Note: Descriptions are shown in the official language in which they were submitted.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
1
CELL PRODUCTION
The present invention relates to neurectoderm cells and to differentiated or
partially differentiated cells derived therefrom. The present invention also
relates
to methods of producing, differentiating and culturing the cells of the
invention,
s and to uses thereof.
Initial developmental events within the mammalian embryo entail the
elaboration of extra-embryonic cell lineages and result in the formation of
the
blastocyst, which comprises trophectoderm, primitive endoderm and a pool of
pluripotent cells, the inner cell mass (ICM/epiblast). As development
continues,
the cells of the ICM/epiblast undergo rapid proliferation, selective
apoptosis,
differentiation and reorganisation as they develop to form the primitive
ectoderm.
In the mouse, the cells of the iCM begin to proliferate rapidly around the
time of
blastocyst implantation. The resulting pluripotent cell mass expands into the
blastocoelic cavity. Between 5.0 and 5.5 dpc (days post coitus) the inner
cells of
i 5 the epiblast undergo apoptosis to form the proamniotic cavity. The outer,
surviving cells, or early primitive ectoderm, continue to proliferate and by
6.0-6.5 dpc have formed a pseudo-stratified epithelial layer of pluripotent
cells,
termed the primitive or embryonic ectoderm. Primitive ectoderm cells are
pluripotent, and distinct from cells of the ICM in terms of morphology, gene
2o expression and differentiation potential.
By 4.5 dpc pluripotent cells exposed to the blastocoelic cavity have
differentiated to form primitive endoderm. The primitive endoderm gives rise
to
two distinct endodermal cell populations, visceral endoderm, which remains in
contact with the epiblast, and parietal endoderm, which migrates away from the
25 pluripotent cells to form a layer of endoderm adjacent to the
trophectoderm.
Formation of these endodermal layers is coincident with formation of primitive
ectoderm and creation of an inner cavity. Visceral endoderm is known to
express
signals that influence pluripotent cell differentiation.
At gastrulation pluripotent cells of the primitive ectoderm differentiate to
3o form the three germ layers of the embryo: mesoderm, endoderm and ectoderm.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
2
Pluripotent cells from this time are confined to the germline. Differentiation
of
primitive ectoderm cells in the distal and anterior regions of the embryo is
directed
along the ectodermal lineage forming definitive ectoderm, a transient
embryonic
cell type fated to form neurectoderm and surface ectoderm.
Neurectoderm cells are found in the mammalian embryo in the neural plate,
which folds and closes to form the neural tube. These cells are the precursors
to
all neural lineages. They have the capacity to differentiate into all neural
cell types
present in the central nervous system (CNS) and peripheral nervous system
(PNS). fn the CNS these cells include multiple neuron subtypes and glia (eg;
astrocytes and oligodendrocytes). Neural cells of the peripheral nervous
system
also include many different types of neurons and glial cells. Peripheral
neural
cells differentiate from transient embryonic precursor cells termed neural
crest
cells, which arise from the neural tube. Neural crest cells are also precursor
cells
to non-neural cells, including melanocytes, cartilage and connective tissue of
the
head and neck, and cells of cardiac outflow septation (Anderson, 1989).
In the human and in other mammals, formation of the blastocyst, including
development of ICM cells and their progression to pluripotent cells of the
primitive
ectoderm, and subsequent differentiation to form the embryonic germ layers and
differentiated cells, follow a similar developmental process.
2o Pluripotent cells can be isolated from the preimplantation mouse embryo as
embryonic stem (ES) cells. ES cells can be maintained indefinitely as a
pluripotent cell population in vitro, and, when reintroduced into a host
blastocyst,
can contribute to all adult tissues of the mouse including the germ cells. ES
cells,
therefore, retain the ability to respond to all the signals that regulate
normal mouse
development. EPL cells are a separate population of pluripotent cells distinct
from
ES cells. EPL cells are equivalent to early primitive ectoderm cells of the
post-
implantation embryo, and can be maintained, proliferated and differentiated in
a
controlled manner in vitro. EPL cells and their properties are described in
International patent application W099/53021.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
3
ES cells and EPL cells represent powerful model systems for the
investigation of mechanisms underlying pluripotent cell biology and
differentiation
within the early embryo, as well as providing opportunities for embryo
manipulation and resultant commercial, medical and agricultural applications.
Furthermore, appropriate proliferation and differentiation of ES and EPL cells
can
be used to generate an unlimited source of cells suited to transplantation for
treatment of diseases which result from cell damage or dysfunction.
Other pluripotent cells and cell lines including in vivo or in vitro derived
ICM/epiblast, in vivo or in vitro derived primitive ectoderm, primordial germ
cells
(EG cells), teratocarcinoma cells (EC cells), and pluripotent cells derived by
dedifferentiation or by nuclear transfer will share some or all of these
properties
and applications.
The successful isolation, long term clonal maintenance, genetic
manipulation and germ-line transmission of pluripotent cells from species
other
than rodents has generally been difficult to date and the reasons for this are
unknown. International patent application W097/32033 and US Patent 5,453,357
describe pluripotent cells including cells from species other than rodents.
Primate
ES cells have been described in International patent application W096/23362,
and in US Patent 5,843,780, and human EG cells have been described in
2o International patent application WO98/43679.
The differentiation of murine ES cells can be regulated in vitro by the
cytokine leukaemia inhibitory factor (LIF) and other gp130 agonists or by
culture
on feeder cells which promote self-renewal and prevent differentiation of the
stem
cells. Differentiation in vitro of human ES cells is not inhibited by LIF, but
is
inhibited by culture on feeder cells.
The ability to form predominantly homogeneous populations of partially
differentiated or terminally differentiated cells by differentiation in vitro
of
pluripotent cells has proved problematic. Current approaches involve the
formation of embryoid bodies from pluripotent cells, in a manner that is not
so controlled and does not result in homogeneous populations. Mixed cell
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
4
populations such as those in embryoid bodies of this type are generally
unlikely to
be suitable for therapeutic or commercial use.
Selection procedures have been used to obtain cell populations enriched in
neural cells from embryoid bodies. These include manipulation of culture
conditions to select for neural cells (Okabe et al, 1996), and genetic
modification
of ES cells to allow selection of neural cells by antibiotic resistance (Li et
al, 1998).
In these procedures the differentiation of pluripotent cells in vitro does not
involve biological molecules that direct differentiation in a controlled
manner.
Hence homogeneous synchronous, populations of neurectoderm cells with
1o unrestricted neural differentiation capability are not produced,
restricting the ability
to derive essentially homogeneous populations of partially differentiated or
differentiated neural cells.
Chemical inducers such as retinoic acid have also been used to form neural
lineages from a variety of pluripotent cells including ES cells (Bain et al,
1995).
However the route of retinoic acid-induced neural differentiation has not been
well
characterised, and the repetoire of neural cell types produced appears to be
generally restricted to ventral somatic motor, branchiomotor or visceromotor
neurons (Renoncourt et al, 1998).
In summary it has not been possible to control the differentiation of
2o pluripotent cells in vitro, to provide homogeneous, synchronous populations
of
neurectoderm cells with unrestricted neural differentiation capacity.
Similarly
methods have not been developed for the derivation of neurectoderm cells from
pluripotent cells, in a manner that parallels their formation during
embryogenesis.
These limitations have restricted the ability to form essentially homogeneous,
synchronous populations of partially differentiated and terminally
differentiated
neural cells in vitro, and have restricted their further development for
therapeutic
and commercial applications.
Neural stem cells and precursor cells have also been derived from foetal
brain and adult primary central nervous system tissue in a number of species,
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
including rodent and human (e.g. see United States patent 5,753,506 (Johe),
United States patent 5,766,948 (Gage), United States patent 5,589,376
(Anderson
and Stemple), United States patent 5,851,832 (Weiss et al), United States
patent
5,958,767 (Snyder et al) and United States patent 5,968,829 (Carpenter).
s However, each of these disclosures fails to describe a predominantly
homogeneous population of neural stem cells able to differentiate into all
neural
cell types of the central and peripheral nervous systems, andlor essentially
homogeneous populations of partially differentiated or terminally
differentiated
neural cells derived from neural stem cells by controlled differentiation.
1o Furthermore, it is not clear whether cells derived from primary foetal or
adult tissue can be expanded sufficiently to meet potential cell and gene
therapy
demands.
It is an object of the present invention to overcome, or at least alleviate,
one
or more of the difficulties or deficiencies associated with the prior art.
Applicant has surprisingly found that maintaining contact of EPL cells with a
conditioned medium as hereinafter described, preferably in cell aggregates
grown
in suspension, may be used to produce an at least partially differentiated
cell type
equivalent to embryonic neurectoderm, which can differentiate further to all
neural
cell types.
2o In a first aspect of the present invention there is provided a method of
producing neurectoderm cells, which method includes
providing
a source of early primitive ectoderm-like (EPL) cells;
a conditioned medium as hereinafter described; or an extract
2s therefrom exhibiting neural inducing properties; and
contacting the EPL cells with the conditioned medium or extract, for a time
sufficient to generate controlled differentiation to neurectoderm cells.
The neurectoderm cells so formed may be characterised in that they are
synchronous, homogeneous and their formation parallels the formation of
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
6
neurectoderm in vivo. The neurectoderm is formed in response to molecules of
biological origin and has apparently unrestricted neurectoderm differentiation
capability.
As used herein, the term "neurectoderm" refers to undifferentiated neural
s progenitor cells substantially equivalent to cell populations comprising the
neural
plate and/or neural tube. Neurectoderm cells referred to herein retain the
capacity
to differentiate into all neural lineages, including neurons and glia of the
central
nervous system, and neural crest cells able to form all cell types of the
peripheral
nervous system.
1o The neurectoderm cells so formed may be characterised as "early", for
example the neurectoderm cells exhibit neural plate-like characteristics.
This is indicated by upregulation of expression of Gbx2, an early
neurectoderm marker.
In a preferred aspect, the neurectoderm cells may be further cultured in a
suitable culture medium while neurectoderm cells are formed that may be
characterised as "late", for example the neurectoderm cells exhibit neural
tube-like
characteristics.
This is indicated by down regulation of Gbx2.
By the term "suitable culture medium" as used herein we mean a culture
2o medium which is suitable for culturing neurectoderm cells. Desirably the
culture
medium excludes foetal calf serum (FCS). Desirably the culture medium does not
include the conditioned medium as hereinbefore described.
Accordingly in a preferred embodiment of this aspect of the present
invention, the method includes further providing a suitable culture medium as
2~ hereinbefore defined, and
further culturing the early neurectoderm cells in the presence of the suitable
culture medium while late neurectoderm cells are formed.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
7
Preferably the late neurectoderm cells so produced exhibit neural tube-like
characteristics.
In one form, the method may include the preliminary steps of
providing
a source of pluripotent cells,
a source of a biologically active factor including
a low molecular weight component selected from the group
consisting of proline and peptides including proline and functionally
active fragments and analogues thereof; and
1o a large molecular weight component selected from the group
consisting of extracellular matrix proteins and functionally active
fragments or analogues thereof, or the low or large molecular weight
component thereof; and
contacting the pluripotent cells with the biologically active factor, or the
large or low molecular weight component thereof, or the conditioned medium, or
the extracellular matrix and/or the low molecular weight component, to produce
early_primitive ectoderm-like (EPL) cells.
The source of the biologically active factor includes a partially or
substantially purified form of the biologically active factor, a conditioned
medium
2o including the low and/or large molecular weight component thereof; or an
extracellular matrix including a large molecular weight component thereof
and/or
the low molecular weight component , as described in W099/53021 above.
The pluripotent cells from which the EPL cells may be derived, may be
selected from one or more of the group consisting of embryonic stem (ES)
cells, in
vivo or in vitro derived ICM/epiblast, in vivo or in vitro derived primitive
ectoderm,
primordial germ cells (EG cells), teratocarcinoma cells (EC cells), and
pluripotent
cells derived by dedifferentiation or by nuclear transfer. EPL cells may also
be
derived from differentiated cells by dedifferentiation.
The step of contacting the pluripotent cells with the biologically active
3o factor, etc. to produce EPL cells may be conducted in any suitable manner.
For
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
8
example, EPL cells may be generated in adherent culture or as cell aggregates
in
suspension culture. It is particularly preferred that the EPL cells are
produced in
suspension culture in a culture medium such as Dulbecco's Modified Eagles
Medium (DMEM), supplemented with the biologically active factor etc, It is
also
preferred that there is little or no disruption of cell to cell contact (i.e.
trypsinisation).
The conditioned medium utilised in the method according to the present
invention is described in International patent application WO99/53021, the
entire
disclosure of which is incorporated herein by reference.
The term "conditioned medium" includes within its scope a fraction thereof
including medium components below approximately 5 kDa, and/or a fraction
thereof including medium components above approximately 10 kDa
Preferably the conditioned medium is prepared using a hepatic or
hepatoma cell or cell line, more preferably a human hepatocellular carcinoma
cell
15 line such as Hep G2 cells (ATCC HB-8065) or Hepa-1 c1 c-7 cells (ATCC CRL-
2026), primary embryonic mouse liver cells, primary adult mouse liver cells,
or
primary chicken liver cells, or an extraembryonic endodermal cell or cell line
such
as the cell lines END-2 and PYS-2. However, the conditioned factor may be
prepared from a medium conditioned by liver or other cells from any
appropriate
2o species, preferably mammalian or avian. The conditioned medium MEDII is
particularly preferred.
