Note: Descriptions are shown in the official language in which they were submitted.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
CELL PROLIFERATION ASSAY'
FIELD OF THE INVENTION
The invention relates generally to cell proliferation and more particularly to
cell proliferation assays using a luciferase.
BACKGROUND
Control of cell proliferation is important in all multicellular organisms.
Typically, cell number is determined, directly, by microscopic or electronic
enumeration, or indirectly, by the use of chromogenic dyes, incorporation of
radioactive precursors or measurement of metabolic activity of cellular
enzymes.
r
'These methods are often insensitive, labor intensive, or hazardous. For
example,
measurement of cell proliferation generally involves the incorporation of a
labeled
nucleoside into genomic DNA. Examples include the tritiated thymidine (3H-dT)
and
bromodeoxyuridine (Brdl~ methods. These techniques are of limited
applicability,
however, because of radiation induced DNA damage with the former and
toxicities of
nucleoside analogues with the latter.
~ne colorimetric assay is based on the cellular conversion of a tetrazolium
salt
into a blue formazan product that is detected using a ELISA plate reader
(Mossmann
T., J. Immunol, Meth. X5:55-63, 1983). Despite numerous attempts to reduce
several
technical problems related to this method (e.g., protein precipitation and
incomplete
solubilization of the formazan product), the assay is time consuming and
requires the
use of highly toxic materials (e.g., dimethyl formamide and thiazoyl blue).
There has been considerable interest recently in replacing radioactive labels
used in analytical assays with other types of labels, such as luminescent
labels. Firefly
luciferase is one molecule that has been proposed for use as such labels.
However,
firefly luciferase suffers from a number of deficiencies that make this
molecule less
than optimal in biological assays. For example, ATP is required as an energy
source
in the firefly luciferase system, and the ubiquitous nature of ATP makes
control of
this variable difficult.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
2
Indirect methods have also been used in specific cases. Recent interest in
CD4+ T lymphocyte turnover in AIDS, for example, has been stimulated by
indirect
estimates of T cell proliferation based on their rate of accumulation in the
circulation
following initiation of effective anti-retroviral therapy (Ho et al., 1995,
Nature
373:123-I26; Wei et al., 1995, Nature 73:117-122). Unfortunately, such
indirect
techniques, which rely on changes in pool size, are not definitive. For
example, the
increase in the blood T cell pool size may reflect redistribution from other
pools to
blood rather than true proliferation. In the absence of direct measurements of
cell
proliferation, it may not be possible to distinguish between these and other
alternatives.
Measurement of cell proliferation is of great diagnostic value in diseases
such
as cancer. Anti-cancer therapies aim to reduce tumor cell growth, which can be
determined by whether tumor DNA is being synthesized or whether it is being
broken
down. Currently, the efficacy of therapy, whether chemotherapy, irnmunologic
therapy or radiation therapy, is evaluated by indirect and often imprecise
methods
such as observation of apparent size of a tumor by x-ray. Efficacy of therapy
and
rational selection of combinations of therapies could be most directly
determined on
the basis of an individual tumor's biosynthetic and catabolic responsiveness
to various
interventions. One model used for bacterial infections in clinical medicine
includes
the culture of an organism and determination of its sensitivities to
antibiotics followed
by selection of an antibiotic to which the organism is sensitive can be used
for cancer
therapy as well. However, current management practices proceed without the
ability
to determine directly how well therapeutic agents are working.
A long-standing vision of oncologists is to be able to select chemotherapeutic
agents similar to the way antibiotics are chosen, e.g., on the basis of
measured
sensitivity of tumor cells to a drug. The ability to measure cancer cell
proliferation
would place chemotherapy drug selection and research on an equal basis as
antibiotic
selection, with great potential for improved outcomes.
The Re~illa, also known as sea pansies, belong to a class of coelenterates
known as the anthozoans. In addition to Rehilla, other representative
bioluminescent
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
3
genera of the class Anthozoa include Cavarnularia, Ptilosarcus, Stylatula,
Acanthoptilum, and Parazoanthus. All of these organisms are bioluminescent and
emit light as a result of the action of an enzyme (luciferase) on a substrate
(luciferin)
under appropriate biological conditions. Prior studies have demonstrated that
all of the
above-mentioned anthozoans contain similar luciferases and luciferins (See,
for
example, Cormier et al., J. Cell. Physiol. (1973) 81: 291-298). The
luciferases and
luciferins from each of these anthozoans crossreact with one another to
produce the
characteristic blue luminescence observed in Renilla extracts. Each of these
luciferases has similar biochemical properties, and the biochemical
requirements for
bioluminescence are identical regardless of the anthozoan from which the
luciferase
was derived. The bioluminescence of Renilla luciferase lends itself to use in
research
and in vivo and in vitro assays.
SUMMARY O~' THE IN~'ENTIO1V
The present invention provides a method for determining the effect of an agent
on cell proliferation by contacting a cell containing a Renilla luciferase
polypeptide or
a polynucleotide encoding a Renilla luciferase with an agent suspected of
modulating
cell proliferation under conditions that allow the agent and the cell to
interact; and
comparing the light emission data from the cell to the light emission data
from the cell
in the absence of the agent, wherein a difference in light emission data is
indicative of
an effect on cell proliferation. The cell may be a eukaryotic, a prokaryotic,
or a plant
cell, for example. In one aspect the cell is a cancer cell.
The invention also provides a method for determining cell proliferation of a
cell or population of cells by obtaining light emission data from the cells)
containing
a Renilla luciferase over a period of time wherein a change in light emission
data is
indicative of proliferation or a change in cell number.
The invention further provides a method for determining the effect of an agent
on cell proliferation. The method includes transfecting a cell with a vector
containing
a polynucleotide sequence encoding a Renilla luciferase; contacting the
transfected
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
4
cell with an agent suspected of modulating cell proliferation under conditions
that
allow the agent and the cell to interact; and comparing the light emission
data from
the cell to the light emission data from the cell in the absence of the agent,
wherein a
difference in light emission data is indicative of an effect on cell
proliferation. The
cell can be any cell such as a prokaryotic cell or a eukaryotic cell, e.g., a
mammalian
cell or a human cell. In one aspect the cell is a cancer cell.
The invention also provides a eukaryotic host cell containing an expression
vector encoding Renilla luciferase. For example, the host cell can be any
eukaryotic
or mammalian cell such as a human cell. In one aspect, the cell is a HeLa
cell. In a
further embodiment, the HeLa cell has ATCC accession number X. In yet another
aspect, the cell is a plant cell.
The invention also provides a method of diagnosing a cell proliferative
disorder in a subject or in a population of cells by transfecting a cell
obtained from the
subject with a polynucleotide encoding a Renilla luciferase; obtaining light
emission
data from the cell over a period of time; and comparing the light emission
data from
the cell to light emission data from a cell which does not have a cell
proliferative
disorder, wherein a difference in light emission is indicative of a cell
proliferative
disorder.
Also provided is a method of screening eukaryotic cells to determine their
susceptibility to treatment with an agent. The method includes contacting
cells
containing a Renilla luciferase with an agent and measuring light emissions
from the
cells in the presence and absence of the agent, wherein a difference in light
emissions
is indicative of an agent which affects cell proliferation.
In another embodiment, the invention provides a kit comprising a container
containing a eukaryotic or a plant host cell containing a Renilla luciferase
and
instructions for use of the cell for measuring cell proliferation.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
In another embodiment, the invention provides genetic material encoding
Renilla luciferase. The genetic material can be used to produce the enzyme for
use as
luminescent tags in bioluminescence assays and for other purposes for which
such
labels are desirable. Accordingly, in one embodiment, the invention provides a
vector
containing a polynucleotide sequence encoding a Renilla luciferase for
expression in a
eukaryotic organism or a plant cell.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 (A-B) shows a sequence (SEQ ID Nos:3-5) and (C) a vector map of a
Renilla luciferase.
Figure 2 shows a cell proliferation assay comparing the sensitivity of an MTT
assay to the sensitivity of a luciferase assay of the invention.
Figure 3 shows a cell proliferation assay of a transformed HeLa cell of the
invention compared to an MTT assay of HeLa cells.
Figure 4. shows a graph depicting Rehilla luciferase activity in intact cells.
PBS: a Phosphate Buffered Saline control; NIH3T3: a Renilla luciferase minus
cell
line; and HRL2G6: HeLa cells stably transfected with Renilla luciferase.
Figure S shows a kinetics analysis of stably transfected intact cells
containing
Rehilla luciferase.
Figure 6 shows a graph depicting a proliferation assay of the invention in
intact cells compared with an MTT assay method.
DETAILED DESCRIPTION OF THE INVENTION
As used herein and in the appended claims, the singular forms "a," "and," and
"the" include plural referents unless the context clearly dictates otherwise.
Thus, for
example, reference to "a sample" includes a plurality of samples and reference
to "the
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
6
agent" generally includes reference to one or more agents and equivalents
thereof known
to those skilled in the art, and so forth.
Unless defined otherwise, all technical and scientific terms used herein have
the
same meaning as commonly understood to one of ordinary skill in the art to
which this
invention belongs. Although any methods, devices and materials similar or
equivalent to
those described herein can be used in the practice or testing of the
invention, the
preferred methods, devices and materials are now described.
