another embodiment, the invention provides a high-throughput capillary
array
system for screening that allows one to assess an enormous number of clones to
identify
and recover cells encoding useful enzymes, as well as other biomolecules
(e.g., ligmds).
In particular, the capillary array-based techniques described herein can be
used to screen,
identify and recover proteins having a desired bioactivity or other ligands
having a
desired binding affinity. For example, binding assays may be conducted by
using an
appropriate substrate or other marker that emits a detectable signal upon the
occurrence
of the desired binding event.
In addition, fluorescence activated cell sorting can be used to screen and
isolate
clones having an activity or sequence of interest. Previously, FAGS machines
have been
employed in the studies focused on the analyses of eukaryotic and prokaryotic
cell lines
and cell culture processes. FACS has also been utilized to monitor production
of foreign
proteins ain both eukaryotes and prokaryotes to study, for example,
differential gene
expression, and the like. The detection and counting capabilities of the FAGS
system
have been applied in these examples. However, FACS has never previously been
employed in a discovery process to screen for and recover bioactivities in
prokaryotes.
Furthermore, the present invention does not require cells to survive, as do
previously
described technologies, since the desired nucleic acid (recombinant clones)
can be
obtained from alive or dead cells. The cells only need to be viable long
enough to
produce the compound to be detected, and can thereafter be either viable or
non-viable
cells so long as the expressed biomolecule remains active. The present
invention also
solves problems that would have been associated with detection and sorting of
E. coli
expressing recombinant enzymes, and recovering encoding nucleic acids.
Additionally,
the present invention includes within its embodiments any apparatus capable of
detecting
fluorescent wavelengths associated with biological material, such apparati are
defined
herein as fluorescent analyzers (one example of which is a FAGS apparatus).
In some instances it is desirable to identify nucleic acid sequences from a
mixed
population of organisms, isolates, or enriched populations. In this
embodiment, it is not
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
13
necessary to express gene products. Nucleic acid sequences of interest can be
identified
or "biopanned" by contacting a clone, device (e.g. a gene chip), filter, or
nucleic acid
sample with a probe labeled with a detectable molecule. The probe will
typically have a
sequence that is substantially identical to the nucleic acid sequence of
interest,
Alternatively, the probe will be a fragment or full length nucleic acid
sequence encodilig
a polypeptide of interest. The prove and nucleic acids are incubated under
conditions
and for such time as to allow the probe and a substantially complementary
sequence to
hybridize. Hybridization stringency will vary depending on, for example, the
length and
GC content of the probe. Such factors can be determined empirically (See, for
example,
Sambrook et al., Molecular Cloning --A Laboratory Manual, Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY, 199, and Current Protocols in Molecular
Biology, M. Ausubel et al., eds., (Current Protocols, a joint venture between
Greene
Publishing Associates, Inc. and John Wiley & Sons, Inc., most recent
Supplement)).
Once hybridized the complementary sequence can be PCR amplified, identified by
1 S hybridization techniques (e.g., exposing the probe and nucleic acid
mixture to a film), or
detecting the nucleic acid using a chip.
Prior to the present invention, the evaluation of complex gene libraries or
environmental expression libraries was rate limiting. The present invention
allows the
rapid screening of complex environmental libraries, containing, for example,
genomic
sequences from thousands of different organisms or subsets and isolates
thereof. The
benefits of the present invention can be seen, for example, in screening a
complex
environmental sample. Screening of a complex sample previously required one to
use
labor intensive methods to screen several million clones to cover the genomic
biodiversity. The invention represents an extremely high-throughput screening
method
which allows one to assess this enormous number of clones. The method
disclosed
allows the screening anywhere from about 30 million to about 200 million
clones per
hour for a desired nucleic acid sequence, biological activity, or biomolecule
of interest.
This allows the thorough screening of environmental libraries for clones
expressing
novel bioactivities or biomolecules.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
14
Once a sequence or bioactivity of interest is identified (e.g., an enzyme of
interest) the sequence or polynucleotide encoding the bioactivity of interest
can be
evolved, mutated or derived to modify the amino acid sequence to provide, for
example,
modified activities such as increased thermostability, specificity or
activity.
S An "amino acid" is a molecule having the structure wherein a central carbon
atom (the a-carbon atom) is linked to a hydrogen atom, a carboxylic acid group
(the
carbon atom of which is referred to herein as a "carboxyl carbon atom"), an
amino group
(the nitrogen atom of which is referred to herein as an "amino nitrogen
atom"), and a
side chain group, R. When incorporated into a peptide, polypeptide, or
protein, an
amino acid loses one or more atoms of its amino acid carboxylic groups in the
dehydration reaction that links one amino acid to another. As a result, when
incorporated into a protein, an amino acid is referred to as an "amino acid
residue."
"Protein" or "polypeptide" refers to any polymer of two or more individual
amino acids (whether or not naturally occurring) linked via a peptide bond,
and occurs
when the carboxyl carbon atom of the carboxylic acid group bonded to the a-
carbon of
one amino acid (or amino acid residue) becomes covalently bound to the amino
nitrogen
atom of amino group bonded to the a-carbon of an adjacent amino acid. The term
"protein" is understood to include the terms "polypeptide" and "peptide"
(which, at
times may be used interchangeably herein) within its meaning. In addition,
proteins
comprising multiple polypeptide subunits (e.g., DNA polymerase III, RNA
polymerase
II) or other components (for example, an RNA molecule, as occurs in
telomerase) will
also be understood to be included within the meanitlg of "protein" as used
herein.
Similarly, fragments of proteins and polypeptides axe also within the scope of
the
invention and may be referred to herein as "proteins."
A particular amino acid sequence of a given protein (i.e., the polypeptide's
"primary structure," when written from the amino-terminus to carboxy-terminus)
is
determined by the nucleotide sequence of the coding portion of a mRNA, which
is in
turn specified by genetic information, typically genomic DNA (including
organelle
DNA, e.g., mitochondrial or chloroplast DNA). Thus, determining the sequence
of a
gene assists in predicting the primary sequence of a corresponding polypeptide
and
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
more particular the role or activity of the polypeptide or proteins encoded by
that gene or
polynucleotide sequence.
The term "isolated" or "purified" when referring to a nucleic acid sequence or
a
polypeptide sequence, respectively, means altered "by the hand of man" from
its natural
5 state; i. e., if it occurs in nature, it has been changed or removed from
its original
environment, or both. For example, a naturally occurnng polynucleotide or a
polypeptide naturally present in a living animal, a biological sample or an
environmental
sample in its natural state is not "isolated" or "purified", but the same
polynucleotide or
polypeptide separated from the coexisting materials of its natural state is
"isolated" or
10 "purified", as the term is employed herein. Such polynucleotides, when
introduced into
host cells in culture or in whole organisms, still would be isolated, as the
term is used
herein, because they would not be in their naturally occurring form or
environment.
Similarly, the polynucleotides and polypeptides may occur in a composition,
such as a
media formulation (solutions for introduction of polynucleotides or
polypeptides, for
15 example, into cells or compositions or solutions for chemical or enzymatic
reactions).
"Polynucleotide" or "nucleic acid sequence" refers to a polymeric form of
nucleotides. In some instances a polynucleotide refers to a sequence that is
not
immediately contiguous with either of the coding sequences with which it is
immediately contiguous (one on the 5' end and one on the 3' end) in the
naturally
occurring genome of the organism from which it is derived. The term therefore
includes,
for example, a recombinant DNA which is incorporated into a vector; into an
autonomously replicating plasmid or virus; or into the genomic DNA of a
prokaryote or
eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent
of other
sequences. The nucleotides of the invention can be ribonucleotides,
deoxyribonucleotides, or modified forms of either nucleotide. A
polynucleotides as used
herein refers to, among others, single-and double-stranded DNA, DNA that is a
mixture
of single- and double-stranded regions, single- and double-stranded RNA, and
RNA that
is mixture of single- and double-stranded regions, hybrid molecules comprising
DNA
and RNA that may be single-stranded or, more typically, double-stranded or a
mixture of
single- and double-stranded regions.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
16
In addition, polynucleotide as used herein refers to triple-stranded regions
comprising RNA or DNA or both RNA and DNA. The strands in such regions may be
from the same molecule or from different molecules. The regions may include
all of one
or more of the molecules, but more typically involve only a region of some of
the
molecules. One of the molecules of a triple-helical region often is an
oligonucleotide.
The term polynucleotide encompasses genomic DNA or RNA (depending upon the
organism, i. e., RNA genome of viruses), as well as mRNA encoded by the
genomic
DNA, and cDNA.
As mentioned above, there is currently a need in the biotechnology and
chemical
industry for molecules that can optimally carry out biological or chemical
processes
(e.g., enyzmes). For example, molecules and compounds that are utilized in
both
established and emerging chemical, pharmaceutical, textile, food and feed, and
detergent
markets must meet stringent economical and environmental standards. The
synthesis of
polymers, pharmaceuticals, natural products and agrochemicals is often
hampered by
expensive processes which produce harmful byproducts and which suffer from
poor or
inefficient catalysis. Enzymes, for example, have a number of remarkable
advantages
which can overcome these problems in catalysis: they act on single functional
groups,
they distinguish between similar functional groups on a single molecule, and
they
distinguish between enantiomers. Moreover, they are biodegradable and function
at very
low mole fractions in reaction mixtures. Because of their chemo-, regio- and
stereospecificity, enzymes present a unique opportunity to optimally achieve
desired
selective transformations. These are often extremely difficult to duplicate
chemically,
especially in single-step reactions. The elimination of the need for
protection groups,
selectivity, the ability to carry out mufti-step transformations in a single
reaction vessel,
along with the concomitant reduction in environmental burden, has led to the
increased
demand for enzymes in chemical and pharmaceutical industries. Enzyme-based
processes have been gradually replacing many conventional chemical-based
methods. A
current limitation to more widespread industrial use is primarily due to the
relatively
small number of commercially available enzymes. Only 300 enzymes (excluding
DNA modifying enzymes) are at present commercially available from the > 3000
non
DNA-modifying enzyme activities thus far described.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
17
The use of enzymes for technological applications also may require performance
under demanding industrial conditions. This includes activities in
environments or on
substrates for which the currently known arsenal of enzymes was not
evolutionarily
selected. However, the natural environment provides extreme conditions
including, for
example, extremes in temperature and pH. A number of organisms have adapted to
these conditions due in part to selection for polypeptides than can withstand
these
extremes.
Enzymes have evolved by selective pressure to perform very specific biological
functions within the milieu of a living organism, under conditions of
temperature, pH
and salt concentration. For the most part, the non-DNA modifying enzyme
activities
thus far identified have been isolated from mesophilic organisms, which
represent a very
small fraction of the available phylogenetic diversity. The dynamic field of
biocatalysis
takes on a new dimension with the help of enzymes isolated from microorganisms
that
thrive in extreme environments. For example, such enzymes must function at
temperatures above 100°C in terrestrial hot springs and deep sea
thermal vents, at
temperatures below 0°C in arctic waters, in the saturated salt
environment of the Dead
Sea, at pH values around 0 in coal deposits and geothermal sulfur-rich
springs, or at pH
values greater than 11 in sewage sludge. Environmental samples obtained, for
example,
from extreme conditions containing organisms, polynucleotides or polypeptides
(e.g.,
enzymes) open a new field in biocatalysis. By rapidly screening for
polynucleotides
encoding polypeptides of interest, the invention provides not only a source of
materials
for the development of biologics, therapeutics, and enzymes for industrial
applications,
but also provides a new materials for further processing by, for example,
directed
evolution and mutagenesis to develop molecules or polypeptides modified for
particular
activity, specificity or conditions.
In addition to the need for new enzymes for industrial use, there has been a
dramatic increase in the need for bioactive compounds with novel activities.
This
demand has arisen largely from changes in worldwide demographics coupled with
the
clear and increasing trend in the number of pathogenic organisms that are
resistant to
currently available antibiotics. For example, while there has been a surge in
demand for
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
18
antibacterial drugs in emerging nations with young populations, countries with
aging
populations, such as the U.S., require a growing repertoire of drugs against
cancer,
diabetes, arthritis and other debilitating conditions. The death rate from
infectious
diseases has increased 58% between 1980 and 1992 and it has been estimated
that the
emergence of antibiotic resistant microbes has added in excess of $30 billion
annually to
the cost of health care in the U.S. alone. (Adams et al., Cheynical arad
EngineeYing
News, 1995; Amann et al., Microbiological Reviews, 59, 1995). As a response to
this
trend pharmaceutical companies have significantly increased their screening of
microbial
diversity for compounds with unique activities or specificity. Accordingly,
the invention
can be used to obtain and identify polynucleotides and related sequence
specific
information from, for example, infectious microorganisms present in the
environment
such as, for example, in the gut of various macroorganisms.
Identifying novel enzymes in an environmental sample is one solution to this
problem. By rapidly identifying polypeptides having an activity of interest
and
polynucleotides encoding the polypeptide of interest the invention provides
methods,
compositions and sources for the development of biologics, diagnostics,
therapeutics,
and compositions for industrial applications.
The methods and compositions of the invention provide for the identification
of
lead drug compounds present in an environmental sample. The methods of the
invention
provide the ability to mine the environment for novel drugs or identify
related drugs
contained in different microorganisms. There are several common sources of
lead
compounds (drug candidates), including natural product collections, synthetic
chemical
collections, and synthetic combinatorial chemical libraries, such as
nucleotides, peptides,
or other polymeric molecules that have been identified or developed as a
result of
environmental mining. Each of these sources has advantages and disadvantages.
The
success of programs to screen these candidates depends largely on the number
of
compounds entering the programs, and pharmaceutical companies have to date
screened
hundred of thousands of synthetic and natural compounds in search of lead
compounds.
Unfortunately, the ratio of novel to previously-discovered compounds has
diminished
with time. The discovery rate of novel lead compounds has not kept pace with
demand
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
19
despite the best efforts of pharmaceutical companies. There exists a strong
need for
accessing new sources of potential drug candidates. Accordingly, the invention
provides a rapid and efficient method to identify and characterize
environmental samples
that contain novel drug compounds.
The maj ority of bioactive compounds currently in use are derived from soil
microorganisms. These compounds are generally thought to be nonessential for
growth
of the organism and are synthesized with the aid of genes involved in
intermediary
metabolism hence their name- "secondary metabolites". Secondary metabolites
that
influence the growth or survival of other organisms are known as "bioactive"
compounds and serve as key components of the chemical defense arsenal of both
micro-
and macro-organisms. Approximately 6,000 bioactive compounds of microbial
origin
have been characterized, with more than 60% produced by the gram positive soil
bacteria of the genus St~eptomyces. (Barnes et al., Proc.Nat. Acad. Sci.
U.S.A., 91,
1994). Of these, at least 70 are currently used for biomedical and
agricultural
applications. The largest class of bioactive compounds, the polyketides,
include a broad
range of antibiotics, immunosuppressants and anticancer agents which together
account
for sales of over $5 billion per year.
The invention provides methods of identifying a nucleic acid sequence encoding
a polypeptide having either known or unknown function. For example, much of
the
diversity in microbial genomes results from the rearrangement of gene clusters
in the
genome of microorganisms. These gene clusters can be present across species or
phylogenetically related with other organisms.
For example, bacteria and many eukaryotes have a coordinated mechanism for
regulating genes whose products are involved in related processes. The genes
are
clustered, in structures referred to as "gene clusters," on a single
chromosome and are
transcribed together under the control of a single regulatory sequence,
including a single
promoter which initiates transcription of the entire cluster. The gene
cluster, the
promoter, and additional sequences that function in regulation altogether are
referred to
as an "operon" and can include up to 20 or more genes, usually from 2 to 6
genes. Thus,
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
a gene cluster is a group of adjacent genes that are either identical or
related, usually as
to their function.
Some gene families consist of identical members. Clustering is a prerequisite
for
maintaining identity between genes, although clustered genes are not
necessarily
identical. Gene clusters range from extremes where a duplication is generated
to
adj acent related genes to cases where hundreds of identical genes lie in a
tandem array.
Sometimes no significance is discernable in a repetition of a particular gene.
A principal
example of this is the expressed duplicate insulin genes in some species,
whereas a
single insulin gene is adequate in other mammalian species.
10 Further, gene clusters undergo continual reorganization and, thus, the
ability to
create heterogeneous libraries of gene clusters from, for example, bacterial
or other
prokaryote sources is valuable in determining sources of novel proteins,
particularly
including enzymes such as, for example, the polyketide synthases that are
responsible for
the synthesis of polyketides having a vast array of useful activities. For
example,
15 polyketides are molecules wluch are an extremely rich source of
bioactivities, including
antibiotics (such as tetracyclines and erythromycin), anti-cancer agents
(daunomycin),
immunosuppressants (FK506 and rapamycin), and veterinary products (monensin).
Many polyketides (produced by polyketide synthases) are valuable as
therapeutic agents.
Polyketide synthases are multifunctional enzymes that catalyze the
biosynthesis of a
20 huge variety of carbon chains differing in length and patterns of
functionality and
cyclization. Polyketide synthase genes fall into gene clusters and at least
one type
(designated type I) of polyketide synthases have large size genes and enzymes,
complicating genetic manipulation and ifa vitro studies of these
genes/proteins.Other
types of proteins that are the products) of gene clusters are also
contemplated, including,
for example, antibiotics, antivirals, antitumor agents and regulatory
proteins, such as
insulin.
The ability to select and combine desired components from a library of
polyketides and postpolyketide biosynthesis genes for generation of novel
polyketides
for study is appealing. The methods) of the present invention make it possible
to, and
facilitate the cloning of, novel polyketide synthases and other gene clusters,
since one
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
21
can generate gene banks with clones containing large inserts (especially when
using the
f factor based vectors), which facilitates cloning of gene clusters.
For example, a gene cluster can be ligated into a vector containing an
expression
regulatory sequences which can control and regulate the production of a
detectable
protein or protein-related array activity from the ligated gene clusters. Use
of vectors
which have an exceptionally large capacity for exogenous nucleic acid
introduction are
particularly appropriate for use with such gene clusters and are described by
way of
example herein to include the f factor (or fertility factor) of E. coli. This
f factor of E.
coli is a plasmid which affects high-frequency transfer of itself during
conjugation and is
ideal to achieve and stably propagate large nucleic acid fragments, such as
gene clusters
from mixed microbial samples.
The nucleic acid isolated or derived from these samples (e.g., a mixed
population
of microorganisms) or isolates thereof can be inserted into a vector or a
plasmid prior to
screening of the polynucleotides. Such vectors or plasmids are typically those
containing expression regulatory sequences, including promoters, enhancers and
the like.
Accordingly, the invention provides novel systems to clone and screen mixed
populations of organisms enriched samples, or isolates thereof for
polynucleotides
encoding molecules having an activity of interest, enzymatic activities and
bioactivities
of interest ih vitro. The methods) of the invention allow the cloning and
discovery of
novel bioactive molecules in vitro, and in particular novel bioactive
molecules derived
from uncultivated or cultivated samples. Large size gene clusters, genes and
gene
fragments can be cloned, sequenced and screened using the ~nethod(s) of the
invention.
Unlike previous strategies, the methods) of the invention allow one to clone
screen and
identify polynucleotides and the polypeptides encoded by these polynucleotides
in vitro
from a wide range of environmental samples.
The invention allows one to screen for and identify polynucleotide sequences
from complex environmental samples, enriched samples thereof, or isolates
thereof.
Gene libraries can be generated from cell free samples, so long as the sample
contains
nucleic acid sequences, or from samples containing cells, cellular material or
viral
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
22
particles. The organisms from which the libraries may be prepared include
prokaryotic
microorganisms, such as EubacteYia and Af-chaebacteria, lower eukaryotic
microorganisms such as fungi, algae and protozoa, as well as mixed populations
of
plants, plant spores and pollen. The organisms may be cultured organisms or
uncultured
organisms obtained from environmental samples and includes extremophiles, such
as
thermophiles, hyperthermophiles, psychrophiles and psychrotrophs.
Sources of nucleic acids used to generate a DNA library can be obtained from
environmental samples, such as, but not limited to, microbial samples obtained
from
Arctic and Antarctic ice, water or permafrost sources, materials of volcanic
origin,
materials from soil or plant sources in tropical areas, droppings from various
organisms
including mammals and invertebrates, as well as dead and decaying matter and
the like.
The nucleic acids used to generate the gene libraries can be obtained, for
example, from
enriched subpopulations or ioslates of the sample. In another embodiment, DNA
of a
plurality of isolates can be pooled to create a source of nucleic acids for
generation of the
library. Alternatively, the nucleic acids can be obtained from a plurality of
isolates, a
plurality of gene libraries generated from the plurality of isolates to obtain
a plurality of
gene libraries. Two or more of the gene libraries can be pooled or combined to
obtain a
pooled isolate library. Thus, for example, nucleic acids may be recovered from
either a
cultured or non-cultured organism and used to produce an appropriate gene
library (e.g.,
a recombinant expression library) for subsequent determination of the identity
of the
particular biomolecule of interest (e.g., a polynucleotide sequence) or
screened for a
bioactivity of interest (e.g., an enzyme or biological activity).
The following outlines a general procedure for producing libraries from both
culturable and non-culturable organisms, enriched populations, as well as
mixed
population of organisms and isolates thereof, which libraries can be probed,
sequenced
or screened to select therefrom nucleic acid sequences having an identified,
desired or
predicted biological activity (e.g., an enzymatic activity), which selected
nucleic acid
sequences can be further evolved, mutagenized or derived.
As used herein an environmental sample is any sample containing organisms or
polynucleotides or a combination thereof. Thus, an environmental sample can be
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
23
obtained from any number of sources (as described above), including, for
example,
insect feces, hot springs, soil and the like. Any source of nucleic acids in
purified or
non-purified form can be utilized as starting material. Thus, the nucleic
acids may be
obtained from any source which is contaminated by an organism or from any
sample
S containing cells. The environmental sample can be an extract from any bodily
sample
such as blood, urine, spinal fluid, tissue, vaginal swab, stool, amniotic
fluid or buccal
mouthwash from any mammalian organism. For non-mammalian (e.g., invertebrates)
organisms the sample can be a tissue sample, salivary sample, fecal material
or material
in the digestive tract of the organism. An environmental sample also includes
samples
obtained from extreme environments including, for example, hot sulfur pools,
volcanic
vents, and frozen tundra. The sample can come from a variety of sources. For
example,
in horticulture and agricultural testing the sample can be a plant,
fertilizer, soil, liquid or
other horticultural or agricultural product; in food testing the sample can be
fresh food or
processed food (for example infant formula, seafood, fresh produce and
packaged food);
and in environmental testing the sample can be liquid, soil, sewage treatment,
sludge and
any other sample in the environment which is considered or suspected of
containing an
organism or polynucleotides.
When the sample is a mixture of material containing a mixed population of
organisms, for example, blood, soil or sludge, it can be treated with an
appropriate
reagent which is effective to open the cells and expose or separate the
strands of nucleic
acids. Although not necessary, this lysing and nucleic acid denaturing step
will allow
cloning, amplification or sequencing to occur more readily. Further, if
desired, the mixed
population can be cultured prior to analysis in order to purify or enrich a
particular
population or a desired isolate (e.g., an isolate of a particular species,
genus, or family of
organisms) and thus obtaining a purer sample. This is not necessary, however.
For
example, culturing of organisms in the sample can include culturing the
organisms in
microdroplets and separating the cultured microdroplets with a cell sorter
into individual
wells of a mufti-well tissue culture plate. Alternatively, the sample can be
cultured on
any number of selective media compositions designed to inhibit or promote
growth of a
particular subpopulation of organisms.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
24
Where isolates are derived from the sample containing mixed population of
organisms, nucleic acids can be obtained from the isolates as described below.
The
nucleic acids obtained from the isolates can be used to generate a gene
library or,
alternatively, be pooled with other isolate fractions of the sample wherein
the pooled
nucleic acids are used to generate a gene library. The isolates can be
cultured prior to
extraction of nucleic acids or can be uncultured. Methods of isolating
specific
populations of organisms present in a mixed population
Accordingly, the sample comprises nucleic acids from, for example, a diverse
and mixed population of organisms (e.g., microorganisms present in the gut of
an
insect). Nucleic acids axe isolated from the sample using any number of
methods for
DNA and RNA isolation. Such nucleic acid isolation methods are commonly
performed
in the art. Where the nucleic acid is RNA, the RNA can be reversed transcribed
to DNA
using primers known in the art. Where the DNA is genomic DNA, the DNA can be
sheared using, for example, a 25 gauge needle.
The nucleic acids can be cloned into an appropriate vector. The vector used
will
depend upon whether the DNA is to be expressed, amplified, sequenced or
manipulated
in any number of ways known in the art (see, for example, U.S. Patent No.
6,022,716
which discloses high throughput sequencing vectors). Cloning techniques are
known in
the art or can be developed by one skilled in the art, without undue
experimentation. The
choice of a vector will also depend on the size of the polynucleotide sequence
and the
host cell to be employed in the methods of the invention. Thus, the vector
used in the
invention may be plasmids, phages, cosmids, phagemids, viruses (e.g.,
retroviruses,
parainfluenzavirus, herpesviruses, reoviruses, paramyxoviruses, and the like),
or selected
portions thereof (e.g., coat protein, spike glycoprotein, capsid protein). For
example,
cosmids and phagemids are typically used where the specific nucleic acid
sequence to be
analyzed or modified is large because these vectors are able to stably
propagate large
polynucleotides.
The vector containing the cloned nucleic acid sequence can then be amplified
by
plating (i. e., clonal amplification) or transfecting a suitable host cell
with the vector (e.g.,
a phage on an E. coli host). The cloned nucleic acid sequence is used to
prepare a library
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
for screening (e.g., expression screening, PCR screening, hybridization
screening or the
like) by transforming a suitable organism. Hosts, known in the art are
transformed by
artificial introduction of the vectors containing the nucleic acid sequence by
inoculation
under conditions conducive for such transformation. One could transform with
double
5 stranded circular or linear nucleic acid or there may also be instances
where one would
transform with single stranded circular or linear nucleic acid sequences. By
transform or
transformation is meant a permanent or transient genetic change induced in a
cell
following incorporation of new DNA (e.g., DNA exogenous to the cell). Where
the cell
is a mammalian cell, a permanent genetic change is generally achieved by
introduction
10 of the DNA into the genome of the cell. A transformed cell or host cell
generally refers
to a cell (e.g., prokaryotic or eukaryotic) into which (or into an ancestor of
which) has
been introduced, by means of recombinant DNA techniques, a DNA molecule not
normally present in the host organism.
