Note: Descriptions are shown in the official language in which they were submitted.
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
GENE DISRUPTION METHODOLOGIES
FOR DRUG TARGET DISCOVERY
S This application claims priority to the United States provisional
application
serial no. 60/183,534, filed February 18, 2000, which is incorporated herein
by reference in
its entirety.
1. INTRODUCTION
The present invention is directed toward (1) methods for constructing strains
useful for identification and validation of gene products as effective targets
for therapeutic
intervention, (2) methods for identifying and validating gene products as
effective targets
for therapeutic intervention, (3) a collection of identified essential genes,
and (4) screening
methods and assay procedures for the discovery of new drugs.
2. BACKGROUND OF THE INVENTION
Validation of a cellular target for drug screening purposes generally involves
an experimental demonstration that inactivation of that gene product leaves
the cell inviable.
Accordingly, a drug active against the same essential gene product expressed,
for example,
by a pathogenic fungus, would be predicted to be an effective therapeutic
agent. Similarly,
a gene product required for fungal pathogenicity and virulence is also
expected to provide a
suitable target for drug screening programs. Target validation in this
instance is based upon
a demonstration that inactivation of the gene encoding the virulence factor
creates a fungal
strain that is shown to be either less pathogenic or, ideally, avirulent, in
animal model
studies. Identification and validation of drug targets are critical issues for
detection and
discovery of new drugs because these targets form the basis for high
throughput screens
within the pharmaceutical industry.
Target discovery has traditionally been a costly, time-consuming process, in
which newly-identified genes and gene products have been individually analyzed
as
potentially-suitable drug targets. DNA sequence analysis of entire genomes has
markedly
accelerated the gene discovery process. Consequently, new methods and tools
are required
to analyze this information, first to identify all of the genes of the
organism, and .then, to
discern which genes encode products that will be suitable targets for the
discovery of
effective, non-toxic drugs. Gene discovery through sequence analysis alone
does not
validate either known or novel genes as drug targets. Elucidation of the
function of a gene
from the underlying and a determination of whether or not that gene is
essential still present
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
substantial obstacles to the identification of appropriate drug targets. These
obstacles are
especially pronounced in diploid organisms.
C. albicans is a major fungal pathogen of humans. An absence of identified
specific, sensitive, and unique drug targets in this organism has hampered the
development
of effective, non-toxic compounds for clinical use. The recent completion of
the DNA
sequence analysis of the entire C. albicans genome has rejuvenated efforts to
identify new
antifungal drug targets. Nevertheless, two primary obstacles to the
exploitation of this
information for the development of useful drug targets remain: the paucity of
suitable
markers for genetic manipulations in C. albicans and the inherent difficulty
in establishing,
in this diploid organism, whether a specific gene encodes an essential
product. Co-pending
provisional patent application, filed February 18, 2000, discloses the
identification of
dominant selectable markers, and the construction of two genes encoding those
markers,
which are suitable for transformation and gene disruption in C. albicans.
Current methods for gene disruption in C. albicans (Fig. l ) typically involve
a
multistep process employing a "URA blaster" gene cassette which is recombined
into the
genome, displacing the target gene of interest. The URA blaster cassette
comprises the
CaURA3 marker which is selectable in the corresponding auxotrophic host and
which is
flanked by direct repeats of the Salmonella typhimurium HisG gene. The URA
blaster
cassette also carnes flanking sequences corresponding to the gene to be
replaced, which
facilitate precise replacement of that gene by homologous recombination.
Putative
heterozygous transformants, which have had one allele of the target gene
deleted, are
selected as uracil prototrophs, and their identity and chromosomal structure
confirmed by
Southern blot and PCR analyses. Isolates within which intrachromosomal
recombination
events have occurred between HisG repeats, leading to excision of the CaURA3
gene and
loss of the integrated cassette, are selected on 5-fluoroorotic acid (5-FOA)
containing
media. This allows a repetition of the entire process, including reuse of the
Ura-blaster
cassette, for disruption of the second allele of the target gene. In those
instances in which
the target gene is nonessential, homozygous gene disruptions are produced in
the second
round gene replacement and identified by Southern blot and PCR analyses.
However, homozygous deletion strains, which lack both alleles of a gene that
is essential will not be viable. Accordingly, the Ura blaster method will not
provide an
unequivocal result, establishing the essential nature of the target gene since
alternative
explanations, including poor growth of a viable mutant strain, may be equally
likely for the
negative results obtained. More recent approaches for identification of
essential genes,
including those disclosed by Wilson, R.B., Davis, D., Mitchell, A.P. (1999) J.
Bacteriol.
-2-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
181:1868-74, employ multiple auxotrophic markers and a PCR-based gene
disruption
strategy. Although such methods effectively overcome the need to use the Ura
Blaster
cassette, determination of whether a given gene is essential, and therefore, a
potentially
useful target, remains labor-intensive and unsuitable for genome-wide
analyses. Substantial
effort is required to support a statistically valid conclusion that a given
gene is essential
when using either the Ura blaster cassette or multiple auxotrophic marker-
based methods for
gene disruption in Candida albicans. Typically, between 30 and 40 second round
transformants must all be confirmed as reconstructed heterozygous strains
(using PCR or
Southern blot analysis) resulting from homologous recombination between the
disruption
fragment and previously constructed disruption allele, before statistical
support to the claim
that the gene is essential can be made. Moreover, since secondary mutations
may be selected
in either the transformation step or 5-FOA counterselection (if the Ura
blaster cassette is
reused), two independently constructed heterozygous strains are preferably
examined during
the attempted disruption of the second allele. In addition, demonstration that
a particular
phenotype is linked to the homozygous mutation of the target gene (and not a
secondary
mutation) requires complementation of the defect by transforming a wild type
copy of the
gene back into the disruption strain.
Finally, the Ura blaster method precludes direct demonstration of gene
essentiality. Therefore, one is unable to critically evaluate the terminal
phenotype
characteristic of essential target genes. Consequently, establishing whether
inactivation of a
validated drug target gene results in cell death (i.e., a cidal terminal
phenotype) versus
growth inhibition (i.e., a static terminal phenotype) is not possible with
current approaches;
despite the value such information would provide in prioritizing drug targets
for suitability
in drug development.
Clearly, since current gene disruption methods are labor intensive and largely
refractile to a high throughput strategy for target validation, there is a
need for effective
methods and tools for unambiguous, rapid, and accurate identification of
essential genes in
diploid, pathogenic fungi, and particularly, in Candida albicans. The present
invention
overcomes these limitations in current drug discovery approaches by enabling
high
throughput strategies that provide rapid identification, validation, and
prioritization of drug
targets, and consequently, accelerate drug screening.
-3-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
3. SUMMARY OF THE INVENTION
The present invention provides effective and efficient methods that enable,
for each gene in the genome of an organism, the experimental determination as
to whether
that gene is essential, and for a pathogenic organism, in addition, whether it
is required for
virulence or pathogenicity. The identification and validation of essential
genes and those
genes critical to the development of virulent infections, provides a basis for
the development
of high-throughput screens for new drugs against the pathogenic organism.
The present invention can be practiced with any organism independent of
ploidy, and in particular, pathogenic fungi. Preferably, the pathogenic fungi
are diploid
pathogenic fungi, including but not limited to Candida albicans, Aspergillus
fumigatus,
Cryptococcus neoformans and the like.
In one embodiment, the present invention is directed toward a method for
constructing a diploid fungal strain in which one allele of a gene is modified
by insertion of
or replacement by a cassette comprising an expressible dominant selectable
marker. This
cassette is introduced into the chromosome by recombination, thereby providing
a
heterozygous strain in which the first allele of the gene is inactivated.
The other allele of the gene is modified by the introduction, by
recombination, of a promoter replacement fragment comprising a heterologous
promoter,
such that the expression of the second allele of the gene is regulated by the
heterologous
promoter. Expression from the heterologous promoter can be regulated by the
presence of a
transactivator protein comprising a DNA-binding domain and transcription-
activation
domain. The DNA-binding domain of this transactivator protein recognizes and
binds to a
sequence in the heterologous promoter and increases transcription of that
promoter. The
transactivator protein can be produced in the cell by expressing a nucleotide
sequence
encoding the protein.
This method for the construction of a diploid fungus having both alleles of a
gene modified, is carried out, in parallel, with each and every gene of the
organism, thereby
allowing the assembly a collection of diploid fungal cells each of which
comprises the
modified alleles of a gene. This collection, therefore, comprises modified
alleles of
substantially all of the genes of the diploid organism. As used herein, the
term
"substantially all" includes at least 60%, 70%, 80%, 90%, 95% or 99% of the
total.
Preferably, every gene in the genome of the diploid organism is represented in
the
collection.
The present invention also encompasses diploid organisms, such as diploid
pathogenic fungal strains, comprising modified alleles of a gene, where the
first allele of a
-4-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gene is inactivated by insertion of or replacement by a nucleotide sequence
encoding an
expressible dominant selectable marker; and where the second allele of the
gene has also
been modified so that expression of the second allele is regulated by a
heterologous
promoter. In one aspect of the present invention, the alleles modified in the
mutant diploid
pathogenic fungal strain correspond to an essential gene, which is required
for growth,
viability and survival of the strain. In another aspect of the present
invention, the modified
alleles correspond to a gene required for the virulence and pathogenicity of
the diploid
pathogenic fungal strain against a host organism. In both cases, the essential
gene and the
virulence/pathogenicity gene are potential drug targets.
Accordingly, the present invention encompasses collections of mutant
diploid fungal strains wherein each collection comprises a plurality of
strains, each strain
containing the modified alleles of a different gene. The collections of
strains of the
invention include modified alleles for substantially all the different
essential genes in the
genome of a fungus or substantially all the different virulence genes in the
genome of a
pathogenic fungus.
In another embodiment, the present invention is also directed to nucleic acid
microarrays which comprise a plurality of defined nucleotide sequences
disposed at
identifiable positions in an array on a substrate. The defined nucleotide
sequences can
comprise oligonucleotides complementary to, and capable of hybridizing with,
the
nucleotide sequences of the essential genes of the diploid pathogenic organism
that are
required for the growth and survival of the diploid pathogenic organism, the
nucleotide
sequences of genes contributing to the pathogenicity or virulence of the
organism, and/or
the unique molecular tags employed to mark each of the mutant strains.
The present invention is also directed to methods for the identification of
genes essential to the survival of a diploid organism, and of genes that
contribute to the
virulence and/or pathogenicity of the diploid pathogenic organism. First, the
invention
provides mutants of diploid organisms, such as mutant fungal cells, having one
allele of a
gene inactivated by insertion of or replacement with a disruption cassette,
and the other
allele modified by a nucleic acid molecule comprising a heterologous regulated
promoter,
such that expression of that second allele is under the control of the
heterologous promoter.
Second, such mutant cells are cultured under conditions where the second
allele of the
modified gene is substantially not expressed. The viability or pathogenicity
of the cells are
then determined. The resulting loss of viability or exhibition of a severe
growth defect
indicates that the gene that is modified in the mutant cells is essential to
the survival of a
pathogenic fungus. Similarly, the resulting loss of virulence and/or
pathogenicity of the
-5-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
mutant cells indicates that the gene that is modified contributes to the
virulence and/or
pathogenicity of the pathogenic fungus.
In yet another embodiment of the present invention, the mutant pathogenic
fungal strains constructed according to the methods disclosed are used for the
detection of
antifungal agents effective against pathogenic fungi. Mutant cells of the
invention are
cultured under differential growth conditions in the presence or absence of a
test compound.
The growth rates are then compared to indicate whether or not the compound is
active
against a target gene product. The second allele of the target gene may be
substantially
underexpressed to provide cells with enhanced sensitivity to compounds active
against the
gene product expressed by the modified allele. Alternatively, the second
allele may be
substantially overexpressed to provide cells with increased resistance to
compounds active
against the gene product expressed by the modified allele of the target gene.
In yet another embodiment of the present invention, the strains constructed
according to the methods disclosed are used for the screening of therapeutic
agents
1 S effective for the treatment of non-infectious diseases in a plant or an
animal, such as a
human. As a consequence of the similarity of a target's amino acid sequence
with a plant or
animal counterpart, or the lack of sequence similarity, active compounds so
identified may
have therapeutic applications for the treatment of diseases in the plant or
animal, in
particular, human diseases, such as cancers and immune disorders.
The present invention, in other embodiments, further encompasses the use of
transcriptional profiling and proteomics techniques to analyze the expression
of essential
andlor virulence genes under a variety of conditions, including in the
presence of known
drugs. The information yielded from such studies can be used to uncover the
target and
mechanism of known drugs, to discover new drugs that act in a similar fashion
to known
drugs, and to delineate the interactions between gene products that are
essential to growth
and survival of the organism and that are instrumental to virulence and
pathogenicity of the
organism.
In a further embodiment of the present invention, a set of genes of a
pathogenic organism are identified as potential targets for drug screening.
Such genes
comprise, genes that have been determined, using the methods and criteria
disclosed herein,
to be essential for survival of a pathogenic fungus and/or for the virulence
and/or
pathogenicity of the pathogenic fungus. The polynucleotides of the essential
genes or
virulence genes of a pathogenic organism (i.e., the target genes) provided by
the present
invention can be used by various drug discovery purposes. Without limitation,
the
polynucleotides can be used to express recombinant protein for
characterization, screening
-6-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
or therapeutic use; as markers for host tissues in which the pathogenic
organisms invade or
reside (either permanently or at a particular stage of development or in a
disease states); to
compare with DNA sequences of other related or distant pathogenic organisms to
identify
potential orthologous essential or virulence genes; for selecting and making
oligomers for
attachment to a nucleic acid array for examination of expression patterns; to
raise anti-
protein antibodies using DNA immunization techniques; as an antigen to raise
anti-DNA
antibodies or elicit another immune response; and as a therapeutic agent
(e.g., antisense).
Where the polynucleotide encodes a protein which binds or potentially binds to
another
protein (such as, for example, in a receptor-ligand interaction), the
polynucleotide can also
be used in assays to identify polynucleotides encoding the other protein with
which binding
occurs or to identify inhibitors of the binding interaction.
The polypeptides or proteins encoded by the essential genes and virulence
genes (i.e. the target gene products) provided by the present invention can
also be used in
assays to determine biological activity, including its uses as a member in a
panel or an array
of multiple proteins for high-throughput screening; to raise antibodies or to
elicit immune
response; as a reagent (including the labeled reagent) in assays designed to
quantitatively
determine levels of the protein (or its receptor) in biological fluids; as a
marker for host
tissues in which the pathogenic organisms invade or reside (either permanently
or at a
particular stage of development or in a disease states); and, of course, to
isolate correlative
receptors or ligands (also referred to as binding partners) especially in the
case of virulence
factors. Where the protein binds or potentially binds to another protein (such
as, for
example, in a receptor-ligand interaction), the protein can be used to
identify the other
protein with which binding occurs or to identify inhibitors of the binding
interaction.
Proteins involved in these binding interactions can also be used to screen for
peptide or
small molecule inhibitors or agonists of the binding interaction, such as
those involved in
invasiveness, and pathogenicity of the pathogenic organism.
Any or all of these drug discovery utilities are capable of being developed
into a kit for commercialization as research products. The kits may comprise
polynucleotides and/or polypeptides corresponding to a plurality of essential
genes and
virulence genes of the invention, antibodies, and/or other reagents.
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
4. BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 depicts the URA blaster method for gene disruption in Candida
albicans.
Figure 2 depicts the GRACE method for constructing a gene disruption of
one allele of a gene (CaKRE9), and promoter replacement of the second allele
of the target
gene, placing the second allele under conditional, regulated control by a
heterologous
promoter.
Figure 3 presents conditional gene expression , using GRACE technology,
with KREI, KRES, KRE6 and KRE9.
Figure 4 presents conditional gene expression using GRACE technology with
CaKREI, CaTUBI, CaALG7, CaAURI, CaFKSI and CaSAT2.
Figure 5 presents a Northern Blot Analysis of CaHIS3, CaALRI, CaCDC24
and CaKRE9 mRNA isolated from GRACE strains to illustrate elevated expression
under
non-repressing conditions.
Figure 6 presents growth of a CaHIS3 heterozygote strain and a tetracycline
promoter-regulated CaHIS3 GRACE strain compared to growth of a wild-type
diploid
CaHIS3 strain in the presence and absence of 3-aminotriazole (3-AT).
Figure 6A depicts growth of a wild-type strain and a CaHIS3 heterozygote
strain as compared with a CaHIS3 GRACE strain constitutively expressing the
tetracycline
promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of
inhibitory
levels of 3-aminotriazole.
Figure 6B depicts growth of a wild-type strain, a haploinsufficient CaHIS3
heterozygote strain, and a CaHIS3 GRACE strain constitutively expressing the
tetracycline
promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of
an
intermediate level of 3-aminotriazole.
Figure 6C depicts growth of a wild-type strain, a haploinsufficient CaHIS3
heterozygote strain, and a CaHIS3 GRACE strain minimally expressing the
tetracycline
_g_
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of
an
intermediate level of 3-aminotriazole.
Figure 6D demonstrates the hypersensitivity of the CaHIS3 GRACE strain
minimally expressing the tetracycline promoter-regulated imidazoleglycerol
phosphate
dehydratase, in the presence of an intermediate level of 3-aminotriazole.
5. DETAILED DESCRIPTION OF THE INVENTION
5.1 Gene Disruption And Drug Target Discovery
The present invention provides a systematic and efficient method for drug
target identification and validation. The approach is based on genomics
information as well
as the biological function of individual genes.
The methods of the invention generates a collection of genetic mutants in
which the dosage of specific genes can be modulated, such that their functions
in growth,
survival, and/or pathogenicity can be investigated. The information accrued
from such
investigations allows the identification of individual gene products as
potential drug targets:
The present invention further provides methods of use of the genetic mutants
either
individually or as a collection in drug screening and for investigating the
mechanisms of
drug action.
Generally, in gene disruption experiments, the observation that homozygous
deletions cannot be generated for both alleles of a gene in a diploid
organism, cannot, per
se, support the conclusion that the gene is an essential gene. Rather, a
direct demonstration
of expression of the gene in question that is coupled with viability of the
cell carrying that
gene, is required for the unambiguous confirmation that the gene in question
is essential.
A direct demonstration that a given gene is essential for survival of a cell
can
be established by disrupting its expression in diploid organisms which have a
haploid stage.
For example, in Saccharomyces cerevisiae, this is achieved by complete removal
of the
gene product through gene disruption methods in a diploid cell type, followed
by
sporulation and tetrad dissection of the meiotic progeny to enable direct
comparison of
haploid yeast strains possessing single mutational differences. However, such
an approach .
is not applicable to asexual yeast strains, which include most diploid
pathogenic cell types,
and alternative methods are required for eliminating expression of a putative
essential gene.
-9-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
In one embodiment, the invention provides a method for creating a diploid
mutant cell of an organism in which the dosage of a specific gene can be
modulated. By
this method of the invention, one allele of a target gene in a diploid cell of
an organism is
disrupted while the second allele is modified by having its promoter replaced
by a regulated
promoter of heterologous origin. A strain constructed in this manner is said
to comprise a
modified allelic pair, i.e., a gene wherein both alleles are modified as
described above.
Where the genomic DNA sequence of the organism is available, this process may
be
repeated with each and every gene of the organism, thereby constructing a
collection of
mutant organisms each harboring a disrupted allele and an allele which can be
conditionally
expressed. This gene disruption strategy, therefore, provides a substantially
complete set of
potential drug target genes for that organism. This collection of mutant
organisms,
comprising a substantially complete set of modified allelic pairs, forms the
basis for the
development of high throughput drug screening assays. A collection of such
mutant
organisms can be made even when the genomic sequences of an organism are not
1 S completely sequenced. It is contemplated that a smaller collection of
mutant organisms can
be made, wherein in each mutant organism, one allele of a desired subset of
gene is
disrupted, and the other allele of the genes in this subset is placed under
conditional
expression. The method of the invention employed for the construction of such
strains is
referred to herein as the GRACE method, where the acronym is derived from the
phrase
gene replacement and conditional expression.
The GRACE method, which involves disruption of one allele coupled with
conditional expression of the other allele, overcomes limitations relying upon
repeated
cycles of disruption with the URA blaster cassette followed by
counterselection for its loss.
The GRACE method permits large scale target validation in a diploid pathogenic
microorganism, such as a pathogenic fungus.
The GRACE method of the invention, as applied to a diploid cell involves
two steps: (i) gene replacement resulting in disruption of the coding and/or
non-coding
regions) of one wild type allele by insertion, truncation, and/or deletion,
and (ii) conditional
expression of the remaining wild type allele via promoter replacement or
conditional protein
instability (Fig. 2). Detailed descriptions of the method is provided in later
sections.
Isolated mutant organisms resulting from the application of the GRACE
method are referred to herein as GRACE strains of the organism. Such mutant
strains of an
organism are encompassed by the invention. In a particular embodiment, a
collection of
GRACE strains which are generated by subjecting substantially all the
different genes in the
genome of the organism to modification by the GRACE method is provided. In
this
-10-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
collection, each strain comprises the modified alleles of a different gene,
and substantially
all the genes of the organism are represented in the collection. It is
intended that a GRACE
strain is generated for every gene in an organism of interest. Alternatively,
a smaller
collection of GRACE strains of an organism can be generated wherein a desired
subset of
the genes in the organism are modified by the GRACE method.
A gene is generally considered essential when viability and/or normal growth
of the organism is substantially coupled to or dependent on the expression of
the gene. An
essential function for a cell depends in part on the genotype of the cell and
in part the cell's
environment. Multiple genes are required for some essential function, for
example, energy
metabolism, biosynthesis of cell structure, replication and repair of genetic
material, etc.
Thus, the expression of many genes in an organism are essential for its growth
and/or
survival. Accordingly, when the viability or normal growth of a GRACE strain
under a
defined set of conditions is coupled to or dependent on the conditional
expression of the
remaining functional allele of a modified allelic gene pair, the gene which
has been
modified in this strain by the GRACE method is referred to as an "essential
gene" of the
organism.
A gene is generally considered to contribute to the virulence/pathogenicity of
an organism when pathogenicity of the organism is associated at least in part
to the
expression of the gene. Many genes in an organism are expected to contribute
to the
virulence and/or pathogenicity of the organism. Accordingly, when the
virulence and/or
pathogenicity of a GRACE strain to a defined host or to defined set of cells
from a host is
associated with the conditional expression of the remaining functional allele
of a modified
allelic gene pair, the gene which has been modified in this strain by the
GRACE method is
referred to as a "virulence gene" of the organism.
The present invention provides a convenient and efficient method to identify
essential genes of a pathogenic organism, and to validate their usefulness in
drug discovery
programs. The method of the invention can similarly be used to identify
virulence genes of
a pathogenic organism. The identities of these essential genes and virulence
genes of an
organism as identified by the GRACE method are encompassed in the present
invention.
substantially all of the essential genes and virulence genes of an organism
can be identified
and validated by the GRACE method of the invention.
Each of the essential genes and virulence genes so identified represent a
potential drug target for the organism, and can be used individually or as a
collection in
various methods of drug screening. Depending on the objective of the drug
screening
program and the target disease, the essential genes and virulence genes of the
invention can
-11-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
be classified and divided into subsets based on the structural features,
functional properties,
and expression profile of the gene products. The gene products encoded by the
essential
genes and virulence genes within each subset may share similar biological
activity, similar
intracellular localization, structural homology, and/or sequence homology.
Subsets may
S also be created based on the homology or similarity in sequence to other
organisms in a
similar or distant taxonomic group, e.g. homology to Saccharomyces cerevisiae
genes, or to
human genes, or a complete lack of sequence similarity or homology to genes of
other
organisms, such as S. cerevisiae or human. Subsets may also be created based
on the
display of cidal terminal phenotype or static terminal phenotype by the
organism bearing the
modified gene. Such subsets, referred to as essential gene sets or virulence
gene sets, which
can be conveniently investigated as a group in a drug screening program, are
provided by
the present invention. Accordingly, the present invention provides a plurality
of mutant
organisms, such as a collection of GRACE strains, each comprising the modified
alleles of a
different gene, wherein each gene is essential for the growth and/or survival
of the cells.
In a specific embodiment, substantially all of the essential genes in the
genome of a pathogenic fungus are identified by the GRACE method, and the
GRACE
strains containing the modified allelic pairs of essential genes are included
in a collection of
GRACE strains. In another specific embodiment, substantially all of the
virulence genes in
the genome of a pathogenic fungus are identified by the GRACE method, and the
GRACE
strains containing the modified allelic pairs of virulence genes are included
in a collection of
GRACE strains.
For Candida albicans, a GRACE strain collection for the entire genome may
comprise approximately 7000 modified allelic pairs of genes based on analysis
of the C.
albicans genome sequence. The complete set of essential genes of C. albicans
is estimated
to comprise approximately 1000 genes. The present invention provides the
identities of
some of these genes in C. albicans, and the various uses of these genes and
their products as
drug targets. In addition, estimates as to the number of genes participating
in the virulence
of this pathogen range between 100 and 400 genes. Once the identity of an
essential gene is
known, various types of mutants containing one or more copies of the mutated
essential
gene created by other methods beside the GRACE method are contemplated and
encompassed by the invention.
The invention also provides biological and computational methods, and
reagents that allow the isolation and identification of genes that are
homologous to the
identified essential and virulence genes of C. albicans. Information obtained
from the
GRACE strains of diploid organisms can be used to identify homologous
sequences in
-12-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
haploid organisms. The identities and uses of such homologous genes are also
encompassed
by the present invention.
For clarity of discussion, the invention is described in the subsections below
by way of example for the pathogenic fungus, Candida albicans. However, the
principles
may be analogously applied to the essential and virulence genes of other
pathogens and
parasites, of plants and animals including humans. The GRACE method can be
applied to
any pathogenic organisms that has a diploid phase in their life cycles. Hence,
the term
diploid pathogenic organism is not limited to organism that exist exclusively
in diploid
form, but encompasses also organisms that have both haploid and diploid phases
in their life
cycle.
For example, the GRACE method for drug target identification and
validation can be directly applied to other pathogenic fungi. Deuteromycetous
fungi, i. e.
those lacking a sexual cycle and classical genetics, (in which C. albicans is
included),
represent the majority of human fungal pathogens. Aspergillus fumigatus is
another
medically-significant member of this phylum, which, more strictly, includes
members of the
Ascomycota and the Basidiomycota. A. fumigatus, an Ascomycte is the
predominant air
borne infectious fungal agent causing respiratory infection, or invasive
aspergillosis (IA), in
immunocompromised patients. While relatively unknown 20 years ago, today the
number
of IA cases is estimated to be several thousand per year. Moreover, IA
exhibits a mortality
rate exceeding 50% and neither amphothericin B nor fluconazole are highly
efficacious.
Compounding these problems is that identification of novel drug targets is
limited by the
current state of target validation in this organism.
The GRACE method demonstrated for C. albicans is readily adapted for use
with A. fumigatus, for the following reasons. Although, A. fumigatus possesses
a haploid
genome, the GRACE method could be simplified to one step-conditional promoter
replacement of the wild type promoter. Since A. fumigatus, in contrast to
Candida albicans,
adheres to the universal genetic code, extensive site-directed mutagenesis,
like that required
to engineer the GRACE method for C. albicans, would not be required. Moreover,
essential
molecular biology techniques such as transformation and gene disruption via
homologous
recombination have been developed for A. fumigatus. Selectable markers are
available for
these techniques in A. fumigatus, and include genes conferring antibiotic
resistance to
hygromycin B and phleomycin, and the auxotrophic marker, ura3. Furthermore,
both
public and private A. fumigatus genome sequencing projects exist. Therefore,
sequence
information is available both for the identification of putative essential
genes as well as for
~e experimental validation of these drug targets using the GRACE method.
Additional
-13-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
pathogenic deuteromycetous fungi to which the GRACE method may be applied
include
Aspergillus,flavus, Aspergillus niger, and Coccidiodes immitis.
In another aspect of the present invention, the GRACE method for drug
target identification and validation is applied to Basidiomycetous pathogenic
fungi. One
particular, medically-significant member of this phylum is Cryptococcus
neoformans. This
air borne pathogen represents the fourth (7-8%) most commonly recognized cause
of life-
threatening infections in AIDS patients. Transformation and gene disruption
strategies exist
for C. neoformans and a publically funded genome sequencing project for this
organism is
in place. C. neoformans possesses a sexual cycle, thus enabling the GRACE
method to be
employed with both haploid and diploid strains. Other medically-significant
Basidiomycetes include Trichosporon beigelii and Schizophylum commune.
In the same way medically relevant fungal pathogens are suitable for a
rational drug target discovery using the GRACE method, so too may plant fungal
pathogens
and animal pathogens be examined to identify novel drug targets for
agricultural and
1 S veterinary purposes. The quality and yield of many agricultural crops
including fruits, nuts,
vegetables, rice: soybeans, oats, barley and wheat are significantly reduced
by plant fungal
pathogens. Examples include the wheat fungal pathogens causing leaf blotch
(Septoria
tritici, glume blotch (Septoria nodorum), various wheat rusts (Puccinia
recondita, Puccinia
graminis); powdery mildew (various species), and stem/stock rot (Fusarium
spp.) Other
p~icularly destructive examples of plant pathogens include, Phytophthora
infestans, the
causative agent of the Irish potato famine, the Dutch elm disease causing
ascomycetous
fungus, Ophiostoma ulmi, the corn smut causing pathogen, Ustilago maydis and
the
rice-blast-causing pathogen Magnapurtla grisea. The emerging appearance of
fungicidal-
resistant plant pathogens and increasing reliance on monoculture practices,
clearly indicate a
growing need for novel and improved fungicidal compounds. Accordingly, the
present
invention encompasses the application of the GRACE method to identify and
validate drug
targets in pathogens and parasites of plants and livestock. Table I lists
exemplary groups of
haploid and diploid fungi of medical, agricultural, or commercial value.
35
-14-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Table I: Exemplary Haploid and Diploid Fungi
Ascomycota
Animal patho ens: Plant Pathoogens: General Commercial
Significance
Aspergillus fumigatusAlternaria solanii Aspergillus niger
Alternaria spp Gaeumannomyces graminisSchizosaccharomyces
pombe
Blastomyces dermatidisCercospora zeae-maydisPichia pastoris
Candida spp includingBotrytis cinerea Hansenula polymorpha
Candida dublinensis Claviceps purpurea Ashbya gossipii
Candida glabrata Corticum rolfsii Aspergillus nidulans
Candida krusei Endothia parasitica Trichoderma reesei
Candida lustaniae Sclerotinia sclerotiorumAureobasidium pullulans
Candida parapsilopsisErysiphe gramini Yarrowia lipolytica
Candida tropicalis Erysiphe triticii Candida utilis
Coccidioides immitis Fusarium spp. Kluveromyces lactis
Exophalia dermatiditisMagnaporthe grisea
Fusarium oxysporum Plasmopara viticola
Histoplasma capsulatumPenicillium digitatum
Pneumocystis carinii Ophiostoma ulmi
Rhizoctonia species
including oryzae
Septoria species including
- Septoria avenae
Septoria nodorum
Septoria passerinii
Septoria triticii
Venturia inequalis
Verticillium dahliae
Verticillium albo-atrum
Basidiomycota
Animal pathogens: Plant Patho,_ens: General commercial
significance
Cryptococcus neoformans Puccinia spp includingAgaricus campestris
Trichosporon beigelii Puccinia coronata Phanerochaete chrysosporium
Puccinia graminis Gloeophyllum trabeum
Puccinia recondita Trametes versicolor
Puccinia striiformis
Tilletia spp including
Tilletia caries
Tilletia controversa
Tilletia indica
Tilletia tritici
Tilletiafoetida
Ustilago maydis
Ustilago hordeii
-15-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Zygomycota
Animal ~atho~.~ens: Plant Patho ens: General commercial
si~~nificance
Absidia corymbifera
Mucor rouxii
Rhizomucor pusillus
Rhizopus arrhizus
All Candida species except Candida glabrata are obligate diploid species that
lack a haploid
phase in its life cycle, and are thus subject to the application of the GRACE
methods.
5.2 Construction of GRACE Strains
According to the invention, in a GRACE strain of a diploid organism, only
one allele of a gene is eliminated, while the second allele is placed under
the control of the
heterologous promoter, the activity of which is regulatable. Where the gene is
essential,
elimination of both alleles will be lethal or severely crippling for growth.
Therefore, in the
present invention, a heterologous promoter is used to provide a range of
levels of expression
of the second allele. Depending on the conditions, the second allele can be
non-expressing,
underexpressing, overexpressing, or expressing at a normal level relative to
that when the
allele is linked to its native promoter. A heterologous promoter is a promoter
from a
different gene from the same pathogenic organism, or it can be a promoter from
a different
species.
Precise replacement of a target gene is facilitated by using a gene disruption
cassette comprising a selectable marker, preferably a dominant selectable
marker, that is
expressible in the strain of interest. The availability of two distinct
dominant selectable
markers allows the gene replacement process to be engineered at both alleles
of the target
gene, without the required counterselection step inherent in existing methods.
In particular, the present invention encompasses a method for constructing a
strain of diploid pathogenic fungal cells, in which both alleles of a gene are
modified, the
method comprising the steps of (a) modifying a first allele of a gene in
diploid pathogenic
fungal cells by recombination using a gene disruption cassette comprising a
nucleotide
sequence encoding a selectable marker that is expressible in the cells,
thereby providing
heterozygous pathogenic fungal cells in which the first allele of the gene is
inactivated; and
(b) modifying the second allele of the gene in the heterozygous diploid
pathogenic fungal
cells by recombination with a promoter replacement fragment comprising a
heterologous
promoter, such that the expression of the second allele of the gene is
regulated by the
heterologous promoter.
- 16-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
The process can be repeated for a desired subset of the genes such that a
collection of GRACE strains is generated wherein each strain comprises a
modified allelic
pair of a different gene. By repeating this process for every gene in a
pathogenic fungus, a
complete set of GRACE strains representing the entire genome of the pathogenic
fungus can
S be obtained. Thus, the present invention provides a method of assembling a
collection of
diploid pathogenic fungal cells, each of which comprises the modified alleles
of a different
gene. The method comprises repeating the steps of modifying pairs of alleles a
plurality of
times, wherein a different pair of gene alleles is modified with each
repetition, thereby
providing the collection of diploid pathogenic fungal cells each comprising
the modified
alleles of a different gene.
A preferred embodiment for the construction of GRACE strains, uses the
following two-step method. C. albicans is used as an example.
5.2.1 Heterozygote Construction By Gene Disruption
Several art-known methods are available to create a heterozygote mutant. In
less preferred embodiments, auxotrophic markers, such as but not limited to
CaURA3,
CaHIS3, CaLEU2, or CaTRPl, could be used for gene disruption if desired.
However, the
preferred method of heterozygote construction in diploid fungi employs a
genetically
modified dominant selectable marker. G albicans is sensitive to the nucleoside-
like
antibiotic streptothricin at a concentration of 200 micrograms per milliliter.
The presence of
the Escherichia coli SAT1 gene within C. albicans allows acetylation of the
drug rendering
it nontoxic and permitting the strain to grow in the presence of
streptothricin at a
concentration of 200 micrograms per milliliter. Expression of the SAT1 gene in
C. albicans
is made possible by engineering the gene so that its DNA sequence is altered
to conform to
the genetic code of this organism and by providing a CaACTl promoter
(Morschhauser et
al. .(1998) Mol. Gen. Genet. 257:412-420) and a CaPCKI terminator sequence
(Leuker et al.
(1997) Gene 192: 235-40). This genetically modified marker is referred to as
CaSATI which
is the subject of a copending United States nonprovisional application, filed
February 16,
2001.
C. albicans is also sensitive to a second fungicidal compound, blasticidin,
whose cognate resistance gene from Bacillus cereus, BSR, has similarly been
genetically
engineered for expression in C. albicans (CaBSRI ), and has been shown to
confer a
dominant drug resistance phenotype. PCR amplification of either dominant
selectable
marker so as to include about 65 by of flanking sequence identical to the
sequence 5' and 3'
- 17-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
of the C. albicans gene to be disrupted, allows construction of a gene
disruption cassette for
any given C. albicans gene.
By employing the method of Baudin et al. ( 1993, Nucleic Acids Research
21:3329-30), a gene disruption event can be obtained following transformation
of a C.
albicans strain with the PCR-amplified gene disruption cassette and selection
for drug
resistant transformants that have precisely replaced the wild type gene with
the dominant
selectable marker. Such mutant strains can be selected for growth in the
presence of a drug,
such as but not limited to streptothricin. The resulting gene disruptions are
generally
heterozygous in the diploid C. albicans, with one copy of the allelic pair on
one homologous
chromosome disrupted, and the other allele on the other homologous chromosome
remaining as a wild type allele as found in the initial parental strain. The
disrupted allele is
non-functional, and expression from this allele of the gene is nil. By
repeating this process
for all the genes in the genome of an organism, a set of gene disruptions can
be obtained for
every gene in the organism. The method can also be applied to a desired subset
of genes.
5.2.2 Conditional Expression By a Tetracycline-Regulatable Promoter
The conditional expression system used in this embodiment of the invention
comprises a regulatable promoter and a means for regulating promoter activity.
Conditional
expression of the remaining wild type allele in a heterozygote constructed as
set forth in
Section 5.1.1 is achieved by replacing its promoter with a tetracycline-
regulatable promoter
. . system that is developed initially for S. cerevisiae but which is modified
for use in
C. albicans. See Gari et al., 1997, Yeast 13:837-848; and Nagahashi et al.,
1997, Mol. Gen.
Genet. 255:372-375.
Briefly, conditional expression is achieved by first constructing a
transactivation fusion protein comprising the E. coli TetR tetracycline
repressor domain or
DNA binding domain (amino acids 1-207) fused to the transcription activation
domain of S.
cerevisiae GAL4 (amino acids 785-881 ) or HAP4 (amino acids 424-554). Multiple
CTG
codon corrections were introduced to comply with the C. albicans genetic code.
The
nucleotide sequences encoding the transactivation fusion proteins of E. coli
TetR (amino
acids 1-207) plus S. cerevisiae GAL4 (amino acids 785-881), and of E. coli
TetR (amino
acids 1-207) plus S. cerevisiae HAP4 (amino acids 424-554), both of which have
been
modified for proper expression in C. albicans are encompassed by the present
invention.
Accordingly, the invention provides haploid or diploid cells that can comprise
a nucleotide
sequence encoding a transactivation fusion protein expressible in the cells,
wherein the
transactivation fusion protein comprises a DNA binding domain and a
transcription
-18-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
activation domain.
Constitutive expression of the transactivation fusion protein in C. albicans
can be achieved by providing a CaACTI promoter and CaACTI terminator sequence.
However, it will be appreciated that any regulatory regions, promoters and
terminators, that
are functional in C. albicans can be used to express the fusion protein. Thus,
a nucleic acid
molecule comprising a promoter functional in C. albicans, the coding region of
a
transactivation fusion protein, and a terminator functional in C. albicans,
are encompassed
by the present invention. Such a nucleic acid molecule can be a plasmid, a
cosmid, a
transposon, or a mobile genetic element. In a preferred embodiment, the TetR-
Gal4 or
TetR-Hap4 transactivators can be stably integrated into a C. albicans strain,
by using either
ura3 and his3 auxotrophic markers.
In this embodiment, the invention further provides that a promoter
replacement fragment comprising a nucleotide sequence encoding heterologous
promoter
which comprises at least one copy of a nucleotide sequence which is recognized
by the
DNA binding domain of the transactivation fusion protein, and wherein binding
of the
transactivation fusion protein increases transcription of the heterologous
promoter. The
heterologous tetracycline promoter initially developed for S cerevisiae gene
expression,
contains an ADHI 3' terminator sequence, variable number of copies of the
tetracycline
operator sequence (2, 4, or 7 copies), and the CYCI basal promoter. The
tetracycline
promoter has been subcloned adjacent to both CaHIS3 and CaSATI selectable
markers in
the orientation favoring tetracycline promoter-dependent regulation when
placed
immediately upstream the open reading frame of the gene of interest. PCR
amplification of
the CaHIS3-Tet promoter cassette incorporates 65bp of flanking sequence
homologous to
the promoter sequence around nucleotide positions -200 and -1 (relative to the
start codon)
of the target gene, thereby producing a conditional promoter replacement
fragment for
transformation. When transformed into a C. albicans strain made heterozygous
as described
in Section 5.1.1 using the CaSATI disruption cassette, homologous
recombination between
the promoter replacement fragment and the promoter of the wild type allele
generates a
strain in which the remaining wild type gene is conditionally regulated gene
by the
tetracycline promoter. Transformants are selected as His prototrophs and
verified by
Southern blot and PCR analysis.
In this particular embodiment, the promoter is induced in the absence of
tetracycline, and repressed by the presence of tetracycline. Analogs of
tetracycline,
including but not limited to chlortetracycline, demeclocycline, doxycycline,
meclocycline,
methocycline, minocycline hydrochloride, anhydrotetracycline, and
oxytetracycline, can also
- 19-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
be used to repress the expression of the modified gene allele in a GRACE
strain.
The present invention also encompasses alternative variants of the
tetracycline promoter system, based upon a mutated tetracycline repressor
(tetR) molecule,
designated tetR', which is activated (i. e. binds to its cognate operator
sequence) by binding
of the antibiotic effector molecule to promote expression, and is repressed
(i. e. does not
bind to the operator sequence) in the absence of the antibiotic effectors,
when the tetR' is
used instead of, or in addition to, the wild-type tetR. For example, the GRACE
method
could be performed using tetR' instead of tetR in cases where repression is
desired under
conditions which lack the presence of tetracycline, such as shut off of a gene
participating in
drug transport (e.g. CaCDRI, CaPDRS, or CaMDRI). Also, the GRACE method could
be
adapted to incorporate both the tetR and tetR' molecules in a dual
activator/repressor system
where tetR is fused to an activator domain and tetR' is fused to a general
repressor (e.g.
CaSsr6 or CaTupl) to enhance or further repress expression in the presence of
the antibiotic
effector molecules (Belli et al., 1998, Nucl Acid Res 26:942-947 which is
incorporated
herein by reference). These methods of providing conditional expression are
also
contemplated.
In another embodiment of the invention, the method may also be applied to
haploid pathogenic fungi by modifying the single allele of the gene via
recombination of the
allele with a promoter replacement fragment comprising a nucleotide sequence
encoding a
heterologous promoter, such that the expression of the gene is conditionally
regulated by the
heterologous promoter. By repeating this process for a preferred subset of
genes in a
haploid pathogenic organism, or its entire genome, a collection or a complete
set of
conditional mutant strains can be obtained. A preferred subset of genes
comprises genes
that share substantial nucleotide sequence homology with target genes of other
organisms,
e.g.~ C. albicans and S. cerevisiae. For example, this variation to the method
of the
invention may be applied to haploid fungal pathogens including, but not
limited to, animal
fugal pathogens such as Aspergillus fumigatus, Aspergillus niger, Aspergillus
flavis,
Candida glabrata, Cryptococcus neoformans, Coccidioides immitis, Exophalia
dermatiditis,
Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis carinii,
Trichosporon
beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia
corymbigera, or
the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis,
Magnaporthe
grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago
maydis, or any
species falling within the genera of any of the above species.
The means to achieve conditional expression are not restricted to the
tetracycline promoter system and can be performed using other conditional
promoters. Such
-20-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
conditional promoter may, for example, be regulated by a repressor which
repress
transcription from the promoter under particular condition or by a
transactivator which
increases transcription from the promoter, such as, when in the presence of an
inducer. For
example, the C. albicans CaPCKl promoter is not transcribed in the presence of
glucose but
has a high level of expression in cells grown on other carbon sources, such as
succinate, and
therefore could also be adopted for conditional expression of the modified
allele in a
GRACE strain. To this end, it has been shown that both CaHISI and CaSATl are
essential
for growth on glucose-containing medium using the CaPCKI promoter as an
alternative to
the tetracycline promoter in the above description. In this instance, the
CaPCKl promoter
is heterologous to the gene expressed and not to the organism, and such
heterologous
promoters are also encompassed in the invention. Alternative promoters that
could
functionally replace the tetracycline promoter include but are not limited to
other antibiotic-
based regulatable promoter systems (e.g., pristinamycin-induced promoter or
PIP) as well as
Candida albicans conditionally-regulated promoters such as MET25, MAL2, PHOS,
GALI,10, STE2, or STE3.
In a preferred embodiment of the GRACE method, performing the gene
disruption first enables heterozygous strains to be constructed and separately
collected as a
heterozygote strain collection during the process of drug target validation.
Such a
C albicans heterozygote strain collection enables drug screening approaches
based on
haploinsufficiency for validated targets within the collection. As used
herein, the term
"haploinsufficiency" refers to the phenomenon whereby heterozygous strains for
a given
gene express approximately half the normal diploid level of a particular gene
product.
Consequently, these strains provide constructions having a diminished level of
the encoded
gene product, and they may be used directly in screens for antifungal
compounds. Here
differential sensitivity of a diploid parent, as compared with its
heterozygous derivative, will
indicate that a drug is active against the encoded gene product.
It is clear to those skilled in the art that the order of allele modification
followed in this embodiment of the invention is not critical, and that it is
feasible to perform
these steps in a different order such that the conditional-expressing allele
is constructed first
~d ~e disruption of the remaining wild type gene allele be performed
subsequently.
However, where the promoter replacement step is carried out first, care should
be taken to
delete sequences homologous to those employed in the gene disruption step.
A specific application of the GRACE method, as used to construct modified
alleles of the target gene CaKRE9 is provided in Section 6.
-21 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
5.2.3 Alternative Methods of Conditional Expression
In other embodiments of the invention, conditional expression could be
achieved by means other than the reliance of conditional promoters. For
example,
conditional expression could be achieved by the replacement of the wild type
allele in
heterozygous strains with temperature sensitive alleles derived in vitro, and
their phenotype
would then be analyzed at the nonpermissive temperature. In a related
approach, insertion
of a ubiquitination signal into the remaining wild type allele to destabilize
the gene product
during activation conditions can be adopted to examine phenotypic effects
resulting from
gene inactivation. Collectively, these examples demonstrate the manner in
which C.
albicans genes can be disrupted and conditionally regulated using the GRACE
method.
In an alternative embodiment of the present invention, a constitutive
promoter regulated by an excisable transactivator can be used. The promoter is
placed
upstream to a target gene to repress expression to the basal level
characteristic of the
promoter. For example, in a fungal cell, a heterologous promoter containing
lexA operator
elements may be used in combination with a fusion protein composed of the lexA
DNA
binding domain and any transcriptional activator domain (e.g. GAL4, HAP4,
VP16) to
provide constitutive expression of a target gene. Counterselection mediated by
5-FOA can
be used to select those cells which have excised the gene encoding the fusion
protein. This
procedure enables an examination of the phenotype associated with repression
of the target
gene to the basal level of expression provided by the lexA heterologous
promoter in the
absence of a functional transcription activator. The GRACE strains generated
by this
approach can be used for drug target validation as described in detail in the
sections below.
In this system, the low basal level expression associated with the
heterologous promoter is
critical. Thus, it is preferable that the basal level of expression of the
promoter is low to
make this alternative shut-off system more useful for target validation.
Alternatively, conditional expression of a target gene can be achieved
without the use of a transactivator containing a DNA binding, transcriptional
activator
domain. A cassette could be assembled to contain a heterologous constitutive
promoter
downstream of, for example, the URA3 selectable marker, which is flanked with
a direct
repeat containing homologous sequences to the 5' portion of the target gene.
Additional
homologous sequences upstream of the target, when added to this cassette would
facilitate
homologous recombination and replacement of the native promoter withe above-
described
heterologous promoter cassette immediately upstream of the start codon of the
target gene
or open reading frame. Conditional expression is achieved by selecting
strains, by using
S-FOA containing media, which have excised the heterologous constitutive
promoter and
-22-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
URA3 marker (and consequently lack those regulatory sequences upstream of the
target
gene required for expression of the gene) and examining the growth of the
resulting strain
versus a wild type strain grown under identical conditions.
5.3 Identification of Essential Genes and Virulence Genes
5.3.1 Essential Genes
The present invention provides methods for determining whether the gene
that has been modified in a GRACE strain is an essential gene or a virulence
gene in a
pathogenic organism of interest. To determine whether a gene is an essential
gene in an
organism, a GRACE strain containing the modified alleles of the gene is
cultured under
conditions wherein the second modified allele of the gene which is under
conditional
expression, is substantially underexpressed or not expressed. The viability
and/or growth of
the GRACE strain is compared with that of a wild type strain cultured under
the same
conditions. A loss or reduction of viability or growth indicates that the gene
is essential to
the survival of a pathogenic fungus. Accordingly, the present invention
provides a method
for identifying essential genes in a diploid pathogenic organism comprising
the steps of
culturing a plurality of GRACE strains under culture conditions wherein the
second allele of
each of the gene modified in the respective GRACE strain is substantially
underexpressed or
not expressed; determining viability and/or growth indicators) of the cells;
and comparing
that with the viability and/or growth indicators) of wild type cells. The
level of expression
of the second allele can be less than 50% of the non-modified allele, less
than 30%, less
than 20%, and preferably less than 10%. Depending on the heterologous promoter
used, the
level of expression can be controlled by, for example, antibiotics, metal
ions, specific
chemicals, nutrients, pH, temperature, etc.
Candida albicans is used herein as an example which has been analyzed by
the GRACE methodology.
For example, C. albicans conditional gene expression using the GRACE
method was performed using CaKREI, CaKRES, CaKRE6, and CaKRE9 (Fig. 3).
CaKRES, CaKRE6, and CaKRE9 are predicted to be essential or conditionally
essential
(CaKRE9 null strains are nonviable on glucose but viable on galactose), in C.
albicans as
demonstrated by gene disruption using the Ura blaster method. CaKREI has been
demonstrated as a nonessential gene using the Ura blaster method in C.
albicans. Strains
heterozygous for the above genes were constructed by PCR-based gene disruption
method
using the CaSATl disruption cassette followed by tetracycline regulated
promoter
- 23 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
replacement of the native promoter of the wild type allele. Robust growth of
each of these
strains suggests expression proceeds normally in the absence of tetracycline.
When
tetracycline is added to the growth medium, expression of these tetracycline
promoter-
regulated genes is greatly reduced or abolished. In the presence of
tetracycline, the GRACE
strain cells containing each one of the three essential C. albicans genes
cited above stop
growing. As expected, only the CaKREI GRACE strain demonstrates robust growth
despite repression of CaKREI expression.
To further examine the utility of the GRACE method in target validation,
growth of four additional GRACE strains controlling expression of the known
essential
genes CaTUBI, CaALG7, CaAURI, and CaFKSI, as well as the predicted essential
gene
CaSAT2, and CaKREI were compared under inducing versus repressing conditions
(Fig. 4).
As expected, GRACE strains of CaTUBl, CaALG7, CaAURI and CaFKSI failed to grow
under repressing conditions, unlike the non-essential CaKREl GRACE strain.
Furthermore,
as predicted, the CaSAT2 GRACE strain demonstrates essentiality of this gene
in C.
albicans. The CaSAT2 gene, which has been engineered as a dominant selectable
marker
for use in,C. albicans, is a C. albicans gene that is homologous to a S.
cereviaiae gene but is
unrelated to the Satl gene of E. coli.
In all cases based on other disruption data that have been generated, this is
the expected response if the tetracycline regulated gene is repressed to a
level where it is
nonfunctional in the presence of tetracycline. Furthermore. in applying the
GRACE
methodology of conditional gene disruption to two additional C. albicans genes
(CaYPDI,
and CaYNLl94c) whose S cerevisiae counterpart is known not to be essential, no
inhibition
of growth was observed when these strains were incubated in the presence of
tetracycline.
These results establish that the method of conditional gene expression using a
GRACE
strain is a reliable indicator of gene essentiality.
Furthermore, the utility of the present method, as a rapid and accurate means
to identifying the complete set of essential genes in C. albicans, has been
demonstrated by
an analysis of the null phenotype of a large number of genes using the GRACE
two-step
method of gene disruption and conditional expression. Target genes were
selected as being
~g~ Specific and essential. Such genes are referred to as target essential
genes in the
screening assays described below.
A literature search identified reports of URA blaster-based gene disruption
experiments on a total of 89 genes, of which 13 genes were presumed to be
essential, based
on the inability to construct homozygous deletion strains. The 13 genes are
CaCCT8
(Rademacher et al., Microbiology, UK 144, 2951-2960 (1998)); CaFKSl (Mio et
al., J.
-24-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Bacteriol, 179, 4096-105 (1997); and Douglas, et al., Antimicrob Agents
Chemother 41,
2471-9 (1997)); CaHSP90 (Swoboda et al., Infect Immun 63, 4506-14 (1995));
CaKRE6
(Mio et al., J. Bacteriol 179, 2363-72 (1997)); CaNMTl (Weinberg et al., Mol
Microbiol 16,
241-50 (1995)); CaPRSl (Payne et al., J. Med. Vet. Mycol. 35, 305-12 (1997));
CaPSAI
(Care et al., Mol Microbiol 34, 792-798 (1999)); CaRAD6 (Care et al., Mol
Microbiol 34,
792-798 (1999)); CaSEC4 (Mao et al., J. Bacteriol 181, 7235-7242 (1999));
CaSECl4
(Monteoliva et al., Yeast 12, 1097=105 (1996)); CaSNFI (Petter et al., Infect
Immun. 65,
4909-17 (1997)); CaTOP2 (Keller, et al., Biochem J., 329-39 (1997)); and
CaEFT2
(Mendoza et al., Gene 229, 183-1991 (1999)). These 13 putatively essential
genes and
CaTUBl, CaALGI, and CaAURIof C. albicans are not initially identified by the
GRACE
method. However, GRACE strains containing modified alleles of any one of these
17 genes
and their uses are encompassed by the invention, for example, the CaTUBl ,
CaALGI , and
CaAURl GRACE strains in Fig. 4 and the CaKRE6 GRACE strain in Fig. 3. Any of
these
17 genes may be included as a control for comparisons in the methods of the
invention, or
1 S as a positive control for essentiality in the collections of essential
genes of the invention.
The nucleic acid molecules comprising a nucleotide sequence corresponding to
any of these
17 genes may be used in the methods of drug discovery of the invention as drug
targets, or
they may be included individually or in subgroups as controls in a kit or in a
nucleic acid
microarray of the invention.
In contrast to the use of conventional method, application of the GRACE
method has already identified significantly more C. albicans essential genes
than previously
determined by the collective efforts of the entire C. albicans research
community. The data
presented herewith establishes the speed inherent to the approach of the
invention and,
therefore, the feasibility of extending the GRACE method to the examination of
all the
genes of the C. albicans genome, the identification of the complete set of
essential genes of
this diploid fungal pathogen, and its application to other species.
An alternative method is available for assessing the essentiality of the
modified gene in a GRACE strain. According to the invention, repression of
expression of
the modified gene allele within a GRACE strain may be achieved by homologous
recombination-mediated excision of the gene encoding the transactivator
protein. In a
preferred embodiment, where conditional expression of a target gene is
achieved using the
tetracycline-regulated promoter, constitutive expression (under nonrepressing
conditions)
may be repressed by homologous recombination-mediated excision of the
transactivator
gene (TetR-GAL4AD). In this way, an absolute achievable repression level is
produced
independently of that produced by tetracycline-mediated inactivation of the
transactivator
- 25 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
protein. Excision of the transactivator gene is made possible by virtue of the
selectable
marker and integration strategy used in GRACE strain construction. Stable
integration of
the CaURA3-marked plasmid containing the TetR-GAL4AD transactivator gene into
the
CaLEU2 locus results in a tandem duplication of CaLEU2 flanking the integrated
plasmid.
S Counterselection on 5-FOA-containing medium can then be performed to select
for excision
of the CaURA3-marked transactivator gene and to directly examine whether this
alternative
repression strategy reveals the target gene to be essential.
Three examples of genes defined as essential on S-FOA containing medium
but lacking any detectable growth impairment on tetracycline supplemented
medium are the
genes, CaYCL052c, CaYNLl94c and CaYJR046c. Presumably, this is due to the
target gene
exhibiting a lower basal level of expression under conditions where the
transactivator gene
has been completely eliminated than its gene product incompletely inactivated
by addition
of tetracycline. Thus, the GRACE method offers two independent approaches for
the
determination of whether or not a given gene is essential for viability of the
host strain.
5.3.2 Virulence/Pathogenicity Genes
The present invention also provides methods of using the GRACE strains of
a diploid pathogenic organism to identify virulence/pathogenicity genes. In
addition to
uncovering essential genes of a pathogenic organism, the GRACE methodology
enables the
identification of other genes and gene products potentially relevant to the
screening of drugs
useful .for the treatment of diseases caused by the pathogenic organism.
Nonessential genes
and their gene products of a pathogen which nevertheless display indispensable
roles in the
pathogenesis process, may therefore serve as potential drug targets for
prophylactic drug
development and could be used in combination with existing cidal therapeutics
to improve
treatment strategies. Thus, genes and their products implicated in virulence
and/or
pathogenicity represent another important class of potential drug targets.
Moreover, some
of the genes implicated in virulence and pathogenicity may be species-
specific, and unique
to a particular strain of pathogen. It has been estimated that approximately 6-
7% of the
genes identified through the C. albicans sequencing project are absent in S
cerevisiae. This
represents as many as 420 Candida albicans-specific genes which potentially
participate in
the process of pathogenesis or virulence. Such a large scale functional
evaluation of this
gene set can only be achieved using the GRACE methodology of the invention.
Although essential genes provide preferred targets, value would also be
placed on those nonessential C. albicans specific genes identified. The
potential role of
nonessential C. albicans-specific genes in pathogenesis maybe evaluated and
prioritized
-26-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
according to virulence assays (e.g. buccal epithelial cell adhesion assays and
macrophage
assays) and various C. albicans infection studies (e.g. oral, vaginal,
systemic) using mouse
or other animal models. In the same manner described above for essential
genes, it is
equally feasible to demonstrate whether nonessential genes comprising the
GRACE strain
collection are required for pathogenicity in a cellular assay or in a mouse
model system.
Accordingly, GRACE strains that fail to cause fungal infection in mice under
conditions of
gene inactivation by tetracycline (or alternative gene inactivation means)
define the GRACE
virulence/pathogenicity subset of genes. More defined subsets of pathogenicity
genes, for
example those genes required for particular steps in pathogenesis (e. g.
adherence or
invasion) can be determined by applying the GRACE pathogenicity subset of
strains to in
vitro assays which measure the con esponding process. For example, examining
GRACE
pathogenicity strains in a buccal adhesion or macrophage assay by conditional
expression of
individual genes would identify those pathogenicity factors required for
adherence or cell
invasion respectively. Moreover, essential genes that display substantially
reduced
virulence and growth rate when only partially inactivated represent
"multifactorial" drug
targets for which even minimally inhibitory high specificity compounds would
display
therapeutic value.
Accordingly, to determine whether a gene contributes toward the
virulence/pathogenicity of a pathogenic organism in a host, a GRACE strain of
the pathogen
containing the modified alleles of the gene is allowed to infect host cells or
animals under
conditions wherein the second modified allele of the gene which is under
conditional
expression, is substantially underexpressed or not expressed. After the host
cells and/or
animals have been contacted with the GRACE strain for an appropriate period of
time, the
condition of the cells and/or animals is compared with cells and/or animals
infected by a
wild type strain under the same conditions. Various aspects of the infected
cell's
morphology, physiology, and/or biochemistry can be measured by methods known
in the art.
When an animal model is used, the progression of the disease, severity of the
symptoms,
and/or survival of the host can be determined. Any loss or reduction of
virulence or
pathogenicity displayed by the GRACE strain indicates that the gene modified
in the strain
contributes to or is critical to the virulence andlor pathogenicity of the
virus. Such genes are
referred to as target virulence genes in the screening assays described below.
In another aspect of the present invention, GRACE methodology can be used
for the identification and delineation of genetic pathways known to be
essential to the
development of pathogenicity. For example, extensive work in S. cerevisiae has
uncovered
a number of processes including cell adhesion, signal transduction,
cytoskeletal assembly,
-27-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
that play roles in the dimorphic transition between yeast and hyphal
morphologies. Deletion
of orthologous genes participating in functionally homologous cellular
pathways in
pathogenic fungi such as C. albicans, A. fumigatus, and C. neoformans, has
clearly
demonstrated a concomitant loss of virulence. Therefore, the use of GRACE
strains of
S orthologous genes found in C. albicans and other pathogenic fungi could
rapidly validate
potential antifungal drug target genes whose inactivation impairs hyphal
development and
pathogenicity.
5.3.3 Validation of Genes Encoding Drug Targets
Target gene validation refers to the process by which a gene product is
identified as suitable for use in screening methods or assays in order to find
modulators of
the function or structure of that gene product. Criteria used for validation
of a gene product
as a target for drug screening, however, may be varied depending on the
desired mode of
action that the compounds sought will have, as well as the host to be
protected.
In one aspect of the present invention, a set of GRACE strains identified and
grouped as having only modified alleles of essential genes can be used
directly for drug
screening.
In another aspect, the initial .set of essential genes is further
characterized
using, for example, nucleotide sequence comparisons, to identify a subset of
essential genes
which include only those genes specific to fungi - that is, a subset of genes
encoding
essential genes products which do not have homologs in a host of the pathogen,
such as
humans. Modulators, and preferably inhibitors, of such a subset of genes in a
fungal
pathogen of humans would be predicted to be much less likely to have toxic
side effects
when used to treat humans.
Similarly, other subsets of the larger essential gene set could be defined to
include only those GRACE strains carrying modified allele pairs that do not
have a
homologous sequence in one or more host (e.g., mammalian) species to allow the
detection
of compounds expected to be used in veterinary applications. In addition,
using other
homology criteria, a subset of GRACE strains could be identified that would be
used for the
detection of anti-fungal compounds active against agricultural pathogens,
inhibiting targets
that do not have homologs in the crop to be protected.
Current C. albicans gene disruption strategies identify nonessential genes
and permit the inference that other genes are essential, based on a failure to
generate a
homozygous null mutant. The null phenotype of a drug target predicts the
absolute
efficaciousness of the "perfect" drug acting on this target. For example, the
difference
-28-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
between a cidal (cell death) versus static (inhibitory growth) null terminal
phenotype for a
particular drug target. Gene disruption of CaERGIl, the drug target of
fluconazole, is
presumed to be essential based on the failure to construct a homozygous
CaERGII deletion
strain using the URA blaster method. However, direct evaluation of its null
phenotype
being cidal or static could not be performed in the pathogen, and only after
the discovery of
fluconazole was it possible to biochemically determine both the drug, and
presumably the
drug target to be static rather than as cidal. Despite the success fluconazole
enjoys in the
marketplace, its fungistatic mode of action contributes to its primary
limitation, i.e., drug
resistance after prolonged treatment. Therefore, for the first time, the
ability to identify and
evaluate cidal null phenotypes for validated drug targets within the pathogen
as provided by
the invention, now enables directed strategies to identifying antifungal drugs
that
specifically display a fungicidal mode of action.
Using a single GRACE strain or a desired collection of GRACE strains
comprising essential genes, one or more target genes can be directly evaluated
as displaying
either a cidal or static null phenotype. This is determined by first
incubating GRACE
strains under repressing conditions for the conditional expression of the
second allele for
varying lengths of time in liquid culture, and measuring the percentage of
viable cells
following plating a defined number of cells onto growth conditions which
relieve
repression. The percentage of viable cells that remain after return to non-
repressing
2U . conditions reflects either a cidal (low percent survival) or static (high
percent survival)
phenotype. Alternatively, .vital dyes such as methylene blue or propidium
iodide could be
used to quantify percent viability of cells for a particular strain under
repressing versus
inducing conditions. As known fungicidal drug targets are included in the
GRACE strain
collection (e.g CaAURl), direct comparisons can be made between this standard
fungicidal
drug target and novel targets comprising the drug target set. In this way each
member of
the target set can be immediately ranked and prioritized against an industry
standard cidal
drug target to select appropriate drug targets and screening assays for the
identification of
the most rapid-acting cidal compounds.
5.4 Essential Genes and Virulence Genes
5.4.1 Nucleic Acids Encoding Targets, Vectors, and Host Cells
By practice of the methods of the invention, the essentiality and the
contribution to virulence of substantially all the genes in the genome of an
organism can be
determined. The identities of essential genes and virulence genes of a diploid
pathogenic
-29-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
organism, such as Candida albicans, once revealed by the methods of the
invention, allow
the inventors to study their functions and evaluate their usefulness as drug
targets.
Information regarding the structure and function of the gene product of the
individual
essential gene or virulence gene allows one to design reagents and assays to
find compounds
that interfere with its expression or function in the pathogenic organism.
Accordingly, the
present invention provides information on whether a gene or its products) is
essential to
growth, survival, or proliferation of the pathogenic organism, or that a gene
or its products)
contributes to virulence or pathogenicity of the organism with respect to a
host. Based on
this information, the invention further provides, in various embodiments,
novel uses of the
nucleotide and/or amino acid sequences of genes that are essential and/or that
contributes to
virulence or pathogenicity of a pathogenic organism, for purpose of
discovering drugs that
act against the pathogenic organism. Moreover, the present invention provides
specifically
the use of this information to identify orthologs of these essential genes in
a non-pathogenic
yeast, such as Saccharomyces cerevisiae, and the use of these orthologs in
drug screening
methods. Although the nucleotide sequence of the orthologs of these essential
genes in S.
cerevisiae may be known, it was not appreciated that these S. cerevisiae genes
can be
useful for discovering drugs against pathogenic fungi.
As used herein, the terms "gene" and "recombinant gene" refer to nucleic
acid molecules comprising a nucleotide sequence encoding a polypeptide or a
biologically
active ribonucleic acid (RNA). The term can further include nucleic acid
molecules
comprising upstream, downstream, and/or intron nucleotide sequences. The term
"open
reading frame (ORF)," means a series of nucleotide triplets coding for amino
acids without
any termination codons and the triplet sequence is translatable into protein
using the codon
usage information appropriate for a particular organism.
As used herein, the term "target gene" refers to either an essential gene or a
virulence gene useful in the invention, especially in the context of drug
screening. The
terms "target essential gene" and "target virulence gene" will be used where
it is appropriate
to refer to the two groups of genes separately. However, it is expected that
some genes will
contribute to virulence and be essential to the survival of the organism. The
target genes of
~e invention may be partially characterized, fully characterized, or validated
as a drug
target, by methods known in the art and/or methods taught hereinbelow. As used
herein, the
term "target organism" refers to a pathogenic organism, the essential and/or
virulence genes
of which are useful in the invention.
The term "nucleotide sequence" refers to a heteropolymer of nucleotides,
including but not liriiited to ribonucleotides and deoxyribonucleotides, or
the sequence of
-30-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
these nucleotides. The terms "nucleic acid" and "polynucleotide" are also used
interchangeably herein to refer to a heteropolymer of nucleotides, which may
be unmodified
or modified DNA or RNA. For example, polynucleotides can be single-stranded or
double-
stranded DNA, DNA that is a mixture of single-stranded and double-stranded
regions,
hybrid molecules comprising DNA and RNA with a mixture of single-stranded and
double-
stranded regions. In addition, the polynucleotide can be composed of triple-
stranded regions
comprising DNA, RNA, or both. A polynucleotide can also contain one or
modified bases,
or DNA or RNA backbones modified for nuclease resistance or other reasons.
Generally,
nucleic acid segments provided by this invention can be assembled from
fragments of the
genome and short oligonucleotides, or from a series of oligonucleotides, or
from individual
nucleotides, to provide a synthetic nucleic acid.
The term "recombinant," when used herein to refer to a polypeptide or
protein, means that a polypeptide or protein is derived from recombinant (e.
g., microbial or
mammalian) expression systems. "Microbial" refers to recombinant polypeptides
or
proteins made in bacterial or fungal (e.g., yeast) expression systems. As a
product,
"recombinant microbial" defines a polypeptide or protein essentially
unaccompanied by
associated native glycosylation. Polypeptides or proteins expressed in most
bacterial
cultures, e. g., E coli, will be free of glycosylation modifications;
polypeptides or proteins
expressed in yeast will be glycosylated.
The term "expression vehicle or vector" refers to a plasmid or phage or virus,
for expressing a polypeptide from a nucleotide sequence. An expression vehicle
can
comprise a transcriptional unit, also referred to as an expression construct,
comprising an
assembly of (1) a genetic element or elements having a regulatory role in gene
expression,
for example, promoters or enhancers, (2) a structural or coding sequence which
is
transcribed into mRNA and translated into protein, and which is operably
linked to the
elements of (1); and (3)~appropriate transcription initiation and termination
sequences.
"Operably linked" refers to a link in which the regulatory regions and the DNA
sequence to
be expressed are joined and positioned in such a way as to permit
transcription, and
ultimately, translation. In the case of C. albicans, due to its unusual codon
usage,
modification of a coding sequence derived from other organisms may be
necessary to ensure
a polypeptide having the expected amino acid sequence is produced in this
organism.
Structural units intended for use in yeast or eukaryotic expression systems
preferably
include a leader sequence enabling extracellular secretion of translated
protein by a host
cell. Alternatively, where a recombinant protein is expressed without a leader
or transport
sequence, it may include an N-terminal methionine residue. This residue may or
may not be
-31 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
subsequently cleaved from the expressed recombinant protein to provide a final
product.
The term "recombinant host cells" means cultured cells which have stably
integrated a recombinant transcriptional unit into chromosomal DNA or carry
stably the
recombinant transcriptional unit extrachromosomally. Recombinant host cells as
defined
S herein will express heterologous polypeptides or proteins, and RNA encoded
by the DNA
segment or synthetic gene in the recombinant transcriptional unit. This term
also means
host cells which have stably integrated a recombinant genetic element or
elements having a
regulatory role in gene expression, for example, promoters or enhancers.
Recombinant
expression systems as defined herein will express RNA, polypeptides or
proteins
endogenous to the cell upon induction of the regulatory elements linked to the
endogenous
DNA segment or gene to be expressed. The cells can be prokaryotic or
eukaryotic.
The term "polypeptide" refers to the molecule form by joining amino acids to
each other by peptide bonds, and may contain amino acids other than the twenty
commonly
used gene-encoded amino acids. The term "active polypeptide" refers to those
forms of the
polypeptide which retain the biologic and/or immunologic activities of any
naturally
occurring polypeptide. The term "naturally occurring polypeptide" refers to
polypeptides
produced by cells that have not been genetically engineered and specifically
contemplates
various polypeptides arising from post-translational modifications of the
polypeptide
including, but not limited to, proteolytic processing, acetylation,
carboxylation,
glycosylation, phosphorylation, lipidation and acylation.
The term ".isolated" as used herein refers to a nucleic acid or polypeptide
separated from at least one macromolecular component (e.g., nucleic acid or
polypeptide)
present with the nucleic acid or polypeptide in its natural source. In one
embodiment, the
polynucleotide or polypeptide is purified such that it constitutes at least
95% by weight,
more preferably at least 99.8% by weight, of the indicated biological
macromolecules
present (but water, buffers, and other small molecules, especially molecules
having a
molecular weight of less than 1000 daltons, can be present).
Table II lists a set of fungal specific genes that are demonstrated to be
essential in C. albicans when conditionally expressed under the tetracycline
repression
system in the respective GRACE strains or when the gene encoding the
transactivator
protein is excised in the respective GRACE strain.in a 5-FOA assay.
-32-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Table II
Gene designationDNA Protein PrimerPrimerPrimerPrimerPrimerPrimer
S ID Se ID KOu KOdn tet tet A B
a do
CaYBR070C SAT21 63 124 185 246 307 368 429
CaYBR167C POP72 64 125 186 247 308 369 430
CaYBR243C ALG73 65 126 187 248 309 370 431
CaYCL031C RRP74 66 127 188 249 310 371 432
CaYDL105W 5 67 128 189 250 311 372 433
CaYDL153C SAS106 68 129 190 251 312 373 434
CaYDR052C DBF47 69 130 191 252 313 374 435
CaYDR118W APC48 70 131 192 253 314 375 436
CaYDR361C 9 71 132 193 254 315 376 437
CaYDR412W 10 72 133 194 255 316 377 438
CaYDR498C SEC2011 73 134 195 256 317 378 439
CaYER026C CHO112 74 135 196 257 318 379 440
CaYGR090W 13 75 136 197 258 319 380 441
CaYGR245C 14 76 137 198 259 320 381 442
CaYHR007C ERGI115 77 138 199 260 321 382 443
CaYHR036W 16 78 139 200 261 322 383 444
CaYHR058C MED617 79 140 201 262 323 384 445
CaYHR118C ORC618 80 141 202 263 324 385 446
CaYHR172W (SPC9719 81 142 203 264 325. 386 447
CaYHR196VV 20 82 143 204 265 326' 387 448
CaYIROI1C(STS121 83 144 205 266 327 388 449
CaYJL069C 22 84 145 206 267 328 389 450
CaYJL090C DPB1123 85 146 207 268 329, 390 451
CaYJR041C 24 86 147 208 269 330' 391 452
CaYJR112W F1 25 87. 148 209 270 331 392 453
CaYKL004W AUR126 88 149 210 271 332 393 454
CaYKL033 W 27 89 150 211 272 333 394 455
CaYKR025W RPC3728 90 151 212 273 334 395 456
CaYKR063C LAS129 91 152 213 274 335 396 457
CaYKR071C 30 92 153 214 275 336 397 458
CaYKR081C 31 93 154 215 276 337 398 459
CaYKR083C 32 94 155 216 277 338 399 460
CaYLL003W SFI133 95 156 217 278 339 400 461
CaYLR002C 34 96 157 218 279 340 401 462
CaYLR103C CDC4535 97 158 219 280 341 402 463
CaYLR342W FKS136 98 159 220 281 342 403 464
CaYLR355C ILVS37 99 160 221 282 343 404 465
CaYML025C YML638 100 161 222 283 344 405 466
CaYML085C TUB139 101 162 223 284 345 406 467
CaYMR149W SWP140 102 163 224 285 346 407 468
CaYMR200W ROT141 103 164 225 286 347 408 469
CaYMR220W ERG842 104 165 226 287 348 .409 470
CaYMR277W FCPI43 105 166 227 288 349 410 471
CaYNL132W 44 106 167 228 289 350 411 472
CaYNL149C 45 107 168 229 290 351 412 473
CaYNL151C RPC3146 108 169 230 291 352 413 474
CaYNL181W 47 109 170 231 292 353 414 475
- 33 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
CaYNL232W CSL448 I10 171 232 293 354 415 476
CaYNL245C 49 111 172 233 294 355 416 477
CaYNL256W 50 112 173 234 295 356 417 478
CaYNL260C 51 113 174 235 296 357 418 479
CaYOR004W 52 114 175 236 297 358 419 480
CaYOR075W UFE153 115 176 237 298 359 420 481
CaYOR148C SPP254 116 177 238 299 360 421 482
CaYOR206W 55 117 178 239 300 361 422 483
CaYOR287C 56 118 179 240 301 362 423 484
CaYPL128C TBF157 119 180 241 302 363 424 485
CaYPL160W CDC6058 120 181 242 303 364 425 486
CaYPL228W CET159 121 182 243 304 365 426 487
CaYPR165W RHO160 122 183 244 305 366 427 488
CaYPR175W DPB261 123 184 245 306 367 428 489
CaYPL160W CDC6062 N/A 181 242 303 364 425 486
In one embodiment, the present invention provides the identities of 61
essential genes. Although the nucleotide sequence and the reading frame of a
number of
these genes are known, the fact that these genes are essential to the growth
and/or survival
of Candida albicans was not known until the inventors' discovery. Thus, the
uses of these
genes and their gene products are encompassed by the present invention. Also
provided in
Table II are SEQ ID NOs: that are used herein to identify the open reading
frame, the
deduced amino acid sequence and related oligonucleotide sequences for each
identified
essential gene.
Accordingly, SEQ ID NO:1 through to SEQ ID N0:62 each identifies a
nucleotide sequence of the opening reading frame (ORF) of an identified
essential gene.
The nucleotide sequences labeled as SEQ ID NO:1-62 were obtained from a
Candida
w albicans genomic sequence database version 6 assembled by the Candida
albicans
Sequencing Project and is accessible by Internet at the web sites of Stanford
University and
University of Minnesota (See http://www-sequence.stanford.edu:8080/ and
http://alces.med.umn.edu/Candida.html).
The predicted amino acid sequence of the identified essential genes are set
forth in SEQ ID N0:63 through to SEQ ID N0:123 which are obtained by
conceptual
translation of the nucleotide sequences of SEQ ID NO: 1 through to 61 once the
reading
frame is determined. As it is well known in the art, the codon CTG is
translated to a serine
residue in C. albicans, instead of the usual leucine in other organisms.
Accordingly, the
conceptual translation of the ORF is performed using the codon usage of C.
albicans.
The DNA sequences were generated by sequencing reactions and may
contain minor errors which may exist as misidentified nucleotides, insertions,
and/or
deletions. However, such minor errors, if present, in the sequence database
should not
-34-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
disturb the identification of the ORF as an essential gene of the invention.
Since clones
containing the ORF are available, one can readily repeat the sequencing and
correct the
minor error(s). Moreover, minor sequence errors do not affect the construction
of GRACE
strains and the uses of the GRACE strains, since these methods do not require
absolute
sequence identity between the chromosomal DNA sequences and the sequences of
the gene
in the primers or recombinant DNA. In some instances, the correct reading
frame of the C.
albicans gene can be identified by comparing its overall amino acid sequence
with known S
cerevisiae sequences.
Thus, in one embodiment of the invention, conceptual translation of the
nucleotide sequence of SEQ ID NO: 62 leads to an apparently premature
termination of the
opening reading frame when compared to its ortholog in S. cerevisiae. To
maintain the
reading frame, four nucleotides were added to create SEQ ID NO: 58 which
results in the
amino acid sequence of SEQ ID NO: 120. In another embodiment, the invention
provides
the genomic sequence of an identified essential gene, wherein the genomic
sequence as set
forth in SEQ ID NO: 490 contains an intron. The unpublished nucleotide
sequence which
does not contain intron sequence and encodes a protein is set forth in SEQ ID
NO: 39.
SEQ ID N0:124-486 refers to oligonucleotide primers and probes that were
designed for and used in the construction of the GRACE strain for the
corresponding
identified essential gene. (i.e., SEQ ID N0:124-184 knockout upstream primer
(KO-I1P);
SEQ ID N0:185-245 knockout downstream primer (KO-Down); SEQ ID N0:246-306
tetracycline promoter upstream primer (Tet-Up); SEQ ID N0:307-367 Tetracycline
promoter downstream primer (Tet-Down); and SEQ ID N0:368-489 primers for
identification of the respective GRACE strains (primers A and B). Therefore,
each set of
oligonucleotides can be used to identify a unique essential gene and a unique
GRACE
strain, e.g. by hybridization, or PCR.
The essential genes listed in Table II can be obtained using cloning methods
well known to those of skill in the art, and include but are not limited to
the use of
appropriate probes to detect the genes within an appropriate cDNA or gDNA
(genomic'
DNA) library. (See, for example, Sambrook et al., 1989, Molecular Cloning: A
Laboratory
Manual, Cold Spring Harbor Laboratories, which is incorporated herein by
reference in its
entirety.) Probes for the sequences identified herein can be synthesized based
on the DNA
sequences disclosed herein in SEQ ID NO:1-62.
As used herein, "target gene" i.e. essential and/or virulence gene) refers to
(a) a gene containing at least one of the DNA sequences and/or fragments
thereof that are
set forth in SEQ ID NO:1 through to SEQ ID N0:62; (b) any DNA sequence or
fragment
-35-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
thereof that encodes the amino acid sequence that are set forth in SEQ ID
N0:63 through to
SEQ ID N0:123 using the universal genetic code or the codon usage of C.
albicans; (c) any
DNA sequence that hybridizes to the complement of the nucleotide sequences set
forth in
SEQ ID NO:I through to SEQ ID N0:62 under stringent conditions, e.g.,
hybridization to
filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about
45°C followed by
one or more washes in 0.2xSSC/0.1% SDS at about SO-65°C, or under
highly stringent
conditions, e.g., hybridization to filter-bound nucleic acid in 6xSSC at about
45°C followed
by one or more washes in O.IxSSC/0.2% SDS at about 68°C, or under other
hybridization
conditions which are apparent to those of skill in the art (see, for example,
Ausubel, F.M. et
al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green
Publishing
Associates, Inc. and John Wiley & Sons, Inc., New York, at pp. 6.3.1-6.3.6 and
2.10.3).
Preferably, the polynucleotides that hybridize to the complements of the DNA
sequences
disclosed herein encode gene products, e.g., gene products that are
functionally equivalent
to a gene product encoded by a target gene. As described above, target gene
sequences
include not only degenerate nucleotide sequences that encode the amino acid
sequences of
SEQ ID N0:63 to 123 in C. albicans, but also degenerate nucleotide sequences
that when
translated in organisms other than C Albicans, would yield a polypeptide
comprising one of
the amino acid sequences of SEQ ID N0:63 to 123, or a fragment thereof. One of
skill in
the art would know how to select the appropriate codons or modify the
nucleotide sequences
of SEQ ID NO: 1 to 62 when using the target gene sequences in G albicans or in
other .
organisms. Moreover, the term "target gene" encompasses genes that are
naturally
occurring in Saccharomyces cerevisiae or variants thereof, that share
extensive nucleotide
sequence homology with C albicans genes having one of the DNA sequences that
are set
forth in SEQ ID NO:1 through to SEQ ID N0:62, i.e., the orthologs in S.
cerevisiae. It is
contemplated that methods for drug screening that can be applied to C.
albicans genes can
also be applied to orthologs of the same genes in the non-pathogenic S.
cerevisiae.
In another embodiment, the invention also encompasses the following
polynucleotides, host cells expressing such polynucleotides and the expression
products of
such nucleotides: (a) polynucleotides that encode portions of target gene
product that
corresponds to its functional domains, and the polypeptide products encoded by
such
nucleotide sequences, and in which, in the case of receptor-type gene
products, such
domains include, but are not limited to signal sequences, extracellular
domains (ECD),
transmembrane domains (TM) and cytoplasmic domains (CD); (b) polynucleotides
that
encode mutants of a target gene product, in which all or part of one of its
domains is deleted
or altered, arid which, in the case of receptor-type gene products, such
mutants include, but
-36-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
are not limited to, mature proteins in which the signal sequence is cleaved,
soluble receptors
in which all or a portion of the TM is deleted, and nonfunctional receptors in
which all or a
portion of CD is deleted; and (d) polynucleotides that encode fusion proteins
containing a
target gene product or one of its domains fused to another polypeptide.
The invention also includes polynucleotides, preferably DNA molecules, that
hybridize to, and are therefore the complements of, the DNA sequences of the
target gene
sequences. Such hybridization conditions can be highly stringent or less
highly stringent, as
described above and known in the art. The nucleic acid molecules of the
invention that
hybridize to the above described DNA sequences include oligodeoxynucleotides
("oligos")
which hybridize to the target gene under highly stringent or stringent
conditions. In general,
for oligos between 14 and 70 nucleotides in length the melting temperature
(Tm) is
calculated using the formula: Tm(°C) = 81.5 + 16.6(log[monovalent
cations (molar)] + 0.41
(% G+C) - (500/N)
where N is the length of the probe. If the hybridization is carried out in a
solution
containing formamide, the melting temperature may be calculated using the
equation:
Tm(°C) = 81.5 + 16.6(log[monovalent cations (molar)]) + 0.41(%
G+C) -
(0.61 ) (% formamide) - (500/N).
where N is the length of the probe. In general, hybridization is carried out
at about
20-25 degrees below Tm (for DNA-DNA hybrids) or about 10-15 degrees below Tm
(for
RNA-DNA hybrids). Other exemplary highly stringent conditions may refer,. e.
g. , to
.washing in 6xSSC/0.05% sodium pyrophosphate at 37°C (for 14-base
oligos), 48°C (for 17-
base oligos), SS°C (for 20-base oligos), and 60°C (for 23-base
oligos). Examples of such
oligos are set forth in SEQ ID N0:124-489.
These nucleic acid molecules can encode or act as target gene antisense
molecules, useful, for example, in target gene regulation and/or as antisense
primers in
. amplification reactions of target gene nucleotide sequences. Further, such
sequences can be
used as part of ribozyme and/or triple helix sequences, also useful 'for
target gene regulation.
Still further, such molecules can be used as components of diagnostic methods
whereby the
presence of the pathogen can be detected. The uses of these nucleic acid
molecules are
discussed in detail below.
Fragments of the target genes of the invention can be at least 10 nucleotides
in length. In alternative embodiments, the fragments can be about 20, 30, 40,
50, 60, 70, 80,
90, 100, 200, 300, 400, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500,
5000 or more
contiguous nucleotides in length. Alternatively, the fragments can comprise
nucleotide
sequences that encode at least 10, 20, 30, 40, S0, 100, 150, 200, 250, 300,
350, 400, 450 or
-37-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
more contiguous amino acid residues of the target gene products. Fragments of
the target
genes of the invention can also refer to exons or introns of the above
described nucleic acid
molecules, as well as portions of the coding regions of such nucleic acid
molecules that
encode functional domains such as signal sequences, extracellular domains
(ECD),
transmembrane domains (TM) and cytoplasmic domains (CD).
5.4.2 Homologous Target Genes
In addition to the nucleotide sequences of Candida albicans described above,
homologs or orthologs of these target gene sequences, as can be present in
other species, can
be identified and isolated by molecular biological techniques well known in
the art, and
without undue experimentation, used in the methods of the invention. For
example,
homologous target genes in Aspergillus fumigatus, Aspergillus flavus,
Aspergillus niger,
Coccidiodes immitis, Cryptococcus neoformans, Histoplasma capsulatum,
Phytophthora
infestans, Puccinia seconditii, Pneumocystis carinii, or any species falling
within the genera
of any of the above species. Other yeasts in the genera of Candida,
Saccharomyces;
Schizosaccharomyces, Sporobolomyces, Torulopsis, Trichosporon, Tricophyton,
Dermatophytes, Microsproum, Wickerhamia, Ashbya. Blastomyces, Candida,
Citeromyces,
Crebrothecium, Cryptococcus, Debaryomyces, Endomycopsis, Geotrichum,
Hansenula,
Kloeckera, Kluveromyces, Lipomyces, Pichia, Rhodosporidium, Rhodotorula, and
Yarrowia
~.e also contemplated. Also included are homologs of these target gene
sequences can be
identified im and isolated from animal fugal pathogens such as Aspergillus
fumigatus,
Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida
parapsilopsis, Candida
krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis,
Fusarium
oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon
beigelii,
Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera,
or the plant
fungal pathogens, such as Alternaria solanii, Botrytis cinerea, Erysiphe
graminis,
Magnaporthe grisea, Puccinia recodita, Sclerotinia sclerotiorum, Septoria
triticii, Tilletia
controversa, Ustilago maydis, Yenturia inequalis, Verticullium dahliae or any
species
falling within the genera of any of the above species.
Accordingly, the present invention provides nucleotide sequences that are
hybridizable to the polynucleotides of the target genes, and that are of a
species other than
Saccharomyces cerevisiae and Candida albicans. In one embodiment, the present
invention
encompasses an isolated nucleic acid comprising a nucleotide sequence that is
at least 50%
identical to a nucleotide sequence selected from the group consisting of SEQ
ID No. 1
through to SEQ ID N0:62. In another embodiment, the present invention
encompasses
-38-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
an isolated nucleic acid comprising a nucleotide sequence that hybridizes
under medium
stringency conditions to a second nucleic acid that consists of a nucleotide
sequence
selected from the group consisting of SEQ ID NO:1 through to SEQ ID N0:62.
In yet another embodiment, the present invention includes an isolated nucleic
acid comprising a nucleotide sequence that encodes a polypeptide the amino
acid sequence
of which is at least 50% identical to an amino acid sequence selected from the
group
consisting of SEQ ID No.63 through to 123, wherein the polypeptide is that of
a species
other than Saccharomyces cerevisiae and Candida albicans.
Although the nucleotide sequences and amino acid sequences of homologs or
orthologs of such genes in S. cerevisiae is mostly published, uses of such
homologs or
orthologs in S. cerevisae in drug screening are not known and are thus
specifically provided
by the invention. To use such nucleotide and/or amino acid sequences of S
cerevisiae,
public databases, such as Stanford Genomic Resources (www-
genome.stanford.edu),
Munich Information Centre for Protein Sequences (www.mips.biochem.mpg.del, or
proteome (www.proteome.coml may be used to identify and retrieve the
sequences. In
cases where the ortholog or homolog of a C. albicans gene in S cerevisiae is
known, the
name of the S. cerevisiae gene is indicated in parenthesis in column 1 of
Table I. Orthologs
of S. cerevisiae can also be identified by hybridization assays using nucleic
acid probes
consisting of any one of the nucleotide sequences of SEQ ID NO: 1 to 61, and
490.
The nucleotide sequences of the invention still further include nucleotide
sequences that have at least 40%, 45%, SS%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,
95%,
98% or more nucleotide sequence identity to the nucleotide sequences set forth
in SEQ ID
NO:1 through to SEQ ID N0:62. The nucleotide sequences of the invention also
include
nucleotide sequences that encode polypeptides having at least 25%, 30%, 40%,
50%, 55%,
60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or higher amino acid sequence
identity
or similarity to the amino acid sequences set forth in SEQ ID N0:63 through
to123.
To determine the percent identity of two amino acid sequences or of two
nucleotide sequences, the sequences are aligned for optimal comparison
purposes (e.g., gaps
can be introduced in the sequence of a first amino acid or nucleotide sequence
for optimal
alignment with a second amino acid or nucleotide sequence). The amino acid
residues or
nucleotides at corresponding amino acid positions or nucleotide positions are
then
compared. When a position in the first sequence is occupied by the same amino
acid
residue or nucleotide as the corresponding position in the second sequence,
then the
molecules are identical at that position. The percent identity between the two
sequences is a
action of the number of identical positions shared by the sequences (i.e., %
identity =
-39-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
number of identical overlapping positions/total number of positions x 100%).
In one
embodiment, the two sequences are the same length.
The determination of percent identity between two sequences can also be
accomplished using a mathematical algorithm. A preferred, non-limiting example
of a
mathematical algorithm utilized for the comparison of two sequences is the
algorithm of
Karlin and Altschul (1990) Proc. Natl. Acad. Sci. U.S.A. 87:2264-2268,
modified as in
Karlin and Altschul (1993) Proc. Natl. Acad Sci. U.S.A. 90:5873-5877. Such an
algorithm
is incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990,
J. Mol.
Biol. 215:403-0. BLAST nucleotide searches can be performed with the NBLAST
nucleotide program parameters set, e.g., for score=100, wordlength=12 to
obtain nucleotide
sequences homologous to a nucleic acid molecules of the present invention.
BLAST protein
searches can be performed with the XBLAST program parameters set, e.g., to
score-50,
wordlength=3 to obtain amino acid sequences homologous to a protein molecule
of the
present invention. To obtain gapped alignments for comparison purposes, Gapped
BLAST
can be utilized as described in Altschul et al., 1997, Nucleic Acids Res.
25:3389-3402.
Alternatively, PSI-BLAST can be used to perform an iterated search which
detects distant
relationships between molecules (Id.). When utilizing BLAST, Gapped BLAST, and
PSI-
Blast programs, the default parameters of the respective programs (e.g., of
XBLAST and '
NBLAST) can be used (see, e.g., http://www.ncbi.nlm.nih.gov). Another
preferred, non-
limiting example of a mathematical algorithm utilized for the comparison of
sequences is
the algorithm of Myers and Miller, (1988) CABIOS 4:1.1-17. Such an algorithm
is
incorporated in the ALIGN program (version 2.0) which is part of the GCG
sequence
alignment software package. When utilizing the ALIGN program for comparing
amino acid
sequences, a PAM120 weight residue table, a gap length penalty of 12, and a
gap penalty of
4 can be used.
To isolate homologous target genes, the C. albicans target gene sequence
described above can be labeled and used to screen a cDNA library constructed
from mRNA
obtained from the organism of interest. Hybridization conditions should be of
a lower
stringency when the cDNA library was derived from an organism different from
the type of
organism from which the labeled sequence was derived. cDNA screening can also
identify
clones derived from alternatively spliced transcripts in the same or different
species.
Alternatively, the labeled fragment can be used to screen a genomic library
derived from the
organism of interest, again, using appropriately stringent conditions. Low
stringency
conditions will be well known to those of skill in the art, and will vary
predictably
depending on the specific organisms from which the library and the labeled
sequences are
-40-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
derived. For guidance regarding such conditions see, for example, Sambrook et
al., 1989,
Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; and
Ausubel et
al., 1989, Current Protocols in Molecular Biology, (Green Publishing
Associates and Wiley
Interscience, N.Y.).
Further, a homologous target gene sequence can be isolated by performing a
polymerase chain reaction (PCR) using two degenerate oligonucleotide primer
pools
designed on the basis of amino acid sequences within the target gene of
interest. The
template for the reaction can be cDNA obtained by reverse transcription of
mRNA prepared
from the organism of interest. The PCR product can be subcloned and sequenced
to ensure
that the amplified sequences represent the sequences of a homologous target
gene sequence.
The PCR fragment can then be used to isolate a full length cDNA clone by a
variety of methods well known to those of ordinary skill in the art. -
Alternatively, the
labeled fragment can be used to screen a genomic library.
PCR technology can also be utilized to isolate full length cDNA sequences.
For example, RNA can be isolated, following standard procedures, from an
organism of
interest. A reverse transcription reaction can be performed on the RNA using
an
oligonucleotide primer specific for the most 5' end of the amplified fragment
for the priming
of first strand synthesis. The resulting RNA/DNA hybrid can then be "tailed"
with guanines
using a standard terminal transferase reaction, the hybrid can be digested
with RNAase H,
and second strand synthesis can then be primed with a poly-C primer. Thus,
cDNA
sequences upstream of the amplified fragment can easily be isolated. For a
review of
cloning strategies which can be used, see e.g., Sambrook et al., 1989,
Molecular Cloning, A
Laboratory Manual, Cold Springs Harbor Press, N.Y.; and Ausubel et al., 1989,
Current
Protocols in Molecular Biology, (Green Publishing Associates and Wiley
Interscience,
N.Y.).
