Note: Descriptions are shown in the official language in which they were submitted.
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 GENETIC ENGINEERING OF DROUGHT TOLERANCE
VIA A PLASTID GENOME
CROSS-REFERENCES TO RELATED APPLICATIONS
This patent application claims the benefit of U.S. Provisional Application No.
60/185,658,
6 filed 2/29!2000. This earlier provisional application is hereby incorporated
by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
The work of this invention is support in part by the USDA-NRICGP grants 95-
82770, 97-
35504 and 98-0185 to Henry Daniel!.
FIELD OF INVENTION
11 This application pertains to the field of genetic engineering of plant
plastid genomes,
paaticularly chloroplasts and to methods of transforming plants to confer or
increase drought
tolerance and engineered plants which are drought tolerant.
DESCRIPTION OF RELATED ART
Patents of Interest
16 Londesboroughet.al.,inU.S.patentno.5,792,921 (1998),entitled"Increasing
thetrehalose
content of organisms by transforming them with combinations of the structural
genes for trehalose
syrithase," and U.S. patent no. 6,130,368 (2000), entitled "Transgenic plants
producing trehalose",
proposed a method for increasing trehalose content in various organisms
through nuclear
transformation.
21 Hoekema, in U.S. patent no. 5,925,804 (1999), entitled "Production of
Trehalose in Plants,"
proposes a method of engineering plants to produce trehalose. This patent
suggests the
transformation of plants by introducing to the plant nuclear genome any
trehalose phosphate synthase
gene driven by an appropriate promoter.
Strom, et al., in U.S. patent no. 6,133,038 entitled "Methods and compositions
related to the
26 production of trehalose" (2000), described the genes involved in the
biosynthesis of trehalose,
trehalose synthase and trehalose-6-phosphate. Methods for producing trehalose
biosynthetic
enzymes in a host cell through transformation of the cell's nucleus are also
proposed. In addition,
the patent also suggests nuclear transgenic host cells which contain
recomvinant DNA constructs
encoding for a trehalose synthase, trehalose phosphatase or both trehalose
synthase and, trehalose
31 phosphatase.
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1
BACKGROUND OF THE INVENTION
Effects of increased trehalose accumulation
Water stress due to drought, salinity or freezing is a maj or limiting factor
in plant growth and
development. Trehalose is a non-reducing disaccharide of glucose and its
synthesis is mediated by
6 the trehalose-6-phosphate (T6P) synthase and trehalose-6-phosphate
phosphatase complex in
Sacchar°omyces cer~evisiae. In S. cerevisiae, this complex consists of
at least three subunits
performing either T6P synthase (TPS1), T6P phosphatase (TPS2) or regulatory
activities (TPS3 or
TSLI). Trehalose is found in diverse organisms including algae, bacteria,
insects, yeast, fungi,
animal and plants. Because of its accumulation under various stress conditions
such as freezing,
11 heat, salt or drought, there is general consensus that trehalose protects
against damages imposed by
these stresses. Trehalose is also known to accumulate in anhydrobiotic
organisms that survive
complete dehydration , the resurrection plant and some desiccation tolerant
angiosperms. Trehalose,
even when present in low concentrations, stabilizes proteins and membrane
structures under stress
because of the glass transition temperature, greater flexibility and chemical
stability / inertness.
16 Prior efforts to engineer plants for trehalose production
There have been several efforts to generate various stress resistant
transgenic plants by
introducing genes) responsible for trehalose biosynthesis, regulation or
degradation. When
trehalose accumulation was increased in transgenic tobacco plants by over-
expression of the yeast
TPS 1, trehalose accumulation resulted in the loss of apical dominance,
stunted growth, lancet-shaped
21 leaves and some sterility. Altered phenotype was always correlated with
drought tolerance, plants
showing severe morphological alterations had the highest tolerance under
stress conditions.
Advantages of transforming plants through the chloroplast
In order to minimize the pleiotropic effects observed in the nuclear
transgenic plants
accumulating trehalose, this invention compartmentalizes trehalose
accumulation within
26 chloroplasts. Several toxic compounds expressed intransgenic plants have
been compartmentalized
in chloroplasts, even through no targeting sequence was provided indicating
that this organelle could
be used as a repository like the vacuole. Also, osmoprotectants are known to
accumulate inside
chloroplasts under stress conditions. Inhibition of trehalase activity is
known to enhance trehalose
accumulation in plants. Therefore, trehalose accumulation in chloroplast may
be protected from
31 trehalase activity in the cytosol, if trehalase was absent in the
chloroplast.
_2_
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 In addition, chloroplast transformation has several other advantages over
nuclear
transformation. A common environmental concern about nuclear transgenic plants
is the escape of
foreign genes through pollen or seed dispersal, thereby creating super weeds
or causing genetic
pollution among other crops. T'he latter has resulted in several lawsuits and
shrunk the European
market for organic produce from Canada from 83 tons in 1994-1995 to 20 tons in
1997-1998. These
6 are serious environmental concerns, especially when plants are genetically
engineered for drought
tolerance, because of the possibility of creating robust drought tolerant
weeds and passing on
undesired pleiotropic traits to related crops. Chloroplast transformation
should also overcome some
of the disadvantages of nuclear transformation that result in lower levels of
foreign gene expression,
such as gene suppression by positional effect or gene silencing.
11 Chloroplast genetic engineering has been successfully employed to address
aforementioned
concerns. For example, chloroplast transgenic plants expressed very high level
of insect resistance,
due to expression of 10,000 copies of foreign genes per cell, thereby
overcoming the problem of
insect resistance observed in nuclear transgenic plants. Similarly,
chloroplast derived herbicide
resistance overcomes out-cross problems of nuclear transgenic plants because
of maternal
16 inheritance of plastid genomes. This invention thus presents a solution to
the pitfalls of nuclear
expression of TPS 1 in transgenic plants.
Non-obvious nature of the invention.
Trehalose is a non-reducing disaccharide of glucose and is found in diverse
organisms including
algae, bacteria, insects, yeast, fungi, animal and plants. Because of its
accumulation under various
21 stress conditions such as freezing, heat, salt or drought, there is general
consensus that trehalose
protects against damages imposed by these stresses. Trehalose is also known to
accumulate in
anhydrobiotic organisms that survive complete dehydration, the resurrection
plant and some
desiccation tolerant angiosperms.