A particularly type of vector for use in the invention contains an f factor
origin
15 replication. The f factor (or fertility factor) in E. coli is a plasmid
which effects high
frequency transfer of itself during conjugation and less frequent transfer of
the bacterial
chromosome itself. In a particular embodiment cloning vectors referred to as
"fosmids"
or bacterial artificial chromosome (BAC) vectors are used. These are derived
from E.
coli f factor which is able to stably integrate large segments of DNA. When
integrated
20 with DNA from a mixed uncultured environmental sample, this makes it
possible to
achieve large genomic fragments in the form of a stable environmental gene
library.
The nucleic acids derived from a mixed population or sample may be inserted
into the vector by a variety of procedures. In general, the nucleic acid
sequence is
inserted into an appropriate restriction endonuclease sites) by procedures
known in the
25 art. Such procedures and others are deemed to be within the scope of those
skilled in the
art. A typical cloning scenario may have DNA "blunted" with an appropriate
nuclease
(e.g., Mung Bean Nuclease), methylated with, for example, EcoR I Methylase and
ligated to EcoR Ilinkers GGAATTCC (SEQ m NO:1). The linkers are then digested
with an EcoR I Restriction Endonuclease and the DNA size fractionated (e.g.,
using a
sucrose gradient). The resulting size fractionated DNA is then ligated into a
suitable
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
26
vector for sequencing, screening or expression (e.g., a lambda vector and
packaged using
an in vitt~o lambda packaging extract).
Transformation of a host cell with recombinant DNA may be carried out by
conventional techniques as are well known to those skilled in the art. Where
the host is
prokaryotic, such as E. coli, competent cells which are capable of DNA uptake
can be
prepared from cells harvested after exponential growth phase and subsequently
treated
by the CaCl2 method by procedures well known in the art. Alternatively, MgCl2
or RbCl
can be used. Transformation can also be performed after forming a protoplast
of the host
cell or by electroporation.
When the host is a eukaryote, methods of transfection or transformation with
DNA include calcium phosphate co-precipitates, conventional mechanical
procedures
such as microinjection, electroporation, insertion of a plasmid encased in
liposomes, or
virus vectors, as well as others known in the art, may be used. Eukaryotic
cells can also
be cotransfected with a second foreign DNA molecule encoding a selectable
marker,
such as the herpes simplex thymidine kinase gene. Another method is to use a
eukaryotic viral vector, such as simian virus 40 (SV40) or bovine papilloma
virus, to
transiently infect or transform eukaryotic cells and express the protein.
(Eukaryotic Viral
Vectors, Cold Spring Harbor Laboratory, Gluzman ed., 1982). The eukaryotic
cell may
be a yeast cell (e.g., Saccha~omyces ceYevisiae), an insect cell (e.g.,
Drosophila sp.) or
may be a mammalian cell, including a human cell.
Eukaryotic systems, and mammalian expression systems, allow for post-
translational modifications of expressed mammalian proteins to occur.
Eukaryotic cells
which possess the cellulax machinery for processing of the primary transcript,
glycosylation, phosphorylation, or secretion of the gene product should be
used. Such
host cell lines may include, but are not limited to, CHO, VERO, BHK, HeLa,
COS,
MDCK, Jurkat, HEK-293, and WI38.
In one embodiment, once a library of clones is created using any number of
methods, including those describe above, the clones are resuspended in a
liquid media,
for example, a nutrient rich broth or other growth media known in the art.
Typically the
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
27
media is a liquid media which can be readily pipetted. One or more media types
containing at least one clone of the library is then introduced either
individually or
together as a mixture, into capillaries (all or a portion thereof) in a
capillary array.
In another embodiment, the library is first biopanned prior to introduction or
delivery into a capillary device or other screening techniques. Such
biopanning methods
enrich the library for sequences or activities of interest. Examples of
methods for
biopanning or enrichment are described below.
In one embodiment, the library can be screened or sorted to enrich for clones
containing a sequence or activity of interested based on polynucleotide
sequences
present in the library or clone. Thus, the invention provides methods and
compositions
useful in screening organisms for a desired biological activity or biological
sequence and
to assist in obtaining sequences of interest that can further be used in
directed evolution,
molecular biology, biotechnology and industrial applications.
Accordingly, the invention provides methods to rapidly screen, enrich and/or
identify sequences in a sample by screening and identifying the nucleic acid
sequences
present in the sample. Thus, the invention increases the repertoire of
available sequences
that can be used for the development of diagnostics, therapeutics or molecules
for
industrial applications. Accordingly, the methods of the invention can
identify novel
nucleic acid sequences encoding proteins or polypeptides having a desired
biological
activity.
After the gene libraries (e.g., an expression library) have been generated one
can
include the additional step of "biopanning" such libraries prior to expression
screening.
The "biopanning" procedure refers to a process for identifying clones having a
specified
biological activity by screening for sequence homology in a library of clones.
The probe sequence used for selectively interacting with the target sequence
of
interest in the library can be a full-length coding region sequence or a
partial coding
region sequence for a known bioactivity. The library can be probed using
mixtures of
probes comprising at least a portion of the sequence encoding a known
bioactivity or
having a desired bioactivity. These probes or probe libraries are preferably
single-
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
28
stranded. In one embodiment, the library is preferably'been converted into
single-
stranded form. The probes that are particularly suitable are those derived
from DNA
encoding bioactivities having an activity similar or identical to the
specified bioactivity
wluch is to be screened. The probes can be used to PCR amplify and thus select
target
sequences. Alternatively, the probe sequences can be used as hybridization
probes
which can be used to identify sequences with substantial or a desired
homology.
In another embodiment, ih vivo biopanning may be performed utilizing a
FACS-based machine. gene libraries or expression libraries axe constructed
with
vectors which contain elements which stabilize transcribed RNA. For example,
the
inclusion of sequences which result in secondary structures such as hairpins
which are
designed to flank the transcribed regions of the RNA would serve to enhance
their
stability, thus increasing their half life within the cell. The probe
molecules used in
the biopanning process consist of oligonucleotides labeled with detectable
molecules
that provide a detectable signal upon interaction with a target sequence
(e.g., only
fluoresce upon.binding of the probe to a target molecule). Various dyes or
stains well
known in the art, for example those described in "Practical Flow Cytometry",
1995
Wiley-Liss, Inc., Howard M. Shapiro, M.D., can be used to intercalate or
associate
with nucleic acid in order to "label" the oligonucleotides. These probes are
introduced into the recombinant cells of the library using one of several
transformation methods. The probe molecules interact or hybridize to the
transcribed
target mRNA or DNA resulting in DNA/RNA heteroduplex molecules or DNA/DNA
duplex molecules. Binding of the probe to a target will yield a detectable
signal (e.g.,
a fluorescent signal) which is detected and sorted by a FACS machine, or the
like,
during the screening process.
The probe DNA should be at least about 10 bases and preferably at least 15
bases. In one embodiment, an entire coding region of one part of a pathway may
be
employed as a probe. Where the probe is hybridized to the target DNA in an iya
vitro
system, conditions for the hybridization in which target DNA is selectively
isolated by
the use of at least one DNA probe will be designed to provide a hybridization
stringency
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
29
of at least about 50% sequence identity, more particularly a stringency
providing for a
sequence identity of at least about 70%.
Hybridization techniques for probing a microbial DNA library to isolate target
DNA of potential interest are well known in the art and any of those which are
described
in the literature are suitable for use herein including, for example, chip-
based assays,
membrane-based assays, and the like.
The resultant libraries of transformed clones can then be further screened for
clones which display an activity of interest. Clones can be shuttled in
alternative hosts
for expression of active compounds, or screened using methods described
herein.
An alternative to the in vivo biopanning described above is an encapsulation
techniques such as, for example, gel microdroplets, which may be employed to
localize
multiple clones in one location to be screened on a FAGS machine. Clones can
then be
broken out into individual clones to be screened again on a FAGS machine to
identify
positive individual clones. Screening in this manner using a FACS machine is
fully
,sdescribed in patent application Ser. No. 08/876,276 filed Jun. 16, 1997.
Thus, for
example, if a clone mixture has a desirable activity, then the individual
clones may be
recovered and rescreened utilizing a FAGS machine to determine which of such
clones
has the specified desirable activity.
Different types of encapsulation strategies and compounds or polymers can be
used with the present invention. For instance, high temperature agarose can be
employed for making microdroplets stable at high temperatures, allowing stable
encapsulation of cells subsequent to heat-kill steps utilized to remove all
background
activities when screening for thermostable bioactivities. Encapsulation can be
in beads,
high temperature agaroses, gel microdroplets, cells, such as ghost red blood
cells or
macrophages, liposomes, or any other means of encapsulating and localizing
molecules.
For example, methods of preparing liposomes have been described (e.g., U.S.
Patent No.'s 5,653,996, 5393530 and 5,651,981), as well as the use of
liposomes to
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
encapsulate a variety of molecules (e.g., U.S. Patent Nos. 5,595,756,
5,605,703,
5,627,159, 5,652,225, 5,567,433, 4,235,871, 5,227,170). Entrapment ofproteins,
viruses, bacteria and DNA in erythrocytes during endocytosis has been
described, as
well (see, for example, Journal of Applied Biochemistry 4, 418-435 (1982)).
Erythrocytes employed as carriers in vitro or in vivo for substances entrapped
during
hypo-osmotic lysis or dielectric breakdown of the membrane have also been
described
(reviewed in Ihler, G. M. (1983) J. Pharm. Ther). These techniques are useful
in the
present invention to encapsulate samples in a microenvironment for screening.
10 "Microenvironment," as used herein, is any molecular structure which
provides an appropriate environment for facilitating the interactions
necessary for the
method of the invention. An environment suitable for facilitating molecular
interactions include, for example, liposomes. Liposomes can be prepared from a
variety of lipids including phospholipids, glycolipids, steroids, long-chain
alkyl esters;
15 e.g., alkyl phosphates, fatty acid esters; e.g., lecithin, fatty amines and
the like. A
mixture of fatty material may be employed such a combination of neutral
steroid, a
charge amphiphile and a phospholipid. Illustrative examples of phospholipids
include
lecithin, sphingomyelin and dipalmitoylphos-phatidylcholine. Representative
steroids
include cholesterol, cholestanol and lanosterol. Representative charged
amphiphilic
20 compounds generally contain from 12-30 carbon atoms. Mono- or dialkyl
phosphate
esters, or alkyl amines; e.g., dicetyl phosphate, stearyl amine, hexadecyl
amine,
dilauryl phosphate, and the like.
Further, it is possible to combine some or all of the above embodiments such
25 that a normalization step is performed prior to generation of the
expression library, the
expression library is then generated, the expression library so generated is
then
biopanned, and the biopanned expression library is then screened using a high
throughput cell sorting and screening instrument. Thus there are a variety of
options,
including: (i) generating the library and then screen it; (ii) normalize the
target DNA,
30 generate the library and screen it; (iii) normalize, generate the library,
biopan and
screen; or (iv) generate, biopan and screen the library. The nucleic acids
used to
generate a library can be obtained, for example, from environmental samples,
mixed
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
31
populations of organisms (e.g., cultured or uncultured), enriched populations
thereof,
and isolates thereof. In addition, the screening techniques include, for
example,
hybridization screening, PCR screening, expression screening, and the like.
The gel microdroplet technology has had significance in amplifying the signals
available in flow cytometric analysis, and in permitting the screening of
microbial strains
in strain improvement programs for biotechnology. Wittrup et al.,
(Biotechnolo.Bioeng.
(1993) 42:351-356) developed a microencapsulation selection method which
allows the
rapid and quantitative screening of >106 yeast cells for enhanced secretion of
Aspergillus
awamori glucoamylase. The method provides a 400-fold single-pass enrichment
for
high-secretion mutants.
Gel microdroplet or other related technologies can be used in the present
invention to localize, sort as well as amplify signals in the high throughput
screening of
recombinant libraries. Cell viability during the screening is not an issue or
concern since
nucleic acid can be recovered from the microdroplet.
Following any number of biopanning techniques capable of enriching the library
population for clones containing sequences of interest, the enriched clones
are suspended
in a liquid media such as a nutrient broth or other growth media. Accordingly,
the
enriched clones comprise a plurality of host cells transformed with constructs
comprising vectors into which have been incorporated nucleic acid sequences
derived
from a sample (e.g., mixed poulations of organisms, isolates thereof, and the
like).
Liquid media containing a subset of clones and one or more substrates having a
detectable molecule (e.g., an enzyme substrate) is then introduced or
contacted, either
individually or together as a mixture, with the enriched clones (e.g., into
capillaries iil a
capillary array). Interaction (including reaction) of the substrate and a
clone expressing
an enzyme having the desire enzyme activity produces a product or a detectable
signal,
which can be spatially detected to identify one or more clones or capillaries
containing at
least one signal-producing clone. The signal-producing clones or nucleic acids
contained in the signal-producing clone can then be recovered using any number
of
techniques.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
32
A "substrate" as used herein includes, for example, substrates for the
detection of
a bioactivity or biomolecule (e.g., an enzymes and their specific enzyme
activities).
Such substrates are well known in the art. For example, various enzymes and
suitable
substrates specific for such enzymes are provided in Molecular Probes,
Handbook Of
Fluorescent Probes and Research Chemical (Molecular Probes, Inc.; Eugene, OR),
the
disclosure of which is incorporated herein by reference. The substrate can
have a
detectable molecule associated with it including, for example, chromagenic or
fluorogenic molecules. A suitable substrate for use in the present invention
is any
substrate that produces an optically detectable signal upon interaction (e.g.,
reaction)
with a given enzyme having a desired activity, or a given clone encoding such
enzyme.
One skilled in the art can choose a suitable substrate based on a desired
enzyme
activity, for example. Examples of desired enzyneslenzymatic activities
include those
listed herein. A desired enzyme activity may also comprise a group of enzymes
in an
enzymatic pathway for which there exists an optical signal substrate. One
example of
this is the set of carotenoid synthesis enzymes.
Substrates are known and/or are commercially available for glycosidases,
proteases, phosphtases, and monoxygenases, among others. Among the proteases
with
detectable (e.g., optical) signal substrates are the serine proteases --
trypsin and
chymotrypsin. Among the glucosidases are mannosidase, amyloglucosidase,
cellulase,
neuraminidase, beta-galactosidase, beta-glucosidase, beta-glucouronidase and
alpha-
amylase.
Where the desired activity is in the same class as that of other biomolecules
or
enzymes having a number known substrates, the activity can be examined using a
cocktail of the known substrates. For example, substrates are known for
approximately
20 commercially available esterases and the combination of these known
substrate can
provide detectable, if not optimal, signal production.
The optical signal substrate can be a chromogenic substrate, a fluorogenic
substrate, a bio-or chemi-luminescent substrate, or a fluorescence resonance
energy
transfer (FRET) substrate. The detectable species can be one which results
from
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
33
cleavage of the substrate or a secondary molecule which is so affected by the
cleavage or
other substrate/biomolecule interaction as to undergo a detectable change.
Innumerable
examples of detectable assay formats are known from the diagnostic arts which
use
immmunoassay, chromogenic assay, and labeled probe methodologies.
In one embodiment, the optical signal substrate can be a bio- or chemi-
luminescent substrate. Chemiluminescent substrates for several enzymes are
available
from Tropix (Bedford, MA). Among the enzymes having known chemiluminescent
substrates are alkaline phosphatase, beta-galactosidase, beta-glucouronidase,
and beta-
glucosidase.
In another embodiment, chromogenic substrates may be used, particularly for
certain enzymes such as hydrolytic enzymes. For example, the optical signal
substrate
can be an indolyl derivative, which is enyzmatically cleaved to yield a
chromogenic
product. Where chromogenic substrate are used, the optically detectable signal
is optical
absorbance (including changes in absorbance). In this embodiment, signal
detection can
be provided by an absorbance measurement using a spectrophotometer or the
like.
In another embodiment, a fluorogenic substrate is used, such that the
optically
detectable signal is fluorescence. Fluorogenic substrates provide high
sensitivity for
improved detection, as well as alternate detection modes. Hydroxy- and amino-
substituted coumarins are the most widely used fluorophores used for preparing
fluorogenic substrates. A typical coumarin-based fluorogenic substrate is 7-
hydroxycoumarin, commonly known as umbelliferone (Umb). Derivatives and
analogs
of umbelliferone are also used. Substrate based on derivative and analogs of
florescein
(such as FDG or C 12-FDG) and rhodamine are also used. Substrates derived from
resorufin (e.g., resorufin beta-D -galactopyranoside or resorufin beta-D-
glucouronide)
are particularly useful in the present invention. Resorufin-based substrates
are useful, for
example, in screening for glycosidases, hydrolases and dealkylases. Lipophilic
derivatives of the foregoing substrates (e.g., alkylated derivatives) may be
useful in
certain embodiments, since they generally load more readily into cells and may
tend to
associate with lipid regions of the cell. Fluorescein and resorufin are
available
commercially as alkylated derivatives that form products that are relatively
insoluble in
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
34
water (i. e., lipophilic). For example, fluorescence imaging can be performed
using C 12-
resorufm galactoside, produced by Molecular Probes (Eugene, OR) as a
substrate.
The particular fluorogenic substrate used may be chosen based on the enzymatic
activity being screened. For examples:
LipaseslesteYases. When screening for an enzyme having lipase or esterase
activity, an acylated derivatives of fluorescein in used. The fluorophore is
hydrolyzed
from the derivative to generate a signal.
Proteases. Enzymes having protease activity can be screened in the same way as
the esterases, with an amide bond cleaved instead of an ester. There are now
well over
100 different protease substrates available with an acylated fluorophore at
the scissile
bond. Rhodamine derivatives are generally used.
Monooxygenases (dealkylases). Several coumarin derivatives suitable as
monooxygenase substrates are commercially available. Typically, in these
substrates,
the hydroxylation of the ethyl group in the compound results in the release of
the
resorufm fluorophore.
Typically, the substrates are able to enter the cell and maintain its presence
within the cell for a period sufficient for analysis to occur (e.g., once the
substrate is in
the cell it does not "leak" back out before reacting with the enzyme being
screened to an
extend sufficient to produce a detectable response). Retention of the
substrate in the cell
can be enhanced by a variety of techniques. In one method, the substrate
compound is
structurally modified by addition of a hydrophobic (e.g., alkyl) tail. In
another
embodiment, a solvent, such as DMSO or glycerol, can be used to coat the
exterior of
the cell. Also the substrate can be administered to the cells at reduced
temperature,
which has been observed to retard leakage of substrates from cells. However,
entry of
the substrate into the cell is not necessary where, for example, the enzyme or
polypeptide
is secreted, present in a lysed cellular sample or the like, or where the
substrate can act
externally to the cell (e.g., an extracellular receptor-ligand complex).
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
The optical signal substrate can, in some embodiments, be a FRET substrate.
FRET is a spectroscopic method that can monitor proximity and relative angular
orientation of fluorophores. A fluorescent indicator system that uses FRET to
measure
the concentration of a substrate or products includes two fluorescent moieties
having
5 emission and excitation spectra that render one a "donor' fluorescent moiety
and the
other an "acceptor" fluorescent moiety. The two fluorescent moieties are
chosen such
that the excitation spectrum of the acceptor fluorescent moiety overlaps with
the
emission spectrum of the excited moiety (the donor fluorescence moiety). The
donor
moiety is excited by light of appropriate intensity within the excitation
spectrum of the
10 donor moiety and emits the absorbed energy as fluorescent light. When the
acceptor
fluorescent protein moiety is positioned to quench the donor moiety in the
excited state,
the fluorescence energy is transferred to the acceptor moiety, which can emit
a second
photon. The emission spectra of the donor and acceptor moieties have minimal
overlap
so that the two emissions can be distinguished. Thus, when acceptor emits
fluorescence
15 at longer wavelength that the donor, then the net steady state effect is
that the donor's
emission is quenched , and the acceptor now emits when excited at the donor's
absorption maximum.
The detectable or optical signal can be measured using, for example, a
fluoremeter (or the like) to detect fluorescence, including fluorescence
polarization,
20 time-resolved fluorescence or FRET. In general, excitation radiation, from
an excitation
source having a first wavelength, causes the excitation radiation to excite
the sample. In
response, fluorescence compounds in the sample emit radiation having a
wavelength that
is different from the excitation wavelength. Methods of performing assays on
fluorescent materials are well known in the art and are described, e.g., by
Lakowicz
25 (Principles of Fluorescence Spectroscopy, New York" Plenum Press, 1983) and
Herman
("Resonance energy transfer microscopy," in: Fluorescence Microscopy of Living
Cells
in Culture, Part B, Methods in Cell Biology, vol. 30, ed. Taylor & Wang, San
Diego,
Academic Press, 1989, pp. 219-243). Examples of fluorescence detection
techniques are
described in further detail below.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
36
In addition, several methods have been described in the literature for using
reporter genes to measure gene expression. Nolan et al. describes a technique
to analyze
beta-galactosidase expression in mammalian cells. This technique employs
fluorescein-
di-beta-D-glactopyranoside (FDG) as a substrate for beta-galactosidase, which
releases
fluorescein, a product that can be detected by its fluorescence emission upon
hydrolysis
(Nolan et al., 1991). Other fluorogenic substrates have been developed, such
as 5-
dodecanoylamino fluorescein di-beta-Dgalactopyranside (C12-FDG) (Molecular
Probes), which differs from FDG in that it is a lipophilic fluorescein
derivative that can
easily cross most cell membranes under physiological culture conditions.
The above-mentioned beta-galactosidase assays may be employed to screen
single E. coli cells, expressing recombinant beta-D-galactosidase isolated,
for example,
from a hyperthermophilic archaeon such as Sulfolobus solfataricus. Other
reporter
genes may be useful as substrates and are known for beta-glucouronidase,
allcaline
phosphatase, chloramphenical acetyltransferase (CAT) and luciferase.
The library may, for example, be screened for a specified enzyme activity.
For example, the enzyme activity screened for may be one or more of the six
IUB
classes; oxidoreductases, transferases, hydrolases, lyases, isomerases and
ligases. The
recombinant enzymes which are determined to be positive for one or more of the
ILTB
classes may then be rescreened for a more specific enzyme activity.
Alternatively, the library may be screened for a more specialized enzyme
activity. For example, instead of generically screening for hydrolase
activity, the
library may be screened for a more specialized activity, i.e. the type of bond
on which
the hydrolase acts. Thus, for example, the library may be screened to
ascertain those
hydrolases which act on one or more specified chemical functionalities, such
as: (a)
amide (peptide bonds), i. e. proteases; (b) ester bonds, i. e. esterases and
lipases; (c)
acetals, i.e., glycosidases and the like.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
37
As described with respect to one of the above aspects, the invention provides
a
process for activity screening of clones containing selected DNA derived from
a
microorganism which method includes:
screening a library for a biomolecule of interest or bioactivity of interest,
wherein
the library includes a plurality of clones, the clones having been prepared by
recovering
nucleic acids (e.g., genomic DNA) from a mixed population of organisms,
enriched
populations thereof, or isolates thereof, and transforming a host with the
nucleic acids to
produce clones which are screened for the biomolecule or bioactivity of
interest.
In another embodiment, an enrichment step may be used before activity based
screening. The enrichment step can be, for example, a biopanning method. This
procedure of "biopanning" is described and exemplified in U.S. Patent No.
6,054,002,
issued April 25, 2000, which is incorporated herein by reference.
1n another embodiment, polynucleotides are contained in clones, the clones
having been prepared from nucleic acid sequences of a mixed population of
organisms,
wherein the nucleic acid sequences are used to prepare a gene library of the
mixed
population of organisms. The gene library is screened for a sequence of
interest by
transfecting a host cell containing the library with at least one nucleic acid
sequence
having a detectable molecule which is all or a portion of a DNA sequence
encoding a
bioactivity having a desirable activity and separating the library clones
containing the
desirable sequence by, for example, a fluorescent based analysis.
The present invention offers the ability to screen for many types of
bioactivities.
For instance, the ability to select and combine desired components from a
library of
polyketides and postpolyketide biosynthesis genes for generation of novel
polyketides
for study is appealing. The methods) of the present invention make it possible
to and
facilitate the cloning of novel polyketide synthases, and other relevant
pathways or genes
encoding commercially relevant secondary metabolites, since one can generate
gene
libraries with clones containing large inserts (especially when using vectors
which can
accept large inserts, such as the f factor based vectors), which facilitates
cloning of gene
clusters.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
38
The biopanning approach described above can be used to create libraries
enriched with clones carrying sequences homologous to a given probe sequence.
Using
this approach libraries containing clones with inserts of up to 40 kbp can be
enriched
approximately 1,000 fold after each round of panning. This enables one to
reduce the
number of clones to be screened after 1 round of biopanning enrichment. This
approach
can be applied to create libraries enriched for clones carrying sequence of
interest related
to a bioactivity of interest for example polyketide sequences.
Hybridization screening using high density filters or biopanning has proven an
efficient approach to detect homologues of pathways containing conserved
genes. To
discover novel bioactive molecules that may have no known counterparts,
however,
other approaches are necessary. Another approach of the present invention is
to screen in
E. c~li for the expression of small molecule ring structures or "backbones".
Because the
genes encoding these polycyclic structures can often be expressed in E. colt
the small
molecule backbone can be manufactured albeit in an inactive form. Bioactivity
is
conferred upon transferring the molecule or pathway to an appropriate host
that
expresses the requisite glycosylation and methylation genes that can modify or
"decorate" the structure to its active form. Thus, inactive ring compounds,
recombinantly
expressed in E. colt are detected to identify clones which are then shuttled
to a
metabolically rich host, such as Streptomyces, for subsequent production of
the bioactive
molecule. The use of high throughput robotic systems allows the screening of
hundreds
of thousands of clones in multiplexed arrays in microtiter dishes.
