Note: Descriptions are shown in the official language in which they were submitted.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
HUMAN ZVEN PROTEINS
s
TECHNICAL FIELD
The present invention relates generally to new polypeptides having
to diagnostic and therapeutic uses. In particular, the present invention
relates to
polypeptides, designated "Zvenl" and "Zven2," and to nucleic acid molecules
encoding
the Zven polypeptides.
BACKGROUND OF THE INVENTION
15 Cellular differentiation of multicellular organisms is controlled by
hormones and polypeptide growth factors. These diffusable molecules allow
cells to
communicate with each other, to act in concert to form tissues and organs, and
to repair
and regenerate damaged tissue. Examples of hormones and growth factors include
the
steroid hormones, parathyroid hormone, follicle stimulating hormone, the
interferons,
20 the interleukins, platelet derived growth factor, epidermal growth factor,
and
granulocyte-macrophage colony stimulating factor, among others.
Hormones and growth factors influence cellular metabolism by binding
to receptor proteins. Certain receptors are integral membrane proteins that
bind with
the hormone or growth factor outside the cell, and that are linked to
signaling pathways
25 within the cell, such as second messenger systems. Other classes of
receptors are
soluble intracellular molecules.
Wnt proteins are emerging as one of the pre-eminent families of
signaling molecules in animal development. To date, murine Wnt genes include
Wnt-l,
Wnt-2, Wnt-2Bl13, Wnt-3, Wnt-3A, Wnt-4, Wnt-SA, Wnt-SB, Wnt-6, Wnt-7A, Wnt-7B,
30 Wnt-8A, Wnt-8B, Wnt-10A, Wnt-IOB, Wnt-ll , and Wnt-I5, while the following
human
Wnt genes have been described: Wnt-1, Wnt-2, Wnt-2Bl13, Wnt-3, Wnt-4, Wnt-SA,
Wnt-
7A, Wnt-8A, Wnt-8B, Wnt-10B, Wnt-11, Wnt-14, and Wnt-15. See, for example,
Nusse
and Varmus, Cell 31:99 (1982), van Ooyen et al., EMBO J. 4:2905 (1985),
Wainwright
et al., EMBO J. 7:1743 (1988), McMahon and McMahon, Development 107:643
35 (1989), Gavin et al., Genes Dev. 4:2319 (1990), Roelink et al., Proc. Nat'l
Acad. Sci.
USA 87:4519 (1990), Roelink and Nusse, Genes Dev. 5:381 (1991), Clark et al.,
Genomics 18:249 (1993), Roelink et al., Genomics 17:790 (1993), Adamson et
al.,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
2
Genomics 24:9 (1994), Huguet et al., Cancer Res. 54:2615 (1994), Bouillet,
Mech. Dev.
58:141 (1996), Ikegawa et al., Cytogenet. Cell Genet. 74:149 (1996), Katoh et
al.,
Oncogene 13:873 (1996), Lako et al., Genomics 35:386 (1996), Wang and
Shackleford,
Oncogene 13:1537 (1996), Bergstein, Genomics 46:450 (1997), Bui et al.,
Oncogene
14:1249 (1997), and Grove et al., Development 125:2315 (1998).
Wnt genes typically encode secreted glycoproteins having 350-400
amino acids, and the proteins often include a conserved pattern of 23-24
cysteine
residues in addition to other invariant residues (Cadigan and Nusse, Genes &
Dev.
11:3286 (1997)). Following cellular secretion, Wnt proteins are believed to
reside
l0 mainly in the extracellular matrix or to associated with the cellular
surface.
According to the classical Wnt signaling pathway model, Wnt proteins
induce gene expression by de-repressing a signal pathway via a so-called
"Frizzled"
transmembrane receptor (see, for example, Brown and Moon, Curr. Opin. Cell
Biol.
10:182 (1998)). In the absence of Wnt, glycogen synthase kinase-3(3 activity
results in
~5 the degradation of the free cytosolic pool of ~3-catenin. The association
of cognate Wnt
proteins and Frizzled receptors leads to the activation of a signaling
pathway. The most
proximal intracellular component of this pathway is the Disheveled protein,
which
becomes phosphorylated and inhibits glycogen synthase kinase-3(3.
Consequently, the
pool of intracellular (3-catenin increases, and (3-catenin can interact with
members of the
20 lymphoid enhancer/T cell factor (LEF/TCF) family of architectural
transcription factors
in the nucleus. These complexes bind consensus LEF/TCF sites in promoters and
induce transcription of Wnt-responsive genes.
The Wnt proteins are multipotent, and the proteins are capable of
inducing different biological responses in both embryonic and adult contexts
(see, for
25 example, Ingham, TIG 12:382 (1996)). This type of broad activity is shared
with
fibroblast growth factors, transforming growth factors Vii, and nerve growth
factors
(Nusse and Varmus, Cell 69:1073 (1992)). When over-expressed, Wnt proteins can
promote tumor formation (Erdreich-Epstein and Shackleford, Growth Factors
15:149
(1998)). Knock-out mutations in mice have shown Wnt proteins to be essential
for
3o brain development, and the out growth of embryonic primordia for kidney,
tail bud and
limb bud (McMahon and Bradley, Cell 62:1073 (1990), Thomas and Capecchi,
Nature
346:847 (1990), Stark et al., Nature 372:679 (1994), Takada et al., Genes Dev.
8:174
(1994), and Parr and McMahon, Nature 374:350 (1995)).
Several secreted factors inhibit Wnt signaling (see, for example, Finch et
35 al., Proc. Nat'l Acad. Sci. USA 94:6770 (1997); Moon et al., Cell 88:725
(1997);
Luyten et al., WO 98/16641); Brown and Moon, Curr. Opin. Cell Biol. 10:182
(1998);
Aikawa et al., J. Cell. Sci. 112:3815 (1999)). The Frzb proteins, for example,
bind to
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
3
secreted Wnt proteins and prevent productive interactions between Wnt and
Frizzled
proteins. These proteins contain a region that is homologous to a putative Wnt-
binding
domain of Frizzled proteins. Wnt-inhibitory factor-1 is another type of
secreted
protein, which binds to Wnt proteins and inhibits Wnt signaling (Hsieh et al.,
Nature
398:431 (1999)). Wnt-inhibitory factor-1 proteins are produced by fish,
amphibia, and
mammals, indicating the importance of these inhibitory proteins (Hsieh et al.,
Nature
398:431 (1999)).
Inhibitors of Wnt signaling can be used to block the inducement of
tumor formation by inappropriate Wnt expression. Accordingly, a need exists
for the
to provision of new Wnt inhibitory proteins.
BRIEF SUMMARY OF THE INVENTION
The present invention provides members of a new human gene family,
designated as "Zven," and, in particular, illustrative members of the gene
family,
designated "Zvenl" and "Zven2." The present invention also provides Zvenl and
Zven2 polypeptides and fusion proteins, nucleic acid molecules encoding such
polypeptides and proteins, and methods for using these nucleotide and amino
acid
sequences.
DESCRIPTION OF THE INVENTION
1. Overview
The present invention provides nucleic acid molecules that encode
human Zven polypeptides. An illustrative nucleic acid molecule containing a
sequence
that encodes the Zvenl polypeptide has the nucleotide sequence of SEQ ID NO:1.
The
encoded polypeptide has the following amino acid sequence: MRSLCCAPLL
LLLLLPPLLL TPRAGDAAVI TGACDKDSQC GGGMCCAVSI WVKSIRICTP
MGKLGDSCHP LTRKVPFFGR RMHHTCPCLP GLACLRTSFN RFICLAQK (SEQ
ID N0:2). Thus, the Zvenl nucleotide sequence described herein encodes a
polypeptide
of 108 amino acids. The putative signal sequences of Zvenl polypeptide reside
at
amino acid residues 1 to 20, 1 to 21, and 1 to 22 of SEQ ID N0:2.
Zvenl is expressed in eosinophils, and northern analysis indicates Zvenl
gene expression is present in human testicular tissue and peripheral blood
lymphocytes.
As described in Example l, Zvenl is expressed in B cell, T cell, monocyte, and
granulocyte cell lines. Moreover, Zvenl gene expression was detectable in
unactivated
monocytes, but not in activated monocytes. Thus, Zvenl gene expression can be
used to
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
4
differentiate between unactivated and activated monocytes. Example 2 describes
studies, which indicate that Zvenl can inhibit the proliferation of lung tumor
cells. The
Zvenl gene resides in human chromosome 3p21.1 - 3p14.3.
An illustrative nucleic acid molecule containing a sequence that encodes
the Zven2 polypeptide has the nucleotide sequence of SEQ ID N0:4. The encoded
polypeptide has the following amino acid sequence: MRGATRVSIM LLLVTVSDCA
VITGACERDV QCGAGTCCAI SLWLRGLRMC TPLGREGEEC HPGSHKVPFF
RKRKHHTCPC LPNLLCSRFP DGRYRCSMDL KNINF (SEQ ID NO:S). Thus, the
Zven2 nucleotide sequence described herein encodes a polypeptide of 105 amino
acids.
The putative signal sequences of Zven2 polypeptide reside at amino acid
residues 1 to
17, and 1 to 19 of SEQ >D NO:S.
Northern analyses show that the Zven2 gene is highly expressed in
human testicular and ovarian tissue. High levels of Zven2 gene expression were
also
detected in placenta, adrenal gland, and prostate. In contrast, little or no
Zven2 gene
expression was evident in heart, brain, lung, small intestine, liver, skeletal
muscle,
kidney, pancreas, spleen, thymus, colon, peripheral blood lymphocytes,
stomach,
thyroid, spinal cord, lymph node, trachea, and bone marrow. Accordingly, Zven2
nucleic acid probes and anti-Zven2 antibodies can be used to differentiate
between
various tissues.
2o Sequence analysis revealed a homology relationship between Zven2 and
dkk-1, a potent inhibitor of Wnt action reported in amphibians and humans
(Glinka et
al., Nature 391:357 (1998); Fedi et al., J. Biol. Chem. 274:19465 (1999)).
Since the
activation of Wnt signaling can contribute to the neoplastic process, a Wnt
inhibitor can
provide a useful therapeutic protein.
As described below, the present invention provides isolated polypeptides
comprising an amino acid sequence that is at least 70%, at least 75%, at least
80%, at
least 85%, at least 90%, or at least 95% identical to amino acid residues 23
to 108 of
SEQ ID N0:2. Certain of such isolated polypeptides can specifically bind with
an
antibody that specifically binds with a polypeptide consisting of the amino
acid
sequence of SEQ >D N0:2. Particular polypeptides can inhibit the proliferation
of lung
tumor cells. An illustrative polypeptide is a polypeptide that comprises the
amino acid
sequence of SEQ >D N0:2.
Similarly, the present invention includes provides isolated polypeptides
comprising an amino acid sequence that is at least 70%, at least 75%, at least
80%, at
least 85%, at least 90%, or at least 95% identical to amino acid residues 20
to 105 of
SEQ ID NO:S, wherein such isolated polypeptides can specifically bind with an
antibody that specifically binds with a polypeptide consisting of the amino
acid
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
sequence of SEQ m NO:S. An illustrative polypeptide is a polypeptide that
comprises
the amino acid sequence of SEQ >D N0:5.
The present invention also provides polypeptides comprising an amino
acid sequence selected from the group consisting of: (1) amino acid residues
21 to 108
5 of SEQ ID N0:2, (2) amino acid residues 22 to 108 of SEQ ID N0:2, (3) amino
acid
residues 23 to 108 of SEQ >D N0:2, (4) amino acid residues 82 to 108 of SEQ ID
N0:2, (5) amino acid residues 1 to 78 (amide) of SEQ ID N0:2, (6) amino acid
residues 1 to 79 of SEQ ID N0:2, (7) amino acid residues 21 to 78 (amide) of
SEQ ~
N0:2, (8) amino acid residues 21 to 79 of SEQ ID N0:2, (9) amino acid residues
22 to
t0 78 (amide) of SEQ ID N0:2, (10) amino acid residues 22 to 79 of SEQ >D
N0:2, (11)
amino acid residues 23 to 78 (amide) of SEQ >D N0:2, (12) amino acid residues
23 to
79 of SEQ ID N0:2, (13) amino acid residues 20 to 108 of SEQ ID N0:2, (14)
amino
acid residues 20 to 72 of SEQ >D N0:2, (15) amino acid residues 20 to 79 of
SEQ ID
N0:2, (16) amino acid residues 20 to 79 (amide) of SEQ ID N0:2, (17) amino
acid
~5 residues 21 to 72 of SEQ ID N0:2, (18) amino acid residues 21 to 79 (amide)
of SEQ
ID N0:2, (19) amino acid residues 22 to 72 of SEQ ID N0:2, (20) amino acid
residues
22 to 79 (amide) of SEQ >D N0:2, (21 ) amino acid residues 23 to 72 of SEQ >I7
N0:2,
(22) amino acid residues 23 to 79 (amide) of SEQ >D N0:2, (23) amino acid
residues
28 to 108 of SEQ ID N0:2, (24) amino acid residues 28 to 72 of SEQ 1D N0:2,
(25)
2o amino acid residues 28 to 79 of SEQ ID N0:2, (26) amino acid residues 28 to
79
(amide) of SEQ >D N0:2, (27) amino acid residues 75 to 108 of SEQ ID N0:2,
(28)
amino acid residues 75 to 79 of SEQ ID N0:2, and (29) amino acid residues 75
to 78
(amide) of SEQ ID N0:2. lllustrative polypeptides consist of amino acid
sequences (1)
to (29).
25 The present invention further includes polypeptides comprising an
amino acid sequence selected from the group consisting of: (a) amino acid
residues 20
to 105 of SEQ ID N0:5, (b) amino acid residues 18 to 105 of SEQ >D N0:5, (c)
amino
acid residues 1 to 70 of SEQ >D N0:5, (d) amino acid residues 20 to 70 of SEQ
ID
N0:5, (e) amino acid residues 18 to 70 of SEQ ID N0:5, (f) amino acid residues
76 to
30 105 of SEQ >D NO:S, (g) amino acid residues 66 to 105 of SEQ ID N0:5, and
(h)
amino acid residues 82 to 105 of SEQ ID NO:S. Illustrative polypeptides
consist of
amino acid sequences (a) to (h).
The present invention further provides antibodies and antibody
fragments that specifically bind with such polypeptides. Exemplary antibodies
include
35 polyclonal antibodies, marine monoclonal antibodies, humanized antibodies
derived
from marine monoclonal antibodies, and human monoclonal antibodies.
Illustrative
antibody fragments include F(ab')Z, F(ab)2, Fab', Fab, Fv, scFv, and minimal
recognition
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
6
units. The present invention also includes anti-idiotype antibodies that
specifically bind
with such antibodies or antibody fragments. The present invention further
includes
compositions comprising a carrier and a peptide, polypeptide, antibody, or
anti-idiotype
antibody described herein.
The present invention also provides isolated nucleic acid molecules that
encode a Zven polypeptide, wherein the nucleic acid molecule is selected from
the
group consisting of (a) a nucleic acid molecule comprising the nucleotide
sequence of
SEQ ID N0:3, (b) a nucleic acid molecule encoding the amino acid sequence of
SEQ
117 N0:2, (c) a nucleic acid molecule that remains hybridized following
stringent wash
1o conditions to a nucleic acid molecule consisting of the nucleotide sequence
of
nucleotides 66 to 161 of SEQ m NO:1, the nucleotide sequence of nucleotides
288 to
389 of SEQ m NO:1, or to the complement of the nucleotide sequence of either
nucleotides 66 to 161 of SEQ 1D NO:1 or nucleotides 288 to 389 of SEQ ID NO:1,
(d)
a nucleic acid molecule comprising the nucleotide sequence of SEQ ~ N0:6, (e)
a
nucleic acid molecule encoding the amino acid sequence of SEQ ID N0:5, (f) a
nucleic
acid molecule that remains hybridized following stringent wash conditions to a
nucleic
acid molecule consisting of the nucleotide sequence of nucleotides 334 to 405
of SEQ
1D N0:4, or to the complement of the nucleotide sequence of nucleotides 334 to
405 of
SEQ >D N0:4.
lllustrative nucleic acid molecules include those in which any difference
between the amino acid sequence encoded by the nucleic acid molecule and the
corresponding amino acid sequence of either SEQ ID N0:2 or SEQ D) N0:5 is due
to a
conservative amino acid substitution. The present invention further
contemplates
isolated nucleic acid molecules that comprise a nucleotide sequence of
nucleotides 132
to 389 of SEQ ID NO:1, and nucleotides 148 to 405 of SEQ ID N0:4.
The present invention also includes vectors and expression vectors
comprising such nucleic acid molecules. Such expression vectors may comprise a
transcription promoter, and a transcription terminator, wherein the promoter
is operably
linked with the nucleic acid molecule, and wherein the nucleic acid molecule
is
operably linked with the transcription terminator. The present invention
further
includes recombinant host cells comprising these vectors and expression
vectors.
Illustrative host cells include bacterial, yeast, avian, fungal, insect,
mammalian, and
plant cells. Recombinant host cells comprising such expression vectors can be
used to
prepare Zven polypeptides by culturing such recombinant host cells that
comprise the
expression vector and that produce the Zven protein, and, optionally,
isolating the Zven
protein from the cultured recombinant host cells. The present invention
further
includes products made by such processes.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
7
In addition, the present invention provides pharmaceutical compositions
comprising a pharmaceutically acceptable carrier and at least one of such an
expression
vector or recombinant virus comprising such expression vectors.
The present invention also contemplates methods for detecting the
presence of Zvenl RNA in a biological sample, comprising the steps of (a)
contacting a
Zven 1 nucleic acid probe under hybridizing conditions with either (i) test
RNA
molecules isolated from the biological sample, or (ii) nucleic acid molecules
synthesized from the isolated RNA molecules, wherein the probe has a
nucleotide
sequence comprising a portion of the nucleotide sequence of SEQ ID NO:1, or
its
complement, and (b) detecting the formation of hybrids of the nucleic acid
probe and
either the test RNA molecules or the synthesized nucleic acid molecules,
wherein the
presence of the hybrids indicates the presence of Zvenl RNA in the biological
sample.
Analogous methods can be used to detect the presence of Zven2 RNA in a
biological
sample, wherein the probe has a nucleotide sequence comprising a portion of
the
~ 5 nucleotide sequence of SEQ >D N0:4, or its complement.
The present invention further provides methods for detecting the
presence of Zven polypeptide in a biological sample, comprising the steps of:
(a)
contacting the biological sample with an antibody or an antibody fragment that
specifically binds with a polypeptide either consisting of the amino acid
sequence of
2o SEQ ID N0:2 or consisting of the amino acid sequence of SEQ ID NO:S,
wherein the
contacting is performed under conditions that allow the binding of the
antibody or
antibody fragment to the biological sample, and (b) detecting any of the bound
antibody
or bound antibody fragment. Such an antibody or antibody fragment may further
comprise a detectable label selected from the group consisting of
radioisotope,
25 fluorescent label, chemiluminescent label, enzyme label, bioluminescent
label, and
colloidal gold.
Illustrative biological samples include human tissue, such as an autopsy
sample, a biopsy sample, and the like.
The present invention also provides kits for performing these detection
3o methods. For example, a kit for detection of Zvenl gene expression may
comprise a
container that comprises a nucleic acid molecule, wherein the nucleic acid
molecule is
selected from the group consisting of (a) a nucleic acid molecule comprising
the
nucleotide sequence of nucleotides 66 to 161 of SEQ ID NO:1, (b) a nucleic
acid
molecule comprising the nucleotide sequence of nucleotides 288 to 389 of SEQ
ID
35 NO:1, (c) a nucleic acid molecule comprising the complement of the
nucleotide
sequence of nucleic acid molecules (a) or (b), (d) a nucleic acid molecule
that is a
fragment of (a) consisting of at least eight nucleotides, (e) a nucleic acid
molecule that
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
8
is a fragment of (b) consisting of at least eight nucleotides, and (f) a
nucleic acid
molecule that is a fragment of (c) consisting of at least eight nucleotides. A
kit for
detection of Zven2 gene expression may comprise a container that comprises a
nucleic
acid molecule, wherein the nucleic acid molecule is selected from the group
consisting
of (a) a nucleic acid molecule comprising the nucleotide sequence of
nucleotides 334 to
405 of SEQ >D N0:4, (b) a nucleic acid molecule comprising the complement of
the
nucleotide sequence of (a), (c) a nucleic acid molecule that is a fragment of
(a)
consisting of at least eight nucleotides, and (d) a nucleic acid molecule that
is a
fragment of (b) consisting of at least eight nucleotides. Such kits may also
comprise a
second container that comprises one or more reagents capable of indicating the
presence
of the nucleic acid molecule.
On the other hand, a kit for detection of Zven protein may comprise a
container that comprises an antibody, or an antibody fragment, that
specifically binds
with a polypeptide consisting of the amino acid sequence of SEQ >D N0:2 or
consisting
of the amino acid sequence of SEQ >D NO:S.
The present invention also contemplates anti-idiotype antibodies, or anti-
idiotype antibody fragments, that specifically bind an antibody or antibody
fragment
that specifically binds a polypeptide consisting of the amino acid sequence of
SEQ >D
N0:2 or the amino acid sequence of SEQ ID NO:S.
The present invention further provides variant Zvenl polypeptides,
which comprise an amino acid sequence that shares an identity with the amino
acid
sequence of SEQ 1D N0:2 selected from the group consisting of at least 70%
identity,
at least 80% identity, at least 90% identity, at least 95% identity, or
greater than 95%
identity, and wherein any difference between the amino acid sequence of the
variant
polypeptide and the amino acid sequence of SEQ >D N0:2 is due to one or more
conservative amino acid substitutions. lllustrative variant Zven2
polypeptides, which
comprise an amino acid sequence that shares an identity with the amino acid
sequence
of SEQ ID NO:S selected from the group consisting of at least 70% identity, at
least
80% identity, at least 90% identity, at least 95% identity, or greater than
95% identity,
and wherein any difference between the amino acid sequence of the variant
polypeptide
and the amino acid sequence of SEQ >D NO:S is due to one or more conservative
amino
acid substitutions.
The present invention also provides fusion proteins comprising a Zven 1
polypeptide moiety or a Zven2 polypeptide moiety. Such fusion proteins can
further
comprise an immunoglobulin moiety. A suitable immunoglobulin moiety is an
immunoglobulin heavy chain constant region, such as a human Fc fragment. The
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
9
present invention also includes isolated nucleic acid molecules that encode
such fusion
proteins.
The present invention also includes methods of inhibiting the
proliferation of tumor cells (e.g., lung tumor cells), comprising the step of
administering a composition comprising Zvenl to the tumor cells. In an in vivo
approach, the composition is a pharmaceutical composition, administered in a
therapeutically effective amount to a subject, which has a tumor. Such in vivo
administration can provide at least one physiological effect selected from the
group
consisting of decreased number of tumor cells, decreased metastasis, decreased
size of a
1o solid tumor, and increased necrosis of a tumor.
These and other aspects of the invention will become evident upon
reference to the following detailed description. In addition, various
references are
identified below.
2. Definitions
In the description that follows, a number of terms are used extensively.
The following definitions are provided to facilitate understanding of the
invention.
2o As used herein, "nucleic acid" or "nucleic acid molecule" refers to
polynucleotides, such as deoxyribonucleic acid (DNA) or ribonucleic acid
(RNA),
oligonucleotides, fragments generated by the polymerase chain reaction (PCR),
and
fragments generated by any of ligation, scission, endonuclease action, and
exonuclease
action. Nucleic acid molecules can be composed of monomers that are naturally-
occurring nucleotides (such as DNA and RNA), or analogs of naturally-occurring
nucleotides (e.g., a-enantiomeric forms of naturally-occurring nucleotides),
or a
combination of both. Modified nucleotides can have alterations in sugar
moieties
and/or in pyrimidine or purine base moieties. Sugar modifications include, for
example, replacement of one or more hydroxyl groups with halogens, alkyl
groups,
amines, and azido groups, or sugars can be functionalized as ethers or esters.
Moreover, the entire sugar moiety can be replaced with sterically and
electronically
similar structures, such as aza-sugars and carbocyclic sugar analogs. Examples
of
modifications in a base moiety include alkylated purines and pyrimidines,
acylated
purines or pyrimidines, or other well-known heterocyclic substitutes. Nucleic
acid
monomers can be linked by phosphodiester bonds or analogs of such linkages.
Analogs
of phosphodiester linkages include phosphorothioate, phosphorodithioate,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate,
phosphoranilidate,
phosphoramidate, and the like. The term "nucleic acid molecule" also includes
so
called "peptide nucleic acids," which comprise naturally-occurring or modified
nucleic
acid bases attached to a polyamide backbone. Nucleic acids can be either
single
5 stranded or double stranded.
The term "complement of a nucleic acid molecule" refers to a nucleic
acid molecule having a complementary nucleotide sequence and reverse
orientation as
compared to a reference nucleotide sequence. For example, the sequence 5'
ATGCACGGG 3' is complementary to 5' CCCGTGCAT 3'.
1o The term "contig" denotes a nucleic acid molecule that has a contiguous
stretch of identical or complementary sequence to another nucleic acid
molecule.
Contiguous sequences are said to "overlap" a given stretch of a nucleic acid
molecule
either in their entirety or along a partial stretch of the nucleic acid
molecule.
The term "degenerate nucleotide sequence" denotes a sequence of
nucleotides that includes one or more degenerate codons as compared to a
reference
nucleic acid molecule that encodes a polypeptide. Degenerate codons contain
different
triplets of nucleotides, but encode the same amino acid residue (i.e., GAU and
GAC
triplets each encode Asp).
The term "structural gene" refers to a nucleic acid molecule that is
transcribed into messenger RNA (mRNA), which is then translated into a
sequence of
amino acids characteristic of a specific polypeptide.
An "isolated nucleic acid molecule" is a nucleic acid molecule that is not
integrated in the genomic DNA of an organism. For example, a DNA molecule that
encodes a growth factor that has been separated from the genomic DNA of a cell
is an
isolated DNA molecule. Another example of an isolated nucleic acid molecule is
a
chemically-synthesized nucleic acid molecule that is not integrated in the
genome of an
organism. A nucleic acid molecule that has been isolated from a particular
species is
smaller than the complete DNA molecule of a chromosome from that species.
A "nucleic acid molecule construct" is a nucleic acid molecule, either
3o single- or double-stranded, that has been modified through human
intervention to
contain segments of nucleic acid combined and juxtaposed in an arrangement not
existing in nature.
"Linear. DNA" denotes non-circular DNA molecules having free 5' and
3' ends. Linear DNA can be prepared from closed circular DNA molecules, such
as
plasmids, by enzymatic digestion or physical disruption.
"Complementary DNA (cDNA)" is a single-stranded DNA molecule that
is formed from an mRNA template by the enzyme reverse transcriptase.
Typically, a
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
11
primer complementary to portions of mRNA is employed for the initiation of
reverse
transcription. Those skilled in the art also use the term "cDNA" to refer to a
double
stranded DNA molecule consisting of such a single-stranded DN-A molecule and
its
complementary DNA strand. The term "cDNA" also refers to a clone of a cDNA
molecule synthesized from an RNA template.
A "promoter" is a nucleotide sequence that directs the transcription of a
structural gene. Typically, a promoter is located in the 5' non-coding region
of a gene,
proximal to the transcriptional start site of a structural gene. Sequence
elements within
promoters that function in the initiation of transcription are often
characterized by
I o consensus nucleotide sequences. These promoter elements include RNA
polymerase
binding sites, TATA sequences, CAAT sequences, differentiation-specific
elements
(DSEs; McGehee et al., Mol. Endocrinol. 7:551 (1993)), cyclic AMP response
elements
(CREs), serum response elements (SREs; Treisman, Seminars in Cancer Biol. 1:47
(1990)), glucocorticoid response elements (GREs), and binding sites for other
transcription factors, such as CRE/ATF (O'Reilly et al., J. Biol. Chem.
267:19938
(1992)), AP2 (Ye et al., J. Biol. Chem. 269:25728 (1994)), SP1, cAMP response
element binding protein (CREB; Loeken, Gene Expr. 3:253 (1993)) and octamer
factors
(see, in general, Watson et al., eds., Molecular Biology of the Gene, 4th ed.
(The
Benjamin/Cummings Publishing Company, Inc. 1987), and Lemaigre and Rousseau,
2o Biochem. J. 303:1 (1994)). If a promoter is an inducible promoter, then the
rate of
transcription increases in response to an inducing agent. In contrast, the
rate of
transcription is not regulated by an inducing agent if the promoter is a
constitutive
promoter. Repressible promoters are also known.
A "core promoter" contains essential nucleotide sequences for promoter
function, including the TATA box and start of transcription. By this
definition, a core
promoter may or may not have detectable activity in the absence of specific
sequences
that may enhance the activity or confer tissue specific activity.