As stated above, a neural inducing extract from the conditioned medium
may be used in place of the conditioned medium. Optionally, the neural
inducing
extract does not include the biologically active factor conditioned medium or
the
25 large or low molecular weight component fihereof. The term "neural inducing
extract" as used herein includes within ifs scope a natural or synthetic
molecule or
molecules which exhibits) similar biological activity, e.g. a molecule or
molecules
which compete with molecules within the conditioned medium that bind to a
receptor on EPL cells responsible for neural induction.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
9
In a preferred aspect of the present invention, in the neurectoderm cell
production method, the further culturing step is conducted in the presence of
a
growth factor from the FGF family.
The growth factor from the FGF family, when present, may be of any
suitable type. Examples include FGF2 and FGF4.
Accordingly, it should be understood that the term "EPL cells" refers to cells
derived from pluripotent cells that retain pluripotency and are converted to
and/or
maintained as cells that express Oct4 and FgfS by:
(a) the biologically active factor as hereinbefore described or the large or
low
1o molecular weight component thereof;
(b) a conditioned medium as hereinbefore described; or
(c) An extracellu(ar matrix as hereinbefore described in the presence or
absence of the low molecular weight component.
The step of contacting the EPL cells with the conditioned medium may be
conducted in any suitable manner. For example neurectoderm cells may be
generated in adherent culture or as cell aggregates in suspension culture.
Preferably the neurectoderm cells are produced in suspension culture in a
culture
medium such as DMEM, supplemented with the conditioned medium or extract.
Preferably the cells are cultured for approximately 1 to 7 days, more
preferably
2o approximately 3 to 7 days, most preferably approximately 5 days.
Again, a conditioned medium as hereinbefore described may be used to
derive and maintain the neurectoderm cells or the conditioned medium may be
fractionated to yield an extract therefrom exhibiting neural inducing
properties,
which may be added alone or in combination to other media to provide the
neurectoderm cell deriving medium. The conditioned medium may be used
undiluted or diluted (e.g. approx. 10-80%, preferably approximately 40-60%,
more
preferably approximately 50%).
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
After day 3, the conditioned medium is preferably replaced with a suitable
culture medium as hereinbefore described.
It is optional that the suitable culture medium also includes a growth factor
from the FGF family. The concentration of the growth factor from the FGF
family
5 is preferably in the range approximately 1 to 100 ng/ml, more preferably
approximately 5 to 50 ng/ml. When FGF4 or FGF2 is used, its concentration is
preferably approximately 20 ng/ml.
In a further preferred form of this aspect of the invention, the method
includes the further step of
1o identifying the neurectoderm cells by procedures including gene expression
markers, morphology and differentiation potential.
The conversion of EPL cells to neurectoderm cells is characterised by
down regulation of expression of Oct4 relative to embryonic stem (ES)
cells;and absence of expression of brachyury; and one or more of
up regulation of expression of N-Cam and nestin;
up regulation of expression of Sox1 and Sox2; and
initial up regulation of expression of Gbx2; followed by down regulation
thereof as neurectoderm cells persist.
In particular the upregulation of expression of Gbx2 is indicative of
2o neurectoderm cells having neural plate-like characteristics.
The subsequent downregulation of Gbx2 is indicative of cells having neural
tube-like characteristics.
Preferably the neurectoderm cell exhibits three of the above characteristics,
more preferably four.
For example, the following gene expression profile is evident in
neurectoderm cells according to the present invention.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
11
~ Down regulation of Oct4 expression (pluripotent cell marker).
Expression of N-Cam (expressed by all neural lineages), nestin (an
intermediate filament protein expressed by undifferentiated neural
stem cells), Sox1 and Sox2 (expressed in neurectoderm and all
undifferentiated neural cells), Gbx2 (expressed in neural plate and
open neural tube).
~ Expression of the neural genes Otxl, Mashl, En1 and En2. They
may also express Pax3 and Pax6.
Marker genes which may be used to assess the conversion of pluripotent
cells to neurectoderm cells and neural lineages include known markers such as
Gbx2, Soxl, Sox2, nestin, N-Cam, Oct4 and brachyury. Markers down regulated
during the transition from pluripotent cells to neurectoderm include Oct4.
Markers
up regulated during this transition include Gbx2, Soxl, Sox2, nestin and N-
Cam.
Markers not expressed during this transition include brachyury (a marker of
1s mesoderm). As neurectoderm cells persist in culture Gbx2 may be down
regulated.
The neurectoderm cells according to the present invention may also
express the neural genes Otxl, Mashl, En1 and En2. They may also express
Pax3 and Pax6.
2o As stated above, in a further aspect of the present invention there is
provided a neurectoderm cell derived in vitro.
The neurectoderm cell may exhibit two of more of the following
characteristics
down regulation of Oct4 expression;
2s expression of N-CAM and nestin;
expression of Sox1 and Sox2
expression of Gbx2;
expression of neural genes, as described above.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
12
In particular the neurectoderm cell exhibits initial upregulation of Gbx2
indicative of early neurectoderm cells having neural plate-like
characteristics.
The neurectoderm cell exhibits subsepuent down regulation of Gbx2
indicative of late neurectoderm cells having neural tube-like characteristics,
the late neurectoderm being further characterised by the substantial
absence of patterning marker expression;
and up regulation of neural genes
The neurectoderm cell according to the present invention has the capacity
to differentiate into all neural lineages.
1o As discussed below, the neurectoderm cell according to the present
invention may disperse and differentiate in vivo following brain implantation.
In
particular following intraventricular implantation, the cell is capable of
dispersing
widely along the ventricle walls and moving to the sub-ependymal layer. The
cell
is further able to move into deeper regions of the brain, including into the
~5 uninfected side of the brain into sites that include the thalamus, frontal
cortex,
caudate putamen and colliculus.
During embryogenesis in vivo, neurectoderm cells respond to positional
signals that lead to the formation of specific differentiated neural cell
types. As
part of the response to positional signals, position-dependent gene expression
is
2o initiated in neurectoderm cells in restricted locations along the rostro-
caudal and
dorso-ventral axes within the developing nervous system. These genes serve as
markers of positional responses, indicative of future developmental
restriction.
Surprisingly, neurectoderm cells according to the present invention do not
express the patterning markers Hox8l, Hoxa7, Krox20, Nkx2.2 and Shh. This
25 may distinguish neurectoderm cells produced according to the present
invention
from neurectoderm cells produced from other sources including for example
foetal
and adult primary tissues including neural stem cells. Accordingly, the
potential
for neural development of these cells is expected to be unrestricted, and thus
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
13
retain the ability to differentiate into all neural cell types, including
neuronal cells,
glial cells and neural crest cells.
During embryonic development in vivo, Hox81 is expressed with
Phombomere 4, Hoxa7 is expressed in the posterior ectoderm and trunk, Krox20
s is expressed in early neural plate, and a more posterior domain, these
domains
coinciding with later position of rhombomeres 3 and 5, Nkx 2.2 expressed in
the
developing forebrain and Shh expressed initially in the ventral midbrain, and
later
extending in a strip of ventral tissue from the rostral limit of the forebrain
to the
caudal regions of the spine.
If has further been found that by growing EPL cells in suspension culture in
presence of factors in the conditioned medium MEDII for a time insufficient to
form
neurectoderm cells, cells exhibiting characteristics of definitive ectoderm
may be
produced. Definitive ectoderm cells express lower levels of Oct4 than
pluripotent
cells, and do not express the neural lineage marker Soxl.
15 Neurectoderm formation in vivo proceeds via the formation of definitive
ectoderm. Although no markers exist for definitive ectoderm in vivo, gene
expression analysis identified a population of cells in EPL cells programmed
to
form neurectoderm which expressed low levels of Oct4 and failed to express
neurectodermal markers. See International patent application "Ectodermal Cell
2o Production", to Applicants, filed on even date. These cells were present
transiently between primitive ectoderm (high Oct4 expression, low Soxl, Gbx2
expression) and neurectoderm (high Soxl, Obx2 expression, low Oct4
expression) and suggest that neurectoderm formation proceeds via an
intermediate population which may represent definitive ectoderm.
2s The definitive ectoderm may exhibit substantially no Soxl expression.
In a further aspect of the present invention there is provided a method for
maintaining neurectoderm cells in vitro in cell populations that are
predominantly
homogeneous, which method includes
providing
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
14
neurectoderm cells produced as described above; and
a suitable culture medium as hereinbefore described;
further culturing the neurectoderm cells in the culture medium to form
aggregates of neurectoderm cells.
Preferably the further culturing step begins at day 3 or later.
In a further aspect of the invention there is provided methods for producing
differentiated or partially differentiated cells from neurectoderm cells,
which
method includes
providing
1o neurectoderm cells as hereinbefore described, and
a suitable culture medium;
further culturing the cells in the presence or absence of a growth factor from
the FGF family, and optionally in the presence of additional growth factors
and/or
differentiation agents, to produce the differentiated or partially
differentiated cells.
Preferably the cells produced are cells selected from the group consisting
of neuronal cell precursors, neural crest cells, glial cell precursors, or
differentiated
neurons or glial cells.
The neurectoderm cells may differentiate to form neuronal cells with high
frequency.
2o The step of further culturing the neurectoderm cells in the presence or
absence of a growth factor from the FGF family and in the presence of
additional
growth factors and/or differentiation agents, may be conducted in any suitable
manner. Preferably the cellular aggregates or explants cultured in the
presence or
absence of a growth factor from the FGF family in the presence of additional
growth factors and/or differentiation agents,. For example, differentiated or
partially differentiated cells may be generated in adherent culture or as cell
aggregates in suspension culture. Preferably the cells are cultured for
approximately a further 3 hours to 10 days, more preferably approximately 1 to
6
days.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
The concentration of the growth factor from the FGF family if included is
preferably in the range approximately 1 to 100 ng/ml, more preferably
approximately 5 to 50 ng/ml. When FGF4 or FGF2 is used, its concentration is
preferably approximately 10 ng/ml.
s In a preferred embodiment the neurectoderm cells may differentiate in a
controlled manner to form predominantly homogeneous populations of neural
crest cells.
The additional neurectoderm cell culture step is accordingly preferably
conducted in the presence of a Protein Kinase Inhibitor, for example
1o staurosporine.
Staurosporine is a Protein Kinase C inhibitor known to induce neural crest
formation from premigratory neural cells in quail (Newgreen and Minichiello,
1996).
The conversion of neurectoderm cells to neural crest cells is characterised
15 by a change in morphology, cell migration and up regulation of expression
of
SoxlO.
A suitable culture medium may include Ham's F12 nurient mixture
containing, e.g. 3% FCS and 10 nm/ml FGF2. Plating may occur onto plasticware
coated with cellular fibronectin (e.g. 1 ~,g/cm2).
2o Culture medium may be supplemented with for example lluM to 200 ~,M
staurosporine, preferably 25 ~.M staurosporine in a suitable solvent (eg
DMSO).
In an alternative embodiment, the neurectoderm cells may differentiate in a
controlled manner to form predominantly homogeneous populations of glial
cells.
The differentiation of neurectoderm to glial cells is accordingly preferably
conducted
in a first stage, in the presence of laminin, an FGF growth factor and an
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
16
EGF growth factor; and
in a second stage, in the presence of a PDGF growth factor and in the
substantial absence of EGF, FGF and laminin.
For example neurectoderm aggregates or explants are preferably grown in
adherent culture in medium that includes a member of the FGF family (eg; FGF2
or FGF4 10 ng/ml) and EGF (eg; 20 ng/ml) and laminin (eg; 1 to 3 p,g/ml) for
~3 d
then cultured for further 2 to 3 d in the absence of EGF, FGF and laminin and
presence of PDGF (eg PDGF-AA, 10 ng/ml).
The conversion of neurectoderm cell fio glial cells is characterised by a
1o change in morphology and up regulation of expresion of the cell surface
marker
GFAP.
Accordingly, in a further aspect of the present invention, there is provided a
partially differentiated neuronal cell, or a terminally differentiated
neuronal cell, a
partially differentiated neural crest cell, or a terminally differentiated
neural crest
is cell, a partially differentiated glial cell, or a terminally differentiated
glial cell,
produced by the method described above or derived from neurectoderm cells as
hereinbefore described.
Preferably the cells are present as a predominantly homogeneous
population.
2o In a preferred aspect there is now provided
a substantially homogeneous neural crest cell population obtained in vitro
exhibiting two or more of the following characteristics:
neural crest cell morphology;
cell migration; and
25 expression of SoxlO.
In a further preferred aspect there is provided
a substantially homogeneous gliai cell population obtained in vitro exhibiting
one or both of the following characteristics:
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
17
glial cell morphology; and
expression of the cell surface marker GFAP.
Preferably the substantially homogeneous glial cell population includes glial
cell progenitors and terminally differentiated glial cells.