Additionally, an expression library can be constructed utilizing DNA isolated
from or cDNA synthesized from the organism of interest. In this manner, gene
products
made by the homologous target gene can be expressed and screened using
standard antibody
screening techniques in conjunction with antibodies raised against the C.
albicans gene
product, as described, below. (For screening techniques, see, for example,
Harlow, E. and
Lane, eds., 1988, "Antibodies: A Laboratory Manual," Cold Spring Harbor Press,
Cold
Spring Harbor). Library clones detected via their reaction with such labeled
antibodies can
be purified and subjected to sequence analysis by well known methods.
Alternatively, homologous target genes or polypeptides may be identified by
searching a database to identify sequences having a desired level of homology
to a target
-41 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gene or polypeptide involved in proliferation, virulence or pathogenicity. A
variety of such
databases are available to those skilled in the art, including GenBank and
GenSeq. In
various embodiments, the databases are screened to identify nucleic acids with
at least 97%,
at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least
60%, at least
50%, or at least 40% identity to a target nucleotide sequence, or a portion
thereof. In other
embodiments, the databases are screened to identify polypeptides having at
least 99%, at
least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least
60%, at least 50%,
at least 40% or at least 25% identity or similarity to a polypeptide involved
in proliferation,
virulence or pathogenicity or a portion thereof.
Alternatively, functionally homologous target sequences or polypeptides may be
identified by creating mutations that have phenotypes by removing or altering
the fimction of a
gene. This can be done for one or all genes in a given fungal species
including, for example:
Saccharomyces cerevisiae, Candida albicans, and Aspergillus fumigates. Having
mutants in the
genes of one fungal species offers a method to identify fimctionally similar
genes (orthologs) or
related genes (paralogs) in another species, by use of a functional
complementation test.
A library of gene or cDNA copies of messenger RNA of genes can be made
from a given species, e.g. Candida albicans, and the library cloned into a
vector permitting
expression (for example, with the Candida albicans promoters or a
Saccharomyces cerevisiae
promoter) of the genes in a second species, e.g. Saccharomyces cerevisiae.
Such a library is
referred to as a "heterologous library." Transfornlation of the Candida
albicans heterologous
library into a defined mutant of Saccharomyces cerevisiae that is functionally
deficient with
respect to the identified gene, and screening or selecting for a gene in the
heterologous library
that restores phenotypic function in whole or in part of the mutational defect
is said to be
"heterologous fimctional complementation" and in this example, permits
identification of gene
in Candida albicarrs that are functionally related to the mutated gene in
Saccharomyces
cerevisiae. Inherent in this fimctional-complementation method, is the ability
to restore gene
fimction without the requirement for sequence similarity of nucleic acids or
polypeptides; that is,
this method permits interspecific identification of genes with conserved
biological fimction,
even where sequence similarity comparisons fail to reveal or suggest such
conservation.
In those instances in which the gene to be tested is an essential gene, a
number
of possibilities exist regarding performing heterologous fiznctional
complementation tests. The
mutation in the essential gene can be a conditional allele, including but not
limited to, a
temperature-sensitive allele, an allele conditionally expressed from a
regulatable promoter, or an
3 S ~lele that has been rendered the mRNA transcript or the encoded gene
product conditionally
unstable. Alternatively, the strain carrying a mutation in an essential gene
can be propagated
-42-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
using a copy of the native gene (a wild type copy of the gene mutated from the
same species) on
a vector comprising a marker that can be selected against, permitting
selection for those strains
carrying few or no copies of the vector and the included wild type allele. A
strain constructed in
this manner is transformed with the heterologous library, and those clones in
which a
heterologous gene can functionally complement the essential gene mutation, are
selected on
medium non-permissive for maintenance of the plasmid carrying the wild type
gene.
In the following example, the identification, by functional complementation,
of a
Candida albicans homolog of a Saccharomyces cerevisiae gene, KRE 9, is
described. (Lussier et
al. 1998, "The Candida albicans KRE 9 gene is required for cell wall ~i-1,6-
glucan synthesis and
is essential for growth on glucose," Proc. Natl. Acad Sci. USA 95: 9825-30).
The host strain
was a Saccharomyces cerevisiae haploid null mutant in KRE 9, kre 9::HIS3,
which has a severe
growth defect phenotype. The host strain carried a wild type copy of the
native Saccharomyces
cerevisiae KRF 9 gene on a LYS-2 based pRS317 shuttle vector and was
transformed with a
Candida albicans genomic library. This heterologous library was constructed
using, as a vector,
~e multicopy plasmid YEp352, which carries the URA3 gene as a selectable
marker. To screen
for plasmids supporting growth of the kre 9::HIS 3 mutant host, approximately
20,000 colonies
capable of growth in the absence of histidine, lysine, and uracil, were
replica-plated onto
minimal medium containing a-amino adipate as a nitrogen source to allow
selection for cells
that have lost the LYS2 plasmid-based copy of KRE 9 and that possess a copy of
a
fictionally-complementing Candida albicans ortholog, CaKRE 9. These cells were
tested
further for loss of the pRS317-KRE 9 plasmid by their inability to grow in the
absence of lysine,
and YEp352-based Candida albicans genomic DNA was recovered from them. On
retransformation of the Saccharomyces cerevisiae kre 9::HIS3 mutant, a
specific genomic insert
of 8kb of Candida albicans was recovered that was able to restore growth
partially. Following
fiirther subcloning using functional complementation for selection, a 1.6 kb
DNA fi~agment was
obtained that contained the fimctional Candida albicans KRE 9 gene.
A heterologous fimctional complementation test is not restricted to the
exchange
of genetic information between Candida albicans and Saccharomyces cerevisiae;
functional
complementation tests can be performed, as described above, using any pair of
fungal species.
For example, the CRE1 gene of the fungus Sclerotininia sclerotiorum can
fimctionally
complement the creAD30 mutant of the CREA gene of Aspergillus nidulans (see
Vautard et al.
1999, "The glucose repressor gene CRE1 from Sclerotininia sclerotiorum is
fi.mctionally related
to CREA from Aspergillus nidulans but not to the Mig proteins from
Saccharomyces
cerevisiae," FEBS Lett. 453: 54-58).
In yet another embodiment, where the source of nucleic acid deposited on a
gene
- 43 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
expression array and the source of the nucleic acid probe being hybridized to
the array are from
two different species of organisms, the results allow rapid identification of
homologous genes in
the two species.
In yet another embodiment, the invention also encompasses (a) DNA vectors
that contain a nucleotide sequence comprising any of the foregoing coding
sequences of the
target gene and/or their complements (including antisense); (b) DNA expression
vectors that
contain a nucleotide sequence comprising any of the foregoing coding sequences
operably linked
with a regulatory element that directs the expression of the coding sequences;
and (c) genetically
engineered host cells that contain any of the foregoing coding sequences of
the target gene
operably linked with a regulatory element that directs the expression of the
coding sequences in
the host cell. Vectors, expression constructs, expression vectors, and
genetically engineered host
cells containing the coding sequences of homologous target genes of other
species (excluding S
cerevisiae) are also contemplated. Also contemplated are genetically
engineered host cells
containing mutant alleles in homologous target genes of the other species. As
used herein,
regulatory elements include but are not limited to inducible and non-inducible
promoters,
enhancers; operators and other elements known to those skilled in the art that
drive and regulate
expression. Such regulatory elements include but are not limited to the lac
system, the trp
system, the tet system and other antibiotic-based repression systems
(e.g.PIP), the TAC system,
the TRC system, the major operator and promoter regions of phage A, the
control regions of fd
coat protein, and the fungal promoters for 3-phosphoglycerate kinase, acid
phosphatase, the yeast
mating pheromone responsive promoters (e.g. STE2 and STE3), and promoters
isolated from
genes involved in carbohydrate metabolism (e.g. GAL promoters), phosphate-
responsive
promoters (e.g. PHOS), or amino acid metabolism (e.g. MET genes). The
invention includes
fi~agments of any of the DNA vector sequences disclosed herein.
A variety of techniques can be utilized to further characterize the identified
essential genes and virulence genes. First, the nucleotide sequence of the
identified genes can be
used to reveal homologies to one or more known sequence motifs which can yield
information
regarding the biological fimction of the identified gene product. Computer
programs well
known in the art can be employed to identify such relationships. Second, the
sequences of the
identified genes can be used, utilizing standard techniques such as in situ
hybridization; to place
the genes onto chromosome maps and genetic maps which can be correlated with
similar maps
constructed for another organism, e.g., Saccharomyces cerevisiae. The
information obtained
through such characterizations can suggest relevant methods for using the
polynucleotides and
polypeptides for discovery of drugs against Candida albicans and other
pathogens.
~ Methods for performing the uses listed above are well known to those skilled
in
-44-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
the art. References disclosing such methods include without limitation
"Molecular Cloning: A
Laboratory Manual," 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J.,
E. F. Fritsch
and T. Maniatis eds., 1989, and "Methods in Enzymology: Guide to Molecular
Cloning
Techniques," Academic Press, Berger, S. L. and A. R. Kimmel eds., 1987. Many
of the uses of
the polynucleotides and polypeptides of the identified essential genes are
discussed in details
hereinbelow.
5.4.3 Target Gene Products
The target gene products used and encompassed in the methods and
compositions of the present invention include those gene products (e.g., RNA
or proteins) that
are encoded by the target essential gene sequences as described above, such
as, the target gene
sequences set forth in SEQ ID NO:1 through to 62. In Table II, the amino acid
sequences of
SEQ ID NO: 63 to 123 are deduced using the codon usage of C. albicans from the
respective
nucleotide sequences of SEQ ID NO: 1 to 61. However, when expressed in an
organism other
1 S than C. albicans, protein products of the target genes having the amino
acid sequences of SEQ
ID NO: 63 to 123 may be encoded by nucleotide sequences that are translated
using the
universal genetic code. One of skill in the art would know the modifications
that are necessary
to accommodate for such a dii~erence in codon usage.
In addition, however, the methods and compositions of the invention also use
and encompass proteins and polypeptides that represent functionally equivalent
gene products.
Such functionally equivalent gene products include, but are not limited to,
natural variants of the
polypeptides having an amino acid sequence set forth in SEQ ID N0:63 through
to 123.
Such equivalent target gene products can contain, e.g., deletions, additions
or
substitutions of amino acid residues within the amino acid sequences encoded
by the target gene
sequences described above, but which result in a silent change, thus producing
a functionally
equivalent target gene product. Amino acid substitutions can be made on the
basis of similarity
in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or the
amphipathic nature of
the residues involved. For example, nonpolar (i.e., hydrophobic) amino acid
residues can
- include alanine (Ala or A), leucine (Leu or L), isoleucine (Ile or I),
valine (Val or ~, proline
(Pro or P), phenylalanine (Phe or F), tryptophan (Trp or V~ and methionine
(Met or M); polar
neutral amino acid residues can include glycine (Gly or G), serine (Ser or S),
threonine (Thr or
T), cysteine (Cys or C), tyrosine (Tyr or ~, asparagine (Asn or N) and
glutamine (Gln or Q);
positively charged (i.e., basic) amino acid residues can include arginine (Arg
or R), lysine (Lys
or K) and histidine (His or H); and negatively charged (i.e., acidic) amino
acid residues can
include aspartic acid (Asp or D) and glutamic acid (Glu or E).
- 45 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
In one particular embodiment, a composition comprising a mixture of natural
variants of the polypeptides having one of SEQ ID N0:63 through to 123 is
provided. Since it is
known in the art that, in C. albicans, 99% of the tRNA molecules that
recognize the codon CTG
is charged with a serine residue, and 1 % are charged with a leucine residue,
there is a possibility
S that during biosynthesis, a leucine is incorporated into a growing
polypeptide chain..
Accordingly, when a nucleotide sequence comprising the codon CTG is translated
in C.
albicans, a small percentage of the resulting polypeptides may have a leucine
residue in
positions where a serine residue encoded by CTG (conforniing to the codon
usage of C.
albicans) is expected. The product of translation of such a nucleotide
sequence may comprise a
I 0 mixture of polypeptides with minor leucine/serine variations at positions
that correspond to a
CTG codon in the nucleotide sequence.
"Functionally equivalent," as the term is utilized herein, refers to a
polypeptide
capable of exhibiting a substantially similar in vivo activity as the Candida
albicans target gene
product encoded by one or more of the target gene sequences described in Table
II.
15 Alternatively, when utilized as part of assays described hereinbelow, the
term "functionally
equivalent" can refer to peptides or polypeptides that are capable of
interacting with other
cellular or extracellular molecules in a manner substantially similar to the
way in which the
corresponding portion of the target gene product would interact with such
other. molecules.
Preferably, the functionally equivalent target gene products of the invention
are also the same .
20 sirx or about the same size as a target gene product encoded by one or more
of the target gene
sequences described in Table II.
In another embodiment of the invention, the use of target gene products that
are
RNA or proteins of Saccharomyces cerevisiae are provided.
Peptides and polypeptides corresponding to one or more domains of the target
25 gene products (e.g., signal sequence, TM, ECD, CD, or ligand-binding
domains), truncated or
deleted target gene products (e.g., polypeptides in which one or more domains
of a target gene
product are deleted) and fusion target gene proteins (e.g., proteins in which
a full length or
truncated or deleted target gene product, or a peptide or polypeptide
corresponding to one or
more domains of a target gene product is fused to an unrelated protein) are
also within the scope
30 of the present invention. Such peptides and polypeptides (also referred to
as chimeric protein or
polypeptides) can be readily designed by those skilled in the art on the basis
of the target gene
nucleotide and amino acid sequences listed in Table II. Exemplary fusion
proteins can include, .
but are not limited to, epitope tag-fusion proteins which facilitates
isolation of the target gene
product by affinity chromatography using reagents that binds the epitope.
Other exemplary
35 fusion proteins include fusions to any amino acid sequence thaf allows,
e.g., the fusion protein to
-46-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
be anchored to a cell membrane, thereby allowing target gene polypeptides to
be exhibited on a
cell surface; or fusions to an enzyme (e.g., ~3-galactosidase encoded by the
LAC4 gene of
Kluyveronmyces lactis (Leuker et al., 1994, Mol. Gen. Genet., 245:212-217)),
to a fluorescent
protein (e.g., from Renilla reniformis (Srikantha et al., 1996, J. Bacteriol.
178:121-129), or to a
luminescent protein which can provide a marker function. Accordingly, the
invention provides a
fission protein comprising a fragment of a first polypeptide fused to a second
polypeptide, said
fi~agment of the first polypeptide consisting of at least 6 consecutive
residues of an amino acid
sequence selected from one of SEQ ID NO: 63 to 123.
Other modifications of the target gene product coding sequences described
above
can be made to generate polypeptides that are better suited, e.g., for
expression, for scale up, etc.
in a chosen host cell. For example, cysteine residues can be deleted or
substituted with another
amino acid in order to eliminate disulfide bridges.
The target gene products of the invention preferably comprise at least as many
contiguous amino acid residues as are necessary to represent an epitope
fi~agment (that is, for the
gene products to be recognized by an antibody directed to the target gene
product). For
example, such protein fiagments or peptides can comprise at least about 8
contiguous amino
acid residues from a fill length differentially expressed or pathway gene
product. In alternative
embodiments, the protein fragments and peptides of the invention can comprise
about 6, 10, 20, .
30, 40, 50,60, 70, 80, 90, 10.0, 150, 200, 250, 300, 350, 400, 450 or more
contiguous amino
acid residues of a target gene product.
.The target gene products used and encompassed in the methods and
compositions of the present invention also encompass amino acid sequences
encoded by one or
more of the above-described target gene sequences of the invention wherein
domains often
encoded by one or more exons of those sequences, or fragments thereof, have
been deleted. The
target gene products of the invention can still further comprise post
translational modifications,
including, but not limited to, glycosylations, acetylations and
myristylations.
The target gene products of the invention can be readily produced, e.g., by
synthetic techniques or by methods of recombinant DNA technology using
techniques that are
well known in the art. Thus, methods for preparing the target gene products of
the invention are
discussed herein. First, the polypeptides and peptides of the invention can be
synthesized or
prepared by techniques well known in the art. See, for example, Creighton,
1983, Proteins:
Structures and Molecular Principles, W.H. Freeman and Co., N.Y., which is
incorporated
herein by reference in its entirety. Peptides can, for example, be synthesized
on a solid support
or in solution.
Alternatively, recombinant DNA methods which are well known to those skilled
-47-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
in the art can be used to construct expression vectors containing target gene
protein coding
sequences such as those set forth in SEQ ID NO: 1 through to 61, and
appropriate
transcriptionaUtranslational control signals. These methods include, for
example, in vitro
recombinant DNA techniques, synthetic techniques and in vivo
recombination/genetic
recombination. See, for example, the techniques described in Sambrook et al.,
1989, Molecular
Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor,
N.Y., Pla et
al., Yeast 12:1677-1702 (1996), which are incorporated by reference herein in
their entireties,
and Ausubel, 1989, supra. Alternatively, RNA capable of encoding target gene
protein
sequences can be chemically synthesized using, for example, synthesizers. See,
for example, the
techiliques described in Oligonucleotide Synthesis, 1984, Gait, M.J. ed., IRL
Press, Oxford,
which is incorporated by reference herein in its entirety.
A variety of host-expression vector systems can be utilized to express the
target
gene coding sequences of the invention. Such host-expression systems represent
vehicles by
which the coding sequences of interest can be produced and subsequently
purified, but also
represent cells which can, when transformed or transfected with the
appropriate nucleotide
coding sequences, exhibit the target gene protein of the invention in situ.
These include but are
not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis)
transformed with
recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors
containing
target gene protein coding sequences; yeast (e.g., Saccharomyces,
Schizosaccarhomyces,
Neurospora, Aspergillus, Candida, Pichia) transformed with recombinant yeast
expression
vectors containing the target gene protein coding sequences; insect cell
systems infected with
recombinant virus expression vectors (e.g., baculovirus) containing the target
gene protein
coding sequences; plant cell systems infected with recombinant virus
expression vectors (e.g.,
cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with
recombinant
plasmid expression vectors (e.g., Ti plasmid) containing target gene protein
coding sequences; or
mammalian cell systems (e.g. COS, CHO, BHK, 293, 3T3) harboring recombinant
expression
constructs containing promoters derived from the genome of mammalian cells
(e.g.,
metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late
promoter; the
vaccinia virus 7.5K promoter). If necessary, the nucleotide sequences of
coding regions may be
~ modified according to the codon usage of the host such that the translated
product has the
correct amino acid sequence.
In bacterial systems, a number of expression vectors can be advantageously
selected depending upon the use intended for the target gene protein being
expressed. For
example, when a large quantity of such a protein is to be produced, for the
generation of
antibodies or to screen peptide libraries, for example, vectors which direct
the expression of high
-48-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
levels of fusion protein products that are readily purified can be desirable.
Such vectors include,
but are not limited, to the E. coli expression vector pUR278 (Ruther et al.,
1983, EMBO J.
2:1791 ), in which the target gene protein coding sequence can be ligated
individually into the
vector in fi~ame with the lacZ coding region so that a fusion protein is
produced; p1N vectors
(Inouye & Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster,
1989, J.
Biol. Chem. 264:5503-5509); and the like. pGEX vectors can also be used to
express foreign
polypeptides as fission proteins with glutathione S-transferase (GST). In
general, such fusion
proteins are soluble and can easily be purified from lysed cells by adsorption
to glutathione-
agarose beads followed by elution in the presence of free glutathione. The
pGEX vectors are
designed to include thrombin or factor Xa protease cleavage sites so that the
cloned target gene
protein can be released from the GST moiety.
When a target gene is to be expressed in mammalian host cells, a number of
viral-based expression systems can be utilized. In cases where an adenovirus
is used as an
expression vector, the target gene coding sequence of interest can be ligated
to an adenovirus
transcription/translation control complex, e.g., the late promoter and
tripartite leader sequence.
This chimeric gene can then be inserted in the adenovirus genome by in vitro
or in vivo
recombination. Insertion in a non-essential region of the viral genome (e.g.,
region E1 or E3)
will result in a recombinant virus that is viable and capable of expressing
target gene protein in .
infected hosts, (e.g., See Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA
81:3655-3659).
Specific initiation signals can also be required for efficient translation of
inserted target gene
coding sequences. These signals include the ATG initiation codon and adjacent
sequences. In
cases where an entire target gene, including its own initiation codon and
adjacent sequences, is
inserted into the appropriate expression vector, no additional translational
control signals can be
needed. However, in cases where only a portion of the target gene coding
sequence is inserted,
exogenous translational control signals, including, perhaps, the ATG
initiation codon, must be
provided. Furthermore, the initiation codon must be in phase with the reading
fi~ame of the
desired coding sequence to ensure translation of the entire insert. These
exogenous translational
control signals and initiation codons can be of a variety of origins, both
natural and synthetic.
The efficiency of expression can be enhanced by the inclusion of appropriate
transcription
enhancer elements; transcription terminators, etc. (see Bittner et al., 1987,
Methods in Enzymol.
153:516-544).
In addition, a host cell strain can be chosen which modulates the expression
of
the inserted sequences, or modifies and processes the gene product in the
specific fashion
desired. Such modifications (e.g., glycosylation) and processing (e.g.,
cleavage) of protein
products can be important for the fiznction of the protein. Different host
cells have characteristic
-49-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
and specific mechanisms for the post-translational processing and modification
of proteins.
Appropriate cell lines or host systems can be chosen to ensure the correct
modification and
processing of the foreign protein expressed. To this end, eukaryotic host
cells which possess the
cellular machinery for proper processing of the primary transcript,
glycosylation, and
S phosphorylation of the gene product can be used.
For long-term, high-yield production of recombinant proteins, stable
expression
is preferred. For example, cell lines which stably express the target gene
protein can be
engineered. Host cells can be transformed with DNA controlled by appropriate
expression
control elements (e.g., promoter, enhancer, sequences, transcription
terminators, polyadenylation
sites, etc. ), and a selectable marker. Following the introduction of the
foreign DNA, engineered
cells can be allowed to grow for 1-2 days in an enriched media, and then are
switched to a
selective media. The selectable marker in the recombinant plasmid confers
resistance to the
selection and allows cells to stably integrate the plasmid into their
chromosomes and grow to
form foci which in turn can be cloned and expanded into cell lines. This
method can
advantageously be used to engineer cell lines which express the target gene
protein. Such
engineered cell lines can be particularly useful in screening and evaluation
of compounds that
affect the endogenous activity of the target gene protein.
A number of selection systems can be used, including but not limited to the
herpes simplex virus thymidine kinase (Wigler et al., 1977, Cell 11:223),
hypoxanthine-guanine.
phosphoribosyltransferase (Szybalska Bc Szybalski, 1962, Proc. Natl. Acad.
Sci. USA 48:2026),
and adenine phosphoribosyltransferase (Lowy et al., 1980, Cell 22:817) genes
can be employed
in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance
can be used as the basis
of selection for dhfr, which confers resistance to methotrexate (Wigler et
al., 1980, Proc. Natl.
Acad. Sci. USA 77:3567; O'Hare et al., 1981, Proc. Natl. Acad. Sci. USA
78:1527); gpt, which
confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl.
Acad. Sci. USA
78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-
Garapin et al.,
1981, J. Mol. Biol. 150:1 ); and hygro, which confers resistance to hygromycin
(Santerre et al.,
1984, Gene 30:147) genes.
Alternatively, any fission protein may be readily purified by utilizing an
antibody
specific for the fi.ision protein being expressed. For example, a system
described by Janknecht et
al. allows for the ready purification of non-denatured fission proteins
expressed in human cells
lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88: 8972-8976). In
this system, the
gene of interest is subcloned into a vaccinia recombination plasmid such that
the gene's open
reading fi~ame is translationally fused to an amino-terminal tag consisting of
six histidine
residues. Extracts from cells infected with recombinant vaccinia virus are
loaded onto
-SO-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ni2+witriloacetic acid-agarose columns and histidine-tagged proteins are
selectively eluted with
imidazole-containing buffers. Fusions at the carboxy terminal of the target
gene product are also
contemplated.
When used as a component in assay systems such as those described herein, the
target gene protein can be labeled, either directly or indirectly, to
facilitate detection of a
complex formed between the target gene protein and a test substance. Any of a
variety of
suitable labeling systems can be used including but not limited to
radioisotopes such as ~ZSI;
enzyme labeling systems that generate a detectable colorimetric signal or
light when exposed to
substrate; and fluorescent labels.
Indirect labeling involves the use of a protein, such as a labeled antibody,
which
specifically binds to either a target gene product. Such antibodies include
but are not limited to
polyclonal antibodies, monoclonal antibodies (mAbs), human, humanized or
chimeric
antibodies, single chain antibodies, Fab fragments, F(ab')Z fi~agments,
fragments produced by a
Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-
binding fiagments of any
of the above.
Following expression of the target gene protein encoded by the identified
target
nucleotide sequence, the protein is purified. Protein purification techniques
are well known in
the art. Proteins encoded and expressed from identified exogenous nucleotide
sequence 17
s can be partially purified using precipitation techniques, such as
precipitation with polyethylene
glycol. Alternatively, epitope.tagging of the protein can be used to allow
simple one step
purification of the protein. In addition, chromatographic methods such as ion-
exchange
chromatography, gel filtration, use of hydroxyapaptite columns, immobilized
reactive dyes,
chromatofocusing, and use of high-performance liquid chromatography, may also
be used to
purify the protein. Electrophoretic methods such as one-dimensional gel
electrophoresis, high-
resolution two-dimensional polyacrylamide electrophoresis, isoelectric
focusing, and others are
contemplated as purification methods. Also, ai~mity chromatographic methods,
comprising
solid phase bound- antibody, ligand presenting columns and other af~mity
chromatographic
matrices are contemplated as purification methods in the present invention.
In addition, the purified target gene products, fi-agments thereof, or
derivatives
hereof may be administered to ari individual in a pharmaceutically acceptable
carrier to induce
an immune response against the protein or polypeptide. Preferably, the immune
response is a
protective immune response which protects the individual. Methods for
determining appropriate
dosages of the protein (including use of adjuvants) and pharmaceutically
acceptable carriers are
familiar to those skilled in the art.
-51-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
5.4.4 Antibodies Specific for Target Gene Products
Described herein are methods for the production of antibodies capable of
specifically recognizing epitopes of one or more of the target gene products
described above.
Such antibodies can include, but are not limited to, polyclonal antibodies,
monoclonal antibodies
S (mAbs), human, humanized or chimeric antibodies, single chain antibodies,
Fab fragments,
F(ab')Z fragments, fragments produced by a Fab expression library, anti-
idiotypic (anti-Id)
antibodies, and epitope-binding fragments of any of the above.
For the production of antibodies to a target gene or gene product, various
host
animals can be immunized by injection with a target gene protein, or a portion
thereof. Such
host animals can include but are not limited to rabbits, mice, and rats, to
name but a few.
Various adjuvants can be used to increase the immunological response,
depending on the host
species, including but not limited to Freund's (complete and incomplete),
mineral gels such as
aluminum hydroxide, surface active substances such as lysolecithin, pluronic
polyols,
polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol,
and potentially
useful human adjuvants such as BCG (bacille Calmette-Guerin) and
Corynebacterium parvum.
Accordingly, the invention provides a method of eliciting an immune response
in an animal,
comprising introducing into the animal an immunogenic composition comprising
an isolated
polypeptide, the amino acid sequence of which comprises at least 6 consecutive
residues of one
of SEQ ID NO: 63 to 123.
Polyclonal antibodies are heterogeneous populations of antibody molecules
derived from the sera of animals immunized with an antigey such as target gene
product, or an
antigenic functional derivative thereof. For the production of polyclonal
antibodies, host
animals such as those described above, can be immunized by injection with
differentially
. expressed or pathway gene product supplemented with adjuvants as also
described above. The
antibody titer in the immunized animal can be monitored over time by standard
techniques, such
as with an enzyme linked immunosorbent assay (ELISA) using immobilized
polypeptide. If
desired, the antibody molecules can be isolated from the animal (e.g., from
the blood) and
further purified by well-known techniques, such as protein A chromatography to
obtain the IgG
fraction.
Monoclonal antibodies, which are homogeneous populations of antibodies to a
particular antigen, can be obtained by any technique which provides for the
production of
antibody molecules by continuous cell lines in culture. These include, but are
not limited to the
hybridoma technique of Kohler and Milstein, (1975, Nature 256:495-497; and
U.S. Patent No.
4,376,110), the human B-cell hybridoma technique (Kosbor et al., 1983,
Immunology Today
4:72; Cole et al., 1983, Proc. Natl. Acad. Sci. USA 80:2026-2030), and the EBV-
hybridoma
-52-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
technique (Cole et al., 1985, Monoclonal Antibodies And Cancer Therapy, Alan
R. Liss, Inc.,
pp. 77-96). Such antibodies can be of any immunoglobulin class including IgG,
IgM, IgE, IgA,
IgD and any subclass thereof. The hybridoma producing the mAb of this
invention can be
cultivated in vitro or in vivo. Production of high titers of mAbs in vivo
makes this the presently
preferred method of production.
Alternative to preparing monoclonal antibody-secreting hybridomas, a
monoclonal antibody directed against a polypeptide of the invention can be
identified and
isolated by screening a recombinant,combinatorial immunoglobulin library
(e.g., an antibody
phage display library) with the polypeptide of interest. Kits for generating
and screening phage
display libraries are commercially available (e.g., the Pharmacia Recombinant
Phage Antibody
System, Catalog No. 27-9400-O1; and the Stratagene SurfZAPTMPhage Display Kit,
Catalog No.
240612). Additionally, examples of methods and reagents particularly amenable
for use in
generating and screening antibody display library can be found in, for
example, U.S. Patent No.
5,223,409; PCT Publication No. WO 92/18619; PCT Publication No. WO 91/17271;
PCT
Publication No. WO 92/20791; PCT Publication No. WO 92/15679; PCT Publication
No. WO
93/01288; PCT Publication No. WO 92/01047; PCT Publication No. WO 92/09690;
PCT
Publication No. WO 90/02809; Fuchs-et al. (1991 ) BiolTechnolo~ 9:1370-1372;.
Hay et al.
(1992) Hum. Antibod Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-
1281; Griffiths
et.al. (1993) .EMBO J. 12:725-734.
Additionally, recombinant antibodies, such as chimeric and humanized
monoclonal antibodies, comprising both human and non-human portions, which can
be made
using standard recombinant DNA techniques, are within the scope of the
invention. A chimeric
antibody is a molecule in which different portions are derived from different
animal species,
such as those having a variable region derived from a marine mAb and a human
immunoglobulin constant region. (See, e.g., Cabilly et al., U.S. Patent No.
4,816,567; and Boss
et al., U.S. Patent No. 4,816397, which are incorporated herein by reference
in their entirety.)
Humanized antibodies are antibody molecules from non-human species having one
or more
complementarily determining regions (CDRs) from the non-human species and a
framework
region from a human immunoglobulin molecule. (See, e.g., Queen, U.S. Patent
No. 5,585,089,
which is incorporated herein by reference in its entirety.) Such chimeric and
humanized
monoclonal antibodies can be produced by recombinant DNA techniques known in
the art, for
example using methods described in PCT Publication No. WO 87/02671; European
Patent
Application 184,187; European Patent Application 171,496; European Patent
Application
173,494; PCT Publication No. WO 86/01533; U.S. Patent No. 4,816,567; European
Patent
Application 125,023; Better et al. (1988) Science 240:1041-1043; Liu et al.
(1987) Proc. Natl.
-53-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Acad. Sci. USA 84:3439-3443; Liu et al. (1987) J. Immunol. 139:3521-3526; Sun
et al. (1987)
Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al. (1987) Canc. Res.
47:999-1005; Wood
et al. (1985) Nature 314:446-449; and Shaw et al. (1988) J. Natl. Cancer Inst.
80:1553-1559);
Morrison (1985) Science 229:1202-1207; Oi et al. (1986) Biol!'echniques 4:214;
U.S. Patent
5,225,539; Jones et al. (1986) Nature 321:552-525; Verhoeyan et al. (1988)
Science 239:1534;
and Beidler et al. (1988) J. Immunol. 141:4053-4060.
Completely human antibodies are particularly desirable for therapeutic
treatment
of human patients. Such antibodies can be produced using transgenic mice which
are incapable
of expressing endogenous immunoglobulin heavy and light chains genes, but
which can express
human heavy and light chain genes. The transgenic mice are immunized in the
normal fashion
with a selected antigen, e.g., all or a portion of a polypeptide of the
invention. Monoclonal
antibodies directed against the antigen can be obtained using conventional
hybridoma
technology. The human immunoglobulin transgenes harbored by the transgenic
mice rearrange
during B cell differentiation, and subsequently undergo class switching and
somatic mutation.
Thus, using such a technique, it is possible to produce therapeutically useful
IgG, IgA and IgE
antibodies. For an overview of this technology for producing human antibodies,
see Lonberg
and Huszar (1995, Int. Rev. Immunol. 13:65-93). For a detailed discussion of
this technology for
producing human antibodies and human monoclonal antibodies and protocols for
producing
such antibodies, see, e.g., U.S. Patent 5,625,126; U.S. Patent 5,633,425; U.S.
Patent 5,569,825;
U.S. Patent 5,661,016; and U.S. Patent 5,545,806.
Completely human antibodies which recognize a selected epitope can be
generated using a technique referred to as "guided selection." In this
approach a selected non-
human monoclonal antibody, e.g., a mouse antibody, is used to guide the
selection of a
completely human antibody recognizing the same epitope. (Jespers et al. (1994)
Bioltechnology
12:899-903).
Antibody fragments which recognize specific epitopes can be generated by
known techniques. For example, such fragments include but are not limited to:
the F(ab')2
fragments which can be produced by pepsin digestion of the antibody molecule
and the Fab
fragments which can be generated by reducing the disulfide bridges of the
F(ab')2 fragments.
Alternatively, Fab expression libraries can be constructed (Hose et al., 1989,
Science 246:1275
1281 ) to allow rapid and easy identification of monoclonal Fab fi~agments
with the desired
specificity.
Antibodies of the present invention may also be described or specified in
terms
of their binding affinity to a target gene product. Preferred binding
affinities include those with a
dissociation constant or Kd less than 5 X 10~ M, 10'~M, 5 X 10'' M, 10''M, 5 X
10'8 M, 10-8 M, 5
-54-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
X 10-9 M, 10-9 M, 5 X 10''° M, 10-'° M, 5 X 10-" M, 10-" M, 5 X
10''2 M, 10-'Z M, 5 X 10-'3 M, 10-
'3 M, S X 10-'4 M, 10-'4 M, 5 X 10-'5 M, or 10-'S M.
Antibodies directed against a target gene product or fragment thereof can be
used to detect the a target gene product in order to evaluate the abundance
and pattern of
expression of the polypeptide under various environmental conditions, in
different
morphological forms (mycelium, yeast, spores) and stages of an organism's life
cycle.
Antibodies directed against a target gene product or fragment thereof can be
used diagnostically
to monitor levels of a target gene product in the tissue of an infected host
as part of a clinical
testing procedure, e.g., to, for example, determine the efficacy of a given
treatment regimen.
Detection can be facilitated by coupling the antibody to a detectable
substance. Examples of
detectable substances include various enzymes, prosthetic groups, fluorescent
materials,
luminescent materials, bioluminescent materials, and radioactive materials.
Examples of
suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-
galactosidase, or
acetylcholinesterase; examples of suitable prosthetic group complexes include
streptavidin/biotin
and avidin/biotin; examples of suitable fluorescent materials include
umbelliferone, fluorescein,
fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein,
dansyl chloride or
phycoerythrin; an example of a luminescent material includes luminol; examples
of
bioluminescent materials include luciferase, luciferin, and aequorin, and
examples of suitable
radioactive material include 125h 131h 35g or 3H.
Further, antibodies directed against a target gene product or fragment thereof
can
be used therapeutically to treat an infectious disease by preventing
infection, and/or inhibiting
growth of the pathogen. Antibodies can also be used to modify a biological
activity of a target
gene product. Antibodies to gene products related to virulence or
pathogenicity can also be used
to prevent infection and alleviate one or more symptoms associated with
infection by the
organism. To facilitate or enhance its therapeutic effect, an antibody (or
fragment thereof) may
be conjugated to a therapeutic moiety such as a toxin or fungicidal agent.
Techniques for
conjugating a therapeutic moiety to antibodies are well known, see, e.g.,
Thorpe et al., "The
Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol.
Rev., 62:119-
58 (1982).
An antibody with or without a therapeutic moiety conjugated to it can be used
as
a therapeutic that is administered alone or in combination with
chemotherapeutic agents.
-55-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
5.4.5 Antisense Molecules
The use of antisense molecules as inhibitors of gene expression may be a
specific, genetically based therapeutic approach (for a review, see Stein, in
Ch. 69, Section 5
"Cancer: Principle and Practice of Oncology", 4th ed., ed. by DeVita et al.,
J.B. Lippincott,
Philadelphia 1993). The present invention provides the therapeutic or
prophylactic use of
nucleic acids of at least six nucleotides that are antisense to a target
essential or virulence gene or
a portion thereof. An "antisense" target nucleic acid as used herein refers to
a nucleic acid
capable of hybridizing to a portion of a target gene RNA (preferably mRNA) by
virtue of some
sequence complementarity. The invention further provides pharmaceutical
compositions
comprising an effective amount of the antisense nucleic acids of the invention
in a
pharmaceutically acceptable carrier, as described infra.
In another embodiment, the invention is directed to methods for inhibiting the
expression of a target gene in an organism of interest, such as C. albicans in
vitro or in vivo
comprising providing the cell with an effective amount of a composition
comprising an
antisense nucleic acid of the invention. Multiple antisense polynucleotides
hybridizable to
different target genes may be used in combinations, sequentially or
simultaneously.
In another embodiment, the present invention is directed toward methods for
modulating expression of an essential gene which has been identified by the
methods described
supra, in which an antisense RNA molecule, which inhibits translation of mRNA
transcribed
from an essential gene, is expressed from a regulatable promoter. In one
aspect of this
embodiment, the antisense RNA molecule is expressed in a GRACE strain of
Candida albicans
or another GRACE strain constructed from another diploid pathogenic organism.
In other
aspects of this embodiment, the antisense RNA molecule is expressed in a wild-
type or other
non-GRACE strain of Candida albicans or another diploid pathogenic organism,
including
animal fugal pathogens such as Aspergillus fumigates, Aspergillus niger,
Aspergillus flavis,
Candida.tropicalis, Candida parapsilopsis, Candida Irrusei, Cryptococcus
neoformans,
Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma
capsulatum,
Phneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii,
Rhizomucor
pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as
Botrytis cinerea,
Erysiphe graminis, Magnaporthe grisea, Puccinia recodita, Septoria triticii,
Tilletia
controversa, Ustilago maydiss, or any species falling within the genera of any
of the above
species.
The nucleic acid molecule comprising an antisense nucleotide sequence of the
invention may be complementary to a coding and/or noncoding region of a target
gene mRNA.
~e ~fisense molecules will bind to the complementary target gene mRNA
transcripts and
-56-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
reduce or prevent translation. Absolute complementarity, although preferred,
is not required. A
sequence "complementary" to a portion of an RNA, as referred to herein, means
a sequence
having sufficient complementarity to be able to hybridize with the RNA,
forming a stable
duplex; in the case of double-stranded antisense nucleic acids, a single
strand of the duplex DNA
may thus be tested, or triplex formation may be assayed. The ability to
hybridize will depend on
both the degree of complementarity and the length of the antisense nucleic
acid. One skilled in
the art can ascertain a tolerable degree of mismatch by use of standard
procedures to determine
the melting point of the hybridized complex.
Nucleic acid molecules that are complementary to the 5' end of the message,
e.g.,
the 5' untranslated sequence up to and including the AUG initiation codon,
should work most
efficiently at inhibiting translation. However, sequences complementary to the
3' untranslated
sequences of mRNAs have recently been shown to be effective at inhibiting
translation of
mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335.
Nucleic acid molecules comprising nucleotide sequences complementary to the
5' untranslated region of the mRNA can include the complement of the AUG start
codon.
Antisense nucleic acid molecules complementary to mRNA coding regions are less
efficient
inhibitors of translation but could be used in accordance with the invention.
Whether designed
to hybridize to the 5'-, 3'- or coding region of target gene mRNA, antisense
nucleic acids should
be at least six nucleotides in length, and are preferably oligonucleotides
ranging from 6 to about
50 nucleotides in length. In specific aspects, the oligonucleotide is at least
10 nucleotides, at
least 17 nucleotides, at least 25 nucleotides, at least 50 nucleotides, or at
least 200 nucleotides.
Regardless of the choice of target gene sequence, it is preferred that in
vitro
studies are first performed to quantitate the ability of the antisense
molecule to inhibit gene
expression. It is preferred that these studies utilize controls that
distinguish between antisense
gene inhibition and nonspecific biological effects of oligonucleotides. It is
also preferred that
these studies compare levels of the target RNA or protein with that of an
internal control RNA
or protein. Additionally, it is envisioned that results obtained using the
antisense oligonucleotide
are compared with those obtained using a control oligonucleotide. It is
preferred that the control
oligonucleotide is of approximately the same length as the test
oligonucleotide and that the
nucleotide sequence of the oligonucleotide differs from the antisense sequence
no more than is
necessary to prevent specific hybridization to the target sequence.
The antisense molecule can be DNA or RNA or chimeric mixtures or derivatives
or modified versions thereof, single-stranded or double-stranded. The
antisense molecule can be
modified at the base moiety, sugar moiety, or phosphate backbone, for example,
to improve
stability of the molecule, hybridization, etc. The antisense molecule may
include other
-57-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
appended groups such as peptides (e.g., for targeting cell receptors in vivo),
hybridization-
triggered cleavage agents. (See, e.g., Krol et al., 1988, BioTechniques 6:958-
976) or
intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this
end, the antisense
molecule may be conjugated to another molecule, e.g., a peptide, hybridization
triggered cross-
linking agent, transport agent, hybridization-triggered cleavage agent, etc.
The antisense molecule may comprise at least one modified base moiety which
is selected from the group including but not limited to 5-fluorouracil, 5-
bromouracil,
5-chlorouracil, 5-iodouracil, ~hypoxanthine, xanthine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine,
inosine,
N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine,
2-methyladenine, 2-methylguanine, 3-methylcytosine, S-methylcytosine, N6-
adenine,
7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil,
beta-
D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-
methylthio-N6-
isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil,
queosine,
2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-
methyluracil, uracil-
5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-
thiouracil, 3-(3-amino-
3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
The antisense:molecule may also comprise at least one modified sugar moiety
selected from the group including but not limited to arabinose, 2-
fluoroarabinose, xylulose, and
hexose.
In yet another embodiment, the antisense molecule comprises at least one
modified phosphate backbone selected from the group consisting of a
phosphorothioate, a
phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a
phosphordiamidate, a
methylphosphonate, an alkyl phosphotriester, and a formacetal or analog
thereof.
In yet another embodiment, the antisense molecule is an a-anomeric
oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded
hybrids with
complementary RNA in which, contrary to the usual ~i-units, the strands run
parallel to each
other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The
oligonucleotide is a 2'-0-
methylribonucleotide (moue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a
chimeric RNA-
DNA analogue (moue et al., 1987, FEBS Lett. 215:327-330).
Antisense molecules of the invention may be synthesized by standard methods .
known in the art, e.g. by use of an automated DNA synthesizer (such as are
commercially
available from Biosearch, Applied Biosystems, etc.). As examples,
phosphorothioate
oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl.
Acids Res.
-58-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
16:3209), methylphosphonate oligonucleotides can be prepared by use of
controlled pore glass
polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-
7451), etc.
While antisense nucleotides complementary to the coding region of a target
gene
could be used, those complementary to the transcribed untranslated region are
also preferred.
Pharmaceutical compositions of the invention comprising an effective amount of
an antisense nucleic acid in a pharmaceutically acceptable carrier, can be
administered to a
subject infected with the pathogen of interest.
The amount of antisense nucleic acid which will be effective in the treatment
of
a particular disease caused by the pathogen will depend on the site of the
infection or condition,
and can be determined by standard techniques. Where possible, it is desirable
to determine the
antisense cytotoxicity of the pathogen to be treated in vitro, and then in
useful animal model
systems prior to testing and use in humans.
A number of methods have been developed for delivering antisense DNA or
RNA to cells; e.g., antisense molecules can be injected directly into the
tissue site in which the
pathogens are residing, or modified antisense molecules, designed to target
the desired cells
(e.g., antisense molecule linked to peptides or antibodies that specifically
bind receptors or
antigens expressed on the pathogen's cell surface) can be administered
systemically. Antisense
molecules can be delivered to the desired cell population via a delivery
complex. In a specific
embodiment, pharmaceutical compositions comprising antisense nucleic acids of
the target
genes are administered via biopolymers (e.g., poly-~3-1 ~4-N-acetylglucosamine
polysaccharide),
liposomes, microparticles, or microcapsules. In various embodiments of the
invention, it may be
useful to use such compositions to achieve sustained release of the antisense
nucleic acids. In a
specific embodiment, it may be desirable to utilize liposomes targeted via
antibodies to specific
identifiable pathogen antigens (Leonetti et al., 1990, Proc. Natl. Acad. Sci.
U.S.A. 87:2448-
2451; Renneisen et al., 1990, J. Biol. Chem. 265:16337-16342).
5.4.6 Ribozyme Molecules
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific
cleavage of RNA (For a review see, for example Rossi, J., 1994, Current
Biology 4:469-471).
The mechanism of ribozyme action involves sequence specific hybridization of
the ribozyme
molecule to complementary target RNA, followed by a endonucleolytic cleavage.
The
composition of ribozyme molecules must include one or more sequences
complementary to the
target gene mRNA, and must include the well known catalytic sequence
responsible for mRNA
cleavage. For this sequence, see U.S. Pat. No. 5,093,246, which is
incorporated by reference
herein in its entirety. As such, within the scope of the invention are
engineered hammerhead
-59-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
motif ribozyme molecules that specifically and efficiently catalyze
endonucleolytic cleavage of
RNA sequences encoding target gene proteins.
Ribozyme molecules designed to catalytically cleave specific target gene mRNA
transcripts can also be used to prevent translation of target gene mRNA and
expression of target
genes. While ribozymes that cleave mRNA at site specific recognition sequences
can be used to
destroy target gene mRNAs, the use of hammerhead ribozymes is preferred.
Hammerhead
ribozymes cleave mRNAs at locations dictated by flanking regions that form
complementary
base pairs with the target gene mRNA. The sole requirement is that the target
mRNA have the
following sequence of two bases: 5'-UG-3'. The construction and production of
hammerhead
ribozymes is well known in the art and is described more filly in Haseloff and
Gerlach, 1988,
Nature, 334:585-591. Preferably the ribozyme is engineered so that the
cleavage recognition site
is located near the 5' end of the target gene mRNA; i.e., to increase
efficiency and minimize the
intracellular accumulation of non-functional mRNA transcripts.
The ribozymes of the present invention also include RNA endoribonucleases
(hereinafter "Cech-type ribozymes") such as the one which occurs naturally in
Tetrahymena
thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively
described
by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-578;
Zaug and Cech,
1986, Science, 231:470-475; Zaug, et al., 1986, Nature, 324:429-433; published
International
patent application No. WO 88/04300 by University Patents Inc.; Been and Cech,
1986, Cell,
47:207-216). The Cech-type ribozymes have an eight base pair active site which
hybridizes to a
target RNA sequence whereafter cleavage of the target RNA takes place. The
invention
encompasses those Cech-type ribozymes which target eight base-pair active site
sequences that
are present m a target gene.
As in the antisense approach, the ribozymes can be composed of modified
oligonucleotides (e.g. for improved stability, targeting, etc.) and should be
delivered to cells
which express the target gene in vivo. Because ribozymes unlike antisense
molecules, are
catalytic, a lower intracellular concentration is required for efficiency.
Multiple ribozyme
molecules directed against different target genes can also be used in
combinations, sequentially
or simultaneously.
~fi_~~e RNA and DNA, ribozyme, and triple helix molecules of the
invention can be prepared by any method known in the art for the synthesis of
DNA and RNA
molecules. These include techniques for chemically synthesizing
oligodeoxyribonucleotides and
oligoribonucleotides well known in the art such as for example solid phase
phosphoramidite
chemical synthesis. Alternatively, RNA molecules can be generated by in vitro
and in vivo
ripfion~of DNA sequences encoding the antisense RNA rriolecule. Such DNA
sequences
-60-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
can be incorporated into a wide variety of vectors which incorporate suitable
RNA polymerise
promoters such as the T7 or SP6 polymerise promoters. Alternatively, antisense
cDNA
constructs that synthesize antisense RNA constitutively or inducibly,
depending on the promoter
used, can be introduced stably into cell lines. These nucleic acid constructs
can be administered
selectively to the desired cell population via a delivery complex.
Various well-known modifications to the DNA molecules can be introduced as a
means of increasing intracellular stability and half life. Possible
modifications include, but are
not limited to, the addition of flanking sequences of ribo- or deoxy-
nucleotides to the 5' and/or
3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather
than phospho-
diesterase linkages within the oligodeoxyribonucleotide backbone.
5.5 SCREENING ASSAYS
The following assays are designed to identify compounds that bind to target
gene
products, bind to other cellular proteins that interact with the target gene
product, and to
1 S compounds that interfere with the interaction of the target gene product
with other cellular
proteins. Compounds identified via such methods can include compounds which
modulate the
activity of a polypeptide encoded by a target gene of the invention (that is,
increase or decrease
its activity, relative to activity observed in the absence of the compound).
Alternatively,
compounds identified via such methods can include compounds which modulate the
expression
of me polynucleotide (that is, increase or decrease expression relative to
'expression levels
observed in the absence of the compound), or increase or decrease the
stability of the expressed
product encoded by that polynucleotide. Compounds, such as compounds
identified via the
methods of the invention, can be tested using standard assays .well known to
those of skill in the
art for their ability to modulate acfivity/expression.
Accordingly, the present invention provides a method for identifying an
antimycotic compound comprising screening a plurality of compounds to identify
a compound
that modulates the activity or level of a gene product, said gene product
being encoded by a
nucleotide sequence selected from the group consisting of SEQ ID NO: 1 to 61,
or a nucleotide
sequence that is naturally occurring in Saccharomyces cerevisiae and that is
the ortholog of a
gene having a nucleotide sequence selected from the group consisting of SEQ ID
NO: 1 to 61.
5.5.1 In Vitro Screening Assays
In vitro systems are designed to identify compounds capable of binding the
target
gene products of the invention. Compounds identified in this manner are
useful, for example, in
modulating the activity of wild type and/or mutant target gene products, are
usefi>I in elucidating
-61 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
the biological function of target gene products, are utilized in screens for
identifying other
compounds that disrupt normal target gene product interactions, or are useful
themselves for the
disruption of such interactions.
The principle of the assays used to identify compounds that bind to the target
gene product involves preparing a reaction mixture comprising the target gene
product and the
test compound under conditions and for a time sufficient to allow the two
components to interact
and bind, thus forming a complex which is removed and/or detected within the
reaction mixture.
These assays are conducted in a variety of ways. For example, one method
involves anchoring
target gene product or the test substance onto a solid phase and detecting
target gene product/test
compound complexes anchored, via the intermolecular binding reaction, to the
solid phase at the
end of the reaction. In one embodiment of such a method, the target gene
product is anchored
onto a solid surface, and the test compound, which is not anchored, is
labeled, either directly or
indirectly.
In practice, microtiter plates are conveniently utilized as the solid phase.
The
anchored component is immobilized by non-covalent or covalent attachments. Non-
covalent
attachment can be accomplished by simply coating the solid surface with a
solution of the
protein and drying the coated surface. Alternatively, an immobilized antibody,
preferably a
monoclonal antibody, specific for the protein to be immobilized is used to
anchor the protein to
the solid surface. The surfaces are prepared in advance and stored.
In order to conduct the assay, the nonimmobilized component is added to the
coated surface containing the anchored component. After the reaction is
complete, unreacted
components are removed (e. g., by washing) under conditions such that any
complexes formed
will remain immobilized on the solid surface. The detection of complexes
anchored'on the solid
surface is accomplished in a number of ways. Where the previously
nonimmobilized
component is pre-labeled, the detection of label immobilized on the surface
indicates that
complexes were formed. Where the previously nonimmobilized component is not
pre-labeled,
an indirect label is used to detect complexes anchored on the surface; ~,
using a labeled
antibody specific for the previously nonimmobilized component (the antibody,
in tum, is
directly labeled or indirectly labeled with a labeled anti-Ig antibody).
Alternatively, a reaction is conducted in a liquid phase, the reaction
products are
separated from unreacted components, and complexes are detected; e.g., using
an immobilized
antibody specific for the target gene product or for the test compound, to
anchor complexes
formed in solution, and a second labeled antibody, specific for the other
component of the
complex to allow detection of anchored complexes.
-62-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
5.5.1.1 Assays For Proteins That Interact With A Target Gene Product
Any method suitable for detecting protein-protein interactions can be employed
for identifying novel target protein-cellular or extracellular protein
interactions.
The target gene products of the invention interact, in vivo, with one or more
cellular or extracellular macromolecules, such as proteins. Such
macromolecules include, but
are not limited to, nucleic acid molecules and proteins identified via methods
such as those
described above. For purposes of this discussion, such cellular and
extracellular
macromolecules are referred to herein as "binding partners." Compounds that
disrupt such
interactions can be useful in regulating the activity of the target gene
protein, especially mutant
target gene proteins. Such compounds include, but are not limited to molecules
such as
antibodies, peptides, and the like, as described.
The basic principle of the assay systems used to identify compounds that
interfere with the interaction between the target gene product and its
cellular or extracellular
binding partner or partners involves preparing a reaction mixture containing
the target gene
product and the binding partner under conditions and for a time sufficient to
allow the two to
interact and bind, thus forming a complex. In order to test a compound for
inhibitory activity,
the reaction mixture is prepared in the presence and absence of the test
compound. The test
compound is initially included in the reaction mixture, or added at a time
subsequent to the
addition of target gene product and its cellular or extracellular binding
partner. Control reaction
textures are incubated without the test compound. The formation of complexes
between the
target gene protein and the cellular or extracellular binding partner is then
detected. The
formation of a complex in the control reaction, but not in the reaction
mixture containing the test
compound, indicates that the compound interferes with the interaction of the
target gene protein
and the interactive binding partner. Additionally, complex formation within
reaction mixtures
Wing ~e test compound and normal target gene protein can also be compared to
complex
formation within reaction mixhires containing the test compound and a mutant
target gene
protein. This comparison can be important in those cases wherein it is
desirable to identify
compounds that disrupt intermolecular interactions involving mutant but not
normal target gene
proteins.
The assay for compounds that interfere with the interaction of the target gene
products and binding partners is conducted in either a heterogeneous or a
homogeneous format.
Heterogeneous assays involve anchoring either the target gene product or the
binding partner
onto a solid phase and detecting complexes anchored on the solid phase at the
end of the
reaction. In homogeneous assays, the entire reaction is carried out in a
liquid phase. In either
approach, the order of addition of reactants is varied to obtain dii~erent
information about the
- 63 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
compounds being tested. For example, test compounds that interfere with the
interaction
between the target gene products and the binding partners, e.g., by
competition, are identified by
conducting the reaction in the presence of the test substance; i. e., by
adding the test substance to
the reaction mixture prior to or simultaneously with the target gene protein
and an interacting
cellular or extracellular binding partner. Alternatively, test compounds that
disrupt preformed
complexes, e.g_ compounds with higher binding constants that displace one of
the components
from the complex, are tested by adding the test compound to the reaction
mixture after
complexes have been formed. The various formats are described briefly below.
In a heterogeneous assay system, either the target gene protein or the
interactive
cellular or extracellular binding partner, is anchored onto a solid surface,
while the non-anchored
species is labeled, either directly or indirectly. In practice, microtiter
plates are conveniently
utilized. The anchored species is immobilized either by non-covalent or
covalent attachment.
Non-covalent attachment is accomplished simply by coating the solid surface
with a solution of
the target gene product or binding. partner and drying the coated surface.
Alternatively, an
immobilized antibody specific for the species to be anchored is used to anchor
the species to the
solid surface. The surfaces can be prepared in advance and stored.
In order to conduct the assay, the partner of the immobilized species is
exposed
to the coated surface with or without the test compound. After the reaction is
complete,
unreacted components are removed (e.g., by washing) and any complexes formed
will remain
immobilized on the solid surface. The detection of complexes anchored on the
solid surface is
accomplished in a number of ways. Where the non-immobilized species is pre-
labeled, the
detection of label immobilized on the surface indicates that complexes were
formed. Where the
non-immobilized species is not pre-labeled, an indirect label can be used to
detect complexes
anchored on the surface; e.g., using a labeled antibody specific for the
initially non-immobilized
species (the antibody, in turn, is directly labeled or indirectly labeled with
a labeled anti-Ig
antibody). Depending upon the order of addition of reaction components, test
compounds
which inhibit complex formation or which disrupt preformed complexes are
detected.
Alternatively, the reaction is conducted in a liquid phase in the presence or
absence of the test compound, the reaction products separated from unreacted
components, and
complexes detected; e.g., using an immobilized antibody specific for one of
the binding
components to anchor any complexes formed in solution, and a second, labeled
antibody
specific for the other partner to detect anchored complexes. Again, depending
uporrthe order of
addition of reactants to the liquid phase, test compounds which inhibit
complex or which disrupt
preformed complexes are identified.
' In an alternate embodiment of the invention, a homogeneous assay can be
used.
-64-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
In this approach, a preformed complex of the target gene protein and the
interacting cellular or
extracellular binding partner is prepared in which either the target gene
product or its binding
partner is labeled, but the signal generated by the label is quenched due to
complex formation
(see, e.g., U.S. Patent No. 4,109,496 by Rubenstein which utilizes this
approach for
immunoassays). The addition of a test substance that competes with and
displaces one of the
species from the preformed complex results in the generation of a signal above
background. In
this way, test substances which disrupt target gene protein/cellular or
extracellular binding
partner interaction are identified.
In a particular embodiment, the target gene product is prepared for
immobilization using recombinant DNA techniques described above. For example,
the target
gene coding region is fused to a glutathione-S-transferase (GST) gene using a
fusion vector,
such as pGEX-5X-1, in such a manner that its binding activity is maintained in
the resulting
fusion protein. The interactive cellular or extracellular binding partner is
purified and used to
raise a monoclonal antibody, using methods routinely practiced in the art and
as described
above. This antibody is labeled with the radioactive isotope'ZSI, for example,
by methods
routinely practiced in the art. In a heterogeneous assay, eg, the GST-target
gene fusion protein
is anchored to glutathione-agarose beads. The interactive cellular or
extracellular binding
partner is then added in the presence or absence of the test compound in a
manner that allows
interaction and binding to occur. At the end of the reaction period, unbound
material can be
washed away, and the labeled monoclonal antibody is added to the system and
allowed to bind
to the complexed components. The interaction between the target gene protein
and the
interactive cellular or extracellular binding partner is detected by measuring
the amount of
radioactivity that remains associated with the glutathione-agarose beads. A
successful inhibition
of the interaction by the test compound results in a decrease in measured
radioactivity.
Alternatively, the GST-target gene fusion protein and the interactive cellular
or
extracellular binding partner are mixed together in liquid in the absence of
the solid glutathione-
agarose beads. The test compound is added either during or after the species
are allowed to
interact. This mixture is added to the glutathione-agarose beads and unbound
material is washed
away. Again the extent of inhibition of the target gene product/binding
partner interaction is
detected by adding the labeled antibody and measuring the radioactivity
associated with the
beads.
In another embodiment of the invention, these same techniques are employed
using peptide figments that correspond to the binding domains of the target
gene product
and/or the interactive cellular or extracellular binding partner (in cases
where the binding partner
3 S is a protein), in place of one or both of the full length proteins. Any
number of methods
-65-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
routinely practiced in the art are used to identify and isolate the binding
sites. These methods
include, but are not limited to, mutagenesis of the gene encoding one of the
proteins and
screening for disruption of binding in a co-immunoprecipitation assay.
Compensating mutations
in the gene encoding the second species in the complex are then selected.
Sequence analysis of
S the genes encoding the respective proteins reveals the mutations that
correspond to the region of
the protein involved in interactive binding. Alternatively, one protein is
anchored to a solid
surface using methods described above, and allowed to interact with and bind
to its labeled
binding partner, which has been treated with a proteolytic enzyme, such as
trypsin. After
washing, a short, labeled peptide comprising the binding domain remains
associated with the
solid material, and can be isolated and identified by amino acid sequencing.
Also, once the gene
coding for the cellular or extracellular binding partner is obtained, short
gene segments are
engineered to express peptide fi~agments of the protein, which are tested for
binding activity and
purified or synthesized.
For example, and not by way of limitation, a target gene product is anchored
to a
solid material as described, above, by making a GST-target gene fusion protein
and allowing it
to bind to .glutathione agarose beads. The interactive cellular or
extracellular binding partner is
labeled with a radioactive isotope, such as 355, and cleaved with a
proteolytic enzyme such as .
trypsin. Cleavage products are added to the anchored GST-target gene fusion
protein and
allowed to bind. After washing away unbound peptides, labeled bound material,
representing
the cellular or extracellular binding partner binding domain, is eluted,
purified, and analyzed for
amino acid sequence by well known methods. Peptides so identified are produced
synthetically
or fiised to appropriate facilitative proteins using well known recombinant
DNA technology.
5.5.1.2 Screening a Combinatorial Chemical library
In one embodiment of the present invention, the proteins encoded by the
fiuigal
genes identified using the methods of the present invention are isolated and
expressed. These
recombinant proteins are then used as targets in assays to screen libraries of
compounds for
potential drug candidates. The generation of chemical libraries is well known
in the art. For
example, combinatorial chemistry is used to generate a library of compounds to
be screened in
~e ~~ys described herein. A combinatorial chemical library is a collection of
diverse chemical
compounds generated by either chemical synthesis or biological synthesis by
combining a
number of chemical "building block" reagents. For example, a linear
combinatorial-chemical
library such as a polypeptide library is formed by combining amino acids in
every possible
combination to yield peptides of a given length. Millions of chemical
compounds theoretically
~ ~ ~~es~ ~.ough such combinatorial mixings of chemical building blocks. For
-66-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
example, one commentator observed that the systematic, combinatorial mixing of
100
interchangeable chemical building blocks results in the theoretical synthesis
of 100 million
tetrameric compounds or 10 billion pentameric compounds. (Gallop et al.,
"Applications of
Combinatorial Technologies to Drug Discovery, Background and Peptide
Combinatorial
Libraries," Journal of Medicinal Chemistry, Vol. 37, No. 9, 1233-1250 (1994).
Other chemical
libraries known to those in the art may also be used, including natural
product libraries.
Once generated, combinatorial libraries are screened for compounds that
possess
desirable biological properties. For example, compounds which may be useful as
drugs or to
develop drugs would likely have the ability to bind to the target protein
identified, expressed and
p~ fed as discussed above. Further, if the identified target protein is an
enzyme, candidate
compounds would likely interfere with the enzymatic properties of the target
protein. For
example, the enzymatic function of a target protein may be to serve as a
protease, nuclease,
phosphatase, dehydrogenase, transporter protein, transcriptional enzyme,
replication component,
and any othei type of enzyme known or unknown. Thus, the present invention
contemplates
~~g ~e protein products described above to screen combinatorial chemical
libraries.
In some embodiments of the present invention, the biochemical activity of the
protein, as well as the chemical structure of a substrate on which the protein
acts is known. In
other embodiments of the present invention, the biochemical activity of the
target protein is
unknown and the target protein has no known substrates.
In some embodiments of the present invention, libraries of compounds are
screened to identify compounds that function as inhibitors of the target gene
product. First, a
library of small molecules is generated using methods of combinatorial library
formation well
known in the art. U.S. Patent NOs. 5,463,564 and 5,574, 656, to Agrafiotis, et
al., entitled
"System and Method of Automatically Generating Chemical Compounds with Desired
properties," the disclosures of which are incorporated herein by reference in
their entireties, are
two such teachings. Then the library compounds are screened to identify those
compounds that
possess desired structural and functional properties. U.S. Patent No.
5,684,711, the disclosure of
which is incorporated herein by reference in its entirety, also discusses a
method for screening
libraries.
To illustrate the screening process, the target gene product, an enzyme, and
chemical compounds of the library are combined and permitted to interact with
one another. A
labeled substrate is added to the incubation. The label on the substrate is
such that a detectable
signal is emitted from metabolized substrate molecules. The emission of this
signal permits one
3 S to measure the effect of the combinatorial library compounds on the
enzymatic activity of target
enzymes by comparing it to the signal emitted in the absence of combinatorial
library
-67-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
compounds. The characteristics of each library compound are encoded so that
compounds
demonstrating activity against the enzyme can be analyzed and features common
to the various
compounds identified can be isolated and combined into future iterations of
libraries.
Once a library of compounds is screened, subsequent libraries are generated
using those chemical building blocks that possess the features shown in the
first round of screen
to have activity against the target enzyme. Using this method, subsequent
iterations of candidate
compounds will possess more and more of those structural and fimctional
features required to
inhibit the function of the target enzyme, until a group of enzyme inhibitors
with high specificity
for the enzyme can be found. These compounds can then be further tested for
their safety and
e~cacy as antibiotics for use in mammals.
It will be readily appreciated that this particular screening methodology is
exemplary only. Other methods are well known to those skilled in the art. For
example, a
wide variety of screening techniques are known for a large number of naturally-
occurring
targets when the biochemical function of the target protein is known. For
example, some
t~~ques involve the generation and use of small peptides to probe and analyze
target proteins
both biochemically and genetically .in order to identify and develop drug
leads. Such techniques
include the methods described in PCT publications No. W09935494, W09819162,
W09954728, the disclosures of which are incorporated herein by reference in
their entireties.
Similar methods may be used to identify compounds which inhibit the activity
of proteins from organisms other than Candida albicans which are homologous to
the Candida
albicans target proteins described herein. For example, the proteins may be
from animal fugal
pathogens such as Aspergillus fumigates, Aspergillus niger, Aspergillus
flavis, Candida
tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus neoformans,
Coccidioides
immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum,
Phneumocystis
carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor
pusillus, or Absidia
corymbigera, or the plant fimgal pathogens, such as Botrytis cinerea, Erysiphe
graminis,
Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia
controversa, Ustilago maydis,
or any species falling within the genera of any of the above species. In some
embodiments, the
proteins are from an organism other than Saccharomyces cerevisiae.
5.5.1.3 In vitro Enzyme Assays
GRACE methods and strains are used to develop in vitro assays for biochemical
activities that are shown to be essential to cell viability. A number of
essential genes identified
by ~e GRACE conditional expression methodologies display statistically
significant similarity
to biochemically characterized gene products from other organisms. For
example, based on
-68-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
amino acid sequence similarity, a number of essential and fimgal specific
genes listed in Table II
are predicted to possess the following biochemical activities:
CaRH01 GTPase involved in (1,3)-(3-glucan synthesis and polarity
CaYHR118c (ORC6) Origin of replication complex subunit
CaYPLl28c (T'BPI) Telomere binding protein
CaYNL256w Dihydropteroate synthase
CaYKL004w (AURI) Phosphatidylinositol: ceramide phosphoinositol transferase
CaYJL090c (DPBlI) DNA polB subunit
CaYOLl49w (DCPI) mRNA decapping enzyme
CaYNL151 c (RPC31) RNA poIIII subunit
CaYORl48c (SPP2) RNA splicing
CaYER026c (CHOI) Phosphatidylserine synthase
Therefore, a number of well characterized standard in vitro biochemical assays
(e.g., DNA binding, RNA processing, GTP binding and hydrolysis, and
phosphorylation) are
readily adapted for these validated drug targets. For example the validated
target, CaRH0l, is
used within a in vitro-based drug screen by adapting standard GTPase assays
developed for a
wide range of such proteins. Alternatively, novel assays are developed using
biochemical
~.o~ation pertaining to validated drug targets within our GRACE strain
collection. Any
assays known in the art for enzymes with similar biochemical activities (e.g.,
mechanism of
action, class of substrate) are adapted for screening for inhibitors of the
enzymes encoded by
these essential C. albicans genes.
For example, a number of features make the C. albicarrs gene, CaTBFI, a
candidate for in vitro assay development. CaTBFl shares significant homology
to its S.
cerevisiae counterpart, TBFI , a telomere binding factor. In addition, the DNA
sequence
CaTBFIp recognizes is known and is relatively short (Koering et al., Nucleic
Acid Res.
28:2519-2526, which is incorporated herein by reference in its entirety),
enabling inexpensive
s~~esis of oligonucleotides corresponding to this element. Moreover since this
assay only
requires the target protein and a DNA fragment containing the nucleotide
sequence it recognizes,
only purification of CaTBFIp protein is necessary in order to develop an in
vitro binding assay.
One preferred embodiment of this in vitro assay involves crosslinking the DNA
element to the
bottom of a well, incubation of radiolabeled CaTBF 1 p to facilitate protein-
DNA binding, a
ones of washes to remove unbound material, and deten~nination of the
percentage of bound
radiolabeled CaTBFIp. Alternatively, purified CaTBFlp is attached to the well
and
-69-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
radiolabeled oligonucleotides added. Drug screening, including the use of high
throughput
screening technique, is performed by searching for compounds that inhibit the
protein-DNA
binding measured in this assay.
Similarly, a second validated drug target, CaORC6, is used in this type of
assay
since its S. cerevisiae homolog, ORC6, directly binds a DNA element within the
origin of
replication of yeast chromosomes (Mizushima et al., 2000, Genes & Development
14:1631-
1641, which is incorporated herein by reference in its entirety). Biochemical
purification of any
of these targets could be achieved, for example, by PCR-based construction of
C. albicans
heterozygbus strains in which the gene encoding the CaORC6 protein has been
modified to
include a carboxy-terminal hexahistidine tag enabling purification of the
chimeric protein using
standard Ni+z affinity column chromatography techniques.
For other targets like CaDPBI l , a homolog of which in S. cerevisiae encode
proteins that physically associate with Sld2p (Kamimura et al., 1998, Cell
Biol. 18:6102-6109,
which is incorporated herein by reference in its entirety), in vitro assays
similar to those
1 S described above are developed. In addition, two-hybrid assays based on
known physical
interactions are developed for any validated targets within the GRACE strain
collection.
The present invention also provides cell extracts useful in establishing in
vitro
assays for suitable biochemical targets. For example, in an embodiment of the
present
invention, GRACE-derived C. albicans strains are grown either under
constitutive expression
conditions or transcription repression conditions to either overproduce or
deplete a particular
gene product. Cellular extracts resulting from strains incubated under these
two conditions are
compared with extracts prepared from identically-grown wild type strains.
These extracts are
then used for the rapid evaluation of targets using existing in vitro assays
or new assays directed
toward novel gene products, without having to purify the gene product. Such a
whole cell
extract approach to in vitro assay development is typically necessary for
targets involved in cell
wall biosynthetic pathways (e. g. (1,3)-~i-glucan synthesis or chitin
synthesis) which involve
multiple gene products that transit the secretory pathway before receiving
essential post-
translational modifications required for their functional activity. GRACE-
derived strains for
conditional expression of target genes involved in these, or other cell wall
pathways (e. g. (1,6)-
(3-glucan synthesis) enable in vitro assays to be performed directly in C.
albicans.
-70-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
5.5.2 Cell-based Screening Assays
Current cell-based assays used to identify or to characterize compounds for
drug
discovery and development frequently depend on detecting the ability of a test
compound to
modulate the activity of a target molecule located within a cell or located on
the surface of a cell.
Most often such target molecules are proteins such as enzymes, receptors and
the like.
However, target molecules also include other molecules such as DNAs, lipids,
carbohydrates
and RNAs including messenger RNAs, ribosomal RNAs, tRNAs and the like. A
number of
highly sensitive cell-based assay methods are available to those of skill in
the art to detect
binding and interaction of test compounds with specific target molecules.
However, these
methods are generally not highly effective when the test compound binds to or
otherwise
interacts with its target molecule with moderate or low affinity. In addition,
the target molecule
may not be readily accessible to a test compound in solution, such as when the
target molecule is
located inside the cell or within a cellular compartment such as the periplasm
of a bacterial cell.
Thus, current cell-based assay methods are limited in that they are not
effective in identifying or
characterizing compounds that interact with their targets with moderate to low
affinity or
compounds that interact with targets that are not readily accessible.
The cell-based assay methods of the present invention have substantial
advantages over current cell-based assays. These advantages derive from the
use of sensitized
cells in which the level or activity of at least one gene product required for
fungal proliferation,
virulence, or pathogenicity (the target molecule) has been specifically
reduced to the point where
the presence or absence of its function becomes a rate-determining step for
fungal growth,
survival, proliferation, virulence, or pathogenicity. Such sensitized cells
become much more
sensitive to compounds that are active against the affected target molecule.
For example,
sensitized cells are obtained by growing a GRACE strain in the presence of a
concentration of
inducer or repressor which provides a level of a gene product required for
fungal growth,
survival, proliferation, virulence, or pathogenicity such that the presence or
absence of its
function becomes a rate-determining step for fungal growth, survival,
proliferation, virulence, or
pathogenicity. Thus, cell-based assays of the present invention are capable of
detecting
compounds exhibiting low or moderate potency against the target molecule of
interest because
such compounds are substantially more potent on sensitized cells than on non-
sensitized cells.
The effect may be such that a test compound may be two to several times more
potent, at least
10 times more potent, at least 20 times more potent, at least SO times more
potent, at least 100
times more potent, at least 1000 times more potent, or even more than 1000
times more potent
when tested on the sensitized cells as compared to the non-sensitized cells.
Due in part to the increased appearance of antibiotic resistance in pathogenic
-71 -
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
microorganisms and to the significant side-erects associated with some
currently used
antibiotics, novel antibiotics acting at new targets are highly sought after
in the art. Yet, another
limitation in the current art related to cell-based assays is the problem of
repeatedly identifying
hits against the same kinds of target molecules in the same limited set of
biological pathways.
This may occur when compounds acting at such new targets are discarded,
ignored or fail to be
detected because compounds acting at the "old" targets are encountered more
frequently and are
more potent than compounds acting at the new targets. As a result, the
majority of antibiotics in
use currently interact with a relatively small number of target molecules
within an even more I
limited set of biological pathways.
The use of sensitized cells of the current invention provides a solution to
the
above problems in two ways. First, desired compounds acting at a target of
interest, whether a
new target or a previously known but poorly exploited target, can now be
detected above the
"noise" of compounds acting at the "old" targets due to the specific and
substantial increase in
potency of such desired compounds when tested on the sensitized cells of the
current invention.
Second, the methods used to sensitize cells to compounds acting at a target of
interest may also
sensitize these cells to compounds acting at other target molecules within the
same biological
pathway. For example, expression of a gene encoding a ribosomal protein at a
level such that
the function of the ribosomal protein becomes rate limiting for fiuigal
growth, survival,
proliferation, virulence, or-pathogenicity is expected to sensitize the cell
to compounds acting at.
fat ribosomal protein to compounds acting at any of the ribosomal components
(proteins or
rRNA) or even to compounds acting at any target which is part of the protein
synthesis pathway.
'Thus an important advantage of the present invention is the ability to reveal
new targets and
pathways that were previously.not readily accessible to drug discovery
methods.
Sensitized cells of the present invention are prepared by reducing the
activity or
level of a target molecule. The target molecule may be a gene product, such as
an RNA or
polypeptide produced from the nucleic acids required for fixngal growth,
survival, proliferation,
virulence, or pathogenicity described herein. In addition, the target may be
an RNA or
polypeptide in the same biological pathway as the nucleic acids required for
fungal growth,
s~'ival, proliferation, virulence, or pathogenicity as described herein. Such
biological
pathways include, but are not limited to, enzymatic, biochemical and metabolic
pathways as
well as pathways involved in the production of cellular structures such as the
cell membrane.
Current methods employed in the arts of medicinal and combinatorial
chemistries are able to make use of structure-activity relationship
information derived from
testing compounds in various biological assays including direct. binding
assays and cell-based
assays. Occasionally compounds are directly identified in such assays that are
sufficiently
-72-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
potent to be developed as drugs. More often, initial hit compounds exhibit
moderate or low
potency. Once a hit compound is identified with low or moderate potency,
directed libraries of
compounds are synthesized and tested in order to identify more potent leads.
Generally these
directed libraries are combinatorial chemical libraries consisting of
compounds with structures
related to the hit compound but containing systematic variations including
additions,
subtractions and substitutions of various structural features. When tested for
activity against the
target molecule, structural features are identified that either alone or in
combination with other
features enhance or reduce activity. This information is used to design
subsequent directed
libraries containing compounds with enhanced activity against the target
molecule. After one or
several iterations of this process, compounds with substantially increased
activity against the
target molecule are identified and may be fiuther developed as drugs. 'This
process is facilitated
by use of the sensitized cells of the present invention since compounds acting
at the selected
targets exhibit increased potency in such cell-based assays, thus; more
compounds can now be
characterized providing more useful information than would be obtained
otherwise.
'Thus, it is now possible using cell-based assays of the present invention to
identify or characterize compounds that previously would not have been readily
identified or
characterized including compounds that act at targets that previously were
not.readily exploited
using cell-based assays. The process of evolving potent drug leads from
initial hit compounds is
also substantially improved by the cell-based assays of the present invention
because, for the
~e number of test compounds, more structure-function relationship information
is likely to be
revealed.
The method of sensitizing a cell entails selecting a suitable gene. A suitable
gene is one whose expression is required for the growth, survival,
proliferation, virulence, or
pa~ogenicity of the cell to be sensitized. The next step is to obtain a cell
in which the level or
activity of the target can be reduced to a level where it is rate limiting for
growth, survival,
proliferation, virulence or pathogenicity. For example, the cell may be a
GRACE strain in
which the selected gene is under the control of a regulatable promoter. The
amount of RNA
transcribed from the selected gene is limited by varying the concentration of
an inducer or
repressor which acts on the regulatable promoter, thereby varying the activity
of the promoter
driving transcription of the RNA. Thus, cells are sensitized by exposing them
to an inducer or
repressor concentration that results in an RNA level such that the function of
the selected gene
product becomes rate limiting for fungal growth, survival, proliferation,
virulence, or
pathogenicity.
In one embodiment of the cell-based assays, GRACE strains, in which the
sequences required for fungal growth, survival, proliferation, virulence, or
pathogenicity of
-73-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Candida albicans described herein are under the control of a regulatable
promoter, are grown in
the presence of a concentration of inducer or repressor which causes the
fiuiction of the gene
products encoded by these sequences to be rate limiting for fimgal growth,
survival,
proliferation, virulence, or pathogenicity. To achieve that goal, a growth
inhibition dose curve
of inducer or repressor is calculated by plotting various doses of inducer or
repressor against the
corresponding growth inhibition caused by the limited levels of the gene
product required for
fimgal proliferation. From this dose-response curve, conditions providing
various growth rates,
from 1 to 100% as compared to inducer or repressor-free growth, can be
determined. For
example, if the regulatable promoter is repressed by tetracycline, the GRACE
strain may be
grown in the presence of varying levels of tetracyline. Similarly, inducible
promoters may be
used. In this case, the GRACE strains are grown in the presence of varying
concentrations of
inducer. For example, the highest concentration of the inducer or repressor
that does not reduce
the growth rate significantly can be estimated firm the dose-response curve.
Cellular
proliferation can be monitored by growth medium turbidity via OD measurements.
In another
example, the concentration of inducer or repressor that reduces growth by 25%
can be predicted
from the dose-response curve. In still another example, a concentration of
inducer or repressor
that reduces growth by 50% can be calculated from the dose-response curve.
Additional
parameters such as colony forming units (cfix) are also used to measure
cellular growth, survival
and/or viability.
In another embodiment of the present invention, an individual haploid strain
may
similarly be used as the basis for detection of an antifixngal or therapeutic
agent. In this
embodiment, the test organism (e.g. Aspergillus, fumigatus, Cryptococcus
neoformans,
Magnaportha grisea or.any other haploid organisms represented in Table I) is a
strain
constructed by modifying the single allele of the target gene in one step by
recombination with a
promoter replacement fiagment comprising a heterologous regulatable promoter,
such that the
expression of the gene is conditionally regulated by the heterologous
promoter. Like individual
diploid GRACE strains, sensitized haploid cells may similarly be used in whole
cell-based assay
methods to identify compounds displaying a preferential activity against the
affected target.
In various embodiments, the modified strain is grown under a first set of
conditions where the heterologous promoter is expressed at a relatively low
level (i.e. partially
repressed) and the extent of growth determined. This experiment is repeated in
the presence of a
test compound and a second measurement of growth obtained. The extent of
growth in the
presence and in the absence of the test compound are then compared to provide
a first indicator
v~ue. Two fiuther experiments are performed, using non-repressing growth
conditions where
the target gene is expressed at substantially higher levels than in the first
set of conditions. The
-74-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
extent of growth is determined in the presence and absence of the test
compound under the
second set of conditions to obtain a second indicator value. The first and
second indicator values
are then compared. If the indicator values are essentially the same, the data
suggest that the test
compound does not inhibit the test target. However, if the two indicator
values are substantially
different, the data indicates that the level of expression of the target gene
product may determine
the degree of inhibition by the test compound and, therefore, it is likely
that the gene product is
the target of that test compound. Whole-cell assays comprising collections or
subsets of multiple
sensitized strains may also be screened, for example, in a series of 96-well,
384-well, or even
1586-well microtiter plates, with each well containing individual strains
sensitized to identify
compounds displaying a preferential activity against each affected target
comprising a target set
or subset selected from, but not limited to the group consisting of fungal-
specific, pathogen-
specific, desired biochemical-function, human-homolog, cellular localization,
and signal
transduction cascade target sets.
Cells to be assayed are exposed to the above-determined concentrations of
~ducer or repressor. The presence of the inducer or repressor at this sub-
lethal concentration
reduces the amount of the proliferation-required gene product to the lowest
amount in the cell
that will support growth. Cells grown in the presence of this concentration of
inducer or
repressor are therefore specifically more.sensitive to inhibitors of the
proliferation-required
protein or RNA of interest as well as to inhibitors of proteins or RNAs in the
same
biological pathway as the proliferation-required protein or RNA of interest
but not
°specifically more sensitive to inhibitors of unrelated proteins or
RNAs.
Cells pretreated with sub-inhibitory concentrations of inducer or repressor,
.. which therefore contain a reduced amount of proliferation-required target
gene product, are
used to screen for compounds that reduce cell growth. The sub-lethal
concentration of
inducer or repressor may be any concentration consistent with the intended use
of the assay
to identify candidate compounds to which the cells are more sensitive than are
control cells
in which this gene product is not rate-limiting. For example, the sub-lethal
concentration of
the inducer or repressor may be such that growth inhibition is at least about
5%, at least
about 8%, at least about 10%, at least about 20%, at least about 30%, at least
about 40%, at
least about 50%, at least about 60% at least about 75%, , at least 80%, at
least 90%, at least
95% or more than 95%. Cells which are pre-sensitized using the preceding
method are
more sensitive to inhibitors of the target protein because these cells contain
less target
protein to inhibit than wild-type cells.
It will be appreciated that similar methods may be used to identify
compounds which inhibit virulence or pathogenicity. In such methods, the
virulence or
-75-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
pathogenicity of cells exposed to the candidate compound which express rate
limiting levels
of a gene product involved in virulence or pathogenicity is compared to the
virulence or
pathogenicity of cells exposed to the candidate compound in which the levels
of the gene
product are not rate limiting. Virulence or pathogenicity may be measured
using the
techniques described herein.
In another embodiment of the cell-based assays of the present invention, the
level or activity of a gene product required for fungal growth, survival,
proliferation,
virulence, or pathogenicity is reduced using a mutation, such as a temperature
sensitive
mutation, in the sequence required for fungal growth, survival, proliferation,
virulence, or
pathogenicity and an inducer or repressor level which, in conjunction with the
temperature
sensitive mutation, provides levels of the gene product required for fungal
growth, survival,
proliferation, virulence, or pathogenicity which are rate limiting for
proliferation. Growing
the cells at an intermediate temperature between the permissive and
restrictive temperatures
of the temperature sensitive mutant where the mutation is in a gene required
for fungal
growth, survival, proliferation, virulence, or pathogenicity produces cells
with reduced
activity of the gene product required for growth, survival, proliferation,
virulence, or
pathogenicity. The concentration of inducer or repressor is chosen so as to
further reduces
the activity of the gene product required for fungal growth, survival,
proliferation, virulence,
or pathogenicity. Drugs that may not have been found using either the
temperature sensitive
mutation or the inducer or repressor alone may be identified by determining
whether cells in
which expression of the nucleic acid encoding the proliferation-required gene
product has
been reduced and which are grown at a temperature between the permissive
temperature and
the restrictive temperature are substantially more sensitive to a test
compound than cells in
which expression of the gene product required for fungal growth, survival,-
proliferation,
virulence, or pathogenicity has not been reduced and which are grown at a
permissive
temperature. Also drugs found previously from either the use of the inducer or
repressor
alone or the temperature sensitive mutation alone may have a different
sensitivity profile
when used in cells combining the two approaches, and that sensitivity profile
may indicate a
~ more specific action of the drug in inhibiting one or more activities of the
gene product.
Temperature sensitive mutations may be located at different sites within a
gene and may lie within different domains of the protein. For example, the
dnaB gene of
Escherichia coli encodes the replication fork DNA helicase. DnaB has several
domains,
including domains for oligomerization, ATP hydrolysis, DNA binding,
interaction with
primase, interaction with DnaC, and interaction with DnaA. .Temperature
sensitive
mutations in different domains of DnaB confer different phenotypes at the
restrictive
-76-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
temperature, which include either an abrupt stop or a slow stop in DNA
replication either
with or without DNA breakdown (Wechsler, J.A. and Gross, J.D. 1971 Escherichia
coli
mutants temperature-sensitive for DNA synthesis. Mol. Gen. Genetics 113:273-
284) and
termination of growth or cell death. Thus, temperature sensitive mutations in
different
domains of the protein may be used in conjunction with GRACE strains in which
expression of the protein is under the control of a regulatable promoter.
It will be appreciated that the above method may be performed with any
mutation which reduces but does not eliminate the activity or level of the
gene product
which is required for fungal growth, survival, proliferation, virulence, or
pathogenicity.
When screening for antimicrobial agents against a gene product required for
fungal growth, survival, proliferation, virulence, or pathogenicity, growth
inhibition,
virulence or pathogenicity of cells containing a limiting amount of that gene
product can be
assayed. Growth inhibition can be measured by directly comparing the amount of
growth,
measured by the optical density of the culture relative to uninoculated growth
medium,
between an experimental sample and a control sample. Alternative methods for
assaying
cell proliferation include measuring green fluorescent protein (GFP) reporter
'construct
emissions, various enzymatic activity assays, and other methods well known in
the art.
Virulence and pathogenicity may be measured using the techniques described
herein.
It will be appreciated that the above method may be performed in solid
phase, liquid phase, a combination of the two preceding media., or in vivo.
For example,
cells grown on nutrient agar containing the inducer or repressor which acts on
the
regulatable promoter used to express the proliferation required gene product
may be
exposed to compounds spotted onto the agar surface. A compound's effect may be
judged
from the diameter of the resulting killing zone, the area around the compound
application
point in which cells do not grow. Multiple compounds may be transferred to
agar plates and
simultaneously tested using automated and semi-automated equipment including
but not
restricted to mufti-channel pipettes (for example the Beckman Multimek) and
mufti-channel
spotters (for example the Genomic Solutions Flexys). In this way multiple
plates and
thousands to millions of compounds may be tested per day.
The compounds are also tested entirely in liquid phase using microtiter plates
as described below. Liquid phase screening may be performed in microtiter
plates
containing 96, 384, 1536 or more wells per microtiter plate to screen multiple
plates and
thousands to millions of compounds per day. Automated and semi-automated
equipment
are used for addition of reagents (for example cells and compounds) and for
determination
of cell density.
-77_
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
The compounds are also tested in vivo using the methods described herein.
It will be appreciated that each of the above cell-based assays may be used to
identify compounds which inhibit the activity of gene products from organisms
other than
Candida albicans which are homologous to the Candida albicans gene products
described
herein. For example, the target gene products may be from animal fugal
pathogens such as
Aspergillus fumigatus, Aspergillus niger, Aspergillus_flavis, Candida
tropicalis, Candida
parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis,
Exophalia
dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis
carinii,
Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus,
or Absidia
~orymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe
graminis,
Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia controver-
sa, Ustilago
maydis, or any species falling within the genera of any of the above species.
In some
embodiments, the gene products are from an organism other than Saccharomyces
cerevisiae.
1 S 5,5.2.1 Cell-Based Assays Using GRACE Strains
GRACE strains in which one allele of a gene required for fungal growth,
survival, proliferation, virulence, or pathogenicity is inactivated while the
other allele is
under the control of a regulatable promoter are constructed using the methods
described
herein. For the purposes of the present example, the regulatable promoter may
be the
tetracycline regulated promoter described herein, but it will be appreciated
that any
regulatable promoter may be used.
In one embodiment of the present invention, an individual GRACE strain is
used as the basis for detection of a therapeutic agent active against a
diploid pathogenic
fungal cell. In this embodiment, the test organism is a GRACE strain having a
modified
allelic gene pair, where the first allele of the gene has been inactivated by
the insertion of, or
replacement by, a nucleotide sequence encoding an expressible, dominant
selectable marker
and the second allele has been modified, by recombination, to place the second
allele under
the controlled expression of a heterologous promoter. This test GRACE strain
is then
grown under a first set of conditions where the heterologous promoter is
expressed at a
relatively low level ("repressing") and the extent of growth determined. This
measurement
may be carried out using any appropriate standard known to those skilled in
the art
including optical density, wet weight of pelleted cells, total cell count,
viable count, DNA
content, and the like.. This experiment is repeated in the presence of a test
compound and a
second measurement of growth obtained. The extent of growth in the presence
and in the
absence of the test compound, which can conveniently be expressed in terms of
indicator
_78_
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
values, are then compared. A dissimilarity in the extent of growth or
indicator values
provides an indication that the test compound may interact with the target
essential gene
product.
To gain more information, two further experiments are performed, using a
second set of "non-repressing" growth conditions where the second allele,
under the control
of the heterologous promoter, is expressed at a level substantially higher
than in the first set
of conditions described above. The extent of growth or indicator values is
determined in the
presence and absence of the test compound under this second set of conditions.
The extent
of growth or indicator values in the presence and in the absence of the test
compound are
then compared. A dissimilarity in the extent of growth or indicator values
provides an
indication that may interact with the target essential gene product.
Furthermore, the extent of growth in the first and in the second set of growth
conditions can also be compared. If the extent of growth is essentially the
same, the data
suggest that the test compound does not inhibit the gene product encoded by
the modified
allelic gene pair carried by the GRACE strain tested. However, if the extent
of growth are
substantially different, the data indicate that the level of expression of the
subject gene
product may determine the degree of inhibition by the test compound and,
therefore, it is
likely that the subject gene product is the target of that test compound.
Although each GRACE strain can be tested individually, it will be more
efficient to screen entire sets or subsets of a GRACE strain collection at one
time.
Therefore in one aspect of this invention, arrays may be established, for
example in a series
of 96-well microtiter plates, with each well containing a single GRACE strain.
In one
representative, but not limiting approach, four microtiter plates are used,
comprising two
pairs where the growth medium in one pair supports greater expression of the
heterologous
promoter controlling the remaining active allele in each strain, than the
medium in the other
pair of plates. One member of each pair is supplemented with a compound to be
tested and
measurements of growth of each GRACE strain is determined using standard
procedures to
provide indicator values for each isolate tested. The collection of diploid
pathogenic
GRACE strains used in such a method for screening for therapeutic agents may
comprise,
for example, a substantially complete set of all the modified allelic gene
pairs of the
organism, the substantially complete set of all the modified allelic essential
gene pairs of the
organism or the collection may be selected from a subset of GRACE strains
selected from,
but not limited to the group consisting of fungal-specific, pathogen-specific,
desired
biochemical-function, human-homolog, cellular localization, and signal
transduction
c~cade target sets.
-79-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
The GRACE strains are grown in medium comprising a range of tetracycline
concentrations to obtain the growth inhibitory dose-response curve for each
strain. First,
seed cultures of the GRACE strains are grown in the appropriate medium.
Subsequently,
aliquots of the seed cultures are diluted into medium containing varying
concentrations of
tetracycline. For example, the GRACE strains may be grown in duplicate
cultures
containing two-fold serial dilutions of tetracycline. Additionally, control
cells are grown in
duplicate without tetracycline. The control cultures are started from equal
amounts of cells
derived from the same initial seed culture of a GRACE strain of interest. The
cells are
grown for an appropriate period of time and the extent of growth is determined
using any
appropriate technique. For example, the extent of growth may be determined by
measuring
the optical density of the cultures. When the control culture reaches mid-log
phase the
percent growth (relative to the control culture) for each of the tetracycline
containing
cultures is plotted against the log concentrations of tetracycline to produce
a growth
inhibitory dose response curve for tetracycline. The concentration of
tetracycline that
i~ibits cell growth to 50% (ICso) as compared to the 0 mM tetracyline control
(0% growth
inhibition) is then calculated from the curve. Alternative methods of
measuring growth are
also contemplated. Examples of these methods include measurements of proteins,
the .
expression of which is engineered into the cells being tested and can readily
be measured.
Examples of such proteins include green fluorescent protein (GFP) and various
enzymes.