One approach to detect and enrich for clones carrying these structures is to
use
the capillary screening methods or FACS screening, a procedure described and
exemplified in U.S. Ser. No. 08/876,276, filed Jun. 16, 1997. Polycyclic ring
compounds
typically have characteristic fluorescent spectra when excited by ultraviolet
light. Thus,
clones expressing these structures can be distinguished from background using
a
sufficiently sensitive detection method. For example, high throughput FAGS
screening
can be utilized to screen for small molecule backbones in E. colt libraries.
Commercially
available FACS machines are capable of screening up to 100,000 clones per
second for
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
39
LJV active molecules. These clones can be sorted for further FACS screening or
the
resident plasmids can be extracted and shuttled to Streptomyces for activity
screening.
In an alternate screening approach, after shuttling to Streptomyces hosts,
organic
extracts from candidate clones can be tested for bioactivity by susceptibility
screenng
against test organisms such as Staphylococcus aureus, E. coli, or
Saccha~ornyces
cervisiae. FACS screening can be used in this approach by co-encapsulating
clones with
the test organism.
An alternative to the above-mentioned screening methods provided by the
present invention is an approach termed "mixed extract" screening. The "mixed
extract"
screening approach takes advantage of the fact that the accessory genes needed
to confer
activity upon the polycyclic backbones are expressed in metabolically rich
hosts, such as
Streptomyces, and that the enzymes can be extracted and combined with the
backbones
extracted from E. coli clones to produce the bioactive compound iu vitro.
Enzyme
extract preparations from metabolically rich hosts, such as Streptomyces
strains, at
various growth stages are combined with pools of organic extracts from E. coli
libraries
and then evaluated for bioactivity.
Another approach to detect activity in the E. coli clones is to screen for
genes
that can convert bioactive compounds to different forms. For example, a
recombinant
enzyme was recently discovered that can convert the low value daunomyciri to
the
higher value doxorubicin. Similar enzyme pathways are being sought to convert
penicillins to cephalosporins.
Capillary screening, for example, can also be used to detect expression of UV
fluorescent molecules in metabolically rich hosts, such as Streptomyces.
Recombinant
oxytetracylin retains its diagnostic red fluorescence when produced
heterologously in S.
lividarzs TK24. Pathway clones, which can be identified by the methods and
systems of
the invention, can thus be screened for polycyclic molecules in a high
throughput
fashion.
Recombinant bioactive compounds can also be screened ifz vivo using "two-
hybrid" systems, which can detect enhancers and inhibitors of protein-protein
or other
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
interactions such as those between transcription factors and their activators,
or receptors
and their cognate targets. In this embodiment, both a small molecule pathway
and a GFP
reporter construct are co-expressed. Clones altered in GFP expression can then
be
identified and the clone isolated for characterization.
5 As indicated, common approaches to drug discovery involve screening assays
in
which disease targets (macromolecules implicated in causing a disease) are
exposed to
potential drug candidates which are tested for therapeutic activity. In other
approaches,
whole cells or organisms that are representative of the causative agent of the
disease,
such as bacteria or tumor cell lines, are exposed to the potential candidates
for screening
10 purposes. Any of these approaches can be employed with the present
invention.
The present invention also allows for the transfer of cloned pathways derived
from uncultivated samples into metabolically rich hosts for heterologous
expression and
downstream screening for bioactive compounds of interest using a variety of
screening
approaches briefly described above.
15 After viable or non-viable cells, each containing a different expression
clone
from the gene library are screened, and positive clones are recovered, DNA can
be
isolated from positive clones utilizing techniques well known in the art. The
DNA can
then be amplified either ih vivo or in vitro by utilizing any of the various
amplification
techniques known in the art. In vivo amplification would include
transformation of the
20 clones) or subclone(s) into a viable host, followed by growth of the host.
In vitro
amplification can be performed using techniques such as the polymerase chain
reaction.
Once amplified the identified sequences can be "evolved" or sequenced.
One advantage afforded by present invention is the ability to manipulate the
identified biomolecules or bioactivities to generate and select for encoded
variants with
25 altered sequence, activity or specificity.
Clones found to have biomolecules or bioactivities for wluch the screen was
performed can be subjected to directed mutagenesis to develop new biomolecules
or
bioactivities with desired properties or to develop modified biomolecules or
bioactivities
with particularly desired properties that are absent or less pronounced in
nature (e.g.,
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
41
wild-type activity), such as stability to heat or organic solvents. Any of the
known
techniques for directed mutagenesis are applicable to the invention. For
example,
particularly preferred mutagenesis techniques for use in accordance with the
invention
include those described below.
Alternatively, it may be desirable to variegate a biomolecule (e.g., a
peptide,
protein, or polynucleotide sequence) or a bioactivity (e.g., an enzymatic
activity)
obtained, identified or cloned as described herein. Such variegation can
modify the
biomolecule or bioactivity in order to increase or decrease, for example, a
polypeptide's
activity, specificity, affinity, function, and the like. DNA shuffling can be
used to
increase variegation in a particular sample. DNA shuffling is meant to
indicate
recombination between substantially homologous but non-identical sequences, in
some
embodiments DNA shuffling may involve crossover via non-homologous
recombination, such as via cer/lox andlor flp/frt systems and the like (see,
for example,
U.S. Patent No. 5,939,250, issued to Dr. Jay Short on August 17, 1999, and
assigned to
Diversa Corporation, the disclosure of which is incorporated herein by
reference).
Various methods for shuffling, mutating or variegating polynucleotide or
polypeptide
sequences are discussed below.
Nucleic acid shuffling is a method for ih vitro or if2 vivo homologous
recombination of pools of shorter or smaller polynucleotides to produce a
polynucleotide or polynucleotides. Mixtures of related nucleic acid sequences
or
polynucleotides are subjected to sexual PCR to provide random polynucleotides,
and
reassembled to yield a library or mixed population of recombinant hybrid
nucleic acid
molecules or polynucleotides. In contrast to cassette mutagenesis, only
shuffling and
error-prone PCR allow one to mutate a pool of sequences blindly (without
sequence
information other than primers).
The advantage of the mutagenic shuffling of the invention over error-prone
PCR alone for repeated selection can best be explained as follows. Consider
DNA
shuffling as compared with error-prone PCR (not sexual PCR). The initial
library of
selected or pooled sequences can consist of related sequences of diverse
origin or can
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
42
be derived by any type of mutagenesis (including shuffling) of a single gene.
A
collection of selected sequences is obtained after the first round of activity
selection.
Shuffling allows the free combinatorial association of all of the related
sequences, for
example.
This method differs from error-prone PCR, in that it is an inverse chain
reaction. In error-prone PCR, the number of polymerase start sites and the
number of
molecules grows exponentially. However, the sequence of the polymerase start
sites
and the sequence of the molecules remains essentially the same. In contrast,
in
nucleic acid reassembly or shuffling of random polynucleotides the number of
start
sites and the number (but not size) of the random polynucleotides decreases
over time.
For polynucleotides derived from whole plasmids the theoretical endpoint is a
single,
large concatemeric molecule.
Since cross-overs occur at regions of homology, recombination will primarily
occur between members of the same sequence fanuly. This discourages
combinations
of sequences that are grossly incompatible (e.g., having different activities
or
specificities). It is contemplated that multiple families of sequences can be
shuffled in
the same reaction. Further, shuffling generally conserves the relative order.
Rare shufflants will contain a large number of the best molecules (e.g.,
highest
activity or specificity) and these rare shufflants may be selected based on
their
superior activity or specificity.
A pool of 100 different polypeptide sequences can be permutated in up to 103
different ways. This large number of permutations cannot be represented in a
single
library of DNA sequences. Accordingly, it is contemplated that multiple cycles
of
DNA shuffling and selection may be required depending on the length of the
sequence and the sequence diversity desired. Error-prone PCR, in contrast,
keeps all
the selected sequences in the same relative orientation, generating a much
smaller
mutant cloud.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
43
The template polynucleotide which may be used in the methods of the
invention may be DNA or RNA. It may be of various lengths depending on the
size
of the gene or shorter or smaller polynucleotide to be recombined or
reassembled.
Preferably, the template polynucleotide is from 50 by to 50 kb. It is
contemplated that
entire vectors containing the nucleic acid encoding the protein of interest
can be used
in the methods of the invention, and in fact have been successfully used.
The template polynucleotide may be obtained by amplification using the PCR
reaction (US Patent Nos. 4,683,202 and 4,683,195) or other amplification or
cloning
methods. However, the removal of free primers from the PCR products before
subjecting them to pooling of the PCR products and sexual PCR may provide more
efficient results. Failure to adequately remove the primers from the original
pool
before sexual PCR can lead to a low frequency of crossover clones.
The template polynucleotide often is double-stranded. A double-stranded
nucleic acid molecule is recommended to ensure that regions of the resulting
single-stranded polynucleotides are complementary to each other and thus can
hybridize to form a double-stranded molecule.
It is contemplated that single-stranded or double-stranded nucleic acid
polynucleotides having regions of identity to the template polynucleotide and
regions
of heterology to the template polynucleotide may be added to the template
polynucleotide, at this step. It is also contemplated that two different but
related
polynucleotide templates can be mixed at this step.
The double-stranded polynucleotide template and any added double-or
single-stranded polynucleotides are subjected to sexual PCR which includes
slowing
or halting to provide a mixture of from about 5 by to 5 kb or more. Preferably
the size
of the random polynucleotides is from about 10 by to 1000 bp, more preferably
the
size of the polynucleotides is from about 20 by to 500 bp.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
44
Alternatively, it is also contemplated that double-stranded nucleic acid
having
multiple nicks may be used in the methods of the invention. A nick is a break
in one
strand of the double-stranded nucleic acid. The distance between such nicks is
preferably 5 by to 5 kb, more preferably between 10 by to 1000 bp. This can
provide
areas of self priming to produce shorter or smaller polynucleotides to be
included
with the polynucleotides resulting from random primers, for example.
The concentration of any one specific polynucleotide will not be greater than
1% by weight of the total polynucleotides, more preferably the concentration
of any
one specific nucleic acid sequence will not be greater than 0.1% by weight of
the total
nucleic acid.
The number of different specific polynucleotides in the mixture will be at
least
about 100, preferably at least about 500, and more preferably at least about
1000.
At this step single-stranded or double-stranded polynucleotides, either
synthetic or natural, may be added to the random double-stranded shorter or
smaller
polynucleotides in order to increase the heterogeneity of the mixture of
polynucleotides.
It is also contemplated that populations of double-stranded randomly broken
polynucleotides may be mixed or combined at this step with the polynucleotides
from
the sexual PCR process and optionally subjected to one or more additional
sexual
PCR cycles.
Where insertion of mutations into the template polynucleotide is desired,
single-stranded or double-stranded polynucleotides having a region of identity
to the
template polynucleotide and a region of heterology to the template
polynucleotide
may be added in a 20 fold excess by weight as compared to the total nucleic
acid,
more preferably the single-stranded polynucleotides may be added in a 10 fold
excess
by weight as compared to the total nucleic acid.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
Where a mixture of different but related template polynucleotides is desired,
populations of polynucleotides from each of the templates may be combined at a
ratio
of less than about 1:100, more preferably the ratio is less than about 1:40.
For
example, a backcross of the wild-type polynucleotide with a population of
mutated
5 polynucleotide may be desired to eliminate neutral mutations (e.g.,
mutations yielding
an insubstantial alteration in the phenotypic property being selected for). In
such an
example, the ratio of randomly provided wild-type polynucleotides which may be
added to the randomly provided sexual PCR cycle hybrid polynucleotides is
approximately 1:1 to about 100:1, and more preferably from 1:l to 40:1.
The mixed population of random polynucleotides are denatured to form
single-stranded polynucleotides and then re-annealed. Only those single-
stranded
polynucleotides having regions of homology with other single-stranded
polynucleotides will re-anneal.
The random polynucleotides may be denatured by heating. One skilled in the
art could determine the conditions necessary to completely denature the double-
stranded nucleic acid. Preferably the temperature is from ~0 °C to 100
°C, more
preferably the temperature is from 90 °C to 96 °C. ~ther methods
which may be used
to denature the polynucleotides include pressure and pH.
The polynucleotides may be re-amlealed by cooling. Preferably the
temperature is from 20 °C to 75 °C, more preferably the
temperature is from 40 °C to
65 °C. If a high frequency of crossovers is needed based on an average
of only 4
consecutive bases of homology, recombination can be forced by using a low
annealing temperature, although the process becomes more difficult. The degree
of
renaturation which occurs will depend on the degree of homology between the
population of single-stranded polynucleotides.
Renaturation can be accelerated by the addition of polyethylene glycol
("PEG") or salt. The salt concentration is preferably from 0 mM to 200 mM,
more
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
46
preferably the salt concentration is from 10 mM to 100 mm. The salt may be KC1
or
NaCI. The concentration of PEG is preferably from 0% to 20%, more preferably
from
5% to 10%.
The annealed polynucleotides are next incubated in the presence of a nucleic
acid polymerase and dNTP's (i.e. dATP, dCTP, DGTP and dTTP). The nucleic acid
polymerase may be the I~lenow fragment, the Taq polymerase or any other DNA
polymerase known in the art.
The approach to be used for the assembly depends on the minimum degree of
homology that should still yield crossovers. If the areas of identity are
large, Taq
polymerase can be used with an annealing temperature of between 45-65
°C. If the
areas of identity are small, I~lenow polymerase can be used with an annealing
temperature of between 20-30 °C. One skilled in the art could vary the
temperature of
annealing to increase the number of cross-overs achieved.
The polymerase may be added to the random polynucleotides prior to
annealing, simultaneously with annealing or after annealing.
The cycle of denaturation, renaturation and incubation in the presence of
polymerase is referred to herein as shuffling or reassembly of the nucleic
acid. This
cycle is repeated for a desired number of times. Preferably the cycle is
repeated from
2 to 50 times, more preferably the sequence is repeated from 10 to 40 times.
The resulting nucleic acid is a larger double-stranded polynucleotide of from
about 50 by to about 100 kb, preferably the larger polynucleotide is from 500
by to 50
kb.
This larger polynucleotides may contain a number of copies of a
polynucleotide having the same size as the template polynucleotide in tandem.
This
concatemeric polynucleotide is then denatured into single copies of the
template
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
47
polynucleotide. The result will be a population of polynucleotides of
approximately
the same size as the template polynucleotide. The population will be a mixed
population where single or double-stranded polynucleotides having an area of
identity
and an area of heterology have been added to the template polynucleotide prior
to
shuffling. These polynucleotides are then cloned into the appropriate vector
and the
ligation mixture used to transform bacteria.
It is contemplated that the single polynucleotides may be obtained from the
larger concatemeric polynucleotide by amplification of the single
polynucleotide prior
to cloning by a variety of methods including PCR (IJS Patent Nos. 4,683,195
and
4,683,202), rather than by digestion of the concatemer.
The vector used for cloning is not critical provided that it will accept a
polynucleotide of the desired size. If expression of the particular
polynucleotide is
desired, the cloning vehicle should further comprise transcription and
translation
signals next to the site of insertion of the polynucleotide to allow
expression of the
polynucleotide in the host cell.
The resulting bacterial population will include a number of recombinant
polynucleotides having random mutations. This mixed population may be tested
to
identify the desired recombinant polynucleotides. The method of selection will
depend on the polynucleotide desired.
For example, if a polynucleotide, identified by the methods of described
herein, encodes a protein with a first binding affinity, subsequent mutated
(e.g.,
shuffled) sequences having an increased binding efficiency to a ligand may be
desired. In such a case the proteins expressed by each of the portions of the
polynucleotides in the population or library may be tested for their ability
to bind to
the ligand by methods known in the art (i.e. panning, affinity
chromatography). If a
polynucleotide which encodes for a protein with increased drug resistance is
desired,
the proteins expressed by each of the polynucleotides in the population or
library may
be tested for their ability to confer drug resistance to the host organism.
One skilled
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
4~
in the art, given knowledge of the desired protein, could readily test the
population to
identify polynucleotides which confer the desired properties onto the protein.
It is contemplated that one skilled in the art could use a phage display
system
in which fragments of the protein are expressed as fusion proteins on the
phage
surface (Pharmacia, Milwaukee WI). The recombinant DNA molecules are cloned
into the phage DNA at a site which results in the transcription of a fusion
protein a
portion of which is encoded by the recombinant DNA molecule. The phage
containing the recombinant nucleic acid molecule undergoes replication and
transcription in the cell. The leader sequence of the fusion protein directs
the
transport of the fusion protein to the tip of the phage particle. Thus, the
fusion protein
which is partially encoded by the recombinant DNA molecule is displayed on the
phage particle for detection and selection by the methods described above.
It is further contemplated that a number of cycles of nucleic acid shuffling
may be conducted with polynucleotides from a sub-population of the first
population,
which sub-population contains DNA encoding the desired recombinant protein. In
this manner, proteins with even higher binding affinities or enzymatic
activity could
be achieved.
It is also contemplated that a number of cycles of nucleic acid shuffling may
be conducted with a mixture of wild-type polynucleotides and a sub-population
of
nucleic acid from the first or subsequent rounds of nucleic acid shuffling in
order to
remove any silent mutations from the sub-population.
Any source of nucleic acid, in a purified form can be utilized as the starting
nucleic acid. Thus the process may employ DNA or RNA including messenger RNA,
which DNA or RNA may be single or double stranded. In addition, a DNA-RNA
hybrid which contains one strand of each may be utilized. The nucleic acid
sequence
may be of various lengths depending on the size of the nucleic acid sequence
to be
mutated. Preferably the specific nucleic acid sequence is from 50 to 50,000
base
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
49
pairs. It is contemplated that entire vectors containing the nucleic acid
encoding the
protein of interest may be used in the methods of the invention.
Any specific nucleic acid sequence can be used to produce the population of
hybrids by the present process. It is only necessary that a small population
of hybrid
sequences of the specific nucleic acid sequence exist or be available for the
present
process.
A population of specific nucleic acid sequences having mutations may be
created by a number of different methods. Mutations may be created by error-
prone
PCR. Error-prone PCR uses low-fidelity polymerization conditions to introduce
a
low level of point mutations randomly over a long sequence. Alternatively,
mutations
can be introduced into the template polynucleotide by oligonucleotide-directed
mutagenesis. In oligonucleotide-directed mutagenesis, a short sequence of the
polynucleotide is removed from the polynucleotide using restriction enzyme
digestion
and is replaced with a synthetic polynucleotide in which various bases have
been
altered from the original sequence. The polynucleotide sequence can also be
altered
by chemical mutagenesis. Chemical mutagens include, for example, sodium
bisulfite,
nitrous acid, hydroxylamine, hydrazine or formic acid. other agents which are
analogues of nucleotide precursors include nitrosoguanidine, 5-bromouracil,
2-aminopurine, or acridine. Generally, these agents are added to the PCR
reaction in
place of the nucleotide precursor thereby mutating the sequence. Intercalating
agents
such as proflavine, acriflavine, quinacrine and the like can also be used.
Random
mutagenesis of the polynucleotide sequence can also be achieved by irradiation
with
X-rays or ultraviolet light. Generally, plasmid polynucleotides so mutagenized
are
introduced into E. coli and propagated as a pool or library of hybrid
plasmids.
Alternatively, a small mixed population of specific nucleic acids may be found
in nature in that they may consist of different alleles of the same gene or
the same
gene from different related species (i.e., cognate genes). Alternatively, they
may be
related DNA sequences found within one species, for example, the
immunoglobulin
genes.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
Once a mixed population of specific nucleic acid sequences is generated, the
polynucleotides can be used directly or inserted into an appropriate cloning
vector,
using techniques well-known in the art.
5
The choice of vector depends on the size of the polynucleotide sequence and
the host cell to be employed in the methods of the invention. The templates of
the
invention may be plasmids, phages, cosmids, phagemids, viruses (e.g.,
retroviruses,
parainfluenzavirus, herpesviruses, reoviruses, paramyxoviruses, and the like),
or
10 selected portions thereof (e.g., coat protein, spike glycoprotein, capsid
protein). For
example, cosmids and phagemids are preferred where the specific nucleic acid
sequence to be mutated is larger because these vectors axe able to stably
propagate
large polynucleotides.
15 If a mixed population of the specific nucleic acid sequence is cloned into.
a
vector it can be clonally amplified. Utility can be readily determined by
screening
expressed polypeptides.
The DNA shuffling method of the invention can be performed blindly on a
20 pool of unknown sequences. By adding to the reassembly mixture
oligonucleotides
(with ends that are homologous to the sequences being reassembled) any
sequence
mixture can be incorporated at any specific position into another sequence
mixture.
Thus, it is contemplated that mixtures of synthetic oligonucleotides, PCR
polynucleotides or even whole genes can be mixed into another sequence library
at
25 defined positions. The insertion of one sequence (mixture) is independent
from the
insertion of a sequence in another part of the template. Thus, the degree of
recombination, the homology required, and the diversity of the library can be
independently and simultaneously varied along the length of the reassembled
DNA.
30 Shuffling requires the presence of homologous regions separating regions of
diversity. Scaffold-like protein structures may be particularly suitable for
shuffling.
The conserved scaffold determines the overall folding by self association,
while
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
51
displaying relatively unrestricted loops that mediate the specific binding.
Examples
of such scaffolds are the immunoglobulin beta-barrel, and the four-helix
bundle which
are well-known in the art. This shuffling can be used to create scaffold-like
proteins
with various combinations of mutated sequences for binding.
The equivalents of some standard genetic matings may also be performed by
shuffling ih vitro. For example, a "molecular backcross" can be performed by
repeatedly mixing the hybrid's nucleic acid with the wild-type nucleic acid
while
selecting for the mutations of interest. As in traditional breeding, this
approach can be
used to combine phenotypes from different sources into a background of choice.
It is
useful, for example, for the removal of neutral mutations that affect
unselected
characteristics (e.g., immunogenicity). Thus it can be useful to determine
which
mutations in a protein are involved in the enhanced biological activity and
which are
not, an advantage which cannot be achieved by error-prone mutagenesis or
cassette
mutagenesis methods.
Large, functional genes can be assembled correctly from a mixture of small
random polynucleotides. This reaction may be of use for the reassembly of
genes
from the highly fragmented DNA of fossils. In addition random nucleic acid
fragments from fossils may be combined with polynucleotides from similar genes
from related species.
It is also contemplated that the method of the invention can be used for the
ira
vitro amplification of a whole genome from a single cell as is needed for a
variety of
research and diagnostic applications. DNA amplification by PCR typically
includes
sequences of about 40 kb. Amplification of a whole genome such as that of E.
coli (5,
000 kb) by PCR would require about 250 primers yielding 125 forty kb
polynucleotides. On the other hand, random production of polynucleotides of
the
genome with sexual PCR cycles, followed by gel purification of small
polynucleotides will provide a multitude of possible primers. Use of this mix
of
random small polynucleotides as primers in a PCR reaction alone or with the
whole
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
52
genome as the template should result in an inverse chain reaction with the
theoretical
endpoint of a single concatamer containing many copies of the genome.
A 100 fold amplification in the copy number and an average polynucleotide
size of greater than 50 kb may be obtained when only random polynucleotides
are
used. It is thought that the larger concatamer is generated by overlap of many
smaller
polynucleotides. The quality of specific PCR products obtained using synthetic
primers will be indistinguishable from the product obtained from unamplified
DNA.
It is expected that this approach will be useful for the mapping of genomes.
The polynucleotide to be shuffled can be produced as random or non-random
polynucleotides, at the discretion of the practitioner. Moreover, the
invention
provides a method of shuffling that is applicable to a wide range of
polynucleotide
sizes and types, including the step of generating polynucleotide monomers to
be used
as building blocks in the reassembly of a larger polynucleotide. For example,
the
building blocks can be fragments of genes or they can be comprised of entire
genes or
gene pathways, or any combination thereof.
In an embodiment of in vivo shuffling, a mixed population of a specific
nucleic acid sequence is introduced into bacterial or eukaryotic cells under
conditions
such that at least two different nucleic acid sequences are present in each
host cell.
The polynucleotides can be introduced into the host cells by a variety of
different
methods. The host cells can be transformed with the smaller polynucleotides
using
methods known in the art, for example treatment with calcium chloride. If the
polynucleotides are inserted into a phage genome, the host cell can be
transfected with
the recombinant phage genome having the specific nucleic acid sequences.
Alternatively, the nucleic acid sequences can be introduced into the host cell
using
electroporation, transfection, lipofection, biolistics, conjugation, and the
like.
In general, in this embodiment, specific nucleic acid sequences will be
present
in vectors which are capable of stably replicating the sequence in the host
cell. In
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
53
addition, it is contemplated that the vectors will encode a marker gene such
that host
cells having the vector can be selected. This ensures that the mutated
specific nucleic
acid sequence can be recovered after introduction into the host cell. However,
it is
contemplated that the entire mixed population of the specific nucleic acid
sequences
need not be present on a vector sequence. Rather only a sufficient number of
sequences need be cloned into vectors to ensure that after introduction of the
polynucleotides into the host cells each host cell contains one vector having
at least
one specific nucleic acid sequence present therein. It is also contemplated
that rather
than having a subset of the population of the specific nucleic acids sequences
cloned
into vectors, this subset may be already stably integrated into the host cell.
It has been found that when two polynucleotides which have regions of
identity are inserted into the host cells homologous recombination occurs
between the
two polynucleotides. Such recombination between the two mutated specific
nucleic
acid sequences will result in the production of double or triple hybrids in
some
situations.
It has also been found that the frequency of recombination is increased if
some
of the mutated specific nucleic acid sequences are present on linear nucleic
acid
molecules. Therefore, in a one embodiment, some of the specific nucleic acid
sequences are present on linear polynucleotides.
After transformation, the host cell transformants are placed under selection
to
identify those host cell transformants which contain mutated specific nucleic
acid
sequences having the qualities desired. For example, if increased resistance
to a
particular drug is desired then the transformed host cells may be subjected to
increased concentrations of the particular drug and those transformants
producing
mutated proteins able to confer increased drug resistance will be selected. If
the
enhanced ability of a particular protein to bind to a receptor is desired,
then
expression of the protein can be induced from the transformants and the
resulting
protein assayed in a ligand binding assay by methods known in the art to
identify that
subset of the mutated population which shows enhanced binding to the ligand.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
54
Alternatively, the protein can be expressed in another system to ensure proper
processing.