In a further aspect of the present invention, there is provided a method of
producing genetically modified neurectoderm cells or their partially or
terminally
differentiated progeny, said mefihod including
providing
pluripotent cells,
a source of early primitive ectoderm-like (EPL) cells; and
a conditioned medium as hereinbefore defined, or an extract
therefrom exhibiting neural inducing properties
modifying one or more genes in the EPL cells; and
contacting the genetically modified EPL ce(Is with the conditioned medium
or extract to produce genetically modified early neurectoderm cells.
Preferably, the method further includes providing a suitable culture medium
as hereinbefore defined, and
further culturing the early neurectoderm cells in the presence of the suitable
culture medium for a time sufficient to form late neurectoderm cells.
2o More preferably, the further culturing step is conducted in the presence of
a
growth factor from the FGF family.
Alternatively, ES cells may be genetically modified before conversion to
EPL cells and differentiation to neurectoderm, or neurectoderm cells or their
partially or terminally differentiated progeny may be produced as hereinbefore
25 described and then genetically modified.
Accordingly, in a still further aspect of the present invention, there is
provided a method of producing genetically modified neurectoderm cells, which
method includes
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
18
providing
a source of genetically modified pluripotent cells;
a source of a biologically active factor including
a low molecular weight component selected from the group
consisting of proline and peptides including proline and functionally
active fragments and analogues thereof; and
a large molecular weight component selected from the group
consisting of extracellular matrix portions and functionally active
fragments or analogues thereof, or the low or large molecular weight
1 o component thereof;
a conditioned medium as hereinbefore defined; or an extract
therefrom exhibiting neural inducing properties;
contacting the pluripotent cells with the source of the biologically active
factor, or the large or low molecular weight component thereof, to produce
15 genetically modified early primitive ectoderm-like (EPL) cells; and
contacting the genetically modified EPL cells with the conditioned medium
or extract to produce genetically modified early neurectoderm cells.
The method preferably further includes providing a suitable culture medium
as hereinbefore defined, and
2o further culturing the early neurectoderm cells in the presence of the
suitable
culture medium for a time sufficient to form genetically. modified late
neurectoderm
cells.
More preferably, the further culturing step is conducted in the presence of a
growth factor from the FGF family.
25 Modification of the genes of these cells may be conducted by any means
known to the skilled person which includes introducing extraneous DNA,
removing
DNA or causing mutations within the DNA of these cells. Modification of the
genes includes any changes to the genetic make-up of the cell thereby
resulting in
a cell genetically different to the original cell.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
19
The genetically modified or unmodified neurectoderm cells of the present
invention and the differentiated or partially differentiated cells derived
therefrom
are well defined, and can be generated in amounts that allow widespread
availability for therapeutic and commercial uses. The cells have a number of
s uses, including the following:
~ use in human cell therapy to treat and cure neurodegenerative
disorders such as Parkinson's disease, Huntington's disease,
lysosomal storage diseases, multiple sclerosis, memory and
behavioural disorders, Alzheimer's disease and macular
1 o degeneration, and other pathological conditions including stroke and
spinal chord injury. For example genetically modified or unmodified
neurectoderm cells or their differentiated or partially differentiated
progeny may be used to replace or assist the normal function of
diseased or damaged tissue. For example in Parkinson's disease
15 the dopaminergic cells of the substantia nigra are progressively lost.
The dopaminergic cells in Parkinson's patients could be replaced by
implantation of neurectodermal neural cells, produced in the manner
described in this application.
~ use of neural crest cells for the derivation of cells for the treatment of
2o spinal cord disorders and Schwann cells for the treatment of multiple
sclerosis.
~ use to produce cells, tissues or components of organs for transplant.
For example neural crest cells retain the capacity to form non-neural
cells, including cartilage and connective tissue of the head and neck,
25 and are potentially useful in providing tissue for craniofacial
reconstruction.
use in human gene therapy to treat neuronal and other diseases. In
one approach neurectoderm cells or their differentiated and partially
differentiated products may be genetically modified; eg; so that they
3o provide functional biological molecules. The genetically modified
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
cells can be implanted, thus allowing appropriate delivery of
therapeutically active molecules.
~ use as a source of cells for reprogramming. For example
karyoplasts from neurectoderm or their differentiated or partially
differentiated progeny may be reprogrammed by nuclear transfer.
Cytoplasts from neurectodermal cells may also be used as vehicles
for reprogramming so that nuclear material derived from other cell
types are directed along neural lineages. Alternatively neural stem
cells may be reprogrammed in response to environmental and
1o biological signals that they are not normally exposed to. For
example the differentiation of murine neural stem cells is redirected
to form haematopoietic cells (cells of mesodermal lineage), when
injected into the bone marrow (eg; Bjornson et al, 1999). Hence
neurectoderm cells described herein are potentially capable of
15 forming differentiated cells of non-neural lineages, including cells of
mesodermal lineage, such as haematopoietic cells and muscle.
Reprogramming technology using neural cells potentially offers a
range of approaches to derive cells for autologous transplant. In one
approach karyoplasts from differentiated cells are obtained from the
2o patient, and reprogrammed in neurectoderm cytoplasts to generate
autologous neurectoderm. The autologous neurectoderm cells or
their differentiated or partially differentiated progeny could then be
used in cell therapy to treat neurodegenerative diseases. See
Australian provisional patent applications PR1348 and PR2126, the
2s entire disclosures of which are incorporated herein by reference.
Alternatively neurectoderm could be further dedifferentiated to a
pluripotent state by fusion with pluripotent cytoplasts, and
subsequently directed along alternative differentiation pathways to
form cells of mesodermal or endodermal lineage.
~ use in pharmaceutical screening for therapeutic drugs that influence
the behaviour of neurectoderm cells and their differentiated or
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
21
partially differentiated progeny. Neurectoderm cells may be
particularly appropriate in evaluating the toxicology and teratogenetic
properties of pharmaceutically useful drugs, since many birth
defects, including spina bifida are caused by failures in neural tube
closure.
~ Use in the identification and evaluation of biological molecules that
direct differentiation of neural cells or neural precursors, including
patterning molecules.
~ Use in identifying genes expressed in neurectoderm cells and
partially differentiated or differentiated neural cells.
Accordingly, in a further aspect of the present invention, there is provided a
method for the treatment of neuronal and other diseases, as described above,
which method includes treating a patient requiring such treatment with
genetically
modified or unmodified neurectoderm cells as described above, or their
partially
differentiated or terminally differentiated progeny, through human or animal
cell or
gene therapy.
In a still further aspect of the present invention, there is provided a method
for the preparation of tissue or organs for transplant, which method includes
providing neural crest cells or neurectoderm produced as described above;
2o and
culturing the neural crest cells to produce neural or non-neural cells and the
neurectoderm cells to produce neural cells.
The present invention will now be more fully described with reference to the
accompanying examples and drawings. It should be understood, however, that
the description following is illustrative only and should not be taken in any
way as
a restriction on the generality of the invention described above.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
22
In the figures:
Figure 1
Analysis of EB4 and EBM4
A-D. 7 p,m sections of paraffin embedded EBM4 (A, B) and EB4 (C, D)
stained with haematoxylin;eosin (A, C) and Hoescht 22358 (B, D). E. 20 pg RNA
from EB2-4 and EBM2-4 was analysed for the expression of FgfS, brachyury, Oct4
and mGAP by Northern blot analysis. FgfS transcripts were 2.7 and 1.8 kb
(Herbert et al., 1990), brachyury 2.1 kb (Lake et al., 2000), Oct4 1.55 kb
(Rosner
et al., 1990) and mGAP 1.5 kb. F-tC. In situ hybridisation analysis of EBM4
(F, G,
1o H) and EB4 (I, J, K) with deoxygenin labelled antisense probes for Oct4 (F,
I), FgfS
(G, J) and brachyury (H, K).
Figure 2
Differentiation of EBM
Morphology of EBM' (A) and EBM9 (B). C. 7 p,m section of paraffin
embedded EBM9 stained with haematoxylin. D. 20 lug RNA from EB4-$ and EBM4~$
was analysed for the expression of Oct4 and mGAP. Oct4 transcripts were 1.55
kb (Rosner et al., 1990) and mGAP 1.5 kb. E. In situ hybridisation analysis of
seeded EBM' two days post-seeding with deoxygenin labelled antisense probes
for Oct4.
2o Figure 3
ES cells differentiated as EBM form neurectoderm
A, B. In situ hybridisation analysis of seeded EBM' two days post-seeding
with deoxygenin labelled antisense probes for Sox1 (A) and Sox2 (B). C, D.
Immunohistochemical analysis of seeded EBM' two days post-seeding with
antibodies directed against nestin (C) and NCam (D). Nestin immunoreactivity
was
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
23
detected with an enzymatic reaction for the presence of the alkaline
phosphatase
conjugated secondary antibody. NCam immunoreactivity was detected with a
FITC labelled secondary antibody and fluorescent microscopy. E, F. individual
EBM were seeded on day 7 of development and assayed on days 8, 10 and 12 for
the presence of neurons (E) and beating cardiocytes (F). Neurons and beating
cardiocytes were identified morphologically.
Figure 4
Neural formation by clonal ES cell lines
9 clonally derived ES cell lines were differentiated as EB in IC:DMEM and
as EBM in IC:DMEM +50% MEDII. Individual cell aggregates were seeded on day
7 of development and scored for the presence of neurons on day 14 and the
percentage of aggregates forming neurons was averaged. Neurons were identified
morphologically. For each clonal variant and condition n>48.
Figure 5
EDII induces neuron formation from EPL cells
A. EPL cells were differentiated as cellular aggregates in IC:DMEM
(EPLEB) or IC;DMEM + 50% MEDII (EPLEBM). On day 7 individual aggregates
were seeded and assessed for the formation of beating cardiocytes (n=48). The
experiment was repeated three times. B. ES and EPL cells were differentiated
as
2o cellular aggregates in IC:DMEM (EB, EPLEB) or IC:DMEM + 50% MEDII (EBM,
EPLEBM). On day 7 individual aggregates were seeded and assessed for the
formation of neurons (n=48). The experiment was repeated three times.
Figure 6
EBM comprise a homogeneous population of neurectoderm
A, B. EBM9 were analysed by wholemount in situ hybridisation for the
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
24
expression of Sox1 (A) and Sox2 (B). Stained EBM9 were embedded in paraffin
wax and 7 ~,m sections analysed for homogeneity of gene expression. C. Flow
cytometry of dissociated EBM'° and EB'° analysed for expression
of the cell
surface antigen NCam. NCam positive cells were identified by comparison with
cell populations that had been stained with secondary antibody only (data not
shown). Cells staining with intensities greater than the secondary antibody
only
control were determined to be expressing NCam, and are indicated by the bar.
Figure 7
Gbx2 is temporally regulated during EBM differentiation
1o In situ hybridisation analysis of seeded EBM7 1 (A, D), 2 (B, E) and 3 (C,
F)
days post-seeding with deoxygenin labelled antisense probes for Sox1 (A, B, C)
and Gbx2 (D, E, F).
Figure 8
Expression of positionally specified genes in EBM9
1 s cDNA was synthesised from 1 p,g of total RNA isolated from EB9 (EB),
EPLEB9 (EPLEB), EBM9 (EBM) and a day 10 mouse embryo (day 10) and used
as a template for PCR analysis of the genes denoted. Expression of Actin was
used as a positive control. Primer sequences and product sizes can be found in
example 3.
2o Figure 9
ES cell-derived neurectoderm can be directed down neural crest and glial
lineages
A-D. EBM9 explants were seeded onto cellular fibronectin treated tissue
culture plasticware in medium supplemented with 25 nM staurosporine/ 0.1
25 DMSO (A, C, D) or 0.1 % DMSO alone (B). Cultures were examined after 3 (A,
B)
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
or 48 hours (C, D). In situ hybridisation analysis of EBM9 explants with
deoxygenin
labelled antisense probes for SoxlO (D). E-H. EBM9 explants were seeded onto
poly-L-ornithine treated tissue culture plasticware in medium supplemented
with
10 ng/ml FGF2, 20 ng/ml EGF and 1 ~.g/ml laminin (E, F) followed by culture in
5 medium supplemented with 10 ng/ml PDGF-AA (G, H). Cultures were examined
after 2 (A) or 4 (F), and 6 (G, H) days. H. Immunohistochemistry of EBM9
explants
with antibodies directed against glial fibrillary acidic protein (GFAP). GFAP
immunoreactivity was detected with an enzymatic reaction for the presence of
the
alkaline phosphatase conjugated secondary antibody
1o Figure 10
GFP positive cells after 2 weeks in rat brain
Light (left) and fluorescent (right) microscope (Nikon TE300) images of GFP
positive cells (arrow, right) in the ependyma of the left lateral ventricle of
the rat
brain implanted with 200,000 EBM7 at 2 weeks. The brain section was 0.5mm
15 thick and the picture was taken at 40 times magnification.
Figure 11
GFP positive cells after 4 weeks in rat brain
Light (left) and fluorescent (right) microscope (Nikon TE300) images of
dispersed GFP positive cells (arrow, right) in the sub ependymal layer of the
left
20 lateral ventricle of the rat brain injected with 200,000 EBM7 at 4 weeks.