There have been several efforts to generate various stress resistant
transgenic plants by
26 introducing genes) responsible for trehalose biosynthesis, regulation or
degradation. When trehalose
accumulation was increased in nuclear transgenic tobacco plants by over-
expression of the yeast
TPSl , trehalose accumulation resulted in the loss of apical dominance,
stunted growth, lancet shaped
leaves and some sterility. Altered phenotype was always correlated with
drought tolerance; plants
showing severe morphological alterations had the highest tolerance under
stress conditions. Prior
31 to this invention, it was not obvious that accumulation of trehalose within
plastids would minimize
-3-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 the pleiotropic effects observed in the nuclear transgenic plants
accumulating trehalose or damage
plastids. There were no prior reports of trehalose accumulation within
plastids or localization of
enzymes of trehalose biosynthetic pathway within plastids.
Osmoprotectants are known to accumulate inside chloroplasts under stress
conditions but their mode
of action is to provide osmotic protection by accumulation of such compounds
(as sugars or amino
6 acids) in large quantities. This invention.demonstrates that the protection
is offered by accumulation
of small quantities of trehalose which was not adequate to provide protection
from dehydration but
rather stability of biological membranes. Inhibition of trehalase activity is
knomn to enhance
trehalose accumulation in the cytosol but there are no reports of the presence
or absence of trehalase
within plastids. Therefore, it was unanticipated that trehalose accumulation
within plastids would
11 be protected from trehalase activity. Prior to this invention, there were
no reports of using plastid
transformation as a strategy to confer drought tolerance to transgenic plants.
BRIEF SUMMARY OF THE INVENTION
This invention provides a method to transform plants through the plastids,
particularly
16 chloroplasts, to confer drought tolerance to plants. The vectors with which
to accomplish the
chloroplast transformation is provided. The tr ansformed plants and their
progeny are provided. The
transformed plants and their progeny display drought resistance. More
importantly, they display no
negative pleiotropic effects such as sterility or stunted growth.
The present invention is applicable to all plastids of plants. These include
chromoplasts
21 which are present in the fruits, vegetables and flowers; amyloplasts which
are present in tubers like
the potato; proplastids in roots; leucoplasts and etioplasts, both of which
are present in non-green
parts of plants.
The present invention provides a method to increase water stress tolerance in
dicotyledonous
or a monocotyledonous plant, comprising introducing an expression cassette
into the cells of a plant
26 to yield transformed plant cells. Plant cells include cells of
monocotyledenous plants such as cereals,
including corn (Zea mays), wheat, oats, rice, barley, millet and cells of
dicotyledenous plant such
as soybeans and vegetables like peas. The expression cassette comprises a
preselected DNA
sequence encoding an enzyme which catalyzes the synthesis of an
osmoprotectant, operably linked
to a promoter functional in the chloroplast plant cell. The enzyme encoded by
the DNA sequence
31 is expressed in the transformed plant cells to increase the level of
osmoprotection so as to render the
-4-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 transformed cells substantially tolerant or resistant to a reduction in
water availability that inhibits
the growth of untransformed cells of the plant.
As used herein, an "osmoprotectant" is an osmotically active molecule which,
when that
molecule is present in an effective amount in a cell or plant, confers water
stress tolerance or
resistance, or salt stress tolerance or resistance, to the cell or plant; when
present in lower amounts
6 in a cell or plant, an "osmoprotectant" confers membrane stability. Those
skilled in the art will
appreciate that an osmoprotectant confers resistance to water or salt stress
when present in the cell
in high amounts, and confers membrane stability in lower amounts.
Osmoprotectants include sugars
such as monosaccharides, disaccharides, oligosaccharides, polysaccharides,
sugar alcohols, and sugar
derivatives, as well as proline and glycine-betaine. A preferred embodiment of
the invention is an
11 osmoprotectant that is a sugar. Useful osmoprotectants include fructose,
erythritol, sorbitol, dulcitol,
glucoglycerol, sucrose, stachyose, raffmose, ononitol, mannitol, inositol,
methyl-inositol, galactol,
hepitol, ribitol, xylitol, arabitol, trehalose, and pinitol.
Genes which encode an enzyme that catalyzes the synthesis of an osmoprotectant
include
genes encoding mannitol dehydrogenase (Lee and Saier, J. Bacteriol., 153
(1982)) and trehalose-6
16 phosphate synthase (Kaasen et al., J. Bacteriol., 174, 889 (1992)). Through
the subsequent action
of native phosphatases in the cell or by the introduction and coexpression of
a specific phosphatase
into the nucleus, these introduced genes result in the accumulation of either
mannitol or trehalose
in the nucleus, respectively, both of wluch have been well documented as
protective compounds able
to mitigate the effects of stress. Mannitol accumulation in the nucleus of
transgenic tobacco has
21 been verified and preliminary results indicate that plants expressing high
levels of this metabolite
are able to tolerate an applied osmotic stress (Tarczynslci et al., cited
supra (1992), (1993)).
Also provided is an isolated transformed plant cell and an isolated
transformed plant
comprising said transformed cells, which cell and plant are substantially
tolerant of or resistant to
a reduction in water availability. The cells of the transformed monocot plant
comprise a
26 recombinant DNA sequence comprising a preselected DNA sequence encoding an
enzyme which
catalyzes the synthesis of an osmoprotectant. The preselected DNA sequence is
present in the cells
of the transformed plant and the enzyme encoded by the preselected DNA
sequence is expressed in
those cells to yield an amount of osmoprotectant effective to confer tolerance
or resistance to those
cells to a reduction in water availability that inhibits the growth of the
corresponding untransformed
31 plant cells. A preferred embodiment of the invention includes a transformed
plant that has an
-5-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 improved osmotic potential when the total water potential of the transformed
plant approaches zero
relative to the osmotic potential of a corresponding untransformed plant.
As used herein, a "preselected" DNA sequence is an exogenous or recombinant
DNA
sequence that encodes an enzyme which catalyzes the synthesis of an
osmoprotectant, such as sugar.
The enzyme preferably utilizes a substrate that is abundant in the plant cell.
It is also preferred that
6 the preselected DNA sequence encode an enzyme that is active without a co-
factor, or with a readily
available co-factor. For example, the mild gene of E. Coli encodes a mannitol-
1-phosphate
dehydrogenase (M 1 PD). The only co-factor necessary for the enzymatic
activity of M 1 PD in plants
is NADH and the substrate for M 1 PD in plants is fructose-6-phosphate.
BothNADH and fructose-6-
phosphate are plentiful in higher plant cells.
11 As used herein, "substantially increased" or "elevated" levels of an
osmoprotectant in a
transformed plant cell, plant tissue, plant part, or plant, are greater than
the levels in an
untransformed plant cell, plant part, plant tissue, or plant, i.e., one where
the chloroplast genome has
not been altered by the presence of a preselected DNA sequence. In the
alternative, "substantially
increased" or "elevated" levels of an osmoprotectant in a water-stressed
transformed plant cell, plant
16 tissue, plant part, or plant, are levels that are at least about 1.1 to 50
times, preferably at least about
2 to 30 times, and more preferably about 5-20 times, greater than the levels
in a non-water-stressed
transformed plant cell, plant tissue, plant part of plant.