Once a subset of the first recombined specific nucleic acid sequences
(daughter sequences) having the desired characteristics are identified, they
are then
subject to a second round of recombination. In the second cycle of
recombination, the
recombined specific nucleic acid sequences may be mixed with the original
mutated
specific nucleic acid sequences (parent sequences) and the cycle repeated as
described
above. In this way a set of second recombined specific nucleic acids sequences
can
be identified which have enhanced characteristics or encode for proteins
having
enhanced properties. This cycle can be repeated a number of times as desired.
It is also contemplated that in the second or subsequent recombination cycle,
a
backcross can be performed. A molecular backcross can be performed by mixing
the
desired specific nucleic acid sequences with a large number of the wild-type
sequence, such that at least one wild-type nucleic acid sequence and a mutated
nucleic
acid sequence are present in the same host cell after transformation.
Recombination
with the wild-type specific nucleic acid sequence will eliminate those neutral
mutations that may affect unselected characteristics such as immunogenicity
but not
the selected characteristics.
In another embodiment of the invention, it is contemplated that during the
first
round a subset of specific nucleic acid sequences can be generated as smaller
polynucleotides by slowing or halting their PCR amplification prior to
introduction
into the host cell. The size of the polynucleotides must be large enough to
contain
some regions of identity with the other sequences so as to homologously
recombine
with the other sequences. The size of the polynucleotides will range from 0.03
kb to
100 kb more preferably from 0. 2 kb to 10 kb. It is also contemplated that in
subsequent rounds, all of the specific nucleic acid sequences other than the
sequences
selected from the previous round may be utilized to generate PCR
polynucleotides
prior to introduction into the host cells.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
The shorter polynucleotide sequences can be single-stranded or
double-stranded. The reaction conditions suitable for separating the strands
of nucleic
acid are well known in the art.
5 The steps of this process can be repeated indefinitely, being limited only
by
the number of possible hybrids which can be achieved.
Therefore, the initial pool or population of mutated template nucleic acid is
cloned into a vector capable of replicating in a bacteria such as E. coli. The
particular
10 vector is not essential, so long as it is capable of autonomous replication
in E. coli. In
a one embodiment, the vector is designed to allow the expression and
production of
any protein encoded by the mutated specific nucleic acid linked to the vector.
It is
also preferred that the vector contain a gene encoding for a selectable
marker.
15 The population of vectors containing the pool of mutated nucleic acid
sequences is introduced into the E. coli host cells. The vector nucleic acid
sequences
may be introduced by transformation, transfection or infection in the case of
phage.
The concentration of vectors used to transform the bacteria is such that a
number of
vectors is introduced into each cell. Once present in the cell, the efficiency
of
20 homologous recombination is such that homologous recombination occurs
between
the various vectors. This results in the generation of hybrids (daughters)
having a
combination of mutations which differ from the original parent mutated
sequences.
The host cells are then clonally replicated and selected for the marker gene
present on
the vector. Only those cells having a plasmid will grow under the selection.
The host
25 cells which contain a vector are then tested for the presence of favorable
mutations.
Once a particular daughter mutated nucleic acid sequence has been identified
which confers the desired characteristics, the nucleic acid is isolated either
already
linked to the vector or separated from the vector. This nucleic acid is then
mixed with
30 the first or parent population of nucleic acids and the cycle is repeated.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
56
The parent mutated specific nucleic acid population, either as polynucleotides
or cloned into the same vector is introduced into the host cells already
containing the
daughter nucleic acids. Recombination is allowed to occur in the cells and the
next
generation of recombinants, or granddaughters are selected by the methods
described
above. This cycle can be repeated a number of times until the nucleic acid or
peptide
having the desired characteristics is obtained. It is contemplated that in
subsequent
cycles, the population of mutated sequences which are added to the hybrids may
come
from the parental hybrids or any subsequent generation.
In an alternative embodiment, the invention provides a method of conducting a
"molecular" backcross of the obtained recombinant specific nucleic acid in
order to
eliminate any neutral mutations. Neutral mutations are those mutations which
do not
confer onto the nucleic acid or peptide the desired properties. Such mutations
may
however confer on the nucleic acid or peptide undesirable characteristics.
Accordingly, it is desirable to eliminate such neutral mutations. The method
of the
invention provide a means of doing so.
In this embodiment, after the hybrid nucleic acid, having the desired
characteristics, is obtained by the methods of.the embodiments, the nucleic
acid, the
vector having the nucleic acid or the host cell containing the vector and
nucleic acid is
isolated.
The nucleic acid or vector is then introduced into the host cell with a large
excess of the wild-type nucleic acid. The nucleic acid of the hybrid and the
nucleic
acid of the wild-type sequence are allowed to recombine. The resulting
recombinants
are placed under the same selection as the hybrid nucleic acid. ~nly those
recombinants which retained the desired characteristics will be selected. Any
silent
mutations which do not provide the desired characteristics will be lost
through
recombination with the wild-type DNA. This cycle can be repeated a number of
times until all of the silent mutations are eliminated.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
57
In a another embodiment, the invention provides for a method for shuffling,
assembling, reassembling, recombining, and/or concatenating at least two
polynucleotides to form a progeny polynucleotide (e.g., a chimeric progeny
polynucleotide that can be expressed to produce a polypeptide or a gene
pathway). In
a particular embodiment, a double stranded polynucleotide (e.g., two single
stranded
sequences hybridized to each other as hybridization partners) is treated with
an
exonuclease to liberate nucleotides from one of the two strands, leaving the
remaining
strand free of its original partner so that, if desired, the remaining strand
may be used
to achieve hybridization to another partner.
In a particular aspect, a double stranded polynucleotide end (that may be part
of - or connected to - a polynucleotide or a non-polynucleotide sequence) is
subjected
to a source of exonuclease activity. Enzyme with 3' exonuclease activity, an
enzyme
with 5' exonuclease activity, an enzyme.with both 3' exonuclease activity and
S'
exonuclease activity, and any combination thereof can be used in the
invention. An
exonuclease can be used to liberate nucleotides from one or both ends of a
linear
double stranded polynucleotide, and from one to all ends of a branched
polynucleotide having more than two ends.
By contrast, a non-enzymatic step may be used to shuffle, assemble,
reassemble, recombine, and/or concatenate polynucleotide building blocks that
is
comprised of subjecting a working sample to denaturing (or "melting")
conditions
(for example, by changing temperature, pH, and /or salinity conditions) so as
to melt a
working set of double stranded polynucleotides into single polynucleotide
strands.
For shuffling, it is desirable that the single polynucleotide strands
participate to some
extent in annealment with different hybridization partners (i.e. and not
merely revert
to exclusive re-annealment between what were former partners before the
denaturation step). The presence of the former hybridization partners in the
reaction
vessel, however, does not preclude, and may sometimes even favor, re-
annealment of
a single stranded polynucleotide with its former partner, to recreate an
original double
stranded polynucleotide.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
58
In contrast to this non-enzymatic shuffling step comprised of subjecting
double stranded polynucleotide building blocks to denaturation, followed by
annealinent, the invention further provides an exonuclease-based approach
requiring
no denaturation - rather, the avoidance of denaturing conditions and the
maintenance
of double stranded polynucleotide substrates in annealed (i. e. non-denatured)
state are
necessary conditions for the action of exonucleases (e.g., exonuclease III and
red
alpha gene product). In further contrast, the generation of single stranded
polynucleotide sequences capable of hybridizing to other single stranded
polynucleotide sequences is the result of covalent cleavage - and hence
sequence
destruction - in one of the hybridization partners. For example, an
exonuclease III
enzyme may be used to enzymatically liberate 3' terminal nucleotides in one
hybridization strand (to achieve covalent hydrolysis in that polynucleotide
strand);
and this favors hybridization of the remaining single strand to a new partner
(since its
former partner was subjected to covalent cleavage).
It is particularly appreciated that enzymes can be discovered, optimized
(e.g.,
engineered by directed evolution), or both discovered and optimized
specifically for
the instantly disclosed approach that have more optimal rates andlor more
highly
specific activities &/or greater lack of unwanted activities. In fact it is
expected that
the invention may encourage the discovery and/or development of such designer
enzymes.
Furthermore, it is appreciated that one can protect the end of a double
stranded
polynucleotide or render it susceptible to a desired enzymatic action of an
exonuclease as necessary. For example, a double stranded polynucleotide end
having
a 3' overhang is not susceptible to the exonuclease action of exonuclease III.
However, it may be rendered susceptible to the exonuclease action of
exonuclease III
by a variety of means; for example, it may be blunted by treatment with a
polymerase,
cleaved to provide a blunt end or a 5' overhang, joined (ligated or
hybridized) to
another double stranded polynucleotide to provide a blunt end or a 5'
overhang,
hybridized to a single stranded polynucleotide to provide a blunt end or a 5'
overhang,
or modified by any of a variety of means).
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
59
According to one aspect, an exonuclease may be allowed to act on one or on
both ends of a linear double stranded polynucleotide and proceed to
completion, to
near completion, or to partial completion. When the exonuclease action is
allowed to
go to completion, the result will be that the length of each 5' overhang will
be extend
far towards the middle region of the polynucleotide in the direction of what
might be
considered a "rendezvous point" (which may be somewhere near the
polynucleotide
midpoint). Ultimately, this results in the production of single stranded
polynucleotides (that can become dissociated) that are each about half the
length of
the original double stranded polynucleotide.
Thus, the exonuclease-mediated approach is useful for shuffling, assembling
and/or reassembling, recombining, and concatenating polynucleotide building
blocks.
The polynucleotide building blocks can be up to ten bases long or tens of
bases long
or hundreds of bases long or thousands of bases long or tens of thousands of
bases
long or hundreds of thousands of bases long or millions of bases long or even
longer.
Substrates for an exonuclease may be generated by subjecting a double
stranded polynucleotide to fragmentation. Fragmentation may be achieved by
mechanical means (e.g., shearing, sonication, and the like), by enzymatic
means (e.g.,
using restriction enzymes), and by any combination thereof. Fragments of a
larger
polynucleotide may also be generated by polymerase-mediated synthesis.
Additional examples of enzymes with exonuclease activity include red-alpha
and venom phosphodiesterases. Red alpha (Veda) gene product (also referred to
as
lambda exonuclease) is of bacteriophage ~, origin. Red alpha gene product acts
processively from 5'-phosphorylated termini to liberate mononucleotides from
duplex
DNA (Takahashi & Kobayashi, 1990). Venom phosphodiesterases (Laskowski,
190) is capable of rapidly opening supercoiled DNA.
In one aspect, the present invention provides a non-stochastic method.termed
synthetic ligation reassembly (SLR), that is somewhat related to stochastic
shuffling,
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
save that the nucleic acid building blocks are not shuffled or concatenated or
chimerized randomly, but rather are assembled non-stochastically.
The SLR method does not depend on the presence of a high level of homology
5 between polynucleotides to be shuffled. The invention can be used to non-
stochastically generate libraries (or sets) of progeny molecules comprised of
over
101°° different chimeras. Conceivably, SLR can even be used to
generate libraries
comprised of over lOlooo different progeny chimeras.
10 Thus, in one aspect, the invention provides a non-stochastic method of
producing a set of finalized chimeric nucleic acid molecules having an overall
assembly order that is chosen by design, which method is comprised of the
steps of
generating, by design, a plurality of specific nucleic acid building blocks
having
serviceable mutually compatible ligatable ends, and assembling these nucleic
acid
15 building blocks, such that a designed overall assembly order is achieved.
The mutually compatible ligatable ends of the nucleic acid building blocks to
be assembled are considered to be "serviceable" for this type of ordered
assembly if
they enable the building blocks to be coupled in predetermined orders. Thus,
in one
20 aspect, the overall assembly order in which the nucleic acid building
blocks can be
coupled is specified by the design of the ligatable ends and, if more than one
assembly
step is to be used, then the overall assembly order in which the nucleic acid
building
blocks can be coupled is also specified by the sequential order of the
assembly step(s).
In a one embodiment of the invention, the annealed building pieces are treated
with an
25 enzyme, such as a ligase (e.g., T4 DNA ligase) to achieve covalent bonding
of the
building pieces.
In a another embodiment, the design of nucleic acid building blocks is
obtained upon analysis of the sequences of a set of progenitor nucleic acid
templates
30 that serve as a basis for producing a progeny set of finalized chimeric
nucleic acid
molecules. These progenitor nucleic acid templates thus serve as a source of
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
61
sequence information that aids in the design of the nucleic acid building
blocks that
are to be mutagenized, i.e. chimerized or shuffled.
In one exemplification, the invention provides for the chimerization of a
family of related genes and their encoded family of related products. In a
particular
exemplification, the encoded products are enzymes. As a representative list of
families of enzymes which may be mutagenized in accordance with the aspects of
the
present invention, there may be mentioned, the following enzymes and their
functions: Lipase/Esterase, Protease, Glycosidase/Glycosyl, transferase,
Phosphatase/Kinase, Mono/Dioxygenase, Haloperoxidase, Lignin,
peroxidase/Diarylpropane peroxidase, Epoxide hydrolase, Nitrile
hydratase/nitrilase,
Transaminase, Amidase/Acylase. These exemplifications, while illustrating
certain
specific aspects of the invention, do not portray the limitations or
circumscribe the
scope of the disclosed invention.
Thus according to one aspect of the invention, the sequences of a plurality of
progenitor nucleic acid templates identified using the methods of the
invention are
aligned in order to select one or more demarcation points, which demarcation
points
can be located at an area of homology. The demarcation points can be used to
delineate the boundaries of nucleic acid building blocks to be generated.
Thus, the
demarcation points identified and selected in the progenitor molecules serve
as
potential chimerization points in the assembly of the progeny molecules.
Typically a demarcation point is an area of homology (comprised of at least
one homologous nucleotide base) shared by at least two progenitor templates,
but the
demarcation point can be an area of homology that is shared by at least half
of the
progenitor templates, at least two thirds of the progeutor templates, at least
three
fourths of the progenitor templates, and preferably at almost all of the
progenitor
templates. Even more preferably still a demarcation point is an area of
homology that
is shared by all of the progenitor templates.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
62
In another embodiment, the ligation reassembly process is performed
exhaustively in order to generate an exhaustive library. In other words, all
possible
ordered combinations of the nucleic acid building blocks are represented in
the set of
finalized chimeric nucleic acid molecules. At the same time, the assembly
order (i.e.
the order of assembly of each building block in the 5' to 3 sequence of each
finalized
chimeric nucleic acid) in each combination is by design (or non-stochastic).
Because
of the non-stochastic nature of the invention, the possibility of unwanted
side products
is greatly reduced.
In yet another embodiment, the invention provides that, the ligation
reassembly process is performed systematically, for example in order to
generate a
systematically compartmentalized library, with compartments that can be
screened
systematically, e.g., one by one. In other words the invention provides that,
through
the selective and judicious use of specific nucleic acid building blocks,
coupled with
the selective and judicious use of sequentially stepped assembly reactions, an
experimental design can be achieved where specific sets of progeny products
are
made in each of several reaction vessels. This allows a systematic examination
and
screening procedure to be performed. Thus, it allows a potentially very large
number
of progeny molecules to be examined systematically in smaller groups.
Because of its ability to perform chimerizations in a manner that is highly
flexible yet exhaustive and systematic as well, particularly when there is a
low level
of homology among the progenitor molecules, the instant invention provides for
the
generation of a library (or set) comprised of a large number of progeny
molecules.
Because of the non-stochastic nature of the instant ligation reassembly
invention, the
progeny molecules generated preferably comprise a library of finalized
chimeric
nucleic acid molecules having an overall assembly order that is chosen by
design. In
a particularly embodiment, such a generated library is comprised of greater
than 103
to greater than l Olooo different progeny molecular species.
In one aspect, a set of finalized chimeric nucleic acid molecules, produced as
described is comprised of a polynucleotide encoding a polypeptide. According
to one
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
63
embodiment, this polynucleotide is a gene, which may be a man-made gene.
According to another embodiment, this polynucleotide is a gene pathway, which
may
be a man-made gene pathway. The invention provides that one or more man-made
genes generated by the invention may be incorporated into a man-made gene
pathway, such as pathway operable in a eukaryotic organism (including a
plant).
In another exemplification, the synthetic nature of the step in which the
building blocks are generated allows the design and introduction of
nucleotides (e.g.,
one or more nucleotides, which may be, for example, codons or introns or
regulatory
sequences) that can later be optionally removed in an in vitro process (e.g.,
by
mutagenesis) or in an ih vivo process (e.g., by utilizing the gene splicing
ability of a
host organism). It is appreciated that in many instances the introduction of
these
nucleotides may also be desirable for many other reasons in addition to the
potential
benefit of creating a demarcation point.
Thus, according to another embodiment, the invention provides that a nucleic
acid building block can be used to introduce an intron. Thus, the invention
provides
that functional introns may be introduced into a man-made gene of the
invention. The
invention also provides that functional introns may be introduced into a man-
made
gene pathway of the invention. Accordingly, the invention provides for the
generation of a chimeric polynucleotide that is a man-made gene containing one
(or
more) artificially introduced intron(s).
Accordingly, the invention also provides for the generation of a chimeric
polynucleotide that is a man-made gene pathway containing one (or more)
artificially
introduced intron(s). Preferably, the artificially introduced intron(s) are
functional in
one or more host cells for gene splicing much in the way that naturally-
occurring
introns serve functionally in gene splicing. The invention provides a process
of
producing man-made intron-containing polynucleotides to be introduced into
host
organisms for recombination and/or splicing.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
64
A man-made gene produced using the invention can also serve as a substrate
for.recombination with another nucleic acid. Likewise, a man-made gene pathway
produced using the invention can also serve as a substrate for recombination
with
another nucleic acid. In a preferred instance, the recombination is
facilitated by, or
occurs at, areas of homology between the man-made intron-containing gene and a
nucleic acid with serves as a recombination partner. In a particularly
preferred
instance, the recombination partner may also be a nucleic acid generated by
the
invention, including a man-made gene or a man-made gene pathway. Recombination
may be facilitated by or may occur at areas of homology that exist at the one
(or
more) artificially introduced intron(s) in the man-made gene.
The synthetic ligation reassembly method of the invention utilizes a plurality
of nucleic acid building blocks, each of which preferably has two ligatable
ends. The
two ligatable ends on each nucleic acid building block may be two blunt ends
(i.e.
each having an overhang of zero nucleotides), or preferably one blunt end and
one
overhang, or more preferably still two overhangs.
An overhang for this purpose may be a 3' overhang or a 5' overhang. Thus, a
nucleic acid building block may have a 3' overhang or alternatively a 5'
overhang or
alternatively two 3' overhangs or alternatively two 5' overhangs. The overall
order in
which the nucleic acid building blocks are assembled to form a finalized
chimeric
nucleic acid molecule is determined by purposeful experimental design and is
not
random.
According to one preferred embodiment, a nucleic acid building block is
generated by chemical synthesis of two single-stranded nucleic acids (also
referred to
as single-stranded oligos) and contacting them so as to allow them to anneal
to form a
double-stranded nucleic acid building block.
A double-stranded nucleic acid building block can be of variable size. The
sizes of these building blocks can be small or large. Preferred sizes for
building block
range from 1 base pair (not including any overhangs) to 100,000 base pairs
(not
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
including any overhangs). Other preferred size ranges are also provided, which
have
lower limits of from 1 by to 10,000 by (including every integer value in
between), and
upper limits of from 2 by to 100, 000 by (including every integer value in
between).
5 Figure 6 shows the activity of the enzyme exonuclease III. This is an
exemplary enzyme that can be used to shuffle, assemble, reassemble, recombine,
and/or concatenate polynucleotide building blocks. The asterisk indicates that
the
enzyme acts from the 3' direction towards the 5' direction of the
polynucleotide
substrate. Figure 7 shows an exemplary application of the enzyme exonuclease
III in
10 exonuclease-mediated polynucleotide reassembly. Shown also is the combined
use of
in vivo "repair" by transforming a suitable host (e.g. Escherichia,
Pseudomonas,
Steptomyces, or Bacillus) and utilizing the host's repair mechanism to provide
further
diversity by generating a library of cloned mutagenized progeny nucleic acids
( and
preferably polypeptides expressed by such nucleic acids) that can be analyzed
by
15 expression screening.
Figure ~ shows the generation of a poly-binding nucleic acid strand. In this
case, the generated strand is of the same length as the parental template, but
is not
methylated. Dpn I treatment can thus be used to select for the generated
strand.
20 Although not shown, the template as well as the generated product can be
part of a
vector (linear or circular). Figure 9 shows the use of exonuclease treatment
as a means
to liberate 3' and 5'-terminal nucleotides from the unhybridized single-
stranded end
of an annealed nucleic acid strand in a heteromeric nucleic acid complex,
leaving a
shortened but hybridized end to facilitate polymerase-based extension and/or
ligase-
25 mediated ligation of the treated end. Shown also is the combined use of in
vivo
"repair" by transforming a suitable host (e.g. Escherichia, Pseudomonas,
Steptornyces, or Bacillus) and utilizing the host's repair mechanism to
provide further
diversity by generating a library of cloned mutagenized progeny nucleic acids
( and
preferably polypeptides expressed by such nucleic acids) that can be analyzed
by
30 expression screening.
Figure 10 shows the use of exonuclease-mediated nucleic acid reassembly in
an example in which one methylated poly-binding nucleic acid strand is
annealed to
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
66
several unmethylated mono-binding nucleic acid strands. The annealed nucleic
acid
strands form heterorneric nucleic acid complexes and are subjected to
exonuclease
treatment as a means to liberate 3' and 5'-terminal nucleotides from the
unhybridized
single-stranded ends of a plurality of annealed nucleic acid strands in the
heteromeric
nucleic acid complexes, leaving shortened but hybridized ends to facilitate
polymerase-based extension and/or ligase-mediated ligation of the treated
ends.
Treatment with DpnI is then serviceable for selecting against the generated
annealed
mono-binding nucleic acid strands that are unmethylated and chimeric in
nature.
Figure 11 shows the use of exonuclease-mediated nucleic acid reassembly in
an example in which a plurality of methylated poly-binding nucleic acid strand
are
annealed to several unmethylated mono-binding nucleic acid strands. The
annealed
nucleic acid strands form heteromeric nucleic acid complexes that are subj
ected to
exonuclease treatment as a means to liberate 3' and 5'-terminal nucleotides
from the
unhybridized single-stranded ends of a plurality of annealed nucleic acid
strands in
the heteromeric nucleic acid complexes, leaving shortened but hybridized ends
to
facilitate polymerase-based extension and/or ligase-mediated ligation of the
treated
ends. Treatment with DpnI is then serviceable for selecting against the
generated
annealed mono-binding nucleic acid strands that are unmethylated and chimeric
in
nature.
Many methods exist by which a double-stranded nucleic acid building block
can be generated that is serviceable for the invention; and these are known in
the art
and can be readily performed by the skilled artisan.
According to one embodiment, a double-stranded nucleic acid building block
is generated by first generating two single stranded nucleic acids and
allowing them to
anneal to form a double-stranded nucleic acid building block. The two strands
of a
double-stranded nucleic acid building block may be complementary at every
nucleotide apart from any that form an overhang; thus containing no
mismatches,
apart from any overhang(s). According to another embodiment, the two strands
of a
double-stranded nucleic acid building block are complementary at fewer than
every
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
67
nucleotide apart from any that form an overhang. Thus, according to this
embodiment, a double-stranded nucleic acid building block can be used to
introduce
codon degeneracy. Preferably the codon degeneracy is introduced using the site-
saturation mutagenesis described herein, using one or more N,N,G/T cassettes
or
alternatively using one or more N,N,N cassettes.
Figure 1 shows a preferred embodiment of site-saturated mutagenesis as
described herein. Nucleic acid sequences that can be mutagenized by non-
stochastic
site-saturation mutagenesis include any polynucleotide of 15-100,000 bases in
length
(e.g. any coding region and any non-coding region). For example, such nucleic
acid
sequences include promoters, enhancers, introns, whole genes, cDNA, gene
segments,
operators, polynucleotide functional groups, expression regulatory sequences,
expressed sequence tags (ESTs), open reading frames (ORFs),
rpressors/transactivators, origin of replication, or gene pathways by way of
example.
Mutagenic cassettes that can be mutagenized by non-stochastic site-saturation
mutagenesis include any polynucleotide cassette of 1-500 bases in length. Site-
saturation mutagenesis is servicable for mutagenizing a complete set of
cassettes
contained within a polynucleotide sequence to be mutagenized. As shown in
Figure 1,
cassettes can be spaced along each polynucleotide differently (i.e.
immediately
adjacent, evenly spaced, or unevenly spaced) and of any size. In a preferred
but non-
limiting exemplification a set of mutagenic cassettes is a set of contiguous
codons
within a sequence of defined length. Alternatively, in another preferred but
non-
limiting example, a set of mutagenic cassettes is a set of nucleotide
cassettes that are
not shared by aligned related polynucleotides.
The type of mutations to be introduced in a set of mutagenic cassettes can be
of the same type or of different types within each round of polynucleotide
site-
saturation mutagenesis. Each mutagenic cassette (within the nucleic acid
sequence to
be mutagenized) preferably is usually mutagenized by the use of a
corresponding
oligo (including by a degenerate oligo). Examples of degenerate mutations
provided
by this invention include:
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
68
Colons for all 20 amino acids (e.g. N,N,N or N,N,G/T or N,N,G/C)
All degenerate colons that do not change the amino acid sequence of the
parental template (i.e. colons for the same amino acid that is present in the
parental
template)
Colons (all or selected) for amino acids within the same grouping according
to the selected amino acid grouping scheme*.
Colons for at least 1 amino acid in each amino acids group*.
1. Aromatic (Phe, Trp, Tyr)
2. Aliphatic (Gly, Ala, Val, Leu, Ile)
3. OH-containing (Ser, Tyr, Thr)
4. Acidic (Asp, Glu, Asn, Gln)
5. Basic (Lys, Arg, His)
6. Sulfur-containing (Met, Cys)
7. Polar (Ser, Thr, Cys, Asn, Gln, Tyr)
8. Non-polar (Gly, Ala, Val, Leu, Ile, Met, Phe,Trp, Pro)
Figure 2 showcases the power of this invention in its ability to generate
exhaustively and systematically all possible combinations of the nucleic acid
building
blocks designed in this example. Particularly large sets (or libraries) of
progeny
chimeric molecules can be generated. Because this method can be performed
exhaustively and systematically, the method application can be repeated by
choosing
new demarcation points and with correspondingly newly designed nucleic acid
building
blocks, bypassing the burden of re-generating and re-screening previously
examined and
rejected molecular species. It is appreciated that, colon wobble can be used
to
advantage to increase the frequency of a demarcation point. In other words, a
particular
base can often be substituted into a nucleic acid building block without
altering the
amino acid encoded by progenitor colon (that is now altered colon) because of
colon
degeneracy. As illustrated, demarcation points are chosen upon alignment of 8
progenitor templates. Nucleic acid building blocks including their overhangs
(which are
serviceable for the formation of ordered couplings) are then designed and
synthesized.