All publications mentioned herein are incorporated herein by reference in full
for
the purpose of describing and disclosing the databases, proteins, and
methodologies,
which are described in the publications which might be used in connection with
the
presently described invention. The publications discussed above and throughout
the text
are provided solely for their disclosure prior to the filing date of the
present application.
Nothing herein is to be construed as an admission that the inventors are not
entitled to
antedate such disclosure by virtue of prior invention.
The headings and subheadings used herein are for the convenience of the
reader and are not intended to limit the invention.
Renilla luciferase
As used herein, "Renilla luciferase" means a luciferase enzyme isolated from a
member of the genus Renilla or an equivalent molecule obtained from any other
source or obtained synthetically.
The photoprotein aequorin (which consists of apoaequorin bound to a
coelenterate luciferin molecule) and Renilla luciferase both utilize the same
coelenterate luciferin, and the chemistry of light emission in both cases has
been
shown to be the same. However, aequorin luminescence is triggered by calcium
and
represents a single turnover event. In contrast, Renilla luciferase is not
triggered by
calcium and requires dissolved oxygen in order to produce light in the
presence of
coelenterate luciferin. Renilla luciferase also acts as a true enzyme,
catalyzing a long-
lasting luminescence in the presence of saturating levels of luciferin.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
7
Sub-attomole levels of aequorin can be detected with photometers even though
its luminescence represents a single turnover event. Renilla luciferase, due
to its
enzymatic ability, is detectable at levels one to two orders of magnitude
lower than
aequorin. Furthermore, Renilla luciferase is known to be relatively stable to
heat, an
important consideration for assays that often involve incubation at
physiological
temperatures. Accordingly, Renilla luciferase is a desirable tool for
biological and
other assays.
On the other hand, Renilla live on the ocean bottom, about 30 to 100 feet
deep,
and must be collected by dredging. From 1 kg of Renilla (about 1000 individual
animals), approximately 1 mg of pure Renilla luciferase can be obtained
following a
tedious procedure which requires purifying the protein about 12,000 fold. The
purification procedure is described in Matthews et al. (Biochemistry, 1~: 85-
91,
1977). Renilla Iuciferase has been cloned, sequenced and expressed as
described in
U.S. Patent Nos. 5,292,658 and 5,418,155, the disclosures of which axe
incorporated
I S herein by reference. Figures l and 2 of U.S. Patent No. 5,292,658 disclose
the
polynucleotide sequence and corresponding amino acid sequence of a Renilla
luciferase.
Since a polynucleotide sequence of the Renilla Iuciferase has been identified,
it is possible to produce a polynucleotide sequence entirely by synthetic
chemistry,
after which the polynucleotide can be inserted into any of the many available
DNA
vectors using known techniques of recombinant DNA technology. Thus, the
present
invention can be carried out using reagents, plasmids, and microorganisms
which are
freely available and in the public domain at the time of filing of this patent
application
without requiring a deposit of genetic material.
Polynucleotide or nucleic acid sequence refers to a polymeric form of
nucleotides. In some instances a polynucleotide refers to a sequence that is
not
immediately contiguous with either of the coding sequences with which it is
immediately contiguous (one on the S' end and one on the 3' end) in the
naturally
occurring genome of the organism from which it is derived. The term therefore
includes,
for example, a recombinant DNA which is incorporated into a vector; into an
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
8
autonomously replicating plasmid or virus; or into the genomic DNA of a
prokaryote or
eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent
of other
sequences. The nucleotides of the invention can be ribonucleotides,
deoxyribonucleotides, or modified forms of either nucleotide. In addition, the
polynucleotide sequence involved in producing a polypeptide chain can include
regions
preceding and following the coding region (leader and trailer) as well,as
intervening
sequences (introns) between individual coding segments (exons) depending upon
the
source of the polynucleotide sequence. In addition, polynucleotides greater
than 100
bases long can be readily synthesized on an Applied Biosystems Model 380A DNA
Synthesizer, for example.
The term polynucleotide(s) generally refers to any polyribonucleotide or
polydeoxyribonucleotide, which may be unmodified RNA or DNA or modified RNA or
DNA. Thus, for instance, polynucleotides as used herein refers to, among
others, single-
and double-stranded DNA, DNA that is a mixture of single- and double-stranded
regions, single- and double-stranded RNA, and RNA that is mixture of single-
and
double-stranded regions, hybrid molecules comprising DNA and RNA that may be
single-stranded or, more typically, double-stranded or a mixture of single-
and double-
stranded regions.
In addition, polynucleotide as used herein refers to triple-stranded regions
comprising RNA or DNA or both RNA and DNA. The strands in such regions may be
from the same molecule or from different molecules. The regions may include
all of one
or more of the molecules, but more typically involve only a region of some of
the
molecules. One of the molecules of a triple-helical region often is an
oligonucleotide.
Ixa addition, the polynucleotides or nucleic acid sequences may contain one or
more modified bases. Thus, DNAs or RNAs with backbones modified for stability
or
for other reasons are "polynucleotides" as that term is intended herein.
Moreover, DNAs
or RNAs comprising unusual bases, such as inosine, or modified bases, such as
tritylated
bases, to name just two examples, are polynucleotides as the term is used
herein.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
9
Nucleic acid sequences can be created which encode a fusion protein and can be
operatively linked to expression control sequences. "Operatively linked"
refers to a
juxtaposition wherein the components so described are in a relationship
permitting them
to function in their intended manner. For example, a coding sequence is
"operably
linked" to another coding sequence when RNA polymerase will transcribe the two
coding sequences into a single mRNA, which is then translated into a single
polypeptide
having amino acids derived from both coding sequences. The coding sequences
need
not be contiguous to one another so long as the expressed sequences ultimately
process
to produce the desired protein. An expression control sequence operatively
linked to a
coding sequence is ligated such that expression of the coding sequence is
achieved under
conditions compatible with the expression control sequences. As used herein,
the term
"expression control sequences" refers to nucleic acid sequences that regulate
the
expression of a nucleic acid sequence to which it is operatively linked.
Expression
control sequences are operatively linked to a nucleic acid sequence when the
expression
control sequences control and regulate the transcription and, as appropriate,
translation
of the nucleic acid sequence. Thus, expression control sequences can include
appropriate promoters, enhancers, transcription terminators, a start codon
(i.e., ATG) in
front of a protein-encoding gene, splicing signals for introns, maintenance of
the correct
reading frame of that gene to permit proper translation of the mRNA, and stop
codons.
The term "control sequences" is intended to include, at a minimum, components
whose
presence can influence expression, and can also include additional components
whose
presence is advantageous, for example, leader sequences and fusion partner
sequences.
Expression control sequences can include a promoter.
By "promoter" is meant minimal sequence sufficient to direct transcription.
Also
included in the invention are those promoter elements which are sufficient to
render
promoter-dependent gene expression controllable for cell-type specific, tissue-
specific,
or inducible by external signals or agents; such elements may be located in
the 5' or 3'
regions of the of the polynucleotide sequence. Both constitutive and inducible
promoters, are included in the invention (see e.g., Bitter et al., Methods in
Enzymology
153:516-544,1987). For example, when cloning in bacterial systems, inducible
promoters such as pL of bacteriophage, plat, ptrp, ptac (ptrp-lac hybrid
promoter) and
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
the like may be used. When cloning in mammalian cell systems, promoters
derived
from the genome of mammalian cells (e.g., metallothionein promoter) or from
mammalian viruses (e.g., the retrovirus long terminal repeat; the adenovirus
late
promoter; the vaccinia virus 7.5K promoter) may be used. Promoters produced by
5 recombinant DNA or synthetic techniques may also be used to provide for
transcription
of the nucleic acid sequences of the invention. When cloning in plant systems
plant
promoters can be used with the construct comprising a plant promoter operably
associated with a sequence encoding a luciferase. The plant promoter may be
constitutive or inducible. Useful constitutive promoters include, but are not
limited to,
10 the CaMV 35S promoter, the T-DNA mannopine synthetase promoter, and their
various
derivatives. Useful inducible promoters include but are not limited to the
promoters of
ribulose bisphosphate carboxylase (RUBISCO) genes, chlorophyll binding protein
(CAB) genes, heat shock genes, the defense responsive gene (e.g.,
phenylalanine
ammonia lyase genes), wound induced genes (e.g., hydroxyproline rich cell wall
protein
genes), chemically-inducible genes (e.g., nitrate reductase genes, gluconase
genes,
chitinase genes, PR-1 genes), dark-inducible genes (e.g., asparagine
synthetase gene
(Coruzzi and Tsai, U.S. Pat. No. 5,256,558) to name just a few.