A "regulatory element" is a nucleotide sequence that modulates the
activity of a core promoter. For example, a regulatory element may contain a
3o nucleotide sequence that binds with cellular factors enabling transcription
exclusively
or preferentially in particular cells, tissues, or organelles. These types of
regulatory
elements are normally associated with genes that are expressed in a "cell-
specific,"
"tissue-specific," or "organelle-specific" manner.
An "enhancer" is a type of regulatory element that can increase the
efficiency of transcription, regardless of the distance or orientation of the
enhancer
relative to the start site of transcription.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
12
"Heterologous DNA" refers to a DNA molecule, or a population of
DNA molecules, that does not exist naturally within a given host cell. DNA
molecules
heterologous to a particular host cell may contain DNA derived from the host
cell
species (i.e., endogenous DNA) so long as that host DNA is combined with non-
host
DNA (i.e., exogenous DNA). For example, a DNA molecule containing a non-host
DNA segment encoding a polypeptide operably linked to a host DNA segment
comprising a transcription promoter is considered to be a heterologous DNA
molecule.
Conversely, a heterologous DNA molecule can comprise an endogenous gene
operably
linked with an exogenous promoter. As another illustration, a DNA molecule
to comprising a gene derived from a wild-type cell is considered to be
heterologous DNA
if that DNA molecule is introduced into a mutant cell that lacks the wild-type
gene.
A "polypeptide" is a polymer of amino acid residues joined by peptide
bonds, whether produced naturally or synthetically. Polypeptides of less than
about 10
amino acid residues are commonly referred to as "peptides."
A "protein" is a macromolecule comprising one or more polypeptide
chains. A protein may also comprise non-peptidic components, such as
carbohydrate
groups. Carbohydrates and other non-peptidic substituents may be added to a
protein
by the cell in which the protein is produced, and will vary with the type of
cell.
Proteins are defined herein in terms of their amino acid backbone structures;
substituents such as carbohydrate groups are generally not specified, but may
be present
nonetheless.
A peptide or polypeptide encoded by a non-host DNA molecule is a
"heterologous" peptide or polypeptide.
An "integrated genetic element" is a segment of DNA that has been
incorporated into a chromosome of a host cell after that element is introduced
into the
cell through human manipulation. Within the present invention, integrated
genetic
elements are most commonly derived from linearized plasmids that are
introduced into
the cells by electroporation or other techniques. Integrated genetic elements
are passed
from the original host cell to its progeny.
A "cloning vector" is a nucleic acid molecule, such as a plasmid, cosmid,
or bacteriophage, that has the capability of replicating autonomously in a
host cell.
Cloning vectors typically contain one or a small number of restriction
endonuclease
recognition sites that allow insertion of a nucleic acid molecule in a
determinable fashion
without loss of an essential biological function of the vector, as well as
nucleotide
sequences encoding a marker gene that is suitable for use in the
identification and
selection of cells transformed with the cloning vector. Marker genes typically
include
genes that provide tetracycline resistance or ampicillin resistance.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
13
An "expression vector" is a nucleic acid molecule encoding a gene that is
expressed in a host cell. Typically, an expression vector comprises a
transcription
promoter, a gene, and a transcription terminator. Gene expression is usually
placed under
the control of a promoter, and such a gene is said to be "operably linked to"
the promoter.
Similarly, a regulatory element and a core promoter are operably linked if the
regulatory
element modulates the activity of the core promoter.
A "recombinant host" is a cell that contains a heterologous nucleic acid
molecule, such as a cloning vector or expression vector. In the present
context, an
example of a recombinant host is a cell that produces a Zven 1 or Zven2
peptide or
polypeptide from an expression vector. In contrast, such polypeptides can be
produced
by a cell that is a "natural source" of Zvenl or Zven2, and that lacks an
expression
vector.
"Integrative transformants" are recombinant host cells, in which
heterologous DNA has become integrated into the genomic DNA of the cells.
A "fusion protein" is a hybrid protein expressed by a nucleic acid
molecule comprising nucleotide sequences of at least two genes. For example, a
fusion
protein can comprise at least part of a Zvenl or Zven2 polypeptide fused with
a
polypeptide that binds an affinity matrix. Such a fusion protein provides a
means to
isolate large quantities of Zven1 or Zven2 using affinity chromatography.
2o The term "receptor" denotes a cell-associated protein that binds to a
bioactive molecule termed a "ligand." This interaction mediates the effect of
the ligand
on the cell. Receptors can be membrane bound, cytosolic or nuclear; monomeric
(e.g.,
thyroid stimulating hormone receptor, beta-adrenergic receptor) or multimeric
(e.g.,
PDGF receptor, growth hormone receptor, IL-3 receptor, GM-CSF receptor, G-CSF
receptor, erythropoietin receptor and IL-6 receptor). Membrane-bound receptors
are
characterized by a mufti-domain structure comprising an extracellular ligand-
binding
domain and an intracellular effector domain that is typically involved in
signal
transduction. In certain membrane-bound receptors, the extracellular ligand-
binding
domain and the intracellular effector domain are located in separate
polypeptides that
comprise the complete functional receptor.
In general, the binding of ligand to receptor results in a conformational
change in the receptor that causes an interaction between the effector domain
and other
molecules) in the cell, which in turn leads to an alteration in the metabolism
of the cell.
Metabolic events that are often linked to receptor-ligand interactions include
gene
transcription, phosphorylation, dephosphorylation, increases in cyclic AMP
production,
mobilization of cellular calcium, mobilization of membrane lipids, cell
adhesion,
hydrolysis of inositol lipids and hydrolysis of phospholipids.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
14
The term "secretory signal sequence" denotes a DNA sequence that
encodes a peptide (a "secretory peptide") that, as a component of a larger
polypeptide,
directs the larger polypeptide through a secretory pathway of a cell in which
it is
synthesized. The larger polypeptide is commonly cleaved to remove the
secretory
peptide during transit through the secretory pathway.
An "isolated polypeptide" is a polypeptide that is essentially free from
contaminating cellular components, such as carbohydrate, lipid, or other
proteinaceous
impurities associated with the polypeptide in nature. Typically, a preparation
of isolated
polypeptide contains the polypeptide in a highly purified form, i.e., at least
about 80%
pure, at least about 90% pure, at least about 95% pure, greater than 95% pure,
or greater
than 99% pure. One way to show that a particular protein preparation contains
an
isolated polypeptide is by the appearance of a single band following sodium
dodecyl
sulfate (SDS)-polyacrylamide gel electrophoresis of the protein preparation
and
Coomassie Brilliant Blue staining of the gel. However, the term "isolated"
does not
~ 5 exclude the presence of the same polypeptide in alternative physical
forms, such as
dimers or alternatively glycosylated or derivatized forms.
The terms "amino-terminal" and "carboxyl-terminal" are used herein to
denote positions within polypeptides. Where the context allows, these terms
are used
with reference to a particular sequence or portion of a polypeptide to denote
proximity
20 or relative position. For example, a certain sequence positioned carboxyl-
terminal to a
reference sequence within a polypeptide is located proximal to the carboxyl
terminus of
the reference sequence, but is not necessarily at the carboxyl terminus of the
complete
polypeptide.
The term "expression" refers to the biosynthesis of a gene product. For
25 example, in the case of a structural gene, expression involves
transcription of the
structural gene into mRNA and the translation of mRNA into one or more
polypeptides.
The term "splice variant" is used herein to denote alternative forms of
RNA transcribed from a gene. Splice variation arises naturally through use of
alternative splicing sites within a transcribed RNA molecule, or less commonly
3o between separately transcribed RNA molecules, and may result in several
mRNAs
transcribed from the same gene. Splice variants may encode polypeptides having
altered amino acid sequence. The term splice variant is also used herein to
denote a
polypeptide encoded by a splice variant of an mRNA transcribed from a gene.
As used herein, the term "immunomodulator" includes cytokines, stem
35 cell growth factors, lymphotoxins, co-stimulatory molecules, hematopoietic
factors, and
synthetic analogs of these molecules.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
The term "complement/anti-complement pair" denotes non-identical
moieties that form a non-covalently associated, stable pair under appropriate
conditions.
For instance, biotin and avidin (or streptavidin) are prototypical members of
a
complement/anti-complement pair. Other exemplary complement/anti-complement
5 pairs include receptor/ligand pairs, antibody/antigen (or hapten or epitope)
pairs,
sense/antisense polynucleotide pairs, and the like. Where subsequent
dissociation of
the complement/anti-complement pair is desirable, the complement/anti-
complement
pair preferably has a binding affinity of less than 109 M-'.
An "anti-idiotype antibody" is an antibody that binds with the variable
region domain of an immunoglobulin. In the present context, an anti-idiotype
antibody
binds with the variable region of an anti-Zvenl or anti-Zven2 antibody, and
thus, an
anti-idiotype antibody mimics an epitope of Zvenl or Zven2.
An "antibody fragment" is a portion of an antibody such as F(ab')2, F(ab)2,
Fab', Fab, and the like. Regardless of structure, an antibody fragment binds
with the same
~ 5 antigen that is recognized by the intact antibody. For example, an anti-
Zven 1 monoclonal
antibody fragment binds with an epitope of Zven 1.
The term "antibody fragment" also includes a synthetic or a genetically
engineered polypeptide that binds to a specific antigen, such as polypeptides
consisting of
the light chain variable region, "Fv" fragments consisting of the variable
regions of the
heavy and light chains, recombinant single chain polypeptide molecules in
which light
and heavy variable regions are connected by a peptide linker ("scFv
proteins"), and
minimal recognition units consisting of the amino acid residues that mimic the
hypervariable region.
A "chimeric antibody" is a recombinant protein that contains the variable
domains and complementary determining regions derived from a rodent antibody,
while
the remainder of the antibody molecule is derived from a human antibody.
"Humanized antibodies" are recombinant proteins in which murine
complementarity determining regions of a monoclonal antibody have been
transferred
from heavy and light variable chains of the murine immunoglobulin into a human
variable
domain.
A "detectable label" is a molecule or atom which can be conjugated to
an antibody moiety to produce a molecule useful for diagnosis. Examples of
detectable
labels include chelators, photoactive agents, radioisotopes, fluorescent
agents,
paramagnetic ions, or other marker moieties.
The term "affinity tag" is used herein to denote a polypeptide segment
that can be attached to a second polypeptide to provide for purification or
detection of
the second polypeptide or provide sites for attachment of the second
polypeptide to a
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
16
substrate. In principal, any peptide or protein for which an antibody or other
specific
binding agent is available can be used as an affinity tag. Affinity tags
include a poly-
histidine tract, protein A (Nilsson et al., EMBO J. 4:1075 (1985); Nilsson et
al.,
Methods Enzymol. 198:3 (1991)), glutathione S transferase (Smith and Johnson,
Gene
67:31 (1988)), Glu-Glu affinity tag (Grussenmeyer et al., Proc. Natl. Acid.
Sci. USA
82:7952 (1985)), substance P, FLAG peptide (Hopp et al., Biotechnology 6:1204
(1988)), streptavidin binding peptide, or other antigenic epitope or binding
domain.
See, in general, Ford et al., Protein Expression and Purification 2:95 (1991).
DNAs
encoding affinity tags are available from commercial suppliers (e.g.,
Pharmacia
t0 Biotech, Piscataway, NJ).
A "naked antibody" is an entire antibody, as opposed to an antibody
fragment, which is not conjugated with a therapeutic agent. Naked antibodies
include
both polyclonal and monoclonal antibodies, as well as certain recombinant
antibodies,
such as chimeric and humanized antibodies.
As used herein, the term "antibody component" includes both an entire
antibody and an antibody fragment.
A "target polypeptide" or a "target peptide" is an amino acid sequence
that comprises at least one epitope, and that is expressed on a target cell,
such as a
tumor cell, or a cell that carries an infectious agent antigen. T cells
recognize peptide
2o epitopes presented by a major histocompatibility complex molecule to a
target
polypeptide or target peptide and typically lyse the target cell or recruit
other immune
cells to the site of the target cell, thereby killing the target cell.
An "antigenic peptide" is a peptide, which will bind a major
histocompatibility complex molecule to form an MHC-peptide complex which is
recognized by a T cell, thereby inducing a cytotoxic lymphocyte response upon
presentation to the T cell. Thus, antigenic peptides are capable of binding to
an
appropriate major histocompatibility complex molecule and inducing a cytotoxic
T
cells response, such as cell lysis or specific cytokine release against the
target cell
which binds or expresses the antigen. The antigenic peptide can be bound in
the
3o context of a class I or class II major histocompatibility complex molecule,
on an antigen
presenting cell or on a target cell.
In eukaryotes, RNA polymerise II catalyzes the transcription of a
structural gene to produce mRNA. A nucleic acid molecule can be designed to
contain
an RNA polymerise II template in which the RNA transcript has a sequence that
is
complementary to that of a specific mRNA. The RNA transcript is termed an
"anti-
sense RNA" and a nucleic acid molecule that encodes the anti-sense RNA is
termed an
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
17
"anti-sense gene." Anti-sense RNA molecules are capable of binding to mRNA
molecules, resulting in an inhibition of mRNA translation.
An "anti-sense oligonucleotide specific for Zven 1" or a "Zven 1 anti
sense oligonucleotide" is an oligonucleotide having a sequence (a) capable of
forming a
stable triplex with a portion of the Zvenl gene, or (b) capable of forming a
stable
duplex with a portion of an mRNA transcript of the Zvenl gene. Similarly, an
"anti
sense oligonucleotide specific for Zven2" or a "Zven2 anti-sense
oligonucleotide" is an
oligonucleotide having a sequence (a) capable of forming a stable triplex with
a portion
of the Zven2 gene, or (b) capable of forming a stable duplex with a portion of
an mRNA
t o transcript of the Zven2 gene.
A "ribozyme" is a nucleic acid molecule that contains a catalytic center.
The term includes RNA enzymes, self splicing RNAs, self-cleaving RNAs, and
nucleic
acid molecules that perform these catalytic functions. A nucleic acid molecule
that
encodes a ribozyme is termed a "ribozyme gene."
~ 5 An "external guide sequence" is a nucleic acid molecule that directs the
endogenous ribozyme, RNase P, to a particular species of intracellular mRNA,
resulting
in the cleavage of the mRNA by RNase P. A nucleic acid molecule that encodes
an
external guide sequence is termed an "external guide sequence gene."
The term "variant Zvenl gene" refers to nucleic acid molecules that
2o encode a polypeptide having an amino acid sequence that is a modification
of SEQ >D
N0:2. Such variants include naturally-occurring polymorphisms of Zvenl genes,
as
well as synthetic genes that contain conservative amino acid substitutions of
the amino
acid sequence of SEQ )D N0:2. Additional variant forms of Zvenl genes are
nucleic
acid molecules that contain insertions or deletions of the nucleotide
sequences
25 described herein. A variant Zvenl gene can be identified by determining
whether the
gene hybridizes with a nucleic acid molecule having the nucleotide sequence of
SEQ m
NO:1, or its complement, under stringent conditions. Similarly, a variant
Zven2 gene
and a variant Zven2 polypeptide can be identified with reference to SEQ >D
N0:4 and
SEQ >D NO:S, respectively.
3o Alternatively, variant Zven genes can be identified by sequence
comparison. Two amino acid sequences have "100% amino acid sequence identity"
if
the amino acid residues of the two amino acid sequences are the same when
aligned for
maximal correspondence. Similarly, two nucleotide sequences have "100%
nucleotide
sequence identity" if the nucleotide residues of the two nucleotide sequences
are the
35 same when aligned for maximal correspondence. Sequence comparisons can be
performed using standard software programs such as those included in the
LASERGENE bioinformatics computing suite, which is produced by DNASTAR
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
18
(Madison, Wisconsin). Other methods for comparing two nucleotide or amino acid
sequences by determining optimal alignment are well-known to those of skill in
the art
(see, for example, Peruski and Peruski, The Internet and the New Biology:
Tools for
Genomic and Molecular Research (ASM Press, Inc. 1997), Wu et al. (eds.),
"Information Superhighway and Computer Databases of Nucleic Acids and
Proteins,"
in Methods in Gene Biotechnology, pages 123-151 (CRC Press, Inc. 1997), and
Bishop
(ed.), Guide to Human Genome Computing, 2nd Edition (Academic Press, Inc.
1998)).
Particular methods for determining sequence identity are described below.
Regardless of the particular method used to identify a variant Zvenl gene
or variant Zven 1 polypeptide, a variant gene or polypeptide encoded by a
variant gene
may be characterized by its ability to bind specifically to an anti-Zvenl
antibody.
Similarly, a variant Zven2 gene product or variant Zven2 polypeptide may be
characterized by its ability to bind specifically to an anti-Zven2 antibody.
The term "allelic variant" is used herein to denote any of two or more
alternative forms of a gene occupying the same chromosomal locus. Allelic
variation
arises naturally through mutation, and may result in phenotypic polymorphism
within
populations. Gene mutations can be silent (no change in the encoded
polypeptide) or
may encode polypeptides having altered amino acid sequence. The term allelic
variant
is also used herein to denote a protein encoded by an allelic variant of a
gene.
2o The term "ortholog" denotes a polypeptide or protein obtained from one
species that is the functional counterpart of a polypeptide or protein from a
different
species. Sequence differences among orthologs are the result of speciation.
"Paralogs" are distinct but structurally related proteins made by an
organism. Paralogs are believed to arise through gene duplication. For
example, a-
globin, (3-globin, and myoglobin are paralogs of each other.
The present invention includes functional fragments of Zvenl and Zven2
genes. Within the context of this invention, a "functional fragment" of a
Zvenl (or
Zven2) gene refers to a nucleic acid molecule that encodes a portion of a
Zvenl (or
Zven2) polypeptide, which specifically binds with an anti-Zven 1 (anti-Zven2)
antibody.
Due to the imprecision of standard analytical methods, molecular
weights and lengths of polymers are understood to be approximate values. When
such
a value is expressed as "about" X or "approximately" X, the stated value of X
will be
understood to be accurate to ~10°l0.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
19
3. Production of Human Zven 1 and Zven2 Genes
Nucleic acid molecules encoding a human Zvenl gene can be obtained
by screening a human cDNA or genomic library using polynucleotide probes based
upon SEQ m NO:1. Similarly, nucleic acid molecules encoding a human Zven2 gene
can be obtained by screening a human cDNA or genomic library using
polynucleotide
probes based upon SEQ >D N0:4. These techniques are standard and well-
established.
As an illustration, a nucleic acid molecule that encodes a human Zvenl
gene can be isolated from a human cDNA library. In this case, the first step
would be to
prepare the cDNA library by isolating RNA from tissues, such as testis or
peripheral
blood lymphocytes, using methods well-known to those of skill in the art. In
general,
RNA isolation techniques must provide a method for breaking cells, a means of
inhibiting
RNase-directed degradation of RNA, and a method of separating RNA from DNA,
protein, and polysaccharide contaminants. For example, total RNA can be
isolated by
freezing tissue in liquid nitrogen, grinding the frozen tissue with a mortar
and pestle to
~ 5 lyse the cells, extracting the ground tissue with a solution of
phenoUchloroform to remove
proteins, and separating RNA from the remaining impurities by selective
precipitation
with lithium chloride (see, for example, Ausubel et al. (eds.), Short
Protocols in
Molecular Biology, 3rd Edition, pages 4-1 to 4-6 (John Wiley & Sons 1995)
["Ausubel
(1995)"]; Wu et al., Methods in Gene Biotechnology, pages 33-41 (CRC Press,
Inc. 1997)
["Wu (1997)"]). Alternatively, total RNA can be isolated from tissue by
extracting
ground tissue with guanidinium isothiocyanate, extracting with organic
solvents, and
separating RNA from contaminants using differential centrifugation (see, for
example,
Chirgwin et al., Biochemistry 18:52 (1979); Ausubel (1995) at pages 4-1 to 4-
6; Wu
(1997) at pages 33-41).
In order to construct a cDNA library, poly(A)+ RNA must be isolated from
a total RNA preparation. Poly(A)+ RNA can be isolated from total RNA using the
standard technique of oligo(dT)-cellulose chromatography (see, for example,
Aviv and
Leder, Proc. Nat'l Acad. Sci. USA 69:1408 (1972); Ausubel (1995) at pages 4-11
to 4-
12).
3o Double-stranded cDNA molecules are synthesized from poly(A)+ RNA
using techniques well-known to those in the art. (see, for example, Wu (1997)
at pages
41-46). Moreover, commercially available kits can be used to synthesize double
stranded cDNA molecules. For example, such kits are available from Life
Technologies, Inc. (Gaithersburg, MD), CLONTECH Laboratories, Inc. (Palo Alto,
CA), Promega Corporation (Madison, Wl7 and STRATAGENE (La Jolla, CA).
Various cloning vectors are appropriate for the construction of a cDNA
library. For example, a cDNA library can be prepared in a vector derived from
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
bacteriophage, such as a ~,gtl0 vector. See, for example, Huynh et al.,
"Constructing
and Screening cDNA Libraries in ~,gtl0 and ~,gtll," in DNA Cloning: A
Practical
Approach Vol. 1, Glover (ed.), page 49 (IRL Press, 1985); Wu (1997) at pages
47-52.
Alternatively, double-stranded cDNA molecules can be inserted into a
5 plasmid vector, such as a PBLUESCRIPT vector (STRATAGENE; La Jolla, CA), a
LAMDAGEM-4 (Promega Corp.) or other commercially available vectors. Suitable
cloning vectors also can be obtained from the American Type Culture Collection
(Manassas, VA).
To amplify the cloned cDNA molecules, the cDNA library is inserted into
1o a prokaryotic host, using standard techniques. For example, a cDNA library
can be
introduced into competent E. coli DH5 cells, which can be obtained, for
example, from
Life Technologies, Inc. (Gaithersburg, MD).
A human genomic library can be prepared by means well-known in the art
(see, for example, Ausubel (1995) at pages 5-1 to 5-6; Wu (1997) at pages 307-
327).
15 Genomic DNA can be isolated by lysing tissue with the detergent Sarkosyl,
digesting the
lysate with proteinase K, clearing insoluble debris from the lysate by
centrifugation,
precipitating nucleic acid from the lysate using isopropanol, and purifying
resuspended
DNA on a cesium chloride density gradient.
DNA fragments that are suitable for the production of a genomic library
20 can be obtained by the random shearing of genomic DNA or by the partial
digestion of
genomic DNA with restriction endonucleases. Genomic DNA fragments can be
inserted
into a vector, such as a bacteriophage or cosmid vector, in accordance with
conventional
techniques, such as the use of restriction enzyme digestion to provide
appropriate termini,
the use of alkaline phosphatase treatment to avoid undesirable joining of DNA
molecules,
and ligation with appropriate ligases. Techniques for such manipulation are
well-known
in the art (see, for example, Ausubel (1995) at pages 5-1 to 5-6; Wu (1997) at
pages 307-
327).
Nucleic acid molecules that encode a human Zvenl or Zven2 gene can
also be obtained using the polymerase chain reaction (PCR) with
oligonucleotide
3o primers having nucleotide sequences that are based upon the nucleotide
sequences
described herein. General methods for screening libraries with PCR are
provided by,
for example, Yu et al., "Use of the Polymerase Chain Reaction to Screen Phage
Libraries," in Methods in Molecular Biology, Vol. I5: PCR Protocols: Current
Methods and Applications, White (ed.), pages 211-215 (Humana Press, Ine.
1993).
Moreover, techniques for using PCR to isolate related genes are described by,
for
example, Preston, "Use of Degenerate Oligonucleotide Primers and the
Polymerase
Chain Reaction to Clone Gene Family Members," in Methods in Molecular Biology,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
21
Vol. I5: PCR Protocols: Current Methods and Applications, White (ed.), pages
317-
337 (Humana Press, Inc. 1993).
Alternatively, human genomic libraries can be obtained from commercial
sources such as Research Genetics (Huntsville, AL) and the American Type
Culture
Collection (Manassas, VA).
A library containing cDNA or genomic clones can be screened with one or
more polynucleotide probes based upon SEQ ID NO:1, using standard methods
(see, for
example, Ausubel (1995) at pages 6-1 to 6-11).
Anti-Zven antibodies, produced as described below, can also be used to
to isolate DNA sequences that encode human Zven genes from cDNA libraries. For
example, the antibodies can be used to screen ~,gtll expression libraries, or
the
antibodies can be used for immunoscreening following hybrid selection and
translation
(see, for example, Ausubel (1995) at pages 6-12 to 6-16; Margolis et al.,
"Screening ~,
expression libraries with antibody and protein probes," in DNA Cloning 2:
Expression
Systems, 2nd Edition, Glover et al. (eds.), pages 1-14 (Oxford University
Press 1995)).
As an alternative, a Zven gene can be obtained by synthesizing nucleic
acid molecules using mutually priming long oligonucleotides and the nucleotide
sequences described herein (see, for example, Ausubel (1995) at pages 8-8 to 8-
9).
Established techniques using the polymerase chain reaction provide the ability
to
2o synthesize DNA molecules at least two kilobases in length (Along et al.,
Plant Molec.
Biol. 21:1131 (1993), Bambot et al., PCR Methods and Applications 2:266
(1993),
Dillon et al., "Use of the Polymerase Chain Reaction for the Rapid
Construction of
Synthetic Genes," in Methods in Molecular Biology, Vol. 15: PCR Protocols:
Current
Methods and Applications, White (ed.), pages 263-268, (Humana Press, Inc.
1993), and
Holowachuk et al., PCR Methods Appl. 4:299 (1995)).
The nucleic acid molecules of the present invention can also be
synthesized with "gene machines" using protocols such as the phosphoramidite
method.
If chemically-synthesized double stranded DNA is required for an application
such as
the synthesis of a gene or a gene fragment, then each complementary strand is
made
separately. The production of short genes (60 to 80 base pairs) is technically
straightforward and can be accomplished by synthesizing the complementary
strands
and then annealing them. For the production of longer genes (>300 base pairs),
however, special strategies may be required, because the coupling efficiency
of each
cycle during chemical DNA synthesis is seldom 100%. To overcome this problem,
synthetic genes (double-stranded) are assembled in modular form from single-
stranded
fragments that are from 20 to 100 nucleotides in length. For reviews on
polynucleotide
synthesis, see, for example, Glick and Pasternak, Molecular Biotechnology,
Principles
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
22
and Applications of Recombinant DNA (ASM Press 1994), Itakura et al., Annu.
Rev.
Biochem. 53:323 (1984), and Climie et al., Proc. Nat'l Acad. Sci. USA 87:633
(1990).
The sequence of a Zven cDNA or Zven genomic fragment can be
determined using standard methods. Zven polynucleotide sequences disclosed
herein
can also be used as probes or primers to clone 5' non-coding regions of a Zven
gene.
Promoter elements from a Zven gene can be used to direct the expression of
heterologous genes in tissues of, for example, transgenic animals or patients
treated
with gene therapy. The identification of genomic fragments containing a Zven
promoter or regulatory element can be achieved using well-established
techniques, such
as deletion analysis (see, generally, Ausubel (1995)).
Cloning of 5' flanking sequences also facilitates production of Zven
proteins by "gene activation," as disclosed in U.S. Patent No. 5,641,670.
Briefly,
expression of an endogenous Zven gene in a cell is altered by introducing into
the Zven
locus a DNA construct comprising at least a targeting sequence, a regulatory
sequence,
~5 an exon, and an unpaired splice donor site. The targeting sequence is a
Zven 5' non-
coding sequence that permits homologous recombination of the construct with
the
endogenous Zven locus, whereby the sequences within the construct become
operably
linked with the endogenous Zven coding sequence. In this way, an endogenous
Zven
promoter can be replaced or supplemented with other regulatory sequences to
provide
20 enhanced, tissue-specific, or otherwise regulated expression.
4. Production of Zven Gene Variants
The present invention provides a variety of nucleic acid molecules,
including DNA and RNA molecules, which encode the Zven polypeptides disclosed
25 herein. Those skilled in the art will readily recognize that, in view of
the degeneracy of
the genetic code, considerable sequence variation is possible among these
polynucleotide molecules. SEQ ID NOs:3 and 6 are a degenerate nucleotide
sequences
that encompasses all nucleic acid molecules that encode the Zven polypeptides
of SEQ
ID NOs:2 and 5, respectively. Those skilled in the art will recognize that the
3o degenerate sequence of SEQ ID N0:3 also provides all RNA sequences encoding
SEQ
ID N0:2, by substituting U for T, while the degenerate sequence of SEQ >D N0:6
also
provides all RNA sequences encoding SEQ ID NO:S, by substituting U for T.