In this instance, 18 nucleic acid building blocks are generated based on the
sequence of
each of the 8 progenitor templates, for a total of 144 nucleic acid building
blocks (or
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
69
double-stranded oligos). Performing the ligation reassembly procedure will
then
produce a library of progeny molecules comprised of yield of ~ 1 ~ (or over
1.~ x 1016)
chimeras.
The in vivo recombination method of the invention can be performed blindly
on a pool of unknown hybrids or alleles of a specific polynucleotide or
sequence.
However, it is not necessary to know the actual DNA or RNA sequence of the
specific
polynucleotide.
The approach of using recombination within a mixed population of genes can
be useful for the generation of any useful proteins, for example, interleukin
I,
antibodies, tPA and growth hormone. This approach may be used to
generate,proteins
having altered specificity or activity. The approach may also be useful for
the
generation of hybrid nucleic acid sequences, for example, promoter regions,
introns,
exons, enhancer sequences, 31 untranslated regions or 51 untranslated regions
of
genes. Thus this approach may be used to generate genes having increased rates
of
expression. This approach may also be useful in the study of repetitive DNA
sequences. Finally, this approach may be useful to mutate ribozymes or
aptamers.
The invention provides a method for selecting a subset of polynucleotides
from a starting set of polynucleotides, which method is based on the ability
to
discriminate one or more selectable features (or selection markers) present
anywhere
in a working polynucleotide, so as to allow one to perform selection for
(positive
selection) and/or against (negative selection) each selectable polynucleotide.
In a one
aspect, a method is provided termed end-selection, which method is based on
the use
of a selection marker located in part or entirely in a terminal region of a
selectable
polynucleotide, and such a selection marker may be termed an "end-selection
marker".
End-selection may be based on detection of naturally occurnng sequences or
on detection of sequences introduced experimentally (including by any
mutagenesis
procedure mentioned herein and not mentioned herein) or on both, even within
the
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
same polynucleotide. An end-selection marker can be a structural selection
marker or
a functional selection marker or both a structural and a functional selection
marker.
An end-selection marker may be comprised of a polynucleotide sequence or of a
polypeptide sequence or of any chemical structure or of any biological or
biochemical
tag, including markers that can be selected using methods based on the
detection of
radioactivity, of enzymatic activity, of fluorescence, of any optical feature,
of a
magnetic property (e.g., using magnetic beads), of immunoreactivity, and of
hybridization.
10 End-selection may be applied in combination with any method for performing
mutagenesis. Such mutagenesis methods include, but are not limited to, methods
described herein (supra and infra). Such methods include, by way of non-
limiting
exemplification, any method that may be referred herein or by others in the
art by any
of the following terms: "saturation mutagenesis", "shuffling",
"recombination", "re-
15 assembly", "error-prone PCR", "assembly PCR", "sexual PCR", "crossover
PCR",
"oligonucleotide primer-directed mutagenesis", "recursive (and/or exponential)
ensemble mutagenesis (see Arkin and Youvan, 1992)", "cassette mutagenesis",
"in
vivo mutagenesis", and "in vitro mutagenesis". Moreover, end-selection may be
performed on molecules produced by any mutagenesis and/or amplification method
20 (see, e.g., Arnold, 1993; Caldwell and Joyce, 1992; Stemmer, 1994)
following which
method it is desirable to select for (including to screen for the presence of)
desirable
' progeny molecules.
In addition, end-selection may be applied to a polynucleotide apart from any
25 mutagenesis method. In a one embodiment, end-selection, as provided herein,
can be
used in order to facilitate a cloning step, such as a step of ligation to
another
polynucleotide (including ligation to a vector). The invention thus provides
for end-
selection as a means to facilitate library construction, selection and/or
enrichment for
desirable polynucleotides, and cloning in general.
In a another embodiment, end-selection can be based on (positive) selection
for a polynucleotide; alternatively end-selection can be based on (negative)
selection
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
71
against a polynucleotide; and alternatively still, end-selection can be based
on both
(positive) selection for, and on (negative) selection against, a
polynucleotide. End-
selection, along with other methods of selection and/or screening, can be
performed in
an iterative fashion, with any combination of like or unlike selection and/or
screening
methods and mutagenesis or directed evolution methods, all of which can be
performed in an iterative fashion and in any order, combination, and
permutation. It is
also appreciated that end-selection may also be used to select a
polynucleotide in a:
circular (e.g., a plasmid or any other circular vector or any other
polynucleotide that is
partly circular), and/or branched, and/or modified or substituted with any
chemical
group or moiety.
In one non-limiting aspect, end-selection of a linear polynucleotide is
performed using a general approach based on the presence of at least one end-
selection marker located at or near a polynucleotide end or terminus (that can
be
either a 5' end or a 3' end). In one particular non-limiting exemplification,
end-
selection is based on selection for a specific sequence at or near a terminus
such as,
but not limited to, a sequence recognized by an enzyme that recognizes a
polynucleotide sequence. An enzyme that recognizes and catalyzes a chemical
modification of a polynucleotide is referred to herein as a polynucleotide-
acting
enzyme. In a preferred embodiment, polynucleotide-acting enzymes are
exemplified
non-exclusively by enzymes with polynucleotide-cleaving activity, enzymes with
polynucleotide-methylating activity, enzymes with polynucleotide-ligating
activity,
and enzymes with a plurality of distinguishable enzymatic activities
(including non-
exclusively, e.g., both polynucleotide-cleaving activity and polynucleotide-
ligating
activity).
It is appreciated that relevant polynucleotide-acting enzymes include any
enzymes identifiable by one skilled in the art (e.g., commercially available)
or that
may be developed in the future, though currently unavailable, that are useful
for
generating a ligation compatible end, preferably a sticky end, in a
polynucleotide. It
may be preferable to use restriction sites that are not contained, or
alternatively that
are not expected to be contained, or alternatively that are unlikely to be
contained
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
72
(e.g., when sequence information regarding a working polynucleotide is
incomplete)
internally in a polynucleotide to be subjected to end-selection. It is
recognized that
methods (e.g., mutagenesis methods) can be used to remove unwanted internal
restriction sites. It is also appreciated that a partial digestion reaction
(i. e. a digestion
reaction that proceeds to partial completion) can be used to achieve digestion
at a
recognition site in a terminal region while sparing a susceptible restriction
site that
occurs internally in a polynucleotide and that is recognized by the same
enzyme. In
one aspect, partial digest are useful because it is appreciated that certain
enzymes
show preferential cleavage of the same recognition sequence depending on the
location and environment in which the recognition sequence occurs.
It is also appreciated that protection methods can be used to selectively
protect
specified restriction sites (e.g., internal sites) against unwanted digestion
by enzymes
that would otherwise cut a working polypeptide in response to the presence of
those
sites; and that such protection methods include modifications such as
methylations
and base substitutions (e.g., U instead of T) that inhibit an unwanted enzyme
activity.
In another embodiment of the invention, a useful end-selection marker is a
terminal sequence that is recognized by a polynucleotide-acting enzyme that
recognizes a specific polynucleotide sequence. In one aspect of the invention,
useful
polynucleotide-acting enzymes also include other enzymes in addition to
classic type
II restriction enzymes. According to this preferred aspect of the invention,
useful
polynucleotide-acting enzymes also include gyrases (e.g., topoisomerases),
helicases,
recombinases, relaxases, and any enzymes related thereto.
It is appreciated that, end-selection can be used to distinguish and separate
parental template molecules (e.g., to be subjected to mutagenesis) from
progeny molecules
(e.g., generated by mutagenesis). For example, a first set of primers, lacking
in a
topoisomerase I recognition site, can be used to modify the terminal regions
of the parental
molecules (e.g., in polymerase-based amplification). A different second set of
primers
(e.g., having a topoisomerase I recognition site) can then be used to generate
mutated
progeny molecules (e.g., using any polynucleotide chimerization method, such
as
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
73
interrupted synthesis, template-switching polymerase-based amplification, or
interrupted
synthesis; or using saturation mutagenesis; or using any other method for
introducing a
topoisomerase I recognition site into a mutagenized progeny molecule) from the
amplified
template molecules. The use of topoisomerase I-based end-selection can then
facilitate,
not only discernment, but selective topoisomerase I-based ligation of the
desired progeny
molecules.
It is appreciated that an end-selection approach using topoisomerase-based
nicking and ligation has several advantages over previously available
selection
methods. In sum, this approach allows one to achieve direction cloning
(including
expression cloning).
Figure 3 is a diagram of the application of end-selection using a
topoisomerase-
guided selection step to select for desirable polynucleotides (e.g. the
selection of full
length molecules) generated by polynucleotide reassembly (e.g. by synthetic
ligation
reassembly). Figure 4 illustrates various aspects of the end-selection
technology. These
include the method of end-selecting in vitro reassembled genes comprising the
steps of:
a) Amplifying genes of interest with gene-specific primers template:
chromosomal
DNA/lambda clone/genomic clone/any subcloned DNA; b) Performing
recombinatorial
PCR: mix PCR products from homologous genes add universal TOPO cloning
primers,
PCR, e.g.: 5' 94 C; 80 x (30" 94 C; 10" 37 C; 10" 72 C); c) Performing
directed
expression cloning: gel-purify reasssembled PCR products; bind vaccinia virus
Topoisomerase (optimum molar ratio DNA: enzyme 1:5); add vector (2x amount of
insert); transform E.coli; screen transformants. Figure 5 illustrates a
specific aspect of
the end-selection technology where step of "c) Performing directed expression
cloning"
is achieved using the enzyme N.BstNBI in order to introduce "sticky ends" into
an
originally blunt-ended DNA in order to achieve directional expression cloning
of the
original blunt-ended DNA.
The present method can be used to shuffle, by ih vitro and/or in vivo
recombination by any of the disclosed methods, and in any combination,
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
74
polynucleotide sequences selected by peptide display methods, wherein an
associated
polynucleotide encodes a displayed peptide which is screened for a phenotype
(e.g.,
for affinity for a predetermined receptor (ligand).
An increasingly important aspect of bio-pharmaceutical drug development and
molecular biology is the identification of peptide structures, including the
primary
amino acid sequences, of peptides or peptidomimetics that interact with
biological
macromolecules. One method of identifying peptides that possess a desired
structure
or functional property, such as binding to a predetermined biological
macromolecule
(e.g., a receptor), involves the screening of a large library or peptides for
individual
library members which possess the desired structure or functional property
conferred
by the amino acid sequence of the peptide.
In addition to direct chemical synthesis methods for generating peptide
libraries, several recombinant DNA methods also have been reported. One type
involves the display of a peptide sequence, antibody, or other protein on the
surface of
a bacteriophage particle or cell. Generally, in these methods each
bacteriophage
particle or cell serves as an individual library member displaying a single
species of
displayed peptide in addition to the natural bacteriophage or cell protein
sequences.
Each bacteriophage or cell contains the nucleotide sequence information
encoding the
particular displayed peptide sequence; thus, the displayed peptide sequence
can be
ascertained by nucleotide sequence determination of an isolated library
member.
A well-known peptide display method involves the presentation of a peptide
sequence on the surface of a filamentous bacteriophage, typically as a fusion
with a
bacteriophage coat protein. The bacteriophage library can be incubated with an
immobilized, predetermined macromolecule or small molecule (e.g., a receptor)
so
that bacteriophage particles which present a peptide sequence that binds to
the
immobilized macromolecule can be differentially partitioned from those that do
not
present peptide sequences that bind to the predetermined macromolecule. The
bacteriophage particles (i.e., library members) which are bound to the
immobilized
macromolecule are then recovered and replicated to amplify the selected
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
bacteriophage sub-population for a subsequent round of affinity enrichment and
phage
replication. After several rounds of affinity enrichment and phage
replication, the
bacteriophage library members that are thus selected are isolated and the
nucleotide
sequence encoding the displayed peptide sequence is determined, thereby
identifying
the sequences) of peptides that bind to the predetermined macromolecule (e.g.,
receptor). Such methods are further described in PCT patent publications WO
91/17271, WO 91/18980, WO 91/19818 and WO 93/08278.
The present invention also provides random, pseudorandom, and defined
10 sequence framework peptide libraries and methods for generating and
screening those
libraries to identify useful compounds (e.g., peptides, including single-chain
antibodies) that bind to receptor molecules or epitopes of interest or gene
products
that modify peptides or RNA in a desired fashion. The random, pseudorandom,
and
defined sequence framework peptides are produced from libraries of peptide
library
15 members that comprise displayed peptides or displayed single-chain
antibodies
attached to a polynucleotide template from which the displayed peptide was
synthesized. The mode of attachment may vary according to the specific
embodiment
of the invention selected, and can include encapsulation in a phage particle
or
incorporation in a cell.
A significant advantage of the present invention is that no prior information
regarding an expected ligand structure is required to isolate peptide ligands
or
antibodies of interest. The peptide identified can have biological activity,
which is
meant to include at least specific binding affinity for a selected receptor
molecule and,
in some instances, will further include the ability to block the binding of
other
compounds, to stimulate or inhibit metabolic pathways, to act as a signal or
messenger, to stimulate or inhibit cellular activity, and the like.
The invention also provides a method for shuffling a pool of polynucleotide
sequences identified by the methods of the invention and selected by affinity
screening a library of polysomes displaying nascent peptides (including single-
chain
antibodies) for library members which bind to a predetermined receptor (e.g.,
a
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
76
mammalian proteinaceous receptor such as, for example, a peptidergic hormone
receptor, a cell surface receptor, an intracellular protein which binds to
other
proteins) to form intracellular protein complexes such as hetero-dimers and
the like)
or epitope (e.g., an immobilized protein, glycoprotein, oligosaccharide, and
the like).
Polynucleotide sequences selected in a first selection round (typically by
affinity selection for binding to a receptor (e.g., a ligand)) by any of these
methods are
pooled and the pools) is/are shuffled by ifz vitro and/or ih vivo
recombination to
produce a shuffled pool comprising a population of recombined selected
polynucleotide sequences. The recombined selected polynucleotide sequences are
subjected to at least one subsequent selection round. The polynucleotide
sequences
selected in the subsequent selection rounds) can be used directly, sequenced,
and/or
subjected to one or more additional rounds of shuffling and subsequent
selection.
Selected sequences can also be back-crossed with polynucleotide sequences
encoding
neutral sequences (i.e., having insubstantial functional effect on binding),
such as for
example by back-crossing with a wild-type or naturally-occurring sequence
substantially identical to a selected sequence to produce native-like
functional
peptides, which may be less immunogenic. Generally, during back-crossing
subsequent selection is applied to retain the property of binding to the
predetermined
receptor (ligand).
Prior to or concomitant with the shuffling of selected sequences, the
sequences
can be mutagenized. In one embodiment, selected library members are cloned in
a
prokaryotic vector (e.g., plasmid, phagemid, or bacteriophage) wherein a
collection of
individual colonies (or plaques) representing discrete library members are
produced.
Individual selected library members can then be manipulated (e.g., by site-
directed
mutagenesis, cassette mutagenesis, chemical mutagenesis, PCR mutagenesis, and
the
like) to generate a collection of library members representing a kernal of
sequence
diversity based on the sequence of the selected library member. The sequence
of an
individual selected library member or pool can be manipulated to incorporate
random
mutation, pseudorandom mutation, defined kernal mutation (i.e., comprising
variant
and invariant residue positions and/or comprising variant residue positions
which can
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
77
comprise a residue selected from a defined subset of amino acid residues),
codon-based mutation, and the like, either segmentally or over the entire
length of the
individual selected library member sequence. The mutagenized selected library
members are then shuffled by in vitro and/or ih vivo recombinatorial shuffling
as
disclosed herein.
The invention also provides peptide libraries comprising a plurality of
individual library members of the invention, wherein (1) each individual
library
member of said plurality comprises a sequence produced by shuffling of a pool
of
selected sequences, and (2) each individual library member comprises a
variable
peptide segment sequence or single-chain antibody segment sequence which is
distinct from the variable peptide segment sequences or single-chain antibody
sequences of other individual library members in said plurality (although some
library
members may be present in more than one copy per library due to uneven
amplification, stochastic probability, or the like).
The invention also provides a product-by-process, wherein selected
polynucleotide sequences having (or encoding a peptide having) a predetermined
binding specificity are formed by the process of: (1) screening a displayed
peptide or
displayed single-chain antibody library against a predetermined receptor
(e.g., ligand)
or epitope (e.g., antigen macromolecule) and identifying and/or enriching
library
members which bind to the predetermined receptor or epitope to produce a pool
of
selected library members, (2) shuffling by recombination the selected library
members (or amplified or cloned copies thereof) which binds the predetermined
epitope and has been thereby isolated and/or enriched from the library to
generate a
shuffled library, and (3) screening the shuffled library against the
predetermined
receptor (e.g., ligand) or epitope (e.g., antigen macromolecule) and
identifying and/or
enriching shuffled library members which bind to the predetermined receptor or
epitope to produce a pool of selected shuffled library members.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
7~
The present method can be used to shuffle, by ifa vitro andlor ira vivo
recombination by any of the disclosed methods, and in any combination,
polynucleotide sequences selected by antibody display methods, wherein an
associated polynucleotide encodes a displayed antibody which is screened for a
phenotype (e.g., for affinity for binding a predetermined antigen (ligand)).
Various molecular genetic approaches have been devised to capture the vast
irnmunological repertoire represented by the extremely large number of
distinct
variable regions which can be present in immunoglobulin chains. The
naturally-occurring germ line immunoglobulin heavy chain locus is composed of
separate tandem arrays of variable segment genes located upstream of a tandem
array
of diversity segment genes, which are themselves located upstream of a tandem
array
of joining (i) region genes, which are located upstream of the constant region
genes.
During B lymphocyte development, V-D-J rearrangement occurs wherein a heavy
chain variable region gene (VH) is formed by rearrangement to form a fused D
segment followed by rearrangement with a V segment to form a V-D-J joined
product
gene which, if productively rearranged, encodes a functional variable region
(VH) of
a heavy chain. Similarly, light chain loci rearrange one of several V segments
with
one of several J segments to form a gene encoding the variable region (VL) of
a light
chain.
The vast repertoire of variable regions possible in immunoglobulins derives in
part from the numerous combinatorial possibilities of joining V and i segments
(and,
in the case of heavy chain loci, D segments) during rearrangement in B cell
development. Additional sequence diversity in the heavy chain variable regions
arises
from non-uniform rearrangements of the D segments during V-D-J joining and
from
N region addition. Further, antigen-selection of specific B cell clones
selects for
higher affinity variants having non-germline mutations in one or both of the
heavy
and light chain variable regions; a phenomenon referred to as "affinity
maturation" or
"affinity sharpening". Typically, these "affinity sharpening" mutations
cluster in
specific areas of the variable region, most commonly in the
complementarity-determining regions (CDRs).
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
79
In order to overcome many of the limitations in producing and identifying
high-affinity immunoglobulins through antigen-stimulated 13 cell development
(i.e.,
immunization), various prokaryotic expression systems have been developed that
can
be manipulated to produce combinatorial antibody libraries which may be
screened
for high-affinity antibodies to specific antigens. Recent advances in the
expression of
antibodies in Esche~ichia eoli and bacteriophage systems (see "alternative
peptide
display methods", ihfYa) have raised the possibility that virtually any
specificity can
be obtained by either cloning antibody genes from characterized hybridomas or
by de
novo selection using antibody gene libraries (e.g., from Ig cDNA).
Combinatorial libraries of antibodies have been generated in bacteriophage
lambda expression systems which may be screened as bacteriophage plaques or as
colonies of lysogens (Ruse et al., 1989); Caton and Koprowski, 1990; Mullinax
et al.,
1990; Persson et al., 1991). Various embodiments of bacteriophage antibody
display
libraries and lambda phage expression libraries have been described (Kang et
al.,
1991; Clackson et al., 1991; McCafferty et al., 1990; Burton et al., 1991;
Hoogenboom et al., 1991; Chang et al., 1991; Breitling et al., 1991; Marks et
al.,
1991, p. 581; Barbas et al., 1992; Hawkins and Winter, 1992; Marks et al.,
1992, p.
779; Marks et al., 1992, p. 16007; and Lowman et al., 1991; Lerner et al.,
1992; all
incorporated herein by reference). Typically, a bacteriophage antibody display
library
is screened with a receptor (e.g., polypeptide, carbohydrate, glycoprotein,
nucleic
acid) that is immobilized (e.g., by covalent linkage to a chromatography resin
to
enrich for reactive phage by affinity chromatography) and/or labeled (e.g., to
screen
plaque or colony lifts).
One particularly advantageous approach has been the use of so-called
single-chain fragment variable (scfv) libraries (Marks et al., 1992, p. 779;
Winter and
Milstein, 1991; Clackson et al., 1991; Marks et al., 1991, p. 581; Chaudhary
et al.,
1990; Chiswell et al., 1992; McCafferty et al., 1990; and Huston et al.,
1988).
Various embodiments of scfv libraries displayed on bacteriophage coat proteins
have
been described.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
Beginning in 1988, single-chain analogues of Fv fragments and their fusion
proteins have been reliably generated by antibody engineering methods. The
first step
generally involves obtaining the genes encoding VH and VL domains with desired
5 binding properties; these V genes may be isolated from a specific hybridoma
cell line,
selected from a combinatorial V-gene library, or made by V gene synthesis. The
single-chain Fv is formed by connecting the component V genes with an
oligonucleotide that encodes an appropriately designed linker peptide, such as
(Gly-Gly-Gly-Gly-Ser (SEQ ID N0:3)) or equivalent linker peptide(s). The
linker
10 bridges the C-terminus of the first V region and N-terminus of the second,
ordered as
either VH-linker-VL or VL-linker-VH' In principle, the scfv binding site can
faithfully replicate both the affinity and specificity of its parent antibody
combining
site.
15 Thus, scfv fragments are comprised of VH and VL domains linked into a
single polypeptide chain by a flexible linker peptide. After the scfv genes
are
assembled, they are cloned into a phagemid and expressed at the tip of the M13
phage
(or similar filamentous bacteriophage) as fusion proteins with the
bacteriophage PIII
(gene 3) coat protein. Enriching for phage expressing an antibody of interest
is
20 accomplished by panning the recombinant phage displaying a population scfv
for
binding to a predetermined epitope (e.g., target antigen, receptor).
The linked polynucleotide of a library member provides the basis for
replication of the library member after a screening or selection procedure,
and also
25 provides the basis for the determination, by nucleotide sequencing, of the
identity of
the displayed peptide sequence or VH and VL amino acid sequence. The displayed
peptide (s) or single-chain antibody (e.g., scfv) and/or its VH and VL domains
or their
CDRs can be cloned and expressed in a suitable expression system. Often
polynucleotides encoding the isolated VH and VL domains will be ligated to
30 polynucleotides encoding constant regions (CH and CL) to form
polynucleotides
encoding complete antibodies (e.g., chimeric or fully-human), antibody
fragments,
and the like. Often polynucleotides encoding the isolated CDRs will be grafted
into
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
81
polynucleotides encoding a suitable variable region framework (and optionally
constant regions) to form polynucleotides encoding complete antibodies (e.g.,
humanized or fully-human), antibody fragments, and the like. Antibodies can be
used
to isolate preparative quantities of the antigen by immunoaffmity
chromatography.
Various other uses of such antibodies are to diagnose and/or stage disease
(e.g.,
neoplasia) and for therapeutic application to treat disease, such as for
example:
neoplasia, autoimmune disease, AmS, cardiovascular disease, infections, and
the like.
Various methods have been reported for increasing the combinatorial diversity
of a scfv library to broaden the repertoire of binding species (idiotype
spectrum) The
use of PCR has permitted the variable regions to be rapidly cloned either from
a
specific hybridoma source or as a gene library from non-immunized cells,
affording
combinatorial diversity in the assortment of VH and VL cassettes which can be
combined. Furthermore, the VH and VL cassettes can themselves be diversified,
such
as by random, pseudorandom, or directed mutagenesis. Typically, VH and VL
cassettes are diversified in or near the complementarity-determining regions
(CDRS),
often the third CDR, CDR3. Enzymatic inverse PCR mutagenesis has been shown to
be a simple and reliable method for constructing relatively large libraries of
scfv
site-directed hybrids (Stemmer et al., 1993), as has error-prone PCR and
chemical
mutagenesis (Deng et al., 1994). Riechmann (Riechmann et al., 1993) showed
semi-
rational design of an antibody scfv fragment using site-directed randomization
by
degenerate oligonucleotide PCR and subsequent phage display of the resultant
scfv
hybrids. Barbas (Baxbas et al., 1992) attempted to circumvent the problem of
limited
repertoire sizes resulting from using biased variable region sequences by
randomizing
the sequence in a synthetic CDR region of a human tetanus toxoid-binding Fab.
CDR randomization has the potential to create approximately 1 x
102° CDRs
for the heavy chain CDR3 alone, and a roughly similar number of variants of
the
heavy chain CDRl and CDR2, and light chain CDRl-3 variants. Taken individually
or together, the combination possibilities of CDR randomization of heavy
and/or light
chains requires generating a prohibitive number of bacteriophage clones to
produce a
clone library representing all possible combinations, the vast majority of
which will
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
~2
be non-binding. Generation of such large numbers of primary transformants is
not
feasible with current transformation technology and bacteriophage display
systems.
For example, Barbas (Barbas et al., 1992) only generated 5 x 10'
transformants,
which represents only a tiny fraction of the potential diversity of a library
of
thoroughly randomized CDRs.