A nucleic acid sequence of the invention including, for example, a
polynucleotide encoding a fusion protein, may be inserted into a recombinant
expression
vector. A recombinant expression vector generally refers to a plasmid, virus
or other
vehicle known in the art that has been manipulated by insertion or
incorporation of a
nucleic acid sequences. For example, a recombinant expression vector of the
invention
includes a polynucleotide sequence encoding a Renilla luciferase polypeptide
of
fragment thereof. The expression vector typically contains an origin of
replication, a
promoter, as well as specific genes which allow phenotypic selection of the
transformed
cells. Vectors suitable for use in the present invention include, but are not
limited to the
T7-based expression vector for expression in bacteria (Rosenberg, et al., Gene
56:125,
1987), the pMSXND expression vector for expression in mammalian cells (Lee and
Nathans, J, Biol. Chem. 263:3521, 1988), baculovirus-derived vectors for
expression in
insect cells, cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV. The
nucleic
acid sequences of the invention can also include a localization sequence to
direct the
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
11
indicator to particular cellular sites by fusion to appropriate organellar
targeting signals
or localized host proteins. For example, a polynucleotide encoding a
localization
sequence, or signal sequence, can be used as a repressor and thus can be
ligated or fused
at the 5' terminus of a polynucleotide encoding a polypeptide of the invention
such that
the localization or signal peptide is located at the amino terminal end of a
resulting
polynucleotide/polypeptide (see fox example, Liu et al., Gene, 203 2 :141-8,
1997). The
construction of expression vectors and the expression of genes in transfected
cells
involves the use of molecular cloning techniques also well known in the art.
(See, for
example, Sambrook et al., Molecular Cloning --A Laboratory Manual, Cold Spring
Harbor Laboratory, Cold Spring Harbor, NY, 1989, and Current Protocols in
Molecular
Biology, M. Ausubel et al., eds., (Current Protocols, a joint venture between
Greene
Publishing Associates, Inc. and John Wiley & Sons, Inc., most recent
Supplement)).
These methods include in vitro recombinant DNA techniques, synthetic
techniques and
in vivo recombination/genetic recombination. (See also, Maniatis, et al.,
Molecular
Cloning A Laboratory Manual, Cold Spring Harbor Laboratory, N.Y., 1989).
In yeast, a number of vectors containing constitutive or inducible promoters
may
be used. For a review see, Current Protocols in Molecular Biology, Vol. 2, Ed.
Ausubel,
et al., Greene Publish. Assoc. & Wiley Interscience, Ch. 13,1988; Grant, et
al.,
"Expression and Secretion Vectors for Yeast," in Methods in Enzymology, Eds.
Wu &
Grossman, 1987, Acad. Press, N.Y., Vol. 153, pp.516-544,1987; Glover, DNA
Cloning,
Vol. II, IRL Press, Wash., D.C., Ch. 3, 1986; and Bitter, "Heterologous Gene
Expression
in Yeast," Methods in Enzymology, Eds. Berger & Kimmel, Acad. Press, N.Y.,
Vol.
152, pp. 673-684, 1987; and The Molecular Biology of the Yeast Saccharomyces,
Eds.
Strathern et al., Cold Spring Harbor Press, Vols. I and II, 1982. A
constitutive yeast
promoter such as ADH or LEU2 or an inducible promoter such as GAL may be used
("Cloning in Yeast," Ch. 3, R. Rothstein In: DNA Cloning Vol.l I, A Practical
Approach, Ed. DM Glover, IRL Press, Wash., D.C., 1986). Alternatively, vectors
may
be used which promote integration of foreign DNA sequences into the yeast
chromosome.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
12
An alternative expression system which could be used to express a Renilla
luciferase polypeptide of the invention is an insect system. In one such
system,
AutogYapha californica nuclear polyhedrosis virus (AcNPV) is used as a vector
to
express foreign or mutated polynucleotide sequences. The virus grows in
Spodoptera
S f~ugiperda cells. The sequence encoding a protein of the invention may be
cloned into
non-essential regions (for example, the polyhedrin gene) of the virus and
placed under
control of an AcNPV promoter (for example the polyhedrin promoter). Successful
insertion of the sequences coding for a protein of the invention will result
in inactivation
of the polyhedrin gene and production of non-occluded recombinant virus (i.e.,
virus
lacking the proteinaceous coat coded for by the polyhedrin gene). These
recombinant
viruses are then used to infect S. fYUgipeYda cells in which the inserted gene
is
expressed, see Smith, et al., J. Viol. 46:584, 1983; Smith, U.S. Patent No.
4,21 S,OS 1.
The vectors of the invention can be used to transform a host cell. By
transform
or transformation is meant a permanent or transient genetic change induced in
a cell
1 S following incorporation of new DNA (i. e., DNA exogenous to the cell).
Where the cell
is a mammalian cell, a permanent genetic change is generally achieved by
introduction
of the DNA into the genome of the cell.
A transformed cell or host cell generally refers to a cell (e.g., prokaryotic,
eukaryotic or plant cells) into which (or into an ancestor of which) has been
introduced,
by means of recombinant DNA techniques, a DNA molecule encoding a Renilla
luciferase polypeptide or fragment thereof. The term "plant cell" as used
herein refers to
protoplasts, gamete producing cells, and cells which regenerate into whole
plants. Plant
cells include cells in plants as well as protoplasts in culture. Accordingly,
a seed
comprising multiple plant cells capable of regenerating into a whole plant, is
included in
the definition of "plant cell".
Transformation of a host cell with recombinant DNA may be carried out by
conventional techniques as are well known to those skilled in the art. Where
the host is
prokaryotic, such as E. coli, competent cells which are capable of DNA uptake
can be
prepared from cells harvested after exponential growth phase and subsequently
treated
by the CaCl2 method by procedures well known in the art. Alternatively, MgClz
or RbCl
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
13
can be used. Transformation can also be performed after forming a protoplast
of the host
cell or by electroporation.
When the host is a eukaryote, methods of transfection or transformation with
DNA include calcium phosphate co-precipitates, conventional mechanical
procedures
such as microinjection, electroporation, insertion of a plasmid encased in
liposomes, or
virus vectors, as well as others known in the art, may be used. Eukaryotic
cells can also
be cotransfected with DNA sequences encoding a Renilla luciferase polypeptide
and a
second foreign DNA molecule encoding a selectable marker, such as the herpes
simplex
thymidine kinase gene. .Another method is to use a eukaryotic viral vector,
such as
simian virus 40 (SV40) or bovine papilloma virus, to transiently infect or
transform
eukaryotic cells and express the protein. (Eukaryotic Viral Vectors, Cold
Spring Harbor
Laboratory, Gluzman ed., 1982). Typically, a eukaryotic host will be utilized
as the host
cell. The eukaryotic cell may be a yeast cell (e.g., Saccharomyces
ce~evisiae), an insect
cell (e.g., Drosophila sp.) or may be a mammalian cell, including a human
cell.
Eukaryotic systems, and mammalian expression systems, allow for post-
translational modifications of expressed mammalian proteins to occur.
Eukaryotic cells
which possess the cellular machinery for processing of the primary transcript,
glycosylation, phosphorylation, and, advantageously secretion of the gene
product
should be used. Such host cell lines may include, but are not limited to, CHO,
VERO,
BHK, HeLa, COS, MDCK, Jurkat, HEK-293, and WI38.
Mammalian cell systems which utilize recombinant viruses or viral elements to
direct expression may be engineered. For example, when using adenovirus
expression
vectors, a polynucleotide encoding a Renilla luciferase may be ligated to an
adenovirus
transcription/ translation control complex, e.g., the late promoter and
tripartite leader
sequence. This chimeric sequence may then be inserted in the adenovirus genome
by in
vitro or ih vivo recombination. Insertion in a non-essential region of the
viral genome
(e.g., region E1 or E3) will result in a recombinant virus that is viable and
capable of
expressing a Renilla luciferase polypeptide or fragment thereof in infected
hosts (e.g.,
see Logan & Shenk, Proc. Natl. Acad. Sci. USA, 81:3655-3659,1984)..
Alternatively,
the vaccinia virus 7.5K promoter may be used. (e.g., see, Mackett, et al.,
Proc. Natl.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
14
Acad. Sci. USA, 79:7415-7419, 1982; Mackett, et al., J. Virol. 49:857-864,
1984;
Panicali, et al., Proc. Natl. Acad. Sci. USA 79:4927-4931, 1982). Of
particular interest
are vectors based on bovine papilloma virus which have the ability to
replicate as
extrachromosomal elements (Sarver, et al., Mol. Cell. Biol. 1:486, 1981).
Shortly after
entry of this DNA into mouse cells, the plasmid replicates to about 100 to 200
copies per
cell. Transcription of the inserted cDNA does not require integration of the
plasmid into
the host's chromosome, thereby yielding a high level of expression. These
vectors can
be used for stable expression by including a selectable marker in the plasmid,
such as the
neo gene. Alternatively, the retroviral genome can be modified for use as a
vector
capable of introducing and directing the expression of a Renilla luciferase
gene in host
cells (Cone & Mulligan, Proc. Natl. Acad. Sci. USA, 81:6349-6353, 1984). High
level
expression may also be achieved using inducible promoters, including, but not
limited
to, the metallothionine IIA promoter and heat shock promoters.