As used herein, a plant cell, plant part, plant tissue or plant that is
"substantially resistant or
tolerant" to a reduction in water availability is a plant cell, plant part,
plant tissue, or plant that grows
21 under water-stress conditions, e.g., high salt, low temperatures, or
decreased water availability, that
normally inhibit the growth of the untransformed plant cell, plant tissue,
plant part, or plant, as
determined by methodologies laiown to the art. Methodologies to determine
plant growth or
response to stress include, but are not limited to, height measurements,
weight measurements, leaf
area, plant water relations, ability to flower, ability to generate progeny,
and yield. For example, a
26 stably transformed plant of the invention has a superior osmotic potential
during a water deficit
relative to the corresponding.
As used herein, an "exogenous" gene or "recombinant" DNA is a DNA sequence
that has
been isolated from a cell, purified, and amplified.
As used herein, the term "isolated" means either physically isolated from the
cell or
31 synthesized in vitro in the basis of the sequence of an isolated DNA
segment.
-6-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 As used herein, a "native" gene means a DNA sequence or segment that has not
been
manipulated in vitro, i.e., has not been isolated, purified, and amplified.
The invention also provides, preferably, a plastid vector that is capable of
stably transforming
and conferring drought resistance to tolerance to different plant species.
The invention provides a plastid vector comprising of a DNA construct. The DNA
construct
6 includes a 5' part of the plastid DNA sequence inclusive of a spacer
sequence; a promoter that is
operative in the plastid; heterologous DNA sequences comprising at least one
gene of interest
encoding a molecule; a gene that confers resistance to a selectable marker; a
transcription
termination region functional in the target plant cells; and a 3' part of the
plastid DNA sequence
inclusive of a spacer sequence. The molecule can be a peptide of interest.
Preferably, the vector
11 includes a ribosome binding site (rbs) and a 5' untranslated region
(5'UTR). A promoter functional
in green or non-green plastids is used in conjunction with the 5'UTR.
Further, the invention provides a heterologous DNA sequence, which codes for
an
osmoprotectant, such as the Yeast T6P synthase gene (TSP1 gene), the E. coli
otsA gene. The
invention also provides the psbA 3' region, which enhances the translation of
foreign genes.
16 The invention provides a promoter is one that is operative in green and non-
green plastids
such as the l6SrRNA promoter, the psbA promoter, and the accD promoter.
The invention provides a gene that confers resistance, such as antibiotic
resistance like the
aadA gene or an antibiotic-free selectable marker such as BADH or the chlB
gene, as a selectable
marker.
21 All lcnown methods of tra~lsformation can be used to introduce the vectors
of this invention
into target plant plastids including bombardment, PEG Treatment,
Agrobacterium, microinj ection,
etc.
The invention provides transformed crops, lilce solanaceous plants that are
either
monocotyledonous or dicotyledonous. Preferably, the plants are those having
economic value which
26 are edible for mammals, including humans.
Any plant can be transformed to an osmprotectant-expressing plant in
accordance of the
inyention which can carry a helogerous DNA sequence which encodes a desired
trait. The
transformed osmoprotectant-expressing plant need not comprise such a trait
other than the DNA
sequence which encodes the osmoprotentant.
31 The invention provides plants that have been transformed via the
chloroplast which
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 accumulate trehalose at an amount at least 17-fold higher than non-
transformed plants which are
drought resistant.
The invention provides plants that have been transformed via the chloroplast
which has at
least a seven-fold increase in TPS 1 activity.
The invention provides plants that have been transformed via the chloroplast
which, in the
6 T° generation, display otherwise normal phenotype other than
decreased growth and delayed flowing.
The invention further provides that the T~/TZ generations of the transformed
plants display no
pleiotropic effects.
The invention provides the transformed chloroplasts of the target plants which
contain high
levels of trehalose.
11 The invention provides for chloroplast transformant seedlings which are
drought resistant
which are resistant to medium containing 3% to 6% PEG.
The invention provides a method to confer drought resistance to plants via
chloroplast
transformation with a universal chloroplast vector which contains a drought-
resistant or
osrnoprotectant gene and the accumulation of high levels of trehalose in the
chloroplast.
16 The invention provides a method to transform a target plant for expression
of the TPS 1 gene
leading to accumulations of trehalose in the chloroplast of the plant cells
and eliminating adverse
pleiotropic effects.
The invention provides proof of integration of the heterologous DNA sequence
into the
chloroplast genome by PCR.
21 The invention provides an environmental friendly method of engineering
drought resistance
to plants through chloroplast transformation.
Yeast trehalose phosphate syntlZase (TPSI ) gene was introduced into the
tobacco chloroplast
or nucleax genomes to study resultant phenotypes. PCR and Southern blots
confirmed stable
integration of TPSI into the chloroplast genomes of T,, TZ and T3 transgenic
plants. Northern blot
26 analysis of transgenic plants showed that the chloroplast transformant
expressed 16,966-fold more
TPSI transcript than the best surviving nuclear transgenic plant. Although
both the chloroplast and
nuclear transgenic plants showed significant TPS 1 enzyme activity, no
significant trehalose
accumulation was observed in T°lT1 nuclear transgenic plants whereas
chloroplast transgenic plants
showed 15-25 fold higher accumulation of trehalose than the best surviving
nuclear transgenic plants.
31 Nuclear transgenic plants (T°) that showed significant amounts of
trehalose accumulation showed
_g_
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 stunted phenotype, sterility and other pleiotropic effects whereas
chloroplast transgenic plants (T,,
T2, T3) showed normal growth and no pleiotropic effects. Chloroplast
transgenic plants also showed
a high degree of drought tolerance as evidenced by growth in 6% polyethylene
glycol whereas
untransformed plants were bleached. After 7hr drying, chloroplast transgenic
seedlings (T~, T3)
successfully rehydrated while control plants died. There was no difference
between control and
6 transgenic plants in water loss during dehydration but dehydrated leaves
from transgenic plants (not
watered for 24 days) recovered upon rehydration while control leaves died. In
order to prevent
escape of drought tolerance trait to weeds and associated pleiotropic traits
to related crops, it is
desirable to genetically engineer crop plants for drought tolerance via the
chloroplast genome instead
of the nuclear genome.