Cells are pretreated with the selected concentration of tetracycline and then
used to test the sensitivity of cell populations to candidate compounds. For
example, the
cells may be pretreated with a concentration of tetracycline which inhibits
growth by at least
about 5%, at least about 8%, at least about 10%, at least about 20%, at least
about 30%, at
least about 40%, at least about 50%, at least about 60% at least about 75%,.at
least 80%, at
least 90%, at least 95% or more than 95%. The cells are then contacted with
the candidate
compound and growth of the cells in tetracycline containing medium is compared
to growth
of the control cells in medium which lacks tetracycline to determine whether
the candidate
compound inhibits growth of the sensitized cells (i.e. the cells grown in the
presence of
tetracycline). For example, the growth of the cells in tetracycline containing
medium may
be compared to the growth of the cells in medium lacking tetracycline to
determine whether
the candidate compound inhibits the growth of the sensitized cells (i.e. the
cells grown in
the presence of tetracyline) to a greater extent than the candidate compound
inhibits the
growth of cells grown in the absence of tetracycline. For example, if a
significant difference
in growth is. obseived between the sensitized cells (i.e. the cells grown in
the presence of
tetracycline) and the non-sensitized cells (i.e. the cells grown in the
absence of tetracycline),
-80-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
the candidate compound may be used to inhibit the proliferation of the
organism or may be
further optimized to identify compounds which have an even greater ability to
inhibit the
growth, survival, or proliferation of the organism.
Similarly, the virulence or pathogenicity of cells exposed to a candidate
compound which express a rate limiting amount of a gene product required for
virulence or
pathogenicity may be compared to the virulence or pathogenicity of cells
exposed to the
candidate compound in which the level of expression of the gene product
required for
virulence or pathogenicity is not rate limiting. In such methods, test animals
are challenged
with the GRACE strain and fed a diet containing the desired amount of
tetracycline and the
c~didate compound. Thus, the GRACE strain infecting the test animals expresses
a rate
limiting amount of a gene product required for virulence or pathogenicity
(i.e. the GRACE
cells in the test animals are sensitized). Control animals are challenged with
the GRACE
strain and are fed a diet containing the candidate compound but lacking
tetracycline. The
virulence or pathogenicity of the GRACE strain in the test animals is compared
to that in
~e control animals. For example, the virulence or pathogenicity of the GRACE
strain in
the test animals may be compared to that in the control animals to determine
whether the
candidate compound inhibits the virulence or pathogenicity of the sensitized
GRACE cells
(i.e. the cells in the animals whose diet included tetracyline) to a greater
extent'than the
candidate compound inhibits the growth of the GRACE cells in animals whose
diet lacked
tetracycline. For example, if a significant difference in growth is observed
between the
sensitized GRACE cells (i.e. the cells in animals whose diet included
tetracycline) and the
non-sensitized cells (i.e. the GRACE cells animals whose diet did not include
tetracycline),
the candidate:compound may be used to inhibit the virulence or pathogenicity
of the
organism or may be further optimized to identify compounds which have an even
greater
ability to inhibit the virulence or pathogenicity of the organism. Virulence
or pathogenicity
may be measured using the techniques described therein.
It will be appreciated that the above cell-based assays may be used to
identify compounds which inhibit the activity of gene products from organisms
other than
Candida albicans which are homologous to the Candida albicans gene products
described
herein. For example, the gene products may be from animal fugal pathogens such
as
Aspergillus fumigatus, Aspergillus niger, Aspergillus flavis, Candida
tropicalis, Candida
parapsilopsis, Candida krusei, Cryptococcus neoformans, Coccidioides immitis,
Exophalia
dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis
carinii,
Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus,
or Absidia
corymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Erysiphe
graminis,
-81-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Magnaporthe grisea, Puccinia recodita, Septoria triticii, Tilletia
controversa, Ustilago
maydis, or any species falling within the genera of any of the above species.
In some
embodiments, the gene products are from an organism other than Saccharomyces
cerevisae.
The cell-based assay described above may also be used to identify the
biological pathway in which a nucleic acid required for fungal proliferation,
virulence or
pathogenicity or the gene product of such a nucleic acid lies. In such
methods, cells
expressing a rate limiting level of a target nucleic acid required for fungal
proliferation,
virulence or pathogenicity and control cells in which expression of the target
nucleic acid is
not rate limiting are contacted with a panel of antibiotics known to act in
various pathways.
If the antibiotic acts in the pathway in which the target nucleic acid or its
gene product lies,
cells in which expression of target nucleic acid is rate limiting will be more
sensitive to the
antibiotic than cells in which expression of the target nucleic acid is not
rate limiting.
As a control, the results of the assay may be confirmed by contacting a panel
of cells in which the levels of many different genes required for
proliferation, virulence or
pa~ogenicity, including the target gene, is rate limiting. If the antibiotic
is acting
specifically, heightened sensitivity to the antibiotic will be observed only
in the cells in
which the target gene is rate limiting (or cells in which genes in the same
pathway as the
target gene is rate limiting) but will not be observed generally in which a
gene product
required for proliferation, virulence or pathogenicity is rate limiting.
It will be appreciated that the above method for identifying the biological
pathway in which a nucleic.acid required for proliferation, virulence or
pathogenicity lies
may be applied to nucleic acids from organisms other than Candida albicans
which are
homologous to the Candida albicans nucleic acids described herein. For
example, the
nucleic acids may be from animal fugal pathogens such as Aspergillus
fumigatus,
Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida
parapsilopsis, Candida
krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis,
Fusarium
oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon
beigelii,
Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera,
or the plant
gal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe
grisea,
Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago maydis,
or any species
falling within the genera of any of the above species. In some embodiments,
the nucleic
acids are from an organism other than Saccharomyces cerevisae.
Similarly, the above method may be used to determine the pathway on which
a test compound, such as a test antibiotic acts. A panel of cells, each of
which expresses a
rate limiting amount of a gene product required for fungal proliferation,
virulence or
-82-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
pathogenicity where the gene product lies in a known pathway, is contacted
with a
compound for which it is desired to determine the pathway on which it acts.
The sensitivity
of the panel of cells to the test compound is determined in cells in which
expression of the
nucleic acid encoding the gene product required for proliferation, virulence
or pathogenicity
is at a rate limiting level and in control cells in which expression of the
gene product
required for proliferation, virulence or pathogenicity is not at a rate
limiting level. If the test
compound acts on the pathway in which a particular gene product required for
proliferation,
virulence, or pathogenicity lies, cells in which expression of that particular
gene product is
at a rate limiting level will be more sensitive to the compound than the cells
in which gene
products in other pathways are at a rate limiting level. In addition, control
cells in which
expression of the particular gene required for fungal proliferation, virulence
or
pathogenicity is not rate limiting will not exhibit heightened sensitivity to
the compound. In
this way, the pathway on which the test compound acts may be determined.
It will be appreciated that the above method for determining the pathway on
which a test compound acts may be applied to organisms other than Candida
albicans by
using panels of cells in which the activity or level of gene products which
are homologous
to the Candida albicans gene products described herein is rate limiting. For
example, the
gene products may be from animal fugal pathogens such as Aspergillus
fumigatus,
Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida
parapsilopsis, Candida
~.~ei, Cryptococcus ncoformans, Coccidioides immitis, Exophalia dermatiditis,
Fusariumv
oxysporum; Histoplasma capsulatum, Pneumocystis carinii, Trichosporon
beigelii,
Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera,
or the plant
fungal pathogens, such as Botrytis cinerea, Erysiphe graminis, Magnaporthe
grisea,
Puccinia recodita, Septoria triticii, Tilletia controversa, Llstilago maydis,
or any species
falling within the genera of any of the above species. In some embodiments,
the gene
products are from an organism other than Saccharomyces cerevisiae. Example
6.4, infra,
provided below describes one method for performing such assays.
One skilled in the art will appreciate that further optimization of the assay
conditions, such as the concentration of inducer or repressor used to produce
rate limiting
levels of a gene product required for fungal proliferation, virulence or
pathogenicity and/or
the growth conditions used for the assay (for example incubation temperature
and medium
components) may further increase the selectivity and/or magnitude of the
antibiotic
sensitization exhibited.
It will be appreciated that the above methods for identifying the pathway in
which a gene required for growth, survival, proliferation, virulence or
pathogenicity lies or
-83-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
the pathway on which an antibiotic acts may be performed using organisms other
than
Candida albicans in which gene products homologous to the Candida albicans
gene
products described herein are rate limiting. For example, the gene products
may be from
animal fugal pathogens such as Aspergillus fumigatus, Aspergillus niger,
Aspergillus flavis,
Candida tropicalis, Candida parapsilopsis, Candida krusei, Cryptococcus
neoformans,
Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma
capsulatum, Pneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus,
Mucor rouxii,
Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens,
such as
Botrytis cinerea, Erysiphe graminis, Magnaporthe grisea, Puccinia recodita,
Septoria
triticii, Tilletia controversa, Ustilago maydis, or any species falling within
the genera of any
of the above species. In some embodiments, the gene products are from an
organism other
than Saccharomyces cerevisae.
Furthermore, as discussed above, panels of GRACE strains may be used to
characterize the point of intervention of any compound affecting an essential
biological
pathway including antibiotics with no known mechanism of action.
Another embodiment of the present invention is a method for determining
the pathway against which a test antibiotic compound is active, in which the
activity of
proteins or nucleic acids involved in pathways required for fungal growth,
survival,
proliferation; virulence or pathogenicity is reduced by contacting cells with
a sub-lethal
concentration of a known antibiotic which acts against the protein or nucleic
acid. The
method is similar to those described above for determining which pathway a
test antibiotic
acts against, except that rather than reducing the activity or level of a gene
product required
for fungal proliferation, virulence or pathogenicity by expressing the gene
product at a rate
limiting amount in a GRACE strain, the activity or level of the gene product
is reduced
using a sub-lethal level of a known antibiotic which acts against the gene
product.
Growth inhibition resulting from the presence of sub-lethal concentration of
the known antibiotic may be at least about 5%, at least about 8%, at least
about 10%, at least
about 20%, at least about 30%, at least about 40%, at least about 50%, at
least about 60%,
°r at least about 75%, at least 80%, at least 90%, at least 95% or more
than 95%.
Alternatively, the sub-lethal concentration of the known antibiotic may be
determined by measuring the activity of the target proliferation-required gene
product rather
than by measuring growth inhibition.
Cells are contacted with a combination of each member of a panel of known
~tibiotics at a sub-lethal level and varying concentrations of the test
antibiotic. As a
control, the cells are contacted with varying concentrations of the test
antibiotic alone. The
-84-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
ICS° of the test antibiotic in the presence and absence of the known
antibiotic is determined.
If the ICS°s in the presence and absence of the known drug are
substantially similar, then the
test drug and the known drug act on different pathways. If the ICsos are
substantially
different, then the test drug and the known drug act on the same pathway.
Similar methods may be performed using known antibiotics which act on a
gene product homologous to the Candida albicans sequences described herein.
The
homolgous gene product may be from animal fugal pathogens such as Aspergillus
fumigatus, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida
parapsilopsis,
Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia
dermatiditis,
F'usarium oxysporum, Histoplasma capsulatum, Pneumocystis carinii,
Trichosporon
beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia
corymbigera, or
the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis,
Magnaporthe
grisea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago
maydis, or any
species falling within the genera of any of the above species. In some
embodiments, the
gene products are from an organism other than Saccharomyces cerevisae.
Another embodiment of the present invention is a method for identifying a
candidate compound for use as an antibiotic in which the activity of target
proteins or
nucleic acids involved in pathways required for fungal proliferation,
virulence'or
pathogenicity is reduced by contacting cells with a sub-lethal concentration
of a known
~tibiotic which acts against the target protein or nucleic acid. The method is
similar to
those described above for identifying candidate compounds for use as
antibiotics except that
rather than reducing the activity or level of a gene product required for
proliferation,
virulence or pathogenicity using GRACE strains which express a rate limiting
level of the
gene product, the activity or level of the gene product is reduced using a sub-
lethal level of
a known antibiotic which acts against the proliferation required gene product.
The growth inhibition from the sub-lethal concentration of the known
antibiotic may be at least about 5%, at least about 8%, at least about 10%, at
least about
20%, at least about 30%, at least about 40%, at least about 50%, at least
about 60%, or at
least about 75%, or more.
Alternatively, the sub-lethal concentration of the known antibiotic may be
determined by measuring the activity of the target proliferation-required gene
product rather
than by measuring growth inhibition.
In order to characterize test compounds of interest, cells are contacted with
a
peel of known antibiotics at a sub-lethal level and one or more concentrations
of the test
compound. As a control, the cells are contacted with the same concentrations
.of the test
-85-
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
compound alone. The ICso of the test compound in the presence and absence of
the known
antibiotic is determined. If the ICso of the test compound is substantially
different in the
presence and absence of the known drug then the test compound is a good
candidate for use
as an antibiotic. As discussed above, once a candidate compound is identified
using the
above methods its structure may be optimized using standard techniques such as
combinatorial chemistry.
Similar methods may be performed using known antibiotics which act on a
gene product homologous to the Candida albicans sequences described herein.
The
homolgous gene product may be from animal fugal pathogens such as Aspergillus
fumigatus, Aspergillus niger, Aspergillus flavis, Candida tropicalis, Candida
parapsilopsis,
Candida krusei, Cryptococcus neoformans, Coccidioides immitis, Exophalia
dermatiditis,
Fusarium oxysporum, Histoplasma capsulatum, Pneumocystis carinii, Trichosporon
beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia
corymbigera, or
the plant fungal pathogens, such as Botrytis cinerea, Erysiphe graminis,
Magnaporthe
gj.isea, Puccinia recodita, Septoria triticii, Tilletia controversa, Ustilago
maydis, or any
species falling within the genera of any of the above species. In some
embodiments, the
gene products are from an organism other than Saccharomyces cerevisae.
An exemplary target gene product is encoded by CaTBFI. A number of
features make this C. albicans gene product a valuable drug target. First, the
protein
encoded by CaTBFI is compatible with in vitro high throughput screening of
compounds
that inhibit its activity: Modulated expression of this gene product in whole
cell assays
could be performed in parallel with in vitro assays to broaden the spectrum of
possible
inhibitory compounds identified. In addition, demonstration of the predicted
physical
interaction between CaTbflp and chromosomal telomerases could be used to
develop two-
hybrid assays for drug screening purposes. Finally, because CaTBFI is a fungal
specific
gene, its nucleotide sequence could serve in designing PCR-based diagnostic
tools for
fungal infection.
Other validated drug targets included in the GRACE-derived strain collection
that represent preferred drug targets include the products encoded by the
following
C. albicans genes: CaRH0l, CaERGB, CaAURI, and CaCH0l, as well as those
encoded
by SEQ ID NOs.:I-62. The ability to manipulate these genes using GRACE methods
of the
present invention will improve drug screening practices now in use that are
designed to
identify inhibitors of these critical gene products.
In another embodiment of the present invention, all potential drug targets of
a pathogen could be screened simultaneously against a library of compounds
using, for
86
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
example a 96 well microtiter plate format, where growth, measured by optical
density or
pellet size after centrifugation, may be determined for each well. A genomic
approach to
drug screening eliminates reliance upon potentially arbitrary and artificial
criteria used in
evaluating which target to screen and instead allows all potential targets to
be screened.
This approach not only offers the possibility of identifying specific
compounds which
inhibit a preferred process (e. g. cell wall biosynthetic gene products) but
also the possibility
of identifying all fungicidal compounds within that library and linking them
to their cognate
cellular targets.
In still another embodiment of the present invention, GRACE strains could
be screened to identify synthetic lethal mutations, and thereby uncover a
potentially novel
class of drug targets of significant therapeutic value. For example two
separate genes may
encode homologous proteins that participate in a common and essential cellular
function,
where the essential nature of this function will only become apparent upon
inactivation of
both family members. Accordingly, examination of the null phenotype of each
gene
separately would not reveal the essential nature of the combined gene
products, and
consequently, this potential .drug target would not be identified. Provided
the gene products
are highly homologous to one another, compounds found to inhibit one family
member are
likely to inhibit the other and are therefore predicted to approximate the
synthetic growth
inhibition demonstrated genetically. In other cases however, synthetic
lethality may uncover
seemingly unrelated (and often nonessential) processes, which when combined
produce a
. . synergistic growth impairment (cell death). For example, although
disruption of the
S. cerevisiae gene RVS161 does not present any discernable vegetative growth
phenotype in
yeast carrying this single mutation, at least 9 other genes are known to
display a synthetic
lethal effect when combined with inactivation of RYSl6l. These genes
participate in
processes ranging from cytoskeletal assembly and endocytosis, to signal
transduction and
lipid metabolism and identifies multiple avenues to pursuing a combination
drug target
strategy. A directed approach to uncovering synthetic lethal interactions with
essential and
nonessential drug targets is now performed where a GRACE strain or
heterozygote strain is
identified as displaying an enhanced sensitivity to the tested compound, not
because it
expresses a reduced level of activity for the drug target, but because its
mutation is
synthetically lethal in combination with inhibition of a second drug target.
Discerning
whether the compound specifically inhibits the drug target in the sensitized
GRACE strain
or heterozygote strain or a second target may be achieved by screening the
entire GRACE or
heterozygote strain sets for additional mutant strains displaying equal or
greater sensitivity
to the compound, followed by genetic characterization of a double mutant
strain
87
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
demonstrating synthetic lethality between the two mutations.
5.5.2.2 Screening for Non-antifungal Therapeutic Agents With GRACE
Strains
The biochemical similarity existing between pathogenic fungi and the
mammalian hosts they infect limits the range of clinically useful antimycotic
compounds.
However, this similarity can be exploited using a GRACE strain collection to
facilitate the
discovery of therapeutics that are not used as antimycotics, but are useful
for treatment a
ode-range of diseases, such as cancer, inflammation, etc.
In this embodiment of the invention, fungal genes that are homologous to
disease-causing genes in an animal or plant, are selected and GRACE strains of
this set of
genes are used for identification of compounds that display potent and
specific bioactivity
towards the products of these genes, and therefore have potential medicinal
value for the
treatment of diseases. Essential and non-essential genes and 'the
corresponding GRACE
strains carrying modified allelic pairs of such genes are useful in this
embodiment of the
invention. It has been predicted that as many as 40% of the genes found within
the C.
albicans genome share human functional homologs. It has also been predicted
that as many
as 1% of human genes are involved inhuman diseases and therefore may serve as
potential
drng targets. Accordingly, many genes within the GRACE strain collection are
homologs to
.. ~ disease-causing human.genes.and compounds that specifically inactivate
individual
members of this gene set may in fact have alternative therapeutic value. The
invention
provides a pluralities of GRACE strains in which the modified alleles are
fungal genes that
share sequence, structural and/or functional similarities to genes that are
associated with one
or more diseases of the animal or plant.
For example, much of the signal transduction machinery that promotes cell
cycle progression and is often perturbed in a variety of cancers is conserved
in fungi. Many
of these genes encode for cyclins, cyclin-dependent kinases (CDK), CDK
inhibitors,
phosphatases, and transcription factors that are both structurally and
functionally related.
As a result, compounds found to display specificity towards any of these
functional classes
of proteins could be evaluated by secondary screens to test for potential
anticancer activity.
However, cytotoxic compounds identified in this way need not act on cancer
causing targets
to display therapeutic potential. For example the taxol family of anti-cancer
compounds,
which hold promise as therapeutics for breast and ovarian cancers, bind
tubulin and
promote microtubule assembly, thereby disrupting normal microtubule dynamics.
Yeast
88
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tubulin displays similar sensitivity to taxol, suggesting that additional
compounds affecting
other fundamental cellular processes shared between yeast and man could
similarly be
identified and assessed for antitumor activity.
The phenomenon of pathogenesis extends far beyond the taxonomic borders
of microbes and ultimately reflects the underlying physiology. In many ways,
the
phenomenon of cancer is analogous to the process of pathogenesis by an
opportunistic
pathogen such as C. albicans. Both are non-infectious diseases caused by
either the body's
own cells, or microbes from its natural fauna. These cells grow in a manner
unchecked by
the immune system and in both cases disease manifests itself by colonization
of vital organs
and eventual tissue damage resulting in death. Effective drug-based treatment
is also
elusive for both diseases primarily because the causative agent in both cases
is highly
related to the host.
In fact, a number of successful therapeutic drugs affecting processes
unrelated to cancer have also been discovered through anti-fungal drug
screening programs.
One clinically-important class of compounds includes the immunosuppressant
molecules
rapamycin, cyclosporin A, and FK506, which inhibit conserved signal
transduction
components. Cyclosporin A and FK506, form distinct drug-prolyl isomerase
complexes
(CyPA- Cyclosporin A and FKBP12-FK506 respectively) which bind and inactivate
the
regulatory subunit of the calcium and calmodulin-dependent phosphatase,
.calcineurin.;
Rapamycin also complexes with FKBP12, but this drug-protein complex also binds
to the
TOR family of .phosphatidylinositol kinases to inhibit translation and cell
cycle progression.
In each case. both the mechanism of drug action, and the drug targets
themselves are highly
conserved from yeast to humans.
The identification of C. albicans drug targets, and grouping the targets into
essential-gene, fungal-specific, and pathogen-specific target sets provide the
basis for the
development~of whole=cell screens for compounds that interact with and inhibit
individual
members of any of these targets. Therefore, similar analyses can be used to
identify other
sets of GRACE strains having modified allelic pairs of genes encoding drug
targets with
other specific common functions or attributes. For example, GRACE strain
subsets can be
established which comprise gene targets that are highly homologous to human
'genes, or
gene targets that display a common biochemical function, enzymatic activity,
or that are
involved in carbon compound catabolism, bosynthesis, transport of molecules
(transporter
activity), )cellular localization, signal transduction cascades, cell cycle
control, cell
adhesion, transcription, translation, DNA replication, etc.
89
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
5.5.2.3 Target Gene Dosage-Based Whole Cell Assays
Experiments involving modulating the expression levels of the encoding
gene to reveal phenotypes from which gene function may be inferred can be
carried out in a
pathogenic diploid fungus, such as Candida albicans, using the strains and
methods of the
present intention. The principle of drug-target-level variation in drug
screening involves
modulating the expression level of a drug target to identify specific drug
resistance or drug
sensitivity phenotypes, thereby linking a drug target to a particular
compound. Often, these
phenotypes are indicative of the target gene encoding the bona fide drug
target of this
compound. In examples where this is not the case, the candidate target gene
may
nonetheless provide important insight into the true target gene that is
functioning either in a
pathway or process related to that inhibited. by the compound (e.g. producing
synthetic
phenotype), or instead functioning as a drug resistance mechanism associated
with the
identified compound.
Variation of the expression levels of the target protein is also incorporated
Within both drug screening and drug target identification procedures. The
total, cellular
expression level of a gene product in a diploid organism is modified by
disrupting one allele
of the gene encoding that product, thereby reducing its functional activity in
half; creating a
"haploinsufficient" phenotype. A heterozygous S. cerevisiae strain collection
has been used
in such a haploinsufficiency screen to link drug-based resistance and
hypersensitive
phenotypes to heterozygous drug targets. Nonessential genes are screened
directly using a
haploid deletion strain collection against a compound library for specific
phenotypes or
"chemotypes." However, this procedure cannot be used in a haploid organism
where the
target gene is an essential one.
The expression level of a given gene product is also elevated by cloning the
gene into a plasmid vector that is maintained at multiple copies in the cell.
Overexpression
of the encoding gene is also achieved by fusing the corresponding open reading
frame of the
gene product to a more powerful promoter carried on a multicopy plasmid. Using
these
strategies, a number of overexpression screens have been successfully employed
in S.
~erevisiae to discover novel compounds that interact with characterized drug
targets as well
as to identify the protein targets bound by existing therapeutic compounds.
The GRACE strain collection replaces the surrogate use of S. cerevisiae in
whole cell drug screening by providing a dramatic range in gene expression
levels for drug
targets directly within the pathogen (Fig. 5). In one embodiment of the
invention, this is
achieved using the C. albicans-adapted tetracycline promoter system to
construct GRACE
strains. Northern Blot analysis of 30 different GRACE strains grown under
nonrepressing
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
conditions (i.e. no tetracycline) reveals that 83% of conditionally expressed
genes tested
maintain an overexpression level greater than or equal to 3 fold of wild type,
and 60% of all
genes examined express greater than or equal to 5 times that of the wild type
C. albicans
strain used for GRACE strain construction. As each GRACE strain is in fact
heterozygous,
this expression range is presumably doubled if compared against their
respective
heterozygote strain. For most GRACE strains then, this represents an elevated
expression
level rivaling that typically achieved in S. cerevisiae using standard 2,u-
based multicopy
plasmids, and an absolute level of constitutive expression comparable to that
provided by
the CaACTl promoter. Therefore, the GRACE strain collections of the invention
are not
only useful in target validation under repressing conditions, but are also
useful as a
collection of strains overexpressing these same validated drug targets under
wonrepressing
conditions for whole cell assay development and drug screening.
Variation in the level of expression of a target gene product in a GRACE
strain is also used to explore resistance to antimycotic compounds. Resistance
to existing
~tifungal therapeutic agents reflects both the limited number of antifungal
drugs available
and the alarming dependence and reliance clinicians have in prescribing them.
For example,
dependence on azole-based compounds such as fluconazole for the treatment of
fungal
infections, has dramatically undermined the clinical therapeutic value for
this compound.
The GRACE strain collection is used to combat fluconazole resistance by
identifying gene
products that interact with the cellular target of fluconazole. Such products
are used to
identify drug targets which, when inactivated in concert with ~fluconazole,
provide a
synergistic effect and thereby overcome resistance to fluconazole seen when
this compound
is used alone. This is accomplished, for example, by using the GRACE strain
collection to
overexpress genes that enhance drug resistance. Such genes include novel.or
known plasma
membrane exporters including ATP-binding cassette (ABC) transporters and
multidrug
resistance (MDR) efflux pumps, pleiotropic drug resistance (PDR) transcription
factors, and
protein kinases and phosphatases. Alternatively, genes specifically displaying
a differential
drug sensitivity are identified by screening GRACE strains expressing reduced
levels
(either by haploinsufficiency or threshold expression via the tetracycline
promoter)
individual members of the target set. Identifying such genes provides
important clues to
drug resistance mechanisms that could be targeted for drug-based inactivation
to enhance
the efficacy of existing antifungal therapeutics.
In another aspect of the present invention, overexpression of the target gene
for whole cell assay purposes is supported with promoters other than the
tetracycline
promoter system. (see Section 5.3.1 ) For example, the CaPGKI promoter is used
to
91
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
overexpress C. albicans drug targets genes. In S. cerevisiae, the PGK1
promoter is known
to provide strong constitutive expression in the presence of glucose. See,
Guthrie, C., and G.
R. Fink. 1991. Guide to yeast genetics and molecular biology. Methods Enzymol.
194:373-
398. A preliminary analysis of five C. albicans genes placed under the control
of the
CaPGKI promoter (CaKRE9, CaERGIl, CaALG7, CaTUBI and CaAURI) revealed
dramatic overexpression versus wild type as judged by Northern blot analysis.
The level of
overexpression achieved for all genes exceeds that obtained by the
tetracycline promoter by
3-4 fold. Moreover, CaAURl, which was not overexpressed significantly when
constitutively expressed using the tetracycline promoter, was overexpressed 5-
fold relative
to wild type CaAURl expression levels, suggesting that the CaPGKl promoter is
useful in
overexpressing genes normally not overexpressed by the tetracycline promoter.
In another aspect of the present invention, intermediate expression levels of
individual drug targets within the GRACE strain collection may are engineered
to provide
strains tailored for the development of unique whole cell assays. In this
embodiment of the
invention, GRACE strains are grown in a medium containing a tetracycline
concentration
determined to provide only a partial repression of transcription. Under these
conditions, it
is possible to maintain an expression level between that of the constitutively
expressed
overproducing strain and that of wild type strain, as well as levels of
expression lower than.
that of the wild-type strain. That is, it is possible to titrate the level of
expression to the
minimum required for cell viability. By repressing gene expression to this
critical state,
novel phenotypes, resembling those produced by a partial loss of function
mutation (r. e.
phenocopies of hypomorphic mutants) may be produced and offer additional
target
expression levels applicable for whole cell assay development and drug
screening.
Repressing expression of the remaining allele of an essential gene to the
threshold level
required for viability, therefore will provide a strain with enhanced
sensitivity toward
compounds active against this essential gene product.
In order to demonstrate the utility of target level expression in whole cell
assays for. drug screening, both a CaHIS3 heterozygote strain and a
tetracycline promoter-
regulated CaHIS3 GRACE strain were compared against a wild type (diploid)
CaHIS3
s~.ain for sensitivity towards the 3-aminotriazole (3-AT) (Example 6.3). The
data derived
from these experiments clearly indicate that distinct levels of target gene
products
synthesized within the pathogen could be directly applied in whole cell assay
based drug
screens to identify novel antifungal compounds active against novel drug
targets validated
using the GRACE method.
92
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
5.5.2.4 Uses of Tagged strains
In still another aspect of the present invention, unique oligonucleotide
sequence tags or "bar codes" are incorporated into individual mutant strains
included within
a heterozygous strain collection of validated targets. The presence of these
sequence tags
enables an alternative whole cell assay approach to drug screening. Multiple
target strains
may be screened simultaneously in a mixed population (rather than separately)
to identify
phenotypes between a particular drug target and its inhibitory agent.
Large-scale parallel analyses are performed using mixed populations of the
entire bar coded heterozygous essential strain collection target set and
comparing the
relative representation of individual strains within a mixed population prior
to and after
growth in the presence of a compound. Drug-dependent depletion or
overrepresentation of a
unique bar-coded strain is determined by PCR-amplifying and fluorescently
labeling all bar
codes within the mixed population and hybridizing the resulting PCR products
to an array of
complementary oligonucleotides. Differential representation between bar coded
strains
indicates gene-specific hypersensitivity or resistance and suggests the
corresponding gene
product may represent the molecular target of the compound tested.
In one specific embodiment, the mutant strains are GRACE strains, and each
of the GRACE strains of the set comprises a unique molecular tag, which,
generally, is
incorporated within the cassette used to replace the first allele of the gene
pair to be
modified. Each molecular tag is flanked by primer sequences which are common
to all
members of the set being tested. Growth is carried out in repressive and non-
repressive
media, in the presence and absence of the compound to be tested. The relative
growth of
each strain is assessed by carrying out simultaneous PCR amplification of the
entire
collection of embedded sequence tags.
In one non-limiting aspect of the present invention, the PCR amplification is
performed in an asymmetric manner with fluorescent primers and the resulting
single
stranded nucleic acid product hybridized to an oligonucleotide array fixed to
a surface and
comprises the entire corresponding set of complementary sequences. Analysis of
the level of
each fluorescent molecular tag sequence is then determined to estimate the
relative amount
of growth of GRACE strain of the set, in those media, in the presence and
absence of the
compound tested.
Therefore, for each GRACE strain of the set tested, there could be, in one
non-limiting example of this method, four values for the level of the
corresponding
molecular tag found within the surviving population. They would correspond to
cell growth
under repressing and non-repressing conditions, both in the presence and
absence of the
93
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
compound being tested. Comparison of growth in the presence and absence of the
test
compound provides a value or "indicator" for each set of growth media; that
is, an indicator
derived under repressing and non-repressing conditions. Again, comparison of
the two
indicator values will reveal if the test compound is active against the gene
product expressed
by the modified allelic gene pair carried by that specific member of the GRACE
set tested.
In still another aspect of the present invention, each potential drug target
gene in this heterozygous tagged or bar-coded collection, may be overexpressed
by
subsequently introducing either the Tet promoter or another strong,
constitutively expressed
promoter (e. g. CaACTI , CaADHI and CaPGKI ) upstream of the remaining non-
disrupted
allele. These constructions allow a further increase in the dosage of the
encoded target gene
product of individual essential genes to be used in mixed-population drug
susceptibility
studies. Although overexpression may itself disrupt the normal growth rate of
numerous
members of the population, reliable comparisons could still be made between
mock and
drug-treated mixed cultures to identify compound-specific growth differences.
In S. cerevisiae, the molecular drug targets of several well-characterized
compounds including 3-amino-triazol, benomyl, tunicamycin and fluconazole were
identified by a similar approach. In that study, bar-coded strains bearing
heterozygous
mutations in HIS3, TUB1, ALG7, and ERG11, (i.e. the respective drug targets to
the
compounds listed above) displayed significantly greater sensitivity when
challenged with
their respective compound than other heterozygote bar-coded strains when grown
together
in a mixed population.
In another aspect of the present invention, screens for antifungal compounds
can be carried out using complex mixtures of compounds that comprise at least
one
compound active against the target strain. Tagging'or bar-coding the GRACE
strain
collection facilitates a number of large scale analyses necessary to identify
gene sets as well
as evaluate and ultimately evaluate individual targets within particular gene
sets. For
example, mixed-population drug screening using a bar-coded GRACE strain
collection
effectively functions as a comprehensive whole cell assay. Minimal amounts of
a complex
compound library are sufficient to identify compounds that act on individual
essential target
genes within the collection. This is done without the need to array the
collection. Also,
strong predictions as to the 'richness' of any particular compound library
could be made
before committing to it in drug screening. It becomes possible then to assess
whether, for
example, a carbohydrate-based chemical library possesses greater fungicidal
activity than a
natural product or synthetic compound library. Particularly potent compounds
within any
complex library of molecules can be immediately identified and evaluated
according to the
94
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
priority of targets and assays available for drug screening. Alternatively,
the invention
provides applying this information to developing "tailored" screens, in which
only those
targets which were demonstrated to be inactivated in mixed population
experiments by a
particular compound library would be included in subsequent array-formatted
screens.
Traditionally, drug discovery programs have relied on an individual or a
limited set of validated drug targets. The preceding examples emphasize that
such an
approach, is no longer necessary and that high throughput target evaluation
and drug
screening are now possible. However, a directed approach based on selecting
individual
targets may still be preferred depending on the expertise, interest, strategy,
or budget of a
drug discovery program.
5.5.3 Target Evaluation in an Animal Model System.
Currently, validation of an essential drug target is demonstrated by
examining the effect of gene inactivation under standard laboratory
conditions. Putative
drug target genes deemed nonessential under standard laboratory conditions may
be
examined within an animal model, for example, by testing the pathogenicity of
a strain
homozygous for a deletion in the target gene versus wild type. However,
essential drug
targets are precluded from animal model studies. Therefore, the most desirable
drug targets
are omitted from.the most.pertinent conditions to their target evaluation.
In an embodiment of the invention, conditional expression, provided by the
:GRACE essential.strain collection, overcomes .this longstanding limitation to
target
validation within a host environment. Animal studies can be performed using
mice
inoculated with GRACE essential strains and examining the effect of gene
inactivation by
conditional expression. In a preferred embodiment of the invention, the effect
on mice
injected with a lethal inoculum of a GRACE essential strain could be
determined depending
on whether the mice were provided with an appropriate concentration of
tetracycline to
inactivate expression of a drug target gene. The lack of expression of a gene
demonstrated
to be essential under laboratory conditions can thus be correlated with
prevention of a
terminal C albicans infection. In this type of experiment, only mice "treated"
with
tetracycline-supplemented water, are predicted to survive infection because
inactivation of
the target gene has killed the GRACE strain pathogen within the host.
In yet another embodiment of the invention, conditional expression could be
achieved using a temperature-responsive promoter to regulate expression of the
target gene
or a temperature sensitive allele of a particular drug target, such that the
gene is functional at
3 S 30 ° C but inactivated within the normal body temperature of the
mouse.
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
In the same manner as described above for essential genes, it is equally
feasible to demonstrate whether nonessential genes comprising the GRACE strain
collection
are required for pathogenicity in a mouse model system. Included in this set
are multiple
genes whose null phenotype results in a reduced growth rate and may attenuate
the virulence
of the pathogen. Many mutants demonstrating a slow growth phenotype may
represent
hypomorphic mutations in otherwise essential genes (as demonstrated by
alternative
methods) which are simply not completely inactivated by the conditional
expression method
used to construct the GRACE strain. One important use of such strains is to
assess whether
any given essential gene doubly functions in the process of virulence.
Essential genes that
display substantially reduced virulence and growth rate when only partially
inactivated
represent "multifactorial" drug targets for which even minimally inhibitory
high specificity
compounds would display therapeutic value. Collectively, all GRACE strains
that fail to
cause fungal infection in mice under conditions of gene inactivation by
tetracycline (or
alternative gene inactivation means) define a subset of genes that are
required for
pathogenicity, i.e., GRACE pathogenicity subset. More defined subsets of
pathogenicity
genes, for example those genes required for particular steps in pathogenesis
(e.g. adherence
or invasion) may be determined by applying the GRACE pathogenicity subset of
strains to
in vitro assays which measure the corresponding process. For example,
examining GRACE
pathogenicity strains in a buccal adhesion or macrophage assay by conditional
expression of
individual genes would identify those pathogenicity factors required for
adherence ~or cell
invasion respectively.
The GRACE strain collection or a desired subset thereof is also well suited
for evaluating acquired resistance/suppression or distinguishing between
fungicidal/fungistatic phenotypes for an inactivated drug target within an
animal model
system. In this embodiment of the invention, GRACE strains repressed for
expression of
different essential drug target genes would be inoculated into mice raised on
tetracycline-supplemented water. Each of the GRACE strains would then be
compared
according to the frequency of death associated with the different mice
populations they
infected. It is expected that the majority of infected mice will remain
healthy due to fungal
cell death caused by tetracycline-dependent inactivation of the essential gene
in the GRACE
strain. However, a GRACE strain harboring a drug target more likely to develop
extragenic
suppressors because it is a fungistatic target rather than fungicidal one, or
suppressed by an
alternative physiological process active within a host environment, can be
identified by the
higher incidence of lethal infections detected in mice infected with this
particular strain. By
this method', it is possible to evaluate/rank the likelihood that individual
drug target genes
96
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
may develop resistance within the host environment.
5.5.4 Rational Design of Binding Compounds
Compounds identified via assays such as those described herein can be
useful, for example, for inhibiting the growth of the infectious agent and/or
ameliorating the
symptoms of an infection. Compounds can include, but are not limited to, other
cellular
proteins. Binding compounds can also include, but are not limited to, peptides
such as, for
example, soluble peptides, comprising, for example, extracellular portions of
target gene
product transmembrane receptors, and members of random peptide libraries (see,
e.g., Lam
et al., 1991, Nature 354:82-84; Houghten et al., 1991, Nature 354:84-86) made
of D-and/or
L-configuration amino acids, rationally-designed antipeptide peptides, (see
e.g., Hurby et
al., Application of Synthetic Peptides: Antisense Peptides," In Synthetic
Peptides, A User's
Guide, W.H. Freeman, NY (1992), pp. 289-307), antibodies (including, but not
limited to
polyclonal, monoclonal, human, humanized, anti-idiotypic, chimeric or single
chain
~tibodies,.and FAb, F(ab')2 and FAb expression library fragments, and epitope-
binding
fragments thereof), and small organic or inorganic molecules. In the case of
receptor-type
target molecules, such compounds can include organic molecules (e.g.,
peptidomimetics)
that bind to the ECD and either mimic the activity triggered by the natural
ligand (i.e.,
agonists); as well as peptides, antibodies or fragments thereof, and other
organic compounds
fat mimic the ECD (or a portion thereof) and bind to a "neutralize" natural
ligarid.'
Computer modeling and searching technologies permit identification of
compounds, or the improvement of already identified compounds, that can
modulate target
gene expression or activity. Having identified such a compound or composition,
the active
sites or regions are preferably identified. In the case of compounds affecting
receptor
molecules, such active sites might typically be ligand binding sites, such as
the interaction
domains of ligand with receptor itself. The active site is identified using
methods known in
the art including, for example, from the amino acid sequences of peptides,
from the
nucleotide sequences of nucleic acids, or from study of complexes of the
relevant compound
or composition with its natural ligand. In the latter case, chemical or X-ray
crystallographic
methods are used to find the active site by finding where on the factor the
complexed ligand
is found.
The three-dimensional geometric structure of the active site is then
preferably determined. This is done by known methods, including X-ray
crystallography,
which determines a complete molecular structure. Solid or liquid phase NMR is
also used
to determine certain infra-molecular distances within the active site and/or
in the ligand
97
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
binding complex. Other experimental methods of structure determination known
to those of
skill in the art, are also used to obtain partial or complete geometric
structures. The
geometric structures are measured with a complexed ligand, natural or
artificial, which
increases the accuracy of the active site structure determined. Methods of
computer based
numerical modeling are used to complete the structure (e.g., in embodiments
wherein an
incomplete or insufficiently accurate structure is determined) or to improve
its accuracy.
Finally, having determined the structure of the active site, either
experimentally, by modeling, or by a combination, candidate modulating
compounds are
identified by searching databases containing compounds along with information
on their
molecular structure. Such a search seeks compounds having structures that
match the
determined active site structure and that interact with the groups defining
the active site.
Such a search can be manual, but is preferably computer assisted. These
compounds found
from this search are potential target or pathway gene product modulating
compounds.
Alternatively, these methods are used to identify improved modulating
compounds from an already known modulating compound or ligand. The composition
of
the known compound is modified and the structural effects of modification are
determined
using the experimental and computer modeling methods described above applied
to the new
composition. The altered structure is then compared to the active site
structure of the
compound to determine if an improved fit or interaction results. In this
manner systematic
variations in composition, such as by varying side groups, are quickly
evaluated to obtain
modified modulating compounds or ligands of improved specificity or activity.
Further experimental and computer modeling methods useful to identify
modulating compounds based upon identification of the active sites of target
or pathway
gene or gene products and related transduction and transcription factors are
apparent to
those of skill in the art.
There are a number of articles that review the art of computer modeling of
drugs that interact with specific proteins, including the following: Rotivinen
et al., 1988,
Acta Pharmaceutical Fennica 97:159-166; Ripka, (June 16, 1988), New Scientist
54-57;
McKinaly and Rossmann, 1989, Annu. Rev. Pharmacol. Toxiciol. 29:111-122; Perry
and
Davies, OSAR: Quantitative Structure Activity Relationships in Drug Design pp.
189-193
(Alan R. Liss, Inc. 1989); Lewis and Dean, 1989 Proc. R. Soc. Lond. 236:125-
140 and 1-
162; and, with respect to a model receptor for nucleic acid components, Askew
et al., 1989,
J. Am. Chem. Soc. 111:1082-1090.
Although generally described above with reference to design and generation
of compounds which could alter binding, one could also screen libraries of
known
98
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
compounds, including natural products or synthetic chemicals, as well as other
biologically
active materials, including proteins, for compounds which are inhibitors or
activators.
5.6 Transcriptional Profiling
S
5.6.1 Analysis of Gene Expression
Gene expression profiling techniques are important tools for the
identification of suitable biochemical targets, as well as for the
determination of the mode of
action of known compounds. Completion of the C. albicans genome sequence and
development of nucleic acid microarrays incorporating this information, will
enable
genome-wide gene expression analyses to be carried out .with this diploid
pathogenic
fungus. Therefore, the present invention provides methods for obtaining the
transcriptional
response profiles for both essential and virulence/pathogenicity genes of
Candida albicans.
Conditional expression of essential genes serves to delineate, for example,
regulatory
interactions valuable for the design of drug screening programs focused upon
C. albicans.
In an embodiment of the present invention, the GRACE strain collection is
used for the analysis of expression of essential genes within this pathogen.
One particularly.
powerful application of such a strain collection involves the construction of
a
comprehensive transcriptional profile database for the entire essential gene
set or a desired
subset of essential genes within a pathogen. Such a database is used to
compare the
response profile characteristic of lead antimycotic compounds with the profile
obtained with
new anti-fungal compounds to distinguish those with similar from those with
distinct modes
of action. Matching (or even partially overlapping) the transcriptional
response profiles
determined after treatment of the strain with the lead compound with that
obtained with a
p~icular essential target gene under repressing conditions, is used to
identity the target and
possible mode of action of the drug.
Gene expression analysis of essential genes also permits the biological
function and regulation of those genes to be examined within the pathogen, and
this
information is incorporated within a drug screening program. For example,
transcriptional
profiling of essential drug targets in C. albicans permits the identification
of novel drug
targets which participate in the same cellular process or pathway uncovered
for the existing
drug target and which could not otherwise be identified without direct
experimentation
within the pathogen. These include genes not only unique to the pathogen but
also broad-
range gene classes possessing a distinct function or subject to different
regulation in the
pathogen. Furthermore, pathogen-specific pathways may be uncovered and
exploited for
99
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
the first time.
In another aspect of the present invention, the gene expression profile of
GRACE-derived strains under nonrepressing or induced conditions is established
to
evaluate the overexpression response profile for one or more drug targets. For
example,
overexpression of genes functioning in signal transduction pathways often
display
unregulated activation of the pathway under such conditions. Moreover, several
signaling
pathways have been demonstrated to function in the pathogenesis process.
Transcriptional
response profiles generated by overexpressing C. albicans GRACE strains
provide
information concerning the set of genes regulated by such pathways; any of
which may .
potentially serve an essential role in pathogenesis and therefore representing
promising drug
targets. Furthermore, analysis of the expression profile may reveal one or
more genes
whose expression is critical to the subsequent expression of an entire
regulatory cascade.
Accordingly, these genes are particularly important targets for drug discovery
and mutants
carrying the corresponding modified allelic pair of genes form the basis of a
mechanism-of action based screening assays. Presently such an approach is not
possible.
Current drug discovery practices result in an exceedingly large number of
"candidate"
compounds and little understanding of their mode of action. A transcriptional
response
database comprising both gene shut-off and overexpression profiles generated
using the
GRACE strain collection offers a solution to this drug discovery bottleneck by
1) determining the transcriptional response or profile resulting from an
antifungal's
inhibition of a wild type strain, and 2) comparing this response to the
transcriptional profiles
resulting from inactivation or overexpression of drug targets comprising the
GRACE strain
collection.
Matching or significantly correlating transcriptional profiles resulting from
both genetic alteration of a drug target and chemical/compound inhibition of
wild type cells
provides evidence linking the compound to its cellular drug target and
suggests its
mechanism of action.
Accordingly, the invention provides a method for evaluating a compound
ag~nst a target gene product encoded by a nucleotide sequence comprising one
of SEQ ID
NO: 1 to 61, said method comprising the steps of (a) contacting wild type
diploid fungal
cells or control cells with the compound and generating a first transcription
profile; (b)
determining the transcription profile of mutant diploid fungal cells, such as
a GRACE
strain, which have been cultured under conditions wherein the second allele of
the target
gene is substantially underexpressed, not expressed or overexpressed and
generating a
second transcription profile for the cultured cells; and comparing the first
transcription
100
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
profile with the second transcription profile to identify similarities in the
profiles. For
comparisons, similarities of profiles can be expressed as an indicator value;
and the higher
the indicator value, the more desirable is the compound.
5.6.2 Identification of Secondary Targets
Methods are described herein for the identification of secondary targets.
"Secondary target," as used herein, refers to a gene whose gene product
exhibits the ability
to interact with target gene products involved in the growth and/or survival
of an organism
(i.e., target essential gene ,products), under a set of defined conditions, or
in the pathogenic
mechanism of the organism, (i.e., target virulence gene products) during
infection of a host.
Any method suitable for detecting protein-protein interactions can be
employed for identifying secondary target gene products by identifying
interactions between
gene products and target gene products. Such known gene products can be
cellular or
extracellular proteins. Those gene products which interact with such known
gene products
represent secondary target gene products and the genes which encode them
represent
secondary targets.
Among the traditional methods employed are co-immunoprecipitation,
crosslinking and co-purification through gradients or chromatographic columns:
Utilizing
procedures.such as these allows for the identification of secondary target
gene products.
Once identified, a secondary .target gene product is used, in conjunction with
standard
techniques, to identify its corresponding secondary target. For example, at
least a portion of
the amino acid sequence of the secondary target gene product is ascertained
using
techniques well known to those of skill in the art, such as via the Edman
degradation
technique (see, e.g., Creighton, 1983, "Proteins: Structures and Molecular
Principles,"
W,H. Freeman & Co., N.Y., pp.34-49). The amino acid sequence obtained can be
used as a
guide for the generation of oligonucleotide mixtures that can be used to
screen for secondary
target gene sequences. Screening can be accomplished, for example, by standard
hybridization or PCR techniques. Techniques for the generation of
oligonucleotide
mixtures and for screening are well-known. (See, e.g., Ausubel, supra., and
PCR Protocols:
A Guide to Methods and Applications, 1.990, Innis, M. et al., eds. Academic
Press, Inc.,
New York).
Additionally, methods are employed which result in the simultaneous
identification of secondary targets which encode proteins interacting with a
protein involved
in the growth and/or survival of an organism under a set of defined
conditions, or in the
pa~ogenic mechanism of the organism during infection of a host. These methods
include,
101
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
for example, probing expression libraries with labeled primary target gene
protein known or
suggested to be involved in or critical to these mechanisms, using this
protein in a manner
similar to the well known technique of antibody probing of ~.gtl 1 phage
libraries.
One method which detects protein interactions in vivo, the two-hybrid
system, is described in detail for illustration purposes only and not by way
of limitation.
One version of this system has been described (Chien et al., 1991, Proc. Natl.
Acad. Sci.
USA, 88:9578-9582) and is commercially available from Clontech (Palo Alto,
CA).
Briefly, utilizing such a system, plasmids are constructed that encode two
hybrid proteins: one consists of the DNA-binding domain of a transcription
activator protein
fused to a known protein, in this case, a protein known to be involved in
growth of the
organism, or in pathogenicity, and the other consists of the activator
protein's activation
domain fused to an unknown protein that is encoded by a cDNA which has been
recombined into this plasmid as part of a cDNA library. The plasmids are
transformed into
a strain of the yeast S. cerevisiae that contains a reporter gene (e.g., lacZ)
whose regulatory
region contains the transcription activator's binding sites. Either hybrid
protein alone cannot
activate transcription of the reporter gene, the DNA-binding domain hybrid
cannot because
it does not provide activation function, and the activation domain hybrid
cannot because it
cannot localize to the activator's binding sites. Interaction of the two
hybrid proteins
reconstitutes the functional activator protein and results in expression of
the reporter gene,
. which is detected by an assay for the reporter gene product.
The two-hybrid system or related methodology is used to screen activation
domain libraries for proteins that interact with a known "bait" gene product.
By way of
example, and not by way of limitation, target essential gene products and
target virulence
gene products are used as the bait gene products. Total genomic or cDNA
sequences
encoding the target essential gene product, target virulence gene product, or
portions
thereof, are fused to the DNA encoding an activation domain. This library and
a plasmid
encoding a hybrid of the bait gene product fused to the DNA-binding domain are
cotransformed into a yeast reporter strain, and the resulting transformants
are screened for
those that express the reporter gene. For example, and not by way of
limitation, the bait
gene is cloned into a vector such that it is translationally fused to the DNA
encoding the
DNA-binding domain of the GAL4 protein. These colonies are purified and the
library
plasmids responsible for reporter gene expression are isolated. DNA sequencing-
is then
used to identify the pioteins encoded by the library plasmids.
A cDNA library of the cell.line from which proteins that interact with bait
gene product are to be detected is made using methods routinely practiced in
the art.
102
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
According to the particular system described herein, for example, the cDNA
fragments are
inserted into a vector such that they are translationally fused to the
activation domain of
GAL4. This library is co-transformed along with the bait gene-GAL4 fusion
plasmid into a
yeast strain which contains a lacZ gene driven by a promoter which contains
GAL4
activation sequence. A cDNA encoded protein, fused to GAL4 activation domain,
that
interacts with bait gene product reconstitutes an active GAL4 protein and
thereby drive
expression of the lacZ gene. Colonies which express lacZ are detected by their
blue color in
the presence of X-gal. The cDNA can then be purified from these strains, and
used to
produce and isolate the bait gene-interacting protein using techniques
routinely practiced in
I 0 the art.
Once a secondary target has been identified and isolated, it is further
characterized and used in drug discovery by the methods of the invention.
5.6.3 Use of Gene Expression Arrays
To carry out profiling, gene expression arrays and microarrays can be
employed. Gene expression arrays are high density arrays of DNA samples
deposited at
specific locations on a glass surface, silicon, nylon membrane, or the like.
Such arrays are
used by researchers to quantify relative gene expression under different
conditions. An
example of this technology is found in U.S. Patent No. 5807522, which is
hereby
incorporated by reference.
It is possible to' study the expression of substantially all of the genes in
the
genome of a particular microbial organism using a single array. For example,
the arrays
may consist of 12 x 24 cm nylon filters containing PCR products corresponding
to ORFs
from Candida albicans. 10 ngs of each PCR product are spotted every 1.5 mm on
the filter.
Single stranded labeled cDNAs are prepared for hybridization to the array (no
second strand
synthesis or amplification step is done) and placed in contact with the
filter. Thus the
labeled cDNAs are of "antisense" orientation. Quantitative analysis is done
using a
phosphorimager.
Hybridization of cDNA made from a sample of total cell mRNA to such an
~.ay followed by detection of binding by one or more of various techniques
known to those
in the art provides a signal at each location on the array to which cDNA
hybridized. The
intensity of the hybridization signal obtained at each location in the array
thus reflects the
amount of mRNA for that specific gene that was present in the sample.
Comparing the
results obtained for mRNA isolated from cells grown under different conditions
thus allows
for a comparison of the relative amount of expression of each individual gene
during growth
103
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
under the different conditions.
Gene expression arrays are used to analyze the total mRNA expression
pattern at various time points after reduction in the level or activity of a
gene product
required for fungal proliferation, virulence or pathogenicity. Reduction of
the level or
activity of the gene product is accomplished by growing a GRACE strain under
conditions
in which the product of the nucleic acid linked to the regulatable promoter is
rate limiting
for fungal growth, survival, proliferation, virulence or pathogenicity or by
contacting the
cells with an agent which reduces the level or activity of the target gene
product. Analysis
of the expression pattern indicated by hybridization to the array provides
information on
other genes whose expression is influenced by reduction in the level or
activity of the gene
product. For example, levels of other mRNAs may be observed to increase,
decrease or stay
the same following reduction in the level or activity of the gene product
required for growth,
survival, proliferation, virulence or pathogenicity. Thus, the mRNA expression
pattern
observed following reduction in the level or activity of a gene product
required for growth,
1 S survival, proliferation, virulence or pathogenicity identifies other
nucleic acids required for
growth, survival, proliferation, virulence or pathogenicity. In addition, the
mRNA
expression patterns observed when the fungi are exposed to candidate drug
compounds or
known antibiotics are compared to those observed when the level or activity of
a gene
product required for fungal growth; survival, proliferation, virulence or
pathogenicity is
reduced. If the mRIVA expression pattern observed with the candidate drug
compound is
sirriilar to that observed when the level of the gene product is reduced, the
drug compound is
a promising therapeutic candidate. Thus, the assay is useful in assisting in
the selection of
promising candidate drug compounds for use in drug development.
In cases where the source of nucleic acid deposited on the array and the
source of the nucleic acid being hybridized to the array are from two
different
microorganisms, gene expression identify homologous genes in the two
microorganisms.
5.7 Proteomics Assays
In another embodiment of the present invention, and in much the same way
that the GRACE strain collection enables transcriptional profiling within a
pathogen, a
GRACE strain collection provides an invaluable resource for the analysis of
the expressed
protein complement of a genome. By evaluating the overall protein expression
by members
of a GRACE strain collection under repressing and non-repressing growth
conditions,. a
correlation between the pattern of protein expression of a cell can be made
with the non-
expression or the level of expression of an essential gene. Accordingly, the
invention
104
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
provides a pattern of expression of a set of proteins in a GRACE strain as
determined by
methods well known in the art for establishing a protein expression pattern,
such as two-
dimensional gel electrophoresis. A pluralities of protein expression patterns
will be
generated for a GRACE strain when the strain is cultured under different
conditions and
different levels of expression of one of the modified allele.
In yet another embodiment, defined genetic mutations can be constructed to
create strains exhibiting protein expression profiles comparable to those
observed upon
treatment of the strain with a previously uncharacterized compound. In this
way, it is
possible to distinguish between antimycotic compounds that act on multiple
targets in a
complicated manner from other potential lead compounds that act on unique
fungal-specific
targets and whose mode of action can be determined.
Evaluation of the full complement of proteins expressed within a cell
depends upon definitive identification of all protein species detectable on
two-dimensional
polyacrylamide gels or by other separation techniques. However, a significant
fraction of
these proteins are of lower abundance and fall below the threshold level
required for
positive identification by peptide sequencing or mass spectrometry.
Nevertheless, these
"orphan" proteins are detectable using an analysis of protein expression by
individual
GRACE strains. Conditional expression of low abundance gene products
facilitates their
positive identification by comparing protein profiles of GRACE strains under
repressing
versus nonrepressing or overexpression conditions. In some cases, a more
complex protein
profile results because of changes of steady state levels for multiple
proteins, which is
caused indirectly by manipulating the low abundance gene in question.
Overexpression of
individual targets within the GRACE strain collection can also directly aid
orphan protein
identification by providing sufficient material for peptide sequencing or mass
spectrometry.
In various embodiments, the present invention provides a method of
quantitative analysis of the expressed protein complement of a diploid
pathogenic fungal
cell: a first protein expression profile is developed for a control diploid
pathogenic fungus,
which has two, unmodified alleles for the target gene. Mutants of the control
strain, in
which one allele of the target gene is inactivated, for example, in a GRACE
strain, by
insertion by or replacement with a disruption cassette, is generated. The
other allele is
modified such that expression of that second allele is under the control of a
heterologous
regulated promoter. A second protein expression profile is developed for this
mutant
fungus, under conditions where the second allele is substantially
overexpressed as compared
to the expression of the two alleles of the gene in the control strain.
Similarly, if desired, a
third protein expression profile is developed, under conditions where the
second allele is
105
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
substantially underexpressed as compared to the expression of the two alleles
of the gene in
the control strain. The first protein expression profile is then compared with
the second
expression profile, and if applicable, a third protein expression profile to
identify an
expressed protein detected at a higher level in the second profile, and if
applicable, at a
lower level in the third profile, as compared to the level in first profile.
Accordingly, the invention provides a method for evaluating a compound
against a target gene product encoded by a nucleotide sequence comprising one
of SEQ ID
NO: 1 to 61, said method comprising the steps of (a) contacting wild type
diploid fungal
cells or control cells with the compound and generating a first protein
expression profile; (b)
determining the protein expression profile of mutant diploid fungal cells,
such as a GRACE
strain, which have been cultured under conditions wherein the second allele of
the target
gene is substantially underexpressed, not expressed or overexpressed and
generating a
second protein expression profile for the cultured cells; and comparing the
first protein
expression profile with the second protein expression profile to identify
similarities in the
profiles. For comparisons, similarities of profiles can be expressed as an
indicator value;
and the higher the indicator value, the more desirable is the compound.
5.8 Pharmaceutical Compositions
And Uses Thereof
Compounds including nucleic acid molecules that are identified by the
methods of the invention as described herein can be administered to a subject
at
therapeutically effective doses to treat or prevent infections by a pathogenic
organism, such
as Candida albicans. Depending on the target, the compounds may also be useful
for
treatment of a non-infectious disease in a subject, such as but not limited
to, cancer. A
therapeutically effective dose refers to that amount of a compound (including
nucleic acid
molecules) sufficient to result in a healthful benefit in the treated subject.
Typically, but not
so limited, the compounds act by reducing the activity or level of a gene
product encoded by
a nucleic acid comprising a sequence selected from the group consisting of SEQ
ID NO: 1
to 62. The subject to be treated can be a plant, a vertebrate, a mammal, an
avian, or a
h~~. ~ese compounds can also be used for preventing or containing
contamination of
an object by Candida albicans, or used for preventing or inhibiting formation
on a surface
of a biofilm comprising Candida albicans. Biofilm comprising C. albicans are
found on
surfaces of medical devices, such as but not limited to surgical tools,
implanted devices,
catheters and stems.
106
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
5.8.1 Effective Dose
Toxicity and therapeutic efficacy of compounds can be determined by
standard pharmaceutical procedures in cell cultures or experimental animals,
e.g., for
determining the LDso (the dose lethal to 50% of the population) and the EDSO
(the dose
therapeutically effective in 50% of the population). The dose ratio between
toxic and
therapeutic effects is the therapeutic index and it can be expressed as the
ratio LDSO/EDSO.
Compounds which exhibit large therapeutic indices are preferred. While
compounds that
exhibit toxic side effects can be used, care should be taken to design a
delivery system that
targets such compounds to the site of affected tissue in order to minimize
potential damage
to uninfected cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used
in formulating a range of dosage for use in humans. The dosage ~of such
compounds lies
preferably within a range of circulating concentrations that include the EDSO
with little or no
toxicity. The dosage can vary within this range depending upon the dosage form
employed
and the route of administration utilized. For any compound used in the method
of the
invention, the therapeutically effective dose can be estimated initially from
cell culture
assays. A dose can be formulated in animal models to achieve a circulating
plasma
concentration range that includes the ICso (i.e., the concentration of the
test compound
which achieves a half maximal inhibition of symptoms) as determined in cell
culture. Such
information can be used to more accurately determine useful doses in humans.
Levels in
plasma can be measured, for example, by high performance liquid
chromatography. A
useful dosage can range from 0.001 mg/kg body weight to 10 mg/kg body weight.
5.8.2 Formulations and Use
Pharmaceutical compositions for use in accordance with the present
invention can be formulated in conventional manner using one or more
physiologically
acceptable carriers or excipients.
Thus, the compounds and their physiologically acceptable salts and solvents
can be formulated for administration by inhalation or insufflation (either
through the mouth
or the nose) or oral, buccal, parenteral or rectal administration.
For oral administration, the pharmaceutical compositions can take the form
of, for example, tablets or capsules prepared by conventional means with
pharmaceutically
acceptable excipients such as binding agents (e.g., pregelatinised maize
starch,
polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g.,
lactose,
microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g.,
magnesium
107
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch
glycolate); or
wetting agents (e.g., sodium lauryl sulphate). The tablets can be coated by
methods well
known in the art. Liquid preparations for oral administration can take the
form of, for
example, solutions, syrups or suspensions, or they can be presented as a dry
product for
constitution with water or other suitable vehicle before use. Such liquid
preparations can be
prepared by conventional means with pharmaceutically acceptable additives such
as
suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated
edible fats);
emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g.,
almond oil, oily
esters, ethyl alcohol or fractionated vegetable oils); and preservatives
(e.g., methyl or
propyl-p-hydroxybenzoates or sorbic acid). The preparations can also contain
buffer salts,
flavoring, coloring and sweetening agents as appropriate.
Preparations for oral administration can be suitably formulated to give
controlled release of the active compound.
For buccal administration the compositions can take the form of tablets or
lozenges formulated in conventional manner.
For administration by inhalation, the compounds for use according to the
present invention are conveniently delivered in the form of an aerosol spray
presentation
from pressurized packs or a nebulizer, with the use of a suitable propellant,
e:g.,
dichlorodifluoromethane, trichlorofluorometharie, dichlorotetrafluoroethane,
carbon dioxide
or other suitable gas. In the case of a pressurized aerosol the dosage unit
can be determined
. by providing a valve to deliver a metered amount. Capsules and cartridges of
e.g. gelatin
for use in an inhaler or insufflator can be formulated containing a powder mix
of the
compound and a suitable powder base such as lactose or starch.
The compounds can be formulated for parenteral administration (i.e.,
intravenous or intramuscular) by injection, via, for example, bolus injection
or continuous
infusion. Formulations for injection can be presented in unit dosage form,
e.g., in ampoules
or in multi-dose containers, with an added preservative. The compositions can
take such
forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and
can contain
formulatory agents such as suspending, stabilizing and/or dispersing agents.
Alternatively,
the active ingredient can be in powder form for constitution.with a suitable
vehicle, e.g.,
sterile pyrogen-free water, before use.
The compounds can also be formulated in rectal compositions such as
suppositories or retention enemas, e.g., containing conventional suppository
bases such as
cocoa butter or other glycerides.
~ In addition to the formulations described previously, the compounds can also
108
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
be formulated as a depot preparation. Such long acting formulations can be
administered by
implantation (for example subcutaneously or intramuscularly) or by
intramuscular injection.
Thus, for example, the compounds can be formulated with suitable polymeric or
hydrophobic materials (for example as an emulsion in an acceptable oil) or ion
exchange
resins, or as sparingly soluble derivatives, for example, as a sparingly
soluble salt.
6. EXAMPLES
6.1 Construction of a GRACE strain containing modified alleles of CaKRE9
Oligonucleotide primers for PCR amplification of the SAT selectable marker
used in Step 1 (i. e. gene replacement) contain 25 nucleotides complementary
to the SAT
disruption cassette in pRC 18-ASP, and 65 nucleotides homologous to regions
flanking the
CaKRE9 open reading frame. Figure 2 illustrates the 2.2 kb cakre9d: : SAT
disruption
fragment produced after PCR amplification and resulting gene replacement of
the first wild
type CaKRE9 allele via homologous recombination following transformation. PCR
conditions were as follows: 5-50 rig pRC 18-ASP, 100 pmol of each primer, 200
p,M dNTPs,
10 mM Tris- pH 8.3, 1.5 mM MgCl2, 50 mM KCI, 1 unit Taq DNA polymerase
(Gibco).
PCR amplification times were: 5 min 94°C, 1 min 54°C, 2 min
72°C, for 1 cycle; 45 sec
94°C, 45 sec 54°C, 2 min 72°C, for 30 cycles.
Transformation was performed using the
lithium acetate method adapted for C'. albicans, by Braun and Johnson,-(Braun,
B. R., and
A. D. Johnson (1997), Control of filament formation in Candida albicans by the
transcriptional repressor TUP1, Science 277:105-109), with minor
modifications, including
shorter incubation times at 30 ° C and 42 ° C ( 1 hr and 5 min
respectively) and a greater
amount of material transformed (50 ~g of ethanol-precipitated cakre9d: : SAT
PCR product).
Transformed cells were spread onto YPD plates and incubated overnight at 30
° C, providing
a preincubation period for expression of SAT prior to replica plating onto YPD
medium
containing streptothricin (400p,g/ml). Streptothricin-resistant colonies were
detected after 36
hr and cakre9d: : SATlCaKRE9 heterozygotes identified by PCR analysis using
suitable
Primers which amplify both CaKRE9 and cakre9d: : SAT alleles.
Oligonucleotide primers for PCR amplification of the conditional promoter
used in Step 2 (i.e. promoter replacement) contain 25 nucleotides
complementary to the
CaHIS3-marked tetracycline regulated promoter cassette in pBSK-HT4 and 65
nucleotides
of homologous sequence corresponding to promoter regions -270 to -205,
relative to the
point of transcription initiation, and nucleotides 1-65 of the CaKRE9 open
reading frame.
109
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
The resulting 2.2 kb PCR product was transformed into the cakre9d: ~SATICaKRE9
heterozygous strain produced in step 1, and His+ transformants selected on YNB
agar.
Bonafide CaKRE9 GRACE strains containing both a cakre9d::SAT allele and CaHIS3-
Tet-
CaKRE9 allele were determined by PCR analysis. Typically, 2 independent GRACE
strains
are constructed and evaluated to provide a reliable determination of the
terminal phenotype
of any given drug target. Terminal phenotype is that phenotype caused by the
absence of
the gene product of an essential gene
6.2 Phenotype determination of the CaKRE9 Grace strain
The terminal phenotype of the resulting GRACE strains was evaluated in
three independent methods. In the first, rapid determination of the CaKRE9
GRACE strain
terminal phenotype was achieved by streaking approximately 1.0 X 106 cells
onto both a
YNB plate and YNB plate containing 100pg/ml tetracycline and comparing growth
rate
after 48 hr at room temperature. For essential genes, such as CaKRE9, no
significant growth
is detected in the presence of tetracycline. In the second approach, the
essential nature of a
gene may be determined by streaking C.,aKRE9 GRACE cells onto a casamino acid
plate
containing 625 pg/ml 5-fluroorotic acid (SFOA) and 100 pg/ml uridine to select
for ura
cells which have excised (via recombination between CaLEU2 sequence
duplications
created during targeted integration) the transactivator gene that is normally
required for
expression of the tetracycline promoter-regulated target gene. Again, whereas
nonessential
GRACE strains demonstrate robust growth under such conditions, essential GRACE
strains
fail to grow. Quantitative evaluation of the terminal phenotype associated
with an essential
GRACE strain is performed using 2 x 103 cells/ml of overnight culture
inoculated into 5.0
ml YNB either lacking or supplemented with 100 pg/ml tetracycline and
measuring optical
density (O.D.6~) after 24 and 48 hr incubation at 30°C. Typically, for
essential GRACE
strains, no significant increase in optical density is detected after 48 hrs.
Discrimination
between cell death (cidal) and growth inhibitory (static) terminal phenotypes
for a
demonstrated essential gene is achieved by determining the percentage of
viable cells (as
Judged by the number of colony forming units (CFU) from an equivalent of 2 x
103 washed
cells at T=0) from the above tetracycline-treated cultures after 24 and 48
hours of
incubation. Essential GRACE strains producing a cidal terminal phenotype are
those which
display a reduction in percent viable cells (i.e. < 2 x 103 CFU) following
incubation under
repressing conditions.
110
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
6.3 Target Level Variation in Whole Cell Assays
In order to demonstrate the utility of target level expression in whole cell
assays for drug screening, both a CaHIS3 heterozygote strain and a
tetracycline
promoter-regulated CaHIS3 GRACE strain were compared against a wild type
(diploid)
CaHIS3 strain for sensitivity towards the 3-aminotriazole (3-AT) (Fig.6). 3-AT
is a
competitive inhibitor of the enzyme encoded by CaHIS3, imidazoleglycerol
phosphate
dehydratase, and together serve as a model for a drug and drug target
respectively.
Overexpression, achieved by the constitutive expression level of CaHIS3
maintained by the
tetracycline promoter, confers 3-AT resistance at concentrations sufficient to
completely
inhibit growth of both wild type and CaHIS3 heterozygote strains (Fig 6A). The
phenotype
observed is consistent with that expected in light of the predicted 7.5 fold
overexpression of
CaHIS3 determined by Northern bolt analysis (see Fig 5). A heterozygous CaHIS3
strain
demonstrates enhanced sensitivity (i.e. haploinsufficient phenotype) to an
intermediate
3-AT concentration unable to effect either wild type or tetracycline promoter-
based
overproducing CaHIS3 strains noticeably (Fig 6B). A third CaHIS3 expression
level
evaluated for differential sensitivity to 3-AT was produced by partial
repression of the
GRACE CaHIS3 strain using a threshold concentration of tetracycline 0.1 % that
normally is
used to achieve complete shut-off.
This level of CaHIS3 expression represents the minimum expression level
required for viability and as predicted, demonstrates an enhanced drug
sensitivity relative
the heterozygous CaHIS3 strain at an intermediate 3-AT concentration (Fig 6C).
Similarly,
GRACE strain-specific drug resistance and sensitivity phenotypes to
fluconazole and
tunicamycin have been demonstrated by increasing and decreasing the level of
expression of
their respective known drug targets, CaERGIl and CaAlG7. Together these
results
demonstrate that three different levels of expression are achieved using the
C. albicans
GRACE strain collection, and that they exhibit the predicted drug sensitivity
phenotypes
between known drugs and their known drug target. Moreover, these experiments
clearly
indicate how distinct levels of target gene products synthesized within the
pathogen could
be directly applied in whole cell assay based drug screens to identify novel
antifungal
compounds against those novel drug targets validated using the GRACE method.
6.4 Identification of a Target Pathway
A target pathway is a genetic or biochemical pathway wherein one or more
of the components of the pathway (e.g., enzymes, signaling molecules, etc) is
a drug target
as determined by the methods of the invention.
111
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
6.4.1. Preparation of Stocks of GRACE Strains for Assay
To provide a consistent source of cells to screen, frozen stocks of host
GRACE strains are prepared using standard microbiological techniques. For
example, a
single clone of the microorganism can be isolated by streaking out a sample of
the original
stock onto an agar plate containing nutrients for cell growth and an
antibiotic for which the
GRACE strain contains a gene which confers resistance. After overnight growth
an isolated
colony is picked from the plate with a sterile needle and transferred to an
appropriate liquid
growth medium containing the antibiotic to which the GRACE strain is
resistant. The cells
~.e incubated under appropriate growth conditions to yield a culture in
exponential growth.
Cells are frozen using standard techniques.
6.4.2. Growth of GRACE Strains for Use in the Assay
Prior to performing an assay, a stock vial is removed from the freezer,
rapidly thawed and a loop of culture is streaked out on an agar plate
containing nutrients for
cell growth and an antibiotic for which the GRACE strain contains a gene which
confers
resistance. After overnight growth, randomly chosen, isolated colonies are
transferred from
the plate (sterile inoculum loop) to a sterile tube containing medium
containing the
antibiotic to which the GRACE strain contains a gene which confers resistance.
After
vigorous mixing fo form a homogeneous cell suspension. the optical density. of
the
suspension is measured and if necessary an aliquot of the suspension is
diluted into a second
tube of medium plus antibiotic. The culture is then incubated until the cells
reach an
optical density suitable for use in the assay.
6.4.3. Selection of Medium to be Used in Assay
Two-fold dilution series of the inducer or repressor for the regulatable
promoter which is linked to the gene required for the fungal proliferation,
virulence or
pathogenicity of the GRACE strain are generated in culture medium containing
the
appropriate antibiotic for which the GRACE strain contains a gene which
confers resistance.
Several medium are tested side by side and three to four wells are used to
evaluate the
effects of the inducer or repressor at each concentration in each media. Equal
volumes of
test media-inducer or repressor and GRACE cells are added to the wells of a
384 well
microtiter plate and mixed. The cells are prepared as described above and
diluted in the
appropriate medium containing the test antibiotic immediately prior to
addition to the
microtiter plate wells. For a control, cells are also added to several wells
of each medium
112
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
that do not contain inducer or repressor. Cell growth is monitored
continuously by
incubation by monitoring the optical density of the wells. The percent
inhibition of growth
produced by each concentration of inducer or repressor is calculated by
comparing the rates
of logarithmic growth against that exhibited by cells growing in medium
without inducer or
repressor. The medium yielding greatest sensitivity to inducer or repressor is
selected for
use in the assays described below.
6.4.4. Measurement of Test Antibiotic Sensitivity in GRACE Strains in
which the Level of the Target Gene Product is not Rate Limiting
Two-fold dilution series of antibiotics of known mechanism of action are
generated in the culture medium selected for further assay development that
has been
supplemented with the antibiotic used to maintain the GRACE strain. A panel of
test
antibiotics known to act on different pathways is tested side by side with
three to four wells
being used to evaluate the effect of a test antibiotic on cell growth at each
concentration.
Equal volumes of test antibiotic and cells are added to the wells of a 384
well microtiter
plate and mixed. Cells are prepared as described above using the medium
selected for assay
development supplemented with the antibiotic required to maintain the GRACE
strain and
are diluted in identical medium immediately prior to addition to the
microtiter plate wells. .
For a control, cells are also added to several wells that lack antibiotic, but
contain the
solvent used to dissolve the antibiotics. Cell growth is monitored
continuously by
w incubation in a microtiter plate reader monitoring the optical density of
the wells. The
percent inhibition of growth produced by each concentration of antibiotic is
calculated by
comparing the.rates of logarithmic growth against that exhibited by cells
growing in
medium without antibiotic. A plot of percent inhibition against log
[antibiotic
concentration] allows extrapolation of an ICSO value for each antibiotic.
6.4.5. Measurement of Test Antibiotic Sensitivity in the GRACE
Strains in which the Level of the Target Gene Product is Rate
Limiting
The culture medium selected for use in the assay is supplemented with
inducer or repressor at concentrations shown to inhibit cell growth by a
desired amount as
described above, as well as the antibiotic used to maintain the GRACE strain.
Two fold
dilution series of the panel of test antibiotics used above are generated in
each of these
media. Several antibiotics are tested side by side in each medium with three
to four wells
being used to evaluate the effects of an antibiotic on cell growth at each
concentration.
113
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Equal volumes of test antibiotic and cells are added to the wells of a 384
well microtiter
plate and mixed. Cells are prepared as described above using the medium
selected for use
in the assay supplemented with the antibiotic required to maintain the GRACE
strain. The
cells are diluted 1:100 into two aliquots of identical medium containing
concentrations of
inducer that have been shown to inhibit cell growth by the desired amount and
incubated
under appropriate growth conditions. Immediately prior to addition to the
microtiter plate
wells, the cultures are adjusted to an appropriate optical density by dilution
into warm
sterile medium supplemented with identical concentrations of the inducer and
antibiotic
used to maintain the GRACE strain. For a control, cells are also added to
several wells that
contain solvent used to dissolve test antibiotics but which contain no
antibiotic. Cell growth
is monitored continuously by incubation under suitable growth conditions in a
microtiter
plate reader monitoring the optical density of the wells. The percent
inhibition of growth
produced by each concentration of antibiotic is calculated by comparing the
rates of
logarithmic growth against that exhibited by cells growing in medium without
antibiotic. A
plot of percent inhibition against log [antibiotic concentration] allows
extrapolation of an
ICso value for each antibiotic:
6.4.6. Determining the Specificity of the Test Antibiotics
A comparison of the ICsos generated by antibiotics of known mechanism of
action under conditions in which the level of the gene product required for
fungal
proliferation, virulence or pathogenicity is rate limiting or is not rate
limiting allows the
pathway in which a gene product required for fungal proliferation, virulence
or
pathogenicity lies to be identified. If cells expressing a rate limiting level
of a gene product
required for fungal proliferation, virulence or pathogenicity are selectively
sensitive to an
antibiotic acting via a particular pathway, then the gene product encoded by
the gene linked
to the regulatable promoter in the GRACE strain is involved in the pathway on
which the
antibiotic acts.
6.4.7. Identification of Pathway in which a Test Antibiotic Acts
As discussed above, the cell-based assay may also be used to determine the
pathway against which a test antibiotic acts. In such an analysis, the
pathways against in
which the gene under the control of the regulatable promoter in each member of
a panel of
GRACE strains lies is identified as described above. A panel of cells, each
containing a
regulatable promoter which directs transcription of a proliferation, virulence
or
pathogenicity-required nucleic acid which lies in a known biological pathway
required for
114
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
fungal proliferation, virulence or pathogenicity, is contacted with a test
antibiotic for which
it is desired to determine the pathway on which it acts under conditions in
which the gene
product of the nucleic acid is rate limiting or is not rate limiting. If
heightened sensitivity is
observed in cells in which the gene product is rate limiting for a gene
product which lies in
a particular pathway but not in cells expressing rate limiting levels of gene
products which
lie in other pathways, then the test antibiotic acts against the pathway for
which heightened
sensitivity was observed.
The present invention is not to be limited in scope by the specific
embodiments described herein. Indeed, various modifications of the invention
in addition
to those described herein will become apparent to those skilled in the art
from the foregoing
description and accompanying figures. Such modifications are intended to fall
within the
scope of the appended claims.
Various references are cited herein, the disclosures of which are incorporated
by reference in their entireties.
