Note: Descriptions are shown in the official language in which they were submitted.
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
~~ TTENANT LES PAGES 1 A 303
NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 303
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
BIALLELIC MARKERS DERIVED FROM GENOMIC REGIONS CARRYING GENES
INVOLVED IN CENTRAL NERVOUS SYSTEM DISORDERS
FIELD OF THE INVENTION
The present invention is in the held of pharmacogenomics, and is primarily
directed to
biallelic markers that are located in or in the vicinity of genes that play a
role in disorders of the
brain and nervous system and to the uses of these markers. The present
invention encompasses
methods of establishing associations between these markers and central nervous
system (CNS)
disorders such as psychiatric disorders and neurodegenerative diseases as well
as associations
between these markers and treatment response to a variety of therapeutic
agents. The present
invention also provides means to determine the genetic predisposition of
individuals to such
diseases and means to predict responses to such drugs.
BACKGROUND OF THE INVENTION
Advances in the technological armamentarium available to basic and clinical
investigators have enabled increasingly sophisticated studies of brain and
nervous system
function in health and disease. Numerous hypotheses both neurobiological and
pharmacological
have been advanced with respect to the neurochemical and genetic mechanisms
involved in
central nervous system (CNS) disorders, including psychiatric disorders and
neurodegenerative
diseases. However, CNS disorders have complex and poorly understood
etiologies, as well as
symptoms that are overlapping, poorly characterized, and difficult to measure.
As a result future
treatment regimes and drug development efforts will be required to be more
sophisticated and
focused on multigenic causes, and will need new assays to segment disease
populations, and
provide more accurate diagnostic and prognostic information on patients
suffering from CNS
disorders.
A, Neurological Basis of CNS Disorders
Neurotransmitters serve as signal transmitters throughout the body; therefore,
diseases
that affect neurotransmission can have serious consequences. Far example, for
over 30 years the
leading theory to explain the biological basis of many psychiatric disorders
such as depression
has been the monoamine hypothesis. This hypothesis proposes that depression is
partially due to
a deficiency in one of the three major biogenic monoamines, namely dopamine,
norepinephrine
and serotonin, However, this hypothesis has been replaced by one that takes
into account the
overall function of the brain and no longer only considers a single neuronal
system.
Dopamine
Dopamine is synthesized via the hydroxylation of tyrosine to
dihydroxyphenylalanine
(DOPA), involving the enzyme tyrosine hydroxylase (TH) and catechol O-methyl
transferase
(see Table 2: TH and COMT). Tyrosine hydroxylase is the rate-limiting enzyme
in the synthesis
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
of catecholamines such as dopamine and norepinephrine. Dopamine and the
enzymes involved
in its biosynthesis and degradation are known to be involved in the
pathophysiology of a
depression, schizophrenia and Parkinson's disease. For example, it is believed
tyrosine
hydroxylase may be involved in the pathophysiology of psychiatric disorders
and positive
associations have been reported for tyrosine hydroxylase gene markers in mood
disorders.
However, a recent study Was unable to conclude tyrosine hydroxylase variants
are related with
depressive symptomatology in subjects affected by mood disorder (Serretti A.
et al.; American
Journal ofMedical Genetics 81(2):127-130, 1998).
Dopamine, released from the nerve terminals, is largely recaptured by a re-
uptake
mechanism involving dopamine transporter (DAT) (see Table 2: DAT). Following
re-uptake,
dopamine is metabolized by monoamine oxidases A and B (MAOA/B) (see Table 2:
MAOA and
MAOB). Monoamine oxidase A and B are critical enzymes in deamination of
biogenic amines
and may be involved in the pathophysiology of rnaj or psychoses, including
mood disorder,
Parkinson's disease and schizophrenia. Recently, evidence for genetic
association between the
MAOA gene and bipolar mood disorder was demonstrated in a Caucasian
population, but not
seen in a Japanese population (Sasaki T. et al.; Biological Psychiatry
44(9):922-924, 1998).
Receptors for dopamine regulate dopaminergic neurotransmission. A plethora of
dopamine receptors exist, including the presynaptic dopamine transporter and
at least five
pharmacologic subtypes (Dl -which is linked to the enzyme adenyl cyclase, DZ -
not linked to
adenyl cyclase, D3, D4, and DS). Classically, the most extensively
investigated dopamine
receptor is the DZ receptor, as it is stimulated by dopaminergic agonists for
the treatment of
Parkinson's disease and blocked by dopamine antagonist neuroleptics for the
treatment of
schizophrenia (see Table 2: DRD2). Recently, other dopamine receptors,
particularly the D~
receptor, have become targets for new antipsychotics in the treatment of
Parkinson's disease (see
Table 2: DRD4). It appears the interaction of all or some of the dopamine
receptors play a role
in many CNS disorders. However, only a limited number of studies investigating
the association
of such disorders with genes of the dopaminergic pathway have been completed
and often with
conflicting results.
Norepinephrine
The noradrenergic system is known to play a large role in the determination of
mood,
dysfunction of contributes to the "functional" disorders of depression, mania
and anxiety. It is
believed depressed patients are unable to produce sufficient norepinephrine in
some parts of the
brain for neuronal transmission, while mania may result from excessive
activity or sensitivity of
this system.
The amino acid tyrosine, having been actively taken up by adrenergic neurons,
is
converted to DOPA by means of tyrosine hydroxylase. DOPA is then converted to
dopamine
and later into norepinephrine in the synaptic vesicles. Conversion of
norepinephrine to
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
epinephrine occurs in the adrenal medulla and also in certain restricted parts
of the brain.
Catecholamine degradation is enzymatically controlled by MAOAIB
intraneuronally, with the
main norepinephrine metabolite being 3-methoxy-4-hydroxyphenylglycol.
The noradrenergic neuron is regulated by a multiplicity of receptors and for
norepinephrine, these being designated a~, ocz, ail and (32. Postsynaptic
norepinephrine receptors
bind norepinephrine released from the presynaptic neuron and activate a
molecular cascade in the
postsynaptic neuron. Specifically, the activation of a2 receptors causes
inhibition of
norepinephrine, whereas activation of (31 receptors leads to increased release
of norepinephrine
from adrenergic terminals (see Table 2: ADRB1R). Systemically, the
adrenoreceptor subtypes
ocl, a2, (31 and (32 are functional in a variety of other ways ranging from
vasodilatation to
initiating smooth muscle relaxation. The action of norepinephrine is
terminated by the
norepinephrine transporter (NET), a membrane protein that serves as a reuptake
pump for
synaptic norepinephrine (see Table 2: NET). These receptors and transporter
are the target of
many therapeutic agents currently used to treat psychiatric disorders
particularly depression.
Serotonin~5-hydroxytryptamine, SHT~
The serotoninergic system is an anatomically diverse system with pathways that
follow
closely those of the noradrenergic system, but are quite different from those
of the dopaminergic
distribution. The physiological functions in which the serotoninergic system
is involved include
sleep, appetite, nociception, diurnal rhythmicity, neuroendocrine regulation
and mood. At the
level of consciousness there is also the suggestion that rational thought
processes arise, using
previously stored information, with the aid of the serotoninergic system.
Serotoninergic
projections innervating the hypothalamus influence the secretion of several
anterior pituitary
hormones. There is evidence that serotonin may serve as the final common
pathway by which
other neurotransmitters act in controlling secretion of many hormones.
Tryptophan is taken up by active transport into the neurons where it is
hydroxylated by
tryptophan hydroxylase to 5-hydroxytryptophan (SHTP). The latter is then
decarboxylated to
serotonin which, following release from the neurons, is recovered by a re-
uptake mechanism:
Degradation of serotonin occurs by way of MAOAB and the majority of the
metabolites are
excreted in the urine.
Serotonin receptors come in 13 or more subtypes that can vary in their
sensitivity to
serotonin and in the effects they produce. An increasingly complex series of
serotonin receptors
is being identified. Presynaptic serotonin uptake sites and serotonin
receptors designated SHTI
(and further subdivided into SHT,a, SHT,b, SHT,~), SHT2, SHT3, SHT4, and SHT6,
have been
identified by means of pharmacological studies (see Table 2: SHTT, SHT1A,
SHTR2C, SHTR6,
and 5HTR7). As a whole, communication between two neurons is complex and may
be
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
mediated by more than one neurotransmitter; for example, the serotonergic
system may co-exist
with other neurotransmitter in the same synapses.
Gamma aminobutyric acid (GABA)
Gamma aminobutyric acid (GABA) is an important amino acid which functions as
the
most prevalent inhibitory neurotransmitter in the central nervous system.
Gamma aminobutyric
acid works in partnership with a derivative of Vitamin B-6, pyridoxine, to
cross from the axons
to the dendrites through the synaptic cleft, in response to an electrical
signal in the neuron and
inhibits message transmission. This helps control the nerve cells from firing
too fast, which
would overload the system.
The gamma aminobutyric acid (a) receptor (see Table 2: GABRAS and GABRG2)
appears to play a key role in modulating anxiety and could be involved in
either the etiology or
the pathogenesis of anxiety disorders (Crowe et al. Arn JPsyclZiatry 154:8). A
benzodiazepine
binding site is located on this receptor, and ligands that bind to this site
can either increase or .
decrease anxiety.
Growth associated protein ~GAP43)
Growth associated protein (GAP43) is localized exclusively to nerve tissue and
is known
to play a role in synaptic transmission and membrane permeability. The
expression of GAP43 is
associated with mammalian peripheral nerve regeneration (Kosik et al. Neuron
1:127-132,
1988). A polymorphism in the 3'-untranslated region of GAP43 is found at
slightly lower
frequencies in Alzheimers and Parkinson's patients (Poduslo. Hufn Genet.
92:635-636, 1993).
Subreceptor Activity
The activity of subreceptors has also been investigated in recent years for
its role in a .
wide range of CNS disorders. When neurotransmitters bind to receptors on the
membranes of
postsynaptic neurons, they elicit a target response in the cell via a second
or third messenger
Several different messenger chemicals are known including cyclic adenosine
monophosphate
(AMP). G proteins serve as signal transduction subunits in the cyclic AMP
pathway (see Table
2: Gbeta3). G protein coupled receptors are thought to have seven membrane
spanning domains
and have been divided into 2 subclasses: those in which the binding site is in
the extracellular
domain for example receptors for glycoprotein hormones, such as thyroid
stimulating hormone
(TSH) and follicle stimulating hormone (FSH) and those in which the ligand
binding site is likely
to be in the plane of the 7 transmembrane domains for example rhodopsin and
receptors for small
neurotransmitters and hormones for example muscarinic acetylcholine receptor.
However,
orphan G-protein coupled receptor (see Table 2: HM77) does not contain N-
linked glycosylation .
sites near the N-terminus like other members of this protein family. .
There is evidence that various monoamine or monoaminergic receptors are able
to alter
cyclic AMP levels through the same G protein. Therefore, G proteins serve as
an important
cross-talk mechanism between transmitter systems in the CNS. An abnormality in
a G protein or
4
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
in the responsiveness of cyclic AMP to any of the receptors may result in an
alteration in
monoaminergic neurotransmission. For example, guanine nucleotide binding
protein olfactory
type (see Table 2: GOLF) is believed to play a role in signaling involving the
cAMP mediated
signaling pathway as well as the norepinephrine pathway.
B. Endocrine Basis of CNS Disorders
Biological theories of many CNS disorders have long revolved around the main
monoamine systems, namely dopamine, norepinephrine and serotonin. It is
apparent, however,
that these three systems do not completely explain the pathophysiology of many
CNS disorders.
The hypothalamic-pituitary-adrenal (HPA) axis, including the effects of
corticotrophin-releasing
factor and glucocorticoids, plays an important role in the pathophysiology of
CNS disorders.
The hypothalamus lies at the top of the hierarchy regulating hormone secretion
via the
hypothalamus-pituitary-adrenal (HPA) axis. It manufactures and releases
peptides that act on the
pituitary, thus stimulating or inhibiting the pituitary's release of various
hormones into the blood.
These hormones, among them growth hormone, thyroid-stimulating hormone and
adrenocorticotrophic hormone (ACTH), control the release of other hormones
from target glands.
In addition to functioning outside the nervous system, the hormones released
in response to
pituitary hormones feed back to the pituitary and hypothalamus. There they
deliver inhibitory
signals that serve to limit excess hormone biosynthesis. .
Also included in the regulation of the HPA axis is vasopressin receptor 1A
(see Table 2:
AVPR1A). Vasopressin receptors are present in a number of tissues including
the anterior
pituitary, where they stimulate adrenocorticotrophic hormone (ACTH) release
(Thibonnier et al.
Genomics 31: 327-334, 1996).
Dysregulation of the HPA axis appears to be an important feature of many
psychiatric .
disorders and neurodegenerative diseases. When a threat to physical or
psychological well-being
is detected, the hypothalamus amplifies production of corticotrophin-releasing
factor (CRF),
which induces the pituitary to secrete ACTH (see Table 2: CRF, CRHBP, CRFR1
and CRFR2).
ACTH then instructs the adrenal glands to release cortisol. Therefore, it is
believed chronic
activation of the HPA axis may lay the ground for illness.
The increased HPA drive is primarily mediated by hypersecretion of
corticotrophin-
releasing factor. Patients with major depression show increased levels of
lumbar cerebrospinal
fluid (CSF) corticotrophin-releasing factor as compared to matched controls or
patients with
other neurologic illnesses (Plotsky, P.M., Psych. Clin. Of North Atyz., 21
(2):293-307, 1998).
Dysregulation of hypothalamic corticotrophin-releasing factor neurons, Whether
intrinsic or
extrinsic to these neurons, can result in corticotrophin-releasing factor
hypersectretion leading to
elevations in cortisol followed by adaptive down regulation of both pituitary
and central
glucocorticoid receptors and corticotrophic-releasing receptors.
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
The anxiolytic effects of corticotrophin-releasing factor appear to be
mediated by the
activation of the central noradrenergic system. A CRF-positive projection has
been identified
linking limbic structures to the noradrenergic locus ceruleus, stimulation of
which plays an
important role in emotional memory and increases tyrosine hydroxylase
activity. Therefore,
primary or secondary dysfunction of corticotrophin-releasing factor would be
expected to initiate
a cascade of maladaptations.
Glucocorticoids and mineralocorticoids are both classes of steroid hormones
that play an
important role in the HPA axis; and have therefore been implicated in the
pathophysiology of
various psychiatric disorders and neurodegenerative diseases (see Table 2: GRL
and MLR).
Glucocorticoids exert numerous effects on metabolism, reproduction,
inflammation and
immunity. In addition, glucocorticoids serve as the primary negative feedback
mechanism that
regulates the HPA axis. Mineralocorticoids maintain electrolyte balance by
regulating salt and
water retention in the kidneys.
Brain-derived neurotrophic factor (see Table 2: BDNF) is a member of a group
of
proteins that includes neurotrophin-31415 and nerve growth factor (NGF) and
are believed to play
a role in the etiology of a number of CNS-related disorders including
schizophrenia and
Parkinson's disease (Hawi et al. Psychiatry Research 81: 111-116, 1998 and
Gasser et al. Annals
ofNeurology 36(3)387-396, 1994). BDNF plays an important role in promoting
growth and
maintenance during normal development and differentiation of the vertebrate
system (Hanson et
al. Genornics 13: 1331-1333, 1992). Further, it is believed BDNF has an effect
on the
differentiation of dopaminergic and serotonergic neurons (Studer et al. Euro.
J. of Neuroscience
7: 223-233, 1995).
C. Examples of CNS Disorders
Neurotransmitter and hormonal abnormalities are implicated in disorders of
movement
(e.g. Parkinson's disease, Huntington's disease, motor neuron disease, etc.),
disorders of mood
(e.g. unipolar depression, bipolar disorder, anxiety, etc.) and diseases
involving the intellect (e.g.
Alzheimer's disease, Lewy body dementia, schizophrenia, etc.), In addition,
Neurotransmitter and
hormonal abnormalities have been implicated in a wide range of disorders, such
as coma, head
injury, cerebral infarction, epilepsy, alcoholism and the mental retardation
statesvof metabolic
origin seen particularly in childhood.
Schizophrenia
In developed countries schizophrenia occurs in approximately one per cent of
the adult
population at some point during their lives. There are an estimated 45 million
people with
schizophrenia in the world, with more than 33 million of them in the
developing countries.
Moreover, schizophrenia accounts for a fourth of all mental health costs and
takes up one in three
psychiatric hospital beds. Most schizophrenia patients are never able to work.
The cost of
schizophrenia to society is enormous. In the United States, for example, the
direct cost of
6
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
treatment of schizophrenia has been estimated to be close to 0.5% of the gross
national product.
Standardized mortality ratios (SMRs) for schizophrenic patients are estimated
to be two to four
times higher than the general population and their life expectancy overall is
20 % shorter than for
the general population.
The most common cause of death among schizophrenic patients is suicide (in 10%
of
patients) which represents a 20 times higher risk than for the general
population. Deaths from
heart disease and from diseases of the respiratory and digestive system are
also increased among
schizophrenic patients.
Schizophrenia comprises a group of psychoses with either'positive'
or'negative'
symptoms. Positive symptoms consist of hallucinations, delusions and disorders
of thought;
negative symptoms include emotional flattening, lack of volition and a
decrease in motor
activity.
A number of biochemical abnormalities have been identified and, in
consequence,
several neurotransmitter-based hypotheses have been advanced over xecent
years; the most
popular one has been "the dopamine hypothesis," one variant of which states
that there is over-
activity of the mesolimbic dopamine pathways at the level of the Dz receptor.
However,
researchers have been unable to consistently find an association between
various receptors of the
dopaminergic system and schizophrenia.
In addition to the hypotheses which are briefly presented here, and which
attempt to
draw together the neurochemical observations in schizophrenia, one should add
that some
abnormalities of cortical neuropeptides are well documented. These
abnormalities include
changes in the levels of somatostatin, substance P, cholecystokinin (CCK) and
vasoactive
intestinal peptide (VIP) found in association with negative symptom defect
states in the temporal
area of the brain (i.e. the hippocampus, amygdala and neocortex), in
particular. '
Bipolar Disorder
Bipolar disorders are relatively common, occurnng in about 1.3% of the
population, and '
have been reported to constitute about half of the mood disorders seen in
psychiatric clinics.
Bipolar disorders have been found to vary with gender depending of the type of
disorder; for
example, bipolar disorder I is found equally among men and women, while
bipolar disorder II is
reportedly more common in women. The age of onset of bipolar disorders is
typically in the
teenage years and diagnosis is typically made in the patient's early twenties.
Bipolar disorders
also occur among the elderly, generally as a result of a neurological disorder
or other medical
conditions. In addition to the severe effects on patients' social development,
suicide completion
rates among bipolar patients are reported to be about 15%.
Bipolar disorders are characterized by phases of excitement and depression;
the
excitement phases (mania) and depressive phases can alternate or occur in
numerous admixtures
with varying degrees of severity and duration. Because bipolar disorders can
exist in different
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
forms and display different symptoms, the classification ofbipolar disorder
has been the subject
of extensive studies resulting in the definition of bipolar disorder subtypes
and widening of the
overall concept to include patients previously thought to be suffering from
different disorders.
Bipolar disorders often share certain clinical signs, symptoms, treatments and
neurobiological
features with psychotic illnesses in general and therefore present a challenge
to the psychiatrist to
make an accurate diagnosis. Furthermore, because the course of bipolar
disorders and various
mood and psychotic disorders can differ greatly, it is critical to
characterize the illness as early as
possible in order to offer means to manage the illness over a long term.
Diagnosis of bipolar disorder can be very challenging. One particularly
troublesome
difficulty is that some patients exhibit mixed states, simultaneously manic
and dysphoric or
depressive, but do not fall into the DSM-IV classification because not all
required criteria for
mania and major depression are met daily for at least one week. Other
difficulties include
classification of patients in the DSM-IV groups based on duration of phase
since patients often
cycle between excited and depressive episodes at different rates. In
particular, it is reported that
the use of antidepressants may alter the course of the disease for the worse
by causing "rapid-
cycling". Also making diagnosis more difficult is the fact that bipolar
patients, particularly at
what is known as Stage III mania, share symptoms of disorganized thinking and
behavior with
bipolar disorder patients. Furthermore, psychiatrists must distinguish between
agitated
depression and mixed mania; it is common that patients with major depression
exhibit agitation,
resulting in bipolar-like features.
For both schizophrenia and bipolar disorder, all the known molecules used for
treatment
have side effects and act only against the symptoms of the disease. There is a
strong need for
new molecules without associated side effects or reduced side effects which
are directed against
targets that are involved in the causal mechanisms of schizophrenia and
bipolar disorder.
Therefore, tools facilitating the discovery and characterization of these
targets are necessary and
useful.
The aggregation of schizophrenia and bipolar disorder in families, the
evidence from
twin and adoption studies, and the lack of variation in incidence worldwide,
indicate that
schizophrenia and bipolar disorder are primarily genetic conditions, although
environmental risk
factors are also involved at some level as necessary, sufficient, or
interactive causes. For
example, schizophrenia occurs in 1% of the general population. However, if a
subject has one
grandparent with schizophrenia, the risk of getting the illness increases to
about 3%, while one
parent with Schizophrenia increases risk to about 10%. When both parents have
schizophrenia,
the risk rises to approximately 40%. Consequently, there is a strong need to
identify genes
involved in schizophrenia and bipolar disorder. The knowledge of these genes
will allow
researchers to understand the etiology of schizophrenia and bipolar disorder
and could lead to
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
drugs and medications which are directed against the cause of the diseases,
not just against their
symptoms.
There is also a great need for new methods to detect susceptibility to
schizophrenia and
bipolar disorder, as well as for preventing or following up the development of
the disease.
Diagnostic tools could also prove extremely useful. Indeed, early
identification of subjects at
risk of developing schizophrenia would enable early and/or prophylactic
treatment to be
administered. Moreover, accurate assessments of the eventual efficacy of a
medicament as well
as the patent's eventual tolerance to it may enable clinicians to enhance the
benefit/risk ratio of
schizophrenia and bipolar disorder treatment regimes.
Depression
Depression is a serious medical illness that affects 340 million people
worldwide. In
contrast to the normal emotional experiences of sadness, loss, or passing mood
states, clinical
depression is persistent and can interfere significantly with an individual's
ability to function. As
a result, depression is the leading cause of disability throughout the world
with an estimated cost
of $53 billion each year in the United States alone.
Symptoms of depression include depressed mood, diminished interest or pleasure
in
activities, change in appetite or weight, insomnia or hypersomnia, psycho-
motor agitation or
retardation, fatigue or loss of energy, feelings of worthlessness or excessive
guilt, anxiety,
inability to concentrate or act decisively, and recurrent thoughts of death or
suicide. A diagnosis
of unipolar major depression (or major depressive disorder) is made if a
person has five or more
of these symptoms and impairment in usual functioning nearly every day during
the same two-
week period. The onset of depression generally begins in late adolescence or
early adult life;
however, recent evidence suggests depression may be occurring earlier in life
in people born in
the past thirty years.
The World Health Organization predicts that by the year 2020 depression will
be the
greatest burden of ill-health to people in the developing world, and that by
then depression will
be the second largest cause of death and disability. Beyond the almost
unbearable misery it
causes, the big risk in major depression is suicide. Within five years of
suffering a major
depression, an estimated 25% of sufferers try to kill themselves. In addition,
depression is a
frequent and serious complication of heart attack, stroke, diabetes, and
cancer. According to one
recent study that covered a 13 year period, individuals with a history of maj
or depression were
four times as likely to suffer a heart attack compared to people without such
a history.
Depression may be a feature in up to 50% of patients with CNS disorders such
as
Parkinson's disease and Alzheimer's disease. The neuronal loss in the locus
ceruleus, typical of
Alzheimer's disease, is greatest in those patients who have depression; such
patients also have
lower norepinephrine levels than do those who lack depressive features.
Approximately 50% of
9
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
patients with Alzheimer's disease have less norepinephrine than normal in the
majority of cortical
and subcortical areas of the brain that have been examined to date.
Many neurochemical findings are coming to light implicating a biological basis
for the
depression, at least for certain subtypes. Abnormalities of monoamine function
have been
xecognized in depression for many years involving norepinephrine, serotonin
and dopamine.
Changes in adrenoceptor density and function as well as changes in
adrenoceptors associated
with the pituitary-adrenal axis function strongly implicate a disorder in
central noxadrenergic
transmission in depression. This dysfunction may be caused by changes in the
activity of
tyrosine hydroxylase. The effect of corticotrophin releasing factor in
modulating the activity of
noradrenergic neurons in the locus ceruleus may provide the link between
environmental trigger
factors and central noradrenergic dysfunction, along with dysfunction of the
HPA axis.
Dysfunction of serotonin metabolism, as shown by decreased concentrations of
the
metabolite SHIAA in cerebrospinal fluid (CSF), is linked with depression;
nevertheless, it is not
a feature in all patients with depression. Therefore, a subgroup entitled
"serotonin depression"
has been proposed. Often included among those who suffer from serotonin
depression are
patients who also suffer a number of neurological diseases. A reduction in the
number of
serotonin-containing neurons in the median raphe in Parkinson's disease,
Alzheimer's disease
and, possibly, the elderly, is associated with the development of depression.
Low levels of the dopamine metabolite HVA are found in the CSF in patients
with
depression. In addition, dopamine agonists produce a therapeutic response in
depression.
Presently, antidepressants are designed to address many of the symptoms of
depression
by increasing neurotransmitter concentration in aminergic synapses. Distinct
pharmacologic
mechanisms allow the antidepressants to be separated into seven different
classes. The two
classical mechanisms are those of tricyclic antidepressants (TCAs) and
monoamine oxidase
inhibitors (MAOIs): The most widely prescribed agents are the serotonin
selective reuptake
inhibitors (SSRIs). Three other classes of antidepressants, like the SSRIs,
increase serotonergic
neurotransmission, but they also have additional actions, namely dual
serotonin and
norepinephrine reuptake inhibition; serotonin-2 antagonism/reuptake
inhibition; and a2
antagonism plus serotonin-2 and -3 antagonism. The selective norepinephrine
and dopamine
reuptake inhibitors define a novel class of antidepressant that has no direct
actions on the
serotonin system.
Recent findings suggest some re-appraisal and modifications of the monoamine
hypothesis are necessary. The increased levels of monoamine transmitters at
the synapses,
although quickly produced in response to antidepressant therapy, are in
contrast with the much
slower clinical recovery of the patient from depression, which takes about two
weeks to begin
and may only reach maximal levels several weeks later. Moreover, should acute
depletion of
either norepinephrine and/or serotonin occur experimentally in a normal
individual, then
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
depression does not, in the short-term, occur. Not in keeping with the
hypothesis, too, is the
cerebral resistance generated in response to the pharmacological changes
induced by
antidepressant compounds. These counteractive changes comprise reduction in
the number of
post-synaptic (3-receptors, together with a lowered firing rate of
noradrenergic neurons.
In addition, there are subsets of patients with differential responses to
antidepressants.
Thus far, biochemical predictors of treatment response have failed to identify
definite parameters
that could correctly identify patients more likely to respond to particular
classes of
antidepressants (Schatzberg, Alan F., Journal of Clinical Psychiatry, 59:15-
18, 1998). As a
result, psychiatrists often must choose a treatment based on intuition or
trail and error. However,
probes such as biallelic markers could serve as an invaluable tool to
successfully identify patients
who might respond preferentially to existing and new antidepressants (Charney,
Dennis S,
Journal of Clinical Psychiatry, 59:11-14, 1998). In particular, markers from
genes known to
affect drug response such as transcription factors (see Table 2: SEF-1B) and
drug metabolizing
enzymes (see Table 2: CYP3A4) need to be investigated to determine
"responders" and "non-
responders" to medicaments.
While modulating monoamine activity as a therapeutic strategy continues to
dominate
research, an important new development has been the emergence of novel
mechanisms of action,
notably modulation of the activity of neuropeptides, namely through the
neuropeptide receptor
Y1, the tachykinin NK1 receptor and nicotinic receptors (see Table 2: NPY1R,
TACRl and
CHRNA7). Recent clinical trails showed that tachykinin NK1 receptor
antagonists are effective
in treating depression and chemotherapy-induced emesis. Therefore, it is well
possible that such
antagonists will be clinically useful for treatment of specific CNS disorders.
Nicotinic receptors
are known to serve as important ligand-gated ion channels active in classical,
excitatory
neurotransmission and perhaps more novel forms of neurochemical signaling.
Their critical
functional roles both centrally and peripherally make them ideal targets for
regulation of the
nervous system. Finally, new antidepressants that may render the HPA axis more
sensitive to
glucocorticoid feedback are being investigated as well.
In addition to monoamine dysfunction as a possible cause of depression,
researchers
have reported increased activity in the HPA axis in untreated depressed
patients, as evinced by
raised levels of cortisol in urine, blood and cerebrospinal fluid, as well as
by other measures.
Numerous studies have confirmed that substantial numbers of depressed
patients, particularly
those most severely affected, display HPA axis hyperactivity. Patients with
depression
frequently have symptom clusters which point strongly to involvement of the
HPA system as a
relay station between neurocircuitries in the brain and peripheral hormone and
autonomic
nervous function. It has been proposed that this increased, state-dependent
hyperactivity of the
HPA system in depression is probably initiated and/or maintained by the
combination of
enhanced central production of corticotrophin-releasing factor and
desensitization of the binary,
11
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
glucocorticoid receptor binding system in the hippocampus, which is the
central regulator of
HPA system activity.
Deeper investigation of the phenomenon has now revealed alterations at each
level of the
HPA axis in depressed patients. For instance, both the adrenal gland and the
pituitary are
enlarged, and the adrenal gland hypersecretes cortisol. But many researchers,
have become
persuaded that aberrations in GRF-producing neurons of the hypothalamus and
elsewhere bear
most of the responsibility for HPA axis hyperactivity and the emergence of
depressive
symptoms.
Many studies have shown corticotrophin-releasing factor concentrations in
cerebrospinal
fluid to be elevated in depressed patients, compared with control subjects or
individuals with
other psychiatric disorders. This magnification of corticotrophin-releasing
factor levels is
reduced by treatment with antidepressants and by effective electroconvulsive
therapy. Further,
postmortem brain tissue studies have revealed a marked exaggeration both in
the number of
CRF-producing neurons in the hypothalamus and in the expression of the
corticotrophin-
releasing factor gene (resulting in elevated corticotrophin-releasing factor
synthesis) in depressed
patients as compared with controls. Moreover, delivery of corticotrophin-
releasing factor to the
brains of laboratory animals produces behavioral effects that are cardinal
features of depression
in humans, namely, insomnia, decreased appetite, decreased libido and anxiety.
Geneticists have provided some of the oldest proof of a biological component
to
depression in many people. Depression and manic-depression frequently run in
families. Thus,
close blood relatives of patients with severe depressive or bipolar disorder
are much more likely
to suffer from those or related conditions than are members of the general
population. Studies of
identical and fraternal twins also support an inherited component. Illness in
both members of a
pair is much higher for manic-depression in identical twins than in fraternal
and is somewhat
, elevated for depression alone.
In the past 20 years, genetic researchers have expended great effort trying to
identify the
genes which contribute to depression. So far, though, those genes have evaded
discovery,
perhaps because a predisposition to depression involves several genes, each of
which makes only
a small, hard-to-detect contribution. As a result, psychiatrists today have to
choose
antidepressant medications by intuition and trial and error; a situation that
can put suicidal
patients in jeopardy for weeks or months until the right compound is selected.
Therefore, there is
a strong need to successfully identify genes involved in depression; thus
allowing researchers to
understand the etiology of depression and address its cause, rather than
symptoms.
Alzheimer's Disease
~ Alzheimer's disease is characterized by the onset in middle age of a slowly
progressive
dementia; there is loss of memory for past events, inability to develop new
memories and
impairment of intellect, all leading to a lessened capacity for dealing with
the tasks and problems
12
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
of daily living. It is the most common cause of both presenile and senile
dementia. Alzheimer's
disease is not the non-specific degenerative disorder of the CNS that it was
once thought to be, as
neurochemical studies on postmortem material now reveal the degeneration to be
selective for
certain neuronal populations in the subcortical and cortical areas; other cell
populations seem to
be unaffected. Senile plaques and neurofibrillary tangles are the
characteristic histological
feature, found throughout the cerebral cortex and especially in certain
regions of the limbic
system (the amygdala and hippocampus), perhaps accounting for the memory loss
so typical of
the early phase of the disease. In addition, there is reduction of
acetylcholine, norepinephrine,
serotonin and somatostatin in the subcortical areas in Alzheimer's disease.
The activity of CAT, the enzyme involved in acetylcholine synthesis, is
markedly
decreased in Alzheimer's disease. This decrease does not occur in all areas of
the brain, but does
so particularly in the hippocampus and amygdala, which are some of the main
sites where senile
plaques and neurofibrillary tangles accumulate. The loss of such cortical
cholinergic activity
correlates well with he degree of dementia in patients with this disease. A
further finding is that
~ nerve growth factor (NGF) is now known to be involved in the maintenance of
cholinergic
neurons in the forebrain; also, nicotine, a cholinomimetic compound, is able
to stimulate
dopaminergic neurons via their nicotinic receptors; thus, seemingly, to
provide smokers with
some protection against degeneration of the dopaminergic neurons. The
forebrain cholinergic
system degenerates not only in Alzheimer's disease, but also in alcohol-
induced dementia, Pick's
, disease, Lewy body dementia, progressive supranuclear palsy and in
Parkinson's disease.
In Alzheimer's disease there is a reduction of both serotonin and its receptor
proteins in
the temporal lobe of the brain, as revealed from studies on autopsy and biopsy
material. The loss
of serotonin is, however, less than in Parkinson's disease and it would be
unlikely, therefore, that
the severe memory loss of Alzheimer's disease could be accounted for on this
basis alone,
although in Parkinson's disease there is an important difference in that the
SHT~ receptor is not
decreased. Of interest in this context, but not necessarily related, is the
bradyphrenia
(characterized by difficulty in concentration, slowing of thought processes
and inability to
associate ideas) of Parkinson's disease where serotonin is low in most of the
cortical regions. In
the Lewy body type of senile dementia it is common for visual hallucinations
to occur, and ~it is
of great interest that in the temporal lobe the serotonergic activity is
higher (as shown by the
raised serotonergic:cholinergic ratio) in those patients who suffer from
hallucinations compared
with those who do not.
In addition to the involvement of serotonin in Alzheimer's disease, patients
also suffer
from decreased levels of norepinephrine and several neuropeptides. It is in
those patients with
Alzheimer's disease who also have depression that there is not only greatest
reduction in the
number of neurons within the locus ceruleus but also a markedly reduced
norepinephrine content.
There is also associated reduction in cortical somatostatin and corticotrophin-
releasing factor,
13
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
and loss of the somatostatin content of neurons in the temporal cortex
develops early in the
condition.
There is no laiown definitive cure for Alzheimer's disease; therefore,
treatment is aimed
at relief of symptoms and protection from the effects of the deteriorating
condition. Most
treatments are still considered experimental or have had variable results.
Treatment is also aimed
at underlying disorders that contribute to confusion such as heart failure,
hypoxia, thyroid
disorders, anemia, nutritional disorders, infections, and psychiatric
conditions such as depression.
The correction of coexisting medical and psychiatric disorders often improves
the patient's
mental function.
Parkinson's Disease
Parkinson's disease is, a disabling progressive neurodegenerative disorder
characterized
by tremor, rigidity, bradykinesia, and loss of postural reflexes. In the
United States, about a
million people are believed to suffer from Parkinson's disease, and about
50,000 new cases are
reported every year. Because the symptoms typically appear later in life,
these Tables are
expected to grow as the average age of the population increases over the next
several decades:
The disorder is most frequent among people in there 70s and 80s, and appears
to be slightly more
common in men than in women. Parkinson's disease is found all over the world.
The rates vary
from country to country, but it is not clear whether this reflects true ethnic
or geographic
differences or simply variations in data collection.
The pathology is not completely understood, but there appears to be consistent
changes
in the melanin-containing nerve cells in the brainstem (substantia nigra,
locus ceruleus), where
there are varying degrees of nerve cell loss with reactive gliosis along with
eosinophilic
intracytoplasmic inclusions (Lewy bodies). As a result, the primary
neurochemical defect in
Parkinson's disease is the loss of dopaminergic projections to the striatum.
Moreover, the loss
of these populations of neurons also leads to neurotransmitter deficits, but
to a lesser~extent than
that which accompanies the massive degeneration of dopaminergic neurons. For
example,
norepinephrine, serotonin and acetylcholine are variably decreased in
Parkinson's disease dueao .
loss of neurons in the locus ceruleus, raphe nuclei and the nucleus basalis of
Meynert. Thus,
some of the secondary clinical features of Parkinson's disease have been
ascribed to these
neurotransmitter deficits.
The neurochemical defect associated with Parkinson's disease can be partially
corrected
by L-DOPA, which helps replace the brain's dopamine, but cannot reverse the
progression of the
disease. There is no specific biological test for the diagnosis of Parkinson's
disease. Twin
studies have shown variable results and suggest that the genetics of this
disorder will prove to be '
complex. Despite the importance and severity of Parkinson's disease and many
years of
research, a cause has not been identified and there is neither means of
preventing the disease nor
a proven permanent cure.
14
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Findings of considerable importance in this search would be the location of a
genetic
marker, determination of the probability of penetrance, determination of
possible genetic
heterogeneity, and evidence of multifactorial inheritance with environmental
interaction. Genetic
factors determining susceptibility to Parkinson's disease will enhance
epidemiological studies
and possibly lead to identification of susceptible groups and of significant
risk factors.
HuntinQton's Disease
Huntington's disease is a hereditary neurodegenerative disease that generally
develops
subtly in a person's thirties or forties; though it can begin any time between
childhood and old
age. In the United States alone, about 30,000 people have Huntington's
disease, while at least
150,000 others have a 50 percent risk of developing the disease and thousands
more of their
relatives live with the possibility that they, too, might develop Huntington's
disease.
Huntington's disease is characterized by difficulties in three areas: a
movement disorder,
dementia, and psychiatric disturbances. The movement disorder consists of two
parts:
involuntary twitching movement which first tend to involve the fingers and
toes and then
progress to include the whole body, and difficulties with voluntary movements
in the form of
clumsiness, stiffness, or trouble with walking. Dementia refers to a gradual
loss of intellectual
abilities such as memory, concentration, problem solving, and judgment.
Psychiatric
disturbances do not strike every person with Huntington's disease, but when
they do, usually take
the form of depression, irritability, and apathy. Depression and other
psychiatric conditions in
people with Huntington's disease, which seem to result from damage to the
brain, can be
debilitating.
Loss of neurotransmitter receptors, especially glutamate and dopamine
receptors, is one
of the pathologic hallmarks of patients with Huntington's disease (Cha J.H. et
al.; Proc National
Acad Sci USA rnay 26;95(11):6480-5, 1998). In addition, deficiency of GABA
permits excessive
dopaminergic activity in the corpus striatum resulting in onset of
Huntington's disease, on
account of the imbalance generated between cholinergic and dopaminergic
systems.
Researchers have identified a single gene product thought to be causal when
mutated by
a tri-nucleotide repeat expansion. However, there is at present no cure for
Huntington's disease
or even any direct treatments, although researchers are presently working on a
number of
treatments which may slow down the progression of the disease. In the early
and middle stages of
the disease, medications called neuroleptics, which are given in larger doses
for psychiatric
complaints, can be given in small doses to Huntington's disease patients to
suppress the
involuntary movements. Drugs that cause increased dopamine release in the
brain and dopamine -
receptor agonists are used, but both precipitate nausea and vomiting as side
effects and dopamine
antagonists are anti-emetic.
Pharmaco~enomics and CNS Disorders
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
The vast majority of common diseases, such as all of the CNS disorders
described above,
are polygenic, meaning multiple genes cause them. In addition, these diseases
are modulated by
environmental factors such as pollutants, chemicals and diet. This is why many
diseases are
considered to be multifactorial; they result from a synergistic combination of
factors, both
genetic and environmental. Therapeutic management and drug development could
be markedly
improved by the identiftcation of specific genetic polymorphisms that
determine and predict
patient susceptibility to diseases or patient responses to drugs.
To assess the origins of individual variations in disease susceptibility or
drug response,
pharmacogenomics uses the genomic technologies to identify polymorphisms
within genes
which are part of biological pathways involved in disease susceptibility,
etiology, and
development, or more specifically in drug response pathways responsible for a
drug's efficacy,
tolerance or toxicity. Pharmacogenomics can also provide tools to refine the
design of drug
development by decreasing the incidence of adverse events in drug tolerance
studies, by better '
defining patient subpopulations of responders and non-responders in efficacy
studies and, by
combining the results obtained therefrom, to further allow better enlightened
individualizeddrug
usage based on efficacy/tolerance prognosis. Pharmacogenomics can also provide
tools to
identify new targets for designing drugs and to optimize the use of already
existing drugs, in
order to either increase their response rate and/or exclude non-responders
from corresponding
treatment, or decrease their undesirable side effects andlor exclude from
corresponding treatment
patients with marked susceptibility to undesirable side effects. However, for
pharmacogenomics
to become clinically useful on a large scale, additional molecular tools and
diagnostics tests must
become available.
Genetic Analysis of Complex Traits
Until recently, the identification of genes linked with detectable traits has
relied mainly
on a statistical approach called linkage analysis. Linkage analysis is based
upon establishing a
correlation between the transmission of genetic markers and that of a specific
trait throughout
generations within a family. Linkage analysis involves the study of families
with multiple .
affected individuals and is useful in the detection of inherited-traits, which
are caused by a single .
gene, or possibly a very small number of genes. Linkage analysis has been
successfully applied
to map simple genetic traits that show clear Mendelian inheritance patterns
and which have. a
high penetrance (the probability that a person with a given genotype will
exhibit a trait). About
100 pathological trait-causing genes have been discovered using linkage
analysis over the last 10
years. But, linkage studies have proven difficult when applied to complex
genetic traits. Most
traits of medical relevance do not follow simple Mendelian monogenic
inheritance. However,
complex diseases often aggregate in families, which suggests that there is a
genetic component to
be found. Such complex traits are often due to the combined action of multiple
genes as well as
environmental factors. Such complex trait, include susceptibilities to heart
disease, hypertension,
16
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
diabetes, cancer and inflammatory diseases. Drug efficacy, response and
tolerance/toxicity can
also be considered as multifactoral traits involving a genetic component in
the same way as
complex diseases. Linkage analysis cannot be applied to the study of such
traits for which no
large informative families are available. Moreover, because of their low
penetrance, such
complex traits do not segregate in a clear-cut Mendelian manner as they are
passed from one
generation to the next. Attempts to map such diseases have been plagued by
inconclusive results,
demonstrating the need for more sophisticated genetic tools.
Knowledge of genetic variation in the neuronal and endocrine systems is
important for
understanding why some people are more susceptible to disease or respond
differently to
treatments. Ways to identify genetic polymorphism and to analyze how they
impact and predict
disease susceptibility and response to treatment are needed.
Although the genes involved in the neuronal and endocrine systems represent
major drug
targets and are of high relevance to pharmaceutical research we. still have
scant knowledge
concerning the extent and nature of, sequence variation in these genes and
their regulatory
elements. In the case where polymorphisms have been identified the relevance
of the variation is .
rarely understood. While polymorphisms hold promise for use as genetic markers
in determining
which genes contribute to multigenic or quantitative traits, suitable markers
and suitable methods
for exploiting those markers have not been found and brought to bare on the
genes related to
disorders of the brain and nervous system.
In the cases where polymorphisms have been identified, the relevance of the
variation is
rarely understood. While polymorphisms hold promise for use as genetic markers
in determining
which genes contribute to multigenic or quantitative traits, suitable markers
and suitable methods
for exploiting those markers have not been found and brought to bare on the
genes related to
central nervous system disorders.
SUMMARY OF THE INVENTION
The present invention is based on the discovery of a set of novel CNS disorder-
related
biallelic markers. 'See Table 7. These markers are located in the coding
regions as well as non-
coding regions adjacent to genes which express proteins associated with CNS
disorders. The
position of these markers and knowledge of the surrounding sequence has been
used to design
polynucleotide compositions which are useful in determining the identity of
nucleotides at the
marker position, as well as more complex association and haplotyping studies
which are useful in
determining the genetic basis for disease states involving the neuronal and
endocrine systems. In
addition, the compositions and methods of the invention find use in the
identification of the
targets for the development of pharmaceutical agents and diagnostic methods,
as well as the
characterization of the differential efficacious responses to and side effects
from pharmaceutical
agents acting on CNS disorders. Further, the compositions and methods of the
invention may be
17
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
employed in a process for screening for antagonists and/or agonists for the
polypeptides of the
invention. Such molecules may prove useful as therapeutics in the diagnosis
and/or treatment of
CNS disorders, particularly depression.
A first embodiment of the invention encompasses polynucleotides consisting of,
consisting essentially of, or comprising a contiguous span of nucleotides of a
sequence selected
as an individual or in any combination from the group consisting of SEQ ID N0:
1-542, the
complements thereof, the sequences described in arty one or more of Tables 8,
9, 10, 1 l, 12, 13
and 14 and the complements thereof, wherein said contiguous span is at least
6, 8, 10, 12, 15, 20,
25, 30, 35, 40, 50, 75, 100, 200, 500 or 1000 nucleotides in length, to the
extent that such a '
length is consistent with the lengths of the particular Sequence ID. The
present invention also
relates to polynucleotides hybridizing under stringent or intermediate
conditions to a sequence
selected from the group consisting of SEQ m NO: 1-542; and the complements
thereof. In
addition, the polynucleotides of the invention encompass polynucleotides with
any further
limitation described in this disclosure, or those following, specified alone
or in any combination:
Said contiguous span may optionally include the CNS disorder-related biallelic
marker in said
sequence; Optionally either the original or the alternative allele of Table 9
may be specified as
,being.present at said CNS disorder-related biallelic marker; Optionally
either the first or the.
second allele of Tables 8 or 10 may be specified as being present at said CNS
disorder-related
biallelic marker; Optionally, said polynucleotide may consists of, or consist
essentially of a .
contiguous span which ranges in length from 8, 10, 12, 15, 18 or 20 to 25,
.35, 40, 50, 60, 70, or
80 nucleotides, or be specified as being 12, 15, 18, 20, 25, 35, 40, or 50
nucleotides in length and
including a CNS disorder-related biallelic marker of said sequence, and
optionally the original
allele of Table 9 is present at said biallelic marker; Optionally, said
biallelic marker may be
within 6, 5, 4, 3, 2, or 1 nucleotides of the center of said polynucleotide or
at the centex of said
2S polynucleotide; Optionally, the 3' end of said contiguous span may be
present at. the 3' end of
said polynucleotide; Optionally, biallelic marker may be present at the 3' end
of said
polynucleotide; Optionally, the 3' end of said polynucleotide may be located
within or at least 2,
~4, 6, 8, 10, 12, 15, 18, 20, 25, 50, 100, 250, 500 or 1000 nucleotides
upstream of a CNS disorder-
related biallelic marker in said sequence, to the extent that such a distance
is consistent with'the
lengths of the particular Sequence >D; Optionally, the 3' end of said
polynucleotide may be
located 1 nucleotide upstream of a CNS disorder-related biallelic marker in
said sequence; and
-Optionally, said polynucleotide may further comprise a label. .
A second embodiment of the invention encompasses any polynucleotide of the
invention
attached to a solid support. In addition, the polynucleotides of the invention
which are attached
to a solid support encompass polynucleotides with any further limitation
described in this
disclosure, or those following, specified alone or in any combination:
Optionally, said
polynucleotides may be specified as attached individually or in groups of at
least 2, 5, 8, 10, 12,
18
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
15, 20, or 25 distinct polynucleotides of the inventions to a single solid
support; Optionally,
polynucleotides other than those of the invention may be attached to the same
solid support as
polynucleotides of the invention; Optionally, when multiple polynucleotides
are attached to a
solid support they may be attached at random locations, or in an ordered
array; Optionally, said
ordered array may be addressable.
A third embodiment of the invention encompasses the use of any polynucleotide
for, or
any polynucleotide for use in, determining the identity of one or more
nucleotides at a CNS
disorder-related biallelic marker. Microsequencing primers are provided in
Table 12. In
addition, the polynucleotides of the invention for use in determining the
identity of one or more
nucleotides at a CNS disorder-related biallelic marker encompass
polynucleotides with any
further limitation described in this disclosure, or those following, specified
alone or in any
. combination. Optionally, said CNS disorder-related biallelic marker may be
in a sequence
selected individually or in any combination from the group consisting of SEQ m
NO: 1-542; and
the complements thereof; Optionally, said polynucleotide may comprise a
sequence disclosed in
the present specification; Optionally, said polynucleotide may consist of, or
consist essentially of
any polynucleotide described in the present specification; Optionally, said
determining may be
performed in a hybridization assay, sequencing assay, microsequencing assay,
or an enzyme-
based mismatch detection assay; Optionally, said polynucleotide may be
attached to a solid
support, array, or addressable array; Optionally, said polynucleotide may be
labeled.
A fourth embodiment of the invention encompasses the use of any polynucleotide
for, or
any polynucleotide for use in, amplifying a segment of nucleotides comprising
a CNS disorder-
related biallelic marker. Amplification primers are provided in Table 13. Tn
addition, he
polynucleotides of the invention for use in amplifying a segment of
nucleotides comprising a
CNS disorder-related biallelic marker encompass polynucleotides with any
further limitation .
described in this disclosure, or those following, specified alone or in any
combination:
Optionally, said CNS disorder-related biallelic marker may be in a sequence
selected individually
or in any combination from the group consisting of SEQ )D 1-130; and the
complements thereof;
Optionally, said CNS disorder-related biallelic marker may be selected
individually or~in any
combination from the biallelic markers described in Table 7; Optionally, said
CNS disorder-
related biallelic marker may be selected from the following biallelic markers:
99-27207-117, 99-
28110-75, 99-28134-215, 99-32181-192, 99-28106-185, 99-30858-354, 18-20-174,
99-32002-
313, 18-31-178, 18-38-395, 99-30853-364, 19-56-140, 19-28-136, 99-28788-300,
99-32061-304,
99-32121-242, 19-14-241, 16-50-196, 8-19-372, 12-254-180, 10-214-279, 10-217-
91, 18-194-
130, 18-186-391, 18-198-252, 18-242-300, 20-205-302, 19-58-162, 19-9-45, 19-22-
74, 19-88-
185, 19-18-310, 19-19-174, 19-17-188, 19-16-127, 99-32148-315, 19-46-322, 99-
32131-312, 99-
32065-303, 19-44-251, 19-29-303, 18-355-67, 18-353-267, 18-338-305, 16-88-185,
24-243-346,
99-62531-351, 99-54279-152, 99-28171-458, 99-28173-395, 18-186-394, 8-15-126,
99-2409-
19
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
298, 99-28?22-90 and 99-32306-409; Optionally, said CNS disorder-related
biallelic marker
may be selected from the following biallelic markers: 99-28788-300, 99-32061-
304, 99-32121-
242, 19-14-241, 19-28-136, 16-50-196, 19-58-162, 19-9-45, 20-205-302, 24-243-
346, 99-27207-
117, 99-28110-75, 99-28134-215, 99-32181-192, 19-17-188 and 19-19-174;
Optionally, said
polynucleotide may comprise a sequence disclosed in the present specification;
Optionally, said
polynucleotide may consist of, or consist essentially of any polynucleotide
described in the
present specification; Optionally, said amplifying may be performed by a PCR
or LCR.
Optionally, said polynucleotide may be attached to a solid support, array, or
addressable array.
Optionally, said polynucleotide may be labeled.
A fifth embodiment of the invention encompasses methods of genotyping a
biological
sample comprising determining the identity of a nucleotide at a CNS disorder-
related biallelic
marker. In addition, the genotyping methods of the invention encompass methods
with any
further limitation described in this disclosure, or those following, specified
alone or in any
combination: Optionally, said CNS disorder-related biallelic marker may be in
a sequence
selected individually or in any combination from the group consisting of SEQ m
NO: 1-542, and
the complements thereof; Optionally, said CNS disorder-related biallelic
marker may be selected
individually or in any combination from the biallelic markers described in
Table 7; Optionally,
said CNS disorder-related biallelic marker may be selected from the following
biallelic markers:
99-27207-117, 99-28110-75, 99-28134-215, 99-32181-192, 99-28106-185, 99-30858-
354, 18-
.20 20-174, 99-32002-313, 18-31-178, 18-38-395, 99-30853-364, 19-56-140,-19-28-
136, 99-28788-
300, 99-32061-304, 99-32121-242, 19-14-241, 16-50-196, 8-19-372, 12-254-180,
10-214-279,
10-217-91, 18-194-130, 18-186-391, 18-198-252, 18-242-300, 20-205-302, 19-58-
162, 19-9-45,
19-22-74, 19-88-185, 19-18-310, 19-19-174, 19-17-188, 19-16-127, 99-32148-315,
19-46-322;
99-32131-312, 99-32065-303, 19-44-251, 19-29-303, 18-355-67, 18-353-267, 18-
338-305, 16-
88-185, 24-243-346, 99-62531-351, 99-54279-152, 99-28171-458, 99-28173-395, 18-
186-394,
8-15-126, 99-2409-298, 99-28722-90 and 99-32306-409; Optionally, said CNS
disorder-related
biallelic marker may be selected from the following biallelic markers: 99-
28788-300, 99-32061-
304, 99-32121-242, 19-14-241, 19-28-136, 16-50-196, 19-58-162, 19-9-45, 20-205-
302, 24-243-
346, 99-27207-117, 99-28110-75, 99-28134-215, 99-32181-192, 19-17-188 and 19-
19-174;
Optionally, said method further comprises determining the identity of a second
nucleotide at said
biallelic marker, wherein said first nucleotide and second nucleotide are not
base paired (by
Watson & Crick base pairing) to one another; Optionally, said biological
sample is derived from
a single individual or subject; Optionally, said method is performed in vitro;
Optionally, said
biallelic marker is determined for both copies of said biallelic marker
present in said individual's
genome; Optionally, said biological sample is derived from multiple subjects
or individuals;
Optionally, said method further comprises amplifying a portion of said
sequence comprising the
biallelic marker prior to said determining step; Optionally, wherein said
amplifying is performed
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
by PCR, LCR, or replication of a recombinant vector comprising an origin of
replication and said
portion in a host cell; Optionally, wherein said determining is performed by a
hybridization
assay, sequencing assay, microsequencing assay, or an enzyme based mismatch
detection assay.
A sixth embodiment of the invention comprises methods of estimating the
frequency of
an allele in a population comprising genotyping individuals from said
population for a CNS
disorder-related biallelic marker and determining the proportional
representation of said biallelic
marker in said population. In addition, the methods of estimating the
frequency of an allele in a
population of the invention encompass methods with any further limitation
described in this
disclosure, or those following, specified alone or in any combination:
Optionally, said CNS
disorder-related biallelic marker may be in a sequence selected individually
or in any
combination from the group consisting of SEQ NO: 1-542; and the complements
thereof;
Optionally, said CNS disorder-related biallelic marker may be selected from
the biallelic markers
described in Table 7; Optionally, said CNS disorder-related biallelic marker
may be selected
from the following biallelic markers: 99-27207-117, 99-28110-75, 99-28134-215,
99-32181-192;
99-28106-185, 99-30858-354, 18-20-174, 99-32002-313, 18-31-178, 18-38-395, 99-
30853-364,
19-56-140, 19-28-136, 99-28788-300, 99-32061-304, 99-32121-242, 19-14-241, 16-
50-196, 8-
19-372, 12-254-180, 10-214-279, 10-217-91, 18-194-130, 18-186-391, 18-198-252,
18-242-300,
20-205-302, 19-58-162, 19-9-45, 19-22-74, 19-88-185, 19-18-310, 19-19-174, 19-
17-188, 19-16-
127, 99-32148-315, 19-46-322, 99-32131-312, 99-32065-303, 19-44-251, 19-29-
303; 18-355-67,
v 18-353-267, 18-338-305, 16-88-185, 24-243-346, 99-62531-351, 99-54279-152,
99-28171-458, ,
99-28173-395, 18-186-394, 8-15-126, 99-2409-298, 99-28722-90 and 99-32306-409;
Optionally, said CNS disorder-related biallelic marker may be selected from
the following
biallelic markers: 99-28788-300, 99-32061-304, 99-32121-242, 19-14-241, 19-28-
136, 16-50-
196, 19-58-162, 19-9-45, 20-205-302, 24-243-346, 99-27207-117, 99-28110-75, 99-
28134-215, '
99-32181-192, 19-17-188 and 19-19-174; Optionally, determining the frequency
of a biallelic
marker allele in a population may be accomplished by determining the identity
of the nucleotides
for both copies of said biallelic marker present in the genome of each
individual in said
population and calculating the proportional representation of said nucleotide
at said CNS
disorder-related biallelic marker for the population; Optionally, determining
the frequency of a
biallelic marker allele in a population may be accomplished by performing a
genotyping method
on a pooled biological sample derived from a representative number of
individuals, or each
individual, in said population, and calculating the proportional amount of
said nucleotide
compared with the total.
A seventh embodiment of the invention comprises methods of detecting an
association
between an allele and a phenotype, comprising the steps of a) determining the
frequency of at
least one CNS disorder-related biallelic marker allele in a trait positive
population, b)
determining the frequency of said CNS disorder-related biallelic marker allele
in a control
21
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
population and; c) determining whether a statistically significant association
exists between said
genotype and said phenotype. In addition, the methods of detecting an
association between an
allele and a phenotype of the invention encompass methods with any further
limitation described
in this disclosure, or those following, specified alone or in any combination:
Optionally, said
CNS disorder-related biallelic marker may be in a sequence selected
individually or in any
combination from the group consisting of SEQ )D NO: 1-542, and the complements
thereof;
Optionally, said CNS disorder-related biallelic marker may be selected from
the biallelic markers
described in Table 7; Optionally, said control population may be a trait
negative population, or a
random population; Optionally, said phenotype is a CNS disorder, a response to
an agent acting
on a CNS disorder, or side effect to an agent acting on a CNS disorder;
Optionally, the identity
of the nucleotides at the biallelic markers in everyone of the following
sequences:'SEQ m NO:
1-542 is determined in steps a) and b).
An eighth embodiment of the present invention encompasses methods of
estimating the
frequency of a haplotype for a set of biallelic markers in a population,
comprising the steps of a)
genotyping each individual in said population for at least one CNS disorder-
related biallelic
marker, b) genotyping each individual in said population for a second
biallelic marker by
determining the identity of the nucleotides at said second biallelic marker
for both copies of said
second biallelic marker present in the genome; and c) applying a haplotype
determination.method
to the identities of the nucleotides determined in steps a) and b) to obtain
an estimate of said
frequency. In addition the methods of estimating the frequency of a haplotype
of the invention
encompass methods with any further limitation described in this disclosure, or
those following,
specified alone or in any combination: Optionally said haplotype determination
method is
selected from the group consisting of asymmetric PCR amplification, double PCR
amplification
of specific alleles, the Clark method, or an expectation maximization
algorithm; Optionally, said
second biallelic marker is a CNS disorder-related biallelic marker in a
sequence selected from the
group consisting of the biallelic markers of SEQ )D NO: 1-542, and the
complements thereof; .
Optionally, said CNS disorder-related biallelic markers may be selected
individually or in any
combination from the biallelic markers described in Table 7; Optionally, said
CNS disorder-
related biallelic marker may be selected from the following biallelic markers:
99-27207-117, 99-
28110-75, 99-28134-215, 99-32181-192, 99-28106-185, 99-30858-354, 18-20-174,
99-32002-
313, 18-31-178, 18-38-395, 99-30853-364, 19-56-140, 19-28-136, 99-28788-300,
99-32061-304,
99-32121-242, 19-14-241, 16-50-196, 8-19-372, 12-254-180, 10-214-279, 10-217-
91, 18-194-
130, 18-186-391, 18-198-252, 18-242-300, 20-205-302, 19-58-162, 19-9-45, 19-22-
74, 19-88-
185, 19-18-310, 19-19-174, 19-17-188, 19-16-127, 99-32148-315, 19-46-322, 99-
32131-312, 99-
32065-303, 19-44-251, 19-29-303, 18-355-67, 18-353-267, 18-338-305, 16-88-185,
24-243-346,
99-62531-351, 99-54279-152, 99-28171-458, 99-28173-395, 18-186-394, 8-15-126,
99-2409-
298, 99-28722-90 and 99-32306-4097; Optionally, said CNS disorder-related
biallelic marker
22
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
may be selected from the following biallelic markers: 99-28788-300, 99-32061-
304, 99-32121-
242, 19-14-241, 19-28-136, 16-50-196, 19-58-162, 19-9-45, 20-205-302, 24-243-
346, 99-27207-
117, 99-28110-75, 99-28134-215, 99-32181-192, 19-17-188 and 19-19-174;
Optionally, the
identity of the nucleotides at the biallelic markers in everyone of the
sequences of SEQ >D NO:
1-542 is determined in steps a) and b).
A ninth embodiment of the present invention encompasses methods of detecting
an
association between a haplotype and a phenotype, comprising the steps of: a)
estimating the
frequency of at least one haplotype in a trait positive population according
to a method of
estimating the frequency of a haplotype of the invention; b) estimating the
frequency of said
haplotype in a control population according to the method of estimating the
frequency of a
haplotype of the invention; and c) determining Whether a statistically
significant association
exists between said haplotype and said phenotype. In addition, the methods of
detecting an
association between a haplatype and a phenotype of the invention encompass
methods with any
further limitation described in this disclosure, or those following, specified
alone or in any
combination: Optionally, said CNS disorder-related biallelic marker may be in
a sequence
selected individually or in any combination from the group consisting of SEQ
)17 NO: 1-542, and
the complements thereof; Optionally, said CNS disorder-related biallelic
markers may be
selected individually or in any combination from the biallelic markers
described in Table 7;
Optionally, said CNS disorder-related biallelic marker may be selected from
the following
biallelic markers: 99-27207-117, 99-28110-75, 99-28134-215, 99-32181-192, 99-
28106-185, 99-
30858-354, 18-20-174, 99-32002-313, 18-31-178, 18-38-395, 99-30853-364, 19-56-
140, 19-28-
136; 99-28788-300, 99-32061-304, 99-32121-242, 19-14-241, 16-50-196, 8-19-372;
12-254-180,
10-214-279, 10-217-91, 18-194-130, 18-186-391, 18-198-252, 18-242-300, 20-205-
302, 1,9-58-
162, 19-9-45, 19-22-74, 19-88-185, 19-18-310, 19-19-174, 19-17-188, 19-16-127,
99-32148-315,
19-46-322, 99-32131-312, 99-32065-303, 19-44-251, 19-29-303, 18-355-67, 18-353-
267, 18-
338-305, 16-88-185, 24-243-346, 99-62531-351, 99-54279-152, 99-28171-458, 99-
28173-395,
18-186-394, 8-15-126, 99-2409-298, 99-28722-90 and 99-32306-409; Optionally,
said CNS
disorder-related biallelic marker may be selected from the following biallelic
markers: 99-28788-
300, 99-32061-304, 99-32121-242, 19-14-241, 19-28-136, 16-50-196, 19-58-162,
19-9-45, 20-
205-302, 24-243-346, 99-27207-117, 99-28110-75, 99-28134-215, 99-32181-192, 19-
17-188 and
19-19-174; Optionally, said control population may be a trait negative
population, or a random
population; Optionally, said phenotype is a CNS disorder, a response to an
agent acting on a
CNS disorder, or side effect to an agent acting on a CNS disorder; Optionally,
the identity of the
nucleotides at the biallelic markers in everyone of the following sequences:
SEQ ID NO: 1-542 is
included in the estimating steps a) and b).
A tenth embodiment of the present invention encompasses polypeptides encoded
by SEQ
m NO: 543 or 544, as well as antisense analogs thereof and biologically active
and
23
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
diagnostically or therapeutically useful fragments and derivatives thereof.
The polypeptides of
the present invention are of human origin. In accordance with a further aspect
of the present
invention, there is provided a method for producing such polypeptides by
recombinant
techniques which comprises culturing recombinant prokaryotic and/or eukaryotic
host cells,
containing a nucleic acid sequence encoding a polypeptide of the present
invention, under
conditions promoting expression of said protein and subsequent recovery of
said protein. A
further embodiment of the present invention encompasses antibodies against
such polypeptides.
An eleventh embodiment of the present invention is a method for using one or
more of
the polypeptides according to the invention to screen for polypeptide
antagonists and/or agonists
and/or receptor ligands. A further embodiment of the present invention is a
method of using such
agonists to activate the polypeptides of the present invention for the
treatment of conditions
related to the underexpression of the polypeptide of the present invention,
preferably depression.
In accordance With another aspect of the present invention there is provided a
method of using
such antagonists for inhibiting the polypeptide of the present invention for
treating conditions
associated with overexpression of the polypeptides of the present invention.
A twelfth embodiment of the present invention encompasses non-naturally
occurring
synthetic, isolated and/or recombinant polypeptides which are fragments,
consensus fragments
and/or sequences having conservative amino acid substitutions, of at least one
transmembrane
domain, such that the polypeptides of the present invention may bind ligands,
or which may also
modulate, quantitatively or qualitatively, ligand binding to the polypeptides
of the present
invention. A further embodiment of the present invention encompasses synthetic
or recombinant'
polypeptides, conservative substitution derivatives thereof, antibodies, anti-
idiotype antibodies,
compositions and methods that can be useful as potential modulators of CNS-
related protein
function, by binding to ligands or modulating ligand binding, due to their
expected biological
properties, which may be used in diagnostic, therapeutic and/or research
applications relating'to
CNS disorders. In yet a further embodiment of the present invention, there is
provided synthetic,'
isolated or recombinant polypeptides which are designed to inhibit or mimic
various
polypeptides of the invention or fragments thereof, as receptor types and
subtypes.
A thirteenth embodiment of the present invention encompasses a diagnostic
assay for
detecting a disease or susceptibility to a disease related to a mutation in a
nucleic acid sequence
encoding a polypeptide of the present invention. Preferably said disease is
depression.
A fourteenth embodiment of the present invention is a method of administering
a drug or
a treatment comprising the steps of: a) .obtaining a nucleic acid sample from
an individual; b)
determining the identity of the polymorphic base of at least one CNS disorder-
related biallelic
marker which is associated with a positive response to the treatment or the
drug; or at least one
biallelic CNS disorder-related marker which is associated with a negative
response to the
treatment or the drug; and c) administering the treatment or the drug to the
individual if the
24
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
nucleic acid sample contains said biallelic marker associated with a positive
response to the
treatment or the drug or if the nucleic acid sample lacks said biallelic
marker associated with a
negative response to the treatment or the drug. In addition, the methods of
the present invention
for administering a drug or a treatment encompass methods with any further
limitation described
in this disclosure, or those following, specified alone or in any combination:
optionally, said CNS
disorder-related biallelic marker may be in a sequence selected individually
or in any
combination from the group consisting of SEQ. )D. NO: 1-542 and the
complements thereof , or
optionally, the administering step comprises administering the drug or the
treatment to the
individual if the nucleic acid sample contains said biallelic marker
associated with a positive
response to the treatment or the drug and the nucleic acid sample lacks said
biallelic marker
associated with a negative response to the treatment or the drug.
A fifteenth embodiment of the present invention is a method of selecting an
individual
for inclusion in a clinical trial of a treatment or drug comprising the steps
of a) obtaining a
nucleic acid sample from an individual; b) determining the identity of the
polymorphic base of at
least one CNS disorder-related biallelic marker which is associated with a
positive response to
the treatment or the drug, or at least one CNS disorder-related biallelic
marker which is
associated with a negative response to the treatment or the drug in the
nucleic acid sample, and c)
including the individual in the clinical trial if the nucleic acid sample
contains said CNS disorder-
related biallelic marker associated with a positive response to the treatment
or the drug or if the
nucleic acid sample lacks said biallelic marker associated with a negative
response to the
treatment or the drug. In addition, the methods of the present invention for
selecting an
individual for inclusion in a clinical trial of a treatment or drug encompass
methods with any
further limitation described in this disclosure, or those following, specified
alone or in any
combination: Optionally, said CNS disorder-related biallelic marker may be in
a sequence
selected individually or in any combination from the group consisting of SEQ.
ID. NO: 1-542
and the complements thereof, optionally, the including step comprises
administering~the drug or
the treatment to the individual if the nucleic acid sample contains said
biallelic marker associated
with a positive response to the treatment or the drug and the nucleic acid
sample lacks said
biallelic marker associated with a negative response to the treatment or the
drug.
Additional embodiments are set forth in the Detailed Description of the
Invention and in
the Examples.
BRIEF DESCRIPTION OF THE TABLES
Tables 7A and 7C are charts containing a list of all of the CNS-related
biallelic markers
for each gene with an indication of the gene for which the marker is in
closest physical
proximity, an indication of whether the markers have been validated by
microsequencing (with a
Y indicating that the markers have been validated by microsequencing and an N
indicating that it
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
has not), and an indication of the identity and frequency of the least common
allele determined
by genotyping (with a blank left to indicate that the frequency has not yet
been reported for some
markers).
Tables 7B and 7D contain all of the CNS-related biallelic markers provided in
Tables 7A
and 7C; however, they are provided in shorter, easier to search sequences of
47 nucleotides.
Accordingly, Table 7A begins with SEQ U~ NO: 1 and ends with SEQ )D NO: 130,
while
corresponding Table 7B begins with SEQ ID NO: 131 and ends with SEQ 1Z7 NO:
260. Also
Table 7C begins with SEQ ID NO: 261 and ends with SEQ )D NO: 401, while
corresponding
Table 7D begins with SEQ ID NO: 402 and ends with SEQ 117 NO: 542. Table 1
contains the
first five markers listed in the sequence listing and their corresponding SEQ
m numbers in
Tables 7A and 7C to illustrate the relationship between Tables 7A and 7B:
Table 1
BIALLELIC SEQ ID BIALLELIC SEQ ID BIALLELIC .
MARKER NO. MARKER NO. IN MARKER
ID IN TABLE POSITION IN TABLE POSITION IN
7A SEQ 7B SEQ
ID NO. ID NO.
99-27199-2071 207 131 24
99-27207-1172 117 132 24
99-27213-533 53 133 24
99-27218-3334 333 134 24
99-28108-2335 ' 233 ~ 135 ~ 24
1
Tables 7B and 7D are the same as Tables 7A and 7C, respectively, in that they
are a list
of all of the CNS-related biallelic markers for each gene with an indication
of the gene for which
the marker is in closest physical proximity, an indication of whether the
markers have been
validated by microsequencing (with a Y indicating that the markers have been
validated by
microsequencing and an N indicating that it has not), and an indication of the
identity and
frequency of the least common allele determined by genotyping (with a blank
left to indicate that
the frequency has not yet been reported for some markers). However, the
"Biallelic Marker
Position in SEQ ID No." for all of the CNS-related biallelic markers provided
in Tables 7B and
7D is position 24 (representing the midpoint of the 47mers that make up Tables
7B and 7D)
Tables 8, 9, and 10 are charts containing lists of the CNS disorder-related
biallelic
markers. Each marker is described by indicating its SEQ m, the biallelic
marker ID, and the two
most common alleles. Table 8 is a chart containing a list of biallelic markers
surrounded by
preferred sequences. In the column labeled, "POSITION RANGE OF PREFERRED
SEQUENCE" of Table 8 regions of particularly preferred sequences are listed
for each SEQ ID,
which contain a CNS disorder-related biallelic marker, as well as particularly
preferred regions
26
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
of sequences that do not contain a CNS disorder-related biallelic marker but,
which are in
sufficiently close proximity to a CNS disorder-related biallelic marker to be
useful as
amplification or sequencing primers.
Table 11 is a chart listing particular sequences that are useful for designing
some of the .
primers and probes of the invention. Each sequence is described by indicating
its Sequence m
and the positions of the first and last nucleotides (position range) of the
particular sequence in the
Sequence>D.
Table 12 is a chart listing microsequencing primers which have been used to
genotype
CNS disorder-related biallelic markers (indicated by an *) and other preferred
microsequencing
primers for use in genotyping CNS disorder-related biallelic markers. Each of
the primers which
falls within the strand of nucleotides included in the Sequence Listing are
described by indicating
their Sequence >D number and the positions of the first and last nucleotides
(position range) of
the primers in the Sequence m. Since the sequences in the Sequence Listing are
single stranded
and half the possible microsequencing primers are composed of nucleotide
sequences from the
complementary strand, the primers that are composed of nucleotides in the
complementary strand
are described by indicating their SEQ lD numbers and the positions of the
first and last
nucleotides to which they are complementary (complementary position range) in
the Sequence
DJ.
Table 13 is a chart listing amplification primers which have been used to
amplify
polynucleotides containing one or more CNS disorder-related biallelic markers.
Each of the .
primers which falls within the strand of nucleotides included in the Sequence
Listing are '
described by indicating their Sequence m number and the positions of the first
and last
nucleotides (position range) of the primers in the Sequence )D. Since the
sequences in the
Sequence Listing are single stranded and half the possible amplification
primers are composed of
nucleotide sequences from the complementary strand, the primers that are
composed of
nucleotides in the complementary strand are defined by the SEQ ID numbers and
the positions of
the first and last nucleotides to which they are complementary (complementary
position range) in
the Sequence TD.
Table 14 is a chart listing preferred probes useful in genotyping CNS disorder-
related
biallelic markers by hybridization assays. The probes are 25-mers with a CNS
disorder-related
biallelic markers in the center position, and described by indicating their
Sequence m number
and the positions of the first and last nucleotides (position range) of the
probes in the Sequence
m. The probes complementary to the sequences in each position range in each
Sequence ID are
also understood to be a part of this preferred list even though they are not
specified separately:
Table 1 S is a table showing the results of single marker association tests
between both
biallelic marker alleles and genotypes of candidate genes and major
depression.
27
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Table 16 is a table showing the results of the LR rank of haplotypes using
combinations
of 2, 3 and 4 biallelic markers from each gene.
Table 17 is a table showing the rank of permutation tests for individual
haplotypes
confirming the statistical significance of the association between biallelic
marker haplotypes
from the candidate genes and major depression.
Table 18 is a table showing the results of single marker association tests
between both
biallelic marker alleles and genotypes of candidate genes and major depression
using additional
markers and a new population set as described in Example 4.
Table 19 is a table showing the results of the LR rank of haplotypes using
combinations
of 2, 3 and 4 biallelic markers from additional candidate genes and using data
from a new
population set as described in Example 4.
Table 20 is a table showing the rank of permutation tests for individual
haplotypes from
Table 19 confirming the statistical significance of the association between
biallelic marker
haplotypes from additional candidate genes and major depression.
DETAILED DESCRIPTION OF THE INVENTION .
I. Candidate Genes of the Present Invention
Different approaches can be employed to perform association studies: genome-
wide
association studies, candidate region association studies and candidate gene
association studies.
Genome-wide association studies rely on the screening of genetic markers
evenly spaced and
covering the entire genome. Candidate region association studies rely on the
screening of genetic
markers evenly spaced covering a region identified as linked to the trait of
interest. The
candidate gene approach is based on the study of genetic markers specifically
derived from genes
potentially involved in the pathophysiology of a disease. In the present
invention; genes
involved in the central nervous system and/or the endocrine system have been
chosen as
candidate genes. The candidate genes of the present invention are listed in
Table 2.
Table 2
Candidate Gene Name Gene Symbol Description
Serotonin receptor SHTR6 A postsynaptic serotonin receptor.
6
Serotonin receptor SHTR7 A postsynaptic serotonin receptor.
7 .
Neuronal nicotinic CHRNA7 An ion channel in the reward
acid pathway..
receptor a7
Corticotrophin releasingCRFR1 A corticotrophin releasing factor
factor receptor 1 receptor in
the hypothalamus-pituitary-adrenal
axis.
Mineralocorticoid MLR A mineralocorticoid receptor.
receptor
28
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Corticotrophin releasingCRFR2 A corticotrophin releasing factor
receptor in
factor receptor 2 the hypothalamus-pituitary-adrenal
axis.
Glucocorticoid receptorGRL A glucocorticoid receptor in
the hypothalamus-
pituitary-adrenal axis.
Monoamine oxidase MAOA Key enzyme in catecholamine
A metabolism.
Monoamine oxidase MAOB Key enzyme in catecholamine
B metabolism.
Serotonin receptor 5HTR2c Postsynaptic receptor for serotonin.
2C
Tyrosine hydroxylaseTH The rate-limiting enzyme in
the synthesis of
dopamine and norepinephrine.
Corticotrophin releasingCRF A hormone released by the hypothalamus
that
factor stimulates the release of corticotrophin
by the
anterior pituitary gland.
Dopamine receptor DRD4 A postsynaptic dopamine receptor.
4
Serotonin transporterSHTT A presynaptic membrane receptor
that serves
as a reuptake mechanism for
serotonin.
Dopamine receptor DRD3 A postsynaptic dopamine receptor.
3
Cytochrome P450 3A4 CYP3A4 A principal drug metabolizing
enzyme.
Norepinephrine transporterNET A membrane protein responsible
for .
termination of the action of
synaptic
norepinephrine.
Neurokinin or tachykininNK1/TACR1 A receptor for the neuropeptideaubstance
P.
receptor 1
Neuropeptide Yl receptorNPY1R A receptor for the neuropeptide
Y1: Belongs
to family of g-protein coupled
receptors with it
highest similarity to tachykinins
receptors.
Dopamine receptor DRD2 G protein-coupled dopamine receptor.
2
Guanine nucleotide Gbeta3 An important component of CAMP
binding mediated
protein, (33 signaling pathways.
Wolfram Syndrome WFS 1 A gene that plays a role in
1 gene the etiology of
Wolfram syndrome.
Beta 1 adrenergic ADRB1R An important component of the
receptor norepinephrine
signaling pathway. Antidepressants
are known
to suppress expression.
Brain derived neurotrophicBDNF A protein known to affect the
differentiation of
factor dopaminergic and serotonergic
neurons.
29
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Increased by antidepressants
and electro-
convulsive therapy.
Orphan G-protein HM74 A putative chemokine receptor.
coupled
receptor
Vasopressin receptorAVPR1A A receptor that stimulates
adrenocorticotrophic
1A
hormone (ACTH) release in the
anterior
pituitary.
Serotonin receptor SHT1A A receptor that is misregulated
1-A in depression,
as well as anxiety and stress.
Growth associated GAP43 A protein known to play a role
protein 43 in synaptic
plasticity. Increased levels
in suicide victims.
Guanine nucleotide GOLF (GNAL) A protein known to play a role
binding in signaling:
protein, a, subunit, possibly in cAMP mediated signaling
olfactory
type pathways and norepinephrine-related
pathways.
Clock protein CLOCK A protein associated with sleeping
patterns in
humans.
Corticotrophin hormoneCRHBP A protein capable of binding
to corticotrophin
binding protein releasing factor.
Dopamine transporterDAT (SLC6A3)A protein involved in the re-uptake
of
dopamine.
Phosphodiesterase PDE4b An enzyme believed to be involved
type 4b in
mediating central nervous system
effects of
therapeutic agents ranging from
antidepressants to anti-inflammatory
agents.
Catechol O-methyl COMT An enzyme that catalyzes the
transfer of a
transferase methyl group from s-adenosylmethionine
to a
catecholamine such as dopamine,
epinephrine,
or norepinephrine.
Melanin concentratingSLC1 A transmembrane protein that
serves as the
hormone receptor functional receptor of melanin
concentrating
hormone.
Transcription factorSEF2-1B A transcription factor that
binds to the e-box
(TCF4) present in the somatostatin
receptor 2 initiator
element (sstr2,-inr) to activate
transcription (by
similarity).
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Heat shock protein HSP70 A protein believed to interact
with
polypeptides during a variety
of assembly
processes in such a way as to
prevent the
formation of nonfunctional structures.
GABA-A receptor subunitGABRG2 A receptor known to mediate
inhibitory
neurotransmission, complexing
with DRDS
and promoting mutually inhibitory
functional
interactions between these receptor
systems,
putatively involved in the physiological
dependence on alcohol, and in
the maintenance
of psychomotor disease states.
GABA-A receptor subunitGABRAS A receptor known to be part
of the ligand-gated
ionic channels protein family.
Associated with
bipolar disorder.
Both the central nervous system and the endocrine system play an important
role in the
pathophysiology of CNS disorders, moreover, these systems contain important
drug targets and
genetic polymorphisms in these genes are highly relevant in the response to a
number of drugs.
The candidate gene analysis clearly provides a short-cut approach to the
identification of genes
and gene polymorphisms related to a particular disease when some information
concerning the
pathophysiology of the disorder is available as is the case for many CNS
disorders. However, it
should be noted that all of the biallelic markers disclosed in the instant
application can be
employed as part of genome-wide association studies or as part of candidate
region association
studies and such uses are specifically contemplated in the present invention
and claims. All of
the markers are known to be in close proximity to the genes with which they
are listed in Table 7.
For a portion of the markers, the precise' position of the marker with respect
to the various coding
and non-coding elements of the genes has also been determined.
II. Definitions
Before describing the invention in greater detail, the following definitions
are set forth to
illustrate and define the meaning and scope of the terms used to describe the
invention herein.