Thus,
the present invention contemplates Zvenl polypeptide-encoding nucleic acid
molecules
comprising nucleotide 66 to nucleotide 389 of SEQ ID NO:1, and their RNA
35 equivalents, as well as Zven2 polypeptide-encoding nucleic acid molecules
comprising
nucleotide 91 to nucleotide 405 of SEQ >D N0:4, and their RNA equivalents.,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
23
Table 1 sets forth the one-letter codes used within SEQ 1D NOs:3 and 6
to denote degenerate nucleotide positions. "Resolutions" are the nucleotides
denoted
by a code letter. "Complement" indicates the code for the complementary
nucleotide(s). For example, the code Y denotes either C or T, and its
complement R
denotes A or G, A being complementary to T, and G being complementary to C.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
24
Table 1
NucleotideResolutionComplement Resolution
A A T T
C C G G
G G C C
T T A A
R A~G Y , C~T
i Y C~T R A~G
M A~C K GET
K G~T M A~C
S C~G S C~G
W A~T W A~T
H A~C~T D A~G~T
B C~G~T V A~C~G
V A~C~G B C~G~T
D A~G~T H A~C~T
N A~C~G~T N A~C~G~T
The degenerate codons used in SEQ >D NOs:3 and 6, encompassing all
possible codons for a given amino acid, are set forth in Table 2.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
Table 2
One Letter Degenerate
Amino AcidCode Codons Codon
Cys C TGC TGT TGY
Ser S AGC AGT TCA TCC TCG TCT WSN
Thr T ACA ACC ACG ACT ACN
Pro P CCA CCC CCG CCT CCN
Ala A GCA GCC GCG GCT GCN
Gly G GGA GGC GGG GGT GGN
Asn N AAC AAT AAY
Asp D GAC GAT GAY
Glu E GAA GAG GAR
Gln Q CAA CAG CAR
His H CAC CAT CAY
Arg R AGA AGG CGA CGC CGG CGT MGN
L s K AAA AAG AAR
Met M ATG ATG
lle I ATA ATC ATT ATH
Leu L CTA CTC CTG CTT TTA TTG YTN
Val V GTA GTC GTG GTT GTN
Phe F TTC TTT TTY
Tyr Y TAC TAT TAY
Trp W TGG TGG
Ter . TAA TAG TGA TRR
Asn~Asp B RAY
Glu~Gln Z SAR
Any X NNN
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
26
One of ordinary skill in the art will appreciate that some ambiguity is
introduced in determining a degenerate codon, representative of all possible
codons
encoding an amino acid. For example, the degenerate codon for serine (WSN)
can, in
some circumstances, encode arginine (AGR), and the degenerate codon for
arginine
(MGN) can, in some circumstances, encode serine (AGY). A similar relationship
exists
between codons encoding phenylalanine and leucine. Thus, some polynucleotides
encompassed by the degenerate sequence may encode variant amino acid
sequences, but
one of ordinary skill in the art can easily identify such variant sequences by
reference to
the amino acid sequence of SEQ ID NOs:2 and 5. Variant sequences can be
readily
t o tested for functionality as described herein.
Different species can exhibit "preferential codon usage." In general, see,
Grantham et al., Nuc. Acids Res. 8:1893 (1980), Haas et al. Curr. Biol. 6:315
(1996),
Wain-Hobson et al., Gene 13:355 (1981), Grosjean and Fiers, Gene 18:199
(1982),
Holm, Nuc. Acids Res. 14: 3075 ( 1986), Ikemura, J. Mol. Biol. 158:573 (
1982), Sharp
and Matassi, Curr. Opin. Genet. Dev. 4:851 (1994), Kane, Curr. Opin.
Biotechnol.
6:494 (1995), and Makrides, Microbiol. Rev. 60:512 (1996). As used herein, the
term
"preferential codon usage" or "preferential codons" is a term of art referring
to protein
translation codons that are most frequently used in' cells of a certain
species, thus
favoring one or a few representatives of the possible codons encoding each
amino acid
(See Table 2). For example, the amino acid threonine (Thr) may be encoded by
ACA,
ACC, ACG, or ACT, but in mammalian cells ACC is the most commonly used codon;
in other species, for example, insect cells, yeast, viruses or bacteria,
different Thr
codons may be preferential. Preferential codons for a particular species can
be
introduced into the polynucleotides of the present invention by a variety of
methods
known in the art. Introduction of preferential codon sequences into
recombinant DNA
can, for example, enhance production of the protein by making protein
translation more
efficient within a particular cell type or species. Therefore, the degenerate
codon
sequences disclosed in SEQ ID NOs:3 and 6 serve as templates for optimizing
expression of polynucleotides in various cell types and species commonly used
in the
art and disclosed herein. Sequences containing preferential codons can be
tested and
optimized for expression in various species, and tested for functionality as
disclosed
herein.
The present invention further provides variant polypeptides and nucleic
acid molecules that represent counterparts from other species (orthologs).
These
species include, but are not limited to mammalian, avian, amphibian, reptile,
fish, insect
and other vertebrate and invertebrate species. Of particular interest are Zven
polypeptides from other mammalian species, including porcine, ovine, bovine,
canine,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
27
feline, equine, and other primate polypeptides. Orthologs of human Zven can be
cloned
using information and compositions provided by the present invention in
combination
with conventional cloning techniques. For example, a cDNA can be cloned using
mRNA obtained from a tissue or cell type that expresses Zven. Suitable sources
of
mRNA can be identified by probing northern blots with probes designed from the
sequences disclosed herein. A library is then prepared from mRNA of a positive
tissue
or cell line.
A Zven-encoding cDNA molecule can then be isolated by a variety of
methods, such as by probing with a complete or partial human cDNA or with one
or
more sets of degenerate probes based on the disclosed sequences. A cDNA can
also be
cloned using the polymerase chain reaction with primers designed from the
representative human Zven sequences disclosed herein. Within an additional
method,
the cDNA library can be used to transform or transfect host cells, and
expression of the
cDNA of interest can be detected with an antibody to Zven polypeptide. Similar
~ 5 techniques can also be applied to the isolation of genomic clones.
Those skilled in the art will recognize that the sequences disclosed in
SEQ >D NOs:I and 4 represent single alleles of human Zvenl and Zven2,
respectively,
and that allelic variation and alternative splicing are expected to occur.
Allelic variants
of this sequence can be cloned by probing cDNA or genomic libraries from
different
2o individuals according to standard procedures. Allelic variants of the
nucleotide
sequences shown in SEQ ID NOs:I and 4, including those containing silent
mutations
and those in which mutations result in amino acid sequence changes, are within
the
scope of the present invention, as are proteins which are allelic variants of
SEQ ID
NOs:2 and 5. cDNA molecules generated from alternatively spliced mRNAs, which
25 retain the properties of the Zven polypeptide are included within the scope
of the
present invention, as are polypeptides encoded by such cDNAs and mRNAs.
Allelic
variants and splice variants of these sequences can be cloned by probing cDNA
or
genomic libraries from different individuals or tissues according to standard
procedures
known in the art.
30 Within certain embodiments of the invention, the isolated nucleic acid
molecules can hybridize under stringent conditions to nucleic acid molecules
comprising nucleotide sequences disclosed herein. For example, such nucleic
acid
molecules can hybridize under stringent conditions to nucleic acid molecules
consisting
of the nucleotide sequence of SEQ >D NO:1, to nucleic acid molecules
consisting of the
35 nucleotide sequence of nucleotides 66 to 161 of SEQ 1D NO:l, to nucleic
acid
molecules consisting of the nucleotide sequence of nucleotides 288 to 389 of
SEQ ID
NO:1, to nucleic acid molecules consisting of the nucleotide sequence of SEQ
ID N0:4,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
28
to nucleic acid molecules consisting of the nucleotide sequence of nucleotides
334 to
405 of SEQ >D N0:4, or to nucleic acid molecules consisting of nucleotide
sequences
that are the complements of such sequences. In general, stringent conditions
are
selected to be about 5°C lower than the thermal melting point (Tm) for
the specific
sequence at a defined ionic strength and pH. The Tm is the temperature (under
defined
ionic strength and pH) at which 50% of the target sequence hybridizes to a
perfectly
matched probe.
A pair of nucleic acid molecules, such as DNA-DNA, RNA-RNA and
DNA-RNA, can hybridize if the nucleotide sequences have some degree of
1o complementarity. Hybrids can tolerate mismatched base pairs in the double
helix, but
the stability of the hybrid is influenced by the degree of mismatch. The Tm of
the
mismatched hybrid decreases by 1°C for every 1-1.5% base pair mismatch.
Varying the
stringency of the hybridization conditions allows control over the degree of
mismatch
that will be present in the hybrid. The degree of stringency increases as the
hybridization temperature increases and the ionic strength of the
hybridization buffer
decreases. Stringent hybridization conditions encompass temperatures of about
5-25°C
below the Tm of the hybrid and a hybridization buffer having up to 1 M Na+.
Higher
degrees of stringency at lower temperatures can be achieved with the addition
of
formamide which reduces the Tm of the hybrid about 1 °C for each 1 %
formamide in the
2o buffer solution. Generally, such stringent conditions include temperatures
of 20-70°C
and a hybridization buffer containing up to 6x SSC and 0-50% formamide. A
higher
degree of stringency can be achieved at temperatures of from 40-70°C
with a
hybridization buffer having up to 4x SSC and from 0-50% formamide. Highly
stringent
conditions typically encompass temperatures of 42-70°C with a
hybridization buffer
having up to lx SSC and 0-50% formamide. Different degrees of stringency can
be
used during hybridization and washing to achieve maximum specific binding to
the
target sequence. Typically, the washes following hybridization are performed
at
increasing degrees of stringency to remove non-hybridized polynucleotide
probes from
hybridized complexes.
The above conditions are meant to serve as a guide and it is well within
the abilities of one skilled in the art to adapt these conditions for use with
a particular
polypeptide hybrid. The T", for a specific target sequence is the temperature
(under
defined conditions) at which 50% of the target sequence will hybridize to a
perfectly
matched probe sequence. Those conditions that influence the Tm include, the
size and
base pair content of the polynucleotide probe, the ionic strength of the
hybridization
solution, and the presence of destabilizing agents in the hybridization
solution.
Numerous equations for calculating Tm are known in the art, and are specific
for DNA,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
29
RNA and DNA-RNA hybrids and polynucleotide probe sequences of varying length
(see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual,
Second
Edition (Cold Spring Harbor Press 1989); Ausubel et al., (eds.), Current
Protocols in
Molecular Biology (John Wiley and Sons, Inc. 1987); Berger and Kimmel (eds.),
Guide
to Molecular Cloning Techniques, (Academic Press, Inc. 1987); and Wetmur,
Crit. Rev.
Biochem. Mol. Biol. 26:227 (1990)). Sequence analysis software such as OLIGO
6.0
(LSR; Long Lake, MN) and Primer Premier 4.0 (Premier Biosoft International;
Palo
Alto, CA), as well as sites on the Internet, are available tools for analyzing
a given
sequence and calculating Tm based on user defined criteria. Such programs can
also
1o analyze a given sequence under defined conditions and identify suitable
probe
sequences. Typically, hybridization of longer polynucleotide sequences, >50
base pairs,
is performed at temperatures of about 20-25°C below the calculated Tm.
For smaller
probes, <50 base pairs, hybridization is typically carried out at the Tm or 5-
10°C below.
This allows for the maximum rate of hybridization for DNA-DNA and DNA-RNA
~ 5 hybrids.
The length of the polynucleotide sequence influences the rate and
stability of hybrid formation. Smaller probe sequences, <50 base pairs, reach
equilibrium with complementary sequences rapidly, but may form less stable
hybrids.
Incubation times of anywhere from minutes to hours can be used to achieve
hybrid
20 formation. Longer probe sequences come to equilibrium more slowly, but form
more
stable complexes even at lower temperatures. Incubations are allowed to
proceed
overnight or longer. Generally, incubations are carried out for a period equal
to three
times the calculated Cot time. Cot time, the time it takes for the
polynucleotide
sequences to reassociate, can be calculated for a particular sequence by
methods known
25 in the art.
The base pair composition of polynucleotide sequence will effect the
thermal stability of the hybrid complex, thereby influencing the choice of
hybridization
temperature and the ionic strength of the hybridization buffer. A-T pairs are
less stable
than G-C pairs in aqueous solutions containing sodium chloride. Therefore, the
higher
3o the G-C content, the more stable the hybrid. Even distribution of G and C
residues
within the sequence also contribute positively to hybrid stability. In
addition, the base
pair composition can be manipulated to alter the Tm of a given sequence. For
example,
5-methyldeoxycytidine can be substituted for deoxycytidine and 5-
bromodeoxuridine
can be substituted for thymidine to increase the Tm, whereas 7-deazz-2'-
deoxyguanosine
35 can be substituted for guanosine to reduce dependence on Tm .
The ionic concentration of the hybridization buffer also affects the
stability of the hybrid. Hybridization buffers generally contain blocking
agents such as
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
Denhardt's solution (Sigma Chemical Co., St. Louis, Mo.), denatured salmon
sperm
DNA, tRNA, milk powders (BLOTTO), heparin or SDS, and a Na+ source, such as
SSC
(lx SSC: 0.15 M sodium chloride, 15 mM sodium citrate) or SSPE (lx SSPE: 1.8 M
NaCI, 10 mM NaHZP04, 1 mM EDTA, pH 7.7). By decreasing the ionic concentration
5 of the buffer, the stability of the hybrid is increased. Typically,
hybridization buffers
contain from between 10 mM - 1 M Na+. The addition of destabilizing or
denaturing
agents such as formamide, tetralkylammonium salts, guanidinium cations or
thiocyanate cations to the hybridization solution will alter the Tm of a
hybrid.
Typically, formamide is used at a concentration of up to 50% to allow
incubations to be
t o carried out at more convenient and lower temperatures. Formamide also acts
to reduce
non-specific background when using RNA probes.
As an illustration, a nucleic acid molecule encoding a variant Zven 1
polypeptide can be hybridized with a nucleic acid molecule having the
nucleotide
sequence of SEQ ID NO:1 (or its complement) at 42°C overnight in a
solution
~5 comprising 50% formamide, SxSSC (IxSSC: 0.15 M sodium chloride and 15 mM
sodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution (100x
Denhardt's solution: 2% (w/v) Ficoll 400, 2% (w/v) polyvinylpyrrolidone, and
2%
(w/v) bovine serum albumin), 10% dextran sulfate, and 20 ~,g/ml denatured,
sheared
salmon sperm DNA. One of skill in the art can devise variations of these
hybridization
2o conditions. For example, the hybridization mixture can be incubated at a
higher
temperature, such as about 65°C, in a solution that does not contain
formamide.
Moreover, premixed hybridization solutions are available (e.g., EXPRESSHYB
Hybridization Solution from CLONTECH Laboratories, Inc.), and hybridization
can be
performed according to the manufacturer's instructions.
25 Following hybridization, the nucleic acid molecules can be washed to
remove non-hybridized nucleic acid molecules under stringent conditions, or
under
highly stringent conditions. Typical stringent washing conditions include
washing in a
solution of O.Sx - 2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 55 -
65°C. For
example, nucleic acid molecules encoding particular variant Zvenl polypeptides
can
3o remain hybridized with a nucleic acid molecule consisting of the nucleotide
sequence of
nucleotides 66 to 161 of SEQ ff~ NO:I, the nucleotide sequence of nucleotides
288 to
389 of SEQ ID NO:I, or their complements, following washing under stringent
washing conditions, in which the wash stringency is equivalent to 0.5x - 2x
SSC with
0.1% SDS at 55 - 65°C, including 0.5x SSC with 0.1% SDS at 55°C,
or 2xSSC.with
0.1% SDS at 65°C. In a similar manner, nucleic acid molecules encoding
particular
Zven2 variants can remain hybridized with a nucleic acid molecule consisting
of the
nucleotide sequence of nucleotides 334 to 405 of SEQ ll~ N0:4, or its
complement,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
31
following washing under stringent washing conditions, in which the wash
stringency is
equivalent to O.Sx - 2x SSC with 0.1% SDS at 55 - 65°C, including O.Sx
SSC with
0.1% SDS at 55°C, or 2xSSC with 0.1% SDS at 65°C. One of skill
in the art can
readily devise equivalent conditions, for example, by substituting SSPE for
SSC in the
wash solution.
Typical highly stringent washing conditions include washing in a
solution of O.lx - 0.2x SSC with 0.1% sodium dodecyl sulfate (SDS) at 50 -
65°C. As
an illustration, nucleic acid molecules encoding particular variant Zvenl
polypeptides
can remain hybridized with a nucleic acid molecule consisting of the
nucleotide
1o sequence of nucleotides 66 to 161 of SEQ m NO:1, the nucleotide sequence of
nucleotides 288 to 389 of SEQ m NO:1, or their complements, following washing
under highly stringent washing conditions, in which the wash stringency is
equivalent
to O.lx - 0.2x SSC with 0.1% SDS at 50 - 65°C, including O.lx SSC with
0.1% SDS at
50°C, or 0.2xSSC with 0.1% SDS at 65°C. Similarly, nucleic acid
molecules encoding
particular Zven2 variants remain hybridized with a nucleic acid molecule
consisting of
the nucleotide sequence of nucleotides 334 to 405 of SEQ ~ N0:4, or its
complement,
following washing under highly stringent washing conditions, in which the wash
stringency is equivalent to O.lx - 0.2x SSC with 0.1% SDS at 50 - 65°C,
including O.lx
SSC with 0.1% SDS at 50°C, or 0.2xSSC with 0.1% SDS at
65°C.
. The present invention also provides isolated Zven 1 polypeptides that
have a substantially similar sequence identity to the polypeptides of SEQ ID
N0:2, or
their orthologs. The term "substantially similar sequence identity" is used
herein to
denote polypeptides having 85%, 90%, 95% or greater than 95% sequence identity
to
the sequences shown in SEQ m N0:2, or their orthologs. Similarly, the present
invention provides isolated Zven2 polypeptides having 85%, 90%, 95% or greater
than
95% sequence identity to the sequences shown in SEQ m NO:S, or their
orthologs.
The present invention also contemplates Zven variant nucleic acid
molecules that can be identified using two criteria: a determination of the
similarity
between the encoded polypeptide with the amino acid sequence of SEQ ~ NOs:2 or
5,
3o and a hybridization assay, as described above. For example, certain Zvenl
gene
variants include nucleic acid molecules (1) that remain hybridized with a
nucleic acid
molecule consisting of the nucleotide sequence of nucleotides 66 to 161 of SEQ
~
NO:1, the nucleotide sequence of nucleotides 288 to 389 of SEQ m NO:1, or
their
complements, following washing under stringent washing conditions, in which
the
wash stringency is equivalent to O.Sx - 2x SSC with 0.1% SDS at 55 -
65°C, and (2)
that encode a polypeptide having 85%, 90%, 95% or greater than 95% sequence
identity
to the amino acid sequence of SEQ m N0:2. Alternatively, certain Zvenl variant
genes
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
32
can be characterized as nucleic acid molecules (1) that remain hybridized with
a nucleic
acid molecule consisting of the nucleotide sequence of nucleotides 66 to 161
of SEQ ID
NO:1, the nucleotide sequence of nucleotides 288 to 389 of SEQ ID NO:1, or
their
complements, following washing under highly stringent washing conditions, in
which
the wash stringency is equivalent to O.lx - 0.2x SSC with 0.1% SDS at 50 -
65°C, and
(2) that encode a polypeptide having 85%, 90%, 95% or greater than 95%
sequence
identity to the amino acid sequence of SEQ ID N0:2.
Moreover, certain Zverc2 gene variants include nucleic acid molecules
(1) that remain hybridized with a nucleic acid molecule consisting of the
nucleotide
sequence of nucleotides 334 to 405 of SEQ ID N0:4, or its complement,
following
washing under stringent washing conditions, in which the wash stringency is
equivalent
to O.Sx - 2x SSC with 0.1% SDS at 55 - 65°C, and (2) that encode a
polypeptide having
85%, 90%, 95% or greater than 95% sequence identity to the amino acid sequence
of
SEQ m NO:S. Alternatively, certain Zven2 variant genes can be characterized as
nucleic acid molecules ( 1 ) that remain hybridized with a nucleic acid
molecule
consisting of the nucleotide sequence of nucleotides 334 to 405 of SEQ >D
N0:4, or its
complement, following washing under highly stringent washing conditions, in
which
the wash stringency is equivalent to O.lx - 0.2x SSC with 0.1% SDS at 50 -
65°C, and
(2) that encode a polypeptide having 85%, 90%, 95% or greater than 95%
sequence
2o identity to the amino acid sequence of SEQ m N0:5.
Percent sequence identity is determined by conventional methods. See,
for example, Altschul et al., Bull. Math. Bio. 48:603 (1986), and Henikoff and
Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 ( 1992). Briefly, two amino acid
sequences are aligned to optimize the alignment scores using a gap opening
penalty of
10, a gap extension penalty of 1, and the "BLOSUM62" scoring matrix of
Henikoff and
Henikoff (ibid.) as shown in Table 3 (amino acids are indicated by the
standard one-
letter codes). The percent identity is then calculated as: ([Total number of
identical
matches]/ [length of the longer sequence plus the number of gaps introduced
into the
longer sequence in order to align the two sequences])(100).
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
33
~r
'-I N M
ri I
H Ill N N O
I
d' r1 M N N
I I I
L~ r1 r1 VI M N
I I I I
w ~ d' N N r1 M r-I
I I I I
In o N ,-i r1 ~I ~-I ,~
I I I I I
Lf1 r1 M r1 O r1 M N N
I I I 1 I I 1
d' N N O M N o-i N r1 r1
I I I I I I
I"I d' N M r1 O M N r1 M r1 M
I I I I I I
x 00 M M r1 N r1 N r-I N N N M
I I I I I I I I I I
CJ l0 N cr d~ N M M N O N N M M
I I I I I I I I I I I
W Ill N O M M r1 N M r1 O r1 M N N
I I I I I I I I I I
OI Ill N N O M N r1 O M r1 O r1 N r1 N
I I I I I I I I I
U 01 M d~ M M r1 r1 M r1 N M ri r1 N N r-I
I I I I I I I I I I I I I I I
C7 l0 M O N r1 r1 M ~ r1 M M ri O r1 dl M M
1 1 I I I I I I I I I I I
z 10 r1 M O O O r1 M M O N M N r1 O ~ N M
I I I I I I I I I
I~ ~ O N M r1 O N O M N N r1 M N r1 r1 M N M
I I I I I I I I I I I I I
dW -I N N O r1 r1 O N r1 r1 r1 r1 N r1 r1 O M N O
I I I I I I I I I I I I I I
r~ rx z A U a w ~ x H a x ~ w w ~n H 3
v1 o In o
~ ~ N
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
34
Those skilled in the art appreciate that there are many established
algorithms available to align two amino acid sequences. The "FASTA" similarity
search algorithm of Pearson and Lipman is a suitable protein alignment method
for
examining the level of identity shared by an amino acid sequence disclosed
herein and
the amino acid sequence of a putative Zvenl or Zven2 variant. The FASTA
algorithm
is described by Pearson and Lipman, Proc. Nat'l Acad. Sci. USA 85:2444 (1988),
and
by Pearson, Meth. Enzymol. 183:63 ( 1990).
Briefly, FASTA first characterizes sequence similarity by identifying
regions shared by the query sequence (e.g., SEQ ID N0:2) and a test sequence
that have
either the highest density of identities (if the ktup variable is 1) or pairs
of identities (if
ktup=2), without considering conservative amino acid substitutions,
insertions, or
deletions. The ten regions with the highest density of identities are then
rescored by
comparing the similarity of all paired amino acids using an amino acid
substitution
matrix, and the ends of the regions are "trimmed" to include only those
residues that
t 5 contribute to the highest score. If there are several regions with scores
greater than the
"cutoff' value (calculated by a predetermined formula based upon the length of
the
sequence and the ktup value), then the trimmed initial regions are examined to
determine whether the regions can be joined to form an approximate alignment
with
gaps. Finally, the highest scoring regions of the two amino acid sequences are
aligned
2o using a modification of the Needleman-Wunsch-Sellers algorithm (Needleman
and
Wunsch, J. Mol. Biol. 48:444 (1970); Sellers, SIAM J. Appl. Math. 26:787
(1974)),
which allows for amino acid insertions and deletions. Preferred parameters for
FASTA
analysis are: ktup=1, gap opening penalty=10, gap extension penalty=1, and
substitution matrix=BLOSUM62. These parameters can be introduced into a FASTA
25 program by modifying the scoring matrix file ("SMATRIX"), as explained in
Appendix
2 of Pearson, Meth. Enzymol. 183:63 ( 1990).
FASTA can also be used to determine the sequence identity of nucleic
acid molecules using a ratio as disclosed above. For nucleotide sequence
comparisons,
the ktup value can range between one to six, preferably from three to six, and
most
30 preferably, three. The other parameters can be set as: gap opening
penalty=10, and gap
extension penalty=1.
The present invention includes nucleic acid molecules that encode a
polypeptide having a conservative amino acid change, compared with the amino
acid
sequence of SEQ >D NOs:2 or 5. That is, variants can be obtained that contain
one or
35 more amino acid substitutions of SEQ >D NOs:2 or 5, in which an alkyl amino
acid is
substituted for an alkyl amino acid in a Zvenl or Zven2 amino acid sequence,
an
aromatic amino acid is substituted for an aromatic amino acid in a Zvenl or
Zven2
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
amino acid sequence, a sulfur-containing amino acid is substituted for a
sulfur-
containing amino acid in a Zvenl or Zven2 amino acid sequence, a hydroxy-
containing
amino acid is substituted for a hydroxy-containing amino acid in a Zvenl or
Zven2
amino acid sequence, an acidic amino acid is substituted for an acidic amino
acid in a
5 Zvenl or Zven2 amino acid sequence, a basic amino acid is substituted for a
basic
amino acid in a Zvenl or Zven2 amino acid sequence, or a dibasic
monocarboxylic
amino acid is substituted for a dibasic monocarboxylic amino acid in a Zvenl
or Zven2
amino acid sequence.
Among the common amino acids, for example, a "conservative amino
10 acid substitution" is illustrated by a substitution among amino acids
within each of the
following groups: (1) glycine, alanine, valine, leucine, and isoleucine, (2)
phenylalanine, tyrosine, and tryptophan, (3) serine and threonine, (4)
aspartate and
glutamate, (5) glutamine and asparagine, and (6) lysine, arginine and
histidine.
The BLOSUM62 table is an amino acid substitution matrix derived from
15 about 2,000 local multiple alignments of protein sequence segments,
representing
highly conserved regions of more than 500 groups of related proteins (Henikoff
and
Henikoff, Proc. Nat'l Acad. Sci. USA 89:10915 (1992)). Accordingly, the
BLOSUM62
substitution frequencies can be used to define conservative amino acid
substitutions that
may be introduced into the amino acid sequences of the present invention.
Although it
2o is possible to design amino acid substitutions based solely upon chemical
properties (as
discussed above), the language "conservative amino acid substitution"
preferably refers
to a substitution represented by a BLOSUM62 value of greater than -1. For
example,
an amino acid substitution is conservative if the substitution is
characterized by a
BLOSUM62 value of 0, l, 2, or 3. According to this system, preferred
conservative
25 amino acid substitutions are characterized by a BLOSUM62 value of at least
1 (e.g., 1,
2 or 3), while more preferred conservative amino acid substitutions are
characterized by
a BLOSUM62 value of at least 2 (e.g., 2 or 3).
Particular variants of Zvenl or Zven2 are characterized by having at
least 70%, at least 80%, at least 85%, at least 90%, at least 95% or greater
than 95%
30 sequence identity to a corresponding amino acid sequence disclosed herein
(i.e., SEQ
>D N0:2 or SEQ ID N0:5), wherein the variation in amino acid sequence is due
to one
or more conservative amino acid substitutions.
Conservative amino acid changes in a Zvenl gene and a Zven2 gene can
be introduced by substituting nucleotides for the nucleotides recited in SEQ
>D NO:1
35 and SEQ >D N0:4, respectively. Such "conservative amino acid" variants can
be
obtained, for example, by oligonucleotide-directed mutagenesis, linker-
scanning
mutagenesis, mutagenesis using the polymerase chain reaction, and the like
(see
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
36
Ausubel (1995) at pages 8-10 to 8-22; and McPherson (ed.), Directed
Mutagenesis: A
Practical Approach (IRL Press 1991 )).
The proteins of the present invention can also comprise non-naturally
occurring amino acid residues. Non-naturally occurring amino acids include,
without
limitation, traps-3-methylproline, 2,4-methanoproline, cis-4-hydroxyproline,
traps-4
hydroxyproline, N-methylglycine, allo-threonine, methylthreonine,
hydroxyethylcysteine, hydroxyethylhomocysteine, nitroglutamine, homoglutamine,
pipecolic acid, thiazolidine carboxylic acid, dehydroproline, 3- and 4-
methylproline,
3,3-dimethylproline, tert-leucine, norvaline, 2-azaphenylalanine, 3-
azaphenylalanine, 4-
azaphenylalanine, and 4-fluorophenylalanine. Several methods are known in the
art for
incorporating non-naturally occurring amino acid residues into proteins. For
example,
an in vitro system can be employed wherein nonsense mutations are suppressed
using
chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino
acids
and aminoacylating tRNA are known in the art. Transcription and translation of
plasmids containing nonsense mutations is typically carried out in a cell-free
system
comprising an E. coli S30 extract and commercially available enzymes and other
reagents. Proteins are purified by chromatography. See, for example, Robertson
et al.,
J. Am. Chem. Soc. 113:2722 (1991), Ellman et al., Methods Enzymol. 202:301
(1991),
Chung et al., Science 259:806 (1993), and Chung et al., Proc. Nat'l Acad. Sci.