25
35
115
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
SEQUENCE LISTING
<110> Roemer, Terry
Jiang, Bo
Boone, Charles
Bussey, Howard
<120> Gene Disruption Methodologies for Drug
Targets Discovery
<130> 10182-004-999
<160> 490
<170> FastSEQ for Windows Version 4.0
<210> 1
<211> 660
<212> DNA
<213> Candida albicans
<400>
1
atggatatcgaaactgccgcttgcttttcaatagcatttatagccacaccgatcctcata 60
gtattggtaagattgctattcattcttccatcattaagacttccaacctccgtaaagaaa 120
aagaaaaagctcattcaggaatgccaactttcaatcttgcttggttcaggtggccatact 180
ggggagatgatgagaattatatctaaacttgacatgggaaaagtttctcgtacatggata 240
tacacttcgggcgacaatgcgtccttagcaaaggcacaggattatgaaaggaaatcgggt 300
acatccctgcagtacataccaatcccaagagcacggacagtgggccaatcatatatactg 360
agcattccaaccaccatatactcattcttgttttctgcaattgcgatgctcaaacacaga 420
ccagcagtgatacttttgaacggcccaggtacttgtgttcccgtggcatacattttgttt 480
ctctataaactccttggattatgcaatacaaagataatttatattgaaagtttagctaga 540
gtgaacaagttgagtctcagtggattactattattaccgatcagcgatcgatttattgtc 600
cagtgggaaagtttatatcaacagtatagccgtgtcgagtattatggtatattgatatag 660
<210> 2
<211> 504
<212> DNA
<213> Candida albicans
<400> _
2
atgggaaccaacaacaaaactgtcactaataagtcaaacaagagaatccaagggaaacga 60
catatcaaacatagtcccaacttgactccctttaatgaaacacaaaatgcttcgaatttt 120
ttaatcaaatcatcaactccttatatatcagctatcaaacaaattaccaagaaattgaat 180
aaattctccaaatcaaagaatagtcacacgataaataaatttcaaaatgaacaatacaag 240
acgatcaaatatatagccgtcaaaggtatgggtaaaacaattgaaaaagtggcgagtatt 300
ggtactcatttccaaaaggattataaagttgatgtgttgacagggtctactacagtgtta 360
gatgagtttgcaccaattgaatcaaaccaagagcctgataatgagaacaagagtgatgat 420
gatgacgacgacgacgacgaaactatatataagaaacgtactgtgagttctatagagatt 480
agaatatggataaaacgagattaa 504
<210> 3
<211> 1485
<212> DNA
<213> Candida albicans
<400> 3
atgctagcaa ggcttttgaa acttgcaata gtagttgcag caatagcggc aatcacaccc 60
1
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
aataacccaatacgtacactgatttcatttgggtgtataggttacgtggcaaccttactg120
gtaataccgaaagttagcccaagttttgtcaagatcgggctcaaagggaaagatttatct180
aaaccaccaccggtgtcagaaatacccgaaacaatggggctagtggcgtcaactacatat240
atgtttcttatgtttggtcttatcccatttatttttttcaaataccttgtttcttttgga300
tcaatgtctaacgacgaggtgataactaaaaattacttgtctcaatatcaatcgcttgcc360
gacaacaggttattcccccacaataagttggcagaatacttgagtgccttgttgtgttta420
cagagtaccacattgttgggattactagacgacttgtttgatatcaggtggcgtcacaag480
tttttcttacctgcagttgcatcattgcccttattgattgtatactacgtcgactttagt540
gtaacttcagtcgtgatccccaagtttgtcactgaattccctggaggctacgttctaatt600
aatactataaatttttttataaagtatagtaaccatttggtcacaagtatcactgggctt660
tcatttagaactttacaaacagactatgttgttcctgacagttcaccaaagttgattgat720
ttgggaattttctactacgtatacatgtcggctatttcaattttctcaccgaattcaatc780
aatattcttgcaggcgttaacggtttggaggttggacaatcattagttttagcagccata840
tttttaattaatgatttctgctatcttttttcaccgggaatatcacaagcagctcatgat900
tcacacatgttttctgttgtatttataattccttttgtcggagtgtcattggctttattg960
caatacaactggttccctgcaagagtatttgttggtgatacgtattgttatttcagtggc1020
atggtatttgctattgttggtattataggtcatttttccaaaactcttttgatatttttg1080
ttacctcaaataatcaattttgtgtattcagttcctcagttgtttcacatcttgccctgt1140
ccaagacacagattacccagatttagtattgaggatggtttgatgcatcccagttttgca1200
gaattaaagaaagcaagccgtctaaacttggcgattttagaaactctcagttttttcaag1260
ctcataaaagtggaaaggggttccaaactgaatcagattgttagattttccaatatgacc'
1320
ataatcaatcttacgttggtgtgggtaggacctttacgagaagaccaattatgtatatct1380
attttggtcgttcaatttgttattggcgtgacaatgatagttgttagacataccattgga1440
ccatggttatttggatacgataatttatcatggggtgtaaaataa 1485
<210> 4
<211> 843
<212> DNA
<213> Candida albicans
<400>
4
atggcacctacagaaataaaagggttttatgtgttgcctctcaagttaacaggtaccaaa 60
tcaatacattacatatactttaagaaacatgaactgaaaggcactgccaatgataacaga 120
tcattatttatttgcaacttgccaatatccacagacttgtctactatcaaaaaatttttt 180
cagaaagtagccataggatctacaatagaactgtttataaactcacttttgactgattat 240
cctgaagacatatggattaatttaaccaaactaacatcggacttggatttggtcgacgct 300
gttgatgaacaagcaagcaagttacctaaaaactgtggtattgtggcatttatagataag 360
gcctctttcacactagcctttaactcattgaaaaagttatcatctagccttactgagtgt 420
gaatggccaatacaacagttcacatcaaattattatttgaaacaatatcagaagcagata 480
ctagacccaaatagcttaacagaagaagtctcccaagcgttaatagattttgacaaagca 540
gaacaacagtcaattgaagaattacaactgcaaagaaatttggttgatgaagatgggttc 600
actttggtggtcggtagtcacagaaaaaccaaagcgggtattttgggcaaacagaaatta 660
gcatcaaccgttggagttgtgaaagctcaatccaagatgaagagtaaggaaaaacaagac 720
ttttatagatttcaattgaggcaacgaaagaaggaagaaatgaatgagttgttgaataag 780
ttcaaattggatcaagaaaaggtcagaatgatgaaggaaaagaaaagatttagaccttat 840
tag 843
<210> 5
<211> 1116
<212> DNA
<213> Candida albicans
<400>
atgacggatacacaaccaaggaaaatacgtaaagtgtctactcaagagcaaattgaagat60
tatgaaaaacttcgtcaaagaatcaaaaatcatttcaaagatgcccttaaaggtaaagga120
tcatctatgctgttgcattatattgatgaaataaccgaattatataaaagagttcaatca180
caaaaagttaaagatacaagagttcatttagaagattctgaagttttcaaagaagcatcg240
gattttgctgccttgaatgcacgtaatatagttttcgatgattcgggaattgctcttgat300
2
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gataaagaatttttcaaatgtttaagaagatttgctgttactgatcctagtcttttaagt360
cgtaatgatataggagataatgatggcaataatagtaacgatgaggatgacgtagatgat420
gatgatctggatgaagaagaagaagctattactgatgaatacacattcaataaaacaaat480
tggttaaaacttgggattctttatcatcaagttagtaaaaaatccatactggtagatttt540
ttaaatggacccttaaaagcagaaaagaggaaaatagttcgagcaagaaatgttgatgat600
actaaaggtagcgggatggcgaaaactgctcgacaagttcaagctagtgatatttctggt660
aatcaagaacaaaatactgccaacatggttaaatcagtttatcaaacatatattgaaaaa720
tatgatggtaatggtgttaatttatttaaattttttataaaccctagatcatttggtcaa780
agtgtggagaatttattttacaccagtttcctcgttaaagatggtcgattgaaattatat840
gtgaataatgacgggatgccttgtattcaaagagtgagtagtgatgaaatcagagaggct900
caattggaaagcaataaaatttttgctagtcatcatattgctagttttaattacaaagca960
tggaagaaatatactcaattatataacataagagaagcatttttgggacatcgtgatgaa1020
cctgaagaccaaatgccacctgaagatataattgattataatgacgaggaacctataccg1080
tcatctcaaagaagggatctgaattcatcggattaa 1116
<210> 6
<211> 1695
<212> DNA
<213> Candida albicans
<400>
6
atggctagaagaaatagaaataaaactgtgaatgaagaagagattgaacttgatgaagtt60
gactcatttaatgccaatagagaaaagatattattagatgaagctggagaatatggacgt120
gatgatcaatcggaggaagatgattctgaagaggaagtcatgcaggtagaagaagatagt180
gaggatgacgaagaagatcaagaagacgaagaagaggaggaggaggaggaagaaggggaa240
gaagaagaagaagaggaggaaaaaggatggggaggaagacagaattattatggaggagat300
gatctaagtgatgatgaagatgctaaacaaatgacagaagaagcattgagacaacagaag360
aaacatttacaagaattagcaatggatgattatttggatgatgagatgatggaagattgg420
cagaaaaaggctgattcatatgacaataaagacacactgtcatcaacccagcagcagcaa480
caacaacaacttatcattgaaagcaatagttctattgcgaatttggaagatagtgataaa540
ttgaaattacttcaacaatcattccctgaatttattccattattaaaagaattgaacagt600
ttgaaagttaaattagaagatttacaaaaattagaggataaaaacaaatgcatagagaca660
aagattgtagcattatcagcatatttgggagctatatcgtcatattttgccatatttgtt720
gataatttgaacaatgaagaatcgtttgtatcgatgaaagataatccaatcatggaaact780
atattgagttctagagagatttggagacaagcaaatgaattacctgatgatattaaattg840
gatgatgttaaagtacatgtttccgatgttgtttcttctagtgatattgatgacgaagac900
aattttgttgacgccaaagaagaacaatctgaagatgaagagatatcagaagaagaagtt960
tctcaagacgaagacgaagatcaatcagatgatcttgacattgatgctaattcagaaaga1020
attatcaagcatgtttccaaaaaacacggtgatgatttcacagaagctgatatcgaagat1080
attgatatggaggataaacaacgtcgtaaaaagacattaagattctacacttccaaaatt1140
gataaagctgcagctaaaaaagaccaatcatattctggtgatatagatgttccatataaa1200
gaaagattgtttgaaagacaacagcgtctacttgaagaagcaagaaaacgaggattacaa1260
aaacaagatgatgaaaatatatcggataatgacaatgacaatgacggtgtcaatgatgat1320
gaaggatttgaacaaggtgatgattattacgaatcaataaaacaacataaattaaataag1380
aaacaatccagaaaatcagctcatgaagctgcggttaaagctgctaaggaaggtaaattg1440
gcagaattacaagaagctgttggtcaagatggtaaaagagcaattaattatcaaattctt1500
aagaacaaaggtcttacgcctcacagaaagaaggaatatagaaactccagagtcaaaaag1560
agaaaacaatacgaaaaggcacaaaagaaacttaaatctgttagacaagtctatgatgct1620
aataatagaggtccatatgaaggtgaaaagacaggtatcaagaaagggttatcaaaatca1680
gttaaattggtgtaa
1695
<210> 7
<211> 1521
<212> DNA
<213> Candida albicans
<400> 7
3
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
atgtcgaaagtggaagagcatgagagtgtgaataacctaaagaggaaattcccctcgttg60
gcaaaacccagacagccgttgaaagagacgaattctaacatcccatcaccacataagcgt120
gctaaaatagaatccccaagtaaacaacaatcaacgcaacaacctcaacagcaaccacaa180
ccacaaccacaaccacaaccacaacaagaaaaggctactcacaagccaaagaaatcatca240
catcagctgaaaaataatgacaagcttgctggggatgaaatgcacgaatggcaacagtct300
tggagaagaattatgaagagttcaattgtttactttgaaggagaccagcaactgctagaa360
tatagaaaagcacataaactattgagactagttgggtgcaaagtgactcctttttatgac420
aacaatgtaactataattatttctaaacgtccgtacgacagtaagacagaatattctccg480
catgacattttcagcaacgtaagcaaagcgagtatcaaggtttggaactatgataaagtg540
tttcgttttttaaaacatcttggtattaatatccagaccggggtagacgagcttgcggtt600
aacacacatacaattcttcctccatcgttgaccaataacaatgagaaacccgatttatac660
aatttgttgaaagaagaaaaaatatatggctcaaccgatagagatcctaatgcaaagcgt720
gatgatttgcattatttgggcaagaactatttatatgtttatgacttgacccagacagta780
cggcccattgccattcgtgaatggagtgaccattatccggttatgcagttatcattggac840
ggcaagtgtccatttatagaagatcccacagaccagaacctggagagaaaacggcttaaa900
cgattaagaaagttcgaagctaatcaagcgcatcgtgaggctttgagattggccacatat960
aagatgatcaatggcatttcaatgagtgtgcatggtttcactgccacgagcaccagcaca1020
gacaaggttgatgaagaggaggattccactgtcaaggaacctagtgaagatccaagattc1080
cgtcaaccacttaacagaaactcttcttgcatgcagtcaaaggcatttgaggcaatggct1140
tctggatataatggggcatctaatgcggttcagccctcaatggattctaacttgaatagt1200
gctgctgcaatggctggcgggaacggtttaggtccagcattatcacaggttccttccaaa1260
cagttaaataacttgaagagaaggattttgatgaagaagaaaacgacaaacacaactgaa1320
aagaaagataaggaacatgcctcgggttattgtgagaactgtcgtgttaagtatactaat1380
tttgatgaacatattatgaccaataggcatcgcaattttgcttgtgatgatagaaatttt1440
caagatatagatgagttaattgctagtttgagggaaagaaaaagtttgggaaatgtcatc1500
tcaaacggcgattatgtatag 1521
<210> 8
<211> 1599
<212> DNA
<213> Candida albicans
<400> 8
atgaaaccaatggtgaccacactttataatggcaagctcccgttggcgttggctgaccct60
aatgggatattcacatggtgtccgcatttgaatttgatatttatagccatgaacaagatg120
tcgatctggtgttatcgaatgaatggcgagcgaatatattccatcaacaacaaatcgatt180
gtcaaacatatagcgttttaccgcgagtacttttgtttgtcggggacagacaacttgatc240
aagatatatgattctaataatgggcagttggtgaaggtgttgccgcaggagtttgatggt300
gttgagtttgttgggtggaatgggactgagtatagagtgctggtgtcgatgccgatggtt360
tatgacttggttagtgagttggattatttggtggtgagcgacggcaagaggatggcgatt420
acgtttaaccagttgttgacggtggactgggagtgtgagatgagtgtgcaccagcaacta480
aatagggacttgttcaaccaagtgtatgtcgctggggataagctagttagggtcaggttt540
gttgtcgacaaccagaagttgtatacggagcagattatcaaggtgtgtcagcttatcagt600
ttgctagagtatggggagcagcacatacaaaagattaaggggttggtggtaccgtttttg660
ctggcgatggaccggtatatgtcgaatttggaatctgagtgtggtgatttggcgcagtac720
ttgtctgatcttgttgttagtaatatcattcctgaattttctaaagatttctggctaaac780
cagtatggcgagcgtggacacaagaggatggttaaattggcaggggtgtatgagagttgt840
gtaaaggatacgtaccagcacttggtgagcaccacagagagggtgatttcgattgtgggg900
gagttgattggtgtgtccaaatgggagcaaggattgttggcgacaacggagttggaggcc960
ttgttagaccaggcgaagctgcagctaaagttttattataggtttatttgggatttgcag1020
actgagcggcagcaggtaagtcagtttttggtatggacaaagagtattatcgatatgcta1080
aatgatcaggagtgtgatattgcctattcgactacagatgtgttgtgctttatcaatggg1140
gcacttacgaagagtgtgatgctaaagtattttgatatcaagggggtaccagaaacgcca1200
atgacgaatattagtatggatttgactacaattggtgagtaccaccggtcgagggttgag1260
gtggaggtgttgcagaacatttcattaccgtctgtctatacaaacctaaaactagcccaa1320
tgggaggaggtggtggttacctatcaacaaggtaacgcccttgttattgctaatgtggat1380
ggtgtggtgtcaacggtgcaagatgtgtactcctatcaacacaggcagaccgatttggtg1440
gcgttgacgagcaagtcgttgttgattattgattcgtcgtcgtgtataccgattgcactt1500
4
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
ccggaaacac tgttccaacc gaccaagcta attcttaacc aagagtatgg tgtgttgctc 1560
gactcaacgagacagcactattcaatatttaggatgtag 1599
<210>
9
<211>
966
<212>
DNA
<213>
Candida
albicans
<400>
9
atgggtaaaagaagagtagatgaagaatctgattcagatattgatgttagttcacccgat60
tcagaaactgaattagaaagcacgcaccaccaccaccaccaccaagaaggtgctactaca120
attcaagaaactgttgatgttgattttgatttttttgatttaaatcctcaaattgatttc180
catgctactaagaattttttaagacaattatttggtgatgataatggagaatttaattta240
agtgaaatagccgatttaattttacgagaaaattccgtggggacatcaattaaaactgaa300
ggaatggaaagtgatccatttgcaattttaagtgtaattaatttaactaataatttaaat360
gtggccgtgattaaacaattgattgaatatattttaaataaaaccaaatctaaaactgaa420
ttcaatattattttgaaaaaattgttaaccaatcagaacgatactactagagataggaaa480
tttaaaactggattaataattagtgaaagatttataaatatgccagttgaagtgattcca540
ccaatgtataaaatgcttttacaagaaatggaaaaagctgaagatgctcatgaaaattay600
gaatttgattattttttaattatatcaagagtttatcaattagttgatccagtggaaaga660
gaagatgaagatcacgaaaaagaatccaatcgtaaaaagaagaacaagaataagaagaag720
aaattggctaataatgaaccaaaaccaatagaaatggattatttccatcttgaagatcaa780
attttggaatyaaatactcaatttaaaggaatatttgaatataataatgaaaataaacaa840
gaaacagattcaagaagagtatttactgaatatggtattgatcctaaattaagtttaatc900
ttaattgataaggataatttagctaaatcagtcattgaaatggaacaacaattcccacct960
ccataa 966
<210> 10
<211> 801
<212> DNA
<213> Candida albicans
<400>
atggcaggatttaaaaagaatagagaaattttaactggaggtaagaaatatatccaacaa 60
aaacaaaagaaacatttagttgatgaagttgtatttgataaagaatcccgtcatgaatat 120
ttaactggtttccataaacgtaaattacaacgacagaaaaaagctcaagaatttcataaa 180
gaacaagaacggttagctaaaattgaagaacgtaaacaattaaaacaagaacgtgaacga 240
gatttacaaaatcaattacaacaatttaagaaaactgctcaagaaattgctgccataaat 300
aatgatattggatttgatcaatcagatgacaataatgacaatgataatgaagaatggagt 360
ggattccaagaagatgaagaaggagaaggagaagaagtaactgatgaagatgacgaagat 420
aaggaaaaacctttgaaggggattttacatcatactgaaatatataaacaagatccatca 480
ttatcaaatattactaataatggtgccataatagatgatgaaacaacagtagtggtagaa 540
tcattagataatccaaatgctgttgatactgaagaaaaacttcaacaattggctaaatta 600
aataatgttaatcttgataaatctgatcaaattttagaaaaatctattgaacgagctaaa 660
aattatgctgtgatatgtggagttgctaaacctaatccaatcaaacaaaagaagaagaaa 720
ttcagatatttaacaaaagcagaacgtagagaaaatgttcgtaaagagaaatcaaaatca 780
aaatcaaagggcaagaagtaa 801
<210> 11
<211> 999
<212> DNA
<213> Candida albicans
<400> 11
atgtcaacag tatattataa aaaactagat aaattacaat tccagattta cgacttgttc 60
agctctttgc ttcaattatc cgaagctgaa gatgaatctg tctacaaggc cagctttgat 120
gacaccgtgc aagaaattga tctgttattg attgctttca aagacctcct tagactttta 180
cgacccaaag ataaatccaa caaattcgat acatacgaat tgaaatttca ttctttgaag 240
5
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
cacaaattgcgtgagttgcaagtatttattaatgatcaacaacaagacaagttgcatgaa300
tataggataaagcatttccatctacaagatctgcctgtggataccatcaataacgaattt360
gctcgagaccaattatttgctgatcgttccactaagaagactaagaaagaaatggaagcg420
tctataaatcaacaaattgtcagccaaaataaacaaataacaaaatccttgcaagcatcg480
agacaattgttatcagcaggtatattgcagagtgaattgaacattgacaacattgatcag540
caaaccaaggatttatacaagttaaatgaaggatttatccaattcaacgatttgttaaat600
agatctaagaaaattgtcaagtttattgaaaagcaagataaagctgaccgtcaacgtata660
tatttgagtatggggttcttcatactttgttgttcttgggtggtttatagaagaatttta720
aggcgaccacttaaaatattcttgtggtcctttttcaagatctttaatattttcaactgg780
ttgcttggaggtggtagaagtaaagggttatctgcaagtgatatgatagtttcatctgtg840
attgctgctaccacggaaatcgtcgactatgaggcaacgaaaactttgttggataccttg900
tcgaacgctgtggactctaatacagcgattgatacacttgcaatggtagtggaatctctt960
acgacatcatcaatggaacatattgtagatgaactatag 999
<210> 12
<211> 822
<212> DNA
<213> Candida albicans
<400>
12
atgacagactcatcagctaccgggttctccaagcaccaagaatcagcaattgtatcagat 60
tcagaaggagatgcaattgattccgaattgcacatgagtgccaacccacctttattgaga 120
agatcatcttcattattctccttatcctcgaaagatgacttgccaaaacccgattccaaa 180
gaatatttgaaattcattgacgataatagacatttcagtatgattagaaacttgcacatg 240
gccgactttatcactttattaaatgggtttagtgggttttattctattatttcatgttta 300
agatacactttaactggacaaactcattacgtacaaagagcacattttttcatattgttg 360
gggttatttttcgatttttttgatggtagagttgcaagattaagaaataaatcatcatta 420
atgggacaagagttagattcattagctgatttggtatcatttggggtatctccagcaaca 480
attgcctttgctattggattcagaacaactgttgatgtgttatttttggccttttgggtt 540
ttatgtggattaacaagattggctagatttaatatctccgtcaataacattcctaaagat 600
aaacacggtaaatcacaatattttgagggattgccaattccaacaaatttgttttgggtc 660
ggattcatggctttattggtgtacaaagattggattcatgacaacttaccatttggaata 720
gttttccaagatactctgtttgaattccatttggtcacaataggatttgttttacaaggg 780
tgtgctgaaatctcaaaatctttaaaaattcctaaaccatag 822
<210> 13
<211> 3528
<212> DNA
<213> Candida albicans
<400>
13
atggcaaaacggaagttagaggaaaatgatatttctaccattgaagatgatgaattcaag60
tccttttccgatcgagatgaacaaatagatgaactcagcaacggccatgcaaagcataga120
gagaacaacgcacaggagagtgatgaccacagtgcaagtgaagacgacgatgatgaagac180
gatgaggaagagggagaaaaatcagtacaaccacctaataagaaacaaaaaaagcagctt240
tctgcacaagatgtccaagtagccagagagacagctgaattattcaaatctaatatattt300
aaacttcagattgacgaactaatgaaagaagtgaaagtaaagaaagctcacgaagaaaaa360
attgagaaagtattgcaccgtttgcatgatttgattaaacaagtgccacctgtggaaaat420
ctaactttacaacaagcagaacaacattttaatcccaagaaattagtcatcccatttcca480
gatcccaaaccaacaaaagtaaactatagattttcttatttgccactgggagatctttct540
ttggttgggtcgtacggattaaaaacagctattaaccaaccacatggacaaagtatcgaa600
gtagcactaactatgcctaa.agaattgtttcaaccaaaagattatttaaattatagagca660
ttatataaaaagtcattttatttggcatacttgggtgagaatttaatccatttgtcgaaa720
aagaataatttgccgatcaaggtgtcgtatcaattcttcaatgacgatgtattgaacccc780
gtcttaaaaatagagagtatccaaactgaaaatcccgaagatttgacttttactaaaact840
aaaattgctattaatttaatagtagcattcccatttggtgtttttgactcgaaaaagcta900
cttcctgataaaaactgtatccgtgtgcaatcagacaccgagactttgccacctactcca960
ttgtacaattctagcgtgttatcacaaacatcctacgactattatttaaagtatttatat1020
6
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
accaccaaaaaatcaacagaagcattcaaagatgcatgtatgttggggaaactttggttg 1080
cagcaaagagggttcaattcgtctctcaataatggggggttcggtcattttgaatttgct 1140
attttaatgagcgcgttgttgaatggaggtggattaaacggtaacaagatattgttgcat 1200
ggattttcctcataccaattattcaaaggtaccatcaagtacttggctacaatggatcta 1260
aatggagggtatttatctttctcgtctttaattggagaaaacattgcatcgaaatacaaa 1320
tcagatgggtttaatgttcctaccatattcgataaaaacaccaaattaaacatcttatgg 1380
aaaatgaccaagagttcttacaagagtcttcaattgcaagcacaacagactttggaatta 1440
ttgaatgacgttgtaaaagacagatttgacgccattttgcttcaaaagtctgattttgat 1500
ccgatgagatacgatattgtcttcaagttatcagcacctgaagagttgtacgattctttt 1560
ggtccattggaaaagatagcatacattacttttgataattatttcaagagcagattattt 1620
gcaattttaacaaaagcattaggtgaaagaatagaactgattgttattaaaaatgaacac 1680
ccttcaaacacatttgccatccacaagagaaagccatcacacacaagctcaacctttgtt 1740
attggtttgcaattaaatccafiaagaatgtgacaaattagtaaccaaaggtccgaataat 1800
gaagataaggatgctggtatcaaattcagatccttttgggggaacaaagcatctttgaga 1860
agattcaaagatggatctatccaacattgtgttgtttggaatattaaagatcaagagcca 1920
gtggtaatgaacattatcaaatatgctttagatactcacttgcaatctgaaatatcacaa 1980
catttggcatctctgatcagttattttgataagaaattgccagttccattattgccttca 2040
gcaacaaatcaagtgatcacatctttaagcagctttactgctttaaggaactcatttgaa 2100
aacttgagtaaagtcttgacaaatttagagttaccacttagtgtgaagacagttttgccc 2160
gcatcatctggtttaagatacacgtcagtattacagccagtgccatttgcagcatccaac 2220
cctgatttctggaactactgtgtattacaatttgagacttcaacaagatggccagatgaa 2280
ctaagtgcattggagaaaacaaagacggcatttttattgaaaattagcgaagaattagct 2340
gaaacagaatacaattcatttatttcaaaagatgaatcagtacctttcaatgaaaatata 2400
actttgttgaacattttaactccagaaggttacggattcagaatcagagcttttacagaa 2460
cgtgacgaattgttatacttgagagcagtatcaaacgcagacaaacagaaagcgttagtc 2520
caagatgtttatttgaaattcaatgaaaaatatatgggctcagtaaagcacaccagatct 2580
gtaacacaacttgcacaacattttcacttttattcaccaactgtcagattttttaaacaa 2640
tggttggattcccaattacttttgcaacatttcagcgaagaattggtggaactcattgct 2700
ttgaaaccatttgttgacccagctccatactcaattccccattctgttgaaaatggattt 2760
ttacaaattttgaatttcctagccagctggaattggaaagaagacccattagttcttgac 2820
ttagttaaaagttctgctgatgatgatatcaaattaagtgataagttaactatacaagca 2880
catagaatcattgagcaaaattttgaaaaaattagaaaaacagacccttcaggtattaaa 2940
acacagtattttattggatcgaaagatgacccttctggaatattatggtctcataattta 3000
actttaccaatttctactaggctaactgcattgtctcgagctgccatccagttgcttaga 3060
aaggaaggcattactgaaaccaacttggatttgatatttactccagcattacaggattat 3120
gacttcactattaaggtcaaggcgaataacgttactacttcttcaggtattttaccacca 3180
aacacatttaaaaacttaattcaaccattaacttcattccctgatgatataactacaaaa 3240
tacgatttggttcaaggttatgttgatgaattgaataaaaaatttggtaatgctattata 3300
ttttcaagtaaaaagttcacaggtttatgcaagaacaatgaaaacgtcattggtggtatt 3360
tttgttcctaccaacttgaccaaaaagaaattcagggtcaatttgggcattaacgttaaa 3420
cctttggatgataaaggagatgaagttataatcaacaccagctccatatacgatgaaatt 3480
gaattacttggtggagatttaattaaagcattcgataaacgtaaataa. 3528
<210> 14
<211> 2280
<212> DNA
<213> Candida albicans
<400>
14
atggctaaaaaaagaagagctgctatattgcctaccaacattattcttttacagaatgtt 60
gtgcgtagagatcctgaatcataccatgaagaattcttacagcaattttcccattatgaa 120
tctcttcgagatttgtatttaattaatccgaccggtgtggatgctaactctacaaccgag 180
tttattgatttaataggatttatgtcagctgtatgtaactgctatccaaaagagactgct 240
aattttcctaatgaattaaaagagatattattaaacaaccatcgtgatttaactcccgag 300
ttacgtgaga,aaattatccaatgcttgacaatgttaagaaataaagacattatatctgct 360
gaaatgttgatacagacaatattcccattattaattactagtaatgctggacagcaagtg 420
aagcaaatgagaaaacaaatttattccactttgattgcattgttgaaatctgttaataca 480
ggcacaaagaaccagaaattgaatagatcaactcaggcattattgtttaatttattggag 540
7
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
caaagggacaatcaagggttatgggctactaaattgacaagggaattatggagaagaggt600
atttgggatgattccagaaccgttgaaataatgactcaggctgctttacatccagatgtc660
aaagttgccgtcgcaggtgctaggttctttttaggggctgacaaggaaagggaagacaat720
tttgaagagagttcagatgaagatggtttcgatatgaatgagttgagacataaaatgcaa780
attaataaaaagacatccaaaagaggtaagaagttggagcaagctgtaaaagccatgaaa840
aagaagaataattccaaacattcagcaacttacttgaacttttctgccattcatttatta900
agagatccccaaggctttgcggaacaaatgtttgataatcatttgagcagtaaaaattcc960
aataaatttgatttggatcaaaagattttgtttatgaatttgatttcaagattaattggt1020
acacataaacttattgtgttgggtgtatatacatttttcttgaaatatctcactccaaag1080
caaagaaatgtcactcaaattatggctgccgctgctcaagcatcacacgatttggtacca1140
ccagagtcaattcaaattgtcgtgagaaaaattgctgacgaattcgttagtgatggtgtt1200
gctgcagaagtagcatcagcaggtataaacaccattagagaaatattagccagagcccca1260
ttggctatcgacgctccgttattgcaagatttgactgaatataagggttcaaaatctaaa1320
gcagtgatgatggcagcaagatcattgatttctttgtatcgtgaagtagcacccgaaatg1380
ttgttgaaaaaagatcgtggtaaggtggctagcatagaattgcagaagggtgagaaaagt1440
ggcttgcctcaatatggggttgagaataacgttacttcaattccaggtattgaattatta1500
gctaaatggaagaaagagcaaggcttagatagtagagaggacgaagaagatgatgccaat1560
tgggaggttgacgatgatgaagatgcaagtgatatcgaaggtgattggatagatgttgaa1620
tctgacaaagagatcaatatttcagatagtgatgatgacaatgaagaggatgagcaagaa1680
caagaaccagagaaaggtaaagcaaaaataggtaaagcagaagataacgaagatgaagtt1740
tctgatttagagttgtcatcagatgacgacgatgaagatagcgaggagaacaaagatgga1800
aaagcagttgctgattcagaagaacctcctaccaagaagcaaaagatcagaaacgaaaat1860
gcagatatcaatgccgaacaagccatgaatgagttactttccagcagaatattgacacca1920
gctgatttcgccaaattagaagaattaaggacagaagcaggtgtatcgaagattatgggt1980
atttcaaatgaagaagctgttgattctacttccttggtaggtaaagtcaaatacaaacaa2040
ttgcgagaagaaagaattgctcatgctaaagagggtaaggaagatcgtgagaagtttggc2100
tctagaaaaggtaagagagatactcctcattctactaccaataaggaaaaggcaagaaag2160
aagaattttgtcatgatgattcataaaaaagctgttcaaggtaaacagaaactttcttta2220
cgtgatagacaaagggttttaagagcacatataacgaagcaaaagaagaaagggttatag2280
<210> 15
<211> 1587
<212> DNA
<213> Candida albicans
<400>
15
atggctattgttgaaactgtcattgatggcattaattattttttgtcccttagtgttaca60
caacagatcagtatattattaggggttccatttgtttacaacttagtatggcaatattta120
tattcattaagaaaagatagagctccattagtgttttattggattccttggtttggttct180
gcagcttcatatggtcaacaaccttatgaatttttcgaatcatgtcgtcaaaagtatggt240
gatgtattttcatttatgttattagggaaaattatgacggtttatttaggtccaaaaggt300
catgaatttgttttcaatgctaaattatctgatgtttctgctgaagaagcttataagcat360
ttaactactccagttttcggtaaaggggttatttatgattgtccaaattctagattaatg420
gaacaaaaaaaatttgctaaatttgctttgactactgattcatttaaaagatatgttcct480
aagattagagaagaaattttgaattattttgttactgatgaaagtttcaaattgaaagaa540
aaaactcatggggttgccaatgttatgaaaactcaaccagaaattactattttcactgct600
tcaagatctttatttggtgatgaaatgagaagaatttttgaccgttcatttgctcaacta660
tattctgatttagataaaggttttacccctattaattttgttttccctaatttaccttta720
cctcattattggagacgtgatgctgctcaaaagaaaatctctgctacttatatgaaagaa780
attaaactgagaagagaacgtggtgatattgatccaaatcgtgatttaattgattcctta840
ttgattcattcaacttataaagatggtgtgaaaatgactgatcaagaaattgctaatctt900
ttaattggtattcttatgggtggtcaacatacttctgcttctacttctgcttggttcttg960
ttacatttaggtgaaaaacctcatttacaagatgttatttatcaagaagttgttgaattg1020
ttgaaagaaaaaggtggtgatttgaatgatttgacttatgaagatttacaaaaattacca1080
tcagtcaataacactattaaggaaactcttagaatgcatatgccattacattctattttt1140
agaaaagttactaacccattaagaatccctgaaaccaattatattgttccaaaaggtcat1200
tatgttttagtttctccaggttatgctcatactagtgaaagatattttgataaccctgaa1260
gattttgatccaactagatgggatactgctgctgccaaagctaattctgtttcatttaac1320
g
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tcttctgatgaagttgattatgggtttgggaaagtttctaaaggggtttcttcaccttat1380
ttaccatttggtggtggtagacatagatgtattggggaacaatttgcttatgttcaattg1440
ggaaccattttaactacttttgtttataacttaagatggactattgatggttataaagtg1500
cctgaccctgattatagttcaatggtggttttacctactgaaccagcagaaatcatttgg1560
gaaaaaagagaaacttgtatgttttaa 1587
<210> 16
<211> 1302
<212> DNA
<213> Candida albicans
<400> 16
atgcctagtcatgttaccaatgtatataacgatattgatgatggaatgcttctactgtct60
ttgtcattaaatgagagatcaaatgatagaagaggtttggaaattgaagaggtatacgac120
tccagttttgatgatcctatggatattgatgatacaggtgagttgtcgaatcacatggat180
atagatgatacaacttttgagatagatcacgtcgcaagtgataactacgcaaataaaaga240
gaagacgacaatgatactaataacgaagaagaacgtcgggaagatgggttgttttcttta300
ctatctcctacgttgatgggggcaaaacttgcaatcaaaaagccattactattaatgcct360
ccgcccactgtttcggaacaatctgattcaaaaactgaaagtgcatcttctgttgattat420
gaatatgacactagttcattcaaacccatgaaaagcaatggattgattacacgaaaaacc480
aatagcagtacatttcagccaagcaatatagactcgtttttattccacagtgatggaatt540
tcactgggtcagctgttaggtggttatcaagatttacatagcaattatcaacagccagtg600
actatccataatcatcaccatcactattactattacaataaagatgaatcagtaccgtcg660
ccaccttctaacaacaatttacaatcacttgaacacgagcaaagaaatttgcagatgcaa720
caatacaaacaacaattagaggagcatcagttatatttacaagagtataaacgtaacaat780
caaatacttttaccttctccttggcagcataatatatctccaatagaaagagtcccctat840
ctattgatgtcctacttacaaatgttgataaatttcattgcttcgttatatggtgtatat900
cttgtttattgtttatttcgaacgataaatacagacatcaaaaccaaaatagaggaacaa960
caaacgaatttgattatcagcattgagtcctgtcgtcgatcgtactatcagaatggctgt1020
gacgacaaggataacttggtcccattattggtatccaaatgtcaaaaatttgagaaatgt1080
atgaaacaggacccttacaaattaagtaacgtttccattatgagtgctgagattattgga1140
atgatcatcaactcattaattgaacctttaagtttaaaattttacttgtttatgttagca1200
tttatattaattatatttgcatgcaattttacgtttggatatattcgagccaaggcatat1260
tatggtggtagtatgaagtatagtcttgacaaactcgattag 1302
<210> 17
<211> 792
<212> DNA
<213> Candida albicans
<400>
17
atggaatcattagacgaaatacagtggaaatctccagagttcatacaagagagagggctt 60
aataccaataatgtgttggagtacttttctttatcgccattctacgaccgaacatcgaac 120
aaccaagtgttgatgatgcaatttcagtaccagcagatacaaataccacctggtgtatca 180
ttccaccaatactttcagtcgcggttgagtgagatgaccggaatagagtttgttattgcg 240
tatactaaagagcctgatttttggataatcagaaaacaaaaacgacaggacccccagaac 300
actgtgacactacaagattactacataataggagcaaatgtttaccaggcaccgaggatc 360
tacgatgtgttgtcatcgagactccttgcaagcgttttgtcgataaagaactccactgac 420
ctattaaatgacatgacaagctatcatatctcagacgggggtcattcctatatcaactcc 480
atacacggcagctcctcgaaaccatcacagtcatcggctgtctcgaagccactgtcaaca 540
aatactggaacgaatgcaactactaccccgatcactttgacgactccactgggtgctact 600
gtcccgagcacagtgtccaatggaatctcaaccagcacagagattgccagcggagtgttt 660
gatacgttgttgaatgatgtggtgatgaatgatgatcacttgtacatcgatgagattcca 720
ttatatggtgagggaagcacacttgagagacttgggttaaagggaaataaagatgcgggt 780
ttgagtctatga 792
<210> 18
<211> 1092
9
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<212> DNA
<213> Candida albicans
<400>
18
atgtcctcttctcaagcacgaaaagctcttcaagatgtaattcccaattatttaggtgaa60
tttacacccaagctactagattatatcaattccttatatcaacttagtttaaggaaacaa120
gcaatactaccaaataaatcggaaattgcacgttttcatctatgtgctgttgttattgtt180
gaaaaatataaacaatcttttgaattgccgactcctgatgtgtcaagaataccaacacaa240
cctaaagtagcagcaaagttactagacacttttcgtgagttgatagaacaaatctccgca300
gccagcacacctgtatcaagtcccaaaaaggtgaaaccaccatcccaaagtccactgaca360
ccaacaaagagtcgaacaagcaaagagaatttgaaatcaggatcccctttaaaacgtctt420
cgagcagaaatgttgcaagaagaccaggtcaatggtaactcccccgatggccaacttaag480
gatgtagactctccctttaacccaaagaaaagaaaagaatccaaggcaggcaccccaaca540
cataaagtttataaatacgataagaaacacgttctgatagcagattttatagcattctgc600
aacactttccttataccaggtgatatcaccgccaagatggtgggcacatttttaacgcat660
caacacaagtttcttaaaaaaagtgattggtcattggcctgtggtatggtttatgcggca720
tacattcggataaataacagattacttgcacaactggttggcaccaagtcagagttcacg780
aaacaattgttacaataccagaagggaggtttactgctaggggccatgcaatcttggtgt840
ggtataatcgaagaatggattcaagatgaaccatggattcaagagatagaaaagacttac900
gcttatggtagcaaaacagctgaagaaaccagaaattcttttgaaagaaaagcgaaaata960
ggtgaaggctgggacctaatggaacagtttggggctatgattcatggcgagacaatttcg1020
ttatcaagtcaccaagaagagtattacaaaaactggcgtaaagaggctttagagaaatgt1080
gaccaactatas 1092
<210> 19
<211> 2616
<212> DNA
<213> Candida albicans
<400> 19
atgaatacgttttcatccccaccaaacgtgatacgagagtataatgactccacatatcag 60
ctgccattgaattcacaattccaccaatcaccattcttgcagactcaatcaccagactat 120.
gtcagcttacgagaagaagaggatgataataatgataagaatctagacatcatgtcatca 180
tgtatagtagattcagtaatatataaatcacaaaaaattgctggcccactattgagtcaa 240
atatccaatttgaacattcagcaagcattgattatacgagaactactattcacattgtta 300
ggacatgaaggtcattacattcaatatagtaaacgttatgatccaacctcacaaatcagc 360
cgaattgaaggaccggactataagattgcaaagaacttggatataagtcttaaagttatc 420
accaagaaattggtcaaatttggaaagttttacagtgggttaaaatcgtttattcaagta 480
tttgataataacaaatttgggaaaattgtgcaaaagttttgctctgaagtgagaaagttt 540
ttatcgagttatcaacaagtgctaataaatgttgagcatgagttcaagtttaataagaat 600
tttaatttgaatatgttggatctgctcttacatcaagaaatatcgaatgaaatgactcat 660
ttatatcaaattggaatagagattagtcggataacggaagaaagacagaaaatgtcacag 720
gcggaaatcatgggtaattttgaaccaacgactttggcaaacacaagtatgaatgggatc 780
aattccgagcctaatttgtattatggcaaatttgattgttgtaaaggtggactattactt 840
caagttattcaggaaagaatggtttattataaaggtgatcctacatctctagatttttta 900
actcaactttttgatattgttagttcggattatattgggatgttgaatcagtggcttttg 960
gaaggtgtaataaatgatccgtttgatgagttcatgattagagaaaaacgagtgccagac 1020
tcctttatggaaatatttcaaagtaaaagtgaatactattggaacgaattgtttttaatt 1080
aaaatagatggattactcaatcaatttcagaattcaaccatacagtcgaaaattctcaat 1140
acagggaaatacttgaatatattcaaacgatgcacagggttacacaattttgaatcatta 1200
aaagaaaaattgacaactataactagtttggcagctcctgatttggaacttaagattgat 1260
gagttttatcatagagcaaacaaaatgttgatgaagttgcttttcgatggatataatttc 1320
ccaagtgtggtgaacatatttcaaagattatttcttttcgctgattcttttcaaatcgac 1380
aactttattgatagtactttcagtgaattgaaacgtgggaaactcaaaatctcagtttcc 1440
agactacaaaagcaatatgatgatatattcaaagaaaaaattgaaaataaagttggagta 1500
cggccaagtgtatacgacgtgttgaagaaaaatcagaagctatcggtaacgtcggagtca 1560
ttgtataaagtggttgaggaattaatggaaaagaacctggattatttgatttcagacaac 1620
aatttgcgtgggatatttcatcgagtggcgtcgttaagagacgacctgcgacttaccata 1680
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
ctgagtactgctgattctgcaactgaaaacgtgaaggatgaaccaacaataactagtgtt1740
gatcttactataccgttgccattcccattaaatttggttttgaatcaacaattgtcatac1800
caatatgaaataatgtttaaattattaattaatatcaagtttatttcaaaatataatagt1860
tccaattggcaagagatgaattattctaaaatttggacaaattcgcatttcaactcgagt1920
gtgaaaaaatggatattgcgttgcagagtattgcattcgagaatttgcagttttattcat1980
gaacttgaaaactatatagtgcatgatgtcattgaacataattttgaggaaatcaaaaat2040
ttgattcacaccacggctactaacttggcgacaagtgaactaggatcagacataaatgat2100
gaaggtgataatatattcaatggatctttgattcgaggtacatttaacaataattcgatc2160
tttgattccaaagttcacaaacataggacaacaacatacgtggaaggtatttcaacagtt2220
gaacaattaattcaaaaatttctagattattcaagtactttgttgaatgattcgttgctt2280
acccgtgaagagtcgttgcgtcaattacgtaaaatgttggacttcattttccatttcaat2340
aattacattgtccaagtaaagaaagttttggtattgttgaaccatgaattgttcaatgag2400
tattctaaggaattccctaccaagtttgaaaagccaatggatcaagagctgatagataaa2460
agatttgcaaacttgagtgatacttttctaatgcagtacgaaaagtttggtgaaaatctt2520
gttacatttttagccaccattaaacaggttggtgaaagagaaaaccaaggattattggaa2580
ttaagtaatagactagaactttgtttcccagaatag 2616
<210> 20
<211> 1911
<212> DNA
<213> Candida albicans
<400> 20
atgtcaggaccaataatttgttcaaagtttgatcagtcggggaactatttggcaaccggt 60
atggttgctcttgattcccatcaagtcaaagttcaatccataacctcatctcaagcatcg 120
ttaaatacatcattcaccttggaaaaatcaaacaaattagtaaatttagcatggatccca 180
tcagattcaatacaattgttagctctttgtttatccaagggaagtattttgatatattct 240
cctcaaacaaatgaaattgttctggaattgattagttctgcaaatgtctcaattttggat 300
ttccattactcaacaactactagaactgggtggtcttgcgatatagaaggaaacgtgtac 360
gaatgggatttgaattcttatttgttagttgattctttcaaagtcaatgaatacattgaa 420
tctgttgattcgataaatagaatatctacagtaatgttcaattctcaaccgcatttattg 480
cttggttcaaacgcagtctaccttttcaatattaaacaaagagaacttgtgaaaactttc 540
ccaggtcatattcaaccagtaaactcgataacagctttaaacaacgacatgtttttaacg 600
agtgctaaaggtgaccgatttgtcaatttgtatcaacttgataaaactgccacaaaggca 660
gtctttgtgggtctgtcctcagtatcgagcttatcagtttctataaaagacgacaagtca 720
gttttggtgattattaatgaagaaggtgatattgagattttcaacaatccattagcagac 780
gccaaatctcaagtttccactcctgtaccgaaaaagaaaagaaagcaagttggtgtttct 840
tcaagatcattcaatgcatcaattaaattatctcgtccagaaccagaaatcaaaagccca 900
caagatacacatttatttatcaatgctgtttccactgaagataacttgatcacattcact 960
tggttggaaaattcaactatcccattctttgacacccttaaatggattgatgaaaccggt 1020
tctttgcttcttgaatcagccaaagtattgctaaaatctaaaccaaattt.aaaagtcact1080
caacatttgactaacggtcacgatgtggccgcaccaaaactttatactgaagggcacacc 1140
attgtgagtgatggcagtaatatcagagatttggaatttcaagaccatcaagaggatgaa 1200
gaggacactgaggaatctttggctgaaaaattagagcgattggcaatggatcaaacttca 1260
caacaaaaatcaagaagaaggaaactagaagaggcaagaagtggtgtatctttatcgatt 1320
gtattaacccaatctttgaaaaataatgatcaagctttattagaaaccgtgttatcgaat 1380
cgtgatcctatcactattcaaaacacaatcagtagattagacccttattcatgtgtcaca 1440
tttttggataaattgagtgagaagattcaacgtcaaccaacaagatttgatcaagtgagt 1500
ttttggctcaaatggatccttgtgattcatggtccaactatggcttctttgccaaacttg 1560
agcatcaaactatctagcttacgtgcagtattaaataagaaagctgaagaattgccaaga 1620
ttattagaattacaaggtagattgaaattaatggatgattctgctgcattgagaaatgag 1680
tttagtgctgaagaaatagctgaagatcttgaagaacgaagtgatattgaatacaatgaa 1740
gaaattgatgatgcaaagtatgttggggtgatcagcgacgacgaaagcatggatgatgtg 1800
gatgactttgatgatcttgacgatgaagaggaagaggaagaggaagaagaggaagatggt.1860
attcctgatgctgcaaatttagatg~tagagaagattctgatcttgaataa 1911
<210> 21
<211> 984
11
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<212> DNA
<213> Candida albicans
<400>
21
atgatgtccacaaattttcaatggccaggaaccaataagaatgataatacagaagtatct 60
gttgaaacaccatcaagcacagatcctcatgtccctcgctatccatttaccgcaatgtca 120
catgcgacggcaagcacaactatgaagaaaagaaagcgagacgattttgatggcgacaag 180
tcaacaactatcaccatgaataccacgacaacacgtaaatacatacaatcatctttagga 240
tcttccaagttcaagaaggccaaaacacccaaaatcagtgggcaacctttgccactacct 300
agattgattgaatcattagacaaatccaatttacaaaaacttgtgcaagatttaataact 360
gttcatcctgaattacaatctacattaattaaaatttcccctagaccttctattcaagat 420
tccattcaacttttacaagacaaatttgatatgattatatctcatttaccttacaaatgt 480
gatgttgaaagtgattattcatatttaagaatcaaacctcatttgcaagaatttttatca 540
tcagtgtctgattttattttaaattatttacccccattagaaacaaatatgacacattct 600
ttgcaatttttacacgaaactaccaaattagtgtataacttgcctaatttcactaatcaa 660
gaatttcaatacaccaagtcctctgcattagaacagattgctaactgttggttgattgta 720
ttaagccaggatgaagaaaaagaaggaaacactgatgtggtgaaagttatacaagaattg 780
gaattgttagagaaattacacgaacataatgagatatcattcaataagtttgaaaaagtt 840
gttgattattgtaaagacaagttagaacaacatgaattaatcatgaataataacgaagcc 900
ggctctggtgttacatcgtcaataagtgacttgatcactgtggattattctaaatactct 960
atagccaatacaacttctatatag 984
<210> 22
<211> 1659
<212> DNA
<213> Candida albicans
<400>
22
atgcccacaaacatacaaggagaagaagtgataatacctcctaaagatgaagaggaaata60
ttgttggagaaattagtatttggagatgccgcagggtttgaaaataacttgaaaaaatta120
gacaacttatatgattattcagacgaggaggaagagatagatgaaaaaggtctggagaaa180
gaatcagatattgaagatttacaagatgaagacctattttttattgatgatgggaataat240
gaagagcatagcagtggtgatgatatggaaatagatcaatccgaagacgaagaagaaggc300
gaagatcaagattcagataatgcatgggaggatagcgatgatgaaaaggttaacatttcc360
ttattaacatcagataaattgaaaaagttgagaaaaacaccacaggattcagttatatct420
ggcaagtcatatattattagattgagatcccaatttgaaaagatatacccaagaccacaa480
tggatagaggatatagaaaacaacagcgatgatgagaaagacttgtcggacgaagacaag540
gttgacgatgaagaaggacaagtaggatcaacaactgcattattaaacatcttgtcaagt600
actgaaaaattcataaacacaaagcaattgaaactaattgctgcaaataaaatatctata660
accagattgaaagatgcaaactataaaagaatcggtaaatcgggtatccagaccattgac720
ttccatccaaactatcctattttgctaacaggtgggtttgataagactattagaatttac780
caaattgacgggaaatcaaacaactttatcacttcatactttttgaaaaactgtccaata840
atggaagccagcttctatccacaattgtcaggcgatgacaccaaaaccagcaacttaata900
tatgctagtggtcgaagaagatatatgaataaaatcaacttgtcaactggggaaatagag960
aaaatcagtcgattatatgggcatgagcagacacaaaagtcgtttgagtacttcaaaata1020
agtcctcaaggtaaatacattggattgactggtaacaacggatggtgtaacttattaaat1080
gctcaaaccgggcattgggttcatgggttcaaaattgaaggaacaatagtcgactttgca1140
tttgccaacgatgaatcatttattatgattgtaaattctgctggtgaagtatgggagttt1200
gctctcgaagggaaaatcacttccaaaaccccaaacaaaatcattcgcagatggtacgat1260
gatggtggtgtcggaatcacaaagctacaaattggtggtaaaaacaatcgttgggtcgcc1320
attggtaacaataacgggatagtcaatatctacgatcgatcagtatttgctcctgaaaca1380
acacacccaaaaccaatcaaaacagtggaaaacttaatcacatcaatatcttcgttggtt1440
ttcaaccccgacggacaattattatgtattgcatcaagagctaaacgtgatgctttgagg1500
ttggtgcacttaccaagtggttcagtgtatagtaactggccaaccagtggcacaccttta1560
ggtaaggttaccagtattgcattctcgccaaataacgagatgttggccattgggaaccaa1620
accggtaaggtcactttgtggcgtttgaaccattattaa 1659
<210> 23
12
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 2148
<212> DNA
<213> Candida albicans
<400>
23
atgtcattgaaaccatttacggggttattattctgttgcactgggttggaatcaaccaca60
cgacgagaggtggtagagaagatagagacccttgggggaattcattattcagatttaatg120
acagatgtcaattatcttat~agtgggagatagagacactgagaaatatcgattttgcatt180
aaatatagacctgacattatttttattgatgctgattccattttcacaattcataaacat240
tggataaacggtgaagatgagaacctggacttactacgaatagagaaatataggttggca300
atatttgctcaattgaatgcatgtttctcaagaatagaaatgtcaacctctcaaattgat360
catttagtcaacacagtaaaatttcgacagcgtactaatacttcacctgagtattttcgc420
ccgaaaaatttattcaaattgtttgttgataatggtggtattgccaaagaatctttactg480
tgtcatcagaattttattatcacagctgatccacgaggaacacgatacaacaaggctctt540
gaatggaatgtacccgcaatacatcctatttggattgtcgatagtgtattgagaggtgct600
gcattagattggaaagattatattttaaacaacaatccaaatgattgctatgatcgaggg660
tgtgatgtttggcccgaagttttcgattgtcaggagaaacaaaaacagaaatctcaacaa720
caacctaaaagattagagtctactgaaccagaagtaaaacggaaaatcaccaataataaa780
accaatgctgatatttggaactcgattatggatcataccaagaagcaaacaaagcaattg840
attcacgacaagacctgggatgatgatgaggaggaggaagataatgatgatgatggtgat900
acccaaaccaaaaatgaaaagaataatcaatacaagaatattactacaattcctaaagat960
ggaaagcaaaaaccagaattaaacggtaaaatacataatttggatcttaaattggtgtca1020
gaaagtaaagaaaactcaccaaatgtcctggaaagtcaattatttttagggttcaactat1080
tatacggtcggttttgactctcgtgagtttgacttgttatccaaagcaattgaaaactac1140
ctgggagaaatatctaatgatccaaatgacgattctatcactcatgtggttattcctgca1200
aaaaaggggtatcagtcaatgctggttttgaaagtcttacctgctgaccttaagctgaga1260
attgcaaatgggtttgtcaaaattgttactgagtttttcattgaaagatgtatgttttac1320
aagaaaattatattagatagatggggacagccaatgaagggattagtgccgtctaaaaaa1380
tcatttaaaatttgtaccactgggtttactggcattgaattattgcatattgaaaaacta1440
atacggtcgtttaactttgaatattgtgaaacattgtcagaacagagagatctactaatt1500
ctcaacgtaaatttatttaaaaaaagcttgatgaattcgccaaagttatttcaatacaaa1560
tgtaaggacatcatcaattgtccaactggtggatctgtgtcgttgatgtcatctaaacac1620
aaagttgaagctgcaaaacgatggaacattcctgttgtttcagtggcatatttgtgggag1680
attttagaactttcaactaataaatcacatattattatgccggatattacagatttgcaa1740
tggtgtgtctttgcaccgagcaactataataaaccgaaatcattattggagtacgtgaag1800
aatttggataaggctagtagagaaagttcttttagtcccaaaagtcaagaaaatgaagca1860
ttggaagaacccacaatggataatctggtgagattgccatcaccacgaagagttaatctg1920
aaacaaaaatacggtaaattagtgggaggcaaatctcccaaatcaattaaacggaaatta1980
ctcgaagctgcaaatctgtttgctgatggacagaatgatcatagtattaatccagatgtt2040
acaattgaagaggatctgatgtctcaaataaggtatcaagacaacgaatcaatgatcaac2100
caagaaagattattagagaaattggatggatcagctgtgcttgtgtaa 2148
<210> 24
<211> 3363
<212> DNA
<213> Candida albicans
<400>
24
atggggaaggatttgttgactgcagaagcggtgactaaactattaagatcgaaggacacc60
tccatcacagagattgtcaatactgcaaatagtcttttgaataatacattggatatatat120
ttacctggaaaagaagtgtttgtattgaacttactatgtgacagattgaatgacaaatca180
aatggtaaatttggaaagtggaagtttaacaaggatgtatggaatttgcttcttctggtt240
tggtcgaaattaaatcaccagaaggtagacagacaaagggtaatacagagattgaaaatc300
attgagattataattttggttttacagcagaacaatgacaatgaagtcttctcgagcttg360
tttgagtttcttggtattatgtttcaagagtcttacattattgcagatgaaaattctgct420
acacaattattgaaatgctttgttgaacacatggatgttctccaagctagcgattcaatt480
gtgagttggactgaactagttcgagatatatatactcgtgcctgcctgaaaatcagttta540
gaaggatcaaagaagttttacaataagttttttgaagattgttgtttccccttgatcgag600
13
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tatttagccatttctgaaggtctgtctgtctcaccaatattaaaggagttgttaattcaa660
ggggtgttcaatgcggattccacaaagtactaccaatcaagtttagagcgggagctcaaa720
aagaaagacatcaaagaggtatcagtgatatatttatacaccttaacggtgcaacttttc780
agtgccaaacatatggaaatatgtgaaggggtatattctatcatggcttcaaagtgtcct840
gacttggcagaaaagctattgtctattttggcaagctgcaggaaaacaatttctaaacca900
tttatagagctgatttacaaagtagaggttgctgataagccttttaaacaattaaactgg960
gacatggttaaacatatatttgcaattgatagtgagttggcaattagcaaatcagggttt1020
ttgttcaagacttacaagtctgaatttcagttggatgacaaagttgtacctgttgctgaa1080
gtgattgttgatggttttgcaagaaaccgcgaattgctggatttttttacaaaagtgtgg1140
cccaaagccataaagagagacgagatatgggaatcagatgagttcatacatactgtatca1200
cagcatgttaagactttttcagggaaacagttaattgatgtcatcgaaagctcgttttat1260
gcggataaggggagtcaacgtgcgatttttacagcaattacaaagggactaaccagttca1320
tctgcaaacctaattgatgccgtcaaacagacattattagaccgcagcaactatttcaat1380
gccacagagaatttttggtgtattcgttattacttgctctgtttatatggcacggatttt1440
actattgctgaacagaatatgaaacagaatattgatttgtactatcatttttctattttc1500
agattattggagttacaggttatcaaggagtattcaaagtctgatcaaaagtattttatt1560
gcttgcattgaaggggagaaggaaatgatatctccgattttcaaaagatggttggtcatt1620
ttcaacaaattttttgatagtgacttgttgattaagttaattctgcttggatatccagac1680
attgaatttgacgatgtatttttcgaacaaccaaagctaacaacttcattgattagattc1740
attactgagaatttaccagcaagaatggatcttatcgcttctatacctattgtttgcttt1800
aataaagcattcaaaaaggagttacttaatggtttgtttgtcttatttgtaagcaatccc1860
actaaggaaacactcgaaaacattcagtatttgcttggccagcctacttacctgtctatt1920
ttggagacaaattttgataacatgttaaaattgttgactgttagtactgaggaatcaaaa1980
ttgatagcttataatgtcattgaaattgtatggaaaaataatgtccggcagattaaaaat2040
gaagagaatcaaaagtatgtcaacgatgctatctcgaaattgagtagttatttggactcc2100
atgtcacaacaaataattctgcctgaactagaagcaattctgataatacttacaaatact2160
aaggaagttggtttattcgaaaatacggaaaaggggttgaataagttaaatgaaaagttt2220
acaaactattgtattaacactttaaacaactgcaacacccaaaattttattactgtaagg2280
tggctattacaggcacttgtaatgttgccacctaaatcattgtcttttgaaaatgtcatt2340
tcctgtacaaaaagattagatccaaatattttgaaagacaactctattcaatccacattg2400
tttcaattgatttgcaagacaatagactttaactacaagagtttggtctatgttttgagt2460
ttgtttgtctctttgctgtctgggagaaatacggagttgtatacagtgttaaagtcgtta2520
tttcaaaaattttctaaacattcgcagttatattttgaagtctttgatttttttacccgt2580
tcaattgatgctgtcccagttgaattcaatttaagttttgcacagattgcttccatattt2640
ttgagcacagttccaaaagacgcagatgccaatcgctacaacagcaaatgttttactttt2700
tatgttaacgctttacaatctggaaacgaatgtgtggccatgcagattttgactagctta2760
aaagatttgttgactaaccagtcctggattttcaaacaaaatttgctagaaataacttta2820
gttattgttaaaaccggattgcaaaaactaaactcttttgccaaccaagaacaaatttat2880
attttatcaacccaaattgtttcccatatcttgttgtatcacaggtttaagattgccact2940
agacaccatcttgttttgaacgtgatgtcaagtttattgaagtacctagcagatggaact3000
tcaaagttatcatcaaacacagaagctgcatctgcctatgctcgtttattgagtaatcta3060
tgtgaaccttcggagagagttggagataagatgtttcacttaacaacttcggcaagttat3120
ttcaaaaaattgttaagaaaacatttgtctgttttattaagcaattatatctattttaat3180
ttgaagtacacttttactcgtactgtgaatgatgctataatgccaggaatttacagtatg3240
tttactgttttgtcacaaaatgaattgagagtagttaatgattctttggactacggtggg3300
aaagcattct gtataatgattacaaagatc gaaagatcaa3360
ataaaacttt atgggaaatg
taa
3363
<210> 25
<211> 591
<212> DNA
<213> Candida albicans
<400> 25
atgtccgccg atgaaaataa caaagtgaga tttgagcggt tgaggcttgt tgccaggaaa 60
gccttagaac aactgattaa aaagtctttg actatggagc aagtaaaaac atgttttccg 120
actctagtga cttctcaaga tggagtcaga tcactcgaat tggccctttc acaaatgtcc 180
gggttttggc atgcaaactc gttggacgaa tttgatctaa tatataaaga aaaagatatt 240
14
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gaatctaaactagatgaattggacgatataatacagaatgctcaacggactaaagacagt 300
gggaaagaaccaagtaatatagatcagctttcacctttagaaattgttgattccacgatt 360
gttagcaatagcaaaaatgttttggatagtcttcaaatgatatacgaccaattgtgtctc 420
gataatgctgagctatatacagaactttcagaactcacaaaagaaagcactagaatcaat 480
aattctataaaatccggtattgaacaattaaacaaagaagctaatagtgttgagctagaa 540
aaagcgggacttcaaattgacaaattaatagatatccttgaagaaaaataa 591
<210> 26
<211> 1416
<212> DNA
<213> Candida albicans
<400> 26
atggcgtcttctattttgcgttccaaaataatacaaaaaccgtaccaattattccactac60
tattttctcctggagaaggctcctggttctacagttagtgatttgaattttgatacaaac120
atacaaacgagtttacgtaaattaaagcatcatcattggacggtgggagaaatattccat180
tatgggtttttggtttccatactttttttcgtgtttgtggttttcccagcttcatttttt240
ataaaattaccaataatcttagcatttgctacttgttttttaatacccttaacatcacaa300
ttttttcttcctgccttgcccgttttcacttggttggcattatattttacgtgtgctaaa360
atacctcaagaatggaaaccagctatcacagttaaagttttaccagctatggaaacaatt420
ttgtacggcgataatttatcaaatgttttggcaaccatcactaccggagtgttagatata480
ttggcatggttaccatatgggattattcatttcagtttcccatttgtacttgctgctatt540
atatttttatttgggccaccgacggcattaagatcatttgggtttgcctttggttatatg600
aacttgcttggagtcttgattcaaatggcattcccagctgctcctccatggtacaaaaac660
ttgcacggattagaaccagctaattattcaatgcacgggtctcctggtggacttggaagg720
atagataaattgttaggtgttgatatgtataccaccggattttccaattcatcaatcatt780
tttggggcattcccatcgttacattcaggatgttgtatcatggaagtgttatttttgtgt840
tggttgtttccacgattcaagtttgtgtgggttacatacgcatcttggctttggtggagc900
acgatgtatttgactcatcactactttgtcgatttgattggtggagccatgttatctttg960
actgtttttgaattcaccaaatataaatatttgccaaaaaacaaagaaggccttttctgt1020
cgttggtcatacactgaaattgaaaaaatcgatatccaagaaattgaccctttatcatac1080
aattatatccctatcaacagcaatgataatgaaagcagattgtatacgagagtgtaccaa1140
gagtctcaggttagtcccccactgagagctgaaacacctgaagcatttgagatgtcaaat1200
ttttctaggtccagacaaagctcaaagactcaggttccattgagtaatcttactaacaat1260
gatcaagtgcctggaattaacgaagaggatgaagaagaagaaggcgatgaaatttcgtcg1320
agtactccttcggtgtttgaagacgaaccacagggtagcacatatgctgcatcctcagct1380
acatcagtagatgatttggattccaaaagaaattag 1416
<210> 27
<211> 3540
<212> DNA
<213> Candida albicans
<400>
27
atgacatcaagttcacaattatctgcttcttccaacgaactgattcaaaatgagagatta 60
ttatctctgctgttatttgaccaaataaggccggtttgcatagaactatcagaagcttca 120
actctgcaaccattcaacacaaacaaagttgtcaatttgatgatatcaatggaagacatt 180
cttaaaaagcaccacgatgagtataataaggatggaaattttagaatctatcagctatcg 240
cccaagctagcagattatatcttttaccctttatccaatatattgaaacagccggcttta 300
gatgatacaattatacagcatttgttcggaataattagattcctagttgaatactcttgg 360
agcttcaacgttaattttgttcttaccgatcagttacttcctttagtgatatacctttcc 420
agtggagatttgaacaaggaaccattactcataacaaagaaatccatacaattcaaaata 480
gcaacagtttctgtattatatactattacgagcactttgaacaaggaatattttcaatcc 540
ctaactgaaaaaagactattgtttataagcaatgtcataactatttgtttaagtatcata 600
gtcggcctgcgagtggaatctcaagatacaatacaattggtcctcaaatgtcttagttta 660
atctccaacgtgaaaaggtatttgaattcgagtcagatatcaataattcttccaggtatt 720
gtttcttcgataactaaatttatatcactaaatttaaatttaaattatcaaatcataatc 780
caattcttgcgattattatcaggtttcatatgcgcttcctttaatgataaagagttagat 840
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gcccaaatcgagttgaacgaaggtataagtgatatttcagaaatccatgtcggatgggac900
gacgacaatgagactttgggcaacaattcattatattcagatgtcactattacagagaat960
gatcataggtcaagtgcatggttaaaagccacttccaaacaattgaaattatcattaata1020
atcatttttaagtcgatactacttggatcaagaaatagacatcggttgagatccaagcaa1080
gaactatacgatgagattcttggatttgttgagactattttgaaaaattgtttcaacagc1140
ttgtttaaagaatttgcctcattggcaattgacatagtatcaattcttggatacgtaaca1200
tctgaagacaacaaagaaatggccgataaaaccaacaaactatcaaatacactttgcatg1260
attattgaaggtgaaaccaacaaagaggaagttcttttcgaattagttaaaactaaactt1320
gctgatttaattgataataaactatcagggattgtttttgccttagatgaagataagata1380
tcgtcaactgtagcatcaatgatgttcaattttagtcttttgttatgtttatcaagaaaa1440
gtaaaacttgattgtgaggacttggattcattgaaacaaagatgtttggccctattaaca1500
gaatatgttgcggataggttcaaattcgagagttccaaaccgatcaaaagctctaatgct1560
agtgggttactcgaaacgtcttcaatgacaaatcaactagactcgatcgaattacctggg1620
tacattaatgcaaaaagtgttgtaaaacaagaaccattgaagaaagaacaggacaagagg1680
gcttatattcataatttgaaaacaatttcccgcaattggaataccaatgaaattaataac1740
tcttctggtaatacactaattggtataagttctaagttttcagagacaatactacagaac1800
tttattaattatttatcaagcttaaagtacgaagctagcaacagttcaacgttaacagaa1860
ttggagaatatttttgaattagctgacgataatgacatgattactaaaagtacctctctt1920
tgggttgcttctaattattacaaacgatcaacccttggcaaagtgatcaattttgattta1980
ggaaaatacttggttttagatgatgatgaagatatggaaatagatgatgataccaaagaa2040
atgtcatttttagttttatcaagggcagaagagttacttgaagagatttccgagaaccaa2100
gaaaagtactcttcacaaacttatatcctagcttacaatgcagcattacaatcaattaaa2160
gttgttgctggctcgatcccacttgatcagtttagaaccaattttttgatggatcatttg2220
ttgtcagtatttcaagcattaacgtataatgatatgccagaaatacaattacaggcacag2280
tcgacgttgaaagtggtattggatacatattataatggttcgatggtcaacttgatttct2340
gataatctggattatcttattgacagcataagcttgcagatgtcagtggctagtaattta2400
accccaatgcttccaggtattcttttgatcattgtaaagattgccggaatccaattattg2460
gagtcgaatcaattgcacgatgttttgactgatatgtttgtgatacttgactcctttcat2520
ggttacaataaactcgttgaaagttttttcatagtgtttgaggctttgatagatcagatc2580
catcataagttcgacagtcaacttaaagttgaatttaaggagtcttcgaaaacaaacact2640
tcattgtataagccatggggaatgaccaataaggatcaactattggaactacttaacgag2700
tcaaacaaaatggtcgataaatatgaaggttatgatagtaacaaggagtattttaaaaga2760
aaagctgacttgcctttttcggagatggatgcagattctgatgacgaagaagaggacgat2820
gaagcaaatattgatgacaatggagaagaagaagaagaaaaagaggaaatatggagctca2880
cccgtctcaaaggacatttatatgatttcactacgaatatttaattatggttttacattg2940
gtatcacaggaatcttacacattgaaaacacaaattatcaaaacactaagattgttattg30.00
cctttgctttgcaccaattacaaattattattacctgtattagccttaaattggcagatg3060
ctaattgctttagtgacaggttcaaaatctttatctacaagtattgaaagcaatggtgaa3120
tatgcttcggaagatattggtgtcatgaccgaggcccttcaattggtgactgaaatatta3180
gaagaggataaaaggagatatgaacatttcttcagtaaaaagtttcaggaagcttgggaa3240
ttcatatctcgacactcaaaactagtgcgccaaagagaagtcacatcaacaactaatatt3300
agagaacaaaagcaactagttgtttctgaaaaagcgatatatactttcagaaactatcca3360
ttactaaagacatcactagtaacgtttttaattactggtgtacaaaattatgaaaaaatg3420
atccctgatattcaccgctttgagattatcaaattgtgctatgaattgcaaattcctcaa3480
agtattcctttatctagggatacaatcggcgtactagaagttcttaaaaatacaacgtaa3540
<210> 28
<211> 837
<212> DNA
<213> Candida albicans
<400> 28
atgagcctgttattcattaatgaggaggatgatatgactcccgaaccatataaaccatca 60
acatctacaatcagggaggaagaagaagaagtgcaagtgaaacaagaatttccagacgag 120
aagatggttgatccagatgaagatgatccaatagtcgaatcgataccattacttataaac 180
acagtaccagaaagggcgaaacagtcattacatgttttgcaatatgccggtcgacccaaa 240
tcacgcccaaatagagctggaaattgccatgcctcaataaaaccagaatcacaatatctt 300
caagtgaaagtaccccttgatactgaaaaattctttaacgtcgacaaaattcaagaatgg 360
16
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
ggtgaacaaattgttgaacaaaccattctgggtgtgctagatgggtcttatgaagtagga 420
aactatgctgcaaaaataataaatgacagcgatggaagaagagttgtattgattccagtg 480
gatagtacagtccaattaaaaccttcattcaagtacattgacgatttggaagcccaaagt 540
atccaacaaagaagacaacaagagagtactaatgaaaaaccagcaaatgtccaaatttta 600
caatcagctgctaagcattctactcaatctggagaatttctgcattctttgggagactca 660
ttgaaactggtaaagcattttgaagaagaggaatggcaaaatctaatttggaaaagaggc 720
gatgatgatgtaaccaagagtataaagtttggtttagatcaccacacagatactaatatt 780
gaattaaaaacaaacacttcatatgatgaatacatagacatgttaataaataactga 837
<210> 29
<211> 1479
<212> DNA
<213> Candida albicans
<400>
29
atgaaacaacatccacttgtcacggcatataaaggcattgatgacttgcaacaattgaaa 60
aaatggttttacgagtataatgacacaatagaccatagaaaaaaagcaatatcaaaagta 120
aaaggattgttaaccagagggaaattaccacatggagttgaagccacatcgcttctaaca 180
tccatagttttggatgatttgcaaagaaaagacattgactcttgtgtgttacagttatct 240
tacaccatggctttgattagatttgttaatgggttgttagatccttatcagcagtcaaac 300
tatgccattcctatgcacctattggcaaaacaattgaacctacctacatattttgtagaa 360
ttgcgacacatggggactcatgaaaacttgccaagcctagatatattgagaagtacttgt 420
tcaaaagcattgacttggctttatgacaattattggtgtcatgtggaagaagcaaatcag 480
gataaacaagtttctattggggggccattgactgatgccgttgaatttcgaagtaatgat 540
ctaaggacaagaattgaagattctcagatttacaataatttgaaagcgttcaagcgaata 600
cggaaacaagatctaaacaaggtttacgagaagaatgatacaacgagcgatttagctgcg 660
acatatcataggtgtgttctggacatagtcgaatttgctaaagaaaattgtgatttatta 720
gtgaatgttttattgctcaagaattaccttatatacccttcttcaaaagtcaaagataag 780
aaactgaaattcaatcccttgattataaaattgtatgaaccattatttgacgcattgggg 840
ttgtcatttaaactcaaatgtttttccaagactatcgaattgattgaggcgaccccttca 900
agttttgtggacaagaaggtatatcgaaagcttggttttactgaaaagtttgagtatgac 960
gaactcttccaagtaatggaatgggtgttatatttcatgcaagaccttttgagaaacgaa 1020
aatgttcccctgccagtccacaacaagaatgagttggtaatcttatttttggacagtctc 1080
aaactgatagaacaaaagatatcacaatcacttttgcctagttttgcaaaaatcttgcaa 1140
ggtctttgtgacgtggtgaacgatggagttaaatctgaaattgatccagaaactgtacaa 1200
aagttggatgcttggaataaactgcttaataacctacatagtacaaagaagatttttgag 1260
ttgccaccatccttggacgatttattaggattatcgccgtcgcctggtccaatcccagag 1320
acaacttccagcaacccaatgaaacatgtcttagatgatgatgatgatgaagaggaagaa 1380
ggtgttcgtagaaagcagcaccactcgagtgatagtaaaacctatattttgaaaccccat 1440
aagaattggaggcccgttccttttgggacatgtatttag 1479
<210> 30
<211> 1230
<212> DNA
<213> Candida albicans
<400>
30
atgacttcactgatcaatattttattattacttcatccaacagtagtcactgatgcccaa 60
ttagtagaacaaatcaaactgaaaatttatcaatcacataataacaataacaacaacaat 120
ggtggcactacaacgacgacaacaggaacagtgaatatcaatcttaatcaacaaataata 180
gatagagtcactaaagggatcattgaattaccatatgattattatgatgaaataatatat 240
attaacccaaataatgaatctcaatatcgagaaattcctattctgttaatgcaattaatt 300
tataaattattgaaatcaaatgggaaatttaaaggtgatttaccattagatcaaaattta 360
gatgttttaatgacaggatttataatagaagaagaagaaaaagaaaaagaaaaagaagaa 420
aacaatcttgaaggtgaattagttaatgtatgggttaaaccaatacctgttgatgaacca 480
gtggtgacattattgaaaaagaaaacaactactagtaatactactaccataaaaaaatca 540
ttgccgttatttaaaaaactaaataaagatgaaattaataattctgataaagatattaac 600
aatgataatataactaataataataataataataataataaaagaaaattggtggagaca 660
17
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
aaattaacttattttagtagtgatgatgaaaatagttctgatggatcagttttggagaat720
gatgacattgatgatgatgatgaacttatagatgaaaatgatttacttaactttaacaac780
aacaacaacacaaatggtgggagtttattatctgataaattaattacaccaagaaaatgt840
gatatatcattaaatggaggtaaaaaaagaaaaaaagcttgtaaagattgtacttgtgga900
ttaaaagaattggaagaattagaagtatcaaatcaacaaaatttacaagatcaaatttta960
ggtaaattggctcaatcagcaactttagaagctataaaaattgaagaaagattaaaacag1020
caacaacaacaacaacaacagaaagttaaagttaaatttactgaagaagatttatcagaa1080
atagatttcaccgtacaaggtaaaactggtggttgtggactgtgtgctcttggtgatgca1140
tttagatgtgatggatgtccttatttaggattaccaccttttaaacctggtgaagttgtt1200
aaattagatggatttggtgaagatatctaa 1230
<210> 31
<211> 984
<212> DNA
<213> Candida albicans
<400>
31
atgattaggacgatcaaaccaaagaatgctcgttctaaaagagcattagctaaaaaggaa 60
gctaaattagttgaaaacaccaaatcagcattatttgttccaggttcaacggggaataaa 120
tttttacatgatgccatgtgtgatttaatggcatttaaaaaaccatttgccaaaaaattt 180
tccaaaaaaaatgaaattagaccatttgaagattctagtcaattagaattttttgcagaa 240
aagaatgattcatcattaatggtattttcatcaaataataaaaaaagaccaaagacttta 300
acgtttgtaagatttttcaattttaaagtttatgatatgattggattatcaatacaagaa 360
aatcataaattattacaagattttaaaaaattaacatttacaattggattaaaaccaatg 420
tttgtttttaatggtccaatttttgatagtcatccagtttatcaacatattaaatcttta 480
tttcttgattttttccgtggtgaagaaactgatttacaagatgttgctgggttacaatat 540
gtgattgccttatctgctggagaagtcgaagatttaaataatgataaagtattaccatta 600
gttcatttcagagtgtataaattgaaatcttataaatcaggtcaaaaattaccaagaatt 660
gaattggatgaaattggtcctcgttttgattttaaaattggtagaagaattactcctact 720
ccagatgttgaaaaagaagctactaaaaaaccaaaacaattggaagctaaagtcaaaaag 780
aatgtcactaccgatttcatgggtgataaagttgctcaaatacatgtgggtaaacaagat 840
ttgagtaaattacaaacaagaaagatgaaaggattgaaagaaaaatacgatcaagaaagt 900
gaagaagaagatgtgtatgtttctgatgaagagtactttggtgaagatatagaagaacca 960
gagactaaaagacaaaaagtatag 984
<210> 32
<211> 378
<212> DNA
<213> Candida albicans
<400> 32
atgctgaaaacaaatactgctatataccaaaagattgctgaaaaaagagcaaacttggaa 60
cgatttagggaatttaaagaattgacagatgatttggttttacaactagagtctataggt 120
gacaaattagagacgatgaatggaggaactgccagtgtagcattaattttagcaaactgg 180
aagagtgtggtacaatctatttcattagcatctctagctttaatgaaagagtctaatgat 240
aataacaaag~aggctttccctgaaccattagtaagagtgcgtgttggacaatcaaatgaa 300
gaaaatcaagacgatgaagaagcagatgaagaagaaggtgttagagatagtgaagaagtt 360
gaagaatccacggaataa 378
<210> 33
<211> 3363
<212> DNA
<213> Candida albicans
<400> 33
atggattacc aagatctact acataaaata ataaaggagt tccactcact caaagagttc 60
aaaccatggg atagcagtgt tttgtatgag acgttacttc gatcagtatt aactactttg 120
atcgaacttt tgggcataga caatccaccc agttatctac acctcaccac caacaatgat 180
18
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
agtataggtgatttgaaaataaaatactatggaaatgcattaagcaagtcaatcaacggt 240
catagcatgttgcaatatcttgaatcaaagcatgtatcgatattacaggccgtggttgag 300
attattaatacgcgatcatatagaatcaaagagtcttattctgctgttttcaaagacgtt 360
tctcatttatttgaaaaactactaaaggaaagatatgaagctgaatctaatctagaggat 420
tatatattgcagtgcttgatgtacgagacccaattttaccaaggaattgttgataatgtt 480
ttaactgccgatgacaccgaaaaattggctagttttttggggacacgactatctgaagaa 540
gattcgatgtttagctatagggatatagattatccactagagttaaacattaataatgaa 600
tctcttgaaaagatatataaaattttcttaggagtcattggcaccaaaagattcgatatc 660
aaggaggttgcgtctgctgttgttggtgtgtataaacgacaccagagaatagatcatttt 720
gaaaagttggattcagatgagattttgggaaagtttttcagaaatatattgccacaactg 780
ttccagagtgtgacaaataaggttttccgggaatttcacaaagaggtagatgacccacca 840
tcggacgtgctagaccagctagataatattgttgatgactttattgcggttggaattgaa 900
ggggtagatttgggctttccggctttgttcagacactacataaaattcatgaacgaaatt 960
tttcccactgtggtcgaggatgctgaccgcgattttgttgcaagaattaatagtttaatt 1020
gctcaagtcttggagtttaaagacgatgaaaaatcctgtgatatcaatcaagtggtatct 1080
gaatttgtttcattacaaagtttgctacttaagaataactatctttcaccatctacatta 1140
ttgatgcgtgcaagtactcacgattactataaaaatttacagatcgtgaaaataaccttt 1200
gatggatggaatgagaattcaaagaggatattgaaattggagaacagcggctttttacaa 1260
agcaagacattgccaaagtatttaaaattatggtactcaaaaagtatgaagttgaatgaa 1320
ttatgtaaccgggtagatgaattttataatggagaactttgtcggaaagtttggcattgt 1380
tggaggtcacaacaaaatgtctataatctcaaaatggaggttgctgacaaacgtctccta 1440
aatcaatattatatcaaatggcggaaaaaagagaaggatatgaaagccaatcttactata 1500
gctgttgaatttgatcattttcatttattggataaaagctttaagatattgaaagggtac 1560
ttcaacttggccaaaaacagtgatgtcctcgcaatgtctctatttcagtcatttgaggag 1620
aatcgcgacagccgtatcaagttgaagtattttcaatactggaatctaaaaatatctgat 1680
agagtacacggcttgactatgaaattagagaagtttcaccaagttaaggacaaatttgta 1740
ttaggaaattattttgaaacatggtattataaacataatctcgttgaaaagtctaacaat 1800
ttcgtttctgctaaagatttgcagttattggcgaaaacttttaccaatacatggctaaag 1860
aaattcttgctatacaagaaagcattcaaaattgaagaagagcttggcgctgatttaaaa 1920
aggaaaacttttgatagatggaaggaggctgtccaacttgaagtcaaggcaaaggagttt 1980
cacgagcgacatcttctagagactgcatttcatgaatggaagttgaaactgattttgata 2040
agtaacagggcttcatttgatcatattttggtacagcgttgctttcaaacttggtccgtg 2100
gaaataaaacttcgagaactacagcaaaaacaagatactcgtttggtagtgaacattttt 2160
caaaaatggagaaccaggcaactcgagctagcaaaacttgacgaaaagtctcaggcattt 2220
tatgaatcaaatatgaaacatttggtagtgcaaaaatggaatgtcgaaaacagtaatatt 2280
ggactattagagaaacgagcagatcgatttttcattcgaagatttttcatccagaaatgg 2340
caatcaaaaatgacaaagtatgaggacatcactgtttatcacttggaagatgaaattgcc 2400
acaaaattagcctacaaagtatggaggcagagatattttgaaaactacgaagaaaagttg 2460
gataacttacttgaaacaatggataccagtgcagcagatactgtacgctgttcgcgatat 2520
ttcggtctatggcgggccaaattgcagaccgtgaagcaaattgaagaacgcgtatctacg 2580
tctgtagcacctagtgttgcaatacattttaaaaactggcacgtcaagagccagcagaag 2640
caagagttattggaaaatgccttgcagtttgaagaaataaacttgtcgcgttttcttctc 2700
atttggtttcagcgtctacaagaagtgagtcagttggaagatcaggcagaggacttattg 2760
gctcaaactaatttcaatttactacgtaatgctgttcataaatggtctatgctctacaac 2820
aaaaacatcaagcgacataaacaattgtgtgaggattttatagcaagaaaagagacggca 2880
aaagtcagatctatttttgatttatggctatacaagatcaaagaaatcgaagccaatacc 2940
accatcataagcaatccttcacctctttccaaaagatttcagcatcaaagagagatgggc 3000
ttgacccctcaaaagaaaaactctcctaccaaagtttttacccccaccacttccaaagat 3060
ccgagtccaactaaactccaagaaactacccaaagaatgagaaaccagaacattagtgct 3120
ttgagggagcattttggaagggcacgggcatcgtctacacctaaaaagttatctcctgtc 3180
cggctctcgtatactaatattccttccaatcttcggccgcaactgccaccaaaattcgat 3240
gattcagatattgctactgccaagagtttgggtcgtatcagacccatggtgtttccaata 3300
gatgatcaagcaaatttttcacctatggatagaacaaaattacaatctagaaatgctatg 3360
tag 3363
<210> 34
<211> 2238
<212> DNA
19
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Candida albicans
<400> 34
atggctaaacgaaaaagtaaacaacaagatttagaaaaaaagaagaaacttaaacaaagt 60
caagatgaacaattatctacgggattgttcaataatgttggacagggacaacaccaaggg 120
gatgatgacgatgaagaaggtgatgaaatagattgggataatcaagagatggattatgaa 180
ttaataccaaggaaaatcaccaccaagaaaacaattgaagcattaccaattaaaaaatcc 240
gacgggactatagaaagagttgttagagaagttgaagaagaagaagaggaagaggaagag 300
gaagagcctgaagaagagcctgaattagaaaatgatgttgaaaatgaaccatcaaaacaa 360
gaaaacaaagaaaataaagaggagggggatattgataccgacgacacattaacaccacaa 420
gaaaagttaattcaaacaaaagaagaaattgcagaattaggatcaaaattaattgaagat 480
cctgaagaaaatatagtttgtcttactagattaagaaaaatgtctgaatcgaaaaatttc 540
atgacatctcaattatcaatattagcattaataccaatttttaaatctcttgctccatct 600
tataagataagaccattaactgatactgaaaaaagagaaaaagttagtcgtgaaatagct 660
aaattaagaaattttgaacaaaatttagtgataaattataaagcttacattgaattatta 720
acaaaatatctgaaaatatcatattcaaattctatgaataataataaaatcactagtgat 780
caattgaaacgaggcaatattgctttaaaagcagccactgaactttgtttaagttcatta 840
agacattttaatttccgagaagaattatttactattattattaaacgattaaataaaaaa 900
cctcaacatcaacaagattatccaatatttataaaatctttaagagttttagaaacttta 960
ttaaaagatgatgctgaacatggagatattacttttgatataataaaaatcatgacaaaa 1020
tcaattaaagataaaaaattccgagttgatgaatcagttgttaatgtttttttatcaatt 1080
tcattattagaagattatgatcctaataataataataataataaagatgatcatcacaac 1140
accactttaaaaccaaaattaaaaaaaaaggatcgaattcatttatctaaaaaagaacgg 1200
aaagctcgtaaagaaagaaaagaaattgaagaagaaatacaaaaggctgaacaagccatc 1260
actgttgaacaacgagaaaaatatcaagctcaagtattaaaaatggtattaactttatat 1320
ctagaaatattaaaagcagggtcgtctagttcacaattaattgatggtgatggtaaaaaa 1380
actaaaaatgatgctagtttgttaatgggggcggttttagaaggattatcaagatttggt 1440
caaatgtcaaatttagatttattaggtgattttttggaagtattaagagaaattatgacc 1500
gatatcattgaagaacataaacaaagtggtgataatgataatgataatgataatgatgat 1560
gaaagtggggggatgtatagtgggaatgaattaagaacaatattattatgtattgccaca 1620
tcattttcattagtattaaatcataattctatggggaaattacctatggcaatagattta 1680
agtaaatttgtttccacattatatattattttaaccgatttggcattagatcctgattta 1740
gaatttagtcataaaacattaagattagctgatccattatcatcatcatcattatcaaat 1800
gaattagagaataataaaccagcagttaatgtttcaactaaagcagaattattattaaga 1860
tgtcttgattttatttttttccgatcgaaaaatggtactatacctcgagcaacagcattt 1920
attaaacgattatatatattaacattacaaacaccagagaaaactagtttggccaatttg 1980
aaatttattggtaaattaatgaatagatatggtgaaaatattaaaggattatggaacacc 2040
gaagaaagaattagtggtgaaggaaattatattttaggaattgaacgacaaaataaagat 2100
aaagatgttgaattagaacgaagtaatagtggtgcagcaacattatgggaaaatgtatta 2160
ttagataaacattattcaataatgattaaagatggttcaaggtcgttaatgaaaaatagt 2220
aaagccaacaccaattga 2238
<210> 35
<211> 1740
<212> DNA
<213> Candida albicans
<400> 35
atgtatataaccccgaaccaatatgcaaagacgttccaagatataaaacgctcatcatta 60
tctcactccacctgtaaacttgttatatttgtttcttgcttagatgtggatgcattatgt 120
gctgccaaaattttgagtttacttttaagaaaagaattaatccaatatcaattaattcct 180
acaacaggatactcggatttaaaattgcattatgataagttggatagtgaggtcacaaat 240
ataatactaattggatgtggtgccatgttggatttagaaggatttttcgatgtcaatcca 300
gaagagtttttaggtgataattctactaccaatggccacacaatagataacgacactgaa 360
ttagaactagatgcagtgaaaactgacaattttgccttgacaagaaaaatctatgttgta 420
gatggacacagaccgtggaatttggataatttatttgggtcggccatggttgtttgtttg 480
gataatgggtatattgatgggaacttgaacgaagaaaaggaagcatacaatgtgttggta 540
gaaatgagtatagtgaagag gatgaagggcacaaccagaacggtcatact 600
cgaagatgaa
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gatgatgaccaagagggagacaaaactgatgctgatgatgaaaatgacgaatcaagtgtt 660
tcaacatcacgcaaaggagttaaatccatcaatgaagataagattcagacatattacaac 720
cagtcatcaacaatagcaagctcatgctcgataacagtttatgcattagttagtgccatc 780
ggtgagaccaatgttgacaacttatggttaggcattgtcggtgccagtggatttgattgt 840
tctatatttgtcgacgaagtgaggcgtttctcgaccgattctggtattcatatggaacgt 900
gggacgtaccttccgttgttgcgacattcttctctttacgatgccttgctttataactgg 960
attgacggtgacaagagaatacacaagattcttgcaaaaatgggtgttccgattgttgct 1020
gcaaaacaacaatggcaatatttagatccaccaatcaagaacaaactacctggattattg 1080
aagaaatatctacctgaactcccacaagttgaaatattttaccgatgtggtgtcacgtcc 1140
atggacgtgtttgtttcattaactgcattattagagaccggggttggtctcaacaatact 1200
agtgctaatagtattgaccatggtgaccttgaagatgaaaatgaactaattcgaagagaa 1260
attaaaagcagagagtcaagctacattcgaaatttttggtcagcctttgattcagtaagt 1320
tcttttgggatttccaacaacattggattagaaaagggaataacagcagcaaaattggtt 1380
caaaaagaattattccaaactatcaaatacataattgaacaaaaattaattaaaaattta 1440
aaagtttatcgactttgcattttaaaagatgagtcctcgcatctgggttttgataatcca 1500
gtattgttaattaaattgtctaatcgtatcatggattatttaaaacaacaaacactgaaa 1560
cctttagtggtagcagcagaactttccaatacatatttcgttttgggtatgggaattaac 1620
aatgcattttctaaaatttctggtgcccaaatgaagaaggatttctttgaagcatcatta 1680
gtggaaattaaaaaggaagatttggctccatttttggaacagttgaccttcaatttataa 1740
<210> 36
<211> 5694
<212> DNA
<213> Candida albicans
<400>
36
atgtcgtataacgataataataatcattattacgaccctaatcaacagggcggtatgcca 60
cctcatcaaggaggagaagggtattaccaacaacagtatgatgatatgggtcaacaacca 120
caccaacaagattattacgatccaaatgctcaatatcaacaacaaccatatgacatggat 180
ggatatcaagaccaagccaactatggtggtcaaccaatgaatgcccagggttataatgct 240
gacccagaagccttttctgactttagttatggtggtcaaactcctggaactcctggttat 300
gatcaatacggtactcaatacaccccatctcaaatgagttatggtggtgatccaagatct 360
tctggtgcttcaacaccaatttatggtggtcaaggtcaaggttacgatccaactcaattc 420
aatatgtcatcgaacttgccatatccagcttggtctgctgatcctcaagctccaattaag 480
attgaacacatcgaagatattttcattgatttgactaataaatttggtttccaaagagat 540
tctatgagaaacatgtttgattactttatgacattgttggactcgagatcttcccgtatg 600
tcaccagctcaggccttgttgagtttacatgctgattatattggtggtgacaatgccaat 660
tatagaaaatggtatttttcttcacaacaagatttggatgattccttaggttttgctaat 720
atgactttaggtaaaattggtagaaaagccagaaaagcttccaagaaatccaaaaaagct 780
agaaaagctgctgaagaacatggtcaagatgtcgatgctcttgctaatgaattagaaggt 840
gattattcattggaagccgctgaaatcagatggaaagccaagatgaactctttgactcca 900
gaagaaagagtaagagaccttgctctttatttgttgatatggggtgaagccaatcaagtt 960
cgttttactcctgaatgtttgtgttacatttacaaatctgccactgattatttaaattct 1020
ccattgtgtcaacaaagacaagaaccagtgcctgaaggtgattacttgaaccgtgtgatc 1080
actccactttacagattcatcagatctcaagtttatgaaatttatgatggaagatttgtc 1140
aagcgtgaaaaagaccacaacaaggtcattggttatgatgatgtcaatcaattgttttgg 1200
tacccagaaggtatttccagaattatttttgaagatggaaccagattggttgatatccct 1260
caagaagaacgtttcttgaaattaggtgaagttgaatggaagaatgttttcttcaaaact 1320
tataaggaaatcagaacctggttgcatttcgttaccaattttaatagaatctggattatc 1380
catggtaccatctactggatgtacactgcttacaactccccaaccttgtatactaaacat 1440
tatgtccaaaccataaatcaacaaccacttgcttcgtcaagatgggctgcttgtgccatt 1500
ggtggtgttcttgcttcatttattcaaattcttgccacacttttcgaatggattttcgtg 1560
cctagagaatgggccggtgctcaacatttgagtcgtcgtatgctatttttggtgttaatt 1620
ttcttactcaatttggttccaccagtttatacattccaaattaccaaattggtgatttat 1680
tcgaaatcggcatatgctgtgtcgattgttggatttttcattgctgtggccactttagta 1740
ttctttgccgtcatgccattgggtggtttattcacttcatacatgaacaagagatcaaga 1800
agatatattgcatcacaaacatttactgccaactacattaaattgaaaggtttagatatg ~
1860
tggatgtcttatttgttatggtttttggttttccttgccaaattggttgaatcttatttc 1920
21
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
ttctcgactt agaaacttgtcgaccatgac 1980
tgtctttaag aatgagatgt
agatcctatt
gttggtgaag tgtagaaaccaagccaagat 2040
tttggtacaa tgtcttgggg
agatattgtt
ttgatgtatcttgttgatttgttattgttctttttggatacttatatgtg 2100
gtacattatt
tgtaactgta tggtcgttcattctatttgggtatttccattttgactcct2160
tcttctccat
tggagaaacattttcaccag agaatttattccaagattttagctaccacg2220
attgccaaag
gaaatggaaatcaaatataaacctaaagttttgatttcacaaatttggaatgccattgtt2280
atttccatgtacagagaacatttgttagccattgatcacgttcaaaaattattgtatcat2340
caagttccatctgaaattgaaggcaagagaactttgagagctccaactttctttgtttct2400
caagatgacaacaattttgaaacggaatttttcccaagaaattctgaagctgaaagaaga2460
atttcatttttcgctcaatctttggctacaccaatgccagaaccattaccagttgataat2520
atgccaacttttactgttttcactcctcattattcggaaaagattttgttatctttgaga2580
gaaatcattagagaagatgatcaattctcaagagtgacattattggaatatttgaaacaa2640
ttacatccagttgaatgggattgttttgttaaggacaccaagattttggctgaagaaact2700
gctgcttatgaaaatggtgatgattctgaaaaattatctgaagatggattgaaatccaag2760