11 BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. PCR analysis of control and chloroplast transformants. A. Map of pCt-
TPS1,
chloroplast transformation vector and primer landing sites. P denotes plus
strand and M denotes
minus strand. Please note that tRNA genes contain introns. B. 1 % agarose gel
containing PCR
products using total plant DNA as template. M: 1 lcb ladder; 1. N. Nicotiana
tabacurn Burley,
16 untransformed control; Lanes 1, 3, 5: pCt basic vector transformants. 2, 4,
6: pCt-TPS 1
transformants. C. Map of the nuclear expression vector pHGTPS 1.
Figure 2. Southern blot analysis of control, TI and T3 chloroplast transgenic
plants. A. Site of
integration of foreign genes into the chloroplast genome and expected fragment
sizes in Southern
blots. P1 is the 0.811cb BamHl-BgIII fragment containing chloroplast DNA
flaucing sequences
21 used for homologous recombination. P2 is the 1.Slcb Xbal Fragment
containing the TPS 1 coding
sequence. B. Southern blot of DNA digested with BgIII and hybridized with
probes P 1 or P2.
Lanes: C, untransformed control; 1, Tl generation chloroplast transformant; 2,
T3 generation
chloroplast transformant.
Figure 3. Northern and western blot analyses of control, nuclear and
chloroplast transgenic plants.
26 A, D Western blots detected through chemiluminescence (100~g total protein
per lane). B, E
Northern blots detected using 32P TPSI probe. C, F Ethidium bromide stained
RNA gel before
blotting ( 1 O~.g total RNA loaded par lane). Panel A, B, C: T° nuclear
and TI chloroplast transgenic
plants. Lanes: 1. N. t. xanthi control; 2~5: T° nuclear transgenic
plants. 2, X-113; 3. X-119; 4.
X-121; 5. X-224; 6: N. t. Burley control; 7: chloroplast transgenic plant
(T~). Panel D, E, F: T~
31 nuclear and Tz chloroplast transgenic plants. Lanes: 1. N. t xanthi
control; 2, 3: T, nuclear
-9-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 transgenic plants 2, X-113; 3.X-119; 4: N. t. Burley control; 5: chloroplast
transgenic plant (T2).
Figure 4. Nuclear and chloroplast transgenic plants to illustrate pleiotropic
effects. 1. N. t xanthi
control; 2~5: T°nuclear transgenic plants 2, X-113; 3.X-121; 4. X-119;
5. X-224; 6, T~ chloroplast
transgenic plant; 7, N. t. Burley control.
Figure 5. Germination of Tl, TZ and T3 generation of chloroplast transformants
and untransformed
6 control on MS plate containing spectinomycin (SOO~g/ml).
Figure 6. Assay for drought tolerance on PEG. Four weelc old seedlings on MS
medium
containing 3% (A, B) or 6% (C, D) polyethylene glycol (MW 8,000). A, C:
Control
untransformed N. t. Burley. B, D: T, Chloroplast transgenic plants.
Figure 7. Dehydrationrehydration assay. Three week old seedlings from control
and chloroplast
11 transgenic lines germinated on agarose in the absence or presence of
spectinomycin (SOO~.g/ml)
were air-dried at room temperature in 50% relative humidity. After 7 hrs
drying, seedlings were
rehydrated for 48 hrs by placing roots in MS medium. A, untransformed; B,C, T,
and T3
chloroplast transgenic lines.
Figure 8. Water loss assay. Detached leaves from mature plants at similar
developmental stages
16 were dried at room temperature in 25% relative humidity. Leaf weight during
drying was recorded
and shown as percentage of initial fresh weight.
Figure 9. Dehydration and rehydration of potted plants. Potted plants were not
watered for 24
days and rehydrated for 24 hours. Arrows indicate fully dried leaves that
either recovered or did
not recover from dehydration. A, C: Control untransformed; B,D: chloroplast
transgenic plants.
21
DETAILED DESCRIPTION OF THE INVENTION
This invention discloses a method of conferring drought tolerance to plants by
transforming
plants via the chloroplast with a vector that contains a DNA sequence encoding
a gene of interest that
26 protects against water stress. In the preferred embodiment of this
invention, the vector used is the
universal vector as described by Daniell in W099/10513, which is incorporated
herein by reference.
Other vectors that are capable of chloroplast transformation such as pUC,
pBR322, pBlueScript,
pGem and others described in U.S. patent numbers 5,693,507 and 5,932,479 may
be used. In the
preferred embodiment of this invention, the osmoprotection is the yeast
trehalose-6-phosphate
31 synthase (TSP 1 ). Other genes which are capable of conferring drought
resistance or osmoprotection
-10-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
may also be used.
Expression of yeast TPSl in E. coli:
It is known that the yeast trehalose-6-phosphate synthase gene can be
expressed in nuclear
transgenic plants. Because chloroplasts are prolcaryotic in nature, it is
desirable to test expression
levels of the eukaryotic yeast TPS 1 gene in E coli. Because of the high
similarity in the transcription
6 and translation systems between E. coli and chloroplasts, expression vectors
are. routinely tested in
E. coli before proceeding with chloroplast transformation of higher plants.
Therefore, the TPS 1 gene
fiom yeast was cloned into the E. coli expression vector pQE 30 (see Figure 1A
for details of pQE-
TPS1) and expressed in a suitable E. coli strain M15 (pREP4). SDS-PAGE as
shown in Figure 1B
shows the presence of TPS 1 protein in crude cell extracts, even with
Coomassie Blue stain (lane 1 ),
11 indicating high levels of expression. Western blot analysis using TPS 1 -
antibody confirms the true
identity of the expressed protein as shown in Figure 1 B, lane 41. These
results confirm that the
codon preference of TPSl is compatible for expression in a prokaryotic
compartment. Hyper-
expression also facilitated purification as shown in Figure 1, lanes 2.55 and
preparation of polyclonal
antibody for characterization of transgenic plants.
16 Chloroplast and nuclear expression vectors.
Having confirmed suitability for prokaryotic expression, the yeast TPS1 gene
was inserted
into the universal chloroplast expression vector pCt-TPS 1 as shown in Figure
2B. This vector can
be used to transform chloroplast genomes of several plant species because the
flanking sequences are
highly conserved among higher plants. This vector contains the l6SrRNA
promoter (Prrn) driving
21 the aadA (aminoglyeoside 3"- adenylyl transferase) and TPS1 genes with the
psbA 3' region (the
terminator from a gene coding for photosystem II reaction center component)
from the tobacco
ehloroplast genome. It is known that the l6SrRNA promoter is one of the strong
chloroplast
promoters and the psbA 3' region stabilized transcripts to avoid hyper-
expression of TPS-1 and
associated Pleiotropic effects. The yeast ribosme binding site (RBS) was used
instead of the genome
26 chloroplast RBS (GGAGG). This construct integrates both genes into the
spacer region between the
chloroplast transfer RNA genes coding for alanine and isoleucine within the
inverted repeat (IR)
region of the chloroplast genome by homologous recombination. For nuclear
expression, the yeast
TPS1 gene was inserted into the binary vector pHGTPSl (Figure 2C), in which
the TPS1 gene is
driven by the CaMV 35S promoter and the hph gene is driven by the nopaline
synthase promoter.
