Note: Descriptions are shown in the official language in which they were submitted.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
APPARATUS AND METHODS FOR DRUG SCREENING
Cross-Reference to Related Applications
This application is a continuation-in-part of U.S.S.N. 09/455,950, filed
December 7,
1999, which claims priority to and the benefit of U.S.S.N. 60/152,847, filed
September 8, 1999.
This application also claims priority to and the benefit of U.S.S.N.
60/169,457, filed December
7, 1999. All three of these patent applications are incorporated herein by
reference.
Background of the Invention
Many diseases are associated with genomic instability. That is, a disruption
in genomic
stability, such as a mutation, has been linked to the onset or progression of
certain diseases.
Accordingly, various aspects of genomic instability have been proposed as
reliable markers for
disease. For example, mutations in the BRCA genes have been proposed as
markers for breast
l0 cancer, and mutations in the p53 cell cycle regulator gene have been
associated with numerous
cancers, especially colorectal cancer. It has been suggested that specific
mutations might be a
basis for molecular screening assays for the early stages of certain types of
cancer. See, e.g.,
Sidransky, et al., Science, 256: 102-105 (1992).
The search for genomic disease markers has been especially intense in the area
of cancer
15 detection. Cancer is characterized by uncontrolled cell growth which can be
associated with one
or more genetic mutations. Such mutations can cause the affected cells to
avoid cell death. For
example, a mutation in a tumor suppressor gene can cause cells to avoid
apoptosis - a type of cell
death thought to be under direct genetic control. During apoptosis, cells lose
their membranes,
the cytoplasm condenses, and nuclear chromatin is split into oligonucleotide
fragments of
20 characteristically short length. In fact, those characteristic DNA cleavage
patterns have been
proposed as an assay for apoptosis.
Once these diseases are detected, the question becomes one of providing the
most
effective treatment to a patient. Currently, physicians need effective, simple
strategies to
monitor the efficacy of a drug when administered to a patient. Also, drug
developers need a
25 simple, rapid strategy for rational drug design, particularly one that
provides results that are
predicative of drug activity in vivo.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-2-
Summary of the Invention
The present invention provides screening methods for drug selection and for
determining
drug activity. Methods of the invention take advantage of the recognition that
nucleic acid
integrity observed in a tissue or a body fluid sample is a marker for disease,
and that preservation
of nucleic acid integrity in cellular debris increases with disease severity.
According to methods
of the invention, nucleic acid integrity also is useful as a marker for use in
drug selection and in
determining drug efficacy against a wide range of diseases.
As healthy cells proceed through a normal cell cycle, apoptosis or programmed
cell
death, causes general cellular disruption, including disruption of the cell
membrane and
1o degradation of nucleic acids. This process results in small (about 140 by
to about 200 bp)
nucleic acid fragments. Diseased cells, such as cancer or pre-cancer cells,
lose the ability to
undergo apoptosis, and their nucleic acids are not degraded through apoptosis.
Nonetheless, a
percentage of those cells are sloughed or discarded (e.g., for lack of
nutrients, mechanical
shearing, etc. ), resulting in a population of cells and cellular debris that
contain high integrity
15 nucleic acids as well as high integrity proteins, membranes, and other
cellular components. That
population is subject to lysis and degradation through other mechanisms in the
body, but those
mechanisms are not able to produce consistently small, low integrity fragments
typical of cells
that have undergone apoptosis. It was previously recognized that the presence
of high integrity
cellular components, especially nucleic acids, in a patient sample was a
marker for disease. See,
2o e.g., Co-pending, commonly owned U.S.S.N. 09/455,950, filed December 7,
1999, which is
incorporated by reference herein. It now has been recognized that those same
high integrity
markers are useful to screen drug candidates for efficacy against diseases,
especially cancer and
pre-cancer, and to aid in the identification and selection of drugs for use in
treating disease. A
basis for this recognition is that amounts of high integrity markers fluctuate
with disease status.
25 Thus, the efficacy of a drug candidate with respect to a targeted disease
is measured by the
ability of the drug candidate to reduce disease-associated high integrity
markers, such as nucleic
acids.
Accordingly, the invention provides methods for screening drug candidates for
activity
and efficacy that include determining whether a drug candidate produces a
decrease in an
3o amount of a high integrity component observed in a patient sample.
Preferred high integrity
components are nucleic acids or a proteins. Preferred methods of the invention
are conducted by
obtaining tissue or body fluid sample from a patient having a disease,
determining an amount of
high integrity nucleic acid present in the sample, treating a patient with a
drug candidate, and
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-3-
obtaining a second tissue or body fluid sample to determine whether the amount
of high integrity
nucleic acid has been reduced. The same method can be carried out on an animal
model of a
disease.
Methods of the invention also are performed in vitro or ex vivo. For example,
the
efficacy of a pharmaceutical preparation against disease is measured by its
ability to reduce the
presence of high integrity nucleic acid directly in a tissue or body fluid
sample obtained from a
patient known or suspected to have a target disease or an animal model of a
disease.
Methods of the invention also are useful to monitor a patient's response to
treatment. For
example, the efficacy of a treatment is high if that treatment (e.g.,
administration of a drug
1 o candidate or cocktail of drug candidates) produces a decrease in high
integrity cellular
components observed in post-treatment samples obtained from the patient. As is
apparent to the
skilled artisan, methods of the invention are useful to screen the efficacy of
any treatment means
(e.g., drug(s), radiation, diet, surgery, and/or exercise) and are not limited
to screening for
pharmaceutical activity and efficacy.
15 Methods of the invention are also useful as in vitro or ex vivo drug
candidate screens. In
preferred methods, a tissue or body fluid is obtained from a patient or an
animal model having a
known disease. The sample is screened against one or more candidate drugs by
applying the
candidate to the sample, or a portion thereof, and observing the effect on
nucleic acid integrity in
the sample as compared to a pretreatment standard for the disease in question.
The standard may
2o be a pretreatment measurement of nucleic acid integrity in the sample or an
empirically known
standard (e.g., healthy patients). Screening assays of the invention may be
multiplexed in order
to allow screening of a plurality of intra-patient or inter-patient samples
simultaneously. As
discussed above, the levels of high integrity nucleic acids are indicative of
the disease status of
the tissue or body fluid being measured. Accordingly, a drug candidate that is
capable of
25 reducing nucleic acid integrity in a sample is a potential medicament
effective in treating the
disease. In some embodiments the sample is a disease state cell culture.
Preferred patient samples are preferably prepared from specimens likely to
contain
sloughed cellular debris. Such specimens include, but are not limited to,
stool, blood serum or
plasma, sputum, pus, and colostrum. Additionally, some specimens do not
contain an abundance
30 of intact (non-exfoliated) cells, such as stool, sputum, urine, bile,
pancreatic juice, and blood
serum or plasma, all of which contain shed cells or cellular debris. Other
samples include
cerebrospinal fluid, seminal fluid, breast nipple aspirate, and biopsy tissue,
but any tissue or
body fluid can be used.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-4-
As used herein, the term "high integrity nucleic acid" refers to long segments
of nucleic
acid relative to the length of nucleic acid segments in a normal sample. Those
segments
typically are greater than about 170 bp, and preferably greater than about 200
bp, in order to
exceed the typical length of a fragment resulting from apoptotic degradation.
The term "disease
state sample" as used herein refers to any sample, whether taken directly from
a patient known to
have a particular disease, suspected to have a particular disease, or being
screened for a
particular disease; provided as an animal model or taken from an animal model
of a disease;
grown as a cell culture that has characteristics of a particular disease or
that is diagnostic for or is
used as a diagnostic for a particular disease; or harvested from such a cell
culture. As used
to herein, "drug candidate" means a composition of matter that is being
investigated for a
pharmacological or other activity or that is known to have a pharmacological
or other activity,
but is being tested to see if it has any type of activity in a particular
subject, such as a patient.
Efficacy of a drug candidate is one example of a pharmacological activity.
Moreover, clinical
outcome can be characterized as an activity of a drug candidate.
Nucleic acid is measured by any known means. For example, nucleic acid
integrity is
measured by the ability to amplify long nucleic acids in the sample. Any
nucleic acid locus can
be used as a template in an amplification reaction conducted in a tissue
sample, fluid sample, or
cell culture sample. It is not required that the target genomic loci be
associated with any specific
disease, because an increase or decrease in amplifiable nucleic acid about any
locus is itself
2o diagnostic. If post-treatment amounts of amplification product ("amplicon")
are lower than pre-
treatment amounts, treatment is said to be effective, and the drug candidate
with which the
sample was treated is said to be active. It is preferable that, in the case of
DNA, the
amplification reaction is a polymerase chain reaction ("PCR") or, in the case
of RNA, that the
amplification reaction is reverse transcriptase PCR. Primers are designed to
amplify the locus or
loci chosen for analysis.