attgatgatttaccattctattgtattggtttcaagtctgccgcccctgaatatacttta2820
agaacaagaatttgggcttcattgagatcccaaactttgtacagaactgtatctgggttt2880
atgaattatgccagagccattaaattgttatacagagtggaaaacccagaattggttcaa2940
tatttcggtggtgaccctgaaggattagaattagctttagaaagaatggccagaagaaag3000
tttagatttttggtttctatgcaaagattgtctaaattcaaagatgatgaaatggaaaat3060
gctgagttcttattgcgtgcttaccctgatttgcaaattgcttacttggatgaagaaccg3120
gctttgaatgaggacgaggaaccaagagtatactctgccttgattgatggtcattgtgaa3180
atgttagaaaatggtagacgtcgtcctaaattcagagttcaattgtctggtaatccaatt3240
ttgggtgatggtaaatctgataatcaaaatcatgcggttattttccatagaggtgaatat3300
attcaattgattgatgctaatcaagataattatttggaagaatgtttgaagattagatca3360
gttttggctgaatttgaagaaatgaatgttgaacatgttaatccatatgcaccaaatttg3420
aaatctgaagataataacaccaagaaggatccagtggcatttttgggtgctagagaatat3480
attttctcagaaaattctggtgttttgggtgatgttgctgctggtaaagaacaaactttt3540
ggtacattgtttgcaagaactttggcacaaattggaggtaaattgcattatggtcatccg3600
gattttttgaatgctacatttatgttaactagaggtggtgtttctaaagcacaaaagggt3660
ttacatttgaatgaagatatttatgctggtatgaatgccatgatgagaggtggtaaaatc3720
aagcattgtgaatattatcaatgtggtaaaggtagagatttaggttttggatccattttg3780
aatttcaccaccaagattggtgctggtatgggagaacaaatgctttcaagagaatatttc3840
tatttgggtactcaacttccattggatagatttttgtcattttactatggtcatccaggt3900
ttccatattaataacttgtttattcaattgtctttacaagtgtttattttggtgttgggt3960
aacttgaattcattagctcatgaagctatcatgtgttcttacaacaaagatgtcccagtt4020
actgatgttttgtatccatttggttgttacaatattgctcctgccgttgattggattaga4080
cgttatactttgtctattttcattgttttcttcatttctttcattccattggttgtacaa4140
gaattgattgaaagaggggtatggaaagcgttccaaagatttgttagacattttatttcc4200
atgtcaccatttttcgaagttttcgttgcccaaatttattcatcatcggttttcactgat4260
ttgaccgttggtggtgctagatatatttccactggtagaggttttgccacttcaagaatt4320
ccattttcaatcttgtattcacgttttgctgattcatccatttatatgggagcaagattg4380
atgttgattttattatttggtacagtttctcattggcaagcaccattattatggttctgg4440
gcttcattatcggctttaatgttctccccattcattttcaatcctcatcaatttgcttgg4500
gaagactttttccttgattacagagatttcattagatggttatctagaggtaacactaaa4560
tggcacagaaactcatggattggttatgttagactttctagatcacgtatcactggtttc4620
aaacgtaagttgactggtgatgtttctgaaaaagctgctggtgatgcttcaagagctcat4680
agatccaatgttttgtttgctgatttcttaccaacattgatttatactgctggtctttat4740
gttgcttatacttttattaatgctcaaactggggttactagttatccatatgaaatcaat4800
ggatctactgatccacaaccagttaattctactttgagacttattatttgtgctttagct4860
ccagttgttattgatatgggatgtttaggtgtttgtcttgccatggcatgttgtgctggt4920
ccaatgttaggattatgttgtaaaaagactggtgctgttattgctggtgttgcccatggt4980
gttgccgtcattgttcatattattttctttattgttatgtgggtcactgaaggtttcaat5040
tttgccagattaatgttgggtattgccaccatgatttatgttcaaagattattattcaag5100
tttttgacattatgtttcttgactagagaatttaagaatgataaagccaatactgctttc5160
tggactggtaaatggtataatactggtatg cttttactcaaccatctcgt5220
ggatggatgg
gaatttgttgctaaaatcattgaaatgtcg gtgatttcgttttggcacat5280
gaatttgctg
attatattattctgtcaattaccattattg tagttgatagatggcattca5340
tttattccat
atgatgttattctggttgaaaccatcaaga caccaatttattctttgaaa5400
ttgattagac
22
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
caagccagattaagaaagagaatggtgagaaaatattgtgttttatattttgccgtgttg 5460
atattatttattgtcattattgttgcaccagcagttgcttcgggacaaattgctgttgat 5520
caatttgccaatattggtggatctggttctattgctgatggattattccaaccaagaaat 5580
gtcagtaataatgatactggtaatcatagaccaaaaacctacacttggagttatttgagt 5640
actcgttttactggaagtaccaccccttattctacaaatccattcagagtttaa 5694
<210> 37
<211> 1203
<212> DNA
<213> Candida albicans
<400>
37
atgtctttcagaactacttccatgagaatggctagattagccactgccaaagctactttg 60
tccaagagaaccttctccttattggccaatgctaccaccagatacactgctgcttcatct 120
gctgctaaagctatgactccaatcacctcaatccgtggtgttaaaaccatcaactttggt 180
ggtaccgaagaagttgtccacgaaagagctgattggccaaaggaaagattattagactat 240
ttcaaaaacgacacctttgctttaattggttacggttcccaaggttacggtcaaggttta 300
aacttgagagataacggtttaaacgttattattggtgttagaaaaggttcttcttgggaa 360
gctgccgttgaagatggttgggttccaggtgaaaacttgtttgaagttgacgaagctatt 420
tctagaggtaccatcattatggacttgttatcagatgctgctcaatctgaaacctggttt 480
cacattaaaccacaattgactgaaggtaaaaccttgtacttctcccacggtttctcccca 540
gttttcaaagacttgactcacgttgaaccaccatcaaacattgatgtcatcttggctgct 600
ccaaaaggttctggtagaactgtcagatctttattcaaagaaggtagaggtatcaactcc 660
tcatacgctgtctggaacgatgttaccggtaaagctgaagaaaaagctattgccatggcc 720
attgctattggttctggttatgtttacaagaccactttcgaaagagaagtcaactccgat 780
ttatatggtgaacgtggttgtcttatgggtggtatccacggtatgttcttggctcaatac 840
gaagtcttgagagaaaacggtcacactccatctgaagctttcaatgaaaccgttgaagaa 900
gctactcaatcattgtacccattgattggtaaatacggtatggactacatgtacgatgct 960
tgttccactactgccagaagaggtgctttggactggtacccaagattcaaagatgctttg 1020
aaaccagttttcgaagaattgtacgaatctgttaagaacggttctgaaaccaagagatct 1080
ttggaattcaactctagatctgattacaaagaaagattagaagaagaattacaaactatc 1140
agaaatatggaaatctggagagttggtaaagaagttagaaaattgcgtccagaaaaccaa 1200
tag 1203
<210> 38
<211> 837
<212> DNA
<213> Candida albicans
<400>
38
atgttcaaacaatccatacgtagtctagctaccaagtcaccaatttcaagtgctgctgcc 60
acgaccaccaccgctagtaccaccagcactaccaccacagcttccttgaattttgcaaaa 120
ccaccatcttatacattagctcaattacgtgaattcccaagtttagaaccaaaaacattt 180
attccattaccaacgacatttttcaacaccgaaaaacctattcgtagagatatattatgg 240
agttgtgttacatatgaagccgataaggcccgagtaggatcaaattatgcaattttaaaa 300
tcggattcaccttattctaatcgtaaattacgtcctcaaaaaggttcaggtcgtgctcgt 360
ttaggtgatgccaattctccacatatggataatgaaattaaagctcatgctataaaggga 420
cctcatgattggagtactgatttacctagtaaaatatattctcgtggtattcaaaatgct 480
tttactatgcattataaacaaggaaatttaaatgttgttgaaaatgaattagatttccaa 540
tatggatatgatattataactcaactgtttgtttcagtgcataatttgaataaattgaat 600
ttattatttataactaatgaaccaagagataatttaatggaaagtattaaaaaattctac 660
attaatgaaaaagaatttaattcattaaataaaaaggaaaaaccaaaatatttacagaaa 720
ttaaaaggcaaagtattgacaaaggaagatgttgaagttagagatatattaagagctcat 780
agagtattcattgaatcttctgctttacaatggttcatcactaaacatactgtttaa 837
<210> 39
23
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 1347
<212> DNA
<213> Candida albicans
<400>
39
atgagagaagtcatcagtattaatgttggtcaagccgggtgtcaaattggtaacgcctgt60
tgggaattgtattcacaggaacatggtattagaccagatgggtatttacaagaaggttta120
gacagaccaaagggaggagaagaaggtttttctacttttttcagtgaaactggttcaggt180
aaatacgttcctcgtgccttgtatgttgatttggaaccaaatgtcattgatgaagttcgt240
actggtgtttacaaagatttattccaccctgaacaattgattgccggtaaagaagatgcc300
gccaataatt atgctagaggtcactacactgttggaagagaaattttagacgacatttta 360
gatagagtca gaagaatgagtgatcaatgtgacggattacaaggtttccttttcacccac 420
tctttgggtg gtggtaccggttccggtttgggttctttgttattggaacaattatctttg 480
gattacggta aaaaatccaaattggaatttgctgtttacccagctccacaagtgtccact 540
tcagttgttg aaccatataatactgtgttgactacccacaccactttggaacacgccgat 600
tgtactttta tggttgataatgaagccatctacgatatgtgtagaagaaacttggatatt 660
gccagaccaa attttagttcattgaacaacttgattgctcaagttgtgtcatccgttacc 720
gcctctttga gatttgacggttccttgaatgttgatttgaatgaattccaaactaacttg 780
gttccatacc caagaatccatttcccattggtcagttatgctccagttttctccaagagt 840
agagctaccc atgaagccaactctgtttctgaaattactcaatcttgttttgaaccaggt 900
aaccaaatgg tcaaatgtgacccaagaactggtaaatacatggccacctgtttgttatac 960
cgtggtgatg ttgttactagagacgttcaaaatgctgttgctcaagttaaatctaaaaag 1020
actgttcaat tagtcgattggtgtccaactggtttcaagattggtatctgttaccaacca 1080
ccaactgcca ttaagggatctgaattggccagtgcttctagagctgtttgtatgttgtct 1140
aacactactg ccattgctgaagcttggagaagaattgacagaaaattcgacttgatgtac 1200
tctaagagag cctttgttcactggtacgttggtgaaggtatggaagaaggtgaattcact 1260
gaagctagag aagacttggctgctttagagagagattatattgaagttggtactgattct 1320
ttccctgaag aagaagaagaatattag 1347
<210> 40
<211> 828
<212> DNA
<213> Candida albicans
<400>
40
atgaaaacgtcagtatttatagcaatcttcaatttacttgtttgcgctcttgcgtacaca 60
gacttgacaggatcaattaaaatcaatgacaaaaagattacccttggtgagttcaatact 120
caagaagttaaacaattgacaatcaattctccaaaggatataatagaaattgacttaaaa 180
agtaaagatatcaagggtaaacctgagcagattatggttagtttggcagatgtcaaaaac 240
ccagctatttctacgcattatgttcctgtggtcaaagaatcgaaaatcaagttgaacatc 300
aaagcactttcaatcccggaagttttgaaaactaaagacaaattagttttgactattgta 360
attgccgactcaaaatcaaagaataacatgattagaagattggttgaagttttgccaagt 420
cccgagtttaagagtacaagcaggtaccaggctaaaccaagaattggaatacaaccagag 480
atccatcacattttcagagaggatgagaggactgttaacccaattgtgccagttgtattt 540
ataattgcagcttttactttacttcttggtttgtttggctcgtgggttggttttattgga 600
attgataatttatttagaacgttcaagactattagtaaagttcaattgttacacaacgtt 660
agctttttgatttcagttttggggtttgaattgaattttgtcaagtactatttgggtcaa 720
tcaattttcaccactttgttttacggatttattttgagcattccatgtgtttactttgga 780
gtcagcgttttgagaagtttagcaaaaaaccgtgctttaggcaagtaa 828
<210> 41
<211> 582
<212> DNA
<213> Candida albicans
<400> 41
atgctaatgt acaccatcct tataccaagc cttttataca ttgctttgac aatcgcatca 60
24
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tccgagttattgaattccatacagggaacatggcaaagtcaaagtgaacgagtaattact 120
ggaccaactttttttgatccccagaaggaattgctagaagaacctaagctaccaggtata 180
tcatattcatttaaaaatggatactgggaactggcacaatatattgtcatggggaataat 240
agaaaccaccaatgtcctcaagcaatgttaatttggcaacatgggaaatataatttaaaa 300
cgaggaaaacttgtgcttattcccaatagaaatgacggtcgacaattaatcagcgatcct 360
tgtttggataatggtaaatctgaatataaaaggtttcataacggagaaacattagaagtt 420
gatattagatttgatggatattttggtaattggaagttggttttggtagattatcttaca 480
ggtaaaaagaagcaaccaatgtggttgacactgagaaatgccacaatgttgcccacagga 540
accataacctctacaaagaggaaatatgttaaaaaagagtag 582
<210> 42
<211> 1299
<212> DNA
<213> Candida albicans
<400>
42
atgtcaaaagcatttagtgcacctggaaaagcatttcttgctggtggatatttggttctt60
gagccaatttatgatgcttatgtgacagcattgtcatcacgaatgcatgcagttataaca120
ccaaaaggaaccagtttgaaagaatctagaatcaaaatttcttcaccccaatttgcaaac180
ggagaatgggaatatcacatatcatcaaatacagaaaaacccaaagaagttcagtcacgc240
ataaatccatttttagaggcaactatattcatcgttttagcttatattcaaccgaccgaa300
gcatttgatcttgaaatcattatttactcggaccctggatatcattcacaagaagatact360
gaaaccaagacatcctcgaatggagaaaaaacttttctttaccattctcgtgccattacc420
gaagtggaaaagaccggattaggttcatcggcaggattagtgtcagttgttgccacaagt480
ttattatcccattttatccccaatgttatcagtacgaataaagatattttgcacaacgtt540
gcacagattgcacattgttatgcccaaaaaaagataggatctgggtttgatgttgcaact600
gcaatttatggtctgattgtatatagaagatttcagccagctttgataaatgacgtgttt660
caggttctagaaagtgatcctgagaagttccccacagagttgaaaaaattgattgcaagt720
aactgggaattcaaacatgaaagatgtacattaccacacggaatcaagttattaatgggt780
gacgtcaagggtggctcagaaacacccaaattggtatcacgagtactccaatggaaaaag840
gaaaagccagaagaaagctctgttgtgtatgaccagcttaatagtgccaatttacagttt900
atgaaggaattgagggaaatgcgtgaaaaatacgactcagacccagagacttatattaaa960
gagttagatcattctgttgagcctttgactgttgcgattaagaacatcagaaaagggtta1020
caagcattaacacaaaaatcagaggttccaattgaacctgatgtccaaacccagttgttg1080
gaccgttgtcaagagattcctggttgtgttggtggtgtggttccaggtgctggtggatac1140
gatgcaatagctgtattagtgttggaaaatcaagtgggaaattttaagcagaaaactctt1200
gaaaatccagattattttcataatgtttactgggttgatttggaagagcaaacagaaggt1260
gtacttgaagaaaaaccagaagactatataggtttataa 1299
<210> 43
<211> 2307
<212> DNA
<213> Candida albicans
<400> 43
atgtcggacctaactccaattaaacttccttcgtccgctccatttccggttgtcatatca 60
tctgtattatgcaaacctggagatacaatttccaagcacaagactatattcaagtacaaa 120
tactgggactaccaagatgatccaacttcaaaggaggacccacctaagaaaatacgagta 180
gaacggttaggtacatttgagagtcccatagaaggcgaaattgaccagattaacatcaag 240
ccattgcaagaagtgatgcatagtgatgtggatttgttatttgttaaagaagcatgtcct 300
catactgtgcaatacagtgggttatgtgcattatgtggcaaatccttagaagaagaaaag 360
gattattcaggatacaattacgaagacagggccacaattgaaatgtcccatgacaacact 420
ggcttgaaaattagttttgatgaagcagctaaaatcgaacacaacacaactgaccgatta 480
attgatgaaagaaagttgattcttgttgttgacttggatcaaactgttatacatgccacc 540
gtggacccaactgttggagagtggcaactggacccagccaatcccaactatgctgctgtc 600
aaagacgttaagacattttgtttggaagaagaggcaattgttcctcctggatggacaggt 660
ccgaaattggctccaacaaaatgcacctattatgtcaaactccgtccagggttgctggag 720
tttttggagaaaatggctgagaaatatgaaatgcatatttacacaatggccacaagaaac 780
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tatgcgttatcgattgctaaaatcattgatccagatgggaaatattttggtgatagaata 840
cttagtcgtgatgaaagtggttctttgactcataaaaacttgaagagattgttccccgtg 900
gaccaatcgatggtagttattattgatgataggggagatgtgtggcaatgggaaagcaat 960
ttaattaaggtggttccctatgatttctttgttggtattggagacatcaattcgagtttc 1020
ttaccgaagaaaaatggtcaattaacaggaccaaccaaaaagaggaaatctatagccaaa 1080
ttagaagctgctgctgaactagccaaggaatcagataccaataatgacaagcaagagact 1140
gaatcgggggaagaagagggtgaagaagatgctgatggtcactcggacgtgtcaaactcc 1200
cctgttgaaagaatccttgaactcggaggaggtgaaggaaacactagtttattgttggaa 1260
caatcattgacaagaaatcagtcaatagaagaacaacaacagaagcgtccattagcaaag 1320
ttgcaacacgatttggaacaaatgcatgagcatcgccacgatagtgatagcaagtcagag 1380
agtggttctgatgatgagagtgatgaagaagacaatttgttatttgatgatgataatgaa 1440
ttagcagccttggataaagtcttggggaatatccatcaagggtattataacttgtttgat 1500
aaagacaaaatcaacaaaccggatttgactgaaatcataccgtcaatgaaaagcaagaca 1560
ttggaagggataacggtcttgttctcgggt-attattccattgggaattaatttggattct 1620
gccgatatcgtgatatggtgcagacaatttggtgtgaaagttgtcaatgaagtgtaccca 1680
gaagttactcacgttgtttgccgcgatgttagtgaaggtgctggaccaacattcaagacc 1740
agagttgcaagaaaactatatcctgacactatcaaaattgtcaatccagattggctattt 1800
gcatgtttgagtaactggacaaaagttgatgaaaaagattatttgatttcaactgatgat 1860
acaaagctttggaccgtgaaagagaatgagattaccaagtaccagaaagctttggaagac 1920
agaagtgctttggcaaatgctactcatattgattctattgagtcatttgatgagtacgat 1980
ttggatgaagctaatcaagaagttgatgatttcttggcagggttaagtgatgatgatgag 2040
gaagaagaggaggaagaagaagatgaagagatcgagaatccagaatcaaataatgatgat 2100
gaagaaatctatgagcaatcaaccaatggacatgattcatttatcaaggatgcttatagt 2160
aagaagagaaatagagatgaagaggaggtacaacttgttaaaaagcaaaaaatagaaaat 2220
ggagaaaatggagaaaatgaaaatgaaaatgatttagacgatttggaaaaagaactactt 2280
gacggttttgacgacttggaagaataa
2307
<210> 44
<211> 3129
<212> DNA
<213> Candida albicans
<400> 44
atgggtaaaaaagcaattgatgcacgtattcctgccttgatacgtaatggcgttcaagaa 60
aagcaaagatcttttttcatcattgtgggtgataaagctcgtaatcaattaccaaacttg 120
cattatttgatgatgagtgctgatttgaagatgaataagtcagtattatgggcatacaag 180
aaaaaattattaggcttcacctcccacagacagaagcgtgaagcaaaaattaagaaagac 240
ataaagcgtggaattagagaagtcaacgaacaagatccttttgaagcatttatatctaat 300
caacatatcagatatgtttactacaaagaaactgaaaaaatcttgggtaacacttacgga 360
atgtgtattctacaagattttgaagccatcacccctaatttgttggctagaacaattgaa 420
acagtcgaaggtggtggattagttgttatcttgctcaagaatatgacatcattgaagcag 480
ttatatactatgtccatggatatacattcaagatacagaactgaagcacatgatgatgtt 540
gttgccagattcaatgaaagattcttactttctttagggtcttgcgaaaattgtttagtt 600
gttgatgatgaattgaatgtcttacctatttcagggggcaaacatgttaaaccattgcca 660
cctaaagacgacgacgaattgactcctaatgccaaggaattaaaggagttgaaagagagt 720
cttgctgacgtacaacctgctgggtcattagtggccttgtccaaaactataaatcaagca 780
caagcaattttgacttttattgatgtcatctcagaaaagacattgagaaatacagtcaca 840
ttaactgcaggaagaggtcgtggtaaatctgctgctttaggtattgctattgctgcagct 900
atttcccatggatattccaatatttttgttacttcaccatcacctgaaaacttgaagaca 960
ttgtttgaatttattttcaaaggttttgatgcattaggatataccgaacatatggattat 1020
gacattattcagtctactaatccatctttcaacaaagctattgtcagagttgatgttaaa 1080
agagaacacagacaaacgattcagtacatttctccaaatgatagtcatgttttaggacaa 1140
gcagaattattgattatcgatgaagcagcagccataccacttccaatcgtgaaaaaattg 1200
atggggccctatttgatttttatggcttctaccattaatgggtatgaaggtactggaaga 1260
tcattatcattgaaattgattcaacaattgagaactcagtccaataatgcaacaccttca 1320
gaaactaccgtggtatccagagataagaaatccaatgaaattactggagctttgactaga 1380
acattgaaagaagttgtattggatgagcctattagatatgcaccaggcgaccctattgaa 1440
aaatggttaaataaattgctttgtcttgatgtttcattatctaaaaatgccaagtttgca 1500
26
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
acaaagggcactccacatccatctcagtgtcaacttttctatgtaaatagagatactttg 1560
ttctcctatcaccctgtctctgaagcattcttacaaaagatgatggcattgtatgttgct 1620
tctcattacaaaaattcacctaatgatttacaattgatgagtgatgctccagcacatcag 1680
ttattcgtgttgttacctccaatagaggcaggtgataatagagtacctgacccattgtgt 1740
gttattcaattagcattggagggtgaaatatccaaagaaagtgtaagaaaatctttatct 1800
cgtggacaaagagccggaggggatttgataccttggttaatctcacaacaattccaagac 1860
gaagaatttgcctcattgtcaggtgcaagagttgttagaatcgctacaaaccccgaatac 1920
tctggtatgggttatgggtctagagcaatggaattattgagggactattactccggtaag 1980
tttaccgatatcagtgaatccaccgaattgaatgatcacacaattacaagagtcactgat 2040
agcgaattggccaacgcatcactaaaagatgaaattaagttgagagacgttaagacatta 2100
cctccgttgttattgaaattatcagaaaaagccccttactacttgcactacttgggtgtc 2160
tcttatggtttcacgtctcaattacacaaattctggaagaaagcagggttcactccagtt 2220
tatttgagacaaacacctaatgaattaactggggaacatacttcggttgttataagtgtt 2280
,
ctaccaggaagagaagataaatggttacatgaattctcgaaagatttccacaaaagattt 2340
ttgagtttgttatcatatgaattcaaaaaattccaggcttcccaagctttaagcattatt 2400
gaagctgcagagcaaggcgaaggtgatgaaactactagtcaaaaattaaccaaagaacaa 2460
ttagatctgttgttgtctccatttgatttaaagagattggactcgtatgccaataattta 2520
ttggattatcatgtaattgttgatatgttaccactaatctcccaattgtttttttcaaaa 2580
aaaactgggcaagatatcagtttatcatcagttcaatctgccattttattggctattggg 2640
ttgcagcataaagacatggaccagatagcaaaagagttgaacttaccaacgaaccaagcc 2700
atggcaatgtttgctaaaattattcgtaaattctcaacctatttcagaaaagttctcagt 2760
aaagcaattgaagaaagtatgccagatttagaagatgagaatgtcgacgccatgaatggt 2820
aaggaaacggaacaaatcgattataaagccattgagcagaaattgcaagatgacttggaa 2880
gaggctggtgatgaggcaataaaagaaatgagagaaaaacaacgtgaattgattaatgct 2940
cttaatttagataaatatgctattgcagaagatgctgaatgggatgaaaaatcaatggat 3000
aaagctactaagggaaaaggtaatgttgttagtattaagagtgggaaaaggaaatctaaa 3060
gaaaatgctaatgatatttatgagaaagaaatgaaagcagttaagaaatcaaagaaatca 3120
aaaaaataa 3129
<210> 45
<211> 384
<212> DNA
<213> Candida albicans
<400> 45
atggctgcatttgatgaaatatttgattatgtcgatagagatacttttttccaatatttc 60
cgattgacattagttgtttgtacttatttgattttccgtaaatattattcttcatgggcc 120
attaaaaagcaaacagcaacacaattagaacaagataaaagagaacaatctgaaaaatct 180
gaaagagaagctaaagaatctaaagaaaaatttgatactatttctaatgaagctaaagaa 240
tttggttggggtaaaaaaactagaaataatgttaaattaactgaagcagtattagctgaa 300
tatagtgaacaacaaagacaaagaaatcaaactagttatgatgctcaagaagatgctgat 360
attgatgatttattagaagattga 384
<210> 46
<211> 870
<212> DNA
<213> Candida albicans
<400>
46
atgtcatttagaggtggtggtggtagtggtggtagatcaactcaaagaactattcttcca 60
tttggattagattatgctgatattatatcatcaactcaagagacggaaaaaccacaatta 120
ttattacccataaatggagatataactgaaattgaatcaattattgctaaacaatcaatg 180
aatttcactaaactaatgtcagaaggtccatttttcacggggaatctagatagtattgaa 240
atcaccaaaaaacgtaatcataatgatagtgaaaatgaagaagaagaagaagaagaagga 300
ggagatacagagaatactggcgatagaaagaaaaagaaatcaaagactaatggtgatggt 360
agtagtagtggtagtggtagtggtagtgccagtggtgatggaatagaaagatattccgat 420
cgatataaaaaaatccaaaaaattggtagaacaattgatgaacatccatatcaaccagaa 480
tatttccctagtgaattatattcagtcatgggaataactaataaacatgataagaagaaa 540
27
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tttttattattatcgaaatttaaatcaaatggaggattaaaacaaatattatccaatgaa 600
aaattggaaaatttagatgaacaatcaaaattaaattcaatgaaagaaaaaatgttaagt 660
atgattgataatagtgtgaatgtcaatgatgatgataataataatgatgggaaaacacgt 720
agtggagatgaacaagaaattgatgaagatgatttggatgatgaatttgaagatgaagat 780
gatgatgattataatgctgagaaatatttcgatgatggtgatgacgatgatggaggtgat 840
gatggaggtgatgatgaagcagcattttaa 870
<210> 47
<211> 1524
<212> DNA
<213> Candida albicans
<400>
47
atgttagcactgaaaaaaaaaaggacaagaagaataaaaaggcaaccaatttgtgaacaa 60
attccaacctccaatacagcatttttcttcactcttgatataccaattatgccagtgaat 120
tttttaactagtgttgtgtttgatgggccagaggtgattccatattgggaccaaattaaa 180
gaatatggacctaccgttcttcccattctattaactcttgctggagccaagtattatttc 240
catggtgccaccaatacgtgggagcgagacatgcatgggaaagtgtttatgattactggt 300
gggaccagtggtattggagctcaaatagcatatgaattgggacaacgaggagcacaacta 360
atattacttactagaagaaccaatgatcaatgggtggctgagtatattgaagatttacgt 420
gataaaactaat.aatggtttgatatatgccgaagaatgtgatttgagttcactttattca 480
atcagaaagtttgctacaagatggcttgataatcagccaccaagaagattagatggagtc 540
atttgttgtgctgctgaatgtatcccacgaggaaaatccagacaaataactatggatgga 600
gttgaacgacaaatcggtattaattatttggctcatttccatttgttgactttattgggt 660
ccatcactaagggttcaacctcctgatagaaatgtacgggtgttgattgcaacatgttcg 720
tcgcaaaatttgggagatgttgatttaaacgatttattgtggagtaacaagaggtatcca 780
gcaactcagccatggaaggtatatggaacatcgaaattacttttagggttatttgccaaa 840
gagtatcaaagacagttgatgggatatgagcgtaaagataaggccccttgtaatgttcgt 900
atcaatttaatcaaccctggtattgttagaacaccgtcaacaagaagatttttgtctttg 960
ggcactgtatgggggttgattatctacttgattttattcccgatctggtggttgtttttc 1020
aaaagtgctgagcaaggtgctcaatcattttactttgcgttatttgctcctattttcatg 1080
aaaatcgaaggtggtaacgtggtacaagaatgtaaaataatgactaaagttagaaaagaa 1140
tatactgatgatgacttgcaacaaaaagttttccacaacactgaagaattgatcaaacaa 1200
attgaaacaaaatcagctattgaacgtaaaaaacatgaaaacgctaaaaagactccagaa 1260
caaaaagccaaggaaaggcaagaggaattgaatagaaagagggatttgcatattaaacca 1320
gaaactccggaggaactagaactgaaattaaatctgttgagaaatcaaattggtatgggg 1380
actggtattctgtctaatgaaatgccattgttccccgatgacgaaactctcaagaaggtg 1440
atcagttccaagaagaatgctagtagtaataatagtggtggtctgaaatcaaataagagt 1500
caaaagaaatctaaaaaagtatag 1524
<210> 48
<211> 993
<212> DNA
<213> Candida albicans
<400>
48
atgacagatatgtcaaacactactactgatggtaatgtttctagtattgttgttccagga 60
caatatattagtcctacttataaattagaaaatagcaacaacgattcatctataccagtg 120
aaatatattcctggatcggggacaataatatcaaatatcaatatcccatcgccaaacacc 180
tcaacaaactcagttaaatcaatgccaattatagtatcgacaatattagggaatgtatcc 240
atctcacctattgatcaaaccccaacatcaaaaccatccaacaatgatgatatggttatc 300
gataatgagcaaactaaactggatgaagataaagataaagataaatatgttaaaagttat 360
ttagtttctgtgataccaaaatctaccaaacatcaatccaccacctccaccactactagt 420
aatcaatcaggctccaaggcaatttcagcaattgcattacctaaagaaaatgatattgta 480
ttagttcgtattactaaaatcactaaaatccaagcatattgtgaaatcatatcattagat 540
accaccaccaacattttaccagattcaggtcttggtaataatgggaatggatcacatgta 600
tcaatgtcaattaccggaagtaattctcaacataatttcaatcaaaattcaattgcttct 660
28
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
agtcaatcaactaatcaatcagtacaaatttatgaattgggagaaaattttaaagggata 720
attagaattaatgatattagatcgactgaaagagataaattaaaattaattgattgtttt 780
aaacccggtgatattgttaaagctcaagttatatcattaggtgatggatctaattattat 840
ttaacaacggcaaaaaatgagttaggggttgttttcgctaaaagtgaaaatggtgctggt 900
gatttaatgtatcctattgattggcaaaatatgattgatattaatagtggggttatagaa 960
aaacgtaaaaatgccaatccatttttacaataa 993
<210> 49
<211> 666
<212> DNA
<213> Candida albicans
<400>
49
atggcaggtgatctaaatctaaaaaagtcttggaatccagcattagttaagaaccagcaa 60
aaagtttgggaagaagaacaacaaaagttagatgaacttaaacgaataaaagagagaaat 120
caggagtataaacaagaacaagaatacttggaattactaaagctacagcatggagatcaa 180
tttcaaattaaagacttgaacaaacagcagaagctcaaaatatccaaactaaattggatg 240
tatgatgatgtaccatttgaaggcaatgagaaagtggaagagaattcaagtgggtttatt 300
gaatcaaatgtagagtttacagatggcaaatccaaagttgagaatttattaaaaggaaat 360
catgttgtgggcaagaagagagatggtagtggaaccagtgatagaataaataagataatt 420
ggggtggggatgaccaaatcaagtaaagtcagctattccgatgatccattactcaaaata 480
aaacagcagcaacaacaggcacaaagagttgcccgaaaacaacatcctagtgataagcat 540
tctcatcgttttagacatagttccaaaagttcatccgatagagtgcacaaatcacatgag 600
cacgagagaagtcgaaagcataattcctcacatactcgtcacaaagatggatcaccccac 660
agataa 666
<210> 50
<211> 2367
<212> DNA
<213> Candida albicans
<400>
50
atgttgaaaaacgataccgttttcactaaagatatttcttgtacggcgataactggtaaa 60
gatgcctggaatcgrccaacaccacaaccaatcactatatcattatctttcartactgat 120
ttccakaaggcatcggaattggataatttgaaatrctcaattaattatgctgttattacc 180
agaaatgtaactgaatttatgaaatcaaatgagcatttaaatttcaagtcattaggaaat 240
attgctcaagcaattagtgatattggattagatcaatctagaggtggtggatctattgtg 300
gatgtgacgataaaaagtttgaaatcagaaataagagctgaaagtgtcgaatataaaatt 360
aatagaaacactttgggtcaacccgttccattagatattttccaagttaataaattgaga 420
ttattgacrattattggrgttttcacatttgaaagattacaaaaacaaatagttgatgtt 480
gatttrcaatttaaaattgmacctaattccaatttatatttccatcaaataattgctgat 540
attgtttcatacgtggaatcatctaatttcaaaactgtagaagcattggtgtctaagatt 600
ggtcaattgacatttcagaaatatgacggagtagctgaagttgttgctactgtcactaaa 660
ccgaatgcattyagtcatgttgaaggtgttggagtatcatctaccatggtcaaagrcaat 720
ttcaaagatatggaaccagttaaatttgaaaacacaattgctcaaactaatagagcattc 780
aatttacctgttgaaaatgagaaaactgaggattataccgggtaccacactgcatttatt 840
gcctttggatccaatactggaaatcaagtagaaaatattaccaattcattcgaattgttg 900
caaaaatatggaatcaccatagaagcaacttcatcattgtacatttctaaaccaatgtat 960
tacttggatcaaccagattttttcaatggagtaattaaagtgaatttccaaaacatttca 1020
cctttccagttgttgaaaattctaaaagatattgaatataaacatttagaaaggaaaaaa 1080
gactttgataatgggcccagatcaatagatttggatattatactatatgacgatttacaa 1140
ttaaataccgagaatctaattattccacataaatcaatgttagaaagaacatttgtatta 1200
caaccattatgtgaagtattgccccctgattatattcatcccatcagtgcagaaagtttg 1260
catagccatttacaacaattaataaatgataaacctcaagagacagtacaagaatcgtct 1320
gatttattacaatttatcccagtctctagattgcctgtcaaagataatattttgaaattt 1380
gatcaaattaatcataaatctcctactttgattatgggtatattgaatatgactcctgat 1440
tcatttagtgatggtgggaaacattttggaaaagaactagataatactgtgaagcaggca 1500
gagaaattagtcagtgagggtgctacgattattgacattggaggagtttccacacgccca 1560
29
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
ggaagtgttgaacccactgaggaagaagaattggaacgtgtgattccattaattaaagct1620
attcgtcaatcactgaaccctgatttactgaaggtgttgatttcggttgatacttatcgt1680
aggaacgttgctgaacaaagtttacttgtgggtgctgacataatcaacgatatctcaatg1740
ggcaaatatgatgaaaaaatatttgatgtggttgctaaatacggatgtccttatatcatg1800
aatcatactcgaggatcacctaaaaccatgtctaaattgaccaattatgaatcaaataca1860
aatgatgatattatcgaatatataattgatcctaaattaggacatcaagaattggatttg1920
tcacctgaaatcaagaatttactcaatggaatcagtcgtgaattgagtttacaaatgttt1980
aaagccatggctaaaggagtgaaaaaatggcaaattattttggatcctggtattggattt2040
gctaaaaatttgaatcaaaatttagcagttattcgtaatgcctcgttttttaaaaaatat2100
tctattcaaattaatgaacgtgttgatgatgtgacaatcaaacataaatatttaagtttt2160
aatggtgcttgtgttttggtggggacatcaagaaagaagtttttggggacattaactggt2220
aatgaagtgcctctggatcgagtatttggcactggtgcaacagtgtctgcgtgtattgaa2280
caaaacactgatattgtaagagttcatgatgttaaagaaatgaaagatgtagtatgtata2340
agtgatgcaatttataaaaatgtataa 2367
<210>
51
<211>
447
<212>
DNA
<213> da albicans
Candi
<400>
51
atgtcagatatagatatagataatgtattaaatttagaagaagaacaatatgaattagga 60
tttaaagaaggtcaaatacaaggaacaaaagatcaatatttagaaggaaaagaatatggt 120
tatcaaactggatttcaacgatttttaatcattggttatattcaagaattaatgaaattt 180
tggttatcccatatagatcaatataataactcttcttcacttcggaatcatttgaataat 240
ttggaaaatattttggcacaaatttctataacgaatggagataaagaagttgaagattat 300
gaaaaaaatattaaaaaggcaagaaataaattaagagtgatagctagtataactaaagaa 360
acttggaaaattgattcattagataatttggtgaaagaagtaggtggaactttacaagtt 420
agtgaaaaccccgatgatatgtggtga 447
<210>
52
<211>
810
<212>
DNA
<213>
Candida
albicans
<400>
52
atgagacaaaagcgtgccaaggcctataagaaacaaatgagtgtgtatgtccacgcattc 60
aaattcagagaaccataccaaataatagtagacaatgaactcatcaccacttgtcaatca 120
gcatcatttgacattaataaagggtttactcgaactatccaagcagaaaacaaacccatg 180
attactcaatgttgtatccaagcattatatgatactaagaatcaaccagcaatagatatt 240
gctaaatcatttgaacgaagaaaatgtaatcatcgtgaagccatcgatcctagtcaatgt 300
attgaatcaatcgttaatattaaaggacaaaataaacatcgatatatcgttgccagtcaa 360
gatttacaattacgtaaaaaattgcggaaaatccctggagtaccattgatttatatgaat 420
cgatcagtgatggttatggaaccgatcagtgatgttagtaatcaatataatatgaattat 480
gaatcgaaaaaattgaccggaggattgaatgatattgaagctgggaaattggaaaagcaa 540
aatgaaggtgaagatggggatggggatgaactggaagttaaaaagaagaaaagaaaagga 600
cctaaagaaccaaacccattaagtgtcaaaaagaagaaaacagataatgcaactgctgcc 660
agtactaatcaagagcagaaaaagaaaccaaatagaagaaaaagacatggcaagtcaaaa 720
gcagaagagaaggaagaccaagaacaggagcaagtgaacgaagcaacaactaatgaagat 780
gcacaggaggcaataacagctactgaataa 810
<210>
53
<211>
921
<212>
DNA
<213>
Candida
albicans
<400> 53
atgaccgact taacaccatt attccgtcag tgtgttgaca tcgttcagca agagtacaag 60
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
actcagccaaccacagccaaacaaccttactaccttaacgacacatttattaaggagacg 120
accgcctttttccatgtcttgaccaacttgaaccagttcatcaacgaaaccaaatcaagt 180
tatctagccataaacgatgacacgaaactagctgggtcgattgacgacaaaaacaagatc 240
gacgaagagttcaattacaaggtccagcaaatgtacaagcgattaaatcatttggagaca 300
tacgaaacaaagaggcagtcgttactaccaaagactagcgggtggttcagtttcctagac 360
gaatccaacgaccaggacatatactttgagacattggcgaatcatcgtatgcagatattg 420
cggttcctcatggagacactcaaccatgtaaacaaacgctttgaaaacatccaacaaaaa 480
agattggctcgtgaacgacaactaaacttgttaaacttccaaaactttgaagacggcgag 540
gagttggaggatgtgtttcccacactagaccaaatccagcaagtaccagaactatcccaa 600
caacaaatccaacaacttgaaacggaaaaccaggaatttctcaatatgaaaactagccaa 660
ttgaaacaagtcgaaaaagtgcagcagtcaatactcgacatcgtcaacatccaaaacgaa 720
ttggcatttaagctacaagaccagggccaacagatcgagtcgttgatggactcacatgct 780
gatgttcaaacagaagtccaaatggggaaccggacattaagtcaggctacgaaaaagaat 840
aaaagaggtgctaatatgttggtcatgctatgtatagtactaggtgtgttattagtgttg 900
gtagactatgtatcattctga 921
<210>
54
<211>
579
<212>
DNA
<213> da albicans
Candi
<400>
54
atgtcaggtataaaaatcagtttaaagaaaaagaatccaaaactaaagaaacttatagtg 60
aataattcacaacaaacagatgaactgtcagagcagcagaagaaattgattacatcatat 120
tctacagaagataagactactcataaagatgaaaccaaaccaataatagttttgaagcaa 180
ccatgtaaaagtatgttacagaaagaaatcgaaattgacgagaaaccaatactaccgtat 240
ggtgtaacaacgtttgaaaaagtggagactacaaaacaatcaatgatcaaaaagatcgaa 300
tcagaagattccgatgatgactccagcgatgatagaaaaatcccaatagatgaatttggt 360
gcagcatttttaagaggacttggttggcaagaagaagaggaaaagaacaaggatgacagc 420
aaatccactaacactcaaaatttatctcataggaaacatggaatcaccttagggattgga 480
gcaaaacctatagatgaagaaataatacaagatttaaactctacggaaaaaggtattcca 540
atcataaaacgacgtaaattaaatcatataaataaataa 579
<210>
55
<211>
2145
<212>
DNA
<213>
Candida
albicans
<400>
55
atggctaaagcatcgaaacaaacaaagaagtttcaaaataagcatttgaaacatacaata 60
gagcaacgtaagaaggttcaggcacagaacaagaaaattgcttccagaaaaaagagtggt 120
agttcatcatctggggaaagcaatgcccccaaacgtgctgatggaaaagccaaggaagtc 180
tttgaagatatgtcagtagacgactttttcggaggtgggtttgaagttcctaaagaaaag.240
aataagaacaagaacaagcaagatacaattgaagaaaacgaagaagaagactcgtcttct 300
gaagaggaagatgaagaagcaatgaaggaaaacttgaaaaaattagaggcagacgatcca 360
gaattttacaaatacttgaaagataatgacaatgatttattagattttgaagctgtcaat 420
cctttagatgccataagtgatgacgagggtgatgaagatgatgacgaagaaattgaaaaa 480
gaagttcctagcgatgatgattctgaggaagaaccaactctaggaaaagtaaaaggatct 540
aaaattgaaataacgaaatcgttggttaaaaaatggaatcaacaattagataagccaacc 600
cctaagattacaagaaacatacttattgcttttaaggcagctgtcaatatccacaattcg 660
gattctgaagattataagttttccataacagaccctaaagcattttctgaattgatgtta 720
ttagttttgaaaaaagttcctatttctgtgcaaaagttggttaaatacaaaactaacact 780
caaggagtaagaactatcccgcaaaagaatcaatatgccactcaaattgcagctattttg 840
aaatcacatgcaggttcattcatcactttattaaacgatatcaccaatactgaaactgct 900
gctttaattttggcttctatttatgaggtgttcccattttatttgtcacacagaagatta 960
ttaaaacaaattttgactgccgttgtaaatgtttggtctagttcttcagatattgatacg 1020
caaatttctacatttgcatttttgaacaatgtatctagagagtatcctaaatcggtcttg 1080
gaaaccgttttgaaattaacttactcgtctttcttacagaattgcagaaaaacaaatgtc 1140
31
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
cataccatgg cttttgtaaaaactcagctgtggaattgtttggaatcaat 1200
cccagattaa
gaaactttgggttatcaagttggttttgagtatgttagacaattggctatacatttacgt 1260
aacagtatcaatgctacttcgaacgcaaaagagggatacaaaactatatacaactggcaa 1320
tactgtcattcattggatttttggtccagagttttgtctcaacattgtaatcctgaaaaa 1380
gagttgcaaaaccataaatccaaagaatctccattgaggcaattaatttatccattagta 1440
caagttactttgggtgctattagattgatccctaccgctcaattttttccattaagattt 1500
tatttaattagatccttgatcagattatctcaatctaccggcgtgtttattcctttattc 1560
ccattgatttcagagattttatcatctacagcaatgaccaaggcaccaaaagcttctact 1620
ttgcaagctgttgatttcgaacacaatattaaagttaatcaagcatatttgggcactaga 1680
gtttaccaagatgggttatgtgagcaatttatagagttatctggtgaattttttggtttg 1740
tatgcgaagagtattgccttcccagagttggtgaccccagctgtgttagcattgagaaga 1800
tttgtgaaaaaatcaaaaaatgtaaaattcaacaaacaattgcaacaattgatagaaaaa 1860
ttaaatgcaaatgctgttttcattactggaaaaagatccaatgttgagtatggaccatca 1920
aataaagcagaggtacaacaatttttgagtgactttgaatgggaaaagacacctttgggt 1980
caatatgttagtgtacaaagacagttgaaagcagaaagattaagaatcttgaaagaagcc 2040
caagaagaggaagcaaaagcacaagctgaacaaaagaaaaaagaagaagaagaggatgag 2100
caagaagatgaagatattgtaatggaggaggaagatgatgagtag 2145
<210> 56
<211> 846
<212> DNA
<213> Candida
albicans
<400> 56
atgtcaagaggtaaaacaataagaccgtcgtattacgatgaagaggaatcttcacaagat 60
gaattgagtcacactttaagtaaaggccgttcaaatattggctcacaatcagatgatgaa 120
gaaatgtccaaaatatcatttggtgctcttaatcgagcccaatctaaattgaacaaacac 180
aatcaaaaacataaaacacaggaggacaactataagtcttcagaagaagagtttttcgat 240
tcaggctcagattcagatggtccaccagaggaaacaagttctaaagatactaaaaagaag 300
aaaaacaaacatgctccatcagaatcctcttccaaaagaccagtttcaaggataagagat 360
atacctggattaccgtctagaaaacaacaaactttgcataccgatattaggtttgatgct 420
gcgtatgggaaagctgatttggccaaggcaagaaaagattatgcctttttagatgaatat 480
cgaaagcaagaaatagcgaatatggaaagtttattaaaagataaaaagagtagattgaat 540
gatgatgaaagagaagaaatcaaactacagttacaatcattaaaatctcgtatggatact 600
ttgaaaaatcgtgatttggaaaataatatcttatcaaattataaaaagcaacaaatggaa 660
agtttcaaagaaggtaaagtgaataaaccttattttcttaaacgtagtgataaacgtaag 720
atattacaaaaggccaaatttgattctatgaagcctaaacaaagagaaaaggcaatggaa 780
aggaaaaggaagaagagattgggtaaagaattcagacaattggaattcaaaccaactaat 840
cgttaa
846
<210> 57
<211> 2550
<212> DNA
<213> Candida albicans
<400>
57
atgtccgatcaattagaaaaagatatagaggaatcgatagctaaccttgattatcagcaa 60
aatcaagaacaccatgaaacagaacaagataaagataaagaacatcaagacgtagagaag 120
caatccagcgaagaagaaaccaaaggaattgagcatgttacagattcaaatacagacgat 180
atcggcgtaacaaaactgcaggatacagaagaagtcattgaaaattcgccagtggaccct 240
caattgaaagaacaacaggaatctacaaccaagatgctgttgtctgaaagagatttggta 300
gatgagatagatgagctttttactaactccacgaaaactgtcactgaaaataatcaacca 360
agtgaaactaacaaaagagcctacgaatccgtggagaccccacaggaactaacaccaaat 420
gataaacgccaaaaactagatgcaaatacagaaacctcagtgccaactgaacttgaatct 480
gtaaataaccataacgagcaactgcagcctatagagccaacccaagaaagacaaccctct 540
acaaccgaaacaacttactccatatcagtacccgtttctactacaaatgaggtcgaaaga 600
gcgtcttccctgattaatgaacaagaagatctagaaatgattgccaaacaataccaacaa 660
gctacaaatcttgaaatagagcgagccatggagggtcatggtgatggaggacaacacttt 720
32
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tcaactcaagaaaatggtcagccttctggatcgctgctaatatcttccattgttccttct 780
gattctgaattgctcaacaccaatcaggcatatgctgcatatacttcgctatcttctcaa 840
ttagaacagcatactctggctagtgctatgctttcttctgccacactttctgctttgcct 900
ttgtcgattattgctccagtatatttaccaccaagaattcaattgttaataaatactttg 960
cccacattggacaatttagcaacccagctattacgtacagttgcaactagtccataccaa 1020
aaaataattgatttggcctctaacccagatacatcagcag.gggctacttatagagatttg 1080
acttctttgtttgagtttacaaaaagattatacagtgaagatgatccatttttaactgtt 1140
gaacatatagctcctggtatgtggaaggaaggagaagaaacccctagcatttttaaacct 1200
aaacaacaaagtatagaatctactttacgtaaagtcaacttggcgacatttttggcagcc 1260
actttaggtacgatggaaattgggttcttttaccttaatgaatcgttcctagatgttttt 1320
tgtccgctgaataatttggaccctctgaatgcattatccaatttaggaggttatcaaaat 1380
gggttacaaagtactgatagtcccgtaggtgcgagagtcggaaaattgttaaaacctcaa 1440
gccacgttgtatttagacttgaagacccaagcgtatatctcagccattgaggctggagag 1500
agatcaaaggaagaaattttggaggacattttgcccgatgatctccatgtttatttgatg 1560
tcaagaaggaatgcaaagttgttgagtccaacggaaactgactttgtgtggagatgcaaa 1620
cagagaaaggagctgttattaaattacaccgaggaaacacctttgagtgagcaatatgat 1680
tggtttacatttttgagagacttgtttgattatgtctcgaagaatattgcttatttgata 1740
tggggaaaaatgggtaaaacaatgaaaaatagaagggaagacacacctcatactcaggaa 1800
ttgcttgataatactactggttctactcaaatgccaaatcagttgtcttcatcttctggt 1860
caagcttcatcgacaccatctgttgtagatcctaacaaaatgttagtgtcggagatgaga 1920
gaagcaaatattgcagtgccaaaaccctcacaaagacgggcgtggtctcgagaagaagaa 1980
aaggctttaaggcatgcattagaactcaagggtccacattgggcaacaattctagaatta 2040
tttggtcaaggtggaaagatttcggaagctttgaagaatagaactcaagtgcaattaaaa 2100
gacaaggcaagaaattggaaaaagttttttcttagaagcggtttggaaattcctagttat 2160
ttgcggggtgttacaggtggtgtagatgatggtaaacggaaaaaggataacgttactaag 2220
aaaactgctgctgcacctgttccaaatatgctggaacaattgcaacaacaacaacagcga 2280
caacaagaaaagcaagaaaagcaacaacaagaagagcaacaagcacaacaactggaaaaa 2340
caactagagcagcaacaagagccacaacaagagcagcaacaagagcagcaacaaacagag 2400
aaacaacaagcagagcaagagcagccagatcaaccccaggaggaacaacaacaagagaaa 2460
gaacaaccggatcagcaacaaccagatcaacaacacccagatcgacaacaacaagagcag 2520
atccaacaaccagaaagtctggataaatag 2550
<210> 58
<211> 3294
<212> DNA
<213> Candida albicans
<220>
<221> misc_feature
<222> (1). .(3294)
<223> n = A,T,C or G
<400> 58
atgagtggtcctgttacttttgaaaagacatttcgtagagatgccttaatcgatatagaa 60
aagaaatatcaaaaggtatgggcagaagagaaagtttttgaagttgatgccccaactttt 120
gaagaatgtcctattgaagatgttgaacaagttcaagaagcacatccaaaattctttgcc 180
actatggcttatccttacatgaatggtgtcttgcacgccggtcatgcctttacattgtct 240
aaagttgaatttgcaactgggttccaaagaatgaatggtaagagagcattattcccattg 300
ggtttccattgtacgggtatgccaattaaagcagctgccgataaaatcaaaagagaagtt 360
gaattgtttggatctgatttttctaaagctcctgctgatgacgaagatgcagaagaaagc 420
caacaaccagctaaaaccgaaactaaaagagaagatgtcactaaattctcttccaaaaaa 480
tctaaggctgctgccaaacaaggtagagccaagttccaatatgagatcatgatgcaattg 540
ggaatcccaagagaagaagttgccaagtttgctaacaccgactactggttagagtttttc 600
ccaccattgtgtcaaaaagatgtaactgcttttggggctagagttgattggagacgttct 660
atgatcacaaccgatgctaatccttattatgatgcatttgttagatggcaaattaataga 720
ttgagagatgttggtaaaattaagtttggtgaaagatataccatttattctgaaaaggat 780
ggccaagcatgtttggatcacgatagacaatctggtgaaggtgttggtccacaagaatat 840
gttggtataaaaatcagattaactgatgtagcaccacaagcacaagaacttttcaagaaa 900
33
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gagagtctcgatgtgaaggagaacaaagtttacttggttgctgcaactttaagaccagaa 960
actatgtatggtcaaacttgttgttttgtgagtccaaaaattgattatggtgtttttgat 1020
gctggtaatggtgactatttcattaccactgaacgtgctttcaaaaatatgtctttccaa 1080
aacttgactccgaaaagaggatattataaaccacttttcactatcaatggtaagacattg 1140
attggatctcgaattgatgctccatatgctgtcaacaaaaacttgagagttttgcctatg 1200
gaaacagttcttgcaaccaaaggtactggtgtggtcacttgtgttccatcagattctcca ~
gatgattttgttaccacaagagacttggccaataaaccagagtactatggaattgaaaaa 1320
gactgggtacaaacagatattgttcctattgtccataccgaaaaatacggtgataagtgt 1380
gctgagtttttggttaatgatttgaagatacagtcaccaaaagattctgtgcagttggcc~1440
aacgccaaggaattggcttataaagaaggtttttacaatggtactatgcttattggtaaa 1500
tacaaaggtgataaagttgaagacgccaagcctaaagtcaaacaagacttaattgatgaa 1560
ggtcttgcttttgtttacaatgaaccagaatcccaagttatttctagatctggtgatgat 1620
tgttgtgtatcattggaagatcaatggtatattgattatggtgaagaagcttggttgggt 1680
gaagccttagaatgtcttaagaacatggaaacatactccaaggaaaccagacatggtttc 1740
gaaggtgttttagcctggatgaagaactgggctgtcaccagaaaatttggtttgggtact 1800
aaattgccttgggatcctcaatatttggtcgaatctttgtcagattctactgtctatatg 1860
gcttattatactattgatcgtttcttgcattcagattattacggtaagaaggcaggtaag 1920
ttcgacattaagccagagcaaatgactgatgaagtatttgattacatctttactcgtcgt 1980
gatgacgttgaaactgacattccaaaggaacaattgaaggaaatgagaagagagtttgaa 2040
tatttttacccattagacgtcagagtttcaggaaaagatttgatcccaaatcatttgaca 2100
ttcttcatctatacccatgtcgccttgttcccaaaaagattttggccaagaggtgttaga 2160
gccaacggacatttgttgttgaacaatgctaagatgtccaaatcaactggtaactttatg 2220
actttagaacaaatcattgaaaaattcggagctgatgcctctagaattgctatggccgat 2280
gcaggtgacactgttgaagatgccaactttgacgaagccaatgctaatgctgcaatcttg 2340
agattgacaactttgaaagattggtgtgaagaagaagtgaaaaaccaagataagttaaga 2400
attggtgactacgattccttctttgatgctgcttttgaaaatgaaatgaatgatttgatt 2460
gaaaagacttaccaacaatacactttgagtaattacaaacaagcattgaaatccggattg 2520
tttgatttccaaatcgccagagatatttatagagaaagtgtaaacacaacaggaattggt 2580
atgcacaaggatcttgttttgaaatacattgaataccaagcattgatgttagctccaatt 2640
gctcctcattttgccgaatacctttacagagaagttttaggtaaaaatggaagtgttcaa 2700
ctagcnaagttcccaagagcctcaaagcctgtttccaaagctattcttgatgctctggaa 2760
tatgtcagaagccttaccagatctatccgtgaagcagaaggtcaagctttgaaaaagaag 2820
aaaggaaagtctgatgttgatgggtcaaaaccaatcagcttgacagttttggtttccaac 2880
actttcccagaatggcaagataactatattgaacttgtcagagaattgtttgaacaaaac 2940
aagttggacgacaataatgttataagacaaaaggttggcaaggacatgaa~cgtggtatg 3000
ccatacatccaccaaattaaaactagattggcaactgaagatgctgacactgttttcaac 3060
agaaaattgacttttgatgaaatcgatacattgaaaaatgttgttgaaattgtcaagaat 3120
gccccatactctcttaaagttgaaaaattggagattcttagtttcaataacggtgaaact 3180
aaggggaagaatattattagtggtgaagacaatattgagctcaatttcaagggtaaaata 3240
atggaaaatgctgtacctggtgagcctggtatctttattaaaaatgtcgaataa 3294
<210> 59
<211> 1563
<212> DNA
<213> Candida albicans
<400> 59
atgaatgttggatctattttaaatgacgacccaccatcaagtgggaatgcgaatgggaat 60
gatgataataccaagattattaaatcccctactgcatacc-ataaaccttctgttcatgaa 120
cgtcattcaataacgagcatgttgaatgacactccgtcagattcaactccaactaaaaaa 180
ccagaaccgactataagtccagagtttagaaaacccagcataagtctgttaacttctcca 240
agtgttgcacataaacctccgccactaccaccgtcactgagtctggttggaagtagtgag 300
cattcgagtgcaagatcgtccccggctatcacgaagagaaactcgattgcaaacattatc 360
gatgcttatgaagaaccagctactaaaactgaaaaaaaggctgagctaaactcaccaaag 420
ataaaccaactgacaccggtgccaaagcttgaggaacacgagaatgatacaaacaaagta 480
gaaaaggttgtggatagtgcacctgaaccaaaaccaaaaaaggagcctcaaccagttttt 540
gacgaccaagacgatgacttgacaaaaatcaaaaagctcaagcaatctaagaaaccacgt 600
cggtatgaaacacctccaatttgggcccagaggtgggttcccccaaatagacagaaggag 660
34
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gaaactaatgttgatgacgggaatgaagccataactagactttctgaaaaaccggtattt 720
gattataccactaccagaagtgttgatttggagtgtagtattactggtatgataccccca 780
agttcaatcacgagaaaaatagctgaatgggtgtatgccaatttttccaatgttgaagaa 840
aaaagtaaaaggaatgttgaattggagttgaaatttgggaaaattattgacaaaagaagt 900
ggtaatagaattgacttgaatgtggtgacagaatgtattttcactgatcattctagtgtg 960
ttttttgacatgcaagtggaagaggtggcctggaaagaaataacaaaattcttggatgaa 1020
ttggaaaaaagtttccaagaagggaaaaagggaagaaaatttaaaactcttgaatctgat 1080
aatactgacagtttctatcaattggggagaaaaggtgagcaccctaagcggattcgtgta 1140
accaaagacaacttactatcgccaccgagattggttgccatacagaaggaacgtgtggca 1200
gatttatatattcacaatccgggctccttatttgatttgaggttatctatgtcattggaa 1260
ataccagtgccacaggggaacattgagtcgattattaccaagaataagccagagatggtc 1320
agggagaagaagagaatttcttatacacatccacctaccattaccaaatttgacttgact 1380
agggtcattggtaataaaacagaagataaatatgaggtagagttggaggcgggtgttatg 1440
gaaatatttgctgctattgataaaatccagaaaggggtagataatcttagattggaggaa 1500
ttaattgaagtttttttgaacaatgcaagaactctcaataatagattgaacaagatttgc 1560
tag 1563
<210> 60
<211> 597
<212> DNA
<213> Candida albicans
<400>
60
atggttaacggtccagctgaacttcgtagaaaattagtcattgtcggtgatggtgcttgt 60
ggtaagacttgtttattaattgttttttcaaaaggtactttcccagaagtttatgtccca 120
acagtttttgaaaattacgttgctgatgttgaagttgatggtagaaaagttgaattggca 180
ttatgggatactgctggtcaagaagattatgatagattaagaccattatcttatccagat 240
tctaatgttattttgatttgtttttcagttgattcaccagattctttagataacgtttta 300
gaaaaatggatttctgaagttttacatttctgtcaaggtgttccaatcattttagttggt 360
tgtaaatctgatttaagagatgatcctcatactattgaagccttgagacaacaacaacaa 420
caaccagtctcaacttctgaaggccaacaagttgctcaaagaattggtgctgctgattac 480
ttggaatgttctgctaaaaccggtagaggtgttagagaagtgtttgaagctgctactaga 540
gcttctttaagagttaaagaaaagaaggaaaagaagaagaaatgtgttgtcttgtaa 597
<210> 61
<211> 2127
<212> DNA
<213> Candida albicans
<400>
61
atggaagtcacttctttgccaattaaacttcagccatcaaacattagacccatagcattt 60
cgaatattgtctaaaaaacatggattaaatattaatacagatgctttagcaattttaaca 120
gagaccatcggctacaaatttggaactgattggaaaagtgtgagatcacaacaatttctt 180
gaagaggttgccaaagtttggaaaatcgaagatcggggactatttattgatggcgatggg 240
ttaaaacaagttttgaaggatatgaattccaaaagcagcaatgatacaaaaagagctcat 300
cgaactgacaccctagttgatatcactaatgatggtaaccaaaatcatactcatagccac 360
caggataagcaaataagttttgaagataaaaatatggaacatgaagaaagagatgatgta 420
ccaatcaactggcaagattatttcaaagttgtatctcccaataaccaacctactagtata 480
ttcgacaaaacaagaaaacaatttgacatagtatttaaaaataatgatgacaaggataag 540
aaagccgagcgtggcgggaaacttgagtcaattgtggcagagttagtaaaaaatttgcct 600
gcatctattgaatcattcaataatcgatactatctcttaagtgatcgattatcgagaaac 660
gaaaattttcaaaaaaaatcattaatcagtctatcagcgttaaattctttcaaagaagga 720
aaaacagatagtataactggtcatgaaattagtttaatcaaaaatatgttgggtcgagat 780
ggtcaaaaatttttgatattcggtttgctcagtaaaaatgcaaacgatgaatacacattg 840
gaagatgaaacagaccacattgaattaaacttatctcaagcttttaaatctcaaggattg 900
ttttattgtcccggaatgtttctattagtggaaggtatttattctgcaagtgggggtaat 960
tccaaccaggatcatggttatatcggaggatgtttttatgttagtaatatcgggcaccca 1020
ccaagtgaacgaagagagacaagcttagatgtttatgggaatttggattttttagggatg 1080
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
catagacaaattgcacctgtgacaggtgaaaaaatcaccaaaatatctaaaaagtttaag1140
aagagattggttctaatcgaaaagaccttgtataatcataaacttatttttgtgggtacc1200
gatttatacttggatgatttcaaagttttggatgggttgcgaaagtttttccaaaaatta1260
gaaaattcaattattgaatcaatcgaggacgaagaagggcaaatggccgaaggaaccaat1320
ataccacttgctttagttttcacagggtcatttgtgtcaaaacctttatcagttacaaat1380
tcatcagtgaccaacatcaccaattcagaatcatacaagagcaattttgataatttcaca1440
acaatcgtgagcaaatacccaaacattgtatctcgctgcaaaataatattgattccaggt1500
aaaaatgatccttggcaatctacttattcattgggatcatctagcttaaactattttcct1560
cagtcgtctattccaaaagtgtttatcaatcgattggaaaaattattgcccaagggaaat1620
ttagtagtttcatggaatcccacaagaataaattacttgtcacaagagttggtagtattc1680
aaagacgaattgatgaccaaattgaaacgaaatgacattattttccctcgtgatattcaa1740
gaacaagaagagttgattgcacaagatgaccaaagaactaacgaggagagaatcaataat1800
ttaatccagaataaaaatactcatttgccttcaaaaatcaaacaggcaagaaaactagtg1860
aaaaccattttggatcaaggaaatttacaaccattcttgaagaacctaaaattaatcaac1920
ttggcttatgattatagtttaagaattgaaccattgcccagtgtaattattttgaacgat1980
tcaagtttcgacaattttgaagtgacttataatggttgcaaagtggttaacattacttca2040
gttgtcagcttgaataatagaaaattcaattatgttgaatattatccaggaactaaaaga2100
tttgaatttaaggatttgtatttctaa 2127
<210> 62
<211> 3293
<212> DNA
<213> Candida albicans
<400> 62
atgagtggtcctgttacttttgaaaagacatttcgtagagatgccttaatcgatatagaa 60
aagaaatatcaaaaggtatgggcagaagagaaagtttttgaagttgatgccccaactttt 120
gaagaatgtcctattgaagatgttgaacaagttcaagaagcacatccaaaattctttgcc 180
actatggcttatccttacatgaatggtgtcttgcacgccggtcatgcctttacattgtct 240
aaagttgaatttgcaactgggttccaaagaatgaatggtaagagagcattattcccattg 300
ggtttccattgtacgggtatgccaattaaagcagctgccgataaaatcaaaagagaagtt 360
gaattgtttggatctgatttttctaaagctcctgctgatgacgaagatgcagaagaaagc 420
caacaaccagctaaaaccgaaactaaaagagaagatgtcactaaattctcttccaaaaaa 480
tctaaggctgctgccaaacaaggtagagccaagttccaatatgagatcatgatgcaattg 540
ggaatcccaagagaagaagttgccaagtttgctaacaccgactactggttagagtttttc 600
ccaccattgtgtcaaaaagatgtaactgcttttggggctagagttgattggagacgttct 660
atgatcacaaccgatgctaatccttattatgatgcatttgttagatggcaaattaataga 720
ttgagagatgttggtaaaattaagtttggtgaaagatataccatttattctgaaaaggat 780
ggccaagcatgtttggatcacgatagacaatctggtgaaggtgttggtccacaagaatat 840
gttggtataaaaatcagattaactgatgtagcaccacaagcacaagaacttttcaagaaa 900
gagagtctcgatgtgaaggagaacaaagtttacttggttgctgcaactttaagaccagaa 960
actatgtatggtcaaacttgttgttttgtgagtccaaaaattgattatggtgtttttgat 1020
gctggtaatggtgactatttcattaccactgaacgtgctttcaaaaatatgtctttccaa 1080
aacttgactccgaaaagaggatattataaaccacttttcactatcaatggtaagacattg 1140
attggatctcgaattgatgctccatatgctgtcaacaaaaacttgagagttttgcctatg 1200
gaaacagttcttgcaaccaaaggtactggtgtggtcacttgtgttccatcagattctcca 1260
gatgattttgttaccacaagagacttggccaataaaccagagtactatggaattgaaaaa 1320
gactgggtacaaacagatattgttcctattgtccataccgaaaaatacggtgataagtgt 1380
gctgagtttttggttaatgatttgaagatacagtcaccaaaagattctgtgcagttggcc 1440
aacgccaaggaattggcttataaagaaggtttttacaatggtactatgcttattggtaaa 1500
tacaaaggtgataaagttgaagacgccaagcctaaagtcaaacaagacttaattgatgaa 1560
ggtcttgcttttgtttacaatgaaccagaatcccaagttatttctagatctggtgatgat 1620
tgttgtgtatcattggaagatcaatggtatattgattatggtgaagaagcttggttgggt 1680
gaagccttagaatgtcttaagaacatggaaacatactccaaggaaaccagacatggtttc 1740
gaaggtgttttagcctggatgaagaactgggctgtcaccagaaaatttggtttgggtact 1800
aaattgccttgggatcctcaatatttggtcgaatctttgtcagattctactgtctatatg 1860
gcttattatactattgatcgtttcttgcattcagattattacggtaagaaggcaggtaag 1920
ttcgacattaagccagagcaaatgactgatgaagtatttgattacatctttactcgtcgt 1980
36
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gatgacgttgaaactgacattccaaaggaacaattgaaggaaatgagaagagagtttgaa 2040
tatttttacccattagacgtcagagtttcaggaaaagatttgatcccaaatcatttgaca 2100
ttcttcatctatacccatgtcgccttgttcccaaaaagattttggccaagaggtgttaga 2160
gccaacggacatttgttgttgaacaatgctaagatgtccaaatcaactggtaactttatg 2220
actttagaacaaatcattgaaaaattcggagctgatgcctctagaattgctatggccgat 2280
gcaggtgacactgttgaagatgccaactttgacgaagccaatgctaatgctgcaatcttg 2340
agattgacaactttgaaagattggtgtgaagaagaagtgaaaaaccaagataagttaaga 2400
attggtgactacgattccttctttgatgctgcttttgaaaatgaaatgaatgatttgatt 2460
gaaaagacttaccaacaatacactttgagtaattacaaacaagcattgaaatccggattg 2520
tttgatttccaaatcgccagagatatttatagagaaagtgtaaacacaacaggaattggt 2580
atgcacaaggatcttgttttgaaatacattgaataccaagcattgatgttagctccaatt 2640
gctcctcattttgccgaatacctttacagagaagttttaggtaaaaatggaagtgttcaa 2700
ctagcaagttcccaagagcctcaaagcctgtttccaaagctattcttgatgctctggaat 2760
atgtcagaagccttaccagatctatccgtgaagcagaaggtcaagctttgaaaaagaaga 2820
aaggaaagtctgatgttgatgggtcaaaaccaatcagcttgacagttttggtttccaaca 2880
ctttcccagaatggcaagataactatattgaacttgtcagagaattgtttgaacaaaaca 2940
agttggacgacaataatgttataagacaaaaggttggcaaggacatgaaacgtggtatgc 3000
catacatccaccaaattaaaactagattggcaactgaagatgctgacactgttttcaaca 3060
gaaaattgacttttgatgaaatcgatacattgaaaaatgttgttgaaattgtcaagaatg 3120
ccccatactctcttaaagttgaaaaattggagattcttagtttcaataacggtgaaacta 3180
aggggaagaatattattagtggtgaagacaatattgagctcaatttcaagggtaaaataa 3240
tggaaaatgctgtacctggtgagcctggtatctttattaaaaatgtcgaataa 3293
<210> 63
<211> 219
<212> PRT
<213> Candida albicans
<400> 63
Met Asp Ile Glu Thr Ala Ala Cys Phe Ser Ile Ala Phe Ile Ala Thr
1 5 10 15
Pro Ile Leu Ile Val Leu Val Arg Leu Leu Phe Ile Leu Pro Ser Leu
20 25 30
Arg Leu Pro Thr Ser Val Lys Lys Lys Lys Lys Leu Ile Gln Glu Cys
35 40 45
Gln Leu Ser Ile Leu Leu Gly Ser Gly Gly His Thr Gly Glu Met Met
50 55 60
Arg Ile Ile Ser Lys Leu Asp Met Gly Lys Val Ser Arg Thr Trp Ile
65 70 75 80
Tyr Thr Ser Gly Asp Asn Ala Ser Leu Ala Lys Ala Gln Asp Tyr Glu
85 90 95
Arg Lys Ser Gly Thr Ser Ser Gln Tyr Ile Pro Ile Pro Arg Ala Arg
100 105 110
Thr Val Gly Gln Ser Tyr Ile Ser Ser Ile Pro Thr Thr Ile Tyr Ser
115 120 125
Phe Leu Phe Ser Ala Ile Ala Met Leu Lys His Arg Pro Ala Val Ile
130 135 140
Leu Leu Asn Gly Pro Gly Thr Cys Val Pro Val Ala Tyr Ile Leu Phe
145 150 155 160
Leu Tyr Lys Leu Leu Gly Leu Cys Asn Thr Lys Ile Ile Tyr Ile Glu
165 170 175
Ser Leu Ala Arg Val Asn Lys Leu Ser Leu Ser Gly Leu Leu Leu Leu
180 185 190
Pro Ile Ser Asp Arg Phe Ile Val Gln Trp Glu Ser Leu Tyr Gln Gln
195 200 205
Tyr Ser Arg Val Glu Tyr Tyr Gly Ile Leu Ile
210 215
37
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 64
<211> 167
<212> PRT
<213> Candida albicans
<400> 64
Met Gly Thr Asn Asn Lys Thr Val Thr Asn Lys Ser Asn Lys Arg Ile
1 5 10 15
Gln Gly Lys Arg His Ile Lys His Ser Pro Asn Leu Thr Pro Phe Asn
20 25 30
Glu Thr Gln Asn Ala Ser Asn Phe Leu Ile Lys Ser Ser Thr Pro Tyr
35 40 45
Ile Ser Ala Ile Lys Gln Ile Thr Lys Lys Leu Asn Lys Phe Ser Lys
50 55 60
Ser Lys Asn Ser His Thr Ile Asn Lys Phe Gln Asn Glu Gln Tyr Lys
65 70 75 80
Thr Ile Lys Tyr Ile Ala Val Lys Gly Met Gly Lys Thr Ile Glu Lys
85 90 95
Val Ala Ser Ile Gly Thr His Phe Gln Lys Asp Tyr Lys Val Asp Val
100 105 110
Leu Thr Gly Ser Thr Thr Val Leu Asp Glu Phe Ala Pro Ile Glu Ser
115 120 125
Asn Gln Glu Pro Asp Asn Glu Asn Lys Ser Asp Asp Asp Asp Asp Asp
130 135 140
Asp Asp Glu Thr Ile Tyr Lys Lys Arg Thr Val Ser Ser Ile Glu Ile
145 150 155 160
Arg Ile Trp Ile Lys Arg Asp
165
<210> 65
<211> 494
<212> PRT
<213> Candida albicans
<400> 65
Met Leu Ala Arg Leu Leu Lys Leu Ala Ile Val Val Ala Ala Ile Ala
1 5 10 15
Ala Ile Thr Pro Asn Asn Pro Ile Arg Thr Ser Ile Ser Phe Gly Cys
20 25 30
Ile Gly Tyr Val Ala Thr Leu Ser Val .Ile Pro Lys Val Ser Pro Ser
35 40 45
Phe Val Lys Ile Gly Leu Lys Gly Lys Asp Leu Ser Lys Pro Pro Pro
50 55 60
Val Ser Glu Ile Pro Glu Thr Met Gly Leu Val Ala Ser Thr Thr Tyr
65 70 75 80
Met Phe Leu Met Phe Gly Leu Ile Pro Phe Ile Phe Phe Lys Tyr Leu
85 90 95
Val Ser Phe Gly Ser Met Ser Asn Asp Glu Val Ile Thr Lys Asn Tyr
100 105 110
Leu Ser Gln Tyr Gln Ser Leu Ala Asp Asn Arg Leu Phe Pro His Asn
115 120 125
Lys Leu Ala Glu Tyr Leu Ser Ala Leu Leu Cys Leu Gln Ser Thr Thr
130 135 140
Leu Leu Gly Leu Leu Asp Asp Leu Phe Asp Ile Arg Trp Arg His Lys
145 150 155 160
Phe Phe Leu Pro Ala Val Ala Ser Leu Pro Leu Leu Ile Val Tyr Tyr
165 170 175
38
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Val Asp Phe Ser Val Thr Ser Val Val Ile Pro Lys Phe Val Thr Glu
180 185 190
Phe Pro Gly Gly Tyr Val Leu Ile Asn Thr Ile Asn Phe Phe Ile Lys
195 200 205
Tyr Ser Asn His Leu Val Thr Ser Ile Thr Gly Leu Ser Phe Arg Thr
210 215 220
Leu Gln Thr Asp Tyr Val Val Pro Asp Ser Ser Pro Lys Leu Ile Asp
225 230 235 240
Leu Gly Ile Phe Tyr Tyr Val Tyr Met Ser Ala Ile Ser Ile Phe Ser
245 250 255
Pro Asn Ser Ile Asn Ile Leu Ala Gly Val Asn Gly Leu Glu Val Gly
260 265 270
Gln Ser Leu Val Leu Ala Ala Ile Phe Leu Ile Asn Asp Phe Cys Tyr
275 280 285
Leu Phe Ser Pro Gly Ile Ser Gln Ala Ala His Asp Ser His Met Phe
290 295 300
Ser Val Val Phe Ile Ile Pro Phe Val Gly Val Ser Leu Ala Leu Leu
305 310 315 320
Gln Tyr Asn Trp Phe Pro Ala Arg Val Phe Val Gly Asp Thr Tyr Cys
325 330 335
Tyr Phe Ser Gly Met Val Phe Ala Ile Val Gly Ile Ile Gly His Phe
340 345 350
Ser Lys Thr Leu Leu Ile Phe Leu Leu Pro Gln Ile Ile Asn Phe Val
355 360 365
Tyr Ser Val Pro Gln Leu Phe His Ile Leu Pro Cys Pro Arg His Arg
370 375 380
Leu Pro Arg Phe Ser Ile Glu Asp Gly Leu Met His Pro Ser Phe Ala
385 390 395 400
Glu Leu Lys Lys Ala Ser Arg Leu Asn Leu Ala Ile Leu Glu Thr Leu
405 410 415
Ser Phe Phe Lys Leu Ile Lys Val Glu Arg Gly Ser Lys Ser Asn Gln
420 425 430
Ile Val Arg Phe Ser Asn Met Thr Ile Ile Asn Leu Thr Leu Val Trp
435 440 445
Val Gly Pro Leu Arg Glu Asp Gln Leu Cys Ile Ser Ile Leu Val Val
450 455 460
Gln Phe Val Ile Gly Val Thr Met Ile Val Val Arg His Thr Ile Gly
465 470 475 480
Pro Trp Leu Phe Gly Tyr Asp Asn Leu Ser Trp Gly Val Lys
485 490
<210> 66
<211> 280
<212> PRT
<213> Candida albicans
<400> 66
Met Ala Pro Thr Glu Ile Lys Gly Phe Tyr Val Leu Pro Leu Lys Leu
1 5 10 15
Thr Gly Thr Lys Ser Ile His Tyr Ile Tyr Phe Lys Lys His Glu Ser
20 25 30
Lys Gly Thr Ala Asn Asp Asn Arg Ser Leu Phe Ile Cys Asn Leu Pro
35 40 45
Ile Ser Thr Asp Leu Ser Thr Ile Lys Lys Phe Phe Gln Lys Val Ala
50 55 60
Ile Gly Ser Thr Ile Glu Ser Phe Ile Asn Ser Leu Leu Thr Asp Tyr
65 70 75 80
39
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Pro Glu Asp Ile Trp Ile Asn Leu Thr Lys Leu Thr Ser Asp Leu Asp
85 90 95
Leu Val Asp Ala Val Asp Glu Gln Ala Ser Lys Leu Pro Lys Asn Cys
100 105 110
Gly Ile Val Ala Phe Ile Asp Lys Ala Ser Phe Thr Leu Ala Phe Asn
115 120 125
Ser Leu Lys Lys Leu Ser Ser Ser Leu Thr Glu Cys Glu Trp Pro Ile
130 135 140
Gln Gln Phe Thr Ser Asn Tyr Tyr Leu Lys Gln Tyr Gln Lys Gln Ile
145 150 155 160
Leu Asp Pro Asn Ser Leu Thr Glu Glu Val Ser Gln Ala Leu Ile Asp
165 170 175
Phe Asp Lys Ala Glu Gln Gln Ser Ile Glu Glu Leu Gln Ser Gln Arg
180 185 190
Asn Leu Val Asp Glu Asp Gly Phe Thr Leu Val Val Gly Ser His Arg
195 200 205
Lys Thr Lys Ala Gly Ile Leu Gly Lys Gln Lys Leu Ala Ser Thr Val
210 215 220
Gly Val Val Lys Ala Gln Ser Lys Met Lys Ser Lys Glu Lys Gln Asp
225 230 235 240
Phe Tyr Arg Phe Gln Leu Arg Gln Arg Lys Lys Glu Glu Met Asn Glu
245 250 255
Leu Leu Asn Lys Phe Lys Leu Asp Gln Glu Lys Val Arg Met Met Lys
260 265 270
Glu Lys Lys Arg Phe Arg Pro Tyr
275 280
<210> 67
<211> 371
<212> PRT
<213> Candida albicans
<400> 67
Met Thr Asp Thr Gln Pro Arg Lys Ile Arg Lys Val Ser Thr Gln Glu
1 5 10 15
Gln Ile Glu Asp Tyr Glu Lys Leu Arg Gln Arg Ile Lys Asn His Phe
20 25 30
Lys Asp Ala Leu Lys Gly Lys Gly Ser Ser Met Ser Leu His Tyr Ile
35 40 45
Asp Glu Ile Thr Glu Leu Tyr Lys Arg Val Gln Ser Gln Lys Val Lys
50 55 60
Asp Thr Arg Val His Leu Glu Asp Ser Glu Val Phe Lys Glu Ala Ser
65 70 75 80
Asp Phe Ala Ala Leu Asn Ala Arg Asn Ile Val Phe Asp Asp Ser Gly
85 90 95
Ile Ala Leu Asp Asp Lys Glu Phe Phe Lys Cys Leu Arg Arg Phe Ala
100 105 110
Val Thr Asp Pro Ser Leu Leu Ser Arg Asn Asp Ile Gly Asp Asn Asp
115 120 125
Gly Asn Asn Ser Asn Asp Glu Asp Asp Val Asp Asp Asp Asp Ser Asp
130 135 140
Glu Glu Glu Glu Ala Ile Thr Asp Glu Tyr Thr Phe Asn Lys Thr Asn
145 150 155 160
Trp Leu Lys Leu Gly Ile Leu Tyr His Gln Val Ser Lys Lys Ser Ile
165 170 175
Ser Val Asp Phe Leu Asn Gly Pro Leu Lys Ala G1u Lys Arg Lys Ile
180 185 190
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Val Arg Ala Arg Asn Val Asp Asp Thr Lys Gly Ser Gly Met Ala Lys
195 200 205
Thr Ala Arg Gln Val Gln Ala Ser Asp Ile Ser Gly Asn Gln Glu Gln
210 215 220
Asn Thr Ala Asn Met Val Lys Ser Val Tyr Gln Thr Tyr Ile Glu Lys
225 230 235 240
Tyr Asp Gly Asn Gly Val Asn Leu Phe Lys Phe Phe Ile Asn Pro Arg
245 250 255
Ser Phe Gly Gln Ser Val Glu Asn Leu Phe Tyr Thr Ser Phe Leu Val
260 265 270
Lys Asp Gly Arg Leu Lys Leu Tyr Val Asn Asn Asp Gly Met Pro Cys
275 280 285
Ile Gln Arg Val Ser Ser Asp Glu Ile Arg Glu Ala Gln Leu Glu Ser
290 295 300
Asn Lys Ile Phe Ala Ser His His Ile Ala Ser Phe Asn Tyr Lys Ala
305 310 315 320
Trp Lys Lys Tyr Thr Gln Leu Tyr Asn Ile Arg Glu Ala Phe Leu Gly
325 330 335
His Arg Asp Glu Pro Glu Asp Gln Met Pro Pro Glu Asp Ile Ile Asp
340 345 350
Tyr Asn Asp Glu Glu Pro Ile Pro Ser Ser Gln Arg Arg Asp Ser Asn
355 360 365
Ser Ser Asp
370
<210> 68
<211> 564
<212> PRT
<213> Candida albicans
<400> 68
Met Ala Arg Arg Asn Arg Asn Lys Thr Val Asn Glu Glu Glu Ile Glu
1 5 10 15
Leu Asp Glu Val Asp Ser Phe Asn Ala Asn Arg Glu Lys Ile Leu Leu
20 25 30
Asp Glu Ala Gly Glu Tyr Gly Arg Asp Asp Gln Ser Glu Glu Asp Asp
35 40 45
Ser Glu Glu Glu Val Met Gln Val Glu Glu Asp Ser Glu Asp Asp Glu
50 55 60
Glu Asp Gln Glu Asp Glu Glu Glu Glu Glu Glu Glu Glu Glu Gly Glu
65 70 75 80
Glu Glu Glu Glu Glu Glu Glu Lys Gly Trp Gly Gly Arg Gln Asn Tyr
85 90 95
Tyr Gly Gly Asp Asp Leu Ser Asp Asp Glu Asp Ala Lys Gln Met Thr
100 105 110
Glu Glu Ala Leu Arg Gln Gln Lys Lys His Leu Gln Glu Leu Ala Met
115 120 125
Asp Asp Tyr Leu Asp Asp Glu Met Met Glu Asp Trp Gln Lys Lys Ala
130 135 140
Asp Ser Tyr Asp Asn Lys Asp Thr Ser Ser Ser Thr Gln Gln Gln Gln
145 150 155 160
Gln Gln Gln Leu Ile Ile Glu Ser Asn Ser Ser Ile Ala Asn Leu Glu
165 170 175
Asp Ser Asp Lys Leu Lys Leu Leu Gln Gln Ser Phe Pro Glu Phe Ile
180 185 190
Pro Leu Leu Lys Glu Leu Asn Ser Leu Lys Val Lys Leu Glu Asp Leu
195 200 205
41
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Gln Lys Leu Glu Asp Lys Asn Lys Cys Ile Glu Thr Lys Ile Val Ala
210 215 220
Leu Ser Ala Tyr Leu Gly Ala Ile Ser Ser Tyr Phe Ala Ile Phe Val
225 230 235 240
Asp Asn Leu Asn Asn Glu Glu Ser Phe Val Ser Met Lys Asp Asn Pro
245 250 255
Ile Met Glu Thr Ile Leu Ser Ser Arg Glu Ile Trp Arg Gln Ala Asn
260 265 270
Glu Leu Pro Asp Asp Ile Lys Leu Asp Asp Val Lys Val His Val Ser
275 280 285
Asp Val Val Ser Ser Ser Asp Ile Asp Asp Glu Asp Asn Phe Val Asp
290 295 300
Ala Lys Glu Glu Gln Ser Glu Asp Glu Glu Ile Ser Glu Glu Glu Val
305 310 315 320
Ser Gln Asp Glu Asp Glu Asp Gln Ser Asp Asp Leu Asp Ile Asp Ala
325 330 335
Asn Ser Glu Arg Ile Ile Lys His Val Ser Lys Lys His Gly Asp Asp
340 345 350
Phe Thr Glu Ala Asp Ile Glu Asp Ile Asp Met Glu Asp Lys Gln Arg
355 360 365
Arg Lys Lys Thr Leu Arg Phe Tyr Thr Ser Lys Ile Asp Lys Ala Ala
370 375 380
Ala Lys Lys Asp Gln Ser Tyr Ser Gly Asp Ile Asp Val Pro Tyr Lys
385 390 395 400
Glu Arg Leu Phe Glu Arg Gln Gln Arg Leu Leu Glu Glu Ala Arg Lys
405 410 415
Arg Gly Leu Gln Lys Gln Asp Asp Glu Asn Ile Ser Asp Asn Asp Asn
420 425 430
Asp Asn Asp Gly Val Asn Asp Asp Glu Gly Phe Glu Gln Gly Asp Asp
435 440 445
Tyr Tyr Glu Ser Ile Lys Gln His Lys Leu Asn Lys Lys Gln Ser Arg
450 455 460
Lys Ser Ala His Glu Ala Ala Val Lys Ala Ala Lys Glu Gly Lys Leu
465 470 475 480
Ala Glu Leu Gln Glu Ala Val Gly Gln Asp Gly Lys Arg Ala Ile Asn
485 490 495
Tyr Gln Ile Leu Lys Asn Lys Gly Leu Thr Pro His Arg Lys Lys Glu
500 505 510
Tyr Arg Asn Ser Arg Val Lys Lys Arg Lys Gln Tyr Glu Lys Ala Gln
515 520 525
Lys Lys Leu Lys Ser Val Arg Gln Val Tyr Asp Ala Asn Asn Arg Gly
530 535 540
Pro Tyr Glu Gly Glu Lys Thr Gly Ile Lys Lys Gly Leu Ser Lys Ser
545 550 555 560
Val Lys Leu Val
<210> 69
<211> 506
<212> PRT
<213> Candida albicans
<400> 69
Met Ser Lys Val Glu Glu His Glu Ser Val Asn Asn Leu Lys Arg Lys
1 5 10 15
Phe Pro Ser Leu Ala Lys Pro Arg Gln Pro Leu Lys Glu Thr Asn Ser
20 25 30
42
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asn Ile Pro Ser Pro His Lys Arg Ala Lys Ile Glu Ser Pro Ser Lys
35 40 45
Gln Gln Ser Thr Gln Gln Pro Gln Gln Gln Pro Gln Pro Gln Pro Gln
50 55 60
Pro Gln Pro Gln Gln Glu Lys Ala Thr His Lys Pro Lys Lys Ser Ser
65 70 75 80
His Gln Ser Lys Asn Asn Asp Lys Leu Ala Gly Asp Glu Met His Glu
85 90 95
Trp Gln Gln Ser Trp Arg Arg Ile Met Lys Ser Ser Ile Val Tyr Phe
100 105 110
Glu Gly Asp Gln Gln Ser Leu Glu Tyr Arg Lys Ala His Lys Leu Leu
115 120 125
Arg Leu Val Gly Cys Lys Val Thr Pro Phe Tyr Asp Asn Asn Val Thr
130 135 140
Ile Ile Ile Ser Lys Arg Pro Tyr Asp Ser Lys Thr Glu Tyr Ser Pro
145 150 155 160
His Asp Ile Phe Ser Asn Val Ser Lys Ala Ser Ile Lys Val Trp Asn
165 170 175
Tyr Asp Lys Val Phe Arg Phe Leu Lys His Leu Gly Ile Asn Ile Gln
180 185 190
Thr Gly Val Asp Glu Leu Ala Val Asn Thr His Thr Ile Leu Pro Pro
195 200 205
Ser Leu Thr Asn Asn Asn Glu Lys Pro Asp Leu Tyr Asn Leu Leu Lys
210 215 220
Glu Glu Lys Ile Tyr Gly Ser Thr Asp Arg Asp Pro Asn Ala Lys Arg
225 230 235 240
Asp Asp Leu His Tyr Leu Gly Lys Asn Tyr Leu Tyr Val Tyr Asp Leu
245 250 255
Thr Gln Thr Val Arg Pro Ile Ala Ile Arg Glu Trp Ser Asp His Tyr
260 265 270
Pro Val Met Gln Leu Ser Leu Asp Gly Lys Cys Pro Phe Ile Glu Asp
275 280 285
Pro Thr Asp Gln Asn Ser Glu Arg Lys Arg Leu Lys Arg Leu Arg Lys
290 295 300
Phe Glu Ala Asn Gln Ala His Arg Glu Ala Leu Arg Leu Ala Thr Tyr
305 310 315 320
Lys Met Ile Asn Gly Ile Ser Met Ser Val His Gly Phe Thr Ala Thr
325 330 335
Ser Thr Ser Thr Asp Lys Val Asp Glu Glu Glu Asp Ser Thr Val Lys
340 345 350
Glu Pro Ser Glu Asp Pro Arg Phe Arg Gln Pro Leu Asn Arg Asn Ser
355 360 365
Ser Cys Met Gln Ser Lys Ala Phe Glu Ala Met Ala Ser Gly Tyr Asn
370 375 380
Gly Ala Ser Asn Ala Val Gln Pro Ser Met Asp Ser Asn Leu Asn Ser
385 390 395 400
Ala Ala Ala Met Ala Gly Gly Asn Gly Leu Gly Pro Ala Leu Ser Gln
405 410 415
Val Pro Ser Lys Gln Leu Asn Asn Leu Lys Arg Arg Ile Leu Met Lys
420 425 430
Lys Lys Thr Thr Asn Thr Thr Glu Lys Lys Asp Lys Glu His Ala Ser
435 440 445
Gly Tyr Cys Glu Asn Cys Arg Val Lys Tyr Thr Asn Phe Asp Glu His
450 455 460
Ile Met Thr Asn Arg His Arg Asn Phe Ala Cys Asp Asp Arg Asn Phe
465 470 475 480
Gln Asp Ile Asp Glu Leu Ile Ala Ser Leu Arg Glu Arg Lys Ser Leu
485 490 495
43
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Gly Asn Val Ile Ser Asn Gly Asp Tyr Val
500 505
<210> 70
<211> 532
<212> PRT
<213> Candida albicans
<400> 70
Met Lys Pro Met Val Thr Thr Leu Tyr Asn Gly Lys Leu Pro Leu Ala
1 5 10 15
Leu Ala Asp Pro Asn Gly Ile Phe Thr Trp Cys Pro His Leu Asn Leu
20 25 30
Ile Phe Ile Ala Met Asn Lys Met Ser Ile Trp Cys Tyr Arg Met Asn
35 40 45
Gly Glu Arg Ile Tyr Ser Ile Asn Asn Lys Ser Ile Val Lys His Ile
50 55 60
Ala Phe Tyr Arg Glu Tyr Phe Cys Leu Ser Gly Thr Asp Asn Leu Ile
65 70 75 80
Lys Ile Tyr Asp Ser Asn Asn Gly Gln Leu Val Lys Val Leu Pro Gln
85 90 95
Glu Phe Asp Gly Val Glu Phe Val Gly Trp Asn Gly Thr Glu Tyr Arg
100 105 110
Val Ser Val Ser Met Pro Met Val Tyr Asp Leu Val Ser Glu Leu Asp
115 120 125
Tyr Leu Val Val Ser Asp Gly Lys Arg Met Ala Ile Thr Phe Asn Gln
130 135 140
Leu Leu Thr Val Asp Trp Glu Cys Glu Met Ser Val His Gln Gln Leu
145 150 155 160
Asn Arg Asp Leu Phe Asn Gln Val Tyr Val Ala Gly Asp Lys Leu Val
165 170 175
Arg Val Arg Phe Val Val Asp Asn Gln Lys Leu Tyr Thr Glu Gln Ile
180 185 190
Ile Lys Val Cys Gln Leu Ile Ser Leu Leu Glu Tyr Gly Glu Gln His
195 200 205
Ile Gln Lys Ile Lys Gly Leu Val Val Pro Phe Leu Ser Ala Met Asp
210 215 220
Arg Tyr Met Ser Asn Leu Glu Ser Glu Cys Gly Asp Leu Ala Gln Tyr
225 230 235 240
Leu Ser Asp Leu Val Val Ser Asn Ile Ile Pro Glu Phe Ser Lys Asp
245 250 255
Phe Trp Leu Asn Gln Tyr Gly Glu Arg Gly His Lys Arg Met Val Lys
260 265 270
Leu Ala Gly Val Tyr Glu Ser Cys Val Lys Asp Thr Tyr Gln His Leu
275 280 285
Val Ser Thr Thr Glu Arg Val Ile Ser Ile Val Gly Glu Leu Ile Gly
290 295 300
Val Ser Lys Trp Glu Gln Gly Leu Leu Ala Thr Thr Glu Leu Glu Ala
305 310 315 320
Leu Leu Asp Gln Ala Lys Ser Gln Leu Lys Phe Tyr Tyr Arg Phe Ile
325 330 335
Trp Asp Leu Gln Thr Glu Arg Gln Gln Val Ser Gln Phe Leu Val Trp
340 345 350
Thr Lys Ser Ile Ile Asp Met Leu Asn Asp Gln Glu Cys Asp Ile Ala
355 360 365
Tyr Ser Thr Thr Asp Val Leu Cys Phe Ile Asn Gly Ala Leu Thr Lys
370 375 380
44
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ser Val Met Leu Lys Tyr Phe Asp Ile Lys Gly Val Pro Glu Thr Pro
385 390 395 400
Met Thr Asn Ile Ser Met Asp Leu Thr Thr Ile Gly Glu Tyr His Arg
405 410 415
Ser Arg Val Glu Val Glu Val Leu Gln Asn Ile Ser Leu Pro Ser Val
420 425 430
Tyr Thr Asn Leu Lys Leu Ala Gln Trp Glu Glu Val Val Val Thr Tyr
435 440 445
Gln Gln Gly Asn Ala Leu Val Ile Ala Asn Val Asp Gly Val Val Ser
450 455 460
Thr Val Gln Asp Val Tyr Ser Tyr Gln His Arg Gln Thr Asp Leu Val
465 470 475 480
Ala Leu Thr Ser Lys Ser Leu Leu Ile Ile Asp Ser Ser Ser Cys Ile
485 490 495
Pro Ile Ala Leu Pro Glu Thr Ser Phe Gln Pro Thr Lys Leu Ile Leu
500 505 510
Asn Gln Glu Tyr Gly Val Leu Leu Asp Ser Thr Arg Gln His Tyr Ser
515 520 525
Ile Phe Arg Met
530
<210> 71
<211> 319
<212> PRT
<213> Candida albicans
<400> 71
Met Gly Lys Arg Arg Val Asp Glu Glu Ser Asp Ser Asp Ile Asp Val
1 5 10 15
Ser Ser Pro Asp Ser Glu Thr Glu Leu Glu Ser Thr His His His His
20 25 30
His His Gln Glu Gly Ala Thr Thr Ile Gln Glu Thr Val Asp Val Asp
35 40 45
Phe Asp Phe Phe Asp Leu Asn Pro Gln Ile Asp Phe His Ala Thr Lys
50 55 60
Asn Phe Leu Arg Gln Leu Phe Gly Asp Asp Asn Gly Glu Phe Asn Leu
65 70 75 80
Ser Glu Ile Ala Asp Leu Ile Leu Arg Glu Asn Ser Val Gly Thr Ser
85 90 95
Ile Lys Thr Glu Gly Met Glu Ser Asp Pro Phe Ala Ile Leu Ser Val
100 105 110
Ile Asn Leu Thr Asn Asn Leu Asn Val Ala Val Ile Lys Gln Leu Ile
115 120 125
Glu Tyr Ile Leu Asn Lys Thr Lys Ser Lys Thr Glu Phe Asn Ile Ile
130 135 140
Leu Lys Lys Leu Leu Thr Asn Gln Asn Asp Thr Thr Arg Asp Arg Lys
145 150 155 160
Phe Lys Thr Gly Leu Ile Ile Ser Glu Arg Phe Ile Asn Met Pro Val
165 170 175
Glu Val Ile Pro Pro Met Tyr Lys Met Leu Leu Gln Glu Met Glu Lys
180 185 190
Ala Glu Asp Ala His Glu Asn Glu Phe Asp Tyr Phe Leu Ile Ile Ser
195 200 205
Arg Val Tyr Gln Leu Val Asp Pro Val Glu Arg Glu Asp Glu Asp His
210 215 220
Glu Lys Glu Ser Asn Arg Lys Lys Lys Asn Lys Asn Lys Lys Lys Lys
225 230 235 240
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Leu Ala Asn Asn Glu Pro Lys Pro Ile Glu Met Asp Tyr Phe His Leu
245 250 255
Glu Asp Gln Ile Leu Glu Asn Thr Gln Phe Lys Gly Ile Phe Glu Tyr
260 265 270
Asn Asn Glu Asn Lys Gln Glu Thr Asp Ser Arg Arg Val Phe Thr Glu
275 280 285
Tyr Gly Ile Asp Pro Lys Leu Ser Leu Ile Leu Ile Asp Lys Asp Asn
290 295 300
Leu Ala Lys Ser Val Ile Glu Met Glu Gln Gln Phe Pro Pro Pro
305 310 315
<210> 72
<211> 266
<212> PRT
<213> Candida albicans
<400> 72
Met Ala Gly Phe Lys Lys Asn Arg Glu Ile Leu Thr Gly Gly Lys Lys
1 5 10 15
Tyr Ile Gln Gln Lys Gln Lys Lys His Leu Val Asp Glu Val Val Phe
20 25 30
Asp Lys Glu Ser Arg His Glu Tyr Leu Thr Gly Phe His Lys Arg Lys
35 40 45
Leu Gln Arg Gln Lys Lys Ala Gln Glu Phe His Lys Glu Gln Glu Arg
50 55 60
Leu Ala Lys Ile Glu Glu Arg Lys Gln Leu Lys Gln Glu Arg Glu Arg
65 70 75 80
Asp Leu Gln Asn Gln Leu Gln Gln Phe Lys Lys Thr Ala Gln Glu Ile
85 90 95
Ala Ala Ile Asn Asn Asp Ile Gly Phe Asp Gln Ser Asp Asp Asn Asn
100 105 110
Asp Asn Asp Asn Glu Glu Trp Ser Gly Phe Gln Glu Asp Glu Glu Gly
115 120 125
Glu Gly Glu Glu Val Thr Asp Glu Asp Asp Glu Asp Lys Glu Lys Pro
130 135 140
Leu Lys Gly Ile Leu His His Thr Glu Ile Tyr Lys Gln Asp Pro Ser
145 150 155 160
Leu Ser Asn Ile Thr Asn Asn Gly Ala Ile Ile Asp Asp Glu Thr Thr
165 170 175
Val Val Val Glu Ser Leu Asp Asn Pro Asn Ala Val Asp Thr Glu Glu
180 185 190
Lys Leu Gln Gln Leu Ala Lys Leu Asn Asn Val Asn Leu Asp Lys Ser
195 200 205
Asp Gln Ile Leu Glu Lys Ser Ile Glu Arg Ala Lys Asn Tyr Ala Val
210 215 220
Ile Cys Gly Val Ala Lys Pro Asn Pro Ile Lys Gln Lys Lys Lys Lys
225 230 235 240