For long-term, high-yield production of recombinant proteins, stable
expression
is preferred. Rather than using expression vectors which contain viral origins
of
replication, host cells can be transformed with the cDNA encoding a Renilla
luciferase
polypeptide controlled by appropriate expression control elements (e.g.,
promoter,
enhancer, sequences, transcription terminators, polyadenylation sites, etc.),
and a
selectable marker. The selectable marker in the recombinant vector confers
resistance to
the selection and allows cells to stably integrate the plasmid into their
chromosomes and
grow to form foci which in turn can be cloned and expanded into cell lines.
For
example, following the introduction of foreign DNA, engineered cells may be
allowed to
grow for 1-2 days in an enriched media, and then are switched to a selective
media. A
number of selection systems may be used, including, but not limited to, the
herpes
simplex virus thymidine kinase (Wigler, et al., Cell, 11:223,1977),
hypoxanthine-
guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad.
Sci. USA,
48:2026, 1962), and adenine phosphoribosyltransferase (L,owy, et al., Cell,
22:817,
1980) genes can be employed in tk-, hgprt- or aprt- cells respectively. Also,
anti-
metabolite resistance can be used as the basis of selection for dhfr, which
confers
resistance to methotrexate (Wigler, et al., Proc. Natl. Acad. Sci. USA,
77:3567,1980;
O'Hare, et al., Proc. Natl. Acad. Sci. USA, 8:1527,1981); gpt, which confers
resistance
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci. USA, 78:2072,
1981;
neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin,
et al., J.
Mol. Biol. 150:1, 1981); and hygYO, which confers resistance to hygromycin
(Santerre, et
al., Gene 30:147, 1984) genes. Recently, additional selectable genes have been
5 described, namely tYpB, which allows cells to utilize indole in place of
tryptophan; hisD,
which allows cells to utilize histinol in place of histidine (Hartrnan &
Mulligan, Proc.
Natl. Acad. Sci. USA 85:8047,1988); and ODC (ornithine decarboxylase) which
confers resistance to the ornithine decarboxylase inhibitor, 2-
(difluoromethyl)-DL-
ornithine, DFMO (McConlogue L., In: Current Communications in Molecular
Biology,
10 Cold Spring Harbor Laboratory, ed., 1987).
The invention provides a stably transfected mammalian cell containing a
luciferase gene useful in measuring cell proliferation and the affect of an
agent on cell
proliferation. A HeLa cell was stably transfected with a Renilla luciferase
gene as
described in the examples below. This cell was expanded for cryopreservation.
A
15 sample of this cell line has been deposited in the American Type Culture
Collection,
Rockville, Md., U.S.A. under the provisions of the Budapest Treaty and
assigned
accession number ATCC XX~O~.
The term "primer" as used herein refers to an oligonucleotide, whether natural
or
synthetic, which is capable of acting as a point of initiation of synthesis
when placed
under conditions in which primer extension is initiated or possible. Synthesis
of a primer
extension product which is complementary to a nucleic acid strand is initiated
in the
presence of nucleoside triphosphates and a polymerase in an appropriate buffer
at a
suitable temperature. For instance, if a nucleic acid sequence is inferred
from a protein
sequence, a primer generated to synthesize nucleic acid sequence encoding the
protein
sequence is actually a collection of primer oligonucleotides containing
sequences
representing all possible codon variations based on the degeneracy of the
genetic code.
One or more of the primers in this collection will be homologous with the end
of the
target sequence. Likewise, if a "conserved" region shows significant levels of
polymorphism in a population, mixtures of primers can be prepared that will
amplify
adjacent sequences. For example, primers can be synthesized based upon the
nucleotide
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
16
or amino acid sequence of Renilla luciferase such as those set forth in SEQ ID
NO:1 or
2, respectively. Where the amino acid sequence is used, the primer sequence
can be
designed based upon the degeneracy of the genetic code.
A polypeptide or protein refers to a polymer in which the monomers are amino
acid residues which are joined together through amide bonds. When the amino
acids are
alpha-amino acids, either the L-optical isomer or the D-optical isomer can be
used, the
L-isomers being typical. A Rehilla luciferase polypeptide is intended to
encompass any
amino acid sequence and include modified sequences such as glycoproteins,
which
provides a polypeptide having luciferase activity. Accordingly, the
polypeptides of the
invention are intended to cover naturally occurring proteins, as well as those
which are
recombinantly or synthetically synthesized. In addition, a Rehilla luciferase
polypeptide
can occur in at least two different conformations wherein both conformations
have the
same or substantially the same amino acid sequence but have different three
dimensional
structures so long as the have a biological activity related to Renilla
luciferase.
Polypeptide or protein fragments of Renilla luciferase are also encompassed by
the
invention so long as they retain some activity of a full-length luciferase
(e.g., at least
about 50%, 75%, 100% or more of such activity). Fragments can have the same or
substantially the same amino acid sequence as the naturally occurring protein.
A
polypeptide or peptide having substantially the same sequence means that an
amino acid
sequence is largely, but not entirely, the same, but retains a functional
activity of the
sequence to which it is related. In general polypeptides of the present
invention include
peptides, or full length protein, that contains substitutions, deletions, or
insertions into
the protein backbone, that would still have an approximately 70%-90% homology
to the
original protein over the corresponding portion. A yet greater degree of
departure from,
homology is allowed if like-amino acids, i.e, conservative amino acid
substitutions, do
not count as a change in the sequence.
Homology can be measured using standard sequence analysis software (e.g.,
Sequence Analysis Software Package of the Genetics Computer Group, University
of
Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705;
also
see Ausubel, et al., supra). Such procedures and algorithms include, for
example, a
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
17
BLAST program (Basic Local Alignment Search Tool at the National Center for
Biological Information), ALIGN, AMAS (Analysis of Multiply Aligned Sequences),
AMPS (Protein Multiple Sequence Alignment), ASSET (Aligned Segment Statistical
Evaluation Tool), BANDS, BESTSCOR, BIOSCAN (Biological Sequence
S Comparative Analysis Node), BLIMPS (BLocks IMProved Searcher), FASTA,
Intervals & Points, BMB, CLUSTAL V, CLUSTAL W, CONSENSUS,
LCONSENSUS, WCONSENSUS, Smith-Waterman algorithm, DARWIN, Las Vegas
algorithm, FNAT (Forced Nucleotide Alignment Tool), Framealign, Framesearch,
DYNAMIC, FILTER, FSAP (Fristensky Sequence Analysis Package), GAP (Global
Alignment Program), GENAL, GIBBS, GenQuest, ISSC (Sensitive Sequence
Comparison), LALIGN (Local Sequence Alignment), LCP (Local Content Program),
MACAW (Multiple Alignment Construction & Analysis Workbench), MAP
(Multiple Alignment Program), MBLKP, MBLKN, PIMA (Pattern-Induced Multi-
sequence Alignment), SAGA (Sequence Alignment by Genetic Algorithm) and
WIiAT-IF.
A polypeptide is substantially related but for a conservative variation, such
polypeptides being encompassed by the present invention. A conservative
variation
denotes the replacement of an amino acid residue by another, biologically
similar
residue. Examples of conservative variations include the substitution of one
hydrophobic residue such as isoleucine, valine, leucine or methionine for
another, or the
substitution of one polar residue for another, such as the substitution of
arginine for
lysine, glutamic for aspartic acids, or glutamine for asparagine, and the
like. Other
illustrative examples of conservative substitutions include the changes of
alanine to
serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to
glutamate;
cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine
to proline;
histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine
to valine or
isoleucine; lysine to arginine, glutamine, or glutamate; methionine to leucine
or
isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to
threonine;
threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or
phenylalanine;
valine to isoleucine to leucine.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
18
Modifications and substitutions are not limited to replacement of amino acids.
For a variety of purposes, such as increased stability, solubility, or
configuration
concerns, one skilled in the art will recognize the need to introduce, (by
deletion,
replacement, or addition) other modifications. Examples of such other
modifications
include incorporation of rare amino acids, dextra-amino acids, glycosylation
sites,
cytosine for specific disulfide bridge formation. The modified peptides can be
chemically synthesized, or the isolated gene can be site-directed mutagenized,
or a
synthetic gene can be synthesized and expressed in bacteria, yeast,
baculovirus, tissue
culture and so on. Whether a change results in a functioning peptide can
readily be
determined by direct analysis for function in a assay that relies on ability
of the
modified enzyme (or fragment) to carry out the normal function of the natural
luciferase enzyme (or fragment). For example, modified peptides can be tested
for
ability to catalyze the emission of light from coelenterate luciferin by the
same
techniques described below for the recombinant Rehilla luciferase molecule.
Alternatively, the modified sequences can be screened for functional activity
by
attaching a suitable substrate, e.g., a coelenterate Iuciferin molecule, to an
affinity
column and capturing modified peptides that are retained by the bound
substrate.
Solid-phase chemical peptide synthesis methods can also be used to synthesize
the polypeptide or fragments of the invention. Such method have been known in
the art
since the early 1960's (Merrifield, R. B., J. Am. Chem. Soc., 85, 2149-2154
(1963) (See
also Stewart, J. M. and ~'oung, J. I~., Solid Phase Peptide Synthesis, 2 ed.,
Pierce
Chemical Co., Rockford, Ill., pp. 11-12)) and have recently been employed in
commercially available laboratory peptide design and synthesis kits (Cambridge
Research Biochemicals). Such commercially available laboratory kits have
generally
utilized the teachings of H. M. Geysen et al, P~oc. Natl. Acad. Sci., USA, 81,
3998
(1984) and provide for synthesizing peptides upon the tips of a multitude of
"rods" or
"pins" all of which are connected to a single plate. When such a system is
utilized, a
plate of rods or pins is inverted and inserted into a second plate of
corresponding wells or
reservoirs, which contain solutions for attaching or anchoring an appropriate
amino acid
to the pin's or rod's tips. By repeating such a process step, i.e., inverting
and inserting the
rod's and pin's tips into appropriate solutions, amino acids are built into
desired peptides.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
19
Tn addition, a number of available FMOC peptide synthesis systems are
available. For
example, assembly of a polypeptide or fragment can be carned out on a solid
support
using an Applied Biosystems, Inc. Model 431A automated peptide synthesizer.
Such
equipment provides ready access to the peptides of the invention, either by
direct
synthesis or by synthesis of a series of fragments that can be coupled using
other
known techniques.
Functional fragments of a Renilla luciferase, based on these sequences and
fragments and full length sequences representing minor variations thereof,
will have
at least some of the biological activities of luciferase and will therefore be
useful in
appropriate circumstances. For example, functional fragments of the luciferase
enzyme sequence can be prepared and screened for use as luciferin binding site
models. Peptide synthesizers (as described above) can be used to prepare
peptide
fragments (e.g., less than 100 amino acids) or techniques of genetic
engineering can
be used to prepare the peptide fragments. The fragments can then be screened
for
functional activity by attaching a suitable substrate, e.g., a coelenterate
luciferin
molecule, to an affinity column and capturing peptide fragments that axe
retained by
the bound substrate. Polypeptides or fragments that retain at least about 50%
activity
of luciferase are encompassed by the invention.
Pathologies Assoeiatecl with Cell P,roliferative Disorders
A number of diseases or disorders are known to be characterized by altered
cellular proliferation rates and thus can be monitored, diagnosed or used in
the
development of therapies for an afflicted subject. As used herein, "subject"
means
any mammal, but is preferably a human. For example, cancer and malignant
tumors
of any type, including breast cancer, lung cancer, colon cancer, skin cancer,
lymphomas, and leukemias; pre-cancerous conditions such as adenomas, polyps,
prostatic hypertrophy, and ulcerative colitis can be diagnosed using the
methods of
the invention. Immune disorders associated CD4+ and CD8+ T lymphocytes in
AIDS; T and B lymphocytes in vaccine-unresponsiveness; T cells in autoimmune
disorders; B cells in hypogammaglobulinemias; primary immunodeficiencies
(thymocytes); stress-related immune deficiencies (lymphocytes) and the like
can also
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
be diagnosed by the method of the invention. Other disorders include, fox
example,
hematologic conditions (e.g., white blood cell deficiencies
(granulocytopenia),
anemias of any type, myeloproliferative disorders (polycythemia vera), tissue
white
cell infiltrative disorders (pulmonary interstitial eosinophilia, Iymphocytic
thyroiditis,
5 etc.), Iymphoproliferative disorders, monoclonal gammopathies; and the
like); organ
failure (e.g., alcoholic and viral hepatitis (liver cells), diabetic
nephropathy
(glomerular or mesangeal cells), myotrophic conditions (myocytes), premature
gonadal failure (oocytes, stromal cells of ovary, spermatocytes, Leydig cells,
etc.),
and the like); conditions of bone and muscle (e.g., response to exercise
training or
10 physical therapy (myocytes or mitochondria in myocytes), osteoporosis
(osteoclast,
osteoblasts, parathyroid cells) myositis, and the like); endocrine conditions
(e.g.,
diabetes ((3 islet-cells), hypothyroidism and hyperthyroidism (thyroid cells),
hyperparathyroidism (parathyroid cells), polycystic ovaries (stromal cells of
ovary),
and the like); infectious diseases (e.g., tuberculosis
(monocytes/macrophages),
1 S bacterial infections (granulocytes), abscesses and other localized tissue
infections
(granulocytes), viral infections (lymphocytes), diabetes foot disease and
gangrene
(white cells), and the like); vascular disorders such as, for example,
atherogenesis
(smooth muscle proliferation in arterial wall), cardiomyopathies (cardiac
myocyte
proliferation), and the like; and occupational diseases and exposures
including
20 susceptibility to coal dust for black lung (fibroblast proliferative
response),
susceptibility to skin disorders related to sun or chemical exposures (skin
cells), and
the like.
Methods of Measuring Cell Proliferation
The methods provided herein, are well-suited for measuring any change in the
number of cells in culture. The invention provides methods of measuring cell
proliferation of a cell or population of cells by obtaining light emission
data. from a
cell containing a Renilla luciferase over a period of time, wherein a change
in Iight
emission data is indicative of proliferation or a change in cell number. Such
methods
can provide information regarding the rate at which a cell is proliferating,
the rate at
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
21
which the population of cells in culture changes, as well as information
regarding the
total number of cells in culture.
The cell may be any cell including prokaryotic and eukaryotic cells (e.g.,
invertebrate, vertebrate, mammalian and human cells, or plant cells). The
methods
herein are particularly adaptable to determination of the change in cell
number of a
cell or a culture of cells such as in microwell tissue culture plates. These
plates
typically have 96 wells per plate, but higher density formats are available,
including
the 96 well half area format, and 3~4 well plates, and can accommodate as
little as a
fraction of a milliliter of cells or cell Iysate per well, for example, 0.2 ml
or less,
containing as few as 50 cells. Use of such plates are advantageously adaptable
to
automation. Cells are introduced into the microtiter tissue culture plates or
other
suitable vessels. The cells can be adherent cells or grow in suspension. The
cells can
be transfected with a Rehilla luciferase (as described above) either before
primary
culture or during subculture. Such transfected cells can be transiently
transfected or
stably transfected depending upon the culture conditions and assay conditions,
such
techniques for stable and transient transfections are known in the art (as
described
above). The cells may be obtained from any sample, including soil, water, or a
biological sample (e.g., blood, urine, sputum, spinal fluid, and tissue).
The cells containing a Renilla Iuciferase are cultured under conditions that
allow expression of the Renilla luciferase. The luciferase activity can then
be
measured ih vivo or ih vitro (see, for example, Lorenzo et al., J Biolumin
Chemilumin, 11~1~:31-7, 1996, which is incorporated by reference herein) by
providing the cell culture with the substrate coelentrazine. Typically the
coelentrazine
will be in an amount of about 0.05 p,M to about 5 p.M, depending, for example,
upon
the assay conditions (e.g., whole cell, lysate, purified protein).
Alternatively, the cells
can be lysed prior to addition of the substrate. In such instances the cells
can be lysed
by adding appropriate buffer or by mechanical disruption or other methods
known to
those of skill in this art. The vessels, particularly the microtiter plates,
can be placed
in commercially available instruments for measuring light, such as a plate
reader,
which can be interfaced with a. computer for data analysis. Depending upon the
assay
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
22
type, one skilled in the art can develop various methods to determine a change
in cell
number. For example, where cell death is measured, the cells can be washed
between
measurements to determine the number of cells or luciferase activity present
before
and after the wash. For example, a decrease in the number of cells over a
period of
time is indicative of cell death.
The determination of the number of cells can be made at any desired time
during a cell culture period in which the growth, survival, or death of the
cells are to
be measured. These cells can be grown in conventional tissue culture flasks
such as,
for example, T-flasks, roller bottles, flat bed chambers, hollow fiber
reactors, agitated
suspension culture vessels and similar cell culture devices under various
suspension
or anchorage-dependent cell culture conditions. In one embodiment, microtiter
plates
designed for use with high throughput automated instrumentation can be used.
The
time and frequency of the cell counts will depend upon the nature of the
specific cells
being cultured, their normal growth period, the cell products sought after and
other
such factors. For example, measurements of luciferase activity can be measured
continuously or at different time points (e.g., 0 sec., 1 minute, 2 minutes, 5
minutes,
10 minutes, 20 minutes and so on). By following a cell count, one can readily
determine the growth phase or stage in which the cells exist at any given
time.
Cell number can by determined by comparing the light produced by cells with
a control population of cells or a control curve developed using identical
conditions,
but a known or predetermined number of cells. A curve can be developed, for
example, by determining the number of cells per well or other unit of cells in
at least
two different levels and plotting against light or luciferase activity to form
a straight
line relationship. The number of cells for any cell culture of the given cells
can then
be estimated by carrying out the method and comparing light emission or
luciferase
activity to a control curve. In automated methods, such data can be included
in the
programming of the instrument and cell number determined automatically.