In some embodiments, a standard amount of amplification product is determined
by
amplification of a locus, or a portion thereof, being screened in an untreated
disease state sample
or, alternatively, in a known normal sample (e.g., an intact, wild-type
nucleic acid). Also, in
certain embodiments, a standard amount is determined by reference to the art.
Each
amplification reaction in the series is designed to amplify a fragment of a
different length. In
certain embodiments, the target fragment lengths are about 200 bp, about 400
bp, about 800 bp,
about 1.3 Kb, about 1.8 Kb, and about 2.4 Kb. Primers for amplification are
designed according
to knowledge in the art in order to amplify template, if present, of the
desired length at the
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-5-
desired locus. A normal sample, which has undergone or which is undergoing
apoptosis,
typically contains few or no fragments of significant length. Thus, a series
of amplification
reactions targeting fragments from about 200 by to about 2.4 Kb and longer
reveals disease state
samples that contain nucleic acids that have avoided apoptosis as evidenced by
the amplification
of large fragments. As such, the efficacy of a drug candidate being used to
treat a patient can be
assayed by examining the absence or presence of high integrity nucleic acid.
Additionally, in
vitro or ex vivo disease state samples exhibiting these fragments can be
treated with a drug
candidate to assess drug candidate activity. A decrease in the number of
fragments or the level
of fragments present, relative to earlier time course samples or untreated
disease state samples,
1o indicates drug candidate activity. That is the case especially when a large
(e.g., about 1.8 Kb or
about 2.4 Kb) fragment is being screened. Also, the standard amount can be a
molecular weight
marker on, for example, an electrophoretic gel. Alternatively, methods of the
invention can be
carried out by hybrid capture. For example, hybrid capture and subsequent
analysis of the
captured fragments can be used to determine the nucleic acid integrity of a
sample.
In an alternative embodiment, screening of drug candidate activity in disease
state
samples combines detecting amounts of nucleic acid in the sample with an assay
for apoptotic
cell activity. A positive screen is one that produces both: (1) an amount of
nucleic acid that is
less than the amount expected to be present in untreated disease state sample,
and (2) an amount
of apoptotic cell activity that is greater than that expected to be present in
a disease state sample.
2o A plurality of genomic loci can be analyzed to determine an amount of
amplifiable nucleic acid
present at each locus. Analysis across multiple loci using methods of the
invention may increase
the sensitivity of the screening assay.
In one aspect of the invention, a method for screening drug candidate activity
includes
the steps of determining a baseline level of high integrity nucleic acid in a
first sample that is
obtained from a patient having a disease; treating the patient with a drug
candidate; and
determining whether the high integrity nucleic acid in a second sample that is
obtained from the
patient is reduced. Typically, high integrity nucleic acid is more than about
200 by in length.
Preferably, the determining steps include amplifying a target nucleic acid to
determine the
presence of high integrity nucleic acid in the samples. In certain
embodiments, the target nucleic
3o acid is amplified with one forward primer and at least two reverse primers.
In other
embodiments, the target nucleic acid is amplified with at least two pairs of
forward and reverse
primers. Alternatively and/or in addition to amplification, the determining
steps can include
capturing the high integrity nucleic acid. In some embodiments, the high
integrity nucleic acid is
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-6-
captured on a support-based complementary nucleic acid probe. As noted above,
diet, exercise,
and radiation are examples of additional, non-pharmacological treatments that
can be assessed
according to methods of the invention.
Typically, a positive screen is determined by the presence of a lower amount
of high
integrity nucleic acid in the second sample relative to an amount of high
integrity nucleic acid in
the first sample. In some embodiments, a positive screen indicates activity of
the drug candidate.
Also, in some embodiments, a positive screen indicates induction of programmed
cell death.
Also, in some embodiments, a positive screen indicates induction of apoptotic
activity.
Examples of samples include stool, sputum, pus, blood serum, blood plasma,
urine, saliva,
colostrum, bile, and pancreatic juice.
The drug candidate can be any composition of matter, including a nucleic acid,
a peptide,
and a chemical compound. In some circumstances, the drug candidate is a
candidate for an anti-
cancer drug. In many instances, activity of a drug candidate is predictive of
alleviation of
disease symptoms by the drug candidate.
In another aspect of the invention, a kit for screening the activity of a drug
candidate
includes a first primer that is complementary to a first segment of a target
nucleic acid; a second
primer that is complementary to a second segment of the target nucleic acid;
and a third primer
that is complementary to a third segment of the target nucleic. The second
segment is located at
least about 170 base pairs from the first segment and the third segment is
located at least about
170 base pairs from the first segment.
In another aspect of the invention, a method for screening drug candidate
activity
includes the steps of determining a baseline level of high integrity nucleic
acid in a sample from
a subject having a disease; treating the sample with a drug candidate; and
determining whether
high integrity nucleic acid in the sample is reduced. In some embodiments, the
subject is an
animal model of a disease.
In another aspect of the invention, a method for screening drug candidate
activity
includes the steps of determining a baseline level of high integrity nucleic
acid in a sample from
an animal model of a disease; treating the animal model with a drug candidate;
and determining
whether the high integrity nucleic acid in a second sample obtained from the
animal model is
3o reduced.
Other objects and advantages of the invention are apparent upon consideration
of the
following drawings and detailed description thereof.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
_7_
Description of the Drawings
Figures 1 A and B are gel photographs of results of amplification of DNA in
stool from a
total of 30 patients and controls. The band intensity relates to the amount of
amplifiable DNA in
the sample. Lanes N are negative controls, lanes 1, 3, 11, and 18 are results
from patients which
are indicative of the presence off cancer or adenoma, lanes 2, 4, 5-10, 12-17,
and 19-30 are
results from patients which are indicative of the absence of cancer or
adenoma. The remaining
lanes are markers or standards.
Figure 2 shows a schematic representation of the placement of the primers for
amplification in a method of the present invention. In this method, a single
forward primer, F,,
1o is used in conjunction with a series of reverse primers, Ri to R6, chosen
to amplify progressively
longer portions of the target.
Figure 3 shows a schematic representation of the placement of the primers for
amplification in a method of the present invention. In this method, a series
of forward and
reverse primer pairs, (F1 , Ri) to (F3 , R3), are chosen to amplify portions
of the target spaced at
15 intervals along the target.
Detailed Description of the Invention
The invention provides methods and kits for screening drug activity. Methods
of the
invention provide information based upon the integrity of nucleic acids in a
biological sample.
Normal biological samples (those not having indicia of a disease), typically
contain cellular
20 debris that includes a majority of short-fragment, low integrity nucleic
acids (especially DNA)
which are the result of degradation by apoptosis. In a disease state sample,
for example, when a
mutation has caused genomic instability, the normal cell cycle may be
disrupted and apoptotic
degradation of nucleic acid and other cellular components may not occur at the
rate expected in a
normal sample. This situation leads to the presence of high integrity nucleic
acid in the disease
25 state sample. Methods of the invention utilize this realization to screen
for drug activity.
This screen for drug activity and efficacy can be performed by analyzing
samples
containing nucleic acid from a patient under treatment with a drug candidate
at various time
points or by analyzing samples containing nucleic acid from an animal model of
a disease treated
with a drug candidate. Alternatively, this screen can be performed by treating
samples obtained
3o from a patient known or suspected to have a disease, from an animal model
of a disease, or from
a cell culture representing a disease, in vitro or ex vivo, and analyzing the
integrity of nucleic
acid in such samples. Drug candidate activity in such systems, typically,
provides a lead for
rational drug design and/or indicates a likelihood of drug candidate activity
in vivo and/or
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
_g-
indicates a likelihood of alleviating symptoms of a disease in vivo. Various
pharmacological
assays can be adapted to methods of the invention. For example, methods of the
invention can
be used to screen drug candidates on a large scale, used to obtain dose-
response data, used for
kinetic studies, and used to predict and choose the most effective drug
candidate to alleviate a
particular patient's symptoms. A variety of kits can be developed based on
methods of the
invention.
Typically, the nucleic acid being analyzed according to methods of the
invention is
selected from a coding region of a gene, or a portion thereof, a noncoding
nucleic acid region, or
a portion thereof, a regulatory element of a gene, or a portion thereof,
and/or an unidentified
l0 fragment of genomic DNA. In other embodiments, the nucleic acid being
interrogated is RNA.