USA
90:10145 (1993).
In a second method, translation is carried out in Xenopus oocytes by
microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs
(Turcatti et al., J. Biol. Chem. 271:19991 (1996)). Within a third method, E.
coli cells
are cultured in the absence of a natural amino acid that is to be replaced
(e.g.,
phenylalanine) and in the presence of the desired non-naturally occurring
amino acids)
(e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-
fluorophenylalanine). The non-naturally occurring amino acid is incorporated
into the
protein in place of its natural counterpart. See, Koide et al., Biochem.
33:7470 (1994).
Naturally occurring amino acid residues can be converted to non-naturally
occurring
species by in vitro chemical modification. Chemical modification can be
combined
with site-directed mutagenesis to further expand the range of substitutions
(Wynn and
Richards, Protein Sci. 2:395 (1993)).
A limited number of non-conservative amino acids, amino acids that are
not encoded by the genetic code, non-naturally occurring amino acids, and
unnatural
amino acids may be substituted for Zven amino acid residues.
Amino acid sequence analysis indicates that Zvenl and Zven2 share
several motifs. For example, one motif is "AVTTGAC[DE][KR]D," wherein
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
37
acceptable amino acids for a given position are indicated within square
brackets. This
motif occurs in Zvenl at amino acid residues 28 to 37 of SEQ ID N0:2, and in
Zven2 at
amino acid residues 20 to 29 of SEQ ~ NO:S. Another motif is
"CHP[GL][ST][HR]KVPFFX[KR]RXHHTCPCLP," wherein acceptable amino acids
for a given position are indicated within square brackets, and "X" can be any
amino
acid residue. This motif occurs in Zvenl at amino acid residues 68 to 90 in
SEQ m
N0:2, and in Zven2 at amino acid residues 60 to 82 of SEQ >D NO:S. The present
invention includes peptides and polypeptides comprising these motifs.
Sequence analysis also indicated that Zvenl and Zven2 include various
conservative amino acid substitutions with respect to each other. Accordingly,
particular Zvenl variants can be designed by modifying its sequence to include
one or
more amino acid substitutions corresponding with the Zven2 sequence, while
particular
Zven2 variants can be designed by modifying its sequence to include one or
more
amino acid substitutions corresponding with the Zvenl sequence. Such variants
can be
~5 constructed using Table 4, which presents exemplary conservative amino acid
substitutions found in Zvenl and Zven2. Although Zvenl and Zven2 variants can
be
designed with any number of amino acid substitutions, certain variants will
include at
least about X amino acid substitutions, wherein X is selected from the group
consisting
of 2, 5, 7, 10, 12, 14, 16, 18, and 20.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
38
Table 4
Zvenl Zven2
Amino acid Amino acid Amino acid Amino acid
Position Position
(SEQ ID N0:2) (SEQ ID NO:S)
4 Leu 4 Ala
7 Ala 7 Val
9 Leu 9 Ile
14 Leu 14 Val
35 As 27 Glu
36 L s 28 Ar
42 Gly 34 Ala
48 V al 40 Ile
50 lle 42 Leu
52 Val 44 Leu
53 L s 45 Arg
55 Ile 47 Leu
63 Lys 55 Arg
66 As 58 Glu
71 Leu 63 G1
72 Thr 64 Ser
73 Ar 65 His
80 Arg 72 L s
93 Ala 85 Leu
102 Phe 94 Tyr
Essential amino acids in the polypeptides of the present invention can be
identified according to procedures known in the art, such as site-directed
mutagenesis
or alanine-scanning mutagenesis (Cunningham and Wells, Science 244:1081
(1989),
Bass et al., Proc. Nat'l Acad. Sci. USA 88:4498 (1991), Coombs and Corey,
"Site-
Directed Mutagenesis and Protein Engineering," in Proteins: Analysis and
Design,
Angeletti (ed.), pages 259-311 (Academic Press, Inc. 1998)). In the latter
technique,
single alanine mutations are introduced at every residue in the molecule, and
the
resultant mutant molecules are tested for biological activity, such as the
ability to bind
to an antibody, to identify amino acid residues that are critical to the
activity of the
molecule. See also, Hilton et al., J. Biol. Chem. 271:4699 (1996).
The location of Zven 1 or Zven2 receptor binding domains can also be
determined by physical analysis of structure, as determined by such techniques
as
nuclear magnetic resonance, crystallography, electron diffraction or
photoaffinity
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
39
labeling, in conjunction with mutation of putative contact site amino acids.
See, for
example, de Vos et al., Science 255:306 ( 1992), Smith et al., J. Mol. Biol.
224:899
( 1992), and Wlodaver et al., FEBS Lett. 309:59 ( 1992). Moreover, Zven 1 or
Zven2
labeled with biotin or FITC can be used for expression cloning of Zven 1 or
Zven2
receptors.
Multiple amino acid substitutions can be made and tested using known
methods of mutagenesis and screening, such as those disclosed by Reidhaar-
Olson and
Sauer (Science 241:53 (1988)) or Bowie and Sauer (Proc. Nat'l Acad. Sci. USA
86:2152 (1989)). Briefly, these authors disclose methods for simultaneously
randomizing two or more positions in a polypeptide, selecting for functional
polypeptide, and then sequencing the mutagenized polypeptides to determine the
spectrum of allowable substitutions at each position. Other methods that can
be used
include phage display (e.g., Lowman et al., Biochem. 30:10832 (1991), Ladner
et al.,
U.S. Patent No. 5,223,409, Huse, international publication No. WO 92/06204,
and
region-directed mutagenesis (Derbyshire et al., Gene 46:145 ( 1986), and Ner
et al.,
DNA 7:127, (1988)).
Variants of the disclosed Zvenl or Zven2 nucleotide and polypeptide
sequences can also be generated through DNA shuffling as disclosed by Stemmer,
Nature 370:389 (1994), Stemmer, Proc. Nat'L Acad. Sci. USA 91:10747 (1994),
and
international publication No. WO 97/20078. Briefly, variant DNA molecules are
generated by in vitro homologous recombination by random fragmentation of a
parent
DNA followed by reassembly using PCR, resulting in randomly introduced point
mutations. This technique can be modified by using a family of parent DNA
molecules,
such as allelic variants or DNA molecules from different species, to introduce
additional variability into the process. Selection or screening for the
desired activity,
followed by additional iterations of mutagenesis and assay provides for rapid
"evolution" of sequences by selecting for desirable mutations while
simultaneously
selecting against detrimental changes.
Mutagenesis methods as disclosed herein can be combined with high
3o throughput, automated screening methods to detect activity of cloned,
mutagenized
polypeptides in host cells. Mutagenized DNA molecules that encode biologically
active
polypeptides, or polypeptides that bind with anti-Zvenl or anti-Zven2
antibodies, can
be recovered from the host cells and rapidly sequenced using modern equipment.
These
methods allow the rapid determination of the importance of individual amino
acid
residues in a polypeptide of interest, and can be applied to polypeptides of
unknown
structure.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
The present invention also includes "functional fragments" of Zvenl or
Zven2 polypeptides and nucleic acid molecules encoding such functional
fragments.
Routine deletion analyses of nucleic acid molecules can be performed to obtain
functional fragments of a nucleic acid molecule that encodes a Zvenl or Zven2
5 polypeptide. As an illustration, DNA molecules having the nucleotide
sequence of
SEQ 1D NO:1 can be digested with Ba131 nuclease to obtain a series of nested
deletions. The fragments are then inserted into expression vectors in proper
reading
frame, and the expressed polypeptides are isolated and tested for the ability
to bind anti-
Zven antibodies. One alternative to exonuclease digestion is to use
oligonucleotide-
1o directed mutagenesis to introduce deletions or stop codons to specify
production of a
desired fragment. Alternatively, particular fragments of a Zven gene can be
synthesized
using the polymerise chain reaction.
Methods for identifying functional domains are well-known to those of
skill in the art. For example, studies on the truncation at either or both
termini of
15 interferons have been summarized by Horisberger and Di Marco, Pharmac.
Ther.
66:507 (1995). Moreover, standard techniques for functional analysis of
proteins are
described by, for example, Treuter et al., Molec. Gen. Genet. 240:113 (1993),
Content
et al., "Expression and preliminary deletion analysis of the 42 kDa 2-SA
synthetase
induced by human interferon," in Biological Interferon Systems, Proceedings of
20 ISIR-TNO Meeting on Interferon Systems, Cantell (ed.), pages 65-72 (Nijhoff
1987),
Herschman, "The EGF Receptor," in Control of Animal Cell Proliferation, Vol.
l,
Boynton et al., (eds.) pages 169-199 (Academic Press 1985), Coumailleau et
al., J.
Biol. Chem. 270:29270 (1995); Fukunaga et al., J. Biol. Chem. 270:25291
(1995);
Yamaguchi et al., Biochem. Pharmacol. 50:1295 (1995), and Meisel et al., Plant
25 Molec. Biol. 30:1 (1996).
The present invention also contemplates functional fragments of a Zvenl
or Zven2 gene that have amino acid changes, compared with the amino acid
sequence
of SEQ >D N0:2 or SEQ ID NO:S. A variant Zven gene can be identified on the
basis
of structure by determining the level of identity with the particular
nucleotide and
3o amino acid sequences disclosed herein. An alternative approach to
identifying a variant
gene on the basis of structure is to determine whether a nucleic acid molecule
encoding
a potential variant Zvenl or Zven2 gene can hybridize to a nucleic acid
molecule having
the nucleotide sequence of SEQ m NO:1 or SEQ )D N0:4, as discussed above.
The present invention also provides polypeptide fragments or peptides
35 comprising an epitope=bearing portion of a Zven 1 or Zven2 polypeptide
described
herein. Such fragments or peptides may comprise an "immunogenic epitope,"
which is
a part of a protein that elicits an antibody response when the entire protein
is used as an
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
41
immunogen. Immunogenic epitope-bearing peptides can be identified using
standard
methods (see, for example, Geysen et al., Proc. Nat'l Acad. Sci. USA 81:3998
(1983)).
In contrast, polypeptide fragments or peptides may comprise an
"antigenic epitope," which is a region of a protein molecule to which an
antibody can
specifically bind. Certain epitopes consist of a linear or contiguous stretch
of amino
acids, and the antigenicity of such an epitope is not disrupted by denaturing
agents. It is
known in the art that relatively short synthetic peptides that can mimic
epitopes of a
protein can be used to stimulate the production of antibodies against the
protein (see,
for example, Sutcliffe et al., Science 219:660 (1983)). Accordingly, antigenic
epitope-
bearing peptides and polypeptides of the present invention are useful to raise
antibodies
that bind with the polypeptides described herein.
Antigenic epitope-bearing peptides and polypeptides can contain at least
four to ten amino acids, at least ten to fifteen amino acids, or about 15 to
about 30
amino acids of SEQ ID NOs:2 or 5. Such epitope-bearing peptides and
polypeptides
can be produced by fragmenting a Zvenl or Zven2 polypeptide, or by chemical
peptide
synthesis, as described herein. Moreover, epitopes can be selected by phage
display of
random peptide libraries (see, for example, Lane and Stephen, Curr. Opin.
Immunol.
5:268 (1993), and Cortese et al., Curr. Opin. Biotechnol. 7:616 (1996)).
Standard
methods for identifying epitopes and producing antibodies from small peptides
that
2o comprise an epitope are described, for example, by Mole, "Epitope Mapping,"
in
Methods in Molecular Biology, Vol. 10, Manson (ed.), pages 105-116 (The Humana
Press, Inc. 1992), Price, "Production and Characterization of Synthetic
Peptide-Derived
Antibodies," in Monoclonal Antibodies: Production, Engineering, and Clinical
Application, Ritter and Ladyman (eds.), pages 60-84 (Cambridge University
Press
1995), and Coligan et al. (eds.), Current Protocols in Immunology, pages 9.3.1
- 9.3.5
and pages 9.4.1 - 9.4.11 (John Wiley & Sons 1997).
Regardless of the particular nucleotide sequence of a variant Zvenl or
Zven2 gene, the gene encodes a polypeptide that may be characterized by its
ability to
bind specifically to an anti-Zven 1 or anti-Zven2 antibody.
In addition to the uses described above, polynucleotides and
polypeptides of the present invention are useful as educational tools in
laboratory
practicum kits for courses related to genetics and molecular biology, protein
chemistry,
and antibody production and analysis. Due to its unique polynucleotide and
polypeptide sequences, molecules of Zvenl or Zven2 can be used as standards or
as
"unknowns" for testing purposes. For example, Zvenl or Zven2 polynucleotides
can be
used as an aid, such as, for example, to teach a student how to prepare
expression
constructs for bacterial, viral, or mammalian expression, including fusion
constructs,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
42
wherein Zvenl or Zven2 is the gene to be expressed; for determining the
restriction
endonuclease cleavage sites of the polynucleotides; determining mRNA and DNA
localization of Zvenl or Zven2 polynucleotides in tissues (i.e., by northern
and
Southern blotting as well as polymerise chain reaction); and for identifying
related
polynucleotides and polypeptides by nucleic acid hybridization. As an
illustration,
students will find that PvuII digestion of a nucleic acid molecule consisting
of the
nucleotide sequence of nucleotides 66 to 389 of SEQ >D NO:1 provides two
fragments
of about 123 base pairs, and 201 base pairs, whereas Haelll digestion yields
fragments
of about 46 base pairs, and 278 base pairs.
1o Zvenl or Zven2 polypeptides can be used as an aid to teach preparation
of antibodies; identifying proteins by western blotting; protein purification;
determining
the weight of expressed Zvenl or Zven2 polypeptides as a ratio to total
protein
expressed; identifying peptide cleavage sites; coupling amino and carboxyl
terminal
tags; amino acid sequence analysis, as well as, but not limited to monitoring
biological
activities of both the native and tagged protein (i.e., protease inhibition)
in vitro and in
vivo. For example, students will find that digestion of unglycosylated Zvenl
with
cyanogen bromide yields four fragments having approximate molecular weights of
148,
4337, 1909, 2402, and 2939, whereas digestion of unglycosylated Zvenl with
BNPS or
NCS/urea yields fragments having approximate molecular weights of 5231, and
6444.
Zvenl or Zven2 polypeptides can also be used to teach analytical skills
such as mass spectrometry, circular dichroism, to determine conformation,
especially of
the four alpha helices, x-ray crystallography to determine the three-
dimensional
structure in atomic detail, nuclear magnetic resonance spectroscopy to reveal
the
structure of proteins in solution. For example, a kit containing Zvenl or
Zven2 can be
given to the student to analyze. Since the amino acid sequence would be known
by the
instructor, the protein can be given to the student as a test to determine the
skills or
develop the skills of the student, the instructor would then know whether or
not the
student has correctly analyzed the polypeptide. Since every polypeptide is
unique, the
educational utility of Zvenl or Zven2 would be unique unto itself.
30. The antibodies which bind specifically to Zven 1 or Zven2 can be used as
a teaching aid to instruct students how to prepare affinity chromatography
columns to
purify Zvenl or Zven2, cloning and sequencing the polynucleotide that encodes
an
antibody and thus as a practicum for teaching a student how to design
humanized
antibodies. The Zvenl or Zven2 gene, polypeptide, or antibody would then be
packaged
by reagent companies and sold to educational institutions so that the students
gain skill
in art of molecular biology. Because each gene and protein is unique, each
gene and
protein creates unique challenges and learning experiences for students in a
lab
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
43
practicum. Such educational kits containing the Zvenl or Zven2 gene,
polypeptide, or
antibody are considered within the scope of the present invention.
For any Zven polypeptide, including variants and fusion proteins, one of
ordinary skill in the art can readily generate a fully degenerate
polynucleotide sequence
encoding that variant using the information set forth in Tables 1 and 2 above.
Moreover, those of skill in the art can use standard software to devise Zvenl
or Zven2
variants based upon the nucleotide and amino acid sequences described herein.
Accordingly, the present invention includes a computer-readable medium encoded
with
a data structure that provides at least one of the following sequences: SEQ m
NO:1,
to SEQ >D N0:2, SEQ >D N0:3, SEQ >D N0:4, SEQ >D NO:S, and SEQ ID N0:6.
Suitable forms of computer-readable media include magnetic media and optically-
readable media. Examples of magnetic media include a hard or fixed drive, a
random
access memory (RAM) chip, a floppy disk, digital linear tape (DLT), a disk
cache, and
a ZIP disk. Optically readable media are exemplified by compact discs (e.g.,
CD-read
only memory (ROM), CD-rewritable (RW), and CD-recordable), and digital
versatile/video discs (DVD) (e.g., DVD-ROM, DVD-RAM, and DVD+RW).
5. Production of Zven Fusion Proteins
Fusion proteins of Zven can be used to express a Zven polypeptide or
2o peptide in a recombinant host, and to isolate expressed Zven polypeptides
and peptides.
One type of fusion protein comprises a peptide that guides a Zven polypeptide
from a
recombinant host cell. To direct a Zven polypeptide into the secretory pathway
of a
eukaryotic host cell, a secretory signal sequence (also known as a signal
peptide, a
leader sequence, prepro sequence or pre sequence) is provided in the Zven
expression
vector. While the secretory signal sequence may be derived from Zvenl or
Zven2, a
suitable signal sequence may also be derived from another secreted protein or
synthesized de novo. The secretory signal sequence is operably linked to a
Zvenl- or
Zven2-encoding sequence such that the two sequences are joined in the correct
reading
frame and positioned to direct the newly synthesized polypeptide into the
secretory
pathway of the host cell. Secretory signal sequences are commonly positioned
5' to the
nucleotide sequence encoding the polypeptide of interest, although certain
secretory
signal sequences may be positioned elsewhere in the nucleotide sequence of
interest
(see, e.g., Welch et al., U.S. Patent No. 5,037,743; Holland et al., U.S.
Patent No.
5,143,830).
Although the secretory signal sequence of Zvenl, Zven2, or another
protein produced by mammalian cells (e.g., tissue-type plasminogen activator
signal
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
44
sequence, as described, for example, in U.S. Patent No. 5,641,655) is useful
for
expression of Zvenl or Zven2 in recombinant mammalian hosts, a yeast signal
sequence is preferred for expression in yeast cells. Examples of suitable
yeast signal
sequences are those derived from yeast mating phermone oc-factor (encoded by
the
MF~xI gene), invertase (encoded by the SUC2 gene), or acid phosphatase
(encoded by
the PHOS gene). See, for example, Romanos et al., "Expression of Cloned Genes
in
Yeast," in DNA Cloning 2: A Practical Approach, 2"d Edition, Glover and Hames
(eds.), pages 123-167 (Oxford University Press 1995).
In bacterial cells, it is often desirable to express a heterologous protein
as a fusion protein to decrease toxicity, increase stability, and to enhance
recovery of
the expressed protein. For example, Zven 1 or Zven2 can be expressed as a
fusion
protein comprising a glutathione S-transferase polypeptide. Glutathione S-
transferease
fusion proteins are typically soluble, and easily purifiable from E. coli
lysates on
immobilized glutathione columns. In similar approaches, a Zven 1 or Zven2
fusion
~ 5 protein comprising a maltose binding protein polypeptide can be isolated
with an
amylose resin column, while a fusion protein comprising the C-terminal end of
a
truncated Protein A gene can be purified using IgG-Sepharose. Established
techniques
for expressing a heterologous polypeptide as a fusion protein in a bacterial
cell are
described, for example, by Williams et al., "Expression of Foreign Proteins in
E. coli
Using Plasmid Vectors and Purification of Specific Polyclonal Antibodies," in
DNA
Cloning 2: A Practical Approach, 2°d Edition, Glover and Hames (Eds.),
pages 15-58
(Oxford University Press 1995). In addition, commercially available expression
systems are available. For example, the PINPOINT Xa protein purification
system
(Promega Corporation; Madison, WI) provides a method for isolating a fusion
protein
comprising a polypeptide that becomes biotinylated during expression with a
resin that
comprises avidin.
Peptide tags that are useful for isolating heterologous polypeptides
expressed by either prokaryotic or eukaryotic cells include polyHistidine tags
(which
have an affinity for nickel-chelating resin), c-myc tags, calmodulin binding
protein
(isolated with calmodulin affinity chromatography), substance P, the RYIRS tag
(which
binds with anti-RYIRS antibodies), the Glu-Glu tag, and the FLAG tag (which
binds
with anti-FLAG antibodies). See, for example, Luo et al., Arch. Biochem.
Biophys.
329:215 (1996), Morganti et al., Biotechrcol. Appl. Biochem. 23:67 (1996), and
Zheng
et al., Gene 186:55 (1997). Nucleic acid molecules encoding such peptide tags
are
available, for example, from Sigma-Aldrich Corporation (St. Louis, MO).
Another form of fusion protein comprises a Zvenl or Zven2 polypeptide
and an immunoglobulin heavy chain constant region, typically an Fc fragment,
which
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
contains two constant region domains and a hinge region but lacks the variable
region.
As an illustration, Chang et al., U.S. Patent No. 5,723,125, describe a fusion
protein
comprising a human interferon and a human immunoglobulin Fc fragment. The C-
terminal of the interferon is linked to the N-terminal of the Fc fragment by a
peptide
5 linker moiety. An example of a peptide linker is a peptide comprising
primarily a T cell
inert sequence, which is immunologically inert. An exemplary peptide linker
has the
amino acid sequence: GGSGG SGGGG SGGGG S (SEQ ID N0:7). In this fusion
protein, a preferred Fc moiety is a human y4 chain, which is stable in
solution and has
little or no complement activating activity. Accordingly, the present
invention
1o contemplates a Zven fusion protein that comprises a Zvenl or Zven2
polypeptide
moiety and a human Fc fragment, wherein the C-terminus of the Zven polypeptide
moiety is attached to the N-terminus of the Fc fragment via a peptide linker,
such as a
peptide consisting of the amino acid sequence of SEQ ID N0:7.
In another variation, a Zvenl or Zven2 fusion protein comprises an IgG
15 sequence, a Zven polypeptide moiety covalently joined to the amino terminal
end of the
IgG sequence, and a signal peptide that is covalently joined to the amino
terminal of the
Zven polypeptide moiety, wherein the IgG sequence consists of the following
elements
in the following order: a hinge region, a CHZ domain, and a CH3 domain.
Accordingly,
the IgG sequence lacks a CHi domain. The Zven polypeptide moiety displays a
Zvenl
20 or Zven2 activity, such as the ability to bind with a Zvenl or Zven2
receptor. This
general approach to producing fusion proteins that comprise both antibody and
nonantibody portions has been described by LaRochelle et al., EP 742830 (WO
95/21258).
Fusion proteins comprising a Zvenl or Zven2 polypeptide moiety and an
25 Fc moiety can be used, for example, as an in vitro assay tool. For example,
the
presence of a Zven 1 or Zven2 receptor in a biological sample can be detected
using
these Zven 1 or Zven2-antibody fusion proteins, in which the Zven moiety is
used to
target the cognate receptor, and a macromolecule, such as Protein A or anti-Fc
antibody, is used to detect the bound fusion protein-ligand complex. In
addition,
30 antibody-Zven fusion proteins, comprising antibody variable domains, are
useful as
therapeutic proteins, in which the antibody moiety binds with a target
antigen, such as a
tumor associated antigen.
Fusion proteins can be prepared by methods known to those skilled in
the art by preparing each component of the fusion protein and chemically
conjugating
35 them. Alternatively, a polynucleotide encoding both components of the
fusion protein
in the proper reading frame can be generated using known techniques and
expressed by
the methods described herein. General methods for enzymatic and chemical
cleavage
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
46
of fusion proteins are described, for example, by Ausubel (1995) at pages 16-
19 to 16-
25.
6. Production of Zven Polypeptides
The polypeptides of the present invention, including full-length
polypeptides, functional fragments, and fusion proteins, can be produced in
recombinant
host cells following conventional techniques. To express a Zvenl or Zven2
gene, a
nucleic acid molecule encoding the polypeptide must be operably linked to
regulatory
sequences that control transcriptional expression in an expression vector and
then,
t0 introduced into a host cell. In addition to transcriptional regulatory
sequences, such as
promoters and enhancers, expression vectors can include translational
regulatory
sequences and a marker gene, which is suitable for selection of cells that
carry the
expression vector.
Expression vectors that are suitable for production of a foreign protein in
eukaryotic cells typically contain (1) prokaryotic DNA elements coding for a
bacterial
replication origin and an antibiotic resistance marker to provide for the
growth and
selection of the expression vector in a bacterial host; (2) eukaryotic DNA
elements that
control initiation of transcription, such as a promoter; and (3) DNA elements
that
control the processing of transcripts, such as a transcription
termination/polyadenylation
2o sequence. As discussed above, expression vectors can also include
nucleotide
sequences encoding a secretory sequence that directs the heterologous
polypeptide into
the secretory pathway of a host cell. For example, a Zvenl expression vector
may
comprise a Zvenl gene and a secretory sequence derived from a Zvenl gene or
another
secreted gene.
Zvenl or Zven2 proteins of the present invention may be expressed in
mammalian cells. Examples of suitable mammalian host cells include African
green
monkey kidney cells (Vero; ATCC CRL 1587), human embryonic kidney cells (293-
HEK; ATCC CRL 1573), baby hamster kidney cells (BHK-21, BHK-570; ATCC CRL
8544, ATCC CRL 10314), canine kidney cells (MDCK; ATCC CCL 34), Chinese
hamster ovary cells (CHO-K1; ATCC CCL61; CHO DG44 [Chasm et al., Som. Cell.
Molec. Genet. 12:555 1986]), rat pituitary cells (GH1; ATCC CCL82), HeLa S3
cells
(ATCC CCL2.2), rat hepatoma cells (H-4-II-E; ATCC CRL 1548) SV40-transformed
monkey kidney cells (COS-1; ATCC CRL 1650) and murine embryonic cells (NIH-
3T3; ATCC CRL 1658).
For a mammalian host, the transcriptional and translational regulatory
signals may be derived from viral sources, such as adenovirus, bovine
papilloma virus,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
47
simian virus, or the like, in which the regulatory signals are associated with
a particular
gene which has a high level of expression. Suitable transcriptional and
translational
regulatory sequences also can be obtained from mammalian genes, such as actin,
collagen, myosin, and metallothionein genes.
Transcriptional regulatory sequences include a promoter region
sufficient to direct the initiation of RNA synthesis. Suitable eukaryotic
promoters
include the promoter of the mouse metallothionein I gene (Hamer et al., J.
Molec. Appl.
Genet. 1:273 (1982)), the TK promoter of Herpes virus (McKnight, Cell 31:355
( 1982)), the SV40 early promoter (Benoist et al., Nature 290:304 ( 1981 )),
the Rous
sarcoma virus promoter (Gorman et al., Proc. Nat'l Acad. Sci. USA 79:6777 (
1982)),
the cytomegalovirus promoter (Foecking et al., Gene 45:101 (1980)), and the
mouse
mammary tumor virus promoter (see, generally, Etcheverry, "Expression of
Engineered
Proteins in Mammalian Cell Culture," in Protein Engineering: Principles and
Practice,
Cleland et al. (eds.), pages 163-181 (John Wiley & Sons, Inc. 1996)).
Alternatively, a prokaryotic promoter, such as the bacteriophage T3
RNA polymerase promoter, can be used to control Zvenl or Zven2 gene expression
in
mammalian cells if the prokaryotic promoter is regulated by a eukaryotic
promoter
(Zhou et al., Mol. Cell. Biol. 10:4529 ( 1990), and Kaufman et al., Nucl.
Acids Res.
19:4485 ( 1991 )).
An expression vector can be introduced into host cells using a variety of
standard techniques including calcium phosphate transfection, liposome-
mediated
transfection, microprojectile-mediated delivery, electroporation, and the
like. The
transfected cells can be selected and propagated to provide recombinant host
cells that
comprise the expression vector stably integrated in the host cell genome.
Techniques for
introducing vectors into eukaryotic cells and techniques for selecting such
stable
transformants using a dominant selectable marker are described, for example,
by Ausubel
(1995) and by Murray (ed.), Gene Transfer and Expression Protocols (Humana
Press
1991 ).