The brain
section was 0.5mm thick and the picture was taken at 40 times magnification.
Figure 12
GFP positive cells at 8 weeks in rat brain
Confocal images of GFP positive cells located in the caudate putamen of
25 the rat brain injected with EBM' at 8 weeks. Neural processes (arrows)
indicate
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
26
cell differentiation. The brain section was 0.5mm thick and the field of view
is
216x 144~,m .
Figure 13
GFP positive cells at 16 weeks in rat brain
Confocal image of GFP positive cells located in the thalamus of the rat
brain injected with EBM' at 16 weeks. The brain section was 0.5mm thick and
the
field of view is 216x144~,m.
Figure 14
The distribution of GFP positive cells (EBM' and EBM~°) in the rat
brain over
time
The black represents areas where cells were identified up to 4 weeks post
injection and the white represents regions of the brain where the cells were
located at times up to 16 weeks post injection. Note that, the two dimensional
slice
through the rat brain does not depict all the labeled regions.
Figure 15
Cell differentiation at 2 weeks in rat brain
Immunohistochemical analysis of cells in serial sections (7lum) of rat
caudate putamen 14 days after EBM' implantation. Sections were stained for the
expression of nestin (A), NF200 (B), GFP (C) and GFAP (D). The arrows
represent regions of GFP + NF200 co-expression (white arrows) and GFP +
GFAP co-expression (black arrow). Pictures were taken at 400 times
magnification.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
27
EXAMPLE 1
Formation of neurectoderm cells by directed differentiation of pluripotent
cells in vitro
Methods
Cell culture
ES cell lines E14 (Hooper et al., 1987) and D3 (Doetschman et al., 1985)
were used in this study. Routine culture of ES and EPL cells and production of
MEDII and sfMEDlI conditioned medium were as described in Rathjen et al.
(1999).
1 o Formation of GFP expressing D3 ES cell lines
D3 ES cells expressing enhanced green fluorescent protein (EGFP;
Clontech) under the control of the constitutive EF1 a promoter were formed by
transfection with pFIRES+EGFP (obtained from Dr. S. Dalton, Department of
Molecular Biosciences, Adelaide University, Australia). 5x106 D3 ES cells in
0.5 ml
HBS + glucose (20 mM HEPES, 140 mM NaCI, 5 mM KCI, 7 mM Na2HP04, 6 mM
glucose, 0.1 mM (3-mercaptoethanol ((3-ME)) were transfected by
electroporation
with 15 ~,g plasmid DNA (960 ~Fd; 210 V) using a BioRad Gene Pulser. Following
transfection, cells were allowed to recover at room temperature for 10 minutes
before plating and culturing at a density of 4.4 x 104 cell/cm2 in IC DMEM +
LIF
(Dulbecco's Modified Eagles Medium (DMEM; Gibco BRL #12800) supplemented
with 10% foetal calf serum (FCS; Commonwealth Serum Laboratories), 40 mg/ml
gentamycin, 1 mM L-glutamine, 0.1 mM J3-ME and 1000 units of LIF). After 24
hours the medium was changed to IC DMEM + LIF supplemented with 1.2 p,g/ml
puromycin (Sigma). Stable transformants were picked after 8 days of selection.
Single colonies were picked, expanded and assessed morphologically for the
expression of EGFP in pluripotent cells and differentiated derivatives. EGFP
fluorescence was detected on a Nikon TE300 inverted microscope using a FITC
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
28
filter.
Formation of cell aggregates
All cell aggregates were formed from single cell suspensions (1 x 105
cells/ml) of ES or EPL cells cultured in bacterial petri dishes. ES cell and
EPL cell
embryoid bodies (EB and EPLEB respectively) were formed as described in Lake
et al. (2000). EBM, cell aggregates formed and maintained in MEDII, were
formed
from ES cells aggregated in IC:DMEM (DMEM (Gibco BRL #12800) with 10%
foetal calf serum (FCS; Commonwealth Serum Laboratories), 40 mg/ml
gentamycin, 1 mM L-glutamine and 0.1 mM f3-mercaptoethanol (f3-ME))
1o supplemented with 50% MEDII. Aggregates were divided 1 in 2 on days 2 and
4,
and medium was changed on days 2 and 4 and then daily until collection. In
early
experiments 10-20 ng/ml FGF4 was added to the medium from day 4, however
this did not influence the outcome of differentiation and was omitted in later
experiments. The time in days from formation of aggregates was denoted by
~ 5 superscript with the day of formation denoted as day 0. For example, EBM 5
days
after formation are represented as EBMS.
For continued suspension culture of EB and EBM, aggregates on day 7
were transferred to serum free medium (50% DMEM, 50% Hams F12 (Gibco BRL
# 11765) supplemented with 1 x ITSS supplement (Boehringer Mannhiem) and 10
2o ng/ml FGF2 (Peprotech Inc.)).
For adherent culture, aggregates were seeded onto gelatin treated tissue
culture grade plasticware (Falcon) on day 7 of development in 500 p,1 DMEM
supplemented with 10% FCS (Commonwealth serum Laboratories). On day 8
medium was removed and replaced with 50% DMEM, 50% Hams F12
25 supplemented with 1 x ITSS (Boehringer Mannhiem).
Analysis of differentiation potential of cells within cellular aggregates
EB' and EBM' were seeded as described above and assessed on days 8,
10, 12 and 14 for the presence of neurons, identified morphologically by the
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
29
presence of axonal projections (and confirmed by the expression of NF200; data
not shown), and beating cardiocytes, identified morphologically by rhythmical
contraction of cells within the aggregate.
Gene expression analysis
s Cytoplasmic RNA was isolated from cellular aggregates using the following
method. Cellular aggregates were resuspended in 1 ml extraction buffer (50 mM
NaCI, 50 mM Tris.Cl pH 7.5, 5mM EDTA pH 8.0 and 0.5% SDS) and acid washed
glass beads (40 mesh; BDH) were added to the meniscus. Suspensions were
vigorously vortexed before the addition of a further 3 ml of extraction buffer
and
io 200 ~g/ml proteinase K (Merck) and incubation at 37°C for 60
minutes. One tenth
volume of 3M sodium acetate was added before the suspension was
phenol:chloroform extracted. The aqueous phase was added to an equal volume
of iso-propanol, chilled to -80°C for 30 minutes and the nucleic acids
pelleted by
centrifugation (Jouan bench centrifuge, 3,000 rpm). The pellet was resuspended
in DNase I digestion buffer (50 mM Tris.Cl pH 8.0, 1 mM EDTA pH 8.0, 10 mM
MgCI, 0.1 mM DTT) and 20 units of RNase free DNase I (Boehringer Mannhiem)
added. After incubation at 37°C for 60 minutes nucleic acids were
phenol:chloroform extracted and ethanol precipitated. Northern blot analysis
was
performed as described in Thomas et al. (1995). DNA probes were prepared from
2o DNA fragments using a Gigaprime labelling kit (Bresagen).'DNA fragments
used
were as described in Rathjen et al. (1999) and Lake et al. (2000).
Wholemount in situ hybridisation on cell layers was performed using the
method of Rosen and Beddington (1993) as described in Rathjen et al., (1999).
Antisense and sense probes for the detection of Oct4, FgfS and brachyury were
25 synthesised as described in Rathjen et al. (1999). Antisense Sox1 probes
were
synthesised by T3 RNA polymerase as run-off transcripts from plasmid #1022
linearised with BamM. Sox1 sense transcripts, used as controls, were obtained
from the same plasmid linearised with Hindlll and transcribed by T7 RNA
polymerase. Sox2 transcripts were generated from a 748 by AccllXbal cDNA
so fragment cloned into pBluescript SK (obtained from Dr. R. Lovell-Badge,
Division
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
of Developmental Genetics, National Institute for Medical Research, Mill Hill,
London). Transcripts were generated from Accl and Xbal linearised plasmid
transcribed with T3 (anti-sense) and T7 (sense) RNA polymerases respectively.
Histological analysis
5 EB4 and EBM4 were fixed with 4% PFA for 30 minutes before embedding in
paraffin wax and sectioning as described in Hogan et al., 1994. 7 p,m sections
were stained with haematoxylin:eosin as described by Kaufman, 1992 or with
Hoescht 22358 (5~,g/ml in PBS; Sigma) for 5 minutes.
Immunohistochemical Analysis
Cellular aggregates were fixed in 4% paraformaldehyde in PBS for 30
minutes, and dehydrated in sequential 30 minute washes in 50% ethanol and 70%
ethanol. Cells were rehydrated to PBS and permeabilised with RIPA buffer (150
mM NaCi; 1 % NP-40; 0.5% NaDOC; 0.1 % SDS) for 30 minutes, washed in PBS
and blocked in the appropriate blocking buffer as described below for 30
minutes.
~ 5 Primary antibodies, diluted in the appropriate blocking buffer, were added
and
incubated overnight at 4°C. After washing in PBS, aggregates were
incubated with
alkaline phosphatase conjugated, species specific secondary antibodies
directed
against the primary antibodies in 100 mM Tris.Cl (pH7.5), 100 mM NaCI, 0.5%
blocking reagent (Boehringer Mannheim). For alkaline phosphatase conjugated
2o secondary antibodies, cellular aggregates were washed in Buffer 2 (100 mM
Tris.Cl (pH 9.5), 100 mM NaCI, 5 mM MgCl2) and antibody conjugates were
detected enzymatically with NBT and BCIP (both Boehringer Mannheim) made up
in Buffer 2 according to the manufacturers instructions. Aggregates were
visualised on a Nikon TE300 using Hoffmann interference contrast optics. For
25 FITC conjugated secondary antibodies, cellular aggregates were washed in
PBS
and mounted in 80% glycerol containing 5 mg/ml propyl gallate (Sigma).
Aggregates were examined on a Nikon TE300 microscope using a FITC filter.
Nestin: Blocking buffer: 10% goat serum, 2% BSA in PBS. Primary
antibody: Developmental Studies Hybridoma Bank, reference Rat 401, used at a
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
31
dilution of 1:100. Secondary antibody: alkaline phosphatase conjugated goat
anti-
mouse IgG (affinity purified, Rockland) used at a concentration of 1:100.
N-Cam; Blocking buffer: 1 % FCS, 1 mg/ml BSA, 1 % Triton X 100 in PBS.
Primary antibody: Santa Cruz Biotech, SC-1507 used at a concentration of 1:20.
Secondary antibody: FITC conjugated goat anti-mouse IgM (~.-specific: Sigma)
used at a dilution of 1:700.
NF200: Blocking buffer: 10% goat serum, 2% BSA in PBS Primary
antibody: anti-neurofilament 200 (Sigma Immunochemicals N-4142) used at a
dilution of 1:200. Secondary antibody: alkaline phosphatase conjugated goat
anti-
1o rabbit IgG (ZyMaxTM grade, Zymed Laboratories Inc.)
Results
Formation of EPL cells from ES cells in suspension
Embryonic stem (ES) cells cultured in the presence of medium conditioned
by the human hepatocellular carcinoma cell line HepG2 (MEDII) have been shown
to form a second pluripotent cell population, EPL cells (Rathjen et al.,
1999). EPL
cells demonstrate morphology, gene expression, differentiation potential and
cytokine responsiveness distinct from ES cells but characteristic of the post-
implantation pluripotent cell population of the mouse embryo, primitive
ectoderm
(Rathjen et al., 1999.
2o ES cells can be aggregated in suspension culture. In the absence of
exogenous cytokines, such as LIF, aggregated ES cells form structures termed
embryoid bodies (EB), which recapitulate many aspects of cell differentiation
during early mammalian embryogenesis (Doetschman et al., 1985; Shen and
Leder, 1992. Outer cells form extraembryonic endoderm and derivatives while
inner cells undergo processes equivalent to formation of the proamnioatic
cavity
(Coucouvanis and Martin, 1995) and primitive ectoderm (Shen and Leder, 1992),
followed by pluripotent cell differentiation into differentiated tissues
derived from
all three germ layers.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
32
ES cells were aggregated in medium supplemented with 50% MEDII (EBM)
and compared to EB development. After 4 days cellular aggregates formed in the
presence of MEDII (EBM4) could be distinguished from EB4 by morphology.
Histological analysis of sectioned EB4 and EBM4 showed EBM4 to comprise a
s multi-cell layer of uniform thickness surrounding a single, internal area of
cell
death indicated by the presence of pyknotic nuclei (Figure 1A, B). No
morphologically distinct outer layer of cells reflecting the presence of extra-
embryonic endoderm could be detected at this or later stages of EBM
development. In contrast, EB4 were internally disorganised with sporadic,
multiple
1o foci.of cell death dispersed throughout the aggregates (Figure 1C, D). An
outer
layer of extraembryonic endoderm was apparent at low levels in EB4 and at
higher
levels in more advanced EB (data not shown).