As is appreciated by the skilled artisan, any genomic locus is amenable to
screening according to
the invention. The particular locus or loci chosen for analysis depends, in
part, on the disease
being screened, the class of drug candidate being screened, and the
convenience of the
investigator.
As described above, it is not necessary that the locus or loci chosen for
analysis be
correlated with any specific disease, because any portion of the genome (even
those unrelated to
disease) may be used in methods of the invention. However, disease-associated
loci (those in
which a mutation is indicative, causative, or otherwise evidence of a disease)
also can be used.
Examples of disease-associated loci include p53, apc, MSH-2, dcc, scr, c-myc,
B-catnenin, mlh-
1, pms-1, pms-2, pol-delta, and bax. In anti-cancer drug candidate screening,
the target fragment
may optionally be an oncogene, a tumor suppressor, or any other marker
associated with cancer.
However, it is not necessary to use cancer-associated markers in methods of
the invention, as
such methods are based on the general recognition that samples indicative of a
disease state
contain a greater amount of intact nucleic acids and a greater amount of long
fragment nucleic
acids (generally, high integrity nucleic acids). Accordingly, any convenient
target nucleic acid
locus may be used in the methods of the invention.
The amount of amplification product may be determined by any suitable or
convenient
means. Typically, the amount of amplification product is determined by gel
electrophoresis.
Labels, such as fluorescent or radioactive labels, may be used. The amounts of
amplification
product produced may be compared to standard amounts by any suitable or
convenient means,
including, but not limited to visual comparison, machine-driven optical
comparison,
densitometry, mass spectroscopy, hybrid capture, and other known means. The
amplification
reaction itself can be any means for amplifying nucleic acid, including, but
not limited to, PCR,
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-9-
RT-PCR, OLA, rolling circle, single base extension, and others known in the
art. The
amplification product can also be measured by signal amplification techniques,
such as branch
chain amplification (Chiron). Methods of the invention are useful with any
platform for the
identification, amplification, sequencing, or other manipulation of nucleic
acids. For example,
methods of the invention can be applied to ligase chain reaction, strand
displacement (Becton-
Dickinson), and others.
Because many embodiments use amplification of target nucleic acid to assay the
level of
high integrity nucleic acid in a given sample, generally, the probability that
any given set of PCR
primers will amplify a DNA fragment having a length exceeding the primer
distance is expressed
1o as
of Fragments Amplified = (FL-PD)/(FL+PD)
where FL is fragment length (in base pairs) and PD is primer distance (in base
pairs). This
equation assumes that sample DNA fragment lengths are uniformly distributed
(i.e., there is no
favored locus at which breaks occur).
15 After treatment of a patient having or suspected of having a disease,
treatment of an
animal model for a disease, or treatment of other disease state samples with a
drug candidate,
nucleic acid sequences of different lengths in a sample are amplified, if
present, in order to
generate a profile of amplification products indicative of activity of the
drug candidate. For
example, a sample is exposed to a set of PCR primers. The primers include a
single forward
2o primer, which may be a capture probe used to capture target fragments, and
a plurality of
downstream reverse primers which hybridize to portions of a contiguous
sequence (if present) in
the sample. Amplifications using these primers will result in a series of
amplification products,
each having a different length, if the contiguous target sequence is present
in the sample. The
length of the amplification products are determined by the spacings between
the forward primer
25 and each of the downstream reverse primers. An example is shown in Figure
2, which is a
schematic representation showing placement of the primers for amplification.
If the target sequence, or a portion of it, is present in the sample,
amplification will result
in a series of fragments the length of which is dictated by the spacing of the
primers. According
to the principles adduced above, a patient, animal model, or other disease
state sample treated
3o with an active drug candidate will produce a profile of amplification
products in the assay
described above that differs from the profile obtained from a disease state
sample of an earlier
time point during treatment or an untreated disease state sample. A difference
that is indicative
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-10-
of drug candidate activity generally is predictive of activity in vivo and/or
the ability to alleviate
symptoms of a disease in vivo. In one embodiment, the forward primer is
designed to hybridize
at least about 170 by upstream, and preferably about 200 bp, upstream of the
first reverse primer,
and about 2.3 Kb upstream of the last reverse primer. Other reverse primers
are designed to
hybridize at various locations between the first and last reverse primers. For
example, intervals
between the forward primer and the various reverse primers can be about 200 by
(F~-R,), about
400 by (F~-R2), about 800 by (F~-R3), about 1.3 Kb, (F,-R4), about 1.8 Kb (F~-
R5), and about 2.3
Kb (F~-R6). In certain embodiments, the forward primer is at least about 170
by upstream from a
first and second reverse primer. The number and spacing of reverse primers is
chosen at the
convenience of the skilled artisan.
In some embodiments, a hybrid capture probe is used to anchor a target
sequence,
preferably on a solid support (e.g., beads). A plurality of probes are then
placed at various
distances downstream of the capture probe. Those probes can be pairs of
forward and reverse
primers as discussed above, or they can be signal amplification probes, such
as those used in
Ligase Chain Reaction (LCR), and others used in the identification of
sequences. The plurality
of probes hybridize along the length of a target fragment if the target is
present in the sample.
Thus, by interrogating samples for the presence of the probes, one can
determine the integrity of
sequences present in the sample. This can be done in numerous ways, including,
but not limited
to, hybrid capture, PCR, LCR, strand displacement, branched chain, or other
assays known in the
art that incorporate hybrid probes or primers in order to identify or
quantitate sequence.
Typically, the capture probe immobilizes a target sequence, if present in the
sample. Probes that
hybridize to sequence downstream of the capture probe (downstream probes) are
placed into
each well, such that each downstream probe is spaced a unique distance apart
from the common
capture probe, and each well contains only one type of downstream probe.
Signal is then
generated by, for example, amplification, or by standard ELISA procedure
followed by
amplification, or by LCR, or other methods mentioned above. The presence of
signal in each
well indicates the presence of sequence of at least the length between the
capture probe and the
downstream probe. In an alternative embodiment, each well receives multiple
different
downstream probes, which may be distinctly labeled, and the presence of
labels) is correlated
3o with the length of sequence presence in the sample.
The amplification reactions described above may be conducted according to any
suitable
or convenient protocol and the fragment size of the resulting amplification
products (if any) may
be determined by any suitable or convenient means.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-11-
In an alternative embodiment, methods of the invention include conducting a
series of
amplification reactions on a contiguous nucleic acid target fragment, each
amplification reaction
includes one forward primer and one reverse primer, such that pairs of forward
and reverse
primers are spaced at intervals on a contiguous fragment suspected to be in
the sample. An
example of this arrangement is shown in Figure 3. Preferably, the spacings
between each
forward and reverse primer pair are equivalent. Also, in some embodiments, the
forward primer
is about 170 by to about 200 by from reverse primer and at least about 170 by
to about 200 by
from a second forward primer. For an untreated disease state sample, the assay
described above
will result in a series of same-size fragments for most if not all of the
primer pairs. Such an array
l0 of amplification products evidences a contiguous target sequence indicative
of disease (see
above). A normal sample should produce little or no amplification product, but
in any case will
not produce the contiguous array of amplification products expected from a
sample containing a
relatively intact diagnostic target sequence. Typically, the more activity a
drug candidate has,
the more like a normal sample the experimental results will appear.
Each of the methods described above are based upon the principle that an
intact nucleic
acid, or a segment of an intact nucleic acid, in a sample is diagnostic. Thus,
variations on the
methods described above are contemplated. Such variations include the
placement of primers,
the number of primers used, the target sequence, the method for identifying
sequences, and
others. For example, in the method depicted in Figure 3, and described above,
it is not necessary
2o that the numbers of forward and reverse primers be equal. A forward primer
may, for example,
be used to amplify fragments between two reverse primers. Other variations in
primer pair
placement are within the skill in the art, as are details of the amplification
reactions to be
conducted. Finally, as represented in Figures 2 and 3, capture probes may be
used in methods of
the invention in order to isolate a chosen target sequence.
In some embodiments, amplification reactions are conducted on a series of
different
genomic loci. Preferably, from about 2 to about 7 loci are used. However, the
precise number of
interrogated loci is determined by the individual investigator based upon the
disease to be
detected, based upon the class of drug candidate to be used, or based upon
convenience.