Despite these substantial limitations, bacteriophage. display of scfv have
already yielded a variety of useful antibodies and antibody fusion proteins. A
bispecific single chain antibody has been shown to mediate efficient tumor
cell lysis
(Gruber et al., 1994). Intracellular expression of an anti-Rev scfv has been
shown to
inhibit HIV-1 virus replication ih vitro (Duan et al., 1994), and
intracellular
expression of an anti-p2lrar, scfv has been shown to inhibit meiotic
maturation of
d~ehopus oocytes (Biocca et al., 1993). Recombinant scfv which can be used to
diagnose HIV infection have also been reported, demonstrating the diagnostic
utility
of scfv (Lilley et al., 1994). Fusion proteins wherein an scFv is linked to a
second
polypeptide, such as a toxin or fibrinolytic activator protein, have also been
reported
(Holvost et al., 1992; Nicholls et al., 1993).
If it were possible to generate scfv libraries having broader antibody
diversity
and overcoming many of the limitations of conventional CDR mutagenesis and
randomization methods which can cover only a very tiny fraction of the
potential
sequence combinations, the number and quality of scfv antibodies suitable for
therapeutic and diagnostic use could be vastly improved. To address this, the
in vitro
and in vivo shuffling methods of the invention are used to recombine CDRs
which
have been obtained (typically via PCR amplification or cloning) from nucleic
acids
obtained from selected displayed antibodies. Such displayed antibodies can be
displayed on cells, on bacteriophage particles, on polysomes, or any suitable
antibody
display system wherein the antibody is associated with its encoding nucleic
acid(s).
In a variation, the CDRs are initially obtained from mRNA (or cDNA) from
antibody-producing cells (e.g., plasma cells/splenocytes from an immunized
wild-type
mouse, a human, or a transgenic mouse capable of making a human antibody as in
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
83
WO 92/03918, WO 93/12227, and WO 94/25585), including hybridomas derived
therefrom.
Polynucleotide sequences selected in a first selection round (typically by
affinity selection for displayed antibody binding to an antigen (e.g., a
ligand) by any
of these methods are pooled and the pools) is/are shuffled by in vitYO and/or
in vivo
recombination, especially shuffling of CDRs (typically shuffling heavy chain
CDRs
with other heavy chain CDRs and light chain CDRs with other light chain CDRs)
to
produce a shuffled pool comprising a population of recombined selected
polynucleotide sequences. The recombined selected polynucleotide sequences are
expressed in a selection format as a displayed antibody and subjected to at
least one
subsequent selection round. The polynucleotide sequences selected in the
subsequent
selection rounds) can be used directly, sequenced, and/or subjected to one or
more
additional rounds of shuffling and subsequent selection until an antibody of
the
desired binding affinity is obtained. Selected sequences can also be back-
crossed
with polynucleotide sequences encoding neutral antibody framework sequences
(i.e.,
having insubstantial functional effect on antigen binding), such as for
example by
back-crossing with a human variable region framework to produce human-like
sequence antibodies. Generally, during back-crossing subsequent selection is
applied
to retain the property of binding to the predetermined antigen.
Alternatively, or in combination with the noted variations, the valency of the
target epitope may be varied to control the average binding affinity of
selected scfv
library members. The target epitope can be bound to a surface or substrate at
varying
densities, such as by including a competitor epitope, by dilution, or by other
method
known to those in the art. A high density (valency) of predetermined epitope
can be
used to enrich for scfv library members which have relatively low affinity,
whereas a
low density (valency) can preferentially enrich for higher affinity scfv
library
members.
For generating diverse variable segments, a collection of synthetic
oligonucleotides encoding random, pseudorandom, or a defined sequence kernal
set of
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
84
peptide sequences can be inserted by ligation into a predetermined site (e.g.,
a CDR).
Similarly, the sequence diversity of one or more CDRs of the single-chain
antibody
cassettes) can be expanded by mutating the CDR(s) with site-directed
mutagenesis,
CDR-replacement, and the like. The resultant DNA molecules can be propagated
in a
host for cloning and amplification prior to shuffling, or can be used directly
(i.e., may
avoid loss of diversity which may occur upon propagation in a host cell) and
the
selected library members subsequently shuffled.
Displayed peptide/polynucleotide complexes (library members) which encode
a variable segment peptide sequence of interest or a single-chain antibody of
interest
are selected from the library by an affinity enrichment technique. This is
accomplished by means of a immobilized macromolecule or epitope specific for
the
peptide sequence of interest, such as a receptor, other macromolecule, or
other epitope
species. Repeating the affinity selection procedure provides an enrichment of
library
members encoding the desired sequences, which may then be isolated for pooling
and
shuffling, for sequencing, and/or for further propagation and affinity
enrichment.
The library members without the desired specificity are removed by washing.
The degree and stringency of washing required will be determined for each
peptide
sequence or single-chain antibody of interest and the immobilized
predetermined
macromolecule or epitope. A certain degree of control can be exerted over the
binding characteristics of the nascent peptide/DNA complexes recovered by
adjusting
the conditions of the binding incubation and the subsequent washing. The
temperature, pH, ionic strength, divalent cations concentration, and the
volume and
duration of the washing will select for nascent peptide/DNA complexes within
particular ranges of affinity for the immobilized macromolecule. Selection
based on
slow dissociation rate, which is usually predictive of high affinity, is often
the most
practical route. This may be done either by continued incubation in the
presence of a
saturating amount of free predetermined macromolecule, or by increasing the
volume,
number, and length of the washes. In each case, the rebinding of dissociated
nascent
peptide/DNA or peptidelRNA complex is prevented, and with increasing time,
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
nascent peptide/DNA or peptide/RNA complexes of higher and higher affinity are
recovered.
Additional modifications of the binding and washing procedures may be
5 applied to find peptides with special characteristics. The affinities of
some peptides
are dependent on ionic strength or cation concentration. This is a useful
characteristic
for peptides that will be used in affinity purification of various proteins
when gentle
conditions for removing the protein from the peptides are required.
10 One variation involves the use of multiple binding targets (multiple
epitope
species, multiple receptor species), such that a scfv library can be
simultaneously
screened for a multiplicity of scfv which have different binding
specificities. Given
that the size of a scfv library often limits the diversity of potential scfv
sequences, it is
typically desirable to us scfv libraries of as large a size as possible. The
time and
15 economic considerations of generating a number of very large polysome scFv-
display
libraries can become prohibitive. To avoid this substantial problem, multiple
predetermined epitope species (receptor species) can be concomitantly screened
in a
single library, or sequential screening against a number of epitope species
can be
used. In one variation, multiple target epitope species, each encoded on a
separate
20 bead (or subset of beads), can be mixed and incubated with a polysome-
display scfv
library under suitable binding conditions. The collection of beads, comprising
multiple epitope species, can then be used to isolate, by affinity selection,
scfv library
members. Generally, subsequent affinity screening rounds can include the same
mixture of beads, subsets thereof, or beads containing only one or two
individual
25 epitope species. This approach affords efficient screening, and is
compatible with
laboratory automation, batch processing, and high throughput screening
methods.
A variety of techniques can be used in the present invention to diversify a
peptide library or single-chain antibody library, or to diversify, prior to or
30 concomitant with shuffling, around variable segment peptides found in early
rounds
of panning to have sufficient binding activity to the predetermined
macromolecule or
epitope. In one approach, the positive selected peptide/polynucleotide
complexes
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
86
(those identified in an early round of affinity enrichment) are sequenced to
determine
the identity of the active peptides. Oligonucleotides are then synthesized
based on
these active peptide sequences, employing a low level of all bases
incorporated at
each step to produce slight variations of the primary oligonucleotide
sequences. This
mixture of (slightly) degenerate oligonucleotides is then cloned into the
variable
segment sequences at the appropriate locations. This method produces
systematic,
controlled variations of the starting peptide sequences, which can then be
shuffled. It
requires, however, that individual positive nascent peptide/polynucleotide
complexes
be sequenced before mutagenesis, and thus is useful for expanding the
diversity of
small numbers of recovered complexes and selecting variants having higher
binding
affinity and/or higher binding specificity. In a variation, mutagenic PCR
amplification of positive selected peptide/polynucleotide complexes
(especially of the
variable region sequences, the amplification products of which are shuffled
iya vitro
and/or ih vivo and one or more additional rounds of screening is done prior to
sequencing. The same general approach can be employed with single-chain
antibodies in order to expand the diversity and enhance the binding
affinity/specificity, typically by diversifying CDRs or adjacent framework
regions
prior to or concomitant with shuffling. If desired, shuffling reactions can be
spiked
with mutagenic oligonucleotides capable of in vitro recombination with the
selected
library members can be included. Thus, mixtures of synthetic oligonucleotides
and
PCR produced polynucleotides (synthesized by error-prone or high-fidelity
methods)
can be added to the ih vitro shuffling mix and be incorporated into resulting
shuffled
library members (shufflants).
The invention of shuffling enables the generation of a vast library of
CDR-variant single-chain antibodies. One way to generate such antibodies is to
insert
synthetic CDRs into the single-chain antibody andlor CDR randomization prior
to or
concomitant with shuffling. The sequences of the synthetic CDR cassettes are
selected by referring to known sequence data of human CDR and are selected in
the
discretion of the practitioner according to the following guidelines:
synthetic CDRs
will have at least 40 percent positional sequence identity to known CDR
sequences,
and preferably will have at least 50 to 70 percent positional sequence
identity to
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
~7
known CDR sequences. For example, a collection of synthetic CDR sequences can
be generated by synthesizing a collection of oligonucleotide sequences on the
basis of
naturally-occurnng human CDR sequences listed in Kabat (Kabat et al., 1991);
the
pool (s) of synthetic CDR sequences are calculated to encode CDR peptide
sequences
S having at least 40 percent sequence identity to at least one known naturally-
occurring
human CDR sequence. Alternatively, a collection of naturally-occurnng CDR
sequences may be compared to generate consensus sequences so that amino acids
used at a residue position frequently (i.e., in at least 5 percent of known
CDR
sequences) are incorporated into the synthetic CDRs at the corresponding
position(s).
Typically, several (e.g., 3 to about 50) known CDR sequences are compared and
observed natural sequence variations between the known CDRs are tabulated, and
a
collection of oligonucleotides encoding CDR peptide sequences encompassing all
or
most permutations of the observed natural sequence variations is synthesized.
For
example but not for limitation, if a collection of human VH CDR sequences have
carboxy-terminal amino acids which are either Tyr, Val, Phe, or Asp, then the
pools)
of synthetic CDR oligonucleotide sequences are designed to allow the
carboxy-terminal CDR residue to be any of these amino acids. In some
embodiments,
residues other than those which naturally-occur at a residue position in the
collection
of CDR sequences are incorporated: conservative amino acid substitutions are
frequently incorporated and up to 5 residue positions may be varied to
incorporate
non-conservative amino acid substitutions as compared to known naturally-
occurring
CDR sequences. Such CDR sequences can be used in primary library members
(prior
to first round screening) andlor can be used to spike iya vitro shuffling
reactions of
selected library member sequences. Construction of such pools of defined
andlor
degenerate sequences will be readily accomplished by those of ordinary skill
in the
art.
The collection of synthetic CDR sequences comprises at least one member
that is not known to be a naturally-occurnng CDR sequence. It is within the
discretion of the practitioner to include or not include a portion of random
or
pseudorandom sequence corresponding to N region addition in the heavy chain
CDR;
the N region sequence ranges from 1 nucleotide to about 4 nucleotides
occurring at
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
88
V-D and D-J junctions. A collection of synthetic heavy chain CDR sequences
comprises at least about 100 unique CDR sequences, typically at least about
1,000
unique CDR sequences, preferably at least about 10,000 unique CDR sequences,
frequently more than 50,000 unique CDR sequences; however, usually not more
than
about 1 x 106 unique CDR sequences are included in the collection, although
occasionally 1 x 10~ to 1 x 108 unique CDR sequences are present, especially
if
conservative amino acid substitutions are permitted at positions where the
conservative amino acid substituent is not present or is rare (i.e., less than
0.1 percent)
in that position in naturally-occurring human CDRS. In general, the number of
unique CDR sequences included in a library should not exceed the expected
number
of primary transformants in the library by more than a factor of 10. Such
single-chain
antibodies generally bind of about at least 1 x 10 m-, preferably with an
affinity of
about at least 5 x 10' M-1, more preferably with an affinity of at least 1 x
10$ M-1 to
1 x 109 M-1 or more, sometimes up to 1 x 101° M-1 or more. Frequently,
the
predetermined antigen is a human protein, such as for example a human cell
surface
antigen (e.g., CD4, CDB, IL-2 receptor, EGF receptor, PDGF receptor), other
human
biological macromolecule (e.g., thrombomodulin, protein C, carbohydrate
antigen,
sialyl Lewis antigen, L-selectin), or nonhuman disease associated
macromolecule
(e.g., bacterial LPS, virion capsid protein or envelope glycoprotein) and the
like.
High affinity single-chain antibodies of the desired specificity can be
engineered and expressed in a variety of systems. For example, scfv have been
produced in plants (Firek et al., 1993) and can be readily made in prokaryotic
systems
(Owens and Young, 1994; Johnson and Bird, 1991). Furthermore, the single-chain
antibodies can be used as a basis for constructing whole antibodies or various
fragments thereof (Kettleborough et al., 1994). The variable region encoding
sequence may be isolated (e.g., by PCR amplification or subcloning) and
spliced to a
sequence encoding a desired human constant region to encode a human sequence
antibody more suitable for human therapeutic uses where immunogenicity is
preferably minimized. The polynucleotide(s) having the resultant fully human
encoding sequences) can be expressed in a host cell (e.g., from an expression
vector
in a mammalian cell) and purified for pharmaceutical formulation.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
89
Once expressed, the antibodies, individual mutated immunoglobulin chains,
mutated antibody fragments, and other immunoglobulin polypeptides of the
invention
can be purified according to standard procedures of the art, including
arninonium
sulfate precipitation, fraction column chromatography, gel electrophoresis and
the like
(see, generally, Scopes, 1982). Once purified, partially or to homogeneity as
desired,
the polypeptides may then be used therapeutically or in developing and
performing
assay procedures, immunofluorescent stainings, and the like (see, generally,
Lefkovits
and Pernis, 1979 and 1981; Lefkovits, 1997).
The antibodies generated by the method of the present invention can be used
for diagnosis and therapy. By way of illustration and not limitation, they can
be used
to treat cancer, autoimmune diseases, or viral infections. For treatment of
cancer, the
antibodies will typically bind to an antigen expressed preferentially on
cancer cells,
such as erbB-2, CEA, CD33, and many other antigens and binding members well
known to those skilled in the art.
Shuffling can also be used to recombinatorially diversify a pool of selected
library members obtained by screening a two-hybrid screening system to
identify
library members which bind a predetermined polypeptide sequence. The selected
library members are pooled and shuffled by in vitro and/or in vivo
recombination.
The shuffled pool can then be screened in a yeast two hybrid system to select
library
members which bind said predetermined polypeptide sequence (e.g., and SH2
domain) or which bind an alternate predetermined polypeptide sequence (e.g.,
an SH2
domain from another protein species).
An approach to identifying polypeptide sequences which bind to a
predetermined polypeptide sequence has been to use a so-called "two-hybrid"
system
wherein the predetermined polypeptide sequence is present in a fusion protein
(Chien
et al., 1991). This approach identifies protein-protein interactions ira vivo
through
reconstitution of a transcriptional activator (Fields and Song, 1989), the
yeast Gal4
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
transcription protein. Typically, the method is based on the properties of the
yeast
Gal4 protein, which consists of separable domains responsible for DNA-binding
and
transcriptional activation. Polynucleotides encoding two hybrid proteins, one
consisting of the yeast Gal4 DNA-binding domain fused to a polypeptide
sequence of
5 a known protein and the other consisting of the Gal4 activation domain fused
to a
polypeptide sequence of a second protein, are constructed and introduced into
a yeast
host cell. Intermolecular binding between the two fusion proteins
reconstitutes the
Gal4 DNA-binding domain with the Gal4 activation domain, which leads to the
transcriptional activation of a reporter gene (e.g., lacz, HIS3) which is
operably linked
10 to a Gal4 binding site. Typically, the two-hybrid method is used to
identify novel
polypeptide sequences which interact with a known protein (Silver and Hunt,
1993;
Durfee et al., 1993; Yang et al., 1992; Luban et al., 1993; Hardy et al.,
1992; Bartel et
al., 1993; and Vojtek et al., 1993). However, variations of the two-hybrid
method
have been used to identify mutations of a known protein that affect its
binding to a
15 second known protein (Li and Fields, 1993; Lalo et al., 1993; Jackson et
al., 1993;
and Madura et al., 1993). Two-hybrid systems have also been used to identify
interacting structural domains of two known proteins (Bardwell et al., 1993;
Chakrabarty et al., 1992; Staudinger et al., 1993; and Milne and Weaver 1993)
or
domains responsible for oligomerization of a single protein (Iwabuchi et al.,
1993;
20 Bogerd et al., 1993). Variations of two-hybrid systems have been used to
study the in
vivo activity of a proteolytic enzyme (Dasmahapatra et al., 1992).
Alternatively, an E.
coliBCCP interactive screening system (Germino et al., 1993; Guarente, 1993)
can
be used to identify interacting protein sequences (i.e., protein sequences
which
heterodimerize or form higher order heteromultimers). Sequences selected by a
two-
25 hybrid system can be pooled and shuffled and introduced into a two-hybrid
system for
one or more subsequent rounds of screening to identify polypeptide sequences
which
bind to the hybrid containing the predetermined binding sequence. The
sequences
thus identified can be compared to identify consensus sequences) and consensus
sequence kernals.
One microgram samples of template DNA are obtained and treated with U.V.
light to cause the formation of dimers, including TT dimers, particularly
purine
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
91
dimers. U.V. exposure is limited so that only a few photoproducts are
generated per
gene on the template DNA sample. Multiple samples are treated with U.V. light
for
varying periods of time to obtain template DNA samples with varying numbers of
dimers from U.V. exposure.
A random priming kit which utilizes a non-proofreading polymease (for
example, Prime-It II Random Primer Labeling kit by Stratagene Cloning Systems)
is
utilized to generate different size polynucleotides by priming at random sites
on
templates which are prepared by U.V. light (as described above) and extending
along
the templates. The priming protocols such as described in the Prime-It II
Random
Primer Labeling kit may be utilized to extend the primers. The dimers formed
by
U.V. exposure serve as a roadblock for the extension by the non-proofreading
polyrnerase. Thus, a pool of random size polynucleotides is present after
extension
with the random primers is finished.
The invention is further directed to a method for generating a selected
mutaalt
polynucleotide sequence (or a population of selected polynucleotide sequences)
typically in the form of amplified and/or cloned polynucleotides, whereby the
selected
polynucleotide sequences(s) possess at least one desired phenotypic
characteristic
(e.g., encodes a polypeptide, promotes transcription of linked
polynucleotides, binds a
protein, and the like) which can be selected for. One method for identifying
hybrid
polypeptides that possess a desired structure or functional property, such as
binding to
a predetermined biological macromolecule (e.g., a receptor), involves the
screening of
a large library of polypeptides for individual library members which possess
the
desired structure or functional property conferred by the amino acid sequence
of the
polypeptide.
In one embodiment, the present invention provides a method for generating
libraries of displayed polypeptides or displayed antibodies suitable for
affinity
interaction screening or phenotypic screening. The method comprises (1)
obtaining a
first plurality of selected library members comprising a displayed polypeptide
or
displayed antibody and an associated polynucleotide encoding said displayed
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
92
polypeptide or displayed antibody, and obtaining said associated
polynucleotides or
copies thereof wherein said associated polynucleotides comprise a region of
substantially identical sequences, optimally introducing mutations into said
polynucleotides or copies, (2) pooling the polynucleotides or copies, (3)
producing
smaller or shorter polynucleotides by interrupting a random or particularized
priming
and synthesis process or an amplification process, and (4) performing
amplification,
preferably PCR amplification, and optionally mutagenesis to homologously
recombine the newly synthesized polynucleotides.
It is an object of the invention to provide a process for producing hybrid
polynucleotides which express a useful hybrid polypeptide by a series of steps
comprising:
(a) producing polynucleotides by interrupting a polynucleotide
amplification or synthesis process with a means for blocking or interrupting
the
amplification or synthesis process and thus providing a plurality of smaller
or shorter
polynucleotides due to the replication of the polynucleotide being in various
stages of
completion;
(b) adding to the resultant population of single- or double-stranded
polynucleotides one or more single- or double-stranded oligonucleotides,
wherein said
added oligonucleotides comprise an area of identity in an area of heterology
to one or
more of the single- or double-stranded polynucleotides of the population;
(c) denaturing the resulting single- or double-stranded oligonucleotides to -
produce a mixture of single-stranded polynucleotides, optionally separating
the
shorter or smaller polynucleotides into pools of polynucleotides having
various
lengths and further optionally subjecting said polynucleotides to a PCR
procedure to
amplify one or more oligonucleotides comprised by at least one of said
polynucleotide
pools;
(d) incubating a plurality of said polynucleotides or at least one pool of
said polynucleotides with a polymerase under conditions which result in
annealing of
said single-stranded polynucleotides at regions of identity between the single-
stranded
polynucleotides and thus forming of a mutagenized double-stranded
polynucleotide
chain;
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
93
(e) optionally repeating steps (c) and (d);
expressing at least one hybrid polypeptide from said polynucleotide
chain, or chains; and
(g) screening said at least one hybrid polypeptide for a useful activity.
In a one aspect of the invention, the means for blocking or interrupting the
amplification or synthesis process is by utilization of UV light, DNA adducts,
DNA
binding proteins.
In one embodiment of the invention, the DNA adducts, or polynucleotides
comprising the DNA adducts, are removed from the polynucleotides or
polynucleotide pool, such as by a process including heating the solution
comprising
the DNA fragments prior to further processing.
In another embodiment, clones which are identified as having a biomolecule
or bioactivity of interest may also be sequenced to identify the DNA sequence
encoding a polypeptide (e.g., an enzyme) or the polypeptide sequence itself
having
the specified activity, for example. Thus, in accordance with the present
invention it
is possible to isolate and identify: (i) DNA encoding a bioactivity of
interest (e.g., an
enzyme having a specified enzyme activity), (ii) biomolecules (e.g.,
polynucleotides
or enzymes having such activity (including the amino acid sequence thereof))
and (iii)
produce recombinant biomolecules or bioactivities.
Suitable clones (e.g., 1-1000 or more clones) from the library are identified
by
the methods of the invention and sequenced using, for example, high through-
put
sequencing techniques. The exact method of sequencing is not a limiting factor
of the
invention. Any method useful in identifying the sequence of a particular
cloned DNA
sequence can be used. In general, sequencing is an adaptation of the natural
process of
DNA replication. Therefore, a template (e.g., the vector) and primer sequences
are used.
One general template preparation and sequencing protocol begins with automated
picking of bacterial colonies, each of which contains a separate DNA clone
which will
function as a template for the sequencing reaction. The selected clones are
placed into
media, and grown overnight. The DNA templates are then purified from the cells
and
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
94
suspended in water. After DNA quantification, high-throughput sequencing is
performed
using a sequencers, such as Applied Biosystems, Inc., Prism 377 DNA
Sequencers. The
resulting sequence data can then be used in additional methods, including
searching a
database or databases.
A number of source databases are available that contain either a nucleic acid
sequence and/or a deduced amino acid sequence for use with the invention in
identifying
or determining the activity encoded by a particular polynucleotide sequence.
All or a
representative portion of the sequences (e.g., about 100 individual clones) to
be tested
are used to search a sequence database (e.g., GenBank, PFAM or ProDom), either
simultaneously or individually. A number of different methods of performing
such
sequence searches are known in the art. The databases can be specific for a
particular
organism or a collection of organisms. For example, there are databases for
the C.
elegans, A~abadopsis. sp., M. genitalium, M. jarahaschii, E. coli, H.
influerizae, S.
ce~evisiae and others. The sequence data of the clone is then aligned to the
sequences in
the database or databases using algorithms designed to measure homology
between two
or more sequences.
Such sequence alignment methods include, for example, BLAST (Altschul et al.,
1990), BLITZ (lVIPsrch) (Sturrock & Collins, 1993), and FASTA (Person &
Lipman,
1988). The probe sequence (e.g., the sequence data from the clone) can be any
length,
and will be recognized as homologous based upon a threshold homology value.
The
threshold value may be predetermined, although this is not required. The
threshold
value can be based upon the particular polynucleotide length. To align
sequences a
number of different procedures can be used. Typically, Smith-Waterman or
Needleman-
Wunsch algorithms are used. However, as discussed faster procedures such as
BLAST,
FASTA, PSI-BLAST can be used.
For example, optimal alignment of sequences for aligning a comparison window
may be conducted by the local homology algorithm of Smith (Smith and Waterman,
Adv Appl Math, 1981; Smith and Waterman, J Teor Biol, 1981; Smith and
Waterman, J
Mol Biol, 1981; Smith et al, J Mol Evol, 1981), by the homology alignment
algorithm of
Needleman (Needleman and Wuncsch, 1970), by the search of similarity method of
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
Pearson (Pearson and Lipman, 1988), by computerized implementations of these
algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software
Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, WI, or
the
Sequence Analysis Software Package of the Genetics Computer Group, University
of
Wisconsin, Madison, WI), or by inspection, and the best alignment (i. e.,
resulting in the
highest percentage of homology over the comparison window) generated by the
various
methods is selected. The similarity of the two sequence (i. e., the probe
sequence and the
database sequence) can then be predicted.
Such soilware matches similar sequences by assigning degrees of homology to
10 various deletions, substitutions and other modifications. The terms
"homology" and
"identity" in the context of two or more nucleic acids or polypeptide
sequences, refer to
two or more sequences or subsequences that are the same or have a specified
percentage
of amino acid residues or nucleotides that are the same when compared and
aligned for
maximum correspondence over a comparison window or designated region as
measured
15 using any number of sequence comparison algorithms or by manual alignment
and
visual inspection.
For sequence comparison, typically one sequence acts as a reference sequence,
to
which test sequences are compared. When using a sequence comparison algorithm,
test
and reference sequences are entered into a computer, subsequence coordinates
are
20 designated, if necessary, and sequence algorithm program parameters are
designated.
Default program parameters can be used, or alternative parameters can be
designated.
The sequence comparison algorithm then calculates the percent sequence
identities for
the test sequences relative to the reference sequence, based on the program
parameters.