For example, one suitable selectable marker is a gene that provides
resistance to the antibiotic neomycin. In this case, selection is carried out
in the
presence of a neomycin-type drug, such as G-418 or the like. Selection systems
can
also be used to increase the expression level of the gene of interest, a
process referred to
as "amplification." Amplification is carried out by culturing transfectants in
the
presence of a low level of the selective agent and then increasing the amount
of
selective agent to select for cells that produce high levels of the products
of the
introduced genes. A suitable amplifiable selectable marker is dihydrofolate
reductase,
which confers resistance to methotrexate. Other drug resistance genes (e.g.,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
48
hygromycin resistance, multi-drug resistance, puromycin acetyltransferase) can
also be
used. Alternatively, markers that introduce an altered phenotype, such as
green
fluorescent protein, or cell surface proteins such as CD4, CDB, Class I MHC,
placental
alkaline phosphatase may be used to sort transfected cells from untransfected
cells by
such means as FACS sorting or magnetic bead separation technology.
Zvenl or Zven2 polypeptides can also be produced by cultured
mammalian cells using a viral delivery system. Exemplary viruses for this
purpose
include adenovirus, herpesvirus, vaccinia virus and adeno-associated virus
(AAV).
Adenovirus, a double-stranded DNA virus, is currently the best studied gene
transfer
to vector for delivery of heterologous nucleic acid (for a review, see Becker
et al., Meth.
Cell Biol. 43:161 (1994), and Douglas and Curiel, Science & Medicine 4:44
(1997)).
Advantages of the adenovirus system include the accommodation of relatively
large
DNA inserts, the ability to grow to high-titer, the ability to infect a broad
range of
mammalian cell types, and flexibility that allows use with a large number of
available
vectors containing different promoters.
By deleting portions of the adenovirus genome, larger inserts (up to 7
kb) of heterologous DNA can be accommodated. These inserts can be incorporated
into the viral DNA by direct ligation or by homologous recombination with a co-
transfected plasmid. An option is to delete the essential El gene from the
viral vector,
which results in the inability to replicate unless the El gene is provided by
the host cell.
Adenovirus vector-infected human 293 cells (ATCC Nos. CRL-1573, 45504, 45505),
for example, can be grown as adherent cells or in suspension culture at
relatively high
cell density to produce significant amounts of protein (see Gamier et al.,
Cytotechnol.
15:145 ( 1994)).
Zvenl or Zven2 genes may also be expressed in other higher eukaryotic
cells, such as avian, fungal, insect, yeast, or plant cells. The baculovirus
system
provides an efficient means to introduce cloned Zvenl or Zven2 genes into
insect cells.
Suitable expression vectors are based upon the Autographa californica multiple
nuclear
polyhedrosis virus (AcMNPV), and contain well-known promoters such as
Drosophila
heat shock protein (hsp) 70 promoter, Autographa californica nuclear
polyhedrosis
virus immediate-early gene promoter (ie-1 ) and the delayed early 39K
promoter,
baculovirus p10 promoter, and the Drosophila metallothionein promoter. A
second
method of making recombinant baculovirus utilizes a transposon-based system
described by Luckow (Luckow, et al., J. Virol. 67:4566 (1993)). This system,
which
utilizes transfer vectors, is sold in the BAC-to-BAC kit (Life Technologies,
Rockville,
MD). This system utilizes a transfer vector, PFASTBAC (Life Technologies)
containing a Tn7 transposon to move the DNA encoding the Zven polypeptide into
a
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
49
baculovirus genome maintained in E. coli as a large plasmid called a "bacmid."
See,
Hill-Perkins and Possee, J. Gen. Virol. 71:971 (1990), Bonning, et al., J.
Gen. Virol.
75:1551 (1994), and Chazenbalk, and Rapoport, J. Biol. Chem. 270:1543 (1995).
In
addition, transfer vectors can include an in-frame fusion with DNA encoding an
epitope
tag at the C- or N-terminus of the expressed Zven polypeptide, for example, a
Glu-Glu
epitope tag (Grussenmeyer et al., Proc. Nat'l Acad. Sci. 82:7952 (1985)).
Using a
technique known in the art, a transfer vector containing a Zvenl or Zven2 gene
is
transformed into E. coli, and screened for bacmids, which contain an
interrupted lacZ
gene indicative of recombinant baculovirus. The bacmid DNA containing the
1o recombinant baculovirus genome is then isolated using common techniques.
The illustrative PFASTBAC vector can be modified to a considerable
degree. For example, the polyhedrin promoter can be removed and substituted
with the
baculovirus basic protein promoter (also known as Pcor, p6.9 or MP promoter)
which is
expressed earlier in the baculovirus infection, and has been shown to be
advantageous
for expressing secreted proteins (see, for example, Hill-Perkins and Possee,
J. Gen.
Virol. 71:971 (1990), Bonning, et al., J. Gen. Virol. 75:1551 (1994), and
Chazenbalk
and Rapoport, J. Biol. Chem. 270:1543 (1995). In such transfer vector
constructs, a
short or long version of the basic protein promoter can be used. Moreover,
transfer
vectors can be constructed which replace the native Zvenl/Zven2 secretory
signal
2o sequences with secretory signal sequences derived from insect proteins. For
example, a
secretory signal sequence from Ecdysteroid Glucosyltransferase (EGT), honey
bee
Melittin (Invitrogen Corporation; Carlsbad, CA), or baculovirus gp67
(PharMingen:
San Diego, CA) can be used in constructs to replace the native Zvenl/Zven2
secretory
signal sequence.
The recombinant virus or bacmid is used to transfect host cells. Suitable
insect host cells include cell lines derived from IPLB-Sf 21, a Spodoptera
frugiperda
pupal ovarian cell line, such as Sf9 (ATCC CRL 1711), Sf2lAE, and Sf21
(Invitrogen
Corporation; San Diego, CA), as well as Drosophila Schneider-2 cells, and the
HIGH
FNEO cell line (Invitrogen) derived from Trichoplusia ni (U.S. Patent No.
5,300,435).
3o Commercially available serum-free media can be used to grow and to maintain
the
cells. Suitable media are Sf900 IIT"" (Life Technologies) or ESF 921T""
(Expression
Systems) for the Sf9 cells; and Ex-ce11O405T"" (JRH Biosciences, Lenexa, KS)
or
Express FiveOT"~ (Life Technologies) for the T. ni cells. When recombinant
virus is
used, the cells are typically grown up from an inoculation density of
approximately 2-5
x 105 cells to a density of 1-2 x 106 cells at which time a recombinant viral
stock is
added at a multiplicity of infection (MOI) of 0.1 to 10, more typically near
3.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
Established techniques for producing recombinant proteins in
baculovirus systems are provided by Bailey et al., "Manipulation of
Baculovirus
Vectors," in Methods in Molecular Biology, Volume 7: Gene Transfer arid
Expression
Protocols, Murray (ed.), pages 147-168 (The Humana Press, Inc. 1991), by Patel
et al.,
5 "The baculovirus expression system," in DNA Cloning 2: Expression Systems,
2nd
Edition, Glover et al. (eds.), pages 205-244 (Oxford University Press 1995),
by Ausubel
(1995) at pages 16-37 to 16-57, by Richardson (ed.), Baculovirus Expression
Protocols
(The Humana Press, Inc. 1995), and by Lucknow, "Insect Cell Expression
Technology,"
in Protein Engineering: Principles and Practice, Cleland et al. (eds.), pages
183-218
l0 (John Wiley & Sons, Inc. 1996).
Fungal cells, including yeast cells, can also be used to express the genes
described herein. Yeast species of particular interest in this regard include
Saccharomyces cerevisiae, Pichia pastoris, and Pichia methanolica. Suitable
promoters
for expression in yeast include promoters from GALL (galactose), PGK
15 (phosphoglycerate kinase), ADH (alcohol dehydrogenase), AOXl (alcohol
oxidase),
HIS4 (histidinol dehydrogenase), and the like. Many yeast cloning vectors have
been
designed and are readily available. These vectors include YIp-based vectors,
such as
YIpS, YRp vectors, such as YRp 17, YEp vectors such as YEp 13 and YCp vectors,
such
as YCpl9. Methods for transforming S. cerevisiae cells with exogenous DNA and
2o producing recombinant polypeptides therefrom are disclosed by, for example,
Kawasaki, U.S. Patent No. 4,599,311, Kawasaki et al., U.S. Patent No.
4,931,373,
Brake, U.S. Patent No. 4,870,008, Welch et al., U.S. Patent No. 5,037,743, and
Murray
et al., U.S. Patent No. 4,845,075. Transformed cells are selected by phenotype
determined by the selectable marker, commonly drug resistance or the ability
to grow in
25 the absence of a particular nutrient (e.g., leucine). A suitable vector
system for use in
Saccharomyces cerevisiae is the POTl vector system disclosed by Kawasaki et
al.
(U.S. Patent No. 4,931,373), which allows transformed cells to be selected by
growth in
glucose-containing media. Additional suitable promoters and terminators for
use in
yeast include those from glycolytic enzyme genes (see, e.g., Kawasaki, U.S.
Patent No.
30 4,599,311, Kingsman et al., U.S. Patent No. 4,615,974, and Bitter, U.S.
Patent No.
4,977,092) and alcohol dehydrogenase genes. See also U.S. Patents Nos.
4,990,446,
5,063,154, 5,139,936, and 4,661,454.
Transformation systems for other yeasts, including Hansenula
polymorpha, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces
35 fragilis, Ustilago maydis, Pichia pastoris, Pichia methanolica, Pichia
guillermondii
and Candida maltosa are known in the art. See, for example, Gleeson et al., J.
Gen.
Microbiol. 132:3459 (1986), and Cregg, U.S. Patent No. 4,882,279. Aspergillus
cells
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
51
may be utilized according to the methods of McKnight et al., U.S. Patent No.
4,935,349. Methods for transforming Acremonium chrysogenum are disclosed by
Sumino et al., U.S. Patent No. 5,162,228. Methods for transforming Neurospora
are
disclosed by Lambowitz, U.S. Patent No. 4,486,533.
For example, the use of Pichia methanolica as host for the production of
recombinant proteins is disclosed by Raymond, U.S. Patent No. 5,716,808,
Raymond,
U.S. Patent No. 5,736,383, Raymond et al., Yeast 14:11-23 (1998), and in
international
publication Nos. WO 97/17450, WO 97/17451, WO 98/02536, and WO 98/02565.
DNA molecules for use in transforming P. methanolica will commonly be prepared
as
1o double-stranded, circular plasmids, which can be linearized prior to
transformation. For
polypeptide production in P. methanolica, the promoter and terminator in the
plasmid
can be that of a P. methanolica gene, such as a P. methanolica alcohol
utilization gene
(AUGI or AUG2). Other useful promoters include those of the dihydroxyacetone
synthase (DHAS), formate dehydrogenase (FMD), and catalase (CAT) genes. To
facilitate integration of the DNA into the host chromosome, it is preferred to
have the
entire expression segment of the plasmid flanked at both ends by host DNA
sequences.
A suitable selectable marker for use in Pichia methanolica is a P. methanolica
ADE2
gene, which encodes phosphoribosyl-5-aminoimidazole carboxylase (AIRC; EC
4.1.1.21), and which allows ade2 host cells to grow in the absence of adenine.
For
2o large-scale, industrial processes where it is desirable to minimize the use
of methanol, it
is possible to use host cells in which both methanol utilization genes (AUGI
and
AUG2) are deleted. For production of secreted proteins, host cells can be used
that are
deficient in vacuolar protease genes (PEP4 and PRBl ). Electroporation is used
to
facilitate the introduction of a plasmid containing DNA encoding a polypeptide
of
interest into P. methanolica cells. P. methanolica cells can be transformed by
electroporation using an exponentially decaying, pulsed electric field having
a field
strength of from 2.5 to 4.5 kV/cm, preferably about 3.75 kV/cm, and a time
constant (t)
of from 1 to 40 milliseconds, most preferably about 20 milliseconds.
Expression vectors can also be introduced into plant protoplasts, intact
3o plant tissues, or isolated plant cells. Methods for introducing expression
vectors into
plant tissue include the direct infection or co-cultivation of plant tissue
with
Agrobacterium tumefaciens, microprojectile-mediated delivery, DNA injection,
electroporation, and the like. See, for example, Horseh et al., Science
227:1229 (1985),
Klein et al., Biotechnology 10:268 ( 1992), and Miki et al., "Procedures for
Introducing
Foreign DNA into Plants," in Methods in Plant Molecular Biology and
Biotechnology,
Glick et al. (eds.), pages 67-88 (CRC Press, 1993).
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
52
Alternatively, Zven genes can be expressed in prokaryotic host cells.
Suitable promoters' that can be used to express Zvenl or Zven2 polypeptides in
a
prokaryotic host are well-known to those of skill in the art and include
promoters
capable of recognizing the T4, T3, Sp6 and T7 polymerases, the PR and PL
promoters of
bacteriophage lambda, the trp, recA, heat shock, lacUVS, tac, lpp-lacSpr,
phoA, and
lacZ promoters of E. coli, promoters of B. subtilis, the promoters of the
bacteriophages
of Bacillus, Streptomyces promoters, the int promoter of bacteriophage lambda,
the bla
promoter of pBR322, and the CAT promoter of the chloramphenicol acetyl
transferase
gene. Prokaryotic promoters have been reviewed by Glick, J. Ind. Microbiol.
1:277
(1987), Watson et al., Molecular Biology of the Gene, 4th Ed. (Benjamin
Cummins
1987), and by Ausubel et al. (1995).
Suitable prokaryotic hosts include E. coli and Bacillus subtilus. Suitable
strains of E. coli include BL21(DE3), BL21(DE3)pLysS, BL21(DE3)pLysE, DH1,
DH4I, DHS, DHSI, DHSIF', DHSIMCR, DH10B, DH10B/p3, DH11S, C600, HB101,
~5 JM101, JM105, JM109, JM110, K38, RR1, Y1088, Y1089, CSH18, ER1451, and
ER1647 (see, for example, Brown (ed.), Molecular Biology Labfax (Academic
Press
1991)). Suitable strains of Bacillus subtilus include BR151, YB886, MI119,
MI120,
and B 170 (see, for example, Hardy, "Bacillus Cloning Methods," in DNA
Cloning: A
Practical Approach, Glover (ed.) (IRL Press 1985)).
2o When expressing a Zven polypeptide in bacteria such as E. coli, the
polypeptide may be retained in the cytoplasm, typically as insoluble granules,
or may be
directed to the periplasmic space by a bacterial secretion sequence. In the
former case,
the cells are lysed, and the granules are recovered and denatured using, for
example,
guanidine isothiocyanate or urea. The denatured polypeptide can then be
refolded and
25 dimerized by diluting the denaturant, such as by dialysis against a
solution of urea and a
combination of reduced and oxidized glutathione, followed by dialysis against
a
buffered saline solution. In the latter case, the polypeptide can be recovered
from the
periplasmic space in a soluble and functional form by disrupting the cells
(by, for
example, sonication or osmotic shock) to release the contents of the
periplasmic space
3o and recovering the protein, thereby obviating the need for denaturation and
refolding.
Methods for expressing proteins in prokaryotic hosts are well-known to
those of skill in the art (see, for example, Williams et al., "Expression of
foreign
proteins in E. coli using plasmid vectors and purification of specific
polyclonal
antibodies," in DNA Cloning 2: Expression Systems, 2nd Edition, Glover et al.
(eds.),
35 page 15 (Oxford University Press 1995), Ward et al., "Genetic Manipulation
and
Expression of Antibodies," in Monoclonal Antibodies: Principles and
Applications,
page 137 (Whey-Liss, Inc. 1995), and Georgiou, "Expression of Proteins in
Bacteria,"
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
53
in Protein Engineering: Principles and Practice, Cleland et al. (eds.), page
101 (John
Wiley & Sons, Inc. 1996)).
Standard methods for introducing expression vectors into bacterial, yeast,
insect, and plant cells are provided, for example, by Ausubel (1995).
General methods for expressing and recovering foreign protein produced
by a mammalian cell system are provided by, for example, Etcheverry,
"Expression of
Engineered Proteins in Mammalian Cell Culture," in Protein Engineering:
Principles and
Practice, Cleland et al. (eds.), pages 163 (Whey-Liss, Inc. 1996). Standard
techniques for
recovering protein produced by a bacterial system 'is provided by, for
example,
to Grisshammer et al., "Purification of over-produced proteins from E. coli
cells," in DNA
Cloning 2: Expression Systems, 2nd Edition, Glover et al. (eds.), pages 59-92
(Oxford
University Press 1995). Established methods for isolating recombinant proteins
from a
baculovirus system are described by Richardson (ed.), Baculovirus Expression
Protocols (The Humana Press, Ine. 1995).
As an alternative, polypeptides of the present invention can be
synthesized by exclusive solid phase synthesis, partial solid phase methods,
fragment
condensation or classical solution synthesis. These synthesis methods are well-
known
to those of skill in the art (see, for example, Merrifield, J. Am. Chem. Soc.
85:2149
(1963), Stewart et al., "Solid Phase Peptide Synthesis" (2nd Edition), (Pierce
Chemical
Co. 1984), Bayer and Rapp, Chem. Pept. Prot. 3:3 (1986), Atherton et al.,
Solid Phase
Peptide Synthesis: A Practical Approach (IRL Press 1989), Fields and Colowick,
"Solid-Phase Peptide Synthesis," Methods in Enzymology Volume 289 (Academic
Press
1997), and Lloyd-Williams et al., Chemical Approaches to the Synthesis of
Peptides
and Proteins (CRC Press, Inc. 1997)). Variations in total chemical synthesis
strategies,
such as "native chemical ligation" and "expressed protein ligation" are also
standard
(see, for example, Dawson et al., Science 266:776 (1994), Hackeng et al.,
Proc. Nat'l
Acad. Sci. USA 94:7845 (1997), Dawson, Methods Enzymol. 287: 34 (1997), Muir
et al,
Proc. Nat'l Acad. Sci. USA 95:6705 (1998), and Severinov and Muir, J. Biol.
Chem.
273:16205 (1998)).
3o Peptides and polypeptides of the present invention comprise at least six,
at least nine, or at least 15 contiguous amino acid residues of SEQ >D NOs:2
and 5.
lllustrative polypeptides of Zven2, for example, include 15 contiguous amino
acid
residues of amino acids 82 to 105 of SEQ ID N0:5. Exemplary polypeptides of
Zvenl
include 15 contiguous amino acid residues of amino acids 1 to 32 or amino
acids 75 to
108 of SEQ >D N0:2, whereas exemplary Zven2 polypeptides include amino acids
82
to 105 of SEQ ID NO:S. Within certain embodiments of the invention, the
polypeptides comprise 20, 30, 40, 50, 75, or more contiguous residues of SEQ
ll~
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
54
NOs:2 or 5. Nucleic acid molecules encoding such peptides and polypeptides are
useful as polymerise chain reaction primers and probes.
The present invention contemplates compositions comprising a peptide
or polypeptide described herein. Such compositions can further comprise a
carrier.
The carrier can be a conventional organic or inorganic carrier. Examples of
carriers
include water, buffer solution, alcohol, propylene glycol, macrogol, sesame
oil, corn oil,
and the like.
7. Isolation of Zven Polypeptides
1o The polypeptides of the present invention can be purified to at least
about 80% purity, to at least about 90% purity, to at least about 95% purity,
or even
greater than 95% purity with respect to contaminating macromolecules,
particularly
other proteins and nucleic acids, and free of infectious and pyrogenic agents.
The
polypeptides of the present invention can also be purified to a
pharmaceutically pure
~ 5 state, which is greater than 99.9% pure. In certain preparations, a
purified polypeptide
is substantially free of other polypeptides, particularly other polypeptides
of animal
origin.
Fractionation and/or conventional purification methods can be used to
obtain preparations of Zven 1 or Zven2 purified from natural sources, and
recombinant
2o Zven polypeptides and fusion Zven polypeptides purified from recombinant
host cells.
In general, ammonium sulfate precipitation and acid or chaotrope extraction
may be
used for fractionation of samples. Exemplary purification steps may include
hydroxyapatite, size exclusion, FPLC and reverse-phase high performance liquid
chromatography. Suitable chromatographic media include derivatized dextrans,
25 agarose, cellulose, polyacrylamide, specialty silicas, and the like. PEI,
DEAF, QAE
and Q derivatives are preferred. Exemplary chromatographic media include those
media
derivatized with phenyl, butyl, or octyl groups, such as Phenyl-Sepharose FF
(Pharmacia), Toyopearl butyl 650 (Toso Haas, Montgomeryville, PA), Octyl-
Sepharose
(Pharmacia) and the like; or polyacrylic resins, such as Amberchrom CG 71
(Toso
3o Haas) and the like. Suitable solid supports include glass beads, silica-
based resins,
cellulosic resins, agarose beads, cross-linked agarose beads, polystyrene
beads, cross
linked polyacrylamide resins and the like that are insoluble under the
conditions in
which they are to be used. These supports may be modified with reactive groups
that
allow attachment of proteins by amino groups, carboxyl groups, sulfhydryl
groups,
35 hydroxyl groups and/or carbohydrate moieties.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
Examples of coupling chemistries include cyanogen bromide activation,
N-hydroxysuccinimide activation, epoxide activation, sulfhydryl activation,
hydrazide
activation, and carboxyl and amino derivatives for carbodiimide coupling
chemistries.
These and other solid media are well known and widely used in the art, and are
5 available from commercial suppliers. Selection of a particular method for
polypeptide
isolation and purification is a matter of routine design and is determined in
part by the
properties of the chosen support. See, for example, Amity Chromatography:
Principles & Methods (Pharmacia LKB Biotechnology 1988), and Doonan, Protein
Purification Protocols (The Humana Press 1996).
Additional variations in Zven isolation and purification can be devised
by those of skill in the art. For example, anti-Zven antibodies, obtained as
described
below, can be used to isolate large quantities of protein by immunoaffinity
purification.
Moreover, methods for binding receptors to ligand polypeptides, such as Zvenl
or
Zven2, bound to support media are well known in the art.
15 The polypeptides of the present invention can also be isolated by
exploitation of particular properties. For example, immobilized metal ion
adsorption
(IMAC) chromatography can be used to purify histidine-rich proteins, including
those
comprising polyhistidine tags. Briefly, a gel is first charged with divalent
metal ions to
form a chelate (Sulkowski, Trends in Biochem. 3:1 (1985)). Histidine-rich
proteins will
2o be adsorbed to this matrix with differing affinities, depending upon the
metal ion used,
and will be eluted by competitive elution, lowering the pH, or use of strong
chelating
agents. Other methods of purification include purification of glycosylated
proteins by
lectin affinity chromatography and ion exchange chromatography (M. Deutscher,
(ed.),
Meth. Enzymol. 182:529 (1990)). Within additional embodiments of the
invention, a
25 fusion of the polypeptide of interest and an affinity tag (e.g., maltose-
binding protein,
an immunoglobulin domain) may be constructed to facilitate purification.
Zven polypeptides or fragments thereof may also be prepared through
chemical synthesis, as described above. Zven polypeptides may be monomers or
multimers; glycosylated or non-glycosylated; pegylated or non-pegylated; and
may or
3o may not include an initial methionine amino acid residue.
8. Zven Analogs and Zven Receptors
As described above, the disclosed polypeptides can be used to construct
Zven variants. These polypeptides can be used to identify Zvenl or Zven2
analogs.
35 One type of Zven analog mimics Zven by binding with a Zven receptor. Such
an
analog is considered to be a Zven agonist if the binding of the analog with a
Zven
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
56
receptor stimulates a response by a cell that expresses the receptor. On the
other hand,
a Zven analog that binds with a Zven receptor, but does not stimulate a
cellular
response, may be a Zven antagonist. Such an antagonist may diminish Zven or
Zven
agonist activity, for example, by a competitive or non-competitive binding of
the
antagonist to the Zven receptor.
One general class of Zven analogs are agonists or antagonists having an
amino acid sequence that is a mutation of the amino acid sequences disclosed
herein.
Another general class of Zven analogs is provided by anti-idiotype antibodies,
and
fragments thereof, as described below. Moreover, recombinant antibodies
comprising
anti-idiotype variable domains can be used as analogs (see, for example,
Monfardini et
al., Proc. ASSOC. Am. Physicians 108:420 (1996)). Since the variable domains
of anti
idiotype Zven antibodies mimic Zven, these domains can provide either Zven
agonist or
antagonist activity. As an illustration, Lim and Langer, J. Interferon Res.
13:295
(1993), describe anti-idiotypic interferon-a antibodies that have the
properties of either
interferon-oc agonists or antagonists.
A third approach to identifying Zvenl or Zven2 analogs is provided by
the use of combinatorial libraries. Methods for constructing and screening
phage
display and other combinatorial libraries are provided, for example, by Kay et
al.,
Phage Display of Peptides and Proteins (Academic Press 1996), Verdine, U.S.
Patent
No. 5,783,384, Kay, et. al., U.S. Patent No. 5,747,334, and Kauffman et al.,
U.S. Patent
No. 5,723,323.
Zvenl, Zven2, their agonists and antagonists are valuable in both in vivo
and in vitro uses. For example, Zvenl, Zven2, or an agonist can be used as a
component of defined cell culture media, alone or in combination with other
bioactive
agents, to replace serum that is commonly used in cell culture. For example,
Zven
proteins can be used to maintain in vitro models of spermatogenesis. Zven
proteins can
also be used to promote organ or tissue regeneration, to eliminate or to
control cell
proliferation, or to fabricate matrix elements within a vascular prosthesis,
for example,
to promote remodeling of vessels from an artificial vessel implant.
3o Antagonists are also useful as research reagents for characterizing sites
of interaction between a Zven polypeptide and its receptor. In a therapeutic
setting,
pharmaceutical compositions comprising Zven antagonists can be used to inhibit
Zven
activity. As an illustration, Zven antagonists can be used to inhibit
contraction of the
ileum, and to decrease hyperalgesia.
The activity of a Zven polypeptide, agonist, or antagonist can be
determined using a standard cell proliferation or differentiation assay. For
example,
assays measuring proliferation include such assays as chemosensitivity to
neutral red
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
57
dye, incorporation of radiolabeled nucleotides, incorporation of 5-bromo-2'-
deoxyuridine in the DNA of proliferating cells, and use of tetrazolium salts
(Mosmann,
J. Immunol. Methods 65:55 (1983); Porstmann et al., J. Immunol. Methods 82:169
(1985); Alley et al., Cancer Res. 48:589 (1988); Cook et al., Analytical
Biochem. 179:1
(1989); Marshall et al., Growth Reg. 5:69 (1995); Scudiero et al., Cancer Res.
48:4827
(1988); Cavanaugh et al., Investigational New Drugs 8:347 (1990)). Assays
measuring
differentiation include, for example, measuring cell-surface markers
associated with
stage-specific expression of a tissue, enzymatic activity, functional activity
or
morphological changes (Raes, Adv. Anim. Cell Biol. Technol. Bioprocesses,
pages 161-
171 (1989; Watt, FASEB, 5:281 (1991); Francis, Differentiation 57:63 (1994)).
Assays
can be used to measure other cellular responses, that include, chemotaxis,
adhesion,
changes in ion channel influx, regulation of second messenger levels and
neurotransmitter release. Such assays are well known in the art (see, for
example,
Chayen and Bitensky, Cytochemical Bioassays: Techniques & Applications (Marcel
Dekker 1983)).
The effect of a variant Zven polypeptide can also be determined by
observing contractility of tissues, including gastrointestinal tissues, with
tensiometer
that measures contractility and relaxation in tissues (see, for example,
Dainty et al., J.
Pharmacol. 100:767 (1990); Rhee et al., Neurotox. 16:179 (1995); Anderson,
Endocrinol. 114:364 (1984); Downing, and Sherwood, Endocrinol. 116:1206
(1985)).
For example, methods for measuring vasodilatation of aortic rings are well
known in
the art. As an illustration, aortic rings are removed from four-month old
Sprague
Dawley rats and placed in a buffer solution, such as modified Krebs solution
(118.5
mM NaCI, 4.6 mM KCI, 1.2 mM MgS04.7Hz0, 1.2 mM KH2P04, 2.5 mM
CaC12.2H20, 24.8 mM NaHC03 and 10 mM glucose). One of skill in the art would
recognize that this method can be used with other animals, such as rabbits,
other rat
strains, Guinea pigs, and the like. The rings are then attached to an
isometric force
transducer (Radnoti Inc., Monrovia, CA) and the data are recorded with a
Ponemah
physiology platform (could Instrument systems, Inc., Valley View, OH) and
placed in
an oxygenated (95°Io 02, 5% COZ) tissue bath containing the buffer
solution. The
tissues are adjusted to one gram resting tension and allowed to stabilize for
about one
hour before testing. The integrity of the rings can be tested with
norepinepherin (Sigma
Co.; St. Louis, MO) and carbachol, a muscarinic acetylcholine agonist (Sigma
Co.).