According to methods of the invention, primers are designed to amplify nucleic
acid, such as
DNA, at each of the chosen loci as described above. A sample from a patient or
animal model
undergoing treatment with a drug candidate or an in vitro or ex vivo disease
state sample, in
which at least one locus, preferably at least two loci, and most preferably at
least three loci
produces) reduced levels of detectable high integrity nucleic acid
amplification product relative
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-12-
to a first sample taken from a patient earlier in the time course of treating
the patient or relative
to an untreated disease state sample, is considered a positive drug candidate
screen.
Additionally, the lengths of fragments to be amplified in this assay may be
varied, but are
preferably at least about 170 by each in length. It is not necessary that the
same length fragments
be amplified at each of the chosen loci, but it is preferred that the same
length fragments be
amplified at each of the chosen loci.
As described more fully below, patients being treated with a drug candidate
can be
followed over time. Samples are taken from a patient before treatment begins,
and at time points
extending over the course of treatment. These samples are analyzed for the
integrity of nucleic
to acid contained within. By monitoring the level of high integrity nucleic
acid, a patient's
treatment progress can be tracked. This information can be useful, for
example, as an early
indication of the efficacy of a particular treatment.
If a treatment is effective, these samples will show declining amounts of high
integrity
nucleic acid. The drug candidate can be administered once, or at intervals,
during the treatment
15 period. In one time course the drug candidate can be examined at 2 hours, 4
hours, 6 hours, and
8 hours after the drug treatment has begun. In a longer term time course study
the drug candidate
can be examined at 48 hours, 1 week, 2 weeks, and 4 weeks after the drug
treatment has begun.
In comparison to earlier time point samples, the total amount of amplified
high integrity nucleic
acid (or amplifiable high integrity nucleic acid) detected in later time point
samples is expected
2o to be lower if the drug candidates are active or effective in a patient.
Conversely, the total
amount of amplified high integrity nucleic acid (or amplifiable high integrity
nucleic acid)
detected in later time point samples is expected to be similar or slightly
lower if the drug
candidates are inactive or ineffective. Alternatively, the pattern of
fragments amplified from
high integrity nucleic acid can be analyzed. Fewer fragments (particularly the
longer fragments)
25 are expected to be present and/or a lesser amount of some or all of the
fragments are expected to
be present in a later time course samples as compared to those present in
earlier time course
samples in a patient being treated with an active or effective drug candidate.
The fragments will
remain the same, increase in number and/or amount (e.g., band intensity), or
will slightly
diminish in number and/or amount in later time course samples as compared with
earlier time
30 course sample in a patient being treated with an inactive or ineffective
drug candidate.
These same principals can be applied to a drug screen using animal models for
a
particular disease state. The integrity of nucleic acid in samples taken from
the animal model
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-13-
being treated with a drug candidate is monitored over time and activity is
assessed as described
above.
Alternatively, methods of the invention for screening drugs, in an in vitro
setting, allow
for one or a multitude of compounds (e.g., simultaneously) to be screened for
activity. A disease
state sample is placed into an experimental container, such as a wells of a
mufti-well sample
plate. The sample is exposed to one or more compounds and analyzed for its
content of high
integrity nucleic acid. In comparison to an untreated disease state sample,
the total amount of
amplified high integrity nucleic acid (or amplifiable high integrity nucleic
acid) is expected to be
lower in samples treated with active drug candidates, and the total amount of
amplified high
integrity nucleic acid (or amplifiable high integrity nucleic acid) will be
similar, increased, or
slightly lower in samples treated with inactive drug candidates.
Alternatively, the pattern of
fragments amplified from high integrity nucleic acid can be analyzed. Fewer
fragments
(particularly the longer fragments) are expected to be present and/or a lesser
amount of some or
all of the fragments are expected to be present in a sample treated with an
active drug candidate
is as compared to those present in an untreated sample. The fragments will
remain the same, will
increase, or will slightly diminish in number or amount (e.g., band intensity)
in samples treated
with an inactive drug candidate.
If a drug candidate is known to be active, or if it is screened and determined
to be active,
a dose-response curve can be generated. By applying increasing dosages of the
drug candidate
to disease state samples, such as, but without limitation, animal models and
tissue cultures, and
analyzing the level of high integrity nucleic acid (amplified or amplifiable)
at each dosage, a
curve can be drawn relating drug candidate dosage to activity (as measured by
the level of high
integrity nucleic acid). These two basic pharmacological techniques are
exemplary, and not
meant to be limiting. However, these techniques do provide a way to rapidly
screen for active
2s drug candidates as well as make a determination of their potency. For
example, but without
limitation, anti-cancer or anti-bowel inflammation drug candidates can be
screened.
Alternatively, the drug activity can be assayed ex vivo. In one embodiment,
tissue or
fluid can be removed from a patient prior to treatment. This sample can be
treated with various
drug candidates that might be expected to alleviate the symptoms of a disease.
Activity is
assayed as described above. A drug candidate showing the most activity for the
sample can be
chosen as a drug candidate that is likely to alleviate symptoms of a disease
in the patient from
which the sample was taken. In another embodiment tissue is removed from an
animal model
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-14-
and is treated with a drug candidate. Activity is assessed as described above
and can be used to
screen drug candidates.
Methods of the invention also can be used to screen or to "qualify" samples
for further
analysis (e.g., genetic, biochemical, cytological, or other analyses). The
sample to be qualified is
examined for the presence of high integrity nucleic acid, and, if present, the
high integrity
nucleic acid indicates that a sample likely can be used as a sample for in
vitro, ex vivo (for
example, when qualifying an animal model) screening, or in vivo animal model
screening. Thus,
disease state samples that provide the basis of drug candidate activity
screening can be chosen
according to this method. Some of the diseases for which samples are
qualified, and for which
1o methods of the invention can detect changes in the integrity of nucleic
acid, include, but are not
limited to, colon cancers and adenomas; lymphomas; and stomach, lung, liver,
pancreas,
prostate, kidney, testicular, bladder, uterus, or ovarian cancers or adenomas.
Additionally,
diseases such as inflammatory bowel syndrome, inflammatory bowel disease,
Crohn's disease,
and others, in which a genomic instability is thought to play a role, can be
examined. Moreover,
the profile of amplifiable DNA in a sample is correlated with proteins that
have been associated
with disease. For example, up regulation of the apoptosis protein, survivin,
is correlated with
increased amounts of amplifiable DNA, as is the Ras oncogene, as well as other
oncogenes and
their gene products.
Methods of the invention also are useful as assays for apoptosis. The presence
of
2o amplified fragments of high integrity nucleic acid or large quantities of
high integrity nucleic
acid in a sample indicates that the sample was derived from cells that did not
proceed through
apoptosis. The absence of such fragments or quantities indicates that cells
that contributed to the
sample underwent apoptosis. Accordingly, an apoptotic activity assay of the
invention, either
alone or in combination with other assays for genomic instability, also are
useful as screens for
disease. Moreover, programmed cell death is measured in a similar way to
apoptotic activity,
with the induction of programmed cell death being correlated with an increase
in apoptotic
activity in many systems.
The following examples provide further details of methods according to the
invention.
Accordingly, while exemplified in the following manner, the invention is not
so limited and the
skilled artisan will appreciate its wide range of application upon
consideration thereof.
Exemplary Method for the Detection of Colon Cancer
The following example relates to screening for colon cancer in voided stool
samples.
Based upon the principles upon which the invention is based (see above), the
same analysis can
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-15-
be performed on other samples, such as those mentioned above, with the same
results as shown
herein.
For the analysis of stool samples, preferred methods of the invention comprise
obtaining
at least a cross-sectional or circumferential portion of a voided stool as
taught in U.S. patent
number 5,741,650, and co-pending, co-owned U.S. patent number 5,952,178, both
of which are
incorporated by reference herein. While a cross-sectional or circumferential
portion of stool is
desirable, methods provided herein are conducted on random samples obtained
from voided
stool, which include smears or scrapings. Once obtained, the stool specimen is
homogenized. A
preferable buffer for homogenization is one that contains at least 16 mM
ethylenediaminetetraacetic acid (EDTA). However, as taught in co-pending, co-
owned U.S.
patent application serial number 09/491,093, incorporated by reference herein,
it has been
discovered that the use of at least 150 mM EDTA greatly improves the yield of
nucleic acid from
stool. Thus, a preferred buffer for stool homogenization includes phosphate
buffered saline, 20-
100 mM NaCI or KCI, at least 150 mM EDTA, and optionally a detergent (such as
SDS) and a
proteinase (e.g., proteinase K).