Phe Arg Tyr Leu Thr Lys Ala Glu Arg Arg Glu Asn Val Arg Lys Glu
245 250 255
Lys Ser Lys Ser Lys Ser Lys Gly Lys Lys
260 265
<210> 73
<211> 332
<212> PRT
<213> Candida albicans
<400> 73
46
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Met Ser Thr Val Tyr Tyr Lys Lys Leu Asp Lys Leu Gln Phe Gln Ile
1 5 10 15
Tyr Asp Leu Phe Ser Ser Leu Leu Gln Leu Ser Glu Ala Glu Asp Glu
20 25 30
Ser Val Tyr Lys Ala Ser Phe Asp Asp Thr Val Gln Glu Ile Asp Ser
35 40 45
Leu Leu Ile Ala Phe Lys Asp Leu Leu Arg Leu Leu Arg Pro Lys Asp
50 55 60
Lys Ser Asn Lys Phe Asp Thr Tyr Glu Leu Lys Phe His Ser Leu Lys
65 70 75 80
His Lys Leu Arg Glu Leu Gln Val Phe Ile Asn Asp Gln Gln Gln Asp
85 90 95
Lys Leu His Glu Tyr Arg Ile Lys His Phe His Leu Gln Asp Ser Pro
100 105 110
Val Asp Thr Ile Asn Asn Glu Phe Ala Arg Asp Gln Leu Phe Ala Asp
115 120 125
Arg Ser Thr Lys Lys Thr Lys Lys Glu Met Glu Ala Ser Ile Asn Gln
130 135 140
Gln Ile Val Ser Gln Asn Lys Gln Ile Thr Lys Ser Leu Gln Ala Ser
145 150 155 160
Arg Gln Leu Leu Ser Ala Gly Ile Leu Gln Ser Glu Leu Asn Ile Asp
165 170 175
Asn Ile Asp Gln Gln Thr Lys Asp Leu Tyr Lys Leu Asn Glu Gly Phe
180 185 190
Ile Gln Phe Asn Asp Leu Leu Asn Arg Ser Lys Lys Ile Val Lys Phe
195 200 205
Ile Glu Lys Gln Asp Lys Ala Asp Arg Gln Arg Ile Tyr Leu Ser Met
210 215 220
Gly Phe Phe Ile Leu Cys Cys Ser Trp Val Val Tyr Arg Arg Ile Leu
225 230 235 240
Arg Arg Pro Leu Lys Ile Phe Leu Trp Ser Phe Phe Lys Ile Phe Asn
245 250 255
Ile Phe Asn Trp Leu Leu Gly Gly Gly Arg Ser Lys Gly Leu Ser Ala
260 265 270
Ser Asp Met Ile Val Ser Ser Val Ile Ala Ala Thr Thr Glu Ile Val
275 280 285
Asp Tyr Glu Ala Thr Lys Thr Leu Leu Asp Thr Leu Ser Asn Ala Val
290 295 300
Asp Ser Asn Thr Ala Ile Asp Thr Leu Ala Met Val Val Glu Ser Leu
305 310 315 320
Thr Thr Ser Ser Met Glu His Ile Val Asp Glu Leu
325 330
<210> 74
<211> 273
<212> PRT
<213> Candida albicans
<400> 74
Met Thr Asp Ser Ser Ala Thr Gly Phe Ser Lys His Gln Glu Ser Ala
1 5 10 15
Ile Val Ser Asp Ser Glu Gly Asp Ala Ile Asp Ser Glu Leu His Met
20 25 30
Ser Ala Asn Pro Pro Leu Leu Arg Arg Ser Ser Ser Leu Phe Ser Leu
35 40 45
Ser Ser Lys Asp Asp Leu Pro Lys Pro Asp Ser Lys Glu Tyr Leu Lys
50 55 60
47
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Phe Ile Asp Asp Asn Arg His Phe Ser Met Ile Arg Asn Leu His Met
65 70 75 80
Ala Asp Phe Ile Thr Leu Leu Asn Gly Phe Ser Gly Phe Tyr Ser Ile
85 90 95
Ile Ser Cys Leu Arg Tyr Thr Leu Thr Gly Gln Thr His Tyr Val Gln
100 105 110
Arg Ala His Phe Phe Ile Leu Leu Gly Leu Phe Phe Asp Phe Phe Asp
115 120 125
Gly Arg Val Ala Arg Leu Arg Asn Lys Ser Ser Leu Met Gly Gln Glu
130 135 140
Leu Asp Ser Leu Ala Asp Leu Val Ser Phe Gly Val Ser Pro Ala Thr
145 150 155 160
Ile Ala Phe Ala Ile Gly Phe Arg Thr Thr Val Asp Val Leu Phe Leu
165 170 175
Ala Phe Trp Val Leu Cys Gly Leu Thr Arg Leu Ala Arg Phe Asn Ile
180 185 190
Ser Val Asn Asn Ile Pro Lys Asp Lys His Gly Lys Ser Gln Tyr Phe
195 200 205
Glu Gly Leu Pro Ile Pro Thr Asn Leu Phe Trp Val Gly Phe Met Ala
210 215 220
Leu Leu Val Tyr Lys Asp Trp Ile His Asp Asn Leu Pro Phe Gly Ile
225 230 235 240
Val Phe Gln Asp Thr Ser Phe Glu Phe His Leu Val Thr Ile Gly Phe
245 250 255
Val Leu Gln Gly Cys Ala Glu Ile Ser Lys Ser Leu Lys Ile Pro Lys
260 265 270
Pro
<210> 75
<211> 1175
<212> PRT
<213> Candida albicans
<400> 75
Met Ala Lys Arg Lys Leu Glu Glu Asn Asp Ile Ser Thr Ile Glu Asp
1 5 10 15
Asp Glu Phe Lys Ser Phe Ser Asp Arg Asp Glu Gln Ile Asp Glu Leu
20 25 30
Ser Asn Gly His Ala Lys His Arg Glu Asn Asn Ala Gln Glu Ser Asp
35 40 45
Asp His Ser Ala Ser Glu Asp Asp Asp Asp Glu Asp Asp Glu Glu Glu
50 55 60
Gly Glu Lys Ser Val Gln Pro Pro Asn Lys Lys Gln Lys Lys Gln Leu
65 70 75 80
Ser Ala Gln Asp Val Gln Val Ala Arg Glu Thr Ala Glu Leu Phe Lys
85 90 95
Ser Asn Ile Phe Lys Leu Gln Ile Asp Glu Leu Met Lys Glu Val Lys
100 105 110
Val Lys Lys Ala His Glu Glu Lys Ile Glu Lys Val Leu His Arg Leu
115 120 125
His Asp Leu Ile Lys Gln Val Pro Pro Val Glu Asn Leu Thr Leu Gln
130 135 140
Gln Ala Glu Gln His Phe Asn Pro Lys Lys Leu Val Ile Pro Phe Pro
145 150 155 160
Asp Pro Lys Pro Thr Lys Val Asn Tyr Arg Phe Ser Tyr Leu Pro Ser
165 170 175
48
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Gly Asp Leu Ser Leu Val Gly Ser Tyr Gly Leu Lys Thr Ala Ile Asn
180 185 190
Gln Pro His Gly Gln Ser Ile Glu Val Ala Leu Thr Met Pro Lys Glu
195 200 205
Leu Phe Gln Pro Lys Asp Tyr Leu Asn Tyr Arg Ala Leu Tyr Lys Lys
210 215 220
Ser Phe Tyr Leu Ala Tyr Leu Gly Glu Asn Leu Ile His Leu Ser Lys
225 230 235 240
Lys Asn Asn Leu Pro Ile Lys Val Ser Tyr Gln Phe Phe Asn Asp Asp
245 250 255
Val Leu Asn Pro Val Leu Lys Ile Glu Ser Ile Gln Thr Glu Asn Pro
260 265 270
Glu Asp Leu Thr Phe Thr Lys Thr Lys Ile Ala Ile Asn Leu Ile Val
275 280 285
Ala Phe Pro Phe Gly Val Phe Asp Ser Lys Lys Leu Leu Pro Asp Lys
290 295 300
Asn Cys Ile Arg Val Gln Ser Asp Thr Glu Thr Leu Pro Pro Thr Pro
305 310 315 320
Leu Tyr Asn Ser Ser Val Leu Ser Gln Thr Ser Tyr Asp Tyr Tyr Leu
325 330 335
Lys Tyr Leu Tyr Thr Thr Lys Lys Ser Thr Glu Ala Phe Lys Asp Ala
340 345 350
Cys Met Leu Gly Lys Leu Trp Leu Gln Gln Arg Gly Phe Asn Ser Ser
355 360 365
Leu Asn Asn Gly Gly Phe Gly His Phe Glu Phe Ala Ile Leu Met Ser
370 375 380
Ala Leu Leu Asn Gly Gly Gly Leu Asn Gly Asn Lys Ile Leu Leu His
385 390 395 400
Gly Phe Ser Ser Tyr Gln Leu Phe Lys Gly Thr Ile Lys Tyr Leu Ala
405 410 415
Thr Met Asp Leu Asn Gly Gly Tyr Leu Ser Phe Ser Ser Leu Ile Gly
420 425 430
Glu Asn Ile Ala Ser Lys Tyr Lys Ser Asp Gly Phe Asn Val Pro Thr
435 440 445
Ile Phe Asp Lys Asn Thr Lys Leu Asn Ile Leu Trp Lys Met Thr Lys
450 455 460
Ser Ser Tyr Lys Ser Leu Gln Leu Gln Ala Gln Gln Thr Leu Glu Leu
465 470 475 480
Leu Asn Asp Val Val Lys Asp Arg Phe Asp Ala Ile Leu Leu Gln Lys
485 490 495
Ser Asp Phe Asp Pro Met Arg Tyr Asp Ile Val Phe Lys Leu Ser Ala
500 505 510
Pro Glu Glu Leu Tyr Asp Ser Phe Gly Pro Leu Glu Lys Ile Ala Tyr
515 520 525
Ile Thr Phe Asp Asn Tyr Phe Lys Ser Arg Leu Phe Ala Ile Leu Thr
530 535 540
Lys Ala Leu Gly Glu Arg Ile Glu Ser Ile Val Ile Lys Asn Glu His
545 550 555 560
Pro Ser Asn Thr Phe Ala Ile His Lys Arg Lys Pro Ser His Thr Ser
565 570 575
Ser Thr Phe Val Ile Gly Leu Gln Leu Asn Pro Glu Glu Cys Asp Lys
580 585 590
Leu Val Thr Lys Gly Pro Asn Asn_Glu Asp Lys Asp Ala Gly Ile Lys
595 600 605
Phe Arg Ser Phe Trp Gly Asn Lys Ala Ser Leu Arg Arg Phe Lys Asp
610 615 620
Gly Ser Ile Gln His Cys Val Val Trp Asn Ile Lys Asp Gln Glu Pro
625 630 635 640
49
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Val Val Met Asn Ile Ile Lys Tyr Ala Leu Asp Thr His Leu Gln Ser
645 650 655
Glu Ile Ser Gln His Leu Ala Ser Ser Ile Ser Tyr Phe Asp Lys Lys
660 665 670
Leu Pro Val Pro Leu Leu Pro Ser Ala Thr Asn Gln Val Ile Thr Ser
675 680 685
Leu Ser Ser Phe Thr Ala Leu Arg Asn Ser Phe Glu Asn Leu Ser Lys
690 695 700
Val Leu Thr~Asn Leu Glu Leu Pro Leu Ser Val Lys Thr Val Leu Pro
705 710 715 720
Ala Ser Ser Gly Leu Arg Tyr Thr Ser Val Leu Gln Pro Val Pro Phe
725 730 735
Ala Ala Ser Asn Pro Asp Phe Trp Asn Tyr Cys Val Leu Gln Phe Glu
740 745 750
Thr Ser Thr Arg Trp Pro Asp Glu Leu Ser Ala Leu Glu Lys Thr Lys
755 760 765
Thr Ala Phe Leu Leu Lys Ile Ser Glu Glu Leu Ala Glu Thr Glu Tyr
770 775 780
Asn Ser Phe Ile Ser Lys Asp Glu Ser Val Pro Phe Asn Glu Asn Ile
785 790 795 800
Thr Leu Leu Asn Ile Leu Thr Pro Glu Gly Tyr Gly Phe Arg Ile Arg
805 810 815
Ala Phe Thr Glu Arg Asp Glu Leu Leu Tyr Leu Arg Ala Val Ser Asn
820 825 830
Ala Asp Lys Gln Lys Ala Leu Val Gln Asp Val Tyr Leu Lys Phe Asn
835 840 845
Glu Lys Tyr Met Gly Ser Val Lys His Thr Arg Ser Val Thr Gln Leu
850 855 860
Ala Gln His Phe His Phe Tyr Ser Pro Thr Val Arg Phe Phe Lys Gln
865 870 875 880
Trp Leu Asp Ser Gln Leu Leu Leu Gln His Phe Ser Glu Glu Leu Val
885 890 895
Glu Leu Ile Ala Leu Lys Pro Phe Val Asp Pro Ala Pro Tyr Ser Ile
900 905 910
Pro His Ser Val Glu Asn Gly Phe Leu Gln Ile Leu Asn Phe Leu Ala
915 920 925
Ser Trp Asn Trp Lys Glu Asp Pro Leu Val Leu Asp Leu Val Lys Ser
930 935 940
Ser Ala Asp Asp Asp Ile Lys Leu Ser Asp Lys Leu Thr Ile Gln Ala
945 950 955 960
His Arg Ile Ile Glu Gln Asn Phe Glu Lys Ile Arg Lys Thr Asp Pro
965 970 975
Ser Gly Ile Lys Thr Gln Tyr Phe Ile Gly Ser Lys Asp Asp Pro Ser
980 985 990
Gly Ile Leu Trp Ser His Asn Leu Thr Leu Pro Ile Ser Thr Arg Leu
995 1000 1005
Thr Ala Leu Ser Arg Ala Ala Ile Gln Leu Leu Arg Lys Glu Gly Ile
1010 1015 1020
Thr Glu Thr Asn Leu Asp Leu Ile Phe Thr Pro Ala Leu Gln Asp Tyr
1025 1030 1035 1040
Asp Phe Thr Ile Lys Val Lys Ala Asn Asn Val Thr Thr Ser Ser Gly
1045 1050 1055
Ile Leu Pro Pro Asn Thr Phe Lys Asn Leu Ile Gln Pro Leu Thr Ser
1060 1065 1070
Phe Pro Asp Asp Ile Thr Thr Lys Tyr Asp Leu Val Gln Gly Tyr Val
1075 1080 1085
Asp Glu Leu Asn Lys Lys Phe Gly Asn Ala Ile Ile Phe Ser Ser Lys
1090 1095 1100
S~
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
LysPhe ThrGly Leu Lys Asn Glu Asn Ile GlyGly Ile
Cys Asn Val
1105 1110 1115 1120
PheVal ProThr Asn Thr LysLysLys Phe Val AsnLeu Gly
Leu Arg
1125 1130 1135
IleAsn ValLys Pro Asp AspLysGly Asp Val IleIle Asn
Leu Glu
1140 1145 1150
ThrSer SerIle Tyr Glu IleGluLeu Leu Gly AspLeu Ile
Asp Gly
1155 1160 1165
LysAla PheAsp Lys Lys
Arg
1170 1175
<210> 76
<211> 759
<212> PRT
<213> Candida albicans
<400> 76
Met Ala Lys Lys Arg Arg Ala Ala Ile Leu Pro Thr Asn Ile Ile Leu
1 5 10 15
Leu Gln Asn Val Val Arg Arg Asp Pro Glu Ser Tyr His Glu Glu Phe
20 25 30
Leu Gln Gln Phe Ser His Tyr Glu Ser Leu Arg Asp Leu Tyr Leu Ile
35 40 45
Asn Pro Thr Gly Val Asp Ala Asn Ser Thr Thr Glu Phe Ile Asp Leu
50 55 60
Ile Gly Phe Met Ser Ala Val Cys Asn Cys Tyr Pro Lys Glu Thr Ala
65 70 75 80
Asn Phe Pro Asn Glu Leu Lys Glu Ile Leu Leu Asn Asn His Arg Asp
85 90 95
Leu Thr Pro Glu Leu Arg Glu Lys Ile Ile Gln Cys Leu Thr Met Leu
100 105 110
Arg Asn Lys Asp Ile Ile Ser Ala Glu Met Leu Ile Gln Thr Ile Phe
115 120 125
Pro Leu Leu Ile Thr Ser Asn Ala Gly Gln Gln Val Lys Gln Met Arg
130 135 140
Lys Gln Ile Tyr Ser Thr Leu Ile Ala Leu Leu Lys Ser Val Asn Thr
145 150 155 160
Gly Thr Lys Asn Gln Lys Leu Asn Arg Ser Thr Gln Ala Leu Leu Phe
165 170 175
Asn Leu Leu Glu Gln Arg Asp Asn Gln Gly Leu Trp Ala Thr Lys Leu
180 185 190
Thr Arg Glu Leu Trp Arg Arg Gly Ile Trp Asp Asp Ser Arg Thr Val
195 200 205
Glu Ile Met Thr Gln Ala Ala Leu His Pro Asp Val Lys Val Ala Val
210 215 220
Ala Gly Ala Arg Phe Phe Leu Gly Ala Asp Lys Glu Arg Glu Asp Asn
225 230 235 240
Phe Glu Glu Ser Ser Asp Glu Asp Gly Phe Asp Met Asn Glu Leu Arg
245 250 255
His Lys Met Gln Ile Asn Lys Lys Thr Ser Lys Arg Gly Lys Lys Leu
260 265 270
Glu Gln Ala Val Lys Ala Met Lys Lys Lys Asn Asn Ser Lys His Ser
275 280 285
Ala Thr Tyr Leu Asn Phe Ser Ala Ile His Leu Leu Arg Asp Pro Gln
290 295 300
Gly Phe Ala Glu Gln Met Phe Asp Asn His Leu Ser Ser Lys Asn Ser
305 310 315 320
$1
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asn Lys Phe Asp Leu.Asp Gln Lys Ile Leu Phe Met Asn Leu Ile Ser
325 330 335
Arg Leu Ile Gly Thr His Lys Leu Ile Val Leu Gly Val Tyr Thr Phe
340 345 350
Phe Leu Lys Tyr Leu Thr Pro Lys Gln Arg Asn Val Thr Gln Ile Met
355 360 365
Ala Ala Ala Ala Gln Ala Ser His Asp Leu Val Pro Pro Glu Ser Ile
370 375 380
Gln Ile Val Val Arg Lys Ile Ala Asp G1u Phe Val Ser Asp Gly Val
385 390 395 400
Ala Ala Glu Val Ala Ser Ala Gly Ile Asn Thr Ile Arg Glu Ile Leu
405 410 415
Ala Arg Ala Pro Leu Ala Ile Asp Ala Pro Leu Leu Gln Asp Leu Thr
420 425 430
Glu Tyr Lys Gly Ser Lys Ser Lys Ala Val Met Met Ala Ala Arg Ser
435 440 445
Leu Ile Ser Leu Tyr Arg Glu Val Ala Pro Glu Met Leu Leu Lys Lys
450 455 460
Asp Arg Gly Lys Val Ala Ser Ile Glu Leu Gln Lys Gly Glu Lys Ser
465 470 475 480
Gly Leu Pro Gln Tyr Gly Val Glu Asn Asn Val Thr Ser Ile Pro Gly
485 490 495
Ile Glu Leu Leu Ala Lys Trp Lys Lys Glu Gln Gly Leu Asp Ser Arg
500 505 510
Glu Asp Glu Glu Asp Asp Ala Asn Trp Glu Val Asp Asp Asp Glu Asp
515 520 525
Ala Ser Asp Ile Glu Gly Asp Trp Ile Asp Val Glu Ser Asp Lys Glu
530 535 540
Ile Asn Ile Ser Asp Ser Asp Asp Asp Asn Glu Glu Asp Glu Gln Glu
545 550 555 560
Gln Glu Pro Glu Lys Gly Lys Ala Lys Ile Gly Lys Ala Glu Asp Asn
565 570 575
Glu Asp Glu Val Ser Asp Leu Glu Leu Ser Ser Asp Asp Asp Asp Glu
580 585 590
Asp Ser Glu Glu Asn Lys Asp Gly Lys Ala Val Ala Asp Ser Glu Glu
595 600 605
Pro Pro Thr Lys Lys Gln Lys Ile Arg Asn Glu Asn Ala Asp Ile Asn
610 615 620
Ala Glu Gln Ala Met Asn Glu Leu Leu Ser Ser Arg Ile Leu Thr Pro
625 630 635 640
Ala Asp Phe Ala Lys Leu Glu Glu Leu Arg Thr Glu Ala Gly Val Ser
645 650 655
Lys Ile Met Gly Ile Ser Asn Glu Glu Ala Val Asp Ser Thr Ser Leu
660 665 670
Val Gly Lys Val Lys Tyr Lys Gln Leu Arg Glu Glu Arg Ile Ala His
675 680 685
Ala Lys Glu Gly Lys Glu Asp Arg Glu Lys Phe Gly Ser Arg Lys Gly
690 695 700
Lys Arg Asp Thr Pro His Ser Thr Thr Asn Lys Glu Lys Ala Arg Lys
705 710 715 720
Lys Asn Phe Val Met Met Ile His Lys Lys Ala Val Gln Gly Lys Gln
725 730 735
Lys Leu Ser Leu Arg Asp Arg Gln Arg Val Leu Arg Ala His Ile Thr
740 745 750
Lys Gln Lys Lys Lys Gly Leu
755
<210> 77
52
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 528
<212> PRT
<213> Candida albicans
<400> 77
Met Ala Ile Val Glu Thr Val Ile Asp Gly Ile Asn Tyr Phe Leu Ser
1 5 10 15
Leu Ser Val Thr Gln Gln Ile Ser Ile Leu Leu Gly Val Pro Phe Val
20 25 30
Tyr Asn Leu Val Trp Gln Tyr Leu Tyr Ser Leu Arg Lys Asp Arg Ala
35 40 45
Pro Leu Val Phe Tyr Trp Ile Pro Trp Phe Gly Ser Ala Ala Ser Tyr
50 55 60
Gly Gln Gln Pro Tyr Glu Phe Phe Glu Ser Cys Arg Gln Lys Tyr Gly
65 70 75 80
Asp Val Phe Ser Phe Met Leu Leu Gly Lys Ile Met Thr Val Tyr Leu
85 90 95
Gly Pro Lys Gly His Glu Phe Val Phe Asn Ala Lys Leu Ser Asp Val
100 105 110
Ser Ala Glu Glu Ala Tyr Lys His Leu Thr Thr Pro Val Phe Gly Lys
115 120 125
Gly Val Ile Tyr Asp Cys Pro Asn Ser Arg Leu Met Glu Gln Lys Lys
130 135 140
Phe Ala Lys Phe Ala Leu Thr Thr Asp Ser Phe Lys Arg Tyr Val Pro
145 150 155 160
Lys Ile Arg Glu Glu Ile Leu Asn Tyr Phe Val Thr Asp Glu Ser Phe
165 170 175
Lys Leu Lys Glu Lys Thr His Gly Val Ala Asn Val Met Lys Thr Gln
180 185 190
Pro Glu Ile Thr Ile Phe Thr Ala Ser Arg Ser Leu Phe Gly Asp Glu
195 200 205
Met Arg Arg Ile Phe Asp Arg Ser Phe Ala Gln Leu Tyr Ser Asp Leu
210 215 220
Asp Lys Gly Phe Thr Pro Ile Asn Phe Val Phe Pro Asn Leu Pro Leu
225 230 235 240
Pro His Tyr Trp Arg Arg Asp Ala Ala Gln Lys Lys Ile Ser Ala Thr
245 250 255
Tyr Met Lys Glu Ile Lys Ser Arg Arg Glu Arg Gly Asp Ile Asp Pro
260 265 270
Asn Arg Asp Leu Ile Asp Ser Leu Leu Ile His Ser Thr Tyr Lys Asp
275 280 285
Gly Val Lys Met Thr Asp Gln Glu Ile Ala Asn Leu Leu Ile Gly Ile
290 295 300
Leu Met Gly Gly Gln His Thr Ser Ala Ser Thr Ser Ala Trp Phe Leu
305 310 315 320
Leu His Leu Gly Glu Lys Pro His Leu Gln Asp Val Ile Tyr Gln Glu
325 330 335
Val Val Glu Leu Leu Lys Glu Lys Gly Gly Asp Leu Asn Asp Leu Thr
340 345 350
Tyr Glu Asp Leu Gln Lys Leu Pro Ser Val Asn Asn Thr Ile Lys Glu
355 360 365
Thr Leu Arg Met His Met Pro Leu His Ser Ile Phe Arg Lys Val Thr
370 375 380
Asn Pro Leu Arg Ile Pro Glu Thr Asn Tyr Ile Val Pro Lys Gly His
385 390 395 400
Tyr Val Leu Val Ser Pro Gly Tyr Ala His Thr Ser Glu Arg Tyr Phe
405 410 415
53
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asp Asn Pro Glu Asp Phe Asp Pro Thr Arg Trp Asp Thr Ala Ala Ala
420 425 430
Lys Ala Asn Ser Val Ser Phe Asn Ser Ser Asp Glu Val Asp Tyr Gly
435 440 445
Phe Gly Lys Val Ser Lys Gly Val Ser Ser Pro Tyr Leu Pro Phe Gly
450 455 460
Gly Gly Arg His Arg Cys Ile Gly Glu Gln Phe Ala Tyr Val Gln Leu
465 470 475 480
Gly Thr Ile Leu Thr Thr Phe Val Tyr Asn Leu Arg Trp Thr Ile Asp
485 490 495
Gly Tyr Lys Val Pro Asp Pro Asp Tyr Ser Ser Met Val Val Leu Pro
500 505 510
Thr Glu Pro Ala Glu Ile Ile Trp Glu Lys Arg Glu Thr Cys Met Phe
515 520 525
<210> 78
<211> 433
<212> PRT
<213> Candida albicans
<400> 78
Met Pro Ser His Val Thr Asn Val Tyr Asn Asp Ile Asp Asp Gly Met
1 5 10 15
Leu Leu Ser Ser Leu Ser Leu Asn Glu Arg Ser Asn Asp Arg Arg Gly
20 25 30
Leu Glu Ile Glu Glu Val Tyr Asp Ser Ser Phe Asp Asp Pro Met Asp
35 40 45
Ile Asp Asp Thr Gly Glu Leu Ser Asn His Met Asp Ile Asp Asp Thr
50 55 60
Thr Phe Glu Ile Asp His Val Ala Ser Asp Asn Tyr Ala Asn Lys Arg
65 70 75 80
Glu Asp Asp Asn Asp Thr Asn Asn Glu Glu Glu Arg Arg Glu Asp Gly
85 90 95
Leu Phe Ser Leu Leu Ser Pro Thr Leu Met Gly Ala Lys Leu Ala Ile
100 105 110
Lys Lys Pro Leu Leu Leu Met Pro Pro Pro Thr Val Ser Glu Gln Ser
115 120 125
Asp Ser Lys Thr Glu Ser Ala Ser Ser Val Asp Tyr Glu Tyr Asp Thr
130 135 140
Ser Ser Phe Lys Pro Met Lys Ser Asn Gly Leu Ile Thr Arg Lys Thr
145 150 155 160
Asn Ser Ser Thr Phe Gln Pro Ser Asn Ile Asp Ser Phe Leu Phe His
165 170 175
Ser Asp Gly Ile Ser Ser Gly Gln Ser Leu Gly Gly Tyr Gln Asp Leu
180 185 190
His Ser Asn Tyr Gln Gln Pro Val Thr Ile His Asn His His His His
195 200 205
Tyr Tyr Tyr Tyr Asn Lys Asp Glu Ser Val Pro Ser Pro Pro Ser Asn
210 215 220
Asn Asn Leu Gln Ser Leu Glu His Glu Gln Arg Asn Leu Gln Met Gln
225 230 235 240
Gln Tyr Lys Gln Gln Leu Glu Glu His Gln Leu Tyr Leu Gln Glu Tyr
245 250 255
Lys Arg Asn Asn Gln Ile Leu Leu Pro Ser Pro Trp Gln His Asn Ile
260 265 270
Ser Pro Ile Glu Arg Val Pro Tyr Leu Leu Met Ser Tyr Leu Gln Met
275 280 285
54
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Leu Ile Asn Phe Ile Ala Ser Leu Tyr Gly Val Tyr Leu Val Tyr Cys
290 295 300
Leu Phe Arg Thr Ile Asn Thr Asp Ile Lys Thr Lys Ile Glu Glu Gln
305 310 315 320
Gln Thr Asn Leu Ile Ile Ser Ile Glu Ser Cys Arg Arg Ser Tyr Tyr
325 330 335
Gln Asn Gly Cys Asp Asp Lys Asp Asn Leu Val Pro Leu Leu Val Ser
340 345 350
Lys Cys Gln Lys Phe Glu Lys Cys Met Lys Gln Asp Pro Tyr Lys Leu
355 360 365
Ser Asn Val Ser Ile Met Ser Ala Glu Ile Ile Gly Met Ile Ile Asn
370 375 380
Ser Leu Ile Glu Pro Leu Ser Leu Lys Phe Tyr Leu Phe Met Leu Ala
385 390 395 400
Phe Ile Leu Ile Ile Phe Ala Cys Asn Phe Thr Phe Gly Tyr Ile Arg
405 410 415
Ala Lys Ala Tyr Tyr Gly Gly Ser Met Lys Tyr Ser Leu Asp Lys Leu
420 425 430
Asp
<210> 79
<211> 263
<212> PRT
<213> Candida albicans
<400> 79
Met Glu Ser Leu Asp Glu Ile Gln Trp Lys Ser Pro Glu Phe Ile Gln
1 5 10 15
Glu Arg Gly Leu Asri Thr Asn Asn Val Leu Glu Tyr Phe Ser Leu Ser
20 25 30
Pro Phe Tyr Asp Arg Thr Ser Asn Asn Gln Val Leu Met Met Gln Phe
35 40 45
Gln Tyr Gln Gln Ile Gln Ile Pro Pro Gly Val Ser Phe His Gln Tyr
50 ' S5 60
Phe Gln Ser Arg Leu Ser Glu Met Thr Gly Ile Glu Phe Val Ile Ala
65 70 75 80
Tyr Thr Lys Glu Pro Asp Phe Trp Ile Ile Arg Lys Gln Lys Arg Gln
85 90 95
Asp Pro Gln Asn Thr Val Thr Leu Gln Asp Tyr Tyr Ile Ile Gly Ala
100 105 110
Asn Val Tyr Gln Ala Pro Arg Ile Tyr Asp Val Leu Ser Ser Arg Leu
115 120 125
Leu Ala Ser Val Leu Ser Ile Lys Asn Ser Thr Asp Leu Leu Asn Asp
130 135 140
Met Thr Ser Tyr His Ile Ser Asp Gly Gly His Ser Tyr Ile Asn Ser
145 150 155 160
Ile His Gly Ser Ser Ser Lys Pro Ser Gln Ser Ser Ala Val Ser Lys
165 170 175
Pro Ser Ser Thr Asn Thr Gly Thr Asn Ala Thr Thr Thr Pro Ile Thr
180 185 190
Leu Thr Thr Pro Ser Gly Ala Thr Val Pro Ser Thr Val Ser Asn Gly
195 200 205
Ile Ser Thr Ser Thr Glu Ile Ala Ser Gly Val Phe Asp Thr Leu Leu
210 215 220
Asn Asp Val Val Met Asn Asp Asp His Leu Tyr Ile Asp Glu Ile Pro
225 230 235 240
SS
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Leu Tyr Gly Glu Gly Ser Thr Leu Glu Arg Leu Gly Leu Lys Gly Asn
245 250 255
Lys Asp Ala Gly Leu Ser Leu
260
<210> 80
<211> 363
<212> PRT
<213> Candida albicans
<400> 80
Met Ser Ser Ser Gln Ala Arg Lys Ala Leu Gln Asp Val Ile Pro Asn
1 5 10 15
Tyr Leu Gly Glu Phe Thr Pro Lys Leu Leu Asp Tyr Ile Asn Ser Leu
20 25 30
Tyr Gln Leu Ser Leu Arg Lys Gln Ala Ile Leu Pro Asn Lys Ser Glu
35 40 45
Ile Ala Arg Phe His Leu Cys Ala Val Val Ile Val Glu Lys Tyr Lys
50 55 60
Gln Ser Phe Glu Leu Pro Thr Pro Asp Val Ser Arg Ile Pro Thr Gln
65 70 75 80
Pro Lys Val Ala Ala Lys Leu Leu Asp Thr Phe Arg Glu Leu Ile Glu
85 90 95
Gln Ile Ser Ala Ala Ser Thr Pro Val Ser Ser Pro Lys Lys Val Lys
100 105 110
Pro Pro Ser Gln Ser Pro Ser Thr Pro Thr Lys Ser Arg Thr Ser Lys
115 120 125
Glu Asn Leu Lys Ser Gly Ser Pro Leu Lys Arg Leu Arg Ala Glu Met
130 135 140
Leu Gln Glu Asp Gln Val Asn Gly Asn Ser Pro Asp Gly Gln Leu Lys
145 150 155 160
Asp Val Asp Ser Pro Phe Asn Pro Lys Lys Arg Lys Glu Ser Lys Ala
165 170 175
Gly Thr Pro Thr His Lys Val Tyr Lys Tyr Asp Lys Lys His Val Ser
180 185 190
Ile Ala Asp Phe Ile Ala Phe Cys Asn Thr Phe Leu Ile Pro Gly Asp
195 200 205
Ile Thr Ala Lys Met Val Gly Thr Phe Leu Thr His Gln His Lys Phe
210 215 220
Leu Lys Lys Ser Asp Trp Ser Leu Ala Cys Gly Met Val Tyr Ala Ala
225 230 235 240
Tyr Ile Arg Ile Asn Asn Arg Leu Leu Ala Gln Ser Val Gly Thr Lys
245 250 255
Ser Glu Phe Thr Lys Gln Leu Leu Gln Tyr Gln Lys Gly Gly Leu Ser
260 265 270
Leu Gly Ala Met Gln Ser Trp Cys Gly Ile Ile Glu Glu Trp Ile Gln
275 280 285
Asp Glu Pro Trp Ile Gln Glu Ile Glu Lys Thr Tyr Ala Tyr Gly Ser
290 295 300
Lys Thr Ala Glu Glu Thr Arg Asn Ser Phe Glu Arg Lys Ala Lys Ile
305 310 315 320
Gly Glu Gly Trp Asp Leu Met Glu Gln Phe Gly Ala Met Ile His Gly
325 330 335
Glu Thr Ile Ser Leu Ser Ser His Gln Glu Glu Tyr Tyr Lys Asn Trp
340 345 350
Arg Lys Glu Ala Leu Glu Lys Cys Asp Gln Leu
355 360
56
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 81
<211> 871
<212> PRT
<213> Candida albicans
<400> 81
Met Asn Thr Phe Ser Ser Pro Pro Asn Val Ile Arg Glu Tyr Asn Asp
1 5 10 15
Ser Thr Tyr Gln Ser Pro Leu Asn Ser Gln Phe His Gln Ser Pro Phe
20 25 30
Leu Gln Thr Gln Ser Pro Asp Tyr Val Ser Leu Arg Glu Glu Glu Asp
35 40 45
Asp Asn Asn Asp Lys Asn Leu Asp Ile Met Ser Ser Cys Ile Val Asp
50 55 60
Ser Val Ile Tyr Lys Ser Gln Lys Ile Ala Gly Pro Leu Leu Ser Gln
65 70 75 80
Ile Ser Asn Leu Asn Ile Gln Gln Ala Leu Ile Ile Arg Glu Leu Leu
85 90 95
Phe Thr Leu Leu Gly His Glu Gly His Tyr Ile Gln Tyr Ser Lys Arg
100 105 110
Tyr Asp Pro Thr Ser Gln Ile Ser Arg Ile Glu Gly Pro Asp Tyr Lys
115 120 125
Ile Ala Lys Asn Leu Asp Ile Ser Leu Lys Val Ile Thr Lys Lys Leu
130 135 140
Val Lys Phe Gly Lys Phe Tyr Ser Gly Leu Lys Ser Phe Ile Gln Val
145 150 155 160
Phe Asp Asn Asn Lys Phe Gly Lys Ile Val Gln Lys Phe Cys Ser Glu
165 170 175
Val Arg Lys Phe Leu Ser Ser Tyr Gln Gln Val Leu Ile Asn Val Glu
180 185 190
His Glu Phe Lys Phe Asn Lys Asn Phe Asn Leu Asn Met Leu Asp Ser
195 200 205
Leu Leu His Gln Glu Ile Ser Asn Glu Met Thr His Leu Tyr Gln Ile
210 215 220
Gly Ile Glu Ile Ser Arg Ile Thr Glu Glu Arg Gln Lys Met Ser Gln
225 230 235 240
Ala Glu Ile Met Gly Asn Phe Glu Pro Thr Thr Leu Ala Asn Thr Ser
245 250 255
Met Asn Gly Ile Asn Ser Glu Pro Asn Leu Tyr Tyr Gly Lys Phe Asp
260 265 270
Cys Cys Lys Gly Gly Leu Leu Leu Gln Val Ile Gln Glu Arg Met Val
275 280 285
Tyr Tyr Lys Gly Asp Pro Thr Ser Leu Asp Phe Leu Thr Gln Leu Phe
290 295 300
Asp Ile Val Ser Ser Asp Tyr Ile Gly Met Leu Asn Gln Trp Leu Leu
305 310 315 320
Glu Gly Val Ile Asn Asp Pro Phe Asp Glu Phe Met Ile Arg Glu Lys
325 330 335
Arg Val Pro Asp Ser Phe Met Glu Ile Phe Gln Ser Lys Ser Glu Tyr
340 345 350
Tyr Trp Asn Glu Leu Phe Leu Ile Lys Ile Asp Gly Leu Leu Asn Gln
355 360 365
Phe Gln Asn Ser Thr Ile Gln Ser Lys Ile Leu Asn Thr Gly Lys Tyr
370 375 380
Leu Asn Ile Phe Lys Arg Cys Thr Gly Leu His Asn Phe Glu Ser Leu
385 390 395 400
Lys Glu Lys Leu Thr Thr Ile Thr Ser Leu Ala Ala Pro Asp Leu Glu
405 410 415
57
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Leu Lys Ile Asp Glu Phe Tyr His Arg Ala Asn Lys Met Leu Met Lys
420 425 430
Leu Leu Phe Asp Gly Tyr Asn Phe Pro Ser Val Val Asn Ile Phe Gln
435 440 445
Arg Leu Phe Leu Phe Ala Asp Ser Phe Gln Ile Asp Asn Phe Ile Asp
450 455 460
Ser Thr Phe Ser Glu Leu Lys Arg Gly Lys Leu Lys Ile Ser Val Ser
465 470 475 480
Arg Leu Gln Lys Gln Tyr Asp Asp Ile Phe Lys Glu Lys Ile Glu Asn
485 490 495
Lys Val Gly Val Arg Pro Ser Val Tyr Asp Val Leu Lys Lys Asn Gln
500 505 510
Lys Leu Ser Val Thr Ser Glu Ser Leu Tyr Lys Val Val Glu Glu Leu
515 520 525
Met Glu Lys Asn Ser Asp Tyr Leu Ile Ser Asp Asn Asn Leu Arg Gly
530 535 540
Ile Phe His Arg Val Ala Ser Leu Arg Asp Asp Ser Arg Leu Thr Ile
545 550 555 560
Ser Ser Thr Ala Asp Ser Ala Thr Glu Asn Val Lys Asp Glu Pro Thr
565 570 575
Ile Thr Ser Val Asp Leu Thr Ile Pro Leu Pro Phe Pro Leu Asn Leu
580 585 590
Val Leu Asn Gln Gln Leu Ser Tyr Gln Tyr Glu Ile Met Phe Lys Leu
595 600 605
Leu Ile Asn Ile Lys Phe Ile Ser Lys Tyr Asn Ser Ser Asn Trp Gln
610 615 620
Glu Met Asn Tyr Ser Lys Ile Trp Thr Asn Ser His Phe Asn Ser Ser
625 630 635 640
Val Lys Lys Trp Ile Leu Arg Cys Arg Val Leu His Ser Arg Ile Cys
645 650 655
Ser Phe Ile His Glu Leu Glu Asn Tyr Ile Val His Asp Val Ile Glu
660 665 670
His Asn Phe Glu Glu Ile Lys Asn Leu Ile His Thr Thr Ala Thr Asn
675 680 . 685
Leu Ala Thr Ser Glu Leu Gly Ser Asp Ile Asn Asp Glu Gly Asp Asn
690 695 700
Ile Phe Asn Gly Ser Leu Ile Arg Gly Thr Phe Asn Asn Asn Ser Ile
705 710 715 720
Phe Asp Ser Lys Val His Lys His Arg Thr Thr Thr Tyr Val Glu Gly
725 730 735
Ile Ser Thr Val Glu Gln Leu Ile Gln Lys Phe Leu Asp Tyr Ser Ser
740 745 750
Thr Leu Leu Asn Asp Ser Leu Leu Thr Arg Glu Glu Ser Leu Arg Gln
755 760 765
Leu Arg Lys Met Leu Asp Phe Ile Phe His Phe Asn Asn Tyr Ile Val
770 775 780
Gln Val Lys Lys Val Leu Val Leu Leu Asn His Glu Leu Phe Asn Glu
785 790 795 800
Tyr Ser Lys Glu Phe Pro Thr Lys Phe Glu Lys Pro Met Asp Gln Glu
805 810 815
Ser Ile Asp Lys Arg Phe Ala Asn Leu Ser Asp Thr Phe Leu Met Gln
820 825 830
Tyr Glu Lys Phe Gly Glu Asn Leu Val Thr Phe Leu Ala Thr Ile Lys
835 840 845
Gln Val Gly Glu Arg Glu Asn Gln Gly Leu Leu Glu Leu Ser Asn Arg
850 855 860
Leu Glu Leu Cys Phe Pro Glu
865 870
S8
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 82
<211> 636
<212> PRT
<213> Candida albicans
<400> 82
Met Ser Gly Pro Ile Ile Cys Ser Lys Phe Asp Gln Ser Gly Asn Tyr
1 5 10 15
Leu Ala Thr Gly Met Val Ala Leu Asp Ser His Gln Val Lys Val Gln
20 25 30
Ser Ile Thr Ser Ser Gln Ala Ser Leu Asn Thr Ser Phe Thr Leu Glu
35 40 45
Lys Ser Asn Lys Leu Val Asn Leu Ala Trp Ile Pro Ser Asp Ser Ile
50 55 60
Gln Leu Leu Ala Leu Cys Leu Ser Lys Gly Ser Ile Leu Ile Tyr Ser
65 70 75 80
Pro Gln Thr Asn Glu Ile Val Ser Glu Leu Ile Ser Ser Ala Asn Val
85 90 95
Ser Ile Leu Asp Phe His Tyr Ser Thr Thr Thr Arg Thr Gly Trp Ser
100 105 110
Cys Asp Ile Glu Gly Asn Val Tyr Glu Trp Asp Leu Asn Ser Tyr Leu
115 120 125
Leu Val Asp Ser Phe Lys Val Asn Glu Tyr Ile Glu Ser Val Asp Ser
130 135 140
Ile Asn Arg Ile Ser Thr Val Met Phe Asn Ser Gln Pro His Leu Leu
145 150 155 160
Leu Gly Ser Asn Ala Val Tyr Leu Phe Asn Ile Lys Gln Arg Glu Leu
165 170 175
Val Lys Thr Phe Pro Gly His Ile Gln Pro Val Asn Ser Ile Thr Ala
180 185 190
Leu Asn Asn Asp Met Phe Leu Thr Ser Ala Lys Gly Asp Arg Phe Val
195 200 205
Asn Leu Tyr Gln Leu Asp Lys Thr Ala Thr Lys Ala Val Phe Val Gly
210 215 220
Ser Ser Ser Val Ser Ser Leu Ser Val Ser Ile Lys Asp Asp Lys Ser
225 230 235 240
Val Leu Val Ile Ile Asn Glu Glu Gly Asp Ile Glu Ile Phe Asn Asn
245 250 255
Pro Leu Ala Asp Ala Lys Ser Gln Val Ser Thr Pro Val Pro Lys Lys
260 265 270
Lys Arg Lys Gln Val Gly Val Ser Ser Arg Ser Phe Asn Ala Ser Ile
275 280 285
Lys Leu Ser Arg Pro Glu Pro Glu Ile Lys Ser Pro Gln Asp Thr His
290 295 300
Leu Phe Ile Asn Ala Val Ser Thr Glu Asp Asn Leu Ile Thr Phe Thr
305 310 315 320
Trp Leu Glu Asn Ser Thr Ile Pro Phe Phe Asp Thr Leu Lys Trp Ile
325 330 335
Asp Glu Thr Gly Ser Leu Leu Leu Glu Ser Ala Lys Val Leu Leu Lys
340 345 350
Ser Lys Pro Asn Leu Lys Val Thr Gln His Leu Thr Asn Gly His Asp
355 360 365
Val Ala Ala Pro Lys Leu Tyr Thr Glu Gly His Thr Ile Val Ser Asp
370 375 380
Gly Ser Asn Ile Arg Asp Leu Glu Phe Gln Asp His Gln Glu Asp Glu
385 390 395 400
Glu Asp Thr Glu Glu Ser Leu Ala Glu Lys Leu Glu Arg Leu Ala Met
405 410 415
59
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asp Gln Thr Ser Gln Gln Lys Ser Arg Arg Arg Lys Leu Glu Glu Ala
420 425 430
Arg Ser Gly Val Ser Leu Ser Ile Val Leu Thr Gln Ser Leu Lys Asn
435 440 445
Asn Asp Gln Ala Leu Leu Glu Thr Val Leu Ser Asn Arg'Asp Pro Ile
450 455 460
Thr Ile Gln Asn Thr Ile Ser Arg Leu Asp Pro Tyr Ser Cys Val Thr
465 470 475 480
Phe Leu Asp Lys Leu Ser Glu Lys Ile Gln Arg Gln Pro Thr Arg Phe
485 490 495
Asp Gln Val Ser Phe Trp Leu Lys Trp Ile Leu Val Ile His Gly Pro
500 505 510
Thr Met Ala Ser Leu Pro Asn Leu Ser Ile Lys Leu Ser Ser Leu Arg
515 520 525
Ala Val Leu Asn Lys Lys Ala Glu Glu Leu Pro Arg Leu Leu Glu Leu
530 535 540
Gln Gly Arg Leu Lys Leu Met Asp Asp Ser Ala Ala Leu Arg Asn Glu
545 550 555 560
Phe Ser Ala Glu Glu Ile Ala Glu Asp Leu Glu-Glu Arg Ser Asp Ile
565 570 575
Glu Tyr Asn Glu Glu Ile Asp Asp Ala Lys Tyr Val Gly Val Ile Ser
580 585 590
Asp Asp Glu Ser Met Asp Asp Val Asp Asp Phe Asp Asp Leu Asp Asp
595 600 605
Glu Glu Glu Glu Glu Glu Glu Glu Glu Glu Asp Gly Ile Pro Asp Ala
610 615 620
Ala Asn Leu Asp Asp Arg Glu Asp Ser Asp Leu Glu
625 630 635
<210> 83
<211> 327
<212> PRT
<213> Candida albicans
<400> 83
Met Met Ser Thr Asn Phe Gln Trp Pro Gly Thr Asn Lys Asn Asp Asn
1 5 10 15
Thr Glu Val Ser Val Glu Thr Pro Ser Ser Thr Asp Pro His Val Pro
20 25 30
Arg Tyr Pro Phe Thr Ala Met Ser His Ala Thr Ala Ser Thr Thr Met
35 40 45
Lys Lys Arg Lys Arg Asp Asp Phe Asp Gly Asp Lys Ser Thr Thr Ile
50 55 60
Thr Met Asn Thr Thr Thr Thr Arg Lys Tyr Ile Gln Ser Ser Leu Gly
65 70 75 80
Ser Ser Lys Phe Lys Lys Ala Lys Thr Pro Lys Ile Ser Gly Gln Pro
85 90 95
Leu Pro Leu Pro Arg Leu Ile Glu Ser Leu Asp Lys Ser Asn Leu Gln
100 105 110
Lys Leu Val Gln Asp Leu Ile Thr Val His Pro Glu Leu Gln Ser Thr
115 120 125
Leu Ile Lys Ile Ser Pro Arg Pro Ser Ile Gln Asp Ser Ile Gln Leu
130 135 140
Leu Gln Asp Lys Phe Asp Met Ile Ile Ser His Leu Pro Tyr Lys Cys
145 150 155 160
Asp Val Glu Ser Asp Tyr Ser Tyr Leu Arg Ile Lys Pro His Leu Gln
165 170 175
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Glu Phe Leu Ser Ser Val Ser Asp Phe Ile Leu Asn Tyr Leu Pro Pro
180 185 190
Leu Glu Thr Asn Met Thr His Ser Leu Gln Phe Leu His Glu Thr Thr
195 200 205
Lys Leu Val Tyr Asn Leu Pro Asn Phe Thr Asn.Gln Glu Phe Gln Tyr
210 215 220
Thr Lys Ser Ser Ala Leu Glu Gln Ile Ala Asn Cys Trp Leu Ile Val
225 230 235 240
Leu Ser Gln Asp Glu Glu Lys Glu Gly Asn Thr Asp Val Val Lys Val
245 250 255
Ile Gln Glu Leu Glu Leu Leu Glu Lys Leu His Glu His Asn Glu Ile
260 265 270
Ser Phe Asn Lys Phe Glu Lys Val Val Asp Tyr Cys Lys Asp Lys Leu
275 280 285
Glu Gln His Glu Leu Ile Met Asn Asn Asn Glu Ala Gly Ser Gly Val
290 295 300
Thr Ser Ser Ile Ser Asp Leu Ile Thr Val Asp Tyr Ser Lys Tyr Ser
305 310 315 320
Ile Ala Asn Thr Thr Ser Ile
325
<210> 84
<211> 552
<212> PRT
<213> Candida albicans
<400> 84
Met Pro Thr Asn Ile Gln Gly Glu Glu Val Ile Ile Pro Pro Lys Asp
1 5 10 15
Glu Glu Glu Ile Leu Leu Glu Lys Leu Val Phe Gly Asp Ala Ala Gly
20 25 30
Phe Glu Asn Asn Leu Lys Lys Leu Asp Asn Leu Tyr Asp Tyr Ser Asp
35 40 45
Glu Glu Glu Glu Ile Asp Glu Lys Gly Ser Glu Lys Glu Ser Asp Ile
50 55 60
Glu Asp Leu Gln Asp Glu Asp Leu Phe Phe Ile Asp Asp Gly Asn Asn
65 70 75 80
Glu Glu His Ser Ser Gly Asp Asp Met Glu Ile Asp Gln Ser Glu Asp
85 90 95
Glu Glu Glu Gly Glu Asp Gln Asp Ser Asp Asn Ala Trp Glu Asp Ser
100 105 110
Asp Asp Glu Lys Val Asn Ile Ser Leu Leu Thr Ser Asp Lys Leu Lys
115 120 125
Lys Leu Arg Lys Thr Pro Gln Asp Ser Val Ile Ser Gly Lys Ser Tyr
130 135 140
Ile Ile Arg Leu Arg Ser Gln Phe Glu Lys Ile Tyr Pro Arg Pro Gln
145 150 155 160
Trp Ile Glu Asp Ile Glu Asn Asn Ser Asp Asp Glu Lys Asp Leu Ser
165 170 175
Asp Glu Asp Lys Val Asp Asp Glu Glu Gly Gln Val Gly Ser Thr Thr
180 185 190
Ala Leu Leu Asn Ile Leu Ser Ser Thr Glu Lys Phe Ile Asn Thr Lys
195 200 205
Gln Leu Lys Leu Ile Ala Ala Asn Lys Ile Ser Ile Thr Arg Leu Lys
210 215 220
Asp Ala Asn Tyr Lys Arg Ile Gly Lys Ser Gly Ile Gln Thr Ile Asp
225 230 235 240
61
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Phe His Pro Asn Tyr Pro Ile Leu Leu Thr Gly Gly Phe Asp Lys Thr
245 250 255
Ile Arg Ile Tyr Gln Ile Asp Gly Lys Ser Asn Asn Phe Ile Thr Ser
260 265 270
Tyr Phe Leu Lys Asn Cys Pro Ile Met Glu Ala Ser Phe Tyr Pro Gln
275 280 285
Leu Ser Gly Asp Asp Thr Lys Thr Ser Asn Leu Ile Tyr Ala Ser Gly
290 295 300
Arg Arg Arg Tyr Met Asn Lys Ile Asn Leu Ser Thr Gly Glu Ile Glu
305 310 315 320
Lys Ile Ser Arg Leu Tyr Gly His Glu Gln Thr Gln Lys Ser Phe Glu
325 330 335
Tyr Phe Lys Ile Ser Pro Gln Gly Lys Tyr Ile Gly Leu Thr Gly Asn
340 345 350
Asn Gly Trp Cys Asn Leu Leu Asn Ala Gln Thr Gly His Trp Val His
355 360 365
Gly Phe Lys Ile Glu Gly Thr Ile Val Asp Phe Ala Phe Ala Asn Asp
370 375 380
Glu Ser Phe Ile Met Ile Val Asn Ser Ala Gly Glu Val Trp Glu Phe
385 390 395 400
Ala Leu Glu Gly Lys Ile Thr Ser Lys Thr Pro Asn Lys Ile Ile Arg
405 410 415
Arg Trp Tyr Asp Asp Gly Gly Val Gly Ile Thr Lys Leu Gln Ile Gly
420 425 430
Gly Lys Asn Asn Arg Trp Val Ala Ile Gly Asn Asn Asn Gly Ile Val
435 440 445
Asn Ile Tyr Asp Arg Ser Val Phe Ala Pro Glu Thr Thr His Pro Lys
450 455 460
Pro Ile Lys Thr Val Glu Asn Leu Ile Thr Ser Ile Ser Ser Leu Val
465 470 475 480
Phe Asn Pro Asp Gly Gln Leu Leu Cys-Ile Ala Ser Arg Ala Lys Arg
485 490 495
Asp Ala Leu Arg Leu Val His Leu Pro Ser Gly Ser Val Tyr Ser Asn
500 505 510
Trp Pro Thr Ser Gly Thr Pro Leu Gly Lys Val Thr Ser Ile Ala Phe
515 520 525
Ser Pro Asn Asn Glu Met Leu Ala Ile Gly Asn Gln Thr Gly Lys Val
530 535 540
Thr Leu Trp Arg Leu Asn His Tyr
545 550
<210> 85
<211> 715
<212> PRT
<213> Candida albicans
<400> 85
Met Ser Leu Lys Pro Phe Thr Gly Leu Leu Phe Cys Cys Thr Gly Leu
1 5 10 15
Glu Ser Thr Thr Arg Arg Glu Val Val Glu Lys Ile Glu Thr Leu Gly
20 25 30
Gly Ile His Tyr Ser Asp Leu Met Thr Asp Val Asn Tyr Leu Ile Val
35 40 45
Gly Asp Arg Asp Thr Glu Lys Tyr Arg Phe Cys Ile Lys Tyr Arg Pro
50 55 60
Asp Ile Ile Phe Ile Asp Ala Asp Ser Ile Phe Thr Ile His Lys His
65 70 75 80
62
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Trp Ile Asn Gly Glu Asp Glu Asn Ser Asp Leu Leu Arg Ile Glu Lys
85 90 95
Tyr Arg Leu Ala Ile Phe Ala Gln Leu Asn Ala Cys Phe Ser Arg Ile
100 105 110
Glu Met Ser Thr Ser Gln Ile Asp His Leu Val Asn Thr Val Lys Phe
115 120 125
Arg Gln Arg Thr Asn Thr Ser Pro Glu Tyr Phe Arg Pro Lys Asn Leu
130 135 140
Phe Lys Leu Phe Val Asp Asn Gly Gly Ile Ala Lys Glu Ser Leu Ser
145 150 155 160
Cys His Gln Asn Phe Ile Ile Thr Ala Asp Pro Arg Gly Thr Arg Tyr
165 170 175
Asn Lys Ala Leu Glu Trp Asn Val Pro Ala Ile His Pro Ile Trp Ile
180 185 190
Val Asp Ser Val Leu Arg Gly Ala Ala Leu Asp Trp Lys Asp Tyr Ile
195 200 205
Leu Asn Asn Asn Pro Asn Asp Cys Tyr Asp Arg Gly Cys Asp Val Trp
210 215 220
Pro Glu Val Phe Asp Cys Gln Glu Lys Gln Lys Gln Lys Ser Gln Gln
225 230 235 240
Gln Pro Lys Arg Leu Glu Ser Thr Glu Pro Glu Val Lys Arg Lys Ile
245 250 255
Thr Asn Asn Lys Thr Asn Ala Asp Ile Trp Asn Ser Ile Met Asp His
260 265 270
Thr Lys Lys Gln Thr Lys Gln Leu Ile His Asp Lys Thr Trp Asp Asp
275 280 285
Asp Glu Glu Glu Glu Asp Asn Asp Asp Asp Gly Asp Thr Gln Thr Lys
290 295 300
Asn Glu Lys Asn Asn Gln Tyr Lys Asn Ile Thr Thr Ile Pro Lys Asp
305 310 315 320
Gly Lys Gln Lys Pro Glu Leu Asn Gly Lys Ile His Asn Leu Asp Leu
325 330 335
Lys Leu Val Ser Glu Ser Lys Glu Asn Ser Pro Asn Val Ser Glu Ser
340 345 350
Gln Leu Phe Leu Gly Phe Asn Tyr Tyr Thr Val Gly Phe Asp Ser Arg
355 360 365
Glu Phe Asp Leu Leu Ser Lys Ala Ile Glu Asn Tyr Ser Gly Glu Ile
370 375 380
Ser Asn Asp Pro Asn Asp Asp Ser Ile Thr His Val Val Ile Pro Ala
385 390 395 400
Lys Lys Gly Tyr Gln Ser Met Ser Val Leu Lys Val Leu Pro Ala Asp
405 410 415
Leu Lys Ser Arg Ile Ala Asn Gly Phe Val Lys Ile Val Thr Glu Phe
420 425 430
Phe Ile Glu Arg Cys Met Phe Tyr Lys Lys Ile Ile Leu Asp Arg Trp
435 440 445
Gly Gln Pro Met Lys Gly Leu Val Pro Ser Lys Lys Ser Phe Lys Ile
450 455 460
Cys Thr Thr Gly Phe Thr Gly Ile Glu Leu Leu His Ile Glu Lys Leu
465 470 475 480
Ile Arg Ser Phe Asn Phe Glu Tyr Cys Glu Thr Leu Ser Glu Gln Arg
485 490 495
Asp Leu Leu Ile Leu Asn Val Asn Leu Phe Lys Lys Ser Leu Met Asn
500 505 510
Ser Pro Lys Leu Phe Gln Tyr Lys Cys Lys Asp Ile Ile Asn Cys Pro
515 520 525
Thr Gly Gly Ser Val Ser Leu Met Ser Ser Lys His Lys Val Glu Ala
530 535 540
63
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ala Lys Arg Trp Asn Ile Pro Val Val Ser Val Ala Tyr Leu Trp Glu
545 550 555 560
Ile Leu Glu Leu Ser Thr Asn Lys Ser His Ile Ile Met Pro Asp Ile
565 570 575
Thr Asp Leu Gln Trp Cys Val Phe Ala Pro Ser Asn Tyr Asn Lys Pro
580 585 590
Lys Ser Leu Leu Glu Tyr Val Lys Asn Leu Asp Lys Ala Ser Arg Glu
595 600 605
Ser Ser Phe Ser Pro Lys Ser Gln Glu Asn Glu Ala Leu Glu Glu Pro
610 615 620
Thr Met Asp Asn Ser Val Arg Leu Pro Ser Pro Arg Arg Val Asn Ser
625 630 635 640
Lys Gln Lys Tyr Gly Lys Leu Val Gly Gly Lys Ser Pro Lys Ser Ile
645 650 655
Lys Arg Lys Leu Leu Glu Ala Ala Asn Ser Phe Ala Asp Gly Gln.Asn
660 665 670
Asp His Ser Ile Asn Pro Asp Val Thr Ile Glu Glu Asp Ser Met Ser
675 680 685
Gln Ile Arg Tyr Gln Asp Asn Glu Ser Met Ile Asn Gln Glu Arg Leu
690 695 700
Leu Glu Lys Leu Asp Gly Ser Ala Val Leu Val
705 710 715
<210> 86
<211> 1120
<212> PRT
<213> Candida albicans
<400> 86
Met Gly Lys Asp Leu Leu Thr Ala Glu Ala Val Thr Lys Leu Leu Arg
1 5 10 15
Ser Lys Asp Thr Ser Ile Thr Glu Ile Val Asn Thr Ala Asn Ser Leu
20 25 30
Leu Asn Asn Thr Leu Asp Ile Tyr Leu Pro Gly Lys Glu Val Phe Val
35 40 45
Leu Asn Leu Leu Cys Asp Arg Leu Asn Asp Lys Ser Asn Gly Lys Phe
50 55 60
Gly Lys Trp Lys Phe Asn Lys Asp Val Trp Asn Leu Leu Leu Ser Val
65 70 75 80
Trp Ser Lys Leu Asn His Gln Lys Val Asp Arg Gln Arg Val Ile Gln
85 90 95
Arg Leu Lys Ile Ile Glu Ile Ile Ile Leu Val Leu Gln Gln Asn Asn
100 105 110
Asp Asn Glu Val Phe Ser Ser Leu Phe Glu Phe Leu Gly Ile Met Phe
115 120 125
Gln Glu Ser Tyr Ile Ile Ala Asp Glu Asn Ser Ala Thr Gln Leu Leu
130 135 140
Lys Cys Phe Val Glu His Met Asp Val Leu Gln Ala Ser Asp Ser Ile
145 150 155 160
Val Ser Trp Thr Glu Leu Val Arg Asp Ile Tyr Thr Arg Ala Cys Ser
165 170 175
Lys Ile Ser Leu Glu Gly Ser Lys Lys Phe Tyr Asn Lys Phe Phe Glu
180 185 190
Asp Cys Cys Phe Pro Leu Ile Glu Tyr Leu Ala Ile Ser Glu Gly Ser
195 200 205
Ser Val Ser Pro Ile Leu Lys Glu Leu Leu Ile Gln Gly Val Phe Asn
210 215 220
64
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ala Asp Ser Thr Lys Tyr Tyr Gln Ser Ser Leu Glu Arg Glu Leu Lys
225 230 235 240
Lys Lys Asp Ile Lys Glu Val Ser Val Ile Tyr Leu Tyr Thr Leu Thr
245 250 255
Val Gln Leu Phe Ser Ala Lys His Met Glu Ile Cys Glu Gly Val Tyr
260 265 270
Ser Ile Met Ala Ser Lys Cys Pro Asp Leu Ala Glu Lys Leu Leu Ser
275 280 285
Ile Leu Ala Ser Cys Arg Lys Thr Ile Ser Lys Pro Phe Ile Glu Ser
290 295 300
Ile Tyr Lys Val Glu Val Ala Asp Lys Pro Phe Lys Gln Leu Asn Trp
305 310 315 320
Asp Met Val Lys His Ile Phe Ala Ile Asp Ser Glu Leu Ala Ile Ser
325 330 335
Lys Ser Gly Phe Leu Phe Lys Thr Tyr Lys Ser Glu Phe Gln Leu Asp
340 345 350
Asp Lys Val Val Pro Val Ala Glu Val Ile Val Asp Gly Phe Ala Arg
355 360 365
Asn Arg Glu Leu Ser Asp Phe Phe Thr Lys Val Trp Pro Lys Ala Ile
370 375 380
Lys Arg Asp Glu Ile Trp Glu Ser Asp Glu Phe Ile His Thr Val Ser
385 390 395 400
Gln His Val Lys Thr Phe Ser Gly Lys Gln Leu Ile Asp Val Ile Glu
405 410 415
Ser Ser Phe Tyr Ala Asp Lys Gly Ser Gln Arg Ala Ile Phe Thr Ala
420 425 430
Ile Thr Lys Gly Leu Thr Ser Ser,Ser Ala Asn Leu Ile Asp Ala Val
435 440 445
Lys Gln Thr Leu Leu Asp Arg Ser Asn Tyr Phe Asn Ala Thr Glu Asn
450 455 460
Phe Trp Cys Ile Arg Tyr Tyr Leu Leu Cys Leu Tyr Gly Thr Asp Phe
465 470 475 480
Thr Ile Ala Glu Gln Asn Met Lys Gln Asn Ile Asp Leu Tyr Tyr His
485 490 495
Phe Ser Ile Phe Arg Leu Leu Glu Leu Gln Val Ile Lys Glu Tyr Ser
500 505 510
Lys Ser Asp Gln Lys Tyr Phe Ile Ala Cys Ile Glu Gly Glu Lys Glu
515 520 525
Met Ile Ser Pro Ile Phe Lys Arg Trp Leu Val Ile Phe Asn Lys Phe
530 535 540
Phe Asp Ser Asp Leu Leu Ile Lys Leu Ile Ser Leu Gly Tyr Pro Asp
545 550 555 560
Ile Glu Phe Asp Asp Val Phe Phe Glu Gln Pro Lys Leu Thr Thr Ser
565 570 575
Leu Ile Arg Phe Ile Thr Glu Asn Leu Pro Ala Arg Met Asp Leu Ile
580 585 590
Ala Ser Ile Pro Ile Val Cys Phe Asn Lys Ala Phe Lys Lys Glu Leu
595 600 605
Leu Asn Gly Leu Phe Val Leu Phe Val Ser Asn Pro Thr Lys Glu Thr
610 615 620
Leu Glu Asn Ile Gln Tyr Leu Leu Gly Gln Pro Thr Tyr Ser Ser Ile
625 630 635 640
Leu Glu Thr Asn Phe Asp Asn Met Leu Lys Leu Leu Thr Val Ser Thr
645 650 655
Glu Glu Ser Lys Leu Ile Ala Tyr Asn Val Ile Glu Ile Val Trp Lys
660 665 670
Asn Asn Val Arg Gln Ile Lys Asn Glu Glu Asn Gln Lys Tyr Val Asn
675 680 685
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asp Ala Ile Ser Lys Leu Ser Ser Tyr Leu Asp Ser Met Ser Gln Gln
690 695 700
Ile Ile Ser Pro Glu Leu Glu Ala Ile Ser Ile Ile Leu Thr Asn Thr
705 710 715 720
Lys Glu Val Gly Leu Phe Glu Asn Thr Glu Lys Gly Leu Asn Lys Leu
725 730 735
Asn Glu Lys Phe Thr Asn Tyr Cys Ile Asn Thr Leu Asn Asn Cys Asn
740 745 750
Thr Gln Asn Phe Ile Thr Val Arg Trp Leu Leu Gln Ala Leu Val Met
755 760 765
Leu Pro Pro Lys Ser Leu Ser Phe Glu Asn Val Ile Ser Cys Thr Lys
770 775 780
Arg Leu Asp Pro Asn Ile Leu Lys Asp Asn Ser Ile Gln Ser Thr Leu
785 790 795 800
Phe Gln Leu Ile Cys Lys Thr Ile Asp Phe Asn Tyr Lys Ser Leu Val
805 810 815
Tyr Val Leu Ser Leu Phe Val Ser Leu Ser Ser Gly Arg Asn Thr Glu
820 825 830
Leu Tyr Thr Val Leu Lys Ser Leu Phe Gln Lys Phe Ser Lys His Ser
835 840 845
Gln Leu Tyr Phe Glu Val Phe Asp Phe Phe Thr Arg Ser Ile Asp Ala
850 855 860
Val Pro Val Glu Phe Asn Leu Ser Phe Ala Gln Ile Ala Ser Ile Phe
865 870 875 880
Leu Ser Thr Val Pro Lys Asp Ala Asp Ala Asn Arg Tyr Asn Ser Lys
885 890 895
Cys Phe Thr Phe Tyr Val Asn Ala Leu Gln Ser Gly Asn Glu Cys Val
900 905 910
Ala Met Gln Ile Leu Thr Ser Leu Lys Asp Leu Leu Thr Asn Gln Ser
915 920 925
Trp Ile Phe Lys Gln Asn Leu Leu Glu Ile Thr Leu Val Ile Val Lys
930 935 940
Thr Gly Leu Gln Lys Leu Asn Ser Phe Ala Asn Gln Glu Gln Ile Tyr
945 950 955 960
Ile Leu Ser Thr Gln Ile Val Ser His Ile Leu Leu Tyr His Arg Phe
965 970 975
Lys Ile Ala Thr Arg His His Leu Val Leu Asn Val Met Ser Ser Leu
980 985 990
Leu Lys Tyr Leu Ala Asp Gly Thr Ser Lys Leu Ser Ser Asn Thr Glu
995 1000 1005
Ala Ala Ser Ala Tyr Ala Arg Leu Leu Ser Asn Leu~Cys Glu Pro Ser
1010 1015 1020
Glu Arg Val Gly Asp Lys Met Phe His Leu Thr Thr Ser Ala Ser Tyr
1025 1030 1035 1040
Phe Lys Lys Leu Leu Arg Lys His Leu Ser Val Leu Leu Ser Asn Tyr
1045 1050 1055
Ile Tyr Phe Asn Leu Lys Tyr Thr Phe Thr Arg Thr Val Asn Asp Ala
1060 1065 1070
Ile Met Pro Gly Ile Tyr Ser Met Phe Thr Val Leu Ser Gln Asn Glu
1075 1080 1085
Leu Arg Val Val Asn Asp Ser Leu Asp Tyr Gly Gly Lys Ala Phe Tyr
1090 1095 1100
Lys Thr Leu Tyr Asn Asp Tyr Lys Asp His Gly Lys Trp Lys Asp Gln
1105 1110 1115 1120
<210> 87
<211> 196
<212> PRT
66
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Candida albicans
<400> 87
Met Ser Ala Asp Glu Asn Asn Lys Val Arg Phe Glu Arg Leu Arg Leu
1 5 10 15
Val Ala Arg Lys Ala Leu Glu Gln Ser Ile Lys Lys Ser Leu Thr Met
20 25 30
Glu Gln Val Lys Thr Cys Phe Pro Thr Leu Val Thr Ser Gln Asp Gly
35 40 45
Val Arg Ser Leu Glu Leu Ala Leu Ser Gln Met Ser Gly Phe Trp His
50 55 60
Ala Asn Ser Leu Asp Glu Phe Asp Leu Ile Tyr Lys Glu Lys Asp Ile
65 70 75 80
Glu Ser Lys Leu Asp Glu Leu Asp Asp Ile Ile Gln Asn Ala Gln Arg
85 90 95
Thr Lys Asp Ser Gly Lys Glu Pro Ser Asn Ile Asp Gln Leu Ser Pro
100 105 110
Leu Glu Ile Val Asp Ser Thr Ile Val Ser Asn Ser Lys Asn Val Leu
115 120 125
Asp Ser Leu Gln Met Ile Tyr Asp Gln.Leu Cys Leu Asp Asn Ala Glu
130 135 140
Leu Tyr Thr Glu Leu Ser Glu Leu Thr Lys Glu Ser Thr Arg Ile Asn
145 150 155 160
Asn Ser Ile Lys Ser Gly Ile Glu Gln Leu Asn Lys Glu Ala Asn Ser
165 170 175
Val Glu Leu Glu Lys Ala Gly Leu Gln Ile Asp Lys Leu Ile Asp Ile
180 185 190
Leu Glu Glu Lys
195
<210> 88
<211> 471
<212> PRT
<213> Candida albicans
<400> 88
Met Ala Ser Ser Ile Leu Arg Ser Lys Ile Ile Gln Lys Pro Tyr Gln
1 5 10 15
Leu Phe His Tyr Tyr Phe Leu Ser Glu Lys Ala Pro Gly Ser Thr Val
20 25 30
Ser Asp Leu Asn Phe Asp Thr Asn Ile Gln Thr Ser Leu Arg Lys Leu
35 40 45
Lys His His His Trp Thr Val Gly Glu Ile Phe His Tyr Gly Phe Leu
50 55 60
Val Ser Ile Leu Phe Phe Val Phe Val Val Phe Pro Ala Ser Phe Phe
65 70 75 80
Ile Lys Leu Pro Ile Ile Leu Ala Phe Ala Thr Cys Phe Leu Ile Pro
85 90 95
Leu Thr Ser Gln Phe Phe Leu Pro Ala Leu Pro Val Phe Thr Trp Leu
100 105 110
Ala Leu Tyr Phe Thr Cys Ala Lys Ile Pro Gln Glu Trp Lys Pro Ala
115 120 125
Ile Thr Val Lys Val Leu Pro Ala Met Glu Thr Ile Leu Tyr Gly Asp
130 135 140
Asn Leu Ser Asn Val Leu Ala Thr Ile Thr Thr Gly Val Leu Asp Ile
145 150 155 160
Leu Ala Trp Leu Pro Tyr Gly Ile Ile His Phe Ser Phe Pro Phe Val
165 170 175
67
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Leu Ala Ala Ile Ile Phe Leu Phe Gly Pro Pro Thr Ala Leu Arg Ser
180 185 190
Phe Gly Phe Ala Phe Gly Tyr Met Asn Leu Leu Gly Val Leu Ile Gln
195 200 205
Met Ala Phe Pro Ala Ala Pro Pro Trp Tyr Lys Asn Leu His Gly Leu
210 215 220
Glu Pro Ala Asn Tyr Ser Met His Gly Ser Pro Gly Gly Leu Gly Arg
225 230 235 240
Ile Asp Lys Leu Leu Gly Val Asp Met Tyr Thr Thr Gly Phe Ser Asn
245 250 255
Ser Ser Ile Ile Phe Gly Ala Phe Pro Ser Leu His Ser Gly Cys Cys
260 265 270
Ile Met Glu Val Leu Phe Leu Cys Trp Leu Phe Pro Arg Phe Lys Phe
275 280 285
Val Trp Val Thr Tyr Ala Ser Trp Leu Trp Trp Ser Thr Met Tyr Leu
290 295 300
Thr His His Tyr Phe Val Asp Leu Ile Gly Gly Ala Met Leu Ser Leu
305 310 315 320
Thr Val Phe Glu Phe Thr Lys Tyr Lys Tyr Leu.Pro Lys Asn Lys Glu
325 330 335
Gly Leu Phe Cys Arg Trp Ser Tyr Thr Glu Ile Glu Lys Ile Asp Ile
340 345 350
Gln Glu Ile Asp Pro Leu Ser Tyr Asn Tyr Ile Pro Ile Asn Ser Asn
355 360 365
Asp Asn Glu Ser Arg Leu Tyr Thr Arg Val Tyr Gln Glu Ser Gln Val
370 375 380
Ser Pro Pro Ser Arg Ala Glu Thr Pro Glu Ala Phe Glu Met Ser Asn
385 390 395 400
Phe Ser Arg Ser Arg Gln Ser Ser Lys Thr Gln Val Pro Leu Ser Asn
405 410 415
Leu Thr Asn Asn Asp Gln Val Pro Gly Ile Asn Glu Glu Asp Glu Glu
420 425 430
Glu Glu Gly Asp Glu Ile Ser Ser Ser Thr Pro Ser Val Phe Glu Asp
435 440 445
Glu Pro Gln Gly Ser Thr Tyr Ala Ala Ser Ser Ala Thr Ser Val Asp
450 455 460
Asp Leu Asp Ser Lys Arg Asn
465 470
<210> 89
<211> 1179
<212> PRT
<213> Candida albicans
<400> 89
Met Thr Ser Ser Ser Gln Leu Ser Ala Ser Ser Asn Glu Ser Ile Gln
1 5 10 15
Asn Glu Arg Leu Leu Ser Ser Ser Leu Phe Asp Gln Ile Arg Pro Val
20 25 30
Cys Ile Glu Leu Ser Glu Ala Ser Thr Ser Gln Pro Phe Asn Thr Asn
35 40 45
Lys Val Val Asn Leu Met Ile Ser Met Glu Asp Ile Leu Lys Lys His
50 55 60
His Asp Glu Tyr Asn Lys Asp Gly Asn Phe Arg Ile Tyr Gln Leu Ser
65 70 75 80
Pro Lys Leu Ala Asp Tyr Ile Phe Tyr Pro Leu Ser Asn Ile Leu Lys
85 90 95
68
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Gln Pro Ala Leu Asp Asp Thr Ile Ile Gln His Leu Phe Gly Ile Ile
100 105 110
Arg Phe Leu Val Glu Tyr Ser Trp Ser Phe Asn Val Asn Phe Val Leu
115 120 125
Thr Asp Gln Leu Leu Pro Leu Val Ile Tyr Leu Ser Ser Gly Asp Leu
130 135 140
Asn Lys Glu Pro Leu Leu Ile Thr Lys Lys Ser Ile Gln Phe Lys Ile
145 150 155 160
Ala Thr Val Ser Val Leu Tyr Thr Ile Thr Ser Thr Leu Asn Lys Glu
165 170 175
Tyr Phe Gln Ser Leu Thr Glu Lys Arg Leu Leu Phe Ile Ser Asn Val
180 185 190
Ile Thr Ile Cys Leu Ser Ile Ile Val Gly Ser Arg Val Glu Ser Gln
195 200 205
Asp Thr Ile Gln Leu Val Leu Lys Cys Leu Ser Leu Ile Ser Asn Val
210 215 220
Lys Arg Tyr Leu Asn Ser Ser Gln Ile Ser Ile Ile Leu Pro Gly Ile
225 230 235 240
Val Ser Ser Ile Thr Lys Phe Ile Ser Leu Asn Leu Asn Leu Asn Tyr
245 250 255
Gln Ile Ile Ile Gln Phe Leu Arg Leu Leu Ser Gly Phe Ile Cys Ala
260 265 270
Ser Phe Asn Asp Lys Glu Leu Asp Ala Gln Ile Glu Leu Asn Glu Gly
275 280 285
Ile Ser Asp Ile Ser Glu Ile His Val Gly Trp Asp Asp Asp Asn Glu
290 295 300
Thr Leu Gly Asn Asn Ser Leu Tyr Ser Asp Val Thr Ile Thr Glu Asn
305 310 315 320
Asp His Arg Ser Ser Ala Trp Leu Lys Ala Thr Ser Lys Gln Leu Lys
325 330 335
Leu Ser Leu Ile Ile Ile Phe Lys Ser Ile Leu Leu Gly Ser Arg Asn
340 345 350
Arg His Arg Leu Arg Ser Lys Gln Glu Leu Tyr Asp Glu Ile Leu Gly
355 360 365
Phe Val Glu Thr Ile Leu Lys Asn Cys Phe Asn Ser Leu Phe Lys Glu
370 375 380
Phe Ala Ser Leu Ala Ile Asp Ile Val Ser Ile Leu Gly Tyr Val Thr
385 390 395 400
Ser Glu Asp Asn Lys Glu Met Ala Asp Lys Thr Asn Lys Leu Ser Asn
405 410 415
Thr Leu Cys Met Ile Ile Glu Gly Glu Thr Asn Lys Glu Glu Val Leu
420 425 430
Phe Glu Leu Val Lys Thr Lys Leu Ala Asp Leu Ile Asp Asn Lys Leu
435 440 445
Ser Gly Ile Val Phe Ala Leu Asp Glu Asp Lys Ile Ser Ser Thr Val
450 455 460
Ala Ser Met Met Phe Asn Phe Ser Leu Leu Leu Cys Leu Ser Arg Lys
465 470 475 480
Val Lys Leu Asp Cys Glu Asp Leu Asp Ser Leu Lys Gln Arg Cys Leu
485 490 495
Ala Leu Leu Thr Glu Tyr Val Ala Asp Arg Phe Lys Phe Glu Ser Ser
500 505 510
Lys Pro Ile Lys Ser Ser Asn Ala Ser Gly Leu Leu Glu Thr Ser Ser
515 520 525
Met Thr Asn Gln Leu Asp Ser Ile Glu Leu Pro Gly Tyr Ile Asn Ala
530 535 540
Lys Ser Val Val Lys Gln Glu Pro Leu Lys Lys Glu Gln Asp Lys Arg
545 550 555 560
69
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ala Tyr Ile His Asn Leu Lys Thr Ile Ser Arg Asn Trp Asn Thr Asn
565 570 575
Glu Ile Asn Asn Ser Ser Gly Asn Thr Leu Ile Gly Ile Ser Ser Lys
580 585 590
Phe Ser Glu Thr Ile Leu Gln Asn Phe Ile Asn Tyr Leu Ser Ser Leu
595 600 605
Lys Tyr Glu Ala Ser Asn Ser Ser Thr Leu Thr Glu Leu Glu Asn Ile
610 615 620
Phe Glu Leu Ala Asp Asp Asn Asp Met Ile Thr Lys Ser Thr Ser Leu
625 630 635 640
Trp Val Ala Ser Asn Tyr Tyr Lys Arg Ser Thr Leu Gly Lys Val Ile
645 650 655
Asn Phe Asp Leu Gly Lys Tyr Leu Val Leu Asp Asp Asp Glu Asp Met
660 665 670
Glu Ile Asp Asp Asp Thr Lys Glu Met Ser Phe Leu Val Leu Ser Arg
675 680 685
Ala Glu Glu Leu Leu Glu Glu Ile Ser Glu Asn Gln Glu Lys Tyr Ser
690 695 700
Ser Gln Thr Tyr Ile Leu Ala Tyr Asn Ala Ala Leu Gln Ser Ile Lys
705 710 715 720
Val Val Ala Gly Ser Ile Pro Leu Asp Gln Phe Arg Thr Asn Phe Leu
725 730 735
Met Asp His Leu Leu Ser Val Phe Gln Ala Leu Thr Tyr Asn Asp Met
740 745 750
Pro Glu Ile Gln Leu Gln Ala Gln Ser Thr Leu Lys Val Val Leu Asp
755 760 765
Thr Tyr Tyr Asn Gly Ser Met Val Asn Leu Ile Ser Asp Asn Ser Asp
770 775 780
Tyr Leu Ile Asp Ser Ile Ser Leu Gln Met Ser Val Ala Ser Asn Leu
785 790 795 800
Thr Pro Met Leu Pro Gly Ile Leu Leu Ile Ile Val Lys Ile Ala Gly
805 810 815
Ile Gln Leu Leu Glu Ser Asn Gln Leu His Asp Val Leu Thr Asp Met
820 825 830
Phe Val Ile Leu Asp Ser Phe His Gly Tyr Asn Lys Leu Val Glu Ser
835 840 845
Phe Phe Ile Val Phe Glu Ala Leu Ile Asp Gln Ile His His Lys Phe
850 855 860
Asp Ser Gln Leu Lys Val Glu Phe Lys Glu Ser Ser Lys Thr Asn Thr
865 870 875 880
Ser Leu Tyr Lys Pro Trp Gly Met Thr Asn Lys Asp Gln Leu Leu Glu
885 890 895
Leu Leu Asn Glu Ser Asn Lys Met Val Asp Lys Tyr Glu Gly Tyr Asp
900 905 910
Ser Asn Lys Glu Tyr Phe Lys Arg Lys Ala Asp Leu Pro Phe Ser Glu
915 920 925
Met Asp Ala Asp Ser Asp Asp Glu Glu Glu Asp Asp Glu Ala Asn Ile
930 935 940
Asp Asp Asn Gly Glu Glu Glu Glu Glu Lys Glu Glu Ile Trp Ser Ser
945 950 955 960
Pro Val Ser Lys Asp Ile Tyr Met Ile Ser Leu Arg Ile Phe Asn Tyr
965 970 975
Gly Phe Thr Leu Val Ser Gln Glu Ser Tyr Thr Leu Lys Thr Gln Ile
980 985 990
Ile Lys Thr Leu Arg Leu Leu Leu Pro Leu Leu Cys Thr Asn Tyr Lys
995 1000 1005
Leu Leu Leu Pro Val Leu Ala Leu Asn Trp Gln Met Leu Ile Ala Leu
1010 1015 1020
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Val Thr Gly Ser Lys Ser Leu Ser Thr Ser Ile Glu Ser Asn Gly Glu
1025 1030 1035 1040
Tyr Ala Ser Glu Asp Ile Gly Val Met Thr Glu Ala Leu Gln Leu Val
1045 1050 1055
Thr Glu Ile Leu Glu Glu Asp Lys Arg Arg Tyr Glu His Phe Phe Ser
1060 1065 1070
Lys Lys Phe Gln Glu Ala Trp Glu Phe Ile Ser Arg His Ser Lys Leu
1075 1080 1085
Val Arg Gln Arg Glu Val Thr Ser Thr Thr Asn Ile Arg Glu Gln Lys
1090 1095 1100
Gln Leu Val Val Ser Glu Lys Ala Ile Tyr Thr Phe Arg Asn Tyr Pro
1105 1110 1115 1120
Leu Leu Lys Thr Ser Leu Val Thr Phe Leu Ile Thr Gly Val Gln Asn
1125 1130 1135
Tyr Glu Lys Met Ile Pro Asp Ile His Arg Phe Glu Ile Ile Lys Leu
1140 1145 1150
Cys Tyr Glu Leu Gln Ile Pro Gln Ser Ile Pro Leu Ser Arg Asp Thr
1155 1160 1165
Ile Gly Val Leu Glu Val Leu Lys Asn Thr Thr
1170 1175
<210> 90
<211> 278
<212> PRT
<213> Candida albicans
<400> 90
Met Ser Ser Leu Phe Ile Asn Glu Glu Asp Asp Met Thr Pro Glu Pro
1 5 10 15
Tyr Lys Pro Ser Thr Ser Thr-Ile Arg Glu Glu Glu Glu Glu Val Gln
20 25 30
Val Lys Gln Glu Phe Pro Asp Glu Lys Met Val Asp Pro Asp Glu Asp
35 40 45
Asp Pro Ile Val Glu Ser Ile Pro Leu Leu Ile Asn Thr Val Pro Glu
50 55 60
Arg Ala Lys Gln Ser Leu His Val Leu Gln Tyr Ala Gly Arg Pro Lys
65 70 75 80
Ser Arg Pro Asn Arg Ala Gly Asn Cys His Ala Ser Ile Lys Pro Glu
85 90 95
Ser Gln Tyr Leu Gln Val Lys Val Pro Leu Asp Thr Glu Lys Phe Phe
100 105 110
Asn Val Asp Lys Ile Gln Glu Trp Gly Glu Gln Ile Val Glu Gln Thr
115 120 125
Ile Ser Gly Val Leu Asp Gly Ser Tyr Glu Val Gly Asn Tyr Ala Ala
130 135 140
Lys Ile Ile Asn Asp Ser Asp Gly Arg Arg Val Val Leu Ile Pro Val
145 150 155 160
Asp Ser Thr Val Gln Leu Lys Pro Ser Phe Lys Tyr Ile Asp Asp Leu
165 170 175
Glu Ala Gln Ser Ile Gln Gln Arg Arg Gln Gln Glu Ser Thr Asn Glu
180 185 190
Lys Pro Ala Asn Val Gln Ile Leu Gln Ser Ala Ala Lys His Ser Thr
195 200 205
Gln Ser Gly Glu Phe Ser His Ser Leu Gly Asp Ser Leu Lys Ser Val
210 215 220
Lys His Phe Glu Glu Glu Glu Trp Gln Asn Leu Ile Trp Lys Arg Gly
225 230 235 240
71
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asp Asp Asp Val Thr Lys Ser Ile Lys Phe Gly Leu Asp His His Thr
245 250 255
Asp Thr Asn Ile Glu Leu Lys Thr Asn Thr Ser Tyr Asp Glu Tyr Ile
260 265 270
Asp Met Leu Ile Asn Asn
275
<210> 91
<211> 492
<212> PRT
<213> Candida albicans
<400> 91
Met Lys Gln His Pro Leu Val Thr Ala Tyr Lys Gly Ile Asp Asp Leu
1 5 10 15
Gln Gln Leu Lys Lys Trp Phe Tyr Glu Tyr Asn Asp Thr Ile Asp His
20 25 30
Arg Lys Lys Ala Ile Ser Lys Val Lys Gly Leu Leu Thr Arg Gly Lys
35 40 45
Leu Pro His Gly Val Glu Ala Thr Ser Leu Leu Thr Ser Ile Val Leu
50 55 60
Asp Asp Leu Gln Arg Lys Asp Ile Asp Ser Cys Val Leu Gln Leu Ser
65 70 75 80
Tyr Thr Met Ala Leu Ile Arg Phe Val Asn Gly Leu Leu Asp Pro Tyr
85 90 95
Gln Gln Ser Asn Tyr Ala Ile Pro Met His Leu Leu Ala Lys Gln Leu
100 105 110
Asn Leu Pro Thr Tyr Phe Val Glu Leu Arg His Met Gly Thr His Glu
115 120 125
Asn Leu Pro Ser Leu Asp Ile Leu Arg Ser Thr Cys Ser Lys Ala Leu
130 135 140
Thr Trp Leu Tyr Asp Asn Tyr Trp Cys His Val Glu Glu Ala Asn Gln
145 150 155 160
Asp Lys Gln Val Ser Ile Gly Gly Pro Leu Thr Asp Ala Val Glu Phe
165 170 175
Arg Ser Asn Asp Leu Arg Thr Arg Ile Glu Asp Ser Gln Ile Tyr Asn
180 185 190
Asn Leu Lys Ala Phe Lys Arg Ile Arg Lys Gln Asp Leu Asn Lys Val
195 200 205
Tyr Glu Lys Asn Asp Thr Thr Ser Asp Leu Ala Ala Thr Tyr His Arg
210 215 220
Cys Val Ser Asp Ile Val Glu Phe Ala Lys Glu Asn Cys Asp Leu Leu
225 230 235 240
Val Asn Val Leu Leu Leu Lys Asn Tyr Leu Ile Tyr Pro Ser Ser Lys
245 250 255
Val Lys Asp Lys Lys Ser Lys Phe Asn Pro Leu Ile Ile Lys Leu Tyr
260 265 270
Glu Pro Leu Phe Asp Ala Leu Gly Leu Ser Phe Lys Leu Lys Cys Phe
275 280 285
Ser Lys Thr Ile Glu Leu Ile Glu Ala Thr Pro Ser Ser Phe Val Asp
290 295 300
Lys Lys Val Tyr Arg Lys Leu Gly Phe Thr Glu Lys Phe Glu Tyr Asp
305 310 315 320
Glu Leu Phe Gln Val Met Glu Trp Val Leu Tyr Phe Met Gln Asp Leu
325 330 335
Leu Arg Asn Glu Asn Val Pro Ser Pro Val His Asn Lys Asn Glu Leu
340 345 350
72
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Val Ile Leu Phe Leu Asp Ser Leu Lys Ser Ile Glu Gln Lys Ile Ser
355 360 365
Gln Ser Leu Leu Pro Ser Phe Ala Lys Ile Leu Gln Gly Leu Cys Asp
370 375 380
Val Val Asn Asp Gly Val Lys Ser Glu Ile Asp Pro Glu Thr Val Gln
385 390 395 400
Lys Leu Asp Ala Trp Asn Lys Ser Leu Asn Asn Leu His Ser Thr Lys
405 410 415
Lys Ile Phe Glu Leu Pro Pro Ser Leu Asp Asp Leu Leu Gly Leu Ser
420 425 430
Pro Ser Pro Gly Pro Ile Pro Glu Thr Thr Ser Ser Asn Pro Met Lys
435 440 445
His Val Leu Asp Asp Asp Asp Asp Glu Glu Glu Glu Gly Val Arg Arg
450 455 460
Lys Gln His His Ser Ser Asp Ser Lys Thr Tyr Ile Leu Lys Pro His
465 470 475 480
Lys Asn Trp Arg Pro Val Pro Phe Gly Thr Cys Ile
485 490
<210> 92
<211> 409
<212> PRT
<213> Candida albicans
<400> 92
Met Thr Ser Ser Ile Asn Ile Leu Leu Leu Leu His Pro Thr Val Val
1 5 10 15
Thr Asp Ala Gln Leu Val Glu Gln Ile Lys Ser Lys Ile Tyr Gln Ser
20 25 30
His Asn Asn Asn Asn Asn Asn Asn Gly Gly Thr Thr Thr Thr Thr Thr
35 40 45
Gly Thr Val Asn Ile Asn Leu Asn Gln Gln Ile Ile Asp Arg Val Thr
50 55 60
Lys Gly Ile Ile Glu Leu Pro Tyr Asp Tyr Tyr Asp Glu Ile Ile Tyr
65 70 75 80
Ile Asn Pro Asn Asn Glu Ser Gln Tyr Arg Glu Ile Pro Ile Ser Leu
85 90 95
Met Gln Leu Ile Tyr Lys Leu Leu Lys Ser Asn Gly Lys Phe Lys Gly
100 105 110
Asp Leu Pro Leu Asp Gln Asn Leu Asp Val Leu Met Thr Gly Phe Ile
115 120 125
Ile Glu Glu Glu Glu Lys Glu Lys Glu Lys Glu Glu Asn Asn Leu Glu
130 135 140
Gly Glu Leu Val Asn Val Trp Val Lys Pro Ile Pro Val Asp Glu Pro
145 150 155 160
Val Val Thr Leu Leu Lys Lys Lys Thr Thr Thr Ser Asn Thr Thr Thr
165 170 175
Ile Lys Lys Ser Leu Pro Leu Phe Lys Lys Leu Asn Lys Asp Glu Ile
180 185 190
Asn Asn Ser Asp Lys Asp Ile Asn Asn Asp Asn Ile Thr Asn Asn Asn
195 200 205
Asn Asn Asn Asn Asn Lys Arg Lys Leu Val Glu Thr Lys Leu Thr Tyr
210 215 220
Phe Ser Ser Asp Asp Glu Asn Ser Ser Asp Gly Ser Val Leu Glu Asn
225 230 235 240
Asp Asp Ile Asp Asp Asp Asp Glu Leu Ile Asp Glu Asn Asp Leu Leu
245 250 255
73
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asn Phe Asn Asn Asn Asn Asn Thr Asn Gly Gly Ser Leu Leu Ser Asp
260 265 270
Lys Leu Ile Thr Pro Arg Lys Cys Asp Ile Ser Leu Asn Gly Gly Lys
275 280 285
Lys Arg Lys Lys Ala Cys Lys Asp Cys Thr Cys Gly Leu Lys Glu Leu
290 295 300
Glu Glu Leu Glu Val Ser Asn Gln Gln Asn Leu Gln Asp Gln Ile Leu
305 310 315 320
Gly Lys Leu Ala Gln Ser Ala Thr Leu Glu Ala Ile Lys Ile Glu Glu
325 330 335
Arg Leu Lys Gln Gln Gln Gln Gln Gln Gln Gln Lys Val Lys Val Lys
340 345 350
Phe Thr Glu Glu Asp Leu Ser Glu Ile Asp Phe Thr Val Gln Gly Lys
355 360 365
Thr Gly Gly Cys Gly Ser Cys Ala Leu Gly Asp Ala Phe Arg Cys Asp
370 375 380
Gly Cys Pro Tyr Leu Gly Leu Pro Pro Phe Lys Pro Gly Glu Val Val
385 390 395 400
Lys Leu Asp Gly Phe Gly Glu Asp Ile
405
<210> 93
<211> 327
<212> PRT
<213> Candida albicans
<400> 93
Met Ile Arg Thr Ile Lys Pro Lys Asn Ala Arg Ser Lys Arg Ala Leu
1 5 10 15
Ala Lys Lys Glu Ala Lys Leu Val Glu Asn Thr Lys Ser Ala Leu Phe
20 25 30
Val Pro Gly Ser Thr Gly Asn Lys Phe Leu His Asp Ala Met Cys Asp
35 40 45
Leu Met Ala Phe Lys Lys Pro Phe Ala Lys Lys Phe Ser Lys Lys Asn
50 55 60
Glu Ile Arg Pro Phe Glu Asp Ser Ser Gln Leu Glu Phe Phe Ala Glu
65 70 75 80
Lys Asn Asp Ser Ser Leu Met Val Phe Ser Ser Asn Asn Lys Lys Arg
85 90 95
Pro Lys Thr Leu Thr Phe Val Arg Phe Phe Asn Phe Lys Val Tyr Asp
100 105 110
Met Ile Gly Leu Ser Ile Gln Glu Asn His Lys Leu Leu Gln Asp Phe
115 120 125
Lys Lys Leu Thr Phe Thr Ile Gly Leu Lys Pro Met Phe Val Phe Asn
130 135 140
Gly Pro Ile Phe Asp Ser His Pro Val Tyr Gln His Ile Lys Ser Leu
145 150 155 160
Phe Leu Asp Phe Phe Arg Gly Glu Glu Thr Asp Leu Gln Asp Val Ala
165 170 175
Gly Leu Gln Tyr Val Ile Ala Leu Ser Ala Gly Glu Val Glu Asp Leu
180 185 190
Asn Asn Asp Lys Val Leu Pro Leu Val His Phe Arg Val Tyr Lys Leu
195 200 205
Lys Ser Tyr Lys Ser Gly Gln Lys Leu Pro Arg Ile Glu Leu Asp Glu
210 215 220
Ile Gly Pro Arg Phe Asp Phe Lys Ile Gly Arg Arg Ile Thr Pro Thr
225 230 235 240
74
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Pro Asp Val Glu Lys Glu Ala Thr Lys Lys Pro Lys Gln Leu Glu Ala
245 250 255
Lys Val Lys Lys Asn Val Thr Thr Asp Phe Met Gly Asp Lys Val Ala
260 265 270
Gln Ile His Val Gly Lys Gln Asp Leu Ser Lys Leu Gln Thr Arg Lys
275 280 285
Met Lys Gly Leu Lys Glu Lys Tyr Asp Gln Glu Ser Glu Glu Glu Asp
290 295 300
Val Tyr Val Ser Asp Glu Glu Tyr Phe Gly Glu Asp Ile Glu Glu Pro
305 310 315 320
Glu Thr Lys Arg Gln Lys Val
325
<210> 94
<211> 125
<212> PRT
<213> Candida albicans
<400> 94
Met Ser Lys Thr Asn Thr Ala Ile Tyr Gln Lys Ile Ala Glu Lys Arg
1 5 10 15
Ala Asn Leu Glu Arg Phe Arg Glu Phe Lys Glu Leu Thr Asp Asp Leu
20 25 30
Val Leu Gln Leu Glu Ser Ile Gly Asp Lys Leu Glu Thr Met Asn Gly
35 40 45
Gly Thr Ala Ser Val Ala Leu Ile Leu Ala Asn Trp Lys Ser Val Val
50 55 60
Gln Ser Ile Ser Leu Ala Ser Leu Ala Leu Met Lys Glu Ser Asn Asp
65 70 75 80
Asn Asn Lys Glu Ala Phe Pro Glu Pro Leu Val Arg Val Arg Val Gly
85 90 95
Gln Ser Asn Glu Glu Asn Gln Asp Asp Glu Glu Ala Asp Glu Glu Glu
100 105 110
Gly Val Arg Asp Ser Glu Glu Val Glu Glu Ser Thr Glu
115 120 125
<210> 95
<211> 1120
<212> PRT
<213> Candida albicans
<400> 95
Met Asp Tyr Gln Asp Leu Leu His Lys Ile Ile Lys Glu Phe His Ser
1 5 10 15
Leu Lys Glu Phe Lys Pro Trp Asp Ser Ser Val Leu Tyr Glu Thr Leu
20 25 30
Leu Arg Ser Val Leu Thr Thr Leu Ile Glu Leu Leu Gly Ile Asp Asn
35 40 45
Pro Pro Ser Tyr Leu His Leu Thr Thr Asn Asn Asp Ser Ile Gly Asp
50 55 60
Leu Lys Ile Lys Tyr Tyr Gly Asn Ala Leu Ser Lys Ser Ile Asn Gly
65 70 75 80
His Ser Met Leu Gln Tyr Leu Glu Ser Lys His Val Ser Ile Leu Gln
85 90 95
Ala Val Val Glu Ile Ile Asn Thr Arg Ser Tyr Arg Ile Lys Glu Ser
100 105 110
Tyr Ser Ala Val Phe Lys Asp Val Ser His Leu Phe Glu Lys Leu Leu
115 120 125
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Lys Glu Arg Tyr Glu Ala Glu Ser Asn Leu Glu Asp Tyr Ile Leu Gln
130 135 140
Cys Leu Met Tyr Glu Thr Gln Phe Tyr Gln Gly Ile Val Asp Asn Val
145 150 155 160
Leu Thr Ala Asp Asp Thr Glu Lys Leu Ala Ser Phe Leu Gly Thr Arg
165 170 175
Leu Ser Glu Glu Asp Ser Met Phe Ser Tyr Arg Asp Ile Asp Tyr Pro
180 185 190
Leu Glu Leu Asn Ile Asn Asn Glu Ser Leu Glu Lys Ile Tyr Lys Ile
195 200 205
Phe Leu Gly Val Ile Gly Thr Lys Arg Phe Asp Ile Lys Glu Val Ala
210 215 220
Ser Ala Val Val Gly Val Tyr Lys Arg His Gln Arg Ile Asp His Phe
225 230 235 240
Glu Lys Leu Asp Ser Asp Glu Ile Leu Gly Lys Phe Phe Arg Asn Ile
245 250 255
Leu Pro Gln Ser Phe Gln Ser Val Thr Asn Lys Val Phe Arg Glu Phe
260 265 270
His Lys Glu Val Asp Asp Pro Pro Ser Asp Val Leu Asp Gln Leu Asp
275 280 285
Asn Ile Val Asp Asp Phe Ile Ala Val Gly Ile Glu Gly Val Asp Leu
290 295 300
Gly Phe Pro Ala Leu Phe Arg His Tyr Ile Lys Phe Met Asn Glu Ile
305 310 315 320
Phe Pro Thr Val Val Glu Asp Ala Asp Arg Asp Phe Val Ala Arg Ile
325 330 335
Asn Ser Leu Ile Ala Gln Val Leu Glu Phe Lys Asp Asp Glu Lys Ser
340 345 350
Cys Asp Ile Asn Gln Val Val Ser Glu Phe Val Ser Leu Gln Ser Leu
355 360 365
Leu Leu Lys Asn Asn Tyr Leu Ser Pro Ser Thr Leu Leu Met Arg Ala
370 375 380
Ser Thr His Asp Tyr Tyr Lys Asn Leu Gln Ile Val Lys Ile Thr Phe
385 390 395 400
Asp Gly Trp Asn Glu Asn Ser Lys Arg Ile Leu Lys Leu Glu Asn Ser
405 410 415
Gly Phe Leu Gln Ser Lys Thr Leu Pro Lys Tyr Leu Lys Leu Trp Tyr
420 425 430
Ser Lys Ser Met Lys Leu Asn Glu Leu Cys Asn Arg Val Asp Glu Phe
435 440 445
Tyr Asn Gly Glu Leu Cys Arg Lys Val Trp His Cys Trp Arg Ser Gln
450 455 460
Gln Asn Val Tyr Asn Leu Lys Met Glu Val Ala Asp Lys Arg Leu Leu
465 470 475 ~ 480
Asn Gln Tyr Tyr Ile Lys Trp Arg Lys Lys Glu Lys Asp Met Lys Ala
485 490 495
Asn Leu Thr Ile Ala Val Glu Phe Asp His Phe His Leu Leu Asp Lys
500 505 510
Ser Phe Lys Ile Leu Lys Gly Tyr Phe Asn Leu Ala Lys Asn Ser Asp
515 520 525
Val Leu Ala Met Ser Leu Phe Gln Ser Phe Glu Glu Asn Arg Asp Ser
530 535 540
Arg Ile Lys Leu Lys Tyr Phe Gln Tyr Trp Asn Leu Lys Ile Ser Asp
545 550 555 560
Arg Val His Gly Leu Thr Met Lys Leu Glu Lys Phe His Gln Val Lys
565 570 575
Asp Lys Phe Val Leu Gly Asn Tyr Phe Glu Thr Trp Tyr Tyr Lys His
580 585 590
76
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asn Leu Val Glu Lys Ser Asn Asn Phe Val Ser Ala Lys Asp Leu Gln
595 600 605
Leu Leu Ala Lys Thr Phe Thr Asn Thr Trp Leu Lys Lys Phe Leu Leu
610 615 620
Tyr Lys Lys Ala Phe Lys Ile Glu Glu Glu Leu Gly Ala Asp Leu Lys
625 630 635 640
Arg Lys Thr Phe Asp Arg Trp Lys Glu Ala Val Gln Leu Glu Val Lys
645 650 655
Ala Lys Glu Phe His Glu Arg His Leu Leu Glu Thr Ala Phe His Glu
660 665 670
Trp Lys Leu Lys Ser Ile Leu Ile Ser Asn Arg Ala Ser Phe Asp His
675 680 685
Ile Leu Val Gln Arg Cys Phe Gln Thr Trp Ser Val Glu Ile Lys Leu
690 695 700
Arg Glu Leu Gln Gln Lys Gln Asp Thr Arg Leu Val Val Asn Ile Phe
705 710 715 720
Gln Lys Trp Arg Thr Arg Gln Leu Glu Leu Ala Lys Leu Asp Glu Lys
725 730 735
Ser Gln Ala Phe Tyr Glu Ser Asn Met Lys His Leu Val Val Gln Lys
740 745 750
Trp Asn Val Glu Asn Ser Asn Ile Gly Leu Leu Glu Lys Arg Ala Asp
755 760 765
Arg Phe Phe Ile Arg Arg Phe Phe Ile Gln Lys Trp Gln Ser Lys Met
770 775 780
Thr Lys Tyr Glu Asp Ile Thr Val Tyr His Leu Glu Asp Glu Ile Ala
785 790 795 800
Thr Lys Leu Ala Tyr Lys Val Trp Arg Gln Arg Tyr Phe Glu Asn Tyr
805 810 815
Glu Glu Lys Leu Asp Asn Leu Leu Glu Thr Met Asp Thr Ser Ala Ala
820 825 830
Asp Thr Val Arg Cys Ser Arg Tyr Phe Gly Leu Trp Arg Ala Lys Leu
835 840 845
Gln Thr Val Lys Gln Ile Glu Glu Arg Val Ser Thr Ser Val Ala Pro
850 855 860
Ser Val Ala Ile His Phe Lys Asn Trp His Val Lys Ser Gln Gln Lys
865 870 875 880
Gln Glu Leu Leu Glu Asn Ala Leu Gln Phe Glu Glu Ile Asn Leu Ser
885 890 895
Arg Phe Leu Leu Ile Trp Phe Gln Arg Leu Gln Glu Val Ser Gln Leu
900 905 910
Glu Asp Gln Ala Glu Asp Leu Leu Ala Gln Thr Asn Phe Asn Leu Leu
915 920 925
Arg Asn Ala Val His Lys Trp Ser Met Leu Tyr Asn Lys Asn Ile Lys
930 935 940
Arg His Lys Gln Leu Cys Glu Asp Phe Ile Ala Arg Lys Glu Thr Ala
945 950 955 960
Lys Val Arg Ser Ile Phe Asp Leu Trp Leu Tyr Lys Ile Lys Glu Ile
965 970 975
Glu Ala Asn Thr Thr Ile Ile Ser Asn Pro Ser Pro Leu Ser Lys Arg
980 985 990
Phe Gln His Gln Arg Glu Met Gly Leu Thr Pro Gln Lys Lys Asn Ser
995 1000 1005
Pro Thr Lys Val Phe Thr Pro Thr Thr Ser Lys Asp Pro Ser Pro Thr
1010 1015 1020
Lys Leu Gln Glu Thr Thr Gln Arg Met Arg Asn Gln Asn Ile Ser Ala
1025 1030 1035 1040
Leu Arg Glu His Phe Gly Arg Ala Arg Ala Ser Ser Thr Pro Lys Lys
1045 1050 1055
77
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Leu Ser Pro Val Arg Leu Ser Tyr Thr Asn Ile Pro Ser Asn Leu Arg
1060 1065 1070
Pro Gln Ser Pro Pro Lys Phe Asp Asp Ser Asp Ile Ala Thr Ala Lys
1075 1080 1085
Ser Leu Gly Arg Ile Arg Pro Met Val Phe Pro Ile Asp Asp Gln Ala
1090 1095 1100
Asn Phe Ser Pro Met Asp Arg Thr Lys Leu Gln Ser Arg Asn Ala Met
1105 1110 1115 1120
<210> 96
<211> 745
<212> PRT
<213> Candida albicans
<400> 96
Met Ala Lys Arg Lys Ser Lys Gln Gln Asp Leu Glu Lys Lys Lys Lys
1 5 10 15