EB2'4 and EBM2-4 were analysed by Northern blot (Figure 1 E) for the
expression of Oct4, a marker gene for pluripotent cells (Scholer et al.,
1990), and
15 FgfS, a gene up-regulated in pluripotent cells upon primitive ectoderm
formation
(Haub and Goidfarb, 1991 ). Oct4 expression was maintained at high levels
throughout these stages of EBM development indicating that pluripotent cell
differentiation had not commenced within these aggregates. High level Oct4
expression in EBM4 was accompanied by elevated FgfS expression, indicating
that
2o the pluripotent cells had formed primitive ectoderm. In contrast, highest
levels of
Oct4 and FgfS expression in EB were observed at days 2-3 and day 3
respectively. Downregulation of both genes in EB4 indicated that pluripotent
cells
within these aggregates had differentiated.
The distribution of pluripotent cells within aggregates was investigated by
25 wholemount in situ hybridisation of EB4 and EBM4 with Oct4 and FgfS
antisense
probes. Homogeneous expression of Oct4 (Figure 1 F) and FgfS (Figure 1 G)
within
and between individual EBM4 aggregates was consistent with the deduced
cellular
homogeneity of primitive ectoderm within these aggregates and persistence of
pluripotent cells to day 4. This contrasted with patchy expression of these
markers
3o within and between individual EB4 aggregates (Figure 1. I, J), consistent
with the
variable onset and progression of pluripotent cell differentiation within EB
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
33
described here and by others (Haub and Goldfarb, 1991 ).
The expression of brachyury, a marker for nascent mesoderm (Herrmann,
1991 ), was used to confirm the onset of mesodermal differentiation in the
aggregates. Brachyury expression was analysed in EBM2-4 and EB2-4 by Northern
blot (Figure 1 E) and in EBM4 and EB4 by wholemount in situ hybridisation
(Figure
1 H, K). In EB brachyury expression was upregulated on day 4 of development,
coincident with the loss of pluripotence in the aggregates. In contrast
brachyury
expression could not be detected by either method in EBM2~4, consistent with
the
maintenance of Oct4 expression and suggesting a lack of differentiation within
1 o these aggregates.
These results suggest that MEDII effected relatively homogeneous and
synchronous formation of EPL cells from ES cells in suspension. On day 4 of
development EBM comprise a homogeneous population of pluripotent cells that
have acquired primitive ectoderm-like gene expression with no detectable
associated differentiation.
MEDII has been shown to contain 50-100 units of human LIF (Rathjen et
al., 1999). LIF has been shown to retard the developmental progression of EB
in
vitro (Shen and Leder, 1992). ES cells aggregated and maintained in medium
supplemented with 100 units of L1F did not duplicate the morphology or gene
2o expression profile of EBM (data not shown), indicating the importance of
additional
secreted factors contained within MEDII (Rathjen et al., 1999) for EPL cell
induction.
Programmed formation of ectodermal and neurectodermal lineages by
pluripotent cell differentiation in vitro
Continued culture of EBM in medium containing 50% MEDII resulted in the
formation of cellular aggregates displaying an unusual and distinct
morphology. By
day 7 >95% of the cellular aggregates within the EBM population comprised a
convoluted cell monolayer as shown in Figure 2A. EBM' transferred to 50%
DMEM:50% Hams F12 supplemented with ITSS and 10 ng/ml FGF2 for a further
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
34
2 days of culture formed a population in which >95% aggregates comprised a
single stratified epithelial sheet (Figure 2B, C). Cellular aggregates of
similar
morphology were not detected within the EB' or EB9 populations although
equivalent cell layers could be detected within a proportion of individual
aggregates (data not shown).
Northern blot analysis of EB4-8 and EBM4-8 showed a down-regulation of
Oct4 in both populations (Figure 2D) suggesting differentiation of the
pluripotent
cells within both populations of aggregates. However, while Oct4 was
undetectable in EB after day 5, a low but consistent level of Oct4 expression,
4.2-
1 o fold lower than EBM~, could be detected in EBM on all days of development
after
day 5. EBM' were seeded onto gelatin treated tissue culture grade plasticware
in
DMEM containing 10% FCS and analysed after a further 24 hours culture (EBM8)
by wholemount in situ hybridisation with an Oct4 anti-sense probe. This
analysis
failed to detect cells expressing Oct4 at levels equivalent to pluripotent
cells
(Figure 2E), which suggested that the Oct4 expression detected by Northern
blot
analysis represented low level expression by the majority of cells within the
population and not expression by a small population of residual pluripotent
cells
within the aggregates.
As the morphology of EBM9 was clearly reminiscent of neurectoderm
(Figure 2C), the expression of a number of neural markers was analysed. EBM'
were seeded onto gelatin treated tissue culture grade plasticware in DMEM
containing 10% FCS and the medium was changed to 50% DMEM:50% Hams
F12 supplemented with ITSS and 10 ng/ml FGF2 after 16 hours. These
aggregates were analysed by in situ hybridisation for the expression of Sox1
and
Sox2. Soxl has been shown to delineate the neural plate and is expressed by
all
undifferentiated neural cells, while Sox2 shows a similar expression pattern
but is
expressed earlier in embryogenesis (Pevney et al., 1998). Seeded aggregates
were also analysed by immunohistochemistry using antibodies directed against
nestin, a neurofilament protein expressed in neural progenitor cells
(Zimmerman
3o et al., 1994) and N-Cam, a cadherin expressed within the neural system by
primitive neurectoderm, neurons and glia (Rutihauser, 1992). Widespread
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
expression of Sox1 and Sox2 was detected within seeded aggregates derived
from EBM' (Figure 3A, B). In accordance with the acquisition of neural gene
expression, both nestin and N-Cam were also expressed widely in these
aggregates (Figure 3C, 3D).
5 As a consequence of seeding, cells on the periphery of the seeded
aggregates differentiated spontaneously. Individual EBM' were seeded as
described above and assessed on days 8, 10 and 12 for the presence of beating
cardiocytes, a differentiated mesoderm derivative, and neurons, a
differentiated
ectoderm derivative. The differentiation of EBM was compared to EB (Figure 3E,
1o F). Consistent with the up-regulation of neural specific markers, and lack
of
brachyury expression, neurons could be seen in the differentiated products of
the
majority of EBM (91.33%). However, <2% of EBM formed beating cardiocytes. In
contrast, EB comprised a mixed population which differentiated into both
beating
cardiocytes (54.5%) and neurons (24.9%) on day 12 respectively.
~5 Gene expression and differentiation analyses indicate that continued
culture of EBM4, which comprise an homogeneous population of EPL cells, in the
presence of MEDII, programs differentiation of the pluripotent cells to an
ectodermal and neurectodermal fate. °The great majority of
differentiated cells at
day 9 expressed neural markers such as Soxl, Sox2, nestin and N-Cam, and
2o spontaneousdifferentiation resultedefficientformation of neurons.
in The
absence of brachyury expression failure seeded aggregates to
and of form
differentiatedmesodermal derivativesindicatedthat elevated ectodermal
differentiation was achieved at the expense of mesoderm formation. This
directed
differentiation to ectoderm/neurectoderm contrasts with the haphazard
25 differentiation observed in EB, and with the mesoderm-specific
differentiation
reported for EPLEB.
Programming neural pluripotent cell differentiation with MEDII overcomes
heterogeneity associated with EB differentiation of different ES cell lines
Experimental analysis using EB is restricted by variable differentiation of
so alternative ES cell lines (our unpublished data). Nine clonal ES cell
isolates
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
36
expressing EGFP were differentiated as EB or EBM. Individual cell aggregates
were seeded on day 7 and assessed for the formation of neurons on day 14
(Figure 4). All clonal fines formed neurons when differentiated as either EB
or
EBM. When differentiated as EB the formation of neurons varied between 4 and
28% of bodies, with an average of 15.64% +/- 2.54. This indicates that the
uncontrolled differentiation of pluripotent cells in EB is not consistent
between
different clonal ES cell isolates. All clonal lines responded to MEDII as
previously
described by formation of neurectoderm-containing aggregates. Neuron formation
was increased to >80% of aggregates, with an average of 92.13% +/- 1.944. This
1o result suggests that response to MEDII by differentiation to ectodermal
lineages is
an inherent property of ES cells and not restricted to a subpopulation within
the
ES cell population. Further, MEDII-directed differentiation of ES cells as EBM
overcame the inherent variability associated with EB differentiation and
resulted in
uniform, high level production of neurectoderm and neurons.
EPL cells differentiate to form neurons in response to MEDII
It has been previously reported that EPL cells form neurons poorly, if at all,
when differentiated as EB but form elevated levels of nascent and
differentiated
mesoderm (see International patent application PCT/AU99/00265, above). This
has been interpreted as reflecting disrupted signalling from visceral endoderm
or
2o visceral endoderm-derived ECM (Lake et al, 2000). EPL cells were formed
from
ES cells as described, and aggregated and cultured in suspension for 7 days in
either IC:DMEM (EPLEB) or IC:DMEM supplemented with 50% MEDII (EPLEBM).
On day 7, individual EPL cell embryoid bodies were seeded onto gelatin treated
tissue culture plasticware in IC:DMEM. On day 8 the medium was changed to
DMEM:F12 and embryoid bodies were cultured for a further 4 days before
microscopic inspection for the presence of beating cardiocytes and neurons.
As shown in figure 5A, EPL cell embryoid bodies formed beating
cardiocytes efficiently (35.25%), consistent with previous reports and gene
expression (Lake et al., 2000). In contrast, EPL cell embryoid bodies cultured
in
3o the presence of 50% MEDII exhibited drastically lower levels of beating
cardiocyte
formation (0.9%). Aggregation and differentiation of EPL cells in the presence
of
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
37
MEDII resulted in an up regulation in neuron formation from very low levels in
EPLEB (3.6%), to 83.73% in EPLEBM (Figure 5B). These data suggest that
signals contained within MEDII replace those deficient in the EPLEB
differentiation
environment to direct the pluripotent cells to an ectodermal/neural fate.
Conclusion
These results demonstrate that pluripotent cells can be programmed
specifically to an ectodermal and neurectodermal fate by factors within MEDII.
The ectodermal cells are formed in the absence of mesodermal cell types, and
exhibit a temporal pattern of gene expression equivalent to neurectoderm in
vivo.
1o In the embryo these cells are precursors for all neural lineages.
Results of further differentiation in vitro support the conclusion that
neurectoderm is formed at high levels and in the absence of mesodermal cells
by
EBM cultured in the presence of MEDII, since the neurectoderm can give rise to
terminally differentiated neural cell types at elevated levels, but not
terminally
~5 differentiated mesodermal cell types. Aggregates developed from EBM in
MEDII
are therefore enriched in undifferentiated neural cells.
The formation of neurectoderm described here does not rely on the addition
of chemical inducers, such as retinoic acid, or genetic manipulation to
promote
neural formation. Instead, it relies on biologically derived factors found
within the
2o conditioned medium MEDII. Neural progenitors formed in this manner are
thought
to be differentiated from pluripotent cells in a manner analogous to the
formation
of neural cells during embryogenesis and are therefore ideal for the
production of
differentiated neural cells useful for commercial, medical and agricultural
applications. Further, in contrast to the formation of limited neural lineages
by
25 chemical inducers such as retinoic acid, the identity of neural cell types
produced
using these methodologies is not likely to be developmentally restricted.
EXAMPLE 2
EBM comprise a homogeneous and synchronous population of ES cell-
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
38
derived neural progenitors
Methods
Cell culture and gene expression analysis
EB and EBM were aggregated and cultured as described in example 1.
s Gene expression analysis was as described in example 1. EBM which had been
analysed by whole mount in situ hybridisation staining were prepared for
histochemical analysis as follows. Stained EBM were fixed in 4% PFA overnight,
washed several times with PBS, 0.1 % Tween-20, treated with 100% methanol for
minutes and then isopropanol for 10 minutes. Bodies were then treated and
embedded as described in Hogan et ai. (1994).
DIG labelled Gbx2 riboprobes were generated from pG290 which contains
a 290 by PCR fragment from base 780 to base 1070 of the Gbx2 cDNA
(Chapman and Rathjen, 1995) cloned into pGEMT-easy (Promega). Antisense
and sense probes were transcribed from Sall or Styl cut pG290 with T7 or T3
RNA
polymerase respectively.
Flow Cytometry analysis
EB~° and EBM'° were collected and washed in PBS, then
disassociated by
incubating for 5 minutes in 0.5 mM EDTA/PBS followed by vigorous pipetting and
agitation to a single cell suspension. Cells were washed several times in PBS
2o before fixation with 4% PFA for 30 minutes. Cells were washed with 1 %
BSA/PBS,
resuspended at 1 x 106 cells/ml, and incubated with antibody directed against
N-
Cam (Santa Cruz Biotech, SC-1507) at a dilution of 1:2 for 1 hour. Cells were
washed with 1 % BSA/PBS before incubation with FITC conjugated goat anti-
mouse IgM (p,-specific: Sigma) used at a concentration of 1:100. FITC
conjugated
goat anti-mouse IgM was pre-adsorbed for 1 hour in 1 % BSA/PBS before use.
Cells were washed in PBS and fixed in 1 % PFA for 30 minutes. Data was
collected on 1 x 104 cells on a Benton Dickonson FACScan and analysis
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
39
performed using CeIIQuest 3.1.