After homogenization, nucleic acid is preferably isolated from the stool
sample. Isolation
or extraction of nucleic acid is not required in all methods of the invention,
as certain detection
techniques can be adequately performed in homogenized stool without isolation
of nucleic acids.
In a preferred embodiment, however, homogenized stool is spun to create a
supernatant
2o containing nucleic acids, proteins, lipids, and other cellular debris. The
supernatant is treated
with a detergent and proteinase to degrade protein, and the nucleic acid is
phenol-chloroform
extracted. The extracted nucleic acids are then precipitated with alcohol.
Other techniques can
be used to isolate nucleic acid from the sample. Such techniques include
hybrid capture, and
amplification directly from the homogenized stool. Nucleic acids can be
purified and/or isolated
to the extent required by the screening assay to be employed. Total DNA is
isolated using
techniques known in the art.
Screening Assay Protocol
The size of human DNA fragments obtained above can be determined by numerous
means. For example, human DNA can be separated using gel electrophoresis. A 3%
agarose gel
is prepared using techniques known in the art. See Ausubel et al., Short
Protocols in Molecular
Biology, John Wiley & Sons, 1195, pgs. 2-23-2-24, incorporated by reference
herein. The size
of human DNA fragments is then determined by comparison to known standards.
Fragments
greater than about 200 by provide a positive screen. While a diagnosis can be
made on the basis
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-16-
of the screen alone, patients presenting a positive screen are preferably
advised to seek follow-up
testing to render a confirmed diagnosis.
A preferred means for determining human DNA fragment length uses PCR. Methods
for
implementing PCR are well-known. In the present invention, human DNA fragments
are
amplified using human-specific primers. Amplicon of greater than about 200 by
produced by
PCR represents a positive screen. Other amplification reactions and
modifications of PCR, such
as ligase chain reaction, reverse-phase PCR, Q-PCR, and others may be used to
produce
detectable levels of amplicon. Amplicon may be detected by coupling to a
reporter (e.g.,
fluorescence, radioisotopes, and the like), by sequencing, by gel
electrophoresis, by mass
1o spectrometry, or by any other means known in the art, as long as the
length, weight, or other
characteristic of the amplicons identifies them by size.
Examples
Experiments are described below that determine if a drug candidate treatment
is active
and effective by analyzing the integrity of nucleic acid in various samples
taken from patients
15 and animal models of disease. These examples are illustrative of the
invention and are not meant
to be limiting.
EXAMPLE 1
An experiment is conducted to determine treatment outcome over time in cancer
or
adenoma patients. Stool samples are obtained and frozen, and DNA is isolated.
The samples are
20 screened by hybrid capturing human DNA and determining the amount of
amplifiable DNA
having at least 200 base pairs. Each frozen stool specimen, weighing from 7-33
grams, is
thawed and homogenized in 500 mM Tris, 16 mM EDTA, and 10 mM NaCI, pH 9.0 at a
volume
to mass ratio of 3:1. Samples are then rehomogenized in the same buffer to a
final volume to
mass ratio of 20:1 and spun in glass macro beads at 2356 x g. The supernatant
is collected and
25 treated with SDS and proteinase k. The DNA is then phenol-chloroform
extracted and
precipitated with alcohol. The precipitate is suspended in 10 mM Tris and 1 mM
EDTA (1 x
TE), pH 7.4. Finally, the DNA is treated with RNase.
Prior to amplification, DNA is isolated from the samples by hybrid capture.
Biotynilated
probes against portions of the BRCA1, BRCA2, p53, APC genes are used.
3o The BRCA1 probe is
5'GATTCTGAAGAACCAACTTTGTCCTTAACTAGCTCTT3' (SEQ ID NO: 8).
The BRCA2 probe is
5'CTAAGTTTGAATCCATGCTTTGCTCTTCTTGATTATT3' (SEQ ID NO 9).
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-17-
The APC 1 probe is
5'CAGATAGCCCTGGACAAACCATGCCACCAAGCAGAAG3' (SEQ ID NO 10).
The p53 probe, hybridizing to a portion of exon 5, is
5'TACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGG3' (SEQ ID N0:4).
The APC2 probe is
5'GAAGTTCCTGGATTTTCTGTTGCTGGATGGTAGTTGC3' (SEQ ID NO 11).
A 300 ~l aliquot of sample is placed in 300 ~1 of 6 M guanidine isothiocyanate
buffer
with 10 ~1 of each capture probe, and incubated overnight at 25 C. Captured
DNA is isolated
to using 100 ~1 capture beads incubated for one hour at room temperature. The
DNA is eluted off
the beads and PCR amplified under standard PCR conditions.
According to methods of the invention, amplification reactions are conducted
using
forward and reverse primers through the 5 loci for each sample. Forward and
reverse primers are
spaced to amplify fragments of 200 bp, 400 bp, 800 bp, 1.3 Kb, 1.8 Kb, and 2.4
Kb. Each of 30
15 PCR reactions is run for 36 cycles. Amplicon is run on a 3% Seakeam gel,
and stained with
ethidium bromide. The results are shown in Figures 1A and 1B. Each figure
represents the
results for 15 of the 30 patients.
As shown in those figures, patients with cancer or adenoma have an increased
yield of
amplifiable DNA. That is especially true at the 1.8 Kb level and above. Thus,
patients with
20 cancer or adenoma not only produce more amplifiable DNA in their stool, but
also produce
larger DNA fragments than are produced in the stool of patients who do not
have cancer. Thus,
both an increased yield of amplifiable DNA and the presence of high molecular
weight DNA,
especially that at 1.8 Kb and above, are indicative of patient disease status.
Those patients (lanes 1, 3, 11, and 18) that have high integrity nucleic acid
are treated
25 with an anti-cancer drug candidate. The patients are given a dose of the
drug candidate at
intervals dictated by the pharmacokinetics exhibited by the drug candidate
being administered,
and other factors that are known to those skilled in the art. The patients are
treated and
monitored over a period of a month. Samples are taken from each patient for
analysis at 48
hours, 1 week, 2 weeks and 4 weeks. Patients that do not have high integrity
nucleic acid (i.e.,
3o normals) are either excluded from treatment and analysis (for example, in
the case where only
patients that are diagnosed with cancer are treated with a drug candidate
known to have efficacy
as an anti-cancer drug) or are included in subsequent monitoring and given a
placebo treatment
(for example, in a clinical study relating to the efficacy of a drug
candidate). In this example, the
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-18-
patients without high integrity nucleic acid are excluded from treatment, and
the patients having
high integrity nucleic acid are treated.
The hypothetical expected results obtained at the locus interrogated with
BCRAI, for
each of the four patients having high integrity nucleic acid, are presented in
Table 1, below.
Similar hypothetical results are expected at the other loci being
interrogated, because integrity of
nucleic acid is predictive notwithstanding the loci being interrogated.
Table 1. Hypothetical expected results at the BCRAI locus.
Sample taken Sample taken Sample taken Sample taken
at 48 Hours at 1 Week at 2 Weeks at 4 Weeks
Patient 1 Bands greaterBands greaterBands betweenMainly a band
at
than 800 by than 800 by 200 by and 200 by
800
contain less missing by contain
less
nucleic acid nucleic acid
than than
in initial in initial
sam 1e sam 1e
Patient 2 No differenceNo differenceNo differenceNo difference
from initial from initial from initial from initial
sam 1e sam 1e sam 1e sam 1e
Patient 3 Bands greaterBands greaterBands betweenMainly a band
at
than 800 by than 800 by 200 by and 200 by
800
contain less missing by contain
less
nucleic acid nucleic acid
than than
in initial in initial
sample sample
Patient 4 No differenceBands greaterBands greaterBands between
from initial than 800 by than 800 by 200 by and
800
sample contain less contain less by contain
less
nucleic acid nucleic acid nucleic acid
than than than
in initial in initial in initial
sample sample sample
As can be seen in the results above, patients l and 3 responded favorably to
the drug
l0 treatment. By the end of the 4 week monitoring period, these patients have
a profile of nucleic
acid integrity more similar to that of a normal than to an untreated disease
state. During the
monitoring period, bands representing the longest fragments being amplified
were absent first,
followed by bands representing shorter fragments being amplified (but still
greater than 200 bp).