As used interchangeably herein, the terms "nucleic acid molecule",
"oligonucleotide",
and "polynucleotide", unless specifically stated otherwise, include RNA or,
DNA (either single
or double stranded, coding, complementary or antisense), or RNA/DNA hybrid
sequences of
more than one nucleotide in either single chain or duplex form (although each
of the above
species may be particularly specified). The term "nucleotide" as used herein
as an adjective to
describe molecules comprising RNA, DNA, or RNA/DNA hybrid sequences of any
length in
31
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
single-stranded or duplex form. More precisely, the expression "nucleotide
sequence"
encompasses the nucleic material itself and is thus not restricted to the
sequence information (i.e.
the succession of letters chosen among the four base letters) that
biochemically characterizes a
specific DNA or RNA molecule. The term "nucleotide" is also used herein as a
noun to refer to
individual nucleotides or varieties of nucleotides, meaning a molecule, or
individual unit in a
larger nucleic acid molecule, comprising a purine or pyrimidine, a ribose or
deoxyribose sugar
moiety, and a phosphate group, or phosphodiester linkage in the case of
nucleotides within an
oligonucleotide or polynucleotide. Although the term "nucleotide" is also used
herein to
encompass "modified nucleotides" which comprise at least one modifications (a)
an alternative .
linking group, (b) an analogous form of purine, (c) an analogous form of
pyrimidine, or (d) an
analogous sugar, for examples of analogous linking groups,
purine,,pyrimidines, and sugars see
for example PCT publication No. WO 95/04064. Preferred modifications of the
present invention
include, but are not limited to, 5-fluorouracil, 5-bromouracil, 5-
chlorouracil, 5-iodouracil,
hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-
earboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil,
dihydrauracil,
beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-
methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-
methylcytosine,
N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-
thiouracil
beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-
methylthio-N6-
isopentenyladenine, uracil-5-oxyacetic acid (v) ybutoxosine, pseudouracil,
queosine, 2-
thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-
methyluracil, uracil-5-oxyacetic .
acid methylester, uracil-5.-oxyacetic acid, 5-methyl-2-thiouracil, 3-(3-amino-
3-N-2-
carbaxypropyl) uracil, and 2,6-diaminopurine. The polynucleotide sequences of
the invention
may be prepared by any known method, including synthetic, recombinant, ex vivo
generation, ox
a combination thereof, as well as utilizing any purification methods known in
the art.
Methylenemethylimino linked oligonucleosides as well as mixed backbone
compounds having,
may be prepared as described in U.S. Pat. Nos. 5,3?8,825; 5,386,023;
5,489,677; 5,602,240; and
5,610,289. Formacetal and thioformacetal linked oligonucleosides may be
prepared as described
in U.S. Pat. Nos. 5,264,562 and 5,264,564. Ethylene oxide linked
oligonucleosides may be
prepared as described in U.S. Pat. No. 5,223,618. Phosphinate oligonucleotides
maybe prepared
as described in U.S. Pat. No. 5,508,270.. Alkyl phosphonate oligonucleotides
may be prepared
as described in U.S. Pat. No. 4,469,863. 3'-Deoxy-3'-methylene phosphonate
oligonucleotides
may be prepared as described in U.S. Pat. Nos. 5,610,289 or 5,625,050.
Phosphoramidite
oligonucleotides may be prepared as described in U.S. Pat. No. 5,256,775 or
U.S. Pat. No.
5,366,878. Alkylphosphonothioate oligonucleotides may be prepared as described
in published
PCT applications WO 94/17093 and WO 94/02499. 3'-Deoxy-3'-amino
phosphoramidate
oligonucleotides may be prepared as described in U.S. Pat. No. 5,476,925.
Phosphotriester
32
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
oligonucleotides may be prepared as described in U.S. Pat. No. 5,023,243.
Borano phosphate
oligonucleotides may be prepared as described in U.S. Pat. Nos. 5,130,302 and
5,177,198. The
polynucleotide sequences of the invention may be prepared by any known method,
including
synthetic, recombinant, ex vivo generation, or a combination thereof, as well
as utilizing any
purification methods known in the art.
The term "isolated" further requires that the material be removed from its
original
environment (e.g., the natural environment if it is naturally occurring). For
example, a naturally-
occurring polynucleotide present in a living animal is not isolated, but the
same polynucleotide,
separated from some or all of the coexisting materials in the natural system,
is isolated.
Specifically excluded from the definition of "isolated" are: naturally-
occurring chromosomes
(such as chromosome spreads), artificial chromosome libraries, genomic
libraries, and cDNA
libraries that exist either as an in vitro nucleic acid molecule preparation
or as a
transfected/transformed host cell preparation, wherein the host cells are
either an in vitro
heterogeneous preparation or plated as a heterogeneous population of single
colonies. Also
specifically excluded are the above libraries wherein a specified
polynucleotide of the present
invention makes up less than 5% of the number of nucleic acid molecule inserts
in the vector
molecules: Further specifically excluded are whole cell-genomic DNA or whole
cell~RNA or
mRNA preparations (including said whole cell preparations which are
mechanically sheared or
enzymatically digested). Further specifically excluded are the above whole
cell preparations as
either an in vitro preparation or as a heterogeneous mixture separated by
electrophoresis
(including blot transfers of the same) wherein the polynucleotide of the
invention has not further
been separated from the heterologous polynucleotides in the electrophoresis
medium (e.g.,
further separating by excising a single band from a heterogeneous band
population in an agarose
gel or nylon blot).
As used herein, the term "purified" does not require absolute purity; rather,
it is intended as
a relative definition. Individual 5' EST clones isolated from a cDNA library
have been
conventionally purified to electrophoretic homogeneity. The sequences obtained
from these clones
could not be obtained directly either from the library or from total human
DNA. The cDNA clones
are not naturally occurring as such, but rather are obtained via manipulation
of a partially purified
naturally occurring substance (messenger RNA). The conversion of mRNA into a
cDNA library
involves the creation of a synthetic substance (cDNA) and pure individual cDNA
clones can be
isolated from the synthetic library by clonal selection. Thus, creating a cDNA
library from
messenger RNA and subsequently isolating individual clones from that library
results in an
approximately 104-106 fold purification of the native message. Purification of
starting material or
natural material to at least one order of magnitude, preferably two or three
orders, and more
preferably four or five orders of magnitude is expressly contemplated.
Alternatively, purification
may be expressed as "at least" a percent purity relative to heterologous
polynucleotides (DNA, RNA
33
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
or both). As a preferred embodiment, the polynucleotides of the present
invention are at least; 10%,
20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 96%, 98%, 99%, or 100% pure
relative
to heterologous polynucleotides. As a further preferred embodiment the
polynucleotides have an
"at least" purity ranging from any number, to the thousandth position, between
90% and 100% (e.g.,
5' EST at least 99.995% pure) relative to heterologous polynucleotides.
Additionally, purity of the
polynucleotides may be expressed as a percentage (as described above) relative
to all materials
and compounds other than the carrier solution. Each number, to the thousandth
position, may be
claimed as individual species of purity.
The term "primer" denotes a specific oligoiiucleotide sequence which is
complementary
to a target nucleotide sequence and used to hybridize to the 'target
nucleotide sequence. A primer
serves as an initiation point for nucleotide polymerization catalyzed by DNA
polymerase, RNA
polymerase or reverse transcriptase.
The term "probe" denotes a defined nucleic acid segment (or nucleotide analog
segment,
e.g., polynucleotide as defined herein) which can be used to identify a
specific polynucleotide
sequence present in samples, said nucleic acid segment comprising a nucleotide
sequence
complementary of the specific polynucleotide sequence to be identified.
The term "CNS disorder" refers to any condition linked to dysfunction of the
central
. nervous system which is known in the art. A CNS disorder includes
dysfunction of one or
several physiological systems contributing to the function of the central
nervous system, which
includes the endocrine system and the peripheral nervous system. A CNS
disorder further refers
to disorders in neurotransmitter synthesis and degradation, neurotransmitter
function,
neurotransmitter receptor function, weurotransmitter signal transduction,
neurotransmitter
transporter function, motor neuron function, hormone synthesis and
degradation, hormone
function, hormone receptor function and hormone signal transduction. "CNS
disorders" include
mood disorders such as depression, bipolar disorder, anxiety, attention
deficit disorder and
schizophrenia. "CNS disorders" also include neurodegenerative disorders such
as Parkinson's
disease, Huntington's disease, Pick's disease, progressive supranuclear palsy,
Lewy body
dementia and Wolfram syndrome (diabetes insipidus, diabetes mellitus, optic
atrophy and
deafness). "CNS disorders" also include disorders of movement such as motor
neuron disease'as
well as diseases involving the intellect such as Alzheimer's disease,
Wernicke's encephalopathy
and Jakob-Creutzfeldt disease. "CNS disorders" further include other disorders
such as coma,
head injury, cerebral infarction, epilepsy, alcoholism and states of mental
retardation. All of the
possible CNS disorders listed herein are included in, or may be excluded from,
the present
invention as individual species.
The term "depression" as used herein refers to both unipolar major depression
(or major
depressive disorder) and bipolar disorder.
34
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
An "agent acting on a CNS disorder" includes any drug or compound known in the
art
that addresses, reduces or alleviates one or more symptoms of a CNS disorder.
"Agents acting
on a CNS disorder" includes any drug or a compound modulating the activity or
concentration of
an enzyme or regulatory molecule involved in a CNS disorder that is known in
the art. An agent
acting on a CNS disorder includes but is not limited to tyrosine hydroxylase,
monoamine oxidase .
A/B, dopamine (3-hydroxylase, aldehyde dehydrogenase, phenylethanolamine N-
methyltransferase, catechol o-methyltransferase, tryptophan hydroxylase,
acetyl coenzyme A,
proteinases, oestrogens, glucocorticoids, mineralocorticoids, nicotine,
substance P and precursors
to neurotransmitters such as tryptophan. "Agent acting on a CNS disorder"
further refers to
compounds modulating the synthesis, degradation, reuptake and action of
neurotransmitters and
hormones such as tricyclic antidepressants (TCAs), monoamine oxidase
inhibitors (MAOIs),
serotonin selective reuptake inhibitors (SSRIs), selective norepinephrine
reuptake inhibitor (NRI)
such as reboxetine, dual serotonin and norepinephrine reuptake inhibitor
(SNRI), serotonin-2
antagonist/reuptake inhibitors (SARIS), noradrenergic and specific
serotonergic antidepressants
(NaSSAs), drugs that cause increased dopamine release in the brain such as
levodopa, dopamine
receptor agonists such as bromocriptine, dopamine antagonists such as
metoclopramide,
neuroleptic drugs such as phenothiazines, adrenergic agonists such as
clonidine, N-methyl-D-
asparate antagonists such as phencyclidine, anticholinergic compounds,
benzodiazepine drugs
and anxiolytic compounds. Preferably, "agent acting on a CNS disorder" refers
to the
' antidepressant drug Reboxetine.
The terms "response to an agent acting on a CNS disorder" refer to drug
efficacy,
including but not limited to the ability to metabolize a compound, the ability
to convert a pro-
drug to an active drug, and to the pharmacokinetics (absorption, distribution,
elimination) and the
pharmacodynamics (receptor-related) of a drug in an individual.
The terms "side effects to an agent acting on a CNS disorder" refer to adverse
effects of
therapy resulting from extensions of the principal pharmacological action of
the drug or to
idiosyncratic adverse reactions resulting from an interaction of the drug with
unique host factors.
"Side effects to an agent acting on a CNS disorder" include, but are not
limited to autonomic side
effects such as orthostatic hypotension, blurred vision, dry mouth, nasal
congestion and
constipation. "Side effects to an agent acting on a CNS disorder" also include
anxiety, sleep '
disturbances, sexual dysfunction, gastrointestinal disturbances, nausea,
diarrhea, orthostasis,
dizziness, sedation, hypertension and shock.
The terms "trait" and "phenotype" are used interchangeably herein and refer to
any
visible, detectable or otherwise measurable property of an organism such as
symptoms of, or
susceptibility to a disease for example. Typically the terms "trait" or
"phenotype" are used
herein to refer to symptoms of, or susceptibility to a CNS disorder; or to
refer to an individual's
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
response to an agent acting on a CNS disorder; or to refer to symptoms of, or
susceptibility to
side effects to an agent acting on a GNS disorder.
The term "allele" is used herein to refer to variants of a nucleotide
sequence. A biallelic
polymorphism has two forms. Typically the first identified allele is
designated as the original
allele whereas other alleles are designated as alternative alleles. Diploid
organisms may be
homozygous or heterozygous fox an allelic form.
The term "heterozygosity rate" is used herein to refer to the incidence of
individuals in a
population, which are heterozygous at a particular allele. In a biallelic
system the heterozygosity
rate is on average equal to 2Pa(1-Pa), where Pa is the frequency of the least
common allele. In
order to be useful.in genetic studies a genetic marker should have an adequate
level of
heterozygosity to allow a reasonable probability that a randomly selected
person will be
heterozygous.
The term "genotype" as used herein refers to the identity of the alleles
present in an
individual or a sample. In the context of the present invention a genotype
preferably refers to the
description of the biallelic marker alleles present in an individual or a
sample. The term
"genotyping" a sample or an individual for a biallelic marker consists of
determining the specific
allele or the specific nucleotide carried by an individual at a biallelic
marker.
The term "mutation" as used herein refers to a difference in DNA sequence
between or
among different genomes or individuals which has a frequency below 1%.
The term "haplotype" refers to a combination of alleles present in an
individual or a
sample. In the context of the present invention a haplotype preferably refers
to a combination of
biallelic marker alleles found in.a given individual and which may be
associated with a
phenotype.
The term "polymorphism" as used herein refers to the occurrence of two or more
alternative genomic sequences or alleles between or among different genomes or
individuals.
"Polymorphic" refers to the condition in which two or more variants of a
specific genomic
sequence can be found in a population. A "polymorphic site" is the locus at
which the variation
occurs. A single nucleotide polymorphism is a single base pair change.
Typically a single
nucleotide polymorphism is the replacement of one nucleotide by another
nucleotide at~the
polymorphic site. Deletion of a single nucleotide or insertion of a single
nucleotide, also give
rise to single nucleotide polymorphisms. In the context of the present
invention "single
nucleotide polymorphism" preferably refers to a single nucleotide
substitution. Typically,
between different genomes or between different individuals, the polymorphic
site may be
occupied by two different nucleotides.
The terms "biallelic polymorphism" and "biallelic marker" are used
interchangeably
herein to refer to a polymorphism having two alleles at a fairly high
frequency in the population,
preferably a single nucleotide polymorphism. A "biallelic marker allele"
refers to the nucleotide
36
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
variants present at a biallelic marker site. Typically the frequency of the
less common allele of
the biallelic markers of the present invention has been validated to be
greater than 1%, preferably
the frequency is greater than 10%, more preferably the frequency is at least
20% (i.e.
heterozygosity rate of at least 0.32), even more preferably the frequency is
at least 30% (i.e.
heterozygosity rate of at least 0.42). A biallelic marker wherein the
frequency of the less
common allele is 30% or more is termed a "high quality biallelic marker."
The location of nucleotides in a polynucleotide with respect to the center of
the
polynucleotide are described herein in the following manner. When a
polynucleotide has an odd
number of nucleotides, the nucleotide at an equal distance from the 3' and 5'
ends of the
polynucleotide is considered to be "at the center" of the polynucleotide, and
any nucleotide
immediately adjacent to the nucleotide at the center, or the nucleotide at the
center itself is
considered to be "within 1 nucleotide of the center." With an odd number of
nucleotides in a
polynucleotide any of the five nucleotide positions in the middle of the
polynucleotide would be
considered to be within 2 nucleotides of the center, and so on. When a
polynucleotide has an
even number of nucleotides, there would be a bond and not a nucleotide at the
center. of the
polynucleotide. Thus, either of the two central nucleotides would be
considered to be "within 1
nucleotide'of the center" and any of the four nucleotides in the middle of the
polynucleotide
would be considered to be "within 2 nucleotides of the center", and so on. For
polymorphisms
which involve the substitution, insertion or deletion of 1 or more
nucleotides, the polymorphism,
allele or biallelic marker is "at the center" of a polynucleotide if the
difference between the
distance from the substituted, inserted, or deleted polynucleotides of the
polymorphism and the
3' end of the polynucleotide, and the distance from the substituted, inserted,
or deleted
polynucleotides of the polymorphism and the 5' end of the polynucleotide is
zero or one
nucleotide. If this difference is 0 to 3, then the polymorphism is considered
to be "within 1
nucleotide of the center." If the difference is 0 to 5, the polymorphism is
considered to be
"within 2 nucleotides of the center." If the difference is 0 to 7, the
polymorphism is considered
to be "within 3 nucleotides of the center," and so on. For polymorphisms which
involve the
substitution, insertion or deletion of 1 or more nucleotides, the
polymorphism, allele or biallelic
marker is "at the center" of a polynucleotide if the difference between the
distance from the
substituted, inserted, or deleted polynucleotides of the polymozphism and the
3' end of the
polynucleotide, and the distance from the substituted, inserted, or deleted
polynucleotides of the
polymorphism and the 5' end of the polynucleotide is zero or one nucleotide.
If this difference is
0 to 3, then the polymorphism is considered to be "within 1 nucleotide of the
center." If the
difference is 0 to 5, the polymorphism is considered to be "within 2
nucleotides of the center." If
the difference is 0 to 7, the polymorphism is considered to be "within 3
nucleotides of the
center," and so on.
37
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
The term "upstream" is used herein to refer to a location which is toward the
5' end of the
polynucleotide from a specific reference point.
The terms "base paired" and "Watson & Crick base paired" are used
interchangeably
herein to refer to nucleotides which can be hydrogen bonded to one another be
virtue of their
sequence identities in a manner like that found in double-helical DNA with
thymine or uracil
residues linked to adenine residues by two hydrogen bonds and cytosine and
guanine residues
linked by three hydrogen bonds (See Stryer, L., Biochernistiy, 4th edition,
1995).
The terms "complementary" or "complement thereof' are used herein to refer to
the
sequences of polynucleotides which is capable of forming Watson & Crick base
pairing with
another specified polynucleotide throughout the entirety of the complementary
region. This term
is applied to pairs of polynucleotides based solely upon their sequences and
not any particular set
of conditions under which the two polynucleotides would actually bind.
As used herein the term "CNS disorder-related biallelic marker" relates to a
set of
biallelic markers in linkage disequilibrium with genes disclosed in Tables 7(A-
D) which express
proteins that. are involved in the pathophysiology CNS disorders. The term CNS
disorder-related
biallelic marker encompasses all of the biallelic markers disclosed in Tables
7(A-D). The
preferred CNS disorder-related biallelic marker alleles of the present
invention include each one
of the alleles described in Tables 7, 8, 9, and 10 individually or in groups
consisting of all the .
possible combinations of the alleles included in Tables 7, 8, 9, and 10. In
addition, Table 7 may
include Tables 7A-7D, or Tables 7A, 7B, 7C or 7D as individual embodiments of
the present
invention or in any combination of the four.
The term "sequence described in Table 8" is used herein to refer to the entire
collection
of nucleotide sequences or any individual sequence defined in Table 8. The SEQ
ID that
contains each "sequence described in Table 8" is provided in the column
labeled, "SEQ ID NO."
, The range of nucleotide positions within the Sequence ID of which each
sequence consists is
provided in the same row as the Sequence ID in a column labeled, "POSITION
RANGE OF
PREFERRED SEQUENCE". It should be noted that some of the Sequence ID numbers
have
multiple sequence ranges listed, because they contain multiple "sequences
described in Table 8."
Unless otherwise noted the term "sequence described in Table 8" is to be
construed as
. encompassing sequences that contain either of the two alleles listed in the
columns labeled, "1sT
ALLELE" and "2ND ALLELE" at the position identified in field <222> of the
allele feature in the
appended Sequence Listing for each Sequence ID number referenced in Table 8.
The term "sequence described in Table 9" is used herein to refer to the entire
collection
of nucleotide sequences or any individual sequence defined in Table 9. Unless
otherwise noted,
the "sequences described in Table 9" consist of the entire sequence of each
Sequence >D
provided in the column labeled, "SEQ ID NO." Also unless otherwise noted the
term "sequence
described in Table 9" is to be construed as encompassing sequences that
contain either of the two
38
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
alleles listed in the columns labeled, "ORIGINAL ALLELE" and "ALTERNATIVE
ALLELE"
at the position identified in field <222> of the allele feature in the
appended Sequence Listing for
each Sequence ID number referenced in Table 9.
The term "sequence described in Table 10" is used herein to refer to the
entire collection
of nucleotide sequences or any individual sequence defined in Table 10. Unless
otherwise noted,
the "sequences described in Table 10" consist of the entire sequence of each
Sequence )D
provided in the column labeled, "SEQ ID NO." Also unless otherwise noted the
term "sequence
described in Table 10" is to be construed as encompassing sequences that
contain either of the
two alleles listed in the columns labeled, "1 ST ALLELE" and "2ND ALLELE" at
the position
identified in field <222> of the allele feature in the appended Sequence
Listing for each
Sequence ID number referenced in Table 10:
The term "sequence described in Table 11" is used herein to refer to the
entire collection
of nucleotide sequences or any individual sequence defined in Table 11. The
SEQ ID that
contains each "sequence described in Table 11 " is provided in the column
labeled, "SEQ ID
NO." The range of nucleotide positions within the Sequence ID of which each
sequence consists
is provided in the same row as the Sequence ID in a column labeled, "POSITION
RANGE OF .'
PREFERRED SEQUENCE". It should be noted that some of the Sequence ID numbers
have
multiple sequence ranges listed, because they contain multiple "sequences
described in Table
11."
The term "sequence described in Table 12" is used herein to refer to the
entire collection
of nucleotide sequences or any individual sequence defined in Table 12. The
SEQ ID that
contains each "sequence described in Table 12" is provided in the column
labeled, "SEQ ID
NO." The range of nucleotide positions within the Sequence ID of which half of
the sequences
consists is provided in the same row as the Sequence ID in a column labeled,
"POSITION
RANGE OF MICROSEQUENCING PRIMERS". The remaining half of the sequences
described in Table 12 are complementary to the range of nucleotide positions
within the
Sequence ID provided in the same row as the Sequence ID in a column labeled,
"COMPLEMENTARY POSITION RANGE OF MICROSEQUENCING PRIMERS".
The term "sequence described in Table 13" is used herein to refer to the
entire collection
of nucleotide sequences or any individual sequence defined in Table 13. The
SEQ ID that
contains each "sequence described in Table 13" is provided in the column
labeled, "SEQ ID
NO." The range of nucleotide positions within the Sequence ID of which half of
the sequences
consists is provided in the same row as the Sequence ID in a column labeled,
"POSITION
RANGE OF AMPLIFICATION PRIMERS". The remaining half of the sequences described
.in
Table 13 are complementary to the range of nucleotide positions within the
Sequence ID
provided in the same row as the Sequence ID in a column labeled,
"COMPLEMENTARY '
POSITION RANGE OF AMPLIFICATION PRIMERS".
39
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
The term "sequence described in Table 14" is used herein to refer to the
entire collection
of nucleotide sequences or any individual sequence defined in Table 14. The
SEQ ID that
contains each "sequence described in Table 14" is provided in the column
labeled, "SEQ ID
NO.". The range of nucleotide positions within the Sequence ID of which each
sequence consists
is provided in the same row as the Sequence ID in a column labeled, "POSITION
RANGE OF
PROBES". The sequences which are complementary to the ranges listed in the
column labeled,
"POSITION RANGE OF PROBES" are also encompassed by the term, "sequence
described in
Table l4." Unless otherwise noted the term "sequence described in Table 14" is
to be construed
as encompassing sequences that contain either of the two alleles listed in the
allele feature in the
appended Sequence Listing for each Sequence ID number referenced in Table 14.
The terms "biallelic marker described in Table"'and "allele described in
Table" are used
herein to refer to any or all alleles which are listed in the allele feature
in the appended Sequence
Listing for each Sequence ID number referenced in the particular Table being
mentioned.
The following abbreviations are used in this disclosure: serotonin receptor 6
gene is
abbreviated SHTR6; serotonin receptor 7 gene is abbreviated SHTR7; neuronal
nicotinic acid
receptor a7 gene is abbreviated CHRNA7; corticotrophin releasing factor
receptor lgene is
abbreviated CRFRl; mineralocorticoid receptor gene is abbreviated MLR;
corticotrophin
releasing factor receptor 2 gene is abbreviated CRFR2; glueocortieoid receptor
gene is
abbreviated GRL; monoamine oxidases A and B genes are abbreviated MAOA/B;
serotonin
receptor 2C gene is abbreviated SHTR2c; tyrosine hydroxylase gene is
abbreviated TH;
corticotrophin releasing factor gene is abbreviated CRF; dopamine receptor 4
gene is abbreviated
DRD4; serotonin transporter gene is abbreviated SHTT; dopamine receptor 3 gene
is abbreviated
DRD3; cytochrome P450 3A4 gene is abbreviated CYP3A4; norepinephrine
transporter gene is
abbreviated NET; neurokinin or tachykinin receptor 1 gene is abbreviated
NK11TACR1;
dopamine receptor 4 gene is abbreviated DRD2; guanine nucleotide binding
protein, (33 gene is
abbreviated Gbeta3; Wolfram Syndrome 1 gene is abbreviated WFS1; Beta 1
adrenergic receptor
gene is abbreviated ADRB 1R; Brain derived neurotrophic factor gene is
abbreviated BDNF; '
Orphan G-protein coupled receptor gene is abbreviated HM74; Vasopressin
receptor 1A gene is
abbreviated AVPR1A; Serotonin receptor 1-A gene is abbreviated SHT1A; Growth
associated
protien 43 gene is abbreviated GAP43; Guanine nucleotide binding protein, oc
subunit,, olfactory
type gene is abbreviated GOLF (GNAL); Clock protein gene is abbreviated CLOCK;
Corticotrophin hormone binding protein gene is abbreviated CRHBP; Dopamine
transporter gene
is abbreviated DAT (SLC6A3); Phosphodiesterase type 4b gene is abbreviated
PDE4b; Catechol
O-methyl transferase gene is abbreviated COMT; Melanin concentrating hormone
receptor gene
is abbreviated SLCI; Transcription factor gene is abbreviated SEF2-1B (TCF4);
Heat shock
protein gene is abbreviated HSP70; GABA-A receptor subunit gene is abbreviated
GABRG2;
and GABA-A receptor subunit 5 gene is abbreviated GABRAS.
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
III, Biallelic Markers and Polynucleotides Comprising Biallelic Markers
A. Advantages of the Biallelic Markers of the Present Invention
The CNS disorder-related biallelic markers of the present invention offer a
number of
important advantages over other genetic markers such as RFLP (Restriction
fragment length
polymorphism) and VNTR (Variable Number of Tandem Repeats) markers.
The first generation of markers, were RFLPs, which are variations that modify
the length
of a restriction fragment. But methods used to identify and to type RFLPs are
relatively wasteful
of materials, effort, and time. The second generation of genetic markers were
VNTRs, which can
be categorized as either minisatellites or microsatellites. Minisatellites are
tandemly repeated
DNA sequences present in units of 5-50 repeats which are distributed along
regions of the human
chromosomes ranging from 0.1 to 20 kilobases in length. Since they present
many possible
alleles, their informative content is very high. Minisatellites are scored by
performing Southern
blots to identify the number of tandem repeats present in a nucleic acid
sample from the .
' individual being tested. However, there are only 104 potential VNTRs that
can be typed by'
Southern blotting. Moreover, both RFLP and VNTR markers are costly and time-
consuming to
develop and assay in large numbers.
Single nucleotide polymorphism or biallelic markers can be used in the same
manner as
RFLPs and VNTRs but offer several advantages. Single nucleotide polymorphisms
are densely
spaced in the human genome and represent the most frequent type of variation.
An estimated
number of more than 10' sites are scattered along the 3x109 base pairs of the
human genome.
Therefore, single nucleotide polymorphism occur at a greater frequency and
with greater
uniformity than RFLP or VNTR markers which means that there is a greater
probability that such
a marker will be found in close proximity to a genetic locus of interest.
Single nucleotide
polymorphisms are less variable than VNTR markers but are mutationally more
stable.
Also, the different forms of a characterized single nucleotide polymorphism,
such as the
biallelic markers of the present invention, are often easier to distinguish
and can therefore be
typed easily on a routine basis. Biallelic markers have single nucleotide
based alleles and they
have only two common alleles, which allows highly parallel detection and
automated scoring.
The biallelic markers of the present invention offer the possibility of rapid,
high-throughput
genotyping of a large number of individuals.
Biallelic markers are densely spaced in the genome, sufficiently informative
and can be
assayed in large numbers. The combined effects of these advantages make
biallelic markers
extremely valuable in genetic studies. Biallelic markers can be used in
linkage studies in
families, in allele sharing methods, in linkage disequilibrium studies in
populations, in
association studies of case-control populations. An important aspect of the
present invention is
that biallelic markers allow association studies to be performed to identify
genes involved in
41
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
complex traits. Association studies examine the frequency of marker alleles in
unrelated case-
and control-populations and are generally employed in the detection of
polygenic or sporadic
traits. Association studies may be conducted within the general population and
are not limited to
studies performed on related individuals in affected families (linkage
studies). Biallelic markers
in different genes can be screened in parallel for direct association with
disease or response to a
treatment. This multiple gene approach is a powerful tool for a variety of
human genetic studies
as it provides the necessary statistical power to examine the synergistic
effect of multiple genetic
factors on a particular phenotype, drug response, sporadic trait, or disease
state with a complex
genetic etiology.
B. Polynucleotides of the Present Invention
The present invention encompasses polynucleotides for use as primers and
probes in the
methods of the invention. These polynucleotides may consist of, consist
essentially 'of, or
comprise a contiguous span of nucleotides of a sequence from any sequence in
the Sequence
Listing as well as.sequences which are complementary thereto ("complements
thereof'). The
"contiguous span" may be at least 8, 10, 12, 15, 18, 20, 25, 35, 40, 50, 70,
80, 100, 250, 500, .
1000, 2000 or 3000 nucleotides in length, to the extent that a contiguous span
of these lengths is
consistent with the lengths of the particular Sequence ID. It should be noted
that the
polynucleotides of the present invention are not limited to having the exact
flanking sequences
surrounding the polymorphic bases which, are enumerated in the Sequence
Listing. Rather, it
, will be appreciated that the flanking sequences surrounding the biallelic
markers, or any of the
primers of probes of the invention which, are more distant from the markers,
may be lengthened
or shortened to any extent compatible with their intended use and the present
invention
specifically contemplates such sequences. It will be appreciated that the
polynucleotides referred
to in the Sequence Listing may be of any length compatible with their intended
use. Also the
flanking regions outside of the contiguous span need not be homologous to
native flanking
sequences which actually occur in human subjects. The addition of any
nucleotide sequence,
which is compatible with the nucleotides intended use is specifically
contemplated. The
contiguous span may optionally include the CNS disorder-related biallelic
marker in said
sequence. Biallelic markers generally consist of a polymorphism at one single
base position.
Each biallelic marker therefore corresponds to two forms of a polynucleotide
sequence which,
when compared with one another, present a nucleotide modification at one
position. Usually, the
nucleotide modification involves the substitution of one nucleotide for
another. Optionally either
the original or the alternative allele of the biallelic markers disclosed in
Table 9, or the first or
second allele disclosed in Table 8 and 10 may be specified as being present at
the CNS disorder-
related biallelic marker.
The invention also relates to polynucleotides that hybridize, under conditions
of high or
intermediate stringency, to a polynucleotide of a sequence from any sequence
in the Sequence
42
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Listing as well as sequences, which are complementary thereto. Preferably such
polynucleotides
are at least 20, 25, 35, 40, 50, 70, 80, 100, 250, 500, 1000, 2000 or 3000
nucleotides in length, to
the extent that a polynucleotide of these lengths is consistent with the
lengths of the particular
Sequence m. Preferred polynucleotides comprise a CNS disorder-related
biallelic marker.
Optionally either the original or the alternative allele of the biallelic
markers disclosed in Table 9
may be specified as being present at the CNS disorder-related biallelic
marker. Conditions of
high and intermediate stringency are further described herein.
The preferred polynucleotides of the invention include the sequence ranges
included in
any one the sequence ranges of Tables 8 and 11 to 14 individually or in groups
consisting of all
the possible combinations of the ranges of included in Tables 8, and 11 to 14.
The preferred
polynucleotides of the invention also include fragments of at least 8; 10, 12,
15, 18, 20, 25, 35,
40, 50, 70, 80, 100, 250, 500 or 1000 consecutive nucleotides of the sequence
ranges included in
any one of the sequence ranges of Tables 9, and 12 to 15'to the extent that
fragments of these
lengths are consistent with the lengths of the particular sequence range. The
preferred
, polynucleotides of the invention also include fragments of at least 8, 10,
12, 15, 18, 20, 25, 35,
40, 50, 70, 80, 100, 250, 500 or 1000 consecutive nucleotides of the sequence
complementary to
the sequence ranges included in any one of the sequence ranges of Tables 8 and
11 to 14 to.the
extent that fragments of these lengths are consistent with the lengths of the
particular sequence
range.
. The primers of the present invention may be designed from the disclosed
sequences for
any method known in the art. A preferred set of primers is fashioned such that
the 3' end of the
contiguous span of identity with the sequences of the Sequence Listing is
present at~the 3' end of
the primer. Such a configuration allows the 3' end of the primer to hybridize
to a selected nucleic
acid sequence and dramatically increases the efficiency of the primer for
amplification or
~ sequencing reactions. In a preferred set of primers the contiguous span is
found in one of the
sequences described in Table 11. Allele specific primers may be designed such
that a biallelic
marker is at the 3' end of the contiguous span and the contiguous span is
present at the 3' end of
the primer. Such allele specific primers tend to selectively prime an
amplification or sequencing
reaction so long as they are used with a nucleic acid sample that contains one
of the two alleles
present at a biallelic marker. The 3' end of primer of the invention may be
located within or at
least 2, 4, 6, 8, 10, 12, 15, 18, 20, 25, 50, 100, 250, 500, 1000, 2000 or
3000 to the extent that this
distance is consistent with the particular Sequence ID, nucleotides upstream
of a CNS disorder-
related biallelic marker in said sequence or at any other location which is
appropriate for their
intended use in sequencing, amplification or the location of novel sequences
or markers. A list
of preferred amplification primers is disclosed in Table 13. Primers with
their 3' ends located 1
nucleotide upstream of a CNS disorder-related biallelic marker have a special
utility as
microsequencing assays. Preferred microsequencing primers are described in
Tables 12.
43
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
The probes of the present invention may be designed from the disclosed
sequences for
any method known in the art, particularly methods which allow for testing if a
particular
sequence or marker disclosed herein is present. A preferred set of probes may
be designed for
use in the hybridization assays of the invention in any manner known in the
art such that they
selectively bind to one allele of a biallelic marker, but not the other under
any particular set of
assay conditions. Preferred hybridization probes may consists of, consist
essentially of, or
comprise a contiguous span which ranges in length from 8, 10, 12, 15, 18 or 20
to 25, 35, 40, 50,
60, 70, or 80 nucleotides, or be specified as being 12, 15, 18, 20, 25, 35,
40, or 50 nucleotides in
length and including a CNS disorder-related biallelic marker of said sequence.
Optionally the
original allele or alternative allele disclosed in Table 9 and the first or
second allele disclosed in
Tables 8 and 10 may be specified as being present at the biallelic marker
site. Optionally, .said
biallelic marker may be within 6, 5, 4, 3, 2, or 1 nucleotides of the center
of the hybridization
probe or at the center of said probe. A particularly preferred set of
hybridization probes is
disclosed in Table 14 or a sequence complementary thereto.
Any of the polynucleotides of the present invention can be labeled, if
desired, by
incorporating a label detectable by spectroscopic, photochemical, biochemical,
immunochemical,
or chemical means. For example, useful labels include radioactive substances,
fluorescent dyes.
or biotin. Preferably, polynucleotides are labeled at their 3' and 5' ends. A
label can also be used
to capture the primer, so as to facilitate the immobilization of either the
primer or a primer
extension product, such as amplified DNA, on a solid support. A capture label
is attached to the
primers or probes and can be a specific binding member which forms a binding
pair with the
solid's phase reagent's specific binding member (e.g. biotin and
streptavidin). Therefore
depending upon the type of label carried by a polynucleotide or a probe, it
may be employed to
capture or to detect the target DNA. Further, it will be understood that the
polynucleotides,
- primers or probes provided herein, may, themselves, serve as the capture
label. For example, in
the case where a solid phase reagent's binding member is a nucleic acid
sequence, it may be
selected such that it binds a complementary portion of a primer or probe to
thereby immobilize
the primer or probe to the solid phase. In cases where a polynucleotide probe
itself serves as the
binding member, those skilled in the art will recognize that the probe will
contain a sequence or
"tail" that is not complementary to the target. In the case where a
polynucleotide primer itself
serves as the capture label, at least a portion of the primer will be free to
hybridize with a nucleic
acid on a solid phase. DNA Labeling techniques are well known to the skilled
technician.
Any of the polynucleotides, primers and probes of the present invention can be
conveniently immobilized on a solid support. Solid supports are known to those
skilled in the art
and include the walls of wells of a reaction tray, test tubes, polystyrene
beads, magnetic beads,
nitrocellulose strips, membranes, microparticles such as latex particles,
sheep (or other animal)
red blood cells, duracytes~ and others. The solid support is not critical and
can be selected by
44
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
one skilled in the art. Thus, latex particles, microparticles, magnetic or non-
magnetic beads,
membranes, plastic tubes, walls of microtiter wells, glass or silicon chips,
sheep (or other suitable
animal's) red blood cells and duracytes are all suitable examples. Suitable
methods for
immobilizing nucleic acids on solid phases include ionic, hydrophobic,
covalent interactions and
the like. A solid support, as used herein, refers to any material which is
insoluble, or can be
made insoluble by a subsequent reaction. The solid support can be chosen for
its intrinsic ability
to attract and immobilize the capture reagent. Alternatively, the solid phase
can retain an
additional receptor which has the ability to attract and immobilize the
capture reagent. The
additional receptor can include a charged substance that is oppositely charged
With respect to the
capture reagent itself or to a charged substance conjugated to the capture
reagent. As yet another
alternative, the receptor molecule can be any specific binding member which is
immobilized
upon (attached to) the solid support and which has the ability to immobilize
the capture reagent
through a specific binding reaction. The receptor molecule enables the
indirect binding of the
capture reagent to a solid support material before the performance of the
assay or during the
performance of the assay. The solid phase thus can be a plastic, derivatized
plastic, magnetic or
non-magnetic metal, glass or silicon surface of a test tube, microtiter well,
sheet, bead,
microparticle, chip, sheep (or other suitable animal's) red blood cells,
duracytes~ and other
configurations known to those of ordinary skill in the art. The
polynucleotides of the invention
can be attached to or immobilized on a solid support individually or in groups
of at least 2, 5, 8,
10, 12, 15, 20, or 25 distinct polynucleotides of the inventions to a single
solid support. In
addition, polynucleotides other than those of the invention may be attached to
the same solid
support as one or more polynucleotides of the invention.
Any polynucleotide provided herein may be attached in overlapping areas or at
random
locations on the solid support. Alternatively the polynucleotides of the
invention may be
attached in an ordered array wherein each polynucleotide is attached to a
distinct region of the
solid support which does not overlap with the attachment site of any other
polynucleotide.
Preferably, such an ordered array of polynucleotides is designed to be
"addressable" where he
distinct locations are recorded and can be accessed as part of an assay
procedure. Addressable
polynucleotide arrays typically comprise a plurality of different
oligonucleotide probes that are
coupled to a surface of a substrate in different known locations. The
knowledge of the precise
location of each polynucleotides location makes these "addressable" arrays
particularly useful in
hybridization assays. Any addressable array technology known in the art can be
employed with
the polynucleotides of the invention. One particular embodiment of these
polynucleotide arrays
is known as the GenechipsT"~, and has been generally described in US Patent
5,143,854; PCT
publications WO 90J15070 and 92110092. These arrays may generally be produced
using
mechanical synthesis methods or light directed synthesis methods, which
incorporate a
combination of photolithographic methods and solid phase oligonucleotide
synthesis (Fodor et
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
al., Science, 251:767-777, 1991). The immobilization of arrays of
oligonucleotides on solid
supports has been rendered possible by the development of a technology
generally identified as
"Very Large Scale Immobilized Polymer Synthesis" (VLSIPSTM) in which,
typically, probes are
immobilized in a high density array on a solid surface of a chip. Examples of
VLSIPSTM
technologies are provided in US Patents 5,143,854 and 5,412,087 and in PCT
Publications WO
90115070, WO 92110092 and WO 95/11995, which describe methods for forming
oligonucleotide arrays through techniques such as light-directed synthesis
techniques. In
designing strategies aimed at providing arrays of nucleotides immobilized on
solid supports,
further presentation strategies were developed to order and display the
oligonucleotide arrays on
the chips in an attempt to maximize hybridization patterns and sequence
information. Examples
of such presentation strategies are disclosed in PCT Publications WO 94/12305,
WO 94/11530,
WO 97129212 and WO 97/31256.
Oligonucleotide arrays may comprise at least one of the sequences selected
from the
group consisting of SEQ ID No. 1-130; and the sequences complementary thereto
or a fragment
thereof of at least 8, 10, 12, 15, 18, 20, 25, 35, 40, 50, 70, 80, 100, 250,
500, 1000, 2000 or 3000
consecutive nucleotides, to the extent that fragments of these lengths is
consistent with the
lengths of the particular Sequence ID, for determining whether a sample
contains one or more
alleles of the biallelic markers of the present invention. Oligonucleotide
arrays may also
comprise at least one of the sequences selected from the group consisting of
SEQ )D No. 1-130;
and the sequences complementary thereto or a fragment thereof of at least 8,
10, 12, 15, 18, 20,
25, 35, 40, 50, 70, 80, 100, 250, 500, 1000, 2000 or 3000 consecutive
nucleotides, to the extent
that fragments of these lengths is consistent with the lengths of the
particular Sequence m, for
amplifying one or more alleles of the biallelic markers of Table 7. In other
embodiments, arrays
may also comprise at least one of the sequences selected from the group
consisting of SEQ ID
No. 1-130; and the sequences complementary thereto or a fragment thereof of at
least 8, 10, 12~
15, 18, 20, 25, 35, 40, 50, 70, 80, 100, 250, 500, 1000, 2000 or 3000
consecutive nucleotides, to
the extent that fragments of these lengths is consistent with the lengths of
the particular Sequence
ID, for conducting microsequencing analyses to determine whether a sample
contains one or
more alleles of the biallelic markers of the invention. 1n still further
embodiments, the
oligonucleotide array may comprise at least one of the sequences selecting
from the group
consisting of SEQ ID No. 1-130; and the sequences complementary thereto or a
fragment thereof
of at least 8, 10, 12, 15, 18, 20, 25, 35, 40, 50, 70, 80, 100, 250, 500,
1000, 2000 or 3000
nucleotides in length, to the extent that fragments of these lengths is
consistent with the lengths
of the particular Sequence ID, for determining whether a sample contains one
or more alleles of
the biallelic markers of the present invention. In still further embodiments,
the oligonucleotide
array may comprise at least one of the novel sequences listed in the fifth
column of Table 8 or the
sequences complementary thereto or a fragment comprising at least 8, 10, 12,
15, 18, 20, 25, 35,
46
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
40, 50, 70, 80, 100, 250, 500 or 1000 consecutive nucleotides thereof to the
extent that fragments
of these lengths are consistent with the lengths of the particular novel
sequences.
The present invention also encompasses diagnostic kits comprising one or more
polynucleotides of the invention, optionally with a portion or all of the
necessary reagents and
instructions for genotyping a test subject by determining the identity of a
nucleotide at a CNS
disorder-related biallelic marker. The determining of the identity may
optionally be at a CNS
disorder-related biallelic marker that predicts the response of a therapeutic
agent, preferably
Reboxetine, when administered to a patient suffering from depression. The
polynucleotides of a
kit may optionally be attached to a solid support, or be part of an array or
addressable array of
polynucleotides. The kit may provide for the determination of the identity of
the nucleotide at a
marker position by any method known in the art including,.but not. limited to,
a sequencing assay
method, a microsequencing assay method, a hybridization assay method, or an
allele specific
amplification method. Optionally such a kit may include instructions for
scoring the results of
the determination with respect to the test subj ects' risk of contracting a
CNS disorder, or likely
response to an agent acting on CNS disorders, or chances of suffering from
side effects to an
agent acting on CNS disorders.
C. Polypeptides of the Invention
The polynucleotides which encode the WFS1 and the NET polypeptide may include:
only the coding sequence for the mature polypeptide; the coding sequence for
the polypeptide
and additional coding sequence such as a leader or secretory sequence or a
proprotein sequence;
the coding sequence for the polypeptide (and optionally additional coding
sequence) and non-
coding.sequence, such as introns or non-coding sequence 5' and/or 3' of the
coding sequence for
the mature polypeptide. ,
Thus, the term "polynucleotide encoding a polypeptide" encompasses a
polynucleotide
25. which includes only coding sequence for the polypeptide as well as a
polynucleotide which
includes additional coding and/or non-coding sequence.
. As hereinabove indicated, the polynucleotides may have a coding sequence
which is.a
naturally occurring allelic variant of the coding sequence of SEQ >D NO: 543
or 544. As known
in the art, an allelic variant is an alternate form of a polynucleotide
sequence which may have a
substitution, deletion or addition of one or more nucleotides, which does not
substantially alter
the function of the encoded polypeptide.
D. Host Cells
Host cells are genetically engineered (transduced or transformed or
transfected) with the
vectors of this invention which may be, for example, a cloning vector or an
expression vector:
The vector may be, for example, in the form of a plasmid, a viral particle, a
phage, etc: The
engineered host cells can be cultured in conventional nutrient media modified
as appropriate for
activating promoters, selecting transformants or amplifying the WFS 1 or NET
gene. The culture
47
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
conditions, such as temperature, pH and the like, are those previously used
with the host cell
selected for expression, and will be apparent to the ordinarily skilled
artisan.
The polynucleotides of the present invention may be employed for producing
polypeptides by recombinant techniques. Thus, for example, the polynucleotide
may be included
in any one of a variety of expression vectors for expressing a polypeptide.
Such vectors include
chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of
SV40;
bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived
from combinations
of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox
virus, and
pseudorabies. However, any other vector may be used as long as it is
replicable and viable in the
host.
The appropriate DNA sequence may be inserted into the vector by a variety of
procedures. In general, the DNA sequence is inserted into an appropriate
restriction
endonuclease sites) by procedures known in the art. Such procedures and
others:are deemed to
be within the scope of those skilled in the art.
The DNA sequence in the expression vector is operatively linked to an
appropriate
expression control sequences) (promoter) to direct mRNA synthesis. As
representative examples
of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli.
lac or trp, the
phage lambda PL promoter and other promoters known to control expression
of genes in
prokaryotic or eukaryotic cells or their viruses. The expression vector also
contains a ribosome
binding site for translation initiation and a transcription terminator. The
vector may also include
appropriate sequences for amplifying expression.
In addition, the expression vectors preferably contain one or more selectable
marker
genes to provide a phenotypic trait for selection of transformed host cells
such as dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin
resistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove described,
as well
as an appropriate promoter or control sequence, may be employed to transform
an appropriate
host to permit the host to express the protein.
As representative examples of appropriate hosts, there may be mentioned:
bacterial cells,
such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells, such as
yeast; insect cells
such as Drosophila S2 and Spodoptera Sf~; animal cells such as CHO, COS or
Bowes .
melanoma; adenoviruses; plant cells, etc. The selection of an appropriate host
is deemed to be
within the scope of those skilled in the art from the teachings herein.
E. Screenin Assays
The polynucleotides of the present invention may be employed for producing
polypeptides by recombinant techniques. Thus, for example, the polynucleotide
may be included
in any one of a variety of expression vectors for expressing a polypeptide.
Such vectors include
48
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of
SV40;
bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived
from combinations
of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox
virus, and
pseudorabies. However, any other vector may be used as long as it is
replicable and viable in the
host.
The appropriate DNA sequence may be inserted into the vector by a variety of
procedures. In general, the DNA sequence is inserted into an appropriate
restriction endonuclease
sites) by procedures known in the art. Such procedures and others are deemed
to be within the
scope of those skilled in the art.
The DNA sequence in the expression vector is operatively linked to an
appropriate
expression control sequences) (promoter) to direct mRNA synthesis. As
representative examples
of such promoters, there may be mentioned: LTR or SV40 promoter, the E, coli.
lac or trp, the
phage lambda PL promoter and other promoters known to control expression
of genes in
prokaryotic or eukaryotic cells or their viruses. The expression vector also
contains a ribosome
binding site for translation initiation and a transcription terminator. The
vector may also include
appropriate sequences for amplifying expression.
In addition, the expression vectors preferably contain one or more selectable
marker
genes to provide a phenotypic trait for selection of transformed host cells
such as dihydrofolate
reductase or neomycin resistance for eukaryotic cell culture, or such as
tetracycline or ampicillin
resistance in E. coli.
The vector containing the appropriate DNA sequence as hereinabove described,
as well
as an appropriate promoter or control sequence, may be employed to transform
an appropriate
host to permit the host to express the protein. .
As representative examples of appropriate hosts, there may be mentioned:
bacterial cells,
such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells, such as
yeast; insect cells
such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or
Bowes:
melanoma; adenoviruses; plant cells, etc. The selection of an appropriate host
is deemed to be
within the scope of those skilled in the art from the teachings herein.
More particularly, the present invention also includes recombinant constructs
comprising
one or more of the sequences as broadly described above. The constructs
comprise a vector, such
as a plasmid or viral vector, into which. a sequence of the invention has been
inserted, in a
forward or reverse orientation. In a preferred aspect of this embodiment, the
construct further
comprises regulatory sequences, including, for example, a promoter, operably
linked to the
sequence. Large numbers of suitable vectors and promoters are known to those
of skill in the art,
and are commercially available. The following vectors are provided by way of
example.
Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pDlO, phagescript, psiX174,
pbluescript SK,
pbsks, pNHBA, pNHl6a, pNHl8A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-
3,
49
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
pDR540, pRITS (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG
(Stratagene) pSVK3, pBPV, pMSG, PSVL (Pharmacia). However, any other plasmid
or vector
may be used as long as they are replicable and viable in the host.
Promoter regions can be selected from any desired gene using CAT
(chloramphenicol
transferase) vectors or other vectors with selectable markers. Two appropriate
vectors are
PKK232-8 and PCM7. Particular named bacterial promoters include lacI, lacZ,
T3, T7, gpt,
lambda PR, PL and trp. Eukaryotic promoters include CMV immediate
early, HSV
thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse
metallothionein-I.
Selection of the appropriate vector and promoter is well within the level of
ordinary skill in the
art.
In a further embodiment, the present invention relates to host cells
containing the above-
described constructs. The host cell can be a higher eukaryotic cell, such as a
mammalian cell, or
a lower eukaryotic cell, such as a yeast cell, or the host cell can be a
prokaryotic cell, such as a
bacterial cell. Introduction of the construct into the host cell can be
effected by calcium
phosphate transfection, DEAF-Dextran mediated transfection, or
electroporation: (Davis, L.,
Dibner, M., Battey, L, Basic Methods in Molecular Biology, (1986)).
The constructs in host cells can be used in a conventional manner to produce
the gene .
product encoded by the recombinant sequence. Alternatively, the polypeptides
of the invention
can be synthetically~produced by conventional peptide synthesizers.
Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other
cells
under the control of appropriate promoters. Cell-free translation systems can
also be employed to
produce such proteins using RNAs derived from the DNA constructs of the
present invention.
Appropriate cloning and expression vectors for use with prokaryotic and
eukaryotic hosts are
described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second
Edition, Cold
Spring Harbor, N.Y:, (1989), the disclosure of which is hereby incorporated by
reference:
Transcription of the DNA encoding the polypeptides of .the present invention
by higher
eukaryotes is increased. by inserting an enhancer sequence into the vector.
Enhancers are cis-
acting elements of DNA, usually about from 10 to 300 by that act on a promoter
to increase its
transcription. Examples including the SV40 enhancer on the late side of the
replication origin by
100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on
the late side of
the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include origins of replication
and
selectable markers permitting transformation of the host cell, e.g., the
ampicillin resistance gene
of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a.highly-
expressed gene to
direct transcription of a downstream structural sequence. Such promoters can
be derived from
operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK),
.alpha.-factor,
acid phosphatase, or heat shock proteins, among others. The heterologous
structural sequence is
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
assembled in appropriate phase with translation initiation and termination
sequences, and
preferably, a leader sequence capable of directing secretion of translated
protein into the
periplasmic space or extracellular medium. Optionally, the heterologous
sequence can encode a
fusion protein including an N-terminal identification peptide imparting
desired characteristics,
e.g., stabilization or simplified purification of expressed recombinant
product.
Useful expression vectors for bacterial use are constructed by inserting a
structural DNA
sequence encoding a desired protein together with suitable translation
initiation and termination
signals in operable reading phase with a functional promoter. The vector will
comprise one or
more phenotypic selectable markers and an origin of replication to ensure
maintenance of the
vector and to, if desirable, provide amplification within the host. Suitable
prokaryotic hosts for
transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and
various species
within the genera Pseudomonas, Streptomyces, and Staphylococcus, although
others may also be
employed as a matter of choice.
As a representative but nonlimiting example, useful expression vectors for
bacterial use
can comprise a selectable marker and bacterial origin of replication derived
from commercially
available plasmids comprising genetic elements of the well known cloning
vector pBR322
(ATCC 37017). Such commercial vectors include, for example, pKK223-3
(Pharmacia Fine
Chemicals, Uppsala, Sweden) and GEMl (Promega Biotec, Madison, Wis., USA).
These
pBR322 "backbone" sections are combined with an appropriate promoter and the
structural '.
sequence to be expressed.
Following transformation of a suitable host strain and growth of the host
strain to ari
appropriate cell density, the selected promoter is induced by appropriate
means (e.g., temperature
shift or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by physical or
chemical means,
and the resulting crude extract retained for further purification. Microbial
cells employed in
expression of proteins can be disrupted by any convenient method, including
freeze-thaw
cycling, sonication, mechanical disruption, or use of cell lysing agents, such
methods are well
know to those skilled in the art.
Various mammalian cell culture systems can also be employed to express
recombinant.
protein. Examples of mammalian expression systems include the COS-7 lines of
monkey kidney
flbroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines
capable of expressing
a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
Mammalian
expression vectors will comprise an origin of replication, a suitable promoter
and enhancer, and
also any necessary xibosome binding sites, polyadenylation site, splice donor
and acceptor sites,
transcriptional termination sequences, and 5' flanking nontranscribed
sequences. DNA sequences .
derived from the SV40 splice, and polyadenylation sites may be used to provide
the required
nontranscribed genetic elements.
51
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
The WFS 1 and NET polypeptides can be recovered and purified from recombinant
cell
cultures by methods including ammonium sulfate or ethanol precipitation, acid
extraction, anion
or cation exchange chromatography, phosphocellulose chromatography,
hydrophobic interaction
chromatography, affinity chromatography, hydroxylapatite chromatography and
lectin
chromatography. Protein refolding steps can be used, as necessary, in
completing configuration
of the mature protein. Finally, high performance liquid chromatography (HPLC)
can be
employed for final purification steps.
The polypeptides of the present invention may be a naturally purified product,
or a
product of chemical synthetic procedures, or produced by recombinant
techniques from a
prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher
plant, insect and
mammalian cells in culture). Depending upon the host employed in a recombinant
production
procedure, the polypeptides of the present invention rnay be glycosylated or
may be non-
glycosylated. Polypeptides of the invention may also include an initial
methionine amino acid
residue.
~ . F. Screening Assay
The WFS 1 protein receptor of the present invention may be employed in a
process for
screening for antagonists andlor agonists for the receptor.
In general, such screening procedures involve providing appropriate cells
which express
the receptor on the surface thereof. In particular, a polynucleotide encoding
the receptor of the
present invention is employed to transfect cells to thereby express the WFS 1
receptor. Such
transfection may be accomplished by procedures as hereinabove described.
One such screening procedure involves the use of the melanophores which are
transfected to express the WFS 1 receptor of the present invention. Such a
screening technique is. '
described in PCT WO 92101810 published Feb. 6, 1992.
Thus, for example, such assay may be employed for screening for a receptor
antagonist .
by contacting the melanophore cells which encode the WFS 1 receptor with both
the receptor
ligand and a compound to be screened. Inhibition of he signal generated by the
ligand indicates
that a compound is a potential antagonist for the receptor, i.e., inhibits
activation of the receptor.
The screen may be employed for determining an agonist by contacting such cells
with
compounds to be screened and determining whether such compound generates a
signal; i.e.,
activates the receptor.
Other screening techniques include the use of cells which express WFS1
receptor (for
example, transfected CHO cells) in a system which measures extracellular pH
changes caused by
receptor activation, for example, as described in Science, volume 246, pages
181-29.6 (October
1989). For example, potential agonists or antagonists may be contacted with a
cell which
expresses the WFS 1 receptor and a second messenger response, e.g. signal
transduction or pH
changes, may be measured to determine whether the potential agonist or
antagonist is effective.
52
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Another such screening technique involves introducing RNA encoding the WFS 1
receptor into xenopus oocytes to transiently express the receptor. The
receptor oocytes may then
be contacted in the case of antagonist screening with the receptor ligand and
a compound to be
screened, followed by detection of inhibition of a calcium signal.
Another screening technique involves expressing the WFSl receptor in which the
receptor is linked to a phospholipase C or D. As representative examples of
such cells, there may
be mentioned endothelial cells, smooth muscle cells, embryonic kidney cells,
etc. The screening
for an antagonist or agonist may be accomplished as hereinabove described by
detecting
activation of the receptor or inhibition of activation of the receptor from
the phospholipase
second signal.
Another method involves screening for antagonists by determining inhibition of
binding
of labeled ligand to cells which have the receptor on the surface thereof..
Such a method involves
transfecting a eukaryotic cell with DNA encoding the WFS1 receptor such that
the cell expresses
the receptor on its surface and contacting the cell with a potential
antagonist in the presence of a
labeled form of a known ligand. The ligand can be labeled, e.g., by
radioactivity. The amount of
labeled ligand bound to the receptors is measured, e.g., by measuring
radioactivity of the
receptors. If the potential antagonist binds to the receptor as determined by
a reduction of labeled
ligand which binds to the receptors, the binding of labeled ligand to the
receptor is inhibited.
The present invention also provides a method for determining whether a ligand
not
known to be capable of binding to a WFS 1 receptor can bind to such receptor
which comprises
contacting a mammalian cell which expresses a WFS1 receptor with the ligand
under conditions
permitting binding of ligands to the WFS1 receptor, detecting the presence of
a ligand which
binds to the receptor and thereby determining whether the ligand binds to the
WFS 1 receptor.
The systems hereinabove described for determining agonists and/or antagonists
may also be
employed for determining ligands which bind to the receptor.
In general, antagonists for WFS 1 receptors which are determined by screening
procedures may be employed for a variety of therapeutic purposes. For example,
such antagonists
have been employed for treatment of hypertension, angina pectoris, myocardial
infarction, ulcers,
asthma, allergies, psychoses, depression, migraine, vomiting, stroke, eating
disorders, migraine
. headaches, cancer and benign prostatic hypertrophy.
Agonists for WFS 1 receptors are also useful for therapeutic purposes, such as
the
treatment of Wolfram syndrome and/or depression.
Examples of WFS 1 receptor antagonists include an antibody, or in some cases
an
oligonucleotide, which binds to the WFS 1 receptor but does not elicit a
second messenger
response such that the activity of the WFS1 receptor is prevented. Antibodies
include anti-
idiotypic antibodies which recognize unique determinants generally associated
with the antigen-
binding site of an antibody.
53
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Potential antagonists also include proteins which are closely related to the
ligand of the
WFS 1 receptor, i.e. a fragment of the ligand, which have lost biological
function and when
binding to the WFS 1 receptor, elicit no response.
A potential antagonist also includes an antisense construct prepared through
the use of
antisense technology. Antisense technology can be used to control gene
expression through
triple-helix formation or antisense DNA or RNA, both of which methods are
based on binding of
a polynucleotide to DNA or RNA. For example, the 5' coding portion of the
polynucleotide
sequence, which encodes for the mature polypeptides of the present invention,
is used to design
an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
A DNA
oligonucleotide is designed to be complementary to a region of the gene
involved in
transcription (triple helix -see Lee et al., Nucl. Acids Res., 6:3073 (.1979);
Cooney et al, Science,
241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)), thereby
preventing transcription
and the production of WFS 1 receptor. The antisense RNA oligonucleotide
hybridizes to the
mRNA in vivo and blocks translation of the mRNA molecule into the WFS 1
receptor (antisense-
-Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense
Inhibitors of Gene
Expression, CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides
described above can also
be delivered to cells such that the antisense RNA or DNA may be expressed in
vivo to inhibit
production of WFS 1 receptor.
Another potential antagonist is a small molecule which binds to the WFS1
receptor,
making it inaccessible to ligands such that normal biological activity is
prevented. Examples of
small molecules include but 'are not limited to small peptides or peptide-like
molecules.
Potential antagonists also include a soluble form of a WFS1 receptor, e.g. a
fragment of
the receptor, which binds to the ligand and prevents the ligand from
interacting with membrane
bound WFS 1 receptors.
The WFS 1 receptor and antagonists or agonists may be employed in combination
with a
suitable pharmaceutical Garner. Such compositions comprise a therapeutically
effective amount
of the polypeptide, and a pharmaceutically acceptable carrier or excipient.
Such a carrier includes
but is not limited to saline, buffered saline, dextrose, water, glycerol,
ethanol, and combinations
thereof. The formulation should suit the mode of administration.
G. Antibodies
The polypeptides, their fragments or other derivatives, or analogs thereof, or
cells
expressing them can be used as an immunogen to produce antibodies thereto.
These antibodies
can be, for example, polyclonal or monoclonal antibodies. The present
invention also includes
chimeric, single chain, and humanized antibodies, as well as Fab fragments, or
the product of an
Fab expression library. Various procedures known in the art may be used for
the production of
such antibodies and fragments.
54
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Antibodies generated against the polypeptides corresponding to a sequence of
the present
invention can be obtained by direct injection of the polypeptides into an
animal or by
administering the polypeptides to an animal, preferably a nonhuman. The
antibody so obtained
will then bind the polypeptides itself. In this manner, even a sequence
encoding only a fragment
of the polypeptides can be used to generate antibodies binding the whole
native polypeptides.
Such antibodies can then be used to isolate the polypeptide from tissue
expressing that
polypeptide.
IV. Methods for De Novo Identification of Biallelic Markers
Large fragments of human DNA, carrying genes of interest involved in CNS
disorders;
were cloned, sequenced and screened for biallelic markers. Biallelic markers
within the
candidate genes themselves as well as markers located on the same genomic
fragment were
identified. It will be clear to one of skill in the art that large fragments
of human genomic DNA
may be obtained from any appropriate source and may be cloned into a number of
suitable
vectors.
In a preferred embodiment of the invention, BAC (Bacterial Artificial
Chromosomes)
vectors were used to construct DNA libraries covering the entire human genome.
Specific
amplification primers were designed for each candidate gene and'the BAC
library was screened
by PCR until there was at least one positive BAC clone per candidate gene.
Genomic sequence,
20' screened for biallelic markers, was generated by sequencing ends of BAC
subclones. Details of a
preferred embodiment are provided in Example 1. As a preferred alternative to
sequencing the
ends of an adequate number of BAC subclones, high throughput deletion-based
sequencing
vectors, which allow the generation of a high quality sequence information
covering fragments of
about 6kb, may be used. Having sequence fragments longer than 2.5 or 3kb
enhances the
chances of identifying biallelic markers therein. Methods of constructing and
sequencing a
nested set of deletions are disclosed in the related U.S. Patent Application
entitled "High
Throughput DNA Sequencing Vector" (Serial No. 09/058,746).
In another embodiment of the invention, genomic sequences of candidate genes
were
available in public databases allowing direct screening for biallelic markers.
Any of a variety of methods can be used to screen a genomic fragment for
single nucleotide
polymorphisms such as differential hybridization with oligonucleotide probes,
detection of
changes in the mobility measured by gel electrophoresis or direct sequencing
of the amplified
nucleic acid. A preferred method for identifying biallelic markers involves
comparative
sequencing of genomic DNA fragments from an appropriate number of unrelated
individuals.
In a first embodiment, DNA samples from unrelated individuals are pooled
together,
following which the genomic DNA of interest is amplified and sequenced. The
nucleotide
sequences thus obtained are then analyzed to identify significant
polymorphisms. One of the
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
major advantages of this method resides in the fact that the pooling of the
DNA samples
substantially reduces the number of DNA amplification reactions and sequencing
reactions,
which must be carried out. Moreover, this method is sufficiently sensitive so
that a biallelic
marker obtained thereby usually demonstrates a sufficient frequency of its
less common allele to
be useful in conducting association studies. Usually, the frequency of the
least common allele of
a biallelic marker identified by this method is at least 10%.
In a second embodiment, the DNA samples are not pooled and are therefore
amplified
and sequenced individually. This method is usually preferred when biallelic
markers need to be
identified in order to perform association studies within candidate genes.
Preferably, highly
relevant gene regions such as promoter regions or exon regions may be screened
for biallelic
markers. A biallelic marker obtained using this method may show a lower:
degree of
informativeness for conducting association studies, e.g. if the frequency of
its less frequent allele
may be less than about 10%. Such a biallelic marker will .however be
sufficiently informative to
conduct association studies and it will further be appreciated that including
less informative
biallelic markers in the genetic analysis studies of the present invention,
may allow in some cases
the direct identification of causal mutations, which may, depending on their
penetrance, be rare
mutations.
The following is a description of the various parameters of a preferred method
used by
the inventors for the identification of the biallelic markers of the present
invention..
A. Genomic DNA Samples
The genomic DNA samples from which the biallelic markers of the present
invention are
generated are preferably obtained from unrelated individuals corresponding to
a heterogeneous
population of known ethnic background. The number of individuals from whom DNA
samples
are obtained can vary substantially, preferably from about 10 to about 1000,
more preferably
from about 50 to about 200 individuals. Usually, DNA samples are collected
from~at least about
100 individuals in order to have sufficient polymorphic diversity in a
given.population to identify.
as many markers as possible and to generate statistically significant results.
As for the source of the genomic DNA to be subjected to analysis, any test
sample can be
foreseen without any particular limitation. These test samples include
biological samples, which
can be tested by the methods of the present invention described herein, and
include human and
animal body fluids such as whole blood, serum, plasma, cerebrospinal fluid,
urine, lymph fluids,
and various external secretions of the respiratory, intestinal and
genitourinary tracts, tears, saliva,
milk, white blood cells, myelomas and the like; biological fluids such as cell
culture
supernatants; fixed tissue specimens including tumor and non-tumor tissue and
lymph node
tissues; bone marrow aspirates and axed cell specimens. The preferred source
of genomic DNA -
used in the present invention is from peripheral venous blood of each donor.
Techniques to
prepare genomic DNA from biological samples are well known to the skilled
technician. Details
56
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
of a preferred embodiment are provided in Example 1. The person skilled in the
art can choose
to amplify pooled or unpooled DNA samples.
B. DNA Amplification
The identification of biallelic markers in a sample of genomic DNA may be
facilitated
through the use of DNA amplification methods. DNA samples can be pooled or
unpooled fox the
amplification step. DNA amplification techniques are well known to those
skilled in the art.
Various methods to amplify DNA fragments carrying biallelic markers are
further described
herein. The PCR technology is the preferred amplification technique used to
identify new
biallelic markers.
In a first embodiment, biallelic markers are identified using genomic sequence
information generated by the inventors. Genomic DNA fragments, such as the
inserts of the
BAC clones described above, are sequenced and. used to design primers for the
amplification of
500 by fragments: These 500 by fragments are amplified from genomic DNA and
are scanned
for biallelic markers. Primers may be designed using the OSP software (Hillier
L. and Green P.,
1991). All primers may contain, upstream of the specific target bases, a
common oligonucleotide
tail that serves as a sequencing primer. Those skilled in the art are familiar
with primer
extensions, which can be used for these purposes.
In another embodiment of the invention, genomic sequences of candidate genes
are
available in public databases allowing direct screening for biallelic markers.
Preferred primers,
useful for the amplification of genomic sequences encoding the candidate
genes, focus on
promoters, exons and splice sites of the genes. A biallelic marker present in
these functional
regions of the gene has a higher probability to be a causal mutation.
Preferred primers include those disclosed in Table 13.
C. Sequencing of Amplified Genomic DNA and Identification of Single Nucleotide
Polymorphisms
The amplification products generated as described above, are then sequenced
using any
method known and available to the skilled technician. Methods for sequencing
DNAwsing either
the dideoxy-mediated method (Sanger method) or the Maxam-Gilbert method are
widely known ~ .'
to those of ordinary skill in the art. Such methods are for example disclosed
in Maniatis et al.
(Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Second
Edition, 1989).
Alternative approaches include hybridization to high-density DNA probe arrays
as described in
Chee et al. (Science 274, 610, 1996).
Preferably, the amplified DNA is subjected to automated dideoxy terminator
sequencing
reactions using a dye primer cycle sequencing protocol. The products of the
sequencing
reactions are run on sequencing gels and the sequences are determined using
gel image analysis.
The polymorphism search is based on the presence of superimposed peaks in the
electrophoresis
pattern resulting from different bases occurring at the same position. Because
each dideoxy
57
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
terminator is labeled with a different fluorescent molecule, the two peaks
corresponding to a
biallelic site present distinct colors corresponding to two different
nucleotides at the same
position on the sequence. However, the presence of two peaks can be an
artifact due to
background noise. To exclude such an artifact, the two DNA strands are
sequenced and a
comparison between the peaks is carried out. In order to be registered as a
polymorphic
sequence, the polymorphism has to be detected on both strands.
The above procedure permits those amplification products, which contain
biallelic
markers to be identified. The detection limit for the frequency of biallelic
polymorphisms
detected by sequencing pools of 100 individuals is approximately 0.1 for the
minor allele, as
verified by sequencing pools of known allelic frequencies. However, more than
90% of the
biallelic polymorphisms detected by the pooling method have a frequency for
the minor allele
higher than 0.25. Therefore, the biallelic markers selected by this method
have, a .frequency of at
least 0.1 for the minor allele and less than 0.9 for the major allele.
Preferably at least 0.2 for the
minor allele and less than 0.8 for the major allele, more preferably at least
0.3 for the minor allele'
and less than 0.7 for the major allele, thus a heterozygosity rate higher than
0.18, preferably
higher than 0.32, more preferably higher than 0.42.
In another embodiment, biallelic markers are detected by sequencing individual
DNA
samples; the frequency of the minor allele of such a biallelic marker may be
less than 0.1.
The markers carried by the same fragment of genomic DNA, such as the insert in
a BAG.
clone, need not necessarily be ordered with respect to one another within the
genomic fragment
to conduct association studies. However, in some embodiments of the present
invention, the
order of biallelic markers carried by the same fragment of genomic DNA are
determined.. .
D. Validation of the Biallelic Markers of the Present Invention
The polymorphisms are evaluated for their usefulness as genetic markers by
validating
that both alleles are present in a population. Validation of the biallelic
markers is accomplished
by genotyping a group of individuals by a method of the invention and
demonstrating that both
alleles are present. Microsequencing is a preferred method of genotyping
alleles." The validation
by genotyping step may be performed on individual samples derived from, each
individual in the
group or by genotyping a pooled sample derived from more than one individual.
The group can
be as small as one individual if that individual is heterozygous for the
allele in question. .
Preferably the group contains at least three individuals, more preferably the
group contains five
or six individuals, so that a single validation test will be more likely to
result in the validation of
more of the biallelic markers that are being tested. It should be noted,
however, that whem the
validation test is performed on a small group it may result in a false
negative result if as a result
of sampling error none of the individuals tested carries one of the two
alleles. Thus, the
validation process is less useful in demonstrating that a particular initial
result is an artifact, than
it is at demonstrating that there is a bona fide biallelic marker at a
particular position in a
58
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
sequence. For an indication of whether a particular biallelic marker has been
validated see Table
7. All of the genotyping, haplotyping, association, and interaction study
methods of the
invention may optionally be performed solely with validated biallelic markers.
E. Evaluation of the Frequency of the Biallelic Markers of the Present
Invention
The validated biallelic markers are further evaluated for their usefulness as
genetic
markers by determining the frequency of the least common allele at the
biallelic marker site.
The determination of the least common allele is accomplished by genotyping a
group of
individuals by a method of the invention and demonstrating that both alleles
are present. This
determination of frequency by genotyping step may be performed on individual
samples derived
from each individual in the group or by genotyping a pooled sample derived
from more than one
individual. The group must be large enough to be representative of the
population as a whole.
Preferably the group contains at least 20 individuals, more preferably the
group contains at least
50 individuals, most preferably the group contains at least 100 individuals.
Of course the larger
the group the greater the accuracy of the frequency determination because of
reduced sampling
error. For an indication of the frequency for the less common allele of a
particular biallelic
marker of the invention see Table 7. A biallelic marker wherein the frequency
of the less
common allele is 30% or more is termed a "high quality biallelic marker." All
of the genotyping;
haplotyping, association, and interaction study methods of the invention may
optionally be
performed solely with high quality biallelic markers.
V. Methods of Genotypin~ an Individual for Biallelic Markers
Methods are provided to genotype a biological sample for one or more biallelic
markers
of the present invention, all of which may be performed in vitf°o. Such
methods of genotyping
comprise determining the identity of a nucleotide at a CNS disorder-related
biallelic marker by
any method known in the art. These methods find use in genotyping case-control
populations in
association studies as well as individuals in the context of detection of
alleles of biallelic markers
which, are lrnown to be associated with a given trait, in which case both
copies of the biallelic
marker present in individual's genome are determined so that an individual may
be classified as
homozygous or heterozygous for a particular allele.
These genotyping methods can be performed nucleic acid samples derived from a
single
individual or pooled DNA samples.
Genotyping can be performed using similar methods as those described above for
the
identification of the biallelic markers, or using other genotyping methods
such as those further
described below. In preferred embodiments, the comparison of sequences of
amplified genomic
fragments from different individuals is used to identify new biallelic markers
whereas
microsequencing is used for genotyping known biallelic markers in diagnostic
and association
study applications.
59
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
A. Source of DNA for Genotyping
Any source of nucleic acids, in purified or non-purified form, can be utilized
as the
starting nucleic acid, provided it contains or is suspected of containing the
specific nucleic acid
sequence desired. DNA or RNA may be extracted from cells, tissues, body fluids
and the like as
described herein. While nucleic acids for use in the genotyping methods of the
invention can be
derived from any mammalian source, the test subjects and individuals from
which nucleic acid
samples are taken are generally understood to be human.
B. Amplification of DNA Fragments Comprising Biallelic Markers
Methods and polynucleotides are provided to amplify a segment of nucleotides
comprising one or more biallelic marker of the present invention. It will be
appreciated that
amplification of DNA fragments comprising biallelic markers may be used in
various methods
and for various purposes and is not restricted to genotyping. Nevertheless,
many genotyping
methods, although not all, require the previous amplification of the DNA
region carrying the
biallelic marker of interest. Such methods specifically increase the
concentration or total number
of sequences that span the biallelic marker or include that site and sequences
located either distal
or proximal to it. Diagnostic assays may also rely on amplification of DNA
segments carrying a
biallelic marker of the pxesent invention.
Amplification of DNA may be achieved by any method known in the art. The
established PCR (polymerase chain reaction) method or by developments thereof
or alternatives.
Amplification methods which can be utilized herein include but are not limited
to Ligase Chain
Reaction (LCR) as described in EP A 320 308 and EP A 439 182, Gap LCR
(Wolcott, M.J., Clin.
Microbiol. Rev. 5:370-386), the so-called "NASBA" or "3SR" technique described
in Guatelli
J.C. et al. (Proc. Natl. Acad. Sci. USA 87:1874-1878, 1990) and in Compton J.
(Nature 350:91-
92, 1991), Q-beta amplification as described in European Patent Application no
4544610, strand
displacement amplification as described in Walker et al. (Clip. Chem. 42:9-13,
1996) and.EP A
684 315 and, target mediated amplification as described in PCT Publication WO
9322461.
LCR and Gap LCR are exponential amplification techniques, both depend on DNA .
ligase to join adjacent primers annealed to a DNA molecule. In Ligase Chain
Reaction (LCR);
probe pairs are used which include two primary (first and second) and two
secondary (third and
fourth) probes, all ,of which are employed in molar excess to target. The
first probe hybridizes to
a first segment of the target strand and the second probe hybridizes to a
second segment of the
target strand, the first and second segments being contiguous so that the
primary probes abut one
another in 5' phosphate-3'hydroxyl relationship, and so that a ligase can
covalently fuse or ligate
the two probes into a fused product. In addition, a third (secondary) probe
can hybridize to a
portion of the first probe and a fourth (secondary) probe can hybridize to a
portion of the second
probe in a similar abutting fashion. Of course, if the target is initially
double stranded, the
secondary probes also will hybridize to the target complement in the first
instance. Once the
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
ligated strand of primary probes is separated from the target strand, it will
hybridize with the
third and fourth probes Which can be ligated to form a complementary,
secondary ligated
product. It is important to realize that the ligated products are functionally
equivalent to either the
target or its complement. By repeated cycles of hybridization and ligation,
amplification of the
target sequence is achieved. A method for multiplex LCR has also been
described (WO
9320227). Gap LCR (GLCR) is a version of LCR where the probes are not adjacent
but are
separated by 2 to 3 bases.
For amplification of mRNAs, it is within the scope of the present invention to
reverse
transcribe mRNA into cDNA followed by polymerise chain reaction (RT-PCR); or,
to use a
single enzyme for both steps as described in U.S. Patent No. 5,322,770 or, to
use Asymmetric
Gap LCR (RT-AGLCR) as described by Marshall R.L. et al. (PCR Methods and
Applications
4:80-84, 1994). AGLCR is a modification of GLCR that allows the amplification
of RNA.
Some of these amplification methods are particularly suited for the detection
of single
nucleotide polymorphisms and allow the simultaneous amplification of a target
sequence and.the
identification of the polymorphic nucleotide as it is further described
herein.
The.PCR technology is the preferred amplification technique used in the
present
invention. A variety of PCR techniques are familiar to those skilled in the
art. For a review of PCR
technology, see Molecular Cloning to Genetic Engineering White, B.A. Ed. in
Methods in
Molecular Biology 67: Humana Press, Totowa (1997) and the publication entitled
"PCR Methods
and Applications" (1991, Cold Spring Harbor Laboratory Press). In each of
these PCR
procedures, PCR primers on either side of the nucleic acid sequences to be
amplified are added to a
suitably prepared nucleic acid sample along with dNTPs and a thermostable
polymerise such as Taq
polymerise, Pfu polymerise, or Vent polymerise. The nucleic acid in the sample
is denatured and ,
the PCR primers are specifically hybridized to complementary nucleic acid
sequences in the sample.
The hybridized primers are extended. Thereafter, another cycle of
denaturation, hybridization, and
extension is initiated. The cycles are repeated multiple times to produce an
amplified fragment
containing the nucleic acid sequence between the primer sites. PCR has further
been. described in
several patents including US Patents 4,683,195, 4,683,202 and 4,965,188.
The identification of biallelic markers as described above allows the design
of
appropriate oligonucleotides, which can be used as primers to amplify DNA
fragments
comprising the biallelic markers of the present invention. Amplification can
be performed using
the primers initially used to discover new biallelic markers which are
described herein or any set
of primers allowing the amplification of a DNA fragment comprising a biallelic
marker of the
present invention. Primers can be prepared by any suitable method. As for
example, direct
chemical synthesis by a method such as the phosphodiester method of Narang
S.A. et al.
(Methods Enzymol. 68:90-98, 1979), the phosphodiester method of Brown E.L. et
al. (Methods
61
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Enzynol. 68:109-151, 1979), the diethylphosphoramidite method of Beaucage et
al.
(Tetrahedf-on Lett. 22:1859-1862, 1981) and the solid support method described
in EP 0 707 592.
In some embodiments the present invention provides primers for amplifying a
DNA
fragment containing one or more biallelic markers of the present invention.
Preferred
ampliEcation primers are listed in Table 13. It will be appreciated that the
primers listed are
merely exemplary and that any other set of primers which produce amplification
products
containing one or more biallelic markers of the present invention.
The primers are selected to be substantially complementary to the different
strands of
each specific sequence to be amplified. The length of the primers of the
present invention can
. range from 8 to 100 nucleotides, preferably from 8 to 50, 8 to 30 or more
preferably 8 to 25
nucleotides. Shorter primers tend to lack specificity for a target nucleic
acid sequence and
generally require cooler temperatures to form sufficiently stable hybrid
complexes with the
template. Longer primers are expensive to produce and can sometimes self
hybridize to form
hairpin structures. The formation of stable hybrids depends on the melting
temperature (Tm) of
the DNA. The Tm depends on the length of the primer, the ionic strength of the
solution and the
G+C content. The higher the G+C content of the primer, the higher is the
melting temperature
because G:C pairs are held by three H bonds whereas A:T pairs have only two.
The G+C content
of the ampliEcation primers of the present invention preferably ranges between
10 and 75 %,
more preferably between 35 and 60 %, and most preferably between 40 and 55 %.
The
appropriate length for primers under a particular set of assay conditions may
be empirically
determined by one of skill in the art.
The spacing of the primers determines the length of the segment to be
amplified. In the
context of the present invention amplified segments carrying biallelic markers
can range in size
from at least about 25 by to 35 kbp. Amplification fragments from 25-3000 by
are typical,
fragments from 50-1000 by are preferred and fragments from 100-600 by are
highly preferred.. It
will be appreciated that amplification primers for the biallelic markers may
be any~sequence
which allow the specific amplification of any DNA fragment carrying the
markers.
Amplification primers may be labeled or immobilized on a solid support as
described in I.
C. Methods of Genotypin~ DNA samples for Biallelic Markers
Any method known in the art can be used to identify the nucleotide present at
a biallelic
marker site. Since the biallelic marker allele to be detected has been
identified and specified in
the present invention, detection will prove simple for one of ordinary skill
in the art by
employing any of a number of techniques. Many genotyping methods require the
previous .
amplification of the DNA region carrying the biallelic marker of interest.
While the
amplification of target or signal is often preferred at present,
ultrasensitive detection methods
which do not require amplification are also encompassed by the present
genotyping methods.