Results
EBM comprise a homogeneous population of neural progenitor cells
Data presented in example 1 suggested that within the EBM population
approaching 100% of the cellular aggregates contained neural progenitor cells.
The number of cells within the population expressing neural specific markers
was
evaluated to assess the homogeneity of differentiation. EBM9 were probed by
wholemount in situ hybridisation for Soxl and Sox2 expression and histological
sections were examined for homogeneity of expression. Representative sections
io (Figure 6A, B) showed that EBM9 comprised a morphologically uniform
population
of cells equivalent to the neurectoderm-like monolayer described in example 1,
in
which each cell stained positive for expression of Soxl and Sox2.
To enable comparative quantitation of neurectoderm formation,
EBM'° and
EB'° were disaggregated to a single cell suspension, labelled
1s immunocytochemically with antibodies directed against N-Cam, a cell
adhesion
molecule expressed strongly in the nervous system (Bonn et al., 1998) and
analysed by FACS analysis (Figure 6C). 95.7% of cells from EBM'° were
scored
positive for N-Cam expression, demonstrating relatively uniform
differentiation of
these aggregates to neural lineages. In comparison, only 42.13% of cells from
2o EB'° expressed N-Cam, consistent with the established heterogeneity
of ES cell
differentiation within this system.
Neural formation within EBM is relatively synchronous and reflects the
temporal formation of neural lineages in the embryo
During embryogenesis formation of neurectoderm is characterised by
25 progressive alterations in gene expression. The neural plate, which
contains the
earliest neural precursors, is characterised by expression of Sox1 within a
group
of cells on the anterior midline of the embryo (Pevney et al., 1998). This
population of cells also expresses the homeobox gene Gbx2 (Wassarman et al.,
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
1997). With continued development the neural plate folds at the midline and
the
outer edges close to form the neural tube. Soxl expression is maintained after
tube closure but Gbx2 expression is down regulated in the majority of cells of
the
neural lineage and persists only in a restricted population of cells at the
mid
5 brain/hind-brain boundary (Wassarman et al., 1997).
Wholemount in situ hybridisation of seeded EBM8, EBM9 and EBM1°
was
used to investigate the temporal regulation of Sox1 and Gbx2 in during EBM
progression. At day 8, Sox1 was expressed in approximately 50% of the cells
within the seeded aggregates (Figure 7A). The extent of expression was
increased
1o in EBM9, and evident in the majority of cells within the aggregates on both
day 9
and 10 (Figure 7 B, C), indicating homogeneous formation of neurectoderm. Gbx2
was also expressed in approximately 50% of the cells within the seeded
aggregates at day 8, but was less abundant in EBM9, and was virtually
undetectable in EBM'° (Figure 7 D,E,F). The loss of Gbx2 expression in
1s aggregates in which Soxl expression persists recapitulates the temporal
regulation of this gene in the developing neural tube of the embryo. Rapid
downregulation of Gbx2 expression indicates relative synchrony of the EBM
differentiation system, and suggests EBM$ represent cells equivalent to the
time of
neural tube closure in vivo..
20 Conclusion
Cellular analysis of gene expression indicates that differentiation of ES
cells
as EBM results in the formation of a homogeneous population of neural
progenitors. Temporal regulation of gene expression indicated relative
synchrony
of differentiation within and between EBM aggregates, and was conserved in
25 many aspects with formation of the ectodermal/neurectodermal lineages
during
mammalian embryogenesis. EBM differentiation therefore recapitulates
progressive formation of neural plate and neural tube, progenitors for the
entire
nervous system, from pluripotent cells in the mammalian embryo.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
41
EXAMPLE 3
Gene expression in ES cell-derived neurectoderm induced by MEDII
indicates that cells are not positionally specified
Methods
Cell culture and gene expression analysis
EB and EBM were formed and cultured as described in example 1. Gene
expression analysis was as described in example 1.
PCR analysis of neurectoderm gene expression
Total RNA was extracted from cell aggregates as described in Rathjen et al.
(2000). cDNA was synthesised from l,ug of total RNA using SuperscriptTM II
First-
Strand Synthesis System for RT-PCR (Gibco BRL) following the manufacturers
instructions. PCR was performed using Platinum PCR Supermix (Gibco BRL)
following the manufacturers instructions. Reactions were performed in a
capillary
thermocycler (Corbett Research), with cycling parameters as follows;
denaturing
94°C, 10 seconds, annealing 55°C, 10 seconds and extension
72°C, 60 seconds.
Cycling times were determined for each primer set to be within the exponential
phase of amplification. Primers for amplification of actin, En-1, Hoxa7 and
Otx1
have been described previously (Okabe et al., 1996). Primer sepuences and the
length of amplified products were as follows:
2o En2 (512bp)
(5' AGGCTCAAGGCTGAGTTTCA 3': 5' CAGTCCCCTTTGCAGAAAAA 3'),
HoxB 1 (501 bp)
(5' CGAAAGGTTGTAGGGCAAGA 3'; 5' CGGTCTGCTCAGTTCCGTAT 3'),
Shh (502bp)
(5' GGAACTCACCCCCAATTACA 3'; 5' GAAGGTGAGGAAGTCGCTGT 3'),
Mash 1 (482bp)
(5' CGTCCTCTCCGGAACTGAT 3'; 5' TCCTGCTTCCAAAGTCCATT 3'),
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
42
Nkx2.2 (514bp)
(5' CTCTTCTCCAAAGCGCAGAC 3'; 5' AACAACCGTGGTAAGGATCG 3'),
Krox20 (502bp)
(5' GGAGGGCAAAAGGAGATACC 3'; 5' GGTCCAGTTCAGGCTGAGTC 3'),
Pax3 (502 bp)
(5' CGTGTCAGATCCCAGTAGCA 3'; 5' CCTTCCAGGAGGAACTACCC 3'),
Pax6 (500 bp)
(5' AGTTCTTCGCAACCTGGCTA 3'; 5' TGAAGCTGCTGCTGATAGGA 3').
PCR products were analysed on 2% agarose gels and visualised with
1o ethidium bromide.
Results
In vivo the neural tube acquires region specific gene expression with
respect to both the rostral/caudal and dorsal/ventral axes, indicative of
restricted
developmental fate. Expression of neural tube markers expressed in the neural
15 tube shortly after closure in restricted anterior, posterior and ventral
domains was
analysed in EBM9, which expresses Sox1 and Sox2 but not Gbx2, equivalent to
closed neural tube in vivo. The ectodermal expression patterns of the analysed
genes are described in table 1. Gene expression in EBM9 was analysed by RT-
PCR or in situ hybridisation (Gbx2) and compared to EB9 and EPLEB9, which
zo comprise a mixed population of cells containing ectoderm and mesoderm, and
a
mesoderm-enriched, ectoderm deficient (International patent application
PCT/AU99/00265, above) population respectively. RNA from d10 embryos was
used as a positive control.
As shown in figure 8, the expression of genes marking presumptive
2s forebrain (Nkx2.2), individual rhombomeres of the hindbrain (Hox8l,
Krox20),
midbrain/hindbrain boundary (Gbx2), posterior ectoderm and trunk (Hoxa~, and
ventral neural tube (Shh) was not detected in EBM9. Furthermore, the absence
of
Shh expression that is required for specification of ventral identity in the
neural
tube (Echelard et al., 1993), indicates that the signalling pathways leading
to
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
43
ventralisation of the neural tube are not active in the EBM system.
Enl, En2 and Otx1 are expressed in a broad region of the anterior neural
tube around the time of closure and subsequently within defined regions of the
midbrain. These genes were expressed in EBM9 as was Mashl, a gene
s expressed in domains of the neuroepithelum of the forebrain, midbrain and
spinal
cord between days 8.5 and 10.5 (Guillemot and Joyner, 1993). Similarly Pax3
and
Pax6 were expressed in EBM9. While these genes are restricted positionally to
dorsal and ventral aspects of the neural tube respectively, evidence from
chick
(Goulding et al., 1993) suggests that both these genes are expressed widely in
neural tube before their expression domains become restricted in response to
ventral specification.
Consistent with the described mesodermal differentiation within EPLEB,
expression of neural-specific genes in these aggregates was absent or detected
at
very low levels. Where expression was detected it is ascribed to additional,
non-
~5 neural sites of expression described in the embryo, for example, Shh
expression
in the prechordal plate (Marti et a., 1995), HoxBl expression in primitive
streak
mesoderm (Studer et al., 1998), Hoxa7 expression in the primordia of the
vertebrae and ribs (Mahon et al., 1988), Pax3 expression in newly formed
somites
and later in the dermomyotome (Goulding et al., 1991) and Enl expression in
2o tissues of somitic origin (Davis and Joyner, 1988).
Gene expression was much more promiscuous in EB9 which expressed
significant levels of all positionally restricted neural patterning genes.
This
indicates that stochastic differentiation within the EB system is accompanied
by
cryptic positional specification. Use of MEDII for pluripotent cell
differentiation
25 appears to overcome the positional specification inherent within the EB
differentiation system, and as a consequence produces neural progenitor cells
which are less likely to be developmentally restricted. This may be related to
the
lack of interaction with other cell types such as visceral endoderm and
mesoderm
which are not formed in the EBM system.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
44
Conclusion
Analysis of neural tube markers with spatially restricted expression in EBM
indicated that the neural progenitor cells within these aggregates have not
acquired positional specification. Further, signalling systems required for
positional
specification are not operative. This suggests that neural progenitor cells
formed
from pluripotent cells in response to MEDII are unlikely to be developmentally
restricted. EBM therefore provide a superior system for the generation of
neural
progenitors from pluripotent cells compared to chemical induction or
differentiation
within EB in which positionally restricted genes are expressed.
1o EXAMPLE 4
Differentiation of ES cell-derived neurectoderm can be directed to neural
crest or glial lineages in response to exogenous signalling
Methods
Cell culture, in situ hybridisation and immunohistochemistry were as
~ 5 described in example 1.
Sox 10 probes were transcribed from pSox10E.1 (obtained from Dr. Peter
Koopman, IMB, Brisbane, Australia). Anti-sense and sense probes were
transcribed from Hindlll or BamHl cut pSox10E.1 with T7 or T3 RNA polymerase
respectively,
2o Anti-glial fibrillary acidic protein (GFAP: Sigma #G9269) was used at a
dilution of 1/1000 and detected with alkaline phosphatase conjugated goat anti-
rabbit IgG (ZyMax grade, Zymed Laboratories Inc.) used at a dilution of
1/1000.
Cells were blocked for 30 minutes in 10% goat serum, 2% BSA in PBS.
Neural crest formation
25 EBM9 were collected, washed in PBS, treated with 0.5 mM EGTA pH 7.5 for
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
3 minutes, washed in PBS and disaggregated to small clumps (20-200 cells) by
trituration. Cell clumps were allowed to settle and single cells liberated
during
trituration were removed with the supernatant before plating onto tissue
culture
grade plasticware which had been coated with cellular fibronectin (1 p,g/cm2;
5 obtained from M. D. Bettess, Department of Biochemistry, Adelaide
University,
Australia) and allowed to dry. Cells were cultured in Hams F12 containing 3%
FCS
and 10 ng/ml FGF2 and supplemented with either 0.1 % 25 ,uM staurosporine
(Sigma) in DMSO (final concentration, 25 nM) or 0.1 % DMSO. Cellular
aggregates
were allowed to differentiate for 48 hours before fixation in 4% PFA for 30
10 minutes.
Glial lineage formation
EBM9 were collected, washed in PBS and broken into small clumps as
described above. Cell clumps were transferred to tissue culture plastic
pretreated
with poly-L-Ornithine as per manufacturer's instructions (Sigma) and cultured
in
15 50% DMEM, 50% F12, 1 x ITSS, 1 x N2 supplement (Sigma), 10 ng/ml FGF2, 20
ng/ml EGF (R&D Systems Inc.) and 1 p,g/ml Laminin (Sigma). Medium was
changed daily. After 5 days medium was changed to 50% DMEM, 50% F12, 1 x
ITSS, 1 x N2 supplement (Sigma), 10 ng/ml FGF2 and 10 ng/ml PDGF-AA (R&D
Systems Inc.). Cells were fixed for analysis on day 7 or 8 of culture by
treatment
2o with 4% PFA for 30 minutes.
Results
Spontaneous differentiation of EBM leads to formation of multiple cell types
including morphologically identifiable neurons and glia (data not shown).
Neural
tube explants from the quail have been shown to form neural crest in response
to
25 the protein kinase C inhibitor staurosporine (Newgreen & Minichiello,
1996). EBM9
were dissociated to clumps and cultured in medium supplemented with either
0.1 % of 25 ,uM staurosporine in DMSO (final concentration, 25 nM) or 0.1
DMSO. Cell types produced were assessed morphologically and for expression of
the mammalian neural crest marker, SoxlO (Southard-Smith et al., 1998). Within
3o three hours of seeding into medium containing staurosporine, EBM explants
were
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
46
surrounded by a halo of differentiating cells (Fig. 8A) which appeared
morphologically indistinguishable from avian neural crest cells produced from
avian neural tube in response to staurosporine (Newgreen & Minichiello, 1996).