Leu Lys Gln Ser Gln Asp Glu Gln Leu Ser Thr Gly Leu Phe Asn Asn
20 25 30
Val Gly Gln Gly Gln His Gln Gly Asp Asp Asp Asp Glu Glu Gly Asp
35 40 45
Glu Ile Asp Trp Asp Asn Gln Glu Met Asp Tyr Glu Leu Ile Pro Arg
50 55 60
Lys Ile Thr Thr Lys Lys Thr Ile Glu Ala Leu Pro Ile Lys Lys Ser
65 70 75 80
Asp Gly Thr Ile Glu Arg Val Val Arg Glu Val Glu Glu Glu Glu Glu
85 90 95
Glu Glu Glu Glu Glu Glu Pro Glu Glu Glu Pro Glu Leu Glu Asn Asp
100 105 110
Val Glu Asn Glu Pro Ser Lys Gln Glu Asn Lys Glu Asn Lys Glu Glu
115 120 125
Gly Asp Ile Asp Thr Asp Asp Thr Leu Thr Pro Gln Glu Lys Leu Ile
130 135 140
Gln Thr Lys Glu Glu Ile Ala Glu Leu Gly Ser Lys Leu Ile Glu Asp
145 150 155 160
Pro Glu Glu Asn Ile Val Cys Leu Thr Arg Leu Arg Lys Met Ser Glu
165 170 175
Ser Lys Asn Phe Met Thr Ser Gln Leu Ser Ile Leu Ala Leu Ile Pro
180 185 190
Ile Phe Lys Ser Leu Ala Pro Ser Tyr Lys Ile Arg Pro Leu Thr Asp
195 200 205
Thr Glu Lys Arg Glu Lys Val Ser Arg Glu Ile Ala Lys Leu Arg Asn
210 215 220
Phe Glu Gln Asn Leu Val Ile Asn Tyr Lys Ala Tyr Ile Glu Leu Leu
225 230 235 240
Thr Lys Tyr Ser Lys Ile Ser Tyr Ser Asn Ser Met Asn Asn Asn Lys
245 250 255
Ile Thr Ser Asp Gln Leu Lys Arg Gly Asn Ile Ala Leu Lys Ala Ala
260 265 270
Thr Glu Leu Cys Leu Ser Ser Leu Arg His Phe Asn Phe Arg Glu Glu
275 280 285
Leu Phe Thr Ile Ile Ile Lys Arg Leu Asn Lys Lys Pro Gln His Gln
290 295 300
Gln Asp Tyr Pro Ile Phe Ile Lys Ser Leu Arg Val Leu Glu Thr Leu
305 310 315 320
Leu Lys Asp Asp Ala Glu His Gly Asp Ile Thr Phe Asp Ile Ile Lys
325 330 335
78
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ile Met Thr Lys Ser Ile Lys Asp Lys Lys Phe Arg Val Asp Glu Ser
340 345 350
Val Val Asn Val Phe Leu Ser Ile Ser Leu Leu Glu Asp Tyr Asp Pro
355 360 365
Asn Asn Asn Asn Asn Asn Lys Asp Asp His His Asn Thr Thr Leu Lys
370 375 380
Pro Lys Leu Lys Lys Lys Asp Arg Ile His Leu Ser Lys Lys Glu Arg
385 390 395 400
Lys Ala Arg Lys Glu Arg Lys Glu Ile Glu Glu Glu Ile Gln Lys Ala
405 410 415
Glu Gln Ala Ile Thr Val Glu Gln Arg Glu Lys Tyr Gln Ala Gln Val
420 425 430
Leu Lys Met Val Leu Thr Leu Tyr Leu Glu Ile Leu Lys Ala Gly Ser
435 440 445
Ser Ser Ser Gln Leu Ile Asp Gly Asp Gly Lys Lys Thr Lys Asn Asp
450 455 460
Ala Ser Leu Leu Met Gly Ala Val Leu Glu Gly Leu Ser Arg Phe Gly
465 470 475 480
Gln Met Ser Asn Leu Asp Leu Leu Gly Asp Phe Leu Glu Val Leu Arg
485 490 495
Glu Ile Met Thr Asp Ile Ile Glu Glu His Lys Gln Ser Gly Asp Asn
500 505 510
Asp Asn Asp Asn Asp Asn Asp Asp Glu Ser Gly Gly Met Tyr Ser Gly
515 520 525
Asn Glu Leu Arg Thr Ile Leu Leu Cys Ile Ala Thr Ser Phe Ser Leu
530 535 540
Val Leu Asn His Asn Ser Met Gly Lys Leu Pro Met Ala Ile Asp Leu
545 550 555 560
Ser Lys Phe Val Ser Thr Leu Tyr Ile Ile Leu Thr Asp Leu Ala Leu
565 570 575
Asp Pro Asp Leu Glu Phe Ser His Lys Thr Leu Arg Leu Ala Asp Pro
580 585 590
Leu Ser Ser Ser Ser Leu Ser Asn Glu Leu Glu Asn Asn Lys Pro Ala
595 600 605
Val Asn Val Ser Thr Lys Ala Glu Leu Leu Leu Arg Cys Leu Asp Phe
610 615 620
Ile Phe Phe Arg Ser Lys Asn Gly Thr Ile Pro Arg Ala Thr Ala Phe
625 630 635 640
Ile Lys Arg Leu Tyr Ile Leu Thr Leu Gln Thr Pro Glu Lys Thr Ser
645 650 655
Leu Ala Asn Leu Lys Phe Ile Gly Lys Leu Met Asn Arg Tyr Gly Glu
660 665 670
Asn Ile Lys Gly Leu Trp Asn Thr Glu Glu Arg Ile Ser Gly Glu Gly
675 680 685
Asn Tyr Ile Leu Gly Ile Glu Arg Gln Asn Lys Asp Lys Asp Val Glu
690 695 700
Leu Glu Arg Ser Asn Ser Gly Ala Ala Thr Leu Trp Glu Asn Val Leu
705 710 715 720
Leu Asp Lys His Tyr Ser Ile Met Ile Lys Asp Gly Ser Arg Ser Leu
725 730 735
Met Lys Asn Ser Lys Ala Asn Thr Asn
740 745
<210> 97
<211> 579
<212> PRT
<213> Candida albicans
79
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
~400> 97
Met Tyr Ile Thr Pro Asn Gln Tyr Ala Lys Thr Phe Gln Asp Ile Lys
1 5 10 15
Arg Ser Ser Leu Ser His Ser Thr Cys Lys Leu Val Ile Phe Val Ser
20 25 30
Cys Leu Asp Val Asp Ala Leu Cys Ala Ala Lys Ile Leu Ser Leu Leu
35 40 45
Leu Arg Lys Glu Leu Ile Gln Tyr Gln Leu Ile Pro Thr Thr Gly Tyr
50 55 60
Ser Asp Leu Lys Leu His Tyr Asp Lys Leu Asp Ser Glu Val Thr Asn
65 70 75 80
Ile Ile Leu Ile Gly Cys Gly Ala Met Leu Asp Leu Glu Gly Phe Phe
85 90 95
Asp Val Asn Pro Glu Glu Phe Leu Gly Asp Asn Ser Thr Thr Asn Gly
100 105 110
His Thr Ile Asp Asn Asp Thr Glu Leu Glu Leu Asp Ala Val Lys Thr
115 120 125
Asp Asn Phe Ala Leu Thr Arg Lys Ile Tyr Val Val Asp Gly His Arg
130 135 140
Pro Trp Asn Leu Asp Asn Leu Phe Gly Ser Ala Met Val Val Cys Leu
145 150 155 160
Asp Asn Gly Tyr Ile Asp Gly Asn Leu Asn Glu Glu Lys Glu Ala Tyr
165 170 175
Asn Val Leu Val Glu Met Ser Asp Ser Glu Asp Glu Asp Glu Asp Glu
180 185 190
Gly His Asn Gln Asn Gly His Thr Asp Asp Asp Gln Glu Gly Asp Lys
195 200 205
Thr Asp Ala Asp Asp Glu Asn Asp Glu Ser Ser Val Ser Thr Ser Arg
210 215 220
Lys Gly Val Lys Ser Ile Asn Glu Asp Lys Ile Gln Thr Tyr Tyr Asn
225 230 235 240
Gln Ser Ser Thr Ile Ala Ser Ser Cys Ser Ile Thr Val Tyr Ala Leu
245 250 255
Val Ser Ala Ile Gly Glu Thr Asn Val Asp Asn Leu Trp Leu Gly Ile
260 265 270
Val Gly Ala Ser Gly Phe Asp Cys Ser Ile Phe Val Asp Glu Val Arg
275 280 285
Arg Phe Ser Thr Asp Ser Gly Ile His Met Glu Arg Gly Thr Tyr Leu
290 295 300
Pro Leu Leu Arg His Ser Ser Leu Tyr Asp Ala Leu Leu Tyr Asn Trp
305 310 315 320
Ile Asp Gly Asp Lys Arg Ile His Lys Ile Leu Ala Lys Met Gly Val
325 330 335
Pro Ile Val Ala Ala Lys Gln Gln Trp Gln Tyr Leu Asp Pro Pro Ile
340 345 350
Lys Asn Lys Leu Pro Gly Leu Leu Lys Lys Tyr Leu Pro Glu Leu Pro
355 360 365
Gln Val Glu Ile Phe Tyr Arg Cys Gly Val Thr Ser Met Asp Val Phe
370 375 380
Val Ser Leu Thr Ala Leu Leu Glu Thr Gly Val Gly Leu Asn Asn Thr
385 390 395 400
Ser Ala Asn Ser Ile Asp His Gly Asp Leu Glu Asp Glu Asn Glu Leu
405 410 415
Ile Arg Arg Glu Ile Lys Ser Arg Glu Ser Ser Tyr Ile Arg Asn Phe
420 425 430
Trp Ser Ala Phe Asp Ser Val Ser Ser Phe Gly Ile Ser Asn Asn Ile
435 440 445
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Gly Leu Glu Lys Gly Ile Thr Ala Ala Lys Leu Val Gln Lys Glu Leu
450 455 460
Phe Gln Thr Ile Lys Tyr Ile Ile Glu Gln Lys Leu Ile Lys Asn Leu
465 470 475 480
Lys Val Tyr Arg Leu Cys Ile Leu Lys Asp Glu Ser Ser His Ser Gly
485 490 495
Phe Asp Asn Pro Val Leu Leu Ile Lys Leu Ser Asn Arg Ile Met Asp
500 505 510
Tyr Leu Lys Gln Gln Thr Ser Lys Pro Leu Val Val Ala Ala Glu Leu
515 520 525
Ser Asn Thr Tyr Phe Val Leu Gly Met Gly Ile Asn Asn Ala Phe Ser
530 535 540
Lys Ile Ser Gly Ala Gln Met Lys Lys Asp Phe Phe Glu Ala Ser Leu
545 550 555 560
Val Glu Ile Lys Lys Glu Asp Leu Ala Pro Phe Leu Glu Gln Leu Thr
565 570 575
Phe Asn Leu
<210> 98
<211> 1897
<212> PRT
<213> Candida albicans
<400> 98
Met Ser Tyr Asn Asp Asn Asn Asn His Tyr Tyr Asp Pro Asn Gln Gln
1 5 10 15
Gly Gly Met Pro Pro His Gln Gly Gly Glu Gly Tyr Tyr Gln Gln Gln
20 25 30
Tyr Asp Asp Met Gly Gln Gln Pro His Gln Gln Asp Tyr Tyr Asp Pro
35 40 45
Asn Ala Gln Tyr Gln Gln Gln Pro Tyr Asp Met Asp Gly Tyr Gln Asp
50 55 60
Gln Ala Asn Tyr Gly Gly Gln Pro Met Asn Ala Gln Gly Tyr Asn Ala
65 70 75 80
Asp Pro Glu Ala Phe Ser Asp Phe Ser Tyr Gly Gly Gln Thr Pro Gly
85 90 95
Thr Pro Gly Tyr Asp Gln Tyr Gly Thr Gln Tyr Thr Pro Ser Gln Met
100 105 110
Ser Tyr Gly Gly Asp Pro Arg Ser Ser Gly Ala Ser Thr Pro Ile Tyr
115 120 125
Gly Gly Gln Gly Gln Gly Tyr Asp Pro Thr Gln Phe Asn Met Ser Ser
130 135 140
Asn Leu Pro Tyr Pro Ala Trp Ser Ala Asp Pro Gln Ala Pro Ile Lys
145 150 155 160
Ile Glu His Ile Glu Asp Ile Phe Ile Asp Leu Thr Asn Lys Phe Gly
165 170 175
Phe Gln Arg Asp Ser Met Arg Asn Met Phe Asp Tyr Phe Met Thr Leu
180 185 190
Leu Asp Ser Arg Ser Ser Arg Met Ser Pro Ala Gln Ala Leu Leu Ser
195 200 205
Leu His Ala Asp Tyr Ile Gly Gly Asp Asn Ala Asn Tyr Arg Lys Trp
210 215 220
Tyr Phe Ser Ser Gln Gln Asp Leu Asp Asp Ser Leu Gly Phe Ala Asn
225 230 235 240
Met Thr Leu Gly Lys Ile Gly Arg Lys Ala Arg Lys Ala Ser Lys Lys
245 250 255
$l
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ser Lys Lys Ala Arg Lys Ala Ala Glu Glu His Gly Gln Asp Val Asp
260 265 270
Ala Leu Ala Asn Glu Leu Glu Gly Asp Tyr Ser Leu Glu Ala Ala Glu
275 280 285
Ile Arg Trp Lys Ala Lys Met Asn Ser Leu Thr Pro Glu Glu Arg Val
290 295 300
Arg Asp Leu Ala Leu Tyr Leu Leu Ile Trp Gly Glu Ala Asn Gln Val
305 310 315 320
Arg Phe Thr Pro Glu Cys Leu Cys Tyr Ile Tyr Lys Ser Ala Thr Asp
325 330 335
Tyr Leu Asn Ser Pro Leu Cys Gln Gln Arg Gln Glu Pro Val Pro Glu
340 345 350
Gly Asp Tyr Leu Asn Arg Val Ile Thr Pro Leu Tyr Arg Phe Ile Arg
355 360 365
Ser Gln Val Tyr Glu Ile Tyr Asp Gly Arg Phe Val Lys Arg Glu Lys
370 375 380
Asp His Asn Lys Val Ile Gly Tyr Asp Asp Val Asn Gln Leu Phe Trp
385 390 395 400
Tyr Pro Glu Gly Ile Ser Arg Ile Ile Phe Glu Asp Gly Thr Arg Leu
405 410 415
Val Asp Ile Pro Gln Glu Glu Arg Phe Leu Lys Leu Gly Glu Val Glu
420 425 430
Trp Lys Asn Val Phe Phe Lys Thr Tyr Lys Glu Ile Arg Thr Trp Leu
435 440 445
His Phe Val Thr Asn Phe Asn Arg Ile Trp Ile Ile His Gly Thr Ile
450 455 460
Tyr Trp Met Tyr Thr Ala Tyr Asn Ser Pro Thr Leu Tyr Thr Lys His
465 470 475 480
Tyr Val Gln Thr Ile Asn Gln Gln Pro Leu Ala Ser Ser Arg Trp Ala
485 490 495
Ala Cys Ala Ile Gly Gly Val Leu Ala Ser Phe Ile Gln Ile Leu Ala
500 505 510
Thr Leu Phe Glu Trp Ile Phe Val Pro Arg Glu Trp Ala Gly Ala Gln
515 520 525
His Leu Ser Arg Arg Met Leu Phe Leu Val Leu Ile Phe Leu Leu Asn
530 535 540
Leu Val Pro Pro Val Tyr Thr Phe Gln Ile Thr Lys Leu Val Ile Tyr
545 550 555 560
Ser Lys Ser Ala Tyr Ala Val Ser Ile Val Gly Phe Phe Ile Ala Val
565 570 575
Ala Thr Leu Val Phe Phe Ala Val Met Pro Leu Gly Gly Leu Phe Thr
580 585 590
Ser Tyr Met Asn Lys Arg Ser Arg Arg Tyr Ile Ala Ser Gln Thr Phe
595 ~ 600 605
Thr Ala Asn Tyr Ile Lys Leu Lys Gly Leu Asp Met Trp Met Ser Tyr
610 615 620
Leu Leu Trp Phe Leu Val Phe Leu Ala Lys Leu Val Glu Ser Tyr Phe
625 630 635 640
Phe Ser Thr Leu Ser Leu Arg Asp Pro Ile Arg Asn Leu Ser Thr Met
645 650 655
Thr Met Arg Cys Val Gly Glu Val Trp Tyr Lys Asp Ile Val Cys Arg
660 665 670
Asn Gln Ala Lys Ile Val Leu Gly Leu Met Tyr Leu Val Asp Leu Leu
675 680 685
Leu Phe Phe Leu Asp Thr Tyr Met Trp Tyr Ile Ile Cys Asn Cys Ile
690 695 700
Phe Ser Ile Gly Arg Ser Phe Tyr Leu Gly Ile Ser Ile Leu Thr Pro
705 710 715 720
82
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Trp Arg Asn Ile Phe Thr Arg Leu Pro Lys Arg Ile Tyr Ser Lys Ile
725 730 735
Leu Ala Thr Thr Glu Met Glu Ile Lys Tyr Lys Pro Lys Val Leu Ile
740 745 750
Ser Gln Ile Trp Asn Ala Ile Val Ile Ser Met Tyr Arg Glu His Leu
755 760 765
Leu Ala Ile Asp His Val Gln Lys Leu Leu Tyr His Gln Val Pro Ser
770 775 780
Glu Ile Glu Gly Lys Arg Thr Leu Arg Ala Pro Thr Phe Phe Val Ser
785 790 795 800
Gln Asp Asp Asn Asn Phe Glu Thr Glu Phe Phe Pro Arg Asn Ser Glu
805 810 815
Ala Glu Arg Arg Ile Ser Phe Phe Ala Gln Ser Leu Ala Thr Pro Met
820 825 830
Pro Glu Pro Leu Pro Val Asp Asn Met Pro Thr Phe Thr Val Phe Thr
835 840 845
Pro His Tyr Ser Glu Lys Ile Leu Leu Ser Leu Arg Glu Ile Ile Arg
850 855 860
Glu Asp Asp Gln Phe Ser Arg Val Thr Leu Leu Glu Tyr Leu Lys Gln
865 870 875 880
Leu His Pro Val Glu Trp Asp Cys Phe Val Lys Asp Thr Lys Ile Leu
885 890 895
Ala Glu Glu Thr Ala Ala Tyr Glu Asn Gly Asp Asp Ser Glu Lys Leu
900 905 910
Ser Glu Asp Gly Leu Lys Ser Lys Ile Asp Asp Leu Pro Phe Tyr Cys
915 920 925
Ile Gly Phe Lys Ser Ala Ala Pro Glu Tyr Thr Leu Arg Thr Arg Ile
930 935 940
Trp Ala Ser Leu Arg Ser Gln Thr Leu Tyr Arg Thr Val Ser Gly Phe
945 950 955 960
Met Asn Tyr Ala Arg Ala Ile Lys Leu Leu Tyr Arg Val Glu Asn Pro
965 970 975
Glu Leu Val Gln Tyr Phe Gly Gly Asp Pro Glu Gly Leu Glu Leu Ala
980 985 990
Leu Glu Arg Met Ala Arg Arg Lys Phe Arg Phe Leu Val Ser Met Gln
995 1000 1005
Arg Leu Ser Lys Phe Lys Asp Asp Glu Met Glu Asn Ala Glu Phe Leu
1010 1015 1020
Leu Arg Ala Tyr Pro Asp Leu Gln Ile Ala Tyr Leu Asp Glu Glu Pro
1025 1030 1035 1040
Ala Leu Asn Glu Asp Glu Glu Pro Arg Val Tyr Ser Ala Leu Ile Asp
1045 1050 1055
Gly His Cys Glu Met Leu Glu Asn Gly Arg Arg Arg Pro Lys Phe Arg
1060 1065 1070
Val Gln Leu Ser Gly Asn Pro Ile Leu Gly Asp Gly Lys Ser Asp Asn
1075 1080 1085
Gln Asn His Ala Val Ile Phe His Arg Gly Glu Tyr Ile Gln Leu Ile
1090 1095 1100
Asp Ala Asn Gln Asp Asn Tyr Leu Glu Glu Cys Leu Lys Ile Arg Ser
1105 1110 1115 1120
Val Leu Ala Glu Phe Glu Glu Met Asn Val Glu His Val Asn Pro Tyr
1125 1130 1135
Ala Pro Asn Leu Lys Ser Glu Asp Asn Asn Thr Lys Lys Asp Pro Val
1140 1145 1150
Ala Phe Leu Gly Ala Arg Glu Tyr Ile Phe Ser Glu Asn Ser Gly Val
1155 1160 1165
Leu Gly Asp Val Ala Ala Gly Lys Glu Gln Thr Phe Gly Thr Leu Phe
1170 1175 1180
83
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ala Arg Thr Leu Ala Gln Ile Gly Gly Lys Leu His Tyr Gly His Pro
1185 1190 1195 1200
Asp Phe Leu Asn Ala Thr Phe Met Leu Thr Arg Gly Gly Val Ser Lys
1205 1210 1215
Ala Gln Lys Gly Leu His Leu Asn Glu Asp Ile Tyr Ala Gly Met Asn
1220 1225 1230
Ala Met Met Arg Gly Gly Lys Ile Lys His Cys Glu Tyr Tyr Gln Cys
1235 1240 1245
Gly Lys Gly Arg Asp Leu Gly Phe Gly Ser Ile Leu Asn Phe Thr Thr
1250 1255 1260
Lys Ile Gly Ala Gly Met Gly Glu Gln Met Leu Ser Arg Glu Tyr Phe
1265 1270 1275 1280
Tyr Leu Gly Thr Gln Leu Pro Leu Asp Arg Phe Leu Ser Phe Tyr Tyr
1285 1290 1295
Gly His Pro Gly Phe His Ile Asn Asn Leu Phe Ile Gln Leu Ser Leu
1300 1305 1310
Gln Val Phe Ile Leu Val Leu Gly Asn Leu Asn Ser Leu Ala His Glu
1315 1320 132'5
Ala Ile Met Cys Ser Tyr Asn Lys Asp Val Pro Val Thr Asp ~Val Leu
1330 1335 1340
Tyr Pro Phe Gly Cys Tyr Asn Ile Ala Pro Ala Val Asp Trp Ile Arg
1345 1350 1355 1360
Arg Tyr Thr Leu Ser Ile Phe Ile Val Phe Phe Ile Ser Phe Ile Pro
1365 1370 1375
Leu Val Val Gln Glu Leu Ile Glu Arg Gly Val Trp Lys Ala Phe Gln
1380 1385 1390
Arg Phe Val Arg His Phe Ile Ser Met Ser Pro Phe Phe Glu Val Phe
1395 1400 1405
Val Ala Gln Ile Tyr Ser Ser Ser Val Phe Thr Asp Leu Thr Val Gly
1410 1415 1420
Gly Ala Arg Tyr Ile Ser Thr Gly Arg Gly Phe Ala Thr Ser Arg Ile
1425 1430 1435 1440
Pro Phe Ser Ile Leu Tyr Ser Arg Phe Ala Asp Ser Ser Ile Tyr Met
1445 1450 1455
Gly Ala Arg Leu Met Leu Ile Leu Leu Phe Gly Thr Val Ser His Trp
1460 1465 1470
Gln Ala Pro Leu Leu Trp Phe Trp Ala Ser Leu Ser Ala Leu Met Phe
1475 1480 1485
Ser Pro Phe Ile Phe Asn Pro His Gln Phe Ala Trp Glu Asp Phe Phe
1490 1495 1500
Leu Asp Tyr Arg Asp Phe Ile Arg Trp Leu Ser Arg Gly Asn Thr Lys
1505 1510 1515 1520
Trp His Arg Asn Ser Trp Ile Gly Tyr Val Arg Leu Ser Arg Ser Arg
1525 1530 1535
Ile Thr Gly Phe Lys Arg Lys Leu Thr Gly Asp Val Ser Glu Lys Ala
1540 1545 1550
Ala Gly Asp Ala Ser Arg Ala His Arg Ser Asn Val Leu Phe Ala Asp
1555 1560 1565
Phe Leu Pro Thr Leu Ile Tyr Thr Ala Gly Leu Tyr Val Ala Tyr Thr
1570 1575 1580
Phe Ile Asn Ala Gln Thr Gly Val Thr Ser Tyr Pro Tyr Glu Ile Asn
1585 1590 1595 1600
Gly Ser Thr Asp Pro Gln Pro Val Asn Ser Thr Leu Arg Leu Ile Ile
1605 1610 1615
Cys Ala Leu Ala Pro Val Val Ile Asp Met Gly Cys Leu Gly Val Cys
1620 1625 1630
Leu Ala Met Ala Cys Cys Ala Gly Pro Met Leu Gly Leu Cys Cys Lys
1635 1640 1645
84
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Lys Thr Gly Ala Val Ile Ala Gly Val Ala His Gly Val Ala Val Ile
1650 1655 1660
Val His Ile Ile Phe Phe Ile Val Met Trp Val Thr Glu Gly Phe Asn
1665 1670 1675 1680
Phe Ala Arg Leu Met Leu Gly Ile Ala Thr Met Ile Tyr Val Gln Arg
1685 1690 1695
Leu Leu Phe Lys Phe Leu Thr Leu Cys Phe Leu Thr Arg Glu Phe Lys
1700 1705 1710
Asn Asp Lys Ala Asn Thr Ala Phe Trp Thr Gly Lys Trp Tyr Asn Thr
1715 1720 1725
Gly Met Gly Trp Met Ala Phe Thr Gln Pro Ser Arg Glu Phe Val Ala
1730 1735 1740
Lys Ile Ile Glu Met Ser Glu Phe Ala Gly Asp Phe Val Leu Ala His
1745 1750 1755 1760
Ile Ile Leu Phe Cys Gln Leu Pro Leu Leu Phe Ile Pro Leu Val Asp
1765 1770 1775
Arg Trp His Ser Met Met Leu Phe Trp Leu Lys Pro Ser Arg Leu Ile
1780 1785 1790
Arg Pro Pro Ile Tyr Ser Leu Lys Gln Ala Arg Leu Arg Lys Arg Met
1795 1800 1805
Val Arg Lys Tyr Cys Val Leu Tyr Phe Ala Val Leu Ile Leu Phe Ile
1810 1815 1820
Val Ile Ile Val Ala Pro Ala Val Ala Ser Gly Gln Ile Ala Val Asp
1825 1830 1835 1840
Gln Phe Ala Asn Ile Gly Gly Ser Gly Ser Ile Ala Asp Gly Leu Phe
1845 1850 1855
Gln Pro Arg Asn Val Ser Asn Asn Asp Thr Gly Asn His Arg Pro Lys
1860 1865 1870
Thr Tyr Thr Trp Ser Tyr Leu Ser Thr Arg Phe Thr Gly Ser Thr Thr
1875 1880 1885
Pro Tyr Ser Thr Asn Pro Phe Arg Val
1890 1895
<210> 99
<211> 400
<212> PRT
<213> Candida albicans
<400> 99
Met Ser Phe Arg Thr Thr Ser Met Arg Met Ala Arg Leu Ala Thr Ala
1 5 10 15
Lys Ala Thr Leu Ser Lys Arg Thr Phe Ser Leu Leu Ala Asn Ala Thr
20 25 30
Thr Arg Tyr Thr Ala Ala Ser Ser Ala Ala Lys Ala Met Thr Pro Ile
35 40 45
Thr Ser Ile Arg Gly Val Lys Thr Ile Asn Phe Gly Gly Thr Glu Glu
50 55 60
Val Val His Glu Arg Ala Asp Trp Pro Lys Glu Arg Leu Leu Asp Tyr
65 70 75 80
Phe Lys Asn Asp Thr Phe Ala Leu Ile Gly Tyr Gly Ser Gln Gly Tyr
85 90 95
Gly Gln Gly Leu Asn Leu Arg Asp Asn Gly Leu Asn Val Ile Ile Gly
100 105 110
Val Arg Lys Gly Ser Ser Trp Glu Ala Ala Val Glu Asp Gly Trp Val
115 120 125
Pro Gly Glu Asn Leu Phe Glu Val Asp Glu Ala Ile Ser Arg Gly Thr
130 135 140
8$
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ile Ile Met Asp Leu Leu Ser Asp Ala Ala Gln Ser Glu Thr Trp Phe
145 150 155 160
His Ile Lys Pro Gln Leu Thr Glu Gly Lys Thr Leu Tyr Phe Ser His
165 170 175
Gly Phe Ser Pro Val Phe Lys Asp Leu Thr His Val Glu Pro Pro Ser
180 185 190
Asn Ile Asp Val Ile Leu Ala Ala Pro Lys Gly Ser Gly Arg Thr Val
195 200 205
Arg Ser Leu Phe Lys Glu Gly Arg Gly Ile Asn Ser Ser Tyr Ala Val
210 215 220
Trp Asn Asp Val Thr Gly Lys Ala Glu Glu Lys Ala Ile Ala Met Ala
225 230 235 240
Ile Ala Ile Gly Ser Gly Tyr Val Tyr Lys Thr Thr Phe Glu Arg Glu
245 250 255
Val Asn Ser Asp Leu Tyr Gly Glu Arg Gly Cys Leu Met Gly Gly Ile
260 265 270
His Gly Met Phe Leu Ala Gln Tyr Glu Val Leu Arg Glu Asn Gly His
275 280 285
Thr Pro Ser Glu Ala Phe Asn Glu Thr Val Glu Glu Ala Thr Gln Ser
290 295 300
Leu Tyr Pro Leu Ile Gly Lys Tyr Gly Met Asp Tyr Met Tyr Asp Ala
305 310 315 320
Cys Ser Thr Thr Ala Arg Arg Gly Ala Leu Asp Trp Tyr Pro Arg Phe
325 330 335
Lys Asp Ala Leu Lys Pro Val Phe Glu Glu Leu Tyr Glu Ser Val Lys
340 345 350
Asn Gly Ser Glu Thr Lys Arg Ser Leu Glu Phe Asn Ser Arg Ser Asp
355 360 365
Tyr Lys Glu Arg Leu Glu Glu Glu Leu Gln Thr Ile Arg Asn Met Glu
370 375 380
Ile Trp Arg Val Gly Lys Glu Val Arg Lys Leu Arg Pro Glu Asn Gln
385 390 395 400
<210> 100
<211> 278
<212> PRT
<213> Candida albicans
<400> 100
Met Phe Lys Gln Ser Ile Arg Ser Leu Ala Thr Lys Ser Pro Ile Ser
1 5 10 15
Ser Ala Ala Ala Thr Thr Thr Thr Ala Ser Thr Thr Ser Thr Thr Thr
20 25 30
Thr Ala Ser Leu Asn Phe Ala Lys Pro Pro Ser Tyr Thr Leu Ala Gln
35 40 45
Leu Arg Glu Phe Pro Ser Leu Glu Pro Lys Thr Phe Ile Pro Leu Pro
50 55 60
Thr Thr Phe Phe Asn Thr Glu Lys Pro Ile Arg Arg Asp Ile Leu Trp
65 70 75 80
Ser Cys Val Thr Tyr Glu Ala Asp Lys Ala Arg Val Gly Ser Asn Tyr
85 90 95
Ala Ile Leu Lys Ser Asp Ser Pro Tyr Ser Asn Arg Lys Leu Arg Pro
100 105 110
Gln Lys Gly Ser Gly Arg Ala Arg Leu Gly Asp Ala Asn Ser Pro His
115 120 125
Met Asp Asn Glu Ile Lys Ala His_ Ala Ile Lys Gly Pro His Asp Trp
130 135 140
86
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ser Thr Asp Leu Pro Ser Lys Ile Tyr Ser Arg Gly Ile Gln Asn Ala
145 150 155 160
Phe Thr Met His Tyr Lys Gln Gly Asn Leu Asn Val Val Glu Asn Glu
165 170 175
Leu Asp Phe Gln Tyr Gly Tyr Asp Ile Ile Thr Gln Ser Phe Val Ser
180 185 190
Val His Asn Leu Asn Lys Leu Asn Leu Leu Phe Ile Thr Asn Glu Pro
195 200 205
Arg Asp Asn Leu Met Glu Ser Ile Lys Lys Phe Tyr Ile Asn Glu Lys
210 215 220
Glu Phe Asn Ser Leu Asn Lys Lys Glu Lys Pro Lys Tyr Leu Gln Lys
225 230 235 240
Leu Lys Gly Lys Val Leu Thr Lys Glu Asp Val Glu Val Arg Asp Ile
245 250 255
Leu Arg Ala His Arg Val Phe Ile Glu Ser Ser Ala Leu Gln Trp Phe
260 265 270
Ile Thr Lys His Thr Val
275
<210> 101
<211> 448
<212> PRT
<213> Candida albicans
<400> 101
Met Arg Glu Val Ile Ser Ile Asn Val Gly Gln Ala Gly Cys Gln Ile
1 5 10 15
Gly Asn Ala Cys Trp Glu Leu Tyr Ser Gln Glu His Gly Ile Arg Pro
20 25 30
Asp Gly Tyr Leu Gln Glu Gly Leu Asp Arg Pro Lys Gly Gly Glu Glu
35 40 45
Gly Phe Ser Thr Phe Phe Ser Glu Thr Gly Ser Gly Lys Tyr Val Pro
50 55 60
Arg Ala Leu Tyr Val Asp Leu Glu Pro Asn Val Ile Asp Glu Val Arg
65 70 75 80
Thr Gly Val Tyr Lys Asp Leu Phe His Pro Glu Gln Leu Ile Ala Gly
85 90 95
Lys Glu Asp Ala Ala Asn Asn Tyr Ala Arg Gly His Tyr Thr Val Gly
100 105 110
Arg Glu Ile Leu Asp Asp Ile Leu Asp Arg Val Arg Arg Met Ser Asp
115 120 125
Gln Cys Asp Gly Leu Gln Gly Phe Leu Phe Thr His Ser Leu Gly Gly
130 135 140
Gly Thr Gly Ser Gly Leu Gly Ser Leu Leu Leu Glu Gln Leu Ser Leu
145 150 155 160
Asp Tyr Gly Lys Lys Ser Lys Leu Glu Phe Ala Val Tyr Pro Ala Pro
165 170 175
Gln Val Ser Thr Ser Val Val Glu Pro Tyr Asn Thr Val Leu Thr Thr
180 185 190
His Thr Thr Leu Glu His Ala Asp Cys Thr Phe Met Val Asp Asn Glu
195 200 205
Ala Ile Tyr Asp Met Cys Arg Arg Asn Leu Asp Ile Ala Arg Pro Asn
210 215 220
Phe Ser Ser Leu Asn Asn Leu Ile Ala Gln Val Val Ser Ser Val Thr
225 230 235 240
Ala Ser Leu Arg Phe Asp Gly Ser Leu Asn Val Asp Leu Asn Glu Phe
245 250 255
g7
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Gln Thr Asn Leu Val Pro Tyr.Pro Arg Ile His Phe Pro Leu Val Ser
260 265 270
Tyr Ala Pro Val Phe Ser Lys Ser Arg Ala Thr His Glu Ala Asn Ser
275 280 285
Val Ser Glu Ile Thr Gln Ser Cys Phe Glu Pro Gly Asn Gln Met Val
290 295 300
Lys Cys Asp Pro Arg Thr Gly Lys Tyr Met Ala Thr Cys Leu Leu Tyr
305 310 315 320
Arg Gly Asp Val Val Thr Arg Asp Val Gln Asn Ala Val Ala Gln Val
325 330 335
Lys Ser Lys Lys Thr Val Gln Leu Val Asp Trp Cys Pro Thr Gly Phe
340 345 350
Lys Ile Gly Ile Cys Tyr Gln Pro Pro Thr Ala Ile Lys Gly Ser Glu
355 360 365
Leu Ala Ser Ala Ser Arg Ala Val Cys Met Leu Ser Asn Thr Thr Ala
370 375 380
Ile Ala Glu Ala Trp Arg Arg Ile Asp Arg Lys Phe Asp Leu Met Tyr
385 390 395 400
Ser Lys Arg Ala Phe Val His Trp Tyr Val Gly Glu Gly Met Glu Glu
405 410 415
Gly Glu Phe Thr Glu Ala Arg Glu Asp Leu Ala Ala Leu Glu Arg Asp
420 425 430
Tyr Ile Glu Val Gly Thr Asp Ser Phe Pro Glu Glu Glu Glu Glu Tyr
435 440 445
<210> 102
<211> 275
<212> PRT
<213> Candida albicans
<400> 102
Met Lys Thr Ser Val Phe Ile Ala Ile Phe Asn Leu Leu Val Cys Ala
1 5 10 15
Leu Ala Tyr Thr Asp Leu Thr Gly Ser Ile Lys Ile Asn Asp Lys Lys
20 25 30
Ile Thr Leu Gly Glu Phe Asn Thr Gln Glu Val Lys Gln Leu Thr Ile
35 40 45
Asn Ser Pro Lys Asp Ile Ile Glu Ile Asp Leu Lys Ser Lys Asp Ile
50 55 60
Lys Gly Lys Pro Glu Gln Ile Met Val Ser Leu Ala Asp Val Lys Asn
65 70 75 80
Pro Ala Ile Ser Thr His Tyr Val Pro Val Val Lys Glu Ser Lys Ile
85 90 95
Lys Leu Asn Ile Lys Ala Leu Ser Ile Pro Glu Val Leu Lys Thr Lys
100 105 110
Asp Lys Leu Val Leu Thr Ile Val Ile Ala Asp Ser Lys Ser Lys Asn
115 120 125
Asn Met Ile Arg Arg Leu Val Glu Val Leu Pro Ser Pro Glu Phe Lys
130 135 140
Ser Thr Ser Arg Tyr Gln Ala Lys Pro Arg Ile Gly Ile Gln Pro Glu
145 150 155 160
Ile His His Ile Phe Arg Glu Asp Glu Arg Thr Val Asn Pro Ile Val
165 170 175
Pro Val Val Phe Ile Ile Ala Ala Phe Thr Leu Leu Leu Gly Leu Phe
180 185 190
Gly Ser Trp Val Gly Phe Ile Gly Ile Asp Asn Leu Phe Arg Thr Phe
195 200 205
88
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Lys Thr Ile Ser Lys Val Gln Leu Leu His Asn Val Ser Phe Leu Ile
210 215 220
Ser Val Leu Gly Phe Glu Leu Asn Phe Val Lys Tyr Tyr Leu Gly Gln
225 230 235 240
Ser Ile Phe Thr Thr Leu Phe Tyr Gly Phe Ile Leu Ser Ile Pro Cys
245 250 255
Val Tyr Phe Gly Val Ser Val Leu Arg Ser Leu Ala Lys Asn Arg Ala
260 265 270
Leu Gly Lys
275
<210> 103
<211> 193
<212> PRT
<213> Candida albicans
<400> 103
Met Leu Met Tyr Thr Ile Leu Ile Pro Ser Leu Leu Tyr Ile Ala Leu
1 5 10 15
Thr Ile Ala Ser Ser Glu Leu Leu Asn Ser Ile Gln Gly Thr Trp Gln
20 25 30
Ser Gln Ser Glu Arg Val Ile Thr Gly Pro Thr Phe Phe Asp Pro Gln
35 40 45
Lys Glu Leu Leu Glu Glu Pro Lys Leu Pro Gly Ile Ser Tyr Ser Phe
50 55 60
Lys Asn Gly Tyr Trp Glu Ser Ala Gln Tyr Ile Val Met Gly Asn Asn
65 70 75 80
Arg Asn His Gln Cys Pro Gln Ala Met Leu Ile Trp Gln His Gly Lys
85 90 95
Tyr Asn Leu Lys Arg Gly Lys Leu Val Leu Ile Pro Asn Arg Asn Asp
100 105 110
Gly Arg Gln Leu Ile Ser Asp Pro Cys Leu Asp Asn Gly Lys Ser Glu
115 120 125
Tyr Lys Arg Phe His Asn Gly Glu Thr Leu Glu Val Asp Ile Arg Phe
130 135 140
Asp Gly Tyr Phe Gly Asn Trp Lys Leu Val Leu Val Asp Tyr Leu Thr
145 150 155 160
Gly Lys Lys Lys Gln Pro Met Trp Leu Thr Ser Arg Asn Ala Thr Met
165 170 175
Leu Pro Thr Gly Thr Ile Thr Ser Thr Lys Arg Lys Tyr Val Lys Lys
180 185 190
Glu
<210> 104
<211> 432
<212> PRT
<213> Candida albicans
<400> 104
Met Ser Lys Ala Phe Ser Ala Pro Gly Lys Ala Phe Leu Ala Gly Gly
1 5 10 15
Tyr Leu Val Leu Glu Pro Ile Tyr Asp Ala Tyr Val Thr Ala Leu Ser
20 25 30
Ser Arg Met His Ala Val Ile Thr Pro Lys Gly Thr Ser Leu Lys Glu
35 40 45
Ser Arg Ile Lys Ile Ser Ser Pro Gln Phe Ala Asn Gly Glu Trp Glu
50 55 60
89
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Tyr His Ile Ser Ser Asn Thr Glu Lys Pro Lys Glu Val Gln Ser Arg
65 70 75 80
Ile Asn Pro Phe Leu Glu Ala Thr Ile Phe Ile Val Leu Ala Tyr Ile
85 90 95
Gln Pro Thr Glu Ala Phe Asp Leu Glu Ile Ile Ile Tyr Ser Asp Pro
100 105 110
Gly Tyr His Ser Gln Glu Asp Thr Glu Thr Lys Thr Ser Ser Asn Gly
115 120 125
Glu Lys Thr Phe Leu Tyr His Ser Arg Ala Ile Thr Glu Val Glu Lys
130 135 140
Thr Gly Leu Gly Ser Ser Ala Gly Leu Val Ser Val Val Ala Thr Ser
145 150 155 160
Leu Leu Ser His Phe Ile Pro Asn Val Ile Ser Thr Asn Lys Asp Ile
165 170 175
Leu His Asn Val Ala Gln Ile Ala His Cys Tyr Ala Gln Lys Lys Ile
180 185 190
Gly Ser Gly Phe Asp Val Ala Thr Ala Ile Tyr Gly Ser Ile Val Tyr
195 200 205
Arg Arg Phe Gln Pro Ala Leu Ile Asn Asp Val Phe Gln Val Leu Glu
210 215 220
Ser Asp Pro Glu Lys Phe Pro Thr Glu Leu Lys Lys Leu Ile Ala Ser
225 230 235 240
Asn Trp Glu Phe Lys His Glu Arg Cys Thr Leu Pro His Gly Ile Lys
245 250 255
Leu Leu Met Gly Asp Val Lys Gly Gly Ser Glu Thr Pro Lys Leu Val
260 265 270
Ser Arg Val Leu Gln Trp Lys Lys Glu Lys Pro Glu Glu Ser Ser Val
275 280 285
Val Tyr Asp Gln Leu Asn Ser Ala Asn Leu Gln Phe Met Lys Glu Leu
290 295 300
Arg Glu Met Arg Glu Lys Tyr Asp Ser Asp Pro Glu Thr Tyr Ile Lys
305 310 315 320
Glu Leu Asp His Ser Val Glu Pro Leu Thr Val Ala Ile Lys Asn Ile
325 330 335
Arg Lys Gly Leu Gln Ala Leu Thr Gln Lys Ser Glu Val Pro Ile Glu
340 345 350
Pro Asp Val Gln Thr Gln Leu Leu Asp Arg Cys Gln Glu Ile Pro Gly
355 360 365
Cys Val Gly Gly Val Val Pro Gly Ala Gly Gly Tyr Asp Ala Ile Ala
370 375 380
Val Leu Val Leu Glu Asn Gln Val Gly Asn Phe Lys Gln Lys Thr Leu
385 390 395 400
Glu Asn Pro Asp Tyr Phe His Asn Val Tyr Trp Val Asp Leu Glu Glu
405 410 415
Gln Thr Glu Gly Val Leu Glu Glu Lys Pro Glu Asp Tyr Ile Gly Leu
420 425 430
<210> 105
<211> 768
<212> PRT
<213> Candida albicans
<400> 105
Met Ser Asp Leu Thr Pro Ile Lys Leu Pro Ser Ser Ala Pro Phe Pro
1 5 10 15
Val Val Ile Ser Ser Val Leu Cys Lys Pro Gly Asp Thr Ile Ser Lys
20 25 30
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
His Lys Thr Ile Phe Lys Tyr Lys Tyr Trp Asp Tyr Gln Asp Asp Pro
35 40 45
Thr Ser Lys Glu Asp Pro Pro Lys Lys Ile Arg Val Glu Arg Leu Gly
50 55 60
Thr Phe Glu Ser Pro Ile Glu Gly Glu Ile Asp Gln Ile Asn Ile Lys
65 70 75 80
Pro Leu Gln Glu Val Met His Ser Asp Val Asp Leu Leu Phe Val Lys
85 90 95
Glu Ala Cys Pro His Thr Val Gln Tyr Ser Gly Leu Cys Ala Leu Cys
100 105 110
Gly Lys Ser Leu Glu Glu Glu Lys Asp Tyr Ser Gly Tyr Asn Tyr Glu
115 120 125
Asp Arg Ala Thr Ile Glu Met Ser His Asp Asn Thr Gly Leu Lys Ile
130 135 140
Ser Phe Asp Glu Ala Ala Lys Ile Glu His Asn Thr Thr Asp Arg Leu
145 150 155 160
Ile Asp Glu Arg Lys Leu Ile Leu Val Val Asp Leu Asp Gln Thr Val
165 170 175
Ile His Ala ~Thr Val Asp Pro Thr Val Gly Glu Trp Gln Ser Asp Pro
1180 185 190
Ala Asn ~ro~Asn Tyr Ala Ala Val Lys Asp Val Lys Thr Phe Cys Leu
195 200 205
Glu Glu Glu Ala Ile Val Pro Pro Gly Trp Thr Gly Pro Lys Leu Ala
210 215 220
Pro Thr Lys Cys Thr Tyr Tyr Val Lys Leu Arg Pro Gly Leu Ser Glu
225 230 235 240
Phe Leu Glu Lys Met Ala Glu Lys Tyr Glu Met His Ile Tyr Thr Met
245 250 255
Ala Thr Arg Asn Tyr Ala Leu Ser Ile Ala Lys Ile Ile Asp Pro Asp
260 265 270
Gly Lys Tyr Phe Gly Asp Arg Ile Leu Ser Arg Asp Glu Ser Gly Ser
275 280 285
Leu Thr His Lys Asn Leu Lys Arg Leu Phe Pro Val Asp Gln Ser Met
290 295 300
Val Val Ile Ile Asp Asp Arg Gly Asp Val Trp Gln Trp Glu Ser Asn
305 310 315 320
Leu Ile Lys Val Val Pro Tyr Asp Phe Phe Val Gly Ile Gly'Asp Ile
325 330 335
Asn Ser Ser Phe Leu Pro Lys Lys Asn Gly Gln Leu Thr Gly Pro Thr
340 345 350
Lys Lys Arg Lys Ser Ile Ala Lys Leu Glu Ala Ala Ala Glu Leu Ala
355 360 365
Lys Glu Ser Asp Thr Asn Asn Asp Lys Gln Glu Thr Glu Ser Gly Glu
370 375 380
Glu Glu Gly Glu Glu Asp Ala Asp Gly His Ser Asp Val Ser Asn Ser
385 390 395 400
Pro Val Glu Arg Ile Leu Glu Leu Gly Gly Gly Glu Gly Asn Thr Ser
405 410 415
Leu Leu Leu Glu Gln Ser Leu Thr Arg Asn Gln Ser Ile Glu Glu Gln
420 425 430
Gln Gln Lys Arg Pro Leu Ala Lys Leu Gln His Asp Leu Glu Gln Met
435 440 445
His Glu His Arg His Asp Ser Asp Ser Lys Ser Glu Ser Gly Ser Asp
450 455 460
Asp Glu Ser Asp Glu Glu Asp Asn Leu Leu Phe Asp Asp Asp Asn Glu
465 470 475 480
Leu Ala Ala Leu Asp Lys Val Leu Gly Asn Ile His Gln Gly Tyr Tyr
485 490 495
91
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asn Leu Phe Asp Lys Asp Lys Ile Asn Lys Pro Asp Leu Thr Glu Ile
500 505 510
Ile Pro Ser Met Lys Ser Lys Thr Leu Glu Gly Ile Thr Val Leu Phe
515 520 525
Ser Gly Ile Ile Pro Leu Gly Ile Asn Leu Asp Ser Ala Asp Ile Val
530 535 540
Ile Trp Cys Arg Gln Phe Gly Val Lys Val Val Asn Glu Val Tyr Pro
545 550 555 560
Glu Val Thr His Val Val Cys Arg Asp Val Ser Glu Gly Ala Gly Pro
565 570 575
Thr Phe Lys Thr Arg Val Ala Arg Lys Leu Tyr Pro Asp Thr Ile Lys
580 585 590
Ile Val Asn Pro Asp Trp Leu Phe Ala Cys Leu Ser Asn Trp Thr Lys
595 600 605
Val Asp Glu Lys Asp Tyr Leu Ile Ser Thr Asp Asp Thr Lys Leu Trp
610 615 620
Thr Val Lys Glu Asn Glu Ile Thr Lys Tyr Gln Lys Ala Leu Glu Asp
625 630 635 640
Arg Ser Ala Leu Ala Asn Ala Thr His Ile Asp Ser Ile Glu Ser Phe
645 650 655
Asp Glu Tyr Asp Leu Asp Glu Ala Asn Gln Glu Val Asp Asp Phe Leu
660 665 670
Ala Gly Leu Ser Asp Asp Asp Glu Glu Glu Glu Glu Glu Glu Glu Asp
675 680 685
Glu Glu Ile Glu Asn Pro Glu Ser Asn Asn Asp Asp Glu Glu Ile Tyr
690 695 700
Glu G1n Ser Thr Asn Gly His Asp Ser Phe Ile Lys Asp Ala Tyr Ser
705 710 715 720
Lys Lys Arg Asn Arg Asp Glu Glu Glu Val Gln Leu Val Lys Lys Gln
725 730 735
Lys Ile Glu Asn Gly Glu Asn Gly Glu Asn Glu Asn Glu Asn Asp Leu
740 745 750
Asp Asp Leu Glu Lys Glu Leu Leu Asp Gly Phe Asp Asp Leu Glu Glu
755 760 765
<210> 106
<211> 1042
<212> PRT
<213> Candida albicans
<400> 106
Met Gly Lys Lys Ala Ile Asp Ala Arg Ile Pro Ala Leu Ile Arg Asn
1 5 10 15
Gly Val Gln Glu Lys Gln Arg Ser Phe Phe Ile Ile Val Gly Asp Lys
20 25 30
Ala Arg Asn Gln Leu Pro Asn Leu His Tyr Leu Met Met Ser Ala Asp
35 40 45
Leu Lys Met Asn Lys Ser Val Leu Trp Ala Tyr Lys Lys Lys Leu Leu
50 55 60
Gly Phe Thr Ser His Arg Gln Lys Arg Glu Ala Lys Ile Lys Lys Asp
65 70 75 80
Ile Lys Arg Gly Ile Arg Glu Val Asn Glu Gln Asp Pro Phe Glu Ala
85 90 95
Phe Ile Ser Asn Gln His Ile Arg Tyr Val Tyr Tyr Lys Glu Thr Glu
100 105 110
Lys Ile Leu Gly Asn Thr Tyr Gly Met Cys Ile Leu Gln Asp Phe Glu
115 120 125
92
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ala Ile Thr Pro Asn Leu Leu Ala Arg Thr Ile Glu Thr Val Glu Gly
130 135 140
Gly Gly Leu Val Val Ile Leu Leu Lys Asn Met Thr Ser Leu Lys Gln
145 150 155 160
Leu Tyr Thr Met Ser Met Asp Ile His Ser Arg Tyr Arg Thr Glu Ala
165 170 175
His Asp Asp Val Val Ala Arg Phe Asn Glu Arg Phe Leu Leu Ser Leu
180 185 190
Gly Ser Cys Glu Asn Cys Leu Val Val Asp Asp Glu Leu Asn Val Leu
195 200 205
Pro Ile Ser Gly Gly Lys His Val Lys Pro Leu Pro Pro Lys Asp Asp
210 215 220
Asp Glu Leu Thr Pro Asn Ala Lys Glu Leu Lys Glu Leu Lys Glu Ser
225 230 235 240
Leu Ala Asp Val Gln Pro Ala Gly Ser Leu Val Ala Leu Ser Lys Thr
245 250 255
Ile Asn Gln Ala Gln Ala Ile Leu Thr Phe Ile Asp Val Ile Ser Glu
260 265 270
Lys Thr Leu Arg Asn Thr Val Thr Leu Thr Ala Gly Arg Gly Arg Gly
275 280 285
Lys Ser Ala Ala Leu Gly Ile Ala Ile Ala Ala Ala Ile Ser His Gly
290 295 300
Tyr Ser Asn Ile Phe Val Thr Ser Pro Ser Pro Glu Asn Leu Lys Thr
305 310 315 320
Leu Phe Glu Phe Ile Phe Lys Gly Phe Asp Ala Leu Gly Tyr Thr Glu
325 330 335
His Met Asp Tyr Asp Ile Ile Gln Ser Thr Asn Pro Ser Phe Asn Lys
340 345 350
Ala Ile Val Arg Val Asp Val Lys Arg Glu His Arg Gln Thr Ile Gln
355 360 365
Tyr Ile Ser Pro Asn Asp Ser His Val Leu Gly Gln Ala Glu Leu Leu
370 375 380
Ile Ile Asp Glu Ala Ala Ala Ile Pro Leu Pro Ile Val Lys Lys Leu
385 390 395 400
Met Gly Pro Tyr Leu Ile Phe Met Ala Ser Thr Ile Asn Gly Tyr Glu
405 410 415
Gly Thr Gly Arg Ser Leu Ser Leu Lys Leu Ile Gln Gln Leu Arg Thr
420 425 430
Gln Ser Asn Asn Ala Thr Pro Ser Glu Thr Thr Val Val Ser Arg Asp
435 440 445
Lys Lys Ser Asn Glu Ile Thr Gly Ala Leu Thr Arg Thr Leu Lys Glu
450 455 460
Val Val Leu Asp Glu Pro Ile Arg Tyr Ala Pro Gly Asp Pro Ile Glu
465 470 475 480
Lys Trp Leu Asn Lys Leu Leu Cys Leu Asp Val Ser Leu Ser Lys Asn
485 490 495
Ala Lys Phe Ala Thr Lys Gly Thr Pro His Pro Ser Gln Cys Gln Leu
500 505 510
Phe Tyr Val Asn Arg Asp Thr Leu Phe Ser Tyr His Pro Val Ser Glu
515 520 525
Ala Phe Leu Gln Lys Met Met Ala Leu Tyr Val Ala Ser His Tyr Lys
530 535 540
Asn Ser Pro Asn Asp Leu Gln Leu Met Ser Asp Ala Pro Ala His Gln
545 550 555 560
Leu Phe Val Leu Leu Pro Pro Ile Glu Ala Gly Asp Asn Arg Val Pro
565 570 575
Asp Pro Leu Cys Val Ile Gln Leu Ala Leu Glu Gly Glu Ile Ser Lys
580 585 590
93
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Glu Ser Val Arg Lys Ser Leu Ser Arg Gly Gln Arg Ala Gly Gly Asp
595 600 605
Leu Ile Pro Trp Leu Ile Ser Gln Gln Phe Gln Asp Glu Glu Phe Ala
610 615 620
Ser Leu Ser Gly Ala Arg Val Val Arg Ile Ala Thr Asn Pro Glu Tyr
625 630 635 640
Ser Gly Met Gly Tyr Gly Ser Arg Ala Met Glu Leu Leu Arg Asp Tyr
645 650 655
Tyr Ser Gly Lys Phe Thr Asp Ile Ser Glu Ser Thr Glu Leu Asn Asp
660 665 670
His Thr Ile Thr Arg Val Thr Asp Ser Glu Leu Ala Asn Ala Ser Leu
675 680 685
Lys Asp Glu Ile Lys Leu Arg Asp Val Lys Thr Leu Pro Pro Leu Leu
690 695 700
Leu Lys Leu Ser Glu Lys Ala Pro Tyr Tyr Leu His Tyr Leu Gly Val
705 710 715 720
Ser Tyr Gly Phe Thr Ser Gln Leu His Lys Phe Trp Lys Lys Ala Gly
725 730 735
Phe Thr Pro Val Tyr Leu Arg Gln Thr Pro Asn Glu Leu Thr Gly Glu
740 745 750
His Thr Ser Val Val Ile Ser Val Leu Pro Gly Arg Glu Asp Lys Trp
755 760 765
Leu His Glu Phe Ser Lys Asp Phe His Lys Arg Phe Leu Ser Leu Leu
770 775 780
Ser Tyr Glu Phe Lys Lys Phe Gln Ala Ser Gln Ala Leu Ser Ile Ile
785 790 795 800
Glu Ala Ala Glu Gln Gly Glu Gly Asp Glu Thr Thr Ser Gln Lys Leu
805 810 815
Thr Lys Glu Gln Leu Asp Ser Leu Leu Ser Pro Phe Asp Leu Lys Arg
820 825 830
Leu Asp Ser Tyr Ala Asn Asn Leu Leu Asp Tyr His Val Ile Val Asp
835 840 845
Met Leu Pro Leu Ile Ser Gln Leu Phe Phe Ser Lys Lys Thr Gly Gln
850 855 860
Asp Ile Ser Leu Ser Ser Val Gln Ser Ala Ile Leu Leu Ala Ile Gly
865 870 875 880
Leu Gln His Lys Asp Met Asp Gln Ile Ala Lys Glu Leu Asn Leu Pro
885 890 895
Thr Asn Gln Ala Met Ala Met Phe Ala Lys Ile Ile Arg Lys Phe Ser
900 905 910
Thr Tyr Phe Arg Lys Val Leu Ser Lys Ala Ile Glu Glu Ser Met Pro
915 920 925
Asp Leu Glu Asp Glu Asn Val Asp Ala Met Asn Gly Lys Glu Thr Glu
930 935 ~ 940
Gln Ile Asp Tyr Lys Ala Ile Glu Gln Lys Leu Gln Asp Asp Leu Glu
945 950 955 960
Glu Ala Gly Asp Glu Ala Ile Lys Glu Met Arg Glu Lys Gln Arg Glu
965 970 975
Leu Ile Asn Ala Leu Asn Leu Asp Lys Tyr Ala Ile Ala Glu Asp Ala
980 985 990
Glu Trp Asp Glu Lys Ser Met Asp Lys Ala Thr Lys Gly Lys Gly Asn
995 1000 1005
Val Val Ser Ile Lys Ser Gly Lys Arg Lys Ser Lys Glu Asn Ala Asn
1010 1015 1020
Asp Ile Tyr Glu Lys Glu Met Lys Ala Val Lys Lys Ser Lys Lys Ser
1025 1030 1035 1040
Lys Lys
94
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 107
<211> 127
<212> PRT
<213> Candida albicans
<400> 107
Met Ala Ala Phe Asp Glu Ile Phe Asp Tyr Val Asp Arg Asp Thr Phe
1 5 10 15
Phe Gln Tyr Phe Arg Leu Thr Leu Val Val Cys Thr Tyr Leu Ile Phe
20 25 30
Arg Lys Tyr Tyr Ser Ser Trp Ala Ile Lys Lys Gln Thr Ala Thr Gln
35 40 45
Leu Glu Gln Asp Lys Arg Glu Gln Ser Glu Lys Ser Glu Arg Glu Ala
50 55 60
Lys Glu Ser Lys Glu Lys Phe Asp Thr Ile Ser Asn Glu Ala Lys Glu
65 70 75 80
Phe Gly Trp Gly Lys Lys Thr Arg Asn Asn Val Lys Leu Thr Glu Ala
85 90 95
Val Leu Ala Glu Tyr Ser Glu Gln Gln Arg Gln Arg Asn Gln Thr Ser
100 105 110
Tyr Asp Ala Gln Glu Asp Ala Asp Ile Asp Asp Leu Leu Glu Asp
115 120 125
<210> 108
<211> 289
<212> PRT
<213> Candida albicans
<400> 108
Met Ser Phe Arg Gly Gly Gly Gly Ser Gly Gly Arg Ser Thr Gln Arg
1 5 10 15
Thr Ile Leu Pro Phe Gly Leu Asp Tyr Ala Asp Ile Ile Ser Ser Thr
20 25 30
Gln Glu Thr Glu Lys Pro Gln Leu Leu Leu Pro Ile Asn Gly Asp Ile
35 40 45
Thr Glu Ile Glu Ser Ile Ile Ala Lys Gln Ser Met Asn Phe Thr Lys
50 55 60
Leu Met Ser Glu Gly Pro Phe Phe Thr Gly Asn Leu Asp Ser Ile Glu
65 70 75 80
Ile Thr Lys Lys Arg Asn His Asn Asp Ser Glu Asn Glu Glu Glu Glu
85 90 95
Glu Glu Glu Gly Gly Asp Thr Glu Asn Thr Gly Asp Arg Lys Lys Lys
100 105 110
Lys Ser Lys Thr Asn Gly Asp Gly Ser Ser Ser Gly Ser Gly Ser Gly
115 120 125
Ser Ala Ser Gly Asp Gly Ile Glu Arg Tyr Ser Asp Arg Tyr Lys Lys
130 135 140
Ile Gln Lys Ile Gly Arg Thr Ile Asp Glu His Pro Tyr Gln Pro Glu
145 150 155 160
Tyr Phe Pro Ser Glu Leu Tyr Ser Val Met Gly Ile Thr Asn Lys His
165 170 175
Asp Lys Lys Lys Phe Leu Leu Leu Ser Lys Phe Lys Ser Asn Gly Gly
180 185 190
Leu Lys Gln Ile Leu Ser Asn Glu Lys Leu Glu Asn Leu Asp Glu Gln
195 200 205
Ser Lys Leu Asn Ser Met Lys Glu Lys Met Leu Ser Met Ile Asp Asn
210 215 220
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ser Val Asn Val Asn Asp Asp Asp Asn Asn Asn Asp Gly Lys Thr Arg
225 230 235 240
Ser Gly Asp Glu Gln Glu Ile Asp Glu Asp Asp Leu Asp Asp Glu Phe
245 250 255
Glu Asp Glu Asp Asp Asp Asp Tyr Asn Ala Glu Lys Tyr Phe Asp Asp
260 265 270
Gly Asp Asp Asp Asp Gly Gly Asp Asp Gly Gly Asp Asp Glu Ala Ala
275 280 285
Phe
<210> 109
<211> 507
<212> PRT
<213> Candida albicans
<400> 109
Met Leu Ala Ser Lys Lys Lys Arg Thr Arg Arg Ile Lys Arg Gln Pro
1 5 10 15
Ile Cys Glu Gln Ile Pro Thr Ser Asn Thr Ala Phe Phe Phe Thr Leu
20 25 30
Asp Ile Pro Ile Met Pro Val Asn Phe Leu Thr Ser Val Val Phe Asp
35 40 45
Gly Pro Glu Val Ile Pro Tyr Trp Asp Gln Ile Lys Glu Tyr Gly Pro
50 55 60
Thr Val Leu Pro Ile Leu Leu Thr Leu Ala Gly Ala Lys Tyr Tyr Phe
65 70 75 80
His Gly Ala Thr Asn Thr Trp Glu Arg Asp Met His Gly Lys Val Phe
85 90 95
Met Ile Thr Gly Gly Thr Ser Gly Ile Gly Ala Gln Ile Ala Tyr Glu
100 105 110
Leu Gly Gln Arg Gly Ala Gln Leu Ile Leu Leu Thr Arg Arg Thr Asn
115 120 125
Asp Gln Trp Val Ala Glu Tyr Ile Glu Asp Leu Arg Asp Lys Thr Asn
130 135 140
Asn Gly Leu Ile Tyr Ala Glu Glu Cys Asp Leu Ser Ser Leu Tyr Ser
145 150 155 160
Ile Arg Lys Phe Ala Thr Arg Trp Leu Asp Asn Gln Pro Pro Arg Arg
165 170 175
Leu Asp Gly Val Ile Cys Cys Ala Ala Glu Cys Ile Pro Arg Gly Lys
180 185 190
Ser Arg Gln Ile Thr Met Asp Gly Val Glu Arg Gln Ile Gly Ile Asn
195 200 205
Tyr Leu Ala His Phe His Leu Leu Thr Leu Leu Gly Pro Ser Leu Arg
210 215 220
Val Gln Pro Pro Asp Arg Asn Val Arg Val Leu Ile Ala Thr Cys Ser
225 230 235 240
Ser Gln Asn Leu Gly Asp Val Asp Leu Asn Asp Leu Leu Trp ~Ser Asn
245 250 255
Lys Arg Tyr Pro Ala Thr Gln Pro Trp Lys Val Tyr Gly Thr Ser Lys
260 265 270
Leu Leu Leu Gly Leu Phe Ala Lys Glu Tyr Gln Arg Gln Leu Met Gly
275 280 285
Tyr Glu Arg Lys Asp Lys Ala Pro Cys Asn Val Arg Ile Asn Leu Ile
290 295 300
Asn Pro Gly Ile Val Arg Thr Pro Ser Thr Arg Arg Phe Leu Ser Leu
305 310 315 320
96
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Gly Thr Val Trp Gly Leu Ile Ile Tyr Leu Ile Leu Phe Pro Ile Trp
325 330 335
Trp Leu Phe Phe Lys Ser Ala Glu Gln Gly Ala Gln Ser Phe Tyr Phe
340 345 350
Ala Leu Phe Ala Pro Ile Phe Met Lys Ile Glu Gly Gly Asn Val Val
355 360 365
Gln Glu Cys Lys Ile Met Thr Lys Val Arg Lys Glu Tyr Thr Asp Asp
370 375 380
Asp Leu Gln Gln Lys Val Phe His Asn Thr Glu Glu Leu Ile Lys Gln
385 390 395 400
Ile Glu Thr Lys Ser Ala Ile Glu Arg Lys Lys His Glu Asn Ala Lys
405 410 415
Lys Thr Pro Glu Gln Lys Ala Lys Glu Arg Gln Glu Glu Leu Asn Arg
420 425 430
Lys Arg Asp Leu His Ile Lys Pro Glu Thr Pro Glu Glu Leu Glu Ser
435 440 445
Lys Leu Asn Ser Leu Arg Asn Gln Ile Gly Met Gly Thr Gly Ile Ser
450 455 460
Ser Asn Glu Met Pro Leu Phe Pro Asp Asp Glu Thr Leu Lys Lys Val
465 470 475 480
Ile Ser Ser Lys Lys Asn Ala Ser Ser Asn Asn Ser Gly Gly Ser Lys
485 490 495
Ser Asn Lys Ser Gln Lys Lys Ser Lys Lys Val
500 505
<210> 110
<211> 330
<212> PRT
<213> Candida albicans
<400> 110
Met Thr Asp Met Ser Asn Thr Thr Thr Asp Gly Asn Val Ser Ser Ile
1 5 10 15
Val Val Pro Gly Gln Tyr Ile Ser Pro Thr Tyr Lys Leu Glu Asn Ser
20 25 30
Asn Asn Asp Ser Ser Ile Pro Val Lys Tyr Ile Pro Gly Ser Gly Thr
35 40 45
Ile Ile Ser Asn Ile Asn Ile Pro Ser Pro Asn Thr Ser Thr Asn Ser
50 55 60
Val Lys Ser Met Pro Ile Ile Val Ser Thr Ile Leu Gly Asn Val Ser
65 70 75 80
Ile Ser Pro Ile Asp Gln Thr Pro Thr Ser Lys Pro Ser Asn Asn Asp
85 90 95
Asp Met Val Ile Asp Asn Glu Gln Thr Lys Ser Asp Glu Asp Lys Asp
100 105 110
Lys Asp Lys Tyr Val Lys Ser Tyr Leu Val. Ser Val Ile Pro Lys Ser
115 120 125
Thr Lys His Gln Ser Thr Thr Ser Thr Thr Thr Ser Asn Gln Ser Gly
130 135 140
Ser Lys Ala Ile Ser Ala Ile Ala Leu Pro Lys Glu Asn Asp Ile Val
145 150 155 160
Leu Val Arg Ile Thr Lys Ile Thr Lys Ile Gln Ala Tyr Cys Glu Ile
165 170 175
Ile Ser Leu Asp Thr Thr Thr Asn Ile Leu Pro Asp Ser Gly Leu Gly
180 185 190
Asn Asn Gly Asn Gly Ser His Val Ser Met Ser Ile Thr Gly Ser Asn
195 200 205
97
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ser Gln His Asn Phe Asn Gln Asn Ser Ile Ala Ser Ser Gln Ser Thr
210 215 220
Asn Gln Ser Val Gln Ile Tyr Glu Leu Gly Glu Asn Phe Lys Gly Ile
225 230 235 240
Ile Arg Ile Asn Asp Ile Arg Ser Thr Glu Arg Asp Lys Leu Lys Leu
245 250 255
Ile Asp Cys Phe Lys Pro Gly Asp Ile Val Lys Ala Gln Val Ile Ser
260 265 270
Leu Gly Asp Gly Ser Asn Tyr Tyr Leu Thr Thr Ala Lys Asn Glu Leu
275 280 285
Gly Val Val Phe Ala Lys Ser Glu Asn Gly Ala Gly Asp Leu Met Tyr
290 295 300
Pro Ile Asp Trp Gln Asn Met Ile Asp Ile Asn Ser Gly Val Ile Glu
305 310 315 320
Lys Arg Lys Asn Ala Asn Pro Phe Leu Gln
325 330
<210> 111
<211> 221
<212> PRT
<213> Candida albicans
<400> 111
Met Ala Gly Asp Leu Asn Leu Lys Lys Ser Trp Asn Pro Ala Leu Val
1 5 10 15
Lys Asn Gln Gln Lys Val Trp Glu Glu Glu Gln Gln Lys Leu Asp Glu
20 25 30
Leu Lys Arg Ile Lys Glu Arg Asn Gln Glu Tyr Lys Gln Glu Gln Glu
35 40 45
Tyr Leu Glu Leu Leu Lys Leu Gln His Gly Asp Gln Phe Gln Ile Lys
50 55 60
Asp Leu Asn Lys Gln Gln Lys Leu Lys Ile Ser Lys Leu Asn Trp Met
65 70 75 80
Tyr Asp Asp Val Pro Phe Glu Gly Asn Glu Lys Val Glu Glu Asn Ser
85 90 95
Ser Gly Phe Ile Glu Ser Asn Val Glu Phe Thr Asp Gly Lys Ser Lys
100 105 110
Val Glu Asn Leu Leu Lys Gly Asn His Val Val Gly Lys Lys Arg Asp
115 120 125
Gly Ser Gly Thr Ser Asp Arg Ile Asn Lys Ile Ile Gly Val Gly Met
130 135 140
Thr Lys Ser Ser Lys Val Ser Tyr Ser Asp Asp Pro Leu Leu Lys Ile
145 150 155 160
Lys Gln Gln Gln Gln Gln Ala Gln Arg Val Ala Arg Lys Gln His Pro
165 170 175
Ser Asp Lys His Ser His Arg Phe Arg His Ser Ser Lys Ser Ser Ser
180 185 190
Asp Arg Val His Lys Ser His Glu His Glu Arg Ser Arg Lys His Asn
195 200 205
Ser Ser His Thr Arg His Lys Asp Gly Ser Pro His Arg
210 215 220
<210> 112
<211> 778
<212> PRT
<213> Candida albicans
<400> 112
98
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Met Leu Lys Asn Asp Thr Val Phe Thr Lys Asp Ile Ser Cys Thr Ala
1 5 10 15
Ile Thr Gly Lys Asp Ala Trp Asn Pro Thr Pro Gln Pro Ile Thr Ile
20 25 30
Ser Leu Ser Phe Thr Asp Phe Lys Ala Ser Glu Leu Asp Asn Leu Lys
35 40 45
Ser Ile Asn Tyr Ala Val Ile Thr Arg Asn Val Thr Glu Phe Met Lys
50 55 60
Ser Asn Glu His Leu Asn Phe Lys Ser Leu Gly Asn Ile Ala Gln Ala
65 70 75 80
Ile Ser Asp Ile Gly Leu Asp Gln Ser Arg Gly Gly Gly Ser Ile Val
85 90 95
Asp Val Thr Ile Lys Ser Leu Lys Ser Glu Ile Arg Ala Glu Ser Val
100 105 110
Glu Tyr Lys Ile Asn Arg Asn Thr Leu Gly Gln Pro Val Pro Leu Asp
115 120 125
Ile Phe Gln Val Asn Lys Leu Arg Leu Leu Ile Ile Val Phe Thr Phe
130 135 140
Glu Arg Leu Gln Lys Gln Ile Val Asp Val Asp Gln Phe Lys Ile Pro
145 150 155 160
Asn Ser Asn Leu Tyr Phe His Gln Ile Ile Ala Asp Ile Val Ser Tyr
165 170 175
Val Glu Ser Ser Asn Phe Lys Thr Val Glu Ala Leu Val Ser Lys Ile
180 185 190
Gly Gln Leu Thr Phe Gln Lys Tyr Asp Gly Val Ala Glu Val Val Ala
195 200 205
Thr Val Thr Lys Pro Asn Ala Ser His Val Glu Gly Val Gly Val Ser
210 215 220
Ser Thr Met Val Lys Asn Phe Lys Asp Met Glu Pro Val Lys Phe Glu
225 230 235 240
Asn Thr Ile Ala Gln Thr Asn Arg Ala Phe Asn Leu Pro Val Glu Asn
245 250 255
Glu Lys Thr Glu Asp Tyr Thr Gly Tyr His Thr Ala Phe Ile Ala Phe
260 265 270
Gly Ser Asn Thr Gly Asn Gln Val Glu Asn Ile Thr Asn Ser Phe Glu
275 280 285
Leu Leu Gln Lys Tyr Gly Ile Thr Ile Glu Ala Thr Ser Ser Leu Tyr
290 295 300
Ile Ser Lys Pro Met Tyr Tyr Leu Asp Gln Pro Asp Phe Phe Asn Gly
305 310 315 320
Val Ile Lys Val Asn Phe Gln Asn Ile Ser Pro Phe Gln Leu Leu Lys
325 330 335
Ile Leu Lys Asp Ile Glu Tyr Lys His Leu Glu Arg Lys Lys Asp Phe
340 345 350
Asp Asn Gly Pro Arg Ser Ile Asp Leu Asp Ile Ile Leu Tyr Asp Asp
355 360 365
Leu Gln Leu Asn Thr Glu Asn Leu Ile Ile Pro His Lys Ser Met Leu
370 375 380
Glu Arg Thr Phe Val Leu Gln Pro Leu Cys Glu Val Leu Pro Pro Asp
385 390 395 400
Tyr Ile His Pro Ile Ser Ala Glu Ser Leu His Ser His Leu Gln Gln
405 410 415
Leu Ile Asn Asp Lys Pro Gln Glu Thr Val Gln Glu Ser Ser Asp Leu
420 425 430
Leu Gln Phe Ile Pro Val Ser Arg Leu Pro Val Lys Asp Asn Ile Leu
435 440 445
Lys Phe Asp Gln Ile Asn His Lys Ser Pro Thr Leu Ile Met Gly Ile
450 455 460
99
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Leu Asn Met Thr Pro Asp Ser Phe Ser Asp Gly Gly Lys His Phe Gly
465 470 475 480
Lys Glu Leu Asp Asn Thr Val Lys Gln Ala Glu Lys Leu Val Ser Glu
485 490 495
Gly Ala Thr Ile Ile Asp Ile Gly Gly Val Ser Thr Arg Pro Gly Ser
500 505 510
Val Glu Pro Thr Glu Glu Glu Glu Leu Glu Arg Val Ile Pro Leu Ile
515 520 525
Lys Ala Ile Arg Gln Ser Ser Asn Pro Asp Leu Ser Lys Val Leu Ile
530 535 540
Ser Val Asp Thr Tyr Arg Arg Asn Val Ala Glu Gln Ser Leu Leu Val
545 550 555 560
Gly Ala Asp Ile Ile Asn Asp Ile Ser Met Gly Lys Tyr Asp Glu Lys
565 570 575
Ile Phe Asp Val Val Ala Lys Tyr Gly Cys Pro Tyr Ile Met Asn His
580 585 590
Thr Arg Gly Ser Pro Lys Thr Met Ser Lys Leu Thr Asn Tyr Glu Ser
595 600 605
Asn Thr Asn Asp Asp Ile Ile Glu Tyr Ile Ile Asp Pro Lys Leu Gly
610 615 620
His Gln Glu Leu Asp Leu Ser Pro Glu Ile Lys Asn Leu Leu Asn Gly
625 630 635 640
Ile Ser Arg Glu Leu Ser Leu Gln Met Phe Lys Ala Met Ala Lys Gly
645 650 655
Val Lys Lys Trp Gln Ile Ile Leu Asp Pro Gly Ile Gly Phe Ala Lys
660 665 670
Asn Leu Asn Gln Asn Leu Ala Val Ile Arg Asn Ala Ser Phe Phe Lys
675 680 685
Lys Tyr Ser Ile Gln Ile Asn Glu Arg Val Asp Asp Val Thr Ile Lys
690 695 700
His Lys Tyr Leu Ser Phe Asn Gly Ala Cys Val Leu Val Gly Thr Ser
705 710 715 720
Arg Lys Lys Phe Leu Gly Thr Leu Thr Gly Asn Glu Val Pro Ser Asp
725 730 735
Arg Val Phe Gly Thr Gly Ala Thr Val Ser Ala Cys Ile Glu Gln Asn
740 745 750
Thr Asp Ile Val Arg Val His Asp Val Lys Glu Met Lys Asp Val Val
755 760 765
Cys Ile Ser Asp Ala Ile Tyr Lys Asn Val
770 775
<210> 113
<211> 148
<212> PRT
<213> Candida albicans
<400> 113
Met Ser Asp Ile Asp Ile Asp Asn Val Leu Asn Leu Glu Glu Glu Gln
1 5 10 15
Tyr Glu Leu Gly Phe Lys Glu Gly Gln Ile Gln Gly Thr Lys Asp Gln
20 25 30
Tyr Leu Glu Gly Lys Glu Tyr Gly Tyr Gln Thr Gly Phe Gln Arg Phe
35 40 45
Leu Ile Ile Gly Tyr Ile Gln Glu Leu Met Lys Phe Trp Leu Ser His
50 55 60
Ile Asp Gln Tyr Asn Asn Ser Ser Ser Leu Arg Asn His Leu Asn Asn
65 70 75 80
100
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Leu Glu Asn Ile Leu Ala Gln Ile Ser Ile Thr Asn Gly Asp Lys Glu
85 90 95
Val Glu Asp Tyr Glu Lys Asn Ile Lys Lys Ala Arg Asn Lys Leu Arg
100 105 110
Val Ile Ala Ser Ile Thr Lys Glu Thr Trp Lys Ile Asp Ser Leu Asp
115 120 125
Asn Leu Val Lys Glu Val Gly Gly Thr Leu Gln Val Ser Glu Asn Pro
130 135 140
Asp Asp Met Trp
145
<210> 114
<211> 269
<212> PRT
<213> Candida albicans
<400> 114
Met. Arg Gln Lys Arg Ala Lys Ala Tyr Lys Lys Gln Met Ser Val Tyr
1 5 10 15
Val His Ala Phe Lys Phe Arg Glu Pro Tyr Gln Ile Ile Val Asp Asn
20 25 30
Glu Leu Ile Thr Thr Cys Gln Ser Ala Ser Phe Asp Ile Asn Lys Gly
35 40 45
Phe Thr Arg Thr Ile Gln Ala Glu Asn Lys Pro Met Ile Thr Gln Cys
50 55 60
Cys Ile Gln Ala Leu Tyr Asp Thr Lys Asn Gln Pro Ala Ile Asp Ile
65 70 75 80
Ala Lys Ser Phe Glu Arg Arg Lys Cys Asn His Arg Glu Ala Ile Asp
85 90 95
Pro Ser Gln Cys Ile Glu Ser Ile Val Asn Ile Lys Gly Gln Asn Lys
100 105 110
His Arg Tyr Ile Val Ala Ser Gln Asp Leu Gln Leu Arg Lys Lys Leu
115 120 125
Arg Lys Ile Pro Gly Val Pro Leu Ile Tyr Met Asn Arg Ser Val Met
130 135 140
Val Met Glu Pro Ile Ser Asp Val Ser Asn Gln Tyr Asn Met Asn Tyr
145 150 155 160
Glu Ser Lys Lys Leu Thr Gly Gly Leu Asn Asp Ile Glu Ala Gly Lys
165 170 175
Leu Glu Lys Gln Asn Glu Gly Glu Asp Gly Asp Gly Asp Glu Ser Glu
180 185 190
Val Lys Lys Lys Lys Arg Lys Gly Pro Lys Glu Pro Asn Pro Leu.Ser
195 200 205
Val Lys Lys Lys Lys Thr Asp Asn Ala Thr Ala Ala Ser Thr Asn Gln
210 215 220
Glu Gln Lys Lys Lys Pro Asn Arg Arg Lys Arg His Gly Lys Ser Lys
225 230 235 240
Ala Glu Glu Lys Glu Asp Gln Glu Gln Glu Gln Val Asn Glu Ala Thr
245 250 255
Thr Asn Glu Asp Ala Gln Glu Ala Ile Thr Ala Thr Glu
260 265
<210> 115
<211> 306
<212> PRT
<213> Candida albicans
<400> 115
1~1
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Met Thr Asp Leu Thr Pro Leu Phe Arg Gln Cys Val Asp Ile Val Gln
1 5 10 15
Gln Glu Tyr Lys Thr Gln Pro Thr Thr Ala Lys Gln Pro Tyr Tyr Leu
20 25 30
Asn Asp Thr Phe Ile Lys Glu Thr Thr Ala Phe Phe His Val Leu Thr
35 40 45
Asn Leu Asn Gln Phe Ile Asn Glu Thr Lys Ser Ser Tyr Leu Ala Ile
50 55 60
Asn Asp Asp Thr Lys Leu Ala Gly Ser Ile Asp Asp Lys Asn Lys Ile
65 70 75 80
Asp Glu Glu Phe Asn Tyr Lys Val Gln Gln Met Tyr Lys Arg Leu Asn
85 90 95
His Leu Glu Thr Tyr Glu Thr Lys Arg Gln Ser Leu Leu Pro Lys Thr
100 105 110
Ser Gly Trp Phe Ser Phe Leu Asp Glu Ser Asn Asp Gln Asp Ile Tyr
115 120 125
Phe Glu Thr Leu Ala Asn His Arg Met Gln Ile Leu Arg Phe Leu Met
130 135 140
Glu Thr Leu Asn His Val Asn Lys Arg Phe Glu Asn Ile Gln Gln Lys
145 150 155 160
Arg Leu Ala Arg Glu Arg Gln Leu Asn Leu Leu Asn Phe Gln Asn Phe
165 170 175
Glu Asp Gly Glu Glu Leu Glu Asp Val Phe Pro Thr Leu Asp Gln Ile
180 185 190
Gln Gln Val Pro Glu Leu Ser Gln Gln Gln Ile Gln Gln Leu Glu Thr
195 200 205
Glu Asn Gln Glu Phe Leu Asn Met Lys Thr Ser Gln Leu Lys Gln Val
210 215 220
Glu Lys Val Gln Gln Ser Ile Leu Asp Ile Val Asn Ile Gln Asn Glu
225 230 235 240
Leu Ala Phe Lys Leu Gln Asp Gln Gly Gln Gln Ile Glu Ser Leu Met
245 250 255
Asp Ser His Ala Asp Val Gln Thr Glu Val Gln Met Gly Asn Arg Thr
260 265 270
Leu Ser Gln Ala Thr Lys Lys Asn Lys Arg Gly Ala Asn Met Leu Val
275 280 285
Met Leu Cys Ile Val Leu Gly Val Leu Leu Val Leu Val Asp Tyr Val
290 295 300
Ser Phe
305
<210> 116
<211> 192
<212> PRT
<213> Candida albicans
<400> 116
Met Ser Gly Ile Lys Ile Ser Leu Lys Lys Lys Asn Pro Lys Leu Lys
1 5 10 15
Lys Leu Ile Val Asn Asn Ser Gln Gln Thr Asp Glu Ser Ser Glu Gln
20 25 30
Gln Lys Lys Leu Ile Thr Ser Tyr Ser Thr Glu Asp Lys Thr Thr His
35 40 45
Lys Asp Glu Thr Lys Pro Ile Ile Val Leu Lys Gln Pro Cys Lys Ser
50 55 60
Met Leu Gln Lys Glu Ile Glu Ile Asp Glu Lys Pro Ile Leu Pro Tyr
65 70 75 80
102
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Gly Val Thr Thr Phe Glu Lys Val Glu Thr Thr Lys Gln Ser Met Ile
85 90 95
Lys Lys Ile Glu Ser Glu Asp Ser Asp Asp Asp Ser Ser Asp Asp Arg
100 105 110
Lys Ile Pro Ile Asp Glu Phe Gly Ala Ala Phe Leu Arg Gly Leu Gly
115 120 125
Trp Gln Glu Glu Glu Glu Lys Asn Lys Asp Asp Ser Lys Ser Thr Asn
130 135 140
Thr Gln Asn Leu Ser His Arg Lys His Gly Ile Thr Leu Gly Ile Gly
145 150 155 160
Ala Lys Pro Ile Asp Glu Glu Ile Ile Gln Asp Leu Asn Ser Thr Glu
165 170 175
Lys Gly Ile Pro Ile Ile Lys Arg Arg Lys Leu Asn His Ile Asn Lys
180 185 190
<210> 117
<211> 714
<212> PRT
<213> Candida albicans
<400> 117
Met Ala Lys Ala Ser Lys Gln Thr Lys Lys Phe Gln Asn Lys His Leu
1 5 10 15
Lys His Thr Ile Glu Gln Arg Lys Lys Val Gln Ala Gln Asn Lys Lys
20 25 30
Ile Ala Ser Arg Lys Lys Ser Gly Ser Ser Ser Ser Gly Glu Ser Asn
35 40 45
Ala Pro Lys Arg Ala Asp Gly Lys Ala Lys Glu Val Phe Glu Asp Met
50 55 60
Ser Val Asp Asp Phe Phe Gly Gly Gly Phe Glu Val Pro Lys Glu Lys
65 70 75 80
Asn Lys Asn Lys Asn Lys Gln Asp Thr Ile Glu Glu Asn Glu Glu Glu
85 90 95
Asp Ser Ser Ser Glu Glu Glu Asp Glu Glu Ala Met Lys Glu Asn Leu
100 105 110
Lys Lys Leu Glu Ala Asp Asp Pro Glu Phe Tyr Lys Tyr Leu Lys Asp
115 120 125
Asn Asp Asn Asp Leu Leu Asp Phe Glu Ala Val Asn Pro Leu Asp Ala
130 135 140
Ile Ser Asp Asp Glu Gly Asp Glu Asp Asp Asp Glu Glu Ile Glu Lys
145 150 155 160
Glu Val Pro Ser Asp Asp Asp Ser Glu Glu Glu Pro Thr Leu Gly Lys
165 170 175
Val Lys Gly Ser Lys Ile Glu Ile Thr Lys Ser Leu Val Lys Lys Trp
180 185 190
Asn Gln Gln Leu Asp Lys Pro Thr Pro Lys Ile Thr Arg Asn Ile Leu
195 200 205
Ile Ala Phe Lys Ala Ala Val Asn Ile His Asn Ser Asp Ser Glu Asp
210 215 220
Tyr Lys Phe Ser Ile Thr Asp Pro Lys Ala Phe Ser Glu Leu Met Leu
225 230 235 240
Leu Val Leu Lys Lys Val Pro Ile Ser Val Gln Lys Leu Val Lys Tyr
245 250 255
Lys Thr Asn Thr Gln Gly Val Arg Thr Ile Pro Gln Lys Asn Gln Tyr
260 265 270
Ala Thr Gln Ile Ala Ala Ile Leu Lys Ser His Ala Gly Ser Phe Ile
275 280 285
103
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Thr Leu Leu Asn Asp Ile Thr Asn Thr Glu Thr Ala Ala Leu Ile Leu
290 295 300
Ala Ser Ile Tyr Glu Val Phe Pro Phe Tyr Leu Ser His Arg Arg Leu
305 310 315 320
Leu Lys Gln Ile Leu Thr Ala Val Val Asn Val Trp Ser Ser Ser Ser
325 330 335
Asp Ile Asp Thr Gln Ile Ser Thr Phe Ala Phe Leu Asn Asn Val Ser
340 345 350
Arg Glu Tyr Pro Lys Ser Val Leu Glu Thr Val Leu Lys Leu Thr Tyr
355 , 360 365
Ser Ser Phe Leu Gln Asn Cys Arg Lys Thr Asn Val His Thr Met Ala
370 375 380
Gln Ile Asn Phe Cys Lys Asn Ser Ala Val Glu Leu Phe Gly Ile Asn
385 390 395 400
Glu Thr Leu Gly Tyr Gln Val Gly Phe Glu Tyr Val Arg Gln Leu Ala
405 410 415
Ile His Leu Arg Asn Ser Ile Asn Ala Thr Ser Asn Ala Lys Glu Gly
420 425 430
Tyr Lys Thr Ile Tyr Asn Trp Gln Tyr Cys His Ser Leu Asp Phe Trp
435 440 445
Ser Arg Val Leu Ser Gln His Cys Asn Pro Glu Lys Glu Leu Gln Asn
450 455 460
His Lys Ser Lys Glu Ser Pro Leu Arg Gln Leu Ile Tyr Pro Leu Val
465 470 475 480
Gln Val Thr Leu Gly Ala Ile Arg Leu Ile Pro Thr Ala Gln Phe Phe
485 490 495
Pro Leu Arg Phe Tyr Leu Ile Arg Ser Leu Ile Arg Leu Ser Gln Ser
500 505 510
Thr Gly Val Phe Ile Pro Leu Phe Pro Leu Ile Ser Glu Ile Leu Ser
515 520 525
Ser Thr Ala Met Thr Lys Ala Pro Lys Ala Ser Thr Leu Gln Ala Val
530 535 540
Asp Phe Glu His Asn Ile Lys Val Asn Gln Ala Tyr Leu Gly Thr Arg
545 550 555 560
Val Tyr Gln Asp Gly Leu Cys Glu Gln Phe Ile Glu Leu Ser Gly Glu
565 570 575
Phe Phe Gly Leu Tyr Ala Lys Ser Ile Ala Phe Pro Glu Leu Val Thr
580 585 590
Pro Ala Val Leu Ala Leu Arg Arg Phe Val Lys Lys Ser Lys Asn Val
595 600 605
Lys Phe Asn Lys Gln Leu Gln Gln Leu Ile Glu Lys Leu Asn Ala Asn
610 615 620
Ala Val Phe Ile Thr Gly Lys Arg Ser Asn Val Glu Tyr Gly Pro Ser
625 630 635 640
Asn Lys Ala Glu Val Gln Gln Phe Leu Ser Asp Phe Glu Trp Glu Lys
645 650 655
Thr Pro Leu Gly Gln Tyr Val Ser Val Gln Arg Gln Leu Lys Ala Glu
660 665 670
Arg Leu Arg Ile Leu Lys Glu Ala Gln Glu Glu Glu Ala Lys Ala Gln
675 680 685
Ala Glu Gln Lys Lys Lys Glu Glu Glu Glu Asp Glu Gln Glu Asp Glu
690 695 700
Asp Ile Val Met Glu Glu Glu Asp Asp Glu
705 710
<210> 118
<211> 281
<212> PRT
104
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Candida albicans
<400> 118
Met Ser Arg Gly Lys Thr Ile Arg Pro Ser Tyr Tyr Asp Glu Glu Glu
1 5 10 15
Ser Ser Gln Asp Glu Leu Ser His Thr Leu Ser Lys Gly Arg Ser Asn
20 25 30
Ile Gly Ser Gln Ser Asp Asp Glu Glu Met Ser Lys Ile Ser Phe Gly
35 40 45
Ala Leu Asn Arg Ala Gln Ser Lys Leu Asn Lys His Asn Gln Lys His
50 55 60
Lys Thr Gln Glu Asp Asn Tyr Lys Ser Ser Glu Glu Glu Phe Phe Asp
65 70 75 80
Ser Gly Ser Asp Ser Asp Gly Pro Pro Glu Glu Thr Ser Ser Lys Asp
85 90 95
Thr Lys Lys Lys Lys Asn Lys His Ala Pro Ser Glu Ser Ser Ser Lys
100 105 110
Arg Pro Val Ser Arg Ile Arg Asp Ile Pro Gly Leu Pro Ser Arg Lys
115 120 125
Gln Gln Thr Leu His Thr Asp Ile Arg Phe Asp Ala Ala Tyr Gly Lys
130 135 140
Ala Asp Leu Ala Lys Ala Arg Lys Asp Tyr Ala Phe Leu Asp Glu Tyr
145 150 155 160
Arg Lys Gln Glu Ile Ala Asn Met Glu Ser Leu Leu Lys Asp Lys Lys
165 170 175
Ser Arg Leu Asn Asp Asp Glu Arg Glu Glu Ile Lys Leu Gln Leu Gln
180 185 190
Ser Leu Lys Ser Arg Met Asp Thr Leu Lys Asn Arg Asp Leu Glu Asn
195 200 205
Asn Ile Leu Ser Asn Tyr Lys Lys Gln Gln Met Glu Ser Phe Lys Glu
210 215 220
Gly Lys Val Asn Lys Pro Tyr Phe Leu Lys Arg Ser Asp Lys Arg Lys
225 230 235 240
Ile Leu Gln Lys Ala Lys Phe Asp Ser Met Lys Pro Lys Gln Arg Glu
245 250 255
Lys Ala Met Glu Arg Lys Arg Lys Lys Arg Leu Gly Lys Glu Phe Arg
260 265 270
Gln Leu Glu Phe Lys Pro Thr Asn Arg
275 280
<210> 119
<211> 849
<212> PRT
<213> Candida albicans
<400> 119
Met Ser Asp Gln Leu Glu Lys Asp Ile Glu Glu Ser Ile Ala Asn Leu
1 5 10 15
Asp Tyr Gln Gln Asn Gln Glu His His Glu Thr Glu Gln Asp Lys Asp
20 25 30
Lys Glu His Gln Asp Val Glu Lys Gln Ser Ser Glu Glu Glu Thr Lys
35 40 45
Gly Ile Glu His Val Thr Asp Ser Asn Thr Asp Asp Ile Gly Val Thr
50 55 60
Lys Ser Gln Asp Thr Glu Glu Val Ile Glu Asn Ser Pro Val Asp Pro
65 70 75 80
Gln Leu Lys Glu Gln Gln Glu Ser Thr Thr Lys Met Ser Leu Ser Glu
85 90 95
105
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Arg Asp Leu Val Asp Glu Ile Asp Glu Leu Phe Thr Asn Ser Thr Lys
100 105 110
Thr Val Thr Glu Asn Asn Gln Pro Ser Glu Thr Asn Lys Arg Ala Tyr
115 120 125
Glu Ser Val Glu Thr Pro Gln Glu Leu Thr Pro Asn Asp Lys Arg Gln
130 135 140
Lys Leu Asp Ala Asn Thr Glu Thr Ser Val Pro Thr Glu Leu Glu Ser
145 150 155 160
Val Asn Asn His Asn Glu Gln Ser Gln Pro Ile Glu Pro Thr Gln Glu
165 170 175
Arg Gln Pro Ser Thr Thr Glu Thr Thr Tyr Ser Ile Ser Val Pro Val
180 185 190
Ser Thr Thr Asn Glu Val Glu Arg Ala Ser Ser Ser Ile Asn Glu Gln
195 200 205
Glu Asp Leu Glu Met Ile Ala Lys Gln Tyr Gln Gln Ala Thr Asn Leu
210 215 220
Glu Ile Glu Arg Ala Met Glu Gly His Gly Asp Gly Gly Gln His Phe
225 230 235 240
Ser Thr Gln Glu Asn Gly Gln Pro Ser Gly Ser Ser Leu Ile Ser Ser
245 250 255
Ile Val Pro Ser Asp Ser Glu Leu Leu Asn Thr Asn Gln Ala Tyr Ala
260 265 270
Ala Tyr Thr Ser Leu Ser Ser Gln Leu Glu Gln His Thr Ser Ala Ser
275 280 285
Ala Met Leu Ser Ser Ala Thr Leu Ser Ala Leu Pro Leu Ser Ile Ile
290 295 300
Ala Pro Val Tyr Leu Pro Pro Arg Ile Gln Leu Leu Ile Asn Thr Leu
305 310 315 320
Pro Thr Leu Asp Asn Leu Ala Thr Gln Leu Leu Arg Thr Val Ala Thr
325 330 335
Ser Pro Tyr Gln Lys Ile Ile Asp Leu Ala Ser Asn Pro Asp Thr Ser
340 345 350
Ala Gly Ala Thr Tyr Arg Asp Leu Thr Ser Leu Phe Glu Phe Thr Lys
355 360 365
Arg Leu Tyr Ser Glu Asp Asp Pro Phe Leu Thr Val Glu His Ile Ala
370 375 380
Pro Gly Met Trp Lys Glu Gly Glu Glu Thr Pro Ser Ile Phe Lys Pro
385 390 395 400
Lys Gln Gln Ser Ile Glu Ser Thr Leu Arg Lys Val Asn Leu Ala Thr
405 410 415
Phe Leu Ala Ala Thr Leu Gly Thr Met Glu Ile Gly Phe Phe Tyr Leu
420 425 430
Asn Glu Ser Phe Leu Asp Val Phe Cys Pro Ser Asn Asn Leu Asp Pro
435 440 445
Ser Asn Ala Leu Ser Asn Leu Gly Gly Tyr Gln Asn Gly Leu Gln Ser
450 455 460
Thr Asp Ser Pro Val Gly Ala Arg Val Gly Lys Leu Leu Lys Pro Gln
465 470 475 480
Ala Thr Leu Tyr Leu Asp Leu Lys Thr Gln Ala Tyr Ile Ser Ala Ile
485 490 495
Glu Ala Gly Glu Arg Ser Lys Glu Glu Ile Leu Glu Asp Ile Leu Pro
500 505 510
Asp Asp Leu His Val Tyr Leu Met Ser Arg Arg Asn Ala Lys Leu Leu
515 520 525
Ser Pro Thr Glu Thr Asp Phe Val Trp Arg Cys Lys Gln Arg Lys Glu
530 535 540
Ser Leu Leu Asn Tyr Thr Glu Glu Thr Pro Leu Ser Glu Gln Tyr Asp
545 550 555 560
106
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Trp Phe Thr Phe Leu Arg Asp Leu Phe Asp Tyr Val Ser Lys Asn Ile
565 570 575
Ala Tyr Leu Ile Trp Gly Lys Met Gly Lys Thr Met Lys Asn Arg Arg
580 585 590
Glu Asp Thr Pro His Thr Gln Glu Leu Leu Asp Asn Thr Thr Gly Ser
595 600 605
Thr Gln Met Pro Asn Gln Leu Ser Ser Ser Ser Gly Gln Ala Ser Ser
610 615 620
Thr Pro Ser Val Val Asp Pro Asn Lys Met Leu Val Ser Glu Met Arg
625 630 635 640
Glu Ala Asn Ile Ala Val Pro Lys Pro' Ser Gln Arg Arg Ala Trp Ser
645 650 655
Arg Glu Glu Glu Lys Ala Leu Arg His Ala Leu Glu Leu Lys Gly Pro
660 665 670
His Trp Ala Thr Ile Leu Glu Leu Phe Gly Gln Gly Gly Lys Ile Ser
675 680 685
Glu Ala Leu Lys Asn Arg Thr Gln Val Gln Leu Lys Asp Lys Ala Arg
690 695 700
Asn Trp Lys Lys Phe Phe Leu Arg Ser Gly Leu Glu Ile Pro Ser Tyr
705 710 715 720
Leu Arg Gly Val Thr Gly Gly Val Asp Asp Gly Lys Arg Lys Lys Asp
725 730 735
Asn Val Thr Lys Lys Thr Ala Ala Ala Pro Val Pro Asn Met Ser Glu
740 745 750
Gln Leu Gln Gln Gln Gln Gln Arg Gln Gln Glu Lys Gln Glu Lys Gln
755 760 765
Gln Gln Glu Glu Gln Gln Ala Gln Gln Ser Glu Lys Gln Leu Glu Gln
770 775 780
Gln Gln Glu Pro Gln Gln Glu Gln Gln Gln Glu Gln Gln Gln Thr Glu
785 790 795 800
Lys Gln Gln Ala Glu Gln Glu Gln Pro Asp Gln Pro Gln Glu Glu Gln
805 810 815
Gln Gln Glu Lys Glu Gln Pro Asp Gln Gln Gln Pro Asp Gln Gln His
820 825 830
Pro Asp Arg Gln Gln Gln Glu Gln Ile Gln Gln Pro Glu Ser Ser Asp
835 840 845
Lys
<210> 120
<211> 1096
<212> PRT
<213> Candida albicans
<400> 120
Met Ser Gly Pro Val Thr Phe Glu Lys Thr Phe Arg Arg Asp Ala Leu
1 5 10 15
Ile Asp Ile Glu Lys Lys Tyr Gln Lys Val Trp Ala Glu Glu Lys Val
20 25 30
Phe Glu Val Asp Ala Pro Thr Phe Glu Glu Cys Pro Ile Glu Asp Val
35 40 45
Glu Gln Val Gln Glu Ala His Pro Lys Phe Phe Ala Thr Met Ala Tyr
50 55 60
Pro Tyr Met Asn Gly Val Leu His Ala Gly His Ala Phe Thr Leu Ser
65 70 75 80
Lys Val Glu Phe Ala Thr Gly Phe Gln Arg Met Asn Gly Lys Arg Ala
85 90 95
Leu Phe Pro Leu Gly Phe His Cys Thr Gly Met Pro Ile Lys Ala Ala
107
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
100 105 110
Ala Asp Lys Ile Lys Arg Glu Val Glu Leu Phe Gly Ser Asp Phe Ser
115 120 125
Lys Ala Pro Ala Asp Asp Glu Asp Ala Glu Glu Ser Gln Gln Pro Ala
130 135 140
Lys Thr Glu Thr Lys Arg Glu Asp Val Thr Lys Phe Ser Ser Lys Lys
145 150 155 160
Ser Lys Ala Ala Ala Lys Gln Gly Arg Ala Lys Phe Gln Tyr Glu Ile
165 170 175
Met Met Gln Leu Gly Ile Pro Arg Glu Glu Val Ala Lys Phe Ala Asn
180 185 190
Thr Asp Tyr Trp Leu Glu Phe Phe Pro Pro Leu Cys Gln Lys Asp Val
195 200 205
Thr Ala Phe Gly Ala Arg Val Asp Trp Arg Arg Ser Met Ile Thr Thr
210 215 220
Asp Ala Asn Pro Tyr Tyr Asp Ala Phe Val Arg Trp Gln Ile Asn Arg
225 230 235 240
Leu Arg Asp Val Gly Lys Ile Lys Phe Gly Glu Arg Tyr Thr Ile Tyr
245 250 255
Ser Glu Lys Asp Gly Gln Ala Cys Leu Asp His Asp Arg Gln Ser Gly
260 265 270
Glu Gly Val Gly Pro Gln Glu Tyr Val Gly Ile Lys Ile Arg Leu Thr
275 280 285
Asp Val Ala Pro Gln Ala Gln Glu Leu Phe Lys Lys Glu Ser Leu Asp
290 295 300
Val Lys Glu Asn Lys Val Tyr Leu Val Ala Ala Thr Leu Arg Pro Glu
305 310 315 320
Thr Met Tyr Gly Gln Thr Cys Cys Phe Val Ser Pro Lys Ile Asp Tyr
325 330 335
Gly Val Phe Asp Ala Gly Asn Gly Asp Tyr Phe Ile Thr Thr Glu Arg
340 345 350
Ala Phe Lys Asn Met Ser Phe Gln Asn Leu Thr Pro Lys Arg Gly Tyr
355 360 365
Tyr Lys Pro Leu Phe Thr Ile Asn Gly Lys Thr Leu Ile Gly Ser Arg
370 375 380
Ile Asp Ala Pro Tyr Ala Val Asn Lys Asn Leu Arg Val Leu Pro Met
385 390 395 400
Glu Thr Val Leu Ala Thr Lys Gly Thr Gly Val Val Thr Cys Val Pro
405 410 415
Ser Asp Ser Pro Asp Asp Phe Val Thr Thr Arg Asp Leu Ala Asn Lys
420 425 430
Pro Glu Tyr Tyr Gly Ile Glu Lys Asp Trp Val Gln Thr Asp Ile Val
435 440 445
Pro Ile Val His Thr Glu Lys Tyr Gly Asp Lys Cys Ala Glu Phe Leu
450 455 460
Val Asn Asp Leu Lys Ile Gln Ser Pro Lys Asp Ser Val Gln Leu Ala
465 470 475 480
Asn Ala Lys Glu Leu Ala Tyr Lys Glu Gly Phe Tyr Asn Gly Thr Met
485 490 495
Leu Ile Gly Lys Tyr Lys Gly Asp Lys Val Glu Asp Ala Lys Pro Lys
500 505 510
Val Lys Gln Asp Leu Ile Asp Glu Gly Leu Ala Phe Val Tyr Asn Glu
515 520 525
Pro Glu Ser Gln Val Ile Ser Arg Ser Gly Asp Asp Cys Cys Val Ser
530 535 540
Leu Glu Asp Gln Trp Tyr Ile Asp Tyr Gly Glu Glu Ala Trp Leu Gly
545 550 555 560
1~8
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Glu Ala Leu Glu Cys Leu Lys Asn Met Glu Thr Tyr Ser Lys Glu Thr
565 570 575
Arg His Gly Phe Glu Gly Val Leu Ala Trp Met Lys Asn Trp Ala Val
580 585 590
Thr Arg Lys Phe Gly Leu Gly Thr Lys Leu Pro Trp Asp Pro Gln Tyr
595 600 605
Leu Val Glu Ser Leu Ser Asp Ser Thr Val Tyr Met Ala Tyr Tyr Thr
610 615 620
Ile Asp Arg Phe Leu His Ser Asp Tyr Tyr Gly Lys Lys Ala Gly Lys
625 630 635 640
Phe Asp Ile Lys Pro Glu Gln Met Thr Asp Glu Val Phe Asp Tyr Ile
645 650 655
Phe Thr Arg Arg Asp Asp Val Glu Thr Asp Ile Pro Lys Glu Gln Leu
660 665 670
Lys Glu Met Arg Arg Glu Phe Glu Tyr Phe Tyr Pro Leu Asp Val Arg
675 680 685
Val Ser Gly Lys Asp Leu Ile Pro Asn His Leu Thr Phe Phe Ile Tyr
690 695 700
Thr His Val Ala Leu Phe Pro Lys Arg Phe Trp Pro Arg Gly Val Arg
705 710 715 720
Ala Asn Gly His Leu Leu Leu Asn Asn Ala Lys Met Ser Lys Ser Thr
725 730 735
Gly Asn Phe Met Thr Leu Glu Gln Ile Ile Glu Lys Phe Gly Ala Asp
740 745 750
Ala Ser Arg Ile Ala Met Ala Asp Ala Gly Asp Thr Val Glu Asp Ala
755 760 765
Asn Phe Asp Glu Ala Asn Ala Asn Ala Ala Ile Leu Arg Leu Thr Thr
770 775 780
Leu Lys Asp Trp Cys Glu Glu Glu Val Lys Asn Gln Asp Lys Leu Arg
785 790 795 800
Ile Gly Asp Tyr Asp Ser Phe Phe Asp Ala Ala Phe Glu Asn Glu Met
805 810 815
Asn Asp Leu Ile Glu Lys Thr Tyr Gln Gln Tyr Thr Leu Ser Asn Tyr
820 825 830
Lys Gln Ala Leu Lys Ser Gly Leu Phe Asp Phe Gln Ile Ala Arg Asp
835 840 845
Ile Tyr Arg Glu Ser Val Asn Thr Thr Gly Ile Gly Met His Lys Asp
850 855 860
Leu Val Leu Lys Tyr Ile Glu Tyr Gln Ala Leu Met Leu Ala Pro Ile
865 870 875 880
Ala Pro His Phe Ala Glu Tyr Leu Tyr Arg Glu Val Leu Gly Lys Asn
885 890 895
Gly Ser Val Gln Leu Lys Phe Pro Arg Ala Ser Lys Pro Val Ser Lys
900 . 905 910
Ala Ile Leu Asp Ala Ser Glu Tyr Val Arg Ser Leu Thr Arg Ser Ile
915 920 925