Patient 4 showed some response to the drug treatment, but not as great as that
for patients 1 and
15 3. During the monitoring period of patient 4, the longest fragments were
absent after 2 weeks as
compared to 1 week for patients 1 and 3. The shorter fragments being
amplified, between 200
by and 800 bp, were not absent at the end of the 4 week monitoring period,
but, rather were only
reduced relative to the initial measurement. This result could indicate, for
example, that the
treatment was only partially effective in treating the patient's cancer or
that the treatment takes
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
- 19-
longer to become effective in the patient. Finally, patient 2 showed no
decrease in the amount of
any length fragment, indicating that the drug candidate had no effect on
patient 2.
EXAMPLE 2
Another experiment is conducted to determine treatment outcome over time in
cancer or
adenoma patients utilizing several loci that are different from those used in
Example 1. Stool
samples were collected from 9 patients who presented with symptoms or a
medical history that
indicated that a colonoscopy should be performed. Each stool sample was
frozen. Immediately
after providing a stool sample, each patient was given a colonoscopy in order
to determine the
patient's disease status. Based upon the colonoscopy results, and subsequent
histological
to analysis of biopsy samples taken during colonoscopy, individuals were
placed into one of two
groups: normal or abnormal. The abnormal group consisted of patients with
cancer or with an
adenoma of at least 1 cm in diameter. Based upon these results, 4 of the 9
patients were placed
into the abnormal group. Samples from the abnormal group are analyzed further,
and the
normals are not further amalyzed.
The samples are screened by hybrid capturing human DNA, and determining the
amount
of amplifiable DNA having at least 200 base pairs. Each frozen stool specimen,
weighing from
7-33 grams, is thawed and homogenized in 500 mM Tris, 16 mM EDTA, and 10 mM
NaCI, pH
9.0 at a volume, to mass ratio of 3:1. Samples are then rehomogenized in the
same buffer to a
final volume-to-mass ratio of 20:1, and spun in glass macro beads at 2356 xg.
The supernatant is
2o collected and treated with SDS and proteinase k. The DNA is then phenol-
chloroform extracted
and precipitated with alcohol. The precipitate is suspended in 10 mM Tris and
1 mM EDTA (1 x
TE), pH 7.4. Finally, the DNA is treated with RNase.
Human DNA is isolated from the precipitate by sequence-specific hybrid
capture.
Biotynilated probes against portions of the p53, K-ras, and apc genes are
used.
The K-ras probe was 5'GTGGAGTATTTGATAGTGTATTAACCTTATGTGTGAC 3'
(SEQ ID NO: 1 ).
There were two apc probes: apc-1309 was
5'TTCCAGCAGTGTCACAGCACCCTAGAACCAAATCCAG 3' (SEQ ID NO: 2), and apc-
1378 was 5'CAGATAGCCCTGGACAAACAATGCCACGAAGCAGAAG 3' (SEQ ID NO: 3).
There were four probes against p53, the first (hybridizing to a portion of
exon 5) was
5'TACTCCCCTGCCCTCAACAAGATGTTTTGCCAACTGG3' (SEQ ID N0:4), the second
(hybridizing to a portion of exon 7) was
5'ATTTCTTCCATACTACTACCCATCGACCTCTCATC3' (SEQ ID NO: 5), the third, also
CA 02393864 2002-06-07
WO 01/42503 PCT/L1S00/32387
-20-
hybridizing to a portion of exon 7 was
5'ATGAGGCCAGTGCGCCTTGGGGAGACCTGTGGCAAGC3' (SEQ ID NO: 6); and
finally, a probe against exon 8 had the sequence
5'GAAAGGACAAGGGTGGTTGGGAGTAGATGGAGCCTGG3' (SEQ ID NO: 7).
A 10 ~1 aliquot of each probe (20 pmol/capture) is added to a suspension
containing 300
~1 DNA in the presence of 310 ~16M GITC buffer for 2 hours at room
temperature. Hybrid
complexes are isolated using streptavidin-coated beads (Dynal). After washing,
probe-bead
complexes are suspended at 25° C for 1 hour in O.lx TE buffer, pH7.4.
The suspension is then
heated for 4 minutes at 85° C, and the beads are removed.
1o Captured DNA is then amplified using PCR, essentially as described in U.S.
Patent No.
4,683,202, incorporated by reference herein. Each sample is amplified using
forward and
reverse primers through 7 loci (Kras, exon 1, APC exon 15 (3 separate loci),
p53, exon 5, p53,
exon 7, and p53, exon 8) in duplicate (for a total of 14 amplifications for
each locus). Seven
separate PCRs (40 cycles each) are run in duplicate using primers directed to
detect fragments in
15 the sample having 200 base pairs or more. Amplified DNA is placed on a 4%
Nusieve (FMC
Biochemical) gel (3% Nusieve, 1 % agarose), and stained with ethidium bromide
(0.5 ~g/ml).
The resulting amplified DNA is graded based upon the relative intensity of the
stained gels.
Seven different loci that are amplified. All four abnormal patients have
amplifiable DNA of 200
by or greater in length. The results are the same regardless of which locus
was amplified.
2o The four abnormal patients are then treated with a drug candidate for a
period of four
weeks. As shown in Table 2, below, a similar result to that in Example 1 is
obtained for these
four patients.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-21 -
Table 2. Hypothetical expected results at the K-ras locus.
Sample taken Sample taken Sample taken Sample taken
at 48 Hours at 1 Week at 2 Weeks at 4 Weeks
Patient 1 Bands greaterBands greaterBands betweenMainly a band
at
than 800 by than 800 by 200 by and 200 by
800
contain less missing by contain
less
nucleic acid nucleic acid
than than
in initial in initial
sam 1e sam 1e
Patient 2 No differenceNo differenceNo differenceNo difference
from initial from initial from initial from initial
sam 1e sam 1e sam 1e sam 1e
Patient 3 Bands greaterBands greaterBands betweenMainly a band
at
than 800 by than 800 by 200 by and 200 by
800
contain less missing by contain
less
nucleic acid nucleic acid
than than
in initial in initial
sample sample
Patient 4 No differenceBands greaterBands greaterBands between
from initial than 800 by than 800 by 200 by and
800
sample contain less contain less by contain
less
nucleic acid nucleic acid nucleic acid
than than than
in initial in initial in initial
sam 1e sam 1e sam 1e
EXAMPLE 3
In this example, methods of the invention are used in patients who had a
colorectal
adenoma or colorectal cancer. A stool sample is obtained from each of these
patients and
prepared, as described above. Fragments of the 5 different loci referred to in
Example 1 are
amplified using primers spaced 200, 400, 800, 1300, 1800, and 2400 base pairs
apart using the
protocol described above in Example 1. Each amplification is scored such that
successful
amplification of a fragment receives a score of 1, and no amplification
receives a score of 0.
l0 Because five loci were interrogated using 6 primer pairs each, the maximum
score is 30
(successful amplification of all 6 fragments at all five loci). The cutoff for
a positive screen is
set at 21. The results are shown below. Tables 3 and 4 indicate which patients
are positive for
an adenoma or a carcinoma based upon this scoring system.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-22-
Table 3. Scoring for patients to determine if patients have an adenoma.
Patient A a Score
No.
P-003 29
P-001 23
P-045 22
P-162 21
P-163 16
P-088 15
P-050 13
P-060 11
P-061 11
P1058 10
P-075 10
P-077 8
P-024 7
P-056 7
P-067 7
P-025 6
P-080 4
P-123 4
P-048 3
P-040 2
P-006 1
P-004 0
P-015 0
P-083 0
P-047
P-129
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
- 23 -
Table 4. Scoring for patients to determine if patients have a carcinoma.
Patient A a Score
No.
P-064 30
P-103 30
P-104 30
P-108 30
P-101 29
P-102 29
P-099 28
P-107 28
P-110 26
P-098 25
P-134 24
P-062 23
P-090 23
P-095 23
P-093 22
P-100 21
P-122 18
P-084 15
P-109 15
P-118 10
P-138 10
P-091 8
P-096 8
P-053 7
P-119 6
P-117 5
P-105 0
P-097
Those with a score of 21 or higher are treated with an anti-cancer drug
candidate and
monitored as described for Example 1. The hypothetical expected results of
treatment are
presented in Tables 5 and 6 below.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-24-
Table 5. Hypothetical expected results for patients with an adenoma during
treatment, with
scoring at all five loci.
Score of Score of Score of Score of
Sample Taken Sample Taken Sample Taken Sample Taken
at 48 Hours at 1 Week at 2 Weeks at 4 Weeks
P-003 28 24 20 14
P-001 23 23 23 23
P-045 22 20 14 12
P-162 21 20 18 16
Table 6. Hypothetical expected results for patients with a carcinoma during
treatment, with
scoring at all five loci.