After integrity is checked, the rings are washed three times with fresh buffer
and
allowed to rest for about one hour. To test a sample for vasodilatation, or
relaxation of
the aortic ring tissue, the rings are contracted to two grams tension and
allowed to
stabilize for fifteen minutes. A Zven polypeptide sample is then added to one,
two, or
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
58
three of the four baths, without flushing, and tension on the rings recorded
and
compared to the control rings containing buffer only. Enhancement or
relaxation of
contractility by Zven polypeptides, their agonists and antagonists is directly
measured
by this method, and it can be applied to other contractile tissues such as
gastrointestinal
tissues.
The effect of a variant Zven polypeptide on gastric motility would
typically be measured in the clinical setting as the time required for gastric
emptying
and subsequent transit time through the gastrointestinal tract. Gastric
emptying scans
are well known to those skilled in the art, and briefly, comprise use of an
oral contrast
l0 agent, such as barium, or a radiolabeled meal. Solids and liquids can be
measured
independently. Generally, a test food or liquid is radiolabeled with an
isotope (e.g.,
99mTC), and after ingestion or administration, transit time through the
gastrointestinal
tract and gastric emptying are measured by visualization using gamma cameras
(Meyer
et al., Am. J. Dig. Dis. 21:296 (1976); Collins et al., Gut 24:1117 (1983);
Maughan et
al., Diabet. Med. 13 S6 (1996), and Horowitz et al., Arch. Intern. Med.
145:1467
(1985)). These studies can be performed before and after the administration of
a
promotility agent to quantify the efficacy of the Zven polypeptide.
To determine if a variant Zven polypeptide is a chemotractant in vivo,
the Zven polypeptide can be administered by intradermal or intraperitoneal
injection.
2o Characterization of the accumulated leukocytes at the site of injection can
be
determined using lineage specific cell surface markers and fluorescence
immunocytometry or by immunohistochemistry (see, for example, Jose, J. Exp.
Med.
179:881 (1994)). Release of specific leukocyte cell populations from bone
marrow into
peripheral blood can also be measured after Zven injection.
Zvenl or Zven2 polypeptides can be used to identify and to isolate their
cognate receptors. For example, proteins and peptides of the present invention
can be
immobilized on a column and used to bind receptors from a biological sample
that is
run over the column (Hermanson et al. (eds.), Immobilized Affinity Ligand
Techniques,
pages 195-202 (Academic Press 1992)). As a receptor ligand, the activity of
Zven 1 or
Zven2 can be measured by a silicon-based biosensor microphysiometer, which
measures the extracellular acidification rate or proton excretion associated
with receptor
binding and subsequent cellular responses. An exemplary device is the
CYTOSENSOR Microphysiometer manufactured by Molecular Devices Corp.
(Sunnyvale, CA). A variety of cellular responses, such as cell proliferation,
ion
transport, energy production, inflammatory response, regulatory and receptor
activation,
and the like, can be measured by this method (see, for example, McConnell et
al.,
Science 257:1906 (1992), Pitchford et al., Meth. Enzymol. 228:84 (1997),
Arimilli et
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
59
al., J. Immunol. Meth. 212:49 (1998), and Van Liefde et al., Eur. J.
Pharmacol. 346:87
(1998)). Moreover, the microphysiometer can be used for assaying adherent or
non-
adherent eukaryotic or prokaryotic cells.
Since energy metabolism is coupled with the use of cellular ATP, any
event, which alters cellular ATP levels, such as receptor activation and the
initiation of
signal transduction, will cause a change in cellular acid section. By
measuring
extracellular acidification changes in cell media over time, therefore, the
microphysiometer directly measures cellular responses to various stimuli,
including
Zvenl, Zven2, their agonists, or antagonists. The microphysiometer can be used
to
to measure responses of a Zven-responsive eukaryotic cell, compared to a
control
eukaryotic cell that does not respond to a Zven polypeptide. Zven-responsive
eukaryotic
cells comprise cells into which a Zven receptor has been transfected to create
a cell that
is responsive to Zven, or cells that are naturally responsive to Zven. Zven-
modulated
cellular responses are measured by a change (e.g., an increase or decrease in
~5 extracellular acidification) in the response of cells exposed to Zvenl or
Zven2,
compared with control cells that have not been exposed to Zven 1 or Zven2.
Accordingly, a microphysiometer can be used to identify cells, tissues, or
cell lines which respond to a Zven-stimulated pathway, and which express a
functional
Zven receptor. As an illustration, cells that express a functional Zvenl
receptor can be
2o identified by (a) providing test cells, (b) incubating a first portion of
the test cells in the
absence of Zvenl, (c) incubating a second portion of the test cells in the
presence of
Zvenl, and (d) detecting a change (e.g., an increase or decrease in
extracellular
acidification rate, as measured by a microphysiometer) in a cellular response
of the
second portion of the test cells, as compared to the first portion of the test
cells, wherein
25 such a change in cellular response indicates that the test cells express a
functional
Zvenl receptor. An additional negative control may be included in which a
portion of
the test cells is incubated with Zvenl and an anti-Zvenl antibody to inhibit
the binding
of Zvenl with its cognate receptor. Similar approaches can be used to identify
cells that
express a functional Zven2 receptor
3o Radiolabeled or affinity labeled Zven polypeptides can also be used to
identify or to localize Zven receptors in a biological sample (see, for
example,
Deutscher (ed.), Methods in Enzymol., vol. 182, pages 721-37 (Academic Press
1990);
Brunner et al., Ann. Rev. Biochem. 62:483 (1993); Fedan et al., Biochem.
Pharmacol.
33:1167 (1984)). Also see, Varthakavi and Minocha, J. Gen. Virol. 77:1875
(1996),
35 who describe the use of anti-idiotype antibodies for receptor
identification.
A Zven polypeptide or Zven fusion protein can be immobilized onto the
surface of a receptor chip of a commercially available biosensor instrument
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
(BIACORE, Biacore AB; Uppsala, Sweden). The use of this instrument is
disclosed,
for example, by Karlsson, Immunol. Methods 145:229 (1991), and Cunningham and
Wells, J. Mol. Bdol. 234:554 (1993). This approach can be used to identify a
Zven
receptor, or an agonist or antagonist of a Zven receptor.
5 Zvenl or Zven2 receptor binding domains can be further characterized
by physical analysis of structure, as determined by such techniques as nuclear
magnetic
resonance, crystallography, electron diffraction or photoaffinity labeling, in
conjunction
with mutation of putative contact site amino acids of Zvenl or Zven2 agonists.
See, for
example, de Vos et al., Science 255:306 (1992), Smith et al., J. Mol. Biol.
224:899
(1992), and Wlodaver et al., FEBS Lett. 309:59 (1992).
9. Production of Antibodies to Zven Proteins
Antibodies to a Zven polypeptide can be obtained, for example, using
the product of a Zven expression vector or Zven isolated from a natural source
as an
~5 antigen. Particularly useful anti-Zvenl and anti-Zven2 antibodies "bind
specifically"
with Zven 1 and Zven2, respectively. Antibodies are considered to be
specifically
binding if the antibodies exhibit at least one of the following two
properties: (1)
antibodies bind to Zvenl or Zven2 with a threshold level of binding activity,
and (2)
antibodies do not significantly cross-react with polypeptides related to Zvenl
or Zven2.
2o With regard to the first characteristic, antibodies specifically bind if
they
bind to a Zven polypeptide, peptide or epitope with a binding affinity (Ka) of
106 M-1 or
greater, preferably 10' M-' or greater, more preferably 10g M-~ or greater,
and most
preferably 109 M-~ or greater. The binding affinity of an antibody can be
readily
determined by one of ordinary skill in the art, for example, by Scatchard
analysis
25 (Scatchard, Ann. NY Acad. Sci. 51:660 (1949)). With regard to the second
characteristic, antibodies do not significantly cross-react with related
polypeptide
molecules, for example, if they detect Zven, but not known polypeptides (e.g.,
known
Wnt inhibitors) using a standard Western blot analysis. Particular anti-Zvenl
antibodies bind Zvenl, but not Zven2, while certain anti-Zven2 antibodies bind
Zven2,
30 but not Zven l .
Anti-Zvenl and anti-Zven2 antibodies can be produced using antigenic
Zven 1 or Zven2 epitope-bearing peptides and polypeptides. Antigenic epitope-
bearing
peptides and polypeptides of the present invention contain a sequence of at
least four, or
between 15 to about 30 amino acids contained within SEQ m NOs:2 or 5. However,
35 peptides or polypeptides comprising a larger portion of an amino acid
sequence of the
invention, containing from 30 to 50 amino acids, or any length up to and
including the
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
61
entire amino acid sequence of a polypeptide of the invention, also are useful
for
inducing antibodies that bind with Zven 1 or Zven2. It is desirable that the
amino acid
sequence of the epitope-bearing peptide is selected to provide substantial
solubility in
aqueous solvents (i.e., the sequence includes relatively hydrophilic residues,
while
hydrophobic residues are preferably avoided). Moreover, amino acid sequences
containing proline residues may be also be desirable for antibody production.
As an illustration, potential antigenic sites in Zven 1 or Zven2 were
identified using the Jameson-Wolf method, Jameson and Wolf, CABIOS 4:181,
(1988),
as implemented by the PROTEAN program (version 3.14) of LASERGENE
(DNASTAR; Madison, Wn. Default parameters were used in this analysis.
The Jameson-Wolf method predicts potential antigenic determinants by
combining six major subroutines for protein structural prediction. Briefly,
the Hopp-
Woods method, Hopp et al., Proc. Nat'l Acad. Sci. USA 78:3824 (1981), was
first used
to identify amino acid sequences representing areas of greatest local
hydrophilicity
~ 5 (parameter: seven residues averaged). In the second step, Emini's method,
Emini et al.,
J. Virology 55:836 (1985), was used to calculate surface probabilities
(parameter:
surface decision threshold (0.6) = 1). Third, the Karplus-Schultz method,
Karplus and
Schultz, Naturwissenschaften 72:212 (1985), was used to predict backbone chain
flexibility (parameter: flexibility threshold (0.2) = 1 ). In the fourth and
fifth steps of the
2o analysis, secondary structure predictions were applied to the data using
the methods of
Chou-Fasman, Chou, "Prediction of Protein Structural Classes from Amino Acid
Composition," in Prediction of Protein Structure and the Principles of Protein
Conformation, Fasman (ed.), pages 549-586 (Plenum Press 1990), and Gamier-
Robson,
Gamier et al., J. Mol. Biol. 120:97 (1978) (Chow-Fasman parameters:
conformation
25 table = 64 proteins; a region threshold = 103; (3 region threshold = 105;
Garnier-
Robson parameters: a and (3 decision constants = 0). In the sixth subroutine,
flexibility
parameters and hydropathy/solvent accessibility factors were combined to
determine a
surface contour value, designated as the "antigenic index." Finally, a peak
broadening
function was applied to the antigenic index, which broadens major surface
peaks by
3o adding 20, 40, 60, or 80% of the respective peak value to account for
additional free
energy derived from the mobility of surface regions relative to interior
regions. This
calculation was not applied, however, to any major peak that resides in a
helical region,
since helical regions tend to be less flexible.
The results of this analysis indicated that suitable antigenic peptides of
35 Zvenl include the following segments of the amino acid sequence of SEQ ID
N0:2:
amino acids 22 to 27 ("antigenic peptide 1"), amino acids 33 to 41 ("antigenic
peptide
2"), amino acids 61 to 68 ("antigenic peptide 3"), amino acids 80 to 85
("antigenic
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
62
peptide 4"), amino acids 97 to 102 ("antigenic peptide 5"), and amino acids 61
to 85
("antigenic peptide 6"). The present invention contemplates the use of any one
of
antigenic peptides 1 to 6 to generate antibodies to Zvenl. The present
invention also
contemplates polypeptides comprising at least one of antigenic peptides 1 to
6.
Similarly, analysis of the Zven2 amino acid sequence indicated that
suitable antigenic peptides of Zven2 include the following segments of the
amino acid
sequence of SEQ )D N0:5: amino acids 25 to 33 ("antigenic peptide 7"), amino
acids
53 to 66 ("antigenic peptide 8"), amino acids 88 to 95 ("antigenic peptide
9"), amino
acids 98 to 103 ("antigenic peptide 10"), and amino acids 88 to 103
("antigenic peptide
11"). The present invention contemplates the use of any one of antigenic
peptides 7 to
11 to generate antibodies to Zven2. The present invention also contemplates
polypeptides comprising at least one of antigenic peptides 7 to 11.
Polyclonal antibodies to recombinant Zven protein or to Zven isolated
from natural sources can be prepared using methods well-known to those of
skill in the
art. See, for example, Green et al., "Production of Polyclonal Antisera," in
Immunochemical Protocols (Manson, ed.), pages 1-5 (Humana Press 1992), and
Williams et al., "Expression of foreign proteins in E. coli using plasmid
vectors and
purification of specific polyclonal antibodies," in DNA Cloning 2: Expression
Systems,
2nd Edition, Glover et al. (eds.), page 15 (Oxford University Press 1995). The
immunogenicity of a Zven polypeptide can be increased through the use of an
adjuvant,
such as alum (aluminum hydroxide) or Freund's complete or incomplete adjuvant.
Polypeptides useful for immunization also include fusion polypeptides, such as
fusions
of Zven or a portion thereof with an immunoglobulin polypeptide or with
maltose
binding protein. The polypeptide immunogen may be a full-length molecule or a
portion thereof. If the polypeptide portion is "hapten-like," such portion may
be
advantageously joined or linked to a macromolecular carrier (such as keyhole
limpet
hemocyanin (KLH), bovine serum albumin (BSA) or tetanus toxoid) for
immunization.
Although polyclonal antibodies are typically raised in animals such as
horses, cows, dogs, chicken, rats, mice, rabbits, guinea pigs, goats, or
sheep, an anti
3o Zven antibody of the present invention may also be derived from a subhuman
primate
antibody. General techniques for raising diagnostically and therapeutically
useful
antibodies in baboons may be found, for example, in Goldenberg et al.,
international
patent publication No. WO 91/11465, and in Losman et al., Int. J. Cancer
46:310
( 1990).
Alternatively, monoclonal anti-Zven antibodies can be generated.
Rodent monoclonal antibodies to specific antigens may be obtained by methods
known
to those skilled in the art (see, for example, Kohler et al., Nature 256:495
(1975),
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
63
Coligan et al. (eds.), Current Protocols in Immunology, Vol. l, pages 2.5.1-
2.6.7 (John
Wiley & Sons 1991) ["Coligan"], Picksley et al., "Production of monoclonal
antibodies
against proteins expressed in E. coli," in DNA Cloning 2: Expression Systems,
2nd
Edition, Glover et al. (eds.), page 93 (Oxford University Press 1995)).
Briefly, monoclonal antibodies can be obtained by injecting mice with a
composition comprising a Zven gene product, verifying the presence of antibody
production by removing a serum sample, removing the spleen to obtain B-
lymphocytes,
fusing the B-lymphocytes with myeloma cells to produce hybridomas, cloning the
hybridomas, selecting positive clones which produce antibodies to the antigen,
1o culturing the clones that produce antibodies to the antigen, and isolating
the antibodies
from the hybridoma cultures.
In addition, an anti-Zven antibody of the present invention may be derived
from a human monoclonal antibody. Human monoclonal antibodies are obtained
from
transgenic mice that have been engineered to produce specific human antibodies
in
response to antigenic challenge. In this technique, elements of the human
heavy and light
chain locus are introduced into strains of mice derived from embryonic stem
cell lines that
contain targeted disruptions of the endogenous heavy chain and light chain
loci. The
transgenic mice can synthesize human antibodies specific for human antigens,
and the
mice can be used to produce human antibody-secreting hybridomas. Methods for
obtaining human antibodies from transgenic mice are described, for example, by
Green et
al., Nature Genet. 7:13 (1994), Lonberg et al., Nature 368:856 (1994), and
Taylor et al.,
Int. Immun. 6:579 ( 1994).
Monoclonal antibodies can be isolated and purified from hybridoma
cultures by a variety of well-established techniques. Such isolation
techniques include
affinity chromatography with Protein-A Sepharose, size-exclusion
chromatography, and
ion-exchange chromatography (see, for example, Coligan at pages 2.7.1-2.7.12
and
pages 2.9.1-2.9.3; Baines et al., "Purification of Immunoglobulin G (IgG)," in
Methods
in Molecular Biology, Vol. 10, pages 79-104 (The Humana Press, Inc. 1992)).
For particular uses, it may be desirable to prepare fragments of anti-Zven
3o antibodies. Such antibody fragments can be obtained, for example, by
proteolytic
hydrolysis of the antibody. Antibody fragments can be obtained by pepsin or
papain
digestion of whole antibodies by conventional methods. As an illustration,
antibody
fragments can be produced by enzymatic cleavage of antibodies with pepsin to
provide
a 5S fragment denoted F(ab')Z. This fragment can be further cleaved using a
thiol
reducing agent to produce 3.5S Fab' monovalent fragments. Optionally, the
cleavage
reaction can be performed using a blocking group for the sulfhydryl groups
that result
from cleavage of disulfide linkages. As an alternative, an enzymatic cleavage
using
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
64
pepsin produces two monovalent Fab fragments and an Fc fragment directly.
These
methods are described, for example, by Goldenberg, U.S. patent No. 4,331,647,
Nisonoff et al., Arch Biochem. Biophys. 89:230 (1960), Porter, Biochem. J.
73:119
(1959), Edelman et al., in Methods in Enzymology Vol. l, page 422 (Academic
Press
1967), and by Coligan at pages 2.8.1-2.8.10 and 2.10.-2.10.4.
Other methods of cleaving antibodies, such as separation of heavy chains
to form monovalent light-heavy chain fragments, further cleavage of fragments,
or other
enzymatic, chemical or genetic techniques may also be used, so long as the
fragments
bind to the antigen that is recognized by the intact antibody.
1o For example, Fv fragments comprise an association of Vr-, and VL chains.
This association can be noncovalent, as described by mbar et al., Proc. Nat'l
Acad. Sci.
USA 69:2659 (1972). Alternatively, the variable chains can be linked by an
intermolecular disulfide bond or cross-linked by chemicals such as
glutaraldehyde (see,
for example, Sandhu, Crit. Rev. Biotech. 12:437 (1992)).
The Fv fragments may comprise VH and VL chains, which are connected
by a peptide linker. These single-chain antigen binding proteins (scFv) are
prepared by
constructing a structural gene comprising DNA sequences encoding the VH and VL
domains which are connected by an oligonucleotide. The structural gene is
inserted
into an expression vector, which is subsequently introduced into a host cell,
such as E.
2o coli. The recombinant host cells synthesize a single polypeptide chain with
a linker
peptide bridging the two V domains. Methods for producing scFvs are described,
for
example, by Whitlow et al., Methods: A Companion to Methods in Enzymology 2:97
(1991) (also see, Bird et al., Science 242:423 (1988), Ladner et al., U.S.
Patent No.
4,946,778, Pack et al., Biol1'echnology 11:1271 (1993), and Sandhu, supra).
As an illustration, a scFV can be obtained by exposing lymphocytes to
Zven polypeptide in vitro, and selecting antibody display libraries in phage
or similar
vectors (for instance, through use of immobilized or labeled Zven protein or
peptide).
Genes encoding polypeptides having potential Zven polypeptide binding domains
can
be obtained by screening random peptide libraries displayed on phage (phage
display)
or on bacteria, such as E. coli. Nucleotide sequences encoding the
polypeptides can be
obtained in a number of ways, such as through random mutagenesis and random
polynucleotide synthesis. These random peptide display libraries can be used
to screen
for peptides, which interact with a known target which can be a protein or
polypeptide,
such as a ligand or receptor, a biological or synthetic macromolecule, or
organic or
inorganic substances. Techniques for creating and screening such random
peptide
display libraries are known in the art (Ladner et al., U.S. Patent No.
5,223,409, Ladner
et al., U.S. Patent No. 4,946,778, Ladner et al., U.S. Patent No. 5,403,484,
Ladner et
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
al., U.S. Patent No. 5,571,698, and Kay et al., Phage Display of Peptides and
Proteins
(Academic Press, Inc. 1996)) and random peptide display libraries and kits for
screening such libraries are available commercially, for instance from
CLONTECH
Laboratories, Inc. (Palo Alto, CA), Invitrogen Inc. (San Diego, CA), New
England
5 Biolabs, Inc. (Beverly, MA), and Pharmacia LKB Biotechnology Inc.
(Piscataway, NJ).
Random peptide display libraries can be screened using the Zven sequences
disclosed
herein to identify proteins which bind to Zven.
Another form of an antibody fragment is a peptide coding for a single
complementarity-determining region (CDR). CDR peptides ("minimal recognition
10 units") can be obtained by constructing genes encoding the CDR of an
antibody of
interest. Such genes are prepared, for example, by using the polymerise chain
reaction
to synthesize the variable region from RNA of antibody-producing cells (see,
for
example, Larrick et al., Methods: A Companion to Methods in Enzymology 2:106
(1991), Courtenay-Luck, "Genetic Manipulation of Monoclonal Antibodies," in
~ 5 Monoclonal Antibodies: Production, Engineering and Clinical Application,
Ritter et al.
(eds.), page 166 (Cambridge University Press 1995), and Ward et al., "Genetic
Manipulation and Expression of Antibodies," in Monoclonal Antibodies:
Principles
and Applications, Birch et al., (eds.), page 137 (Wiley-Liss, Inc. 1995)).
Alternatively, an anti-Zven antibody may be derived from a
20 "humanized" monoclonal antibody. Humanized monoclonal antibodies are
produced
by transferring mouse complementary determining regions from heavy and light
variable chains of the mouse immunoglobulin into a human variable domain.
Typical
residues of human antibodies are then substituted in the framework regions of
the
murine counterparts. The use of antibody components derived from humanized
25 monoclonal antibodies obviates potential problems associated with the
immunogenicity
of murine constant regions. General techniques for cloning murine
immunoglobulin
variable domains are described, for example, by Orlandi et al., Proc. Nat'l
Acad. Sci.
USA 86:3833 (1989). Techniques for producing humanized monoclonal antibodies
are
described, for example, by Jones et al., Nature 321:522 (1986), Carter et al.,
Proc. Nat'l
3o Acad. Sci. USA 89:4285 (1992), Sandhu, Crit. Rev. Biotech. 12:437 (1992),
Singer et
al., J. Immun. 150:2844 (1993), Sudhir (ed.), Antibody Engineering Protocols
(Humana
Press, Inc. 1995), Kelley, "Engineering Therapeutic Antibodies," in Protein
Engineering: Principles and Practice, Cleland et al. (eds.), pages 399-434
(John Wiley
& Sons, Inc. 1996), and by Queen et al., U.S. Patent No. 5,693,762 (1997).
35 Polyclonal anti-idiotype antibodies can be prepared by immunizing
animals with anti-Zven antibodies or antibody fragments, using standard
techniques.
See, for example, Green et al., "Production of Polyclonal Antisera," in
Methods In
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
66
Molecular Biology: Immunochemical Protocols, Manson (ed.), pages 1-12 (Humana
Press 1992). Also, see Coligan at pages 2.4.1-2.4.7. Alternatively, monoclonal
anti-
idiotype antibodies can be prepared using anti-Zven antibodies or antibody
fragments as
immunogens with the techniques, described above. As another alternative,
humanized
anti-idiotype antibodies or subhuman primate anti-idiotype antibodies can be
prepared
using the above-described techniques. Methods for producing anti-idiotype
antibodies
are described, for example, by Irie, U.S. Patent No. 5,208,146, Greene, et.
al., U.S.
Patent No. 5,637,677, and Varthakavi and Minocha, J. Gen. Virol. 77:1875
(1996).
~ 0 10. Detection of Zven Gene Expression and Examination of the Zven
Chromosomal Locus
Nucleic acid molecules can be used to detect the expression of a Zvenl
or Zven2 gene in a biological sample. Such probe molecules include double-
stranded
nucleic acid molecules comprising the nucleotide sequence of SEQ >D NOs: l or
4, or a
t 5 fragment thereof, as well as single-stranded nucleic acid molecules having
the
complement of the nucleotide sequence of SEQ >D NOs:I or 4, or a fragment
thereof.
Probe molecules may be DNA, RNA, oligonucleotides, and the like.
Illustrative probes comprise a portion of the nucleotide sequence of
nucleotides 66 to 161 of SEQ >D NO:I, the nucleotide sequence of nucleotides
288 to
2o 389 of SEQ >D NO:1, the nucleotide sequence of nucleotides 334 to 405 of
SEQ >D
N0:4, or to the complement of such nucleotide sequences. An additional example
of a
suitable probe is a probe consisting of nucleotides 354 to 382 of SEQ >D NO:1,
or a
portion thereof. As used herein, the term "portion" refers to at least eight
nucleotides to
at least 20 or more nucleotides.
25 For example, nucleic acid molecules comprising a portion of the
nucleotide sequence of SEQ >D NO:1 can be used to detect activated
neutrophils. Such
molecules can also be used to identity therapeutic or prophylactic agents that
modulate
the response of a neutrophil to a pathogen.
In a detection basic assay, a single-stranded probe molecule is incubated
30 with RNA, isolated from a biological sample, under conditions of
temperature and ionic
strength that promote base pairing between the probe and target Zven RNA
species.
After separating unbound probe from hybridized molecules, the amount of
hybrids is
detected.
Well-established hybridization methods of RNA detection include
35 northern analysis and dot/slot blot hybridization (see, for example,
Ausubel (1995) at
pages 4-1 to 4-27, and Wu et al. (eds.), "Analysis of Gene Expression at the
RNA
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
67
Level," in Methods in Gene Biotechnology, pages 225-239 (CRC Press, Inc.
1997)).
Nucleic acid probes can be detectably labeled with radioisotopes such as 32P
or 355.
Alternatively, Zven RNA can be detected with a nonradioactive hybridization
method
(see, for example, Isaac (ed.), Protocols for Nucleic Acid Analysis by
Nonradioactive
Probes (Humana Press, Inc. 1993)). Typically, nonradioactive detection is
achieved by
enzymatic conversion of chromogenic or chemiluminescent substrates.
lllustrative
nonradioactive moieties include biotin, fluorescein, and digoxigenin.
Zven oligonucleotide probes are also useful for in vivo diagnosis. As an
illustration, '8F-labeled oligonucleotides can be administered to a subject
and visualized
1o by positron emission tomography (Tavitian et al., Nature Medicine 4:467
(1998)).
Numerous diagnostic procedures take advantage of the polymerise chain
reaction (PCR) to increase sensitivity of detection methods. Standard
techniques for
performing PCR are well-known (see, generally, Mathew (ed.), Protocols in
Human
Molecular Genetics (Humana Press, Inc. 1991), White (ed.), PCR Protocols:
Current
Methods and Applications (Humana Press, Inc. 1993), Cotter (ed.), Molecular
Diagnosis of Cancer (Humana Press, Inc. 1996), Hanausek and Walaszek (eds.),
Tumor
Marker Protocols (Humana Press, Inc. 1998), Lo (ed.), Clinical Applications of
PCR
(Humana Press, Inc. 1998), and Meltzer (ed.), PCR in Bioanalysis (Humana
Press, Inc.
1998)).
One variation of PCR for diagnostic assays is reverse transcriptase-PCR
(RT-PCR). In the RT-PCR technique, RNA is isolated from a biological sample,
reverse transcribed to cDNA, and the cDNA is incubated with Zven primers (see,
for
example, Wu et al. (eds.), "Rapid Isolation of Specific cDNAs or Genes by
PCR," in
Methods in Gene Biotechnology, pages 15-28 (CRC Press, Inc. 1997)). PCR is
then
performed and the products are analyzed using standard techniques.
As an illustration, RNA is isolated from biological sample using, for
example, the guanidinium-thiocyanate cell lysis procedure described above.
Alternatively, a solid-phase technique can be used to isolate mRNA from a cell
lysate.
A reverse transcription reaction can be primed with the isolated RNA using
random
oligonucleotides, short homopolymers of dT, or Zven anti-sense oligomers.
Oligo-dT
primers offer the advantage that various mRNA nucleotide sequences are
amplified that
can provide control target sequences. Zven sequences are amplified by the
polymerise
chain reaction using two flanking oligonucleotide primers that are typically
20 bases in
length.
PCR amplification products can be detected using a variety of
approaches. For example, PCR products can be fractionated by gel
electrophoresis, and
visualized by ethidium bromide staining. Alternatively, fractionated PCR
products can
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
68
be transferred to a membrane, hybridized with a detectably-labeled Zven probe,
and
examined by autoradiography. Additional alternative approaches include the use
of
digoxigenin-labeled deoxyribonucleic acid triphosphates to provide
chemiluminescence
detection, and the C-TRAK colorimetric assay.