Methods well-known to those skilled in the art that can be used to detect
biallelic polymorphisms
62
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
include methods such as, conventional dot blot analyzes, single strand
conformational
polymorphism analysis (SSCP) described by Orita et al. (Proc. Natl. Acad. Sci.
U.S.A 86:27776-
2770, 1989), denaturing gradient gel electrophoresis (DGGE), heteroduplex
analysis, mismatch
cleavage detection, and other conventional techniques as described in
Sheffield, V.C. et al. (P~°oc.
Natl. Acad. Sci. USA 49:699-706, 1991), White et al. (Genomics 12:301-306,
1992), Grompe, M.
et al. (Proc. Natl. Acad. Sci. USA 86:5855-5892, 1989) and Grompe, M. (Nature
Genetics 5:111-
117, 1993). Another method for determining the identity of the nucleotide
present at a particular
polymorphic site employs a specialized exonuclease-resistant nucleotide
derivative as described
in US patent 4,656,127.
Preferred methods involve directly determining the identity of the nucleotide
present at a
biallelic marker site by sequencing assay, enzyme-based mismatch detection
assay, or
hybridization assay. The following is a description of some preferred methods.
A,highly - .
preferred method is the microsequencing technique. The term "sequencing assay"
is used herein
to refer to polymerase extension of duplex primeritemplate complexes and
includes both
traditional sequencing and microsequencing.
i) Sequencin assays
The nucleotide present at a polymorphic site can be determined by sequencing
methods.
In a preferred embodiment, DNA samples are subjected to PCR amplification
before sequencing
as described above. DNA sequencing methods are described herein. .
Preferably, the amplified DNA is subjected to automated dideoxy terminator
sequencing
reactions using a dye-primer cycle sequencing protocol. Sequence analysis
allows the
identification of the base present at the biallelic marker site.
ii) Microseguencin~ assay
In microsequencing methods, a nucleotide at the polymorphic site that is
unique to one of
the alleles in a target DNA is detected by a single nucleotide primer
extension reaction. This
method involves appropriate microsequencing primers which, hybridize just
upstream of a
polymorphic base of interest in the target nucleic acid. A polymerase is used
to specifically
extend the 3' end of the primer with one single ddNTP (chain terminator)
complementary to the
selected nucleotide at the polymorphic site. Next the identity of the
incorporated nucleotide is
determined in any suitable way. ..
Typically, microsequencing reactions are carxied out using fluorescent ddNTPs
and the
extended microsequencing primers are analyzed by electrophoresis on ABI 377
sequencing
machines to determine the identity of the incorporated nucleotide as described
in EP 412 883.
Alternatively capillary electrophoresis can be used in order to process a
higher number of assays
simultaneously. An example of a typical microsequencing procedure that can be
used in the
context of the present invention is provided in Example 2.
63
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Different approaches can be used to detect the nucleotide added to the
microsequencing
primer. A homogeneous phase detection method based on fluorescence resonance
energy transfer
has been described by Chen and I~wok (Nucleic Acids Researcla 25:347-353 1997)
and Chen et
al. (Proc. Natl. Acad. Sci. USA 94120 10756-10761,1997). In this method
amplified genomic
DNA fragments containing polymorphic sites are incubated with a 5'-fluorescein-
labeled primer
in the presence of allelic dye-labeled dideoxyribonucleoside triphosphates and
a modified Taq
polymerase. The dye-labeled primer is extended one base by the dye-terminator
specific for the
allele present on the template. At the end of the genotyping reaction, the
fluorescence intensities
of the two dyes in the reaction mixture are analyzed directly without
separation or' purification.
All these steps can be performed in the same tube and the fluorescence changes
can be monitored
in real time. Alternatively, the extended primer may be analyzed by MALDI-TOF
Mass
Spectrometry. The base at the polymorphic site is identified by the mass added
onto the
microsequencing primer (see Haff L.A. and Smirnov LP., Gen.ome Research, 7:378-
388, 1997):
Microsequencing may be achieved by the established microsequencing method or
by
developments or derivatives thereof. Alternative methods include several solid-
phase
microsequencing techniques. The basic microsequencing protocol is the same as
described
previously, except that the method is conducted as a heterogenous phase assay,
in which the
primer or the target molecule is immobilized or captured onto a solid support.
To simplify the
primer separation and the terminal nucleotide addition analysis,
oligonucleotides are attached to
solid supports or axe modified in such ways that permit affinity separation as
well as polymerase
extension. The 5' ends and internal nucleotides of synthetic oligonucleotides
can be modified in a
number of different ways to permit different affinity separation approaches,
e.g., biotinylation. ~ If
a single affinity group is used on the oligonucleotides, the oligonucleotides
can be separated from
the incorporated terminator reagent. This eliminates the need of physical or
size separation.
More than one oligonucleotide can be separated from the terminator reagent and
analyzed
simultaneously if more than one affinity group is used. This permits the
analysis of several
nucleic acid species or more nucleic acid sequence information per extension
reaction. The ,
affinity group need not be on the priming oligonucleotide but could
alternatively be present on
the template. For example, immobilization can be carried out via an
interaction between
biotinylated DNA and streptavidin-coated microtitration wells or avidin-coated
polystyrene
particles. In the same manner oligonucleotides or templates may be attached to
a solid support,in
a high-density format. In such solid phase microsequencing reactions,
incorporated ddNTPs can
be radiolabeled (Syvanen, Cliraica Chirnica Acta 226:225-236, 1994) or linked
to fluorescein
(Livak and Hainer, Hunzata Mutation 3:379-385,1994). The detection of
radiolabeled ddNTPs
can be achieved through scintillation-based techniques. The detection of
fluorescein-linked
ddNTPs can be based on the binding of antifluorescein antibody conjugated with
alkaline
phosphatase, followed by incubation with a chromogenic substrate (such as p-
nitrophenyl
64
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
phosphate). Other possible reporter-detection pairs include: ddNTP linked to
dinitrophenyl
(DNP) and anti-DNP alkaline phosphatase conjugate (Harju et al., Clin. Claena.
39/11 2282-2287,
. 1993) or biotinylated ddNTP and horseradish peroxidase-conjugated
streptavidin with o-
phenylenediamine as a substrate (WO 92/15712). As yet another alternative
solid-phase
microsequencing procedure, Nyren et al. (Analytical Biochemistry 208:171-175,
1993) described
a method relying on the detection of DNA polymerase activity by an enzymatic
luminometric
inorganic pyrophosphate detection assay (ELIDA).
Pastinen et al. (Genome research 7:606-614, 1997) describe a method for
multiplex
detection of single nucleotide polymorphism in which the solid phase
minisequencing principle
10' is applied to an oligonucleotide array format. High-density arrays of DNA
probes attached to a
solid support (DNA chips) are further described herein.
In one aspect the present invention provides polynucleotides and methods to
genotype
one or more biallelic markers of the present invention by performing a
microsequencing assay.
Preferred microsequencing primers include those being featured in Table 12. It
will be
appreciated that the microsequencing primers listed in Table 12 are merely
exemplary and that,
any primer having a 3' end immediately adjacent to a polymorphic nucleotide
may be used.
Similarly, it will be appreciated that microsequencing analysis may be
performed for any
biallelic marker or any combination of biallelic markers of the present
invention. One aspect of
the present invention is a solid support which includes one or more
microsequencing primers
listed in Table 12, or fragments comprising at least 8, at least 12, at least
15, or at least 20
. consecutive nucleotides thereof and having a 3' terminus immediately
upstream of the
corresponding biallelic marker, for determining the identity of a nucleotide
at a biallelic marker
site.
iii) Mismatch detection assays based on polymerises and 1i ases
25' In one aspect the present invention provides polynucleotides and methods
to determine
the allele of one or more biallelic markers of the present invention in a
biological sample, by
mismatch detection assays based on polymerises and/or ligases. These assays
are based on the
specificity of polymerises and ligases. Polymerization reactions places
particularly stringent
requirements on correct base pairing of the 3' end of the amplification primer
and the joining of
two oligonucleotides hybridized to a target DNA sequence is quite sensitive.
to mismatches close
to the ligation site, especially at the 3' end. The terms "enzyme based
mismatch detection assay"
are used herein to refer to any method of determining the allele of a
biallelic marker based on the
specificity of ligases and polymerises. Preferred methods are described below.
Methods,
primers and various parameters to amplify DNA fragments comprising biallelic
markers of the
present invention are further described herein.
1. Allele specific amplification
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Discrimination between the two alleles of a biallelic marker can also be
achieved by
allele specific amplification, a selective strategy, whereby one of the
alleles is amplified without
amplification of the other allele. This is accomplished by placing a
polymorphic base at the 3'
end of one of the amplification primers. Because the extension forms from the
3'end of the
primer, a mismatch at or near this position has an inhibitory effect on
amplification. Therefore,
under appropriate amplification conditions, these primers only direct
amplification on their
complementary allele. Designing the appropriate allele-specific primer and the
corresponding
assay conditions are well with the ordinary skill in the art.
2. Ligationlamplification based methods
The "Oligonucleotide Ligation Assay" (OLA) uses two oligonucleotides which are
designed to be capable of hybridizing to abutting sequences of a single
.strand of target
molecules. One of the oligonucleotides is biotinylated, and he other is.
detectably labeled. If the
precise complementary sequence is found in a target molecule, the
oligonucleotides will
hybridize such that their termini abut, and create a ligation substrate that
can be captured and
. detected. OLA is capable of detecting biallelic markers and may be
advantageously combined
with PCR as described by Nickerson D.A. et al. (Proc. Natl. Acad.~ Sci. U.S.A.
87:8923-8927,
1990). In this method, PCR is used to achieve the exponential amplification of
target DNA;
which is then detected using OLA.
Other methods which are particularly suited for the detection of biallelic
markers include
LCR (ligase chain reaction), Gap LCR (GLCR) which are described herein. As
mentioned above
LCR uses two pairs of probes to exponentially amplify a specific target. The
sequences of each
pair of oligonucleotides, is selected to permit the pair to hybridize to
abutting sequences of the
same strand of the target. Such hybridization forms a substrate for a template-
dependant ligase.
In accordance with the present invention, LCR can be performed with
oligonucleotides having
the proximal and distal sequences of the same strand of a biallelic marker
site. In one
embodiment, either oligonucleotide will be designed to include the biallelic
marker site. In such
an embodiment, the reaction conditions are selected such that the
oligonucleotides can be ligated
together only if the target molecule either contains or lacks the specific
nucleotide(s)~that is
complementary to the biallelic marker on the oligonucleotide. In an
alternative embodiment, the
oligonucleotides will not include the biallelic marker, such that when they
hybridize to the target
molecule, a "gap" is created as described in WO 90101069. This gap is then
"filled" with ,
complementary dNTPs (as mediated by DNA polymerase), or by an additional pair
of
oligonucleotides. Thus at the end of each cycle, each single strand has a
complement capable of
serving as a target during the next cycle and exponential allele-specific
amplification of the
desired sequence is obtained.
Ligase/Polymerase-mediated Genetic Bit AnalysisTM is another method for
determining
the identity of a nucleotide at a preselected site in a nucleic acid molecule
(WO 95/21271). This
66
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
method involves the incorporation of a nucleoside triphosphate that is
complementary to the
nucleotide present at the preselected site onto the terminus of a primer
molecule, and their
subsequent ligation to a second oligonucleotide. The reaction is monitored by
detecting a specific
label attached to the reaction's solid phase or by detection in solution.
iv) Hybridization assay methods
A preferred method of determining the identity of the nucleotide present at a
biallelic
marker site involves nucleic acid hybridization. The hybridization probes,
which can be
conveniently used in such reactions, preferably include the probes defined
herein. Any
hybridization assay may be used including Southern hybridization, Northern
hybridization, dot
blot hybridization and solid-phase hybridization (see Sambrook et al.,
Molecular Cloning - A
Laboratory Manual, Second Edition, Cold Spring Harbor Press, N.Y., 1989).
Hybridization refers to the formation of a duplex structure by two single
stranded nucleic
acids due to complementary base pairing. Hybridization can occur between
exactly
complementary nucleic acid strands or between nucleic acid strands that
contain minor regions of
mismatch. Specific probes can be designed that hybridize to one form of a
biallelic marker and .
not to the other and therefore are able to discriminate between different
allelic forms. Allele-
specific probes are often used in pairs, one member of a pair showing perfect
match to a target
sequence containing the original allele and the other showing a perfect match
to the target
sequence containing the alternative allele. Hybridization conditions should be
sufficiently
stringent that there is a significant difference in hybridization intensity
between alleles, and
preferably an essentially binary response, whereby a probe hybridizes to only
one of the alleles.
Stringent, sequence specific hybridization conditions, under which a probe
will hybridize only to
the exactly complementary target sequence are well known in the art (Sambrook
et al., Molecular
Cloning - A Laboratory Manual, Second Edition, Cold Spring Harbor Press, N.Y.,
1989).
Stringent conditions are sequence dependent and will be different in different
circumstances.
Generally, stringent conditions are selected to be about 5°C lower than
the thermal melting point
(Tm) for the specific sequence at a defined ionic strength and pH. By way of
example and not
limitation, procedures using conditions of high stringency are as follows:
Prehybridization of
filters containing DNA is carried out for 8 h to overnight at 65°C in
buffer composed of 6X SSC,
50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and
500 ~.glml~
denatured salmon sperm DNA. Filters are hybridized for 48 h at 65°C,
the preferred
hybridization temperature, in prehybridization mixture containing 100 ~g/ml
denatured salmon
sperm DNA and 5-20 X 106 cpm of 32P-labeled probe. Alternatively, the
hybridization step can
be performed at 65°C in the presence of SSC buffer, 1 x SSC
corresponding to 0.15M NaCI and '
0.05 M Sodium citrate. Subsequently, filter washes can be done at 37°C
for 1 h in a solution
containing 2X SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA, followed by a wash
in O.1X
SSC at 50°C for 45 min. Alternatively, filter washes can be performed
in a solution containing 2
67
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
x SSC and 0.1% SDS, or 0.5 x SSC and 0.1% SDS, or 0.1 x SSC and 0.1% SDS at
68°C for 15
minute intervals. Following the wash steps, the hybridized probes are
detectable by
autoradiography. By way of example and not limitation, procedures using
conditions of
intermediate stringency are as follows: Filters containing DNA are
prehybridized, and then
hybridized at a temperature of 60°C in the presence of a 5 x SSC buffer
and labeled probe.
Subsequently, filters washes are performed in a solution containing 2x SSC at
50°C and the
hybridized probes are detectable by autoradiography. Other conditions of high
and intermediate
stringency which may be used are well known in the art and as cited in
Sambrook et al.
(Molecular Cloning - A Laboratory Manual, Second Edition, Cold Spring Harbor
Press, N.Y.,
1989) and Ausubel et al. (Current Protocols in Molecular Biology, Green
Publishing Associates
and Wiley Interscience, N.Y., 1989).
Although such hybridizations can be performed in solution, it is preferred to
employ a
solid-phase hybridization assay. The target DNA comprising a biallelic marker
of the present
invention may be amplified prior to the hybridization reaction. The presence
of a specific allele
in the sample is determined by detecting the presence or the absence of stable
hybrid duplexes
formed between the probe and the target DNA. The detection of hybrid duplexes
can.be carried
out by a number of methods. Various detection assay formats are well known
which utilize
detectable labels bound to either the target or the probe to enable detection
of the hybrid
duplexes: Typically, hybridization duplexes are separated from unhybridized
nucleic acids and
the labels bound to the duplexes are then detected. Those skilled in the art
will recognize that
wash steps may be employed to wash away excess target DNA or probe. Standard
heterogeneous
assay formats are suitable for detecting the hybrids using the labels present
on the primers and
probes.
Two recentlydeveloped assays allow hybridization-based allele discrimination
with no
need for separations or washes (see Landegren U. et al., Geraonae Research,
8:769-776,1998)..
The TaqMan assay takes advantage of the 5' nuclease activity of Taq DNA
polymerase to digest
a DNA probe annealed specifically to the accumulating amplification product.
TaqMan probes
are labeled with a donor-acceptor dye pair that interacts via fluorescence
energy transfer.
Cleavage of the TaqMan probe by the advancing polymerase during amplification
dissociates the
donor dye from the quenching acceptor dye, greatly increasing the.donor
fluorescence. All
reagents necessary to detect two allelic variants can be assembled at the
beginning of the reaction
and the results are monitored in real time (see Livak et al., Nature Genetics,
9:341-342, 1995).
In an alternative homogeneous hybridization-based procedure, molecular beacons
are used for
allele discriminations. Molecular beacons are hairpin-shaped oligonucleotide
probes that report
the presence of specific nucleic acids in homogeneous solutions. When they
bind to their targets
they undergo a conformational reorganization that restores the fluorescence of
an internally
quenched fluorophore (Tyagi et al., Nature Biotechnology, 16:49-53, 1998).
68
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
The polynucleotides provided herein can be used in hybridization assays for
the
detection of biallelic marker alleles in biological samples. These probes are
characterized in that
they preferably comprise between 8 and 50 nucleotides, and in that they are
sufficiently
complementary to a sequence comprising a biallelic marker of the present
invention to hybridize
thereto and preferably sufficiently specific to be able to discriminate the
targeted sequence for
only one nucleotide variation. The GC content in the probes of the invention
usually ranges
between 10 and 75 %, preferably between 35 and 60 %, and more preferably
between 40 and 55
%. The length of these probes can range from 10, 15, 20, or 30 to at least 100
nucleotides,'
preferably from 10 to 50, more preferably from 18 to 35 nucleotides. A
particularly preferred
probe is 25 nucleotides in length. Preferably the biallelic marker is within 4
nucleotides of the
center of the polynucleotide probe. In particularly preferred probes the
biallelic marker is at the
center of said polynucleotide. Shorter probes may lack specificity for a
target nucleic acid
sequence and generally require cooler temperatures to form sufficiently stable
hybrid complexes
with the template. Longer probes are expensive to produce and can sometimes
self hybridize to
form hairpin structures. Methods for the synthesis of oligonucleotide probes
have been described
above and can be applied to the probes of the present invention.
Preferably the probes of the present invention are labeled or immobilized on a
solid
support. Labels and solid supports are further described in I. Detection
probes are generally
nucleic acid sequences or uncharged nucleic acid analogs such as, for example
peptide nucleic
acids which are disclosed in International Patent Application WO 92120702;
morpholino analogs
which are described in U.S. Patents Numbered 5,185,444; 5,034,506 and
5,142,047. The probe
may have to be rendered "non-extendable" in that additional dNTPs cannot be
added to the
probe. In and of themselves analogs usually are non-extendable and nucleic
acid probes can be
rendered non-extendable by modifying the 3' end of the probe such that the
hydroxyl group is no
longer capable of participating in elongation. For example, the 3' end of the
probe can be
functionalized with the capture or detection label to thereby consume or
otherwise block the
hydroxyl group. Alternatively, the 3' hydroxyl group simply can be cleaved,
replaced or
modified, U.S. Patent Application Serial No. 07/049,061 filed April 19, 1993
describes
modifications, which can be used to render a probe non-extendable.
The probes of the present invention are useful for a number of purposes. They
can be
used in Southern hybridization to genomic DNA or Northern hybridization to
mRNA. The
probes can also be used to detect PCR amplification products. ~By assaying the
hybridization to
an allele specific probe, one can detect the presence or absence of a
biallelic marker allele in a
given sample.
High-Throughput parallel hybridizations in array format are specifically
encompassed
within "hybridization assays" and are described below.
i. Hybridization to addressable arrays of oli~onucleotides
69
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Hybridization assays based on oligonucleotide arrays rely on the differences
in
hybridization stability of short oligonucleotides to perfectly matched and
mismatched target
sequence variants. Efficient access to polymorphism information is obtained
through a basic
structure comprising high-density arrays of oligonucleotide probes attached to
a solid support
(the chip) at selected positions. Each DNA chip can contain thousands to
millions of individual
synthetic DNA probes arranged in a grid-like pattern and miniaturized to the
size of a dime.
The chip technology has already been applied with success in numerous cases.
For
example, the screening of mutations has been undertaken in the BRCAl gene, in
S. cerevisiae
mutant strains, and in the protease gene of HIS-1 virus (Hacia et al., Nature
Genetics, 14(4):441-
447, 1996; Shoemaker et al., Nature Genetics, 14(4):450-456, 1996 ; Kozal et
al., Nature
Medicine, 2:753-759, 1996). Chips of various formats for use in detecting
biallelic
polymorphisms can be produced on a customized basis by Affymetrix
(GeneChipT""), Hyseq
(HyChip and HyGnostics), and Protogene Laboratories.
In general, these methods employ arrays of oligonucleotide probes that are
complementary to target nucleic acid sequence segments from an individual
which, target
sequences include a polymorphic marker. EP785280 describes a tiling strategy
for the detection
of single nucleotide polymorphisms. Briefly, arrays may generally be "tiled"
for a large number
of specific polymorphisms. By "tiling" is generally meant the synthesis of a
defined set of
oligonucleotide probes which is made up of a sequence complementary to the
target sequence of
interest, as well as preselected variations of that sequence, e.g.,
substitution of one or more given
' positions with one or more members of the basis set of monomers, i.e.
nucleotides. Tiling
strategies are further described in PCT application No. WO 95/11995. In a
particular aspect,
arrays are tiled for a number of specific, identified biallelic marker
sequences. In particular the
array is tiled to include a number of detection blocks, each detection block
being specific for a~
specific biallelic marker or a set of biallelic markers. For example, a
detection block may be
tiled to include a number of probes, which span the sequence segment that
includes a specific
polymorphism. To ensure probes that are complementary to each allele, the
probes are
synthesized in pairs differing at the biallelic marker. In addition to the
probes differing at the
polymorphic base, monosubstituted probes are also generally tiled within the
detection block.
These monosubstituted probes have bases at and up to a certain number of bases
in either
direction from the polymorphism, substituted with the remaining nucleotides
(selected from A, T,
G, C and U). Typically the probes in a tiled detection block will include
substitutions of the
sequence positions up to and including those that are 5 bases away from the
biallelic marker. The
monosubstituted probes provide internal controls for the tiled array, to
distinguish-actual
hybridization from artefactual cross-hybridization. Upon completion of
hybridization with the
target sequence and washing of the array, the array is scanned to determine
the position on the
array to which the target sequence hybridizes. The hybridization data from the
scanned array is
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
then analyzed to identify which allele or alleles of the biallelic marker are
present in the sample.
Hybridization and scanning may be carried out as described in PCT application
No. WO
92!10092 and WO 95/11995 and US patent No. 5,424,186.
Thus, in some embodiments, the chips may comprise an array of nucleic acid
sequences
of fragments of about 15 nucleotides in length. In further embodiments, the
chip may comprise
an array including at least one of the sequences selected from the group
consisting of SEQ ID
No. 1-130 and the sequences complementary thereto, or a fragment thereof at
least about 8
consecutive nucleotides, preferably 10, 15, 20, more preferably 25, 30, 40,
47, or 50 consecutive
nucleotides. In some embodiments, the chip may comprise an array of at least
2~ 3, 4, 5, 6, 7, 8
or more of these polynucleotides of the invention. Solid supports and
polynucleotides of the
present invention attached to solid supports are further described in I.
v Inte a~ ted systems
Another technique, which may be used to analyze polymorphisms, includes
multicomponent integrated systems, which miniaturize and compartmentalize
processes such as
PCR and capillary electrophoresis reactions in a single functional device. An
example of such'
technique is disclosed in US patent 5,589,136, which describes the integration
of~PCR
amplification and capillary electrophoresis in chips. , .
Integrated systems can be envisaged mainly when microfluidic systems are used.
These
systems comprise a pattern of microchannels designed onto a glass, silicon,
quartz, or plastic
wafer included on a microchip. The movements of the samples are controlled by
electric,
electroosmotic or hydrostatic forces applied across different areas of the
microchip. For
genotyping biallelic markers, the microfluidic system may integrate nucleic
acid amplification,
microsequencing, capillary electrophoresis and a detection method such as
laser-induced
fluorescence detection.
VI. Methods of Genetic Analysis Using the Biallelic Markers of the Present
Invention
Different methods are available for the genetic analysis of complex traits
(see Lander and
Schork, Science, 265, 2037-2048, 1994). The search for disease-susceptibility
genes is
conducted using two main methods: the linkage approach in which evidence is
sought for
cosegregation between a locus and a putative trait locus using family studies,
and the association
approach in which evidence is sought for a statistically significant
association between an allele
and a trait or a trait causing allele (I~houry J. et al., Furzdamentals of
Genetic Epidezzziology, .
Oxford University Press, NY, 1993). In general, the biallelic markers of the
present invention
find use in any method known in the art to demonstrate a statistically
significant correlation
between a genotype and a phenotype. The biallelic markers may be used in
parametric and non-
parametric linkage analysis methods. Preferably, the biallelic markers of the
present invention
are used to identify genes associated with detectable traits using association
studies, an approach
71
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
which does not require the use of affected families and which permits the
identification of genes
associated with complex and sporadic traits.
The genetic analysis using the biallelic markers of the present invention may
be
conducted on any scale. The whole set of biallelic markers of the present
invention or any subset
of biallelic markers of the present invention may be used. In some embodiments
a subset of
biallelic maxkers corresponding to one or several candidate genes of the
present invention may be
used. In other embodiments a subset of biallelic markers corresponding to CNS
disorder
candidate genes may be used. Alternatively, a subset of biallelic markers of
the present invention
localised on a specific chromosome segment may be used. Further, any set of
genetic markers
including a biallelic marker of the present invention may be used. A set of
biallelic
polymorphisms that, could be used as genetic markers in combination with the
biallelic markers
of the present invention, has been described in WO 98/20165. As mentioned
above, it should be
noted that the biallelic markers of the present invention may be included in
any complete or~
partial genetic map of the human genome. These different uses are specifically
contemplated in
the present invention and claims.
A. Linka _~alysis
Linkage analysis is based upon establishing a correlation between the
transmission of
genetic markers and that of a specific trait throughout generations within a
family: Thus, the aim
of linkage analysis is to detect marker loci that show cosegregation with a
trait of interest in
pedigrees.
i. Parametric methods
. When data are available from successive generations there is the opportunity
to study the
degree of linkage between pairs of loci. 'Estimates of the recombination
fraction enable loci to be ,
ordered and placed onto a genetic map. With loci that are genetic markers; a
genetic map can be
established, and then the strength of linkage between markers and traits can
be calculated and
used to indicate the relative positions of markers and genes affecting those
traits (Weir, B.S.;
Genetic data Analysis Il.~ Methods for Discrete population genetic Data,
Sinauer Assoc., I~ac.,
Sunderland, MA, USA, 1996). The classical method for linkage analysis is the
logarithm of odds
(lod) score method (see Morton N.E., Arn.J. Huna. Genet., 7:277-318, 1955; Ott
J.~ Analysis of
Hurnan Genetic Linkage, John Hopkins University Press, Baltirnore, 1991):
Calculation of lod
scores requires specification of the mode of inheritance for the disease
(parametric method).
Generally, the length of the candidate region identified using linkage
analysis is between 2 and
20Mb. Once a candidate region is identified as described above, analysis of
recombinant
individuals using additional markers allows further delineation of the
candidate region. Linkage
analysis studies have generally relied on the use of a maximum of 5,000
microsatellite markers,
thus limiting the maximum theoretical attainable resolution of linkage
analysis to about 600 kb
on average.
72
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Linkage analysis has been successfully applied to map simple genetic traits
that show
clear Mendelian inheritance patterns and which have a high penetrance (i.e.,
the ratio between the
number of trait positive carriers of allele a and the total number of a
carriers in the population).
However, parametric linkage analysis suffers from a variety of drawbacks.
First, it is limited by
its reliance on the choice of a genetic model suitable for each studied trait.
Furthermore, as
already mentioned, the resolution attainable using linkage analysis is
limited, and complementary
studies are required to refine the analysis of the typical 2Mb to 20Mb regions
initially identified
through linkage analysis. In addition, parametric linkage analysis approaches
have proven
difficult when applied to complex genetic traits, such as those due to the
combined action of
multiple genes and/or environmental factors. It is very difficult to model
these factors adequately
in a lod score analysis. In such cases, too large an effort and cost are
needed to recruit the
adequate number of affected families required for applying linkage analysis to
these situations, as
recently discussed by Risch, N. and Merikangas, K. (Science, 273:1516-1517,
1996).
ii. Non-parametric methods
The advantage of the so-called non-parametric methods for linkage analysis is
that they
do not require specification of the mode of inheritance for the disease, they
tend to be more
useful for the analysis of complex traits. In non-parametric methods, one
tries to prove that the
inheritance pattern of a chromosomal region is not consistent with random
Mendelian
segregation by showing that affected relatives inherit identical copies of the
region more often
than expected by chance. Affected relatives should show excess "allele
sharing" even in the
presence of incomplete penetrance and polygenic inheritance. In non-
parametric:linkage analysis
the degree of agreement at a marker locus in two individuals can be measured
either by the
number of alleles identical by state (IBS) or by the number of alleles
identical by descent (IBD).
Affected sib pair analysis is a well-known special case and is the simplest
form of these methods.
The biallelic markers of the present invention may be used in both parametric
and non-
parametric linkage analysis. Preferably biallelic markers may be used in non
parametric methods
which allow the mapping of genes involved in complex traits. The biallelic
markers of the
present invention may be used in both IBD- and IBS- methods to map genes
affecting a complex
trait. In such studies, taking advantage of the high density of biallelic
markers, several adjacent
biallelic marker loci may be pooled to achieve the efficiency attained by
multi-allelic markers
(Zhao et al., Arn. J. Hurra. Genet., 63:225-240, 1998).
However, both parametric and non-parametric linkage analysis methods analyse
affected
relatives, they tend to be of limited value in the genetic analysis of drug
responses or in the
analysis of side effects to treatments. This type of analysis is impractical
in such cases due to the
lack of availability of familial cases. In fact, the likelihood of having more
than one individual in
a family being exposed to the same drug at the same time is extremely low.
B. Population Association Studies
73
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
The present invention comprises methods for identifying one or several genes
among a
set of candidate genes that are associated with a detectable trait using the
biallelic markers of the
present invention. In one embodiment the present invention comprises methods
to detect an
association between a biallelic marker allele or a biallelic marker haplotype
and a trait. Further,
the invention comprises methods to identify a trait causing allele in linkage
disequilibrium with
any biallelic marker allele of the present invention.
As described above, alternative approaches can be employed to perform
association
studies: genome-wide association studies, candidate region association studies
and candidate
gene association studies. In a preferred embodiment, the biallelic markers of
the present
invention are used to perform candidate gene association studies. The
candidate gene analysis
clearly provides a short-cut approach to the identification of genes and gene
polymorphisms
related to a particular trait when some information concerning the biology of
the trait is available.
Further, the biallelic markers of the present invention may be incorporated in
any map of genetic
markers of the human genome in order to perform genome-wide association
studies. Methods to
generate a high-density map of biallelic markers has been described in US
Provisional Patent
application serial number 60/02,614. The biallelic markers of the present
invention may further
be incorporated in any map of a specific candidate region of the genome (a
specific chromosome
or a specific chromosomal segment for example).
As mentioned above, association studies may be conducted within the general
population
and are not limited to studies performed on related individuals in affected
families. Association
studies are extremely valuable as they permit the analysis of sporadic or
multifactor traits.
Moreover, association studies represent a powerful method for fme-scale
mapping enabling
much finer mapping of trait causing alleles than linkage studies. Studies
based on pedigrees
often only narrow the location of the trait causing allele. Association
studies using the biallelic
markers of the present invention can therefore be used to refine the location
of a trait causing
allele in a candidate region identified by Linkage Analysis methods. Moreover,
once a
chromosome segment of interest has been identified, the presence of a
candidate gene such as a ;
candidate gene of.the present invention, in the region of interest can provide
a shortcut to the
identification of the trait causing allele. Biallelic markers of the present
invention can be used to . .
demonstrate that a candidate gene is associated with a trait. Such uses are
specifically
contemplated in the present invention and claims.
i. Determining the frequency of a biallelic marker allele or of a biallelic
marker
haplotype in a population
Association studies explore the relationships among frequencies for sets of
alleles
between loci.
l~Determinin~ the frequency of an allele in a population
74
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Allelic frequencies of the biallelic markers in a population can be determined
using one
of the methods described above under the heading "Methods for genotyping an
individual for
biallelic markers", or any genotyping procedure suitable for this intended
purpose. Genotyping
pooled samples or individual samples can determine the frequency of a
biallelic marker allele in
a population. One way to reduce the number of genotypings required is to use
pooled samples.
A major obstacle in using pooled samples is in terms of accuracy and
reproducibility for
determining accurate DNA concentrations in setting up the pools. Genotyping
individual
samples provides higher sensitivity, reproducibility and accuracy and; is the
preferred method
used in the present invention. Preferably, each individual is genotyped
separately and simple
gene counting is applied to determine the frequency of an allele of a
biallelic marker or of a
genotype in a given population.
2) Determining the frequency of a haplotype in a population
:The gametic phase of haplotypes is unknown when diploid individuals are
heterozygous
at more than one locus. Using genealogical information in families gametic
phase can sometimes
be inferred (Perlin et al., Ana. J. Hurn. Genet., 55:777-787, 1994). When no
genealogical. .
information is available different strategies may be used. One possibility is
that the multiple-site
heterozygous diploids can be eliminated from the analysis, keeping only the
homozygotes and
the single-site heterozygote individuals, but this approach might lead to a
possible bias in the
sample composition and the underestimation of low-frequency haplotypes.
Another possibility is
that single chromosomes can be studied independently, for example, by
asymmetric PCR
amplification (see Newton et al., Nucleic Acids Res., 17:2503-2516, 1989; Wu
et al., Proc. Natl.
Aced. Sci. USA, 86:2757, 1989) or by isolation of single chromosome by limit
dilution followed
by PCR amplification (see Ruano et al., Proc. Natl. Aced. Sci. USA, 87:6296-
6300, 1990).
Further, a sample may be haplotyped for sufficiently close biallelic markers
by double PCR
amplification of specific alleles (Sarkar, G, and Sommer S.S., Biotechniques,
1991). These'
approaches are not entirely satisfying either because of their technical
complexity, the additional
cost they entail, their lack of generalisation at a large scale, or the
possible biases they introduce.
To overcome these difficulties, an algorithm to infer the phase of PCR-
amplified DNA genotypes
introduced by Clark A.G. (Mol. Biol. Evol., 7:111-122, 1990) may be used.
Briefly, the principle
is to start filling a preliminary list of haplotypes present in the sample by
examining
unambiguous individuals, that is, the complete homozygotes and the single-site
heterozygotes.
Then other individuals in the same sample are screened for the possible
occurrence of previously
recognized haplotypes. For each positive identification, the complementary
haplotype is added to
the list of recognized haplotypes, until the phase information for all
individuals is either resolved
or identified as unresolved. This method assigns a single haplotype to each
multiheterozygous
individual, whereas several haplotypes are possible when there are more than
one heterozygous
site. Alternatively, one can use methods estimating haplotype frequencies in a
population without
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
assigning haplotypes to each individual. Preferably, a method based on an
expectation-
maximization (EM) algorithm (Dempster et al., J. R. Stat. Soc., 39B: 1-38,
1977) leading to
maximum-likelihood estimates of haplotype frequencies under the assumption of
Hardy-
Weinberg proportions (random mating) is used (see Excoffier L. and Slatkin M.,
Mol. Biol. Evol.,
12(5): 921-927, 1995). The EM algorithm is a generalized iterative maximum-
likelihood
approach to estimation that is useful when data are ambiguous and/or
incomplete. The EM
algorithm is used to resolve heterozygotes into haplotypes. Haplotype
estimations are further
described below under the heading "Statistical methods". Any other method
known in the art to
determine or to estimate the frequency of a haplotype in a population may also
be used.
. ii. Linkage disequilibrium analysis
Linkage disequilibrium is the non-random association of alleles at two or more
loci and
represents a powerful tool for mapping genes involved in disease traits (see
Ajioka R.S. et al.,
Am. J. Hum. Genet., 60:1439-1447, 1997). Biallelic markers, because they are
densely spaced in
the human genome and can be genotyped in more numerous numbers than other
types of genetic
markers (such as RFLP or VNTR markers), are particularly useful in genetic
analysis based on
linkage disequilibrium. The biallelic markers of the present invention may be
used in any
linkage disequilibrium analysis method known in the art.
Briefly, when a disease mutation is first introduced into a population (by a
new mutation
or,the immigration of a mutation carrier), it necessarily resides on a single
chromosome and thus
on a single "background" or "ancestral" haplotype of linked markers.
Consequently,. there is
complete disequilibrium between these markers and the disease mutation: one
finds the disease
mutation only in the presence of a specific set of marker alleles. Through
subsequent generations
recombinations occur between the disease mutation and these marker
polymorphisms, and the
disequilibrium gradually dissipates. The pace of this dissipation is a
function of the
recombination frequency, so the markers closest to the disease gene will
manifest higher levels of
disequilibrium than those further away. When not broken up by recombination,
"ancestral" .
haplotypes and linkage disequilibrium between marker alleles at different loci
can be tracked not
only through pedigrees but also through populations. Linkage disequilibrium is
usually seen as
an association between one specific allele at one locus and another specific
allele at a second
locus.
The pattern or curve of disequilibrium between disease and marker loci is
expected to
exhibit a maximum that occurs at the disease locus. Consequently, the amount
of linkage
disequilibrium between a disease allele and closely linked genetic markers may
yield valuable
information regarding the location of the disease gene. For fine-scale mapping
of a disease
locus, it is useful to have some knowledge of the patterns of linkage
disequilibrium that exist
between markers in the studied region. As mentioned above the mapping
resolution achieved.
through the analysis of linkage disequilibrium is much higher than that of
linkage studies. The
76
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
high density of biallelic markers combined with linkage disequilibrium
analysis provides
powerful tools for fine-scale mapping. Different methods to calculate linkage
disequilibrium are
described below under the heading "Statistical Methods".
iii. Population-based case-control studies of trait-marker associations
As mentioned above, the occurrence of pairs of specific alleles at different
loci on the
same chromosome is not random and the deviation from random is called linkage
disequilibrium.
Association studies focus on population frequencies and rely on the phenomenon
of linkage
disequilibrium. If a specific allele in a given gene is directly involved in
causing a particular trait,
its frequency will be statistically increased in an affected (trait positive)
population, when
compared to the frequency in a trait negative population or in a random
control population. As a
consequence of the existence of linkage disequilibrium, the frequency of all
other alleles present
in the.haplotype carrying the trait-causing allele will also be increased in
trait positive individuals
compared to trait negative individuals or random controls. Therefore,
association between the
trait and any allele (specifically a biallelic marker allele) in linkage
disequilibrium with the trait-
causing allele will suffice to suggest the presence of a trait-related gene in
that particular region.
Case-control populations can be genotyped for biallelic markers to identify
associations that
narrowly locate a trait causing allele. As any marker in linkage
disequilibrium with one given
marker associated with a trait will be associated with the trait. Linkage
disequilibrium~ allows the
relative frequencies .in case-control populations of a limited number of
genetic polymorphisms
(specifically biallelic markers) to be analyzed as an alternative to screening
all possible
functional polymorphisms in order to find trait-causing alleles. Association
studies compare the
frequency of marker alleles in unrelated case-control populations, and
represent powerful tools
for the dissection of complex traits.
1'~ Case-control populations Sinclusion criteria)
Population-based association studies do not concern familial inheritance but
compare the
prevalence of a particular genetic marker, or a set of markers, in case-
control populations. They
are case-control studies based on comparison of unrelated case (affected or
trait positive)
individuals and unrelated control (unaffected or trait negative or random)
individuals.
Preferably the control group is composed of unaffected or trait negative
individuals. Further, the
control group is ethnically matched to the case population. Moreover, the
control group is
preferably matched to the case=population for the main known confusion factor
for the trait under
study (for example age-matched for an age-dependent trait). Ideally,
individuals in the two
samples are paired in such a way that they are expected to differ only in
their disease status. In
the following "trait positive population", "case population" and "affected
population" are used
interchangeably.
An important step in the dissection of complex traits using association
studies is the
choice of case-control populations (see Lander and Schork, Science, 265, 2037-
2048, 1994). A
77
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
major step in the choice of case-control populations is the clinical
definition of a given trait or
phenotype. Any genetic trait may be analyzed by the association method
proposed here by
carefully selecting the individuals to be included in the trait positive and
trait negative
phenotypic groups. Four criteria are often useful: clinical phenotype, age at
onset, family history
and severity. The selection procedure for continuous or quantitative traits
(such as blood
pressure for example) involves selecting individuals at opposite ends of the
phenotype
distribution of the trait under study, so as to include in these trait
positive and trait negative
populations individuals with non-overlapping phenotypes. Preferably, case-
control populations
consist of phenotypically homogeneous populations. Trait positive and trait
negative populations
consist of phenotypically uniform populations of individuals representing each
between 1 and
98%, preferably between 1 and 80%, more preferably between 1 and 50%, and more
preferably
between 1 and 30%,.most preferably between 1 and 20% of the-total population
under study, and
selected among individuals exhibiting non-overlapping phenotypes. The clearer
the difference
between the two trait phenotypes, the greater the probability of detecting an
association with
biallelic markers. The selection of those drastically different but relatively
unifoim phenotypes
enables efficient comparisons in association studies and the possible
detection of marked
differences at the genetic level, provided that the sample sizes of the
populations under study are
significant enough.
In preferred embodiments, a first group of between 50 and 300 trait positive
individuals,
preferably about 100 individuals, are recruited according to their phenotypes.
A similar number
of trait negative individuals are included in such studies.
In the present. invention, typical examples of inclusion criteria include a
CNS disorder or the
evaluation of the response to a drug acting on a CNS disorder or side effects
to treatment with
drugs acting on a CNS disorder.
Suitable examples of association studies using biallelic markers including the
biallelic
markers of the present invention, are studies involving the following
populations:
a case population suffering from a CNS disorder and a healthy unaffected
control
population, or
a case population treated with agents acting on a CNS disorder suffering from
side-
effects resulting from the treatment and a control population treated with the
same agents
showing no side-effects, or
a case population treated with agents acting on a CNS disorder showing a
beneficial
response and a control population treated with same agents showing no
beneficial response.
2) Association analysis
The general strategy to perform association studies using biallelic markers
derived from
a region carrying a candidate gene is to scan two groups of individuals (case-
control populations)
78
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
in order to measure and statistically compare the allele frequencies of the
biallelic markers of the
present invention in both groups.
If a statistically significant association with a trait is identified for at
least one or more of
the analyzed biallelic markers, one can assume that: either the associated
allele is directly
responsible for causing the trait (the associated allele is the trait causing
allele), or more likely
the associated allele is in linkage disequilibrium with the trait causing
allele. The specific
characteristics of the associated allele With respect to the candidate gene
function usually gives
further insight into the relationship between the associated allele and the
trait (causal or in
linkage disequilibrium). If the evidence indicates that the associated allele
within the candidate
gene is most probably not the trait causing allele but is in linkage
disequilibrium with the real
trait causing allele, then the trait causing allele can be found by sequencing
the vicinity of the
associated marker.
Association studies are usually run in two successive steps. In a first phase,
the
frequencies of a reduced number of biallelic markers from one or several
candidate genes are
determined in the trait positive and trait negative populations. In a second
phase of the analysis,
the identity of the candidate gene and the position of the genetic loci
responsible for the given
trait is further refined using a higher density of markers from the relevant
region. However, if
the candidate gene under study is relatively small in length, as it is the
case for many of the
candidate genes analyzed included in the present invention, a single phase may
be sufficient to
establish significant associations.
3) Haplotype analysis
As described above, when a chromosome carrying a disease allele first appears
in a
population as a result of either mutation or migration, the mutant allele
necessarily resides on a
chromosome having a set of linked markers: the ancestral haplotype. This
haplotype can be
tracked through populations and its statistical association with a given trait
can be analyzed.
Complementing single point (allelic) association studies with multi-point
association studies also
called haplotype studies increases the statistical power of association
studies. Thus, a haplotype
association study allows one to define the frequency and the type of the
ancestral carrier
haplotype. A haplotype analysis is important in that it increases the
statistical power of an
analysis involving individual markers.
In a first stage of a haplotype frequency analysis, the frequency of the
possible
haplotypes based on various combinations of the identified biallelic markers
of the invention is
determined. The haplotype frequency is then compared for distinct populations
of trait positive
and control individuals. The number of trait positive individuals, which
should be, subjected to
this analysis to obtain statistically significant results usually ranges
between 30 and 300, with a
preferred number of individuals ranging between 50 and 150. The same
considerations apply to
the number of unaffected individuals (or random control) used in the study.
The results of this
79
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
first analysis provide haplotype frequencies in case-control populations, for
each evaluated
haplotype frequency a p-value and an odd ratio are calculated. If a
statistically significant
association is found the relative risk for an individual carrying the given
haplotype of being
affected with the trait under study can be approximated.
4) Interaction analysis
The biallelic markers of the present invention may also be used to identify
patterns of
biallelic markers associated with detectable traits resulting from polygenic
interactions. The
analysis of genetic interaction between alleles at unlinked loci requires
individual genotyping
using the techniques described herein. The analysis of allelic interaction
among a selected set of
biallelic markers with appropriate level of statistical significance can be
considered as a
haplotype analysis. Interaction analysis consists in stratifying the case-
control populations with
respect to a given haplotype for the first loci and performing a haplotype
analysiswith the second
loci with each subpopulation.
Statistical methods used in association studies are further described below in
IV.C. '
iv. Testing for linkage in the presence of association
The biallelic markers of the present invention may further be used in TDT
(transmission/disequilibrium test). TDT tests for both linkage and association
and is not affected
by population stratification. TDT requires data from affected individuals and
their parents or
data from unaffected sibs instead of from parents (see Spielmann S. et al.,
Azzz. J Huzn. Genet.;
52:506-516, 1993; Schaid D.J. et al., Genet. Epidemiol.,13:423-450, 1996;
Spielmann S. and
Ewens W.J., Am. J. Hum. Genet., 62:450-458, 1998). Such combined tests
generally reduce the
false - positive errors produced by separate analyses.
C. Statistical Methods
In general, any method known in the art to test whether a trait and a genotype
show a
statistically significant correlation may be used.
i. Methods in linkage analysis
Statistical methods and computer programs useful for linkage analysis are well-
known to
those skilled in the art (see Terwilliger J.D. and Ott J., Handbook of Hunzan
Genetic Linkage,
John Hopkizzs University Press, London, 1994; Ott J., Analysis of Huzzzan
Genetic Linkage, John -
Hopkins University Press, Baltirnor°e, 1991).
ii. Methods to estimate haplotype frequencies in a population
As described above, when genotypes are scored, it is often not possible to
distinguish
heterozygotes so that haplotype frequencies cannot be easily inferred. When
the gametic phase is
not known, haplotype frequencies can be estimated from the multilocus
genotypic data. Any
method known to person skilled in the art can be used to estimate haplotype
frequencies (see
Lange K., Matlaernatical azzd Statistical Methods for Genetic Analysis,
Springer, New York, 1997;
Weir, B.S., Genetic data Analysis IL~ Methods for Discrete population gezzetic
Data, Sizzauer
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Assoc., Inc., Sunderland, MA, USA, 1996). Preferably, maximum-likelihood
haplotype
frequencies are computed using an Expectation- Maximization (EM) algorithm
(see Dempster et
al., J. R. Stat. Soc., 39B:1-38, 1977; Excoffier L. and Slatkin M., Mol. Biol.
Evol., 12(5): 921-
927, 1995). This procedure is an iterative process aiming at obtaining maximum-
likelihood
estimates of haplotype frequencies from multi-locus genotype data when the
gametic phase is
unknown. Haplotype estimations are usually performed by applying the EM
algorithm using for
example the EM-HAPLO program (Hawley M.E. et al., Arza. J. Phys. Anthropol.,
18:104, 1994)
or the Arlequin program (Schneider et al., Arlequirz: a software for
population genetics data
analysis, University of Geneva, 1997). The EM algorithm is a generalized
iterative maximum
likelihood approach to estimation and is briefly described below.
In what follows, phenotypes will refer to multi-locus genotypes with unknown
haplotypic phase. Genotypes will refer to mutli-locus genotypes with known
haplotypic phase.
Suppose one has a sample of N unrelated individuals typed for K markers. The
data
observed are the unknown-phase K locus phenotypes that can be categorized with
F different
phenotypes. Further, suppose that we have H possible haplotypes (in the case
of K biallelic
markers, we have for the maximum number of possible haplotypes H-- 2 x ).
For phenotype j with c~ possible genotypes, we have:
P~ =,~P(genotype(i))=~P(lak,hz). Equation 1
a=m=i
Here, P~ is the probability of the j~' phenotype, and P(h~,h~ is the
probability of the ith genotype
composed of haplotypes lzk and hz. Under random mating (i. e. Hardy-Weinberg
Equilibrium),
P(h~h~ is expressed as:
P(hh , hi ) = P(ltk )Z for hk = lzz , and
P(hk , hl ) = 2P(lzk )P(lzz ) for h~ ~ hl . Equation 2
The E-M algorithm is composed of the following steps: First, the genotype
frequencies
are estimated from a set of initial values of haplotype frequencies. These
haplotype frequencies
are denoted Pl~o~, P2~o~, h3~o),..., hH~oJ. The initial values for the
haplotype frequencies may be
obtained from a random number generator or in some other way well known in the
art: This step
is referred to the Expectation step. The next step in the method, called the
Maximization step,
consists of using the estimates for the genotype frequencies to re-calculate
the haplotype
frequencies. The first iteration haplotype frequency estimates are denoted by
P~~'~, P2~'~, P3~'~,. ~ ~,
PH~'~. In general, the Expectation step at the st" iteration consists of
calculating the probability of
placing each phenotype into the different possible genotypes based on the
haplotype frequencies
of the previous iteration:
81
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
( )~S~ = h' P' (hk' hr )~S~
P hk , hr , Equation 3
N P~
where n~ is the number of individuals with the jth phenotype and P~ (hk , hr )
~S~ is the probability
of genotype hkhr in phenotype j. In the Maximization step, which is equivalent
to the gene-
counting method (Smith, Ann. Hurn. Genet., 21:254-276, 1957), the haplotype
frequencies are re-
estimated based on the genotype estimates:
°i
P ~s+~> _ 1 ~ ~ S P (h h ) ~S~ .
r - 2 ra ,; x ~ r Equation 4
,;=i r=i
Here, St is an indicator variable which counts the number of occurrences that
haplotype t is
present in ith genotype; it takes on values 0, 1, and 2.
The E-M iterations cease when the following criterion has been reached. Using
Maximum Likelihood Estimation (MLE) theory, one assumes that the phenotypes j
are
distributed multinomially. At each iteration s, one can compute the likelihood
function L.
Convergence is achieved when the difference of the log-likehood between two
consecutive
iterations is less than some small number, preferably 10-x.
iii. Methods to calculate linkage disequilibrium between markers
A number of methods can be used to calculate linkage disequilibrium between
any two
genetic positions, in practice linkage disequilibrium is measured by applying
a statistical
association test to haplotype data taken from a population.
Linkage disequilibrium between any pair of.biallelic markers comprising at
least one of the
biallelic markers of the present invention (M;, M~) having alleles (a;/b;) at
marker M; and alleles
(a~/b~) at marker M~ can be calculated for every allele combination (a;,a~ .
a;,b~. b;,a~ and b;,b~),
according to the Piazza formula
~aiaj- ~e4 - ~ (84 + 83) (A4 +A2), where
A4= - - = frequency of genotypes not having allele a; at M; and not having
allele a~ at M~
83= - + = frequency of genotypes not having allele a; at M; and having allele
a~ at M~
92= + - = frequency of genotypes having allele a; at M; and not having allele
a~ at ~M~
Linkage disequilibrium (LD) between pairs of biallelic markers (M;, M~) can
also be calculated
for every allele combination (ai,aj; ai,bj ; b;,a~ andb;,b~), according to the
maximum-likelihood
estimate (MLE) for delta (the composite genotypic disequilibrium coefficient),
as described by
Weir (Weir B.S., Genetic Data Analysis, Sinauer-Ass. Eds, 1996). The MLE for
the composite
linkage disequilibrium is:
Da;a, (2y + n2 + n3 + n~/2)/N - 2(pr(a;).pr(a~))
Where n; = E phenotype (a;/a;, a~la~), n2 = ~ phenotype (a;la;, a~lb~), n3= E
phenotype (a;/b;, a~la~),
n4= E phenotype (a;/b;, a~/b~) and N is the number of individuals in the
sample.
82
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
This formula allows linkage disequilibrium between alleles to be estimated
when only genotype,
and not haplotype, data are available.
Another means of calculating the linkage disequilibrium between markers is as
follows.
For a couple of biallelic markers, M; (allbl) and M~ (a~lb~), fitting the
Hardy-Weinberg
equilibrium, one can estimate the four possible haplotype frequencies in a
given population
according to the approach described above.
The estimation of gametic disequilibrium between ai and aj is simply:
Daia~ = pr(haplotype(ai , a~ )) - pr(ai ).pr(a j ).
Where pr(a~ is the probability of allele a; and pr(a~ is the probability of
allele a~ and
where pr(haplotype (a~, a~) is estimated as in Equation 3 above.
For a couple of biallelic marker only one measure of disequilibrium is
necessary to describe the
association between M; and M.
Then a normalised value of the above is calculated as follows:
D'aiaj - Daiaj / max (-pr(a;).pr(aj) , -pr(bi).pr(bj)) wlth Daiaj~~
D'aiaj - Daiaj / max (pr(bi).pr(aj) , pr(a;).pr(bj)) with Da;aj>0
The skilled person will readily appreciate that other LD calculation methods
can be used
without undue experimentation.
Linkage disequilibrium among a set of biallelic markers having an adequate
heterozygosity rate
can be determined by genotyping between 50 and 1000 unrelated individuals,
preferably between
75 and 200, more preferably around 100.
iv. Testing for association
Methods for determining the statistical significance of a correlation between
a phenotype
and a genotype, in this case an allele at a biallelic marker or a haplotype
made up of such alleles,
may be determined by any statistical test known .in the art and with any
accepted threshold of
statistical significance being required. The application of particular methods
and thresholds of
significance are well with in the skill of the ordinary practitioner of the
art.
Testing for association is performed by determining the frequency of a
biallelic marker
allele in case and control populations and comparing these frequencies with a
statistical test to
determine if their is a statistically significant difference in frequency
which would indicate a
correlation between the trait and the biallelic marker allele under study.
Similarly, a haplotype
analysis is performed by estimating the frequencies of all possible haplotypes
for a given set of
biallelic markers in case and control populations, and comparing these
frequencies with a
statistical test to determine if their is a statistically significant
correlation between the haplotype
and the phenotype (trait) under study. Any statistical tool useful to test for
a statistically
significant association between a genotype and a phenotype may be used.
Preferably the
statistical test employed is a chi-square test with one degree of freedom. A p-
value is then
83
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
determined (the P-value is the probability that a statistic as large or larger
than the observed one
would occur by chance).
1) Statistical significance
In preferred embodiments, significance for diagnostic purposes, either as a
positive basis
for further diagnostic tests or as a preliminary starting point for early
preventive therapy, the p
value related to a biallelic marker association is preferably about 1 x 10-2
or less, more
preferably about 1 x 10-4 or less, for a single biallelic marker analysis and
about 1 x 10-3 or less,
still more preferably 1 x 10-6 or less and most preferably of about 1 x 10-8
or less, for a
haplotype analysis involving several markers. These values are believed to be
applicable to any
association studies involving single or multiple marker combinations.
The skilled person can use the range of values set forth above as a starting
point in order
to carry out association studies with biallelic markers of the present
invention. In doing so,
significant associations between the biallelic markers of the present
invention and CNS disorders
can be revealed and used for diagnosis and drug screening purposes.
2 Phenotypic permutation
In order to confirm the statistical significance of the first stage haplotype
analysis
described above, it might be suitable to perform further analyses in which
genotyping data from
case-control individuals are pooled and randomized with respect to the trait
phenotype. Each
individual genotyping data is randomly allocated to two groups, which contain
the same number
of individuals as the case-control populations used to compile the data
obtained in the first stage.
A second stage haplotype analysis is preferably run on these artificial
groups, preferably for the
markers included in the haplotype of the first stage analysis showing the
highest relative risk
coefficient. This experiment is re-iterated preferably at least between 100
and 10000 times. The
repeated iterations allow the determination of the percentage of obtained
haplotypes with a
significant p-value level.
3) Assessment of statistical association
To address the problem of false positives similar analysis may be performed
with the
same case-control populations in random genomic regions. Results in random
regions and the
candidate region are compared as described in US Provisional Patent
Application entitled
"Methods, software and apparati for identifying genomic regions harbouring a
gene associated
with a detectable trait".
v. Evaluation of risk factors
The association between a risk factor (in genetic epidemiology the risk factor
is the
presence or the absence of a certain allele or haplotype at marker loci) and a
disease is measured
by the odds ratio (OR) and by the relative risk (RR). If P(R~) is the
probability of developing the
disease for individuals with risk factor R and P(R-) is the probability for
individuals without the
risk factor, then the relative risk is simply the ratio of the two
probabilities, that is:
84
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
RR= P(R+)/P(R_)
In case-control studies, direct measures of the relative risk cannot be
obtained because of
the sampling design. However, the odds ratio allows a good approximation of
the relative risk for
low-incidence diseases and can be calculated:
F+ F-
OR =
1-F+ (1-F-)
OR = [F+1(1-F+)] / [F-/(1-F-)]
F+ is the frequency of the exposure to the risk factor in cases and F- is the
frequency of the
exposure to the risk factor in controls. F+ and F- are calculated using the
allelic or haplotype
frequencies of the study and further depend on the underlying genetic model
(dominant,
recessive, additive...).
One can further estimate the attributable risk (AR) which describes the
proportion of
individuals in a population exhibiting a trait due to a given risk factor.
This measure is important
in quantitating the role of a specific factor in disease etiology and in terms
of the public health
impact of a risk factor. The public health relevance of this measure lies in
estimating the
proportion of cases of disease in the population that could be prevented if
the exposure of interest
~ were absent. AR is determined as follows:
~ - Ps (~-1) / (Ps (~-1)+1)
AR is the risk attributable to a biallelic marker allele or a biallelic marker
haplotype. PE is the
frequency of exposure to an allele or a haplotype within the population at
large; and RR is the
relative risk which is approximated with the odds ratio when the trait under
study has a relatively
low incidence in the general population.
D. Association of Biallelic Markers of the Invention with Ma'ot r Depression
In the context of the present invention, an association between .biallelic
marker alleles
from candidate genes of the present invention and a CNS disorder was
demonstrated. The
considered CNS disorder was major depression.
~ Depression is a serious medical illness that affects 340 million people
worldwide. In
contrast to the normal emotional experiences of sadness, loss, or passing mood
states, clinical
depression is persistent and can interfere significantly with an individual's
ability to function.
Many neurochemical findings are coming to light implicating a biological basis
for the
depression, at least for certain subtypes. Abnormalities of monoamine function
as well as over
stimulation of the HPA axis have been recognized in depression for many years.
Patterns of
clustering and segregation in depressive families have suggested a genetic
component to
depression. However, the lack of a defined and specific depression phenotype
and of suitable
markers for genetic analysis is proving to be a major hurdle for reliably
identifying genes
associated with depression. As a result, psychiatrists today have to choose
antidepressant
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
medications by intuition and trial and error; a situation that can put
suicidal patients in jeopardy
for weeks or months until the right compound is selected. Clearly, there is a
strong need to
successfully identify genes involved in depression; thus allowing researchers
to understand the
etiology of depression and address its cause, rather than symptoms.
As mentioned above, both the nervous system and endocrine system play a major
role in
the etiology of depression. More specifically, the neurotransmitters dopamine,
norepinephrine
and serotonin as well as the hormones corticotrophin releasing factor,
glucocorticoids,
mineralocorticoids and various neuropeptides are thought to play a major role
in the
pathophysiology of depression.
In order to investigate and identify a genetic origin of depression, a
candidate gene scan
for depression was conducted. The rational of this approach was to: 1) select
candidate genes
potentially involved in the pathophysiology of interest, in this case major
depression, 2) to
identify biallelic markers in those genes and finally 3) to measure the
frequency of biallelic
marker alleles in order to determine if some alleles are more frequent in
depressed populations
than in non-affected populations. Results were further validated by haplotype
studies.
Significant associations between biallelic marker alleles from the serotonin
receptor 6 (SHTR6),
serotonin 7 (SHTR7), serotonin transporter (SHTT), dopamine receptor 3 (DRD3),
norepinephrine transporter (NET), guanine nucleotide binding protein, (33
(Gbeta3),
glucocorticoid receptor (GRL), drug metabolizing enzyme cytochrome P450 3A4
(Chl.'3A4) and
Wolfram Syndrome 1 (WFSI) genes and depression were demonstrated in the
context of the
present invention. Association studies are further described in Examples 3, 4
and 5. .
This information is extremely valuable. The lrnowledge of a potential genetic
predisposition, even if this predisposition is not absolute, might contribute
in a very significant
manner to treatment efficacy of depressed patients and to the development of
diagnostic tools.
E. Identification of Biallelic Markers in Linkage Disequilibrium with the
Biallelic
Markers of the Invention
Once a first biallelic marker has been identified in a genomic region of
interest, the
practitioner of ordinary skill in the art, using the teachings of the present
invention, can easily
identify additional biallelic markers in linkage disequilibrium with this
first marker. As
mentioned before any marker in linkage disequilibrium with a first marker
associated with a trait
will be associated with the trait. Therefore, once an association has been
demonstrated between a
given biallelic marker and a trait, the discovery of additional biallelic
markers associated with . .
this trait is of great interest in order to increase the density of biallelic
markers in this particular
region.. The causal gene or mutation will be found in the vicinity of the
marker or set of markers
showing the highest correlation with the trait.
Identification of additional markers in linkage disequilibrium with a given
marker
involves: (a) amplifying a genomic fragment comprising a first biallelic
marker from a plurality
86
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
of individuals; (b) identifying of second biallelic markers in the genomic
region harboring said
first biallelic marker; (c) conducting a linkage disequilibrium analysis
between said first biallelic
marker and second biallelic markers; and (d) selecting said second biallelic
markers as being in
linkage disequilibrium with said first marker. Subcombinations comprising
steps (b) and (c) are
also contemplated.
Methods to identify biallelic markers and to conduct linkage disequilibrium
analysis are
described herein and can be carried out by the skilled person without undue
experimentation.
The present invention then also concerns biallelic markers which are in
linkage disequilibrium ,
with the specific biallelic markers shown in Table 7 and which are expected to
present similar
characteristics in terms of their respective association with a given trait. .
F. Identification of Functional Mutations
Once a positive association is confirmed with a biallelic marker of the
present invention,
the associated candidate gene can be scanned for mutations by comparing the
sequences of a
selected number of trait positive and trait negative individuals. In a
preferred embodiment,
functional regions such as exons and splice sites, promoters and other
regulatory regions of the
candidate gene are scanned for mutations. Preferably, trait positive
individuals carry the
haplotype shown to be associated with the trait and trait negative individuals
do not carry the
haplotype or allele associated with the trait. The mutation detection
procedure is essentially
similar to that used for biallelic site identification.
The method used to detect such mutations generally comprises the following
steps: (a)
amplification of a region of the candidate gene comprising a biallelic marker
or a group of
biallelic markers associated with the trait from DNA samples of trait positive
patients and trait
negative controls; (b) sequencing of the amplified region; (c) comparison of
DNA sequences
from trait-positive patients and trait-negative controls; and (d)
determination of mutations
specific to trait-positive patients. Subcombinations which comprise steps (b)
and (c) are
specifically contemplated.
It is preferred that candidate polymorphisms be then verified by screening a
larger
population of cases and controls by means of any genotyping procedure such as
those described
herein, preferably using a microsequencing technique in an individual test
format. .
Polymorphisms are considered as candidate mutations when present in cases and
controls at
frequencies compatible with the expected association results.
VII. Biallelic Markers of the Invention in Methods of Genetic Diagnostics
The biallelic markers of the present invention can also be used to develop
diagnostics
tests capable of identifying individuals who express a detectable trait as the
result of a specific
genotype or individuals whose genotype places them at risk of developing a
detectable trait at a
subsequent time. The trait analyzed using the present diagnostics may be any
detectable trait,
87
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
including a CNS disorder, a response to an agent acting on a CNS disorder or
side effects to an
agent acting on a CNS disorder.
The diagnostic techniques of the present invention may employ a variety of
methodologies to determine whether a test subj ect has a biallelic marker
pattern associated with
an increased risk of developing a detectable trait or whether the individual
suffers from a
detectable trait as a result of a particular mutation, including methods which
enable the analysis
of individual chromosomes for haplotyping, such as family studies, single
sperm DNA analysis
or somatic hybrids.
The present invention provides diagnostic methods to determine whether an
individual is
at risk of developing a disease or suffers from a disease resulting from a
mutation or a
polymorphism in a candidate gene of the present invention. The present
invention also provides
methods to determine whether an individual is likely to respond positively to
an agent acting on a
CNS disorder or whether an individual is at risk of developing an adverse side
effect to an agent
acting on a CNS disorder.
These methods involve obtaining a nucleic acid sample from the individual and,
determining, whether the nucleic acid sample contains at least one allele or
at least one biallelic
marker haplotype, indicative of a risk of developing the trait or indicative
that the individual
expresses the trait as a result of possessing a particular candidate gene
polymorphism or mutation
(trait-causing allele).
Preferably, in such diagnostic methods, a nucleic acid sample is obtained from
the
individual and this sample is genotyped using methods described herein. The
diagnostics maybe
based on a single biallelic marker or on a group of biallelic markers.
In each of these methods, a nucleic acid sample is obtained from the test
subject and the
biallelic marker pattern of one or more of the biallelic markers listed in
Table 7 is.determined.
In one embodiment, PCR amplification is conducted on the nucleic acid sample
to
amplify regions in which polymorphisms associated with a detectable phenotype
have been '
identified. The amplification products are sequenced to determine whether the
individual
possesses one or more polymorphisms associated with a detectable phenotype.
The primers used
to generate amplification products may comprise the primers listed in Table
13. Alternatively,
the nucleic acid sample is subjected to microsequencing reactions as described
above to
determine whether the individual possesses one or more polymorphisms
associated with a
detectable phenotype resulting from a mutation or a polymorphism in a
candidate gene. The
primers used in the microsequencing reactions may include the primers listed
in Table 12. In
another embodiment, the nucleic acid sample is contacted with one or more
allele specific
oligonucleotide probes which, specifically hybridize to one or more candidate
gene alleles
associated with a detectable phenotype. The probes used in the hybridization
assay may include
the probes listed in Table 14.
88
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
In a preferred embodiment the identity of the nucleotide present at, at least
one, SHTR6
related biallelic marker selected from the group consisting of 99-27207-117,
99-28110-75, and
99-28134-215, is determined and the detectable trait is depression.
In a preferred embodiment the identity of the nucleotide present at, at least
one, SHTR7
related biallelic marker selected from the group consisting of 99-32181-192
and 99-28106-185, is
determined and the detectable trait is depression.
In a preferred embodiment the identity of the nucleotide present at, at least
one, GRL
related biallelic marker selected from the group consisting of 99-30858-354,
18-20-174,' 99-
32002-313, 18-31-178, 18-38-395, and 99-30853-364, is determined and the
detectable trait is
depression.
In a preferred embodiment the identity of the nucleotide present at, at least
one, NET
related biallelic marker selected from the group consisting of 19-56-140, 19-
28-136, 99-28788-
300, 99-32061-304, 99-32121-242, 19-14-241, and 16-50-196, is determined and
the detectable
trait is depression.
In a preferred embodiment the identity of the nucleotide present at, at least
one, DRD3 related
biallelic marker selected from the group consisting of 8-19-372, is determined
and the detectable
trait is depression.
In a preferred embodiment the identity of the nucleotide present at, at least
one, CYP3A4
related biallelic marker selected from the group consisting of 12-254-180, 10-
214-279, and 10-
217-91, is determined and the detectable trait is depression.
In a preferred embodiment the identity of the nucleotide present at, at least
one, SHTT
related biallelic marker selected from the group consisting of 18-194-130, 18-
186-391, 18-198-
252, and 18-242-300, is determined and the detectable trait is depression.
In a preferred embodiment the identity of the nucleotide present at, at least
one, Gbeta3 related
biallelic marker selected from the group consisting of 20-205-302, 19-58-162,
19-9-45, 19-22-74,
and 19-88-185, is determined and the detectable trait is depression.
In a preferred embodiment the identity of the nucleotide present at, at least
one, WFS 1
related biallelic marker selected from the group consisting of 19-18-310, 19-
19-174, 19-17-188,
and 19-16-127, is determined and the detectable trait is depression.
~ Diagnostic kits comprising polynucleotides of the present invention are
further described
in section I.
These diagnostic methods are extremely valuable as they can, in certain
circumstances,
be used to initiate preventive treatments or to allow an individual carrying a
significant haplotype
to foresee warning signs such as minor symptoms. In diseases in which attacks
may be
extremely violent and sometimes fatal if not treated on time, such as asthma,
the knowledge of a
potential predisposition, even if this predisposition is not absolute, might
contribute in a very
significant manner to treatment efficacy. Similarly, a diagnosed
predisposition to a potential side
89
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
effect could immediately direct the physician toward a treatment for which
such side effects have
not been observed during clinical trials.
Diagnostics, which analyze and predict response to a drug or side effects to a
drug, may
be used to determine whether an individual should be treated with a particular
drug. For
example, if the diagnostic indicates a likelihood that an individual will
respond positively to
treatment with a particular drug, the drug may be administered to the
individual. Conversely, if
the diagnostic indicates that an individual is likely to respond negatively to
treatment with a
particular drug, an alternative course of treatment may be prescribed. A
negative response may
be defined as either the absence of an efficacious response or the presence of
toxic side effects.
Clinical drug trials represent another application for the markers of the
present invention.
One or more markers indicative of response to an agent acting on a CNS
disorder or to side
effects to an agent acting on a CNS disorder may be identified using the
methods described
above. Thereafter, potential participants in clinical trials of such an agent
may be screened to
identify those individuals most likely to respond favorably to the drug and
exclude those likely to
experience side effects. In that way, the effectiveness of drug treatment may
be measured in
individuals who respond positively to the drug, without lowering the
measurement as anesult of
the inclusion of individuals who are unlikely to respond positively in the
study and without
risking undesirable safety problems.
VIII. DNA Typing Methods and Systems
The present invention also encompasses a DNA typing system having a much
higher
discriminatory power than currently available typing systems. The systems and
associated
methods are particularly applicable in the identification of individuals for
forensic science and
paternity determinations. These applications have become increasingly
important; in forensic
science, for example, the identification of individuals by polymorphism
analysis has become
widely accepted by courts as evidence.
While forensic geneticists have developed many techniques to compare
homologous
segments of DNA to determine if the segments are identical or if they differ
in one or more
nucleotides, each technique still has certain disadvantages. In particular,
the techniques vary
widely in terms of expense of analysis, time required to carry out an analysis
and statistical
power.
RFLP analysis methods
The best known and most widespread method in forensic DNA typing is the
restriction
fragment length polymorphism (RFLP) analysis. In RFLP testing, a repetitive
DNA sequence
referred to as a variable number tandem repeat (VNTR) which varies between
individuals is
analyzed. The core repeat is typically a sequence of about 15 base pairs in
length; and highly
polymorphic VNTR loci can have an average of about 20 alleles. DNA restriction
sites located
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
on either site of the VNTR are exploited to create DNA fragments from about
O.SKb to less than
l OKb which are then separated by electrophoresis, indicating the number of
repeats found in the
individual at the particular loci. RFLP methods generally consist of (1)
extraction and isolation
of DNA, (2) restriction endonuclease digestion; (3) separation of DNA
fragments by
electrophoresis; (4) capillary transfer; (5) hybridization with radiolabelled
probes; (6)
autoradiography; and (7) interpretation of results (Lee, H.G. et al., Am. J.
Forensic. Med. Pathol.
15(4): 269-282 (1994)). RFLP methods generally combine analysis at about 5
loci and have
much higher discriminate potential than other available test due the highly
polymorphic nature of
the VNTRs. However, autoradiography is costly and time consuming and an
analysis generally
takes weeks or months for turnaround. Additionally, a large amount of sample
DNA is required,
which is often not available at a crime scene. Furthermore, the reliability of
the system and its
credibility as evidence is decreased because the analysis of tightly spaced
bands on
electrophoresis results in a high rate of error.
PCR methods
PCR based methods offer an alternative to RFLP methods. In a first method
called
AmpFLP, DNA fragments containing VNTRs are amplified and then separated
electrophoretically, without the restriction step of RFLP method. While this
method allows small
quantities of sample DNA to be used, decreases analysis time by avoiding
autoradiography, and
retains high discriminatory potential, it nevertheless requires
electrophoretic separation which
takes substantial time and introduces an significant error rate. In another
AmpFLP method, short
tandem repeats (STRs) of 2 to 8 base pairs are analyzed. STRs are more
suitable to analysis of
degraded DNA samples since they require smaller amplified fragments but have
the disadvantage
of requiring separation of the amplified fragments. While STRs are far less
informative than
longer repeats, similar discriminatory potential can be achieved if enough
STRs are used in a
single analysis.
Other methods include sequencing of mitochondria) DNA, which is especially
suitable
for situations where sample DNA is very degraded or in small quantities.
However, only a small
region of 1Kb of the mitochondria) DNA referred to as the D-Loop locus has
been found useful
for typing because of its polymorphic nature, resulting in lower
discriminatory potential than
with RFLP or AmpFLP methods. Furthermore, DNA sequencing is expensive to carry
out on a
large number of samples.
Further available methods include dot-blot methods, which involve using allele
specific
oligonucleotide probes which hybridize sequence specifically to one allele of
a polymorphic site.
Systems include the HLA DQ-alpha kit developed by Cetus Corp. which has a
discriminatory
value of about 1 in 20, and a dot-blot strip referred to as the Polymarker
strip combining five
genetic loci for a discriminatory value of about one in a few thousand.
(Weedn, V., Clinics in
Lab. Med. 16(1): 187-196 (1996)).
91
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
In addition to difficulties in analysis and time consuming laboratory
procedures, it
remains desirable for all DNA typing systems to have a higher discriminatory
power. Several
applications exist in which even the most discriminating tests need
improvement in order to
remove the considerable remaining doubt resulting from such analyses. Table 3
below lists
characteristics of currently available forensic testing systems (Weedn,
(1996)) and compares
them with the method of the invention.
Table 3
Test type Technology TurnaroundDiscf~irninatorySensitivitySample
time potential (amount
DNA)
RFLP VNTR Weeks long . Highly intact
or
(autoradiography)months 106 to 109 DNA
AmpFLP VNTR Days 100pg Moderate
(PCR based) 103 to 106 degradation
Dot blot Sequence specificDays lng Moderate
(ex.
HLADQAl) oligonucleotide 101 to 103 degradation
probes
MitochondrialD-loop sequenceDays lpg Severe
DNA (PCR based) 102 degradation
Present Biallelic MarkersHours 6 100pg Moderate
marker to 238
47
10
10
10
> >
set (set of 13, Days degradation
set of
100, set of (throughput
200, set
of 270) dependent)
Applications
As described above, an important application of DNA typing tests is to
determine
whether a DNA sample (e.g. from a crime scene) originated from an individual
suspected of
leaving said DNA sample.
There are several applications for DNA typing which require a particularly
powerful
genotyping system. In a first application, a high powered typing system is
advantageous when
for example a suspect is identified by searching a DNA profile database such
as that maintained
by the U.S. Federal Bureau of Investigation. Since databases may contain large
numbers of data
entries that are expected to increase consistently, currently used forensic
systems can be expected
to identify several matching DNA profiles due to their relative lack of power.
While database
searches generally reinforce the evidence by excluding other possible
suspects, low powered
typing systems resulting in the identification of several individuals may
often tend to diminish
the overall case against a defendant.
92
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
In another application, a target population is systematically tested to
identify an
individual having the same DNA profile as that of a DNA sample. In such a
situation, a
defendant is chosen at random based on DNA profile from a large population of
innocent
individuals. Since the population tested can often be large enough that at
least one positive
match is identified, and it is usually not possible to exhaustively test a
population, the usefulness
of the evidence will depend on the level of significance of the forensic test.
In order to render
such an application useful as a sole or primary source of evidence, DNA typing
systenns of
extremely high discriminatory potential are required.
In yet another application, it is desirable to be able to discriminate between
related
individuals. Because related individuals will be expected to share a large
portion of alleles at
polymorphic sites, a very high powered DNA typing assay would be required to
discriminate
between them. This can have important effects if a sample is found to match
the.defendant's
DNA profile and no evidence that the perpetrator is a relative can be found.
Accordingly, there a need in this art for a rapid, simple, inexpensive and
accurate
technique having a very high resolution value to determine relationships
between individuals and
differences in degree of relationships. Also, there is a need in the art for a
very accurate genetic
relationship test procedure which uses very small amounts of an original DNA
sample, yet . .
produces very accurate results.
The present invention thus involves methods for the identification of
individuals
comprising determining the identity of the nucleotides at set of genetic
markers in a biological
sample, wherein said set of genetic markers comprises at least one CNS
disorder-related marker.
The present invention provides an extensive set of biallelic markers allowing
a higher
discriminatory potential than the genetic markers used in current forensic
typing systems. Also,
biallelic markers can be genotyped in individuals with much higher efficiency
and accuracy than
the genetic markers used in current forensic typing systems. In preferred
embodiments, the
invention comprises determining the identity of a nucleotide at a CNS disorder-
related marker by
single nucleotide primer extension, Which does not require electrophoresis as
in techniques
described above and results in lower rate of experimental error. As shown in
Table 3, above, in
comparison with PCR based VNTR based methods which allow discriminatory
potential of
thousands to millions, and RFLP based methods which allow discriminatory
potential of merely
millions to billions under optimal assumptions, the biallelic marker based
method of the present
invention provides a radical increase in discriminatory potential.
Any suitable set of genetic markers and biallelic markers of the invention may
be used,
and may be selected according to the discriminatory power desired. Biallelic
markers, sets of
biallelic markers, probes, primers, and methods for determining the identity
of said biallelic
markers are further described herein.
Discriminatory potential of biallelic marker tyoing
93
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Calculating discriminatory potential
The discriminatory potential of the forensic test can be determined in terms
of the profile
frequency, also referred to as the random match probability, by applying the
product rule. The
product rule involves multiplying the allelic frequencies of all the
individual alleles tested, and
multiplying by an additional factor of 2 for each heterozygous locus.
In one example discussed below, the discriminatory potential of biallelic
marker typing
can be considered in the context of forensic science. In order to determine
the discriminatory
potential with respect to the numbers of biallelic markers to be used in a
genetic typing system,
the formulas and calculations below assume that (1) the population under study
is sufficiently
large (so that we can assume no consanguinity); (2) all markers chosen are not
correlated, so that
the product rule (Lander and Budlowle (1992)) can be applied; and (3) the
ceiling rule can be
applied or that the allelic frequencies of markers in the population under
study are known with
sufficient accuracy.
As noted in Weir, B.S., Genetic data Ataalysis IL Methods for Discrete
population .
genetic Data, Sinauer Assoc., Inc., Sundef-land, MA, USA, 1996, the example
assumes a crime
has been committed and a sample of DNA from the perpetrator (P) is available
for analysis. The
genotype of this DNA sample can be determined for several genetic markers, and
the profile A of
the perpetrator can thereby be determined.
In this example, one suspect (S) is available for typing. The same set of
genetic markers,
such as the biallelic markers of the invention, are typed and the same profile
A is obtained for (S)
and (P). Two hypotheses are thus presented as follows:
(1) either S is P (event C)
(2) either S is not P (event E).
The ratio L of both probabilities can then be calculated using the following
equation:
L = pr(S = A, P = A l C)
pr(S=A,P=AlC)
L can then further be calculated by the following equation:
L = 1 ( 1 ) Equation 1
pr(P=AlS=A,C)
These probabilities as well as L can be calculated in several settings,
notably for different
kinship coefficients between P and S for a genetic marker (see Weir, (1996)).
Assuming that all genetic markers chosen are independent of each other, the
global ratio
L for a set of genetic markers will be the product over each genetic marker of
all L.
It is further possible to estimate the mean number of biallelic markers or
VNTRs
required to have a ratio L equal to 10$ or 106 by calculating the expectancy
of the random
variable L using the following equation:
94
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
N
E(L) = Tj E(Li ) where N is the number of loci
i=1
G; _
E(Li ) _ ~ pr(P = Aij l S = Aij , C).Lij, where Aij is the genotype j at the
ith marker,
j=1
Lij the ratio associated with such genotype, Gi being the number of genotypes
at locus i.
From equation 1, it can easily be derived that the expectancy of L; is G;, the
number of possible
genotypes of this marker.
The general expectancy for a set of genetic markers can then be expressed by
the
following equation:
N
E(L) = jlGi (2) Equation 2
i=1
Biallelic marker-based DNA typing systems
Using the equations described above, it is possible to select biallelic marker-
based DNA
typing systems having a desired discriminatory potential.
Using biallelic markers, E(L) can thus be expressed as 3N. When using VNTR-
based
DNA typing systems, assuming the VNTRs have 10 alleles, E(L) can be expressed
as 55~:
Based on these results, the number of biallelic markers or VNTRs needed to
obtain, in mean, a
ratio of at least 106 or 108 can calculated, and are set forth below in Table
4.
Table 4
Marker sets L=106 L=108
Biallelic 13 17
5-allele markers (e.g.5 7
VNTR)
10-allele markers 4 5
(e.g. VNTR)
Thus, in a first embodiment, DNA typing systems and methods of the invention
may
comprise genotyping a set of at least 13 or at least 17 biallelic markers to
obtain a ratio of at least
106 or 108, assuming a flat distribution of L across the biallelic markers. In
preferred
embodiments, a greater number of biallelic markers is genotyped to obtain a
higher L value.