Score of Score of Score of Score of
Sample Taken Sample Taken Sample Taken Sample Taken
at 48 Hours at 1 Week at 2 Weeks at 4 Weeks
P-064 29 27 20 16
P-103 29 28 21 15
P-104 30 27 19 14
P-108 29 29 25 24
P-101 28 22 16 9
P-102 28 25 20 23
P-099 27 23 19 12
P-107 28 28 28 28
P-110 26 25 20 17
P-098 25 20 15 8
P-134 23 19 17 15
P-062 23 21 16 14
P-090 23 20 15 14
P-095 22 21 16 12
P-093 21 19 18 17
P-100 21 21 21 21
The score of the patients, which reflects successful amplification of a
fragment, which, in
turn, reflects the level of high integrity nucleic acid, as described above,
is shown for a time
course of treatment with an anti-cancer drug candidate in Tables 5 and 6.
Because the cut-off for
a positive screen for a diseased patient is set to 21, when the score of a
patient drops below 21,
the drug treatment is considered effective. As shown in Tables 5 and 6, the
length of time it
takes for a score to drop below 21 varies from patient to patient, and the
magnitude of the change
also varies. Some patients do not respond to treatment, as indicated by a
score that does not drop
below 21 or by a score that does not change at all.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
- 25 -
EXAMPLE 4
This example shows how methods of the invention can screen drug candidates for
activity in an animal (non-human) model of a disease ("diseased animal") using
the presence or
absence of amplifiable high integrity nucleic acid as a marker for activity.
Such an experiment
can provide leads for drug development and/or predict which compounds are
likely to be active
in vivo and/or predict which compounds are likely to alleviate symptoms of a
disease in vivo.
An animal model of a disease is used as the test subject, and a normal animal
is used as a
control. Because the assay is to be conducted in triplicate, for each drug
candidate to be tested,
three diseased animals are treated with the drug candidate. As controls, a
diseased animal is
to treated with a sham treatment, such as the carrier in which the drug
candidate is suspended for
administration; a normal animal is treated with the sham treatment; and a
normal animal is
treated with the drug candidate.
The animals are given these treatments periodically over a period of three
weeks. During
the administration period, samples are taken from the animals, the samples are
prepared, and the
samples are analyzed for nucleic acid integrity, as described above. Samples
are taken at a time
before treatment, at 48 hours post-treatment, 1 week post-treatment, 2 weeks
post-treatment, and
3 weeks post-treatment. Analysis is accomplished as described above. Briefly,
DNA is
extracted from these samples. PCR is used to amplify the extracted DNA about a
locus
suspected to be associated with the disease. One forward primer is used with
six reverse primers
. The forward primer is separated from each reverse primer by 200 by (F,-R~),
400 by (F~-RZ),
800 by (F~-R3), 1.3 Kb, (F1-R4), 1.8 Kb (F1-RS), and 2.3 Kb (F,-R6). After
amplification, the
PCR product is run out on a separation gel.
At the endpoint (3 weeks), the untreated diseased animal (sham treatment) is
expected to
show bands for fragments (amplified high integrity nucleic acid) at most, if
not all, of the primer
pairs (200 by (FI-R~), 400 by (F~-R2), 800 by (F,-R3), 1.3 Kb, (F~-R4), 1.8 Kb
(Fl-RS), and 2.3
Kb (F~-R6)). The normal animal treated with the sham treatment is expected to
show very little,
if any, amplified high integrity nucleic acid. Thus, bands corresponding to
fragments of 400 by
(F~-R2), 800 by (F1-R3), 1.3 Kb, (F1-R4), 1.8 Kb (F1-RS), and 2.3 Kb (F~-R6)
are expected to be
substantially absent in the untreated normal sample. More particularly, a very
light band, or no
band at all, is expected for the 200 by fragment (FI-R~), and no other bands,
especially those
corresponding to longer fragments, are expected. A similar pattern is expected
for the normal
animal treated with the drug candidate.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-26-
In this case, the pattern of bands, representing the fragments amplified with
the various
primer pairs, is used as the marker of high integrity nucleic acid, and, thus,
drug candidate
activity. If the drug candidate has activity, the profile of amplified high
integrity nucleic acid
from a treated diseased animal sample will be different from that of the
untreated diseased
animal sample. More particularly, if the drug candidate has an activity, fewer
bands and/or
lighter bands from a treated diseased animal sample will be seen relative to
the untreated
diseased animal sample. The stronger the activity of the drug candidate, the
fewer the bands that
will be seen and/or the lighter the bands that will be seen. It is expected
that the most powerfully
active drug candidates will produce a band pattern similar to that of the
normal animal sample.
to Moreover, during the time course of the experiment, samples taken from the
diseased animal
over the time course will show changes in the number and/or level of intensity
of the bands that
are seen, if the drug candidate is active. Hypothetical expected results are
shown in Table 7,
below.
CA 02393864 2002-06-07
WO 01/42503 PCT/LTS00/32387
-27-
Table 7. Hypothetical expected results at the amplified target.
Sample taken Sample takenSample taken Sample taken
at 48 Hours at 1 Week at 2 Weeks at 3 Weeks
Diseased Bands greaterBands greaterBands betweenMainly a band
at
Animal 1 than 800 by than 800 200 by and 200 by
by 800
contain less missing by contain
less
nucleic acid nucleic acid
than than
in initial in initial
sample sample
Diseased No differenceBands greaterBands greaterBands between
Animal 2 from initial than 800 than 800 by 200 by and
by 800
sample contain lesscontain less by contain
less
nucleic acidnucleic acid nucleic acid
than than than
in initial in initial in initial
sam 1e sam 1e sam 1e
Diseased Bands greaterBands greaterBands betweenMainly a band
at
Animal 3 than 800 by than 800 200 by and 200 by
by 800
contain less missing by contain
less
nucleic acid nucleic acid
than than
in initial in initial
sam 1e sam 1e
Untreated No differenceNo differenceNo differenceNo difference
Diseased from initial from initialfrom initial from initial
Animal sample sample sample sample
(presence (presence (presence (presence
of of of of
high integrityhigh integrityhigh integrityhigh integrity
nucleic acid)nucleic acid)nucleic acid)nucleic acid)
Untreated No differenceNo differenceNo differenceNo difference
Normal Animalfrom initial from initialfrom initial from initial
sample (no sample (no sample (no sample (no
high high high high
integrity integrity integrity integrity
nucleic nucleic nucleic nucleic
acid) acid) acid) acid)
Treated No differenceNo differenceNo differenceNo difference
Normal Animalfrom initial from initialfrom initial from initial
sample (no sample (no sample (no sample (no
high high high high
integrity integrity integrity integrity
nucleic nucleic nucleic nucleic
acid) acid acid) acid)
Drug candidates that are promising can be studied further. For example, the
same
experiment can be run by treating diseased animals with various doses of a
particular drug
candidate, and comparing the pattern of amplified fragments from the treated
diseased animal
samples with an untreated diseased animal sample and with normal animal
samples, as described
above. A dose-response curve can be constructed to represent the effects of
drug candidate
dosage on drug candidate activity.
CA 02393864 2002-06-07
WO 01/42503 PCT/LTS00/32387
-28-
EXAMPLE 5
This example shows how methods of the invention can screen compounds that
induce
apoptotic activity or programmed cell death using the presence or absence of
amplifiable high
integrity nucleic acid as a marker. Essentially, these experiments are carried
out the same way as
in Example 4, and a similar endpoint to that in Example 4 is examined to
determine if an
induction of apoptotic activity or programmed cell death has occurred. If the
compound induces
apoptotic activity and/or programmed cell death, the profile of amplified high
integrity nucleic
acid in a sample from a treated diseased (or normal) animal will be different
from that of the
untreated diseased (or normal) animal sample. If the compound induces
apoptotic activity and/or
to programmed cell death, fewer bands and/or lighter bands will be seen in a
sample from a treated
diseased (or normal) animal relative to the untreated diseased (or normal)
animal sample. The
more induction of apoptotic activity and/or programmed cell death, the fewer
the bands that will
be seen and/or the lighter the bands that will be seen.
EXAMPLE 6
15 This example shows how methods of the invention can screen drug candidates
for
activity in a specimen taken from an animal model (non-human) of a disease
("diseased animal")
using the presence or absence of amplifiable high integrity nucleic acid as a
marker for activity.
Such an experiment can provide leads for drug development and/or predict which
compounds are
likely to be active in vivo and/or predict which compounds are like to
alleviate symptoms of a
20 disease in vivo.