Another approach for detection of Zvenl or Zven2 expression is cycling
probe technology (CPT), in which a single-stranded DNA target binds with an
excess of
DNA-RNA-DNA chimeric probe to form a complex, the RNA portion is cleaved with
RNAase H, and the presence of cleaved chimeric probe is detected (see, for
example,
Beggs et al., J. Clin. Microbiol. 34:2985 (1996), Bekkaoui et al.,
Biotechniques 20:240
to (1996)). Alternative methods for detection of Zven sequences can utilize
approaches
such as nucleic acid sequence-based amplification (NASBA), cooperative
amplification
of templates by cross-hybridization (CATCH), and the ligase chain reaction
(LCR) (see,
for example, Marshall et al., U.S. Patent No. 5,686,272 (1997), Dyer et al.,
J. Virol.
Methods 60:161 (1996), Ehricht et al., Eur. J. Biochem. 243:358 (1997), and
Chadwick
et al., J. Virol. Methods 70:59 (1998)). Other standard methods are known to
those of
skill in the art.
Zven probes and primers can also be used to detect and to localize Zven
gene expression in tissue samples. Methods for such in situ hybridization are
well-
known to those of skill in the art (see, for example, Choo (ed.), In Situ
Hybridization
2o Protocols (Humana Press, Inc. 1994), Wu et al. (eds.), "Analysis of
Cellular DNA or
Abundance of mRNA by Radioactive In Situ Hybridization IRISH)," in Methods in
Gene Biotechnology, pages 259-278 (CRC Press, Inc. 1997), and Wu et al.
(eds.),
"Localization of DNA or Abundance of mRNA by Fluorescence In Situ
Hybridization
IRISH)," in Methods in Gene Biotechnology, pages 279-289 (CRC Press, Inc.
1997)).
Various additional diagnostic approaches are well-known to those of skill in
the art
(see, for example, Mathew (ed.), Protocols in Human Molecular Genetics (Humana
Press, Inc. 1991), Coleman and Tsongalis, Molecular Diagnostics (Humana Press,
Inc.
1996), and Elles, Molecular Diagnosis of Genetic Diseases (Humana Press, Inc.,
1996)).
The Zven2 gene was found to reside at human chromosome 1p13; the
Wnt2B gene also resides in this region, as well as differentiation genes CSFI
and
Notch2. Chromosome 1p13 is associated with various diseases and disorders,
including
retinitis pigmentosa, Stargardt disease, Waardenburg syndrome, nemaline
myopathy,
Kabuki syndrome, and cardiomyopathy. The Zvenl gene resides in human
chromosome 3p21.1 - 3p14.3. This region of chromosome 3 is associated with
metaphyseal chondrodysplasia, small cell cancer of the lung, cerebral
gigantism (Sotos
Syndrome), Larsen Syndrome, spinocerebellar ataxia, Wernicke-Korsakoff
Syndrome,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
69
hyperglycinemia, septooptic dysplasia, progressive external ophthalmoplegia,
and
pancreatic cancer. The WntSA gene also resides in this region.
Nucleic acid molecules comprising Zven nucleotide sequences can be
used to determine whether a subject's chromosomes contain a mutation in the
Zven
gene. Detectable chromosomal aberrations at the Zvenl or Zven2 gene locus
include,
but are not limited to, aneuploidy, gene copy number changes, insertions,
deletions,
restriction site changes and rearrangements. Of particular interest are
genetic
alterations that inactivate a Zvenl or Zven2 gene.
Aberrations associated with a Zvenl or Zven2 locus can be detected
to using nucleic acid molecules of the present invention by employing
molecular genetic
techniques, such as restriction fragment length polymorphism analysis, short
tandem
repeat analysis employing PCR techniques, amplification-refractory mutation
system
analysis, single-strand conformation polymorphism detection, RNase cleavage
methods,
denaturing gradient gel electrophoresis, fluorescence-assisted mismatch
analysis, and
other genetic analysis techniques known in the art (see, for example, Mathew
(ed.),
Protocols in Human Molecular Genetics (Humana Press, Ine. 1991), Marian, Chest
108:255 (1995), Coleman and Tsongalis, Molecular Diagnostics (Human Press,
Ine.
1996), Elles (ed.) Molecular Diagnosis of Genetic Diseases (Humana Press, Inc.
1996),
Landegren (ed.), Laboratory Protocols for Mutation Detection (Oxford
University
2o Press 1996), Birren et al. (eds.), Genome Analysis, Vol. 2: Detecting Genes
(Cold
Spring Harbor Laboratory Press 1998), Dracopoli et al. (eds.), Current
Protocols in
Human Genetics (John Wiley & Sons 1998), and Richards and Ward, "Molecular
Diagnostic Testing," in Principles of Molecular Medicine, pages 83-88 (Humana
Press,
Inc. 1998)).
The protein truncation test is also useful for detecting the inactivation of
a gene in which translation-terminating mutations produce only portions of the
encoded
protein (see, for example, Stoppa-Lyonnet et al., Blood 91:3920 (1998)).
According to
this approach, RNA is isolated from a biological sample, and used to
synthesize cDNA.
PCR is then used to amplify the Zven target sequence and to introduce an RNA
3o polymerase promoter, a translation initiation sequence, and an in-frame ATG
triplet.
PCR products are transcribed using an RNA polymerase, and the transcripts are
translated in vitro with a T7-coupled reticulocyte lysate system. The
translation
products are then fractionated by SDS-PAGE to determine the lengths of the
translation
products. The protein truncation test is described, for example, by Dracopoli
et al.
(eds.), Current Protocols in Human Genetics, pages 9.11.1 - 9.11.18 (John
Wiley &
Sons 1998).
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
The present invention also contemplates kits for performing a diagnostic
assay for Zvenl or Zven2 gene expression or to examine a Zven locus. Such kits
comprise
nucleic acid probes, such as double-stranded nucleic acid molecules comprising
the
nucleotide sequence of SEQ >D NOs:l or 4, or a fragment thereof, as well as
single-
s stranded nucleic acid molecules having the complement of the nucleotide
sequence of
SEQ ID NOs:I or 4, or a fragment thereof. Probe molecules may be DNA, RNA,
oligonucleotides, and the like. Kits may comprise nucleic acid primers for
performing
PCR.
Such a kit can contain all the necessary elements to perform a nucleic
acid diagnostic assay described above. A kit will comprise at least one
container
comprising a Zven probe or primer. The kit may also comprise a second
container
comprising one or more reagents capable of indicating the presence of Zven
sequences.
Examples of such indicator reagents include detectable labels such as
radioactive labels,
fluorochromes, chemiluminescent agents, and the like. A kit may also comprise
a
15 means for conveying to the user that the Zven probes and primers are used
to detect
Zven gene expression. For example, written instructions may state that the
enclosed
nucleic acid molecules can be used to detect either a nucleic acid molecule
that encodes
Zven, or a nucleic acid molecule having a nucleotide sequence that is
complementary to
a Zven-encoding nucleotide sequence. The written material can be applied
directly to a
2o container, or the written material can be provided in the form of a
packaging insert.
11. Detection of Zven Protein with Anti-Zven Antibodies
The present invention contemplates the use of anti-Zven antibodies to
screen biological samples in vitro for the presence of Zven 1 or Zven2. In one
type of in
25 vitro assay, anti-Zven antibodies are used in liquid phase. For example,
the presence of
Zven in a biological sample can be tested by mixing the biological sample with
a trace
amount of labeled Zvenl (or Zven2) and an anti-Zven antibody under conditions
that
promote binding between Zven and its antibody. Complexes of Zven and anti-Zven
in the
sample can be separated from the reaction mixture by contacting the complex
with an
3o immobilized protein which binds with the antibody, such as an Fc antibody
or
Staphylococcus protein A. The concentration of Zven in the biological sample
will be
inversely proportional to the amount of labeled Zven bound to the antibody and
directly
related to the amount of free labeled Zven.
Alternatively, in vitro assays can be performed in which anti-Zven
35 antibody is bound to a solid-phase carrier. For example, antibody can be
attached to a
polymer, such as aminodextran, in order to link the antibody to an insoluble
support such
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
71
as a polymer-coated bead, a plate or a tube. Other suitable in vitro assays
will be readily
apparent to those of skill in the art.
In another approach, anti-Zven antibodies can be used to detect Zvenl or
Zven2 in tissue sections prepared from a biopsy specimen. Such immunochemical
detection can be used to determine the relative abundance of Zven and to
determine the
distribution of Zven in the examined tissue. General immunochemistry
techniques are
well established (see, for example, Ponder, "Cell Marking Techniques and Their
Application," in Mammalian Development: A Practical Approach, Monk (ed.),
pages
115-38 (IRL Press 1987), Coligan at pages 5.8.1-5.8.8, Ausubel (1995) at pages
14.6.1 to
14.6.13 (Whey Interscience 1990), and Manson (ed.), Methods In Molecular
Biology,
Vo1.10: Immunochemical Protocols (The Humana Press, Ins. 1992)).
Immunochemical detection can be performed by contacting a biological
sample with an anti-Zven antibody, and then contacting the biological sample
with a
detestably labeled molecule which binds to the antibody. For example, the
detestably
labeled molecule can comprise an antibody moiety that binds to anti-Zven
antibody.
Alternatively, the anti-Zven antibody can be conjugated with
avidin/streptavidin (or
biotin) and the detestably labeled molecule can comprise biotin (or
avidin/streptavidin).
Numerous variations of this basic technique are well-known to those of skill
in the art.
Alternatively, an anti-Zven antibody can be conjugated with a detectable
label to form an anti-Zven immunoconjugate. Suitable detectable labels
include, for
example, a radioisotope, a fluorescent label, a chemiluminescent label, an
enzyme label, a
bioluminescent label or colloidal gold. Methods of making and detecting such
detectably
labeled immunoconjugates are well-known to those of ordinary skill in the art,
and are
described in more detail below.
The detectable label can be a radioisotope that is detected by
autoradiography. Isotopes that are particularly useful for the purpose of the
present
invention are 3H, ~ZSI, ~~~I, 35S and'4C.
Anti-Zven immunoconjugates can also be labeled with a fluorescent
compound. The presence of a fluorescently-labeled antibody is determined by
exposing
the immunoconjugate to light of the proper wavelength and detecting the
resultant
fluorescence. Fluorescent labeling compounds include fluorescein
isothiocyanate, rhoda-
mine, phycoerytherin, phycocyanin, allophycocyanin, o-phthaldehyde and
fluorescamine.
Alternatively, anti-Zven immunoconjugates can be detestably labeled by
coupling an antibody component to a chemiluminescent compound. The presence of
the
chemiluminescent-tagged immunoconjugate is determined by detecting the
presence of
luminescence that arises during the course of a chemical reaction. Examples of
chemi
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
72
luminescent labeling compounds include luminol, isoluminol, an aromatic
acridinium
ester, an imidazole, an acridinium salt and an oxalate ester.
Similarly, a bioluminescent compound can be used to label anti-Zven
immunoconjugates of the present invention. Bioluminescence is a type of
chemiluminescence found in biological systems in which a catalytic protein
increases the
efficiency of the chemiluminescent reaction. The presence of a bioluminescent
protein is
determined by detecting the presence of luminescence. Bioluminescent compounds
that
are useful for labeling include luciferin, luciferase and aequorin.
Alternatively, anti-Zven immunoconjugates can be detectably labeled by
linking an anti-Zven antibody component to an enzyme. When the anti-Zven-
enzyme
conjugate is incubated in the presence of the appropriate substrate, the
enzyme moiety
reacts with the substrate to produce a chemical moiety, which can be detected,
for
example, by spectrophotometric, fluorometric or visual means. Examples of
enzymes that
can be used to detectably label polyspecific immunoconjugates include ~i-
galactosidase,
glucose oxidase, peroxidase and alkaline phosphatase.
Those of skill in the art will know of other suitable labels, which can be
employed in accordance with the present invention. The binding of marker
moieties to
anti-Zven antibodies can be accomplished using standard techniques known to
the art.
Typical methodology in this regard is described by Kennedy et al., Clin. Chim.
Acta 70:1
(1976), Schurs et al., Clin. Chim. Acta 81:1 (1977), Shih et al., Int'l J.
Cancer 46:1101
(1990), Stein et al., Cancer Res. 50:1330 (1990), and Coligan, supra.
Moreover, the convenience and versatility of immunochemical detection
can be enhanced by using anti-Zven antibodies that have been conjugated with
avidin,
streptavidin, and biotin (see, for example, Wilchek et al. (eds.), "Avidin-
Biotin
Technology," Methods In Enzymology, Vol. 184 (Academic Press 1990), and Bayer
et al.,
"Immunochemical Applications of Avidin-Biotin Technology," in Methods In
Molecular
Biology, Vol. 10, Manson (ed.), pages 149-162 (The Humana Press, Inc. 1992).
Methods for performing immunoassays are well-established. See, for
example, Cook and Self, "Monoclonal Antibodies in Diagnostic Immunoassays," in
Monoclonal Antibodies: Production, Engineering, and Clinical Application,
Ritter and
Ladyman (eds.), pages 180-208, (Cambridge University Press, 1995), Perry, "The
Role of
Monoclonal Antibodies in the Advancement of Immunoassay Technology," in
Monoclonal Antibodies: Principles and Applications, Birch and Lennox (eds.),
pages
107-120 (Whey-Liss, Inc. 1995), and Diamandis, Immunoassay (Academic Press,
Inc.
1996).
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
73
In a related approach, biotin- or FTTC-labeled Zvenl or Zven2 can be used
to identify cells that bind Zven 1 or Zven2. Such can binding can be detected,
for
example, using flow cytometry.
The present invention also contemplates kits for performing an
immunological diagnostic assay for Zven gene expression. Such kits comprise at
least
one container comprising an anti-Zven antibody, or antibody fragment. A kit
may also
comprise a second container comprising one or more reagents capable of
indicating the
presence of Zven antibody or antibody fragments. Examples of such indicator
reagents
include detectable labels such as a radioactive label, a fluorescent label, a
chemiluminescent label, an enzyme label, a bioluminescent label, colloidal
gold, and the
like. A kit may also comprise a means for conveying to the user that Zven
antibodies or
antibody fragments are used to detect Zven protein. For example, written
instructions
may state that the enclosed antibody or antibody fragment can be used to
detect Zven.
The written material can be applied directly to a container, or the written
material can
~ 5 be provided in the form of a packaging insert.
12. Therapeutic Uses of Zven Polypeptides
The present invention includes the use of proteins, polypeptides, and
peptides having Zven activity (such as Zven polypeptides, Zven analogs, active
Zven
2o anti-idiotype antibodies, and Zven fusion proteins) to a subject, which
lacks an
adequate amount of this polypeptide. The present invention contemplates both
veterinary and human therapeutic uses. lllustrative subjects include mammalian
subjects, such as farm animals, domestic animals, and human patients.
For example, a protein, a polypeptide, or a peptide having Zvenl activity
25 can be administered to a subject (e.g., a human patient), which has small
cell cancer of
the lung. In contrast, Zven antagonists (e.g., anti-Zven antibodies or anti-
Zven anti
idiotype antibodies that are biologically inactive) can be used to treat a
subject who
produces an excess of Zven. Therapeutic uses for Zven proteins include, anti-
tumor
agent (e.g., anti-lung tumor agent), anti-inflammatory agent, an agent to
regulate
3o regeneration or remodeling of tissues, and an agent to modulate necrosis or
tissue
growth developmental arrest. As an illustration, Zven polypeptides may be used
to
promote wound healing, to prevent or to treat an adverse reaction of the skin
to a skin-
sensitizing agent or a skin-irritating agent, or to stimulate the immune
system of an
immunocompromised individual.
35 For example, polypeptides, peptides, and peptides having Zven2 activity
may be used to inhibit cellular proliferation, cellular differentiation, and
necrosis. In
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
74
particular, polypeptides, peptides, and peptides having Zven2 activity may be
used to
inhibit cellular proliferation associated with mammary tumors, colon cancer,
melanomas, hepatocellular carcinomas, and the like.
The Zven polypeptides of the present invention may also be used in
treatment of disorders associated with gastrointestinal cell contractility,
secretion of
digestive enzymes and acids, gastrointestinal motility, recruitment of
digestive
enzymes; inflammation, particularly as it affects the gastrointestinal system;
and reflux
disease and regulation of nutrient absorption; and modulation of blood
pressure.
Specific conditions that will benefit from treatment with molecules of the
present
invention include, but are not limited to, diabetic gastroparesis, post-
surgical
gastroparesis, vagotomy, chronic idiopathic intestinal pseudo-obstruction and
gastroesophageal reflux disease. Additional uses include, gastric emptying for
radiological studies, stimulating gallbladder contraction and antrectomy. Zven
antagonists are useful for clinical conditions associated with
gastrointestinal
hypermotility such as diarrhea and Crohn's disease.
Generally, the dosage of administered polypeptide, protein or peptide
will vary depending upon such factors as the patient's age, weight, height,
sex, general
medical condition and previous medical history. Typically, it is desirable to
provide the
recipient with a dosage of a molecule having Zven activity, which is in the
range of
from about 1 pg/kg to 10 mg/kg (amount of agent/body weight of patient),
although a
lower or higher dosage also may be administered as circumstances dictate.
Administration of a molecule having Zven activity to a subject can be
intravenous, intraarterial, intraperitoneal, intramuscular, subcutaneous,
intrapleural,
intrathecal, by perfusion through a regional catheter, or by direct
intralesional injection.
When administering therapeutic proteins by injection, the administration may
be by
continuous infusion or by single or multiple boluses. Alternatively, Zvenl or
Zven2 can
be administered as a controlled release formulation.
Additional routes of administration include oral, dermal, mucosal
membrane, pulmonary, and transcutaneous. Oral delivery is suitable for
polyester
microspheres, zero microspheres, proteinoid microspheres, polycyanoacrylate
microspheres, and lipid-based systems (see, for example, DiBase and Morrel,
"Oral
Delivery of Microencapsulated Proteins," in Protein Delivery: Physical
Systems,
Sanders and Hendren (eds.), pages 255-288 (Plenum Press 1997)). The
feasibility of an
intranasal delivery is exemplified by such a mode of insulin administration
(see, for
example, Hinchcliffe and lllum, Adv. Drug Deliv. Rev. 35:199 (1999)). Dry or
liquid
particles comprising Zven 1 or Zven2 can be prepared and inhaled with the aid
of dry-
powder dispersers, liquid aerosol generators, or nebulizers (e.g., Pettit and
Gombotz,
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
TIBTECH 16:343 (1998); Patton et al., Adv. Drug Deliv. Rev. 35:235 (1999)).
This
approach is illustrated by the AERX diabetes management system, which is a
hand-held
electronic inhaler that delivers aerosolized insulin into the lungs. Studies
have shown
that proteins as large as 48,000 kDa have been delivered across skin at
therapeutic
5 concentrations with the aid of low-frequency ultrasound, which illustrates
the feasibility
of trascutaneous administration (Mitragotri et al., Science 269:850 (1995)).
Transdermal delivery using electroporation provides another means to
administer
Zvenl or Zven2 (Pons et al., Pharm. Biotechnol. 10:213 (1997)).
Zven proteins can also be applied topically as, for example, liposomal
1o preparations, gels, salves, as a component of a glue, prosthesis, or
bandage, and the like.
Topical administration is useful for wound healing applications, including the
prevention of excess scaring and granulation tissue, prevention of keyloids,
and
prevention of adhesions following surgery.
A pharmaceutical composition comprising molecules having Zvenl or
15 Zven2 activity can be furnished in liquid form, in an aerosol, or in solid
form. Proteins
having Zvenl or Zven2 activity can be administered as a conjugate with a
pharmaceutically acceptable water-soluble polymer moiety. As an illustration,
a Zvenl
polyethylene glycol conjugate is useful to increase the circulating half life
of the
interferon, and to reduce the immunogenicity of the polypeptide. Liquid forms,
20 including liposome-encapsulated formulations, are illustrated by injectable
solutions
and oral suspensions. Exemplary solid forms include capsules, tablets, and
controlled-
release forms, such as a miniosmotic pump or an implant. Other dosage forms
can be
devised by those skilled in the art, as shown, for example, by Ansel and
Popovich,
Pharmaceutical Dosage Forms and Drug Delivery Systems, 5'h Edition (Lea &
Febiger
25 1990), Gennaro (ed.), Remington's Pharmaceutical Sciences, 19'h Edition
(Mack
Publishing Company 1995), and by Ranade and Hollinger, Drug Delivery Systems
(CRC Press 1996).
A pharmaceutical composition comprising a protein, polypeptide, or
peptide having Zvenl or Zven2 activity can be formulated according to known
methods
30 to prepare pharmaceutically useful compositions, whereby the therapeutic
proteins are
combined in a mixture with a pharmaceutically acceptable carrier. A
composition is
said to be a "pharmaceutically acceptable carrier" if its administration can
be tolerated
by a recipient patient. Sterile phosphate-buffered saline is one example of a
pharmaceutically acceptable carrier. Other suitable carriers are well-known to
those in
35 the art. See, for example, Gennaro (ed.), Remington's Pharmaceutical
Sciences, 19th
Edition (Mack Publishing Company 1995).
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
76
For purposes of therapy, molecules having Zvenl or Zven2 activity and
a pharmaceutically acceptable carrier are administered to a patient in a
therapeutically
effective amount. A combination of a protein, polypeptide, or peptide having
Zven
activity and a pharmaceutically acceptable carrier is said to be administered
in a
"therapeutically effective amount" if the amount administered is
physiologically
significant. An agent is physiologically significant if its presence results
in a detectable
change in the physiology of a recipient patient.
For example, the present invention includes methods of inhibiting the
proliferation of tumor cells, comprising the step of administering a
composition
comprising a Zven2 polypeptide or peptide to the tumor cells. In an in vivo
approach,
the composition is a pharmaceutical composition, administered in a
therapeutically
effective amount to a mammalian subject, which has a tumor. Such in vivo
administration can provide at least one physiological effect selected from the
group
consisting of decreased number of tumor cells, decreased metastasis, decreased
size of a
solid tumor, and increased necrosis of a tumor.
A pharmaceutical composition comprising molecules having Zven
activity can be furnished in liquid form, or in solid form. Liquid forms,
including
liposome-encapsulated formulations, are illustrated by injectable solutions
and oral
suspensions. Exemplary solid forms include capsules, tablets, and controlled-
release
2o forms, such as a miniosmotic pump or an implant. Other dosage forms can be
devised
by those skilled in the art, as shown, for example, by Ansel and Popovich,
Pharmaceutical Dosage Forms and Drug Delivery Systems, 5th Edition (Lea &
Febiger
1990), Gennaro (ed.), Remington's Pharmaceutical Sciences, 19~h Edition (Mack
Publishing Company 1995), and by Ranade and Hollinger, Drug Delivery Systems
(CRC Press 1996).
Zvenl or Zven2 pharmaceutical compositions may be supplied as a kit
comprising a container that comprises Zvenl or Zven2, a Zvenl or Zven2
agonist, or a
Zvenl or Zven2 antagonist (e.g., an anti-Zvenl or Zven2 antibody or antibody
fragment). For example, Zvenl or Zven2 can be provided in the form of an
injectable
solution for single or multiple doses, or as a sterile powder that will be
reconstituted
before injection. Alternatively, such a kit can include a dry-powder
disperser, liquid
aerosol generator, or nebulizer for administration of a therapeutic
polypeptide. Such a
kit may further comprise written information on indications and usage of the
pharmaceutical composition. Moreover, such information may include a statement
that
the Zven 1 or Zven2 composition is contraindicated in patients with known
hypersensitivity to Zvenl or Zven2.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
77
13. Therapeutic Uses of Zven Nucleotide Sequences
The present invention includes the use of Zven nucleotide sequences to
provide Zven amino acid sequences to a subject in need of proteins,
polypeptides, or
peptides having Zven activity, as discussed in the previous section. For
example, Zven2
nucleotide sequences can be used to produce Zven2 in order to inhibit cellular
proliferation. In addition, a therapeutic expression vector can be provided
that inhibits
Zven gene expression, such as an anti-sense molecule, a ribozyme, or an
external guide
sequence molecule.
There are numerous approaches to introduce a Zven gene to a subject,
including the use of recombinant host cells that express Zven, delivery of
naked nucleic
acid encoding Zven, use of a cationic lipid carrier with a nucleic acid
molecule that
encodes Zven, and the use of viruses that express Zven, such as recombinant
retroviruses, recombinant adeno-associated viruses, recombinant adenoviruses,
and
recombinant Herpes simplex viruses [HSV] (see, for example, Mulligan, Science
260:926 (1993), Rosenberg et al., Science 242:1575 (1988), LaSalle et al.,
Science
259:988 (1993), Wolff et al., Science 247:1465 (1990), Breakfield and Deluca,
The
New Biologist 3:203 (1991)). In an ex vivo approach, for example, cells are
isolated
from a subject, transfected with a vector that expresses a Zven gene, and then
transplanted into the subject.
2o In order to effect expression of a Zven gene, an expression vector is
constructed in which a nucleotide sequence encoding a Zven gene is operably
linked to a
core promoter, and optionally a regulatory element, to control gene
transcription. The
general requirements of an expression vector are described above.
Alternatively, a Zven gene can be delivered using recombinant viral
vectors, including for example, adenoviral vectors (e.g., Kass-Eisler et al.,
Proc. Nat'l
Acad. Sci. USA 90:11498 (1993), Kolls et al., Proc. Nat'l Acad. Sci. USA
91:215
(1994), Li et al., Hum. Gene Ther. 4:403 (1993), Vincent et al., Nat. Genet.
5:130
(1993), and Zabner et al., Cell 75:207 (1993)), adenovirus-associated viral
vectors
(Flotte et al., Proc. Nat'l Acad. Sci. USA 90:10613 (1993)), alphaviruses such
as
3o Semliki Forest Virus and Sindbis Virus (Hertz and Huang, J. Vir. 66:857
(1992), Raju
and Huang, J. Vir. 65:2501 (1991), and Xiong et al., Science 243:1188 (1989)),
herpes
viral vectors (e.g., U.S. Patent Nos. 4,769,331, 4,859,587, 5,288,641 and
5,328,688),
parvovirus vectors (Koering et al., Hum. Gene Therap. 5:457 (1994)), pox virus
vectors
(Ozaki et al., Biochem. Biophys. Res. Comm. 193:653 (1993), Panicali and
Paoletti,
Proc. Nat'l Acad. Sci. USA 79:4927 (1982)), pox viruses, such as canary pox
virus or
vaccinia virus (Fisher-Hoch et al., Proc. Nat'l Acad. Sci. USA 86:317 (1989),
and
Flexner et al., Ann. N. Y. Acad. Sci. 569:86 (1989)), and retroviruses (e.g.,
Baba et al., J.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
78
Neurosurg 79:729 (1993), Ram et al., Cancer Res. 53:83 (1993), Takamiya et
al., J.
Neurosci. Res 33:493 (1992), Vile and Hart, Cancer Res. 53:962 (1993), Vile
and Hart,
Cancer Res. 53:3860 (1993), and Anderson et al., U.S. Patent No. 5,399,346).
Within
various embodiments, either the viral vector itself, or a viral particle which
contains the
viral vector may be utilized in the methods and compositions described below.
As an illustration of one system, adenovirus, a double-stranded DNA
virus, is a well-characterized gene transfer vector for delivery of a
heterologous nucleic
acid molecule (for a review, see Becker et al., Meth. Cell Biol. 43:161
(1994); Douglas
and Curiel, Science & Medicine 4:44 (1997)). The adenovirus system offers
several
to advantages including: (i) the ability to accommodate relatively large DNA
inserts, (ii)
the ability to be grown to high-titer, (iii) the ability to infect a broad
range of
mammalian cell types, and (iv) the ability to be used with many different
promoters
including ubiquitous, tissue specific, and regulatable promoters. In addition,
adenoviruses can be administered by intravenous injection, because the viruses
are
stable in the bloodstream.
Using adenovirus'vectors where portions of the adenovirus genome are
deleted, inserts are incorporated into the viral DNA by direct ligation or by
homologous
recombination with a co-transfected plasmid. In an exemplary system, the
essential E 1
gene is deleted from the viral vector, and the virus will not replicate unless
the E1 gene
is provided by the host cell. When intravenously administered to intact
animals,
adenovirus primarily targets the liver. Although an adenoviral delivery system
with an
E1 gene deletion cannot replicate in the host cells, the host's tissue will
express and
process an encoded heterologous protein. Host cells will also secrete the
heterologous
protein if the corresponding gene includes a secretory signal sequence.
Secreted
proteins will enter the circulation from tissue that expresses the
heterologous gene (e.g.,
the highly vascularized liver).
Moreover, adenoviral vectors containing various deletions of viral genes
can be used to reduce or eliminate immune responses to the vector. Such
adenoviruses
are E1-deleted, and in addition, contain deletions of E2A or E4 (Lusky et al.,
J. Virol.
72:2022 ( 1998); Raper et al., Human Gene Therapy 9:671 ( 1998)). The deletion
of E2b
has also been reported to reduce immune responses (Amalfitano et al., J.
Virol. 72:926
(1998)). By deleting the entire adenovirus genome, very large inserts of
heterologous
DNA can be accommodated. Generation of so called "gutless" adenoviruses, where
all
viral genes are deleted, are particularly advantageous for insertion of large
inserts of
heterologous DNA (for a review, see Yeh. and Perricaudet, FASEB J. 11:615
(1997)).