The methods and compositions of the invention are useful in drug discovery
and drug screening. Such methods utilize the ability to monitor, for example,
cell
viability and cell growth in the presence or absence of various drug
candidates
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
23
utilizing a Renilla luciferase as a reporter gene or polypeptide. The methods
include
contacting a cell containing a Rehilla luciferase with an agent (e.g., a drug,
a drug
candidate, or any combination thereof) under conditions that allow the cell
and the
agent to interact. Prior to, simultaneously with or after contacting the cell
with the
agent the cell is contacted with a Renilla luciferase substrate (e.g., ih vivo
or in vitro)
and Renilla luciferase activity is measured. Accordingly, the growth,
viability and
maintenance of cells can be measured in the presence of agents suspected of
altering
cellular growth, viability or metabolism. One particular advantage of the
methods of
the invention is the ability to screen one or more agents in the same cell or
culture of
cells. For example, it is possible to determine additive or synergistic
effects of two or
more agents, e.g., a "cocktail", on cell proliferation. In this aspect, a cell
or cell
culture is contacted with an agent suspected of altering cell proliferation
and cell
proliferation is measured using Renilla luciferase activity. The same cell or
culture is
contacted with a second agent and the effect of the second agent on cell
proliferation
is measured to determine additive or synergistic effects of the two agents.
For
example, one could screen for one or a mixture of chemotherapeutic agents to
identify
a cocktail or the proper combination of chemotherapeutic agents to treat a
cell
proliferative disorder, e.g., cancer. In another example, the methods of the
invention
can be used to identify a combination of agents, including a combination of
reverse
transcriptase inhibitors, antiviral agents, anti-inflammatory or other agents
useful for
inhibiting production, activation, or infection of a subject's cells by HIV or
for
treating a viral disorder or disease.
The cells used in the invention assay can include, but are not limited to, for
example, commercially available cell lines (e.g., cells obtainable form the
American
Type Culture Collection (ATCC)) as well as cells derived from a subject. Such
subject-derived cells include cells of any number of tissues or fluids present
in a
subject, including, blood, serum, sputum, urine, cerebrospinal fluid, bile,
saliva,
musculoskeletal tissue, gastrointestinal tissue, neurological tissue,
cardiovascular
tissue, urogenital tissue, skin tissue and the like. Other sources of cells or
tissues,
including a subject's tumor cells, axe known in the art. Preferably the
subject, tissue
or cells are mammalian, and most preferably human.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
24
In addition, the methods of the invention can assist in the diagnoses of a
cell
proliferative disorder. For example, cells isolated from a subject suspected
of having
a cell proliferative disorder (e.g., a cancer or neoplasm) can be compared to
control
cells in order to determine if the proliferative rates of the cancer cells are
different
than normal or non-cancerous cells. The control or non-cancerous cells may be
from
the same subject, for example, from a different tissue site.
The methods of the invention are also useful in monitoring the treatment of a
subject diagnosed with a cell proliferative disorder. In this embodiment, the
cells of a
subject are monitored following or concurrent with the beginning of a course
of
therapeutic treatment. Such therapeutic treatments include, for example the
administration of chemotherapeutic agents where cancer has been diagnosed or
bone
marrow transplantation following bone marrow ablation or treatment with a
chemotherapeutic agent. For example, a subject diagnosed with a cancer can
have
biopsies taken at various intervals of time to determine whether the cells
present in the
biopsy contain cancer cells by measuring cell proliferation as described
above.
Similarly, cells can be taken from the bone marrow of a subject to determine
whether
bone marrow replacement therapy is working by measuring whether the bone
marrow
cells in the biopsy are viable and proliferating, for example.
The Examples described below demonstrate that the methods herein can be
adapted for use with a wide variety of cell types, and, can, thus be used for
any
purpose in which cell proliferation or cell number is measured. Because of the
high
sensitivity of the method, it is particularly adaptable for use in assays for
screening for
compounds that modulate cell proliferation (e.g., drug screening assays).
Inhibitors of
proliferation will be useful for treating pathologies that derive from cell
proliferation,
such as tumors, diabetic retinopathies, arthritis and other such disorders
described
herein. Identification of stimulators of cell proliferation is also of
interest as a means
to identify transformation factors.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
Methods of Identifying Agents That Modulate Cell Proliferation
In another embodiment, the invention provides a method for identifying an
agent
which modulates cell proliferation or activity including incubating components
comprising the agent and a cell containing a Renilla luciferase polypeptide,
or a
5 recombinant cell expressing a Renilla luciferase polypeptide, under
conditions sufficient
to allow the components to interact and determining the effect of the agent on
cell
proliferation or activity. The term "effect", as used herein, encompasses any
means by
which cell proliferation or activity can be modulated such as inhibition or
stimulation of
cell proliferation. "Agents" can include, for example, polypeptides,
peptidomimetics,
10 chemical compounds and biologic agents as described below.
Incubating includes conditions which allow contact between the test agent and
cell containing a Renilla luciferase, a cell expressing a Renilla luciferase
or a sample
containing a Renilla luciferase. Contacting includes in solution and in solid
phase. The
test agents may optionally be a combinatorial library fox screening a
plurality of agents.
15 Agents identified in the method of the invention can be further evaluated,
detected,
cloned, sequenced, and the like, either in solution or after binding to a
solid support, by
any method usually applied to the detection of a specific DNA sequence such as
PCI~,
oligomer restriction (Saiki, et al., Bio/Technology, 3:1008-1012, 1985),
oligonucleotide
ligation assays COLAs) (Landegren, et al., Science, 241:1077, 1988), and the
like.
20 Molecular techniques for DNA analysis have been reviewed (Landegren, et
al., Science,
242:229-237, 1988).
Thus, the method of the invention includes combinatorial chemistry methods for
identifying agents that modulate cell proliferation or affect cell
proliferation or activity.
Areas of investigation are the development of therapeutic treatments for
cancer or other
25 disorders associated with abnormal cellular proliferation. The screening
identifies agents
that modulate cell proliferation by either stimulating cell proliferation or
inhibiting cell
proliferation. Of particular interest are screening assays for agents that
have a Iow
toxicity for human cells. For example, chemotherapeutic agents that inhibit
cells having
cell proliferative disorders while maintaining proliferation of normal cells.
In addition,
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
26
screening antibiotic agents to determine effective antibiotics for a
particular
microorganism is applicable to the methods of the invention.
The term "agent" as used herein describes any molecule, e.g. protein or
pharmaceutical, with the capability of altering cell proliferation (e.g.,
stimulating or
inhibiting cell proliferation). Generally, a plurality of assay mixtures are
run in parallel
with different agent concentrations to obtain a differential response to the
various
concentrations. Typically, one of these concentrations serves as a negative
control, e.g.
at zero concentration or below the level of detection.
Candidate agents encompass numerous chemical classes, though typically they
are organic molecules, preferably small organic compounds having a molecular
weight
of more than 50 and less than about 2,500 daltons. Candidate agents comprise
functional
groups necessary for structural interaction with proteins, particularly
hydrogen bonding,
and typically include at least an amine, carbonyl, hydroxyl or carboxyl group,
preferably
at least two of the functional chemical groups. The candidate agents often
comprise
cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic
structures
substituted with one or more of the above functional groups. Candidate agents
are also
found among biomolecules including, but not limited to: peptides, saccharides,
fatty
acids, steroids, purines, pyrimidines, derivatives, structural analogs or
combinations
thereof. Candidate agents are obtained from a wide variety of sources
including libraries
of synthetic or natural compounds. For example, numerous means are available
for
random and directed synthesis of a wide variety of organic compounds and
biomolecules, including expression of randomized oligonucleotides and
oligopeptides.
Alternatively, libraries of natural compounds in the form of bacterial,
fungal, plant and
animal extracts are available or readily produced. Additionally, natural or
synthetically
produced libraries and compounds are readily modified through conventional
chemical,
physical and biochemical means, and may be used to produce combinatorial
libraries.
Known pharmacological agents may be subjected to directed or random chemical
modifications, such as acylation, alkylation, esterification and amidification
to produce
structural analogs.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
27
A variety of other reagents may be included in the screening assay. These
include reagents like salts, neutral proteins, e.g. albumin, detergents, etc
that are used to
facilitate optimal agent cell interaction, stability of the agent being tested
and/or reduce
non-specific or background interactions. Reagents that improve the efficiency
of the
assay, such as protease inhibitors, nuclease inhibitors and anti-microbial
agents may be
used. Incubations are performed at any suitable temperature, typically between
4 and 50
°C. Incubation periods are selected for optimum activity, but may also
be optimized to
facilitate rapid high-throughput screening. Between 0.1 and 48 hours,
typically 1-24
hours, but more typically 1-12 hours will be sufficient time to measure
proliferation.
The invention now being generally described, the same will be better
understood by reference to the following examples which are provided for
purposes of
illustration only and are not to be considered limiting of the invention
unless so
specified.
E~AIbIPLES
Cloning of Renilla Luciferase
A SeaLite plasmid pCR3.1 (SeaLite Sciences, Inc., Norcross, GA) was
amplified by PCR with oligonucleotide primers containing Kozak sequences at it
N-
terminal primer:
LucP4-EcoRI: GCGAATTCGCCACCATGACTTCGAAAGTTTATGAT
(SEQ ID NO:1); and
LucP2-XhoI: CACTCGAGTTATTGTTCATTTTTGAGAAC (SEQ ID
N0:2).
After PCR with primers of LucP4-EcoRI and LucP2-XhoI, the PCR product
(GC-EcoRI site-GCCACC-ATG (Met)-ACT-...RLuc....-CAA (Gln)-TAA (Stop)-
XhoI site-TG was digested with EcoRI and XhoI and cloned into pcDNA3 vector.
(See the vector map and sequence, Figure 1). A Kozak sequence was used for
increased (i.e., more effective) expression of luciferase in mammalian cells.
The
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
28
sequence of the vector insert was verified by DNA sequencing from both DNA
strands. The cloned luciferase gene matched the reported GenBank sequence.
TYa~esfectioh of Mammalian Cells
HeLa cells were seeded onto 10 cm plates 24 hours before transfection.
S Plasmid pcDNA-Rluc or pcDNA3-(3-galactosidase was transfected into Hel,a
cells
with Lipofectamine according to manufacture's protocol (GIBCO-BRL). Cells were
cultured for an additional 48 hours before activity assay.
HeLa cells were harvested by trypsin/EDTA, washed once with culture
medium containing 10% serum and counted using a hemocytometer. The cells were
then resuspended at about 1.S x 106 cells/ml. The cells were serial-diluted by
aliquoting 200 p,l the cell suspension into the first row of wells of a 96-
well plate and
making a series of 4 fold dilutions by transferring S0 p,l of cell suspension
into the
next row of wells which already contained 1 SO ~.l of culture medium. The
cells were
then cultured an additional 24 hours.
1 S To determine the transfection efficiency, about 2 x 105 cells transfected
with
pcDNA3-[3-galactosidase were seeded onto another 10 cm plate. X-gal staining
was
performed after 24 hours in culture. Transfected cells (e.g., cells positive
for
galactosidase) appeared as blue cells.
COS-7 cells were transiently transfected with plasmid pcDNA-Rluc or
pcDNA3-[3-galactosidase using Lipofectamine according to manufacture's
protocol
(GTBCO-BRL). Similar results to those depicted in higure 3 were obtained from
these COS-7 cells.
MTT Assays
The MTT Assay was adapted from a method described in Mossmann, Journal
2S of Tmmunological Methods, CzS:SS-63, 1983. The MTT assay quantitates the
reduction
and subsequent trapping of a yellow tetrazolium dye which is reduced by the
electron
transport chain of functional mitochondria to a purple formazan dye. An MTT
assay
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
29
was carried out using Promega's CELL TTTER 96 AQ"e°us according to the
manufacturer's instuctions. The dye solution was aliquoted into half of the
wells of
the 96 well plate and incubated at 37 °C, 5% COa for 1 hour. Culture
medium alone
plus the dye was used as a blank. Absorbance of each well was measured at 490
nm.
Assay for LZ~ciferase Activity in vitro
Medium from the 96-well plate were aspirated and 20 p,l of lysis buffer was
added to each well. The 96 well plate was incubated for 20 minutes at room
temperature. 5-10 p,l of lysate were removed and placed in a clean 96 well
plate. 200
p,l of luciferase substrate (coelenterazine) at 1 p.M was mixed with the
lysate and light
production was measured for 15 seconds immediately upon the addition of
substrate.
Wells containing medium only were used as controls.
Cell proliferation assays using Renilla luciferase is 100-300 fold more
sensitive than conventional MTT assays. (Figure 2). The assay was able to
detect as
little as 50 cells. Experiments using stably transfected HeLa cells
demonstrated
similar results (Figure 3).
Assay for Luciferase Activity in vivo
Renilla luciferase stable cell line HRL2G6 (HeLa) was maintained with
DMEM containing 10% FBS and O.S mg/ml G41~. Luciferase substrate was prepare
at 1 p,M in PBS.
HRL2G6 cells were harvested with Trypsin/EDTA and washed once with 10%
serum culture mediu. The cells number was determined by hemocytometer, and
resuspended at about 2.5 x 105 celllml. The cells were then aliquoted at 150
p,l per
well in the first row of a 96 well plate A series of 3-fold dilutions were
prepared by
transferring 50 pl of cell suspension into wells which already contained 100
p,l of cell
culture medium. The cells were cultured for 24 hours at 37 °C and 5%
COZ.
MTT assays wer performed as above. MTS solution was thawed at 37
°C for
about 15 minutes and 20 p,l of MTS solution was aliquoted into one half of the
96-
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
well plate containing cells and incubated at 37 °C, 5% C02 for 1 hour.
The optical
density was read at 490 run. Culture medium alone plus MTS solution was used
as a
blank.
Luciferase assays were performed by aspirating out medium from the
5 remaining half of the 96 well-plate containing cells. The wells were washed
3 times
with PBS and 50 p.l of PBS added back to each well. 200 ~,1 of luciferase
substrate
(coelenterazine at 1 ECM) was added and light production was collected for 15
seconds. Wells containing medium only were used as a control. When luciferase
substrate was added to the living cells, light production was detectable
without lysing,
10 demonstrating that the substrate penetrates into the cells.
While the invention has been described in detail with reference to certain
preferred embodiments thereof, it will be understood that modifications and
variations
are within the spirit and scope of that which is described and claimed.
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
SEQUENCE LISTING
<110> Leng, J'ay
<120> CELL PROLIFERATION ASSAY
<130> chem1100-2
<140> Not yet known
<141> 2000-06-02
<150> 09/559,874
<151> 2000-04-25
<160> 5
<170> Patentln Ver. 2.1
<210> 1
<211> 35
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
Sequence
<400> 1
gcgaattcgc caccatgact tcgaaagttt atgat 35
<210> 2
<211> 29
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: Primer
Sequence
<400> 2
cactcgagtt attgttcatt tttgagaac 29
<210> 3
<211> 936
<212> DNA
<213> Renilla reniformis
1
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
<220>
<22i> CDS
<222> (1)..(936)
<400> 3
atg act tcg aaa gtt tat gat cca gaa caa agg aaa cgg atg ata act 48
Met Thr Ser Lys Val Tyr Asp Pro Glu Gln Arg Lys Arg Met Ile Thr
1 5 i0 15
ggt ccg cag tgg tgg gcc aga tgt aaa caa atg aat gtt ctt gat tca 96
Gly Pro Gln Trp Trp Ala Arg Cys Lys Gln Met Asn Val Leu Asp Ser
20 25 ~ 30
ttt att aat tat tat gat tca gaa aaa cat gca gaa aat get gtt att 144
Phe Ile Asn Tyr Tyr Asp Ser Glu Lys His Ala Glu Asn Ala Val Ile
35 40 45
ttt tta cat ggt aac gcg gcc tet tct tat tta tgg cga cat gtt gtg 192
Phe Leu His Gly Asn Ala Ala Ser Ser Tyr Leu Trp Arg His Val Val
50 55 60
cca cat att gag cca gta gcg cgg tgt att ata cca gat ctt att ggt 240
Pro His TIe Glu Pro Val AIa Arg Cys Ile TIe Pro Asp Leu Ile Gly
65 70 75 80
atg ggc aaa tca ggc aaa tct ggt aat ggt tct tat agg tta ctt gat 288
Met Gly Lys Ser Gly Lys Ser Gly Asn Gly Ser Tyr Arg Leu Leu Asp
85 90 95
cat tac aaa tat ctt act gca tgg ttt gaa ctt ctt aat tta cca aag 336
His Tyr Lys Tyr Leu Thr Ala Trp Phe Glu Leu Leu Asn Leu Pro Lys
100 105 110
aag atc att ttt gtc ggc cat gat tgg ggt get tgt ttg gca ttt cat 384
Lys Ile Ile Phe Val Gly His Asp Trp Gly Ala Cys Leu Ala Phe His
il5 120 125
tat agc tat gag cat caa gat aag atc aaa gca ata gtt~cac get gaa 432
Tyr Ser Tyr Glu His Gln Asp Lys Ile Lys Ala Ile Val His Ala Glu
130 135 140
agt gta gta gat gtg att gaa tca tgg gat gaa tgg cct gat att gaa 480
Ser Val Val Asp Val Ile Glu Ser Trp Asp Glu Trp Pro Asp Ile Glu
145 150 155 160
gaa gat att gcg ttg atc aaa tct gaa gaa gga gaa aaa atg gtt ttg 528
Glu Asp Ile Ala Leu Ile Lys Ser Glu Glu Gly G1u Lys Met Val Leu
2
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
165 170 175
gag aat aac ttc ttc gtg gaa acc atg ttg cca tca aaa atc atg aga 576
GIu Asn Asn Phe Phe VaI Glu Thr Met Leu Pro Ser Lys IIe Met Arg
180 185 190
aag tta gaa cca gaa gaa ttt gca gca tat ctt gaa cca ttc aaa gag 624
Lys Leu Glu Pro Glu Glu Phe Ala Ala Tyr Leu Glu Pro Phe Lys Glu
195 200 205
aaa ggt gaa gtt cgt cgt cca aca tta tca tgg cct cgt gaa atc ccg 672
Lys Gly Glu Val Arg Arg Pro Thr Leu Ser Trp Pro Arg Glu Ile Pro
210 215 220
tta gta aaa ggt ggt aaa cct gac gtt gta caa att gtt agg aat tat 720
Leu Val Lys Gly Gly Lys Pro Asp Val Val Gln Ile Val Arg Asn Tyr
225 230 235 240
aat get tat cta cgt gca agt gat gat tta cca aaa atg ttt att gaa 768
Asn Ala Tyr Leu Arg Ala Ser Asp Asp Leu Pro Lys Met Phe Ile Glu
245 250 255
tcg gat cca gga ttc ttt tec aat get att gtt gaa ggc gcc aag aag 816
Ser Asp Pro Gly Phe Phe Ser Asn AIa IIe Val GIu Gly Ala Lys Lys