Preferably at least l, 2, 3, 4, 5, 10, 13, 15, 17, 20, 25, 30, 40, 50, 70, 85,
100, 150, 200, 250 or all
of the CNS disorder-related markers are genotyped. Said DNA typing systems of
the invention
would result in L values as listed in Table 5 below as an indication of the
discriminate potential
of the systems of the invention.
Table 5
Number of biallelic L
markers
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
50 7.2 * 1023
100 5*1047
271 3~271
In situations where the distribution of L is not flat, such as in the worst
case when the
perpetrator is homozygous for the major allele at each genetic locus and L
thus takes the lowest
value, a larger number of biallelic markers is required for the same
discriminatory potential:
Therefore, in preferred embodiments, DNA typing systems and methods of the
invention using a
larger number of biallelic markers allow for uneven distributions of L across
the biallelic
markers. For example, assuming unrelated individuals, a set of independent
markers having an
allelic frequency of 0.1/0.9, and the genetic profile of a homozygote at each
genetic loci for the
major allele, 66 biallelic markers are required to obtain a ratio of 106, and
88 biallelic markers are
required to obtain a ratio of 108. Thus, in preferred embodiments based on the
use of markers
having a maj or allele of sufficiently high frequency, this is a first
estimation of the upper bound
of markers required in a DNA typing system. .
In further embodiments, it is also desirable to have the ability to
discriminate between
relatives. Although unrelated individuals have a low probability of sharing
genetic profiles, the
probability is greatly increased for relatives. For example, the DNA profile
of a suspect matches
the DNA profile of a sample at a crime scene, and the probability of obtaining
the same DNA
profile if left by an untyped relative is required. Table 6 below (Weir
(1996)) lists probabilities
for several different types of relationships, assuming alleles Ai and Aj, and
population
frequencies pi and pj, and lists likelihood ratios assuming genetic loci
having allele frequencies
of 0.1.
Table 6
Genotype Relationship Pr(p=ASS=A) L
Ai Aj Full brothers (1+pi+pj+2pi 3.3
pj)/4
Father and son (pi+pj)/2 10.0
Half brothers (pi+pj+4pi pj)/416.7
Uncle and nephew(1+pi+pj+2pi 16.7
pj)/4
First cousins (1+pi+pj+l2pi 25.0
pj)/8
Unrelated 2pi pj 50.0
Aj Aj I Full brothers I (1+pi)2/q, 3.3
96
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Father and son pi 10.0
Half brothers pi (1+pi)/2 18.2
Uncle and nephewpi (1+pi)/2 18.2
First cousins pi (1+3pi)!4 30.8
Unrelated pit 100.0
In one example, where the suspect is the full brother of the perpetrator, the
number of
required biallelic markers will be 187 assuming the profile is that of a
homozygote for the major
allele at each biallelic marker.
In yet further embodiments, the DNA typing systems and methods of the present
invention may further take into account effects of subpopulations on the
discriminatory potential:
In embodiments described above for example, DNA typing systems consider close
familial
relationships, but do not take into account membership in the same population.
While population
membership is'expected 'to have little effect, the invention may further
comprise genotyping a
larger set of biallelic markers to achieve higher discriminatory potential.
Alternatively, a larger
set of biallelic markers may be optimized for typing selected populations;
alternatively, the
ceiling principle may be used to study allele frequencies from individuals in
various populations
of interest, taking for any particular genotype the maximum allele frequency
found among the
populations.
The invention thus encompasses methods for genotyping comprising determining
the
identity of a nucleotide at least 13, 15, 17, 20, 25, 30, 40, 50, 66, 70, 85,
88, 100, 187, 200, or
250, 500, 700, 1000 or 2000 biallelic markers in a biological sample, wherein
at least 1, 2, 3, 4, : '
5, 10, 13, 17, 20, 25, 30, 40, 50, 70, 85, 100, 150, 200, 250 or all of said
biallelic markers are
CNS disorder-related markers selected from the group consisting of SEQ ID NOS:
1-271. .
Any markers known in the art may be used with the CNS disorder-related markers
of the
present invention in the DNA typing methods and systems described herein, for
example in
anyone of the following web sites offering collections of SNPs and information
about those
SNPs:
Tlae Genetic Annotation Initiative ~(http://c~ap.n~i.nih.~ovl, GAI/l. An NIH
run site
which contains information on candidate SNPs thought to be related to cancer
and tumorigenesis
generally.
dbSNP Polymorplaisrn Repository (http://www.ncbi.nlmnih.~ov/~). A more
comprehensive NIH-run database containing information on SNPs with broad
applicability in
biomedical research.
HUGO Mutatiofa Database haitiative
(http://ariel.ucsa",;",Plb.edu.au:80/ -cottonlmdi.html. A database meant to
provide systematic
97
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
access to information about human mutations including SNPs. This site is
maintained by the
Human Genome Organisation (HUGO).
Human SNP Database (htt~:!/www genome.wi.mit.edu/SNP/human/index.htmll.
Managed by the Whitehead Institute for Biomedical Research Genome Institute,
this site contains
information about SNPs resulting from the many Whitehead research projects on
mapping and
sequencing.
SNPs in the Huznan-Gezzorne SNP database .(http://www.ibc.wustl.edulSNPI. This
website provides access to SNPs that have been organized by chromosomes and
cytogenetic
location. The site is run by Washington University.
HGBase (http://hgb~gr.ki.se/). HGBASE is an attempt to summarize all known
sequence variations in the human genome, to facilitate research into how
genotypes affect
common diseases, drug responses, and other complex phenotypes, and is run by
the Karolinska
Institute of Sweden.
The SNP Consortium Database (http:l/snp.cshl.org/db/snp/mapl. A collection of
SNPs
and related information resulting from the collaborative effort of a number of
large
pharmaceutical and information processing companies.
GeneSNPs ~http://www.genome.utah.edu/genes~t~s/). Run by the University of
Utah, this
site contains information about SNPs resulting from the U. S. National
Institute of Environmental
Health's initiative to understand the relationship between genetic variation
and response to
environmental stimuli and xenobiotics.
In addition, biallelic markers provided in the following patents and patent
applications
may also be used with the map-related biallelic markers of the invention in
the DNA typing
methods and systems described above: US Serial No. 60/206,615, filed 24 March
2000; US
Serial No. 60!216,745, fled 30 June 2000; WIPO Serial No. PCT/IB00/00184,
filed 11 February.
2000; WIPO Serial No. PCT/IB98/01193, fled 17 July 1998; PCT Publication No.
WO
99/54500, filed 21 April 1999; and WIPO Serial No. PCT/IB00/00403, filed 24
March 2000.
Biallelic markers, sets of biallelic markers, probes, primers, and methods for
determining
the identity of a nucleotide at said biallelic markers are also encompassed
and are further
described herein, and may encompass any further limitation described in this
disclosures alone or
in any combination.
Forensic matching by microsequencing is further described in Example 6 below
Throughout this application, various publications, patents, and published
patent
applications are cited. The disclosures of the publications, patents, and
published patent
specifications referenced in this application are hereby incorporated by
reference into the present
disclosure to more fully describe the state of the art to which this invention
pertains.
98
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
EXAMPLES
Several of the methods of the present invention are described in the following
examples,
which are offered by way of illustration and not by way of limitation. Many
other modifications
and variations of the invention as herein set forth can be made without
departing from the spirit
and scope thereof and therefore only such limitations should be imposed as are
indicated by the
appended claims.
Example 1: De Novo Identification of Biallelic Markers
The biallelic markers set forth in this application were isolated from human
genomic
sequences. To identify biallelic markers, genomic fragments were amplified,
sequenced and
compared in a plurality of individuals.
DNA samples
Donors were unrelated and healthy. They represented a sufficient diversity for
being
representative of a French heterogeneous population. The DNA from 100
individuals was
extracted and tested for the de novo identification of biallelic markers.
DNA samples were prepared peripheral venous blood as follows. 30 ml of
peripheral
venous blood were taken from each donor in the presence of EDTA. Cells
(pellet) were collected
after centrifugation for 10 minutes at 2000 rpm. Red cells were lysed in a
lysis solution (50 ml
final volume: 10 mM Tris pH7.6; 5 mM MgCl2; 10 mM NaCl). The solution was
centrifuged (10
minutes, 2000 rpm) as many times as necessary to eliminate the residual red
cells present in the
supernatant, after resuspension of the pellet in the lysis solution. The
pellet of white cells was
lysed overnight at 42°C with 3.7 ml of lysis solution composed of: (a)
3 ml TE 10-2 (Tris-HCl 10
mM, EDTA 2 mM) / NaCI 0.4 M; (b) 200 ~l SDS 10%; and (c) 500 w1 proteinase K
(2 mg
proteinase K in TE 10-2 / NaCI 0.4 M).
For the extraction of proteins, 1 ml saturated NaCI (6M) (1/3.5 v/v) was
added. After
vigorous agitation, the solution was centrifuged for 20 minutes at 10000 rpm.
For the
precipitation of DNA, 2 to 3 volumes of 100% ethanol were added to the
previous supernatant,
and the solution was centrifuged for 30 minutes at 2000 rpm. The DNA solution
was rinsed
three times with 70% ethanol to eliminate salts, and centrifuged for 20
minutes at 2000 rpm. The
pellet was dried at 37°C, and resuspended in 1 ml TE 10-1 or 1 ml
water. The DNA
concentration was evaluated by measuring the optical density (OD) at 260 nm (1
unit OD = 50
p,g/ml DNA). To determine the presence of proteins in the DNA solution, the OD
260 / OD 280
ratio was determined. Only DNA preparations having a OD 260 / OD 280 ratio
between 1.8 and
2 were used in the subsequent examples described below. DNA pools were
constituted by
mixing equivalent quantities of DNA from each individual.
99
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Amplification of ~enomic DNA by PCR
Amplification of specific genomic sequences was carried out on pooled DNA
samples
obtained as described above.
Amplification Timers
The primers used for the amplification of human genomic DNA fragments were
defined
with the OSP software (Hillier & Green, 1991). Preferably, primers included,
upstream of the
specific bases targeted for amplification, a common oligonucleotide tail
useful for sequencing.
Primers PU contain the following additional PU 5' sequence :
TGTAAAACGACGGCCAGT;
primers RP contain the following RP 5' sequence : CAGGAAACAGCTATGACC..Primers
are
listed in Table 12.
Amplification
PCR assays were performed using the following protocol:
Final volume 25 ~1
DNA 2 ng/~l .
MgClz 2 mM
dNTP (each) 200 ~.M
primer (each) 2.9 ng/~.1
Ampli Taq Gold DNA polymerase 0.05 unit/pl
PCR buffer (10x = 0.1 M TrisHCl pH8.3 O.SM KCl) lx
DNA amplification was performed on a Genius II thermocycler. After heating at
94°C
for 10 min, 40 cycles were performed. Cycling times and temperatures were: 30
sec at 94°C,
55°C for 1 min and 30 sec at 72°C. Holding for 7 min at
72°C allowed final elongation. The
quantities of the amplification products obtained were determined on 96-well
microtiter plates,
using a fluorometer and Picogreen as intercalant agent (Molecular Probes).
Sequencing of amplified genomic DNA and identification of
biallelic~olymorphisms
Sequencing of the amplified DNA was carried out on ABI 377 sequencers. The
sequences of the amplification products were determined using automated
dideoxy terminator
sequencing reactions with a dye terminator cycle sequencing protocol. The
products of the
sequencing reactions were run on sequencing gels and the sequences were
determined using gel
image analysis (ABI Prism DNA Sequencing Analysis software 2.1.2 version).
The sequence data were further evaluated to detect the presence of biallelic
markers
within the amplified fragments. The polymorphism search was based on the
presence of
superimposed peaks in the electrophoresis pattern resulting from different
bases occurring at the
same position. However, the presence of two peaks can be an artifact due to
background noise.
100
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
To exclude such an artifact, the two DNA strands were sequenced and a
comparison between the
two strands was carried out. In order to be registered as a polymorphic
sequence, the
polymorphism had to be detected on both strands. Further, some biallelic
single nucleotide
polymorphisms were conftrmed by microsequencing as described below.
Biallelic markers were identified in the analyzed fragments and are shown in
Table 7.
Example 2: Genotype of Biallelic Markers
The biallelic markers identified as described above were further confirmed and
their
respective frequencies were determined through microsequencing.
Microsequencing was carried
out on individual DNA samples obtained as described herein.
Microsequencin~ primers
Amplification of genomic DNA fragments from individual DNA samples was
performed
as described in Example 1 using the same set of PCR primers (Table 12).
Microsequencing was
carried out on the amplified fragments using specifte primers. See Table 13.
The preferred .
primers used in microsequencing had about 19 nucleotides in length and
hybridized just upstream
of the considered polymorphic base.
The microsequencing reactions were performed as follows: 5 p1 of PCR products
were
added to 5 p,1 purification mix (2U SAP (Shrimp alkaline phosphate) (Amersham
E70092X)); 2U
Exonuclease I (Amersham E70073Z); and 1 p,1 SAP buffer (200 mM Tris-HCl pHB,
100 mM
MgCl2) in a microtiter plate. The reaction mixture was incubated 30 minutes at
37°C~ and
denatured 10 minutes at 94°C afterwards. To each well was then added 20
p,1 of
microsequencing reaction mixture containing: 10 pmol microsequencing
oligonucleotide
(l9mers, GENSET, crude synthesis, 5 OD), 1 U Thermosequenase (Amersham
E79000G), 1.25
p1 Thermosequenase buffer (260 mM Tris HCl pH 9.5, 65 mM MgClz), and the two
appropriate
fluorescent ddNTPs complementary to the nucleotides at the polymorphic site
corresponding to
both polymorphic bases (11.25 nM TAMRA-ddTTP ; 16.25 nM ROX-ddCTP ; 1.675 nM
REG-
ddATP ; 1.25 nM RHO-ddGTP ; Perkin Elmer, Dye Terminator Set 401095). After 4
minutes at
94°C, 20 PCR cycles of 15 sec at 55°C, 5 sec at 72°C, and
10 sec at 94°C were carried out in a
Tetrad PTC-225 thermocycler (MJ Research). The microtiter plate was
centrifuged 10 sec at
1500 rpm. The unincorporated dye terminators were removed by precipitation
with 19 ~.l MgCl2
2mM and 55 p1 100 % ethanol. After 15 minute incubation at room temperature,
the microtiter .
plate was centrifuged at 3300 rpm 15 minutes at 4°C. After discarding
the supernatants, the
microplate was evaporated to dryness under reduced pressure (Speed Vac).
Samples were
resuspended in 2.5 p1 formamide EDTA loading buffer and heated for 2 min at
95°C. 0.8 p1
microsequencing reaction were loaded on a 10 % (19:1) polyacrylamide
sequencing gel. The
101
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
data were collected by an ABI PRISM 377 DNA sequencer and processed using the
GENESCAN software (Perkin Elmer).
Frequency of biallelic markers
Frequencies are reported for the less common allele only and are shown in
Table 7.
Example 3: Association Study Between Ma'oj r Depression and the Biallelic
Markers of
Candidate Genes
Collection of DNA samples from affected and non-affected individuals
The disease trait followed in this association study was major depression, a
complex
disorder believed to involve several neurotransmitter pathways including those
utilizing
norepinephrine and serotonin. The depressed patient population consists of 140
individuals that
participated in a clinical study for the evaluation of the anti-depressant
compound Reboxetine
(Montgomery S.A. and Schatzberg A.F.; Journal Clin. Psychiatry 59(suppl 14): 3-
7, 1998).
Approximately 90% of these individuals were from a Caucasian ethnic
background. The control
population consisted of 94 individuals from a Caucasian population that had
been found not to
have any personal or family evidence of psychiatric disease.
Geno ink of affected and control individuals
The general strategy was to individually determine allele frequencies of
biallelic markers
in all individuals from each population described above. Allele frequencies of
the biallelic
markers were determined by performing microsequencing reactions on amplified
DNA
fragments obtained from genomic PCR performed on DNA samples from each
individual:
Genomic PCR and microsequencing were performed as detailed above in Examples 1
and 2
Frequency of the biallelic markers alleles and genotypes of candidate gene and
association with
maior depression
Frequencies of biallelic marker alleles were compared in the case-control
populations
described above. The data in Table 15 show the p-value obtained for each
marker typed for.each
candidate gene for individual alleles and genotypes. Nine markers from 7 of 19
candidate genes
were significant at the 5% level for allele frequency differences while seven
markers from 6 of
19 candidate genes were significant at the 5% level for genotype frequency
differences. In 4
cases, the same marker was significant at the 5% level for both allele and
genotype frequency
differences. This occurred for markers from the genes 5HTR6, 5HTR7, NET, and
Gbeta3.
These genes all participate in the mechanism of either serotonin or
norepinephrine
neurotransmission.
Haplotype frequency anal sis
102
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
The results of the haplotype analysis using combinations of 2, 3, and 4
biallelic markers
from each gene are shown in Tables 17 and 18. Haplotype analyses for the
candidate genes were
performed by estimating the frequencies of all 2, 3, and 4 marker haplotypes
in the depressed and
control populations. Haplotype estimations were performed by applying the
Expectation-
s Maximization (EM) algorithm (Excoffier and Slatkin, Mol. Biol. Evol., 12:921-
927, 1995).
Estimated haplotype frequencies in the depressed and control populations were
compared by
means of permutation tests based on individual haplotypes (Permutation test)
as well as the
distribution of frequencies from all possible haplotypes derived from a
particular combination of
given markers (Omnibus LR test).
The results of the Omnibus LR test are shown in Table 16. Listed are the top
10 marker
combinations for each category of 4, 3, and 2 marker combinations and boxed in
a double line
border are the top 5% of each category (by p-value based on phenotypic
reiteration of at least
1000 simulations). It is remarkable that several of the same genes identified
by single marker
association tests also appear in the top 5% of the Omnibus LR test. In
particular, markers from
the genes NET and Gbeta3 appear as top 5% in each category of combinations for
the Omnibus
LR test.
The, results of the Permutation test for individual haplotypes are shown in
Table 17.
Listed are the top 20 haplotypes for each category of 4, 3, and 2 marker
haplotypes and boxed in
a double line border are the top 1% of each category (by p-value based on
phenotypic reiteration
of at least 1000 simulations). Again it is remarkable that several of the same
genes identified by
single marker association tests and Omnibus LR test also contribute haplotypes
that appear in the
top 1% of the Permutation test for individual haplotypes. Of all genes, only
NET contributes to
the top percentiles of each category of testing (individual markers for allele
and genotype
frequencies, Omnibus LR 4,3 and 2 marker combinations, and Permutation test
for individual 4, .
3, and 2 marker haplotypes). However several other genes contribute to several
testing
categories including previously mentioned Gbeta3 and 5HTR7 as well as WFS1,
GRL, SHTT
and DRD3.
Two preferred haplotypes can be constructed from markers derived from the NET
gene.
One consists of markers 99-28788/300, 99-32061/304, and 99-32121/242 each
manifesting the G
allele. The GGG haplotype is present in only 1 % of depressed cases vs. 7% of
controls. While
this haplotype is low in overall frequency, the p-value by permutation test is
2 X 10-a and the p-
value for this group of markers is 2 X 10-3 by Omnibus LR test suggesting that
the result is
highly significant. A second haplotype consists of markers 16-3/199, 16-28/93,
and 16-50/196
manifesting alleles TCT respectively. The haplotype TCT is present in only 30%
of cases vs.
43% of controls. The p-value by permutation test is 9 X 10~ and the p-value
for this group of
markers is 8.9 X 10~ by Omnibus LR test, also indicating a high level of
significance.
103
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Another example of a preferred haplotype comes from markers 16-16/285, 16-
17/121,
and 16-106/364 which are derived from the gene Gbeta3. The haplotype TTC is
present in 21
of cases vs. 35% of controls. The p-value by permutation test is 1 X 10-3 and
the p-value for this
group of markers is 1 X 10~ by Omnibus LR test, indicating a high level of
significance.
Example 4: Association Study Between Major Depression and the Biallelic
Markers of
Candidate Genes
The association analysis of Example 3 was repeated using a different
population set as
described below. In general, these estimates agreed with the frequencies
observed in the first
screening within a few percent. Statistical assessments of haplotype frequency
differences
between depressed cases and controls were made by Omnibus LR tests and
individual haplotype
tests.
For Omnibus analyses, WFS 1 marker combinations showed the most significant
(p<0.01) differences between the depressed cases and controls for 2, 3, and 4
locus haplotypes.
Strongest among these associations were combinations of markers spanning the
core exonic
region of the WFS1 gene including 19-17/188, 19-19/174, and 24-243/346.
Several NET marker
combinations showed significant associations (p<0.05) including those from the
5' flanking
region and those from the exonic region. When compared to the distribution of
Omnibus p-
values observed in the 1St screening, 11 WFS1 marker combinations would have
been among the
top 5% of observed Omnibus p-values whereas 2 NET marker combinations would
have been
among the top 5%.
For individual haplotypes; haplotype GT from WFS1 markers 19-17/188 and 24-
243/346
showed an 11% difference (37% cases vs. 26% controls, p<0.001). A similar
difference was
observed for haplotype GC from WFS l markers 19-17/188 and 19-19/174 and GCT
from all
three markers (p<0.005). Several NET haplotypes showed >10% frequency
differences between
cases and controls (p<0.01). When compared to the distribution of individual
haplotype p-
values observed in the first screening, 6 WFS1 marker combinations would have
been among the
top 1% of observed individual haplotype p-values. '
Frequency of the biallelic markers alleles and enotypes of candidate ~ene.and
association with
major depression
Frequencies of biallelic marker alleles were compared in the case-control
populations
described above. The data in Table 18 show the p-value obtained for each
marker typed for each
candidate gene for individual alleles and genotypes. Nine markers from 7 of 19
candidate genes
were significant at the 5% level for allele frequency differences while seven
markers from 6 of
19 candidate genes were significant at the 5% level for genotype frequency
differences. In 4
cases, the same marker was significant at the 5% level for both allele and
genotype frequency
differences. This occurred for markers from the genes SHTR6, SHTR7, and WFS1.
104
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Haplot'~pe frequency analysis
The results of the haplotype analysis using combinations of 2, 3, and 4
biallelic markers
from each gene are shown in Tables 19 and 20. Haplotype analyses for the
candidate genes were
performed by estimating the frequencies of all 2, 3, and 4 marker haplotypes
in the depressed and
control populations. Haplotype estimations were performed by applying the
Expectation-
Maximization (EM) algorithm (Excoffier and Slatkin, Mol. Biol. Evol., 12:921-
927, 1995).
Estimated haplotype frequencies in the depressed and control populations were
compared by
means of permutation tests based on individual haplotypes (Permutation test)
as well as the
distribution of frequencies from all possible haplotypes derived from a
particular combination of
given markers (Omnibus LR test).
The results of the Omnibus LR test are shown in Table 19. Listed are the top
10 marker
combinations for each category of 4, 3, and 2 marker combinations and boxed in
a double line
border are the top 5% of each category (by p-value based on phenotypic
reiteration of at least
1000 simulations). It is remarkable that several of the same genes identified
by single marker
association tests also appear in the top 5% of the Omnibus LR test. In
particular, markers from
the gene WFS 1 appears as top 5% in each category of combinations for the
Omnibus LR test.
The results of the Permutation test for individual haplotypes are shown in
Table 20.
Listed are the top 20 haplotypes for each category of 4, 3, and 2 marker
haplotypes and boxed in
a double line border are the top 1% of each category (by p-value based on
phenotypic reiteration
of at least 1000 simulations). Again it is remarkable that several of the same
genes identified by
single marker association tests and Omnibus LR test also contribute haplotypes
that appear in the
top 1 % of the Permutation test for individual haplotypes. Of all genes, WFS 1
contributes to the
top percentiles of nearly all categories of testing (individual markers for
allele and genotype
frequencies, Omnibus LR 4,3 and 2 marker combinations, and Permutation test
for individual 3
and 2 marker haplotypes). However several other genes contribute to several
testing categories
including previously mentioned SHTR7 as well as NET, GRL, SHTT and DRD3.
A preferred haplotype can be constructed from markers derived from the WFS 1
gene.
This consists of markers 19-17/188, 19-19/174, and 24-243/176 manifesting
alleles GCT
.respectively. The GCT haplotype is present in 34% of depressed cases vs. 24%
of controls.
While this haplotype is low in overall frequency, the p-value by permutation
test is 3 X 10-3 and
the p-value for this group of markers is 1 X 10-3 by Omnibus LR test
suggesting that the result is
highly significant.
Example 5: Response to Reboxetine in Depressed Patients
Single point analyses were also performed on data from the candidate genes to
determine
Reboxetine response among depressed patients as compared to controls. Two
markers from NET
105
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
(99-32061/304 and 99-32121/242) showed allelic and genotypic association
(p<0.05). A single
marker from Gbeta3 (18-355/67) showed allelic association with drug response
(p=0.05).
Multipoint analyses on the data revealed Omnibus LR-based associations to be
minimal
for these genes with only two marker combinations from NET achieving a level
of significance
of p<0.05. At the individual haplotype level, a number of NET haplotypes
achieved this level of
significance with 10-15% responder/non-responder differences in haplotype
frequencies. Also of
note is the observation that a few individual haplotypes from Gbeta3 showed a
remarkable level
of significance (p<0.0005) corresponding to a nearly infinite relative risk
(15-20% in non-
responders vs. 0% in responders). This difference in estimated haplotype
frequency is based
largely on the observation that one particular haplotype cannot be
unambiguously detected in the
204 responder haplotypes although there are at least 9 copies in 182 non-
responder haplotypes.
In conclusion, modest association is present between NET and drug response. In
addition, select individual haplotypes from Gbeta3 show a strong statistical
association with drug
response.
Example 6: Forensic Matching by Microsequencin
DNA samples are isolated from forensic specimens of, for example, hair, semen,
blood
or skin cells by conventional methods. A panel of PCR primers based on a
number of the
sequences of SEQ ID NOS: 1 to 542 is then utilized according to the methods
described herein to '
amplify DNA of approximately 500 bases in length from the forensic specimen.
The alleles
present at each of the selected biallelic markers site according to biallelic
markers SEQ ID NOS:
1 to 542 are then identified according Example 2. A simple database comparison
of the analysis
results determines the differences, if any, between the sequences from a
subject individual or
from a database and those from the forensic sample. In a preferred method,
statistically
significant differences between the suspect's DNA sequences and those from the
sample
conclusively prove a lack of identity. This lack of identity can be proven,
for example, with only
one sequence. Identity, on the other hand, should be demonstrated with a large
number of
sequences, all matching. Preferably, a minimum of 13, 17, 20, 25, 30, 40, 50,
66, 70, 85, 88,
100, 187, 200 or 250 biallelic markers are used to test identity between the
suspect and the
sample.
In accordance with the regulations relating to Sequence Listings, the
following codes
have been used in the Sequence Listing to indicate the locations of biallelic
markers within the
sequences and to identify each of the alleles present at the polymorphic base.
The code "r" in the
sequences indicates that one allele of the polymorphic base is a guanine,
while the other allele is
an adenine. The code "y" in the sequences indicates that one allele of the
polymorphic base is a
thymine, while the other allele is a cytosine. The code "m" in the sequences
indicates that one
106
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
allele of the polymorphic base is an adenine, while the other allele is an
cytosine. The code "k" in
the sequences indicates that one allele of the polymorphic base is a guanine,
while the other allele
is a thymine. The code "s" in the sequences indicates that one allele of the
polymorphic base is a
guanine, while the other allele is a cytosine. The code "w" in the sequences
indicates that one
allele of the polymorphic base is an adenine, while the other allele is an
thymine.
107
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7A
GENE BIALLELIC SEQ BIALLELIC VALIDATIONGENOTYPING
MARKER ID MARKER MICRO- LEAST
ID NO. POSITION SEQUENCINGCOMMON
IN ALLELE
SEQ ID NO. FREQUENCY
5HTR6 99-27199-2071 207 Y T 0.30
5HTR6 99-27207-1172 117 Y C 0.37
5HTR6 99-27213-533 53 Y
5HTR6 99-27218-3334 333 Y
5HTR6 99-28108-2335 233 Y
5HTR6 99-28109-2756 275 N
5HTR6 99-28110-757 74 Y T 0.48
5HTR6 99-28125-818 81 Y
5HTR6 99-28134-2159 215 Y T 0.37
5HTR6 99-28137-9610 96 Y
5HTR6 99-32204-30511 305 N
5HTR7 99-28149-11812 118 Y C 0.31
5HTR7 _ 13 285 Y G 0.49
99-28160-285
5HTR7 99-28171-45814 457 Y A 0.38
5HTR7 99-28173-39515 395 Y
5HTR7 99-32177-11316 113 Y
5HTR7 99-32181-19217 192 Y C 0.38
5HTR7 99-32193-25818 257 Y T 0.65
CHRNA7 99-28722-9019 90 Y C 0.32
CHRNA7 99-28730-35120 351 Y A 0.38
CHRNA7 99-32306-40921 407 Y G 0.33
CRFR1 99-27088-24622 246 Y A 0.38
CRFR1 99-27090-20323 204 Y G 0.22
CRFR1 99-27091-22024 221 Y A 0.49
CRFR1 99-27093-14525 145 N
CRFR1 99-27094-40626 406 Y T 0.21
CRFR1 99-27096-41027 410 N
CRFR1 99-27097-8328 83 Y T 0.47
CRFR1 99-27098-16229 162 N
CRFR1 99-27550-4830 48 Y A 0.26
CRFR1 99-27558-33531 335 Y
CRFR1 .99-27561-10632 106 Y
CRFR1 99-27562-36633 364 N
MLR 16-31-738 34 738 Y G 0.47
MLR 99-27110-30135 300 Y
MLR 99-27563-40036 400 Y A 0.44
MLR _ 37 443 Y
99-27573-443
MLR 99-28732-13338 133 Y A 0.31
MLR 99-28735-5639 56 Y T 0.30
MLR 99-28736-39940 399 Y
MLR 99-28738-31941 319 Y C 0.37
MLR 99-28739-36442 364 Y
CRFR2 99-27875-18543 185 Y C 0.40
CRFR2 99-27880-17644 176 Y T 0.44
CRFR2 99-28747-37145 373 Y C 0.44
CRFR2 99-28753-35346 352 Y C 0.39
CRFR2 99-28755-20647 207 Y G 0.41
CRFR2 99-32333-36648 366 N C
GRL 16-38-323 49 323 Y A 0.33
GRL 99-28484-17950 179 Y A 0.40
108
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7A (cont)
GRL 99-30853-36451 364 Y G 0.42
GRL 99-28485-19852 198 Y G 0.20
GRL 99-30858-35453 354 Y T 0.16
GRL 99-32002-31354 311 Y A 0.48
GRL 18-15-366 55 366 Y
GRL 18-20-174 56 174 Y G 0.27
GRL 18-31-178 57 178 Y C 0.35
GRL 18-38-395 58 395 Y T 0.37
MAOA 18-2-192 59 192 Y T 0.32.
MAOB 99-26921-21060 211 Y G 0.48
MAOA 16-215-80 61 250 Y T 0.33
'
MAOA-B 18-132-36862 368 Y C 0.34
MAOA 18-133-29363 292 Y A 0.27
5HTR2c 18-12-191 64 191 Y A 0.14
5HTR2c 18-11-137 65 138 Y G 0.27
5HTR2c 18-93-96 66 96 Y
TH 16-115-34367 343 Y C 0.24
TH 16-42-140 68 140 Y G 0.30
TH 18-251-17669 176 Y T 0.43
TH 18-269-44 70 44 Y A 0.38
CRF 16-218-62471 624 N
CRF 18-393-33072 330 Y
CRF 18-394-40273 402 Y
DRD4 16-217-55 74 55 Y
DRD4 18-284-13975 139 Y
DRD4 18-285-30576 305 Y
DRD4 18-289-23977 239 Y
DRD4 18-291-91 78 91 Y
5HTT 18-186-39179 391 Y T 0.47
5HTT 18-194-13080 130 Y T 0.48
'
5HTT 18-198-25281 252 Y A 0.49.
5HTT 18-242-30082 299 Y G 0.46.
DRD3 8-15-126 83 1501 Y G ~ 0.30
'
DRD3 8-'19-372 84 1501 Y A 0.28
"'
DRD3 99-2409-29885 428 Y A 0.40
DRD3 99-339-54 86 1501 Y G 0.46
.
CYP3A4-712-254-18087 311 Y G 0.46
.'
CYP3A4-710-214-27988 1501 Y C 0.12
CYP3A4-710-217-91 89 1501 Y T 0.07
';
NET 99-28779-16890 168 Y
N ET 99-28788-30091 300 Y A . 0.47
'
NET 99-32052-26292 263 Y
N ET 99-32121-24293 244 Y G 0.48
NET 99-320 94 169 N
59-169
NET _ 95 304 Y A 0.39.
99-32061-304
N ET 99-32065-30396 303 Y
NET 99-32123-11897 118 Y
N ET 99-32148-398 314 Y
1 5
N ET 16-2-76 99 95 Y A 0.27
'
NET 16-28-93 100 120 Y C 0.44
NET 16-3-199 101 342 Y C 0.32
N ET 16-50-197 102 197 Y C 0.21,
N ET 16-1-59 103 181 Y
NET 16-2-187 104 206 Y
'TACR1 99-28761-311105 311 Y A 0.22
109
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7A (cont)
TACR1 99-28771-86106 86 Y T 0.48
TACR1 99-28791-291107 291 Y A 0.26
TACR1 99-32077-66108 66 Y
TACR1 99-32078-466109 467 Y
TACR1 99-32376-426110 426 Y
TACR1 99-32361-419111 420 Y T 0.48
DRD2 16-21-228 112 228 Y A 0.16
DRD2 16-22-156 113 156 Y C 0.45
DRD2 16-23-404 114 404 Y G 0.47
DRD2 16-24-175 115 175 Y A 0.16
DRD2 16-25-286 116 286 Y T 0.37
DRD2 16-25-279 117 279 Y
DRD2 16-23-393 118 393 Y
Gbeta3 16-106-364119 364 Y T 0.01,
Gbeta3 16-16-285 120 285 Y T 0.38
Gbeta3 16-17-121 121 121 Y T _0.36
Gbeta3 16-84-185 122 185 Y C 0.40
Gbeta3 16-87-74 123 74 Y A 0.34
Gbeta3 16-91-333 124 333 Y A 0.43
WFS1 16-128-142125 142 Y C 0.27
W FS 16-133-205126 245 Y G 0.34
1
WFS1 16-135-181127 232 Y A 0.28
W FS 16-145-405128 455 Y C 0.11
1
W FS 16-177-320129 320 Y A 0.07
1
W FS 16-4-354 130 354 Y C 0.36
1
TABLE 7B
GENE BIALLELIC SEQ ID BIALLELIC VALIDATIONGENOTYPING
. MARKER NO. MARKER MICRO- LEAST
ID POSITION SEQUENCINGCOMMON
IN ALLELE
SEQ ID FREQUENCY
NO.
5HTR6 99-27199-207131 24 Y T ' .' 0.30
5HTR6 99-27207-117132 24 Y C 0.37.
5HTR6 99-27213-53133 24 Y
5HTR6 99-27218-333134 24 Y
5HTR6 99-28108-233135 24 Y
5HTR6 99-28109-275136 24 N
5HTR6 99-28110-75137 24 Y T 0.48
5HTR6' 99-28125-81138 24 Y
5HTR6 99-28134-215139 24 Y T 0.37
5HTR6 99-28137-96140 24 Y
5HTR6 99-32204-305141 24 N
5HTR7 99-28149-118142 24 Y C ~ 0.31
5HTR7 99-28160-285143 24 Y G 0.49
5HTR7 99-28171-458144 24 Y A 0.38
.
5HTR7 99-28173-395145 24 Y
5HTR7 99-32177-113146 24 Y
5HTR7 99-32181-192147 24 Y C 0.38
5HTR7 99-32193-258148 24 Y T 0.65
CHRNA7 99-28722-90149 24 Y C 0.32
CHRNA7 99-28730-351150 24 Y A 0.38
CHRNA7 99-32306-409151 24 Y G 0.33
CRFR1 99-27088-246152 24 Y A~ 0.38
CRFR1 99-27090-203~ 153 24 - Y G ~ 0.22
110
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7B (cont)
CRFR1 99-27091-220154 24 Y A 0.49
CRFR1 99-27093-145155 24 N
CRFR1 99-27094-406156 24 Y T 0.21
CRFR1 99-27096-410157 24 N
CRFR1 99-27097-83158 24 Y T 0.47
CRFR1 99-27098-162159 24 N
CRFR1 99-27550-48160 24 Y A 0.26
CRFR1 99-27558-335161 24 Y
CRFR1 99-27561-106162 24 Y
CRFR1 99-27562-366163 24 N
MLR 16-31-738 164 24 Y G 0.47
MLR 99-27110-301165 24 Y
MLR 99-27563-400166 24 Y A 0.44
MLR 99-27573-443167 24 Y
MLR 99-28732-133168 24 Y A 0.31
MLR 99-28735-56169 24 Y T 0.30
MLR ~ 99-28736-399170 24 Y
MLR 99-28738-319171 24 Y C 0.37
MLR ' 99-28739-364172 24 Y
CRFR2 99-27875-185173 24 Y C ' 0.40
CRFR2 99-27880-176174 24 Y T _
0.44
CRFR2 99-28747-371175 24 Y C ~ ' 0.44
CRFR2 99-28753-353176 24 Y C _
0.39
CRFR2 99-28755-206177 24 Y G 0.41
CRFR2 99-32333-366178 24 N C
G RL 16-38-323 179 24 Y A 0.33
GRL 99-28484-179180 24 Y A 0.40
GRL 99-30853-364181 24 Y G 0.42
GRL 99-28485-19. 182 24 Y G 0.20
8
GRL _ 183 24 Y T 0.16
99-30858-354
GRL _ 184 24 Y A 0.48
99-32002-313
GRL 18-15-366 185 24 Y
GRL 18-20-174 186 24 Y G , ' 0.27
GRL 18-31-178 187 24 Y C 0.35
GRL 18-38-395 188 24 Y T 0.37
MAOA 18-2-192 189 24 Y T 0.32
MAOB 99-26921-210190 24 Y G 0.48
MAOA 16-215-80 191 24 Y T ' 0.33
MAOA-B 18-132-368192 24 Y C 0.34
MAOA 18-133-293193 24 Y A . ' 0.27
5HTR2c 18-12-191 194 24 Y A 0.14
5HTR2c 18-11-137 195 24 Y G 0.27
_
5HTR2c 18-93-96 196 24 Y
,
TH 16-115-343197 24 Y C ' 0.24
~
TH 16-42-140 198 24 Y G 0.30
TH 18-251-176199 24 Y T 0.43
TH 18-269-44 200 24 Y A 0.38
CRF 16-218-624201 24 N
CRF 18-393-330202 24 Y
CRF 18-394-402203 24 Y
DRD4 16-217-55 204 24 Y
DRD4 18-284-139205 24 Y
DRD4 18-285-305206 24 Y
DRD4 18-289-239207 24 Y
DRD4 18-291-91 208 24 Y ~~
111
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7B (cont)
5HTT 18-186-391 209 24 Y T 0.47
5HTT 18-194-130 210 24 Y T 0.48
5HTT 18-198-252 211 24 Y A 0.49
5HTT 18-242-300 212 24 Y G 0.46
DRD3 8-15-126 213 24 Y G 0.30
DRD3 8-19-372 214 24 Y A 0.28
DRD3 99-2409-298215 24 Y A 0.40
DRD3 99-339-54 216 24 Y G 0.46
CYP3A4-712-254-180 217 24 Y G 0.46
CYP3A4-710-214-279 218 24 Y C 0.12
CYP3A4-710-217-91 219 24 Y T 0.07
N ET 99-28779-168220 24 Y
NET 99-28788-300221 24 Y A 0.47
NET 99-32052-262222 24 Y
N ET 99-32121-242223 24 Y G ~ 0.48
NET 99-32059-169224 24 N
NET 99-32061-304225 24 Y A . 0.39
N ET 99-32065-303226 24 Y
N ET 99-32123-11_8227 24 Y
N ET 99-32148-315228 24 Y
N ET 16-2-76 229 24 Y A ' 0.27
NET 16-28-93 230 24 Y C 0.44
NET 16-3-199 231 24 Y C 0.32
NET 16-50-197 232 24 Y C 0.21
N ET 16-1-59 233 24 Y
NET 16-2-187 234 24 Y
TACR1 99-28761-311235 24 Y A 0.22
TACR1 99-28771-86236 24 Y T 0.48
TACR1 99-28791-291237 24 Y A 0.26
TACR1 99-32077-66238 24 Y
TACR1 99-32078-466239 24 Y
TACR1 99-32376-426240 24 Y
TACR1 99-32361-419241 24 Y T 0.48
DRD2 16-21-228 242 24 Y A 0.16
DRD2 16-22-156 243 24 Y C . 0.45
. DRD2 16-23-404 244 24 Y G ' 0.47
'
DRD2 16-24-175 245 24 Y A ;.' 0.16
DRD2 16-25-286 246 24 Y T 0.37
DRD2 16-25-279 247 24 Y .. ,
DRD2 16-23-393 248 24 Y
Gbeta3 16-106-364 249 24 Y T 0.01
Gbeta3 16-16-285 250 24 Y T 0.38
Gbeta3 16-17-121 251 24 Y T 0.36
Gbeta3 16-84-185 252 24 Y C 0.40
Gbeta3 16-87-74 253 24 Y A ' 0.3
4
Gbeta3 16-91-333 254 24 Y A _
0.43
WFS1 16-128-142 255 24 Y C ' 0.27
WFS1 16-133-205 256 24 Y G ' 0.34
WFS1 16-135-181 257 24 Y A ~ 0.28
WFS1 16-145-405 258 24 Y C ~ ' 0.11
WFS1 16-177-320 259 24 Y A 0.07
WFS1 16-4-354 260 24 Y C 0.36
112
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7C
GENE BIALLELIC SEQ ID BIALLELIC VALIDATIONGENOTYPING
MARKER NO. MARKER MICRO- LEAST
ID POSITION SEQUENCINGCOMMON
IN ALLELE
SEQ ID FREQUENCY
NO.
MAO A/B 18-473-362261 362 Y C 0.43
MAO A/B 99-12361-88262 88 Y C 0.36
MAO A/B 99-12368-335263 335 Y C 0.36
MAO A/B 99-12370-67264 67 Y A 0.29
N ET 99-32148-315265 314 Y C 0.27
N ET 19-46-322 266 322 Y C 0.31
NET 19-47-315 267 315 Y T 0.14
N ET 19-51-347 268 346 Y
NET 99-32052-262269 263 Y T 0.38
CYP3A4/710-213-292270 1501 Y G 0.11
5HTT 18-419-135271 135 Y
5HTT 18-424-419272 41 Y
9
5HTT 18-429 273 _ Y
-289 290
5HTT _ 274 256 Y C 0.48
18-246-256
Gbeta3 18-355-67 275 68 Y C 0.49
Gbeta3 18-353-267276 266 Y T 0.27
Gbeta3 18-338-305277 306 Y G 0.3
WFS1 24-243-346278 1501 Y T 0.3
W FS1 99-62531-351279 1501 Y T 0.36
WFS1 99-54279-152280 1501 Y G 0.44
DRD2 _ 281 245 Y A 0.45
18-168-245
DRD2 __ 282 291 Y C ~ 0.37
18-171
-291
DRD2 _ 283 346 Y T 0.45
18-172-346
DRD2 18-177-406284 406. Y T 0.37
HM74 18-298-338285 338 Y G 0.49
HM74 18-298-110286 110 Y
HM74 _ 287 104 Y
18-299-105
HM74 18-884-30 288 _ Y C 0.26
31
HM74 18-299-343289 342 Y
HM74 99-61513-139290 140 Y A 0.26
HM74 99-6151 291 179 Y G 0.27
4-179
HM74 _ 292 _ Y C 0.33
99-61516-323 323
CRHBP 18-204-70 293 70 Y C 0.20
CRHBP 18-207-441294 442 Y C 0.41
CRHBP 18-210-65 295 65 Y
CRHBP 18-212-200296 200 Y T 0.31.
CRHBP 18-229-334297 334 Y T ~ 0.33
CRHBP 18-230-332298 332 Y T ~ 0.32
AVPR1A 18-966-378299 378 Y C 0.41
AVPR1A 18-987-308300 307 Y A 0.35
AVPR1A 18-1169-118301 118 Y
AVPR1A 18-1172-138302 138 Y G 0.16
AVPR1A 18-1173-92303 92 Y T 0.32
AVPR1A 18-1174-387304 387 Y C ~ 0.21
_ ____
AVPR1 18-1175-416305 416 Y G 0.21
A
AVPR1A 18-542-146306 146 Y G 0.21
5HT1 8-42-211 307 1501 Y G 0.46
A
5HT1A 8-45-389 308 1501 Y G 0.01
5HT1A 18-994-270309 270 Y C 0.25
5HT1A 18-912-165310 165 Y T 0.46
5HT1A 18-991-124311 124 Y T 0.45
113
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7C (cont)
5HT1A 18-920-219312 219 Y
5HT1A 18-911-312313 312 Y
5HT1A 99-65963-368314' 368 Y
5HT1 99-65966-225315 225 Y
A
5HT1A 99-65968-75316 75 Y
5HT1A 99-5069-331317 1501 Y
5HT1 99-5070-176318 175 Y T 0.02
A
GABRG2 18-511-348319 348 Y
GABRG2 18-523-352320 352 Y C 0.49
GABRG2 18-545-478321 480 Y G 0.45
GABRG2 18-522-194322 194 Y G 0.32
GABRG2 18-524-284323 284 Y C 0.36
ADRB1 18-626-52 324 52 Y G 0.36
R
ADRB1 18-629-189325 189 Y T 0.40
R
ADRB1 18-1131-71326 71 Y T 0.41
R
ADRB1 18-534-126327 126 Y
R
ADRB1 18-596-59 328 59 Y
R -
ADRB1 18-597-27 329 27 Y A 0.20
R
GABRA5 18-730-203330 203 Y G 0.48
GABRA5 18-734-89 331 89 Y C 0.48
GABRA5 18-895-321332 321 Y A 0.27
GABRA5 18-896-69 333 69 Y
GABRA5 18-903-58 334 58 Y
GOLF 18-590-216335 216 . Y G 0.42
GOLF 18-817-436336 433 Y T " 0.41
GOLF 18-829-85 337 85 Y G 0.39
GOLF 18-832-387338 387 Y
GOLF 18-833-259339 259 Y
GOLF 18-839-271340 271 Y C 0.40
GOLF 18-770-194_ 194 Y T 0.37
341
GOLF 18-771-302342 302 Y G 0.30
GOLF 18-827-53 343 53 Y G 0.34
GOLF 18-768-318344 318 Y G 0.31
GOLF 18-769-26 345 26 Y A ~ 0:17
SLC6A3 18-709-321346 320 Y C 0.46
SLC6A3 18-714-280347 281 Y T 0.17
SLC6A3 18-843-271348 271 Y C 0.37
SLC6A3 18-850-265349 265 Y T 0.34.
SLC6A3 18-853-296350 296 Y T 0.23
SLC6A3 18-867-331351 332 Y C 0.48
SLC6A3 18-877-73 352 73 Y
SLC6A3 18-856-85 353 85 Y C 0.42
SLC6A3 18-861-101354 101 Y T 0.33
PDE4b 18-635-323355 323 Y
PDE4b 18-636-205356 205 Y A 0.36
PDE4b 18-649-427357 427 Y C 0.46
PDE4b 18-1134-316358 316 Y G 0.38
PDE4b 18-633-316359 316 Y
COMT 18-489-425360 425 Y
COMT 18-492-212361 212 Y C 0.41
COMT 18-488-156362 156 Y T 0.45
COMT 18-491-266363 266 Y T 0.42
COMT 18-497-141364 141 Y T 0.43
COMT 18-503-174365 174 Y C 0.31
COMT 18-490-95 366 - 95 Y A 0.31
~
114
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7C (cont)
NPY1 R 18-699-115367 114 Y
NPY1 R 18-1099-293368 293 Y
NPY1 R 18-1105-22369 22 Y
SLC1 18-562-418370 418 Y C 0.49
SLC1 18-564-204_ 204 Y C 0.50
_
371
SEF2-1 18-1032-262372 261 Y C 0.33
B
SEF2-1 18-1035-412373 412 Y C 0.50
B
SEF2-1 18-1036-293374 293 Y C 0.34
B
SEF2-1 18-1038-95375 95 Y T 0.34
B
SEF2-1 18-1040-361376 361 Y G 0.44
B
SEF2-1 18-748-356377 356 Y T 0.47
B .
BDNF 18-937-181378 179 Y A 0.26
BDNF 18-942-175379 175 Y T 0.29
BDNF 18-1213-221380 221 Y
BDNF 18-937-147381 145 Y '
BDNF 18-946-408382 407 Y C 0.20
GAP43 18-787-133383 133 Y A 0.39 .
GAP43 18-1149-239384 239 Y A 0.49
GAP43 18-1159-291385 291 Y 6 0.23
GAP43 18-1135-273386 273 Y T 0.43
GAP43 18-1136-108387 108 Y
GAP43 18-1147-68388 68 Y
GAP43 18-1157-295389 295 Y
GAP43 18-802-460390 459 Y A 0.32
CLOCK 18-1064-110391 109 Y C 0.36
CLOCK 18-1068-327392 327 Y T 0.32
CLOCK 18-1069-365393 365 Y A ' 0.23
CLOCK 18-1073-367394 367 Y A 0.35
CLOCK 18-1070-272395 272 Y T 0.36
CLOCK 18-1057-35396 35 Y
CLOCK 18-1062-415397 415 Y
CLOCK 18-1082-165398 165 Y
CLOCK 18-1080-361399 363 Y C 0.18
HSP70 18-506-297400 297 Y ~
'
HSP70 18-570-38 401 38 ~ ~ ~ ~
~
TABLE 7D
GENE BIALLELIC SEQ ID BIALLELIC VALIDATIONGENOTYPING ;
MARKER NO. MARKER MICRO- LEAST '
ID POSITION SEQUENCINGi
IN COMMON ,
SEQ ID ALLELE
NO. FREQUENCY
MAO A/B 18-473-362402 24 Y C 0.43
MAO A/B 99-12361-88403 24 Y C 0.36
MAO A/B 99-12368-335404 24 Y C 0.36
MAO A/B 99-12370-67405 24 Y A 0.29
N ET 99-32148-315406 24 Y C 0.27
N ET 19-46-322 407 24 Y C ' 0.31
N ET 19-47-315 408 24 Y T 0.14
N ET 19-51-347 409 24 Y
NET 99-32052-262410 24 Y T 0.38
CYP3A4/710-213-292411 24 Y G 0.11
5HTT 18-419-135412 24 Y
5HTT 18-424-419413 24 Y
5HTT 18-429-289414 24 Y
5HTT 18-246-256415 24 Y C 0.48
115
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7D (cont)
Gbeta3 18-355-67 416 24 Y C 0.49
Gbeta3 18-353-267417 24 Y T 0.27
Gbeta3 18-338-305418 24 Y G 0.3
WFS1 24-243-346419 24 Y T 0.3
W FS 99-62531-351420 24 Y T 0.36
1
W FS 99-54279-152421 24 Y G 0.44
1
DRD2 18-168-245422 24 Y A 0.45
DRD2 18-171-291423 24 Y C 0.37
DRD2 18-172-346424 24 Y T 0.45
DRD2 18-177-406425 24 Y T 0.37
HM74 18-298-338426 24 Y G 0.49
HM74 18-298-110427 24 Y
HM74 18-299-105428 24 Y
HM74 18-884-30 429 24 Y C 0.26
HM74 18-299-343430 24 Y
HM74 99-61513-139431 24 Y A 0.26
HM74 99-61514-179432 24 Y G 0.27
HM74 99-61516-323433 24 Y C 0.33
CRHBP 18-204-70 434 24 Y C 0.20
CRHBP 18-207-441435 24 Y C 0.41
CRHBP 18-210-65 436 24 Y
CRHBP 18-212-200437 24 Y T 0.31
CRHBP 18-229-334438 24 Y T 0.33
CRHBP 18-230-332439 24 Y T 0.32
AVPR1A _ 440 24 Y C 0.41
18-966-378
AVPR1A 18-987-308441 24 Y A 0.35
AVPR1A 18-1169-118442 24 Y
AVPR1A 18-1172-138443 24 Y G ' 0.16
-
AVPR1A 18-1173-92444 24 Y T 0.32
AVPR1A 18-1174-387445 24 Y C 0.21
AVPR1A 18-1175-416446 24 Y G 0.21
AVPR1A 18-542-146447 24 Y G 0.21
HT 8-42-211 448 24 Y G 0.46
1 A
5HT1A 8-45-389 449 24 Y G ' 0.01
5HT1A 18-994-270450 24 Y C 0.25
5HT1A 18-912-165451 24 Y T 0.46
5HT1A 18-991-124452 24 Y T 0.45
5HT1A 18-920-219453 24 Y
5HT1A 18-911-312454 24 Y
5HT1A _ 455 24 Y
99-65963-368
5HT1 99-65966-225456 24 Y
A
5HT1A 99-65968-75457 24 Y
5HT1A 99-5069-331458 24 ' Y
5HT1A 99-5070-176459 24 Y T 0.02
GABRG2 18-51 460 24 Y
1-348
GABRG2 _ 461 24 Y C 0.49
18-523-352_
GABRG2 18-545-478462 24 Y G 0.45
GABRG2 18-52 463 24 Y G 0.32
2-194
GABRG2 _ 464 24 Y C 0.36
18-524-284
ADRB1R 18-626-52 465 24 Y G 0.36
ADRB1 18-629-189466 24 Y T 0.40
R
ADRB1 18-1131-71467 24 Y T 0.41
R .
ADRB1 18-534-126468 24 Y
R
ADRB1 18-596-59 469 24 Y
R
ADRB1 18-597-27 470 24 Y A 0.20
R
116
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7D (cont)
GABRA5 18-730-203471 24 Y G 0.48
GABRA5 18-734-89 472 24 Y C 0.48
GABRA5 18-895-321473 24 Y A 0.27
GABRA5 18-896-69 474 24 Y
GABRA5 18-903-58 4 24 Y
75
GOLF 18-590-216_ 24 Y G 0.42
_
476
GOLF 18-817-436477 24 Y T 0.41
GOLF 18-829-85 478 24 Y G 0.39
GOLF 18-832-387479 24 Y
GOLF 18-833-259480 24 Y
GOLF 18-839-271481 24 Y C 0.40.
GOLF 18-770-194482 24 Y T 0.37
GOLF 18-771-302483 24 Y G 0.30
GOLF 18-827-53 484 24 Y G 0.34
GOLF 18-768-318485 24 Y G 0.31
GOLF 18-769-26 486 24 Y A 0.17
SLC6A3 18-709-321487 24 Y C 0.46
SLC6A3 18-714-280488 24 Y T 0.17.
SLC6A3 18-843-271489 24 Y C 0.37
SLC6A3 18-850-265490 24 Y T 0.34
SLC6A3 18-853-296491 24 Y T 0.23
SLC6A3 18-867-331492 24 Y C 0.48
SLC6A3 18-877-73 493 24 Y
SLC6A3 18-856-85 494 24 Y C 0.42
SLC6A3 18-861-101495 24 Y T 0.33
PDE4b 18-635-323496 24 Y
PDE4b 18-636-205497 24 Y A 0.36
PDE4b 18-649-427498 24 Y C 0.46
PDE4b 18-1134-316499 24 Y G 0.38
PDE4b 18-633-316500 24 Y
COMT 18-489-425501 24 Y
COMT 18-492-212502 24 Y C 0.41
COMT 18-488-156503 24 Y T 0.45
COMT 18-491-26650 24 Y T 0.42
4
COMT 18-497-141_ 24 Y T 0.43
505
COMT 18-503-174506 24 Y C 0.31
COMT 18-490-95 507 24 Y A 0.31 ,
~
NPY1 R 18-699-115508 24 Y .
NPY1 R 18-1099-293509 24 Y
NPY1 R 18-1105-22510 24 Y
SLC1 18-562-418511 24 Y C ' 0.49
SLC1 18-564-204512 24 Y C 0.496
SEF2-1 18-1032-262513 24 Y C 0.33
B
SEF2-1 18-1035-412514 24 Y C 0.50
B
SEF2-1 18-1036-293515 24 Y C 0.34
B .
SEF2-1 18-1038-95516 24 Y T 0.34
B
SEF2-1 18-1040-361517 24 Y G 0.44
B
SEF2-1 18-748-356518 24 Y T 0.47
B
BDNF 18-937-181519 24 Y A 0.26
BDNF 18-942-175520 24 Y T 0.29
BDNF 18-1213-221521 24 Y
BDNF 18-937-147522 24 Y
BDNF 18-946-408523 24 Y C 0.20
GAP43 18-787-133524 24 Y A 0.39
GAP43 18-1149-239525 24 Y A 0.49
117
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 7D (cont)
GAP43 18-1159-291526 24 Y G 0.23
GAP43 18-1135-273527 24 Y T 0.43
GAP43 18-1136-108528 24 Y
GAP43 18-1147-68529 24 Y
GAP43 18-1157-295530 24 Y
GAP43 18-802-460531 24 Y A 0.32
CLOCK 18-1064-110532 24 Y C 0.36
CLOCK 18-1068-327533 24 Y T 0.32
CLOCK 18-1069-365534 24 Y A 0.23
CLOCK 18-1073-367535 24 Y A 0.35
CLOCK 18-1070-272536 24 Y T 0.36
CLOCK 18-1057-35537 24 Y
CLOCK 18-1062-415538 24 Y
CLOCK 18-1082-165539 24 Y
CLOCK 18-1080-361540 24 Y C 0.18
HSP70 18-506-297541 24 Y
HSP70 18-570-38 542 24 Y
118
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 8
SEQ BIALLELIC 1ST 2ND - POSITION RANGE OF PREFERRED
ID MARKER ALLELE ALLELE SEQUENCE
NO. ID
12 99-28149-118C T [1-478]
13 99-28160-285A G [1-456]
14 99-28171-458A G [1-48],[141-514]
15 99-28173-395C T [1-550]
16 99-32177-113C T [1-466]
17 99-32181-192C T [1-449]
18 99-32193-258G T [1-458]
20 99-28730-351A G [1-452]
21 99-32306-409G C [1-455]
28 99-27097-83C T [1-273]
29 99-27098-162C T [226-421 ]
32 99-27561-106A G [1-465]
33 99-27562-366G T [1-470]
35 99-27110-301G C [1-455]
37 99-27573-443G T [1-513]
38 99-28732-133A G [1-411]
40 99-28736-399C T [1-453]
41 99-28738-319C T [1 _458]
42 99-28739-364C - T - [1 _509]
62 18-132-368C T [1-480]
64 18-12-191 A C [1-450]
65 18-11-137 A G [1-157],[348-390]
66 18-93-96 G T [1-454]
69 18-251-176C T [104-494]
72 18-393-330G C [1-93],[146-479]
73 18-394-402A C [1-21],[119-518]
75 18-284-139C T [146-450] ;
76 18-285-305A G [1-520]
77 18-289-239C T [1-486] '
78 18-291-91 C T [1-453]
80 18-194-130C T [1-460]
81 18-198-252A G [1-316],[349-459]
82 18-242-300A G [224-476]
85 99-2409-298A G [117-127],[160-359],[395-71,1]
86 99-339-54 G C [1-247],[293-1514],[1544-2128],[2159-3001]
98 99-32148-315G C [1-24]
108 99-32077-66A G [37-63]
1110 ~99-32376-426A G ~[235-470] ~I
119
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 9A
SEQ.IDBIALLELIC ORIGINAL ALTERNATIVE
NO. MARKER ID ALLELE ALLELE
1 99-27199-207T C
2 99-27207-117C T
3 99-27213-53A G
4 99-27218-333T G
6 99-28109-275G A
7 99-28110-75C T
8 99-28125-81A C
9 99-28134-215C T
99-28137-96A G
11 99-32204-305G A
19 99-28722-90T C
22 99-27088-246G A
23 99-27090-203G A
24 99-27091-220G A
25 99-27093-145T C
26 99-27094-406T C
27 99-27096-410G A
30 99-27550-48A G
31 99-27558-335C T
34 16-31-738 C G
39 99-28735-56C T
43 99-27875-185T C
44 99-27880-176T C
46 99-28753-353T C
47 99-28755-206A G
48 99-32333-366T C
49 16-38-323 A C
50 99-28484-179A T
51 99-30853-364G A
52 99-28485-198G T
53 99-30858-354T C
54 99-32002-313G A
55 18-15-366 C T
56 18-20-174 G A
59 18-2-192 G T
60 _ G A
99-26921-210
63 18-133-293 C A
68 16-42-140 A G
70 18-269-44 A G
71 16-218-624 G C
74 16-217-55 A G
88 10-214-79 C T
90 99-28779-168T C
I91 99-28788-300G A
120
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 9B
94 99-32059-169T C
95 99-32061-304A G
96 99-32065-303T G
97 99-32123-118G A
99 16-2-76 A G
101 16-3-199 C T
102 16-50-197 C T
103 16-1-59 C T
104 16-2-187 A G
105 99-28761-311A G
106 99-28771-86T C
109 99-32078-466C T
111 99-32361-419T G
112 16-21-228 G A
117 16-25-279 G C
118 16-23-393 G T
119 16-106-364 T C
122 16-84-185 T C
124 16-91-333 G A
126 16-133-205 A G
127 16-135-181 T A
128 16-145-405 C T
1129 16-177-320 A ~ G
121
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 10
SEQ BIALLELIC 1ST 2N
ID MARKER ALLELE ALLELE
NO. ID
99-28108-233A C
36 99-27563-400A G
45 99-28747-371C T
61 16-215-80 C T
67 16-115-343A C
79 18-186-391G T
83 8-15-126 A G
87 12-254-180A G
92 99-32052-262C T
93 99-32121-242A G
100 16-28-93 A C
107 99-28791-291A G
113 16-22-156 C T
114 16-23-404 A G
115 16-24-175 A C
116 16-25-286 C T
120 16-16-285 C T
121 16-17-121 C T
123 16-87-74 A G
125 16-128-142C G
130 16-4-354 C T
122
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 11
SEQ. POSITION RANGE OF PREFERRED
ID SEQUENCE
NO.
1 [103-147]
7 [1-25]
8 [508-518]
9 [398-432]
[295-364]
11 [301-342]
23 [246-287]
25 [369-413]
30 [126-153],[182-468]
31 [271-313],(443-452],
34 [408-461 ]
39 [147-235],[438-457]
43 [498-549]
46 (432-448]
49 [263-320]
54 [472-489]
59 [280-321 ]
63 [486-505]
71 [258-437],[669-927]
74 [90-165]
79 [1-82],j150-191]
83 [1-16],[144-498],[620-800],[1300-1366],
1823-1908 , 2336-2365
, 2398-3001
88 [1-1297],[1998-2689],[2895-2965]
92 [255-348],[493-499]
93 [445-467]
94 [1-16],[396-438]
96 [246-288]
97 [1-91],[420-541]
111 [443-457]
121 [130-181 ]
122 [160-399]
123 [144-145],[351-435]
128 [283-551 ]
129 [375-458]
123
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE '12
SEQ POSITION RANGE COMPLEMENTARY
ID OF POSITION RANGE OF
NO. MICROSEQUENCING MICROSEQUENCING
PRIMERS PRIMERS
1 188-206* 208-227
2 98-116* 118-136*
3 34-52* 54-73
4 314-332* 334-353
214-232* 234-253
6 255-274 276-295
7 54-73 75-94
8 62-80* 82-101
9 196-214* 216-235
77-95* 97-116
11 285-304 306-325
12 98-117 119-137*
13 266-284* 286-305
14 438-456* 458-477
375-394 396-414*
16 93-112 114-132*
17 172-191 193-212
18 238-256* 258-277
19 71-89* 91-110
332-350* 352-370*
21 387-406 408-427
22 226-245 247-266
23 185-203* 205-224
24 201-220 222-241
125-144 146-165
26 387-405* 407-426
27 390-409 411-430
28 63-82 84-103
29 142-161 163-182
28-47 49-67*
31 316-334* 336-355
32 87-105* 107-126
33 344-363 365-384
34 715-737* 739-761*
281-299* 301-319*
36 381-399* 401-420
37 423-442 444-462*
38 114-132* 134-153
39 36-55 57-76
379-398 400-418*
41 299-318 320-338*
42 345-363* 365-384
43 ~ 165-184 186-204*
124
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 12 (cont)
44 156-175 177-195*
45 353-372 374-392*
46 332-351 353-371*
47 187-206 208-226*
48 346-365 367-386
49 300-322* 324-346*
50 160-178* 180-199
51 345-363* 365-384
52 179-197* 199-217*
53 334-353 355-373*
54 292-310* 312-331
55 347-365* 367-385*
56 155-173* 175-194
57 158-177 179-197*
58 375-394 396-414*
59 172-191 193-211
60 192-210* 212-231
61 231-249* 251-270
62 348-367 369-387*
63 273-291* 293-311*
64 172-190* 192-210*
65 118-137 139-157*
66 77-95* 97-115*
67 320-342* 344-366*
68 121-139* 141-163*
69 157-175* 177-196
70 25-43* 45-64
71 601-623* 625-644
72 311-329* 331-349*
73 382-401 403-421
74 32-54* 56-74*
75 120-138* 140-159
76 286-304* 306-325
77 219-238 240-258*
78 71-90 92-110*
79 371-390 392-410*
80 110-129 131-149*
81 233-251 * 253-272
82 280-298* 300-319
83 1481-1500 1502-1520*
84 1481-1500 1502-1520*
85 408-427 429-447*
86 1482-1500* 1502-1521
87 292-310* 312-331
88 1482-1500* 1502-1521
89 1482-1500* 1502-1521
~90 149-167* 169-187*
125
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 12 (cont.)
91 281-299* 301-320
92 244-262* 264-282*
93 225-243* 245-264
94 149-168 170-189
95 285-303* 305-324
96 284-302* 304-322*
97 99-117* 119-138
98 294-313 315-333*
99 76-94* 96-114*
100 101-119* 121-143*
101 323-341* 343-361*
102 178-196* 198-216*
103 158-180* 182-200*
104 183-205* 207-225*
105 292-310* 312-331
106 67-85* 87-106
107 272-290* 292-311
108 47-65* 67-85*
109 448-466* 468-486*
110 407-425* 427-446
111 400-419 421-439*
112 205-227* 229-251*
113 133-155* 157-175*
114 381-403* 405-427*
115 156-174* 176-194*
116 267-285* 287-305* .
117 260-278* 280-298*
118 370-392* 394-416*
119 345-363* 365-383*
120 265-284 286-304*
121 102-120* 122-140*
122 162-184* 186-208*
123 51-73* 75-97*
124 310-332* 334-356*
125 123-141 * 143-161
126 222-244* 246-268*
127 209-231 * 233-251
128 436-454* 456-474*
129 297-319* 321-343*
130 335-353* 355-373*
261 343-361* 363-382
262 68-87 89-107*
263 316-334* 336-355
264 48-66* 68-87
126
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 12 (cont.)
265 295-313* 315-333*
266 302-321 323-341*
267 296-314* 316-334*
268 327-345* 347-366
269 244-262* 264-282*
270 1482-1500* 1502-1521
271 115-134 136-154*
272 400-418* 420-439
273 271-289* 291-309*
274 237-255* 257-276 -
275 48-67 69-87*
276 246-265 267-285*
277 287-305* 307-326
278 1482-1500* 1502-1521
279 1482-1500* 1502-1521
_ 1482-1500* 1502-1521
280
281 225-244 246-264*
282 271-290 292-310*
283 327-345* 347-366
_ 387-405* 407-426
'284
285 319-337* 339-357*
286 91-109* 111-130
1287 85-103* 105-124
288 12-30* 32-50*
289 323-341* 343-362
290 121-139* 141-160
291 160-178* 180-199
292 304-322* 324-343
293 50-69 71-89*
294 422-441 443-461*
295 46-64* 66-85
296 181-199* 201-220
297 314-333 335-353*
298 313-331* 333-352
299 358-377 379-397*
300 288-306* 308-327
301 99-117* 119-138
302 119-137* 139-158
303 72-91 93-111
304 368-386* 388-407
305 397-415* 417-436
306 127-145* 147-165*
307 1481-1500 1482-1500*
308 1481-1500 1502-1520*
309 250-269 271-289*
310 146-164* 166-184*
311 105-123* 125-144
312 199-218 220-238*
313 293-311 * 313-331
314 349-367* 369-388
315 206-224* 226-245
316 56-74* 76-95
317 1482-1500* 1502-1521
ia~
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE. '12 (cont.)
318 156-174* 176-194*
1319 328-347 349-367*
320 332-351 353-371*
321 461-479* 481-500
322 175-193* 195-214
323 265-283* 285-304
324 33-51 * 53-72
325 169-188 190-208*
326 51-70 72-90*
327 106-125 127-145*
328 40-58* 60-79
329 7-26 28-46*
330 184-202* 204-223
331 70-88* 90-108*
332 302-320* 322-341
333 50-68* 70-89
334 39-57* 59-77*
335 197-215* 217-236
336 414-432* 434-452*
337 66-84* 86-105
338 368-386* 388-407
339 239-258 260-278*
340 252-270* 272-291
341 175-193* 195-213*
342 283-301* 303-321*
343 33-52 54-72*
344 299-317* 319-338
345 6-25 27-45*
346 300-319 321-339*
347 262-280* 282-300*
348 252-270* 272-290*
349 246-264* 266-284*
350 277-295* 297-315*
351 313-331 * 333-352
352 54-72* 74-93
353 66-84* 86-104*
354 82-100* 102-120*
355 304-322* 324-343
356 186-204* 206-225
35 408-426* 428-447
7
_ 297-315* 317-336
358
359 297-315* 317-336
360 406-424* 426-445
361 193-211* 213-231*
362 137-155* 157-175*
363 247-265* 267-285*
364 122-140* 142-160*
365 155-173* 175-194
366 75-94 96-114*
367 95-113* 115-134
36_8 274-292* 294-312*
369 3-21 * 23-42
1370 ~ 399-417* 419-438
128
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 12 (cont.)
371 185-203* 205-224
372 242-260* 262-281
373 393-411 * 413-431 *
374 274-292* 294-313
375 75-94 96-114*
376 342-360* 362-381
377 336-355 357-375*
378 160-178* 180-198*
379 158-174* 176-195
380 202-220* 222-241
381 126-144* 946-9 65
382 387-406 408-426*
383 113-132 134-152*
384 220-238* 240-259
385 272-290* 292-311
386 254-272* 274-293
387 89-107* 109-128
388 49-67* 69-88
389 276-294* 296-315
390 440-458* 460-479
391 89-108 110-128*
392 307-326 328-346*
393 345-364 366-384*
394 348-366* 368-387
395 253-271* 273-292
396 16-34* 36-54*
397 396-414* 416-435
398 146-164* 166-185
399 343-362 364-382*
_ 278-296* 298-317
400
1401 I 19-37* -. I - 3g_58 -
-
129
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 13
SEQ POSITION RANGE COMPLEMENTARY
ID OF POSITION RANGE
NO. AMPLIFICATION OF
PRIMERS AMPLIFICATION
PRIMERS
1 1-20 431-450
2 1-21 432-452
3 1-18 446-464
4 1-20 528-546
1-18 _
394-413
1-X8 434-454 -..
7 1-18 530-549
8 1-18 500-518
9 1-20 453-472
1-18 529-546
11 1-20 384-401
12 1-19 459-478
13 - 1-19 439-456
14 1-18 494-514
1-18 532-550
16 1-19 446-466
17 1-18 432-449
18 1-19 438-458
19 1-17 429-449
1-18 435-451
21 1-18 437-454
22 1-19 510-527
23 1-20 431-451
24 1-20 455-473
1-20 453-472
26 1-20 436-455
27 1-18 432-450
28 1-18 486-504
29 1-19 404-421
1-19 448-468
31 1-18 432-452
32 1-19 446-465
33 1-19 450-470
34 1-25 975-1003
1-18 438-455
36 1-18 526-546
37 1-18 496-513
38 1-19 391-410
39 1-19 438-456
1-20 434-452
41 1-18 441-457
42 1-17 489-508
I~ 1-18 531-549
43
130
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 13 (cont)
44 1-18 444-462
45 1-19 478-496
46 1-20 427-447
47 1-17 452-470
48 1-20 520-540
49 1-28 389-416
50 1-17 488-505
51 1-17 465-485
52 1-17 449-466
53 1-17 456-473
54 1-19 472-488
55 1-20 507-525
56 1-17 408-425
57 1-19 437-457
58 1-19 456-473
59 1-19 450-468
60 1-21 431-451
61 171-188 284-303
62 1-18 461-479
63 1-17 487-504
64 1-18 431-449
65 1-18 516-535
66 1-17 436-453
67 1-24 533-553
68 1-18 154-171
69 1-19 474-493
70 1-17 457-477
71 1-22 906-927
72 1-18 459-479
73 1-20 500-518
74 1-20 568-587
75 1-17 430-449
76 1-17 499-519
77 1-17 466-485
78 1-17 432-452
79 1-18 442-459
80 1-17 439-459
81 1-17 438-458
82 1-17 455-475
83 1376-1395 1792-1810
84 1130-1148 1534-1552
85 131-148 560-580
86 1448-1467 1883-1902
87 132-152 586-603
88 1225-1244 1747-1764
89 1414-1430 1759-1775
90 1-17 390-409
131
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 13 (cont)
91 1-17 458-478
92 1-18 - - 4.78-498
93 1-17 448-466
94 1-17 448-468
95 1-19 430-449
96 1-17 469-486
97 1-20 520-540
98 1-18 428-448
99 20-39 240-260
100 28-47 354-374
101 143-162 374-393
102 1-20 227-245
103 123-142 290-309
104 20-39 240-260
105 1-18 446-465
106 1-18 444-461
107 1-18 432-451
108 1-18 471-488
109 1-17 470-488
110 1-18 449-469 ~ ,
111 1-18 442-456
112 1-25 399-424
113 1-24 458-481
114 1-26 455-478
115 1-22 405-428
116 1-22 412-433
117 1-22 412-433
118 1-26 455-478
119 1-22 723-742
120 1-19 516-535
121 1-19 508-529
122 1-22 525-540
123 1-22 504-525
124 1-19 641-665
125 1-20 308-327 ; ,
126 41-59 472-490
127 52-71 482-501
128 51-69 523-540
129 1-22 472-492
130 1-20 740-759
261 1-21 482-502 ,
262 1-21 438-457
263 1-20 482-502
264 1-19 441-461
265 1-18 428-448
266 1-19 409-426
267 1-19 403-422
268 1-19 401-419
I~ ~ 1-18 478-498 ~ I
269
132
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 13(cont.)
270 1211-1229 1588-1606
271 1-18 448-465
272 1-20 507-527
273 1-18 434-451
274 1-17 466-486
275 1-19 436-453
276 1-18 452-471
277 1-18 450-468
278 1156-1173 1652-1672
279 1149-1166 1591-1608
280 1170-1187 1635-1652
281 1-18 440-460
282 1-18 433-453
283 1-17 538-558
284 1-17 450-467
285 1-18 439-456
286 1-18 439-456
287 1-20 431-451
288 1-20 431-451
289 1-20 431-451
290 1-19 458-476
291 1-18 497-517
292 1-18 419-436
293 1-17 487-504
294 1-17 443-463
295 1-18 438-455
296 1-18 463-483
297 1-20 464-484
298 1-19 439-456
299 1-18 458-478
300 1-18 443-463
301 1-18 442-460
,
302 1-18 457-475
303 1-18 515-533
304 1-18 443-463
305 1-19 434-451
306 1-21 430-450
307 1263-1281 1694-1711
308 1114-1133 1516-1533
309 1-19 481-498
310 1-18 447-467
311 1-20 444-463
312 1-19 534-551
313 1-19 37-457
4
314 1-19 _
459-477
315 1-19 486-502
316 1-18 432-452
317 1171-1189 1702-1719
318 1-18 476-493
319 1-20 430-450
320 1-20 455-475
321 1-21 489-509
322 1-21 457-477
133
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 13 (cont.)
32 1-19 430-450
3
_ 1-21 485-505
324
325 1-20 466-486
326 1-21 437-457
327 1-19 497-517
328 1-20 495-514
329 1-20 450-470
330 1-18 456-476
331 1-20 433-453
332 1-19 435-455
333 1-19 544-561
334 1-18 442-459
335 1-20 434-453
338 1-21 514-534
337 1-20 464-483
338 1-21 580-597
339 1-18 441-461
340 1-20 430-450
341 1-18 479-496
342 1-21 461-481
343 1-21 429-449
344 1-21 409-429
345 1-21 430-450
346 1-20 433-453
347 1-19 495-514
348 1-20 433-451
349 1-20 443-460
350 1-20 440-459
351 1-18 445-463
352 1-18 432-449
353 1-19 430-450
354 1-19 462-480
355 1-21 445-465
3 1-18 473-493
56
_ 1-18 570-589
357
358 1-20 412-432
359 1-20 412-432
360 1-20 515-533
361 1-20 465-485
362 1-18 550-570
363 1-20 430-450
364 1-21 416-435
365 1-20 455-475
366 1-20 481-501
367 1-21 428-448
368 1-19 459-478
369 1-18 458-476
370 1-20 475-495
371 1-18 456-476
372 1-20 447-467
373 1-21 447-466
374 1-18 467-484
375 1-18 466-484
134
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 13 (cont.)
376 1-19 437-455
377 1-20 383-403
378 1-20 428-448
379 1-20 431-449
380 1-18 434-452
381 1-20 428-448
382 1-19 453-473
383 1-21 480-497
384 1-21 532-552
385 1-20 480-500
386 1-18 429-449
387 1-21 433-450
388 1-21 430-450
389 1-21 576-595
390 1-21 549-569
391 1-18 438-455
392 1-19 496-516
393 1-19 455-472
394 1-20 441-458
395 1-19 455-475
396 1-18 449-469
397 1-18 557-577
398 1-18 433-453
399 1-18 475-494
400 1-20 491-511
401 1-21 380-400
135
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 14
SEQ POSITION RANGE
ID OF PROBES
NO.
1 195-219
j 2 105-129
3 41-65
4 32
1-345
_
221-245
6 263-287
7 62-86
8 gg_93
9 203-227
84-108
11 293-317
12 106-130
13 273-297
14 445-469
383-407
16 101-125
17 180-204
18 245-269
19 78-102
339-363
21 395-419
22 234-258
23 192-216
24 209-233
133-157
26 394-418
27 398-422
28 71-95
29 150-174
36-60
31 323-347
32 94-118
33 352-376
34 726-750
288-312
36 388-412
37 431-455
38 121-145
39 44-68
387-411
41 307-331
42 352-376
43 173-197
44 164-188
~~ 45 361-385
136
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
TABLE 14 (cont.)
46 340-364
47 195-219
48 354-378
49 311-335
50 167-197
TABLE 14 (COnt.) 51 352-376
52 186-210
53 342-366
54 299-323
55 354-378
56 162-186
57 166-190
58 383-407
59 180-204
60 199-223
61 238-262
62 356-380
63 280-304
64 179-203
65 126-150
66 84-108
67 331-355
68 128-152
69 164-188
70 32-56
71 612-636
72 318-342
73 390-414
74 43-67
75 127-151
76 293-317
77 227-251
78 79-103
79 379-403
80 118-142
81 240-264
82 287-3
11
83 _
1489-1513
84 1489-1513
85 416-440
86 1489-1513
87 299-323
88 1489-1513
89 1489-1513
90 156-180
91 288-312
92 251-275
93 232-256
94 157-181
95 292-316
96 291-315
97 106-130
137
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
98 302-326
99 83-107
100 108-132
101 330-354
102 _
185-209
103 169-193
104 194-218
105 299-323
106 74-98
107 279-303
108 54-78
109 455-479
110 414-438
111 408-432
112 216-240
113 144-168
114 392-416
115 163-187
116 274-298
117 267-291
118 381-405
119 352-376
120 273-297
121 109-133
122 173-197
123 62-86
124 321-345
125 130-154
126 233-257
127 220-244
128 443-467
129 308-332
130 342-366
261 350-374
262 76-100
263 323-347
264 55-79
265 302-326
266 310-334
267 303-327
268 334-358
269 251-275
270 1489-1513
TABLE 14 ~ 271 123-147
011t
~
.