The phenotypic alteration induced by staurosporine was homogeneous across the
s population of aggregates, and was not observed in EBM explants cultured in
medium containing 0.1 % DMSO (Figure 8B). This differentiation was observed in
the presence of 1 nM to 100 nM staurosporine, although uniform differentiation
required concentrations greater than 10 nM (data not shown). After 48 hours
culture, EBM explants were analysed by in situ hybridisation for expression of
1o SoxlO (Figure 8C) which is up regulated on the formation of mouse neural
crest in
vivo (Southard-Smith et al., 1998). SoxlO expression was observed in all cells
formed in response to staurosporine, but not in those cultured in medium
containing 0.1 °l° DMSO.
ES cell derived neural stem cells have been shown to differentiate to glial
15 lineages in response to sequential culture in EGF/laminin and PDGF-AA
(Brustle
et al., 1999). EBM9 explants were cultured in medium containing FGF2 (10
ng/ml),
EGF (20 ng/ml) and laminin (1 ,~g/ml). After 5 days EGF and laminin were
omitted
from the medium and PDGF-AA was added to a concentration of 10 ng/ml for a
further 2-3 days. Cells were not trypsinised or triturated during
differentiation.
2o Cultures were analysed by immunohistochemistry for the expression of glial
fibrillary acidic protein (GFAP), a marker expressed by both glial precursors
and
differentiated astrocytes (Landry et al., 1990). Differentiation of EBM9
explants in
response to EGF/laminin and PDGF-AA follows a homogeneous morphological
progression depicted in Figure 8E-G. >95% of differentiated cells formed from
2s EBM explants using this protocol expressed GFAP (Figure 8H), indicating
homogeneous differentiation to cells of the glial lineage.
Conclusion
Differentiation of neurectoderm derived from pluripotent cells in response to
MEDII can be directed to neural crest or glial fates by the additional of
biologically
so relevant exogenous signalling molecules. This indicates that neurectoderm
derived by differentiation of pluripotent cells in response to MEDII has
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
47
differentiation properties equivalent to neurectoderm in vivo.
Homogeneous, lineage specific differentiation to both lineages was
achieved. Neural crest cells are precursors in vivo to craniofacial bone and
cartilage, and several different types of neurons including sensory cranial
nerves,
parasympathetic, sympathetic and sensory ganglia. Terminally differentiated
glial
cells are expected to have wide ranging biological and medical applications
including the treatment of neuronal diseases using cell and gene therapy.
Unpatterned neural progenitors produced by differentiation of pluripotent
cells in response to MEDII can therefore be used as a superior substrate for
directed formation of ectodermal lineages of medical importance.
EXAMPLE 5
Neural progenitors derived by differentiation of pluripotent cells in response
to MEDII are capable of incorporation and differentiation in the rat brain.
Methods:
Cell culture and preparation
D3 ES cells expressing EGFP were formed by the transfection of D3 ES
cells with pFIRES+EGFP (Example 1), and used throughout. Routine tissue
culture and maintenance of ES cells was as described in Example 1. EBM were
formed and cultured as described in Example 1.
2o For injection, EBM' and EBM'° were allowed to settle and media was
aspirated. Cell aggregates were washed with 10m1 PBS, and treated with 0.5mM
EGTA pH7.5 for 3 minutes. This was removed and aggregates were treated with
3m1 of trypsin (0.05%, Gibco, UK) /EDTA (0.5mM, Gibco, UK) for 1 minute. 1 ml
of
FCS (Gibco, UK) was then added and cells were dissociated by vigorous
pipetting.
Cells were collected by centrifugation and re-suspended to 1 x 10' and 1 x 10$
cells/ml in Dulbecco's MEM (DMEM). The cell suspensions were chilled on ice
for
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
48
no more than 2 hours before implantation.
Injection procedure
Sprague Dawley rats no older than 8 hours were chilled on ice for up to 20
minutes to reduce their metabolic rate and reduce movement. 2p,1 of cell
suspension or DMEM was injected into the left lateral ventricle.
A sterile 5p,1 positive displacement gas chromatography syringe (SGE, UK),
modified by ~ reducing the length of the needle to 2cm, was used for
injection.
Coordinates for the location of the left lateral ventricle were obtained from
Paxinos
et al, 1994. The needle was introduced at a 45° angle into the skull
2mm above
the left eye socket, to a depth of approximately 0.5cm, and the cells were
implanted. Successful injection into the lateral ventricle was identified by
displacement of 2p.1 of clear CSF from the injection site following
introduction of
the cells. The left rear toe was clipped for identification purposes. The
newborn
rats were placed under a heat lamp for 15 minutes to reset their core
temperature,
reunited with their mothers and observed daily.
Assessment of cellular incorporation
Rats were sacrificed by cervical dislocation at 1, 2, 4, 8 and 16 weeks after
implantation of cells.
Brains were removed and fixed for 4 hours in 4% para-formaldehyde before
2o dehydration. Brains were immersed in 50% ethanol for 4 hours then 70%
ethanol
for 4 hours. Brains were stored at 4°C in 70% ethanol inside tissue
processing
cassettes (Bayer, Australia).
All brains were sectioned horizontally using a vibratome (Lancer, 1000).
0.5mm sections were visualised under the fluorescent (Nikon TE300, FITC,
excitation 465/95 emission 515/55nm, with the dichroic mirror set at 505nm) or
confocal (Bio/Rad MRC 1000uv confocal system attached to a Nikon Diphot 3000
microscope) microscope. For confocal microscopy, excitation and emission
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
49
bandwidths were 488/8 nm and 522/35 nm respectively and images were taken
using a water immersion x 40 lens with a numerical aperture of 1.15.
Sections containing green fluorescent regions were embedded in paraffin
wax as follows; tissue was dehydrated through 80% ethanol for 1 hour, followed
by 95 % ethanol for 1.5 hours, then 100% ethanol for 4 hours. Sections were
then
immersed in Histoclear (Ajax, Australia)/ethanol (50%:50%) for 1 hour, then
100%
Histoclear for 4 hours, followed by paraffin wax (Oxford labware, USA) at
60°C for
2 hours and then paraffin wax under vacuum (15-20KPa) for a further 2 hours.
The 0.5mm brain slices were removed -from the molten wax bath and placed on a
1o hot plate at 60°C. A pre-warmed mould was half filled with molten
wax. The lid of
the cassette was removed and tissue was positioned at the bottom of the mould
and then transferred to a cold (-20°C) surface. The mould was removed
from the
cold surface after the wax at the bottom solidified. The bottom of the
cassette was
placed on top of the base mould and tissue and the mould was filled with wax
and
~5 allowed to solidify. The wax block containing tissue was separated from the
mould
before thin sections (7~,m, Leica RM2135 Microtome) were cut. Using fine
paintbrushes, the sections were floated on the surface of a water bath heated
at
45-55°C. These sections were floated onto superfrost+ slides (Bayer,
Australia)
and allowed to dry completely prior to immunohistochemical analysis.
2o Immunohistochemistry.
Paraffin wax embedded 7~,m thick brain sections were washed with
Histoclear twice for 4 minutes, in order to remove paraffin wax from the
tissue.
The slices were then treated with graded ethanol (100%, 80% and 70% each for 2
minutes) before washing with PBS twice for 5 minutes. The tissue was then
25 permeablised with 0.1% triton-X100 {Sigma, UK), in PBS for 5 minutes and
treated with blocking solution (10% goat serum, Gibco, UK, 3% bovine serum
albumin, Roche, Germany) in PBS for 30 minutes at room temperature.
Antibodies for Nestin and NF200 were used as previously described in
Example 1. Use of other antibodies is outlined below.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
GFP: Blocking buffer containing primary antibody to GFP raised in mouse
and used at 1 in 1000, Clonetec, USA. Secondary antibody: Anti-mouse IgG
conjugated to alkaline phosphatase, 1 in 4000, Rockland, USA.
GFAP: Blocking buffer containing primary antibody to glial fibrilliary acidic
5 protein, GFAP raised in rabbit used at 1 in 500, Sigma, UK; Secondary
antibody:
Anti-rabbit IgG conjugated to alkaline phosphatase, 1 in 500, Zymed, USA.
Primary antibodies were added to the slices overnight at 4°C. The
tissue
sections were then washed 3 times for 30 minutes at room temperature with PBS,
and then with buffer 1 (Tris-HCI 100mM, pH 7.5, NaCI 150mM) for 10 minutes at
1o room temperature. The secondary antibodies were diluted in buffer 1
containing
0.5% blocking powder (Roche, Germany) and added to the sections for 2 hours at
room temperature. The tissue was then washed in buffer 1 twice for 15 minutes
and then in buffer 2 (Tris-HCI 1 OOmM pH9.5, NaCI 1 OOmM, MgCl2 5mM, with 0.1
Tween 20, Sigma, UK for 10 minutes). Development solution (buffer 2 with 0.2%
15 Nitroblue tetrazolium/5-Bromo-4-chloro-4-indolyl phosphate, Roche, Germany
and
5mM levamisole, Sigma, UK) was then added to the tissue and the dark purple
colour was allowed to develop overnight in the dark.
Results
A total of 72 rats were used in the study and their treatment is summarised
2o in table 1.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
51
TABLE 1
Implantation of EBM' and EBM1° in rat brains showing numbers of
rats,
number of cells implanted, the cell type implanted or control and the time of
brain
harvest.
Number of rats Number of cellsCell type Brain harvest
8 200,000 EBM' 4 at 1 week
4 at 2 weeks
8 20,000 EBM' 4 at 1 week
4 at 2 weeks
8 Non injected4 at 1 week
4 at 2 weeks
7 200,000 EBM "' 4 at 1 week
3 at 2 weeks
8 DMEM 4 at 1 week
4 at 2 weeks
14 200,000 EBM' 5 at 4 weeks
5 at 8 weeks
4 at 16 weeks
14 200,000 EBM 5 at 4 weeks
5 at 8 weeks
4 at 16 weeks
5 DMEM 2 at 4 weeks
2 at 8 weeks
1 at 16 weeks
.
Neural progenitors derived by differentiation of pluripotent cells in response
to
MEDII persists and disperses in the rat brain.
All the injections of the cells were performed in the absence of
immunosuppression.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
52
After one week GFP positive cells were identified in all implanted rats,
predominantly located around the implantation site as multiple clumps (~50-300
cells per clump) within the left lateral ventricle wall. Rats injected with
20,000 cells
had fewer GFP positive clumps of cells compared with rats implanted with
s 200,000 cells. All brains harvested at 1 week showed no abnormal development
when compared with the un-injected and DMEM injected control animals.
After 2 weeks, GFP positive cells were still present in the left lateral
ventricle wall of all implanted rats, however additional regions of GFP
positive cells
in other sites such as the 3rd ventricle wall and the cerebral aqueducts were
identified, indicating that the cells had moved within . the cerebrospinal
fluid.
Implanted cells at 2 weeks formed multiple clumps per brain, each clump
consisting of approximately 50 to 300 GFP positive cells within the walls of
the
ventricular system (a typical clump is shown in Fig. 10). No apparent
difference
between the implantation of EBM' or EBM'° cells in the brain was
observed at 1
and 2 weeks.
After 4 weeks, GFP positive cells were found in all implanted brains and
they had dispersed widely along the ventricle walls. Many cells had moved into
the
sub-ependymal layer (Fig. 11 ). No difference was observed between the
distribution of EBM' or EBM'° implants.
2o At 8 and 16 weeks after implantation, GFP positive cells could no longer be
identified around the ventricle walls and were difficult to find. This may be
due to
dispersal of the cells within the brain or represent a loss of cells due to
immuno
rejection. In all the brains examined in both EBM' and EBM'° groups at
8 and 16
weeks, GFP positive cells were identified in deeper brain regions such as the
25 thalamus, (Fig. 12), frontal cortex, caudate putamen (Fig. 13) and
colliculus,
midbrain and in these sites in the un-injected right side of the brain. There
were no
apparent differences in the distribution of EBM' and EBM'° at either 8
or 16
weeks. The distribution of implanted GFP positive cells within rat brains over
16
weeks is shown in Fig. 14. The black areas represent the location of the GFP
3o positive cells at time points up to 4 weeks and the white at later times up
to 16
weeks. The cells were initially located within the CSF, then incorporated into
the
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
53
ependyma and were later found in brain regions between the main ventricles and
the ventricular canals.
Neural progenitors derived by differentiation of pluripotent cells in response
to MEDII differentiates in rat brain
Using confocal microscopy cellular processes (Fig. 13 arrows), were
identified at 8 weeks in rats implanted with EBM', which was indicative of
differentiation to neurons or glia. To further assess neural differentiation,
thin
serial sections were taken from a GFP positive brain region for
immunohistochemical analysis to assess gene expression. Fig. 15 shows serial
1o sections from a GFP positive region located in the caudate putamen of a rat
injected with EBM' cells after 2 weeks. Serial sections were stained for
nestin (Fig.