31 The expression cassette is flanked by both the left and right T-DNA border
sequences.
-11-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 The binary vector pHGTPS 1 was mobilized into the Agrobacterium tunzafaciens
strain LBA
4404 by electroporation. Transformed Agrobacterium strain was introduced into
Nicotiana tabaccum
var xanthi using the leaf disc transformation method. Ninety two independent
TPS1 nuclear
tranformants were obtained on hygromycin selection. Seventeen confirmed
nuclear tranformants
were analyzed by northern blots. Among tranformants showing various levels of
transcripts, five
6 tranformants with strong, moderate, wealc, very weak and absence of
transcripts were chosen for
further characterization. For chloroplast transformation, green leaves of N.
tabacum var. Burley
were transformed with the chloroplast integration and expression vector by the
biolistic process.
Bombarded leaf segments were selected on spectinomycinlstreptomycin selection
medium.
Integration of foreign gene into the chloroplast genome was determined by PCR
screening of
11 chloroplast tranformants, (Figure 2A). Primers were designed to eliminate
mutants, nuclear
integration and to determine whether the integration of foreign genes had
occurred in the chloroplast
genome at the directed site by homologous recombination. Primers 5P/SM land
within the aadA gene
and should generate a 0.4 lcbp fragment if the aadA gene was present in
transgenic plants and
eliminates the possibility of mutation that could otherwise confer
streptomycinlspectinomycin
16 resistance. Figure 2A shows the presence of 0.4 lcbp PCR product in plants
transformed with the
universal vector alone (pCt,) or the universal vector containing the TPS 1
gene (pCt-TPS 1 ), but not
in control untransformed plants, confirming that these are transgenic plants
and not mutants. The
strategy to distinguish between nuclear and chloroplast transgenic plants was
to land one primer (3P)
on the native chloroplast genome adjacent to the point of integration and the
second primer (3M) on
21 the aadA gene. This primer set generated 1.6 lcbp PCR product in
chloroplast tranformants obtained
with the universal vector (pCt) and the universal vector containing the TPSl
gene (pCt-TPS1).
Because this product can not be obtained in nuclear transgenic plants, the
possibility of nuclear
integration can be eliminated. Another primer set was designed to test
integration of the entire gene
cassette. The presence of the expected size PCR products using SP/SM confirms
that the entire gene
26 cassette has been integrated and that there has been no internal deletions
or loop outs during
integration via homologous recombination.
Determination of chloroplast integration, homoplasmy and copy number:
Since there are no significant differences in the level of foreign gene
expression among
different chloroplast transgenic lines, one line was chosen to generate
subsequent generations
31 (T1TZT3). Southern blot analysis was performed using total DNA isolated
from transgenic and wild
-12-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 type tobacco leaves. Total DNA was digested with a suitable restriction
enzyme. Presence of a Bglll
at the 3' end of the flanking 16S rRNA gene and the trnA intron allowed
excision of predicted size
fragments in the chloroplast tranformants and untransformed plants. To confirm
foreign gene
integration and homoplasmy, individual blots were probed with the chloroplast
DNA flanking
sequence (probe P 1, Figure 2A). In the case of the TPSI integrated plastid
tranformants (T, TZ), the
6 border sequence hybridized with 6.13 and 1.17 lcbp fragments while it
hybridized witha native 4.47
lcbp fragment in the untransformed plants (Figure 2B). The copy number of the
integrated TPSI gene
was also determined by establishing homoplasmy in transgenic plants. Tobacco
chloroplasts contain
about 10,000 copies of chloroplast genomes per cell. If only a fraction of the
genomes were
transformed, the copy number should be less than 10,000. By confirming that
the TPSI integrated
11 genome is the only one present in transgenic plants, one could establish
that the TPSI gene copy
number could be as many as 10,000 per cell.
DNA gel blots were also probed with the TPSI gene coding sequence (probe P2)
to confirm
integration into the chloroplast genomes. In chloroplast transgenic plants
(T,T3), the TPSl gene
coding sequence hybridized with 6.13 and 1.17 kbp fragments which also
hybridized with the border
16 sequence in plastid transgenic lines (Figure 2B). This confirms that the
tobacco tranformants indeed
integrated the intact gene expression cassette into the chloroplast genome and
that there has been no
internal deletions or loop out during integration via homologous
recombination.
Analysis of transcript level in nuclear and chloroplast tranformants:
For comparison of introduced gene expression between chloroplast and nuclear
tranformants,
21 northern blot analysis of transgenic tobacco at similar developmental
stages was performed in T~, T,
and T2 plants. As shown in Figure 3, quantification of transcription level
showed that the chloroplast
transformant (T2) expressed 16,960-fold (Figur a 3E, lane S) more TPS 1
transcript than that of highly
expressing nuclear (T1) transformant (Figure 3E, lanes 2, 3). Similar results
were obtained when T,
chloroplast (Figure 3B, lane 7) and To nuclear transgenic plants (Figure 38,
lanes 2-5) were
26 compared. This large difference in TPS1 expression between nuclear and
chloroplast transgenic
plants should be due to the presence of thousands of TPS 1 gene copies in each
cell of transgenic
tobacco. Figure 3 (C, F) show ethidium bromide stained RNA gels before
blotting; this confirms that
equal amount of RNA (10 qg) was loaded in all lanes. It is remarkable that the
l6SrRNA promoter
is driving both genes very efficiently, eliminating the need for inserting
additional promoters for the
31 gene of interest.
-13-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 Western blot analysis of nuclear and chloroplast tranformants:
Polyclonal antibodies raised againstthe TPS 1 protein overexpressed and
purified from E. coli
(see experimental protocol) were used for immunoblotting (Figure 3A, D). A 60
kDa TPS 1
polypeptide was detected in the To nuclear (Figure 3A, lanes 2,3,5), T~
nuclear (3D lanes 2,3) and T~
plastid (Figure 3A, lane 7) and TZ plastid (Figure 3D, lane .5) tranformants.
However, no TPS 1 was
6 detected in the untransformed control (Figure 3A, lanes 1,6; 3D 1,4)) and
transgenic plants which
showed no TPS 1 transcript (Figure 3A, lane 4). As anticipated, western blots
showed only a five or
ten fold increase in TPS 1 protein in chloroplast over highly expressing
nuclear transgenic plants.