C
272 407-431
273 278-302
274 244-268
275 56-80
276 254-278
277 294-318
278 1489-1513
279 1489-1513
280 1489-1513
138
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
281 233-257
282 _
279-303
283 334-358
284 394-418
285 326-350
286 98-122
287 92-116
288 19-43
289 330-354
290 128-152
291 167-191
292 311-335
293 58-82
294 430-454
295 53-77
296 188-212
297 322-346
298 320-344
299 366-390
300 295-319
301 106-130
302 126-150
303 80-104
304 375-399
305 404-428
306 134-158
307 1489-1513
308 1489-1513
309 258-282
310 153-177
311 112-136
312 207-231
313 300-324
314 356-380
315 213-237
316 63-87
317 1489-1513
318 163-187
319 336-360
320 340-364
321 468-492
322 182-206
323 272-296
324 40-64
TABLE '14 ~C011t.~ 325 177-201
326 59-83
327 114-138
328 47-71
329 15-39
330 191-215
331 77-101
332 309-333
333 57-81
139
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
334 46-70
335 204-228
336 421-445
337 73-97
338 375-399
339 247-271
340 259-283
341 182-206
342 290-314
343 41-65
344 306-330
345 14-38
346 308-332
347 269-293
348 259-283
349 253-277
350 284-308
351 320-344
352 61-85
353 73-97
354 89-913
355 311-335
356 193-217
357 415-439
358 304-328
359 304-328
360 413-437
361 200-224
362 144-168
363 254-278
364 129-153
365 162-186
366 83-107
367 102-126
368 281-305
369 10-34
370 406-430
371 192-216
372 249-273
373 400-424
374 281-305
375 83-107
376 349-373
377 344-368
TABLE 14 ~COilt.~ 378 167-191
379 163-187
380 209-233
381 133-157
382 395-419
383 121-145
384 227-251
385 279-303
386 261-285
140
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
387 98-120
388 56-80
389 283-307
390 447-471
391 97-121
392 315-339
393 353-377
394 355-379
395 260-284
396 23-47
397 403-427
398 153-177
399 351-375
400 285-309
401 26-50
141
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
0
d'M O M r O ti'LOlf> d'~ r MN O r N O Cfl00 etM rM
O O W O O O O a000 O O O OO O O O o0OM O O OO
N
O O O c0 O COI~COI~ O O I~ a0I~O a0 f~ N I~CO O O)00O
d'M M M ~tM M M M ~tM M MM ~ctM M M MM ~fM MM
ID - -
r r r r r e r r r r r r re r r r r rr r r rr
V
p
M CflIn~ ~ d'00'd'N N O In I~O r 00 O d'MM L(7COO00
00O O O ChI~r O r N O N ~tf7r M CO InN~ N I'MCO
O O O O O O O O O O O O OO O O O O OO O O OO
Q.
f~O N tn M r (p(pr W 00O OGfl~ tn N M I'O Lf~O tn~
N O ~YN r N ~ r M r M N O d:N r tn N M ~tr crJN Mr
N O O O O O O O O O O O O OO O O O O OO O O OO
In[vr M M N I~r Op N ~ CO tf)O CO00 O CO~O ~ I'~N'd'
N 'd'V L(7d' lOd'LOtn~Y COCOCO 'd't(7InM Gf~'d'VV' d'd'~d'
r
O O O O O O O O O O O O OO O O O O OO O O OO
00M I~N ~ t~f~M r r M ~t Ind'GO1~ 00 r OO CO',NMt~
p
~ r N ~ N r N r ~ O O (~ rN N O N N OIn r M NM
N r
C O O O O O O O O O O O O O OO O O O O OO O O'OO
3
C)
00O 'd'<t O tL7COd'N COr r COr 'd'~t 00 00I~O Lf7d'f~O
O N r N N d:N ~ r ~ ~ O MM N Cfl r N MO d:N Mr
d O O O O O O O O O O O O OO O O O O OO O O'OO '
Q.
rr
C t-~ t!>O d'N f~M 'ch d'GON ~O r N ~ ~ !~r O GDtwO
p N ~ <t~ Ln d:V d:M M tf~Lnf' ~In~ c~ tn Lf~d;d Ch~ '~tLO
r
Ve O O O O O O O O O O O O OO O O O O OO O O OO
d
r ~ r (p W M I~~ M O ~hCO O~ d'd' 00 ~ CflO CflO CON
J N '-'~ N d'N N r N O In O O N Nr M O N r rt(7 r M rM
O O O O 0 0 0 O O 0 0 0 00 0 0 O 0 00 0 0 00
V
d
a-N r r M ~ M N CO I~!~r rN M !~ O 07ON O 1~<YIn
p 1~O O O I~~ M O N N r M MC''7~ r fv f~O00 CY7~ MCO,
O O O O O O O O O O O O OO O O O O OO O O OO
Q
O f~N M r 00tf~ODtn N 00I~ Ot707M CO M 'd'rO O Cpd'~
r ~ t~M Lt~CO InM tI7M CO M M CO M~tL(7N tn 'd:MI' ~ InCrLn
C7 N
p O O O O O O O O O O O O' OO O O O O OO O O OO
_..
C
d N o0d'r W 'd'r M N V N~ ~ O O Or (pM OCO
IL N ~ ~ O ~ ~tM LnN ~ N M CO ~t~ ~ N ~c7~hMI~ M ~ M~
p O O O O O O O O O O O O OO O O.. O O OO O O'OO
C)
N
41
y H-1--f~H C~C9H-1-~H I-C~C9 C9C~I-CJ C~ C~C~I- E-F-HC~
a
T
d
d U U U U Q Q U U C9 U Q U QQ U Q U Q QU U U UQ
Q
I~(~ l(7 Lf700LnN 00 r ~ COO O M (nCOrCO
O r Lf)r 0pIn~ ~ Ln O lI~O ~'N M ~ O MCO 00h-I~O
r fwN N d'M r N O M d' NN 00'd' M ~'rL(~ r r MN
w w ~ w w w ~ ~ w ~ ~~ w w w~ ~ w ~
w w
~ I~O 'ch O r M r M N O CO 00r N O ~ M NLO Lf~O f~In
y O O r M CflI~.~ 00O N M O 00O O ~ ~ COMM I~DOd'tn
_, r N r r r r r r r [~h M OO O ~ ~ Inf~I~ QOQOf~f~
f~1~N a0 0000a0N N o0a0N I~f~I~I' O t~COa0 I~t~a000
N N N N N N N M M N N M NN N N N N NN N N NN
~ ~ i ~ ~ ~~ i ~
O O O O W ~ O O O O O O iO O O ~ O OO O O OO
O O
O
O O O O O ~ O O O O O O OO O O r O OO O O OO
N
N ~ r
c0CO(flCfl I~t~I~~ I~ Z
Z Z p",'Q_'Q_'d'
.' LLLLLLLL 0..'~ 4'~ LLLLLLIL
Z Z Z Z S Z Z Z Z Z Z Z ~~ ~ ~ J J JJ
U' ~.m m n u n ~ m n U U U UU U U ~ ~ ~~ U U UU
142
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
M OO ~hti'~ rh MO MN M rM M d'~td' d'd'd'd' ~ d'd"d' ~'chd'
O MM O OO O OO OO O OO O OO O OO OO O OO O OO O
O Od'O OO O Oo0OO ~ COO O OO O OO OO O OO O OO O
M d'M d'ttd'ft V'M Md' M M~ ei'Wi'~ ~td'~'~t' ~t'Vd'~t ~l'd'd'
r rr r rr r rr !-r r rr r rr r rr rr r rr r rr r
t~Mlf~O l(7O I~ NCOOI~ M 00N r Lf~N CO OCflNd' M ~f~tI~ COO O
'
OprN r l(7d:e- I~~ NI~ O 00O 'u-'00~ r Or etN r 0O N OIsM
O O0 0 00 0 00 00 O OO 0 00 0 O OCO O ~0 0 O0 0
O
M Nr ~ IWn O Or COO 00L(7t(7O 00L(7~h' !~~ MN COI~O ~ Mm r
N OCOr OV~r NN NCO <Y<tr CONM N ~r ~N O ~tChr N1~O ,
O OO O OO O OO OO O OO O OO O OO OO O OO O OO O
O f~N inOO 'd' 'cf'V ~-CO O ~L7I~00rr f~ rfwMN f~OO M' In03M
M NM COMV Lf~ NN c1'N d'd'lf)M ~lf~d' d'Lf7d'~ d'~COtn 'd'r r
O OO O OO O OO OO O OO O OO O OO OO O OO O OO O
O rr (pMInCO Cfld'r~ N Oa0N r~ O rM 'd'C4 f~Mr 00 NN CO
M I~O r L(7r M l(7InMr O rN O Nr N ON ON ~ Or N MO 00
O OO O OO O OO OO O OO O OO O OO OO O OO O OO O
COC CO'- t~O I~Ltd M ' Lf7 CO M L(7N ' '~ N
'
~tOO N dr 00 rN MLf7 ~ MO O ~d r ON ~M ~-CflN d df7O
N t0 OLC)r ~ 'cY CONM LI~ N Ci'N CY71'
00 00 0 00 0 00 00 0 00 0 00 0 00 00 0 00 0 00 0
V
r 'ctO r OOpCO COCOOO d'Cfl07r d'r m (flCDOO N OChN hM O
~ MM ~ MM ~ NN MN <YV'ctc~7tf3tnd: M<tM~t 'ctNC'~ ~N r
O OO O OO O OO OO O OO O OO O OO OO O OO O OO O ,
tn~~ M hr (p Cpd'MCfl N Nd'~ NCOCfl f~ti'~~ M ~~f'~Y ~N ~
M ~O N LI~r M l(7~ M~ r r~ O Nr M ON ON d'Or M rO f~
O OO O OO O OO OO O OO O OO O OO OO O OO O OO O '
N ~M ~ ~pr ~p (pO 1~fD r cfr O ~f7r ~ 07M M~ CONO M NLC)(p,
.
CDO(fl~ MN M COO <Td' r CflO ~ COf~O MM ~~ r NM ~ O~ r
0 00 0 00 0 0 00 0 0 0 00 0 00 00 Q o0 0 00 0
00d'O N MInM Ni~Nt~ I~NCflr 1~O N NN CON O o0O Ct 'd'N M
tI~0ON ~tI'M CO COCOLt7N N M~ N d'M ~ Ntf~NIn I~N<h~ LOr O
0 00 0 00 0 00 00 0 00 0 00 0 00 00 0 00 0 00 0 -.
~ ~~ M ~O ~ OI~00O d'LOOpd'~r r Lf7OpOpM ti'MCOl(7 M'd'~
L(7t~r 'd'[~M'lf~ I~COVM M MCflN d'~ CO N<hNIn C4NM tf~ ~'r Op
O OO O OO O OO OO O OO O OO O OO OO O OO O OO O
C9I-I-ICOC~I-I- I-I-C9U C~I-U I-C7C9C7 C~I-C~I- C9C~C~C9 C9I-I-.
a UC7a aU a C7U aa a Ua U aa a aU aC9 a aa U aU U
~ d'00M O Od'N r rt'~
(fll>7~ r r OO 'd' rCO~r 00
M Mr M NM MM N M00Nd' O Od7
w wv v .~.00L(7 I~~07 O rCOr ~v v vv vw N d' 00f~r
M 00t(]N ~~ ~ NO rN 'd' M tnMr r rr rr ~ Nv ~ rN ~
InL(700O rr M ~V N~ r ~r MCON CO!~~Cfl ~ v wv v
0 OC1d'O O N N ~ ~ N ~ d' f~
0 ' vw v v' M v 'v ' fO r f~f~IM MO O V
'
'
O O00N Or Op In(pM COti00d 00N N 000000N W ~fM LI~r r
M MN M NM M NN Nr InrN d'NM M NN NM LnON M NN N
1 11 1 I1 1 11 11 1 11 1 1 1 1 1 1 11 1
O OO O 0000'00 00O O00 O OO 1 O1 O O1 OI r rW O NO O
O O O O 1 1
rr r rr ~r r rr r ~~ !~ ~~ ~~ ~ ~~ ~ rr r
rr rr
J JJ J JJ J OO OO ~~ ~~ DD
D Q O.,a ~
t-I-t-f-I-I-F- UU UU
~ aa aa u~ww w wu~w aa aa ~ ~~ ~ ~-~ ~-
C~CaC7COCOC9C9 ~~ ~~ z zz Z zZ Z E-H-Ht- D DD O UU U
143
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
~ d'd'~1' M M N M M r N N ~ d' d''cYM ~ r <t~ d-
O O O O O O O O O O O O O O O O O O O OO O
O O O O O O a0~ O 07O M O O O O O O N OO
dwt ~heY M M M M d' M M M Wit'd' M efd'd' M d'V' M
r r r r r r r r r r r ~'r r r r r r r rr r
N O O r ~ 00dWt'M CO00r O ~ O N 00N r rM O
O N O Ch ~ h M N CO r N ~YChp M C'~r r C'~rLn
O O O O O O O O O O O O O ~ O O O O O OO O
[~r O O N ~ N r I~ M M COCflO O r r (p Op'd'O~ CO
r N r N ~ r I'r N r r ~ ~ O M tt7r 00 O rM f~
O O O O O O O O O O O O O O O O O O O OO O
M ~ 'd'd' d'~ 'd'N CO r f~~ O r r ~ COM N I~CO
CO~ ~ lf~ N ~ N ltd~ ~ d'N ~'O Lf~V 'cf'r M Ind' N
O O O O O O O O O O O O O O O O O O O OO O
O O f~CO d-f0~ 00I~ CflO tL~<tO r LnM r O Otn M
N N N N O N O M r M d-N r O) r O ~ O CONr O
O O O O O O O O O O O O O O O O O O O OO O
'd'~tN o0 ~tO N o0O 07a0a0M O N M COLf~ N OO t'
N N M N CON CflO N O O M d;O M ~ r N r NM f'
O O O O O O O O O O O O O O O O O O O OO O
Wit'h d'L(7 r O N M O N M 000 N r O r M Iv~r 1'
V'<hd'd' M Lf~M d'LO V d'M d'r In~ tnN M ~In r
O O O O O O O O O O O O O O O O O O O OO O
r O ~ I~ !nO COO)r 07O ~'O 07 I~O N N r (pr CO
M N N N O M O <YN ct~ N O 00 r O M O tnMr CO
O O O O O O O O O O O O O O O O O O O OO O
I~f~O N d'c0~ N O ~ N O O ~ ~ O I~~t O tm-- M
COlnO tf~ N I'r r t' O r lnIsO r r 0 O r Op[ y s~
O O O O O O O O O O O O O 0 O O O O O OO O
N O '~tM (OM CflM ~ N ~ O d'O COI~CUt~ (ON00 wt
L()~ i1)L() r Lnr (p~ Cfl(p~ M O M N COO ~ II~M r
O O O O O O O O O O O O O O O O O O O OO O
d'N COO r lf~N O Cfl O r M M 'd' M M 00d' O NCfl In
Lnlf~V ~ N lf~N N <h' f~I~d'M O 'd'M ~ r COl(7M r
O O O O O O O O O O O O O O O O GOO O OO O
H C~C~I- C9C~U I-I- I-I-I-C7f- I-C9C~C9 U f-C7 U
U Q Q C~ Q Q Q U U U U U Q U U U Q Q Q UQ Q
O N O r N CO
M t!)O O In N Lf~ O d'I~a0O 'd'f~~Y r
r N M M r Ivr LI7Op Cfl 00'd'M !~N N r N r<t O
v v w v N [~I N r r tnr f~~ r r r M M ~~ r
CON CO v ~ Ln v v w v w r~ w
O O ~tOO M M r N r OO~ w w O O CO1'a0 LnInCD N
v w v w v o0N
r r N r N InCOf~d' InO o0N N r r ~~-r r NN r
r ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ i i ~ i
00000000 O O O O O ~ O ~ O O O O O O O o0a0 a0
O O
r r T r r r r r r r r r r N r r r r r rr r
N M M N
D D D Q ~ c c ~ ~ f~fnfn
0 B
Z '
W n ~ ~ O D D O D U'C7U'COU ~ ~ S ~ I-I-I-
144
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
a~ a~
j O O OO N N O O OlI~ j O ~ ~c~O OO O O O N
O O f~N Lf?1nM O o000 , O ~ O O OI~f~~tWit'N
Q'M M NN N N N N ~-r Q'd'M M M MN N N N N
O
O O
i T
O O
r c-NN M M Lf~O MCt ~ O r rN N <Yd'CO
((3O O OO O O O r rr (0O O O O OO O O O O
> O O OO O O O O OO > O O O O OO O O O O
Q.O O OO O O O O OO Q O O O O OO O O O O
N N N N N N N
~l' ~ ~ d'd~ 'd'
N N NN N N N N ON
\ \ O\ O \ \ \ O\
r r r r r r r
d'N N MN M N N N MN d'0 0 0 0 00 0 0 0 0
L s
r r Iiir ~.()r r r Nr -
'
N N ON O N N N dN
L.M c~CVM CVM M M NM L
O ~ O O~ O ~ ~ O o0~ O
p p Np N O)p d)rp
r
M M M M M M N N N
_ _ _ _M_ _ N_ N N N
r r r ~ r r c-~r ~ O O CO~ 00O T ~ COO
M (0CO~CO~ COCOCflNCOJ M M M ~ N ~M N N
O O \O \ O O O MO ~ \ \ r \Lf~r r \ I,n
~ N N NN o0N N N ON ~ Y O o0O N 1~O N N O O
L,M M NM 00M M M rM ~ L N r lf~M rN M M ~ N
, , ,, , , , , ,, , , , , ,, , , , ,
~
p Q)rp r p p p rp ~ N ~-r ~ rN p p r N
O O d' d'~
O O O O O
M M M ~ M M M
N o a M O MO N O ~ NeY~ ~ d'
0 0 O
\ ~ \ O \ d'\ '-~ _ \ O \\ O O _ \
~ \ \
0000~00\ 00W O OO y ~ f~00N CON N N o0N
L,N N pN d)N M x.17r~ L ~ r N M rN M M N N
, , ,, , , , , ~, O , , , , ,, , a , ~
O O OO O O O M MO O O O O OO O O O O
~
O)07rr r r r r rr r r e-~ rr ~ ~ r r
O
O
r- M
in O CON N O O COOO tn N d' COd'N \ O
M
C r d'M COO COd'~ M Md'C COI~O M I~Cfl d'O
\ ~
O L r r r~ r r r r r O L r r ~ r rT r
CIA \ \ \ \ \ \ \ CO\ \ \ \ \\ I~
;~ O r ~, O r \ r d.
W m coo~oo\ aocflcflaoo~co~ o00>\ aoo>ao0oc~\ \
O ~ ~ N ~M InlI~tI~N rLnO Y liar M N rInN ~ M d)
L L
, ,, , , , , ,, O , , , , ,, , , , ,
O O a3M O O O O 00O .Q O O M O OO O O O O
~
r r rr r r r r rr ~ r r r r rr ~ r r r ,
C O O
U U
N
~ w w -~.s-.w .N-~w .v-.+~~ p +..n-.w .~w.rte.~.v-.w .,r
L C C CC C C C C CC L C C C C CC C C C C
~ _ O O ON N N N O NN p ~ N N N N NN N N N N
r C ~ ~ ~~ ~ ~ ~ ~ ~7~ ~ O ~ 07~ 07~~ a7
O O
w T
U a a aa a a a a aa M U a a a a aa a a a a
x
c ~ o
w w ww .,_..,~w w ww ~ ~ w +..w w w.v-..,~w w .w
~ ~ ~ v ~ a~v ~ ~ ~ ~ ~
~
C C C CC C C C C
-~
a ~ caa~a~a~a~a~a~a~a~a~a~~ ~ c~a~a~a~a,a~a~a~a~a~a~
U C9C9C9C9C9C9C9C9C9C9~ ~ U C9C9C7C9C9C9C9C9C9C90
t~ f/) O fn U
U ~
O
~ m
N ..Ø ~ H N .~r r.~ +(~-.
C I-'I-NI- I-'I-I-' I-'~ z U ~-I~~ I-'E-E-
N /- C N N N
0 ~G O LIJW .OLlJ.QIJJLlJW =IJJ~ N ~ ~-LJJUJ~-.nW W LJJ.OM
o c~z z c~z c~z z z ~nz N c~c~~ z z ~c~z z z c~r
~ o
145
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
as
O N o0O N N ~ I'~ N O
> LnCOO lf~N r 00000000
MM N N N ~-r r r
O
O
T
O O
N
O
O Or M COI~d'd'~ CO
(BO OO O O O r r r r
> O OO O O O O O O O
Q O O'O O O O O O O O
O OO O O O O O O O
L
L
M O OO O O O O O O O
r N
(B
J
m
O OpO N O ~ N O N O
O' ~
M
N C'pC N M 00~ M M
\
tn\ltdr Lnr O Inr N
O t~O N O N d'O N d'
N ~N M CVM CVCVM N
0 0 00 050 ~ 050 0 00
N rN ~ N ~ O)N
~t ~ N
O 00 O
M r r
_ _ _
r (p r
N r ~ M O d'O CO00M M
O ~ 0~ N N ~ ~
~ 0 )\ ODT N O
0 D
L ~f7e~O)M CVN ~.f~00M
C ~ O f~O O O O T O O 00
r rr ~ r ~ ppr ~ r
O
U U
O O N ~ N N N
U C O N N O N
p>a7O)O O O O C~07O)
O O
L LL L L L L L L L
U a aa a a a a a a a
o
0
~ ~ ~~ v v v ~ ~ ~ ~~
U C9C9C9C9C9C9(9C9C9C9
fn U
(B
~ ~
N .(~~~ ~ M ~ O
N ~ V
O C~U ~U Z U L~D (~~ LCDT
146
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
d N V ~CirO O OO O n00N 1f)COn N aDV'n O
~ r ~ M ra000aOO ~ d'O O M nd'(ON COr (O
O
O r O r rO O rM O rr r Or O r rr r
j
J
y n o m aoo~o~Mr ~ ~~ro w ~v o M Mn u~
n co~rmn uoro Maornv nM m n NcoN
fl O M O O r OO c'7OO O O rO N O O O
" ~ r O
C Q O O O OO O OO O OO O O OO O O OO O
O O O MO O f0n W [~.tn07~hMr n N Od'r
N ~ O n QOO O COO r (pI M r Opr O ~ rr d'
J W (Ottj'O O IOr (O(~7O CVCMOjV'07n VO 1(j
~p
N r r N NN N NM r rN N N rN r N rr N
Q. r,tfiNN N NO o7ON N N tf7O u7InNN N
~
(A O tD~ tnt!~InO 1n~ M MN N N rr O O 07W O
~
j N N CV(VN N (VCVCVNN CVN CV(VCVfVrr r
C
N M M MM M Metd'47~DCOt0n07O O NN N
Hr ~ O O O OO O OO O OO O O OO O O _
O O O OO O OO O OO O O OO O O OO O
O O O OO O OO O OO O O OO O O OO O
O O
O OO O OO O OO O O OO O O OO O
0 0 0 0o O o0 0 00 0 0 00 0 0 00 0
E o O o oO o 00 0 00 o O o0 0 o Oo 0
O O O ~- r r
N O COn n Ma0O OOD07<ttnInODO tnCON
.CO r ~ M~ n rN N 07a0(Dc0CDr n n CpO op
j
~ d'00~Yc0~ <td'd'd'NM d'd'~f7u7cO'~NN M
V
p (O00COf0C4COnd'N OM (OW hO IO00Or tn
N N N V'f0InO N O COD
~ et (hN, r Mr ~ C r
O O O OO M OO N OO M ~ OO M O OO O
O U
~ L ~ ~ ~ OO O OO ~ rr O M O0 r O rr O
c O ''O O 0
~ O O O OO O
O O O p O p p p OO p O OOO
c~O O
n N Net~ 00~ 00a000t1) lf~~ COc0a00~
~tr N rr O OO O MN O O rO O O MM O
V o 0 0 00 0 00 0 00 0 0 00 0 0 00 0
O CO MCOM N ODnn f0CO OJO nn'
7
t O r OO r OO r N T O OO O NN O
N r
U o 0 0 00 0 00 0 0r 0 0 00 r 0 00 0
0 0
I-Q U UU F-~UU'Q UfU-~ Q ~ U UC7C7
o U U Q Q Q C9UU C9
d
~ a ~ ~~ ~ ~Q ~ ~~ ~ ~ c~~ Q ~ aa H
N vtd'd't N d'Nd'd~ d'N N N a007N
IWC7t(74~Od'~ OO ~ ~.~I7d'd''d'~tf7V'
O O M MM M mN M ~M M~~ MN N N ~N N
p r M opof~ OD a0 CO~ o~ MM
N N N
L O ~ 0 o~O~ M ~N a~MO ~ M ~N 070
p ~ M a OO o NN O NN a M O_ N N NN N
0 O O O N
O O O
C~ ~ CDOJM MM M ~M M M.M M m MM M M MM M
r m OO O)rO O O7a7W O OO?W O)O7O m
Q1OO O W m W07O Om O W m07m
~ O ~ ~ M 0 0 0 ~~ 0
c N C Cb
0 O
~ M~ ~ NM M M~ M N ~M M M ~~ M
r CMMf=(~7 r M Mr M ('7 ~ r r r
0~0r 00~M 00MM ~ n~ ~ ~ MO W t000c0f0
N N ('~IM~c~?M ~N O p~~ O ~ MN ~ N NN N
d app Mo p M M Np M N 0M N M MM M
Ip7 O ~~ O ~O ~ mt ~ O a~ O d5OQ)C~3
r r r r r r
W 07O O7 W O W W W 0707O7
M O 00 MO lfj~ O
OO tn O OM O
M ~ ~~ n MM ~ ~ ~ ~ Mf''~~ ~ MM CM
1 M= r_s~ _ r f1 (~4pr r mm OD
r M O
N M M M ~ M ~N M ~ Nan0~ ~ 00N
L O 0 00~ p C 0 Cm p ' M D 0 CC
7 M a o ~V 0 V O M N C c VV N
r
O O O OW OO O
.T'r M M M O-. - ~M cn
p O d''d'd'_ r COr ~ of ch(flO r
n n M M O M ~ n O nO d'd' ~
r r =N NM T N CON r r r_N COr N
_ _ _ O~ O 00_ O ~~ _ ~ _O CO~ Or d'0
(DO O M r O
,.p N ~ N N NN N N N 00 M r N~ tn 00c0i
~ D ~ ~
O 00OJchM ~~ M N~ ~ ~ 00f~ NCVO>
r r r rO ~ rr ~ ~r r r r r OO r
c~ 03O O O Q1m
~-J J JJ J ~E-J ~~ J ~ J~-~-E-Q_'~ f--p
w ~ ~ ~~ ~ w W -w ~ ~w m w ~.i-w E-
z c~c~csc~c~~z c~xz c~o c~z z z ~~ z vo
147
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
f1 tn~ r tn O 00N M (O M NI~~ O O OJO ~
=
~y (DInO O M O M t0 f~O lf)!nV:N d:V' O COO l1~
O CVM r CYjr ~ r r O O r c-rM O N ~ rc'~c'j
j
N O N O O N ~ a007 00r a0r 1net r O
O
O O O d'O d'_ OJO N M MO tnO 00 N O
j O O O O O O O O r r O O OO M O O OO O
O O O O O O O O O O O O OO O O O OO O
~.UO
c
0 M ~t07N M O O O I~~tf~O O CO CO 00d'c0
~ O M h t!)N InN I~ M I~ O tnInN O CO r NN M ,
(/l
N N N ~ O ~ M r r ~ N r ~N N
N
N N r N r N
fl-t~07r t!)(.nCDO O N N N N COr O O O OO O
~
h t0r O O)O I~h ~ ~ InIn~td''d'd' V' d'M M
M CMM M N CVCVCV N N N CVCVN CVCV CV CVCVCV
d
H
N N 00 O r N N M M M M Md''d'd' d' d'~ Ln
O O O O p O O O O O O O OO O O O OO O
Y=~ j O O O O O O O O O O O O OO O O O OO O
,N d O O O O O O O O O O O O OO O O O OO O
O O O O O ~ O O O O O O OO O O O OO O
O O O O O O O O O O O O OO O O O OO O
E
y O O O O O O O O O O O OO O O O OO O
O O O O O ~ r r r r r r OO r r r r r
Z r r r r rr
N
~'
N d' M o O N O M d0r rV'N t~ M t(7N N
0
~..LOM In_ 00d:r O a0 O r Md'O 00 a0 rO M
U f~.coa0 <Yu7drd'to <YcM dv~ '~tcMCVc0 d' V'd'CV
~ 00r M Ind'r h 00 O ~f'I~'d'00V r r I ~ CO
0 t ' tl~~ N N N CO ~ NN
O O n d O O N N _ _ r
O O O lOO O O O O N O O MO O O CV OO CV
,
C r.COI~ 'd' ~ d'In O p (4COppV I~ N CO~ p
O O O r r r O ~-~- O O OO ~ O r OO O
a ~ 0 0 0 0 0 0 0 0 0 0 0 0 00 0 0 0 00 0
a
h h f~ M M I(7N (O O O a0O d'COr f~ <h 00COCO
O O O d:N M InO O r O O OO <tO r OO O
'
V o 0 0 0 0 0 0 0 0 0 0 0 00 0 0 0 00 0
r O O r 00 OpO N N r O CO N
"C N - O O O
~ O O O M M O r t O r M O N O
U o 0 0 0 0 0 0 0 0 0 0 0 00 0 0 0 00 0
C9C~C~ I-U U U C~ !- Q QI-U C9 ~H'~~ Q
~ ~ '
- U Q CJ U Q I-C9 Q U C9C~I-C9 U U
a~ t-C~~ Q U t- C~C9 I-U U UU U
C9U I- I- CJ (~
0 0 0 0 0 0 0 0 0 0 0 0 00 0 0 0 00 0
N ~ N ~ ~ O OO M N Ln ~07O
d ~ d ~ O ~ d O N M d' 00
' '
_M M _M d._ M_
~
~N ~ ~~~ O ~~~C~C N O~ p pr Od~N
'
~ ~ N t~ N N )N N N ~~ N O O dr
O N M
N ~ N ~ ~ ~ p N O O 4p00NCfl~ N 0r0pp~ O)
M r M r M N ~'M M M r ~-~ r M N rr r
I
~tM -d'COtn ~ d a0'~ ~ ~ NM r d' f~ ~I~OD
'
M M M ~ M '~d'N M ' M ' N MMrN M r Nr ~ ,
~ m OD0~0~ ~ 1 ~ ~'M ~ ~ i ~ OCOf~
~ M O h
r
r O CVM ~ N O M 07 O 07~r r O O ~~ r i
o ~ ~ o N
N ~ N O M '-O N ~ O o0~ N~O O N N O'O ~
M M r '~' r M M ~-.~- r r M N ~-r r
ctCO r ~ N ~ r M 00 ~ ~ V'O O r MV ~t
teO r r M M p~ r ~ N r~ ~
a N M \ ~_ ~
-
~ ~ M ~ ~ 0 O nO COc0 O ~~ O)
M O O
N O ~ l~ r N lfN . M a W tr tf~Ln O r~ ~ ~ ,
O '7~ - 0 r ~
r
07~ CD ~ , ~ N O> O M ~ a0a0p O)~ t~ q~'07O
00 N
N r r r r r r r M r r r r r r N rr r
'
U
~ I-~ 1- 1--~...~.~ M O r O
~ ~
= 21 1
1 1
Z ~ Z Z C~~ U Z C~U' z = ~~ Z Z
M
148
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
Q- 00NI~GOCON O d' O 00a0 1~00N ~h (D1~t~1~a0
~
COt(707COM t1)O ~ 07CDM 07CDM l0 COO 07(DO
j M d'r M r N fMr r-rr r CMr r r c-O O <-
O Od'N d'M W CO N d'OLC)M N ~ d'~ ~h
O O N
O O ~ O N d' r o N N a0M 00
O OO Q O O O O O OO O OO O O O r N O
j
0 00 0 0 0 0 0 0 00 0 00 0 0 0 0 0 0
"Q U
' N Nr N ~ ~ N N M ~p ~ Nt~ t0 M O IntnO
fr ~ o d _
.~!1 O, ,'
r' -J~N N~ N ~ ~ ~ ~ ~ O~ O Nm ~ m n ~ M r.
O N c
-
fl-~O ~hM 070 0 0 N N NN O tnO O 0 0 0 0 (0
M OO t~f~h I~In Inl(7tn d wt'd' V' Wit'M M M N
O rjMCVN CVN CVN N CVN CVCVCV (V CVN CVCVCV
~
j ~ ~~ ~ N N N M M MM M d'V' Wit'~ttf~tnLn(O
O OO O O O O O O OO O OO O O O O O O
>
p. 0 00 0 0 O O 0 0 0O 0 0O O O 0 0 0 O
~ ~ O OO O O O O O O OO O OO O O O O O O
".,
~ 'Q O OO O O O O O O OO O OO O O O O O O
~ E
o 00 0 0 0 0 0 0 00 0 00 0 0 0 0 0 0
5 O OO O r T T T r rT O OT t- r r O
C r r'T r r r
~ 0700InO COM 0~07 CONN COf0CO <- O O M LOh
.c ~-c~O~O d wnu7r M W - d;r r N c0d'O ~
~ '
U 1nd~td'M f~M d' f0ct~ ~ Mtt efiM chN GOcrJ
~
O a-MN O O ~ a0c- In<!'O 00d't~ OO N O InI O ',
~ ~
~ N ~~ h;~ ~ M N N ~ N00 ~ 1~COCO_ (O
U O G1O r O O O N O OO M Or O r O O CVO
~ '
C c0MM M N a0N p a0CON p~d' d' O M
-
~ O rr r r O r O ON O O c O O O
OO O O O O OO O O
O p p p p p p
: s
a
ODa0t~~DM O~COO r 07O? V'(OCO c0 tnN SOf0M
O MM N V O M r- r ON O ON o N ~ V M ~
o 00 0 0 0 0 0 0 00 0 00 0 0 0 0 0
V 0
N ~M r r ~ O M Nh M rN d' (OO o In
O NN 'd'M O N N O OO r Od: ~t M M M l1)
-
U o 00 0 cio 0 0 0 00 0 00 0 0 0 0 0 0
T
o Q U C9U U U Q U Q C9C9 U C9I-I-C9U
~ ~ 9 Q C~
U I-C~I- C U C V-I- Q C9 f-Q
Z
,. d'
0 00 0 0 0 0 0 0 00 0 00 0 0 0 0 0 0
m
M
O OO O O O O O O OO O OO ' 'OO O O O
O
M M M _
N M 0N M M N'O X 0 0O N 0 ~ r
a _ a d _ 0~ O d'
0 O 0 ~
07 ~ N ~ ~M C~N~~ p ~N .iMt ~ N M I',
'' r 'ON r N O~N O~ N NOM N ~~m m~ N N ~ ~M
r CV
~ ~ o ~ ~ N O O a0a0N ON O p ~ 00O ,
N~ M N M r-rM ~ rM M ~ ~- N
O O O
'd'N d'a-d' 00 d~N~ d'N ltdO O O ~ O
.~..' L N CON N ehO ~ M NC~ N ~p M N ~ ~ha CO
m ' ~ ~ ~
~~ ~ ~ O ~ M M ~p ~ ~O M O o ll~0 l O
CO p 00 O 0
~ Wp'~ ~ N O ~ _ ON _ O M O N ~ N N cc3
r 0 of
r m - r M a G rM r N r ~ r-~
r r
~.
U i
c fn:~D fn~".F-m _I Z D ~~ J ~ N 1-Z ~ O
N LLN~ u..UJlJJN ~ ~ ~ L~h- ~ ~-a LLI~ p
h h
_ _ _
o ~ z z ~ c~ ,r,~n~ o ~~ ~ v ~ z ~ v
~
N w h
149
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
"_. cfi M O M r O '~ LO LO C '<f' r M N O r N O CO 0p ~ M r M
L C O O O O O O O M 00 O O O O O O O O 00 00 N O O O O
O
U
E
o c~ o co o cfl I~ co N o o~ ~ ao r~ o ao r~ ao r~ co 0 0> ao o~
p d' M M M ~t M M M M V' M M M M ct M M M M M ~t M M M
r 't'~ r r r r r r r r r r r r r r r r r r r r r r
M(O~d'~. ~d'N~~r'ct'~N NO~ t~OraO OVMM LOGO000
(p 00 O O: O M f~ r' 0.;. r N O N ~ t() r M Cfl ~ N O N I~ M CO
0 0 0 0~ 0 0 0 0~ 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
O
'- (p O r Op CO r (p 1(~ O O M I~ N ~ O N If) Lf~ N d' CO In CO f~
.C ~ M I~ ~ LC> ~ CO ~Y N M O ~ I~ r O 'cY ~ f~ N O r 1~ tn 00 ~
U O Lp LO (O r O M CO ~ N d' N r r ~ r O r N O N O r O
O
N 1~ O N tn M r (O (fl r tv 00 O O Cfl f3~ LO N M N O LO O Ln O
N O 'ct N ~- N ~ r M r M N O d: N r l0 N M d: r M N c'7, r
O O O O O O O O O O O O O O O O O O O O O O O O
Q3
~U
O LO f~ r M M N I~ r 00 N O CO ~ O CO 00 O CO 'd' O O? f~ N d'
j ~ ~ d: ~t lid ~ ~ d; tf7 In ~ cO CO CO ~1; ~ In M ~ C; d: ~t d; ~ C: ~
~ p o 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 o a o
L U
O N M I~ N 'd' 1~ ~ M r r M d' Lt7 d' t0 I~ 00 r O O CO N M h
r' ~rN~h' NrNr~ OOM rNNO NNOIn rMNM
O r O O O O O O O O O O O O O O O O O O O O O O O O
p
p
U
00 07 ~ d' O In CO ~ N CO r r CO r d' d' 00 00 ~ O Lf~ 'd' h. O
N O N r N N d; N ~ r ct d' O C~7 C~7 N CD r N C~') O d: N M r
O O O O O O O O O O O O O O O O O O O O O O O O
r I~ l0 O d' N I~ 00 d' <t tn N cf O r N lI~ d' ~ r ~ CO W O
m N ~t d' ~ tn <t ~h wt M M LO t0 f~ rf ~ d' M tn ~ ~ ~t M dwt tO
O r O O O O O O O O O O O O O O O O O O O O O O O O
- U
--~ r~r..CO I~MI~OM O~CO OOd'~ 000(00 fflOCON
~ r LC~ N d: N N r N O In O O N N r M O N r t- In r M r M
.-N r 0000 00000 000 0000 0000 0000
~t ; ~, ;,,.
O r N r ~-! M 'd' M N ~p y r r N M I~ O W O 1~ O I~ 'cY LI~
!~ D O O~ f~ 'ct M~. O N N r M M M I~ r N Iw O 00 M ~ M Cfl
O O ;,0, CY', O O Oy O. O O O O O O O O O O O O O O O O
p O .
~ 00 M M N r d' O O) ~i' Cfl N 'V' O N M In (~ d' M CO N O r
1~ O V r CO ~ l1) N N 00 O O O r ~ r O O O O In ~ N
U o ~ ui cO 0 0 0 ~ci ~ ~ ~ .= ~ ~ o r o o c~i o ~ 0 0 0
U
L
r O O I' N M r 00 tf~ 00 tn N Op I~ 00 O M (O M d' r O 'O CO d' O
_N ~ f~ M lf~ GD L(7 M !f7 M CD M M CD M d; t() N ~l7 ~ M 1~ <t' in ~ tn
O p O O O O O O O O O O O O O O O O O O O O O O O O
Q U
N N 40 d' r O ~ r Op O h N N N 'd' LO O LO Cfl O t- CO M O CO
' t/~ I~ d' CO t0 ~ M LO N t~ N M CO 'vt 'V' tn N ~LO ~h M N M L(7 M ~f7
U O O O O O O O O O O O O O O O O O O O O O O O O
N
~ H I-- I-- E- U' U' F- I-- I-- f- U' U' U' U' F- U' C~ C~ U' F- I- E- I-- U'
,
' Q
r
_~ U U U U Q Q U U C9 U Q U Q Q U Q U Q Q U U U U Q
Q
f~ h tp Il~ 00 tn N 00 r O (O O N O M In CO r CO
O r Lf~ r M t() O O LO O ~ O d' N M Op Q O M CO 00 I~ f~ O
s- N ~- I' N N d' M r N O M d' N N N <h , d' r ~ '~- r M N
. p , , , , , , , , , , , , , , , , M , , , , , , ,
.Y O f~ O d' O r M r M N O CO 00 r I~ O M M N LO l0 O h LO
O O r M CO h f~ 00 O N M O 00 O O L(> ~ CO M M I~ 00 d' ~
N c- r r r r r r ~ [~ M O O O LO , LO I~ f~ 00 N ~ h
l~ 1' c0 N o0 00 00 N N c0 N N f~ I~ I~ !~ r i~ c0 c0 t' l~ c0 c0
N N N N N N N M M N N M N N N N M N N N N N N N
, , , , , , , , , , , , , , , , , , , , , , , ,
O O O O O O O O O O O O O O O O O O O O O O O O
W O O O O O O O O O O O O O O O r O O W O O O O
Q Q Q r r r r N N N N
~ ~ r~ ~ ~ c~ ~ rr ~ z z z ~ ~
C7 f-- H H H- H N H H H ~ ~ ~ ~ t~ u. t~ ~ ~ ~ ~ u. ~ ~
~uzo~ ~~~~~ UUU UUUU ~~~~ UUUU
150
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
M m W f' d' M O M ~ CO d' 'cf'
'ch d~ N r d' d'
~ ~ M ~ ~
C O)00 00 O O O CA p ~ O O
O O O O p 00 O
00
r
r r r r r r r
a~ U
E
O
~ O O ~ O O O OO ~ O M ~ N c0 N O O O
O O O O t~ lf~ O
M d'Md'd'd'd'd'MM~ rNrrNNrrr 'ct~'d'
r r r r r r r r M M M M M M M r r r
r r r M M r
O
N M ~ O ~ 00 (O ~ O O N OW ~ O O~ CO
OW ~ O I~ N t~ N ~t
00r N r tn I' ~ 00 In CO r O r O r d
d: r N I~ ~ N lf) 00
O O O O O O O O O O O O O O O O O O
O O O O O O
O
' O d' Ln r O o0 N r ~ M f~ N M <'- ~
op r O I~ N N N Cfl d'
L N O f~. ffl In O M ~t I' N 1~ In Op Cfl
~ r ~ d- r Ln O O r Is C'~
U O ~h N ~ r O O M O r O d' ~ C'O ~ M r
r M O O Ch r O
N M NrOhInO Or000 I~~NLf~~'d'.LC700~f'OMN
N O CO r O N N N N M N ~t7 r Cfl ~ r t()
d: r CO ~ N O N
O O O O O O O O O O O O O O O O O O
~ O O O O O O
U !O
_
O
.,'r O I~ 00 ~ d' ~ M N O~ CO O d' r I~ M
O O c1' r (fl h f~ M N
N M N M CD M N N '~t ~ ~ 'd M wt M ~t Lf~
d: ~ N d' Ln ~t ~t
U r o 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
0 0 0 0 0 0
,
O O r r Cp M CO d' r ~ O O h N ~ r M d'
Lf) CD r ~ 'd' O t0
r M I~ O r I(7 ~ lf~ N r M O M O O O N O
r r M M r r ~ N
", O O O O O O O O O O O O O O O O O O
O O O O O O
O
C
O ~ CO CO CL~ f~ O CO ~ O CO O M CO O M
U ~ r CO f~ ~ Lf~ d' r M
'
N N O lf~ r r N M N M r d' O CO In N tn
O CO N ~ d: M r N
O O O O O O O O O O O O O O O O O O
O O O O O O
'
~"'d' O r O CO CO r f~ !~ CO 1' Cfl CO
00 CO o Cn M 00 O N O
O
~ M M tn M N N M ~ d: d: '~t ~ M d: M
M ~t N M d' d; 'd:
U o 0 0 0 0 0 0 0 ci o 0 0 0 0 0 0 0 0 .,r
0 0 o 0 0 ,o
o
Pa
r1 ' Lt7O d' M I~ CO ~t M O ~ O d' LO I~ d'
r CO M CD I~ 00 I' O O
M Ln O N Ct7 ~l7 tn N r M O d: O O O N O W
r M M r r ~ CV
O O O O O O O O O O O O O O O O O O ~
O O O O O O
O : .fl
~ ~
O N OO I~ Op CO O N f~ OO Ln N M N ~ ,
r 00 h Cfl d', 00 N If) M O
<h
CDO i0 ~ P') Cfl O Cfl Lf~ M r O' Ch M Lt7 E"~
N M ~Y Ct C'~ 07 CO ~ 1~
0'00000.0 Or00 00000:0000 0000 -
"""., _.".",", ,
N O
ti'O I~ O Cfl O O N In N 00 00 Lf~ 00 Cfl
O t In CO ~ f~ r ~ N r I~
~
N r r O f~ r O tn N M f~ O M f~ f~ O Ch
In t~ t17 O O CO O
t o 0 0
o 0 o r o 0 0 0 0 0
~ 0 0 o c~i ~f o 0 0 0
0
a~
L
r O COd' O CO OD I~ 1' O 'd' f' r N N CD
' M If> M N 1~ O r M r N
N ~-~ 00 N 'ct CO CO ~ ~ ~ N CO r M N ~ N
~ I' M CO In N d: I~ tn
_ p 0 0 0 0 0 0.0 0 0 0 0 0 0 0 0 0 0 0
O 0 0 0 0 0 0
Q U
(pf0 O M GD O f~ Gn M f~ r 07 r Lf7 CO
O O O7 O r N -M O7 M
l!7f~ r ~ f~ f~ CO ~1' ~Y lf> M CO N ~ N
M ~I7 'd' N M ~t Cfl t17
M
U
O O O O O O O O O O O O O O O O O O
O O O O O O
C7 1- f- C9 C9 I- I- I- I- C7 U C~ C7 C9 C9 U I- I- I- I- C9 I- C9 I-
Q
r
Q U C9 Q Q U Q C7 U Q Q Q Q Q U Q U U C9 U Q U Q CJ
Q
'ct d' 00 M O O V N tn M N r_ r O_
(p In O r r
M M r M N M M M N M M M M O~O N
O ~ ~ ~ y. 00 tn O ~ O ~ ~ ~ ~ (fl M N ~ ~ ~ ~ i
L M O LC~ N ~ f~ O N 00 r N ~ r r 00 M O N ~ r r r r r
LC> lD N O r r M O N i N Cfl N ~l' r M M O M O I' O CO
Op 00 ~ O i i n r In O M I' O r r ~ n n O r f~ f~ ~ M
O D 00 N O r O~ , r Cfl M 00 N N N 00 O CO N N 00 00 00 N
M M N M N M M N N N r N M M M N N <h M M N N N M
~ i ~ i ~ ~ ~ ~ i ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ i
O O O O O O M O O O M O O O O O O O O m O O O O
O O O O r r r r r O r 07 O O O r r r O O O O O O
O ~ ~ ~ ~ r r r r
J J J J J J J O O O O /- ~-- f-. ~- ~-- f.- f..- ~-. ~ U U U U
z z z z z z z z z ta- W.a- ~
151
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
~r ~t d- ~
0 0 0 0
0 0 0 0
<t:
0 0
N
M M
d' ~ In N
CO 1~ O O
O ~t M s-
O O O O
I~ O O M
~1' LI7 CO ~
O O O O
I~ M r- 00
~t O ~- N
O O O O
~ N N d'
~- c0 d' N
O O O O
N O d' N
tY N <t ~'
O O O O
M W ~t 'V'
cr O ~- M
O O O O
f0 N O M
e- N M O
O O O O
O O O ~
O d' O O
r- ~- r O
O 00 O <t
~ N d' ~
O O O O
~Y M CD 47
CO N M ~
O O O O
aaa~
N <t
N
~ M O O
~ d' M
~ O N M
r
00 00 O O
M M M M
D O O D
D D D D
152
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
d' d' dwt ~ ~ ~t M M N M M N ~ M O d'
O O O O O O O O O O O O M M ~ M ~
r r r r ~
O O O O O ~ ~ 00 Ln ~ r r N 07
O O O
d' ~ d' 'd' M M M M N N e- O r
'cf' d' ~ d'
r r r r r r r r r N M M M M
r r r
4
Cfl00 ''N,OOr ~ap~~M rrM~ILO~iIf)
O I~ ; .p'' d: ~ C'~ r r N.~'O: CV
C'~ N O Ch N CO
000 -:.;0000 00000 000:Ø.0
M CO M O O lO O OWE t(7 lf~ u'7 d' a0
o0 I' d'
I' d' I~ r 00 CO In r M d' ~ r I~
00 M 00 ~
lIj I~ c'~ r O N N d' d' N CO N '
O t- ~ N O
M O fw r O N O N r p N f~ 00 OO
r O tW
N h r N r I' r ~ r r r N O O
O N N
O O O O O O O O O O O O O O
O O O
~ O M W t V tn d' M N t~ 00 tn
M rh N CO
r r (fl In N ~ N ~ d' d' d' M d'
in tt7 ~L7
O O O O O O O O O O O O O O
O O O
N N O O h dW O ~Y r L(~ ~ ~ t~
c0 cfl a~ f~
M O N N N O N O M ~ ~ N ~ d'
M N r
O O O O O O O O O O O O O O
O O O
ft' ~ ~t N ~t O N o0 O I~ Cfl M M
u7 00 O
N
M I~ N N M (O N CO O O N O r
O N O N
000 0000 0000 aoooo
I' M d" I' r O N M I~ Op LC~ I~ 'd'
~ d' lf~ O
~f' ~ 'd' M ~ M d' ti' d' lt7 M d'
N r d' 'cY LI7
O O O O O O O O O O O O O O
O O O
~ O N N N O M O ~ 0
~ ~ ~ N
~
M N c
0
O O O O O O O O O O O O O O
O O O
N tn f' I~ d- CO ~ M d' r CO t(
(O O N N O
0.Ln CD tf~ N N r r r V In O r
r O In I~
O O O O O O O O O O O O O O
O O O
(p LC> 00 N O O O I~ r ~ O M N 1.t7
r r [v
'
QO M r M 00 'd' O O N CD d' ~ O
O ~t d' O
Ln O O O N ~- O N N fV O O M CV
N O O
~ N N O ~t Cfl M CO M CO O M O
M M M LI~
In r Ln d' r Ln r Cfl CO (O
~ In Lf~ ~
O O O O O O O O O O O O O O
O O O
M 'd' Wit' N r Lf) N 00 O f~ 00 Ln
O CO O O CO
d' r lf~ tn N Lf~ N c0 CO d' (~ CO
o0 <f' Lf7 f~ ~t
O O O O O O O O O O O O O GO
O O O
N
C9 F- t- C~ C9 C9 U I- I- I- I- CJ
F- C9 f- t- I-
Q
r
Q U U Q Q Q Q Q U U U U U Q
U C9 U
a
O O O N O t~ lf~
r
00 f~ M ~ O 00 d' Ln N I~ CO O
r ~ Cfl CO
r N r N M N O I~ 00 CO CO N M
~ M Ltd 1 1 1
l I 1 1 1 '
I 1
d' ~t ~t o0 N ~ r C(7
I~ N CO r N r I ~ M a0
I I I 1
I
Lf~ p) O ~ r M d' ~ N ~1 Ln tn 00
r r Op N
N N r r N N N N N ~ O M M M
N r N I 1 I 1
1 I 1 1 I I
I I
N O 1 I I 1 I
O a0 00 CO CO CO O O 00 00 00
r r 00 OO c0 c0 r r r r r
r r r r r r r r
r r
M
M M ~. N N N N
N
C7 ~ ~ Z Z ~ ~ ~ ~ .Q .a .fl .n ~
~ ~
U U mmn ~ D O O O C~ C9 C9 C9 C9
U D
153
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
o M CO f~ ~ r Wit' ~' 'd'
~ ~ o ~ ~ 0 0 0 0
r r r r r
00 r r (p N O O
(p I~
r r N r M ~ V'
O M
M M M M r r r
M r
~, ~O M r r M
~Y O
O: O' O M r Ln
N ~h' d'
O~.O'000 000 O
N r O N ~ M W
M d'
O CO I~ M ~' O
W CO 00
00 Is Ln N d' r
CV r r
O I~ O r a0 d'
O O) CO
r ~ O r O r M
N f~
O O OO O O O O
O
h M M 07 N f~ CD
O r
d' d' ~t M ~ ~
d' ~ N
O O O O O O O
O O
M O CO O O O t1~
N ~ M
~ O cf' CO N r
~ M O
O O O O O O O
O O
,~' OOCflMfOLnNOO f~
r M r r r N M
r 1~
p ' O O O' O O O
O O O
O 00 O r f' ~f
N r I'
Lf~ V ~ M Cf In
Lf~ In r
O O O O O O O
O O
H
y N CO f~ r (p r
~ M Cp
i..M r M M Ll7 C'~
M r f~
.QO O O O O O O
O O
C~
0',:0 O~ O O O
O O O
N CO 07 I~ N d'
h O) N
CO CO N CO O r
f~ I~ r
M I~ l!~ N O O
N O O
CO r O ~- (D I~
ffl 00 'cY
CO M f~ I~ Lf7
CO In M r
O O O O O O O
O O
h O N ~ O~ 00
O CO
!n d' CD CD L!>
~ in M r
O O O O O O O
O O
C~ t- I- I- C7 U I- C9 U
d U U U U d U d d
r
N
CO M M CO
r
00 ' d' I~
V ~ 'ct r
V
07 M M r- d'
~ ~ 07
ch
M d O
t~ N ~ ~n c
o~ ' O N
d
'
r CO r N N
r ~ r
N
~3 ~ CO ~ 00
~ ~ 00
'~'
r ~ r r r
r ~ r
N
U
r r r r r N
~HH
154
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
' O1~f~W O ~ O~ N O O tl~N~tr (ph(Od'
Q- 'd'd'r eDcOc0~~Y'd't O t0COM r t~~tnV' d'
N
O) NN N r r r c-r-r e C'M N CVCVN r c-r-r r
~ ~-
O
(9
i
>
N
MM 1~M O M N~ 00O r r Ntno0I'f~I~f~ O
> OO O N N MM M ~h O O OO O r NN M M
OO O O O O OO O O O O OO O O OO O O
OO O O O O OO O O O O OO O O OO O O
rN N N N N M N
Intntf) r tn r O r
Mr ~ O M r M M M
~ ~ = ~
O M Nu r
M M
N N N N Mr O r
..
.Y Nd~~Yd~N dWON N N
'- CO~ lON cMtnd'M M M
W
r N Nr r N N
a u m ~nu~~ r ~n
COCflM N M (O r M M M r
M d.d'' tnCO' CON (Oc0 d' ~ ' ' N' c0 t
MM N M MN M N M O
L M M ~ M ~ hM M M ~ .
fl N MM ~(JOD'-~ '-cir M N N~ Ln MN i In
>, .Y d"d'N O oDN Opc0Op~ d" chd'N N N c0'd'00 tn
N cD N CON~tN N C 117~c0COM ettnN M
~ N ~ V ,
V ~ ~ ~ ~~ 0 ~ m 0~ ~ ~ ~ ~
0
Q ~ NV'O M r O rr 7 r V' O 7W O W ~O 0
N r r N O r r r ,
(B
O
N N N O N N
d d V '
0 ' ~ - CVM ~ ~ d
N. N
d'~hV'c~. O d. d' d' cpM
N ~ 7 _ ci O I~c' M N
~~~ ~~ - ~ N Nr N C ~ ~ M M ~ m O
O n c d' M n O Mi M Inr
n
~ O~ O~O N d'N00N N ~ OWhO W a0O~N N
t 0
v rr r r M N MN M M CVr CVN N(OM
OO O 0 0 ' Om O o O ~ 'o ' o Oo 7
o
o
~~ ~ 0 ~ d ~ ~ ~ ~ ~1~ d ~ ~~ ~
rr r O N Or O O r r Nr N r rO ~
O r
O OO O O O O
~ CM MM M M M M
MM ~ M M M MM M OM N
L 0000OOM ~ Op~ 00 0000Op00~ 00~ CO
N ir ~ COO i OCOCOOp r i ~i ~ O r O
O O [~
.Y !~1~f~07N f~.NN N 00 fs f~t~f~h-N ~!sN CJ
rr r M r MM M N r r r M Nr M tn
'
m~ 0 ~ 6 0 7 ~ ~ ~ ,
~ 0 07 7~ 7 ~ 0 O ~ O~ W ~
rr e-r O r OO O O r r rr r O rr O r
O
i
O 00d'I~ 00 00 (~COh O O07I~
O
d't(7LnV O d'OOM Inf0 lf~ COlf~COLt~O h~ t17 (p
U ~ r~ r~r ao
rr r r ~ ~ r r rr r ~ rr ao r
U
O 00f~ChO M M ON r h N rM N N OI~O
' ~ 1~
a01~h d O a0O)O O O o0OO)O O Oa0_
Q NN N r N N NN N N N N NN M M MN O
M N
r r r UJ r r r
Z c~ cn ~ c~H-~ I-f- z c~ t~tOc~~ ~ ~-cy- N
= LLIu-LIJW W LIJW ~- ttl1.LLIt~ ~~-W .Q
~
W n Z S ZZ Z Z U' ~ ~~ ~SZ Z~ ZU
~
O O
M d'InCO1~00O r M lf~CDf~a007 r
155
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
~ r
CV CV CV N r r r r r r
r WoONN~d'IOtOM
0 0 0 0 o O o 0 o O
O o O o o O o O o O
O N r ' a0
N
O M ~~ N
CO 6 O 47 .
7
~t<Yr ~ 07N c~O O
M 00~ M h~ O M M . ,
ic'~r d.O NO N o0
N M ~ CNO~N M N M
ON ~ ~ ~ ~~ ~ ~ 00
N
M O
r r ~ [v
o00a~00 cNOa00'~(O~ MN
O o0
r 0
W~ a0aDf~I~ N a
0 ~
rr N t0r rInM r M
07~ ~ ~ ~r m ~ OO
e-r O r r r00O r r
ODO O m 00 00
t~CON ofCOOd W d~ CO
fl
r-r o0r r O h O> ~-
MN COCOf~COO M O 'd'
Or M N O O~'M 'd'O
MM r N M Nr <-r N
z U7fn~ ",~''fnfnQ ~ ~ .'~
U-LI'~ ~ LLLI-~ ~ ~ ,
U' ~~ ~ U'~ ~D ~ ~U'
O
N a0 O r
156
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
mnroooorco~lf~LO d'CONMMO(OLn
V M r 00 00 00 L(> ~ tn ' O M 00 f~ d: M f~ Ln CO 00
O r r O O r O r O r r O r O r O O r O O
O tI] QO W O M ~i' d' M ~ O Lf7 In M tf~ 00 d' CO N N O
CO d' t~ lO tn r M I' O dWO h t~ M CD M M r d'
M O O r r O M O N O O r O r O <t r O N r
O O O O O O O O O O O O O O O O O O O O
1~ tI~ N N N N 00 O lO N N Ln d' ~ r r O I~ h CO
In tn tn In (f7 In M M N N N r r r r r r O O O
CV CV N N N N N CV NI N CV CV CV N CV N CV N (V CV
M M M M M M et LO (O CD CO h. P f~ N OJ N O m O
O O O O O O O O O O O O O O O O O O O O
O O O O O O O O O O O O O O O O O O O O
O O O O O O O O O O O O O O O O O O O O -
O O O O O O O O O O O O O O O O O O O O
'Q O ' O O O O O O O O O O O O O O O O O O O
O O O O O O O O O O O O O O O O O O O O
O O r r r r r r tf~ r r I,n In r Ln Lf~ In L(7 In L(~
C r r
N O T ~ N ~ (D O O ~ In O r m O N M ~h CD O M .
'- M ~ OD ~ N ~t O ~ M N ~ 00 N N r, 00 O h M
7 ~ O ~ O d) 00 d0 N ~ O O ~ O ~ ~ O r r r r
U cn
U N O O O p~ (~ O r LO p~ ~p N r O r p r0
C r O O O O r r O O O r r O r O r
.O O O O O O~ O O O O O
a -°
.,=r I~ N N _d' Lf) 00 a0 00 ~ In r O (O In O M O O N r
r N r O O O M O O O M N r N O N M N N
C O O O O O O O O O O O O O O O O O O O O
SW W U
H
CO r M t0 M N 0D ~ N d' (O 00 CO CO OD r fv 0D r r
,ti ~ O r O O r O r N O r O r r O r r r r r
O ,+0i ~ 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
N . U
at G~
Ei E~ ~ U Q U Q Q ~ Q U ~ ~ Q ~ Q U U H ~ U U
z a ~ ~ ~ ~ ~ ~ ~ a ~ ~ ~ a ~ ~ a ~ ~ ~ a
0
d' d' d' eh d' N N ~ M d' M M
Lf7 tn In LO LO O r O lO O O
M M M M O M ~ M M M M M M
M M M M M r ~ t~ ~ M M ~ ~ N N N M
M Ln In tn tn It~ 00 M ~ CD In Cfl CO M M M r
CO N c0 W N N c0 ~ O r OD O O
a0 O O O O 'ch O N N O M N OD O N N f0 CO c0 a0
M M M M M N M M M M M M N M M M et ~d' ~ N
QO 67 ~ m ~ 00 ~ ~ 07 ~ ~ ~ O ~ ~ ~ ~ ~ m
r O O O O r O O O O O O r O O O r r r r
0 d' d' tn V N I_O
00 lL) M In tn IN ~ M N ~ N N N lO CO M M CD (D c'
M r M ~ M M ~ ~ ~ M ~ ~ M N M ~ M M r r ~
r OO O 00 00 O O aD (O O d' CO N 4O a0 ~ ~ 00 OJ N
MMMfi7MrMN<YMNd'Mf~7NNNCVNM
00 00 ~ 00 00 OD ~ m ~ ~ ~ ~ 07 00 O ~ O O ~ ~
r O r r r O7 O O O r O r r r r r r O
M OO In d' M_ N ~ N tn d'
In O wt <I' O
M O 'd' M M M N M N M M
N O ~ M r m~- ~ 1~ d' M ~ M CO O N d' M N d' CO
O i , , d' r , O O r r r O
N r 00 r r O r 00 N 00 M QO N N N N o0 N N N
M M M M M r M N M M W N M M M M N M M M
~ OD OD OD ~ 00 OD ~ ~ ~ r 07 ~ ~ p ~ O 07 ~ 07
~2 07 r r r r r r O O r Op r W O O O r O O m
M M M In N d' O d' d' d' d' ~t O
r r OD ~ O O O O O O O O
M M M r N M M M M M M M M
N N M N ~ r ~ p r ~ ~ ~= ~ r= c~-
r r O O O O N r (O 00 (fl (O CO CO (O ~D
, , O O (O O r , N O h r O O O O O f~~
O O O N N a0 N a0 N r N a0 O N N N N N a0
N N N M M r M N M M tfj M N N M M M M M N
4O M M m ~ OD m ~ ~ OD r 07 m OD ~ ~ ~ ~ d7 m
r r r O O r O O m r 00 O O r O O O O O O
M
C J J J J J ~ J ~ ~--. J O ~-- f- J /- /- f-.
c~ ~ ~ c~.~ ~ ~ ~ ~ ~zn z ~ o z z ~ z z z z z z
N M d' IA (O t~ a0 O ~r r ~ r ~ ~ ~ ~ ~ N
157
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
r dW O O M CO In r N N O 00 N 00 O~ M OJ r In (O
M M M O N O tn lf~ d' Cfl O Cfl d' M M M N (O N V'
r CV r M O O r r N c- r O O ~- r s~ O r r
LO O d' O O r M M d' O 00 N aD N <1' ~ ~ In CO 'd'
O O O O r r O O O O O O M e1- O O O N O O
O O O O O O O O O O O O O O O O O O O O
a0 O O N N N N N c0 c0 O O tW t N a_0 4_~ tn O O_
W a0 I~ tn tf~ tn tn ~ d' M V' d' N N N r r
N CV CV CV CV N N CV N CV N CV CV N CV CV CV CV N CV
r N N M M M M M M d' dW t CO CO CO ~ W fv 00 a0
c6 O O O O O O O O O O O O O O O O 4 O O O
.~7 > O O O O O O O O O O O O O O O O O O O O
E O O O O O O O O O O O O O O O O O O O O
O O O O O O O O O O O O O O O O O O O O O
O O O O O O O O O O O O O O O O O O O O
7 O 47 r In r r r r O ~f7 r r tn I17 In r r r r
C
OaNO000~rC~Oc~-NCNO~COONMNd'd.W'oD~
~ a~ Qi 00 N aO ~ 00 ~ m 00 ~ ~ CO r, ~ r a0
U cn
U r d' T O O O M M a0 M N M 00 O N N r O ~
C r O O O p O r O O O r r O O
rd ~ OOOOOO~~OO, 00, O~OOOOpO
U
N p M ~ N ~h O O 00 O d' <Y st 00 M O c0 O a0. OD tn Lt)
N O In N O r O O O O r O O M M N M r O O
O O O O O O O O O O O O O O O O O O O O '.
W U
CCl G~ U r 0O d' 00 O N N r CO N r r o0 1~ I~ !~
U r O M M O O r O N O r N d; r N O , O
O O O O OO O O O O O O O O O O O O O O
N
O
U U U ~ H I- Q ~ Q C9 I- Q I- i- U I- U Q H U
Ua' QQ~U~' la-UU' UU' QU~Q~C~.7CU7QUU' HU
~i ,
e~
~t ~Y d' N _u') N d~ O~
M M CO M M O O m r N O ~ M O
01 M M M M M N O ~ M O O -O N r ~ M O
M In M W n lO i ~ h M n n OJ In O
00 tn t~ M 00 00 N N O N r N M c; ~ M r M M ~,.~ ,
O N d' O O Wt V d"cf' a0 V 07 O CD N a0 O N
M CO N CV M M N N N ~I7 N N N N N st M M M M
m O ~I' ~ O a0 00 ~ m O GO W ~ O 07 07 a0 ~
O W r N O O r r m O p r r r r r p r m O
d' N t~ tU
M r O In
O ('M O N CO r N M O fM M
In ~h h d' 00 M 4'7 'cf' ' ll~ CO f~ CO 00 In
N O I~ N r. 1~ ~ ~ N N M 0 N ,d M N M ~ ~ W ~ '
M W_d' r i 00 d' a0 ~' M N a0 r d_' '- r ~ M Iv
00 O ~ O O O M d' t~, O N OD a0 00 a0 00
M r N r M M ~ m CV N r M N N N N M M N
00 ~ O ~ OD 07 00 OD i d' m OD ~ ~ O ~ ~ 00 GO m
r r r r r O r r 00 N O r O r r r O r r O ,
M t' d' Ln d' 00 M
r O O O In O
O M at N O M M O M H' M O
'd' 00 00 N ' 00 O O a0 ' M ' 07 ~ ' 00 '
I~ 00 00 0 f~ M M CO 00 ~ r ~ ~ i' (r0 M O ~ N
r ~ '~' r O i CO CO N i 'd' O 'd' O r O _i I~
O f~, 1f7 h N r CO M i 1~ f~ 07 N N 117 N c0 N N
N r N ~ M M ~ ~ In ~ N M M CV M N M M CV
a0 ~ N O O) a0 00 a0 '- O 07 a0 ~ ~ N 07 ~ O) 00 67
r r r r O r r r ~ r O r O O r O O O r O
_ _ _ a
C Cn M fn .J -I 0 ~ ~ f- 1- M I- ~ ,-I _I IY
~ o ~ ~ ~~n z z ~ z ~ ~ ~ v
NM u~.cO...ha00)~.r-~~r~~~~~N
I58
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
N N h d' N d- O 00 N r_ h N dW O h h CO N
O O 00 ~ O ~ 00 (O M 00 N (O c0 O CO O wt ~ N
J CV CV r r CV r r r N ~ r r ~- r O r r r r
O
T
d' N O (O r N 00 ~1' tn M N ~ d' d' O M CO
O O O N N V O r N N 07 OJ M O O
O O O O O O O O O O O O O O O N O O
O O O O O O O O O O O O ' O O O O O O O O
NNMd~NNNNN~0000000tONNN
N O d) h tn tn ~ In ~ d' V 'd' d- V' M M N N N N
M N CV CV CV CV N CV CV N CV N N CV N N N N N CV
O j
O N N N M M M M M M M d' 'd' d' ~ ~ CO CO (O (O
(D O O O O O O O O O O O O O O O O O O O O
~ > O O O O O O O O O O O O O O O O O O O O
O O O O O O O O O O O O O O O O O O O O
~ N
O O O O O O O O O O O O O O O O O O O O
C~ E o °o °o °o °o o °o °o
°o °o °o °o °o °o °o
°o o °o °o °o
o ~o u~ o m ~ r <- r .- m o .- r .- .- r o m ~ r
r r r
O dp.' r O N O M ~ N M M M N O h tn = d'
O a0 M 00 . M N M M O m 'd' CO
4j O O7 00 ~ d) ~ O O pp a0 CO h of h m ~ CO
U
H o
O O ~ ~ ~ ~ o ° o o N d' °~ 'r ~ ; r T' ~ ~ o
N ~ r o o r-
0 0 0 o Q o q o 0 0 0 o Q o 0 0 0 0 0 0
~ V~ N
a W
EI E ~ p ' ~ tO O r O d) 'ch 00 OD ~ N CO M h N d'
N N M O O ~- r O N O O N ~ N ~ M ~ N O sh
O O O O O O O O O O O O O O O O O O O O
.,.H
h ao M <t N O M N h c0 M N d' c0 a~ ~ h_ N N
M M N d: O N O O O O r V d' M M Ln 'd: O M
U o 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
~r o
~I o
U I- Q U 1- Q (9 U CJ I- U U U Q
O ~ Q Q ~ C9 ~ U U C9 t- Q CJ Q ~ Q C~ U
~r o~ o ~r r
ao W n o ao mn oo mn
dC0'.V'NM~C~'' 00,00' NNcM'ct~M_MOOI~
W O (O M 00 O O O
M ~ O M M Ln M M O ~ ~ m In ~ N M p ~ M
M O In pj 00 N N M O 4O I(] d' h _Is n N r
y ~Y 07 ~t N ~t O V d' N 't d N O h ~ 07 CO d' 07
CV r N (D CV M N N M O N M M N N N N N N N
d' m ~ ~ d' O~ aO 00 07 ~ ~ O~ ~ ~ O ~ O ~ 00 m
N r O O N O) r ~- d) r 07 W O O r W r r c- O?
N O d' h
O O N O O r
a0 a0 00 00 07 0~7 tN ~ N e' In N a0 ~ GO M M
a0 00 N 00 00 ~ M N N C~ N QO ~ ~ N r ('-O '- O
L i i WO 00 h n r O d' h V~' O V~' N
h h ~ h h r 00 O 00 OO ~ N 0O h Ln 00 In N O h
In c- r ('M r r N ~ O M M N N (V N ('M r N
'i ~ ~ a0 a0 OD ~ 07 r O) a0 O) N O N O 00 O7
~ r M r ~ r r r m ~ OD O r O r O r O r O
h h
_ _ _ _ Q M h ~- ~t Q ~t c0
fn fn p fn fn J ~ ~ 0_.' ~ D ~ J l~L M ~ M
C9 ~ ~ D ~ ~ C~.7 ~ ~ U ~U' D ~ C~ U v U v Z ~
O r N M et O CD h 00 O O
M ~ f0 W pp O r r r r r r r r r v- N
359
CA 02395240 2002-06-20
SEQUENCE LISTING
<110> GENSET
<120> BIALLELIC MARKERS DERIVED FROM GENOMIC REGIONS CARRYING
GENES INVOLVED IN CENTRAL NERVOUS SYSTEM DISORDERS.
<130> 10488-51 LAB
<150> 60/175,854
<151> 2000-01-13
<160> 544
<170> PatentIn version 2.0
<210> 1
<211> 450
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 207
<223> 99-27199-207 . polymorphic base C or T
<220>
<221> misc_binding
<222> 188. 206
<223> 99-27199-207.mis1
<220>
<221> misc_binding
<222> 208. 227
<223> 99-27199-207.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> grimer bind
<222> 431..450
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 195. 219
<223> 99-27199-207 potential probe
<400> 1
tataagaggc ttgattcagg ttctggaact cagtaggtag aagcctccat gcctatccat 60
gcatgtttgc gtgtttgcat gtgtgtacat gcacatttgc acatgattgt ccacgttcac 120
gtgtgtgcat gtgtatgtgt gtgacattca tctcctccac tgctgttgga gtccctccca 180
gcacccaatg tggccaggga cactgayggc cttttctggg gtcttttgcc agattgccaa 240
ggaatcatcg aggacgtcat cctgctgggt gcgcctgtgg agggagaagc caagcattgg 300
gagcctttcc ggaaggtggt gtccgggagg atcatcaacg gctactgcag gtctgtccaa 360
1
CA 02395240 2002-06-20
acctcgtgcc agcggggaag tgacaatgct tacggagcac ttagtatgcc caggctctgt 420
gttggggaca catatttgag acctaatccc 450
<210> 2
<211> 452
is
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 117
<223> 99-27207-117 : polymorphic base C or T
<220>
<221> misc_binding
<222> 98..116
<223> 99-27207-117.mis1
<220>
<221> misc_binding
<222> 118. 136
<223> 99-27207-117.mis2, complement
<220>
<221> primer bind
<222> 1..21
<223> upstream amplification primer
<220>
<221> primer bind
<222> 432..452
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 105..129
<223> 99-27207-117 potential probe
<400> 2
ccaaaaagaa atcacagcaa cgtgaaggtt aaggctaact tttcaaacat cagaatcctg 60
acaatggttg cagtagcttt caaggagaca tggtgtgtgg ccagcccctc cagggcygtg 120
tggacagctt tttgtgtatt ttcctgggtg actcacagca tcaaagggag aaaggaggta 180
gtaattgttc agcacttgac atgtgcttga acacttcgta atcgcaatct gtgecaggca 240
gtggcaccat ctcccctttt tagatgaaga aaccgaggca ccgagataaa aagtaacttg 300
ctcaaggcaa tttaggaagt tgtaaaacca accaacacat atggaatgtg tattatctgc 360
taggctcatt taatatctca tctgaccttc cagataccca tctgatgtag gtaccactcc 420
cagctccaat tgtgagattc agaggggaga as 452
<210> 3
<211> 464
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 53
<223> 99-27213-53 : polymorphic base A or G
<220>
<221> misc binding
<222> 34..52
<223> 99-27213-53.mis1
<220>
<221> misc binding
<222> 54..73
<223> 99-27213-53.mis2, potential complement
2
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 446..464
<223> downstream amplificationimer,
pr complement
<220>
<221> misc_binding
<222> 41..65
<223> 99-27213-53 potential
probe
<400> 3
tatgtagact ctttccccag gaaaaggcttcacacatgtaattgtttatg carcgttagg60
gactctcaga ttctgtggtc tctggaaggatctgagacccagggaagcca tagcaactgt120
tcagccagga gacctggctc tcagtttgattctgctactaaccctctgtg tggccttggg180
cacgtgtctt tccctccctg gacaccagcacacattttctttttttacct atacaattaa240
gggattgaat gatacgtaaa tttctcttgactgtaaggttttgtgtttct gggaggtgag300
ttcatcactg ggccgaccaa ggtgactctttgcagctgaggtctagagtg tgacgtacca360
cccctctgct cctgggtccc tgtctgagccctaaggccacccggcttccc tcacttgttt420
agtgacttca cctctcctct ctgtgcctcatttcttcatctctc 464
<210> 4
<211> 546
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 333
<223> 99-27218-333 . polymorphicbase G T
or
<220>
binding
<221> misc
_
<222> 314. 332
<223> 99-27218-333.mis1
<220>
<221> misc_binding
<222> 334. 353 '
<223> 99-27218-333.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 528..546
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 321..345
<223> 99-27218-333 potential probe
<400> 4
gaagagtaga ggtaaaagag ttaaaatgat taacacattt accctgatct tggctattgt 60
gggtcgtagg tgggtcttat tgtgggtcgt ggctattgta ggtctgataa tcaatattca 120
3
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1100116
tgtttatatatgtaatagtaatcattaatgtgtacttcttgaaacaatttagtaccaggt 180
attgtggtaagccttggcagggggtggcacacaggtgaataggcactggccctaccctcg 240
aggggcttactgccttgaggaatgtgaaaaggatgagggacatttgacccccattttgga 300
aaatatgcagatatttaataggtggaccaggtkggggagtgtgtttcactccttgaaggt 360
gtcccaaaggagagggatactttggttccttctgggaatgatgagaatgaccatcactta 420
ttgagcacttaaccgcatgccaggcacggtgctgagcatgttatattttacatcattatc 480
tcatatccttgtaagatatttctccatttttacaatggaagctcatggtggcagaatccc 540
tccttt 546
<210> 5
<211> 413
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 233
<223> 99-28108-233 : polymorphic base A or C
<220>
<221> mist binding
<222> 214..232
<223> 99-28108-233.mis1
<220>
<221> misc binding
<222> 234..253
<223> 99-28108-233.mis2, potential
complement
<220>
<221> primer bind
-
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 394..413
<223> downstream amplification primer,
complement
<220>
binding
<221> misc
_
<222> 221. 245
<223> 99-28208-233 potential probe
<400> 5
catgcctgtt cttccatcca cactccaggg ctgcccaccagctgacaggc accatcaact60
ggcagcaaca gagcaggcgc aggtacaaag aaggcagctcactcctgctc ttaggagatc120
caatcagatc tgccctgtac agccatgtag gctgtgcgctgcataactcc agggacatga180
gtcacacaga cacaatgtga gtgtgctccc ccgtcatgcaacatctggac acmactaaca240
gagcatggtg aatacatgct gaattgcatt cagtatggctgtgaactagg cctggggaca300
agaatgaatt ttacatggaa agaatttcct gtagcaggaacagaggggat aacaacagca360
ataaataata ataagaagaa gctaccactt cttgagcatgtaccacatac caa 413
<210> 6
<211> 454
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 275
<223> 99-28109-275 : polymorphic baseG
A or
4
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> misc_binding
<222> 255. 274
<223> 99-28109-275.misl, potential
<220>
<221> mist binding
<222> 276..295
<223> 99-28109-275.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 434..454
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 263. 287
<223> 99-28109-275 potential probe
<400> 6
caatgtcatc gacaacccct ggggggtgtg tctccatcga tcagcagagg ttggcaagca 60
cctggcccac atcctgctct cccggcagca ggtacctggg aatggctgtg tgggcgtggc 120
attgagcaag aggggaagtc aggtgctgac ttgttcacag atatcagcct tagaggcaag 180
gctacttgga gataactcaa tggttttggg ggtgtgggca gtccttgctg cctctccagt 240
tcaagtaatg aatgtgtcct aggatgaaca gtaaraatta tagactctgc agctctagca 300
ggtatttagg taaggactga ataacagggc atctgcaggt aggaacaagt ctgggggact 360
ctggcagaag caaaagtggc tcctatgtat cagctcttca ttcaagtgtt taggataatc 420
actgggctca tttgggtgat atttcagtgg aaac 454
<210> 7
<211> 549
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 74
<223> 99-28110-75 : polymorphic base C or T
<220>
<221> misc_binding
<222> 54..73
<223> 99-28110-75.misl, potential
<220>
<221> mist binding
<222> 75..94
<223> 99-28110-75.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 530..549
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 62..86
<223> 99-28110-75
potential probe
<400> 7
aaccacttct cactcacctctgtgcccacagccagccccg cacatcgtgg ggtttccgtg60
ggaaccagat cccygcaggtacaaatggggcccagccctt cctgtttcct gcctcaaaag120
acaccccaac ttacccaaacagaggctgccatcacccacc tccatctgcc ccagtgactc180
cttccaagcc catcaggcccctttgggttctttcacttct tggacctcaa tttcctcatg240
tataaaatga ggctaataaagagacctataccacgtgggc tggctgtgtg gctttgataa300
tacatgtaac aggcttattggcacagggttagaggccact accagaagct acagagatgt360
gtgaatgcag gcagtactgaagcagtggttaacagcccag gttcatccgg ctctaccact420
cacatgccgt ggcaccgcctgcagcctcagttttcacacc tgtacaacgg gttactacca480
ctatgcagga cctctatgaggatcaaatgacttaccccgt aaaacatgtg agttgttggc540
tactgcggt 549
<210> 8
<211> 518
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 81
<223> 99-28125-81
: polymorphic
base A or C
<220>
<221> misc binding
<222> 62..80
<223> 99-28125-8l.misl
<220>
<221> misc binding
<222> 82..101.
<223> 99-28125-8l.mis2, potential
complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primerbind
<222> 500..518
<223> downstream amplification primer,
complement
<220>
<221> misc binding
<222> 69..93
<223> 99-28125-81 potential probe
<400> 8
ggggagtgtt gttaaaagta cagattcyta cagatctcct gcatgtggga60
agccctaccc
ccgaggaagc tgtaattcca maagctctct tgttccctaa actctaagaa120
gggaccttga
ccactgtccc gctgtgactg tcaagtctcc gttgctgttg ggctgtttca180
acatgaccct
agttcatttg accttgggct ttaaaggtct ggaggaacag gtaccctgag240
ctccttgtga
gctgaccctc agatctctga gctggaaagg accagctcct ttggtccttc300
acctctggat
cggcaggatc caaaagtctg ggcctgggca atctgcacat ctatcaggag360
ctggactgga
caatgggggg atgttgcagc acccattgat tttagaagga ggccgtgagg420
catgggctga
aaggggtgca ggctggaagc atgggcgggc ggtgtgtggc tggaagacag480
ttcggggaga
6
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
tgttctgcta gctcgtgccc tccttcccac ttcatggt 51B
<210> 9
<211> 472
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 215
<223> 99-28134-215 : polymorphic base C or T
<220>
<221> misc binding
<222> 196..-214
<223> 99-28134-215.mis1
<220>
<221> misc
binding
_
<222> 216. 235
<223> 99-28134-2I5.mis2, potential
complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 453..472
<223> downstream amplification primer,
complement .