High titer stocks of recombinant viruses capable of expressing a
therapeutic gene can be obtained from infected mammalian cells using standard
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
79
methods. For example, recombinant HSV can be prepared in Vero cells, as
described
by Brandt et al., J. Gen. Virol. 72:2043 (1991), Herold et al., J. Gen. Virol.
75:1211
(1994), Visalli and Brandt, Virology 185:419 (1991), Grau et al., Invest.
Ophthalmol.
Vis. Sci. 30:2474 (1989), Brandt et al., J. Virol. Meth. 36:209 (1992), and by
Brown and
MacLean (eds.), HSV Virus Protocols (Humana Press 1997).
Alternatively, an expression vector comprising a Zven gene can be
introduced into a subject's cells by lipofection in vivo using liposomes.
Synthetic
cationic lipids can be used to prepare liposomes for in vivo transfection of a
gene
encoding a marker (Felgner et al., Proc. Nat'l Acad. Sci. USA 84:7413 (1987);
Mackey
et al., Proc. Nat'l Acad. Sci. USA 85:8027 (1988)). The use of lipofection to
introduce
exogenous genes into specific organs in vivo has certain practical advantages.
Liposomes can be used to direct transfection to particular cell types, which
is
particularly advantageous in a tissue with cellular heterogeneity, such as the
pancreas,
liver, kidney, and brain. Lipids may be chemically coupled to other molecules
for the
purpose of targeting. Targeted peptides (e.g., hormones or neurotransmitters),
proteins
such as antibodies, or non-peptide molecules can be coupled to liposomes
chemically.
Electroporation is another alternative mode of administration of Zven
nucleic acid molecules. For example, Aihara and Miyazaki, Nature Biotechnology
16:867 (1998), have demonstrated the use of in vivo electroporation for gene
transfer
into muscle.
In an alternative approach to gene therapy, a therapeutic gene may
encode a Zven anti-sense RNA that inhibits the expression of Zven. Suitable
sequences
for Zven anti-sense molecules can be derived from the nucleotide sequences of
Zven
disclosed herein.
Alternatively, an expression vector can be constructed in which a
regulatory element is operably linked to a nucleotide sequence that encodes a
ribozyme.
Ribozymes can be designed to express endonuclease activity that is directed to
a certain
target sequence in a mRNA molecule (see, for example, Draper and Macejak, U.S.
Patent No. 5,496,698, McSwiggen, U.S. Patent No. 5,525,468, Chowrira and
3o McSwiggen, U.S. Patent No. 5,631,359, and Robertson and Goldberg, U.S.
Patent No.
5,225,337). In the context of the present invention, ribozymes include
nucleotide
sequences that bind with Zven mRNA.
In another approach, expression vectors can be constructed in which a
regulatory element directs the production of RNA transcripts capable of
promoting RNase
P-mediated cleavage of mRNA molecules that encode a Zven gene. According to
this
approach, an external guide sequence can be constructed for directing the
endogenous
ribozyme, RNase P, to a particular species of intracellular mRNA, which is
subsequently
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
cleaved by the cellular ribozyme (see, for example, Altman et al., U.S. Patent
No.
5,168,053, Yuan et al., Science 263:1269 (1994), Pace et al., international
publication
No. WO 96/18733, George et al., international publication No. WO 96/21731, and
Werner et al., international publication No. WO 97/33991). Preferably, the
external
5 guide sequence comprises a ten to fifteen nucleotide sequence complementary
to Zven
mRNA, and a 3'-NCCA nucleotide sequence, wherein N is preferably a purine. The
external guide sequence transcripts bind to the targeted mRNA species by the
formation
of base pairs between the mRNA and the complementary external guide sequences,
thus
promoting cleavage of mRNA by RNase P at the nucleotide located at the 5'-side
of the
t o base-paired region.
In general, the dosage of a composition comprising a therapeutic vector
having a Zven nucleotide acid sequence, such as a recombinant virus, will vary
depending upon such factors as the subject's age, weight, height, sex, general
medical
condition and previous medical history. Suitable routes of administration of
therapeutic
15 vectors include intravenous injection, intraarterial injection,
intraperitoneal injection,
intramuscular injection, intratumoral injection, and injection into a cavity
that contains
a tumor.
A composition comprising viral vectors, non-viral vectors, or a
combination of viral and non-viral vectors of the present invention can be
formulated
2o according to known methods to prepare pharmaceutically useful compositions,
whereby
vectors or viruses are combined in a mixture with a pharmaceutically
acceptable carrier.
As noted above, a composition, such as phosphate-buffered saline is said to be
a
"pharmaceutically acceptable carrier" if its administration can be tolerated
by a
recipient subject. Other suitable carriers are well-known to those in the art
(see, for
25 example, Remington's Pharmaceutical Sciences, 19th Ed. (Mack Publishing Co.
1995),
and Gilman's the Pharmacological Basis of Therapeutics, 7th Ed. (MacMillan
Publishing Co. 1985)).
For purposes of therapy, a therapeutic gene expression vector, or a
recombinant virus comprising such a vector, and a pharmaceutically acceptable
carrier
30 are administered to a subject in a therapeutically effective amount. A
combination of
an expression vector (or virus) and a pharmaceutically acceptable carrier is
said to be
administered in a "therapeutically effective amount" if the amount
administered is
physiologically significant. An agent is physiologically significant if its
presence
results in a detectable change in the physiology of a recipient subject.
35 When the subject treated with a therapeutic gene expression vector or a
recombinant virus is a human, then the therapy is preferably somatic cell gene
therapy.
That is, the preferred treatment of a human with a therapeutic gene expression
vector or
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
81
a recombinant virus does not entail introducing into cells a nucleic acid
molecule that
can form part of a human germ line and be passed onto successive generations
(i.e.,
human germ line gene therapy).
s 14. Production of Transgenic Mice
Transgenic mice can be engineered to over-express the Zven gene in all
tissues or under the control of a tissue-specific or tissue-preferred
regulatory element.
These over-producers of Zven can be used to characterize the phenotype that
results
from over-expression, and the transgenic animals can serve as models for human
1o disease caused by excess Zven. Transgenic mice that over-express Zven also
provide
model bioreactors for production of Zven in the milk or blood of larger
animals.
Methods for producing transgenic mice are well-known to those of skill in the
art (see,
for example, Jacob, "Expression and Knockout of Interferons in Transgenic
Mice," in
Overexpression and Knockout of Cytokines in Transgenic Mice, Jacob (ed.),
pages 111-
15 124 (Academic Press, Ltd. 1994), Monastersky and Robl (eds.), Strategies in
Transgenic Animal Science (ASM Press 1995), and Abbud and Nilson, "Recombinant
Protein Expression in Transgenic Mice," in Gene Expression Systems: Using
Nature for
the Art of Expression, Fernandez and Hoeffler (eds.), pages 367-397 (Academic
Press,
Inc. 1999)).
20 For example, a method for producing a transgenic mouse that expresses
a Zven gene can begin with adult, fertile males (studs) (B6C3fl, 2-8 months of
age
(Taconic Farms, Germantown, NY)), vasectomized males (duds) (B6D2f1, 2-8
months,
(Taconic Farms)), prepubescent fertile females (donors) (B6C3f1, 4-5 weeks,
(Taconic
Farms)) and adult fertile females (recipients) (B6D2f1, 2-4 months, (Taconic
Farms)).
25 The donors are acclimated for one week and then injected with approximately
8
ILT/mouse of Pregnant Mare's Serum gonadotrophin (Sigma Chemical Company; St.
Louis, MO) LP., and 46-47 hours later, 8 IU/mouse of human Chorionic
Gonadotropin
(hCG (Sigma)) LP. to induce superovulation. Donors are mated with studs
subsequent
to hormone injections. Ovulation generally occurs within 13 hours of hCG
injection.
3o Copulation is confirmed by the presence of a vaginal plug the morning
following
mating.
Fertilized eggs are collected under a surgical scope. The oviducts are
collected and eggs are released into urinanalysis slides containing
hyaluronidase
(Sigma). Eggs are washed once in hyaluronidase, and twice in Whitten's W640
medium
35 (described, for example, by Menino and O'Claray, Biol. Reprod. 77:159
(1986), and
Dienhart and Downs, Zygote 4:129 (1996)) that has been incubated with 5% CO2,
5%
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
82
02, and 90% NZ at 37°C. The eggs are then stored in a 37°C/5%
COZ incubator until
microinjection.
Ten to twenty micrograms of plasmid DNA containing a Zven encoding
sequence is linearized, gel-purified, and resuspended in 10 mM Tris-HCl (pH
7.4), 0.25
mM EDTA (pH 8.0), at a final concentration of 5-10 nanograms per microliter
for
microinjection. For example, the Zvenl encoding sequences can comprise
nucleotide
sequences that encode amino acid residues 23 to 108 of SEQ ID N0:2, while
Zven2
encoding sequences can encode a polypeptide comprising amino acid residues 148
to
405 of SEQ m NO:S.
t0 Plasmid DNA is microinjected into harvested eggs contained in a drop
of W640 medium overlaid by warm, COZ-equilibrated mineral oil. The DNA is
drawn
into an injection needle (pulled from a 0.75mm m, lmm OD borosilicate glass
capillary), and injected into individual eggs. Each egg is penetrated with the
injection
needle, into one or both of the haploid pronuclei.
t5 Picoliters of DNA are injected into the pronuclei, and the injection
needle withdrawn without coming into contact with the nucleoli. The procedure
is
repeated until all the eggs are injected. Successfully microinjected eggs are
transferred
into an organ tissue-culture dish with pre-gassed W640 medium for storage
overnight in
a 37°C/5% COZ incubator.
2o The following day, two-cell embryos are transferred into pseudopregnant
recipients. The recipients are identified by the presence of copulation plugs,
after
copulating with vasectomized duds. Recipients are anesthetized and shaved on
the
dorsal left side and transferred to a surgical microscope. A small incision is
made in
the skin and through the muscle wall in the middle of the abdominal area
outlined by
25 the ribcage, the saddle, and the hind leg, midway between knee and spleen.
The
reproductive organs are exteriorized onto a small surgical drape. The fat pad
is
stretched out over the surgical drape, and a baby serrefine (Roboz, Rockville,
MD) is
attached to the fat pad and left hanging over the back of the mouse,
preventing the
organs from sliding back in.
3o With a fine transfer pipette containing mineral oil followed by
alternating W640 and air bubbles, 12-17 healthy two-cell embryos from the
previous
day's injection are transferred into the recipient. The swollen ampulla is
located and
holding the oviduct between the ampulla and the bursa, a nick in the oviduct
is made
with a 28 g needle close to the bursa, making sure not to tear the ampulla or
the bursa.
35 The pipette is transferred into the nick in the oviduct, and the embryos
are blown in, allowing the first air bubble to escape the pipette. The fat pad
is gently
pushed into the peritoneum, and the reproductive organs allowed to slide in.
The
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
83
peritoneal wall is closed with one suture and the skin closed with a wound
clip. The
mice recuperate on a 37°C slide warmer for a minimum of four hours.
The recipients are returned to cages in pairs, and allowed 19-21 days
gestation. After birth, 19-21 days postpartum is allowed before weaning. The
weanlings are sexed and placed into separate sex cages, and a 0.5 cm biopsy
(used for
genotyping) is snipped off the tail with clean scissors.
Genomic DNA is prepared from the tail snips using, for example, a
QIAGEN DNEASY kit following the manufacturer's instructions. Genomic DNA is
analyzed by PCR using primers designed to amplify a Zven gene or a selectable
marker
gene that was introduced in the same plasmid. After animals are confirmed to
be
transgenic, they are back-crossed into an inbred strain by placing a
transgenic female
with a wild-type male, or a transgenic male with one or two wild-type
female(s). As
pups are born and weaned, the sexes are separated, and their tails snipped for
genotyping.
To check for expression of a transgene in a live animal, a partial
hepatectomy is performed. A surgical prep is made of the upper abdomen
directly
below the zyphoid process. Using sterile technique, a small 1.5-2 cm incision
is made
below the sternum and the left lateral lobe of the liver exteriorized. Using 4-
0 silk, a tie
is made around the lower lobe securing it outside the body cavity. An
atraumatic clamp
2o is used to hold the tie while a second loop of absorbable Dexon (American
Cyanamid;
Wayne, N.J.) is placed proximal to the first tie. A distal cut is made from
the Dexon tie
and approximately 100 mg of the excised liver tissue is placed in a sterile
petri dish.
The excised liver section is transferred to a 14 ml polypropylene round bottom
tube and
snap frozen in liquid nitrogen and then stored on dry ice. The surgical site
is closed
with suture and wound clips, and the animal's cage placed on a 37°C
heating pad for
24 hours post operatively. The animal is checked daily post operatively and
the wound
clips removed 7-10 days after surgery. The expression level of Zven mRNA is
examined for each transgenic mouse using an RNA solution hybridization assay
or
polymerise chain reaction.
3o In addition to producing transgenic mice that over-express Zven, it is
useful to engineer transgenic mice with either abnormally low or no expression
of the
gene. Such transgenic mice provide useful models for diseases associated with
a lack
of Zven. As discussed above, Zven gene expression can be inhibited using anti-
sense
genes, ribozyme genes, or external guide sequence genes. To produce transgenic
mice
that under-express the Zvere gene, such inhibitory sequences are targeted to
Zven
mRNA. Methods for producing transgenic mice that have abnormally low
expression
of a particular gene are known to those in the art (see, for example, Wu et
al., "Gene
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
84
Underexpression in Cultured Cells and Animals by Antisense DNA and RNA
Strategies," in Methods in Gene Biotechnology, pages 205-224 (CRC Press
1997)).
An alternative approach to producing transgenic mice that have little or
no Zven gene expression is to generate mice having at least one normal Zven
allele
replaced by a nonfunctional Zven gene. One method of designing a nonfunctional
Zven
gene is to insert another gene, such as a selectable marker gene, within a
nucleic acid
molecule that encodes Zven. Standard methods for nroducin~ these so-called
"knockout mice" are known to those skilled in the art (see, for example,
Jacob,
"Expression and Knockout of Interferons in Transgenic Mice," in Overexpression
and
Knockout of Cytokines in Transgenic Mice, Jacob (ed.), pages 111-124 (Academic
Press, Ltd. 1994), and Wu et al., "New Strategies for Gene Knockout," in
Methods in
Gene Biotechnology, pages 339-365 (CRC Press 1997)).
The present invention, thus generally described, will be understood more
readily by reference to the following examples, which are provided by way of
illustration
and are not intended to be limiting of the present invention.
EXAMPLE 1
Expression of the Zvenl Gene
Zvenl gene expression was examined using a PCR array panel of cell
lines, including blood cell and connective tissue cell lines. In one study,
Zvenl
expression was found to be restricted to B cell, T cell, monocyte, and
granulocyte cell
lines. Zvenl appeared to be highly expressed in the promyelocytic cell line
HL60. This
observation indicates that Zvenl is expressed in blood progenitor cells,
because the
HL60 line is capable of differentiating into either monocytes or granulocytes.
The only
tested nonhematopoietic line displaying Zvenl expression was A549, a lung
adenocarcinoma line.
In another study, freshly isolated human neutrophils and monocytes were
screened via PCR for Zvenl expression with or without lipopolysaccharide (LPS)
activation. Zvenl gene expression was detected in unactivated monocytes, but
not in
activated monocytes. Expression was also apparent in granulocytes. Zvenl
expression
was not detected in endothelial cells of a microvascular origin.
EXAMPLE 2
Inhibition of Cellular Proliferation by Zvenl
The effect of Zvenl on cellular proliferation was examined using
conditioned media either from cells infected with an adenovirus vector
designed to
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
express Zvenl, or from cells infected with an adenovirus vector that lacked a
Zvenl
gene (parental control). In one study, human fibroblast cells from normal lung
(ATCC
NO. CRL-1490) were plated at 2500 cells/100 ~1/well in 96 well plates with
normal
growth medium (MEM with Earle's salts and NEAA, 10% fetal bovine serum (FBS)).
5 After plating, the cells were allowed to adhere to the plates for 24 hours.
Media were
then discarded, and conditioned media test samples diluted in growth media
were added
(100 p,l/well). For comparison, murine Lewis Lung carcinoma cells (8000 cells
per
well in 10 p.1) were transferred into 96 well plates, which contained 100
~,1/well of
conditioned media test samples diluted in growth media (DMEM high glucose, 10%
FBS). All cells were incubated for 72 hours.
After 72 hours, cells were examined using the CellTiter 96~ Non-
Radioactive Cell Proliferation Assay (Promega Corporation; Madison, W>7.
Absorbance readings were measured at A572-A650. Percent inhibition values were
calculated as the average of triplicate readings of A572-A650, using the
equation: 100-
15 ((100*Abs of sample)/Abs of medium alone). The results indicated that Zvenl
can
inhibit the proliferation of Lewis Lung cells by about 50% below controls,
whereas
Zven 1 treatment appeared to inhibit the proliferation of normal lung cells by
about
10%.
The ability of Zvenl to affect the proliferation of A549 human lung
2o adenocarcinoma cells was tested with conditioned media. A549 cells are
plated at
1,000 cells per well in Hams F12 containing 10%FBS, and incubated for three
days
prior to serum starvation in Hams F12 (without FBS) for 24 hours. Zvenl
conditioned
media samples were diluted 1:l with either serum-free media or media
containing 10%
FBS, and proliferation was measured after a 72 hour incubation. The results of
this
25 study indicated that Zvenl can inhibit the proliferation of A549 cells
below controls by
about 25%.
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
1
SEQUENCE LISTING
<110> Sheppard. Paul 0.
Bishop, Paul D.
Whitmore. Theodore E.
Thompson. Penny P.
<120> Human Zven Proteins
<130> 99-81PC
<160> 7
<170> FastSEQ for Windows Version 3.0
<210> 1
<211> 1496
<212> DNA
<213> Homo Sapiens
<220>
<221> CDS
<222> (66)...(389)
<400> 1
cgcccttact cactataggg ctcgagcggc cgcccgggca ggtgccgccc agtcccgagg 60
gcgcc atg agg agc ctg tgc tgc gcc cca ctc ctg ctc ctc ttg ctg ctg 110
Met Arg Ser Leu Cys Cys Ala Pro Leu Leu Leu Leu Leu Leu Leu
1 5 10 15
ccg ccg ctg ctg ctc acg ccc cgc get ggg gac gcc gcc gtg atc acc 158
Pro Pro Leu Leu Leu Thr Pro Arg Ala Gly Asp Ala Ala Val Ile Thr
20 25 30
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
2
ggg get tgt gac aag gac tcc caa tgt ggt gga ggc atg tgc tgt get 206
Gly Ala Cys Asp Lys Asp Ser Gln Cys Gly Gly Gly Met Cys Cys Ala
35 40 45
gtc agt atc tgg gtc aag agc ata agg att tgc aca cct atg ggc aaa 254
Val Ser Ile Trp Val Lys Ser Ile Arg Ile Cys Thr Pro Met Gly Lys
50 55 60
ctg gga gac agc tgc cat cca ctg act cgt aaa gtt cca ttt ttt ggg 302
Leu Gly Asp Ser Cys His Pro Leu Thr Arg Lys Ual Pro Phe Phe Gly
65 70 75
cgg agg atg cat cac act tgc cca tgt ctg cca ggc ttg gcc tgt tta 350
Arg Arg Met His His Thr Cys Pro Cys Leu Pro Gly Leu Ala Cys Leu
80 85 90 95
cgg act tca ttt aac cga ttt att tgt tta gcc caa aag taatcgctct 399
Arg Thr Ser Phe Asn Arg Phe Ile Cys Leu Ala Gln Lys
100 105
ggagtagaaaccaaatgtgaatagccacatcttacctgtaaagtcttacttgtgattgtg459
ccaaacaaaaaatgtgccagaaagaaatgctcttgcttcctcaactttccaagtaacatt519
tttatctttgatttgtaaatgatttttttttttttttttatcgaaagagaattttacttt579
tggatagaaatatgaagtgtaaggcattatggaactggttcttatttccctgtttgtgtt639
ttggtttgatttggcttttttcttaaatgtcaaaaacgtacccattttcacaaaaatgag699
gaaaataagaatttgatattttgttagaaaaacttttttttttttttctcaccaccccaa759
gccccatttgtgccctgccgcacaaatacacctacagcttttggtcccttgcctcttcca819
cctcaaagaatttcaaggctcttaccttactttatttttgtccatttctcttccctcctc879
ttgcattttaaagtggagggtttgtctctttgagtttgatggcagaatcactgatgggaa939
tccagctttttgctggcatttaaatagtgaaaagagtgtatatgtgaacttgacactcca999
aactcctgtcatggcacggaagctaggagtgctgctggacccttcctaaacctgtcactc1059
aagaggacttcagctctgctgttgggctggtgtgtggacagaaggaatggaaagccaaat1119
taatttagtccagatttctaggtttgggtttttctaaaaataaaagattacatttacttc1179
ttttactttttataaagttttttttccttagtctcctacttagagatattctagaaaatg1239
tcacttgaagaggaagtatttattttaatctggcacaacactaattaccatttttaaagc1299
ggtattaagttgtaatttaaaccttgtttgtaactgaaaggtcgattgtaatggattgcc1359
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
3
gtttgtacct gtatcagtat tgctgtgtaa aaattctgta tcagaataat aacagtactg 1419
tatatcattt gatttatttt aatattatat ccttattttt gtcaaaaaaa aaaaaaaaaa 1479
aaaaatatgc ggccgcg 1496
<210> 2
<211> 108
<212> PRT
<213> Homo sapiens
<400> 2
Met Arg Ser Leu Cys Cys Ala Pro Leu Leu Leu Leu Leu Leu Leu Pro
1 5 10 15
Pro Leu Leu Leu Thr Pro Arg Ala Gly Asp Ala Ala Ual Ile Thr Gly
20 25 30
Ala Cys Asp Lys Asp Ser Gln Cys Gly Gly Gly Met Cys Cys Ala Val
35 40 45
Ser Ile Trp Ual Lys Ser Ile Arg Ile Cys Thr Pro Met Gly Lys Leu
50 55 60
Gly Asp Ser Cys His Pro Leu Thr Arg Lys Ual Pro Phe Phe Gly Arg
65 70 75 80
Arg Met His His Thr Cys Pro Cys Leu Pro Gly Leu Ala Cys Leu Arg
85 90 95
Thr Ser Phe Asn Arg Phe Ile Cys Leu Ala Gln Lys
100 105
<210> 3
<211> 324
<212> DNA
<213> Artificial Sequence
<220>
<223> This degenerate sequence encodes the amino acid
sequence of SEQ ID N0:2.
<221> misc feature
<222> (1)...(324)
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
4
<223> n = A.T,C or G
<400> 3
atgmgnwsnytntgytgygcnccnytnytnytnytnytnytnytnccnccnytnytnytn60
acnccnmgngcnggngaygcngcngtnathacnggngcntgygayaargaywsncartgy120
ggnggnggnatgtgytgygcngtnwsnathtgggtnaarwsnathmgnathtgyacnccn180
atgggnaarytnggngaywsntgycayccnytnacnmgnaargtnccnttyttyggnmgn240
mgnatgcaycayacntgyccntgyytnccnggnytngcntgyytnmgnacnwsnttyaay300
mgnttyathtgyytngcncaraar 324
<210> 4
<211> 1409
<212> DNA
<213> Homo sapiens
<220>
<221> CDS
<222> (91)...(405)
<400> 4
tggcctcccc agcttgccag gcacaaggct gagcgggagg aagcgagagg catctaagca 60
ggcagtgttt tgccttcacc ccaagtgacc atg aga ggt gcc acg cga gtc tca 114
Met Arg Gly Ala Thr Arg Val Ser
1 5
atc atg ctc ctc cta gta act gtg tct gac tgt get gtg atc aca ggg 162
Ile Met Leu Leu Leu Val Thr Val Ser Asp Cys Ala Val Ile Thr Gly
15 20
gcc tgt gag cgg gat gtc cag tgt ggg gca ggc acc tgc tgt gcc atc 210
Ala Cys Glu Arg Asp Val Gln Cys Gly Ala Gly Thr Cys Cys Ala Ile
25 30 35 40
agc ctg tgg ctt cga ggg ctg cgg atg tgc acc ccg ctg ggg cgg gaa 258
Ser Leu Trp Leu Arg Gly Leu Arg Met Cys Thr Pro Leu Gly Arg Glu
45 50 55
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
ggc gag gag tgc cac ccc ggc agc cac aag gtc ccc ttc ttc agg aaa 306
Gly Glu Glu Cys His Pro Gly Ser His Lys Ual Pro Phe Phe Arg Lys
60 65 70
cgc aag cac cac acc tgt cct tgc ttg ccc aac ctg ctg tgc tcc agg 354
Arg Lys His His Thr Cys Pro Cys Leu Pro Asn Leu Leu Cys Ser Arg
75 80 85
ttc ccg gac ggc agg tac cgc tgc tcc atg gac ttg aag aac atc aat 402
Phe Pro Asp Gly Arg Tyr Arg Cys Ser Met Asp Leu Lys Asn Ile Asn
90 95 100
ttt taggcgcttg cctggtctca ggatacccac catccttttc ctgagcacag 455
Phe
105
cctggatttttatttctgccatgaaacccagctcccatgactctcccagtccctacactg515
actaccctgatctctcttgtctagtacgcacatatgcacacaggcagacatacctcccat575
catgacatggtccccaggctggcctgaggatgtcacagcttgaggctgtggtgtgaaagg635
tggccagcctggttctcttccctgctcaggctgccagagaggtggtaaatggcagaaagg695
acattccccctcccctccccaggtgacctgctctctttcctgggccctgcccctctcccc755
acatgtatccctcggtctgaattagacattcctgggcacaggctcttgggtgcattgctc815
agagtcccaggtcctggcctgaccctcaggcccttcacgtgaggtctgtgaggaccaatt875
tgtgggtagttcatcttccctcgattggttaactccttagtttcagaccacagactcaag935
attggctcttcccagagggcagcagacagtcaccccaaggcaggtgtagggagcccaggg995
aggccaatcagccccctgaagactctggtcccagtcagcctgtggcttgtggcctgtgac1055
ctgtgaccttctgccagaattgtcatgcctctgaggccccctcttaccacactttaccag1115
ttaaccactgaagcccccaattcccacagcttttccattaaaatgcaaatggtggtggtt1175
caatctaatctgatattgacatattagaaggcaattagggtgtttccttaaacaactcct1235
ttccaaggatcagccctgagagcaggttggtgactttgaggagggcagtcctctgtccag1295
attggggtgggagcaagggacagggagcagggcaggggctgaaaggggcactgattcaga1355
ccagggaggcaactacacaccaacctgctggctttagaataaaagcaccaactg 1409
<210> 5
<211> 105
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
6
<212> PRT
<213> Homo Sapiens
<400> 5
Met Arg Gly Ala Thr Arg Val Ser Ile Met Leu Leu Leu Val Thr Val
1 5 10 15
Ser Asp Cys Ala Val Ile Thr Gly Ala Cys Glu Arg Asp Val Gln Cys
20 25 30
Gly Ala Gly Thr Cys Cys Ala Ile Ser Leu Trp Leu Arg Gly Leu Arg
35 40 45
Met Cys Thr Pro Leu Gly Arg Glu Gly Glu Glu Cys His Pro Gly Ser
50 55 60
His Lys Val Pro Phe Phe Arg Lys Arg Lys His His Thr Cys Pro Cys
65 70 75 80
Leu Pro Asn Leu Leu Cys Ser Arg Phe Pro Asp Gly Arg Tyr Arg Cys
85 90 95
Ser Met Asp Leu Lys Asn Ile Asn Phe
100 105
<210> 6
<211> 315
<212> DNA
<213> Artificial Sequence
<220>
<223> This degenerate sequence encodes the amino acid
sequence of SEQ ID N0:5.
<221> misc feature
<222> (1)...(315)
<223> n = A,T,C or G
<400> 6
atgmgnggng cnacnmgngt nwsnathatg ytnytnytng tnacngtnws ngaytgygcn 60
gtnathacng gngcntgyga rmgngaygtn cartgyggng cnggnacntg ytgygcnath 120
wsnytntggy tnmgnggnyt nmgnatgtgy acnccnytng gnmgngargg ngargartgy 180
CA 02392128 2002-05-15
WO 01/36465 PCT/US00/31278
7
cayccnggnw sncayaargt nccnttytty mgnaarmgna arcaycayac ntgyccntgy 240
ytnccnaayy tnytntgyws nmgnttyccn gayggnmgnt aymgntgyws natggayytn 300
aaraayatha aytty 315
<210> 7
<211> 16
<212> PRT
<213> Arificial Sequence
<220>
<223> Peptide linker.
<400> 7
Gly Gly Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10 15
