Note: Descriptions are shown in the official language in which they were submitted.
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
EXPRESSION OF AN ANTIMICROBIAL PEPTIDE VIA THE
PLASTID GENOME TO CONTROL
PHYTOPATHOGENIC BACTERIA
RELATED APPLICATIONS
This patent application claims the benefit of U.S. Provisional Application No.
601185,662, filed 2/29/00. This application is here incorporated by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
The work of this invention is supported in part by the USDA-NRICGP grants 95-
82770,
97-35504 and 98-0185 to Henry Daniel!.
FIELD OF INVENTION
This application pertains to the field of genetic engineering of plant
genomes, particularly
plastids, and to methods of and engineered plants that express antimicrobial
peptides that lead to
and result in phytopathogenic bacteria resistance.
DESCRIPTION OF RELATED ART
Zasloff, in U.S. patent 5,643,876 and 4,810,777, entitled "Biologically Active
Synthetic
Magainin Peptides" and "Antimicrobial Compounds," described a family of
synthetic
compounds termed "magainin which are capable of inhibiting the growth or
proliferation of
gram-positive and gram negative bacteria, fungi, virus, and protozoan species.
Haynie, in U. S. patent 5,847,047, entitled "Antimicrobial Composition of
Polymer and a
Peptide Forming Amphiphilic Helices of the Magainin-Type," offers a series of
non-natural
oligopeptides that share a common amino acid sequence referred to as the core
oligopeptide.
Such core oligopeptide has antimicrobial effects. The patent also provides N-
addition analogues
to the core oligopeptide that exhibit higher antimicrobial effects.
Olsen et. al., in U. S. patent 6,143,498, entitled "Antimicrobial Peptide,"
proposed a
method of producing human antimicrobial peptides from the defensin superfamily
through
transformation of host cells. Olsen suggested the production of these defensin-
related peptides
through transformation of host cells with vectors containing the isolated DNA
molecules of the
peptides.
I~im, et. al., in U. S. patent 6,183,992, entitled "Method For Mass Production
Of
Antimicrobial Peptide," offered a method of mass producing an antimicrobial
peptide. In
particular, a fusion gene - containing a basic antimicrovial peptide which
ligated directly or
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
indirectly to a negatively charged acidic peptide having at least two cysteine
residues - is cloned
into an expression vector targeted toward microorganisms such as E. Coli.
All patents and publications are hereby incorporated by reference in their
entireties.
BACKGROUND OF THE INVENTION
Plant diseases caused by bacterial pathogens have had a detrimental effect on
global crop
production for years. Between 1979 and 1980 India lost up to 60% of its rice
crop due to bacterial rice
blight. Between 1988 and 1990, there was a 10.1% loss of the global barley
crop due to bacterial
pathogens, worth $1.9 billion (Baker et al., 1997). In the United States,
there was an estimated 44,600
metric ton reduction of soybean crops due to bacterial pathogens in 1994
(Wrath et al., 1996). On the
average, pathogens are responsible for a 12-13% reduction of global crop
production each year
(Dempsey et al., 1998).
A prior effort to combat these devastating pathogens is plant breeding
(Mourgues et al., 1998).
The results were limited due to the ability of the bacteria to adapt and find
a way around the defense
mechanism. Agrochemicals have also been used but their application is limited
by their toxicity to
humans and the environment (Mourgues et al., 1998).
Plant Defense Against Pathogens: Many of the pathways and products in the
plant response to
phytopathogens have been elucidated with the emergence of molecular biology.
The plant defense
response can be divided into 3 major categories, early defense (fast), local
defense (fast/intermediate)
and systemic defense (intermediate to slow) (Mourgues et al., 1998). During
the early stage, the plant
cell is stimulated by contact with pathogen-produced elicitors. Bacterial
genes such as hrp
(hypersensitive response and pathogenicity) or avr (avirulence) genes
stimulate the plant defense
mechanism (Baker et al., 1997). The most prominent early defense response is
the HR (hypersensitive
response), which leads to cellular death reducing further infection by the
pathogen. Local defense
entails cell wall reinforcement, stimulation of secondary metabolite pathways,
synthesis of thionins and
synthesis of PR (pathogenesis-related) proteins (Mourgues et al., 1998). The
final phase is known as
SAR (systemic acquired resistance), which protects the uninfected regions of
the plant.
Engineering Resistance: Genetic engineering has allowed for some enhancement
of natural defense
genes from plants by cloning and over-expression in non-host plants. Cloning
of resistance (R) genes
has been used to protect rice from bacterial leaf blight (Mourgues et al.,
1998). Pathogenesis-related
(PR) genes have been cloned from barley and have shown to provide resistance
to P. syringae pv.
tabaci (Mourgues et al., 1998). Anti-fungal peptides produced by various
organisms have been cloned
and studied. However, although anti-fungal development has been promising,
bacteria still maintain
the ability to adapt to plant defenses.
2
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
Those skilled in the art will be familiar with antimicrobial peptides.