<220>
<221> misc
binding
_
<222> 203. 227
<223> 99-28134-215 potential probe
<400> 9
tggatggatg gggcttctac tcaggccagt cttagagggctcagttttgg gtttaatctt'
60
ccctcctgcc ccaaagtctg agtcacagct ttggctgaaaccccgcaggt cctccttctc120
aaaccccaaa gggttgcttc ctttctagcc ctgcagccgccagccttcac gggccccctc180
ctctggctgg agggtctgtc accctgtttg ggtayaggctcctgcacgct ggcggcctcc240
tgttctagca ccctgecctg tctccaaggc agcactcagaaagctcagcc taggcccctc300
cagcccctcc ctccaccacc aaagactaac acagaagcctctcagacctt gttcaaagac360
ctccctgtgg yccwatcttt gtttttcagt ctgtgtccactcgcccatgt cccttccccc420
agctccaacc agccaagccg ccccagcctc tcctgtcatcctgctgctct ca 472
<210> 10
<211> 546
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 96
<223> 99-28137-96 : polymorphic base
A or G
<220>
<221> misc binding
<222> 77..95
<223> 99-28137-96.mis1
<220>
7
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1l00116
<221> misc_binding
<222> 97..116
<223> 99-28137-96.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 529..546
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 84..108
<223> 99-28137-96 potential probe
<400> 10
caggaatgct gctattacca ccgctggcca caaggggtcc cagccctgca ggcagccgca 60
ccaaggctcg aaaagcagtc ccagctctta gcaggrcaga ctctgccagg cagagaaggc 120
gccctgaatg gccggccccc agagaaagct gctgagctca tggttatccc tgggtccaca 180
accatttggc actgtaggag caacgataac ccgcatatga tcactgtgca cgttgttatt 240
gcagacagca gagagaaagg ccccagggac cagcagctct gcgtgcagtc tgcgttctgc 300
tcccaggctt attctcattg gctgtgtgac cttgggcaag ccccatcccc tctctgaccc 360
tgtttcctcg tcttccaagg gaaatcgcgt tgatctctaa gggccttttc agcaacagcc 420
ttgccaacaa caaaagcacc tgaagtagcc tttatgttgg agggatatct gagccatcct 480
tgctattcac cacaaactgt cagcttactg aagttttaaa ttcttctgcc agattgtcat- 540
tgtcct 546
<210> 11
<211> 401
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 305
<223> 99-32204-305 . polymorphic base A or G
<220>
<221> misc_binding
<222> 285. 304
<223> 99-32204-305.misl, potential
<220>
<221> misc binding
<222> 306..325
<223> 99-32204-305.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 384..401
<223> downstream amplification primer, complement
<220>
<221> misc binding
8
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 293..317
<223> 99-32204-305 potential probe
<400> 11
gtttggttta cttagccatc ccctccccaa atacatacct cattaccacc ccaaggtaat 60
cccagtaaat tgcagtgggg caaattataa tcactgtggt agcagtagct aacatttatc 120
cagggttcac tggtgccaga cagtgttacc atgccattta acctgcccaa ctcacctgtg 180
aggcaggtcc tgttattatc cacatgttat ctcagaggga aatgaagctg agaggtaaag 240
tgaggacaca aagccaattt ccaggggaac caggactccc ccaggtggtt ggacttcaga 300
gtccractct taaccccatc ctccactgcc tccctctgcc accttgtaaa tcaaaataac 360
gatactagct aacatcgttt ttagtctcat gtagttgagc c 401
<210> I2
<211> 478
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 118
<223> 99-28149-118 : polymorphic base C or T
<220>
<221> misc_binding
<222> 98..117
<223> 99-28249-118.misl, potential
<220>
<221> misc_binding
<222> 119. 137
<223> 99-28149-118.mis2, complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 459..478
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 106..130
<223> 99-28149-118 potential probe
<400> 12
cagcaaattg ctagtgaact tgcaactttt tcaccttttt cttcatctta atgaactagg 60
aaggtcattt tctagatggc tttgcctgaa taagcccaca tacgatactg tgaccttyga 120
tgggaggagc tagcatgtga tgttaaggcc aagtccatgg aatggacagc aatgcacaac 180
agataattcc tcatgtctca cgacagtggt aagattccca gtggctgctt tggtgagagc 240
ttttaattgg ggttcttagg aacttgtatt attatttaaa ccagagtgtg agctcctaga 300
gaacaccggc tgtcatggtc cttttttaag tactccacta tcttgcgtat aatgagtcct 360
ccttacagtt tgttgagtca ataagtacat gttgaactta gcatatcagg gtacagcata 420
ggggacctgg ccaaattctg ctcgttgtta gtcaccagct ggatgtccac attcatca 478
<2I0> I3
<211> 456
<2I2> DNA
<2I3> Homo Sapiens
<220>
9
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> allele
<222> 285 .
<223> 99-28160-285 : polymorphic base A or G
<220>
<221> misc binding
<222> 266..284
<223> 99-28160-285.mis1
<220>
<221> misc_binding
<222> 286. 305
<223> 99-28160-285.mis2, potential complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 439..456
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 273. 297
<223> 99-28160-285 potential probe
<400> 13
caaaagagtc aaagcagagg ccttgagaat tgcttgagaa tttatgctac tttcaggagc 60
tttttgtggt ataacaatgc agagcataga aggaggaagg aaatggtatt tgtttcaaag 120
gatcattatt tacttctggt ttcagtagtc agttagccag tagatatact gagaaactta 180
agaaagtccc catcatctct gttgaagaag gataagttgg tgcacgatga caatataaca 240
ttatattgca tcatagtgtt atggatcaag tgctagggga tcgcrataat gggagtaagt 300
agctggggtg gggtgcagat aggaaggacc ttacagtaga ggtgacactt gagcaaggtc 360
ttaagggata aataggagtt tgctaggcta tgaagtgggg actagaagtg cagacacttt 420
ctgtcttctc cactttggcc tgttactcta tttccc 456
<210> 14
<211> 514
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 457
<223> 99-28171-458 : polymorphic base A or G
<220>
<221> misc binding
<222> 438..456
<223> 99-28171-458.mis1
<220>
<221> misc binding
<222> 458..477
<223> 99-28171-458.mis2, potential complement
<220>
<221> primer bind
c222> 1..18
<223> upstream amplification primer
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> primer bind
<222> 494..514
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 445..469
<223> 99-28171-458 potential probe
<400> 14
ggaaggttgg ggattgtgaa rgagggccca ggagctctat agcataccaa acactccatt 60
tgtgtacttt gcagctcttt tcccttttgt catcttcact gtatgcttag ggcaccataa 120
tttcaattat gcaatttcct ctaaaatctc ccacaaacct cttctggagt ctaagtaact 180
tgtcatcgca tttctgtcat gtgatagatg tgtttctaaa aaattggatt ccactccttt 240
tcttgaataa tcacatgact tcagattatt tagcatttta tgacataagc agtttgatac 300
ctgctttggc ccagcagttt tgggatgggg tagatgttaa ttatctccat atgcaggtaa 360
tacagtagaa tcttaggtag ttcatggttc acacagttaa atgactctct caaggggttg 420
acaagggatt tgtactcaag ctttgattcc aaatctrctg ttatttccta ctgggaaatg 480
ctttttaaag ttactttaca gcagaactct ttgt 514
<210> 15
<211> 550
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 395
<223> 99-28173-395 : polymorphic base C or T
<220>
<221> mist binding
<222> 375.-.394
<223> 99-28173-395.misl, potential
<220>
<221> mist binding
<222> 396..414
<223> 99-28173-395.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> S32..550
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 383..407
<223> 99-28173-395 potential probe
<400> 15
agagccaatg agatacacgt tcaactagga cagaaatact atcttaacaa atgtcattcc 60
cagaaataat caacacaggt gaaagaatta gagatgggga aaagtcaaaa aatgagagag 120
ggaaaggttg cagtgtggaa aatagcattt aaattctaac caaactagaa tcagacatat 180
aggaaaatct aaaataaaat ctgggagcct tgaagccgga ggaagaatta aggaaatctg 240
tgttcgggag ggaaaagcag aaggggcctt caagtacaac tgaattaaat caagatggac 300
1I
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
tgccagttct agaaaaagac aagtttctcc attccccgta aatgctcagg agtaaacccc 360
agtagtcaca gctgggccag tcccaactta tactytgggc aatcgaaact catttgccaa 420
gcagagactt ggaccatact gcctagaaca tgcctaccat tctttcttta ttcttttgaa 480
agagtactgc cactcaagtg acttttgcaa ttgagagtct gattatcatc tctatgctga 540
aaatccttca 550
<210> 16
<211> 466
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 113
<223> 99-32177-I13 : polymorphic base C or T
<220>
<221> misc binding
<222> 93..112
<223> 99-32177-113.misl, potential
<220>
<221> misc_binding
<222> 114. 132
<223> 99-32177-113.mis2, complement
<220> ,
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 446..466
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 101. 125
<223> 99-32177-113 potential probe
<400> 16
cccagaaata gaaaccaact atcaggcaaa gccttcgtga ggcaatttgg ggttgtaaca 60
ctacattacc tacaaatcaa tggatatttt aggagaaatt aaaaagggat gaygtactct 120
gttcaaaaaa aaggtttgaa acccagcaga ttcctgtggg ctttgcatcc ccagccctag 180
gcatctctgt ttaaagaggc agcttagtga taagggagga ggagagaatt tctaagaagg 240
ggtagaagtg tagacttata tttatatata tttttaaaaa gtttttattg tttagcagct 300
tcagtaaggt ataatttcaa gatcataaaa ttacccaggg taagtgggta tagataagta 360
tataggtcat ttattttgag tgaattttta gagttttgta tctatcaaca caattcagtt 420
ttagaacatt ttttaatatc tcttacttca ttttgggttg ctgtaa 466
<210> 17
<211> 449
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 192
<223> 99-32181-192 : polymorphic base C or T
<220>
<221> misc binding
12
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222>172..191
<223>99-32181-192.misl, potential
<220>
<221>misc binding
<222>193..212
<223>99-32181-192.mis2, potential complement
<220>
<221>primer bind
<222>1..18
<223>upstream amplification primer
<220>
<221>primer bind
<222>432..449
<223>downstream amplification primer, complement
<220>
<221>misc
binding
<222>_
180. 204
<223>99-32181-192 potential probe
<400>17
gtcagacatt actcctaacc 60
cctcatggsc
aaacctgata
ccactccttt
cttgctgtgt
tctatcagcc gtgtgcccac 120
tccctgtcct
catcacccag
gagtaggggt
gggggtgtga
agagtggtca ccaacaatgg 180
tggggattaa
atgagatgaa
tcatgcatag
cccttggcac
gattgctact gctgacaccc 240
gycagttcct
atgctcctct
acttgggtat
tgccttcatg
atggctttct gtgaaaaaaa 300
ttctgggatg
tgtggccttc
atcaaaaatg
tgtttattta
aaaaaaggac ctccatagca 360
cctgagattt
tcatttaatt
ttgcctatgt
tctcacactg
cagcactgat cttcacatca 420
gatactaaaa
agctaactcc
tggatctaag
ctgctaagac
ctggcagttt 449
gctaatgtcg
gtgttctgc
<210>18
<211>458
<212>DNA
<213>Homo Sapiens
<220>
<221>allele
<222>257
<223>99-32193-258 : polymorphic base G or T
<220>
<221>misc
binding
<222>_
238. 256
<223>99-32193-258.mis1
<220>
<221>misc
binding
<222>_
258. 277
<223>99-32193-258.mis2, potential complement
<220>
<221>primer bind
<222>1..19
<223>upstream amplification primer
<220>
<221>primer bind
<222>438..458
<223>downstream amplification primer, complement
13
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> misc binding
<222> 245..269
<223> 99-32193-258 potential probe
<400> 18
gaaggagatg agattagaga agtgttgcaa attatattgg gattcagacc aggtaaagag 60
tttggacttt attctaagtg cggcagaacc actggagact ttgaaacata gggtgaaatg 120
gtctggcttt taattttaat ggttcattgt ggttactttg tggagaatga aatggaggag 180
ggtgagaatg aaaacttgga gaccaatggg aaggcttcta cgttagtcaa ggcaagaggt 240
aatcgtagct tggactkggt tggagtagtg gagacagaga caactggaga aattccggat 300
ctgtcttgga ggtgtatcgg caggccttgc tgatggactg gatgtaggcg ctgagggaga 360
caggcatgaa ggatgactct tgtgcttttg gctcaagcaa ttcagtagat ggtgatactg 420
tttaccaaga catgatggta gtagaattgg tggtaaaa 458
<210> 19
<211> 450
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 90
<223> 99-28722-90 : polymorphic base C or T
<220>
<221> misc_binding
<222> 71..89
<223> 99-28722-90.mis1
<220>
<221> misc_binding
<222> 91..110
<223> 99-28722-90.mis2, potentialcomplement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 429..449
<223> downstream amplificationimer, ement
pr compl
<220>
<221> misc binding
<222> 78..102
<223> 99-28722-90 potential
probe
<400> 19
atacgataca etctgccaag tccattttgaattccatggcctgaatcatt aactttcaaa60
gccaaagcat ttaaaagata aaattatccycttggcactcctcaaactgt gctcttgacc120
tcttctgtta ggctacagtt ttgtttctggctgtgcaaatgtcacataat gccactgcac180
ccggcagtat cttcttcata gcaacagatcataataaaagtccctcggag gctgtttgtg240
tttcacatac acatggaatg aaagaaaaatgcagtgtgctatataaagcg agagaaatgc300
ataagcttca tctttcattt gcagccaattggttttaataagcttttatg ctgagaggtg360
aataattagc atatgttctt aattaagattgttctagagcagtagagtgc tccaggtcgt420
taaaaatggt tttgtgtctc aatgtcttaa 450
<210> 20
<211> 452
<212> DNA
14
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<213> Homo Sapiens
<220>
<221> allele
<222> 351
<223> 99-28730-351 : po3ymorphic base A or G
<220>
<221> misc_binding
<222> 332. 350
<223> 99-28730-351.mis1
<220>
<221> misc binding
<222> 352..370
<223> 99-28730-351.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 435..451
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 339. 363
<223> 99-28730-351 potential probe
<400> 20
attcttggta tcctacacga aatctattta tatccaacat aactaatgtt ctgaggaacc 60
cactttatga aacaggattt tgtactgcta ttagtggtga gtcacaataa gaagggaaag 120
atacccaagc tcgcattgtg agaggtcata cagagatggg tccaaatgga atcaggagtt. 180
gaaaggcata gagatgtccc tagaaactgg aggagaccac caagttgttc taaagccagg 240
agaagaatct aacattggcc tgaaagctaa agcctacctg tgggtacaaa ttggacaaag 300
gatactttgc tggacagtca gaaattcagc tgtggagcac caggctggca rtgagctctg 360
ccctcaggca cgccacatag gcagcaccag gactgaggac atctgaggct gagaacggat 420
gtaagaacca tcttggtgtt gtgagatgaa tt 452
<230> 22
<211> 455
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 407
<223> 99-32306-409 : polymorphic base G or C
<220>
<221> misc_binding
<222> 387. 406
<223> 99-32306-409.misl, potential
<220>
<221> misc_binding
<222> 408..427
<223> 99-32306-409.mis2, potential complement
<220>
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 437..454
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 395. 419
<223> 99-32306-409 potential probe
<220>
<221> misc_feature
<222> 162
<223> n=a, g, c or t
<400> 21
catttgcacc tgcactcccc tgaccttgca ctgtggtaga ccagttgctc tctaagtctg 60
ctgctcagtt gtcatctgag atagtccttt attgtcttga ggtggggcta tgtctccttt 120
tgtctaggat ttttattggt tttactgcag aatatcatca angatttatc tttttcactg 180
aagatgcata aagggtaaac attctgaggc ctaggatgac tgaaaatgtg tttatttggc 240
atcgacactc agtataattt ttttttacca ggtgtagaat tctaagttda waataatttc 300
ctctgtggac tttgaagtta ctgcctcatt gtttccagtg ttactaatga gaaatctsat~ 360
gcgagtttga ctgtgatttc tttacagatg ccctgttttg ttccttstct tctaaaacat 420
cacaatgatg catttagggg tgggtgattt tttta 455
<210> 22
<211> 527
<212> DNA
<2I3> Homo Sapiens~
<220>
<221> allele
<222> 246
<223> 99-27088-246 : polymorphic base A or G
<220>
<221> mist binding
<222> 226..245
<223> 99-27088-246.misl, potential
<220>
<221> misc_binding
<222> 247. 266
<223> 99-27088-246.mis2, potential complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 510..527
<223> downstream amplification primer, complement
<220>
<221> miec binding
<222> 234..258
<223> 99-27088-246 potential probe
16
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<400>
22
gtttttcttagcttgctggtgtttttaactcaataaaatgtcaattaact tcgtgagctt60
tcctttaactctatataatctttgcgtttgaatggctgccaatcaaacgc aaagatagat120
gttttctttgaatatgggccaatttccgtgtatgcaccttgttgtcagga tcagctagat180
tatggtgtagtaacaatgtcgatatctcaatggcttgacaaaagtttggt ttccgctcat240
gctacrtgttctgtgagatcagtggggagctcggagtttccacagttacc agcaaacgga300
gagaattctggagggcctcgaacaggcaagcaaatgatctagcccggaag tgatgtttgt360
cactttccttcacatctcattggtctgaactggtcacatgaccccaggca accccagagg420
gccaggaaattcgggctccttgtgcttgccaggaaaggagagtggccctg ttgaaaccgc480
ctgtgactgagacagtgaaagaaatttgacctaaccaactccatctt 527
<210>
23
<211>
451
<212>
DNA
<213> Sapiens
Homo
<220>
<221>
allele
<222>
204
<223> base A
99-27090-203 or G
: polymorphic
<220>
<221>
misc
binding
_ 203
<222>
185.
<223>
99-27090-203.mis1
<220>
<221> misc binding
<222> 205..224
<223> 99-27090-203.mis2, potential
complement
<220>
<221> primer bind
<222> 7...20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 431..451
<223> downstream amplification primer,
complement
<220>
<221> misc binding
.
<222> 192..
216
<223> 99-27090-203 potential probe
<400> 23
gaactctcct ctaatagaac ttccaagttg gccccgcaggcactattttg gtgcagagga60
acccgtcaag cttgacttta aatctggetc tgccactaaatcacccaggg cctttcctct120
ttgggccccc gtttccctgt ctgtaaaatg agaggattgaacagggcagt ccctagagtc180
tgttcagaag ttctcagact gggrcttggg ttcttgcacttttcattttg tcactgttga240
tgtcatcaca cacacaccca cgcacagagt ggagtgaggatttcggctgc acagcaggat300
ggcccagatg ataggaggag gcagggggcg atcactggctgggaggatgg ctgggaaaag360
aggaggaagg ggaaaggcac gcgaggtcac aaatgcaccaaaaggcattt cctggcmtag420
ccctgtgcct cccttctaaa gagccatcac a 451
<210> 24
<211> 473
<212> DNA
<213> Homo Sapiens
<220>
17
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> allele
<222> 221
<223> 99-27091-220 : polymorphic base A or G
<220>
<221> misc_binding
<222> 201. 220
<223> 99-27091-220.misl, potential
<220>
<221> misc_binding
<222> 222. 241
<223> 99-27091-220.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer_,bind
<222> 455..473
<2~3> downstream amplification primer, complement
<220>
<221> misc binding
<222> 209..233
<223> 99-27091-220 potential probe
<400> 24
atcagcggat ggtgaagagg agatcagcgg atggtgggag gaaaaatgca ggaaatctct 60
ggacttttca tggaagtatg attcaggaat aaggcagaag ccctcacaaa ccttccacag 120
agcaagaggt ggcacaggca cagattctgc tacagagcag acctttccag agaggaaagg 180
ttggtttggg aattttaaga agcatttttc tttgcataac rcaacaccag tcctctgtgt 240
ttagaaaatg cctgtgtgaa ccatcacatt caagagaggg acacaagtgt cagggttcta 300
ggcagccaag ggaagactag ccctttgcct ggaatttggc ttcattttct gacgaatcaa 360
gatttgctct gctcctctgt gcacgccagg acattaagat gcgagaataa gaacttatag 420
cctgtatatt tgccatctaa ttagtgtctt gggtcctaag tgctttgtgc cga 473
<210> 25
<2II> 472 '
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 145
<223> 99-27093-145 : polymorphic base C or T
<220>
<221> misc_binding
<222> 125. 144
<223> 99-27093-145.misl, potential
<220>
<221> misc binding
<222> 146..165
<223> 99-27093-145.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
18
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<220>
<221> primer bind
<222> 453..472
<223> downstream amplification
primer, complement
<220> ''
binding
<221> misc
_
<222> 133. 157
<223> 99-27093-145 potential
probe
<400> 25
aggctaggag atgaggagtg gggctgggctgcctctgcacatcatcaaag ccaacactca60
gtctaatcca aatcttgcta gagcatagaacataaggtagaatgagtctt taagcaactg120
ggagtcatct cgaggtaaac agaaytccaagagtaacgaaggcccagagt gaatttattt180
tgagagagtt tcctgttgga gtagcagacactctgcagtagtgtttttct ctctcctggg240
tgggactgcc ctgcctatat gcacttaaggcatagagtttcctgttcttg cctcttctca300
gagccttgca ttgaaactca aatgtattctcagaaatttctctccacaca atgacatatc360
gcctctgtgc ttttactctc tttgtctttctctttctctcaaccattgtt .ttccacccat420
cctctttttc ctaaacttct taagattgttggccatttccctttctccct cc 472
<210> 26.
<211> 455
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 406
<223> 99-27094-406 : polymorphicbase C T
or
<220>
binding
<221> misc
_
<222> 387. 405
<223> 99-27094-406.mis1
<220>
<221> misc binding
<222> 407..426
<223> 99-27094-406.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 436..4-55
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 394. 418
<223> 99-27094-406 potential probe
<400> 26
ttataggtcc caagaagcag ggcctagaaa ccaagagctt gacacgcagt caaactccaa 60
agcagtgtgt gagtgaagga aggaaagacg ggtgttgaaa agcaggtgac tttgagaagg 120
gaggggtccc tggcagcacc tcccttcctc cccgtttcta ggctctaggg tggggctgaa 180
tgatcatgag gcacaaaggt gggtgacatg caagtgctga gaagcactga gctcacaacg 240
gccctcatca tcttctcaga gccaccaagg agctactggc caccaaggag ctactccata 300
ggccttcctg ttggaattac agaacccact tgaaaccaga gatcaagtcc agccctatcc 360
19
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
accaggcatc ccaggagaag ccaagaccct atgcccagtt ccgccyggcc accaaggccc 420
ttctgaagga gcaccctcat tggggaacct ctcca 455
<210> 27
<211> 450
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 410
<223> 99-27096-410 : polymorphic base A or G
<220>
<221> misc_binding
<222> 390. 409
<223> 99-27096-410.misl, potential
<220>
<221> misc binding
<222> 411..430
<223> 99-27096-410.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 432..450
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 398. 422
<223> 99-2709.6-410 potential probe
<400> 27
gagtggagag atttgtagct cagctgcaag ttttatttgg agccttgggg ctgccaggct 60
gtgcacggaa gtgaggcatt agccagtgag tgaacctcgt gctctgccag cttcagcttc 120
agtgccgttt tgattttctc tactagttgg aagatagtaa atcacatgaa gtcttgaaaa 180
cttggttctg aaaggagcgc cagtggctgg gactggtgat ggagtggagg agcaagaggc 240
atctgagaaa ggccaaaagc actttggttt gatttcagag aagatgacat gttcagttca 300
ccccatttac catatgcttc gactgtagtt cccactgttt cagggtgcta gttgttggtg 360
agaagtggag gaagccaaga accctccccg ggaaaatggt tttcatcacr cacaccaact 420
gcatttattt gcaaatcttc acactgcccg 450
<210> 28
<211> 504
<212> DNA ,
<213> Homo Sapiens
<220>
<221> allele
<222> 83
<223> 99-27097-83 : polymorphic base C or T
<220>
<221> misc_binding
<222> 63..82
<223> 99-27097-83.misl, potential
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<220>
<221> misc_binding
<222> 84..103
<223> 99-27097-83.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 486..504
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 71..95
<223> 99-27097-83 potential probe
<220>
<221> misc_feature
<222> 213
<223> n=a, g, c or t
<400> 28
gttcttttca ctacctcctg cttaattttt aatttctaag attagaccct tcatctatcc 60
atgacacctg cctgtcatcc ccygaaaaaa ggtgaacgcc gttcagaaat ttttctagcc 120
tgagctcact cccagttcac ttatttttgc tttgtcatgg ctgcccagtc cccacttgta 180
gaccaggaat aggtcatggc tgcggggact acnacctgtc gctgctgcaa gggccggcct 240
ctgtttccgg ggctgagtgg gggccagacc tgccaggagc accatcttct gtgggtcctg 300
cctggatgtc acatcccggc cccaagaagt cactgcaaac cttcgtatta ttgagcttca 360
catcctagaa tttgctgtca ctgtggctgc tgcatgaagt tgtcctgaga gaaacgggca 420
ttgtcattaa cagggaaatt gatggtctgg gggaaaagtc atcctcattc tcttgcagat 480
ctatgggtga ttgagactgg ctga 504
<210> 29
<211> 421
<212> DNA
<213> Iiomo Sapiens
<220>
<221> allele
<222> 162
<223> 99-27098-162 : polymorphic base C or T
<220>
<221> misc_binding
<222> 142. 161
<223> 99-27098-162.misl, potential
<220>
<221> misc_binding
<222> 163. 182
<223> 99-27098-162.mis2, potential complement
<220>
<221> primer bind
<222> 1..19 -
<223> upstream amplification primer
<220>
<221> primer bind
21
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 404..421
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 150. 174
<223> 99-27098-162 potential probe
<400>
29
acttctgcccagtttggtgcaggggagctgggtagttgccgacttttcctatcttgatcc 60
ctactcagtgtaacaatttatctgtacaactgattccatcaccaggatctttagacccct 120
ctggtcattcagccaatcacaagcactcatccacaggacacygccgatgatgccatttac 180
tgagcagttactatgtgcttggccctagtgagtaccgggttagcttgtgtgaaccccatg 240
gcaacccgtgagacaggtaccatcatactccaagttgtggatgacaaaaaactctccaag 300
cagctaaacaatatggcttaggtctcacagtgagcagggagctgggatttgtgcccagga 360
ggcccgatcagagcctacctccttaaccattaggccaaactgcctccacatgcagaacac 420
t 421
<210> 30
<211> 468
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 4B
<223> 99-27550-48 : polymorphic base A or G
<220>
<221> misc_binding
<222> 28..47
<223> 99-27550-48.misl, potential
<220>
<221> misc_binding
<222> 49..67
<223> 99-27550-48.rnis2, complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 448..468
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 36..60
<223> 99-27550-48 potential probe
<400> 30
tgtgtgtgtg gggtatgtgt gaacattttt catgcttgat gtgagccrga agaaaaatga 60
gcttctctat ttgataagtg tggacctgcc cacagcacta aatttggttc tgccgtcacc 120
ggcgccatga agcagcagcc tggtttagag gcttgccttt ggtttcaaat aatttctcca 180
ggctcatgtt acatatgacc cattcacaga ggctggaggg catggcttct ccagtcctta 240
gcactaaaga cgtgtctttt ggctcctgca cgactagcac aggcagtaga accagatggg 300
ggatgctctg aggttgcaga ggcaggaagg caagcgggag agagcttggg cctggacaga 360
gggatgagct ggctccctcc ccagctgtga aatctctgag tctcagtttg cttctctgca 420
aaatgaggat aataatcccc acctcgggac tgaggattaa cgaggcaa 468
22
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<210> 31
<211> 452
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 335
<223> 99-27558-335 : polymorphic base C or T
<220>
<221> misc_binding
<222> 316. 334
<223> 99-27558-335.mis1
<220>
<221> mist binding
<222> 336..355
<223> 99-27558-335.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 432..452
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 323. 347
<223> 99-27558-335 potential probe
<400> 31
gtcaaatcaa cactcgtcta cattcaaatt tcacattttt ccccctctaa gataacagta 60
taattgagaa ctgacaggga cctaatgaca gtatggtccc ctcacactga atggtcacat 120
ttgcctaaat tgaaataacg tatgctagaa acaatcttaa gcagatctgt cattttaact 180
atatgtgatg tagagttgaa tgttcattcc agataattta gtcaatgtag gtaactaatg 240
gctcacacta attcaggcca agaaaatgca ttccctctct ttcttcctgt ccctttctct 300
tgctgaaaga gaaatctcat ggccgcatat gttayacaat catgcccact tatgtaggat 360
cacagaaggc agaatagcag agaagaaaga aaactggaga gttgggtcct gatcctagcc 420
atcttgtatg accttagaca attcattacc tt 452
<210> 32
<2I1> 465
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 106
<223> 99-27561-106 : polymorphic base A or G
<220>
<221> mist binding
<222> 87..105
<223> 99-27561-106.mis1
<220>
<221> mist binding
<222> 107..126
23
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<223> 99-27561-106.mis2, potential complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 446..4'65
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 94..118
<223> 99-27561-106 potential probe
<400> 32
cagtcactca aacaatgtca caaagaaccc tttgacagga atgtatcctg tgttgactct 60
actttgctct gagtagtctt tccccaggtg atgataaaaa tggtcrtcat cgccaggctt 120
gtgtcctgtt tagtaggaat atacaagaag agctcagtaa atgctggccc caccactaag 180
caaaaacaaa acttttgttg ttgttattgt tgttttaaat aacagcttag acctttcttc 240
tttccttgtt attctctttc atctgtaatc cagttttcta cttctgaagt atagaatgtt 300
ctgatgattt attcttcatt acccacaact tgcacatgtt tatttaaaaa tgccaggatt 360
gcctggccgt tgtgtgctgt taacctttgt ttgctgttag tggatccctg aagttcaggc 420
tcccagggga gcagataatg ggtatccagt tcctgcaata tccac 465
<210> 33
<211> 470
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 364
<223> 99-27562-366 : polymorphic base G or T
<220>
<221> misc_binding
<222> 344. 363
<223> 99-27562-366.misl, potential
<220>
<221> miac_binding
<222> 365. 384
<223> 99-27562-366.mis2, potential complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 450..470
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 352..376
<223> 99-27562-366 potential probe
<400> 33
24
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
ttcctccaccaccactttcctcatcaccgtgttcagagacccccaaagsc ccctyamamt60
cccagaaacacccccctggccactcctaacttgccatgcccaggagttag gtgcttccac120
tagtgacatggagctggcgtttggggggcacctcagcaggtgacgggaag agaagacccc180
agcctcaccagctgggctgcagcagggagaggagtcctcatgttccagca gggactctca240
gctgttttcctgtaaaaccatggttctcaactgggggccactgagatgtc tagagagatg300
tttttgttttcacaactcggggagggtgctactgacatcttgtgggtaga ggccaggaat360
gctkttaaacatcctacaaggaaggcacaggacagtctcctacatcaaaa tatgacccag420
ccccaatgtcaccactgctggggttgacactggcactgctatcttaatta 470
<210>
34
<21I>
1003
<212>
DNA
<213> Sapiens
Iiomo
<220>
<221> le
alle
<222>
738
<223> 1-738 :
16-3 polymorphic
base C
or G
<220>
<221> binding
misc
<222> .737
715.
<223> 1-738.mis1
16-3
<220>
<221> misc
binding
_
<222> 739. 761
<223> 16-31-738.mis2,complement
<220>
<221> primer bind
<222> 1..25
c223> upstream amplification
primer
<220>
c221> primer bind
<222> 975..1003
c223> downstream
amplification primer,
complement
c220>
c221> misc
binding
_
c222> 726. 750
<223> i6-31-738
potential probe
<400> 34
ccactttgga taaatgccctctaactagcagcttttaactgcctttgcga tgggaggtct60
accacccttc ctttacccaaagatgaatttcggatcattttctgtacaat ttttaaagga120
cgtttgaata atatttctttctttatcattgcggacgctcccaaatctca gcggaggtgt180
agcgcataag ggcagttgaaggagatatagatcctatagatcctgtataa aagggggtct240
ggaattctgc atttcccgttcgctagcattcgcgaaactcttgagacagc gtacgcttcc300
tatggcatca gttggaatttaagggcaagggagaagggtgctcggcgtgc ggccgcggcg360
taccggagct gcactttgcagggagaagtggctgcgtaatccggagcaca gtcagtatgg420
tgctgtgtgc ttgttgttttgttttgttttccacttttctcccccttttc ccgccacacc480
actattttgg aaagtttggccactttggataaatgccctctaactagcag cttttaactg540
cctttgcgat gggaggtctaccacccttcctttacccaaagatgaatttc ggatcatttt600
ctgtacaatt tttaaaggacgtttgaataatatttctttctttatcattg cggacgctcc660
caaatctcag ccggaggtgtagcgcataagggcagttgaaggagatatag atcctaatag720
atcctgtata aaaggggstctggaaattcgtgcatttcccgttcgctagc attcgcgaaa780
ctcttgagac aggctacgcttcctatggcatcagttggaattttaagggc aagggagaag840
gggacgaagc ttcttttggtggcatccttactctgctactgaattttagg tgcgtggctt900
tgcctactca atttaaaaagaccaggtttaaataataatggtttatggca ccatcagttt960
taattattta ttatgacataggagttaggaaaacttttgatag 1003
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<210> 35
<2I1> 455
<212> DNA
<213> Homo.Sapiens
<220>
<221> allele
<222> 300
<223> 99-27110-301 : polymorphic base G or C
<220>
<221> misc_binding
<222> 281. 299
<223> 99-27110-301.mis1
<220>
<221> misc binding
<222> 301..319
<223> 99-27110-301.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 438..455
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 288..312
<223> 99-27110-301 potential probe
<400> 35
ttcacattgg gtggcagctg gtcgaaacat tcctgtcagt gactgcagga cagtaacctt 60
cagacctcga atgcccccta attttctgaa atgaagttac agttcctttt ctgttcaact 120
agcaagctaa agttcagccc tcttacctga ttccacactg atcatctgga aggaaggtag 180
gattcaagga gaactctttg agtggaagag cagtcagaga tgtaattctg.cgcctgttct 240
cttacagcaa aaccaagaac ttttgctcta agagagtgga ctttgggagt gaactttgts 300
agatgattag atggtgatgt cctttcttgt taaaggagga aatccatgta ggagcctcag 360
gatcgcacag gctgaggact gagtgttaaa catggcaggc cttccttcat ggggcttgag 420
ggatttcctg cagtgccctt cctcctctcc ctgac 455
<210> 36
<211> 546
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 400
<223> 99-27563-400 : polymorphic base A or G
<220>
<221> misc binding
<222> 381..399
<223> 99-27563-400.mis1
<220>
<221> misc binding
<222> 401..420
26
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
,, <223> 99-27563-400.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 526..546
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 388. 412
<223> 99-27563-400 potential probe
<400> 36
taaccacact gaaacctctt cggttgtctt gaaacctttc tactttttct gtactttttg 60
ttttgttctt ggtctcccgc ttggggcatt tgtgggactc cagcacgttt tctggcttct 120
gcttcatcct gctccatcgg ggaatgacac actgcggtgt ctgcagctcc tggaaggtgt 180
catttgacaa cacatgtggg agaggaggtc cttggagtgc tgcagctttg ggaaagctgc 240
ctcgtttccc ttttcctcta gaagcagaac cagctctacg agagtgagac tgggaacttg 300
atggctcaga gagcatcttt tcctcccatt ttagaaaatc agattttctc ctgtgggaaa 360
aaaaaattcc atgcactctc tctctgttaa agatcagctr ttcccttctg atcttggaaa 420
gaggttctgc actcctggaa ccggtcacag gaacgcacag atcatggcag gatgcgctgg 480
gacggcccat cttggcaagg ttcagtctga atggcatgga gaccgggaga tagaggggtt 540
ttagat 546
<210> 37
<211> 513
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 443
<223> 99-27573-443 : polymorphic base G or T
<220>
<221> misc binding .
<222> 423..442
<223> 99-27573-443.misl, potential
<220>
<221> misc_binding
<222> 444. 462
<223> 99-27573-443.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 496..513
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 431..455
<223> 99-27573-443 potential probe
27
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<400>
37
gtctcgtttcattcagtgacattttgaacacacacgtgttccctgtctgc agcacccagg60
tgctcttcacctaagataccccgtcttctgctaaaccagtacaccagttt ccacgagcag120
tttcccgaggcttctgcactcctcagcatgctctcagattgtttcccctg ccggagaact180
agcaccgtgttcttcagtaccagcatggtctcctggccagcccctaggtg caatcctcca240
acacggtgacactcagcaacctagggccaagtttacccacttgtctccct atacacaatg300
ctcctgcacctgctcacctaccaggggccgtcccgccccagcagcctacc ctgtctgcca360
cagctctgcttcctggcattcccacctctgcctcaagctttgcctttcct ctcaagctcc420
ccgccctgctctaatcttgcccktccttggctcagctccagttccacctc ccccaatact480
ccccctgtggcctctctaacccatacaccttcc 513
<210>
38
<211>
411
<212>
DNA
<213> Sapiens
Homo
<220>
<221>
allele
<222>
133
<223> base A
99-28732-133 or G
. polymorphic
<220>
<221>
misc
binding
<222> _
114. 132
<223> s1
99-28732-133.mi
<220>
<221> misc_binding
<222> 134. 153
<223> 99-28732-133.mis2, potential complement
<220>
<221> primer bind
<222> 1..19 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 391..410
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 121. 145
<223> 99-28732-133 potential probe
<400> 38
ctgttgttgt tcccccctca cacgcataaa ccagtgtacg tgaatcctaa cttgccaata 60
cctcagagat aggaaaatat attttgatgt acagacgctt tatgggcttg tgctggaagg 120
tcacgtgcct tartggtcat gagatcctgg tgcaaagtgg atagaaagtg cttctttgta 180
tgcagcgtcc tccccttcgt agatggccag ttcccccgaa tgtctttaat atctgaactt 240
gagaatgagg atgttgattt ctaattctag ccccaaccta gattgtctat ggctcttcag 300
ttatcctgga aaatcaaaat atattttact atcttgaagt attggcaagt taggattcat 360
aaacacttgg atgaccagcc acaaggcaat gtggcattgt ggttaagagg c 411
<210> 39
<211> 457
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
28
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 56
<223> 99-28735-56 : polymorphic base C or T
<220>
<221> misc_binding
<222> 36..55
<223> 99-28735-56.misl, potential
<220>
<221> misc_binding
<222> 57..76
<223> 99-28735-56.mis2, potential complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 438..456
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 44..68
<223> 99-28735-56 potential probe
<400> 39
ttgtcctgat taccatttct aagactaaag aatctttacg tggtgaaagt cctagycagc 60
catcattcgg cacaacagtg gcttgtcaaa agggtatgta gcaggtcata ccagcctcag 120
gagggtagag caaagcaaaa aaggaaatct tgccatgtca tgtttcaaag ctcttgtgaa 180
tcttgagatc tcattagaaa tctgtcacag ttttaataga gtcccaccaa gatgtgctct 240
gcctgctctt ttgcaggttg gtcaggatag gaagcagggc ctccccagtg ccagttcctc 300
ggggaacaat tcacgagaat ctaaggagtt gtctcccagc agtgccagga aagagtggct 360
gccaaaatgt tactagtaat taaggactag gcacctgagg gcagcaacta agcacatact 420
agttattata acatccagta gaacaaatga aactcct 457
<210> 40
<211> 453
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 399
<223> 99-28736-399 : polymorphic base C or T
<220>
<221> misc_binding
<222> 379. 398
<223> 99-28736-399.misl, potential
<220>
<221> mist binding
<222> 400..418
<223> 99-28736-399.mis2, complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
29
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> primer bind
<222> 434..452
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 387. 411
<223> 99-28736-399 potential probe
<400> 40
gtttcttatt actgattctg aacatctgtc acaaagcaga ttttgttcag gacattatga 60
acaactgcat cattcattac cgggtgaaat aagtgtaaca ccaccaggcc actataccac 120
cagtgacatt catttcccac aaaacatcaa cactgaaaca tacactacac atgcacacaa 180
aatggcatga atacaatgat tattcaatgt atagtctaaa tatttcttat ccttttaatc ~ 240
cacttgtatg aaattccttt tctcaagata gatgaggggt aaaagtgaca ttttctaacc 300
ttctcctcta cttcgaaatt ctgtgaactt cctctaatca gaactaagta gcggtgcagt 360
ttctctttaa tgataaatga tttgttggtt ttttgtgtyc attgcttaga agcagtgagt 420
gttaaggaca acaccttaaa agtgttagct ccc 453
<210> 41
<211> 458
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 319
<223> 99-28738-319 : polymorphic base C or T
<220>
<221> misc_binding
<222> 299. 318
<223> 99-28738-319.misl, potential
<220>
<221> misc_binding
<222> 320. 338
<223> 99-28738-319.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 441..457
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 307. 331
<223> 99-28738-319 potential probe
<400> 41
ggagagacac actgagacat tctcttctag tccagactat gagagcatgt aacacatata 60
acatgagacc cagcacctag caccgtgtca gacacatgat tatctgtgta atgactgagt 120
aagcaaattc agagatgtgc tctcaaagcg atctggcagc aagttacttc cttcatgcct 180
tcactgacct tgactctgac attgttcttc ataccaggat ttttagagac ttctcacttc 240
atccaaacac cccagctggc agtgctacta gtgtgcagcc accatcaggg aaaagctttg 300
gattctatgc aaaacaggyc ctcagggttg taacaatgtg ggJgcctgag tggcaagggg 360
cccagggctg aagtcagagc cctagaggag actcctggct acctagatgc atctgggaaa 420
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
ttaacccctg ggccttgctc gctgtwacct gcaatacg 458
<210> 42
<211> 509
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 364
<223> 99-28739-364 . polymorphic base C or T
<220>
<221> misc_binding
<222> 345. 363
<223> 99-28739-364.mis1
<220>
<221> misc_binding
<222> 365. 384
<223> 99-28739-364.mis2, potential complement
<220>
<221> primer bind
<222> 1..17 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 489..508
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 352..376
<223> 99-28739-364 potential probe
<400> 42
ctcctcctcc aaaacacacg gagacactgg tatttgtgtg cacatgtgtg tacatatgta 60
caaatgtgtg actatgtatg tgtacgtgtg tacacgcaca ctttcttttt aggaagactc 120
caaatcatct cgggacttta gacctggaga acgtaagtct cctgggtcag acgcctacca 180
ggctgtcctc ttttatccaa actggcagat ctgcattggc tttaggcact gaccctcatt 240
cacatggctg tgtgcccaga gcaggtatcc tataccccgt gtgattctca ttggtctaaa 300
tccttgcaaa tgatggatgt agggtaagca tgtgactcag ttctgcatac tgggatgtga 360
ggaygggtaa actaggaaga aattcctgga aaagttttct cattcttaaa ggaacacaag 420
gatgagacac ctccttccgc cagagtgtgg ccatgataca tggaactgtg gtagtcatct 480
cgtcccgcca gggaaacaag acagaggcc 509
<210> 43
<211> 549
<212> DNA
<213> Homo Sapiens
<220>
<221> allele '
<222> 185
<223> 99-27875-185 : polymorphic base C or T
<220>
<221> mist binding
<222> 165..184
<223> 99-27875-185.misl, potential
31
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> misc binding
<222> 186..204
<223> 99-27875-185.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 531..549
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 173..197
<223> 99-27875-185 potential probe
<400> 43
taagggtaaa ggagagagat ttaagattaa tatagtaaaa accctataaa cctaacttta 60
agttaactat taagtatcta tattaactca tgaaaagttt atcttttaaa aaatatcaac 120
ttcctagctc agatcactga caaggtttat aattagtgat caataccatc cccactaata 180
agtaycaagt accagggctc cttggagaaa tgtctgattc caagtctggg acaggaaatg 240
tataagatga gatggcaata tcttgtcata ttaaaggaag ttttcagaga ctacaagggc 300
tgtgtcaaaa ggactcagca gagaactcct agtcaccaaa gactggacaa tttaaccacc 360
aataagataa ctgcaactga ctgaatatca aatatttgaa tctaaagttc acaacagtag 420
gaggaaaaaa cgaaaaggca ggcaggaact cgtgcatttc tgaaggatgt tagggaacca 480
actaatggaa aacaggttta aaaagacaag gggtgggaga atggatgaag macttattct 540
cacctttct 549
<210> 44
<211> 462
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 176
<223> 99-27880-176 : polymorphic base C or T
<220>
<221> misc_binding
<222> 156. 175
<223> 99-27880-176.misl, potential
<220>
<221> misc binding
<222> 177..195
<223> 99-27880-176.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 444..4-62
<223> downstream amplification primer, complement
<220>
32
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221>
misc
binding
<222>
164..188
<223>
99-27880-176
potential
probe
<400>
44
gtagggtgaaagttgtggcaggaggattgttctagatatctagggcagacaacattgctg 60
aagttggggtgaggatgtatcagtaaccaactggagttctggaaacaacctccgtccagg 120
tatttggggggcctatatgacagaaaggccagcaagcaagcttaccctcatcactyactt 180
ggcctctattcaaatagcctacttttgtctgatctatccagggatgtgtgggaaggcata 240
ttggggctggtgagttctatatttctttagaaatttattatgactcagctgtttatgact 300
taagttttttgtgatttctatacgttattcctggtatcatctcttagagtaatacattcc 360
atataaaatacgaggtgtagctaaacataactttctaaggccccaaagtgttttcccagc 420
cccagcgcccacccatttcctgtcttctcttcttactcactg 462
<210> 45
<211> 497
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 373
<223> 99-28747-371 : polymorphic base C or T
<220>
<221> misc_binding
<222> 353. 372
<223> 99-28747-371.misl, potential
<220>
<221> misc_binding
<222> 374. 392
<223> 99-28747-371.mis2, complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 478..496
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 361. 385
<223> 99-28747-371 potential probe
<400> 45
agcaacactc agtgggctcg tcgccatgac gccagcctgt ggaggaaagt ggggagggga 60
ccaacacagg acccctgtgg cagaagctgc cttggaactg agaaacatca ctagaactca 120
tcaagccctc cacccacctg gtgcagatga actgaggtct gaagagggga gaccacctgc 180
ccaaagggag aaaagcagtc agtaggatgg ccgggattag atctggctct cagttcctag 240
ttcctatgaa gtaatgcagg gagaagacag ctggctggca ggatgccagc agcatccctc 300
caggggggca aggggctgcc tttctctaca ggcttttagg gaccagacct tctcaatcta 360
gatagacaga atyctccctc ccaggacatc cccagaagcc acagagttct gggggctctc 420
agagatagca ggagaccacc accccagaat gaggatagcc attcttggtg tgagcrggat 480
ttcccctacc caaggac 497
<210> 46
<211> 448
<212> DNA
33
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<213> Homo Sapiens
<220>
<221> allele
<222> 352
<223> 99-28753-353 . polymorphic base C or T
<220>
<221> misc_binding
<222> 332. 351
<223> 99-28753-353.misl, potential
<220>
<221> misc_binding
<222> 353. 371
<223> 99-28753-353.mis2, complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 427..447
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 340..364
<223> 99-28753-353 potential probe
<400> 46
ccacagccct cgctattaac catggggcag tactccctcc acaagaggca ttcggtttgc 60
gaggagagct tagaggtttg gaaagaagac tcatacctcc ggcctggagg atcagggagg 120
acttagccct ctgagctgga cttctgggga caggttggat tttagcaggt gagtgtaata 180
ggcacaggag aggccctcta ggctgagggg actgagcaaa ggcaaggaga caggctgggc 240
tttgtgcctt gggaggagtg tgttgtatgg agaacaggga gtaggagaaa gaaacaatga 300
ggctggggag gggcatggag gtcaggtgat gcagggcatt ctacagggct tyaccatctg 360
gagagggagc ctgggtgagc ttgtgagcag agaagctcaa ttttgggagc acactgtcct 420
ctggaggaaa ggagaagtaa ggggattt
448
<210> 47
<211> 471
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 207
<223> 99-28755-206 : polymorphic base A or G
<220>
<221> misc binding
<222> 187..206
<223> 99-28?55-206.misl, potential
<220>
<221> misc binding
<222> 208..226
<223> 99-28755-206.mis2, complement
<220>
34
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 452..470
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 195..219
<223> 99-28755-206 potential probe
<400> 47
tcttgaggga tatgaggcat tataaaaatt cctgggttgt gggagaatga gtacttatca 60
tcttctcctt~tgagttaaat ttttttgtgc ccaattttat agaaatcatg tggatccctt 120
ttgcaaatgg atgaatgctg ttagaagctg aacaggcaag gctgtatgtt tggagaagct 180
gggaccctat ccgctgcact cagagcrggg accatccgcc aagggagaca gggaagggtc 240
tgtgccacct gctggaggga gggcagagga aggcagggag aaggctatgg gtctgctgac 300
aaacccacgc tgcctctgag ggtgagggaa ggttgggctt tcctgaaggg aggggcctcc 360
atttcctgtc tgatgctggc atggcctgtg ctaggtgtcc ccgtgggctc tcattcagcc 420
ttcactgtga gcctccgagg tggacttaga tccattgcta aacagatgag g 471
<210> 48
<211> 541
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 366
<223> 99-32333-366 : polymorphic base C or T
<220>
<221> misc_binding
<222> 346. 365
<223> 99-32333-366.misl, potential
<220>
<221> misc_binding
<222> 367. 386
<223> 99-32333-366.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 520..5_40
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 354. 378
<223> 99-32333-366 potential probe
<400> 48
acttagttca ttctttgagg ttaaatgtcc tagaaagaac yayacggttg atgtctaaca 60
ttacgtacac tcaagcttta gaatggccaa gtggatgacg ctgtttcttt caattaacct 120
gacatataca acctctcctt tctagccatt cttctggttg gctttcctag taatctgccc l80
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
aggagtgtaacttctgcaggcagaggtgaggtaaaaatggtgaagtaaggcaaggagata 240
aagaggaagaaggcaaggagcagtgattcagaagcatcagaccgaaaagaaaatttgtgg 300
gagctgatgaagacttcttataaacttctatcttcagcaatacttgaatgctaggaaagg 360
ctataycccagacaactattatcccatttatgatctgtcaagctttcacagtgaaatcac 420
tcaggattcttattttttttaaaaaaaccccagatccctgggtctcagacctagtgaatc 480
agcatctccagagtagaacctaggaattcacatctttaccccaaaagtaccccagacaat 540
t 541
<210> 49
<211> 4I6
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 323
<223> 16-38-323 . polymorphic base A or C
<220>
<221> mist binding
<222> 300..322
<223> 16-3B-323.misl
<220>
<221> misc_binding
<222> 324. 346
<223> 16-38-323.mis2, complement
<220>
<221> primer bind
<222> 1..28
<223> upstream amplification primer
<220>
<221> primer bind
<222> 389..416
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 311..335
<223> 16-38-323 potential probe
<400> 49
agttgctctt ttatgttttg catcttacct ggtattgcct ttgcccattt cactgctgca 60
atcacttgcc gccctcctaa catgttgagc gtagtcatga tcctccaagt tgagtctgga 120
acagagctat catatcctgc atataacact tcaggttcaa taacctccaa cagtgacacc 180
agggtagggg tgagttgtgg taacgttgca ggaactattg ttttgttacc aggattttca 240
gaggtttctt gtgagactcc tgtagtggcc tgctgaattc cttttatttt tttctttgtt 300
tttcgagctg tgggtattta aamaaataca tagaaatgaa ctgtaatggg aaggtctgcg 360
ctacacagtt tattcaagaa~gtatttttac tttctaaaac tattaagatg ggagaa 416
<210> 50
<211> 506
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 179
<223> 99-28484-179 : polymorphic base A or T
<220>
36
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> misc binding
<222> 160..178
<223> 99-28484-179.mis1
c220>
<221> mist binding
<222> 180..199
<223> 99-28484-179.mis2, potential complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 488..505
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 167..191
<223> 99-28484-179 potential probe
<400> 50
gcggctacaa aatattctgg tactccatcc tagaccagag tttcaaggtt cgttatcatt 60
tgtagcatga tactggatcc tcacagtgct tgcctttcat tcaggtgcca ggaaacgtct 120
gcctgaatga atgggtgtaa tttacctgca cattttacat gcttctctag gtgtgtgawt 180
aactcataat ccatccatga ctttcaccca taatcctcct tgtagcaatt gctttgcttg 240
caacaaaact aagtagacat atctagcttt atgcatggtt ttctctctct gaactctaac 300
ataaactcag cctcaggaat tattcggttt ctactacatt tgccattctg attgggaacc 360
accagcattc aggtattcac ctggaacaag gcattttgtt ccaagggttc ctcacttaaa 420
agcaagcacc ctagcaatag ttcataatgg aacttcttaa cattctcaga atgtttggca 480
cagctgtgag tgaacacaca ttgagc 506
<210> 51
<211> 486
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 364
<223> 99-30853-364 . polymorphic base A or G
<220>
<221> misc binding
<222> 345..363
<223> 99-30853-364.mis1
c220>
<221> misc binding
<222> 365..384
<223> 99-30853-364.mis2, potential complement
<220>
<221> primer bind
<222> 1..17 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 465..485
37
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<223> downstream amplification primer, complement
<220>
binding
<221>
misc
_ 376
<222>
352.
<223>
99-30853-364
potential
probe
<400>
51
tgttctcaagcaaggtcggcaaactatgacctgcccgtcaaatccaacctgccacctgtc60
acctaacaattctgtaactgctcccacatacaacatggtcgtcatcataaatcctatagg120
tattgttgagagcaggaggaaagtttggttgagtgagtgagagaccttacccaagccttc180
ctgtggtctctaggagtcatggcagagttcgctgacactggtctgcttttaaccagcctt240
gccagtgacctttcaaattccctgaggagcaaaaggccaaattgaacctgaaagaaaaca300
cctctcagtgttgactgagttgcagtagaaaatggacctgacaaaacgttagtacacttt360
ctcrattgggttagctcaaaatatgttattaggtcttttttccagaggaaaatgcttaca420
cagaccctcttcctccccactccttcacctctacaggagaaaatgaggmwwyacagaaca480
ctatta 486
<210> 52
<211> 467
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 198
<223> 99-28485-198 : polymorphic base G or T
<220> .
<221> misc_binding
<222> 279. 197
<223> 99-28485-198.mis1
<220>
<221> misc_binding
<222> 199. 217
<223> 99-28485-198.mis2, complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 449..466
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 186..210
<223> 99-28485-198 potential probe
<400> 52
gcattataag gcaacacctg gatctgaatt cagctctgcc taattccaaa atctatgcac 60
ctcataacct tgtgactgtt gcctggcagg ggcctgcaga gtagcatcca ttaagcttga 120
cagagttttt taagattatg tgggtcactt aacagacagt cttaaggtaa ggttaaacat 180
caaagttaat ttctgttktc tatctatcct gccccttcta tccttcatat cacaatggag 240
cacaaattat aattaagaga tacaaaagca ttcagtcact tccatttttt tctttagata 300
cttactatat taagtcttaa atgaacatat tggcattcca aattattaag ataatgtcat 360
gctggtcatt gaaatgctaa attaacatga agactacatt tcaaaaatac aaaagtataa 420
ataggagtgt tttgtatatt cataccacga tttttgccct tagagga 467
38
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<210> 53
<211> 474
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 354
<223> 99-30858-354 : polymorphic base C or T
<220>
<221> misc binding
<222> 334..353
<223> 99-30858-354.misl, potential
<220>
<221> misc_binding
<222> 355. 373
<223> 99-30858-354.mis2, complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 456..473
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 342. 366
<223> 99-30858-354 potential probe
<400> 53
aatctactgg gaaactgtcc atttcaacaa gagcacctca gacagtaact ggaaagagaa 60
atagctcata ttctcaggaa cgttagtcat cttgaagcag catgattcgt gatacctgga 120
aaatgcacat ggcagtcact aaaattgggt tctagggata cttttaataa gatttgagag 180
gagctggatc cattcattcc catggtacct aacacagcac cactacacag caggcctgtc 240
ccaaatttcc tttgctgctg gagaacatcc tcatggggga gcccccaagc tgcctaggaa 300
atgggttaac aggagggcac tcagggatct ccttcagttt ctccagccat cttygctgcc 360
acgcccaagc ccaggccacc ttcacctctc acctgggcgc ttccactggc cgcctgacac 420
atcttgtcac tggcttceac tcttgctccc agaacccctt cttcacatag cagc 474
<210> 54
<211> 489
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 311
<223> 99-32002-313 : polymorphic base A or G
<220>
<221> misc_binding
<222> 292. 310
<223> 99-32002-313.mis1
<220>
<221> misc binding
<222> 312..331
39
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<223> 99-32002-313.mis2, potential complement
<220>
<221> primer bind
<222> 1..19 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 472..488
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 299. 323
<223> 99-32002-313 potential probe
<400> 54
aagaccacat ttcagcaagg actggctctg aatgacacct ggattctatg gcctttccct 60
ccactttggg aagctcttta gttagacagg tactgtaggc ggcaggagaa aaaaagctaa 120
ttattacttg ttggagtctt gtctcaggca tgctgtgggg ctgtgcaaga ttcgctgctc 180
tgctgctgtt gtcattttga tgctacaatt acagagaggc ggttcagcac ccagccgatc~ 240
ggtgtggctg ccaaacacat ttgagcatga caagataaat ttgttagaca ccagcacagg 300
gtgggtgaga rgacatcctg ctgactttat aaagtgatgt ggggcagggt tgtcgaggta 360
agtgatgatt gtcaagtttg ccagagatga tagataactc ctttggcaga acacctaggt 420
cattcctttt aaagtcaggt agctaagagg ctgtttggtt tctgcagcgc tgctacctac 480
ttggggaac 489
<210> 55
<211> 526
<212> DNA '
<213> Homo Sapiens
<220>
<221> allele
<222> 366
<223> 18-15-366 : polymorphic base C or T
<220>
<221> mist binding
<222> 347..365
<223> 18-15-366.mis1
<220>
<221> misc_binding
<222> 367. 385
<223> 18-I5-366.mis2, complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 507..5-25
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 354..378
<223> 18-15-366 potential probe
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<400>
55
atgaaattagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaaggaa 60
actccagccagaactggcagcggttttatcaactgacaaaactcttggattctatgcatg 120
aagtaagtgtcaaacataaagccaaatataagagttttctgggacaaagtatgttttgat 180
tagtgaatataattatataccagcagcgcccccacccccgcccccagtttgtggatgttg 240
gtgatagcttgagttcaacttatgaacttcagttttgtagacatttttcctaaggccaat 300
tatgaaatatcctttcacctagtcatgtgtatataaaatcaccatgttattacagaattt 360
agtaayactgtttttaaaaagtatgattaatccattaaattagaataatgcacccttcat 420
atattatggtactacagtgattcatgaaataattctatataattctacatacaatcaaag 480
aaatataaaatgtgttttgtacggaagtgcttatttttcatctggg 526
<210>
56
<211>
426
<212>
DNA
<213> Sapiens
Homo
<220>
<221> le
alle
<222>
174
<223> 0-174
18-2 : polymorphic
base
A or
G
<220>
<221> binding
misc
<222> _
155. 173
<223> 0-174.mis1
18-2
<220>
<221> misc_binding
<222> 175. 194
<223> 18-20-174.mis2, potential complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> grimer bind
<222> 408..425
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 162. 186
<223> 18-20-174 potential probe
<400> 56
ttctctcttc agtgttcatg aaccacagat aagttccttt cccacatttt cacagtcata 60
ggatccagta aggaaggccc gagtgatact tgctgggtca ctgagctggt gatgcctggg 120
ctcagctcca gacatgctgg gtcccaggcc tgagcttgtg tcttcaaact aggratacat 180
caattactta attattgctg gtacaaaaca gggtctaagg aaggccaggc tcaagagcac 240
agttaaaaaa gaaatcccct ccacagctgc ccttgccctg gttggggtgg aggccagcag 300
gcccctcatt gccaggtagg aagcattaga tacgcctgat gagctagaag ctttcttttt 360
tadacaatga agtagaggca aggtgttcta actccccgtc cagagaagag smaggaaagc 420
tagaac 426
<210> 57
<211> 458
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
41
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 178
<223> 18-31-178 : polymorphic base C or T
<220>
<221> misc binding
<222> 158..177
<223> 18-31-178.misl, potential
<220>
<221> misc binding
<222> 179..197
<223> 18-31-178.mis2, complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 437..457
<223> downstream amplification primer, complement
<220>
<22I> misc binding
<222> 166..190
<223> 18-31-178 potential probe
<400> 57
gtttttgtat gattcagtgt gaattaaatc ccacagtgta aaggacttta ctttcttaat 60
gtagattttc aaatacacaa ttactgatgt ttataagtag atttattaca ccaaagcacc 120
tagcaaattc ttgaatggat caggtcttat ttttcagtct tactttgcaa atttaagyca 180
aataattaag gatttgttaa atatttgtct taatatcaag cttttgcata tcggggccct 240
cttttataag ctttataagc aatcttttgt tttctctgct tgctcaaagt agctatgttt 300
gttgtatctg ttagtatttg ctctataaca aacatactgg gtgccttccc acttagattt 360
ggcaattatc actcctgtaa atgagatatt acataagata ggaaaaagaa cagtatcttt 420
ccaagaagaa tagtatcctt ccatattaac agtttaga 458
<210> 58
<211> 474
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 395
<223> 18-38-395 : polymorphic base A or T
<220>
<221> misc_binding
<222> 375. 394 .
<223> 18-38-395.misl, potential
<220>
<221> misc_binding
<222> 396. 414
<223> 18-38-395.mis2, complement
<220>
<221> primer bind
<222> 1..19 -
<223> upstream amplification primer
42
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> primer bind
<222> 456..473
<223> downstream amplification
primer, complement
<220>
binding
<221> misc
_
<222> 383. 407
<223> 18-38-395 potential
probe
<400> 58
actgtaattg tatggtaaca tttaactgtacaggacttgg gaagttaggt ctagctgtga60
gtccaagaaa aggaaatgat tttgttcatcagccaacaat ttttgctata aaagcaaagc120
aatgtgagtg ggggccctaa aaatccccactgttttcgcc attctgacta ccacccactc180
cccaccaaag gtccctgggg cacaccctgcagaccttatt actttagggc acacattttg240
aaaagggctg actttgctaa tttgacttggcattttgatt aaagttactt tcatattttg300
attaaagtta taactgcatg atacaggcatactcttatca ccagtgcttt aagaacatga360
aacgggaagc tgatgacttc taaaccatttcacawtgagt ctaaattcac tgcttaataa420
taaataacaa tgataataat agtaacagatgtgtaccact cacatatacc acca 474
<210> 59
<211> 469
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 192
<223> 18-2-192 : polymorphic
base G or T
<220>
binding
<221> misc
_
<222> 172. 191
<223> 18-2-192.misl, potential
<220>
<221> misc binding
-
<222> 193..
211
<223> 18-2-192.mis2, complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 450..468
<223> downstream amplification
primer, complement
<220>
binding
<221> misc
_
<222> 180. 204
<223> 18-2-192 potential
probe
<400> 59
catcaaaata tcccaaaaga tgtttggaaaatatgttttt ataagaccta tagattgtga60
ttgagtaggt ttgaggtggg gcctgtgtatttgtattttt caacaagctt ttcaggtgat120
tatgataagc aaccagattt agaaaccagtgaataagttc aacgagatga tttgcacagt180
ggcctctttt aktcatcact taggttctgttatttttaga gccaaattaa tcaatcagtg240
cattgtttta acatccttgc cttacatatcttttccaaaa atttttaatt ttaaagggaa300
gaagggaaag ggaaagataa tttcctatgtttgtgtgaac acatccttgg ctcttctaat360
aatatgaaat acagtaaata atgacttgtaactattataa ttgtttttaa cattcatgaa420
43
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
tgaaaactaa ctacaatgtg ggttgattgg attccaggtt tcactctgc 469
<210> 60
<21I> 451
c212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 211
<223> 99-26921-210 : polymorphic base A or G
<220>
<221> mist binding
<222> 192.'210
<223> 99-26921-210.mis1
<220>
<221> misc
binding
_
<222> 212. 231
<223> 99-26921-210.mis2, potential
complement
<220>
<221> primer bind
<222> 1..21
<223> upstream amplification primer
<220>
<221> primer bind
<222> 431..451
<223> downstream amplification primer,
complement
<220>
<221> misc
binding
_
<222> 199. 223
<223> 99-26921-210 potential probe
<400> 60
gaggaagatg ggttacttat ccatcaaatc cagactcatg gctgcttttc60
atgttagtca
ggggggcatt agccccaccc gcactgctca tttgagccaa gaggagctcc120
cctgcctggg
agtggccaga gaaagcctgc aggcaaaaac cagaggcctt aagttcatgt180
ttgcatcaga
gtatgaaaat aagtgccaag gagatttggt caatgtctgc tacaaatgtc240
rggatccctg
aagactcttg gctggaaacc tggccagaat ttcctgaaac cggaaacatt300
atggttccac
ggtggccaaa gaagaaggag caggcaaagg gcaaaggaga ctggtggagc360
aagggagctg
actagcgatt taggagggaa gcaggaaatt gggagtgatg agaagtgacg420
gtactatcat
ttttagaatg cccakttaat acatagccca 451
a
<210> 61
<211> 327
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 250
<223> 16-215-80 : polymorphic base
C or T
<220>
<221> mist binding
<222> 231..249
<223> 16-215-BO.misl
<220>
44
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> misc_binding
<222> 251. 270
<223> 16-215-80.mis2, potential complement
<220>
<221> primer bind
<222> 171..188
<223> upstream amplification primer
<220>
<221> primer bind
<222> 284..3-03
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 238. 262
<223> 16-215-80 potential probe
<220>
<22I> misc_feature
<222> 29
<223> n=a, g, c or t
<400> 61
ccctgcccac cttccaagta actctgtgna acctcttggt tcccttgaag ggtgattcgt 60
caacccgtgg gcaggatttt ctttgcgggc acagagactg ccacaaagtg gagcggctac 120
atggaagggg cagttgaggc tggagaacga gcagctaggg aggtaagcag gaaagcccag 180
gctctctccc tcccccatgg tgactttctt tcaggtctta aatggtctcg ggaaggtgac 240
cgagaaagay atctgggtac aagaacctga atcaaaggta agtttggtga ctctgggcac 300
tatctctcct tagaccaatc atggaac ~ 327
<210> 62
<211> 480
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 368
<223> 18-132-368 : polymorphic base C or T
<220>
<221> misc_binding
<222> 348. 367
<223> 18-132-368.misl, potential
<220>
<221> misc_binding
<222> 369. 387
<223> 18-132-368.mis2, complement
<220>
<221> primer bind
<222> 1..18 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 461..479
<223> downstream amplification primer, complement
<220>
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> mist binding
<222> 356..380
<223> 18-132-368
potential probe
<400> 62
ccccaactaa ttctcccctgttgttcagaatgaaattcag aatatagtgtcatggaaatt 60
gaactggcct ttttaactgtatcaaacatggtagaaagat tggtgagcatgagaaaacac 120
caaaagattt atcgaagtacacagtgtcctctggctgttg gcccctgtgccttgtctgca 180
gattggggaa tcaccccaggtcgggcaatgcttgctctcc attggcctcccatgtattcg 240
aattagcatt gagagcaagagagaggcaggaacgagaaac agggtcctggaaatttgttc 300
tcttggggca agtgcatggccactgatgcctgaagatttg gatgcagaccagacaacctc 360
ttggggtyct tttctgcattgaggtttgatttttattgag ttaaaatcttaacaataaag 420
atattttagg atggggccagactgcaaagtacataaaagt caggaaggagaacacaaaga 480
<210> 63
<211> 505
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 292
<223> 18-133-293
. polymorphic base
A or C
<220>
<221> misc
binding
_
<222> 273. 291
<223> 18-133-293.mis1
<220>
<221> misc
binding
_
<222> 293. 311
<223> 18-7.33-293.mis2,complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification
primer
<220>
<221>.primer bind
<222> 487..504
<223> downstream
amplification primer,
complement
<220>
<221> mist binding
<222> 280..304
<223> 18-133-293
potential probe
<400> 63
agatgtgaga agtgtggctagctgacagccccttgctgtg attttcttca ggatctgcct60
cagctttagt gttaacttcacaatattcttggggaaacac aagccaatga ctaaacaaaa120
cagtcttcat aggaaaacccgcagtgaatgactaagcaag gcagtggtat ggagctagac180
atttattcca gttgagtaactccgggcttctctgagaagt atctttcact gggaactccc240
acttggctgg cagagactttccagatctgcatctggatag ccctcttctg amgtttcctt300
tcagaaagag agataaagtttattttttgtttgtatgaag atgaatttct tttgccttca360
caattgaata acaacttaccttggtaaaggatttttggct caaaataact tttcctctga420
accgtttctc cccagtgcctaatattgagcaaatgtcaag cctagagaac agttaaaaga480
atatttgacc aacaccaacatagtc 505
<210> 64
<211> 450
<212> DNA
46
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<213> Homo Sapiens
<220>
<221> allele
<222> 191
<223> 1B-12-191 : polymorphic base A or C
<220>
<221> misc binding
<222> 172..190
<223> 18-12-191.mis1
<220>
<221> misc_binding
<222> 192. 210
<223> 18-12-191.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 431..449
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 179. 203
<223> 18-12-191 potential probe
<400> 64
tttgcctagt tttgactgtt ggagcatcat attaaagttt tacatattaa aaaataaagt 60
caacaaggtt ggggaataca tgcaaaaaca aaacaaaatc cctaaatgtg aacaattggt 120
atcagaacca cagagaaaaa aaattcaaac taatcctagc attttgaaga caatgctttg 180
actatatgcc mttggtggaa aacattctaa agataaaatt gcaatgaaat tttaaacatt 240
gcatttcatt tattggtagt ggtatgggta tagaaattct gaaattaatt tcttgtatgg 300
taggatatag aaaatataaa taataaatat atcaatggtt tggggacaaa gttactcact 360
gtgagaaaaa tgaggaaaaa taaagaattg gaaagtagca agagtcctgt gttcgtgaat 420
tgggattaaa ggtattgata tataggagca 450
<210> 65
<211> 536
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 138
<223> 18-11-137 : polymorphic base A or G
<220>
<221> misc binding
<222> 118..137
<223> 18-11-137.misl, potential
<220>
<221> misc binding
<222> 139..157
<223> 18-11-137.mis2, complement
<220>
47
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> primer bind
<222> 1..18
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 516..535
<223> downstream amplification
primer, complement
<220>
binding
<221> misc
_
<222> 126. 150
<223> 18-11-137 potential
probe
<400> 65
tttctcaagt ggctctggca tctgttaaaatgccaaactcgtggtcctta acaccttgtg60
atgctggcac ctctctgcag acttttctcaatgtaacctcagaagttggg gaggactggg120
gagaagggag gtcctgcrgg gaggagaaaagggaaagtgggcaactccac tgaaggctgt180
cacacatttg ggggctgttc ccgacagttttaccttcctctttgggcccc tcctttctct240
tccctctcag tccccttgtc agatggttgatggggatcactgggagttgg ggtgactgtc300
aggaaggcag agagggggtt tgggcagcaggtgggaagtggggccaggtg gcctctcggg360
gttctcccac ctcacagttc tggggagttcagggttctgcaagcagagtg atccttaatt420
aataaacagc ggggcaggct cgggctccacgtcaggaaaactgcagtcag ccacgctggg480
ccacccgccc tctgcagagc acacgcaacagcgcagtcattaaagctgaa ctgagc 536
<210> 66
<211> 454
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 96
<223> 18-93-96 : polymorphic
base G or T
<220>
<221> mi'sc_binding
<222> 77..95
<223> 18-93-96.mis1
<220>
<221> misc binding
<222> 97..115
<223> 18-93-96.mis2, complement
<220>
<221> primer bind
<222> 1..17 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 436..453
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 84..108
<223> 18-93-96 potential probe
<400> 66
caaatgccaa agggttcaca atgctgagat ttatcttact gttattttat aattttgagc 60
agcatttggt tttagtgggt tgtggcagaa attgtktctc tacagaatat tatcttaaga I20
48
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
gaacatattg aacataaagttaaaagttttccatcccttgaaattcacta gtggtaactt180
tgaacttcaa gaaaatgtcatttgagtttgataatgtctcaataaagcct ctctctgatg240
actaattctt agtcatctctcccttctcttacttcatatggcacttatta tagctttgtc300
acttgatcta gactactctgcattgctttttatttttttttctggaaaca tcaaggttag360
gaatcatgtg ttatggttctgtgtcactcgtacctggggcacctaagtgt acatatatat420
gtgtgtgtgt gcgctctgggctgtttaaccttat 454
<210> 67
<211> 553
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 343
<223> 16-115-343
: polymorphic
base A or C
<220>
biriding
<221> misc
_
<222> 320. 342
<223> 16-115-343.mis1
<220>
<221> misc
binding
_
<222> 344. 366
<223> 16-115-343.mis2,complement
<220>
<221> primer bind
<222> 1..24
<223> upstream cation
amplifi primer
<220>
<221> primer bind
<222> 533..553
<223> downstream
amplification
primer, complement
<220>
<221> misc
binding
_
<222> 331. 355
<223> 16-115-343
potential probe
<400> 67
caccgtcaca ataaaagaaactgtggtctctacacctgcc tggccccaca tctgtgccac60
agagacagac cctgggatcctcagactcccacacccccac cccagcctca ctcagaggtt120
tcgccctggc ctccttcctcctctgggagatggctggccg ccctggccag gcagctggcc180
cctccgggcc tggtttccccgctcaccctgaggccccgcc cagctctgag ccccaagcag240
ctccagaggc tcgggcaccctggccgagctgccccatctc cgtggggtgc cctcccaagg300
tggggagcca cgtgacagtgggagggcctctctcaggcct ggmagggagc aggggtcaca360
aactgtgctg gctgggggtggtctcagaggtgggcctgca ggcctaaccc tccctgctga420
cagggctccc agcccttgagagaaacagggatggaggaac agctgccctg atgccctcac480
ccacccggag caggccctgcgaaccaaggggaacctcagt gtggccccca gcatgtgtgc540
tgatggggag ggt 553
<210> 68
<211> 171
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 140
<223> 16-42-140
: polymorphic
base A or G
49
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<220>
<221> misc_binding
<222> 121. 139
<223> 16-42-140.mis1
<220>
<221> misc_binding
<222> 141. I63
<223> 16-42-140.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 154..171
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 128..-152
<223> 16-42-140 potential probe
<400> 68
cattgggcgc aggcagagcc tcatcgagga cgcccgcaag gagcgggagg cggcggtggc 60
agcagcggcc gctgcagtcc cctcggagcc cggggacccc ctggaggctg tggcctttga 120
ggagaaggag gggaaggccr tgctaaacct gctcttctcc ccgagggcca c 171
<210> 69
<211> 494
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 176
<223> 18-251-176 : polymorphic base C or T
<220>
<221> misc_binding
<222> 157. 175
<223> 18-251-176.mis1
<220>
<221> misc binding
<222> 177..196
<223> 18-251-176.mis2, potential complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 474..493
<223> downstream amplification primer, complement
<220>
<221> misc binding
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 164..188
<223> 18-251-176
potential probe
<400> 69
gaaaccccct cacacatcctggcctctactcgtacacaatattttctttt ttttaacttg60
gctgcagtga aaaagaatatttttagtaagctacttgttgtttacctaaa gcagccttaa120
gaagcccaga gcaggggatctgttaagtgaacgtagaagtggaagacaga tttgcytctc180
tcaggcacta gggcacttggctgtagaggggtgagtatggcaaacatcat gggaattatg240
agtagtgcgc ccacatccaaagctgcacgtgggttttcctgggcaaagaa actcaatgac300
tgtgcatcaa gagtgtacccagtctgacagcaggaaattgacagaaacga acagccccaa360
gccccagggc acatggaggcactcacctcaggcacracatttcagcagga gccaaaatca420
aaataaataa tattttattacaattttttaaaagacaggatctaacaggg ccagatgagg480
gtaaagcgag tgaa 494
<210> 70
<211> 478
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 44
<223> 18-269-44
: polymorphic base
A or G
<220>
<221> misc_binding
c222> 25..43
<223> 18-269-44.mis1
c220>
c221> misc binding
c222> 45..64
c223> 18-269-44.mis2,potential
complement
<220>
c221> primer bind
-
<222> 1..17
<223> upstream
amplification
primer
<220>
<221> primer bind
<222> 457..477
<223> downstream
amplification
primer, complement
<220>
<221> misc_binc3ing
<222> 32..56
<223> 18-269-44
potential probe
<400> 70
ctcatggtca gttgctcctggcttggcmagatggatggtcaggracttga aaggaacaca60
tttgggaaaa cggtagcaggaggtgtggggaagtgttgtgtggttagagg tctctgaaag120
ggcagagcgt gaagatcctcgcagcccatgtgacatttgccaaagggcaa ccgcctcagc180
cgaggagaag ctcagtgaccaggtagacaagatggccctttctttgggca tcagtcaggc240
tccttcccca gccaccctgtcattgtcagcaggctggtgaagatagagac tgtggtagca300
gggatggagg tcacacatgggatcggcacaggggctccactcaccaaggc ccatccacta360
agtgcccgcc tgccccagtgttgcaggggatctgccagcctccaggtgga gtggatgata420
tgagacagct gccggcatggaactggcaccgctgcgctttcaccaggata gaggcttg 478
<210> 71
<211> 927
<212> DNA
<213> Homo Sapiens
51
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> allele
<222> 624
<223> 16-218-624 : polymorphic base C or G
<220>
<221> misc_binding
<222> 601. 623
<223> 16-218-624.mis1
<220>
<221> misc_binding
<222> 625. 644
<223> 16-218-624.mis2, potential complement
<220>
<221> primer bind
<222> 1..22 -
<223> upstream amplification primer'
<220>
<221> primer bind
<222> 906..927
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 612..636
<223> 16-218-624 potential probe
<400> 71
gaatcccttt caccctccat actgtatcca aagatcactt ttttcaaagg tcacctaggc 60
agaataatca aattaatgct tttaatttgg taatactgaa aagtaaattg caatgtatgc 120
acacacagat tgaaaatcag gtgccacaga catgagcatg cacagagaat ttctgcattc 180
tcatgcctta gtttatcaaa taaggaaaat gtataaaaag ctactccaca attggtgtgt 240
gaatatatta ctttatctaa atgcatcttc tcaggccagg catggtgatt gatgcctata 300
attccaactg ctcaggagtc tgaggatcgc ttgagtcctg gagttctagg ctgcagtgag 360
tatcacagtg ccttcagcct gggcaagaaa gtgagattct agctctaaaa tattttaaaa 420
ttcatctttt cacctcagtt tgtgtgcctc tgctggaaaa gaaagtccaa aggttattgt 480
tacattatgc aaataatatg ggcttgcaat caaaagagct ggttcctaat tctcacttta 540
ccactaactt gctgagtgac ttcaggtaag tcacttaact tctctggttc tcatttaaac 600
caagtgatct ctttaagtca tttstaatgt gaaaactgcg tgatttaatg agatatacat 660
tttggataat gatatggtta gattgtgtcc ccacccaaat ctcatcttga attgtagccc 720
ccataattcc cacgtgttgt gggagagacc tggtgggagg taactgaatc ataagggtgg 780
gttgttccca tgctgttctt gtgatagtaa ataagtctca tcagatctga tggttttaga 840
aaggggagtt ctctttcaca tgctctctct tgcctgccac catgtaagac gtgtctttgc 900
ttctccattg ccttctgcca tgattgt 927
<210> 72
<211> 479
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 330
<223> 18-393-330 : polymorphic base G or C
<220>
<221> misc binding
<222> 311..329
<223> 18-393-330.mis1
52
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> misc_binding
<222> 331. 349
<223> 18-393-330.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<22I> primer bind
<222> 459..479
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 318. 342
<223> 18-393-330 potential probe
<220>
<221> misc_feature
<222> 457
<223> n=a, g, c or t
<400> 72
agtgtacttc gtgattgggg caaactctgg gccagatctt gtggtctgaa attcagactc 60
tgcagtttac taactgtgtg attttgagtg actgcttaat ctctctgggc cccttttctt 120
catctgtaaa gtgggggtaa taatggcatc cacttcttag ggtagttgta accaataaat 180
gagttaatac aggaaaggcc ctttaataac tatgccataa tgtttttgct attattttta 240
ttcctgtaag aaaaggagcc aaagagtgga ataagatgag tttatattga gatcctaaaa 300
gacagaaagc tagtccctgt ttctcaatcs tccttctaaa gtcactttaa ccatcagctc 360
ccatctatgc agacagcaaa ctcagcaaca agaaagagcc cttaatactt catctcaagt 420
caccagaaac tcataggaag gcacagaaga ccaagtnaca aactactcct ttcattcct 479
<210> 73
<211> 518
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 402
<223> 18-394-402 : polymorphic base A or C
<220>
<221> misc_binding
<222> 382. 401
<223> 18-394-402.misl, potential
<220>
<221> misc binding
<222> 403..421
<223> 18-394-402.mis2, complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
53
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 500..518
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 390._.414
<223> 18-394-402 potential probe
<400>
73
cttctgaggataacaaacaccmatgggaaaggcaacttattaaggtacatattacagtct 60
tctaatgtctaaagccagctagacatacatttaaatcccagcagaaattctctgaaaggt 120
ttgcctccaccctaggtcttccaacattagaagaacttcagagagaaagtaggacatttt 180
gtctctcttgggtatttgggaatcaaggtgcagacttggggtagcattgggggtcccatg 240
aagaattgaatacctaggcttatatcaaagccgcccctacctatacatgctccccagtgg 300
cccctgtggcccaatattccaagaatggctcggggaatggccagctcccccacagtcatt 360
tcagattggagcaggctccttagaagtccttggtgtccgagmcttagtcccacaatggat 420
gctggatatgggtcaacatcctggattcatggagagaggagggcatgtggcaaaatatag 480
ttaacttacattatttcttcctcattatcccctcaatt 518
<210> 74
<2I1> 587
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 55
<223> 16-217-55 : polymorphic base A or G
<220>
<222> mist binding
<222> 32..54
<223> 16-217-55.mis1
<220>
<221> mist binding
<222> 56..74 .