This is because of the fact that the chloroplast vector pCt-TPS 1 was
intentionally designed to lower
translation by not inserting a chloroplast preferred ribosome binding site
(GGAGG), so that
11 transgenic plants are not killed by hyper-expression of TPS1. This level
expression was adequate
to compare trehalose accumulation in cytosolic and chloroplast compartments
and observe resultant
phenotypic ! physiological changes. T1 nuclear and TZ chloroplast transgenic
plants had higher levels
of TPS 1 protein; this may be due to homozygous TPSl alleles or homoplasmy.
Quantification of trehalose-6-phosphate and trehalose in tranformants:
16 Trehalose formation is a two step process, involving trehalose-6-phosphate
synthase and
trehalose 6-phosphate phosphatase. Trehalose-6-phosphate was not detected in
all tested chloroplast
and nuclear transformers even though the TPS2, trehalose-6-phosphate
phosphatase that converts
T6P to trehalose, was not introduced (Table 1). Conversion of T6P to trehalose
should have been
accomplished by endogenous tobacco trehalose phosphatase or by any non-
specific endogenous
21 phosphatase. Simultaneous expression of both enzymes in transgenic plants
resulted only in marginal
increase of trehalose accumulation in previous studies, confirming that it is
adequate to express only
TPS 1. Leaf extracts from both nuclear and chloroplast transgenic plants
catalyzed the synthesis of
trehalose 6-phosphate from glucose-6-phosphate and UDP-glucose whereas
untransformed tobacco
had very low activity. To Chloroplast and nuclear transgenic plants showed a 7-
10 fold higher TPS 1
26 activity than untransformed control plants. The amount of trehalose present
in untransformed control
plants and To nuclear transgenic plants were similar whereas chloroplast
transgenic plants
accumulated a 17-25 fold mm trehalose than the best surviving nuclear
transgenic plants (Table 1).
T, nuclear transgenic plants accumulated less trehalose than control
untransformed plants whereas
TI chloroplast transgenic plants continued to accumulate high levels of
trehalose (Table 1).
31 Observation of comparable TPS 1 activity in both nuclear and chloroplast
transgenic plants but lack
-14-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 of trehalose accumulation in nuclear transgenic planes indicates that
trehalose may be degraded in
the cytosol by trehalase but not in the chloroplast compartment. This is
consistent with previous
studies on inhibition of trehalase activity that resulted in trehalose
accumulation in the cytosol.
Drought tolerance and pleiotropic effects:
Chloroplast and nuclear tranformants were examined for drought tolerance and
pleiotropic
6 effects. After six weeks of growth in vitro, rooted shoots were transferred
to pots and grown in the
greenhouse. TPSl nuclear tranformants showed moderate to severe growth
retardation, lancet-
shaped leaves and infertility (Figure 4). The chloroplast tranformants (To)
showed decreased growth
rate and delayed flowering but all subsequent generations (T,, Tz) showed
similar growth rates and
fertility as controls. The nuclear transgenic lines of stunted phenotype
showed delayed flowering
11 and produced fewer seeds compared to wild type or did not flower. This
result is consistent with
prior observations which demonstrated that E. coli otsA (TPS1) and S.
cerevisiae TPS1 transgenic
plants exhibited ~ stunted plant growth and other pleiotropic effects. The
nuclear transgenic line
showing severe growth retardation did not flower. T, nuclear transgenic plants
that survived showed
no growth retardation and trehalose accumulation. Therefore, these plants
could not be used for
16 appropriate comparison with chloroplast transgenic plants. When the seeds
of chloroplast transgenic
plant (crossed between transgenic female and untransformed male) and wild type
seeds were
germinated on MS medium containing spectinomycin, all chloroplast transgenic
progeny were
spectinomycin resistant while all wild type seedlings were sensitive to
spectinomycin (Figure 5).
Because TPS 1 transgenic lines showed accumulation of trehalose, they were
tested for
21 drought tolerance. Seeds of chloroplast and nuclear transgenic plants were
germinated on the MS
medium containing polyethylene glycol. As shown in Figure 6, chloroplast
transformant
seedlings showed resistance to medium containing 3% and 6% PEG whereas control
and nuclear
transgenic seedlings exhibited severe dehydration, necrosis and severe growth
retardation,
ultimately resulting in death. Three-week-old seedlings were chosen to study
drought tolerance
26 by dehydration and subsequent rehydration. When seedlings were dried for 7
hours at room
temperature in 50% relative hwnidity, they were all affected by dehydration.
However, when
dehydrated seedlings were rehydrated for 48 hours in MS medium, all
chloroplast transgenic lines
recovered while all control seedlings were bleached (Figure 7). Even the
couple of control
seedlings that partly survived (because of uneven drying of seedlings on
filter papers) eventually
31 died. These results suggest that the loss of water from TPS 1 transgenic
plants may not be
-15-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 decreased but the ability to recover from drought was dramatically enhanced.
This is consistent
with existing understanding that trehalose functions by protecting biological
membranes rather
than regulating water potential (Iwahashi et al., 1995).
Mature leaves from fully-grown plants were tested for their ability to
regulate water loss
under drought conditions. When detached leaves were air dried, control and
chloroplast
6 transgenic plants lost water to the same extent (Figure 8). Control and
chloroplast transgenic
potted plants were not watered for 24 days. Again, both showed dehydration to
the same extent
(Figure 9A,B). However, upon rehydration, fully dehydrated leaves (indicated
by arrows, Figure
9C,D) recovered in chloroplast transgenic plants but not in controls.
11
This invention is exemplified by the following non-limiting example:
EXAMPLE ONE
Plant, A. tumefaciens and E. coli culture: For transformation experiments,
Nicotianatabacum var.
xanthi and Burley were grown in MS medium in the Magenta culture box (Sigma,
USA). For
16 drought tolerance assays of tr ansgenic tobacco plants, the rooted young
plants were transferred to pre-
swollen Jiffy-7 peat pellets (Jiffy Products, Norway) inside the greenhouse.
Plants used for enzyme
assays were grown and kept in Magenta culture boxes. Seven or 8 leaf stage
plants were used for
enzyme assays. Two to three-week old young transgenic tobacco plants were used
for stress analyses.
(Agrobacte~ium tumefaciens strain LBA4404 was grown in the YEP medium at
29°C In a shaking
21 incubator. Other E. coli strains were cultured and maintained as described
in Sambrook et al.
Plasmid construction and antibody production: For hyper-expression of the TPS1
in E. Coli for
antibody production, the yeast TPS 1 gene was cloned into plasmid pQE30
(Qiagen) and subsequently
transformed into E. coli strain M15 [pREP4]. The resulting E. coli
transformant was grown at 37°C
to an Aboo of 0.5-0.8 and induced by 2mM isopropyl-(3-D-thiogalactopyranoside
(IPTG) for 1-5 hours.