15A), NF200 (Fig. 15B), GFP (Fig. 15C) and GFAP (Fig. 15D). Fig 15A shows
that the GFP positive cells did not express the neural precursor nestin,
however
nestin was expressed in EBM (Example 1 ). This indicates that the implanted
cells
had differentiated in the rat brain. Serial sections of this GFP positive
region
indicated some cellular locations were immunoreactive for both GFP and the
glial
cell marker GFAP (Fig. 15D) and other cellular locations that were
immunoreactive
for both GFP and the neural marker NF200 (Fig. 15B). These data indicate that
the implanted neural progenitor cells had differentiated into glia and neurons
2o respectively.
Safety
Minimal trauma to the animals was maintained throughout the study and
there was no procedure-induced mortality or infection. However, a single rat
injected with 200,000 EBM' cells developed a fieratoma or a teratocarcinoma at
one month and another had obvious hydrocephalus. The hydrocephalus was
shown to be due to blockage of CSF drainage due to cell clumping around the
3ra
ventricle. No tumors were identified in the rats implanted with EBM1°
and there
was only one tumor out of 30 rats implanted with EBM'.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
54
Conclusions
These data show that neural progenitors derived by differentiation of
pluripotent cells in response to MEDII can incorporate, differentiate and
disperse
in the rat brain. The neural progenitors derived by differentiation of
pluripotent
cells in response to MEDII are therefore potentially of use for the
replacement of
damaged or dysfunctional brain cells in conditions such as Parkinson's
disease,
dementia, central ischaemic injury resulting from trauma or stroke, spinal
injury
and movement disorders.
TABLE 2
1 o Summation of the ectodermal expression patterns of positionally specified
neural markers
Gene Ectodermal expression pattern in vivo Reference
Enl Detected on day 8.0 of development Davis and Joyner
in a neural
folds at the level of the foregut pocket.1988
Expression persists at the midbrain/hindbrain
boundary
En2 as for En1 Davis and Joyner
1988
Gbx2 Pan neural expression occurs prior Wassarman et
to neural
tube closure (d 7.5). Expressed caudala1.1997
to
midbrain at d9.5, and later in the
forebrain.
Hoxa7 Expressed in the posterior ectoderm Mahon et al.
and the
trunk 1988
HoxBl Expressed with Rhombomere 4 Studer et al
1998
Krox20 Expression is established in the earlyNieto et al.
neural 1991
plate (d8.0) in a single domain and
then in a
second more posterior domain (d8.5).
These
domains coincide with the later position
of
rhombomeres 3 and 5 respectively.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
Gene Ectodermal expression pattern in vivo Reference
Otx1 First expressed in d8.5 embryos in Simeone et al.
a large region
of the anterior neural tube. By d9-d10,1993
the
posterior boundary of expression coincides
with
the mesencephalon.
Mashl Expressed initially in domains of the Guillemot and
neuroepithelium encompassing forebrain,Joyner 1993
midbrain and spinal cord at 8.5 dpc.
Expression
is later broadened and is found in
the ventricular
zone of ali regions of the brain.
Nkx2.2 Nypothalamic and thalamic regions of Price et al.
the 1992
developing forebrain.
Pax3 First expressed in 8.5 day embryos Goulding et
in the dorsal al.
region of the neural groove and recently1991
closed
neural tube. In the trunk expression
occurred just
prior to neural tube closure.
Pax6 First expressed at d8.0 in the forebrainWalther and
and
hindbrain, and along the entire anteroposteriorGruss 1991
axis of the spinal cord. After neural
tube closure.
Expression is restricted to the ventral
ventricular
zone.
Shh Initially detected in the ventral midbrainMarti et al
1995
expression extends rostrally and caudally
to
encompass a strip of ventral tissue
from the
rostral limit of the forebrain to the
caudal regions
of the spine.
Sox1 Pan specific neural marker Pevney et al.
1998
Sox2 Pan specific neural marker Pevney et al.
1998
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
56
REFERENCES
Anderson D.J. (1989). The neural crest cell lineage problem: neuropoiesis?
Neuron 3, 1-12.
Bain G., Kitchens D., Yao M., Huettneer JE., Gottlieb D1., (1995) Embryonic
stem cells express neuronal properties in vitro. Dev Biol 168, 342-357.
Bjornson C.R., Rietze R.L., Reynolds B.A., Magli M.C. and Vescovi A.L.
(1999). Turning brain into blood: a hematopoietic fate adopted by adult neural
stem cells in vivo. Science; 283, 534-537.
Brustle O., Jones K.N., Learish R.D., Karram K., Choudhary K., Wiestler
1o O.D., Duncan I.D. and McKay R.D. (1999). Embryonic stem cell-derived glial
precursors: a source of myelinating transplants. Science. 285, 754-756.
Chapman, G. and Rathjen, P.D. (1995). Sequence and evolutionary
conservation of the murine Gbx-2 homeobox gene. FEBS Letters 364,289-292.
Coucouvanis, E. and Martin, G. R. (1995). Signals for death and survival: a
~5 two-step mechanism for cavitation in the vertebrate embryo. CeIl83, 279-
287.
Davis, C. A. and Joyner, A. L. (1988). Expression patterns of the
homeobox-containing genes En-1 and En-2 and the proto-oncogene int-1 diverge
during mouse development, Genes Dev. 2, 1736-1744
Doetschman, T. C., Eistetter, H., Katz, M., Schmidt, W. and Kemler, R.
20 (1985). The in vitro development of blastocyst derived embryonic stem cell
lines:
formation of visceral yolk sac, blood islands and myocardium. J. EmbryoG Exp.
Morph. 87, 27-45.
Echalard, Y. Epstein, D. J., St-Jacques, B., Shen, L., Mohler, J., McMahon,
A. P. (1993). Sonic Hedgehog, a member of a family of putative signalling
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
57
molecules, is implicated in the regulation of CNS polarity. Ce1175, 1417-1430.
Goulding, M. D., Chalepakis, G., Deutsch, U., Erselius, J. R. and Gruss, P.
(1991 ). Pax-3, a novel murine DNA binding protein expressed during early
neurogenesis. EMBO J. 10,1135-1147.
Guillemot, F. and Joyner, A. L. (1993). Dynamic expression of the murine
Achaete-Scute homologue Mash-1 in the developing nervous system. Mech. Dev.
42, 171-185.
Haub, O. and Goldfarb, M. (1991 ). Expression of the fibroblast growth
factor-5 gene in the mouse embryo. Development 112, 397-406.
Hebert, J. M., Basilico, C.~ Goldfarb, M., Haub, O. and Martin G. R. (1990).
Isolation of cDNAs encoding four mouse FGF family members and
characfierisation of their expression patterns during embryogenesis. Dev.
Biol.
138, 454-463.
Herrmann, B. G. (1991 ). Expression pattern of the Brachyury gene in
~5 whole-mount TWiS~Twis mutant embryos, Development i 13, 913-917.
Hogan, B., Beddington, R., Constantini, F. and Lacy, E. (1994).
Manipulating the Mouse Embryo: A Laboratory Manual. pp. 330-335. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, New York.
Kaufman, M. H. (1992). The atlas of mouse development. Academic Press
2o Limited, London.
Lake, J., Rathjen, J., Remiszewski, J., and Rathjen, P.D., (2000).
Reversible programming of pluripotent cell differentiation. J Cell Sci. 113,
555-
566.
Landry, C. F., Ivy, G. O. and Brown, 1. R. (1990). Developmental expression
25 of glial fibrillary acidic protein mRNA in the rat brain analyzed by in
situ
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
58
hybridisation. J. Neurosci. Res. 25, 194-203.
Li, M., Pevny, L., Lovell-Badge, R. and Smith, A. (1998). Generation of
neural precursors from embryonic stem cells by lineage selection. Current
Biol. 8.
971-974.
Mahon, K. A., Westphal, H. and Gruss, P. (1988). Expression of the
homeobox gene Hox 1.1 during mouse embryogenesis. Development 104 Suppl,
187-195.
Marti, E., Takada, R., Bumcrot, D. A., Sasaki, H. and McMahon, A. (1995).
Distribution of Sonic hedgehog peptides in the developing chick and mouse
1o embryo. Development 121, 2537-2547.
Newgreen, D. F. and Minichiello, J. (1996). Control of
Epitheliomesenchymal Transformation II. Cross-Modulation of Cell Adhesion and
Cytoskeletal Systems in Embryonic Neural Cells. Dev. BioL 176, 300-312.
Nieto, M. A., Bradley, L. C. and Wilkinson, D. G. (1991). Conserved
segmental expression of Krox-20 in the vertebrate hindbrain and its
relationship to
lineage restriction. Development SuppL 2, 59-62.
Okabe S., Forsberg-Nilsson K., Spiro AC., Segal M., McKay RD. (1996).
Development of neuronal precursor cells and functional postmitotic neurons
from
embryonic stem cells in vitro. Mech Dev 59, 89-102.
2o Paxinos, G., Ashwell, K. W. S. and Tork, I. Atlas of the developing rat
nervous system. 1994; Academic press, second edition, 24 Oval Road, London,
UK.
Pevny, L. H., Sockanathan, S., Placzek, M. and Lovell-Badge, R. (1998). A
role for SOX1 in neural determination. Development 125, 1967-1978.
Price, M., Lazzaro, D., Pohl, T., Mattel, M. G., Ruther, U., Olivio, J. C.,
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
59
Duboule, D, and Lauro, R. (1992). Regional expression of the homeobox gene
Nkx-2.2 in the developing mammalian forebrain. Neuron 8, 241-255.
Rathjen, J., Lake, J.-A., Bettess, M. D., Washington, J. M., Chapman, G.
and Rathjen, P. D. (1999). Formation of a primitive ectoderm like cell
population
from ES cells in response to biologically derived factors. J. Cell Sci. 112,
601-612.
Renoncourt, Y., Carrot, P., Filippi, P., Aru, V. and Alonso, S. (1998).
Neurons derived in vitro from ES ce(Is express homeoproteins characteristic of
motorneurons and interneurons. Mech. Dev. 79, 185-197.
Ronn, L. C., Hartz, B. P. and Bock, E. (1998). The neural cell adhesion
molecule (NCAM) in development and plasticity of the nervous system. Exp.
Gerontol. 33, 853-864.
Rosen B. and Beddington, R. S. (1993). Whole-mount in situ hybridisation
in the mouse embryo: gene expression in three dimensions. Trends Genet. 9,
162-167.
~ 5 Rosner, M. H., Vigano, A., Ozato, K., Timmons, P. M., Poirier, F., Rigby,
P.
W. J. and Staudt, L. M. (1990). A POU-domain transcription factor in early
stem
cells and germ cells of the mammalian embryo. Nature 345, 686-692.
Rutihauser, U. (1992). NCAM and its polysialic acid moiety: a mechanism
for puil/push regulation of cell interactions during development. Development
1992
2o Supplement, 99-104.
Scholer, H. R., Ruppert, S., Suzuki, N., Chowdhury, K. and Gruss, P.
(1990). New type of POU domain in germ line-specific protein Oct-4. Nature
344,
435-439.
Shen, M. M. and Leder, P. (1992). Leukemia inhibitory factor is expressed
25 by the preimplantation uterus and selectively blocks primitive ectoderm
formation
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
in vitro. Proc. Natl. Acad. Sci. U.S.A. 89, 8240-8244.
Simeone, A. (1998). Otx1 and Otx2 in the development and evolution of the
mammalian brain. EMBO J. 17, 6790-6798.
So.utharrd-Smith, E. M., Kos, L. and Pavan, W. J. (1998). SoxlO mutation
5 disrupts neural crest development in Dom Hirschsprung mouse model. Nat.
Genet
18, 60-64.
Studer, M., Gavalas, A., Marshall, H., Ariz-McNaughton, L., Rijli, F. M.,
Chambon, P. and Krumlauf, R. (1998). Genetic interactions between Hoxa1 and
Hoxb1 reveal new roles in regulation of early hindbrain patterning.
Development
1 o 125, 1025-1036.
Wassarman, K. M., Lewandoski, M., Campbell., K., Joyner, A. L.,
Rubenstein, J. L. R., Martinez, S. and Martin, G. R. (1997) Specification of
the
anterior hindbrain and establishment of a normal mid/hindbrain organizer is
dependent on Gbx2 function. Development 124, 2923-2934.
~5 Walther, C. and Gruss, P. (1991). Pax-6, a murine paired box gene, is
expressed in the developing CNS. Development 113,1435-1449.
Zimmerman, L., Parr, B., Lendahl, U., Cunningham, M., McKay, R., Gavin,
B., Mann, J., Vassileva, G. and McMahon, A. (1994). Independent regulatory
elements in the nestin gene direct transgene expression to neural stem cells
or
2o muscle precursors. Neuron 12, 11-24.
It will be understood that the invention disclosed and defined in this
specification extends to all alternative combinations of two or more of the
individual features mentioned or evident from the text or drawings. All of
these
different combinations constitute various alternative aspects of the
invention.
CA 02397292 2002-07-12
WO 01/51611 PCT/AU01/00030
61
It will also be understood that the term "comprises" (or its grammatical
variants) as used in this specification is equivalent to the term "includes"
and
should not be taken as excluding the presence of other elements or features.