260 265 270
ttt cct aat act gaa ttt gtc aaa gta aaa ggt ctt cat ttt tcg caa 864
Phe Pro Asn Thr Glu Phe Val Lys Val Lys Gly Leu His Phe Ser Gln
275 280 285
gaa gat gca cct gat gaa atg gga aaa tat atc aaa tcg ttc gtt gag 912
Glu Asp Ala Pro Asp Glu Met Gly Lys Tyr Ile Lys Ser Phe Val Glu
290 295 300
ega gtt ctc aaa aat gaa caa taa 936
Arg Val Leu Lys Asn Glu Gln
305 . 310
<210> 4
<211> 311
<212> PRT
<213> Renilla reniformis
<400> 4
Met Thr Ser Lys Val Tyr Asp Pro Glu Gln Arg Lys Arg Met Ile Thr
1 5 10 15
Gly Pro Gln Trp Trp Ala Arg Cys Lys Gln Met Asn Val Leu Asp Ser
3
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
20 25 30
Phe Ile Asn Tyr Tyr Asp Ser Glu Lys His Ala Glu Asn Ala Val Ile
35 40 45
Phe Leu His Gly Asn Ala Ala Ser Ser Tyr Leu Trp Arg His Val Val
50 55 60
Pro His Ile GIu Pro Val Ala Arg Cys Ile Ile Pro Asp Leu Ile GIy
65 70 75 80
Met Gly Lys Ser Gly Lys Ser Gly Asn Gly Ser Tyr Arg Leu Leu Asp
85 90 95
His Tyr Lys Tyr Leu Thr Ala Trp Phe Glu Leu Leu Asn Leu Pro Lys
100 105 110
Lys Ile Ile Phe Val Gly His Asp Trp Gly Ala Cys Leu Ala Phe His
115 120 125
Tyr Ser Tyr Glu His Gln Asp Lys Ile Lys Ala Ile Val His Ala Glu
130 135 140
Ser Val Val Asp Val Ile Glu Ser Trp Asp Glu Trp Pro Asp Ile Glu
145 150 155 i60
Glu Asp Ile Ala Leu Ile Lys Ser Glu Glu Gly GlulLys Met Va1 Leu
165 170 175
Glu Asn Asn Phe Phe Val Glu Thr Met Leu Pro Ser Lys Ile Met Arg '
180 185 190
Lys Leu Glu Pro Glu Glu Phe Ala Ala Tyr Leu Glu Pro Phe Lys Glu
195 200 205
Lys Gly Glu Val Arg Arg Pro Thr Leu Ser Trp Pro Arg Glu Ile Pro
210 215 220
Leu Val Lys Gly Gly Lys Pro Asp Val Val Gln Ile Val Arg Asn Tyr
225 230 235 . 240
Asn Ala Tyr Leu Arg Ala Ser Asp Asp Leu Pro Lys Met Phe Ile Glu
245 250 255
Ser Asp Pro Gly Phe Phe Ser Asn Ala Ile Val Glu Gly AIa Lys Lys
260 265 270
Phe Pro Asn Thr Glu Phe Val Lys Val Lys Gly Leu His Phe Ser Gln
275 280 285
Glu Asp Ala Pro Asp Glu Met Gly Lys Tyr Ile Lys Ser Phe Val Glu
290 295 300
Arg Val Leu Lys Asn Glu Gln
305 310
<210> 5
<211> 5446
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: PcDNA3 vector
sequence
4
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
<400> 5
gacggatcgg gagatctccc gatcccctat ggtcgactct cagtacaatc tgctctgatg 60
ccgcatagtt aagccagtat ctgctccctg cttgtgtgtt ggaggtcgct gagtagtgeg 120
cgagcaaaat ttaagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 180
ttagggttag gcgttttgcg ctgcttcgcg atgtacgggc cagatatacg cgttgacatt 240
gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata 300
tggagttccg cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc 360
cccgeccatt gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc 420
attgacgtca atgggtggac tatttacggt aaactgccca cttggcagta catcaagtgt 480
atcatatgcc aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt 540
atgcccagta catgacctta tgggactttc ctacttggca gtacatctac gtattagtca 600
tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg 660
actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc 720
aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg 780
gtaggcgtgt acggtgggag gtctatataa gcagagctct ctggctaact agagaaccca 840
etgcttactg gcttatcgaa attaatacga ctcactatag ggagacecaa gcttggtacc 900
gagctcggat ccactagtaa cggccgccag tgtgctggaa ttctgcagat atccatcaca 960
ctggcggccg ctcgagcatg catctagagg gccctattct atagtgtcac ctaaatgcta 1020
gagctcgctg atcagcetcg actgtgcctt ctagttgcca gccatetgtt gtttgcccct 1080
cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc taataaaatg 1140
aggaaattgc atcgcattgt ctgagtaggt gtcattctat tetggggggt ggggtggggc 1200
aggacagcaa gggggaggat tgggaagaca atagcaggca tgctggggat gcggtgggct 1260
ctatggcttc tgaggcggaa agaaccagct ggggctctag ggggtatccc cacgcgccct 1320
gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg 1380
ccagcgccct agcgcccgct ectttcgctt tcttcccttc ctttctcgcc acgttcgccg 1440
gctttccccg tcaagctcta aatcggggca tccctttagg gttccgattt agtgctttac 1500
ggcacctcga ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct 1560
gatagacggt ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt 1620
tccaaactgg aacaacactc aaccctatet cggtctattc ttttgattta taagggattt 1680
tggggatttc ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt 1740
aattctgtgg aatgtgtgtc agttagggtg tggaaagtcc ccaggctccc caggcaggca 1800
gaagtatgca aagcatgcat ctcaattagt cagcaaccag gtgtggaaag tccccaggct 1860
ccccagcagg cagaagtatg caaagcatgc atetcaatta gtcagcaacc atagtcccgc 192 0
ccctaactcc gcccatcccg eccctaactc cgcccagttc egcecattct ecgccccatg 1980
gctgactaat tttttttatt tatgcagagg ccgaggccgc ctctgcctct gagctattcc 2040
agaagtagtg aggaggcttt tttggaggcc taggcttttg caaaaagctc ccgggagctt 2100
gtatatccat tttcggatct gatcaagaga caggatgagg atcgtttcgc atgattgaac 2160
aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc ggctatgact 2220
gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca gcgcaggggc 2280
gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg caggacgagg 2340
cagegcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg ctcgacgttg 2400
tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag gatctcctgt 2460
catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg cggcggctgc 2520
atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc atcgagcgag 2580
cacgtactcg gatggaagcc ggtcttgtcg atcaggatga tctggacgaa gagcatcagg 2640
ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg catgcccgac ggcgaggatc 2700
tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat ggccgctttt 2760
CA 02406873 2002-10-21
WO 01/81614 PCT/USO1/13512
ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac atagcgttgg 2820
ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc ctcgtgcttt 2880
acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt gacgagttct 2940
tctgagcggg actctggggt tcgaaatgac cgaccaagcg acgcccaacc tgccatcacg 3000
agatttcgat tccaccgccg ccttctatga aaggttgggc ttcggaatcg ttttccggga 3060
cgccggctgg atgatcctcc agcgcgggga tctcatgctg gagttcttcg cccaccccaa 3120
cttgtttatt gcagcttata atggttacaa ataaagcaat agcatcacaa atttcacaaa 3180
taaagcattt ttttcactgc attctagttg tggtttgtcc aaactcatca atgtatctta 3240
tcatgtctgt ataccgtcga cctctagcta gagcttggcg taatcatggt catagctgtt 3300
tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa 3360
gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact 3420
gcccgctttc cagtcgggaa acctgtcgtg ccagetgcat taatgaatcg gccaacgcgc 3480
ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg 3540
ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 3600
cacagaatca ggggataacg caggaaagaa catgtgagca aaaggceagc aaaaggccag 3660
gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 3720
tcacaaaaat cgacgctcaa gtcagaggtg gegaaacccg acaggactat aaagatacca 3780
ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 3840
atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcaatgct cacgctgtag 3900
gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccecccgt 3960
tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 4020
cgacttatcg ecactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 4080
cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt 4140
tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 4200
cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg 4260
cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg 4320
gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 4380
gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg 4440
gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg 4500
ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc 4560
atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc 4620
agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc 4680
ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag 4740
tttgegcaac gttgttgcca ttgetacagg categtggtg teacgetegt cgtttggtat 4800
ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 4860
caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggecgcagt 4920
gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag 4980
atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg 5040
accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt 5100
aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctetcaagga tcttaccgct 5160
gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac 5220
tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat 5280
aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat 5340
ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca 5400
aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtc 5446
6