26 The induced cells were harvested and lysed by sonication. SDS-PAGE analysis
showed the presence
of TPS 1 protein in cxude cell extracts, even with Coomassie Blue stain,
indicating high levels of
expression. Western blot analysis using TPS1 antibody confirmed the true
identity of the expressed
protein (data not shown). The recombinant protein was purified using Niz+
resin, using the
procedures provided by the manufacturer. Affinity column purified recombinant
protein was
31 analyzed for purity by SDS-PAGE. Protein concentrations were determined
using 'the Bio-Rad
-16-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 (USA) protein assay kit with BSA as a standard. Polyclonal antibody was
generated using the
purified TPSl protein by the Talcara Shuzo Co. (Japan).
Vector construction for plant transformation: The yeast 1.537 Icbp TPS 1 gene
was inserted into
the Xbal site of pCt vector generating pCt-TPS1 (Figure 2B). For the nuclear
transformation, the
yeast TPSI gene was inserted into the pHGTPS 1 vector in which the TPS 1 gene
is driven by the
6 CaMV 3 5 S promoter. The resulting vector confers hygromycin resistance
because of the hygromycin
phosphotransferase gene driven by the NOS promoter.
Chloroplast and nuclear transformation: For chloroplast transformation,
particle bombardment
was carried out using a helium driven particle gun, Biolistic PDH 1000.
Briefly, chloroplast vectors,
pCt and pCt-TPS 1 were delivered to tobacco leaves (Burley) using 0.6 g,m gold
microcarriers (Bio-
11 Rad) at 1,100 psi with a target distance of 9 cm. For nuclear
transformation, pHGTPSl was
mobilized into the Acrobactef~ium tumefacier~s strain LBA4404 by
electroporation using Gene Pulsar
(Bio-Rad. USA). The resulting Ags~obacterium strain was used in leaf disc
transformation of wild
type N. tabacum var. xanthi.
Chloroplast DNA isolation and PCR: Total DNA was extracted from leaves of wild
type and
16 transformed plants using CTAB extraction buffer described. PCR was carried
out to confirm
spectinomycin resistant chloroplast tranformants using Peltier Thermal Cycler
PTC-200 (MJ
Research, USA). Three primer sets, 2P(5'-GCGCCTGACCCTG AGATGTGGATCAT-3')-2M(5'-
TGACTGCCCAACCTGAGAGCGGACA-3'), 3P(AAAACCCGTCCTCAGTTCGGATTGC)-
3M(CCGCGTTGTTTCATCA AGCCTTAGG) and -SP(CTGTAGAAGTCACCATTGTTGTGC),
21 SM(GTCCAAGAT AAGCCTGTCTAGCTTC) were used for the PCR. PCR reactions were
carried
out as described elsewhere (Daniell et al., 199; Guda et al., 2000).
RNA isolation and Northern Slot analysis: Total RNA was extracted from
transgenic tobacco
plants using Tri Reagent (MRC, USA) following manufacturer's instruction. For
northern blots,
RNA samples (10 ~,g of total RNA per lane) were electrophoresed on a 1.5%
agarose-MOPS gel
26 containing formaldehyde. Uniform loading and integrity of RNAs were
confirmed by examining the
intensity of ethidium bromide bound ribosomal RNA bands under UV light. RNAs
on the gel were
transferred onto Hybond-N membrane (Amersham, USA). The membrane was
hybridized to
radiolabeled TPS 1 probe and washed at 65°C in a solution of 0.2X SSC
and 0. 1 % SDS for 20 min
twice. The blot was exposed to an X-ray film at -70°C overnight.
Transcripts were quantified using
31 the BiolD++ program with Vilber Lourmat Image Analyzer (Bioprofil, France).
-17-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
1 Western Elot analysis: Tobacco total protein extracts were prepared by
modified methods described
by Ausubel et al. The total extracts were fractionated on a 10% one-
dimensional SDS-PAGE,
transferred to Biotrace PDVF nitrocellulose membrane (Gelman Sciences, USA),
and immunostained
using Renaissance Western Blot Chemiluminescence Reagent (NEN Life Science
Products, USA)
according to manufacturer's instructions. Each lane was loaded with 100 ~g of
total protein. The
6 primary antibody used was anti-TPS 1 at a 5000-fold dilution. The secondary
antibody was anti-
rabbit IgG HRP conjugate at a 2000-fold dilution (Promega, USA).
Drought tolerance and biochemical characterization: For analyses of drought
tolerance, 2-3 week
old transgenic tobacco plants were used. Seeds of chloroplast and nuclear
tranformants were
germinated on MS plates containing 3% or 6% PEG (MW 8,000). TPS1 enzyme assay
was
11 performed spectrophometrically by the method described by Londesbrough and
Vuorio. For
quantitative determination of T6P and trehalose, carbohydrates were extracted
from aerial parts of
transgenic or wild type tobacco plants by treatment in 85% ethanol at
60°C for 1 hour. The amount
of T6P and trehalose were measured by high-performance liquid chromatography
(HPLC) on a
Waters system equipped with a Waters High Performance Carbohydrate Column
(4.6x250 mm) and
16 a refractive index detector. The insoluble phase system was 75%
acetanitrile-25% H20 with a flow
rate of 1.0 mllmin.
-18-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
REFERENCES
Thevelein, J.M. & Hohmann, S. Trehalose synthase: guard to the gate of
glycolysis in yeast? Trends
in Bioscience. 20, 3-10 (1955).
Singer, M.A. & Lindquist, S. Thermotolerance in Saccharomyces cerevisiae: the
Yin and Yang of
trehalose. Trends in Biotech. 16, 460-468 (1998).
Elbein, A.D. The metabolism of a~ trehalose. Adv Carbohyd Chem Biochem. 30,
227-256 (1974).
Maclcenzie, K.F., Singly K.K. & Brwon, A.D. Water stress plating
hypersensitivity of yeast:
11 protective role of trehalose in Saccharomyces cerevisiae. J Gen Microbial.
134, 1661-1666 (1988).
16
21
DeVigilio, C., Hottinger, T., Dominguez, J., Boller, T. & Wielanan, A. The
role of trehalose
synthesis for the acquisition of thermotolerance in yeast 1. Genetic evidence
that trehalose is a
thermoprotectant. Eur J Biochem. 219, 179-186 (1994).
Sharma, S.C. A possible role of trehalose in osmotolerance & ethanol tolerance
in Saccharomyces
cerevisiae. Fems Microbiology Letters. 152, 11-15 (1997).
Crowe J.H., Hoelcstra F.A. & Crowe L.M. Anhydrobiosys. Annu Rev Physiol. 54,
579-599 (1992).