<223> 16-217-55.mis2,complement
<220>
<221> primer bind
<222> 1..20 '
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 568..587
<223> downstream
amplification primer,
complement
<220>
<221> mist binding
<222> 43..67
<223> 16-217-55
potential probe
<400> 74
aacaggcgac tttgtcaagcccagtcccctccgtagctggatttcacctc caggrcagcc60
agctggacag acaggcagatgcaggctcagccccctggctgccgtgggac acacacacac120
acactgccac agccactgcccaccacacacacctagtgcagatgctggca cacccccaga180
aggaggctca cagctcgcaggggagacctgggctggacaaaacccagggg aggggagggt240
gtgtggggac caggcccctgctgagaaccctggggggaagcctgaggggg aattggggga300
tggagcccac actccacaccaggtctggccctcgagtgggtcggccttgg tgccagcccc360
tctgcggcca gagaaaagcagcttagggctgagctggagacgcggtgtcc ccgactgtgg420
gggaggggga ctcgaggtttccccttgatggacacagtgaatccaggcgg ctggggcaga480
54
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
gaccagcagc acgggacacg cgtgacctgt gctcctttcg agccgcagac gtcacagtga 540
cgacgtttaa gctcctaatc tccccaaatc ggcgggaagg attagag 587
<210> 75
<211> 450
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 139
<223> 18-284-139 : polymorphic base C or T
<220>
<221> misc binding
<222> 120..138
<223> 18-284-139.misl
<220>
<221> misc binding
<222> 140.159
<223> 18-284-139.mis2, potential complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 430..449
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 127. 151
<223> 18-284-139 potential probe
<400> 75
gactcctagc ctcattgaag gatggttaga gaggcacggg gagctatcta gtggcaggcc 60
cacggtatat gtttgctgct ttctacaaat acgagatcaa aggaaaataa agcaggggtg 120
gttcctgtca gtgtggagyg agacccggga aagcatcctg gtggctgtca ggccttgctc 180
acggcccctt tctctttcag ggagaggatc ctccacagtg gtatcctgct gcgtgcccct 240
ccaggacagc acccagaggc ccgaattgct gctgcacaga gagcactcgg cctcacccca 300
cgttttccct aagttctgtc tagtaattcc actttggaga ggggggtgtt ccttgacaga 360
tttagagagt tgatgtaact tcctcggatc agttctgctg gctccatccc ctacctgctc 420
agccctgcac aaagtggcta agcacgccac 450
<210> 76
<211> 520
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 305
<223> 18-285-305 : polymorphic base A or G
<220>
<221> misc binding
<222> 286..304
<223> 18-285-305.mis1
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> misc_binding
<222> 306. 325
<223> 18-285-305.mis2, potential complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<22I> primer-bind
<222> 499..519
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 293. 317
<223> 18-285-305 potential probe
<400> 76
gaggtgggag aaattacagc tgaggtagaa gctgcctcgg aaggccaggt gaagagccac 60
acctgtcaga tgggcttgtg gcctgcgttg ggcagggact cccagcaggc tgctgtccgg 120
ccacagttca gcctctgccy gaggcccggc cctgcctgtg ctccttatcc tatagctgca 180
gggccagctg aaagaagcaa ggcgtttccc tcccccatat cctgttctcg tagcatttat 240
ggtgcagtct cccacgcctg actgctgtct acttagaaaa ctgctgaaag ccagttgcat 300
ttcaratagt gtctgtgcca ccttcagagc ccttttgtga tcatgtttta tcagcttatt 360
ttatgtttta tgtgtgggct tcggcgatct ggggacatct ggtcaaccag ggcaggcaac 420
cttgtttcca agtggcagat gccagggtgg gtccagtctc cagaaaggga ttttccctgg~ 480
gaccattggc acctgttact tgtagtcttt tcagccttgg 520
<210> 77
<211> 486
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 239
<223> 18-289-239 : polymorphic base C or T
<220>
<221> misc_binding
<222> 219. 238
<223> 18-289-239.misl, potential
<220>
<221> misc_binding
<222> 240. 258
<223> 18-289-239.mis2, complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 466..485
<223> downstream amplification primer, complement
<220>
<221> misc binding
56
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 227..251
<223> 18-289-239 potential probe
<220>
<221> misc_feature
<222> 154,156
<223> n=a, g, c or t
<400> 77
taaaaagcag ccgtgtccca cagcaaggct gccctgtgtc ccacagcaag gctgcctctc 60
cagctcaaaa aaaaatcctg gcgacagatc ttgagactct gctgctgtgg gactcttcct 120
gcacccacca cccagggcct caggaaggag ctgnancagg gtgttttaga aagaccttac 180
tctataaatg caaaaaccca gacttagtta acaaaagcct attacaaaga cattttctyc 240
tattgctacc tctccccatt taaatcctgt ctgtacaaaa aaataaaaac attagctggg 300
catggtggca cgtgcctgtg gtcccagcta cttgggaggc tgaggtgaga gcagtgcctg 360
agcctgggag gccgaggctg cagcgagccg ggatcctgac gccgccctcc agcccggcca 420
cagagaaaga cccacagagc ttskccgcag ccctcgtcca gcgcactgag atccctcacc 480
aaggac 486
<210> 78
<211> 453
<212> DNA
<2I3> Homo Sapiens
<220>
<221> allele
<222> 91
<223> 18-291-91 : polymorphic base C or T
<220>
<221> mist binding
<222> 71..90
<223> 18-291-9l.misl, potential
<220>
<221> misc_binding
<222> 92..110
<223> 18-291-9l.mis2, complement
<220>
<221> primer bind
<222> 1..17 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 432..452
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 79..103
<223> 18-291-91 potential probe
<400> 78
cctccatgca ggaacagcct accctggact ggatccagct ctctcccagg cccaggttgt 60
gggagaaatg ggggacctcc gcctcccaat ygtgctggct ggaactttcc tgtgctgggg 120
attcggcgtt tgcagccagg gtggccagtc agggtgccag gctcccatct gaacactgac 180
agactgtggg ctgtgcagtc tacagcattg ggcacaacct cagcttgcta aaatactcag 240
tgcaggctgg gtgtggtggt cacgcctgta atcccagcta ctcgggaggc tgaggcagga 300
ggatccctta aagctaggga gtcaaagctg cagtgagccg agatcgtgcc actgcactcc 360
ggcctgggtg acggagaccc tgtctcaaaa aagaaaagaa aacgagtatt gggtggagag 420
aggaccaagc ccaattacta ctttagtgcg get 453
57
CA 02395240 2002-06-20
WO 01/51659 PCT/)BO1/00116
<210> 79
<21l> 460
<212> DNA
<213> Homo Sapiens
<220>
<22l> allele
<222> 391
<223> 18-186-391 : polymorphic base G or T
<220>
<221> misc_binding
<222> 371. 390
<223> 18-186-391.misl, potential
<220>
<221> misc_binding
<222> 392. 410
<223> 18-186-391.mis2, complement
<220>
<221> primer bind
<222> 1..1B -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 442..4-59
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 3?9..403
<223> 18-186-391 potential probe
<400> 79
taggggtcaa ataaatgcat actatgcgga cagacagaga ttttcgattt ttttttttta 60
gtttaataaa gtttgaaaac tttcaaagct cctgtacaat tccattaata ccagacttgg 120
caaaacgcta attctgtttg aaaaggtgtt tttttaaaag tagtatattt gaacaatgtc 180
taagtatgtg gggtggggag aatccatatc cgaatatctt cataaagcaa gttcttaaaa .240
tttgcaaagc tattaggtta gtgcaaaagt aatcatggtt tttcttttgc accaactaat 300
atttaccact gaacacgctg gcatttagat cacttccttc tttcagcatg ctagacagta 360
aagagaatgg gcatgaggtg gcaggaagaa kgaaagagtg aagataatgg agttaggtca 420
gtgagggata tttcctaaat tccccacttc ttttcctcta 460
<210> 80
<211> 460
<212> DNA
<2I3> Homo Sapiens
<220>
<221> allele
<222> 130
<223> 18-194-130 : polymorphic base C or T
<220>
<221> misc binding
<222> 110..129
<223> 18-194-130.misl, potential
<220>
<221> misc binding
58
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<222> 131..149
<223> 18-194-130.mis2, complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 439..459
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 118. 142
<223> 18-194-130 potential probe
<400> 80
agctggaagc ctgtttggct tactattggt aagaaaaagt taaaatttta atctgtctga 60
acattatagt acatccaaat caataaaatg ttttagttgt ggtttttcat cagttttaat 120
cagataatgy cttacttctg tagatatagt ctagtatagt tcaaataaaa agacagttgt 180
acatagataa gacaaagcat attgtgaaaa tgttgggaaa tttaggttat tttaatgatg 240
gctgagaatt tgtgaacttt tctcatatgc tattaaactg aattactagt aaatttatgg 300
taccgagtat atcaaacagt gagggattta aagtaatttt gcaatttgct aaaatttcat 360
ccttaacata ctggctaaga gtgaaaaagc aagaagagag aaaaggaaaa ggatggaact 420
aagacaattc tattagaagt ggggagatgg caagaaaatt 460
<210> 81
<211> 459 '
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 252
<223> 18-198-252 : polymorphic base A or G
<220>
<221> misc_binding
<222> 233. 251
<223> 18-198-252.mis1
<220>
<221>.misc binding
<222> 253. 272
<223> 18-198-252.mis2, potential complement
<220>
<221> primer bind
<222> 1..17 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 438..458
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 240..264
<223> 18-198-252 potential probe
59
CA 02395240 2002-06-20
WO 01/51659 PCT/1B01/00116
<400>
81
ctgaaaaaagagctgacaaaattcaatccctaattaaaatgtttagcaac taaagttatt60
ggttaattttgagaattgatcctgtgttaacaaacatcaccaaagtctca aggettacaa120
tacaaaggtttatttctcgctcatgctacatgtccattgtggacggctgt ggctcctcac180
tgtcttcattctaggactgaagctgaaggcacagtacctatatgcaacat attgttcata240
tggcagaggggrgaaaagcaatgacttaatcaagcaatgactcctgaagt tttgctcaga300
tacagcatacatcacttccactggctaaagcaagcctcatggctaagcct gatatcaaga360
aggtaggaagtatactctctcacagggaggtgcacctggtagaaggactc tattatagag420
ataaactcagtagagaggattgccgaatagttgtaaata 459
<210>
82
<211>
476
<212>
DNA
<213> Sapiens
Homo
<220>
<221>
allele
<222>
299
<223>
I8-242-300
: polymorphic
base
A or
G
<220>
<221> binding
mist
<222>
280..298
<223>
18-242-300.misl
<220>
<221> mist binding
<222> 300..319
<223> 18-242-300.mis2, potentialcomplement
<220>
<221> primer bind
<222> 1..I7
<223> upstream amplification
primer
<220>
<221> primer bind
-
<222> 455..4
75
<223> downstream amplification
primer, complement
<220>
<221> misc
binding
_
<222> 28?. 311
<223> 18-242-300 potential
probe
<400> 82
acctgacatt aagagacaag cagccgggatggctcctaaccagatcttct ttccctgttc60
ccaaaccatc tttcttcata gccggctctggggatgaggagcctgggtta ggaggaaggt120
ttgcaattga ccaggttcct gttttgaaggcttccacctagacttaagat agcaccgctc180
agaagatgga tgtgtgttta gcaatttcccattttattacctgcagacaa agaaaaaaaa240
agatataaat agatgtttaa ccacacaaataattcacattactgtcttct ttatgactrt300
gaaataataa aataaaatta aatcaacagcaataacaatttcggcacagt ggttactagg360
caaaatctgg aaaccaaatt gaaataagaaaactcataaactgggtgttg ggagcacact420
gtggaatttt tcttggtcaa aattctcacagagtgttcaagtgaaaggtg tattaa 476
<210> 83
<211> 3001
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 1501
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<223> 8-15-126 : polymorphic base A or G
<220>
<221> misc binding
<222> 1481..1500
<223> 8-15-126.misl, potential
<220>
<221> misc binding
<222> 1502..1520
<223> 8-15-126.mis2, complement
<220>
<221> primer bind
<222> 1376..1395
<223> upstream amplification primer
<220>
<221> primer bind
<222> 1792..1810
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 1489 .1513
<223> 8-15-126 potential probe
<220>
<221> misc_feature
<222> 15,619,631,646,2196,2462
<223> n=a, g, c or t
<400>
83
ttggaaacaggctcntgagcagttgggtagagaattccctgagtgtggtctagacagggt60
tgtaaacttagtggaccttctccttggcactgtgggaggttacaacatcattctatagag120
gttagaggcataaccagtagagggtgccttagtccttttgggctgctatcacaaaatacc180
ataaactgagtagtttataaacaacagatatctatttttgacagttctgaaggctgggaa240
gtccaagatcaaggcaccagaagattcagtgtctggtgagggcctgctttctggttcata300
gatggctgtcttttcactatgtcttcccatggtgaaagagattagctagctctctgggtc360
tcttttataaaagcactaatcttattcatgagggctctgccctcataacctaatcacctc420
tcaaagacccccacctcctaataccatcatattgggaattaggatttctacatatgaatt480
tagggagacacaaacaccgagaccacagcagaagaccagagtggactcctctatagcacc540
tcctctagagcttggggcaagagtcacttttgcttgggtttcagggttactccctaagtc600
acaggccttatgtcttccncctagccttcangaactgtgagacaantaaatttctgctct660
ttataaattacccagactcaggtgttctgttatagcaacccaaaatggactaagatagat720
gggtttcattattcccacattttacatgggaagaatctggagctcagagaggtaaagtaa780
tatgcataaggtcccagagttaggaagcagcagagctgggattgtaatcctgcaacagct840
tcccatctcactcagagtccaagcatggtactttcaatagccctgcacaatctgtctacc900
tcacaccctcctattctactcctgcctcacttggctccagcctcaccagactccctccta960
tgacttctatgtgctagcccttcctgctggcccgtgttgttctcactgctcagactgcta1020
tcacatctgataactgcatggtctgcttcctgatctcctccaggtcaagactcaattgct1080
gatttctccatgaggagttcctgattatactcagatactcactcacatacgcacaatctt1140
cacccgttacttacctgcctctctgatttgtctccaatatacgtatcattattgaacaca1200
ccacatcttttatttatcttgtttattatctgtcttctcctctagaatgggagcttcaaa1260
gggaaggaattaaaattttatctgttttgttcattgctctatctccaactctcacaacag1320
tgcctactatatagaaaatgctcaataaatatttgctgatgcaataaataaaaaaatgta1380
actaagcaaccaagccccaaagagtctgattttattaatattgttttctgtctcctcaca1440
ggaagcccctggcatcacgt tgggctatggcatctctgagccagctgagt1500
cacctccctc
rgccacctgaactacacctgtggggcagagaactccacaggtgccagccaggcccgccca1560
catgcctactatgccctctcctactgcgcgctcatcctggccatcgtettcggcaatggc1620
ctggtgtgcatggctgtgctgaaggagcgggccctgcagactaccaccaactacttagta1680
gtgagcctggctgtggcagacttgctggtggccaccttggtgatgccctgggtggtatac1740
ctggaggtgagtagacttcaggtgcatgttgtctctatgactgtgctagtacttgtcttc1800
6I
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
cctgagttctggcctttggggctcaaaagactccccagacagtcaggaactgaggaagga1860
aggagagctctcattctccctgtaatgagagagttaaagctctggaaaacagtcaccatc1920
ctgtccctcatccacatcagaaccaaggagctgagaatgattctgttcatgggtctccag1980
tgttcaggtgactggatttgagtgacgggactcttcctaatatggcctagagtttattct2040
ctgtgccagacatgtctcaatgacatggtgggctgggtgaagcagtccagaagacctctt2100
caccagtgtttaatgtatatgagggtgagggtgtgcaggagggatgtgaggccaggagga2160
aaaaggaattatagaaaaaaaaaattagtgaatgtnaagggaagatagaaagaatgacca2220
~cgaacagatcagacttctttcgatggctcagtccctctttgctctttcctcctgggtac2280
~agttctccatagactctgctaccaaaggaacagacaaaaccctcaaatgtatattttcc2340
atgtgtccatgaatagtacagagcctttgccagagagatagtgcagcagatcctggtgaa2400
ttcttttggggagaaacatttattaaatttgaaagtattttcaattgggagtgcaaaaca2460
gnagccagggggtggtcaagacaaaacacccatttgctaacaaagaaatcagggtgacca2520
tatctgttcaagaaacagatattcttaccaggaaaacatgcaattacttaagatatgttt2580
ttttaaaaaaacctgagtatactattaatatttctcctctgcactgtgtgtcattttaaa2640
gaggtatccaatgaaggatcaaaatgatgctatgattaagagaaattaagattcatcaaa2700
ttaatatctcagttaatattgatagtaaaagtgacagttaattaagtatgacatatcacg2760
ggagagcaaaaaccttgtacatagactgcctgtgctaatacctttgttaaagaatggctg2820
ggaactaaaattagacttatgatctcaagggggagacataaagagagaaaaaaagaaaac2880
agagaaataaaaggaaaagaagaaaaacaactaggctgtgtagatctaaaggctaaggga2940
atacttgaggaaaaaatatgcatttattcttcccagttaggataatcctagttgggaggg3000
t 3001
<210> 84
<211> 2684
<212> DNA
<213> Homo Sapiens
<220>
<221> allele .
<222> 1501
<223> 8-19-372 . polymorphic base A or G
<220>
<221> misc binding
<222> 1481..1500
<223> 8-19-372.misl, potential
<220>
<221> misc_binding
<222> 1502 .1520
<223> 8-19-372.mis2, complement
<220>
<221> primer bind
<222> 1130..1148
<223> upstream amplification primer
<220>
<221> primer bind
<222> 1534..1552
<223> downstream amplification primer, complement
c220>
c221> mist binding
<222> 1489..1513
c223> 8-19-372 potential probe
c220>
<221> misc_feature
<222> 240
<223 > n=a, g, c or t
<400> 84
62
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
aaggccaactttgaggttggagaatccccaaccctttatgaagactggccgggtgtacca 60
acagttgttgctcacagtgctggatgaagcacagatgttccatgtcacaatggtaaagag 120
ggatggggagttaaaattatagaaagaacattggcttgggcataaaactggctgcaagaa 180
catatttttcaggtgcagccttgggctacttactgaacctctctgagctttaatctgctn 240
catccgaaaagagagacagtaataatggcacctgtctcatataacgttgccataattatt 300
aggtgggataaggggtacaaagctcttggctcatcgcctggcagatattagtttgctttt 360
cttttctttttcaagatggggcacgtttcaggcccatcttgggccttggaggaatctcag 420
catctgctatgaagaaggcaaagctagagggacctcccaaggagaaatggcaggaacatt 480
tcaggatataaagcagggacaaggacccttctaagtgcacattctccatgtcacaatatc 540
attacctgcctttttcccatcccacctctgacaagtgctgggattccctgaaaaatcaaa 600
tctctgtcttgtattcagccgccatctgccctccatcccagattcaaaattggagaactg 660
gcattctcagcaaataaggcttcttcctttcattgcattcaaacaattctccaatgcctc 720
cgcaccagcaggcccttttctgagggctgcatccctcctgggagcctctgccctgttgcc 780
ctgtaatgctctccccagcctcccaggctgcatgtctctgtgtgacacttgtgacatcct 840
atgaaagggatcatctgtctatctagactgtttgctcccttgagagaagacatggtgtct 900
cattcatctttgtagccccagtgtctggcgtatgattgttggtaactttttattttaagc 960
aagctgtaagaaactcaaagatgaattagaccttctaccctcaaggacctgacagtatac 1020
gtatctgagactgcatccttcccaccccctgtgcagcagaaagtgcaggcaccacacgt,g1080
acatggagccgtgttttatgctccttactgagttctgatacttgctaactgctttacctt 1140
cccccttctcatccacaggggaccccactgtctgctccatctccaaccctgattttgtca 1200
tctactcttcagtggtgtccttctacctgccctttggagtgactgtccttgtctatgcca 1260
gaatctatgtggtgctgaaacaaaggagacggaaaaggatcctcactcgacagaacagtc 1320
agtgcaacagtgtcaggcctggcttcccccaacaagtaagtaccctggagggggtagagg 1380
gaagacaacacccaatctcctgacttcccagcctgtgtccagcagtgcatgattttgccg 1440
tttagctaaattggagacacaaatctgacaccgactttggaatctgctaattttggctgc 1500
rctttgaaggtaggaaatccaatctcaagaaaacattgatagttgcctctagagcctgcc 1560
ttacctggcaaagtgattggagagctcctgggcttgttctgcttcccttcaaagtctttc 1620
attttccccaaatgggcagcagctcagatgtcccacaggttttgaagtttaagtgcagca 1680
gttgtaccttgcactgctggtgggttcccagaactgactttttgtctaaaccactcatgc 1740
caagaatcactggggtccatcaaagccttttttccttactggatctgtccgtgtgtcaag 1800
gaactgacaagctggtgggatagggtgctgataaagcattttattggatctttctaggct 1860
,
ctgaaaagaaatgtcattgcctctgcaatgatcttctaattgctagggctttaatttctc 1920
cttaccccattgcctggcacttagtagttttcccacgatgtacttgaagcatgaatggat 1980
atataccgatcacttgaaatctactagggaagggacagtggtaacattaaacagcatctg 2040
ccttcatggagcttagaatctagaaaagcaaataaagcacccctccactcaatgttaatg 2100
aagatcccagagctgaataggatgtttgccaaatgtgaggtgaagacaattaagcactca 2160
attatgaagtgctctggaggttatagaagagaaaacccaatatgctcagtgatatggttt 2220
ggctgtgtccccacccaaatctcatcttga'attgtagctcccacaattcccatgtgtcat 2280
gggagggacccagtgggaggtaactgaatgatgggggtgggtctttcccttgctgttctc 2340
atgatagtgaataagtctcacgagatctgatggttttatgagggggagtttccctgcaca 2400
aattttctcttgtctgctgccatgcaagacgtgcctttcaecttccaccatgattgtgag 2460
gcctccccagccacatggaactgtgaatccattaaacttctttttctttataaattaccc 2520
agtctcaggtatgtctttattagcagcatgaaaacaggctaatacactcaggaaagggct 2580
ccatagacagagtaagaattgagtttgatcttgaagacagatccaatttgggtgtctaga 2640
ttaatctttgatgacctagataatcttttttttttttttttttt 2684
<210> 85
<211> 711
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 428
<223> 99-2409-298 : polymorphic base A or G
<220>
<221> misc binding
<222> 408..427
<223> 99-2409-298.misl, potential
<220>
<221> misc binding
63
CA 02395240 2002-06-20
WO 01/51659 PCT/iB01/00116
c222> 429..447
c223> 99-2409-298.mis2, complement
<220>
<221> primer bind
c222> 131..148
<223> upstream amplification primer
<220>
<221> primer bind
<222> 560..580
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 416. 440
<223> 99-2409-298 potential probe
<220>
<221> misc_feature
<222> 27,108,118
<223> n=a, g, c or t
<400> 85
ctcaaagatg tcgttgacga aggagtncat gatccccatg gccttagagg agatgccggt 60
gtcagagtgg acctgcttca gcaccttgtg caagtacacg gagtagcntc ccttgcgntg 120
cgcttggttt cttgccgtac ttcttctgcg ccgtagtcac ccacctcttg gaagccctaa 180
ttgggatcag gagcggactt tgttggctct ggcatgtcga gggcgcacta caggtcgagg 240
tgaactaaca gcagctcgag aaaacgggaa ttaatttaat gtttgtcttt actaccaaac 300
tgtaagtttc gtgagattag gaccatattt gcatcattca ttattatgtc tctgggaccc 360
agcacaatgc ctagtacata ttaggacttc aataaacaaa tgcaaagtag cgcatggggc 420
tgcagccrca gatctcctgg gatctgggtc tgggagcagg cagtggcatc tgacacttca 480
tatcccttaa agaagacaaa atgtattcta tgacagatag ggaaccagag ccagggacta 540
gagtgtgact ccctgacttg ttagaggagg ttgggaaaaa tggccttgac tatcttccta 600
ggcagaggeg ggcaaactat gcaccccagc ccaaatccag ccctctgcct gttttggtaa 660
ataaagtttt attggaacac agttacatac tttttttttt tttttttttt t 711
c210> 86
<211> 3001
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
c222> 1501
<223> 99-339-54 : polymorphic base G or C
<220>
<221> misc_binding
<222> 1482 .1500
<223> 99-339-54.mis1
<220>
<221> misc_binding
<222> 1502..1521
<223> 99-339-54.mis2, potential complement
c220>
c221> primer bind
c222> 1448..1467
<223> upstream amplification primer
c220>
64
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> primer bind
<222> 1883..1902
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 1489..1513
<223> 99-339-54 potential probe
<220>
<221> misc_feature
<222> 120,890,929,2457
<223> n=a, g, c or t
<400>
86
atactataaagattcagagactttccacattagtaaaatttttagaggtccagtaggctg60
gggaatgctgagacatgcacttcaaagtaaaggacaaattattgtaacttgcatttcccn120
ataactaagaaggaaacccagcaccaataagcgtcttctggttctgaaagcagcacattt180
cacactcagagacactactctagcacatacgccagctgaaacatgagtctaccagatttg240
gagagagcccagagcaggaaagggctctgcagcaggaccaggcagtagtgcaagctgctc300
tgtcatatgatgattttggtcacatgatgtggtagagcctacagtataggaggtatcatt360
gatagaaaaaggctgtgtacattttatggcaggcctcaataggcaaacacaaatagaccc420
ctaggattcagaagcaagacaagcaatttgcagcagagaactatacgtttagataaatat480
tcctggtgccctactggttcctagtaggaacacagcacccaactatgggatgccaagggt540
ccacacagcaaggactgcccattgcgaattctgacagacccccaaatcatgaaggcaggc600
aggcctaccaacaattgtaaggaaggaaatgatacgtttgggatcaggcattagcagagc660
cagagagcacaaataagttgcacgcatatgtggcccagactactagggtcatccatcaca720
tttgcactgatgcctcacccttagctcacacttacggcagcataaagtgagggcaaaagc780
tgagtttgatttatgtacgggtaagattggaatgtagtagcaagctaaaaatagactatt840
gctatataacaggaccacatccttagcgtgtcccagaaaattagggatgnagagaaattc. 900
ttcctaatggataaagcatcagatggtgncctttgtcgagagaaatactctgagataaga960
tatgtatcacttataggcagtagtgaattatttggacagttgactctatacaacctggga1020
agtagaatgtcttagccagttgatgtcagccagctcctatcagtgctggcacaataggca1080
cattaatggaccatgggtaaggaatggagacaccatcctaacaagactaattgactttat1140
ttttattttttttgagacggagtttcactcttgtcacccaggctggagtgcaatggtacc1200
atctcggctcactgcaacctctgcctcccaggttcaagtgattctcctctgtcagcctcc1260
caagtagctgggattacaggcacctgccaccaagccctgctaatttttgtatttttagta1320
gacatggggtttcaccatgttggccaggctggtctctaactcctgacctcaggtgatctg1380
ctggcctcggcctccaaaagtgctgggattacaggtgtgagccgcagtgactggcctaat1440
tgactttcttaatcaggagaagatagctcttctcttacatgatggcgacagaaaagaata1500
stcccttgcctaattttgatgataaatggataagtacaacaaccatgactgagaaacagt1560
ggtggtgatggaagctatttataggcccaacaacacgtgctctcacttgctaaggctgat1620
ctagttactgccactgctgaagatccagcctgacagcaacagataccatcactgagtctc1680
cagtatggctccatccctcaagaagaccaaccagcttcttaatggcaaattattcttctt1740
'
aatgacaaaatgggtcctttccaccatgtgattccaccctgtgattttgatacgaatgga1800
cacttatcctattcatacaacttcagctagacagtgcctatgtagcattt~gatccactga1860
aacaggatcctgccaaacattgcattggactaaagtaactgcttatgttaatggaagttt1920
aaccttaattacttccttataggccttaactccaaatacagtcacattgggggttataga1980
ttcaacatatgaattttggaaggctcttcttttcccagaattgtctttgctgaaaatcaa2040
ttgaccataaatataacgatttatttctggactgtcaattctgttccattggtctatatg2100
tcttcttactgcaaataccatactgttgataactgcagctttatagttagttttgaaatc2160
aaggattaaacattctccaactcctttcttcccacgcatggaaaatcactgatctctttt2220
ctgtctctacagatttacctattctaggtacttttctttttaaacagtgtcttttggcta2280
ttctaggtcttttgtacttctatgtaaattttacaatctgcttgtcagttcgtgatgaaa2340
aaggctggtggaattttgagagggattgtgttgtctatatatcaatttgtagaaagttgc2400
catcttaacatattgagttttcaaatctcagaacatagaatgttagaggtccctgtntct2460
tttttaattttaaatttcttttcataatttaaacattttttctattgaggtaaaattcat2520
atagataaaattaactattttaaagtgaacaattaagtggcatttattacattcacaata2580
tcgtacaacaactacctctatctagttccaaaatattttcatcaccacaaaagaaaactg2640
tgtacccatcaaacagttactcctetttcctttttctcccaacctcggacaccacagtct2700
tctttctgtctctatggatttacctgttactctgaatatttcatataaatgaagtcatac2760
aacatgtgacctttgtgtctgacttctttcgttagcacagtgagtgtcttcaaggttcat2820
tcacattgtagcatgtatcaacttcattccttttgatgaccaaatgatatcctattatat2880
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
gtatatacca cagtttgttt attcattgat gaatatttga attctttcta ccttttggct 2940
attgtgaata gtgcttctat gaatatttgt gtataagtac tcatttgaat acttttttta 3000
a 3001
<210> 87
<211> 1127
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 311
<223> 12-254-180 : polymorphic base A or G
<220>
<221> mist binding
<222> 292..310
<223> 12-254-180.misl
<220>
<221> mist binding
<222> 312..331
<223> 12-254-180.mis2, potentialcomplement
<220>
<221> primer bind
<222> 132..152
<223> upstream
amplification
primer
<220>
<221> primer bind
<222> 586..603
<223> downstream
amplification
primer, complement
<220>
<221> misc
binding
_
<222> 299. 323
<223> 12-254-180
potential probe
<220>
<221> misc_feature
<222> 952,958
<223> n=a, g, c
or t
<400> 87
ctgccacaat ctcctgagtccagacaatctagagcagaagggtagactga ggaaaatata60
cacagtataa aaaagtaacaaaatcaaaacctgaaacaaagatcaacatc caataaatgc120
ttctgaataa agggagagtagataagaactggattttaatcccaacactg ccatttacca180
gctggccaat actgagctagttactctaaagagttcagttttctcatttg tacaaatagg240
atttgtcttt ccatctcactgagttgtgatgagagtcatatgcaacagca tatgaagagg300
ctagcaaaag rtatttaacaagcgttcaacattctcatgatgacatgaat aacactgtac360
atacaacata ccaacttgataaatacacagcacagttaatagctgagggc agagttatgg420
ttgggaagag agagagtgcaacataggcagagtgaggggggattcccaca attttctaag480
acagaaaagt gggggaatcagtagttactggaaagaataggcaatgcctg actggataga540
aaaagattct atgcctttgtcaaatttcacaaaagtgacttaagcctata ctgcgggatg600
ttcacactac gtccctttagtgcagttacggtacttcaggctgcaagtaa ccaaatacaa660
ctaaaattgt cttatacaataagggcgtaattatctcatataacaagaag cttggcatga720
aggaaatttc aacaatttcacaacggcaacaaaaactctgtttcttctac ctttccacca780
ttcctgtgtt ctcagttccaatatggctgctaacatccatatgtcttccc cgcacatctc840
tttaaaagct acaaaaagatttcccaaaagcgtcttggaaaatttcctgt cccatctcca900
ttggccagac ccacctcccatgggactgcctcttgtgaagcacacaaagg gncagatncc960
aaacggtacc gttagggagacccagaagatggaccatccaggatagagac atgaagggca1020
gaagagggcc cagggatgtgtgtcectcagctggactacagggaaggagt tttggtcagg1080
66
CA 02395240 2002-06-20
WO 01/51659 PCT/1801/00116
ggaagaaaag cctcatttcc tatcagtcac tggtggaatg actaaag 1127
<210> 88
<211> 3001
<2l2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 1501
<223> 10-214-279 : polymorphic base C or T
<220>
<221> misc_binding
<222> 1482 .1500
<223> 10-214-279.mis1
<220>
<22I> _binding
misc
<222> ..1521
1502
<223> potentialcomplement
10-214-279.mis2,
<220>
<221>
primer
bind
<222> ..1244
1225
<223>
upstream
amplification
primer
<220>
<221>
primer
bind
<222> ..1764
1747
<223>
downstream
amplification
primer,
complement
<220>
<221>
misc
binding
<222> ..1513
1489
<223>
10-214-279
potential
probe
<220>
<221> feature
misc
<222> _ .2373
2368 .2369,2372.
<223> g, c or
n=a, t
<400>
88
aatcattgagttttgttctctatattttctctttatctaagaatgtcttc ccccctccat60
taacaatatcctctcattttattccatttaaaatatcccagtggtgcctt gcaagtgacc120
tcatctaactcaagcatttggtcatttggtaaatgtttaaggagtgatat gcagtcgatt180
ggtttgcatacaaatattaagttttttaatgtgaacatttagcaaatgac attcatgtat240
ttgcatgtgtgtgtgcttgcacatgtgcacatgcatgtctgtctgcaggg aaaatatatt300
catgccttttgaaaatttttaaataatgtgttatatttatagaaagattt ggaacctttt360
ctctgaagaagttaaagaacagatgtcattgattcatattaagcaagacc ctataaatct420
tatttctaggtctcatgtat-ttattaagcaactccacaccttaagcaggc tttctacata480
gaagaggaagaagatagagatggtttccatattattttcatattccacat tatttgtggc540
tttaggccagctatgtagctatcctgtatgtgtgctcagacaggagactc agccctgaga600
gaaggcggtcctctggcacacctaggatggggaaggtactcccttggaag tcccaagctg660
gcacttctggatctccatggcaattttcttgcccatcactccatggagat cagaatatca720
ctctattgtgtcccctcaacactgaaggagtgtctcaataagaaaagttg agtcaaaaca780
ctgtaggaattgagaggttccccacttgcactacccttgtaaaccaagag aagatgttaa840
aaaataaaacgataatgcttcctgaaggtgtcttcccatctttacactag atgggttcaa900
ttgagaggaattactggactgtggaagttgaagactgtccacataattaa aatgtacaat960
agctactcaggattaccttgcaagtttcaacatacacaaaattaacttca taagatggtt1020
taaaaagtttaccgttatacctaataatctggtttaaatttttaaaactc atccattttc1080
gttaaaatttaaatcaaaaaagaacacgggttcccatgaatttgtctcag gtcaaacctc1140
acacagaataggtgctccatgaatattttgttaaatgatagatgatgaat gttctcacta1200
67
CA 02395240 2002-06-20
WO 01/51659 PCT/1801/00116
tccaatcttcacacatcttatagagtaagtataacgaatccaagatttatagtgctgaaa1260
gtagtttttatatgtttacaaagcattattgtcagtaatttttttttactttgatgctat1320
actttctacttttgctttatttaatgcttctcaatatgctcgtttaactgttgcagatcc1380
ccctgaaattacgctttggaggacttcttctaacagaaaaacccattgttctaaaggctg1440
agtcaagggatgagaccgtaagtggagcctgatttccctaaggacttctggtttgctctt1500
yaagaaagctgtgccccagaacaccagagacctcaaattactttacaaatagaaccctga1560
aatgaagacgggcttcatccaatgtgctgcataaataatcagggattctgtacgtgcatt1620
gtgctctctcatggtctgtatagagtgttatacttggtaatatagaggagatgaccaaat1680
cagtgctggggaagtagatttggcttctctgcttctcataggactatctccaccaccccc1740
agttagcaccattaactcctcctgagctctgataacataattaacatttctcaataattt1800
caaccacaatcattaataaaaataggaattattttgatggctctaacagtgacatttata1860
tcatgtgttatatctgtagtattctatagtaagctttatattaagcaaatcaataaaaac1920
ctctttacaaaagtattattggatgtttcctgcacattaaggagaaatctatagaactga1980
atgactgagaaccaacaactaaatattttgatcattgtaatcactgttggtgtgggaact2040
ggagtgcagtggtgcaatcttggctcactgcgagctctgcctcccaggttcacgccattc2100
tcctgcctcaacctcctgagtagctgggattacaggtgcctgccaccacgcccggctaat2160
ttttctatttttagtacagacggagtttcactgtgttagccaggatgctctcgatctcct2220
gaccttatgatccacctgcctgggcctcccaaagtgctgggattacaggcatgagccacg2280
gtgcccagcccaatttgattattaacataggtgagagttaacccactatgactttgccca2340
ttgtttagaaagaatattcatagtttanntannacatttttgatgagaca~cagtggctca2400
cacctgtaatcccagcactttgggaggccaaggcaggcagatcatctgaggccaggagtt2460
caagaccagcctgaccaacatggtgaagccccctttctactaaaaatacaaaaattagct2520
aggtatggtggcacacgcctgtaatctcagctacccaggaggctgaggcaggggaattgc2580
ttgaacctgggaggtggaggctgcagtgagccaagatcatgccactgaactccagcctga2640
gtgacagagtgagactgcatctaaaaaataaaattatgcctttttgtagcacatatattt2700
tgtaacatacaactgaagccagtattatattattagttttcatttaatgttttcagccca2760
tctcccctgatatttctgggagacaggaaatatgttttcttacacctcttgcattccatc2820
ctcaactcccaactgtctaaatgcaatgaacatttaataaaaaaaacagttgattggtca2880
attgattggacaacaaggctgaaactactcatttcttttcttttcctatttcttccttta2940
ttttccctttctgaataatttagccctagagccattaggtgggtggcagccagatggtgg3000
c 3001
<210> 89
<211> 3001
<212> DNA
<213> Iiomo Sapiens
<220>
<221> allele
<222> 1501
<223> 10-217-91 : polymorphic base C or T
<220>
<221> misc binding
<222> 1482..1500
<223> 10-217-9l.misl
<220>
<221> misc binding
<222> 1502-..1521
<223> 10-217-9l.mis2, potential complement
<220>
<221> primer bind
<222> 1414..1430
<223> upstream amplification primer
<220>
<221> primer bind
<222> 1759..1775
<223> downstream amplification primer, complement
<220>
68
CA 02395240 2002-06-20
WO 01/51659 PCT/1801/00116
<221> misc binding
<222> 1489..1513
<223> 10-217-91 potential probe
<400> 89
gattgttggt acatagaaac atgcttggct tttgtttgtt gatcttgtat catagaacct 60
tgcagagctg acttagtatt tctagaagtc tttttgtata ttcttgagat tttatacatt 120
gacaattatg tcacttgaaa atagagacaa ttcttttatt tcctttccaa tctgtatgcc 180
ttttaattct ttttcccagt ataatgtcaa ataaatgtgt tgaatttttg aattgttcct 240
aatattagga aggaagcatt tggtctttca tcatcaagaa tgatttagat gaagtgggtt 300
tttttgtaga ttctctttat caaatggagg aattttctct ccctagtttg ctgaattttt 360
aacataaaag agtactgtaa gtactcatta taaaacaaaa tatggctgtg gaagatgaaa 420
gagagtttca agcatgctgg cttgataggc cagatccaag ctggcaaaaa taattatctc 480
tttcttcttt ttttctatcc atggaataaa aaattaagag gaaagaatgt taatagaatc ~ 540
gcattatttc ttcaaaatac gttgtgagtt ttaaaagtat tatctacctt ttttattata 600
ctttttttag ggtacatgtg cacaacgtgc aggtttgtta catatgtatg catgtgccat 660
gttggtgtgc tgtactcatt aactcatcat ttaacattag gtataactcc taatgctatc 720
cttcccccct ctccccaccc cacaacaggc cccagtgtgt gatgttcccc ttcctgtgtc 780
catgtgttct cattgtatat ttttttaaat ctaccacatc aaggcacctc tttttcatgt 840
tgcccatggt ttaggtgaac ataaagacag agctcgtctg aggcaacata cagtccaaca 900
aagccacctg cctctctgtc tccactctct ctctacactg cacgcgtgct aggtgttgat 960
cctgtctatt ccagtggaag aacaggttcc gtaccatgtg gagaatttgc atgtaaaagg 1020
agactgggat atacaggctg gagaccacat caggtggctg ggcatgtggg ataaatccta 1080
ttgagcatct gtcatagggc ctgtcactta gtagacagtc actaaatatt tgttaaatac 1140-
atgatgcctg tttaacacat tttctacaac catggagacc tccacaactg atgtaggaca 1200
aaatctttct gctttgaact ctagcctttc gggccagtgg gatttatgaa aaatgccatc 1260
tctatagctg aggatgaaga atggaagaga atacgatcat tgctgtctcc aacattcacc 1320
agcggaaaac tcaaggaggt atgaaaataa cttgggtttt aattagaaac ttaaagaatg 1380
aatcaggtgg ggacaggtag aaagtaagat cagagttcct ttccgaggag tagtctgctg 1440
aatttgagct tcctaaaaat agtcttttta tgtacagaaa acacatcata aaattcatta 1500
yacaatgtca cttattgttc catgccaggc aaagtcatgt ccttctggga cttatgtctg 1560
cacatttaac tatgggtggt gttgtgtttt gtgcttagat ggtccctatc attgcccagt 1620
atggagatgt gttggtgaga aatctgaggc gggaagcaga gacaggcaag cctgtcacct 1680
tgaaacagta agtaggagca cagccatggg gttctgagct gtcatgagcc cctccagctg 1740
cctgctatgg agctgatact cccgctgttg ggttattcca gtgaccagac aaaaggaggg 1800
ctgtggtaat gcaacttcaa tgggtctccc aagatggggc agctccgatg aggaggtggg ~ 1860
gcagctggag gaaaaggatc ttctcccctg tgcacagagg tcagggttta catatctgtt 1920
aaattgtcac cttggatatt ctggaggact aaatacatcc tttaggggga aaagtgtgat 1980
tgtatcaaag ttttaagcat ggagtgtatg ggatggtgga aggggaaggc acttggtatc '2040
tgttggttgg cagtgagtag ggtgggaaag ttataatgga gaacttagaa taactttgat - 2100
catttcatgt tttttttctg agggtatcag tagaatacta aatattaaac attcccacca . 2160
tttctttttc ctccagtctc aaagagagag ggtggtaaaa acgctatagg tggggcaagc 2220
ctattatttg ctgtctacac ttatgcagga acaacaggtg taatctgagc ctgtcctggg ~ 2280
cagacagggg atatgtggtc actcactata gaagtttcca aatcaaattt tgagagtttt 2340
ttttaaccag gacatcattt gtcattatat tttacaaaaa taattctgcc atcagggcaa 2400
cctcagctca ccacagctgg ggatagtgga attttccaaa gcttgagcag ggagtataga 2460
gaataaggat gatatttcta ggagctcagg acatggtact gttgctttgt aaagtgctga 2520
agaggaatcg gctctgggca tagagtctgt agtcaggcaa tgtcacctgt cttgagcccc 2580
ttagaaagag tgaatttttc tactcttgtt ctgctgaagc acagtgctta cccatcttgt 2640
atcatccaca attaacacat gctactgcag ttgtctgata gtggatctct gtctttctat 2700
gactaggctc cttgacctca gaggtaagtc taactcagtt gagtgtctcc atcaccccca 2760
gcggagagcc agctgtgtca ctgacacctg ataatcacct tctgagggag tgtgatggga 2820
gatgctccag taaatagttc tgaaagtctg tggctgtttg tctgtcttga ctggacatgt 2880
ggatttcctg ctgcacgcat agaggaagga tggtaaagag gtgctgattt taattttcca 2940
catctttctc cactcagcgt ctttggggcc tacagcatgg atgtgatcac tagcacatca 3000
t
3001
<210> 90
<211> 410
<212> DNA
<213> Homo Sapiens
<220>
69
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> allele
<222> 168
<223> 99-28779-168 : polymorphic base C or T
<220>
<221> misc_binding
<222> 149. 167
<223> 99-28779-168.mis1
<220>
<221> misc binding
<222> 169..187
<223> 99-28779-168.mis2, complement
<220>
<221> primer bind
<222> 1..17 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 390..409
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 156. 180
<223> 99-28779-168 potential probe
<400> 90
tgactgctta acagaccaag ttgcttgcat tttgtatgtt tagccctcct ttgccactgc 60
ttttagagcc ttggaaggct aagtgtgata gtaatgctag ctctaatgca tatttaaagg 120
agactgcctc gcttttagaa gacatctggt ctgctctctg catgaggyac agcagtaaag 180
ctctttgatt cccagaatca agaactctcc ccttcagact attaccgaat gcaaggtggt 240
taattgaagg ccactaattg atgctcaaat agaaggatat tgactatatt ggaacagatg 300
gagtctctac tacaaaagtc tttgggtatt tgtttcttac atagaaaatg ctaacatgaa 360
tagaaagata ctggtgcaag accattcccg ggaaagtaga catacttaca 410
<210> 91
<211> 479
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 300
<223> 99-28788-300 : polymorphic base A or G
<220>
<221> misc binding
<222> 281..299 .
<223> 99-28788-300.mis1
<220>
<221> misc_binding
<222> 301. 320
<223> 99-28788-300.mis2, potential complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
CA 02395240 2002-06-20
WO 01151659 PCT/IB01/00116
<220>
<221> primer bind
<222> 458..478
<223> downstream
amplification
primer, complement
<220>
binding
<221> misc
_
<222> 288. 312
<223> 99-28788-300
potential probe
<400> 91
tctacccatt ctgcttctctgatttttaatgcattgtctctatcccaggc tactttggag60
ggtcatcccg agtttgcagataaattcttccttcctctttggactcattt agaagaaagt120
tgtaactatg gaaatgatgtaactagcctgttaacatccctcagcttcct gttagaaatc,180
cccagtgaaa tgtggagaggttggcttttgacctttgtgttcaccatcat caccatcata240
caatatttat gaaacaccacacacatataattctgaactgagccaagcac agagatcacr300
tccactttcc tcaagggacttgtaatttaaccttggtctggtgtgctact tagaccaggt360
gtggttacat aagaaggaggctgctgccagcaaccacacattaataacaa-tctctctatt420
ttagaataag tccaggaatatgttaggcatggatgtagtaaagtagccaa gaaagggga479
<210> 92
<211> 499
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 263
<223> 99-32052-262polymorphicbase C T
: or
<220>
<221> misc binding
<222> 244..262
<223> 99-32052-262.mis1
<220>
binding
<221> misc
_
<222> 264. 282
<223> 99-32052-262.mis2, complement
<220>
<221> primer bind
<222> I..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 478..498
<223> downstream amplification primer,
complement
<220>
<221> mist binding
-
.275
<222> 251.
<223> 99-32052-262 potential probe
<400> 92
cagagtgaca aataagtgct atggcttgat agaagtgaagctcttcacat atattcaaaa60
tacatatcac aaactttggt aaataggata gtaatctgaagaacttttgc cctttttacc120
ccatttactg taactcttgt ttctaggtaa tcgttctctctcaacaaact tctcaagcgt180
ctgtgtaaca agccacatgt tctaacaaat tgtctccatcgcacttcaac agccaggtcc240
ctatttttta taacgtatta acyttattat tttcttattattttaaaaga atctatgcac300
attagcaaaa tttaaaagat agagaaaaat ataaacagaaaaaattatgt ttacttctac360
caccctaaat caactattat caattttata catattttactccatctttt ttcaaagttt420
71
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
cttacatttt ccaatgtcat taaaattctc tgtgaatgta aattttaaaa actgtaccta 480
ctgttttttg gaatctgta 499
<210> 93
<211> 467
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 244
<223> 99-32121-242 : polymorphic base A or G
<220>
<221> misc_binding
<222> 225. 243
<223> 99-32121-242.mis1
<220>
<221> misc binding
<222> 245..264
<223> 99-32121-242.mis2,
potential complement
<220>
<221> primer bind
<222> 1. .7.7
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 448..466
<223> downstream amplification
primer, complement
<220>
<221> misc binding
<222> 232..256
<223> 99-32121-242 potential
probe
<220>
<221> misc_feature
<222> 72
<223> n=a, g, c or t
<400> 93
agcagtatga cagggaccat tctgggtctctgggaagttctcagctgcgg ggagctctgc60
aggccgcagt tnccagctaa atgaacaactttaccaaatgattgtccgcc ggtatgctaa120
tgaagatgga gatatggatt ttaacaatttcatcagctgcttggtccgcc tggatgccat180
gtttcgtgcc ttcaagtctc tggatagagatagagatggcctgattcaag tgtctatcaa240
agartggctg cagttgacca tgtattcctgaagtgggaactgagaagtca agatcctccc300
tggaggacag gactgaaaac cttgccaagctgtacacagttgctgatacc ctgtgcaaca360
gctctcattt cctggcaagc tctttcacaaccctacatatttctgatcat gtgctgcctt420
ttactgctga attaaaacag atattcacgaaaaatgttctgagtggt 467
<210> 94
<211> 469
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 169
<223> 99-32059-169 : polymorphicbase C T
or
72
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> misc binding
<222> 149..168
<223> 99-32059-169.misl, potential
<220>
<221> misc binding
<222> 170..189
<223> 99-32059-169.mis2, potential complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 448..468
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 157. 181
<223> 99-32059-169 potential probe
<400> 94
acaagaaccc acctaccttc cgggttaaga aatagaatat cccatacctg acaagcccac 60
atgcacccca cgccccctaa gcacattcac ccctgttccc tgctctaaaa taaacactat 120
cctgagtttg gcaaacacca cttctttgtt ttttctttat aatattacya tctatgaata 180
tatttctaaa caatacattg ttagtttatt cttcttcaaa ttttatgtaa aaggaatcac 240
actacagata ttgttctgtg acttatttgg cccaatatgt ttctgagatt catccttgct 300
gatggggttg gctgcagttc acttgttttc agtgttgttt atagtaattc tattgtatga 360
ataataacaa tttatttatt catccaactg tgaaggacat~ttggattgtt tccagttttt 420
ttttcttttt ggattttgaa caatgctgtc tataaacgct ttaggatgt 469
<210> 95
<211> 450
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 304
<223> 99-32061-304 . polymorphic base A or G
<220>
<221> misc_binding
<222> 285. 303
<223> 99-32061-304.mis1
<220>
<221> misc binding
<222> 305..324
<223> 99-32061-304.mis2, potential complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 430..449
73
CA 02395240 2002-06-20
WO 01/51659 PCT/1801/00116
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 292..316
<223> 99-32061-304
potential probe
<400> 95
cacaaaactc actattgccatagctgcaattaaaatttagataatctggc tgcttactaa60
agcaaatagc ttgataaaatgtaccccaaaacagataaaaattatacagc aaaatatact120
atttttttaa ttcttaaatgtcaaatcagtatcatgataagaattattgc acaatctttg180
gttcttttct ttaaaacctactgaggtccccaggaagaattataaactta ataaaaaaaa240
atccagactt gaagatatttcagggccacatttcaaaggagaccagctct ttggagggag300
gccrtaatcc ctccataacctgtcctaatctggagcccagagaagtccag agttagaact360
aaggagttac attgggtaagtacaaatagaaaagataatggtctcatgga aactccagac420
agtgggcccc atccctttcctggaagtcag 450
<210> 96
<211> 487
<212> DNA
<213> Homo Sapiens
<220>
<22l> allele
<222> 303
<223> 99-32065-303 base G
: polymorphic or T
<220>
<221> misc
binding
_
<222> 284. 302
<223> 99-32065-303.mis1
<220>
c221> mist binding
c222> 304..322
<223> 99-32065-303.mis2,
complement
<220>
<221> primer bind
-
<222> 1..17
<223> upstream amplification
primer
<220>
<221> primer bind
-
<222> 469..4
86
<223> downstream amplification
primer, complement
<220>
<221> misc
binding
_
<222> 291. 315
<223> 99-32065-303 potential
probe
<400> 96
gcccaaatgc caactacatt atgataatcttctaaaagttataattgcct aatgttaaaa60
tattttgttt tctgagttat tgccaaatgcgatacatccctagttcggaa agatacccaa120
ctactatact tgaaaccact gaagctacaaaataccttgctctcagtttt cacatttgct180
tttctccctc tacagctttc tgcagtggcataagtggattagttatacta tttttattaa240
ttactttagt agtaatttct attaaaacaattattaataacaattattaa ccagtacagt300
ctkgttattt taaacattag catgaggcagaatggaactgcttttcaggc attatctaat360
taagatggta atagaggaga aactgatcatgagttgacaaagctactggt aaaagtttat420
tcttattgaa cagaaccaaa ttgttgtgatctgtatgccttaaaagtgca gcctcttatg480
tggactc
487
74
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<210> 97
<211> 541
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 118
<223> 99-32123-118 : polymorphic base A or G
<220>
<221> misc binding
<222> 99..117
<223> 99-32123-118.mis1
<220>
<221> misc_binding
<222> 119. 138
<223> 99-32123-118.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223>,upstream amplification primer
<220>
<221> primer bind
<222> 520..540
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 106. 130
<223> 99-32123-118 potential probe
<400> 97
cagtaaatga ateagtaaag tacaatataa cacaaaagaa aacgaaatat tgcttgattt 60
tttccaataa aagcaaggtt aataaaaaca tttttagtaa gaaaatctat catttttrtt 120
ttaaaaatct ttcaatttta aacatcatta ccaacacatt aaaagtatta tcaataagtg 180
cctttacaat ttcaagcaaa agctactgtg ttttccttat tggaaatact gctttcagtc 240
atcttttttg tctgaggtac tctcttcatg cttttcaggg ctgactttat tactggcggt 300
ggagggggtt gtctggactt ettttggtaa tgaaaacaca tggcacgtct ggaggtctag 360
gtatgttgta aatatcttag catattctgg atgctttaag gcaaaacttt taaattcctc 420
tagaagagaa agaaaaaaaa tccaataagt tggggtgaat cttcttttgg catgatgcag 480
attaataaat gactctaata atgcaattat tacaaaattc tactacccaa cacacaaaca 540
t 541
<210> 98
<211> 449
<212> DNA
<2I3> Homo Sapiens
<220>
<221> allele
<222> 314
<223> 99-32148-315 : polymorphic base G or C
<220>
<221> misc binding
<222> 294..313
<223> 99-32148-315.misl, potential
<220>
CA 02395240 2002-06-20
WO 01/51659 PCT/1801/00116
<221> misc binding
<222> 315..333
<223> 99-32148-315.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 428..448
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 302. 326
<223> 99-32148-315 potential probe
<400> 98
tgagtgcatt tgatgtgggs cagcaaagct tcattcaggt ggaaacagat taagaagacc 60
aaagagtggt gaaatggcta agtaggaatg aaaaaacagc cagctacccg yggccagtgc 120
cttattctaa aagaggacag ctagcttgcc caaggactct tgcagaagga aacctgggag 180
agtttccttc tcctcttgca gaagtaaact cttcaggttg aagagtcagg aaggagctcc 240
agggatgagt gaagtcaact gaagttgcct cttttataaa cagctctgca gtggttctct 300
ggaaaccgag gctsgttgca aacccctaaa aagtactgct ctgcaaggct tgtaactgcc 360
atacttgtgt ggtcctgctc catctccatg tgtggcagtg ccagctgcaa ccagcctcac 420
acagggtccg agagtctcag aactgcaag 449
<210> 99
<211> 920
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 95
<223> 16-2-76 : polymorphic base A or G
<220>
<221> misc binding
<222> 76..94
<223> 16-2-76.mis1
<220>
<221> misc binding
<222> 96..114
<223> 16-2-76.mis2, complement
<220>
<221> primer bind
<222> 20..39
<223> upstream amplification primer
<220>
<221> primer bind
<222> 240..260
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 83..107
<223> 16-2-76 potential probe
76
CA 02395240 2002-06-20
WO 01!51659 PCT/IBO1/00116
<400>
99
ctggggcctgagactgaggtccagggagaccctaattcct gcaccccacc cctcctggtt60
ccctccagatgggaggcatggaggctgtcatcacrggcct ggcagatgac ttccaggtcc120
tgaagcgacaccggaaactcttcacatttggcgtcacctt cagcactttc cttctcgccc180
tgttctgcataaccaaggtgagtaggggctgggctctggg tcacctgggg gcctctgagg240
ccgcatttcaataaagtcaaacattcctagccttagaact gggctgagct cagggagaac300
aatgcaggatccagcatcctcaattcagcggcctgaccca ctagggttag gcccagtagt360
cttcttccatctctgassctgaggattccattcagccctg ttaattgcct tattgacttg420
agggscagcaaaagtccctttggaacccatctaactcttt attggctgaa actgaggtga480
ctgtaacgtcaatacaacagcaccacagccctatgccctg ggttttcaaa tagagctccg540
agcaagtgggacagggggcaggtaagagttgacagacaca acaatcagtt cccacgtttg600
accaaagagggcctcttggcttcttctctccctgtgccag ggtggaattt acgtcttgac660
cctcctggacacctttgctgcgggcacctccatccttttt gctgtcctca tggaagccat720
cggagtttcctggttttatggtatgtgagtgtgtggaaaa gcctcagctc ccagtcctcc780
tagaatcctgcacctggaggtgtgcagggaggccttccat ttccaggaca gccacctaaa840
attccagagtccagcaagtcacttattgggaacaaatctc aatcctcggc tcatctttgg900
atgaacctgcccttaacagg 920
<210>
loo
<211>
395
<212>
DNA
<213> Sapiens
Homo
<220>
<221>
allele
<222>
120
<223>
16-28-93
. polymorphic
base
A or
C
<220>
<221>
misc
binding
<222> _
101. 119
<223>
16-28-93.mis1
<220>
<221> misc
binding
_
<222> 121. 143
<223> 16-28-93.mis2, complement
<220>
<221> primer bind
<222> 28..47
<223> upstream amplification
primer
<220>
<221> primer bind
-
74
<222> 354..3
<223> downstream amplification
primer, complement
<220>
<221> misc binding
<222> 108..132
<223> 16-28-93 potential
probe
<400> 100
tctgttatct ctaaacctgt gttctgtccgcccacacatg acctaacaat tgggccccca60
gatactcccc tatcatgtgc agctcagaccaatggtttca gccattgatg aggtccttgm120
tgtttcttac aggagctggc ctagtgttcatcctgtatcc agaggccatt tctaccctgt180
ctggatctac attctgggct gttgtgtttttcgtcatgct cctggcgctg ggccttgaca240
gctcagtgag tgaccctgct taggatacctatcccccatc ccactgggcc tgaccccctt300
ccccaacaca cagtgctggg cctgaagttcccactattca aacaccaggt taacagttgt360
ttcccagaag gccctattta aattgcagacaaaaa 395
77
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<210> lol
<211> 922
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 342
<223> 16-3-199 : polymorphic base C or T
<220>
<221> misc_binding
<222> 323. 341
<223> 16-3-199.mis1
<220>
<221> misc
binding
_
<222> 343. 361
<223> 16-3-199.mis2,
complement
<220>
<221> primer bind
<222> 143..162
<223> upstream
amplification
primer
<220>
<221> primer bind
<222> 374..393
<223> downstream
amplification
primer, complement
<220>
<221> misc binding
<222> 330..354
<223> 16-3-199
potential probe
<220>
<221> miac_feature
<222> 565,643
<223> n=a, g, c
or t
<400> 101
agctcaagaa acagtgtctggatgagtgactcaatggacc agctccacaa acaaagctgg60
aggtgtcttg tacagaccccaaatgctatccatgtggggc tgcaggatca aatagcaggt120
ggccctcatc tgcaggtgcagccaggctgcragaagggtg tccctgggcc aagctgaggc180
ctcctcccct tctcttcctttcagagactggcctatggca tcacgccaga gaacgagcac240
cacctggtgg ctcagagggacatcagacagttccaggtgg gtgaagccta gacccctggg300
gtggagatta caagggcgggccctggctgttccctgctgt gyactgccca aggctagaca360
tcacatccag aaaacccagaaacccagtgtgagctgcctt ttccccttgg aaacatcggg420
atgggggaca gggaggctcaccttgagcccatggcctcag gcttgccctg tgactttggg480
gaggttctgc tgccctttctgggcctctgtgacaattagg gaatcaactt gcacgttccc540
tgaggtccgt gaaggaagggggtgnttttctgccttctct ctacctcctg ctgcccccgc600
cagctggccc ttgctcctttctgtccccaccatgtcatca agncctcgct gtctttctct660
gcagttgcaa cactggctggccatctgagcctgcctggag gagaaggagg aacccccatg720
ccaatgtcca ggtcacaggcatccgctgcgctcccacctc ggacaccatc ttgggattec780
tcccctggaa gttgtcctttctgatcctctcttcttttcc catttacaaa tgatttcgtg840
actgtagttt ttgttcaccttctgtgcatctggcctgggg gctgttagct cagaggagag900
gagcaaacag gaaaatgacttc 922
<210> 102
<211> 245
<212> DNA
<213> Homo Sapiens
78
CA 02395240 2002-06-20
WO 01/51659 . PCT/1801/00116
<220>
<221> allele
<222> 197
<223> 16-50-197 : polymorphic base C or T
<220>
<221> misc_binding
<222> 178. 196
<223> 16-50-197.mis1
<220>
<221>misc
binding
<222>_
198. 216
<223>16-50-197.mis2, complement
<220>
<221>primer bind
<222>1..20
<223>upstream amplification
primer
<220>
<221>primer bind
<222>227..245
<223>downstream amplification
primer, complement
<220>
<221>misc
binding
<222>_
185. 209
<223>16-50-197 potential
probe
<400>102
agaacctcat atcatggggg ccatggtaac aggcctgccc60
gggaggacct
ggccctggct
tgtgtgtgca aacgacatcc agcagatgat ggggttcagg120
caggagtgga
caggttcagc
ccgggtctat ttcgtcagtc ctgccttcct cctggtgtgt180
actggagact
gtgctggaag
agtgtctgca agggggctgt gtccaggatg gagctgggtg240
gggaagycct
gcatgtgggg
aggat 245
<210>103
<211>357
<212>DNA
<213>Homo Sapiens
<220>
<22l>allele
<222>181
<223>16-1-59 : polymorphic C or T
base
<220>
<221>misc
binding
<222>_
158. 180
<223>16-1-59.mis1
<220>
<22I> misc_binding
<222> 182. 200
<223> 16-1-59.mis2, complement
<220>
<221> primer bind
<222> 123..142
<223> upstream amplification primer
<220>
79
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> primer bind
<222> 290..309
<223> downstream amplification
primer, complement
<220>
<221> mist binding
<222> 169..193
<223> 16-1-59 potential probe
<400> 103
gttgccaggg ctgcccatct ctggttcagaccatgtttcctctggtctca gagcatcccc60
agggtttctc agcccttccg gaccagtgaggtgttccagtgttgtaggaa gcagaggctg120
atggcttttg tctgctggtt tcaggtatggattgatgccgcaactcagat atttttttcc1B0
ytgggggctg gatttggagt attgattgcatttgccagttacaacaaatt tgacaacaac240
tgttacaggt aagattcttc tcagaattctgagaagctctaaatcctggg gattgactct300
tgtggggtgg cagagagggc tctggtctggaagccaactctccctgggca agccaaa 357
<210> 104
<2I1> 920
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 206
<223> 16-2-187 : polymorphic
base A or G
<220>
<221> mist binding
<222> 7.83..205
<223> 16-2-187.mis1
<220>
<221> mist binding
<222> 207..225
<223> 16-2-187.mis2,complement
<220>
<221> primer bind
<222> 20..39 . '
<223> upstream
amplification
primer
<220>
<221> primer bind
<222> 240..260
<223> downstream
amplification
primer, complement
<220>
<221> misc
binding
_
<222> 194. 218
<223> 16-2-187
potential probe
<400> 104
ctggggcctg agactgaggtccagggagaccctaattcct gcaccccacc cctcctggtt60
ccctccagat gggaggcatggaggctgtcatcacgggcct ggcagatgac ttccaggtcc120
tgaagcgaca ccggaaactcttcacatttggcgtcacctt cagcactttc cttctcgccc180
tgttctgcat aaccaaggtgagtagrggctgggctctggg tcacctgggg gcctctgagg240
ccgcatttca ataaagtcaaacattcctagccttagaact gggctgagct cagggagaac300
aatgcaggat ccagcatcctcaattcagcggcctgaccca ctagggttag gcccagtagt360
cttcttccat ctctgassctgaggattccattcagccctg ttaattgcct tattgacttg420
agggscagca aaagtccctttggaacccatctaactcttt attggctgaa actgaggtga480
ctgtaacgtc aatacaacagcaccacagccctatgccctg ggttttcaaa tagagctccg540
agcaagtggg acagggggcaggtaagagttgacagacaca acaatcagtt cccacgtttg600
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
accaaagagg gcctcttggcttcttctctccctgtgccag ggtggaattt acgtcttgac660
cctcctggac acctttgctgcgggcacctccatccttttt gctgtcctca tggaagccat720
cggagtttcc tggttttatggtatgtgagtgtgtggaaaa gcctcagctc ccagtcctcc780
tagaatcctg cacctggaggtgtgcagggaggccttccat ttccaggaca gccacctaaa840
attccagagt ccagcaagtcacttattgggaacaaatctc aatcctcggc tcatctttgg900
atgaacctgc ccttaacagg 920
<210> 105
<211> 466
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 311
<223> 99-28761-311 base A or G
: polymorphic
<220>
<221> misc binding
<222> 292..310
<223> 99-28761-311.mis1
<220>
<221> misc_binding
<222> 312. 331
<223> 99-28761-311.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 446..465
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 299. 323
<223> 99-28761-311 potential probe
<400> 105
tttgtaactc taagaaggca tttttaaaaa gtaagtaggc aataaagaaa tggtacttct 60
atgtaagtag tgcatgtgta gtagtgagtt ttgtgatcaa tatacattgc tttgtatgtg 120
atttgctttt aagatgttgg aaatgagaat ctgatatatt agagaatttg acttacaaga 180
tttgcaattt taagtgtaac acctaggagg atttaatgaa ttaattttgt agtcaatgtt 240
tggatgctca ggagaacctg aatttatcag tttaattctc agcaggttga aatgctttaa 300
gagaatttgt rtgctaaatt tagaagtttt gatttattag tcttacaaga actaagtaag 360
tcctgagaaa gattttgttt cttctatttg taagtcttcc tgttagggat ttgaagattt 420
taacaaagcc agatgtatca aatttgtgag tatagtttga aatgct 466
<210> 106
<211> 462
c212> DNA
c213> Homo Sapiens
c220>
<221> allele
c222> 86
<223> 99-28771-86 : polymorphic base C or T
<220>
81
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<221>~.misc binding
<222> 67..85
<223> 99-28771-86.mis1
<220>
<221> misc_binding
<222> 87..106
<223> 99-28771-86.mis2, potential complement
<220>
<221> primer bind
<222> 1..18 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 444..461
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 74..98
<223> 99-28771-86 potential probe
<400> 106
ttcagagtag taacttccaa aggctaatgg atgaatgtga gtatttccat tctcattgtg 60
gccaggaaag atagagataa tcatayagta cccagaaaat gactgcttca tatgatgagg 120
ctttaatttc cattttaatg gaaacatgtt catttaaaag aaagaaaagc agatttctga 180
actatgtctc ctctctccgt taacaacctg gatgtgcacc tagaattaat gagctacatt 240
tttatttcta ttttgctaaa gaggctgacc agggctgttg cattacctga tgtctaatct 300
ttccagtgct cctctcacgc ctcccctcac tgttttcccc cttctgaatg cgatgttagt 360
attttggctt tgtctcaaat aaacttacaa gtcgggtttt tatttctccc caacggagcc 420
tctcaaatcc cttatcttca gctcaacagg aaggagatta ct 462
<210> 107
<211> 452
<212> DNA
<213> Homo Sapiens
<220>
<22I> allele
<222> 291
<223> 99-28791-291 : polymorphic base A or G
<220>
<221> miac_binding
<222> 272. 290
<223> 99-28791-291.mis1
<220>
<221> misc_binding.
<222> 292. 313
<223> 99-28791-291.mis2, potential complement
<220>
<221> primer bind
<222> 1..18 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 432..451
<223> downstream amplification primer, complement
82
CA 02395240 2002-06-20
WO 01/51659 PCT/1801/00116
<220>
<221> misc binding
<222> 279..303
<223> 99-28791-291
potential probe
<400> 107
taaaaaccca cactcaacatgggcagtcaagccaaagactgggacctttg gagagcctct60
ggaatgagag ttctctggggtacttccaaagggagctggcagtcagtcca ggggacctaa120
aggaatttgg ttgaacagtatcatctctgtgcatagtaagagggaatgtt gggtggtccg180
ggcagtttcc aatatggcaaagcatctgcttggacagtgccagcaagcct tcctctgacc240
cagtctccaa tgtccactaacttataaaaatgtcatcaactcccacatgt ragaaacacc300
atgatttgta ctgtgcatgggtcacattcttattctagaaatgcatcacc ctgtgtttat360
ccaagtgtgt ttacttggtgtaatgtccagtagtaatagaatatgaaata tcaaggaacc420
atctttgtta cgtgacttccaaaatgtgagat ~ 452
<210> 108
<211> 489
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 66
<223> 99-32077-66 base A
: polymorphic or G
<220>
<221> misc_binding
<222> 47..65
<223> 99-32077-66.mis1
<220>
<221> misc binding
<222> 67..85
<223> 99-32077-66.mis2,
complement
<220>
<221> primer bind
<222> 1..38 '
<223> upstream amplification
primer
<220>
<221> primer bind '
<222> 471..488
<223> downstream amplification
primer, complement
<220>
<221> misc_binding
<222> 54..78
<223> 99-32077-66 potential
probe
<400> 108
gctggaggtg agataaggca tcttcaccgctgcatttccagctttgtagg gggaaaacaa60
tttgcrtttg ggaaataatc caacaagcaatcctatggttttaatacaaa~.cactcaaaga120
ggttctggcc atgaccatct gggtccagcccttcactgaattggaaagac ggcaacgata180
atggttgaac aggcccacat gtgttggctctgattctgagtttcccctac ccaccgcacc240
ccatgattga agaggataca gggctccaccactgtcaggcatcaaggaag acacaggtct300
aggggagaaa tcaacacttc tcagggtccttttcaaggactaccccagag atggaaggtc360
atctagtcta tggtgtcctg gacctgccttggcagtagtcgtggccattt tggggtaacc420
taaagaaaac agacaatgtt tgatttgtaacatattgagagttgtttttg cccttttgat480
gacctgcag 489
<210> 109
83
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<211> 489
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 467
<223> 99-32078-466 : polymorphic base C or T
<220>
<221> misc_binding
<222> 448. 466
<223> 99-32078-466.mis1
<220>
<221> misc binding
<222> 468..486
<223> 99-32078-466.mis2, complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 470..488
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 455. 479
<223> 99-32078-466 potential probe
<400> 109
agcacccagt ttgttagagt aagactgggc caaagcatcc tgggatgcag tagtggtatg 60:
gtagactaac tgctgtaaca aatagacccc aaagcggatg gtagctcata cacaacagga 120
atttattctt gttctcatta cagtagtgga tatgggaata ataagcaggc tccaatctat 1B0
ctgggtcttt cagggaccca gaattgacaa ggctttgctt tcttcaacac ttggcttcaa 240
ggttatcctg gggttgcctt ctattctggc cagccagaag gaacaaaaaa catgatgtat 300
ttctatgcgg gaggctttta ggggcccagt ccacaaaagg cttacatcag ttccaccaac 360
tctccattgg ctggaacgca ggcacagggt ggcacctgac tgtgtgggaa atgtggtcca 420
tggctgctca gcacttccca gcatgatgct tggagcaagc aggccayctc tgtctgagag 480
489
aggatacag
<210> 110
<211> 470
<212> DNA
<213> Iiomo Sapiens
<220>
<221> allele
<222> 426
<223> 99-32376-426 : polymorphic base A or G
<220>
<221> misc binding
<222> 407..425
<223> 99-32376-426.mis1
<220>
<221> misc binding
<222> 427_.446
84
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<223> 99-32376-426.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 449..469
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 414. 438
<223> 99-32376-426 potential probe
<400> 110
ggggctgaga attactggca ttgagacttt tgatgctggt agctgcaact gatgcagttc 60
ctccttaaac ccagtgaaaa aacctgtggt cacgtagctt tcacacttta tcctatgtca 120
caaacaaacc tgaatctgca aacctcctgg gatggtcctg caaatgcaag gtgaccatga 180
acctgctgtt ccccagagcc ccctttgcat tgagggcttt tgaggccatc tctcatttga . 240
tacaagctga gcagcctcgt tcctcctgct cttcctcaaa tgtccttcag gctttctctc 300
cttctcacag catggtgcta gatgcttgac tttttacttc ctggaaaaaa aatttcaggt 360
ccatgtggct tcttgatagt aaaagaaagc aatactcatg tatttattgg ttcactcaca 420
tctggrtgtt agagccaaat tccaaagacc tttgaaagtt ctcttgcagg 470
<210> 111
<211> 457
<212> DNA
<213> Iiomo Sapiens
<220>
<221> allele
<222> 420
<223> 99-32361-419 : polymorphic base G or T
<220>
<221> misc_binding
<222> 400..419
<223> 99-32361-419.misl, potential .