A "comparison window", as used herein, includes reference to a segment of any
25 one of the number of contiguous positions selected from the group
consisting of from 20
to 600, usually about 50 to about 200, more usually about 100 to about 150 in
which a
sequence may be compared to a reference sequence of the same number of
contiguous
positions after the two sequences are optimally aligned.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
96
One example of a usefixl algorithm is BLAST and BLAST 2.0 algorithms, which
are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and
Altschul et
al., J. Mol. Biol. 215:403-410 (1990), respectively. Software for performing
BLAST
analyses is publicly available through the National Center for Biotechnology
Information
(http://www.ncbi.nhn.nih.gov~. This algorithm involves first identifying high
scoring
sequence pairs (HSPs) by identifying short words of length W in the query
sequence,
which either match or satisfy some positive-valued threshold score T when
aligned with
a word of the same length in a database sequence. T is referred to as the
neighborhood
word score threshold (Altschul et al., supra). These initial neighborhood word
hits act as
seeds for initiating searches to find longer HSPs containing them. The word
hits are
extended in both directions along each sequence for as far as the cumulative
alignment
score can be increased. Cumulative scores are calculated using, for nucleotide
sequences, the parameters M (reward score for a pair of matching residues;
always >0).
The BLAST algorithm parameters W, T, and X determine the sensitivity and speed
of
the alignment. The BLASTN program (for nucleotide sequences) uses as defaults
a
wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4 and a comparison of
both
strands.
The BLAST algorithm also performs a statistical analysis of the similarity
between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci.
USA
90:5873 (1993)). One measure of similarity provided by BLAST algorithm is the
smallest sum probability (P(I~), which provides an indication of the
probability by
which a match between two nucleotide sequences would occur by chance. For
example,
a nucleic acid is considered similar to a references sequence if the smallest
sum
probability in a comparison of the test nucleic acid to the reference nucleic
acid is less
than about 0.2, more preferably less than about 0.01, and most preferably less
than about
0.001.
Sequence homology means that two polynucleotide sequences are homologous
(i. e., on a nucleotide-by-nucleotide basis) over the window of comparison. A
percentage
of sequence identity or homology is calculated by comparing two optimally
aligned
sequences over the window of comparison, determining the number of positions
at
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
97~
which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in
both sequences
to yield the number of matched positions, dividing the number of matched
positions by
the total number of positions in the window of comparison (i.e., the window
size), and
multiplying the result by 100 to yield the percentage of sequence homology.
This
substantial homology denotes a characteristic of a polynucleotide sequence,
wherein the
polynucleotide comprises a sequence having at least 60 percent sequence
homology,
typically at least 70 percent homology, often 80 to 90 percent sequence
homology, and
most commonly at least 99 percent sequence homology as compared to a reference
sequence of a comparison window of at least 25-50 nucleotides, wherein the
percentage
of sequence homology is calculated by comparing the reference sequence to the
polynucleotide sequence which may include deletions or additions which total
20
percent or less of the reference sequence over the window of comparison.
Sequences having sufficient homology can the be further identified by any
annotations contained in the database, including, for example, species and
activity
information. Accordingly, in a typical environmental sample, a plurality of
nucleic acid
sequences will be obtained, cloned, sequenced and corresponding homologous
sequences from a database identified. This information provides a profile of
the
polynucleotides present in the sample, including one or more features
associated with the
polynucleotide including the organism and activity associated with that
sequence or any
polypeptide encoded by that sequence based on the database information. As
used herein
"fingerprint" or "profile" refers to the fact that each sample will have
associated with it a
set of polynucleotides characteristic of the sample and the environment from
which it
was derived. Such a profile can include the amount and type of sequences
present in the
sample, as well as information regarding the potential activities encoded by
the
polynucleotides and the organisms from which polynucleotides were derived.
This
unique pattern is each sample's profile or fingerprint.
In some instances it may be desirable to express a particular cloned
polynucleotide sequence once its identity or activity is determined or a
suggested
identity or activity is associated with the polynucleotide. In such instances
the desired
clone, if not already cloned into an expression vector, is ligated downstream
of a
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
98
regulatory control element (e.g., a promoter or enhancer) and cloned into a
suitable host
cell. Expression vectors are commercially available along with corresponding
host cells
for use in the invention.
As representative examples of expression vectors which may be used there may
be mentioned viral particles, baculovirus, phage, plasmids, phagemids,
cosmids,
phosmids, bacterial artificial chromosomes, viral nucleic acid (e.g.,
vaccinia, adenovirus,
foul pox virus, pseudorabies and derivatives of SV40), P1-based artificial
chromosomes,
yeast plasmids, yeast artificial chromosomes, and any other vectors specific
for specific
hosts of interest (such as bacillus, aspergillus, yeast, and the like) Thus,
for example, the
DNA may be included in any one of a variety of expression vectors for
expressing a
polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic
DNA
sequences. Large numbers of suitable vectors are known to those of skill in
the art, and
are commercially available. The following vectors are provided by way of
example;
Bacterial: pQE70, pQE60, pQE-9 (Qiagen), psiXl74, pBluescript SK, pBluescript
KS,
pNHBA, pNHl6a, pNHlBA, pNH46A (Stratagene); pTRC99a, pKK223-3, pKK233-3,
pDR540, pRITS (Pharmacia); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG
(Stratagene), pSVK3, pBPV, pMSG, pSVL (Pharmacia). However, any other plasmid
or vector may be used as long as they are replicable and viable in the host.
The nucleic acid sequence in the expression vector is operatively linked to an
appropriate expression control sequences) (promoter) to direct mRNA synthesis.
Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda
PR, PL and
trp. Eukaryotic promoters include CMV immediate early, HSV thyrnidine kinase,
early
and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of
the
appropriate vector and promoter is well within the level of ordinary skill in
the art. The
expression vector also contains a ribosome binding site for translation
initiation and a
transcription terminator. The vector may also include appropriate sequences
for
amplifying expression. Promoter regions can be selected from any desired gene
using
CAT (chloramphenicol transferase) vectors or other vectors with selectable
markers.
In addition, the expression vectors typically contain one or more selectable
marker genes to provide a phenotypic trait for selection of transformed host
cells such as
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
99
dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or
such as
tetracycline or ampicillin resistance in E, coli.
The nucleic acid sequences) selected, cloned and sequenced as hereinabove
described can additionally be introduced. into a suitable host to prepare a
library which is
screened for the desired biomolecule or bioactivity. The selected nucleic acid
is
preferably already in a vector which includes appropriate control sequences
whereby a
selected nucleic acid encoding a biomolecule or bioactivity may be expressed,
for
detection of the desired activity. The host cell can be a higher eukaryotic
cell, such as a
mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host
cell can be a
prokaryotic cell, such as a bacterial cell. The selection of an appropriate
host is deemed
to be within the scope of those skilled in the art from the teachings herein.
In some instances it may be desirable to perform an amplification of the
nucleic
acid sequence present in a sample or a particular clone that has been
isolated. In this
embodiment, the nucleic acid sequence is amplified by PCR reaction or similar
reaction
known to those of skill in the art. Commercially available amplification kits
are
available to carry out such amplification reactions.
In addition, it is important to recognize that the alignment algorithms and
searchable database can be implemented in computer hardware, software or a
combination thereof. Accordingly, the isolation, processing and identification
of nucleic
acid or polypeptide sequences can be implemented in an automated system.
In addition to the sequence based techniques described above, a number of
traditional assay system exist for measuring an enzymatic activity using mufti-
well
plates. For example, existing screening technology usually relies on two-
dimensional
well (e.g., 96-, 384- and 1536-well ) plates. The present invention also
provides a
capillary array-based approach of that has numerous advantages over well-based
screening techniques, including the elimination of the need for fluid
dispensers for
dispensing fluids (e.g., reactants) into individual well reservoirs, and the
reduced cost per
array (e.g., glass capillaries are reusable) (see, for example, U.S. Patent
Application
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
100
Serial No. 09/444,112, filed November 22, 1999, which is incorporated herein
by
reference in its entirety).
Accordingly, the capillaries, capillary array and systems of the invention are
particularly well suited for screening libraries for activity or biomolecules
of interest
including polynucleotides. The screening for activity may be effected on
individual
expression clones or may be initially effected on a mixture of expression
clones to
ascertain whether or not the mixture has one or more specified activities. If
the mixture
has a specified activity, then the individual clones may be rescreened for
such activity or
for a more specific activity after collection from the capillary array.
All headings and subheading used herein are provided for the convenience of
the
reader and should not be construed to limit the invention.
As used herein and in the appended claims, the singular forms "a," "and," and
"the" include plural referents unless the context clearly dictates otherwise.
Thus, for
example, reference to "a clone" includes a plurality of clones and reference
to "the
nucleic acid sequence" generally includes reference to one or more nucleic
acid
sequences and equivalents thereof known to those skilled in the art, and so
forth.
Unless defined otherwise, all technical and scientific terms used herein have
the
same meaning as commonly understood to one of ordinary skill in the art to
which the
invention belongs. Although any methods, devices and materials similar or
equivalent to
those described herein can be used in the practice or testing of the
invention, the
preferred methods, devices and materials described.
All publications mentioned herein are incorporated herein by reference in full
for
the purpose of describing and disclosing the databases, proteins, and
methodologies,
which are described in the publications which might be used in connection with
the
described invention. The publications discussed above and throughout the text
are
provided solely for their disclosure prior to the filing date of the present
application.
Nothing herein is to be construed as an admission that the inventors are not
entitled to
antedate such disclosure by virtue of prior invention.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
101
The invention will now be described in greater detail by reference to the
following non-limiting examples.
EXAMPLES
Example 1
DNA isolation. DNA is isolated using the IsoQuick Procedure as per
manufacture's instructions (Orca Research Inc., Bothell, WA). The isolated DNA
can
optionally be normalized according to Example 2 (below). Upon isolation, the
DNA is
sheared by pushing and pulling the DNA through a 25-gauge double-hub needle
and a 1-
cc syringe about 500 times. A small amount is run on a 0.8% agarose gel to
make sure
the majority of the DNA is in the desired size range (about 3-6kb).
Blunt-ending DNA. The DNA is blunt-ended by mixing 45 p1 of l OX Mung
Bean Buffer, 2.0 ~,1 Mung Bean Nuclease (1050 u/~l) and water to a final
volume of 405
~.1. The mixture is incubated at 37 °C for 15 minutes. The mixture is
phenol;chlorofonn
extracted, followed by an additional chloroform extraction. One ml of ice cold
ethanol is
added to the final extract to precipitate the DNA. The DNA is precipitated for
10
minutes on ice. The DNA is removed by centrifugation in a microcentrifuge for
30
minutes. The pellet is washed with 1 ml of 70% ethanol and repelleted in the
microcentrifuge. Following centrifugation, the DNA is dried and gently
resuspended in
26 ~.1 of TE buffer.
Methylation of DNA. The DNA is methylated by mixing 4 ~,1 of l OX EcoRI
Methylase Buffer, 0.5 ~,1 SAM (32 mM), 5.0 ~.1 EcoRI Methylase (40 u/~.1) and
incubating at 37 °C for 1 hour. In order to insure blunt ends, the
following can be added
to the methylation reaction: 5.0 ~.1 of 100 mM MgCl2, 8.0 ~1 of dNTP mix (2.5
mM of
each dGTP, dATP, dTTP, dCTP), 4.0 ~1 of I~lenow (Sul~,l). The mixture is then
incubated at 12 °C for 30 minutes.
After incubating for 30 minutes 450 ~,11X STE is added. The mixture is
phenol/chloroform extracted once followed by an additional chloroform
extraction. One
ml of ice cold ethanol is added to the final extract to precipitate the DNA.
The DNA is
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
102
precipitated for 10 minutes on ice. The DNA is removed by centrifugation in a
microcentrifuge for 30 minutes. The pellet is washed with 1 ml of 70% ethanol,
repelleted in the microcentrifuge and allowed to dry for 10 minutes.
Ligation. The DNA is ligated by gently resuspending the DNA in 8 ~1 EcoRI
adapters (from Stratagene's cDNA Synthesis Kit), 1.0 ~,l of 10 X ligation
buffer, 1.0 ~1
of 10 mM rATP, 1.0 p1 of T4 DNA Ligase (4Wulpl) and incubating at 4 °C
for 2 days.
The ligation reaction is terminated by heating for 30 minutes at 70
°C.
Phosphorylation of adapters. The adapter ends are phosphorylated by mixing the
ligation reaction with 1.0 p1 of l OX Ligation Buffer, 2.0 p,1 of 10 mM rATP,
6.0 ~,l of
H20, 1.0 ~1 of polynucleotide kinase (PNK), and incubating at 37 °C for
30 minutes.
After incubating for 30 minutes, 31 p1 of H20 and 5 ml of 10 X STE are added
to the
reaction and the sample is size fractionated on a Sephacryl S-500 spin column.
The
pooled fractions (1-3) are phenol/chloroform extracted once, followed by an
additional
chloroform extraction. The DNA is precipitated by the addition of ice cold
ethanol on
ice for 10 minutes. The precipitate is pelleted by centrifugation in a
microcentrifuge at
high speed for 30 minutes. The resulting pellet is washed with 1 ml 70%
ethanol,
repelleted by centrifugation and allowed to dry for 10 minutes. The sample is
resuspended in 10.5 ~.1 TE buffer. The sample is not plated, but is ligated
directly to
lambda arms as described above, except 2.5 ~ul of DNA and no water is used.
Sucrose Gradient (2.2 ml) Size Fractionation. Ligation is stopped by heating
the
sample to 65 °C for 10 minutes. The sample is gently loaded on a 2.2 ml
sucrose
gradient and centrifuged in a mini-ultracentrifuged 45k rpm at 20 °C
for 4 hours (no
brake). Fractions are collected by puncturing the bottom of the gradient tube
with a 20 -
gauge needle and allowing the sucrose to flow through the needle. The first 20
drops are
collected in a Falcon 2059 tube, and then ten 1-drop fractions (labeled 1-10)
are
collected. Each drop is about 60 ~,1 in volume. Five p,1 of each fraction are
run on a
0.8% agarose gel to check the size. Fractions 1-4 (about 10-1.5 kb) are pooled
and, in a
separate tube, fractions 5-7 (about 5-0.5 kb) are pooled. One ml of ice cold
ethanol is
added to precipitate the DNA and then placed on ice for 10 minutes. The
precipitate is
pelleted by centrifugation in a microcentrifuge at high speed for 30 minutes.
The pellets
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
103
are washed by resuspending them in 1 ml of 70% ethanol and repelleting them by
centrifugation in a microcentrifuge at high speed for 10 minutes, and then
dried. Each
pellet is then resuspended in 10 ~.1 of TE buffer.
Test Ligation to Lambda Arms. The assay is plated by spotting 0.5 p,1 of the
sample on agarose containing ethidium bromide along with standards (DNA sample
of
known concentration) to get an approximate concentration. The samples are then
viewed using W light and the estimated concentration is compared to the
standards.
The following ligation reaction (5 ~,1 reactions) are prepared and incubated
at 4
°C overnight, as shown in Table 1 below:
TABLE 1
Sample H20 l OX 10 mM Lambda Insert T4 DNA
Ligase rATP arms (ZAP)DNA Ligase
Fraction 0.5 0.5 g1 0.5 1.0 ~.1 2.0 ~1 0.5 ~1
1-4 w1 ~ ~1
Fraction 0.5 0.5 ~,1 0.5 1.0 ~1 2.0 ~l 0.5 ~1
5-7 ~1 ~,1
Test Package and Plate. The ligation reactions are packaged following
manufacturer's protocol. Packaging reactions are stopped with 500 ~,l SM
buffer and
pooled with packaging that came from the same ligation. One ~,l of each pooled
reaction
is titered on an appropriate host (OD6oo =1.0) (XL1-Blue MRF). 200 p1 host (in
MgSO4) are added to Falcon 2059 tubes, inoculated with 1 p1 packaged phage and
incubated at 37 °C for 15 minutes. About 3 ml of 4~ °C top agar
(50 ml stock containing
150 p1 IPTG (0.5 M) and 300 ~,l X-GAL (350 mg/ml)) are added and plated on 100
mm
plates. The plates are incubated overnight at 37 °C.
Amplification of Libraries (5.0 x 105 recombinants from each library). About
3.0
ml host cells (OD6oo =1.0) are added to two 50 ml conical tubes, inoculated
with 2.5 X
105 pfu of phage per conical tube, and then incubated at 37 °C for 20
minutes. Top agar
is added to each tube to a final volume of 45 ml. Each tube is plated across
five 150 mm
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
104
plates. The plates are incubated at 37 °C for 6-8 hours or until
plaques are about pin-
head in size. The plates are overlaid with 8-10 ml SM Buffer and placed at 4
°C
overnight (with gentle rocking if possible).
Harvest Phage. The phage suspension is recovered by pouring the SM buffer off
each plate into a 50 ml conical tube. About 3 ml of chloroform are added,
shaken
vigorously and incubated at room temperature for 15 minutes. The tubes are
centrifuged
at 2I~ rpm for 10 minutes to remove cell debris. The supernatant is poured
into a sterile
flask, 500 p,1 chloroform are added and stored at 4 °C.
Titer Amplified Library. Serial dilutions of the harvested phage are made (for
example, 10'5 =1 ~.l amplified phage in 1 ml SM Buffer; 10'6 =1 ~1 of the 10-3
dilution
in 1 ml SM Buffer and the like), and 200 p,1 host (in 10 xnM MgS04) are added
to two
tubes. One tube is inoculated with 10 ~,1 of 10'6 dilution (10'5). The other
tube is
inoculated with 1 ~,1 of 10'6 dilution (10'6), and incubated at 37 °C
for 15 minutes.
About 3 ml of 48 °C top agar (50 ml stock containing 150 ~,1 IPTG (0.5
M) and
37 ~1 X-GAL (350 mg/ml)) are added to each tube and plated on 100 mm plates.
The
plates are incubated overnight at 37 °C.
The ZAP II library is excised to create the pBLUESCRIPT library according to
manufacturer's protocols (Stratagene).
The DNA library can be transformed into host cells (e.g., E. coli) to generate
an
expression library of clones.
EXAMPLE 2
Normalization
Prior to library generation, purified DNA can be normalized. DNA is first
fractionated according to the following protocol A sample composed of genomic
DNA
is purified on a cesium-chloride gradient. The cesium chloride (Rf = 1.3980)
solution is
filtered through a 0.2 pm filter and 15 ml is loaded into a 35 ml OptiSeal
tube
(Beckman) The DNA is added and thoroughly mixed. Ten micrograms of bis-
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
105
benzimide (Sigma; Hoechst 33258) is added and mixed thoroughly. The tube is
then
filled with the filtered cesium chloride solution and spun in a Bti50 rotor in
a Beckman
L8-70 Ultracentrifuge at 33k rpm for 72 hours. Following centrifugation, a
syringe
pump and fractionator (Brandel Model 186) are used to drive the gradient
through an
ISCO UA-SUV absorbance detector set to 280 nm. Peaks representing the DNA from
the organisms present in an environmental sample are obtained. Eubacterial
sequences
can be detected by PCR amplification of DNA encoding rRNA from a 10 fold
dilution
of the E. coli peak using the following primers to amplify:
Forward primer: 5'-AGAGTTTGATCCTGGCTCAG-3' (SEQ ID NO:4)
Reverse primer: 5'-GGTTACCTTGTTACGACTT-3' (SEQ ID NO:S)
Recovered DNA is sheared or enzymatically digested to 3-6 kb fragments.
Lone-linker primers are ligated and the DNA is size-selected. Size-selected
DNA is
amplified by PCR, if necessary.
Normalization is then accomplished by resuspending the double-stranded DNA
sample in hybridization buffer (0.12 M NaH2P04, pH 6.8/0..82 M NaCI/1 mM
EDTA/0.1 % SDS). The sample is overlaid with mineral oil and denatured by
boiling for
10 minutes. The sample is incubated at 68 °C for 12-36 hours. Double-
stranded DNA is
separated from single-stranded DNA according to standard protocols (Sambrook,
1989)
on hydroxyapatite at 60 °C. The single-stranded DNA fraction is
desalted and amplified
by PCR. The process is repeated for several more rounds (up to 5 or more).
EXAMPLE 3
Enzymatic Activity Assay
The following is a representative example of a procedure for screening an
expression library, prepared in accordance with Example 1, for hydrolase
activity.
Plates of the library prepared as described in Example 1 are used to multiply
inoculate a single plate containing 200 p1 of LB Amp/Meth, glycerol in each
well. This
step is performed using the High Density Replicating Tool (HDRT) of the
Beckman
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
106
BIOMEK® with a 1% bleach, water, isopropanol, air-dry sterilization cycle
between each inoculation. The single plate is grown for 2h at 37 °C and
is then used to
inoculate two white 96-well Dynatech microtiter daughter plates containing 250
~,1 of
LB Amp/Meth, glycerol in each well. The original single plate is incubated at
37 °C for
18h, then stored at -80 °C The two condensed daughter plates are
incubated at 37 °C also
for 18 h. The condensed daughter plates are then heated at 70 °C for 45
min. to kill the
cells and inactivate the host E. coli enzymes. A stock solution of 5 mg/mL
morphourea
phenylalanyl-7-amino-4-trifluoromethyl coumarin (MuPheAFC, the "substrate") in
DMSO is diluted to 600 E.iM with 50 mM pH 7.5 Hepes buffer containing 0.6
mg/mL of
the detergent dodecyl maltoside. Fifty ~.1 of the 600 E.iM MuPheAFC solution
is added
to each of the wells of the white condensed plates with one 100 ~,1 mix cycle
using the
BIOMEK to yield a final concentration of substrate of about 100 ~.M. The
fluorescence
CF3
O
,) O ~ \
H
N N ~ ~~ O
N
H
O' W
values are recorded (excitation=400 nm, emission=505 nm) on a plate reading
fluorometer immediately after addition of the substrate (t=0). The plate is
incubated at 70
°C for 100 min, then allowed to cool to ambient temperature for 15
additional minutes.
The fluorescence values are recorded again (t=100). The values at t=0 are
subtracted
from the values at t=100 to determine if an active clone is present.
MuPheAFC
The data will indicate whether one of the clones in a particular well is
hydrolyzing the substrate. In order to determine the individual clone which
carries the
activity, the source library plates are thawed and the individual clones are
used to singly
inoculate a new plate containing LB Amp/Meth, glycerol. As above, the plate is
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
107
incubated at 37 °C to grow the cells, heated at 70 °C to
inactivate the host enzymes, and
50 ~,1 of 600 p,M MuPheAFC is added using the Biomek.
After addition of the substrate the t=0 fluorescence values are recorded, the
plate
is incubated at 70 °C, and the t=100 min. values are recorded as above.
These data
indicate which plate the active clone is in.
The enantioselectivity value, E, for the substrate is determined according to
the
equation below:
~[(1-c(1+e~)]
E-____________________________
In[(1-c(1+eep)]
where eeP =the enantiomeric excess (ee) of the hydrolyzed product and c=the
percent conversion of the reaction. See Wong and Wlutesides, Enzymes in
Synthetic
Organic Chemistry, 1994, Elsevier, Tarrytown, N.Y., pp. 9-12.
The enantiomeric excess is determined by either chiral high performance liquid
chromatography (HPLC) or chiral capillary electrophoresis (CE). Assays are
performed
as follows: two hundred ~.1 of the appropriate buffer is added to each well of
a 96-well
white microtiter plate, followed by 50 p1 of partially or completely purified
enzyme
solution; 50 ~1 of substrate is added and the increase in fluorescence
monitored versus
time until 50% of the substrate is consumed or the reaction stops, whichever
comes first.
EXAMPLE 4
Directed Mutagenesis of Positive Enzyme Activity Clones
Directed mutagenesis was performed on two different enzymes (alkaline
phosphatase and (3-glycosidase) to generate new enzymes which exhibit a higher
degree
of activity than the wild-type enzymes.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
108
Alkaline Phosphatase
The XL1-Red strain (Stratagene) was transformed with genornic clone 27a3a (in
plasmid pBluescript) encoding the alkaline phosphatase gene from the organism
OC9a,
an organism isolated from the surface of a whale bone, according to the
manufacturer's
protocol. A 5 ml culture of LB+0.1 mg/ml ampicillin was inoculated with 200
~,l of the
transformation and the culture was allowed to grow at 37 °C for 30
hours. A miniprep
was then performed on the culture, and the isolated DNA screened by
transforming 2 ~.l
of the resulting DNA into XL-1 Blue cells (Stratagene) according to the
manufacturer's
protocol and following the assay procedure outlined below. The mutated OC9a
phosphatase took 10 minutes to develop color and the wild type enzyme took 30
minutes
to develop color in the screening assay.
Standard Alkaline Phos~hatase Screening AssaX
Transformed XLl Blue cells were plated on LB/amp plates. The resulting
colonies were lifted with Duralon UV (Stratagene) or HATF (Millipore)
membranes and
lysed in chloroform vapors for 30 seconds. Cells were heat killed by
incubating for 30
minutes at 85 °C. The filters were developed at room temperature in
BCIP buffer aild
the fastest developing colonies ("positives") were selected for restreaking
the "positives"
onto a BCIP plate (BCIP Buffer: 20 mm CAPS pH 9.0, 1 mm MgCl2, 0.01 mm ZnClz,
0.1 mg/ml BCIP).
Beta-Ghrcosidase
This protocol was used to mutagenize Thermococcus 9N2 Beta-Glycosidase.
PCR was carned out by incubating 2 microliters dNTP's (10 mM Stocks); 10
microliters l OxPCR Buffer; 0.5 microliters Vector DNA-31G1A-100 nanograms; 20
microliters 3' Primer (100 pmol); 20 microliters 5' Primer (100 pmol); 16
microliters
MnCI 4H20 (1.25 mM Stock); 24.5 microliters H20; and 1 microliter Taq
Polymerase
(5.0 Units) in a total volume of 100 microliters. The PCR cycle was: 95
°C 15 seconds;
58 °C 30 seconds; 72 °C 90 seconds; 25 cycles (10 minute
extension at 72 °C -4 °C
incubation).
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
109
Five microliters of the PCR product was run on a 1 % agarose gel to check the
reaction. Purify on a QIAQUICK column (Qiagen). Resuspend in 50 microliters
HZO.