Examples of some of these
substances include PGLa (frog skin), defensins (human phagocytes), cecropins
(Silkmoth pupae or pig
intestine), apidaecins (honeybee lymph), melittin (bee venom), bombinin (toad
skin) and the magainins
(frog skin). Specifically bactericidal peptides include large polypeptides
such as lysozyme (MW 15000
daltons) and attacins (MW 20-23,000 daltons) as well as smaller polypeptides
such as cecropin (MW
4000 daltons) and the magainins (MW 2500 daltons). The spectrum of biocidal
activity of these
peptides is somewhat correlated to size. In general, the large polypeptides
are active against limited
types and species of microorganisms (e.g., lysozyme against only gram positive
bacteria), whereas
many of the smaller oligopeptides demonstrate a broad spectrum of
antimicrobial activity, killing many
species of both gram positive and gram negative bacteria. It has been shown
that magainin, cecropins,
and bombinin oligopeptides form similar secondary structures described as an
amphiphilic helix
(K iser et al. Annu. Rev. Biophys. Biophys. Chem 16, 561-581, 1987). These
peptides with a-helical
structures are ubiquitous and found in many organisms. They are believed to
participate in the defense
against potential microbial pathogens. One of the first biocidal oligopeptides
to be isolated from
natural sources was bombinin and is described by Csordas et al. (Proc. Int.
Symp. Anim. Plant Toxins,
2, 515-523, (1970)). Csordas teaches significant sequence homology between
bombinin and melittin,
another antimicrobial peptide, isolated from bee venom.
Specifically, the role of magainins from ~enopus laevis (African frog) and its
analogues have
been investigated by Zasloff et al. (WO 9004408) as pharmaceutical
compositions such as a broad-
spectrum topical agent, a systemic antibiotic; a wound-healing stimulant; and
an anticancer agent
(Jacob and Zasloff, 1994). Cuervo et al. (WO 9006129) describe the preparation
of deletion analogues
of magainin I and II for use as pharmaceutical compositions. They disclose a
general scheme for the
synthetic preparation of compounds with magainin-like activity and structure.
However, the possible
agricultural use of magainin-type antimicrobial peptides has not yet been
explored. Accordingly, it is
an objective of this invention to demonstrate the conference of
phytopathogenic bacteria resistance to
plants by transforming plant cell plastids to express magainin and its
analogues.
Plastid Transformation: To date, plastid transformation, particularly has
enabled generation of
herbicide (Daniell et al., 1998), insect resistant crops (Kota et al., 1999;
McBride et al., 1995; DeCosa
et al., 2000) and production of pharmaceutical proteins (Guda et al., 2000;
Staub et al., 2000). Plastid
transformation was selected because of several advantages over nuclear
transformation (Daniell, 1999
A, B; Bogorad, 2000; Heifetz, 2000). With concern growing about outcrossing of
genetically altered
genes, it should be noted that plastid expressed genes are maternally
inherited in most crops. Gene
containment is possible when foreign genes are engineered via the plastid
genome, which prevents
pollen transmission in crops that maternally inherit the plastid genome.
Because a majority of crop
plants inherit their plastid genes maternally, the foreign genes do not escape
into the environment.
3
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
Although pollen from plants that exhibit maternal inheritance contain
metabolically active plastids, the
plastid DNA is lost during pollen maturation (Helfetz, 2000). Despite the
potential advantage of plastid
reproduction of AMPS, it was not obvious that AMPs would be produed in this
manner. Prior to the
patent application there were no published reports of expression of AMPs in
plant plastids.
Non-obviousness of the disease resistance. Several foreign genes have been
expressed within
plastids to introduce novel traits including herbicide resistance or insect
resistance. However, all
of these foreign proteins, without exception, function within plastids. For
example, hexbicides
target proteins or enzymes present within plastids. When engineered plastids
are consumed by
target insects, insecticidal proteins are released inside the insect gut.
However, in order to use the chloroplast compartment to engineer disease
resistance, it
was necessary to export foreign proteins into the cytosol where phytopathogens
colonize.
Therefore, it was not obvious to engineer the~lastid genome to confer disease
resistance. There
are no prior reports or suggestions in the literature that plastid genome
could be engineered to
confer disease resistance. Also, it is known in the art that antimicrobial
peptides are toxic to
plant chloroplasts because of the charge on the chloroplast membranes.
However, this invention
teaches that transgenic plastids expressing antimicrobial peptides rupture at
the site of infection
upon cell death. Release of large amounts of the antimicrobial peptide prevent
the spread of the
phytopathogen. Thus, the present invention confirms a novel and unobvious
solution to combat
phytopathogens that is previously unknown and contrary to all current
understanding of
chloroplast biology.
Most importantly, small peptides are not stable inside living cells and are
highly
susceptible to proteolytic degradation. For this reason, small peptides are
usually produced as
fusion proteins with larger peptides in biological systems. Megainin type
peptides are
chemically synthesized and never made in biological systems for that reason.
Therefore, it was
not obvious to express a small peptide of a few amino acids within plastids.
Successful
expression of this antimicrobial peptide was not anticipated but this
invention opens the door for
expression of several small peptides within plastids, including hormones.
SUMMARY OF THE INVENTION
This invention provides a new option in the battle against phytopathogenic
bacteria
through transformation of the plant plastid genome. The present invention is
applicable to all
plastids of plants. These include chromoplasts which are present in the
fruits, vegetables and
flowers; amyloplasts which are present in tubers like the potato; proplastids
in roots; leucoplasts
and etioplasts, both of which are present in non-green parts of plants. All
known methods of
4
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
transformation can be used to introduce the vectors of this invention into
target plant plastids
including bombardment, PEG Treatment, Agrobacterium, microinjection, etc.
This invention provides plastid expression constructs which are useful for
genetic
engineering of plant cells and which provide for enhanced expression of a
foreign peptide in
plant cell plastids. The transformed plant is preferably a metabolically
active plastid, such as the
plastids found in green plant tissues including leaves and cotyledons. The
plastid is preferably
one which is maintained at a high copy number in the plant tissue of interest.
The plastid expression constructs for use in this invention generally include
a plastid
promoter region and a DNA sequence of interest to be expressed in transformed
plastids. The
DNA sequence may contain one or a number of consecutive encoding regions, one
of which
preferably encoding an antimicrobial peptide of the magainin family. Plastid
expression
construct of this invention is linked to a construct having a DNA sequence
encoding a selectable
marker which can be expressed in a plant plastid. Expression of the selectable
marker allows the
identification of plant cells comprising a plastid expressing the marker
In the preferred embodiment, transformation vectors for transfer of the
construct into a
plant cell include means for inserting the expression and selection constructs
into the plastid
genome. This preferably comprises regions of homology to the target plastid
genome which
flank the constructs.
The plastid vector or constructs of the invention preferably include a plastid
expression
vector which is capable of importing phytopathogenic bacteria resistance to a
target plant species
which comprises an expression cassette which is described further herein. Such
a vector
generally includes a plastid promoter region operative in said plant cells'
plastids, a DNA
sequence which encode at least an antimicrobial peptide of the magainin
family. Preferably,
expression of one or more DNA sequences of interest will be in the transformed
plastids.
The preferred embodiment of the invention provides a universal plastid vector
comprising a DNA construct. The DNA construct includes a 5' part of a plastid
spacer
sequence; a promoter, such as Prrn, which is operative in the plastid of the
target plant cells; a
heterologous DNA sequence encoding at least one antimicrobial peptide of the
magainin family;
a gene that confers resistance to a selectable marker such as the aadA gene; a
transcription
termination region functional in the target plant cells; and flanking each
side of the expression
cassette, flanking DNA sequences which are homologous to a DNA sequence of the
target
plastid genome, whereby stable integration of the heterologous coding sequence
into the plastid
genome of the target plant is facilitated through homologous recombination of
the flanking
sequence with the homologous sequences in the target plastid genome. The
vector may further
comprise a ribosome binding site (rbs), a 5' untranslated region (5'UTR). A
promoter, such as
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
psbA, accD or l6srRNA, is to be used in conjunction with the 5'UTR. In
addition to the
encoding region of the antirnicrobial peptide, the heterologous DNA sequence
of the DNA
construct may also include other genes whose expression are desired.
In another embodiment of the invention, non-universal plastid vectors such as
pUC,
S pBlueScript, pGEM may be used as the agent to insert the DNA construct
This invention provides transformed crops, like solanaceous, monocotyledonous
and
dicotyledonous plants, that are resistant to phytopathogenic bacteria.
Preferably, the plants are
edible for mammals, including humans. These plants express an antimicrobial
peptide at levels
. high enough to provide upwards of 96% inhibition of growth against
Pseudomonas syringae, a
major plant pathogen. The transformed plants do not differ morphologically
from untransformed
plants.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. (A) Chloroplast vector used for transformation of Nicotiana tabacum
var. Petit
Havana. Vector contains the aadA selectable marker gene that confers
resistance to
spectinomycin, the Prrn promoter, and the TpsbA terminator. (B) Amino acid
sequence of the
lytic peptide MSI-99.
Figure 2. (A) Phenotype of To and Tltransgenic plants. Plantsl-3 are To
transgenic plants while
plant 4 is untransformed. Plants 5-7 are T~ transgenic plants. Seedlings
germinated on
MSO+SOO~g/ml spectinomycin (B). Three Tl transgenic lines (1-3) and Control
(4).
Figure 3. (A) Primers, 8P and 8M used to confirm integration of foreign genes
via PCR. 8P
anneals with the Send of the aadA gene and 8M anneals with the 3'end of the
16S rDNA gene.
PCR analysis of DNA extracted from To (B), TI (C) and Tz (D) plants run on a
0.8% agarose gel.
To (B) Lane 1 lkb ladder, 2 through 5 transgenic lines, 6 MSI-99 plasmid. T1
(C) Lane 1, lkb
ladder, 2 through 4 transgenic, lane 5 plasmid control and lane 6
untransformed plant DNA. T2
(C) lane 1, lkb ladder, 2 through 5 txansgenic, lane 6 plasrnid control and
lane 7 untransformed
plant DNA.
Figure 4. Southern analysis of To and Tl generations. (A) Probe used to
confirm integration of
foreign genes. The 2.3kb probe fragment was cut with BamHI and NotI containing
the flanking
sequence. (B) Lane 2-6 To transgenic lines, lane 1 untransformed and Lane 7
plasmid DNA. (C)
Lanes 2-7 Tl transgenic lines, Lane 1 untransformed and Lane 8 plasmid DNA.
Figure 5. Ira situ bioassays. 5 to 7mm areas of To transformants and
untransformed Petit Havana
leaves were scraped with fine grain sandpaper. Ten ~,l of 8x105, 8x104, 8x103
and 8x102 cells
from an overnight culture of P. syringae were added to each prepared area.
Photos were taken 5
days after inoculation
6
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
Figure 6. In vitro bioassays for To, T1 and Ta generations of 3 transgenic
lines (10A, 11A and
13A). Five p1 of bacterial cells from an overnight culture were diluted to
(A6oo 0.1-0.3) and
incubated for 2 hours at 25°C with 100~,g of total plant protein
extract. One rnl of LB broth was
added to each sample. Samples were incubated overnight at temperature
appropriate for the
specific bacteria. Absorbance at 600nm was recorded. Data was analyzed using
GraphPad
Prism. Negative control was untransformed plant extract. Buffer only Was added
as a control
and stock culture was used as a reference point.
Figure 7. In vitro bioassays for P. aeruginosa. Five p1 of bacterial cells
from an overnight
culture were diluted to (A6oo 0.1-0.3) and incubated for 2 hours at
25°C with 100pg of total
protein extract from Tl plants. One ml of LB broth was added to each sample.
Samples were
incubated overnight at 37°C. Absorbance at 600nm was recorded. Data was
analyzed using
GraphPad Prism. Negative control was an untransfornzed plant extract. Buffer
only was added
as a control and stock culture was used as a reference point.
Figure 8. Five ~l of an overnight culture of P. sy~ingae diluted to (A6oo 0.1-
0.3) was mixed with
100~g total protein extract from T2 lines 1 1A and 13A (germinated in the
absence of
spectinomycin). After 2-hour incubation, lml of LB broth was added to the
mixture and
incubated over night at 27°C. The following morning absorbance at 600"m
was recorded (A). In
parallel, SOp,I of each mix was plated onto LB plates and incubated overnight
at 27°C. The next
morning a count of viable CFUs were made using the Bio Rad Gell Dock (B).
DETAILED DESCRIPTION OF THE INVENTION
This invention demonstrates the confering of phytopathogenic resistance in
plants through
plastid transformation. This invention includes the use of all plastids in
plants, including chloroplasts,
chloroplasts which are present in fruits, vegetables and flowers, amyloplasts
which are present in
ZS tubers, proplastids in roots, lencoplasts in non-green parts of plants. In
a preferred embodiment of the
invention, the chloroplast genome is used. Plastid transformation and
expression vectors comprising
heterologous DNA encoding magainin and its analogues are provided . The anti-
microbial peptide
(AMP) used in this invention is an amphipathic alpha-helix molecule that has
an affinity for negatively
charged phospholipids commonly found in the outer-membrane of bacteria. Upon
contact with these
membranes, individual peptides aggregate to form pores in the membrane,
resulting in bacterial lysis.
Because of the concentration dependent action of the AMP, it was expressed via
the plastid genome to
accomplish high dose delivery at the point of infection. PCR products and
Southern blots confirmed
plastid integration of the foreign genes and homoplasmy. Growth and
development of the transgenic
plants was unaffected by expression of the AMP within the plastids. In vitro
assays with To, T~ and Tz
plants, confirmed the AMP was expressed at levels high enough to provide
86%(To), 88%(T~) and
7
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
96%(Tz) inhibition of growth against Pseudomohas syrihgae, a major plant
pathogen. In situ assays
resulted in intense areas of necrosis around the point of infection in control
leaves, while transformed
leaves showed no signs of necrosis. Even when germinated in the absence of
spectinomycin selection,
Tz generation plants showed 96% inhibition of growth against P.syringae.
MSI-99 is an analogue of a naturally occurring peptide (magainin 2) found in
the skin of the
African frog. Changes have been made to the amino acid sequence to enhance its
lytic abilities.
Contrary to the prior knowledge in the art which proposed that anti-microbial
peptides having high
antibacterial activity also have a high potential for toxic activity against
the plastid (Everett and
Nicholas, 1994), the transgenic plants of this invention grew, flowered and
set seeds like the
untransformed control.
Key features of cationic peptides such as MSI-99 are a net positive charge, an
affinity for
negatively charged prokaryotic membrane phospholipids over neutral-charged
eukaryotic membranes,
and the ability to form aggregates that disrupt the bacterial membrane
(Houston et al., 1997; Matsuzaki
et al., 1999; Biggin and Sansom, 1999). Given the fact that the outer membrane
is an essential and
highly conserved part of all bacterial cells, it is highly unlikely that
bacteria would be able to adapt (as
they have against antibiotics) and to resist the lytic activity of these
peptides. In contrast to prokaryotic
membranes, the thylakoid membrane consists of primarily glycolipids and
galactolipids instead of
phospholipids. Monogalactosyldiacylglycerol (MGDG) makes up 50% of membrane
lipid and
digalactosyldiacylglycerol (DGDG) 30% (Siegenthaler et al., 1998). Both of
these lipids are neutral.
An object of this invention is to compartmentalize the expression of the MSI-
99 within the
plastid. Compartmentalization of lytic enzymes is a natural occurrence in
plants.
Compartmentalization serves two purposes: to increase the yield of the peptide
and to deliver the
peptide at the site of the infection. Due to the high copy number associated
with plastid expression, a
larger amount of the peptide is produced. The higher yield is important due to
the concentration-
dependent action of the anti-microbial peptide. Further, the peptide would be
released at the site of
infection during the HR response. When the HR response occurs, cells are
lysed. This disrupts the
osmotic balance and causes plastids to lyse. This would release the peptide at
high concentration
resulting in aggregation and formation of pores in the outer membrane of
bacteria. This aids in the
prevention of the spread of infection by bacteria.
A high level of AMP expression can be expected due to the following reasons.
The nature of
plastids to move from a somatically unstable heteroplasmic state to a state of
homoplasmy itself lends
to high expression (Brock and Hagemann, 2000). The A+T % of MSI-99 is 51.39%,
which is
compatible with the Nicotiaha tobacum plastid 61% A+T content (Bogorad et al.,
1991; Shimada et al.,
1991). Also, published reports from our lab report expression of Cry2A operon
(A+T content of 65%)
at levels as high as 46% total soluble protein (DeCosa et al., 2000).
8
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
MSI-99 was most effective against P, syrihgae, evidenced by total inhibition
of 1000 P.
syringae cells with only 1 gg/1000 bacteria (Smith et al. unpublished data).
Because the lytic activity of
antimicrobial peptides is concentration dependent, the amount of antimicrobial
peptide required to kill
bacteria was used to estimate the level of expression in transgenic plants.
Based on the minimum
inhibitory concentration, it was estimated that transgenic plants expressed
MSI-99 at 21 % of the total
soluble protein. Without the availability of antibody for MSI-99, other direct
methods of protein
estimation were not feasible.
Plastid vectors and plant transformation: The synthetic peptide used in this
invention (MSI-99), is
an analogue of the naturally occurring 23 amino acid peptide, magainin II. MSI-
99 is a 22 amino acid
sequence with an overall charge of +6 as shown in Figure 1. The gene cassette
used for transformation
consisted of the 16S rRNA pxomoter, the aadA gene, which confers resistance to
spectinomycin, the
MS 1-99 gene and the psbA (photosynthetic binding protein) terminator. The
gene construct may
contain, in addition to the MSI-99 gene, another heterologous DNA sequence
coding for a gene of
interest.
Flanking sequences are from the petunia plastid genome as shown in Figure 1A.
Transformation efficiency was much lower (7%) than that observed using the pLD
vector (91%), which
contains tobacco homologous flanking sequences. Other vectors that are capable
of plastid
transformation may be used to deliver the gene cassette into the plastid
genome of the target plant cells.
Such vectors do include plastid expression vectors such as pUC, pBlueScript,
pGEM, and all others
identified by Daniell in US patents number 5,693,507 and 5,932,479. These
publications and patents
are herein incorporated by reference to the same extent as if each individual
publication or patent was
specifically and individually indicated to be incorporated by reference. The
vectors preferably include
a ribosome binding site (rbs) and a 5' untranslated region (5'UTR). A promoter
operably in green or
non-green plastids is to be used in conjunction with the 5'UTR)
The number of transformants from the total number of shoots determined percent
of
transformants. Out of 55 spectinomycin resistant shoots screened, only 4 were
transformants with the
MSI-99 gene and the rest were mutants. All transformants grew healthy with no
apparent
morphological effects to To and Tl, generations as shown in Figure 2A. T1,
seeds germinated in the
presence of spectinomycin produced healthy green seedlings, while control
seedlings were bleached as
shown in Figure 2B.
Foreign gene integration, homoplasmy and copy number: PCR was performed by
landing one
primer on the 5'end of the aadA coding sequence, not present in native plastid
and the 3'end of the 16S
rDNA (Figure 3A). PCR products of To, Tl, and TZ generations yielded the same
size product as the
plasmid (MSI-99) as shown in Figure 3B,C,D confirming integration of the
foreign genes. The probe
9
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
used for the Southern analysis was a 2.3kb fragment from the 5'end of the tmI
(BamHI) to the 3'end of
the l6SrDNA (Notl) (Figure 4A). The plant DNA was digested with BamHI. DNA
from
untransformed plants produced a 3.269kb fragment and transformed plant DNA
produced a 4.65kb
fragment. Southern analysis confirmed integration of foreign genes for To and
Tl, as shown in Figure
4B,C. Untransformed DNA showed a 3.2kb fragment while the transformed
contained a 4.65kb
fragment. Presence of some wild type fragments in To transgenic samples
indicated some heteroplasmy
as shown in Figure 4B. However, DNA from TI, generation produced only the
4.65Kb fragment
confirming homoplasmy. As shown in Figure 4C. A cell is said to be homoplasmic
when all of the
plastid are uniformly transformed. If only a fraction of the genomes was
transformed, the copy number
should be less than 10,000 (Bendich, 1987). By confn~ning that the MSI-99
integrated genome is the
only one present in transgenic plants (homoplasmy), one could estimate that
the MSI-99 gene copy
number could be as many as 10,000 per cell.
Bioassays: To in situ assays in potted plants (6 to 7 months old) resulted in
areas of necrosis
surrounding the point of infection in untransformed control, while transgenic
leaves showed no areas of
necrosis (Figure 5). Even inoculation of 8X105 cells resulted in no necrosis
in transgenic leaves (Figure
5A), suggesting the local concentration of the antimicrobial peptide to be
very high. However,
untransformed plants inoculated with 8x103 cells displayed intense necrosis as
shown in Figure 5B.
Cell free extracts of To, TI, and T2 transgenic plants displayed a strong
ability to inhibit growth
of P. syriugae ih vitf°o by 84%, 86% and 96% compared to untransformed
plants as shown in Figure 6.
The increase in growth inhibition from To to TZ can be attributed to
heteroplasmy in the To generation
that was eliminated in subsequent generations. This indicates the peptides
retained their lytic activity
and successfully passed on the trait to the subsequent generations. The
control had less growth than the
buffer only. This is most probably due to natural defense peptides such as
defensins and thionins
produced by plants (Mourgues et al., 1998). When performing ih vitt°o
bioassays against P, ae~ugifzosa,
results were similar with Tl, generation showing 96% inhibition of growth
(Figure 7).
Absorbance readings as shown in Figure 8A from transgenic plants germinated in
the absence
of spectinomycin, displayed 96% inhibition of growth that is comparable to
transgenic plants
germinated in the presence of spectinomycin. Plated cells of bioassay samples
from TZ plants
germinated in the absence of spectinomycin as shown in Figure 8B showed 83%
inhibition of growth
compared to the control. The marginal degree of difference between the plating
results and the
bioassay results (13%) can be explained by the difference in environment.
While the plated bacteria
were no longer exposed to active peptides, bacteria in the liquid media were
constantly surrounded by
active peptides.
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
Protein Estimation: The plate with 10-5 dilution had 43 CFUs. The equated to
43x106 CFU/ml. The
count was adjusted to reflect the 5~1 of culture used. This resulted in a
count of 21,500 bacterial cells
in the initial 5~1 of culture incubated with the peptide. Using 1 ~g to kill
1000 P. syrihgae cells as the
reference (Smith et al. unpublished data), the estimated expression of MSI-99
was 21.5~g in 100~g
soluble protein (21.5%).
The initial low rate of transformation was most likely due to less than 100%
homology between
the petunia flanking sequences and the tobacco plastid genorne. This is not
surprising because very low
transformation efficiency was also observed when tobacco plastid flanking
sequences were used to
transform potato plastid genome (Sidorov et al., 1999). Also, other projects
in our lab that use the pLD
vector (has tobacco flanking sequences) obtained transformation efficiency of
91 % transforrnants to
mutants. T° and T~ transgenic plants were healthy and showed no
morphological or developmental
abnormalities. Retention of lytic activity was evident in the sharp decrease
in bacterial growth in the i~
vitf°o bioassays (84 to 96%). When comparing Southern blots to lytic
activity, lytic activity increased
as homoplasmy was reached. Equal lytic activity was also observed in
transgenic plants germinated in
the absence of spectinomycin (96% inhibition of growth). Transgenic plants
transferred to potting soil
for 5 to 6 months after being removed from spectinomycin selection, displayed
similar antimicrobial
properties against inoculations of P. syrihgae. These observations eliminate
the possibility that
spectinomycin absorbed into the plant tissue during germinationof seeds, may
be responsible for the
growth inhibition in the in. vitro and ih situ bioassays. Also, the
observation that MSI-99 was equally
active in transgenic plants germinated in the presence or absence of
spectinomycin shows the stability
of the introduced trait in the absence of any selection pressure.
Plastid expression in crops such as tobacco should allow for mass production
of the. peptide at a
lower cost compared to chemical synthesis or production in E. coli. This
invention thus demonstrates
another option in the on going battle against pathogenic bacteria.
The invention is exemplified by the following non-limiting example.
Example 1
Plant transformation: For plant transformation, Nicotiana tabacum var. Petit
Havana seeds were
germinated on MSO media at 27°C with photoperiods of 16 hour light and
8 hour dark. Sterile leaves
were bombarded using the Bio-Rad Helium driven PDS-1000/He System. After
bombardment, leaves
were wrapped and kept in the dark for 48 hours. Leaves were then cut into lcmz
squares and placed on
a petri dish containing RMOP media with 500~g/ml spectinomycin (first round of
selection). Four to
six weeks later, shoots were transferred to fresh media and antibiotic (second
round of selection).
11
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
Shoots that appeared during the second selection were transferred to bottles
containing MSO and
spectinomycin (500pg1m1). Plants were screened via PCR for transformation.
Those that were PCR
positive for the presence of the MSI-99 gene were transferred to pots and
grown in chambers at 27°C
with photoperiods of 16-hour light and 8-hour dark. After flowering, seeds
were harvested and
sterilized with a solution of I-part bleach and 2-part water with 1 drop of
tween-20. Seeds were
vortexed for 5 minutes then washed 6 times with 500p1 of dH20 and dried in
speed vac. T', and
TZSeeds were germinated on MSO + 500~g/mI spectinomycin. Untransformed Petit
Havana seeds were
germinated on the same media as a control to ensure the spectinomycin was
active.
PCR conformation Plant DNA extraction on T°, T~, and T2 was performed
using the QIAGEN
DNeasy Mini Kit on putative transgenic samples and untransfon-ned plants. PCR
primers were
designed using Primer Premier software and made by GIBCO BRL. Primer
(8p:5'ATCACCGCTTCCCTCATAAATCCCTCCC3') anneals with the 5' end of the aadA and
primer
(8M:5'CCACCTACAGACGCTTTACGCCCAATCA3') anneals with the 3' end of l6SrDNA as
shown
in Figure 3. PCR was carried out using the Gene Amp PCR system 2400 (Perkin-
Elmer). Samples
were run for 29 cycles with the following sequence: 94°C for 1 minute,
65°C for 1 minute and 72°C for
3 minutes. The cycles were proceeded by a 94°C denaturation period and
followed by a 72°C final
extension period. A 4°C hold followed the cycles. PCR products were
separated on agarose gels.
Southern analysis: Integration of foreign genes for T° and Tl, was
determined by Southern blot
analysis. DNA from transformed and untransformed plants was digested with
BamHI and run on a
0.7% agarose gel. The DNA was then transferred to a nylon membrane by
capillary action. The probe
was digested with BamHI and Notl and was labeled with 32 P using the Probe
QuantTM G-50 Micro
Colurnris and protocol (Amersharn). Labeled probe was hybridized with the
nylon membrane using the
Stratagene QUICK-HYB hybridization solution and protocol. Membrane was exposed
to film, and
developed.
I~ vitro bioassay: P. sy~ihgae and P.aerugihosa were cultured overnight prior
to the assay. 50 mg of
leaf tissue (minus mid-rib) was grounded in a micro-centrifuge containing 1501
of phosphate buffer
pH5.5 with 5mM PMSF and 5mM with a plastic pestle. Samples were centrifuged
for 5 minutes at
10,000x g at 4°C. Supernatant was transferred to a fresh tube and kept
on ice. Protein concentration
was determined by Bradford assay. One hundred pg of total plant protein was
mixed with 5p1 of
bacteria from overnight culture in a falcon tube. Initial absorbency ranged
from 0.1 to 0.3 (A6°°). Tubes
were incubated for 2 hours'at 25°C on a rotary shaker at 125rpm. One ml
of LB broth was added and
tubes were allowed to incubate for 18 hours at 27°C for P. sy~ingae and
37°C for P. aenuginosa on a
rotary shaker at 125rpm. Absorbance (A6oo) was read fox each tube. Results
were statistically analyzed
using GraphPad Prism.
12
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
To rule out spectinomycin as the cause of growth inhibition, the same
experiment with P.
syringae was repeated using T~ plants that were geminated on MSO with no
spectinomycin, For
confirmation of the absorption readings, a serial dilution was made of samples
after the initial 2-hour
incubation. Dilutions of 10-3 to 10-5 were plated onto LB plates and incubated
overnight at 27°C. The
next morning a count of viable CFUs were made using the Bio Rad Gell Dock.
To estimate the level of protein expression, a serial dilution was prepared
from the starting
bacterial culture (Absorbance6oo, 0.I-0.3) used for the Irc vitro bioassay.
Fifty plof each dilution was
plated on LB medium and incubated overnight at 27°C. The following
morning, CFUs were counted
using the Bio Rad Gel Dock and the amount of cells used in the bioassay was
calculated. The
minimum inhibitory concentration of Igg/1000 P.syf~irzgae cells was used to
determine antimicrobial
peptide concentration in 100~.g of cell free plant extracts.
1h situ bioassay: P. syrircgae was cultured overnight prior to the assay. Five
to seven mm areas
of T° transformants and untransformed Petit Havana leaves were scraped
with fine grain
sandpaper. Ten p1 of 8x105, 8x104, SXI03 and 8x102 cells from an overnight
culture of P.
syringae were added to each prepared area. Photos were taken 5 days after
inoculation.
REFERENCES
Baker B, Zambryski P, Staskawicz SP, Dinesh-Kumar. (1997) Signaling in Plant-
Microbe
Interactions. Science.276: 726-723
Bendich A.J. (1987) Why do chloroplasts and mitochondria contain so many
copies in their genome?
BioEssays. 6: 279-282.
Biggin P, Sansom M. (1999) Interactions of (X-helices with lipid bilayers: a
review of simulation
studies. Biophysical Chemistry. 76.: 161-183
Bock R, Hagemann R. (2000) Extracellular inheritance: Plastid genomics:
Manipulation of plastid
genornes and biotechnological applications. Progress in Botany. 6: 76-90
Bogorad L. (2000) Engineering chloroplasts: an alternative site for foreign
genes, proteins, reactions
and products. TIBTECH 18: 257-263
Bogarad L, Vasil 1. (1991) The Molecular Biolo~y of Plastids. San Diego:
Academic Press, 38
13
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
Cory J, Rajasekaran K, Jaynes J, Cleveland T. (2000) Transgenic expression of
a gene encoding a
synthetic antimicrobial peptide results in inhibition of fungal growth ih
vitro and in planta. Plant
Science. 154: 171-181
Daniell H. (1997) Transformation and foreign expression in plants mediated by
microprojectile
bombardment. Methods in Molecular Biology. 62: 463-489
Daniell H. (1999 A) New tools for plastid genetic engineering. Nat.
Blotechnol. 17: 855-856
Daniell H. (1999 B) GM crops: Public perception and scientific solutions.
Trends in plant science. 4:
467-469
Daniell H, Datta R, Varma S, Gray S, Lee S.B. (1998) Containment of herbicide
resistance through
genetic engineering of the chloroplast genome. Nat. Blotechnol. 16: 345-348
DeCosa B, Moar W, Lee S.B, Miller M, Daniell H. (2000) HyperExpression of the
Cry2Aa2 operon
in chloroplasts leads to the formation of insecticidal crystals. Nat.
Blotechnol. In press
Everett, Nicholas. (1994) Design of Antifun~al~eptides for agricultural
applications. Ed. Hedin,
Paul, Merin, Julius, & Hollingworth, Robert. Washington DC: American Chemical
Society, 278-292
Guda C, Lee S.B., Daniell H. (2000) Stable expression of a biodegradable
protein-based polymer in
tobacco chloroplasts. Plant Cell Reports. 19: 257-262
Heifetz P. (2000) Genetic engineering of the plastid. Blochimie. 82: 655-666
Houston Jr M.E., Kondejewski L, Gough M, Fidal S, Hodges R. S, Hancock R.
(1997) Influence of
performed a-helix and a-helix induction on the activity of cationic
antimicrobial peptides. J.Peptide
Res. 52: 81-88
Jacob L, Zasloff M. (1994) Potential therapeutic applications of magainins and
other antimicrobial;
agents of animal origin. Antirnicrobial peptides. (Ciba Foundation Symposium
186): 197-223
14
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
Kota M, Daniell H, Varma S, Garczynski F, Gould F, Moar WJ. (1999) Over
expression of the
Bacillus thuringiensis Cry2A protein in plastids confers resistance to plants
against susceptible and
Btresistant insects. Proc. Natl. Acad.Sci. USA. 96:1840-1845
Matsuzaki K. (1998) Magainins as paradigm for the mode of action of pore
forming polypeptides.
Biochimica et Blophysica Acta. 1376: 391400
McBride K.E, Svab Z, Schaaf D. J, Hogen P.S, Stalker D.M, Maliga P. (I 995)
Amplification of a
chimeric Bacillus gene in chloroplasts leads to extraordinary level of an
insecticidal protein in tobacco.
Blo/technology 13: 362-36S
Mourgues F, Brisset M.N, Cheveau E. (1998) Strategies to improve plant
resistance to bacterial
diseases through genetic engineering. Trends in Biotechnology. 16: 203-210
Neuhas J, Sticher L, Meins, Jr F, Boller T. (1991) A short C-terminal sequence
is necessary and
sufficient for the targeting of chitinases to the plant vacuole. Proc. Natl.
Acad.Sci. USA. 88: 10362-
10366
Shimada H, Sugiura M. (1991) Fine structural features of the plastid genorne:
comparison of the
sequenced chloroplast genomes. Nucleic Acids Research 19: 983-995
Sidorov V, Kasten D, Pang S, Hajdukiewicz P, Saub J, Nehra N. (1999) Stable
chloroplast
transformation in potato: use of green fluorescent protein as a plastid
marker. The Plant Journal. 19:
209-216
Siegenthaler Paul-Andr6, Murata Noria. Ed. (1998) Lipids in Photosynthesis:
Structure, Function
and Genetics. Boston: Kluwer, 1-52, 119-144.
Staub J, Garcia B, Graves J, Hajdukiewicz P, Hunter P, Nehra N, Paradkar V,
Schlittler M,
Carroll J, Saptola L, Ward D, Ye G, Russell D. (2000) High-yield production of
a human therapeutic
protein in tobacco chloroplasts. Nat. Biotechnol. 18: 333-338.
Tumnieler B, Kiewitz C. (1999) Cystic Fibrosis: an inherited ibility to
bacterial infections. Molecular
Medicine Today. 5: 3 5 1-358
15
CA 02401957 2002-09-03
WO 01/64927 PCT/USO1/06287
Utsugi T, Schroit A, Connor J, Bucana C, Fidler L. (1991) Elevated expression
of
phosphatidylserine in the outer leaflet of human tumor cells and recognition
by activated human blood
monocytes. Cancer Res. 51: 3062-3066
Wrath J.A, Anderson T. R, Arsyad D.M, Gai J, Ploper L. D, Portapuglia A, Ram
H. H, Yorinori
J T.. (1996) Soybean Disease Loss Estimates for the Top 10 Soybean Producing
Counties in 1994.
Plant Disease. 81: 107-110
16