<220>
<221> misc_binding
<222> 421. 439
<223> 99-32361-419.mis2, complement
<220>
<221> primer bind
<222> 1..18 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 442..456
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 408..432
<223> 99-32361-419 potential probe
<400> 111
$5
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
tctctaatct tctccatcatcattatctgttgaaattaaaatgcatcctg aggcatgctg60
cccagtggct ttatatcttgtctgcacaatgagattgtaagctccttgag gaaaaggacc120
aggttgtgtg tgaattatgcattccttgtggtgtctagaataatatcaag ttcagaagac180
tcaggtatca cttgagatgtctctttctggcccctccaatggtctgaata aatctgactc240
aaactcccag tttaacagtcttgatgaagcccaaagccctatccatgata cgtgagaatt300
cttattgttt ttcttttgatgggtcccattgtgactagttcaaaatactg gagactatgt360
cttttttcct tctcattaacatggttacaaaactctctcttttataaact tccataaaak420
ctggtgagtc tcttaagaactggtatttagagacctc 457
<210> 112
<211> 424
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 228
<223> 16-21-228
: polymorphic
base A or G
<220>
binding
<221> misc
_
<222> 205. 227
<223> 16-21-228.mis1
<220>
<221> misc binding
<222> 229..251
<223> 16-21-228.mis2, complement
<220>
<221> primer bind
<222> 1..25 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 399..424
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 216. 240
<223> 16-21-228 potential probe ,
<400> 112
tagcaggcta agtcctcctt ctacttcatc ccagatgata cccacttcag gaagtctttc
ccttctgtgg gatgagatgc ccattctgca gggctttcac tccctgcatc.ctgccaaacc 120
tcatcatctc ttacctggat tcctgctaca gcctcccagt tggtgtcccg cttccactct 1B0
gggcccctcc tctccgttct ccacagtgct gtcagaatca cctattcraa aggcgaatcc 240
gatcatgtgg ttcctgctgc ccttaggatc atgtataaac tcctagcatg acttttaagg 300
ccctctatga tcttgcctat tgcaacctcc ccagactcaa cccttgccag gtccctctgc 360
atcagctatc cagaatctct ttgaggccct ccacctgctg tctacctctc tacctctgtg 420
cttt 424
<210> 113
<211> 481
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 156
<223> 16-22-156 : polymorphic base C or T
86
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<220>
<221> misc binding
<222> 133..155
<223> 16-22-156.mis1
<220>
binding
<221> misc
_
<222> 157. 175
<223> 16-22-156.mis2,complement
<220>
<221> primer bind
<222> 1..24
<223> upstream
amplification
primer
<220>
<221> primer bind
<222> 458..481
<223> downstream
amplification
primer, complement
<220> '
<221> misc
binding
_
<222> 144. 168
<223> 16-22-156
potential probe
<400> 113
gcctgacaca tggtaagtccttagtattattacagttatt aggacttagc tgagccagct60
cagggcctgt actgcaggtctcagctttatgtgagcaaga gcattaagga atgatgcctg120
gatgcctggg ggtgtgaagaaaagagccttgggttygact agggaacctg gggccactcc180
ttcctctgct actaaatcaccaagtgatcttgttctgttt tcttctctga ccctccctag240
ttttgtccac ccttgaaataatcatctttccttttcacat ttcatgctta ccaagtactt300
gtcacctaat tatctcctctcttgataagctagatggtyc cttccagggc agcttagtag360
agagcatggg atgtgatgtttcagattccagctctgctgc acacctgcca ggtgaacttg420
gccacgttac atggcctctctgggcttcagttccctcacc tatgagtggg ataagcaagc480
c 481
<210> 114
<211> 478
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 404
<223> 16-23-404 : polymorphic base A or G
<220>
<221> misc_binding
<222> 381. 403
<223> 16-23-404.mis1
<220>
<221> misc_binding
<222> 405. 427
<223> 16-23-404.mis2, complement
<220>
<221> primer bind
<222> 1..26 -
<223> upstream amplification primer
<220>
87
cttttttcct tctcattaacatggttacaaaactctctcttttataaact tccataaaak420
ctggtgagtc tcttaagaactggtatttagagacctc
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> primer bind
<222> 455..478
<223> downstream
amplification
primer, complement
<220>
binding
<221> misc
_
<222> 392. 416
<223> 16-23-404
potential probe
<400> 114
ctaagtggga ataacgctaaacatacttggattaatgcacaaggccctga gatagaggac60
aggcgtctgg tagacctagaagggcacgcaaacatatgaaacacatagga acacaagtga120
gttcaacaga cagagccaagttatcttgctgcaaacattaaaaggtggcc aacctctccc180
aatacacagg tcagactaaaaagatggtttactcttttaaaagttttctt gtgtcattct240
ttctggatac atcggcttcacttgttatgcccagacatggcaaaactaat gaccaagtaa300
tgagggaata gtaatggaaagacttgggagcagtccatcatcacagctta actttttgct360
cacaaccgtg tttttaatactctggtatctgctgtgcgtttgtrtatatc taagatgacc420
aggcagcctt aaacatctagttgcgttcatattctctgtaaaatcgctcc ttgttcct 478
<210> 115
<211> 428
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 175
<223> 16-24-175
: polymorphic
base A or C
<220>
<221> misc binding
<222> 156..174
<223> I6-24-175.mis1
<220>
<221> misc binding
<222> 176..194
<223> 16-24-175.mis2,complement
<220>
<22l> primer bind
-
<222> 1..22
<223> upstream
amplification
primer
<220>
<221> primer bind
-
28
<222> 405..4
<223> downstream
amplification
primer, complement
<220>
binding
<221> misc
_
<222> 163. 187
<223> 16-24-175
potential probe
<400> 115
tcgaaccgat cttcagttgacagaagaggaaacaggctca gaaagattag gcaactcacc60
cgtctcaaga gttggtgacactaagcccagacctgtgtga ctctgaaatc cacacctgtg120
ttctttccac tgacatgagctgccttatggatgggcaggt tctggggtag gacgmgcaga180
gcagctgcgg ggactggtggcggassagtttgtgtacata gagccctcag gtgcggaagc240
mmagcagacc ccagcctctgccaggtggtagctgtaccaa catgcaagca gcaggcattc300
catcctccag agggatggagaacagggccagagaacccac agagggccgc atacaaaatc360
caggtctggt gtcctgccttcacctgcactgcaagggcag gactctaaga agctgtttat420
gaggcagg 428
88
CA 02395240 2002-06-20
WO 01/51659 PCTI1801/00116
<210> 116
<211> 433
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 286
<223> 16-25-286 : polymorphic base C or T
<220>
<221> misc_binding
<222> 267. 285
<223> 16-25-286.mis1
<220>
binding
<221> misc
_
<222> 287. 305
<223> 16-25-286.mis2, complement
<220>
<221> primer bind
<222> 1..22
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 412..433
<223> downstream amplification
primer, complement
<220>
<221> misc binding
<222> 274..298
<223> 16-25-286 potential
probe
<400> 116
ggtcccatgc ctcagtgaca tccttgcctccctggcaggg tgaccctgtg gtgtttgcag60
gagtcttcag agggtgaaag ggaggggccagtgagatggg tggctgatgc ctgggaactt120
gtccggcttt acccagagcc ctctgcctctggtgcaggag gctgcccggc gagcccagga180
gctggagatg gagatgctct ccagcaccagcccacccgag aggacccggt acagccccat240
cccacccagc caccaccagc tgactctccccgacccgtcc caccayggtc tccacagcac300
tccygacagc cccgccaaac cagagaagaatgggcatgcc aaagaccacc ccaagattgc360
caagatcttt gagatccaga ccatgcccaatggcaaarcc cggacctccc tcaagaccat420
gagccgtagg aag 433
<210> 117
<211> 433
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 279
<223> 16-25-279 : polymorphic
base C or G
<220>
<221> misc binding
<222> 260..278
<223> 16-25-279.mis1
<220>
<22I> misc binding
89
CA 02395240 2002-06-20
WO 01!51659 PCT/IBO1/00116
<222> 280..298
<223> 16-25-279.mis2, complement
<220>
<221> primer bind
<222> 1..22
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 412..433
<223> downstream amplification
primer, complement
<220>
binding
<221> misc
_
<222> 267. 291
<223> 16-25-279 potential
probe
<400> 117
ggtcccatgc ctcagtgaca tccttgcctccctggcaggg tgaccctgtg gtgtttgcag60
gagtcttcag agggtgaaag ggaggggccagtgagatggg tggctgatgc ctgggaactt120
gtccggcttt acccagagcc ctctgcctctggtgcaggag gctgcccggc gagcccagga180
gctggagatg gagatgctct ccagcaccagcccacccgag aggacccggt acagccccat240
cccacccagc caccaccagc tgactctccccgacccgtsc caccayggtc tccacagcac300
tccygacagc cccgccaaac cagagaagaatgggcatgcc aaagaccacc ccaagattgc360
caagatcttt gagatccaga ccatgcccaatggcaaarcc cggacctccc tcaagaccat420
gagccgtagg nag 433
<210> !I8
<211> 478
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 393
<223> 16-23-393 : polymorphic
base G or T
<220>
<221> misc binding
<222> 370..392
<223> 16-23-393.mis1
<220>
<221> mist binding
<222> 394..416
<223> 16-23-393.mis2, complement
<220>
<221> primer bind
<222> 1..26 -
<223> upstream amplification primer
<220>
<221> primer bind
<222> 455..478
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 381..405
<223> 16-23-393 potential. probe
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<400>
118
ctaagtgggaataacgctaaacatacttggattaatgcacaaggccctgagatagaggac 60
aggcgtctggtagacctagaagggcacgcaaacatatgaaacacataggaacacaagtga 120
gttcaacagacagagccaagttatcttgctgcaaacattaaaaggtggccaacctctccc 180
aatacacaggtcagactaaaaagatggtttactcttttaaaagttttcttgtgtcattct 240
ttctggatacatcggcttcacttgttatgcccagacatggcaaaactaatgaccaagtaa 300
tgagggaatagtaatggaaagacttgggagcagtccatcatcacagcttaactttttgct 360
cacaaccgtgtttttaatactctggtatctgckgtgcgtttgtgtatatctaagatgacc 420
aggcagccttaaacatctagttgcgttcatattctctgtaaaatcgctccttgttcct 478
<210> 119
<211> 742
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 364
<223> 16-106-364 : polymorphic base C or T
<220>
<221> misc binding
<222> 345..363
<223> 16-106-364.mis1
<220>
<221> misc binding
<222> 365..383
<223> 16-106-364.mis2,complement
<220>
<221> primer bind
-
<222> 1..22
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 723..742
<223> downstream imer, complement
amplification pr
<220>
<221> misc binding
<222> 352..376
<223> 16-106-364
potential probe
<400> 119
cccagatggg tgatctacaatgaccagaaagtgtgtgcct ccgagaagcc gcccaaggac60
ctgggctaca tctacttctaccagagagtggccagctaag agcctgcctc accccttacc120'
aatgagggca ggggaagaccacctggcatgagggagaggg gctgagggat ggacttcagc180
ccctctgctc tgtaccctttttccttttgtccccggcagc agggaagaag ctggaggccg240
tgggagaatg gctgggcagagcagaggggcagcgatagac tctggggatg gagcaggacg300
gggacgggag gggccggccacctgtctgtaaggagacttt gttgcttccc ctgcccccgg360
aatycacagt gctctgcttctctgtgtcgccccgcccagc cccctggtgt ggagggaggg420
gtctcgtttg tgcgcgtgggtgtagctttgtgcatcctct cccagtggag cgatcacctg480
tgcctcccct ccccctttgtttgcccctgtgtggttggtc aaggagggat gtgagggaaa540
tagggacccc ccgacttgccctcctgcctcagtctttccc ccaccctgtc tcttccttgt600
ccttctctgg aaaatgccaaaatacacgatgtgaataaaa gtacaacggc taaattgtgt660
cctgtttgat accttgggggagaggcttaccttcctgggg ttagcaggag ggcgcttaag720
aaaactccta actctggccgcc 742
<210> I20
<211> 535
<212> DNA
91
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<213> Homo Sapiens
<220>
<221> allele
<222> 285
<223> 16-16-285 e C or T
: polymorphic
bas
<220>
<221> misc
binding
_
<222> 265. 284
<223> 16-16-285.misl,potential
<220>
binding
<221> misc
_
<222> 286. 304
<223> 16-16-285.mis2,complement
<220>
<221> primer bind
-
<222> 1..19
<223> upstream
amplification
primer
<220>
<221> primer bind
<222> 516..535
<223> downstream
amplification
primer, complement
<220>
<221> misc binding
<222> 273..297
<223> 16-16-285
potential probe
<400> 120
gttggcaggg ctgcttctcaccccaaaccaagggagggac aggcagggag gctgagagca60
gcggcttgcc ctggagctgtcaggtgggaggcagagggcg ggagaggctg tgggctgccc120
aggtctgatc cctgacccacttgccacccgtgccctcagt tcttccccaa tggagaggcc180
atctgcacgg gctcggatgacgcttcctgccgcttgtttg acctgcgggc agaccaggag240
ctgatctgct tctcccacgagagcatcatctgcggcatca cgtcygtggc cttctccctc300
agtggccgcc tactattcgctggctacgacgacttcaact gcaatgtctg ggactccatg360
aagtctgagc gtgtgggtaagggccagccctggctgctgc ttcctcagct ggaaggaccc420
tccccagccc tccctccccattctgtaccccccatcagct cccatttcgg actctcttac480
tgctgtccct tgtcactgggtgactccacccctggaatcc agtacccctt ggttc 535
<210> 121
<211> 529
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 121
<223> 16-17-121
: polymorphic
base C or T
<220>
<221> misc binding
<222> 102..120
<223> 16-17-121.mis1
<220>
<221> misc binding
<222> 122..140
<223> 16-17-121.mie2,complement
92
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<220>
<221> primer bind
-
<222> 1..19
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 508..529
<223> downstream amplification
primer., complement
<220>
<221> mist binding
<222> 109..133
<223> 16-17-121 potential
probe
<400> 121
gcaggcccag cagacttgag tctgaggccccaggccctaggattcctccc ccagagccac60
tacctttgtc caggcctggg tggtatagggcgtttggccctgtgactatg gctctggcac120
yactagggtc ctggccctct tcttattcatgctttctcctttttctacct ttttttctct180
cctaagacac ctgcaataaa gtgtagcaccctggtacatctgtgatgttt gccttctact240
ctcttctgtt ccaaaaagac ccaggtcccatttaagggcagtaatgtgtt acaggtgctg300
tgataaaggc tgggtactgg atagcttgtgggcttatgggaggaggcctg agatgggtca360
gggggagaag gtattcagca ggtggctgggggactgtgtgcagcagttcg ctatggcctg420
cctgtggtgc ccatgtgttt gtacgggagggttagcttgagaaggaatca gattataaaa480
ggtcttgaat gtcaagccag agagtccagactttttcctaagggcaatg 529
<2I0> 122
<211> 540
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 185
<223> 16-84-185 : polymorphic
base C or T
<220>
<221> mist binding
<222> 162.184
<223> 16-84-185.mis1
<220>
<221> misc_binding
<222> 186. 208
<223> 16-84-185.mis2, complement
<220>
<221> primer bind
<222> 1..22
<223> upstream amplification primer
<220>
<221> primer bind
<222> 525..540
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 173..197
<223> 16-84-185 potential probe
<400> 122
tagaatgcct ttaatgagca gtaaatctaa ttttattaaa tctcaaccct tgggtacggt 60
93
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
gtgtcatgaa atgggaagtagcacacagtactatatgctacagatgaagtacaatgctgt I20
caaatagggg tacttgtgttaattgttggagtcgcaagctgaactagcgttttcttttct 180
tttcytttct tttcttttcttttcttttcttttcttttcttcttttcaagacaggttctc 240
actctgtcac tcaggctagagtgcagtggtgcaatcacggttcactgcagcctcaacttc 300
ctgggctcaa gcgatcctcccacctcggcctcctaaaatgctgggattataggcatgagc 360
caccactccc agccccacttttttcagactggaaaacgcacactcacatgtgcatcttta 420
aatgatcact tgggctgtggtatggagaatggcgaccagtgaggaggcaggagctgttgt 480
ccgagcaagg gatgatattggcatcttggattggcatggtggcagtagtggtagtgcaga 540
<210> 123
<211> 525
< 212 ~> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 74
<223> 16-87-74 : A or G
polymorphic base
<220>
<221> mist binding
<222> 51..73
<223> 16-87-74.mis1
<220> _
<221> mist binding
<222> 75..97
<223> 16-87-74.mis2,complement
<220>
<221> primer bind
<222> 1..22
<223> upstream ication
amplif primer
<220>
<221> primer bind
<222> 504..525
<223> downstream
amplification
primer, complement
<220>
<221> misc_binding
<222> 62..86
<223> 16-87-74
potential probe
<400> 123
gtccatttcc ctttgtccatgtgtccctcccaccctgcagccggctccct cacatccacc60
ctgggctgca ggcrtgctcggcaggctccccacagatcaaagcttgtcca gggtctgcat120
tgctgccaaa ggccaggaggactggtgtacagaccggaaggagctagagc ttagtggcag180
cctgagaggg gaagctgaaaaaggagaagaggcaaggggcattccagggg agcccgggag240
agccagcacg gcctcctggtatatgaggcaaagaggaagacagacacaga cacagggagc300
tgcaggctgg gggcataagctgggggctgggaagcatagatacagaaatg cacagatgtg360
agctgagaag caaggagggagagagagagacagaaagagagagagagacg tgccagggct420
tgagggacca gagagccctcccagcctctctcggagtgctggtatacagg atgctaccgt480
actagggtaa gacacctctggggacgctgagtatgggaatcaaag 525
<210> 124
<211> 665
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 333
94
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<223> 16-91-333 . polymorphic base A or G
<220>
<221> mist binding
<222> 310.._332
<223> 16-91-333.mis1
<220>
<221> misc_binding
<222> 334. 356
<223> 16-91-333.mis2, complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 641..665
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 321..345
<223> 16-91-333 potential probe
<400> 124
geccatgctc agggtcagtt ggggaagggt ggaaacgggg agtgaagatt tgcctctgct 60
gctatcctga gctccatctc tctatccctc ccatctgtct ctggatttgt agtttcactg 120
tcagggctgc atgggaacca tcacttcaca aggactctaa tttgccctcc tttggcgcct ~ 180
gtgacaagct caggagatgg gcttccttct gccttgctgc ttctcacctt cctttatttt 240
cccccctctt gctcttcttt gaactctcca gctaaggtat gtttgcacca gtgtttgaaa 300
gaaccggcag ctgaacttgt ctgccagtgg gargggggct cttggagtta gctgtctggc 360
ctctggagac caccttctcc agcactgcct ctgccccaag gatcaatgtg ctctaagtat 420
tcatccccca acccctgacc ttgtcgctcc ctctccagtg ggcaatctgt cccaggctat 480
agaaaatgtc ctgagtgtcc tgctcttcta cccggaggat gaggctgcca agagggctct 540
gaaccagtac caggcccagc tgggagagcc gagacctggc ctcggaccca gagaggtaat 600.
cccctctcca cgctcacctg ggaggtagcc ccaaatcaaa caaatagacc tgagaagtaa 660
cctgg 665
<210> 125
<211> 327
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 142
<223> 16-128-142 . polymorphic base C or G
<220>
<221> mist binding
<222> 123..141
<223> 16-128-142.mis1
<220>
<221> miec_binding
<222> 143. 161
<223> 16-128-142.mis2, complement
<220>
<221> primer bind
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 308..327
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 130. 154
<223> 16-128-142 potential probe
<400> 125
ctaggaacag tgcgccagtt tctggtgggc tgcagggcac gaggagatag tcaacttgtc 60
tgactgttaa tccaccctgt cccctgcaga tggaggggcg cagccaggcc ccgtgcccaa 120
gtccctgcag aagcagaggc gsatgctgga gcgcctggtc agcagcgagt gtgagtgcag 180
cccctgcccc gtctcaccca tgcctcccag cctgcacctg cagggcgacc tctccttcct 240
gtgcgactcc atcctggcct gccctatctc acccgtgcct cccagcctgc gcctgcaggg 300
cgacctctcc ttcctgtgcg accccat 327
<210> 126
<211> 551
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 245
<223> 16-133-205 : polymorphic base A or G
<220>
<221> misc binding
<222> 222..244
<223> 16-133-205.mis1
<220> -
<221> misc binding
<222> 246..268
<223> 16-133-205.mis2, complement
<220>
<221> primer bind
<222> 41..59
<223> upstream amplification primer
<220>
<221> primer bind
<222> 472..4-90
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 233. 257
<223> 16-133-205 potential probe
<400> 126
gttctcctgg cactttgctc acctctgttt cccctccagc tcttcctgga gtacctgtcc 60
tttgtgcaat acacctcctg gaactgtctt tccagtctct gctttttgtc ctgatgattt 120
tcatgtgctt ttcctctaca tcatgaagca tttactccac attatcttcc agtttgctca 180
tttgtcctca cctccactct tctctttctg aatttgcctg ttgctttttc agtctcttag 240
ctccrtggag tatgttcagt gttgctgtgt tctgatagag gctccttaag ccatcttgta 300
gattttttgt tgcacttcct ctcttccctt agacctccac aggaggaact tttcaatctg 360
96
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
tcctcttctc tctgcttaat gagcccctgc aaagggtttg ggaagtgctt cagcctctct 420
gtgattgtgt gttcacatta atatttatta ttttcttaaa tgtgcataaa tctcacaatg 480
tgaacagtga tcatctttga gtgatttttt ttctcctttc tacttttagt aattctccaa 540
attttctaca g 551
<210> 127
<211> 551
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 232
<223> 16-135-181 : polymorphic base A or T
<220>
<221> misc binding
<222> 209..231
<223> 16-135-181.mis1
<220>
<221> misc binding
<222> 233..251
<223> 16-135-181.mis2, complement
<220>
<221> primer bind
<222> 52..71
<223> upstream amplification primer
<220>
<221> primer bind
<222> 482..501
<223> downstream amplification primer, complement
<220>
<22I> misc_binding
<222> 220. 244
<223> 16-135-181 potential probe
<400> 127
ttggttgtgg ggaccagaga cagagcaggc agggtctcac gttccccagg gcctctcaag 60
gatagaccct cgccctcatc tccaaaccac gcctcccaga caggaaccaa actcccagag 120
tctccaaact gcctgagcct tgcccactcc ctgggctaac acacacttta aaggaatccc 180
acagtcaccg tgtgaaaagc ttgctacact gcatttgatt ctgggcactg awagcagtac 240
ttggctgcag acactcgttt caaacaggcc ccatttttcc atctctgctg ctgttattag 300
gggagccctt agactctctt gcagcgccgg aataggcgct caagacgtgt gttaatattg 360
caacagcaaa tataatgaat ctgcagttgg ggacgctgag gccggagtgg tggatgaaag 420
gtggccggag ccttttccac gggtccaaac cacctgttac aggagaaggc gagcggcctc 480
gctaagcaac tggacgttcc gcgggcgggg cgggggcggg gccggggccc gagtccgctc 540
ggaaactttc g 551
<210> 128
<211> 551 .
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 455
<223> 16-145-405 : polymozphic base C or T
<220>
97
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/OOI16
<221> misc binding
<222> 436..454
<223> 16-145-405.mis1
<220>
<221> misc binding
<222> 456..474
<223> 16-145-405.mis2, complement
<220>
<221> primer bind
<222> 51..69
<223> upstream amplification primer
<220>
<221> primer bind
<222> 523..540
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 443.467
<223> 16-145-405 potential probe
<400> 128
gtggaaaaaa ccatatggca ttgtcgcctt ctcagcctga cctggcatgc ac'tctcaccc. 60
tcatctgtca tgcctcetgc ttttccacct ggggggctga gaagtccggc catcgaaaec 120
ttggttcctg ccagccacgg gagtttggaa gctttatcag attcctgaag cctcgtttcc 180
tcatgggaac agtgcaggtg aaagcacctt cctctcggaa ccggggggaa gatgagagga 240
aattaaatag atgtatggcc ccgcagcagg actggcgctc tccattgtgt ctgaaattgg 300
caggttcttg gtctcactta cttcaagaat gaaaccacgg accctcgcgg tgactgttac 360
agttcttaaa ggcggcgtgt ctggagtttg ttccttctga tattcagatg tgttccgcgt 420
tttcctcctt ctggtgggtt cctcctctcg ctggytcagg agtgaagctg cagaccttca 480
cggcgagtgt cacagctcat aaacgcagta cagacccaaa gagtgagcag caattagatc. 540
tatcacaaag a 551
<210> 129
<211> 492
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 320
<223> 16-177-320 : polymorphic base A or G
<220>
<221> misc_binding -
<222> 297. 319
<223> 16-177-320.mfs1
<220>
<221> misc binding
<222> 321..343
<223> 16-177-320.mis2, complement
<220>
<221> primer bind
<222> 1..22 -
<223> upstream amplification primer
<220>
<221> primer bind
98
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 472..492
<223> downstream fication
ampli primer,
complement
<220>
binding
<221> misc
_
<222> 308. 332
<223> 16-177-320
potential probe
<400> 129
gaccctatcc gataaatggtgcttcctcttcatgacaaagaaaatgaaca ctcattcact60
caaaatattc agcacctgctgtgtgcttcactcttcctggcacaggggat gcagaatgaa120
cagagagccc ctgccccactgggaggggtgtttgtggggagatggaccag gtaccagtca180
gtgaatatag cacaatggcaggtagagaaaagtgctacagtcatctaccg tgagcgctgt240
gatgctctgc ccagtttcaccacattaatggagcacccactatatgctgg acacatacca300
tgcattttct catcctagcrgctgttgcaaaatagacacgtccattgtga agactgcggg360
cggtagaatc gcagcccccaaaggtgtccaggtcctaatccccaaatcct gtttgtgtgt420
tcccttgcat ggcaggagggatgttgcagatgggattcagttaaagatct tgataccggg480
gagatgattc tg 492
<210> 130
<211> 759
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 354
<223> 16-4-354
: polymorphic
base C or T
<220>
<221> mist binding
<222> 335..353
<223> 16-4-354.mis1
<220>
<221> mist binding
-
<222> 355.
.373
<223> 16-4-354.mis2, complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification
primer
<220>
<221> primer bind
<222> 740..759
<223> downstream amplification
primer, complement
<220>
<221> misc
binding
_
<222> 342. 366
<223> 16-4-354 potential
probe
<400> 130
cctcgttccc acgtaccatc tttcccccaggtggtcaagtaccccctgca cgccatcatg60
gagatcaagg agtacctgat tgacatggcctccagggcaggcatgcactg gctgtccacc120
atcatcccca cgcaccacat caacgcgctcatcttcttcttcatcgtcag caacctcacc180
atcgacttct tcgccttctt catcccgctggtcatcttctacctgtcctt catctccatg240
gtgatctgca ccctcaaggt gttccaggacagcaaggcctgggagaactt ccgcaccctc300
accgacctgc tgctgcgctt cgagcccaacctggatgtggagcaggccga ggtyaacttc360
ggctggaacc acctggagcc ctatgcccatttcctgctctctgtcttctt cgtcatcttc420
tccttcccca tcgccagcaa ggactgcatcccctgctcggagctggctgt catcaccggc480
99
CA 02395240 2002-06-20
WO 01/51659 PCT/1801/00116
ttctttaccgtgaccagcta cctgagcctgagcacccatgcagagcccta cacgcgcagg540
gccctggccaccgaggtcac cgccggcctgctatcgctgctgccctccat gcccttgaat600
tggccctacctgaaggtcct tggccagaccttcatcaccgtgcctgtcgg ccacctggtc660
gtcctcaacgtcagcgtccc gtgcctgctctatgtctacctgctctatct cttcttccgc720
atggcacagctgaggaattt caagggcacctactgctac 759
<210>
131
<211>
47
<212>
DNA
<213> Sapiens
Homo
<220>
<221>
allele
<222>
24
<223> base C
99-27199-207 or T
: polymorphic
<400>
131
cccaatgtggccagggacac tgayggccttttctggggtcttttgcc 47
<210>
132
<211>
47
<212>
DNA
<213> Sapiens
Homo
<220>
<221>
allele
<222>
24
<223> base C
99-27207-117 or T
: polymorphic
<400>
132
tgtgtggccagcccctccag ggcygtgtggacagctttttgtgtatt 47
<210>
133
<211>
47
<212>
DNA
<213> Sapiens
Homo
<220>
<221>
allele
<222>
24
<223>
99-27213-53
: polymorphic
base
A or
G
<400>
133
tcacacatgtaattgtttat gcarcgttagggactctcagattctgt 47
<210>
134
<211>
47
<212>
DNA
<213> Sapiens
Homo
<220>
<221>
allele
<222>
24
<223> base G
99-27218-333 or T
. polymorphic
<400>
134
gatatttaataggtggacca ggtkggggagtgtgtttcactccttga 47
<210>
135
<211>
47
<212>
DNA
<213> Sapiens
Homo
100
CA 02395240 2002-06-20
WO 01151659 PCT/IBO1/00116
<220>
<221> allele
<222> 24
<223> 99-28108-233 . polymorphicbase A or C
<400> 135
cccgtcatgc aacatctgga cacmactaacagagcatggt gaataca 47
<210> 136
<211> 47
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28109-275 : polymorphicbase A or G
<400> 136
atgtgtccta ggatgaacag taaraattatagactctgca gctctag 47
<210> 137
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28110-75 : polymorphic
base C or T
<400> 137
ggtttccgtg ggaaccagat cccygcaggtacaaatgggg cccagcc 47
<210> 138
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28125-81 : polymorphic
base A or C
<400> 138
ggaccgagga agctgtaatt ccamaagctctctgggacct tgatgtt 47
<210> 139
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28134-215 : polymorphicbase C or T
<400> 139
gggtctgtca ccctgtttgg gtayaggctcctgcacgctg gcggcct 47
<210> 140
<211> 47
<212> DNA
101
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28137-96 : polymorphic
base A or G
<400> 140
aagcagtccc agctcttagc aggrcagactctgccaggca gagaagg 47
<210> 141
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32204-305 : polymorphicbase A or G
<400> 141
caggtggttg gacttcagag tccractcttaaccccatcc tccactg 47
<210> 142
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28149-118 : polymorphicbase C or T
<400> 142
cccacatacg atactgtgac cttygatgggaggagctagc atgtgat 47
<210> 143
<211> 47
<212> DNA
<213 > Iiomo Sapiens .
<220>
<22I> allele
<222> 24
<223> 99-28160-285 : polymorphicbase A or G
<400> 143
tggatcaagt gctaggggat cgcrataatgggagtaagta gctgggg 47
<210> 144
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28171-458 : polymorphicbase A or G
<400> 144
actcaagctt tgattccaaa tctrctgttatttcctactg ggaaatg 47
<210> 145
102
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28173-395 : polymorphicbase C or T
<400> 145
ctgggccagt cccaacttat actytgggcaatcgaaactc atttgcc 47
<2I0> 146
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32177-113 : polymorphicbase C or T
<400> 146
taggagaaat taaaaaggga tgaygtactctgttcaaaaa aaaggtt 47
<210> 147
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32181-192 : polymorphicbase C or T
<400> 147
acccaacaat gggattgcta ctgycagttcctatgctcct ctacttg 47
<210> 148
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32193-258 : polymorphicbase G or T
<400> 148
aagaggtaat cgtagcttgg actkggttggagtagtggag acagaga 47
<210> 149
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28722-90 : polymorphicbase C or T
<400> 149
gcatttaaaa gataaaatta tccycttggcactcctcaaa ctgtgct 47
103
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<210> 150
<211> 47
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28730-351 : polymorphicbase A or G
<400> 150
agctgtggag caccaggctg gcartgagctctgccctcag gcacgcc 47
<210> 251
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32306-409 : polymorphicbase G or C
<400> 151
acagatgccc tgttttgttc cttstcttctaaaacatcac aatgatg 47
<210> 152
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27088-246 : polymorphicbase A or G
<400> 152
agtttggttt ccgctcatgc tacrtgttctgtgagatcag tggggag ~ 47
<210> 153
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27090-203 : polymorphicbase A or G
<400> 153
tgttcagaag ttctcagact gggrcttgggttcttgcact tttcatt 47
<210> 154
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27091-220 : polymorphicbase A or G
104
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<400> 154
agaagcattt ttctttgcat aacrcaacaccagtcctctg tgtttag 47
<210> i55
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27093-145 : polymorphicbase C or T
<400> 155
gagtcatctc gaggtaaaca gaaytccaagagtaacgaag gcccaga 47
<210> 156
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27094-406 : polymorphicbase C or T
<400> 156
aagaccctat gcccagttcc gccyggccaccaaggccctt ctgaagg 47
<210> 157
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<22i> allele
<222> 24
<223> 99-27096-410 : polymorphicbase A or G
<400> 157
cccgggaaaa tggttttcat cacrcacaccaactgcattt atttgca 47
<210> 158
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27097-83 .: polymorphic
base C or T
<400> 158
catgacacct gcctgtcatc cccygaaaaaaggtgaacgc cgttcag 47
<210> 159
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
105
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<223> 99-27098-162 : polymorphic base C or T
<400> 159
acaagcactc atccacagga cacygccgatgatgccattt actgagc 47
<210> 160
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27550-48 : polymorphic
base A or G '
<400> 160
atttttcatg cttgatgtga gccrgaagaaaaatgagctt ctctatt 47
<210> 161
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27558-335 . polymorphicbase C or T
<400> 161
aaatctcatg gccgcatatg ttayacaatcatgcccactt atgtagg 47
<210> 162
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27561-106 : polymorphicbase A or G
<400> 162
cccaggtgat gataaaaatg gtcrtcatcgccaggcttgt gtcctgt 47
<210> 163
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27562-366 : polymorphicbase G or T
<400> 163
tgtgggtaga ggccaggaat gctkttaaacatcctacaag gaaggca 47
<210> 164
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
106
CA 02395240 2002-06-20
WO 01/51659 PCT/1801/00116
<221> allele
<222> 24
<223> 16-31-738 : polymorphice C or G
bas
<400> 164
taatagatcc tgtataaaag gggstctggaaattcgtgca tttcccg 47
<210> 165
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27110-301 : polymorphicbase G or C
<400> 165
tggactttgg gagtgaactt tgtsagatgattagatggtg atgtcct 47
<210> 166
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27563-400 : polymorphicbase A or G
<400> 166
tctctctctg ttaaagatca gctrttcccttctgatcttg gaaagag 47
<210> 167
<211> 47
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27573-443 : polymorphicbase G or T
<400> 167
cccgccctgc tctaatcttg cccktccttggctcagctcc agttcca 47
<210> 168
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28732-133 : polymorphicbase A or G
<400> 168
gtgctggaag gtcacgtgcc ttartggtcatgagatcctg gtgcaaa 47
<210> 169
<211> 47
<212> DNA
<213> Homo Sapiens
107
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<220>
<221> allele
<222> 24
<223> 99-28735-56 : polymorphicase C or T
b
<400> 169
tctttacgtg gtgaaagtcc tagycagccatcattcggca caacagt 47
<210> 170
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28736-399 : polymorphicbase C or T
<400> 170
aatgatttgt tggttttttg tgtycattgcttagaagcag tgagtgt 47
<210> 171
<211> 47
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28738-319 : polymorphicbase C or T
<400> 171
ctttggattc tatgcaaaac aggycctcagggttgtaaca atgtggg 47
<210> 172
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28739-364 : polymorphicbase C or T
<400> 172
ttctgcatac tgggatgtga ggaygggtaaactaggaaga aattcct 47
<210> 173
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27875-185 : polymorphicbase C or T
<400> 173
aataccatcc ccactaataa gtaycaagtaccagggctcc ttggaga 47
<210> 174
<211> 47
108
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-27880-176polymorphicbase C or T
:
<400> 174
caagcaagct cctctattca aatagcc 47
taccctcatc
actyacttgg
<210> 175
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28747-371: polymorphicbase C or T
<400> 175
ttctcaatct cccaggacat ccccaga 47
agatagacag
aatyctccct
<210> 176
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28753-353. polymorphicbase C or T
<400> 176
atgcagggca ttctacaggg cttyaccatc tggagaggga gcctggg 47
<210> 177
<211> 47
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28755-206 : polymorphic base A or G
<400> 177
accctatccg ctgcactcag agcrgggacc atccgccaag ggagaca 47
<210> 178
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32333-366 : polymorphic base C or T
<400> 178
cttgaatgct aggaaaggct ataycccaga caactattat cccattt 47
109
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<210> 179
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-38-323 : polymorphice A or C
bas
<400> 179
ttttcgagct gtgggtattt aaamaaatacatagaaatga actgtaa 47
<210> 180
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28484-179 : polymorphicbase A or T
<400> 180
tacatgcttc tctaggtgtg tgawtaactcataatccatc catgact 47
<210> 181
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-30853-364 : polymorphicbase A or G
<400> 181
acaaaacgtt agtacacttt ctcrattgggttagctcaaa atatgtt 47
<210> 182
<211> 4?
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28485-198 : polymorphicbase G or T
<400> 182
aaacatcaaa gttaatttct gttktctatctatcctgccc cttctat 47
<210> 183
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-30858-354 : polymorphicbase C or T
<400> 183
110
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
ccttcagttt ctccagccat cttygctgcc acgcccaagc ccaggcc 47
<210> 184
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32002-313 : polymorphic base
A or G
<400> 184
acaccagcac agggtgggtg agargacatc ctgctgactttataaag 47
<210> 185
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-15-366 : polymorphic base
C or T
<400> 185
catgttatta cagaatttag taayactgtt tttaaaaagtatgatta 47
<210> 186
<211> 47
<212> DNA '
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-20-174 : polymorphic base
A or G
<400> 186
tgagcttgtg tcttcaaact aggratacat caattacttaattattg 47
<210> 187
<211> 47
<212> DNA
_
<213> Homo Sapiens
<220>
<221> allele '
<222> 24
<223> 18-31-I78 : polymorphic base
C or T
<400> 187
cagtcttact ttgcaaattt aagycaaata attaaggatttgttaaa 47
<210> 188
<211> 47
<212> DNA .
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-38-395 : polymorphic base
A or T
111
CA 02395240 2002-06-20
WO 01151659 PCT/IBO1/00116
<400> 188
gatgacttct aaaccatttc acawtgagtctaaattcactgcttaat 47
<210> 189
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-2-192 : polymorphicG or T
base
<400> 189
gatttgcaca gtggcctctt ttaktcatcacttaggttctgttattt 47
<210> 190
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-26921-210 : polymorphicbase A
or G
<400> 190
aataagtgcc aaggagattt ggtrggatccctgcaatgtctgctaca 47
<210> 191
<211> 47
<212> DNA ,
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-215-80 : polymorphic
base C or T
<400> 291
ctcgggaagg tgaccgagaa agayatctgggtacaagaacctgaatc 47
<210> 192
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> I8-132-368 : polymorphic
base C or T
<400> 192
cagaccagac aacctcttgg ggtycttttctgcattgaggtttgatt 47
<210> 193
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
112
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 24
<223> 18-133-293 : polymorphic base
A or C
<400> 193
gcatctggat agccctcttc tgamgtttcc tttcagaaagagagata 47
<210> 194
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-12-191 : polymorphic base
A or C
<400> 194
agacaatgct ttgactatat gccmttggtg gaaaacattctaaagat 47
<210> 195
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-11-137 : polymorphic base
A or G
<400> 195
actggggaga agggaggtcc tgcrgggagg agaaaagggaaagtggg 47
<210> 196
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-93-96 : polymorphic base
G or T
<400> 196
tagtgggttg tggcagaaat tgtktctcta cagaatattatcttaag 47
<210> 197
<2l1> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-115-343 : polymorphic base
A or C
<400> 197
gggagggcct ctctcaggcc tggmagggag caggggtcacaaactgt 47
<210> 198
<211> 47
<212> DNA
<213> Iiomo Sapiens
113
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220> -
c221> allele
<222> 24
c223> 16-42-140 : polymorphic base
A or G
c400> 198
ttgaggagaa ggaggggaag gccrtgctaa acctgctcttctccccg 47
<210> 199
<211> 47
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-251-176 : polymorphic base
C or T
<400> 199
gtagaagtgg aagacagatt tgcytctctc aggcactagggcacttg 47
<210> 200
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-269-44 : polymorphic base
A or G
<400> 200
gcttggcmag atggatggtc aggracttga aaggaacacatttggga 47
<210> 201
<211> 47
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-218-624 : polymorphic base
C or G
<400> 201
caagtgatct ctttaagtca tttstaatgt gaaaactgcgtgattta 47
<210> 202
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 1B-393-330 : polymorphic base
G or C
<400> 202
aagctagtcc ctgtttctca atcstccttc taaagtcactttaacca 47
<210> 203
<211> 47
<212> DNA
114
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-394-402 . polymorphic base
A or C
<400> 203
cttagaagtc cttggtgtcc gagmcttagt atgctgg 47
cccacaatgg
<210> 204
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-217-55 : polymorphic base
A or G
<400> 204
cgtagctgga tttcacctcc aggrcagcca caggcag 47
gctggacaga
<210> 205
<21I> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-284-139 : polymorphic base
C or T
<400> 205
gggtggttcc tgtcagtgtg gagygagacc tcctggt 47
cgggaaagca
<210> 206
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-285-305 : polymorphic base
A or G
<400> 206
tgctgaaagc cagttgcatt tcaratagtg cttcaga 47
tctgtgccac
<210> 207
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-289-239 : polymorphic base
C or T
<400> 207
agcctattac aaagacattt tctyctattg ccattta 47
ctacctctcc
<210> 208
115
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-291-91 : polymorphic base
C or T
<400> 208
atgggggacc tccgcctccc aatygtgctg gctggaactttcctgtg 47
<210> 209
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-186-391 : polymorphic base
G or T
<400> 209
tgggcatgag gtggcaggaa gaakgaaaga gtgaagataatggagtt 47
<210> 210
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-194-130 : polymorphic base
C or T
<400> 210
tcatcagttt taatcagata atgycttact tctgtagatatagtcta 47
<210> 211
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-198-252 : polymorphic base
A or G
<400> 211
atattgttca tatggcagag gggrgaaaag caatgacttaatcaagc 47
<210> 212
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 18-242-300 : polymorphic base
A or G
<400> 212
acattactgt cttctttatg actrtgaaat aataaaataaaattaaa 47
116
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<210> 213
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 8-15-126 : polymorphic base A or G
<400> 213
tggcatctct gagccagctg agtrgccacc tgaactacac ctgtggg 47
<210> 214
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele '
<222> 24
<223> 8-19-372 . polymorphic base A or G
<400> 214
tggaatctgc taattttggc tgcrctttga aggtaggaaa tccaatc 47
<210> 215
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-2409-298 : polymorphic base A or G
<400> 215
aagtagcgca tggggctgca gccrcagatc tcctgggctc tgggtct 47
<210> 216
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-339-54 : polymorphic base G or C
<400> 216
catgatggcg acagaaaaga atastccctt gcctaatttt gatgata 47
<210> 217
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 12-254-180 : polymorphic base A or G
117
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<400> 217
gcatatgaag aggctagcaa aagrtattta acaagcgttc aacattc 47
<210> 218
<211> 47
<212> DNA
<213> Homo Sapiens .
<220>
<221> allele
<222> 24
<223> 10-214-279 : polymorphic base C or T
<400> 218
ctaaggactt ctggtttgct cttyaagaaa gctgtgcccc agaacac 47
<210> 219
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 10-217-91 : polymorphic base C or T
<400> 219
aaaacacatc ataaaattca ttayacaatg tcacttattg ttccatg 47
<210> 220
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28779-168 : polymorphic base C or T
<400> 220
tctggtctgc tctctgcatg aggyacagca gtaaagctct ttgattc 47
<210> 221
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28788-300 : polymorphic base A or G
<400> 221
actgagccaa gcacagagat cacrtccact ttcctcaagg gacttgt 47
<210> 222
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
118
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<223> 99-32052-262 : polymorphic base C or T
<400> 222
cctatttttt ataacgtatt aacyttattattttcttatt attttaa 47
<210> 223
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32121-242 : polymorphicbase A or G
<400> 223
ctgattcaag tgtctatcaa agartggctgcagttgacca tgtattc 47
<210> 224
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32059-169 : polymorphicbase C or T
<400> 224
ttgttttttc tttataatat tacyatctatgaatatattt ctaaaca 47
<210> 225
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32061-304 : polymorphicbase A or G
<400> 225
gaccagctct ttggagggag gccrtaatccctccataacc tgtccta 47
<210> 226
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32065-303 : polymorphicbase G or T
<400> 226
acaattatta accagtacag tctkgttattttaaacatta gcatgag 47
<210> 227
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
119
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<221> allele
<222> 24
<223> 99-32123-118 : polymorphicbase A or G
<400> 227
tagtaagaaa atctatcatt tttrttttaaaaatctttca attttaa 47
<210> 228
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32148-315 : polymorphicbase G or C
<400> 228
gtggttctct ggaaaccgag gctsgttgcaaacccctaaa aagtact 47
<210> 229
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-2-76 : polymorphic A or G
base
<400> 229
ggaggcatgg aggctgtcat cacrggcctggcagatgact tccaggt 47
<210> 230
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-28-93 . polymorphic
base A or C
<400> 230
ttcagccatt gatgaggtcc ttgmtgtttcttacaggagc tggccta 47
<210> 231
<211> 39
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 20
<223> 16-3-199 : polymorphice C or T
bas
<400> 231
ctggctgttc cctgctgtgy actgcccaaggctagacat 39
<210> 232
<211> 47
<212> DNA
<213> Homo Sapiens
120
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<220>
<221> allele
<222> 24
<223> 16-50-197 : polymorphice C or
bas T
<400> 232
ggtgtgtagt.gtctgcaggg aagycctgcatgtggggagggggctgt 47
<210> 233
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-1-59 : polymorphic C or T
base
<400> 233
ccgcaactca gatatttttt tccytgggggctggatttggagtattg 47
<210> 234
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-2-187 : polymorphic
base A or G
<400> 234
ttctgcataa ccaaggtgag tagrggctgggctctgggtcacctggg 47
<210> 235
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28761-311 : polymorphicbase A
or G
<400> 235
tgaaatgctt taagagaatt tgtrtgctaaatttagaagttttgatt 47
<210> 236
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28771-86 : polymorphicbase C
or T
<400> 236
caggaaagat agagataatc atayagtacccagaaaatgactgcttc 47
<210> 237
<211> 47
121
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-28791-291 : polymorphicbase A or G
<400> 237
aaatgtcatc aactcccaca tgtragaaacaccatgattt gtactgt 47
<210> 238
<211> 47
<212 > DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32077-66 : polymorphic
base A or G
<400> 238
tttgtagggg gaaaacaatt tgcrtttgggaaataatcca acaagca . 47
<210> 239
<211> 46
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32078-466 : polymorphicbase C or T
<400> 239
tgatgcttgg agcaagcagg ccayctctgtctgagagagg atacag 46
<210> 240
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32376-426 : polymorphicbase A or G
<400> 240
tttattggtt cactcacatc tggrtgttagagccaaattc caaagac 47
<210> 241
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 99-32361-419 : polymorphicbase G or T
<400> 241
ctcttttata aacttccata aaakctggtgagtctcttaa gaactgg 47
122
CA 02395240 2002-06-20
WO 01/51659 PCTIIBO1/00116
<210> 242
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-21-228 : polymorphic base
A or G
<400> 242
agtgctgtca gaatcaccta ttcraaaggc gaatccgatcatgtggt 47
<210> 243
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-22-156 : polymorphic base
C or T
<400> 243
tgtgaagaaa agagccttgg gttygactag ggaacctggggccactc 47
<210> 244
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-23-404 : polymorphic base
A or G
<400> 244
tctggtatct gctgtgcgtt tgtrtatatc taagatgaccaggcagc 47
<210> 245
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-24-175 : polymorphic base
A or C
<400> 245
tgggcaggtt ctggggtagg acgmgcagag cagctgcggggactggt 47
<210> 246
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-25-286 : polymorphic base
C or T
<400> 246
123
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
actctccccg acccgtccca ccayggtctc cacagcactc cygacag 47
<210> 247
<211> 47
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-25-279 : polymorphic base
C or G
<400> 247
ccagctgact ctccccgacc cgtsccacca yggtctccacagcactc 47
<210> 248
<2I1> 47
<212 > DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-23-393 . polymorphic base
G or T
<400> 248
gtttttaata ctctggtatc tgckgtgcgt ttgtgtatatctaagat 47
<210> 249
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> I6-106-364 : polymorphic base
C or T
<400> 249 '
gttgcttccc ctgcccccgg aatycacagt gctctgcttctctgtgt 47
<210> 250
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-16-285 : polymorphic base
C or T
<400> 250
agcatcatct gcggcatcac gtcygtggcc ttctccctcagtggccg 47
<210> 251
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-17-121 : polymorphic base
C or T
124
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
<400> 251
ccctgtgact atggctctgg cacyactagg gtcctggccctcttctt 47
<210> 252
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele -
<222> 24
<223> 16-84-185 : polymorphic base C
or T
<400> 252
aactagcgtt ttcttttctt ttcytttctt ttcttttcttttctttt 47
<210> 253
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-87-74 : polymorphic base A or
G
<400> 253
cacatccacc ctgggctgca ggcrtgctcg gcaggctccccacagat 47
<210> 254
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-91-333 : polymorphic base A
or G
<400> 254
gctgaacttg tctgccagtg ggargggggc tcttggagttagctgtc 47
<210> 255
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 24
<223> 16-128-142 : polymorphic base C
or G
<400> 255
aagtccctgc agaagcagag gcgsatgctg gagcgcctgg tcagcag 47
<210> 256
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
125
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 24
<223> 16-133-205 : polymorphic base
A or G
c400> 256
tgctttttca gtctcttagc tccrtggagt ttgctgt 47
atgttcagtg
c210> 257
<211> 47
<212> DNA
<213> Homo Sapiens
<220>
c221> allele '
c222> 24
c223> 16-135-181 : polymorphic base
A or T
c400> 257
ctgcatttga ttctgggcac tgawagcagt agacact 47
acttggctgc
c210> 258
c211> 47
<212> DNA
c213> Homo Sapiens
c220>
<221> allele
<222> 24
c223> 16-145-405 : polymorphic base
C or T
<400> 258
tggtgggttc ctcctctcgc tggytcagga agacctt 47
gtgaagctgc
c210> 259
c211> 47
<212> DNA
c213> Homo Sapiens
<220>
<221> allele
<222> 24
c223> 16-177-320 : polymorphic base
A or G
<400> 259
accatgcatt ttctcatcct agcrgctgtt cacgtcc 47
gcaaaataga
c210> 260
<211> 47
c212> DNA
<213> Homo Sapiens
c220>
<221> allele
<222> 24
c223> 16-4-354 . polymorphic base
C or T
c400> 260
ctggatgtgg agcaggccga ggtyaacttc acctgga 47
ggctggaacc
c210> 261
c211> 502
c212> DNA
<213> Homo Sapiens
126
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> allele
<222> 362
<223> 18-473-362 : polymorphic base C or T
<220>
<221> misc_binding
<222> 343. 361
<223> 18-473-362.mis1
<220>
<221> mist binding
<222> 363..382
<223> 18-473-362.mis2, potential complement
<220>
<221> primer bind
<222> 1..21
<223> upstream amplification primer
<220>
<221> primer bind
<222> 482..502
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 350. 374
<223> 18-473-362 potential probe
<400> 261
ggcattttag caagagatga ctaatcagag aggagttact agtggagaaa agtaatttga 60
gatgtatttt tgaagtagga atcatagtag accacaaaga gatcctttat ttctttaaag 120
ctatcattta ttgttagtac tgtaacaact tcacttatgt gatcctattg aatgctcaga 180
acaactgaac agctagctcc atttaacaga taagaaaatg catgttcaat accaagattc 240
aaacccaggc ctagccagct ccagaaacct gagcttttaa catttacgct ttcctacaaa 300
acagggtgac ttaacaaagt atctgtttct aaagacagtt cttagggcta agaaatcaga 360
aygtgccttt agaaataata agtattccta gttgtgtgtt aaaggtagga agctgaaacc 420
aacagacttt cctgtcccta agctaaacaa tactgaacca gtcaaaataa cttggctact 480
tgtcccagga aatacttgct cc 502
<210> 262
<211> 457
< 212 > DPTA
<213> Homo Sapiens
<220>
<221> allele
<222> 88
<223> 99-12361-88 : polymorphic base C or T
<220>
<221> misc_binding
<222> 68..87
<223> 99-12361-88.misl, potential
<220>
<221> misc_binding
<222> 89..107
<223> 99-12361-88.mis2, complement
<220>
<221> primer bind
127
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 1..21
<223> upstream amplification primer
<220>
<221> primer bind
<222> 438..457
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 76..100
<223> 99-12361-88 potential probe
<400> 262
caaggaacac aagagtttga ggscacttct ttagcctttg aactggttat tcatcctcat 60
tcttacctgg cattatttgg aatgcttyat ttcctctgta cctggccttc actcttggga 120
agtctagctt gtttgtgcag tttcctactg tttaaacaag agattgttta aactctagcc 180
actgatttcc acagctgttg ccagtgtttt tctttctcac tgaagccaaa catggagtgg 240
ctggagtctg gaaacatgcc ttgagaaatc aaagttccca tctgacattg cagcctactt 300
cctagagcta gtgtcactga ggaaggggtc atttactcat tctaatgtca ggattcccac 360
accaataacc acatcatttc tcaacaaata catcccttcc cctactccac ctcgggcaat 420
aactgtgggt ccggaggcta cagggctttg ggtgtgt 457
<210> 263
<211> 502
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 335
<223> 99-12368-335 : polymorphic base A or C
<220>
<221> mist binding
<222> 316..334
<223> 99-12368-335.mis1
<220>
<221> mist binding
<222> 336..355
<223> 99-12368-335.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
<222> 482..502
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 323.-.347
<223> 99-12368-335 potential probe
<400> 263
gaacagaagg tattgaacag aaacaaagta ttttcaaaot ggtagaaaaa ggattagaaa 60
tcttggtctg tcaatttcct catatccttg gccacacata atgaccccaa gagcacttgt 120
tggcaatggg agggaagaag gagatcacat cagtcataag gccaccattg ccctgactcc 180
tggcatctgt cctgcttctt actttttatg agcagagtga ggtcaacagg caccatggaa 240
128
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01100116
agagcactgc gttgaagtta cacattccgggacttcgcttgcttgctagc atcagtctgt300
agctgtaaag tggtgacagt aatacctaccactamggtgttgtgagaatt aaatgaggca360
ggatcttgga cttagaaagc tgcccagatatggtggctactgttgataag cattctggtt420
atactcatcg gattccctcc tcccacctcttccctggattgggtcattcc ctccaatgca480
gcccttctct ttcctcatgt at 502
<210> 264
<211> 461
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 67
<223> 99-12370-67 : polymorphicbase A
or G
<220>
<221> misc_binding ,
<222> 48..66
<223> 99-12370-67.mis1
<220>
<221> misc_binding
<222> 68..87
<223> 99-12370-67.mis2, potential complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<222> primer bind
<222> 441..461
<223> downstream amplification primer, complement
<220> -
<221> misc binding
<222> 55..79
<223> 99-12370-67 potential probe
<400> 264
attacgcaag cactacgcca attaatccaa gacctgtgcc aaatttaaaa ggaaaagcag 60
agttcartgc aaattctaga aatagttgtc aaaatcccca tttcttatgt cctagataat 120
acttgtatat ttctggatgt ccatagaaaa ataaggatgt cattacatag aacaatagct 180
gtcagcatac agaacaatag cagaacagtg gggaggattt cagatgtgaa cagtgcttgt 240
gagaatgaag caagctacag tgtcctccaa ggggacttcg tgagctcaac ttgacattta 300
gtctcacatg actgccttag gctccttggc accagtcaac acagaaggac attggatgtg 360
tttatccaac acttctgtct tgccaacaga gcagcatcag cagacagtcc tcttcagggg 420
aagagtcctc actgtataca gttgagatgt gaggaaatga c 461
<210> 265
<211> 449
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 314
<223> 99-32148-315 : polymorphic base G or C
<220>
<221> misc bindiag
129
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 295..313
<223> 99-32148-315.mis1
<220>
<221> misc binding
<222> 315..333
<223> 99-32148-315.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 428..448
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 302..326
<223> 99-32148-315 potential probe
<400> 265
tgagtgcatt tgatgtgggs cagcaaagct tcattcaggt ggaaacagat taagaagacc 60
aaagagtggt gaaatggcta agtaggaatg aaaaaacagc cagctacccg yggccagtgc 120
cttattctaa aagaggacag ctagcttgcc caaggactct tgcagaagga aacctgggag 180
agtttccttc tcctcttgca gaagtaaact cttcaggttg aagagtcagg aaggagctcc 240
agggatgagt gaagtcaact gaagttgcct cttttataaa cagctctgca gtggttctct 300
ggaaaccgag gctsgttgca aacccctaaa aagtactgct ctgcaaggct tgtaactgcc 360
atacttgtgt ggtcctgctc catctccatg tgtggcagtg ccagctgcaa ccagcctcac 420
acagggtccg agagtctcag aactgcaag 449
<210> 266
<211> 426
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 322
<223> 19-46-322 : polymorphic base C or T
<220>
<221> misc_binding
<222> 302. 321
<223> 19-46-322.misl, potential
<220>
<221> misc_binding
<222> 323. 341
<223> 19-46-322.mis2, complement
<220>
<221> primer bind
<222> 1..19 - '
<223> upstream amplification primer
<220>
<221> primer bind
<222> 409..426
<223> downstream amplification primer, complement
130
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> misc
binding
_
<222> 310. 334
<223> 19-46-322
potential probe
<400> 266
gatgagtgac tcaatggaccagctccacaaacaaagctgg aggtgtcttg tacagacccc60
aaatgctatc catgtggggctgcaggatcaaatagcaggt ggccctcatc tgggggtgca120
gccaggctgc cagaagggtgtccctgggccaagctgaggc ctcctcccct tctcttcctt180
tcagagactg gcctatggcatcacgccagagaacgagcac cacctggtgg ctcagaggga240
catcagacag ttccaggtgggtgaagcctagacccctggg gtggagatta caagggcggg300
ccctggctgt tccctgctgtgyactgcccaaggctagaca tcacatccag aaaacccaga360
aacccagtgt gagctgccttttccccttggaaacatcggg atgggggaca gggagcctca420
ccttga 426
<210> 267
<211> 422
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 315
<223> 19-47-315
: polymorphic
base C or T
<220>
<221> misc
binding
_
<222> 296. 314
<223> 19-47-315.mis1
<220>
<221> misc
binding
_
<222> 316. 334
<223> 19-47-315.mis2,complement
<220>
<221> primer bind
<222> 1..19
<223> upstream
amplification
primer
<220>
<221> primer bind
<222> 403..422
<223> downstream
amplification
primer, complement
<220>
<221> mist binding
<222> 303..327
<223> 19-47-315
potential probe
<220>
<221> misc feature .
~
<222> 103
<223> n=a, g, c
or t
<400> 267
tcctcgctgt ctttctctgcagttgcaacactggctggccatctgagcct gcctggagga60
gaaggaggaa cccccatgccaatgtccaggtcacaggcatycnctgcgct cccacctcgg120
acaccatctt gggattcctcccctggaagttgtcctttctgatcctctct tcttttccca180
tttacaaatg atttcgtgactgtagtttttgttcaccttctgtgcatctg gcctgggggc240
tgttagctca gaggagaggagcaaacaggaaaatgacttctgttctgtcc ccgctgtttt300
gggggaagtc tctcycactttgggatcctgctgaagctaggttcatgagg tcggaaatcc360
ccaccacatt tgcctagactttgggcacaggagttcttagtecaccaaat cagagagagg420
131
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
at 422
<210> 268
<211> 419
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 346
<223> 19-51-347 : polymorphic base A or G
<220>
<221> misc_binding
<222> 327. 345
<223> 19-51-347.mis1
<220>
<221> misc_binding
<222> 347. 366
<223> 19-51-347.mis2, potential complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 401..419
<223> downstream amplification primer, complement
<220>
<221> miac_binding
<222> 334. 358
<223> 19-51-347 potential probe
<400> 268
atcaggtcaa gcccatgtgg tgcatggcag tggctagggt ccctgagtta ggggagagtg 60
gccaggtcct gtctccatca gcatgcattt gcagggactg gtctgtggtc acggcctctg 120
tcgtcctccc tgacgacatt taccctggtc ccctcccctc tcctctgggc aggcgtggtg 180
tcctgcacct tcacgagagc agcgggattc atgacatcgg cctgccccag tggcagctct 240
tgctctgtct gatggtcgtc gtcatcgtct tgtattttag cctctggaaa ggggtgaaga 300
catcaggaaa ggtaatatct ctgtgtttct ctttcactta cttggrtgat caaccttggg 360
gggtgtgatt atttctagca ataattatgt agctggtgga caaaaaagat ggagctgga 419
<210> 269
<211> 499
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 263
<223> 99-32052-262 : polymorphic base C or T
<220>
<221> misc_binding
<222> 244. 262
<223> 99-32052-262.mis1
<220>
<221> misc binding
132
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 264..282
<223> 99-32052-262.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 478..498
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 251. 275
<223> 99-32052-262 potential probe
<400> 269
cagagtgaca aataagtgct atggcttgat agaagtgaag ctcttcacat atattcaaaa 60
tacatatcac aaactttggt aaataggata gtaatctgaa gaacttttgc cctttttacc 120
ccatttactg taactcttgt ttctaggtaa tcgttctctc tcaacaaact tctcaagcgt 180
ctgtgtaaca agccacatgt tctaacaaat tgtctccatc gcacttcaac agccaggtcc 240
ctatttttta taacgtatta acyttattat tttcttatta ttttaaaaga atctatgcac 300
attagcaaaa tttaaaagat agagaaaaat ataaacagaa aaaattatgt ttacttctac 360
caccctaaat caactattat caattttata catattttac tccatctttt ttcaaagttt 420
cttacatttt ccaatgtcat taaaattctc tgtgaatgta aattttaaaa actgtaccta 480
ctgttttttg gaatctgta 499
<210> 270
<211> 3001
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 1501
<223> 10-213-292 : polymorphic base G or C
<220>
<221> misc_binding
<222> 1482 .1500
<223> 10-213-292.mis1
<220>
<221> misc_binding
<222> 1502..1521
<223> 10-213-292.mis2, potential complement
<220>
<221> primer bind .
<222> 1211..1229
<223> upstream amplification primer
<220>
<221> primer bind
<222> 1588..1606
<223> downstream amplification primer, complement
<220>
<221> misc bindiag
<222> 1489..1513
<223> 10-213-292 potential probe
133
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<400> 270
gcagaagtataagatctttgtaaaacagtcctctccctggttcatctgctttctgttacc 60
acaataatgctaagtaaaaaaacatccaaaaacctccctggcatttaacaatatgcatat 120
tgctcacacgtcttgatagtgagctctgctgatattggcaggacttgctctggtctggct 180
gtgatctgatggagcctggccctgggtgcgctgtgcaggttgactcagctctgccccaca 240
tgtgtctcatgtttcagtcaggtaaccactggtgaagaagcaagctaggaaccagggtat 300
ctgacttctgagctaaactcttaaactctataatattgcctttcaaatataacactaagt 360
actaggtgcctatcaaccacactgttttcagacctctgccaaaacttggattctttgtgc 420
tatgaagagacatggcttttgggctggtctttgtgtggcagtgaggtgagcacaaaggga 480
tgttcttcagagattacagtccagccctgaagcaacaactaggagactgtttcagcaagt 540
gaggacagggctgtgtggggttctatccttttcataactttgcctggcactgaaatcaca 600
tgctctgataacatccaccagaactttcttttgtcatatttgggatagaaagggactagt 660
ttttcctcaaattattgatagagattttatataatatagtgtttctctccacattttatg 720
tatataacaaaagccctgcttttgtgtatatatgcatatatatatatatacacacacaca 780
cacacacatatatataatacaaatcctgctttgtaactgtttttgtttgtatatataaca 840
aaaagagttatgaaccagaagtttggccaataatccttgtcgcacagagaatttgctttt 900
tctatctgttttcactttcttggttacagacgtgtaacctcttttttgaatggtgacaat 960
cactttgtcatattttatttgatgctagtggtcatagcctattagtcatgtttgcttcca 1020
tgagaaagaaaaaccactacatggttatgctaaggatttcagtcattggggttagagcet 1080
tcccgaatgtctcctgctttcataactcctccacacatcttagtgggccattgagcacat 1140
caaagggcatgacagttattaaaatactttatgaatgctacaatcctttgccagtatgag 1200
ttgttctctggaacttctaacagttcaacagtactacatggactgagttaaaagttaatt 1260
caaaaatctcaatttatccaaatctgtttctttcttttcaggcaccacccacctatgata 1320
ctgtgctacagttggagtatcttgacatggtggtgaatgaaacactcagattattcccag 1380
ttgctatgagacttgagagggtctgcaaaaaagatgttgaaatcaatgggatgtttattc 1440
ccaaaggggtggtggtgatgattccaagctatgttcttcatcatgacccaaagtactgga 1500
sagagcctgagaagttcctccctgaaaggtaggaggcccctgggaagggagccctccctg 1560
aaccagcctggttcaagcatattctgcctctctacaggacagtctgggcttgtacaatca 1620
tttgcttgtctttttatgtttaaaaggttttttcaaatcatgaaattgatcattgtcaca 1680
ctttacaaaccacagactagataaaagaaaactatagccagtcacagtcccagcaactta 1740
agatgaaggtcctcaattatgtccttatgggtcataagtgtccaaaatgtaaggactctt 1800
ttaaaaacacatgatcacaatgctattattatgtcccacaaatgaatattttttcctgaa 1860
tataatcaaatcttcaggaatcaaatttgaataaaaaacatgcgtctaatcttcaaagaa 1920
tttataggttagtgcaacagatagacaaagaaagcagtgatgacactgctttccatcaat 1980
acagtagcatcatatgcctgtgtaaattatctgacttaaactattctatggaggtgtggg 2040
ggagaaagaaggagagatggagattagaagaaggaggagaaggaggagagaaggaggggt 2100
aagacaaggtagggaggagaaggaggagaattagaaaaacaagagacgagaggagaagga 2160
aagtgcaaaataacaattttgaagtagtgcaagacaatttcttctccttcctcatgacca 2220
acataagggtgacttgaggcaggaatctacttttctgtcagtcattctcatcacttatgt 2280
gccttttgtagtgtgaacacatcaccatcctgactataatttgagtgtttagaaataaat 2340
atactttgcaacagtatttatctcctctcaacaagactgaaagctcctataatgtaagga 2400
gagtagaaaggatctgtaccttacaattctcatagcaaaatatgcatagcaggatttcag 2460
tgactagcccacaaaagtatcctgtgtactgctagtagaggggtgggccctaagtaagaa 2520
accctaacatgtaactcttagaggtattatgtctttaacttttaaaatatctaccaatat 2580
ggaaccaggttcagtaaaaagaacaaggacaacatagatccttacatatacacacccttt 2640
ggaagtggacccagaaactgcattggcatgaggtttgctctcgtgaacatgaaacttgct 2700
ctagtcagagtccttcagaacttctccttcaaaccttgtaaagaaacacaggtcagtcaa 2760
ttttctgcattaataatgttttattaacaattattttaactgaatggtctatatatttaa 2820
aaaagaatacactcacttaatcttttaataatttgttctatgggccaaggaatctatttg 2880
gacccatctatgatctttaagggtgcttcagttctggagttcaaaagctgtagcattaaa 2940
aacatcatgcaatgtcaatgtagactagcatgacatgattatctacagtctccttgaact 3000
t 3001
<210> 271
<211> 465
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 135
<223> 18-419-135 : polymorphic base C or T
134
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> misc binding
<222> 115..134
<223> 18-419-135.misl, potential
<220>
<221> misc binding
<222> 136..154
<223> 18-419-135.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 448..465
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 123. 147
<223> 18-419-135 potential probe
<400> 271
ttccaaccct gttaagactc ttctacagtt gctttttgtg tagctgacca acataacaat 60
catgttcttt attctacatt ccttgataca tttcaaccct tccatactga tcacttccct 120
tctgttgggg caaaytcagt tttttttgtg aaaatgtttt ctattttacc cttgttcttg 180
aaagggtggc ccaatctcag taagataact tactgaccta ttctaaggct gggcccaaca 240
gagcctcact ccccaccctt gtagggaccc tggatctggg tagaacattt atgcggtagg 300
ggaacagtcc ttcttaaaca ggcgcttgga agccctttgc agatgccggt gagaatcggc 360
ggtctgggaa agagtacaca tcttgcagag aagctgaaga gggaagccct tttcctgttt 420
tttcactttc aagaacatga gccacctggc tgctttcttt tgtag 465
<210> 272
<211> 527
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 419
<223> 18-424-419 : polymorphic base G or C
<220>
<221> misc binding
<222> 400.-.418
<223> 18-424-419.mis1
<220>
<221> misc_binding
<222> 420. 439
<223> 18-424-419.mis2, potential complement
<220>
<221> primer bind
<222> 1..20
<223> upstream amplification primer
<220>
<221> primer bind
135
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<222> 507..527
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 407..431
<223> 18-424-419 potential probe
<220>
<221> misc feature
<222> 47B
<223> n=a, g, c or t
<400> 272
cgctttaatt tttagggttc caaaccaaaa gtggcaatca ccatggcata tgtgtacctg . 60
tgagcatgta gattcatgtg tgctgggggc attttatagc cagttctttc tcagagtccc 120
tttttctttt agccaatgga ttctggctag gaaaaacatt aaccgcacct tagtagacta 180
gttagaagac tgagaagaac caggtaggga agccagagaa gtgacattca gagatatttg 240
gaaacaaact tgagcataca ttttacccaa caggaattag ccaggcattt tatttttaaa 300
aaaagaaaga aaaagaaatt ttagcaactc tttgttgttg cccctctctg tgtttagaat 360
cgtgattttc cagctatgtt cctcacagcc gtaggatttc caagggtaaa aggtagagsa 420
gggggtgtgg aggtttggat atgagcatat gggacttcca tagctcctat ttgaaaanwt 480
gctgttttag aagagcctgt taagctgagt tttgaacttg acagcat 527
<210> 273
<211> 451
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 290
<223> 18-429-289 : polymorphic base A or C
<220>
<221> misc_binding
<222> 271. 289
<223> 18-429-289.mis1
<220>
<221> misc_binding
<222> 291. 309
<223> 18-429-289.mis2, complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 434..451
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 278..302
<223> 18-429-289 potential probe
<220>
<221> misc_feature
<222> 110
<223> n=a, g, c or t
136
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<400> 273
gtccagcttc tttagttccatgctgccagacagaccgtcagagcagaaca gataccttca60
ttttgtcata acttttttaaaaatggcaaaaaataatagccacatacagn tttgttagtg120
aggtgaaatt cctcatagaacaaagacaacaaagaatataaaatgtttct aatatgttaa180
aatatatttt atattctttgtattctttagtctgaaaggcttaaatctta catttctggt240
gggatttcag aaaaaaaagttttcttaggtaaagcgtcttttttcccttm aactagccca300
tttgaaactc ttctgtttctgaatgaatttcacctaacctgtctacagct atattcacag360
acactgtttt tccctttacagactgaccctaccctttctgttacaaaata cagaaacgtt420
gccagtgttt tttggttggttggttggtttg 451
<210> 274
<211> 487
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 256
<223> 18-246-256
: polymorphic base
C or T
<220>
<221> misc binding
<222> 237..255
<223> 18-246-256.mis1
<220>
<221> misc_binding
<222> 257. 276
<223> 18-246-256.mis2, potential complement
<220>
<221> primer bind
<222> 1..17
<223> upstream amplification primer
<220>
<221> primer bind
<222> 466..486
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 244. 268
<223> 19-246-256 potential probe
<400> 274
tcataggaag acgagagcaa atatttaatg tgttttgcct tcagttacat aggaaaaatg 60
tctaagaagg tgacattggg acttgtgttt aatgaaacag agaactgtgg gcagcgtcag 120
tgttgggttt ttaggagcgt agggagcaca cagctttgac tctttgtccc attacttgct 180
tctgtgtgaa gccactgagg ccccagggtt cgggttttcc tgccacgcac tctggggtgg 240
cagtgaccgt tccaayatgg atgagtgaga agcaggttct tatgaggttt gtgcaaattg 300
agcaagccac ttggggcatg ggtttttcct cttttctttc tttctttctt tttcccacta 360
aagaacagat tgaaagtgct tcacaattaa tcaaaagtcc cctcaacact ctggtgatcc 420
atctaagacc tctcagagat ataaccacca gcacagatat tcaaacccat ttttttcaat 480
ctccttg 487
<210> 275
<211> 453
<212> DNA
<213> Homo Sapiens
<220>
137
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<221> allele
<222> 68
<223> 18-355-67 : polymorphic base C or T
<220>
<221> mist binding
<222> 4s..s7
<223> 18-355-67.misl, potential
<220>
<221> misc_binding
<222> 69..87
<223> 18-355-67.mis2, complement
<220>
<221> primer bind
<222> 1..19
<223> upstream amplification primer
<220>
<221> primer bind
<222> 436..453
<223> downstream amplification primer, complement
<220>
<221> mist binding
<222> 56..80
<223> 18-355-67 potential probe
<220>
<221> misc_feature
<222> 32,51
<223> n=a, g, c or t
<400> 275
tgccctgttt ctggttctgg tgctgggagg tnaggagtgg agaagactag ntcccctaga 60
gctgaggyct gtcttgaagg actcactggg gccctcatcc tcagggggct gattggcagc 120
cacccctcag tgtggtggac atggagaaag gaaaggctgg ggaaggtaag gatgctagag 180
gcccgagtct cctt'tggagg ccccaaagga ggaatgtcag ggagcttact ttctttgttg 240
cctcagctcc acacccctac caagttggca aatccactta ctcagggaca ctaacaccag 300
taagccaacc ctgatgatgt tctatgttgt acctctggac ctctaagcca ggccactgtg 360
gggagaccaa ggtcctaccc cagatcctgt cccctgggtg cttatgtgac ttaaggtaga 420
cataaggtag tgtgccagtt tagtgcatgt acg 453
<210> 276
<211> 471
<212> DNA
c213> Homo Sapiens
c220>
<221> allele
<222> 266
<223> 18-353-267 : polymorphic base C or T
<220>
<221> mist binding
<222> 246..265
<223> 18-353-267.misl, potential
<220>
<221> mist binding
<222> 267..285
<223> 18-353-267.mis2, complement
138
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification
primer
<220>
<221> primer bind
-
<222> 452..4
71
<223> downstream amplification
primer, complement
<220>
<221> misc
binding
_
<222> 254. 278
<223> 18-353-267 potential
probe
<400> 276
agttgcctac gtggctgggg aagcggggcgccggttgtactcacctcagc tcagggtcct60
agagacctgc gggttttgct ggtcgctgaggtctcccccacttccccacc tcacttaagc120
catcacttcc acctggtctc ccaaattgaggtcctgaagtcctgagaccc atgtcccacc180
caactccgac gtctttagat cccctttccctcggtgccagccttctgaga gtcccaacgt240
tctggcctct aggggatctg cagttygggcggtgggcggttctgattggc cagtcttcca300
tgaggctctg gggcacccag agtgtgtgtctggggtagggtggggaggct ggccaggggg360
cagaggtctg ccccccgtcc cagggctctgatgccctcctcccttcgcct cctcagttga420
agaagctgga tctggcagct gcggcassacacaccttctttgtagcaaac c . 471
<210> 277
<211> 468
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 306
<223> 18-338-305 : polymorphic
base A or G
<220>
<221> misc binding
<222> 287..305
<223> 18-338-305.mis1
<220>
<221> misc_binding
<222> 307. 326
<223> 18-338-305.mis2, potential complement
<220>
<221> primer bind
<222> 1..18
<223> upstream amplification primer
<220>
<221> primer bind
<222> 450..468
<223> downstream amplification primer, complement
<220>
<221> misc binding
<222> 294..318
<223> 18-338-305 potential probe
<220>
<221> misc feature
139
CA 02395240 2002-06-20
VSO 01151659 PCT/IBO1/00116
<222>
84
<223> g, c or
n=a, t
<400>
277
ttgtaggtccccaagatggtgggggtgcagggacagagagcttgctgttc tgctcctgat60
gtcacacaggggcttcctgbgcgncctggcatcaagatggccttccacaa gtcaagtggc120
cacatcctcaaggagctggctcagccactcacagctcctcccgaacccga ggtgcccttc180
cagtcttgtcttggaccctctggtgcctgcggctagggggctctggggaa gggtctttgc240
tgggcatttcttcctcttcctcttcctcctcctcctgtgactcctgcagc agttctttgg300
cttctrtccactcctggggttggggaggagagtgtggcccattccctgca cccaccttcc360
ctgggtcagctcagcccctgaccctcaccgactgtgagccttctcggggg ctccttgccc420
acccttcacgcaccaggagaaccacatcccttcctaacccgctcctta 468
<210>
278
<211>
3001
<212>
DNA
<213> Sapiens
Homo
<220>
<221> le
alle
<222>
1501
<223> 43-346
24-2 : polymorphic
base
C or
T
<220>
<221> binding
misc
<222> _
1482 .1500
<223> 43-346.mis1
24-2
<220>
<221> misc binding
<222> 1502~..1521
<223> 24-243-346.mis2, potential complement
<220>
<221> primer bind
<222> 1156..1173
<223> upstream amplification primer
<220>
<221> primer bind
<222> 1652..1672
<223> downstream amplification primer, complement
<220>
<221> misc_binding
<222> 1489..1513
<223> 24-243-346 potential probe
<220>
<221> misc_feature
<222> 1556,2069,2084
<223> n=a, g, c or t
<400> 278
agaatctctc tctctttttt attattattt tttgagacag agtttcactc tcatcgccca 60
ggctggaatg caatgacaaa atctcggctc gccacaacct ctgcctctcg ggttcaagcg 120
attcttctgc ctcagcctcc tgagtagctg ggaatacagg cggccgccac catgcccagc 180
taagtttttt tgtattttta gtagagacag ggtttcacca tgttggccag gctggtctcg 240
aacccctgac ctcaggtgat ctgctgcctc agcctcccaa agtgctggga ttacaggtct 300
gagccactgc gcccagccca gaatctcttt gagatggaca cacaccctct tcattattcc 360
agcttccata tggcagtggt gggctcgtcc tgcagaccag ttagctcagt ccatgaagta 420
ggagccttcg tgggctcaaa ggcaaatccc agcatgctca ctgctcagtg ccagaaagat 480
cacccccaga agccggctgc atcagtgtgg accaccaaga accatcaaac acacgtgttt 540
140
CA 02395240 2002-06-20
WO 01/51659 PCT/IB01/00116
tctgtgtgctcgacctcCgttccttgctttttctgatgactgcaccttgatgtccctttt600
ggggaaccccgccactctcagtcctcatggtctgggtggcactgccccctcccctgcgct660
gcacagaaggcccgcacccccacctggccaatcagagttgccaggtcatctccctgacta720
cagcacctggttcagggatggacacagcccagcggagtttgtgctagaactgctgggaaa780
tgggctttcaccttctgctcatcttggcacgtggatgccagcttgaactgtggaaggtca840
ccctgtgggcagagcccctgagacacaggcagcacaggaaagcagagtggaatgggggcg900
ggggagtacttcctgatgacatcatctgagcccctggatccagccgtgcctgaagcaaac960
tactctaggctctacagatctatggactcatcaatcccttgcccctctacttttttggct1020
tgtgtcaatttatattgagattttgtcacttacaactaaaagggtcctgaatctaactca1080
ttctttgaaagtctgcctatcaatcacaaaatagcagtgtgatcagagctggataccatg1140
ggcaggtctccttccctctgtgaggttctatggagaacaccctacatctttttaattatt1200
tgtcatgcacgggccctatggatttgagagattcatggatgccacgtggaatcagtcaat1260
gaccctcactttctcaggcactacctagggcatcctccaggatgcgccccttcccggcac1320
agcccactgccatatcttgctggaacctgggtcatcgtccatcgtctatcacaggctccg1380
ccagccttcgtggatgccatctatgtccgtgggtctcacccgtctcgccaccagcttcca1440
ctacgacgctggacagtacacagggagcagacggggattccaggaggaagccactgcaaa1500
yagggcctgcagctgccctctctccttctgaaatcctagcatagtccaggacacangcac1560
ctccctggctgagcagctgaactgccaagctcaactccctgattgagcagatattctgca1620
gaaatagaaaaggatggagggaaggcttcttcccacacaatgaacatcaaacccacccaa1680
ggggcagtggctggggcctcccttcccaaacagctggctcaaaacatgcacaaaattttc1740
ccaaagtgggctgggagcagggcagctggcttccactttcatattactgatgcatccaga1800
catacttccatagtgtttaaaaatttttggatgtatgtcaaatgctcttaagagtgcgat1860
cttaggcatgtggtaaataaatatgatgtaatcctcccgtctccaagggtgctgctgccc1920
tctccctccctccctcactggtcctgggcaagcccttgacctccacgatctctctgcgcc1980
tctcgtgacgcccacaacaaggggctgtgccaaagggaaaggtagaaagaaaagaggatg2040
tgctgtgtgctgtcatcatccctgtgccnagagacagggcacangggtggtggccttgca2100
ccaccggcgcatcccccacatggggaagctggggtcaccctgcaccacaggcatcccatc2160
agcctctgtgacactgacaatgattctcgtgaatggacaggctgaatggtcctcagccct2220
ctctttctatgctggctgaactctgaggcgggaacaggacagacagtggctggaggccct2280
ggcagggagggcacccttctaacaggccctgcgtagccgagggcaccaaactgacaggca2340
ggacccctgagctcaccacggcctgccctgggccaggcaagaacgagcacgtccacccat2400
gagagttggggctgtgtaggtgactgtagacatcacccacagtgggagggttcctggagg2460
tgacgtccgaggcttggagcgcaaagtaggacaggcacactgccaagttcccagaagact2520
gagtgccaccagatcctgtggccagtcctcagtgtggtgtggggggctcagcaggagcac2580
atcagcaatcagatgggccaggtcaggataaagaacaggcgtgacagctgcttcctaaat2640
aatcaacggtgggtgccctgagtagcacctcctgctgtgcctgtccccagggcagcaggg2700
gctcagcgcactcccacatctgcatcagagccccagtccctcctgggcccccttgtaccc2760
tctaagactaagctcggaccccgccgggaaccacccccaggaccctacctcaggctgtgc2820
caccaccgtccacctggcagccccagccagaaacctggaggccaccctggctttctcccc2880
tccatgtctacctgtccctcagccttcttgtggcctggctactcctctctctgctccgcc2940
tcctggctggcctttaatgtaaacaatccatctaacagctgagccccactcacgacaatg3000
c 3001
<210> 279
<211> 3001
<212> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 1501
<223> 99-62531-351 : polymorphic base C or T
<220>
<221> misc binding
<222> 1482-..1500
<223> 99-62531-351.mis1
<220>
<221> misc~binding
<222> 1502..1521
<223> 99-62531-351.mis2, potential complement
141
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
<220>
<221> primer bind
<222> 1149..1166
<223> upstream amplification primer
<220>
<221> primer bind
<222> 1591..1608
<223> downstream
<220>
amplification primer, complement
<221> misc binding
<222> 1489..1513
<223> 99-62531-351.potential probe
<220>
<221> misc_feature
<222> 755,890,893,1406,1412,2220,2222,2224,2232,2241
<223> n=a, g, c or t
<400>
279
tgtggtttccctttccagggagtgatggctctgtaggctctgggattgctttttcatttg 60
tttgttgttttgggacagagttttactctgtcacccaggctagactgcagtggtaaatca 120
cagctcactgcagtctctgcctccccaggctcaggtgatcctcctgcctccccaggctca 180
ggtgatcctcctgcctcaacctcctgaatagctgggactacggtcatttttaattttttt 240
ttgtagaggtggagtctcgctatgttgtccaggctggtcttgaactcctaggctgaagca 300
atcctcccaccggggcctcccaaagtcctgggattatgggcgtgagcccccacacctggg 360
cttatttctcgagaaggggcttgtgctcctcctcacctgatgcctctccttctcccacca 420
gcgtcatcatgaccggggcctacaacaacttcttccgcatgttcgatcggaacaccaagc 480
gggacgtgaccctggaggcctcgagggaaagcagcaagccccgggctgtgctcaagccac 540
ggcgcgtgtgcgtggggggcaagcgccggcgtgatgacatcagtgtggacagcttggact
tcaccaagaagatcctgcacacggcctggcacccggctgagaacatcattgccatcgccg 660
ccaccaacaacctgtacatcttccaggacaaggtaaactctgacatgcactaggtatgtg 720
cagttcccggcccctgccacccagcctcatgcaangtcatccccgacatgaccttcacga 780
ccgcaatgcaaggaggggaagaaagtcacagcactgatgaggacagctgcagaggtggca 840
gtgtgtggacacaggaagtttgggccccctccctgccccagctttcctanggnccagaat 900
tgtgtttggcagtaattgtctgtttaaaaaaataaaaaggaaaggaagcgttcaccgcca 960
caaatcataaaatggacatgactgtggagtcttacagttcagggttctttcattcacgtc 1020
ccttcctgtctcggtctgcggtctttaccacatcaataggactttttatgcgtccgggtt 1080
aatttttcactccagtgcgtcctgttgcagggaccggagctgatgggagctgcttctccc 1140
ccatgcctcactggtcccagatcagggctccagggacagatgatgagtctcaaacgagcc 1200
agccaggggttcttttggttataaatggggcaattcgccctgtctcagagctgatgacct 1260
caccgttgttttttggatggtgaattcatgctgagaatttgcagatgcaagctcctctcc 1320
taggtcttctgaatgtcttgaaacatcccaggtcccaggtctggtgcggtttcccgagag 1380
gagcggagtggggtttgtcttctgtngtgccntgtgtcctcatctgattcacctgccatt 1440
tgctgagcctctgctgtgtaccaggcgtggtgctcagccctagaggcagttgacttaccc 1500
yctgcagccctccctgccgcctcacccttcagcattcactgggcaccttcccggagcgga 1560
cactgactcccatgcacgattttttggaatcttcctcctgactgtgaggtgggtgttcat 1620
tcatttcctccataaacaccaacttctcgaagcgtgccaggctctgggctggatgctggg 1680
gataagcgggaacccttaggatcccctctgtccacgagaagaagctgaggctctgagcgg 1740
atgcacaggtcacccatggcaggtgccgtgcagtggtgtcaggaacccgtccgggtcttc 1800
acacaaggttctctccagtccatctcgtgggcggctcatgttagagcgacattcaaatgg 1860
aaggtttggaaaggaatgcctctgtcttgtgaagtaggacatggcagacttggcgacgac 1920
aagggtccaggagaactgagacgcaggatggaagacagagaagaccccccggagctcctc 1980
gctctgcttggtggcttcaggagtgtggccctccccaggactccacttcatcctgggctt 2040
gcaccctccttgagccaatgcactgaactgcctttgaaaggaaattgcatgttctgacca 2100
ttttaggatacctttactttaaggaccacacagtcccagaggacacatccctcgggaact 2160
ctgcccctctgacaatgagggccacagagaaggtggtgtttccatggtagatgctcctgn 2220
tntnggtgatanccaaacctngcccacccctctgagtcgtctttgctcatggacttgcag 2280
cagagccacgtagtttggcattttgattcagaaagtggggagcagagacccagccaaatc 2340
caaactttttttttggttttgttttgttttgttttttacaagatataacataacccagga 2400
aacagacccagctgaggttattctcagtggattacagtatacttttgtgtgtgtaaaagc 2460
acaaagtgcatgtgtactcacttctggccatataacatttacacagggaaatggatcatt 2520
142
CA 02395240 2002-06-20
WO 01/51659 PCT/IBO1/00116
gatttttttt taatcaacgtgaatgaagaatgtttgtttatatatcacta taaaatccag2580
ttgacctgga cagtattatatgtacatatctattctaattaaatttaaca atcaaaggat2640
tggattactt ttttcccccttgtaaagaggttcgagaatgtggtcaattg tatagatagc2700
gtgttaaagc caaaacccagctctgagggccttacccattacttggatat ttgctacgat2760
ccatctccct ttgtgagtcaaatgttaagagaagaaacttgtatttgcag ctagaggtta2820
ctgtcacatc atagatttaacatttaccatcttcaaagtacaaatcttac atgtccttca2880
aaaggaggtc ttaatacagttcctagttccttacttctgttttaaacttt gggtaccaaa2940
ccaaaaagaa gaaaaaagaaaggaaaagatcttctttgaagaaaagtatg tctctggatc3000
c 3001
<210> 280
<211> 3001
<2I2> DNA
<213> Homo Sapiens
<220>
<221> allele
<222> 1501
<223> 99-54279-152 base C
: polymorphic or G
<220>
<221> misc
binding
_
<222> 1502 .1521
<223> 99-54279-152.misl,
potential complement
<220>
<221> misc_binding
<222> 1482 .1500
<223> 99-54279-152.mis2
<220>
<221> primer bind
<222> 1635..1652
<223> upstream
amplification
primer, complement
<220>
<221> primer bind
<222> 1170..1187
<223> downstream
amplification
primer
<220>
<221> misc binding
<222> 1489..1513
<223> 99-54279-152
potential probe
<220>
<221> misc_feature
<222> 44,377,423,696,723,1501
<223> n=a, g, c
or t
<400> 280 .
ctaaagtgac agagttcagactttgagagtctgaatgaggcaanggtaag gattttcata60
gctctgagag agggttctcctgagaggggacagacatggcgtttgcacgg actcacacgc.
120
tgtggtatga gacacatgatcacactcactcatttctctcataaatcttc acttccttag180
aacctaccct cccgttagacactagctgtgtcttcttcagcctgacggtc ctctccggaa240
ggtgcgcgtc tgtctctcagcccaattcaaagaggtgggagaggcggcca cagcctctgt300
cggcctgctg ggcacctggggctatagaagagggaccgaggctcagcgag attaagtgac360
cacatcccac agctacntatggctgctgcaggatttgaatttaggacgat ctcgctgggc420
ccntactccc agcgagacaaattaacacaaagccccagggagacaaatta acccaaaccc480
ctggaagaat tttaaaagcagaagctcaagccccccaccccaacacagat tttgattccg540
ttggtctggg tgaggctacccagaaggccctgctgggtggcttgggggcc tgtgcagaag600
gccaggtgca ctgctccatgatggcaaaaccagcccagctccctgctctc ttgcaagggc660
tcagcatctg gtaccagagcaggagatgctcacaangtgagaatttctgt aggggtctac720
143
DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.
CECI EST LE TOME 1 DE 2
~~ TTENANT LES PAGES 1 A 303
NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des
brevets
JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME
THIS IS VOLUME 1 OF 2
CONTAINING PAGES 1 TO 303
NOTE: For additional volumes, please contact the Canadian Patent Office
NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:
