Note: Descriptions are shown in the official language in which they were submitted.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
1
Moss genes from Physcomitrella patens encoding proteins involved in the
synthesis of polyunsaturated fatty acids and lipids
Background of the Invention
Certain products and by-products of naturally-occurring metabolic processes in
cells have utility in a wide array of industries, including the food, feed,
cosmetics,
and pharmaceutical industries. These molecules, collectively termed 'fine
chemicals', include lipids and fatty acids, cofactors and enzymes. Fine
chemicals
can be produced in microorganisms through the large-scale culture of
microorganisms developed to produce and secrete large quantities of one or
more
desired molecules
Their production is most conveniently performed through the large-scale
culture
of microorganisms developed to produce and secrete large quantities of one or
more desired molecules. One particularly useful organism for this purpose is
Corynebacterium glutamicum, a gram positive, nonpathogenic bacterium.
Further particularly useful organisms for this purpose are Phaedactylum
tricornutum, a polyunsaturated fatty acids (PUFA) producing algae or ciliates
like
Stylonychia lemnae. Through strain selection, a number of mutant strains of
the
respective microorganisms have been developed which produce an array of
desirable compounds. However, selection of strains improved. for the
production
of a particular molecule is a time-consuming and difFcult process.
Alternatively the production of fme chemicals can be most conveniently
performed via the large scale production of plants developed, to produce one
of
aforementioned fine chemicals. Particularly well suited plants for this
purpose are
oilseed plants containing high amounts of lipid compounds like rapeseed,
canola,
linseed, soybean and sunflower. But also other crop plants containing oils or
lipids
and fatty acids are well suited as mentioned in the detailed description of
this
invention. Through conventional breeding, a number of mutant plants have been
developed which produce an array of desirable lipids and fatty acids,
cofactors
and enzymes. However, selection of new plant cultivars improved for the
production of a particular molecule is a time-consuming and difficult process
or
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
2
even impossible if the compound does not naturally occur in the respective
plant
as in the case of polyunsaturated fatty acids.
Summary of the Invention
This invention provides novel nucleic acid molecules which may be used to
modify lipids and fatty acids, cofactors and enzymes in microorganims and
plants,
especially and most preferred to produce polyunsaturated fatty acids.
Microorganisms like Phaeodactylum, Stylonychia lemnae and Corynebacterium,
fungi and plants are commonly used in industry for the large-scale production
of a
variety of fme chemicals.
Given the availability of cloning vectors for use in Corynebacterium
glutamicum,
such as those disclosed in Sinskey et al., U.S. Patent No. 4,649,119, and
techniques for genetic manipulation of ,G glutamicum and the related
Brevibacterium species (e.g., lactofermentum) (Yoshihama et al, .I. Bacteriol.
162:
591-597 (1985); Katsumata et al., J. Bacteriol. 159: 306-311 (1984); and
Santamaria et al., J. Gen. Microbiol. 130: 2237-2246 (1984)), the nucleic acid
molecules of the invention may be utilized in the genetic engineering of this
organism to make it a better or more e~cient producer of one or more fine
chemicals. This improved production or efficiency of production of a fine
chemical may be due to a direct effect of manipulation of a gene of the
invention,
or it may be due to an indirect effect of such manipulation.
Given the availability of cloning vectors and techniques for genetic
manipulation
of ciliates such as disclosed in W09801572 or algae and related organisms such
as Phaeodactylum tricornutum described in Falciatore et al., 1999, Marine
Biotechnology 1 (3):239-251 as well as Dunahay et al. 1995, Genetic
transformation of diatoms, J. Phycol. 31:10004-1012 and references therein the
nucleic acid molecules of the invention may be utilized in the genetic
engineering
of this organism to make it a better or more e~cient producer of one or more
fine
chemicals. This improved production or efFciency of production of a fme
chemical may be due to a direct effect of manipulation of a gene of the
invention,
or it may be due fo an indirect effect of such manipulation.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
3
Mosses and algae are the only known plant systems that produce considerable
amounts of polyunsaturated fatty acids like arachidonic acid (ARA) and/or
eicosapentaenoic acid (EPA) and/or docosahexaenoic acid (DHA). Therefor
nucleic acid molecules originating from a moss like Physcomitrella patens are
especially suited to modify the lipid and PUFA production system in a host,
_ especially in microorganisms and plants. Furthermore nucleic acids from the
moss
Physcomitrella patens can be used to identify those DNA sequences and enzymes
in other species which are useful to modify the biosynthesis of precursor
molecules of PUFAs in the respective organisms.
The moss Physcomitrella patens represents one member of the mosses. It is
related to other mosses such as Ceratodon purpureus which is capable to grow
in
the absense of light. Mosses like Ceratodon and Physcomitrella share a high
degree of homology on the DNA sequence and polypeptide level allowing the use
of heterologous screening of DNA molecules with probes evolving from other
mosses or organisms, thus enabling the derivation of a consensus sequence
suitable for heterologous screening or functional annotation and prediction of
gene functions in third species. The ability to identify such functions can
therefor
have significant relevance, e.g., prediction of substrate specificity of
enzymes.
Further, these nucleic acid molecules may serve as reference points for the
mapping of moss genomes, or of genomes of related organisms.
These novel nucleic acid molecules encode proteins, referred to herein as
Lipid Metabolism Related P_roteins_(LMRPs). These LMRPs are capable of, for
example, performing a function involved in the metabolism (e.g., the
biosynthesis
or degradation) of compounds necessary for lipid or fatty acid biosynthesis,
or of
assisting in the fransmembrane transport of one or more lipid/fatty acid
compounds either into or out of the cell. Given the availability of cloning
vectors
for use in plants and plant transformation, such as those published in and
cited
therein: Plant Molecular Biology and Biotechnology (CRC Press, Boca Raton,
Florida), chapter 6/7,5.71-119 (1993); F.F. White, Vectors for Gene Transfer
in
Higher Plants; in: Transgenic Plants, Vol. 1, Engineering and Utilization,
eds.:
Kung and R. Wu, Academic Press, 1993, 15-38; B. Jenes et al., Techniques for
Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization,
eds.:
Kung and R. Wu, Academic Press (1993), 128-143; Potrykus, Annu. Rev. Plant
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
4
Physiol. Plant Molec. Biol. 42 (1991), 205-225)) the nucleic acid molecules of
the
invention may be utilized in the genetic engineering of a wide variety of
plants to
make it a better or more efficient producer of one or more fine chemicals.
This
improved production or efficiency of production of a fine chemical may be due
to
a direct effect of manipulation of a gene of the invention, or it may be due
to an
indirect effect of such manipulation.
There are a number of mechanisms by which the alteration of an LMRP of the
invention may directly affect the yield, production, and/or efficiency of
l0 production of a fine chemical from an oilseed plant due to such an altered
protein.
Those LMRPs involved in the transport of fine chemical molecules from the cell
may be increased in number or activity such that greater quantities of these
compounds are allocated to different plant cell compartments or the cell
exterior
space from which they are more readily recovered and partitioned into the
biosynthetic flux or deposited. Similarly, those LMRPs involved in the import
of
nutrients necessary for the biosynthesis of one or more fine chemicals (e.g.,
fatty
acids, polar and neutral lipids) may be increased in number or activity such
that
these precursors, cofactors, or intermediate compounds are increased in
concentration within the cell or within the storing compartments. Further,
fatty
2o acids and lipids themselves are desirable fme chemicals; by optimizing the
activity or increasing the number of one or more LMRPs of the invention which
participate in the biosynthesis of these compounds, or by impairing the
activity of
one or more LMRPs which are involved in the degradation of these compounds, it
may be possible to increase the yield, production, and/or efficiency of
production
of fatty acid and lipid molecules from plants or microorganisms.
The mutagenesis of one or more LMRPs of the invention may also result in
LMRPs having altered activities which indirectly impact the production of one
or
more desired fine chemicals from plants. For example, LMRPs of the invention
3o involved in the export of waste products may be increased in number or
activity
such that the normal metabolic wastes of the cell (possibly increased in
quantity
due to the overproduction of the desired fine chemical) are efficiently
exported
before they are able to damage nucleotides and proteins within the cell (which
would decrease the viability of the cell) or to interfere with fme chemical
biosynthetic pathways (which would decrease the yield, production, or
efficiency
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
of production of the desired fme chemical). Further, the relatively large
intracellular quantities of the desired fine -chemical may in itself be toxic
to the
cell or may interfere with enzyme feedback mechanisms such as allosteric
regulation, so by increasing the activity or number of transporters able to
export
5 this compound from the compartment, one may increase the viability of seed
cells,
in turn leading to a greater number of cells in the culture producing the
desired
fine chemical. The LMRPs of the invention may also be manipulated such that
the relative amounts of different lipid and fatty acid molecules are produced.
This
may have a profound effect on the lipid composition of the membrane of the
cell.
Since each type of lipid has different physical properties, an alteration in
the lipid
composition of a membrane may significantly alter membrane fluidity. Changes
in membrane fluidity can impact the transport of molecules across the
membrane,
as well as the integrity of the cell, both of which have a profound effect on
the
production of fine chemicals. In plants these changes can moreover also
influence
other characteristic like tolerance towards abiotic and biotic stress
conditions.
The invention provides novel nucleic acid molecules which encode proteins,
referred to herein as LMRPs, which are capable of, for example, participating
in
the metabolism of compounds necessary for the construction of cellular
membranes or lipids and fatty acids, or in the transport of molecules across
membranes. Nucleic acid molecules encoding an LMRP are referred to herein as
LMRP nucleic acid molecules. In a preferred embodiment, the LMRP
participates in the metabolism of compounds necessary for the construction of
cellular membranes in plants, or in the transport of molecules across these,
membranes of oilseed plants. Examples of such proteins include those encoded
by
the genes set forth in Table 1. As biotic and abiotic stress tolerance is a
general
trait wished to be inherited into a wide variety of plants like maize, wheat;
rye,
oat, triticale, rice, barley, soybean, peanut, cotton, rapeseed and canola,
manihot,
pepper, sunflower and tagetes, solanaceaous plants like potato, tobacco,
eggplant,
3o and tomato, Vicia species, pea, alfalfa, bushy plants (coffee, cacao, tea),
Salix
species, trees (oil palm, coconut) and perennial grasses and forage crops.
These
crop plants are also preferred target plants for a genetic engineering as one
father
embodiment of the present invention.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
6
Accordingly, one aspect of the invention pertains to isolated nucleic acid
molecules (e.g., cDNAs) comprising a nucleotide sequence encoding an LMRP or
biologically active portions thereof, as well as nucleic acid fragments
suitable as
primers or hybridization probes for the detection or amplification of LMRP-
encoding nucleic acid (e.g., DNA or mRNA). In particularly preferred
embodiments, the isolated nucleic acid molecule comprises one of the
nucleotide
sequences set forth in Appendix A or the coding region or a complement of one
of
these nucleotide sequences. In other particularly preferred embodiments, the
isolated nucleic acid molecule of the invention comprises a nucleotide
sequence
l0 which hybridizes to or is at least about 50%, preferably at least about
60%, more
preferably at least about 70%, 80% or 90%, and even most preferably at least
about 95%, 96%, 97%, 98%, 99% or more homologous to a nucleotide sequence
set forth in Appendix A, or a portion thereof. In other preferred embodiments,
the
isolated nucleic acid molecule encodes one of the amino acid sequences set
forth
in Appendix B. The preferred LMRPs of the present invention also preferably
possess at least one of the LMRP activities described herein.
In another embodiment, the isolated nucleic acid molecule encodes a protein or
portion thereof wherein the protein or portion thereof includes an amino acid
sequence which is sufficiently homologous to an amino acid sequence of
Appendix B, e.g., sufficiently homologous to an amino acid sequence of
Appendix B such that the protein or portion thereof maintains an LMRP
activity.
Preferably, the protein or portion thereof encoded by the nucleic acid
molecule
maintains the ability to participate in the metabolism of compounds necessary
for
the construction of cellular membranes of plants or in the transport of
molecules
across these membranes. In one embodiment, the protein encoded by the nucleic
acid molecule is at least about 50%, preferably at least about 60%, and more
preferably at least about 70%, 80%, or 90% and most preferably at least about
95%, 96%, 97%, 98%, or 99% or more homologous to an amino acid sequence of
Appendix B (e.g., an entire amino acid sequence selected from those sequences
set forth in Appendix B). In another preferred embodiment, the protein is a
full
length Physcomitrella patens protein which is substantially homologous to an
entire amino acid sequence of Appendix B (encoded by an open reading flame
shown in Appendix A).
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
7
In another preferred embodiment, the isolated nucleic acid molecule is derived
from Physcomitrella patens and encodes a protein (e.g., an LMRP fusion
protein)
which includes a biologically active domain which is at least about 50% or
more
homologous to one of the amino acid sequences of Appendix B and is able to
participate in the metabolism of compounds necessary for the construction of
cellular membranes or in the transport of molecules across these membranes, or
has one or more of the activities set forth in Table 1, and which also
includes
heterologous nucleic acid sequences encoding a heterologous polypeptide or
regulatory regions.
Another aspect of the invention pertains to an LMRP polypeptide whose amino
acid sequence can be modulated with the help of art-known computer simulation
programms resulting in an polypeptide with e.g. improved activity or altered
regulation (molecular modelling). On the basis of this artificially generated
polypeptide sequences, a corresponding nucleic acid molecule coding for such a
modulated polypeptide can be synthesized in-vitro using the specific codon-
usage
of the desired host cell, e.g. of microorganisms, mosses, algae, ciliates,
fungi or
plants.
In a preferred embodiment, even these artificial nucleic acid molecules coding
for
improved LMRP proteins are within the scope of this invention.
In another embodiment, the isolated nucleic acid molecule is at least 15
nucleotides in length and hybridizes under stringent conditions to.a nucleic
acid
molecule comprising a nucleotide sequence of Appendix A. Preferably, the
isolated nucleic acid molecule corresponds to a naturally-occurring nucleic
acid
molecule. More preferably, the isolated nucleic acid encodes a naturally-
occurring Physcomitrella patens LMRP, or a biologically active portion
thereof.
Another. aspect of the invention pertains to vectors, e.g., recombinant
expression
vectors, containing the nucleic acid molecules of the invention, and host
cells into
which such vectors have been introduced, especially microorganims, plant
cells,
plant tissue, organs or whole plants. In one embodiment, such a host cell is a
cell
capable of storing fme chemical compounds in order to isolate the desired
compound from harvested material The compound or the LMRP can then be
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
8
isolated from the medium or the host cell, which in plants are cells
containing and
storing fine chemical compounds, most preferably cells of storage tissues like
epidermal and seed cells.
Yet another aspect of the invention pertains to a genetically altered
Physcomitrella patens plant in which an LMRP gene has been introduced or
altered. In one embodiment, the genome of the Physcomitrella patens plant has
been altered by introduction of a nucleic acid molecule of the invention
encoding
wild-type or mutated LMRP sequence as a transgene. In another embodiment, an
to endogenous LMRP gene within the genome of the Physcomitrella patens plant
has been altered, e.g., functionally disrupted, by homologous recombination
with
an altered LMRP gene. In a preferred embodiment, the plant organism belongs to
the genus Physcomitrella or Ceratodon, with Physcomitrella being particularly
preferred. In a preferred embodiment, the Physcomitrella patens plant is also
utilized for the production of a desired compound, such as lipids or fatty
acids,
with PUFAs being particularly preferred.
Hence in another preferred embodiment, the moss Physcomitrella patens can be
used to show the function of new, yet unidentified genes of mosses or plants
using
homologous recombination based on the nucleic acids described in this
invention.
Still another aspect of the invention pertains to an isolated LMRP or a
portion,
e.g., a biologically active portion, thereof. In a preferred embodiment, the
isolated
LMRP or portion thereof can participate in the metabolism of compounds
necessary for the construction of cellular membranes in a microorganism or a
plant cell, or in the transport of molecules across its membranes. In another
preferred embodiment, the isolated LMRP or portion thereof is sufficiently
homologous to an amino acid sequence of Appendix B such that the protein or
portion thereof maintains the ability to participate in the metabolism of
compounds necessary for the construction of cellular membranes in
microorganisms or plant cells, or in the transport of molecules across these
membranes.
The invention also provides an isolated preparation of an LMRP. In preferred
embodiments, the LMRP comprises an amino acid sequence of Appendix B. In
another preferred embodiment, the invention pertains to an isolated full
length
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
9
protein which is substantially homologous to an entire amino acid sequence of
Appendix B (encoded by an open reading frame set forth in Appendix A). In yet
another embodiment, the protein is at least about 50%, preferably at least
about
60%, and more preferably at least about 70%, 80%, or 90%, and most preferably
at least about 95%, 96%, 97%, 98%, or 99% or more homologous to an entire
amino acid sequence of Appendix B. In other embodiments, the isolated LMRP
comprises an amino acid sequence which is at least about 50% or more
homologous to one of the amino acid sequences of Appendix B and is able to
participate in the metabolism of compounds necessary for the construction of
fatty
acids in a microorganism or a plant cell, or in the transport of molecules
across
these membranes, or has one or more of the activities set forth in Table 1.
Alternatively, the isolated LMRP can comprise an amino acid sequence which is
encoded by a nucleotide sequence which hybridizes, e.g., hybridizes under
stringent conditions, or is at least about 50%, preferably at least about 60%,
more
preferably at least about 70%, 80%, or 90%, and even most preferably at least
about 95%, 96%, 97%, 98,%, or 99% or more homologous, to a nucleotide
sequence of Appendix B.
The LMRP polypeptide, or a biologically active portion thereof, can be
operatively linked to a non-LMRP polypeptide to form a fusion protein. In
preferred embodiments, this fusion protein has an activity which differs from
that
of the LMRP alone. In other preferred embodiments, this fusion protein
participate in the metabolism of compounds necessary for the synthesis of
lipids
and fatty acids, cofactors and enzymes in microorganisms or plants, or in the
transport of molecules across the membranes of plants. In particularly
preferred
embodiments, integration' of this fusion protein into a host cell modulates
production of a desired compound from the cell.
Another aspect of the invention pertains to a method for producing a fine
chemical. This method involves either the culturing of a suitable
microorganism .
or culturing plant cells tissues, organs or whole plants containing a vector
directing the expression of an LMRP nucleic acid molecule of the invention,
such
that a fine chemical is produced. In a preferred embodiment, this method
further
includes the step of obtaining. a cell containing such a vector, in which a
cell is
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
transformed with a vector directing the expression of an LMRP nucleic acid. In
another preferred embodiment, this method further includes the step of
recovering
the fme chemical from the culture. In a particularly preferred embodiment, the
cell is from the genus Physcomitrella, Phaeodactylum, Corynebacterium,
ciliates,
5 fungi or plants, especially from oilseed.
Another aspect of the invention pertains to a method for producing a fine
chemical which involves the culturing of a suitable host cell whose genomic
DNA
has been altered by the inclusion of an LMRP nucleic acid molecule of the
l0 invention. In another embodiment, this method involves culturing a suitable
cell
whose membrane has been altered by the inclusion of a LMRP polypeptide of the
invention.
Another aspect of the invention pertains to methods for modulating production
of
a molecule from a microorganism. Such methods include contacting the cell with
an agent which modulates LMRP activity or LMRP nucleic acid expression such
that a cell associated activity is- altered relative to this same activity in
the absence
of the agent. In a preferred embodiment, the cell is modulated for one or more
metabolic pathways for lipids and fatty acids, cofactors and enzymes or is
modulated for the transport of compounds across such membranes, such that the
yields or rate of production of a desired fine chemical by this microorganism
is
improved. The agent which modulates LMRP activity can be an agent which
stimulates LMRP activity or LMRP nucleic acid expression. Examples of agents
which stimulate LMRP activity or LMRP nucleic acid expression include small
molecules, active LMRPs, and nucleic acids encoding LMRPs that have been
introduced into the cell. Examples of agents which inhibit LMRP activity or
expression include small molecules and antisense LMRP nucleic acid molecules.
Another aspect of the invention pertains to methods for modulating yields of a
desired compound from a cell, involving the introduction of a wild-type or
mutant
LMRP gene into a cell, either maintained on a separate plasmid or integrated
into
the genome of the host cell. If integrated into the genome, such integration
can be
random, or it can take place by recombination such that the native gene is
replaced by the introduced copy, causing the production of the desired
compound
from the cell to be modulated or by using a gene in traps such as. the gene is
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
11
functionally linked to a functional expression unit containing at least a
sequence
facilitating the expression of a gene and a sequence facilitating the
polyadenylation of a functionally transcribed gene.
In a preferred embodiment, said yields are modified. In another preferred
embodiment, said desired chemical is increased while unwanted disturbing
compounds can be decreased. In a particularly preferred embodiment, said
desired fine chemical is a lipid or fatty acid, cofactor or enzyme. In
especially
preferred embodiments, said chemical is a polyunsaturated fatty acid.
Detailed Description of the Invention
The present invention provides LMRP nucleic acid and protein molecules which
are involved in the metabolism of lipids and fatty acids, cofactors and
enzymes in
the moss Physcomitrella patens or in the transport of lipoplulic compounds
across
such membranes. The molecules of the invention may be utilized in the
modulation of production of fine chemicals from microorganisms, such as
Corynebacterium or Brevebacterium, selected from the group consisting of
Corynebacterium glutamicum, Corynebacterium herculis, Corynebacterium,
lilium, Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum,
Corynebacterium acetophilum, Corynebacterium ammoniagenes,
Corynebacterium fujiokense, Corynebacterium nitrilophilus, Brevibacterizcm
ammoniagenes, Brevibacterium butanicum, Brevibacterium divaricatum,
Brevibacterium flavum, Brevibacterium healii, Brevibacterium ketoglutamicum,
Brevibacterium ketosoreductum, Brevibacterium lactofermentum, Brevibacterium
linens or Brevibacterium paraj~nolyticum. Further the molecules of the
invention
may be utilized in the modulation of production of fine chemicals from
ciliates,
fungi, mosses, algae and plants like maize, wheat, rye, oat, triticale, rice,
barley,
soybean, peanut, cotton, Brassica species like rapeseed, canola and turnip
rape,
pepper, sunflower and tagetes, solanaceaous plants like potato, tobacco,
eggplant,
and tomato, Vicia species, pea, manihot, alfalfa, bushy plants (coffee, cacao,
tea),
Salix species, trees (oil palm, coconut) and perennial grasses and forage
crops
either directly (e.g.; where overexpression or optimization of a fatty acid
biosynthesis protein has a direct impact on the yield, production, and/or
efficiency
of production of the fatty acid from modified organisms), or may have an
indirect
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
12
impact which nonetheless results . in an increase of yield, production, and/or
efficiency of production of the desired compound or decrease of undesired
compounds (e.g., where modulation of the metabolism of lipids and fatty acids,
cofactors and enzymes results in alterations in the yield, production, and/or
efficiency of production or the composition of desired compounds within the
cells, which in turn may impact the production of one or more fine chemicals).
Aspects of the invention are further explicated below.
Fine Chemicals
The term 'fme chemical' is art-recognized and includes molecules produced by
an
organism which have applications in various industries, such as, but not
limited
to, the pharmaceutical, agriculture, and cosmetics industries. Such compounds
include lipids, fatty acids, cofactors and enzymes, both proteinogenic and non-
proteinogenic amino acids, purine and pyrimidine bases, nucleosides, and
nucleotides (as described e.g. in Kuninaka, A. (1996) Nucleotides and related
compounds, p. 561-612, in Biotechnology vol. 6, Rehm et al., eds. VCH:
Weinheim, and references contained therein), lipids, both saturated and
polyunsaturated fatty acids (e.g., arachidonic acid), diols (e.g., propane
diol, and
butane diol), carbohydrates (e.g., hyaluronic acid and trehalose), aromatic
compounds (e.g., aromatic amines, vanillin, and indigo), vitamins and
cofactors
(as described in Ullmann's Encyclopedia of Industrial Chemistry, vol. A27,
Vitamins, p. 443-613 (1996) VCH: Weinheim and references therein; and Ong,
A.S., Niki, E. & Packer, L. (1995) Nutrition, Lipids, Health, and Disease
Proceedings of the UNESCO/Confederation of Scientific and Technological
Associations in Malaysia, and the Society for Free Radical Research, Asia,
held
Sept. 1-3, 1994 at Penang, Malaysia, AOCS Press, (1995)), enzymes, and all
other
chemicals described in Gutcho (1983) Chemicals by Fermentation, Noyes Data
Corporation; ISBN: 0818805086 and references therein. The metabolism and
uses of certain of these fine chemicals are further explicated below.
I lipids and fatty acids cofactors and enzymes
Cellular membranes serve a variety of functions in a cell. First and foremost,
a
membrane differentiates the contents of a cell from the surrounding
environment,
thus giving integrity to the cell. Membranes may also serve as barners to the.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
13
influx of hazardous or unwanted compounds, and also to the efflux of desired
compounds. Cellular membranes are by nature impervious to the unfacilitated
diffusion of hydrophilic compounds such as proteins, water molecules and ions
due to their structure: a bilayer of lipid molecules in which the polar head
groups
face outwards (towards the exterior and interior of the cell, respectively)
and the
nonpolar tails face inwards at the center of the bilayer, forming a
hydrophobic
core (for a general review of membrane structure and function, see Gennis,
R.B.
(1989) Biomembranes, Molecular Structure and Function, Springer: Heidelberg).
This barrier enables cells to maintain a relatively higher concentration of
desired
compounds and a relatively lower concentration of undesired compounds than are
contained within the surrounding medium, since the diffusion of these
compounds
is effectively blocked by the membrane.
However, the membrane also presents an effective barrier to the import of
desired
compounds and the export of waste molecules. To overcome this difficulty,
cellular membranes incorporate many kinds of transporter proteins which are
able
to facilitate the transmembrane transport of different kinds of compounds.
There
are two general classes of these transport proteins: pores or channels and
transporters. The former are integral membrane proteins, sometimes complexes
of proteins, which form a regulated hole through the membrane. This
regulation,
or 'gating' is generally specific to the molecules to be transported by the
pore or
channel, rendering these transmembrane constructs selectively permeable to a
specific class of substrates; for example, a potassium channel is constructed
such
that only ions having a like charge and size to that of potassium may pass
through.
Channel and pore proteins tend to have discrete hydrophobic and hydrophilic
domains, such that the hydrophobic face of the protein may associate with the
interior of the membrane while the hydrophilic face lines the interior of the
channel, thus providing a sheltered hydrophilic environment through which the
selected hydrophilic molecule may pass. Many such pores/channels are known in
the art, including those for potassium, calcium, sodium, and chloride ions.
This pore and channel-mediated system of facilitated diffusion is limited to
very
small molecules, such as ions, because pores or channels large enough to
permit
the passage of whole proteins by facilitated diffusion would be unable to
prevent
the passage of smaller hydrophilic molecules as well. Transport of molecules
by
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
14
this process is sometimes termed 'facilitated diffusion' since the driving
force of a
concentration gradient is required for the transport to occur. Permeases also
permit facilitated diffusion of larger molecules, such as glucose or other
sugars,
into the cell when the concentration of these molecules on one side of the
membrane is greater than that on the other (also called 'uniport'). In
contrast to
pores or channels, these integral membrane proteins (often having between 6-14
membrane-spanning a-helices) do not form open channels through the membrane,
but rather bind to the target molecule at the surface of the membrane and then
undergo a conformational shift such that the target molecule is released on
the
l0 opposite side of the membrane.
However, cells frequently require the import or export of molecules against
the
existing concentration gradient ('active transport'), a situation in which
facilitated
diffusion cannot occur. There are two general mechanisms used by cells for
such
membrane transport: symport or antiport, and energy-coupled transport such as
that mediated by the ABC transporters. Symport and antiport systems couple the
movement of two different molecules across the membrane (via permeases having
two separate binding sites for the two different molecules); in symport, both
molecules are transported in the same direction, while in antiport, one
molecule is
imported while the other is exported. This is possible energetically because
one
of the two molecules moves in accordance with a concentration gradient, and
this
energetically favorable event is permitted only upon concomitant movement of a
desired compound against the prevailing concentration gradient. Single
molecules
may be transported across the membrane against the concentration gradient in
an
energy-driven process, such as that utilized by the ABC transporters. In this
system, the transport protein located in the membrane has an ATP-binding
cassette; upon binding of the target molecule, the ATP is converted to ADP +
Pi,
and the resulting release of energy is used to drive the movement of the
target
molecule to the opposite face of the membrane, facilitated by the transporter.
For
more detailed descriptions of all of these transport systems, see: Bamberg, E.
et
al., (1993) Charge transport of ion pumps on lipid bilayer membranes, Q. Rev.
Biophys. 26: 1-25; Findlay, J.B.C. (1991) Structure and function in membrane
transport systems, Curr. Opin. Struct. Biol. 1:804-810; Higgins, C.F. (1992)
ABC
transporters from microorganisms to man, Ann. Rev. Cell Biol. 8: 67-113;
Gennis,
R.B. (1989) Pores, Channels and Transporters, in: Biomembranes, Molecular
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
Structure and Function, Springer: Heidelberg, p. 270-322; and Nikaido, H. and
Saier, H. (1992) Transport proteins in bacteria: common themes in their
design,
Science 258: 936-942, and references contained within each of these
references.
5 The synthesis of membranes is a well-characterized process involving a
number
of components, the most important of which are lipid molecules. Lipid
synthesis
may be divided into two parts: the synthesis of fatty acids and their
attachment to
sn-glycerol-3-phosphate, and the addition or modification of a polar head
group.
Typical lipids utilized in bacterial membranes include phospholipids,
glycolipids,
10 sphingolipids, and phosphoglycerides. Fatty acids are a class of compounds
containing a long hydrocarbon chain and a terminal carboxylate group. Fatty
acids
include the following: lauric acid, palmitic acid, palmitoleic acid, stearic
acid,
oleic acid, taxoleic acid, 6,9-octadecadienoic acid, linolenic acid, gamma-
linolenic acid, pinolenic acid, alpha-linoleic acid, stearidonic acid,
arachidici acid,
15 eicosenic acid, behehic acid, erucic acid, docasadienoic acid, arachidonic
acid,
~r6-eicosatrienoic dihomo-gamma linolenic acid, eicasapentanoic acid
(timnodonic acid), ~3-eicosatrienoic acid, ~r3-eicosatetraenoic acid,
docosapentaenoic acid, docosahexaenoic acid (cervonic acid), lignoceric acid
and
further ones of this class not mentioned explicitly. Fatty acid synthesis
begins
with the conversion of acetyl CoA either to malonyl CoA by acetyl CoA
carboxylase, or to acetyl-ACP by acetyltransacylase. Following a condensation
reaction, these two product molecules together form acetoacetyl-ACP, which is
converted by a series of condensation, reduction and dehydration reactions to
yield a saturated fatty acid molecule having a desired chain length. The
production of unsaturated fatty acids from such molecules is catalyzed by
specific
desaturases either aerobically, with the help of molecular oxygen, or
anaerobically
(for reference on fatty acid synthesis in microorganisms, see F.C. Neidhardt
et al.
(1996) E. coli and Salmonella. ASM Press: Washington, D.C., p. 612-636 and
references contained therein; Lengeler et al. (eds) (1999) Biology of
Procaryotes.
Thieme: Stuttgart, New York, and references contained therein; and Magnuson,
K. et al., (1993) Microbiological Reviews 57: 522-542, and references
contained
therein).
Cyclopropane fatty acids (CFA) are synthesized by a specific CFA-synthase
using
SAM as a cosubstrate. Branched chain fatty acids are synthesized from branched
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
16
chain amino acids that are deaminated to yield branched chain 2-oxo-acids (see
Lengeler et al., eds. (1999) Biology of Procaryotes.
For publications on plant fatty acid biosynthesis, desaturation, lipid
metabolism
and membrane transport of lipoic compounds, beta-oxidation, fatty acid
modification and cofactors, triacylglycerol storage and assembly including
references therein see following articles: Kinney, 1997, Genetic Engeneering,
ed.:
JK Setlow, 19:149-166; Ohkogge and Browse, 1995, Plant Cell 7:957-970;
Shanklin and Cahoon, 1998, Annu. Rev. Plant Physiol. Plant Mol. Bio1.,49:611-
641; Voelker, 1996, Genetic Engeneering, ed.: JK Setlow, 18:111-13; Gerhardt,
l0 1992, Prog. Lipid R. 31:397-417; Giihnemann-Schafer &Kindl, 1995, Biochim.
Biophys Acta 1256:181-186; Kunau et al., 1995, Prog. Lipid Res. 34:267-342;
Stymne et al 1993, in: Biochemistry and Molecular Biology of Membrane and
Stowage Lipids of Plants, Eds-. Murata and Somerville, Rockville, American
Society of Plant Physiologists, 150-158, Murphy & Ross 1998, Plant Journal.
13(1):1-16.
Furthermore fatty acid have to be transported and incorporated into the
triacylglycerol storage lipid subsequent to various modifications. Lipid
bodies can
be produced by budding from the ER surrounded by structural proteins such as
oleosins. Oleosins are amphipatic polypeptides which are specifically
associated
with the lipid storage bodies of plants (Murphy DJ (1990) Prog Lipid Res
29:299-
324). Oleosins such as clone PP013009039R in Table 1 are involved in the
stabilization of oil bodies, size determination of oil bodies and protection
of oil
bodies from coalescence during water stress. A Physcomitrella patens oleosin
cDNA sequence can be used to produce transgenic plants that overexpress the
oleosin cDNA as a single gene or in combination with other lipid biosynthesis
genes in order to increase the number of oil bodies or to stabilize oil
bodies,
respectively. Furthermore production of oil bodies can be induced or in plant
tissue that has no endogenous oil body production by over-expression of the
moss
oleosin in this particular tissue. Moss ACCases are a tool to increase or
modify
fatty acid content of plants.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
17
Plastidic acetyl-coenzyme A (CoA) carboxylase (ACCase, ) catalyzes the first
committed reaction of de novo fatty acid biosynthesis. In an ATP-dependant
reaction malony-CoA is synthesized from acetyl-CoA. Two forms of the ACCase
enzyme are present in plants: a homodimeric and a heterotetrameric ACCase.
The tetrameric ACCase is composed of one plastid-coded subunit (beta-
carboxyltransferase) and three nuclear-coded subunits: biotin carboxy-carrier
protein (BCCP), biotin carboxylase (BC), alpha-carboxyl transferase. Covalent
modifications and allosteric control mechanisms regulate the ACCase enzyme
activity. The novel alpha-carboxyl transferase from the moss Physcomitrella
patens has a chloroplast transit peptide at the N-terminus (position 1 - 47)
and can
be used for plastidial targeting. Furthermore ACCase needs biotinylation for
enzymatic activity. Therefor enzymes involved in biotinylation and biotin
synthesis such as biotin carboxylase are important for the formation of active
ACCase.
Northern blot analysis of alpha-carboxyl transferase reveals that the subunit
mRNA accumulates in chloroplast rich tissue. This tissue synthesizes actively
fatty acids, which are used for membrane biogenesis and oil (triacylglycerol)
production. Overexpression of the alpha-carboxylase in oil storing plants
under
the control of an embryo-specific promotor can lead to a higher protein
expression
2o and therefore to a higher enzyme activity and modification of oil
synthesis. The
increased amount of fatty acids can be measured quantitatively according to
methods known in the art.
The fatty acid profile of oilseeds to a great extent determines the agronomic
value
of lipid compounds or oils. Uniformity of oils, chain length and desaturation
degree determine oxidative stability, use as lubricants, copolymers etc.. The
fatty
acid profile of a organism such as a plant furthermore influences growth and
development characteristics such as resistance towards biotic and abiotic
stresses.
Hence, the use of genes involved in the desaturation or elongation process can
be .
used to optimize lipid compounds. Such genes as free cytochrome b5, NADH
cytochrome b5 reductase, cytochrome P450, thioredoxin delta 5-,delta 6-, delta
9-,
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
18
delta 12 desaturase (either acyl lipid or ACP desaturases) as well as acyl or
acetyl
CoA synthase, ketoacyl (CoA or ACP) synthase, ketoacyl reductase, wax
biosynthesis enzymes.
Another essential step in lipid synthesis is the transfer of fatty acids onto
the polar
head groups by, for example, glycerol-phosphate-acyltransferases (see
Frentzen,
1998, Lipid, 100(4-5):161-166). Further enzymatic steps can be modified in
order
to infuence intermediate compounds of the formation of acylglycerols.
Diacylglycerol kinase, phosphatidylinositol synthase, phosphatidylserine
synthase
and phospatidate phosphatase are such genes useful to modify intermediate
compounds. The combination of various precursor molecules and biosynthetic
enzymes results in the production of different fatty acid molecules, which has
a
profound effect on the composition of the membrane.
Also degradative pathways can be used to modify the formation, distribution
and
storage of lipid compounds. Especially lipolytic enzymes such as
lysophospholipase, triacylglycerol lipase, phospholipase D1 and D2,
lipoxygenase
and thioesterases as well as enzymes of the beta-oxidation pathway such as
peroxisomal acyl CoA synthase, acyl CoA oxidase, methylcrotonyl CoA
carboxylase and ketoacyl CoA thiolase are well suited genes to influence the
2o breakdown of lipid compounds. Also the distribution of lipid compounds can
be
influenced if such genes as acyl CoA binding protein, lipid transfer protein
or
thioesterases are introduced into lipid synthesizing organisms.
Polyunsaturated fattX acids
Vitamins, cofactors, and nutraceuticals comprise another group of molecules
which the higher animals have lost the ability to synthesize and so must
ingest or
which the higher animals cannot Buff cietly produce on their own and so must
ingest additionally, although they are readily synthesized by other organisms
such
. as bacteria. These molecules are either bioactive substances themselves, or
are
precursors of biologically active substances which may serve as electron
carriers
or intermediates in a variety of metabolic pathways. Aside from their
nutritive
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
19
value, these compounds also have significant industrial value as coloring
agents,
antioxidants, and catalysts or other processing aids. (For an overview of the
structure, activity, and industrial applications of these compounds, see, for
example, Ullman's Encyclopedia of Industrial Chemistry, Vitamins vol. A27, p.
443-613, VCH: Weinheim, 1996.). In case of polyunsaturated fatty acids see and
also references cited therein: Simopoulos 1999, Am. J. Clip. Nutr., 70 (3
Suppl):560-569, Takahata et al., Biosc. Biotechnol. Biochem, 1998, 62
(11):2079-
2085, Willich and Winther, 1995, Deutsche Medizinische Wochenschrift, 120
(7):229 ff.
The language cofactor includes nonproteinaceous compounds required for a
normal enzymatic activity to occur. Such compounds may be organic or
inorganic; the cofactor molecules of the invention are preferably organic. The
term nutraceutical includes dietary supplements having health benefits in
plants
and animals, particularly humans. Examples of such molecules are vitamins,
antioxidants, and also certain lipids (e.g., polyunsaturated fatty acids).
The biosynthesis of these molecules in organisms capable of producing them,
such as bacteria, has been largely characterized (Ullman's Encyclopedia of
Industrial Chemistry, Vitamins vol. A27, p. 443-613, VCH: Weinheim, 1996;
Michal, G. (1999) Biochemical Pathways: An Atlas of Biochemistry and
Molecular Biology, John Wiley & Sons; Ong, A.S., Niki, E. & Packer, L. (1995)
Nutrition, Lipids, Health, and Disease" Proceedings of the
UNESCO/Confederation of Scientific and Technological Associations in
Malaysia, and the Society for Free Radical Research Asia, held Sept. 1-3, 1994
at
Penang, Malaysia, AOCS Press: Champaign, IL X, 374 S).
Another aspect of the invention pertains to the use of a produced fme chemical
itself in the biosynthesis and production of other fme chemicals. For example,
the
produced fine chemical itself can have catalytical acitivity, such as a
desaturase,
which supports the conversion of one fine chemical, e.g. a saturated fatty
acid,
into another fme chemical, e.g. a unsaturated fatty acid.
III. Elements and Methods of the Invention
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
The present invention is based, at least in part, on the discovery of novel
molecules, referred to herein as LMRP nucleic acid and protein molecules,
which
control the production of cellular membranes in Physcomitrella patens and
5 Ceratodon purpureus and govern the movement of molecules across such
membranes. In one embodiment, the LMRP molecules participate in the
metabolism of compounds necessary for the construction of cellular membranes
microorganims and plants, or in the transport of molecules across these
membranes. In a preferred embodiment, the activity of the LMRP molecules of
10 the present invention to regulate membrane component production and
membrane
transport has an impact on the production of a desired fine chemical by this
organism. In a particularly preferred embodiment, the LMItP molecules of the
invention are modulated in activity, such that the microorganisms or plants
metabolic pathways which the LMRPs of the invention regulate are modulated in
15 yield, production, and/or efficiency of production and the transport of
compounds
through the membranes is altered in efficiency, which either directly or
indirectly
modulates the yield, production, and/or efficiency of production of a desired
fine
chemical by microorganisms and plants.
The language, LMRP or LMRP polypeptide includes proteins which participate in
20 the metabolism of compounds necessary for the construction of cellular
membranes in microorganisms and plants, or in the transport of molecules
across
these membranes. Examples of LMRPs include those encoded by the LM1ZP
genes set forth in Table 1 and Appendix A. The terms LMRP gene or LMRP
nucleic acid sequence include nucleic acid sequences encoding an LMRP, which
consist of a coding region and also corresponding untranslated 5' and 3'
sequence
regions. Examples of LMRP genes include those set forth in Table 1. The terms
production or productivity are art-recognized and include the concentration of
the
fermentation product (for example, the desired fme chemical) formed within a
given time and a given fermentation volume (e.g., kg product per hour per
liter).
The term efficiency of production includes the time required for a particular
level
of production to be achieved (for example, how long it takes for the cell to
attain a
particular rate of output of a fine chemical). The terrri yield or
product/carbon
yield is art-recognized and includes the e~ciency of the conversion of the
carbon
source into the product (i.e., fine chemical). This is generally written as,
for
example, kg product per kg carbon source. By increasing the yield or
production
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
21
of the compound, the quantity of recovered molecules, or of useful recovered
molecules of that compound in a given amount of culture over a given amount of
time is increased. The terms biosynthesis or a biosynthetic pathway are art-
recognized and include the synthesis of a compound, ' preferably an organic
compound, by a cell from intermediate compounds in what may be a multistep
and highly regulated process. The terms degradation or a degradation pathway
are art-recognized and include the breakdown of a compound, preferably an
organic compound, by a cell to degradation products (generally speaking,
smaller
or less complex molecules) in what may be a multistep and highly regulated
process. The language metabolism is art-recognized and includes the totality
of
the biochemical reactions that take place in an organism. The metabolism of a
particular compound, then, (e.g., the metabolism of a fatty acid) comprises
the
overall biosynthetic, modification, and degradation pathways in the cell
related to
this compound.
In another embodiment, the LMRP molecules of the invention are capable of
modulating the production of a desired molecule, such as a fine chemical, in a
microorganisms and plants. There are a number of mechanisms by which the
alteration of an LMRP of the invention may directly affect the yield,
production,
2o and/or efficiency of production of a fme chemical from a microorganisms or
plant
strain incorporating such an altered protein. Those LMRPs involved in the
transport of fine chemical molecules within or from the cell may be increased
in
number or activity such that greater quantities of these compounds are
transported
across mebranes, from which they are more readily recovered and
interconverted.
Similarly, those LMRPs involved in the import of nutrients necessary for the
biosynthesis of one or more fine chemicals may be increased in number or
activity
such that these precursor , cofactor, or intermediate compounds are increased
in
concentration within a desired cell. Further, fatty acids and lipids
themselves are
desirable fine chemicals; by optimizing the activity or increasing the number
of
one or more LMRPs of the invention which participate in the biosynthesis of
these
compounds, or by impairing the activity of one or more LMRPs which are
involved in the degradation of these compounds, it may be possible to increase
the
yield, production, and/or e~ciency of production of fatty acid and lipid
molecules
from microorganisms or plants.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
22
The mutagenesis of one or more LMRP genes of the invention may also result in
LMRPs having altered activities which indirectly impact the production of one
or
more desired fine chemicals from microorganisms and plants. For example,
LMRPs of the invention involved in the export of waste products may be
increased in number or activity such that the normal metabolic wastes of the
cell
(possibly increased in quantity due to the overproduction of the desired fine
chemical) are efficiently exported before they are able to damage nucleotides
and
proteins within the cell (which would decrease the viability of the cell) or
to
interfere with fine chemical biosynthetic pathways (which would decrease the
l0 yield, production, or efficiency of production of the desired fme
chemical).
Further, the relatively large intracellular quantities of the desired fme
chemical
may in itself be toxic to the cell, so by increasing the activity or number of
transporters able to export this compound from the cell, one may increase the
viability of the cell in culture, in turn leading to a greater number of cells
in the
culture producing the desired fine chemical. The LMRPs of the invention may
also be manipulated such that the relative amounts of different lipid and
fatty acid
molecules are produced. This may have a profound effect on the lipid
composition of the membrane. of the cell. Since each type of lipid has
different
physical properties, an alteration in the lipid composition of a membrane may
significantly alter membrane fluidity. Changes in membrane fluidity can impact
the transport of molecules across the membrane, as well as the integrity of
the
cell, both of which have a profound effect on the production of fine chemicals
from microorganisms and plants in large-scale fermentative culture. Plant
membranes confer specific characteristics such as tolerance towards heat,
cold,
salt, drought and tolerance towards pathogens like bateria and fimgi.
Modulating
membrane compounds therefor can have a profound effect on the plants fitness
to
survive under aforementioned stress parameters. This can happen either via
changes in signaling cascades or directly via the changed membrane composition
(for example see: Chapman, 1998, Trends in Plant Science, 3 (11):419-426) and
3o influence signalling cascades (see Wang 1999, Plant Physiology, 120:645-
651). In
mammalian systems, forms of phosphatidate phosphatase involved in glycerolipid
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
23
synthesis and signal transduction have been identified. In yeast,
phosphatidate
phosphatases have also been purified and partially characterized (Brindley DN
(1988) In: Phosphatidate Phosphohydrolase (Brindley DN,ed) Vol.l , pp. 21-77,
CRC Press, Boca Raton). The same second messenger function can be assumed
for plant systems.
The isolated nucleic acid sequences of the invention are contained within the
genome of a Physcomitrella patens strain available through the moss collection
of
the University of Hamburg. The nucleotide sequence of the isolated
Physcomitrella patens LMRP cDNAs and the predicted amino acid sequences of
the Physcomitrella patens LMRPs are shown in Appendices A and B,
respectively.
Computational analyses were performed which classified and/or identified these
nucleotide sequences as sequences which encode proteins involved in the
metabolism of cellular membrane components or proteins involved in the
transport of compounds across such membranes.
The present invention also pertains to proteins which have an amino acid
sequence which is substantially homologous to an amino acid sequence of
Appendix B. As used herein, a protein which has an amino acid sequence which
is substantially homologous to a selected amino acid sequence is least about
50%
homologous to the selected amino acid sequence, e.g., the entire selected
amino
acid sequence. A protein which has an amino acid sequence which is
substantially homologous to a selected amino acid sequence can also be least
about 50-60%, preferably at least about 60-70%, and more preferably at least
about 70-80%, 80-90%, or 90-95%; and most preferably at least about 96%, 97%,
98%, 99% or more homologous to the selected amino acid sequence.
The LMRP or a biologically active portion or fragment thereof of the invention
can participate in the metabolism of compounds necessary for the construction
of
cellular membranes in microorganisms or plants, or in the transport of
molecules
across these membranes, or have one or more of the activities set forth in
Table 1.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
24
Various aspects of the invention are described in further detail in the
following
subsections:
A. Isolated Nucleic Acid Molecules
One aspect of the invention pertains to isolated nucleic acid molecules that
encode
LMRP polypeptides or biologically active portions thereof, as well as nucleic
acid
fragments suffcient for use as hybridization probes or primers for the
identification or amplification of LMRP-encoding nucleic acid (e.g., LMRP
DNA). As used herein, the term "nucleic acid molecule" is intended to include
DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g.,
mRNA) and analogs of the DNA or RNA generated using nucleotide analogs.
This term also encompasses untranslated sequence located at both the 3' and S'
ends of the coding region of the gene: at least about 100 nucleotides of
sequence
upstream from the 5' end of the coding region and at least about 20
nucleotides of
sequence downstream from the 3'end of the coding region of the gene. The
nucleic acid molecule can be single-stranded or double-stranded, but
preferably is
double-stranded DNA. An "isolated" nucleic acid molecule is one which is
separated from other nucleic acid molecules which are present in the natural
2o source of the nucleic acid. Preferably, an "isolated" nucleic acid is free
of
sequences which naturally flank the nucleic acid (i.e., sequences located at
the 5'
and 3' ends of the nucleic acid) in the genomic DNA of the organism from which
the nucleic acid is derived. For example, in various embodiments, the isolated
LMRP nucleic acid molecule can contain less than about 5 kb, 4kb, 3kb, 2kb, 1
kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic
acid
molecule in genomic DNA of the cell from which the nucleic acid is derived
(e.g,
a Physcomitrella patens cell). Moreover, an "isolated" nucleic acid molecule,
such as a cDNA molecule, can be substantially free of other cellular material,
or
culture medium when produced by recombinant techniques, or chemical
3o precursors or other chemicals when chemically synthesized.
A nucleic acid molecule of the present invention, e.g., a nucleic acid
molecule
having a nucleotide sequence of Appendix A, or a portion thereof, can be
isolated
using standard molecular biology techniques and the sequence information
provided herein. For example, a P. patens LMRP cDNA can be isolated from a P.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
patens library using all or portion of one of the sequences of Appendix A as a
hybridization probe and standard hybridization techniques (e.g., as described
in
Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold
Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
5 Harbor, NY, 1989). Moreover, a nucleic acid molecule encompassing all or a
portion of one of the sequences of Appendix A can be isolated by the
polymerise
chain reaction using oligonucleotide primers designed based upon this sequence
(e.g., a nucleic acid molecule encompassing all or a portion of one of the
sequences of Appendix A can be isolated by the polymerise chain reaction using
10 oligonucleotide primers designed based upon this same sequence of Appendix
A).
For example, mRNA can be isolated from plant cells (e.g., by the guanidinium-
thiocyanate extraction procedure of Chirgwin et al. (1979) Biochemistry 18:
5294-
5299) and cDNA can be prepared using reverse transcriptase (e.g., Moloney MLV
reverse transcriptase, available from GibcoBRL, Bethesda, MD;. or AMV reverse
15 transcriptase, available from Seikagaku America, Inc., St. Petersburg, FL).
Synthetic oligonucleotide primers for polymerise chain reaction amplification
can
be designed based upon one of the nucleotide sequences shown in Appendix A. A
nucleic acid of the invention can be amplified using cDNA or, alternatively,
genomic DNA, as a template and appropriate oligonucleotide primers according
20 to standard PCR amplification techniques. The nucleic acid so amplified can
be
cloned into an appropriate vector and characterized by DNA sequence analysis.
Furthermore, oligonucleotides corresponding to an LMRP nucleotide sequence
can be prepared by standard synthetic techniques, e.g., using an automated DNA
synthesizer.
In a preferred embodiment, an isolated nucleic acid molecule of the invention
comprises one of the nucleotide sequences shown in Appendix A. The sequences
of Appendix A correspond to the Physcomitrella patens LMRP cDNAs of the
invention. This cDNA comprises sequences encoding LMRPs (i.e., the "coding
3o region", indicated in each sequence in Appendix A), as well as 5'
untranslated
sequences and 3' untranslated sequences. Alternatively, the nucleic acid
molecule
can comprise only the coding region of any of the sequences in Appendix A or
can contain whole genomic fragments isolated from genomic DNA.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
26
For the purposes of this application, it will be understood that each of the
sequences set forth in Appendix A has an identifying entry number. Each of
these
sequences comprises up to three parts: a 5' upstream region, a coding region,
and
a downstream region. Each of these three regions is identified by the same
entry
number designation to eliminate confusion. The recitation of one of the
sequences in Appendix A, then, refers to any of the sequences in Appendix A,
which may be distinguished by their differing entry number designations. The
coding region of each of these sequences is translated into a corresponding
amino
acid sequence, which is set forth in Appendix B. The sequences of Appendix B
l0 are identified by the same entry numbers designations as Appendix A, such
that
they can be readily correlated. For example, the amino acid sequence in
Appendix B designated 38 ck21_g07fwd is a translation of the coding region of
the, nucleotide sequence of nucleic acid molecule 38 ck21_g07fwd. Table 1
gives
the function and utility of the respective clones as 38 ck21_g07fwd is
identified
as a MGD synthase (monogalactosyldiacylglycerol synthase). Further Table 1
shows the entry no. of the longest clone. For example, entry no. PP010004041R
represents a cDNA sequence corresponding to clone 38 ck21_g07fwd. It
represents a longer clone providing more sequence information. Such longer
clones can be used to produce a functionally active protein bearing the MGD
2o polypeptide sequence or such a longer sequence can be used to influence
part of a
complex of several polypeptides MGD synthase is a part of..
In another preferred embodiment, an isolated nucleic acid molecule of the
invention comprises a nucleic acid molecule which is a complement of one of
the
nucleotide sequences shown in Appendix A, or a portion thereof. A nucleic acid
molecule which is complementary to one of the nucleotide sequences shown in
Appendix A is one which is sufficiently complementary to one of the nucleotide
sequences shown in Appendix A such that it can hybridize to one of the
nucleotide sequences shown in Appendix A, thereby forming a stable duplex.
In still another preferred embodiment, an isolated nucleic acid molecule of
the
invention comprises a nucleotide sequence which is at least about 50-60%,
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
27
preferably at least about 60-70%, more preferably at least about 70-80%, 80-
90%,
or 90-95%, and even most preferably at least about 95%, 96%, 97%, 98%, 99% or
more homologous to a nucleotide sequence shown in Appendix A, or a portion
thereof. In an additional preferred embodiment, an isolated nucleic acid
molecule
of the invention comprises a nucleotide sequence which hybridizes, e.g.,
hybridizes under stringent conditions, to one of the nucleotide sequences
shown in
Appendix A, or a portion thereof.
Moreover, the nucleic acid molecule of the invention can comprise only a
portion
of the coding region of one of the sequences in Appendix A, for example a
fragment which can be used as a probe or primer or a fragment encoding a
biologically active portion of an LMRP. The nucleotide sequences detemined
from the cloning of the LMRP genes from P. patens allows for the generation of
probes and primers designed for use in identifying and/or cloning LMRP
homologues in other cell types and organisms, as well as LMRP homologues from
other mosses or related species. The probe/primer typically comprises
substantially purified oligonucleotide. The oligonucleotide typically
comprises a
region of nucleotide sequence that hybridizes under stringent conditions to at
least
about 12, preferably about 25, more preferably about 40, 50 or 75 consecutive
nucleotides of a sense strand of one of the sequences set forth in Appendix A,
an
anti-sense sequence of one of the sequences set forth in Appendix A, or
naturally
occurring mutants thereof. Primers based on a nucleotide sequence of Appendix
A can be used in PCR reactions to clone LMRP homologues. Probes based on the
LMRP nucleotide sequences can be used to detect transcripts or genomic
sequences encoding the same or homologous proteins. In preferred embodiments,
the probe further comprises a label group attached thereto, e.g. the label
group can
be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor.
Such probes can be used as a part of a genomic marker test kit for identifying
cells
which misexpress an LMRP, such as by measuring a level of an LMRP-encoding
nucleic acid in a sample of cells, e.g., detecting LMRP mRNA levels or
determining whether a genomic LMRP gene has been mutated or deleted.
In one embodiment, the nucleic acid molecule of the invention encodes a
protein
or portion thereof which includes an amino acid sequence which is sufficiently
homologous to an amino acid sequence of Appendix B such that the protein or
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
28
portion thereof maintains the ability to participate in the metabolism of
compounds necessary for the construction of cellular membranes in
microorganisms or plants, or in the . transport of molecules across these
membranes. As used herein, the language "sufficiently homologous" refers to
proteins or portions thereof which have amino acid sequences which include a
minimum number of identical or equivalent (e.g., an amino acid residue which
has
a similar side chain as an amino acid residue in one of the sequences of
Appendix
B) amino acid residues to an amino acid sequence of Appendix B such that the
protein or portion thereof is able to participate in the metabolism of
compounds
necessary for the construction of cellular membranes in microorganisms or
plants,
or in the transport of molecules across these membranes. Protein members of
such membrane component metabolic pathways or membrane transport systems,
as described herein, may play a role in the production and secretion of one or
more fine chemicals. Examples of such activities are also described herein.
Thus,
the function of an LMRP" contributes either directly or indirectly to the
yield,
production, and/or efficiency of production of one or more fine chemicals.
Examples of LMRP activities are set forth in Table 1.
In another embodiment, the protein is at least about 50-60%, preferably at
least
about 60-70%, and more preferably at least about 70-80%, 80-90%, 90-95%, and
2o most preferably at least about 96%, 97%, 98%, 99% or more homologous to an
entire amino acid sequence of Appendix B.
Portions of proteins encoded by the LMRP nucleic acid molecules of the
invention are preferably biologically active portions of one of the LMRPs. As
used herein, the term "biologically active portion of an LMRP" is intended to
include a portion, e.g., a domain/motif, of an LMRP that participates in the
metabolism of compounds necessary for the construction of cellular membranes
in
microorganisms or plants, or in the transport of molecules across these
membranes, or has an activity as set forth in Table 1. To determine whether an
LMRP or a biologically active portion thereof can participate in the
metabolism of
compounds necessary for the construction of cellular membranes in
microorganisms or plants, or in the transport of molecules across these
membranes, an assay of enzymatic activity may be performed. Such assay
methods are well known to those skilled in the art, as detailed in Example 8
of the
Examplification.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
29
Additional nucleic acid fragments encoding biologically active portions of an
LMRP can be prepared by isolating a portion of one of the sequences in
Appendix
B, expressing the encoded portion of the LMRP or peptide (e.g., by recombinant
expression in vitro) and assessing the activity of the encoded portion of the
LMRP
or peptide.
The invention further encompasses nucleic acid molecules that differ from one
of
the nucleotide sequences shown in Appendix A (and portions thereof) due to
to degeneracy of the genetic code and thus encode the same LMRP as that
encoded
by the nucleotide sequences shown in Appendix A. In another embodiment, an
isolated nucleic acid molecule of the invention has a nucleotide sequence
encoding a protein having an amino acid sequence shown in Appendix B. In a
still further embodiment, the nucleic acid molecule of the invention encodes a
full
length Physcomitrella patens protein which is substantially homologous to an
amino acid sequence of Appendix B (encoded by an open reading frame shown in
Appendix A).
In addition to the Physcomitrella patens LMRP nucleotide sequences shown in
Appendix A, it will be appreciated by those skilled in the art that DNA
sequence
polymorphisms that lead to changes in the amino acid sequences of LMRPs may
exist within a population (e.g., the Physcomitrella patens population). Such
genetic polymorphism in the LMRP gene may exist among individuals within a
population due to natural variation. As used herein, the terms "gene" and
"recombinant gene" refer to nucleic acid molecules comprising an open reading
frame encoding an LMRP, preferably a Physcomitrella patens LMRP. Such
natural variations can typically result in 1-5% variance in the nucleotide
sequence
of the LMRP gene. Any and all such nucleotide variations and resulting amino
acid polymorphisms in LMRP that are the result of natural variation and that
do
not alter the functional activity of LMRPs are intended to be within the scope
of
the invention.
Nucleic acid molecules corresponding to natural variants and non-
Physcomitrella
patens homologues of the Physcomitrella patens LMRP cDNA of the invention
can be isolated based on their homology to Physcomitrella patens LMRP nucleic
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
acid disclosed herein using the Physcomitrella patens cDNA, or a portion
thereof,
as a hybridization probe according to standard hybridization techniques under
stringent hybridization conditions. Accordingly, in another embodiment, an
isolated nucleic acid molecule of the invention is at least 15 nucleotides in
length
5 and hybridizes under stringent conditions to the nucleic acid molecule
comprising
a nucleotide sequence of Appendix A. In other embodiments, the nucleic acid is
at least 30, 50, 100, 250 or more nucleotides in length. As used herein, the
term
"hybridizes under stringent conditions" is intended to describe conditions for
hybridization and washing under which nucleotide sequences at least 60%
10 homologous to each other typically remain hybridized to each other.
Preferably,
the conditions are such that sequences at least about 65%, more preferably at
least
about 70%, and even most preferably at least about 75% or more homologous to
each other typically remain hybridized to each other. Such stringent
conditions
are known to those skilled in the art and can be found in Current Protocols in
15 Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A
preferred,
non-limiting example of stringent hybridization conditions are hybridization
in 6X
sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or
more
washes in 0.2 X SSC, 0.1% SDS at 50-65°C. Preferably, an isolated
nucleic acid
molecule of the invention that hybridizes under stringent conditions to a
sequence
20 of Appendix A corresponds to a naturally-occurring nucleic acid molecule.
As
used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or
DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes
a
natural protein). In one embodiment, the nucleic acid encodes a natural
Physcomitrella patens LMRP.
In addition to naturally-occurring variants of the LMRP sequence that may
exist
in the population, the skilled artisan will further appreciate that changes
can be
introduced by mutation into a nucleotide sequence of Appendix A, thereby
leading to changes in the amino acid sequence of the encoded LMRP, without
altering the functional ability of the LMRP. For example, nucleotide
substitutions
leading to amino acid substitutions at "non-essential" amino acid residues can
be
made in a sequence of Appendix A. A "non-essential" amino acid residue is a
residue that can be altered from the wild-type sequence of one of the LMRPs .
(Appendix B) without altering the activity of said LMRP, whereas an
"essential"
amino acid residue is required for LMRP activity. Other amino acid residues,
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
31
however, (e.g., those that are not conserved or only semi-conserved in the
domain
having LMRP activity) may not be essential for activity and thus are likely to
be
amenable to alteration without altering LMRP activity.
Accordingly, another aspect of the invention pertains to nucleic acid
molecules
encoding LMRPs that contain changes in amino acid residues that are not
essential for LMRP activity: Such LMRPs differ in amino acid sequence from a
sequence contained in Appendix B yet retain at least one of the LMRP
activities
described herein. In one embodiment, the isolated nucleic acid molecule
comprises a nucleotide sequence encoding a protein, wherein the protein
comprises an amino acid sequence at least about 50% homologous to an amino .
acid sequence of Appendix B and is capable of participation in the metabolism
of
compounds necessary for the construction of cellular membranes in P. patens,
or
in the transport of molecules across these membranes, or has one or more
activities set forth in Table 1. Preferably, the protein encoded by the
nucleic acid
molecule is at least about 50-60% homologous to one of the sequences in
Appendix B, more preferably at least about 60-70% homologous to one of the
sequences in Appendix B, even more preferably at least about 70-80%, 80-90%,
90-95% homologous to one of the sequences in Appendix B, and most preferably
at least about 96%, 97%, 98%, or 99% homologous to one of the sequences in
Appendix B.
To determine the percent homology of two amino acid sequences (e.g., one of
the
sequences of Appendix B and a mutant form thereof) or of two nucleic acids,
the
sequences are aligned for optimal comparison purposes (e.g., gaps can be
introduced in the sequence of one protein or nucleic acid for optimal
alignment
with the other protein or nucleic acid). The amino acid residues or
nucleotides at
corresponding amino acid positions or nucleotide positions are then compared.
When a position in one sequence (e.g., one of the sequences of Appendix B) is
occupied by the same amino acid residue or nucleotide as the corresponding
position in the other sequence (e.g., a mutant form of the sequence selected
from
Appendix B), then the molecules are homologous at that position (i.e., as used
herein amino acid or nucleic acid "homology" is equivalent to amino acid or
nucleic acid "identity"). The percent homology between the two sequences is a
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
32
function of the number of identical positions shared by the sequences (i.e.,
homology = numbers of identical positions/total numbers of positions x 100).
An isolated nucleic acid molecule encoding an LMRP homologous to a protein
sequence of Appendix B can be created by introducing one or more nucleotide
substitutions, additions or deletions into a nucleotide sequence of Appendix A
such that one or more amino acid substitutions, additions or deletions are
introduced into the encoded protein. Mutations can be introduced into one of
the
sequences of Appendix A by standard techniques, such as site-directed
l0 mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino
acid substitutions are made at one or more predicted non-essential amino acid
residues. A "conservative amino acid substitution" is one in which the amino
acid
residue is replaced with an amino acid residue having a similar side chain.
Families of amino acid residues having similar side chains have been defined
in
the art. These families include amino acids with basic side chains (e.g.,
lysine,
arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid),
uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine,
threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine,
leucine,
isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched
side
chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g.,
tyrosine,
phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino
acid
residue in an LMRP is preferably replaced with another amino acid residue from
the same side chain family. Alternatively, in another embodiment, mutations
can
be introduced randomly along all or part of an LMRP coding sequence, such as
by
z5 saturation mutagenesis, and the resultant mutants can be screened for an
LMRP
activity described herein to identify mutants that retain LMRP activity.
Following
mutagenesis of one of the sequences of Appendix A, the encoded protein can be
expressed recombinantly and the activity of the protein can be determined
using,
for example, assays described herein (see Example 8 of the Examplification).
In addition to the nucleic acid molecules encoding LMRPs described above,
another aspect of the invention pertains to isolated nucleic acid molecules
which
are ~antisense thereto. An "antisense" nucleic acid comprises a nucleotide
sequence which is complementary to a "sense" nucleic acid encoding a protein,
e.g., complementary to the coding strand of a double-stranded cDNA molecule or
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
33
complementary to an mRNA sequence. Accordingly, an antisense nucleic acid
can hydrogen bond to a sense nucleic acid. The antisense nucleic acid can be
complementary to an entire LMRP coding strand, or to only a portion thereof.
In
one embodiment, an antisense nucleic acid molecule is antisense to a "coding
region" of the coding strand of a nucleotide sequence encoding an LMRP. The
term "coding region" refers to the region of the nucleotide sequence
comprising
codons which are translated into amino acid residues (e.g., the entire coding
region of "", comprises nucleotides 1 to ....). In another embodiment, the
antisense nucleic acid molecule is antisense to a "noncoding region" of the
coding
l0 strand of a nucleotide sequence encoding LMRP. The term "noncoding region"
refers to 5' and 3' sequences which flank the coding region that are not
translated
into amino acids (i.e., also referred to as 5' and 3' untranslated regions).
Given the coding strand sequences encoding LMRP disclosed herein (e.g., the
sequences set forth in Appendix A), antisense nucleic acids of the invention
can
be designed according to the rules of Watson and Crick base pairing. The
antisense nucleic acid molecule can be complementary to the entire coding
region
of LMRP mRNA, but more preferably is an oligonucleotide which is antisense to
only a portion of the coding or noncoding region of LMRP mRNA. For example,
2o the antisense oligonucleotide can be complementary to the region
surrounding the
translation start site of LMRP mRNA. An antisense oligonucleotide can be, for
example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or SO nucleotides in length.
An
antisense nucleic acid of the invention can be constructed using chemical
synthesis and enzymatic ligation reactions using procedures known in the art.
For
example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be
chemically synthesized using naturally occurring nucleotides or variously
modified nucleotides designed to increase the biological stability of the
molecules
or to increase the physical stability of the duplex formed between the
antisense
and sense nucleic acids, e.g., phosphorothioate derivatives and acridine
3o substituted nucleotides can be used. Examples of modified nucleotides which
can
be used to generate the antisense nucleic acid include 5-fluorouracil, S-
bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-
acetylcytosine, 5-(carboxyhydroxylinethyl) uracil, 5-carboxymethylaminomethyl-
2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-
galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
34
methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-
methylcytosine, S-methylcytosine, N6-adenine, 7-methylguanine, 5-
methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-
mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-
methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine,
pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-
thiouracil, 5-methyluracil, uracil-S- oxyacetic acid methylester, uracil-5-
oxyacetic
acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil,
(acp3)w,
and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be
produced
biologically using an expression vector into which a nucleic acid has been
subcloned in an antisense orientation (i.e., RNA transcribed from the inserted
nucleic acid will be of an antisense orientation to a target nucleic acid of
interest,
described further in the following subsection).
The antisense nucleic acid molecules of the invention are typically
administered
to a cell or generated in situ such that they hybridize with or bind to
cellular
mRNA and/or genomic DNA encoding an LMRP to thereby inhibit expression of
the protein, e.g., by inhibiting transcription and/or translation. The
hybridization
can be by conventional nucleotide complementarity to form a stable duplex, or,
2o for example, in the case of an antisense nucleic acid molecule which binds
to
DNA duplexes, through specific interactions in the major groove of the double
helix. The antisense molecule can be modified such that it specifically binds
to a
receptor or an antigen expressed on a selected cell surface, e.g., by linking
the
antisense nucleic acid molecule to a peptide or an antibody which binds to a
cell
surface receptor or antigen. The antisense nucleic acid molecule can also be
delivered to cells using the vectors described herein. To achieve sufFcient
intracellular concentrations of the antisense molecules, vector constructs in
which
the antisense nucleic acid molecule is placed under the control of a strong
prokaryotic, viral, or eukaryotic including plant promoters ase preferred.
In yet another embodiment, the antisense nucleic acid molecule of the
invention is
an a-anomeric 'nucleic acid molecule. An a-anomeric nucleic acid molecule
forms specific double-stranded hybrids with complementary RNA in which,
contrary to the usual [3-units, the strands run parallel to each other
(Gaultier et al.
(1987) Nucleic Acids. Res. 15:6625-6641). The antisense nucleic acid molecule
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
can also comprise a 2'-o-methylribonucleotide (moue et al. (1987) Nucleic
Acids
Res. 15:6131-6148) or a chimeric RNA-DNA analogue (moue et al. (1987) FEBS
Lett. 215:327-330).
5 In still another embodiment, an antisense nucleic acid of the invention is a
ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity
which are capable of cleaving a single-stranded nucleic acid, such as an mRNA,
to which they have a complementary region. Thus, ribozymes (e.g., hammerhead
ribozymes (described in HaselhofF and Gerlach (1988) Nature 334:585-591)) can
l0 be used to catalytically cleave LMRP mRNA transcripts to thereby inhibit
translation of LMRP mRNA. A ribozyme having specificity for an LMRP-
encoding nucleic acid can be designed based upon the nucleotide sequence of an
LMRP cDNA disclosed herein (i.e., 38 ck21_g07fwd in Appendix A) or on the
basis of a heterologous sequence to be isolated according to methods taught in
this
15 invention. For example, a derivative of a Tetrahymena L-19 IVS RNA can be
constructed in which the nucleotide sequence of the active site is
complementary
to the nucleotide sequence to be cleaved in an LMRP-encoding mRNA. See, e.g.,
Cech et al. U.S. Patent No. 4,987,071 and Cech et al. U.S. Patent No.
5,116,742.
Alternatively, LMRP mRNA can be used to select a catalytic RNA having a
20 specific ribonuclease activity from a pool of RNA molecules. See, e.g.,
Bartel, D.
and Szostak, J.W. (1993) Science 261:1411-1418.
Alternatively, LMRP gene expression can be inhibited by targeting nucleotide
sequences complementary to the regulatory region of an LMRP nucleotide
25 sequence (e.g., an LMRP promoter and/or enhancers) to form triple helical
structures that prevent transcription of an LMRP gene in target cells. See
generally, Helene, C. (1991) Anticancer Drug Des. 6(6):569-84; Helene, C. et
al.
(1992) Ann. N. Y. Acad. Sci. 660:27-36; and Maher, L.J. (1992) Bioassays
14(12):807-15.
B. Recombinant Expression Vectors and Host Cells
Another aspect of the invention pertains to vectors, preferably expression
vectors,
containing a nucleic acid encoding an LMRP (or a portion thereof). As used
herein, the term "vector" refers to a nucleic acid molecule capable of
transporting
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
36
another nucleic acid to which it has been linked. One type of vector is a
"plasmid", which refers to a circular double stranded DNA loop into which
additional DNA segments can be ligated. Another type of vector is a viral
vector,
wherein additional DNA segments can be ligated into the viral genome. Certain
vectors are capable of autonomous replication in a host cell into which they
are
introduced (e.g., bacterial vectors having a bacterial origin of replication
and
episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian
vectors) are integrated into the genome of a host cell upon introduction into
the
host cell, and thereby are replicated along with the host genome. Moreover,
certain vectors are capable of directing the expression of genes to which they
are
operatively linked. Such vectors are referred to herein as "expression
vectors". In
general, expression vectors of utility in recombinant DNA techniques are often
in
the form of plasmids. In the present specification, "plasmid" and "vector" can
be
used interchangeably as the plasmid is the most commonly used form of vector.
However, the invention is intended to include such other forms of expression
vectors, such as viral vectors (e.g., replication defective retroviruses,
adenoviruses
and adeno-associated viruses), which serve equivalent functions.
The recombinant expression vectors of the invention comprise a nucleic acid of
the invention in a form suitable for expression of the nucleic acid in a host
cell,
which means that the recombinant expression vectors include one or more
regulatory sequences, selected on the basis of the host cells to be used for
expression, which is operatively linked to the nucleic acid sequence to be
expressed. Within a recombinant expression vector, "operably linked" is
intended
to mean that the nucleotide sequence of interest is linked to the regulatory
sequences) in a manner which allows for expression of the nucleotide sequence
are fused to each other so that both sequences fulfil the proposed function
addicted to the sequence used. (e.g., in an in vitro transcription/
translation system
or in a host cell when the vector is introduced into the host cell). The term
"regulatory sequence" is intended to include promoters, enhancers and other
expression control elements (e.g., polyadenylation signals). Such regulatory
sequences are described, for example, in Goeddel; Gene Expression Technology:
Methods in Enzymology 185, Academic Press, San Diego, CA (1990) or see:
Gruber and Crosby, in: Methods in Plant Molecular Biology and Biotechnolgy,
CRC Press,Boca Raton, Florida, eds.:Glick and Thompson, Chapter 7, 89-108
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
37
including the references therein. Regulatory sequences include those which
direct
constitutive expression of a nucleotide sequence in many types of host cell
and
those which direct expression of the nucleotide sequence only in certain host
cells
or under certain conditions. It will be appreciated by those skilled in the
art that
the design of the expression vector can depend on such factors as the choice
of the
host cell to be transformed, the level of expression of protein desired, etc.
The
expression vectors of the invention can be introduced into host cells to
thereby
produce proteins or peptides, including fusion proteins or peptides, encoded
by
nucleic acids as described herein (e.g., LMRPs, mutant forms of LMRPs, fusion
proteins, etc.).
The recombinant expression vectors of the invention can be designed for
expression of LMRPs in prokaryotic or eukaryotic cells. For example, LMRP
genes can be expressed in bacterial cells such as C. glutamicum, insect cells
(using baculovirus expression vectors), yeast and other fungal cells (see
Romanos,
M.A. et al. (1992) Foreign gene expression in yeast: a review, Yeast 8: 423-
488;
van den Hondel, C.A.M.J.J. et al. (1991) Heterologous gene expression in
filamentous fungi, in: More Gene Manipulations in Fungi, J.W. Bennet & L.L.
Lasure, eds., p. 396-428: Academic Press: San Diego; and van den Hondel,
C.A.M.J.J. & Punt, P.J. (1991) Gene transfer systems and vector development
for
filamentous fungi, in: Applied Molecular Genetics of Fungi, Peberdy, J.F. et
al.,
eds., p. 1-28, Cambridge University Press: Cambridge), algae (Falciatore et
al.,
1999, Marine Biotechnology.l, 3:239-251), ciliates of the types: Holotrichia,
Peritrichia, Spirotrichia, Suctoria, Tetrahymena, Paramecium, Colpidium,
Glaucoma, Platyophrya, Potomacus, Pseudocohnilembus, Euplotes,
Engelmaniella, and Stylonychia, especially of the genus Stylonychia lemnae
with
vectors following a transformation method as described in W09801572 and
multicellular plant cells (see Schmidt, R. and Willmitzer, L. (1988), High
efficiency Agrobacterium tumefaciens-mediated transformation of Arabidopsis
3o thaliana leaf and cotyledon explants, Plant Cell Rep.: 583-586); Plant
Molecular
Biology and Biotechnology, C Press, Boca Raton, Florida, chapter 6/7, 5.71-119
(1993); F.F. White, B. Jenes et al., Techniques for Gene Transfer, in:
Transgenic
Plants, Vol. 1, Engineering and Utilization, eds.:Kung and R. Wu, Academic
Press (1993), 128-43; Potrykus, Annu. Rev. Plant Physiol. Plant Molec. Biol.
42
(1991), 205-225 (and references cited therein) or mammalian cells. Suitable
host
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
38
cells are discussed further in Goeddel, Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, CA (1990). Alternatively, the
recombinant expression vector can be transcribed and translated in vitro, for
example using T7 promoter regulatory sequences and T7 polymerase.
Expression of proteins in prokaryotes is most often carried out with vectors
containing constitutive or inducible promoters directing the expression of
either
fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a
protein encoded therein, usually to the amino terminus of the recombinant
protein
l0 but also to the C-terminus or fused within suitable regions in the
proteins. Such
fusion vectors typically serve three purposes: 1) to increase expression of
recombinant protein; 2) to increase the solubility of the recombinant protein;
and
3) to aid in the purification of the recombinant protein by acting as a ligand
in
affinity purification. Often, in fusion expression vectors, a proteolytic
cleavage
site is introduced at the junction of the fusion moiety and the recombinant
protein
to enable separation of the recombinant protein from the fusion moiety
subsequent
to purification of the fusion protein. Such enzymes, and their cognate
recognition
sequences, include Factor Xa, thrombin and enterokinase.
Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith,
D.B. and Johnson, K.S. (1988) Gene 67:31-40), pMAL (New England Biolabs,
Beverly, MA) and pRITS (Pharmacia, Piscataway, NJ) which fuse glutathione S
transferase (GST), maltose E binding protein, or protein A, respectively, to
the
target recombinant protein. In one embodiment, the coding sequence of the
LMRP is cloned into a pGEX expression vector to create a vector encoding a
fusion protein comprising, from the N-terminus to the C-terminus, GST-thrombin
cleavage site-X protein. The fusion protein can be purified by affinity
chromatography using glutathione-agarose resin. Recombinant LMRP unfused to
GST can be recovered by cleavage of the fusion protein with thrombin.
Examples of suitable inducible non-fusion E. coli expression vectors include
pTrc
(Amann et al., (1988) Gene 69:301-315) and pET lld (Studier et al., Gene
Expression Technology: Methods in Enzymology 185, Academic Press, San
Diego, California (1990) 60-89). Target gene expression from the pTrc vector
relies on host RNA polymerase transcription from a hybrid trp-lac fusion
promoter. Target gene expression from the pET l 1d vector relies on
transcription
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
39
from a T7 gnl0-lac fusion promoter mediated by a coexpressed viral RNA
polymerase (T7 gnl). This viral polymerase is supplied by host strains
BL21 (DE3) or HMS 174(DE3) from a resident ~, prophage harboring a T7 gnl
gene under the transcriptional control of the lacUV 5 promoter.
One strategy to maximize recombinant protein expression is to express the
protein
in a host bacteria with an impaired capacity to proteolytically cleave the
recombinant protein (Gottesman, S., Gene Expression Technology: Methods in
Enzymology 185, Academic Press, San Diego, California (1990) 119-128).
Another strategy is to alter the nucleic acid sequence of the nucleic acid to
be
inserted into an. expression vector so that the individual codons for each
amino
acid are those preferentially utilized in the bacterium chosen for expression,
such
as C. glutamicum (Wada et al. (1992) Nucleic Acids Res. 20:2111-2118). Such
alteration of nucleic acid sequences of the invention can be carried out by
standard DNA synthesis techniques.
In another embodiment, the LMRP expression vector is a yeast expression
vector.
Examples of vectors for expression in yeast S. cerivisae include pYepSecl
(Baldari, et al., (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz,
(1982) Cell 30:933-943), pJRY88 (Schultz et al., (1987) Gene 54:113-123), and
pYES2 (Invitrogen Corporation, San Diego, CA). Vectors and methods for the
construction of vectors appropriate for use in other fungi, such as the
filamentous
fungi, include those detailed in: van den Hondel, C.A.M.J.J. & Punt, P.J.
(1991)
"Gene transfer systems and vector development for filamentous fungi, in:
Applied
Molecular Genetics of Fungi, J.F. Peberdy, et al., eds., p. 1-28, Cambridge
University Press: Cambridge.
Alternatively, the LMRPs of the invention can be expressed in insect cells
using
baculovirus expression vectors. Baculovirus vectors available for expression
of
proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series
(Smith et
al. (1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow and
Summers (1989) Virology 170:31-39).
In yet another embodiment, a nucleic acid of the invention is expressed in
mammalian cells using a mammalian expression vector. Examples of mammalian
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
expression vectors include pCDM8 (Seed, B. (1987) Nature 329:840) and
pMT2PC (Kaufman et al. (1987) EMBO J. 6:187-195). When used in mammalian
cells, the expression vector's control functions are often provided by viral
regulatory elements. For example, commonly used promoters are derived from
5 polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other
suitable
expression systems for both prokaryotic and eukaryotic cells see chapters 16
and
17 of Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A
Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.
1o
In another embodiment, the recombinant mammalian expression vector is capable
~ of directing expression of the nucleic acid preferentially in a particular
cell type
(e.g., tissue-specific regulatory elements are used to express the nucleic
acid).
Tissue-specific regulatory elements are known in the art. Non-limiting
examples
15 of suitable tissue-specific promoters include the albumin promoter (liver-
specific;
Pinkert et al. (1987) Genes Dev. 1:268-277), lymphoid-specific promoters
(Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of
T cell receptors (Winoto and Baltimore (1989) EMBO .I. 8:729-733) and
immunoglobulins (Banerji et al. (1983) Cell 33:729-740; Queen and Baltimore
2o (1983) Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament
promoter; Byrne and Ruddle (1989) PNAS 86:5473-5477), pancreas-specific
promoters (Edlund et al. (1985) Science 230:912-916), and mammary gland-
specific promoters (e.g., milk whey promoter; U.S. Patent No. 4,873,316 and
European Application Publication No. 264,166). Developmentally-regulated
25 promoters are also encompassed, for example the marine hox promoters
(Kessel
and Grass (1990) Science 249:374-379) and the fetoprotein promoter (Campes
and Tilghman (1989) Genes Dev. 3:537-546).
In another embodiment, the LMRPs of the invention may be expressed in
30 unicellular plant cells (such as algae) see Falciatore et al., 1999, Marine
Biotechnology.l (3):239-251 and references therein and plant cells from higher
plants (e.g., the spermatophytes, such as crop plants). Examples of plant
expression vectors include those detailed in: Becker, D., Kemper, E., Schell,
J.
and Masterson, R. (1992) "New plant binary vectors with selectable markers
35 located proximal to the left border", Plant Mol. Biol. 20: 1195-1197; and
Bevan,
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
41
M.W. (1984) "Binary Agrobacterium vectors for plant transformation, Nucl.
Acid.
Res. 12: 8711-8721; Vectors for Gene Transfer in Higher Plants; in: Transgenic
Plants, Vol. 1, Engineering and Utilization, eds.: Kung and R. Wu, Academic
Press, 1993, S. 15-38.
A plant expression cassette preferably contains regulatory sequences capable
to
drive gene expression in plants cells and which are operably linked so that
each
sequence can fulfil its function such as termination of transcription such as
polyadenylation signals. Preferred polyadenylation signals are those
originating
from Agrobacterium tumefaciens t-DNA such as the gene 3 known as octopine
synthase of the Ti-plasmid pTiACHS (Gielen et al., EMBO J. 3 (1984), 835 ff)
or
functional equivalents therof but also all other terminators functionally
active in
plants are suitable.
As plant gene expression is very often not limited on transcriptional levels a
plant
expression cassette preferably contains other operably linked sequences like
translational enhancers such as the overdrive-sequence containing the 5'
untranlated leader sequence from tobacco mosaic virus enhancing the protein
per
RNA ratio (Gallie et al 1987, Nucl. Acids Research 15:8693-8711).
Plant gene expression has to be operably linked to an appropriate promoter
conferring gene 'expression in a timely , cell or tissue specific manner.
Preferrred
are promoters driving constitutitive expression (Benfey et al., EMBO J. 8
(1989)
2195-2202) like those derived from plant viruses like the 35S CAMV (Franck et
al., Cell 21(1980) 285-294), the 19S CaMV (see also US5352605 and
W08402913) or plant promoters like those from Rubisco small subunit described
in US4962028.
Other preferred sequences for use operable linkage in plant gene expression
cassettes are targeting-sequences necessary to direct the gene-product in its
appropriate cell compartment (for review see Kermode, Crit. Rev. Plant Sci.
15, 4
(1996), 285-423 and references cited therin) such as the vacuole, the nucleus,
all
types of plastids like amyloplasts, chloroplasts, chromoplasts, the
extracellular
space, mitochondria, the endoplasmic reticulum, oil bodies, peroxisomes and
other compartments of plant cells.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
42
Plant gene expression can also be facilitated via a chemically inducible
promoter
(for rewiew see Gatz 1997, Annu. Rev. Plant Physiol. Plant Mol. Biol., 48:89-
108). Chemically inducible promoters are especially suitable if gene
expression is
wanted to occur in a time specific manner. Examples for such promoters are a
salicylic acid inducible promoter (WO 95/19443), a tetracycline inducible
promoter (Gatz et al., (1992) Plant J. 2, 397-404) and an ethanol inducible
promoter (WO 93/21334).
Also promoters responding to biotic or abiotic stress conditions are suitable
promoters such as the pathogen inducible PRP1-gene promoter (Ward et al.,
Plant.
Mol. Biol. 22 (1993), 361-366), the heat inducible hsp80-promoter from tomato
(US5187267), cold inducible alpha-amylase promoter from potato (W09612814)
or the wound-inducible pinII-promoter (EP375091).
Especially those promoters are preferred which confer gene expression in
tissues
and organs where lipid and oil biosynthesis occurs in seed cells such as cells
of
the endosperm and the developing embryo. Suitable promoters are the napin-gene
promoter from rapeseed (US5608152), the USP-promoter from Vicia faba
(Baeumlein et al., Mol Gen Genet, 1991, 225 (3):459-67), the oleosin-promoter
from Arabidopsis (W09845461), the phaseolin-promoter from Phaseolus vulgaris
(US5504200), the Bce4-promoter from Brassica (W09113980) or the legumin B4
promoter (LeB4; Baeumlein et al., 1992, Plant Journal, 2 (2):233-9) as well as
promoters conferring seed specific expression in monocot plants like maize,
barley, wheat, rye, rice etc. Suitable promoters to note are the lpt2 or lptl-
gene
promoter from barley (W09515389 and W09523230) or those desribed in
W09916890 (promoters from the barley hordein-gene, the rice glutelin gene, the
rice oryzin gene, the rice prolamin gene, the wheat gliadin gene, wheat
glutelin
gene, the maize zero gene, the oat glutelin gene, the Sorghum kasirin-gene,
the rye
secalin gene).
Also especially suited are promoters that confer plastid-specific gene
expression
as plastids are the compartment where precursors and some end products of
lipid
biosynthesis are synthesized. Suitable promoters such as the viral RNA
polymerase promoter are described in W09516783 and W09706250 and the
clpP-promoter from Arabidopsis described in W09946394.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
43
The invention further provides a recombinant expression vector
comprising a DNA molecule of the invention cloned into the expression vector
in
an antisense orientation. That is, the DNA molecule is operatively linked to a
regulatory sequence in a manner which allows for expression (by transcription
of
the DNA molecule) of an RNA molecule which is antisense to LMRP mRNA.
Regulatory sequences operatively linked to a nucleic acid cloned in the
antisense
orientation can be chosen which direct the continuous expression of the
antisense
RNA molecule in a variety of cell types, for instance viral promoters and/or
to enhancers, or regulatory sequences can be chosen which direct constitutive,
tissue
specific or cell type specific expression of antisense RNA. The antisense
expression vector can be in the form of a recombinant plasmid, phagemid or
attenuated virus in which antisense nucleic acids are produced under the
control of
a high efficiency regulatory region, the activity of which can be determined
by the
cell type into which the vector is introduced. For a discussion of the
regulation of
gene expression using antisense genes see Weintraub, H. et al., Antisense RNA
as
a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1)
1986 and Mol et al., 1990, FEBS Letters 268:427-430.
Another aspect of the invention pertains to host cells into which a
recombinant
expression vector of the invention has been introduced. The terms "host cell"
and
"recombinant host cell" are used interchangeably herein. It is understood that
such terms refer not only to the particular subject cell but to the progeny or
potential progeny of such a cell. Because certain modifications may occur in
succeeding generations due to either mutation or environmental influences,
such
progeny may not, in fact, be identical to the parent cell, but are still
included
within the scope of the term as used herein. Further included in the scope of
this
invention are descendants, seeds or reproducable cell material derived from a
transformed or recombinant host cell. They can be used to create new cellines
or
3o plants with improved production of fme chemincal by art-known breeding-
techniques.
A host cell can be any prokaryotic or eukaryotic cell. For example, an LMRP
can
be expressed in bacterial cells such as C. glutamicum, insect cells, fungal
cells or
mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells),
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
44
mosses, algae, ciliates, plant cells, fungi or other microorganims like C.
glutamicum. Other suitable host cells are known to those skilled in the art.
Vector DNA can be introduced into prokaryotic or eukaryotic cells via
conventional transformation or transfection techniques. As used herein, the
terms
"transformation" and "transfection", conjugation and transduction are intended
to
refer to a variety of art-recognized techniques for introducing foreign
nucleic acid
(e.g., DNA) into a host cell, including calcium phosphate or calcium chloride
co-
precipitation, DEAF-dextran-mediated transfection, lipofection, natural
competence, chemical-mediated transfer, or electroporation. Suitable methods
for
transforming or transfecting host cells including plant cells can be found in
Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold
Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY, 1989) and other laboratory manuals such as Methods in Molecular
Biology, 1995, Vol. 44, Agrobacterium protocols, ed: Gartland and Davey,
Humana Press, Totowa, New Jersey.
For stable transfection of mammalian cells, it is known that, depending upon
the
expression vector and transfection technique used, only a small fraction of
cells
may integrate the foreign DNA into their genome. In order to identify and
select
these integrants, a gene that encodes a selectable marker (e.g., resistance to
antibiotics) is generally introduced into the host cells along with the gene
of
interest. Preferred selectable markers include those which confer resistance
to
drugs, such as 6418, hygromycin and methotrexate or in plants that confer
resistance towards a herbicide such as glyphosate or glufosinate. Nucleic acid
encoding a selectable marker can be introduced into a host cell on the same
vector
as that encoding an LMRP or can be introduced on a separate vector. Cells
stably
transfected with the introduced nucleic acid can be identified by, for
example,
drug selection (e.g., cells that have incorporated the selectable marker gene
will
survive, while the other cells die).
To create a homologous recombinant microorganism, a vector is prepared which
contains at least a portion of an LMRP gene into which a deletion, addition or
substitution has been introduced to thereby alter, e.g., functionally disrupt,
the
LMRP gene. Preferably, this LMRP gene is a Physcomitrella patens LMRP gene,
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
but it can be a homologue from a related plant or even from a mammalian,
yeast,
or insect source. In a preferred embodiment, the vector is designed such that,
upon homologous recombination, the endogenous LMRP gene is functionally
disrupted (i.e., no longer encodes a functional protein; also referred to as a
knock-
s out vector). Alternatively, the vector can be designed such that, upon
homologous
recombination, the endogenous LMRP gene is mutated or otherwise altered but
still encodes functional protein (e.g., the upstream regulatory region can be
altered
to thereby alter the expression of the endogenous LMRP). To create a point
mutation via homologous recombination also DNA-RNA hybrids can be used
10 known as chimeraplasty known from Cole-Strauss et al. 1999, Nucleic Acids
Research 27(5):1323-1330 and Kmiec Gene therapy. 19999, American Scientist.
87(3):240-247.
Whereas in the homologous recombination vector, the altered portion of the
LMRP gene is flanked at its 5' and 3' ends by additional nucleic acid of the
15 LMRP gene to allow for homologous recombination to occur between the
exogenous LMRP gene carried by the vector and an endogenous LMRP gene in a
microorganism or plant. The additional flanking LMRP nucleic acid is of
sufficient length for successful homologous recombination with the endogenous
gene. Typically, several hundreds of basepairs up to kilobases of flanking DNA
20 (both at the 5' and 3' ends) are included in the vector (see e.g., Thomas,
K.R., and
Capecchi, M.R. (1987) Cell 51: 503 for a description of homologous
recombination vectors or Strepp et al., 1998, PNAS, 95 (8):4368-4373 for cDNA
based recombination in Physcomitrella patens). The vector is introduced into a
microorganism or plant cell (e.g., via polyethyleneglycol, mediated DNA) and
25 cells in which the introduced LMRP gene has homologously recombined with
the
endogenous LMRP gene are selected, using art-known techniques.
In another embodiment, recombinant microorganisms can be produced which
contain selected systems which allow for regulated expression of the
introduced
30 gene. For example, inclusion of an LMRP gene on a vector placing it under
control of the lac operon permits expression of the LMRP gene only in the
presence of IPTG. Such regulatory systems are well known in the art.
A host cell of the invention, such as a prokaryotic or eukaryotic host cell in
35 culture, can be used to produce (i.e., express) an LMRP. An alternate
method can
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
46
be applied in addition in plants by the direct transfer of DNA into developing
flowers via electroporation or Agrobacterium medium gene transfer.
Accordingly,
the invention further provides methods for producing LMRPs using the host
cells
of the invention. In one embodiment, the method comprises culturing the host
cell of invention (into which a recombinant expression vector encoding an LMRP
has been introduced, or into which genome has been introduced a gene encoding
a
wild-type or altered LMRP) in a suitable medium until LMRP is produced. In
another embodiment, the method further comprises isolating LMRPs from the
medium or the host cell.
C. Isolated LMRPs
Another aspect of the invention pertains to isolated LMRPs, and biologically
active portions thereof. An "isolated" or "purified" protein or biologically
active
portion thereof is substantially free of cellular material when produced by
recombinant DNA techniques, or chemical precursors or other chemicals when
chemically synthesized. The language "substantially free of cellular material"
includes preparations of LMRP in which the protein is separated from cellular
components of the cells in which it is naturally or recombinantly produced. In
one embodiment, the language "substantially free of cellular material"
includes
preparations of LMRP having less than about 30% (by dry weight) of non-LMRP
(also referred to herein as a "contaminating protein"), more preferably less
than
about 20% of non-LMRP, still more preferably less than about 10% of non-
LMRP, and most preferably less than about 5% non-LMRP. When the LMRP or
biologically active portion thereof is recombinantly produced, it is also
preferably
substantially free of culture medium, i.e., culture medium represents less
than
about 20%, more preferably less than about 10%, and most preferably less than
about 5% of the volume of the protein preparation. The language "substantially
free of chemical precursors or other chemicals" includes preparations of LMRP
in
which the protein is separated from chemical precursors or other chemicals
which
are involved in the synthesis of the protein. In one embodiment, the language
"substantially free of chemical precursors or other chemicals" includes
preparations of LMRP having less than about 30% (by dry weight) of chemical
precursors or non-LMRP chemicals, more preferably less than about 20%
chemical precursors or non-LMRP chemicals, still more preferably less than
about
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
47
10% chemical precursors or non-LMRP chemicals, and most preferably less than
about 5% cheriiical precursors or non-LMRP chemicals. In preferred
embodiments, isolated proteins or biologically active portions thereof lack
contaminating proteins from the same organism from which the LMRP is derived.
Typically, such proteins are produced by recombinant expression of, for
example,
a Physcomitrella patens LMRP in other plants than Physcomitrella patens or
microorganisms such as C. glutamicum or ciliates, mosses, algae or fungi.
An isolated LMRP or a portion thereof of the invention can participate in the
metabolism of compounds necessary for the construction of cellular membranes
in
Physcomitrella patens, or in the transport of molecules across these
membranes,
or has one or more of the activities set forth in Table 1. In preferred
embodiments, the protein or portion thereof comprises an amino acid sequence
which is sufficiently homologous to an amino acid sequence of Appendix B such
that the protein or portion thereof maintains the ability participate in the
metabolism of compounds necessary for the construction of cellular membranes
in
Physcomitrella patens, or in the transport of molecules across these
membranes.
The portion of the protein is preferably a biologically active portion as
described
herein. In another preferred embodiment, an LMRP of the invention has an amino
acid sequence shown in Appendix B. In yet another preferred embodiment, the
LMRP has an amino acid sequence which is encoded by a nucleotide sequence
which hybridizes, e.g., hybridizes under stringent conditions, to a nucleotide
sequence of Appendix A. In still another preferred embodiment, the LMRP has
an amino acid sequence which is encoded by a nucleotide sequence that is at
least
about 50-60%, preferably at least about 60-70%, more preferably at least about
70-80%, 80-90%, 90-95%, and even most preferably at least about 96%, 97%,
98%, 99% or more homologous to one of the amino acid sequences of Appendix
B. The preferred LMRPs of the present invention also preferably possess at
least
one of the LMRP activities described herein. For example, a preferred LMRP of
the present invention includes an amino acid sequence encoded by a nucleotide
sequence which hybridizes, e.g., hybridizes under stringent conditions, to a
nucleotide sequence of Appendix A, and which can participate in the metabolism
of compounds necessary ' for the construction of cellular membranes in
Physcomitrella patens, or in the transport of molecules across these
membranes,
or which has one or more of the activities set forth in Table 1.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
48
In other embodiments, the LMRP is substantially homologous to an amino acid
sequence of Appendix B and retains the functional activity of the protein of
one of
the sequences of Appendix B yet differs in amino acid sequence due to natural
variation or mutagenesis, as described in detail in subsection I above.
Accordingly, in another embodiment, the LMRP is a protein which comprises an
amino acid sequence which is at least about 50-60%, preferably at least about
60-
70%, and more preferably at least about 70-80, 80-90, 90-95%, and most
preferably at least about 96%, 97%, 98%, 99% or more homologous to an entire
amino acid sequence of Appendix B and which has at least one of the LMRP
activities described herein. In another embodiment, the invention pertains to
a full
Physcomitrella patens protein which is substantially homologous to an entire
amino acid sequence of Appendix B.
Biologically active portions of an LMRP include peptides comprising amino acid
sequences derived from the amino acid sequence of an LMRP, e.g., the an amino
acid sequence shown in Appendix B or the amino acid sequence of a protein
homologous to an LMRP, which include fewer amino acids than a full length
LMRP or the full length protein which is homologous to an LMRP, and exhibit at
least one activity of an LMRP. Typically, biologically active portions
(peptides,
e.g., peptides which are, for example, 5, 10, 15, 20, 30, 35, 36, 37, 38, 39,
40, 50,
100 or more amino acids in length) comprise a domain or motif with at least
one
activity of an LMRP. Moreover, other biologically active portions, in which
other
regions of the protein are deleted, can be prepared by recombinant techniques
and
evaluated for one or more of the activities described herein. Preferably, the
biologically active portions of an LMRP include one or more selected
domains/motifs or portions thereof having biological activity.
LMRPs are preferably produced by recombinant DNA techniques. For example,
a nucleic acid molecule encoding the protein is cloned into an expression
vector
(as described above), the expression vector is introduced into a host cell (as
described above) and the LMRP is expressed in the host cell. The LMRP can then
be isolated from the cells by an appropriate purification scheme using
standard
protein purification techniques. Alternative to recombinant expression, an
LMRP,
polypeptide, or peptide can be synthesized chemically using standard peptide
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
49
synthesis techniques. Moreover, native LMRP can be isolated from cells (e.g.,
endothelial cells), for example using an anti-LMRP antibody, which can be
produced by standard techniques utilizing an LMRP or fragment thereof of this
invention. In another embodiment, a test kit comprising the aforementioned
specific anti-LMRP-antibody can be used to identify and/or purify further LMRP
molecules or fragments thereof in other cell types or organisms.
The invention also provides LMRP chimeric or fusion proteins. As used herein,
an LMRP "chimeric protein" or "fusion protein" comprises an LMRP polypeptide
operatively linked to a non-LMRP polypeptide. An "LMRP polypeptide" refers to
a polypeptide having an amino acid sequence corresponding to an LMRP,
whereas a "non-LMRP polypeptide" refers to a polypeptide having an amino acid
sequence corresponding to a protein which is not substantially homologous to
the
LMRP, e.g., a protein which is different from the LMRP and which is derived
from the same or a different organism: Within the fusion protein, the term
"operatively linked" is intended to indicate that the LMRP polypeptide and the
non-LMRP polypeptide are fused to each other so that both sequences fulfil the
proposed function addicted to the sequence used. The non-LMRP polypeptide
can be fused to the N-terminus or C-terminus of the LMRP polypeptide. For
example, in one embodiment the fusion protein is a GST-LMRP fusion protein in
which the LMRP sequences are fused to the C-terminus of the GST sequences.
Such fusion proteins can facilitate the purification of recombinant LMRPs. In
another embodiment, the fusion protein is an LMRP containing a heterologous
signal sequence at its N-terminus. In certain host cells (e.g., mammalian host
cells), expression and/or secretion of an LMRP can be increased through use of
a
heterologous signal sequence.
Preferably, an LMRP chimeric or fusion protein of the invention is produced by
standard recombinant DNA techniques. For example, DNA fragments coding for
the different polypeptide sequences are ligated together in-frame in
accordance
with conventional techniques, for example by employing blunt-ended or stagger-
ended termini for ligation, restriction enzyme digestion to provide for
appropriate
termini, filling-in of cohesive ends as appropriate, alkaline phosphatase
treatment
to avoid undesirable joining, and enzymatic ligation. In another embodiment,
the
fusion gene can be synthesized by conventional techniques including automated
DNA synthesizers. Alternatively, PCR amplification of gene fragments can be
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
carried out using anchor primers which give rise to complementary overhangs
between two consecutive gene fragments which can subsequently be annealed and
reamplified to generate a chimeric gene sequence (see, for example, Current
Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992).
5 Moreover, many expression vectors are commercially available that already
encode a fusion moiety (e.g., a GST polypeptide). An LMRP-encoding nucleic
acid can be cloned into such an expression vector such that the fusion moiety
is
linked in-frame to the LMRP.
10 Homologues of the LMRP can be generated by mutagenesis, e.g., discrete
point
mutation or truncation of the LMRP. As used herein, the term "homologue"
refers
to a variant form of the LMRP which acts as an agonist or antagonist of the
activity of the LMRP. An agonist of the LMRP can retain substantially the
same,
or a subset, of the biological activities of the LMRP. An antagonist of the
LMRP
15 can inhibit one or more of the activities of the naturally occurring form
of the
LMRP, by, for example, competitively binding to a downstream or upstream
member of the cell membrane component metabolic cascade which includes the
LMRP, or by binding to an LMRP which mediates transport of compounds across
such membranes, thereby preventing translocation from taking place.
In an alternative embodiment, homologues of the LMRP can be identified by
' screening combinatorial libraries of mutants, e.g., truncation mutants, of
the
LMRP for LMRP agonist or antagonist activity. In one embodiment, a variegated
library of LMRP variants is generated by combinatorial mutagenesis at the
nucleic
acid level and is encoded by a variegated gene library. A variegated library
of
LMRP variants can be produced by, for example, enzymatically ligating a
mixture
of synthetic oligonucleotides into gene sequences such that a degenerate set
of
potential LMRP sequences is expressible as individual polypeptides, or
alternatively, as a set of larger fusion proteins (e.g., for phage display)
containing
the set of LMRP sequences therein. There are a variety of methods which can be
used to produce libraries of potential LMRP homologues from a degenerate
oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can
be performed in an automatic DNA synthesizer, and the synthetic gene then
ligated into an appropriate expression vector. Use of a degenerate set of
genes
allows for the provision, in one mixture, of all of the sequences encoding the
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
51
desired set of potential LMRP sequences. Methods for synthesizing degenerate
oligonucleotides are known in the art (see, e.g., Narang, S.A. (1983)
Tetrahedron
39:3; Itakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984)
Science 198:1056; Ike et al. (1983) Nucleic Acid Res. 11:477.
In addition, libraries of fragments of the LMRP coding sequence can be used to
generate a variegated population of LMRP fragments for screening and
subsequent selection of homologues of an LMRP. In one embodiment, a library
of coding sequence fragments can be generated by treating a double stranded
PCR
fragment of an LMRP coding sequence with a nuclease under conditions wherein
nicking occurs only about once per molecule, denaturing the double stranded
DNA, renaturing the DNA to form double stranded DNA which can include
sense/antisense pairs from different nicked products, removing single stranded
portions from reformed duplexes by treatment with S 1 nuclease, and ligating
the
resulting fragment library into an expression vector. By this method, an
expression library can be derived which encodes N-terminal, C-terminal and
internal fragments of various sizes of the LMRP.
Several techniques are known in the art for screening gene products of
2o combinatorial libraries made by point mutations or truncation, and for
screening
cDNA libraries for gene products having a selected property. Such techniques
are
adaptable for rapid screening of the gene libraries generated by the
combinatorial
mutagenesis of LMRP homologues. The most widely used techniques, which are
amenable to high through-put analysis, for screening large gene libraries
typically
include cloning the gene library into replicable expression vectors,
transforming
appropriate cells with the resulting library of vectors, and expressing the
combinatorial genes under conditions in which detection of a desired activity
facilitates isolation of the vector encoding the gene whose product was
detected.
Recursive ensemble mutagenesis (REM), a new technique which enhances the
frequency of functional mutants in the libraries, can be used in combination
with
the screening assays to identify LMRP homologues (Arkin and Yourvan (1992)
PNAS 89:7811-7815; Delgrave et al. (1993) Protein Engineering 6(3):327-331).
In another embodiment, cell based assays can be exploited to analyze a
variegated
LMRP library, using methods well known in the art.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
52
D. Uses and Methods of the Invention
The nucleic acid molecules, proteins, protein homologues, fusion proteins,
primers, vectors, and host cells described herein can be used in one or more
of the
following methods: identification of Physcomitrella patens and related
organisms;
mapping of genomes of organisms related to Physcomitrella patens;
identification
and localization of Physcomitrella patens sequences of interest; evolutionary
studies; determination of LMRP regions required for fi~.nction; modulation of
an
LMRP activity; modulation of the metabolism of one or more cell membrane
components; modulation of the transmembrane transport of one or more
compounds; and modulation of cellular production of a desired compound, such
as a fine chemical.
The LMRP nucleic acid molecules of the invention have a variety of uses.
First,
they may be used to identify an organism as being Physcomitrella patens or a
close relative thereof. Also, they may be used to identify the presence of
Physcomitrella patens or a relative thereof in a mixed population of
microorganisms. The invention provides the nucleic acid sequences of a number
of Physcomitrella patens genes; by probing the extracted genomic DNA of a
culture of a unique or mixed population of microorganisms under stringent
conditions with a probe spanning a region of a Physcomitrella patens gene
which
is unique to this organism, one can ascertain whether this organism is
present.
Although Physcomitrella patens itself is not used for the commercial
production
of polyunsaturated acids, mosses are the only known plants that produce PUFAs.
Therefor DNA sequences related to LMRPs are especially suited to be used for
PLTFA production in other organisms.
Further, the nucleic acid and protein molecules of the invention may serve as
markers for specific regions of the genome. This has utility not only in the
mapping of the genome, but also for functional studies of Physcomitrella
patens
proteins. For example, to identify the region of the genome to which a
particular
Physcomitrella patens DNA-binding protein binds, the Physcomitrella patens
genome could be digested, and the fi-agments incubated with the DNA-binding
protein. Those which bind the protein may be additionally probed with the
nucleic
acid molecules of the invention, preferably with readily detectable labels;
binding
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
53
of such a nucleic acid molecule to the genome fragment enables the
localization
of the fragment to the genome map of Physcomitrella patens, and, when
performed multiple times with different enzymes, facilitates a rapid
determination
of the nucleic acid sequence to which the protein binds. Further, the nucleic
acid
molecules of the invention may be sufficiently homologous to the sequences of
related species such that these nucleic acid molecules may serve as markers
for
the construction of a genomic map in related mosses, such as Physcomitrella
patens.
The LMRP nucleic acid molecules of the invention are also useful for
evolutionary and protein structural studies. The metabolic and transport
processes
in which the molecules of the invention participate are utilized by a wide
variety
of prokaryotic and eukaryotic cells; by comparing the sequences of the nucleic
acid molecules of the present invention to those encoding similar enzymes from
other organisms, the evolutionary relatedness of the organisms can be
assessed.
Similarly, such a comparison permits an assessment of which regions of the
sequence are conserved and which are not, which may aid in determining those
regions of the protein which are essential for the functioning of the enzyme.
This
type of determination is of value for protein engineering studies and may give
an
indication of what the protein can tolerate in terms of mutagenesis without
losing
function.
Manipulation of the LMRP nucleic acid molecules of the invention may result in
the production of LMRPs having functional differences from the wild-type
LMRPs. These proteins may be improved in efficiency or activity, may be
present in greater numbers in the cell than is usual, or may be decreased in
efficiency or activity.
There are a number of mechanisms by which the alteration of an LMRP of the
invention may directly affect the yield, production, and/or e~ciency of
production of a fme chemical incorporating such an altered protein. Recovery
of
fme chemical compounds from large-scale cultures of C. glutamicum, ciliates,
mosses, algae or fungi is significantly improved if the cell secretes the
desired
compounds, since such compounds may be readily purified from the culture
medium (as opposed to extracted from the mass of cultured cells). In the case
of
plants expressing LMRPs increased transport can lead to improved partitioning
within the plant tissue and organs. By either increasing the number or the
activity
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
54
of transporter molecules which export fme chemicals from the cell, it may be
possible to increase the amount of the produced fine chemical which is present
in
the extracellular medium, thus permitting greater ease of harvesting and
purification or in case of plants mor efficient partitioning. Conversely, in
order to
efficiently overproduce one or more fine chemicals, increased amounts of the
cofactors, precursor molecules, and intermediate compounds for the appropriate
biosynthetic pathways are required. Therefore, by increasing the number and/or
activity of transporter proteins involved in the import of nutrients, such as
carbon
sources (i.e., sugars), nitrogen sources (i.e., amino acids, ammonium salts),
phosphate, and sulfur, it may be possible to improve the production of a fme
chew ical, due to the removal of any nutrient supply limitations on the
biosynthetic
process. Further, fatty acids and lipids are themselves desirable fine
chemicals, so
by optimizing the activity or increasing the number of one or more LMRPs of
the
invention which participate in the biosynthesis of these compounds, or by
impairing the activity of one or more LMRPs which are involved in the
degradation of these compounds, it may be possible to increase the yield,
production, andlor efficiency of production of fatty acid and lipid molecules
in
mosses, algae, plants, fungi or other microorganims like C. glutamicum.
The engineering of one or more LMRP genes of the invention may also result in
LMRPs having altered activities which indirectly impact the production of one
or
more desired fine chemicals from mosses, algae, plants, ciliates or fungi or
other
microorganims like C. glutamicum. For example, the normal biochemical
processes of metabolism result in the production of a variety of waste
products
, (e.g., hydrogen peroxide and other reactive oxygen species) which may
actively
interfere with these same metabolic processes (for example, peroxynitrite is
known to nitrate tyrosine side chains, thereby inactivating some enzymes
having
tyrosine in the active site (Groves, J.T. (1999) Curr. Opin. Chem. Biol. 3(2):
226-
235). While these waste products are typically excreted, cells utilized for
large-
scale fermentative production are optimized for the overproduction of one or
more
fine chemicals, and thus may produce more waste products than is typical for a
wild-type cell. By optimizing the activity of one or more LMRPs of the
invention
which are involved in the export of waste molecules, it may be possible to
improve the viability of the cell and to maintain efficient metabolic
activity. Also,
the presence of high intracellular levels of the desired fme chemical may
actually
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
be toxic to the cell, so by increasing the ability of the cell to secrete
these
compounds, one may improve the viability of the cell.
Further, the LMRPs of the invention may be manipulated such that the relative
5 amounts of various lipid and fatty acid molecules produced are altered. This
may
have a profound effect on the lipid composition of the membrane of the cell.
Since each type of lipid has different physical properties, an alteration in
the lipid
composition of a membrane may significantly alter membrane fluidity. Changes
in membrane fluidity can impact the transport of molecules across the
membrane,
10 which, as previously explicated, may modify the export of waste products or
the
produced fine chemical or the import of necessary nutrients. Such membrane
fluidity changes may also profoundly affect the integrity of the cell; cells
with
relatively weaker membranes are more vulnerable abiotic and biotic stress
conditions which may damage or kill the cell. By manipulating LMRPs involved
15 in the production of fatty acids and lipids for membrane construction such
that the
resulting membrane has a membrane composition more amenable to the
environmental conditions extant in the cultures utilized to produce fine
chemicals,
a greater proportion of the cells should survive and multiply. Greater numbers
of
producing cells should translate into greater yields, production, or
efficiency of
20 production of the fine chemical from the culture.
The aforementioned mutagenesis strategies for LMRPs to result in increased
yields of a fme chemical are not meant to be limiting; variations on these
strategies will be readily apparent to one skilled in the art. Using such
strategies,
and incorporating the mechanisms disclosed herein, the nucleic acid and
protein
25 molecules of the invention may be utilized to generate mosses, algae,
ciliates,
plants, fungi or other microorganims like C. glutamicum expressing mutated
LMRP nucleic acid and protein molecules such that the yield, production,
and/or
efficiency of production of a desired compound is improved. This desired
compound may be any natural product of mosses, algae, ciliates, plants, fungi
or
30 C. glutamicum, which includes the final products of biosynthesis pathways
and
intermediates of naturally-occurring metabolic pathways, as well as molecules
which do not naturally occur in the metabolism of said cells, but which are
produced by a said cells of the invention.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
56
This invention is further illustrated by the following examples which should
not
be construed as limiting. The contents of all references, patent applications,
patents, and published patent applications cited throughout this application
are
hereby incorporated by reference.
Examplification
Example 1
General processes
a) General cloning processes:
Cloning processes such as, for example, restriction cleavages, agarose gel
electrophoresis, purification of DNA fragments, transfer of nucleic acids to
nitrocellulose and nylon membranes, linkage of DNA fragments, transformation
of Escherichia coli and yeast cells, growth of bacteria and sequence analysis
of
recombinant DNA were carried out as described in Sambrook et al. (1989) (Cold
Spring Harbor Laboratory Press: ISBN 0-87969-309-6) or Kaiser, Michaelis and
Mitchell (1994) "Methods in Yeast Genetics" (Cold Spring Harbor Laboratory
2o Press: ISBN 0-87969-451-3). Transformation and cultivation 2lof algae such
as
Chlorella or Phaeodactylum are transformed as described by El-Sheekh (1999),
Biologia Plantarum 42: 209-216; Apt et al. (1996), Molecular and General
Genetics 252 (5): 872-9.
b) Chemicals:
The chemicals used were obtained, if not mentioned otherwise in the text, in
p.a.
quality from the companies Fluka (Neu-Ulm), Merck (Darmstadt), Roth
(Karlsruhe), Serva (Heidelberg) and Sigma (Deisenhofen). Solutions were
prepared using purified, pyrogen-free water, designated as H20 in the
following
text, from a Milli-Q water system water purification plant (Millipore,
Eschbom).
Restriction endonucleases, DNA-modifying enzymes and molecular biology kits
were obtained from the companies AGS (Heidelberg), Amersham
(Braunschweig), Biometra (Gottingen), Boehringer Mannheim (Mannheim),
Genomed (Bad Oeynnhausen), New England Biolabs (Schwalbach/Taunus),
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
57
Novagen (Madison, Wisconsin, USA), Perkin-Elmer (Weiterstadt), Pharmacia
(Freiburg), Qiagen (Hilden) and Stratagene (Amsterdam, Netherlands). They were
used, if not mentioned otherwise, according to the manufacturer's
instructions.
c) Plant material
For this study, plants of the species Physcomitrella patens (Hedw.) B.S.G.
from
the collection of the genetic studies section of the University of Hamburg
were
used. They originate from the strain 16/14 collected by H.L.K. Whitehouse in
to Gransden Wood, Huntingdonshire (England), which was subcultured from a
spore
by Engel (1968, Am J Bot 55, 438-446). Proliferation of the plants was carried
out
by means of spores and by means of regeneration of the gametophytes. The
protonema developed from the haploid spore as a chloroplast-rich chloronema
and
chloroplast-low caulonema, on which buds formed after approximately 12 days.
These grew to give gametophores bearing antheridia and archegonia. After
fertilization, the diploid sporophyte with a short seta and the spore capsule
resulted, in which the meiospores mature.
d) Plant growth
Culturing was carried out in a climatic chamber at an air temperature of 25~C
and
light intensity of 55 micromols-1 m-2 (white light; Philips TL 65 W/25
fluorescent
tube) and a light/dark change of 16/8 hours. The moss was either modified in
liquid culture using Knop medium according to Reski and Abel (1985, Planta
165,
354-358) or cultured on Knop solid medium using 1% oxoid agar (Unipath,
Basingstoke, England). The protonemas used for RNA and DNA isolation were
cultured in aerated liquid cultures. The protonemas were comminuted every
9 days and transferred to fresh culture medium.
Example 2
Total DNA isolation from plants
The details for the isolation of total DNA relate to the working up of one
gram
fresh weight of plant material. CTAB buffer: 2% (w/v) N-cethyl-N,N,N-
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
58
trimethylammonium bromide (CTAB); 100 mM Tris HC1 pH 8.0; 1.4 M NaCI; 20
mM EDTA. N-Laurylsarcosine buffer: 10% (w/v) N-laurylsarcosine; 100 mM
Tris HCl pH 8.0; 20 mM EDTA.
The plant material was triturated under liquid nitrogen in a mortar to give a
fine
powder and transferred to 2 ml Eppendorf vessels. The frozen plant material
was
then covered with a layer of 1 ml of decomposition buffer (1 ml CTAB buffer,
100 ml of N-laurylsarcosine buffer, 20 ml of beta-mercaptoethanol and 10 ml of
proteinase K solution, 10 mg/ml) and incubated at 60 °C for one hour
with
to continuous shaking. The homogenate obtained was distributed into two
Eppendorf
vessels (2 ml) and extracted twice by shaking with the same volume of
chloroform/isoamyl alcohol (24:1). For phase separation, centrifugation was
carried out at 8000 x g and RT for 15 min in each case. The DNA was then
precipitated at 70 °C for 30 min using ice-cold isopropanol. The
precipitated DNA
was sedimented at 4 °C and 10,000 g for 30 min and resuspended in 180
ml of TE
buffer (Sambrook et al., 1989, Cold Spring Harbor Laboratory Press: ISBN 0-
87969-309-6). For further purification, the DNA was treated with NaCI ( 1.2 M
final concentration) and precipitated again at 70 °C for 30 min using
twice the
volume of absolute ethanol. After a washing step with 70% ethanol, the DNA was
2o dried and subsequently taken up in 50 ml of H20 + RNAse (50 mg/ml final
concentration). The DNA was dissolved overnight at 4 °C and the RNAse
digestion was subsequently carried out at 37 °C for 1 h. Storage of the
DNA took
place at 4 °C.
Example 3
Isolation of total RNA and poly-(A)+ RNA from plants
For the investigation of transcripts, both total RNA and poly-(A)+ RNA were
isolated. The total RNA was obtained from wild-type 9d old protonemata
following the GTC-method (Reski et al. 1994, Mol. Gen. Genet., 244:352-359).
Isolation of PolyA+ RNA was isolated using Dyna BeadsR (Dynal, Oslo, Finland)
Following the instructions of the manufacturers protocol. After determination
of
the concentration of the RNA or of the poly(A)+ RNA, the RNA was precipitated
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
59
by addition of 1/10 volumes of 3 M sodium acetate pH 4.6 and 2 volumes of
ehanol and stored at 70 °C.
Example 4
cDNA library construction
For cDNA library construction first strand synthesis was achieved using Marine
Leukemia Virus reverse transcriptase (Roche, Mannheim, Germany) and olido-
to d(T)-primers, second strand synthesis by incubation with DNA polymerase I,
Klenow enzyme and RNAseH digestion at 12 °C (2h), 16 °C (1h)
and 22 °C (1h).
The reaction was stopped by incubation at 65 °C (10 min) and
subsequently
transferred to ice. Double stranded DNA molecules were blunted by T4-DNA-
polymerase (Roche, Mannheim) at 37 °C (30 min). Nucleotides were
removed by
phenol/chloroform extraction and Sephadex G50 spin columns. EcoRI adapters
(Pharmacia, Freiburg, Germany) were ligated to the cDNA ends by T4-DNA-
ligase (Roche, 12 °C, overnight) and phosphorylated by incubation with
polynucleotide kinase (Roche, 37 °C, 30 min). This mixture was
subjected to
separation on a low melting agarose gel. DNA molecules larger than 300
basepairs were eluted from the gel, phenol extracted, concentrated on Elutip-D-
columns (Schleicher and Schuell, Dassel, Germany) and were ligated to vector
arms and packed into lambda ZAPII phages or lambda ZAP-Express phages using
the Gigapack Gold Kit (Stratagene, Amsterdam, Netherlands) using material and
following the instructions of the manufacturer.
Example 5
Identification of genes of interest
Gene sequences can be used to identify homologous or heterologous genes from
cDNA or genomic libraries. Homologous genes (e. g. full length cDNA clones)
can be isolated via nucleic acid hybridization using for example cDNA
libraries:
Depended on the abundance of the gene of interest 100 000 up to 1 000 000
recombinant bacteriophages are plated and transferred to a nylon membrane.
After
denaturation with alkali, DNA is immobilized on the membrane by e. g. UV cross
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
linking. Hybridization is carried out at high stringency conditions. In
aqueous
solution hybridization and washing is performed at an ionic strength of 1 M
NaCl
and a temperature of 68 °C. Hybridization probes are generated by e. g.
radioactive (32P) nick transcription labeling (High Prime, Roche, Mannheim,
5 Germany). Signals are detected by autoradiography.
Partially homologous or heterologous genes that are related but not identical
can
be identified analog to the above described procedure using low stringency
hybridization and washing conditions. For aqueous hybridization the ionic
10 strength is normally kept at 1 M NaCI while the temperature is
progressively
lowered from 68 to 42 °C.
Isolation of gene sequences with homologies only in a distinct domain of (for
example 10-20 aminoacids) can be carried out by using synthetic radio labeled
oligonucleotide probes. Radio labeled oligonucleotides are prepared by
15 phosphorylalation of the 5'-prime end of two complementary oligonucleotides
with T4 polynucleotede kinase. The complementary oligonucleotides are annealed
and ligated to form concatemers. The double stranded concatemers are than
radiolabled by for example nick transcription. Hybridization is normally
performed at low stringency conditions using high oligonucleotide
concentrations.
Oligonucleotide hybridization solution:
6 x SSC; 0.01 M sodium phosphate; 1 mM EDTA (pH 8); 0.5 % SDS; 100 ~,g/ml
denaturated salmon sperm DNA; 0.1 % nonfat dried milk.
During hybridization temperature is lowered stepwise to 5-10 ~C below the
estimated oligonucleotid Tm or down to room temperature followed by washing
steps and autoradiography. Washing is performed in extremely with extremely
low stringency such as 3 washing steps using 4x SSC. Further details are
described by Sambrook, J. et al. (1989), "Molecular Cloning: A Laboratory
3o Manual", Cold Spring Harbor Laboratory Press or Ausubel, F.M. et al. (1994)
"Current Protocols in Molecular Biology", John Wiley & Sons.
Example 6
Identification of genes of interest by screening expression libraries with
antibodies
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
61
C-DNA sequences can be used to produce recombinant protein for example in E.
coli (e.g. Qiagen QIAexpress pQE system). Recombinant proteins are than
normally affinity purified via Ni-NTA affinity chromatoraphy (Qiagen).
Recombinant proteins are than used to produce specific antibodies for example
by
using standard techniques for rabbit immunization. Antibodies are affinity
purified using a Ni-NTA column saturated with the recombinant antigen as
described by Gu et al., (1994) BioTechniques 17: 257-262. The antibody can
than
be used to screen expression cDNA libraries to identify homologous or
heterologous genes via an immunological screening (Sambrook, J. et al. (1989),
Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press
or Ausubel, F.M. et al. (1994) "Current Protocols in Molecular Biology", John
Wiley & Sons).
Example 7
Northern-hybridization
For RNA hybridization, 20 mg of total RNA or 1 mg of poly-(A)+ RNA were
2o separated by gel electrophoresis in 1.25% strength agarose gels using
formaldehyde as described in Amasino (1986, Anal. Biochem. 152, 304),
transferred by capillary attraction using 10 x SSC to positively charged nylon
membranes (Hybond N+, Amersham, Braunschweig), immobilized by UV light
and prehybridized for 3 hours at 68 °C using hybridization buffer (10%
dextran
sulfate w/v, 1 M NaCI, 1% SDS, 100 mg of herring sperm DNA). The labeling of
the DNA probe with the Highprime DNA labeling kit (Roche, Mannheim,
Germany) was carried out during the prehybridization using alpha-32P dCTP
(Amersham, Braunschweig, germany). Hybridization was carried out after
addition of the labeled DNA probe in the same buffer at 68 C overnight. The
washing steps were carried out twice for 15 min using 2 x SSC and twice for 30
min using 1 x SSC, 1% SDS at 68 °C. The exposure of the sealed filters
was
carned out at -70 °C for a period of 1 to 14d.
Example 8
DNA Sequencing
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
62
CDNA libraries as described in Example 4 were used for DNA sequencing
according to standard methods, in particular by the chain termination method
using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready Reaction Kit
(Perkin-Eliner, Weiterstadt, germany). Random Sequencing was carried out
subsequent to preparative plasmid recovery from cDNA libraries via in vivo
mass
excision and retransformation of DH10B on agar plates (material and protocol
details from Stratagene, Amsterdam, Netherlands. Plasmid DNA was prepared
from overnight grown E. coli cultures grown in Luria-Broth medium containing
to ampicillin (see Sambrook et al. (1989) (Cold Spring Harbor Laboratory
Press:
ISBN 0-87969-309-6)) on a Qiagene DNA preparation robot (Qiagen, Hilden)
according to the manufacturers protocols. Sequencing primers with the
following
nucleotide sequences were used:
S'-CAGGAAACAGCTATGACC-3'
5 '-CTAAAGGGAACAA.AAGCTG-3 '
5'-TGTAAA.ACGACGGCCAGT-3'
Example 9
Plasmids for plant transformation
For plant transformation binary vectors such as pBinAR can be used (Hofgen and
Willmitzer, Plant Science 66(1990), 221-230). Construction of the binary
vectors
can be performed by ligation of the cDNA in sense or antisense orientation
into
the T-DNA. 5'-prime to the cDNA a plant promotor activates transcription of
the
cDNA. A polyadenylation sequence is located 3'-prime to the cDNA.
Tissue specific expression can be archived by using a tissue specific
promotor.
For example seed specific expression can be archived by cloning the napin or
phaseolin, DC3, LeB4 or USP promotor 5-prime to the cDNA. Also any other
seed specific promotor element can be used. For constitutive expression within
the
whole plant the CaMV 35S promotor can be used. The expressed protein can be
targeted to a cellular compartment using a signal peptide, for expample for
plasids, mitochondria or endoplasmatic reticulum (Kermode, Crit. Rev. Plant
Sci.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
63
15, 4 (1996), 285-423). The signal peptide is cloned 5'-prime in frame to the
cDNA to archive subcellular localization of the fusionprotein.
Example 10
Transformation of Agrobacterium
Agrobacterium mediated plant transformation can be performed using for
example the GV3101(pMP90) (Koncz and Schell, Mol. Gen.Genet. 204 (1986),
383-396) or LBA4404 (Clontech) Agrobacterium tumefaciens strain.
Transformation can be performed by standard transformation techniques
(Deblaere et al., Nucl. Acids. Tes. 13 (1984), 4777-4788).
Example 11
Plant transformation
Agrobacterium mediated plant transformation can be performed using standard
transformation and regeneration techniques (Gelvin, Stanton B.; Schilperoort,
Robert A, Plant Molecular Biology Manual,2nd Ed. - Dordrecht : Kluwer
Academic Publ., 1995. - in Sect., Ringbuc Zentrale Signatur: BT11-P ISBN 0-
7923-2731-4; Glick, Bernard R.; T'hompson, John E., Methods in Plant Molecular
Biology and Biotechnology, Boca Raton: CRC Press, 1993. - 360 S.,ISBN 0-
8493-5164-2).
For example rapeseed can be transformed via cotyledon or hypocotyl
transformation (Moloney et al., Plant cell Report 8 (1989), 238-242; De Block
et
al., Plant Physiol. 91 (1989, 694-701). Use of antibiotica for agrobacterium
and
plant selection depends on the binary vector and the agrobacterium strain used
for
transformation. Rapeseed selection is normally performed using kanamycin as
selectable plant marker.
Agrobacterium mediated gene transfer to flax can be performed using for
example
a technique described by Mlynarova et al. (1994), Plant Cell Report 13: 282-
285.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
64
Transformation of soybean can' be performed using for example a technique
described in EP 0424 047, US 322 783 (Pioneer Hi-Bred International) or in EP
0397 687, US 5 376 543, US 5 169 770 (University Toledo).
Plant transformation using particle bombardment, Polyethylene Glycol mediated
DNA uptake or via the Silicon Carbide Fiber technique is for example described
by Freeling and Walbot "The maize handbook" (1993)ISBN 3-540-97826-7,
Springer Verlag New York).
Example 12
In vivo Mutagenesis
In vivo mutagenesis of microorganisms can be performed by passage of plasmid
(or other vector) DNA through E. coli or other microorganisms (e.g. Bacillus
spp.
or yeasts such as Saccharomyces cerevisiae) which are impaired in their
capabilities to maintain the integrity of their genetic information. Typical
mutator
strains have mutations in the genes for the DNA repair system (e.g., mutHLS,
mutD, mutT, etc.; for reference, see Rupp, W.D. (1996) DNA repair mechanisms,
in: Escherichia coli and Salmonella, p. 2277-2294, ASM: Washington.) Such
strains are well known to those skilled in the art. The use of such strains is
illustrated, for example, in Greener, A. and Callahan, M. (1994) Strategies 7:
32
34. Transfer of mutated DNA molecules into plants is preferably done after
selection and testing in microorganisms. Transgenic plants are generated
according to various examples within the examplification of this document.
Example 13
DNA Transfer Between Escherichia coli and Corynebacterium glutamicum
Several Corynebacterium and Brevibacterium species contain endogenous
plasmids (as e.g., pHM1519 or pBLI) which replicate autonomously (for review
see, e.g., Martin, J.F. et al. (1987) Biotechnology, 5:137-146). Shuttle
vectors for
Escherichia coli and Corynebacterium glutamicum can be readily constructed by
using standard vectors for E. coli (Sambrook, J. et al. (1989), "Molecular
Cloning:
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
A Laboratory Manual", Cold Spring Harbor Laboratory Press or Ausubel, F.M. et
al. (1994) "Current Protocols in Molecular Biology", John Wiley & Sons) to
which a origin or replication for and a suitable marker from Corynebacterium
glutamicum is added. Such origins of replication are preferably taken from
5 endogenous plasmids isolated from Corynebacterium and Brevibacterium
species.
Of particular use as transformation markers for these species are genes for
kanamycin resistance (such as those derived from the Tn5 or Tn903 transposons)
or chloramphenicol (Winnacker, E.L. (1987) From Genes to Clones Introduction
to Gene Technology, VCH, Weinheim). There are numerous examples in the
10 literature of the construction of a wide variety of shuttle vectors which
replicate in
both E. coli and C. glutamicum, and which can be used for several purposes,
including gene over-expression (for reference, see e.g., Yoshihama, M. et al.
(1985) .l. Bacteriol. 162:591-597, Martin J.F. et al. (1987) Biotechnology,
5:137-
146 and Eikmanns, B.J. et al. (1991) Gene, 102:93-98).
Using standard methods, it is possible to clone a gene of interest into one of
the
shuttle vectors described above and to introduce such a hybrid vectors into
strains
of Corynebacterium glutamicum. Transformation of C. glutamicum can be
achieved by protoplast transformation (Kastsumata, R. et al. (1984) J.
Bacteriol.
159306-311), electroporation (Liebl, E. et al. (1989) FEMS Microbiol. Letters,
53:399-303) and in cases where special vectors are used, also by conjugation
(as
described e.g. in Schafer, A et al. (1990) J. Bacteriol. 172:1663-1666). It is
also
possible to transfer the shuttle vectors for C. glutamicum to E. coli by
preparing
plasmid DNA from C. glutamicum (using standard methods well-known in the
art) and transforming it into E. coli. This transformation step can be
performed
using standard methods, but it is advantageous to use an Mcr-deficient E. coli
strain, such as NM522 (Gough & Murray (1983) J. Mol. Biol. 166:1-19).
Example 14
Assessment of the Expression of a recombinant gene product in a transformed
organism
The activity of a recombinant gene product in the transformed host organism
has
been measured on the transcriptional or/and on the translational level. A
useful
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
66
method to ascertain the level of transcription of the gene (an indicator of
the
amount of mRNA available for translation to the gene product) is to perform a
Northern blot (for reference see, for example, Ausubel et al. (1988) Current
Protocols in Molecular Biology, Wiley: New York), in which a primer designed
to
bind to the gene of interest is labeled with a detectable tag (usually
radioactive or
chemiluminescent), such that when the total RNA of a culture of the organism
is
extracted, run on gel, transferred to a stable matrix and incubated with this
probe,
the binding and quantity of binding of the probe indicates the presence and
also
the quantity of mRNA for this gene. This information is evidence of the degree
of
l0 transcription of the transformed gene. Total cellular RNA can be prepared
from
cells, tissues or organs by several methods, all well-known in the art, such
as that
described in Bormann, E.R. et al. (1992) Mol. Microbiol. 6: 317-326.
To assess the presence or relative quantity of protein translated from this
mRNA,
standard techniques, such as a Western blot, may be employed (see, for
example,
Ausubel et al. (1988) Current Protocols in Molecular Biology, Wiley: New
York).
In this process, total cellular proteins are extracted, separated by gel
electrophoresis, transferred to a matrix such as nitrocellulose, and incubated
with
a probe, such as an antibody, which speciFcally binds to the desired protein.
This
probe is generally tagged with a chemiluminescent or colorimetric label which
may be readily detected. The presence and quantity of label observed indicates
the
presence and quantity of the desired mutant protein present in the cell.
Example 15
Growth of Genetically Modified Corynebacterium glutamicum
Media and Culture Conditions
Genetically modified Corynebacteria are cultured in synthetic or natural
growth
media. A number of different growth media for Corynebacteria are both well-
known and readily available (Lieb et al. (1989) Appl. Microbiol. Biotechnol.,
32:205-210; von der Osten et al. (1998) Biotechnology Letters, 11:11-16;
Patent
DE 4,120,867; Liebl (1992) "The Genus Corynebacterium; in: The Procaryotes,
Volume II, Balows, A. et al., eds. Springer-Verlag). These media consist of
one
or more carbon sources, nitrogen sources, inorganic salts, vitamins and trace
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
67
elements. Preferred carbon sources are sugars, such as mono-, di-, or
polysaccharides. For example, glucose, fi-uctose, mannose, galactose, ribose,
sorbose, ribulose, lactose, maltose, sucrose, raffmose, starch or cellulose
serve as
very good carbon sources. It is also possible to supply sugar to the media via
complex compounds such as molasses or other by-products from sugar
refinement. It can also be advantageous to supply mixtures of different carbon
sources. Other possible carbon sources are alcohols and organic acids, such as
methanol, ethanol, acetic acid or lactic acid. Nitrogen sources are usually
organic
or inorganic nitrogen compounds, or materials which contain these compounds.
Examplary nitrogen sources include ammonia gas or ammonia salts, such as
NH4C1 or (NH4)2SOa, NH40H, nitrates, urea, amino acids or complex nitrogen
sources like corn steep liquor, soy bean flour, soy bean protein, yeast
extract, meat
extract and others.
Inorganic salt compounds which may be included in the media include the
chloride-, phosphorous- or sulfate- salts of calcium, magnesium, sodium,
cobalt,
molybdenum, potassium, manganese, zinc, copper and iron. Chelating
compounds can be added to the medium to keep the metal ions in solution.
Particularly useful chelating compounds include dihydroxyphenols, like
catechol
or protocatechuate, or organic acids, such as citric acid. It is typical for
the media
to also contain other growth factors, such as vitamins or growth promoters,
examples of which include biotin, riboflavin, thiamin, folic acid, nicotinic
acid,
pantothenate and pyridoxin. Growth factors and salts frequently originate from
complex media components such as yeast extract, molasses, corn steep liquor
and
others. The exact composition of the media compounds depends strongly on the
immediate experiment and is individually decided for each specific case.
Information about media optimization is available in the textbook "Applied
Microbiol. Physiology, A Practical Approach (eds. P.M. Rhodes, P.F. Stanbury,
IRL Press (1997) pp. 53-73, ISBN 0 19 963577 3). It is also possible to select
growth media from commercial suppliers, like standard 1 (Merck) or BHI (grain
heart infusion, DIFC) or others.
All medium components are sterilized, either by heat (20 minutes at 1.5 bar
and
121 °C) or by sterile filtration. The components can either be
sterilized together
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
68
or, if necessary, separately. All media components can be present at the
beginning of growth, or they can optionally be added continuously or
batchwise.
Culture conditions are defined separately for each experiment. The temperature
should be in a range between 15 °C and 45 °C. The temperature
can be kept
constant or can be altered during the experiment. The pH of the medium should
be in the range of 5 to 8.5, preferably around 7.0, and can be maintained by
the
addition of buffers to the media. An examplary buffer for this purpose is a
potassium phosphate buffer. Synthetic buffers such as MOPS, HEPES, ACES
and others can alternatively or simultaneously be used. It is also possible to
maintain a constant culture pH through the addition of NaOH or NH40H during
growth. If complex medium components such as yeast extract are utilized, the
necessity for additional buffers may be reduced, due to the fact that many
complex compounds have high buffer capacities. If a fermentor is utilized for
culturing the micro-organisms, the pH can also be controlled using gaseous
ammonia.
The incubation time is usually in a range from several hours to several days.
This
time is selected in order to permit the maximal amount of product to
accumulate
in the broth. The disclosed growth experiments can be carried out in a variety
of
vessels, such as microtiter plates, glass tubes, glass flasks or glass or
metal
fermentors of different sizes. For screening a large number of clones, the
microorganisms should be cultured in microtiter plates, glass tubes or shake
flasks, either with or without baffles. Preferably 100 ml shake flasks are
used,
filled with 10% (by volume) of the required growth medium. The flasks should
be shaken on a rotary shaker (amplitude 25 mm) using a speed-range of 100-300
rpm. Evaporation losses can be diminished by the maintenance of a humid
atmosphere; alternatively, a mathematical correction for evaporation losses
should
be performed.
If genetically modified clones are tested, an unmodified control clone or a
control
clone containing the basic plasmid without any insert should also be tested.
The
medium is inoculated to an OD6oo of Ø5-1.5 using cells grown on agar plates,
such as CM plates (10 g/1 glucose, 2,5 g/1 NaCI, 2 g/1 urea, 10 g/1
polypeptone,
5 g/1 yeast extract, 5 g/1 meat extract, 22 g/1 NaCI, 2 g/1 urea, 10 g/1
polypeptone, 5
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
69
g/1 yeast extract, 5 g/1 meat extract, 22 g/1 agar, pH 6.8 with 2M NaOH) that
had
been incubated at 30 °C. Inoculation of the media is accomplished by
either
introduction of a saline suspension of C. glutamicum cells from CM plates or
addition of a liquid preculture of this bacterium.
Example 16
In vitro Analysis of the Function of Physcomitrella genes in transgenic
organisms
The determination of activities and kinetic parameters of enzymes is well
established in the art. Experiments to determine the activity of any given
altered
enzyme must be tailored to the specific activity of the wild-type enzyme,
which is
well within the ability of one skilled in the art. Overviews about enzymes in
general, as well as specific details concerning structure, kinetics,
principles,
methods, applications and examples for the determination of many enzyme
activities may be found, for example, in the following references: Dixon, M.,
and
Webb, E.C., (1979) Enzymes. Longmans: London; Fersht, (1985) Enzyme
Structure and Mechanism. Freeman: New York; Walsh, (1979) Enzymatic
Reaction Mechanisms. Freeman: San Francisco; Price, N.C., Stevens, L. (1982)
Fundamentals of Enzymology. Oxford Univ. Press: Oxford; Boyer, P.D., ed.
(1983) The Enzymes, 3'd ed. Academic Press: New York; Bisswanger, H., (1994)
Enzymkinetik, 2°d ed. VCH: Weinheim (ISBN 3527300325); Bergmeyer,
H.U.,
Bergmeyer, J., Graf3l, M., eds. (1983-1986) Methods of Enzymatic Analysis, 3'a
ed., vol. I-XII, Verlag Chemie: Weinheim; and Ullmann's Encyclopedia of
Industrial Chemistry (1987) vol. A9, Enzymes. VCH: Weinheim, p. 352-363.
The activity of proteins which bind to DNA can be measured by several well-
established methods, such as DNA band-shift assays (also called geI
retardation
assays). The effect of such proteins on the expression of other molecules can
be
measured using reporter gene assays (such as that described in Kolmar, H. et
al.
(1995) EMBO J. 14: 3895-3904 and references cited therein). Reporter gene test
systems are well known and established for applications in both pro- and
eukaryotic cells, using enzymes such as beta-galactosidase, green fluorescent
protein, and several others.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
The determination of activity of membrane-transport proteins can be performed
according to techniques such as those described in Gennis, R.B. (1989) Pores,
Channels and Transporters, in Biomembranes, Molecular Structure and Function,
Springer: Heidelberg, p. 85-137; 199-234; and 270-322.
5
Example 17
Analysis of Impact of Recombinant Proteins on the Production of the Desired
Product
The effect of the genetic modification in plants, C. glutamicum, fungi,
mosses,
algae, cilates or on production of a desired compound (such as fatty acids)
can be
assessed by growing the modified microorganism or plant under suitable
conditions (such as those described above) and analyzing the medium and/or the
cellular component for increased production of the desired product (i.e.,
lipids or a
fatty acid). Such analysis techniques are well known to one skilled in the
art, and
include spectroscopy, thin layer chromatography, staining methods of various
kinds, enzymatic and microbiological methods, and analytical chromatography
such as high performance liquid chromatography (see, for example, Ullman,
Encyclopedia of Industrial Chemistry, vol. A2, p. 89-90 and p. 443-613, VCH:
Weinheim (1985); Fallon, A. et al., (1987) Applications of HPLC in
Biochemistry
in: Laboratory Techniques in Biochemistry and Molecular Biology, vol. 17; Rehm
et al. (1993) Biotechnology, vol. 3, Chapter III: Product recovery and
purification, page 469-714, VCH: Weinheim; Belter, P.A. et al. (1988)
Bioseparations: downstream processing for biotechnology, John Wiley and Sons;
Kennedy, J.F. and Cabral, J.M.S. (1992) Recovery processes for biological
materials, John Wiley and Sons; Shaeiwitz, J.A. and Henry, J.D. (1988)
Biochemical separations, in: Ulmann's Encyclopedia of Industrial Chemistry,
vol. B3, Chapter 11, page 1-27, VCH: Weinheim; and Dechow, F.J. (1989)
Separation and purification techniques in biotechnology, Noyes Publications.)
Besides the above mentioned methods, plant lipids are extracted from plant
material as described by' Cahoon et al. (1999)PNAS 96 (22): 12935-12940 and
Browse et al. (1986) Analytic Biochemistry 152: 141-145. Qualitative and
quantitative lipid or fatty acid analysis is described at Christie, William
W.,
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
71
Advances in Lipid Methodology. Ayr/Scotland : Oily Press. - (Oily Press Lipid
Library ; 2); Christie, William W., Gas Chromatography and Lipids. A Practical
Guide - Ayr, Scotland : Oily Press, 1989 Repr. 1992. - IX,307 S. - (Oily Press
Lipid Library ; 1); "Progress in Lipid Research,Oxford : Pergamon Press,
1(1952)
- 16(1977) u.d.T.: Progress in the Chemistry of Fats and Other Lipids CODEN
In addition to the measurement of the final product of fermentation, it is
also
possible to analyze other components of the metabolic pathways utilized for
the
production of the desired compound, such as intermediates and side-products,
to
to determine the overall efficiency of production of the compound. Analysis
methods include. measurements of nutrient levels in the medium (e.g., sugars,
hydrocarbons, nitrogen sources, phosphate, and other ions), measurements of
biomass composition and growth, analysis of the production of common
metabolites of biosynthetic pathways, and measurement of gasses produced
during fermentation. Standard methods for these measurements are outlined in
Applied Microbial Physiology, A Practical Approach, P.M. Rhodes and P.F.
Stanbury, eds., IRL Press, p. 103-129; 131-163; and 165-192 (ISBN:
0199635773) and references cited therein.
One example is the analysis of fatty acids (abbreviations: FAME, fatty acid
methyl ester; GC-MS, gas-liquid chromatography-mass spectrometry; TAG,
triacylglycerol; TLC, thin-layer chromatography).
Unequivocal proof for the presence of fatty acid products can obtained by the
analysis of recombinant organisms following standard analytical procedures:
GC,
GC-MS or TLC as variously described by Christie and references therein (1997,
in: Advances on Lipid Methodology- Fours ed.: Christie, Oily Press, Dundee,
119-169; 1998, gas-chromatography-mass spectrometry methods, Lipids 33:343-
353).
Material to be analyzed can be disintegrated via sonification, glass milling,
liquid
nitrogen and grinding or via other applicable methods. The material has to be
centrifuged after disintegration. The sediment is resuspended in Aqua dest,
heated
for 10 min at 100 °C, cooled on ice and centrifuged again followed by
extraction
in 0,5 M sulfuric acid in methanol containing 2% dimethoxypropane for 1h at 90
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
72
°C leading to hydrolyzed oil and lipid compounds resulting in
transmethylated
lipids. These fatty acid methyl esters are extracted in petrolether and
finally
subjected to GC analysis using a capillary column (Chrompack, WCOT Fused
Silica, CP-Wax-52 CB, 25 m, 0,32 mm) at a temperature gradient between 170
°C
and 240 °C for 20 min and 5 min at 240 °C. The identity of
resulting fatty acid
methylesters has to be defined by the use of standards available form
commercial
sources (i.e. Sigma).
In case of fatty acids where standards are not available molecule identity has
to be
l0 shown via derivatization and subsequent GC MS analysis. For example the
localization of triple bond fatty acids have to be shown via GC-MS after
derivatisation via 4,4-Dimethoxyoxazolin-Derivaten (Christie, 1998 see above).
Example 18
Purification of the Desired Product from transformed organisms
Recovery of the desired product from plants material or fungi, mosses, algae,
cilates or C. glutamicum cells or supernatant of the above-described cultures
can
be performed by various methods well known in the art. If the desired product
is
not secreted from the cells, the cells, can be harvested from the culture by
low-
speed centrifugation, the cells can be lysed by standard techniques, such as
mechanical force or sonification. Organs of plants can be separated
mechanically
from other tissue or organs. Following homogenization cellular debris is
removed by centrifugation, and the supernatant fraction containing the soluble
proteins is retained for further purification of the desired compound. If the
product is secreted from desired cells, then the cells are removed from the
culture
by low-speed centrifugation, and the supernate fi-action is retained for
further
purification.
The supernatant fraction from either purification method is subjected to
chromatography with a suitable resin, in which the desired molecule is either
retained on a chromatography resin while many of the impurities in the sample
are
not, or where the impurities are retained by the resin while the sample is
not.'
Such chromatography steps may be repeated as necessary, using the same or
different chromatography resins. One skilled in the art would be well-versed
in
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
73
the selection of appropriate chromatography resins and in their most
efficacious
application for a particular molecule to be purified. The purified product may
be
concentrated by filtration or ultrafiltration, and stored at a temperature at
which
the stability of the product is maximized.
10
There are a wide array of purification methods known to the art and the
preceding
method of purification is not meant to be limiting. Such purification
techniques
are described, for example, in Bailey, J.E. & Ollis, D.F. Biochemical
Engineering
Fundamentals, McGraw-Hill: New York (1986).
The identity and purity of the isolated compounds may be assessed by
techniques
standard in the art. These include high-performance liquid chromatography
(HPLC), spectroscopic methods, staining methods, thin layer chromatography,
NIRS, enzymatic assay, or microbiologically. Such analysis methods are
reviewed in: Patek et al. (1994) Appl. Environ. Microbiol. 60: 133-140;
Malakhova et al. (1996) Biotekhnologiya 11: 27-32; and Schmidt et al. (1998)
Bioprocess Engineer. 19: 67-70. Ulmann's Encyclopedia of Industrial Chemistry,
(1996) vol. A27, VCH: Weinheim, p. 89-90, p. 521-540, p. 540-547, p. 559-566,
575-581 and p. 581-587; Michal, G. (1999) Biochemical Pathways: An Atlas of
Biochemistry and Molecular Biology, John Wiley and Sons; Fallon, A. et al.
(1987) Applications of HPLC in Biochemistry in: Laboratory Techniques in
Biochemistry and Molecular Biology, vol. 17.
Example 19:
Expression of Physcomitrella genes in crop plants:
In order to express moss genes in crop plants expression cassettes have to be
created according to example 9. To yield overexpression or cosuppression, the
respective coding sequence, preferably the longest open reading frame, more
preferably the open reading frame containing start and stop codon are
transformed
in sense or antisense orientation into higher plants. For suitable expression
vectors
and transformation systems see example 9-11.
There are two ways to clone cDNA fragments into expression vectors. Either the
cloning sites of the inserts can be used for cloning purposes or the cDNA
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
74
fragment to be cloned can be designed by the use of PCR and designed PCR
primers. The start and stop codons of the longest open reading frames are
determined as shown in Table 1B and can be used for the definition of suitable
primers. The start of suitable open reading frame and stop codon and the
fragment
length are examplified for the given clones in Table 1.
In the following, this can be examplified for the coding cDNA sequences of
Table
1 such as of Phosphatidate phosphatase or abbreviated: PAP; (clone entry no.
PP004072140R) from Physcomitrella patens which can then be applied in an
analogous way for the other cDNA sequences. The PAP cDNA clone .is amplified
from clone PP004072140R using the polymerase chain reaction (PCR). The
forward primer contains the PAP gene encoding sequence from the 5' end of the
cDNA, including a restriction site and a translation optimization sequence
prior to
the ATG codon and 18-24 further coding basepairs to be included in the PCR
primer such as:
5'-forward primer: GGTACCAAAATGGGAA.ACGGATACAGTTCCC
3'-reverse primer: GGATCCTAAGTTTACAGACATAGTACGTGT
PCR primers can be designed for all other genes from this invention in a
similar
way. Restriction sites can vary and have to be chosen on a gene specific
basis. It
has to be asured that the chosen restriction motif is not present within the
coding
region of the individual gene. This is necessary to allow restriction enzyme
mediated cleavage after PCR amplification that does not lead to a smaller or
truncated cDNA fragment. Alternative restriction sites are for example those
from
pBluescript SK- (Stratagene).
The reverse primer contains the complementary sequence to 21 nucleotides prior
to the stop codon, the stop codon itself and restriction cloning sites. If
applicable
Asp718 prior to the start ATG codon and BamHI sites following the stop codon
are used for designed primer synthesis and subsequent directed cloning of PCR
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
products. If desired other sequences can be inherited via the PCR primers or
via
the cloning cassette.
Following PCR using the forward and reverse primers, the resulting fragment is
5 cloned into Asp718BamHI - digested pBSSK (Stratagene, CA, USA). The
nucleotide sequence of the cloned gene is determined to insure that no errors
are
introduced by the PCR reaction.
The plasmid containing the clone sequence is digested with Asp718BamHI. The
resulting fragment containing the cDNA sequence is eluted from an agarose gel
10 and ligated into an Asp718BamHI digested vector. The resulting plasmid
containing the cDNA sequence in the vector is transformed into Agrobacterium
(see example 9). The Agrobacteria are used to transform Arabidopsis thaliana,
rapeseed or linseed plants.
15 Phosphatidate phosphatase (EC 3.1.3.4) catalyzes the hydrolysis of
phosphatidate
to yield sn-1,2-diacylglycerol and inorganic phosphate, a key step in the
formation
of triacyglycerol (TAG). The sn-1,2-diacyglycerol (DAG) is acylated at the sn-
3
position by diacyglycerol acyltransferase ultimately forming TAG.
Methods can be used to measure this enzymatic activity from plant materials.
The
2o characterization of phosphatididate phosphatase (PAP) from plants can be
used to
modify the total fatty acyl composition of trigylcerides and oils according to
the
description of this invention. To modify the lipid content in higher plants
and to
alter plant developmental processes and physiology (e.g. stress tolerance),
PAP
from Physcomitrella patens is expressed in Arabidopsis thaliana, rapeseed,
25 linseed or other crop plants, especially those described in example
description 9.-
11. Enzyme assays are used to determine PAP activity in various tissues of the
control plants and plants transformed with the sense and antisense constructs.
Leaf
lipids are analyzed by gas chromatography, thin layer chromatography (TLC) for
their glycerolipid composition followed by FID detection using a Iatroscan
device
3o (Iatron laboratories, Tokyo, Japan). Seed lipids of the control and
transgenic
plants are examined for alterations in the levels of diacyglycerol,
triacyglycerol,
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
76
or phospholipids. To this end, oil distilled from mature seeds is subjected to
a
digestion by the pancreatic lipase. The pancreatic lipase (Thompson W.
MacDonald G. European Journal of Biochemistry. 65(1):107-11, 1976) cleaves
fatty acids from the sn-l and sn-3 positions but not from the sn-2 position.
Thus,
the fatty acids in the resulting monoglyceride are presumed to be those in the
sn-2
position. The digestion products are chromatographed on TLC plates.
Afterwards,
the chromatographed products are eluted and analyzed as fatty acid methyl
esters.
Furthermore, PAP enzyme activity is measured by following the release of water
soluble 32Pi from chloroform soluble [32P]PA (Cayman GM and Lin YP (1991)
to Methods Enzymol. 197, 548-553). The reaction. mixture contains 50 mM Tris
maleate buffer (pH 6.5), 0.1 mM PA, 1 mM Triton X-100, 2 mM Na2EDTA, 10
mM 2-mercaptoethanol and enzyme in a total volume of 100 ~.1. The enzyme
assays are conducted at 30 °C for 30 min.
Equivalents
Those skilled in the art will recognize, or will be able to ascertain using no
more
than routine experimentation, many equivalents to the specific embodiments of
the invention described herein. Such equivalents are intended to be
encompassed
by the following claims.
CA 02392475 2002-05-23
WO 01/38484 PCT/EP00/11615
77
Legends to the Figurs:
Table 1 A: Proteins and enzymes involved in lipid metabolism and the
accession/entry number of the corresponding partial nucleic acid
molecules.
B: Proteins and enzymes involved in lipid metabolism and clone
entry numbers of the longest nucleic acid clones to coiTesponding
partial nucleic acid clones, as well as clone entry numbers of
additional longest clones which have no corresponding partial
nucleic acid clone. Further, the number of total base pairs and the
starting postion of open reading frames and stop codons of the
longest nucleic acid clone are shown.
Appendix A: Nucleic acid sequences encoding for Lipid Metabolism Related
Proteins (LMRPs)
Appendix B: LMRP polypeptide sequences