Bianchi, G. Gamba, A. & Limiroli, R. The unusual sugar composition in leaves
of the resurrection
plant Myrothamnus flatbellifolia. Physiol Plantarum. 87, 223-226 (1993).
Drennan, P.M., Smith, M.T., Goldsworthy, D. & Van Staden, J. The occurrence of
trehalose in the
26 leaves of the desiccation-tolerant angiosperm Myrothamnus flabellifolius
Welw. J. Plant Physiol.
142, 493-496 (1993).
Colaco, C. Sen. S. Thangavelu, M., Pinder, S. & Roser, B. Extraordinary
stability of enzymes dried
in trehalose: simplified molecular biology. Biol technology, 10, 1007-1011
(1992).
31
Iwahashi, H., Obuchi, K., Fujii, S. & Komatsu, Y. The correlative evidence
suggesting thattrehalose
stabilizes membrane-structure in the yeast Saccharomyces cerevisiae. Cell.
Mol. Biol. 41, 763-769
(1995).
36 Holmstrom, K.O., Mantyla, M., Welcin, B., Mandal, A., Palva. E.T., Tunnela,
O.E. &
Londesborough, J. Drought tolerance in tobacco. Nature. 379, 683-684 (1996).
Goddijyn, O.J.M., Verwoerd, T.C., Voogd, E., Krutwagen, W.H.H., ce Graff,
P.T.H.M., Poels, J.,
van Dun, K., Ponstein, A.S., Damm, B. & Pen, K. Inhibition oftrehalase
activity enhances trehalose
41 accumulation in transgenic plants. Plant Physiol. 113, 181-190 (1997).
46
Romero, C., Belles, J.M., Vaya, J.L., Serrano, R. & Culianz-Macia, F.A.
Expression of the yeast
trehalose-6-phosphate synthase gene in transgenic tobacco plants: pleiotropic
phenotypes include
drought tolerance. Planta. 201, 293-297 (1997).
-19-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
Serrano, R., Culianz-Macia, F.A. & Moreno, V. Genetic engineering of salt & dr
ought tolerance with
yeast regulatory genes. Scientia Horticulture 78:261-269.
During K. Hippe S. Kreuzaler F, Schell J (1990) Synthesis and self assembly of
a functional
monocionalantibodyintransgenicNicotianatabacum. Plant Molecular Biology. 15,
281-293 (1999).
Daniell, H. & Guda, C. Biopolymer production in microorganisms and plants.
Chemistry and
industry. 14, 555-560 (1997).
Nuccio, M.L., Rhodes, D., McNeil, S.D. & Hanson, A.D. Metabolic engineering of
plants for osmotic
11 stress resistance. Crrunt opinion in plant biology 2: 128-134 (1999).
Daniell, H. New tools for chloroplast genetic engineering. Nat. Biotechnol..
17, 855-856. (1999).
Daniell, H. GM crops: Public perception and scientific solutions. Trends in
Plant Science. 4, 467-469
16 (1999).
Daniell, H. Environmentally friendly approaches to genetic engineering. In
vitro Cellular and
Developmental Biology-Plant. 35, 361-368 (1999).
21 Daniell, H. Genetically modified food crops: current concerns and solutions
for the next generation
crops. Biotechnology and Genetic Engineering Reviews, 17, in press.
Hoyle, B. Canadian farmers seek compensation for genetic pollution. Nat.
Biotechnol 17, 747-748
(1999).
26
Finnegan J. & McElroy, D. Transgene Inactivation: Plants fight back.
Biotechnology. 12, 883-888
(1994).
Kota, M., Daniell, H., Varma, S., Garcynski, F., Gould. F. & Morar, W.J.
Overexpression of Bacillius
31 thuringiepsis Cry2A protein in chloroplasts confers resistance to plants
against susceptible and Bt
resistant insects. Proc Natl Acad Sci USA. 96, 1840-1845 (1999).
36
Daniell, H., Data, R., Vanna, S., Gray, S.&Lee, S.-B. Containment of herbicide
resistance through
genetic engineering of the chloroplast genome. Nature Biotech. 16, 345-348.
(1998).
Scott. S.E. & Wilkinson, M.J. Low probability of chloroplast movement from
oilseed rape (Brassica
napus) into wild Brassica napa. Nat. Biotechnol. 17: 390-392. (1999).
Brixey,. P. J. Guda, C. & Daniell, H. The chloroplast psbA promoter is more
efficient in E.coli than
41 the T7 promoter for hyper-expression of a foreign protein. Biotechnology
letters. 19, 2395-399
(1997).
Guda, G., Lee, S-B., & Daniell, H. Stable expression of a biodegradable
protein-based polymer in
tobacco chloroplasts. Plant Cell Reports 18, (1999).
46
-20-
CA 02401855 2002-09-03
WO 01/64850 PCT/USO1/06271
Daniell, H. Transformation and foreign gene expression in plants mediated by
microprojectile
bombardment. Meth. Mol. Biol. 62, 453-488 (1997).
Roser, B. & Colaco, C.A sweeter way to fresher food New Scientist. 138, 24-28
(1993).
6 Sambrook. J., Maniatis, T. & Fritsch, E.J. Molecular Cloning: A Laboratory
Manual. Cold Spring
Harbor Laboratory, Cold Spring Harbor, N.Y. (1989).
11
Dellaporta, S.L., Wood, J. & Hiclcs, J.B. A plant DNA minipreparation: Version
II. Plant Mol Biol
Rep. 1, 19. (1983).
Ausubel, F., Brent, R., Kingston, R.E., Moore, D.D., Sediman, J.G., Smith,
J.A. & Struhl, K. Short
protocols in molecular biology. Wiley and Sons, Inc. USA (1995).
Londesbrough, J. & Vuorio, O. Trehalose-6 phosphate synthaselphosphat-ase
complex from baker's
16 yeast: purification of a protelytically activated form. J. Gen.
Microbiology. 137, 323-330 (1991).
Herbicide Resistance Crops, Agricultural, Enviromnental, Economic, Re~ulatom
and Technical
Aspects, Dulce, S.O., edt., CRC Press, Inc. (1996).
21 Herbicide Resistance in Plants, Biolo~y and Biochemistry, Powles, S.B., and
Holtum, J.A.M.,
eds., CRC Press, Inc. (1994).
26
Peptides: Design, Synthesis, and Biological Activity, Basava, C. and
Anantharamaiah, G.M., eds.,
Birkhauser Boston, 1994.
Protein Folding: Deciphering the Second Half of theGenetic Code, Gierasch,
L.M., and King, J.,
eds., American Association For the Advancement of Science (1990).
-21-