Arg Glu Ala Glu Gly Gln Ala Leu Lys Lys Lys Lys Gly Lys Ser Asp
930 935 940
Val Asp Gly Ser Lys Pro Ile Ser Leu Thr Val Leu Val Ser Asn Thr
945 950 955 960
Phe Pro Glu Trp Gln Asp Asn Tyr Ile Glu Leu Val Arg Glu Leu Phe
965 970 975
Glu Gln Asn Lys Leu Asp Asp Asn Asn Val Ile Arg Gln Lys Val Gly
980 985 990
Lys Asp Met Lys Arg Gly Met Pro Tyr Ile His Gln Ile Lys Thr Arg
995 1000 1005
109
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Leu Ala Thr Glu Asp Ala Asp Thr Val Phe Asn Arg Lys Leu Thr Phe
1010 1015 1020
Asp Glu Ile Asp Thr Leu Lys Asn Val Val Glu Ile Val Lys Asn Ala
1025 1030 1035 1040
Pro Tyr Ser Leu Lys Val Glu Lys Leu Glu Ile Leu Ser Phe Asn Asn
1045 1050 1055
Gly Glu Thr Lys Gly Lys Asn Ile Ile Ser Gly Glu Asp Asn Ile Glu
1060 1065 1070
Leu Asn Phe Lys Gly Lys Ile Met Glu Asn Ala Val Pro Gly Glu Pro
1075 1080 1085
Gly Ile Phe Ile Lys Asn Val Glu
1090 1095
<210> 121
<211> 520
<212> PRT
<213> Candida albicans
<400> 121
Met Asn Val Gly Ser Ile Leu Asn Asp Asp Pro Pro Ser Ser Gly Asn
1 5 10 15
Ala Asn Gly Asn Asp Asp Asn Thr Lys Ile Ile Lys Ser Pro Thr Ala
20 25 30
Tyr His Lys Pro Ser Val His Glu Arg His Ser Ile Thr Ser Met Leu
35 40 45
Asn Asp Thr Pro Ser Asp Ser Thr Pro Thr Lys Lys Pro Glu Pro Thr
50 55 60
Ile Ser Pro Glu Phe Arg Lys Pro Ser Ile Ser Ser Leu Thr Ser Pro
65 70 75 80
Ser Val Ala His Lys Pro Pro Pro Leu Pro Pro Ser Ser Ser Ser Val
85 90 95
Gly Ser Ser Glu His Ser Ser Ala Arg Ser Ser Pro Ala Ile Thr Lys
100 105 110
Arg Asn Ser Ile Ala Asn Ile Ile Asp Ala Tyr Glu Glu Pro Ala Thr
115 120 125
Lys Thr Glu Lys Lys Ala Glu Leu Asn Ser Pro Lys Ile Asn Gln Ser
130 135 140
Thr Pro Val Pro Lys Leu Glu Glu His Glu Asn Asp Thr Asn Lys Val
145 150 155 160
Glu Lys Val Val Asp Ser Ala Pro Glu Pro Lys Pro Lys Lys Glu Pro
165 170 175
Gln Pro Val Phe Asp Asp Gln Asp Asp Asp Leu Thr Lys Ile Lys Lys
180 185 190
Leu Lys Gln Ser Lys Lys Pro Arg Arg Tyr Glu Thr Pro Pro Ile Trp
195 200 205
Ala Gln Arg Trp Val Pro Pro Asn Arg Gln Lys Glu Glu Thr Asn Val
210 215 220
Asp Asp Gly Asn Glu Ala Ile Thr Arg Leu Ser Glu Lys Pro Val Phe
225 230 235 240
Asp Tyr Thr Thr Thr Arg Ser Val Asp Leu Glu Cys Ser Ile Thr Gly
245 250 255
Met Ile Pro Pro Ser Ser Ile Thr Arg Lys Ile Ala Glu Trp Val Tyr
260 265 270
Ala Asn Phe Ser Asn Val Glu Glu Lys Ser Lys Arg Asn Val Glu Leu
275 280 285
Glu Leu Lys Phe Gly Lys Ile Ile Asp Lys Arg Ser Gly Asn Arg Ile
290 295 300
11~
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Asp Leu Asn Val Val Thr Glu Cys Ile Phe Thr Asp His Ser Ser Val
305 310 315 320
Phe Phe Asp Met Gln Val Glu Glu Val Ala Trp Lys Glu Ile Thr Lys
325 330 335
Phe Leu Asp Glu Leu Glu Lys Ser Phe Gln Glu Gly Lys Lys Gly Arg
340 345 350
Lys Phe Lys Thr Leu Glu Ser Asp Asn Thr Asp Ser Phe Tyr Gln Leu
355 360 365
Gly Arg Lys Gly Glu His Pro Lys Arg Ile Arg Val Thr Lys Asp Asn
370 375 380
Leu Leu Ser Pro Pro Arg Leu Val Ala Ile Gln Lys Glu Arg Val Ala
385 390 395 400
Asp Leu Tyr Ile His Asn Pro Gly Ser Leu Phe Asp Leu Arg Leu Ser
405 410 415
Met Ser Leu Glu Ile Pro Val Pro Gln Gly Asn Ile Glu Ser Ile Ile
420 425 430
Thr Lys Asn Lys Pro Glu Met Val Arg Glu Lys Lys Arg Ile Ser Tyr
435 440 445
Thr His Pro Pro Thr Ile Thr Lys Phe Asp Leu Thr Arg Val Ile Gly
450 455 460
Asn Lys Thr Glu Asp Lys Tyr Glu Val Glu Leu Glu Ala Gly Val Met
465 470 475 480
Glu Ile Phe Ala Ala Ile Asp Lys Ile Gln Lys Gly Val Asp Asn Leu
485 490 495
Arg Leu Glu Glu Leu Ile Glu Val Phe Leu Asn Asn Ala Arg Thr Leu
500 505 510
Asn Asn Arg Leu Asn Lys 'Ile Cys
515 520
<210> 122
<211> 198
<212> PRT
<213> Candida albicans
<400> 122
Met Val Asn Gly Pro Ala Glu Leu Arg Arg Lys Leu Val Ile Val Gly
1 5 10 15
Asp Gly Ala Cys Gly Lys Thr Cys Leu Leu Ile Val Phe Ser Lys Gly
20 25 30°
Thr Phe Pro Glu Val Tyr Val Pro Thr Val Phe Glu Asn Tyr Val Ala
35 40 45
Asp Val Glu Val Asp Gly Arg Lys Val Glu Leu Ala Leu Trp Asp Thr
50 55 60
Ala Gly Gln Glu Asp Tyr Asp Arg Leu Arg Pro Leu Ser Tyr Pro Asp
65 70 75 80
Ser Asn Val Ile Leu Ile Cys Phe Ser Val Asp Ser Pro Asp Ser Leu
85 90 95
Asp Asn Val Leu Glu Lys Trp Ile Ser Glu Val Leu His Phe Cys Gln
100 105 110
Gly Val Pro Ile Ile Leu Val Gly Cys Lys Ser Asp Leu Arg Asp Asp
115 120 125
Pro His Thr Ile Glu Ala Leu Arg Gln Gln Gln Gln Gln Pro Val Ser
130 135 140
Thr Ser Glu Gly Gln Gln Val Ala Gln Arg Ile Gly Ala Ala Asp Tyr
145 150 155 160
Leu Glu Cys Ser Ala Lys Thr Gly Arg Gly Val Arg Glu Val Phe Glu
165 170 175
111
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Ala Ala Thr Arg Ala Ser Leu Arg Val Lys Glu Lys Lys Glu Lys Lys
180 185 190
Lys Lys Cys Val Val Leu
195
<210> 123
<211> 708
<212> PRT
<213> Candida albicans
<400> 123
Met Glu Val Thr Ser Leu Pro Ile Lys Leu Gln Pro Ser Asn Ile Arg
1 5 10 15
Pro Ile Ala Phe Arg Ile Leu Ser Lys Lys His Gly Leu Asn Ile Asn
20 25 30
Thr Asp Ala Leu Ala Ile Leu Thr Glu Thr Ile Gly Tyr Lys Phe Gly
35 40 45
Thr Asp Trp Lys Ser Val Arg Ser,Gln Gln Phe Leu Glu Glu Val Ala
50 55 60
Lys Val Trp Lys Ile Glu Asp Arg Gly Leu Phe Ile Asp Gly Asp Gly
65 70 75 80
Leu Lys Gln Val Leu Lys Asp Met Asn Ser Lys Ser Ser Asn Asp Thr
85 90 95
Lys Arg Ala His Arg Thr Asp Thr Leu Val Asp Ile Thr Asn Asp Gly
100 105 110
Asn Gln Asn His Thr His Ser His Gln Asp Lys Gln Ile Ser Phe Glu
115 120 125
Asp Lys Asn Met Glu His Glu Glu Arg Asp Asp Val Pro Ile Asn Trp
130 135 140
Gln Asp Tyr Phe Lys Val Val Ser Pro Asn Asn Gln Pro Thr Ser Ile
145 150 155 160
Phe Asp Lys Thr Arg Lys Gln Phe Asp Ile Val Phe Lys Asn Asn Asp
165 170 175
Asp Lys Asp Lys Lys Ala Glu Arg Gly Gly Lys Leu Glu Ser Ile Val
180 185 190
Ala Glu Leu Val Lys Asn Leu Pro Ala Ser Ile Glu Ser Phe Asn Asn
195 200 205
Arg Tyr Tyr Leu Leu Ser Asp Arg Leu Ser Arg Asn Glu Asn Phe Gln
210 215 220
Lys Lys Ser Leu Ile Ser Leu Ser Ala Leu Asn Ser Phe Lys Glu Gly
225 230 235 240
Lys Thr Asp Ser Ile Thr Gly His Glu Ile Ser Leu Ile Lys Asn Met
245 250 255
Leu Gly Arg Asp Gly Gln Lys Phe Leu Ile Phe Gly Leu Leu Ser Lys
260 265 270
Asn Ala Asn Asp Glu Tyr Thr Leu Glu Asp Glu Thr Asp His Ile Glu
275 280 285
Leu Asn Leu Ser Gln Ala Phe Lys Ser Gln Gly Leu Phe Tyr Cys Pro
290 295 300
Gly Met Phe Leu Leu Val Glu Gly Ile Tyr Ser Ala Ser Gly Gly Asn
305 310 315 320
Ser Asn Gln Asp His Gly Tyr Ile Gly Gly Cys Phe Tyr Val Ser Asn
325 330 335
Ile Gly His Pro Pro Ser Glu Arg Arg Glu Thr Ser Leu Asp Val Tyr
340 345 350
Gly Asn Leu Asp Phe Leu Gly Met His Arg Gln Ile Ala Pro Val Thr
355 360 365
112
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
Gly Glu Lys Ile Thr Lys Ile Ser Lys Lys Phe Lys Lys Arg Leu Val
370 375 380
Leu Ile Glu Lys Thr Leu Tyr Asn His Lys Leu Ile Phe Val Gly Thr
385 390 395 400
Asp Leu Tyr Leu Asp Asp Phe Lys Val Leu Asp Gly Leu Arg Lys Phe
405 410 415
Phe Gln Lys Leu Glu Asn Ser Ile Ile Glu Ser Ile Glu Asp Glu Glu
420 425 430
Gly Gln Met Ala Glu Gly Thr Asn Ile Pro Leu Ala Leu Val Phe Thr
435 440 445
Gly Ser Phe Val Ser Lys Pro Leu Ser Val Thr Asn Ser Ser Val Thr
450 455 460
Asn Ile Thr Asn Ser Glu Ser Tyr Lys Ser Asn Phe Asp Asn Phe Thr
465 470 475 480
Thr Ile Val Ser Lys Tyr Pro Asn Ile Val Ser Arg Cys Lys Ile Ile
485 490 495
Leu Ile Pro Gly Lys Asn Asp Pro Trp Gln Ser Thr Tyr Ser Leu Gly
500 505 510
Ser Ser Ser Leu Asn Tyr Phe Pro Gln Ser Ser Ile Pro Lys Val Phe
515 520 525
Ile Asn Arg Leu Glu Lys Leu Leu Pro Lys Gly Asn Leu Val Val Ser
530 535 540
Trp Asn Pro Thr Arg Ile Asn Tyr Leu Ser Gln Glu Leu Val Val.Phe
545 550 555 560
Lys Asp Glu Leu Met Thr Lys Leu Lys Arg Asn Asp Ile Ile Phe Pro
565 570 575
Arg Asp Ile Gln Glu Gln Glu Glu Leu Ile Ala Gln Asp Asp Gln Arg
580 585 590
Thr Asn Glu Glu Arg Ile Asn Asn Leu Ile Gln Asn Lys Asn Thr His
595 600 605
Leu Pro Ser Lys Ile Lys Gln Ala Arg Lys Leu Val Lys Thr Ile Leu
610 615 620
Asp Gln Gly Asn Leu Gln Pro Phe Leu Lys Asn Leu Lys Leu Ile Asn
625 630 635 640
Leu Ala Tyr Asp Tyr Ser Leu Arg Ile Glu Pro Leu Pro Ser Val Ile
645 650 655
Ile Leu Asn Asp Ser Ser Phe Asp Asn Phe Glu Val Thr Tyr Asn Gly
660 665 670
Cys Lys Val Val Asn Ile Thr Ser Val Val Ser Leu Asn Asn Arg Lys
675 680 685
Phe Asn Tyr Val Glu Tyr Tyr Pro Gly Thr Lys Arg Phe Glu Phe Lys
690 695 700
Asp Leu Tyr Phe
705
<210> 124
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 124
ctctctttta tattctcgtc aataaaatcg ctcactcgaa aaccctaaaa aaaagcagac 60
aaccccgctc tagaactagt ggatcc 86
<210> 125
113
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 125
agaaaaaaaa gtaacccaca atgagatgaactaaaccaac atcaatcaac cattacacac60
caatccgctc tagaactagt gga g3
<210> 126
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 126
ttctattttt cagattgact atcctttaaccttctaatca tttacatctt caagaactaa60
gttcccgctc tagaactagt gga 83
<210> 127
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 127
ctcttcctca tctataaatc tctaatcatctcgagtagat actgttaatc tataacttca60
ctatacgctc tagaactagt gga g3
<210> 128
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 128
aaaatataca ttcaaaatcc ctaaaatcacttcatacttc aacaacaaca ataataaata60
ccattcgctc tagaactagt ggatcc 86
<210> 129
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 129
ttttcttata atgagatgag atttgatttgatacatcgaa ttctacaata attatacaac60
caactcgctc tagaactagt ggatcc g6
114
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 130
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 130
ttgaaacagg acctaagtat aataaagttgattaactaat caccatcaaa caggacgctc60
tagaactagt ggatcc 76
<210> 131
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 131
cgtcaaaaaa aaaaaatttt tctaggttagacgattgagt tgtgattacg taattcgctc60
tagaactagt ggatcc 76
<210> 132
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 132
caccaaaaaa tttttgatat tgatcaatcacttctttctt cattgtgtaa aaactactag60
ccgaccgctc tagaactagt ggatcc g6
<210> 133
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 133
taacacccat agcaatacac caataccgttgattttgaac taaacttatt ccatacgctc60
tagaactagt ggatcc 76
<210> 134
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 134
aaaaaaatgt aggtgttcac caagtgttaacacatactac ttttccattc tctacagctt60
115
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
ctaaacgctc tagaactagt ggatcc g6
<210> 135
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 135
cttaaacttc ctcctcacat tcagctcttcttccactttt cttactccac acatacacac60
ctattcgctc tagaactagt ggatcc 86
<210> 136
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 136
tggtattttt cttaagaaag gataattagcatagtaaagg tcattctact atactcatat60
aaaatcgctc tagaactagt ggatcc 86
<210> 137
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 137
gcttgtattg caaaggaagc tttataaattacttttgata atctaatatc ctagagttta60
caacgcgctc tagaactagt gga 83
<210> 138
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 138
cgttatactt tccatattac ttgtcttctttttattatat atataagttt cttttcaaga60
agatccgctc tagaactagt gga 83
<210> 139
<211> 86
<212> DNA
<213> Artificial Sequence .
<220>
<223> DNA primer
116
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 139
caaaggtaat ttcattacta ttgtcgttttttaggttttc acttacaatt aatggtctat60
tcttacgctc tagaactagt ggatcc g6
<210> 140
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 140
aaaatagagc aacaaaaaag caacacccacagtatagata tatagttacc ctcaacaata60
gacaacgctc tagaactagt gga 83
<210> 141
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 141
tacttttttt tttttcaaat ttttcaattacgacatcgag tattcacccc aaggtctcag60
tacaacgctc tagaactagt ggatcc g6
<210> 142
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 142
ctaaactaat cacacaacag cttcaactttaatcttacca atcaactgta caaatcgctc60
tagaactagt ggatcc
76
<210> 143
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 143
ctttcttaaa gaagcttctc ttttttttattgtcatttac cataacacac cccttcctaa60
ggatacgctc tagaactagt ggatcc g6
<210> 144
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
117
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 144
cttttaactt tttcacatat tataaaagattagacagttt ctcaagcata tatccctcac60
agaaccgctc tagaactagt ggatcc g6
<210> 145
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 145
tgaaattttt tttttttcac ataaaaaagtatctcctaca tctttccgta ctacactcat60
cagcccgctc tagaactagt gga 83
<210> 146
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 146
ttttaactat tcattttttt agtacataattacaatttat tgtgagtccc cattttacta60
aggtccgctc tagaactagt ggatcc 86
<210> 147
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 147
ccatccatat atatctacca ctatcaagatccctatatct tgttgataca cactttttgg60
ttaaacgctc tagaactagt ggatcc 86
<210> 148
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 148
tttttatcat taaaatcata tccctcccctctcaaaaaca actatatatc taatccgctc60
tagaactagt ggatcc 76
<210> 149
<211> 86
<212> DNA
<213> Artificial Sequence
118
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 149
atttagcaaa cataatccgt gttttacatatattattcac ccaatatcat aacaaaaaca60
aactgcgctc tagaactagt ggatcc g6
<210> 150
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 150
ggaaatcatt aataaaacat gcttctagggttgttctaaa gtgaaaaacc acgacaaaca60
cgtcgcgctc tagaactagt ggatcc g6
<210> 151
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 151
ttggaagaac tcctttcctt ttctatagtcattactcgaa gcgaaataca taattcgctc60
tagaactagt ggatcc
76
<210> 152
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 152
gaaaaaaaaa actttttgac agtacgtctaacagattatt gtgatgaact aatcccacat60
atttccgctc tagaactagt ggatcc g6
<210> 153
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 153
ttatttatta aattaatcct taataattcaagcatttcta gacacacaca aatcacgctc60
tagaactagt ggatcc 76
<210> 154
<211> 83
<212> DNA
119
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 154
aaatttcaaa attctctgac acccactctttatcttatta aactcaatac actcccatat60
cacaacgctc tagaactagt gga g3
<210> 155
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 155
aaaataaatc actctaatca tttcattcatcaatacccac cacaaaacct ttcaacgctc60
tagaactagt ggatcc 76
<210> 156
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 156
agaaattgaa acaatcggaa aacaacaatatcaaactgat gcccaataac actgtatgta60
cctagcgctc tagaactagt gga g3
<210> 157
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 157
aatttttcaa tattcaaaaa ctacacttattcattaatca atcatcaacc attaaactat60
ttgtccgctc tagaactagt gga g3
<210> 158
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 158
aatttgaaat tttacaacaa acaacaacattcaacgttca ccaccaccca ccactagtaa60
acacacgctc tagaactagt gga g3
<210> 159
120
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 159
ccccccttct ttttttttaa atattaaaaaccaacaccca actgatatac taacttatct60
tttttcgctc tagaactagt gga g3
<210> 160
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 160
ctttttttct ttatcaacaa taagaaagaattactcaatt ccgtaatatt tattctacat60
taacacgctc tagaactagt gga g3
<210> 161
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 161
caacaaacga tctatttaaa ggatactctaagaaatcgag gggtgttcaa ccatagctca60
taatccgctc tagaactagt ggatcc 86
<210> 162
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 162
ttcttctacc ctttttttca atagaaacaactacacatat ttttatcgat aatataattc60
aaaaacgctc tagaactagt gga g3
<210> 163
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 163
acttgaaagg taacttgaga ctaaccaatcatagtaacga tacattcgag tcaatcgctc60
tagaactagt ggatcc 76
121
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 164
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 164
tggaaatgga tgcaaatgag attttctactattcttttac catgtttctt tgttatggat60
cgtgccgctc tagaactagt ggatcc, g6
<210> 165
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 165
agattccaac ttcagaatat tcattcagatctgaacattt ctttttctcc gatcatcaat60
tggcacgctc tagaactagt ggatcc 86
<210> 166
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 166
taaatataaa aatccattat tctactgtttttcagctttg cattgctatt tactccgctc60
tagaactagt ggatcc 76
<210> 167
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 167
acttcaactt gcttttcttt tttaaatcctcagttgtaca ttaatcagat tgttcacatt60
aaatccgctc tagaactagt gga 83
<210> 168
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 168
acaacaacaa caacaacatc aacttctaaagcattatact actctttcct tcacgcgctc60
122
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tagaactagt ggatcc 76
<210> 169
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 169
cctcaaaaca gtataacctt tgcctcctttctatcctctt tataattcat taaataatta60
caccccgctc tagaactagt ggatcc g6
<210> 170
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 170
tgaacaaatt cccacctcca atacagcatttttcttcact cttgatatac caattcgctc60
tagaactagt ggatcc 76
<210> 171
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 171
ccacccattc attctttctt tttgaaggtgcttgcagcta agtttaataa cagacgtatt60
ctaatcgctc tagaactagt gga 83
<210> 172
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 172
atcacaaaca ctttcctaaa ttaatccagcgttaattatc tcaatataat caactcgctc60
tagaactagt ggatcc 76
<210> 173
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
123
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 173
tcaagtcggc gattaacccg acaataaataaacaatttcg aaaagcattc cattattcta60
tcactcgctc tagaactagt ggatcc g6
<210> 174
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 174
ttccttactt tgaacaactt ccctctcctcctcgtctccc ccctcaccaa cagcccgctc60
tagaactagt ggatcc
76
<210> 175
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 175
tcacataaaa ccacattaac attctttattcttcatttca taactaatca cccacatatt60
ccatccgctc tagaactagt ggatcc g6
<210> 176
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 176
taaatagtgt gtgcagcaac aaaaaattagaaaaaaaaga caactcactt cttcacgctc60
tagaactagt ggatcc 76
<210> 177
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 177
gagcacacaa aaaaaaaaac accacccagtatcgaaccaa cattgtttcc ccaaccccca60
ttcttcgctc tagaactagt ggatcc g6
<210> 178
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
124
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 178
tgagaatttt ttaagaaatt taatctgctaataactcttt tctacacaag gaacccgctc60
tagaactagt ggatcc 76
<210> 179
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 179
tttgtatttc tattttgcaa gttctacttttaatatcatt tgatcaagac catctcgctc60
tagaactagt ggatcc 76
<210> 180
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 180
gggaaactat aaacaaagag ttcagatgaggtaatagttt caaggagaag attagttaaa60
aaatacgctc tagaactagt ggatcc g6
<210> 181
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 181
tttttcactt cttgagtcat tcttgtaaccataatccact tttgtttcca acgaactata60
aaatccgctc tagaactagt gga g3
<210> 182
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 182
tctccaaaaa tgtcagaact agcttgttgatgggcaaccg ttgacttgtt tatggccata60
ctgcacgctc tagaactagt gga g3
<210> 183
<211> 83
<212> DNA
<213> Artificial Sequence
125
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 183
tccctcccct cccctcttccccttttaataatacatctat caaatataac atataaactt60
acatacgctc tagaactagtgga g3
<210> 184
<211> 83
<212> DNA
<213> Artificial
Sequence
<220>
<223> DNA primer
<400> 184
aagacgcgtt gttttaccttctttcaacatcttttagcaa caccacccat tcaataacct60
tcaatcgctc tagaactagtgga g3
<210> 185
<211> 86
<212> DNA
<213> Artificial
Sequence
<220>
<223> DNA primer
<400> 185
ctctatatca atataccataatactcgacacggctatact gttgatataa actttcccac60
tggacccctc gaggtcgacggtatcg
86
<210> 186
<211> 83
<212> DNA
<213> Artificial
Sequence
<220>
<223> DNA primer
<400> 186
attatcgtaa cattaaatttatacatcagatatttataat tacacttctt aaataaaata60
ttcagtcgag gtcgacggtatcg g3
<210> 187
<211> 83
<212> DNA
<213> Artificial nce,
Seque
<220>
<223> DNA primer
<400> 187
ctacgatgta tatacatacaaaagctgtacattaatactg atagaacatt taagttatag60
gttcatcgag gtcgacggtatcg 83
<210> 188
<211> 83
<212> DNA
126
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 188
ttcaaggtat ttgcatttta gtttttgctacttctataac attacaaatt atatacaact60
atttgtcgag gtcgacggta tcg g3
<210> 189
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 189
tttgtaaata ttaaatagta cacacacacacaattcttgt atataatacg aacaaacagt60
aatagccctc gaggtcgacg gtatcg g6
<210> 190
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 190
tatatatata tataaatatt tacaaagtgaatcttggata aatatcatac actatcttta60
ctcttccctc gaggtcgacg gtatcg g6
<210> 191
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 191
ggtttgtcac attacacgca. ctacactaaatttatattag ataaaacgaa acattccctc60
gaggtcgacg gtatcg
76
<210> 192
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 192
cttcgccgat cctcaaacaa tacttggctagacagttcta cttagaagac ggaaaccctc60
gaggtcgacg gtatcg 76
<210> 193
127
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 193
catcatcatc attgtaaatc tatttctttttatggaggtg ggaattgttg ttccatttca60
atgacccctc gaggtcgacg gtatcg g6
<210> 194
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 194
aaataataca attaacttta taacaatatataaatctata ttatcaaaca actacccctc60
gaggtcgacg gtatcg
76
<210> 195
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 195
tagaaactcc ataggatgta taaaaaaaaacacgtatcga attcttatta ctttgtttat60
aaaacccctc gaggtcgacg gtatcg~ g6
<210> 196
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 196
taatcgactc ctacagcgtc tgataataccaaaaaaagag aaaaggattc tattttagaa60
tcatcccctc gaggtcgacg gtatcg g6
<210> 197
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 197
acaacaacac atctaagggt tgtagttattctttacttgt ttgtatcttg tgagattact60
tcaacccctc gaggtcgacg gtatcg g6
128
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210w 198
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 198
tttttatctc tatatgtaaa gtgtataaaaaaaagaaata caaacctaaa aaacttatat60
gtagatcgag gtcgacggta tcg g3
<210> 199
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 199
gtatatgtgt taatccaact aagtaacaaaatgaaaacaa tctgaacact gaatcgaaag60
aaagttcgag gtcgacggta tcg g3
<210> 200
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 200
catactgaat ttgccaccta cacgaagtgataccaatggc tgtcgtattc tggacaactt60
taaacccctc gaggtcgacg gtatcg g6
<210> 201
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 201
aaatacacgt atccgtacat ttatatgtatatataggtac.attttacctc aatagtatag60
ccagttcgag gtcgacggta tcg 83
<210> 202
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 202
aaatcataaa ctagtcctta acaaatctaatagtctatgc attactaatt atttatctcc60
129
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
atgtcccctc gaggtcgacg gtatcg g6
<210> 203
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 203
aaatgtaagt catttataaa aaaaaaaatacaaactttct ttgtttttaa aaaacccctc60
gaggtcgacg gtatcg 76
<210> 204
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 204
taataggatt tatttttata ttaatatgaggtatatttac tatctataaa ggaaaaaaaa60
atcccccctc gaggtcgacg gtatcg 86
<210> 205
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 205
tatgaaataa agtgggtttc taaattagatataacgataa taagtgttgt gtattctttt60
ttgcaccctc gaggtcgacg gtatcg 86
<210> 206
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 206
aaatggtaat ttgtagggtt ttacatattcaatctagaca taacatttat taattgtttc60
ctctatcgag gtcgacggta tcg 83
<210> 207
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
130
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 207
agctgatcca tccaatttct ctaataatctttcttggttg atcattgatt cgttgtcttg60
ataccccctc gaggtcgacg gtatcg g6
<210> 208
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 208
gaatattggt aaaatactac ataatgatgcaaatagatat ttatagagac aacaacgaca60
acgacccctc gaggtcgacg gtatcg g6
<210> 209
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 209
taaatcatgt acatatatta ttattttgcattactaatct attactattt tacatccctc60
gaggtcgacg gtatcg
76
<210> 210
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 210
gatagtgtag gtattgaaca taaaatcattaattaggagg aaataaagaa attaatagaa60
actgcccctc gaggtcgacg gtatcg 86
<210> 211
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 211
aggtcaggtc ttacgttgta tttttaagaacttctagtac gccgattgta tccctagata60
aaggaccctc gaggtcgacg gtatcg 86
<210> 212
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
131
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 212
ataaatctat attatagtta taaaacctccaaaaaattgt acatcttcct atgtcccctc60
gaggtcgacg gtatcg
76
<210> 213
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 213
aagagagaaa caacttctta catcatacttattaataagt catatataca ttataccagc60
atctaccctc gaggtcgacg gtatcg 86
<210> 214
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 214
aaaaaaagta tggttaaaaa ggaaaaaaaataagctatca tcatcttctt cttaaccctc60
gaggtcgacg gtatcg
76
<210> 215
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 215
tggtgtaaat gagaaatcct tttgcattactactatctac tcattagtat acttatatga60
.
tgacctcgag gtcgacggta tcg 83
<210> 216
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 216
agagttatta tatgtacaca ttttttttaatataaacatg tagcaatata ctttaccctc60
gaggtcgacg gtatcg 76
<210> 217
<211> 83
<212> DNA
<213> Artificial Sequence
132
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 217
ggaaattcga caagatgtaaacgagcagatagacaagttt gaaagtgctg tattataata60
aataatcgag gtcgacggtatcg 83
<210> 218
<211> 83
<212> DNA
<213> Artificial
Sequence
<220>
<223> DNA primer
<400> 218
tttagtatta agtaaatatctctttctctctctctctcta tatatatata tatatgtatc60
tttgatcgag gtcgacggtatcg 83
<210> 219
<211> 83
<212> DNA
<213> Artificial
Sequence
<220>
<223> DNA primer
<400> 219
atattattac aaaaattatggtttgaatgcaatatagtag tatatttttc tttcgctttc60
tttcctcgag gtcgacggtatcg g3
<210> 220
<211> 83
<212> DNA
<213> Artificial
Sequence
<220>
<223> DNA primer
<400> 220
aatggatttg tagaataaggggtggtacttccagtaaaac gagtactcaa ataactccaa60
gtgtatcgag gtcgacggtatcg 83
<210> 221
<211> 83
<212> DNA
<213> Artificial
Sequence
<220>
<223> DNA primer
<400> 221
cataattttt tatattttgattgaaagaaaatcttgaaaa agttttataa tcccctcaag60
ttaactcgag gtcgacggtatcg g3
<210> 222
<211> 86
<212> DNA
133
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 222
acatgtatta acaaattata taatgacataaaacatttta catctgctag ttcttaaact60
taaacccctc gaggtcgacg gtatcg g6
<210> 223
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 223
agacctttgt aattaaaaaa atttaaacattagcaacaaa gtaagaacac gatcaaccat60
actactcgag gtcgacggta tcg g3
<210> 224
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 224
gatgtttcta tttaatgatt tatagaataaggatatagcg tgttattgca caagcccctc60
gaggtcgacg gtatcg 76
<210> 225
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 225
tccacaaatg tcaaatacat atatttgcacctaccaatta gagggatctt gaattaataa60
cttacccctc gaggtcgacg gtatcg g6
<210> 226
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 226
atatgttaaa acgggtagca gaaaatctaatcgaaatcac cttgtagaca tatcctagtg60
atattccctc gaggtcgacg gtatcg g6
<210> 227
134
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 227
gtaacatgtc tcaatttagt ttggcatttgaatcgactaa ttcaccccat ttcatccctc60
gaggtcgacg gtatcg
76
<210> 228
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 228
gatagagcta aaaacgttta taacaaattaataatatttg actaaactaa cttcctattc60
acctttcgag gtcgacggta tcg 83
<210> 229
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 229
aatactcata tatatatgta tgtatatatatatattacat aaccattcac cccaaccctc60
gaggtcgacg gtatcg 76
<210> 230
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 230
gagggggtat ttcactccat atttgctctattatttgtaa ttcttgctat ttattatcca60
tggtcccctc gaggtcgacg gtatcg g6
<210> 231
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 231
ttcagttcta gttcctctgg agtttctggtttaatatgca aatccctctt tctatccctc60
gaggtcgacg gtatcg
76
135
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 232
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 232
acccccatat atatttagca tcaatttttataaatgtata ttagatcctt attccactca60
cttattcgag gtcgacggta tcg 83
<210> 233
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 233
taaaaataag taaattataa atgctaatcgtttattatgc agctattcaa ccaagccctc60
gaggtcgacg gtatcg
76
<210> 234
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 234
cgttgggaaa cgtaacagct cccgataaagaaaaagattc ctttttgata ttttttttaa60
tctatccctc gaggtcgacg gtatcg 86
<210> 235
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 235
tgaattggcc ccatatgata tgttttcctatttcttcata tcatctaatt attgcccctc60
gaggtcgacg gtatcg
76
<210> 236
<211> 86
<212> DNA
<213> Artificial Sequence
<220> -
<223> DNA primer
<400> 236
tgtagtacta ttgatattat agcattaaaattttcttcct tttttgtcaa atgtatctgt60
136
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
agtatccctc gaggtcgacg gtatcg 86
<210> 237
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer ,
<400> 237
aatcgttata agaagagagg gtacaactattggcgcaggt acggttattg attttccctc60
gaggtcgacg gtatcg 76
<210> 238
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 238
gaacttgtac atatattaca tacacaaattacggtttatt gtgcattatt ttatctattg60
atttaccctc gaggtcgacg gtatcg g6
<210> 239
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 239
atgtaatatt attatcgtgt attaacacaactgtaaatta tttgttaaat ctaaaccctc60
gaggtcgacg gtatcg 76
<210> 240
<211> 76
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 240
attccaattg tctgaattct tactccaatctctgcttcct tttccttccc attgcccctc60
gaggtcgacg gtatcg
76
<210> 241
<211> 86
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
137
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 241
aagatagatt aattaacaat acaaatataatgctacatgg aaataaatag taaatataaa60
aactcccctc gaggtcgacg gtatcg g6
<210> 242
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 242
catagtatta ttgatatctc taaacaaaaagttatgtatt aaaagcaacc taaacaagac60
tctattcgag gtcgacggta tcg
83
<210> 243 ,
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 243
taaagactga ttctaggatt acaaatgatacactacatta catcataaca ggtcaggaag60
tcctgtcgag gtcgacggta tcg g3
<210> 244
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 244
aactcataag agggcttcag gtttctttctattctgactt tgccttttgt tgtatttgct60
tgacttcgag gtcgacggta tcg
83
<210> 245
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 245
ggtattcacg ataactgcta gaatgacctacttcttaata caaattactt tctagtatta60
actattcgag gtcgacggta tcg 83
<210> 246
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
138
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 246
ttctcttaaa aatgacttat atttaatatacacttgcaaa actgttagta taacgctact60
caaagagtgt gattatgtaa gcaggcg
87
<210> 247
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 247
tgttttcatt catcgaacgc gtgggccaaaaaaaaaacaa tcgattattt agactggtac60
aaatatgatt atgtaagcag gcg g3
<210> 248
<211> 72
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 248
tcaccacgag tactcatctt gtatttctttaaatcggtca ataattactt agtgtgatta60
tgtaagcagg cg 72
<210> 249
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 249
tgtattgtgg gcgtgtctgt gcgtctgtgtgtgtgtacca ctgtcatttt ctttctttcg60
gttgatgatt atgtaagcag gcg g3
<210> 250
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 250
ttttgaattg cgaagaatac gtgtagtaatatggatctta ttttaagtag ggtataactg60
attcaagtgt gattatgtaa gcaggcg
87
<210> 251
<211> 87
<212> DNA
<213> Artificial Sequence
139
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 251
cgatccagaa gatgaagatg aagatactggctttctagga tttaatgatt ccaatcgatt60
agacaagtgt gattatgtaa gcaggcg 87
<210> 252
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 252
taccaaatac ggaagaaagt cagtttcagtgtttactttt tcatgtacat agttgagtgt60
gattatgtaa gcaggcg 77
<210> 253
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 253
atctacctga accactctcg ccaattatcatgatggagaa gttgattgat ttcttagtgt60
gattatgtaa gcaggcg 77
<210> 254
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 254
atgacagaat ttgttgaaat gatccagcaaatgttttcac ttttttaaat ggtggtcgct60
cattaagtgt gattatgtaa gcaggcg
87
<210> 255
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 255
caggttaggg atttgggctg gaatgtattttaatagttgt tcaactggct aggatagtgt60
gattatgtaa gcaggcg 77
<210> 256
<211> 87
<212> DNA
140
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 256
ttagacaaat tacttttatt gtttctttcattacttgtcg gcagcattct aatgttgtct60
agagaagtgt gattatgtaa gcaggcg g7
<210> 257
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 257
aaattgaagc acaaatttca caaatgtcattttcgttcct tgccatttca tttcaaagca60
atcaaagtgt gattatgtaa gcaggcg 87
<210> 258
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 258
tagaacagcc aattctgtta ttatttttttttgtgagtgt gtgtgtcgtc gtgcataatt60
tcattagtgt gattatgtaa gcaggcg g7
<210> 259
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 259
ttattataga tttggtgttt aaaaattagtaatatagtac tttaacttat atttggtttt60
ctttatgatt atgtaagcag gcg 83
<210> 260
<211> 72
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 260
atatcgtacc cgattatgtc gtatattcttttttcaatgt caatttgaga agtgtgatta60
tgtaagcagg cg 72
<210> 261
141
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 261
tataattaat gtatacaatt aaggtttattaatataaaaa aattatatta aacaggttac60
aaaaaagtgt gattatgtaa gcaggcg g7
<210> 262
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 262
atcagattga ccagatgacc aaaaagaacgaattctccaa aggtgacgag gaaagggtag60
caagatgatt atgtaagcag gcg g3
<210> 263
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 263
tacaatacaa ttgaaaatga tgaaaaccgagaaagtagtg cgaattgcaa caaaacttca60
ggactagtgt gattatgtaa gcaggcg g7
<210> 264
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 264
ggatgatgat gttagcaatg atattgatgaggattctgag tggttaagtt gatagagtgt60
gattatgtaa gcaggcg 77
<210> 265
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 265
taatatttca atatcgaaag acatggaagtgcatgaacct gaagtaaaga agtttaatac60
atgagagtgt gattatgtaa gcaggcg g7
142
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 266
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 266
tttatacact tcatttggac ttaacttttaaaatatatcc atcaatcaac aacttattta60
caaatagtgt gattatgtaa gcaggcg g7
<210> 267
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 267
cacaatttgg atttaaaaga ttttaaaaagtattttatca gttttatcaa caaaatgaaa60
agtggtgatt atgtaagcag gcg g3
<210> 268
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 268
acagacttga attagtatta gaaactagaaccacagcatc tttaaaatca acttatttgc60
atcgaagtgt gattatgtaa gcaggcg 87
<210> 269
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 269
aaagacaaga ttgaaacttt gttgatctaagtagtaaatg caattcaaac tattatttgt60
atataagtgt gattatgtaa gcaggcg 87
<210> 270
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 270
agtctgattc ttccttcaaa aaagaaagggaaaagcaagt gaatttgatt gcataagtgt60
143
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
gattatgtaa gcaggcg
77
<210> 271
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 271
tctcttctca tattcccatt ttgtataaaacttcttacaa gtccacttag acaaccaacc60
agcctagtgt gattatgtaa gcaggcg g7
<210> 272
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 272
cttattattt gttcttgttt ataattattaaggaagaaag agtttaaaat attctggtga60
aaattagtgt gattatgtaa gcaggcg g7
<210> 273
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 273
atacgtttcc ttaatgtcaa aatcagccattctagattag ttatgagttg ggagtagtgt60
gattatgtaa gcaggcg _ 77 ,
<210> 274
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 274
ttctaacaac tatagctgca agtattgttgagcgtttaat attgtgttta aatgaattgg60
atgtgagtgt gattatgtaa gcaggcg g7
<210> 275
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
144
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 275
tctgaccaat tcgattacta atctttcacactcactcact ccctcactca tttccagtgt60
gattatgtaa gcaggcg 77
<210> 276
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 276
tcatcaacca cttttattat tggcatcataggtcaaacgt taatactatg ttgctctttc60
ttttttgatt atgtaagcag gcg 83
<210> 277
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 277
tcgtcttgcc cccctatcac taatggggatttccgatctc cttgccatat tttgaagtgt60
gattatgtaa gcaggcg 77
<210> 278
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 278
ttgataagca ctggaaaaat ggaaagaggtattaacacag ggaggattct agataaacgg60
tttcgtgatt atgtaagcag gcg 83
<210> 279
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 279
attgtaatat gatttgatgg ggaaaatagaaattcaactt tcgtagtagt tggttggttg60
gttagtgatt atgtaagcag gcg 83
<210> 280
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
145
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 280
caaaatagca tatcgaacat agattcaagt atgttgctat ccccaacaat actttccatt 60
atctttgatt atgtaagcag gcg g3
<210> 281
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 281
ctacgtttca catatactat tatttcaatttcccatcatt gcaacaacaa acgaaagtgt60
gattatgtaa gcaggcg 77
<210> 282
<211> 83
<212> DNA
<213> Artificial Sequence
<220> -
<223> DNA primer
<400> 282
agggcctgca tcgcgcaacg cttatgtacaggattttatg aatcattgaa tgaaaaattt60
tcaattgatt atgtaagcag gcg 83
<210> 283
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 283
tttcggtaca gtggagatta gagatcttgtagatttatat aacgaataat agtttgattt60
ttattagtgt gattatgtaa gcaggcg
87
<210> 284
<211> 72
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 284
aattgtatat gattacacga ccatacaaaaattttgcgaa ttgagattct agtgtgatta60
tgtaagcagg cg 72
<210> 285
<211> 77
<212> DNA
<213> Artificial Sequence
146
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 285
ggattaatat tcacctagga gtcatattttgcagcaccta gtatcaaggg atgttagtgt60
gattatgtaa gcaggcg 77
<210> 286
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 286
taacttggat ttttcttatt tcaacttttttttagcattt gaatctttat atatatatat60
atcgtagtgt gattatgtaa gcaggcg g7
<210> 287
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 287
ttgtaaattc tttaattcag tttccgccatagctatatgt gtaacttgtt tattaactag60
gcttgagtgt gattatgtaa gcaggcg 87
<210> 288
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 288
aagagaaaaa ttaagccaag aagaatgaaaaaagtacaaa aactgtttga ctactagtgt60
gattatgtaa gcaggcg 77
<210> 289
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 289
ttgtatttta tgaacaaaag tggtagcacttggagaactt tttaatagag tgagatctgc60
gcttatgatt atgtaagcag gcg g3
<210> 290
<211> 77
<212> DNA
147
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 290
gattttttta atagccgacg tgaataaaagagctaagtga ttatagagta tcggtagtgt60
gattatgtaa gcaggcg 77
<210> 291
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 291
gtagttaaac aatatatatt gcactaacaccaaaacagta caattttttt ttttcctttc60
taaagagtgt gattatgtaa gcaggcg g7
<210> 292
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 292
tcagctggat caccttgagc tatgtaaaatactacttcat ccatgtttgt gaattagtgt60
gattatgtaa gcaggcg 77
<210> 293
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 293
tcatattctt ttaatgttat tgttggtggtgttgtatcgt tgatatattt tggaagaaat60
gattgtgatt atgtaagcag gcg g3
<210> 294
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 294
agctgtggct ataagaactg taaccagtgttttgatttca gagtgatttc tactgagtgt60
gattatgtaa gcaggcg 77
<210> 295
148
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 295
ttggttccaa gaggggaaaa aaacaattgactcaaatagt tttttaaatc gttccaactt60
tttagagtgt gattatgtaa gcaggcg
87
<210> 296
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 296
ctcccctttt ccttcttcta ctgctattattcacagtgga ttcaccaaca ttactagtgt60
gattatgtaa gcaggcg 77
<210> 297
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 297
tgaggttcta tgaacataaa gtggtttgtaagttcaacta ataagttggg cgctcacaca60
gaatgagtgt gattatgtaa gcaggcg
87
<210> 298
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 298
gctcccgagt acgtggtcta cgtaaacttttcacccgatg agaaaaagct ctacaagtgt60
gattatgtaa gcaggcg 77
<210> 299
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 299
ctcaccgctt aggttcacat gtaataggttacaaaactag agcatatacc agcgttctat60
gtgtgagtgt gattatgtaa gcaggcg
87
149
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 300
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 300
taagctatac tactggctac aaaatgcattcagaggaaat tttgacgaat taaacagtgt60
gattatgtaa gcaggcg 77
<210> 301
<211> 77
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 301
cagaagagga ttaatacact taaattataccgatataaaa ctctctacaa ttgggagtgt60
gattatgtaa gcaggcg 77
<210> 302
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 302
ggctctggta taccataatc attagcgcatcactctttga tcattcatta tttggtcttt60
taatgagtgt gattatgtaa gcaggcg 87
<210> 303
<211> 72
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 303
ttagtgatta gtcacttaac gaccctaaatagttttgaaa cctcccgtaa agtgtgatta60
tgtaagcagg cg 72
<210> 304
<211> 72
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 304
cgagacctac aaatacaact tttgaacttgtcacaatcat cgcattcttt agtgtgatta60
150
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tgtaagcagg cg 72
<210> 305
<211> 72
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 305
aacttttttc tctctcacac tctcaaaatttcttccaaca acaaaccttt agtgtgatta60
tgtaagcagg cg 72
<210> 306
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 306
tattgtttaa aaagcaaatc aataccttccagataaatcg gtattctcta taactgatta60
tatggtgatt atgtaagcag gcg g3
<210> 307
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 307
aatactatga ggatcggtgt ggctataaatgctattgaaa agcaagcggc agtttcgata60
tccatcgaat tgatccggta atttagtgtg 9p
<210> 308
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 308
atatgtcgtt tcccttggat tctcttgtttgacttattag tgacagtttt gttgttggtt60
cccatatccg gtaatttagt gtg 83
<210> 309
<211> 75
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
151
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 309
gccgctattg ctgcaactac tattgcaagt ttcaaaagcc ttgctagcat 60
cgaattgatc
cggtaattta gtgtg
<210> 310
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 310
attgatttgg tacctgttaa cttgagaggc aacacataaa acccttttat 60
ttctgtaggt
gccatatccg gtaatttagt gtg g3
<210> 311
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 311
tcataatctt caatttgctc ttgagtagac actttacgta ttttccttgg 60
ttgtgtatcc
gtcatcgaat tgatccggta atttagtgtg 9p
<210> 312
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 312
gagtcaactt catcaagttc aatctcttct tcattcacag ttttatttct atttcttcta60
gccatcgaat tgatccggta atttagtgtg 9p
<210> 313
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 313
aggggaattt cctctttagg ttattcacac tctcatgctc ttccactttc gacatcgaat60
tgatccggta atttagtgtg
80
<210> 314
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
152
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 314
cagccaacgc caacgggagc ttgccattataaagtgtggt caccattggt ttcatcgaat60
tgatccggta atttagtgtg g0
<210> 315
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer -
<400> 315
tctgaatcgg gtgaactaac atcaatatctgaatcagatt cttcatctac tcttctttta60
cccatcgaat tgatccggta atttagtgtg 9p
<210> 316
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 316
ggatatattt cttacctcca gttaaaatttctctattctt tttaaatcct gccatcgaat60
tgatccggta atttagtgtg g0
<210> 317
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 317
gagctgaaca agtcgtaaat ctggaattgtaatttatcta gttttttata atatactgtt60
gacatcgaat tgatccggta atttagtgtg 90
<210> 318
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 318
tctgaatctg atacaattgc tgattcttggtgcttggaga acccggtagc tgatgagtct60
gtcatcgaat tgatccggta atttagtgtg 90
<210> 319
<211> 90
<212> DNA
<213> Artificial Sequence
153
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 319
aaggacttga attcatcatc ttcaatggtagaaatatcat tttcctctaa cttccgtttt60
gccatcgaat tgatccggta atttagtgtg 90
<210> 320
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 320
cgcacaacat tctgtaaaag aataatgttggtaggcaata tagcagctct tcttttttta60
gccatatccg gtaatttagt gtg g3
<210> 321
<211> 75
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 321
agggacaaaa aataattaat gccatcaatgacagtttcaa caatagccat cgaattgatc60
cggtaattta gtgtg 75
<210> 322
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 322
gacaaagaca gtagaagcat tccatcatcaatatcgttat atacattggt aacatgacta60
ggcatcgaat tgatccggta atttagtgtg 90
<210> 323
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 323
gtattaagcc ctctctcttg tatgaactctggagatttcc actgtatttc gtctaatgat60
tccatatccg gtaatttagt gtg g3
<210> 324
<211> 90
<212> DNA
154
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 324
gtaaattcac ctaaataatt gggaattacatcttgaagag cttttcgtgc ttgagaagag60
gacatcgaat tgatccggta atttagtgtg g0
<210> 325
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 325
atgtggagtc attatactct cgtatcacgtttggtgggga tgaaaacgta ttcatcgaat60
tgatccggta atttagtgtg g0
<210> 326
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 326
accataccgg ttgccaaata gttccccgactgatcaaact ttgaacaaat tattggtcct60
gacatcgaat tgatccggta atttagtgtg 90
<210> 327
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 327
tcaacagata cttctgtatt atcattcttattggttcctg gccattgaaa atttgtggac60
atcatcgaat tgatccggta atttagtgtg 9p
<210> 328
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 328
aacaatattt cctcttcatc tttaggaggtattatcactt cttctccttg tatgtttgtg60
ggcatatccg gtaatttagt gtg g3
<210> 329
155
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 329
cgtcgtgtgg ttgattccaa cccagtgcaacagaataata accccgtaaa tggtttcaat60
gacatcgaat tgatccggta atttagtgtg 90
<210> 330
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 330
atggaggtgt ccttcgatct taatagtttagtcaccgctt ctgcagtcaa caaatccttc60
cccatcgaat tgatccggta atttagtgtg 90
<210> 331
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 331
tggcaacaag cctcaaccgc tcaaatctcactttgttatt ttcatcggcg gacatcgaat60
tgatccggta atttagtgtg
80
<210> 332
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 332
aaatagtagt ggaataattg gtacggtttttgtattattt tggaacgcaa aatagaagac60
gccatcgaat tgatccggta atttagtgtg 9p
<210> 333
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 333
gataataatc tctcattttg aatcagttcgttggaagaag cagataattg tgaacttgat60
gtcatcgaat tgatccggta atttagtgtg 90
156
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 334
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 334
gtttatatgg ttcgggagtc atatcatcctcctcattaat gaataacagg ctcatcgaat60
tgatccggta atttagtgtg 80
<210> 335
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 335
cattttttca attgttgcaa gtcatcaatgcctttatatg ccgtgacaag tggatgttgt60
ttcatcgaat tgatccggta atttagtgtg 90
<210> 336
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 336
catcagtgac tactgttgga tgaagtaataataaaatatt gatcagtgaa gtcatcgaat60
tgatccggta atttagtgtg 80
<210> 337
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 337
ttagcttcct ttttagctaa tgctcttttagaacgagcat tctttggttt gatcgtccta60
atcatatccg gtaatttagt gtg
83
<210> 338
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 338
agtttgctct tttttcagca atcttttggtatatagcagt atttgttttc agcatcgaat60
157
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tgatccggta atttagtgtg gp
<210> 339
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 339
ggtttgaact ctttgagtga gtggaactcctttattattt tatgtagtag atcttggtaa60
tccatatccg gtaatttagt gtg g3
<210> 340
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 340
tcttgacttt gtttaagttt cttctttttttctaaatctt gttgtttact ttttcgttta60
gccatatccg gtaatttagt gtg g3,
<210> 341
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 341
tgagataatg atgagcgttt tatatcttggaacgtctttg catattggtt cggggttata60'
tacatatccg gtaatttagt gtg
8
3"
<210> 342
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 342
taccgccctg ttgattaggg tcgtaataatgattattatt atcgttatac gacatcgaat60
tgatccggta atttagtgtg gp
<210> 343
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
158
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 343
ttggacaaag tagctttggc agtggctaat ctagccattc tcatggaagt agttctgaaa 60
gacatatccg gtaatttagt gtg
83
<210> 344
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 344
gtcgtggcag cagcacttga aattggtgac ttggtagcta gactacgtat ggattgtttg 60
aacatcgaat tgatccggta atttagtgtg g0
<210> 345
<211> 75
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 345
acggtaaaca atcactaaga cataccatta atactgatga cttctctcat 60
cgaattgatc
cggtaattta gtgtg ~ 75
<210> 346
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 346
acgcaagagc gcaaacaagt aaattgaaga ttgctataaa tactgacgtt 60
ttcatcgaat
tgatccggta atttagtgtg g0
<210> 347
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 347
tcggatgatg cgattgtcaa agcaatgtat aaaaggcttg gtataaggat 60
ggtgtacatt
agcatcgaat tgatccggta atttagtgtg g0
<210> 348
<211> 90 ,
<212> DNA
<213> Artificial Sequence
<220>
159
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 348
ggctcaagaa ccaaatatcc accagcaagaaatgcttttc caggtgcact aaatgctttt60
gacatcgaat tgatccggta atttagtgtg 90
<210> 349
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 349
tgacaaccgg aaatggagcg gacgaaggaagtttaattgg agttaggtcc gacatcgaat60
tgatccggta atttagtgtg 80
<210> 350
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 350
tgcttttctt gaacgccatt acgtatcaaggcaggaatac gtgcatcaat tgctttttta60
cccatatccg gtaatttagt gtg g3
<210> 351
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 351
attggaaaaa agtatctcta tcgacataatcaaatatttc atcaaatgca gccatcgaat60
tgatccggta atttagtgtg
80
<210> 352
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 352
ccaaatggaa gaatagttct ttgagttgatctaccaccac taccaccacc acctctaaat60
gacatcgaat tgatccggta atttagtgtg 90
<210> 353
<211> 80
<212> DNA
<213> Artificial Sequence
160
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 353
atggaatcac ctctggccca tcaaacacaacactagttaa aaaattcact ggcatcgaat60
tgatccggta atttagtgtg g0
<210> 354
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 354
tattgtcctg gaacaacaat actagaaacattaccatcag tagtagtgtt tgacatatct60
gtcatatccg gtaatttagt gtg 83
<210> 355
<211> 80
<212> DNA -
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 355
ggttcttaac taatgctgga ttccaagacttttttagatt tagatcacct gccatcgaat60
tgatccggta atttagtgtg
80
<210> 356
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 356
gcatctttac cagttatcgc cgtacaagaaatatctttag tgaaaacggt atcgtttttc60
aacatcgaat tgatccggta atttagtgtg 90
<210> 357
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 357
attcatattg ttcttcttct aaatttaatacattatctat atctatatct gacatcgaat60
tgatccggta atttagtgtg 8p
<210> 358
<211> 90
<212> DNA
161
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 358
aatttgaatg cgtggacata cacactcatttgtttcttat aggccttggc acgcttttgt60
ctcatcgaat tgatccggta atttagtgtg 90
<210> 359
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 359
actcttgctg aacgatgtca acacactgacggaataatgg tgttaagtcg gtcatcgaat60
tgatccggta atttagtgtg g0
<210> 360
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 360
ttattcacta taagtttctt tagttttggattctttttct ttaaactgat ttttatacct60
gacatcgaat tgatccggta atttagtgtg 90
<210> 361
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 361
tatgtttcaa atgcttattt tgaaacttctttgtttgttt cgatgcttta gccatcgaat60
tgatccggta atttagtgtg gp
<210> 362
<211> 80
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 362
gtgaagattc ctcttcatcg taatacgacggtcttattgt tttacctctt gacatcgaat60
tgatccggta atttagtgtg
80
<210> 363
162
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 90
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 363
tgattttgct gataatcaag gttagctatcgattcctcta tatctttttc taattgatcg60
gacatcgaat tgatccggta atttagtgtg 90
<210> 364
<211> 75
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 364
attaaggcat ctctacgaaa tgtcttttcaaaagtaacag gaccactcat cgaattgatc60
cggtaattta gtgtg 75
<210> 365
<211> 75
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 365
gcattcccac ttgatggtgg gtcgtcatttaaaatagatc caacattcat cgaattgatc60
cggtaattta gtgtg 75
<210> 366
<211> 75
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 366
tcaccgacaa tgactaattt tctacgaagttcagctggac cgttaaccat cgaattgatc60
cggtaattta gtgtg 75
<210> 367
<211> 83
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 367
attcgaaatg ctatgggtct aatgtttgatggctgaagtt taattggcaa agaagtgact60
tccatatccg gtaatttagt gtg 83
163
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 368
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 368
cctgtttgat catcttgatt cg 22
<210> 369
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 369
tgaattgaaa aatgaaaaca gcttcg 26
<210> 370
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 370
ccagtgaaaa tccacgtgta gatgg 25
<210> 371
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 371
ttgtcctttt cccacttcta tcaatg 26
<210> 372
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 372
atttccttta acgcgtttgc tg 22
<210> 373
<211> 22
<212> DNA
164
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 373
gtgttaagta ggagtgggat gg 22
<210> 374
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 374
tgggtattat aggccttgtt tgtcaga 27
<210> 375
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 375
acctgaacca ctctcgccaa t , 21
<210> 376
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 376
gttgccgttt caattgttta gc 22
<210> 377
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 377
tgttctccat ttttggtggt gatt 24
<210> 378
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
165
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 378
tatatcacca gccccgttag ac 22
<210> 379
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 379
ccttgccatt tcatttcaaa gc 22
<210> 380
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 380
cgagagagta tttggaaagt cg 22
<210> 381
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 381
cagctgccga tagtgcaaag a 21
<210> 382
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 382
tttgagaaca gccacacgac as 22
<210> 383
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 383
166
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
ggagccattc cattcaatag tg 22
<210> 384
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 384
cgcgaatacc aggagttctt cc 22
<210> 385
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 385
tatgagacaa ctgggaagaa gt 22
<210> 386
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA prime r
<400> 386
tgctcgaaga tttgtcgttg ga 22
<210> 387
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 387
cgagctgttc aaaactggtt ag 22
<210> 388
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 388
caagtggtag caaaaaccaa gc 22
<210> 389
167
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 389
cgattaattg ctcaagaaat tgccata 27
<210> 390
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 390
tacagagaca ttcaaacgcg tc 22
<210> 391
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 391
ttgcactgtc tggtgtgagt tg 22
<210> 392
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 392
tcatggaagc ggaagaacct g 21
<210> 393
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 393
atcaggcgac tacaccagaa cc 22
<210> 394
<211> 22
<212> DNA
<213> Artificial Sequence
168
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 394
gttacttaca acttcatggg gc 22
<210> 395
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 395
tgccgcgata ggcatagtca 20
<210> 396
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 396
ggtggtggtg gcagaaatag ga 22
<210> 397
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 397
cggaggagga ggaggaggag 20
<210> 398
<211> 21
<212> DNA
<213> Artificial Sequence .
<220>
<223> DNA primer
<400> 398
cctccttgta actccggttc g 21
<210> 399
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
169
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 399
tgatgaagaa gaacttgggg gtaga 25
<210> 400
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 400
cgttatcgat gccttccttc g 21
<210> 401
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer ,
<400> 401
gggttccaga ggttatcatg tgtg 24
<210> 402
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 402
ttgatgggtc cgagatcaag c 21
<210> 403
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 403
ggtcagattc acatttccag atctca 26
<210> 404
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 404
tcccttttcc gctgatccat 20
170
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 405
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 405
gatgagttta taattggcag cg 22
<210> 406
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 406
tcgagtgaat gttaggggag agaga 25
<210> 407
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 407
gtggaggaca atgctcttga gg 22
<210> 408
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 408
ttatccaaac accttttcct gg 22
<210> 409
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 409
ttaattcagt ttccgccata gc 22
<210> 410
<211> 21
<212> DNA
171
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 410
tggaacattg ccgaaactga a 21
<210> 411
<211> 30
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 411
aggtatgata tttgacgttg tttattttgc 30
<210> 412
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 412
tccatttgct gatgatgatg atg 23
<210> 413
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 413
cctttctaaa gaatcccatc gc 22
<210> 414
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 414
ccggaccaat accagttacc g 21
<210> 415
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
172
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 415
caagtagttg aagcccacga tgc 23
<210> 416
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 416
tttgaaagga actatcggat tattggt 27
<210> 417
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 417
ccaggaagaa tttgatgcta cc 22
<210> 418
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 418
tcctcctcca gttgttgttg ttg 23
<210> 419
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 419
gatgaaacac aaaacgcaag gc 22
<210> 420
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 420
173
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
tgccccagga acattgattg 20
<210> 421
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 421
ggtagtgctc aaaagtcatt gc 22
<210> 422
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 422
catggcactg gtgatgacaa tgta 24
<210> 423
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 423
tccgggtaaa ccaagaagtc aga 23
<210> 424
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 424
atatattctg ctgagcgcat tc 22
<210> 425
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 425
tgattcccac cacagttaga cgaa 24
<210> 426
174
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 426
tcgtcagatg cagcacacgt t 21
<210> 427
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 427
ttcccagcca aacaccaaaa 20
<210> 428
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 428
aagcaccacc aaatctacac caaa 24
<210> 429
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 429
tcttgggatt ggtatgtact gc
22
<210> 430
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 430
tcgtgtgact attctttgat ttggaga 27
<210> 431
<211> 20
<212> DNA
<213> Artificial Sequence
1~5
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 431
ttgacgccac tagccccatt 20
<210> 432
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 432
cgaccaaatc caagtccgat g 21
<210> 433
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 433
ccagatcatc atcatctacg tc 22
<210> 434
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 434
gctgggttga tgacagtgtg tc 22
<210> 435
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 435
tggttgtggt tgtggttgtg g 21
<210> 436
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
176
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 436
actcctgcgg caacaccttc 20
<210> 437
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 437
ggatcacttt ccattccttc ag 22
<210> 438
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 438
tggcagcaat ttcttgagca g 21
<210> 439
,
<211
> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 439
ggaacgatca gcaaataatt gg 22
<210> 440
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 440
ggcaattgtt gctggagata cc 22
<210> 441
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 441
gtccatgtgg ttggttaata gc 22
177
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 442
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 442
aaactcggtt gtagagttag catcca 26
<210> 443
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 443
ccttttggac ctaaataaac cgtca 25
<210> 444
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 444
gtcactggct gttgataatt gc 22
<210> 445
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 445
ctcactcaac cgcgactgaa a 21
<210> 446
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 446
ctttatgtgt tggggtgcct gc
22
<210> 447
<211> 21
<212> DNA
178
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 447
tgactcaata gtgggccagc a 21
<210> 448
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 448
tacacgtttc cttctatatc gc 22
<210> 449
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 449
tctaggtagt ggcaaaggtt gc 22
<210> 450
<211> 27
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 450
tctgattctt tctccagacc tttttca 27
<210> 451
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 451
tatctgttcc tcgtggatca gc 22
<210> 452
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
179
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 452
tggtagtact ttgtggaatc cg
22
<210> 453
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 453
catgccaaaa cccggacatt 20
<210> 454
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 454
acccgtgcat tgaataatta gc 22
<210> 455
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 455
ttccttgttc aaatctccac tg 22'
<210> 456
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 456
tgactgtttc gccctttctg g 21
<210> 457
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 457
i8~
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
ccttgtttag atcttgtttc cg 22
<210> 458
<211> 25
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 458
ccactggttc atcaacaggt attgg 25
<210> 459
<211> 26
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 459
attggaccat taaaaacaaa cattgg 26
<210> 460
<211> 23
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 460
catttgattg tccaacacgc act 23
<210> 461
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 461
tcattgttgg tggtgaggtg taga 24
<210> 462
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 462
tcttggtggt gattttcctt gg
22
<210> 463
181
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 463
tccaacatgg caccacatcc 20
<210> 464
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 464
ccctgggcat tcattggttg 20
<210> 465
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 465
gccaatcagc tctttcgtgg a 21
<210> 466
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 466
tgatcctact cgggccttat cg
22
<210> 467
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 467
aacatacaag gcacgaggaa cg 22
<210> 468
<211> 25
<212> DNA
<213> Artificial Sequence
182
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<220>
<223> DNA primer
<400> 468
tgccaaacta accataatct gctca 25
<210> 469
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 469
atcgatagac ggaacggaac ag 22
<210> 470
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 470
tggcaacaac tgacactaat cc 22
<210> 471
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 471
tcgccttcta tgggactctc as
22
<210> 472
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 472
cgcttctgtc tgtgggaggt g 21
<210> 473
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
183
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<400> 473
ccccaaccaa attctttagc ttca 24
<210> 474
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 474
tttcttgttc atctccacta cg 22
<210> 475
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 475
tgtgctcctc gttgtcccaa t 21
<210> 476
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 476
gttgaggtgt ttggcgatgg 20
<210> 477
<211> 24
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 477
ttttgagctt ctgctgtttg ttca 24
<210> 478
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 478
tatctaatgg aacgggttga cc 22
184
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<210> 479
<211> 25
<212> DNA
<213> Artificial Sequence.
<220>
<223> DNA primer
<400> 479
tcaaatgatt ccgaagtgaa gaaga 25
<210> 480
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 480
cccatcttca ccttcatttt gc 22
<210> 481
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 481
cgacccagct agtttcgtgt ca 22
<210> 482
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 482
cgaatttggt gagagatgat gc 22
<210> 483
<211> 21
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 483
tggcttttcc atcagcacgt t 21
<210> 484
<211> 23
<212> DNA
185
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 484
ggaccatctg aatctgagcc tga 23
<210> 485
<211> 22
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 485
tagcttgttg gtattgtttg gc 22
<210> 486
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 486
ggcgtgcaag acaccattca 20
<210> 487
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
<223> DNA primer
<400> 487
tggcggaggt ttatgtgcaa 20
<210> 488
<211> 22
<212> DNA
<213>.Artificial Sequence
<220>
<223> DNA primer
<400> 488
tgagcaactt gttggccttc ag 22
<210> 489
<211> 20
<212> DNA
<213> Artificial Sequence
<220>
186
CA 02398861 2002-08-19
WO 01/60975 PCT/USO1/05551
<223> DNA primer
<400> 489
ccccgatctt cgattttcca 20
<210> 490
<211> 1561
<212> DNA
<213> Candida albicans
<400>
490
atgagagaagtcatcagtattaatggtatgtcttagtgattgtttaccgtttcaaaatcg 60
ccatcagttttttttttggggatggattgaaaacactaagatccggtttttttggttgtc 120
ttgatttcaaagtttgatccaagcttcattagtaagcagccataacaatccatcttaaac 180
gcgtcgatttttgattgaatcaatcaaagaattctgttcatactaacgccattgtatagt'240
tggtcaagccgggtgtcaaattggtaacgcctgttgggaattgtattcacaggaacatgg 300
tattagaccagatgggtatttacaagaaggtttagacagaccaaagggaggagaagaagg 360
tttttctacttttttcagtgaaactggttcaggtaaatacgttcctcgtgccttgtatgt 420
tgatttggaaccaaatgtcattgatgaagttcgtactggtgtttacaaagatttattcca 480
ccctgaacaattgattgccggtaaagaagatgccgccaataattatgctagaggtcacta 540
cactgttggaagagaaattttagacgacattttagatagagtcagaagaatgagtgatca 600
atgtgacggattacaaggtttccttttcacccactctttgggtggtggtaccggttccgg 660
tttgggttctttgttattggaacaattatctttggattacggtaaaaaatccaaattgga 720
atttgctgtttacccagctccacaagtgtccacttcagttgttgaaccatataatactgt 780
gttgactacccacaccactttggaacacgccgattgtacttttatggttgataatgaagc 840
catctacgatatgt.gtagaagaaacttggatattgccagaccaaattttagttcattgaa 900
caacttgattgctcaagttgtgtcatccgttaccgcctctttgagatttgacggttcctt 960
gaatgttgatttgaatgaattccaaactaacttggttccatacccaagaatccatttccc 1020
attggtcagttatgctccagttttctccaagagtagagctacccatgaagccaactctgt 1080
ttctgaaattactcaatcttgttttgaaccaggtaaccaaatggtcaaatgtgacccaag 1140
aactggtaaatacatggcca_cctgtttgttataccgtggtgatgttgttactagagacgt 1200
tcaaaatgctgttgctcaagttaaatctaaaaagactgttcaattagtcgattggtgtcc 1260
aactggtttcaagattggtatctgttaccaaccaccaactgccattaagggatctgaatt 1320
ggccagtgcttctagagctgtttgtatgttgtctaacactactgccattgctgaagcttg 1380
gagaagaattgacagaaaattcgacttgatgtactctaagagagcctttgttcactggta 1440
cgttggtgaaggtatggaagaaggtgaattcactgaagctagagaagacttggctgcttt 1500
agagagagattatattgaagttggtactgattctttccctgaagaagaagaagaatatta 1560
g 1561
Ig~