An animal model of a disease is used as the test subject, and a normal animal
is used as a
control. Because the assay is to be conducted in triplicate, for each drug
candidate to be tested, a
tissue specimen from each of three diseased animals is removed and each
specimen is treated
with the drug candidate. As controls, a tissue specimen from a diseased animal
is treated with a
25 sham treatment, such as the carrier in which the drug candidate is
suspended; a tissue specimen
from a normal animal is treated with the sham treatment; and a tissue specimen
from a normal
animal is treated with the drug candidate.
The tissue specimens are cultured and are given these treatments as a bolus
dose and
incubated for 8 hours. During the 8 hour incubation period, samples are taken
from the cultured
3o specimens, the samples are prepared, and the samples are analyzed for
nucleic acid integrity, as
described above. Samples are taken at a time before treatment, at 2 hours post-
treatment, 4 hours
post-treatment, 6 hours post-treatment, and 8 hours post-treatment. Analysis
is accomplished as
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-29-
described above. Briefly, DNA is extracted from these samples. PCR is used to
amplify the
extracted DNA about a locus suspected to be associated with the disease. One
forward primer is
used with six reverse primers . The forward primer is separated from each
reverse primer by 200
by (F1-R,), 400 by (F1-R2), 800 by (F1-R3), 1.3 Kb, (FI-R4), 1.8 Kb (F~-RS),
and 2.3 Kb (F,-R6).
After amplification, the PCR product is run out on a separation gel.
At the endpoint (8 hours), samples from the untreated tissue specimen from the
diseased
animal (sham treatment) are expected to show bands for fragments (amplified
high integrity
nucleic acid) at most, if not all, of the primer pairs (200 by (Fl-R~), 400 by
(F1-R2), 800 by (F~-
R3), 1.3 Kb, (F1-R4), 1.8 Kb (F1-RS), and 2.3 Kb (F1-R6)). Samples from the
tissue specimen,
1 o that are treated with the sham treatment, taken from the normal animal are
expected to show very
little, if any, amplified high integrity nucleic acid. Thus, bands
corresponding to fragments of
400 by (F~-R2), 800 by (F,-R3), 1.3 Kb, (F,-R4), 1.8 Kb (F,-RS), and 2.3 Kb
(F~-R6) are expected
to be substantially absent in samples from the untreated tissue specimen taken
from the normal
animal. More particularly, a very light band, or no band at all, is expected
for the 200 by
fragment (F1-R1), and no other bands, especially those corresponding to longer
fragments, are
expected. A similar pattern is expected for samples from the tissue specimen
treated with the
drug candidate from the normal animal.
In this case, the pattern of bands, representing the fragments amplified with
the various
primer pairs, is used as the marker of high integrity nucleic acid, and, thus,
drug candidate
2o activity. If the drug candidate has activity, the profile of amplified high
integrity nucleic acid
obtained from samples taken from treated tissue specimens of the diseased
animal will be
different from that of samples from the untreated tissue specimen from the
diseased animal.
More particularly, if the drug candidate has an activity, fewer bands and/or
lighter bands will be
seen in samples taken from treated tissue specimens from diseased animals
relative to samples
from the untreated tissue specimen from the diseased animal. The stronger the
activity of the
drug candidate, the fewer the bands that will be seen and/or the lighter the
bands that will be
seen. It is expected that the most powerfully active drug candidates will
produce a band pattern
similar to that of samples from the tissue specimen taken from the normal
animal. Moreover,
during the time course of the experiment, samples taken from the treated
tissue specimen of the
diseased animal over the time course will show changes in the number and/or
level of intensity
of the bands that are seen, if the drug candidate is active. These expected
results are shown in
Table 8, below.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
-30-
Table 8. Hypothetical expected results at the amplified target.
Sample TakenSample Taken Sample Taken Sample Taken
at 2 Hours at 4 Hours at 6 Hours at 8 hours
Tissue Bands greaterBands greaterBands betweenMainly a band
at
Specimen 1 than 800 than 800 by 200 by and 200 by
by 800
from Diseasedcontain lessmissing by contain
less
Animal 1 nucleic acid nucleic acid
than than
in initial in initial
sam 1e sam 1e
Tissue No differenceBands greaterBands greaterBands between
Specimen 2 from initialthan 800 by than 800 by 200 by and
800
from Diseasedsample contain less contain less by contain
less
Animal 2 (presence nucleic acid nucleic acid nucleic acid
of than than than
high integrityin initial in initial in initial
sample sample sample
nucleic)
Tissue Bands greaterBands greaterBands betweenMainly a band
at
Specimen 3 than 800 than 800 by 200 by and 200 by
by 800
from Diseasedcontain lessmissing by contain
less
Animal 3 nucleic acid nucleic acid
than than
in initial in initial
sample sample
Untreated No differenceNo differenceNo differenceNo difference
Tissue from initialfrom initial from initial from initial
Specimen fromsample sample sample sample
Diseased (presence (presence (presence (presence
of of of of
Animal high integrityhigh integrityhigh integrityhigh integrity
nucleic acid)nucleic acid)nucleic acid)nucleic acid)
Untreated No differenceNo differenceNo differenceNo difference
Tissue from initialfrom initial from initial from initial
Specimen fromsample (no sample (no sample (no sample (no
high high high high
Normal Animalintegrity integrity integrity integrity
nucleic nucleic nucleic nucleic
acid) acid) acid) acid)
Treated TissueNo differenceNo differenceNo differenceNo difference
Specimen fromfrom initialfrom initial from initial from initial
Normal Animalsample (no sample (no sample (no sample (no
high high high high
integrity integrity integrity integrity
nucleic nucleic nucleic nucleic
acid) acid) acid acid)
Drug candidates that are promising can be studied further. For example, the
same
experiment can be run by treating tissue specimens from diseased animals with
various doses of
a particular drug candidate, and comparing the pattern of amplified fragments
in samples taken
from these treated tissue specimens with the pattern obtained from samples
taken from tissue
specimens from untreated diseased animals and with normal animals, as
described above. A
dose-response curve can be constructed to represent the effects of drug
candidate dosage on drug
candidate activity.
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
1
SEQUENCE LISTING
<110> Shuber, Anthony
<120> Apparatus and Methods for Drug Screening
<130> EXT-042PC
<150> US 60/169,457
<151> 1999-12-07
<160> 11
<170> PatentIn version 3.0
<210> 1
<211> 37
<212> DNA
<213> Artificial
<220>
<223> K-ras probe
<400> 1
gtggagtatt tgatagtgta ttaaccttat gtgtgac 37
<210> 2
<211> 37
<212> DNA
<213> Artificial
<220>
<223> APC-1309
<400> 2
ttccagcagt gtcacagcac cctagaacca aatccag 37
<210> 3
<211> 37
<212> DNA
<213> Artificial
<220>
<223> APC-1378
<400> 3
cagatagccc tggacaaaca atgccacgaa gcagaag 37
<210> 4
<211> 37
<212> DNA
<213> Artificial
<220>
<223> p53 probe
<400> 4
tactcccctg ccctcaacaa gatgttttgc caactgg 37
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
2
<210> 5
<211> 35
<212> DNA
<213> Artificial
<220>
<223> p53 probe
<400> 5
atttcttcca tactactacc catcgacctc tcatc 35
<210> 6
<211> 37
<212> DNA
<213> Artificial
<220>
<223> p53 probe
<400> 6
atgaggccag tgcgccttgg ggagacctgt ggcaagc 37
<210> 7
<211> 37
<212> DNA
<213> Artificial
<220>
<223> p53 probe
<400> 7
gaaaggacaa gggtggttgg gagtagatgg agcctgg 37
<210> 8
<211> 37
<212> DNA
<213> Artificial
<220>
<223> BRCA1 probe
<400> 8
gattctgaag aaccaacttt gtccttaact agctctt 37
<210> 9
<211> 37
<212> DNA
<213> Artificial
<220>
<223> BRCA2 probe
<400> 9
ctaagtttga atccatgctt tgctcttctt gattatt 37
CA 02393864 2002-06-07
WO 01/42503 PCT/US00/32387
3
<210> to
<211> 37
<212> DNA
<213> Artificial
<220>
<223> APC1
<400> 10
cagatagccc tggacaaacc atgccaccaa gcagaag 37
<210> 11
<211> 37
<212> DNA
<213> Artificial
<220>
<223> APC2
<400> 11
gaagttcctg gattttctgt tgctggatgg tagttgc 37