Twenty-five microliters of purified PCR product; 10 microliters NEB Buffer #2;
3 microliters Kpn I (1 OU/microliter); 3 xnicroliters EcoRl (20 U/microliter);
and 59
microliters H20. were incubated for 2 hours at 37 °C to digest the PCR
products and
purified on a QIA.QUICK column (Qiagen). Elute with 35 microliters H20.
Ten microliters of digested PCR product, 5 microliters Vector (cut with
EcoR1/KpnI and phosphatased with shrimp alkaline phosphatase, 4 microliters 5
x
Ligation Buffer, and 1 microliter T4 DNA Ligase (BRL) were incubated overnight
to
ligate the PCR products into the vector.
The resulting vector was transformed into MlSpREP4 cells using
electroporation. 100 or 200 microliters of the cells were plated onto LB amp
meth kan
plates, and grown overnight at 37 °C.
Beta-galactosidase was assayed by (1) Perform colony lifts using Millipore
HATF membrane filters; (2) lyse colonies with chloroform vapor in 150 mm glass
petri
dishes; (3) transfer filters to 100 mm glass petri dishes containing a piece
of Whatman
3MM filter paper saturated with Z buffer containing 1 mg/ml XGLU (After
transfernng
filter bearing lysed colonies to the glass petri dish, maintain dish at room
temperature);
and (4) "Positives" were observed as blue spots on the filter membranes
("positives" are
spots which appear early). A Pasteur pipette (or glass capillary tube) was
used to core
blue spots on the filter membrane. Place the small filter disk in an Eppendorf
tube
containing 20.1 water. Incubate the Eppendorf tube at 75 °C for 5
minutes followed by
vortexing to elute plasmid DNA off filter. Transform this DNA into
electrocompetent E.
coli cells and repeat filter-lift assay on transformation plates to identify
"positives."
Return transformation plates to 37 °C incubator after filter lift to
regenerate colonies.
Inoculate 3 ml LBamp liquid with repurified positives and incubate at 37
°C overnight.
Isolate plasmid DNA from these cultures and sequence plasmid insert. The
filter assay
uses buffer Z (see recipe below) containing 1 mg/ml of the substrate 5-bromo-4-
chloro-
3-indolyl-.beta.-o-glucopyranoside (XGLU) (Diagnostic Chemicals Limited or
Sigma).
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
110
Z-Buffer: (referenced in Miller, J. H. (1992) A Short Course in Bacterial
Genetics, p.
445.) per liter:
NaZHP04 -7Hz0 16.1 g
Na2HP04 -4H20 5.5 g
KCl 0.75 g
NaZHP04 -7H20 0.246 g
6-mercaptoethanol 2.7 ml
Adjust pH to 7.0
Example 5
Construction of a Stable, Large Insert DNA Library of Picoplankton Genomic
DNA
Cell collection and preparation of DNA. Agarose plugs containing concentrated
picoplankton cells were prepared from samples collected on an oceanographic
cruise
from Newport, Oregon to Honolulu, Hawaii. Seawater (30 liters) was collected
in Niskin
bottles, screened through 10 pm Nitex, and concentrated by hollow fiber
filtration
(Amicon DC 10) through 30,000 MW cutoff polyfulfone filters. The concentrated
bacterioplankton cells were collected on a 0.22 burn, 47 mm Durapore filter,
and
resuspended in 1 ml of 2 X STE buffer (1M NaCI, O.1M EDTA, 10 mM Tris, pH 8.0)
to
a final density of approximately 1X101° cells per ml. The cell
suspension was mixed
with one volume of 1% molten Seaplaque LMP agarose (FMC) cooled to
40°C., and
then immediately drawn into a 1 ml syringe. The syringe was sealed with
parafilin and
placed on ice for 10 min. The cell-containing agarose plug was extruded into
10 ml of
Lysis Buffer (10 mM Tris pH 8.0, 50 mM NaCI, O.1M EDTA, 1% Sarkosyl, 0.2%
sodium deoxycholate, 1 mglml lysozyme) and incubated at 37 °C for one
hour. The
agarose plug was then transferred to 40 mls of ESP Buffer (1% Sarkosyl, 1
mg/ml
proteinase K, in O.SM EDTA), and incubated at 55 °C for 16 hours. The
solution was
decanted and replaced with fresh ESP Buffer, and incubated at 55 °C for
an additional
hour. The agarose plugs were then placed in 50 mM EDTA and stored at 4
°C shipboard
for the duration of the oceanographic cruise.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
111
One slice of an agarose plug (72 p1) prepared from a sample collected off the
Oregon coast was dialyzed overnight at 4 °C against 1 mL of buffer A
(100 mM NaCI,
mM Bis Tris Propane-HCI, 100 ~,glml acetylated BSA: pH 7.0 at 25 °C) in
a 2 mL
microcentrifuge tube. The solution was replaced with 250 ,u1 of fresh buffer A
containing
5 10 mM MgCl2 and 1 mM DTT and incubated on a rocking platform for 1 hr at
room
temperature. The solution was then changed to 250 p1 of the same buffer
containing 4U
of Sau3A1 (NEB), equilibrated to 37 °C in a water bath, and then
incubated on a rocking
platform in a 37 °C incubator for 45 min. The plug was transferred to a
1.5 ml
microcentrifuge tube and incubated at 68 °C for 30 min to inactivate
the enzyme and to
10 melt the agarose. The agarose was digested and the DNA dephosphorylased
using
Gelase and HK-phosphatase (Epicentre), respectively, according to the
manufacturer's
recommendations. Protein was removed by gentle phenol/chloroform extraction
and the
DNA was ethanol precipitated, pelleted, and then washed with 70% ethanol. This
partially digested DNA was resuspended in sterile H2O to a concentration of
2.5 ng/p,l
for ligation to the pFOS 1 vector.
PCR amplification results from several of the agarose plugs indicated the
presence of significant amounts of archaeal DNA. Quantitative hybridization
experiments using rRNA extracted from one sample, collected at 200 m of depth
off the
Oregon Coast, indicated that planktonic archaea in (this assemblage comprised
approximately 4.7% of the total picoplankton biomass (this sample corresponds
to
"PACI"-200 m in Table 1 of DeLong et al., Nature, 371:695-698, 1994). Results
from
archaeal-biased rDNA PCR amplification performed on agarose plug lysates
confirmed
the presence of relatively large amounts of archaeal DNA in this sample.
Agarose plugs
prepared from this picoplankton sample were chosen for subsequent fosmid
library
preparation. Each 1 ml agarose plug from this site contained approximately
7.5x105
cells, therefore approximately 5.4x105 cells were present in the 72 p,1 slice
used in the
preparation of the partially digested DNA.
Vector arms were prepared from pFOSl as described (Kim et al., Stable
propagation of cosmid sized human DNA inserts in an F factor based vector,
Nucl.
Acids Res., 20:10832-10835, 1992). Briefly, the plasmid was completely
digested with
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
112
AstII, dephosphorylated with HK phosphatase, and then digested with BamHI to
generate two arms, each of which contained a cos site in the proper
orientation for
cloning and packaging ligated DNA between 35-45 kbp. The partially digested
picoplankton DNA was ligated overnight to the PFOS1 arms in a 15 ~,1 ligation
reaction
containing 25 ng each of vector and insert and 1U of T4 DNA ligase (Boehringer-
Mannheim). The ligated DNA in four microliters of this reaction was ifa vitro
packaged
using the Gigapack XI, packaging system (Stratagene), the fosmid particles
transfected
to E. coli strain DH10B (BRL), and the cells spread onto LB~";15 plates. The
resultant
fosmid clones were picked into 96-well microliter dishes containing LB~".,ls
supplemented with 7% glycerol. Recombinant fosmids, each containing ca. 40 kb
of
picoplankton DNA insert, yielded a library of 3.552 fosmid clones, containing
approximately 1.4x10$ base pairs of cloned DNA. All of the clones examined
contained
inserts ranging from 38 to 42 kbp. This library was stored frozen at -80
°C for later
analysis.
Example 6
Generation of Random Size Polvnucleotides Using U.V. Induced Photoproducts
One microgram samples of template DNA are obtained and treated with U.V
light to cause the formation of dimers, including TT dimers, particularly
purine
dimers. U.V exposure is limited so that only a few photoproducts are generated
per
gene on the template DNA sample. Multiple samples are treated with U.V light
for
varying periods of time to obtain template DNA samples with varying numbers of
dimers from U.V exposure.
A random priming kit which utilizes a non-proofreading polymease (for
example, Prime-It II Random Primer Labeling kit by Stratagene Cloning Systems)
is
utilized to generate different size polynucleotides by priming at random sites
on
templates which are prepared by U.V light (as described above) and extending
along
the templates. The priming protocols such as described in the Prime-It II
Random
Primer Labeling kit may be utilized to extend the primers. The dimers formed
by
U.V exposure serve as a roadblock for the extension by the non-proofreading
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
113
polymerase. Thus, a pool of random size polynucleotides is present after
extension
with the random primers is finished.
Example 7
Isolation of Random Size PolXnucleotides
Polynucleotides of interest which are generated according to Example 1 are
are gel isolated on a 1.5% agarose gel. Polynucleotides in the 100-300 by
range are
cut out of the gel and 3 volumes of 6 M NaI is added to the gel slice. The
mixture is
incubated at 50 °C for 10 minutes and 10 p,1 of glass milk (Bio 101) is
added. The
mixture is spun for 1 minute and the supernatant is decanted. The pellet is
washed
with 500 ~1 of Column Wash (Column Wash is 50% ethanol, lOmM Tris-HCl pH 7.5,
100 mM NaCl and 2.5 mM EDTA) and spin for 1 minute, after which the
supernatant
is decanted. The washing, spinning and decanting steps are then repeated. The
glass
milk pellet is resuspended in 20.1 of H20 and spun for 1 minute. DNA remains
in the
aqueous phase.
Example 8
Shuffling of Isolated Random Size 100-300bp Polynucleotides
The 100-300 by polynucleotides obtained in Example 2 are recombined in an
annealing mixture (0.2 mM each dNTP, 2.2 mM MgCl2, 50 mM ICI, 10 mM Tris-
HCl ph 8.8, 0.1% Triton X-100, 0.3 ~; Taq DNA polymerase, 50 ~1 total volume)
without adding primers. A Robocycler by ~tratagene was used for the annealing
step
with the following program: 95 °C for 30 seconds, 25-50 cycles of [95
°C for 30
seconds, 50 - 60 °C (preferably 58 °C) for 30 seconds, and 72
°C for 30 seconds] and
5 minutes at 72 °C. Thus, the 100-300 by polynucleotides combine to
yield double-
stranded polynucleotides having a longer sequence. After separating out the
reassembled double-stranded polynucleotides and denaturing them to form single
stranded polynucleotides, the cycling is optionally again repeated with some
samples
utilizing the single strands as template and primer DNA and other samples
utilizing
random primers in addition to the single strands.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
114
Example 9
Screening of PolYpe~tides from Shuffled Poh~nucleotides
The polynucleotides of Example 3 are separated and polypeptides are
expressed therefrom. The original template DNA is utilized as a comparative
control
by obtaining comparative polypeptides therefrom. The polypeptides obtained
from
the shuffled polynucleotides of Example 3 are screened for the activity of the
polypeptides obtained from the original template and compared with the
activity
levels of the control. The shuffled polynucleotides coding for interesting
polypeptides
discovered during screening are compared further for secondary desirable
traits.
Some shuffled polynucleotides corresponding to less interesting screened
polypeptides are subjected to reshuffling.
Example 10
Directed Evolution an EnzwSaturationMutagenesis
Site-Saturation Mutagenesis: To accomplish site-saturation mutagenesis every
residue (316) of a dehalogenase enzyme was converted into all 20 amino acids
by site
directed mutagenesis using 32-fold degenerate oligonucleotide primers, as
follows:
1. A culture of the dehalogenase expression construct was grown and a
preparation
of the plasmid was made.
Primers were made to randomize each codon - they have the common structure
X2oNN(G/T)X2o; where X2o represents a 20-base sequence with sufficient
homology
to bind the template, and NN(G/T) is a 32-fold degenerate 3-base sequence that
encodes all 20 amino acids. In alternative aspects, this invention provides
for the use
of, in addition to an N,N,G/T or identically NN(G/T) cassette, any set of
codons that
is serviceable for introducing all 19 amino acid substitutions including (but
not
limited to) a 32-fold degenerate NN(G/C) cassette, a 64-fold degenerate NNN
cassette, a 4g-fold NN(A/C/G) cassette, a 4~-fold NN(A/G/T) cassette, any non-
degenerate set of 19 codons that is serviceable for introducing all 19 amino
acid
substitutions, and any set of 20 codons is serviceable for introducing all 19
amino acid
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
115
substitutions. In yet another alternative aspect, this invention provides that
a subset of
the 20 amino acids is introduced at each of a set of codon positions; an
example of
such a subset can comprise amino acids) selected from a subset based on a
grouping
scheme, which grouping scheme can be, by way of non-limiting exemplification,
the
following grouping scheme with 8 subsets:
~Aromatic (Phe, Trp, Tyr)
~ Aliphatic (Gly, Ala, Val, Leu, Ile)
~ OH-containing (Ser, Tyr, Thr)
~Acidic (Asp, Glu, Asn, Gln)
~ Basic (Lys, Arg, His)
~ Sulfur-containing (Met, Cys)
~Polar (Ser, Thr, Cys, Asn, Gln, Tyr)
~ Non-polar (Gly, Ala, Val, Leu, Ile, Met, Phe,Trp, Pro)
2. A reaction mix of 25 u1 was prepared containing ~50 ng of plasmid template,
125
ng of each primer, 1X native Pfu buffer, 200 uM each dNTP and 2.5 U native Pfu
DNA polymerase
3. The reaction was cycled in a Robo96 Gradient Cycler as follows:
Initial denaturation at 95°C for 1 min
20 cycles of 95°C for 45 sec, 53°C for 1 min and 72°C for
11 min
Final elongation step of 72°C for 10 min
4. The reaction mix was digested with 10 U of DpnI at 37°C for 1 hour
to digest the
methylated template DNA
5. Two u1 of the reaction mix were used to transform 50 u1 of XL1-Blue MRF'
cells
and the entire transformation mix was plated on a large LB-Amp-Met plate
yielding 200-1000 colonies
6. Individual colonies were toothpicked into the wells of 96-well microtiter
plates
containing LB-Amp-IPTG and grown overnight
7. The clones on these plates were assayed the following day
Screening: Approximately 200 clones of mutants for each position were grown in
liquid media (384 well microtiter plates) and screened as follows:
Overnight cultures in 384-well plates were centrifuged and the media
removed. To each well was added 0.06 mL 1 mM Tris/504~- pH 7.8.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
116
2. Made 2 assay plates from each parent growth plate consisting of 0.02 mL
cell
suspension.
3. One assay plate was placed at room temperature and the other at elevated
temperature (initial screen used 55°C) for a period of time (initially
30
minutes).
4. After the prescribed time 0.08 mL room temperature substrate (TCP saturated
1 mM Tris/5042- pH 7.8 with 1.5 mM NaN3 and 0.1 mM bromothymol blue)
was added to each well.
5. Measurements at 620 nm were taken at various time points to generate a
progress curve for each well.
6. Data were analyzed and the kinetics of the cells heated to those not heated
were compared. Each plate contained 1-2 columns (24 wells) of un-mutated
20F12 controls.
7. Wells that appeared to have improved stability were re-grown and tested
under
the same conditions.
Following this procedure nine single site mutations appeared to confer
increased thermal stability on the enzyme. Sequence analysis was performed to
determine of the exact amino acid changes at each position that were
specifically
responsible for the improvement. In sum, the improvement was conferred at 7
sites
by one amino acid change alone, at an eighth site by each of two amino acid
changes,
and at a ninth site by each of three amino acid changes. Several mutants were
then
made each having a plurality of these nine beneficial site mutations in
combination; of
these two mutants proved superior to all the other mutants, including those
with single
point mutations.
Example 11
Direct expression cloning using end-selection
An esterase gene was amplified using 5'phosphorylated primers in a standard
PCR reaction (10 ng template; PCR conditions: 3' 94 C; [1' 94 C; 1' S0 C;
1'30" 68
C] x 30; 10' 68 C.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
117
Forward Primer = 9511TopF
(CTAGAAGGGAGGAGAATTACATGAAGCGGCTTTTAGCCC)
Reverse Primer = 9511TopR (AGCTAAGGGTCAAGGCCGCACCCGAGG)
The resulting PCR product (ca.1000 bp) was gel purified and quantified.
A vector for expression cloning, pASK3 (Institut fuer Bioanalytik, Goettingen,
Germany), was cut with Xba I and Bgl II and dephosphorylated with CIP.
0.5 pmoles Vaccina Topoisomerase I (Invitrogen, Carlsbad, CA) was added to
60 ng (ca. 0.1 pmole) purified PCR product for 5' 37 C in buffer NEB I (New
England Biolabs, Beverly, MA) in 5 ~,l total volume.
The topogated PCR product was cloned into the vector pASK3 (5 ~l, ca. 200 ng
in
NEB I) for 5' at room temperature.
This mixture was dialyzed against H20 for 30'.
2 ~,1 were used for electroporation of DH10B cells (Gibco BRL, Gaithersburg,
MD).
Efficiency: Based on the actual clone numbers this method can produce 2 x
106 clones per ~g vector. All tested recombinants showed esterase activity
after
induction with anhydrotetracycline.
Example 12
Dehalogenase Thermal Stability
This invention provides that a desirable property to be generated by directed
evolution is exemplified in a limiting fashion by an improved residual
activity (e.g. an
enzymatic activity, an immunoreactivity, an antibiotic activity, etc.) of a
molecule
upon subjection to altered environment, including what may be considered a
harsh
enviroment, for a specified time. Such a harsh environment may comprise any
combination of the following (iteratively or not, and in any order or
permutation): an
elevated temperature (including a temperature that may cause denaturation of a
working enzyme), a decreased temperature, an elevated salinity, a decreased
salinity,
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
118
an elevated pH, a decreased pH, an elevated pressure, a decreased pressure,
and an
change in exposure to a radiation source (including uv radiation, visible
light, as well
as the entire electromagnetic spectrum).
According to this invention a desirable property, such as an improved residual
activity can be an improved activity (e.g. higher activity) after a certain
period of
maintenance in a harsh environment (e.g. higher temperature, lower
temperature,
higher pH, lower pH, higher salinity, lower salinity, increased organic
solvent
presence, lower organic solvent presence, etc. ) can comprise a selection
criterion for
a screening or selection step following the application of a directed
evolution step,
such as, but not limited to, an end-selection-based step, an exonuclease
treatment-
based step, a site-saturation mutagenesis-based step, or a synthetic ligation
reassembly-based step.
According to another aspect of this invention a desirable property, such as an
improved residual activity an improved activity (e.g. higher activity) after
exposure
to, followed by removal from, a harsh environment (e.g. higher temperature,
lower
temperature, higher pH, lower pH, higher salinity, lower salinity, increased
organic
solvent presence, lower organic solvent presence, etc. ) can comprise a
selection
criterion for a screening or selection step following the application of a
directed
evolution step, such as, but not limited to, an end-selection-based step, an
exonuclease
treatment-based step, a site-saturation mutagenesis-based step, or a synthetic
ligation
reassembly-based step.
In a preferred embodiment, the residual activity results from an increased
ability of a molecule to regain, after subjection to denaturing conditions, an
active 3-
dimensional form (including the original 3-dimensional form, a 3-dimensional
form
that is similar to the original 3-dimensional form, or a 3-dimensional form
that is
different than the original 3-dimensional form). This ability to re-fold is
sometimes
referred to as "reversibility of denaturation" or "re-naturation ability" or
"denaturation-renaturation reversibility" and is a selection parameter
according to this
invention.
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
119
The following example shows an application of directed evolution to evolve
the ability of an enzyme to regain &/or retain activity upon exposure to an
elevated
temperature.
Every residue (316) of a dehalogenase enzyme was converted into all 20 amino
acids
by site directed mutagenesis using 32-fold degenerate oligonucleotide primers.
These
mutations were introduced into the already rate-improved variant Dhla 20F12.
Approximately 200 clones of each position were grown in liquid media (384 well
microtiter plates) to be screened. The screening procedure was as follows:
1. Overnight cultures in 384-well plates were centrifuged and the media
removed. To each well was added 0.06 mL 1 mM Tris/SO42- pH 7.8.
2. The robot made 2 assay plates from each parent growth plate consisting of
0.02 mL cell suspension.
3. One assay plate was placed at room temperature and the other at elevated
temperature (initial screen used 55°C) for a period of time (initially
30
minutes).
4. After the prescribed time 0.08 mL room temperature substrate (TCP saturated
1 mM Tris/S04a- pH 7.8 with 1.5 mM NaN3 and 0.1 mM bromothymol blue)
was added to each well. TCP = trichloropropane.
5. Measurements at 620 nm were taken at various time points to generate a
progress curve for each well.
6. Data were analyzed and the kinetics of the cells heated to those not heated
were compared. Each plate contained 1-2 columns (24 wells) of un-mutated
20F12 controls.
7. Wells that appeared to have improved stability were regrown and tested
under
the same conditions.
Following this procedure nine single site mutations appeared to confer
increased
thermal stability on Dhla-20F12. Sequence analysis showed that the following
changes were beneficial:
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
120
D89G
F91S
T159L
G189Q, G189V
I220L
N238T
W251Y
15
P302A, P302L, P302S, P302K
P302R/S306R
Only two sites (189 and 302) had more than one substitution. The first 5 on
the list
were combined (using G189Q) into a single gene (this mutant is referred to as
"DhlaS"). All changes but S306R were incorporated into another variant
referred to
as Dhla8.
Thermal stability was assessed by incubating the enzyme at the elevated
temperature
(55°C and 80°C) for some period of time and activity assay at
30°C. Initial rates were
plotted vs. time at the higher temperature. The enzyme was in 50 mM Tris/S04
pH
7.8 for both the incubation and the assay. Product (C1-) was detected by a
standard
method using Fe(N03)3 and HgSCN. Dhla 20F12 was used as the de facto wild
type.
The apparent half life (Tli2) was calculated by fitting the data to an
exponential decay
function.
Thermal stability of Dhla 5 dehalogenase at 55°C. Purified protein
in 50 mM
Tris/S04z~ pH 7.8 was incubated at 55°C for variable times and aliquots
were removed
to assay for trichloropropane (TCP) hydrolysis. The assay was performed in 50
mM
Tris/SO42- pH 7.8, 30°C with 10 mM TCP. Product (C1-) release was
analyzed by a
standard Cl- assay. Initial rates (A450/min) were derived from the enzyme
progress
curves and plotted vs. incubation time. The data are fit to an exponential
decay
(C*exp'~'t) where tl~a= ln2/k. (see Figure 13).
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
121
Enzyme progress curves for Dhla 5 and 20F12 at 30°C and 55°C
(see Figure 14).
The reaction was performed in 50 mM Tris/5042-, pH 7.8 with 10 mM TCP using
purified protein. Equal amounts of protein were used in each assay. Product
(C1-)
concentration was determined at variable times using a standard Cl- assay.
Dhla 5
appears to have the same specific activity as 20F12 at both 30°C and
55°C but the
enzyme continues to turn over after 20F12 is thermally inactivated.
Thermal stability of Dhla 5 dehalogenase at 80°C. Purified protein
in 50 mM
Tris/5042- pH 7.8 was incubated at 80°C for variable times and aliquots
were removed
to assay for trichloropropane (TCP) hydrolysis. The assay was performed in 50
mM
Tris/5042- pH 7.8, 30°C with 10 mM TCP. Product (C1-) release was
analyzed by a
standard Cl- assay. Initial rates (A450/min) were derived from the enzyme
progress
curves and plotted vs. incubation time. The data are fit to an exponential
decay
(C*exp kt) where tli2 = ln2/k. (see Figure 15).
Thermal stability of Dhla 5 and Dhla 8 dehalogenase at 80°C. Purified
protein in 50
mM Tris/SO4a- pH 7.8 was incubated at 80°C for variable times and
aliquots were
removed to assay for trichloropropane (TCP) hydrolysis. The assay was
performed in
50 mM Tris/SO~a- pH 7.8, 30°C with 10 mM TCP. Product (C1-) release was
analyzed
by a standard Cl- assay. Initial rates (A450/min) were derived from the enzyme
progress curves and relative rates were plotted vs. incubation time. The data
are fit to
an exponential decay (C*exp-kt) where tli2 = ln2/k giving values of 13 and 138
minutes
for Dhla 5 and Dhla 8, respectively. (see Figure 16).
Differential scanning calorimetry of the three dehalogenase variants is shown
in
Figures 17 A, B and C. The data were recorded using a Perkin Elmer Pyris 1 at
a
scan rate of 10°C/min. The protein concentration was 10 mg/ml in 40 ~,1
(0.4 mg total
protein). The buffer was 10 mM NaP; pH 7.5. The melting temperatures derived
from the data are: 68°C (20F12), 73°C (Dhla 5) and 73°C
(Dhla 8). The data also
indicate that 20F12 undergoes irreversible denaturation, Dhla 5 is partially
reversible
and Dhla 8 is fully reversible. (see Figure 17).
CA 02391626 2002-05-14
WO 02/22810 PCT/USO1/29712
122
Thermal stability of wild type (20F12) and mutant (Dhla 5) dehalogenase at
55°C.
Purified protein in 50 mM TrislS042- pH 7.8 was incubated at 55°C for
variable times
and aliquots were removed to assay for trichloropropane (TCP) hydrolysis. The
assay
was performed in 50 mM Tris/5042- pH 7.8, 30°C with 10 mM TCP. Product
(C1-)
release was analyzed by a standard Cl- assay. Initial rates (A450/min) were
derived
from the enzyme progress curves and plotted vs: incubation time. The data are
fit to
an exponential decay (C*exp kt) where tli2 = ln2/k. (see Figure ~12)
Numerous modifications and variations of the present invention are possible in
light of the above teachings; therefore, within the scope of the claims, the
invention may
be practiced other than as particularly described. While the invention has
been described
in detail with reference to certain preferred embodiments thereof, it will be
understood
that modifications and variations are within the spirit and scope of that
which is
described and claimed.
